PREFACE
To some people, the study of cancer and autoimmunity may be something only slighdy less sterile than a Johnson...
37 downloads
1811 Views
34MB Size
Report
This content was uploaded by our users and we assume good faith they have the permission to share this book. If you own the copyright to this book and it is wrongfully on our website, we offer a simple DMCA procedure to remove your content from our site. Start by pressing the button below!
Report copyright / DMCA form
PREFACE
To some people, the study of cancer and autoimmunity may be something only slighdy less sterile than a Johnson & Johnson gauze pad, a pursuit followed by dilettanti and pseudo-scholastic professors. To others, the word connotates the exotic, the esoteric and the desirable. To us, it embodies the hopes and ambitions of generating an anti-tumor response in the patient. It is somewhat ironic that over forty years ago there were two disciplines that started with "TI". There was tumor immunology and there was transplantation immunology. The latter thrived and has led to some of the most critical discoveries in immunobiology. The former continues to thwart bench scientists and clinicians alike. In fact, the original hope that cancer cells would each contain a novel antigen that might be recognized by the immune system has proven, for the most part, to be naive. On the other hand, it was perhaps equally naive to assume that a process as biologically conserved as neoplasia, would lead to the production of something as simple as a unique antigen that would be common to all patients. The work, however, on tumor immunology has been productive and has led to interrelationships between the molecular processes of neoplastic development and the understanding of the phenotypic changes which occur. These changes which were once considered to be only involved in cell surface markers, now encompass the disciplines of signal transduction, apoptosis, and differentiation. As immunologists, our goal is to develop a simple and effective means to manipulate cancer in vivo. This manipulation can encompass several venues. First, it might be as direct as the original hope and aspiration of identifying a phenotypic marker and the use of either active or passive immunization. Second, it might include the use of passive reagents carrying "warheads" to selectively destroy cancer cells. Third, it might include altering the basic process of cell survival, be it via nucleic acid or protein biosynthesis, or programmed cell death. The list goes on and on as the black box gets bigger and bigger. In fact, we used to teach our students that the immune system was little more than a large black box, except that upon opening the box, one only discovered multiple smaller black boxes, and so on. This volume is an attempt by a collection of workers in many disciplines, to present a theme which has not been well described before. The papers include both basic and clinical science and range from sophisticated molecular biology to little more than phenomenology (e.g., the increased association of cancer in some autoimmune diseases and increased presentation of autoimmune phenomena in malignant conditions). This, however, is state-of-the-art. Our hope is that this collection of themes will be of use not only to bench scientists, but also to clinicians who treat patients. We also expect that as we enter the millenium, that much of this work will become an anachronism. The latter of course would be a great success and would imply real progress. In fact, as we finish this volume, the editors realize more than anything else the need to update this book 5-10 years hence. We greatly appreciate the help of our contributors. We have done our best to edit the manuscripts. The errors which remain are ours alone. Y.S. and M.E.G.
Vll
List of Contributors
Mahmud Abu-Shakra Rheumatic Diseases Unit and Department of Medicine 'B' & 'D' Soroka Medical Center and Ben-Gurion University P.O. Box 151 Beer-Sheva 84101 Israel Donato Alarcon-Segovia Department of Immunology and Rheumatology Institute Nacional De La Nutricion Salvador Zubiran Mexico City Mexico C. Alessandri University di Roma "La Sapienza" Policlinico Umberto I Clinica Medica I 00161 Roma Italy
Antonio Bandeira Instituto Gulbenkian de Ciencia Oeiras Portugal Yaron Bar-Dayan INSERM Unite 430 Hopital Broussais 96, Rue Didot 75014 Paris Cedex 14 France Yosefa Bar-Dayan INSERM Unite 430 Hopital Broussais 96, Rue Didot 75014 Paris Cedex 14 France
Anabel Aron-Maor Department of Medicine 'B' Research Unit of Autoimmune Diseases Chaim Sheba Medical Center (Affiliated to Tel-Aviv University) Tel-Hashomer 52621 Israel
Eytan R. Barnea The S.I.E.P Division of Research Scientific Secretariat and Registration 1697 Lark Lane, Cherry Hill New Jersey 08003-3157 USA
Ronald A. Asherson The Rheumatic Diseases Unit Department of Medicine University of Cape Town School of Medicine The Groote Schuur Hospital Observatory 7925 Cape Town 8001 South Africa
Narayan K. Bhat Center for Molecular and Structural Biology HoUings Cancer Center Medical University of South Carolina 17 Ashley Avenue Charleston, S.C. 29425-2213 USA
Emmanuelle Bonnin INSERM Unite 430 Hopital Broussais 96, Rue Didot 75014 Paris Cedex 14 France
Dan Buskila Rheumatic Disease Unit Department of Medicine 'B' Soroka Medical Center and Faculty of Health Science Ben-Gurion University of the Negev P.O. Box 151 Beer-Sheva 84101 Israel
Mary C. Cantrell Division of Rheumatology/ Allergy and Clinical Immunology University of California at Davis TB 192, School of Medicine Davis, CA 95616-8660 USA
Carlos A. Casiano Department of Microbiology and Molecular Genetics Loma Linda University School of Medicine Loma Linda, CA 922350 USA Ricard Cervera Unitat de Malalties Autoimmunes Sistemiques Hospital Clinic, Villarroel 170 Barcelona 08036 Catalonia Spain Karsten Conrad Institute for Immunology Medical Faculty Technical University of Dresden Karl Marx Str. 3 PO. Box 8001 15 D-01101 Dresden Germany
Fabrizio Conti University di Roma "La Sapienza" Policlinico Umberto I Clinica Medica I 00161 Roma Italy Antonio Coutinho Department of Immunology Pasteur Institute 25 Rue du Docteur Roux 75724 Paris Cedex 15 France Sidney Croul Center for Neurovirology and Neurooncology MCP Hahnemann University 245 N. 15th Street, Mail Stop #406 Philadelphia, PA 19102 USA David D'Cruz Bone & Joint Research Unit The Royal London Hospital 25-29 Ashfield Street Whitechapel London El 2AD England Jocelyne Demengeot Unite du Developpement des Lymphocytes CNRS URA 1961 Institut Pasteur Paris France Luis Del Valle Center for Neurovirology and Neurooncology MCP Hahnemann University 245 N. 15th Street, Mail Stop #406 Philadelphia, PA 19102 USA Smruti A. Desai New York Medical College Department of Microbiology & Immunology Valhalla, New York 10505 USA
Guilliam Dighiero Institut Pasteur Unite d'Immuno-Hematologie et d' Immunopathologie 28 rue du Dr Roux F-75724 Paris Cedex 15 France
Josep Font Unitat de Malalties Autoimmunes Sistemiques Hospital Clinic, Villarroel 170 Barcelona 08036 Catalonia Spain
Lea Eisenbech Department of Immunology Weizmann Institute of Science Rheovot76100 Israel
Mario Garcia-Carrasco Unitat de Malalties Autoimmunes Sistemiques Hospital Chnic, Villarroel 170 Barcelona 08036 Catalonia Spain
Khaled M. El-Shami Department of Immunology Weizmann Institute of Science Rheovot76100 Israel
Jacob George Department of Medicine 'B' and The Research Unit of Autoimmune Diseases Chaim-Sheba Medical Center Tel-Hashomer 52621 Israel
Felix Fernandez-Madrid Department of Internal Medicine Division of Rheumatology and Center for Molecular Medicine and Genetics Wayne State University 4707 St. Antoine Detroit MI 48201 USA Soldano Ferrone New York Medical College Department of Microbiology & Immunology Valhalla, New York 10505 USA Claire Fieschi Medecin des Hopitaux Groupe Hospitalier Pitie—Salpetiere 47-83 Bd de I'Hopital 75651 Paris Cedex 13 France Heiko T. Flammann Institute of Immunology Pathology and Molecular Biology Lademannbogen 61 D-22339 Hamburg Germany
Panagiotis Georgiou Center for Molecular and Structural Biology Hollings Cancer Center Medical University of South Carolina 17 Ashley Avenue Charleston, S.C. 29425-2213 USA Eric M. Gershwin Division of Rheumatology/ Allergy and Clinical Immunology University of California at Davis TB 192, School of Medicine Davis, CA 95616-8660 USA Pascal Godmer Department of Internal Medicine Hopital Avicenne Universite Paris-Nord 125, Rue de StaUngrad 93000 Bobigny France Jennifer Gordon Center for Neurovirology and Neurooncology MCP Hahnemann University 245 N. 15th Street, Mail Stop #406 Philadelphia, PA 19102 USA
XI
Wolfgang L. Gross University Poliklinik fiir Rheumatologie, Lubeck Ratzeburger Allee 160 23538 Lubeck And Akad. Lehrkrankenhaus der Rheumaklinik B.B. Postfach 1488 Bramstedt 24572 Germany
Michel D. Kazatchkine INSERM Unite 430 Immunopathologie Humaine Hopital Broussais 96 Rue Didot 75014 Paris Cedex 14 France
Loic Guillevin Department of Internal Medicine Hopital Avicenne Universite Paris-Nord 125, Rue de Stalingrad 93000 Bobigny France
Kamel Khalili Center for Neurovirology and Neurooncology MCP Hahnemann University 245 N. 15th Street, Mail Stop #406 Philadelphia, PA 19102 USA
Michael Heike Johannes Gutenberg-Universitat Mainz Klinikum I. Medizinische Klinik und Poliklinik Das Klinikum befindet sich in der LangenbeckstraBe 1 55131 Mainz Germany
Arnoldo Kraus Department of Immunology and Rheumatology Institute Nacional De La Nutricion Salvador Zubiran Mexico City Mexico
Shohei Hori Department of Immunology Pasteur Institute 25 Rue du Docteur Roux 75724 Paris Cedex 15 France C. Jamin Centre Hospitaluer Universitaire Laboratoire d'Immunologic B.R 824 F-29609 Brest Cedex France Viggo J0nsson Department of Autoimmunology Statens Serum Institiit 5 Artillerivej 2300 Copenhagen 5 Denmark Srinivas Kaveri INSERM Unite 430 Hopital Broussais 96, Rue Didot 75014 Paris Cedex 14 France
xn
Barbara Krynska Center for Neurovirology and Neurooncology MCP Hahnemann University 245 N. 15th Street, Mail Stop #406 Philadelphia, PA 19102 USA Hella-Monika Kuhn Israelitic Hospital Orchideenstieg 14 D-22297 Hamburg Germany Nitza Lahat Immunology Research Unit Carmel Medical Center 7, Michal Str. Haifa 34362 Israel Steven P. Levine The S.I.E.P Division of Research Scientific Secretariat and Registration 1697 Lark Lane, Cherry Hill New Jersey 08003-3157 USA
Peter M. Lydyard Centre Hospitaluer Universitaire Laboratoire d'Immunologie B.R 824 F-29609 Brest Cedex France
Jessica Otte Center for Neurovirology and Neurooncology MCP Hahnemann University 245 N. 15th Street, Mail Stop #406 Philadelphia, PA 19102 USA
loanna Maroulakou Center for Molecular and Structural Biology Rollings Cancer Center Medical University of South Carolina 17 Ashley Avenue Charleston, S.C. 29425-2213 USA
Takis S. Papas Center for Molecular and Structural Biology HoUings Cancer Center Medical University of South Carolina 17 Ashley Avenue Charleston, S.C. 29425-2213 USA
Karl-Herman Meyer zum Buschenfelde Office: I. Med. Klinik und Poliklinik Universitat Mainz D55131 Germany
J.O. Pers Centre Hospitaluer Universitaire Laboratoire d'Immunologie B.P 824 F-29609 Brest Cedex France
Ariel Miller Immunology Research Unit Carmel Medical Center 7, Michal Str. Haifa 34362 Israel Mathias Montenarh Universitat des Saarlandes Medizinische Biochemie und Molekularbiologie Geb. 44 66421 Hamburg Germany Arnon Nagler Department of Bone Marrow Transplantation Hadassah University Hospital Ein Karem Jerusalem 91120 Israel Elvyra J. Noronha New York Medical College Department of Microbiology & Immunology Valhalla, New York 10505 USA
Jean-Charles Piette Medecin des Hopitaux Groupe Hospitaller Pitie—Salpetiere 47-83 Bddel'Hopital 75651 Paris Cedex 13 France Miloslav Pospisil Academy of Science of Czech Republic Prague Czech Republic Sonja Praprotnik University Medical Center Ljubliana Department of Rheumatology Vodnikova 62 1000 Ljubliana Slovenia Nagenda Prasad INSERM Unite 430 Hopital Broussais 96, Rue Didot 75014 Paris Cedex 14 France
Xlll
Roberta Priori University di Roma "La Sapienza" Policlinico Umberto I Clinica Medica I 00161 Roma Italy
Marc Scbmitz Institute of Immunology Medical Faculty Technical University of Dresden Karl-Marx-Str. 3 D-01109 Dresden Germany
Thomas P. Prindiville Division of Rheumatology/ Allergy and Clinical Immunology University of California at Davis TB 192, School of Medicine Davis, CA 95616-8660 USA
Yaniv Sberer Department of Internal Medicine 'B' Sheba Medical Center Tel Hashomer 52621 Israel
O. Pritsch Institut Pasteur Unite d'Immuno-Hematologie et d'Immunopathologie 28 rue du Dr Roux F-75724 Paris Cedex 15 France
Yehuda Shoenfeld Department of Medicine 'B' Research Unit of Autoimmune Diseases Chaim Sheba Medical Center (Affiliated to Tel-Aviv University) Tel-Hashomer 52621 Israel
Michal A. Rabat Immunology Research Unit Carmel Medical Center 7, Michal Str. Haifa 34362 Israel
Emanuel Sikuler Department of Medicine 'B' Research Unit of Autoimmune Diseases Chaim Sheba Medical Center (Affiliated to Tel-Aviv University) Tel-Hashomer 52621 Israel
Manel Ramos-Casals Unitat de Malalties Autoimmunes Sistemiques Hospital Clinic, Villarroel 170 Barcelona 08036 Catalonia Spain Ernst Peter Rieber Institute of Immunology Medical Faculty Technical University of Dresden Karl-Marx-Str. 3 D-01109 Dresden Germany Jozef Rovensky Research Institute of Rheumatic Diseases Nabrezie I. Krasku 4 921 01 Piestany Slovak Rep.
XIV
Shimon Slavin Department of Bone Marrow Transplantation Hadassah University Hospital Ein Karem Jerusalem 91120 Israel Sooryanarayana INSERM U430 Hospital Broussais Sheba Medical Center Tel Hashomer Israel Renata Stepankova Academy of Science of Czech Republic Prague Czech Republic
Efstratios Tatsis University Poliklinik ftir Rheumatologie, Lubeck Ratzeburger Allee 160 23538 Lubeck And Akad. Lehrkrankenhaus der Rheumaklinik B.B. Postfach 1488 Bramstedt 24572 Germany Moshe Tishler Department of Rheumatology Tel Aviv Souraski Medical Center Tel-Aviv University Sackler School of Medicine 6 Weiman St. Tel Aviv 64239 Israel Helena Tlaskalova Academy of Science of Czech Republic Prague Czech Republic Ludmila T\ickova Academy of Science of Czech Republic Prague Czech Republic Yaron Tomer Department of Endocrinology Box 1055 Mount Sinai Medical Center One Gustave L. Levy Place New York, N.Y. 10029 USA
Alena Tbchyiiova Research Institute of Rheumatic Diseases Nabrezie I. Krasku 4 921 01 Piestany Slovak Rep. Guido Valesini University di Roma "La Sapienza" Policlinico Umberto I Clinica Medica I 00161 Roma Italy F. Viganego University di Roma "La Sapienza" PoHcHnico Umberto I CUnica Medica I 00161 Roma Italy Antonio R. Villa Department of Immunology and Rheumatology Institute Nacional De La Nutricion Salvador Zubiran Mexico City Mexico Xinhui Wang New York Medical College Department of Microbiology & Immunology Valhalla, New York 10505 USA
J. Tomkiel Department of Internal Medicine Division of Rheumatology and Center for Molecular Medicine and Genetics Wayne State University 4707 St. Antoine Detroit MI 48201 USA
Dennis K. Watson Center for Molecular and Structural Biology Rollings Cancer Center Medical University of South Carolina 17 Ashley Avenue Charleston, S.C. 29425-2213 USA
M. Tomsic University Medical Center Ljubliana Department of Rheumatology Vodnikova 62 1000 Ljubliana Slovenia
Allan Wiik Department of Autoimmunology Statens Serum Institiit 5 Artillerivej 2300 Copenhagen 5 Denmark
XV
Joerg Willers New York Medical College Department of Microbiology & Immunology Valhalla, New York 10505 USA Pierre Youinou Centre Hospitaluer Universitaire Laboratoire d'Immunologic B.R 824 F-29609 Brest Cedex France
XVI
Dongsheng Zhang New York Medical College Department of Microbiology & Immunology Valhalla, New York 10505 USA
(c) 2000 Elsevier Science B.VAll rights reserved. Cancer and Autoimmunity Y. Shoenfeld and M. E. Gershwin, editors
Introduction: The Immune System, the Autoimmune State and Autoimmune Disease Jacob George and Yehuda Shoenfeld Department of Medicine 'B' and the Research Unit of Autoimmune Diseases, Sheba Medical Center, Tel-Hashomer, Sackler Faculty of Medicine, Tel-Aviv University, Tel-Aviv, Israel
1. INTRODUCTION Autoimmune diseases stand as important causes of morbidity and mortality in western society and as such, they impose a heavy burden in financial terms. The significance of autoimmune diseases can be demonstrated by the study showing that half of the patients with RA are unemployed due to medical disabilities resulting from their illness [1]. Similarly, patients with insulin dependent diabetes mellitus, an additional autoimmune disease, who today have a longer life expectancy, increasingly require supporting medical facilities such as dialysis. The pathogenesis and the relative importance of factors leading to autoimmunity are not defined precisely. Key questions include: what is the origin of autoantibodies, thought to play a detrimental role in autoimmunity, their interrelations with the autoantigens to which they are directed and the influence of this interplay on the immune system. The enigma is further intensified by the detection of natural autoantibodies found in healthy organisms and thought to possess regulatory and protective properties. Moreover, the cellular immune response has similarly been shown to participate in the evolvement of autoimmunity through its principal effector—the T-cell. However, the initiating events rendering these cells autoreactive and therefore capable of precipitating damage to cell-structures and the precise nature of this reaction still await comprehensive elucidation.
2. THE ESSENTIALS OF THE IMMUNE RESPONSE The principal role of the immune system is to confer protection on the organism against foreign invading pathogens, which can gain access to the body by different routes. The targeted (specific) immune response is generated by the combined interaction of the cellular and humoral responses, both coordinated by the production of active substances—the cytokines. Cellular immunity refers to the immune mechanisms mediated by T lymphocytes, regardless of immunoglobulin molecules, whereas humoral immunity denotes secretion of antibodies by B lymphocytes. The humoral and cellular arms of the immune system should be viewed, not as two independent mechanisms of self defense, but rather as acting in an orchestrated and synergistic manner to accomplish protection [2]. 2.1. Humoral Immune Response B-cells stem from bone marrow precursors and later localize in the circulation as well as in folHcles of peripheral lymphoid tissues. They are responsible for the production of antibodies, once they have differentiated into plasma cells [3]. B-lymphocytes are also involved in antigen presentation to T-cells, secretion of immunoregulating cytokines and establishment of 'memory' towards antigenic determinants [4]. Direct activation of B-cells by distinct antigens is facilitated by binding to antigen receptors located within the membrane of the B-lymphocytes and under the influence of cytokines. This complex interac-
tion activates B-cells after which they proliferate and produce the appropriate antibody. The final function of the B-cell (i.e., memory cell, plasma cell or cytokine secreting cell) is determined by the profile of the cytokines present, and the mechanisms of activation (through B-cell receptors for the Fc region of IgG, or for complement components) [4]. The end product following antigenic stimulation is a population of B-cells producing and secreting one specific antibody against the introduced antigen. Immunoglobulins are glycoproteins forming 9 classes of isotypes: IgG, divided to 4 subclasses (IgGI-4), IgM, IgA comprising 2 subclasses (IgAl-2), IgD and IgE (Tables 1) [5]. The basic structure of immunoglobulins (similar in all five isotypes) consists of two identical heavy chains (MW 50,000-75,000) combined with two identical light chains (MW 25,000). Antigen specificity is determined by variable areas containing the antigen binding site, whereas the constant region (as can be inferred from its name), is common to all immunoglobulins of a certain class. The hypervariable region is located in the variable region, representing the closest relationship to the epitope (its corresponding site on the antigen). The idiotypes, located in the variable region are the antigenic determinants (defining antigen binding) of the immunoglobulins themselves. The diversity of antibody response is formulated due to encoding of the heavy and light chains by multiple genetic elements. As such, light chains are generated following pairing of VK and JK genes, whereas heavy chains exhibit greater diversity since they are created following the assembly of three germline genes (VH, DH, JH). 2.2. Cellular Immune Response A T-cell cycle is initiated in hematopoietic stem cells, differentiating in the thymus and subsequently wandering to the lymphoid tissue in the periphery [2, 6]. T-cells are heterogeneous by virtue of their different functions (lysis of foreign cells, modulation of the interaction between B and T cells, regulation of monocyte functions). The peripheral T-cells are discerned by their expression of antigenic markers. As such, Tcells carrying CD4 molecules (T-helpers) interact with antigen associated with MHC class II on the surface of the antigen presenting cell, and T-cells expressing
CDS molecules (cytotoxic T-cells) engage in suppression of the immune response. The T-cell receptor is a molecule present on the surface of the T-cell, responsible for recognition of the complex antigen-MHC II molecule [7]. The variety of T-cell receptors is immense, thus accounting for its ability to recognize diverse antigens. The immune response is mounted following presentation of the antigen to the lymphocytes by antigen presenting cells, examples of which are: macrophages, Langerhans cells and dendritic cells. The process of presentation requires the participation of MHC class II molecules on the surface of the antigen presenting cell. The antigen, prior to its presentation to the T-cell is processed and degraded and later associated with the MHC class II molecule to form a complex reacting with the T-cell receptor. It should be outlined that the APCs are capable of secreting cytokines that act to facilitate the interaction described above. 2.3. Coordination of the Immune Response Several intrinsic factors belonging to the immune system itself are responsible for the modulation and regulation of the immune response. Cytokines are small proteins (MW 8000-30,000) produced and secreted by a diverse population of cells (i.e., macrophages, monocytes, T and B cells, as well as nonlymphoid cells) [8]. Cytokines elicit different actions (Table 2) including proinflammatory (TNF, IL-1, IL-2) and anti-inflammatory (TGF, IL-4, IL6, IL-10) functions and stimulation of lymphocyte proliferation (IL-2, IL-7). The regulation of cytokines is under the supervision of genetic factors (capable of generating corresponding inhibitors) and by the liberation of soluble forms of cytokine receptors. The complement system consists of circulating glycoprotein constituents that can be triggered and activated in two major patterns to initiate a cascadic chain of events, the consequence of which leads to diverse influences on the progression and perpetuation of the immune response [9]. This cascade can, therefore, be activated by the classical pathway (immune complexes comprising IgM and IgG) or by the alternative pathway—independent of antibodies (by bacterial LPS). The idiotypic system—will later be reviewed in detail.
Table 1. Characteristics of human immunoglobuhn subclasses Characteristic
IgG
IgM
IgA
IgD
IgE
Molecular form Molecular weight Subclasses Serum half life(days) Valence Serum concentration (mg/dl) Sedimentation constant Percentage of serum immunoglobulins Placental transfer
Monomer 160,000 1,2,3,4 23 2 1000-1500 7S 75-85
Pentamer, hexamer 900,000 None 5.1 10,12 100-150 19S 5-10
Monemer, dimer 170,000 1,2 5.8 2,4 250-300 7S(9, 11, 13) 7-15
Monomer 180,000 None 2.8 2 0.3-30 7S 0.3
Monomer 190,000 None 2.3 2 0.0015-0.2
-H
-
-
-
-
8S 0.0003
Table 2. Representative cytokins and their corresponding biological activities Cytokine
Activities
lL~a, IL-^
Lymphocyte acivation; bone resorption, induction of fibroblasts synovial cells and endothelial cells; prostaglandin liberation. T and B growth factor; increased secretion of several cytokines; activation of cytotoxic cells. Proliferation of marrow stem cells; growth factor for: macrophages, eosinophils, mast cells. Activation of B-cells and macrophages; stimulated proliferation of T-cells and mast cells; Induce secretion of IgE by B-cells. Induce antibody production and acute phase protein production by the hepatocytes. Inhibit production of several cytokines Decrease cell replication; Increases MHC class I replication; disrupts viral replication. Activate NK cells, cytotoxic T cells, endothelial cells and macrophages; anti-tumoral effects; Increase expression of MHC class I and II. Acute phase reactant; anti-tumoral; activate macrophages; increase expression of MHC class I; bone resorption. Inhibit IL-1; enhance tissue repair; suppress lymphocyte proliferation.
IL-2 IL-3 IL-4 IL-6 IL-10 IFN-a IFN-y TNF-a TGF-)^
Suppressor T-cells. As can be recalled, suppressor T-cells constitute a distinct subset of T-cells in charge of down-regulating the expression of either T cells and immunoglobulin secreting cells [10].
3. EVOLUTION OF THE AUTOIMMUNITY CONCEPT Paul Ehrlich was the first to coin the term autoimmunity [11] with regard to the harmful aspects of immunity, namely—the emergence of autoantibodies directed against the organism's own antigens. However, the expression used ('horror autotoxicus') has served to denote a mechanism avoiding autoimmunization, exemplified in goat models (producing alloantibodies but not autoantibodies).
The revolutionary ideas expressed by Ehrlich were subsequently abandoned for a century although anecdotal works confirming his notions were sporadically reported. The turning point, leading to the general acceptance of the autoimmunity concept was the experiments by Witebski & Rose (reviewed in Reference [12]) showing that rabbits immunized with rabbit thyroglobulin developed thyroiditis following production of anti-thyroglobulin autoantibodies. These observations were supported by the models of autoimmune hemolytic anemia and thrombocytopenia in which anti-red blood cell antibodies were detected and had been shown to be associated with bouts of hemolysis and thrombocytopenia [13]. The discovery of the NZB mouse (a strain which develops spontaneous autoimmune disease) provided a new tool for the study of autoimmmunity, con-
firming the previous evolving notions regarding the abiUty of the immune system to attack its own inherent constituents. Further progress towards better understanding of autoimmunity has been achieved by the reaUzation that the abihty to distinguish between self and non-self during fetal life is a prerequisite for normal function of the immune system. The term tolerance was introduced to signify the lack of autoreactivity. These ideas were later extended by Burnet [14], assuming that autoimmunization results from the emergence of 'forbidden' clones (lymphocytes possessing receptors for autoantigens escaping 'normal' deletion by the thymus during fetal life). Although this idea was later neglected, it represents the basis for the modern approach regarding autoimmunity as failure of the immune system to recognize its intrinsic components as its own. Different methods of classification have been proposed for autoimmune diseases. An accepted method is based upon the organs afflicted (Table 3). Accordingly, diseases involving multiple organs include: SLE, rheumatoid arthritis, Sjogren's syndrome and scleroderma, whereas examples of organ-specific diseases encompass: Graves' disease, Hashimoto's thyroiditis, myasthenia gravis, polymyositis, pernicious anemia, Addison's disease, IDDM, primary billiary cirrhosis, autoimmune hemolytic anemia and pemphigus.
4. DYNAMIC PRESERVATION OF IMMUNOLOGIC TOLERANCE 4.1. The Nature of Lymphocyte Repertoire Selection The appearance of tolerance, a key concept in autoimmunity, is not yet fully elucidated. It is probably established by processes which involve the selection of lymphocytes in the thymus. The precise nature of the signal, determining the selection of lymphocytes is likely to reside in a small peptide (9 amino acid) either endogenous or extrinsic [15] which is contained in the MHC molecule expressed by thymic epithelial cells or macrophages. The importance of this peptide lies in its ability to direct the lymphocye to the 'negative selection' pathway (leading to its death or to its entry into a dormant state)
and subsequently to the 'positive selection' destiny terminating in its differentiation into a mature T cell. The immunoregulatory properties of the peptide are expressed by its ability to influence (by the mechanism previously described) the population of helper and cytotoxic T cells, thereby defining the nature and aim of the immune response. One of the key questions regarding the developmental aspects of the immune system relates to the signaling events which determine the fate of selection of its inherent constituents (positive versus negative selection). Moreover, it is clear that in comparison to an adult animal, the fetus and newborn are highly susceptible to the induction of immunological tolerance. A factor contributing to the quality of selection is the affinity of the interaction TCR-MHC-peptide complex. Thus, progression of the T-cell towards apoptotic death (negative selection), or to differentiation into a mature T-lymphocyte is governed by the strength of the complex (T-cell-epithelial cell) affinity. Furthermore, it has been suggested that macrophages exert clonal deletion, whereas epithelial cells enhance clonal anergy (entry of the T-cell into a dormant state). 4.2. Programmed Cell Death (Apoptosis) The high turnover of human lymphocytes necessitates the existence of a control mechanism that would provide means of deleting these cells (the autoreactive cells in particular) in a coordinated manner. Apoptosis indeed fulfiUs such requirements by leading to nuclear fragmentation and ingestion by macrophages. This process of rapid cell elimination does not result in tissue inflammation thereby differentiating it from cell death by necrosis which evokes a considerable inflammatory response [16]. The recognition of apoptosis provided a compelling insight into the possible emergence of autoimmune disorders as a result of its defective development. Two genes play major roles regarding the evolution of autoimmunity in association with programmed cell death: the bcl-2 gene producing a mitochondrial protein prevents the apoptotic death by the B-cell. However, this 'rescue operation' depends on sensitization by an antigen, which renders the B-cell long lived by virtue of its escape from apoptosis. The population of B-cells is thus selected in a highly specialized manner, defined by its antigenic reactivity.
Table 3. Classification of autoimmune diseases and corresponding autoantigens Disease
Corresponding autoantibody towards:
(1) Multisystem disease Systemic lupus erythematosus Antiphospholipid syndrome Rheumatoid arthritis Sjogren's syndrome Goodpasture's syndrome Scleroderma
DNA (other polynuclotides), phospholipids, cellular ribonucleoproteins, histones. Phospholipids, y0-2-glycoprotein 1 Fc region of IgG collagen components Ro (SS-A) and La (SS-B) Alveolar and kidney basement membrane Centromere, Topoisomerase l(Scl-70)
(2) Organ specific disease Myasthenia gravis Polymyositis Graves' disease Hashimoto's thyroiditis Addison's disease Pernicious anemia Insulin dependent diabetes Primary billiary cirrhosis Autoimmune hemolytic anemia Idiopathic thrombocytopenic purpura Pemphigus
Acetylcholine receptor Jo-1 TSH receptor Thyroglobulin Adrenocortical cytoplasmic antigen Gastic parietal cells Pancreatic islet cells Mitochondrial antigens I antigens Platelet antigens Desmosomes
Bcl-2 also influences the T-cell repertoire. It has been observed that the location of lymphocytes within the thymus determines its faith. Thus, in the medullar regions, enhanced clonal deletion is observed following low gene transcription, while the opposite is so in the thymic cortex. The second gene is Fas (Apo-I), which specifies for a 48kD transmembrane protein [17]. It has been observed that mice with mutations in Fas or the Fas ligand (Ipr, Iprcg, gld) have defective apoptosis and develop massive lymphadenopathy and autoantibodies characteristic of lupus. The lupus like disease was however more obvious when the mutations occurred on an autoimmune background, such as MRL and NZB. 4.3. Cytokines The existence of these molecules had been predicted by Bretcher & Cohn in 1970. They postulated that lymphocyte activation follows a two signal mechanism. As such, the binding of a lymphocyte receptor to the antigen was not sufficient for its activation and therefore requires a 'second signal'. This role has been found to be possessed by a special 'messenger
molecule'. Indeed, it was later realized that provision of the first signal (the mere ligation of the antigen to the receptor) resulted in a state of 'clonal anergy' (inactivation). The CO-stimulatory molecules constituting signal 2 were identified as bacterial products (lypopolysacchrides, Freund's adjuvant), lymphokines and adhesion molecules. It has been shown that the existence of B or T-cells lacking stimulation by these factors did not result in autoimmunization.
5. NATURAL AUTOIMMUNITY The existence of B and T-cells harboring selfreactivity complicates the concept of autoimmunity, since it goes to show that this property is not necessarily associated with disease states [18]. Moreover, the abundant existence of anti-self reactivity implies that representation of self within the immune system might even have teleological roles in terms of protection or immune modulation. As such, it has been initially proposed by Grabar [19] that natural autoantibodies (NAA) could act as transporters of catabolic products serving to clear the organism of harmful self as well as
foreign substrates. This view has later been extended by suggesting that by low affinity binding to autoantigens, natural autoantobodies could function as filters preventing the induction of autoimmunity [20]. An elaborate description of the biological roles of NAA is provided in Table 4. A compelling theory regarding the essentials of this network has been proposed by I. Cohen designating the expression 'immunologic hommunculus' to indicate the capacity of the brain to "imagine" itself. NAA are bound to various structures found in the organism's body (i.e., serum proteins, cytokines and hormones) amongst which are also highly conserved self antigens (DNA, intracellular structures). One of the unique properties of NAA is their independent production by the immune system, namely— they do not require antigenic stimuli as do other antibodies. NAA are predominately of the IgM isotype, although some consist of IgG and IgA. Another characteristic property is polyreactivity (widespread reactivity with infectious antigens and organic chemical substances). The clinical significance of NAA has been questioned by some authors owing to their low avidities to self-antigens. Furthermore, the presence of NAA in huge amounts among patients with monoclonal gammopathies (Reference reviewed in [21]) without any corresponding clinical manifestations was inconsistent with a presumed pathogenic potential of these autoantibodies. This view was recently challenged by a set of studies in which active immunization with monoclonal antibodies (human IgM antibodies obtained from a healthy subject immunized with diphtheria and tetanus) resulted in the emergence of a clinical picture resembling human SLE and antiphospholipid syndrome [22]. Another relevant finding is the increased occurrence of NAA with ageing, which may seem paradoxical, owing to the well documented decline in immunologic functions accompanying the ageing process. Moreover, attempts to induce experimental autoimmune disease in aged animals are fraught with heightened resistance. Thus, the age-related increase in the incidence of autoantibodies can be considered a physiological process that improves the capacity of the individual to handle tissue damage. NAA are probably produced by CD5 positive Bcells [23] by using selected unmutated germline genes that encode conserved sequences for large binding
sites, capable of reacting with various autoantigens. This characteristic of NAA could explain the low affinities for different autoantigens.
6. AVOIDANCE OF IMMUNOLOGIC TOLERANCE 6.1. Autoantigens The fundamental study of any autoimmune disease is initiated by attempts to characterize and define the autoantigen towards which the autoantibody is directed. Research in this field is headed by immunohistochemical studies of recombinant proteins obtained by screening expression libraries with autoantibodies. Examples of autoantigens detected by this method consist of myelin basic protein (MBP) in mice and acetylcholine receptors in patients with myasthenia gravis. The role of autoantigen recognition has been exemplified in a classic study by which sera from diabetic children were found to contain elevated titers of antibodies, specific for A-17 residue bovine serum peptide differing in sequence from that of human albumin. Cross-reaction of these antibodies with the p-69 (a pancreatic ^-cell surface protein) which is considered the target autoantigen in autoimmune diabetes, had been noticed [24]. It should be emphasized that even the most highly conserved and basic self structures can potentially induce autoantibody production. As such, immunizing rabbits with cytochrome C resulted in the production of antibodies against mouse specific domains of the enzyme as well as against rabbit cytochrome C. The latter was shown to react with conserved residues found in all mammalian cytochromes C [25]. 6.2. Aberrant Expression of HLA HLA are classified to two groups (I and II) based on structural and functional attributes. These antigens are characterized by a wide variance between unrelated individuals (allotypic polymorphism). Class I antigens are located in chromosome 6 and consist of three subclasses (HLA A, B and C). These molecules are found in membranes of nucleated cells and blood platelets. Class II molecules are mainly detected on macrophages, dendritic cells and other antigen pre-
Table 4. Biologic and physiologic functions of natural autoantibodies NAA
Action
IgG and IgM Anti-a galacosyl Anti-band 3 IgG Anti-keratin IgG IgM NAA
Clearance of altered self constituents Phagocytosis of senescent erythrocytes form in the circulation Clearance of cellular debris from the circulation as well as enhancement of phagocytosis Disposal of keratin following death of keratinocytes Increased resistance to tumors Protection against microbial infections Protection against parasitic infections Regulation of the immune system by increased IgG binding following tissue damage Inhibition of IgG binding to self-antigens Possessing proteolytic activities on vasoactive intestinal peptides (VIP) Regulation of the immune system through suppression or induction of antibody synthesis Preventing the harmful interaction of autoreactive B-cells with self-antigens
IgG NAA IgM anti-IgG F(ab02 Various NAA's Anti-idiotyopic NAA Various NAA
senting cells. Binding of HLA class II by certain antigens is an absolute requirement for recognition by T-helper cells, whereas cytotoxic T-cells identify antigens associated with class I HLA molecules. It has been suggested that avoidance of autoimmunization of self peptides, presented by the HLA class II molecules, stems from the failure of the cell to express these antigens. Aberrant expression of HLA glycoproteins (provoked by stimuli such as interferon administration) could play a key role in the evolution of autoimmunity [26]. This concept has been supported by studies showing that thyroid epithelial cells acquired antigen presenting properties following viral infections or stimulation by y-interferon. The study of the association between HLA and autoimmune diseases furnished clues to understanding their etiopathogenesis. It was noticed that several autoimmune diseases are more prevalent among humans with HLA DR 3/4. For example, distinct subtypes of DR4 are associated with different susceptibilities to contract rheumatoid arthritis (RA) in different ethnic groups. Evidence for the association between HLADR haplotypes and several AI diseases is presented in Table 5. Furthermore, knowledge of the HLA haplotype may provide tools for recognition of specific subgroups. For example, RA patients who are DR3 positive are more likely to develop gold induced nephropathy, whereas DR4 positive subjects tend to have a severe form of the disease, complicated by extra-articular manifestations [27].
It should be stated, however, that the value of HLA haplotype at the level of the individual, is of limited application, either in predicting the disease course or as a tool for genetic counseHng. 6.3. Polyclonal Activation Most autoimmune diseases are antigen driven. An elaborate activation of B-cells repertoire in an antigen dependent manner represents a possible mechanism, interfering with self-tolerance, although an established link to organ specific autoimmune damage has not been proven. The stimuli leading to polyclonal B cell activation could be bacterial lipopolysacharide (or other bacterial mitogen) as well as a specific 'atmosphere' of cytokines. It has been demonstrated that mice stimulated with LPS continuously produce antiDNA and rheumatoid factor which were subsequently detected within immune complexes in their kidneys. An additional important factor is the product of the bcl-2 gene (responsible for blocking apoptosis), which following its enhanced expression, results in the production of high levels of immunoglobolins in transgenic mice immunized with sheep red blood cells, finally leading to their death due to immune deposit nephritis. The role of polyclonal T-cell activation in triggering autoimmunity has been observed following the introduction of high doses of IL-2 in thymectomized animals and in humans. Moreover, thymectomy of MRL Ipr/lpr mice early in life prevented
Table 5. Association of autoimmune diseases with HLA-DR haploypes HLA-DR2
HLA-DR3
HLA-DR4
HLA-DR5
Subacute thyroiditis Multiple sclerosis Systemic lupus erythematosus Graves's disease Goodpasture's syndrome
Multiple sclerosis Myasthenia gravis Sjogren's syndrome Graves' disease Addison's disease Insulin dependent diabetes mellitus Systemic lupus erythematosus Dermatitis herpetiformis
Rheumatoid arthritis Insulin dependent diabetes mellitus Pemphigus vulgaris
Pernicious anemia Hashimoto's disease
the emergence of splenomegaly, nephritis and massive lymphadenopathy in these animals [28].
diseases consistent with APS and SLE in humans [22, 31].
6.4. Idiotypes and Idiotypic Connectivities
6.5. Environmental Factors
Idiotypes are phenotypic markers of the V genes used to encode immunoglobulin molecules (as soluble antibody molecules or as lymphocyte receptors). It was initially suggested by Jerne [29] that recognition of self by the organism formulates an immune equilibrium in addition to identification of foreign antigens. This theory, by which a complementary set of interconnecting idiotypes form to establish a well orchestrated network has been evidenced in mice and considerable support is present for its existence in humans. The principle of the network is founded on the presence of complementary pairs of antibodies consisting of the idioype (Abl) and its anti-idiotype (Ab2) and correspondingly, the anti-idiotype and its anti-anti-idiotype (Ab3). It can be viewed (Figure 1) that structural resemblance exists between the antigen and Ab2, as well as between Abl and Ab3. Since these two sets of idiotypes display apparently opposing influences, the system is capable of modulating the intensity of the targeted immune response by changing the titers of the idiotypes. Probably the most soUd proof to support the possible pathogenic potential of disruption of the idiotypic network resides in a set of studies by which autoimmune diseases have been induced by introduction of the pathogenic idiotype (reviewed in [30]). Accordingly, it has been suggested that immunizing mice with Abl leads to production of Ab2 which in turn elicits Ab3, bearing structural homology with the 'original' Abl. The production of Ab3 is associated with the emergence of clinical manifestations of autoimmune
Although not established unequivocally, infectious agents are regarded as highly probable etiologic factors leading to disruption of immune regulation resulting in autoimmune diseases [32]. Evidence for the role of infections in autoimmunity consists of: * Onset of autoimmune diseases following distinct infections (rheumatic fever after streptococcal infections and insulin dependent diabetes following mumps or Cocksackie infections) * Structural antigenic similarities between infectious agents and self-antigens. * Viral, bacterial, and parasitic infections are associated with increased titers of antibodies in the host (summarized in Reference [33]). The mechanisms by which infections may induce autoimmunity are still debated. However, an acceptable one is molecular mimicry initially suggested by George Snell in 1968, referring to the antigenic similarities between infecting agents and self structures following which cross reactivity is triggered between the resulting antibodies and self-antigens. Several examples exist which could support this concept, one of the most demonstrative of which is the proposed relationship between mycobacteria and autoimmunity [34]. Epidemiologic data also incriminates Klebsiella, Yersinia and Shigella infections in triggering ankylosing spondylitis and Reiter's syndrome in subjects who are HLA-B27 positive. The model of adjuvant arthritis in rats provides a strong argument favoring molecular mimicry as a key mechanism. Clinically it is evident that rats injected subcutaneously with oil suspension
AB3 anti-anti-Id « autoantibody
ADJUVANT Bacterial wall Superandgen
1-2 MONTHS
AB2
ABl
aiiti*Id
2-3 WEEKS
T HELPER Figure 1. Immunization with an autoantibody carrying a pathogenic idiotype (Abl) results in the appearance of anti-idiotypic antibodies (Ab2), 2-3 weeks afterwards. Ab2 may induce the production of complementary anti-anti-idiotypic antibodies (Ab3), six to 12 weeks after the initial immunization (1-2 months following the detection of Ab2). Ab3 bears structural resemblance to Abl, which is expressed by similar binding properties and therefore comparable pathogenic potential. This idiotypic manipulation could also account for emergence of AI disease following infections. As such, the infectious agent would stand as the triggering element leading to the production of Ab2.
of Mycobacterium tuberculosis, develop characteristic inflammation of the joints. It has been found that Tcell clones from these mice recognized the heat shock protein-65 (HSP65) antigen present both in mycobacteria and in the synovial fluid [35]. Concomitantly, an autoimmune attack is generated, that was initially triggered by the foreign mycobacterial agent. Other mechanisms of autoimmune disease induction, thought to be initiated by infections include: * Polyclonal activation (discussed earlier). * The 'altered self hypothesis according to which the release of bacterial or viral products changes the structure of self constituents rendering them immunogenic. * Aberrant or excessive expression of HLA class II resulting in autoantigen presentation to autoareactive T-cells (discussed previously). Apart from infections which probably constitute the commonest environmental factors, several other extrinsic insults have been incriminated as contributing to autoimmune diseases (reviewed in Reference [36]). Drug induced autoimmunity is a well characterized phenomenon, the classic prototype of which is lupus like syndrome [37] occurring in the context of hydralazine, isoniazide, procainamide (and probably other medications) ingestion and is manifested either by the appearance of various clinical pictures (rheumatic symptoms, fever, pleuropulmonary involvement) and by serologic markers (anti-histone antibodies, ect.). The mechanisms proposed to account for these drug related effects consist of cross reactivity or interaction with nuclear antigens. Alternatively, the medication may impair immune function by interacting with lymphocytes or by eliciting anti-lymphocytic antibodies. Similarly the role of various toxins and chemicals have been noticed as possible factors antedating the occurrence of autoimmune phenomena. As such, cigarette smoking has been observed to increase the risk of developing autoimmune conditions such as Graves' ophthalmopathy and to exacerbate pulmonary hemorrhage in patients with Goodpasture's syndrome. Ultraviolet radiation has been shown to precipitate flares of SLE (in particular, its skin lesions).
6.6. Hormonal Factors The influence of the hormonal profile on the evolution of autoimmune conditions can be deduced from their higher prevalence among women and exacerbations during puberty and the postpartum period. Furthermore, several observations provide additional support for the significance of hormones with regard to autoimmunity. As such, it has been shown that the clinical manifestation of SLE worsened following the introduction of sex hormones in experimental models [38]. The role of estrogen in autoimmune disease is probably bimodal, namely, it could either inhibit intrathymic differentiation, or in other circumstances, extrathymic pathways. Testosterone had opposite effects regarding the immune system and the initiation of autoimmunity. Recent studies also support the existence of a link between prolactin, the immune system and autoimmune diseases. 6.7. Immunologic Factors Deficiencies in early complement components (CI, C2, C4) have been associated with the evolvement of SLE and other autoimmune conditions. Moreover, patients with SLE or RA were found to harbor, more often, a complement receptor deficiency (CRl-normally present on red blood cell membranes). Various immune deficiency states have also been linked with autoimmune diseases. The classic example is IgA deficiency (one of the most common immune deficiency states) which has been found to co-exist with conditions such as SLE, RA, thyroiditis, polymyositis, and other autoimmune conditions. One of the most acceptable explanations for this well documented association relates to the continuous 'burden' of infections imposed on the compromised immune system resulting in its elaborate activation to produce high titers of antibodies resulting in frequent allergic and autoimmune states.
7. AUTOANTIBODY MEDIATED TISSUE DAMAGE In general, although not always fully defined, autoantibodies can be subclassified into those which were
10
definitely proved as pathogenic, others, for which the pathogenicity has not been defined and those whose pathogenic properties are unhkely (the principal group of which are NAA). The following fines will engage in a short description of the mechanisms by which autoantibodies have been shown or presumed to precipitate organ damage. 7.1. Direct Cytotoxicity This mechanism follows binding of the autoantibody to surface membranes resulting in cell destruction. This action is well documented and is modulated by several mediators: ^Antibody mediated cell mediated cytotoxicity (ADCC) This mechanism involves lysis of the tissue mediated by mononuclear cells carrying receptors for the Fc portion of IgG (K-cells). The binding of the autoantibodies to the target cells supplemented by attachment of the Fc receptor of the K-cell, results in the liberation of hydroxyl radicals and hydrogen peroxide, which exert direct cytotoxic effects. The mechanism is targeted owing to the specificity of the IgG antibodies. Conflicting data is provided regarding the nature of ADCC in SLE during in vitro studies (showing decreased ADCC) and in vivo ones (by which ADCC is apparently enhanced). Concomitant findings are lymphopenia and anti-lymphocyte antibodies explained by binding of the latter to lymphocyes via F(ab02 fragment and to K-cells through their Fc portion. * Phagocytosis Human macrophages dispersed throughout the body formulate the mononuclear system (formerly regarded as part of the reticuloendothelial system). These cells stem from progenitors (promonocytes) contained within the bone marrow. Following the process of maturation monocytes wander and deposit at the basement membrane around the small blood vessels as mature macrophages, obviating their role as protecting guards of penetrating pathogens. The principle location in which macrophages are situated are however: the alveoli, the liver (Kuppfer cells) and the splenic sinusoids. The mechanisms of protection conferred by the macrophages are related to their ability to engulf the foreign pathogen following its adherence to the surface of the cell. This attachment triggers a contractile system (composed of actin and myosin fibers)
extending pseudopods that surround the target substance/pathogen forming a phagosome. This process is followed by fusion of the macrophage cytoplasmic granules with the phagosome, externalizing their lytic content which leads to the destruction of the engulfed element. It has been shown that this process may be responsible for some autoimmune phenomena due to phagocytosis of self constituents by the macrophages. For example, SLE patients may develop anemia as a result of the possession of Fc receptors (in their activated macrophages), which can attach autoantibodies bound to erythrocytes. * Complement mediated cytotoxicity The complement system can trigger tissue damage by a process eventuating in a net influx of sodium and water through transmembranal channels generated in the target cell leading to its destruction. Activation of the complement cascade can be initiated by the binding of autoantibodies to cell membranes. This can be demonstrated in cases of anti-red blood cell antibodies present in patients with autoimmune hemolytic anemia (AIHA) who have anti-red blood cell antibodies and some individuals with Hashimoto's disease having anti-thyroid antibodies. 7.2. Cell Surface Receptor Binding (No Cytolysis) Autoantibodies can bind cell surface receptors after which alteration of their biologic activities occurs. Several mechanisms have been described as responsible for these modifications: * Binding of the antibody to the cell surface receptor may reduce the expression of the receptors. This process of effective down-regulation of receptors results from their realignment causing their disappearance from the cell surface. The classic example of this phenomena is impairment of neuromuscular function in myasthenia gravis due to the presence of anti-acetyl choline receptors. * Different effects may be accomplished by antibodies which block binding of a physiologic ligand resulting in inhibition of cell binding. This influence is exemplified by antibodies to type I intrinsic factor preventing binding of B12 to intrinsic factor molecules leading to the development of pernicious anemia. * Opposing effect can be evidenced by the existence of long acting thyroid stimulating (LATS) antibodies which precipitate thyrotoxicosis by virtue of
11
their stimulatory action culminating in activation of TSH receptors on thyroid cells.
7.3. Immune Complex Mediated Damage One of the principle defense mechanisms engaged in normal homeostasis preservation stems from concomitant elaboration and disposal of immune complexes (consisting of antibodies bound to autoantigens) from circulation by the mononuclear phagocyte system. This well-orchestrated and dynamic equilibrium can be offset in certain autoimmune conditions with resultant tissue damage. The mechanisms which might divert this tightly equilibrated response to evolve in tissue damage include: (1) formation of antibodies reacting with distinct self autoantigens (i.e., Goodpasture's syndrome) and (2) in situ formation of immune complexes (Farmer's lung) and lodging in specific tissues (seen in certain glomerulonephropathies). The site of immune complex deposition could either be determined by physical conditions (i.e., local vascular permeability) or by the relevant properties of the antigen and the existence of corresponding receptors in the tissue. For example, it has been suggested that in RA, the local elaboration of rheumatoid factor reacting with IgG in the joint is essential for the development of the inflammatory process. Another possible mechanism could be inferred from the observation of C3b receptors within normal tissue, the presence of which may designate a process of local entrapment of immune complexes. The net biologic effect achieved following the formation of immune complexes depends largely on its properties, namely, its complement binding (classic or alternative) potential. The local immune mediated inflammation within the tissue is potentiated by the production of various modulators (e.g., cytokines) which may amplify the response. Finally, it has been argued that some of the effects of immune complexes may depend on its size which may grow to contain 2 or 3 bound IgG molecules. An additional mechanism of antibody mediated damage includes its penetration to the tissues to produce deleterious effects. This is suggested by the observation of IgG in epithelial cells of skin biopsy from lupus patients. Several cell populations (predominantly neurons) have been shown to engulf IgG by pinocytosis through in vitro studies.
12
Exposure of cryptic (hidden) epitopes following cell injury may result in presentation of an intracellular antigen, previously not exposed to the influence of the immune system. This mechanism has been demonstrated in Goodpasture's syndrome patients exposed to cigarette smoking (which probably mediate alveolar and glomerular exposure of the cryptic epitopes towards which the corresponding autoantibody react).
8. CANCER AND AUTOIMMUNITY Many reports exist regarding the association of autoimmune diseases and neoplasms. Autoimmune phenotype and various autoantibodies have been found in patients with diverse malignancies. For example: antinuclear antibodies have been described in a prevalence of 19%-31% by different authors (reviewed in Reference [39]). Unlike the autoantibodies found in prototypic autoimmune diseases (i.e., SLE), autoantibodies in various malignancies exhibit a more restricted pattern of reactivity. Similarly, rheumatoid factor has also been detected in higher prevalence in patients with malignancies in comparison with control subjects (between 11% and 85% in different reports). The presence of RF was found to correlate with a poorer prognosis in malignancies such as transitional cell carcinoma, melanoma and gastrointestinal malignancies. Malignant transformation is an important process occurring in patients with autoimmune diseases. The reasons for the increased tendency to malignancies is not always apparent but probably derives both from genetic factors and from environmental determinants (i.e., chemotherapy). Examples of common neoplasms in autoimmune diseases include: lymphoproliferative malignancies in patients with rheumatoid arthritis, lymphomas in patients with SLE and Sjogren's syndrome, epithelial malignancies in patients with dermatomyositis and polymyositis, lung cancer in scleroderma and lymphomas as well as thyroid papillary carcinomas in patients with autoimmune thyroid diseases. Thus, the relationship between autoimmunity and cancer is dual and a cause and effect association can not be determined with certainty. However, regardless of the initial triggering factor, it appears that the immune system plays a detrimental role in the pathogenesis of both autoimmunity and cancer suggesting
AUTOIMMUNE STATE/NORMAL HEALTH ENVIRONMENTAL: Infection Stress Drugs, UV Smoking
GENETIC: HLA, Gm allotypes idiotypes C deficiency
IMMUNE DEFICIENCIES: IgA deficiency fl
HORMONAL: Estrogen i\ Testosterone U Prolactin 11 Thymic hormones ftU
TsU C2,C4 deficiency i\ NKU
1 1 1 1 1 1
t MffiCO^IMUNE DISEASl Figure 2. Evolution of an autoimmune disease from a "state of autoimmunity" may require the participation of diverse elements consisting of environmental, hormonal, immunological and genetic effects. These factors may act in concert or each one a part, to render an individual prone to autoimmune disease following an inciting 'triggering event'. It is probably the combined action of these factors, rather than the existence of each, that results in an autoimmune disease.
it may be implemented in the future for targeted immunomodulation of neoplasms.
9. CONCLUDING REMARKS-THE "MOSAIC" OF AUTOIMMUNITY As could be viewed from the above, the ability to distinguish self from non-self is a key inherent property of the immune system engaging in normal preserva-
tion of immunological homeostasis [40]. However, an interplay of predisposing conditions which indeed have been found to occur frequently in autoimmmue diseases render an individual prone to experience an attack of his immune system on his own self constituents [41]. No consistent condition has been shown to accompany all autoimmune states, yet it may be so that a unique set of terms are fulfilled in an individual, combining in a 'mosaic' pattern that results in diverting
13
an immune mediated inflammatory process to damage self-structures. Thus, incriminated predisposing factors include hormonal, environmental, immunologic and genetic elements (Figure 2), which collectively constitute a milieu which enable a seemingly innocent triggering event to activate a vicious cascade resulting in autoimmune disease. Thus, for example, two members of the same family (first degree relatives) indeed ^inherit' the same preponderance to develop autoimmunity as determined by their HLA status. However, the different frequencies of AI diseases among these apparently 'equally prone' subjects could well be explained by the existence of additional factors (environmental, hormonal and immunologic). These observations lend further support to the concept of mosaicism as predominating in autoimmunity.
11.
12. 13.
14.
15.
16.
17. 18.
REFERENCES 1.
2. 3.
4.
5.
6.
7. 8. 9.
10.
14
Pincus T, Mitchell JM, Burkhauser RV. Substantial work disabilities and earnings losses in individuals less than 65 with osteoarthritis: comparison with rheumatoid arthritis. J Clin Epidemiol 1989; 42: 449457. Nossal GJ. Immunology: the basic concepts of the immune system. N Eng J Med 1987; 8: 227-235. Hamaoka T, Ono S. Regulation of B-cell differentiation: interaction of factors and corresponding receptors. Annu Rev Immunol 1986; 4: 167-204. Cambier JC, Ransom JT. Molecular signaling in Blymphocytes. Annu Rev Immunol 1987; 5: 175199. Natvig JB, Kunkel HG. Human immunoglobulins: classes, subclasses, genetic variants and idioypes. Adv Immunol 1973; 16: 1-59. Romain PL, Schlossman SE. Human T lymphocyte subsets: functional heterogenicity and surface recognition sturctures. J Clin Invest 1984; 74: 15591565. Acuto O, Reinherz EL. The human T-cell receptor. N Eng J Med 1985; 312: 1100-1 111. Balkwill PR, Burk F. The cytokine network. Immunol Today 1989; 10: 299-302. Muller-Eberhard HJ. Molecular organization and function of the complement system. Annu Rev Biochem 1988; 57: 321-335. Tada TM, Tanaguch TM, Takemori T. Properties of primed suppressor T cells and their products. Transplant Rev 1975; 26: 106-129.
19.
20.
21.
22.
23.
24.
25.
26.
27.
Ehrlich P. In : Himmelweit F (Ed) The collected papers of Paul Ehrlich, Vol 2, London, Pergamon Press, 1957; 246-255. Rose NR. Autoimmunity: a personal memoir. Autoimmunity 1988; 1: 15-21. Coombs RRA, Mourant AE, Race RR. A new test for the detection of weak and incomplete Rh agglutinins. Br J Exp Pathol 1945; 26: 255. Burnet FN. The clonal selection theory of acquired immunity. Cambridge University Press, London, 1959. Elliot T How do peptides associate with MHC class I -restricted processing pathway. Immunol Today 1991; 12: 447-155. Cohen J J, Duke RC, Fadok VA, Sellins KS. Apoptosis and programmed cell death in immunity. Annu Rev Immunol 1992; 10: 267-293. Nagata S, Golstein P. The fas death factor. Science 1995;267:1449-1456. Shoenfeld Y, Isenberg DA, eds. Natural autoantibodies. Boca Ranton: CRC Press, Inc, 1992, 1-550. Grabar P. Autoantibodies and the physiological roles of immunoglobulins. Immunol Today 1983; 4: 387342. Cohen IR, Cooke A. Natural autoantibodies might prevent autoimmune disease.Immunol Today 1986; 7: 363-364. George J & Shoenfeld Y. Natural Autoantibodies. In: "Autoantibodies". Eds. Peter JB & Shoenfeld Y. Elsevier, Ltd, 1996. Bakimer R, Fishman P, Blank M, Srendi B, Djaldetti M, Shoenfeld Y. Induction of primary antiphospholipid syndrome in naive mice by immunization with a human monoclonal anti-cardiolipin antibody J Clin Invest 1992; 89 1558-1663. Casali P, Burastero SE, Nakamura M, et al. Human lymphocytes making rheumatoid factor and antibody to ss-DNA belong to Leu-1+ B cell subset. Science 1987; 236: 77-81. Karjalainen J, Martin JM, Knip M, Ilonen J, Robinson BH, Savilahti E, et al. A bovine albumin peptide as a possible trigger of insulin-dependent diabetes mellitus. N Eng J Med 1992; 327: 302. Jemmerson R, Morrow PR, Klinman NR, et al. Analyses of an evolutionarily conserved antigenic site on mammalian cytochrome c using synthetic peptides. Proc Natl Acad Sci USA 1982; 82: 1508. Botazzo GF, Pujol-Borrel R, Hanfusa T, et al. Role of aberrant HLA-DR expression and antigen presentation in induction of endocrine autoimmunity. Lancet 1983; 2:1115. Ferraccioli G, Savi M. Association between DR antigens, rheumatoid arthritis with and without extraar-
28.
29. 30.
31.
32.
33.
34.
ticular features and SLE in Northern Italy. Ital J Rheumatol 1988 15:51-53. Thofilopoulus AN, Dixon FJ. Murine models of systemic lupus erythematusus. Adv Immunol 1985; 37: 269. Jeme NK. Towards a network theory of the immune system. Annales D'immunologie 1974 125c; 373-89. Shoenfeld Y. Idiotypic induction of autoimmunity: a new aspect of the idiotypic network. FASEB J 1994; 8: 1296-1303. Mendlovic S, Brocke S, Shoenfeld Y et al. Induction of SLE-like disease in mice by a common anti-DNA idiotype. Proc Natl Acad Sci USA 1988; 85: 2260-64. Behar MB, Porcelli SA. Mechanisms of autoimmune disease induction. The role of the immune response to microbial pathogens. Arthritis Rheum 1995; 38: 45876. Shoenfeld Y, Cohen IR. Infection and autoimmunity. In: Sela M, ed. The Antigens. CRC Press, Boca Raton, FL1988: 430-88. Shoenfeld Y, Isenberg DA. Mycobacteria and autoimmunity. Immunol Today 1988; 9: 178-182.
35.
36.
37. 38.
39.
40.
41.
Van Eden W. Heat shock proteins as immunogenic bacterial antigens with the potential to induce and regulate autoimmune arthritis. Immunol Rev 1991; 121: 5. Shoenfeld Y, Isenberg DA. Environmental Factors and Autoimmunity. In: The Mosaic of Autoimmunity, Elsevier, Amsterdam, 1989, 321-410. Hess E. Drug related lupus. N Eng J Med 1988; 318: 1460. Blank M, Mendlovic S, Fricke H, Moses E, Talal N, Shoenfeld Y Sex hormone involvement in the induction of SLE by a pathogenic anti-DNA idiotype in naive mice. J Rheumatol 1990; 17: 311-319. Tomer Y, Sherer Y, Shoenfeld Y. Autoantibodies, autoimmunity and cancer. Oncology Rep 1998; 5: 753-761. Schwartz RS. Autoimmunity and autoimmune disease. In: Fundamental Immunology. Ed:Paul WE. Raven Press, Ltd. New York, 1993: 10331098 Shoenfeld Y, Isenberg DA. The mosaic of autoimmunity. Immunology Today. 1989; 10: 123-126.
15
© 2000 Elsevier Science B.V All rights reserved. Cancer and Autoimmunity Y. Shoenfeld and M. E. Gershwin, editors
Rheumatoid Arthritis and Cancer Mahmoud Abu-Shakra^ Dan Buskila^ and Yehuda Shoenfeld^ ^Soroka Medical Center and Ben-Gurion University, Beer-Sheva, Israel; ^Sheba Medical Centre and Sackler Faculty of Medicine, Tel-Aviv, Israel
1. INTRODUCTION Rheumatoid arthritis (RA) is a chronic systemic inflammatory disease characterized by proliferative synovitis of diarthrodial joints, serositis, lymphocytic infiltration in various tissues, vasculitis of small vessels and the production of anti-immunoglobulin autoantibodies (rheumatoid factor) [1]. The etiology of the disease remains unknown. However, environmental and immunogenetic factors may have a role in the development of the disease [2]. Furthermore, the genetic background of the patients may determine the severity of the disease. Genetic analyses have shown that certain HLA DRBl genotypes (0401/0401)are associated with more severe, erosive and deforming form of RA [3]. The disease affects both females and males, but it is 2-3 times more common in women than men. The articular features of the disease include, morning stiffness and swelling, erosions and deformities of the small joints of the hands and feet as well as the large joints. Extra-articular features are also common and include malaise, fatigue, rheumatoid nodules, Sjogren's syndrome, lymphadenopathy, splenomegaly, vasculitis of the skin and internal organs, pleuritis, perecarditis and others [1]. The management of RA include the use of nonsteroidal anti-inflammatory drugs, steroids, and the disease modifying anti-rheumatic drugs (DMARDs). Methotrexate, gold salts and azathioprine are commonly used in the treatment of the disease. Other treatment modalities include the use of cyclosporine A and biologic agents [4]. Various studies have suggested an increased risk of malignancy among patients with RA and malig-
nant diseases contribute significantly to the morbidity and mortality of the disease [5-9]. In the present chapter, we review the association between RA and malignancies.
2. PREVALENCE OF CANCER IN RA The link between RA and cancers is based on numerous case reports of RA patients who developed solid and lymphoproliferative cancers and on large population-based studies. Cases of non-Hodgkin's lymphoma (NHL) [10], acute and chronic leukemia [11-12], multiple myeloma [13], and lung cancers [14] were all reported in association with RA patients. Over the last three decades, several studies have reported the rate of cancer among large cohorts of RA patients [5-7]. Furthermore, the contribution of various DMARDs to the overall risk of cancer and to the risk of lymphoproliferative tumors was also reported [15-19]. Mortality and autopsies studies have indicated a low rate of cancer-related deaths among patients with RA compared to the general population [20-22]. In three mortality studies, the rate of death as result of cancer was between 7-11%. In a cohort of 1000 patients with RA followed over 3 years between 19701975, cancer was the cause of death in 9% of the total deaths compared to 27% in the general population [21]. In a more recent study [8] from four North American centers, the observed rate of cancer death among the patients with RA was 9.4% compared with 27.7% in the general population. Epidemiologic studies have shown the frequency of cancers in patients with RA to be between 2-15%.
19
In three large population-based studies, the prevalence of cancer was 2.6% among 46,101 patients with RA included in the nationwide registry in Finland [5], 7.2% among 11,683 RA patients from Sweden [6], and 9.7% within a cohort of 20,699 patients recorded in the Danish Hospital Discharge Register [7]. Higher rates of cancer were identified among RA patients living in Rochester, Minnesota, USA (16%) [23], among RA patients living in Saskatchewan, Canada (15.8%) [24] among men with Felty's syndrome (15%) [26], and among RA patients who received cyclophosphamide (16-30%) [27-28]. Table 1 shows the frequency of cancer within various cohorts. Tennis et al. [29] estimated the incidence of cancer among 1210 patients with RA who followed over 6539 patient-years in the province of Saskatchewan, Canada. The age adjusted incidence densities of cancer in RA was 8.2 cases/1000 person-years for women and 26.1 cases/1000 person-years for men. In the same study, incidence densities in the general population were, 10.4 cases/1000 persons in women and 16.1 cases/1000 persons per year. Similarly, in a large population-based study [6] of 11,683 Swedish RA patients followed over 101,000 patient-years, the estimated incidence rate of cancer in that cohort was 8.3 cases/1000 person-years.
In three large population-based long-term studies of RA patients living in Scandinavia, the overall risk of cancer was not increased in two cohorts [5,6], and a significant 11% increase in all cancers was observed within the third cohort [7]. The studies populations comprised 46,101 RA patients living in Finland [5], 11,683 RA patients from Sweden [6] and 20,699 RA patients living in Denmark [7]. The standardized incidence ratios (SIR) (observed/expected) for cancer were 1.06 in the first study [5], 0.95 in the second [6], and 1.11 (1.7 for hematopoeitic cancers, 1.08 for nonhematopoietic cancers) in the third [7]. A significantly increased risk of cancer compared with the general population was observed in RA patients treated with cyclophosphamide (SIR = 3.7) [28], and in RA patients with Felty's syndrome (SIR = 2.09) [25]. Taken together, the data suggest that the overall risk of cancer among patients with RA is not increased, or is slightly increased. However, patients with severe RA and particularly those with Felty's syndrome [25], and those who received cyclophosphamide [28], have a clinically and statistically significant increased risk for development of cancers.
4. SPECIFIC CANCERS AND RA 3. RISK OF CANCER IN RA COMPARED TO THE GENERAL POPULATION
4.1. Lymphoproliferative Cancers
Several studies were designed to determine whether, or not, RA is associated with: (a) an increased risk for the development of all cancers; (b) an increased risk for the development of specific cancer types; (c) no link occurs between RA and malignancy; and (d) low risk for the development of certain cancers. The risk of cancer among patients with RA was studied in small and large cohorts of RA patients followed at certain rheumatology clinics and in large population-based studies. Table 1 shows the relative risk of cancer among patients with RA compared to the general population. The table shows that while some of the studies indicate that the overall risk of cancer in RA is not increased [5, 6, 15, 23, 24], others have shown a significantly increased risk of cancer in patients with RA compared with the general population [7, 25, 27, 28].
The data from several cohorts of RA patients who developed malignant neoplasms indicate that RA is associated with an increased risk of lymphoproliferative cancers including lymphoma [5-7, 16, 25, 30], leukemia [5, 6, 24, 25, 27] and myeloma [5]. Table 2 shows the relative risk for development of lymphoproliferative diseases in patients with RA compared to the general population. A 1.5- to 8.7-fold increased risks for all lymphoproliferative cancers were observed in several studies [6, 7, 15, 27]. In two large population-based studies, the risks of developing all lymphoproliferative cancers were 1.52 (1.2-1.9) [6] and 1.7 (1.5-2.0) [7]. While the relative risks for haematopoietic cancers among men and women with RA were similar (1.7 each) in a large cohort of patients with RA [7], other studies reported higher risks for lymphoproliferative cancers among men with RA [6, 27] and among men with Felty's syndrome [25]. Prior [27] found the
20
Q
<
^
^
<
o o V
o d V
*5b
B o
ill Ml <
Q
^ -3
00
s
en
ON
q ^-
1 oo
O
»o q q
0^
^ ^" ^*
d
'-: ^ «n
X
m
CO
m r-
ON
^-*
's I
^ E2
VD ON ON
d
ON (N rr-~. r- O c o a (N O ^ (N (U ^c ^ c B " ^ a 4 3 D o
S
d
0^
00
S &:
q
r 7
d d
p^ -c
u
^
^
>>
^
C/5
i-
U
<
g^ ^ o
C/5 C/5
Q
O
00
r-
vo
^^
»—
^ 1
ON
—!
'^ CO ^ --^
00 00
i.
5 • 21 ^. ^ 5 Il§ 5
I
ON
0^
OS 00
•
^
_w 'o 03
00
2
^ ^-^
VO
o CO lO
o c^
VO O ON
o 03 D >H
-u
^
D
C
toX)
u
cd
s ;-( O !^
^
li
li
B
o
(N
^-^
^
5
S
o
II
21
vo' OS ^^ r- ^ ^ 1 1
9 U
(N ON
o ^
VO
(N (N
00
O lO
1 o\ o
(N
'^.
r-;
in
^ (N ^^ 00 ^H in ^ (N ^" '-H
1 00
1 1 ro^ ( d ^ o^ m rOO 00 '—1 ^ d ^*
^
a\" ^ 1
T 7
I
C. d^ d^
O
in
u
m1 o
o
in
1
CO
o o O^ en »o ON
—^
o
00
T-^
r-H*
I O
I
I 00
^
^. d, d^
o^ ro
—^
00' 00 00 (N
"c ^ !5 in^
JH
I
(N
O OH
—'
u
(U
^
2
^ ' in CO
d^ O in
^. ON
O
DC cii
-^
(N rl^ t CO
B o O
<
^ ^
G^
^
J^rn1 o (N OO
00
—
o
O
lO
(N
o
—
OS
O (N
(N
1 r-; r-^ r~ ri
O N1
' ^
I
^^^ in ^^ ^^_^ ^ ^ (N
fi
CO
1 in
1
1 in
O 73 V-i
cd
OO CO
CO
00 O)
o
CNJ
•i^
Pu
22
I
^
I
a •? ^
111
o c
t/j
^ '^ ^ > 'o _c 13 a
0)
l—H
U
^(U q g
o M?^ V ;3 C^ a. J
^ II
^
U
risk for all lymphoproliferative cancers to be 10.9 for men and 6.9 for women with RA compared to the general population. Gridley et al. [6] found a 2.6fold increased risk for lymphoproliferative cancers in men with RA, however, no increased risk for lymphoproliferative cancer was identified among women with RA in the same study. A 8.05-fold increased risk for lymphoproliferative malignancies was seen in men with Felty's syndrome [25], suggesting that the risk for malignancies is higher in patients with severe disease. A literature review has revealed numerous case reports of patients with RA who developed Hodgkin's (HL) and non-Hodgkin's lymphoma (NHL) [10, 31-33]. Lymphomas occurred in patients with mild and severe form of RA. Nodal and extra-nodal cases of lymphomas were reported among patients of RA. Cases of lymphomas localized to the joints and presenting as monoarticular swelling have also been reported [34-35]. Several cases have indicated a link between NHL and treatment with DMARDs [31-38]. Whether lymphoma in patients with RA develops as a result of the disease state, or its treatment with cytotoxic agents, remains controversial. In a review of 20 cases of patients with RA and lymphoma, the mean interval between the development of lymphoma and RA was 13.2 years. No predominance of specific clinical or histological type was noted and none of the patients received cytotoxic drugs in that series [10]. In an another review of methotrexate treated RA patients who developed lymphoma, the interval between the development of lymphoma and RA was only 2.4 years [31]. The role of cytotoxic drugs in the development of lymphoma in patients with RA will be detailed later in this chapter. Table 2 shows the risk for development of HL, NHL and all lymphomas in patients with RA compared to the general population. In large populationbased studies from Scandinavia, compared to the general population the risks for development of NHL in patients with RA were 2.67 in Finland [5], 1.88 in Sweden [6] and 2.4 in Denmark. However, two studies from Saskatchewan, Canada, have failed to identify an increased risk for lymphoma among RA patients [24, 29]. On the other hand, a strikingly increased risk for development NHL was seen in male RA patients with Felty's syndrome (observed /expected ratio of 12.7) [25].
The presence of Sjogren's syndrome was found to increase the risk for development of lymphoma. Compared to the general population in Finland the risk for development of NHL was 2.2 for patients with RA, 4.5 for patients with secondary Sjogren's syndrome and 8.7 for patients with primary Sjogren's syndrome [30]. Numerous studies have described patients with RA who developed acute [10] or chronic leukemia [11], including chronic lymphocytic leukemia (CLL) [11], acute nonlymphoblastic leukemia (ANLL) [39], hairy cell leukemia [40] and others [41]. Leukemia developed mainly in patients treated with cytotoxic drugs [11] including cyclophosphamide [42], chlorambucil [43], azathioprine [44] and methotrexate [45]. However, leukemia were also reported among RA patients who received only gold [46] or penicillamine [47], suggesting that the disease itself increases the risk for the development of leukemia. Patients with RA may present with primary ANLL, or they may develop ANLL as a result of blast transformation of myelodesplastic syndrome. Out of 6 cases of ANLL in patients with RA and other autoimmune diseases treated with methotrexate, 4 had ANLL with differentiation (M2), 1 had acute myelomonocytic leukemia and another was diagnosed with ANLL M4 associated with Inv 16 [48]. Epidemiological studies (Table 2) have revealed an increased risk for the development of leukemia and CLL only in men with RA [5-7]. The risk for the development of leukemia in men with RA was 2.34 in Finland [5], 1.86 in Sweden [6] and 7.6 in patients with Felty's syndrome [25]. A 2.34-fold increased risk for CLL was found among men with RA living in Sweden [6] and a 2.4-fold increased risk for the development of ANLL was identified among men with RA living in Denmark [7]. It has been reported that the prevalence of monoclonal paraproteins is increased in patients with RA and their presence is associated with a high rate of B-cell mahgnant transformation [49]. Out of 23 RA patients with monoclonal band, 5 developed myeloma and 2 developed NHL during a mean follow-up of 4 years [50]. In the large population-based studies, no risk for the development of myeloma was noted in two studies [6, 7], however, a 2.2-fold increased risk for myeloma was found among RA patients living in Finland [5]. Eriksson [51] in a case-control study, matched 275 patients with myeloma to as many con-
23
trols, and found myeloma to be associated with both rheumatic diseases in general and RA specifically. In summary, the data suggest that lymphoproliferative disorders are more common in RA patients compared to the general population.
5. SOLID TUMORS Several studies have reported the site-specific risks for solid tumors among patients with RA (Table 3). A thorough review of those reported indicates that RA is not associated with an increased risk for the development of most of the solid tumors. However, men with Felty's syndrome [25] were found to have an increased risk for the development of lung cancer (RR = 1.98) and melanoma (RR = 6.95). The association between RA and lung cancer is unclear. Case reports have indicated that the presence of pulmonary rheumatoid nodules may increase the risk for lung cancer [14]. Similarly, others have suggested that RA patients with interstitial lung disease have an increased risk for the development of lung malignancies [53]. A strong association between lung cancer and pulmonary fibrosis was found among patients with systemic sclerosis (SSc) [54]. A 7-fold increased risk for lung cancer was found among patients with SSc and all patients with lung cancer had pulmonary fibrosis [54]. In the large population-based studies, a significant 50% and increased risk for lung cancer was identified among men and women with RA from Denmark [7]. An increased risk for lung cancer was also observed among men with RA from Finland (RR = 1.29) [5], and among men with Felty's syndrome (RR = 1.98) [25]. Several studies have reported that patients with RA have reduced risks for the development of stomach [5, 6], colon [6, 24, 52] and/or rectum adenocarcimomas [5, 7, 24]. Gridley et al. [6] found a significant 30% decreased risk for the development of all gastro-intestinal malignancies among patients with RA. Compared to the general population, the relative risks for stomach and colon malignancies among patients with RA were 0.63 (95% CI 0.5-0.9) each. The relative risk for rectal carcinoma was 0.72, however, this was not statistically significant [6]. Isomaki et al. [5] observed significandy reduced risks for the development of stomach and rectum only among women
24
with RA. No reduced risk for the development of gastro-intestinal malignancies was identified among men with RA. However, in a subsequent study [52], from the same center, of 9469 patients with RA followed over, 65,400 person-years, the risks for colon and colorectal cancers compared to the general population were 0.57 (CI 0.33-0.93), and 0.62 (0.42-0.88), respectively. The low risk of colon and rectal adenocarcinoma among patients with RA was attributed to the use of nonsteroidal anti-inflammatory drugs (NSAID), particularly aspirin [55]. NSAIDs and aspirin were shown to suppress growth of colon cancer cells and regulate angiogenesis induced by colon cancer cells of humans and animals [56-57]. It has been suggested that aspirin decreases the risk of colorectal cancer through suppression of cyclooxygenase activity [56-57]. The risk of bladder cancer was not found to be increased among patients with RA. However, the frequency of bladder cancer was 5% among 119 patients with refractory RA treated with cyclophosphamide between 1968-1973 [26]. None of the control RA patients untreated with cyclophosphamide developed bladder cancer. A high rate of overall malignancies (31%) and skin cancers (8.5%) were also observed in the same study. As a result of these findings, cyclophosphamide is not used for the treatment of RA.
6. CAUSES OF CANCER IN RA The data summarized indicate that RA is associated with increased risk for the development of haematopoietic malignancies and possibly several solid tumors. A causal relationship between the development of RA and malignancies may occur. Possible causes for the increased risk of malignancies among patients with RA include; the use of cytotoxic and immunosuppressive agents, a common etiologic agent, genetic susceptibility and immunoregulatory disturbances of the immune system.
7. CYTOTOXIC AND IMMUNOSUPPRESSIVE AGENTS The role of cytotoxic agents in the development of malignancies in patients with RA has been widely studied [15-19, 26, 28, 36]. Various cytotoxic drugs
i ^
in CO
P
^
O
2 2 -^ ^ rrtI" Q 5 B U S O
00
^ ^ d
^ 2 ^ 2 "^ d
III
d CIT in p ^ .a
D S U S O S
D S u S O B
^
>^ V
D U O
,^ o
-^ ^
00
1 CQ
^
c^
CX
en
D oo
1
« S5 e £ S
^
.2
p.
^
u o
^
p
ON
r^
in
o
^-^
o
d 2
c/5UQi
O
(U
coucti
1=3
<^
c
?i
lO ON 5
'-: in
d d -^
-^
—'
00
^ d
^
5
0^
'^ d -^ < ^
oo -5
t^
< S ^ S u S Q i
!-i
a OH
s o <
C^ -C3 .tn
U
^ >n ^ § ^ ^ oo PQ ftj 1/2
u
m
I—I
a;
31:
o C/1
3 (S3
a o
e
=« w
I ^i
>. ^
o
Tl
(U
a
««
2^
o xi U
•—^
(U
•r7> T^
s^ 13
S
Id a)
irT
o d V
25
have been used in the past and are currently used for the treatment of RA. This includes cyclophosphamide, chlorambucil, azathioprine, methotrexate, cyclosporine and others. Cyclophosphamide had been used for the treatment of RA during the sixties and seventies. In controlled studies [26] of RA patients treated with cyclophosphamide and other DMARDs, a 2.3-fold increased risk for cancer was observed among RA patients treated with cyclophosphamide compared to RA patients receiving other drugs. Bladder, haematopoietic and skin cancer were specifically associated with cyclophosphamide. None of the control patients developed skin or bladder cancers [26]. Similarly, 20% of 39 patients with RA treated with chlorambucil developed cutaneous or lymphoid malignancies. The cancers in the chlorambucil treated patients were multiple and recurrent [58]. In several case studies, RA patients treated with azathioprine or methotrexate were found to develop various lymphoproliferative malignancies including NHL and acute and chronic leukemia [10-12, 32, 33, 37]. Georgescu et al. [31] reviewed 25 cases of lymphoma occurring in RA patients treated with methotrexate. Most of the patients had large B-cell lymphoma. The most striking finding in that series, is the spontaneous appearance of lymphoma in 8 cases shortly after the withdrawal of the treatment with methotrexate, suggesting a causal role for methotrexate in the development of lymphoma in patients with RA. In a long-term follow-up study [17] of 202 RA patients treated with high doses of azathioprine (300 mg/d), and 202 RA untreated with azathioprine, it was found that compared to the general population the risks for development of lymphoma were 10-fold in the azathioprine treated patients and 5-fold in the nonazathioprine treated RA patients. In a review paper of all published cohort studies of RA patients who developed lymphomas, the risk for lymphoma compared to the general population was 9.7 among RA patients who received immunosuppressive agents and 2.5 among patients untreated with these drugs [59]. However, the role of other factors, including disease severity, genetic factors, disease duration and others, was not included in the analyses. Therefore, it is unclear which proportion of all lymphoproliferative cancers is directly related to the use of cytotoxic drugs. Several studies have suggested that
26
the risk of lymphoproliferative malignancies associated with cytotoxic drugs is likely to be comparatively small [60, 61]. Cytotoxic drugs may increase the risk of lymphoproliferative malignancies by several mechanisms including; prolonged immunosuppression, high rate of chronic and latent infection and induction of chromosomal aberrations [62-70]. Cytotoxic drugs were found to reduce the number of cytotoxic lymphocytes and to induce a state of immunosuppression of the cell mediated immune system. Profound immunosuppression may occur in patients treated with cyclophosphamide, chlorambucil and cyclosporine [62]. Treatment with a low dose of methotrexate is rarely associated with global immunosuppression [63]. The rate of infections was found to be higher in patients with RA treated with various cytotoxic drugs compared to those who did not received these drugs [64]. The impaired immune surveillance among patients treated with cytotoxic drugs may lead to persistence of viral infections, particularly EBV. Chronic infection with EBV may lead to malignant transformation of B cells and development of lymphoma [65-66]. Cytotoxic drugs may have a direct oncogenic effect. In vitro and in vivo studies have shown that MTX was associated with chromosomal aberrations and cellular morphological transformation [67-70]. Treatment with MTX and cyclophosphamide was associated with a dramatic increase of sister chromatid exchanges frequency, which indicate an instability of DNA or a deficiency of DNA repair. The chromosomal aberration were observed in patients taking relatively low doses of MTX or cyclophosphamide. Those aberrations may persist over many years after the chemotherapy [68].
8. INFECTIOUS AGENTS Infectious agents have been associated with the development of malignancies in patients with RA [66]. Patients with RA have an increased risk of infection. Sepsis, bacterial and viral infections are common in patients with RA and are among the leading causes of death for patients with RA [8]. Furthermore, patients with RA may develop chronic viral infections. This increased risk of infection is related to the immuno-
suppressive therapy and possibly to the immunological alteration that occur as a result of the disease itself. Chronic infection with Epstein-Barr Virus (EBV) has been associated with the development of lymphomas in patients with RA and patients receiving immunosuppressive therapy for organ transplantation [71]. EBV genome was detected in the malignant cells of RA patients who developed large cell lymphoma. Infected cells from those patients expressed the full complement of EBV encoded proteins and nuclear RNAs essential for latent infection [72]. Natkunam et al. [73] reported 10 cases of patients with RA or dermatomyositis who developed EB V-related lymphomas. In 8 of these cases, the predominant type of EBV was type A. This frequency of infection with type A is similar to that seen in patients with post-solid organ transplantation immunosuppression associated lymphomas [73]. In three patients, a deletion at the 3^ end of the latent membrane protein 1 (LMP-1) was seen. The LMP-1 is EBV-encoded membrane protein known to be oncogenic and mutation at the LMP-1 gene is known to increase the tumorigenic effect. In vitro studies have shown that LMP-1 has the ability to transform fibroblasts and induce malignancy in mice, and to inhibit apoptosis of the B cell. Mutation of the LMP-1 gene is associated with aggressive forms of lymphoproliferative diseases [73]. The data suggest that the development of lymphoma in patients with RA is similar to that seen in patients treated with immunosuppressive therapy for solid organ transplantation and infection with EBV plays a central role for the development of lymphoproliferative disorders in those patients.
9. IMMUNOLOGICAL ABNORMALITIES Activation of inflammatory cells is one of the hallmarks of RA. Proliferation of antigen-presenting cells, B and T lymphocytes is seen in the synovium of patients with RA. Increased T helper and decreased T suppresser and cytotoxic activity are common features ofRA[2]. Activation and expansion of CD+ B have been reported in patients with RA and it may be associated with the generation of autoantibodies [74]. Dauphinee et al. [75] found 47% of B cells from patients with RA to express the CD5+ cell surface marker compared to
26% of B cells from normal donors. Continuous stimulation of the CD"^ B cells may result in malignant transformation. In humans, malignant transformation of CD5+ cells results in the development of chronic lymphocytic leukemia (CLL) [76]. The risk for the development of CLL among patients with RA was reported to be significantly increased compared to the general population. In a case report, severe deficiency of T-cell activity was found in patients with RA who developed lymphoma [77]. However, EBV genome was identified in the malignant cells, suggesting that impaired immune activity may increase the risk of viral infections which may trigger malignant transformation.
10. SUMMARY The data presented in this chapter suggest that, in general, the overall risk for the development of malignancies is not increased or slightly increased compared to the general populations. However, patients with severe RA, and particularly Felty's syndrome, have a clinically significant increased risk for the development of cancers. The risk of colon cancer is significantly reduced compared to the general population and this is most likely related to the use of aspirin and other NSAIDs. All the large population-based studies found an increased risk for the development of lymphoproliferative diseases, and particularly NHL. Several mechanisms may explain the reasons for the increased risk for NHL among patients with RA. These include (a) the use of cytotoxic drugs which may act through induction of chromosomal abnormalities, direct oncogenic effect by facilitating the development of latent and chronic infection with EBV and other viruses, and (b) expansion and malignant transformation of the lymphocytic clones as a result of all of the immunogenetic mechanisms involved in the pathogenesis of RA.
REFERENCES 1.
Harris ED. Clinical features of rheumatoid arthritis. In: Kelly WN, Harris ED, Ruddy S, Sledge CB, eds., Textbook of Rheumatology, 5th edn. Philadelphia: WB Saunders 1997:895-922.
27
2.
3.
6.
9.
10.
11.
12.
13.
14.
15.
16.
28
Firestein GS. Etiology and pathogenesis of rheumatoid arthritis. In: Kelly WN, Harris ED, Ruddy S, Sledge CB, eds., Textbook of Rheumatology, 5th edn. Philadelphia: WB Saunders 1997:851-898. Weyand CM, Hicok KC, Conn DL, Goronzy JJ. The influence of HLA-DRB1 genes on disease severity in rheumatoid arthritis. Ann Int Med 1992;117:801-806. Harris ED. Treatment of rheumatoid arthritis. In: Kelly WN, Harris ED, Ruddy S, Sledge CB, eds., Textbook of Rheumatology, 5th edn. Philadelphia: WB Saunders 1997:933-950. Isomaki HA, Hakulinen T, Joutsenlahti U. Excess risk of lymphomas, leukemia and myeloma in patients with rheumatoid arthritis. J Chron Dis 1978;31:691696. Gridley G, McLaughhn JK, Ekbom A, Klareskog L, Adami HO, Hacker DG, Hoover R, Fraumeni JF Jr. Incidence of cancer among patients with rheumatoid arthritis. J Natl Cancer Inst. 1993 17; 85:307-311. Mellemkjaer L, Linet MS, Gridley G, Frisch M, MoUer H, Olsen JH. Rheumatoid arthritis and cancer risk. Eur J Cancer 1996;32A: 1753-1757. Wolfe F, Mitchell DM, Sibley JT, Fries JF, Bloch DA, Williams C, Spitz PW, Haga M, Kleinheksel SM, Cathey MA. The mortality of rheumatoid arthritis. Arthrit Rheum 1994;37:481-494. Fries JF, Bloch D, Spitz P, Mitchell DM. Cancer in rheumatoid arthritis: a prospective long term study of mortality. Am J Med 1985;21:78(lA):56-59. Symmons DP, Ahern M, Bacon PA, Hawkins CF, Amlot PL, Jones EL, Prior P, Scott DL. Lymphoproliferative malignancy in rheumatoid arthritis: a study of 20 cases. Ann Rheum Dis 1984;43:132-135. Seidenfeld AM, Smythe HA, Ogryzlo MA, Urowitz MB, Dotten DA. Acute leukemia in rheumatoid arthritis treated with cytotoxic agents. J Rheumatol 1984;11:586-587. Taylor HG, Nixon N, Sheeran TP, Dawes PT. Rheumatoid arthritis and chronic lymphatic leukemia. Clin Exp Rheumatol 1989;7:529-532. Fam AG, Lewis AJ, Cowan DH. Multiple myeloma and amyloid bone lesions complicating rheumatoid arthritis. J Rheumatol 1981;8:845-850. Shenberger KN, Schned AR, Taylor TH. Rheumatoid disease and bronchogenic carcinoma—case report and review of the literature. J Rheumatol 1984;13:909-911. Matteson JL, Hickey AR, Maquire L, Tilson HH, Urowitz MB. Occurrence of neoplasia in patients with rheumatoid arthritis enrolled in a DMARD registry. J Rheumatol 1991;18:809-814. Kinlen LJ. Incidence of cancer in rheumatoid arthritis and other disorders after immunosuppressive treatment. Am J Med 1985;78 (S1A):44^9.
17.
18.
19.
20.
21.
22. 23.
24.
25.
26.
27.
28.
29.
30.
Silman AJ, Petrie J, Hazleman B, Evans SJ. Lymphoproliferative cancer and other malignancy in patients with rheumatoid arthritis treated with azathioprine: a 20 year follow up study. Ann Rheum Dis 1988;47:988-992. Kirsner AB, Farber SJ, Sheon RP, Finkel RI. The incidence of malignant disease in patients receiving cytotoxic therapy for rheumatoid arthritis. Ann Rheum Dis 1982;41(Sl):32-33. Moder KG, Tefferi A, Cohen MD, Menke DM, Luthra HS. Hematologic malignancies and the use of methotrexate in rheumatoid arthritis: a retrospective study. Am J Med 1995;99:276-281. Mutru O, Koota K, Isomaki H. Causes of death in autopsied RA patients. Scand J Rheumatol 1976;5:239240. Isomaki HA, Mutru O, Koota K. Death rate and causes of death in patients with rheumatoid arthritis. Scand J Rheumatol 1975;4:205-208. Monson RR, Hall AP. Mortality among arthritic. J Chronic Dis 1976;29:459-462. Katusic S, Beard CM, Kurland LT, Weis JW, Bergstralh E. Occurrence of malignant neoplasms in the Rochester, Minnesota, rheumatoid arthritis cohort. Am J Med 1985;78:50-55. Cibere J, Sibley J, Haga M. Rheumatoid arthritis and the risk of malignancy. Arthrit Rheum 1997;40:15801586. Gridley G, Klippel JH, Hoover RN, Fraumeni JF. Incidence of cancer among men with Felty syndrome. Ann Int Med 1994;120:35-39. Baker GL, Kahl LE, Zee BC, Stolzer BL, Agarwal AK, Medsger TA. Malignancy following treatment of rheumatoid arthritis with cyclophosphamide. Am J Med 1987;83:1-9. Prior P. Cancer and rheumatoid arthritis: Epidemiologic considerations. Am J Med 1985;78(S1A):1521. Baltus JAM, Boersma JW, Hartman AP, Vanderbroucke JP. The occurrence of malignancies in patients with rheumatoid arthritis treated with cyclophosphamide: a controlled retrospective follow-up. Ann Rheum Dis 1983;43:368-373. Tennis P, Andrews E, Bombardier C, Wang Y, Strand L, West R, Tilson H, Doi P. Record Unkage to conduct an epidemiologic study on the association of rheumatoid arthritis and lymphoma in the Province of Saskatchewan, Canada. J Clin Epidemiol 1993;46:685-695. Kauppi M, Pukkala E, Isomaki H. Elevated incidence of hematologic malignancies in patients with Sogren's syndrome compared with patients with rheumatoid arthritis. Cancer Causes Control 1997;8:201204.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
Georgescu L, Quinn GC, Schwartzman S, Paget SA. Lymphoma in patients with rheumatoid arthritis: association with the disease state or methotrexate treatment. Semin Arthrit Rheum 1997;26:794-804. Usman AR, Yunus MB. Non-Hodgkin's lymphoma in patients with rheumatoid arthritis treated with low dose methotrexate. J Rheumatol 1996;23:1095-1097. Padeh S, Sharon N, Schiby G, Rechavi G, Passwell JH. Hodgkin's lymphoma in systemic onset juvenile rheumatoid arthritis after treatment with low dose methotrexate. J Rheumatol 1997;24:2035-2037. de-Beer JD, Bogoch ER, Smythe HA. Lymphoma presenting as popliteal mass in a patient with rheumatoid arthritis. J Rheumatol 1990;17:1242-1243. Findeisen JM, Clague RB. An unusual cause of joint swelling in rheumatoid arthritis. Br J Rheumatol 1989;28:62-64. Arellano F, Krupp P. Malignancies in rheumatoid arthritis patients treated with cyclosporin A. Br J Rheumatol 1993;32(Sl):72-75. Kingsmore SF, Hall BD, Allen NB, Rice JR, Caldwell DS. Association of methotrexate, rheumatoid arthritis and lymphoma. J Rheumatol 1992;19:1462-1465. Pitt PI, Sultan AH, Malone M, Andrews V, Hamilton EB. Association between azathioprine therapy and lymphoma. J R Soc Med 1987;80:428-429. Roubenoff R, Jones RJ, Karp JE, Stevens MB. Remission of rheumatoid arthritis with the successful treatment of acute myelogenous leukemia with cytosine arabinoside, daunorubicin and m-AMSA. Arthrit Rheum 1987;30:1187-1190. Crofts MA, Sharp JC, Joyner MV. Rheumatoid arthritis and hairy cell leukemia. Lancet 1979;28(2):203204. Lipton JH, Messner HA. Chronic myeloid leukemia in a woman with Still's disease treated with 198 Au synoviorthesis. J Rheumatol 1991;18:734-735. Kapadia SB, Kaplan SS. Acute melogenous leukemia following immunosuppressive therapy for rheumatoid arthritis. Am J Clin Pathol 1978;70:301-302. Kauppi MJ, Savolainen HA, Anttila VJ, Isomaki HA. Increased risk of leukemia in patients with juvenile chronic arthritis treated with chlorambucil. Acta Paediatr 1996;85:248-250. Gilmore IT, Holden G, Rodan KS. Acute leukemia during azathioprine therapy. Postgrad Med 1977;53:173-174. Pointud P, Prudat M, Peron JM. Acute leukemia after low dose methotrexate therapy in a patient with rheumatoid arthritis. J Rheumatol. 1993;20:12151216. Bendix G, Bjelle A, Holmberg E. Cancer morbidity in rheumatoid arthritis patients treated with Proresid or
47.
48.
49. 50.
51.
52.
53.
54. 55.
56.
57.
58.
59. 60.
61.
62.
parenteral gold. Scand J Rheumatol 1995;24(2):7984. Clausen JE, Arndal JC, Gram L, Kudahl SB. Chronic lymphocytic leukemia after treatment with penicillamine [letter]. Lancet 1978;15(2):152. Rosenthal NS, Farhi DC. Myelodysplastic syndromes and acute myeloid leukemia in connective tissue disease after single agent chemotherapy. Am J Clin Pathol 1996;106:676-679. Kelly CA. Paraproteins in rheumatoid arthritis and related disorders. Int J Clin Lab Res 1992;21:288-291. Kelly C, Baird G, Foster H, Hosker H, Griffiths I. Prognostic significance of paraproteinaemia in rheumatoid arthritis. Ann Rheum Dis 1991 ;50:290294. Eriksson M. Rheumatoid arthritis as a risk factor for multiple myeloma: a case control study. Eur J Cancer 1993;29A:259-263. Kauppi M, Pukkala E, Isomaki H. Low incidence of colorectal cancer in patients with rheumatoid arthritis. Clin Exp Rheumatol 1996;14:551-553. Helmers R, Galvin J, Hunninghake GW. Pulmonary manifestations associated with rheumatoid arthritis. Chest 1991;100:235-238. Abu-shakra M, Guilleman F, Lee P. Cancer in Systemic Sclerosis. Arthrit Rheum 1993;36:460-464. Heath CW. Rheumatoid arthritis, aspirin, and gastrointestinal cancer. J Natl Cancer Inst 1993;17(85):258-259. Tsujii M, Kawano S, Tsuji S, Sawaoka H, Hori M, DuBois RN. Cyclooxygenase regulates angiogenesis induced by colon cancer cells. Cell 1998;93:705716. Qiao L, Hanif R, Sphicas E, Shiff SJ, Rigas B. Effect of aspirin on induction of apoptosis in HT-29 human colon adenocarcinoma cells. Biochem Pharmacol 1998;55:53-64. Patapanian H, Graham S, Sambrook PN, Browne CD, Champion GD, Cohen ML, Day RO. The oncogenicity of chlorambucil in rheumatoid arthritis. Br J Rheumatol 1988;27:44-47. Kinlen LJ. Malignancy in autoimmune diseases. J Autoimmun 1992;5(SA):363-371. Kremer JM. Is methotrexate oncogenic in patients with rheumatoid arthritis? Semin Arthrit Rheum 1997;26:785-787. Macfarlane GJ, Black RJ. Rheumatoid arthritis and lymphatic cancer. Eur J Cancer 1996;32A:16301632. Fauci AS, Young KR. Immunoregulatory agents. In: Kelly WN, Harris ED, Ruddy S, Sledge CB, eds.. Textbook of Rheumatology, 5th edn. Philadelphia: WB Saunders 1997:805-827.
29
63.
64.
65.
66.
67.
68.
69.
70.
30
Weinblatt ME, Trentham DE, Eraser PA. Long term prospective trial of low dose methotrexate in rheumatoid arthritis. Arthrit Rheum 1988;31:167. Boerbooms AMT, Kerstens PM, van Loenhout JW, Mulder J, van de Putte LA. Infections during low dose methotrexate treatment in rheumatoid arthritis. Sem Arthrit Rheum 1995;24:411-421. Eerraccioli GF, Casatta L, Bartoli E, De-Vita S, Dolcetti R, Boiocchi M, Carbone A. Epstein Barr virus associated Hodgkin's lymphoma in a rheumatoid arthritis patient treated with methotrexate and cyclosporine A. Arthrit Rheum 1995;38:867-868. Liote F, Pertuiset E, Cochand-PrioUet B, D'Agay MF, Dombret H, Numeric P, D'Anglejan G, Kuntz D. Methotrexate related B lymphoproliferative disease in a patient with rheumatoid arthritis. Role of EpsteinBarr virus infection J Rheumatol 1995;22:1174-1178. Banerjee A, Benedict WF. Production of sister chromatid exchange by various cancer chemotherapeutic agents. Cancer Res 1979;39:797-799. Udayakumar AM, Bhargava MK. Persistence of chromosomal aberrations in blood lymphocytes 11 years after cessation of CMF therapy in a breast cancer patient. Cancer Lett 1996;107:1-3. Melnik J, Duffy DM, Sparkes RS. Human mitotic and meiotic chromosome damage following in vivo exposure to methotrexate. Clin Genet 1971 ;2:28-31. Benedict WF, Banerjee A, Gardner A, Jone PA. Induction of morphological transformation in mouse C3H/10T1/2 clone 8 cells and chromosomal damage
71.
72.
73.
74.
75.
76.
77.
in hamster A (Tl) Cl-3 cells by cancer chemotherapeutic agents. Cancer Res 1977;37:2202-2208. Bachman TR, Sawitzke AD, Perkins SL, Ward JH, Cannon GW. Methotrexate associated lymphoma in patients withrheumatoid arthritis: report of two cases. Arthrit Rheum 1996;39:325-329. Van de Rijn M, Cleary ML, Variakojis D, Warnke RA, Chang PP, Kamel OW. Epstein Barr virus clonality in lymphomas occuring in patients with rheumatoid arthritis. Arthrit Rheum 1996;39:638-642. Natkunam Y, Elenitoba KS, Kingma DW, Kamel OW. Epstein Barr virus strain type and latent membrane protein 1 gene deletions in lymphomas in patients with rheumatic diseases. Arthrit Rheum 1997;40:1152-1156. Youinou P, Mackenzie LE, Lamour A, Mageed RA, Lydyard, PM. Human CD5-positive B cells in lymphoid malignancy and connective tissue diseases. Eur J Clin Invest 1993;23:139-150. Dauphinee M, Tovar Z, Talal N. B cells expressing CD5 are increased in Sogren's syndrome. Arthrit Rheum 1988;31:642-647. Shiari T, Hirose S, Okada T, Nishimura H. CD5 + B cells in autoimmune disease and lymphoid malignancy. Clin Immunol Immunopathol 1991 ;59:173186. Weir AB, Herrod HG, Lester EP, Holbert J. Diffuse large-cell lymphoma of B-cell origin and deficient Tcell function in a patient with rheumatoid arthritis. Arch Intern Med 1989;149:1688-1690.
(c) 2000 Elsevier Science B. V All rights reserved. Cancer and Autoimmunity Y. Shoenfeld and M. E. Gershwin, editors
SLE and Cancer Mahmoud Abu-Shakra^ Dan Buskila^ and Yehuda Shoenfeld^ ^Soroka Medical Center and Ben-Gurion University, Beer-Sheva, Israel; ^Sheba Medical Centre and Sackler Faculty of Medicine, Tel-Aviv, Israel
1. INTRODUCTION
2. PREVALENCE OF CANCER IN SLE
Systemic lupus erythematosus (SLE) is a chronic inflammatory multisystem disease with distinct clinical and laboratory features. The etiology of the disease remains unknown. However, various hormonal, genetic and environmental factors have been implicated in the pathogenesis of SLE. Cardinal features of the disease include, B lymphocytes activation, the production of a wide variety of autoantibodies, the generation of pathogenic autoantibodies and their idiotypes and the formation of immune complexes with the development of immune mediated tissue damage [1]. The disease mainly affects females. More than 90% of SLE patients are young women in their reproductive years, suggesting a significant role for hormonal factors in the development of the disease. The disease is characterized by a variable clinical course. While in some patients the disease may be mild affecting only one organ system, in others it is manifested by severe central nervous system, renal and other vital organs involvement. The medical management of SLE includes the use of nonsteroidal anti-inflammatory (NSAID) and antimalarial drugs for the cutaneous and articular features of the disease and corticosteroids and cytotoxic agents for the severe forms of the disease [2]. Recent studies have recognized malignancy as a significant contributor to the mortality and morbidity of the disease. In the present study, the association between SLE and cancers is detailed.
The association between malignancy and SLE was initially based on a number of case reports that suggested a possible relationship between SLE and non-Hodgkin's lymphoma (NHL), Hodgkin's disease, leukemia and several solid tumors [3-7]. Subsequent studies have shown the frequency of cancer in patients with SLE to be between 2.5 and 7.3% [8-11]. Lewis et al. [8] found the frequency of malignant neoplasms in 484 patients with SLE to be 3.7%. Similarly, 24 cancers were identified in 23 (3.2%) of 724 SLE patients at a single center during 7233 patient-years of follow-up [12]. A higher prevalence of cancer (7.3%) was found among 205 consecutive SLE patients followed-up for cancer through the files of the Finnish Cancer Registry [13]. Mortality studies have also found cancer to be an important primary cause of death among patients with SLE. In a recent mortaUty studies of 665 SLE patients followed-up at a North American lupus clinic, mafignant tumors were found in 12 (9.7%) out of 124 deceased SLE patients. In 6.5% of the total deaths, metastatic cancer was found to be the primary cause [14].
3. THE RISK OF CANCER COMPARED WITH THE GENERAL POPULATION For a long period, the risk of cancer among patients with SLE compared with the general population was unknown. This was because the data from the initial studies were difficult to interpret due to the small number of SLE patients, the selection bias of patients
31
with severe disease, or the lack of a suitable control population. During the last decade, four studies have estimated the overall risk of cancer in SLE patients compared with the general population (Table 1) [12, 13, 15, 16]. In the first study [13], a 2.4-fold increased risk for all cancers was observed among SLE patients compared with the general Finnish population. However, in subsequent studies, the overall estimated risk for all cancers had not increased in two large North American lupus cohorts compared with the general population [12, 15]. In a more recent study from Finland, a 30% increased risk was observed with a relative risk (RR) of 1.3 (95% confidence interval (CI) 1.06-1.58) [16]. The risk of cancer was significantly lower in a cohort of 724 patients with SLE compared with the incidence of cancer in 1426 patients with rheumatoid arthritis (RA), and in 248 patients with systemic sclerosis (SSc) [12]. The standardized incidence ratio (SIR) in the SLE cohorts were 0.65 (95% CI 0.410.96) and 0.4 (95% CI 0.26-0.6) compared with the RA and the SSc cohorts, respectively. Taken together, it is controversial whether, or not, the risk of all cancers is increased in SLE patients compared with the general population. Long term multicenter study is needed to determine whether, or not, malignant tumors occur more frequently among patients with SLE.
4. SPECIFIC CANCERS AND SLE 4.1. Hematologic Malignancies While the overall frequency of cancers may not increase in patients with SLE, cohorts from various centers have shown that patients with SLE have an increased risk of lymphoproliferative and hematopoietic malignancies. A 4.1 - to 44-fold increased risk for these cancers was observed [12,13, 15, 16]. However, from this group of cancers, only NHL was significantly associated with an increased risk of cancer. The SIR of NHL in SLE was 5.38 in Toronto [12], 9.3 in Pittsburgh [15] and 44 in Finland [13]. In a recent study of 1585 patients with SLE from the nationwide Danish Hospital Discharge Register [16], there was a significant excess of NHL among the SLE patients with RR = 5.2.
32
A literature review has revealed numerous case reports of patients with SLE who developed NHL, Burkitt's lymphoma and Hodgkin's disease [3, 4, 17-19]. The development of neoplasia in patients with SLE was not related to specific clinical features or a certain subtype of SLE. Lymphoproliferative tumors were identified in patients with mild and severe forms of SLE, in patients with discoid lupus and in patients with subacute cutaneous lupus (SCLE) [12, 13,15, 16, 20]. Twenty cases (3 males, 17 females) of NHL were included in four cohorts of SLE patients [12, 13, 15, 16]. In all cases, NHL occurred after the diagnosis of SLE. The mean age at the diagnosis of SLE was 41 years (range 12-83 years), and the mean interval between the diagnosis of SLE and NHL was 12 years (range 1-30 years). However, in a few case reports [21, 22], SLE developed after the diagnosis of lymphoma. In one case, a 62-year-old woman developed SLE 6 years following chemotherapy for malignant lymphoma [21], and in an another case, SLE developed in a patient with small cleaved cells lymphoma 3 years after treatment with total body irradiation [22]. In the majority of cases of the four SLE cohorts [12, 13, 15, 16], the lymphomas were localized to lymph nodes, however, cases of extra-nodal disease were also noted. Extra-nodal locations included the breast (one case), vertebra (one case) and central nervous system (CNS) in another case. Similarly, in a review of the reported cases of SLE patients who developed lymphoma [23-26], the malignant cells were identified in the spleen [23], liver [24], bones [25] and CNS [26]. Peripheral lymphadenopathy is a very common feature of SLE and lymphoma. However, in patients with SLE the lymph nodes may regress following treatment, while in lymphoma the lymph nodes are large, persistent and progressive. Furthermore, the presence of eosinophilia and pruritis may also suggest lymphoma. One of the 2 SLE patients from Pittsburgh who developed NHL [15] also had Sjogren's syndrome, suggesting that this syndrome may trigger the development of NHL in patients with SLE. However, the association between SLE, NHL and Sjogren's syndrome has not been addressed in the other cohorts of SLE patients who developed malignancies. [12, 13, 16].
Table 1. The risk estimates for cancer in 4 SLE cohorts compared with the general population Cancer risk RR,CI
Petterson etal. [12]
Abu-Shakra etal. [13]
Sweeney etal. [15]
Mellemkjaer et al. [16]
All cancers
2.5(1.3-4.3)
1.08(0.7-1.62)
1.36(0.6-3.03)
1.3(1.06-1.58)
NHL
44(11.9-111)
5.38(1.11-15.7)
9.3(1.3-67.3)
5.2(2.2-10.3)
Leukemia
3.07(0.37-11.1)
All hematologic
4.12(1.52-9.01)
Myaloma/macroglobulinemia
4.1 (0.1-23.2)
2 (0.4-5.7)
1.4(0-7.7)
0.7 (.19-1.8)
2 (.64-6.17)
1(0.5-1.7)
Colon
2.04 (0.4-5.9)
3.4 (0.5-24.3)
1.1 (0.5-1.9)
Pancreas
6.1 (0.75-22.2)
0.5 (0-2.5)
Renal
2.6 (0.07-14.7)
0.5 (0-2.9)
Breast cancer
2.7 (0.7-6.8)
Sarcomas
49 (6.0-177)
Lung
1.9(L1-3.1)
women
1.7(0.35^.9)
men
1.2(0.03-6.8)
Gynecologic
1.2(0.3-3.1)
Liver
8 (2.6-18.6)
Metastatic disease
3.7(1.0-9.5)
RR relative risk; CL 95% confidence interval; NHL: non-Hodgkin's lymphoma.
No cases of Hodgkin's lymphoma were found in the major cohorts studying the association between SLE and malignancies [12-16]. However, Bhalla et al. [4] reviewed 14 cases of Hodgkin's lymphoma in patients with SLE. Similar to Hodgkin's lymphoma in the general population, the disease occurred in patients aged between 15-35 years and above the age of 50. In 8 cases, Hodgkin's lymphoma occurred subsequently to the diagnosis of SLE, and in 6 cases it was diagnosed concurrently with SLE. No specific clinical feature was associated with SLE patients who developed Hodgkin's lymphoma. However, a significant reduction in the amount of y-globulins was observed in some SLE patients who developed Hodgkin's lymphoma [4]. Nonmalignant forms of lymph nodes enlargement in patients with SLE include the Kikushi syndrome [27]: A disease that affect usually young women and manifested as generalized or cervical lymphadenopa-
thy, symptoms of systemic illness and histological features of histiocytic necrotizing lymphadenitis. Kikushi syndrome may precede the development of SLE. Out of 8 patients with primary Kikushi syndrome, 2 developed SLE years after the onset of the Kikushi syndrome [27]. The association between SLE and plasma cells dyscresia is unclear. Monoclonal (M) proteins occur in 2% of patients with SLE [28-29]. This frequency is higher than the expected rate of M proteins in the general population [28]. In a review of 9 cases of SLE patients and M gammopathies followed at a single center, the isotypes of the M protein were IgG in 6 patients, IgA in 2 patients and IgM in 1 patient. No clinical features suggesting multiple myeloma were seen in this group of SLE patients [28]. On the other hand, high percentages of the sera of patients with M gammopathies were found to bind various autoantibodies including, DNA, RNA, Sm, RNP, histones, phospholipids and others. Taken together, the data
33
may suggest a common etiologic agent for SLE and M proliferation of B cells [30-33]. Few studies have described SLE patients who developed Waldenstrom's macroglobulenimea and/or multiple myeloma [12, 34]. The myeloma developed in SLE patients with long-standing disease and usually when the SLE is quiescent. Two cohort have shown a trend of increased risk of leukemia among patients with SLE [12, 16]. A 2- and 3-fold increased risk of leukemia was found in these studies. However, these increased risks of leukemia were not statistically significant. Patients with SLE were found to develop chronic lymphocytic leukemia (CLL), chronic granulocytic leukemia (CGL) acute nonlymphoblastic leukemia (ANLL) and acute lymphoblastic leukemia (ALL) [7, 35-43]. However, in the majority of cases, SLE patients developed either CLL or ANLL. None of the SLE patients included in the major cohorts developed CGL or ALL [1116]. In most cases of SLE patients with leukemia, the development of leukemia, and particularly ANLL, was associated with cytotoxic and immunosuppressive therapy, including cyclophosphamide, azathioprine, and methotremate [7, 35-37, 43]. Six case of acute nonlymphocytic leukemia were reported in SLE patients treated with these agents [7, 35-37, 43]. One case was associated with inversion of chromosome-16 and reported in a patient with SLE treated with cyclophosphamide and azathioprine [35]. In an another case, acute leukemia occurred in a patient after receiving 4 g of cyclophosphamide for lupus nephritis [7]. However, none of the 2 SLE patients with leukemia included in the Toronto cohort received cyclophosphamide and/or other cytotoxic agents before the diagnosis of the leukemia [12]. Similarly, Colovic et al. [40] described a 72-year-old SLE patient who developed acute megacaryocytic (M7) leukemia. Cytotoxic drugs were not given to this patient prior to the diagnosis of leukemia.
5. SOLID TUMORS In several case studies, patients with SLE were found to develop various cancers including, lung, breast, gastrointestinal and gynecological [5, 6, 10-16, 44, 45].
34
Two of the SLE-cancer cohorts [12, 15] have no indication of an increased risk of solid tumors among patients with SLE. However, the data from Danish SLE cohort [16] have shown a significantly increase risk for hepatoma (RR = 8), lung cancer (RR = 1.9) and cancers of the vulva/vagina (RR = 5.7). However, this cohort included only SLE patients who were hospitalized. Patients followed-up only at out patient clinics were not included. Therefore, the increased risk of hepatoma, lung cancer and malignancies of the vulva and vagina in this cohort may be the result of a selection bias. In the second study [13], an increased risk of soft-tissue sarcoma (RR 49, CI 6, 177) was observed. However, these data were based only on 2 cases of soft-tissue sarcoma and the clinical significance of this finding is not clear. A thorough search of the literature has not revealed a similar association between SLE and soft-tissue sarcomas. An increased risk of cervical cancer among patients with SLE has been suggested in a small series of patients [8, 9]. Other studies have indicated an increased frequency of cervical atypia and cervical intraepethilial neoplasia [46-47]. Urinary bladder cancer and squamous cell carcinoma (SCC) were found to be associated with SLE. A strong association was suggested between bladder cancer and treatment with cyclophosphamide for SLE [48]. However, in 5- and 10-year follow-up studies, none of 38 patients with lupus nephritis who were treated with cyclophosphamide developed bladder cancer [49-50]. Patients with chronic discoid lesions were reported to develop SCC of the skin inside the discoid rash [51]. The SCC lesions in patients with SLE were reported to be multiple and highly fatal [52]. Dabaki et al. [51] described 2 SLE patients who developed SCC of the skin. The first patient was white and his SCC of the skin was rapidly metastatic. The second patient was black and had developed SCC at seven different sites over his skin. The association between thymoma and autoimmunity is of a great interest [53]. SLE has been associated with thymoma. SLE may develop concurrently or subsequently to thymoma. It has been reported that more than 30% of patients with thymoma develop autoimmune diseases including, myasthenia gravis, pure red cell aplasis, pemphigus and SLE. Thymectomy may result in regression of the autoimmune diseases [53] in a large number of the patients.
6. CAUSES OF CANCERS IN SLE It is possible that various tumors, and particularly solid cancers, occur simply by chance in patients with SLE with no causal relationship between the development of malignancy and SLE. However, the data of all studies indicate that NHL occurs more commonly in SLE patients compared with the general population. Possible causes for the increased risk of NHL among patients with SLE include the use of cytotoxic agents, a common etiologic agent, similar genetic susceptibility and immunoregulatory disturbances of B and T cells in patients with SLE that predisposes to malignancy. These possible mechanisms will be detailed below. 6.1. Cytotoxic and Immunosuppressive Agents Cyclophosphamide is used in a large proportion of SLE patients with diffuse proliferative glomerulonephritis, in patients with severe CNS involvement and in refractory cases of SLE. Methotrexate and azathioprine are commonly given to patients with SLE and their main role is steroid sparing agents. It has been suggested that the use of those agents may be associated with the development of malignancies. Cyclophosphamide therapy has been reported to be associated with bladder cancer, NHL, acute and chronic leukemia. In a previous study [54], 6% of organ transplant recipient developed malignancies within the first few years after transplantation and immunosuppressive therapy. The most common cancers were, lymphoma and skin and cervix carcinoma. Out of the 20 SLE patients and NHL included in 4 SLE cohorts [12, 13, 15, 16], only 3 received cyclophosphamide before the diagnosis of NHL. Most of the reported case of ANLL in patients with SLE, occurred in patients who received immunosuppressive agents, including cyclophosphamide and azathioprine. To determine whether, or not, the risk of cancer in SLE is associated with cyclophosphamide therapy, Pettersson et al. [13], selected 3 controls for each patients with SLE and cancer. The controls were matched by age and the year of onset of SLE. The odd ratio related to cyclophosphamide therapy was 0.6 (CI, 0.6-3.5), suggesting that the development of malignancy in patients with SLE is not associated with cytostatic therapy. Similarly, none of the 6 Canadian
SLE patients who developed lymphoproliferative cancers were treated with cyclophosphamide before the diagnosis of the malignancy [12]. In a 5-year followup study [50] of SLE patient treated with intravenous cyclophosphamide, none of the patients developed malignancies. Azathioprine is widely used in the treatment of SLE. Few cases have suggested that treatment with azathioprine may be followed by the development of acute leukemia or NHL [55]. However, in a large cohort of patients with RA treated with azathioprine and other disease modifying drugs, the risk for the development of NHL among patients treated with azathioprine was not statistically different from the that of RA patients who did not received the drug [56]. Cytotoxic therapy may induce malignant transformation by several mechanisms including direct oncogenic effect and severe immunosuppression that prevent the destruction of mutant malignant cells or elimination of oncogenic viruses. Taken together, the data indicate that treatment with cytostatic agents may trigger the development of cancers only in the minority of SLE patients who developed malignancies, and obviously the development of NHL and other neoplasms in patients with SLE is related to other possible causes. Treatment of neoplastic diseases immunomodulating agents may result in a state of autoimmunity. SLE and other autoimmune diseases may develop following therapy with interferon [57, 58]. Several case of patients with myeloproliferative disorders including chronic myelogenous leukemia (CML) and essential thrombocytosis (ET) developed SLE following treatment with a- and /-interferons [57, 58]. Twenty percent of 137 patients with CGL or ET developed rheumatic symptoms [58] after interferon therapy. During interferon therapy, 18 (72%) of 25 patients with CGL had ANA positivity. Of these, 15 reported symptoms related to rheumatic diseases and 3 patients fulfilled the classification criteria for SLE. In another study, 19% of 135 patients with malignant carcinoid, developed autoimmune diseases including autoimmune thyroid disease, SLE, pernicious anemia and vasculitis [59]. The data indicate that interferon therapy may trigger the development of autoimmunity and should not be used in patients with clinical and laboratory features suggesting autoimmune diseases.
35
6.2. Common Etiologic Agent Environmental agents have been associated with the pathogenesis of SLE. Of these, ultraviolet B (UVB) light, infectious agents and exposure to certain drugs and hormones [1]. Flare of the skin disease may occur in more than 70% of patients with SLE after exposure to UVB [60]. It has been suggested that UVB may make the DNA to be more immunogenic and to mobilize Ro and La antigens to the surface of keratinocytes. This leads to the binding of anti-Ro and anti-La to those cells, activating of cytotoxic T cells [61] and induction of damage to the keratinocytes. UVB is the strongest risk factor for basal cell and s e c of the skin. Patients with SLE were found to develop SCC of the skin into chronic disceid lesions, suggesting that UVB is a common etiologic agent for discoid lupus and skin cancer in the same patient [51, 52]. Patients with SLE have an increased risk of infections. Sepsis and other bacterial and viral infections are the most common cause of death among patients with SLE [14, 62]. Furthermore, SLE patients, and particularly those on prolonged immunosuppressive therapy, are at increased risk of chronic or recurrent viral infections. Recendy, several cases of chronic hepatitis C were reported in patients with SLE [63, 64]. Patients with chronic infection with hepatitis C are also at increased risk of developing hepatic malignancies and lymphoproliferative disorders [65], suggesting that chronic infection with HCV may trigger the development of cancer in patients with SLE. Kojima et al. [66] performed clinicopathological and immunohistochemical analyses on 5 patients with B-cell lymphoma and rheumatic diseases. (2 patients with SLE, 2 with dermatomyositis and 1 with scleroderma). In 3 of the 4 cases examined, Epstein-Barr virus (EB V) encoded small RNAs were seen in a small to large number of the lymphoma cells. The data indicate that, similar to the general population, infection with EBV in SLE patients may be associated with the development of NHL. Thirty percent of sera of patients with SLE were found to react with retroviral gag protein p24 [67]. Similarly, 24% of sera of patients with SLE were found to bind type C retroviral particles [67]. Ito et al. [68] reported that a patient with lupus nephritis developed adult T-cell leukemia associated with human T-cell leukemia virus (HTLV) type 1.
36
Human papillomavirus (HPV) has been associated with the development of premalignant and malignant tumors of the vagina and cervix [69]. Cohen et al. [70] described an SLE patient with cutaneous lesions who was treated with azathioprine and developed multiple lesions of SCC of the skin. HPV type 11 DNA and the oncogenes neu and ras were identified in the tissue of the SCC, suggesting a role for HPV in the development of SCC of the skin in SLE. In summary, patients with SLE are at increased risk of infection with various viruses. In selected cases the viral infection may trigger the development of cancer. Hormonal factors are implicated in the pathogenesis of SLE [1]. Alterations in the metaboHsm of estrogen SLE have been associated with the pathogenesis of SLE and gynecological cancers. States of increased levels of estrogen such as ovulation induction, pregnancy and estrogen replacement therapy have been reported to be associated with the development of SLE [1]. The role of estrogen in the pathogenesis of SLE is unclear. In one study, 17-^6-estradiol was found to induce up to a 5-fold increase of 52 and 60 kDa SS/A Ro expression in human keratinocytes [71]. This induction of Ro and La antigens may trigger the generation of anti-Ro and anti-La autoantibodies, or it may facilitate the binding of anti-Ro and anti-La antibodies to keratinocytes. In women with endometrial carcinoma, it has been reported that exposure to unopposed estrogen from either endogenous or exogenous sources is a risk factor for the development of the carcinoma. 6.3. Genetic Susceptibility Several genes are associated with an increased risk for the development of SLE and, therefore, they are classified as susceptibility genes. SLE is strongly associated with specific haplotypes of the HLA system. HLA DR3, DR2, B8, C4A, DQw2 and others are associated with an elevated relative risk for the development of SLE. The disease is also associated with single gene deletion as in C2 and C4 deficiency. Other genetic constellations related to the development of SLE include genes encoding the constant region of the immunoglobulin heavy chain molecules (Gm allotypes) [1]. The malignant transformation of normal cells is associated with genetic abnormalities. The possibilities
of malignant transformation include the overactivation of genes (proto-oncogenes) that promotes cell division, and the malfunction of genes that normally suppress growth and abnormalities in genes that repair DNA. The abnormalities of these genes usually occur as a result of point mutation, amplification or translucation. Since SLE is associated with abnormal growth of cells of the immune system, several researches have studies the expression of various oncogenes in patients with SLE. In vitro studies [72] have indicated that activation and proliferation of the B cells, from normal people and SLE patients with IgM antibodies, resulted in expression of c-myc proto-oncogene RNA. Boumpas et al. [72] found that in vitro activation of T and B cells from patients with SLE had significantly increased expression of c-myc, c-myb and c-raf RNA compared with normal cells. Similarly, peripheral blood mononuclear cells (PBMC) from SLE patients expressed significandy more c-myc RNA than did healthy controls [74-75]. In another study [76], the c-myc and c-myb expression was directly related to disease activity. B and T cells from SLE patients were also found to express the bcl-2 oncogene which is associated with prolonged survival of lymphocytes and protection from apoptosis. This oncogene is highly associated with human follicular lymphoma [77]. The expression of the bcl-2 in the lymphocytes of patients with SLE was not related to the degree of disease activity. Unlike malignancy, the activation of oncogenes is not associated with mutations, translocation, deletion or amplification [78]. Therefore, no maUgnant transformation in the majority of patients with autoimmune diseases. However, in selected cases the prolonged activation of oncogenes, and particularly bcl-2, may result in genetic abnormality associated with malignant transformation and lymphoproliferative disease. 6.4. Immunological Abnormalities SLE is associated with hyperactivation of B and T cells, secretion of large amount of autoantibodies and activation of cytokines network [1, 79]. All of those abnormalities in the immune system may be associated with tissue damage and malignant transformation. The characteristics of lymphocytes of lymphoma cells from patients with SLE were reported only in
a few studies. Munzert et al. [17] described a patient with SLE who developed B-cell type NHL and M expansion of CD5-I- B cells in his blood. CD5-I- B cells are the equivalent of Lyb-1 B cells in mice which are associated with autoimmunity and lymphoma [80]. In humans, CD5-I- B cells are associated with CLL, a disease characterized by a high rate of autoimmune features including autoimmune hemolytic anemia and thrombocytopenia. A link between CD5-I- cell and RA was reported, however, their role in SLE is unclear [80-81]. In animals, spontaneous SLE-like disease and lymphomas develop in various strains of mice including NZW, NZWxNZB and BAV mice [82-84]. In all of these mice, a marked proliferation of Ly-1 B cells was observed [79]. Taken together, CD5+ and Ly-1 B cells expansion may occur in some patients and mice with SLE that may be associated with lymphoproliferative disorders.
7. SUMMARY The data summarized in this chapter indicate that maUgnant diseases occur in patients with SLE. All the studies suggest that the risk of developing lymphoproliferative disorders is clearly increased among patients with SLE. A trend of increased risk for solid tumors was also reported. The reasons why cancers occur in SLE in unclear. Several environmental, genetic and immunological factors may play a role in the development of malignancy. Further studies are needed to elucidate these immunopathogenic mechanisms.
REFERENCES 1.
2.
3.
Hahn BH. Pathogenesis of SLE. In: Kelly WN, Ruddy S, Harris ED, Sledge CB., eds., Textbook of Rheumatology, 5th edn. Philadelphia: WB Saunders 1997;1015-1027. Lahita RG. Clinical presentation of SLE. In: Kelly WN, Ruddy S, Harris ED, Sledge CB., eds., Textbook of Rheumatology, 5th edn. Philadelphia: WB Saunders 1997; 1028-1039. Green JA, Dawson AA, Walker W. SLE and lymphoma. Lancet II 1978;7:753-756.
37
4.
5.
6.
7.
8.
9. 10.
11.
12. 13.
14.
15.
16.
17.
18.
19.
20.
38
Bhalla R, Ajmani HS, Kim WW, Swedler WI, Lazarevic MB, Skosey JL. SLE and Hodgkin's lymphoma. J Rheumatol 1993;20:1316-1320. Chuong JJ, Livstone EM, Barwick KW. SLE and gastric carcinoma: a report of two cases and review of the literature. Am J Gastroenterol 1982;77:611-613. Nikravan K, Bejjani BB, Edson M. Bilateral liposarcoma in immunosuppressed patient with SLE. Urology 1983;22:64-66. Gibbons RB, Westerman E. Acute nonlymphocytic leukemia following short-term, intermittent, intravenous cyclophosphamide treatment of lupus nephritis. Arthrit Rheum 1988;31:1552-1554. Lewis RB, Castor CW, Knisley RE, Bole CG. Frequency of neoplasms in SLE and RA. Arthrit Rheum 1976;19:1256-1260. Canoso JJ, Coher AS. Malignancy in a series of 70 patients with SLE. Arthrit Rheum 1974;17:383-388. Menson S, Snaith ML, Isenberg D. The association of malignancy with SLE: an analysis of 150 patients under long term review. Lupus 1993;2:177-181. Lopez DM, Khamashta M, Pintado GV, Lavilla UP, Gil AA. Malignancy in SLE: a report of five cases in a series of 96 patients. Lupus 1993;2:377-380. Abu-Shakra M, Gladman DD, Urowitz MB. Malignancy in SLE. Arthrit Rheum 1996;39:1050-1054. Pettersson T, Pukkala E, Teppo L, Friman C. Increased risk of cancer in patients with SLE. Ann Rheum Dis 1992;51:437-439. Abu-Shakra M, Urowitz MB, Gladman DD, Gough J. Mortality studies in systemic lupus erythematosus. Results from a single centre. I. Causes of death. J Rheumatol 1995;22:1259-1264. Sweeney DM, Manzi S, Janosky J, Selvaggi KJ, Ferri W, Medsger TA, Ramsey-Goldman R. Risk of malignancy in women with SLE. J Rheumatol 1995;22:1478-1482. Mellemkjer L, Andersen V, Linet MS, Gridley G, Hoover R, Olsen JH. Non-Hodgkin's lymphoma and other cancers among a cohort of patients with SLE. Arthrit Rheum 1997; 40:761-768. Munzert G, Frickhofen N, Bauditz J, Schreiber S, Herrmann F. Concomitant manifestation of SLE and low-grade non-Hodgkin's lymphoma. Leukemia 1997;11:1324-1328. Agudelo CA, Schumacher HR, Ghck JH, Molina J. Non-Hodgkin's lymphoma in SLE: report of 4 cases with ultrastructural studies in 2. J Rheumatol 1981;8:69-78. Posner MA, Gloster ES, Bonagura VR, Valacer DJ, Ilowite NT. Burkitt's lymphoma in a patient with SLE. J Rheumatol 1990;17:380-382. Castanet J, Taillan B, Lacour JP, Gamier G, Perrin C, Ortonne JP. Subacute cutaneous lupus erythematosus
21.
22.
23.
24. 25.
26.
27. 28. 29.
30.
31.
32.
33.
34.
35.
associated with Hodgkin's disease. CUn Rheumatol 1995;14:692-694. Berliner S, Sidi Y, Mor C, Galih N, Weinberger A, Pinkhas J. SLE six years following chemotherapy for malignant lymphoma. Scan J Rhematol 1985; 14:276278. Spinozzi F, Capodicasa E, Gerli R, Bertotto A, Ramotti P, Grignani F. SLE following total body irradiation for malignant lymphoma. Allergol Immunopathol Mdr 1986;14:241-244. Buskila D, Gladman DD, Hannah W, Kahn HJ. Primary malignant lymphoma of the spleen in SLE. J Rheumatol 1989;16:993-996. Sutton E, Malatjalian D, Hayne OA, Hanly JG. Liver lymphoma in SLE. J Rheumatol 1989;16:1584-1588. Pal B, Burton I, Knox F, Weighill F. Non-Hodgkin's lymphoma of the femur presenting as a pathological fracture in a patient with lupus/Sjogren's syndrome overlap. Br. J Rheumatol. 1998;37:462^63. Cras P, Franchx C, Martin J J. Primary intracerebral lymphoma in SLE treated with immunosuppressives. Clin Neuropathol 1989;8:200-205. El-Ramahi KM, Karrar A, Ali MA. Kikuchi disease and its association with SLE. Lupus 1994;3:409^11. Rubin L, Urowitz MB, Pruzanski W. SLE with paraproteinemia. Arthrit Rheum 1984;27:638-644. Youinou P, Le-Corre R, Dueymes M. Autoimmune diseases and monoclonal gammopathies. Clin Exp Rheumatol 1996;14 S14:55-58. Abu-Shakra M, Krupp M, Argov S, Buskila D, Slor H, Shoenfeld Y. The detection of anti-Sm-RNP activity in sera of patients with monoclonal gammopathies. Clin Exp Immunol 1989;76:349-353. Shoenfeld Y, Ben-Yehuda O, Naparstek Y, et al. The detection of a common idiotype of anti-DNA antibodies in the sera of patients with monoclonal gammopathies. J Clin Immunol 1986;6:194-204. Shoenfeld Y, El-Roeiy A, Ben-Yehuda O, Pick AI. Detection of anti-histone activity in sera of patients with monoclonal gammopathies. Clin Exp Immunol 1989;76:349-353. Buskila D, Abu-Shakra M, Amital-Tepliski H, Krupp M, Sukenik S, Shoenfeld Y. Serum monoclonal antibodies derived from patients with multiple myeloma react with mycobacterial phosphoinositides and nuclear antigens. CUn Exp Immunol 1989;76:378383. Afeltra A, Amoroso A, Garzia P, Addessi MA, Pulsoni A, Bonomo L. SLE and multiple myeloma: a rare association. Semin Arthrit Rheum 1997;26:845-849. Vasquez S, Kavanaugh AF, Schneider NR, Wacholtz MC, Lipsky PE. Acute nonlymphocytic leukemia after treatment of SLE with immunosuppressive agents. J Rheumatol 1992;19:1625-1627.
36. 37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
50.
Paolozzi FP, Goldberg J. Acute granulocytic leukemia following SLE. Am J Med Sci 1985;290:32-35. Rosenthal NS, Farhi DC. Myelodysplastic syndromes and acute myeloid leukemia in connective tissue disease after single agent chemotherapy. Am J Clin Pathol 1996;106:676-679. Lishner M, Hawker G, Amato D. Chronic lymphocytic leukemia in a patient with SLE. Acta Haematol 1990;84:38-39. Lugassy G, Lishner M, PoUiack A. SLE and chronic lymphocytic leukemia: rare coexistence in three patients, with comments on pathogenesis. Leuk Lymphoma 1992;8:243-245. Colovic M, Jankovic G, Lazarevic V, Novak A. Acute megacaryocytic leukemia in a patient with SLE. Med Oncol 1997;14:31-34. Kletzel M, Melloni L, Terrez A, Rosenthal J. SLE preceding acute lymphoblastic leukemia. J Ark Med Soc 1986;82:263-265. Meloni G, Capria S, Vignetti M, Mandelli F, Mondena V. Blast crisis of chronic myelogenous leukemia in long standing SLE: regression of both diseases after autologous bone marrow transplantation. Blood 1997;89:465-469. Alexon E, Brandt KD. Acute leukemia after azathioprine treatment of connective tissue disease. Am J Med Sci 1977;273:335-340. Schewach-Millet M, Shapiro D, Ziv R, Trau H. Subacute cutaneous lupus erythematosus associated with breast carcinoma. J Am Acad Dermatol 1988; 19:406408. Kigawa J, Kanamori Y, Takeuchi Y, Minagawa Y, Terakawa N. Involvement of the local immune response in a case of advanced cervical cancer in a patient with SLE. Gynecol Obstet Invest 1993;36:62-64. Nyberg G, Eriksson O, Westberg NG. Increased incidence of cervical atypia in women with SLE treated with chemotherapy. Arthrit Rheum 1981;24:648650. Blumenfeld Z, Lorber M, Yoffe N, Scharf Y. SLE: predisposition for uterine cervical dysplasia. Lupus 1994;3:59-61. Ortiz A, Gonzalez E, Alvarez G, Egido J. Bladder cancer after cyclophosphamide therapy for lupus nephritis. Nephron 1992;60:378-379. Moroni G, Banfi G, PonticeUi C. Clinical status of patients after 10 years of lupus nephritis. Quart J Med 1992;84:681-689. Valeri R, Radhakrishnan J, Estes D, D'Agati V, Kopelman R, Pernis A, Appel GB. Intravenous pulse cyclophosphamide treatment of severe lupus nephritis: A prospective five year study. Clin Nephrol 1994;42:71-78.
51.
52.
53.
54.
55.
56.
57.
58.
59.
60.
61.
62.
63.
64.
65.
Dabski K, Stoll HL, Milgrom H. Squamous cell carcinoma complicating late chronic discoid lupus erythematosus. J Surg Oncol 1986;32:233-237. Caruso WR, Stewart ML, Nanda VK, Quismorio FR Squamous cell carcinoma of the skin in black patients with discoid lupus erythematosus. J Rheumatol 1987;14:156-159. Sherer Y, Bar-Dayan Y, Shoenfeld Y. Thymoma, thymic hyperplasia, thymectomy, and autoimmune diseases. Int J Oncol 1997;10:939-943. Penn I, Halgrimson CG, Starzl TE. De novo mahgnant tumors in organ transplant recipient. Transplantation Proceedings 1971;2:773-778. Berhner S, Shoenfeld Y, Sidi Y, et al. Systemic lupus erythematosus and lymphoma. Scand J Rheumatol 1983;12:310-314. Matteson EL, Hickey AR, McGuire L, Tilson HH, Urowitz MB. Occurrence of neoplasia in patients with rheumatoid arthritis enrolled in a DMARD registry. J Rheumatol 1991;18:809-814. Morris LF, Lemak NA, Arnett EC, Jordon RE, Duvic M. SLE diagnosed during interferon alpha therapy. South Med J. 1996;89:810-814. Wandl UB, Nagel-Hiemke M, May D, Kreuzfelder E, Kloke O, Niederle N. Lupus like autoimmune disease induced by interferon therapy for myeloproliferative disorders. Clin Immunol Immunopathol 1992;65:7074. Ronnblom LE, Alm-GV, Oberg KE. Autoimmunity after alpha-interferon therapy for malignant carcinoid. Ann Int Med 1991;115:178-183. Wysenbeek A, Block DA, Fries JF. Prevalence and expression of photosensitivity in SLE. Ann Rheum Dis 1989;48:461^64. Furukawa F, Kashihara M, Lyons MB. Binding of antibodies to the ENA SS-A/Ro and SS-B/La is induced on the surface of human keratinocytes by UV light: implication for the pathogenesis of photosensitivity cutaneous lupus. I Inves Dermatol 1990;94:77. Rosner S, Ginzler EM, Diamond HS, et al. A multicenter study of outcome in SLE. II. Causes of death. Arthrit Rheum 1982;25:612-617. Abu-Shakra M, El-Sana S, Margalith M, Sikuletr E, Neumann L, Buskila D. Hepatitis B and C viruses serology in patients with SLE. Lupus 1997;6:543544. McMurray RW, Elbourne K. Hepatitis C virus infection and autoimmunity. Semin Arthrit Rheum 1997;26:689-701. Sikuler E, Shnaider A, Zilberman D, Hilzenrat N, Shemer-Avni Y, Neumann L, Buskila D. Hepatitis C virus infection and extrahepatic malignancies. J Clin Gastroenterol 1997; 24:87-89.
39
66.
67.
68. 69.
70.
71.
72.
73.
40
Kojima M, Nakamura S, Futamura N, Kurabayashi Y, Ban S, Itoh H, Yoshida K, Joshita T, Suchi T. Malignant lymphoma in patients with rheumatic diseases other than Sjogren's syndrome: a clinicopathologic study of five cases and a review of the Japanese literature. Jpn J CUn Oncol 1997;27:84-90 Tamura N, Sekigawa I, Hashimoto H, Yamamoto N, Kira S. Syncytial cell formation in vivo by type C retroviral particles in the SLE lung. Clin Exp Immunol 1997;107:474-479. Ito H, Harada R, Uchida Y, et al. Lupus nephritis with adult T cell leukemia. Nephron 1990;55:325-328. Schiffman MH, Bauer HM, Hoover RN et al. Epidemiologic evidence showing that human papillomavirus infection causes most cervical intraepithelial neoplasia. J Natl Cancer Inst 1993;85:958964. Cohen LM, Tyring SK, Rady P, Callen JR Human papillomavirus type 11 in multiple squamous cell carcinomas in a patient with subacute cutaneous lupus erythematosus. J Am Acad Dermatol 1992;26:840845. Wang D, Chan EKL. 17-beta-estradiol increases expression of 52-kDa and 60 kDa SS-A/Ro autoantigens in human keratinocytes and breast cancer cell line MCF-7. J Invest Dermatol 1996;107:610-614. Klinman DM, Mushinski JF, Honda M, Ishigatsubo Y, Mountz JD, Raveche ES, Steinberg AD. Oncogene expression in autoimmune and normal peripheral blood mononuclear cells. J Exp Med 1986 163:12921307. Boumpas DT, Tsokos GC, Mann DL, Eleftheriades EG, Harris CC, Mark GE. Increased proto-oncogene expression in peripheral blood lymphocytes from patients with SLE and other autoimmune diseases. Arthritis Rheum 1986;29:755-760.
74.
75.
76.
77.
78. 79. 80.
82.
83.
84.
Deguchi Y, Negoro S, Hosokawa T, Kishimoto S. C-myc gene binding factors in peripheral blood mononuclear cells from patients with SLE. Clin Exp Immunol 1989;77:157-162. Suzuki H, Nakanishi K, Steinberg A, Green I. Induction of c-myc expression early in the course of B-cell activation: studies in normal humans and patients with SLE. Int Arch Allergy Appl Immunol 1986;79:380-387. Deguchi Y, Hara H, Negoro S, Kakunaga T, Kishimoto S. Protooncogene expression in peripheral blood mononuclear cells from patients with SLE as an indicator of the disease activity. Clin Immunol Immunopathol 1987;45:424^39. Gatenby PA, Irvine M. The bcl-2 proto-oncogene is overexpressed in SLE. J Autoimmun 1994;7:623631. Sibbitt WL. Oncogenes, growth factors and autoimmune diseases. Anticancer Res 1991;11:97-113. Lauwerys BR, Houssiau FA. Cytokines: clues to the pathogenesis of SLE. Lupus 1998;7:211-213. Shirai T, Hirose S, Okada T, Nishimura H. CD5+ B cell in autoimmune disease and lymphoid malignancies. Clin Immunol Immunopathol 1991;59:173-186. Bataille R, Bernard K. CD5 positive lymphocytes: A link between autoimmunity and B-cell oncogenesis. Anticancer Res 1988;8:707-710. Mellors RC. Autoimmune and immunoproliferative diseases of NZW/B mice and hybrids. Int Rev Exp Pathol 1966;5:217-219. Csey TP. Azathioprine administration and the development of malignant lymphoma in NZB mice. Clin Exp Immunol 1968;3:305-312. Wofsy D, Chiang NY. Proliferation of Ly-1 B cells in autoimmune NZB and (NZBxNZW) Fl mice. Eur J Immunol 1987;17:809-814.
© 2000 Elsevier Science B.V.All rights reserved. Cancer and Autoimmunity Y. Shoenfeld and M. E. Gershwin, editors
Malignancies Occurring in Scleroderma Pascal Godmer and Loi'c Guillevin Department of Internal Medicine, Hopital Avicenne, Universite Paris-Nord, 125, rue de Stalingrad, 93000 Bobigny, France
1. INTRODUCTION Progressive systemic sclerosis (PSS), also called scleroderma, is a systemic disease mainly affecting the skin, joints, lungs, kidneys and/or gastrointestinal (GI) tract. PSS is severe and can shorten life expectancy to years or months. The main causes of mortality are lung fibrosis, renal and/or cardiac failure, and death is ultimately the consequence of a poor general condition and multisystemic manifestations. Some patients, develop malignancies that can cause death. Very few publications [1] have defined relationships between PSS and cancer. We analyzed the available epidemiological data concerning cancers that occurred during PSS and attempted to differentiate true relationships between the two diseases and coincidences.
2. EPIDEMIOLOGY The prevalence of PSS varies from 4 [2] to 290 per milHon [3], and its incidence varies from 2.3 [4] to 19.1 [5] per million population/year. Estimates of survival after presentation vary widely with 60% median survival at 5 years and 50% at 10 years [1]. A collaborative US study reported a 12-year survival rate of 30% [6]—the methodology applied could have biased these very poor results.
3. MALIGNANCIES OCCURRING DURING PSS Case reports suggest that the development of the two diseases is not coincidental and that scleroderma patients have twice the risk of developing malignancies than the general population. Lung and perhaps breast cancers seem to be more frequent in PSS patients. In a Danish series of 344 patients [7], scleroderma was responsible for a 3-fold increased risk of death (Table 1). Most patients died of PSS-related causes (acute renal crisis, hypertension, lung fibrosis, etc.), but malignancies were also described. Lung cancer was the most frequent cause of death-related malignancies (13/160 deaths). Hematological maUgnancies were the second most common cause of death in the cancer group (4 cases). The other causes were anecdotal: breast and ovarian cancer (3 of each), uterus, ovarian etc. An over-representation of lymphoma has been suggested by others [8] who observed 2 cases of non-Hodgkin's lymphoma in PSS patients. These authors reported that the standardized incidence ratio for all cancers among the 233 patients was sharply increased (by 2.4). The risk of lung cancer was increased by 7.8 and the risk of non-Hodgkin's lymphoma by 9.6. Similar results had been previously pubUshed [9]. Other cases of nonHodgkin's lymphoma have been reported [10-12] and support the association with PSS. Other papers also described cancers occurring in PSS: esophageal cancer, particularly in patients with Barrett's syndrome [13], ovarian and breast cancers [1, 10, 14, 15]. In studies by Rosenthal et al.. [8] and Jacobsen et al. [7], the frequencies of breast and ovarian cancer were not higher than in the general population.
41
In Japan [16], the frequency of lung cancer in PSS patients suggests that race has no influence on the occurrence of the two diseases.
^
-i o
c
-e
•=
=^
11 1
4. PATHOGENESIS
^ ^o _y^
PSS should not be considered a paraneoplastic syndrome unlike other autoimmune diseases, such as some myositis. However, there is a close relationship between the occurrence of some malignancies and scleroderma. Indeed, lung cancers seem to be associated with lung fibrosis more often than with scleroderma. Although alveolar cell carcinoma is the most frequent cancer complicating lung fibrosis in PSS patients, other lung carcinomas, such as squamous cell carcinoma, have been observed [8]. A hypothesis possibly explaining the occurrence of alveolar cell carcinoma could be the mitogenic effect of growth factors implicated in the genesis of lung fibrosis [17]. The changes in the extracellular matrix could also affect the behavior of normal cells [18]. Abu-Shakra et al. [19] hypothesized that an altered immune response could facilitate the occurrence of malignancies. The patient's age at the time that the cancer developed in PSS could also be a factor, since patients over 50 years old at the time of PSS onset had a higher risk of developing cancer [19]. Other factors do not favor the occurrence of lung cancer, for example, sex, smoking status, or limited or disseminated PSS. In the case of breast cancer, pathogenetic factors have not been established and the temporal association between cancer and PSS cannot be excluded. In the case of hematological malignancies, the responsibility of immunosuppressants in the occurrence of PSS can be considered, as can a direct relationship between PSS and blood cancers. Among their 262 PSS patients, Roumm and Medsger [9] observed 1 case of acute myelogenous leukemia in 17 patients who, simultaneously, had received immunossuppressants and 1 case of histiocytic lymphoma and 1 case of chronic myelogenous leukemia in 245 others. Rosenthal et al. [8] also described 2 cases of non-Hodgkin's lymphoma and discussed the role of therapy rather than that of PSS. Abu-Shakra et al. [19] reported no hematological malignancies in their cohort of patients untreated with cytotoxic drugs. The potential responsibility of Sjogren's syndrome-associated lymphoma can be suggested for some PSS patients, as lymphoma is known
J%1 Z I 1
tl
^£ •H
2
•
^
a.
£
z z z
•§
r-
.c
vC
sw - <^ "1.£. -o"•^. •5
o o d d VV
•p
57
•S
S
"c
"B
E E
•a
=
<
D
-J
(2 :§ c.
C/5
D •p Z
^
£ 1
^ 2 c i£ i _E
S g, i
^1 Q
%1 I^ a.^
30 Ui ^
D M £
o .2 > '^
B
^
42
U C U J
. E o c
to be strongly associated with Sjogren's syndrome which is frequent in PSS. Indeed, Sjogren's syndrome was present in 38 out of 248 PSS patients reported by Nishioka et al. [16]. From the data available, which are admittedly very limited, it can, nonetheless, be concluded that PSS is not a paraneoplastic syndrome. Because the data supporting a PSS-cancer link are weak, the association might indeed be coincidental Obviously, prospective studies are needed to clarify any such relationship.
8.
9.
10. 11.
12.
REFERENCES 1. 2.
3.
4.
5.
6.
7.
Silman AJ. Scleroderma—demographics and survival. J Rheumatol 1997;34(suppl 48):58-61. Medsger TA, Masi AT. Epidemiology of systemic sclerosis (scleroderma). Ann Int Med 1971;74:714721. Maricq HR, Weinrich MC, Keil JE et al. Prevalence of scleroderma spectrum disorders in the general population of South Carolina. Arthrit Rheum 1989;32:9981006. Wigley RD, Borman B. Medical geography and the etiology of the rare connective tissue. Soc Sci Med 1980;14D:175-183. Steen V, Conte C, Santoro D et al. Twenty year incidence survey of systemic sclerosis. Arthrit Rheum 1988;32(suppl):557. Altman RD, Medsger TA, Bloch DA, Michel BA. Predictors of survival in systemic sclerosis (scleroderma). Arthrit Rheum 1991;34:403-413. Jacobsen S, Halberg P, Ullman S. Mortality and causes of death of 344 Danish patients with systemic sclerosis (scleroderma). Br J Rheumatol 1998;37:750-755.
13.
14.
15.
16.
17.
18.
19.
Rosenthal AK, McLaughlin JK, Linet MS, Persson I. Scleroderma and malignancy: an epidemiological study Ann Rheum Dis 1993;52:531-533. Roumm AD, Medsger TA. Cancer and systemic sclerosis: an epidemiologic study. Arthrit Rheum 1985;28:1336-1340. Duncan SC, Winkelman RK. Cancer and scleroderma. Arch Dermatol 1979;115:950-955. Doyle JA, Connolly SM, Haogland HC. Hematologic disease in scleroderma syndromes. Arch Dermatol Venereol 1985;65:521-525. Pulik, Teillet-Thiebaud F, Mahe A, Teillet F. Association lymphome non-Hodgkinien et sclerodermic. PresseMed 1991;20:1513-1514. Katzka D, Reynolds JC, Saul SH, et al. Barrette's metaplasia and adenocarcinoma of the esophagus in scleroderma. Am J Med 1987;82:46-52. Talbott JH, Barrocas M. Progressive systemic sclerosis and malignancy, pulmonary and non-pulmonary. Medicine (Baltimore) 1979;58:182-207. Lee P, Alderdice C, Wilkinson S, et al. Malignancy in progressive systemic sclerosis-association with breast carcinoma. J Rheumatol 1983;10:665-666. Nishioka K, Katayama I, Kondo H, et al. Epidemiological analysis of prognosis of 496 Japanese patients with progressive systemic sclerosis. J Dermatol 1996;23:677-682. LeRoy EC, Smith EA, Kahalch MB, et al. A strategy for determining the pathogenesis of systemic sclerosis: is transforming growth factor beta the answer? Arthrit Rheum 1989;32:817-824. Allen-Hoffman BL, Crankshaw CL, Mosher DE Transforming growth factor beta increases cell surface binding and assembly of exogenous (plasma) fibronectin by normal human fibroblasts. Mol Cell Biol 1988;8:4234-4242. Abu-Shakra M, Guillemin F, Lee P. Cancer in systemic sclerosis. Arthrit Rheum 1993;36:460-464.
43
© 2000 Elsevier Science B.V All rights reserved. Cancer and Autoimmunity Y. Shoenfeld and M. E. Gershwin, editors
PSS (Scleroderma) and Cancer Anabel Aron-Maor and Yehuda Shoenfeld Sheba Medical Center, Tel-Hashomer, Israel
1. INTRODUCTION Scleroderma was first described centuries ago. The name literally means "hard skin" even though the disease may progress to involve numerous organs and sometimes rapidly leading to the patients' demise. It is classified as localized (morphea, generalized morphea, linear scleroderma) and systemic (acrosclerosis and diffuse sclerodema). The incidence of scleroderma and malignant conditions has been seldom described and sporadically (unlike the well-recognized relation between malignancy and dermatomyositis). Several case-reports, as well as later controlled larger studies, reported a significant coincidence between scleroderma and certain types of cancer, with a frequency rate between 3-7% [1]. The most frequent malignancy reportedly associated with PSS is lung cancer.
2. PSS AND LUNG CARCINOMA Pulmonary involvement in PSS is characterized by fibrosis of the lung, a condition that does not, normally, cause hemoptysis. Therefore, the manifestation of hemoptysis in a patient with PSS and lung involvement should not go unchecked. It is usually the presentation of a secondary lesion that is possibly malignant. In 1953, the first report of an association between scleroderma and malignancy [2] described three patients, each with long- standing systemic sclerosis (PSS) and lung involvement. In all three patients carcinoma of the lung was found at necropsy.
Further case-reports [3-7] described a similar association between PSS and lung cancer, usually diagnosed in patients known to have had diffused scleroderma involving the lungs for many years prior to the appearance of the malignancy. . The most common type of lung cancer reported in connection with PSS is bronchiolar ("alveolar-cell") carcinoma [2-A, 9] (representing less than 4% of all forms of lung cancer). This type of cancer can be found in areas of chronic fibrosis and has been described in association with scarring. Squamous cell carcinoma of the lung has been rarely reported in association with PSS (in nonsmokers) [5], and also oat-cell carcinoma [5]. These cancers developed without long-standing pulmonary involvement with systemic sclerosis. Therefore, it has been suggested that these tumors were coincidental with the collagen disease, and not directly related to it. Another possibility raised regarding these cases was that the collagen disease represented an unusual paraneoplastic phenomenon [5]. It is possible that cell products, including growth factors, might cause sclerodermatous changes [12]. Scleroderma-like skin lesions have been described in some patients with metatstatic secreting carcinoid tumors [13], and also in multiple myeloma in which all test results for amyloid were negative [1].
3. PSS AND BREAST CANCER An additional type of malignancy frequently reported with PSS is breast carcinoma. Several cases are cited where the two diseases developed within months of one another [10-12]. In a 1979 study [1], an even
45
greater incidence of breast carcinoma in association with PSS than lung carcinoma was found. Occasionally, a worsening of the scleroderma was noted when the mahgnancy recurred, while improvement of skin changes occurred after treatment of the neoplasm [10]. (A similar finding was also noted in connection with bladder carcinoma [10].) An incidence of breast cancer of up to 17% of all types of neoplasms in PSS is mentioned in several studies. In a number of cases the breast carcinoma was diagnosed after the onset of PSS, whereas, in others the scleroderma developed after the diagnosis and treatment of the malignancy (mastectomy/lumpectomy and radio- or chemotherapy). There is no consistent connection between immunosuppressive therapy for scleroderma and the appearance of malignancy. Contrary, scleroderma (localized and systemic) has occasionally developed after radiotherapy for breast cancer. In these cases it is unclear whether the collagen disease may be connected to the malignancy itself, or to the radiation. The explanation suggested for the association of lung carcinoma and PSS is that the fibrosed pulmonary tissue represents a "fertile" ground for the ensuing of the neoplastic changes, eventually giving rise to the cancer. No similar association was found between breast cancer and scleroderma since the two conditions were often diagnosed a few months apart, suggesting a possible common etiology and not a co-dependence. It may be argued that in the few cases when the scleroderma developed after radiotherapy for breast cancer, the radiation may have provided the trigger for the collagen disease.
4. PSS AND HEMATOLOGIC MALIGNANCIES Hematologic malignancies have been seldom described in PSS patients, except the lymphomas (mainly non-Hodgkin's lymphoma [8]) and leukemias that in one study were second only to breast carcinoma [1]. Other conditions (such multiple myeloma [14]) have been described only sporadically, and no consistent association could be found between them and scleroderma.
46
5. PSS AND OTHER SOLID TUMORS Carcinoma of the esophagus [5] has been described with a slighdy increased incidence in PSS patients with esophageal dysmotility. Patients with mainly esophageal disease constitute a unique group, and perhaps, dysphagia with malignancy would suggest scleroderma. Also, older patients with scleroderma should be suspected of having cancer, although the number of such patients is not great. A close temporal relationship between the onset of scleroderma and other tumors has been reported, notably carcinoma of the stomach [15], colon [16], rectum [17], bladder [16], ovary [6] and cervix [16].
6. SUMMARY As yet, there is no conclusive evidence linking systemic scleroderma to an increased risk for malignant diseases. However, based on case-reports and the results of several controlled studies involving hundreds of patients, a small but significant increase in the risk of cancer was found in association with PSS. The 5-year survival rate in scleroderma patients with cancer was worse for men than women, and poorer for patients with a later onset of the disease. Scleroderma and cancer may develop sequentially or together in elderly patients. The occurrence of both diseases may represent depression of the normal immune response. No consistent pattern of HLA class was found in scleroderma patients with cancer. There is no consistent association between immunosuppressive treatment (given for scleroderma) and the development of malignant disease. The histological changes brought about by the scleroderma in the affected organs may predispose to the development of the malignancy. The fibrous tissue in the lungs, or the structural changes in the esophagus of patients with systemic sclerosis and involvement of these organs, may provide the necessary environment for the neoplastic changes leading to the development of the malignant disease. Since the immune response of patients with autoimmune diseases (PSS among them) is altered, this may place them at a greater risk of malignancies. Vigilance and further studies are required to elucidate the
question of the association between scleroderma and cancer.
REFERENCES 1. 2.
3. 4.
5. 6.
7.
8.
Duncan SC, Winkelman RK. Cancer and scleroderma. Arch Dermatol 1979;115:950-955. Zatuchni J, Campbell WN, Zarafonetis CJD. Pulmonary fibrosis and terminal bronchiolar ("alveolar-cell") carcinoma in scleroderma. Cancer 1953;6:1147-1157. Richards RL, Mikne JA. Cancer of the lung in progressive systemic sclerosis. Thorax 1958;13:238-245. Montgomery RD, Stirling GA, Hamer NAJ. Bronchiolar carcinoma in progressive systemic sclerosis. Lancet 1964;14:586-587. Tomkin GH. Systemic sclerosis associated with carcinoma of the lung. Br J Dermatol 1969;81:213-216. Roumm AD, Medsger TA Jr. Cancer and systemic sclerosis; an epidemiologic study. Arthrit Rheum 1985;28:1336-1340. Abu-Shakra M, Guillemin F, Lee R Cancer in systemic sclerosis. Arthrit Rheum 1993;36:460464. Rosenthal AK, McLaughlin JK, Linet MS, Persson
10
11. 12.
13.
14.
15. 16. 17.
I. Scleroderma and malignancy: an epidemiological study. Ann Rheum Dis 1993;52:531-533. Talbot JH, Banocas M. Progressive systemic sclerosis (PSS) and malignancy, pulmonary and nonpulmonary. Medicine 1979;58:182-207. Lee P, Alderdice C, Wilkinson S, Keystone EC, Urowitz MB, Gladman DD. Malignancy in progressive systemic sclerosis-association with breast carcinoma. J Rheumatol 1983;10:665-666. Papsavvas G, Goodwill CJ. Scleroderma and breast carcinoma. Br J Rheumatol 1989;28:366-367. Forbes AM, Woodrow JC, Verbov JL, Graham RM. Carcinoma of the breast and scleroderma: four further cases and a literature review. Br J Rheumatol 1989;28:65-69. Fries JF, Lindgren JA, Bull JM. Scleroderma-like lesions and the carcinoid syndrome. Arch Int Med 1973;131:550-553. Jablonska S, Stachow A. Scleroderma-Hke lesions in multiple myeloma. Dermatologica 1972; 144:257269. Basten A, Bonnin M. Scleroderma in carcinoma. Med J Aust 1966;1:452-454. Duncan SC, Winkelmann RK. Cancer and scleroderma. Arch Dermatol 1979;115:950-955. Forman L, Atkins H. Scleroderma and carcinoma. Proc Roy Soc Med 1958;51:935.
47
(c) 2000 Elsevier Science B. V. All rights reserved. Cancer and Autoimmunity Y. Shoenfeld and M. E. Gershwin, editors
Vasculitis and Malignancy Efstratios Tatsis and Wolfgang L. Gross Medical University ofLUbeck, Germany
1. INTRODUCTION Vasculitides have been linked to several processes, including infections, drugs and neoplastic disease. Their occurrence in association with malignancies is a rare, and therefore less known, phenomenon. Because of its rarity, this phenomenon has been described mostly in case-reports and small series. In these reports, two categories can be distinguished based on the different underlying pathogenetic processes. (I)Paraneoplastic vasculitides. These are usually considered as vasculitis-associated maUgnancies. The development of vasculitis is thought to be induced by distant tumor via mediators. The paraneoplastic vascuHtides may precede (as a rule by no more than two years), appear concomitantly with, or follow the diagnosis of cancer. The clinical course of a paraneoplastic vasculitis usually parallels that of the tumor. Thus, the cure of the neoplasia is usually, but not invariably, accompanied by regression of the paraneoplastic disorder [1]. Conversely, recurrence of vasculitis several years after diagnosis of the malignancy can be a sign of relapse of the tumor. Paraneoplastic vasculitides are usually classified as secondary vasculitides to distinguish them from the primary vasculitides. Nonetheless, they may fulfill the classification criteria for the primary vasculitides. Screening procedures for cancer should therefore be included in the diagnostic procedure for primary vasculitides to exclude an underlying malignant disease. Most cases of vasculitides associated with malignancy have been reported to occur simultaneously with, or a few months before or after, diagnosis of the underlying malignancy. Cutaneous leukocytoclastic vasculitis is the
most common type of vasculitis in patients with malignancy [2, 3]. (2) Malignancies occurring several years after onset of vasculitis. Cryoglobulinemic vasculitis may be the best example for this group. It is now widely accepted that cryoglobulinemic vasculitis is usually associated with hepatitis C virus. After a latency period of several years, hepatitis C virus can induce malignant lymphoma. The basic defect underlying the disorders in this category may be a deficiency in suppressor T-cell function, which allows unopposed proliferation of B lymphoid cells and the subsequent transition from polyclonal lymphoid hyperplasia to monoclonal proliferative disease. Such a transition may take some years to develop. Thus, the interval between the diagnosis of vasculitis and the diagnosis of the associated malignant disease can amount to several years. Cryoglobulinemic vasculitis is sometimes regarded as a benign lymphoproliferative disease because the cryoglobulins are produced as a result of monoclonal or polyclonal B lymphocyte proliferation. The benign lymphoproliferation may evolve into malignant non-Hodgkin's lymphoma [4]. These two categories of pathogenetic association between the two diseases have to be distinguished from three other groups mimicking such an association: (1) pseudovasculitides (malignancies mimicking vasculitis); (2) pseudomalignancies (vasculitides mimicking malignancy); and (3) vasculitides as adverse reactions to anticancer therapy in patients with neoplasm (Table 1).
49
Table 1. Categories of vasculitides associated with malignant disease Processes mimicking and association
Pathogenetic association 1. 2.
Paraneoplastic vasculitides Malignancies occurring several years after onset of the vasculitis
2. PRANEOPLASTIC VASCULITIDES (VASCULITIS-ASSOCIATED MALIGNANCIES) Various vasculitic syndromes have been associated with maUgnancy. Greer et al. [5] found 8 cases of vasculitis among 1730 cases of hematologic malignancy in a tumor registry covering a 17-year period. Mertz et al. [6] reviewed the American literature and found 41 cases of bonemarrow-related malignancy associated with vasculitis, hairy-cell leukemia being the most common such malignancy. This review reported only 11 cases of nonbonemarrow-related malignancies that were associated with vasculitides. Vasculitis resembling polyarteritis nodosa in particular was linked to hairy-cell leukemia in this and other reports [7, 8]. Sanchez-Guerrero et al. [2] reviewed 222 cases of vasculitis at a single institution in Mexico over a 5-year period and identified 11 with an associated neoplasm. Seven of these patients had a hematologic neoplasm and 4 had a solid malignant tumor. Nine of the patients had cutaneous vasculitis, the other 2 had vasculitis involving the intestine and resulting in acute abdomen. Fain et al. [9] observed 14 cases with associated malignancies in 320 vasculitis patients treated over a 10-year period in rheumatologic departments in Paris, France. Seven of the vasculitides were leukocytoclastic vasculitides, 4 were polyarteritis nodosa, 1 was a cutaneous granulomatous vasculitis, 1 a microvasculitis nervosa, and 1 was classified as purpura rheumatica. Among the neoplasms, 10 were hematologic neoplasms and only 5 were solid tumors (1 patient had two tumors). Kurzrock et al. [3] focused their interest on clinical manifestations of vasculitis in patients with solid tumors. Their review of the literature disclosed 36 cases of vasculitis in patients with solid tumors. The most common malignant neoplasms in these cases were lung cancer (7 cases of non-small cell cancer, two cases of small cell cancer).
50
1. 2. 3.
Pseudovasculitides Pseudomalignancies vasculitis as adverse reaction to anti-cancer therapy
and prostate, breast, colon and renal cancer (4 cases each). Cutaneous leukocytoclastic vasculitis and nerve and muscle microvasculitis were the most frequently observed vasculitis subtypes. Importantly, in 71% of cases manifestations of vasculitis appeared before or concurrently with the initial recognition or relapse of the tumor. Retrospective and prospective studies on a definite vasculitis syndrome are rare. One prospective study [10] examined the occurrence of cancer associated with polymyalgia rheumatica and temporal arteritis in 158 patients over a 5-year period. Ninety- one of these patients were found to have only polymyalgia rheumatica, 54 only temporal arteritis and 40 had both diseases. Twenty-seven of the 158 patients had malignancy! Sixteen of these 27 patients had biopsyproven temporal arteritis. Statistical analyses with 925 matched controls that were cross-checked with a data file at the national cancer registry of Norway showed that patients with positive biopsy were at 2.35 times greater risk of developing malignancy than the controls, and 4.40 times greater risk than the rest of the patient population. In contrast to other vasculitides commonly associated with hematologic neoplasms, polymyalgia rheumatica and temporal arteritis were strongly associated with solid tumors. Twenty-five of the 27 patients with cancer had solid tumors. Importantly, patients with temporal arteritis had a long mean interval of 6.5 years between diagnosis of vasculitis and diagnosis of the malignancy. In only 1 patient was the interval between the temporal arteritis and the malignancy brief. Although this is not consistent with the paraneoplastic mechanism, we include polymyalgia rheumatica/temporal arteritis in this category because both exhibit the classic symptoms of paraneoplastic disease. Further research on the pathogenetic mechanisms underlying giant cell arteritis and the development of malignancy is needed to detect whether, or not, they differ from those underlying
other vasculitic syndromes and the development of malignant disease. A few case-reports on an association between antineutrophil cytoplasmic antibody-positive renal disease and malignancy [11] prompted us to perform a retrospective statistical analysis of 477 patients with Wegener's granulomatosis in our clinic to determine the frequencies and types of malignant neoplasms. Twenty-nine patients (6.1%) with malignancy were found. Simultaneous occurrence of cancer and Wegener's granulomatosis was observed in 14 of these 29 patients. Compared with a control group of rheumatoid arthritis patients, the odds ratio of simultaneous occurrence of cancer and Wegener's granulomatosis was 18.00, while the overall odds ratio for malignant neoplasm in the Wegener's granulomatosis group was 1.79. Interestingly, 7 of the patients in the Wegener's granulomatosis group had renal cell carcinoma (odds ratio of 8.37). In 5 of these 7 patients the two diseases occurred simultaneously. We concluded that the close temporal association between malignancy and Wegener's granulomatosis suggests that mahgnancy could be a trigger for development of Wegener's granulomatosis in some cases [12, 13]. Several case-reports have described other types of paraneoplastic vasculitis: Blanco et al. [14] reported a patient presenting with Henoch-Schonlein purpura in whom myelodysplastic syndrome was subsequently diagnosed. Three cases of lung cancer associated with Henoch-Schonlein purpura have been reported [15-17]. Yamada et al. [18] described a patient with hepatitis B virus infection and gastric cancer in whom histology revealed arterial vasculitis in the resected stomach leading to diagnosis of polyarteritis nodosa. A melanoma with associated Churg-Strauss syndrome was reported in a 31-year-old woman [19].
3. MALIGNANCIES OCCURRING SEVERAL YEARS AFTER ONSET OF THE VASCULITIS Rinaldi et al. [20] studied 41 patients with cirrhosis alone, and 41 patients with cirrhosis and hepatocellular carcinoma. They showed that patients with cirrhosis are at high risk of developing hepatocellular carcinoma, especially when they have hepatitis
B or C virus infection. They also demonstrated a strong association between hepatitis C virus infection and cryoglobulinemia in cirrhosis patients with and without hepatocellular carcinoma. Cryoglobulins were detected in 88% of patients with hepatocellular carcinoma and in only 58% of patients without hepatocellular carcinoma. Ferri et al. [21] reported on the development of hepatocellular carcinoma in 3 of 250 patients with cryoglobulinemic vasculitis (mixed cryoglobulinemia) after a period of 8 (2 patients) and 16 years (1 patient). Two of the patients had hepatitis C virus infection and the remaining patient had chronic hepatitis B virus infection. Thus, not only is the hepatitis C virus associated with cryoglobulinemic vasculitis, but also with the occurrence of hepatocellular carcinoma several years after the onset of the cryoglobulinemic vasculitis [22]. La Civita et al. [4] reported the occurrence of non-Hodgkin's lymphoma in 14 out of 200 patients with cryoglobulinemic vasculitis, suggesting that cryoglobulinemia is a preneoplastic disorder. The non-Hodgkin's lymphoma developed one to 11 years (mean ±SD, 5.6 it 3.8 years) after diagnosis of cryoglobulinemic vasculitis. In all cases, the nonHodgkin's lymphoma was confirmed by histology. All 14 patients had anti-hepatitis C virus antibodies, and in 12 of the patients hepatitis C virus RNA was detected in the serum. These findings suggest that hepatitis C virus may influence the transition of cryoglobulinemic vasculitis from a benign to a malignant disorder. In another study, Zignego et al. [23] investigated the pathogenetic relevance of hepatitis C virus infection in cryoglobulinemic vasculitis with or without complicating B-cell non-Hodgkin's lymphoma in comparison with other immunological and lymphoproliferative disorders. They found that hepatitis C virus infection is involved in the pathogenesis of cryoglobulinemic vasculitis, both by direct participation in the immune complex- related vasculitis and by triggering the lymphoproliferative disorder underlying the disease. They concluded that non-Hodgkin's lymphoma seems to be related to hepatitis C virus lymphotropism, which could also be responsible for the evolution of cryoglobulinemic vasculitis to malignant lymphoma.
51
4. PSEUDOVASCULITIDES (MALIGNANCIES MIMICKING VASCULITIS) Intravascular proliferation of cells in angiocentric lymphomas of B- or T-cell origin can mimic systemic necrotizing vasculitis and lead to misdiagnosis [2426]. Cardiac myxomas can produce a clinical picture resembling polyarteritis nodosa. These intracardiac tumors occur predominantly in middle-aged women and are associated with fever, weight loss, arthralgias, Raynaud's phenomenon and ischemic extremities [27]. Multiple cerebral, visceral or renal aneurysms, have been detected by angiography in patients with cardiac myxomas [28]. Two recent casereports described mimicking of systemic vasculitis by the tumor: A young girl had a stroke that was attributed to a vasculitic process until the atrial myxoma was found [29]. Kawasaki disease was suspected in a 13-year-old girl after detection of coronary artery occlusions and aneurysms. Echocardiography revealed myxoma and a tricuspid valve lesion that led to embolism by myxomatous material [30]. Microemboli of small arteries can cause vascular changes through seeding of the vascular wall [31]. Destruction of the internal elastic lamina and media can lead to aneurysm formation and mimic vasculitis. A case of primary amyloidosis limited to the vascular system and masquerading as giant cell arteritis was described by Rao [32]. A biopsy revealed the amyloidosis and did not show signs of vasculitis. McColl and Fraser [33] described a patient with pheochromocytoma mimicking systemic vasculitis. This patient developed ischemic colitis and died of respiratory renal failure. An autopsy revealed a unilateral pheochromocytoma and there was no evidence of vasculitis on macro- or microscopic examination.
the kidney. Histology showed granuloma formation and demonstrated necrotizing vasculitis within these lesions but disclosed no evidence of malignant disease [36, 37]. Wegener's granulomatosis masqueraded as breast cancer in a woman who had had a previous diagnosis of necrotizing ophthalmitis requiring enucleation. The patient underwent mastectomy and the final pathology specimen revealed the vasculitic disease [38]. Another patient presented with unilateral ocular symptoms suspicious of a subretinal tumor. Positive titres of antineutrophil cytoplasmic antibodies led to further diagnostic procedures, including an open lung biopsy that revealed Wegener's granulomatosis [39]. In polyarteritis nodosa case-reports have documented the occurrence of a vasculitis limited to the testes which mimicked the tumor [40, 41]. Testicular cancer was excluded when pathology revealed the surprising diagnosis of the vasculitis.
6. VASCULITIDES AS ADVERSE REACTIONS TO ANTICANCER THERAPY In addition to paraneoplastic vasculitides or malignancies following systemic vasculitides, adverse reactions to anticancer therapy can lead to vasculitis. The case-reports include instances of arteritis following radiation [42], vasculitis following bonemarrow transplantation [43, 44], tamoxifen-associated vasculitis [45] and vasculitis arising during intrahepatic chemotherapy [46]. A recent review of 117 patients receiving intrahepatic chemotherapy for liver tumors over a 2-year period in Italy revealed 9 cases (7.7 %) of toxic arteritis due to chemoembolization. Seven of these patients had arterial stenosis, 2 patients thrombosis related to toxic arteritis due to chemoembolization [47].
5. PSEUDOMALIGNANCIES (VASCULITIDES MIMICKING MALIGNANCY)
7. CONCLUSIONS
A few reports of Wegener's granulomatosis masquerading as neoplasm have been published. Two patients presented with a pulmonary mass initially thought to be bronchial carcinoma. A biopsy revealed granulomas and led to a diagnosis of Wegener's granulomatosis [34, 35]. In 2 other patients, Wegener's granulomatosis presented with tumor-like lesions in
Paraneoplastic vasculitides show a temporal association with onset of the tumor or occur concomitantly with relapse of the tumor. The most common malignancies reported to be associated with paraneoplastic vasculitides are hematologic neoplasms. Cutaneous vasculitides tend to be the most common vasculitic syndromes associated with malignancies. It is impor-
52
tant to distinguish paraneoplastic vasculitides from vasculitides masquerading as malignancy and from malignancies mimicking vasculitis. For this purpose objective histological confirmation of the diagnosis of vasculitis is indispensable. On the other hand, a cutaneous vasculitis can be the initial manifestation of maUgnancy, especially in elderly patients. It is therefore advisable to closely examine elderly patients with cutaneous vasculitis to exclude a concurrent neoplasm. Finally, it is sometimes difficult to distinguish anticancer-therapy-induced vasculitides from malignancy-induced forms of vasculitis.
REFERENCES 1.
2.
3.
4.
5.
6. 7.
8.
9.
10.
Naschitz JE, Rosner I, Rozenbaum M, Elias N, Yeshurun D. Cancer-associated rheumatic disorders: clues to occult neoplasia. Semin Arthrit Rheum 1995;24:231-241. Sanchez-Guerrero J, Gutierrez-Urena S, Vidaller A, Reyes E, Iglesias A, Alarcon-Segovia D. Vasculitis as a paraneoplasfic syndrome. Report of 11 cases and review of the literature. J Rheumatol 1990; 17:14581462. Kurzrock R, Cohen PR. Clinical manifestations of vascuUtis in pafients with soUd tumors. Arch Int Med 1994;154:334-342. La Civita L, Zignego AL, Monti M, Longobardo G, Pasero G, Ferri C. Mixed cryoglobulinemia as a possible paraneoplastic disorder. Arthrit Rheum 1995;38:1859-1860. Greer JM, Longley S, Edwards L, Elfenbein GJ, Panush RS. Vasculitis associated with malignancy. Experience with 13 patients and literature review. Medicine 1988;67:220-230. Mertz LE, Conn DL. Vasculitis associated with malignancy Curr Opin Rheumatol 1992:4:90-93. Curth HO. Skin lesions and internal carcinoma. In: Andrade R, Gumport SL, Popkin GL, eds., Cancer of the skin. Philadelphia: WB Saunders, 1976;13081343. Gabriel SE, Conn DL, Phyliky RL, Pittelkow MR, Scott RE. Vasculitis in hairy cell leukemia: review of literature and consideration of possible pathogenetic mechanisms. J Rheumatol 1986;13:1167-1172. Fain O, Guillevin L, Kaplan G, Sicard D, Lemaire V, Godeau P, Kahn MF. Vascularites et neoplasies. Quatorze observations. Ann Med Int 1991;142;486-504. Haga HJ, Eide GE, Brun J, Johansen A, Langmark F. Cancer in association with polymyalgia rheumatica
11.
12.
13.
14.
15.
16.
17.
18.
19. 20.
21.
22.
23.
and temporal arteritis. J Rheumatol 1993;20:13351339. Edgar JDM, Rooney DP, McNamee P, McNeill TA: An association between ANCA positive renal disease and malignancy Clin Nephrol 1993;40:22-25. Tatsis E, Reinhold-Keller E, Mistry N, Gross WL. Wegener's granulomatosis and malignancy: Is there an association? Arthrit Rheum 1994;37(suppl.):408. Tatsis E, Reinhold-Keller E, Steindorf K, Feller AC, Gross WL. Wegener's granulomatosis associated with renal cell carcinoma. Arthrit Rheum (in press). Blanco R, Gonzalez-Gay MA, Ibanez D, LopezViana A, Ferran C, Regueira A, Gonzalez-Vela C Henoch-Schonlein purpura as clinical presentation of a myelodysplastic syndrome. Clin Rheumatol 1997;16:626-628. Cairns SA, Mallick NP, Lawler W, Williams G. Squamous cell carcinoma of bronchus presenting with Henoch-Schonlein purpura. Br Med J 1978;2:474475. Mitchell DM, Hoffbrand BI. Relapse of HenochSchonlein disease associated with lung carcinoma. J Roy Soc Med 1979;72:614-615. Blanco R, Gonzalez-Gay MA, Ibanez D, Alba C, Perez de Llano LA. Henoch-Schonlein purpura as a cUnical presentation of small cell lung cancer. CHn Exp Rheumatol 1997;15:545-547. Yamada T, Miwa H, Ikeda K, Ohta K, Iwazaki R, Miyazaki A, Watanable S, Hashimoto H, Futagawa S, Sato N. Polyarteritis nodosa associated with gastric carcinoma and hepatitis B virus infection. J Clin Gastroenterol 1997;25:535-537. Cupps TR, Fauci AS. Neoplasm and systemic vasculitis: a case report. Arthrit Rheum 1982;25:475^77. Rinaldi G, Saccardo F, Petrozzino MR, Bossi E, Manna MR, Monti G. Hepatitis C antibody and cryoglobulins in patients with cirrhosis and hepatocellular carcinoma. Clin Exp Rheumatol 1995;13(suppl.):161-163. Ferri C, La Civita L, Zignego Al, Lombardini F, Longombardo G, Gentilini O, Pasero G. Hepatocellular carcinoma in mixed cryoglobulinemia patients. Clin Exp Rheumatol 1996;14:111-112. Ferri C, La Civita L, Longombardo G, Zignego AL, Pasero G. Mixed cryoglobulinemia: a crossroad between autoimmune and lymphoproliferative disorders. LUPUS 1998;7:275-279. Zignego AL, Ferri C, La Civita L, Careccia G, Longombardo G, Bellesi G, Caracciolo F, Thiers V, Gentilini P. Hepatitis C virus infection in mixed cryoglobulinemia and B-cell non-Hodgkin's lymphoma: evidence for a pathogenetic role. Arch Virol 1997;142:545-555.
53
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
54
Thomas R, Vuitch F, Lakhanpal S. Angiocentric T cell lymphoma masquerading as cutaneous vasculitis. J Rheumatol 1994;21:760-762. Roux S, Grossin M, Do Bandt M, Palazzo E, Vachon F, Kahn MF. Angiotrophic large cell lymphoma with mononeuritis multiplex mimicking systemic vasculitis. J Neurol Neurosurg Psychiat 1995 ;58:363368. Walker UA, Herbst EW, Ansorge O, Peter HH. Intravascular lymphoma simulating vasculitis. Rheumatol Int 1994;14:131-133. MacGregor GA, Cullen RA. The syndrome of fever, anaemia, and high sedimentation rate with an atrial myxoma. Br Med J 1959;2:991-993. Leonhardt ET, Kullenberg KP. Bilateral atrial myomas with multiple arterial aneurysms. A syndrome mimicking polyarteritis nodosa. Am J Med 1977;62:792-794. Navarro PH, Bravo FP, Beltran GG. Atrial myxoma with livedoid macules as its sole cutaneous manifestations. J Am Acad Dermatol 1995;32:881-883. Togo T, Hata M, Sai S, Ito T, Sato N, Haneda K, Mohri H. Tricuspid valve myxoma in a child with coronary artery occlusion and aneurysms. Cardiovasc Surgl994;2:418^41. Boussen K, Moalla M, Blondeau P, Ben Ayed H, Lie JT. Embolization of cardiac myxomas masquerading as polyarteritis nodosa. J Rheumatol 1991;18:283285. Rao JK, Allen NB. Primary systemic amyloidosis masquerading as giant cell arteritis. Arthrit Rheum 1993;11:191-201. McCoU GJ, Eraser K. Phaeochromocytoma and pseudovascuhtis. J Rheumatol 1995;22:14421443. Kux A, Wassermann K, Klocke RK, Lathan B, Pothoff G, Mager G, Krueger GRF, Neufang KER, Hilger HH. Bronchialkarzinom oder Mobus Wegener: Differentialdiagnostische Probleme eines atypischen Verlaufs. Med Klin 1991;86:414-418. Van der Werf TS, Stegeman CA, Meuzelaar KJ, Timens W. Late recurrence of Wegener's granulomatosis presenting as solitary upper lobe pulmonary mass. Eur Respir J 1994;7:1365-1368.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45. 46.
47.
Schapira HE, Kapner J, Szporn AH. Wegener's granulomatosis presenting as renal mass. Urology 1986;28:307-309. Schydlowsky P, Rosenkilde P, Skriver E, Helin P, Braendstrup O. Wegener's granulomatosis presenting with a tumor-like lesion in the kidney. Scand J Rheumatol 1992;21:204-205. Gobel U, Kettritz R, Kettritz U, Thieme U, Schneider W, Luft FC. Wegener's granulomatosis masquerading as breast cancer. Arch Int Med 1995;155:205-207. Agostini HT, Brautigam P, Loffler KU. Subretinal tumor in a patient with a limited form of Wegener's granulomatosis. Acta Ophthalmol Scand 1995;73:460^63. Warfield AT, Lee SJ, Phillips SM, Pall AA. Isolated testicular neoplasm. J Clin Pathol 1994;47:11211123. Mukadel E, Abarbanel J, Savion M, Konichezky M, Yachia D, Auslaender L. Testicular mass as a presenting symptom of isolated polyarteritis nodosa. Am J Clin Pathol 1995;103:215-217. Meniere D, Becquemin JP, Kassab M, Etienne G, Gaston A. Natural and corrected history of obliterative radiation arteritis: apropos of 14 case reports. J Mai Vase 1990;15:73-80. Seiden MV, O'Donnell WJ, Weinblatt M, Licht J. Vasculitis with recurrent pulmonary hemorrhage in long-term survivor after autologous bone marrow transplantation. Bone Marrow Trans 1990;6:345-347. Jafri EM, Mendelow H, Shadduck RK, Sekas G. Jejunal vasculitis with protein-losing enteropathy after bone marrow transplantation. Gastroenterology 1990;98:1689-1692. Drago F, Arditi M, Rebora A. Tamoxifen and purpuric vasculitis. Ann Int Med 1990;12:965-966. Minakuchi K, Fujimoto K, Takada K, Takashima S, Nakamura K, Mitsuhashi T. Hepatocellular carcinoma associated with polyarteritis nodosa with symptoms appearing after intraarterial chemotherapy. Br J Radiol 1991;64:272-275. Belli L, Magistretti G, Puricelli GP, Damiani G, Colombo E, Comalba GP. Arteritis following intraarterial chemotherapy for liver tumors. Eur Radiol 1997;7:323-326
© 2000 Elsevier Science B.V All rights reserved. Cancer and Autoimmunity Y. Shoenfeld and M. E. Gershwin, editors
Sjogren's Syndrome and Lymphoproliferative Diseases Manel Ramos-Casals^ Mario Garcia-Carrasco^, Josep Font^ and Ricard Cervera^ Hospital Clinic, Barcelona, Catalonia, Spain; ^Autonomous University ofPuebla, Mexico
1. INTRODUCTION
2. HISTORICAL PERSPECTIVE
Sjogren's syndrome (SS) is an autoimmune disease that mainly affects exocrine glands and usually presents as a persistent dryness of the mouth and eyes due to functional impairment of the salivary and lacrimal glands [1]. In the absence of an associated systemic autoimmune disease, patients with this condition are classified as having primary SS. The histological hallmark is a focal lymphocytic infiltration of the exocrine glands. The spectrum of the disease extends from an organ specific autoimmune disease (autoimmune exocrinopathy) [2] to a systemic process (musculoskeletal, pulmonary, gastric, hematological, vascular, dermatological, renal and nervous system involvement) [3]. Because of this heterogeneity, attempts have been made to identify subsets of patients that would permit more reliable prediction of the course of primary SS in the affected individuals [4]. The incidence of malignant lymphoproliferations in SS is the highest among all autoimmune diseases [5], and primary SS is often considered to be a link between autoimmune and lymphoproliferative diseases. Interestingly, most lymphomas observed in patients with SS are of B-cell origin, despite the fact that the vast majority of cells infiltrating the salivary glands are T cells. The transition from an autoimmune benign proliferation to lymphoproliferation and malignant transformation seen in SS may represent a multistage process involving B cells. The initial polyclonal activation of B cells may evolve to an oligoclonal/monoclonal proliferation in which particular subpopulation of B cells are selected.
The association between SS and lymphoma has been known since 1951, when Rothman et al. [6] described the first case of this association. Some years later, in 1964, Talal and Bunim [7] reported the first study on the incidence of lymphoma in a cohort of 58 patients with SS followed-up over 4 years and observed 3 cases of reticulosarcoma and 1 of IgM macroglobuHnemia. In 1966, Hornbakeret al. [8] described the association of SS and nodular reticulum cell sarcoma in a patient dying due to a severe hemolytic crisis. One year later. Miller [9] studied the presence of autoimmune diseases in 264 patients with lymphoma and found 14 cases of autoimmune disorders, one was a patient who developed a reticulum cell sarcoma 4 years after the diagnosis of SS. In the 1970s, several studies reported a broad spectrum of lymphoproliferative malignancies in patients with SS, and focused on the description of the clinical and immunological markers associated with the development of malignancy. In 1972, Anderson and Talal [10] reported the first compilation of patients who had SS and lymphoproliferative disorders, including 38 cases with several conditions such as pseudolymphoma, histiocytic lymphoma, nodular and diffuse lymphocytic lymphoma, thymoma or Waldenstrom macroglobuHnemia. Hughes and Whaley [11] reviewed the association of SS with several lymphoproliferative disorders (reticulum cell sarcoma, lymphosarcoma, Waldenstrom's macroglobuHnemia, pseudolymphoma) and stressed that benign lymphoproliferation, which occurs as a part of the spectrum of SS, may be difficult to distinguish from its malignant counterpart. Another similar review of this association was published by Perez-Pena et al. in
55
1974 [12]. In 1978, Faguet et al. [13] reported the first study of immunological cell markers in a patient in whom a malignant lymphoma was detected 22 months after the diagnosis of SS. These authors established the monoclonal origin of the lymphoproliferation by the demonstration of IgM/c on more than 90% of the B cells obtained from fresh lymph node and biopsy specimens from a lymphoid lung nodule. The same year, Zulman et al. [14] demonstrated that 6 out of 9 lymphomas developed in patients with SS showed a proHferation of cells producing monoclonal immunoglobulins (MIgs), identifying these 6 cases as being of B-cell origin. Kassan et al. [15] published an epidemiological study, that attempted to estimate the risk of development of lymphoma in patients with SS and to study the clinical and immunological features associated with its development during the course of the disease. The authors studied 136 women with SS followed at the National Institutes of Health (NIH), and found that 7 patients developed non-Hodgkin lymphoma (NHL) from 6 months to 13 years after their first admission to the NIH. Analysis of the risk of development of lymphoma showed that the patients with SS had had 43.8 times the incidence expected from the rates of cancer prevailing among women of the same age range in the general population during this time, and the patients with a history of parotid enlargement, splenomegaly, and lymphadenopathy had an increased risk of lymphoma. The authors concluded that these clinical manifestations seem to identify a subset of patients with SS with marked lymphoid reactivity, who had a particularly high risk of subsequently developing lymphoma. This study remains during the following 20 years as the main reference point of the high risk of development of lymphoma in patients with SS. In the 1980s, several studies have shown that patients with SS, in addition to the polyclonal Bcell activation, as illustrated by autoantibody production, express a mono/oligoclonal process. The latter was shown by the presence of serum MIgs as well as monoclonal type II cryoglobulins and excretion of monoclonal light chains in the urine. All these phenomena were evident in patients with systemic (extraglandular) disease and long before any overt clinical signs of lymphoid malignancy were present. Finally, the most recent studies have focused on the pathogenesis of the B-cell lymphoproliferation.
56
including the role of some infectious agents such as Epstein-Barr virus (EBV) or hepatitis C virus (HCV), as factors responsible for B-cell clonal expansion, as well as the potential role of molecular analysis for B-cell clonality as a first step for the diagnosis of malignancy.
3. EPIDEMIOLOGICAL STUDIES The occurrence of non-Hodgkin lymphoma is the most serious complication of SS. A higher risk for the development of lymphoma in these patients, reaching 6.4 cases per 1000 patients/year (44 times greater than in a normal population), was first described by Kassan et al. [15] in a prospective study. Since this initial epidemiological study, several authors have retrospectively analyzed the incidence of lymphoma in patients with SS (Table 1). The percentage of patients with SS who develop lymphoma varied in these studies from 1 to 10%. Potential explanations for this variation include differences in the criteria used for the diagnosis of SS and in the length of follow-up. Patients with primary SS have the highest risk of developing lymphoproliferative disorders. None of the patients described by Kruize et al. [16] with isolated keratoconjunctivitis sicca or secondary SS had developed lymphoproliferative disease in a long-term follow-up study. Similarly, in another study of 331 Italian patients [17], no lymphoma was diagnosed in patients with secondary SS. A recent epidemiological study performed in Finland [18] showed a standardized incidence ratio of non-Hodgkin lymphoma of 2.2 for rheumatoid arthritis (RA), 4.5 for secondary SS and 8.7 for primary SS. Finally, patients with a younger onset of SS seem to be a higher risk for developing lymphoproliferative disorders. In a study by Kassan et al. [15], patients with an onset of SS before the age of 45 years had 60 times the incidence expected for developing lymphoma from the rate obtained in general population. Our recent studies [19) confirmed these data and showed a higher incidence of lymphadenopathy, rheumatoid factor, MIgs and lymphoma in SS patients with a disease onset before the age of 35.
Table 1. Incidence of lymphoma in patients with SS according to several authors Authors
Year
[ref.] Talal & Bunim [7] Bloch et al. [20] Sheam [28] Whaley et al.[29] Kassan etal. [15] McCurley et al. [21] Kelly et al. [22] Pariente et al. [23] Pavlidis et al. [24] Zufferey et al. [25] Kruize etal. [16] Hernandez et al. [26] Tzioufas et al. [27] Valesini et al. [17] Ramos-Casals et al. [19]
1964 1965 1971 1973 1978 1990 1991 1992 1992 1995 1996 1996 1996 1997 1998
Patients
Lymphoma
(n)
(%)
Follow-up (years)
58 62 80 171 136 138 100 62 120 55 31 39 103 295 144
5 (8%) 3 (5%) 1 (1%) 2(1%) 7 (5%) 8 (6%) 3 (3%) 4 (6%) 8 (7%) 5 (9%) 3 (10%) 4 (10%) 7 (7%) 9 (3%) 4 (3%)
4 2 NA NA 8.1 12 2.8 3-27 7 12 10-12 3.2 5 6 9
NA: not available.
4. PATHOGENESIS OF B-CELL LYMPHOPROLIFERATION 4.1. Factors Responsible for B-cell Clonal Expansion 4.1.1. Genetic alterations Chromosomal translocations are the most common genetic alterations associated with B-cell lymphomagenesis. These changes are responsible for the functional alteration of a variety of genes contributing to B-cell transformation, including proto-oncogenes and genes encoding the proteins involved in the control of the cell cycle, differentiation and programmed cell death. Of interest is the fact that at least one specific chromosomal abnormaHty characterizes each lymphoma subtype. These findings support the hypothesis that distinct molecular pathways underlie the pathogenesis of different B lymphoma histotypes, thus providing the biological bases for the broad clinicopathological heterogeneity displayed by these lymphoproliferative disorders [30]. Several chromosomal abnormalities have been described in patients with SS having an associated lymphoma (Table 2). The first one is the t(14;18) chromosomal traslocation, which is the cytogenetic hallmark of follicle center lymphoma (FCL) [31]. This translo-
cation results in the deregulated expression of the bcl-2 gene: the translocation juxtaposes the bcl-2 gene with Ig heavy chain locus leading to an inappropriately high synthesis of bcl-2 protein [32]. Although the function of the bcl-2 gene product is not yet clear, the presence of high levels of bcl-2 protein inhibits B-cell apoptosis thus increasing B-cell survival and this may lead to an increased chance of neoplastic transformation. Some authors have studied the presence of this traslocation in SS patients with lymphoma. Fox et al. [33], using both Southern blot and the polimerase chain reaction (PCR), demonstrated that 50% of SS-associated lymphomas present this translocation which was not detected in SS patients without lymphoma, or in those with pseudolymphoma. Translocations of this bcl-2 gene were also observed by Pisa et al. [34] in 5 of 7 SS-associated lymphomas by Southern blot analysis, and no bcl-2 translocations were detected in 50 consecutive salivary gland biopsies of patients with SS lacking clinical evidence of coexistent lymphoma or in the pre-lymphoma biopsies from the same patient. Other authors failed to identify this t(14;18) translocation in any of the lip biopsies showing heavy chain monoclonality or in any of the extrasalivary gland lymphomas [35]. We may conclude that analysis of bcl-2 translocations in tissue biopsies will aid in the diagnosis of lymphoma, although a negative result would not eliminate the diagnosis of malignancy.
57
Table 2. Genetic alterations in primary SS Biological Consequence 1. Translocation t(14,18) 2. Translocation t(l 1,14) 3. Trisomy 3 4. Mutation of the gene p53 5. Defective repair of O" -methy Iguanine-DN A
Altered expression of bcl-2 protein Overexpression of PRADl gene ? Altered expression of p53 protein Persistence of 0^-DNA (carcinogenetic)
Another translocation, t(ll;14), is observed in most cases of mantle cell lymphoma (MCL), involving the immunoglobulin heavy chain locus and the bcl-1 gene on the long arm of the chromosome 11. This translocation results in overexpression of PRAD1 gene, which encodes for cyclin Dl, a cell-cycle protein that is not normally expressed in lymphoid cells [36]. Mucossa-associated lymphoid tissue (MALT) and monocytoid B-cell lymphomas (MBCL) may exhibit a third chromosomal abnormality the trisomy 3, in 50% of the cases [37]. Finally, mutations of the tumor-suppresser activity gene p53 have been observed in lymphomas and have been associated with progression of low-grade MALT lymphoma to high-grade [38], and Guo et al. [39] described recently that a defective repair of 0^-methylguanine-DNA in patients with primary SS predisposed to lymphoma. 0^-methylguanine mispairs with thymine, then DNA replication leads to propagation of a G-to-A transition mutation, a known mechanism of human oncogene activation and tumor suppresser gene inactivation. The persistence of 0^-methylguanine-DNA in lymphocytes seems to be carcinogenic and theses lymphoid cells are at risk for transformation to the maUgnant phenotype. 4.1.2. Infectious Agents Infectious agents, mainly viruses, may play a etiopathogenic role in the development of lymphoma. Two distinct types of interactions with lymphoid cells may contribute to lymphomagenesis. First, oncogenic viruses such as EBV and HCV can directly infect B cells and drive their proliferation through the expression of virus-encoded transforming proteins. Second, infectious agents can be the source of antigenic de-
58
terminants which, in the case of persistent infections, may induce and sustain the proliferation of B cells. 4.1.2.1. Epstein-Barr virus The EBV, a ubiquitous herpesvirus found in humans, can infect B cells and cause transformation, outgrowth and polyclonal immunoglobulin secretion [40]. It has been shown to be the causative agent in infectious mononucleosis and to be associated with Burkitt's lymphoma, nasopharyngeal carcinoma and X-linked lymphoproliferative syndrome. EBV replicates in the salivary glands and nasopharyngeal epithelia during primary infection and remains latent for the rest of the host's life [41]. A possible role of the EBV in the lymphomagenesis observed in patients with SS has been postulated by several authors, that have found a higher frequency of EBV genes or protein expression in labial salivary gland biopsies from patients with SS in comparison with control subjects [42, 43]. Other authors have found increased levels of EBV DNA in the saliva of SS patients with pseudolymphoma [43] and increased levels of antibodies against EBV early antigen in their sera [44]. Some reports detected EBV in lymphomatous tissues. Fox et al. [45] found EBV DNA in 2 out of 5 cervical node NHL's in SS, Jeffers et al. [46] in 3 out of 6 SS associated MALT lymphomas, Royer et al. [47] in 1 out of 4 parotid lymphomas, Fox et al. [48] in 1 out of 14 NHL in SS patients and Freimark et al. [49] in 1 out of 9 lymphomas arising in the setting of SS. Other authors have not found evidence of EBV in low-grade NHL complicating SS [46]. The EBV is latent in the ductal epithelium of the salivary and lacrimal glands and B cells can be reactivated in patients with SS due to the defective T-cell regulation, and possibly to mutated EBV that escapes recognition by EBV-specific cytotoxic cells [45]. Sahvary gland epithelial cells in SS patients express high levels of HLA-DR antigens and may present EBVassociated antigens to immune T cells in patients with SS. Intrinsic, but unknown abnormalities of SS B cells may also contribute to a potent and persistent production of EBV, and the selective expansion of a certain subset of B cells may cause monoclonal lymphoproliferation [50]. SS may represent a situation in which genetically predisposed individuals (i.e., HLA-DR3DQA4-DQB2) have a persistent but ineffectual T-cell immune response against EBV at its site of latency [48].
4.1.2.2. Human herpes virus-6 The recent isolation of a new member of the herpes virus family (human herpes virus-6, HHV-6) from patients with lymphoproliferative diseases prompted several authors to examine this virus in tissue samples [45] and saliva [51] from patients with primary SS who developed NHL. Jarrett et al. [52] analyzed tissue samples from a patient with a B-cell lymphoma occurring in the context of SS, and found the presence of HHV-6-specific DNA sequences. Fox et al. [53] found HHV-6 DNA in lymph nodes of 1 out of 14 patients. 4.1.2.3. Hepatitis C virus A possible relationship between HCV—a virus that can be excreted in saliva—and SS was postulated in 1992 by Haddad et al. [54]. They reported the occurrence of histologic changes characteristic of SS in salivary glands of patients with HCV infection. Recently, two clinical studies, performed in large series of patients, described the clinical and immunological features of this subset of patients with SS and HCV infection [55, 56]. Furthermore, Koike et al. [57] reported the first experimental evidence of the relationship between SS and HCV infection. These authors found an exocrinopathy resembling SS in the salivary and lacrimal glands of transgenic mice that carry the HCV envelope genes [58]. Taken these findings together, it is conceivable that there is a direct pathogenetic link between SS and HCV infection. On the other hand, the relationship between HCV and lymphoproliferation has been postulated in recent years, although in 1971 Heimann [59] described the frequent association between liver cirrhosis and lymphoproliferative disorders, suggesting the possible role of hepatotropic viruses in the pathogenesis of both conditions. Twenty-three years later, in 1994, the presence of HCV ongoing replication in both serum and peripheral lymphocytes was first demonstrated in one-third of Italian patients with unselected B-cell NHL, regardless of their different grades of maUgnancy [60, 61]. Subsequent studies confirmed this higher incidence of HCV infection in NHL [62, 63]. Additional support for the possible association of clonal B-cell expansion and HCV infection has been provided by Franzin et al. [64], who found a high frequency of clonal B-cell expansion in HCV-infected patients, even in the absence of cryoglobulinemia. Finally, the first attempts to localize HCV within the malignant NHL lesion are quite recent [65-66].
De Vita et al. [67] characterized the B-cell lymphomas observed in 35 consecutive patients with HCV infection. They found a definite clinical picture of mixed cryoglobulinemia or SS preceding NHL onset in 5 patients and, when comparing the sites of NHL involvement at onset in patients with primary extranodal NHL (HCV infected vs. HCV uninfected), liver and salivary involvement were significantly more frequent in HCV-infected patients. Both the liver and the major salivary glands are targets of HCV infection, and their involvement seems to be significantly overrepresented in NHL-HCV infected patients, whereas, the localization in these primary organs is extremely uncommon in unselected series of B-cell NHLs [6870]. In summary, HCV may infect and actively replicate within the hepatocytes [71, 72] as well as in the salivary gland epitheUum [65], and HCV RNA can be detected in the peripheral blood mononuclear cells of patients with chronic hepatitis C [73]. According to their lympho-, syalo- and hepatotropism, HCV may exert its oncogenic potential in two different directions, leading to B-cell neoplasms (in some cases, there is a previous development of SS or mixed cryoglobulinamia) and liver cancer (Fig. 1). Therefore, it is more appropriate to consider chronic HCV infection as a multisystem clinical syndrome than as a simple liver disease [73-75]. 4.1.2.4. Helicobacter pylori In the last few years, a small Gram negative curved rod denominated Helicobacter pylori has been etiologically linked to the most important gastroduodenal pathology, including peptic ulcer and gastric carcinoma. Several recent epidemiological and experimental studies have also linked H. pylori to both gastric lymphoid follicles/MALT and MALT lymphoma. Findings reported by different groups demonstrated the dependence of the proliferation of neoplastic lymphoma B cells on the presence of H pylori specific T cells and the apparent regression of MALT lymphoma after the erradication of H. pylori [76-80]. It appears that persistent infection with H. pylori causes organized lymphocyte proliferation which, in turn, can become autonomous and progress to a lymphoproliferative neoplastic disease. A possible relationship between H pylori and gastric lymphomagenesis in SS has been recently postulated. Lymphoid accumulation in the gastric mucosa
59
HCV tropism Salivary glands
©
V
Lymphocytes
©
/
B-cell Lymphomas
Hepatocytes
-
.
@
• Hepatocellular carcinoma
Figure 1. Oncogenic potential of the chronic HCV infection. (SS: Sjogren's syndrome, MC: mixed cryioglobuUnemia, CH: chronic hepatitis/cirrhosis).
is common in SS but full evidence for an antigendriven B-cell expansion has not been demonstrated. De Vita et al. [79] described a low-grade gastric lymphoma concomitantly with H. pylori infection in a patient with SS. After H. pylori erradication, a dramatic regression of gastric lymphoma into chronic gastritis was observed, but no amelioration occurred in the parotid and nodal involvement. Multiple molecular analyses showed the expansion of the same B-cell clone in synchronous and metachronous lymph node, parotid, and gastric lesions before and after H. pylori eradication. Other authors [80] studied the gastric tissue in SS in order to define whether the presence of MALT in the stomach is associated with several infectious agents, and showed that H. pylori infection is not more frequent among patient with SS than in controls, and that the abnormal accumulation of MALT may occur in the stomach even in the absence of H. pylori infection. Other studies performed on a limited number of SS patients with simple dyspepsia indicate that clonality may persist for up to six months after the eradication of H. pylori. [81]. Thus, although H. pylori may play a crucial role in the local boosting
60
of B-cell lymphoproliferation, the underlying B-cell disorder seems to be a nonmalignant process. [79] 4.1.3. Molecular Pathogenesis 4.1.3.1. Apoptosis Although interstitial lymphocytes of salivary gland tissue from patients with primary SS may show in situ apoptosis, recent investigations described that these lymphocytes have significandy less apoptosis in spite of a high expression of Fas [24] and that the progression of SS from benign to malignant lymphoproliferation may be related to suppression of apoptotic death by bcl-2 [82]. The possible mechanisms explaining this blocked apoptosis in SS salivary gland are under study and could involve abnormalities in bcl2-related gene products, cytokines such interleukin (IL)-IO, adhesion molecules and costimulatory molecules (CD80/CD28) [83]. In order to elucidate the mechanism of the progression from polyclonal to monoclonal lymphoproliferation in patients with SS, Takeshita et al. [84] analyzed the monoclonal nature and the expression of bcl-2 protein in the salivary
glands and found that 36 out of 45 patients showed small areas of bcl-2 expression in periductal lymphocytes of lip biopsy specimens. Other authors [82] found that the lymphocytes from the lymphoepithelial lesion in the major salivary glands of patients with SS expressed the oncogene bcl-2 protein. We may conclude that the expression of bcl-2 protein in the cells plays a crucial role in the cells escaping apoptotic cell death, living long and resulting in autoantibody production, and thus producing an increased risk of monoclonal proHferation of the cells [84]. 4.1.3.2. Cytokines Perpetuation of the immune response within the SS glands also depends on production of cytokines by both lymphocytes and epithelial cells. Local cytokine networks probably play a contributory role in the development and evolution of B-cell lymphoproliferation, and continued stimulation of such B cells in the glandular microenvironment may promote their transition to lymphomas. Several cytokines such as IL-1, IL-3, IL-6, IL-10, tumor necrosis factor (TNF)-a and TNF^ are known to behave like autocrine growth factors for B lymphocytes. Conversely, IL-2, IL-4 and IL-13 stimulate B-cell proliferation almost exclusively in a paracrine fashion [85]. Determination of the relative growth-promoting activities of these cytokines is often difficult since more than one lymphokine may play a role, and the effects on the proliferation of B lymphocytes may vary according to the activation or differentiation state of these cells. De Vita et al. [86] described a putative pathobiological role of the IL-12/IL-4 balance, in the presence of cytokines that may sustain B-cell proliferation (i.e., IL-3, IL-6, IL-10), in prelymphomatous and definite lymphomatous SS lesions (which might be then implicated in lymphoma progression in this disease). 4.1.3.3. CD5+B cells Patients with chronic lymphocytic leukemia (CLL) show a specific circulating B cell that expresses a cell surface marker normally associated with T cells, the CD5+ (Leu-1) molecule [87]. The role of CD5-f- B cells in human and murine autoimmune/lymphoproliferative disorders has recently attracted much interest [88-89], and evidence is emerging that CD5-I- B cells belong to a developmental lineage distinct from that of conventional B cells and mainly participate in natural immunity. Since CD5+
B cells are probably the source of rheumatoid factor (RF) in patients with RA [90] and the proliferating cells in CLL [91], it has been suggested that this subgroup of B cells may be implicated in the oligoclonal/monoclonal expansion seen in SS. In fact, it has been demonstrated that CD5+ B cells are increased in both the peripheral blood [92] and salivary infiltrates of patients with SS [91, 93-98]. B cells, expanded under selective pressure through an antigenic or T-celldriven process, may represent a precursor of CD5-Ilymphomas in SS (i.e., small lymphocytic lymphoma and MCL) [83]. Interestingly, the percentage of these cells has been shown to be higher in primary SS patients with circulating IgMk monoclonal component than in those without [93], and remission of malignant lymphoma in some patients with primary SS has been shown to be accompanied by restoration of CD5+ B-cell levels to normal [94]. Perhaps the lymphoproliferation in primary SS is highly selective and a distinct subpopulation of B cells, possibly those expressing the CD5-I- molecule. Therefore, CD5+ B lymphocyte may be the element playing the central role in the progression from SS to B-cell lymphoproliferation [99]. 4.2. Monoclonal Selection Physiologically, humoral immune response to an antigen involves the activation of several B-cell clones producing immunoglobulins with different heavy and light chains. Studies carried out in animal models as well as in humans have shown that the appearance of B-cell clonality may occur in the context of a preexisting polyclonal lymphocyte proliferation, probably induced by continuous exposure to either autoantigens (favored by altered self-tolerance) or exogenous antigens such as those associated with persistent infections (e.g., viruses, malaria, H. pylori) that may be responsible for the induction and sustaining of polyclonal lymphoproUferation. Thus, the direct infection of B cells by oncogenic viruses (EBV, HCV) may also induce the clonal expansion of virus-carrying cells. Benign lymphoproliferative disorders are generally composed of a mixture of polyclonal B and T cells and small numbers of other mononuclear cell populations. The benign lymphoepitelial lesions that are characteristic of SS are composed of a majority of CD4 T-cell lymphocytes [100] and a minority of B-cell lymphocytes that are often oHgoclonal [90, 101].
61
While peripheral blood B cells from patients with SS do not spontaneously secrete increased amounts of immunoglobulins, B cells infiltrating the target issue (i.e., the epithelial cells of the exocrine glands) produce large amounts of immunoglobulins with RF activity. Previous studies have indicated that the polyclonally activated B cells in patients with primary SS are mainly localized in the affected exocrine glands [10, 102, 103]. Data obtained by Moutsopoulos et al. [104] indicated that the B cells from minor salivary gland infiltrates of patients with SS have a common idiotype with the MIgs from patients with B-cell lymphoid malignancies, thus suggesting that neoplastic transformation in primary SS may start in the exocrine glands [43]. The finding of an association between serum IgMk monoclonality and an increased proportion of k-positive plasma cells in salivary glands of patients with SS [104] also indicates that the affected exocrine glands are the main area of monoclonal B-cell activity. The reports of Ig- and T-cell antigen receptorgene rearrengements in salivary gland lymphocytes of patients with SS have confirmed that oligoclonal lymphocyte expansion is a feature of the exocrinopathy, even before any overt malignancy develops. Although B cells represent a minority of SS tissue lymphoid infiltrates, they may undergo polyclonal activation and oligomonoclonal expansion, which may in turn predispose to an as yet undefined B-cell neoplastic transformation event [105]. Monoclonality in SS arises mainly from salivary glands, but may arise also from visceral organs and lymph nodes. The earlier phases of lymphomagenesis therefore may be characterized by the appearance of a clonal expansion of immortalized but not fully malignant B lymphocytes which may persist in involved tissues for variable periods of time. Subclones characterized by proliferative advantages are then selected within the lesion and are responsible for the shift towards a more malignant phenotype. The lymphomas in SS may home to multiple MALT sites and may be detectable at a very early stage in the salivary glands. 4.3. Monoclonal Overexpansion The observation that the activated B lymphocyte is located mainly in the salivary glands, in association with other factors which may promote neoplasia in the salivary gland lesion (e.g., the absence of natural killer cells), prompted several studies to determine
62
the monoclonal B-cell subsets in the minor salivary gland infiltrates of SS patients responsible for the production of MIgs [27]. In 1982, Schmid et al. [106] suggested that the benign lymphoepithelial lesion of SS salivary glands with areas of confluent lymphoid proliferation contains plasma cells with cytoplasmic monoclonal IgMk immunoglobuHns and represents in situ malignant lymphoma. Subsequent studies [49, 90, 104] suggested that the salivary glands in SS patients may serve as the initial site of B-cell neoplastic transformation. Fishleder et al. [90] found in benign lymphoepithelial lesions of parotid and submandibular gland, removed two years later from the same patient with SS, that the rearrangements of the heavy chain and the k light chain genes were entirely different, thus making highly unlikely that the B-cell clone identified in the second lesion evolved from the first. Different immunoglobulin gene rearrangements in the same patient with benign lymphoepithelial lesions of different major salivary glands have also been observed by Freimark et al. [49]. However, the observation of Bodeutch et al. [107] that multiple separated minor salivary glands of labial salivary gland tissue biopsy specimen are populated by monotypic plasma cells of the same isotype (IgMk) or even of different isotypes in different glands in one of their patients (IgMk and IgAk) supports the hypothesis that monotypic plasma cell populations in the salivary glands of patients with SS are not the result of a clonal expansion of a single neoplastic changed lymphoid stem cell. All aforementioned observations support the hypothesis that monotypic plasma cell populations appear after a latency period in the labial salivary gland tissue and probably also in other exocrine glands in some patients with SS and with an initial polytypic plasma cellular infiltrate. This switch from a polytypic into a monotypic plasma cell infiltrate in many different glands cannot be attributed to neoplastic changes. A more likely explanation is that the exocrine glands in a subpopulation of patients with SS are homed by primitive B cells, which are liable to homeostatically regulated clonal expansions after prolonged antigenic stimulation by modified parenchymal cells in the target organs, and that this phenomenon is accompanied by an increased risk to develop systemic monoclonal lymphoproliferative disorders. However, B cells from other organs rather than salivary glands must also be carefully evaluated for
the presence of B-cell monoclonal expansion. To better characterize the prelymphomatous stages of B-cell lymphoproliferation in SS, De Vita et al. [108] studied multiple tissue lesions (synchronous from different tissues and metachronous from the same tissue) of 6 consecutive patients with SS who had an associated lymphoproliferative disorder, and evaluated the persistence and dissemination of the same B-cell clone, as well as the estimate of the "size" of the expanded Bcell clone(s) during the disease. By molecular analyses of synchronous biopsy specimens, the local overexpansion of the same B-cell clone may be detected in multiple sites. In contrast, in the majority of SS patients, dominant bands of different molecular weight were observed in synchronous biopsy samples from different tissues, indicating different dominant B-cell clones in different microenvironments. The analysis of the metachronous biopsies have shown that B-cell clonal overexpansion is frequently multifocal and fluctuating in SS, since different clones predominated not only in different tissues (synchronous biopsy tissue), but also in the same affected tissue at different times (metachronous biopsies). The authors provided conclusive evidence that clonal B-cell expansion is a frequent event in SS, but may be either oligoclonal or monoclonal, either smaller or larger in size, either fluctuating or established, or either localized or disseminated. Importantly, these different events conceivably imply a different risk of lymphoma progression, though they may all occur under the same pathologic diagnosis of lymphoproliferative lesion. In summary, lymphoproliferation in SS patients follows a multistep etiopathological process (Fig. 2). The first step may be a noxious infective agent (EBV, HCV...). The antigenic stimulus caused by viral infections, which may be attributed to viral antigenic products or, alternatively, to desegregated or crossreactive autoantigens (for instance through the mechanism of molecular mimicry), may enhance the activity of specific helper T-cell clones and, consequently, may cause the polyclonal activation of B cells. The production of different types of autoantibodies is the result of this polyclonal B-cell hyperactivity, together with the overproduction of soluble immune complexes or cryoglobulins. In the subsequent phase, some B-cell clones may selectively proliferate, thus inducing the production of MIgs—usually IgMk with RF activity—which can be detected in the serum and in type II cryoglobu-
lins. Minor populations of B or T cells may clonally expand in the salivary gland tissues of SS patients, and such lymphocyte expansions may be controlled by the endogenous immune response and/or medications. However, continued lymphoproliferation in these salivary gland tissues may eventually lead to emergence of a neoplastic clone, maybe a particular B- or T-cell clone with a karyotipic underlying alteration, that escapes immunologic control and develops into a NHL as a result of a multistep process [49].
5. HISTOLOGICAL CLASSIFICATION 5.1. Pseudolymphoma Some patients develop a clinical picture suggestive of malignancy but that cannot be classified as malignant, even using modern molecular pathology techniques, such as immunophenotyping and immunogenotyping. The term "pseudolymphoma", introduced in 1952 by Godwin [109], has been applied to such cases [110] and has been considered an intermediate stage in the transition from benign to malignant lymphoproliferation. In the original description of pseudolymphoma of salivary glands, the infiltrate was described as being composed of small lymphocytes, plasma cells, immunoblasts, and a "distinct" mononuclear cell population [110]. Subsequent studies clearly demonstrated the B-cell nature of this "distinct" mononuclear cell population [111-113] and the designation "monocytoid B lymphocytes" has been recently accepted as an appropriate term for these cells. What was called pseudolymphoma in the literature corresponds probably in most cases to slowly progressive MALT/MBCL. 5.2. B-Cell Lymphomas Various histological subtypes of B-cell lymphomas in patients with SS have been described in the literature (Table 3). Although there may be similarities, these tumors can be distinguished in most cases by a combination of morphological and immunophenotypic features [83]. The most frequent B-cell lymphoma described in patients with SS is the marginal zone B-cell lymphoma (MZL), that includes low-grade B-cell lymphoma of MALT type and MBCL [31]. Extranodal lymphoid tissue associated with the gastrointestinal and bronchial epithelium as well as
63
HC V tropism Salivary glands
Lymphocytes
Hepatocytes
0
I
B-cell Lymphomas
Hepatocellular carcinoma
Figure 2. Lymphoproliferation in SS: a multistep etiopathological process. Table 3. Histological subtypes of B-cell lymphomas that have been described in patients with SS 1. 2. 3.
Mantle cell lymphoma (MCL) [21,124] Follicle center lymphoma (FCL) [24, 125] Small lymphocytic lymphoma (SLL) [24]
4. 5.
Lymphoplasmacytoid lymphoma/immunocytoma [21] Marginal zone B-cell lymphoma (MZL) [23, 125, 126] 5.1. MALT lymphomas (115] 5.2. Monocytoid B-cell lymphomas (MBCL) [117, 119]
with other mucosal tissues has been termed MALT, and is composed of lymphocytes that may home preferentially to these sites to process luminal antigens and to provide mucosal immunity. Low-grade B-cell lymphomas may arise in this lymphoid tissue (MALTlymphomas) and in lymphoid tissue associated with other types of epithelium that apparently differ morphologically, immunologically, and clinically from other low-grade lymphomas. MALT lymphomas commonly present with localized extranodal disease involving glandular epithelial tissues. The concept of extra-nodal lymphomas arising in MALT was first elucidated by Isaacson et al. [114, 115]. This group
64
of lymphomas is described to arise in MALT of the gastrointestinal tract, salivary gland, lung and thyroid [114-116] and uncommonly arise from normal MALT such as Peyer's patches. Although MALT lymphomas may be of low or high grades, the low-grade tumors are characterized by an indolent clinical course and a resemblance to the organization of normal MALT. The mechanism by which the neoplastic cells remain committed to a single site, the presence or absence of neoplastic-cell traffic or homing, and the specific dissemination of MALT lymphomas to other mucosal sites are all properties of these lymphomas that are poorly understood. MBCL represent the nodal counterpart of MALT lymphomas, and is a recently recognized B-cell neoplasm [117-118]. A combination of morphologic, immunologic, immunogenetic and clinical features makes MBCL a unique B-cell lymphoma [117]. Morphologically, neoplastic cells of MBCL have characteristic light microscopic and ultrastructural features [119]. Immunologically, MBCL has a fairly distinct antigenic phenotype. The neoplastic cells of MBCL, in addition to having monoclonal surface immunoglobulin and B-cell-associated antigens, express CDllc, a myelomonocyte-associated antigen, but lack CD25
Table 4. T-cell lymphomas in patients with SS
Table 5. Hodgkin's disease in patients with SS
Year
Author
Ref.
Involvement
Year Author
1984 1987 1987 1988 1989 1989 1989
Wilke et al. Schuurman et al. Isenberg et al. Rustin et al. Fredenrich et al. Van der Valk et al. Freimark et al.
[127] [128] [129] [130]
NA Systemic Skin Skin NA Skin Skin
1990 1992 1992 1993 1997 1998 1998
1991 1996 1997 1998
Chevalier et al. Ros et al. Royer et al. Dubin et al.
[133] [135] [47] [134]
[131] [132] [49]
Systemic Pulmonary Skin Skin
NA: not available.
(IL-2 receptor/TAC antigen) [117, 120, 121]. Clinically, MBCL usually has an indolent course and frequently involves the lymph nodes, but the disease may evolve to a more aggressive lymphoma [117,118, 121, 122]. It may also occasionally involve extranodal sites [117, 121, 122]. It is suggested that the frequent association of IVIBCL with SS may be due to the fact that the saUvary glands drain to cervical lymph nodes that are part of the systemic, rather than the mucosal, lymphocyte circulation pathway [123]. 5.3. T-Cell Lymphomas T-cell lymphomas have been described sporadically in patients with SS (Table 4) [47, 49, 127-135]. The most frequent presentation is the cutaneous involvement. Ros et al. [135] described a rare angiocentric pulmonary T-cell lymphoma associated with primary SS. 5.4. Hodgkin's Lymphoma The first case of definite Hodgkin's disease (HD) developing in a patient with primary SS has been reported in 1990 [136]. This association had been mentioned previously [10, 14, 29], but it had not been completely documented nor had the histological features been entirely conclusive of HD. Vivancos et al. [96] described in 1992 two additional cases of histologically proven HD occurring in patients with a previous clinical and histological diagnosis of primary SS. These two patients had different histological types of HD: lymphocytic depletion and mixed-cellularity
Ref.
Type
Martin-Santos et al. [136] Lymphocytic predominance [96] Lymphocytic depletion Vivancos et al. [96] Mixed-cellularity Vivancos et al. [37] Mixed-cellularity Nagai et al. [138] NA Caches et al. Ramos-Casals et al. [19] Mixed-cellularity Ramos-Casals et al. [19] Lymphocytic depletion
NA: not available.
types, and a lymphocytic predominance type was found in the first pubHshed case [136]. Other studies reported additional cases of SS and HD (Table 5) [19, 137, 138]. It is more difficult to give a convincing explanation about a pathogenetic relationship between primary SS and HD. In fact, the cause of HD is still unknown. Recent studies strongly support a B-cell origin for Reed-Stemberg cells, and one could argue that in patients with SS there might be a pathogenetic predisposition to the development of HD similar to that described for B-cell lymphoma. In contrast to this speculation, however, we must bear in mind that the incidence of NHL in patients with SS is much greater than that expected in the general population, whereas the incidence of HD in this disorder appears to be very low. Therefore, this might be only a casual relationship. Nevertheless, it seems reasonable to include HD in the clinical spectrum of the lymphoproliferative disorders that may occur in the course of primary SS. 5.5. Other Hematologic Malignancies Association of SS and multiple myeloma (MM) seems to be extremely rare, and only 6 cases [139-143] have been reported (Table 6). Among these cases, two were extramedullary plasmacytoma with or without bone marrow involvement. Other authors have reported extramedullary plasmacytoma in salivary glands [144] and skin [21]. A parotideal myeloma has also described [141]. Recently, a case of SS as the initial manifestation of MM was reported [145]. Lip biopsy showed lymphocyte and plasma cell infiltration in the minor salivary glands. Other hematologic malignancies described in SS patients are acute myelocytic leukemia [146], an-
65
Table 6. Multiple myeloma in patients with SS Year
Author
Ref.
1975 1983 1987 1989 1990 1997
Sheam et al. Bourbigot et al. Casaril et al. lijima et al. Villanueva et al. Rodriguez-Cuartero et al.
[140] [143] [141] [139] [144] [142]
gioimmunoblastic lymphadenopathy [147] and multicentric Castleman's disease [148].
6. CLINICAL EVALUATION In primary SS, the local exocrine gland lesions produce sicca manifestations such as xerostomia, keratoconjunctivitis sicca, dyspareunia and dry skin. As the disease evolves an aggressive polyclonal B-cell activation is observed, often accompanied by lymphocytic infiltration of other organs. At this stage, patients present with extraglandular manifestations, attributable to two main pathophysiological mechanisms: (i) an extension of the lymphocytic infiltration to several parenchymal organs, resulting in their functional impairment; and (ii) immune complex mediated injury. Extraglandular features usually observed include cutaneous vasculitis, lung involvement, kidney involvement, hepatic involvement, Raynaud's phenomenon and non-erosive arthritis. A complicated or progressive lymphoproliferative disorder in SS is usually manifested clinically as salivary gland enlargement. In addition, regional or generalized lymphadenopathy, hepatosplenomegaly, pulmonary infiltrates on chest X-ray, renal insufficiency and cytopenias are clinical and laboratory findings that suggest extraglandular involvement by an SS-associated lymphoma. The appearance of some clinical features, such as lymphadenopathy, splenomegaly and parotid gland enlargement, are considered as predictive clinical factors for the development of lymphoma in patients with SS. Clinical presentation of lymphoma in a patient with SS can be diverse. IMost patients with systemic NHL present with painless adenopathies, more commonly in the cervical or supraclavicular regions. When present, however, they usually are associated
66
with advanced stages of disease. Lymphomas may affect the salivary glands or major parenchymal organs such as the lungs, kidneys or gastrointestinal tract [149]. Hansen et al. [124] described pulmonary involvement in 10 out of 50 patients with SS and lymphoma. Pulmonary involvement by lymphoma is more likely to occur in those patients with systemic lymphoma, although in some cases the lungs were the only organs involved [130]. Gastrointestinal symptoms are nonspecific with vague abdominal pain as the most common presenting symptom in intestinal lymphoma. Unusual metabolic presentations include hyperuricemic renal failure [150] and hypercalcemia. Neurologic symptoms and signs, including headache or cranial nerve palsies, may be the presenting features and they are more commonly associated with high-grade lymphomas. Genitourinary presentations include renal mass, ureteral obstruction, testicular mass, ovarian mass, and vaginal bleeding. Unusual sites of lymphoma involvement are thymus [151], skin [98] and ocular adnexa [152]. These lymphomas may differ in location and grading. Therefore, the clinical picture of lymphoma in patients with SS appears to be diverse, suggesting that the therapeutic approach should be guided by the stage and the grade of the disease. Staging of lymphoma involves a radiologic evaluation (computed tomography or magnetic resonance), usually a bone marrow examination, and an awareness of clinicopathologic associations. In addition to histopathologic features and stage, various factors, including age, performance status, the size or bulk of lymphoma, the number of extranodal sites involved, and the elevation of lactic dehydrogenase (LDH) levels may determine the prognosis and play a role in selecting the optimal therapy for a patient.
7. DIAGNOSIS 7.1. Detection of MIgs IVIIgs represent the unique product of a single clone of relatively mature B lymphocytes or plasma cells. The presence of an IVlIg does not in itself demonstrate the existence of a maUgnant B-cell lymphoproliferative disorder and only indicates the presence of one or more clonal population(s) of B cells able to produce a homogeneous immunoglobulin. Screening for
MIgs is commonly performed by serum protein electrophoresis on cellulose acetate or agarose gel, that in the majority of cases allows the detection of an electrophoretically homogeneous band resulting from the accumulation in the serum of immunoglobulin molecules with restricted electric charge heterogeneity, which thus migrate within a narrow zone on the electrophoretogram. Over the past several years, it has been demonstrated that the essential characteristic of the transition process from the autoimmune state to malignant lymphoproliferation is the presence of MIgs in the sera and urine of patients with SS before the development of an overt lymphoma. High resolution electrophoresis/immunofixation has proven to be of great value in the screening and characterization of serum and urine MIgs associated with SS [153, 154]. Moutsopoulos et al. [154] disclosed in 1983 that patients with SS have a high incidence of circulating monoclonal free light chains in the serum. In those cases in which lymphoma develops, the level of urinary free light chains may correlate with disease activity [97]. In SS, the value of serum and/or urine MIgs in predicting the risk of developing lymphoma has been clearly demonstrated [97]. The detection of MIgs or Ught chains showed that a B-cell clonal expansion may be present early in a number of patients with SS, coexisting with a polyclonal B-cell activation [7, 105, 155]. The monoclonal origin of the monotypic plasma cells in autoimmune sialadenitis has been confirmed by immunoglobulin gene rearrangement studies [49, 90] but evidence of monoclonality does not represent necessarily the existence of lymphoid malignancy. Several studies showed that ohgoclonal B-cell expansion is present in the early minor salivary lesions of patients with SS in the absence of progression to pseudolymphoma or lymphoma. Pablos et al. [101] studied 13 unselected SS patients with early minor salivary lesions and disclosed B-cell clonal expansion in all of them. In the follow-up, all were free of lymphoproliferative disease. Bahler et al. [156] found that different biopsies from the same patient may contain distinct clones indicates that some myoepithelial sialadenitis (MESA) associated does have not yet evolved to malignant lymphomas. This finding contrasts with the view of B-cell clonal expansion as an early marker of malignancy, and therefore does not support the use of aggressive therapy in these patients [97, 157, 158].
7.1.1. Monoclonal rheumatoid factor Most patients with SS present high levels of RF in their sera [20, 159]. Previous studies, using polyclonal anti-idiotypes have shown that monoclonal RF share cross-reactive idiotypes (CRI) [160, 161] that had been originally classified into three CRI groups, Wa and Po, that include 60 and 20% of monoclonal RF, respectively [160], and the Bla group, which defines a minor subgroup [161]. Furthermore, with the use of the hibrydoma technology, monoclonal antibodies to idiotypic determinants on intact light or heavy chains of human monoclonal RF were developed [162-164]. The majority of SS patients express a CRI on the k chains of their RF molecules that is defined by a monoclonal antibody (MoAb 17-109) [43]. The 17-109 MoAb reacts with monoclonal RF which belong to the Wa idiotypic family and bear remarkably similar x light-chain variable regions belonging to the VxIIIbxL chain subgroup and more specifically to a highly conserved humkv 325 gene [165]. In addition, the prevalence of 17-109 reactive B-lymphocytes within the infiltrated salivary glands of patients with SS are approximately 10-fold higher than that of lymph modes from age matched [43]. In patients with SS, the high levels of 17-109-positive RF molecules may reflect intrinsic B- or T-cell defects, or both. Intrinsic B-cell defects could result in preferential selection of a particular light-chain variable region gene [166] and/or the failure to diversify this gene by subsequent somatic mutations [167]. T-cell defects might include excessive T helper-cell function or the failure to suppress particular B-cell clones. The increased frequency of B cells reactive with MoAb 17-109 in SS may be part of a generalized disorder in immunoregulation, because these patients have a high incidence of free light chains [154] and paraproteins in their sera and urine [168-170], and, in most cases, IgM monoclonal RF from the sera, and cryoprecipitates of patients with SS expressed the epitope associated with the Vklllb variable region. This expression was evident in the early stages of the disease and persisted during the disease course [171]. 7.1.2. Monoclonal cryoglobulins Mixed cryoglobulins are cold precipitable proteins containing IgG and anti-IgG rheumatoid factor, usually an IgM of monoclonal (type II) or polyclonal (type
67
Ill) origin [172] . Cryoglobulins have been observed in a wide variety of diseases, including malignancies, infections and systemic autoimmune diseases [173]. Since the first report of cryoglobuUnemia in a patient with SS [174], some studies on the prevalence and clinical significance of cryoglobuHns in primary SS patients have been performed. The prevalence of cryoglobulinemia in primary SS has ranged from 5 to 61% [104, 154, 175-179]. Further characterization of the cryoprecipitates demonstrated a IgMk monoclonal RF in most of the cryoglobulins that presented the SS patients [27, 175, 179]. We have found [179] that the presence of leukocytoclastic cutaneous vasculitis, hypocomplementemia and HCV infection are independently associated with the presence of cryoglobulins in the sera of patients with SS. In patients with SS-associated type II cryoglobulinemia, the same monoclonal k light-chain B cells have been observed in salivary glands [104]. Moutsopoulos et al. [104] described that over half of the patients with circulating IgMk monoclonal cryoglobulins (type II) have an increased proportion of cells expressing k light chains in their minor salivary gland infiltrates. Tzioufas et al. [180] analyzed the phenotypic expression of the plasma cells infiltrating the minor salivary glands of patients with SS and found that these cells were predominantly k positive, while patients without cryoglobulins or with polyclonal cryoglobulins had an equal number of k and 1 expressing plasma cells [49]. Therefore, it is possible to conclude that the presence of type II cryoglobulin with an IgM monoclonal RF could be considered an early sign of oligoclonal/monoclonal B-cell selection in patients with SS.
7.2.1. Immunophenotypic analysis Clonal expansions are characterized by identical rearrangements of the genes codifying for the Igs or T-cell receptors (TCR), thus resulting in homogeneous phenotypic expression of these gene products [181]. Immunophenotypic analysis of peripheral blood cells or resuspended cells from various tissues (lymph nodes, spleen, bone marrow, etc.) is widely employed in the clinical laboratory for the diagnosis and the characterization of lymphoproliferative disorders. Phenotypic characterization of clonality on B lineage cells involves the use of mono- or polyclonal antibodies against the heavy and light chains of the Igs. Immunophenotyping employs peroxidase-conjugated antiserum specific for heavy (IgM, IgA, IgG) or light (X or K) chains applied directly on tissue sections to identify monoclonal populations. The appearance and expression of the Igs during ontogeny of normal B lymphocytes is well established, and permits a clear classification of the developmental stages of their B-cell neoplastic counterparts [182, 183]. Thus, all of the B-cell expansions capable of synthesizing and expressing Igs are well characterized by their cytoplasmic or membrane Ig expression, with the characteristic light-chain restriction (e.g., the expression of either K or X light chain, but not both). Also, the intensity of membrane Ig expression can be correlated with the level of B-cell differentiation and, obviously, with different types of B-cell neoplastic expansion. In SS, some authors had used in past years immunologic phenotyping in order to determine the nature of the lymphoproliferative disorder. Discrepancies between histopathology and immunophenotypic analysis may be resolved by immunogenotypic analysis. 7.2.2. Immunogenotypic analysis
7.2. Molecular Analyses for B-Cell Clonality The evaluation of clonal B-cell expansion is an important preliminary step to better investigate the pathobiologic events implicated in the different stages of progression and in different microenvironments. The assessment of clonality may be dependent on the technique used to identify monoclonal B-cell proliferation in tissue lymphoid infiltrates, and includes immunophenotypic and immunogenotypic analysis [83].
68
122A. B-cell Immunogenotyping is a more sensitive technique in which clonal rearrengements of DNA can be detected in biopsy tissue extracts by molecular hybridization, using DNA probes specific for immunoglobulin heavy and light chains. The DNA is first digested in vitro by bacterial restriction enzymes, and the restriction fragments of DNA are separated by size using agarose gel electrophoresis, then transferred on to a membrane and exposed to Ig-specific DNA probes. The probe binds only to bands on the membrane that contain
homologous DNA sequences. The membrane is then dried, and autoradiography is performed to identify rearrangement bands representing clonal populations. This technique can detect 1% or more of cells in the biopsy specimen containing the same Ig rearrangement compared with 10% for the immunoperoxidase technique. The immunogenotypic analysis included Southern blot analysis, PCR and in situ hibridization (ISH). Past studies have used Southern DNA restriction fragment length polymorphism methods to detect clonal expansion of B cells [49, 90] in biopsy specimens lacking clinical lymphoma (i.e., MESA). The molecular evaluation of B-cell clonality by Southern blot hybridization analysis, an approach developed 10-12 years ago, represented a major advance in the study of B-cell lymphomagenesis. Using this technique, the presence of clonal populations in instances other than overt lymphoma could be demonstrated [90, 125, 184, 185]. This type of study requires a large amount of fresh tissue, which limits the investigation to patients. Fishleder et al. [90] showed the presence of immunoglobuHn-gene rearrengements in the salivary gland lesions that were considered to be benign lymphoepitheHal lesions without lymphomatous involvement, according to their histologic criteria. These authors further indicated that detectable immunoglobulin-gene rearrengements does not represent overt lymphoid neoplasia. Finally, Bodeutsch et al. [107] described that progression into systemic monoclonal gammopathy or malignant lymphoma exclusively occurred in the subgroup of patients with monotypic plasma cell populations, defined by a /c: X ratio of 1: 3. More recently, the PCR has been successfully used for the rapid assessment of B-cell clonality in B-cell tumors by the amplification of immunoglobulin heavy (IgH) and Hght chain variable-diversity-joining (VDJ) region gene rearrangements [131,195, 196]. PCR offers a more sensitive technique for the detection of monoclonal gene rearrangements than Southern blotting and has shown to detect monoclonality in up to 85% of MALT lymphomas [187, 188]. De Vita et al. [125] investigated the usefulness of PCR in the detection of B-cell clonality in 7 patients with parotid sweUing and suspected malignant lymphoma in the course of SS. The use of PCR to demonstrate clonal immunoglobulin-gene rearrangement has allowed the detection of small monoclonal B-cell pop-
ulations in paraffin-embedded tissue and this has provided a marker with which to follow the progress of a neoplastic B-cell clone in serial archival biopsy specimens. Finally, Speight et al. [189] have used ISH for K and X chain mRNA in labial salivary glands, and suggested that the determination of K :X ratios in labial minor salivary glands may provide important prognostic information. Jordan et al. [35] found a high frequency of light-chain restriction detected by ISH in 13 out of 70 cases of SS (19%) and, of the 13 SS cases showing restriction, 4 (31%) have subsequently developed extrasalivary gland lymphoma. The positive predictive value of this test to identify patients at risk of lymphoma was 31% with a sensitivity of 67% and a specificity of 86%. Results of immunogenotypic analysis always should be interpreted in the context of the clinical situation and in conjunction with the results of morphological examination. On the whole, it appears that small B-cell clonalities (as detected by highly sensitive molecular approaches) in fully benign lesions may be of little clinical importance and, in our opinion, molecular analyses should not be primarily targeted to such biopsy samples. 7.2.2.2. T-cell repertoire Few studies have focused on the T-cell repertoire of patients with SS in the course of B-cell lymphoproliferation [190-192]. T-cell expansion may be in turn sustained by chronic antigenic triggering in the local microenvironment, as demonstrated in the model of H. pj/on-associated B-cell lymphoproliferation in the stomach [78, 193]. Thus, the study of T-cell clonal expansion is of great importance in investigating the stages of B-cell lymphoproliferation (fully benign, pseudolymphoma or definitely malignant) which may be still T-cell- and antigen-dependent. Two different, although complementary, approaches are currently employed for the assessment of TCR expression, i.e., reverse transcriptase (RT)-PCR-based molecular analyses and cytofluorometry and/or immunohistochemistry studies using monoclonal antibodies [194, 195]. Concerning T-cell expansion in autoimmune diseases predisposing to B-cell malignancies, conflicting results have been obtained in RA [196-198] and few studies have focused on SS [199-201]. Methodological differences, as well as the presence of a vast majority of bystander T cells in the tissue lesion (besides the putative pathogenetic initiating T cells), the
69
stage of the disease, the possible role of multiple environmental antigens or autoantigens, and the genetic background of the individual patient, make it understandable why no consensus has been reached regarding restricted or preferential TCR V gene usage [105,197,201,202]. 7.3. Histopathological Diagnosis An important clinical decision involves knowing when to biopsy a major salivary gland to rule out lymphoma and how to interpret the results. Clinical guidelines for the evaluation of patients with parotid gland swelling or lymphadenopathy have been published [203-205]. If malignancy is clinically suggested in a patient with SS, a biopsy must be performed to rule out NHL. Although minor salivary gland biopsy is certainly the most widely used test specific for the salivary component in SS, in patients whose main complaint is persistent parotid gland swelling and in whom lymphoma associated to SS is suggested, parotid biopsy should be considered instead of minor salivary gland biopsy [206-207]. On the other hand, biopsy material may be readily accessible from superficially affected tissues, e.g., lymph nodes, but is more difficult to obtain when deeper structures are involved, particularly the lungs. Precise assessment of hematopathologic specimens depends, in large part, on adequate sampling and proper handling of tissues, both of which may be influenced significantly by clinicians. The largest lymph node or mass lesion generally provides the most useful material for accurate diagnosis and should undergo surgical biopsy. Needle biopsies and aspirates are not recommended for initial diagnosis of malignant lymphomas because these small samples can miss focal lesions, provide little or no evaluable tissue architecture, and limit the number of ancillary studies that can be performed; these specimens can be used for staging purposes and for demonstrating recurrences in patients with documented lymphomas. Strict pathologic criteria remain, at present, the "conditio sine qua non" for the diagnosis of a frank B-cell NHL in SS. The present clinical situation is patently unsatisfactory, since some borderline cases can be rather difficult to define as either benign or lowgrade malignant by histopathologic evaluation, and since the clinical behavior does not always correlate with the histopathological findings. Furthermore, the simple detection of B-cell clonality cannot be used
70
as a criterion for the diagnosis of B-cell malignancy, when a definite diagnosis by histopathologic evaluation alone is problematic. In fact, B-cell clonal expansion is a common event in SS (whereas overt lymphoma develops in a minority of patients [155, 208]. In the salivary glands, features of lymphoma include sheets of monotonous small to medium lymphocytes which have abundant pale cytoplasm and produce a pale staining zone around the epithelial islands. These cells frequently have irregular cleaved nuclei and have been termed centrocyte-like (CCL) cells [205]. However, their appearance is variable and they may also appear monocytoid [119, 210], may resemble typical lymphocytes or may occasionally show plasmacytoid differentiation. Immunoblasts and plasma cells are often scattered throughout the infiltrate and large epithelioid and Reed-Sternberg-like cells may also be seen [157]. An important criterion for diagnosis of lymphoma is the demonstration of K or X light-chain restriction among these cells. Reactive follicles are characteristic and almost always accompany a MALT lymphoma. Occasionally, these may be infiltrated by CCL cells to produce an appearance similar to follicle centre-cell lymphoma [211]. This strong association with reactive follicles lends weight to the concept that the lymphoma is a result of escape of a neoplastic clone of B cells following persistent antigenic stimulation. Indeed, there is evidence that the lymphoma itself may be antigen dependent, since low-grade B-cell gastric lymphomas of MALT have been shown to regress after eradication of H. pylori infection. The distinction between lymphoma versus reactive clonal expansion of lymphoid cells is often extremely difficult, especially since the accepted criteria for diagnosis of NHL do not apply well to lymphomas arising in mucosal tissues such as salivary gland [115]. Lymphomas may remain localized for many years, and low-grade lymphomas may undergo spontaneous remissions in the absence of therapy [8, 9]. The clinical situation in patients with SS, however, seems analogous to the diagnostic problem in patients with benign monoclonal gammopathy, where the circulating paraproteins probably reflect an expanded B-cell population and the patients have an increased risk of developing subsequent lymphoid malignancy [212]. In patients with either SS pseudolymphoma or benign monoclonal gammopathy, laboratory results (includ-
Table 7. Clinical and immunological findings suggesting malignant lymphoproliferation in primary SS (a) Clinical features - Persistent enlargement of parotid glands - Splenomegaly - Adenopathy - Mediastinal or hilar lymph nodes - Lung nodules - Persistent fever (b) Immunological findings - Lowered serum IgM - Negative rheumatoid factor (having been positive) - High serum )S2-microglobulin - Monoclonal gammopathy - Mixed cryoglobulinemia - Cross-reactive idiotypes (17-109, G6, SF18/2)
et al. [25] described that the presence of extraglandular manifestations at the time of SS diagnosis was seen in all the patients who develop lymphoma. Purpura of the lower limbs is an extraglandular manifestation that has often been reported in SS patients with lymphoma [26, 125] and was seen in 3 out of the 5 lymphoma patients many years before the development of lymphoma [25]. On the contrary, Valesini et al. [17] found that patients who developed lymphoma showed a lower prevalence of ocular symptoms, arthralgia and anti-Ro/SSA antibodies. Recently, we have found that patients with a younger onset of SS (before the age of 35) have a higher prevalence of lymphadenopathy, RF and MIgs, as well as a higher incidence of development of lymphoproliferative disease, thus conferring to the age at onset of symptoms an important prognostic value [19]. 8.1.2. Immunological markers
ing DNA analysis) must be taken together with the overall clinical picture to determine when neoplastic transformation (and the need for aggressive therapeutic intervention) has occurred.
8. PROGNOSIS 8.1. Predictive Factors for Lymphoma Development 8.1.1. Clinical features Lymphoma is an extraglandular complication whose early diagnosis in patients with SS has high priority. Knowing that patients with SS are at higher risk of developing lymphoma, several investigators have attempted to establish predictive factors for this progression (Table 7). In 1978, Kassan et al. [15] were the first to show prospectively that lymphadenopathy, splenomegaly, parotid gland enlargement and previous exposure to cytotoxic agents are more often observed in patients with SS that developed lymphoma. Recent data of Valesini et al. [17] confirm that lymphadenopathy and splenomegaly are, as observed by Kassan et al. [15], risk factors of developing NHL, but retrospective studies [25] failed to support these findings. Other risk factors or associated disease phenomena of significance for the development of lymphoma are the presence of multiorgan involvement [15]. Zufferey
In 1971, Cummings et al. [213] suggested that a sharp reduction in hypergammaglobulinemia was frequent just before the development of lymphoma. Other authors described decreases in previously elevated serum IgM and IgM-RF levels [214], but this finding has not been confirmed in some subsequent studies. Some authors also described elevated serum levels of ^2microglobulin [215] and soluble IL-2 receptor [216] as laboratory markers of lymphoma development in SS. In 1986, Walters et al. [97] described that urinary monoclonal free light chains in primary SS may be an aid to the diagnosis of malignant lymphoma, and studies on RF from patients with SS have shown that the presence of CRI 17-109 and G6 are associated with NHL [217]. In a recent study, Tzioufas [218] prospectively investigated whether the presence of mixed monoclonal cryoglobulinemia and the monoclonal RF CRI may serve as predictive factors for lymphoma development in primary SS. In a series of 103 consecutive patients with SS followed for a period of 5 years, 7 patients developed lymphoma. Six of these 7 patients (86%) had cryoglobulinemia before the appearance of lymphoma, as compared to 12/96 (12%) of the remainder. The CRI 17-109 and G6 were also correlated with the development of lymphoma. A step-wise multiple comparison analysis revealed that both of these CRI were linked to the presence of monoclonal mixed cryoglobulinemia. These recent data clearly demonstrate that the determination of cryoglobulins, a simple and easily performed test, can be
71
used as a predictive factor for lymphoma development in SS, and that the CRIs 17-109 and G6 may also be used to predict lymphoma development, especially when the monoclonal component is absent. Finally, the finding of light-chain restriction in lip minor salivary gland biopsy samples is a strong evidence of a monoclonal population of B cells and early evidence of dysregulation of the B-cell system, and seems to predispose to the development of malignant lymphoproliferation. In patients with SS who develop lymphomas, dissemination of malignant cells may result in detectable disease in the minor salivary glands and other tissues and determination of K .X ratios in labial minor salivary glands may thus provide important prognostic information [189]. 8.2. Natural History Few prospective studies have been performed in primary SS and, consequently, the natural history is poorly understood. The evidence obtained in crosssectional studies suggests that multiple etiologic factors are involved and that the pathogenesis of this disorder is a multistage process fundamentally involving immunological mechanisms. Moreover, it is assumed that when progression occurs it is a slow process, clinically characterized by gradually increasing symptoms and signs. Within the immune system, there is a transition from polyclonal to monoclonal lymphocyte proliferation resulting in B-cell lymphoma, but this is applicable to only a few patients.
9. TREATMENT The clinical picture of lymphoma in patients with SS is diverse, and the treatment and prognosis of SS-associated NHL depend on type and stage of lymphoma [83, 219]. Patients with low-grade lymphomas affecting exocrine glands should be completely evaluated for the extent of the disease and, if the disease is localized, a "wait and watch" policy should be undertaken. Chemotherapy is usually efficient and long-term survival is common (survival rate at 5 years in low-grade B-NHL associated with SS generally is >50%) [47]. Some cases of clinically reported pseudolymphomas have been successfully treated with combination therapy including steroids and cyclophosphamide [220]. Surgical resection is
72
essential for accurate histological assessment and staging extranodal NHL, but also may be curative in histologically low-grade and lower stages (I/II) NHL. If the tumor cannot be totally resected, radiation therapy should be considered, although in NHL of the parotid glands, there is no consensus on the use of radiotherapy, because painful oral mucositis and exacerbation of preexisting xerostomia may result [207]. In high-grade and clinically aggressive malignancy, combination chemotherapy and radiation therapy (if necessary) are recommended. Cyclophosphamide, doxorubicin, vincristine, and prednisone (CHOP protocol) is the treatment of choice for patients with advanced intermediate- or high-grade NHL. Other therapies may include bone marrow transplantation, interferons and monoclonal antibody therapy. Site of involvement and histologic type are both important factors in the management of extranodal lymphomas. Extranodal lymphomas of the gastrointestinal tract and nasopharynx are generally more aggressive than those of the lung, orbit, or salivary glands. Although somewhat variable according to series, the majority of salivary gland lymphomas are low grade and localized, have been treated with radiation, and have survivals of 70-80% at 5 years and 40-50% at 10 years.
ACKNOWLEDGEMENTS The authors wish to thank Dr. Alvaro Urbano Ispizua, Department of Hematology, Hospital Clinic, Barcelona, Catalonia, Spain, for his critical review of this chapter.
REFERENCES 1.
2.
3.
Moutsopoulos HM, Chused TM, Mann DL, et al. Sjogren's syndrome (Sicca syndrome): current issues. Ann Int Med 1980;92:212-226. Talal N. Clinical and pathogenetic aspects of Sjogren's syndrome. Semin Clin Immunol 1993;6:1120. Anaya JM, Gutierrez M, Espinosa LR. Sindrome de Sjogren primario. Manifestaciones clinicas ex-
4.
5.
6.
7.
8.
9.
10.
11. 12.
13.
14.
15.
16.
17.
18.
traglandulares. Rev Esp Reumatol 1994;21:337342. Ramos M, Cervera R, Garcia-Carrasco M, et al. Sindrome de Sjogren primario: caracteiisticas clinicas e inmunologicas en una serie de 80 pacientes. Med Clin (Bare) 1997;108:652-657. Moutsopoulos HM. Sjogren's syndrome: autoimmune epithelitis. Clin Immunol Immunopathol 1994;72:162-165. Rothman S, Bloch M, Hauser FV. Sjogren's syndrome associated with lymphoblastoma and hypersplenism. Arch Dermatol e Syph 1951;63:642. Talal N, Bunim JJ. Development of malignant lymphoma in the course of Sjogren's syndrome. Am J Med 1964;36:529-540. Hornbaker JH Jr, Foster EA, Williams GS, Davis JS. Sjogren's syndrome and nodular reticulum cell sarcoma. Arch Int Med 1966; 118:449452. Miller DG. The association of immune disease and malignant lymphoma. Ann Int Med 1967;66:507521. Anderson LG, Talal N. The spectrum of benign to malignant lymphoproHferation in Sjogren's syndrome. Clin Exp Immunol 1972;10:199-221. Hughes GR, Whaley K. Sjogren's syndrome. Br Med J 1972;4:533-536. Perez Pe:a F, Gonzalez AA, Candel Monserrate I. Relacion existente entre el sindrome de Sjogren y los linfomas mahgnos. Rev Clin Esp 1974; 133:465470. Faguet GB, Webb HH, Agee JF, Ricks WB, Sharbaugh AH Immunologically diagnosed malignancy in Sjogren's pseudolymphoma. Am J Med 1978;65:424-429. Zulman J, Jaffe R, Talal N Evidence that the malignant lymphoma of Sjogren's syndrome is a monoclonal B-cell neoplasm. N Engl J Med 1978;299:1215-1220. Kassan SS, Thomas TL, Moutsopoulos HM, et al. Increased risk of lymphoma in sicca syndrome. Ann Int Med 1978;89:888-892. Kruize AA, Hene RJ, Van der Heide A, et al. Longterm follow-up of patients with Sjogren's syndrome. Arthrit Rheum 1996;39:297-303. Valesini G, Priori R, Bavoillot D, et al. Differential risk of non-Hodgkin's lymphoma in Italian patients with primary Sjogren's syndrome. J Rheumatol 1997;24:2376-380. Kauppi M, Pukkala E, Isomaki H. Elevated incidence of hematologic malignancies in patients with Sjogren's syndrome compared with patients with rheumatoid arthritis. Cancer Causes Control 1997;8:201-204.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28. 29.
30.
31.
32.
33.
Ramos-Casals M, Cervera R, Font J, et al. Young onset of primary Sjogren's syndrome: clinical and immunological characteristic. Lupus 1998;7:202206. Bloch KJ, Buchanan WW, Wohl MJ, Bunim JJ. Sjogren's syndrome: a clinical, pathological and serological study of sixty-two cases. Medicine 1965;44:187-231. McCurley TL, Collins RD, Ball E, Collins RD. Nodal and extranodal lymphoproliferative disorders in Sjogren's syndrome: a clinical and immunopathologic study. Hum Pathol 1990;21:482-492. Kelly CA, Foster H, Pal B, et al. Primary Sjogren's syndrome in north east England. A longitudinal study. Br J Rheumatol 1991;30:437-442. Pariente D, Anaya JM, Combe B, et al. NonHodgkin's lymphoma associated with primary Sjogren's syndrome. Eur J Med 1992;l(6):337-342. Pavlidis NA, Drosos AA, Papadimitriou C, Talal N, Moutsopoulos HM. Lymphoma in Sjogren's syndrome. Med Pediatr Oncol 1992;20:279-283. Zufferey P, Meyer OC, Grossin M, Kahn MR Primary Sjogren's syndrome (SS) and malignant lymphoma. A retrospective cohort study of 55 patients with SS. Scand J Rheumatol 1995;24:342-345. Hernandez JA, Olive A, Ribera JM, Tena X, Cuxart A, Feliu E. Probability of the development of nonHodgkin's lymphoma in primary Sjogren's syndrome. Scand J Rheumatol 1996;25:396-397. Tzioufas AG, Boumba DS, Skopouli FN, Moutsopoulos HM. Mixed monoclonal cryoglobulinemia and monoclonal rheumatoid factor cross-reactive idiotypes as predictive factors for the development of lymphoma in primary Sjogren's syndrome. Arthrit Rheum 1996;39:767-772. Shearn M. Sjogren's syndrome. Philadelphia: WB Saunders, 1971. Whaley K, Webb J, McAvoy BA, et al. Sjogren's syndrome. II. Clinical associations and immunological phenomena. Quart J Med 1973;42:513-548. Dolcetti R, Boiocchi M. Cellular and molecular bases of B-cell clonal expansions. Clin Exp Rheumatol 1996;14(suppl 14):S3-S13. Harris NL, Jaffe ES, Stein H, et al. A revised European-American classification of lymphoid neoplasms: A proposal from the international lymphoma study group. Blood 1994;84:1361-1392. Graninger WB, Seton B, Boutain B, et al. Expression of Bcl-2 and Bcl-2-Ig fusion transcripts in normal and neoplastic cells. J Clin Invest 1987;80:1512. Fox RI, Robinson C, Pisa P, Pisa E. Detection of bcl-2t (14,18) translocations in Sjogren's syndrome lymphoma. Clin Exp Rheumatol 1991;9:333 (abstract).
73
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
74
Pisa EK, Pisa P, Kang HI, Fox RI High frequency of t(14;18) translocation in salivary gland lymphomas from Sjogren's syndrome patients. J Exp Med 1991;174:1245-1250. Jordan RC, Pringle JH, Speight PM High frequency of light chain restriction in labial gland biopsies of Sjogren's syndrome detected by in situ hybridization. J Pathol 1995;177(l):35-40. Bosch F, Jares P, Campo E, et al. PRAD-1/cyclin Dl gene overexpression in chronic lymphoproliferative disorders: a high specific marker of mantle cell lymphoma. Blood 1994;84:2726-2732. Dielermann J, Pittaluga S, Wlodarska I, et al. Marginal zone B-cell lymphomas of different sites share similar cytogenetic and morphologic features. Blood 1996;87:299. Du M, Pengh H, Singh N, Isaacson PG, Pan L. The accumulation of p53 abnormalities is associated with progression of mucosa-associated lymphoid tissue lymphoma. Blood 1995;86:4587. Guo K, Major G, Foster H, et al. Defective repair of 06-methylguanine-DNA in primary Sjogren's syndrome patients predisposed to lymphoma. Ann Rheum Dis 1995;54:229-232. Kirschner H, Tosato G, Blaese RM, et al. Polyclonal immunoglobulin secretion by human B lymphocytes exposed to Epstein-Barr virus in vitro. J Immunol 1979;122:1310-1313. Morgan DG, Niederman JC, Miller G, et al. Site of Epstein-Barr virus replication in the oropharynx. Lancet 1979;1:1154-1157. Mariette X, Gozlan J, Clerc D, et al. Detection of Epstein-Barr virus DNA by in situ hybridization and polymerase chain reaction in salivary gland biopsy specimens from patients with Sjogren's syndrome. AmJMedl991;90:286. Fox RI, Chen P, Carson DA, Fong S. Expression of a cross-reactive idiotype on rheumatoid factor in patients with Sjogren's syndrome. J Immunol 1986;136:477-483. Fox RI, Scott S, Houghton R, et al. Synthetic peptide derived from the Epstein-Barr virus encoded early diffuse antigen (EA-D) reactive with human antibodies. J Clin Lab Anal 1987;1:140-145. Fox RI, Saito I, Chan EK, et al. Viral genomes in lymphomas of patients with Sjogren's syndrome. J Autoimmun 1989;2:449-455. Jeffers M, Crilly A, Kerr T, Richmond J, Madhok R. Non-Hodgkin's lymphomas complicating Sjogren's syndrome: can Epstein Barr virus be implicated? Scand J Rheumatol 1997;26:180-183. Royer B, Cazals-Hatem D, Sibilia J, et al. Lymphomas in patients with Sjogren's syndrome are marginal zone B-cell neoplasms, arise in diverse ex-
48.
49.
50.
51.
52.
53.
54.
55.
56.
57.
58.
59. 60.
61.
tranodal and nodal sites, and are not associated with viruses. Blood 1997;90:766-775. Fox RI, Saito I, Chan EK, Josephs S, Salahuddin SZ, Ahlashi DV, Staal FW, Gallo R, Pei-Ping H, Le CS. Viral genomes in lymphomas of patients with Sjogren's syndrome. J Autoimmun 1989;2:449455. Freimark B, Fantozzi R, Bone R, Bordin G, Fox R. Detection of clonally expanded salivary gland lymphocytes in Sjogren's syndrome. Arthrit Rheum 1989;32:859-869. Miyasaka N, Saito I, Haruta J. Possible involvement of Epstein-Barr virus in the pathogenesis of Sjogren's syndrome. Clin Immunol Immunopathol 1994;72:166-170. Saito I, Nishimura S, Kudo I, Fox RI, Moro I. Detection of Epstein-Barr virus and human herpes virus type 6 in saliva from patients with lymphoproliferative diseases by the polymerase chain reaction. Arch Oral Biol 1991;36:779-784. Jarrett RE, Gledhill S, Qureshi F, et al. Identification of human herpesvirus 6-specific DNA sequences in two patients with non-Hodgkin's lymphoma. Leukemia 1988;2:496-502. Fox RI, Luppi M, Kang HI, Ablshi D, Josephs S. Detection of high levels of human herpes virus-6 DNA in a lymphoma of a patient with Sjogren's syndrome. J Rheumatol 1993;20(4):764-765. Haddad J, Deny P, Munz-Gotheil C, et al. Lymphocytic sialadenitis of Sjogren's Syndrome associated with chronic hepatitis C virus liver disease. Lancet 1992;339:321-323. Garcia-Carrasco M, Ramos M, Cervera R, et al. Hepatitis C virus infection in "primary" Sjogren's syndrome: prevalence and clinical significance in a series of 90 patients. Ann Rheum Dis 1997;56:1-3. Jorgensen C, Legouffe MC, Perney P, et al. Sicca syndrome associated with hepatitis C virus infection. Arthrit Rheum 1996;39:1166-1171. Koike K, Moriya K, Ishibashi K, et al. Sialadenitis histologically resembUng Sjogren syndrome in mice transgenic for hepatitis C virus envelope genes. Proc Natl Acad Sci USA 1997;94:233-236. Koike K, Moriya K, Ishibashi K, et al. Expression of hepatitis C virus envelope proteins in transgenic mice. J Gen Virol 1995;76:3031-3038. Heimann R. Cirrhosis and lymphoproliferative disorders. Lancet 1971;ii:101. Ferri C, La Civita L, Caracciolo F, Zignego AL. Non-Hodgkin's lymphoma: a possible role of hepatitis C virus infection. JAMA 1994;272:355-356. Ferri C, Caracciolo F, Zignego AL, et al. Hepatitis C virus infection in patients with non-Hodgkin lymphoma. Br J Haematol 1994;88:392-394.
62.
63.
64.
65.
66.
67.
68. 69.
70.
71.
72.
73.
74.
75. 76.
77.
Pozzato G, Mazzaro C, Santini GF, Burrone O. Nepatitis C virus and non-Hodgkin's lymphoma. Leuk Lymphoma 1996;22:53. Silvestri F, Pipan C, Barillari G, et al. Prevalence of hepatitis C virus infection in patients with lymphoproliferative disorders. Blood 1996; 87: 4296. Franzin F, Efremov DG, Pozzato G, et al. Clonal Bcell expansions in peripheral blood of HCV-infected patients. Br J Haematol 1995;90:548-552. De Vita S, Sansonno D, Dolcetti R, et al. Hepatitis C virus infection within a malignant lymphoma lesion in the course of type II mixed cryoglobulinemia. Blood 1995;86:1887. Sansonno D, De Vita S, Cornacchiulo V, et al. Detection and distribution of hepatitis C virus-related proteins in lymph nodes of patients with type II mixed cryoglobulinemia and neoplastic or non-neoplastic lymphoproliferation. Blood 1996;88:4638. De Vita S, Sacco C, Sansonno D, et al. Characterization of overt B-cell lymphomas in patients with hepatitis C virus infection. Blood 1997;90:776-782. Osborne BM, Butler JJ, Guarda LA. Primary lymphoma of the livar. Cancer 1985;56:2902. Aozasa K, Mishima K, Ohsawa M. Primary malignant lymphoma of the liver. Leuk Lymphoma 1993;10:353. Thieblemont C, Berger F, Coiffier B. Mucosaassociated lymphoid tissue lymphomas. Curr Opin Oncol 1995;7:415-420. Sansonno D, Dammacco F. Hepatitis C virus clOO antigen in liver tissue from patients with acute and chronic infection. Hepatology 1993; 18:240. Sansonno D, Cornacchiulo V, lacobelli AR, et al. Localization of hepatitis C virus antigens in liver and skin tissues of chronic hepatitis C virus-infected patients with mixed cryoglobulinemia. Hepatology 1995;21:305. Ferri C, Monti M, La Civita L, et al. Infection of peripheral blood mononuclear cells by hepatitis C virus in mixed cryoglobulinemia. Blood 1993;82:37013704. Cumber S, Chopra S. Hepatitis C: a multifaceted disease. Review of extrahepatic manifestations. Ann Int Med 1995;123:615-620. Martin P. Hepatitis C: more than just a liver disease. Gastroenterology 1993;104:320-323. Wotherspoon AC, Doglioni C, Diss TC, et al. Regression of primary low grade B-cell gastric lymphoma of mucosa-associated lymphoid tissue type after erradication of Helicobacter pylori. Lancet 1993;342:575-577. Stolte M, Eidt S. Healing gastric MALT lymphoma by erradicating H. Pylori?. Lancet 1993;342:568.
78.
79.
80.
81. 82.
83.
84.
85.
86.
87.
88.
89.
90.
91.
Bayerdorffer E, Neubauer A, Rudolph B, et al. Regression of primary gastric lymphoma of mucosaassociated lymphoid tissue type after cure of Helicobacter pylori infection. Lancet 1995;345:15911594. De Vita S, Ferraccioli G, Avellini C, et al. Widespread clonal B-cell disorder in Sjogren's syndrome predisposing to Helicobacter pylori-related gastric lymphoma. Gastroenterology 1996;110:1969-1974. Ferraccioli GF, Sorrentino D, De Vita S, et al. B cell clonality in gastric lymphoid tissues of patients with Sjogren's syndrome. Ann Rheum Dis 1996;55:311316. Al-Saleem T. Gastric lymphomas (letter reply). Lancet 1993 ;342:1184. Sugai S, Saito I, Masaki Y, et al. Rearrangement of the rheumatoid factor-related germline gene Vg and bcl-2 expression in lymphoproliferative disorders in patients with Sjogren's syndrome. CHn Immunol Immunopathol 1994;72:181-186. Anaya JM, McGuff HS, Banks PM, Talal N. Clinicopathological factors relating malignant lymphoma with Sjogren's syndrome. Semin Arthrit Rheum 1996;25:337-346. Takeshita S, Sugai S. Sjogren's syndrome as a lymphoaggressive disorder; bcl-2 expression in lymphocytes infiltrated in salivary glands. Nippon Rinsho 1995;53:2440-2445. Hsu SM, Waldron JW Jr, Hsu PL, Hough AG. Cytokines in malignant lymphomas: review and prospective evaluation. Hum Pathol 1993;24:10401057. De Vita S, Dolcetti R, FerraccioH G, et al. Local cytokine expression in the progression toward B cell malignancy in Sjogren's syndrome. J Rheumatol 1995;22:1674-1680. Carson DA, Chen PO, Fox RI, et al. Rheumatoid factor and immune networks. Annu Rev Immunol 1987;5:109-126. Hayakawa K, Hardy RR, Honda M, et al. Ly-1 B cells: functionally distinct lymphocytes that secrete IgM autoantibodies. Proc Natl Acad Sci USA 1984;81:2494-2498. Casali P, Burastero SE, Nakamura M, et al. Human lymphocytes making rheumatoid factor and antibody to ssDNA belong to Leu-l-i- B cell subset. Science 1987;236:77-80. Fishleder A, Tubbs R, Hesse B, Levine H. Uniform detection of immunoglobulin-gene rearrangement in benign lymphoepithelial lesions. N Engl J Med 1987;316:1118-1121. Caligaris-Cappio F, Janossy G. Surface markers in chronic lymphoid leukemias of B cell type. Semin Hematol 1985;22:1-12.
75
92.
93.
94.
95.
96.
97.
98.
99.
100.
101.
102.
103.
104.
76
Zeher M, Suranyi P, Szegedi G. CD5 positivity on peripheral blood B lymphocytes in patients with primary Sjogren's syndrome. AUergol Immunopathol (Madr) 1990;18:75-78. Youinou P, MacKenzie L, Masson GL, et al. CD5expressing B-lymphocytes in the blood and salivary glands of patients with primary Sjogren's syndrome. J Autoimmun 1988;1:185-194. Dauphinee M, Tovar Z, Talal N. B cells expressing CD5 are increased in Sjogren's syndrome. Arthrit Rheum 1988;31:642-647. Deacon EM, Mathews JB, Potts JC, et al. Expression of RF-associated cross-reactive idiotypes by glandular B-cells in Sjogren's syndrome. Clin Exp Immunol 1991;83:280-285. Vivancos J, Bosch X, Grau JM, Coca A, Font J. Development of Hodgkin's disease in the course of primary Sjogren's syndrome. Br J Rheumatol 1992;31:561-563. Walters MT, Stevenson FK, Herbert A, Cawley MI, Smith JL. Urinary monoclonal free light chains in primary Sjogren's syndrome: an aid to the diagnosis of malignant lymphoma. Ann Rheum Dis 1986;45:210-219. Jubert C, Cosnes A, Clerici T, Gaulard P, Andre P, Revuz J, Bagot M. Sjogren's syndrome and cutaneous B cell lymphoma revealed by anetoderma. Arthrit Rheum 1993;36:133-134. Dauphinee M, Tovar Z, Ballester A, et al. The expression and function of CD3 and CD5 in patients with primary Sjogren's syndrome. Arthrit Rheum 1989;32:420-429. Adamson TC, Fox FI, Frisman DM, Howell FV. Immunohistologic analysis of lymphoid infiltrates in primary Sjogren's syndrome using monoclonal antibodies. J Immunol 1983;130-203. Pablos JL, Carreira PE, Morillas L, Montalvo G, Ballestin C, Gomez-Reino JJ. Clonally expanded lymphocytes in the minor salivary glands of Sjogren's syndrome patients without lymphoproliferative disease. Arthrit Rheum 1994;37:1441-1444. Fauci AS, Moutsopoulos HM. Polyclonally triggered B-cells in the peripheral blood and bone marrow of normal individuals and in patients with systemic lupus erythematosus and primary Sjogren's syndrome. Arthrit Rheum 1981;24:577-583. Lane HC, CoUihan TR, Jaffe ES, Fauci AS, Moutsopoulos HM. Presence of intracytoplasmic IgG in the lymphocytic infiltrates of the minor salivary glands of patients with primary Sjogren's syndrome. Clin Exp Rheumatol 1983;1:237-239. Moutsopoulos HM, Tzioufas AG, Bai MK, et al. Association of IgMk monoclonicity in patients with Sjogren's syndrome with an increased proportion of
105. 106.
107.
108.
109.
110.
111.
112.
113.
114.
115.
116.
117.
118.
k positive plasma cells infiltrating the labial minor salivary glands. Ann Rheum Dis 1990;49:929-931. Fox RI, Kang HI. Pathogenesis of Sjogren's syndrome. Rheum Dis Clin N Am 1992;18:517-538. Schmidt V, Helbron D, Lennert K. Development of malignant lymphoma in myoepithelial sialadenitis (Sjogren" syndrome). Pathol Anat 1982;395:1143. Bodeutsch C, De Wilde PCM, Kater L, et al. Monotypic plasma cells in labial salivary glands of patients with Sjogren's syndrome: prognosticator for systemic lymphoproliferative disease. J Clin Pathol 1993;46:123-128. De Vita S, Boiocchi M, Sorrentino D, et al. Characterization of prelymphomatous stages of B cell lymphoproliferation in Sjogren's syndrome. Arthrit Rheum 1997;40:318-331. Godwin JT. Benign lymphoepithelial lesion of the parotid gland (adenolymphoma, chronic inflammation, lymphoepithelioma, Mikuhcz's disease): report of 11 cases. Cancer 1952;5:1089-1103. Talal N, Sokoloff L, Barth WF Extrasalivary lymphoid abnormalities in Sjogren's syndrome (reticulum cell sarcoma, "pseudolymphoma", macroglobulinemia). Am J Med 1967;43:50-65. DeAlmeida PC, Harris NI, Bhan AK. Characterization of immature sinus histiocytes (monocytoid cells) and reactive lymph nodes by use of monoclonal antibodies. Hum Pathol 1984;15:330-335. Stein H, Lennert K, Mason DY, et al. Immature sinus histiocytes. Their identification as a novel B-cell population. Am J Pathol 1984;117:44-52. Van der Oord JJ, De Wolf-Peeters C, De Vos R, et al. Immature sinus histiocytosis: light- and electronmicroscopic features, immunologic phenotype, and relationship with marginal zone lymphocytes. Am J Pathol 1985;118:266-277. Isaacson PG, Wright DH. Extranodal malignant lymphoma arising from mucosa-associated lymphoid tissue. Cancer 1984;53:2515-2524. Isaacson PG, Spencer J. MaHgnant lymphoma of mucossa-associated lymphoid tissue. Histopathologyl987;l 1:445-^62. Isaacson PG, Wright DH. Malignant lymphoma of mucossa-associated lymphoid tissue: a distinctive B cell lymphoma. Cancer 1983;52:1410-1416. Sheibani K, Burke JS, Swartz WG, Nademanee A, Winberg CD. Monocytoid B-cell lymphoma. Clinicopathologic study of 21 cases of a unique type of low-grade lymphoma. Cancer 1988;62:1531-1538. Cogliatti SB, Lennert K, Hansmann ML, et al. Monocytoid B cell lymphoma: clinical and prognostic features of 21 patients. J Clin Pathol 1990;43:619-625.
119.
120.
121.
122.
123.
124.
125.
126.
127.
128.
129.
130.
131.
132.
Shin SS, Sheibani K, Fishleder A, et al. Monocytoid B-cell lymphoma in patients with Sjogren's syndrome: a clinicopathologic study of 13 patients. Hum Pathol 1991;22:422-430. Burke JS, Sheibani K. Hairy cells and monocytoid B lymphocytes: are they related?. Leukemia 1987;1:298-300. Traweek ST, Sheibani K, Winberg CD, et al. Monocytoid B-cell lymphoma: its evolution and relationship to other low-grade B-cell neoplasms. Blood 1989;73:573-578. Sheibani K, Koo C, Bailey A, et al. Progression of monocytoid B-cell lymphoma to large cell lymphoma: report of six cases. Lab Invest 1990;62:92 (abstract). Ortiz-Hidalgo C, Wright DH. The morphological spectrum of monocytoid B-cell lymphoma and its relationship to lymphomas of mucosa-associated lymphoid tissue. Histopathology 1992;21:555-561. Hansen LA, Prakash UB, Colby TV. Pulmonary lymphoma in Sjogren's syndrome. Mayo Clin Proc 1989;64:920-931. De Vita S, Ferraccioli G, De Re V, et al. The polymerase chain reaction detects B cell clonalities in patients with Sjogren's syndrome and suspected malignant lymphoma. J Rheumatol 1994 Aug;21(8): 1497-1501. Isaacson P, Spencer J. Autoimmunity and malignancy. In: Isenberg DA, Horsfall AC, eds. Autoimmune Disease. Focus on Sjogren's Syndrome. Oxford, England, Bios Scientific Publishers 1994, pp189-204. Wilke WS, Tubbs RR, Bukowski RM, et al. T cell lymphoma occurring in Sjogren's syndrome. Arthrit Rheum 1984;27:951-955. Schuurman HJ, Gooszen HC, Tan IW, Kluin PM, Wagenaar SS, Van Unnik JA. Low-grade lymphoma of immature T-cell phenotype in a case of lymphocytic interstitial pneumonia and Sjogren's syndrome. Histopathology 1987; 11:1193-1204. Isenberg DA, Griffiths MH, Rustin M, Webb FWS, Souhami RL. T-cell lymphoma in a patient with longstanding rheumatoid arthritis and Sjogren's syndrome. Arthrit Rheum 1987;30:115-117. Rustin MH, Isenberg DA, Griffiths MH, Gilkes JJ. Sjogren's syndrome and pleomorphic T-cell lymphoma presenting with skin involvement. J R Soc Med 1988;81:47-49. Fredenrich A, Fuzibet JG, Lasserre M, et al. Non-Hodgkin's malignant T-cell lymphoma in Gougerot-Sjogren syndrome. Ann Med Interne (Paris) 1989;140:428. Van der Valk PG, Hollema H, Van Voorst Vander PC, Brinker MG, Poppema S. Sjogren's syndrome
133.
134.
135.
136.
137.
138.
139.
140.
141.
142.
143.
144.
145.
with specific cutaneous manifestations and multifocal clonal T-cell populations progressing to a cutaneous pleomorphic T-cell lymphoma. Am J Clin Pathol 1989;92:357-361. Chevalier X, Gaulard P, Voisin MC, Martigny J, Farcet JP, Larget-Piet B. Peripheral T cell lymphoma with Sjogren's syndrome: a report with immunologic and genotypic studies. J Rheumatol 1991; 18:17441746. Dubin DB, Hurowitz JC, Brettler D, et al. Adnexotropic T-cell lymphoma presenting with generalized anhidrosis, progressive alopecia, pruritus, and Sjogren's syndrome. J Am Acad Dermatol 1998;38:493^97. Ros S, Gomez C, Nolla JM, Roig-Escofet D. Linfoma pulmonar angiocentrico de celulas T asociado a sindrome de Sjogren primario. Med Clin (Bare) 1996;107:117-118. Martin-Santos JM, Carretero L, Armentia A, Alonso E, Gil I. Hodgkin's disease occurring in primary Sjogren's syndrome. Ann Rheum Dis 1990;49:646647. Nagai M, Sasaki K, Tokuda M, Tasaka T, Goto T, Ohnishi M, Murata M, Ikeda K, Kurata N, Takahara J. Hodgkin's disease and Sjogren's syndrome. Eur J Haematol 1993;50(3): 180-182. Caches F, Alvarez M, Couret B, Mazerolles C, Delsol G, Arlet-Suau E. Hodgkin disease with cellular markers of Epstein-Barr virus complicating the course of Gougerot-Sjogren syndrome. Rev Med Interne 1997;18:79-80. lijima M, Suzuki N, Arata M, et al. A case of Sjogren's syndrome associated with extramedullary myeloma. Jpn J Med 1989;78:618. Shearn KA, Moutsopoulos HM, Sawada S, Gak C. Sjogren's syndrome with light chain myeloma. West J Med 1975;123:496-497. Casaril M, Venturini L, Pecci R, et al. A case of parotideal myeloma in Sjogren's syndrome. Haematologica 1987;72:167-170. Rodriguez-Cuartero A, Salas-Galan A Sjogren's syndrome and multiple myeloma. Eur J Cancer 1997;33:167-168. Bourbigot B, Potel G, Barrier J, Dubigeon P, Hauptmann G, Guenel J. Association of partial genetic C4 deficiency, Sjogren's syndrome and myeloma. PresseMedl983;12:3006. Villanueva JL, Rivera J, Ogea JL, et al. Evolution of extramedullary plasmacytoma in a patient with primary Sjogren's syndrome. Arthrit Rheum 1990;33:150-151. Ota T, Wake A, Eto S, Kobayashi T. Sjogren's syndrome terminating with multiple myeloma. Scand J Rheumatol 1995;24:316-318.
77
146.
147.
148.
149.
150.
151.
152.
153.
154.
155.
156.
157.
158.
78
Wakita H, Asai T, Nakamura M, et al. Development of acute myelocytic leukemia in the course of Sjogren's syndrome. Rinsho Ketsueki 1989;30:5660. Bignon YJ, Janin-Mercier A, Dubost JJ, et al. Angioimmunoblastic lymphadenopathy with dysproteinaemia (AILD) and sicca syndrome. Ann Rheum Dis 1986;45:519-522. Kingsmore SF, Silva OE, Hall BD, Sheldon EA, Cripe LD, St Clair EW. Presentation of multicentric Castleman's disease with sicca syndrome, cardiomyopathy, palmar and plantar rash. J Rheumatol 1993;20:1588-1591. Mariette X, Koeger AC, Alcaix D, et al. Primary Sjogren's syndrome complicated by gastric lymphoma. Study of Epstein-Barr viral DNA in the tumor. Ann Med Interne (Paris) 1989;140:62-64. Cacoub P, Ginsburg C, Tazi Z, et al. Sjogren's syndrome with acute renal failure caused by renal pseudolymphoma. Am J Kidney Dis 1996;28:762766. Takagi N, Nakamura S, Yamamoto K, et al. Malignant lymphoma of mucosa-associated lymphoid tissue arising in the thymus of a patient with Sjogren's syndrome. A morphologic, phenotypic, and genotypic study. Cancer 1992;69:1347-1355. Chazerain P, Meyer O, Kaplan G, et al. Lymphomas of the ocular adnexa in Gougerot-Sjogren syndrome. Apropos of 4 cases. Ann Med Interne (Paris) 1995;146:223-225. Riches PG. Immunological investigation and identification of paraprotein. In: Delamore IW, ed. Multiple Myeloma and Other Paraproteinemias. Edinburgh, Melbourne, New York: Churchill Livingstone, 1986;56-74. Moutsopoulos HM, Steinberg AD, Fauci AS, Lane HC, Papadopoulos NM. High incidence of free monoclonal light chains in the sera of patients with Sjogren's syndrome. J Immunol 1983;130:2263-2265. Tzioufas AG, Moutsopoulos HM, Talal N. Lymphoid malignancy and monoclonal proteins. In: Talal N, Moutsopoulos HM, Kassan SS, eds. Sjogren's Syndrome. Clinical and Immunological Aspects. BerUn: Springer-Verlag, 1987:129-136. Bahler DW, Swerdlow SH. Clonal salivary gland infiltrates associated with myoepithelial sialadenitis (Sjogren's syndrome) begin as nonmalignant antigen-selected expansions. Blood 1998;91:18641872. Schmid U, Helbron D, Lennert K. Primary malignant lymphomas localized in salivary glands. Histopathology 1982;6:673-687. Falzon M, Isaacson PG. The natural history of benign lymphoepithelial lesion of the salivary gland in
159.
160.
161.
162.
163.
164.
165.
166.
167.
168.
169.
170.
171.
which there is a monoclonal population of B cells. Am J Surg Pathol 1991;15:59-65. Fox RI, Howell FV, Bone RC, Michelson PE. Primary Sjogren's syndrome: clinical and immunopathologic features. Semin Arthrit Rheum 1984;14:77. Kunkel HG, Agnello V, Joslin EG, et al. Cross idiotypic specificity among monoclonal IgM proteins with anti-gamma-globulin activity. J Exp Med 1973;137:331-337. Agnello V, Arbetter A, DeKasep GI, et al. Evidence for a subset of rheumatoid factor that cross-react with DNS-histone and have a distinct cross-idiotype. J Exp Med 1980;151:1514-1519. Carson DA, Fong SA. A common idiotype on human rheumatoid factors identified by a hybridoma antibody. Mol Immunol 1983;20:1081-1086. Schrohenloher RE, Koopman WJ. An idiotype common to rheumatoid factors from patients with rheumatoid arthritis identified by a monoclonal antibody. Arthrit Rheum 1986;29:S28. Mageed RA, Dearlove M, Goodall DM, Jefferis R. Immunogenic and antigenic epitopes of immunoglobulins. XVII. Monoclonal anti-idiotypes to the heavy chain of human rheumatoid factors. Rheumatol Int 1986;6:179-185. Kipps TJ, Tomhave E, Chen PP, Fox RI. Molecular characterization of a major auto-antibody associated cross-reactive idiotype in Sjogren's syndrome. J Immunol 1989;142:4261^268. Yancopoulos G, Desiderio S, Paskind M, et al. Preferential utilization of the most Jh-proximal Vh gene segments in pre-B cell lines. Nature 1984;311:727. McKean D, Huppi K, Bell L, et al. Generation of antibody diversity in the immune response of BALB/c mice to influenza virus hemagglutinin. Proc Natl Acad Sci USA 1984;81:3180. Berard C, Greene M, Jaffe E, Magrath I, Ziegler J. A multidiscipHnary qpproach to non-Hodgkin's lymphoma: NIH conference. Ann Int Med 1981;94:218. Waldman T, Johnson J, Talal N. Hypogammaglobulinemia associated with accelerated catabolis of IgG secondary to interaction with an IgG reactive monoclonal IgM. J Clin Invest 1971;50:951. Schrohenloher RE, Koopman WJ, Moldoveanu Z, Solomon A. Activity of rheumatoid factors of different molecular sizes: comparison of autologous monomeric and polymeric monoclonal IgA rheumatoid factors. J Immunol 1985; 134:1469. Shokri F, Magged RA, Maziak R, et al. Lymphoproliferation in primary Sjogren's syndrome. Evidence of selective expansion of B cell subset characterized by the expression of crossreactive idiotypes. Arthrit Rheum 1993;36:1128-1136.
172.
173.
174.
175. 176.
177.
178.
179.
180.
181.
182.
183.
184.
185.
Brouet JC, Clauvel JP, Danon F, Klein M, Seligmann M. Biological and clinical significance of cryoglobulins: a report of 86 cases. Am J Med 1974;57:775-788. Gorevic PD, Kassab HJ, Levo Y, et al. Mixed cryoglobulinemia: clinical aspects and long-term follow-up of 40 patients. Am J Med 1980;69:287308. Bett DCG. Gougerot's maladie trysimptomatique avec cryoglobulinemia. Proc R Soc Med 1958;51:325. Vitali C, Tavoni A, Bombardieri S. La sindrome di Sjogren primitiva. Reumatismo 1987;39:69-64. Invemizzi F, Galli M, Serino G, et al. Secondary and essential cryoglobulinemias. Frequency, nosological classification and long-term follow-up. Acta Haematol 1983;70:73-82. Katsikis P, Youinou P, Galanopoulou V, Papadopoulos NM, Tzioufas AG, Moutsopoulos HM. Monoclonal process in primary Sjogren's syndrome and cross-reactive idiotype associated with rheumatoid factor. Clin Exp Immunol 1990;48:167-185. Shokri F, Mageed RA, Kitas GD, Katsikis P, Moutsopoulos HM, Jefferis R. Quantitation of cross reactive idiotype positive rheumatoid factor produced in autoimmune rheumatic diseases: an indicator of clonality and B-cell proliferative mechanisms. Clin Exp Immunol 1991;85:20-27. Ramos-Casals M, Cervera R, Yagiie J, et al. Cryoglobulinemia in primary SS: prevalence and clinical characteristics in a series of 115 patients. Semin Arthrit Rheum 1998;28:200-205. Tzioufas AG, Manoussakis MN, Costello R, et al. Cryoglobulinemia in autoimmune rheumatic disease: evidence for circulating monoclonal cryoglobulins in patients with primary Sjogren's syndrome. Arthrit Rheum 1986;29:1098-1104. Waldmann TA. Rearrangement of immunoglobulin and T-cell receptor genes in human lymphoproliferative disorders. Adv Immunol 1987;40:247-251. Borowitz MJ. Immunophenotyping of acute leukemia by flow cytometry. Clin Immunol Newsletter 1993;13:53-60. Wormsly SB, Varki NM. Immunophenotypic characterization of chronic lymphoproliferative disorders. Chn Immunol Nesletter 1993;13:60-63. Carbone A, De Re V, Gloghini A, et al. Immunoglobulin and T cell receptor gene rearrangements and in situ immunophenotyping in lymphoproliferative disorders. Virchows Arch A Pathol Anat Histopathol 1989;414:223-230. Weiss LM, Spagnolo DV. Assesment of clonality in lymphoid proliferations. Am J Pathol 1993;142:1679-1682.
186.
187.
188.
189.
190.
191.
192.
193.
194.
195.
196.
197. 198.
Trainor KJ, Brisco MJ, Story CJ, Morley AA. Monoclonality in B-lymphoproliferative disorders detected at the DNA level. Blood 1990;75:22202222. Diss TC, Peng H, Wotherspoon AC, Isaacson PG, Pan L. Detection of monoclonality in low-grade Bcell lymphomas using the polymerase chain reaction is dependent on primer selection and lymphoma type. J Pathol 1992;169:291-295. Diss TC, Peng H, Wotherspoon AC, Pan L, Speight PM, Isaacson PG. A single neoplastic clone in sequential biopsy specimens from apatient with primary gastric-mucosa-associated lymphoid-tissue lymphoma and Sjogren's syndrome. N Engl J Med 1993;329:172-175. Speight PM, Jordan R, Colloby P, Nandha H, Pringle JH. Early detection of lymphomas in Sjogren's syndrome by in situ hybridisation for kappa and lambda light chain mRNA in labial salivary glands. Eur J Cancer B Oral Oncol 1994;30:244-247. Farace F, Orlanducci F, Dietrich PY, et al. T cell repertoire in patients with B chronic lymphocytic leukemia. Evidence for multiple in vivo T cell clonal expansions. J Immunol 1994;153:4281-4290. Xerri L, Mathoulin MP, Birg F, et al. Heterogeneity of rearranged T-cell receptor V-alpha and V-beta transcripts in tumor-infiltrating lymphocytes from Hodgkin's disease and non-Hodgkin's lymphoma. Am J Clin Pathol 1994;101:76-80. Yumoto N, Araki A, Sumida T, et al. Restricted V beta gene usage of tumour-infiltrating T lymphocytes in primary gastric malignant B-cell lymphoma. Virchows Arch 1995;426:11-18. Hussell T, Isaacson PG, Crabtree JE, Spencer J. The response of cells from low-grade-B-cell gastric lymphomas of mucosa-associated lymphoid tissue to Helicobacter pylori. Lancet 1993;342:571-574. Choi YW, Kotzin B, Herron L, Callahan J, Marrack P, Kappler J. Interaction of Staphylococcus aureus toxin superantigens with human T cells. Proc Natl Acad Sci USA 1989;86:8941-8945. Yamamoto K, Masuko K, Takahashi S, Ikeda Y, Kato T, Mizushima Y, Hayashi K, Nishioka K. Accumulation of distinct T cell clonotypes in human solid tumors. J Immunol 1995;154:1804-1809. Theofilopoulos AN, Balderas RS, Baccala R, Kono DH. T-cell receptor genes in autoimmunity. Ann NY Acad Sci 1993;681:33-46. Gold DP. TCR V gene usage in autoimmunity. Curr Opin Immunol 1994;6:907-912. Navarrete C, Bottazzo GF. In search of TCR restriction in autoreactive T cell in human autoimmunity: why is it so elusive? Clin Exp Inmunol 1993;91:189192.
79
199.
200.
201.
202.
203.
204.
205.
206.
207.
208. 209.
80
Sumida T, Yonaha F, Maeda T, Tanabe E, Koike T, Tomioka H, Yoshida S. T cell receptor repertoire of infiltrating T cells in lips of Sjogren's syndrome patients. J Clin Invest 1992;89:681-685. Smith MD, Lamour A, Boylston A, Lancaster FC, Pennec YL, Van Agthoven A, Rook GA, Roncin S, Lydyard PM, Youinou P. Selective expression of V beta families by T cells in the blood and salivary gland infiltrate of patients with primary Sjogren's syndrome. J Rheumatol 1994;21:1832-1837. Legras F, Martin T, Knapp AM, Pasquali JL. Infiltrating T cells from patients with primary Sjogren's syndrome express restricted or unrestricted T cell receptor V beta regions depending on the stage of the disease. EurJ Immunol 1994;24:181-185. Sensi M, Parmiani G. Analysis of TCR usage in human a new tool for assessinc, tumor-specific immune responsos. Immunol Today 1995;16:588-595. Bridges AJ, England DM. Benign lymphoepithelial lesion: relationship to Sjogren's syndrome and evolving malignant lymphoma. Semin Arthrit Rheum 1989;19:201-208. Pangalis GA, Vassilakopoulos TP, Boussiotis VA, et al. Clinical approach to lymphadenopathy. Semin Oncol 1993;20:570-582. Segal G, Clough JD, Tubbs RR. Autoimmune and iatrogenic causes of lymphadenopathy. Semin Oncol 1993;20:611-626. Marx RE, Hartman KS, Rethman KV. A prospective study comparing incisional labial to incisional parotid biopsies in the detection and confirmation of sarcoidosis, Sjogren's disease, sialosis and lymphoma. J Rheumatol 1988;15:621-629. Stewart A, Bleukinsopp PT, Henry K. Bilateral parotid MALT lymphoma and Sjogren's syndrome. Br J Oral Maxillofac Surg 1988;32:318-322. Fox RI. Sjogren's syndrome. Curr Opin Rheumatol 1995;7:409-416. Hyjek E, Smith WJ, Isaacson PG. Primary Bcell lymphoma of salivary glands and its rela-
210.
211.
212. 213.
214.
215.
216.
217.
218.
219.
220.
tionship to myoepithelial sialadenitis. Hum Pathol 1988;19:766-776. Isaacson PG. Lymphomas of mucosa-associated lymphoid tissue (MALT-type lymphomas). Forum: Trends Exp Clin Med 1993;3:234-245. Isaacson PG, Wotherspoon AC, Diss TC, Pan LX. Follicular colonization in B-cell lymphoma of mucosa-associated lymphoid tissue. Am J Surg Pathol 1991;15:819-828. Kyle RA. Benign monoclonal gammopathy: a misnomer?. JAMA 1984;1849-1854. Cummings NA, Schall GL, Asofski R. Sjogren's syndrome. New aspects of research, diagnosis and therapy. Ann Int Med 1971;75:937. Strand V, Talal N. Advances in the diagnosis and concept of Sjogren's syndrome (autoimmune exocrinopathy). Bull Rheum Dis 1980;30:1046-1052. Michalski JP, Daniels TE, Talal N, et al. Beta2 microglobulin and lymphocytic infiltration in Sjogren's syndrome. N Engl J Med 1975;293:1228-1231. Manoussakis MN, Papadopoulos GK, Drosos AA, et al. Soluble interleukin-2 receptor molecules in the serum of patients with autoimmune diseases. Clin Immunol Immunopathol 1989;50:321-332. Tzioufas AG, Boumba D, Mageed R, et al. Predicting factors of lymphoma development in primary Sjogren's syndrome. Arthrit Rheum 1993;36:S44 (abstr). Tzioufas AG. B-cell lymphoproliferation in primary Sjogren's syndrome. Clin Exp Rheumatol 1996; 14 (suppl 14):65-70. The International non-Hodgkin's lymphoma prognostic factors project: a predictive model for aggressive non-Hodgkin's lymphoma. N Engl J Med 1993;329:987-994. Tzusaka K, Akama H, Yamada H, et al. Pulmonary pseudolymphoma presented with a mass lesion in a patient with primary Sjogren's syndrome: beneficial effect of intermittent intravenous cyclophosphamide. Scand J Rheumatol 1993;22:90-93.
© 2000 Elsevier Science B.V All rights reserved. Cancer and Autoimmunity Y. Shoenfeld and M. E. Gershwin, editors
Polymyalgia Rheumatica, Temporal Arteritis and Occurrence of Malignant l\imors Jozef Rovensky and Alena Tuchynova Research Institute of Rheumatic Diseases, Piest'any, Slovak Republic
Polymyalgia rheumatica (PMR) and temporal arteritis (TA) are clinical syndromes characterized by their onset at advanced age. Little is known about the etiopathogenesis of these two nosological units. TA has recently been suggested to be an autoimmune syndrome brought on as a consequence of the immune response of the body against antigens localized in the walls of certain vessels [1]. Peptides of elastin are considered to be among the presumed targets of the autoimmune reaction [2]. The clinical picture of these syndromes is varied and thus their diagnosis rather difficult, due also to the fact that, unequivocal diagnostic tests are still lacking, which applies particularly to PMR. Differential diagnosis requires the exclusion of several other diseases with a symptomatology similar to that of PMR or TA. These include primarily infections and tumors, whose rate keeps increasing with advancing age, and they are frequently manifested as polymyalgia-like syndrome. Naschitz et al. [3] studied the incidence of cancer in 47 patients with PMR over a period of ten years. In five of these patients, polymyalgia-like syndrome was discovered 1-3 months before malignancy was diagnosed. In all these patients, scintigraphic examination detected metastases localized in bones and joints, while the primary tumor was in the lungs (1 patient), kidneys (1 patient), colon (2 patients), and in one patient the localization of the primary tumor could not be established. An interesting observation in this series was the atypical course of the polymyalgic syndrome, which differed from classical PMR by the onset of complaints before the age of 50 years, by affecting only one typical site, asymmetrically affecting typical localizations, by pain in the joints and by
partial or delayed effect of prednisone on the rehef of symptoms. The authors assumed that patients with an atypical course of PMR are at a higher risk of having developed a malignancy metastasizing into bones or articulations. On the other hand, cases of coexistence of PMR and/or TA with tumor diseases have also been reported. The interval between the manifestation of PMR and TA and diagnosis of malignancy was sufficiently long for the polymyalgic syndrome not to be considered a paraneoplastic one. As early as in 1969, Mackenzie [4] described the development of malignancy in one subject of a series of 76 patients with PMR. Several papers have appeared since addressing the potential association between PMR and/or TA and the incidence of malignant tumors (Table 1). Presumably the most detailed study was published by Haga et al. [5] who investigated the incidence of tumor diseases in 185 patients with PMR and/or TA in a prospective study covering the years 1978-1983. A series of 925 subjects randomly selected from the Central Population Registry of Norway served as controls. The data obtained from the patients and from the control subjects were compared with data from the Cancer Registry of Norway. By the end of the 5year study, malignancy was established in 27 patients (14.6%) with PMR and/or TA and in 131 subjects (14.2%) from the control group. A higher occurrence rate of malignant tumor diseases was recorded in 16 patients with histologically verified TA (24.6%). In this subgroup of patients, the risk of developing malignancy was 2.25 times higher than in the control group and 4.4 times higher compared to the other patients with PMR and TA. In 13 patients of the series.
81
Table 1. Survey of published papers about the incidence of mahgnant tumors in patients with PMR and TA Author [ref.]
No. of patients
Diagnosis
Kalra & Delamere [6]
Case-reports
PMR
Monoclonal gammopathy-acute myeloblastic leukemia, multiple myeloma, susp. Waldenstrom's macroglobulinemia
Montanaro & Bizzarri [7]
Case-report
PMR-like syndrome
Non-Hodgkin's lymphoma later transformed into acute lymphoblastic leukemia
Haga et al. [5]
185
PMR and/ orTA
O'Keefe & Goldstraw [8]
Case-report
PMR
1
Nonsmall cell carcinoma of lungs
Tabata & Kobayashi
Case-report
PMR
1
Papillary carcinoma of the thyroid gland
KohH& Bennett [10]
Case-reports
PMR
3
Myelodysplastic syndrome
Shimamoto et al. [14]
Case-report
TA
1
Acute myelogenous leukemia
Mertens etal. [12]
111
PMR and/ orTA
Lie [13]
Case-report
TA
1
Adenocarcinoma of lungs
Das-gupta et al. [14]
Case-report
PMR
1
IgA kappa paraproteinemia
Genereau etal. [15]
Case-report
PMR
I
Urinary bladder
Gonzales-Gay etal. [16]
Case-report
TA
1
Chronic lymphocytic leukemia
Assietal. [17]
Case-report
TA
1
Squamous dermatocarcinoma
Bahlasetal. [18]
149
PMR and/ orTA
4
Multiple myeloma (2), squamous cell carcinoma, carcinoid, lymphoma^
No. of patients with malignancy
28
12
Localization/ type of tumor(s)
Carcinoma uteri (3), recti (5), renis (2), pancreatis (1), ovaries (1), vulvae (1), penis (1), mammae (3), ventriculi (1), testis (1), prostatae (1), coli (5), lungs (1), lymphonodorum (2)^
Breast (1), skin (2), colon (2), stomach (2), hypernephroma [2], ovaries [1], lungs (1), Waldenstrom's macroglobuhnemia [1]
^ In one patient several primary localizations of the malignant tumor.
the malignancy preceded PIVIR and/or TA diagnosis by 4-17 years. In 14 patients of the series, PIVIR and/or TA were manifested first and malignancy was diagnosed in the course of three months up to seven years. In the light of the relatively long interval between the diagnosis of malignancy and PIVIR and/or TA, the authors do not regard the manifestations as paraneoplastic syndrome. Gradually further studies appear observing the occurrence of PIVIR, TA and malignancies, though the majority of them were case reports. The primary localization of the malignant tumor covered a rather
82
broad range. Haga et al. [5] reported predominantly organ localizations of tumors, yet other authors published findings on the occurrence of leukemia [6, 11, 16], non-Hodgkin's lymphoma [7], or Waldenstrom's macroglobulinemia [6,12]. In our series of 26 patients (18 patients with PMR, 8 patients with TA), we did not observe any malignancies either before diagnosis of PMR or TA was established or in the course of the three-year prospective follow-up of the patients. These results are to be considered preliminary, especially with regard to the short follow-up interval from setting up the diagnosis and from the onset of treatment. We
did, however, performed a research probe in a retrospective study of the clinical material of 42 patients with PMR or TA, who had been hospitalized in our Institute after 1972. Association with malignancy was detected in two patients. One of them underwent hysterectomy for rhabdomyosarcoma 9 years before PMR was diagnosed, and in the other patient tumor of the breast was detected one year before the appearance of PMR. Malignancy was not found in any of the patients with TA. Nevertheless, despite the above mentioned findings, patients with giant cell arteritis and also patients with rheumatic polymyalgia may be considered at risk of developing malignancy. This assumption is supported by several factors: higher occurrence rate of tumor diseases in subjects of advanced age, presumed derangement of some functions of the immune system in patients with TA and PMR, known coincidence of malignancies with dermatopolymyositis and vasculitis, and alterations in the immune response brought on by the therapy administered. To confirm the given assumption, prospective studies have to be performed on larger series of patients. Due to the low number of patients with TA and PMR, the problem will have to be investigated in terms of international cooperation using adequate mathematical and statistical methods in evaluating the obtained results.
6.
7.
8.
9. 10.
11.
12.
13.
14.
REFERENCES 1.
2.
3.
4. 5.
Weyand, CM, Hartley GB. Giant cell arteritis: new concepts in pathogenesis and implications for management. Am J Ophtalmol 1997;123:392-395. Gillot JM, Masy E, Davril M, Hachulla E, Matron PY, Devulder B, Dessaint JP. Elastase derived elasdn peptides: putative autoimmune targes in giant cell arteritis. J Rheumatol 1997;24:677-682. Naschitz JE, Slobodin G, Yeshurun D, Rozenbaum M, Rosner I. A polymyalgia rheumatica-like syndrome as presentation of metastatic cancer. J Clin Rheumatol 1996;2:305-308. Mackenzie AH. The polymyalgia rheumatica syndrome. Geriatrics 1969;24:158. Haga HJ, Eide GE, Brun J, Johansen A, Langmark F. Cancer in associadon with polymyalgia rheumatica
15.
16.
17.
18.
and temporal arteritis. J Rheumatol 1993;20:13351339. Kalra L, Delamere JP. Lymphoreticular malignancy and monoclonal gammopathy presenting as polymyalgia rheumatica. Br J Rheumatol 1987:26:458-459. Montanaro M, Bizzarri F. Non-Hodgkin's lymphoma and subsequent acute lymphoblastic leukemia in a patient with polymyalgia rheumatica. Br J Rheumatol 1992;31:277-278. O'Keefe PA, Goldstraw P. Gastropleural fistula following pulmonary resection. Thorax 1993;48:12781279. Tabata M, Kobayashi T. Polymyalgia rheumatica and thyroid papillary carcinoma. Int Med 1994;33:41-44. Kohli M, Bennett RM. An associadon of polymyalgia rheumatica with myelodysplastic syndromes. J Rheumatol 1994;21:1357-1359. Shimamoto Y, Matsunaga C, Suga K, Fukushima A, Nomura K, Yamaguchi M. A Human T-cell lymphotropic virus type I carrier with temporal arteritis terminating in acute myelogenous leukemia. Scand J Rheumatol 1994;23:151-153. Mertens JCC, Willemsen G, Van Saase JLCM, Bolk JH, Dijkmans BAC. Polymyalgia rheumadca and temporal arterids: a retrospective study of 111 patients. Clin Rheumatol 1995;14:650-655. Lie JT. Simultaneous clinical manifestations of malignancy and giant cell temporal arterids in a young woman. J Rheumatol 1995;22:367-369. Das-gupta E, Bandyopadhyay P, Kok Shun JL. Polymyalgia rheumadca, temporal arterids and malignancy. Postgrad J Med 1996;72:317-318. Genereau T, Koeger AC, Chaibi P, Bourgeois P. Polymyalgia rheumatica with temporal arteritis following intravesical Calmette-Guerin bacillus immunotherapy for bladder cancer. Clin Exp Rheumatol, 1, 1996;110. Gonzales-Gay MA, Blanco R, Gonzales-Lopez MA. Simultaneous presentadon of giant cell arteritis and chronic lymphocytic leukemia. J Rheumatol 1997;24:407-408. Assi A, Nischal KK, Uddin J, Thyveedl MD. Giant cell arteritis masquerading as squamous cell carcinoma of the skin. Br J Rheumatol 1997;36:10231025. Bahlas S, Ramos-Remus C, Davis P. Clinical outcome of 149 patients with polymyalgia rheumatica and giant cell arterids. J Rheumatol 1998;25:99104.
83
(c) 2000 Elsevier Science B.V All rights reserved. Cancer and Autoimmunity Y. Shoenfeld and M. E. Gershwin, editors
Myositis and Neoplasia Claire Fieschi and Jean-Charles Piette Groupe Hospitaller Pitie-Salpetriere, Paris, France
1. MYOSITIS: DEFINITION AND CLASSIFICATION Twenty years ago Bohan et al. [1] proposed five primary criteria for myositis: symmetrical weakness of proximal limb muscles, elevated serum levels of enzymes present in skeletal muscles, specific electromyographic (EMG) myopathic modifications, abnormal muscle biopsy with muscle fiber necrosis and inflammatory cell infiltrates, associated in DM with specific cutaneous modifications such as: eyelids lilac discoloration and erythema on the extension side of both metacarpophalangeal and proximal interphalangeal joints. In reality, any of these criteria can be absent, especially those pertaining to muscle histological modifications, due to the heterogeneous distribution of inflammatory sites as documented by recent MRI studies [2]. Purely cutaneous forms have also been described and called "dermatomyositis sine myositis" [3,4]. Bohan et al. [1] proposed to classify myositis into five subgroups: primary idiopathic polymyositis (PM), primary idiopathic dermatomyositis (DM), dermatomyositis (or polymyositis) associated with malignancy, childhood DM or PM and myositis overlapping with another connective tissue disease [1]. This classification is simple and easy to use, but it has some drawbacks, especially the fact that some individual patients may be classified in more than one subgroup. Furthermore, it does not individualize inclusion body myositis (IBM), whose diagnosis is suggested by "atypical" manifestations, such as distal muscle involvement at times asymmetrical, discrete muscle enzyme modifications, neurological EMG alterations, resistance to both steroid and immunosuppressive therapies, and confirmed by characteristic
features on optical and more specifically electron microscopy [5, 6]. Macrophage myofasciitis has been described too recently to be included in any of the proposed classification for myositis [7]. Although frequently studied together, DM and PM probably result from distinct processes. In DM, the elementary muscular lesion is microvasculitis with B and T-CD4 lymphocytic infiltrates, whereas in PM there are no endothelial abnormalities and the cellular infiltrate is made of T-CD8, macrophages and natural killer cells [6, 8, 9]. Therefore, it is thought that immune dysfunction is mainly humoral in DM, and cellular in PM [6]. In 1991, based on this observation, Dalakas reclassified myositis into three groups: DM, PM and inclusion body myositis [6]. This classification however does not take into account "specific" myositis autoantibodies (ab), mainly those directed against certain aminoacyl-tRNA synthetases (antisynthetases), predominandy anti-Jol ab. Patients who carry these antibodies have indeed been identified as having distinctive clinical and genetic features [9, 10]. 1.1. The Prevalence of Neoplasia is Increased in PM and Especially DM The occurrence of myositis and neoplasia in the same patient was reported as early as 1916 [11], but its possible fortuitous nature remained debated for a while. Even, two recent case-control studies concluded that this association was merely coincidental [12, 13]. However, compilation of literature data revealed an remarkably high frequency of neoplasia (approximately 25%) among DM patients [14-17]. It was finally the meticulous epidemiological study by Sigurgeirsson et al. [18], based on the Swedish
85
national register of patients and therefore eliminating most of potential bias, that established the irrefutable link between DM and neoplasia. Among 392 DM patients, 59 (15%) had cancer (excluding skin basal cell carcinoma), either in conjunction with DM or subsequently. Compared to the normal general population, the relative risk of cancer was significantly raised: 2.4 in men and 3.4 in women [18]. Regarding PM, 37 out of 396 patients (9%) had cancer either simultaneously or subsequently to PM, leading to relative risks of 1.8 and 1.7 in men and women, respectively. Among deceased patients, cancer was the leading cause of death in 40% of DM and 14% of PM. Cancer mortality rate was 3.8 that of normal general population in DM patients, whereas, it was unremarkable in PM (0.9). It is important to note that this study included childhoodonset myositis (namely, 20% of DM and 3% of PM), all cancer free. Confirmations of these results followed [19-23], and especially a distinct meta-analysis performed in adult DM and PM revealed relative cancer risks of 4.4 and 2.1, respectively [24]. The highly pejorative prognostic significance of cancer occurring in association with DM or PM was confirmed by all authors, most of patients dying from cancer, not myositis, within 1 or 2 years following diagnosis of neoplasia [1, 10, 14, 15, 20,21,25]. All this raises several questions: are there some types of cancer specifically associated with myositis? or vice versa, do cancer-related myositis have peculiar characteristics? and what is the temporal relationship between both disorders? 1.2. Myositis and Neoplasia: Which Neoplasia? According to the above-mentioned studies, a great diversity of malignancies may be observed. On first appearance, their localization is devoid of any specificity, with breast and pelvis as leading sites in women, bronchi/lung in men and gastrointestinal tract in both genders [14, 16, 22, 23, 26]. We believe, however, that certain localizations require closer consideration. Based on a series of 7 patients with both disorders, we recently focused attention on ovarian adenocarcinoma found, in our experience, to be present in 21.4% of DM women older then 40 years, compared with 1% of Caucasian women [27]. This distinctive association has since been confirmed by other groups [17, 2830]. In the study by Sigurgeirsson et al. [18], despite
86
the small number of ovarian cancer reported, the relative risk of developing this malignancy during the 5 years following a diagnosis of DM was as high as 16.7. More anecdotical, a fortuitous association between these two diseases seems to us unlikely given that we observed it in two sisters. Additional conditions should be mentioned, especially in regard to their pathophysiologic implications. These include: nasopharyngeal carcinoma, frequently reported in Asia [31-33] and lymphoid hemopathies [21,34, 35], such as Hodgkin's or non-Hodgkin's lymphoma and B-cell chronic lymphocytic leukemia. In the latter, the lymphocytic infiltrate observed within muscle seems to belong to the leukemic process [35]. 1.3. Myositis and Neoplasia: Which Type of Myositis? Considering its implications, namely, the more or less extensive systematic search for an occult cancer in patients with myositis, this is a highly relevant practical question. However, precise data regarding this question remain limited. Numerous authors agree that DM is much more associated with cancer than PM [17, 18, 23, 24]. The presence of an occult cancer is very unlikely in patients with both clearcut infectionor drug-induced myositis, and in those with a longstanding disease (i.e., several years). Cancer are also exceptional in the course of IBM [5, 6, 17, 36]. Additional established associations also seem, with rare exceptions, reassuring in terms of cancer risk. These include: childhood DM, myositis associated with a defined connective tissue disease such as systemic lupus erythematosus or scleroderma, and myositis occurring as a feature of mixed connective tissue disease [1, 14, 17, 18, 37-40]. Similarly, the presence of antisynthetase ab, which characterizes a subset of myositis frequently featuring with interstitial lung involvement, carries a very low risk of cancer both in literature [10] and in our experience. Unsurprisingly, the same is true for the presence of interstitial pneumonitis. In a series of 63 DM patients, none of the 8 with interstitial pneumonitis had cancer, compared with 18 out of the 55 patients without [41]. Nevertheless, the theoretical risk of pulmonary neoplasia occurring as a long-term complication of pulmonary fibrosis must be kept in mind for patients with connective tissue diseases [17].
Among the criteria relating myositis to a higher risk of neoplasia, the only well established one is the patient's age at the time of the disease onset [1, 21, 23, 42]. The mean age was 62 vs. 47 years according to the presence or absence of cancer in the study by Bohan et al. [1], and 63 vs. 47 years in the study by Rose et al. [21]. Other authors have suggested additional "predictive" signs of cancer risk such as: the rapid onset of myositis [15], vesicular skin eruption [30], cutaneous necrosis [43-45], acquired ichthyosis [46], hypoalbuminemia [21], and frankly elevated C reactive protein levels [21] or erythrocyte sedimentation rate [43]. All of these still remain to be confirmed. Muscle histological evaluation does seem to contribute to this duty [14], although it has been said that necrotic lesions are rarely lacking in patients with cancer [1, 43]. Finally, the absence of muscular involvement—as assumed by negative clinical, biochemical, electrophysiological, histological and/or imaging (MRI) anomalies depending among the reports—which defines the rare "DM sine myositis", does not seem to reduce, but rather could increase, the risk of cancer, with ovarian adenocarcinoma once more occupying a prominent position [4, 32, 34, 47, 48].
1.4. Myositis and Neoplasia: Which Temporal Relationship? Before engaging in this discussion, one must be reminded that in patients with neoplasia, the presence of muscular symptoms can be related to numerous causes related to the cancer itself or its treatment, independently of an associated myositic process. These include: malnutrition, hyper or more rarely hypocalcemia, hypokalemia, hypomagnesemia, hypophosphatemia, thyroid dysfunction—particularly late hypothyroidism—spontaneous or more frequently iatrogenic hypercorticism, bacterial pyomyositis [49], paraneoplastic Lambert-Eaton syndrome and vasculitis—either paraneoplastic, drug-induced or virus-induced [50]. Numerous cancer treatments such as steroids, vincristine, cyclosporin [51], interleukin-2 [52], paclitaxel [53] and LH-RH analogues [54] can cause adverse effects affecting muscle by different mechanisms distinct from myositis. Alternatively, interferon-of seems capable of inducing a "true" PM [55-57], while hydroxyurea can
provoke an eruption highly similar to that of DM [58, 59]. Muscular lesions that are indiscernible from those of PM may sometimes be observed in the course of chronic graft-vs-host disease after allogenic bonemarrow transplantation [60]. Furthermore, immunosuppressive treatments used in severe myositis may lead to the emergence of malignant lymphoma, which at times can regress after treatment is discontined [17, 61], which we also observed in one case. Altogether, these difficult diagnostic problems enhanced by methodological pitfalls, complicate the evaluation of the temporal relationship between myositis and neoplasia. A "peak" in simultaneous cancer discovery and myositis diagnosis may indeed be related to numerous bias, especially because these usually hospitalized patients undergo numerous explorations, which frequently are all the more extensive given the thought of a potential occult cancer. This statistical "peak" has been noted by several authors [15, 20-23, 42, 50], including the Swedish study where it was much higher for DM than for PM patients [18], and in a compilation of DM associated with ovarian adenocarcinoma [27]. In the Swedish study [18], after the exclusion of early cancer discovery, the relative risk of cancer occurrence within the first 5 years following DM diagnosis remains as high as 3.9 and 2.2 for women and men, respectively. In their meta-analysis, Zantos et al. revealed that a higher risk of cancer was present not only in the 5 years following DM or PM diagnosis, but also in the 5 years preceding DM, but not PM, diagnosis [24]. This final observation, which cannot result from the previously mentioned bias, is a strong evidence favoring a temporal link between neoplasia and DM. Under such circumstances, DM occurrence can sometimes be simultaneous to that of cancer relapse [42].
1.5. When is the Term "Paraneoplastic" Appropriate? Underlining the concept of a paraneoplasic syndrome implies not only their more-or-less simultaneous occurrence, which as previously noted is quite frequent, but also a parallel course—far less encountered. Hence, the term "paraneoplasic syndrome" cannot be used in the following three circumstances:
87
— the discordant course of both diseases, such as persistent myositis activity in spite of durable complete cancer remission, or more exceptionally, prolonged disappearance of myositis in spite of cancer frank relapse or sustained smouldering progression; — the rapidly lethal outcome due to refractory neoplasia which frequently occurs; and — the complete and definitive simultaneous cure of both cancer and myositis following systemic chemotherapy. Although myositis regression may result from cancer resolution, it may also be due to the immunosuppressive activity of chemotherapy. Alternatively, two evolutive profiles are consistent with the "paraneoplastic" nature of myositis: — the simultaneous healing of cancer and myositis following an exclusive regionally-confined cancer treatment (surgery and/or radiation) without associated steroid therapy. Such therapeutic procedures are rarely employed nowadays; and — the simultaneous healing, and then relapse, of both disorders (once more, additional causes of muscle disorders have to be excluded). Finally, although cases corresponding to these criteria do exist and are known for years, the term "paraneoplastic" can only be applied to a minority of myositis associated to neoplasia [1, 15, 17, 20, 21, 42]. Furthermore, as will be discussed later, knowledge of their precise pathophysiology remains poorly elucidated. 1.6. Myositis and Neoplasia: How Extensive Should the Investigations be? The well established increased prevalence of cancer in patients with myositis, and the temporal relationship between both disorders, imply that a search for occult neoplasia should follow diagnosis of myositis. However, no consensus exists regarding the extent of the search required and the type of myositis which demand it. Explorations should obviously be performed in the case of recently diagnosed adult DM not clearly induced by infection or drugs, whether muscular involvement is highly present, discrete or even absent [48]. The search for neoplasia is considered by some less imperative in adult PM. However, according to recently published epidemiological data [18, 24], we believe it is justified.
Two opposing attitudes exist regarding the extent of these explorations. The "minimalist" proposal, which is usually employed, is restricted to patient interrogation, complete physical examination, few routine blood and urine tests, fecal occult blood, chest X-ray, eventually complemented by abdominal ultrasound; additional oriented examinations are performed only in the case of specific symptoms or signs [4,6,14,17,21,42]. The "maximalist" attitude has been adopted for many years by our group and others [20, 25, 62]. Beside the preceding list, it includes a thoracoabdomino-pelvic CT scan, gastrointestinal tract and bronchial tree endoscopic explorations, ENT examination, mammogram, bonemarrow biopsy, serum Immunoelectrophoresis, screening for the main tumour markers [63] and the study of circulating lymphocytes subpopulations. We think that the high risk of ovarian adenocarcinoma in women, which is often diagnosed with delay, implies (besides from clinical gynecological examination and serum CA-125 assay), a trans-vaginal ultrasound, and at least doubt pelvic laparoscopy [27, 29]. Considering the rare ensuing discovery of a curable occult neoplasia, we agree that such extensive explorations are both burdensome and very costly [14]. To top it all, the negative results do not exclude future occurrence of full-fledged neoplasia in the following year [42]. Although there is no validated proof, we do hope like others, that such extensive search reduces the risk to initially overlook neoplasia [25]. Due to the paraneoplastic nature of certain DM, it seems also justified to repeat the explorations for an occult neoplasia in patients with resistant or recurrent forms of the disease [1, 14, 17, 25, 42, 63,64]. There is also an "intermediate" probabilistic attitude, consisting of personalized initial explorations depending on the patient's age, ethnic origin, family cancer history and associated tobacco and/or alcohol intoxication [17, 25, 50, 64]. The identification of possible specific characteristics of neoplasia-associated myositis would be the only way to rationalize the required initial explorations. Finally, it should be remembered that certain clinical manifestations unexplained by the myositis, such as rapid weight loss, high fever or thromboemboli complications, always justify a search for cancer. The same applies to dysphagia, which can only be attributed to myositis following both ENT exami-
nation and oesophageal endoscopy [21]. Regarding biological abnormalities, highly elevated serum lacticodeshydrogenase levels, contrasting with those of transaminases and creatine kinase, may reflect the presence of occult neoplasia. Raised CA-125 levels are not synonymous with ovarian cancer, given that CA-125 elevation may be observed in serous effusions of various causes [65], but in patients with myositis, it should be regarded as very suspicious, and in the case of associated ascitis, a pelvic laparoscopy is justified in women. 1.7. Myositis and Neoplasia: Which Mechanisms? Our knowledge concerning the pathophysiology of DM and PM remains parcellary. Recent discoveries concerning the role of cytokines and the phenomenon leading to muscle cell destruction [66-69], partly explain the mechanism of action of therapeutic immunoglobulins infusions in DM and PM [8]. The inconstant presence of antibodies directed against different aminoacyl-tRNA synthetases, statistically associated with certain alleles of the MHC [9, 10], opens up interesting perspectives for the understanding of myositis pathophysiology. Unfortunately, they do not concern the subset of neoplasia-associated myositis, where such antibodies are usually absent [10]. Beside the rare myositis induced by several drugs, or some protozoal or bacterial infections, the etiological aspects of DM and PM remain unknown [6, 9]. The presumed implication of certain viruses in the pathogenesis of myositis, suggested by few explicit isolated cases, has not been confirmed in large series [70, 71]. The association between myositis and neoplasia could theoretically result from two distinct mechanisms: — a common origin (i.e., genetic predisposition and/or environmental factors), which would explain the occurrence of both diseases without requiring a temporal relationship; or — alternatively, an authentic paraneoplastic syndrome, therefore implying a direct causative relationship. As discussed earlier, this mechanism can be evoked only in a minority of patients [14, 17]. Within this setting, some pathogenic proposals have been suggested, based on individual observations, but they remain highly hypothetical [14,72].
Despite recent acquisitions in the domain of paraneoplasic syndromes revealing the potential role of tumour antigens [73, 74], the pathophysiology of neoplasia-associated myositis is still mysterious. The recent finding that the DM-associated autoantigen Mi2b and the candidate metastasis-associated protein MAT2 exist in the same protein complex offers, however, fascinating perspectives for a potential molecular explanation [75]. In conclusion, DM and PM are separate disorders thought to result from distinct alterations of immune response. The former undoubtedly carry an increased risk of cancer, but the mechanisms underlining this association remain poorly understood.
REFERENCES 1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
Bohan A, Peter JB, Bowman RL, Pearson CM. A computer-assisted analysis of 153 patients with polymyositis and dermatomyositis. Medicine 1977;56:255-286. Schweitzer ME, Fort J. Cost-effectiveness of MR imaging in evaluating polymyositis. AJR 1995;165:1469-147L Euwer RL, Sontheimer RD. Amyopathic dermatomyositis: a review. J Invest Dermatol 1993;100:124S127S. Cosnes A, Amaudric F, Gherardi R, Verroust J, Wechsler J, Revuz J, Roujeau JC. Dermatomyositis without muscle weakness—long-term follow-up of 12 patients without systemic corticosteroids. Arch Dermatoll995;131:1381-1385. Sayers ME, Chou SM, Calabrese LH. Inclusion body myositis—analysis of 32 cases. J Rheumatol 1992;19:1385-1389. Dalakas MC Polymyositis, dermatomyositis, and inclusion-body myositis. N Engl J Med 1991;325:1487-1498. Gherardi RK, Coquet M, Cherin P, et al. Macrophagic fasciitis: an emerging entity. Lancet 1998;352:347352. Dalakas MC Clinical benefits and immunopathological correlates of intravenous immune globulin in the treatment of inflammatory myopathies. Clin Exp Immunol 1996;104(suppl l):55-60. Plotz PH, Rider LG, Targoff IN, Raben N, O'Hanlon TP, Miller FW. Myositis: immunologic contributions to understanding cause, pathogenesis, and therapy. Ann Int Med 1995;122:715-724. Love LA, Leff RL, Eraser DD, Targoff IN, Dalakas M, Plotz PH, Miller FW. A new approach to the
89
11. 12.
13.
14. 15.
16. 17.
18.
19.
20.
21.
22.
23.
24.
25.
90
classification of idiopathic inflammatory myopathy— myositis-specific autoantibodies define useful homogeneous patient groups. Medicine 1991;70:360-374. Stertz G. Polymyositis. Berl Klin Wochenschr 1916;53:489. Lakhampal S, Bunch TW, Ilstrup DM, Melton LJ III. Polymyositis-dermatomyositis and malignant lesions: does an association exist? Mayo Clin Proc 1986;61:645-653. Lyon MG, Bloch DA, Hollak B, Fries JF. Predisposing factors in dermatomyositis-polymyositis: results of a nationwide survey. J Rheumatol 1989;16:1218-1224. Bernard P, Bonnetblanc JM. Dermatomyositis and malignancy. J Invest Dermatol 1993; 100:S128-S 132. Bonnetblanc JM, Bernard P, Fayol J. Dermatomyositis and malignancy. A multicenter cooperative study. Dermatologica 1990;180:212-216. Callen JP. Myositis and malignancy. Clin Rheum Dis 1984, 10:117-130. Callen JP. Relationship of cancer to inflammatory muscle diseases: dermatomyositis, polymyositis, and inclusion body myositis. Rheum Dis Clin North Am 1994;20:943-953. Sigurgeirsson B, Lindelof B, Edhag O, Allander E. Risk of cancer in patients with dermatomyositis or polymyositis. A population-based study. N Engl J Med 1992;326:363-367. Airio A, Pukkala E, Isomaki H. Elevated cancer incidence in patients with dermatomyositis: a population based study. J Rheumatol 1995;22:1300-1303. Maugars YM, Berthelot JM, Abbas AA, Mussini JM, Nguyen JM, Prost AM. Long-term prognosis of 69 patients with dermatomyositis or polymyositis. Clin Exp Rheumatol 1996;14:263-274 Rose C, Matron PY, Brouillard M, et al. Signes predictifs de cancers au cours de la dermatomyosite. Etude de 29 observations. Rev Med Int 1994; 15:19-24. Maoz CR, Langevitz P, Livneh A, Blumstein Z, Sadeh M, Bank I, Gur H, Ehrenfeld M. High incidence of malignancies in patients with dermatomyositis and polymyositis: an 11-year analysis. Semin Arthrit Rheumatol 1998;27:319-324. Marie I, Matron PY, Levesque H, HachuUa E, Hellot MF, Michon-Pasturel U, Courtois H, Devulder B. Influence of age on characteristics of polymyositis and dermatomyositis in adults. Medicine (Baltimore) 1999;78:139-147. Zantos D, Zhang Y, Felson D. The overall and temporal association of cancer with polymyositis and dermatomyositis. J Rheumatol 1994;21:18551859. Schulman P, Kerr LD, Spiera H. A reexamination of the relationship between myositis and malignancy. J Rheumatol 1991;18:1689-1692.
26. 27.
28.
29.
30.
31.
32.
33. 34.
35.
36.
37.
38.
39.
40.
41.
Barnes BE. Dermatomyositis and malignancy. A review of the literature. Ann Int Med 1976;84:68-76. Cherin P, Piette JC, Herson S, et al. Dermatomyositis and ovarian cancer: a report of 7 cases and literature review. J Rheumatol 1993;20:1897-1899. Whitmore SE, Rosenshein NB, Provost TT. Ovarian cancer in patients with dermatomyositis. Medicine 1994;73:153-160. Whitmore SE, Anhalt GJ, Provost TT, Zacur HA, Hamper UM, Hhlzlsouer KJ, Rosenshein NB. Serum CA-125 screening for ovarian cancer in patients with dermatomyositis. Gynecol Oncol 1997;65:241-244. Kubo M, Sato S, Kitahara H, Tsuchida T, Tamaki K. Vesicle formation in dermatomyositis associated with gynecologic malignancies. J Am Acad Dermatol 1996;34:391-394. Peng JC, Sheen TS, Hsu MM. Nasopharyngeal carcinoma with dermatomyositis: analysis of 12 cases. Arch Otolaryngol Head Neck Surg 1995; 121:12981301. Fung WK, Chan HL, Lam WM. Amyopathic dermatomyositis in Hong Kong—association with nasopharyngeal carcinoma. Int J Dermatol 1998;37:659-663. Leow YH, Goh CL. Malignancy in adult dermatomyositis. Int J Dermatol 1997;36:904-907. Osman Y, Narita M, Kishi K, Fujiwara H, Fukuda T, Koike T, Shibata A. Amyopathic dermatomyositis associated with transformed malignant lymphoma. Am J Med Sciences 1996, 311:240-242. Creange A, Theodorou I, Sabourin JC, Vital C, Farcet JP, Gherardi RK. Inflammatory neuromuscular disorders associated with chronic lymphoid leukemia:Evidence for clonal B cells within muscle and nerve. J Neurol Sci 1996, 137: 35-41. Ytterberg SR, Roelofs RI, Mahowald ML. Inclusion body myositis and renal cell carcinoma—report of two cases and review of the literature. Arthrit Rheumatol 1993;36:416-421. Sherry DD, Haas JE, Milstein JM. Childhood polymyositis as a paraneoplastic phenomenon. Pediatr Neurol 1993;9:155-156. Guiziou C, Lebreton C, Kaplan G, Vigneron AM, Kahn MF. Les sclerodermatomyosites. A propos de 13 observations. Rev Rheumatol 1987;54:457-461. Tymms KE, Webb J. Dermatopolymyositis and other connective tissue diseases: a review of 105 cases. J Rheumatol 1985;12:1140-1148. Dawkins MA, Jorizzo JL, Walker FO, Albertson D, Sinai SH, Hinds A. Dermatomyositis: a dermatologybased case series. J Am Acad Dermatol 1998;38:397404. Grau JM, Miro O, Pedrol E, Casademont J, Masanes F, Herrero C, Haussman G, Urbano-Marquez A. Inter-
42.
43.
44.
45.
46.
47.
48.
49.
50.
51. 52.
53.
54.
stitial lung disease related to dermatomyositis. Comparative study with patients without lung involvement. J Rheumatol 1996;23:1921-1926. Cox NH, Lawrence CM, Langtry JA, Ive FA Dermatomyositis. Disease associations and an evaluation of screening investigations for malignancy. Arch Dermatol 1990, 126:61-65. Basset-Seguin N, Roujeau JC, Gherardi R, Guillaume JC, Revuz J, Touraine R. Prognostic factors and predictive signs of malignancy in adult dermatomyositis. A study of 32 cases. Arch Dermatol 1990; 126:633637. Gallais V, Crickx B, Belaich S. Lesions necrotiques cutanees au cours de la dermatomyosite de radulte:un signe predictif de cancer? Presse Medicale 1995;24:1907. Mautner GH, Grossman ME, Silvers DN, Rabinowitz A, Mowad CM, Johnson BL Jr. Epidermal necrosis as a predictive sign of malignancy in adult dermatomyositis. Cutis 1998;61:190-194. Roselino AM, Souza CS, Andrade JM, Tone LG, Soares FA, Llorach-Velludo MA, Foss NT. Dermatomyositis and acquired ichthyosis as paraneoplastic manifestations of ovarian tumor. Int J Dermatol 1997;36:611-614. Fudman EJ, Schnitzer TJ Dermatomyositis without creatine kinase elevation. Am J Med 1986;80:329332. Whitmore SE, Watson R, Rosenshein NB, Provost TT. Dermatomyositis sine myositis: association with malignancy. J Rheumatol 1996;23:101~105. Matsuno O, Matsumoto T, Miyazaki E, Nakagawa H, Kumamoto T, Tsuda T. Pyomyositis associated with bacteroides fragilis in a patient with multiple myeloma. Am J Trop Med Hyg 1998;59:42-44. Carsons S The association of malignancy with rheumatic and connective tissue diseases. Semin Oncol 1997;24:360-372. Zuckner J Drug-related myopathies. Rheum Dis Clin North Am 1994;20:1017-1032. Esteva-Lorenzo FJ, Janik JE, Fenton RG, EmslieSmith A, Engel AG, Longo DL. Myositis associated with interleukin-2 therapy in a patient with metastatic renal cell carcinoma. Cancer 1995;76:1219-1223. Rowinsky EK, Chaudhry V, Forastiere A A, et al. Phase I and pharmacologic study of paclitaxel and cisplatin with granulocyte colony-stimulating factor: neuromuscular toxicity is dose-limiting. J Clin Oncol 1993;11:2010-20. Crayton H, Bohlmann T, Sufit R, Graziano FM. Drug Induced Polymyositis Secondary to Leuprolide Acetate (Lupron) Therapy for Prostate Carcinoma. Clin Exp Rheumatol 1991;9:525-528.
55.
56.
57.
58.
59.
60.
61.
62.
63.
64. 65.
66.
67.
68.
Arai H, Tanaka M, Ohta K, Kojo T, Niijima K, Imawari M. Symptomatic myopathy associated with interferon therapy for chronic hepatitis C. Lancet 1995;345:582. Kalkner KM, Ronnblom L, Karlsson Parra AK, Bengtsson M, Olsson Y, Oberg K. Antibodies against double-stranded DNA and development of polymyositis during treatment with interferon. QJM 1998;91:393-399. Falcone A, Bodenizza CA, Musto P, Carotenuto M. Symptomatic myopathy during interferon alpha therapy for chronic myelogenous leukemia. Leukemia 1998;12:1329. Bahadoran P, Castanet J, Lacour JPH, et al. Pseudodermatomyositis induced by long-term hydroxyurea therapy: report of two cases. Br J Dermatol 1996;134:1161-1163. Kirby B, Rogers S Hydroxy urea-induced dermopathy: a unique lichenoid eruption complicating longterm therapy with hydroxyurea. J Am Acad Dermatol 1998;38:781-782. Parker P, Chao NJ, Ben-Ezra J, et al. Polymyositis as a manifestation of chronic graft-versus-host disease. Medicine 1996;75:279-285. Kamel OW, Van de Rijn M, Weiss LM, et al. Reversible lymphomas associated with Epstein-Barr virus occurring during methotrexate therapy for rheumatoid arthritis and dermatomyositis. N Eng J Med 1993;328:1317-1321. Serratrice G. Dermatopolymyosites. In: Kahn MF, Peltier AP, Meyer O, Piette JC, eds., Les maladies systemiques. Paris: Flammarion Medecine-Sciences, 1991;473-497. O'Gradaigh D, Merry P. Tumour markers in dermatomyositis: useful or useless? Br J Rheumatol 1998;37:914. Till SH, Jones AC. Dermatomyositis—how far to go! Ann Rheum Dis 1998;57:198-200. Le Thi Huong Du, Mohattane A, Piette JC ,et al. Specificite du marqueur tumoral CA 125. Etude de 328 observations de medecine interne. Presse Med 1988;17:2287-2291. Cherin P, Herson S, Crevon MC, Hauw JJ, Cervera P, Galanaud P, Emilie D. Mechanisms of lysis by activated cytotoxic cells expressing perforin and granzyme-B genes and the protein TIA-1 in muscle biopsies of myositis. J Rheumatol 1996;23:11351142. Tews DS, Goebel HH. Cytokine expression profile in idiopathic inflammatory myopathies. J Neuropathol Exp Neurol 1996;55:342-347. Tateyama T, Nagano I, Yoshioka M, Chida K, Nakamura S, Itoyama Y. Expression of tumor necrosis
91
69.
70.
71.
92
factor-alpha in muscles of polymyositis. J Neurol Sci 1997;146:45-51. Ilia I, Gallardo E, Gimeno R, Serrano C, Ferrer I, Juarez C. Signal transducer and activator of transcription 1 in human muscle: implications in inflammatory myopathies. Am J Pathol 1997; 151:818. Leff RL, Love LA, Miller FW, Greenberg SJ, Klein EA, Dalakas MC, Plotz PH. Viruses in idiopathic inflammatory myopathies—absence of candidate viral genomes in muscle. Lancet 1992;339:11921195. Pachman LM, Litt DL, Rowley AH, et al. Lack of detection of enteroviral RNA or bacterial DNA in magnetic resonance imaging-directed muscle biopsies from twenty children with active untreated juvenile
72.
73. 74. 75.
dermatomyositis. Arthrit Rheumatol 1995;38:15131518. Nakamura S, Umeda T, Yokozeki H, Katayama I, Nishioka K. Possible involvement of tumourderived interleukin-6 in dermatomyositis associated with cervical squamous cell carcinoma. Br J Dermatol 1997;136:475-476. Hall TC. Paraneoplastic syndromes:mechanisms. Semin Oncol 1997;24:269-276. Scott AM. Clinical promise of tumour immunology. Lancet 1997;349(suppl II): 19-22. Zhang Y, LeRoy G, Seelig HP, Lane WS, Reinberg D. The dermatomyositis-specific autoantigen Mi2 is a component of a complex containing histone deacetylase and nucleosome remodeling activities. Cen 1998;95:279-289.
(c) 2000 Elsevier Science B. V. All rights reserved. Cancer and Autoimmunity Y. Shoenfeld and M. E. Gershwin, editors
Antiphospholipid Antibodies and Malignancies Ronald A. Asherson^ and Ricard Cervera^ ^ The Rheumatic Disease Unit, The Groote Schuur Hospital, Cape Town, South Africa; '^Systemic Autoimmune Diseases Unit, Hospital Clinic, Barcelona, Spain
1. INTRODUCTION Antiphospholipid antibodies (aPL) comprise those antibodies responsible for the lupus anticoagulant "in vitro" phenomenon (LA), antibodies to cardiolipin and other negatively charged phospholipids predominantly (aCL), and the antibodies responsible for the biological false positive test of syphilis (BFP-STS). They have been shown to be strongly associated with a clinical syndrome termed the "antiphospholipid syndrome" (APS), manifesting primarily repeated episodes of venous and arterial thrombosis, recurrent abortions and a moderate thrombocytopenia [1]. Although the exact pathogenesis of the APS still remains unknown and is probably multifactorial, there is increasing evidence that the binding of aPL to the phospholipid is dependent on B2-glycoprotein I (B2-GPI) a natural inhibitor of coagulation via the intrinsic pathway. It also binds to activated protein C and inhibits platelet aggregation. Together with other proteins such as prothrombin itself, B2-GPI is an essential cofactor for the binding of antibody to antigen in autoimmune situations only [2]. aPL produced by other stimuli such as drugs, infections, etc., do not require the presence of B2-GPI for binding and these situations are also not usually associated with thrombotic events. aPL and the APS occur in patients with systemic lupus erythematosus (SLE) and the "primary" syndrome (PAPS) predominantly and over the years the APS has evolved to include other manifestations involving many organs [3]. Elevated aPL concentrations (aCL or LA) has been shown to be associated with differing malignant disorders, as well as being consequent on therapy with powerful compounds such as of-interferon. Although more
frequently unassociated with clinical compHcations in these conditions, cases have been reported with typical manifestations of the APS and these may in fact antedate the clinical appearance of the malignancy. It is, therefore, of paramount importance to exclude underlying malignancies in patients presenting symptomatology related to the APS e.g., DVT and/or pulmonary embolism/arterial vascular occlusions, especially when they occur in middle-aged or elderly patients, the group most prone to develop neoplastic disease. These patients do not usually have clinical or serological features of SLE, but rather present as a PAPS, with low positive antinuclear antibodies (ANA) often demonstrable in serological testing.
2. EPIDEMIOLOGY Malignancies of various types may be associated with thromboses and it has recently become clear that a proportion of patients who suffer from malignancyassociated thrombosis have elevated aPL. The clinical association of cancer with thrombosis was first documented over 100 years ago by Trousseau [4]. The work of Bowie and his colleagues from the Mayo Clinic in the 1970s stressed the high prevalence of overt or subclinical intravascular coagulation in cancer patients [5, 6] and recent reviews have also stressed this occurrence [7, 8]. Agents which activate blood coagulation tend to promote tumour growth and spread in experimental animals. Conversely, inhibitors of coagulation may lead to tumour regression and this latter aspect has been supported by the Veterans Administration Co-
93
operative Study (CSP#75) utilizing warfarin treatment for small cell carcinoma of the lung [9]. The generation of fibrin has been associated with tumour growth [10] and tumour cells themselves or accompanying inflammatory cells may be responsible for the generation of this compound. Indeed, serum fibrinopeptide A (FPA) levels were found to be elevated in 60% of cancer patients by Ricklesetal. [11]. The levels of FPA, when serially determined, may parallel progression of disease and when persistently elevated, suggests treatment failure. FPA levels may be reduced by the administration of warfarin. A warfarin-sensitive protease which is vitamin K dependent has been discovered in Lewis lung carcinoma cells and this functions as a powerful procoagulant [12]. This enzyme is heparin-resistant. In addition to coagulation abnormalities described, other causes of vascular occlusions in cancer patients include vasculitis and this encompasses cutaneous leucocytoclastic vasculitis associated with various carcinomas [13-19], temporal arteritis and polyarteritis nodosa with hairy cell leukaemia, Churg-Strauss vasculitis with melanoma [22], Henoch-Schonlein purpura with carcinoma of the lung [23-24], central nervous system angiitis preceding Hodgkin's disease [25], Raynaud's phenomenon antedating the diagnosis of a malignant tumour [26] and digital gangrene [27-32]. Estimates of the frequency of antiphospholipid antibodies (aPL) in malignancies vary. Zuckerman et al. [33] studied the prevalence of aCL in patients with malignancy as well as investigating the possible association of aCL with thromboembolic events in these patients. They included 216 patients in their group and an age matched control group of 88 healthy subjects. Forty-seven (22%) of the cancer patients were found to be aCL positive compared with only 3 (3%) of the control group. The aCL positive cancer patients had a significantly higher rate of thromboembolic events than the aCL negative cancer patients (13/47 = 28% vs 24/169 = 14%, respectively (p < 0.05)). Interestingly, when aCL levels were followed, in four patients, the levels decreased after successful surgery/chemotherapy treatment and remained negative with the patients being thromboembolism free for 12 months of follow-up. High titres of either IgG aCL or IgM aCL were found in 10/13 patients with throm-
94
boembolic complications, but in only 2/34 patients without thromboembolic complications. Lupus anticoagulant (LA) positivity was detected in 2-12% of their series by Gastineau et al. [34], while Love and Santoro [35] found 3% aPL positivity in their series. Studies on aPL positivity in haematological malignancies particularly have also been undertaken. Stasi et al. [36] found 10 aPL positive patients only in their group of patients with acute myeloid leukaemia (AML) and non-Hodgkins' lymphoma (NHL). Five out of 19 patients with AML (26.3%) and 5 out of 14 with NHL (35.7%) had elevated aPL levels at the time of diagnosis. aPL normalised in all patients responding to treatment, whereas the nonresponders retained their elevated levels. In addition, 6 patients (4 with AML and 2 with NHL) who had normal aPL at the time of diagnosis and who were either refractory to treatment or in relapse, subsequently developed LA and/or aCL positivity. These investigators also measured the cytokines IL-6, TNF-Qf and IL-2r and found that the levels of these cytokines correlated with IgG-aCL. They postulated that the aPL may have a role as markers of disease activity and progression in these haematological malignancies. The prevalence of malignant disease in aPL positive patients has also been extensively investigated and was found to be 20 and 17% in two consecutive series ofpatients [37,38]. A large prospective epidemiological study on the occurrence of malignant disease in aPL positive patients was recently conducted in Montpelier, France [37]. One thousand and fourteen patients were tested at entry and, interestingly enough, carcinoma was the most frequendy associated disease. Among the 72 aPL positive patients, 14 had a history of carcinoma, 9 had active malignant disease while 5 were in cHnical remission. The types of malignant diseases are reproduced in Table 1. One patient in the above study, with NHL was aPL positive when first tested, but was found to be negative on repeat testing, once complete remission had been achieved. None of the patients who were positive and had malignant disease had a history of thrombosis, nor did any of the aPL positive patients have a history of drug exposure associated with induction of aPL (e.g., phenothiazines).
Table 1. APA positive patients: Malignant disease Patient
Table 2. Malignancies with aPL
Sex
Age
Malignant disease
Remission
1
F
84
No
2 3 4 5 6 7 8 9 10
M F M M F M M M M
25 88 68 74 68 70 78 88 58
11 12 13 14
F M F M
60 78 86 54
Hepatic metastasis (unknown origin) Non-Hodgkin lymphoma Ovarian carcinoma Hepatocarcinoma Pulmonary epithelioma Colon adenocarcinoma Prostatic adenocarcinoma Bone metastasis Prostatic adenocarcinoma Cutaneous squamous-cell carcinoma Breast carcinoma Prostatic adenocarcinoma Breast carcinoma ORL carcinoma
No.
No No No No No No No No Yes Yes Yes Yes Yes
Malignancy
Conditions
Solid tumours
Lung, colon, cervix, prostate, liver, caecum, kidney (hypernephroma, thymus (thymoma), oesophagus, maxilla, ovary, breast
Haematological
Myeloid/lymphatic leukaemias. Hairy-cell leukaemia, polycythaemia, myelofibrosis
Lymphoproliferative
Non-Hodgkin lymphoma, Hodgkin's, lymphosarcoma; cutaneous T-cell lymphoma; Sezary syndrome
diseases Paraproteinemias
Monoclonal Gammopathies, Waldenstrom's macroglobulinemia, multiple myeloma
Immunotherapy
a-interferon treatment
Source: Schved et al., 1994.
In a previous study, undertaken by Jude et al. [38] in 1988, among a smaller series of 100 patients with positive LA, were 17 with a history of neoplasia, including haematologic maUgnant disease. The tumour neoplasias included carcinoma of the breast, uterus, ovary, tongue and lip (17%). Finazzi et al. [39] followed 360 aPL positive patients for 5 years prospectively with regular 6-month follow-up examinations. Five patients (age 42-70 years) developed a malignant neoplastic disease during the follow-up period. One patient (age 42 years) with primary APS developed a breast carcinoma and 4 presented with NHL. These included one with Waldenstrom's Macroglobulinaemia. Eighteen patients died during the follow-up period. Haematological cancers accounted for 5 of these deaths. The four new cases of NHL recorded with an estimated rate of 0.28% was far higher than the expected incidence of NHL which ranges between 5-15 X 1001000/year. Not only are antibodies to cardiolipin and positive lupus anticoagulants found in patients with malignancies, but specifically antibodies to phosphatidylinositol [40]. Faiderbe et al. [41] described antibodies to phosphatidylinositol in sera of patients with malignant tumours, regardless of the type, grade or organ lo-
cation as well as finding them in female rats during the development of chemically-induced malignancy, mammary tumours or sarcomas [42]. Occasionally aPL have disappeared following surgical removal of a tumour [43]. It is well known that nonbacterial thrombotic endocarditis (NBTE) with Trousseau's syndrome is a common manifestation of malignant diseases, particularly in those affected with lung or gastrointestinal tract carcinomas and pancreatic adenocarcinomas. One such case with Trousseau's syndrome, NBTE and LA, accompanied by antibodies to phosphatidylinositol as well as B2-GPI was documented by Bessis et al. [44].
3. CLINICAL ASSOCIATIONS The clinical association of aPL with mahgnancies are shown in Table 2. A large variety of solid tumours, haematological and lymphoproliferative malignancies have been documented as being associated with aPL/APS itself which is most frequently manifested by thromboses (venous/arterial) on occasion accompanied by haematological disturbances such a thrombocytopenia or haemolytic anaemia.
95
3.1. Solid T\imours
4. HAEMATOLOGICAL: LEUKEMIA
Patients with solid tumours exhibiting positive aPL have been sporadically reported and they include carcinoma of the lung [45, 46] kidney [47, 48], colon [49], prostate [50], liver [51], ovary [52], trachea [53] as well as thymoma [54]. The 2 patients reported with lung carcinoma [4546] had differing clinical aPL-associated complications. The first had elevated titres of aCL (IgG isotype) and suffered recurrent DVT and pulmonary embolism resistant to anticoagulation with warfarin as well as SC heparin. Venous gangrene supervened and the patient died 7 months following his initial presentation. The second patient presented with extensive bruising, purpura and splinter haemorrhages. He was also found to have a right hemiplegia. Severe thrombocytopenia (8 X 10^/1) was detected with positive LA, elevated IgG and IgM aCL and a false positive VDRL. A CT brain scan was compatible with a left parietal haemorrhagic infarction. Both the patients reported with renal carcinoma [47] had pulmonary embolism, while the second [48] only demonstrated a false positive VDRL as well as positive serology for SLE with thrombocytopenia. The tumour in this case was a hypernephroma. Interestingly the patient with a prostate carcinoma [50] had developed the haemolytic-uraemic syndrome (HUS) accompanying systemic sclerosis. Thrombotic microangiopathy was found on renal histology. It was suggested by the authors that the scleroderma was of paraneoplastic origin. Ruffatti et al. [52] reported a 41-year-old female who had a history of recurrent superficial thrombophlebitis DVT and pulmonary emboli with positive LA and IgM aCL (IgG aCL was normal). Three months later, she subsequendy developed a right iliac vein occlusion extending to the inferior vena cava and renal veins. CT scan of the abdomen showed a pelvic mass which proved to be an ovarian endometrial adenocarcinoma. With surgical removal, LA activity and IgM aCL disappeared. This patient also demonstrated NBTE affecting the tricuspid valve. Of interest in this particular case was the demonstration of an increased level of polyclonal IgM suggesting that the IgM aCL activity derived from this abnormal protein.
4.1. Leukaemias
96
aPL have been infrequently described in association with leukaemias. One patient who had the unusual combination of chorea, eosinophilia and acute lymphoblastic leukaemia, was reported by Schiff and Ortega [56]. Donner et al. [56] also reported a patient with acute lymphoblastic leukaemia who had developed cerebral infarction [57]. A 66-year-old female with acute monocytic leukaemia had an elevated IgG aCL and a positive LA and developed a hemiplegia with obstruction of a tibial artery resulting in ischaemia of the toes with necrosis [58]. The vascular occlusions occurred in the presence of severe thrombocytopenia in this case (< 10 X 10^/1). The presence of aPL in patients with acute myeloid leukaemia (AML) was investigated by Lossos et at [59], Twenty-five of 37 consecutive AML patients were found to be positive for aCL (68%); none had high positive titres, 8 had moderate positive titres and 11 had low positive levels. The titres did correlate with AML activity in 93% of the patients during 4 19 months of follow-up. The authors suggested that aCL may be a useful adjunct in predicting relapse and documenting disease activity and response to therapy. A smaller study undertaken by Stasi et al. [36] previously found an LA and aCL prevalence of 26% in a group of 19 patients with AML. An 80-year-old Japanese male, admitted because of TIA with a past history of recurrent TIA was found to have a positive LA. One year later he developed severe thrombocytopenia (28 x 10^/1) and chronic myelomonocytic leukaemia was diagnosed on bone-marrow biopsy [59]. Hairy-cell leukaemia in a patient with positive LA which resolved followed splenectomy was documented by Duncombe et al. [60].
5. LYMPHOPROLIFERATIVE DISORDERS 5.1. Lymphomas Lymphoproliferative disorders not infrequently occur in the autoimmune group of disease, particularly SLE
(61-65), Sjogren's syndrome [66-69] and rheumatoid arthritis [69-71]. Although NHL has been frequently encountered in SLE patients, Hodgkin's disease is distinctly rare [72]. The lymphoma may precede, occur simultaneously or follow the diagnosis of SLE, the latter being the commonest sequence of events. There has been speculation that immunosuppressive therapy may be responsible for the development of these malignancies [73-75]. In 1975, Schwartz [76] reviewed evidence of the association between the immunosuppressed state and the development of lymphoid maUgnancies, similar to the situations seen with AIDS. Sciarra et al. [77] looked at 22 patients with newly diagnosed NHL. Nine of the 22 (40.9%) presented elevated aPL at the time of diagnosis. The aPL levels normalised in all patients responding to treatment, whereas the nonresponders retained elevated levels. One patient with negative aPL at the time of diagnosis subsequently developed elevated aPL in relapse. Concordance between aCL and LA reached 12%. There were no clinical differences between patients with normal or elevated aPL levels and no thromboembolic events in the aPL positive group. Duhrsen et al. [78], among their series of patients, singled out one patient who developed low-grade NHL with an autoimmune haemolytic anaemia combined with Ig and IgA deficiencies 18 years following a spontaneous abortion. An IgM-K monoclonal gammopathy appeared 5 years later. LA was positive and correlated with the IgM concentration temporally. Mills et al. [79] also documented a patient with an autoimmune haemolytic anaemia who subsequently also developed lymphocytic lymphoma 3 years later accompanied by positive LA. Asherson et al. [80] subsequently reported a female with a history of polyarthralgias who developed SLE and lymphoma simultaneously. The lymphoma responded well to chemotherapy and steroids. She then developed an arterial occlusion resulting in amputation of a toe, TIA, livedo reticularis and thrombocytopenia (68 X 10^/1). aCL (IgM isotype) was positive and a biological false test for syphilis was also demonstrated subsequently. The activity of the SLE in this patient appeared to increase after cessation of chemotherapy for the lymphoma. The authors felt that the lymphoma in this patient may have been preceded by clinical/serological SLE by as long as 10 years.
5.2. Cutaneous T-Cell Lymphoma Immunological disorders frequently occur in patients with cutaneous T-cell lymphoma and include monoclonal gammopathy, haemolytic anaemia, cold agglutinins, acquired factor VII inhibitor, warm and cold erythrocyte antibodies and plasma cell myeloma . Mycosis Fungoides characterised by a clonal proliferation of CD4 and CDW29 positive cells, may be associated with B-cell proliferation and the production of a variety of antibodies, including those directed against phospholipids. Clinically the condition exhibits erythroderma. One such patient who developed cutaneous necrosis associated with a low free protein S, was reported by Hill et al. [82]. Protein S acts as a cofactor to protein C, a natural inhibitor of clotting and is vitamin K dependent, as is protein C itself. Spontaneous cutaneous necrosis has been seen with the use of warfarin, which reduced protein S in patients with a heterozygous deficiency of this compound. Some patients with aPL have been shown to have a deficiency of their protein S accompanied by high levels of C4b binding protein. A previous case of cutaneous T-cell lymphoma also of the mycosis fungoides type with APS was documented by Allegue et al. [83]. One patient with Sezary syndrome (erythroderma associated with abnormally hyperconvoluted lymphocyte T cells in peripheral blood) with positive LA and elevated IgG aCL but without clinical complications was reported by Carrascosa et al. [84].
5.3. Peripheral T-Cell Lymphoma (PTCL) This term includes heterogenous diseases such angioimmunoblastic T-cell lymphoma, angiocentric lymphoma, intestinal T-cell lymphoma and adult Tcell lymphoma/leukaemia. The majority however are grouped in a category termed "peripheral T-cell lymphoma, unspecified". These latter lymphomas usually affect adults with generalised disease and may involve extranodal sites. The clinical course is often aggressive with frequent relapses [85, 86]. A 65-year-old man with a history of hypertension and ischaemic stroke and recurrent deep vein thrombosis was documented by Onida et al. [87]. Lymph node biopsy was consistent with a diagnosis of PTCL. He had partial obliteration of the main branches of
97
the pulmonary artery and a possible left renal infarct. Multiple diffuse ischaemic lesions were evident on CT brain scanning. He demonstrated elevated IgM aCL of 22 units/ml and a positive lupus anticoagulant test.
5.4. Lymphoma of the Spleen: Malignant Lymphoplasmacytic Lymphoma of the Spleen Primary lymphoma of the spleen is a rare condition, the incidence being 1-11.6% of malignant lymphomas [88, 89]. Four patients with primary lymphoplasmacytic malignant lymphoma, all of whom demonstrated high levels of monoclonal IgM and LA were reported by Ciaudo et al. [90]. One patient in this series (patient number 3) developed pulmonary embolism following orthopaedic surgery without prophylactic anticoagulation treatment. No thrombotic events occurred in the other patients following splenectomy. This may be explained by the fact that the LA in all patients was associated with immunoglobuhn class IgM not very frequently associated with thrombotic complications.
6. MONOCLONAL GAMMOPATHIES In this situation, a monoclonal protein is present in serum ("M" protein). This is an immunoglobulin which persists constantly at an elevated level over many years without the development of any malignant systemic disease. It is caused by the proliferation of a single clone of mature differentiated B lymphocytes producing this y-globulin. This monoclonal immunoglobulin may not only be directed against proteins of the coagulation pathway (usually factor VIII) but may also be an antibody against the phospholipid of tissue thromboplastin, resulting in a 'lupus-like' anticoagulant/Antiphospholipid Syndrome. The first such case was described by Thiagarajan [91] in 1980. This was an IgM which reacted specifically with phosphatidylserine and phosphatidylinositol and prolonged the PTT and RVVT in vitro. "Lupus anticoagulants" are generally polyclonal immunoglobulins.
98
Reviewing patients over a 20-year period at the Mayo Clinic who had demonstrated a serum IgM monoclonal gammopathy, it was found that patients could be classified into several groups, the majority (56%) falling into "monoclonal gammopathy of undetermined significance" (MGUS) with no constitutional symptoms, hepatosplenomegaly, lymphadenopathy or anaemia who required no chemotherapy [92, 93]. This is also referred to as benign monoclonal gammopathy. These paraproteins are also produced with other B-cell disorders which include multiple myeloma, and Waldenstrom's macroglobulinaemia mainly. To a lesser extent they may also be produced in patients with lymphoma, chronic lymphocytic leukaemia and hairy cell leukaemia. Usually haemolytic complications ensue but these complications are often multifactorial and not due to the paraproteinemia alone (e.g., thrombocytopenia, renal failure, clotting factor depletion, etc.). Splenectomy often improves platelet damage by this organ. In patients with MGUS, myeloma or Waldenstrom's macroglobulinaemia, the monoclonal protein may demonstrate unusual specificities e.g., antistreptolysin, antinuclear, dsDNA, apolipoprotein or even anticardiolipin activity [94]. Up to 10% of MGUS sera demonstrate autoantibody activity without autoimmune disease. aPL in patients with MGUS were studied by Stern et al. [95] in 1994. In MGUS sera it was found that they manifested a significantly higher (p < 0.01) incidence of aPL than did normal controls. Monoclonal gammopathies with LA activity and/or a biological false positive test for syphilis (BFP STS) have been described by many investigators [96-98]. However clinical manifestations of the APS have not been frequent. A 73-year-old male documented by Drusin et al. [99] with Waldenstrom's macroglobulinaemia and a BFP-STS experienced multiple myocardial infarctions. Lechner and Pabinger-Fasching [100] also refer to one of their 5 patients with paraproteinemia who developed thrombotic complications. Bellotti et al. [101] in their study of three patients with monoclonal gammopathies and "lupus-like" anticoagulants included one each with MGUS, myeloma and lymphoma. Only the patient with lymphoma had any APS related complaints, viz., recurrent TIA.
7. MYELOMA Myeloma patients are predisposed to thrombosis because of a number of factors which include immobilisation, hyperviscosity, low grade DIC and possibly hypercalcaemia [1]. To this list must also be added the aPL. Myeloma is one of the B-cell disorders characterised by significant paraprotein production and most of the associated haemostatic abnormalities act to increase the risk of clinically significant bleeding rather than thrombosis [102].
7.1. Plasma Cell Dyscrasias/Multiple Myeloma Among 10 patients with LA reviewed by Duhrsen et al. [102] were two with multiple myeloma and monoclonal gammopathy. One suffered from lymphoplasmacytoid (LP) immunocytoma. In the one patient with myeloma, recurrent DVT preceded the diagnosis of multiple myeloma with IgG-K monoclonal gammopathy and K-light chain Bence-Jones proteinuria by 10 years. The patient died from a pulmonary embolus. Acute small bowel infarction and obliterating peripheral vascular disease had also occurred. In the second multiple myeloma patient, with a 2year history of the disease, both venous and arterial occlusions were seen. Pulmonary emboli also supervened in this patient. Repeated myocardial, renal and cerebral infarctions were recorded. The patients with malignant systemic disease differ from the SLE patients in that: (a) the paraproteinemia accompanying SLE rarely, if ever, exceeded a level of 2000 mg/dl; (b) Bence-Jones proteinuria and marrow plasmacytosis were missing; (c) a revised sex ratio to SLE was evident; (d) a higher age of disease onset; and (e) a lesser frequency of serological autoimmune phenomena were seen in the malignant group of patients. In addition, the coagulation abnormalities were not as homogeneous as those seen in the autoimmune group e.g., a powerful antithrombin effect of the LA in one patient, prolonging the PT greatly [103]. Among the 3 patients described by Bellotti et al. [101] was one patient with multiple myeloma, a 59year-old male with the prolonged thrombin time of 18
sec (n = < 15 sec) and an activated partial thromboplastin time (aPTT) of 85 sec (n =< 50 sec). LA was demonstrable. No clinical complications were recorded in this patient.
8. APS ASSOCIATED WITH IMMUNOTHERAPY Immunotherapy using interleukin-2 (IL-2), ainterferon or both, for patients with melanoma may induce increased levels of antithyroid microsomal and antithyroglobulin antibodies which may persist for months [104-106] as well as the induction of other autoantibodies [107]. Becker et al. [108] reported that immunotherapy in patients with cancer may be associated with the induction of aPL. Thirty melanoma patients were studied and 2 out of 4 treated with of-interferon alone (50%) and 3 out of 8 (37.5%) treated with IL-2 and ainterferon (37.5%) developed aPL. In this group, aPL elevations were detected on of-interferon alone. In the 5 patients with increased aPL, all showed a prolongation of the partial thromboplastin time and 4/5 (80%) had DVT, which in one patient was followed by a pulmonary embolus. Naldi et al. [109] then reviewed 97 consecutive cases of melanoma and found one with increased aPL and also documented another with a superficial melanoma who had a history of recurrent spontaneous abortions and cerebrovascular accident. The mechanism by which interferon particularly induces aPL is unknown, but may include alteration in endothehal cell integrity, induced by cytokines [110].
9. aPL FOLLOWING CHRONIC GRAFT-VERSUS-HOST DISEASE: ALLOGENEIC BONE-MARROW TRANSPLANTATION aPL have been described in several patients after allogeneic bone-marrow transplantation in association with graft-versus-host disease [104-105]. In the one patient documented [105], it was thought that the severe thrombocytopenia may have been associated with the presence of aPL.
99
10. BONE-MARROW NECROSIS Bone-marrow necrosis, a rare condition, most commonly found in patients with neoplastic disorders, severe infections and sickle cell disease, has also been reported in patients with the APS [111,112]. A patient with high grade B-cell lymphoma presenting with bone-marrow necrosis, followed by extensive marrow fibrosis was recently reported by Murphy etal. [113].
10.
11.
12. REFERENCES 13. 1.
2.
3.
4.
5.
6.
7.
8.
9.
100
Asherson RA, Cervera R, Piette J-C, Shoenfeld Y. In: Asherson RA, Cervera R, Piette J-C, Shoenfeld Y., eds. The antiphospholipid syndrome: History, definition, classification and differential diagnosis. The Antiphospholipid Syndrome. Boca Raton, FL: CRC Press 1996:3-12 Kandiah DA, Krihs SA. In: Asherson RA, Cervera R, Piette J-C, Shoenfeld Y, eds. Immunology and Methods of Detection of the Antiphospholipid Antibodies in: The Antiphospholipid Syndrome. Boca Raton, FL: CRC Press 1996:29-48. Asherson RA, Cervera R. The antiphospholipid syndrome: a syndrome in evolution. Ann Rheum Dis 1992;51:147-150. Trousseau A. Phlegmasia alba dolens. In: Clinique Medical de L'Hotel-Diev de Paris, Vol. 3. London: The New Sydenham Society 1865:94. Bowie EJW, Owen CA. Symposium on the diagnosis and treatment of intravascular coagulationfibrinolysis (ICF) syndrome, with special emphasis on this syndrome in patients with cancer. Mayo CHn Proc 1974;49:635. Sun NCJ, Bowie EJW, Kazmier FJ, Elveback LR, Owen CA. Blood coagulation studies in patients with cancer. Mayo Clin Proc 1974;49:636641. Ambrus JL, Ambrus CM, Pickern J, Solder S, Bross I. Haematologic changes and thromboembolic complications in neoplastic disease and their relationship to metastasis. J Med 1975;6:433-350. Sack GH Jr, Levin J, Bell WR. Trousseau's syndrome and other manifestations of chronic disseminated coagulopathy in patients with neoplasms. Clinical, pathophysiologic and therapeutic features. Medicine 1977;56:1-37. Zacharski LR, Henderson WG, Rickles FR, et al. Effect of Warfarin therapy on survival in small cell
14.
15.
16.
17.
18.
19.
20.
21.
22. 23.
24.
carcinoma (SCC) of the lung. JAMA 1981;245:831835. Dvorak HE, Dvorak AM, Manseau EJ, Wiberg L, Churchill WH. Fibrin gel associated with fine 1 and line 10 solid tumour growth, angiogenesis and fibroplasia in guinea pigs: Role of cellular immunity, myofibroblasts, microvascular damage, and infarction in line 1 tumour regression. J. Natl. Cane Inst. 1979;62:1459-1472. Rickles FR, Edwards RL, Barb C, Cronlund M. Abnormalities of blood coagulation in patients with cancer. Cancer 1983;51:301-307. Donati MB, Delaini F, Colucci M, et al. Cancer procoagulant: a novel vitamin K-dependent activity? Proc Int Soc Thromb Haemost 1981;46(suppl.):33A. Mertz LE, Conn DL, Vascuhtis associated with malignancy Curr Opin Rheumatol 1992;4:39-^6. Sanchez-Guerrero J, Gutierrez-Urena S, Vidaller A, et al. Vasculitis as a paraneoplastic syndrome. Report of 11 cases and review of the literature. J Rheumatol 1990;17:1458-1462. Ekenstam E, Callen JP Cutaneous leukocytoclastic vasculitis. Clinical and laboratory features of 82 patients seen in a private practice. Arch Dermatol 1984;120:484-489. Lacour J-P, Castanet J, Perrin C, et al. Cutaneous leukocytoclastic vasculitis and renal cancer: two cases. Am J Med 1993;94:104-107. Lewis JE. Urticarial vasculitis occurring in association with visceral malignancy. Acta Derm Venerol (Stockholm) 1990;70:345-347. Caruzaa F, Houdelette P, Arnoux S. Urticarial vasculitis revealing renal adenocarcinoma. A paraneoplastic syndrome? PresseMed 1992;21:1175. Collet E, Dalac S, Calillot D, et al. Paraneoplastic vasculitis and multiple myeloma. Presse Med 1990;19:1105. Greer JM, Longley S, Edwards NL, et al. Vasculitis associated with malignancy: experience with 13 patients and literature review. Medicine 1988;67:222230. Gabriel S, Conn S, Phyliky R, et al. Vasculitis in hairy cell leukaemia: review of literature and consideration of possible pathogenic mechanisms. J Rheumatol 1986;13:1167-1172. Cupps TR, Fauci AS. The VascuHtides. Philadelphia: PA Saunders 1981:116-118. Cairns SA, Mallick NP, Lawler W, et al. Squamous cell carcinoma of bronchus presenting with HenochSchonlein purpura. Br Med J 1978;2:474-475. Mitchell DM, Hoffbrand BI. Relapse of HenlochSchonlein disease associated with lung carcinoma. J Roy Soc Med 1979;72:614-615.
25. 26. 27.
28.
29.
30.
31. 32.
33.
34.
35.
36.
37.
38.
39.
40.
Moore PM, Cupps TR. Neurological complications of vasculitis. Ann Neurol 1983;14:155-167. DeCross AJ, Sahasrabudhe DM. Paraneoplastic Raynaud's phenomenon. Am J Med 1992;92:570-572. Taylor LM, Hauty MG, Edwards JM, et al. Digital ischaemia as a manifestation of malignancy. Ann Surg 1987;206:62-68. Nielson BL, Petri C. Peripheral symmetric gangrene with metastatic carcinoma of the colon. Nordisk Med 1963;21:235-239. Porter JM, Rivers SP, Anderson CJ. Evaluation and management of patients with Raynaud's phenomenon. Am J Surg 1981;142:183-189. Taylor LM Jr, Baur GM, Porter JM. Finger gangrene caused by small artery occlusive disease. Ann Surg 1981;193:543-561. Hild DH, Myers TJ. Hyperviscosity in chronic granulocytic leukaemia. Cancer 1980;46:1418-1421. Naschitz JE, Yeshurun D, Abrahamson J. Arterial occlusive disease in occult cancer. Am Heart J 1992;124:738-745. Zuckerman E, Toubi E, Golan T, et al. Increased thromboembolic incidence in anticardiolipinpositive patients with malignancy.Br J Cancer 1995;72:447-451. Gastineau DA, Kazmier FJ, Nichols WL, Borie EJ. Lupus anticoagulant: an analysis of the clinical and laboratory features of 219 cases. Am J Haematol 1985;19:265-275 . Love PE, Santoro SA. Antiphospholipid antibodies, anticardiolipin and the lupus anticoagulant in systemic lupus erythematosus (SLE) and in non-SLE disorders. Prevalence and clinical significance. Ann Int Med 1990;112:682-698. Stasi R, Stipa E, Masi M, et al. Antiphospholipid antibodies: prevalence, clinical significance and correlation with cytokine levels in acute myeloid leukaemia and non-Hodgkin's lymphoma. Thromb Haemostl993;70:568-573. Schved JF, Dupuy-Fons C, Biron C, et al. A prospective epidemiological study of the occurrence of antiphospholipid antibody; the Montpelier antiphospholipid (MAP) study. Haemostasis 1994;24:175182. Jude B, Goudermand J, Dolle I, et al. Lupus anticoagulant: a clinical study of 100 cases. Clin Lab Haematol 1988;10:41-51 . Finazzi G, for the members of the Registry. The Italian registry of antiphospholipid antibodies. Haematologica 1997;82:101-105. Falcon CR, Hoffer AM, Carreras LO. Antiphosphatidylinositol antibodies as markers of the antiphospholipid syndrome. Thromb Haemost 1990;63:321-322 .
41.
42.
43.
44.
45.
46.
47.
48.
49.
50.
51.
52.
53.
54.
Faiderbe S, Chagnaud JL, Charrier MC, et al. Antibodies directed against lipid membrane components in sera of patients with malignant tumours. Cane Detect Prev 1991;15:199-203. Faiderbe S, Chagnaud JL, Geffard L. Increase of auto anti-phosphatidylinositol antibodies in plasma of female rats during the appearance of DMBAinduced malignant mammary tumours. Cane Lett 1991;57:15-19. Malnick SD, Sthoeger Z, Ahali M, Geltner D. Anticardiolipin antibodies associated with hypernephroma. Eur J Med 1993;2:308-309. Bessis D, Sotto A, Viaid J-P, Berard M, Civrana A-J, Boffa M-C. Trousseau's syndrome with non-bacterial thrombotic endocarditis: pathogenic role of antiphospholipid syndrome. Am J Med 1995;98:511-513 . Shaukat MN, Hughes P. Recurrent thrombosis and anticardiolipin antibodies associated with adenocarcinoma of the lung. Postgrad Med J 1990;66:316318. Kozlowski CL, Johnson MJ, Gorst DW, Willey RE Lung cancer immune thrombocytopenia and the lupus inhibitor. Postgrad Med J 1987;63:793-795. Papagiannis A, Cooper A, Banks J. Pulmonary embolism and lupus anticoagulant in a woman with renal cell carcinoma. J Urol 1994;152:941-942. Marcus RM, Grayzel AL A lupus-antibody syndrome associated with hypernephroma. Arthritis Rheum 1979;22:1396-1398. Schleider MA, Nachman RL, Jaffe EA, Coleman M. A clinical study of the lupus anticoagulant. Blood 1976;48:499-509. Schreiber DP, Kapp DS. Axillary-subclavian vein thrombosis following combination chemotherapy and radiation therapy in lymphoma. Int. J Radiat Oncol Biol Phys 1986;12:391-395. Park CJ, Cho HI, Kim SI. A study on changes of coagulation inhibitors and fibrinolysis inhibitors in patients with liver cirrhosis and hepatoma. J Korean Med Sci 1991;6:1-6. Ruffatti A, Aversa S, Del Ross T, et al. Antiphospholipid antibody syndrome associated with ovarian cancer. A new paneoplastic syndrome. J Rheumatol 1994;21:2162-2163. Hofgartner F, Bader A, Buckle V, Schmeiser T, Bosch A, Sigel H. Right ventricular thrombus after pacemaker implantation in a patient with secondary antiphospholipid syndrome. Deutsche. Med Woch 1998;123:12-16. Levine SR, Diaczok IM, Deegan MG, Kieran SN, Feit H, Elias SB, Welch KMA. Recurrent stroke associated with thymoma and anticardiolipin antibodies. Arch Neurol 1987;44:678-679.
101
55.
56.
57.
58.
59.
60.
61.
62.
63.
64. 65.
66.
67.
68.
69.
102
Schiff DE, Ortega JA, Chorea, eosinophilia and lupus anticoagulant associated with acute lymphoblastic leukaemia. Pediatr Neurol 1992;8:466-468. Donner M, Bekassy NA, Garwicz S, Holmberg L, Wiebe T. Cerebral infarction in a girl who developed anticardiolipin syndrome after acute lymphoblastic leukaemia. Pediatr Haematol Oncol 1992;9: 377. Movas H, Lortholarx O, Eclache K, et al. Antiphospholipid syndrome during acute monocytic leukaemia. Eur J Haematol 1994;53:59-60. Lossos IS, Bogomolski-Yahalom V, Hatzner Y. Anticardiolipin antibodies in acute myeloid leukaemia: Prevalence and clinical significance. Am J Haematol 1998;57:139-143. Yahata N, Ohyashiki K, Iwama H, et al. Chronic myelomonocytic leukaemia in a patient with Antiphospholipid Syndrome: First case report. Leukaemia Res 1997;21:889-890. Duncombe AS, Dalton RG, Savidge GF. Lupustype coagulation inhibitor in hairy cell leukaemia and resolution with splenectomy. Br J Haematol 1987;65:120-121. Green JA, Dawson AA, Walker W. Systemic lupus erythematosus and lymphoma. Lancet 1978;2:753756. McCarty GA, Rice JR, Fetter BF, Pisetsky DS. Lymphocytic lymphoma and systemic lupus erythematosus. Their co-existence with antibody to the Sm antigen. Arch Pathol Lab Med 1982;106:196-199. Agudelo CA, Schumacher HR, Click JH, Molina J. Non-Hodgkin's lymphoma in systemic lupus erythematosus. Report of four cases with ultrastructural studies in two. J Rheumatol 1981;8:69-78. Cudworth AG, ElUs A. Malignant lymphoma and acute SLE. Br Med J 1972;3:291-292. Houssiau FA, Devogelaer JP, Gerard R, et al. Systemic lupus erythematosus and concomitant lymphoma. A case report. Acta Clin Belg 1987;42:445449. Talal N, Bunim JJ. The development of malignant lymphoma in the course of Sjogren's syndrome. Am J Med 1964;36:529-540. Asherson RA, Muncey F, Pambakian H, et al. Sjogren's syndrome and fibrosing alveolitis complicated by pulmonary lymphoma. Ann Rheum Dis 1987;46:701-705. Frayha RA, Nasr FW, Mufarrij A A. Mixed connective tissue disease. Sjogren's syndrome and abdominal pseudolymphoma. Br J Rheumatol 1985;24:7073. Symons DPH. Neoplasms of the immune system in rheumatoid arthritis. Am J Med 1985;78(suppl lA):22-28.
70. 71.
72.
73.
74.
75.
76.
77.
78.
79.
80.
81. 82.
83.
84.
85.
Reiche K. Carcinogenicity of antineoplastic agents in man. Cane Treat Rev 1984;11:39-67. Kinlen LJ, Skell AGR, Peto RJ, Doll R. Collaborative United Kingdom-Australian study of cancer in patients treated with immune suppressive drugs. Br Med J 1979;2:1461-1469. Nilsen BL, Missal MR, Condemi JJ. Appearance of Hodgkin's disease in a patient with systemic lupus erythematosus. Cancer 1967;20:1930-1933. Hehit ME, Sewell JR, Hughes GRV. Reticulum cell sarcoma in azathioprine treated systemic lupus erythematosus. Ann Rheum Dis 1979;38:94-95. Berliner S, Shoenfeld Y, Sidi Y, et al. Systemic lupus erythematosus and lymphoma. A family study. Scand J Rheumatol 1983;12:310-314. Lipsmeyer BA. Development of malignant cerebral lymphoma in a patient with systemic lupus erythematosus treated with immunosuppression. Arthritis Rheum 1872;15:183-186. Schwartz RS. Current concepts: Another look at immunologic surveillance. N Engl J Med 1975;293:181. Sciarra A, Stasi R, Stipa E, et al. Anticorpi antifosfolipidi: prevalenza, significato clinico e correlazione con i livelli di citochine nella leucemia mieloide e nel linfoma non-Hodgkin. Recenti. Prog Med 1995;86:57-62. Duhrsen U, Paar D, Brittinger G. Lupus Anticoagulant associated syndrome in benign and malignant systemic disease. Klin Wochenschr 1987;65:752822. Mills RC, Zacharskie LR, Mcintyre OR. Circulating anticoagulant, autoimmune hemolytic anaemia and maUgnant lymphoma. Am J Med Sci 1977;274:7581. Asherson RA, Block S, Houissiou FA, Hughes GRV. Systemic lupus erythematosus and lymphoma: association with an antiphospholipid syndrome. J Rheumatol 1991;18:277-279. Schaller J, Breier B. Kutane necrosen beig antiphospholipid syndrome. Z Hauttor 1992;68:96-101. Hill VA, Whittaker SJ, Hunt BJ, Liddell K, Spittle MF, Smith N P. Cutaneous necrosis associated with the antiphospholipid syndrome and mycosis fungoides. Br J Derm 1994;130:92-96. Allegue F, Martin-Gonzales M, Alonso ML, et al. Sindrome antifosfolipidos en un paciente con limphoma cutaneo de celulas. Med Cuba Ibero Lat Am 1989;17:49-51. Carrascosa M, Hernandez JJ, Perez-Castrillon JL, Sampedro I. Antiphospholipid antibodies and Sezary syndrome (letter). Am J Hematol 1995;49:365. Harris NL, Jaffe S, Stein H, Bank PM, et al. A revised European American classification of lym-
86.
87.
88.
89.
90.
91.
92. 93.
94.
95.
96.
97.
98.
99.
phoid neoplasms: a proposal from the international lymphoma study group. Blood 1994;84:1361-1392. Pinkus GS, O'Hara PJ, Said JW. Peripheral/postthymic T-cell lymphoma. A spectrum of disease, clinical, pathologic, and immunologic features in 78 cases. Cancer 1990;65:971-998. Onida P, Tresoldi M, Rugarli C. Antiphospholipidantibody syndrome associated with peripheral T-cell lymphoma 167-168. Lennert K, Histopathologic des lymphomes malins non hodgkiniens d'apres la classification de Kiel. Paris: Douin, 1981. Theml H, Burger A, Keiditsch E, Enne W, Eggert K. Klinische Beobachtungen zur Charaktersierung des splenomegalen Immunozytoms. Med Klin 1977;72:1019. Ciaudo M, Horellou MH, Audouin J, De Carbonnieres C, Conard J, Samama M. Lupus anticoagulant associated with primary malignant lymphoplasmacytic lymphoma of the spleen: a report of four patients. Am J Haematol 1991;38:271-276. Thiagarajan P, Shapiro SS, De Marco L. Monoclonal immunoglobulin MA coagulation inhibitor with phospholipid specificity. Mechanism of a lupus anticoagulant. J Clin Invest 1980;66:397-405. Kyle RA. Current concepts on monoclonal gammopathies. Aust NZ J Med 1992;22:291-300. Kyle RA, Lust JA, Monoclonal gammopathies of undetermined significance. Semin Hematol 1989'26:176-200. Guilbert B, Dighiero G, Avrameas S. Naturally occurring antibodies against nine common antigens in human sera. J Immunol 1982;128:2779-2787. Stern JJ, Ng RH, Triplett DA, Mclntyre JA. Incidence of antiphospholipid antibodies in patients with monoclonal gammopathy of undetermined significance. Am J Clin Path 1994;101:471-474. Henstell HH, Kligerman M. A new theory of interference with the clotting mechanism: the complexing of euglobulin with factor V, Factor VII and prothrombin. Ann Int Med 1958;49:371-387. Long LA, Riopelle JL, Francoeur M, Pare A, Poirier P, Georgesco M, Colpron G. Macroglobulinaemia: effect of macroglobulins on prothrombin conversion accelerators. Can Med Assoc J 1955;73:726-733. Cooper MR, Cohen HJ, Huntley CC, Waite BM, Specs L, Spurr CL. A monoclonal IgM with antibody-like specificity for phospholipid in a patient with lymphoma. Blood 1974;43:493-504. Drusin LM, Litwin SD, Armstrong D, Webster BP. Waldenstrom's macroglobulinemia in a patient with a chronic biologic false-positive test for syphilis. Am J Med 1974;56:429--132.
100.
101.
102.
103.
104. 105.
106.
107.
108.
109.
110.
111.
112.
113.
Lechner K, Pabinger-Fasching I. Lupus anticoagulants and thrombosis. A study of 25 cases and review of the Uterature. Haemostasis 1985; 15:254262. Bellotti V, Gamba G, Merlini G, et al. Study of three patients with monoclonal gammopathies and 'lupuslike' anticoagulants. Br J Haematol 1989;73:221227. Duhrsen U, Paar D, Kolbel C, Boestegers A, MetzKurschel U, Wagner R, Kirch W, et al. Lupus anticoagulant associated syndrome in benign and malignant systemic disease—analysis of ten observations. Klin Wochenschr 1987;65:852-859. Glaspy JA. Haemostatic abnormalities in multiple myeloma and related disorders. Haematol/Oncol Clinics N America 1992;6:1301-1314. Ferraro JLM, Deegh J. Graft—versus—host disease. N Engl. J Med 1991;324:667-674. Schultz M, Muller R, Von zur Muhlen A, Brabant G. Induction of hypothyroidism by interferon alpha IIB (letter)/Lancet 1989;1:1452. Schwartzentruber DJ, White DE, Zweig MH, Weintraub BD, Rosenberg SA. Thyroid dysfunction associated with immunotherapy for patients with cancer. Cancer 1991;68:2384-2390. Mayet WJ, Hess G, Gerken G, Frossole S, Voth R, Manns M, et al. Treatment of chronic type B hepatitis with recombinant alpha interferon induces auto antibodies not specific for auto immune chronic hepatitis. Hepatology 1989;10:24-28. Becker JG, Winkler B, KHngert S, Brocker EB. Antiphospholipid syndrome associated with immunotherapy in patients with melanoma. Cancer 1994;73:1621-1624. Naldi L, Locati F, Finazzi G, Barbui T, Calnelli T. Antiphospholipid syndrome associated with immunotherapy in patients with melanoma. Cancer 1995;75:2784-2785 . Richards F, Konigsberg W, Rosenstein W, Varga J. On the specificity of antibodies. Biochemical and biophysical evidence indicates the existence of polyfunctional antibody combining regions. Science 1975;187:130-136. Bulvick S, Aronson I, Ress S, Jacobs P. Extensive bone marrow necrosis associated with antiphospholipid antibodies. Am J Med 1995;98:572-574. Paydas S, Kocak R, Zorludemir S, Baslamisli F. Bone marrow necrosis in antiphospholipid syndrome. J Clin Pathol 1997;50:261-262. Murphy PT, Sivakumaran M, Casey MC, Liddicoat A, Wood JK. Lymphoma associated bone marrow necrosis with raised anticardiolipin antibody. J Clin Path 1998;51:507-409.
103
(c) 2000 Elsevier Science B.V. All rights reserved. Cancer and Autoimmunity Y. Shoenfeld and M. E. Gershwin, editors
Malignancy in Coeliac Disease and Dermatitis Herpetiformis Helena Tlaskalova, Ludmila Tuckova, Miloslav Pospisil and Renata Stepankova Academy of Science of Czech Republic, Prague, Czech Republic
1. INTRODUCTION Coeliac disease (CD), gluten-sensitive enteropathy, is defined as a permanent intolerance of dietary gluten and similar proteins of wheat, rye, barley and oats. The disease is characterized by mucosal injury appearing in genetically susceptible individuals after gluten ingestion. The active lesions in jejunal mucosa are characterized by villous atrophy crypt hypertrophy and massive lymphocytic infiltration of epithelium and lamina propria. A long-Ufe gluten-free diet is used for treatment; it usually improves the morphological picture and clinical symptoms. The incidence of the clinically characteristic CD is 1:2000. In affected children, gastrointestinal symptoms and signs of malabsorption develop soon after introduction of gluten into the diet diarrhea, abdominal pain and anorexia with retardation of growth and anemia usually appear [1-3]. In contrast, development of CD in older children and adults is not always accompanied by these characteristic symptoms. The onset of the disease in adultness often occurs atypically or without any symptoms (silent form of CD) and, therefore, eludes early and appropriate diagnosis. Recent results of screening studies applying serological markers demonstrated a much higher incidence of CD (1: 250) then described a few years ago. A ratio of 1:7 has been found for recognized versus nonrecognized coeliac cases [4, 5]. The danger of undiagnosed and/or untreated CD (patients not keeping a gluten-free diet) is in the potential of development of lymphoma or carcinoma [6, 7]. The association between clinical CD and malignancies is well established. In untreated CD, there is a 43-fold higher relative risk of small bowel lymphoma, a 12-fold higher relative risk of cancer of the oesophagus and a 10-fold higher relative risk of cancer of
the mouth and pharynx. It was shown that a glutenfree diet plays a protective role against the malignancy [8-10]. However, it is not known whether, or not, the risk of malignancy for patients with subclinical disease is the same as for patients with clinically developed disease.
2. CD AND AUTOIMMUNITY Although the pathogenic mechanism of CD is not yet fully elucidated, there is no doubt about the involvement of immune factors in the development of the disease. Many features present in CD fulfil the criteria generally accepted to define autoimmune disease and suggest that CD belongs to this group of diseases [1,11]: (1) HLA linkage: For the majority of patients, a particular HLA-DQ heterodimer, encoded by the DQAl 0501 and DQBl 0201 alleles on chromosome 6, confers the primary susceptibility to CD [1, 12]. (2) Associated autoimmune diseases: It has been reported that insulin-dependent diabetes mellitus (IDDM) occurs in 1-10% of adult coeliac patients and the prevalence of CD in patients with IDDM has been 2-7%. Similarly, 2-4% of coeliacs suffer from autoimmune thyroid disease and serological screening for CD in patients with autoimmune thyroid disease gives a coeliac prevalence of approximately 4%. The association between Sjogren's syndrome and CD was recently shown: 3-5% of adult coeliac patients had Sjogren's syndrome and 14% of patients with Sjogren's syndrome had CD [1,13]. (3) Intestinal lymphomononuclear infiltration: lymphocytic infiltration of the intestinal lamina propria
105
and increased numbers of intraepithelial lymphocytes are important diagnostic features of the disease. Intraepithelial cells are mainly CD8+ T lymphocytes with substantially increased proportion of y/5 TCR bearing cells. Plasma cells producing immunoglobulins of all isotypes (mainly IgA) and activated CD4-I- T lymphocytes are increased in lamina propria [1]. (4) Presence of specific autoantibodies: Characteristically increased levels of IgA and IgG antigliadin antibodies in sera of coeliac patients are accompanied by high levels of specific autoantibodies reacting with components of the extracellular matrix. Antireticulin, antiendomy slum and antijejunal antibodies of IgA isotype were found to have a high degree of specificity and sensitivity for CD [14]. Antiendomysial autoantibodies occurring in 90-100% of CD patients are used, therefore, for serological screening of CD [15]. We found that autoantibodies directed to enterocytes occur in most sera of coeliac patients and that both monoclonal and affinity purified antibody directed to gliadin from patients' sera exert reactivity to intestinal epithelial cells [16-18]. Furthermore, the occurrence of various autoantibodies characteristic for other autoimmune diseases were found in 5-20% of the sera of CD patients [11]. (5) Existence of defined autoantigens: Two autoantigenic molecules were recently defined as targets for autoantibodies in CD; the autoantigen of endomysium was determined as tissue transglutaminase [12, 19, 20], and one of enterocyte autoantigens sharing similar epitopes with of-gliadin was defined as calreticulin [21-23]. Tissue transglutaminase is expressed in many tissues and the enzyme is present intracellularly and extracellularly. The calcium-dependent enzymatic activity of transglutaminase catalyses deamidation or crosslinking of protein bound glutamine residues. It is suppose that transglutaminase potentiates-binding of gliadin peptides to HLA DR2 on antigen presenting cells and gliadin specific T-helper cells then promote specific antibody response by B cells. Transglutaminase is necessary for activation of transforming growth-factor-^ (TGF^) and participates in differentiation intestinal epithelium. In the extracellular environment transglutaminase is involved in extracellular matrix assembly and cell adhesion. However, how the external agent.
106
gliadin, leads to generation of IgA autoantibody formation against transglutaminase is still open to speculation [12, 19]. The second defined autoantigen, calreticulin, is a multifunctional highcapacity calcium-binding protein and molecular chaperon which is distributed in a wide variety of cells. It has been found in different locations including the lumen of the endoplasmic reticulum, the cell surface, perinuclear areas, or cytosolic granules and is expression seems to vary between cell types. Recent studies showed that this protein interacts with of-subunit of integrins, the steroid/nuclear hormone receptor family, vitamin D receptor, the B-^ chain of fibrinogen, oligomannosides of laminin and the polypeptide of Ro/SS-A ribonucleoprotein. There is also evidence to suggest the role of calreticulin in immune processes. The synthesis of calreticulin is stress induced. It has also been reported that calreticulin may be released from the lytic granules of cytolytic lymphocytes after stimulation of the T-cell receptor complex. Similarly as in the case of tissue transglutaminase the role of calreticulin in pathogenic mechanism of CD remain to be elucidated [22]. (6) Response to corticosteroids and immunosuppressive treatment: Severe forms of CD are successfully treated by corticosteroids or immunosuppressive drugs [24-26]. (7) CD is more common in females than in males, similar to other autoimmune diseases [1]. (8) Transfer of mucosal damage by intraepithelial lymphocytes: animal model of CD has been recently introduced in our laboratory by long-term gliadin feeding of rats provided that it starts from birth. Intestinal intraepithelial lymphocytes from rats suffering from gluten induced enteropathy transferred to jejunal loops of inbred recipients caused changes in recipients gut mucosa and were shown to be responsible for mucosa damaging effects [27]. (9) Transfer of the disease by lymphocytes during bonemarrow transplantation: Recently, the transfer of human bonemarrow cell suspension containing T lymphocytes from donor with CD was performed and resulted in CD development in the recipient [28]. (10) Stimulation of natural killer cell activity by gliadin in patients with coeliac disease: Spontaneous cell cytotoxicity, the lysis of susceptible targets by
unprimed lymphocytes, is considered to be an important first line of host defense against tumors and infected cells. In peripheral blood, spontaneous cell cytotoxicity is accomplished by NK cells. We did not find significant differences between NK-cell activity of peripheral blood mononuclear cell from healthy donors and patients with CD. However, a 1-day incubation of peripheral blood lymphocytes with gliadin induced cytotoxic cell activity against the natural killer resistant target cells, such as the epithelial HT29 cells and the lymphoblastoid RAJI cell lines suggesting that the activation of peripheral NK cells by gliadin can occur [29].
herpetiformis and the other with CD imply that environmental factors are responsible for the development of the rash in dermatitis herpetiformis. The presence of antigliadin and antiendomysial autoantibodies in sera of patients suggests a common pathogenetic mechanism, but the nature of the autoantigen and its role in the blister formation remains to be elucidated [31]. As with CD, an increased incidence of malignant disease (lymphoma) has been reported in patients with dermatitis herpetiformis. A gluten-free diet appears to protect patients from this complication [32, 33]. The results of these studies give further support for advising patients to adhere to a strict gluten-free diet for life.
3. DERMATITIS HERPETIFORMIS Dermatitis herpetiformis was described 100 years ago by Louis Duhring as a relatively rare skin disease characterized by a rash with small blisters and intense itch. Predilection sites are on the elbows, knees and buttocks, but lesions can also be found on the scalp, axillary folds and back. The onset in young adults is usually sudden. Diagnosis is based on biopsy from the uninvolved skin; immunofluorescence shows characteristic granular IgA deposits along the basement membrane. In dermatitis herpetiformis lesions, subepidermal blisters with cellular inflammatory infiltration are found. The rash is gluten-dependent and the improvement in skin lesions occurs slowly; even on a strict gluten-free diet it lasts several months before the patient can stop using dapsone (diaminodiphenyl sulphane) which controls the rash in few days and, therefore, it has been used for years in the treatment of dermatitis herpetiformis [30, 31]. Even though less than 10% of patients with dermatitis herpetiformis have gastrointestinal symptoms suggestive of CD, they all have gluten-sensitive enteropathy ranging from flat mucosa to normal mucosal architecture, but with increased numbers of intraepithelial y8 TCR-bearing T cells. Molecular genetics did not point out any difference between dermatitis herpetiformis and CD. The genetic background of dermatitis herpetiformis is the same as in CD. Both conditions are associated with the class II HLA DQ2 molecule, and especially with DQ alleles Al 0501 and Bl 0201. The disease can cluster in famiUes similar to CD. Monozygotic twins, one with dermatitis
4. NON-HODGKIN LYMPHOMA (EATL, ENTEROPATHY-ASSOCIATED T-CELL LYMPHOMA) Coeliac patients have a higher incidence of nonHodgkin's lymphoma than that of the general population [7, 34-39]. Malignancy develops in 8-13% of patients. EATL is slightly more frequent in males and has its peak in the sixth decade of life. An interesting recent finding shows that the incidence of lymphoma in CD diagnosed in elderly patients (over 60 years) was much higher (23%) than that in younger population (8%). Moreover, other autoimmune diseases, dermatitis herpetiformis and autoimmune thyroiditis, were common in this group of patients [10]. The relationship between EATL and CD is underlined by the finding of the CD associated DQAl 0501, DQBl 0201 phenotype in EATL patients. In most cases lymphoma and CD are found together or diagnosed at about the same time. The diagnosis of lymphoma arising in the context of CD is often difficult and delayed because the symptoms are nonspecific and indistinguishable from noncomplicated CD itself. A rise in serum IgA level can be found, but this could be also seen in uncomplicated CD. In some patients the symptoms are acute, involving for instance intestinal perforation or obstruction, bleeding from the tumor or an opportunistic infection. Tumors are usually located in the jejunum but may be found in the ileum, stomach and colon. At diagnosis, the lymphoma is usually widespread and the prognosis is therefore very poor [7].
107
The understanding of celiac-associated lymphomas has improved in recent years [40]. It was shown that ceUac-associated lymphomas were of single histogenetic type. Immunohistological and molecular studies then indicated that these tumors are of T-cell origin. It appears likely that enteropathy associated T-cell lymphoma derives from intraepithelial lymphocytes (lEL); monoclonal HML-1 antibody stains lymphoma cells (CD 103-1- lymphocytes expressing integrin-Qf E-fi 7 characteristic for mucosal associated lymphocytes). The lymphoma cells are usually pleiomorphic and manifest a cytotoxic CD3-I-, CD4/CD8-phenotype [41, 42]. A monomorphic small cell variant has been described in which the cells are CD3+, CD4-, CD8-h and CD56+. To assess the clonality of duodenal mucosal T cells in coeliac patients, the analysis of TCR rearrangements by multiplex polymer chain reaction (PCR) on DNA extracted from duodenal biopsies of patients with complicated and noncomplicated celiac disease was recently performed and published [43]. None of the 15 patients studied had histological evidence of lymphoma. In this study performed by PCR analysis of Yy-]y genes, it was found that a minority of patients had a monoclonal rearrangement and the majority of patients had a polyclonal (8 cases) or oligoclonal (3 cases) pattern. A monoclonal pattern was associated with complicated CD (ulcerative jejunitis and nonresponsive CD), whereas, polyclonal or oligoclonal patterns were associated with uncomplicated CD. Three patients with complicated CD evolved later to T-cell lymphoma with liver or bonemarrow invasion. Interestingly, identical clones were found in enteropathic duodenojejunum and peripheral blood in a patient with large cell lymphoma with bonemarrow invasion. The study suggested that some patients with adult onset of the disease may have a cryptic low-grade T-cell lymphoma and may be at a higher risk of developing a subsequent overt enteropathyassociated T-cell lymphoma. Moreover, the authors of this study suggested that in patients with complicated CD, molecular analysis of clonality may be used to provide earlier diagnosis of lymphoma by detecting a predominant T-cell clone before a tumor mass is evident [43, 44]. The relationship of lymphoma and refractory sprue (i.e., disease mimicking coeliac sprue refractory to a gluten-free diet) seems to be clinically important. Recently, a multicenter study was presented demonstrat-
108
ing that ulcerative jejuno-ileitis, collagenous colitis and mesenteric lymph node cavitation are the most frequent associated features of refractory sprue. Abnormal phenotypic intestinal intraepitheUal lymphocyte population expressing CD3 but not CD8, with a clonal TCR-y gene configuration was found in most patients with refractory sprue suggesting that most patients with refractory sprue may have a prelymphomatous condition [45].
5. CARCINOMA OF GASTROINTESTINAL TRACT The British collaborative study of CD and malignancy coordinated from Northwick Park was published in 1989 [8]. Among 235 coeliac patients with malignancy, 67 had small intestinal lymphoma, 19 had small bowel carcinoma, 10 had carcinoma of the oesophagus and 4 had carcinoma of the pharynx. It was suggested that the risk of oesophageal and pharyngeal cancer might be reduced by a gluten-free diet, similar to the case of small gut lymphoma. Carcinoma of the small bowel as a complication of CD was shown to be the most common invasive malignancy after lymphoma. Anemia is the most usual initial feature and is often associated with blood loss. Weight loss, abdominal pain and intestinal obstruction are other prominent features. Bowel radiology will be helpful in locating the tumor. If the tumor is in the proximal duodenum it may be seen at endoscopy. In cases where the tumor is still confined to the bowel, the resection can substantially prolong the survival. Cancer of the small intestine is rare compared with other sites in the gastrointestinal tract. Out of the four major primary small bowel tumors (adenocarcinomas, lymphomas, carcinoid, and leiomyosarcomas), adenocarcinomas and lymphomas are associated with diseases that seem to increase the risk of developing these malignancies. Therefore, treatment of the predisposing condition seems to decrease the risk of developing subsequent malignancy.
ACKNOWLEDGEMENTS This publication has been supported by Grant Nos. 312198/K034, 311/97/0784 and 306/98/0433 of the Grant Agency of Czech Republic; Grant Nos.
A7020716 and A7020808/1998 of the Grant Agency of the Czech Academy of Science; Grant Nos. 50513, 4150-3 and 5264-3 from the Ministry of Health of the Czech Republic and Grant VS 96149 from the Ministry of Education, Youth and Sport.
15. 16.
REFERENCES 1.
2. 3.
4.
5.
6. 7. 8.
9. 10.
11. 12.
13.
14.
Strober W, Fuss IJ. Gluten-sensitive enteropathy and other immunologically mediated enteropathies. In: Ogra PL, Lamm ME, Binenstok J, Mestecky J, Strober W, McGhee JR, eds.. Mucosal Immunology. San Diego: Academic Press, 1999;1101-1128. Trier JS. Diagnosis of celiac sprue. Gastroenterology 1998;115;211-216. Kasarda DD. Gluten and gliadin: precipitating factor in coeliac disease. In: Maki M, Collin P, Visakorpi JK, eds., Coeliac Disease. Tampere, Finland: Coeliac Disease Study Group, 1997;195-219. Catassi C, Ratsch IM, Fabiani E, Rossini M, Bordicchia F, Candela F, Coppa GV, Giorgi PL. Coeliac disease in the year 2000: exploring the iceberg. Lancet 1994;343;200-203. Catassi C. Gliadin antibodies. In: Peter JB, Shoenfeld Y, eds.. Autoantibodies. Amsterdam: Elsevier, 1996;285-290. Ferguson A, Kingstone K. CoeHac disease and malignancies. Acta Paediatr 1996;412(suppl):78-81. Holmes GKT. Cehac disease and malignancy. J Pediatr Gastroenterol Nutr 1997;24:520-524. Holmes GKT, Prior P, Lane MR, Pope D, Allan RN. Malignancy in celiac disease—effect of a gluten free diet. Gut 1989;30;333-338. Parnell ND, Ciclitira PJ. Coeliac disease and its management. Aliment Pharmacol Ther 1999;13:1-13. Freeman HJ. Neoplastic disorders in 100 consecutive patients with adult celiac disease (CD). Seventh International Symposium on Coeliac Disease (abstract). Tampere, Finland: 1996;31. Lemer A, Blank M, Shoenfeld Y Celiac disease and autoimmunity Isr Med Sci 1996;32;33-36. Sollid L, Scott H. New tool to predict celiac disease on its way to the clinics. Gastroenterology 1998;115;1584-1594. Reunala T, Collin P, Lewis HM, Fry L. Associated diseases and malignancy in dermatitis herpetiformis. In: Maki M, Collin P, Visakorpi JK, eds., Coeliac Disease. Tampere, Finland: Coeliac Disease Study Group, 1997;75-79. Ascher H, Hahn-Zoric M, Hanson LA, Kilander AF, Nilsson LA, Tlaskalova H. Value of serologic markers
17.
18.
19.
20.
21.
22.
23.
24.
25.
for clinical diagnosis and population studies of coeliac disease. Scand J Gastroenterol 1996;31;61-67. Peter JB, Shoenfeld Y Autoantibodies. Amsterdam: Elsevier, 1996. Tlaskalova-Hogenova H, Stepakova R, Fric P, Kolinska J, Vancikova Z, Jilek M, Kocna P, Lipska L, Slaby J. Dvorak M. Lymphocyte activation by gliadin in coeliac disease and in experimentally induced enteropathy of germfree rats. In: MacDonald TT, et al., eds., Advances in Mucosal Immunology. Dordrecht: Kluwer, 1999;781-784. Tlaskalova-Hogenova H, Stepakova R, Tuckova L, Farre MA, Vetvicka V, Travnicek J, Fric P, Kolinska J, Vancikova Z, Jilek M, Kocna P, Fric P, Holub M, Zoric M, Nilsson L, Ascher H, Hanson L. Autoimmune reaction induced by gliadin. In: Mestecky J, et al., eds.. Advances in Mucosal Immunology. New York: Plenum Press, 1995;1191-1197. Tuckova L, Tlaskalova-Hogenova H, Farre MA, Karska K, Rossmann P, Kolinska J, Kocna P. Molecular mimicry as a possible cause of autoimmune reactions in celiac disease? Antibodies to gliadin crossreact with epitopes on enterocytes. Clin Immunol Immunopathol 1995;74;170-176. Schuppan D, Dietrich W, Riecken EO. Exposing gliadin as a tasty food for lymphocytes. Nature Medicine 1998;4;666-667. Scott H, Brandtzaeg. Endomysial autoantibodies. In: Peter JB, Shoenfeld Y, eds.. Autoantibodies. Amsterdam: Elsevier, 1996;237-244. Karska K, Tuckova L, Steiner L, TlaskalovaHogenova H, Michalak M. Calreticulin—the potentional autoantigen in celiac disease. Biochem Biophys Res Commun 1995;209;597-605. Tuckova L, Karska K, Walters JRF, Michalak M, Rossmann P, Krupickova S, Verdu E F, Saalman R) Hanson L A, Tlaskalova'-Hogenova H. Anti-gliadin antibodies in patients with celiac disease cross-react with enterocytes and human calreticulin. Clin Immunol Immunopath 1997;85;289-296. Krupickova S, Tuckova L, Flegelova Z, Michalak M, Walters JRF, Whelan A, Harries J, Vencovsky j , Tlaskalova-Hogenova H. Identification of common epitopes on gliadin, enterocytes, and calreticulin recognised by antigliadin antibodies of patients with coehac disease. Gut 1999;44; 168-173. O'Mahony S, Howdle PD, Losowsky MS. Review article: management of patients with nonresponsive coeliac disease. Aliment Pharmacol Ther 1996;10;671-680. Bernstein EF, Whitington PR Successful treatment of atypical sprue in an infant with cyclosporine. Gastroenterology 1988;95; 199-204.
109
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36. 37.
110
Rolny P, Sigurjonsdottir HA, Remontti H, Nilsson LA, Ascher H, Tlaskalova-Hogenova H, Tuckova L. Role of immunosuppressive therapy in refractory sprue-like disease. Am J Gastroenterol 1999;94;219225. Stepankova R, Tlaskalova-Hogenova H, Sinkora J, Jodl J, Fric R Changes in jejunal mucosa after longterm feeding of germfree rats with gluten. Scand J Gastroenterol 1996;31;551-557 Bargetzi M, Schonenberger A, Tichelli A, Fried R, Cathoma SG, Grawohl A. Celiac disease transmitted by allogeneic non-T cell-depleted bone marrow transplantation. Bone Marrow Transplant 1997;20;607609. Farre Castany MA, Nguyen HR, Pospisil M, Fric P, Tlaskalova-Hogenova H. Natural killer cell activity in coeliac disease: effect of in vitro treatment on effector lymphocytes and/or target lymphoblastoid, myeloid and epithelial cell lines with gUadin. Folia Microbiol 1995;40;615-620 Fry L. Dermatitis herpetiformis: from gut to skin. Contributions to the nature of coeliac disease. In: Maki M, CoUin P, Visakorpi JK, eds., Coeliac Disease. Tampere, Finland: Coeliac Disease Study Group, 1997;67-74. Heymans HS A, Mulder CJJ, Mearin ML. Preface. The international workshop on celiac disease and malignancy. J Pediatr Gastroenterol Nutr 1997;24;S1-S52 Swerdlow AJ, Whittaker S., Carpenter LM. Mortality and cancer incidence in patients with dermatitis herpetiformis: a cohort study. Br J Dermatol 1993;129;140-144. Collin P, Pukkala E, Reunala T. Malignancy and survival in dermatitis herpetiformis: a comparison with coeliac disease. Gut 1996;38;528-530. Logan RF, Rifkind EA, Turner ID, Ferguson A. Mortality in celiac disease. Gastroenterology. 1989;97;265-271. Marsh MN. Is celiac disease (gluten sensitivity) a premalignant disorder? J Pediatr Gastroenterol Nutr 1997;24:525-527. Wright DH. Enteropathy associated T cell lymphoma. Cancer Surv 1997;30;249-261. Bleiberg H, Duchateau J, N'Koua-M'Bon JB, Gerard B, Bron D, Debusscher L, Stryckmans P. Increased
38.
39.
40.
41.
42.
43.
44.
45.
incidence of lymphomas and carcinomas with coeliac disease. Eur J Cancer 1998;34;592-593. Murray A, Cuuevas EC, Jones DB, Wright DH. Study of the immunohistochemistry and T cell clonality of enteropathy-associated T cell lymphoma. Am J Pathol 1995;146;509-519. O'Boyle CJ, Kerin MJ, Feeley K, Given HF. Primary small intestinal tumours: increased incidence of lymphoma and improved survival. Ann Roy Coll Surg Engl 1998;80;332-334 Spencer J, Cerf-Bensussan N, Jarry A, Brousse N, Guy-Grand D, Krajewski AS, Isaacson PG. Enteropathy-associated T cell lymphoma (malignant histiocytosis of the intestine) is recognized by a monoclonal antibody (HML-1) that defines a membrane molecule on human mucosal lymphocytes. Am J Pathol 1988;132;l-5. De Bruin PC, Kummer JA, Van der Valk P, Van Heerde P, Kluin PM, Willemze R, Ossenkoppele GJ. Granzyme B-expressing peripheral T-cell lymphomas: neoplastic equivalents of activated cytotoxic T cells with preference for mucosa-associated lymphoid tissue localization. Blood 1994;84;3785-3791. Daum S, Foss HD, Anagnostopoulos I, Dederka B, Demel G, Araujo I, Riecken EO, Stein H. Expression of cytotoxic molecules in intestinal T-cell lymphomas. The German study group on intestinal non-Hodgkin lymphoma. J Pathol 1997; 182;311-317. Carbonnel F, Grollet-Bioul L, Brouet JC, Teilhac MF, Cosnes J, Angonin R, Deschaseaux M, Chatelet FP, Gendre JP, Sigaux F. Are complicated forms of celiac disease cryptic T-cell lymphomas? Blood 1998;92;3879-3886. Schmitt-Graff A, Daum S, Hummel M, Zemlin M, Stein H, Riecken EO. Presence of clonal T-cell receptor gene rearrangements provides evidence of widespread intramucosal intestinal T-cell lymphoma. Z Gastroenterol 1996;34;680-685. Cellier C, Helmer C, Patey N, Jabri B, Matuchansky C, Modigliani R, Lerebours E, Colombel JF, Deichier JC, Delabesses E, Macintyre E, Cerf-Bensussan N, Brousse N, Barbier JP. Refractory sprue. Clinical, histological and phenotypical features, and outcome: a multicenter study. Eight International Symposium on Coeliac Disease (abstract). Naples, Italy, 1999;97.
(c) 2000 Elsevier Science B.V. All rights reserved. Cancer and Autoimmunity Y. Shoenfeld and M. E. Gershwin, editors
Autoimmune Rheumatic Diseases and Cancer: Evidence of Causality? Antonio R. Villa, Arnoldo Kraus and Donato Alarcon-Segovia Instituto Nacional de la Nutricion Salvador Zubirdn, Mexico City, Mexico
1. INTRODUCTION Among the pathological entities observed in the clinical practice, there is a particularly disturbing relationship: the autoimmune rheumatic diseases that associate with malignant neoplasms. There has been exhaustive medical literature about such a relationship, mainly written since 1960 (there are more than 3000 references in a computer-search of MEDLINE on autoimmunity and cancer). Many reports were based on case-series which provided evidence of the association with malignancy in Sjogren's syndrome (SS) and rheumatoid arthritis (RA) [1-4]. However, the first papers where a rheumatic disease was associated with malignancy had been previously described. Thus, in 1916 Stertz [5] observed an increase of cancer in patients with polymyositis; in 1953 Zatuchni et al. [6] reported the association of bronchiolar carcinoma and scleroderma; and in 1959 Williams [7] published a review of the literature on dermatomyositis and malignancy. Nowadays, the majority of these studies have focused on estimating the observed risk that one patient with a rheumatic disease has to develop cancer when compared to the expected risk of the general population, independent of age, gender and/or race distribution (standardized incidence ratio (SIR)). The epidemiologic designs used to estimate the SIR have been both retrospective and prospective cohorts. Among the larger cohorts studies conducted to explore the association of malignancy with systemic lupus erythematosus (SLE) and RA, are the Finnish [8-12], the Canadian [13, 14], the Danish [15] and the American [16]. The follow-up periods were different but some of them describe observations of up to 35 years.
This chapter reviews the different probabilities of developing a malignancy (lymphoproHferative or solid) among the more frequent autoimmune rheumatic diseases. We have included only followup population-based (cohort) studies, so as to report the SIR or SMR (standardized mortality ratio) as epidemiological association measures. We conclude with a discussion about the applicability of Bradford-Hill's postulates for evidence of causality.
2. RHEUMATOID ARTHRITIS Medical literature in RA demonstrating evidence of its association with maUgnancy abounds (Table 1). Isomaki et al. [8] published the largest study conducted todate (46,101 Finnish patients with RA and 213,911 person-years of follow-up). They observed a higher risk to develop a malignancy, mainly lymphoproliferative in both males and females (SIR 2.1-2.7) when compared to that expected in the general population. However, the highest risks described (SIR> 8) have been reported by Prior et al. [17, 18] and Wolfe et al. [19] with an 8-fold probability of developing a lymphoproliferative malignancy in RA patients. Contrarily, the evidence of association of RA with soHd tumors is less stressing than that of hematological disorders. Several studies have failed to demonstrate statistically significant associations [8, 17, 20-22]. The reported strength of association with soUd tumors is quite weak.
Ill
Table 1. Rheumatoid arthritis Obs
Author [ref.]
n
Gender
Person-years
SIR or SMR
Lymphoproliferative Isomaki et al. [8]^ Isomaki et al. [8]^ Isomaki et al. [8]^^ Isomaki et al. [8]^ Isomaki et al. [8]^^ Isomaki et al. [8]^ Prior et al. [17] Prior [18] Laaksoetal. [10] Silman et al. [23] Wolfe et al. [19] Myllykangas-Luosujarvi et al. [24] Moritomo et al. [21] Moritomo et al. [21] Cibere et al. [25]
11483 11483 11483 34618 34618 34618 489 489 1000 202 898 1666 655 655 862
Male Male Male Female Female Female Both Both Both Both Both Both Male Female Both
49131 49131 49131 164780.4 164780.4 164780.4 7 7 7
2.7 2.1 2.5 2.7 2.2 1.4 8.0 8.7 5.0^ 10 8.02 1.4 3.95 0 1.25
13 7 18 25 21 27 9 11 10 4 0.02 35 1 0.5 12
All sites Isomaki et al. [8] Isomaki et al. [8] Prior et al. [17] Prior [18] Kinlen [26] Fries et al. [27] Laaksoetal, [10] Bendix et al. [28] Wolfe etal. [19] Bendix et al. [20] Moritomo etal. [21] Moritomo et al. [21] Kauppietal. [12] Cibere et al. [25] Bologna et al. [22]
11483 34618 489 489 1634 805 1000 334 898 305 655 655 9469 862 426
Male Female Both Both Both Both Both Both Both Both Male Female Both Both Both
49131 164780.4 7
1.1 1.0 1.3 1.3 1.6 0.6 0.7^ 1.1 0.34 1.1 0.75 1.71 1.16 0.80 1.0
407 795 36 42 65 14.1 42 25 0.09 28 5 21 540 136 8.0
2260 7 7 3988.9 3988.9 14,998
7 7 7 7 7 7 2117 3988.9 3988.9 65391 14998 1981.15
Exp
4.84 3.26 7.1 9.34 9.49 18.74 1.13 1.27 1 0.4 0.002 25 0.25 0 9.6
354.1 783.8 27.6 31.1 40.3 22.8 58 22 0.28 24.8 6.6 12.3 465 167.5 8.31
/?-value
<0.01 <0.05 <0.01 <0.001 <0.001 NS <0.001 <0.001 0.04 7 7 <0.05 NS NS NS
<0.01 NS NS <0.05 7 7 0.11 NS 7 NS NS <0.05 <0.05 0.01 NS
Abbreviations'. SIR = standardized incidence ratio; SMR = standardized mortality ratio; Obs = observed; Exp = expected. ^ Lymphomas. ^ Myeloma. ^ Leukemia. ^ Odds ratio.
3. SYSTEMIC LUPUS ERYTHEMATOSUS Recently, IVlellemkjaer et al. [15] published the largest study about the association between lupus and malignancy. They studied malignancy in 1585 SLE patients for 10,807 person-years of follow-up. They observed statistically significant risks of 5.2-fold to develop lymphoproliferative neoplasm and 1.3-fold for cancer of all sites. In 1966, Abu-Shakraet al. [14] studied 724
112
SLE patients and 7233 person-years and also found a 4.12-fold probability of suffering hematological disorders. Previously in 1992, Pettersson et al. [11] noted a SIR of 2.6 of developing cancer (all sites) among 205 SLE patients followed by 2340 person-years. All the previous associations were statistically significant. On the other hand, Sweeney et al. [29] and Abu-Shakra et al. [14] found no association with cancer (all sites) (Table 2).
Table 2. Systemic lupus erythematosus Author [ref.]
n
Gender
Person-years
SIR or SMR
Lymphopwliferative Abu-Shakra et al. [14] Mellemkjaer et al. [15]^
724 1585
Both Both
7233 10807
4.12 5.20
6 8
All sites Pettersson et al. [11] Sweeney et al. [29] Abu-Shakra et al. [14] Mellemkjaer et al. [15]
205 219 724 1585
Both
2340 1157 7233 10807
2.6 1.36 1.08 1.30
15 6 24 102
Female Both Both
Obs
Exp
/7-value
?
0.01 <0.05
1.5
5.7 4.42 7
78.5
<0.05 NS NS <0.05
Abbreviations'. SIR = standardized incidence ratio; SMR = standardized mortality ratio; Obs = observed; Exp = expected. ^ Non-Hodgkin's lymphoma.
Table 3. Sjogren's syndrome Author [ref.]
n
Gender
Person- years
SIR or SMR
Obs
Exp
/?-value
Lymphopwliferative Kassan et al. [30]^ Valesini et al. [31]^
134 295
Female Female
1098.7 1756
43.8 33.3
7 9
0.16 0.27
0.01 <0.001
All sites Kassan et al. [30]
131
Female
1098.7
2.2
15
6.74
0.01
Abbreviations'. SIR = standardized incidence ratio; SMR = standardized mortality ratio; Obs = observed; Exp = expected. ^ Lymphoma.
4. SJOGREN'S SYNDROME The classical work of Kassan et al. [30] in 1978 is used as a reference to demonstrate the highest association between an autoimmune rheumatic disease and the probability of developing a neoplasm. In their study, they followed 136 women with SS for 1098.7 person-years at the US National Institutes of Health. They reported a SIR of 43.8 for lymphoma and 2.2 for cancer (all sites). More recently, Valesini et al. [31] studying Italian patients with primary SS observed 9 cases of non-Hodgkin's lymphoma versus 0.27 expected for a SIR of 33.3 which is highly significant statistically (Table 3).
5. POLYMYOSITIS AND DERMATOMYOSITIS The evidence of association in polymyositis and dermatomyositis with lymphoproliferative malignancies
is unclear. There is not one cohort study that demonstrates such relationship. However, the opposite is true of solid tumors. Dermatomyositis appears more strongly associated than polymyositis with malignant tumors (other than lymphoproUferative) [32, 33] with SIR between 2.4 and 8.3. Maoz et al. [34] in a recent study of Israeli patients found a statistically significant SIR of 12.6, irrespective of their having polymyositis or dermatomyositis (Table 4).
6. SYSTEMIC SCLEROSIS The malignant neoplasm more strongly and consistently associated with systemic sclerosis is that of the lung. The probability reported for this association is between 4.5 and 16.5 [35-37]. The association with cancer (all sites) is of lesser magnitude (SIR 1.3-2.4, depending of gender) [36-38]. Another neoplasm which has been statistically associated with systemic sclerosis is non-Hodgkin's lymphoma (SIR 9.6)
113
Table 4. Polymyositis and Dermatomyositis Author [ref.] All sites
n
Gender
Person-years
Polymyositis Sigurgeirsson et al. [32] Sigurgeirsson et al. [32] Airio et al. [33] Airio et al. [33]
168 228 103^ 208^
Male Female Male Female
5990^ 5990^ 2712^ 2712^
Dermatomyositis Sigurgeirsson et al. [32] Sigurgeirsson et al. [32] Airio et al. [33] Airio et al. [33]
145 247 103^ 208''
Male Female Male Female
5990^ 5990^ 2712^ 2712^
Polymyositis or Dermatomyositis Maoz et al. [34]
31
7
Both
Obs
Exp
/?-value
1.8 1.7 0.9 1.1
20 22 5 7
7
<0.05 =0.05 NS NS
2.4 3.4 8.3 6.0
25 36 6 13
0.7 2.2
<0.05 <0.05 <0.05 <0.05
12.6
9
0.72
<0.05
SIR or SMR
7 5.3 6.2
7 7
Abbreviations: SIR = standardized incidence ratio; SMR = standardized mortality ratio; Obs = observed; Exp = expected. ^ Follow-up for the total sample (male and female). ^ Total sample (PM + DM).
Table 5. Systemic sclerosis Author [ref.] All sites
n
Gender
Person-years
SIR or SMR
Obs
Exp
/?-value
Peters-Golden et al. [35]^ Roumm and Medsger [39] Roumm and Medsger [39] Abu-Shakra et al. [38] Rosenthal et al. [36] Rosenthal et al. [36]^ Rosenthal et al. [36]^ Rosenthal et al. [36]^ Rosenthal et al. [36]^ Rosenthal et al. [36]^ Rosenthal et al. [37] Rosenthal et al. [37] Rosenthal et al. [37] Rosenthal et al. [37]^ Rosenthal et al. [37]^ Rosenthal et al. [37]^ Rosenthal et al. [37]^ Rosenthal et al. [37]^ Rosenthal et al. [37]^
71 60 202 248 233 233 233 233 233 233 917 287 630 287 630 630 630 287 630
Both Male Female Both Both Both
349 275 1060 2001 1195 1195 1195 1195 1195 1195 7403 7403 7403 7403 7403 7403 7403 7403 703
16.5 2.46 1.58 2.1 2.4 7.8 1.7 3.6 4.7 9.6 1.5 1.9 1.3 4.5 5.5 1.1 0 2.6 2.2
8.6 5 9 7.9 22 5 2 1 3 2 69 29 40 8 7 8 0 3 4
0.52 2.03 5.69 3.74 9.27 0.64 1.19 0.28 0.64 0.20 7 7 7 7 7 7 7 7 7
<0.05 NS NS <0.0001 <0.05 <0.05 NS NS NS <0.05 <0.05 <0.05 <0.05 <0.05 <0.05 NS NS NS NS
Female Female Both Both Both Male Female Male Female Female Female Male Female
Abbreviations: SIR = standardized incidence ratio; SMR = standardized mortality ratio; Obs = observed; Exp = expected. ^ Lung cancer. Breast cancer. ^ Ovarian cancer. ^ Lymphoproliferative cancer. ^ Non-Hodgkin's lymphoma.
114
Table 6. Bradford-Hill's postulates [40] 1.
Strength
2.
Consistency
3.
Specificity
4.
Temporality
5.
Biological gradient
6.
Plausibility
7.
Coherence
8.
Experiment
9.
Analogy
It measures the magnitude of association. In our example it is determined by SIR. It responded by the question: has the association been repeatedly observed by different persons, in different places, circumstances and times? If the association is limited to that cause and that effect. In other words: does the supposed cause only produce that effect? Here: is the malignancy only produced by autoimmune rheumatic diseases? Evidence upon sequence in the presentation of events. Here: is the rheumatic disease diagnosed first and afterwards the malignancy? Is the association related to a gradient dose-response? In other words: if more frequent the rheumatic disease is higher the probability of neoplasm? Is the association biologically plausible? This knowledge depends on the medical information of each day. Here: can an autoimmune rheumatic disease produce a malignancy? Interpretation of facts about association should not conflict with the facts known about the cause and effect. So, does the association between rheumatic disease and malignancy conflict with the knowledge about the two entities? Is there evidence of association derived from experimental studies such as clinical trials? Here: human experimental evidence is not ethically permissible. Is there evidence of a similar association in the medical literature? Here, for example: other autoimmune diseases like thyroiditis can be associated with a high probability of developing a malignancy.
Table 7. Fulfilment of Bradford-Hill's [40] postulates in autoimmune rheumatic diseases and malignancy Rheumatic Malignant Strength Consistency Specificity Temporality Biological Plausibility Coherence Experiment Analogy Disease neoplasm gradient
RA RA SLE SLE SS SS PM DM SCL SCL
LP ST LP ST LP ST ST ST ST LC
X X X X X X
X X X X
X X X X X X X X X X
X X X X X X X X X X
X X X X X X X X X X
X X X X X X X X X X
Abbreviations: RA = rheumatoid arthritis; SLE = systemic lupus erythematosus; SS = Sjogren's syndrome; PM = polymyositis; DM = dermatomyositis; SCL = systemic sclerosis; LP = lymphoproliferative neoplasms; ST = solid tumors; LC = lung cancer; X = evidence of association; - = no evidence of association.
[36]. Breast or ovarian cancer, and other lymphoproliferative disorders different to non-Hodgkin's lymphoma have not been consistently associated (Table 5).
7. CAUSALITY In 1965, Sir Austin Bradford-Hill published his famous "postulates" in The Environment and Disease: Association or Causation [40]. The nine BradfordHill's postulates (summarized in Table 6) give a mea-
sure of the degree in which evidence of causality between a factor and a disease could be established. The Bradford-Hill's postulates result particularly suitable to evaluate the degree in which an autoimmune rheumatic disease is conditioning a higher probability to develop a malignant neoplasm. Table 7 shows the degree of fulfilment of Bradford-Hill's postulates depending of the evidence reported in the medical literature. We can draw from the analysis presented in Table 7 that there is enough evidence of causality of an autoimmune rheumatic disease in association with a higher probability of developing a maUgnancy
115
in four pathological entities: (i) RA in association with lymphoproliferative neoplasm; (ii) SS in association with lymphoproliferative neoplasm; (iii) dermatomyositis in association with solid tumors; and (iv) systemic sclerosis in association with lung cancer. For the above four autoimmune disease-cancer relationships the main Bradford-Hill's postulates are satisfied: strength, consistency and temporality of association, as well as plausibility, coherence and analogy. For other associations as that of SLE with solid tumor or with lymphoproliferative disorders, there is not enough evidence to establish causality. On the other hand, the absence of specificity, biological gradient, and experiment tells us that occurrence of cancer is not only conditioned by presence of the rheumatic disease. Also, there is no dose-response like gradient (e.g., more rheumatic disease vs. less rheumatic disease). Experiment on this could only be conducted in animal models. Miettinen [41] distinguished two different types of causality: (i) descriptive, in which a parameter of occurrence is related to a determinant without any view to causal interpretation of the relationship; and (ii) causal, relevant to rational intervention (to influence the outcome through modification of the determinant). The latter is particularly relevant here considering the importance of establishing close surveillance in rheumatic patients on the probability that they develop a malignancy. Vineis and Porta [42] comment on the current extended interpretation of the phenomenon: determination rather than causality. They suggest to use the word determinant of a disease as more appropriate in epidemiology. In this way, we can conclude of certain autoimmune rheumatic diseases as determinants of certain malignant neoplasms.
5. 6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
REFERENCES 1.
2.
3. 4.
116
Bujim JJ, Talal N. The Association of malignant lymphoma with Sjogren's syndrome. Trans Assoc Am Physicians 1963;76:4546. Talal N, Bunim J J. Development of malignant lymphoma in the course of Sjogren's syndrome. Am J Med 1964;36:529-540. Calabro JJ. Cancer and arthritis. Arthrit Rheum 1967;10:553-567. Goldenberg GJ, Paraskevas F, Israels LG. The association of rheumatoid arthritis with plasma cell and
16.
17.
18.
lymphocytic neoplasms. Arthrit Rheum 1969;2:569579. Stertz G. Polymyositis. Berl KHn Wochenschr 1916;53:489. Zatuchni J, Campbell WN, Zarafonetis CJD. Pulmonary fibrosis and terminal bronchiolar ("alveolar cell") carcinoma in scleroderma. Cancer 1953;6:1147-1158. Williams RC Jr. Dermatomyosids and mahgnancy: a review of the literature. Ann Int Med 1959;50:11741181. Isomaki HA, Hakulinen T, Joutsenlahti U. Excess risk of lymphomas, leukemia and myeloma in patients with rheumatoid arthritis. J Chron Dis 1978;31:691696. Hakulinen T, Isomaki H, Knekt P. Rheumatoid arthritis and cancer studies based on linking nationwide registries in Finland. Am J Med 1985;78(suppl lA):29-32. Laakso M, Mutru O, Isomaki H, Koota K. Cancer mortality in patients with rheumatoid arthritis. J Rheumatol 1986;13:522-526. Pettersson T, Pukkala E, Teppo L, Friman C. Increased risk of cancer in patients with systemic lupus erythematosus. Ann Rheum Dis 1992;51:437439. Kauppi M, Pukkala E, Isomaki H. Low incidence of colorectal cancer in patients with rheumatoid arthritis. CUn Exp Rheumatol 1996;14:551-553. Tennis P, Andrews E, Bombardier C, Wang Y, Strand L, West R, et al. Record Unkage to conduct an epidemiologic study on the association of rheumatoid arthritis and lymphoma in the province of Saskatchewan, Canada. J Clin Epidemiol 1993;46:685-695. Abu-Shakra M, Gladman DD, Urowitz MB. Malignancy in systemic lupus erythematosus. Arthrit Rheum 1996;39:1050-1054. Mellemkjaer L, Andersen V, Linet MS, Gridley G, Hoover R, Olsen JH. Non-Hodgkin's lymphoma and other cancers among a cohort of patients with systemic lupus erythematosus. Arthrit Rheum 1997;40:761-768. Moder KG, Tefferi A, Cohen MD, Menke DM, Luthra HS. Hematologic malignancies and the use of methotrexate in rheumatoid arthritis: a retrospective study Am J Med 1995;99:276-281. Prior P, Symmons DPM, Hawkins CF, ScoU DL, Brown R. Cancer morbidity in rheumatoid arthritis. Ann Rheum Dis 1984;43:128-131. Prior P. Cancer and rheumatoid arthritis: epidemiologic considerations. Am J Med 1985;78(suppl 1A):15-21.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
Wolfe F, Mitchell DM, Sibley JT, Fries JF, Bloch DA, Williams CA, et al. The mortality of rheumatoid arthritis. Arthrit Rheum 1994;37:481-494. Bendix G, Bjelle A, Holmberg E. Cancer morbidity in rheumatoid arthritis patients treated with proresid or parenteral gold. Scand J Rheumatol 1995;24:79-84. Moritomo H, Ueda T, Hiyama T, Hosono N, Mori S, Komatsubara Y. The risk of cancer in rheumatoid patients in Japan. Scand J Rheumatol 1995;24:157-159. Bologna C, Picot MC, Jorgensen C, Viu P, Verdier R, Sany J. Study of eight cases of cancer in 426 rheumatoid arthritis patients treated with methotrexate. Ann Rheum Dis 1997;56:97-102. Silman AJ, Petrie J, Hazleman B, Evans SJW. Lymphoproliferative cancer and other malignancy in patients with rheumatoid arthritis treated with azathioprine: a 20 year follow up study. Ann Rheum Dis 1988;47:988-992. Myllykangas-Luosujarvi R, Aho K, Isomaki H. Mortality from cancer in patients with rheumatoid arthritis. Scand J Rheumatol 1995;24:76-78. Cibere J, Sibley J, Haga M. Rheumatoid arthritis and the risk of malignancy. Arthrit Rheum 1997;40:15801586. Kinlen LJ. Incidence of cancer in rheumatoid arthritis and other disorders after immunosuppressive treatment. Am J Med 1985;78(suppl 1 A):44-49. Fries JF, Bloch D, Spitz P, Mitchell DM. Cancer in rheumatoid arthritis: a prospective long-term study of mortality. Am J Med 1985;78(suppl lA):56-59. Bendix G, Bjelle A. Proresid therapy in rheumatoid arthritis. A comparison with injectable gold using lifetable analysis. Scand J Rheumatol 1993;22:77-82. Sweeney DM, Manzi S, Janosky J, Selvaggi KJ, Ferri W, Medsger TA Jr, et al. Risk of malignancy in women with systemic lupus erythematosus. J Rheumatol 1995;22:1478-1482. Kassan SS, Thomas TL, Moutsopoulos HM, Hoover R, Kimberly RP, Budman DR, et al. Increased risk of lymphoma in Sicca syndrome. Ann Int Med 1978;89:888-892.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41. 42.
Valesini G, Priori R, Bavoillot D, Osborn J, DanieH MG, del Papa N, et al. Differential risk of nonHodgkin's lymphoma in Italian patients with primary Sjogren's syndrome. J Rheumatol 1997;24:23762380. Sigurgeirsson B, Lindelof B, Edhag O, Allander E. Risk of cancer in patients with dermatomyositis or polymyositis. A population-based study. N Engl J Med 1992;326:363-367. Airio A, Pukkala E, Isomaki H. Elevated cancer incidence in patients with dermatomyositis. A population based study. J Rheumatol 1995;22:13001303. Maoz CR, Langevitz P, Livneh A, Blumstein Z, Sadeh M, Bank I, et al. High incidence of malignancies in patients with dermatomyositis and polymyositis: an 11-year analysis. Semin Arthrit Rheum 1998;27:319324. Peters-Golden M, Wise RA, Hochberg M, Stevens MB, Wigley FM. Incidence of lung cancer in systemic sclerosis. J Rheumatol 1985;12:1136-1139. Rosenthal AK, McLaughhn JK, Linet MS, Persson I. Scleroderma and malignancy: an epidemiological study. Ann Rheum Dis 1993;52:531-533. Rosenthal AK, McLaughlin JK, Gridley G, Nyren O. Incidence of cancer among patients with systemic sclerosis. Cancer 1995;76:910-914. Abu-Shakra M, Guillemin F, Lee P. Cancer in systemic sclerosis. Arthrit Rheum 1993;36:460464. Roumm AD, Medsger TA Jr. Cancer and systemic sclerosis. An epidemiologic study. Arthrit Rheum 1985;28:1336-1340. Bradford-Hill A. The environment and disease: association or causation?. Proc Roy Soc Med 1965;58:295-300. Miettinen OS. Theoretical Epidemiology. New York: John Wiley; 1985. Vineis P, Porta M. Causal thinking, biomarkers, and mechanisms of carcinogenesis. J Clin Epidemiol 1996;49:951-956.
117
© 2000 Elsevier Science B. V All rights reserved. Cancer and Autoimmunity Y. Shoenfeld and M. E. Gershwin, editors
Paraneoplastic Syndromes Moshe Tishler^ and Yehuda Shoenfeld^ ^ Tel Aviv University Sackler School of Medicine; ^Chaim Sheba Medical Center, Tel-Hashomer
1. INTRODUCTION Paraneoplastic syndromes reflect the communication between tumor and host cells that occurs at remote sites from the primary tumor. These syndromes are present in 7-10% of patients with cancer and about 50% of patients will experience such phenomena during their disease course. These syndromes have a significant clinical importance since they may present as a first symptom and give a diagnostic clue to the primary tumor. Furthermore, some mediators of paraneoplastic conditions may serve as tumor markers and may have prognostic significance. The mechanisms involved in paraneoplastic syndromes vary and include humoral, immunologic and possibly neurologic. The syndromes discussed in this chapter are divided according to the systems affected.
2. PARANEOPLASTIC SYNDROMES OF THE KIDNEY Malignant diseases can be associated with a wide variety of abnormalities in both renal structure and function. The fluid and electrolyte abnormalities are discussed in this chapter under endocrine/metabolic syndromes and this section focuses on the glomerular diseases.
2.1. Membranous Nephropathy Idiopathic membranous nephropathy (MN) is clinically characterized by heavy proteinuria accompanied by hypertension and microscopic hematuria. This
glomerular lesion is most commonly associated with malignancy, and in the elderly as many as 22% of patients may have an underlying cancer [1]. Various neoplasia have been associated with MN, most commonly carcinomas of the lung, colon and stomach. Although the presence of tumor antigen deposited within the glomeruli has only infrequently been described, the fact that in approximately 80% of reported cases malignancy was diagnosed either before or concurrently links MN to cancer.
2.2. Minimal Change Glomerulopathy Minimal change glomerulopathy (MCG) is the most common glomerulopathy associated with lymphoproliferative disorders, especially Hodgkin's disease [2]. The clinical manifestation is that of nephrotic syndrome and is present in 10-15% of patients before, and in 40-50% after, the tumor is diagnosed. In recent years there has been a gradual decrease in the reports of this association due to better diagnostic and therapeutic measures.
2.3. Other Glomerulopathies In addition to the two classically described glomerulopathies, other glomerular diseases have been manifested as paraneoplastic syndromes. Rapidly progressive glomerulonephritis has been described in association with lymphoplasmocytic disorders while focal and segmental glomerulonephritis were reported with T-cell lymphomas and IgA nephropathy with bronchogenic carcinoma and squamous cell carcinoma of the tongue.
121
3. PARANEOPLASTIC SYNDROME 3.1. Endocrine/Metabolic Paraneoplastic Syndrome The most common cause of endocrine paraneoplastic syndrome is production of protein hormones or hormone precursors by the tumor cells. However, many of these so-called "hormones" are regularly produced by the normal tissues and act as cytokines. In some paraneoplastic syndromes these cytokines are produced in large quantities, circulate in the blood and act on distant tissues. The list of hormones and hormone precursors reported in paraneoplastic syndrome is long and includes almost every human hormone [3]. The most common endocrine/metabolic paraneoplastic syndromes and their associated malignant tumors are summarized in Table 1. 3.2. "Ectopic" ACTH Syndrome A wide range of tumors has been described to produce biologically active ACTH. Many studies have shown that the molecular mechanism of this syndrome is due mainly to a precursor of the ACTH molecule which is proopiomelanocortin (POMC) and is a 31 kD glycoprotein. These precursor molecules, which are produced normally by the normal cells, are produced by some tumors in greater concentrations. Some tumors convert these precursors to biologically active ACTH, thus causing this paraneoplastic syndrome [4]. The ectopic ACTH syndrome differs from the classical Cushing's disease by several markers: (1) serum and urine Cortisol concentrations are usually markedly increased; (2) plasma ACTH and POMC levels are usually markedly increased and the ratio of POMC to ACTH concentration is high; (3) Hypokalemia is common; and (4) Dexamethasone does not suppress ACTH and Cortisol levels. 3.3. Hypercalcemia Syndrome Hypercalcemia is a relatively common manifestation in cancer present in up to 40% of patients, depending on the type of tumor [3]. The cause of hypercalcemia is a cancer-produced substance which has some PTH activities. This protein has been termed PTH-related protein (PTH-RP), and is a 141-amino acid protein homologous with PTH in its amino terminus [6]. The
122
PTH-RP gene is located on the short arm of chromosome 12 and has been shown to be expressed at low levels in many normal tissues, such as lactating breast and keratinocytes [7] where it acts in paracrine fashion. Following malignant transformation there is an increased PTH-RP gene expression following production of large amounts of this protein. In this state, PTH-RP behaves as a hormone causing bone resorption and renal phosphate wasting, which is expressed by hypercalcemia and hypophosphatemia. The mechanism involved in causing hypercalcemia in hematological malignancies is somewhat different. In multiple myeloma cytokines such as lymphotoxin and tumor necrosis factor, act locally on the osteoclasts adjacent to the myeloma cells. On the other hand, in T-cell lymphomas, increased production of 1,25 OH vitamin D is probably the causing factor involved in producing hypercalcemia. 3.4. Hypoglycemia Syndromes The most common neoplasms associated with hypoglycemia are tumors of "mesenchymal" origin, such as mesotheliomas, fibrosarcomas, neurofibromas, spindle cell carcinomas and leiomyosarcomas. The most common mechanism involved in hypoglycemia is abnormal production of a precursor molecule to insulinlike growth factor (IGF) II, which is bound to insulin and IGF receptors, thus causing suppression of growth hormone secretion [8]. Other rare causes that are not well documented are the production of insulin in excessive quantities and increased insulin receptor numbers in the liver and muscles. 3.5. Antidiuretic Hormone Syndrome (Arginin-Vasopressin) The description of hyponatremia, hypervolemia, urinary sodium excretion and high urinary osmolality in 1957, led to the assumption that it was caused by cancer antidiuretic hormone (ADH) production. This syndrome is most commonly associated with oat cell carcinoma of the lung, and about 40% of lung carcinoma patients have increased ADH production [9]. Since only a minority of these patients are symptomatic, it is presumed that the clinical picture also requires increased water intake by the patients.
Table 1. Endocrine/metabolic paraneoplastic syndromes and type of neoplasm (approximate percentage of reported cases) Syndrome Ectopic ACTH
Hypercalcemic
Hypoglycemic
ADH
Erythrocytosis
Carcinoma of lung (oat cell) (50%) Carcinoma of thymus (10%) Carcinoma of pancreas (10%) Pheochromocytoma (5%) Medullary thyroid carcinoma (5%) Miscellaneous (18%)
Carcinoma of breast (48%) Carcinoma of lung (22%) Carcinoma of kidney (15%) Carcinoma of ovary (5%) Hematologic neoplasms (5%)
Mesenchymal tumors (45%) Hepatic carcinoma (23%) Adrenal carcinoma (10%) Gastrointestinal carcinomas
Carcinoma of lung (oat cell) (40%)
Renal carcinoma (40%) Hepatocelluar carcinoma (18%) Cerebellar hemangioblastoma (15%) Miscellaneous
(8%) Hematologic neoplasms (6%)
3.6. Acromegaly Syndrome Acromegaly has been described in a small number of patients with nonpituitary tumors, mainly carcinoids and pancreatic islet cell tumors [10]. The mechanism involved in this syndrome is the production of growth hormone (GH)-releasing hormone by the tumor cells, which stimulates the pituitary to secrete GH in excessive amounts. Only rarely has GH itself been described as a product of cancer. 3.7. Erythrocytosis Syndrome Production of red blood cells is normally controlled by erythropoietin (EPO)—a hormone produced by renal cells. Although carcinomas of the kidney have most commonly been associated with polycythemia, other types of neoplasms like hepatocellular carcinoma, cerebellar hemangioblastoma, and even chronic lymphatic leukemia have been described [11]. Increased EPO levels are the presumed mechanism causing polycythemia, although measurable EPO levels poorly correlate with the degree of polycythemia. 3.8. Oncogenic Osteomalacia Syndrome This rare syndrome is associated with hypophosphatemia, hyperphosphaturia, osteomalacia and low 1,25 OH vitamin D levels in the serum. About 80% of the reported cases are caused by pleomorphic neo-
(3%)
plasms, another 11 % by oat cell carcinoma of the lung and about 7% by prostatic carcinoma [12]. The presumed mechanism of this syndrome is inhibition of phosphorus renal cell absorption by a protein not yet characterized, which is produced by the tumor cells. 3.9. Hyper-Reninemic Syndrome Increased plasma renin levels causing hypertension and hypokalemia have been rarely described in tumors arising from the juxtaglomerular apparatus. More rarely, this syndrome has been described in case reports in other tumors outside the kidney.
4. MUCOCUTANEOUS PARANEOPLASTIC SYNDROME Mucocutaneous paraneoplastic syndromes represent a group of dermatoses of variable pathology, morphology and etiology. These syndromes either precede, occur concurrently or follow the existence of an internal malignancy. The suggested mechanisms involved in the pathogenesis of these syndromes include [13]: (1) production of tumor substances which cause the dermatosis; (2) depletion of a specific substance by the tumor that can cause the dermatologic symptoms; and (3) a host response to the neoplasm to which the dermatosis is etiologically related.
123
Table 2. The clinical characteristics of paraneoplastic mucocutaneous syndromes Clinical feature
% with cancer
Most common malignancy
Acantocytosis nigricans Acquired ichthiosis Amyloidosis (light chain) Bazer syndrome
Majority Unclear
Dermatomyositis Digital clubbing and hypertrophic osteoarthropathy Erythema gyratum repens Erythroderma and exfoliative dermatitis Erythromelalgia Extramammary Paget's disease Florid cutaneous papillomatosis Hypertrichosis lanuginosa acquisita Multicentric reticulohistiocytosis Polmar fasciitis Paraneoplastic pemphigus
25 90 80 8-25 20 50 100 Unclear 30 Unclear 100
Gastric adenocarcinoma Hodgkin's lymphoma Multiple myeloma Squamous cell carcinoma of upper aerodigestive tract A variety of solid tumors Nonsmall cell lung carcinoma Lung and genitourinary neoplasms Cutaneous T-cell lymphoma Myeloproliferative disorders Genitourinary and colon cancers Gastric adenocarcinoma Lung and colorectal carcinoma A variety of solid tumors Ovarian and lung cancer Non-Hodgkin's lymphoma, Chronic lymphatic leukemia Hodgkin's lymphoma, Cutaneous T-cell lymphoma Acute myeloblastic leukemia Acute myeloblastic leukemia Lung carcinoma Pancreatic adenocarcinoma Hairy cell leukemia
13-25 100
Pruritus
10
Pyoderma gangrenosum Sweet's syndrome Triple palmis Trouseau's syndrome Vasculitis
8 20 90 50 20
The clinical characteristics of neoplastic associated mucocutaneous syndromes are summarized in Table 2.
4.1. Acanthocytosis Nigricans This type of dermatosis occurs most commonly on the posterior neck, axilla and groin and presents as confluent small hyperkeratotic papules with hyperpigmented mass-like appearance. The pathologic features of the lesion are hyperkeratosis and papillomatosis. Although this dermatosis can occur as a benign familial form in children and in endocrinopathies, its appearance in an adult, especially on musocal membranes, is alarming. This type of lesion is frequently associated with abdominal adenocarcinoma, most commonly, gastric [14].
124
4.2. Acquired Ichthyosis This type of lesion presents as small white scales with free edges distributed on trunk and extremities. Other features that may be present are moderate hyperkeratosis and mild acanthocytosis. Acquired ichthyosis has been associated with endocrinopathies, acquired immunodeficiency, sarcoidosis and cholesterol-lowering drugs. The malignancies associated with this lesion are mainly Hodgkin's lymphoma, but carcinoma of breast, cervix and lung have also been described. 4.3. Amyloidosis Light chain amyloidosis (AL-amyloid) is most frequently associated with multiple myeloma. The cutaneous manifestations of AL-amyloidosis included purpura, plaques, scleroderma-like infiltration, alope-
cia, nail changes and bulbous eruptions. In contrast, secondary amyloidosis (AA), which occurs in association with renal cell carcinoma and other types of solid cancers, presents with parenchymal involvement. 4.4. Bazer Syndrome This syndrome, also called acrokeratosis paraneoplastica, is characterized by three clinical stages: (1) psoriasiform lesions initially appearing on acral areas; (2) palmar and plantar keratoderma associated with nail abnormalities; and (3) generalized psoriasiform plaques. The detection of cross reactivity between antigens in the tumor and epidermal antigens as well as secretion of growth factors by the tumor cells TGFa and ILGF-I, have been postulated as pathogenic mechanisms for the dermatosis [15].
includes clubbing, painful swelling and tenderness of the distal phalanges. In this type of lesion, there is subperiosteal edema with new bone formation along the shafts of the tubular bones of the limbs. In 90% of patients with this condition, a nonsmall cell lung carcinoma is usually detected. Other malignancies that have been noted are intrathoracic tumors and solid tumors with lung metastasis. 4.7. Erythema Gyratum Repens This type of lesion has a distinctive clinical presentation of an advancing weave-like erythema producing a "striped" appearance of the affected skin. The typical areas affected are the trunk and proximal limbs. In most of the patients an associated malignancy is present or subsequently discovered, most commonly lung cancer and tumors of the genitourinary tract.
4.5. Dermatomyositis 4.8. Erythroderma and Exfoliative Dermatitis Dermatomyositis is an inflammatory myopathy manifested mainly by proximal muscle weakness as well as other systemic organ involvement such as heart, lung and gastrointestinal tract. The pathognomonic skin lesions are the heliotrope rash (edematous violaceous changes of periorbital areas) and the Gottron's papules (erythematous dermal scaling overlying the metacarpo-phalangeal joints). Other cutaneous manifestations are malignant erythema, photosensitivity, cuticular hypertrophy with erythema and red scaly pruritic scalp rash. About 25% of patients with dermatomyositis, especially those in whom the disease starts at the age of 50 and over, will have cancer. The types of solid tumors associated with this dermatosis seem to approximate those that occur in the general population [16]. 4.6. Digital Clubbing and Hypertrophic Osteoarthropathy Digital clubbing is characterized by thickening of the distal phalanges, increased convexity of the nail plate and thickening of the nail bed. Clubbing can be primary (hereditary or idiopathic) or secondary to systemic diseases such as chronic lung disorders, endocarditis, gastrointestinal disorders or hyperthyroidism. In about 10-20% of patients, the clubbing is associated with hypertrophic osteoarthropathy that
The clinical presentation of this lesion involves a widespread redness and skin inflammation. In most of the cases, exfoliation and pruritus are present, as well as other systemic symptoms such as adenopathy, chills and malaise. Erythroderma is often associated with hematological malignancies, especially cutaneous Tcell lymphoma, Hodgkin's disease and leukemias. 4.9. Erythromelalgia Erythomelalgia is characterized by attacks of erythema, severe burning pain and warmth of the limbs. Symptoms are precipitated by exercise and heat and relieved by cold exposure and elevation of the limb. Erythromelalgia can be idiopathic or secondary to a variety of nonmahgnant systemic disorders such as diabetes mellitus, pregnancy, systemic lupus erythematosus, rheumatoid arthritis and drug reaction. In about 20% of patients, an associated myeloproliferative disorder can be detected often presenting with thrombocytosis. 4.10. Extramammary Paget's Disease This lesion typically appears as an erythematous exudative dermatosis in the groin, perineum and perianal areas. The disease is actually a cutaneous adenocar-
125
cinoma that is associated with a solid tumor in 50% of patients. The site of the visceral tumor corresponds to the location of the dermatosis adenocarcinoma of the digestive tract for perianal involvement and genitourinary tract malignancy for perineal-groin involvement. 4.11. Florid Cutaneous Papillomatosis The clinical presentation of the skin lesion includes the sudden appearance of multiple cutaneous verrucous papillomas on the trunk, extremities and finally the face. This type of paraneoplastic manifestation has been associated with malignancy in all reported cases, mostly with adenocarcinoma of the stomach. 4.12. Hypertrichosis Lanugiosa Acquisita This skin lesion is characterized by the appearance of colorless, fine-textured hair growth which is generalized and spares only the palms and soles. This cutaneous syndrome has been associated with lung and colorectal carcinoma.
tous patches, vesicles, bullae, papules and plaques. The clinical picture can also include mucosal lesions presenting as painful blisters or erosions of the oral cavity and conjuctivas. In addition to the microscopic features, patients with this syndrome have characteristic serum immunoprecipitation findings. This type of lesion is present mainly in patients with chronic lymphocytic leukemia and non-Hodgkin's lymphoma, but can appear also in other neoplasms.
4.16. Pruritus Although pruritus is a common manifestation that can appear with a variety of systemic diseases, when a patient presents with generalized itching without any apparent disorder, malignancy can be detected in about 10% of cases. The most common malignancies associated with pruritus are Hodgkin's lymphoma and cutaneous T-cell lymphoma. Less commonly, pruritus can occur in leukemia, polycythemia vera and a variety of soUd tumors.
4.17. Sweet's syndrome 4.13. Multicentric Reticulohistiocytosis Multicentric reticulohistiocytosis is characterized by papunodular skin lesions and polyarthritis affecting hands, knees, shoulders, hips and spine, that progresses to arthritis mutilans in 50% of the cases. The papular and nodular skin lesions involve the upper half of the body, especially the face. In about 30% of the cases, a solid tumor has been discovered with no predominant type.
This syndrome originally described in 1964, is a complex of fever, neutrophilia and erythematous painful, cutaneous plaques of the upper extremities, neck and head. Systemic involvement of eyes, muscles, joints, lungs and liver has also been described. Although most of the cases are idiopathic, malignancy develops in up to 20% of patients [17]. The most commonly associated malignancy is acute myelogenous leukemia. Other less frequently reported neoplasms are solid tumors of the breast, genitourinary tract and colon.
4.14. Palmar Fasciitis This syndrome is manifested by thickening of the palmar fascia thus causing flexion contracture of fingers. This type of lesion is often associated with solid tumors, most commonly ovarian and lung cancer, however, its existence is a poor prognostic sign since it manifests only after the tumor is already metastatic. 4.15. Paraneoplastic Pemphigus This paraneoplastic syndrome is characterized by widely distributed lesions which include erytherma-
126
4.18. Vasculitis The vasculitis associated cutaneous lesions are polymorphous and their pathogenesis is unknown, although it has been suggested that tumors release some cytokines which destroy the vascular bed. Paraneoplastic vasculitis can present pathologically with or without septal panniculitis. About 5-20% of patients with vasculitis have an associated malignancy, most commonly hematologic (hairy cell leukemia, lymphomas and multiple myeloma).
5. HEMATOLOGICAL PARANEOPLASTIC SYNDROME
sometime difficult. Eosinophilia has frequently been associated with Hodgkin's disease.
Cancer may affect the cellular elements of the blood as well as the coagulation system, resulting in a wide range of paraneoplastic syndromes (Table 3). In modern health-care systems routine hematological testing is so common that many cancers are first detected by one of these paraneoplastic syndromes.
Neutropenia: Neutropenia has only rarely been described as a paraneoplastic disorder; in these cases, antigranulocytes antibodies have been found.
5.1. Red Blood Cells Disorders Anemia: Anemia of cancer is probably the most common paraneoplastic syndrome [18]. It is usually characterized by a normochromic or mild hypochromic red blood cell (RBC) morphology with low serum iron and increased ferritin levels. The etiology is probably due to low erythropoietin levels mediated by cytokines such as interleukin-1 (IL-1), and tumor necrosis factor (TNF) [19]. Autoimmune hemolytic anemia occurs by both warm and cold antibodies. It predominates in chronic lymphatic leukemia (CLL) and B-cell lymphomas. In most of these cases the autoantibody is polyclonal and appears to be a result of immune dy sregulation and not a direct tumor product. Another proposed mechanism includes the RBC as an innocent bystander due to a cross reacting tumor antigen. Another paraneoplastic phenomenon of obscure pathogenesis is microangiopathic hemolytic anemia with azotemia which is usually associated with gastric adenocarcinoma.
5.4. Platelet Disorders Thrombocytopenia: Thrombocytopenia resulting from a paraneoplastic phenomenon is uncommon. Although autoimmune thrombocytopenia has been reported in CLL and B-cell lymphomas, it can hardly be differentiated from that caused by hypersplenism or direct bone-marrow replacement. Thrombocytosis: Paraneoplastic thrombocytosis results from IL-6 and thrombopoietin release and it might play a role in the hypercoagulable state which affects many cancer patients. Functional disorders: Abnormal platelet aggregation studies have been reported in primary dermatological malignancies, as well as in some solid tumors. In most cases these defects are minor, but they can sometimes aggravate a pre-existing thrombocytopenia. 5.5. Hemostatic Disorders
5.3. Leukocyte Disorders
Thrombosis: The association of cancer and deep vein thrombosis (DVT) has been widely described and diagnosis of cancer has followed in many patients presenting with DVT without obvious risk factors [22]. The presence of accentuated sub-clinical thrombotic activity has been detected in most advanced cancers by finding procoagulant activators secreted by tumor cells such as sialic acid, phospholipids and various cytokines. Mucin-producing tumors of the GI tract, lung and pelvic organs are most commonly associated with DVT and pulmonary embolism, but may also present as nonbacterial endocarditis or Budd-Chiari syndrome [23].
Leukocytosis: Leukocytosis with neutrophil counts of up to 5010^/L are not uncommon in malignancy [21]. This phenomenon is due to cytokine release (IL-1 or granulocyte-colony-stimulating factor) and its differentiation from the myeloproliferative disorder is
Hemorrhage: Abnormal coagulation activity can result also in hemorrhage due to consumption of clotting factors and platelets, thus causing DIC. The most common malignant disease causing DIC is acute premyelocytic leukemia. Another bleeding disorder reported
5.2. Erythrocytosis The most common tumor associated with erythrocytosis is renal cell carcinoma. The presumed mechanism is a tumor mediated increase in erythropoietin secretion. Other types of tumors include cerebellar hemangioblastomas, sarcomas and pheochromocytomas [20].
127
Table 3. Autoantibodies associated with paraneoplastic neurological disorders Antibody
Antigens
Neuronal specificity
Associated tumors
Clinical disorders
Anti-Hu(ANNA-l)
35-^0 kD
All types of neuronal nuclei
SCLC, sarcoma
Anti-Yo Anti-Ri Anti-Tr Anti-VGCC Antiamphiphysin
34, 62 kD 55, 80 kD
Purkinje cell cytoplasm CNS neuronal nuclei Purkinje cell cytoplasm Motor nerve terminal Synapses
Ovary, breast, SCLC Breast, gynecological, bladder Hodgkin's lymphoma SCLC Breast, SCLC, Hodgkin's lymphoma
Encephalomyelitis sensory neuropathy cerebellar degeneration myoclonus/opsoclonus Cerebellar degeneration Myoclonus/opsoclonus Cerebellar degeneration LEMS Stiff-man syndrome encephalomyelitis
VGCC, 64, 37 kD 128 kD
Abbreviations: SCLC: small cell lung carcinoma; VGCC: voltage gated calcium channel; LEMS: Lambert-Easton myasthenic syndrome.
with cancer is acquired von-Willebrand disease found in lympho and myeloproliferative disorders.
6. PARANEOPLASTIC SYNDROMES OF THE NERVOUS SYSTEM Paraneoplastic syndromes of the nervous system are rare and affect less than 1% of cancer patients. These disorders often precede the identification of the underlying neoplasm and have a subacute onset. They can affect all parts of the nervous system usually causing focal neurological dysfunction with neuronal degeneration. 6.1. Pathogenesis The best current hypothesis that explains the peculiar phenomenon of nervous system degeneration in these syndromes is autoimmunity. Most investigations suggest that antigens normally restricted to the nervous system are aberrantly expressed by the tumor. The immune system recognizes the ectopic "foreign" antigen and responds by antibody production thus damaging all neurons expressing this "onconeural" antigen [24]. The histopathological picture of these syndromes differs according to the individual syndrome and although sometimes no pathological lesion can be identified in light microscopy, the usual picture is that of neuronal degeneration and inflammatory infiltrates [25].
128
6.2. Autoantibodies A number of well documented autoantibodies have been identified in patients with neurological paraneoplastic syndromes which are usually associated with specific syndromes. Although some of these antibodies are quite specific to a specific type of tumor, their sensitivity is less prominent. A summary of the well characterized autoantibodies is given in Table 3. 6.3. Anti-Hu (ANNA-1) The presence of these antibodies has been associated with small cell lung cancer (SCLC) in about 90% of patients with this type of neoplasm. Nevertheless, 1520% of patients harbor these antibodies without having paraneoplastic syndromes. The onconeural antigen termed Hu antigen refers to a family of predominantly nuclear proteins expressed in all neurons of the central and peripheral nervous system. The Hu antigen corresponds to a set of proteins with a molecular weight of 35-40 kD expressed both in neurons and SCLC cells [26]. The Hu proteins constitute a family of RNAbinding proteins (HuD, HuC, Hel-Nl and Hel-N2) characterized by an RNA recognition motif of about 80 amino acids. All Hu proteins are thought to have a role in the development and maintenance of the nervous system because of their restricted expression in neurons and their homology to the drasophila protein elav [27]. The anti-Hu antibodies have shown specific binding capacity to neurons in both the central and peripheral nervous system.
The main clinical symptoms associated with this antibody are encephalomyeHtis, sensory neuropathy, cerebellar degeneration and gastrointestinal dysmotilities, although various other neurological symptoms have been reported [28]. The presence of low titers of this antibody in SCLC patients is usually associated with a Umited cancer stage, good response to chemotherapy and a longer survival of patients. 6.4. Anti-Yo The presence of these antibodies has been associated with breast or gynecologic cancer in more than 90% of patients. The onconeural antigen termed Yo protein refers to a family of proteins highly expressed in the cytoplasm of cerebellar Purkinje cells and in the corresponding neoplasms. The Yo antigen corresponds to two sets of proteins with a molecular weight of 62 and 34 kD, respectively, expressed on Purkinje cells. There are at least three types of Yo proteins, cdr 34, cdr 62-1 and cdr 62-2, whose genes have been cloned and sequenced [29]. Recent work has shown that the mRNA for 62 kD Yo protein is widely distributed in the body but the protein is not expressed outside Purkinje cells. Furthermore, the 62 kD Yo protein binds to c-myc, pulls it out of the nucleus into the cytoplasm, thus inhibiting the activity of the c-myc gene. The clinical symptoms associated with the presence of this antibody are those of cerebellar degeneration. The pathogenic role of these antibodies is suggested by the fact that in paraneoplastic cerebellar degeneration, high titers of this antibody reacting and causing selective loss of Purkinje cells have been demonstrated. 6.5. Anti-Ri The presence of these antibodies has been associated with a variety of neoplasms including breast, gynecological and SCLC. The onconeural antigen refers to a set of proteins with a molecular weight of 55 and 80 kD. The Ri proteins are neuron specific RNA nuclear proteins and are found in the tumors of the causal cancers but not outside the central nervous system. The clinical symptoms associated with the presence of these antibodies are opsoclonus/myoclonus and also cerebellar degeneration. Two Ri proteins NOVA (neuronal, onconeural, ventral nervous system antigen)-! and NOVA-2 have been sequenced and
cloned and the inhibition of NOVA-1 by anti-Ri antibodies might suggest their pathogenic role in the paraneoplastic disorders [30]. 6.6. Anti-Tr The presence of these antibodies has recently been shown to be specific for paraneoplastic cerebellar degeneration associated with Hodgkin's disease [31]. The exact onconeural antigen has not been identified yet. Nevertheless, it has been shown that the antibodies label the cytoplasm of human and rat Purkinje cells and the molecular layer has a characteristic dotted pattern suggesting immunoreactivity of the dendritic spines of Purkinje cells. 6.7. Other autoantibodies Several other autoantibodies have been identified in the sera of patients with neurological paraneoplastic syndromes. Anti-VGCC (voltage gated calcium channel) antibodies can be detected in patients with Lambert-Eaton myasthenic syndrome (LEMS) which is associated with SCLC. These antibodies react with the active zone of the presynaptic cholinergicsynapses, thus blocking the entry of calcium necessary for the release of acethylchoHne. The antigens recognized by these antibodies are contained in the p/a type VGCCs of the presynaptic cholinergic-synapse. Unlike other antibodies such as anti-Hu and Yo and Ri and anti-Tr, this antibody is present in patients with LEMS whether it is associated with cancer or not. Antiamphiphysin antibodies are normally present in the sera of patients with stiff-man syndrome and less frequently in encephalomyelitis associated with lung, breast or other cancers. The antigen amphiphysin is a 1.28-kD protein on the synaptic terminal that binds the vesicle core protein adaptor AP2 and dynamin, thus causing the antibodies against this protein to prevent the release of the appropriate neurotransmitter. 6.8. Clinical Syndromes Encephalomyelitis'. This type of cHnical syndrome is an inflammatory disorder of the nervous system with a variable symptomatology occurring in patients with SCLC. The clinical findings vary from single cell type involvement like Purkinje cells to involvement of the dorsal ganglia, spinal cord, autonomic nervous
129
system, peripheral nerves and muscles [32]. The chnical picture has a subacute course and most patients with SCLC and these clinical findings have anti-Hu antibodies. Lambert-Eaton myasthenic syndrome (LEMS): This disorder is characterized by generalized weakness which worsens on exertion, starting from lower extremity and spreading to the upper limbs. Weakness affects more often proximal muscles and many patients complain of autonomic dysfunction such as dry mouth, blurred vision and impotence [33]. Cranial nerve involvement including diplopia, dysphagia and dysarthria, occurs frequently but the clinical findings are usually mild. About 1-3% of patients with SCLC suffer from LEMS, but in only 2/3 of LEMS patients this disorder is paraneoplastic, while in the others the causal mechanism is unknown. Peripheral neuropathy: In most cancer patients peripheral neuropathy is not a consequence of paraneoplastic syndrome but rather of other causes, such as chemotherapy, nutritional or metabolic. The peripheral neuropathy which is paraneoplastic occurs in patients with anti-Hu antibodies and SCLC [32]. The polyneuropathy can be motor, sensory, mixed type or autonomic. The motor neuropathies include the Guillan-Barre syndrome which occurs more commonly in patients with Hodgkin's disease and a subacute motor neuropathy affecting the anterior horn cells of patients with lymphomas. The sensory neuropathies can be subacute and affect distal neurons or an acute disease developing rapidly and causing loss of all sensory modalities in all limbs. This type is usually associated with SCLC and high titers of anti-Hu antibodies. The autonomic neuropathy is also associated with SCLC and anti-Hu antibodies and is expressed by abdominal distention, gastroparesis, postural hypotension, urinary retention and impotence.
SCLC, breast cancer, thymoma and especially in those who have antiamphiphysin antibodies. Paraneoplastic cerebellar degeneration (PCD): This clinical syndrome has a sudden onset and is expressed by ataxia, dysarthria and dysphagia, causing severe debilitation. In this disorder which is rare and is associated with breast, ovarian and lung carcinoma, anti-Yo and anti-Tr antibodies are usually detected. Opsoclonus/myoclonus: This disorder has an acute onset and occurs mainly in children with neuroblastoma. The clinical symptoms are those of involuntary arrhythmia, conjugate eye movements in all planes, together with diffuse or focal myoclonus. In adults with this syndrome a variety of cancers have been described and in some, anti-Ri antibodies can be detected. For most of these paraneoplastic syndromes, no established therapy exists. Only some syndromes respond to treatment of the underlying malignancy or to immunosuppression.
REFERENCES 1.
2. 3. 4.
5.
6. Neuromyotonia and stiff-man syndrome: Neuromytonia is characterized by continuous muscle activity with stiffness and cramps which increase with exercise and have delayed relaxation. This clinical presentation is often associated with anti-Hu encephalomyelitis. Stiff-man syndrome is also characterized by rigidity and severe spasms of skeletal muscles which can cause even bone fractures. This paraneoplastic syndrome occurs in patients with
130
7.
8.
Austin HA, Antonovych T. MacKay, et al. NIH conference: membranous nephropathy. AnnlntMed 1992 116:672-676. Morris SH. Paraneoplastic glomerulopathies. Semin Nephrol 1993;13:258-272. Odell WO. Endocrine/metabolic syndromes of cancer. Semin Oncol 1997;24:299-317. Stewart PM, Gibson S, Crosby SR, et al. ACTH precursors characterize the ectopic ACTH syndrome. CUn Endocrinol 1994;40:199-204. Howlett TA, Drury PL, Perry L, et al. Diagnosis and management of ACTH-dependent Cushing's syndrome: comparison of the features in ectopic and pituitary ACTH production. Clin Endocrinol 1986;24:699-713. Broadus AE, Goltzman P. Webb AC, et al. Messenger ribonucleic acid from tumors associated with humoral hypercalcemia of malignancy directs the synthesis of a secretory parathyroid hormone-like peptide. Endocrinology 1985;117:1661-1666. Thiede MA, Rodun GA. Expression of a calcium mobilizing parathyroid hormone-like peptide in lactating mammary tissue. Science 1988;242:278-280. Ron P. Powers AC, Pandian MR, et al. Insulin-like growth factor II production and consequent suppression of growth hormone secretion. A dual mechanism
9.
10.
11.
12.
13. 14. 15. 16. 17. 18.
19. 20. 21. 22.
23.
for tumor-induced hypoglycemia. J Clin Endocrinol Metab 1989;68:701-706. Odell WD, Wolfsen A, Yoshimoto Y, et al. Ectopic peptide synthesis. A universal concomitant of neoplasia. Trans Assoc Am Physicians 1977;90:204-227. Sonksen PH, Ayres AB, Braimbridge M, et al. Acromegaly caused by bronchial carcinoid tumors. Clin Endocrinol 976:5:505-513. Ljunberg B, Rasmuson T, Grankvist IL. Erythropoietin in renal cell carcinoma. Evaluation of its usefulness as a tumor marker. Eur Urol 1992;21:160-163. Wilkens GE, Granleese S. Hegele RG, et al. Oncogenic osteomalacia: evidence for a humoral phosphaturic factor. J Clin Endocrinol Metab 1995;80:16281634. Cohen PR, Kurzrock R. Mucocutaneous paraneoplastic syndromes. Semin Oncol 1997;24:334-359. Swantz RA. Acanthocytosis nigricans. J Am Acad Dermatol 1994;31:1-19. Bolognia JL. Bazer syndrome. CUn Dermatol 1993;11:37-42. Callen JP. Dermatomyositis and malignancy. Clin Dermatol 1993;11:61-65. Cohen PR. Kurzrock R. Sweet's syndrome and cancer. Clin Dermatol 1993;11:149-157. Mates M, Heyd J, Sonroujon M, et al. The haematologist as watchdog of community health by full blood count. Quart J Med 1995;88:333-339. Spivak JL. Cancer related anemia: its causes and characteristics. Semin Oncol 1994; 21(suppl 3):3-8. Staszewski H. Hematologeal paraneoplastic syndromes. Semin Oncol 1997;24:329-333. McKee LC. Excessive leucocytosis associated with malignant diseases. SouthMed J 1985;78:1475-1482. Prandoni P, Lensing AWA, Buller HR, et al. Deep vein thrombosis and the subsequent incidence of symptomatic mahgnant disease. N Engl J Med 1972;327:1128-1138. Green KB, Silverstein RL. Hypercoagulability in can-
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
cer. Hematol Oncol CHn North Am 1996;10:506-507. Dalman JO, Posner JB. Paraneoplastic syndromes affecting the nervous system. Semin Oncol 1997;24:318-328. Lang B, Newson-Davis J. Immunopathology of the Lambert-Easton myasthenic syndrome. Semin Immunol 1995;7:3-15. Graus F, Elkon KB, Cordon-Cardo C, Posner JB. Sensory neuropathy and small cell lung cancer. Antineuronal antibody that also reacts with the tumor. Am J Med 1986;80:45-52. Marusich M, Fumeauz H, Henlon P, Weston J. Hu neuronal proteins are expressed in proliferating neurogenic cells. J Neurobiol 1994;25:143-155. Lucchinetti CF, Kimmel DW. Lennon VA. Paraneoplastic and oncologic profiles of patients seropositive for type I antineuronal nuclear autoantibodies. Neurobiology 1998;50:652-657. Fathallah-Shaykh H, Wolf S, Wong E, Posner JB, Furneaux HM. Cloning of leucine zipper protein recognized by the sera of patients with antibodyassociated paraneoplastic cerebellar degeneration. Proc Natl Acad Sci USA 1991;88:3451-3454. Buckanovick R, Darnell R. The neuronal RNA binding protein NOVA-1 recognized specific RNA targets in vitro and in vivo. Am Soc Microbiol 1997;17:3194-3201. Motomura M, Lang B, Johnson I, Palace J, Vincent A, Dewsom-Davis J. Incidence of serum anti-p/a type and anti-n-type calcium channel autoantibodies in the Lambert-Eaton myasthenic syndrome. J Neural Sci 1997;47:35-42. Dalman J, Graus F, Rosenblum MK, et al. Anti-Hu associated paraneoplastic encephalomyelitis sensory neuronopathy. A clinical study of 71 patients. Medicine 1992;71:59-72. O'Neill JH, Murray NM, Newson-Davis J. The Lambert-Eaton myasthenic syndrome. A review of 50 cases. Brain 1988;111:577-596.
131
(c) 2000 Elsevier Science B.V. All rights reserved. Cancer and Autoimmunity Y. Shoenfeld and M. E. Gershwin, editors
Paraneoplastic Arthritis S. Praprotnik and M. Tomsic University Medical Centre Ljubljana, Vodnikova 62, 1000 Ljubljana, Slovenia
1. INTRODUCTION Malignant disease is associated with a wide variety of musculoskeletal disorders and, importantly, may present as such. The arthropathy can result from the direct invasion of bone and joints by a primary tumour or metastases, or indirectly as a paraneoplastic syndrome. The latter group, which is the subject of the present review, can frequendy be a source of confusion because of its extremely varied clinical presentation. Awareness that an underlying malignancy may produce certain musculoskeletal symptoms may allow earlier recognition of an otherwise occult, potentially curable malignancy. The paraneoplastic arthropathies can be grouped into three broad categories: (i) paraneoplastic arthropathies of solid tumours; (ii) paraneoplastic arthropathies of haematological malignancies; and (iii) arthropathies associated with cancer immunotherapy. The clinical manifestation and possible mechanisms involved in the pathogenesis of these disorders are discussed.
2. PARANEOPLASTIC ARTHROPATHIES OF SOLID TUMOURS 2.1. Cancer Arthritis Occult malignancy is a rare cause of polyarthritis and its prevalence is unknown, although it seems to be similar to that of hypertrophic osteoarthritis (HOA) and dermatomyositis [1]. Cancer arthritis is a distinct entity not to be confused with HOA or with metastatic implants. The clinical manifestations of cancer arthritis are extremely varied, making it sometimes difficult
to distinguish this disease from rheumatoid arthritis. The same is true with adult Still's disease when associated with unexplained fever or reflex sympathetic dystrophy syndrome, particularly two of its clinical variants (shoulder-hand syndrome and the syndrome of palmar fasciitis and polyarthritis). The pathogenesis of paraneoplastic symptoms remains to be elucidated. One of the distinct mechanisms might be the deposition of immune complexes consisting of tumour antigens and host antibodies within the joint [2]. Cytotoxic lymphocytes may be produced by normal immune system against the host tumour, and an immune response to a target antigen within the joint might play a role in the cancer arthritis [3] An activated cytokine network is the third proposed mechanism. Elevated concentrations of interleukin-(IL)-lra, IL-6 [4] and IL-1 [5] in patients with malignant diseases and arthritis were described. In a series of 18 patients with arthritis and cancer, 8 had typical rheumatoid arthritis while the other 10 had atypical features including an explosive onset, asymmetry and predominate lower limb involvement with sparing of the hands; only one of this latter group was rheumatoid factor positive. The arthropathy antedated the discovery of the tumour by a mean 10 months. In 8 of 11 patients, in whom the tumour could be treated, the arthritis improved, and relapsed in 2 of 3 cases with tumour recurrence [1]. In another series, 26 patients were described whose inflammatory arthropathy began within 2 years of discovery of a tumour. Four of these patients met the American Rheumatism Association's (ARA) criteria for definite rheumatoid arthritis, while 7 of the remaining 22 were rheumatoid factor positive and 3 had bone erosions. No consistent relationship between successful treatment of the ma-
133
lignancy and remission were found and in addition no correlation was noted between tumour location and development of arthritis. However, breast cancer was by far the most common cause of an asymmetrical arthritis in women [6]. Analysis of an additional 12 cases revealed symmetric arthritis and a positive rheumatoid factor in 10 and 6 patients, respectively. Therapy of the tumour resulted in complete disappearance of the joint symptoms in 9 of the 12 patients and amelioration was achieved in the remaining 3 patients. The arthropathy antedated discovery of the tumour from 15 days to 18 months. Although the late age at onset of arthritis was suggested as a typical feature of cancer arthritis, in this series of 12 patients the youngest was a 36year-old man who suffered from testicular seminoma [7]. Another case of a 21-year-old man was reported in which symmetric polyarthritis antedate a discovery of a malignant fibrous histiocytoma of the heart by 5 months [8]. Besides the late age at the onset of arthritis, a predominant lower extremity involvement with sparing of wrists and small joints of hands was proposed as another typical feature of cancer arthritis. However, two cases were recently reported in which these two typical features were not observed. The first was 50-year-old man who presented with seronegative arthritis of the left elbow, wrists, metacarpophalangeal and proximal interphalangeal joints of both hands. Eleven months later laryngeal carcinoma was diagnosed [9]. The second case was a 49-year-old woman with a fever, seronegative symmetrical polyarthritis and erythematous rash. Six weeks after the onset of symptoms, a metastatic breast cancer was found [4]. The clinical course of a cancer arthritis usually parallels that of the tumour. Cure or significant remission of cancer usually but not invariably results in regression of the arthritis.
(aged 50-65 years old) developed PFA 5-25 months before the diagnose of ovarian adenocarcinoma was established. All had bilateral pain and a limitation of motion of the shoulders and hands, as well as prominent palmar fasciitis and polyarthritis. A nonresectable tumour with ascites and peritoneal metastatic seeding was found in all patients [11]. In another series 5 patients, 3 women and 2 men were reported. The neoplasm with PFA in this study included chronic myelogenous leukaemia, adenocarcinoma of the pancreas, squamous cell carcinoma of unknown origin, and Hodgkin's lymphoma. Rheumatologic symptoms occurred in close temporal relation to the discovery of malignancy in all patients. Arthritis involving joints in the upper extremities was seen in all patients, as well as a flexion contratures of the small joints of the hands resulting in Claw hand. Two patients exhibited also arthritis of the lower extremities, palmar and plantar faciitis [10]. It is important to emphasise the aggressive fibrosing nature of the upper extremity lesions. Several patients described [10,11] were initially misdiagnosed as having scleroderma, idiopathic fibromatosis or a fibrosing syndrome of unknown aetiology. Recently a patient with PFA associated with breast cancer was reported [12]. The PFA syndrome has also been noted in a patient suffering from endometrial benign ovarian cyst [13]. Rheumatologic symptoms are usually reluctant to nonsteroidal anti-inflammatory agents, corticosteroids, ganglion blockade or physical therapy but chemotherapy may offer some improvement [10]. Successful removal of a tumour may also be followed by a dramatic improvement in pain and vasomotor disturbances, but predictably, contractures improve at a slower rate [14].
2.3. Hypertrophic Osteoarthropathy 2.2. Palmar Fasciitis and Polyarthritis Palmar fasciitis and polyarthritis (PFA) are considered as an atypical form of the reflex sympathetic dystrophy syndrome (RSDS). It differs from typical cases of RSDS in that the fasciitis is more severe, arthritis is more inflammatory and both are more rapidly progressive [10]. The association between PFA and the underlying maUgnant neoplasm was first described in an ovarian carcinoma. Six postmenopausal women
134
The syndrome of hypertrophic osteoarthropathy (HOA) is a well recognised complication of malignancy [15]. It is characterised by digital clubbing, periostosis of the tubular bones and oligosynovitis or poly synovitis [16]. As a minimum digital clubbing and periostosis of the tubular bones must be present to diagnose HOA, it may be classified as either primary, which is usually hereditary, or secondary [17]. The latter most commonly occurs in the setting of nonsmall
cell lung cancer and lung metastases [15, 18]. Rarely the syndrome is also seen with lymphomas, hepatic, oesophageal and colon carcinoma as well as with some non malignant diseases. This is especially true with chronic infections, cystic fibrosis, pulmonary fibrosis, cyanotic congenial heart disease and liver cirrhosis [16]. The pathogenesis of HOA is uncertain, with neural involvement suggested by rapid response to vagotomy and atropine [19]. Platelet-endothelial interaction with the production of von Willebrand factor antigen has been impUcated in the pathogenesis of HOA [20]. It was also proposed that clubbing and HOA are the result of the peripheral impaction of megakaryocytes and platelet clumps in the fingers and toes, to which this particular matter has passed in an axial stream [21]. Synovial effusions, usually with an insidious onset, most often involves knees, ankles, wrists, and metacarpophalangeal joints. It is often associated with tenderness over adjacent bones. Synovial fluid from affected joints is typically noninflammatory [22]. An isotopic bone scan may demonstrate a pericortical, linear concentration of nuclide along the shafts of affected bones and so permit an early diagnosis before periostal new bone formation is apparent on plain Xray images [23]. The bone scan may be positive prior to the development of symptoms [16]. The treatment of HOA is rather disappointing. Successful treatment of the underlying diseases is usually associated with a rapid resolution of the problem. However, in most cases with lung cancer, the disease is often in the advanced state, making successful treatment difficult. Although nonsteroidal anti-inflammatory drugs and colchicine might be successful in pain reUeving, many times, however, the symptoms do not respond to therapy [24].
2.4. Jaccoud's Type Arthropathy Jaccouds arthropathy, characterised by a rapidly developing, nonerosive, deforming, painless arthropathy, has been associated with a variety of medical conditions (rheumatic fever, SLE, eosinophilic fasciitis, myocardial infarction, chronic obstructive lung disease and tuberculosis, and in otherwise apparently healthy patients). But it may be also an initial manifestation of metastatic lung carcinoma [25].
3. PARANEOPLASTIC ARTHROPATIES OF HAEMATOLOGICAL DISORDERS 3.1. Leukaemic Arthritis Arthritis is observed more frequently in children (1265%) than in adults (4-13%) and more often in acute than in chronic leukaemia [26-28]. The pathogenic mechanisms leading to leukaemic arthritis have not been entirely clarified. From synovial fluid analyses, synovial biopsies and use of leukaemia-associated cell surface markers, synovial infiltration appears to be the predominant mechanism [27, 29-34]. In this case the leukaemic arthritis tends to be asymmetric and additive. Large joints, most commonly the knees, are usually involved [27]. However, ankle, wrist, elbow, shoulders and hip involvement have been described. Effusions, if present, are small. Severe joint pain, out of proportion to the degree of inflammatory arthritis has been reported by several authors [26]. The white blood cells count in the synovial fluid of the involved joints ranged from noninflammatory to highly inflammatory, rarely revealing leukaemic cells. Rheumatoid factor and ANA results are typically negative. Patients may develop several kinds of radiologic abnormalities: osteopenia, erosions, lytic lesions and metaphyseal radiolucent bands [26]. Histologic examination of the synovial membrane usually shows infiltration of malignant cells, without villous proliferation of synovia or neovascular formation [27, 35]. On the other hand, there are several cases of leukaemic arthritis in which synovial biopsy (some of them obtained at open surgery) revealed no leukaemic infiltration. Even more, marked stratification of synovial lining cells and prominent proliferation of synovial stromal cells were described [35-38]. Autopsy studies indicated that leukaemic involvement of the sinovium may be rare, even with clinical evidence of arthritis [39]. Thus, joint manifestation in leukaemia clearly can occur without evident malignant cell infiltrations. In those cases it is more likely that the synovitis is an immune complex induced synovitis. Cases of proliferative synovitis associated especially with adult T-cell leukaemia [37, 38], hairy cell leukaemia [40, 41] and acute lymphoblastic leukaemia [42], but also to myeloid leukaemia [35, 43] have been reported. In those patients the arthritis tends to be symmetrical, sometimes mimicking rheumatoid arthritis. Radiographic findings of the involved joints may be either
135
normal [35] or reveal erosions [26, 38,40,44,45]. The pathogenic mechanisms leading to the proliferative synovitis are uncertain. Human adult T-cell leukaemia is closely linked to human T-cell lymphotropic virus type I (HTLV-1) infections. It has been shown that HTLV-1 induced transformation of T-cells generated constitutive production of various proinflammatory cytokines, which in turn may cause proliferative synovitis [38]. It has also been shown that cells from patients with B-cell chronic lymphocytic leukaemia, secrete a number of regulatory and pro-inflammatory cytokines, including IL-lj0 [46, 47]. Recendy, a case was reported in which overexpanded B-ceU clone mediated leukaemic symmetric polyarthritis by abundant secretion of IL-1^ [45]. Therefore, cytokines secreted by leukaemic cells could be implicated in the pathogenesis of some forms of leukaemic arthritis. In same cases leukaemic arthritis seems to improve with administration of nonsteroidal anti-inflammatory agents. The best therapy is chemotherapy for the underlying leukaemia. 3.2. Lymphoma Musculoskeletal symptoms in lymphoma are common. Approximately 7-25% of patients may develop skeletal involvement at some time during the course of the disease, mosdy as polyarthralgia, pathological fractures of bones or hypertrophic osteoarthropathy associated with mediastinal involvement [48, 49]. Notwithstanding, arthritis as a presenting feature of lymphomas is extremely rare and many of these are due to direct synovial involvement by the lymphoma or a reaction to adjacent lymphomatous process [50, 51]. However, several patients with non-Hodgkins lymphoma who presented with polyarthritis, sometimes mimicking rheumatoid arthritis, have been reported [52-56]. It is likely that the arthritis and lymphoma were causally linked, because in those cases in which the lymphoma was successfully treated, the arthritis symptoms resolved promptly and completely. Most of the lymphomas, where the phenotype was known, were T-cell lineage, including cutaneous forms [52]. In the cases, which were reported, synovial biopsy findings revealed chronic nonspecific inflammatory changes; these were felt to be a reactive phenomenon. No malignant lymphocytic infiltration was noted [53, 55, 57]. One may postulate that the polyarthritis associated with non-Hodgkins lymphoma.
136
similar to leukaemic polyarthritis, may be cytokine driven. Another rheumatologic manifestation of lymphoma was reported in a patient with stage IV diffuse, well-differentiated lymphocitic lymphoma who subsequendy developed rapidly progressive sacroiliitis and enthesopathies with extensive symmetric erosions of the sacroiUac joints [58]. 3.3. Myelodysplastic Syndromes The myelodysplasdc syndromes (MDS) are a heterogenous group of poorly understood refractory anaemias resuldng from a clonal abnormality in the pluripotendal stem cell [59]. An increased frequency of clinical immune disorders has been reported in padents with MDS, up to 30% in some series [6064]. These include cutaneous vasculitis, a lupus-like syndrome, neurological manifestations and polyarthrids. The pathophysiologic basis for the development of autoimmune disorders in patients with MDS remains unclear. Abnormalities of T- and B-cell function, decreased helper and suppressor T-cell numbers, decreased natural killer cells, T-cell receptor gene rearrangements and occasional T-cell lymphomas occur in patients with MDS [62]. It may be hypothesised that abnormal antigen presentation, T-cell responses to antigen presentation and/or abnormal B- and T-cell interactions in MDS leads to immune dysregulation and consequent development of autoimmune disorders. Alternatively, a common trigger could damage both myeloid and lymphoid cells, leading to the development of MDS and a predisposition to autoimmunity [62]. Two patterns of arthritis were seen: symmetric peripheral polyarthritis, mimicking rheumatoid arthritis and asymmetric oligoarthritis limited to the large joints. In most instances, the arthritis was temporally related to the initial discovery of cytopenias. Radiographs of the involved joints were either normal or revealed joint space narrowing and erosions. Histologic examinations of the synovial membrane were not mentioned. The rheumatoid factor was positive in some series and negative in others [60, 61]. The use of steroids resulted in improvement in articular complaints and hematological manifestations in some series and in one case report [60, 64]. Thus, the MDS need to be considered in the differential diagnosis of any case of new-onset arthritis accompanied or subsequendy followed by persistent cytopenias.
3.4. Amyloid Arthropathy Multiple myeloma can present as polyarthritis, which is due to amyloid deposition in synovia and articular cartilage [65, 66]. Amyloid arthropathy occurs in about 5% of patients with multiple myeloma, occasionally as the initial manifestation. It has also been described in Waldenstroms macroglobulinaemia with Bence-Jones proteinuria. The clinical picture can resemble rheumatoid arthritis mostly affecting shoulders, wrists, knees and small joints of the hands. Carpal tunnel compression is usually associated with amyloid arthropathy [66]. Thus, it appears that the combination of carpal tunnel syndrome and an arthropathy in a patient with multiple myeloma strongly suggests that the patient may have amyloidosis. Diagnosis can be established by demonstration of amyloid deposits in synovia and/or synovial fluid sediment [65, 66].
4. ARTHROPATHIES ASSOCIATED WITH CANCER IMMUNOTHERAPY The immunotherapy of malignancy utilises the hosts immune system to destroy neoplastic cells. Polyarthritis may evolve or reappear as a result of this therapy. In a report of 3 patients receiving IL-2 immunotherapy for metastatic melanoma and renal-cell carcinoma, 2 patients developed a clinical picture resembling rheumatoid arthritis. A third patient, who had a remote history of Reiters syndrome, developed symmetric oligoarthritis [67]. The authors postulated induction of an autoimmune arthritis via an IL-2 induced T-cell mechanism, based on the inflammatory histologic findings, elevated levels of rheumatoid factor, positive antinuclear antibodies and positive HLADR4 genotype. Patients receiving IL-2 also developed spondiloarthritis with peripheral involvement and psoriatic arthritis [68]. The arthritis was self-limited, with improvement when immunotherapy was stopped but could be reproducibly induced by successive treatment cycles. HLA typing of these patients showed the presence of HLA-B27 and HLA-B38, both major histocompatibility complex antigens associated with the respective diseases. Three cases of self-limited symmetrical polyarthritis following tamoxifen therapy for breast cancer were described [69]. Arthritis was also seen in patients after interferon-a treatment. Pol-
yarthritis was the most common type of presentation, reported in 19 patients. Oligoarthritis or monoarthritis were less common, described in only 5 patients [70]. Lately, there have been several reports on the development of symmetric polyarthritis in patients receiving Calmette-Guerin bacillus immunotherapy [71-73]. Patients with cancer undergoing immunotherapy may provide an excellent model for investigation and clarifying the mechanisms underlying inflammatory arthritides and autoimmunity in general [67].
5. CONCLUSIONS Arthritis is a well-recognised complication of neoplastic diseases. It may present before, after, or at the same time as the underlying malignancy. Identifying an occult neoplastic disease by its rheumatic symptoms is a challenge. The paraneoplastic cause of the arthritis should be suspected in cases of atypical presentation and/or nonresponding to conventional therapy, regardless the patients age. Treatment of the neoplasia may afleviate the joint symptoms.
REFERENCES 1.
2.
3.
4.
5. 6.
7.
8.
MacKenzie AH, Scherbel AL. Connective tissue syndromes associated with carcinoma. Geriatrics 1963;18:745-753. Awerbuch MS, Brooks PM. Role of immune complexes in cancer in hypertrophic osteoarthropaty and nonmetastatic polyarthritis. Ann Rheum Dis 1981;40:470-472. Butler RC, Thompson JM, Keat ACS. Paraneoplastic rheumatic disorders: a review. J Roy Soc Med 1987;80:168-172. Drenth JPH, de Kleijn EHMA, de Mulder PHM, van der Meer JWM. Metastatic breast cancer presenting as fever, rash, and arthritis. Cancer 1995;75:1608-1611. Hall TC. Paraneoplastic syndromes: mechanisms. Semin Oncol 1997;24:269-276. Sheon RP, Kirsner AB, Tangsintanapas P, Samad F, Garg ML, Finkel RI. Malignancy in rheumaic disease: interrelationships. J Am Geriat Soc 1977;25:2027. Pfitzenmeyer P, Bielefeld P, Tavemier C, Besancenot JF, Gaudet M. Aspects actuels de la polyarthrite aigue paraneoplasique. Rev Med Int 1992;13:195-199. Berkelbach van der Sprenkel JW, Timmermans AIM, Fibers HRJ, van Herpen G, Dinant HJ. Polyarthritis
137
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
138
as the presenting symptom of a malignant fibrous histiocytoma of the heart. Arthrit Rheum 1985;28:944947. Eggelmeijer F, Macfarlane JD. Polyarthiltis as the presenting symptom of the occurrence and recurrence of a laryngeal carcinoma. Ann Rheum Dis 1 992;51:556-557. Pfinsgraff J, Buckingham RB, Keister SR, et al. Palmar facutis and arthritis with malignant neoplasms: a paraneoplastic syndrome. Semin Arthrit Rheum 1986;16:118-125. Medsger TA, Dixon JA, Garwood VF. Palmar fascutis and polyarthritis associated with ovarian carcinoma. Ann Int Med 1982:96:424^31. Saxman SB, Seitz D. Breast cancer associated with palmar fascutis and arthritis. J Clin Oncol 1997;15:3515-3516. Champion GD, Saxon JA, Kossard S. The syndrome of palmar fibromatosis (fascutis) and polyarthritis. J Rheumatol 1987;14:1196-1198. Caldwell DS. Musculoskeletal syndromes associated with malignancy. In: Kelley WN, Harris ED, Ruddy S, Sledge CB, eds. Textbook of Rheumatology. Philadelphia: WB Saunders 1997:1521-1533 Schumacher HR. Articular manifestation of hypertrophic osteoarthropathy in bronchogenic carcinoma. Arthrit Rheum 1976;19:629-636. Altman RD, Tenenbaum J. Hypertrophic osteoarthropathy. In: Kelley WN, Harris ED, Ruddy S, Sledge CB, eds. Textbook of Rheumatology. Philadelphia: WB Saunders 1997:15141520. Martinez-Lavin M, Matucc-Cerinic M, Jajic I, Pineda C. Hypertrophic osteoarthropaty: consensus on its definition, classification, assessment and diagnostic criteria. J Rheumatol 1993;20:13861387. Vogl A, Blumenfeld S, Gutner LB. Diagnostic significance of pulmonary hypertrophic osteoarthropathy. Am J Med 1955;18:51-55 Lopez-Enriquez E, Morales AR, Robert F. Effect of atropine sulphate in pulmonary hypertrophic osteoarthropathy. Arthrit Rheum 1980;23:822-824. Matucci-Cerinic M, Martinez-Lavin M, Rojo F, Fonseca C, Kahalen BM. Von Willebrand factor antigen in hypertrophic osteoarthropathy. J Rheumatol 1992;19:765. Dickinson CJ. The etiology of clubbing and hypertrophic osteoarthropathy. Eur J Clin Invest 1993;23:330-338. Naschitz JE, Rosner I, Rozenbaum M, Elias N, Yeshurun D. Cancer-associated rheumatic disorders: clues to occult Neoplasia. Semin Arthrit Rheum 1995;24:231-241.
23.
24.
25.
26. 27. 28. 29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
Segal AM, MacKenzie AH. Hypertrophic osteoarthropathy: a 10-year retrospective analysis. Semin Arthrit Rheum 1982;12:220-232. John WJ, Foon KA, Patchell RA. Paraneoplastic syndromes. In: DeVita VT, Hellman S, Rosenberg SA, eds., Cancer: Principles and Practice of Oncology, 5th edn. Philadelphia: Lippincott-Raven 1997:23972422. Johnson JJ, Leonard-Segal A, Nashel DJ. Jaccoud's type arthropathy: an association with malignancy. J Rheumatol 1989;16:1278-1280. Evans TI, Nercessian BM, Sanders KM. Leukemic arthritis. Semin Arthrit Rheum 1994;24:48-56. Spilberg I, Meyer GJ. The arthritis of leukemia. Arthrit Rheum 1972;15:630-635. Silverstein MN, Kelly P. Leukemia with osteoarticular symptoms and signs. Ann Int Med 1963;59:637-645. Holdrinet RSG, Corstens F, VanHorn JR, Bogman JJT. Leukemic synovitis. Am J Med 1989;86:123126. Fam AG, Voorneveld C, Robinson JB, Sheridan BJ. Synovial fluid immunocytology in the diagnosis of leukemic synovitis. J Rheumatol 1991;18:293296. Gramatski M, Burmester G, Konig HJ, et al. Synovial fluid involvement in null cell acute lymphoblastic leukemia diagnosed with monoclonal antibodies. J Rheumatol 1988;15:500-504. Gagnerie F, Taillan B, Euller-Ziegler L, et al. Arthritis of the knees in B cell chronic lymphocytic leukemia: a patient with immunologic evidence of B lymphocytic synovial infiltration. Arthrit Rheum 1988;31:815816. Sanders KM, Nercessian BM, Todd WM, Carlson PL. Leukemic arthritis diagnosed by flow cytometry of synovial fluid. J Rheumatol 1993 ;20:1621. Harden EA, Moore JQ, Haynes BE. Leukemiaassociated arthritis: Identification of leukemic cells in synovial fluid using monoclonal and polyclonal antibodies. Arthrit Rheum 1984;27:13061308. Weinberger A, Schumacher HR, Schimmer BM, Myers AR, Brogadir SP. Arthritis in acute leukemia: clinical and histopathological observation. Arch Int Med 1981;141:1183-1187. Fink CW, Windmiller J, Sartain P Arthritis as the presenting feature of childhood leukemia. Arthrit Rheum 1972;15:347-349. Eguchi K, Aoyagi T, Nakashima M, et al. A case of adult T cell leukemia complicated by proliferative synovitis. J Rheumatol 1991;18:297-299. Taniguchi A, Takenada Y, Noda Y, et al. Adult T cell leukemia presenting with proliferative synovitis. Arthrit Rheum 1988;31:1076-1077.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48. 49.
50.
51.
52.
53.
54.
Thomas LB, Forkner CE, Frei E, Besse BE, Stabenau JR. The skeletal lesions of acute leukemia. Cancer 1961;14:608-621. Zervas J, Vayopoulos PH, Kaklamanis CH, Zerva CH, Fessas PH. Hairy-cell leukemia-associated polyarthritis: a report of two cases. Br J Rheumatol 1991;30:157-158. Taylor HG, Davis MJ, Hothersall TE. Hairy cell leukemia and rheumatoid arthritis. Br J Rheumatol 1991;30:391-392. Luzar MJ, Sharma HM. Leukemia and arthritis: including reports on light, immunofluorescent, and electron microscopy of the synovium. Arthrit Rheum;10:132-135. Taillan B, Leyge JF, Fuzibet JG, Nectouk F, Ziegler G, Dujardin P. Knee arthritis revealing acute leukemia in a patient with rheumatoid arthritis. Clin Rheumatol 1991;10:76-77. Crofts MAJ, Sharp JC, Jorney MY. Rheumatoid arthritis and hairy cell leukemia. Lancet 1979;ii:203204. Rudwaleit M, EHas F, Humaljoki T, et al. Overexpanded B cell clone mediating leukemic arthritis by abundant secretion of interleukin-1/3. Arthrit Rheum 1998;41:1695-1701. Hoffbrand AV, Panayiotidis P, Reittie J, Ganeshaguru K. Autocrine and paracrine growth loops in chronic lymphocytic leukemia. Semin Hematol 1993;4:306317. Schuler M, Huber C, Peschel C. Cytokines in the pathophysiology and treatment of chronic B-cell malignancies: a review. Ann Hematol 1995;71:57-63. Braunstein EM, White SJ. Non-Hodgkin's lymphoma of bone. Radiology 1980;135:59-63. Reimer RR, Chabner BA, Young RC, Reddick R, Johnson RE. Lymphoma presenting in bone. Ann Int Med 1977;87:50-55. Dorfman HD, Siegel HL, Perry MC, Oxenhandler R. NHL of synovium simulating rheumathoid arthritis. Arthrit Rheum 1987;30:155-161. Rice DM, Semle E, Ahl ET, Bohrer SP, Rothberger N. Primary lymphoma of bone presenting as monoarthritis. J Rheumatol 1984;11:851-854. McDonagh JE, Clarke F, Smith SR, Kesteven P, Walker DJ. Non-Hodgkin's lymphoma presenting as polyarthritis. Br J Rheumatol 1994;33:79-84. Seleznick MJ, Aguilar JL, Rayhack J, Fenske N, Espinoza LR. Polyarthritis associated with cutaneous T cell lymphoma. J Rheumatol 1989;16:1379-1382. Von Kempis J, Kohler G, Herbst EW, Peter HH. Intravascular lymphoma presenting as symmetric polyarthritis. Arthrit Rheum 1998;41:11261130.
55.
56.
57.
58.
59.
60.
61.
62.
63.
64.
65.
66.
67.
68.
69.
Roldan MR, Martinez F, Roman J, Torres A. NonHodgkin's lymphoma: initial manifestations. Ann Rheum Dis 1993;52:85-86. Menon N, Madhok R. Symmetrical polyarthritis is not always rheumatoid. Ann Rheum Dis 1994;53:631632. Mathur A, Parhami N. Arthritis mutilans associated with cutaneous T cell lymphoma. J Rheumatol 1992;19:1489. Richter Cohen M, Carrera GE, Lundberg J. Rapidly progressive sacroiliitis in a patient with lymphocytic lymphoma. Ann Rheum Dis 1993;52:239240. Bennett JM, Catovsky D, Daniel MT, et al. Proposals for the classification of the myelodysplastic syndromes. Br J Haematol 1982;51:189199. George SW, Newman ED. Seronegative inflammatory arthritis in the myelodysplastic syndromes. Semin Arthrit Rheum 1992;21:345-354. Enright H, Jacob HS, Vercellotti G, Howe R, Belzer M, Miller W. Paraneoplastic autoimmune phenomena in patients with myelodysplastic syndromes: response to immunosuppressive therapy. Br J Haematol 1995;91:403-408. Enright H, Miller W. Autoimmune phenomena in patients with myelodysplastic syndromes. Leuk Lymphoma 1997;24:483-489. Kuzmich PV, Ecker GA, Karsh J. Rheumatic manifestations in patients with myelodysplastic and myeloproliferative diseases. J Rheumatol 1994;21:16491654. Castro M, Conn DL, Daniel Su WP, Garton JR Rheumatic manifestations in myelodysplastic syndromes. J Rheumatol 1991;18:721-727. Turner-Stokes L. Hematology-prymary blood disorders presenting with arthritis. In: Maddison PJ, Isenberg DA, Woo P, Glass DN, eds., Oxford Textbook of Rheumatology. Oxford: Oxford University Press 1993:374-375. Hickling P, Wilkins M, Newman GR, et al. A study of amyloid arthropathy in multiple myeloma. Quart J Med 1981;50:417-433. Massarotti E, Liu NY, Mier J, Atkins MB. Chronic inflammatory arthritis after treatment with high dose interleukin-2 for malignancy. Am J Med 1992;92:693-697. Scheibenbogen C, Keilholz U, Pezzutto A, Hunstein W. Rheumatic disease following immunotherapy. Ann Rheum Dis 1993;52:165-168. Creamer P, Lim K, George E, Dieppe P. Acute inflammatory polyarthritis in association with tamoxifen. Br J Rheumatol 1994;33:538-585.
139
70.
71.
140
Nesher G, Ruchlemer R. Alpha-interferon-induced arthritis: clinical presentation, treatment, and prevention. Semin Arthrit Rheum 1998;27:360365. Goupille P, Soutif D, Valat JP. Arthritis after Calmette-Guerin bacillus immunotherapy for bladder cancer. J Rheumatol 1992;19:266-267.
72.
73.
Missioux D, Hermabessiere J, Sauvezie B. Arthritis and iritis after bacillus Calmette-Guerin therapy. J Rheumatol 1995;22:2010. Fenske TK, Davis P, Aaron SL. Human adjuvant disease revisited: a review of eleven postaugmentation mammoplasty patients. Clin Exp Rheumatol 1994;12:477-481.
(c) 2000 Elsevier Science B.V. All rights reserved. The Decade of Autoimmunity Y. Shoenfeld and M. E. Gershwin, editors
Autoantibodies, Autoimmunity and Cancer Yaron Tomer and Yehuda Shoenfeld Tel-Aviv University, Tel-Aviv, Israel
1. INTRODUCTION
2.1. Autoimmune Hemolytic Anemia [1-9]
There appears to be a close relationship between autoimmunity and neoplasia. Both autoimmunity and cancer are conditions in which cellular regulation is impaired. In autoimmune diseases immune dysregulation initiates production of autoantibodies and autoreactive lymphocytes, and in malignancies impaired regulation of cellular maturation and proliferation induces uncontrolled neoplastic growth. More specifically, immune dysregulation is believed to play a pathogenic role in the development of both autoimmunity and neoplasia. The close relationship between autoimmunity and cancer is manifested by the finding of increased incidence of autoimmune conditions and autoantibodies in patients with neoplastic diseases. Conversely, an increased incidence of malignancies has been observed among patients with autoimmune diseases. This chapter reviews the pertinent data relating to the association of autoimmunity and neoplasia, focusing on the mechanisms involved in the induction of malignancy in autoimmune diseases.
Autoimmune hemolytic anemia is the most common autoimmune syndrome associated with cancer and is characterized by an increased destruction of red blood cells by autoantibodies. In one series, a malignant disease was found in 14% of 175 patients with autoimmune hemolytic anemia [2]. Usually, autoimmune hemolytic anemia is associated with lymphomas and leukemias [4]. However, autoimmune hemolytic anemia has been described in solid tumors including cancer of the lung, breast, colon, cervix [5], hypernephroma and melanoma. In most patients with paraneoplastic autoimmune hemolytic anemia, the tumor had already metastasized. Moreover, steroid treatment has been found to be much less effective in paraneoplastic autoimmune hemolytic anemias than in idiopathic autoimmune hemolytic anemias [9]. In most cases of malignancy related autoimmune hemolytic anemia, the autoantibodies are of the warm autonatibody type, however, there are reports of cancer patients with cold agglutinins [10-12]. The mechanism of autoimmune hemolytic anemia secondary to neoplasia is unknown, and several hypotheses have been proposed including release of tumor-associated antigens mimicking to red blood cell antigens, production of autoantibodies by the tumor itself in case of B-cell lymphomas, and adsorption of immune complexes, formed as a result of the immune reaction to the tumor, on the erythrocyte membrane [9].
2. AUTOIMMUNE CONDITIONS IN MALIGNANT DISEASES Numerous autoimmune phenomena have been reported in malignancies. The autoimmune conditions reported in malignancies may be regarded as paraneoplastic syndromes or syndromes that cannot be explained by the local effects of the tumor or its metastases.
2.2. Autoimmune Thrombocytopenia [13-19] An autoimmune thrombocytopenia similar to idiopathic thrombocytopenic purpura (ITP) has been reported in neoplastic diseases. In different series a ma-
141
lignant disease was found in 4—19% of patients with thrombocytopenia and purpura [13]. In most cases, paraneoplastic autoimmune thrombocytopenia was associated with lymphoproliferative diseases, especially Hodgkin's disease, however, it was also described in epithehal cancers [18-19]. Corticosteroid treatment of paraneoplasitc autoimmune thrombocytopenic is less effective than in ITP, but splenectomy may induce long remissions [14]. As in the case of paraneoplastic autoimmune hemolytic anemia, several mechanisms have been proposed to explain the development of thrombocytopenia in malignancies and these include cross-reaction between a tumor-associated and thrombocyte antigens, or adhesion of immune complexes to the thrombocyte membrane [18]. 2.3. Autoimmune Neutropenia Autoimmune neutropenia is a rare disorder described in a few patients with Hodgkin's and non-Hodgkin's lymphomas. In these patients the neutropenia was attributed to IgG autoantibodies directed against leukocytes and white blood cell precursors in the bonemarrow [20-22]. 2.4. Myasthenia Gravis [23-24] Myasthenia gravis is a neuromuscular disease characterized by weakness and fatigability of skeletal muscles. The disease is caused by the production of antiacetylcholine receptor antibodies which block and destroy the acetylcholine receptors. The association between myasthenia gravis and thymomas is a well known one. The incidence of myasthenia gravis in patients with thymoma is approximately 35%. In some patients with thymoma only antiacetylcholine receptor antibodies were described without apparent myasthenia gravis. The mechanisms for this association are still unknown.
in patients with small cell carcinoma of the lung, sometimes appearing long before the tumor becomes apparent. 2.6. Dermatomyositis [26-31 ] Dermatomyositis and polymyositis are conditions believed to be of autoimmune etiology in which the skeletal muscle is damaged by an inflammatory process consisting mainly of lymphocytic infiltration. In polymyositis there are no skin lesions, but in dermatomyositis there is a characteristic skin rash. As early as 1916, an increased incidence of cancer was noted in patients with polymyositis [26], and since then this association has been reported in many other studies. Recently, the risk of cancer was estimated in a cohort of 788 patients with dermatomyositis or polymyositis in Sweden [31]. Among the 396 patients with polymyositis, cancer was diagnosed in 9% of the patients and the relative risk of cancer was 1.7-1.8. Among the 392 patients with dermatomyositis, cancer was diagnosed in 15% of the patients and the relative risk of cancer was 2.4 in male and 3.4 in female patients. These results demonstrated a moderate but significant increase in the incidence of cancer in patients with polymyositis and a significant increase in the incidence of cancer in patients with dermatomyositis, especially in females.
3. AUTOANTIBODIES IN MALIGNANT DISEASES The association between neoplastic diseases and autoimmune conditions led investigators to search for autoantibodies in cancer patients who did not necessarily develop overt autoimmune manifestations. Indeed, various autoantibodies have been detected in sera of patients with both hematologic and epithelial malignancies [32].
2.5. Eaton-Lambert Syndrome [25] This syndrome which clinically resembles myasthenia gravis is caused by antibodies that react with voltagegated calcium channels on the presynaptic neuromuscular junction. The binding of these antibodies to the calcium channels prevents release of acetylcholine which induces the clinical manifestations of the syndrome. Eaton-Lambert syndrome has been described
142
4. ANTINUCLEAR ANTIBODIES [33-45] There are many reports of antinuclear antibodies in the sera of patients with malignant tumors. Burnham [33] found positive ANF tests in 65 (19%) of 342 patients with neoplastic disease, compared with a frequency of 1% in the controls. In another series
including 113 cancer patients, the incidence of positive ANA test was 27% compared with 2% in the control group [34]. Likewise, Zermosky et al. [35] found positive ANF test in 13% of patients with various malignancies. Increased prevalence of ANA was reported in epithelial tumors including carcinoma of the breast, prostate, melanoma, hepatocellular carcinoma and leukemias [35^2]. The antinuclear antibodies produced in malignancies differ from those that characterize SLE. In SLE the antinuclear antibodies are typically directed against many nuclear antigens including ssDNA, dsDNA, Sm and RNP. However, in malignancies the spectrum of antinuclear antibodies described is more limited; for example in one study of patients with lymphomas and leukemias only anti-ssDNA antibodies were described. We studied 84 patients with Hodgkin's lymphoma and 55 with non-Hodgkin's lymphomas for the presence of autoantibodies to ssDNA, dsDNA, Poly (I), Poly (G), cardiolipin, histones, RNP, Sm, Ro, La and the common anti-DNA idiotype (16/6), using an ELISA assay [45]. Anti-ssDNA antibodies were detected in the sera of 23.8% of the patients with lymphomas. Anti-RNP and anti-Sm antibodies were found in 21.7% and 20% of the patients respectively, significantly more than in the controls. With all other autoantibodies examined no significant difference could be observed in the incidence between lymphoma patients and controls. The prognostic significance of increased ANA was examined in breast cancer and the results have shown that the presence of ANA in the serum of these patients prior to mastectomy was associated with higher risk of recurrence or metastases in a follow-up of 2 years [37]. In another study, the presence of ANA in the serum of patients with breast cancer was found to be a poor prognostic factor [36].
5. RHEUMATOID FACTOR [46-51] Rheumatoid factors (RF) are autoantibodies directed against antigenic sites on the Fc portion of IgG and are one of the serological markers of rheumatoid arthritis. RF was reported in various autoimmune diseases and was found to be increased in several malignancies as well. The incidence varies according to different workers between 11 and 85% [49]. Similar to ANA, the presence of RF was also found to correlate with poor prognosis in transitional cell carcinoma of the
bladder [49], melanoma and gastrointestinal cancer [48].
6. OTHER TISSUE AUTOANTIBODIES Several workers reported increased incidence of smooth muscle antibodies of the IgG or IgM type in malignancies [32, 34, 37]. These autoantibodies were described in several malignant tumors including melanoma [52], carcinoma of the lung [32], breast [37], ovary, lung [34] and cervix [32]. In one study [37] the presence of antismooth muscle antibodies was correlated with poor prognosis in patients with breast cancer. Since antismooth muscle antibodies typically are raised in chronic active hepatitis it was suggested that their presence in malignancies may be associated with liver metastases. However, antismooth muscle antibodies were found in patients with localized malignancies [52] and this hypothesis seems unlikely. Other autoantibodies that were found to be increase in malignancies include antiparietal cell antibodies [40], thyroid autoantibodies, anticytoplasmic antibodies [40] and antiperinuclear antibodies.
7. AUTOANTIBODIES IN MALIGNANCIES ARE THEY TRULY INCREASED? The finding of increased incidence of autoantibodies in malignancies caused much excitement and hope among oncologists and immunologists. Some investigators have raised the possibility that autoantibodies may be the long awaited for tumor markers and may even serve as serological screening test for malignancies [33]. Several hypotheses have been proposed to explain the production of autoantibodies in malignancies including host immune-reactions to tumor-associated antigens [34], antigenic stimulation as a result of enhanced destruction of malignant cells [37], immune dysregulation induced by the neoplastic process, antigenic stimulation as a result of therapy [47], and production of autoantibodies by the tumor itself as in the case of B-cell lymphomas and monoclonal gammopathies. However, autoantibodies and malignancy may both be associated with another condition rather than with each other. Since autoantibodies and cancer are known to be more prevalent in old age we investigated whether or not the associa-
143
tion between neoplasia and autoimmunity results from increased incidence of both conditions in senescence. In our preliminary investigation [61] we studies 139 patients (55 of whom were aged 60 years and younger, and 84 were older than 60 years) suffering from a variety of malignant tumors for ANA, RF and antierythrocyte antibodies (Coomb's test). There was no significant difference between the incidences of ANA and RF in the young patients and in the young controls and similarly, there was no significant difference between the incidences of ANA and RF in the elderly cancer patients and in the elderly controls. Our results suggest that the reported high incidence of ANA and RF in malignancies is a result of the old age of these patients rather than the tumor itself. However, the incidence of antierythrocyte antibodies was significandy higher in the patients than in the controls. This study was later extended to test a large battery of autoantibodies and the malignancies were grouped into lymphomas and solid tumors. Sera from 164 patients with carcinomas (71 with breast cancer, 30 with colonic carcinoma, 16 with cancer of the prostate, 11 with lung cancer, 9 with melanoma, and the rest with other solid tumors) were analyzed for the presence of autoantibodies to ssDNA, dsDNA, Poly (I), Poly (G), cardiolipin, histones, RNP, Sm, Ro(SSA) and La (SSB) [62]. No distinction could be made between these patients and a comparative group composed of ageadjusted healthy subjects in the levels of antibodies to these autoantigens. This finding remained valid after further subgrouping the patients according to age, sex and histologic origin of the tumor. In contrast, a further analysis of 84 patients with Hodgkin's lymphoma and 55 patients with non-Hodgkin's lymphomas for the presence of autoantibodies to the same autoantigens, have shown that significant increase in the incidence of anti-ssDNA antibodies, anti-RNP, and anti-Sm antibodies when compare to normal age matched controls. With all other autoantibodies examined no significant difference could be observed in the incidence between lymphoma patients and controls [45]. In summary the association between malignancies and autoantibody production seems more complicated than previously believed. The increased incidence of anti-ssDNA, Sm and RNP in patients with lymphomas reflects in our opinion an increased proportion of natural autoantibody producing lymphocytes, which are expanded in the malignant process. This is analogous to our findings in monoclonal gammopathis [59, 60]. However
144
the increased incidence of many (but not all) autoantibodies in the sera of patients with solid malignancies may well reflect the older age of these patients rather than be a result of the tumor itself. However, further analyses with more autoantibodies and larger series of patients with specific tumors are needed to clarify this complex subject.
8. MALIGNANT TRANSFORMATION IN AUTOIMMUNE DISEASES Malignant tumors specifically lymphoid malignancies are diagnosed with increasing frequency in various autoimmune diseases. The cancer may appear during the diagnosis of the autoimmune disease or many years later. This association has important clinical and therapeutic implications. First, it may imply that in certain autoimmune diseases screening tests for malignancies should be performed routinely. Moreover, it has to be determined if the treatment given to these autoimmune diseases contributed to the malignant transformation or whether the malignancies appear independent of the treatment. 8.1. Rheumatoid Arthritis [64-72] Many workers have reported an association between rheumatoid arthritis (RA) and malignancies. Two cohort analyses of cancer morbidity have shown an excess of risk of cancer at all sites in patients with rheumatoid arthritis. Special emphasis has been given to the simultaneous occurrence of lymphoproliferative neoplasms and rheumatoid arthritis. In the study reported by Isomaki et al. [64] the relative risk for lymphoma in RA patients was 2.7 compared with the general population. A wide range of types of lymphoproliferative neoplasms has been reported in RA including Hodgkin's disease, various non-Hodgkin's lymphomas, and myelomas. The mean interval between the two diseases was 13 years [66-67]. Some workers have attributed the development of lymphomas in patients with RA to the treatment. In one large series including 643 patients with RA treated with immunosuppressive drugs a 13-fold increase in the incidence of lymphomas was found. However, in the study reported by Isomaki et al. [64] the 2.7-fold excess of lymphomas was determined in the absence of immunosuppressive drugs. Therefore it can be con-
eluded that patients with RA have two to three times greater risk for lymphoproHferative maUgnancies in the absence of immunosuppressive therapy, and this risk is further increased after such treatment. 8.2. Systemic Lupus Erythematosus (SLE) [73-81] There are many anecdotal reports of SLE patients who developed malignancies, including both epithelial tumors and lymphoproHferative neoplasms. However, only a few studies which included large series of patients have demonstrated such an association, and some of these studies were too small or not well controlled. The view that SLE is associated with lymphomas stems from animal models of SLE, namely, NZB/NZW Fl and MRL/lpr mice, that spontaneously develop malignant lymphomas [77], and from case reports of patients with SLE who developed lymphomas. In summary, although there is no definite evidence for an association between SLE and lymphoma, lupus patients with enlarged lymph nodes should be reviewed regularly and biopsies should be performed if a malignancy is suspected.
8.3. Sjogren's Syndrome (SS) [82-89] The association between SS and lymphoma was first described in 1963; this association was estabUshed following the report by Kassan et al. [83] that 7 out of 136 SS patients developed lymphomas, 44 times the frequency expected in the general population. The high prevalence of lymphomas in patients with SS could not be due to irradiation or chemotherapy, as patients who did not receive such treatment showed and increased risk of lymphoma. In a recent study in which 100 SS patients were followed for 34 months, 3 cases of lymphoma were detected [84]. The time interval between the development of SS and the diagnosis of lymphoma may be as long as 20 years. The lymphomas can be of B- or T-cell origin. Some workers have suggested that reactivation of Epstein-Barr virus (EBV) in SS patients may cause development of lymphomas. Indeed, EBV DNA was detected in increase amounts in the tumor tissue of an SS patient that developed Hodgkin's disease [86]. This finding if confirmed by other studies is of major importance as early aniviral treatment may prevent the development of lymphomas in
SS patients. Another interesting finding was reported by Pisa et al. [89] who studied 7 SS patients who developed lymphomas. In 5 of these patients translocations of the protooncogene bcl-2 t(14:18) were found. 8.4. Dermatomyositis and Polymyositis [90-99] The well known association between dermatomyositis internal malignancies has been substantiated by many studies [31], The incidence of cancer in patients with dermatomyositis has been reported to be 7—24% [90, 93]. One of the major difficulties in estimating the incidence of malignancy in dermatomyositis and polymyositis arises from the lack of common criteria for diagnosing these diseases. In 1975, Bohan and Peter [95] defined criteria for the diagnosis of dermatomyositis and polymyositis. These criteria include progressive symmetrical proximal weakness, muscle biopsy consistent with myositis, elevated muscle enzymes, abnormal electromyogram and cutaneous signs of dermatomyositis. In a recent large series of 392 patients with dermatomyositis and 396 patients with polymyositis which were diagnosed using these criteria the incidence of cancer was 15 and 9%, respectively [31]. The tumors associated with dermatomyositis and polymyositis are epithelial malignancies mainly of the colon, breast, lung, pancreas and ovary [31]. However, rare cases of hepatoma, melanoma, and lymphoma have been reported. The strong association between dermatomyositis/polymyositis and cancer has lead some investigators to recommend a thorough search for occult malignancy in any patient with dermatomyositis/polymyositis [99]. 8.5. Scleroderma [100-107] The association between scleroderma and lung cancer was first reported in 1953 [100], and since then has been substantiated by other studies. Although some workers did not find increased incidence of lung cancer in patients with scleroderma, two recent controlled studies have demonstrated increased risk for lung cancer in scleroderma. The incidence of lung cancer in scleroderma in these studies was 0.9-5% [101-104]. The most prevalent histologic type of lung cancer associated with scleroderma is bronchoalveolar carcinoma. It should be noted that lung cancer occurs in patients with scleroderma after long-standing
145
pulmonary fibrosis, but is not associated with cigarette smoking or immunosuppressive therapy [105, 106]. Breast carcinoma has also been associated with systemic sclerosis [105-107]. Increased incidence of malignant tumors has also been reported in mixed connective tissue disease. The relative risk for developing cancer in patients with mixed connective tissue disease was 12.9 [107].
transformation. The possible role of decreased immune surveillance in the induction of lymphoproliferative diseases in autoimmune conditions is supported by the observation of increased frequency of malignancies in immune deficiency states. Recently, it has been suggested that increased oncogene expression reported in some autoimmune conditions, may induce malignant transformation in these diseases [116-118].
8.6. Autoimmune Thyroid Diseases Several studies have found an increased risk of thyroid lymphoma in patients with thyroiditis. In a large controlled study, including 829 patients with chronic lymphocytic thyroiditis and 829 age- and sex-matched patients with colloid goiter, patients with thyroiditis had an increased risk of myeloproliferative and lymphoproliferative neoplasms. Acute leukemia has also been reported to be associated with autoimmune thyroid diseases [109-112].
9. MECHANISMS OF MALIGNANT TRANSFORMATION IN AUTOIMMUNE CONDITIONS The association between autoimmune diseases and maUgnant tumors can be due to a common pathogenic factor inducing the diseases, triggering of malignant transformation by the autoimmune process or due to the treatment. Genetic predisposition is believed to be important both in autoimmune diseases and cancer [113]. Indeed, there are inherited conditions, notably IgA deficiency, which predispose both to autoimmunity and malignancy [114]. It is possible that in autoimmune diseases there is immunologic predisposition for the development of malignancies. It has been suggested that the basic defect in SLE, rheumatoid arthritis and other autoimmune conditions is a deficiency in suppressor T-cell function (reviewed in [115]). A deficiency in suppressor T-cell function may lead to unregulated proliferation of B cells and lymphoproliferative malignancies. Another possibility is that the chronic antigenic stimulation of lymphocytes that takes place in autoimmune conditions (e.g., SS) may lead to a population of lymphocytes that are more susceptible to neoplastic transformation. It is not known whether an intrinsic defect in B cells in patients with autoimmune diseases might enhance malignant
146
10. CONCLUSION There are many reports on the association between autoimmune diseases and neoplasia. Autoimmune phenomena and autoantibodies have been detected in patients with malignancies. Conversely, many autoimmune conditions are associated with increased incidence of malignant tumors. The association between autoimmune diseases and malignant tumors can be due to a common pathogenic factor inducing the diseases, due to triggering of malignant transformation by the autoimmune process or due to the treatment. Several lines of evidence demonstrate that both genetic factors and nongenetic factors associated with the autoimmune process contribute to the increased frequency of malignancies. This association supports the notion that the immune system is of prime importance in the natural defense against malignancies, and we believe that future research will lead to increased utilization of immunotherapy in malignant tumors.
REFERENCES 1.
2.
3. 4. 5. 6.
Dacie JV. The Hemolytic Anemias, Congenital and Acquired, 3rd edn, part II. London: Churchill, 1962. Pirofsky B. Autoimmune hemolytic anemia and neoplasia of the reticuloendothelium. Ann Int Med 1968;68:109. Jones SE. Autoimmune disorders and malignant lymphoma. Cancer 1973;31:1092. May RB, Bryan JH. Autoimmune hemolytic anemia in Hodgkin's disease. J Pediatr 1976;89:428. Ellis LD, Westerman MP. Autoimmune hemolytic anemia and cancer. JAMA 1965; 193:962. Sohier WD Jr, Juranies E, Aub JC. Hemolytic anemia, a host response to malignancy. Cancer Res 1957;17:767.
7. 8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
Gordon PA, Baylis PH. Tumor induced autoimmune hemolytic anemia. Br Med J 1967;1:1569. Pirofsky B. Autoimmunization and the autoimmune hamolytic anemias. Baltimore: Williams and Wilkins, 1968;236. Spira MA, Lynch EC. Autoimmune hemolytic anemia and carcinoma: an unusual association. Am J Med 1979;67:753. Shulman lA, Branch DR, Nelson JM et al. Autoimmune hemolytic anemia with noth cold and ward autoantibodies. JAMA 1985;253:1746. Wortman J, Rosse W, Logue G. Cold agglutinin autoimmune hemolytic anemia in nonhematologic mUgnancies. Am J Hematol 1979;6:275. Dodds AJ, Klarkowski D, Cooper DA et al. In-vitro synthesis of an anti-BI cold agglutinin complicating a case of lymphoma. Am J Clin Pathol 1979 ;71:473. Doan C, Bouroncle BA and Wiseman BK. Idiopathic and secondary thrombocytopenic purpura. Clinical study and evalutation of 381 cases over a period of 28 years. Ann Int Med 1960;53:861. Kim HD, Boggs DR. A syndrome resembling idiopathic thrombocytopenic purpura in 10 patients with diverse forms of cancer. Am J Med 1979;67:371. Kedar A, Khan AB, Mattem JQA, et al. Autoimmune diseorders complicating adolescent Hodgkin's disease. Cancer 1979;44:112. Kirshner JJ, Zamkoff KW, Gottlieb AJ. Idiopathic thrombocytopenic purpura and Hodgkin's disease: report of two cases and a review of literature. Am JMedScil983;280:21. Berkman AW, Woog JJ, Rickler TS et al. Serial dterminations of antiplatelet antibodies in a patient with Hodgkin's diseae and autoimmune thrombocytopenia. Cancer 1983 ;51:2057. Bellone JD, Kunicki TJ, Aster RH. Immune thrombocytopenica associated with carcinoma. Ann Int Med 1983;99:470. Schwartz KA, SHchter SJ, Harker LA. Immunemediated platelet destruction and thormbocytopenia in patients with solid tumors. Br J Haematol 1982;51:17. Weitberg AB, Harmon DC. Autoimmune neutropenia, hemolytic anemia and reticulocytopenia in Hodgkin's disease. Ann Int Med 1984;100:702. Hunter JD, Logue GL, Joyner JT. Autoimmune neutropenia in Hodgkin's disease. Arch Int Med 1982;142:386. Kruskall MS, Weitzman SA, Stossel TP et al. Lymphoma with autoimmune neutropenia and hepatic sinusoidal infiltration, a syndrome. Ann Int Med 1982;97:202. Rosenow III EC, Hurley BT. Disorders of the thymus. A review. Arch Int Med 1984; 144:763.
24.
25.
26. 27.
28.
29.
30.
31.
32. 33. 34. 35.
36.
37.
38. 39.
40.
41.
Moore HJ, Woods EL. Myasthenia gravis-associated antibodies in asymptomatic thymoma. J Thorac CardiovascSurgl985;89:308. Lambert EH, Eaton LM, Rooke ED. Defect of neuromuscular conduction associated with malignant neoplasms. Am J Physiol 1956; 187:612. Stertz G. Polymyositis. Berl Khn Wochenschr 1916;53:489. Vesterager L, Worm AM, Thomsen K. Dermatomyositis and malignancy. Clin Exp Dermatol 1980;5:31-35. Tymms KE, Webb J. Dermatopolymyotitis and other connective tissue diseases: a review of 105 cases. J Rheumatol 1985;12:11140-1148. Manchul LA, Jin A, Pritchard KI, et al. The frequency of malignant neoplasms in patients with polymyositis-dermatomyositis: a controlled study. Arch Int Med 1985;145:1835-1839. Bonnetblanc JM, Bernard P, Fayol J. Dermatomyositis and malignancy: a multicenter cooperative study. Dermatologica 1990;180:212-216. Sigurgeirsson B, Lindelof B, Edhag O, Assander E. Risk of cancer in patients with dermatomyositis or polymyositis. A population-based study. N Engl J Med 1992;326:363-367. Nelson DS. Autoantiboies in cancer patients. Pathology 1977;9:155-160. Burnham TK. Antinuclear antibodies in patients with malignancies. Lancet 1972;2:436-437. Fairley GH. Autoantibodies in malignant disease. Br J Haematol 1972;23 (Suppl):231-234. Zermosky JO, Gormy MK, Jarczewska K. MHgnancy associated with antinuclear antibodies. Lancet 1972;2:1035-1036. Turnbull AR, Turner DTL, Eraser JD, et al. Autoantiboides in early breast cancer: a stage related phhenomenon? Br J Cancer 1978;38:461-463. Wasserman J, Glas U, Blomgren H. Autoantiboies in patients with carcinoma of breat. Correlation with prognosis. Clin Exp Immunol 1975; 19:417422. Albin RJ. Malignancy associated with antinuclear antibodies. Lancet 1972;2:1253-1254. Thomas PJ, Kaur JS, Aitcheson CT, et al. Antinuclear, antinucleolar, and anticytoplasmatic antibodies in patients with malignant melanoma. Cancer Res 1983;43:1372-1380. Betterle C, Peserico A, Bersani G, et al. Circulating antibodies in malignant melanoma patients. Dermatologica 1979;159:24. Kiosawa K, Daemer RJ, He LF, et al. The spectrum of complement-fixing antinuclear antibodies in patients with hepatocellular carcinoma. Hepatology 1985;5:548-555.
147
42.
43.
44.
45.
46.
47.
48.
49.
50.
51.
52.
53.
54.
55.
56. 57.
58.
148
Steiner M, Klein E, Klein G. Antinuclear reactivity of sera in pateints with leukemia and other neoplastic diseases. Clin Immunol Immunopathol 1975;4:374381. Isenberg DA, Shoenfeld Y, Schwartz RS. Multiple serologic reactions and their relationship to clinical activity in SLE. Arthrit Rheum 1984;27:132. Kostiala AAI, Gripenberg M, Elonen E, et al. Follow-up of antiboides against single-stranded DNA in patients with haematological malignancies. Clin Exp Immunol 1985;61:15. Swissa M, Cohen Y, Shoenfeld Y Autoantibodies in the sera of patients with lymphoma. Leukemia and Lymphoma 1992;7:117-122. Johnson PM, Faulk WR Rheumatoid factor: its nature, specifity and production in rheumatoid arthritis. CHn Immunol Immunopathol 1976;6:414. Twomey JJ, Rossen RD, Lewis VM, et al. Rheumatoid factor and tumor-host interaction. Proc Natl Acad Sci USA 1976;73:2106-2108. Schattner A, Shani A, Talpaz M, Bentwich Z. Rheumatoid factors in the sera of patients with gastrointestinal carcinoma. Cancer 1983;52:2156-2161. Gupta NP, Malaviya AN, Singh SM. Rheumatoid factor: correlation with recurrence in transitional cell carcinoma of the bladder. J Urol 1979; 121:417^ 18. Poskitt TR, Poskitt PK. Lack of association of rheumatoid factor with either circulating immune complexes or tumor burden in cancer patients. Cancer 1985;55:1507-1509. Lewis MG, Hartman D, Jerry LM. Antiboides and anti-antibodies in human malignancy: an expression of deranged immune regulation. Ann NY Acad Sci 1976;276:316. Whitehouse JMA, Holborow EJ. Smooth muscle antibody in maUgnant disease. Br Med J 1971 ;27: 511. Mittra I, PerUn J, Kumakoa S. Thyroid ant other autoantiboides in British and Japanese women: an epidemiological study of breast cancer. Br Med J 1976;31:257. Youinou P, Zabbe C, Eveilland C, et al. Antiperinuclear activity in lung carcinoma patients. Cancer Immunol 1984;18:80. Roubinian JR, Talal N. Neoplasia, autoimmunity and the immune response. Adv Int Med 1978;23:435450. Theofilopoulos AN. Immune complexes in cancer. N Engl J Med 1982;307:1208-1209. Talal N, Bunin JJ. Development of malignant lymphoma in the course of Sjogren's syndrome. Am J Med 1969;36:529-540. Ghorssein NA, Boworth JL. Immunocompetence in radiation therapy patients. In Waters H ed. The
59.
60.
61.
62.
63. 64.
65.
66.
67.
68.
69.
70.
71.
72.
Handbook of Cancer Immunology. New York: Gerland STPM Press, 1978:180-181. Shoenfeld Y, Segol G, Segol O, et al. Detection of antibodies to total histones and their subfractions in SLE patients and their asymptomatic relatives. Arthrit Rheum 1987;30:169-175. Shoenfeld Y, Ben-Yehuda O, Naparstek Y, et al. The detection of a common idiotype of anti-DNA antibodies in the sera of patients with monoclonal gammopathies. J Clin Immunol 1986;6:194204. Huminer D, Tomer Y, Pitlick S, Shoenfeld Y Autoantibodies in cancer patients: are the tumor related or age related? Autoimmunity 1990;5:232233. Swissa M, Amital-Teplizki H, Haim N, Cohen Y, Shoenfeld Y Autoantibodies in neoplasia. An unresolved enigma. Cancer 1990;65:2554-2558. Sela O, Shoenfeld Y Cancer in autoimmune diseases. Sem Arthrit Rheum 1988;18:77-87. Isomaki HA, Hakulinen T, Joutsenlahti U. Excess risk of lymphomas, leukemia and myeloma in patients with rheumatoid arthritis. J Chron Dis 1978;31:691-696. Prior P, Symmons DPM, Hawkins CF, et al. Cancer Morbidity in rheumatoid arthirtis. Ann Rheum Dis 1984;43:128-131. Symmons DPM, Ahern M, Bacon PA, et al. Lymphoproliferative malignancy in rhumatoid arthritis: a study of 20 cases. Ann Rheum Dis 1984;43:132135. Banks PM, Witrak GA, Conn DL. Lymphoid neoplasia following connective tissue disease. Mayo Clin Proc 1979;54:104-108. Kelly C, Baird G, Foster H, Hosker H, Griffiths I. Prognostic significance of paraproteinemia in rheumatoid arthritis. Ann Rheum Dis 1991;50:290294. Ellman MH, Hurwitz H, Thomas C, Kozloff M. Lymphoma developing in a patient with rheumatoid arthritis taking low dose weekly methotrexate. J Rheumatol 1991;18:1741-1743. Zijlmans JM, van Rijthoven AW, Kluin PM, Jiwa NM, Dijkmans BA, Kluin-Nelemans JC. Epstein Barr associated lymphoma in a patient with rhumatoid arthritis treated with cyclosporin. N Engl J Med 1992;326:1363. Matteson EL, Hickey AR, Maguire L, Tilson HH, Urowitz MB. Occurence of neoplasia in patients with rheumatoid arthritis enrolled in a DMARD registry. J Rheumatol 1991;18:809-814. Kinlen LJ. Incidence of cancer in rheumatoid arthritis and other disorders after immunosuppressive treatment. Am J Med 1985;78:44^9.
73.
74.
75.
76.
77.
78.
79.
80.
81.
82.
83.
84.
85.
86.
87.
Sulkes A, Naparstek Y. The infrequent association of systemic lupus erhthematosus and solid tumors. Cancer 1991;68:1389-1393. Houssiau FA, Kirkove C, Asherson RA, Hughes GR, Timothy AR. Malignant lymphoma in systemic rheumatic diseases. A report of five cases. Clin Exp Rheumatol 1991;9:515-518. Canoso JJ, Cohen AS. Malignancy in a series of 70 patients with systemic lupus erhthematosus. Arthrit Rheum 1974;17:383-390. Black RA, Zilko PJ, Dawkins PI, et al. Cancer in connective tissue disease. Arthrit Rheum 1982;25:1130-1133. Mellous RC. Autoimmune and immunoproliferative disease of NZBAV mice and hybrids. Int Rev Exp Pathol 1966;5:217-219. Berliner J, Shoenfeld Y, Sidi Y, et al. Systemic lupus erythematosus and lymphoma. Scand J Rheumatol 1983;12:310-314. Kaji T, Inose K, Tsuchida A, Andoh K, Ohkubo Y, Ono K, Murakami H, Yano S, Omine M, Naruse T, et al. T-zone lymphoma in association with systemic lupus erythematosus. J Med 1991;22:225-241. Tsusumi Y, Deng YL, Uchiyama M, Kawano K, Ikeda Y. OPD4-positive T-cell lymphoma of the liver in systemic lupus erythematosus. Acta Pathol Jpn 1991;41:829-833. Green JA, Dawson AA, Walker W. Systemic lupus erythematosus and lymphoma. Lancet 1978;2:753755. Bunim Jj, Talal N. Development of malignant lymphoma in the course of Sjogren's syndrome. Trans Assoc Am Physicians 1963;76:45^6. Kassan SS, Thomas TL, Moutsopoulus HM, et al. Increased risk of lymphoma in Sicca Syndrome. Ann Int Med 1978;89:888-892. Kelly CA, Foster H, Pal B, Gardiner P, Malcolm AJ, Charles P, Blair GS, Howe J, Dick WC, Griffiths ID. Primary Sjogren's syndrome in north east England— a longitudinal study. Br J Rheumatol 1991;30:437442. Takagi N, Nakamura S, Yamamoto K, Kunishma K, Takagi I, Suyama M, Shinoda M, Sugiura T, Oyama A, Suzuki H, et al. Malignant lymphoma of mucosa-associated lymphoid tissue arising in the thymus of a patient with Sjogren's syndrome. A morphologic, phenotypic, and genotypic study. Cancer 1992;69:1347-1355. Ngan BY, Warnke RA, Wilson M, Takagi K, Cleary ML, Dorfman RF. Monocytoid B-cell lymphoma: a study of 36 cases. Hum Pathol 1991;22:409421. Chevalier X, Gaulard P, Voisin MC, Martigny J, Farcet JP, Larget-Piet B. Peripheral T cell lymphoma
88.
89.
90. 91. 92.
93.
94.
95.
96.
97.
98.
99.
100.
101.
102.
103.
with Sjogren's syndrome: a report with immunologic and genotypic studies. J Rheumatol 1991;18:17441746. Fox RI, Luppi M, Kang HI, Pisa P. Reactivation of Epstein-Barr virus in Sjogren's syndrome. Springer Semin Immunopathol 1991;13:217-231. Pisa EK, Pisa P, Kang HI, Fox RI. High frequency of t(14:18) translocation in salivary gland lymphomas from Sjogren's syndrome patients. J Exp Med 1991;174:1245-1250. 90.Williams RC. Deramtomyositis and malignancy—a review of the literature. Ann Int Med 1959;50:1174-1181. Barnes BE. Deramtomyositis and malignancy—a review of the literature. Ann Int Med 1976;84:68-76. Callen JP. Dermatomyositis and malignancy. Clin Rheum Dis 1982;8:369-387. Schwarzer AC, Schrieber L. Rheumatic manifestations of neoplasia. Curr Opin Rheumatol 1991;3:145-154. Christianson HB, Brunspry LA, Perry HO. Drmatomyositis: unusual features, complications and treatment. Arch Dermatol 1956;74:581-589. Manchul LA, Jin A, Pritchard KI, et al. The frequency of malignant neoplasms in patients with polymyositis-dermatomyositis. A controlled study. Arch Int Med 1985;145:1835-1839. Bohan A, Peter JB. Polymyostis and dermatomyositis. N Engl J Med 1975;292:344-347, 403407. Sattar MA, Guindi RT, Khan RA, Tungekar MR Polymyositis and hepatocellular carcinoma. Clin Rheumatol 1988;7:538-542. Rivers JK, Shaw HM, Milton GW, McCarthy WH. Polymyositis in association with melanoma. Arch Dermatol 1990;126:686-687. Landa NG, Zelickson BD, Kurtin PJ, Winkelmann RK. Primary B-cell lymphoma with histologic features of a T-cell neoplasm. J Am Acad Dermatol 1992;26:288-292. Schulman P, Kerr LD, Spiera H. A reexamination of the relationship between myositis and malignancy. J Rheumatol 1991;18:1689-1692. Zatuchini J, Campbell WN, Zarafonetis CJD. Pulmonary fibrosis and terminal bronchiolar ("alveolar cell") carcinoma in scleroderma. Cancer 1953;6:1147-1158. Jones AW. Alveolar cell carcinoma occuring in ideopathic interstitial pulmonsry fibrosis. Br J Dis Chest 1970;64:78-84. Fraire AE, Greenberg SD. Carcinoma and diffuse interstitial fibrosis of lung. Cancer 1973;31:10781086. Duncan SC, Winkelman RR. Cancer and scleroderma. Arch Dermatol 1979;115:950-955.
149
104.
105. 106.
107.
108. 109.
110.
111.
150
Peter-Golden M, Wise RA, Hochberg M, et al. Incidence of lung cancer in systemic sclerosis. J Rheumatol 1985;12:1136-1139. Roumm AD, Medsger TA. Cancer and systemic sclerosis. Arthrit Rheum 1985;28:1336-1340. Talbott JH, Barrocas M. Carcinoma of the lung in progressive systemic sclerosis: a tabular review of the literature and a detailed report of the roentgenographic changes in two cases. Semin Arthrit Rheum 1980;9:191-216. Black RA, Zilko PJ, Dawkins PL, et al. Cancer in connective tissue disease. Arthrit Rheum 1982;25:1130-1133. Hamburger JL, Miller JM, Kini SR. Lymphoma of the thyroid. Ann Int Med 1983;99:685-693. Devine RM, Edis AJ, Banks PM. Primary lymphoma of the thyroid: a review of the Mayo Clinic experience through 1978. World J Surg 1981;5:3338. Aozasa K, Tajima K, Tominaga N, Katagiri S, Yonezawa T, Matsuzuka F, Kuma K, Sawada M. Immunologic and immunohistochemical studies on chronic lymphocytic thyroiditis with or without thyroid lymphoma. Oncology 1991;48:657L Holm LE, Blomgren H, Lowhagen T. Cancer risks
112.
113.
114.
115.
116.
117.
118.
in patients with chronic lymphocytic thyrodiditis. N Engl J Med 1985;312:601-604. Moskowitz C, Dutcher JP, Wiernik PH. Association of thyroid disease with acute leukemia. Am J Hematol 1992;39:102-107. Shoenfeld Y, Schwartz RS. Immunologic and genetic factors in autoimmune diseases. N Engl J Med 1984;311:1019-1023. Seggev JS, Ben-Yosef N, Meytes D. Is selective IgA deficiency associated with morbidity? review and reevaluation. Isr J Med Sci 1988;24:65-69. Tomer Y, Shoenfeld Y. The significance of T suppressor cells in the development of autoimmuntiy. J Autoimmunity 1989;2:739-758. Primi D, Hammarstrom L, Smith CIE. Genetic control of lymphocyte defect I. Lack of suppression in aged NZB mice is due to a B cell defect. J Immunol 1978;121:2241-2243. Klinnan DM, Mushinsky JF, Steinberg AD. Oncogene expression in systemic lupus erythematosus (abstr). Clin Res 1985;33:558A. Boumpas DT, Tsokus GC, Mann DL, et al. Increased proto-oncogene expression in peripheral blood lymphocytes from patients with systemic lupus erythematosus and other autoimmune disease. Arthrit Rheum 1986;29:755-760.
© 2000 Elsevier Science B. V. All rights reserved. Cancer and Autoimmunity Y. Shoenfeld and M. E. Gershwin, editors
Antinuclear Antibodies as Potential Markers of Lung Cancer F. Fernandez-Madrid and J. Tomkiel Wayne State University, Detroit, USA
1. NUCLEAR REACTIVITY IN CANCER SERA Patients with cancer frequently develop antinuclear autoantibodies [1-22] however, the mechanisms by which autoimmunity develops and the significance of these antibodies in these patients is uncertain [23]. Are these autoantibodies immunologic footprints of previous biological events, as has been suggested for the antinuclear antibodies found in the systemic autoimmune diseases [24-26], or are they largely irrelevant to the process of oncogenesis? The evidence reviewed here, both our own observations on lung cancer and recent findings of others studying a variety of cancers, weighs heavily on the side of the former. Our work and that of others suggest that the humoral immune response directed against tumor cell nuclear antigens appears to be characteristic of many cancers, and this response includes the recognition of tumor-associated, and perhaps in some cases tumor-specific antigens, that may play a causative role in the process of tumorigenesis. Based on this hypothesis, we have developed a new approach to identify lung tumor nuclear antigens that may be relevant to the oncogenic process. We will discuss what our experiments have revealed thus far, and how these new observations might allow us to ask both clinically and biologically relevant questions about the association between autoimmunity and cancer.
2. NUCLEAR ANTIGENS AS CANDIDATES FOR ONCOGENIC PROTEINS In a growing number of reports, antibodies present in the sera of cancer patients have provided useful mole-
cular tools for the identification of the corresponding antigens [27-32]. These autoantigens are often either mutated or overexpressed in tumors [32], which strongly supports the idea that the immune response is indeed targeted against the tumor. Many of these autoantigens appear to be specific to an individual patient [33]. However, we hypothesize that the proteins involved in tumorigenesis might comprise a class of autoantigens that would be more generally recognized by groups of patients. This hypothesis is based on the following reasoning. There is no rationale to suggest that the immune system should treat oncogenic proteins differently than any other cellular antigen. That is, abnormalities in important cell-cycle regulators that lead to unregulated cell growth and division may be as likely as any other tumor antigen to be recognized by the immune system. Thus, we postulate that a subset of autoantigens in cancer is likely to be made up of molecules known to play important roles in cell proliferation. This is supported by reports of antigens recognized by cytotoxic T lymphocytes that are important regulatory molecules with potential roles in oncogenesis. In one case, a mutated version of the cell-cycle regulator CDK4 was identified as an autoantigen in a patient with melanoma [34]. The particular mutant abolishes the interaction with the negative regulator pi6, and thus clearly has potential to play a causative role in cancer. A mutated form of )S-catenin, an extracellular matrix protein that participates in cell adhesion and growth, has also been identified as a T-cell autoantigen in association with melanoma [35] . Finally, an antigenic mutation in caspase-8, which may have a role in mediating apoptosis, has also been reported [36]. There is also evidence for a humoral response directed against potentially oncogenic tumor antigens.
151
Mutations in the tumor suppressor p53 have been found in tumor tissue but not in normal tissue from a patient who had anti-p53 antibodies [37]. Expression of p53 has also been reported to be elevated in tumor cells in cancer patients with anti-p53 antibodies [38]. Cloning of autoantigens by screening autologous tumor cDNA libraries using patient sera has also identified two potentially oncogenic antigens, p53 isolated from a case of colon cancer and NY-LU-12 in lung cancer [39, 40] . In addition, we have recently cloned the 32 kDa subunit of replication protein A (RPA) [41] using autoantibodies from a breast cancer patient. By screening with recombinant antigen, we have found autoantibodies to this important replication and repair protein in 8% of cancer patient sera [42]. This antigen has been previously reported in the sera from patients with Sjogrens syndrome and systemic lupus erythematosus [43], but has not so far been described in cancer. We are presently asking whether this frequent autoimmune response to RPA is related to mutation in the gene or to abnormalities in expression or localization of the protein. A second reason to suggest that oncogenic proteins may constitute a commonly recognized set of nuclear autoantigens is that our current knowledge on tumor suppressors and oncogenes suggests that there are a finite number of pathways to cause cancer. That is to say, all tumors are expected to have an abnormality in at least one of a limited subset of proteins that regulate the cell cycle, DNA repair and/or apoptosis. These proteins are likely candidates to be involved in the process of carcinogenesis. The majority of proteins in this subset defined to-date are nuclear during at least part of the cell cycle (e.g., transcription factors p53, Rb, cyclins, CDKs, DNA repair enzymes and caspases). Thus, it might be expected that some members of this subset will be found as nuclear autoantigens in multiple cancer patients. It is also possible that the particular oncogenic proteins that appear as autoantigens may be specific to cancer type, and/or to the nature of the mutagen. As tumor characteristics are in part defined by the underlying molecular changes that allow escape from normal growth regulation, we suggest that the presence or absence of autoantibodies to these particular nuclear proteins may also be useful predictors of prognosis and indicators of therapeutic outcomes.
152
3. LUNG CANCER AS A MODEL SYSTEM We have chosen lung cancer as a model in which to investigate the association of antinuclear antibodies and oncogenesis for a number of reasons. First, lung cancer is the most frequently diagnosed cancer in the world, and is the most common cause of cancer deaths in men and women in the US and worldwide, representing 28% of all cancer deaths in the US [44]. The majority of people with lung cancer will die within 1 year of its detection. This high mortality rate can in part be attributed to lack of diagnostic methods that allow early detection. New molecular markers, such as autoantibodies to a defined set of antigens, that lead to an earlier diagnosis and treatment are likely to improve survival. Second, one of the mutagens in cigarette smoke has been identified as the prime etiologic factor responsible for the disease. There is good evidence that exposure to a particular mutagen gives rise to molecular lesions characteristic of that mutagen. Tobacco-specific A^-nitrosamines are known to produce methyl-DNA adducts [45], and tobacco-specific pulmonary carcinogens such as 4(methylnitrosamino)-l-(3-pyridyl)-l-butanone are believed to be involved in the induction of lung cancer in smokers [46]. By examining a group of patients exposed to a common class of mutagens, the likelihood of recognizing a recurrent molecular event that may be implicated in oncogenesis may be increased. It is our hypothesis that this commonality may in turn be reflected in the repertoire of antinuclear antibodies in these patients. This is supported by the recent finding that the development of antibodies to p53 in lung cancer patients appears to be dependent on the type of p53 mutation [37]. Third, four types of tumors account for 95% of all lung malignancies: small cell, squamous cell, adenocarcinoma and large cell carcinoma. Primary carcinoma of the lung is classified according to tumor cell appearance by light microscopy, although it is now apparent that up to 25% of tumors have mixed cytology and only about one-third of cases are homogeneous [47]. Since treatment varies depending on the cell type, an accurate classification is essential. The lung cancer model allows us to ask if antinuclear antibodies are characteristic to each cell type, and if they might provide a means of more accurate classification.
Fourth, several studies report an increased risk of second cancers in patients with cured neoplasia [48, 49]. For example, patients who have survived the treatment of head and neck cancer are highly susceptible to lung cancer. It is estimated that cancer of the lung develops in one-third of these patients with a second cancer. Thus, associations between antinuclear antibodies and lung cancer might be particularly useful in predicting the development of second tumors in this group of patients. Finally, the association of autoantibodies with paraneoplastic syndromes offers compelling evidence of a tumor-specific humoral response in lung cancer. A recent study found a striking correlation between the presence of "anti-Hu" autoantibodies (also known as type 1 antinuclear antibody, ANNA-1) and small cell lung carcinoma (SCLC) [50]. Out of 162 patients identified as seropositive for ANNA-1, 142 (88%) had or developed cancer by the end of the follow-up period, and small cell lung carcinoma was found in 132 (81%) of these patients. Moreover, the presence of anti-Hu antibodies at diagnosis of SCLC has been reported to be a strong and independent predictor of complete response to treatment [51].
4. A NEW APPROACH TO IDENTIFYING INFORMATIVE AUTOANTIBODIES ASSOCIATED WITH LUNG CANCER Recently, construction of tumor cell cDNA libraries and screening using autologous host sera (SEREX) has revealed that a B-cell response to tumor antigens is more prevalent than previously observed [28-32]. The success of this methodology is likely attributable to enriching for cDNA expressed by the autologous tumor. This enrichment no doubt facilitates the identification and cloning of antigens corresponding to autoantibodies in the autologous sera, which may be relatively rare or nonexistent in expression libraries made from cancer cell lines or other nonautologous cells. This established method may also preferentially identify autoantigens that are overexpressed, rather than mutated, in tumor cells. Indeed, while SEREX has identified some mutational antigens, the majority of SEREX antigens appear to be overexpressed, but otherwise normal antigens [32]. In addition, SEREX methodology alone does not select for antigens that are oncogenic.
We have devised an alternative strategy to identify autoantigens associated with lung cancer, with the goal of first focusing our attention on those that have the most potential to be informative. Our method first aims to identify the antinuclear autoantibodies that show significant association with diagnosis, cancer cell type, or patient outcome. Once identified, nuclear antigens can be cloned from either a HeLa cDNA library, the most appropriate lung cell library, or in combination with the SEREX approach, from a library constructed from autologous tumor cDNA. We have chosen to screen populations of patient sera for reactivity on immunoblots of nuclear proteins derived from all four types of lung cell cancers, as well as from normal lung cell and HeLa cells. This maximizes the probability of detecting antigens associated with a given type of cancer, while minimizing detection of antigens that are specific to one individual's tumor. All reactivities are catalogued by estimated molecular mass and antigen type, and subsequently analyzed by classification and regression tree analysis (CART) [52, 53]. Unique reactivities are defined as antibody reactivities associated with only one antigen type. Associations are then sought between individual or groups of unique reactivities and the presence or absence of cancer, cancer cell type, and prognosis. In a pilot study, the sera of 64 lung cancer patients and 64 subjects without a history of cancer were retrospectively tested for reactivity on immunoblots of nuclear extracts of HeLa, small cell carcinoma, squamous cell carcinoma, adenocarcinoma, large cell carcinoma of the lung and normal lung cells [54]. Demographics as well as clinical characteristics of these groups have been reported [55]. All IgG and IgM reactivities detectable on immunoblots at a 1:500 dilution of the sera were recorded and antigen molecular masses were calculated by comparison to molecular weight standards. We found that a sizable proportion of lung cancer sera show unique nuclear reactivity under similar conditions (see Fig. 1). Even with this relatively small data set, we were able to identify antinuclear antibodies that had significant predictive ability for all three parameters. Statistical analyses using cross-validated CART suggested that immunoblots using a battery of nuclear antigen sets may reveal some degree of tumor specificity and that groups of nuclear antigens recognized by autoantibodies have the potential to discriminate among dif-
153
Innnllnnnnn nfln n 120 140 160 180
Antigen Molecular Mass (kDa)
Figure 1. Frequency of patients with autoantibodies to nuclear antigens.
ferent lung cancer cell types. A cross-validated CART analysis utilizing all six sets of antigens selected nine antigens as the most useful predictors. By considering reactivity to these antigens, we achieved a 50% overall correctly predicted cancer cell type (Table 1). The presence of three of the antigens (HeLa cell antigens of 65 kDa and 110 kDa, and a large cell antigen of 160 kDa) was associated with small cell carcinoma, one with squamous cell carcinoma (squamous 85 kDa), three with adenocarcinoma (adenocarcinoma 180 kDa, normal lung 55 kDa, and squamous cell 30 kDa), and two with large cell carcinoma (HeLa 90 kDa and small cell 70 kDa). Nuclear antigen reactivity was also found to be a potential predictor of lung cancer diagnosis. Using selected antigen variables from all six nuclear antigen sets, the cross-validated CART correctly predicted diagnosis of lung cancer for 73% of the patients, with a sensitivity of 55% and a specificity of 92%. Similarly, certain autoantibodies were found to be associated
154
with progression-free survival. Four of the antigens were associated with a longer survival, four were associated with an intermediate length of survival and one was associated with a shorter survival without progression (Table 1). This work suggests that the limitations to detecting tumor-specific antinuclear antibodies can in part be circumvented by testing patient sera against immunoblots of nuclear proteins derived from multiple cell types, including antigens derived from the same cell type as the patient tumor. It has been our experience that antinuclear antibodies can be detected in virtually all lung cancer patient sera using this method. Indeed, we may miss some nuclear reactivities only detectable using autologous tumor antigens. However, our approach is adequate to identify a number of potentially useful antigen markers of lung cancer, without resorting to constructing cDNA libraries from each patient's autologous tumors. We are presently cloning the antigens with the greatest predictive value from our pilot experiment. Cloning of one adenocarcinoma antigen has identified a novel protein, conserved from bacteria to man, but curiously absent from the budding yeast S. cerevisiae. To our knowledge, this is the first protein discovered with this unusual pattern of evolutionary conservation. We are presently testing how frequendy this protein is recognized as an autoantigen by a wider range of cancer patients. In summary, these initial studies show that autoimmunity is often a prominent feature of lung cancer and suggest that molecular characterization of nuclear autoantigens may lead to the discovery of proteins with diagnostic and prognostic value. We also suggest the possibility that the finding of certain antinuclear antibodies uniquely associated with certain types of cancer may provide clues on the critical genetic events essential for malignant transformation.
5. THE AUTOIMMUNE RESPONSE IN LUNG CANCER IS SIMILAR TO THAT IN THE SYSTEMIC AUTOIMMUNE DISEASES A parallel can be drawn between the systemic autoimmune diseases and cancer in relation to the antinuclear antibodies observed in both conditions. In both, cellular proteins become antigenic targets of a humoral response. By far the most common autoantibodies
Table 1. Predicting ability of antinuclear antibodies. (The ability of antinuclear antibodies to predict lung cancer cell type, diagnosis, or progression-free survival were analyzed by cross-validated CART) Correctly predicted
Sensitivity
Specificity
Predictive antigens
(%)
(%)
(%)
Cell type: hg90, smVO, hgl 10, lgl60, hg65, qg85, agl80, ng55, sg30
50
n/a
n/a
Lung cancer diagnosis: nm60, ami 15, nm200, hm55, lgl60, ag75, smlOO, agl80, ng55, qml05, qg200, hglSO
73
55
92
Progression-free survival: agl50(<4 months), am45, IglSO, hg65, or amVO (4-9 months), lml60, ng30, qgl60, or sm220 (>9 months)
52
n/a
n/a
Antigen variables selected by cross-validated CART analyses are presented and labeled with the first letter designating the antigen set (h, s, q, a, 1, n, for HeLa, small cell carcinoma, squamous cell carcinoma, adenocarcinoma, large cell carcinoma and normal lung cell, respectively); the second letter (g or m) designates the recognizing isotype IgG or IgM, and the following number designates the antigen size in kDa.
found in the systemic autoimmune diseases are those directed against nuclear antigens [8, 23-26, 56]. Attempts to show nuclear reactivity in patients with cancer using characterized antigens known to be involved in the immune response in the systemic autoimmune diseases have been unrewarding [14, 57]. The failure of cancer sera to recognize those antigens may merely reflect the presence of different specificities related to the cancer itself. A characteristic profile of autoantibodies is found in each of the systemic autoimmune diseases. These autoantibodies are helpful in establishing a correct diagnosis and prognosis and frequendy facilitate the follow-up and treatment of these patients. The value of these antibodies in the diagnosis of the systemic autoimmune diseases is related to their immunologic specificity. Similarly, our data suggest that some of the antinuclear antibodies found in lung cancer sera may be relatively tumor specific and can be predictive of outcome [54]. Autoantibodies frequently precede the onset of a systemic autoimmune disease such as SLE by many years [56]. The report of Frenkel et al. [58] of high titer antinuclear antibodies years before the diagnosis of cancer and the frequent finding of high titer IgG antinuclear antibodies at the time of diagnosis in patients with neoplasia in our work, suggests that an established immune response to some nuclear antigens can be demonstrated in cancer sera before the tumor is clinically evident. An important feature of autoantibodies in systemic autoimmune diseases is their occurrence as linked sets. Antibodies to native DNA are frequently asso-
ciated with antibodies to histones, antibodies to Sm are frequently associated with antibodies to nuclear RNP (Ul-RNP) and antibodies to La/SS-B are often associated with antibodies to Ro/SS-A [24-26]. Autoantibodies in the systemic autoimmune disease are directed at antigens that are complexed to each other. For example DNA and histones occur together as nucleosomes, Sm and UlRNP are found together as nuclear particles called small nuclear ribonucleoproteins (smRNPs), and La/SS-B and Ro/SS-A are complexed as intracellular particles. There are also indications for the development of linked antibody response in cancer. In melanoma, multiple components of the melanosome, a cellular organelle found in melanocytes, have been reported to be recognized by autoantibodies [59]. Also, we have recently identified autoantibodies to the 32- and 14kDa subunits of replication protein A (RPA) in the sera of patients with lung, breast and prostate cancer [42]. These subunits of RPA are known to be a part of a multicomponent enzyme complex [41, 6062] involved in the metaboUsm of DNA [60, 63-68]. Thus, our data suggest that autoantibodies developing in cancer patients, similar to those of the systemic autoimmune diseases, may be recognized multiple epitopes of immunogenic subcellular particles. This possibility deserves further investigation. The wide occurrence of autoantibodies found by our work in cancer patients is similar to that in systemic autoimmune diseases and one could entertain the working hypothesis of a common immunopathogenesis. In this light cancer could be hypothesized to
155
be a family of systemic autoimmune diseases in which alteration of cellular oncogenes and tumor suppressor genes have led to deregulation of cell growth. As is true of the systemic autoimmune diseases, this model would imply that autoantibodies may appear in these subjects long before the clinical symptoms of cancer develop and that some of them could be laboratory indicators of therapeutic success or failure. This hypothesis can be tested by developing specific ELISAs using recombinant proteins as substrate and showing the tumor specificity and predictive ability of these autoantibodies. Experiments monitoring the development of the immune response in a well defined animal model of cancer could be revealing. Whether the repertoire of autoantibodies produced would reflect the ontogeny of the disease is an open question.
12.
13. 14. 15.
16.
17.
REFERENCES 18. 1. 2. 3. 4. 5. 6.
7.
8.
9.
10.
11.
156
Howqua J, Mackay IR. LE cells in lymphoma. Blood 1963;22:191-198. Whitehouse JMA, Holborow EJ. Smooth muscle antibody in malignant disease. Br Med J 1971 ;4:511. Burnham TK. Antinuclear antibodies in patients with malignancies. Lancet 1972;2:436-437. Hamilton-Fairley G. Autoantibodies in malignant disease. Br J Haematol 1972;23(suppl):231. Ablin RJ. Malignancy associated with antinuclear antibodies. Lancet 1972;2:253-254. Steiner M, Klein E, Klein G. Antinuclear reactivity of sera in patients with leukemia and other neoplastic diseases. Clin Immunol Immunopathol 1975;4:374381. Hodson ME, Turner-Warwick M. Autoantibodies in patients with bronchial carcinoma. Thorax 1975;30: 367-370. Fernandez-Madrid F, Mattioli M. Antinuclear antibodies (ANA): immunological and clinical significance. Semin Arthrit Rheumatol 1976;6:83-124. LameUn JR, De-The G, Revillard JP, Gabbiani G. Autoantibodies, cold lymphocytotoxins, antiactin antibodies and antinuclear factors in nasopharyngeal carcinoma patients. lARC Sci Pub 1978;20: 523-536. Osman J, Regan RJ, Dathan JR. Bilateral renal carcinoma with metastases in the gall bladder and associated with a strongly positive ANA. Br J Urol 1978;50:121. Bentwich Z, Talpaz M, Schechter D. Antinuclear Antibodies, "ANA" in the sera of carcinoma patients: increased incidence with dissemination of the dis-
19. 20.
21.
22.
23.
24.
25.
26. 27.
ease. Proc Am Assoc Cancer Res/Am Soc CHn Oncol 1979;20:14. Marcus RM, Grayzel Al. A Lupus antibody syndrome associated with hypernephroma. Arthrit Rheumatol 1979;22:1396-1298. Salem NB. Lupus antibody syndrome with intestinal lymphoma. Arthrit Rheumatol 1980;23:613. McCarty GA. Autoimmunity and malignancy. Med Clin North Am 1985;69:599-615. Chen Y-M, Hu C-P, Chu MH, Tsai YT, Lee SD, Chang, C Nuclear antigens reacted with sera and ascitis of hepatocellular carcinoma patients. Hepatology 1988;8:547-552. Buddle-Steffen, C, Anderson, NE, Rosenblum, MK, Posner, JB. Expression of an antigen in small cell lung carcinoma lines detected by antibodies from patients with paraneoplastic dorsal root ganglionopathy. Cancer Res 1988;48:430-434. Freundlich B, Makover D, Maul GG. A novel antinuclear antibody associated with a lupus-like paraneoplastic syndrome. Ann IntMed 1988;109:295-297. Takimoto T, Ishikawa S, Masuda D, Tamaka D, Yoshizaki T, Umeda R. Antinuclear antibodies in the sera of patients with nasopharyngeal carcinoma. Am J Otolaryngol 1989;10:39-403. Imai H, Ochs RI, Kiyosawa K, Furuta S, Nakamura RM, Tan EM. Am J Pathol 1992;140:859-870. Smith P, Rice M, Ricci N, Toogood I, Robertson D. A case of Burkitt's lymphoma presenting with digital ischemia. Acta Paediatrica 1993;82:217-219. Imai H, Nakano Y, Kiyosawa K, Tan EM. Increasing titers and changing specificities of antinuclear antibodies in hepatocellular carcinoma. Cancer 1993; 71:267-235. Doutre MS, Beylot J, Beylot C, Abs L, Lacoste D. Systemic lupus erythematosus and Hodgkins' disease. Int J Dermatol 1994;33:436-437. Burek GL, Rose NR. Autoantibodies In: RB CoUins, HK Bhan, RT McCluskey, eds.. Diagnostic Immunopathology, 2nd edn., RB Clovin, AK Bhan, RT McCluskey, eds. New York: Raven Press, 1995;207230. Tan EM. Antinuclear antibodies. Diagnostic markers for autoimmune diseases and probes for cell biology. Adv Immunol 1989;44:93-151. Tan EM. Antibody markers in systemic autoimmunity. In: Brandt KD, ed.. Diagnostic Studies in Rheumatology. New Jersey: Ciba Geigy Summit, 1992. Reichlin M. Autoantibodies to the RNP particles. CHn Exp Immunol 1995; 99:7-9. Muro YC, Chan IE, Landberg G, Tan EM. A cellcycle nuclear autoantigen containing WD-40 motifs
28.
29.
30.
31.
32. 33. 34.
35.
36.
37.
38.
39.
40.
expressed mainly in S and G2 phase cells. Biochem Biophys Res Commun 1995;207:1029-1037. Sahin UO, Tureci H, Schmitt B, Cochlovius T, Johannes R, Schmitts F, Stenner G, Luo I, Schobert I and Pfreundschuh M, Human neoplasms elicit multiple specific immune responses in the autologous host. Proc Natl Acad Sci USA 1995;92:11810-11813. Tureci, Shain UO, Pfreundschuh M. Serological analysis of human tumor antigens: molecular definition and implications. Mol Med Today 1997;3:342349. Sahin UO, Tureci, Pfreundschuh M. 97. Serological analysis of human tumor antigens. Curr Opin Immunol 1997;9:709-716. Jager E, Chen Y-T, Drijfout JW, Karback J, Ringhoffer M, Jager D, Arand M, Wada H, Noguchi Y, Stockert E, et al. Simultaneous humoral and cellular immune response against cancer-tests antigen NY-ESO-1: definition of HLA-A2 binding peptide epitopes. J Exp Med 1998;187:265-270. Old, LJ, Chen, Y-T. New paths in human cancer serology. J Exp Med 1998;187:1163-1167. Boon T, Old LJ. Cancer tumor antigens. Curr OP Immunol 1997;5:681-683. Wolfel TM, Hauer et al. A pl6INK4a-insensitive CDK4 mutant targeted by cytolytic T lymphocytes in a human melanoma. Science 1995;269:1281-1284. Robbins PF, El-Gamil M, Li YF, Kawakami Y, Loftus D, Apelle E, Rosenberg SA. A mutated beta-catenin gene encodes a melanoma-specific antigen recognized by tumor infiltrating lymphocytes. J Exp Med 1996;183(3):1185-1192. Mandruzzato S, Brasseur F, Andry G, Boon T, van der Bruggen P. A CASP-8 mutation recognized by cytolytic T lymphocytes on a human head and neck carcinoma. J Exp Med 1997;186:785-793. Winter SF, Minna JD, Johnson BE, Takahashi T, Gazdar AF, Carbone DP. Development of antibodies to p53 in lung cancer patients appears to be dependent on the type of p53 mutation. Cancer Res 1992;52:41684174. Ralhan R, Nath N, Agarwal S, Mathur M, Wasylyk B, Shukla NK. Circulating p53 Antibodies as early markers of oral cancer: correlation with p53 alterations. Clinical Cancer Research 1998;4:2147-2152. Scanlan MJ, Chen Y-T, Williamson B, Cure AO, Stockert E, Gordan JD, Sahin U, Pfreundschuh M, Old LJ. Characterization of human colon cancer antigens recognized by autologous antibodies. Int J Cancer 1998;76:652-8. Cure AO, Altorki NK, Stockert E, Scanlan MJ, Old LJ, Chen Y-T. Human lung cancer antigens recognized by autologous antibodies: definition of a novel cDNA derived from the tumor supressor gene locus
41.
42.
43.
44.
45.
46.
47.
48.
49.
50.
51.
52.
53.
54.
on chromosome 3p21.3. Cancer Res 1998;58:10341041. Erdile LF, Wold MS, Kelly TJ. The primary structure of the 32-kDa subunit of replication protein A. J Biol Chem 1990;265:3177-3182. Fernandez-Madrid F, Granda JL, Gimothy P, VandeVord P, Kraut M, Yang X Tomkiel JE. Autoantibodies to subunits of replication protein A (RPA) in sera of patients with malignancies (abstract) Cancer Detection and Prevention 1998;22:5186. Garcia-Lozano R, Gonzalez-Escribano F, SanchezRoman J, Wichmann I, Nunez-Roldan A. Presence of antibodies to different subunits of replication protein A in autoimmune sera. Proc Natl Acad Sci USA 1995;92:5116-5120. Fry WA, Menck HR, Winchester DP The National Cancer Data Base report on lung cancer. Cancer 1996;77:1947-1955. Petruzzelli S, Travanti LM, Cell A, Guintini C. Detection of n-methyl-deoxyguanosine adducts in human pulmonary alveolar cells. Am J Resp Cell Mol Biol 1996;15:216-223. Hecht SS. Recent studies on mechanism of bioactivation and detoxification of 4-methylnitrosamine)-l-(3pyridyl) -1-butanone (NNK), a tobacco-specific lung carcinogen. Crit Rev Toxicol 1996;26:163-181. Rubin E Farber J. The Respiratory System. Pathology, 2nd edn. Philadelphia, PA: J.B. Lippincott, 1994;557617. Sturgis EM. Miller RH. Second primary malignancies in the head and neck cancer patient. Ann Otol Rhinol and Laryngol 1995;104:946-954. Brenner SE, Lippman SM, Hong WK. Retinoid chemoprevention of second primary tumors. Semin Hematol 1994;31(4)(supp 5):26-30. Luchinetti CF, Kimmel DW, Lennon VA. Paraneoplastic and oncologic profiles of patients seropositive for type 1 antineuronal nuclear autoantibodies. Neurology 1998;50(3):652-657. Graus F, Dalmau J, Rene R, Tora M, Malats N, Verschuuren JJ, Cardenal F, Vinolas N, Garcia del Muro J, Vadell C, Mason WP, Rosell R, Posner JB, Real EX. Anti-Hu antibodies in patients with small-cell lung cancer: association with complete response to therapy and improved survival. J Clin Oncol 1997;15(8):2866-2872. Brieman L, Friedman JH, Olshen RA, Stone CJ. Classification of Regression Trees. Belmont, CA: Wadsworth, 1984. Clark LA, Pregibon D. Tree-based models. In: Chambers JM, Haste TJ, eds.. Statistical Association. 1958;53:457-481. Fernandez-Madrid F, Granda JL, VandeVord PJ, Karvonen RL, Kraut MJ, Yang X, Tomkiel JE. Anti-
157
55.
56.
57.
58.
59. 60.
61.
62.
158
nuclear antibodies in lung cancer (abstract). Cancer Detection and Prevention 1998;22:S185. Fernandez-Madrid F, Karvonen RL, Kraut MJ, Czelusniak B, Ager J. Autoimmunity to collagen in human lung cancer. Cancer Res 1996;56:121126. Aho K, Koskola P, Makitalo R, Heliovaara M, Palosuo T. Antinuclear antibodies heralding the onset of Systemic Lupus Erythematosus. J Rheumatol 1992;19:1377-1379. Swissa M, Amital-TepHzki H., Haim N, Cohen Y, Shoenfeld Y. Autoantibodies in neoplasia. An unresolved enigma [see comments]. Cancer 1990;65:2554-2558. Frenkel K, Karkoszka J, Kato J, Powell J, Pero R. Systemic biomarkers of cancer risk. Cancer Detection and Prevention 1996;20:234. Houghton AN. Cancer antigens: Immune recognition of self and altered self. J Exp Med 180; 1:1-4. Wold MS. Kelly TJ. Purification and characterization of replication protein A, a cellular protein required for in vitro replication of Simian virus 40 DNA. Proc Natl Acad Sci USA. 1988;85:2523-2527. Erdile LF, Heyer WD, Kolodner R, Kelly, TJ. Characterization of a cDNA encoding the 70-kDa single stranded DNA-binding subunit of human replication protein A and the role of the protein in DNA replication. Biol Chem 1991;266:1290-1298. Umbricht CB, Erdile LF, Jabs EW, Kelly TJ. Cloning
63.
64.
65.
66.
67.
68.
overexpression and genomic mapping of the 14 kDa subunit of human replication protein A. J Biol Chem 1993;268:6131-6138. Tang CM, Tomkinson AE, Lane WS, Wold MS, Seto E. Replication protein A is a component of a complex that binds the human metallothionein II a gene transcription start site. J Biol Chem 1996;271:2163721644. Kin C, Paulus BE, Wold MS. Interactions of human replication protein A with oligonucleotides. Biochemistry. 1994;33:14197-14206. Li L, Lu X, Peterson CA, Legerski RJ. An interaction between the DNA repair factor XPA and replication protein A appears essential for nucleotide excision repair. Mol Cell Biol 1995;15:5396-53402. Lee SH, Kim DK, Drissi R. Human xeroderma pigmentosum group A protein interacts with human replication protein A and inhibits DNA replication. J Biol Chem 1995;270:21800-21805. Matsuda T, Saijo M, Kuraoka I, Kobuyashi T, Nakatsu Y, Nagai A, Enjoji T, Masutani C, Sugasawa K, Hanaoka F et al. DNA repair protein XPA binds replication protein (RPA). J Biol Chem 1995;27:41524157. Miller SD, Moses K, Jayaramin L, Prives C. Complex formation between p53 and replication protein A inhibits the sequence specific DNA binding of p53 and is regulated by single stranded DNA. Mol Cell Biol 1997;17:2194-2211.
© 2000 Elsevier Science B.V All rights reserved. Cancer and Autoimmunity Y. Shoenfeld and M. E. Gershwin, editors
Autoantibodies in Cancer Patients and in Persons with a Higher Risk of Cancer Development Karsten Conrad Technical University of Dresden, Germany
1. INTRODUCTION Autoimmunity (autoantibodies as well as autoreactive T cells) is often associated with tumor development. Burtin et al. [1] were the first to describe autoantibodies in cancer patients in 1965. In the same year, Wilkinson and Zeromski [2] detected autoantibodies (AAb) against neurons in sensory carcinomatous neuropathy. The continuous search for human cancerspecific antibodies started in the 1970s using a variety of serological test systems and antigen sources with the aim of detecting tumor-associated antigens (TAA). Shiku et al. [3], Pfreundschuh et al. [4] and Ueda et al. [5] estabUshed the strategy of "autologous typing" using autologous serum and tumor cell lines from cancer patients. Although only a few tumor-specific antigens could be detected by extensive absorption analyses and were further defined biochemically, this work provided strong evidence for the specificity of antibody responses in tumor patients [6]. A new phase in cancer serology was introduced in the 1990s by two developments. First, molecularly defined proteins (such as oncoproteins) or glycoproteins (such as the mucin MUC-1) were used in immunoassays to look for cancer-specific autoantibodies [7, 8]. Second, a new technique introduced by Sahin et al. [9, 11] and Tiireci et al. [10] led the autologous typing to a new level of specificity analysis and comprehensiveness. A large number (>400) of tumor antigens, approximately one third of these are novel, have hitherto been identified with autoantibodies of cancer patients by various groups using this new methodology called SEREX (serological analysis of recombinant cDNA
expression libraries of human tumors with autologous serum) [12]. Antibodies directed against self antigens (proteins, glycoproteins, lipoproteins, gangliosides, nucleoproteins, nucleic acids) can be classified into two main categories: natural occurring and nonnatural (pathologic) AAb. Some characteristic differences between these two are: (1) mechanisms of induction (germline-coded versus induced); (2) specificity (polyspecific/polyreactive versus monospecific); and (3) affinity (low versus high affinity). Both AAb groups are implicated in tumor immunology. Natural occurring autoantibodies (NOA) are germline-encoded polyreactive antibodies probably involved in the "first line defence", in the clearance of senescent products and in immune regulatory mechanisms. Among the first functions described for NOA was the reactivity with tumor cells [13]. This reactivity is most probably a manifestation of polyreactivity rather than an interaction between a tumor-specific antigen and a corresponding antibody [14]. Tumorreactive NOA may have different biological effects ranging from enhancement of, to surveillance of tumor development. Furthermore, the modulation of host responses by NOA may influence tumorigenesis [15]. The induction and presence of nonnatural autoantibodies in tumor patients is mostly associated with aberrant, de novo or overexpression of the autoantigenic targets in the tumor (Table 1). The detection of such AAb may be important to find new markers for the improvement of diagnosis and prognosis of tumors as well as for the development of new vaccine strategies for the treatment of tumor patients.
159
Table 1. Autoantigens that may elicit or augment immune responses in tumor patients Type of autoantigens
Expression and possible factors involved in the induction of autoantibodies
Examples of (tumorspecific) autoantibodies
Oncoproteins
Expressed as proto-oncogenes in normal tissues; (over)expression of mutated proteins in tumors
L-myc HER2/neu
Tumor suppressor proteins
Expressed in normal tissues; accumulation of (mutated)proteins in tumors
p53
Cell-cycle/mitosisassociated proteins
Overexpression in tumors?
CENP-F SG2NA
Differentiation antigens
Expressed lineage-specific in tumors and also in normal cells of the same origin
tyrosinase
Cancer/testis class of tumor antigens (CTA)
Expressed in a variable proportion of a wide range of cancers; the expression in normal tissues is restricted to the testis; the (neo/de novo) expression in tumors might result by gene activation or derepression [12]
NY-ESOl MAGE-1 MAGE-3 SSX
Onconeural antigens (ONA)
Normally restricted to the nervous system but aberrantly expressed in a number of tumors (by gene activation or derepression or post-transcriptional regulatory mechanisms?)
Hu, Ri, Yo Amphiphysin
voce
Expressed both in neoplastic and normal tissues, but elicit antibody responses only in cancer patients possibly by tumorassociated post-translational modifications and changes in the antigen processing and/or presentation in tumor cells
HOM-MEL-2.4
Cancer-independent autoantigens
Expressed in normal cells or tissues; specific targets of autoantibodies in autoimmune diseases; increased incidence of tumors in a variety of autoimmune diseases
Topoisomerase I ACA
Carbohydrate antigens (mucins, gangliosides)
Modified expression in tumors (underglycosylation, sialylation)
MUCl GM1,GM2, GD2
Cancer-related autoantigens
2. AUTOANTIBODIES AGAINST ONCOPROTEINS Proteins encoded by oncogenes and tumor suppressor genes are involved in the control of cell growth and differentiation and, if inappropriately expressed or mutated, in the genesis of tumors. Recently, AAb against oncoproteins and the tumor suppressor p53 have been reported in patients with malignant tumors. Such immune responses may be of special interest in the early diagnosis and therapy of cancer. There are a growing number of reports regarding p53 AAb, but only a few data about autoimmunity against oncogene products in tumor patients (summarized in Table 2) are available to date [7, 16-23]. AAb to the HER-
160
[11]
2/neu product, a 185-kDa transmembrane protein with extensive homology to the epidermal growth factor receptor have been found in 11-55% of breast cancer patients [7, 16]. The AAb response correlated with HER-2/neu protein overexpression in the patient's primary tumor, but could also be found in some women with HER-2/neu negative breast cancer, suggesting an active immunoselection for HER-2/neu negative variants [16]. This possibility is also underlined by the higher frequency and the higher titers of pjg5HER-2/neu p^J^^^ -j^ ^^^ ^^^^^ ^^^g^ of disease [16]. AAb against the p2F^^ protein, a member of the GTPase complex whose transforming activity evolves by point mutations, has been found in 32% of patients with colon cancer [17]. Although p21^^^ is activated
Table 2. Autoantibodies against proteins involved in the pathogenesis of maHgnant tumors Autoantibody against
Frequency in tumor patients
Remarks
plg^HER—2/neu
Breast cancer 11-55% [7]
Frequency in healthy volunteers 0-5% [16]
p2ira^
Colon cancer 32% [17]
Frequency in healthy volunteers 3% [17]
c-myc
Colorectal cancer 57% [18] Hematological maUgnancies 2.7-5.2% [20] AIDS related lymphoma 15.4% [20]
Different results in healthy volunteers (1.1-17%) and SLE patients (0.8-35%) [18-20]; significantly higher titers in African Burkitt lymphoma patients and Ghanian normals compared to American normals [20]
L-myc
Lung cancer 10% [21]
No association to histology or staging; not detected in normal volunteers [21]; detectable in pleural effusions [22]
c-myb
Breast cancer 43% [23] Colon cancer 40.5% [23] Ovary cancer 33.3% [23]
Not cancer-specific (24% in controls), but frequency significantly elevated in breast cancer patients compared to controls; not found in neuroblastoma patients [23]
by point mutations, most AAb detect epitopes near the carboxyl terminus of the wild-type protein [17]. In addition to these AAb directed against growth factor receptors (pi85™^"^/"^") or GTP binding proteins (p2r^^), AAb to another group of oncoproteins have been described in patients with solid tumors (colorectal, breast, ovary, lung cancer) and patients with leukemias/lymphomas. These AAb are directed against nuclear regulatory proteins such as myb and myc [18-23]. However, with the exception of AAb to the L-myc protein, these antibodies have been shown to be relatively unspecific for tumors in some studies (see Table 2). Furthermore, the frequencies of c-myc AAb in healthy volunteers and SLE patients varied greatly in the different studies [18-20]. In general, different methods of AAb determinations and differences in the populations studied may account for varying results. The source and purification of autoantigens and the assays used for AAb determination may influence results dramatically. For example, c-myc AAb were determined with ELISAs using 31mer c-myc peptides [19] or human prokaryotically expressed recombinant c-myc protein [20] or with immunoblotting using the recombinant protein [18]. Furthermore, variations in the definition of standards of detectability led to different frequencies as has been shown for pjg5HER-2/neu ^^13 -^^ ^^^^^^ cancer patients (1121%) and in healthy volunteers (0-1%) [16]. But also ethnic differences and different influences of endogeneous and exogenous factors in the populations studied may be relevant for the variation in results.
For example, the frequency of pi85™^"^/"^" AAb is highest in women with premenopausal breast cancer because there is also highest frequency of HER-2/neu protein overexpression [7]. In conclusion, there is a further need for studies of the clinical and biological nature concerning humoral autoimmune responses to oncoproteins such as: (a) the evaluation of diagnostic relevance (diagnostic sensitivity and specificity) and the prognostic significance (correlation with the stage of the disease and survival) in defined patient groups using optimized and standardized methods; (b) the search for associations of antibody titers with disease progression or relapse and therapeutic effects; (c) the search for possible mechanisms of AAb induction (correlation with protein overexpression, mutations or presence of oncoproteins in the circulation); and (d) the search for possible effects of AAb on tumor cells.
3. AUTOANTIBODIES AGAINST THE TUMOR SUPPRESSOR PROTEIN P53 As the "guardian of the genome", p53 is the main regulator preventing carcinogenic and teratogenic lesions [24, 25]. Therefore, it is not surprising that the loss of p53 function(s) is linked to the development of human cancer. Mutations of this tumor suppressor gene are the most frequently reported gene alteration in human cancers [26, 27]. In 1982, it was shown for the first time that p53 may become immunogenic in cancer pa-
161
Table 3. Autoantibody response against p53 in different groups of former uranium miners Group of uranium miners or control subjects
(n)
p53 antibody response (in%) B
A-C
Miners with lung cancer Serum analysis - before manifestation - at time of manifestation - after manifestation and therapy
(73)
6.8
4.1
1.4
12.3
(39) (18) (16)
10.3 0 6.3
2.6 5.5 0
5.1 0 0
18.0 5.5 6.3
Miners with probable lung cancer
(30)
6.7
3.3
3.3
13.3
Miners with SLE or scleroderma, but without tumor
(51)
11.8
2.0
0
13.8
(463)
4.1
1.3
1.3
7.8
1.7 2.7 0.8 0
1 1.8 0 0
0 0 0 0
4.5 0.8 0
Healthy miners Women with idiopathic SLE (<40 years old) Blood donors - men >50 years old - men 18-40 years old - women 18-62 years old
(37) (415) (225) (128) (62)
tients [28]. In the years that followed p53 AAb were detected in sera from a variety of cancer patients in frequencies between 3 and 65% depending on tumor type and method of antibody detection, whereas the prevalence of such AAb in normal populations was very low [29, 30]. In most studies of serum p53 AAb, patients with a relatively late stage of cancer were screened. Lubin et al. [31] were the first to describe that the humoral anti-p53 response may be an early event during tumorigenesis and can be detected before clinical manifestation of the disease. In two studies Trivers et al. [32, 33] showed that p53 AAb were present months to years before the manifestation of tumors: (1) angiosarcoma of the liver in workers occupationally exposed to vinyl chloride; and (2) lung cancer in heavy smokers with chronic obstructive pulmonary disease (Table 8). To further evaluate the predictive value of p53 AAb we analysed the AAb responses in a group with a high risk of developing lung cancer, former uranium miners occupationally exposed to alpha radiation of radon and radon daughter products [34]. Our objective was to determine the prevalence and time of appearance of these AAb during the pathogenesis of lung cancer. We determined p53 AAb by three different enzyme immunoassays using eukaryotically and prokaryotically expressed human p53 as
162
2.7
well as p53 of tumor cell preparations. Positive results were also tested by immunoblotting with recombinant p53. Sera of 73 uranium miners with lung cancer, 30 miners with radiographically suspected lung cancer, 51 miners with connective tissue diseases (CTD) and 463 healthy miners were studied. In 39 lung cancer patients, sera could be analyzed up to 7 years before clinical disease manifestation. We observed that the different ELISAs used (PharmaCell Paris, France; Dianova, Hamburg, Germany; ORGA-MED, Bad Heilbrunn, Germany) showed some different results that may in part be explained by the detection of p53 AAb which differ in their epitope recognition. Therefore, anti-p53 responses were grouped into three categories: (A) positive in only one ELISA; (B) positive in at least two different ELISA; and (C) strongly positive in at least two different ELISA as well as positive in immunoblot. The results are shown in Table 3. Assessing all categories (A-C) as true positive, the frequency of p53 AAb in lung cancer patients is similar to the frequency described in other studies. Nearly the same prevalence can be observed in miners with probable lung cancer and in miners with scleroderma and SLE suggesting a higher risk of developing cancer or of having "silent" cancer in these groups. Indeed, p53 AAb can be detected in 17- 47 months before clini-
Table 4. Autoantibodies to proliferation associated antigens in tumor patients Autoantibodies against Cyclins and CDKs -CyclinBl - Cyclin A - Cyclin-dependent kinase 2 (CDK2) SG2NA (S/G2 nuclear antigen)
Autoantigen expression and function
Relevance
Involved in cell cycle progression (Gl/S; G2/M); Increased expression in many cancers [39^2]
Hepatocellular carcinoma: anticyclin Bl in 15%, anticyclin A in 1%, anti-CDK2inl%[42]
Member of the TLE (tranducin-like enhancer of split) protein family, many of which take part in regulating nuclear functions associated with the cell cycle [45]
Found in a patient with bladder and metastatic lung cancer [44]
Centromere protein F (CENP-F) Cell cycle-regulated centromere protein that appears to play an (p330^, mitosin, MSA 3) important role in mitosis [46, 47].
Retrospective study of patients selected on the basis of a particular autoantibody specificity: association with cancer and other disorders involving increased cell proliferation [49]
DNA Topoisomerase II
Nuclear enzyme that catalyzes the interconversion of topological Found in hepatocellular carcinoma [55] forms of dsDNA (required for DNA replication, recombination and chromosome segregation); marker for proliferating cells [53]; target of antitumor drugs [54]; might be directly involved in oncogenesis [55]
NOR-90/hUBF (human upstream binding factor)
Nucleolus organizer region proteins (89 and 93 kDa) involved in RNA polymerase I transcription
Found in a patient with HCC [56]
Fibrillarin
Protein of the nucleolar U3-RNP involved in pre-ribosomal RNA processing
Found in a patient with HCC [56]
B23/nucleophosmin
Nucleolar protein involved in ribosome maturation and cell proliferation
Found in patients with HCC, lung cancer and dysgerminoma [56]
HCCl
64 kDa nuclear protein probably involved in splicing of pre-mRNA [57]
ANA specificity changed to HCCl in a patient with liver cirrhosis who progressed to HCC [57]
cal tumor manifestation or diagnostic detection. This has been shown in 7 of the 39 patients whose serum samples were available. In 4 patients only response A could be seen. In one patient response B and in two patients response C was detected 41,24 and 25 months before disease manifestation. Furthermore, we found a significantly higher frequency of p53 AAb in uranium miners compared with blood donors (p = 0.008). Taken together, there are important hints of a predictive value of p53 AAb regarding tumor development: (1) these relatively cancer-specific AAb are detectable months to years before disease manifestation [31-34]; (2) the frequency of p53 AAb is significantly higher in risk groups for lung cancer compared to healthy blood
donors as has been shown for uranium miners heavily exposed to alpha radiation [34]. The higher frequency in older male blood donors compared to younger men or women (Table 3) may also be explained in part by a higher prevalence of "silent" tumors (prostate, lung) in older men. Unfortunately, we had no information about the smoking habits of these blood donors; (3) in the risk group of uranium miners without detectable tumor at time of serum analysis, the highest frequency of p53 AAb could be found in patients with a further increase of risk: scleroderma patients and miners with large silicotic opacities [35, 36]; and (4) in the followup of the autoimmune response in two miners, signs of epitope spreading could be observed.
163
Therefore, p53 AAb should be determined in larger risk groups (e.g., smokers) for early diagnosis and therapy of cancer. On account of the low frequency, other possible autoimmune tumor markers, e.g., AAb against L-myc, pi85^^^"^/"^" or some of those described below, should be further evaluated.
4. Autoantibodies to proliferation associated antigens other than oncoproteins Proteins involved in cell-cycle regulation/progression and mitosis, but also other proteins involved in cellular processes that might be increased in unregulated cell growth, may drive autoimmune responses in tumor patients (Table 4). AAb against nuclear and cytoplasmic cell-cycle regulated or regulating proteins and proteins involved in splicing processes and ribosome biosynthesis could be detected in tumor patients. This supports previous observations that AAb responses against intracellular antigens are often directed at molecules involved in cellular biosynthetic or proliferative functions [37]. Cyclins and cyclin-dependent kinases (CDK) are a group of cell-cycle regulating proteins acting at different points of the cell-cycle progression. They are amplificated and overexpressed in many tumors [3841]. Covini et al. [42] showed that AAb to cyclin Bl, cyclin A and CDK2 are present in sera of patients with hepatocellular carcinomas (HCC) in 15, 1 and 1%, respectively. Furthermore, anticyclin Bl antibodies could be found in patients with a higher risk of HCC development, e.g., in patients with chronic hepatitis (in 1 out of 70 cases) and cirrhosis (in 3 out of 70 cases), suggesting a predictive relevance of these AAb. To date, there are no reports about aberrant expression of cyclin Bl in HCC tissue. If an antigen-driven process caused by cyclin B1 overexpression results in AAb production, cyclin B1 antibodies should be also found in other tumors, such as leukemias, breast and colorectal cancers [39-41]. Sera of cancer patients have been shown to be useful reagents for identifying new cellular proteins possibly involved in tumor development. A new cellcycle-specific DNA-binding nuclear protein has been identified using autoimmune serum of a patient with bladder and metastatic lung cancer [43, 44]. This serum produced a previously undescribed cell-cyclerelated staining pattern on HEp-2 cells. According
164
to the cell-cycle distribution the detected antigen was provisionally named SG2NA (S/G2 nuclear antigen). The structural analyses reveal that SG2NA belongs to the TLB (tranducin-like enhancer of split) protein family, many of which take part in regulating nuclear functions associated with the cell cycle [44]. The centromere protein F is another novel proliferation associated and cell-cycle-dependent protein detected by autoimmune sera. Casiano et al. identified a centromere protein provisionally designated p330^ (doublet polypeptide of 330 kDa), which accumulates in the nuclear matrix during S phase, reaching maximum levels during G2 phase and localized at the centromeres during prophase and metaphase and at the central spindle and midbody regions during anaphase and telophase [45]. The same protein, designated centromere protein F (CENP-F), was identified by Rattner et al. [46] using a serum from a lung cancer patient. Already in 1986, an AAb called MSA 3 with a staining pattern of p330^/CENP-F was described by Humbel [47]. A retrospective analysis of the clinical features of the 36 CENP-F autoantibody positive patients showed that 22 of these (=61%) had neoplasms of various types [48]. The predominant types were breast (9 cases) and lung cancer (5 cases). Other types of cancer included stomach (2 cases), tracheal, tonsilar, nasopharyngeal, ovarial, HCC, and Waldenstrom's macroglobulinemia (1 case each). The other diseases were also associated with abnormal cell proliferation: chronic inflammatory diseases of liver, intestinum, pancreas and joints (8 cases), chronic renal allograft rejection (2 cases), SLE (2 cases) and undifferentiated connective tissue disease (1 case). The findings of this retrospective study of patients selected on the basis of a particular AAb specificity point to the probability that anti-CENP-F autoimmunity could be related to increased or abnormal cell proliferation, but important conclusions regarding disease associations cannot be drawn. A screening of several hundred sera of unselected cancer patients by indirect immunofluorescence on HEp-2 cells showed that the prevalence of CENPF antibodies detectable with this method is very low (<0.1%) [49, 50]. By analyzing the sera of 1365 patients with various tumors we found one CENP-F antibody and two antibodies with a CENP-F like pattern in patients with breast cancer. Furthermore, other AAb to mitosis-associated or cell-cycle-dependent expressed antigens (e.g., staining of the midbody region, of the chromatin only in mitotic cells, NuMA-like
staining, variable staining in interphase nuclei) were seen in another 27 patients, but not in blood donors [50]. Of the 73 uranium miners with lung cancer one had NuMA/centrophilin antibodies. Overall, in our screening of sera of 1438 tumor patients by indirect immunofluorescence on HEp-2 cells we found middle to high titred AAb showing mitosis associated/cellcycle-dependent patterns in 31 patients with cancer (2.2%). This may be a further hint that autoimmunity to proteins related to increased or abnormal cell proliferation may be induced in cancer patients. Indeed, the results of Rattner et al. [48] and Landberg et al. [51] suggest that the CENP-F protein may drive the AAb response. DNA topoisomerase II, another protein which is selectively enriched in the centromere of metaphase chromosomes, has been shown to be a marker for proliferating cells and a target of antitumor drugs [52, 53] and might be directly involved in oncogenesis [54]. Autoantibodies have been described in patients with HCC [55]. The screening of sera from tumor patients by immunofluorescence on tumor cell monolayer led also to the identification of autoantigens not involved in cellcycle regulation or mitosis, but in splicing processes and ribosome biosynthesis [56-58]. Antinuclear antibodies (ANA) have been found in a higher frequency in HCC patients (31%) than in patients with chronic hepatitis or liver cirrhosis (13%) or in healthy subjects (5%) [56]. Most prevalent in HCC are AAb showing nucleolar or speckled pattern. Three of the autoantigens detected by antinucleolar antibodies have been identified as NOR-90/hUBF (human upstream binding factor), the U3-RNP associated fibrillarin and protein B23 (nucleophosmin), proteins engaged in some aspect of ribosome biosynthesis, a process that might be increased in unregulated cell growth [56]. A novel nuclear autoantigen with splicing factor motifs, provisionally designated HCCl, was identified with an AAb developed in a patient with liver cirrhosis who progressed to HCC [57]. Covini et al. [59] found 3 AAb in 204 HCC patients and 2 AAb in 194 chronic virus hepatitis patients that co-localized with non-snRNP splicing factor SC35, but showed different responses to MOLT-4 proteins in immunoblot. This leads to the suggestion that different proteins probably involved in mRNA splicing might be antigenic targets in HCC and patients with a higher risk of HCC development.
5. AUTOANTIBODIES TO THE CANCER/TESTIS CLASS OF TUMOR ANTIGENS Cancer/testis antigens (CTA) are expressed in a variable proportion of a wide range of human tumors, but are silent in most normal tissues except the testis. Seven CTAs or CTA families have been described up to now (Table 5). They were initially identified as targets for cytotoxic T cells (MAGE, GAGE, BAGE) and, later on, uncovered by SEREX analysis (reviewed in [11,12]). CTAs identified by SEREX elicited an AAb response in tumor patients. Therefore, this methodology leads not only to the detection of new tumor antigens but also to the identification of specific humoral responses which may be used for diagnostic purposes. Stockert et al. were the first who tested a great number of tumor sera for humoral immune response to SEREX-identified tumor antigens, including several CTAs, by ELISA with recombinant proteins [60]. They showed that 9.4% of melanoma patients, 12.5% of ovarian cancer patients, 4.2% of patients with lung cancer and 7.7% of patients with breast cancer have AAb against NY-ESO-1. No AAb was found in 47 patients with NY-ESO-1 negative melanomas, but in 53% patients with NY-ESO-1 positive melanomas, suggesting an autoantigen driven response. MAGE-1 and SSX2 autoantibodies were only rarely detectable (Table 5). No AAb against CTAs were found in 70 blood donors [60]. Jager et al. showed that both NYESO-1 autoantibodies and cytotoxic T cells (CTL) against NY-ESO-1 peptides can be present in the same patient [61]. This suggests that the screening for an AAb response may be a simple and effective way to identify concomitantly CTL reactivity.
6. AUTOANTIBODIES TO ONCONEURAL ANTIGENS (For reviews, see refs [62-66]; see also the chapter "Paraneoplastic Syndrome" by M. Tishler and Y. Shoenfeld, this volume.) Onconeural antigens (ONA) are normally restricted to the nervous system but are aberrantly expressed in a number of tumors possibly by gene activation or derepression or post-transcriptional regulatory mechanisms. They may then be recognized by the immune system as "foreign" and elicit an autoimmune
165
Table 5. Cancer/testis antigens (CTAs) and autoantibodies Cancer/testis antigen(s)
No. of genes in family
SEREX-identified CTAs
Autoantibodies against CTAs
MAGE family
13
MAGE-l,MAGE-4a
MAGE-1 antibodies were found in 1 out of 127 melanoma patients, 1 out of 32 ovarian cancer and 1 out of 24 lung cancer patients [60]
GAGE family
6
BAGE
1
SSX family
5
HOM-MEL-40/SSX2
SSX2 antibodies were found in patients with melanoma, in 2 out of 11 using a plaque assay and in 1 of 127 using ELISA [9, 60]
ESQ
1
NY-ESO-1
NY-ESO-1 were found in 12 out of 127 melanoma patients, 4 out of 32 ovarian cancer, 2 out of 26 breast cancer and 1 out of 24 lung cancer patients [60]
SCP (family) synaptonemal complex protein(s) CT7 (family)
unknown lor 2
H0M-TES14/SCP-1 CT7
response causing paraneoplastic syndromes affecting the nervous system. AAb against ONA may detect neuronal nuclear antigens (= antineuronal nuclear antibodies ANNA), cytoplasmic antigens of Purkinje cells (= anti-Purkinje cell antibodies APCA), synaptic or retinal proteins (see Table 6). In most cases of paraneoplastic syndromes the detection of specific AAb can strongly suggest the presence of a tumor. Anti-Hu positive patients with paraneoplastic encephelomyelopathies (PEIM) or subacute sensory neuronopathy (SSN) most often have small cell lung cancer (SCLC) as underlying disease. Similarly, antiYo positive patients with paraneoplastic cerebellar degeneration (PCD) often harbor gynaecological neoplasms. Furthermore, Hu, Yo and Ri AAb can be found in lower frequency and at lower titers in SCLC or ovarian cancer patients without neurological diseases [67, 68]. Neurological syndromes associated with AAb to ion channel proteins have a lower frequency of tumors as the syndromes associated with Hu, Yo and Ri antibodies. Patients with anti-VGKC positive acquired neuromyotonia have SCLC or thymoma in 20% and only 10-15% of the AchR antibody positive IVIyasthenia gravis (IMG) cases are associated with thymoma. In thymoma associated IVIG other autoantigens such as ryanodine receptor and titin may
166
also play a pathogenic role [69,70] (see also the chapter "Thymoma and Autoimmunity" by Y Sherer and Y Shoenfeld, this volume).
7. CONNECTIVE TISSUE DISEASE (CTD) SPECIFIC AUTOANTIBODIES AND CANCER There is an association of many autoimmune diseases with malignancies and on the other hand of specific autoimmune phenomena in patients with hematological and epitheUal neoplasms [35, 72] (see also the chapter "SLE and Cancer" by M. Abu-Shakra, D. Buskila and Y Shoenfeld, this volume). The close relationship between autoimmunity and cancer may have several causes (reviewed in [35] and [73]): a common susceptibility (genetic and immunologic predispositions), the activation of oncogenes and abnormal expression of oncoproteins, defects in apoptotic processes or common pathogenic factors inducing the diseases. Therefore, due to a possible common background, some disease-specific AAb may also be detectable in cancer patients without or before the development of autoimmune disease. Indeed, several AAb (antinuclear antibodies of various specificities, rheumatoid
Table 6. Autoantibodies against onconeural antigens and associated diseases [62-71] Autoantibodies
Onconeural antigens
Paraneoplastic syndromes
Associated tumors
Anti-Hu (ANNA-1)
Hu antigens (HuD, HuC, Hel-Nl)
Paraneoplastic encephalomyelopathies (PEM) Subacute sensory neuronopathy (SSN)
Small cell lung cancer
Anti-Ri (ANNA-2)
Ri antigens (N0VA-l,N0VA-2)
Opsoclonus/myoclonus syndrome (OMS)
Breast cancer Small cell lung cancer
Anti-Yo (APCA-1)
Yo antigens (cdr34, cdr62-l,cdr62-2)
Paraneoplastic cerebellar degeneration (PCD)
Ovarian cancer Breast cancer Small cell lung cancer Hodgkin's lymphoma
Antiamphiphysin
Synaptic vesicle-related protein amphiphysin
Paraneoplastic stiff man syndrome (SMS) Paraneoplastic encephalomyelitis
Breast cancer Small cell lung cancer
Anti-VGCC
Protein(s) of the P/Q, N and L type of voltage-gated calcium channels (VGCC)
Lambert-Eaton myasthenic syndrome (LEMS) Small cell lung cancer
Anti-VGKC
Protein(s) of voltage-gated potassium channels Acquired neuromyotonia (Isaacs' syndrome)
Anti-AchR
Protein(s) of the acetylcholine receptor
Antititin Anti-RyR
Cross-reactive titin epitopes Ryanodine receptor
Anti-CAR
Recovering a protein of photoreceptor cells
factor, antiphospholipid antibodies, antibodies against various tissues) have been detected in sera of tumor patients (reviewed in [35]). However, two studies including comparative groups of age-adjusted healthy subjects had shown that the increased incidence of RF, anticardiolipin antibodies, ANA as well as the ANA specificities against DNA, histones, Ro/SS-A, La/SSB, Sm and Ul-RNP in sera of tumor patients may well reflect the higher age of these patients rather than be a result of the tumor itself [74,75]. Further studies with larger groups of patients and with the inclusion of other AAb specificities should be done to clarify whether there is any specific relationship between defined AAb and cancer. In CTD the strongest associations to epithelial malignancies are in the group of patients with dermatomyositis, polymyositis and systemic sclerosis (reviewed in [35]; see also the chapter "Scleroderma and Cancer" by L. Guillevin). Furthermore, the results of Boyeldieu et al. [76], Kuwana [77] and Zuber [78] have led to the supposition that there is a relationship between systemic sclerosis (SSc) typical AAb and cancer. We addressed this question with a
Myasthenia gravis (MG)
Cancer-associated retinopathy
Small cell lung cancer thymoma Thymoma or thymic carcinoma
Breast cancer Small cell lung cancer
retrospective study on uranium miners—a risk group for both SSc and cancer [79, 80]. Nonorgan specific AAb were screened by indirect immunofluorescence on HEp-2 cells in sera of 1743 uranium miners [81], including sera of 73 uranium miners with lung cancer, 30 miners with radiographically suspected lung cancer and 25 miners with other malignant tumors. In ANA positive cases sera were analyzed for CTD typical AAb against dsDNA (CLIFT, ELISAs), Sm, Ul-RNP, Ro/SS-A, La/SS-B, topoisomerase I (immunodiffusion, ELISAs, immunoblot) and CENP-B (ELISA). Results were regarded as positive only if they were at least middle titred in one ELISA and positive in at least another but different assay. Antinucleolar antibodies were assessed as positive with patterns like those of SSc typical nucleolar antibodies (antifibrillarin, -RNA-polymerases, -Pm-Scl, -To) at titer > 1:320. We compared the results of the cancer patients without CTD symptoms (all cancers and separately lung cancer) with the results of the following groups of miners or control subjects:
167
Table 7. CTD typical autoantibodies in sera of different groups of uranium miners Group of uranium miners or control subjects
(n)
Autoantibodies (in %) against Topocentromere isomerase I proteins
nucleolar proteins
Ro/SS-A
dsDNA
At least one CTD AAb
All miners with definite and probable cancer: - without CTD symptoms
(128) (99)
2.40 2.02
2.40 1.01
0.80 0
5.60 4.04
6.40 4.04
14.40 9.09
Miners with lung cancer: - without CTD symptoms
(73) (53)
4.10 3.77
2.73 1.89
1.37 0
5.48 3.77
6.84 3.77
16.44 11.32
(311)
1.61
1.93
1.61
3.86
6.11
14.46
(1304)
0.92
0.69
0.46
1.69
2.15
5.67
0
0
0.5
0.5
0
1.0
Miners without cancer, but with possible CTD development Healthy miners^ Healthy older men^
(200)
^ Miners without cancer and symptoms of possible CTD development. ''Age and gender related control group for miners with cancer: men from the same geographical region older than 55 years, no cancer, no CTD symptoms and no environmental exposure to carcinogeneous substances.
(1)311 miners without tumor, but with a possible CTD development: symptoms of a possible development of SSc (Raynaud, diffuse lung fibrosis) or symptoms of possible development of other CTD, esp. SLE: one of the clinical ACR criteria for SLE and/or two or more "minor" signs of possible CTD development [82, 83]; (2) 1304 "healthy" miners regarding cancer and CTD symptoms; and (3)200 healthy men older than 55 years, from the same geographical region as the miners, but without any environmental exposure to carcinogeneous substances (=age and gender related control group of miners with cancer). The results are shown in Table 7. The prevalence of CTD typical AAb in miners with tumors or probable tumors is significantly higher compared to healthy miners (p < 0.03) and to a gender and age related control group (p < 0.0002), even if the tumor patients have no CTD symptoms. Particularly antitopoisomerase I (ATA) and anticentromere antibodies (ACA) may be associated with tumor development. The higher prevalence of tumors and p53 AAb in miners with CTD compared to those without CTD, the higher prevalence of CTD AAb in miners with cancer regardless of CTD symptoms and the development of cancer in patients with CTD AAb but without CTD symptoms suggest that CTD antibody positive miners should not only be followed-up for the development
168
of CTD, but also for the manifestation of tumors, especially for lung cancer.
8. AUTOANTIBODIES AS PARAMETERS IN THE PREDICTION AND EARLY DIAGNOSIS OF CANCER? The sooner cancer is diagnosed, the better the therapeutic outcome. However, an early diagnosis is still a problem with many kinds of tumors, e.g., with lung, pancreas, gallbladder and colon cancer. Therefore, there is a need for parameters which are specific for tumors and are detectable in preclinical stages. The ideal tumor marker should be (1) highly sensitive and (2) highly specific for tumors. (3) The tumor sensitivity should be higher than that of other diagnostic methods and (4) the earlier diagnosis should lead to an improvement of therapy. Tumor-associated antigens present in sera of cancer patients (e.g., CEA, NSE, s e c , CA50 etc.) can be useful markers for prognosis and for monitoring cancer therapy but have a limited value for diagnosis, esp. for the early diagnosis of cancer. Furthermore, other diagnostic methods—although improving—do not allow an early diagnosis of most tumors. Theoretically, the autoimmune response to antigens (proteins, glycoproteins) involved in the tumorigenesis and/or aberrantly expressed in tumors, may be an early event leading to detectable parameters
•H. E^^
< <
I <
(N
id c ^
B
3
O
< O < c
OH
y^ 'So O
^
^
C/5
^
o c
1 ^ s. rai ^1 \6 ^
03
i».
g o ^ ^e
o ^ E "7 ^
^
X)
T3
c3
lo
X)
CA
O
o. T3 C 03
^
Q ii .14 O H O
1
o
II pq t5 s5
03
c3
M
•c
W
T-!
< -S
-O
2
f^
_S
HJ
ex PQ
o; 00
c -o o (73
< yu j O
Q OH
O U
1 fe ea
-^
•^
"tS
-a ^,
c3
53
t^
3^
^ ^
:2
^ ^
-1
. iti
jD
1)
a ''^ -h
b o
g- t
II
c o S
u -a
c^
a; .5
<3
S O
(U
X5
"O
OH
b
t:
^
in
OH
(N
E 3
O
a. u m
IT)
_ ^ '3> 5 a r^ vD
•=; -^ .^> >> _^
C
C
iii„ (U
1
o c .2^
toX)
VJ
O U
5
5 £ -I O
"s
c OJ
P
QJ
^
w
•5
CD
Q
^
Q
pq
-^
U U
.S
169
(autoreactive T cells, autoantibodies) in the blood of patients with preclinical stages of tumors. Such early responses can be verified by retrospective and prospective studies of risk groups. Three retrospective studies with a greater cohort of risk persons (Table 8) as well as the results of Lubin et al. [31] have shown that up to now in 15 patients p53 AAb could be detected prior to the diagnosis of a tumor. The period of time before diagnosis of lung cancer (11 cases), ASL (2 cases), breast (1 case) and prostate cancer (1 case) was between 4 months and 11 years (on average 26 months). Of greater importance regarding the predictive value of AAb are prospective studies in risk groups. The study of persons with an endogeneous (e.g., Li-Fraumeni syndrome, mutations in BRCA genes, first degree relatives of patients with tumors, etc.) or exogeneous risk (occupational exposure to cancerous noxes) as well as patients with preneoplastic diseases (e.g., Barretts' oesophagus) or diseases associated with a higher risk of tumor development (e.g., some autoimmune diseases. Sweets' syndrome, gluten-sensitive enteropathy, etc.) may give further hints of the real specificity of defined AAb (esp. antip53) for the development of tumors. It has been shown that AAb to p53 and cyclin Bl are present in various risk groups in higher frequencies than in blood donors [32, 34, 42, 84]. The follow-up of positive persons will show whether defined AAb are specific enough in the screening for preneoplastic or microinvasive tumor lesions allowing an early diagnosis and an early intervention of cancer. Further studies may confirm that some of the AAb described above are highly specific and predictive markers for tumors. But for the screening of risk groups the sensitivities of most AAb are too low. Even the highest frequencies of about 30-50% found in lung, colorectal, head and neck cancer (anti-p53, antip2V^^) and breast cancer (anti-HER-2/neu) are not sufficient for a screening programme. A combined determination of two or more tumor specific AAb may resolve this problem. Therefore, a further evaluation of the relevance of known AAb specificities as well as the search for other diagnostically relevant AAb is necessary. The strategies for identifying new tumor relevant AAb are: (1) Screening with defined autoantigens known to be aberrant or overexpressed in tumors. This has been shown for AAb against oncoproteins, p53 and cyclins; (2) screening of tumor sera by in-
170
direct immunofluorescence on tumor cell monolayer or other targets for identifying antibodies reactive with cell-cycle-dependent antigens or other antigens possibly involved in cell growth. This type of procedure has led to the detection of the new autoantigens SG2NA, CENP-F and HCCl; and (3) The immunoscreening of cDNA expression libraries is the most powerful method for primary screening (SEREX) or for identifying novel proteins detected by indirect immunofluorescence with tumor sera. Taken together, the screening for an AAb response in tumor patients may lead to new diagnostic tumor markers and may be a simple and effective way to identify concomitantly CTL reactivity [61]. Furthermore, as "reporters from the immune system" such AAb could be used to elucidate the nature of autoantigens which drive the immune response [85].
REFERENCES 1.
2.
3.
4.
5.
6.
7.
8.
Burtin P, Von Kleist S, Rapp W, Loisillier F, Bonatti A, Grabar P. Auto-anticorp chez les cancereux. Presse Med 1965;73:2599-2603. Wilkinson PC, Zeromski J. Immunofluorescent detection of antibodies against neurones in sensory carcinomatous neuropathy. Brain 1965;88:529583. Shiku H, Takahashi T, Oettgen HF, Old LJ. Cell surface antigens of human malignant melanoma. II. Serological typing with immune adherence assays and definition of two new surface anUgens. J Exp Med 1976;144:873-88L Pfreundschuh M, Shiku H, Takahashi T, Whitmore WF, Oettgen HF, Old LJ. Serological analysis of cell surface antigens of malignant human brain tumors. Proc Natl Acad Sci USA 1978;75:5122-5126. Ueda R, Shiku H, Pfreundschuh M, Takahashi T, Whitmore WF, Oettgen HF, Old LJ. Cell surface antigens of human renal cancer defined by autologous typing. J Exp Med 1979;150:564-579. Old LJ. Cancer immunology: the search for specificity - G.H.A. Lowes memorial lecture. Cancer Res 1981;41:361-375. Cheever MA, Disis ML, Bernhard H, Gralow JR, Hand SL, Huseby ES, Qin HL, Takahashi M, Chen W. Immunity to oncogenic proteins. Immunol Rev 1995;145:33-59. Kotera Y, Fontenot JD, Pecher G, Metzgar RS, Finn OJ. Humoral immunity against a tandem repeat epitope of human mucin MUC-1 in sera from breast.
9.
10.
11.
12. 13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
pancreatic and colon cancer patients. Cancer Res 1994;54:2856-2860. Sahin U, Tureci O, Schmitt H, Cochlovius B, Johannes T, Schmits R, Stenner F, Luo G, Schobert I, Pfreundschuh M. Human neoplasms elicit multiple specific immune responses in the autologous host. Proc Natl Acad Sci USA 1995;92:11810-11813. Tureci O, Sahin U, Pfreundschuh M: Serological analysis of human tumor antigens: molecular definition and implications. Mol Med Today 1997;3:342349. Sahin U, Tureci O, Pfreundschuh M. Serological identification of human tumor antigens. Curr Opin Immunol 1997;9:709-716. Old LJ, Chen YT. New paths in human cancer serology. J Exp Med 1998;187:1163-1167. Ehrlich R, Witz IP. Natural killer cells and naturally occurring antibodies as representative of natural tumor immunity. Pathobiol Ann 1982;12:85-113. Witz IP, Agassy-Cahalon L. Do naturally occuring antibodies play a role in progression and proliferation of tumor cells? Int Rev Immunol 1988;3:133-145. Cahalon L, Korem S, Gonen B, Puri J, Smorodinsky NI, Witz IP. Autoantibody-mediated regulation of tumor growth. Ann NY Acad Sci 1992;621:393-408. Disis ML, Pupa SM, Gralow JR, Dittadi R, Menard S, Cheever MA. High-titer HER-2/neu protein-specific antibody can be detected in patients with early-stage breast cancer. J CHn Oncol 1997;15:3363-3367. Takahashi M, Chen W, Burd DR, Disis ML, Huseby ES, Qin H, McCahill L, Nelson H, Shimada H, Okuno K, Yasutomi M, Peace DJ, Cheevers MA. Antibody to ras proteins in patients with colon cancer. Clin Cancer Res 1995;1:1071-1077. Ben-Mahrez K, Sorokine I, Thierry D, Kawasumi T, Ishii S, Salmon R, Kohiyama M. Circulating antibodies against c-myc oncogene product in sera of colorectal cancer patients. Int J Cancer 1990;46:3538. Deguchi Y, Negoro S, Kishimoto S. Autoantibody to human c-myc oncogene product in autoimmune patients' sera. Int Arch Allergy Appl Immunol 1988;87:313-316. LaFond RE, Eaton RB, Watt RA, Villee CA, Actor JK, Schur PH. Autoantibodies to c-myc protein: elevated levels in patients with African Burkitt's lymphoma and normal Ghanians. Autoimmunity 1992; 13:215224. Yamamoto A, Shimizu E, Ogura T, Sone S. Detection of auto-antibodies against L-myc oncogene products in sera from lung cancer patients. Int J Cancer 1996;69:283-289. Yamamoto A, Shimizu E, Sumitomo K, Shinohara A, Namikawa O, Uehara H, Sone S. L-myc over-
23.
24. 25. 26.
27.
28.
29.
30.
31.
32.
33.
34.
expression and detection of auto-antibodies against L-myc in both the serum and pleural effusion from a patient with non-small cell lung cancer. Int Med 1997;36:724-727. Sorokine I, Ben-Mahrez K, Bracone A, Thierry D, Ishii S, Imamoto F, Kohiyama M. Presence of circulating anti-c-myb oncogene product antibodies in human sera. Int J Cancer 1991;47:665-669. Hansen R, Oren M. p53: from inductive signal to cellular effect. Curr Opin Genet Dev 1997;7:46-51. Hall PA, Lane DP. Tumour suppressors: a developing role for p53? Current Biol 1997;7:144-147. Nigro JM, Baker SJ, Preisinger AC, Jessup JM, Hosteter R, Cleary K, Bigner SH, Davidson N, Bayhn S, Devilee P. Mutation in the p53 gene occur in diverse human tumour types. Nature 1989;342:705-708. Hollstein M, Sidransky D, Vogelstein B, Harris CC. p53 mutations in human cancer. Science 1991;253:49-53. Crawford LV, Pim DC, Bulbrook RD. Detection of antibodies against the cellular protein p53 in sera from patients with breast cancer. Int J Cancer 1982;30:403408. Lubin R, Schlichtholz B, Teillaud JL, Garay E, Bussel A, Wild CP. p53 antibodies in patients with various types of cancer: Assay, identification, and characterization. Clin Cancer Res 1995;1:1463-1469. Montenarh M. Humoral immune response against p53 in human malignancies. In: Conrad K, Humbel RL, Meurer M, Shoenfeld Y, Tan EM, eds., Pathogenic and Diagnostic Relevance of Autoantibodies. Lengerich, Berlin: Pabst Science Publishers, 1998;377-394. Lubin R, Zalcman G, Bouchet L, Tredanel J, Legros Y, Cazals D, Hirsch A, Soussi T. Serum p53 antibodies as early markers of lung cancer. Nature Med 1995;1:701-702. Trivers GE, Cawley HL, De Benedetti VMG, Hollstein M, Marion MJ, Bennett WP, Hoover ML, Prives C, Tamburro C, Harris CC. Anti-p53 antibodies in sera of workers occupationally exposed to vinyl chloride. J Natl Cancer Inst 1995;87:1400-1407. Trivers GE, De Benedetti VMG, Cawley HL, Caron G, Harrington AM, Bennett WP, Jett JR, Colby TV, Tazelaar H, Pairolero P, Miller RD, Harris CC. Antip53 antibodies in sera from patients with chronic obstructive pulmonary disease can predate a diagnosis of cancer. Clin Cancer Res 1996;2:1767-1775. Rohayem J, Conrad K, Frey M, Mehlhom J, Frank KH. Autoantibodies—predictive parameters of tumor development? In: Conrad K, Humbel RL, Meurer M, Shoenfeld Y, Tan EM, eds.. Pathogenic and Diagnostic Relevance of Autoantibodies. Lengerich, Berlin: Pabst Science PubUshers, 1998;412^14.
171
35.
36.
37. 38.
39.
40.
41.
42.
43.
44.
45.
46.
47. 48.
49.
172
Tomer Y, Sherer Y, Shoenfeld Y. Autoantibodies, autoimmunity and cancer (Review). Oncol Rep 1998;5:753-761. lARC. Silica, some silicates, cool dust and paraaramid fibrils. Lyon: I ARC Monographs on the evaluation of carcinogenic risk to human 68; 1997. Tan EM. Autoantibodies in pathology and cell biology. Cell 1991;67:841-842. Hunter T, Pines J. Aberrant expression of cyclins may be intimately associated with the neoplastic process. Cell 1991;66:1071-1074. Gong J, Ardett B, Traganos F, Darzynkiewicz Z. Unscheduled expression of cyclin Bl and cyclin E in several leukemic and solid tumor cell lines. Cancer Res 1994;54:4285-4288. Buckley MP, Sweeney KJ, Hamilton JA, Sini RL, Manning DL, Nicholson RI, de Fazio A, Watts CK, Musgrove EA, Sutherland RL. Expression and amplification of cyclin genes in human breast cancer. Oncogene 1993;8:2117-2133. Wang A, Yoshimi N, Ino N, Tanaka T, Mori H. Overexpression of cyclin Bl in human colorectal cancers. J Cancer Res Clin Oncol 1997;123:124-127. Covini G, Chan EKL, Nishioka M, Morshed SA, Reed SI, Tan EM. Immune response to cyclin Bl in hepatocellular carcinoma. Hepatol 1997;25:7580. Landberg G, Tan EM. Characterization of a DNAbinding nuclear autoantigen mainly associated with S phase and G2 cells. Exp Cell Res 1994;212:255-261. Muro Y, Chan EKL, Landberg G, Tan EM. A cellcycle nuclear autoantigen containing WD-40 motifs expressed mainly in S and G2 phase cells. Biochem Biophys Res Commun 1995;207:1029-1037. Casiano CA, Landberg G, Ochs R, Tan EM. Autoantibodies to a novel cell cycle-regulated protein that accumulates in the nuclear matrix during S phase and is localized in the kinetochores and spindle midzone during mitosis. J Cell Sci 1993; 106:10451056. Rattner JB, Rao A, Fritzler MJ, Valencia DW, Yen TJ. CENP-F is a ca. 400 kDa kinochore protein that exhibits a cell-cycle dependent localization. Cell Motil Cytoskeleton 1993;26:214-226. Humbel RL. Autoantibodies to the cellular mitotic apparatus. Immunobiology 1986;173:211. Rattner JB, Rees J, Whitehead CM, Casiano CA, Tan EM, Humbel RL, Conrad K, Fritzler M. High frequency of neoplasia in patients with autoantibodies to centromere protein CENP-F. Clin Invest Med 1997;20:308-319. Casiano CA, Humbel RL, Peebles C, Covini G, Tan EM. Autoimmunity to the cell cycle-dependent centromere protein p330^/CENP-F in disorders
50.
51.
52.
53.
54.
55.
56.
57.
58.
59.
60.
61.
associated with cell proliferation. J Autoimmun 1995;8:575-586. Gosrau G, Conrad K, Frank KH. Non-organspecific autoantibodies in tumor patients. In: Conrad K, Humbel RL, Meurer M, Shoenfeld Y, Tan EM, eds.. Pathogenic and Diagnostic Relevance of Autoantibodies. Lengerich, Berlin: Pabst Science Publishers, 1998;415-416. Landberg G, Erlanson M, Roos G, Tan EM, Casiano CA. Nuclear autoantigen p330^/CENP-F: A marker for cell proliferation in human malignances. Cytometry 1996;25:90-98. Heck MMS, Earnshaw WC. Topoisomerase II: A specific marker for cell proliferation. J Cell Biol 1986;103:2569-2581. Zwelling LA. DNA topoisomerase II as a target of antineoplastic drug therapy. Cancer Met Rev 1985;4:263-276. Francis GE. Leukaemogenesis: a postulated mechanism involving tyrosine protein kinase and DNA topoisomerase. Med Hypoth 1987;22:223-231. Imai H, Furuta K, Landberg G, Kiyosawa K, Liu LF, Tan EM. Autoantibodies to DNA topoisomerase II in primary liver cancer. CHn Cancer Res 1995;1:417422. Imai H, Ochs RL, Kiyosawa K, Furuta S, Nakamura RM, Tan EM. Nucleolar antigens and autoantibodies in hepatocellular carcinoma and other malignancies. Am J Pathol 1992;140:859-870. Imai H, Chan EKL, Kiyosawa K, Fu XD, Tan EM. Novel nuclear autoantigen with splicing factor motifs identified with antibody from hepatocellular carcinoma. J Clin Invest 1993;92:2419-2426. Imai H, Fritzler MJ, Neri R, Bombardieri S, Tan EM, Chan EKL. Immunocytochemical characterization of human NOR-90 (upstream binding factor) and associated antigens reactive with autoimmune sera. Mol Biol Rep 1994;19:115-124. Covini G, von Miihlen CA, Pacchetti S, Colombo M, Chan EKL, Tan EM. Diversity of antinuclear antibody responses in hepatocellular carcinoma. J Hepatol 1997;26:1255-1265. Stockert E, Jager E, Chen YT, Scanlan MJ, Gout I, Karbach J, Arand M, Knuth A, Old LJ. A survey of the humoral immune response of cancer patients to a panel of human tumor antigens. J Exp Med 1998;187:1349-1354. Jager E, Chen YT, Drijfhout JW, Karbach J, Ringhoffer M, Jager D, Arand M, Wada H, Noguchi Y, Stockert E, Old LJ, Knuth A. Simultaneous humoral and cellular immune response against cancer-testis antigen NY-ESO-1: Definition of human histocompatibility leukocyte antigen (HLA)-A2-binding peptide epitopes. J Exp Med 1998;187:265-270.
62. 63.
64.
65.
66.
67.
68.
69.
70.
71.
72. 73. 74.
Posner JB, Dalmau J. Paraneoplastic syndromes. Curr Opin Immunol 1997;9:723-729. Lang B, Vincent A. Autoimmunity to ion-channels and other proteins in paraneoplastic disorders. Curr Opin Immunol 996;8:865-871. Lennon VA. Calcium channel and related paraneoplastic disease autoantibodies. In: Peter JB, Shoenfeld Y, eds., Autoantibodies. Amsterdam: Elsevier, 1996; 139-146. Furneaux HM. Neuronal nuclear autoantibodies, Type 1 (Hu). In: Peter JB, Shoenfeld Y, eds., Autoantibodies. Amsterdam: Elsevier, 1996;551-554. Dalmau JO, Posner JB. Purkinje cell autoantibodies, type 1 (Yo). In: Peter JB, Shoenfeld Y, eds.. Autoantibodies. Amsterdam: Elsevier, 1996;655659. Graus F, Dalmou J, Rene R, Tora M, Malats N, Verschuuren JJ, Cardenal F, Vinolas N, del Muro G, Vadell C, Mason WP, Rosell R, Posner JB, Real FX. Anti-Hu antibodies in patients with small-cell lung cancer: association with complete response to therapy and improved survival. J Clin Oncol 1997;15:28662872. DrUcek M, Bianchi G, Bogliun G, Casati B, Grisold W, Kolig C, Liszka-Setinek U, Marzorati L, Wondrusch E, Cavaletti G. Antibodies of the anti-Yo and anti-Ri type in the absence of paraneoplastic neurological syndromes: a long-term survey of ovarian cancer patients. J Neurol 1997;244:85-89. Voltz RD, Albrich WC, Nagele A, Schumm F, Wick M, Freiburg A, Gautel M, Thaler HT, Aarli J, Kirchner T, Hohlfeld R. Paraneoplastic myasthenia gravis: Detection of anti-MGT30 (titin) antibodies predict thymic epithelial tumor. Neurol 1997 ;49:14541457. Mygland A, Aarli JA, Matre G, Gilhus NE. Ryanodine receptor (RyR) antibodies are detected in about 50% of patients with myasthenia gravis who have a thymoma. J Neurol Neurosurg Psychiat 1994;57:843846. Dropcho EJ. Antiamphiphysin antibodies with small-cell lung carcinoma and paraneoplastic encephalomyelitis. Ann Neurol 1996;39:659-667. Sela O, Shoenfeld Y Cancer in autoimmune diseases. Semin Arthrit Rheum 1988;18:77-87. Fishman P. Autoimmunity and cancer. Isr J Med 30 1994;30:15-19. Huminer D, Tomer Y, Pitlick S, Shoenfeld Y Autoantibodies in cancer patients: are they tumor related or age related? Autoimmunity 1990;5:232-233.
75.
76.
77.
78.
79.
80.
81.
82.
83.
84.
85.
Swissa M, Amital-TepHtzky H, Haim N, Cohen Y, Shoenfeld Y Autoantibodies in neoplasia. An unresolved enigma. Cancer 1990;65:2554-2558. Boyeldieu D, Rouquette-Gally AM, Laugier A, Abuaf N. Anticorp anti-centromere, CREST et cancer. PresseMed 1987;16;1924-1925. Kuwana M, Fujii T, Mimori T, Kaburaki J. Enhancement of anti-DNA topoisomerase I autoantibody response after lung cancer in patients with systemic sclerosis. A report of two cases. Arthrit Rheum 1996;39:686-691. Zuber M, Gotzen R, Filler I. Clinical correlation of anticentromere antibodies. Clin Rheumatol 1994;13:427-432. Conrad K, Stahnke G, Liedvogel B, Mehlhorn J, Barth J, Blasum C, Altmeyer P, Sonnichsen N, Frank KH. Anti-CENP-B response in sera of uranium miners exposed to quartz dust and patients with possible development of systemis sclerosis. J Rheumatol 1995;22:1286-1294. Schiittmann W. Schneeberg lung disease and uranium mining in the Saxon Ore Mountains (Erzgebirge). Am J Industr Med 1993;23:355-368. Conrad K, Frank KH, Mehlhorn J. Kollagenosetypische Autoantikorper in Seren von quarzstaubexponierten Uranerzbergarbeitern. Diagnostische, prognostische und atiopathogenetische Bedeutung in Bezug auf die Entwicklung systemischer Autoimmunerkrankungen. In: Conrad K, ed., Autoantikorper. Lengerich, Berlin: Pabst Science Publishers, 1998;250-288. Tan EM, Cohen AS, Fries JF, Masi AT, McShane DJ, Rothfield NF, Green Schaller J,Talal N, Winchester RJ. The revised criteria for the classification of systemic lupus erythematosus. Arthrit Rheum 1982;25:1271-1277. Conrad K, Mehlhorn J, Llithke K, Dorner T, Frank KH. Systemic lupus erythematosus after heavy exposure to quartz dust in uranium mines: clinical and serological characteristics. Lupus 1996;5:62-69. Green JA, Mudenda B, Jenkins J, Leinster SJ, Tarunina M, Green B, Robertson L. Serum p53 autoantibodies: incidence in familial breast cancer. Eur J Cancer 1994;30A:580-584. Tan EM. Autoantibodies as diagnostic markers and messengers form the immune system. In: Conrad K, Humbel RL, Meurer M, Shoenfeld Y, Tan EM, eds., Pathogenic and Diagnostic Relevance of Autoantibodies. Lengerich, Berlin: Pabst Science Publishers, 1998;20-31.
173
(c) 2000 Elsevier Science B.V All rights reserved. Cancer and Autoimmunity Y. Shoenfeld and M. E. Gershwin, editors
Autoantibodies to the Proliferation-Associated Nuclear Protein CENP-F in Cancer Carlos A. Casiano Loma Linda University School of Medicine, USA
1. INTRODUCTION Antinuclear autoantibodies (ANAs) have been long recognized as a hallmark of systemic autoimmune diseases such as systemic lupus erythematosus (SLE), systemic sclerosis (SSc) and Sjogren syndrome [1]. It is well established that each of these diseases is associated with a specific ANA profile, which facilitates the use of ANAs as diagnostic probes [1]. In recent years, ANAs have been also detected, although with relatively lower frequencies, in patients with other disease conditions such as paraneoplastic neurologic syndromes [2], liver disease [3], chronic fatigue syndrome [4, 5], interstitial cystitis [6] and various types of malignant tumors [7-10]. It should be noted that in contrast to the autoantibody specificity found in several systemic autoimmune diseases, the ANA response in other disease conditions, particularly in cancer, appears to be highly diverse [7, 9, 10]. ANAs target predominandy protein or nucleic acid components of nuclear structures involved in essential functions, including chromatin, nucleoli, spliceosomes, centrosomes, centromeres, replication and transcription complexes, and coiled bodies [11, 12]. For many years, ANAs have been used systematically to screen cDNA expression libraries derived from a variety of tissues and cell lines, which has led to the rapid and direct isolation of cDNA clones encoding the target autoantigens [13]. The molecular characterization of these autoantigens has contributed significantly to understanding nuclear structure and function [11-13].
Growing evidence indicates that in some cancer patients the antitumor immune response involves the elicitation of ANAs and other autoantibodies that recognize self-antigens expressed in the tumors [14]. These "tumor-associated autoantibodies" (TAA) have been shown to target tissue-specific differentiation antigens such as tyrosinase, galectin-4, and gp75 [14, 15]; membrane receptors such as the HER-2/neu oncoprotein [16]; tissue-restricted antigens such as MAGE and NY-ESO-1 [ 15]; and nuclear proteins such as p53 [8], c-myc [17], c-myb [18], DNA topoisomerase II [19], CENP-F [20, 21], and the nucleolar proteins NOR-90/UBF, fibrillarin and B23 [7]. Many of these autoantigens have been identified by serological analysis of recombinant cDNA expression libraries (SEREX). In this approach, the patient's autoantibodies are used as probes for immunoscreening of autologous tumor cDNA Ubraries [22]. While the therapeutic and diagnostic value of TAA is still unclear, a detailed knowledge of cancerassociated autoantigens that could potentially stimulate specific antitumor immune responses is essential for exploring and designing novel immunotherapeutic approaches in the treatment of cancer. Such knowledge is also relevant for providing insights into mechanisms underlying immunity to self-antigens in cancer and the potential role of these antigens in malignant transformation. The current chapter will review recent studies involving CENP-F, a novel proliferationassociated nuclear protein that is the target of a vigorous autoantibody response in certain patients with cancer.
175
2. SUBCELLULAR LOCALIZATION AND MOLECULAR ANALYSIS OF CENP-F CENP-F, which is also known as pSSO"^ (doublet protein of approximately 330 kD) and mitosin, was initially identified during a search for human sera containing autoantibodies to nuclear proteins associated with cell division [23, 24]. The expression of CENP-F is proliferation-dependent and cell cycleregulated since the protein is detected predominantly during G2 and mitosis [23-26]. CENP-F undergoes dramatic nuclear redistributions, as visualized by indirect immunofluorescence (IIF), confocal, and immunoelectron (lEM) microscopic analysis of cultured mammalian cells [23-26]. The protein accumulates throughout the nuclear matrix during late S phase, reaching maximum expression during G2. It then relocates to the kinetochore region of centromeres and to the spindle poles during early prophase, where it remains until the metaphase:anaphase transition. In the centromere CENP-F interacts with the cell cycle-dependent kinetochore proteins CENP-E and hBUBRl, a BUBl related kinase that was found to be mutated in colorectal carcinomas [27]. After the metaphase:anaphase transition, CENP-F moves from the kinetochores and spindle poles to the spindle midzone. During the final stages of mitosis, CENP-F is predominantly associated with the cleavage furrow, first forming a belt-like structure and later concentrating in the intercellular bridge regions flanking the midbody. The protein is degraded after the separation of the daughter cells. The spatial reorganization of CENP-F during the cell cycle coincides with its phosphorylation state, suggesting that phosphorylation might be important for determining CENP-F intracellular distribution or function [26]. The dynamic subcellular redistribution of CENP-F implies an important function in mitosis, with possible roles in centromere/kinetochore maturation, chromosome alignment and segregation, regulation of the metaphase checkpoint, anaphase spindle stabilization, determination of the cleavage furrow, and cytokinesis. Immunoscreening of mammalian cDNA libraries using anti-CENP-F autoantibodies led to the identification of a 10,142-bp cDNA encoding a full length CENP-F protein consisting of approximately 3,210 amino acids, with an estimated mass of 367 kD [25]. Comparison of the CENP-F cDNA sequence with that of mitosin, a 350 kD protein identified using an as-
176
say to detect proteins associated to the retinoblastoma tumor suppressor protein Rb [26], reveals that except for some minor discrepancies in the sequences these two proteins are virtually identical. Partial cDNA sequences encoding portions of the autoantigen p330^ [24] also revealed identity to CENP-F and mitosin (Casiano and Tan, unpublished observations). The reported subcellular distributions of CENP-F, mitosin, and p330^ are indistinguishable, regardless of the nature of the antibody probes (human vs experimentallyinduced) used in IIF and lEM [23-26] Analysis of the CENP-F cDNA sequence revealed the following features: (1) a pi of 5.2; (2) two 1,600-amino acid-long coil domains flanking a central flexible core and containing several leucine heptad repeats; (3) a putative nucleotide binding site (ADIPTGKT) located within the globular carboxy terminus; (4) a pair of highly charged tandem repeats (residues 2,110-2,289 and 2,292-2,471) separated by two proline residues; (5) a proline rich (10.6%) carboxyl terminus; (6) a putative bipartite nuclear localization signal (NLS) (residues 2,916-2,958); and (7) consensus phosphorylation sites for either MAP kinases or cyclin dependent kinases [25]. Deletion mutant analysis revealed that the C-terminus of CENP-F is essential for its centromere localization, spindle pole association, self-dimerization, and in vitro Rb binding [28, 29] Overexpression of N-terminally truncated mutants of CENP-F, which retain the ability to locate within the nucleus, was observed to arrest the cell cycle at G2/M [26], suggesting a role for the protein in the transition from interphase to mitosis. The gene encoding CENP-F has been assigned to human chromosome lq32-41, a region implicated in various types of cancer, including lung and breast cancer, and in the Van der Woude syndrome [28, 30]
3. AUTOIMMUNITY TO CENP-F IN CANCER Although the clinical significance of anti-CENP-F autoantibodies still needs to be further investigated, the available evidence indicates that autoimmunity to this protein is likely to be associated with the presence of a malignant tumor. An evaluation of the clinical histories of 26 patients producing anti-CENP-F IgG antibodies revealed that 14 (54%) of these patients had cancers of various types [20]. Some of the non-cancer patients had conditions associated with ab-
normal or increased cell proliferation such as hepatitis B and C-associated chronic liver disease. Interestingly, the average IIF titer of the anti-CENP-F antibodies in the patients with cancer, 1:10,103, was significantly higher than the average titer in the noncancer patients, 1:3,200 {p = 0.008), indicative of a vigorous immune response to CENP-F in the antibodypositive cancer patients. A more recent study extended the characterization of the 26 anti-CENP-F positive sera and added an additional group of 10 CENP-F antibody-positive patients [21]. This new group included 8 patients with cancer. In total, 22 (61%) of these individuals had cancer, with breast (9 out of 22) and lung (5 out of 22) neoplasms being the most common malignancies. The presence of anti-CENPF autoantibodies did not appear to be associated with systemic autoimmunity since only 4 of the 36 patients were diagnosed with systemic rheumatic diseases and the antibodies were not detected by IIF in large numbers of patients with systemic autoimmunity [20, 21]. Tables 1 and 2 summarize the clinical data of patients with circulating autoantibodies to CENP-F for which a diagnosis is known. It is unclear whether the appearance of antibodies to CENP-F antedates the clinical appearance of cancer. It would be important to follow prospectively CENP-F antibody-positive patients with no cancer history and assess whether their clinical status might change to a malignant condition. Of particular interest would be patients with disease conditions, such as hepatitis B- and C-associated chronic liver disease, that may develop with time into malignancy. It should be emphasized that although the majority of patients producing autoantibodies to CENP-F have cancer, the frequency of these autoantibodies in unselected cancer populations is rare when detected by IIF. For instance, a survey of 10 patients with smallcell lung carcinoma, 50 patients with breast cancer, and 50 patients with mahgnant melanoma by IF in HEp-2 cells did not reveal antibodies to CENP-F [21]. More extensive surveys involving 204 patients with hepatocellular carcinoma and 1,365 patients with various solid tumors yielded a frequency of anti-CENP-F autoantibodies of less than 1% [9, 10]. This low frequency of anti-CENP-F antibodies in unselected cancer patients, which should be confirmed by other detection methods, raises questions concerning the association of these autoantibodies with malignancy. Although the presence of these autoantibodies might be
indicative of an underlying tumor, it can not be ruled out that autoimmunity to CENP-F may be linked not to tumor development but to a specific cancer-associated condition or treatment, or perhaps other clinical conditions shared by anti-CENP-F-positive patients. It is therefore of paramount importance to follow closely in different centers the clinical evolution of patients that are positive for anti-CENP-F autoantibodies. Epitope mapping studies in which anti-CENP-Fpositive sera were reacted with recombinant polypeptides corresponding to different regions of the CENP-F molecule indicated a correlation between the presence of cancer and preferential antibody reactivity with epitopes in the C-terminal portion [21], an important region for CENP-F function. Although the biological significance of this observation is still unclear, it should be noted that in general autoantibodies are preferentially directed against highly conserved and functional regions of proteins [11].
4. CENP-F AS A MARKER OF TUMOR CELL PROLIFERATION CENP-F has several features that make it an attractive candidate for a marker of cell proliferation in tumors. First, its expression is proliferation-dependent and relatively specific for the 0 2 and M phases of the cell cycle. Second, its cell cycle-dependent distribution is highly conserved in mammalian cell lines [24]. Third, its association with the nuclear matrix confers resistance to a wide variety of preparation and fixation procedures [24, 31]. Three studies have been conducted to determine the potential use of CENP-F as a proliferation marker. The first study used CENP-F autoantibodies in two-parameter flow cytometry to correlate CENP-F expression with S-phase fraction in 24 hematological tumors, 12 breast cancers, and several cultured cell lines [31]. A significant correlation was observed between the percentage of CENP-F positive cells and S-phase fraction for all the tumors analyzed [31]. In the second study, an anti-mitosin monoclonal antibody, designated 14C10, was used in immunohistochemistry to evaluate mitosin/CENP-F expression in 386 node-negative, formaUn-fixed, archival breast cancers [32]. A strong positive correlation was found in this study between CENP-F expression and S-phase fraction. The expression of the protein correlated negatively with other prognostic factors such as estrogen
177
Table 1. Clinical features of patients with CENP-F antibodies Patient No.
Sex
Age
Clinical feature
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36
F F M M F M F F F F F F F M M F F F F F F M M M M M F F M F F F F F F M
49 65 42 60 54 50 62 47 60 68 63 62 40 93 77 74 64 43 56 61 59 68 58 65 54 61 55 44 58 75 72 64 50 76 72 46
Chronic hepatitis B Ischemic colitis; SLE Chronic renal allograft rejection Lung cancer Breast cancer Crohn disease Tonsil cancer Breast cancer Breast cancer Liver dysfunction of unknown origin Cerebral ischemia associated with heavy smoking Liver cirrhosis (hepatitis B virus positive) Nasopharyngeal carcinoma SLE Lung cancer Pancreatic duct dilatation; colon polyps Undifferentiated connective tissue disease Chronic hepatitis C; colon polyps Breast cancer Breast cancer Tracheal cancer Stomach cancer Waldenstrom's macroglobulinemia Stomach cancer Chronic renal allograft rejection Hepatocellular carcinoma Breast cancer Ovarian cancer Lung cancer Lung cancer Breast cancer Breast cancer Lung cancer Breast cancer Prolactinoma; hepatitis Arthralgia
Based on ref. [20,21].
and progesterone receptors, and patient age. In a multivariate analysis of disease-free survival, large tumor size (>2 cm) and high CENP-F expression were the only independently significant predictors of recurrence in a model containing steroid receptors, patient age, and S-phase fraction [32]. In the third study, a rabbit CENP-F antibody (designated 911) was used by immunohistochemistry to evaluate CENP-F expression in 41 cases of non-Hodgkin's lymphoma and a
178
significant correlation between CENP-F positive cells and S-phase fraction was observed [33]. These studies indicate that CENP-F is a potentially valuable marlcer of tumor cell proliferation using flow cytometry and immunohistochemistry techniques. Additional studies with other tumors will be needed to validate these promising observations.
Table 2. Summary of clinical features of patients producing autoantibodies to CENP-F Feature
Patients with other diagnoses
Patients with cancer
No. of patients Average age Sex Average anti-CENP-F antibody titer by IIF Diagnoses (No. of patients)
22 60.1 years 7M, 15F 1 :10,000 Breast cancer (9) Lung cancer (5) Head and neck cancers (3) Stomach cancer (2) Ovarian cancer (1) Liver cancer (1) Waldenstrom's IgM myeloma (1)
14 60.4 years 5M, 9F 1:3,000 Liver disease (5) SLE (2) Renal allograft rejection (2) Pancreatic duct dilatation (1) Arthralgia (1) UCTD (1) Crohn's disease (1)
5. SUMMARY AND PERSPECTIVES CENP-F is a novel proliferation-associated and cell cycle-regulated nuclear protein whose unique subcellular distribution is indicative of an important role in mitosis. The observation that CENP-F is the target of a vigorous IgG autoantibody response in some cancer patients points to this protein as a potential cancer-associated autoantigen. It should be cautioned, however, that since autoantibodies to CENP-F appear to be rare in unselected cancer populations, one can not rule out the possibility that autoimmunity to this protein might be associated with yet to be identified clinical- or therapy-associated conditions shared by CENP-F antibody-positive patients. Multicenter studies on the clinical associations of anti-CENP-F autoantibodies, involving a significant number of CENP-F antibody-positive patients, will be essential to fully understand the significance of the high frequency of malignancy currently observed in patients producing these antibodies. Assessment of the expression, structural integrity, and functional activity of CENP-F in normal and tumor tissues should also provide important information regarding the potential role of this protein in malignant transformation. Finally, it is important to emphasize that cancer serology is entering a new and exciting era. The realization that human tumors provoke autoantibody responses against self-proteins expressed in the tumors opens the door to large scale screenings of cancer sera for the presence of autoantibodies to potentially oncogenic novel proteins. Identification and characterization of these cancer-associated autoantigens will be valuable not only for increasing our understand-
ing of the molecular basis of malignant transformation, but also for the development of cancer vaccines based on immunization with self-peptides and aimed at enhancing immune responses to tumors.
ACKNOWLEDGEMENT This work was supported by the National Institutes of Health and the Arthritis Foundation.
REFERENCES 1.
2.
3.
4.
5.
6.
Von Miihlen CA, Tan EM. Autoantibodies in the diagnosis of systemic rheumatic diseases. Semin Arthrit Rheumatol 1995;24:323-358. Darnell RB. Onconeural antigens and the paraneoplastic neurologic disorders: at the intersection of cancer, immunity and the brain. Proc Natl Acad Sci USA 1996;93:4529-4536. Gershwin ME, Manns MP, Mackay IR. Molecular analysis of cytoplasmic autoantigens in liver diseases. In: Rose NR, Mackay IR, eds.. The Autoimmune Diseases II. San Diego: Academic Press, 1992;213-234. Konstantinov K, Von Mikecz A, Buchwald D, Jones J, Gerace L, Tan EM. Autoantibodies to nuclear envelope antigens in chronic fatigue syndrome. J Clin Invest 1996;98:1888-1896. von Mikecz A, Konstantinov K, Buchwald DS, Gerace L, Tan EM. High frequency of autoantibodies to insoluble cellular antigens in patients with chronic fatigue syndrome. Arthrit Rheumatol 1997;40:295-305. Ochs RL. Autoantibodies and interstitial cystitis. Clin Lab Med 1997;17:571-579.
179
7.
8.
9.
10.
11.
12.
13. 14. 15. 16.
17.
18.
19.
20.
21.
180
Imai H, Ochs RL, Kiyosawa K, Furuta S, Nakamura RM, Tan EM. Nucleolar antigens and autoantibodies in hepatocellular carcinoma and other malignancies. Am J Pathol 1992;140:859-870. Angelopoulou K, Diamandis EP, Sutherland DJA, Kellen JA, Bunting PS. Prevalence of serum antibodies against the p53 tumor suppressor gene protein in various cancers. Int J Cancer 1994;58:480-487. Covini G, von Miihlen CA, Pacchetti S, Colombo M, Chan EKL, Tan EM. Diversity of antinuclear antibody responses in hepatocellular carcinoma. J Hepatol 1997;26:1255-1265. Gosrau G, Conrad K, Frank KH. Non-organ specific autoantibodies in tumor patients. In: Conrad K, Humbel RL, Meurer M, Shoenfeld Y, Tan EM, eds., Pathogenic and Diagnostic Relevance of Autoantibodies. Lengerich: PABST Science Publishers, 1998;415^16. Tan EM, Antinuclear antibodies: diagnostic markers for autoimmune disease and probes for cell biology. Adv Immunol 1989;44:93-151. Balczon R. Autoantibodies as probes in cell and molecular biology. Proc Soc Exp Biol Med 1993;204:138154. Tan EM. Molecular biology of nuclear autoantigens. Adv Neprol Necker Hosp 1993;22:213-36. Houghton AN. Cancer antigens: immune recognition of self and altered self. J Exp Med 1994;180:1-4. Old LJ, Chen YT. New paths in human cancer serology. J Exp Med 1998;187:1163-1167. Cheever MA, Disi ML, Bemhard H, Gralow JR, Hand SL, Huseby ES, Qin HL, Takahashi M, Chen W. Immunity to oncogenic proteins. Immunol Rev 1995;145:33-59. Ben-Mahrez K, Thierry D, Sorokine I, Danna-Muller A, Kohiyama M. Detection of circulating antibodies against c-myc protein in cancer patient sera. Br J Cancer 1988;57:529-534. Sorokine I, Ben-Mahrez K, Bracone A, Thierry D, Ishii S, Imamoto F, Kohiyama M. Presence of circulating anti-c-myb oncogene product antibodies in human sera. Int J Cancer 1991;47:665-669. Imai H, Furuta K, Landberg G, Kiyosawa K, Liu LF, Tan EM. Autoantibody to DNA topoisomerase II in primary liver cancer. Clin Cancer Res 1995; 1:417424. Casiano CA, Humbel RL, Peebles C, Covini G, Tan EM. Autoimmunity to the cell cycle-dependent centromere protein p330*^/CENP-F in disorders associated with cell proliferation. J Autoimmun 1995;8:575-586. Rattner JB, Rees J, Whitehead CM, Casiano CA, Tan EM, Humbel RL, Conrad K, Fritzler MJ. High frequency of neoplasia in patients with autoantibod-
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
ies to centromere protein CENP-F. Clin Invest Med 1997;20:308-309. Sahin U, Tureci O, Pfreundschuch M. Serological identification of human tumor antigens. Curr Opin Immunol 1997;9:709-716. Rattner JB, Rao A, Fritzler MJ, Valencia DW, Yen TJ. CENP-F is a ca 400 kDa kinetochore protein that exhibits a cell cycle dependent locaHzation. Cell Mot Cytoskel 1993;26:214-226. Casiano CA, Landberg G, Ochs RL, Tan EM. Autoantibodies to a novel cell cycle-regulated protein that accumulates in the nuclear matrix during S phase and is localized in the kinetochores and spindle midzone during mitosis. J Cell Sci 1993;106:1045-1056. Liao H, Winkfein RJ, Mack G, Rattner JB, Yen TJ. CENP-F is a protein of the nuclear matrix that assembles onto kinetochores at late G2 and is rapidly degraded after mitosis. J Cell Biol 1995;130:507-518. Zhu X, Mancini MA, Chang KH, Liu CY, Chen CF, Shan B, Jones D, Yang-Feng TL, Lee WH. Characterization of a novel 350-kilodalton nuclear phosphoprotein that is specifically involved in mitotic-phase progression. Mol Cell Biol 1995a;15:5017-5029. Chan GKT, Schaar BT, Yen TJ. Characterization of the kinetochore binding domain of CENP-E reveals interactions with the kinetochore proteins CENP-F and hBUBRl. J Cell Biol 1998;143:49-63. Zhu X, Chang KH, He D, Mancini MA, Brinkley WR, Lee WH. The C terminus of mitosin is essential for its nuclear localization, centromere/kinetochore targeting, dimerization. J Biol Chem 1995b;270:1954519550. Zhu X, Ding L, Pei G. Carboxyl terminus of mitosin is sufficient to confer spindle pole localization. J Cell Biochem 1997;66:441-449. Testa J, Zhou JY, Bell DW, Yen TJ. Chromosomal localization of the genes encoding the kinetochore proteins CENPE and CENPF to human chromosomes 4q24-q25 and Iq32-q41, respectively, by fluorescence in situ hybridization. Genomics 1994;23:691-693. Landberg G, Erlanson M, Roos G, Tan EM, Casiano CA. The nuclear autoantigen p330^/ CENP-F: a new marker for cell proliferation in human malignancies. Cytometry 1996;25:90-98. Clark GM, Allred DC, Hilsenbeck SG, Chamness GC, Osborne CK, Jones D, Lee WH. Mitosin (a new proliferation marker) correlates with clinical outcome in node-negative breast cancer. Cancer Res 1997;57:5505-5508. Erlanson M, Casiano CA, Tan EM, Lindh J, Roos G, Landberg G. Immunohistochemical analysis of the proliferation associated nuclear antigen CENPF in non-Hodgkin's lymphoma. Mod Pathol 1999; 12:69-74.
© 2000 Elsevier Science B.V All rights reserved. Cancer and Autoimmunity Y. Shoenfeld and M, E. Gershwin, editors
p53 Autoantibodies and Cancer: Specificity, Diagnosis and Monitoring Heiko T. Flammann^ and Hella-Monika Kuhn^ ^Institute of Immunology, Pathology and Molecular Biology, Hamburg, Germany; ^ Israelitic Hospital, Hamburg, Germany
1. INTRODUCTION TO p53 p53 has been rightfully called the "guardian of the genome" [1]. This tumor suppressor gene plays a critical cellular role with major implications in clinical oncology (for a review, see [2]). In brief, its protein participates in the regulation of the cell-cycle, acts as transcriptional transactivator/repressor, helps in DNA repair, suppresses cell growth, induces apoptosis, and functions in numerous other ways [3-11]. The loss of normal p53 functions during carcinogenesis occurs in several ways. In about 50% of human cancers, the p53 gene is mutated [12], Cancerous cells that harbor an altered p53 gene carry mainly a missense point mutation with dominant-negative effects. The wild-type allele may then be lost. Ninety-five percent of these missense mutations fall within the evolutionary conserved DNA-binding domain of the gene [13]; some of them, however, may lead to a gain of new function [14]. Germline mutations of p53 (LiFraumeni syndrome [15]) pose a high risk for cancer and predispose individuals at an early age to various mesenchymal and epithelial neoplasms at multiple sites. Nonmutational mechanisms leading to a p53 functional loss include complex formation with viral oncoproteins in virus-induced carcinogenesis [16, 17], overexpression of the mdm2 protein in sarcoma [18] as well as inactivation of the dislocated nuclear p53 protein [19] in the cytoplasm (some human breast cancers [20]). Generally, it is the stabilization of an otherwise rapidly turned-over p53 protein which leads to its intracellular (mainly nuclear) accumulation. A p53 mutation is usually a preinvasive event; both the frequency and the timing vary with the type of cancer [21]. In lung cancer, for example, p53 alter-
ations represent a very early genetic change [22, 23]. However, in colorectal carcinoma (model of Fearon and Vogelstein [24]), p53 mutations are a late event [25] and mark the transition between a dysplastic adenoma and an invasive adenocarcinoma. The fraction of tumors with a mutated p53 gene is typically higher in late-stage neoplasms.
2. ANTI-p53 HUMORAL RESPONSE AND CLINICAL SIGNIFICANCE OF p53 AUTOANTIBODIES Almost 17 years ago, human p53 autoantibodies (p53AAb) were detected for the first time in sera of patients with breast cancer [26]. Since then, p53AAb were found to be associated mainly with solid tumors of the epithelias (carcinoma) or, at reduced frequencies, the lymphatic system (for a review, see [27]). In general, 30-40% of patients with a somatically mutated p53 gene develop specific autoantibodies (overall prevalence: 18-25%). Still, what triggers an antip53 immune response remains unclear. It has been suggested that loss of tolerance via p53 protein accumulation is an essential element for the induction of p53AAb [28]. In cells of healthy adults, the nuclear p53 protein is present only in very low copy numbers [29] and p53AAb are rare (among blood donors, less than 0.5%). For their frequency in cancer patients, it was assumed to be proportional to the occurence of p53 mutations [30]. Thus, the accumulation of p53 protein may be due to the mutational event and prolonged half-life seems to be one important prerequisite of the humoral response. However, accumulation is not always associated with a mutation [20, 31]. In
181
some cases, p53AAb are elicited without a detectable p53 gene alteration [32, 33]. Moreover, p53AAb were reported for patients with no overexpression of p53 in the tumor [34, 35]. In this context, however, the presence of a second yet occult cancer eliciting p53AAb should also be taken into consideration. Davidoff et al. [36] have suggested that the site of the p53 mutation might influence the generation of p53AAb. Other studies, however, gave no support to this hypothesis [33, 37]. In lung cancer, immunogenicity seems to depend on the type of the p53 mutation (missense); no p53AAb were detected in patients who had stop, splice or frameshift mutations in their tumors [38]. As another prerequisite, complex formation with heat shock protein Hsp70 has been linked to an immunogenic p53 protein [36]; only tumor tissue from seropositive patients contained such aggregates. Generally, human sera react equally well with mutant and wild-type p53 protein exposing conformational and denaturation-resistent epitopes [39]. These epitopes are located in the amino and in the carboxy-terminal regions of the protein outside the central mutational hotspots [28] and are also detected by sera of animals hyperimmunized with wild-type p53 [40]. Ninetyeight percent of p53AAb-positive sera from patients with various cancer types recognize the epitopes in the amino-terminus of the p53 protein while only 48% react with those of the carboxy-terminus [41]. The anti-p53 humoral response mainly generates immunoglobulins of the IgGl and IgG2 subclasses [30]; few patients develop predominantly IgA. As with p53 mutations, the clinical significance of p53AAb varies with cancer type. Furthermore, different investigators come to contradictory conclusions. In cancer of the head and neck, for example, shorter relapse-free and overall survival of the patients were reported for carcinoma harboring p53 mutations [42, 43]. Other studies, however, found no association between mutation, protein accumulation and poor clinical outcome [44,45]. Bosari et al. [46] pointed out for colorectal carcinoma that p53 mutations were not correlated with clinical parameters and not related to patient survival. Moreover, 30% of colorectal tumors may have p53 accumulation without the gene mutation [47]. This conflicts with three studies [48-50] in which a prognostic significance for the altered gene was found. Likewise, in an early study on p53AAb in lung cancer (NSCLC and SCLC) patients, the humoral response was not correlated with clinical data or survival
182
[38]. Later, however, clinical relevance of p53AAb was clearly shown for two patients in whom the antibodies predated a lung cancer diagnosis by several months [51] (see below). It should also be noted that the presence of p53AAb in patients with small-cell lung carcinoma may indicate a favorable prognosis with an improved survival [52]. Patients with breast cancer who develop p53AAb, on the other hand, face a shorter overall survival; the humoral response is negatively correlated with oestrogen and progesterone receptors [53]. With respect to colorectal cancer, the prognostic value of p53AAb is still unclear. Houbiers et al. [54] see a decreased survival for patients with p53AAb as do Kressner et al. [55]. Angelopoulou et al. [56], however, ascribe no prognostic value to a p53AAb test. To date, only a few reports turned their focus from the qualitative p53AAb evaluation in cancer diagnosis and prognosis to its usefulness in patient monitoring. With the recent arrival of quantitative ELISA kits, trailing serum levels during therapy or in posttreatment cancer patients will soon provide additional information on the clinical usefulness of p53AAb. This short compilation aims to review some aspects of p53AAb in early diagnosis, patient follow-up, and specificity for malignant diseases.
3. p53 AUTOANTIBODIES: NONTUMOROUS DISEASES AND HEALTHY INDIVIDUALS The presence of p53AAb is generally indicative of malignancy. Nevertheless, rare exceptions become known. In autoimmune diseases (AID), p53AAb can be detected in patients with systemic lupus erythematosus (SLE) [57, 58], Sjogren's syndrome and systemic sclerosis (scleroderma) [57]. Additionally, we found seropositive individuals among patients with Graves' disease, Wegener's granulomatosis, and other vasculitis [58]. The role of p53AAb in AID is yet unknown. Furthermore, is there an association between p53AAb generation and p53 protein accumulation in patients with AID? Recently, extensive apoptosis was demonstrated in most of the epidermis of cutaneous lupus erythematosus; lesional skin showed a marked increase in p53 protein-positive keratinocytes [59]. Skin samples from 44 patients with scleroderma, however, revealed no abnormal expression of p53 [59] although Kovacs et al. [57] found a p53AAb-positive patient.
n=40 • •
I 1200
E
1 • • •
CO
CO
• •
600
'c
i •
CO
a>
'TD
o
300 c CO
o •<—•
13
<
CO
in
150
•• • X
• ! • • • • • • • •
CRC
n=16
t •
authors concluded that the complex of self and nonself triggered an immune response that subsequently was perpetuated by the nuclear self-antigen. Second, p53AAb in AID may be directed against wild-type p53 protein - no mutations were found in the p53 gene of T-cell lines established from 18 SLE patients [57]. Surprisingly, p53AAb were also detected in multiparous women [62]; the fetal p53 protein from cord blood seems to be distinct from "wild-type" p53 protein and is characterized by enhanced stability, structural differences and inability to bind DNA. The authors speculate that maternal exposure to the fetal protein may form the basis for immunologic protection against cancer induced by multiparity. Finally, among 105 controls, we found one seropositive patient (250 U/ml) who was treated just for hemorrhoids prior to testing of this elderly male, there were no indications of cancer so the humoral response may have been elicited by an asymptomatic tumor (Flammann et al., manuscript in preparation).
AID
Figure 1. Levels of p53 autoantibodies in seropositive patients with autoimmune diseases (AID) or colorectal cancer (CRC). Note: Data are plotted on a log scale. Data are from [58] and Flammann et al., manuscript in preparation.
Observed prevalences (15-35%) among patients with AID resemble those seen in various cancers [60]. Their humoral p53 response, however, is quite distinct in two aspects. First, we detected a clear difference in the order of magnitude of p53AAb levels ([58]; see Fig. 1): no patient had p53AAb levels exceeding 300 U/ml, whereas more than 60% of seropositive CRC patients had higher levels up to 1750 U/ml (Flammann et al., manuscript in preparation). Fifty percent of patients with AID showed levels <200 U/ml but only 10% of seropositive patients with CRC had levels that low. This comparison underlines the necessity of a quantitative p53AAb evaluation over a mere qualitative determination. In this context, it should be mentioned that in mice autoimmunity to the nuclear antigen p53 was found to be inducible with complexes of murine p53 protein and SV40 large T-antigen but not with either protein alone [61]. The resulting high p53AAb levels were transient but low levels persisted. Since the anti-p53 humoral response was boosted by murine p53 protein but not by the viral protein, the
4. p53 AUTOANTIBODIES IN INDIVIDUALS AT INCREASED RISK FOR CANCER HTLV-1 is the etiologic agent of the rare adult Tcell leukemia [63] and the only virus firmly linked to a human malignancy. For patients infected with this virus, low frequencies of p53AAb-positive sera were reported [64]: 2% with asymptomatic infections, 4% with a HTLV-1-associated T-cell leukemia and 6% with the virus-associated myelopathy/tropical spastic paraparesis. What causes the p53 immunogenicity in the context of a HTLV-1 infection is unclear. In analogy to the findings with adenovirus 5 or SV40transformed cells where complex formation of p53 is associated with stabilization [65, 66], elevated levels of p53 protein in HTLV-1-infected cells without a p53 mutation [67, 68] may indicate functional inactivation [67]. However, Chen at al. [64] see no diagnostic value in their finding of p53AAb in sera from HTLV1-infected patients. A hepatitis C-virus infection is a common cause for chronic liver disease and hepatocellular carcinoma (HCC). Among 147 individuals with hepatitis C, 3 out of 7 patients with confirmed HCC revealed p53AAb, but none of the 140 patients without malignancy [69]. Thus, the humoral anti-p53 response was strictly specific for the tumor.
183
Patients with chronic pancreatitis have an increased risk of developing a pancreatic carcinoma. Overexpression of p53 protein was seen in about 60% of cytological smears of pancreatic juice from these patients [70]. Eleven out of 27 specimens revealed immunoreactivity with a wild type-specific monoclonal Ab. A wild-type p53 protein was also detected in 10 out of 13 samples from pancreatic carcinomas. Some 2-5% of patients with chronic pancreatitis may develop a humoral response against the protein [71, 72]; these results, however, were not confirmed by other studies [73,74]. p53 AAb were also reported for 4 patients with Barrett's esophagus [75]. One case with dysplasia later progressed to an adenocarcinoma (see the following section). Another patient with esophagitis also developed p53AAb. The authors suggested that chronic esophagitis may constitute a condition for the development of squamous cell carcinoma in some highrisk geographic areas (Iran, China), analogous to Barrett's esophagus for an adenocarcinoma. Several subgroups of patients with colorectal diseases face an increased risk for CRC [76]. Individuals with a history of colorectal adenomas, for example, constitute such a risk group since colorectal cancer often arises within a (larger) polyp. The majority of larger or severly dysplastic adenomas show p53 immunoreactivity [77, 78] which correlates with an increased cell proliferation rate [77]. Interestingly, the accumulated p53 protein in highly dysplastic adenomas seems to represent the wild-type species [79]. The authors hypothesized that a novel mechanism affecting the regulation of p53 protein could occur in colorectal adenomas. Among more than 40 patients with colorectal adenomas we assayed for p53AAb (Flammann et al., unpublished), none was seropositive despite a significantly elevated level of pan p53 protein in 11 adenomas chosen for quantification (comparison with normal colon mucosa). Patients with inflammatory bowel disease (IBD), such as ulcerative colitis (UC) and Crohn's disease, are also prone to CRC. The strongest predisposing factor for CRC is the anatomic extent of the inflammation. The longer a patient has the disease, the greater the risk of cancer; most cancers do not occur until after 8 years of pancolitis [80]. Neoplasias arisen in UC often show p53 protein accumulation [81,82]. Recently, we tested 33 patients with IBD for p53AAb: one individual with UC, one with Crohn's disease plus one with proctitis were seropo-
184
sitive (Flammann et al., manuscript in preparation). All three individuals were inconspicuous with respect to cancer at serum sampling time. Last year, Hammel et al. [34] reported on a seropositive patient with UC who had a focal Dukes C colon cancer missed in preoperative colonoscopy. It is well documented that smokers are at a particular high risk to develop lung cancer. In one study, p53AAb were detected in 24% of sera from controls comprised of heavy smokers [83]. p53AAb in sera from these individuals may indicate occult lung malignancies as shown for another "healthy" control who died of an otherwise undetected lung cancer [84]. An occupational cancer risk exists for workers exposed to carcinogens; this exposure can provoke an antip53 humoral response (see section below). Finally, in individuals with a familial history of breast cancer, p53AAb were detected in 4 out of 36 women at risk [85].
5. p53 AUTOANTIBODIES PREDATING DIAGNOSIS OF CANCER As mentioned before, p53AAb can predate the clinical manifestation of cancer by several months or years (see Table 1). Lubin et al. [51] documented two cases of heavy smokers who showed an anti-p53 humoral response 5 and 15 months prior to lung cancer diagnosis, respectively. Likewise, four smokers with chronic obstructive pulmonary disease (COPD) developed lung, prostate or breast cancer 5 to 11 months after they tested positive for p53AAb [86]; none of the other COPD patients without a manifest cancer had p53AAb. Among workers exposed to the carcinogen vinyl chloride, 2/5 seropositive patients with angiosarcoma of the liver (ASL) revealed elevated p53 AAb 11 years or 4 months prior to ASL diagnosis; four others with p53AAb had no diagnosed tumor at that time [87]. Recently, Cawley et al. [75] reported on seropositive patients with esophageal carcinoma predated by p53AAb as well as one individual with Barrett's esophagus whose dysplasia later progressed to an adenocarcinoma. These examples clearly show that p53 AAb can be detected in individuals at high risk such as heavy smokers or workers exposed to carcinogenic chemicals and may represent a very early marker for tumorigenesis.
Table 1. Selected studies on p53 autoantibodies p53 Autoantibodies in
Incidence/cancer
Reference
Nonmalignancies
Autoimmune diseases Multiparity
Kovacs et al. [57]; Kuhn et al. [58] Yashar et al. [62]
Predating malignancy
Lung Liver Breast Prostate Esophagus Colon/rectum
Lubin et al. [51]; Trivers et al. [86]; Conrad, this volume Trivers et al. [87] Trivers et al. [86]; Lubin et al.(cited in [88]) Trivers et al. [86] Cawley et al. [75] Hammel et al. [34]
Lung Breast Ovaries Head and neck Stomach
Schlichtholz et al. [90]; Lubin et al. [51]; Zalcman et al. [88] Angelopoulou et al. [60]; Lubin et al.(cited in [88]) Angelopoulou et al. [60] Gottschlich et al. [89] Wiirl et al. [74]; Flammann et al. [97]; Kuhn et al., manuscript in preparation
Colon/rectum
Angelopoulou et al. [56]; Hammel et al. [34]; Flammann et al. [97]; Kuhn et al., manuscript in preparation
Monitoring
6. p53 AUTOANTIBODIES IN THE MONITORING OF CANCER PATIENTS As yet, only a few studies (Table 1) focused on the fate of p53AAb in the follow-up of tumor patients. In 1994, Angelopoulou et al. [60] monitored five patients with ovarian cancer and one with breast cancer and showed that temporal changes of p53AAb correlated with disease progression or regression. The authors concluded that this immunization represents a continous process driven by the tumor and is not a temporally isolated event. In a later report on another breast cancer patient, reappearance of p53AAb was observed two years after initial therapy which predated the clinical diagnosis of a relapse by three months (Lubin et al. as cited in [88]). With 17 initially seropositive head and neck cancer patients, 5/8 recurrences were accompanied by an increase in p53AAb levels [89]; levels of the three others remained unchanged as in six of nine patients without a relapse. The remaining three patients showed an increase in p53AAb without indications of a recurrence (32 months into followup). In gastric cancer, 14/15 patients with preoperative p53AAb remained seropositive after surgery; all patients died within 2-12 months [74]. Remarkably, the only patient who was seronegative after tumor resection was still alive 17 months later. All 14 patients with
persisting antibodies were diagnosed with prognostically poor tumor stage III/IV - 30% of the patients from the respective seronegative group, however, survived. For lung cancer patients, it was shown that p53AAb present at the time of carcinoma diagnosis may persist during disease progression [90]. p53AAb levels in one patient with tracheal chondromata increased over a period of 2 years concomitantiy with tumor development until clinical lung cancer diagnosis; therapeutical intervention by chemotherapy was paralleled by a sharp decrease in p53AAb [51]. The usefulness of p53AAb in trailing therapy was investigated by a study on 16 seropositive patients with inoperable lung cancer [88]. A substantial decrease in p53AAb during therapy was noted for 12 patients - four had unchanged p53AAb levels or a decrease of less than 50%. Since chemotherapy can eventually lead to (partial) immunosuppression, the authors addressed the questionable specificity of the observed p53AAb drop by simultaneous analyses of HAV antibodies. These antibodies are frequently found in the normal population and were present in all studied cancer patients at the time of diagnosis. Neither total serum immunoglobulins nor HAV antibodies changed significandy during monitoring underlining the specificity of the p53AAb changes in response to cancer treatment. The authors saw a trend toward an asso-
185
-900
E^ .•
T3 cn
-600
< o
> ^ c
1 -300
< LU
1 1F
1— 1— 100 200 300 Days after surgery
—r
^
£_
Figure 2. Follow-up on a gastric cancer patient with first-time appearance of p53 autoantibodies after tumor resection. Pre- and postoperative levels of p53 autoantibodies (closed circles), CEA (crosses) and CA242 (open circles). Cut-offs: p53AAb, 150 U/ml; CEA, 5 ng/ml; CA242, 20 U/ml. Only one postoperative serum was available. Data are from [97].
elation between p53AAb and an overall response to treatment: no responder had an unchanged p53AAb level whereas nonresponders maintained a stable level. It is noteworthy that during follow-up three complete responders relapsed without a rise in p53AAb. As an explanation for the lack of a secondary p53AAb response in two patients, the site of the metastases (brain) was suggested (immune "sanctuary"?). Just recently, however, p53AAb were detected in sera from patients with glioma [91]. Detailed as an alternative, the authors assumed that the relapses might be due to a tumoral clone retaining metastasizing or invasive potential but without a p53 mutation. We will come back to this important point later in the review. With 3 CRC patients monitored after secondary resection of liver metastases, increases of p53AAb levels were indicative for relapses [56]. In another report and after resection of primary colorectal carcinoma, 5/8 preoperatively seropositive patients showed a rapid drop of p53AAb within one month of monitoring but four of them died within a quarter of a year [34]. When the remaining four patients plus four others not monitored after one month were tested one year after surgery, three patients returned to normal p53AAb levels and three had an antibody decrease by 13-79% of the initial ratio; the latter six were all in good condition. The other two CRC patients showed persisting p53AAb and relapsed during follow-up; their temporal changes in p53 AAb levels correlated well with disease progression. The diagnosis of a perianastomosis recur-
186
rence in one patient and pulmonary metastases in the other was preceded by an elevated p53AAb level. Using a quantitative ELISA, we recently monitored patients with resected CRC and gastric carcinomas (Kuhn et al., manuscript in preparation). The majority (16/25) was pre- and postoperatively seronegative. Four of six initially seropositive patients became seronegative during follow-up (preoperatively, all four patients had fairly low antibody levels). The other two patients remained seropositive after surgery. In one case, a nine-fold increase from a rather low preoperative p53AAb level was paralleled by development of a local tumor recurrence and lung metastases. The other individual with a persistentiy high p53AAb level (> 1000 U/ml serum) was postoperatively diagnosed with liver metastases. Surprisingly, 3/19 initially seronegative patients (two CRC, one gastric carcinoma) revealed a dramatically high p53AAb level during follow-up (see example shown in Figure 2). One patient with the primary tumor in the sigmoid colon had hepatic and peritoneal metastases at the time of surgery; she developed more liver metastases later. The two other patients (CRC and gastric carcinoma) were diagnosed with anastomosis tumors 342 and 847 days after carcinoma resection. To the best of our knowledge, those three patients are the first documented cases of a postoperative development of p53AAb in initial seronegatives (see concluding section). In summary, we note that disease progression in 5/11 cases was accompanied by elevated p53AAb levels. 8 of those 11 patients were preoperatively seronegative. Among four patients showing a drop in p53-AAb levels, one individual did not receive chemotherapy. However, two of the three patients turning seropositive after surgery were chemotherapeutically treated as well as those two with persisting antibody levels. We conclude that our observations of decreases in p53AAb levels were not linked to unspecific chemotherapy-induced immunosuppression and, thus, support the recent results by Zalcman et al. [88] for lung cancer patients. Although the number of monitored patients in the reviewed studies is limited, it can be said that in > 80% of seropositive patients changes in p53AAb mirrored disease progression/regression or therapeutical intervention.
7. p53 AUTOANTIBODIES AND TUMOR MARKERS DURING MONITORING In five patients with ovarian cancer, patterns of temporal changes for the tumor marker CA125 and p53AAb were similar but with a time lag of 1-3 months for the antibody [60]; one patient with breast cancer had noninformative levels of CEA despite a significant rise in p53AAb. In 2/3 CRC patients monitored after resection of liver metastases, p53AAb and CEA showed a similar time course of changes [56]. The third patient had no pathological CEA level from the beginning. Usually, the presence of p53AAb does not correlate with the elevation of CEA, CA19-9 and CA242. Among 14 CRC patients with preoperative p53AAb, four had an elevated CEA serum concentration and three a pathological CA19-9 level [34]. With our 40 seropositive CRC patients, we found simultaneous elevation of CEA in 13 and of CA242 in 8 cases (Kuhn et al., manuscript in preparation). In two of our three initially p53 AAb-negative patients turning positive postoperatively, CEA and CA242 remained noninformative with respect to a diagnosed tumor recurrence (see Figure 2). As reported by Hammel et al. [34], CEA and CA19-9 were not elevated as well in two CRC patients with p53AAb predating a relapse. Our and other results give support to the notion that a (quantitative) p53-AAb test might supplement established tumor markers in the follow-up of cancer patient subgroups.
8. CONCLUSIONS What can be generalized about the value of p53 serology and its usefullness with respect to the p53 status in cancer patients? While mutational analysis and immunohistochemistry (IHC) require tumor specimens which may be scarce and depend on rather timeconsuming and laborious techniques, p53AAb are more readily analyzed. Additionally, p53AAb evaluation may be the only available approach during monitoring. It should be emphasized that p53 AAb represent a more global approach in the assessment of p53 alterations. IHC and gene analysis, on the other hand, can produce a wealth of information but are local analyses relying on tumor sampling. This is particularly tricky when the neoplasm is heterogenous or highly conta-
minated with normal cells. Furthermore, the precise relationship between p53 mutations and immunohistologic protein detection remains controversial. It should be cautioned against the assumption that p53 accumulation is always associated with a gene mutation [92]. Not at least technical factors influence IHC results and their interpretation [93-96]. Moreover, since epigenetic phenomena may account for a significant proportion of the IHC-positive tumors, p53 mutational analysis is not always the best approach. The obvious disadvantage of p53AAb as an acceptable tumor marker—its low sensitivity [27]—is alleviated by the expectation that it may turn out to be quantitatively useful during follow-up with some patient subgroups, particularly if established tumor markers like alphafetoprotein or CEA and/or clinical surveillance remain noninformative. Previous to our results, p53AAb did not surface during monitoring of preoperatively seronegative cancer patients [28,34,88,90]. This observation led to the assumption that each patient may have an inherent capacity to develop an anti-p53 humoral response linked to the site of a p53 mutation or MHC class [88]. We like to build on an interpretation given by Zalcman et al. [88] for p53AAb-positive lung cancer patients who developed nonimmunogenic metastases. If that seronegative relapse was due to a tumoral clone retaining its virulent potential but without any p53 mutation, than it is also feasible that a previously seronegative tumor sheds subclone cells, possibly with a lately acquired p53 mutation, that grow into metastases with p53 immunogenic potential. p53AAb in patients with AID or potentially oncogenic viral infections by HTLV-1 or HCV could open new vistas for research. With more reports on p53AAb predating a clinical diagnosis of cancer, screening for p53AAb of clearly defined groups with hereditary cancer risk or habituary/occupational exposure to hazardous substances may be well advised. Future studies with larger numbers of monitored patients have to establish the validity of the observed association between p53AAb levels and disease status. The magnitude of p53 AAb levels could turn out to be generally informative in the interpretation of a cancer-specific p53 humoral response and its differentiation from a weaker reaction as in patients with AID. We hope that the evaluation of the anti-p53 humoral response during follow-up will become another helpful tool in effective patient care.
187
ACKNOWLEDGEMENT Part of this work was supported by a grant from the Schiirfeld Foundation, Hamburg, Germany.
15. 16.
REFERENCES 17. 1. 2.
3.
4.
5.
6.
7. 8. 9.
10.
11.
12.
13.
14.
188
Lane DP. P53, guardian of the genome. Nature 1992;358:15-16. Chang F, Syrjanen S, Syrjanen K. Implication of the p53 tumor-suppressor gene in clinical oncology. J Clin Oncol 1996;13:1009-1022. Diller L, Kassel J, Nelson CE, Gryka MA, Litwak G, Gebhardt M, Bressac B, Ozturk M, Baker SJ, Vogelstein B, Friend SH. p53 funcdons as a cell cycle control protein in osteosarcomas. Mol Cell Biol 1990;10:5772-5781. Park DJ, Chumakov AM, Miller CW, Pham EY, Koeffler HP. p53 transactivation through various p53responsive elements. Mol Carcinog 1996;16:101108. Cairns CA, White RJ. p53 is a general repressor of RNA polymerase III transcripdon. EMBO J 1998;17:3112-3123. Gotz C, Montenarh M. p53: DNA damage, DNA repair and apoptosis. Rev Physiol Biochem Pharmacol 1995;127:65-95. Lane DP, Benchimol S. p53: oncogene or antioncogene. Genes Dev 1990;4:1-8 Levine AJ, Momand J, Finlay CA. The p53 tumour suppressor gene. Nature 1991;351:453^56. Shay JW, Pereira-Smith CM, Wright WE. A role for both RB and p53 in the regulation of human cellular senescence. Exp Cell Res 1991;196:33-39. Dameron KM, Volpert OV, Tainsky MA, Bouck N. Control of angiogenesis in fibroblasts by p53 regulation of thrombospondin-1. Science 1994;265:15821584. Mummenbrauer T, Janus F, Miiller B, Wiesmiiller L, Deppert W, Grosse F. p53 protein exhibits 3^ to 5^ exonuclease activity Cell 1996;85:1089-1099. Hollstein M, Sidransky D, Vogelstein B, Harris CC. p53 mutations in human cancers. Science 1991;253:49-53. Hainaut P, Hernandez T, Robinson A, RodriguezTome P, Flores T, Hollstein M, Harris CC, Montesano R. IARC database of p53 gene mutaUons in human tumors and cell lines: updated compilation, revised formats and new visualization tools. Nucleic Acids Res 1998;26:205-213. Iwamoto KS, Mizuno T, Ito T, Tsuyama N, Kyoizumi S, Seyama T. Gain-of-funcdon p53 mutations
18.
19.
20.
21.
22.
23.
24. 25.
26.
27.
28.
enhance alteration of the T-cell receptor following Xirradiadon, independently of the cell cycle and cell survival. Cancer Res 1996;56:3862-3865. Malkin D. p53 and the Li-Fraumeni syndrome. Cancer Genet Cytogenet 1993;66:83-92. Levine AJ. The p53 protein and its interacUon with the oncogene of the small DNA tumor viruses. Virology 1990;177:419-426. Hoppe-Seyler F, Butz K. Molecular mechanisms of virus-induced carcinogenesis: the interaction of viral factors with cellular tumor suppressor proteins. J Mol Med 1995;73:529-538. Shaulsky G, Goldfinger N, Tosky MS, Levine AJ, Rotter V. Nuclear localizaUon is essential for the activity of p53 protein. Oncogene 1991;6:2055-2065. Oliner JD, Pietenpol JA, Thiagalingam S, Gyuris J, Kinzler KW, Vogelstein B. Oncoprotein MDM2 conceals the activation domain of tumor suppressor p53. Nature 1993;362:857-867. Moll UM, Riou G, Levine AJ. Two distinct mechanisms alter p53 in breast cancer: Mutation and nuclear exclusion. Proc Nati Acad Sci USA 1992;89:72627266. Harris CC, Hollstein M. Clinical Implication of the p53 tumor-suppressor gene. N Engl J Med 1993;329:1318-1327. Sozzi G, Miozzo M, Donghi R, Pilotti S, Cariani CT, Pastorino U, Delia Porta G, Pierotti MA. Deletions of 17p and p53 mutations in preneoplastic lesions of the lung. Cancer Res 1992;52:6079-6082. Sozzi G, Miozzo M, Pastorino U, Pilotti S, Donghi R, Giarola M, De Gregorio L, Manenti G, Radice P, Minoletti F et al. Genetic evidence for an independent origin of multiple preneoplastic and neoplastic lung lesions. Cancer Res 1995;55:135-140. Fearon ER, Vogelstein B.A genetic model for colorectal tumorigenesis. Cell 1990;61:759-767. Baker SJ, Preisinger AC, Jessup JM, Paraskeva C, Markowitz S, Wilson JKV, Hamilton S, Vogelstein B. p53 gene mutations occur in combination with 17p allelic deletions as late events in colorectal tumorigenesis. Cancer Res 1990;50:7717-7722. Crawford LV, Pim DC, Bulbrook RD. Detection of antibodies against the cellular protein p53 in sera from patients with breast cancer. Int J Cancer 1982;30:403408. Montenarh M. Humoral immune response against p53 in human malignancies. In: Conrad K, Humbel RL, Meurer M, Shoenfeld Y, Tan, EM, editors. Pathogenic and diagnostic relevance of autoantibodies.Berlin:Pabst Science, 1998;377-394. Schlichtholz B, Legros Y, Gillet D, Gaillard C, Marty M, Lane D, Calvo F, Soussi T. The immune response to p53 in breast cancer patients is directed against im-
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
munodominant epitopes unrelated to the mutational hot spot. Cancer Res 1992;52:6380-6384. Hassapoglidou S, Diamandis EP, Sutherland DJ. Quantification of p53 protein in tumor cell lines, breast tissue extracts and serum with time-resolved immunofluorometry. Oncogene 1994;8:15011509. Lubin R, Schlichtholz B, Teillaud JL, Garay E, Bussel A, Wild CP, Soussi T. p53 antibodies in patients with various types of cancer: assay, identification, and characterization. Clin Cancer Res 1995;1:1463-1469. Bourdo JC, D'Errico A, Paterlini P, Grigioni W. May E, Debuire B. p53 protein accumulation in European hepatocellular carcinoma is not always dependent on p53 mutation. Gastroenterology 1995;108:11761182. Preudhomme C, Lubin R, Lepelley P, Vanrumbeke M, Fenaux P. Detection of serum anti-p53 antibodies and their correlation with p53 mutations in myelodysplastic syndromes and acute myeloid leukemia. Leukemia 1994;8:1589-1591. Wild CP, Ridanpaa M, Anttila S, Lubin R, Soussi T, Husgafvel-Fursiainen K, Vanino H. p53 antibodies in the sera of lung cancer patients: comparison with p53 mutations in the tumour tissue. Int J Cancer 1995;64:176-181. Hammel P, Boissier B, Chaumette MT, Piedbois P, Rotman N, Kouyoumdjian JC, Lubin R, Delchier JC, Soussi T. Detection and monitoring of serum p53 antibodies in patients with colorectal cancer. Gut 1997;40:365-361. Montenarh M, Harlozinska A, Bar JK, Kartarius S, Gunther J, Sedlaczek P. p53 autoantibodies in the sera, cyst and ascitic fluids of patients with ovarian cancer. Int J Oncol 1998;13:605-610. Davidoff AM, Iglehart JD, Marks JR. Immune response to p53 is dependent upon p53/HSP70 complexes in breast cancers. Proc Natl Acad Sci 1992;89:3439-3442. Guinee Jr, DG, Travis WD, Trivers GE, De Benedetti VMG, Cawley H, Welsh JA, Benett WP, Jett J, Colby TV, Tazelaar H, Abbondanzo SL, Pairolero P, Trastek V, Caporaso NE, Liotta LA, Harris CC. Gender comparisons in human lung cancer: analysis of p53 mutations, anti-p53 serum antibodies, and C-erb B-2 expression. Carcinogenesis 1995;16:993-1002. Winter SF, Minna JD, Johnson BE, Takahashi T, Gazdar AF, Carbone DP. Development of antibodies against p53 in lung cancer patients appears to be dependent on the type of p53 mutation. Cancer Resl992;52:4168-4174. Labrecque S, Naor N, Thomson D, Matlashewski G. Analysis of the anti-p53 antibody response in cancer patients. Cancer Resl993;53:3468-3471.
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
Legros Y, Lafon C, Soussi T. Linear antigenic sites defined by the B-cell response to human p53 are localized predominantly in the amino and carboxy-termini of the protein. Oncogene 1994;9:2071-2076. Lubin R, Schlichtholz B, Bengoufa D, Zalcman G, Tredaniel J, Hirsch A, Caron de Fromentel CC, Preudhomme C, Fenaux P, Fournier G, Mangin P, LaurentPuigP, Pelletier G, Schlumberger M, Desgrandchamps F, Le Due A, Peyrat JP, Janin N, Bressac B, Soussi T. Analysis of p53 antibodies in patients with various cancers define B-cell epitopes of human p53: distribution on primary structure and exposure on protein surface. Cancer Res 1993;53:5872-5876. Brennan JA, Boyle JO, Koch WM, Goodman SN, Hruban RH, Eby YJ, Couch MJ, Forastiere AA, Sidranksi D. Association between cigarette smoking and mutation of the p53 gene in squamous-cell carcinoma of the head and neck. N Engl J Med 1995;332:712-717. Boyle JO, Hakim J, Koch W, Van der Riet P, Hruban RH, Roa RA, Correro R, Eby YJ, Ruppert JM, Sidranski D. The incidence of p53 mutations increases with progression of head and neck cancer. Cancer Res 1993;53:4477-4480. Ahomadegbe JC, Barrois M, Fogel S, Le Bihan ML, Douc-Rasy S, Duvillard P, Armand JP, Riou G. High incidence of p53 alterations (mutation, deletion, overexpression) in head and neck primary tumors and metastases; Absence of correlation with clinical outcome. Frequent protein over-expression in normal epithelium and in early non-invasive lesions. Oncogene 1995;10:1217-1227. Bourhis J, Bosq J, Wilson GD, Bressac B, Talbot M, Leridant AM, Dendale R, Janin N, Armand JP, Luboinski B, Malaise EP, Wibault P, Eschwege F. Correlation between p53 gene expression and tumorcell proliferation in oropharyngeal cancer. Int J Cancer 1994;57:458-462. Bosari S, Viale G, RoncaUi M, Graziani D, Borsani G, Lee AKC, Coggi G. p53 mutations, p53 protein accumulation and compartimentalization in colorectal adenocarcinoma. Am J Pathol 1995;147:790-798. Cripps KJ, Purdie CA, Carder PJ, White S, Komine K, Bird CC, Wyllie AH. A study of stabilization of p53 protein versus point mutation in colorectal carcinoma. Oncogene 1994;9:2739-2743. Hamelin R, Laurent-Puig P, Olschwang S, Jego N, Asselain B, Remvikos Y, Girodet J, Salmon RJ, Thomas G. Association of p53 mutations with short survival in colorectal cancer. Gastroenterology 1994; 106:4248. Goh HS, Yao J, Smith DR. p53 point mutation and survival in colorectal cancer patients. Cancer Res 1995;55:5217-5221.
189
50.
51.
52.
53.
54.
55.
56.
57.
58.
59.
60.
61.
62.
190
Smith DR, Ji CY, Goh HS. Prognostic significance and mutation in colorectal adenocarcinoma. Br J Cancer 1996;74:216-223. Lubin R, Zalcman G, Bouchet L, Tredaniel J, Legros Y, Cazais D, Hirsch A, Soussi T. Serum p53 antibodies as early markers of lung cancer. Nature Med 1995;1:701-702. Winter SF, Sekido Y, Minna JD, Mclntire D, Johnson BE, Gazdar AF Carbone DR Antibodies against autologous tumour cell proteins in patients with smallcell lung cancer: Association with improved survival. JNCI 1993;85:2012-2018. Peyrat JP, Bonneterre J, Lubin R, Vanlemmens L, Fournier J, Soussi T. Prognostic significance of circulating antibodies in patients undergoing surgery for locoregional breast cancer. The Lancet 1995;345:621622. Houbiers JGA, van der Burg SH, van de Watering LMG, ToUenaar RAEM, Brand A, van de Velde CJH, Melief CJM. Antibodies against p53 are associated with poor prognosis of colorectal cancer. Br J Cancer 1995;72:637-641. Kressner U, GHmehus B, Bergstrom R, Pahlman L, Larsson A, Lindmark G. Increased serum p53 antibody levels indicate poor prognosis in patients with colorectal cancer. Br J Cancer 1998; 77:1846-1851. Angelopoulou K, Stratis M, Diamandis E. Humoral immune response against p53 protein in patients with colorectal carcinoma. Int J Cancer 1997;70:46-51. Kovacs B, Patel A, Hershey JN, Dennis GJ, Kirschfink M, Tsokos GC. Antibodies against p53 in sera from patients with systemic lupus erythematosus and other rheumatic diseases. Arthritis Rheum 1997;40:980982. Kuhn HM, Kromminga A, Flammann HT, Frey M, Layer P, Arndt R. p53 autoantibodies in autoimmune diseases. In: Conrad K, Humbel RL, Meurer M, Shoenfeld Y, Tan, EM, editors. Pathogenic and diagnostic relevance of autoantibodies.Berlin:Pabst Science, 1998;422-423. Chung JH, Kwon OS, Eun HC, Youn JI, Song YW, Kim JG, Cho KH. Apoptosis in the pathogenesis of cutaneous lupus erythematosus. Am J Dermatopathol 1998;20:233-241. Angelopoulou K, Diamandis EP, Sutherland DJA, Kellen JA, Bunting PS. Prevalence of serum antibodies against the p53 tumour gene protein in variuos cancers. Int J Cancer 1994;58:480-487. Dong X, Hamilton KJ, Satoh M, Wang J, Reeves WH. Initiation of autoimmunity to the tumor suppressor protein by complexes of p53 and SV40 large T antigen. J Exp Med 1994;179:1243-1252. Yashar CM, Gercel-Taylor C, Gibb RK, Weeks JW, Taylor DD. Identification of a unique form of p53 in
63.
64.
65.
66. 67.
68.
69.
70.
71.
72.
73.
74.
human cord blood associated with the development of maternal autoantibodies. Am J Reprod Immunol 1998;39:368-375. Blattner WA. Human retroviruses and malignancy. In: Brugge J, Curran T, Harlow E, McCormick F, editors. Origins of human cancer: a comprehensive review. Cold Spring Harbor:Cold Spring Harbor Laboratory Press, 1991; 199-209. Chen YMA, Chen SH, Fu CY, Chen JY, Osame M. Antibody reactivities to tumor-suppressor protein p53 and HTLV-1 Tof, Rex and Tax in HTLV-1-infected people with differing cHnical status. Int J Cancer 1997;71:196-202. Ludlow JW. Interactions between SV40 large tumor antigen and the growth suppressor proteins Rb and p53. FASEB J 1993;7:866-871. Moran E. Interaction of adenoviral proteins with pRb and p53. FASEB J 1993;7:880-885. Reid RL, Lindholm PF, Mireskandari A, Dittmer J, Brady JN. Stabilization of wild-type p53 in human T-lymphocytes transformed by HTLV-1. Oncogene 1993;8:3029-3036. Yamato K, Oka T, Hiroi M, Iwahara Y, Sugito S, Tsuchida N, Miyoshi I. Aberrant expression of the p53 tumor suppressor gene in adult T-cell leukemia and HTLV-1-infected cells. Jpn J Cancer Res 1993;84:4-8. Raedle J, Roth WK, Oremek G, Caspary WF, Zeuzem S. Alpha-fetoprotein and p53 autoantibodies in patients with chronic hepatitis C. Dig Dis Sci 1995;40:2587-2594. Maacke H, Kessler A, Schmiegel W, Roeder C, Vogel I, Deppert W, Kalthoff H. Overexpression of p53 protein during pancreatitis. Br J Cancer 1997;75:15011504. Gansauge S, Gansauge F, Negri G, Galle P, Miiller J, Nussler AK, Poch B, Beger HG. The role of anti-p53 autoantibodies in pancreatic disorders. Int J Pancreatol 1996;19:171-178. Marxsen J, Schmiegel W, Roder C, Harder R, Juhl H, Hanne-Bruhns D, Kremer B, Kalthoff H. Detection of the anti-p53 antibody response in malignant and benign pancreatic disease. Br J Cancer 1994;70:10311034. Laurent-Puig P, Lubin R, Semhoun-Ducloux S, Pelletier G, Fourre C, Ducreux M, Briantais MJ, Buffet C, Soussi T. Antibodies against p53 protein in serum of patients with benign or malignant pancreatic and biliary diseases. Gut 1995;36:455^58. Wurl P, Weigmann F, Meye A, Fittkau M, Rose U, Berger D, Rath FW, Dralle H, Taubert H. Detection of p53 autoantibodies in sera of gastric cancer patients and their prognostic relevance. Scand J Gastroenterol 1997;32:1147-1151.
75.
76.
77.
78.
79.
80.
81.
82. 83.
84.
85.
86.
Cawley HM, Meltzer S, De Benedetti, Hollstein MC, Muehlbauer KR, Liang L, Bennett WP, Souza RF, Greenwald BD, Cottrell J, Salabes A, Bartsch H, Trivers GE. Anti-p53 antibodies in patients with Barrett's esophagus or esophageal carcinoma can predate cancer diagnosis. Gastroenterology 1998;115:1927. Winawer SJ, Fletcher RH, Miller L, Godlee F, Stolar MH, Mulrow CD, Woolf SH, Glick SN, Ganiats TG, Bond JH, Rosen L, Zapka JG, Olsen SJ, Giardiello FM, Sisk JE, Van Antwerp R, Brown-Davis C, Marciniak DA, Mayer RJ. Colorectal cancer screening: clinical guidelines and rationale. Gastroenterology 1997;112:594-642. Pignatelli M, Stamp GWH, Kafiri G, Lane D, Bodmer WF. Over-expression of p53 nuclear oncoprotein in colorectal adenomas. Int J Cancer 1992;50:683-688. Sinicrope FA, Ruan SB, Cleary KR, Stephens LC, Lee JJ, Levin B. bcl-2 and p53 oncoprotein expression during colorectal tumorigenesis. Cancer Res 1995;55:237-241. Tominaga O, Hamelin R, Trouvat V, Salmon RJ, Lesec G, Thomas G, Remvikos Y. Frequently elevated content of immunochemically defined wildtype p53 protein in colorectal adenomas. Oncogene 1993;8:2653-2658. Manning AP, Bilgim OR, Dixon MF, Axon AT. Screening by colonoscopy for colonic epithelial dysplasia in inflammatory bowel disease. Gut 1987;28:1489-1494. Harpaz N, Peck AL, Yin J, Fiel I, Hontanosas M. p53 protein expression in ulcerative colitis-associated colorectal dysplasia and carcinoma. Hum Pathol 1994;25:1069-1074. Ilyas M, Talbot IC. p53 expression in ulcerative colitis: a longitudinal study. Gut 1995;37:802-804. Wollenberg B, Jan NV, Pitzke P, Reiter W, Stieber R Anti-p53 antibodies in serum of smokers and head and neck cancer patients. Anticancer Res 1997; 17:413418. Lang C, Unteregger G, Montenarh M, Zwergel T. p53 autoantibodies in patients with urological tumors. In: Conrad K, Humbel RL, Meurer M, Shoenfeld Y, Tan, EM, editors. Pathogenic and diagnostic relevance of autoantibodies.BerUn:Pabst Science, 1998;417. Green JA, Mudenda B, Jenkins J, Leinster SJ, Tarunina M, Green B, Robertson L. Serum p53 autoantibodies: Incidence in familial breast cancer. Eur J Cancer [A] 1994;30A:580-584. Trivers GE, De Benedetti VMG, Cawley HL, Caron G, Harrington AM, Bennett WP, Jett JR, Colby TV,
87.
88.
89.
90.
91.
92.
93.
94.
95. 96.
97.
Tazelaar H, Pairolero P, Miller RD, Harris CC. Antip53 antibodies in sera from patients with chronic obstructive pulmonary disease can predate a diagnosis of cancer. CUn Cancer Res 1996;2:1767-1775. Trivers GE, Cawley HL, De Benedetti VMG, Hollstein M, Marion MJ, Benett WP, Hoover ML, Prives CC, Tamburro CC, Harris CC. Anti-p53 antibodies in sera of workers occupationally exposed to vinyl chloride. JNCI 1995;87:1400-1407. Zalcman G, Schlichthol B, Tredaniel J, Urban T, Lubin R, Dubois I, Milleron B, Hirsch A, Soussi T. Monitoring of p53 autoantibodies in lung cancer durin therapy: relationship to response to treatment. Clin Cancer Res 1998;4:1359-1366. Gottschlich S, Maass JD, Hoffmann M, HoffmannFazel A, Werner JA, Rudert H. p53 serum antibodies as tumor marker in head and neck cancer? In: Conrad K, Humbel RL, Meurer M, Shoenfeld Y, Tan, EM, editors. Pathogenic and diagnostic relevance of autoantibodies. Berlin:Pabst Science, 1998;419. Schlichtholz B, Tredaniel J, Lubin R, Zalcman G, Hirsch A, Soussi T. Analysis of p53 autoantibodies in sera of patients with lung carcinoma define immunodominant regions in the p53 protein. Br J Cancer 1994;69:809-816. Weller M, Bornemann A, Stander M, Schabet M, Dichgans J, Meyermann R. Humoral immune response in malignant glioma. J Neurol 1998;245;169172. Dix B, Robbins P, Carrello S, House A, lacopetta B. Comparison of p53 gene mutation and protein overexpression in colorectal carcinomas. Br J Cancer 1994;70:585-590. Wynford-Thomas D. p53 in tumour pathology: can we trust immunocytochemistry? J Pathol 1992; 166:329330. Hall PA, Lane DP. p53 in tumour pathology: can we trust immunohistochemistry?-Revisited! J Pathol 1994;172:1-4. Battifora H. p53 Immunohistochemistry: a word of caution. Human Pathol 1994; 25:435-436. Bosari S, Viale G. The clinical significance of p53 aberrations in human tumours. Virchows Arch 1995;427:229-241. Flammann HT, Kuhn HM, Weinland G, Fibbe C, Arndt R, Frenzel H, Layer P. Postoperative p53 autoantibodies in patients with gastric or colon carcinoma seronegative at the time of tumor resection. In: Conrad K, Humbel RL, Meurer M, Shoenfeld Y, Tan, EM, editors. Pathogenic and diagnostic relevance of autoantibodies. Berlin:Pabst Science, 1998;420-42L
191
© 2000 Elsevier Science B. V. All rights reserved. Cancer and Autoimmunity Y. Shoenfeld and M. E. Gershwin, editors
Humoral Immune Response Against the Growth Suppressor p53 in Human Malignancies Mathias Montenarh Universitdt des Saarlandes, Homburg, Germany
1. INTRODUCTION Since 1979, when p53 was discovered as a tumorassociated antigen, it has attracted an enormous number of scientists in several fields. p53 has since been revealed to be a multifaceted protein functioning as a transcriptional transactivator or repressor, as a key molecule in DNA repair, apoptosis, growth suppression, differentiation, senescence, control of angiogenesis and mitotic spindle function [1-4]. p53 seems to have a singular position among the class of growth suppressor genes because it is inactivated with a high frequency in most types of human cancers [5]. p53 seems to prevent cells from developing into cancerous cells and, therefore, it was regarded as the "guardian of the genome" [6]. Beside the inactivation of p53 in somatic cells, individuals with germline mutations were also found who were of high risk to develop cancer [7]. A steadily increasing number of papers revealed that in many cases alterations in the p53 gene or protein were found to be predictive factors for tumor formation and an unfavorable prognosis. Unusual forms of p53 are associated with aggressive tumors, early metastasis and low 5-years survival rates. Therefore, changes in the p53 gene, protein expression or protein modification as well as different subcellular localizations of the p53 protein were used in clinical oncology for early diagnosis, for prognostic evaluation, to trail treatment of individual patients and to assess the response to therapy [8]. The analysis of p53 gene alterations or p53 protein modifications requires tumor material and a variety of skilful techniques and, therefore, these types of analysis are inadequate for the individual patient or for medical-care people. In 1982, p53 autoantibod-
ies were discovered in sera of breast cancer patients [9]. The following articles then described detectable levels of p53 autoantibodies in sera from a variety of other cancer patients [10, 11]. Analyzing a great number of sera it was shown that p53 autoantibodies are very rare in healthy donors (<0.5%). These early findings suggested that the serological search for antibodies against the p53 protein may help to improve the diagnosis of malignant neoplasia, without invasive treatment of patients.
2. MOLECULAR BASIS FOR THE IMMUNE RESPONSE AGAINST p53 So far, it is unclear what triggers an immune response to p53. The most frequent alterations in human tumors are point mutations in the p53 gene, although also wild-type p53 was found in a number of tumor cells. However, mutant and wild-type p53 in tumor cells in general exhibit a prolonged half-life accounting for the accumulation of the protein in tumor cells. Most patients with p53 autoantibodies exhibit an accumulation of the p53 protein in the tumor material suggesting that elevated levels of the p53 protein may account for the generation of an immune response against p53. However, there are also observations that patients may develop antibodies against p53 without an overexpression of the protein in the corresponding tumor material [12, 13]. It has been suggested that the site of mutation within the p53 gene may be a determinant for the p53 autoantibody response [1416]. However, such a correlation was not found in other studies [15, 17]. The site of mutation is not
193
expected to influence the antibody response against p53 because the immunogenic sites of the p53 molecule reside in the amino-terminal and more weakly in the carboxy-terminal part of the p53 polypeptide chain [18, 19]. These two regions are unaffected by mutations in human tumors [18, 20]. Furthermore, human sera react equally with mutant and wild-type p53 and with conformational and denaturation resistant antigenic epitopes [10, 14, 21]. Another study connects the immunogenicity of p53 to its ability to form complexes with the heat shock protein HSP70 [16], because co-immunoprecipitation experiments showed that tumor tissue from patients with circulating antibodies contained hsp70/p53 complexes, whereas, no such complexes were found in tissue from patients without p53 autoantibodies [22-24]. Typing of p53 autoantibodies revealed that they correspond mainly to IgGl and IgG2 subclasses, but some patients exhibit a predominant IgA response. In addition, primary cytotoxic T-lymphocyte responses to wild-type and mutant peptides of p53 in vitro and in a mouse model were described.
3. METHODS TO DETECT p53 AUTOANTIBODIES A variety of different methods were applied to detect p53 autoantibodies. Early studies on p53 autoantibodies used radioactively labeled p53 from cell extracts which was immunoprecipitated with sera from patients, run on a gel under denaturing conditions and positive sera were detected by autoradiography [9,16]. Alternatively, monoclonal antibodies against p53 were used to precipitate p53 from tumor cell extracts, run on a gel under denaturing conditions and the patients' sera were used in a Western Blot analysis [11]. In the last 6 years, ELISAs were developed which allow a rapid and highly sensitive screening of large numbers of sera. The ELISAs differ in as much as bacterially expressed, p53 synthetic peptides consisting of 15 amino acids, p53 from insect cells infected with recombinant baculoviruses or p53 from human tumor cells were used. Comparing some of these different methods within the same study it turned out that most but not all sera were positive with at least three different methods [25, 26]. However, some sera were negative in one type of ELISA and positive in another, and either negative or positive in Western Blot
194
analysis. The conclusion of one of these studies was that using different assay systems and taking multiple blood samples from the same patient helps to optimize the detection of p53 autoantibodies [26].
4. p53 AUTOANTIBODIES AND THE DETECTION OF A MALIGNANT DISEASE From all the reports on p53 autoantibodies it seems to come up that p53 autoantibodies are in general associated with a malignant disease, whereas, healthy blood donors are rarely positive for p53 autoantibodies. Two individuals were found to express p53 autoantibodies although no tumor was detected. Both individuals were heavy smokers and diagnosed for chronic cough or a benign obstructive tracheal tumor. Both developed lung cancer within 5 or 15 months, respectively [27]. In a study of patients with prostate carcinoma, a "healthy" control patient was also positive for p53 autoantibodies [28]. Later, it turned out that this patient died from an undetected lung cancer. Thus, these studies might indicate that p53 autoantibodies may be early markers for malignancy and that this type of analysis allows for the detection of an unknown cancerous malignancies. However, there are also reports that p53 autoantibodies were found in patients with nontumorous diseases such as autoimmune diseases. p53 autoantibodies were found in 32% of patients with systemic lupus erythematosus (SLE) in 15% of nonSLE control patients but in none of the healthy control sera [29]. Out of the non-SLE antibody-positive sera, two were from patients with Sjogren's syndrome and one from a patient with systemic sclerosis. It is interesting to note that this study was performed with an ELISA and the data were confirmed by Western Blot analysis. Furthermore, it turned out that p53 from T cells established from SLE patients was wild-type as detected by sequencing. People infected with viruses were also analyzed for the presence of p53 autoantibodies. It was found that 2% of asymtomatic HTLV-I infected individuals, 4% of HTLV-I-associated T-cell leukemia and 6% of HTLV-I-associated myelopathy/tropical spastic paraparesis patients carried antibodies against p53. However, the low number of positive case might indicate that p53 autoantibodies are not a useful serological marker for the analysis of HTLV-I infected individuals [30]. p53 autoantibodies were described to be present
in patients with a hepatocellular carcinoma [31-33]. Since at least in Western countries a hepatitis C virus infection is the major etiologic agent in the development of hepatocellular carcinomas (HCC) one might be interested to analyze whether, or not, p53 autoantibodies might be already present in hepatitis C virus infected individuals. Raedle et al. [34] found that the sensitivity to detect hepatitis C virus infected patients with hepatocellular carcinoma was about 43% and that the immune response against p53 was highly specific (100%) for a malignancy [34]. p53 autoantibodies were also detected although with a low frequency (4%) in patients with chronic liver diseases and in patients with liver cirrhosis. All of these patients were free of a hepatocellular carcinoma and they were carefully investigated for another underlying maUgnancy which was not found. Thus, these results might suggest that p53 autoantibodies are not exclusively detectable in patients with a malignant disease [35]. Unexpectedly, p53 autoantibodies were also found in multiparous women. However, there is ample evidence that the fetal p53 protein is distinct from wild-type p53 because it exhibits enhanced stability, structurally differences and it is unable to bind DNA and these features may be responsible for the immune response of the mother against the fetal p53 protein [36]. In a study of patients with pancreatic diseases, p53 autoantibodies were also found in individuals with benign pancreatic disease [37]. These patients had a long history of chronic pancreatitis. Other authors found that none of the patients with chronic pancreatitis were positive for p53 autoantibodies. In the course of the later study the serum from one patient with a stone in the common bile duct was found to have p53 autoantibodies. The relevance of this observation is unclear. This finding may be explained by the presence of an undetected other malignant disease or it may be an early marker for malignancy as it may be the case for lung cancer [27, 39]. Since the presence of p53 autoantibodies may help to detect an otherwise undetected cancerous malignancy or be an early marker for the development of cancer, it seems to be attractive to screen individuals occupationally exposed to carcinogens for the presence of p53 autoantibodies. Angiosarcoma of the liver (ASL) is a rare cancer in humans, except in instances of exposure to carcinogens. Molecular epidemiology
studies of vinyl chloride exposed workers found p53 mutations in liver tissue of ASL patients. Using an enzyme linked immunoassay 9 out of 92 individuals were found to have p53 autoantibodies. Among these 9 individuals, 5 had already developed angiosarcoma of the liver, whereas 4 had no clinically evident cancer. In one case the person had p53 autoantibodies 11 years in another case 4 months before the diagnosis of ASL. Thus, p53 autoantibodies can predate cHnical diagnosis of ASL and may be useful in identifying individuals at high cancer risks. In addition to these studies there is some indication that the presence of p53 autoantibodies can predate the clinical diagnosis of esophageal cancer although these patients might be classified as healthy individuals according to conventional diagnosis [26].
5. FREQUENCY OF p53 AUTOANTIBODIES IN SERA OF PATIENTS WITH DIFFERENT CANCERS Studying sera from patients with various cancers revealed that p53 autoantibodies were found with high frequency in patients with solid tumors and with reduced rates in patients with tumors of the lymphatic system. Moreover, in initial studies it was shown that lung and pancreas carcinoma patients have high incidences for p53 autoantibodies. These two cancer types are known to have a high frequency for p53 gene mutation. Low incidences for p53 autoantibodies were found for patients with leukemia and prostate carcinoma, cancers where mutations in the p53 gene are rare. Meanwhile patients with a lot more tumor types were analyzed for the presence of p53 autoantibodies and the correlation between the presence of p53 autoantibodies and p53 gene mutation is not that strict. Table 1 shows the frequency of p53 autoantibodies found in patients with different tumor entities. Between 8-40% of lung cancer patients, 16-25% of patients with colorectal cancer, 6-27% of patients with pancreas carcinoma, 25-36% patients with hepatocellular carcinoma, 17-44% of patients with head and neck cancer, 9-26% of breast cancer patients and 11-41% of patients with ovarian cancer have p53 autoantibodies. Low incidences for p53 autoantibodies were found for patients with leukemia [63], nonHodgkin's lymphoma and multiple myeloma [81], for prostate carcinoma and for patients with endometrial
195
Table 1. Frequency of p53 autoantibodies in patients with different tumor entities Cancer
p53 autoantibodies (%)
Ref.
Lung Lung (not specified) SCLC SCLC SCLC SCLC NSCLC NSCLC NSCLC NSCLC NSCLC NSCLC NSCLC Colorectal Colorectal Colorectal Colorectal Colorectal Colorectal Pancreas carcinoma Pancreas carcinoma Pancreas carcinoma Biliary tract Hepatocellular carcinoma Hepatocellular carcinoma Hepatocellular carcinoma Hepatocellular carcinoma Hepatocellular carcinoma Head and neck Head and neck Head and neck Head and neck head and neck Head and neck Head and neck Head and neck Head and neck Head and neck Angiosarcoma of the liver B-cell lymphoma MDS-AML AML Leukemia Mamma carcinoma Mamma carcinoma Mamma carcinoma Mamma carcinoma Mamma carcinoma
10 8 10 16 40 14 21 33 16 15 12 27 12 16 24 26 23 68 25 6 27 16 15 36 25 13 43 22 19 17 44 23 38 20 22 27 22 44 10 21 2 10 3 12 11 25 26 14
[41] [15] [14] [42] [25] [17] [43] [14] [25]
196
[17] [46] [44] [45] [46] [47] [48] [49] [50] [51] [39] [38] [37] [38] [32] [31] [52] [34] [35] [53] [54] [55] [56] [57]^ [58] [59] [60] [61] [62] [40] [11] [63] [63] [63] [64] [16] [65] [66] [18]
Table 1. (continued) Cancer
p53 autoantibodies (%)
Ref.
Mamma carcinoma Mamma carcinoma Mamma carcinoma Mamma carcinoma Mamma carcinoma Ovarian carcinoma Ovarian carcinoma Ovarian carcinoma Ovarian carcinoma Ovarian carcinoma Ovarian carcinoma Ovarian carcinoma Ovarian carcinoma Esophageal Esophageal Esophageal Endometrium carcinoma Zollinger-Ellison syndrome
9 10 21 14 17 11 24 29 33 9 9 15-20 41 25 25 33 7 16 14 20 3
[9] [46] [67] [68] [47] [46] [69] [70] [71] [72] [13] [73] [74] [75] [76] [26] [77] [78] [79] [80] [28]
Glioma Gastric Prostate carcinoma 'Only smokers.
cancer [77]. The low incidence of p53 autoantibodies in patients with these malignancies seems to suggest that the serum assay for these autoantibodies has a limited clinical relevance in the management of this malignancy. It seems to be very confusing that there is such an enormous range in the percentage of positive sera found for the same type of tumor. These variations may reflect the different methods used for the detection of p53 autoantibodies but also a selection of patients might be responsible for these variations. Moreover, there are also controversies about the specificity of p53 autoantibodies for the same types of tumors. In an early study of sera from lung cancer patients a higher percentage of positive sera were found for patients with nonsmall cell lung cancer cell (NSCLC) than for small-cell lung cancer cells (SCLC) [14]. Using two different types of ELISAs other authors found just the opposite result [25]. The earliest study engaged in analyzing the immunogenic status of breast cancer patients stems from Crawford et al. [9]. They found 9% of the patients with breast cancer positive for p53 autoantibodies by using immunoprecipitation techniques. By using
ELISA techniques in a number of more recent studies the percentage of positive sera is fluctuating in a wide range from 3% in patients with nonmetastasizing breast cancer to over 50% in patients with metastasizing cancer [82]. Starting from a unselected population of patients other authors found a range from 10 to 25% of patients positive for p53 autoantibodies [16, 18, 46, 64-66], which might again reflect that the selection of patients but also the used techniques to detect p53 autoantibodies might be responsible for these variations. In many malignancies, reactive lymphocytes can be found in close contact with tumor cells and therefore it was an interesting question as to whether, or not, the formation of ascites or pleural effusion in patients with advanced malignancies would lead to a higher incidence of the antibody response against p53. The analysis of the ascites and pleural effusions of 40 patients with advanced malignancies revealed that 12% individuals had p53 autoantibodies, whereas, none of the control group had p53 autoantibodies [83]. There was neither a correlation with a particular type of tumor nor a correlation with the presence of tumor cells in the effusions [73]. A very recent study showed that p53 autoantibodies were simultaneously present in the sera, ascites and cyst fluids of patients with ovarian cancer [13]. Therefore, there seems to be no advantage to analyze ascites, pleural effusions or cyst fluids for the presence of p53 autoantibodies. p53 autoantibodies can also be detected in sera and in saliva of patients with squamous-cell carcinoma of the oral cavity [84]. High incidences for squamous-cell carcinoma of the oral cavity were found in southern Asia where high rates of betel and tobacco chewing are very frequent. In these cases it might be useful to screen saliva samples for p53 autoantibodies.
6. p53 AUTOANTIBODIES AS A DIAGNOSTIC TOOL The diagnostic value of analyzing patients for the presence of p53 autoantibodies is obvious in malignancies which are usually detected at late stages of the disease by using conventional methods. This is shown for lung cancer, where the mortality is higher than 90% and therapeutic results are often disappointing. Screening individuals for lung cancer by chest radiography has
not resulted in a reduction in lung cancer mortality and therefore the analysis of p53 autoantibodies might be useful for early detection of lung cancer. Also the diagnosis of pancreatic tumor is very difficult and only successful at late stages of the disease and therefore despite improved diagnosis and therapy patients with pancreas carcinomas still have a very poor prognosis. Therefore, also in this case the analysis of p53 autoantibodies might be a useful marker for pancreatic cancer. The hepatocellular carcinoma is one of the most common tumors in the world. Risk factors are aflatoxin Bl exposure in Africa and Asia and chronic HBV infection in nearly all countries. Patients with this disease have a bad prognosis and the detection of this tumor by markers such as of-fetoprotein or by computer tomography is poor. According to all studies with hepatocellular carcinomas the humoral response to p53 is clearly independent of the o?-fetoprotein status. Of-fetoprotein is more likely to be positive in large tumors, whereas, antibodies against p53 are detectable in patients with small hepatocellular carcinomas [33, 52]. Thus, in some cases the determination of p53 autoantibodies seems to give an additional information and therefore seems to be of diagnostic value. However, since p53 autoantibodies are not specific for a particular disease further diagnostic tools have to be applied. The clinical significance of p53 gene alterations is controversial. Some groups found that p53 mutations are associated with a shorter relapse-free and overall survival [85-88], whereas, other studies have not found an association between p53 mutation, protein accumulation and poor clinical outcome [89-93]. The prognostic value of p53 autoantibodies seems to depend on the tumor type. It is controversial whether the level of p53 autoantibodies can be used to trail treatment of lung cancer patients [15, 25, 41]. In one study it was shown that p53 autoantibodies were present at diagnosis and persist during progression of the disease [25]. In addition, 5 lung cancer patients who were negative for p53 autoantibodies did not develop p53 autoantibodies during tumor progression. In another study it was shown that the level of p53 antibodies decreased in response to radiological treatment, and the level remained low for more than 8 months after the end of treatment. However, one reported case is not enough to draw any convincing conclusion. In the case of ovarian cancer the incidence of serum antibodies was statistically significantly lower in patients
197
with complete remission as compared to those with recurrence and before surgery [74]. Analyzing multiple serum samples from the same patient at different times during the course of the disease, Angelopoulou et al. [69] found changes only in the concentration of the p53 autoantibodies indicating that p53 autoantibodies were stable for along period of time. By a recently developed quantitative ELISA analysis it was shown that 12 out of 16 patients had reduced p53 autoantibody titers during chemotherapy, which led to a partial or complete remission of the disease [41]. With this type of analysis it may be possible to use the p53 autoantibody titer for checking the response to therapy and probably for monitoring some relapses before they are clinically detectable.
7. p53 AUTOANTIBODIES AND PROGNOSIS There is one observation that patients with small-cell lung carcinoma and with nonsmall lung carcinoma who had antibodies against p53 had an improved survival compared to those in the antibody negative group [44, 94]. In the case of nonsmall-cell lung carcinoma where the diagnosis of p53 autoantibodies was made before radiotherapy it turned out that the antibody positive patients had a significantly good prognosis for an increased survival [44]. Similar results were also reported for patients with pancreas carcinoma. Gansauge et al. [37] showed that patients with stage III tumors and p53 autoantibodies had a prolonged survival rate compared to patients without p53 autoantibodies. Also patients with metastasizing mamma carcinoma and p53 autoantibodies were reported to have longer survival rates compared to individuals without p53 autoantibodies [82]. A quite distinct conclusion was drawn by Rosenfeld et al. [42] who found that the presence of anti-p53 autoantibodies in the sera of patients with SCLC was not associated with any clinical characteristics or prognostic markers. In a recent study, neither p53 autoantibodies nor the overexpression of the p53 protein was found to be a prognostic factor for patients with NSCLC, whereas, the combination of both parameters proved to be prognostic factors for a short survival [45]. A recent study showed no significant differences in the level of p53 autoantibodies by sex, age, smoking index and disease stage for lung cancer patients [95]. This controversy in the correlation of p53 autoantibody status and prognosis
198
might be due to the extremely different selection of patients for these studies. In the case of breast cancer, two reports demonstrated that there is no correlation of p53 autoantibodies with age, menopausal status, lymph node involvement or tumor size [9, 18]. A similar observation was made for the hepatocellular carcinoma where no correlation was found between the development of p53 autoantibodies and age, sex, multifocal or unifocal localization, tumor size or the existence of extrahepatic metastasis [31]. Several authors found the seropositivity of patients associated with a high histological grade [9, 18, 64]. By trying to relate the autoimmune reaction to a family history or genetic predisposition there seems to be a lower prevalence of p53 autoantibodies in patients with a family history of breast cancer [65, 66]. The most significant observation in these studies was the correlation of p53 autoantibodies with the hormone receptor status. There is a good correlation between the presence of autoantibodies and the absence of estrogen and progesterone receptors [18, 64]. The situation is somewhat different in patients with ovarian cancer where no significant correlation was found for the presence of p53 autoantibodies and clinical stage or FIGO-classification [13, 69]. The rate of p53 autoantibodies was lower in patients under 50 years of age than those over 50 years old. In general, patients with p53 autoantibodies had a shorter disease-free survival than patients without p53 autoantibodies. p53 autoantibodies are good prognostic markers for a bad outcome for patients with pancreas carcinoma. In one study all patients with p53 autoantibodies had a metastasized tumor and all patients died within 7 months after diagnosis [39]. In another study, more patients with tumors classified as stage III had developed antibodies compared to all other stages. Quite similar observations were reported for patients with gastric cancer, prostate carcinoma and squamouscell carcinoma of the head and neck [28, 53, 55, 58, 60, 61, 80]. For patients with esophageal cancer the analysis of p53 autoantibodies may allow to identify a subset of patients with an aggressive premalignant or malignant esophageal disease [26]. The analysis of p53 autoantibodies in the sera of smokers with head and neck cancer revealed a severe problem for this type of analyses. About 38% of patients with primary and 36% of recurrent small-cell carcinoma of head and neck had p53 autoantibodies
[57]. However, also 24% of the control group had p53 autoantibodies. Since smokers are of high risk to develop lung cancer this high percentage of positive sera might reflect undetected lung cancer. Thus, in general it is unclear from the reported studies, that the number of positive sera was indeed attributable to the cancer type which the analysis was performed for or if there is an underlying unknown other cancerous disease. In general, the prognostic value of p53 autoantibodies is very high if there is an additional tumor specific marker as also shown for patients with ZollingerEllison syndrome [78]. About 16% of patients with Zollinger-Ellison syndrome have p53 autoantibodies and together with the presence of liver metastases this observation means a poor prognosis and the patients may require an additional therapy.
ACKNOWLEDGEMENTS I thank Marianne Buchholz for typing and editing the manuscript and Dr Claudia Gotz for helpful suggestions. The work of the author is supported by a grant from Deutsche Krebshilfe W77/93/Mo2, by a grant from Alois Lauer Stiftung and by Fonds der Chemischen Industrie.
REFERENCES 1.
2.
3. 8. SUMMARY 4. In conclusion, p53 autoantibodies were detected in patients with a variety of different cancer types. Since p53 autoantibodies are not specific for one type of cancer additional parameters or markers are necessary for a clear diagnosis. However, there seems to be a good correlation between the presence of p53 autoantibodies and a malignancy. The presence of p53 autoantibodies in virus infected patients or in patients with an autoimmune disease may open a new interesting field for research. However, one might also keep in mind that the presence of p53 autoantibodies may reflect the presence of an undetected tumor. With regard to prognosis or to trail treatment of cancer patients there seem to be tumor specific variations in the importance of p53 autoantibodies and probably additional factors are required. In addition there is a clear need for the quantitation of p53 autoantibodies because the titer may indicate the stage of the disease or it may allow to follow the patient after treatment and to allow early detection of a relapse. However, follow up of patients have to be regarded with caution because so far no data are available about the influence of chemotherapy or radiotherapy on the induction of an immune response to p53. However, it turns out that the p53 autoantibody status together with other markers and under certain circumstances is an excellent marker for a tumorous malignancy.
5.
6. 7. 8.
9.
10.
11.
12.
Agarwal ML, Taylor WR, Chernov MV, Chernova OB, Stark GR. The p53 network. J Biol Chem 1998;273:1^. Almog N, Rotter V. Involvement of p53 in cell differentiation and development. Biochim Biophys Acta Rev Cancer 1997;1333:F1-F27. Gotz C, Montenarh M. p53: DNA-damage, DNA repair and apoptosis. Rev Physiol Biochem Pharmacol 1995;127:65-95. Mowat MRA. p53 in tumor progression: life, death, and everything. Adv Cancer Res 1998;74:25-48. Hainaut P, Hernandez T, Robinson A, RodriguezTome P, Flores T, Hollstein M, Harris CC, Montesano R. I ARC database of p53 gene mutations in human tumors and cell lines: updated compilation, revised formats and new visualisation tools. Nucl Acid Res 1998;26:205-213. Lane DP. Cancer: p53, guardian of the genome. Nature 1992;358:15-16. Malkin D. p53 and the Li-Fraumeni syndrome. Cancer Genet Cytogenet 1993;66:83-92. Chang F, Syrjanen S, Syrjanen K. Implications of the p53 tumor-suppressor gene in clinical oncology. JCHnOncol 1995;13:1009-1022. Crawford LV, Pim DC, Bulbrook RD. Detection of antibodies against the cellular protein p53 in sera from patients with breast cancer. Int J Cancer 1982;30:403408. Labrecque S, Naor N, Thomson D,Matlashewski G. Analysis of the anti-p53 antibody response in cancer patients. Cancer Res 1993;53:3468-3471. Caron de Fromentel C, May LF, Mouriesse H, Lemerle J, Chandrasekaran K, May P. Presence of circulating antibodies against cellular protein p53 in a notable proportion of children with B-cell lymphoma. Int J Cancer 1987;39:185-189. Hallak R, Mueller J, Lotter O, Gansauge S, Gansauge F, Jumma MED, Montenarh M, Safi F, Beger H. p53 genetic alterations, protein expression and autoanti-
199
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
200
bodies in human colorectal carcinoma: a comparative study. Int J Oncol 1998;12:785-791. Montenarh M, Harlozinska A, Bar JK, Kartarius S, Gtinther J, Sedlaczek P. p53 autoantibodies in the sera, cyst and ascites fluids of patients with ovarian cancer. Int J Oncol 1998;13:605-610. Winter SF, Minna JD, Johnson BE, Takahashi T, Gazdar AF,Carbone DP. Development of antibodies against p53 in lung cancer patients appears to be dependent on the type of p53 mutation. Cancer Res 1992;52:4168-4174. Guinee DG Jr, Travis WD, Trivers GE, De Benedetti VMG, Cawley H, Welsh JA, Bennett WP, Jett J, Colby TV, Tazelaar H, Abbondanzo SL, Pairolero P, Trastek V, Caporaso NE, Liotta LA, Harris CC. Gender comparisons in human lung cancer: analysis of p53 mutations, anti-p53 serum antibodies and C-erbB-2 expression. Carcinogenesis 1995;16:993-1002. Davidoff AM, Iglehart JD, Marks JR. Immune response to p53 is dependent upon p53/HSP70 complexes in breast cancers. Proc Natl Acad Sci USA 1992;89:3439-3442. Wild CP, Ridanpaa M, Anttila S, Lubin R, Soussi T, Husgafvel-Pursiainen K, Vainio H. p53 antibodies in the sera of lung cancer patients: comparison with p53 mutation in the tumour tissue. Int J Cancer 1995;64:176-181. Schlichtholz B, Legros Y, Gillet D, Gaillard C, Marty M, Lane D, Calvo F, Soussi T. The immune response to p53 in breast cancer patients is directed against immunodominant epitopes unrelated to the mutational hot spot. Cancer Res 1992;52:6380-6384. Legros Y, Lafon C, Soussi T. Linear antigenic sites defined by the B-cell response to human p53 are localized predominantly in the amino and carboxy-termini of the protein. Oncogene 1994;9:2071-2076. Lubin R, Schlichtholz B, Bengoufa D, Zalcman G, Tredaniel J, Hirsch A, Caron de Fromentel CC, Preudhomme C, Fenaux P, Fournier G, Mangin P, Laurent-Puig P, Pelletier G, Schlumberger M, Desgrandchamps F, Le Due A, Peyrat JP, Janin N, Bressac B, Soussi T. Analysis of p53 antibodies in patients with various cancers define B-cell epitopes of human p53: Distribution on primary structure and exposure on protein surface. Cancer Res 1993;53:58725876. Hoher D, Kartarius S, Porzsolt F, Montenarh M. Immunologically defined subclasses of the growth suppressor protein p53 detected with antibodies in sera from tumor patients. Int J Oncol 1993;3:741-747. Tilkin AF, Lubin R, Soussi T, Lazar V, Janin N, Mathieu M-C, Lefrere I, Carlu C, Roy M, Kayibanda M, Bellet D, Guillet J-G, Bressac-de Paillerets B. Primary proliferative T cell response to wild-type p53
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
protein in patients with breast cancer. Eur J Immunol 1995;25:1765-1769. Houbiers JGA, Nijman HW, Van der Burg SH, Drijfhout JW, Kenemans P, Van de Velde CJH, Brand A, Momburg F, Kast WM, Melief CJM. In vitro induction of human cytotoxic T lymphocyte responses against peptides of mutant and wild-type p53. Eur J Immunol 1993;23:2072-2077. Yanuck M, Carbone DP, Pendleton CD, Tsukui T, Winter SF, Minna JD, Berzofsky JA. A mutant p53 tumor suppressor protein is a target for peptide-induced CD8+ cytotoxic T-cells. Cancer Res 1993;53:32573261. Schlichtholz B, Tredaniel J, Lubin R, Zalcman G, Hirsch A, Soussi T. Analyses of p53 antibodies in sera of patients with lung carcinoma define immunodominant regions in the p53 protein. Br J Cancer 1994;69:809-816. Cawley HM, Meltzer SJ, De Benedetti VMG, Hollstein MC, Muehlbauer KR, Liang L, Bennett WP, Souza RF, Greenwald BD, Cottrell J, Salabes A, Bartsch H, Trivers GE. Anti-p53 antibodies in patients with Barrett's esophagus or esophageal carcinoma can predate cancer diagnosis. Gastroenterology 1998;115:19-27. Lubin R, Zalcman G, Bouchet L, Tredaniel J, Legros Y, Cazals D, Hirsch A, Soussi T. Serum p53 antibodies as early markers of lung cancer. Nature Med 1995;1:701-702. Lang C, Unteregger G, Kartarius S, Giinther J, Zwergel T, Montenarh M. p53 autoantibodies in patients with urological tumors. Br J Urol 1998;82:721-725. Kovacs B, Patel A, Hershey JN, Dennis GJ, Kirschfink M, Tsokos GC. Antibodies against p53 in sera from patients with systemic lupus erythematosus and other rheumatic diseases. Arthritis Rheum 1997;40:980982. Chen YMA, Chen SH, Fu CY, Chen JY, Osame M. Antibody reactivities to tumor-suppressor protein p53 and HTLV-I Tof, Rex and Tax in HTLV-I-infected people with differing clinical status. Int J Cancer 1997;71:196-202. Volkmann M, Miiller M, Hofmann WJ, Meyer M, Hagelstein J, Rath U, Kommerell B, Zentgraf H, Galle PR. The humoral immune response to p53 in patients with hepatocellular carcinoma is specific for malignancy and independent of the a-fetoprotein status. Hepatology 1993;18:559-565. Ryder SD, Rizzi PM, Volkmann M, Metivier E, Pereira LMMB, Galle PR, Naoumov NV, Zentgraf H, Williams R. Use of specific ELISA for the detection of antibodies directed against p53 protein in patients with hepatocellular carcinoma. J Clin Pathol 1996;49:295-299.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
Raedle J, Roth WK, Oremek G, Caspary WF, Zeuzem S. a-fetoprotein and p53 autoantibodies in patients with chronic hepatitis C. Dig Dis Sci 1995;40:25872594. Raedle J, Oremek G, Roth WK, Caspary WF, Zeuzem S. Anti-p53 autoantibodies in hepatitis C virusinfected patients. Anticancer Res 1997;17:30793081. Raedle J, Oremek G, Truschnowitsch M, Lorenz M, Roth WK, Caspary WF, Zeuzem S. Clinical evaluation of autoantibodies to p53 protein in patients with chronic liver disease and hepatocellular carcinoma. Eur J Cancer [A] 1998;34:1198-1203. Yashar CM, Gercel-Taylor C, Gibb RK, Weeks JW, Taylor DD. Identification of a unique form of p53 in human cord blood associated with the development of maternal autoantibodies. Am J Reprod Immunol 1998;39:368-375. Gansauge S, Gansauge F, Negri G, Galle P, Mliller J, Nussler AK, Poch B, Beger HG. The role of anti-p53-autoantibodies in pancreatic disorders. Int J Pancreatol 1996;19:171-178. Laurent-Puig P, Lubin R, Semhoun-Ducloux S, Pelletier G, Fourre C, Ducreux M, Briantais MJ, Buffet C, Soussi T. Antibodies against p53 protein in serum of patients with benign or malignant pancreatic and biliary diseases. Gut 1995;36:455-458. Marxsen J, Schmiegel W, Roder C, Harder R, Juhl H, Henne-Bruns D, Kremer B, Kalthoff H. Detection of the anti-p53 antibody response in malignant and benign pancreatic disease. Br J Cancer 1994;70:10311034. Trivers GE, Cawley HL, DeBenedetti VMG, Hollstein M, Marion MJ, Bennett WP, Hoover ML, Prives CC, Tamburro CC, Harris CC. Anti-p53 antibodies in sera of workers occupationally exposed to vinyl chloride. JNCI 1995;87:1400-1407. Zalcman G, Schlichtholz B, Tredaniel J, Urban T, Lubin R, Dubois I, Milleron B, Hirsch A, Soussi T. Monitoring of p53 autoantibodies in lung cancer during therapy:relationship to response to treatment. Clin Cancer Res 1998;4:1359-1366. Rosenfeld MR, Malats N, Schramm L, Graus F, Cardenal F, Viiiolas N, Rosell R, Tora M, Real FX, Posner JB, Dalmau J. Serum anti-p53 antibodies and prognosis of patients with small-cell lung cancer. JNCI 1997;89:381-385. lizasa T, Fujisawa T, Saitoh Y, Hiroshima K, Ohwada H. Serum anti-p53 autoantibodies in primary resected non-small- cell lung carcinoma. Cancer Immunol Immunother 1998;46:345-349. Bergqvist M, Brattstrom D, Larsson A, Holmertz J, Hesselius P, Rosenberg L, Wagenius G, Brodin O. p53 auto-antibodies in non-small cell lung cancer
45.
46.
47.
48.
49.
50.
51.
52.
53.
54.
55.
56.
patients can predict increased life expectancy after radiotherapy. Anticancer Res 1998;18:1999-2002. Komiya T, Hirashima T, Takada M, Masuda N, Yasumitsu T, Nakagawa K, Hosono Y, Kikui M, Tsuji S, Fukuoka M, Kawase I. Prognostic significance of serum p53 antibodies in squamous cell carcinoma of the lung. Anticancer Res 1997;17:3721-3724. Angelopoulou K, Diamandis EP, Sutherland DJA, Kellen JA, Bunting PS. Prevalence of serum antibodies against the p53 tumor suppressor gene protein in various cancers. Int J Cancer 1994;58:480-487. Coomber D, Hawkins NJ, Clark M, Meagher A, Ward RL. Characterization and clinicopathological correlates of serum anti-p53 antibodies in breast and colon cancer. J Cancer Res CUn Oncol 1996;122:757-762. Hammel P, Boissier B, Chaumette MT, Piedbois P, Rotman N, Kouyoumdjian JC, Lubin R, Delchier JC, Soussi T. Detection and monitoring of serum p53 antibodies in patients with colorectal cancer. Gut 1997;40:356-361. Angelopoulou K, Stratis M, Diamandis EP. Humoral immune response against p53 protein in patients with colorectal carcinoma. Int J Cancer 1997;70:46-51. Shibata Y, Kotanagi H, Andoh H, Koyama K, Itoh H, Kudo SE. Detection of circulating anti-p53 antibodies in patients with colorectal carcinoma and the antibody's relation to cHnical factors. Dis Colon Rectum 1996;39:1269-1274. Houbiers JGA, Van der Burg SH, Van de Watering LMG, Tollenaar RAEM, Brand A, Van de Velde CJH, Melief CJM. Antibodies against p53 are associated with poor prognosis of colorectal cancer. Br J Cancer 1995;72:637-641. Edis C, Kahler C, Klotz W, Herold M, Feichtinger H, Konigsreiner A, Margreiter R, Jaschke W, Vogel W. A comparison between a-fetoprotein and p53 antibodies in the diagnosis of hepatocellular carcinoma. Transplant Proc 1998;30:780-781. Bourhis J, Lubin R, Roche B, Koscielny S, Bosq J, Dubois I, Talbot M, Marandas P, Schwaab G, Wibault P, Luboinski B, Eschwege F, Soussi T. Analysis of p53 serum antibodies in patients with head and neck squamous cell carcinoma. JNCI 1996;88:1228-1233. Cough MJ, Koch M, Brennan JA, Sidransky D. The humoral response to oncoprotein p53 in head and neck cancer. Head Neck 1994;16:495. Lavieille JP, Lubin R, Soussi T, Reyt E, Brambilla C, Riva C. Analysis of p53 antibody response in patients with squamous cell carcinoma of the head and neck. Anticancer Res 1996;16:2385-2388. Kaur J, Srivastava A, Ralhan R. Serum p53 antibodies in patients with oral lesions: Correlation with p53/HSP70 complexes. Int J Cancer 1997;74:609613.
201
57.
58.
59.
60.
61.
62.
63.
64.
65.
66.
67.
68.
202
Wollenberg B, Jan NV, PItzke P, Reiter W, Stieber P. Anti-p53 antibodies in serum of smokers and head and neck cancer patients. Anticancer Res 1997;17:413418. Maass JD, Gottschlich S, Lippert BM, Niemann AM, Gorogh T, Werner JA. Antikorperbildung gegen das zellulare Protein p53 bei Patienten mit Plattenepithelkarzinomen der oberen Luft- und Speisewege. Laryngo-Rhino-Otol 1996;75:1-4. Friedrich RE, Bartel-Friedrich S, Plambeck K, Bahlo M, Klapdor R. P53 auto-antibodies in the sera of patients with oral squamous cell carcinoma. Anticancer Res 1997;17:3183-3184. Werner JA, Gottschlich S, Folz BJ, Goeroegh T, Lippert BM, Maass JD, Rudert H. p53 serum antibodies as prognostic indicator in head and neck cancer. Cancer Immunol Immunother 1997;44:112-116. Maass JD, Gottschlich S, Goeroegh T, Lippert BM, Werner JA. Head and neck cancer and p53-immunogenicity. Anticancer Res 1997; 17:28732874. Lavieille JP, Righini C, Reyt E, Brambilla C, Riva C. Implications of p53 alterations and anti-p53 antibody response in head and neck squamous cell carcinomas. Oral Oncol 1998;34:84-92. Preudhomme C, Lubin R, Lepelley P, Vanrumbeke M, Fenaux P. Detection of serum anti p53 antibodies and their correlation with p53 mutations in myelodysplastic syndromes and acute myeloid leukemia. Leukemia 1994;8:1589-1591. Peyrat J-P, Bonneterre J, Lubin R, Vanlemmens L, Fournier J, Soussi T. Prognostic significance of circulating P53 antibodies in patients undergoing surgery for locoregional breast cancer. Lancet 1995;345:621622. Green JA, Mudenda B, Jenkins J, Leinster SJ, Tarunina M, Green B, Robertson L. Serum p53 autoantibodies: incidence in famihal breast cancer. Eur J Cancer [A] 1994;30A:580-584. Mudenda B, Green JA, Green B, Jenkins JR, Robertson L, Tarunina M, Leinster SJ. The relationship between serum p53 autoantibodies and characteristics of human breast cancer. Br J Cancer 1994;69:11151119. Huober J, Sprenger H, Costa SD, Zentgraf H, Kaufmann M, Bastert G. Prognostische Bedeutung von p53 Autoantikorpern im Serum bei Patientinnen mit Mammakarzinom. Zentralbl Gynakol 1996; 118:560564. Regidor PA, Regidor M, Callies R, Schindler AE. Detection of p53 auto-antibodies in the sera of breast cancer patients with a new recurrence using an ELIS A assay. Does a correlation with the recurrence free interval exist? Eur J Gynaecol Oncol 1996;17:192-199.
69.
70.
71.
72.
73.
74.
75.
76.
77.
78.
Angelopoulou K, Rosen B, Stratis M, Yu H, Solomon M, Diamandis EP. Circulating antibodies against p53 protein in patients with ovarian carcinoma— correlation with clinicopathologic features and survival. Cancer 1996;78:2146-2152. Green JA, Robertson LJ, Campbell IR, Jenkins J. Expression of the p53 gene and presence of serum autoantibodies in ovarian cancer: correlation with differentiation. Cancer Detection and Prevention 1995;19:151-155. Wieczorek AM, Waterman JLF, Waterman MJF, Halazonetis TD. Structure-based rescue of common tumor-derived p53 mutants. Nature Med 1996;2:1143-1146. Vennegoor CJGM, Nijman HW, Drijfhout JW, Vernie L, Verstraeten RA, Von Mensdorff-Pouilly S, Hilgers J, Verheijen RHM, Kast WM, Melief CJM, Kenemans P. Autoantibodies to p53 in ovarian cancer patients and healthy women: A comparison between whole p53 protein and 18-mer peptides for screening purposes. Cancer Lett 1997;116:93101. Angelopoulou K, Diamandis EP. Detection of the TP53 tumour suppressor gene product and p53 autoantibodies in the ascites of women with ovarian cancer. Eur J Cancer [A] 1997;33A: 115-121. Marx D, Uebel T, Schauer A, Kuhn W, Meden'H. Association of serum autoantibodies to tumor suppressor gene p53 in patients with ovarian cancer according to the status of the disease. Oncol Rep 1997;4:11571160. Von Brevern MC, Hollstein MC, Cawley HM, De Benedetti VMG, Bennett WP, Liang L, He AG, Zhu SM, Tursz T, Janin N, Trivers GE. Circulating anti-p53 antibodies in esophageal cancer patients are found predominantly in individuals with p53 core domain mutations in their tumors. Cancer Res 1996;56:4917^921. Collet B, Raoul J-L, Le Berre N, Heresbach D, Meritte H, Quillien V, De Certaines J-D. Serum anti-p53 antibodies in patients with squamous cell carcinoma of the esophagus: Comparison with p53 alterations and lymph node invasion. Int J Oncol 1997;11:617-621. Gadducci A, Ferdeghini M, Buttitta F, Fanucchi A, Annicchiarico C, Prontera C, Bevilacqua G, Genazzani AR. Preoperative serum antibodies against the p53 protein in patients with ovarian and endometrial cancer. Anticancer Res 1996;16:3519-3523. Jais P, Vuagnat A, Terris B, Houillier AM, Bonfils S, Laurent-Puig P, Mignon M, Lewin MJM. Association of serum antibodies against p53 protein with poor survival in patients with Zollinger-Ellison syndrome. Gastroenterology 1998;114:37^3.
79.
80.
82.
83.
84.
85.
86.
87.
Weller M, Bornemann A, Stander M, Schabet M, Dichgans J, Meyermann R. Humoral immune response to p53 in malignant glioma. J Neurol 1998;245:169-172. Wiirl P, Weigmann F, Meye A, Fittkau M, Rose U, Berger D, Rath FW, Dralle H, Taubert H. Detection of p53 autoantibodies in sera of gastric cancer patients and their prognostic relevance. Scand J Gastroenterol 1997;32:1147-1151. Preudhomme C, Vanrumbeke M, Detourmignies L, Facon T, Lepelley P, Sous si T, Fenaux P. Very low incidence of p53 antibodies in adult non-Hodgkin's lymphoma and multiple myeloma. Br J Haematol 1998;100:184-186. Porzsolt F, Schmid M, Hoher D, Muche R, Gaus W, Montenarh M. Biological relevance of autoantibodies against p53 in patients with metastatic breast cancer. Onkologie 1994;17:402-408. Munker R, Stotzer O, Darsow M, Classen S, Lebeau A, Wilmanns W. Autoantibodies against p53 are not increased in human ascites and pleural effusions. Cancer Immunol Immunother 1996;42:200-201. Tavassoli M, Brunei N, Maher R, Johnson NW, Soussi T. p53 antibodies in the saliva of patients with squamous cell carcinoma of the oral cavity. Int J Cancer 1998;78:390-391. Brachman DG, Graves D, Yokes E, Beckett M, Haraf D, Montag A, Dunphy E, Mick R, Yandell D, Weichselbaum RR. Occurrence of p53 gene deletions and human papilloma virus infection in human head and neck cancer. Cancer Res 1992;52:4832-4836. Brennan JA, Boyle JO, Koch WM, Goodman SN, Hruban RH, Eby YJ, Couch MJ, Forastiere AA, Sidransky D. Association between cigarette smoking and mutation of the p53 gene in squamous-cell carcinoma of the head and neck. N Engl J Med 1995;332:712-717. Boyle JO, Hakim J, Koch W, Van der Riet P, Hruban RH, Roa RA, Correo R, Eby YJ, Ruppert JM, Sidransky D. The incidence of p53 mutations increases with progression of head and neck cancer. Cancer Res 1993;53:4477-4480.
88.
89.
90.
91.
92.
93.
94.
95.
Yin X-Y, Smith ML, Whiteside TL, Johnson JT, Herberman RB, Locker J. Abnormalities in the p53 gene in tumors and cell lines of human squamouscell carcinomas of the head and neck. Int J Cancer 1993;54:322-327. Ahomadegbe JC, Barrois M, Fogel S, Le Bihan ML, Douc-Rasy S, Duvillard P, Armand JP, Riou G. High incidence of p53 alterations (mutation, deletion, overexpression) in head and neck primary tumors and metastases: absence of correlation with clinical outcome. Frequent protein overexpression in normal epithelium and in early non-invasive lesions. Oncogene 1995;10:1217-1227. Bourhis J, Bosq J, Wilson GD, Bressac B, Talbot M, Leridant AM, Dendale R, Janin N, Armand JP, Luboinski B, Malaise EP, Wibault P, Eschwege F. Correlation between p53 gene expression and tumorcell proliferation in oropharyngeal cancer. Int J Cancer 1994;57:458-462. Frank JL, Bur ME, Garb JL, Kay S, Ware JL, Sismanis A, Neifeld JP. p53 tumor suppressor oncogene expression in squamous cell carcinoma of the hypopharynx. Cancer 1994;73:181-186. Gasparini G, Weidner N, Maluta S, Pozza F, Boracchi P, Mezzetti M, Testolin A, Bevilacqua P. Intratumoral microvessel density and p53 protein: Correlation with metastasis in head-and-neck squamous-cell carcinoma. Int J Cancer 1993;55:739-744. Nylander K, Stenling R, Gustafsson H, Zackrisson B, Roos G. p53 expression and cell proliferation in squamous cell carcinomas of the head and neck. Cancer 1995;75:87-93. Winter SF, Sekido Y, Minna JD, Mclntire D, Johnson BE, Gazdar AF, Carbone DP. Antibodies against autologous tumour cell proteins in patients with smallcell lung cancer: Association with improved survival. JNCI 1993;85:2012-2018. Segawa Y, Kageyama M, Suzuki S, Jinno K, Takigawa N, Fujimoto N, Hotta K, Eguchi K. Measurement and evaluation of serum anti-p53 antibody levels in patients with lung cancer at its initial presentation: a prospective study. Br J Cancer 1998;78:667-672.
203
(c) 2000 Elsevier Science B. V. All rights reserved. Cancer and Autoimmunity Y. Shoenfeld and M. E. Gershwin, editors
Expression of ETS Family of Genes in Systemic Lupus Erythematosis Panagiotis Georgiou^ loanna Maroulakou^, Narayan K. Bhat^, Dennis K. Watson^ and Takis S. Papas^ ^ University ofPatras Medical School Rio, Patras, Greece; ^Medical University of South Carolina, Charleston, USA; ^National Cancer Institute, Frederick Cancer Research and Development Center, Frederick, USA
1. AUTOIMMUNE DISEASE PROCESS
2. THE ETS GENE FAMILY
Systemic lupus erythematosus (SLE) is a chronic autoimmune disease of unknown etiology. SLE is characterized by the involvement of multiple organ systems and the production of autoantibodies directed against nuclear components, including ssDNA, dsDNA and histones [1-2]. The hallmark of autoimmunity is the activation and proliferation of lymphocytes directed against self-antigen. Abnormalities in lymphoid cell function include: (i) changes in the ratio of T-cell subset population; (ii) increased T-helper and decreased T-suppressor functions; (iii) restricted usage of T-cell receptor genes; (iv) defect in programmed T-cell death mechanisms, (v) increased population of active T cells; (vi) increased expansion of B cells leading to the production of autoantibodies; and (vii) abnormalities in the signal transduction pathway in lymphocytes. Defect in the signal transduction cascade mechanisms in lymphocytes from SLE patients have been shown to result in the aberrant expression of many genes and some of which encode DNA sequence specific transcription factors [1]. These in turn may regulate the transcription of genes contributing towards disease process. In this chapter, we provide a brief overview of the ETS gene family (see recent reviews [3-7] for additional information and references). We discuss the expression pattern of ETSl, ETS2 and ERGB/FLIl genes in lymphocytes from SLE patients and the possible role of ERGB/FLIl transcription factor in the autoimmune disease process.
Transcription factors are critical for proper regulation of cellular proliferation, differentiation and programmed cell death. Alterations in transcription factor function have been shown to cause developmental defects or carcinogenesis. ETS family of transcription factor genes have been isolated and characterized from different organisms, including the human, mouse, rat, chicken, Xenopus, sea urchin, Drosophila and C elegans (reviewed in [3-7]). To date, over 30 members of the ETS family have been identified, including 22 human homologues (see Fig. 1 [8-34]). All ETS genes retain a region of sequence similarity with the v-ETS oncogene of the E26 virus. On the basis of their amino acid sequence identities, we originally defined three regions: A, B and C [8]. The A region is localized at the amino terminus and has a moderate degree of amino acid similarity among some ETS family members (e.g., ETSl, ETS2, ERG, ERGB/FLIl and GABPa). This region contains weak homology with the helix-loop-helix domain of the HLH family of proteins, also known as the "pointed" domain (PNT, stippled boxes, Fig.l). In contrast, the middle B region is highly variable between family members and even appears to be dispensable—as in the case of the genes ERG, ERGB/FLIl and GABPof. We observed that all ETS genes retain a region of conserved sequence, the C domain. This domain contains approximately 85 amino acids that constitute the DNA binding domain (ETS domain. Fig. 1, filled boxes). While located near the carboxyl terminus in many family members, the ETS domain is located at the amino terminus of some family members (e.g., ELKl), as well as near the center of some ets family proteins (e.g., ELFl) (see
205
Fig. 1). An additional region, designated "R" (Fig. 1, cross-hatched boxes), may be an erg-specific domain based upon sequence conservation between sea urchin, mouse and human erg-related genes. Based on the sequence divergence among ETS family members, they can be divided into 9 subgroups with multiple members. The evolution of these subgroups may have involved duplication of a highly conserved ETS domain, followed by acquisition of divergence by genetic recombination [3, 6].
3. FUNCTIONAL DOMAINS OF THE ETS TRANSCRIPTION FACTORS The ETS genes encode sequence-specific DNAbinding proteins and function as transcription factors [3-7]. ETS proteins bind as monomers (with the exception of GABPa) to the-GGAA/T-core motif present in the transcriptional regulatory regions of many cellular, viral promoters and enhancers [5,6]. Comparison of DNA-binding sequences determined by the site selection methods, as well as binding of ETS proteins to different target genes, reveals that the sequence surrounding the—GGAA/T-core strongly influences the binding of ETS family proteins [3, 5 7]. Transcriptional control of unique ETS target genes depends on the specific ETS protein(s) expressed in a given cell type and its ability to bind the target sequence.
3.1. DNA-Binding Domain The secondary structure of the ETS DNA binding domains of human FLU and mouse ETSl proteins has been determined by NMR analyses [3, 5-6]. These studies predict the existence of three alpha helices and a 4-stranded )^-sheet, similar to structures of the winged helix-turn-heUx family of DNA-binding proteins. X-ray crystallographic analysis of ETS proteins in the presence or the absence of DNA provides data further supporting this structural model. The amino acids capable of forming this structure, as well as amino acids involved in the interaction with the DNA, as expected, are also highly conserved. This could be one of the reasons why different ETS proteins recognize the—GGAA/T—core sequence.
206
3.2. Transactivation Domain The transactivation domains are located outside of the ETS DNA-binding domain. Interestingly, these transactivation regions map to weakly homologous or divergent (A, B and R) regions of the ETS proteins. The presence of a transactivation domain located in a divergent region provides greater flexibility and an opportunity to interact differently and uniquely with other proteins in order to increase their capacity to modulate the activities of a large number of target genes. The ETS proteins interact with other proteins in the presence or absence of DNA. Such interaction increases the stability and affinities for ETS-binding sequences. The protein-protein interaction domain in some of the ETS proteins is both flexible and distinct and is located in different regions of ETS proteins. Protein-protein interactions are able to direct specific ETS proteins to act on promoters or enhancers that contain multiple transcription factor binding sites; this type of interaction increases their potential to activate different target genes. It should be noted that while most family members function as activators of transcription, some function as repressors (e.g., ERP).
4. ROLE OF ETS IN CANCER AND DISEASE The oncogene v-ETS was originally discovered as a fused component of a chimeric genome in an avian leukosis virus, E26 (a replication-defective retrovirus that arose by transducing portions of two chicken cellular proto-oncogenes, myb and ETSl. The E26 oncogene transforms fibroblasts, myeloblasts, and erythroblasts in vitro and causes mixed erythroid-myeloid and lymphoid leukemia in vivo [3,4]. Malignant transformation by leukemia retroviruses can also result from proviral integration upstream from specific cellular proto-oncogenes, activating gene expression. Activation of Spi-1 (PU.l) has been observed in a collection of murine erythroblastic tumors induced by spleen focus forming virus (SFFV). In rat thymomas induced by the Moloney strain of the Murine leukemia virus (Mo-MuLV), it has been found that proviral insertion events occurred at common integration loci thought to be associated with tumor progression, termed Tpl-1. These sites have now been shown to result in the rearrangement or activated expression of the ETSl gene. Three different proviral
PNT Domain
ETS Domain
ETSl [8] ETS2 [8] ERG2 [9] ELKl [10] SPIl (PU.l) [11] ERGB/FLIl [12,13] SAPla [14] ELFl [15] SPIB [16] E4TFl-60(GABPa)[i7][ E l A F (PEA3) [18] PEl [19] ERM [20] TEL [21] SAP2 (NET/ERP) [22] ERF [23] ETVl [24,25] NERF2 [26] MEF [27] ESX (JEN/ESE/ERT/ELF3) [2832] FEV [33] ELFR [34] Fig. 1. The human ETS gene family. Schematic diagram of the human ETS proteins. Uppercase letters (A, B, C and R) define hypothetical ETS domains. The ETS domain is indicated by the black box. The conserved PNT (pointed) domain is shown as a stippled box.
insertions near the FLU gene lead to hematopoietic oncogenesis. The erythroleukemias induced by Friend-MuLV activate the FLU locus. Similarly, primitive stem cell tumors with characteristics of early hematopoietic cells and non-T, non-B lymphomas are induced by integration of the lOAl isolate of MuLV or the Cas-Br viruses, respectively, near the FLU locus [4, 6]. Tumor cell formation also results from the translocation-associated production of FLU chimeric proteins as has been shown for Ewing's sarcoma (EWS), a childhood bone tumor, and related peripheral neuroectodermal tumors (PNET). In this instance,
the FLU gene is translocated from its normal llq24 position to chromosome 22, which generates the formation of chimeric transcripts resulting in fusing the amino terminal region of the EWS gene to the carboxy 1 terminal DNA-binding domain of the FLU gene. The chimeric fusion protein lacks the putative RNA-binding domain of EWS and one of the transactivation domains of the FLU gene product [3, 4, 6]. Structure-function analyses reveal that both the EWS and FLU regions of the EWS/FLIl chimeric protein are particularly important for transforming activity in NIH3T3 cells. Three additional Ewing's sarcoma translocations have been described [t(21;22), t(7;22).
207
t(2;22)] that result in chimeric proteins between EWS and three other ETS proteins, ERG, ETVl and FEV, respectively [3,4,6, 33]. These fusion proteins may be unable to modulate ETS-targeted genes appropriately. Other targeted gene products might be activated by the unscheduled (and therefore inappropriate) specific interaction with the EWS binding domain. These actions could trigger autonomous growth of these tumor cells. In summary, whether by activation through retroviral transduction of cellular sequences, retroviral promoter integration or by chromosomal translocation, dysregulation of ETS has been shown to result in carcinogenic transformation.
The ETS-1 gene is expressed at higher levels in quiescent T cells and its expression decreases to very low levels after activation. The repression of ETS-1 gene expression requires both activation of protein kinase C and elevation of intracellular Ca^"^ ions, and is dependent on de novo protein synthesis. While a similar pattern is observed for FLU gene expression, ETS2 expression is increased during T-cell activation [7].
5. EXPRESSION OF ETSl, ETS2 AND FLU GENES DURING NORMAL DEVELOPMENT
We have examined the expression of ETSl, ETS2 and ERGB/FLIl genes in human PBMC samples from SLE patients and compared them with those from healthy individuals. A representative sample of Reverse Transcription-Polymerase Chain Reaction results from very active (samples 1 and 2), active (samples 3, 4 and 5), inactive SLE patients (samples 6 and 7), along with healthy individuals (sample 8) are shown in Fig. 2. Although ETSl gene expression is 2-fold higher in SLE, its expression is independent of disease activity. However, both ERGB/FLIl and ETS2 gene expression changed with the disease activity. ERGB/FLIl gene expression is about 7-fold higher in very active SLE samples compared to its expression in healthy individuals. On the other hand, ETS2 gene expression is about 3-fold higher in very active SLE samples than in healthy individuals. We did not find any correlation of ETSl, ERGB/FLIl and ETS2 gene expression between the duration of the disease, the clinical characteristics, the laboratory characteristics or the therapy.
The ETS2 gene is expressed in most cell types, whereas ETSl and FLU gene expression are tissue specific [3-6]. Expression of these genes in multiple tissues during embryonic development suggests that these genes may be required for multiple functions during critical stages of organogenesis. ETSl expression is detected at around 8 days post conception (dpc). During embryogenesis, ETSl expression is detected in lymphoid tissues, as well as several other organ systems (mosdy in cells of mesodermal origin). ETS 1 gene expression in the thymus begins to appear two days before birth, coinciding with the appearance of mature (single positive) thymocytes. Expression of ETSl is restricted primarily to lymphoid cells after birth. In contrast, ETS2 expression is more ubiquitous. While ETS2 expression is distincdy different from that of ETSl during embryonic development and in the adult, FLU expression is similar to ETSl. Expression patterns during embryogenesis suggest that FLU may function in the development of mesodermal, endothelial and hematopoietic cells as well as in cells that are derived from the neural crest and in migrating neural crest cells. During later development, the overall expression levels decrease, with high levels remaining in newly formed mesenchymal cells. Expression observed in the spleen and thymus during development continues after birth. These studies are consistent with the hypothesis that FLU has a role in mesoderm formation and in the development of endothelial and hematopoietic lineages [5, 6].
208
6. EXPRESSION OF ETSl, ETS2, ERGB/FLIl GENES IN LYMPHOCYTES FROM SLE PATIENTS
7. EXPRESSION OF ETSl, ETS2, ERGB/FLIl IN LYMPHOCYTES FROM AUTOIMMUNE PRONE MICE New Zealand Black (NZB)/New Zealand White (NZW) provides a good model system because Fl hybrids of NZB with NZW develop autoimmune disease having characteristic phenotypes similar to that seen in human SLE. We studied ETSl, ETS2, ERGB/FLIl gene expression in thymocytes, splenic B and T cells from NZW, FI hybrids (NZB xNZW), as well as
12
3 4 5 6 7 8
ERGB/FLIl—
- 643 bp
G3PDH—
- 983 bp
HI f ^ 238-
ETS2 —
<si p-actin probe <si ERGB/FLIl probe -- P-aedn
P;i^:pJ — 790 bp H ERGBM.I1
G3PDH—
ETSl
- 983 bp 716 bp
:
455 bp
G3PDH-
983 bp
Fig. 2. ETS2 and ERGB/FLIl expression correlates with SLE activity. ERGB/FLIl, ETS2 and ETSl mRNA expression was studied by quantitative RT-PCR in PBMC samples from SLE patients with very active (lanes 1 and 2), active (lanes 3, 4 and 5) and inactive (lanes 6 and 7) disease compared to that of a healthy individual (lane 8). Expected size of PCR products are shown on the right side (further details are described in ref. [42]).
DBA/2 normal mice. As shown in Fig. 3, ERGB/FLIl expression did not change significantly in splenic B cells and thymocytes from either autoimmune prone or normal mice. However, its expression is 2- to 3fold higher in splenic T cells of lupus prone mice (NZW and Fl hybrids) compared to normal DBA/2 and SWISS mice. In contrast, there was no change in the expression level of the ETSl and ETS2 genes in lupus prone mice compared to normal mice.
8. FUNCTIONAL SIGNIFICANCE OF OVEREXPRESSION OF ERGB/FLIl GENE IN AUTOIMMUNE DISEASE Lymphocytes are important components and regulators of immune response. We and have shown that the ETS family of proteins are involved in lymphoid cell development, differentiation, maturation and activation and therefore, they are important regulators of lymphoid gene expression. Inappropriate expression of ETS family of genes may have a detrimental effect on lymphoid cell differentiation, activation and function. T cells in autoimmune diseases are in activated state because they have been shown to express
B
I O ETS2 probe - ETS2 ^ ETSl probe <3 P-actki probe - ETSl i|^ - p-actin
Fig. 3. Expression of ERGB/FLIl, ETSl and ETS2 in splenic T cells: ERGB/FLIl expression (panel A), and ETSl and ETS2 expression (panel B), were studied by RNAse protection assay as described in ref. [42]. Probes and RNA protected fragments are shown on the right side. Sizes of pBR322 DNA-MspI digest are shown on the left-hand side.
interleukin-(IL)-2 receptor (IL-2R) [35-36], MYC, MYB and RAF genes [37^0]. T cells are activated by interaction between TCR and antigen in conjunction with the major histocompatibility complex protein recognized on antigen presenting cells. This interaction initiates a cascade of intracellular biochemical events leading to the elevation of intracellular Ca^"^ ions and activation of protein kinase C. These signals are conveyed to the nucleus by different effector molecules to initiate or reprogram gene expression. During lymphocyte activation, the activities of a large number of genes involved are changed, including lymphokines and their receptor genes. Activation or repression of T-cell gene expression is facilitated by transcription factors expressed in that cell type. Others and we have shown that several members of the ETS family of transcription factors (ETSl, ETS2, ELFl, ERGB/FLIl, GABPof and ELK) are expressed in T cells. During T-cell activation, some members of the ETS family of transcription factors are differentially expressed.
209
In normal T cells, both ETSl and ERGB genes are expressed at high levels in quiescent state and their expression level decreases to low levels after activation. ETS2 gene expression is induced only after T-cell activation. High expression of ETS2 genes in SLE patients with active disease could thus be contributed by the activated lymphocytes. High levels of ERGB/FLIl expression observed in lymphoid cells from autoimmune diseases could be due to the development and expansion of special type of autoreactive T cells. On the other hand, it is possible that activation of T cells by autoantigen(s) does not affect the expression of the ERGB/FLIl gene. Thus, unscheduled expression of ERGB/FLIl in lymphocytes could contribute to the disease phenotype. This argument is further strengthened by a recent demonstration that transgenic mice overexpressing FLU develop high incidence of a progressive immunologic renal disease [41]. Transgenic mice constitutively expressing FLU accumulated abnormal T (B220+ CD3+) and B (B220+ CD5+) cells as well as immunocomplexes in the kidney. At late states of the disease, different types of autoantibodies were detected. Inappropriate expression of FLU results in an increased number of mature B cells, which have a reduced activation-induced apoptotic response compared to B cells from wild type animals. Splenic B cells from FLU transgenic mice had an increased capacity for proliferation and survival. Furthermore, FLU gene expression is higher in infiltrated lymphocytes surrounding affected kidney tissue [41]. Lymphocytes recognizing these autoantigens may escape the selection process and have enhanced survival because of heightened expression of FLU gene. These FLU-induced alterations in normal maturation of T and B cells suggest that FLU play a critical role in normal lymphoid cell function, perhaps through modulation of apoptosis Thus it appears that the unscheduled expression of ERGB/FLIl gene may perturb lymphoid cell development, differentiation, and function.
REFERENCES 1.
2. 3.
4.
5.
6.
7.
8.
9.
10.
11.
12. ACKNOWLEDGEMENTS This project has been funded in by a grant from the National Cancer Institute, National Institutes of Health, POl CA78582. We thank Ms Gwen Bowers and Judy Yost for expert editorial assistance. Figures 2 and 3 presented in this chapter were modified from our published paper [42].
210
13.
14.
Liossis SNC, Vassilopoulos D, Kovacs B, Tsokos GC. Immune cell biochemical abnormalities in systemic lupus erythematosis Clin Exptal Rheumatol 1997;15:677-684. Van Noort JM, Amor S. Cell biology of autoimmune diseases. Int Rev Cytol 1998;178:127-206. Graves BJ, Petersen JM. Specificity within the ets family of transcripUon factors. Adv Cancer Res 1998;75:1-55. Dittmer J, Nordheim A. Ets transcripUon factors and human disease. Biochimica et Biophysica Acta 1998;1377:F1-11. Bassuk AG, Leiden JM. The role of Ets transcripUon factors in the development and function of the mammalian immune system. Advances in Immunology 1997;64:65-104. Ghysdael J and Boureux A. The ETS family of transcriptional regulators. In: Yaniv M and Ghysdael J, eds., Oncogenes as TranscripUonal Regulators. Basel: Birkhauser Verlag, 1997;29-88. Bhat NK, Fischinger PF, Seth A, Watson DK, Papas T. Pleiotropic functions of ETS-1. Int J Oncol 1996;8:841-846. Watson DK, McWilliams MJ, Lapis P, Lautenberger JA, Schweinfest CW, Papas TS. MammaUan ets-1 and ets-2 genes encode highly conserved proteins. Proc Natl Acad Sci USA 1998;85:7862-7866. Rao VN, Papas TS, Reddy ES. Erg, a human ets-related gene on chromosome 21: Alternative splicing, polyadenylation, and translation. Science 1987;237:635-639. Rao VN, Huebner K, Isobe M, ar-Rushdi A, Croce CM, Reddy ES. Elk, Ussue-specific ets-related genes on chromosomes X and 14 near translocation breakpoints. Science 1989;244:66-70. Ray D, Culine S, Tavitain A, Moreau-Gachelin F. The human homologue of the putative protooncogene Spi-1: Characterization and expression in tumors [published erratum appears in Oncogene 1990;10:1611-1612]. Oncogene 1990;5:663-668. Watson DK, Smyth FE, Thompson DM, Cheng JQ, Testa JR, Papas TS, Seth A. The ERGB/FH-1 gene: Isolation and characterization of a new member of the family of human ETS transcription factors. Cell Growth Differ 1992;3:705-713. Prasad DD, Rao VN, Reddy ES. Structure and expression of human FU-1 gene. Cancer Res 1992;52:58335837. Dalton S, Treisman R. Characterization of SAP-1, a protein recruited by serum response factor to the c-fos serum response element. Cell 1992;68:597-612.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
Leiden JM, Wang CY, Petryniak B, Markovitz DM, Nabel GJ, Thompson CB. A novel Ets-related transcription factor, Elf-1, binds to human immunodeficiency virus type 2 regulatory elements that are required for inducible trans activation in T cells. J Virol 1992;66:5890-5897. Ray D, Bosselut R, Ghysdael J, Mattel MG, Tavitian A, Moreau-Gachelin F. Characterization of Spi-B, a transcription factor related to the putative oncoprotein Spi-1/PU.l. Mol Cell Biol 1992; 12:4297^304. Watanabe H, Sawada J, Yano K, Yamaguchi K, Goto M, Handa H. cDNA cloning of transcription factor E4TF1 subunits with Ets and notch motifs. Mol Cell Biol 1993;13:1385-1391. Higashino F, Yoshida K, Fujinaga Y, Kamio K, Fujinaga K. Isolation of a cDNA encoding the adenovirus El A enhancer binding protein: A new human member of the ets oncogene family. Nucleic Acids Res 1993;21:547-553. Klemsz M, Hromas R, Raskind W, Bruno E, Hoffman R. PE-1, a novel ETS oncogene family member, localizes to chromosome Iq21-q23. Genomics 1994;20:291-294. Monte D, Baert JL, Defossez PA, de Launoit Y, Stehelin D. Molecular cloning and characterization of human ERM, a new member of the Ets family closely related to mouse PEA3 and ER81 transcription factors. Oncogene 1994;9:1397-1406. Golub TR, Barker GF, Lovett M, Gilliland DG. Fusion of PDGF receptor beta to a novel ets-like gene, tel, in chronic myelomonocytic leukemia with t(5; 12) chromosomal translocation. Cell 1994;77:307-316. Price MA, Rogers AE, Treisman R. Comparative analysis of the ternary complex factors Elk-1, SAPla and SAP-2 (ERP/NET). EMBO J 1995; 14:25892601. Sgouras DN, Athanasiou MA, Beal J, Fisher RJ, Blair DG, Mavrothalassitis GJ. ERF: An ETS domain protein with strong transcriptional repressor activity, can suppress ets-associated tumorigenesis and is regulated by phosphorylation during cell cycle and mitogenic stimulation. EMBO J 1995;14:4781-4793. Jeon IS, Davis JN, Braun BS, Sublett JE, Roussel MF, Denny CT, Shapiro DN. A variant Ewing's sarcoma translocation (7;22) fuses the EWS gene to the ETS gene ETVl. Oncogene 1995;10:1229-1234. Monte D, Coutte L, Baert JL, Angeli I, Stehelin D, de Launoit Y. Molecular characterization of the etsrelated human transcription factor ER81. Oncogene 1995;11:771-779. Oettgen P, Akbarali Y, Boltax J, Best J, Kunsch C, Libermann TA. Characterization of NERF, a novel transcription factor related to the Ets factor ELF-1. Mol Cell Biol 1996;16:5091-5106.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
Miyazaki Y, Sun X, Uchida H, Zhang J, Nimer S. MEF, a novel transcription factor with an Elf1 like DNA binding domain but distinct transcriptional activating properties. Oncogene 1996; 13:17211729. Chang CH, Scott GK, Kuo WL, Xiong X, Suzdaltseva Y, Park JW, Sayre P, Erny K, Collins C, Gray JW, Benz CC. ESX: A structurally unique Ets overexpressed early during human breast tumorigenesis. Oncogene 1997;14:1617-1622. Andreoli JM, Jang SI, Chung E, Coticchia CM, Steinert PM, Markova NG. The expression of a novel, epithelium-specific ets transcription factor is restricted to the most differentiated layers in the epidermis. Nucl Acids Res 1997;25:42874295. Oettgen P, Alani RM, Barcinski MA, Brown L, Akbarali Y, Boltax J, Kunsch C, Munger K, Libermann TA. Isolation and characterization of a novel epithelium-specific transcription factor, ESE-1, a member of the ets family. Molecular & Cellular Biology 1997; 17:4419^433. Tymms MJ, Ng AY, Thomas RS, Schutte BC, Zhou J, Eyre HJ, Sutherland GR, Seth A, Rosenberg M, Papas T, Debouck C, Kola I. A novel epithelial-expressed ETS gene, ELF3: Human and murine cDNA sequences, murine genomic organization, human mapping to lq32.2 and expression in tissues and cancer. Oncogene 1997;15:2449-2462. Choi SG, Yi Y, Kim YS, Kato M, Chang J, Chung HW, Hahm KB, Yang HK, Rhee HH, Bang YJ, Kim SJ. A novel ets-related transcription factor, ERT/ESX/ESE-1, regulates expression of the transforming growth factor-beta type II receptor. J Biol Chem 1998;273:110-117. Peter M, Couturier J, Pacquement H, Michon J, Thomas G, Magdelenat H, Delattre O. A new member of the ETS family fused to EWS in Ewing tumors. Oncogene 1997;14:1159-1164. Aryee DN, Petermann R, Kos K, Henn T, Haas OA, Kovar H. Cloning of a novel human ELF-1-related ETS transcription factor, ELFR, its characterization and chromosomal assignment relative to ELF-1. Gene 1998;210:71-78. Raziuddin S, Al-Janadi MA, Al-Wabel AA. Soluble interleukin 2 receptor levels in serum and its relationship to T cell abnormality and cUnical manifestations of disease in patients with systemic lupus erythematosus. J. Rheum 1991;18:831-836. Ward MW, Dooley MA, Christenson VD, Pisetsky DS. The relationship between soluble interleukin 2 receptor levels and antidouble stranded DNA antibody levels in patients with systemic lupus derythematosus. J. Rheum 1991;18:235-240.
211
37.
38.
39.
40.
212
Mountz DJ, Muschinski FJ, Mark EG, Steinberg DA. Oncogene expression in autoimmune mice. J Mol Cell Immunol 1985;2:121-131. Boumpas DT, Tsokos CG, Mann LD, Eleftheriades GE, Harris CC, Mark EG. Increased protooncogene expression in peripheral blood lymphocytes from patients with systemic lupus erythematosus and other autoimmune diseases. Arthrit Rheumatol 1986;29:755-760. Klinman MD, Muschinski FJ, Honda M, Ishigatsubo Y, Mountz DJ, Raveche E, Steinberg DA. Oncogene expression in autoimmune and normal peripheral blood mononuclear cells. J Exp Med 1986;163:12921307. Deguchi Y, Hara H, Negoro S., Kakunage T, Kishi-
41.
42.
moto S. Proto-oncogene expression in peripheral blood mononuclear cells from patients with systemic lupus erythematosus as an indicator of the disease activity. Clin Immunol Immunopathol 1987;45:424439. Zhang L, Eddy A, Teng Y-T, Fritzler M, Kluppel M, Melet F, Bernstein A. An immunological renal disease in transgenic mice that overexpresses Fli-1, a member of the ets family of transcription factor genes. Mol Cell Biol 1995;15:6961-6970. Georgiou P, Maroulakou IG, Green, JE, Dantis P, Romano-Spica V, Kottaradis S, Lautenberger JA, Watson DK, Papas TS, Fischinger PJ, Bhat, NK. Int J Oncol 1996;9:9-18.
© 2000 Elsevier Science B.V All rights reserved. Cancer and Autoimmunity Y. Shoenfeld and M. E. Gershwin, editors
Immune Response to Himor Stress Proteins—Implications for Vaccine Development Against Cancer Michael Heike and Karl-Hermann Meyer zum Biischenfelde Johannes Gutenberg-UniversitdtMainz, Germany
1. INTRODUCTION Stress proteins or heat shock proteins (HSP) belong to the most conserved proteins. Members of stress protein families are expressed in prokaryotic and eukaryotic cells. The conservation of stress proteins stems from their basic and vital role in cells: prevention of protein aggregation under stress and physiological conditions. Under stress, HSP prevent aggregation of partially denatured and misfolded proteins. Under physiological conditions, they prevent immature folding of nascent proteins, assist intracellular protein transport through membranes, guide the assembly of protein complexes and regulate the function and degradation of cellular proteins [1-4]. An additional role for members of the HSP 70 and 90 families has emerged recently—peptide binding chaperones possibly involved in antigen presentation [5-8]. Stress proteins are discussed as important target antigens in autoimmune diseases and during certain bacterial infections [9, 10]. It is assumed that bacterial infections might trigger T-cell responses against conserved sequences of stress proteins, which can induce or inhibit autoimmune processes [11]. The apparent immunogenicity of stress proteins in autoimmunity and immunity against infections leads to the question whether stress proteins of tumor cells are immunogenic as well. In the following article we will review and discuss whether tumor stress proteins can stimulate a T-cell response of the host and what implications this T-cell response will have for immunity against the tumor or autoimmunity. A major part of the article will focus on the T-cell response induced by tumor stress proteins of the HSP 70 and 90 family includ-
ing the endoplasmic HSP 90 homologue gp96. This T-cell response is stricdy speaking not an autoreactive T-cell response because it is not directed against stress proteins themselves but against peptide antigens complexed with them. However, the tumor stress proteins seem to play a crucial role as carriers and strong natural adjuvants for these tumor peptide antigens.
2. OVEREXPRESSION OF STRESS PROTEINS IN TUMORS: TUMORIGENICITY VERSUS IMMUNOGENICITY The expression of stress proteins in cancer can be altered. An overexpression of constitutively expressed or inducible stress proteins of the HSP 70 and 90 family in tumor tissue has been reported [12-14]. Additionally, an aberrant expression of HSP 70, HSP 90 and gp96 stress proteins on the cell surface of tumor cells has been described constitutively or after induction [12, 15-17]. A loss of stress protein expression has not been reported. A hostile microenvironment with hypoxia, acidosis, glucose starvation will increase stress protein expression in tumors [18] and may confer tumor cells an increased resistance against stress factors and in consequence an increased tumorigenicity. This has been substantiated by several experimental studies and clinical observations. An increased HSP 70 and 60 stress protein expression by ovarian and breast cancer, respectively, has been correlated with an unfavourable prognosis [19, 20]. In experimental tumor models increased stress protein expression correlated with increased tumorigenicity. Menoret and coworkers [21]
213
showed in a rat colon cancer model that tumorigenicity correlated with resistance to glucose starvation and to increased gp96 expression level. Additionally, an increased expression of grp78, the endoplasmic HSP 70 homologue, conferred mouse fibrosarcoma cells an increased resistance against lysis by CTL and TNF [22]. In vivo, HSP 70 and grp78 expression correlated with tumorigenicity of mouse fibrosarcoma cells [23, 24] and this was related with resistance against TNF [25]. However, in other mouse tumor models an inverse correlation between HSP 70 expression and tumorigenicity was found. In these cases expression of HSP 70 correlated with increased immunogenicity of tumor cells [26, 27]. Transfection of mouse tumors with bacterial HSP 60 also led to increased immunogenicity [28].
3. IMMUNE RECOGNITION OF TUMOR STRESS PROTEINS What explanations exist for the correlation of immunogenicity and stress protein expression of tumors? (1) Stress proteins can be recognized by NK cells if they are aberrantly expressed on the cell surface of tumor cells [17, 29]. Multhoff and coworkers [29] described either an heat inducible surface expression of HSP 72 on human sarcoma cells, or a stable HSP 72 surface expression on human colon carcinoma cells [17]. The extent of HSP 72 expression correlated with NK-cell lysis. The NK-cell lysis of tumor cells expressing surface HSP 72 could be blocked by antibodies against HSP 72, indicating that HSP 72 on the surface of tumor cells serves as a NK-cell recognition structure. (2) Stress protein peptide antigens can be recognized by HLA class-II restricted tumor infiltrating lymphocytes (TIL) and may augment a specific immune response against tumors. CD4 positive TIL recognized antigen presenting cells (APC) pulsed with HSP 70 and stressed APC in an HLA-DR restricted fashion [30]. An increased HSP 70 expression by tumor stroma cells, or by tumor cells themselves, may lead to this T-cell response. (3) Stress proteins on the surface of tumor cells can present peptide antigens to certain T-cell populations. Tamura and coworkers [31] reported that an H-ras transformed rat fibrosarcoma-cell line
214
expresses HSP 70 molecules on the cell surface which can be recognized by syngenic CD3 positive, CD4, CD8 and ofjg-TCR negative T cells, presumably y8-T cells. The T-cell recognition was shown to be peptide dependent but MHCunrestricted [32], suggesting that surface HSP 70 on tumor cells can act as an antigen presenting molecule for y8-T cells. HSP 70 expressing tumor cells in this system were more immunogenic in vivo than HSP 70 negative cells, supporting the in vivo relevance of HSP 70 surface expression [31]. A corresponding example was found for a human B-cell lymphoma line, which was shown to be recognized by autologous y8-T cells. These y8T-cell lines recognized an immunoglobuHn peptide presented by an HSP 70 surface molecule [33]. (4) Tumor-derived HSP 70, 90 and gp96 stress proteins were identified as tumor-specific transplantation antigens of chemically induced mouse tumors [34-37]. It was demonstrated in different tumor models that preparations of stress proteins HSP 70, 90 and gp96 from mouse tumors elicit a protective and specific T-cell mediated immunity against the tumor from which the stress protein was derived [38]. The observations under items (3) and (4) have strong implications for vaccine development against cancer, because they suggest that active immunization with stress protein preparations from tumors can elicit tumor-specific T-cell responses and immunologically mediated tumor regressions. This will be reviewed and discussed in the subsequent part of the article.
4. TUMOR-DERIVED STRESS PROTEIN PREPARATIONS AS TUMOR VACCINES Most current strategies of tumor vaccination aim at the activation of a T-cell response against tumors. One reason for this is the observation that immunologically induced tumor regressions in inbred mice are mediated by T cells. The second reason is the knowledge that during carcinogenesis and due to genetic instability multiple random and transformation-related genetic changes take place in tumor cells. These changes lead to the expression of altered proteins and in consequence to the formation of altered peptide epitopes, against which immunological tolerance has not been
developed and which can be recognized by T cells of the host. It has been proposed that the antigenicity of a tumor cell is the consequence of a multitude of altered epitopes, which lead to an individual antigenic finger print for each tumor [39]. However, tumor cells exert a multiplicity of mechanisms to circumvent an effective primary activation of T cells: lack of costimulation [40], secretion of immunosuppressive cytokines, interference with T-cell signal transduction [41], expression of CD95 ligand [42], loss of antigen expression, defects in antigen processing and presentation [43, 44]. It can be followed that an ideal tumor vaccine should have two major characteristics. First, it should mirror the individual antigenicity of a tumor. Second, antigenic epitopes of the vaccine should be presented by professional APC to overcome the suppressive effects of tumor cells on the primary Tcell activation. Tumor-derived HSP 70, 90 or gp96 stress protein preparations as autologous tumor vaccines come near to this ideal because of the following reasons. First, it has been shown that these stress protein preparations elicit an individually distinct transplantation immunity against the tumor from which they were purified [34, 35, 37]. Additionally to the induction of preventive immunity, it was reported recently that HSP 70 and gp96 preparations from tumors also elicit a specific therapeutic immunity against tumors in the early phase of tumor growth and metastasis. This was demonstrated in inbred mice with syngenic carcinogen-induced, UV-induced and spontaneously arisen mouse tumors [45, 46]. The induction of distinct immunity by gp96 vaccination was observed also in other models of immune responses against viral antigens like influenza, SV40, VSV [47^9] and against antigens like yS-galactosidase or H minor antigens [50]. In general, it was observed in these experiments that the vaccination with gp96 preparations elicited CTL responses against antigens of the cells from which gp96 was derived. Second, phagocytic cells in addition to CDS positive T cells were shown to be necessary for the priming phase of gp96-induced tumor immunity, suggesting a role of phagocytic cells as APC [51]. Recendy, it was shown directly that gp96-associated antigens are represented by mouse macrophages in vitro to antigenspecific CDS positive T cells [4S]. These studies suggest that vaccination with gp96 preparations leads to processing of the vaccine by professional phagocytic
APC and to channeling of antigens into the MHC class I restricted antigen presentation pathway. What is the basis for the individually distinct immunity induced by stress protein vaccination, which depends obviously on the cellular source of the stress protein preparation? Polymorphism of the stress proteins gp96, HSP 90 and 70 is unknown within one species and therefore does not explain the distinct immunogenicity of stress protein preparations. A possible explanation would be the association of stress proteins HSP 70, 90 and gp96 with specific peptide antigens in cells. In the recent years substantial experimental evidence has accumulated which verifies this hypothesis.
5. HSP 70,90 AND GP96 ARE PEPTIDE BINDING CHAPERONES The association of stress proteins with peptide antigens can be explained easily with their function to prevent protein aggregation under stress and physiological conditions by binding to exposed peptide stretches of non-native proteins. Under stress conditions stress proteins of the HSP 70 and 90 family are preventing aggregation of partially denatured and misfolded proteins. Under physiological conditions they prevent immature folding of nascent proteins, assist intracellular protein transport through membranes, guide the assembly of protein complexes and regulate function and degradation of cellular proteins [ 1 ^ ] . Due to these functions stress proteins must have the ability to bind promiscuitively to exposed peptide sequences of partially unfolded, misfolded or nascent proteins. Indeed, the ability of HSP 70 to bind short stretches of peptides has been described in vitro [52] and recently the existence of a peptide binding pocket has been demonstrated in the HSP 70 crystal structure [53]. HSP 70 binds and releases peptides by cycles of ATP-hydrolysis and ATP binding [54]. This was recently demonstrated also for immunogenic peptides in vitro [49]. The reconstituted HSP 70/peptide complexes elicited a peptide-specific CTL response in mice. For HSP 90 evidence for two substrate binding sites has been obtained [55]. Peptide binding activity in vitro has also been demonstrated for gp96, the HSP 90 homologue in the endoplasmic reticulum (ER) [49, 56]. The peptide binding of gp96 seems to have
215
a physiological role because it has been shown by peptide translocation assays that gp96 is one of several peptide binding chaperones of the ER [57-59]. The peptide translocation in these studies was TAPdependent, showing that gp96 associates with peptides in the ER. Together these results show that stress proteins of the HSP 70 and 90 family including gp96 are peptide binding chaperones which can associate with a wide array of cellular peptides.
6. ASSOCIATION OF HSP 70 AND GP96 WITH IMMUNOGENIC PEPTIDE ANTIGENS IN CELLS Recently, several studies provided direct evidence that immunogenicity of stress protein preparations is due to bound peptides. Arnold et al. [60] showed that only gp96 preparations from TAP competent cells can induce CTL responses against antigens, whose presentation is TAP-dependent. In conclusion, gp96 can associate with CTL-recognized peptide antigens translocated by TAP. Further studies showed that the depletion of peptides from tumor-derived HSP 70 preparations abrogated their immunogenicity [37, 45, 61]. Two studies obtained direct evidence for the association of naturally processed CTL recognized peptide epitopes with HSP 70 and gp96 in cells. Nieland et al. reported the isolation of a naturally processed VSV-peptide epitope from gp96 preparations of VSV infected cells and Breloer et al. showed the isolation of naturally processed ovalbumin epitopes from gp96 and HSP 70 derived from ovalbumin transfected cells [62,63]. We obtained experimental evidence that gp96 in human melanoma cells is associated with different CTL-recognized melanoma peptide antigens. In these experiments it was observed that HLA-A2 restricted CTL clones specific for different melanoma peptide antigens, especially for a tyrosinase peptide antigen, were preferentially stimulated by gp96 from the autologous melanoma cells in presence of APC [64].
216
7. MECHANISMS OF IMMUNOGENICITY OF TUMOR STRESS PROTEIN PREPARATIONS As stated above, in the current model for the mechanism of gp96-induced tumor-specific immunity gp96peptide complexes are processed by professional phagocytic APC and gp96-associated peptides are channelled into the MHC-class I restricted antigen presentation pathway. This model was corroborated by cell depletion experiments which showed that for the priming phase of gp96-induced immunity CDS positive T cells and phagocytic cells are needed [51] and by representation of gp96-associated peptide antigens by mouse macrophages in vitro [48]. The observation that extremely small quantities of peptides complexed with gp96 are sufficient to induce immunity led to the hypothesis that the uptake of gp96/peptide complexes by APC is receptor-mediated [65]. There is no direct evidence so far that this is the case. We could observe preferential binding of gp96 to monocytes within human PBMC subpopulations and to subpopulations of monocytic dendritic cells (Heike and Bethke, unpublished results). Both APC types could mediate gp96induced CTL activation in our experiments, although dendritic cells were more effective than monocytes. However, a characterization of a stress protein receptor on APC awaits further characterization. The intracellular processing pathways of gp96/peptide complexes in APC remain also unclear. Another function of tumor stress protein preparations, which augments the specific immune responses and may be responsible for the extraordinary effectivity of tumor-derived HSP vaccines is the activation of innate immunity. NK cells are essential in addition to T cells for the gp96-induced therapeutic immunity against tumors in early phases of tumor growth and metastasis [45]. This corresponds to the observation of Multhoff et. al. [16, 29] that NK cells can recognize HSP 70 directly on the surface of human tumor cells. It is still unclear, as to whether, or not, y8-T cells also contribute to stress protein-induced tumor immunity. The demonstration that y^-T cells or CD4/CD8 negative T cells can recognize HSP 70 on the cell surface of tumor cells, presumably in association with specific tumor antigens [32, 33], points to this possibility. In addition to the activation of cytotoxic effector cells of the innate immune system, preliminary data suggest that gp96 preparations primarily activate pro-
fessional APC to release proinflammatory cytokines [48, and Heike et al., unpublished results]. If this can be substantiated, gp96 vaccines would be especially suitable for primary activation of T cells, because they would represent danger signals, which are postulated to be essential for a primary immune activation [66]. Gp96 and possibly other stress proteins like HSP 70 and 90 would then have a unique combination of adjuvant effects: binding to APC, channeling of associated antigens into the MHC class I restricted antigen presentation pathway of APC and primary APC activation to release proinflammatory cytokines. An additional effect would be that the stress proteins themselves elicit a T-cell helper response. These mechanisms might also explain the strong adjuvant effects of the stress proteins HSP 60, 70 and gp96 for antigens from infectious agents complexed with the respective stress proteins or bound covalently to them [49, 67-72]. These stress protein/antigen complexes were clearly superior to the antigens alone in eliciting antigen-specific helper or cytotoxic T-cell responses, antibody responses and protective immunity against the respective infectious agents.
8. INDUCTION OF AUTOIMMUNITY BY TUMOR STRESS PROTEINS? In some experimental models, T-cells recognizing stress protein epitopes, especially from HSP 60, can induce autoimmune disease [9, 73]. Stress protein HSP 60 is a dominant epitope in T-cell responses to certain pathogens, for example mycobacteria [7478]. Since stress proteins are highly conserved with sequence homologies between bacterial and human members of stress protein families, it has been discussed that bacterial infections can trigger autoimmune disease [9, 10, 73, 79]. Recent experimental observations however show that the T-cell response to bacterial heat shock proteins, especially HSP 60, is suppressive for the development of autoimmune disease [11, 80]. So far there is no experimental evidence that stress proteins expressed on tumors cells can trigger an autoimmune response, even in case of an aberrant surface expression. Furthermore, from numerous experiments where HSP 70, 90 and gp96 stress protein preparations from syngenic tumors and normal liver were injected into inbred mice, the development of autoimmune diseases
was not observed or reported [34, 45, 81]. However, this might be due to natural resistance of the mouse strains used in these experiments against autoimmune diseases. The assumed association of stress proteins with endogenous self-peptide antigens in addition to tumor-specific peptide antigens causes concern that the vaccination with tumor stress protein preparations might induce autoimmunity in susceptible individuals. To address this concern, it has to be clarified what categories of endogenous peptide antigens are possibly associated with stress proteins: (1) Self-epitopes presented by MHC; (2) cryptic mimicry epitopes for MHC presented selfepitopes; (3) tumor-specific epitopes; (4) cryptic mimicry epitopes for tumor-specific epitopes; and (5) cryptic epitopes, which do not mimic tumorspecific or self-epitopes. The immunization with epitopes of the first and second category might induce autoimmunity in susceptible individuals, if thymic tolerance has not been developed against these self-epitopes and if the strong adjuvant effect of the stress proteins breaks peripheral tolerance. However, it is more and more recognized that immunization with self-HSP antigens might also cause resistance against the development of autoimmune diseases [73]. Accordingly, the likelihood of an autoimmune disease induced by self-epitopes might even be decreased if these epitopes are complexed with self-HSP. It can be expected that the immunization with epitopes of the third category will induce tumor immunity. Experimental observations support that epitopes of the fourth category, cryptic mimicry epitopes for tumor antigens, are indeed associated with gp96. We observed cross-reactivity of CTL clones specific for melanoma peptide antigens Melan A and a mutated CDK4 epitope with gp96 purified from EBV transformed B cells or from normal human liver [64]. Tamura et al. observed a protective effect against tumor metastasis in a minority of mice imunized with gp96 from normal mouse liver [45]. These observations can be explained by the association of gp96 with cryptic mimicry epitopes for the relevant tumor antigens. Cryptic mimicry epitopes for the Melan A peptide antigen, stimulating the respective CTL clones have been described [82]. Obviously, these cryptic mimicry epitopes for tumor antigens will cause tumor immunity rather than autoimmunity. Antigens
217
gp96 jgjo HSP70 OS HSP90 APC Figure 1. Concept of tumor-derived stress protein (HSP 70, 90, gp96) peptide complexes as autologous tumor vaccines. Stress proteins HSP 70 and 90 in the cytoplasm, and gp96 in the endoplasmic reticulum (ER) are complexed with endogenous tumor peptide antigens. The heterogenous array of peptides associated with the stress proteins mirrors the individual antigenicity of a tumor, a multitude of altered peptide epitopes resulting from its genetic instability. After vaccination the stress protein/peptide complexes are incorporated and processed by professional antigen presenting cells (APC). The exact mechanisms of incorporation (receptor-mediated uptake?) and processing still remain unclear. The peptide antigens associated with stress proteins are channeled into the MHC class I restricted antigen presentation pathway and presented on the surface of APC by MHC class I molecules towards CDS positive T cells. In context of costimulatory signals and a supportive cytokine milieu, tumor-specific CDS positive T cells are efficiently activated and develop to tumor-specific cytotoxic T lymphocytes which can lyse the tumor cells.
of the fifth category will also not trigger autoimmunity but might stimulate a temporary T-cell response which could provide help for a tumor-specific T-cell response. Taking together, the association of stress proteins with endogenous peptide epitopes in addition to tumor-specific epitopes will likely support the induction of tumor immunity rather than autoimmunity in case of tumor stress protein vaccination.
9. CONCLUSION There is a comprehensive experimental evidence that tumor-derived stress protein preparations are effective as autologous tumor vaccines (Fig. 1). Due to this concept, the antigenicity of stress proteins preparations is derived from endogenous peptide antigens complexed with these stress proteins. The vaccination with tumor-
218
derived stress proteins leads to channeling of these tumor peptide antigens into the MHC class I restricted antigen presentation pathway of professional APC. This leads to the primary activation of MHC class I restricted tumor reactive T cells by tumor stress protein vaccines (Fig. 1). The advantage of tumor stress protein vaccines over vaccines consisting of defined tumor antigens lies in the observation that: (i) tumor stress protein preparations mirror the individual antigenicity of a tumor due to its genetic instability; and (ii) that tumor-derived stress proteins were shown to elicit tumor rejections in vivo. The latter has not been shown for most tumor antigens, which were identified by in vitro CTL recognition. There are still a number of open questions concerning the mechanisms at work in stress protein vaccination. It is unclear how stress protein/peptide complexes are incorporated and processed by APC, how associated peptide antigens enter the MHC class I restricted antigen presentation pathway and which APC are effective. It is also unclear how representative the tumor antigens are, which are complexed with the respective stress proteins. It can be assumed that HSP 70, 90 and gp96 are complexed with differing repertoires of peptide antigens due to their different subcellular location and different binding properties. Peptide motifs of endogenous peptides complexed with the different stress proteins have not been published so far. On the other side, there is enough preclinical evidence from different research groups supporting the concept and efficiency of tumor stress proteins as autologous tumor vaccines to start carefully designed studies in cancer patients. The first phase I studies addressing the immunization of cancer patients with autologous gp96/peptide complexes derived from autologous tumor tissue have started in renal cancer, melanoma, pancreatic cancer and gastric cancer. These studies will permit a first analysis whether the vaccination with tumor-derived gp96 preparations elicits a T-cell response against autologous tumor cells in humans.
REFERENCES 1. 2.
Gething M-J, Sambrook J. Protein folding in the cell. Nature 1992;355:33-^4. Craig EA, Weissman JS, Horwich AL. Heat shock proteins and molecular chaperones: mediators of protein conformation and turnover in the cell. Cell 1994;78:365-372.
3. 4. 5.
6.
7.
10.
11.
12.
13.
14.
15.
16.
17.
Buchner J. Supervising the fold: functional principles of molecular chaperones. FASEB J 1996;10:10-19. Hartl F. Molecular chaperones in cellular protein folding. Nature 1996;381:571-579. Vanbuskirk A, Crump BL, Margoliash E, Pierce SK. A peptide binding protein having a role in antigen presentation is a member of the HSP70 heat shock family. J Exp Med 1989;170:1799-1809. Srivastava PK, Heike M. Tumor-specific immunogenicity of stress-induced proteins: convergence of two evolutionary pathways of antigen presentation? Semin Immunol 1991;3:57-64. Williams D, Watts T. Molecular chaperones in antigen presentation. Curr Opin Immunol 1995;7:77-84. Schirmbeck R, Bohm W, Reimann J. Stress protein (hsp73)-mediated, TAP-independent processing of endogenous, truncated SV40 large T antigen for Db-restricted peptide presentation. Eur J Immunol 1997;27:2016-2023. Cohen I. Autoimmunity to chaperonins in the pathogenesis of arthritis and diabetes. Ann Rev Immunol 1991;9:567-590. Young DB. Heat-shock proteins: immunity and autoimmunity. Curr Opin Immunol 1992;1992:396400. Van der Zee R, Anderton S, Prakken A, Paul A, van Eden W. T cell responses to conserved bacterial heatshock protein epitopes induce resistance in experimental autoimmunity. Semin Immunol 1998; 10:3541. Ferrarini M, Heltai S, Zocchi MR, Rugarli C. Unusual expression and localization of heat-shock proteins in human tumor cells. Int J Cancer 1992;51:613-619. Gress TM, Miiller-Pilasch F, Weber C, Lerch M, Friess H, Buchler M, Beger HG, Adler G. Differential expression of heat shock protein in pancreatic carcinoma. Cancer Res 1994;54:547-551. Jameel A, Skilton RA, Campbell TA, Chander SK, Coombes RC, Luqmani YA. Clinical and biological significance of HSP89 alpha in human breast cancer. Int J Cancer 1992;50(3):409^15. Altmeyer A, Maki R, Feldweg A, Heike M, Protopopov V, Masur S, Srivastava P. Tumor-specific cell surface expression of the -KDEL containing, endoplasmic reticular heat shock protein gp96. Int J Cancer 1996;69:340-349. Multhoff G, Botzler C, Wiesnet M, Miiller E, Meier T, Wilmanns W, Issels R. A stress-inducible 72-kDa heat-shock protein (HSP72) is expressed on the surface of human tumor cells, but not on normal cells. Int J Cancer 1995;61:272-279. Multhoff G, Botzler C, Jennen L, Schmidt J, Ellwart J, Issels R. Heat shock protein 72 on tumor
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
cells. A recognition structure for natural killer cells. J Immunol 1997;158:4341^350. Vaupel P, Kallinowski F, Okunieff R Blood flow, oxygen and nutrient supply, and metabolic microenvironment of human tumors: a review. Cancer Res 1989;49:6449-6464. Ciocca D, Clark G, Tandon A, Fuqua S, Welch W, McGuire W. Heat shock protein hsp70 in patients with axillary lymph node negative breast cancer: prognostic implications. J Natl Cancer Inst 1993;85:570-574. Kimura E, Enns RE, Alcaraz JE, Arboleda J, Slamon DJ, Howell SB. Correlation of the survival of ovarian cancer patients with mRNA expression of the 60-kD heat-shock protein HSP-60. J Clin Oncol 1993;11:891-898. Menoret A, Meflah K, Le Pendu J. Expression of the 100-kDa glucose-regulated protein (GRPlOO/endoplasmin) is associated with tumorigenicity in a model of rat colon adenocarcinoma. Int J Cancer 1994;56:400^05. Sugawara S, Takeda K, Lee A, Dennert G. Suppression of stress protein GRP78 induction in tumor B/CIOME eliminates resistance to cell mediated cytotoxicity. Cancer Res 1993;53:6001-6005. Jaatela M. Over-expression of hsp70 confers tumorigenicity to mouse fibrosarcoma cells. Int J Cancer 1995;60:689-693. Jamora C, Dennert G, Lee A. Inhibition of tumor progression by suppression of stress protein GRP78/BiP induction in fibrosarcoma B/CIOME. Proc Natl Acad Sci 1996;93:7690-7694. Jaattela M, Wissing D, Bauer PA, Li GC. Major heat shock protein hsp70 protects tumor cells from tumor necrosis factor cytotoxicity. EMBO J 1992; 11:35073512. Menoret A, Patry Y, Burg C, Le Pendu J. Cosegregation of tumor immunogenicity with expression of inducible but not constitutive hsp70 in rat colon carcinomas. J Immunol 1995;155:740-747. Melchers A, Todryk S, Hardwick N, Ford M, Jacobson M, Vile R. Tumor immunogenicity is determined by the mechanism of cell death via induction of heat shock protein expression. Nature Medicine 1998;4:581-587. Lukacs K, Lowrie D, Stokes R, Colston M. Tumor cells transfected with a bacterial heat-shock gene lose tumorigenicity and induce protection against tumors. J Exp Med 1993;178:343-348. Multhoff G, Botzler C, Wiesnet M, Eissner G, Issels R. CD3- large granular lymphocytes recognize a heatinducible immunogenic determinant associated with the 72-kD heat shock protein on human sarcoma cells. Blood 1995;86:1374-1382.
219
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40. 41.
42.
43.
220
Yoshino I, Goedegebuure PS, Peoples GE, Lee KY, Eberlein TJ. Human tumor-infiltrating CD4+ T cells react to B cell lines expressing heat shock protein 70. J Immunol 1994;153:4149^158. Tamura Y, Tsuboi N, Sato N, Kikuchi K. 70 kDa heat shock cognate protein is a transformation-associated antigen and a possible target for the host's anti-tumor immunity. Cancer Res 1993;151:5516-5524. Takashima S, Sato N, Kishi A, Tamura Y, Hirai I, Torigoe T, Yagihashi A, Takahashi S, Sagae S, Kudo R, Kikuchi K. Involvement of peptide antigens in the cytotoxicity between 70-kDa heat shock protein-like molecule and CD3+, CD4-, CD8-, TCR-ofiS-killer T cells. J Immunol 1996;157:3391-3395. Kim HT, Nelson EL, Clayberger C, Sanjanwala M, Sklar J, Krensky AM. Gamma delta T cell recognition of tumor Ig peptide. J Immunol 1995;154:1614-1623. Srivastava PK, DeLeo A, Old LJ. Tumor rejection antigens of chemically induced sarcomas of inbred mice. Proc Natl Acad Sci USA 1986;83:3407-3411. Ullrich SJ, Robinson EA, Law LW, Willingham M, Appella E. A mouse tumor-specific transplantation antigen is a heat shock-related protein. Proc Natl Acad Sci USA 1986;83:3121-3125. Maki RG, Old LJ, Srivastava PK. Human homologue of murine tumor rejection antigen gp96: 5'-regulatory and coding regions and relationship to stress-induced proteins. Proc Natl Acad Sci USA 1990;87:56585662. Udono H, Srivastava PK. Heat shock protein 70associated peptides elicit specific cancer immunity. J Exp Med 1993;178:1391-1396. Heike M, Noll B, Meyer zum Biischenfelde KH. Heat shock protein-peptide complexes for use in vaccines. J Leukoc Biol 1996;60:153-158. Srivastava P, Menoret A, Basu S, Binder R, McQuade K. Heat shock proteins come of age: Primitive functions acquire new roles in an adaptive world. Immunity 1998;8:657-665. Lanzavecchia A. Identifying strategies for immune intervention. Science 1993;260:937-944. Mizoguchi H, O' Shea J, Longo D, Leffler C, McVicar D, Ochoa A. Alterations in signal transduction in T lymphocytes from tumor-bearing mice. Science 1992;258:1795-1798. Strand S, Hofmann W, Hug H, Mliller M, Oho G, Strand D, Mariani S, Stremmel W, Krammer P, Galle PR. Lymphocyte apoptosis induced by CD95 (APO1/Fas) ligand-expressing tumor cells—A mechanism of immune evasion. Nature Medicine 1996;2:13611366. Heike M, Schmitt U, Hohne A, Huber C, Meyer zum Buschenfelde K-H, Seliger B. Impaired HLA-class I stability in a sarcoma cell line which stimulates exclu-
44. 45.
46.
47.
48.
49.
50.
51.
52.
53.
54.
55.
56.
57.
sively HLA-class II restricted autologous T cells. Int J Cancer 1996;67:743-748. Seliger B, Maeurer M, Ferrone S. TAP off-tumors on. Immunol Today 1997;18:292-299. Tamura Y, Peng P, Liu K, Daou M, Srivastava PK. Immunotherapy of tumors with autologopus tumorderived heat shock protein preparations. Science 1997;278:117-120. Nicchitta C. Biochemical, cell biological and immunological issues surrounding the endoplasmic reticulum chaperone GRP94/gp96. Curr Opin Immunol 1998;10:103-109. Blachere NE, Udono H, Janetzki S, Li Z, Heike M, Srivastava PK. Heat shock protein vaccines against cancer. J Immunother 1993;14:352-356. Suto R, Srivastava PK. A mechanism for the specific immunogenicity of heat shock protein-chaperoned peptides. Science 1995;269:1585-1588. Blachere N, Li Z, Chandawarkar RY, Suto R, Jaikaria NS, Basu S, Udono H, Srivastava PK. Heat shock protein-peptide complexes reconstituted in vitro, elicited peptide-specific cytotoxic T lymphocyte response and tumor immunity. J Exp Med 1997;186:1315-1322. Arnold D, Faath S, Rammensee H-G, Schild H. Crosspriming of minor histocompatibility antigen-specific cytotoxic T cells upon immunization with the heat shock protein gp96. J Exp Med 1995;182:885-889. Udono H, Levey DL, Srivastava PK. Cellular requirements for tumor-specific immunity elicited by heat shock proteins: tumor rejection antigen gp96 primes CD8+ T cells in vivo. Proc Natl Acad Sci U S A 1994;91:3077-3081. Flynn GC, Pohl J, Flocco MT, Rothman JE. Peptidebinding specificity of the molecular chaperone BiP. Nature 1991;353:726-730. Zhu X, Zhao X, Burkholder W, Gragerov A, Ogata C, Gottesmann M, Hendrickson W. Structural analysis of substrate binding by the molecular chaperone DnaK. Science 1996;272:1606-1614. Palleros DR, Shi L, Reid KL, Fink AL. Hsp70protein complexes. Complex stability and conformation of bound substrate protein. J Biol Chem 1994;269:13107-13114. Scheibel T, Weikl T, Buchner J. Two chaperone sites in Hsp90 differing in substrate specificity and ATP dependence. Proc Natl Acad Sci USA 1998;95:14951499. Wearsch P, Nicchitta C. Interaction of endoplasmic reticulum chaperone GRP94 with peptide substrates is adenine nucleotide-independent. J Biol Chem 1997;272:5152-5156. Lammert E, Arnold D, Nijenhuis M, Momburg F, Hammerling G, Brunner J, Stevanovic S, Rammensee
58.
59.
60.
61.
62.
63.
64.
65.
66. 67.
68.
69.
H-G, Schild H. The endoplasmic reticulum-resident stress protein gp96 binds peptides translocated by TAP. Eur J Immunol 1997;27:923-927. Marusina K, Reid G, Gabathuler R, Jefferies W, Monaco JJ. Novel peptide binding proteins and peptide transport in normal and TAP-deficient microsomes. Biochemistry 1997;36:856-863. Spec. P, Neefjes J. TAP-translocated peptides specifically bind proteins in the endoplasmic reticulum, including gp96, protein disulfide isomerase and calreticuHn. Eur J Immunol 1997;27:2441-2449. Arnold D, Wahl C, Faath S, Rammensee G, Schild H. Influences of transporter associated with antigen processing (TAP) on the repertoire of peptides associated with the endoplasmic reticulum-resident stress protein gp96. J Exp Med 1997;186:461-466. Peng P, Menoret A, Srivastava PK. Purification of immunogenic heat shock protein hsp70-peptide complexes by ADP-affinity chromatography. J Immunol Meth 1996;204:13-21. Nieland TJ, Tan MC, Monne van Muijen M, Koning F, Kruisbeek AM, van Bleek GM. Isolation of an immunodominant viral peptide that is endogenously bound to the stress protein GP96/GRP94. Proc Natl Acad Sci USA 1996;93:6135-6139. Breloer M, Marti T, Fleischer B, Von Bonin A. Isolation of processed, H-2Kb-binding ovalbumin-derived peptides associated with the stress proteins HSP70 and GP96. Eur J Immunol 1998;28:1016-1021. Heike M, Noll B, Bernhard H, Batten W, Bethke K, Weinmann A, Schmitt U, Meyer zum Biischenfelde K-H. Stress protein gp96 purified from melanoma cells stimulates autologous CTL against melanoma peptide antigens (submitted). Srivastava PK, Udono H, Blachere NE, Li Z. Heat shock proteins transfer peptides during antigen processing and CTL priming. Immunogenetics 1994;39:93-98. Matzinger P. Tolerance, danger, and the extended family. Ann Rev Immunol 1994;12:991-1045. Lussow AR, Barrios C, Van Embden J, Van der Zee R, Verdini AS, Pessi A, Louis JA, Lambert PH, Del Giudice G. Mycobacterial heat-shock proteins as carrier molecules. Eur J Immunol 1991;21:2297-2302. Barrios C, Lussow AR, Van Embden J, Van der Zee R, RappuoH R, Costantino P, Louis JA, Lambert PH, Del Giudice G. Mycobacterial heat-shock proteins as carrier molecules. II: The use of the 70-kDa mycobacterial heat-shock protein as carrier for conjugated vaccines can circumvent the need for adjuvants and Bacillus Calmette Guerin priming. Eur J Immunol 1992;22:1365-1372. Suzue K ZX, Eisen HN, Young RA. Heat shock fusion proteins as vehicles for antigen delivery into the
70.
71.
72.
73.
74.
75.
76.
77.
78.
79.
80.
major histocompatibility complex class I presentation pathway. Proc Nad Acad Sci USA 1997;94:1314613151. Roman E, Moreno C. Synthetic peptides noncovalently bound to bacterial hsp 70 elicit peptidespecific T-cell responses in vivo. Immunology 1996;88:487-492. Roman E, Moreno C. Delayed-type hypersensitivity elicited by synthetic peptides complexed with Mycobacterium tuberculosis hsp 70. Immunology 1997;90:52-56. Ciupitu A-M, Pertersson M, O'Donnell C, WilUams K, Jindal S, Kiesshng R, Welsh R. Immunization with a lymphocytic choriomeningitis virus peptide mixed with heat shock protein 70 results in protective antiviral immunity and specific cytotoxic T lymphocytes. J Exp Med 1998;187:685-691. Van Eden W. Heat-shock proteins as immunogenic bacterial antigens with the potential to induce and regulate autoimmune arthritis. Immunol Rev 1991;121:5-28. Ottenhoff TH, Ab BK, Van Embden JD, Thole JE, Kiessling R. The recombinant 65-kD heat shock protein of Mycobacterium bovis Bacillus CalmetteGuerin/M. tuberculosis is a target molecule for CD4-Icytotoxic T lymphocytes that lyse human monocytes. J Exp Med 1988;168:1947-1952. Munk ME, Schoel B, Modrow S, Karr RW, Young RA, Kaufmann SH. T lymphocytes from healthy individuals with specificity to self-epitopes shared by the mycobacterial and human 65-kilodalton heat shock protein. J Immunol 1989;143:2844-2849. Kaufmann SH, Schoel B, van Embden JD, Koga T, Wand-Wurttenberger A, Munk ME, Steinhoff U. Heat-shock protein 60: imphcations for pathogenesis of and protection against bacterial infections. Immunol Rev 1991;121:67-90. Mustafa AS, Lundin KE, Oftung R Human T cells recognize mycobacterial heat shock proteins in the context of multiple HLA-DR molecules: studies with healthy subjects vaccinated with Mycobacterium bovis BCG and Mycobacterium leprae. Infect Immun 1993;61:5294-5301. Silva CL, Silva MF, Pietro RC, Lowrie DB. Protection against tuberculosis by passive transfer with T-cell clones recognizing mycobacterial heat-shock protein 65. Immunology 1994;83:341-346. Li SG, Quayle AJ, Shen Y, Kjeldsen-Kragh J, Oftung F, Gupta RS, Natvig JB, Forre OT. Mycobacteria and human heat shock protein-specific cytotoxic T lymphocytes in rheumatoid synovial inflammation. Arthrit Rheumatol 1992;35:270-28L Elias D, Cohen IR. Peptide therapy for diabetes in NOD mice. Lancet 1994;343:704-706.
221
81.
82.
Udono H, Srivastava PK. Comparison of tumorspecific immunogenicities of stress-induced proteins gp96, hsp90, and hsp70. J Immunol 1994;152:53985403. Loftus DJ, Castelli C, Clay TM, Squarcina P, Marincola FM, Nishimura MI, Parmiani G, Appella E, Rivoltini L. Identification of epitope mimics recognized by CTL reactive to the melanoma/melanocyte-derived peptide MART-1(27-35). J Exp Med 1996;184:647657.
NOTE ADDED IN PROOF Evidence for receptor-mediated endocytosis of gp96 and HSP70 by AFC has recently been provided
222
(Amold-Schild D, Hanau D, Spehner D, Schmid C, Rammensee H-G, De la Salle H, Schild H. Receptor-mediated endocytosis of heat shock proteins by professional antigen-presenting cells. J Immunol 1999;162:3757-3760. Calreticulin, a known peptide binding endoplasmic chaperone has recently been identified as a tumor specific transplantation antigen and was demonstrated to elicit CTL responses in inbred mice against associated peptide antigens (Basu S, Srivastava PK. Calreticulin, a peptide-binding chaperone of the endoplasmic reticulum, elicits tumor- and peptide-specific immunity. J Exp Med 1999;189:797802.)
(c) 2000 Elsevier Science B.V. All rights reserved. Cancer and Autoimmunity Y. Shoenfeld and M. E. Gershwin, editors
Autoimmunity and B-Cell Malignancies O. Pritsch and G. Dighiero Institut Pasteur, Paris, France
SUMMARY There is evidence indicating that autoreactive B cells constitute a substantial part of the B-cell repertoire. This autoreactive repertoire secretes the so-called natural autoantibodies characterized by their broad reactivity mainly directed against well conserved public epitopes. Their germinal origin is suggested by their early appearance during ontogeny, their expression of cross-reactive idiotopes and structural studies of their sequence. As for the physiological role of the repertoire, they may play a major role as a first barrier of defense. It is presently unknown whether, or not, these polyreactive B cells could constitute a pre-immune template which through an antigen-driven process may be involved in the production of immune high affinity antibodies. Studies carried out in monoclonal gammopathies, chronic lymphocytic leukemia and follicular lymphomas, demonstrated that this autoreactive B-cell repertoire frequently undergoes malignant transformation, although there is controversy concerning the reasons for this. It has been postulated that the continuous challenge of this autoreactive repertoire by self-antigens could create propitious conditions for malignant transformation to occur. However, this hypothesis needs to be substantiated.
1. INTRODUCTION The historical key-concept of humoral immunity is based on three major properties of antibodies (Abs): nonself-specificity, monospecificity and immune memory. In 1900, a group from Metchnikoff suggested the concept of autoimmunization by demonstrating the presence of autoantibodies in normal con-
ditions [1, 2]; which was opposed to the concept of horror autotoxicus raised by Ehrlich and Morgenroth [3, 4]. At nearly the same time, Landsteiner [5] described the rules governing blood compatibility. He showed that a subject will never be able to produce auto-Abs against the major blood group antigens. These results provided strong support for Ehrlich and Morgenroth's idea. Although, Metalnikoff [1] clearly demonstrated that animals were able to produce autoantibodies against spermatozoids, their significance was soon confined to the convenient explanation of a pathological process. The influence of Ehrlich ideas was so strong that these experiments were forgotten, and when Donath and Landsteiner [6] described an autoantibody for the first time— the biphasic hemagglutinin responsible for paroxismal cold hemoglobinuria—they failed to call it an autoantibody. In 1949, Burnet and Fenner [7] proposed the clonal deletion theory, which was strongly influenced by the experiments conducted by Owen [8] with dizygotic calfs sharing a single placenta. The red blood cells from these two calfs were mixed but, despite the fact that they expressed different blood groups, they were displaying double populations of red blood cells at birth, and each was unable to produce alloantibodies against the blood group from the other. The interpretation of these experiments led Burnet and Fenner [7] to elaborate on the clonal deletion theory. This was an excellent theory that explained tolerance and autoimmunity in a simple way. Autoimmunity, according to this theory, would only arise as a consequence of somatic mutation, which is an unusual phenomenon. During recent years, however, evidence has emerged indicating that the autoreactive repertoire is an important component of the normal B-cell reper-
223
toire which is frequently involved in malignant transformation.
2. THE AUTOREACTIVE REPERTOIRE IS AN IMPORTANT COMPONENT OF THE NORMAL B-CELL REPERTOIRE In 1956, Witebsky and Rose [9] induced for the first time, an experimental autoimmune disease mediated by autoantibodies: autoimmune thyroiditis. They succeeded in inducing the disease by injecting thyroglobulin in the presence of Freund's adjuvant. Since they were able to produce autoantibodies, the precursor B cells producing these should exist. More recently, considerable data have accumulated raising doubts concerning the clonal deletion theory as an unique explanation for tolerance since: (1) autoimmune diseases can be induced by injecting organ extracts [9]; (2) numerous autoantibodies have been demonstrated under normal conditions [10-12]; and (3) autoantibodies have been induced from normal B lymphocytes upon mitogenic stimulation [13, 14]. In the early eighties, our group [15], and several other groups [16, 17], demonstrated the presence of polyreactive auto-Abs naturally occurring in the serum of all normal subjects, and that myeloma proteins frequently correspond to expansion of these polyreactive auto-Abs [18, 19]. We could also demonstrate a high frequency of precursor B cells displaying natural autoantibody (NAA) activity [20, 21]. These data were further confirmed and expanded to wider developments by multiple functional and structural studies (reviewed in [22, 23]). Thus, we have evolved from Ehrlich and Morgenroth's [3,4] "horror autotoxicus" notion, to Burnet and Fenner's [7] forbidden clones hypothesis, to now reach the view that autoimmunity is a normal physiological phenomenon. But, how can we reconcile the experiments from Metchnikoff [1] with those from Ehrlich and Morgenroth [3, 4] and Landsteiner [5], since all these results could never be challenged. Experiments with transgenic mice allows for the integration of all this experimental evidence. Nemazee and Burki [24] created transgenic mice by transfecting both an Ig transgene with antibody activity against class I antigens of the major histocompatibility complex (MHC), and the respective MHC antigen recognized by the antibody transgene. This is a very critical situation,
224
since the transgene is recognizing a determinant of polymorphism, that is a real self-antigen. In that case, according to Burnet and Fenner's prediction, the transgene is deleted. However, if transgenic mice are created expressing Ig transgenes with autoantibody activity, which is not directed against critical self-polymorphic determinants as is the case for antiDNA and antilysozyme antibodies, the transgene is not deleted—it is simply down-regulated or anergized [25, 26]. These experiments throw light on the apparent discrepancy between EhrHch and Morgenroth [3, 4], Landsteiner [5] and Metchnikoff [1]. Indeed, the observation that a subject expressing the A or B group will never produce autoantibodies against these determinants is widely accepted, and we know of no cases of autoimmune hemolytic anemias displaying autoantibodies with this specificity. However, the production of autoantibodies against public antigens like the I group, is a common phenomenom. Hemolytic anemia autoantibodies are all directed against these public antigens. So, the B-cell repertoire that is going to be directed against critical self-determinants will probably be subjected to a very stringent negative selection, i.e., deletion, whereas the repertoire that is directed against determinants shared by all individuals without belonging to the species (public self-antigens) is probably not deleted and is an important component of the normal immune repertoire. These NAA are characterized by their widespread- but low affinity-binding pattern. These results indicate that, in normal serum, a substantial proportion of circulating Igs are indeed NAA, and the precursors of this autoreactive repertoire account for a substantial part of the normal B cells. As these autoantibodies express recurrent idiotopes and V genes frequently in germinal configuration and predominate early in life, they are the expression of the germinal repertoire [27-30]. They are autoantibodies because they bind autoantigens. However, they are not self-specific, because they have never been reported to exist against the very critical self-antigens such as the A and B red blood-cell groups. On the contrary, these autoantibodies bind public epitopes shared by all individuals belonging to a given species, and even antigens that are well conserved during evolution. However, this is also the characteristic of pathogenic autoantibodies observed in autoimmune diseases. For example, anti-red blood cell autoantibodies recognize public antigens; anti-DNA from systemic lupus ery-
thematous (SLE) patients recognize human, rat and murine DNA; anti-AChR autoantibodies recognize human and even fish receptors, etc. [22]. One of the major characteristics of NAA is their broad specificity that allows them to bind self- and nonself-antigens such as microbial molecules. Interestingly, this repertoire has been found in species phylogenetically distant from mammals such as fish and batracians [31], where this specificity can be associated with the immune defences against infections [32]. We know that these animals are unable to make somatic mutations and produce highly specific, highaffinity antibodies. Hence, their repertoire is much less diverse [32]. When the possibility of high diversification is absent, the only possible strategy is to produce these polyreactive, low-affinity antibodies. The reason why they are conserved during evolution is probably to serve as a first barrier of defence. Even with a memory response to a foreign antigen it takes 5-6 days to obtain high-affinity antibodies. This polyreactive NAA repertoire might be the system that is coping with aggression during this time. The possibiUty exists that these polyreactive NAA could constitute a template on which Ag-driven selection and somatic mutation could operate to derive highly specific immune antibodies [20, 22]. However, this hypothesis requires an experimental verification.
3. NAA CLONES ARE FREQUENTLY COMMITTED TO MALIGNANT TRANSFORMATION Accumulated evidence indicates that this autoreactive B-cell repertoire frequendy undergoes a malignant transformation. This evidence arose from the study of monoclonal immunoglobulins (MIg), chronic lymphocytic leukemia (CLL) and follicular non-Hodgkin lymphomas (FNHL).
has been reported against: (1) I blood group antigen (cold agglutinins, [CA]); (2) the Fc fraction of IgG (rheumatoid factor [RF]); (3) cytoskeleton proteins and DNA (polyreactive autoantibodies); and (4) antimyelin associated glycoproteins (MAG). 3.1.1. MIg with CA activity An interesting exception to the usage of multiple VH segments in the case of pathogenic human autoantibodies, is given by anti-Ii cold agglutinins. Pioneer work by Williams et al. [34] demonstrated that these cold agglutinins were sharing recurrent idiotopes. This result suggested the presence of common V-region structures shared by these pathogenic autoantibodies leading to hemolytic anemia. Recent structural studies substantiated this theory by demonstrating that anti-Ii autoantibodies are constantly encoded by the VH421 gene segment, which is frequently associated to a V/cIII gene [35-37]. The structural basis of the recurrent idiotope detected by the rat anti-idiotypic antibody 9G4, which binds to these autoantibodies and inhibits the binding of these to red blood cells, was recently elucidated by Potter et al. [38], who showed that the presence of an AVY motif in positions 2 3 25 of the FRl region of the antibody, constituted the reactive site of the idiotope. The structural relationship between this binding site and that of the antigen is unclear as yet. Cold agglutinins share a gross antigenic specificity but differ in their fine antigenic specificity. According to Silberstein et al. [36], the gross anti-Ii specificity could be regulated by the VH4-21 region, whereas, the fine specificity could be determined by the CDR3 regions, which differ among the different cold agglutinins. CA paraproteins are almost constantly IgM/c paraproteins, which usually react with a set of antigenic determinants directed against the li system, or compound antigens including li (Al, HI, etc.). Their activity is increased by cold, but thermal amplitude is variable [39].
3.1. Antibody Activity of MIg 3.1.2. MIg with RF activity MIg correspond to normal synthetic products whose counterpart can be found in the heterogenous normal Ig compartment. The antibody-like activity of MIg has been described against a large number of antigens, e.g., bacterial antigens, plasma proteins, tissue antigens and nonbiological haptens [33]. However, an impressive and unexpected frequency of activities
Since the first report by Kritzman et al. [40] of a monoclonal IgM/c paraprotein with anti-IgG activity, an increasing number of cases have been reported, and the frequency of this specificity has been estimated at more than 10% of total IgM, paraproteins [41]. Most monoclonal components with reported RF activity.
225
were found to form a cryoprecipitate. Almost all cases corresponded to IgM/c MIg, but rare cases of human monoclonal IgG and IgA with RF activity and cryoprecipitables have been described. Agnello et al. [42] first reported the presence of cross-reactive idiotypic (CRY) specificities among these MIg. Sixty percent of these MIg displaying RF activity were found to share a major CRI called Wa; 20% belonged to a less common CRI designated Po, and a few expressed a more rare CRI, named Bla. During recent years, considerable work, largely emanating from the group of Dennis Carson, has contributed important information concerning this type of MIg, by precisely defining genetic origins in serological and structural terms [43]. These studies were mainly focused on MIg sharing the Wa CRI. It was found that: (a) almost all Wa+ RF share the 17109 CRI related to light chains and the G6 idiotype related to heavy chains; (b) they constantly express the minor subgroup V/cIIIb light chain; (c) the V/c light chain is derived from a single germinal gene (Hum/c v325), since most Wa"^ paraproteins display an identical or nearly identical light chain sequence, as stated by 13 complete light chain sequences; and (d) there is strong sequence homology among /x chains expressing the Wa idiotype. Most of them use the VHl family (80%) and the minority use VH2 and VH3 families. Although information derived from Po"^ RF MIg is less extensive, they appear to constantly use a V/c germinal gene (Hum/cv328) and to use a conserved VH3 sequence [43, 44]. More recently, it has been demonstrates that the idiotype Bla was encoded by a gene of the VH4 gene family [45].
a monoclonal Ig with anti-DNA activity. However, only 25% of these MIg were demonstrated to possess anti-DNA activity. Another anti-idiotypic reagent (F4) was found to be present in 12% of MIg and was found to be strongly associated with IgG isotype and anti-DNA activity [48]. The sequences of myeloma immunoglobulin genes do reveal a lot of information about the stage in the B-cell differentiation pathway in which the oncogenic event might have taken place. The presence of somatic mutations in a nonrandom fashion without intraclonal variation leads to the conclusion that the precursor myeloma cell could not possibly be a pre-B cell or stem cell but has to be a mature B cell that has been in contact with antigen and has past through the phase of somatic mutation, like a memory B cell or plasmablast [49]. 3.1.4. MIg with anti-MAG activity A peripheral neuropathy is observed in about 5% of Waldenstrom's macroglobulinemia patients [50, 51]. In a majority of these cases MIg display an antibody activity against a myelin associated glycoprotein (MAG). The epitope recognized corresponds to a glycuronyl sulfate group. However, the pathogenic role of the MIg is not definitively established. Brouet et al. [51], reported a recurrent idiotype among 9 MIg with anti-MAG activity. Six out of these 7 MIgs for which studies could be performed were expressing VH3 and the remaining VH2. Interestingly the rare V/c IV family was found in 3 cases, V/c I in 2 and V/c II in 1 and the remaining patient expressed X light chain.
3.1.3. MIg with polyreactive activity
3.1.5. Antibody activity of the CD^^ CLL-B lymphocytes
Prompted by our results in normal human serum in the early 80s, we screened 612 MIg for the presence of antibody activity directed against cytoskeleton proteins and DNA. Our results indicated that about 6% of all MIg and 10% of IgM paraproteins bound to these antigens, and that most of them displayed a polyreactive pattern of binding comparable to that found in normal human serum, indicating that MIg frequently correspond to expansion of a clone normally producing a NAA [18, 19]. Dellagi et al. [46] also reported the presence of IgM paraproteins binding to intermediate filaments, and Shoenfeld et al. [47] found that more than 10% MIg shared the 16-6 CRI derived from
One of the main difficulties in working with CLLB lymphocytes arises from the fact that these cells are highly resistant to transformation by Epstein-Barr virus (EBV) and only a few EBV cell lines have been obtained from CLL-B lymphocytes [52]. Given this difficulty, recent work was performed by using mitogenic stimulation of CLL-B lymphocytes and succeeded to demonstrate autoantibody production by these cells [53, 54]. With the aim to obtain long-term cell lines that would enable production of high level of Ig and permit studies at the molecular level, we have fused leukemic lymphocytes from 27 different CLL patients with the nonsecreting X-63 mouse myeloma.
226
We have found that 11 out of the 19 patients for which we could study antibody activity were expressing autoantibody activity [55]. These results were indicating that CD^+ B-CLL lymphocytes are frequently committed to the production of natural autoantibodies. In addition, the surprising high frequency of this autoantibody activity among CLL-B lymphocytes favors the idea that CLL-B cells are expressing a restricted set of genes. In a recent work, Kipps et al. [56, 57] found that a high proportion of B-CLL cells expressing K at the membrane reacted with a murine anti-idiotypic antibody raised against a monoclonal IgM rheumatoid factor expressing the idiotype Wa. Analysis of V/c genes expressed by leukemic cells sharing idiotype Wa, enabled these authors to demonstrate that they were employing the germinal ummutated Hum/c v 325 germinal gene. Humphries et al. [58] reported that 30% of CLL patients were expressing the 5-51, which is one of the two germinal members of the VH5 family. Logtenberg et al. [59] found that CLLB lymphocytes express VH4 in 50% of cases, VH5 in 20% and VH6 in 15%. Similar restriction was found for VH genes, since the germinal VHl 1-69 gene, was found to be expressed in 20% of CLL cases [57]. We have studied VH expression in 40 CD^+ B-CLL and found that VHl was employed in 17%, VH2 in 8%, VH3 in 36%, VH4 in 17%, VH5 in 8% and VH6 in 14% [60]. Although, our study failed to find the same incidence of the small VH4, VH5 and VH6 families; it shows a clear overrepresentation of these. The analysis of individual expression of VH genes reveals a skewed expression. According to the complexity of the system, if gene expression follows a stochastic process, each VH gene should be expressed in about 2% of cases. However, by pooling the results from 156 sequences derived from different published series [61-69] it appears that some genes like 4-34 and 1-69 (10% each), 4-39, 3-07 and 3-23 (6% each), and 1-02 and 1-18 (5% each), are overexpressed in B CLL and that these seven different genes account for 48% expression in CLL, as compared to the 14% expression that would be expected in the case of a stochastic process. In contrast, 15 different VH genes among the 51 functionally existing VH genes, i.e., the 1-24,1-45, 1-e, 1-f, 2-70,3-20,3-43,3-d, 3-64,3-72,4-28,4-b, 461, 4-30.1 and 4-30.4 genes, have never been reported to be expressed in B-CLL [61-69] and Pritsch et al. (unpublished).
Although, skewed expression of VH genes could result as a consequence of a selective process driven by the antigen, overexpression for most of these genes (1-18, 3-07,3-23, 4-34, 4-39) has also been found in the fetal and adult normal repertoires [34-37]. Thus, the reasons for the overexpression of these genes in CLL and the normal repertoire remain unclear. Several explanations have been proposed, including the occurrence of several genomic copies, particular regulatory regions and selection through certain antigen binding or idiotypic determinants [36, 37]. In the case of the 3-23 gene, the fact that the same degree of overexpression has been observed in both productive and nonproductive rearrangements of normal B cells favors an intrinsic genetic mechanism [38]. Based on JH family usage and the CDR3 length it was found that CLL-B cells express H chain variable domains typical of postnatal rather than fetal tissues [61]. This study also showed that some genes like 1-69 and 4-39 were in most cases expressed in a germ line configuration, whereas, others like 4-34 and 5-51 contained in most cases somatic mutations. Whether, or not, CLLs expressing genes in germinal configuration represent a more immature set of cases, and CLLs expressing genes containing somatic mutations represent a more mature population selected through an antigen-driven process, remains an open question. Recent work from Chiorazzi's laboratory, reported studies carried out on 7 IgG expressing CLLs. This work indicates that the switch is biased in favor of y l , and that there is evidence favoring an antigen-driven process in at least some of these cases [62]. 3.1.6. Antibody activity of the CD^~ B lymphocyte from follicular non-Hodgkin lymphomas (FNHL) Our results with CLL were in aid to the hypothesis that CD^"^ B mostly secrete autoantibodies. However, in a recent work, based on the detection of mRNA transcript of Lyl gene among 40 murine hybridomas displaying natural autoantibody activity, we could demonstrate that both Lyl" and Lyl+ B lymphocyte subsets were involved in the production of natural autoantibodies [70]. To gain better insight into this problem, we have recently studied 31 hybridomas obtained in the laboratories of Miller and Levy, from CD^" B-cell NHL. Our results indicated that 8 out
227
of the 31 hybridomas displayed rheumatoid factor activity, and 2 out of these 11 displayed a multispecific activity [71]. These results obtained with Igs derived from CD^~ B-cell tumors strongly support the idea that CD^~ B cells are also involved in the production of natural autoantibodies. Cleary et al. [72] reported that at the difference of CLL and acute lymphoblastic leukemia, where a bias in expression of VH4, VH5 and VH6 families has been demonstrated, CD^~ B cells proliferating in NHL appear to employ VH gene families in a more stochastic way, by privilegiating the multigenic VH3 family. In addition, there is an active somatic mutational process in B-cell follicular NHL, that is rarely observed in B-CLL.
REFERENCES 1. 2. 3.
4.
5.
6. 4. CONCLUSION There is consistent evidence indicating that autoreactive B cells constitute a substantial part of the B-cell repertoire. This autoreactive repertoire secretes natural autoantibodies, which are frequently germline encoded, display a widespread reactivity and may play an important physiological role as a first barrier of defense. It is presently unknown whether, or not, these polyreactive B cells could constitute a preimmune template which may be involved through an antigen-driven process in the production of immune high affinity antibodies. This autoreactive B-cell repertoire frequently undergoes malignant transformation, although there is controversy concerning the reasons accounting for this. It has been postulated that the continuous challenge of this autoreactive repertoire by self-antigens could create propitious conditions for malignant transformation to occur. However, it can be alternatively hypothesized that overexpression of certain genes reflect what happens during ontogeny, since V genes expression is a developmentally regulated phenomenon and not all V genes are expressed during fetal life [73-74]. Some of the genes that are recurrently expressed by these malignancies are also overexpressed in fetal repertoires and even in the adult normal B-cell repertoire. We do not know whether it is the challenge by self-antigens or alternatively whether this overexpression simply reflects what happens with the fetal repertoire which could have selective advantages for malignization.
228
7. 8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
Metalnikoff S. Etudes sur la spermotoxine. Ann Inst Pasteur 1900;9:577-589. Besredka M. Les anti-hemolysines naturelles. Ann Inst Pasteur 1901;15:785-807. Ehrlich P, Morgenroth J. On haemolysins: third communication. In: The Collected Papers of Paul Ehrlich, vol. 2. London: Pergamon Press, 1957;205-212. Ehrlich P, Morgenroth J. On haemolysins:fifthcommunication. In: The Collected Papers of Paul Ehrlich, vol. 2. London: Pergamon Press, 1957;246-255. Landsteiner K. The Specificity of Serological Reactions. Cambridge, Massachusetts: Harvard University Press CB 27, 1900;357-371. Donath J, Landsteiner K. (1904) Uber paroxysmale hamoglobinurie. Munch Med Wochenschr 1904;51:1590-1595. Burnet FM, Fenner F. The producUon of antibodies. London: Macmillan, 1949. Owen RD. (1945) Immunogenefic consequences of vascular anastomoses between bovine cattle twins. Science 1945;102:400-404. Rose NR, Witebsky E. Studies on organ specificity: V changes in the thyroid glands of rabbits following acute immunization with rabbit tyroid extracts. J Immunol 1956;76:417^28. Martin SE, Martin WJ. Interspectes brain antigen detected by naturally occurring mouse anti-brain autoantibody Proc Natl Acad Sci USA 1975;72:1036-1041. Martin WJ, Martin SE. Thymus reactive IgM autoantibodies in normal mouse sera. Nature 1975;254:716718. Sela BA, Wang JL, Edelman GM. Antibodies reactive with cell surface carbohydrates. Proc Natl Acad Sci USA 1975;72:1127-1132. Mac Kay IR. Natural autoantibodies to the fore - forbidden clones to the rear?. Immunol Today 1983;4:340-342. Izui S, Lambert PH, Founie GL. Features of systemic lupus erythematosus in mice infected with bacterial lipopolysaccharides. J Exp Med 1977;145:11151128. Guilbert B, Dighiero G, Avrameas S. Naturally occurring antibodies against nine common antigens in human sera: I. Detection, isolation and characterization. J Immunol 1982;128:2779-2787. Lutz HU, Wipf G. Naturally occurring autoantibodies to skeletal proteins from human red blood cells. J Immunol 1982;128:1695-1701. Haspel MV, Onodera T, Prabhakar BS, McCHntock KE, Ray UR, Yagihashi S, Notkins AL. Multi-
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
pie organ-reactive monoclonal autoantibodies. Nature 1983;304:74-76. Dighiero G, Guilbert B, Avrameas S. Naturally occurring antibodies against nine common antigens in human sera: II. High incidence of monoclonal Ig exhibiting antibody activity against actin and tubulin and sharing antibody specificities with natural antibodies. J Immunol 1982;128:2788-2792. Dighiero G, Guilbert B, Fermant JP, et al. Thirtysix human monoclonal immunoglobulins (MIg) with antibody activity against cytoskeleton proteins, thyroglobulin and native DNA, immunological studies and clinical correlations. Blood 1983;62:264-270. Dighiero G, Lymberi P, Mazie JC, Rouyre S, ButlerBrowne GS, Whalen RG, Avrameas S. Murine hybridomas secreting natural monoclonal antibodies reacting with self antigens. J Immunol 1983;131:22672272. Dighiero G, Lymberi P, Holmberg D, Lundquist I, Coutinho A, Avrameas S. High frequency of natural autoantibodies in normal newborn mice. J Immunol 1985;134:765-771. Dighiero G. (1995) Natural autoantibodies in humans: their relevance in autoimmunity and lymphoproliferative disorders. Forum. Trends Exp Clin Med 1995;5:58-71. Casali P, Notkins AL. Probing the human B-cell repertoire with EBV. Polyreactive antibodies and CD5-I- B lymphocytes. Ann Rev Immunol. 1988;7:513-535. Nemazee D, Burki K. Clonal deletion of B lymphocytes in a transgenic mouse bearing anti-MHC Class antibody genes. Nature 1989;337:562-566. Goodnow CC, Brink R, Adams E. Breakdown of self-tolerance in anergic B lymphocytes. Nature 1991;352:532-536. Erikson J, Radic MZ, Camper SA, et al. Expression of anti-DNA immunoglobulin transgenes in nonautoimmune mice. Nature 1991;349:331-335. Holmberg D, Forsgren S, Ivars F, et al. Reactions among IgM antibodies derived from normal, neonatal mice. Eur J Immunol 1984; 14:435-^40. Lymberi P, Dighiero G, Ternynck T, et al. A high incidence of cross-reactive idiotypes among murine natural autoantibodies. Eur J Immunol 1985;5:702707. Kearney JF, Vakil M. Idiotype directed interactions during ontogeny play a major role in the establishment of the adult B cell repertoire. Immunol Rev 1986;94:39-62. Baccala R, Quang TV, Gilbert M, et al. Two murine natural polyreactive autoantibodies are encoded by nonmutated germ-line genes. Proc Natl Acad Sci USA 1989;86:4624-4628.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
Gonzalez R, Charlemagne J, Mahana W, et al. Specificity of natural serum antibodies present in phylogeneticaly distinct fish species. Immunology 1988;63:31-36. Du Pasquier L. Evolution of the immune system. In: William Paul, ed.. Fundamental Immunology, 3rd edn. New York: Raven Press, 1993; 199-235. Seligmann M, Brouet JC. Antibody activity of human myeloma globulins. Semin Hematol 1973; 10:163177. Williams RC, Kunkel HG, Capra JD. Antigenic specificities related to the cold agglutinin activity of gamma M globulins. Science 1968;161:379-384. Pascual V, Victor K, Lelsz D, Spellerberg MB, Hamblin TJ, Thompson KM, Randen I, Natvig J, Capra JD, Stevenson FK. Nucleotide sequence analysis of the V region of two IgM cold agglutinins. Evidence that the VH4-21 gene segment is responsible for the major cross-reactive idiotype. J Immunol 1991; 146:43854392. Silberstein LE, Jefferies LC, Goldman J, Friedman D, Moore JS, Nowell PC, Roelcke D, Pruzanski W, Roudier J, Silverman G. Variable region gene analysis of pathologic human autoantibodies to the related i and I red blood cell antigens. Blood 1991;78:23722379. Stevenson FK, Wrightham M, Glennie MJ, Jones DB, Cattan AR, Feizi T, Hamblin TJ, Stevenson GT. Antibodies to shared idiotypes as agents for analysis and therapy for human B cell tumors. Blood 1986;68:430437. Potter KN, Li Y, Pascual V, Williams RC, Byres LC, Spellerberg M, Stevenson FK, Capra JD. Molecular characterization of a cross-reactive idiotope on human immunoglobulins utilizing the VH4-21 gene segment. J Exp Med 1993;178:1419-1428. Pruzanski W, Shumak KH. Biologic activity of cold reacting autoantibodies. N Engl J Med 1977;297:538542. Kritzman J, Kunkel HG, McCarthy J, Mellors RC. Studies of a Waldenstrom-type macroglobulin with rheumatoid factor properties. J Lab Clin Med 1961;57:905-912. Crowley JJ, Goldfien RD, Schrohenlober RE, Spiegelberg HL, Silverman GJ, Mageed RA, Jefferis R, Koopman WJ, Carson DA, Fong S. Incidence of three cross-reactive idiotypes on human rheumatoid factor paraproteins. J Immunol 1988;140:3411-3418. Agnello V, Joslin EG, Kunkel HG. Cross idiotypic specificity among monoclonal IgM antigammaglobulins. Scand J Immunol 1972;1:283-292. Chen PP, Robbins DL, Jirik FR, Kipps TJ, Carson DA. Isolation and characterization of a light chain variable
229
44.
45.
46.
47.
48.
49.
50.
51.
52.
53.
54.
230
region gene for human rheumatoid factors. J Exp Med 1987;166:1900-1912. Silverman GJ, Goni F, Fernandez J, Chen PP, Frangione B, Carson DA. Distinct patterns of heavy chain variable region subgroup use by human monoclonal autoantibodies of different specificity. J Exp Med 1988;168:2361-2366. Silverman GJ, Schrohenholer RE, Achavitti MA, Koopman WJ, Carson DA. Structural characterization of the second major cross-reactive idiotype group of human rheumatoid factors: Association with the VH4 gene family. Arthritis Rheum 1990;33:1347-1360. Dellagi K, Brouet JC, Danon F. Cross idiotypic antigens among monoclonal immunoglobulin M from patients with Waldenstrom's macroglobulinemia and polyneuropathy. J Clin Invest 1979;64:15301539. Shoenfeld Y, Amital Teplizki H, Mendlovic S, Blank M, Mozes E, Isenberg DA. The role of the human antiDNA idiotype 16/6 in autoimmunity. Clin Immunol Immunopathol 1989;51:313-325. Davidson A, Smith A, Katz J, Preud'homme JL, Salomon A, Diamond B. A cross-reactive idiotype on anti-DNA antibodies define a H chain determinant present almost exclusively on IgG antibodies. J Immunol 1989;143:174-180. Bakkus MH, Van Riet I, Van Camp B, Thielemans K. Evidence that the clonogenic cell in multiple myeloma originates from a pre-switched but somatically mutated B cell. Br J Haematol 1994;87(1):6874. Saito T, Sherman W, Latov N. Specificity and idiotype of M-proteins that react with MAG in patients with neuropathy. J Immunol 130:2496-2502. Brouet JC, Dellagi K, Gendron MC, Chevalier A, Schmitt C, Mihaesco E. Expression of a public idiotype by human monoclonal IgM directed to myelinassociated glycoprotein and characterization of the variability subgroup of their heavy and light chains. J Exp Med 1989;170:1551-1558. Dighiero G, Travade P, Chevret S, Fenaux P, Chastang C, Binet JL. B-cell Chronic Lymphocytic Leukemia: Present status and future directions. Blood 1991;78:1901-1914. Broker BM, Klajman A, Youinou P, Jouquan J, Worman CP, Murphy J, Mackenzie L, Quartey-Papafio R, Blaschek M, Collins P, Lai S, Lydyard PM. Chronic lymphocytic leukemic (CLL) cells secrete multispecific autoantibodies. J Autoimmunity 1988; 1:469481. Sthoeger, ZM, Wakai M, Tse DB, Vinciguerra VP, Allen SL, Budman DR, Lichtman SM, Schulman P, Weiselberg LR, Chiorazzi N. Production of autoantibodies by CD5-expressing B lymphocytes from pa-
55.
56.
57.
58.
59.
60.
61.
62.
63.
64.
65.
tients with chronic lymphocytic leukemia. J Exp Med 1989;169:255-268. Borche L, Lim A, Binet JL, Dighiero G. Evidence that chronic lymphocytic leukemia B lymphocytes are frequently committed to productions of natural autoantibodies. Blood 1990;76:562-569. Kipps TJ, Tomhave E, Chen PP, Carson DA. Autoantibody associated K light chain variable region gene expressed in chronic lymphocytic leukemia with little or no somatic mutation, implications for etiology and immunotherapy. J Exp Med 1988;167:840-852. Kipps TJ, Tomhave E, Pratt LF, Duffy S, Chen PP, Carson DA. Developmentally restricted immunoglobulin heavy chain variable region gene expressed at high frequency in chronic lymphocytic leukemia. Proc Natl Acad Sci USA 1989;86:5913-5917. Humphries CG, Shen A, Kuziel WA, Capra JD, Blattner FR, Tucker PW. A new human immunoglobulin VH family preferentially rearranged in immature B-cell tumors. Nature 1988;331:446-449. Logtenberg T, Schutte MEM, Inghirami G, Berman JE, Gmelig-Meyling FHJ, Insel RA, Knowles DM, Alt FW. Immunoglobulin VH gene expression in human B cells lines and tumors: Biased VH expression in chronic lymphocytic leukemia. Int Immunol 1989;1:362-370. Mayer R, Logtenberg T, Strauchin J, Dimitriu-Bona A, Mayer L, Mechanic S, Chiorazzi N, Borche L, Dighiero G, Mannheimer-Lory A, Diamond B, Alt F, Bona C. CD5 and immunoglobuHn V gene expression in B-cell lymphomas and Chronic Lymphocytic Leukemia. Blood 1991;75:1518-1524. Schroeder HW, and Dighiero G. Clues to the pathogenesis of CLL through analysis of B cell CLL antibody repertoires. Immunol Today 1994;15(6):288294. Pais F, Ghiotto F, Hashimoto S, Sellars B, Allen SL, Schulman P, Vinciguerra VP, Rai K, Rassenti L, Kipps TJ, Dighiero G, Schroeder HW, Ferrarini M, Chiorazzi N. Chronic Lymphocytic Leukemia B cells express restricted sets of mutated and unmutated antigen receptors. J. Clin. Invest. 1998; 102(8): 1515-1525. Ebeling SB, Schutte MEM, Akkermans Koolhaas E, Bloem AC, Gmelig-Meyling FHJ, Lotenberg T. Expression of members of the immunoglobulin VH3 gene families is not restricted at the level of individual genes in human chronic lymphocytic leukemia. Int Immunol 1992;4:313-320. Shen AC, Humphries PW, Tucker PW, Blattner FR. Human heavy-chain gene family nonrandomly rearranged in familial chronic lymphocytic leukemia. Proc Natl Acad Sci USA 1987;84:8563-8567. Cai J, Humphries C, Lutz C, Tucker PW. Analysis of VH 251 gene mutation in chronic lymphocytic
66.
67.
68.
69.
70.
leukemia and normal B-cell subsets. Ann NY Acad Sci 1992;651:384-392. Meeker TC, Grimaldi JC, O'Rourke R, Loeb J, Juliusson G, Einhorn S. Lack of detectable somatic hypermutation in the V region of Ig H chain gene of a human chronic B lymphocytic leukemia. J Immunol 1988;141:3994-3998. Rassenti LZ, Kipps TJ. Lack of extensive mutations in the VH5 genes used in common B cell chronic lymphocytic leukemia. J Exp Med 1993;177:1039-1046. Deane M, Norton JD. Immunoglobulin heavy chain variable region family usage is independent of tumor cell phenotype in human B lineage leukemias. Eur J Immunol 1990;20:2209-2217. Pritsch O, Magnac C, Dumas G, Egile C, Dighiero G. V gene usage by seven hybrids derived from CD5-I- Bcell Chronic Lymphocytic Leukemia and displaying autoantibody activity. Blood 1993;82:3103-3112. Kaushik A, Mayer R, Fidanza V, Zaghouani H, Lim
71.
72.
73.
74.
A, Bona C, and Dighiero G. Lyl and V-gene expression among hybridopas secreting natural autoantibody. J Autoimmunity 1990;3:687-700. Dighiero G, Hart S, Lim A, Borche L, Levy R, Miller RA. Autoantibody activity of immunoglobulins isolated from B-cell foUicular lymphomas. Blood 1991;78:581-586. Cleary ML, Meeker TC, Levy S, Lee E, Trela M, Sklar J, Levy R. Clustering of extensive somatic mutations in the variable region of an immunoglobulin heavy chain gene from a human B cell lymphoma. Cell 1986;44:97-105. Schroeder HW, Hillson JL, Perlmutter RM. Early restriction of the human antibody repertoire. Science 1987;238:791-793. Schroeder HW, Wang JY. Preferential utilization of conserved immunoglobulin heavy chain variable gene segments during human fetal life. Proc Natl Acad Sci USA 1990;87:6146-6150.
231
(c) 2000 Elsevier Science B.V. All rights reserved. Cancer and Autoimmunity Y. Shoenfeld and M. E. Gershwin, editors
Autoimmunity in B-Lymphoproliferative Disorders Viggo J0nsson and Allan Wiik
1. INTRODUCTION For many years autoimmune diseases have been considered to be a consequence of faulty self/nonselfdiscrimination due to incomplete deletion of certain clones of autoreactive immune cells, or some kind of breakage of self-tolerance due to abnormal activation of such clones, e.g., through stimulation by extrinsic factors. Today, there is strong evidence that healthy individuals have both T and B cells and circulating antibodies that can recognize and react with self-components. Some hypotheses for the induction of autoimmune diseases maintain that excessive presentation of self-compounds during tissue damage or altered self-antigens produced due to aberrant apoptosis pathway regulation may explain the breakdown of self-tolerance seen in autoimmune disease [1]. However, it is equally likely that insufficient removal of self-antigen components, or deficient regulation of autoimmune networks, may lead to a similar result [2]. The so-called natural autoantibodies (see preceeding chapter), which are probably not produced as a consequence of autoantigen stimulation, have multiple properties that are important for maintaining a normal immune homeostasis [3-5]. These natural autoantibodies can belong to all three major Ig classes and are encoded by germline genes and show little or no signs of mutations. They are commonly multireactive, having the capacity to recognize both microbial agents and many self-constituents. They constitute an important natural host defense against infections and may have functions relating to scavenger mechanisms of self-components derived from senescent cells or altered self-antigens. Due to their ability to react through their V-regions with idiotypes on pathogenically important autoantibodies, B and T cells and with
other cell surface molecules, they can induce a selection of immune repertoires and limit autoaggressive mechanisms [6, 7]. Any disturbance in this shelter against autoreactivity may be an important contributor to autoimmunity and the emergence of autoimmune disease. There are several reasons to believe that autoimmunity arising in patients with premalignant and malignant B-cell proliferative conditions can be regarded either as an effect of excessive IgM monoclonal autoantibody production (see preceeding chapter), or a hole in the antiself-protective immune system. Since certain infections may drive the immune system towards self-reactivity through epitope mimicry it is also possible that infectious agents may thrive in a host organism that is immunodeficient because of the malignancy and/or the treatment given to control it (see below). Natural autoantibody production in healthy individuals seems to be tightly regulated, and it is not known whether the genes encoding them may be the template for high affinity autoantibody production in patients with autoimmune diseases [4, 6]. 1.1. The B-cell Pathway The malignant B-lymphoproliferative disorders comprise of the acute lymphoblastic and the chronic lymphocytic leukemias, multiple myelomas, Waldenstrom's macroglobulinemia and the malignant lymphomas. These malignancies represent monoclonal expansions of B lymphocytes at a certain stage in the B-cell maturation/differentiation pathway and, thus, carry the characteristic phenotypes corresponding to each particular B-cell pathway stage (Fig. 1) [8, 9]. The inclusion of Hodgkin's disease in this classification has been hotly debated until documentation for its B-cell origin was provided a few years ago [10, 11].
233
Early Pre-B Cell
Pre-B Cell
B Cell
Plasma Cell
HLA-DR 1 TdT CD 34 C
•^•••••l C
^^
CD 19 C CD 20 C CD 21
_
..
CD 22
^ ^
CD 24
B-ALL
J J
Waldenstrdm Ma. Myeloma
B-CLL
Large cell lymphoma Small cell lymphoma Immunobiastic lymphoma Follicular small cleaved lymphoma Lymphoblastic lymphomas Centroblastic lymphoma Burkitt lymphoma Centrocytic lymphoma Anaplastic lymphoma MALT lymphomas Mantle cell lymphoma Figure 1. A rough draft of the B-cell pathway and its related malignant B-lymphoproliferative disorders.
The taxonomy of these B-cell malignancies, which was recently revised in the European-American classification from 1994 [8], makes a practical distinction between low-, intermediate- and high-grade malignancies depending on the growth rates of the tumor cells in each disorder (Table 1). In the lowgrade end of the spectrum we find the follicular and small cell lymphomas, multiple myelomas, Waldenstrom's macroglobulinemia and chronic lymphocytic leukemia, while large cell and lymphoblastic lymphomas as well as acute lymphoblastic leukemia are considered high-grade, rapidly growing malignancies. Autoantibody production is common in patients with low-grade B-cell malignancies, and some of these patients exhibit clinical signs of autoimmune disease (see below).
2. BYPASS OF TOLERANCE TO SELF-CONSTITUENTS
deficiencies are often aggravated by treatment with corticosteroids, cytostatics and irradiation. It is therefore not surprising that infections often complicate the course of B-cell diseases and is a major cause of death. For many years microbial agents have been suspected of having a potential role in the induction of autoimmune diseases. Among the many possibilities we can mention: (1) epitope mimicry on foreign antigens; (2) foreign antigen coupled to self-antigen; (3) superantigen driving T- and B cells; (4) foreign antigen introduced into an autoantigen through viral transposons; (5) upregulation of MHC class II and costimulatory molecules in an infectiously inflammed tissue giving rise to abnormal presentation of self-peptides; and (6) production of autoantibodies which are actually cross-reactive anti-idiotype antibodies (anti-Id) to antimicrobial antibodies [12, 13]. In some patients with Helicobacter pylori infections a MALT lymphoma develops [14-16], and such patients frequently harbour autoantibodies to parietal cells, mostly with clinical signs of gastric ulcer [17-19].
2.1. Infections 2.2. M-components with Autoreaetivity An expanding tumor of B-lymphoid/plasma cells within the immune system often gives rise to multiple cellular and humoral deficiencies. These immuno-
234
Although most natural autoantibodies have low affinity and are commonly poly reactive (see preceeding
Table 1. Gastric ulcer with antibodies against H. pylori and concomitant autoimmunity in 19 patients with malignant B lymphoproliferative diseases
Waldenstrom 5 macroglobulinaemia n=7
Chronic lymphocytic leukemia n=7
Non-Hodgkin lymphoma n=5
Concomitant autoimmunity
Serology
Sensory-motor polyneuropathy 3 Sjogren's syndrome 2 Haemolytic anaemia 1 Immune thrombocytopenia 1 Myelopathy 1
Parietal cell Ab 7 SSA and SSB Ab 1 Coombs' test pos. 1 ANA pos. 1 Platelet Ab 1
Haemolytic anaemia 3 Thyroiditis 2 Anticardiolipin syndrome 2 Bihary cirrhosis 1 Diabetes mellitus 1
Parietal cell Ab 7 Coombs' test pos. 3 Anticardiolipin IgM 2 Mitochondria Ab 1 Rheum, factor IgA 1 Thyroglobulin Ab 1
Haemolytic anaemia 2 Thyroiditis 1 Immune thrombocytopenia 1 Rheumatoid arthritis 1 Sensory polyneuropathy 1 Thyroid
Parietal cell Ab 5 Anticardiolipin IgM 2 Coombs' test pos. 2 Thyroglobulin Ab 1 Platelet Ab 1 Peroxidase Abl Rheum, factor IgM 1 Rheum, factor IgA 1
chapter) they may function like high avidity antibodies dependent on antigen epitope density and antibody concentration. Thus, under certain conditions they drive autoaggressive mechanisms. 2.3. Immunoglobulin Interactions Studies on normal human and mouse sera have shown that IgG molecules with autoreactive properties are commonly present, although they are not easily demonstrable in whole serum because of IgM, IgG or IgA antibodies being bound to their V-regions. After isolation of IgG from other immunoglobulin classes, multiple autoantibody specificities are revealed, and some of these may even have characteristics of pathogenically important antibodies [4-6]. Although formal proof is mostly lacking, such interactions are thought to represent Id recognition by physiologic anti-Id antibodies, and the phenomenon is named immune connectivity [6, 7]. This connectivity may represent an important antiself-protective response, which can be
disturbed if B-cell malignancy develops, and autoimmunity may ensue. Dimeric IgG molecules found in human intravenous immunoglobulin (IVIG) preparations are likely to reflect such Id/anti-Id interactions, and the dimers have been found to be rich in autoantibody activity [6, 7]. 2.4. The Possible Role of Apoptosis Control Very recent data points at the existence in normal polyclonal IVIG of antibodies directed to the apoptosistriggering molecule Fas (=CD95) [20, 21]. The Faspathway of programmed cell death (=apoptosis) is an important mechanism for getting rid of senescent or damaged cells without stimulating an immunoinflammatory response [22]. When B and T cells and monocytes are stimulated to an ongoing immune response or undergo malignant transformation they may express excessive numbers of Fas molecules on the cell membrane [20]. Anti-Fas antibodies can then trigger the Fas cascade of intracellular enzymes that leads
235
to cell destruction through degradation of cellular proteins and DNA. The long-term effects of IVIG may thus be the result of eradication of accessory cells and immunocytes engaged in autoaggressive mechanisms [20]. In B-cell malignancy, however, anti-Fas production might be deficient and activated autoimmune B cells be left free to proliferate. It is interesting that mutations in the Fas molecule in non-Hodgkin's lymphoma has recently be shown to be associated with extranodal disease and autoimmunity [23]. 2.5. Potential Role of Idioypic Stimulation It is possible that an Id expressed on a monoclonally expanded M-component or B-cell surface can mimic an autoantigen by displaying an internal image of the autoantigenic epitope [12]. Immune responses to such epitopes may only be possible in the context of strong adjuvant effects e.g., coming from infectious agents [12]. It should be noted that Ids characteristic of an autoantibody may be found also on antimicrobial antibodies [13,24]. 2.6. B cells as presenting cells The fact that B cells are very efficient autoantigenpresenting cells may lead to an overexpanded APC function with regard to autoantigens, eventually leading to autoimmunity, especially if the surface Ig molecules have polyspecific autoreactivity. 2.7. Enzyme Activity of Autoantibodies Some autoantibodies have been found to have proteolytic enzyme activity [25-26]. An expansion of B-cell clones producing such enzyme-antibodies may directly lead to autoaggressive mechanisms or cryptic epitope formation that result in autoantibody production.
3. AUTOIMMUNITY IN B-CELL MALIGNANCIES Autoimmune phenomena are prevalent in certain Blymphocyte malignancies [27]. Previous work from our group [17] has shown presence of one or more autoimmune manifestations and/or autoantibodies in 42 out of 116 patients with chronic lymphocytic
236
leukemia (CLL). Predominating findings in these patients were Coombs-positive autoimmune haemolytic anemia (AIHA), platelet antibody-positive idiopathic thrombocytopenic purpura (ITP), cold agglutinin syndrome, endocrinopathy involving mainly the thyroid but also the pancreatic islets in the form of autoimmune thyroiditis and diabetes mellitus. A later study which included 57 patients with Waldenstrom's macroglobulinaemia (WM) and 145 patients with nonHodgkin's lymphomas (NHL) 16 and 13, respectively, had signs of concomitant autoimmune manifestations [18]. An unexpectedly high number (10) of these had Sjogren's syndrome, 8 had autoimmune thyroid disease, 6 peptic ulcers with parietal cell antibodies, 2 rheumatoid arthritis and 1 systemic lupus erythematosus. There was a clear-cut female predominance among the patients. Three WM patients had ITP and one had AIHA. All of the patients with autoimmune manifestations had lymphoid infiltrates at extranodal sites as evidenced through biopsies taken from skin, mucous membranes, stomach, bronchi etc. It should be mentioned that the autoantibodies found in these patients were all of the IgG class, and thus did not correlate to the Ig class of the M-components or the surface Ig. In this regard, they were similar to those found in autoimmune diseases without B-cell malignancies. In addition, the autoantibodies completely agreed with the clinical condition. These autoantibodies are thus unlikely to represent polyreactive natural autoantibodies. In 4 WM patients with axonal polyneuropathy no autoantibodies to nerve tissue components could be demonstrated. Maltomas found in most of the patients with parietal cell antibodies correlated strongly with the presence of a H. pylori infection, and eradication of this infection by antibiotics led to remission of the local lymphoma, indicating that the bacterium was an essential lymphoma-forming stimulus to the local lymphoid system (see below). It should be mentioned that malignant transformation of B cells is not mandatory for development of autoimmunity. Autoimmune diseases and phenomena are common also in patients with monoclonal gammopathy of undetermined significance [17]. Certain autoimmune diseases are characterized by marked lymphocyte proliferation, and in such conditions Bcell malignancies develop much more often than in the healthy population [28, 29]. Autoimmune diseases which have been found associated with B-cell malignancies are primarily autoimmune thyreoiditis, Sjo-
gren's syndrome, systemic lupus erythematosus, polyand dermatomyositis, the Guillain-Barre syndrome, myasthenia gravis, sensorimotor neuropathies, autoimmune hemolytic anaemia and thrombocytopenia, acquired haemophilia and acquired Von Willebrand's syndrome [17].
4. NATURAL AUTOANTIBODIES, FRIENDS OR FOES? How should we regard the significance of natural autoantibodies in malignant B-cell proliferative diseases? The fact that we see several multiorgan autoimmune manifestations in malignant B-cell disorders would indicate an untoward effect of the immune system on tissues. Such effects may relate to a number of immunodeficiencies associated with the malignant BlymphoproHferative disorder as discussed above. On the other hand natural autoantibodies have been ascribed a role as scavenger molecules for getting rid of injured cells and altered self-antigens, and thus they may normally fulfill a role for the good. If the concentration of such autoantibodies, however, are very high they may cause tissue damage (see preceeding chapter). 4.1. Lessons from Gastric Pseudolymphomas and Maltomas Although parietal cell antibodies have not been mentioned among the many natural autoantibodies recognized to be strongly represented in Blymphoproliferative diseases [17] we have certainly found an overrepresentation of parietal cell antibodies in several of these disease states [30]. Among 128 consecutive patients with B-cell malignancies, 19 patients had an ongoing infection with H. pylori as evidenced by the presence of specific IgG antibodies to the microorganism by Western blotting technique and ELISA technique (Table 1). Attempts at culturing the H. pylori bacteria from the gastric mucosa were considered inappropriate, since all patients had been treated with antibiotics for different bacterial infections prior to the investigation. The patients all underwent gastroscopy which disclosed severe gastritis and often ulceration of the mucosa. In 8 patients we took biopsies large enough for additional PCR analyses to look for clonality among TCR and IgH. In 4 of
the patients, the malignant B-cell clone found in the blood also was present in the inflammatory infiltrate of the gastric mucosa, while in the remaining patients the gastric biopsies only showed weak B-cell clonality, possibly indicating an effect of long-standing helicobacter infection leading to pseudolymphoma or a newly transformed maltoma. None of the patients had pure monoclonal infiltrates corresponding to the B-lymphoproliferative disease. One patient later developed cancer of the stomach. Our findings are compatible with the idea that the lymphoma may start as a polyclonal response to a bacterial infection, may turn into an oligoclonal lymphoid infiltrate which may eventually transform into a maltoma [15, 16]. There may be two different antigenic drives leading to this result, one coming from the H. pylori bacteria themselves and one from parietal cell autoantigens released from injured gastric tissue (Fig. 2). Parietal cell autoantibodies reacting with exposed parietal cell autoantigens in the environment of the inflammatory infiltrate are likely to promote the inflammation. An excess production of growth-factors and cytokines by cells in the inflammatory infiltrate consisting of T and B cells, neutrophils, macrophages, and possibly dendritic cells may influence subclones of the lymphocytes differently. Subclones can acquire different growth rates, and overexpanded clones will gradually dominate the infiltrate, thus transforming it from a polyclonal to an oligoclonal stage. Cell cycle abnormalities induced by the inflammation can then lead to monoclonal transformation and a low grade malignant lymphoma [16]. The fact that autoantibody may be a stimulating mechanism for tissue injury on the other hand could lead to eradication of malignant lymphocytes by a process of apoptosis or necrosis, and in that situation the antibody would have a beneficial role. The fact that eradication of H. pylori in patients with maltomas often leads to regression of the tumor clearly indicates that infective agents should be eliminated if possible. When natural autoantibodies or autoantibodies produced through autoantigen presentation by de novo activated B or dentritic cells occur at low concentrations they are normally framed by anti-Id antibodies [6, 7]. However, when B-cell malignancy occurs both anti-infectious responses, T-cell responses and adequate B-cell responses may be deficient. Hence, a whole host of B-cell repertoires can be malfunctioning and among these anti-Id to autoantibodies. Autoreactive T cells and autoantibodies can
237
Lymph Node
Blood Vessel
Gastric Mucosa Figure 2. Gastritis caused by H. pylori = A. As part of the inflammatory infiltrate are shown neutrophils = N, monocytes = M and T-helper against H. pylori = T. Recirculating T cells reach lymphoid tissue in lamina propria and in the regional nodes, where B cells produce antibody against H. pylori = X. In case of long-standing antigenic stimulation, A will not be totally eliminated by X and T cells, and B-cell proliferation will be upregulated. The B cell may then undergo transformation, changing the polyclonal inflammatory infiltrate into an oligoclonal one, shown by means of two clones: B and B-transformed = O. Furthermore, we have shown that the malignant B cell (#) in patients with CLL, NHL and Waldenstrom's macroglobulinaemia can also infiltrate the inflammatory site. We interpret our findings in such a way that exposed parietal cell autoantigens = A together with H. pylori = A exert the antigenic drive. Parietal cell autoantibodies are shown as X and mutations as Vx. Now, the diversity of the pseudolymphoma/maltoma consists of the following clones: (1) B cells against H. pylori = B; (2) transformed B cells = O; (3) B-memory against parietal cell autoantigens = Bp; and (4) the malignant clone itself = 0 . Presumably, the four different clones have different growth rates. In the course of time and if the antigenic drives persists, the clone with the highest growth rate will be dominating.
autoimmune diseases [5, 7]. Among the many mechanisms considered to be important for the efficacy of intravenous immunoglobulin preparations is presence of anti-Id antibodies, anti-TCR antibodies, anticytokine antibodies. Fey-receptor blocade, anti-MHC class I antibodies, antiadhesion molecule antibodies and a number of other antibodies directed to surface components on immunocompetent cells. Anti-Id activity in such preparations are mainly directed to idiotypes found on autoantibodies [7]. The recent discovery of anti-Fas activity in immunoglobulin preparations [20] may explain the long- lasting effect of highdose IgG treatment in many autoimmune conditions, since this activity can induce apoptosis in activated immunocytes and monocytes and thus the selection of the B-cell repertoire. Since clearance of apoptotic cell elements is mandatory to avoid proinflammatory stimulation of the immune system [2] polyreactive, nonphlogistic autoantibodies may have a role in clearing autoantigen particles, and thus prevent production of high affinity autoantibodies.
5. CONCLUSIONS The fact that the autoimmune B-cell repertoire constitutes a large part of the total B-cell repertoire is reflected by the frequent emergence of B-cell malignancies possessing autoreactivity (see preceeding chapter). On the other hand the emergence of mafignant B-cell clones with no autoreactivity can induce multiple immunodeficiences which also involve the control of other B cells. The immunoregulatory incapacitation will lead to autoimmunity in persons with predisposition to develop such diseases, and the type of autoimmune disease most probably reflects inherent or acquired predisposition as well as potential external inducers of autoimmunity.
REFERENCES thus be left free and reactive and autoimmune mechanisms lead to tissue damage and/or clonal expansion and transformation. A given autoantibody may thus have the potential to function both as a friend and as a foe. A clear evidence for beneficial clinical effects of mixtures of autoantibodies comes from the use of polyclonal IgG for intravenous high-dose treatment of
238
2.
3. 4.
Utz PJ, Anderson P. Arthritis Rheum 1998;41:11521160. Herrmann M, Voll RE, Zoller CM, Hagenhafer M, Ponner BE, Kaldem JR. Arthritis Rheum 1998;41:1241-1250. Boyden SV. Adv Immunol 1966;5:1-28. Avrameas S, Temynck T. Mol Immunol 1993;30:1133-1142.
9.
10. 11.
12. 13.
14.
15. 16. 17.
18.
Kaveri SV, Lacroix-Desmazes S, Mouthon L, Kazatchkine MD. Immunologist 1998;6:227-233. Coutinho A, Kazatchkine MD, Avrameas S. Curr Opin Immunol 1995;7:812-818. Kazatchkine MD, Dietrich G, Hurez V, Ronda N, Bellon B, Rossi F, Kaveri SV. Immunol Rev 1994;139:79-107. Harris NL, Jaffe ES, Stein H, Banks PM, Chan JKC, Cleary ML, et al. Blood 1994;84:1361-1392. Cousar JB. In: Lee GC, Foerster J, Lukens J, Paraskevas F, Greer JP, Rodgers GM., eds., Wintrobe's Clinical Hematology. Baltimore: WilHams and Wilkins, 1998. Hummel M, Ziemann K, Lammert H, Piled S, Sabattini E, Stein H. N Engl J Med 1995;333:901-906. Carbone A, Gloghini A, Gaidano G, Franceschi S, Capello D, Drexler D, Falini B, Dalla-Favera R. Blood 1998;92:2220-2228. Shoenfeld Y. FASEB J 1994;8:1296-1301. El-Roeiy A, Sela O, Isenberg DA, Kennedy RL, Shoenfeld Y. CHn Exp Immunol 1987;67:507515. Zucca E, Bertoni F, Roggero E, Bosshard G, Cazzaniga G, Pedrinis E, Biondi A, Cavalli F. N Engl J Med 1998;338:804-810. Eidt S, Stolte M, Fischer R. J Clin Pathol 1994;47:436-439. Isaacson PG. Am J Surg Pathol 1996;20:1-7. J0nsson V, Svendsen B. Vorstrup S, Krarup C, Schmalbruch H, Thomsen K, Heegaard NHH, Wiik A, Hansen MM. Leukemia 1996;10:327332. J0nsson V, Wiik A, Hou-Jensen K, Christiansen M, Ryder L.P, Madsen HO, Geisler C, Hansen MM, Thomsen K, Vorstrup S, Svejgaard A. J Int Med 1999;245:277-286.
19.
20.
21.
22. 23.
24. 25. 26.
27. 28. 29. 30.
31.
32.
J0nsson V, Kierkegaard A, Sailing S, Moilander S, Andersen LP, Christiansen M, Wiik A. Leuk.Lymph 1999;34:373-379. Prasad NK, Papoff G, Zeumer A, Bonnin E, Kazatchkine MD, Ruberti G, Kaveri SV. J Immunol 1998;161:3781-3790. Viard I, Wehrli P, Bullani R, Schneider P, Holler N, Salomom D, Hunziker T, Saurat J-H, Tsckopp F, French LE. Science 1998;282:490-493. Lockshin RA, Beaulaton J. Life Science 1974;15:1549-1565. Gr0nbaek K, Straten PT, Ralfkiaer E, Ahrenkiel V, Andersen .K, Hansen NE, Zeuthen J, HouJensen,K, Guldberg R Blood 1998;92:30183024. Shoenfeld Y, Cohen IR. In: Sela M, ed. London: Academic Press, 1987;307. Li L, Tyutyulkova S, Kaveri SV, Kazatchkine MD. J Immunol 1995:154:3328-3332. Gololobov GV, Chernova EA, Schourov DV, Smirnov IV, Kudelina lA, Gabibov AG. Proc Natl Acad Sci USA 1995;92:254-257. Gr0nbaek K, D'Amore F, Schmidt K. Leuk Lymph 1995;18:311. Miralles GD, O'Fallon JR, Talley NJ. N Engl J Med 1992;327:1919-1923. Talal N, Sokologg L, Barth WF Am J Med 1967;43:50-65. Molander S, J0nsson V, Andersen LP, Bennetzen M, Christiansen M, Hou-Jensen K, Madsen HO, Ryder LP, Permin H, Wiik A. Ugeskr. f. Laeger (in press). Ballieux BEPB, Van der Burg SH, Hagen EC, Van der Woude FJ, Melief CJM, Daha MR. Clin Exp Immunol 1995;100:186-193. Hurd ER, LoSpolluto J, Zigg M. Arthritis Rheum 1970;13:724-733.
239
© 2000 Elsevier Science B.V. All rights reserved. Cancer and Autoimmunity Y. Shoenfeld and M. E. Gershwin, editors
CDS Positive B Cells: Crossroads of Autoimmunity and Lymphoid Malignancy C. Jamin^ J.O. Pers^ P.M. Lydyard^ and P. Youinou^ ^ University of Brest, France; ^ UCMSM, London
1. INTRODUCTION For 30 years now, evidence has been accumulating which suggest that the mechanisms governing nonorgan-specific autoimmune diseases are similar to those leading to lymphoproliferative disorders [1]. In other words the mechanisms governing polyclonal B-cell activation are thought to be similar to those leading to the monoclonal B-cell expansion. Autoimmune phenomena can occur in association with several B-cell malignancies. Monoclonal immunoglobulins (MIg) appear in the serum of patients with multiple myeloma (MM), Waldenstrom's macroglobulinemia (WM) and related disorders, such as chronic lymphocytic leukemia (CLL). Moreover, there is a growing awareness that chronic inflammatory conditions, which are thought to have an autoimmune basis, may be predispose to cancer. It appears, therefore, that all these derangements are manifestations of a single underlying cause. The T-lymphocyte CD5 antigen is shared by leukemic cells from patients with CLL, but also expressed by a limited fraction of normal B lymphocytes [2]. One connection between connective tissue diseases and lymphoid malignancies might be established by this B-cell's subpopulation [3]. In addition to acting as a first line of defense, this minor B-cell subset makes natural autoantibodies [4], and malignant cells of most of the CLL of the B-cell lineage express the CD5 molecules [5]. This B-cell subset might be responsible for autoantibody production in one kind of disease and susceptible to malignant transformation in the other. Since autoimmune features are common in lymphoproliferative disorders, and the latter may be
a complication in nonorgan-specific autoimmune diseases, CD5-positive B cells may be a key link between these pathological conditions [6].
2. AUTOIMMUNE DISEASES 2.1. Role Of The CD5+ B Cells The CD5 molecule is present on a minority of B cells and the vast majority of B cells referred to as conventional B cells do not carry this marker. Given the usage of different VH4 germline genes, CD5-positive and conventional B cells possibly belong to separate lineages [7]. Several groups have established that this CD5+ B-cell subset may be expanded in patients with rheumatoid arthritis (RA) (reviewed in [8]). It was found to comprise of an average of 20% of the circulating B cells of 16 RA patients, compared to a maximum of 3% in 8 normal controls [9]. Although CD5 molecules are present at low density on B lymphocytes, this is increased following treatment of B-cell-enriched suspensions with phorbol myristic acetate. Thus, it becomes possible to detect a co-expression of CD5 on a larger population of B cells from patients and controls than from earlier studies, but the mean proportions of B cells that express CD5 was still higher in RA patients than in normal subjects [10]. The elevation of this B-cell subset is insufficient to give rise to RA since some reports showed no significant differences in the percentage of circulating CD5-positive B cells in patients, compared with controls [11]. However, the number of circulating CD5+ B cells appears to correlate with the titer of rheumatoid factor. Increases in the
241
total serum immunoglobulin and autoantibody levels were frequently encountered in the patients as well as their family members, in whom there was a correlation between the titers of rheumatoid factor of the IgM class and the percentage of CD5+ B cells [12]. Intriguingly, patients with systemic lupus erythematosus (SLE) do not have elevated numbers of CD5-positive B cells [9]. Augmented numbers have been described, however, in some lupus patients [12, 13], suggesting that polyclonal activation may also affect this B-cell subset in a proportion of patients with SLE. Nonorganspecific autoimmune diseases other that RA and SLE, may be associated with high numbers of circulating CD5-positive B cells, particularly primary Sjogren's syndrome (pSS) [14]. Furthermore, B cells expressing CD5 have been identified in minor labial salivary glands of such patients [15]. Other nonorgan-specific as well as organ-specific autoimmune diseases have been associated with high numbers of circulating CD5+ B cells. These include systemic sclerosis, seronegative juvenile arthritis. Graves' disease, infectious mononcleosis, myasthenia gravis, chronic hepatitis and liver cirrhosis, notably in hepatitis B surface antigen-positive patients. Interestingly, augmented numbers of CD5-I- B cells have been observed in psychiatric patients [3]. In general, levels of CD5+ B cells are independent of disease activity in the autoimmune conditions.
2.2. Complications With Lymphoid Malignancy While monoclonal spikes have been detected in the sera of some patients with RA [16] and SLE [17], pSS appears to be the archetype of a condition midway between nonorgan-specific autoimmunity and B-cell maUgnancy [18]. Between 5-10% of patients have been claimed to progress to lymphoma [19]. MIg has been identified in the serum and urine of these patients, of whom one-third produce monoclonal rather than polyclonal cryoglobulins [20]. The exocrine glands are indeed sites of intense immunologic activity—a feature associated with the production of rheumatoid factor [21]. Moreover, clonally expanded lymphocytes have been identified in the early labial salivary gland infiltrates of patients who do not experience further progression to pseudolymphoma or lymphoma [22]. Collectively, these results suggest that B cells are activated in RA, SLE and pSS [23].
242
3. LYMPHOID MALIGNANCIES 3.1. Role Of The CD5+ B Cells Human CLL is a malignancy of the CD5+ B cells, characterized by the accumulation of mature appearing, long-lived, slow-growing CD5+ B cells in peripheral blood. Leukemia cells from approximately 95% of CLL patients co-express CD5 and other Bcell markers [24]. Thus, in most cases of CLL, there is a proliferation of B-cell clones characterized by low amounts of surface immunoglobulins and the presence of the CD5 molecule. There is no definite correlation between the expression of CD5 and surface immuglobulin class, type, clinical stage, disease activity or age as diagnosis by other investigators [25]. However, CD5 expression, in conjunction with measurements of surface immunoglobulin intensity and CD22, are regarded as the minimum number of immune markers required for the diagnosis of subtypes of CLL [25]. Expression of CD5 by leukemic cells is only seen in some cases of prolymphocytic leukemia [26], where it is found at low to medium density [27]. Typically, leukocytes of the hairy-cell leukemia type rarely express CD5. Neither is it present in immature B-cell malignancies, such as pre-B acute lymphoblastic leukemia, or in end-stage differentiated B-cell malignancies, including benign mixed cryoglobulinemia, MM or WM [26, 28]. CD5 is expressed by fewer than half of the B-cell derived non-Hodgkin's lymphomas, and this is mainly on those composed predominantly of small lymphocytes, such as welldifferentiated lymhocytic or intermediate lymphocytic lymphomas [27]. 3.2. Complications With Autoimmunity Autoimmune traits have been identified in more than 8% of patients with B lymphoproliferative syndromes, compared with 2% of those with myeloproliferative states [29]. For example, autoimmune hemolytic anemia occurs in one-third of CLL patients at some time during the course of the disease, and a positive direct antiglobulin test has been claimed to be as frequent as 35%, depending on the stage of this leukemia [30]. Whereas antibodies to polymorphonuclear cells have only been found in a few cases of CLL, both immune thrombocytopenia in about 2% of the patients and a higher incidence of platelet-associed immunoglobulin
have been reported [31]. It is interesting that the red cell autoantibodies in these patients are not produced by the malignant B-cell clone. In fact, hemolysis can precede the onset of CLL, indicating that the autoimmune process is not merely the result of autoantibody secretion by the proliferating B cells [32]. Interestingly, it is well documented that the surface immunoglobulin receptors on malignant B cells have specificity for a variety of autoantigens. For example, in a limited series of 13 CLL patients, 31% (4) were found to express surface IgM capable of binding fluorescein-conjugated IgG [33]. Other studies on IgM antibodies released by leukemic B cells [34], after stimulation with phorbol ester or pokeweed mitogen [35], or following fusion of CLL B cells with nonsecreting murine myeloma cells [36]. In one of these experiments, 12 out of 14 CLL clones appeared to bind to Fc, single- and double-stranded DNA, histones, cardiolipin or cytoskeletal components, of which a number recognized more that one autoantigen. The malignant B cells are thus committed to the production of polyreactive autoantibodies. A number of specificities have been assigned to MIg, including binding to red blood cells, lipoprotein, fibrin monomers, transferrin, albumin, almacroglobulin, cardiolipin and heparin [37]. Interestingly, MIg frequently bind to nuclear components, e.g., DNA, Ro/SSA-La/SSB and Sm/RNP [38]. IgM derived from a patient with WM has also been described to react with several cytoskeletal components [39]. Such autoantibodies have even been implicated in the pathogenesis of peripheral neuropathy, since they react with myelin-associated glycoprotein. MIg preparations from patients with MM, WM, CLL and BMG have been analyzed, using a panel of autoantigens [40]. In this study, MIg preparations from all, except two patients, showed evidence of reactivity with at least one of the autoantigens, whereas, there was little binding of the control monoclonal IgG. This is in keeping with the concept of the origin of natural autoantibodies and the data put forward by Dighiero et al. [41]. The latter investigators made an extensive screening of MIg demonstrating that 10, 5 and 3% of the IgM, IgG and IgA, respectively, displayed autoantibody activity. Additional evidence supporting an association between B-cell lymphoproliferative disorders and nonorgan-specific autoimmune conditions comes from the demonstration that the incidence of rheumatoid
factor, cold lymphocytotoxins, antinuclear and antithyroglobulin antibodies is markedly greater in the first-degree relatives of patients with WM [42], CLL [43], MM [44] or benign monoclonal gammopathy [45] than in the normal controls. Full-blown autoimmune diseases, such as multiple sclerosis. Grave's disease, RA, SLE and pernicious anemia have also been recorded in the family members of these patients, again suggesting that a common genetic factors predispose to B-cell proliferation and antiself reactivity. Conversely, levels of serum IgG, IgM and IgA have been reported to be abnormally high in 25,17 and 50% of RA patients and 10, 23 and 8% of their relatives [46]. MIgs were detected in the sera of 25% of these patients and 4% of their first-degree relatives.
4. CD5+B CELLS: CROSSROADS OF LYMPHOID MALIGNANCY AND AUTOIMMUNITY 4.1. Role Of The CD5+ B Cells CD5-positive B lymphocytes represent such a unique physiological subset that they act as the source of natural autoantibodies, are involved in setting up the idiotypic network as well as the repertoire of the immune system, and in addition play some role in antigen presentation and tolerance induction [47]. These cells are located at the crossroads of systemic diseases and B-cell lymphoproliferative disorders. Thus, higher numbers of circulating CD5-positive B cells are present in pSS patients with serum monoclonal immunoglobulins than in those without it [23]. In fact, the mechanism of expansion of CD5-positive B cells in the nonlymphoproliferative conditions is unclear and may reflect a proliferation of these cells and/or their release into the circulation from peripheral lymphoid tissues. Moreover, while it has been largely documented that both normal and malignant CD5-I- B cells produce polyreactive autoantibodies in the absence of extensive somatic hypermutation [3, 4], it has also now been clearly demonstrated that CD5+ B CLL cells harbor somatically mutated V-region genes [48]. In addition, mutated V genes were also found in CD5+ B cells from patients suffering autoimmune diseases and producing high-affinity rheumatoid factor [49]. Therefore, CD5+ B cells secreting mutated V genesderived immunoglobulins might be involved in im-
243
mune dysfunctions, i.e., autoimmunity and lymphoid malignancy [50]. 4.2. Molecular Features Furthermore, studies are now achieve to understand the role of oncogenes and apoptotic genes in the development of cancer as well as autoimmunity. Regarding the CD5+ B cells few data are to date available but shed light on differences between CD5+ B cells in CLL and their normal counterpart. Normal CD5+ B cells regularly express the c-myc oncogene, at least in mice [51], while it is not expressed in CLL cells [52] suggesting that these latter cells are in a resting state of the cell-cycle. Conversely, with regard to autoimmune states, peripheral blood lymphocytes from patients with SLE, RA [53], pSS [54] and systemic sclerosis [55] over-express c-myc, suggesting that these cells, and likely the CD5+ B cells, are activated. One of the well known genes involved in the regulation of apoptosis is Bcl-2 [56], which was identified at 18q21 of the chromosomal breakpoint of t(14;18) translocation in follicular lymphoma [57]. Bcl-2 is commonly highly expressed in CLL cells while normal CD5-I- B cells express low amounts of Bcl-2 [58] which may explain the inability of CLL cells to progress in the cell-cycle. Intringingly, the rate of apoptosis of SLE-[59] or pSS-derived lymphocytes (Garchon, personal communication) in vitro is strickingly accelerated, albeit the expression of Bcl-2 is also enhanced in circulating mononuclear cells of patients with SLE [60] or pSS [61]. Enforced expression of this antiapoptotic gene in B cells prolongs antibody responses and elicits autoimmune disorders in transgenic mice [62]. Furthermore, it is still uncertain whether the enhanced apoptosis reflects intrinsic abnormalities or ongoing activation, due to a putative superantigen. The latter hypothesis is substantiated by the V^ gene biased usage in systemic autoimmune conditions [63]. The Fas receptor (APO-1, CD95), when ligated with a monoclonal antibody leads to the apoptosis of the target cells [64]. Recently, it was shown that CD5-I- B cells in mice do not constitutively express Fas but only after activation [65]. After stimulation with CD40 ligation, these cells express Fas at only low level and have a reduced susceptibility to Fasmediated apoptosis compared to conventional B cells [66]. CD5+ B CLL cells also express low level of
244
Fas receptor [67], but in some cases, APO-1 antigen expression of CLL cells increased, correlated with a down-regulaton of Bcl-2 expression, following in vitro stimulation with Staphylococcus aureus Cowan I and interleukin-2. This upregulation prepared the cells for monoclonal antibody anti-APO-1 mediated apoptosis [67]. The expression of the Fas receptor appears to be also upregulated in SLE [68]. Two mutations that accelerate autoimmunity and lymphoproliferation, Ipr and gld, are known to correspond to mutations within genes encoding Fas receptor and Fas ligand, respectively [69]. Cell-free Fas ligand has been shown to prevent apoptosis in SLE patients [70], which does not fit to the accelerated apoptosis. The susceptibility of CD5+ B cells to Fas-mediated apoptosis in autoimmune diseases remain however to be determined.
5. CONCLUSION In conclusion, the physiological role of the CD5-H B cells in normal individuals representing a putative separate B cell lineage are likely, through a framework of self-reactivities, to be involved in establishing the immune system repertoire. This cell subset appears to be a target lymphocyte population, the aberrant function of which is associated with nonorgan-specific autoimmune diseases and B lymphoproliferative disorders. Studies on the regulation of CD5-I- B-cell production and function are likely to shed light on the etiology, and pathogenetic pathways operating in these distinctive disease states.
REFERENCES 1.
2.
3.
Seligmann M. Human lymphocyte subsets in health and disease. In: Yamamura T, Tada T, eds., Progress in Immunology. Tokyo: Academic Press, 1984; 10471051. Calligaris-Cappio F, Gobbi M, Bofill M, Janossy G. Infrequent normal B lymphocytes express features of B chronic lymphocytic leukemia. J Exp Med 1982;155:623-628. Youinou P, MacKenzie L, Lamour A, Mageed RA, Lydyard PM. Human CD5-positive B cells in lymphoid malignancy and connective tissue diseases. Eur J Clin Invest 1993;23:139-150.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
Buskila D, Mackenzie LE, Shoenfeld Y, Youinou P, Lydyard PM. The biology of CD5+ B cells. In: Shoenfeld Y, Isenberg DA, eds., Natural autoantibodies. Their physiological role and regulatory significance. Boca Raton: CRC Press, 1993; 125-142. Youinou P, Buskila D, Mackenzie LZ, Shoenfeld Y, Lydyard PM. CD5-positive B cells and disease. In: Shoenfeld Y, Isenberg DA, eds.. Natural Autoantibodies. Their Physiological Role and Regulatory Significance. Boca Raton: CRC Press, 1993; 143165. Lydyard PM, Youinou P, Cooke A. CD5-positive B cells in rheumatoid arthritis and chronic lymphocytic leukemia. Immunol Today 1987;8:37-39. Deane M, Mackenzie LE, Stevenson FK, Youinou PY, Lydyard PM, Mageed RA. The genetic basis of human V H 4 gene family-associated cross-reactive idiotype expression in CD5+ and CD5- cord blood Blymphocytes clones. Scand J Immunol 1993;38:348358. Youinou P, MacKenzie L, Lamour A, Jamin C, Lydyard PM. Human CD5-I- B cells and autoimmunity. Israel J Med Sci 1993;29:874-876. Plater-Zyberk C, Maini RN, Lam K, Kennedy TD, Janossy G. A rheumatoid arthritis B cell susbset expresses a phenotype similar to that in chronic lymphocytic leukemia. Arthrit Rheumatol 1985;28:971-976. Youinou P, Mackenzie LE, Jouquan J, Le Goff P, Lydyard PM. CD5-positive B cells in patients with rheumatoid arthritis: phorbol ester-mediated enhancement of detection. Ann Rheum Dis 1987;46:17-22. Sowden JA, Roberts-Thomson PJ, Zola H. Evaluation of CD5-positive B cells in blood and synovial fluid of patients with rheumatoid arthritis. Rheumatol Int 1987;7:255-259. Becker H, Weber C, Storch S, Federlin K. Relationship between CD5-I- B lymphocytes and the activity of systemic autoimmunity. Clin Immunol Immunopathol 1990;56:219-225. Kazbay K, Osterland CK. The frequency of Leul-iB cells in autoantibody positive and negative autoimmune diseases and in neonatal cord blood. Clin Exp Rheumatol 1990;8:231-235. Dauphinee M, Tovar Z, Talal N. B cells expressing CD5 are increased in Sjogren's syndrome. Arthrit Rheumatol 1988;31:642-647. Youinou P, Mackenzie LE, Le Masson G, Papadopoulos NM, Jouquan J, Pennec YL, Angelidis P, Katsikis P, Moutsopoulos HM, Lydyard PM. CD5-expressing B lymphocytes in the blood and salivary glands of patients with primary Sjogren's syndrome. J Autoimmun 1988;1:185-194. Youinou P, Le Goff P, Renier JC, Hurez D, Miossec P, Morrow WJW. Relationship between rheumatoid
17.
18.
19. 20.
21.
22.
23.
24.
25. 26.
27.
28.
29.
30.
arthritis and monoclonal gammopathy. J Rheumatol 1983;108:2105-215. Rubin L, Urowitz MB, Pruzanski W. Systemic lupus erythematosus with paraproteinemia. Arthrit Rheumatol 1984;27:638-644. Talal N, Bunim JJ. The development of malignant lymphoma in the course of Sjogren's syndrome. Am J Med 1964;36:529-540. Talal N. Maintenance of autoimmunity. Autoimmun 1988;1:703. Tzioufas AG, Manoussakis MN, Costello R, Silis M, Papadopoulos NM, Moutsopoulos HM. Cryoglobulinemia in autoimmune rheumatic diseases. Evidence of circulating monoclonal cryoglobulins in patients with Sjogren's syndrome. Arthrit Rheumatol 1986;29:1098-1104. Talal N, Asofsky R, Lightbody P. Immunoglobulin synthesis by salivary lymphoid cells in Sjogren's syndrome. J CHn Invest 1970;49:49-54. Pablos JL, Carreira PE, Morillas L, Montalvo G, Ballestin C, Gomez-Reino JJ. Clonally expanded lymphocytes in the minor salivary glands of Sjogren's syndrome patients without lymphoproliferative disease. Arthrit Rheumatol 1994;37:1441-1444. Youinou P, Pennec YL, Blaschek MA, Centric A, Jouquan J, Lamour A, Angelidis P. Activation of peripheral blood lymphocytes in patients with primary Sjogren's syndrome. Rheumatol Int 1988;8:125-129. Caligaris-Cappio F, Janossy G. Surface markers in chronic lymphoid leukemias of B cell type. Semin Hematol 1985;22:1-12. Batata A, Shen B. Chronic lymphocytic leukemia with low lymphocyte count. Cancer 1993;71:2732-2738. Gobbi M, Caligaris-Cappio F, Janossy G. Normal equivalent cells of B cell malignancies. Analysis with monoclonal antibodies. Br J Haematol 1983;54:393403. Den Ottolander GJ, Schuit HRE, Waayer JLM, Huibregtsen L, Hijmans W, Jansen J. Chronic B-cell leukemias. Relation between morphological and immunological features. Clin Immunol Immunopathol 1985;35:92-102. Martin T, Pasquali JL. CD5-negative IgM rheumatoid factor B-cells in B-chronic lymphocytic leukemia and benign mixed cryoglobulinaemia. Leuk Lymphoma 1992;7:55-62. Duhrsen U, Augener W, Zwingers T, Brittinger G. Spectrum and frequency of autoimmune derangements in lymphoproliferative disorders. Analysis of 637 cases, and comparison with myeloproliferative diseases. Br J Haematol 1987;67:235-239. Hamblin TJ, Oscier DJ, Young BJ. Autoimmunity in chronic lymphocytic leukemia. J Clin Pathol 1986;39:713-716.
245
31. 32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
246
Gale RP, Foon KA. Biology of chronic lymphocytic leukemia. Semin Hematol 1987;24:204-229. Grey HM, Rabellino F, Pirofsky B. Immunoglobulins on the surface of lymphocytes. IV. Distribution of hypogammaglobulinemia cellular immune dificiency and chronic lymphocytic leukemia. J Clin Invest 1971;50:2368-2377. Kipps TJ, Fong S, Tomhave E, Chen PP, Goldfien RD, Carson DA. Immunoglobulin V gene utilisation. In: Gale RP, Rai KR, eds., Chronic Lymphocytic Leukemia. Recent Progress and Future Direction. New York: Alan R Riss, 1987;115-121. Broker BM, Klajman A, Youinou P, Jouquan J, Worman C, Murphy J, Mackenzie L, Quartey-Papafio R, Blaschek MA, Colhns P, Lai S, Lydyard PM. Chronic lymphocytic leukemia cells secrete multispecific autoantibodies. J Autoimmun Sthoeger ZM, Walkai M, Tse DB, Vinciguerra VP, Allen SL, Budman DR, Lichtman SM, Schulman P, Weusekberg LR, Chiorazzi N. Production of autoantibodies by CD5-expressing B lymphocytes from patients with chronic lymphocytic leukemia. J Exp Med 1989;169:255-268. Borche L, Lim A, Binet JL, Dighiero G. Evidence that chronic lymphocytic leukemia B lymphocytes are frequently committed to production of natural autoantibodies. Blood 1990;76:562-569. Seligmann M, Brouet JC. Antibody activity of human myeloma globulins. Semin Hematol 1973;10:163175. Buskila D, Abu-Shakra M, Amital-Teplizki H, Coates ARM, Krupp M, Sukenik S, Shoenfeld Y. Serum monoclonal antibodies derived from patients with multiple myeloma react with mycobacterial phosphoinositides and nuclear antigens. Clin Exp Immunol 1989;76:378-383. Dellagi K, Brouet JC, Perreau J, Paulin D. Human monoclonal IgM with autoantibody activity against intermediate filaments. Proc Natl Acad Sci USA 1982;79:446-450. Gentric A, Lydyard PM, Youinou P. Multispecific autoantibody reactivity of human monoclonal immunoglobulins. Eur J Int Med 1990;1:279-284. Dighiero G, Guilbert B, Fermand JP, Lymberi P, Danon F, Avrameas S. Thrity-six human monoclonal immunoglobulins with antibody activity against cytoskeleton proteins, thyroglobulin and native DNA. Immunologic studies and clinical correlations. Blood 1983;62:264270. Seligmann M, Danon F, Mihaesco C, Fudenberg HH. Immunoglobulin abnormalities in families of patient with Waldenstrom's macroglobulinemia. Am J Med 1967;43:66-83.
43.
44.
45.
46.
47.
48.
49.
50.
51.
52.
53.
54.
55.
Lockard Conley C, Misiti J, Laster AJ. Genetic factor predisposing to chronic lymphocytic leukemia and to autoimmune disease. Medecine (Baltimore) 1980;59:323-334. Youinou P, Le Goff P, Saleun JP, Rivat L, Morin JF, Fauchier C, Le Menn G. Familial occurrence of monoclonal gammapathies. Biomedicine 1978;28:226232. Youinou P, Fauchier C, Prou O, Rivat-Peran L, Jouquan J, Moysan JF, Le Menn G. Nonorgan-specific autoantibodies and immunoglobulin allotypes in relatives of patients with monoclonal gammopathy. Hum Hered 1985;35:227-231. Youinou P, Mackenzie L, Katsikis PD, Merdrignac G, Isenberg DA, Tuaillon N, Lamour A, Le Goff P, Jouquan J, Drogou A, Muller S, Genetet B, Moutsopoulos HM, Lydyard PM. The relationship between CD5-expressing B lymphocytes and serologic abnormalities in rheumatoid arthritis patients and their relatives. Arthrit Rheumatol 1990;33:339-348. Lydyard PM, Youinou P. Physiology of CD5- positive B cells in health and disease. Fund Clin Immunol 1994;2:9-16. Schroeder HW, Dighiero G. The pathogenesis of chronic lymphocytic leukemia: analysis of the antibody repertoire. Immunol Today 1994;15:288-294. Mantovani L, Wilder RL, Casali P. Human rheumatoid B-la (CD5-I- B) cells make somatically hypermutated high affinity IgM rheumatoid factors. J Immunol 1993;151:473-488. Fischer M, Klein U, Kppers R. Molecular single-cell analysis reveals that CD5-positive peripheral blood B cells in healthy humans are characterized by rearranged Vk genes lacking somatic mutation. J Clin Invest 1997;100:1667-1676. Wang Z, Morris DL, Rothstein TL. Constitutive and inducible levels of erg-1 and c-myc early growth response gene expression in self-renewing B-1 lymphocytes. Cell Immunol 1995;162:309-314. Caligari-Cappio F. B-chronic lymphocytic leukemia: amalignacy of anti-self B cells. Blood 1996;87:26152620. Boumpas DT, Eleftheriades EG, Barez S, Tsokos GC. Oncogene expression and regulation in normal lymphocytes and lymphocytes from patients with autoimmune diseases. Anticancer Res 1988;8:977-984. Boumpas DT, Eleftheriades EG, Molina R, Barez S, Atkinson J, Older SA, Balow JE, Stokds GC. Cmyc proto-oncogene expression in peripheral blood mononuclear cells from patients with primary Sjogren's syndrome. Arthrit Rheumatol 1990;33:49-56. Kahan A, Gerfaux J, Kahan A, Joret AM, Menkes CJ, Amor B. Increased proto-oncogene expression in peripheral blood T lymphocytes from patients with
56.
57.
58.
59.
60.
61.
62.
systemic sclerosis. Arthrit Rheumatol 1989;32:430436. Bissonnette RP, Escheverri F, Mahboubi A, Green DR. Apoptotic cell death induced by c-myc is inhibited by bcl-2. Nature 1992;359:552-554. Cleary ML, Sklar J. Nucleotide sequence of a t( 14; 18) chromosomal breakpoint in follicular lymphoma and demonstration of a breakpoint-cluster region near a transcriptionally active locus on chromosome 18. Proc Natl Acad Sci USA 1985;82:7439-7443. Schena M, Larsson LG, Gottardi D, Gaidano G, Carlsson M, Nilsson K, Caligaris-Cappio F. Growthand differentiation-associated expression of bcl-2 in B-chronic lymphocytic leukemia cells. Blood 1992;79:2981-2989. Emlen W, Niebur J, Kadera R. Accelarated in vitro apoptosis of lymphocytes from patients with systemic lupus erythematosus. J Immunol 1994;152:36853692. Aringer M, Wintersberger W, Steiner CW, Kiener H, Presterl E, Jaeger U, Smolen JS, Graninger WB. High levels of bcl-2 protein in circulating T lymphocytes, but not B lymphocytes of patients with systemic lupus erythematosus. Arthrit Rheumatol 1994;37:14231430. Sugai S, Saito I, Masaki Y, Takeshita S, Shimizu S, Tachibana J, Miyasaka N. Rearrangement of the rheumatoid factor related germline gene Vg and bcl-2 expression in patients with Sjogren's syndrome. Clin Immunol Immunopathol 1994;72:181-186. Strasser A, Whittingham S, Vaux DL, Bath ML, Adams JM, Cory S, Harris AW. Enforced bcl-2 ex-
63.
64.
65.
66.
67.
68.
69. 70.
pression in B-lymphoid cells prolongs antibody responses and elicits autoimmune disease. Proc Natl Acad Sci USA 1991;88:8661-8665. Friedman SM, Posnett DN, Dumang JR, Cole BC, Crow MK. A potential role for microbial superantigens in the pathogenesis of systemic autoimmune disease. Arthrit Rheumatol 1991;34:468^80. Trauth BC, Klas C, Peters AMJ, Matzku S, Moller P, Falk W, Debatin KM. Krammer PH. Monoclonal antibody- mediated tumor regression by apoptosis. Science 1989;245:301-305. Mandik L, Nguyen KAT, Erikson J. Fas receptor expression on B-lineage cells. Eur J Immunol 1995;25:3148-3154. Masuda K, Wang J, Watanabe T. Reduced susceptibility to Fas-mediated apoptosis in B-1 cells. Eur J Immunol 1997;27:449-455. Mapara MY, Bargou R, Zugk C, Dohner H, Ustaoglu F, Jonker RR, Krammer PH, Dorken B. APO-1 mediated apoptosis or proliferation in human chronic B lymphocytic leukemia: correlation with bcl-2 oncogene expression. Eur J Immunol 1993;23:702-708. Mysler E, Bini P, Drappa J, Ramos P, Friedman SM, Krammer PH, Elkon KB. The apoptosis Fas protein in human systemic lupus erythematosus. J Clin Invest 1994;93:1029-1034. Nagata S, Suda T. Fas and Fas ligand, Ipr and gld mutations. Immunol Today 1995; 16:39^3. Cheng J, Zhou T, Liu C, Shapiro JP, Brauer MJ, Kiefer MC, Barr PJ, Mountz JD. Identification of a soluble form of the Fas molecule that protects cells from Fasmediated apoptosis. Science 1994;263:1759-1762.
247
© 2000 Elsevier Science B.V. All rights reserved. Cancer and Autoimmunity Y. Shoenfeld and M. E. Gershwin, editors
Thymoma and Autoimmune Diseases Yaniv Sherer and Yehuda Shoenfeld Research Unit of Autoimmune Diseases, Department of Medicine 'B\ Sheba Medical Center, 52621, Tel-Hashomer, Sackler Faculty of Medicine, Tel-Aviv University, Israel
1. INTRODUCTION
2.1. Myasthenia Gravis
Numerous autoimmune phenomena have been reported in malignancies. These autoimmune conditions may be regarded as paraneoplastic syndromes or syndromes that cannot be explained by the local effects of the tumor or its metastases. The most common neoplasm associated with autoimmune diseases is thymoma. Thymoma is an epithelial tumor that constitutes approximately 15% of all mediastinal masses [1]. It has a wide spectrum of aggressiveness, varying from showing slow progression with a relatively favorable prognosis, to rapid progression leading to death in a short time [2]. Thymoma is most often encountered in middle to later life, with a mean age of diagnosis of 50 years, and without gender predilection [3]. It usually arises in the anterior or anterior-superior mediastinum. Grossly, thymomas are firm, tan-pink to gray, and lobulated, most often with a smooth fibrous capsule. Microscopically, they are composed of cytologically bland thymic epithelial cells with a variable mixture of lymphocytes [3].
MG is an autoimmune disease resulting from the production of antibodies against the acetylcholine receptor of the muscular endplate [4]. Only about one-third of the patients with thymoma have MG, while 10-15% of myasthenic patients have a thymoma. MG patients with thymoma are usually older than 40 years of age, have high antibodies titer and a poor clinical response to thymectomy, whereas MG patients with thymic hyperplasia (which is more frequently found in MG than thymoma) can be either older than 40 years of age with low titer of antibodies and poor response to thymectomy, or younger than 40 years of age, with moderate antibodies titer and a good response to thymectomy. In addition, there is an increased prevalence of autoimmune diseases in MG patients, mainly among those with thymic hyperplasia rather than in those with thymoma [5].
2. AUTOIMMUNE DISEASES ASSOCIATED WITH THYMOMA The various autoimmune diseases that occur in patients with thymoma include mainly myasthenia gravis (MG), pemphigus, systemic lupus erythematosus (SLE), pure red cell aplasia (PRCA), and other conditions that seldom appear concomitantly with this tumor.
2.2. Pemphigus Pemphigus refers to a group of autoimmune blistering diseases of the skin, in which the epidermal cell adhesion is lost [6], due to the formation of autoantibodies against desmosomal transmembrane glycoproteins in the stratified squamous epithelia [6]. The association between pemphigus and cancer has long been postulated. In a case series published in 1974,12% of the total cases of pemphigus were found to have associated internal malignancies [7], and in two recently published case series [8-9] the association ratio of internal malignancies with pemphigus was 5.0%. In addition, 54% of the patients with pemphigus who developed a neoplasm were reported to have a malignancy of the
249
lymphoid or reticuloendothelial system [10]. Nonetheless, pemphigus has also been reported with solid tumors of all organs [11]. Pemphigus was found to appear before or after the resection of neoplasm with equal frequency [7]. Thymoma is one of the neoplasms associated with pemphigus. Pemphigus vulgaris is more common in patients with nonthymic neoplasms, whereas in patients with thymoma, it is as common as pemphigus foUaceus [12]. However, Souteyrand et al. [13] have previously reviewed 20 cases of patients with thymoma and pemphigus, and in their report pemphigus erythematosus was the predominant type (55% of the cases). Interestingly, patients with nonthymic neoplasms usually have pemphigus before the detection of malignancy, whereas the majority of patients with thymoma have it before the development of pemphigus [14]. Since thymoma is associated with other autoimmune conditions as well, it is not surprising that many of pemphigus patients have additionally another autoimmune disease. Most of the cases of pemphigus associated with thymoma and another autoimmune disease are summarized in a review by Patten and Dijkstra [15]. A recently published case report, that is not included in this review, deals with a patient who was found to have thymoma, pemphigus erythematosus and systemic lupus erythematosus [16].
2.3. Systemic Lupus Erythematosus SLE is only rarely found in patients with thymoma, usually it is found before the diagnosis of thymoma, and in older patients than those with only SLE [17] are. However, SLE is more common in patients with MG than in patients with thymoma, and hence once chronic fatigue is found in SLE patients, MG should be included in the differential diagnosis [18].
2.4. Pure Red Cell Aplasia PRCA is found in 5-10% of patients with thymoma [19], and there are also reports of patients with the triad of PRCA, MG and thymoma. PRCA is considered as an autoimmune condition that involves either humoral (a serum IgG erythropoietic inhibitor)
250
or a cellular component (T cell capable of inhibiting erythropoiesis). In addition, there are also several reports of autoimmune hemolytic anemia associated with thymoma (reviewed in [20]).
3. AUTOIMMUNE DISEASES IN BENIGN AND MALIGNANT THYMOMA Malignant thymomas, as opposed to benign thymomas, constitute a minority of all epithelial tumors of the thymus. These are classified into type I: tumors which are locally invasive, tend to recur and occasionally metastasize widely, but cannot be differentiated cytologically from their benign counterparts [21]; and type II: tumors that are also identified as thymic carcinoma since they exhibit cytological and histological features of malignancy identical to carcinomas arising in extrathymic sites [22]. We recently discussed the difference between the association of autoimmune diseases with benign and invasive thymomas, as we have reported about 6 patients with autoimmune diseases and malignant thymoma [23]. They included 5 patients with type I malignant thymoma and 1 patient with type II malignant thymoma, and also the first reported cases of Graves' disease with thymoma and of Sjogren's syndrome with thymic carcinoma [23]. With respect to the association of malignant thymoma with autoimmune diseases, there is a significant difference between types II and I. Malignant thymoma type I (invasive thymoma) was often described in some case series to occur in patients with MG, the autoimmune disease most frequently found in thymomatous patients (summarized in [24]). In addition, pemphigus, SLE and PRCA were also reported in patients with type I malignant thymoma. As opposed to malignant thymoma type I, there are only few case reports of autoimmune diseases with thymic carcinoma (mahgnant thymoma type II), usually of MG. The difference between both types in the association with autoimmune conditions is related to their differences in histology. Hence, whether thymic carcinoma is histogenetically distinct from thymoma, or it is a poorly differentiated variant of thymoma, its cellular and environmental features may not be usually sufficient to create a proper stimulus for autoimmunity emergence.
4. THE EFFECT OF THYMECTOMY ON AUTOIMMUNE DISEASES Bone-marrow transplantation has recently been suggested as an optional treatment for severe autoimmune diseases [25]. As there is a strong association between thymic pathology and autoimmunity, it is not surprising that thymectomy also might have a beneficial effect on the course of autoimmune diseases. 4.1. The Rationale Behind Thymectomy for the Treatment of Autoimmune Diseases Since MG is the autoimmune disease most commonly found in patients with thymoma, literature reports focus on the pathogenesis of this disease in thymomatous patients. Alterations in the thymus are found in about 80% of MG patients. When MG is associated with thymitis, the acetylcholine receptors on the myoid cells trigger a classical antigen-driven immune reaction and the intrathymic production of acetylcholine receptor-specific autoantibodies [26]. Thymus cells from 82 out of 109 MG patients with serum acetylcholine receptor-specific autoantibodies secreted these antibodies in vitro [27]. On the other hand, in thymomas there is an expression of abnormal neurofilaments that share epitopes with the acetylcholine-receptor, and they trigger autoantigen-specific T-cell selection by molecular mimicry. Neither intratumor autoantibody production nor T-cell activation seems to occur in thymomas [26]. The isolation of similar acetylcholine receptor-specific T-cell clones from 2 MG thymomas and the presence of their minority isotypes also on antigen-presenting cells in the donors' tumors, further support the theory of active induction of specific T cells by thymomas, rather than failure to tolerize them against self antigens [28]. Therefore, it is only logical to speculate that removal of the thymus/thymoma might at least result in removal of the trigger of the disease, and thus lead to clinical improvement. 4.2. CUnical Outcome of Thymectomy in Autoimmunity Thymectomy is most often used in MG patients, and as a rule of a thumb it should be offered to all MG patients unless they are older than 50 years of age, have purely ocular disease, minimal symptoms or juvenile myasthenia [29]. However, the nature of thymic
involvement in the pathogenesis of MG affects the response to thymectomy: whereas 80% of the patients with thymic hyperplasia are expected to have significant clinical improvement or even complete remission after thymectomy, the response to thymectomy is disappointing in the presence of thymoma [30]. Similarly, thymectomy results in a good clinical response in patients with relapsing-remitting multiple sclerosis rather than patients with chronic-progressive disease [31]. Another condition in which thymectomy was found beneficial is ulcerative colitis: in a series of ulcerative colitis patients, thymectomy induced high percentage of remission, and decreased the anticolon antibody activity [32]. As opposed to either the clinical improvement or the no significant change after thymectomy, this procedure can also result in clinical deterioration. The best example is SLE that is which thymectomy is practically contraindicated [33]. Even though there are few reports of a good clinical outcome of thymectomized SLE patients [17, 34], the disease can either deteriorate [17] or even appear de novo (reviewed in [35]). Furthermore, as autoimmune diseases were found to appear in several cases after bonemarrow transplantation [36], a similar phenomenon occurs after thymectomy: whereas this procedure is used successfully for the treatment of one disease, a "disease switch" occurs and a new disease appears [37-38]. Examples include the appearance of pemphigus, SLE and antiphospholipid syndrome after thymectomy for another condition, usually MG.
REFERENCES 1. 2.
3.
4. 5.
Morgenthaler TI, Brown LR, Colby TV, et al. Thymoma. Mayo Clin Proc 1993;68:1110-1123. Koga K, Matsuno Y, Noguchi M, et al. A review of 79 thymomas: modification of staging system and reappraisal of conventional division into invasive and non-invasive thymoma. Pathol Int 1994;44:359-367. Lewis JE, Wick MR, Scheithauer BW, et al. Thymoma: a clinicopathologic review. Cancer 1987;60:2727-2743. Havard CWH, Fonseca V. New treatment approaches to myasthenia gravis. Drugs 1990;39:66-73. Aarli JA, Gilhus NE, Matre R. Myasthenia gravis with thymoma is not associated with an increased incidence of non-muscle autoimmune disorders. Autoimmunity 1992;11:159-162.
251
6. 7. 8.
9.
10.
11. 12.
13.
14. 15.
16.
17.
18.
19.
20.
21.
22.
23.
252
Stanley JR. Defective cell-cell adhesion in the epidermis. Ciba Found Symp 1995;189:107-120. Krain LS, Bierman SM. Pemphigus vulgaris and internal malignancy. Cancer 1974;33:1091-1099. Ogawa H, Sakuma M, Morioka S, et al. The incidence of internal malignancies in pemphigus and bullous pemphigoid in Japan. J Dermatol Sci 1995;9:136141. Morioka S, Sakuma M, Ogawa H. The incidence of internal malignancies in autoimmune blistering diseases: pemphigus and bullous pemphigoid in Japan. Dermatology 1994;189(suppl l):82-84. Krain LS. The association of pemphigus with thymoma or malignancy: a critical review. Br J Dermatol 1974;90:397-405. Ahmed AR, Graham J, Jordon RE, et al. Pemphigus: current concepts. Ann Int Med 1980;92:396-405. Sherer Y, Bar-Dayan Y, Shoenfeld Y. Thymoma, thymic hyperplasia, thymectomy and autoimmune diseases. Int J Oncol 1997;10:939-943. Souteyrand P, Berthier Boachon M, Thivolet J. Pemphigus and thymoma: review and ethiopathogenesis. Ann Dermatol Venereol 1981;108:457^67. Younus J, Ahmed AR. The relationship of pemphigus to neoplasia. J Am Acad Dermatol 1990;23:498-502. Patten SF, Dijkstra JW. Association of pemphigus and autoimmune disease with malignancy or thymoma. Int J Dermatol 1994;33:836-842. Ascherman DP, Katz P. Systemic lupus erythematosus, pemphigus erythematosus, and thymoma in the same patient. J Clin Rheumatol 1996;2:152-155. Zandman Goddard G, Lorber M, Shoenfeld Y Systemic lupus erythematosus and thymoma—a double-edged sword. Int Arch Allergy Immunol 1995;108:99-102. Yaiopoulos G, Sfikakis PP, Kapsimali V, et al. The association of systemic lupus erythematosus and myasthenia gravis. Postgrad Med J 1994;70:741745. Bailey RO, Dunn HG, Rubin AM, et al. Myasthenia gravis with thymoma and pure red cell aplasia. Am J Clin Pathol 1988;89:687-693. Rennenberg RJ, Pauwels P, Vlasveld LT. A case of thymoma-associated autoimmune haemolytic anaemia. Neth J Med 1997;50:110-114. Snover DC, Levine GD, Rosai J. Thymic carcinoma: five distinctive histological variants. Am J Surg Pathol 1982;6:451-470. Fong PH, Wee A, Chan HL, et al. Primary thymic carcinoma and its association with dermatomyositis and pure red cell aplasia. Int J Dermatol 1992;31:426428. Levy Y, Afek A, Sherer Y, et al. Malignant thymoma associated with autoimmune diseases: a retrospective
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
study and review of the literature. Semin Arthritis Rheum 1998;28:73-79. Monden Y, Nakahara K, Nanjo S, et al. Invasive thymoma with myasthenia gravis. Cancer 1984;54:25132518. Sherer Y, Shoenfeld Y. Stem cells transplantation— a cure for autoimmune diseases. Lupus 1998;7:137140. Marx A, Wilisch A, Schultz A, et al. Pathogenesis of myasthenia gravis. Virchows Arch 1997;430:355364. Yoshikawa H, Lennon VA. Acetylcholine receptor autoantibody secretion by thymocytes: relationship to myasthenia gravis. Neurology 1997;49:562-567. Nagvekar N, Moody AM, Moss P, et al. A pathogenic role for the thymoma in myasthenia gravis. Autosensitization of IL-4-producing T cell clones recognizing extracellular acetylcholine receptor epitopes presented by minority class II isotypes. J Clin Invest 1998;101:2268-2277. Nyberg HR, Gjerstad L. Immunopharmacological treatment in myasthenia gravis. Transplant Proc 1988;20:201-210. Spuler S, Sarropoulos A, Mark A, et al. Thymomaassociated myasthenia gravis. Transplantation of thymoma and extrathymomal thymic tissue into SCID mice. Am J Pathol 1996;148:1359-1365. Trotter JL, Cliffort BD, Montgomery EB, et al. Thymectomy in multiple sclerosis: a three year follow-up. Neurology 1985;35:1049-1051. Tsuchiya M, Asakura H, Yoshimatsu H. Thymic abnormalities and autoimmune diseases. Keio J Med 1989;38:383^02. D'andrea V, Malinovsky L, Ambrogi V, et al. Thymectomy as treatment of autoimmune diseases other than myasthenia gravis. Thymus 1993;21:1-10. Steven MM, Westedt ML, Euldering F, et al. SLE and invasive thymoma: report of 2 cases. Ann Rheum Dis 1984;43:825-828. Mevorach D, Perrot S, Buchanan NM, et al. Appearance of systemic lupus erythematosus after thymectomy: four case reports and review of the literature. Lupus 1995;4:33-37. Sherer Y, Shoenfeld Y. Autoimmune diseases and autoimmunity post-bone marrow transplantation. Bone Marrow Transplant 1998;22:873-881. Sherer Y, Bar-Dayan Y, Shoenfeld Y Thymectomy and autoimmune diseases—the dual connection. Semin Clin Immunol 1997;1:5-11. Sherer Y, Bar-Dayan Y, Shoenfeld Y. The dual relationship between thymectomy and autoimmunity: the kaleidoscope of autoimmune disease. In: Paul S, ed.. Autoimmune Reactions. Totowa, New Jersey: Humana Press, 1998;371-382.
© 2000 Elsevier Science B. V. All rights reserved. Cancer and Autoimmunity Y. Shoenfeld and M. E. Gershwin, editors
Castleman's Disease and Autoimmunity C. Alessandri, F. Viganego and G. Valesini Universita di Roma ''La Sapienza ", Italy
Castleman's disease (CD) is an uncommon lymphoproliferative disorder of unknown aetiology first described by Castleman [1] in 1954. CD histopathologic classification is complex and this disease is also referred to as giant lymph-node hyperplasia, angiomautous lymphoblastoid hamartoma and follicular lymphoreticuloma [2]. Although CD is a distinct clinicopathology entity, it tends to frequently share some common histological features with other immunological disorders, especially autoimmune diseases [3]. The diagnosis of CD is based on pathological classification of biopsy specimen. Keller et al. [4] described two histopathological pictures of CD: hyalinevascular (HV) and plasma cells (PC) type. HV hystomorphology is characterized by small lymphoid follicle with hyalinized germinal centre surrounded by lymphocytes in onion skin appearance, and hypervascular interfollicular tissue with a lack of sinuses. On the other hand, PC type is characterized by a large number of mature plasma cells, within interfollicular tissue, normal or prominent germinal centre and absence of capillary proliferation. Nevertheless, this distinction is not absolute because a mixed hystomorphology feature has been described largely in the literature. Moreover, polyploid follicular dendridic reticulum cells may be found in HV- and PC-CD. Generally, immunophenotyping of the plasma cells and immunoblasts reveals a polyclonal population. Nevertheless, autonomous clones have been detected in multicentric CD [5]. Several clinical differences between the two pathologic types, unicentric- and multicentric-CD, have been recognized. According to McCarty et al. [2], multicentric-CD can also be divided into two subtypes respectively with or without neuropathy. Neu-
ropathy, especially progressive sensorimotor polyradiculitis, could also represent an overlap with the so-called POEMS syndrome (peripheral neuropathy, organomegaly, endocrinopathy, monoclonal protein and skin lesions) [6, 7], a clinical entity first described in 1980 by Bradwick et al. [8]. The clinical onset of CD is variable from 10 to 70 years. The multicentric subtype of the disease occurs more frequently in older patients [2]. Localized mediastinum large benign lymph node, characterized by HV histological morphology, represents the most frequent clinical presentation of this disease. However, the lymph node mass may occur in other sites, most commonly in the neck. Generally asymptomatic or associated to mechanical symptoms, localized CD has a good prognosis and surgery is curative in the majority of cases. In fact, the development of malignant lymphoma, Kaposi's sarcoma or carcinoma has been rarely described. However, the PC subtype more frequently develops as a multicentric disease. Constitutional symptoms—such as fever, haemolytic anaemia, weakness, hyper-y-globulinemia, hypoalbuminemia and hepatosplenomegaly—have been described; prognosis is poor and lymphoma or Kaposi's sarcoma frequently complicates the disease. The aetiology of CD is unclear. Lymphoid hyperplasia in response to chronic infection may be involved. In the past, the Epstein-Barr virus was suspected to be the causative organism [9]; more recently, Kojima et al. [3] detected EBV genomes, using in situ hybridization, in the small lymphocytes of 2 out of 3 patients with systemic lupus erythematosus and CD-like lymphadenopathy. In addition, human Herpesvirus-8 (HHV-8), originally identified in Kaposi's sarcoma, has been involved in a variety of
253
lymphoid disorders, including multicentric CD [10]; HHV-8 is a lymphotropic virus whose infection occurs in 100% of AIDS-related multicentric CD and approximately 40% of AIDS-unrelated multicentric CD [11]. One of the first evidences of a CD-autoimmunity link came from the finding of immune complexes in the glomerular basement membrane of patients with CD-associated nephrotic syndrome [12], as well as from the description of anemia caused by antierythropoietin factor [13]. Autoimmunity plays its role in two complementary ways: B and T autoreactive lymphocytes, both arising from lymph nodes. In fact, the whole process of development of a primary immune response begins in secondary lymphoid tissues, such as lymph nodes, spleen and MALT. Physiologically, the secondary lymphoid tissue is the site where naive lymphocytes intercept antigens, become activated, proliferate and cooperate with B cells, giving birth to a complete immune response. Consequently, autoimmune phenomena could be an expression of a disregulation of the immune system, which is permanently activated against several possible unknown antigens. Thus, the polyclonal hypery-globulinemia and polyclonal plasma cells infiltrates frequendy found respectively in CD patients' sera and pathologic specimens may confirm this "reactive state". Moreover, CD histology and immunohistology are absolutely not specific for CD only: in fact, similar or even identical features may be found in many disorders, including autoimmune diseases. This sort of overlapping has been recently stressed by Kojima, who found lymphadenopathy with histopathological and immunohistochemical features resembling CD in 26% of SLE patients [3]; therefore, sometimes, a differential diagnosis is almost exclusively made on the clinical basis. This sort of lymphatic tissue "overdrive" in patients with CD could evolve, in some of them, into lymphoproliferative diseases [14]. Indeed, to confirm its close association with autoimmune disorders there is also much evidence of CD either following or preceding the onset of autoimmune clinical manifestations. In 1981, Lenner and Lundgren [15] described a case where the onset of autoimmunity (in this case, temporal arteritis) was preceded by recurrent HV-CD localized in a peripheral lymph node; on the other hand, many cases of CD have been described, even after a long time, subsequent to manifestations or diagnosis of autoimmune diseases: among them.
254
for example, cases of patients diagnosed as Sjogren's syndrome (SS) who later developed CD are present in the literature [16, 17]. This heterogeneity in CD onset time in relation to the appearance of autoimmunity signs makes working out a pathogenetical connection between these two disorders even more difficult. Nevertheless, the association between SS and CD does not surprise at all, since both diseases are characterized by lymphocytic infiltration of nodal and extranodal tissues; moreover, SS has been clearly associated with lymphoproliferative disorders [18]. Indeed, many authors reported (mainly multicentric) manifestations of CD with clinical features of autoimmunity, such as Sicca syndrome, cardiomyopathy, palmar and plantar rash [19], hepatosplenomegaly, polyserositis, polyneuropathy [20], temporal arteritis [15], severe orogenital ulcers, bilateral uveitis, necrotic purulent nodules consistent with diagnosis of Behcet's disease [21], relapsing polychondritis [22]. In all these cases, such clinical manifestations seem to reflect organ damage due to lymphocytic infiltration or cytokines overproduction normally observed in multicentric CD. Some authors pointed out that the production of interleukin-(IL)-6 by B cells located in the hyperplastic lymph nodes may be responsible for acute phase manifestations of autoimmunity [23]. Indeed, it is a fact that a high serum IL-6 level has been detected in sera from patients with CD [24]. Besides, inappropriate IL-6 production has been noted in several autoimmune diseases such as RA, SLE and SS [19, 25]. Moreover, anti-IL-6 monoclonal antibody has been reported to produce improvement of constitutional symptoms and laboratory abnormalities in one patient with PC-CD [26]. The bare fact that in many cases of localized CD resection of the lymph node mass brought to the resolution of the disease and to a definitive declining of IL-6 to normal values [24] could be another clue suggesting that the mass itself may play a sustaining role into the inflammatory process, by means of cytokines perturbation—i.e., IL-6 overproduction [27]—triggering the autoimmune phenomenon. This process could be hypothetically "primed" by some common or uncommon infective agent, such as a virus (i.e., HHV-8), in genetically predisposed individuals. Several haematological autoimmune features, such as autoimmune thrombocytopenia and/or neutropenia [17, 28, 29], haemolytic anemia [30, 31] have also
Table 1. Clinical and serological features of 3 patients with CD Patient name/sex/age
Histopathological type
Clinical findings
Laboratory findings
RM.R./female/44
Hyaline-vascular
Fever Weakness Lymphadenopathy Hepatosplenomegaly Polyserositis Polyarthralgias Thrombophlebitis Palmar rash Interstitial lung disease
Hyper- y -globulinaemia ANA (coarse speckled pattern) anticardiolipin antibodies
M.D.L./male/55
Plasmacellular
Fever Weakness Weight loss Lymphadenopathy Hepatosplenomegaly Polyarthralgias Polyneuropathy sensorimotor Polyserositis Palmar rash
Hyper- y -globulinaemia RF ANA (nucleolar pattern) anticardiolipin antibodies
A.R./male/58
Plasmacellular
Fever Weakness Lymphadenopathy Hepatosplenomegaly Pleuritis Interstitial lung disease
Hyper-y -globulinaemia ANA (nucleolar pattern)
been presented coincidentally with CD. Interesting is also the described association of CD with paraneoplastic pemphigus (PNP) [32, 33] and myasthenia gravis [34]. This could account for the extremely wide range of possible organ-targeted pathogenic autoantibodies that CD may be able to raise. In the end, descriptions of a few cases of CD occurring together with disorders somehow connected to manifestations of autoimmunity—like Crohn's disease [29] or renal amyloidosis with red cell aplasia [35]—have recently made their appearance in the literature. During the last 10 years, among approximately 6000 patients who referred to our department for autoimmune-rheumatic diseases, we happened to observe three cases of CD, whose clinical and serological
features are shown in Table 1. Among the clinical manifestations which could be associated to autoimmunity, we observed polyarthralgias, polyserositis, thrombophlebitis and interstitial lung disease, whereas, hyper-)/-globulinemia, antinuclear antibodies (ANA), rheumatoid factor and anticardiolipin antibodies (anti-CL) were the most common serological abnormalities. It is noteworthy that 2 out of 3 patients presented ANA positivity with nucleolar pattern, while the last patient, who was positive for anti-CL, had experienced thrombophlebitis. In the end, these clinical and immunological aspects that CD shares with autoimmune diseases could be useful to understand the pathogenesis of this rare lymphoproliferative disorder.
255
REFERENCES 1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
256
Castleman B. Records of the Massachusetts General Hospital—weekly clinicopathological exercises (Case 40011). N Engl J Med 1954;250:26-30. McCarthy MJ, Vukelja SJ, Banks P, Weiss R. Angiofollicular lymph node hyperplasia (Castleman's disease). Cancer Treat Rev 1995;21:291-310. Kojima M, Nakamura S, Itoh H,Yoshida K, Asano S, Yamane N, et al. Systemic Lupus Erythematosus (SLE) lymphadenopathy presenting with histopathologic features of Castleman's disease: a clinicopathologic study of five cases. Pathol Res Pract 1997;193:565-571. Keller AR, Hochholzer L, Castleman B. Hyalinevascular and plasma-cell types of giant lymph node hyperplasia of the mediastinum and other locations. Cancer 1972;29:670-683. Radaszkiewicz T, Hansmann ML, Lennert K. Monoclonality and polyclonality of plasma cells in Castleman's disease of the plasma cell variant. Histopathologyl989;14(l): 11-24. Leger-Ravet MB, Peuchmaur M, Devergne O, Audouin J, Raphael M, Van Damme J, et al. Interleukin6 gene expression in Castleman's disease. Blood 1991;178:2923-2930. Adelman HM, Cacciatore ML, Pascual JF, Mike JM, Alberts WM, Wallach PM. Case report: Castleman's disease in association with POEMS. Am J Med Sci 1994;307:112-114. Bradwick PA, Zvaifler NJ, Gill GN, Newman D, Greenway GD, Resnik DL. Plasma cell dyscrasia with polyneuropathy, organomegaly, endocrinopathy, M protein and skin changes: the POEMS syndrome. Medicine 1980;59:311-322. Weisenburger DD, DeGowin RL, Gibson P, Armitage JO. Remission of giant lymph node hyperplasia with anemia after chemotherapy. Cancer 1979;44:457462. Luppi M, Torelli G. The new lymphotropic herpesviruses (HHV-6, HHV-7, HHV-8) and hepatitis C virus (HCV) in human lymphoproliferative diseases: an overview. Haematologica 1996;81:265-281. Gaidano G, Pastore C, Gloghini A, Capello D, Polito P, Vaccher E, et al. Human herpesvirus type-8 (HHV8) in haematopoietic neoplasia. Leuk Lymphoma 1997;24(3-4):257-266. Humphreys SR, Holley KE, Smith LH, Mc Ibrat DC. Mesenteric angiofollicular lymph node hyperplasia (lymphoid hamartoma) with nephrotic syndrome. Mayo Clin Proc 1975;50:317-321. Burgert E, Gilchrist GS, Fairbanks VF. Intraabdominal angiofollicular lymph node hyperplasia
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
(plasma cell variant) with an antierythropoietic factor. Mayo Clin Proc 1975;50:442-546. Ghirindelli P, Ghirindelli L. Linfoadenopatie e malattie con manifestazioni di autoimmunita. Min Med 1988;79:761-774. Lenner P, Lundgren E. Giant lymph node hyperplasia (Castleman's disease) associated with temporal arteritis. Scand J Haematol 1981;27:263-266. Tavoni A, Vitali C, Baglioni P, GerH R, Marchetti G, Di Munno O, et al. Multicentric Castleman's disease in a patient with primary Sjogren's syndrome. Rheumatol Int 1993;12:251-253. Higashi K, Matsuki Y, Hidaka T, Aida S, Suzuki K, Nakamura H. Primary Sjogren's syndrome associated with hyaline-vascular type of Castleman's disease and autoimmune idiopathic thrombocytopenia. Scand J Rheumatol 1997;26:482-484. Valesini G, Priori R, Bavoillot D, Osborn J, DanieU MG, Del Papa N, et al. Differential risk of nonHodgkin's lymphoma in Italian patienta with primary Sjogren's syndrome. J Rheumatol 1997;24(12):23762380. Kingsmore SF, Silva OE, Hall BD, Sheldon A, Cripe LD, Clair WS. Presentation of multicentric Castleman's disease with Sicca syndrome, cardiomyopathy, palmar and plantar rash. J Rheumatol 1993;20:15881591. Gohlke F, Marker-Hermann E, Kanzler S, Mitze M, Meyer zum Buschenfelde KH. Autoimmune findings resembling connective tissue disease in a aptient with Castleman's disease. Clin Rheumatol 1997;16(1):8792. Pacor ML, Peroli P, Givanni S, Ambrosetti A, Biasi D, Bambara ML, et al. Unicentric Castleman's lymphoadenopathy presenting with Behget syndrome: a case report. Haematologica 1990;75:470-472. Manganelli P, Quaini F, Olivetti G, Savini M, Pileri S. Relapsing polychondritis with Castleman-like lymphadenopathy: a case report. Clin Rheumatol 1997;16(5):480-484. Kojima M, Nakamura S, Shimizu K, Itoh H, Yoshida K, Hosomura Y, et al. Florid reactive follicular hyperplasia in elderly patients. A cUnicopathological study of 23 cases. Pathol Res Pract 1998;194:391-398. Yoshizaki K, Matsuda T, Nishimoto N, Kuritani T, Taeho L, Aozasa K, et al. Pathogenic significance of Interleukin-6 (IL-6/BSF-2) in Castleman's disease. Blood 1989;74:1360-1367. Germanidis GS, Manoussakis MN, Tzioufas AG, Drosos AA, Aarden LA, Moutsopoulos HM. Interleukin-6 (IL-6) in serum of patients with primary Sjogren's syndrome and other rheumatic diseases. Clin Exp Rheumatol 1991;9:334.
26.
27. 28.
29.
30.
31.
Beck JT, Hsu SM, Wjidenes J, Bataille R, Klein B, Vesole D, et al. Brief report: alleviation of systemic manifestations of Castleman's disease by monoclonal anti-Interleukin-6 antibody. N Engl J Med 1994;330(9):602-605. Yoshizaki, Interleukin-6 in autoimmune disorders. Semin Immunol 1992;4(3): 155-166. Carrington PA, Anderson H, Harris M, Walsh SE, Houghton JB, Morgenstem GR. Autoimmune cytopenias in Castleman's disease. Am J Clin Pathol 1990;94:101-104. Burak KW, Bridges RJ, Blahey WB. Castleman's disease and neutropenic enterocolitis presenting as Crohn's disease. Can J Gastroenterol 1998;12(4):270-272. Liberato NL, Bollati P, Chiofalo F, Filipponi M, Poli M. Autoimmune hemolytic anemia in multicentric Castleman's disease. Haematologica 1996;81(1):4043. Rojas R, Martin C, Roman J, Garcia JM, Marchal T, Torres A. Autoimmune haemolytic anemia presenting
32.
33.
34.
35.
9 years prior to Castleman's disease. Br J Haemaol 1994;86(2):431-432. Jansen T, Plewig G, Anhalt GJ. Paraneoplastic pemphigus with clinical features of erosive lichen planus associated with Castleman's tumor. Dermatology 1995;190:245-~250 Kim SC, Chang SN, Lee IJ, Park SD, Jeong ET, Lee CW, et al. Localized mucosal involvement and severe pulmonary involvement in a young patient with paraneoplastic pemphigus associated with Castleman's tumour. Br J Dermatol 1998;138(4):667671. Pasaoglu I, Dogan R, Topcu M, Gungen Y. Multicentric angiofollicular lymph-node hyperplasia associated with myastenia gravis. Thorac Cardiovasc Surg 1994;42(4):253-256. Funabiki K, Kaneko S, Terajima M, Tomita H, Kawano Y, Tomino Y A case of multicentric Castleman's disease associated with renal amyloidosis and pure red cell aplasia. Am J Nephrol 1998;18(3):247250.
257
(c) 2000 Elsevier Science B.V All rights reserved. Cancer and Autoimmunity Y. Shoenfeld and M. E. Gershwin, editors
IgA and Cancer Thomas P. Prindiville, Mary C. Cantrell, Yehuda Shoenfeld and M. Eric Gershwin University of California at Davis, CA, USA
1. INTRODUCTION The ability of the immune system to discriminate between self and nonself is essential for health and is the basis for the phylogeny of immune development. In contrast, in the emerging field of tumor immunobiology, self-responses depend largely on the immunogenicity of the neoplasm. Immunogenicity, or self-determinant discrimination, is dependent on, or enhanced by, a combination of positive selection, anergy and/or negative selection, HLA function, and absence of inhibiting factors. The humoral immune system is initiated by cellular immune response and is not considered to be normally involved with effective antitumor responses, based on data from transfer experiments in which specific immunity could be demonstrated with transferred T cells but not with antibodies. Nonetheless, developmentally, both B and T lymphocytes are derived from a common stem cell and factors that influence their differentiation and maturation may explain some of the observational findings in patients with neoplasms.
2. IMMUNOGLOBULINS Immunoglobulins (Igs) are produced from differentiated B lymphocytes. They bind antigens and inactivate or remove offending toxins, microbial agents and other foreign substances hostile to the body. Initially, precursor cells transition through several developmental stages, then produce IgM. At this stage, further differentiation involves cytokine facilitated class switching. Structurally, all Ig classes (IgG, IgM, IgA, IgD and IgE) consist of two heavy and two light chains, however, their functional characteristics vary widely.
The mucosal immune system is comprised of the lymphoid tissue associated with epithelial surfaces of the gastrointestinal, respiratory and urogenital tracts. This system is different from the systemic immune system in that it evolves under constant exposure to environmental antigens. The distinctive features of this system include predominance of the mucosa-related immunoglobulin (IgA), mucosa-specific regulatory effector T cells and a mucosa-oriented lymphocytehoming system which allows antigen-activated lymphocytes to migrate selectively from the mucosal follicles to the diffuse subepithelial lymphoid tissue [1]. Thus, the mucosal immune system is relatively segregated from the systemic immune system and functions somewhat as a distinct immunological entity. However, both systems are quite complex with effector mechanisms influenced by cytokines, T cells, macrophages, agents and toxins. Although IgA comprises only 7-15% of the total serum immunoglobulins, it is the predominant immunoglobulin in body secretions such as gastrointestinal tract secretions, saliva, tears, nasal secretions and human milk. The first step in isotype switching to IgA in humans is induction by transforming growth factor pi (TGF-)61). It has been proposed that TGFfil binds to IgM cell surface receptors resulting in signaling and subsequent activation of lA-region. There are two subclasses of IgA in humans, a l and Of2 [2]. IgAl is the predominant circulating subclass in serum while IgA2 is primarily found in body secretions. Secretory IgA (sIgA) is a dimer consisting of two monomers of IgA joined by a "J" chain and a glycoprotein called secretory protein. IgAl fixes complement by the alternate pathway and has potent antiviral properties. IgA also prevents the binding of virus to epithelial cells of the respiratory and the gas-
261
trointestinal tract. IgA has a special role in "immunological exclusion", a process by which it provides a barrier to macromolecular absorption at the mucosal level by binding antigens, leading to their entrapment and subsequent degradation by proteases. This protects the immune system from unnecessary, excessive and potentially harmful antigenic stimulation. Antigen bound IgA interferes with complement fixation which is necessary for cell-mediated tumor lysis [3]. Two lineages of intestinal IgA have been defined, Bl and B2. Bl cells are self-renewing cells of the peritoneal cavity that are directed against bacterial antigens. B2 cells account for the majority of IgA producing cells in mucosa and respond to proteins. B2 cells are IL-6 dependent and IL-5 independent while Bl cells are IL-5 dependent and IL-6 independent [4]. Cytokines are intimately involved in Ig class switching and reciprocal regulation of T-helper cell (Th) subsets occurs. In IFN}//IL-4 double knockout mice, IgA differentiation is normal, however, induction of specific antibody response is impaired [5]. Various external stimuli, such as LPS and toxins, mediated by intestinal macrophages, induce increased IL6 production and elevated IgA levels. A co-stimulatory role for intestinal macrophages is suggested [6]. Dendritic cells recruit antigen specific T cells and induce the production of Igs by increasing B-cell growth and differentiation to IgA producing cells by induced isotype switching [7]. Mature B cells secrete IL-10, which inhibits cell-mediated immunity and inflammation, thereby promoting the humoral limb. The Epstein-Barr virus (EB V) infection induces high levels of human IL-10 in EBV expressing cells. Neutralizing antibody studies suggest that IL-10 acts as a B-cell growth factor in EBV infected B cells, with IL-6 acting synergistically. Overexpression of B cell derived IL-10 may contribute to humoral disorders [8]. IL-12 alters helper T-cell subsets when administered orally, triggering Thl-type responses and subsequent decreased secretory IgA responses [9].
3. IGA DEFICIENCY AND NEOPLASIA The association of immunodeficiency disease and the development of malignancy is based on observational data. Cunningham-Rundles et al. [10] screened the sera of 4120 patients at Memorial Sloan Kettering Cancer Center and showed that in 1517 sera from pa-
262
tients with lymphoproliferative disorders, 6 were IgA deficient, (frequency 1:253) and in 249 sera from patients with gastrointestinal neoplasm, 2 were IgA deficient (frequency 1:125). The incidence of IgA deficiency at their institution was 1:273, higher than that found in normal blood donors (1:1677, in an average of five studies). Zenone et al. [11] described two cases of Hodgkin's disease associated with IgG and IgA deficiency. One patient with IgG2-IgG4 deficiency and partial IgA deficiency without hypo-y-globulinemia, was diagnosed with stage IIIB Hodgkin's disease (nodular sclerosing type, Reye's type 2). The patient went into remission after chemotherapy. The second patient had complete IgA deficiency associated with IgG2 deficiency and developed Hodgkin's disease (nodular sclerosing type, Reye's type 2) that responded to chemotherapy as well. Carcinoma of the stomach has also been associated with IgA deficiency [12,13].
4. GERMLINE ABNORMALITIES Monoclonal gammopathy is an uncommon finding, accounting for 1.2% of randomly selected hospitaHzed patients, 3% in patients older than 70 years and 10% of patients over 80 years. Significance is determined by the magnitude of serum monoclonal protein and associated findings of M-protein in the urine, lytic lesions, anemia, hypercalcemia, renal failure and disease progression. Bemett reported a retrospective study of 534 cases in which the referring diagnosis was plasmacytoma. Twenty-two patients lacked associated findings of a neoplasm and over a 10-year period 36% converted to a maUgnancy [14]. Kyle [15] reported a larger series of 13,022 patients with monoclonal gammopathies. Approximately 62% of the patients with dysproteinemia had monoclonal gammopathies of undetermined significance and solitary plasmacytoma. The significant disease associations with paraproteinemias were, in decreasing order, multiple myeloma (MM), amyloidosis, lymphoproliferative disease, solitary or extramedullary plasmocytoma, Waldenstrom's macroglobulinemia, lymphoma and chronic lymphocytic leukemia. Approximately 15-20% of the Mproteins were of the IgM type. Long-term (>20 year) follow-up of monoclonal gammopathy of undetermined significance in 241 patients revealed the heavy-chain type to be IgG 73%, IgM 14%, IgA
11% and biclonal 2%. In this group of patients the etiology for 75% of the cases was related to nonneoplastic inflammatory conditions. However, in 26% of patients multiple myeloma, macroglobulinemia, amyloidosis or a malignant lymphoproliferative disorder developed.
5. LYMPHOPROLIFERATIVE DISORDERS Immune function is commonly altered in immune system derived neoplastic and preneoplastic conditions. The alteration is in the form of decreased immune responses or a relative immunodeficiency, primarily of the cellular system. Immunoglobulin levels do not correlate with cell type or disease extent in lymphoproliferative disorders and the alterations are suspected to be secondary to the malignancy itself [16, 17]. Immunoglobulin abnormalities have been described in 80 non-Hodgkin's lymphomas and 105 Hodgkin's lymphomas. IgG and IgE were generally increased in Hodgkin's disease while all Igs were decreased in the nodular sclerosing type. Immunoglobulin levels varied with stages of the disease and were generally decreased in non-Hodgkin's lymphoma, however mild elevations of IgA and IgM were reported in Hodgkin's lymphoma [18]. Normal Ig levels are associated with remission [19].
6. PLASMACYTOMA Focal plasma cell neoplasms, without evidence of multiple myeloma, usually occur in axial skeletal muscle areas and, uncommonly, in the bone (3%). Skeletal lesions are generally preceded by regional pain. Serologic presentation is usually evidence for a monoclonal gammopathy of any immunoglobulin type. Therapy generally results in resolution of the gammopathy.
7. MULTIPLE MYELOMA Plasma cell malignancies or multiple myeloma usually develop later in life than solitary plasmacytoma. However, approximately 50% of patients with plasmacytoma progress to multiple myeloma. Presentation is generally preceded by serological abnormalities and
progression may be slow, prognostic factors vary with immunoglobulin type. In IgG myeloma, the serum calcium and serum creatinine are most significant, whereas in IgA myeloma, hemoglobin, serum calcium and M component are the best predictors for outcome. In Bence Jones proteinuria, micromolecular M component (K or A.), creatinine, calcium, presence of B-J protein, diffuse osteolytic lesions and bone marrow plasma cells greater than 30% were best predictors [20]. Controversy exists as to the precursor cell in multiple myeloma. Pre-B cells, memory B cells and pre-switched somatically mutated B cells have been proposed [21]. In another described germline neoplasm, lymphocytoplasmacytic cells occurred at different stages of terminal differentiation within a single neoplastic clone that was manifest by the evolution of one monoclonal protein (IgM-/c) to three monoclonal proteins (IgG-/c, IgA-/c and IgM-/c) [22]. A disproportionate number of patients with an IgA gammopathy type of multiple myeloma progress to an aggressive or anaplastic disease phase. The cell type resembles a high-grade anaplastic lymphoma and the natural history is short, characterized by rapidly enlarging soft tissue masses or bonemarrow replacement that is refractory to therapy. Studies support a clonal evolution of the original malignant cell line that is analogous to the terminal transformation associated with other lymphoproliferative disorders [23]. Simultaneous development of MM and nonlymphoblastic leukemia or myelodysplastic syndromes is unusual and likely represents the transformation of a single progenitor cell. The development of a myelopathy during treatment of MM is quite common [24].
8. PRIMARY GASTROINTESTINAL LYMPHOPROLIFERATIVE DISORDERS Primary gastric lymphoma is a distinct entity which is either extranodal or derived from mucosa-associated lymphoid tissue (MALT) [25]. In the pathogenesis of this disorder, the immune response to Helicobactor pylori is most important. Several lines of data support MALT lymphoma as an acquired process that results from a chronic immune response to H, pylori. Inflammatory cell responses can vary widely from low-grade, polyclonal infiltrates of inflammatory cells to highgrade dysplasia. The grades correlate with response to H. pylori therapy [26, 27], with low-grade MALT
263
lymphomas responding to H. Pylori therapy [28]. The events are thought to be evolutionary although de novo tumor formation may occur [29].
9. IGA GASTROINTESTINAL CANCER Recently, the association of gastric carcinoma and H. pylori has been proposed by several epidemiological studies [30, 31]. These studies correlate the immunoglobulin responses to H. pylori with the incidence of gastric carcinoma. The predominant antibody response was IgG, however, the occurrence of IgA positive and IgG negative serology accounts for about 2% of patient responses [32]. In a large study from Finland, increased IgA and low pepsinogen levels were significantly associated with increased risk of gastric cancer [33]. Ohshio et al. [34] found that high levels of secretory IgA in gastric cancer patients might be indicative of hepatic metastases. The levels of plasma sIgA were found to be slightly higher than in healthy controls. Secretory IgA levels in cases with hepatic metastases were significantly higher than in those without hepatic metastases. The sIgA levels in well-differentiated tubular adenocarcinoma were significantly higher than in those with poorly differentiated adenocarcinoma. Petrelli et al. [35] investigated serum IgA as a complementary tumor marker to carcinoembryonic antigen (CEA) in the postoperative monitoring of patients with advanced colorectal carcinoma presenting with normal CEA. IgAl levels predicted recurrence at an average lead-time of 8 months prior to clinical or radiological detection with the lead-time being longer for local recurrence. In contrast, CEA had an average lag time of 12 months and this lag time was prolonged in patients with local recurrence. This suggests that there is potential clinical value in postoperative IgAl monitoring in colorectal cancer patients with a greater chance of local recurrence, but clearly further studies are needed.
10. SMALL BOWEL Diffuse plasma cell infiltration of the small intestine is geographically unique, and correlates with socioeconomic status. Diagnostic possibilities include re-
264
active plasma cell infiltration or neoplastic processes. Multiple theories have been proposed for this occurrence and revolve around continual antigen challenge with chronic parasitic infestations or exposure to luminal pathogens, then subsequent neoplastic terminal differentaion. Diffuse plasmacytic infiltration or small intestine lymphoproliferative disorders are associated with characteristics similar to those in diffuse intestinal lymphoma or Mediterranean lymphoma. Specifically, these characteristics are geography, age, sex, type of infiltrate, proximal small intestinal involvement and Qf-chain production [36]. An interesting correlate is the association of cholera pandemics and Vibrio cholera toxin stimulation of IgA plasma cells [37]. Helicobacter pylori has been shown to have a significant association with small intestinal lymphoma [38]. Primary small intestinal lymphoma or extranodal lymphoma represents a group of heterogeneous disorders with varied histological findings of histiocytic, lymphocytic infiltration or undifferentiated lymphoma. A true histiocytic lymphoma may occur late in Celiac disease. The variants of this disorder, small intestinal lymphoproliferative disorders, have groups which are characterized by serological abnormalities of the alpha heavy chain of IgA [39]. Alsabti et al. [40] studied normal family members of 8 patients with a-chain disease. Both patients and family members demonstrated increased circulating B lymphocytes, decreased T lymphocytes and defective cellular immune responses. These findings, and serologic abnormalities of a-chain in multiple members of four families, suggest a hereditary form of B-cell disease of IgA class. Characterization of these disorders is facilitated by demonstrating monoclonal plasma cell populations by immunoperoxidase staining for K and A. chains [41]. However, in an immunoperoxidase study of immunoproliferative disease of the small bowel, failure of light chain is not a constant finding. Some cases may secrete a complete IgA molecule and others may be nonsecreting [42]. In another case report of massive plasma cell infiltration of the small bowel a relative failure of secretory component is proposed for the findings of high levels of polymeric IgA [43]. The outcome of primary small intestinal lymphoma is poor, a 59% 5-year survival with multi-modal approaches [44]. Poor outcome has been also been associated with cell turnover rate [45].
11. IGA AND HEAD AND NECK CANCER Head and neck cancers are primarily squamous cell carcinomas that arise from the mucosal epithelial cells of the head and neck. They include tumors of the paranasal sinuses, nasopharynx, oropharynx, hypopharynx, larynx and the oral cavity. A variety of immunological abnormalities occur in tumors and may be important prognostically. Both cell-mediated and humoral immunity is altered in cancers, although attention has been more focused on the humoral immune system in mucosal tumors of the head and neck. The annual number of new cases diagnosed in the US is approximately 40,000, accounting for about 5% of the malignancies in the adult population [46]. There are geographic variations in the location of head and neck cancers. In the Far East and Mediterranean countries, nasopharyngeal carcinomas are more common, whereas oral, oropharyngeal and laryngeal carcinomas comprise most of the head and neck cancers in Europe and North Americas. Alcohol and tobacco are the most common and significant carcinogens associated with head and neck cancer and the combination of the two carcinogens poses the most potent risk. Other implicated etiological factors include nickel refining, textile fibers, wood working and possibly dietary factors such as lack of fiber and increased consumption of salted fish. A viral etiology has been extensively studied and seems to be important in nasopharyngeal, laryngeal and perhaps tonsillar carcinomas. High levels of the Epstein-Barr Virus antibodies are seen in nasopharyngeal carcinomas in the Mediterranean countries and Far East, and EB V DNA is present in tissue samples of both premalignant lesions and malignant nasopharyngeal carcinomas. Human papilloma virus (HPV) DNA has also been detected in tissue samples of laryngeal and tonsillar cancers. High IgA levels have been reported in many malignancies and have been studied as potential diagnostic and prognostic markers. The earliest reports of abnormalities in the concentration of IgA associated with head and neck cancer were in 1975 [47]. In the ensuing 6 years, multiple studies reported increases in IgA with head and neck cancer (Table 1). Brown et al. [47] initially reported increased IgA levels in the saliva and serum of patients with oral and laryngeal cancer and the association of the IgA level with the progression of the disease. They also noted that the serum IgA levels persisted after 'cure' but that salivary levels returned
to normal. The salivary IgA levels spiked again on recurrence of the cancer. Henle et al. [48, 49] found that 93% of sera from patients with nasopharyngeal carcinoma were positive for IgA antibodies to EBV viral capsid antigen (VGA) and 73% to D component of the Early Antigen (EA) complex. Veltri et al. [50] also studied the cellular and humoral immune status of patients with head and neck cancer and found that total complement, a-l acid glycoprotein (AGP), circulating immune complexes (GIG) and IgA levels were significantly elevated, pre-treatment, in these patients. The AGP and GIG declined to nearly normal levels after treatment, but the IgA levels remained elevated. They also studied cell-mediated immunity (GMI) in these patients using both polyclonal activators and specific antigens and found significant depression of GMI both pre- and post-treatment. Similarly, Hollyfield et al. [51] studied salivary IgA levels in alcoholics and head and neck cancer patients and found significantly higher levels of IgA in the cancer patients. Vinzenz et al. [52] measured the serum IgG, IgM, IgA and IgE levels in 226 patients with head and neck cancer before therapy. The IgA and IgE levels were significantly elevated in these patients compared to controls, whereas the IgG and IgM levels were not significantly different. On follow-up of more than 6 months the patients with recurrence of the disease had significantly higher IgA and IgE levels than those without recurrence. Susal et al. [53] studied the association of serum IgA-anti-Fab antibody levels with disease stage in 101 patients with squamous cell cancer of the head and neck and 8 patients with adenoid cystic carcinoma. They found significandy higher levels of these autoantibodies in the cancer patients compared to controls. Circulating immune complexes have also been studied in relation to cancer and seem to correlate with tumor burden and overall poor prognosis [54-56]. Das et al. [56] estimated circulating immune complexes (GIG) in 31 patients with head and neck cancer and 25 controls. All patients with cancer had high levels of GIG, which correlated with stage and survival. None of the controls were positive. Baseler et al. [57] studied the immune complexed IgA in a heterogenous group of patients with head and neck cancer, nasopharyngeal, colon and lung cancer. They compared the levels to a group of healthy blood donors and a group of benign surgery patients.
265
Table 1, IgA head and neck cancer Author
Serum IgA
Brown, Vizenz, Katz, Williams, Digeon, Lehonz,
Veltri Schrantz Baesler Balint Tomasi Wara
Brown, HoUfield, Brantzaez
Brasher Brandy
Sahvary IgA
EBV Abn.'s
CIC complex
IgA anti-Fab
t t t t t t t t t
Lorenz Baslerr Veltri Mathew Henley Pearson Foong
They found significantly higher levels of IgA immune complexes in all cancer patients compared to controls. These studies suggest to the authors an important role for IgA antibody levels in the diagnosis and prognosis of head and neck cancer. Some investigators believe the abnormal levels may suggest a role in the etiology of malignancies. Others believe that the abnormal IgA levels may actually reflect the underlying immunological dysfunction associated with malignancies in general, and with head and neck cancers in particular. IgA autoantibodies are generally believed to represent a state of severe immune dysfunction. Susal et al. [58] studied the IgA antibodies in kidney transplant patients and patients with AIDS. They noted that the antibody levels predicted better outcomes in kidney transplant recipients but were associated with disease progression in AIDS patients. These studies suggest that IgA antibodies may be associated with a state of immunological depression. Lorenz et al. [59] examined the sera of 110 patients with squamous cell carcinoma of the head and neck, 8 patients with adenoid cystic carcinoma and 57 healthy controls, for IgA-anti-Fab autoantibodies. The autoantibodies were significantly higher in the cancer patients compared to controls and correlated with stage of disease. The
266
group of patients with highest IgA-anti-Fab autoantibody levels died within 6 months of testing. Other investigators have also observed alterations in cellular immunity in head and neck cancer patients. Schantz et al. [60, 61] examined the serum IgA levels in patients with head and neck cancer and in controls. The IgA levels were elevated in patients with cancer compared to the controls and were higher in patients with more advanced cancers. Various immunological parameters were also studied in patients with cancer. They characterize the tumor-antigen associated with head and neck cancer as 'self and postulate that the recognition and response of the immune system to this antigen should be termed "autoimmune" rather than anticancer response. They believe that such an immune state, in the proper setting, will promote rather than inhibit tumor cell growth, a concept supported by Prehn et al. [62]. Autoimmunity is known to be a tumor-promoting state and these observations suggest an important role for autoimmunity in these cancers. This view is intriguing but controversial, as most investigators believe that the immunological state of cancer patient is that of immune depression, not enhancement. All of the above-mentioned studies suggest that high IgA levels and IgA containing immune com-
plexes have an important role in the pathophysiology of head and neck cancer. Whether the IgA autoantibodies are involved in the causation of head and neck cancer, or are a consequence of altered immunity in these patients, is not clearly known. It is conceivable that anti-Fab autoantibodies alter the immune system by attacking regulatory cell clones as suggested by Susal et al. [63]. Autoantibodies may also contribute to the formation of CIC's [57, 64, 65]. Immune complexes are known to inhibit natural killer cell activity and block lymphokine-activated killer cell generation [66, 67]. This inhibition of effector cells and disruption of blocking antibodies and the resultant immune dysfunction can lead to a defective host defense against cancer. Another interesting concept is the homology between human anti-Fab molecules and viral antigens, such as EBV in nasopharyngeal carcinoma [68]. This homology may allow immunological reactivity that induces mutations and promotes tumor growth. In summary, there is ample evidence that IgA levels, IgA autoantibodies, IgA directed to EBV and IgA containing immune complexes are elevated in patients with head and neck cancer. However, the importance of their role in the pathophysiology of these tumors is yet to be established. These factors may be essential for the growth and maintenance of the cancers. However, more likely, the IgA levels and EBV directed responses are a result of EBV infection. The increased levels may be a reflection of altered immunity in these cancers, possibly due to EBV IL-10 production, or may be induced by IgA, IgA-autoantibodies and CIC's. It has been proposed that IgA and IgA autoantibodies may be helpful in the diagnosis and prognosis of head and neck cancer.
12. IGA AND OTHER NEOPLASMS Humoral responses in patients with colorectal, esophageal, gastric, lung, fallopian tube, endometrial, endocervical, breast, ovarian, prostatic carcinomas, and mixed colorectal polyps have been intensively evaluated (Table 2). Tsavaris et al. [69] studied 100 patients with colorectal carcinoma. Three samples were evaluated before therapy and every 2 months post-therapy. Patients with increased levels of IgG and IgM had a longer interval for cancer progression. Multiple factors asso-
ciated with 57 esophageal and 71 gastric cancers were evaluated by linear regression analysis. In esophageal cancer, age and malnutrition were related to decreased IgG, while IgA was related to tumor stage. In gastric cancer, stage and elevation of complement levels were related [70]. In 96 patients with lung cancer, concentrations of IgG, IgA, IgM, C3 and C4 were evaluated and compared with cell type and controls. Forty-nine patients had squamous cell carcinoma, 11 adenocarcinoma and 20 small cell carcinoma. Sixteen were not defined. IgA and complement were significantly elevated in almost all cancer patients when compared to controls [71]. Rossel et al. [72] evaluated a large group of patients with lung cancer and a corresponding control population, for secretory component and secretory Ig. Since polymeric immunoglobulin receptor is synthesized by bronchial epithelial cells and released into the lumen as secretory component or secretory Ig (sIgA, sIgM), expression may be up-regulated in patients with lung cancers. Serum secretory component and sIgA levels were significantly elevated in patients with cancer and other nonneoplastic diseases when compared to controls. Adenocarcinoma of the lung was associated with the highest levels. T lymphocytes with membrane receptors for IgA (Ta cells) were evaluated in patients with cancers of the lung and colon. When compared with age-matched controls, significant increases in IgA receptors were demonstrated. Receptors for IgG and IgM were comparable to controls. A regulatory role of this cell type has been demonstrated for IgG and IgM. These findings suggest a regulatory role for Tof cells [73]. T-cell IgA receptors and serum IgAl levels were evaluated in postoperative colon cancer patients over a 14-month period and compared to CEA levels as a prognosticator for tumor reoccurrence. IgA level increases were associated with tumor recurrence and preceded CEA elevation [35]. Menge et al. evaluated surface expression of secretory component in normal and neoplastic endometrial cell lines in response to hormones, interferony, IL-4 and TNF-of. Increased secretory component expression was induced by estradiol and estrogen when combined with interferon-y, IL-4, and TNFa. Approximately 50% of neoplastic cells expressed secretory component which was not influenced by interferon-y. Both cell lines bound polymeric IgA and IgM, while monomeric Igs did not bind [74].
267
Table 2. IgA abnormalities and advance neoplasm types Author
Date
Goton Lauchi
1981 1981
Petrelli Chagnaud Wesselius DePauli Ohshio Mustonen Pucci Mak Nakao Schmidt Aim Godfrey McEvoy
1993 1992 1989 1998 1987 1981 1981 1998 1977 1976 1983 1990 1990
No. of patients
13/24 5/15 19
55
8/23 63 165/58C
Type of neoplasm
Findings
Adenocarcinoma Cancer of the ovary Cancer of the cervix Cancer of the colon Mammary tumors Lung cancer Gastric CA Gastric CA Bronchial small cell CA Bronchogenic & colonic carcinoma Gastrointestinal B-cell lymphoma 1 ° Brain tumor Prostate, bladder, kidney, testis 1 ° Breast lymphoma Lymphoproliferative malignancy CLL plasmacytoma
Secretory component production tIgA tIgA t IgA w / 1 t metastasis tIgA t SIgA, 1 hypoalbuminemia No association w/IgA, IgM, IgG t IgA, f t w/ metastases IgA para-neoplastic disease t IgA (T a cells) IgA nephropathy No t immunoglobuUn t IgE w/ advanced bladder CA tIgA Linear IgA disease Linear IgA dermatosis
IgA and secretory component are frequently found in secretions of adenocarcinomas of the endocervix, endometrium, and fallopian tube. Expression was decreased in more poorly differentiated neoplasms [75]. In breast neoplasms, circulating sIgM was more sensitive than sIgA as a marker for carcinoma. Concentrations were independent of secretory component expression and increased with liver metastases [76]. IgA isotype binding to conjugated anti-idiotype antibody is present in all patients with mammary tumors, suggesting a regulatory role for the elevated IgA levels seen in these tumors [77]. Heino et al. [78] evaluated 64 patients with anal canal carcinoma and 79 control patients for the presence of an antibody response to human papilloma virus. IgG responses were comparable to controls, however IgA reactivity to the E2 region of HPV was present in 89% of the carcinoma group and 24% of controls. All patients with progressive disease were positive, whereas, 36 of 42 patients in remission demonstrated IgA antibody responses to E2 HPV peptide. When studied by in situ hybridization using a probe mix of 7 HPV viruses, 35% were identified as carriers of HPV. These data parallel the serological findings in patients with carcinoma of the cervix.
268
Gupta et al. [79] evaluated serum immunoglobulins, circulating immune-complexes and blocking effects of sera on T-lymphocyte responses in 15 patients with benign ovarian tumors, 32 ovarian carcinomas and 20 age-matched controls. Benign tumors and controls demonstrated no differences in circulating immune-complexes or blocking effects on T lymphocytes. However, significant increases in IgG and IgM were noted without alterations in IgA. Increased levels of IgA in ovarian carcinoma patients were noted along with increases in immune-complexes and T-cell inhibition when compared to controls. In a study of serum immunoglobulins in 44 patients with various prostatic diseases, IgA was increased in prostatic carcinoma. The highest levels were noted in advanced disease [80]. Immunohistological studies of mixed colorectal polyps demonstrated decreased or absent IgA in the border between normal and neoplastic cells [81]. In a study of 63 patients with primary brain tumors (18 meningioma and 45 glioma) serum immunoglobulin types and concentrations did not differ significantly from controls [82]. Another study of 37 patients with brain tumors revealed decreased IgG levels, decreased IgA levels in children and no changes in IgM when compared with controls [83].
13. IGA AND CERVICAL CANCER Cervical carcinoma has been one of the most common causes of cancer related death in women for many years. Although the mortality rates have fallen by 50% in the last three decades in developed countries, it continues to be a major gynecologic cancer in the underdeveloped countries. There were 15,700 new cases of invasive cervical cancer and 4900 deaths in 1996 [46]. Lower socioeconomic status, early age of sexual activity, multiple sexual partners and smoking are considered to be predisposing risk factors. Human papilloma virus has attracted interest as an etiological agent in precancerous lesions and invasive cancer of the cervix. More than 66 types of HPV have been isolated and many of them are associated with genital warts. Protein products of HPV-16 (E7 protein) and HPV-18 (E6 protein) have oncogenic potential and have been associated with cervical cancer [84, 85]. Mann et al. [86] examined the sera of 186 cases of invasive cervical cancer and 172 matched controls. They found a strong association of IgA and IgG antibodies to E7 peptide of HPV with invasive cervical cancer. Lehtinen et al. [87] found high serum IgA antibody levels to HPV 16 (E2 protein) in 122 women with cervical carcinoma, compared to age-matched controls. Casamassima et al. [88] determined total IgA level in cervical smears of women with cervical dysplasia and other benign lesions and controls. They found the highest IgA levels in patients with dysplasia. The Epstein-Barr virus has also been implicated in the etiology of cervical carcinomas. Se Thoe et al. [89] found high IgA antibody levels in 83% of patients with cervical carcinoma and 75% patients with cervical intraepithelial neoplasia (CIN) and none of the controls. Sasagawa et al. [90, 91] studied IgA and IgG antibodies against HPV-16 like particles in 104 women with various cervical diseases and age-matched controls. IgA and IgG responses were higher in women with cervical cancer. Dillner et al. [92] conducted a seroepidemiological study in two counties of northern Sweden that were low risk for cervical cancer. They found a strong association of the antibodies with cervical cancer. Dillner et al. [93] also evaluated 94 cases of cervical cancer and 188 controls for IgA and IgG antibodies against HP-16 viral antigens and found a strong association between the antibody response and cervical cancer.
Reeves et al. [94] also found antibodies to HPV 16 proteins (peptide 245 and E7) in patients with CIN and invasive cervical cancer more frequently than in women with lesions not associated with papilloma virus. Juranic et al. [95] evaluated patients with cervical carcinoma before and after radiotherapy. IgA and IgG levels were elevated in patients with cervical cancer before therapy and declined to near normal levels postirradiation. IgM levels were in the range of the normal controls and remained so in the post treatment period. The levels of circulating immune complexes (CIC) did not change significantly after treatment. They concluded that IgA and IgG levels and CIC's may be of diagnostic value in cervical carcinoma and may be useful for monitoring response to therapy. These studies suggest that HPV and possibly EB V have a causative role in cervical carcinoma and that IgA levels and IgA antibody levels may be useful in the diagnosis and monitoring of this disease. IgA levels are increased in dysplasia and early neoplastic lesions of cervical cancer. The IgA responses appear to be antigen driven, specifically targeted to HPV, EBV and herpes viruses (Table 3).
14. PARANEOPLASTIC SYNDROMES Tumor cells may produce substances or antibodies that have characteristic syndromes, most commonly via active ectopic hormones. Additionally, tumors may produce growth hormones or cytokines that have remote effects [96]. Antibodies may be formed in response to the neoplasm and its associated antigens that cross-react remotely with other cell processes. In germline IgA neoplasia, the excess production and elevated levels of immunoglobulin products may result in a hyperviscosity syndrome with subsequent vascular events [97, 98]. The most commonly reported occurrence in paraproteinemia is neuropathy, and in patients with peripheral neuropathy of unknown etiology, there is a 10% association with a monoclonal gammopathy. IgM monoclonal gammopathy is frequently associated with autoantibodies to myelin-associated glycoprotein and with demyelinating peripheral neuropathy. IgG or IgA monoclonal gammopathy is also associated with neuropathy [99-101]. Dhib-Jalbut and Liwnicz [102] reported a sensorimotor peripheral neuropathy in a
269
Table 3. IgA and cervical cancer Author
Year
No. of patients
Findings
Associations
Mann Lehtinen Casamassima Se Thoe
1990 1992 1992 1995
186p/172c 122
Smoking, and t IgA iw/therapy, HPV 16 E2
28/p
Sasagawa
1995
104p/130c
Dinner
1995 1989 1997 1994
94p/188c
t IgA G, HPV E2 t IgA HPV E2 t IgA w/cervical dysplasia t IgA 83% cervical t IgA 75% lEN t IgA cervical CA HPV- 16VPL t IgA cervical 16 cervical secretions t IgA/M to E7 HPV 16 t IgA E2 protein CIN t IgA before
Johmos-Kudielka Rocha- Zavaleta Jeranic
70p/72c
patient with multiple myeloma in whom immunohistologic studies demonstrated high titer IgA binding with human endoneurium. IgA immunoblot reactivity was demonstrated with 58,43 and 8 kDa endoneurium components. Hays et al. reported the occurrence of breast cancer, IgA paraprotein and amyotrophic lateral sclerosis. All findings were verified at autopsy. Immunofluorescent studies demonstrated significant binding to axons and perikarya of nerve cells in the CNS and peripheral nervous system. The IgA antibody specifically reacted to a 200 kDa neurofilament protein [103]. Cross-reactivity was demonstrated to surface components of neuroblastoma cells. Similar IgA reactivity has been demonstrated in neurodegenerative disorders not related to malignancy [104]. A similar peripheral sensorimotor polyneuropathy has been reported in chronic myelomonocytic leukemia [105]. IgA is also associated with leukocytoclastic vasculitis, Henoch-Schonlein purpura/polyarteritis nodosa overlap syndrome, dermatitis herpetiformis and antilipid antibody [106-109]. POEMS syndrome or polyneuropathy, osteolytic lesions, scleroderma like lesions, diffuse adenopathy, and hepatosplenomegaly, has been associated with an IgA-A plasmacytoma [110]. Approximately five cases of a scleroderma like illness have been reported as paraneoplastic syndromes, one IgA mediated and a second IgA with scleroderma and acanthosis nigracans [111]. The Crow-Fukase syndrome or progressive sensory neuropathy, generalized pigmentation of the skin, pretibial edema and gynecomastia, has been reported with an IgA-A extra medullary plasmacytoma [112].
270
Serum & cervical IgA to EBV Persistent HPV (-) EBV HPV 16 infection i w/ C A of the cervix 1 w/ therapy
Primary IgA nephropathy has been linked to cutaneous T-cell lymphoma [113, 114]. Mak et al. [115] reported a case with simultaneous onset of crescentic IgA nephropathy and gastrointestinal, low-grade B-cell lymphoma of the mucosa associated lymphoid tissue type (MALT), with kidney involvement. After treatment with chlorambucil the proteinuria and impaired creatinine clearance resolved. This also coincided with complete resolution of gastric and renal lymphoma infiltration. The close association of the onset and successful outcome of the two entities suggests a pathophysiological relationship between the MALT lymphoma and human IgA nephropathy. Sessa et al. [116] reported the association of IgA mesangial nephropathy and renal cell carcinoma. Tanaka et al. [117] reported IgA glomerulonephritis with renal cell carcinoma. Ito et al. [118] described mesangial lesions secondary to IgA and severe nephrotic syndrome associated with B-cell lymphoma. Glomerulonephritis secondary to IgA has been associated with a baseloid squamous cell carcinoma [119]. In malignant melanoma, vitiligo and melanoma with hypopigmentation, humoral responses to tyrosinase are demonstrable. This enzyme participates in pigment formation in melanocytes. The autoreactivity is believed to be responsible for the melanoma with hypopigmentation syndrome. The antibody is primarily IgG and the highest titer is found in patients with vitiligo. In 4 out of 41 patients with malignant melanoma, the immunoglobulin type was IgA, with one type IgM. The subsequent clinical course for these patients was not reported. In melanoma and melanoma with hypopigmentation, specific antityrosinase reac-
tivity is an autoimmune, paraneoplastic reaction [120, 121]. Mucocutaneous disorders (cicatroid pimpagoid, linear IgA disease), paraneoplastic syndromes and long term topical medication use represent a spectrum of potentially blinding diseases [122]. Of these diseases IgA multiple myeloma may be complicated by subcorneal pustular dermatosis [123]. Seven cases have been reported, of which five were associated with IgA paraproteinemia and IgA intra-epidermal deposits [124]. Unusual bullous cutaneous IgA mediated lesions have been associated with lung cancer. Antibody activity to desmocollins I and II were demonstrated [125]. This autoantibody and those of linear IgA disease are directed to the proteins that comprise the hemidesmosome basment membrane complex [126]. Linear IgA dermatosis is a bullous disease characterized by linear deposition of IgA at the basement membrane. McEvoy and Connolly [127] described two cases of linear IgA dermatosis with malignancy. One patient had plasmacytoma, which presented 2 months before Unear IgA dermatosis. The other patient had chronic lymphatic leukemia diagnosed 1 year before the diagnosis of linear IgA dermatosis. There have been other cases of linear IgA malignancy including carcinoma of bladder, malignant melanoma [108], esophageal carcinoma [128], and Hodgkin's disease [119, 129]. The relationship of linear IgA dermatosis and malignancy are based on these observations. However, the temporal relationship between the occurrence of neoplasm and the onset of skin lesions has been variable. In the cases reported by Vignon et al. [130] and Bamadas et al. [129], the diagnosis of lymphoma and IgA dermatosis was made at the same time [130, 129]. In the cases described by Leonard et al. [108], the mean time between onset of dermatosis and symptoms of neoplasia was 60 months. In the cases reported by McEvoy and Connolly [127], the diagnosis of neoplasm was made after 2 months in one case and 12 months in another. In the case described by Sekula et al. [131], the patient had a blistering skin lesion 6 weeks after the diagnosis of transitional cell carcinoma of the bladder. The interval between carcinoma occurring after dermatosis in Kienzler et al.'s [132] case report was 5 years, and in Green et al.'s [128] case report was 7 years. The response of IgA dermatosis to chemotherapy of the associated malignancy is not well known. In Barnadas et al.'s [129] case, the bullous eruption responded to treatment of
lymphoma and a flare of linear IgA dermatosis helped in the diagnosis of recurrent lymphoma. In Sekula et al.'s [131] patient with transitional cell carcinoma of the bladder and linear IgA dermatosis, both diseases responded to chemotherapy. In the case of Hodgkin's disease and IgA reported by Vignon et al. [130], the patient required treatment with dapsone after successful treatment of Hodgkin's disease. Of the two cases reported by McEvoy and Connolly [127], one had plasmacytoma which responded to radiation, while the dermatosis responded to prednisone and dapsone. In the second patient, with chronic lymphatic leukemia, the patient's skin disease recurred despite treatment. Given the large variety of tumors, disparity in clinical course, and temporal association, there appears to be a correlation with IgA linear dermatosis and neoplasia. It appears that IgA and anti-IgA antibodies can be helpful in the diagnosis and prognosis of some neoplasms.
ACKNOWLEDGEMENTS The authors would like to thank M. Housini, and R. Sheikh for their contributions to this paper.
REFERENCES 1. 2.
3.
4.
5.
6.
Truedsson L, Raskin B, Pan Q, et al. Genetics of IgA deficiency Apmis 1995;103:833-842. Smith CI, Baskin B, Pattersson E, Hammarstrom L, Islam KB. In vivo switching: identification of germline transcripts for human IgA. Adv Exp Med Biol 1995:9-13. Nikolova EB, Tomana M, Russell MW. All forms of human IgA antibodies bound to antigen interfere with complement (C3)fixationinduced by IgG or by antigen alone. Scand J Immunol 1994;39:275-280. Lycke N. T cell and cytokine regulation of the IgA response [in process citation]. Chem Immunol 1998;71:209-234. Kjerrulf M, Grdic D, Kopf M, Lycke N. Induction of gut mucosal immune responses: importance of genetic background and Thl/Th2 cross-regulation. Scand J Immunol 1998;47:401^07. Yan D, H. R. Zhou, et al. Role of macrophages in elevated IgA and IL-6 production by Peyer's patch cultures following acute oral vomitoxin exposure. Toxicol Appl Pharmacol 1998;148:261-73.
271
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
272
Fayette J, Dubois B, Vandenabeele S, et al. Human dendritic cells skew isotype switching of CD40activated naive B cells towards IgAl and IgA2. J Exp Med 1997;185:1909-1918. Burdin N, Rousset F, Banchereau J. B-cellderived IL-10: production and function. Methods 1997;11:98-111. Yamamoto M, Vancott JL, Okahashi N, et al. The role of Thl and Th2 cells for mucosal IgA responses. Ann N Y Acad Sci 1996;778:64-71. Cunningham-Rundles C, Pudifin DJ, Armstrong D, Good RA. Selective IgA deficiency and neoplasia. Vox Sang 1980;38:61-67. Zenone T, Souquet PJ, Cunningham-Rundles C, Bernard JP. Hodgkin's disease associated with IgA and IgG subclass deficiency. J Int Med 1996;240:99102. Fraser KJ, Rankin JG. Selective deficiency of IgA immunoglobulins associated with carcinoma of the stomach. Australas Ann Med 1970;19:165-167. Branco I, da Costa FB, Rodrigues A, Pires FR, Portugal MA, Goncalves MD. [Gastric neoplasm associated with IgA deficiency. Importance of multidisciplinary care]. Acta Med Port 1993;6:587-592. Bernett A, AUerhand J, Efremides AP, Clejan S. Long-term study of gammopathies. Clinically benign cases showing transition to malignant plasmacytomas after long periods of observation. Clin Biochem 1986; 19:244249. Kyle RA. Monoclonal gammopathy of undetermined significance and solitary plasmacytoma. Implications for progression to overt multiple myeloma. Hematol Oncol Chn North Am 1997;11:71-87. Advani SH, Dinshaw KA, Nair CN, et al. Immune dysfunction in non-Hodgkin's lymphoma. Cancer 1980;45:2843-2848. Dammacco F, Miglietta A, Ventura MT, Bonomo L. Defective monocyte chemotactic responsiveness in patients with multiple myeloma and benign monoclonal gammapathy. Clin Exp Immunol 1982;47:481-486. Amlot PL, Green L. Serum immunoglobulins G, A, M, D and E concentrations in lymphomas. Br J Cancer 1979;40:371-379. Alsabti EA, Shaheen A. The prognostic value of serum innumoglobulin levels in Hodgkin's disease. Neoplasma 1979;26:329-333. Bettini R, Steidl L, Rapazzini P, Giardina G. Prognostic value of the staging system proposed by Merlini, Waldenstrom and Jayakar for multiple myeloma. Acta Haematol 1983;70:379-385. Bakkus MH, Van Riet I, Van Camp B, Thielemans K. Evidence that the clonogenic cell in multiple
22.
23.
24.
25. 26.
27.
28.
29. 30.
31.
32.
33.
34.
35.
myeloma originates from a pre-switched but somatically mutated B cell. Br J Haematol 1994;87:68-74. Berg AR, Weisenburger DD, Linder J, Armitage JO. Lymphoplasmacytic lymphoma. Report of a case with three monoclonal proteins derived from a single neoplastic clone. Cancer 1986;57:1794-1797. Allen SL, Coleman M. Aggressive phase multiple myeloma: a terminal anaplastic transformation resembling high-grade lymphoma. Cancer Invest 1990;8:417^24. Economopoulos T, Pappa V, Panani A, et al. Myelopathies during the course of multiple myeloma. Haematologica 1991;76:289-292. Isaacson PG. Extranodal lymphomas: the MALT concept. Verb Dtsch Ges Pathol 1992;76:14-23. Fischbach W, Bohm S. Primary stomach lymphoma of the MALT type. Diagnosis and therapy. Gastrointestinal lymphoma study group. Leber Magen Darm 1994;24:104, 107-110. Mielke B, Moller P. Histomorphologic and immunophenotypic spectrum of primary gastro- intestinal B-cell lymphomas. Int J Cancer 1991;47:334343. Montalban C, Manzanal A, Boixeda D, et al. Helicobacter pylori eradication for the treatment of low-grade gastric MALT lymphoma: follow-up together with sequential molecular studies. Ann Oncol 1997;8:37-39. Isaacson PG. Gastrointestinal lymphoma. Human Pathol 1994;25:1020-1029. Parsonnet J, Friedman GD, Vandersteen DP, et al. Helicobacter pylori infection and the risk of gastric carcinoma [see comments]. N Engl J Med 1991;325:1127-1131. Nomura A, Stemmermann GN, Chyou PH, Kato I, Perez-Perez GI, Blaser MJ. Helicobacter pylori infection and gastric carcinoma among Japanese Americans in Hawaii [see comments]. N Engl J Med 1991;325:1132-1136. Jaskowski TD, Martins TB, Hill HR, Litwin CM. Immunoglobulin A antibodies to Helicobacter pylori. J Chn Microbiol 1997;35:2999-3000. Aromaa A, Kosunen TU, Knekt P, et al. Circulating anti-Helicobacter pylori immunoglobulin A antibodies and low serum pepsinogen I level are associated with increased risk of gastric cancer. Am J Epidemiol 1996;144:142-149. Ohshio G, Kudo H, Yoshioka H, et al. Plasma levels of secretory IgA in patients with gastric cancer. J Cancer Res Clin Oncol 1987;113:573-575. Petrelli NJ, Cajucom CC, Rodriguez-Bigas M, Henslee J, Bhargava A. Altered immunoglobulin A (IgA-1) levels in patients with advanced colorectal adenocarcinoma presenting with normal preopera-
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
tive levels of carcinoembryonic antigen (CEA). Surg Oncol 1993;2:19-23. Tabbane S, Tabbane F, Cammoun M, Mourali N. Mediterranean lymphomas with alpha heavy chain monoclonal gammopathy. Cancer 1976;38:19891996. Al-Saleem TI. Evidence of acquired immune deficiencies in Mediterranean lymphoma. A possible aetiological link. Lancet 1978;2:709-712. Parsonnet J, Hansen S, Rodriguez L, et al. Helicobacter pylori infection and gastric lymphoma [see comments]. N Engl J Med 1994;330:1267-1271. Al-Mondhiry H. Primary lymphomas of the small intestine: east-west contrast. Am J Hematol 1986;22:89-105. Alsabti EA, Safo MH, Shaheen A. Lymphocytes subpopulation in normal family members of patients with alpha-chain disease. J Surg Oncol 1979;11:365-374. Boo K, Cheng S. A morphological and immunohistochemical study of plasma cell proliferative lesions. Malays J Pathol 1992;14:45-48. Asselah F, Slavin G, Sowter G, Asselah H. Immunoproliferative small intestinal disease in Algerians. I. Light microscopic and immunochemical studies. Cancer 1983;52:227-237. Colombel JF, Rambaud JC, Vaerman JP, et al. Massive plasma cell infiltration of the digestive tract. Secretory component as the rate-limiting factor of immunoglobulin secretion in external fluids. Gastroenterology 1988;95:1106-1113. Zinzani PL, Magagnoli M, Pagliani G, et al. Primary intestinal lymphoma: clinical and therapeutic features of 32 patients. Haematologica 1997;82:305308. Gisbertz lA, Schouten HC, Bot FJ, Arends JW. Cell turnover parameters in small and large cell varieties of primary intestinal non-Hodgkin's lymphoma. Cancer 1998;83:158-165. Parker SL, Tong T, Bolden S, Wingo PA. Cancer statistics, 1996 [see comments]. CA Cancer J Clin 1996;46:5-27. Brown AM, Lally ET, Frankel A, Harwick R, Davis LW, Rominger CJ. The association of the IGA levels of serum and whole saliva with the progression of oral cancer. Cancer 1975;35:1154-1162. Henle G, Henle W. Serum IgA antibodies of EpsteinBarr virus (EBV)-related antigens. A new feature of nasopharyngeal carcinoma. Bibl Haematol 1975:322-325. Henle G, Henle W. Epstein-Barr virus-specific IgA serum antibodies as an outstanding feature of nasopharyngeal carcinoma. Int J Cancer 1976;17:1-7.
50.
51.
52.
53.
54.
55.
56.
57.
58.
59.
60.
61.
62. 63.
Veltri RW, Rodman SM, Maxim PE, Baseler MW, Sprinkle PM. Immune complexes, serum proteins, cell-mediated immunity, and immune regulation in patients with squamous cell carcinoma of the head and neck. Cancer 1986;57:2295-2308. Hollyfield ND, Smith FG, Falkler WA, Jr., Thut PD. IgA concentrations in parotid saliva of alcoholics and head and neck cancer patients. J Baltimore Coll Dent Surg 1980;33:1^. Vinzenz K, Pavelka R, Schonthal E, Zekert F. Serum immunoglobulin levels in patients with head and neck cancer (IgE, IgA, IgM, IgG). Oncology 1986;43:316-322. Susal C, Maier H, Lorenz K, Opelz G. Association of IgA-anti-Fab autoantibodies with disease stage in head-and-neck cancer. Int J Cancer 1994;57:47-50. Aziz M, Akhtar S, Malik A. Evaluation of cellmediated immunity and circulating immune complexes as prognostic indicators in cancer patients. Cancer Detect Prev 1998;22:87-99. Aziz M, Das TK, Rattan A. Role of circulating immune complexes in prognostic evaluation and management of genitourinary cancer patients. Indian J Cancer 1997;34:111-120. Das TK, Aziz M, Rattan A, Sherwani R. Prognostic significance of circulating immune complexes in malignant tumours of head and neck. J Indian Med Assoc 1995;93:3-7. Baseler MW, Maxim PE, Veltri RW. Circulating IgA immune complexes in head and neck cancer, nasopharyngeal carcinoma, lung cancer, and colon cancer. Cancer 1987;59:1727-1731. Susal C, Daniel V, Doerr C, Zimmermann R, HuthKuhne A, Opelz G. IgA-anti-Fab autoantibodies and disease progression in AIDS. Immunol Lett 1993;36:27-30. Lorenz KJ, Susal C, Opelz G, Maier H. Relationship between progression of disease and immunoglobulin A-anti- Fab-/F(ab02 autoantibodies in patients with head and neck cancer. Otolaryngol Head Neck Surg 1998;118:130-136. Schantz SP, Weber RS, Carey TE. Growth and progression of head and neck cancer: a report of the Upper Aerodigestive Cancer Task Force Workshop. Head Neck Surg 1988;10:179-186. Schantz SP, Liu FJ, Taylor D, Beddingfield N, Weber RS. The relationship of circulating IgA to cellular immunity in head and neck cancer patients. Laryngoscope 1988;98:671-678. Prehn RT, Prehn LM. The autoimmune nature of cancer. Cancer Res 1987;47:927-932. Susal C, Daniel V, Opelz G. Does AIDS emerge from a disequilibrium between two complementary
273
64.
65.
66.
67.
68.
69.
70.
71.
72.
73.
74.
75.
274
groups of molecules that mimic MHC? Immunol Today 1996;17:114-119. Samayoa EA, McDuffie FC, Nelson AM, Go VL, Luthra HS, Brumfield HW. Immunoglobulin complexes in sera of patients with malignancy. Int J Cancer 1977;19:12-17. Schantz SP, Savage HE, Lee NK. Head and neck tumor immunology. II. Humoral immunity. Cancer Treat Res 1990;52:243-263. Bugis SP, Lotzova E, Savage HE, et al. Inhibition of lymphokine-activated killer cell generation by blocking factors in sera of patients with head and neck cancer. Cancer Immunol Immunother 1990;31:176-181. Pedersen BK, Thomsen BS, Nielsen H. Inhibition of natural killer cell activity by antigen-antibody complexes. Allergy 1986;41:568-574. Foong YT, Cheng HM, Sam CK, Dillner J, Hinderer W, Prasad U. Serum and salivary IgA antibodies against a defined epitope of the Epstein-Barr virus nuclear antigen (EBNA) are elevated in nasopharyngeal carcinoma. Int J Cancer 1990;45:10611064. Tsavaris N, Tsigalakis D, Bobota A, et al. Prognostic value of serum levels of immunoglobulins (IgA, IgM, IgG, IgE) in patients with colorectal cancer. Eur J Surg Oncol 1992;18:31-36. Saito T, Kuwahara A, Kinoshita T, et al. Increases in immunoglobulin and complement in patients with esophageal or gastric cancer. Surg Today 1992;22:537-542. Gminski J, Mykala-Ciesla J, Machalski M, Drozdz M, Najda J. Immunoglobulins and complement components levels in patients with lung cancer. Rom J Int Med 1992;30:39^4. Rossel M, Brambilla E, Billaud M, et al. Nonspecific increased serum levels of secretory component in lung tumors: relationship to the gene expression of the transmembrane receptor form. Am J Respir Cell Mol Biol 1993;9:341-346. Pucci A, Clancy RL, Doe WF. Increased circulating T alpha lymphocyte population in bronchogenic and colonic carcinoma. Chn Exp Immunol 1981 ;46:130133. Menge AC, Mestecky J. Surface expression of secretory component and HLA class II DR antigen on glandular epithelial cells from human endometrium and two endometrial adenocarcinoma cell lines. J Clin Immunol 1993;13:259264. Lee YS, Raju GC. Expression of IgA and secretory component in the normal and in adenocarcinomas of Fallopian tube, endometrium and endocervix. Histopathology 1988;13:67-78.
76.
77.
78.
79.
80.
81.
82.
83.
84.
85.
86.
87.
88.
89.
90.
Kvale D, Rognum TO, Thorud E, Fossa SD, Ro JS, Brandtzaeg P. Circulating secretory component in breast neoplasms. J Clin Pathol 1987;40:621-625. Chagnaud JL, Faiderbe S, Geffard M. Identification and immunochemical characterization of IgA in sera of patients with mammary tumors. Int J Cancer 1992;50:395-401. Heino P, Goldman S, Lagerstedt U, Dillner J. Molecular and serological studies of human papillomavirus among patients with anal epidermoid carcinoma. Int J Cancer 1993;53:377-381. Gupta SC, Agarwal J, Singh PA, Mehdiratta NK, Keswani NK. A sequential study of humoral factors in ovarian neoplasms. Indian J Pathol Microbiol 1994;37:319-326. Gahankari DR, Golhar KB. An evaluation of serum and tissue bound immunoglobulins in prostatic diseases. J Postgrad Med 1993;39:63-67. Veress B, Gabrielsson N, Granqvist S, Billing H. Mixed colorectal polyps. An immunohistologic and mucin-histochemical study. Scand J Gastroenterol 1991;26:1049-1056. Nakao S, Terano M, Yamashita J, Handa H. [Serum immunoglobulin (IgG, IgM, IgA) levels in patients with primary brain tumors (author's transl)]. No To Shinkei 1977;29:1005-1009. Dawani K, Tayyab M. Immunoglobulin classes G,A,M in brain tumours. JPMA J Pak Med Assoc 1992;42:157-158. Reeves WC, Brinton LA, Garcia M, et al. Human papillomavirus infection and cervical cancer in Latin America. N Engl J Med 1989;320:1437-1441. Reeves WC, Rawls WE, Brinton LA. Epidemiology of genital papillomaviruses and cervical cancer. Rev Infect Dis 1989;11:426-439. Mann VM, de Lao SL, Brenes M, et al. Occurrence of IgA and IgG antibodies to select peptides representing human papillomavirus type 16 among cervical cancer cases and controls. Cancer Res 1990;50:7815-7819. Lehtinen M, Leminen A, Kuoppala T, et al. Pre- and posttreatment serum antibody responses to HPV 16 E2 and HSV 2ICP8 proteins in women with cervical carcinoma. J Med Virol 1992;37:180-186. Casamassima A, Marinaccio L. Cervical smear total IgA in adenomatous polyp, dysplasia and carcinoma of the cervix. Anticancer Res 1992;12:1315-1318. Se Thoe SY, Wong KK, Pathmanathan R, Sam CK, Cheng HM, Prasad U. Elevated secretory IgA antibodies to Epstein-Barr virus (EBV) and presence of EBV DNA and EBV receptors in patients with cervical carcinoma. Gynecol Oncol 1993;50:168-172. Sasagawa T, Inoue M, Lehtinen M, et al. Serological responses to human papillomavirus type 6
91.
92.
93.
94.
95.
96.
97.
98.
99.
100.
101.
102.
103.
and 16 virus-like particles in patients with cervical neoplastic lesions. Clin Diagn Lab Immunol 1996;3:403-410. Sasagawa T, Yamazaki H, Dong YZ, Satake S, Tateno M, Inoue M. Immunoglobulin-A and -G responses against virus-like particles (VLP) of human papillomavirus type 16 in women with cervical cancer and cervical intra-epithelial lesions. Int J Cancer 1998;75:529-535. Dillner J, Lenner P, Lehtinen M, et al. A populationbased seroepidemiological study of cervical cancer. Cancer Res 1994;54:134-141. Dillner J, Wiklund F, Lenner P, et al. Antibodies against linear and conformational epitopes of human papillomavirus type 16 that independently associate with incident cervical cancer. Int J Cancer 1995;60:377-382. Reeves WC, Rawls JA, Green M, Rawls WE. Antibodies to human papillomavirus type 16 in patients with cervical neoplasia [letter]. Lancet 1990;335:551-552. Juranic Z, Vuckovic-Dekic L, Durbaba M. Immune reactive proteins in patients irradiated for cervical cancer. One year follow up. Neoplasma 1994;41:225-228. Walther MM, Johnson B, Culley D, et al. Serum interleukin-6 levels in metastatic renal cell carcinoma before treatment with interleukin-2 correlates with paraneoplastic syndromes but not patient survival. J Urol 1998;159:718-722. Alkner U, Hansson UB, Lindstrom FD. Factors affecting IgA related hyperviscosity. Clin Exp Immunol 1983;51:617-623. Kosmo MA, Gale RP. Plasma cell leukemia with IgA paraproteinemia and hyperviscosity. Am J Hematol 1988;28:113-115. Latov N. Pathogenesis and therapy of neuropathies associated with monoclonal gammopathies. Ann Neurol 1995;37(suppl 1):S32-S42. Vallat JM, Jauberteau MO, Bordessoule D, Yardin C, Preux PM, Couratier P. Link between peripheral neuropathy and monoclonal dysglobulinemia: a study of 66 cases. J Neurol Sci 1996;137:124130. Becq-Giraudon B, Bontoux D, Lefevre JP, Sudre Y. Plasmocyte dyscrasia with polyneuropathy, polyendocrinopathy and polyadenopathy. Ann Med Int 1983;134:563-568. Dhib-Jalbut S, Liwnicz BH. Binding of serum IgA of multiple myeloma to normal peripheral nerve. Acta Neurol Scand 1986;73:381-387. Hays AP, Roxas A, Sadiq SA, et al. A monoclonal IgA in a patient with amyotrophic lateral sclerosis reacts with neurofilaments and surface antigen
104.
105.
106.
107.
108.
109.
110.
111.
112.
113.
114.
115.
116.
117.
on neuroblastoma cells. J Neuropathol Exp Neurol 1990;49:383-398. Sadiq SA, van den Berg LH, Thomas FP, Kilidireas K, Hays AP, Latov N. Human monoclonal antineurofilament antibody cross-reacts with a neuronal surface protein. J Neurosci Res 1991;29:319-325. Maeda T, Ashie T, Kikuiri K, Ishiyama N, Takakura M, Ise T. Chronic myelomonocytic leukemia with polyneuropathy and IgA-paraprotein. Jpn J Med 1989;28:709-716. McMillen JJ, Krueger SK, Dyer GA. Leukocytoclastic vasculitis in association with immunoglobuHn A myeloma. Ann Int Med 1986;105:709-710. Birchmore D, Sweeney C, Choudhury D, Konwinski MF, Carnevale K, D'Agati V. IgA multiple myeloma presenting as Henoch-Schonlein purpura/polyarteritis nodosa overlap syndrome. Arthrit Rheumatol 1996;39:698-703. Leonard JN, Tucker WF, Fry JS, et al. Increased incidence of malignancy in dermatitis herpetiformis. Br Med J (Clin Res Ed) 1983;286:16-18. Fink PC, Galanos C. Serum anti-lipid A antibodies in multiple myeloma and Waldenstrom's macroglobuUnaemia. Immunobiology 1985;169:1-10. Bisail M, Cossu A, Massarelli G, et al. POEMS syndrome: a case report. Haematologica 1990;75:384386. Valente L, Velho GC, Farinha F, Bernardo A, Ribeiro P, Massa A. Scleredema, acanthosis nigricans and IgA/Kappa multiple myeloma. Ann Dermatol Venereol 1997;124:537-539. Shirabe S, Kishikawa M, Mine M, Miyazaki T, Kuratsune H, Tobinaga K. Crow-Fukase syndrome associated with extramedullary plasmacytoma. Jpn J Med 1991;30:64-66. Moe SM, Baron JM, Coventry S, Dolan C, Umans JG. Glomerular disease and urinary Sezary cells in cutaneous T-cell lymphomas. Am J Kidney Dis 1993;21:545-547. Ramirez G, Stinson JB, Zawada ET, Moatamed F. IgA nephritis associated with mycosis fungoides. Report of two cases. Arch Int Med 1981;141:12871291. Mak SK, Wong PN, Lo KY, Wong AK. Successful treatment of IgA nephropathy in association with low-grade B-cell lymphoma of the mucosaassociated lymphoid tissue type. Am J Kidney Dis 1998;31:713-718. Sessa A, Volpi A, Tetta C, et al. IgA mesangial nephropathy associated with renal cell carcinoma. Appl Pathol 1989;7:188-191. Tanaka K, Kanzaki H, Taguchi T. IgA glomerulonephritis in a patient with renal cell carcinoma. Nippon Jinzo Gakkai Shi 1991;33:87-90.
275
118.
119.
120.
121.
122.
123.
124.
125.
276
Ito M, Cui J, Hotchi M, Nagasaki M. An autopsied case of a malignant lymphoma with a severe nephrotic syndrome overlapped by cirrhotic glomerulosclerosis. Gan No Rinsho 1988;34:938945. Lam KY, Law SY, Chan KW, Yuen MC. Glomerulonephritis associated with basaloid squamous cell carcinoma of the oesophagus. A possible unusual paraneoplastic syndrome. Scand J Urol Nephrol 1998;32:61-63. Merimsky O, Baharav E, Shoenfeld Y, et al. Antityrosinase antibodies in malignant melanoma. Cancer Immunol Immunother 1996;42:297-302. Merimsky O, Shoenfeld Y, Fishman P. The clinical significance of antityrosinase antibodies in melanoma and related hypopigmentary lesions [in process citation]. CHn Rev Allergy Immunol 1998;16:227-236. Bernauer W, Broadway DC, Wright R Chronic progressive conjunctival cicatrisation. Eye 1993;7:371378. Bolcskei L, Husz S, Hunyadi J, Varga G, Dobozy A. Subcorneal pustular dermatosis and IgA multiple myeloma. J Dermatol 1992;19:626-628. Atukorala DN, Joshi RK, Abanmi A, Jeha MT. Subcorneal pustular dermatosis and IgA myeloma. Dermatology 1993;187:124-126. Chorzelski TP, Hashimoto T, Nishikawa T, et al.
126.
127.
128.
129.
130.
131.
132.
Unusual acantholytic bullous dermatosis associated with neoplasia and IgG and IgA antibodies against bovine desmocollins I and II. J Am Acad Dermatol 1994;31:351-355. Dabelsteen E. Molecular biological aspects of acquired bullous diseases. Crit Rev Oral Biol Med 1998;9:162-178. McEvoy MT, Connolly SM. Linear IgA dermatosis: association with malignancy. J Am Acad Dermatol 1990;22:59-63. Green ST, Natarajan S. Linear IgA disease and oesophageal carcinoma. J Roy Soc Med 1987;80:4849. Bamadas MA, Moreno A, Brunet S, et al. Linear IgA bullous dermatosis associated with Hodgkin's disease [letter]. J Am Acad Dermatol 1988;19:11221124. Vignon D, Guillaume JC, Revuz J, Touraine R. [Association of Hodgkin's disease and linear IGA dermatosis (letter)]. Nouv Presse Med 1982;11:603604. Sekula SA, Tschen JA, Bean SF, Wolf JE, Jr. Linear IgA bullous disease in a patient with transitional cell carcinoma of the bladder. Cutis 1986;38:354-356, 362. Kienzler JL, Blanc D, Laurent R, Agache P. Linear IgA bullous dermatosis and Hodgkin's disease. Ann Dermatol Venereol 1983;110:727-728.
(c) 2000 Elsevier Science B.V All rights reserved. Cancer and Autoimmunity Y. Shoenfeld and M. E. Gershwin, editors
Apoptosis: The Relation Between Anti-Fas antibodies, and Immunosurveillance Against Cancer and Autoimmunity Yaron Bar-Dayan, Sooryanarayana, Emmanuelle Bonnin, Nagendra Prasad, Yosefa Bar-Dayan, Michel D. Kazatchkine and Srinivas V. Kaveri INSERM U430, Hopital Broussais, Sheba Medical Center, Tel Hashomer, Israel
SUMMARY The protective role of the immune system against cancer is called immunosurveillance. Apoptosis is an active cell death process essential for a large spectrum of physiological functions including T-cell-mediated cytotoxicity and immunosurveillance. Fas is one of the most important molecules implied in the onset of apoptosis. Interaction of Fas with its natural ligand (FasL) or agonistic antibodies leads to the induction of apoptosis. Recently, several agonistic and neutralizing antibodies to human Fas-FasL system have been identified. We suggest that agonistic anti-Fas antibodies may play a role in immunosurveillance and antagonistic antibodies against Fas-FasL interaction may contribute to immune escape of tumors.
1. INTRODUCTION Apoptosis is an active process that regulates a variety of physiological functions including T-cell-mediated cytotoxicity and immunosurveillance. Among the most important molecules involved in triggering apoptosis is the cell surface receptor Fas (also called APO-1 or CD95), which induces apoptosis upon binding of its natural ligand, CD95L (also called APO-IL, or FasL) or specific agonistic antibodies [1]. CD95-dependent apoptosis is an important mechanism, by which the immune system checks the progression of tumors. CD95 can mediate T-cell cytotoxicity and, thus, CD95L+ T cells might eliminate CD95+ tumor cells by inducing apoptosis. Alterations of the CD95 system
may result in the escape of tumor cells from immunosurveillance. The importance of Fas/APO-1-mediated apoptosis in various immune disorders and lymphproliferative disorders is well documented. Dysregulated apoptosis would lead to persistence of autoreactive cells resulting in the production of autoantibodies and subsequently autoimmune conditions.
2. IMMUNOSURVEILLANCE The concept that the immune system has a protective role against cancer by recognizing the tumor antigens leading to the destruction of tumors is often termed as immunosurveillance. The clinical studies and the use of animal models have clearly demonstrated the potential of cancer cells to elicit an immune response through the presentation of tumor-specific antigens. These molecules are antigenic in the host, and the immune system is able to recognize tumor cells and engage a repertoire of cells and molecules that eventually kill the abnormal cells before they develop into tumors, or destroy the tumors once they are formed [2]. Thus, immunodeficient individuals have a higher incidence of tumors than individuals with a potent immune system. Clinicopathological correlations show that the presence of lymphocytic infiltrates in some tumors is associated with a better prognosis, as compared with histologically similar tumors without infiltrates [3]. Moreover, tumors can activate specific T-cell-mediated immune responses and lead to the elimination of cancer cells through effectors such as antibodies, cytokines, CD8+ CTLs, NK cells gran-
277
ulocytes and T cells expressing ot and ^ subunits of the T-cell receptor (TCR) [2]. Although malignant tumors can express antigens that are recognized as foreign by the tumor host, and although immunosurveillance can limit the outgrowth of some tumors, the immune system does not prevent the frequent occurrence of malignant diseases. Different mechanisms have been proposed to explain how alterations of the CD95 system could conceivably result in the escape of tumor cells from immunosurveillance. The possible mechanisms include loss of Fas on the cell surface of tumor cells [4] , expression of high levels of soluble Fas which inhibit FasL-Fas interaction [5] , defects in Fas signaling pathway [6], or overexpression of anti-apoptotic proteins such as Bcl-2 and Bcl-2 family members [7]. An active mechanism of immune escape is overexpression of FasL on the surface of tumor cells, which actively kills the Fas-H cytotoxic T lymphocytes by inducing apoptosis [8]. The regulation of apoptosis involves survival (antiapoptotic) and lethal (pro-apoptotic) signals [9]. The extracellular factors that inhibit apoptosis include normal serum proteins, extracellular matrix, and growth factors such as epidermal growth factor (EGF), insulin-like growth factor-1 (IGF-1) and basic fibroblast growth factor (bFGF). Conversely, several cytokines and inflammatory mediators such as tumor necrosis factor-or (TNF-a) and interleukin(IL)-lQf induce apoptosis [9]. Several extracellular factors participate in the regulation of cell survival and death through activation of sensors. These sensors, in turn, activate intracellular signals leading to cell death. Integrins and certain cytokine receptors transduce survival signals, which inhibit apoptosis. Among these are the phosphorylated EGF receptor and growth factor receptor-bound protein 2 (Grb2) [10]. Other cytokine receptors, including members of the TNF receptor superfamily, enhance apoptosis. The endogenous ligand for Fas, FasL and agonistic anti-Fas antibodies induce apoptosis [1]. Soluble Fas molecules may be secreted and bind to and antagonize FasL [11]. Among the intracellular factors that regulate apoptosis, c-myc, p53, Fos, Jun and Nur77 transcription factors control different signalling pathways of apoptosis [12]. Several proteases are now known to be the key mediators of the effector pathways of apoptosis either through survival factor deprivation or enhance-
278
ment of cell death. Thus, the protease inhibitors Bcl-2 and Bcl-xl are intracellular proteins that protect cells from apoptosis [13].
3. THE DEATH FACTOR—FAS (APO-1 OR CD95) Fas (APO-1 or CD95) is a 45-kD transmembrane receptor belonging to the tumor necrosis factor (TNF)/nerve growth factor (NGF) receptor superfamily [1]. Fas ligand (Fas-L) is a 40-kD transmembrane protein that induces apoptosis by binding to Fas. Fas and FasL are co-expressed in various tissues, including thymus, lung, spleen, small intestine, liver, seminal vesicle, prostate, and uterus [14]. Most tissues with constitutive Fas and FasL co-expression are characterized by continuous apoptotic cell turnover. Several proteins that form complexes with the intracellular domain of Fas have been identified. Extracellular ligation of Fas results in the recruitment of proteins to form a death-inducing signaling complex (DISC). The binding of FasL to Fas results in the recruitment of an adapter protein. Fas-associated death domain (FADD), which binds to a conserved amino acid sequence known as the "death domain" on the cytoplasmic domain of the Fas receptor. In turn, FADD associates with the proenzyme form of caspase8 (FLICE/MACH) through dimerization of a domain known as the death-effector domain (DED). A protein tyrosine phosphatase. Fas-associated phosphatase-1 (FAP-1), may also have a role in DISC formation [15]. Similar to the Fas-mediated death signaling cascade, binding of TNF to TNF-Rl induces DISC formation. TNF-induced DISC formation involves the recruitment of caspase-8, RIP, and FADD, but also recruits TNF receptor-associated death domain (TRADD), which is an adapter protein that binds to TNF-Rl and FADD [16]. In both systems (Fas and TNF), formation of the DISC results in caspase-8 activation, which, in turn, activates other downstream caspases, ultimately resulting in apoptosis.
4. ANTI-FAS ANTIBODIES In the recent years, several studies have examined the role of different anti-Fas antibodies of IgM and IgG isotypes in regulating Fas-dependent apoptosis.
Despite the fact that some of the anti-human Fas monoclonal antibodies (ZB4, VB3, WB3 and CBE) recognize the same linear site on the Fas molecule, these antibodies have different biological properties. AntiFas clone VB3 induces marked apoptotic cell death in Fas-expressing cells, although the killing is delayed when compared to the cytolytic effect mediated by anti-Fas antibody of IgM subclass (clone CH-11). The ZB4 antibody, on the other hand, has been shown to block apoptosis induced by CH-11. The WB3 and CBE clones neither induced nor inhibited apoptosis. The ability of these anti-Fas monoclonal antibodies to induce or inhibit apoptosis appears to correlate with their relative affinity for the Fas molecule [17]. Agonistic anti-Fas antibodies induce apoptosis in a similar mechanism as TNF-induced apoptosis [18]. An in vitro model of the extracellular portion of Fas was constructed, based on the crystallographic coordinates of the TNF-Rl receptor, in order to gain understanding of Fas-FasL interaction [19]. The model demonstrated clearly, that the antibodies do not identically mimic the endogenous FasL to achieve their effect of upregulation of apoptosis, but rather act in an analogous manner by recruiting Fas molecules into clusters, which may lead to oligomerization of 'death domains'. Moreover, the apparent cross-reactivity, observed for the monoclonal anti-Fas antibodies between different regions of Fas, was found to be due to the structural mimicry of these epitopes. Reduction of the Fas cross-reactive peptides by dithiothreitol completely abrogated their antigenic reactivity with the anti-Fas monoclonal antibodies, thus indicating that the establishment of intrapeptide disulfide bonds is critical for antigenic reactivity [19]. Proteases of the caspase family, especially caspase-1, caspase-3 (CPP32/Yama/apopain), caspase-4 and caspase-8 (MACH/FLICE/Mch5) proteases, are implicated in Fas-mediated apoptosis. Anti-Fas antibody-mediated apoptosis is driven by a caspase cascade in which the caspase-4 protease transmits a death signal from caspase-8 to caspase3 proteases probably through directly cleaving pro-caspase-3 proteases [20]. Monoclonal anti-Fas antibodies induce apoptosis in normal cells from different tissues including mesangial cells, chondrocytes, keratinocytes, fibroblasts, neutrophils and eosinophils. Agonistic anti-human Fas antibodies induce a time- and dose-dependent apoptosis in human mesangial cells. Cytotoxicity can be
modulated by pre-stimulation of the mesangial cells with IFN-y and/or by co-treatment with actinomycinD. Mesangial cells are also sensitive to death induced by anti-Fas antibodies in vivo [21]. A subpopulation of chondrocytes expresses Fas and is susceptible to Fas-induced apoptosis. Treatment of freshly isolated normal human articular chondrocytes with an agonistic Fas antibody, induces apoptosis in a subpopulation (approximately 20%) of the cells. Apoptosis induced by anti-Fas antibodies is not dependent on nitric oxide (NO), and anti-Fas antibodies do not induce NO production [22]. The Fas antigen is widely distributed in skin components such as the keratinocytes. The human epidermal keratinocyte cell line KJD and the human skin squamous cell carcinoma cell line HSC strongly express the Fas antigen, and crosslinking of the Fas antigen by an anti-Fas monoclonal antibody induces apoptosis of these cell lines [23]. Anti-Fas antibodies induce apoptosis in fibroblasts in a dose- and time-dependent manner. Adult dermal skin fibroblasts are more susceptible to anti-Fas antibody-induced apoptosis than foreskin fibroblasts, with 21-52% dead cells in different strains. In foreskin fibroblasts, anti-Fas antibodies (1.0 mg/ml) predominantly induce proliferation ([^H]-thymidine incorporation increased to 115-165% of control level) and only low levels of apoptotic cell death after 48 h of treatment. No induction of proliferation by anti-Fas was found in the adult fibroblasts. Addition of TNFa slightly augmented the anti-Fas antibody-induced apoptosis in both cell types [24]. Anti-Fas antibodies effectively accelerate apoptotic cell death in Bcl-2-negative Fas-positive neutrophils. However, the apoptosis-inducing effect of anti-Fas antibody is minimal on Bcl-2 positive. Fas positive monocytes, and Bcl-2 positive. Fas positive lymphocytes were resistant to these antibodies. These results suggest that anti-Fas-mediated cell death may, in part, be determined by Bcl-2 expression status in Fas positive lymphoid and hematopoietic cells [25]. Furthermore, anti-Fas monoclonal antibodies accelerate apoptotic eosinophil death in vitro [26]. Anti-Fas monoclonal antibodies induce apoptosis in HIV-infected lymphocytes [27]. Anti-Fas antibodies induce apoptosis of mouse hepatocytes in primary culture [28]. Biochemical, histological and electron microscope analyses have indicated severe damage of the liver by apoptosis [28]. To test a putative protective effect of the antiapoptotic Bcl-2 protein, transgenic
279
mice were generated to express the human Bcl-2 gene product in hepatocytes. Hepatic apoptosis was delayed and dramatically reduced in transgenic animals, yielding a 93% survival rate. These results demonstrate that Bcl-2 is able to protect from Fas-mediated cytotoxicity in vivo. Anti-Fas monoclonal IgM antibodies have been shown to induce apoptosis in certain tumor cells that express Fas antigen on their surface [29]. Human colorectal carcinoma cell lines express Fas antigen and exposure of these cell Unes to anti-Fas antibodies can induce apoptosis. Fas-mediated apoptosis in human colorectal carcinoma cell lines is regulated by Bcl-2 and correlate with the degree of differentiation [30]. Human malignant glioma cells are sensitive to anti-Fas antibody-mediated cell killing and the sensitivity correlate with cell surface expression of Fas. Fas expression and Fas-dependent cytotoxicity were augmented by pre-exposure of these cells to IFN-y and TNF-a. Furthermore, pretreatment of the cells with TGF-jS 2, IL-1 and IL-8 enhanced anti-Fas antibody-induced apoptosis [31]. Anti-Fas-antibodies induce apoptosis in Fas-positive hepatocellular carcinoma cell lines. Hepatocellular carcinoma cell lines with low Fas expression become sensitive to anti-Fas after preincubation with interferon-/ [32]. Human immunoglobulin repertoire contains different populations of antibodies, which interfere with Fas-FasL interaction. Several studies have identified pro-apoptotic antibodies in the IgG of healthy individuals and in IgG from patients with different autoimmune diseases. The pro-apoptotic activity is mediated by activation of the Fas receptor. Therapeutic preparations of natural human polyspecific immunoglobulin G (IVIg) induce apoptosis mediated at least partially by anti-Fas antibodies. Reactivity of the anti-Fas antibodies was found toward both the extracytoplasmic and intracytoplasmic regions of the Fas receptor. Affinity-purified anti-Fas antibodies from IVIg efficiently induced apoptosis of Fas positive T-cell lines. IVIg also induced apoptosis in normal, nontransformed tonsillar B cells [33]. While unfractionated IVIg induced apoptosis in both resting (noninduced Fas expression) and CD40-activated cells to a similar extent, affinity-purified anti-Fas antibodies from IVIg induced increased apoptosis in the CD40-stimulated cells compared with resting B cells. The apparent discrepancy between the almost similar capacity of unfractionated IVIg to induce apoptosis in CD40-
280
stimulated and unstimulated B cells and the selective ability of anti-Fas antibodies to induce apoptosis of CD40-activated cells, supports the involvement of several pathways in addition to Fas pathway, in IVIgmediated cell death [33]. Some autoantibodies have been shown to penetrate into living cells and induce apoptosis. Human polyclonal anti-DNA, IgG, which efficiendy penetrated living cells, was able to induce a noticeable expression of Fas. Similar results were obtained using different murine anti-DNA monoclonal antibodies [34]. Anti-apoptotic antibodies were demonstrated in human IgG from healthy individuals and from patients with autoimmune diseases. Antibodies present in pooled human intravenous immunoglobulins (IVIg) have also been shown to block Fas-mediated apoptosis of keratinocytes in vitro. IVIg treatment induced a rapid reverse of the disease progression in patients with toxic epidermal necrolysis, which is caused by massive Fas-dependent apoptosis of keratinocytes and the outcome of the patients was favorable [35]. In another study, it has been shown that anti-FasL autoantibodies of IgG-isotype are detected in the sera of 33% of the patients with SLE. These antibodies bind probably to the soluble FasL and inhibit Fas-FasLmediated apoptosis. These neutralizing autoantibodies might be involved in the immune abnormalities, which are critical in the pathogenesis of SLE and may explain the "escape" of autoreactive Fas-positive lymphocytes from apoptosis [36]. Thyroid stimulating antibodies in Graves' disease are TSH agonists and cause hyperthyroidism as well as goiter. Fas expression on thyrocytes is significantly down-regulated by Graves' IgG. Treatment of thyrocytes with IL-1)6 or IFN-y causes a marked augmentation of Fas expression on thyrocytes. The increase of Fas expression of thyrocytes induced by IL-ly6 or IFN-y was significantly suppressed in the presence of Graves' IgG. Anti-Fas-induced apoptosis of thyrocytes was observed in thyrocytes treated with IL-1)6 or IFN-y, but was markedly inhibited in the presence of TSH or Graves' IgG. Thus, thyroid stimulating antibodies, found in Graves' patients, may be potentially involved in the development of goiter by inhibition of Fas-mediated apoptosis of thyrocytes [37]. Thyroid stimulation blocking antibodies (TSBAb) in idiopathic myxoedema are TSH antagonists and cause hypothyroidism and thyroid atrophy. Idiopathic myxoedema IgG abrogates the effect of TSH on both cAMP pro-
duction and inhibition of Fas expression on thyrocytes. Idiopathic myxoedema IgG abrogates most of the inhibitory effect of TSH on Fas-mediated apoptosis of thyrocytes treated with IL-1^ or IFN-y. Thus, TSBAb inhibit action of TSH and increase the sensitivity toward Fas-mediated apoptosis of thyrocytes, inducing thyroid atrophy seen in patients with idiopathic myxoedema [37]. It has been proposed that too Httle apoptosis would lead to persistence of autoreactive cells resulting in the production of autoantibodies and subsequently autoimmune conditions [38]. The importance of Fas/APO-1-mediated apoptosis in various immune disorders and lymphproliferative disorders is well documented. MRL mice homozygous for Ipr (lymphoproliferation) or gld (generalized lymphoproliferative disease) develop a systemic autoimmune disease resembling systemic lupus erythematosus (SLE), Sjogren's disease and rheumatoid arthritis [39]. Defective apoptosis has been implicated in the pathogenesis of several conditions in which IVIg treatment has proven beneficial [38, 40-42]. The presence of antiFas molecules in IVIg may be significant in interfering with the pathogenic processes involved in certain autoimmune diseases and lymphoproliferative disorders. These functionally active anti-Fas molecules may induce apoptosis in activated self-reactive T- and B-cell clones which express Fas on their cell surface. Furthermore, IVIg has also been used in the treatment of clinical stage III and IV chronic lymphocytic leukemia associated with autoimmune hemolytic anaemia or immune thrombocytopenic purpura in which a decrease in total lymphocyte counts were observed [43, 44]. The persistent lowering of the lymphocyte count was associated with dimunition in the size of the lymph nodes and the spleen. In conclusion, Fas-FasL interaction is important in protection against cancer. Antibodies in therapeutic preparations of human IgG are able to interfere with Fas-FasL interaction. This raises the possibility that these antibodies have a role in the regulating apoptosis in vivo. We suggest that pro-apoptotic anti-Fas antibodies have a role in immunosurveillance, whereas, neutraUzing anti-Fas antibodies have a role in immune escape of tumor cells and development of cancer.
REFERENCES 1. 2.
3.
4.
5.
6.
7.
8.
9. 10.
11.
12.
13.
14.
Nagata S, Golstein P. The Fas death factor. Science 1995;267:1449. Schreiber H. Tumor immunology. In: WE P, ed., Fundamental Immunology. New York: Raven Press, 1998;1143. Hakansson A, Gustafsson B, Krysander L, Hakansson L. Tumour-infiltrating lymphocytes in metastatic malignant melanoma and response to interferon alpha treatment. Br J Cancer 1996;74:670. Leithauser F, Dhein J, Mechtersheimer G, Koretz K, Bruderlein S, Henne C, Schmidt A, Debatin KM, Krammer PH, Moller P. Constitutive and induced expression of APO-1, a new member of the nerve growth factor/tumor necrosis factor receptor superfamily, in normal and neoplastic cells. Lab Invest 1993;69:415. Owen-Schaub LB, Yonehara S, III WLC, Grimm EA. DNA fragmentation and cell death is selectively triggered in activated human lymphocytes by Fas antigen engagement. Cell Immunol 1992;140:197. Thome M, Schneider P, Hofmann K, Fickenscher H, Meinl E, Neipel F, Mattmann C, Bums K, Bodmer JL, Schroter M, Scaffidi C, Krammer PH, Peter ME, Tschopp J. Viral FLICE-inhibitory proteins (FLIPs) prevent apoptosis induced by death receptors. Nature 1997;386:517. Ito T, Deng X, Carr B, May WS. Bcl-2 phosphorylation required for anti-apoptosis function. J Biol Chem 1997;272:11671. O'Connell J, O'Sullivan GC, CoUins JK, Shanahan R The Fas counterattack: Fas-mediated T cell killing by colon cancer cells expressing Fas ligand. J Exp Med 1996;184:1075. Thompson CB. Apoptosis in the Pathogenesis and Treatment of Disease. Science 1995;267:1456. Path I, Schweighoffer F, Rey I, Multon MC, Boiziau J, Duchesne M, Tocque B. Cloning of a Grb2 isoform with apoptotic properties. Science 1994;264:971. Cheng J, Zhou T, Liu C, Shapiro JP, Brauer MJ, Kiefer MC, Barr PJ, Mountz JD. Protection from Fas-mediated apoptosis by a soluble form of the Fas molecule. Science 1994;263:1759. Woronicz J, Calnan B, Ngo V, Winoto A. Requirement for the orphan steroid receptor Nur77 in apoptosis of T cell hybridomas. Nature 1994;367:277. Hockenbery D, Nunez G, Milliman C, Schreiber RD, Korsmeyer SJ. Bcl-2 is an inner mitochondrial membrane protein that blocks programmed cell death. Nature 1990;348:334. French L, Tschopp J. Constitutive Fas ligand expression in several non-lymphoid mousetissues:Im-
281
15.
16. 17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
282
plications for immune-protection and cell turnover. Behring Inst Mitt 1996;97:156. Yanagisawa J, Takahashi M, Kanki H, YanoYanagisawa H, Tazunoki T, Sawa E, Nishitoba T, Kamishohara M, Kobayashi E, Kataoka S, Sato T. The molecular interaction of Fas and FAP-1. A tripeptide blocker of human Fas interaction of FAP-1 promotes Fas-induced apoptosis. J Biol Chem 1997;272:8539. Yuan J. Transducing signals of life and death. Curr Opin Cell Biol 1997;9:247. Fadeel B, Thorpe CJ, Yonehara S, Chiodi F AntiFas IgG antibodies recognizing the same epitope of Fas/Apo-1 mediate different biological effects in vitro. Int Immunol 1997;9:201. Yonehara S, Ishii, A, Yonehara, M. A cell-killing monoclonal antibody (anti-Fas) to a cell surface antigen co-downregulated with the receptor of tumor necrosis factor. J Exp Med 1989;169:1747. Fournel S, Robinet E, Bonnefoy-Berard N, Assossou O, Flacher M, Waldmann H, Bismuth G, Revillard JR A noncomitogenic CD2R monoclonal antibody induces apoptosis of activated T cells by a CD95/CD95L-dependent pathway. J Immunol 1998;160:4313. Kamada S, Washida M, Hasegawa J, Kusano H, Funahashi Y, Tsujimoto, Y. Involvement of caspase4(-like) protease in Fas-mediated apoptotic pathway. Oncogene 1997;15:285. Gonzalez-Cuadrado S, Lopez-Armada MJ, GomezGuerrero C, Subira D, Garcia-Sahuquillo A, OrtizGonzalez A, Neilson EG, Egido J, Ortiz A. Anti-Fas antibodies induce cytolysis and apoptosis in cultured human mesangial cells. Kidney Int 1996;49:1064. Hashimoto S, Setareh M, Ochs RL, Lotz, M. Fas/Fas ligand expression and induction of apoptosis in chondrocytes. Arthrit Rheumatol 1997;40:1749. Oishi M, Maeda K, Sugiyama, S. Distribution of apoptosis-mediating Fas antigen in human skin and effects of anti-Fas monoclonal antibody on human epidermal keratinocyte and squamous cell carcinoma cell lines. Arch Dermatol Res 1994;286:396. Jelaska A, Korn, JH. Anti-Fas induces apoptosis and proliferation in human dermal fibroblasts: differences between foreskin and adult fibroblasts. J Cell Physiol 1998;175:19. Iwai K, Miyawaki T, Takizawa T, Konno A, Ohta K, Yachie A, Seki H, Taniguchi, N. Differential expression of bcl-2 and susceptibility to anti-Fas-mediated cell death in peripheral blood lymphocytes, monocytes, and neutrophils. Blood 1994;84:1201. Hebestreit H, Yousefi S, Balatti I, Weber M, Crameri R, Simon D, Hartung K, Schapowal A, Blaser K, Simon, HU. Expression and function of the Fas receptor on human blood and tissue eosinophils. Eur J Immunol 1996;26:1775.
27.
28.
29.
30.
31.
32.
3 3.
34.
35.
36.
37.
Kobayashi N, Hamamoto Y, Yamamoto N, Ishii A, Yonehara M, Yonehara, S. Anti-Fas monoclonal antibody is cytocidal to human immunodeficiency virusinfected cells without augmenting viral replication. Proc Natl Acad Sci USA 1990;87:9620. Ni R, Tomita Y, Matsuda K, Ichihara A, Ishimura K, Ogasawara J, Nagata, S. Fas-mediated apoptosis in primary cultured mouse hepatocytes. Exp Cell Res 1994;215:332. Nakamura S, Takeshima M, Nakamura Y, Ohtake S, Matsuda, T. Induction of apoptosis in HL60 leukemic cells by anticancer drugs in combination with anti-Fas monoclonal antibody. Anticancer Res 1997; 17:173. Meterissian S, Kontogiannea M, Po J, Jensen G, Ferdinand, B. Apoptosis induced in human colorectal carcinoma by anti-Fas antibody. Ann Surg Oncol 1997 ;4:169. Weller M, Malipiero U, Aguzzi A, Reed, JC, Fontana, A. Protooncogene Bcl-2 gene transfer abrogates Fas/APO-1 antibody-mediated apoptosis of human malignant glioma cells and confers resistance to chemotherapeutic drugs and therapeutic irradiation. J Clin Invest 1995;95:2633. Yano H, Fukuda K, Haramaki M, Momosaki S, Ogasawara S, Higaki K, Kojiro M. Expression of Fas and anti-Fas-mediated apoptosis in human hepatocellular carcinoma cell lines. J Hepatol 1996;25:454. Prasad N, Papoff G, Zeuner A, Bonnin E, Kazatchkine MD, Ruberti G, Kaveri SV. Therapeutic preparations of normal polyspecific immunoglobulin G (IVIg) induce apoptosis in human lymphocytes and monocytes: a novel mechanism of action of IVIg involving the Fas apoptotic pathway. J Immunol 1998; 161:3781. Portales-Perez D, Alarcon-Segovia D, Llorente L, Ruiz-Arguelles A, Abud-Mendoza C, Baranda L, de la Fuente H, Ternynck T, Gonzalez-Amaro R. Penetrating anti-DNA monoclonal antibodies induce activation of human peripheral blood mononuclear cells. JAutoimmunl998;ll:563. Viard I, Wehrli P, Bullani R, Schneider P, Holler N, Salomon D, Hunziker T, Saurat JH, Tschopp J, French, LE. Inhibition of toxic epidermal necrolysis by blockade of CD95 with human intravenous immunoglobulin. Science 1998;282:490. Suzuki N, Ichino M, Mihara S, Kaneko S, Sakane, T. Inhibition of Fas/Fas ligand-mediated apoptoticcell death of lymphocytes in vitro by circulating anti-Fas ligand autoantibodies in patients with systemic lupus erythematosus. Arthrit Rheumatol 1998;41:344. Kawakami A, Eguchi K, Matsuoka N, Tsuboi M, Urayama S, Kawabe Y, Tahara K, Ishikawa N, Ito K, Nagataki S. Modulation of Fas-mediated apoptosis of human thyroid epithelial cells by IgG from patients
38.
39. 40.
41.
with Graves disease(GD) and idiopathic myxoedema. Clin Exp Immunol 1997;110:434. Rudin CM, Thompson CB. Apoptosis and disease: regulation and clinical relevance of programmed cell death. Ann Rev Med 1997;48:267. Cohen JJ. Apoptosis: physiologic cell death. J Lab Clin Med 1994;124:761. Bauer J, Wekerle H, Lassman H. Apoptosis in brainspecific autoimmune disease. Curr Opin Immunol 1995;7:839. Mountz JD, Zhou T, Su X, Wu J, Cheng J. The role of programmed cell death as an emerging new concept
42.
43.
44.
for the pathogenesis of autoimmune diseases. Clin Immunol Immunopathol 1996;80:S2. Kazatchkine MD, Dietrich G, Hurez V, Ronda N, Bellon B, Rossi F, Kaveri SV. V region-mediated selection of autoreactive repertoires by intravenous immunoglobulin (IVIg). Immunol Rev 1994; 139:79. Besa EC. Use of intravenous immunoglobulin in chronic lymphocytic leukemia. Am J Med 1984;76(3A):209. Besa EC, Klumpe D. Prophylactic immunoglobulin in chronic lymphocytic leukemia. N Engl J. Med 1992;326:139.
283
© 2000 Elsevier Science B.V All rights reserved. Cancer and Autoimmunity Y. Shoenfeld and M. E. Gershwin, editors
Hepatitis C Virus, Autoimmunity and Cancer Dan Buskila^ Emanuel Sikuler^ and Yehuda Shoenfeld^ ^Ben Gurion University of the Negev; ^Sheba Medical Center, Tel-Hashomer and Tel-Aviv University, Israel
1. INTRODUCTION By its classical definition, the term viral hepatitis refers to a disease caused by a group of hepatotrophic viruses producing hepatitis as the major clinical manifestation [1]. Although, extraheptic effects of viral hepatitis were known for more than a century, it was not until the late 1960s, when serologic testing for hepatitis B became available, that the linkage of viral hepatitis B to pathological manifestations in nonhepatic tissues was unequivocally established [2]. The discovery of hepatitis C virus (HCV) and the development of serological tests for HCV infection was followed by further identification of extraheptic manifestations associated with this viral infection [2, 3]. Hepatitis C virus is the main causative agent of non-A and non-B hepatitis [4]. This is a single stranded RNA virus which is considered to be a member of a distinct genus in the flaviviridae family. Based on nucleic acid sequence analysis, six major genotypes and more closely related subtypes have been identified [5]. Variability is distributed throughout the genome, with the nonstructural genes of different genotypes showing 65-70% homology. Genotypes 1, 2 and 3 are widely distributed throughout Western countries and the Far East. Types 5 and 6 are largely confined to South Africa and South-east Asia, respectively, whereas, type 4 is found predominantly in the Middle East and Central Africa [5]. Infection with HCV is usually persistent despite high titers of antibody to multiple epitopes along the entire genome [6]. Persistence appears to depend primarily upon the virus' ability to rapidly and continuously mutate under im-
mune pressure and to simultaneously exist as a series of immunologically distinct variants (quasispecies) [7]. Chronic HCV infection is associated with chronic hepatitis, cirrhosis and hepatocellular carcinoma. End stage liver disease due to HCV infection is a frequent indication for liver transplantation. Interferon is the only agent of proven efficacy in the treatment of hepatitis C [8]. Recently, combination of interferon and ribavirin was found to be more effective than interferon alone [9]. HCV is not only a hepatotropic but is also a lymphotrophic virus and infects peripheral blood lymphocytes [10,11]. HCV infection has been associated with numerous dermatological, hematological, endocrinological, respiratory, rheumatic and autoimmune syndromes [12-16]. Thus, HCV has been linked with mixed cryoglobulinemia, vasculitis, arthritis, sicca symptoms and autoantibodies [12-23]. Recently, an association between HCV infection and B cell nonHodgkin's lymphoma has been reported [24, 25]. Furthermore, we have suggested that an association between HCV infection and other extrahepatic malignancies may exist as well [26]. The exact underlying mechanisms for the various extraheptic manifestations, which accompany HCV infection, are not completely known. A direct cytopathic effect of the virus may exist, nevertheless, it is generally believed that immune mechanisms play a major role in the pathogenesis of these syndromes [27]. This chapter will focus on the linkage between malignancies and autoimmune phenomena associated with chronic HCV infection.
285
2. HCV, THE IMMUNE SYSTEM AND AUTOIMMUNITY HCV infection has been found to be strikingly associated with autoimmune diseases and serological markers of autoimmunity [28]. Although a direct cytopathic effect of HCV has been suggested, the existence of HCV carriers, fluctuating cUnical course, and frequent findings of lymphoid aggregates or follicles in liver biopsy specimens, all suggest that immunologic mechanisms are involved in the pathogenesis of liver cell damage in chronic HCV infection [29, 30]. Studies in humans suggest that antibody seroconversion appears subsequently to both viremia and onset of liver disease. The onset and pattern of antibody response is highly variable, and antibody seroconversion does not prevent chronic infection nor active hepatitis [31, 32]. Moreover, HCV infection and antibody response may lead to immune complex formation and deposition. Thus, HCV-induced immune complexes have been detected in the liver, skin [33] and kidney [34] of HCV infected patients. These complexes contain HCV antigens and antibodies, rheumatoid factor (RF), and C3 [35]. Since the discovery of HCV, several studies addressing T-cell response were undertaken [36]. HCV antigen-specific, CD8-I- cytotoxic T lymphocytes and CD4+ helper T cells are present in both peripheral blood and liver of patients with chronic hepatitis C [37, 38]. Moreover, the hepatocyte expression of human major histocompatibility complex antigens class I (HLA-I) and cytokine dependent immune adhesion molecules is enhanced in association with increases lobular CD8-^ T cell infiltration in such patients [39, 40]. Furthermore, HLA-I restricted CD8-I- T cell mediated hepatocytotoxicity has been shown to be an important pathogenetic mechanism in patients with chronic HCV infection [41]. T-cell activation involving the interleukin-2 (IL-2) system was shown to be present in these patients [42]. Furthermore, in chronic HCV, IL-2-)6 and TNF-a appear to play a major role in immune responses and IL-2, IL-4 and IFN-y seem to be associated with increased cytotoxic T cell response [43]. Cacciarelli et al. [44] have reported significantly elevated serum IL-2, IL-4, IL-10 and TNF-y in HCV-infected patients compared to normal controls. Treatment with IFN-a produced a parallel reduction in HCV RNA, IL-4, and IL-10. Phagocytosis and killing capacities exerted by polymorphonuclear cells and monocytes were found to be profoundly de-
286
pressed in HCV infected subjects [45]. At the same time, absolute numbers of CD34-, CD8-H and CD16-h cells were reduced, while the CD4+-CD8+ dependent antibacterial activity was also impaired [45]. Czaja et al. [46] have reported that differential immune responses to chronic viral hepatitis are dependent on human leukocyte antigen (HLA) genotype. Patients with HLA-DR3 and chronic hepatitis had higher serum immunoglobulin and a threefold greater frequency of severe liver disease than HLA-DR4 hepatitis patients. In contrast, chronic viral hepatitis patients with HLA-DR4 genotype had a fivefold increase incidence of concurrent immunologic diseases than patients with HLA-DR3. HLA-DR3 and DR4 were not, however, associated with more severe liver disease than other HLA genotypes [46]. HCV-infected subjects express as well high prevalence of serological markers of autoimmunity. Pawlotsky et al. [47] showed that 22% of HCV infected subjects had antinuclear antibody (ANA) seropositivity, 36% had cryoglobulins, 41% had at least one antitissue antibody, 49% showed lymphocytic capillaritis of the salivary gland, and 71% had rheumatoid factor (RF). The serological markers occurred in patients infected with different HCV subtypes. HCV infected patients with and without autoantibodies were similar in respect to sex ratio, serum level of aminotransferases and y-globulins and histological liver activity [48]. Clifford et al. [16] found a high prevalence of autoantibodies, particularly antismooth muscle antibodies (SMA) (66%) and RF (76%) in both men and women with HCV. Fourteen percent of the patients had ANA and forty of 41 tested negative for liver-kidney microsomal antibodies (anti-LKM). Anticardiolipin antibodies were found in 22% of HCV subjects vs. only 1.9% in controls [49]. The presence of thrombocytopenia, portal hypertension and the existence of prior thrombotic episodes were significantly related to positivity to these antibodies. High prevalence of thyroid autoantibodies (thyroglobulin and thyroid microsomal) have been demonstrated as well [50]. Recently, we studied the musculoskeletal manifestations and autoantibody profile in 90 hepatitis C virus infected Israeli patients [51]. Sixty-nine percent of the patient had at least one autoantibody detected in their serum, the most prevalent being rheumatoid factor (44%); antinuclear antibody (38%); and IgM and IgG anticardiolipin antibodies (28% and 22%,
respectively). The frequency of autoantibodies was not associated with liver disease severity or rheumatic disorder. Autoantibodies in HCV-infected subjects appear to be an expression of a generalized immune activation by cytokines as observed during interferon treatment in viral liver diseases.
3. HCV AND AUTOIMMUNE DISEASE In recent years, the interest in the relationship between HCV infection and autoimmune manifestations, has increased. Indeed, there is ample evidence to attribute a role for HCV-associated autoimmunity for a broad spectrum of autoimmune diseases [12, 13,15-23,52]. These include rheumatic autoimmune diseases, nonrheumatic autoimmune diseases and autoimmune liver disease. The most firmly established disease associated with HCV infection is mixed cryoglobulinemia syndrome (MCS) [17-19]. HCV is detected in about 80-90% of MCS patients and cryoglobulinemia is found in around 40% of chronic HCV infected subjects. MCS is more frequent in long standing HCV infection, in older patients, in females and in cirrhosis [53]. Among patients with HCV associated MCS, only 10% are also associated with clinical manifestations of vasculitis [12]. The cryoglobulinemic immune response to HCV infection may be manifested by a variety of cutaneous lesions, including urticaria, livedo reticularis, and palpable purpura [54-56], leukocytoclastic vasculitis, glomerulonephritis, or mononeuritis multiplex [54,57-60]. Recently, Weiner et al. reported a lower prevalence of HCV related cryoglobulinemia in Germany compared with data from Italy and France and suggested a South-North gradient in the prevalence of HCV associated cryoglobulinemia in Europe [61]. Polyarthralgias and polyarthritis have been associated with HCV infection [22, 62], and HCV RNA has been isolated from synovial fluid [63, 64]. Several patients with rheumatoid arthritis attributed to HCV have been reported as well as others with atypical inflammatory arthritis [22, 23]. In few patients the arthritis was the most prominent manifestation of chronic HCV infection [65]. Few cases of HCV-associated SLE have been described [66]. Most of them were cases of SLE induced
or aggravated by a-interferon treatment. In an uncontrolled investigation of HCV seropositivity in 71 consecutive SLE patients, Marchesoni et al. [67], reported 4 patients (6% incidence rate) with HCV seropositivity, which was greater than but not significantly different from the expected incidence for the general population in their geographic area. We have assessed recently the prevalence of anti-HCV antibodies in 95 consecutive SLE patients, only one of them had evidence of HCV infection [68]. This is not different from the prevalence of HCV infection in the general Israeli population (0.5%). Few patients with HCV-associated inflammatory myopathy have been described [63, 64, 69-71]. One HCV patient had anti-Jo-1 positive polymyositis and interstitial lung disease [69]. A preliminary investigation comparing the incidence of HCV in patients with polymyositis/dermatomyositis (PM/DM) versus a control population showed an HCV-seropositive incidence of 10% in PM/DM patients, which was increased but not significantly different from the control group [70]. Sicca syndrome also occurs in MCS in about 15% of cases [72]. Salivary gland lesions were found in 49% of HCV infected patients, all had lymphocytic capillaritis, sometimes associated with lymphocytic sialadenitis resembling that of Sjogrens syndrome and Ro/SS-A antibodies [73]. HCV has been reported to occur in Sjogren's syndrome [21, 74], however, others [75, 76] have refuted this finding. Generalized vasculitis of polyarteritis nodosa (PAN) has been rarely associated with HCV infection [77, 78]. The seroprevalence of specific antibodies to HCV in patients with PAN was about 5-8%. Most cases of HCV-associated vasculitis presented as leukocytoclastic vasculitis secondary to an HCV-induced cryoglobulinemia [79-81]. Unique vasculitis presentations included pulmonary and intestinal vasculitis [81-83]. The frequency and variety of rheumatic manifestations in HCV-infected individuals is not well documented. Few recent studies have attempted to address this issue [84, 85]. Thus, 69% of 42 HCV patients reported musculoskeletal complaints. The majority of these were nonspecific myalgias and arthralgias [84]. In another study [85], more than 50% of 56 patients with chronic hepatitis expressed rheumatic manifestations including arthralgias. Sicca syndrome and myalgias. We have assessed recently, the fre-
287
quency and spectrum of musculoskeletal manifestations in our HCV-infected patients. Rheumatic manifestations were found in 28 subjects (31%), and included arthralgia (9%), arthritis (4%), cryoglobulinemia (11%), sicca symptoms (8%), cutaneous vasculitis (2%), polymyositis (1%), antiphospholipid syndrome (1%). Rheumatic complications were not associated with liver disease severity, or subjects' gender. In addition, 22 patients (24%) reported myalgia, and fibromyalgia was diagnosed in 14 (16%) [51]. The frequency of rheumatic disease was not different among men and women and did not correlate to liver disease severity. Three patients developed autoimmune diseases shortly after diagnosis of HCV infection, namely: myasthenia gravis, polymyositis and antiphospholipid syndrome. Fibromyalgia syndrome (FS) though not an autoimmune disease, is a common disorder of diffuse pain in the muscles or joints accompanied by tenderness at specific tender points and a constellation of related symptoms. In a recent study, Buskila et al. [86] found that 15.6% of HCV infected patients were diagnosed to have FS while no subject from healthy control group (with no evidence of HCV infection had FS). A specific relationship between thyroid dysfunction and chronic HCV infection is currently thought to exist [87, 88]. HCV infection is associated with a higher prevalence of thyroid autoantibodies [50, 89, 90], however, thyroid autoimmune diseases are less frequent [89]. The development of autoimmune thyroiditis has been correlated with HCV antibodies directed against the cDNA clone GOR 47-1 (antiGOR antibodies) [91]. In general, the association between thyroid dysfunction and chronic hepatitis has been claimed to involve all forms of thyroid disease: hypothyroidism, hyperthyroidism, Hashimoto's disease and isolated increased antithyroid antibodies [80, 92]. IFN-Qf may induce thyroid autoantibodies in HCV-infected in [89, 93], and precipitate thyroid dysfunction in patients with existing autoantibodies [94]. An association between HCV and glomerulonephritis (GMN) has been documented and includes membranous [91,96], membranoproliferative [57,96,97] and acute proliferative glomerular disease [57] as well as that associated with cryoglobulinemia [57,60]. Mild to moderate proteinuria has been detected in 27% of patients with chronic HCV infec-
288
tion, whereas microscopic hematuria has been seen in only 9% [97]. Membranoproliferative GMN in HCV infection is seen frequently in the absence of other clinical features of cryoglobulinemia. However, even in such patients, glomerular deposition of IgG, IgM and C3 have been documented. Electron microscopic changes characteristic of cryoglobulin deposition and cryoprecipitates containing HCV RNA and antibodies to HCV nucleocapsid proteins C22-3 have also been demonstrated [97]. Recently, Sansonno et al. [98] have shown that specific HCV related proteins were detected in glomerular and tubulointerstitial vascular structures in two thirds of HCV positive patients with membranoproliferative glomerulonephritis and in none of HCV negative controls. These authors suggest that kidney deposits consistent of HCV-containing immune complexes, play a direct pathogenic role in the renal support in the use of antiviral agents, such as IFN in its treatment. Recently two cases of Guillain-Barre syndrome have been reported in patients with chronic HCV infection [99]. The authors speculate that the immunological disorders triggered by HCV infection predisposed the patients to this immune-mediated polyneuropathy.
4. HCV INFECTION AND MALIGNANCY The linkage between chronic HCV infection and hepatocellular carcinoma is well established [100]. Recently, an association between HCV infection and non Hodgkin's lymphoma has been reported [25, 101]. Furthermore, we have reported that an association between HCV infection and other extrahepatic malignancies may exist as well [26]. In this paragraph we will review the possible role of HCV infection in hepatic and non hepatic malignancies [26]. 4.1. A. HCV Infection and Hepatocellular Carcinoma Hepatocellular carcinoma (HCC) is one of the most common malignancies, especially in Southeast Asia [102]. Studies in the past have demonstrated a close association between HCC and chronic hepatitis B [102]. However, after the discovery of HCV, the incidence of HCC has been shown to be higher in patients with chronic HCV than in those with chronic hepatitis
B [104]. Recently, Serfaty et al. [104] reported that the incidence of HCV in patients with hepatitis C cirrhosis is about 3% per year, an incidence which is higher than previously estimated. This risk is independent of the genotype responsible for infection [105]. 4.2. B. HCV Infection and Non-Hodgkin's Lymphoma (NHL) In 1994, a survey of a group of NHL patients was conducted in Italy. A significant increase in the prevalence rate of HCV serologic positivity or viremia relative to the general population was found [106]. By contrast, Hodgkin's disease and T-cell lymphoma were not found to have a HCV prevalence rate significandy different from that of the general population. Izumi et al. [107] analyzed HCV-RNA in 50 patients with B cell maUgnancy (BCM): 25 cases of NHL, 4 of Waldenstrom's macroglobulinemia and 21 of multiple myeloma. HCV-RNA was detected in 16% of the BCM patients and in none of the control group (the prevalence of HCV infection in blood donors in Japan is approximately 1%). The authors also report four B cell NHL cases with splenic or hepatic origin in the course of chronic hepatitis C. These results further implicate the association between persistent HCV infection and the ocurrence of BCM. Silvestri et al. [108] found a striking high prevalence of HCV genotype 2ac among patients with B cell NHL and suggested that this genotype might be involved in the pathogenesis of lymphoproliferative and autoimmune disorders. In 1994, Nashitz et al. [109] reported on a patient with liver cirrhosis due to HCV infection in whom a B cell heptosplenic lymphoma has found. This was followed by other reports on primary malignant lymphoma of the liver [110] and spleen [111, 112]. The association between HCV infection and NHL was initially reported in the setting of cryoglobulinemia. The development of maUgnant B-cell lymphoma has been reported in a variable fraction of patients with mixed cryoglobulinemia (MC) [72, 113-117]. Pozzato et al. [25] found a high prevalence (38.7%) of low grade NHL in bone marrow specimens of patients with MC associated with HCV infection. A putative patogenetic role of HCV in the development of MC associated B-cell malignancies has been speculated. Indeed, De Vita et al. [118], have reported for the
first time the localization of HCV within a parotid NHL lesion in the course of HCV related MC, an imported step to implicated any infectious agent in the lymphomagensis. Recent studies revealed a link between HCV infection and NHLs outside the setting of cryoglobulinemia. A high frequency of HCV-infected patients without cryoglobulinemia have been found to have clonal immunoglobulin gene rearrangements in their peripheral blood [119]. De Vita et al. [120] recently reported detailed information on 35 consecutive patients with overt B cell NHL of recent onset and HCV infection. Control groups included 122 consecutive HCV negative patients with B cell NHL and 464 consecutive histopathologic cases of B-cell NHL referred to the same center, as well as 127 consecutive patients with HCV infection and without lymphoma referred to a different center in the same geographical area. B-cell NHLs in HCV infected patients frequently presented at onset: (1) an extranodal localization with peculiar target organs of HCV infection (i.e., the liver and major salivary glands) being significantly overepresented; (2) a diffuse large cell histotype without any prior history of low grade B-cell malignancy or bone marrow involvement; and (3) a weak association with a full blown predisposing autoimmune disease, although serum autoimmune features were common and cryoglobulins were always present. Therefore, the HCV related B- cell NHLs presented distinctive features compared with B-cell NHLs in HCV negative patients, and they differed from bone marrow low grade NHLs frequently diagnosed in HCV positive patients with MC. Such novel information may be relevant for future research aimed at clarifying the possible link between HCV infection, autoimmunity, nonmalignant B-cell lymphoproliferation and overt B-cell malignancy. Eight cases of B-cell extranodal NHL occuring during the course of chronic HCV infection have been described recently in noncryoglobulinemic patients [121]. Two were localized to the liver. Other sites were: liver and spleen, spleen, peritoneal cavity, parotid gland nsopharynx and eyelid (one each). Histologically, these lymphomas comprised of: low grade mucosa associated lymphoid tissue (MALT) type, diffuse large cell, Burkitt, diffuse small cell. Molecular analysis of four lymphomatous specimens exhibited clonal immunoglobulin gene rearrangements, lacked bcl-2, bcl-6, c-myc genes and p53 alterations. Replica-
289
tive intermediate HCV-RNA was not found in these tissue specimens. It can be summarized that in cryoglobulinemic patients, the most frequent encountered HNL is lymphoplasmacytic lymphoma; whereas in noncryoglobulinemic patients, extranodal marginal zone B-cell lymphoma and primary hepatosplenic lymphoma are the most commonly found neoplasms [122]. Furthermore, there are similarities between HCV related NHLs in noncryoglobulinemic patients and gastric MALTomas associated with Helicobacter pylori infection suggesting a common pathogeneic mechanism involved in the malignant transformation. 4.3. C. HCV Infection and Other Extrahepatic Malignancies Similar to previous observations regarding NHL, several patients with chronic HCV infection complicated by chronic lymphocytic leukemia (CLL) after a long term follow up were recendy reported [123, 124]. HCV may occasionally be associated with lichen planus [13]. Porter et al. [125] reported on a patient with HCV infection and oral lichen planus who developed a squamous cell carcinoma of the tongue. Verrucous carcinoma of the tongue arising in a patient with oral lichen planus associated with HCV infection was reported as well [126]. In a recent study, we assessed the prevalence and spectrum of different malignancies in HCV infected patients [26]. The medical records of 103 unselected, consecutively chosen, anti-HCV positive and 105 hepatitis B surface antigen (HBsAg) positive patients attending the liver clinic or hospitalized in the Department OS Medicine, Soroka Medical Center, BeerSheva, Israel, were reviewed. Sixteen extrahepatic malignancies were found in 15 (14.6%) of anti-HCV patients and included: non-Hodgkin's lymphoma (n = 4), carcinoma of breast (n = 3), carcinoma of colon and carcinoma of bladder {n = 2, each) and Kaposi's sarcoma, thymoma, carcinoma of uterus, carcinoma of pancreas and metastatic squamous cell carcinoma of unknown origin (one case of each). Three extrahepatic malignancies (2.9%) were found among the HBsAg positive patients (Hodgkin's lymphoma, nonHodgkin's lymphoma and carcinoma of breast). Thirteen of the malignancies were found among the 60 anti-HCV-positive patients aged >55 years old. Only one malignancy was found among the 28 HBsAg pos-
290
itive patients of the same age group (p < 0.01). The prevalence of extrahepatic malignancies in the antiHCV patients, but not in the HBsAg patients, was significantly higher (p < 0.01) than expected in the general Israeli population based on data from Israel Cancer Registry, Ministry of Health.
5. HCV, AUTOIMMUNITY, AND CANCER Despite the epidemiological association between chronic HCV infection and malignancy, the precise underlying mechanism for this observation is largely unclear. HCV is an RNA virus with no DNA intermediate. Disruption of the host genome as a result of viral integration is therefore not possible. Furthermore, HCV is not known to carry oncogenes. Until recently, the most plausible explanation for the link between HCV and HCC was that the virus causes a chronic necroimflammatory process in the liver with potentially neoplastic mutations associated with vigorous hepatic regeneration and nodule formation [100, 127]. Indeed, a possible beneficial effect of interferon in reducing the incidence of HCC was demonstrated in patients in whom ALT normalization was observed during therapy even if HCV was not eradicated [128]. Recently, it has been shown that HCC may develop in patients with HCV infection without preexisting cirrhosis [127, 129]. Mechanisms such as loss of tumor supressor genes, the activation of proto- oncogenes or the activity of specific growth factors have been speculated [130]. Nevertheless, the precise role of HCV in hepatocarcinogenesis and the role of other risk factors e.g., immunological mechanisms, are still unclear [127]. Auto-immune and B-cell lymphoproliferative disorders are often closely related [131] and MCS can be regarded as a "benign" B-cell neoplasm. This lymphoproliferation can switch over to frank, diffuse B-cell NHL generally after a long follow up period [132]. The quasispecies nature of HCV permits it to escape immune surveillance and favors the persistence of infection in the host chiefly in lymphoid cells. The lymphotropism of HCV and its close association with MCS may explain the association between this virus and some lymphoproliferative disorders. Moreover, HCV infection may initiate an autoimmune process through a mechanism of molecular mimicry. This is suggested by the detection of anti-GOR antibodies
which are specific for both HCV core and host nuclear antigen [133]. Since GOR is a nuclear antigen detected only in nuclei of cancer cells, it is likely that the GOR gene may well be an oncogene [133]. Specific genes could be responsible for B cell expansion by inducing proHferation and or death of lymphocytes. Among these, bcl-2, which is able to inhibit apoptosis, is frequently involved both in benign and in malignant B-cell neoplasms [130, 134]. The tendency of HCV infection to be associated with autoimmune and lymphoproliferative disorders, suggest that the infection may predispose to antiapoptotic mechanisms, thus favoring an abnormal persistence of lymphatic clones. Indeed there are recent data suggesting that HCV proteins may modulate apoptosis through immune-mediated apoptotic pathways [135]. Recently, Zignengo et al. [136] reported that bcl-2 rearrangement was found frequently not only in HCV infected patients with and without MCS. Other possible mechanisms for malignant transformation in HCV infected subjects may involve modulation of the P-53 tumor suppressor protein. Although, the role of HCV infection in modifying P-53 expression is not clear, recent data suggest that such an interaction may exist [137, 138].
6. SUMMARY Since the discovery of HCV, interest in extrahepatic manifestations which may accompany chronic infection with this virus, is gaining momentum. Of the various systemic manifestations, autoimmune disorders are the most frequently reported and investigated. Recently, epidemiological data indicating an association between chronic hepatitis C, hepatic and extrahepatic malignancies is emerging. The exact underlying mechanism for HCV related oncogenesis is far from being completely understood. HCV has no direct oncogenic effect. Indirect mechanisms such as modulation of autoimmune mechanisms and regulation of oncogenes are probably involved in this process. Theses mechanisms should be better investigated and defined. Moreover, investigation of therapeutic modalities such as antiviral and immuno-modulatory drugs and their role in treatment and prevention of various manifestations of chronic HCV infection is an exciting task.
REFERENCES 1.
2.
3. 4.
5. 6.
7. 8.
9.
10.
11.
12.
13.
14. 15.
16.
Rizzeto M. Viral hepatitis, Introduction. In: Mcintyre N, Benhamou JP, Bircher J, Rizzeto M, Rodes J, eds., Oxford Textbook of Clinical Hepatology. Oxford: Oxford Medical Publication 1992:529. Koff RS, Dienstag JL. Extraheptic manifestations of hepatitis C and the association with alcoholic liver disease. SemLivDis 1995;15:101-109. Wilson RA. Extrahepatic manifestations of chronic viral hepatitis. Am J Gastroenterol 1997;92:4-17. Kuo G, Choo QL, Alter HJ, et al. An assay for circulating antibodies to a major etiologic virus of human non-A, non-B hepatitis. Science 1989;244:362-364. Simmonds P. Clinical relevance of hepatitis C virus genotypes. Gut 1997;40:291-293. Shimizu YK, Hijikata M, Iwamoto A, Alter HJ, Purcell RH, Yoshikura H. Neutralizing antibodies against hepatitis C virus and the emergence of neutralizing escape mutant viruses. J Virol 1994;68:1494-1500. Enomoto N, Sato C. Clinical relevance of hepatitis C virus quasispecies. J Viral Hepat 1995;2:267-272. Dusheiko GM, Khakoo S, Soni P, Grellier L. A rational approach to the management of hepatitis C infection. Br Med J 1996;312:357-364. Schalm SW, Hansen BE, Chemello L, et al. Ribavirin enhances the efficacy but not the adverse effects of interferon in chronic hepadds C. Meta-analysis of individual patient data from European centers. J Hepatol 1997;26:961-966. Zignego AL, Macchia D, Mond M, et al. Infecdon of peripheral blood mononuclear cells by hepatitis C virus. J Hepatol 1992;15:382-386. Shimizu Y, Feinstone SM, Kohara M, Purcell RH, Yoshikura H. Hepadtis C virus: detecdon of intracellular virus particles by electron microscopy. Hepatology 1996;23:205-209. Wener MH, Johnson RJ, Sasso EH, Gretch DR. Hepatitis C virus and rheumadc disease. J Rheumatol 1996;23:953-959. Hadziyannis SJ. The spectrum of extrahepadc manifestations in hepadds C virus infecdon. J Viral Hepadds 1997;4:9-28. Mardn P. Hepatids C: more than just a liver disease. Gastroenterology 1993;104:320-323. Cumber SC, Chopra S. Hepadds C: a multifaceted disease. Review of extrahepatic manifestations. Ann Intern Med 1995;123:615-620. Clifford BD, Donahue D, Smith L, Cable E, Luttig B, Manns M, Bonkovsky HL. High prevalence of serological markers of autoimmunity in patients with chronic hepatids C. Hepatology 1995;21:613-619.
291
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27. 28. 29.
30.
31. 32. 33.
292
Ferri C, Greco F, Longombardo G, et al. Antibodies to hepatitis C virus in patients with mixed cryoglobulinemia. Arthritis Rheum 1991 ;34:16061610. Agnello V, Chung RT, Kaplan LM. A role for hepatitis C virus infection in type 2 cryoglobulinemia. N Engl J Med 1992;327:1490-1495. Cacoub P, Fabiani FL, Musset L, et al. Mixed cryoglobulinemia and hepatitis C virus. Am J Med 1994;96:124-132. Haddad J, Deny P, Munz-Gotheil C, et al. Lymphocytic sialadenitis of Sjogren's syndrome associated with chronic hepatitis C virus liver disease. Lancet 1992;339:321-323. Mariette X, Zerbib M, Jaccard A, Schenmetzler C, Danon F, Clauvel JP. Hepatitis C virus and Sjogren's syndrome. Arthritis rheum 1993;36:280-281. Siegel LB, Cohn L, Nashel D. Rheumatic manifestations of hepatitis C infection. Sem Arthritis Rheum 1993;23:149-154. Lovy MR, Starkebaum G, Uberoi S. Hepatitis C infection presenting with rheumatic manifestations: A mimic of rheumatoid arthritis. J Rheumatol 1996;23:979-983. Ferri C, Monti M, La Civita L, et al. Hepatitis C virus infection in non-Hodgkin's B-cell lymphoma complicating mixed cryoglobulinemia. Eur J Clin Invest 1994;24:781-784. Pozzato G, Mazzaro C, Crovatto M, et al. Low-grade malignant lymphoma, hepatitis C virus infection, and mixed cryoglobulinemia. Blood 1994;84:30473053. Sikuler E, Schnaider A, Zilberman D, Hilzenrat N, Shemer-Avni Y, Neumann L, Buskila D. Hepatitis C virus infection and extrahepatic malignancies. J Clin Gastroenterol 1997;24:87-89. Wilson RA. Extrahepatic manifestations of chronic viral hepatitis. Am J Gastroenterol 1997;92:4-17. Strassburg CP, Manns MP. Autoimmune hepatitis versus viral hepatitis C. Liver 1995;15:225-232. Scheuer PJ, Ashrafzadeh P, Sherlock S, Brown D, Dusheiko GM. The pathology of hepatitis C. hepatology 1992;15:567-571. Alberti A, Morsica G, Chemello L, et al. Hepatitis C viremia and liver disease in symptom free individuals with anti-HCV. Lancet 1992;340:677-698. Alter HJ. To C or not to C: These are the questions. Blood 1995;85:1681-1695. Koziel MJ. Immunology of viral hepatitis. Am J Med 1996;100:98-109. Sansonno D, Cornacchiulo V, lacobelli AR, Di Stefano R, Lospalluti M, Dammacco F. Localiztion of hepatitis C virus antigens in liver and skin tissues of chronic hepatitis C virus-infected patients with
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
mixed cryoglobuhnemia. Hepatology 1995 ;21:305312. Sinico RA, Winearls CG, Sabadini E, Fornasieri A, Catiglione A, D'Amico. Identification of glomerular immune deposits in cryoglobulinemic glomerulonephritis. Kidney Int 1988;34:109-116. Szymanski lO, Pullman JM, Underwood JM. Electron microscopic and immunochemical studies in a patient with hepatitis C virus infection and mixed cryoglobulinemia type II. Am J Clin Pathol 1994;102:278-283. Rice CM, Walker CM. Hepatitis C virus-specific T lymphocyte responses. Curr Opinion Immunol 1995;7:532-538. Koziel MJ, Dudley D, Afdhal N, et al. Hepatitis C virus (HCV) specific cytotoxic T lymphocytes recognize epitopes in the core and envelop proteins of HCV. J Virol 1993;67:7522-7532. Cerny A, McHutchison JG, PasquinelH C, et al. Cytotoxic T lymphocyte response to hepatitis C virusderived peptides containing the HLA A2.1 binding motif. J Clin Invest 1995;95:521-530. Chu CM, Liaw YF. Coexpression of intercellular adhesion molecule-I and class I major histocompatibilty complex antigens on hepatocyte membrane in chronic viral hepatitis. J CHn Pathol 1993;46:10041008. Mosnier JF, Scoazec JY, MarceUin, Degott C, Benhamou JP, Feldmann G. Expression of cytokinedependent immune adhesion molecules by hepatocytes and bile duct cells in chronic hepatitis C. Gastroenterology 1994;107:1457-1468. Liaw YF, Lee CS, Tsai SL, et al. T-cell mediated autologous hepatocytotoxicity in patients with chronic hepatitis C virus infection. Hepatology 1995;22:1368-1373. Garyfallos A, Raptopoulou-Gigi M, Orphanou H, Spaia S, Petridou P, Vayionas G. Interleukin 2dependent immunoregulatory function in hemodialysis patients with chronic hepatitis C. J Investig Allergol Clin Immunol 1995;5:255-258. Fukuda R, Satoh S, Nguyen XT, et al. Expression rate of cytokine mRNA in the liver of chronic hepatitis C: Comparison with hepatitis B. J Gastroenterol 1995;30:41-47. Cacciarelli TV, Martinez OM, Gish RG, Villanueva JC, Krams SM.l. Immunoregulatory cytokines in chronic hepatitis C virus infection: pre-and posttreatment with interferon alpha. Hepatology 1996;24:69. Jirillo E, Greco B, Caradonna L, et al. Evaluation of cellular immune responses and soluble mediators in patients with chronic hepatitis C virus infection. Immunopharmacol Immunotoxicol 1995;17:347-364.
46.
47.
48.
49.
50.
51.
52.
53.
54.
55.
56.
57.
58.
59.
Czaja AJ. Autoimmune hepatitis, evolving concepts and treatment strategies. Dig Dis Sci 1995;40:435456. Pawlotsky JM, Roudot-Thoraval F, Simmonds P, et al. Extrahepatic immunologic manifestations in chronic hepatitis C and hepatitis C virus serotypes. Ann Intern Med 1995;122:169- 173. Richardet JP, Lons T, Johanet C, et al. Prevalence and characteristics of anti-tissue antibodies in chronic hepatitis caused by hepatitis C virus (French). Gastroenterol Clin Biol 1994;18:819-823. Prieto J, Yuste JR, Beloqui O, et al. Anticardiolipin antibodies in chronic hepatitis C: implication of hepatitis C virus as the cause of the an. Hepatology 1996;23:199-204. Tran A, Quaranta JF, Benzaken S, et al. High prevalence of thyroid autoantibodies in a prospective series of patients with chronic hepatitis C before interferon therapy. Hepatology 1993;18:253-257. Buskila D, Schnaider A, Neumann L, et al. Muskuloskeletal manifestations and autoantibody profile in 90 hepatitis C virus infected Israeli patients. Semin Arthritis Rheum 1998;28:1-8. McMurray RW, Elbourne K. Hepatitis C virus infection and autoimmunity. Semin Arthritis Rheum 1997;26:689-701. Hartmann H, Schott P, Polzien F, et al. Cryoglobulinemia in chronic hepatitis C virus infection: prevalence, clinical manifestations, response to interferon treatment and analysis of cryoprecipitates. Z Gastroenterol, 1955;33:643-50. Karlsberg PL, Lee WM, Casey DL. Coc CJ, Cruz PD Jr. Cutavasculitis and rheumatoid factor positivity as presenting signs of hepatitis C virus induced mixed cryoglobulinemia. Arch Dermatol 1995; 131:11191123. Dupin N, Chosidow O, Lunel F, et al. Essential mixed cryoglobulinemia: a comparative study of dermatologic manifestations in patients infected or noninfected with hepatitis C virus. Arch Dermatol 1995;131:1124-1127. Daoud MS, Gibson LE, Daoud S, el-Azhary RA. Chronic hepatitis C and skin diseases: a review. Mayo Clinic Proc 1995;70:559-564. Johnson RJ, Willson R, Yamabe H. et al. Renal manifestations of hepatitis C virus infection. Kidney Int 1994;46:1255-1263. Johnson RJ, Gretch DR, Couser WG, et al. Hepatitis C virus-associated glomerulonephritis. Effect of a interferon. Kidney Int 1994;46:1700-1704. Khella SL, Frost S, Hermann GA, et al. Hepatitis C infection, cryoglobulinemia, and vasculitic neuropathy. Treatment with interferon alpha: case report and literature review. Neurology 1995;45:407^11.
60.
61.
62.
63.
64.
65.
66.
67.
68.
69.
70.
71.
72.
73.
74.
Stehaman-Breen C, Willson R, Alpers CE, Gretch D, Johnson RJ. Hepatitis C associated glomerulonephritis. Curr Opin Nephrol Hypertens 1995;4:287-294. Weiner SM, Berg T, Berthold H et al. A clinical and virological study of hepatitis C virus-related cryoglobulinemia in Germany. J Hepatol 1998;29:375384. Uneo Y, Kinoshita R, Kishimoto I, Okamoto M. Polyarthritis associated with hepatitis C virus infection. Br J Rheumatol 1994;33:289-291. Uneo Y, Kinoshita R, Tsujinoue H, Kato M. A case of hepatitis C virus (HCV)-associated arthritis. Quantitative analysis of HCV RNA of the synovial fluid and the serum. Br J Rheumatol 1995;34:691692. • Ueno Y, Kondo K, Kidokoro N, Kobashi R, Kanaji K, Matsumura T. Hepatitis C infection and polymyositis. Lancet 1995;346:319-320. Bon E, Cantagrel A, Moulinier L, et al. Rheumatic manifestations of chronic hepatitis C and response to the treatment with interferon alpha 2b (French). Rev Rheum Ed Fr 1994;61:497-504. Kimura Y Kajiyama K Nomura H. Severe thrombocytopenia during interferon-alpha therapy for chronic active hepatitis C associated with systemic lupus erythematosus (Japanese). Fukuoka Igaku Zasshi-Fukuoka Acta Medica 1004;85:329-323. Marchesoni A, Buttafarano N, Podico M. Tosi S. Hepatitis C virus antibodies and systemic lupus erythematosus. Clin Exp Rheumatol 1995;13:267268. Abu-Shakra M, El-Sana S, Margalith M, Sikuler E, Neumann L, Buskila D. Hepatitis B and C viruses serology in patients with SLE. Lupus 1997;6:543544. Weidensaul D, Imam T, Holyst MM, King PD, McMurray RW. Polymyosistis, pulmonary fibrosis, and hepatitis C. Arthritis Rheum 1995;38:437-439. Nishikai M, Miyairi M, Kosaka S. Dermatomyositis following infection with hepatitis C virus. J Rheumatol 1994;21:1584-1585. Horsmans Y, Geubel AP. Symptomatic myopathy in hepatitis C infection without interferon therapy. Lancet 1995;345:1236. Gorevic PD, Kassab HJ, Levo Y, et al. Mixed cryoglobulinemia: clinical aspects and long-term followup of 40 patients. Am J Med 1980;69:287-308. Pawlotsky JM, Ben Yahia M, Andre C, et al. Immunological disorders in C virus chronic active hepatitis: a prospective case-control study. Hepatology 1994;19:841-848. Wattiaux MJ, Jouan-Flahault C, Youinou P, et al. Association of Gougerot-Sjogren syndrome and viral
293
75.
76.
77.
78.
79.
80.
81.
82.
83.
84.
85.
86.
87.
88.
294
hepatitis C: apropos of 6 cases (French). Annal Med Intern 1995;146:247-250. Marrone A, DiBisceglie AM, Fox P. Absence of hepatitis C viral infection among patients with primary Sjogren's syndrome. J Hepatol 1995;22:599. King PD, McMurray RW, Becherer PR. Sjogren's syndrome without mixed cryoglobulinemia is not associated with hepatitis C virus infection. Am J gastroenterol 1994;89:1047-1050. Quint L, Deny P, Guillevin L, et al. Hepatitis C virus in patients with polyarteritis nodosa. Prevalence in 38 patients. Clin Exp Rheumatol 1991;9:253-257. Cacoub P, Lunel-Fabiani F, Du LT. Polyarteritis nodosa and hepatitis C virus infection. Ann Intern Med 1992;116:605-606. Hearth-Holmes M, Zahradka SL, Baethga BA, Wolf RE. Leukocytoclastic vasculitis associated with hepatitis C. Am J Med 1991;90:765-766. Durand JM, Kaplanski G, Richard MA, et al. Cutaneous vasculitis in a patient infected with hepatitis C virus. Detection of hepatitis C virus RNA in the skin by polymerase chain reaction. Br J Dermatol 1993;128:359-360. Marcellin P, Pouteau M, Benhamou JP. Hepatitis C virus infection, alpha interferon therapy and thyroid dysfunction. J Hepatol 1995;22:364-369. Roithinger EX, Allinger S, Kirchgatterer A, et al. A lethal course of chronic hepatitis C, glomerulonephritis, and pulmonary vasculitis unresponsive to interferon treatment. Am J Gastroenterol 1995;90:1006-1008. Gorg S, Niederstadt C, Klouche M, et al. Intestinal vasculitis and glomerulonephritis in hepatitis C-associated cryoglobulinemia. Immunitat und Infektion 1995;23:29-31. Moder KG, Lindor K. Muskuloskeletal symptoms associated with hepatitis C. Arthritis Rheum 1995;38(suppl):284 (abstr). Romero Portales M, De Diego Lorenzo A, Rivera J, et al Rheumatologic and autoimmune manifestations in patients with chronic hepatitis C virus infection. Rev Esp Enferm Dig 1997;89:591-598. Buskila D, Shnaider A, Neumann L, Zilberman D, Hilzenrat N, Sikuler E. Fibromyalgia in hepatitis C virus infection: Another infectious disease relationship. Arch Intrn Med 1997;157:2497-2500. Tran A, Quaranta JF, Beusnel C, et al: Hepatitis C virus and Hashimoto thyroiditis. Eur J Med 1992;1:116-118. Kawaguchi K, Okuwaki J, Takami S. A case of HCV-RNA positive liver cirrhosis with hypergammaglobulinemia and high titers of ANA, accompanied by hypothyroidism (Japanese). Jpn J Gastroenterol 1995;92:909-913.
89.
90.
91.
92.
93.
94.
95.
96.
97.
98.
99.
100. 101.
102.
Abuaf N, Lunel F, Giral P, et al. Non-organ specific autoantibodies associated with chronic C virus hepatitis. J Hepatol 1993;18:359-364. Quaranta JF, Tran A, Regnier D, et al. High prevalence of antibodies to hepatitis C virus in patients with anti-thyroid autoantibodis. J Hepatol 1993;18:136-138. Tran A, Benzaken S, Braun HB, et al. Anti-GOR and anti thyroid autoantibodies in patients with chronic hepatitis C. Clin Immunol Immunopathol 1995;77:127-130. Paggi A, Leri O, Taliani G, et al. Hepatitis C virus and autoimmune thyroid diseases. Possible non coincidential association. Eur J Int Med 1995;6:33-36. Preziati D, LaRosa L, Covini G, et al. Autoimmunity and thyroid function in patients with chronic active hepatitis treated with recombinant interferon-alpha 2a. Eur J Endocrinol 1995;132:587-593. Nagayama Y, Ohta K, Tsuruta M, et al: Exacerbation of thyroid autoimmunity by interferon alpha treatment in patients with chronic viral hepatistis:our studies and review of the literature. Endocrinol J 1994;41:565-572. Rollino C, Roccatello D, Giachino O, Basolo B, Piccoli G. Hepatitis C virus infection and membranous glomerulonephritis. Nephron 1991;59:319320. Yamabe H, Johnson RJ, Gretch DR. et al. Hepatitis C rirus infection membranoproliferative glomerulonephritis in Japan. J Am Soc Nephrol 1995;6:220223. Johnson RJ, GDR, Yamabe H, et al. Membranoproliferative glomerulonephritis associated with hepatitis C virus infection. N Engl J Med 1993;328:465470. Sansonno D, Gesualdo L, Manno C, Schena FP, Dammacco F. Hepatitis C virus-related proteins in kidney tissue from hepatitis C virus-infected patients with cryoglobulinemic membranoproliferative glomerulonephritis. Hepatology 1997;25:12371244. Lacaille F, Zylberberg H, Hagege H, Roualdes B, Meyrignac C, Chousterman M, Girot R. Hepatitis C associated with Guillain-Barre syndrome. Liver 1998;18:49-51. Colombo M. Hepatocellular carcinoma. J Hepatol 1992;15:225-236. Ferri C, Caracciolo F, Zignego Al et al. Hepatitis C virus infection in patients with nonHodgkin's lymphoma. Br J Haematol 1994;88:392394. Isselbacher KJ, Dienstag JL. Tumors of the liver and biliary tract. In: Fauci AS, Braunwald E, Isselbacher KJ et al, eds., Harrison's principles of
103.
104.
105.
106.
107.
108.
109.
110.
HI.
112.
113.
114.
115.
Internal Medicine. New York: McGraw-Hill 14th edn 1998:579. Takano S, Yokosuka O, Imazeki F, Tagawa M, Omata M. Incidence of hepatocellular carcinoma in chronic hepatitis B and C. A prospective study of 251 patients. Hepatology 1995;21:650-655. Serfaty L, Aumaitre H, Chazouilleres O, Bonnand AM, Rosmorduc O, Rpupon R and Rpupon R. Determinants of outcome of compensated hepatitis C virus-related cirrhosis. Hepatology 1998;27:14351440. Fattovich G, giustina G, Degos F, et al. Morbidity and mortality in compensated cirrhosis type C: a retrospective follow-up study of 384 patients. Gastroenterology 1997;112:463-472. Ferri C, Caracciolo F, Zignego AL et al. Hepatitis C virus infection in patients with non Hodgkin's lymphoma. Brit J Clin Invest. 1995;25:833-837. Izumi T, Sasaki R, Tsunoda S, Akutsu M, Okamoto H, Minura Y B cell Malignancy and hepatitis C virus infection. Leukemia 1997;(suppl 3):516-518. Silvestri F, Barillari G, Fanin R, et al. The genotype of the hepatitis C virus in patients with HCVrelated B cell non-Hodgkin's lymphoma. Leukemia 1997;11:2157-2161. Naschitz JE, Zuckerman E, Elias N, Yeshurun D. Primary hepatosplenic lymphoma of the B-cell variety in a patient with hepatitis C liver cirrhosis. Am J Gastroenterol 1994;89:1915-1916. Ellenrieder V, Beckh K, Muller D, Klatt S, Adler G. Intrahepatic high-grade malignant nonHodgkin lymphoma in a patient with chronic hepatitis C infection. Z Gastroenterol 1996;34:283285. Satoh T, Yamada T, Nakano S, et al. The relationship between primary splenic malignant lymphoma and chronic liver disease associated with hepatitis c virus. Cancer 1997;80:1981-1988. Gil J, Rodriguez C, del Toro J, Montenegro T, Fernandez-Cruz E, Menarguez J. Fulminant hepatosplenic B cell lymphoma in a young patient with HCV-chronic hepatitis. Leukemia 1998;12:10051006 Perl A, Gorevic PD, Ryan DH, Condemi JJ, Ruszkowski RJ, Abraham GN. Clonal B cell expansion in patients with essential mixed cryoglobulinemia. Clin Exp Immunol 1989;76:54-60. Monteverde A, Rivano MT, Allegra GC, et al. Essential mixed cryoglobulinemia type II: A manifestation of 12 cases with special reference to immunohistochemical findings. Acta Haemtol 1988;79:2025. Invernizzi F, Pioltelli P, Cattaneo R, Gavazzeni V, Borzini P, Monti G, Zanussi C. A long-term follow-
116.
117.
118.
119.
120.
121.
122.
123.
124.
125.
126.
127.
128.
129.
up study in essential mixed cryoglobulinemia. Acta Haematol 1979;61:93-99. Mussini C, Ghini M, Zanni G, Campioli D, Bianconi G, Artusi T. Cryoglobulinemia: Bone marrow histological investigation. Con Tissue Res 1992; 11:25. Mussini C, Mascia MT, Zanni G, Curci G. A cytomorphological and immunohistochemical study of bone marrow in the diagnosis of essential mixed type II cryoglobulinemia. Haematologica 1991;76:389391. De Vita S, Sanaonno D, Dolcetti R, et al. Hepatitis C virus within a malignant lymphoma lesion in the course of type II mixed cryoglobulinemia. Blood 1995;86:1887-1892. Franzin F, Efremov DG, Pozzato G et al. Clonal Bcell expansions in peripheral blood of HCV-infected patients. Br J Hematol 1995;90:548-552. De Vita S, Sacco C Sanaonno D, et al. Characterization of overt B-cell lymphomas in patients with Hepatitis C virus infection. Blood 1997;90:776-782. Ascoli V, Coco FL Artini M, Levrero M, Martelli M, Negro R Extranodal lymphomas associated with hepatitis C virus infection. Am J Clin Pathol 1998;109:600-609. Lai R, Weiss LM. Hepatitis C virus and Non-Hodgkin's lynphoma. Am J Clin Pathol 1998;109:508-510. La Civita L, Zignego AL, Monti M, Longombardo G, Greco F, Pasero G, Ferri C. Type C hepatitis and chronic lymphocytic leukemia (letter). Eur J cancer 1996;32A:1819-1820. Marinella MA, Moseley RH. Chronic lymphocytic leukemia complicating chronic hepatitis C infection. J Clin Gastroenterol 1996;23:302. Porter SR, Lodi G, Chandler K, Kumar N. Developmant of squamous cell carcinoma in hepatitis C virus-associated lichen planus. Oral Oncol 1997;33:58-59. Carrozzo M, Carbone M, Gandolfo S, Valente G, Colombatto P, Ghisetti V. An atypical verrucous carcinoma of the tongue arising in a patient with oral lichen planus associated with hepatitis C virus infection. Oral Oncol 1997;33:220-225. El-Refaie A, Savage K, Bhattacharya S et al. HCVassociated hepatocellular carcinoma without cirrhosis. J hepatol 1996;24:277-285. Kasahara A, Hayashi N, Mochizuki K, Takayanagi M, Yoshioka K, Kakumu S, lijima A et al. Risk factors for hepatocellular carcinoma and its incidence after interferon treatment in patients with chrinic hepatitis C. Hepatology 1998;27:1394-1402. De-Mitri MS, Poussin K, Baccarini P Pontisso P, D'Errico A, Simon N, Grigioni W, Alberti A, Beaugrand M, Pisi E, Christian Brechot, Paterlini P. HCV
295
130. 131.
132.
133.
134.
296
associated liver cancer without cirrhosis. Lancet 1995;345:413-415. Morris JD, Eddleston AL, Crook T. Viral infection and Cancer. Lancet 1995;346:754-758. Gorevic PD, Frangione B. Mixed cryoglobulinemia cross- reactive idiotypes: implication for relationship of MC to rheumatic and lymphoproliferative diseases. SeminHematol 1991;28:79-94. Ferri C, Monti M, La Civita L et al. Hepatitis C virus infection in non-Hodgkin's B-cell lymphoma complicating mixed cryoglobulinemia. Euro. J. Clin. Inves. 1994;24:781-784. Mishiro S, Takeda K, Hoshi Y, Yoshikawa A, Gotanda T, Itoh Y. An auto-antibody cross-reactive to hepatitis C-virus core and a host nuclear antigen. Autoimmunity 1991;10:269-273. Ellis M, Rathaus M, Amiel A, Manor Y, Klein A, Lishner M. Monoclonal lymphocytic proliferation and bcl-2 rearrangement in essential mixed cryoglobulinemia. Europ. J. Clin. Invest 1995;25:833837.
135.
136.
137.
138.
Lau JYN, Xie X, Lai MMC, WU PC. Apoptosis and viral hepatitis. Seminars in liver disease 1998;18:169-176. Zignego AL, Giannelli F, Giannini C et al. Bcl2 rearrangement in mixed cryoglobulinemia and HCV-related chronic disease. Abstracts of the International Meeting of hepatitis C virus and related viruses. Molecular virology and pathogenesis, Venezia,June 1998:169. Ishido S, Fujita T, Hotta H. Complex formation of hepatitis C virus NS3 protein with the P53 tumor suppressor protein. Abstracts of the International Meeting of hepatitis C virus and related viruses. Molecular virology and pathogenesis, Venezia 1998:090 Chen SY, Kao CF, Chen JY, Lee YHWL. Direct association of the hepatitis C virus core protein with tumor suppressor P53 modulates the transcriptional activity of P53. Abstracts of the International Meeting of hepatitis C virus and related viruses. Molecular virology and pathogenesis, Venezia 1998:104.
(c) 2000 Elsevier Science B.V. All rights reserved. Cancer and Autoimmunity Y. Shoenfeld and M. E. Gershwin, editors
The Human Neurotropic Virus, JCV, and Its Association with CNS Tumors Kamel Khalili, Luis Del Valle, Barbara Krynska, Jennifer Gordon, Jessica Otte and Sidney Croul Center for NeuroVirology and NeuroOncology, MCP Hahnemann University, Philadelphia, USA
1. SUMMARY The human polyomavirus JCV shows significant neurotropism to cells from the central nervous system (CNS) and productively infects human oligodendrocytes, the myelin-producing cells of the brain. Like other polyomaviruses, this virus can cause tumors when intracerebrally inoculated at high titer into developing rodents. JCV is the only polyomavirus to cause brain tumors in nonhuman primates. Tumorigenecity is most likely induced by the viral early gene product, T-antigen, as is demonstrated by the occurrence of tumors in T-antigen transgenic animals. T-antigen may well interact with p53 and the pRb family of proteins, and resulting in the stimulation of S-phase specific genes via E2F-L The possibility that JCV may be involved in human brain tumors has been raised both by the occurrences of these tumors coincident with productive JCV infection of the brain leading to the demyelinating disease Progressive Multifocal Leukoencephalopathy. The recent findings of both JCV DNA and T-antigen in human brain tumor samples points to a strong association of JCV with some forms of human brain tumors, namely meduUoblastoma. Similar to other polyomaviruses, the JCV genome consists of a closed, circular, supercoiled DNA molecule that is 5130 nucleotides in size [1]. The DNA of the virus can be divided into three functional domains: a viral early region encoding the tumor antigens, large and small T-antigens, which are expressed throughout viral infection [2]; a viral late region which encodes the three major capsid proteins, VPl, VP2 and VP3 during the late phase of the lytic cycle; and a noncod-
ing regulatory region located between the early and late regions which encompasses several transcription regulatory modules and the viral origin of DNA rephcation (Fig. 1). Viral proteins are encoded on both DNA strands and are transcribed divergently from the central promoter region. Large and small T-antigens are produced by alternative splicing of a single transcript from the early region which share a common amino terminus. An additional open reading frame located in the leader of the early RNA with the capacity to produce a small peptide termed JELP (JCV early leader protein) is thought to be expressed from the early region. VPl is encoded by the 3^end of the late region, while VP2 and VP3 are translated from a common mRNA at the 5^end of the late region. Transcripts from the late promoter encode a polypeptide of 71 amino acids contained within the S^region of the late transcripts termed agnoprotein. The viral regulatory region of the prototype Mad-1 strain of JCV consists of two exact 98-base pair (bp) repeats which contain cis elements required for expression of viral genes [3]. This region also contains an origin of viral DNA replication located to the early side of the 98-bp repeats. A TATA box has been identified within each 98-bp repeat. Subsequent viral isolates have shown that the regulatory region is heterogeneous in different strains, and several isolates do not contain exact 98-bp repeats [4]. The lytic cycle of JCV in primary human fetal glial cells begins with the synthesis of RNAs initiated from the early side of the viral genome during early post-infection and prior to DNA replication. DNA replication occurs by day 5 post-infection and continues for more than 15 days. At day 5, the synthesis of
297
Figure 1. Genomic structure of the human polyomavirus, JCV. Schematic representation of the JC virus genome depicting coding regions for the early genes, large and small T-antigens (gray) and the late genes, capsid proteins VPl, VP2, VP3 and the agnoprotein (black). The coding regions are separated by a bi-directional promoter containing the 98 base pair sequence elements and the origin of viral DNA replication.
late RNAs initiates and continues for 10-15 days [5]. The lytic cycle of JCV, like that of other papovaviruses such as SV40, depends on the presence of a functional T-antigen, which through binding to the multiple DNA binding sites near the origin of DNA replication: (i) mediates down regulation of the level of early gene expression through a repressor-like function; (ii) stimulates the initiation of viral DNA replication; and (iii) both directly and indirecdy activates the late transcriptional processes. The role of JCV T-antigen in stimulating viral DNA replication has been directly investigated; however, its function in autoregulation of the early promoter remains to be established. Recendy, we have shown that the interplay between the viral early protein, T-antigen, and the cellular proteins, Purof and YB-1, may determine the level of viral early and late promoter activity [6,7]. Furthermore, we have demonstrated that overexpression of Puro? in glial cells down-regulates replication of JCV DNA [8]. In vivo studies have indicated that human oligodendrocytes are the only cells that are productively infected by JCV [9]. Although human cells from em-
298
bryonic lung, intestine, liver and testis do not support JCV replication, previous studies have demonstrated that JCV DNA can replicate in any primate cell type, provided that JCV or SV40 large T-antigen is endogenously produced in those cells [10]. However, replication of JCV DNA in primate cells requires prior expression of JCV large T-antigen which appears to be regulated at the transcriptional level [11, 12]. The host-range restriction of JCV at the early stage of infection can be determined on at least two levels: (1) tissue-specific transcriptional regulation of viral RNA synthesis; and (2) species-specific replication of the viral DNA. Whether or not there are additional restrictions in the viral life-cycle that contribute to the cell-type specificity of the virus is unclear. Although the involvement of the initial stages, i.e. adsorption, penetradon and uncoating, do not exhibit tissue specificity, restriction in later stages such as viral late gene transcription and capsid protein synthesis have yet to be investigated. Although the precise mechanism responsible for the restricted transcriptional activity of JCV to glial cells has not been well identified, studies from several laboratories including our laboratory, have indicated that the JCV control region has an enhancer function that is glial cell-specific [3, 11-13]. This property of host-cell specificity of an enhancer apparendy plays a key role in determining the hostrange of JCV and may also be a critical factor in determining the disease potential of this virus [14]. The initial observations that polyomaviruses had tumorigenic potential came from experiments in which the viruses were inoculated into animal species unrelated to the natural hosts. In the case of JCV, hamsters inoculated intracerebrally, intraocularly, intraperitoneally, or subcutaneously with the Mad-1 strain of JCV developed neuroectodermal tumors (Fig. 2). Many of these appear to derive from neuronal elements (meduUoblastomas, pineocytomas and neuroblastomas) while other (glioblastomas) are probably glial in origin [15-17]. Similarly, nude mice injected intracerebrally with JCV develop primitive neuroectodermal tumors [Gordon et al., unpublished observations]. JCV represents the only polyomavirus that induces tumors in nonhuman primates [18]. As is the case in rodents, intracerebral inoculadon of JCV in owl and squirrel monkeys results in malignant tumors with both neuronal and gUal components [19, 20]. Control animals inoculated with SV40 or human papovavirus BKV were seropositive for viral antigen, but
did not develop tumors. Like Mad-1, other strains of JCV exhibit a high incidence of tumor development. Evidently, Mad-4 virus predominantly caused tumors of pineal gland origin [21], whereas a strain isolated in Tokyo produced cerebellar medullablastomas in hamster and undifferentiated neuroectodermal tumors in cerebra of rats [22]. There are certain obvious limitations to these rodent inoculation models in understanding the pathogenic mechanism through which this virus might act in humans. Since JCV does not replicate efficiently in rodents, tissue tropism, the pattern of JCV dissemination in the animal, and the molecular pathways surrounding replication are different from humans. Although the injection of high titers of virus, often directly into the CNS, circumvents many barriers, it clearly does not provide a true parallel to the viral life-cycle in humans. Some of these limitations have been circumvented by investigating the ability of JCV or its gene products to transform cells in culture, as both human and hamster glial cells can be transformed with JCV T-antigen [21, 23]. As shown in Fig. 3, JCV T-antigen transformed hamster cells can generate tumors when injected subcutaneously in nude mice. Since polyomaviruses induce tumors most readily in nonpermissive cells, it has been assumed that the transformation is dependent upon expression of polyoma early gene product accumulation of tumor antigen past a certain threshold level sufficient to alter the normal cell cycle. Thus, it is not surprising that normal cells transformed by JCV in culture express T-antigen. Similarly, cells taken from JCV owl monkey gliomas also express T-antigen in vitro [24, 25], and following explanation into the nude mouse flank [Gordon, unpublished observations]. Other limitations of the direct viral inoculation model have been overcome by creating transgenic mice that constitutively produce T-antigen. When Tantigen is produced under the control of the Mad-1 early promoter/enhancer, mice develop adrenal neuroblastomas and neuroectodermal origin tumors [26, 27]. Mice that express T-antigen under the control of the archetype (98 bp without repeats) promoter/enhancer [4] developed purely CNS neuronal tumors resembling medulloblastomas, one of the most common maUgnancies of childhood [28]. These results suggest that JCV T-antigen is directly associated with tumorigenesis in these animal models. They also suggest that promoter/enhancer elements may exert tissue-specific transcriptional control on viral RNA
synthesis thereby determining the cell types that develop pathology in vivo. There are numerous reports linking polyomaviruses (JCV, BKV, SV40) with human tumors. It is of interest that all these viruses have been associated with brain tumors, emphasizing their neurotropism. In order to establish this association, one must reliably detect the virus in the tumor under study and show that its presence is not incidental to the pathologic process. In the setting of lytic JCV infection of human oligodendrocytes, primary CNS tumors have been documented on several occasions (for a review see [29]). There have been several documented cases of patients with central nervous system neoplasms and concomitant progressive multifocal leukoencephalopathy (PML). The first of these, reported in 1961 [30] was a 58 year-old man with chronic lymphocytic leukemia who at autopsy was found to have PML and an incidental oligodendroglioma. In another neoplasm, discovered at autopsy in the brain of a patient with PML, electron microscopy revealed polyomavirus in one tumor cell [31]. In a case of PML in a patient with concomitant gliomas, JCV was detected using immunofluorescence, hemagglutination and electron microscopy [32]. A case of atypical PML and primary cerebral malignant lymphoma was reported by GiaRusso and Koeppen [33]. In that patient, no intranuclear inclusions were present, nor was virus detectable by immunofluorescence or electron microscopy. Since PML generally occurs in immunosuppressed individuals, its has seemed logical to document the presence of JCV DNA in the immunosuppressed population which is PML-free. Thus, using PCR, JCV DNA has been found in more than 30% of CNS tissue and peripheral blood lymphocytes of HIV-1 positive individuals with PML [34, 35]. In normal individuals, similar techniques have detected JCV DNA in CNS samples, urine and peripheral blood lymphocytes [36-39]. Two recent studies have also detected JCV in primary human CNS tumors. In one, nested PCR revealed genome sequences of the LTR and VPl regions of JCV in a pleomorphic xanthroastrocytoma from a 9-year-old that were not found in the patient's peripheral blood [40]. Sequence analysis showed a mutated region most consistent with the Mad-4 variant which has previously demonstrated oncogenic potential in animal models. Another report [41] describes an immunocompetent individual with an oligoastrocy-
299
Figure 2. Intracerebral inoculation of JC virus in newborn Golden Syrian hamsters induces neural origin tumors. Eighty percent of newborn hamsters inoculated with JC virus succumb to neural origin neoplasms. The most prevalent, medulloblastoma, appears as a highly cellular, poorly differentiated tumor with evidence of high mitotic activity. Note the presence of neuroblastic (Homer Wright) rosettes. Original magnification, x400.
toma. This tumor was also PCR positive for the Mad-4 strain of JCV. Primer extension studies showed synthesis of early RNA for T-antigen, while T-antigen protein was demonstrated by Western blot analysis and within tumor cells by immunocytochemistry. Drawing from the tendency of JCV to produce primitive neuronal tumors in animal models and the above associations of the virus with primary human CNS neoplasms, we have recently analyzed a retrospective series of human medulloblastomas for JCV DNA and T-antigen expression. Using formalin-fixed paraffin embedded surgical material, genomic DNA was isolated. PCR was performed with primers to amplify the N- and C-terminal regions of T-antigen and products were analyzed via Southern blot hybridizations with JCV-specific radiolabeled probes. Immunohistochemistry was also performed on 16 of the tumors with a monoclonal antibody to T-antigen. Age-matched autopsy cerebellar tissue was used for
300
both PCR and immunohistochemical negative controls. Analysis of the PCR products demonstrated JCV-specific sequences in a majority of the specimens. T-antigen positive nuclei were found in several of the specimens tested with specific nuclear localization. Since the data from this study show both JCV DNA and T-antigen protein in a significant proportion of human medulloblastomas, they argue for a strong association of this polyomavirus with one of the most frequent malignancies in childhood. The large T-antigen of JCV is comprised of 688 amino acids with 70% homology with the wellcharacterized SV40 large T-antigen. The structural composition of SV40 large T-antigen encompassing various functional domains and the conserved regions between SV40 and JCV T-antigen are shown in Fig. 4. Note that the most highly conserved domain among all polyomavirus T-antigens is the ATPase domain, which partially overlaps with the region important
Figure 3. JCV T-antigen transformed cells form tumors when injected subcutaneously into the flanks of Nude mice. (A) HJC-15 cells injected subcutaneously form large palpable masses within 2-3 weeks. (B) Histological evaluation of the excised tumors reveals poorly differentiated neural-origin tumors. Original magnification, x400.
301
helicase
Figure 4. Structural and functional domains of the JC viral regulatory oncoprotein, T-antigen. Domains represented include the nuclear localization signal (NLS), and regions responsible for DNA binding, polymerase (pol), helicase, ATPase activity and host range specificity. The black boxes depict the regions of the protein which are responsible for binding to the cellular factors, p53 and pRb.
for complex formation with the cellular tumor suppressor protein, p53. Despite sequence conservation in the regions encompassing p53 binding sites, the interaction between p53 and JCV T-antigen has not been completely established. In earlier studies, analysis of proteins from owl monkey brain tumors induced by intracranial inoculation of JCV, or proteins from JCV-infected human fetal glial cells, revealed nuclear expression of JCV T-antigen which was not associated with the host cell p53 protein [24, 42]. However, later studies have demonstrated complex formation between p53 and the early protein of JCV in owl monkey glioblastoma. These tumors were generated by intracranial inoculation of a juvenile owl monkey with a cell suspension of an explanted JCV-induced owl monkey glioblastoma [25]. The T-antigen protein synthesized by this virus reacted with several monoclonal antibodies which differentially detect T-antigens of SV40 and the other strains of JCV (Mad-1). Immunoprecipitation of T-antigen from JCV-transformed primary hamster brain cells showed an association of cellular proteins (50 to 56 kDa), which may represent cellular p53 protein. These discrepancies may stem from heterogeneities within the regions of T-antigen important for its interaction with p53. Additionally, JCV T-antigen potentially interacts with the cellular tumor suppressor proteins pRb and its related family, including pl07, pl30 and p300 and perhaps, upon inactivation of these proteins, mediates its transforming and tumorigenic activities. It is postulated that JCV T-antigen may mediate its transforming potential through its interaction with the cellular tumor suppressor proteins, p53, pl07, pl30/Rb2, p300 and the retinoblastoma gene product, pRb. In support of this hypothesis, results from co-immunoprecipitation assays have revealed the association of JCV T-antigen with p53 [43, 44], pl07
302
[45] and pRb [46]. The critical question is whether, or not, the expression of T-antigen functionally blocks the inhibitory effects of these proteins in normal cells, leading to the oncogenic transformation of glial cells. As well, the question remains as to whether expression and/or biological activities of cell-cycle regulators, including cyclins and their inhibitors, which are important for activation/inactivation of the pRb family, alter transformation and the course of initiation and progression of brain tumors in an in vivo whole animal system. A large number of studies during the past 5 years have shown that several oncoproteins from DNA tumor viruses, by sequestering pRb, disrupt the normal interaction of this protein with its cellular partners, including the transcription factor, E2F [47-50]. E2F was initially identified as a cellular protein whose ability to bind DNA was stimulated upon adenovirus infection [51]. Functional E2F binding sites, with the consensus sequence, 5^TTTSSCGC-3^(S = C or G), have been identified in promoters of several cellular genes, including E2F-1 itself, dihydrofolate reductase (DHFR), c-myc, cdc2, thymidine kinase (tk), cyclin Dl, c-myb, ribonucleotide reductase and DNA polymerase-of (for reviews, see [52, 53]). Furthermore, E2F binding sites have been shown to be necessary and sufficient for proper temporal expression [54, 55]. In the JCV hamster gUoma cell fine, HJC-15, T-antigen expression leads to high levels of p53 and E2F-1, possibly through similar mechanisms (Fig. 5). E2F itself appears to be a multicomponent transcription factor whose ability to bind DNA increases upon association with DP proteins [56]. A number of cDNA clones have recently been isolated that encode distinct members of the E2F family [57-60]. These various proteins bind to the same consensus E2F sites, but differ in their interaction with various cellular proteins, and in their cell-cycle profile. An interesting aspect of E2F function is that its expression in nontransformed cells in culture is cellcycle regulated, as it rises from undetectable levels during quiescence to very high levels prior to the onset of DNA synthesis in cell culture systems [61, 62]. Of interest, it has been reported that E2F1 expression is very high in adult brain [63] in which there typically are low levels of proliferating cells. It appears that other members of the E2F family (E2F2, E2F3 and DPI) are not expressed in brain [57, 59, 64]. One pos-
^ m
*i^ # ^ S
f •^*••%•/W*•
#f"
#
jite
••
Irli
^
•
4>
*
• •
r c
I Ik
^
Figure 5. Immunocytochemical staining of HJC-15 cells for viral T-antigen and the cellular factors, p53 and E2F-L Immunostaining of the JCV T-antigen transformed cell line, HJC-15, for the viral T-antigen (Panel A), and cellular proteins p53 and E2F-1 (panels B and C, respectively) demonstrate prominent nuclear localization. Original magnification, x400 (A and C) or x200 (B).
303
sibility is that E2F1, as opposed to other characterized members of the E2F family, is responsible for regulating expression of brain specific genes. This might occur through dimerization with brain specific helixloop-helix proteins, including neuro-D [65]. In this regard, earlier studies have indicated that E2F1 regulates expression of genes needed for control of contact inhibition of growth as well as for control of cell shape and adherence to the substratum [66]. Also, it has been found that E2F1 regulates movement through the GO/Gl phase of the cell cycle when overexpressed in NIH3T3 fibroblasts [66]. Constitutive expression of E2F1 in these nontransformed fibroblasts causes them to move prematurely into S phase from GO/Gl during serum starvation [66, 67]. Thus, while E2F1 regulates transcription of genes needed for exit from GO/Gl and entry into S phase, it may also be involved in the regulation of transcription of tissue-specific genes. Taken together, these data indicate that E2F1 is likely to be a multifunctional transcription factor, regulating expression of different genes depending on the specific tissue or cell-type analyzed. As mentioned above, the state of phosphorylation of pRb, presumably by various Gl-associated cyclins, cyclin D and cyclin E, and their associated kinases, cdk4,6 and cdk2, respectively, affects its ability to bind to and regulate E2F activity. Thus, the control of E2F activity may be an event that takes place downstream from the action of cdk's in the Gl phase. It has been demonstrated that transforming growth factor ^ [TGF^], a family of proteins with complex and sometimes opposing activities in various cell types [68, 69] inhibits cell-cycle progression in mid- to late-Gl phase. It appears that TGF^ exerts its activity by inactivating cyclin D:cdk4,6 and cyclin E:cdk2 complexes which are believed to be important for phosphorylation of pRb. Phosphorylation of pRb liberates E2F from the pRb:E2F complex, allowing E2F to activate genes important for progressing cells into S phase. Therefore, TGF^, by maintaining pRb in the underphosphorylated form, encourages formation of pRb:E2F complexes. To exert its activity, TGF^ generates signals which induce the production/activation of pi5, a cdk inhibitor, which in turn displaces and replaces another cdk inhibitor, p27, from its complexes with cyclin D:cdk4 and cyclin D:cdk6. The free p27, by forming complexes with cyclinE:cdk2 inhibits its action. Moreover, recent observations have demonstrated that treatment of epithelial cells with
304
TGF^ leads to a dramatic decrease in the level of E2F1 transcription in the cells, and overexpression of E2F1 in the cells can overcome TGFyS-mediated growth suppression [70]. Conversely, in mouse fibroblasts, addition of TGF^S to the culture media induced E2F transcriptional activity [71]. These two observations suggest that TGFyS possesses a unique ability to differentially regulate expression of E2F in various cell types. Results from our laboratory have demonstrated that in T-antigen producing oligodendrocytic cells, the TGF^ promoter is more responsive to E2F1 activity, and that overexpression of E2F1 under these conditions elevates the endogenous level of TGFyS RNA. Of particular interest is the notion that overexpression of E2F1 in oligodendrocytic cells reproducibly results in the appearance of a novel TGF^-related transcript of 1.8 kb in size in Northern blot assay. From these studies, it appears that under certain conditions, TGF^ and E2F regulate each others' expression, as well as expression of other related genes, which may play an important roles in determining the rate of cell proliferation in normal and malignant states. In this respect one may envision a scenario whereby the interplay between the JCV early protein, and p53 and pRb perturbs the regulatory function of these two tumor suppressors in brain cells. For example, the association of T-antigen with p53 may inhibit the ability of p53 to enhance expression of cellular genes including p21WAF-l. p21WAF-l is an inhibitor of the cyclin and cyclin-dependent kinase complexes. These complexes can prevent cell progression from Gl into S phase by phosphorylating pRb. The result of pRb phosphorylation, as mentioned earlier, is freedom of E2F-1, a transcription factor which can stimulate S-phase specific genes. Indeed, liberation of E2F-1 from pRb:E2F-l can also be accomplished upon direct association of T-antigen with pRb. Thus, JCV T-antigen direcdy by associating with pRb, and indirectly through p21WAF-l, enhance Gl to S phase entry of the cells and causes brain tumor formation.
REFERENCES 1. 2.
Frisque RJ, Bream GL, Cannella MT. Human polyomavirus JC virus genome. J Virol 1984;51:458-469. Tooze, J. DNA Tumor Viruses, 2nd edn. New York: Cold Spring Harbor Laboratory, 1981.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
Kenney S, Natarajan V, Strika V, Khoury G, Salzman NP. JC virus enhancer-promoter active in human brain cells. Science 1984;226:1337-1339. Martin JD, King DM, Slauch M, Frisque RJ. Differences in regulatory sequences of naturally occurring JC virus variants. J Virol 1985;53:306-311. Khalili K, Feigenbaum L, Khoury G. Evidence for a shift in 5'termini of early viral RNA during the lytic cycle of JC virus. Virology 1987; 158:469-^72. Chen NN and Khalih K. Transcriptional regulation of human JC polyomavirus promoters by cellular proteins YB-1 and Pura in glial cells. J Virol 1995;69:5843-5848. Chen NN, Chang C-F, Gallia G, Kerr DA, Johnson EM, Krachmarov CP, Barr SM, Frisque RJ, Bollag B, Khalili, K. Cooperative action of cellular proteins YB-1 and Pura with the tumor antigen of the human JC polyomavirus determines their interaction with the viral lytic control element. Proc Natl Acad Sci USA 1995;92:1087-1091. Chang C-F, Chen NN, Muralidharan V, Zoltick P, Johnson EM, Khalili K. Evidence that DNA replication of human neurotropic JC virus DNA in glial cells is regulated by a sequence-specific single-stranded DNA-binding protein, Pura . J Virol 1996;70:41504156. Major EO, Ameniya K, Tornatore C, Houff S, Berger J. Pathogenesis and molecular biology of progressive multifocal leukeoencephalopaty, the JC virusinduced demyelinating disease of the human brain. Clin Microbiol Rev 1992;5:49-73. Finlay CA, Hinds PW, Levine AJ. The p53 protooncogene can act as a suppressor of transformation. Cell 1989;57:1083-1093. Ahmed S, Rappaport J, Tada H, Kerr D, Khalili K. A nuclear protein derived from brain cells stimulates transcription of the human neurotropic virus promoter, JCVE, in vitro. J Biol Chem 1990a;265:13899-13905. Ahmed S, Chowdhury M, Khalili K. Regulation of the human neurotropic virus promoter, JCVE: identification of a novel activator domain located upstream from the 98-bp enhancer region. Nucl Acids Res 1990b;18:7417-7423. Tada H, Lashgari M, Rappaport J, Khalili K. Cell type-specific expression of JC virus early promoter is determined by positive and negative regulation. J. Virol. 1989;63:463-466. Raj GV and Khalili K. Transcriptional regulation: lessons from the human neurotropic polyomavirus, JCV Virology 1995;213:283-291. Walker DL, Padgett BL, ZuRhein GM, Albert AE, Marsh RF. Human papovavirus (JC): induction of brain tumors in hamsters. Science 1973;181:674-676.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
ZuRhein GM. Studies of JC virus-induced nervous system tumors in the Syrian hamster: a review. In: Sever JL, Madden DM, eds., Polyomaviruses and Human Neurological Disease. New York: Alan R. Liss, 1983;205-221. ZuRhein GM and Varakis J. Perinatal induction of medulloblastomas in Syrian golden hamsters by a human polyoma virus (JC). Natl Cancer Inst Monogr 1979;51:205-208. Houff SA, London WT, ZuRhein GM, Padgett BL, Walker DL, Sever JL New world primates as a model for virus-induced astrocytomas in: Sever JL, Madden DM, eds., Polyomaviruses and Neurologic Disease. New York: Alan R. Liss, 1983;223-226. London WT, Houff SA, Madden DL, Fuccillo DA, Graven M, Wallen WC, Palmer AE, Sever JL, Padgett BL, Walker DL, ZuRhein GM, Ohashi T. Brain tumors in owl monkeys inoculated with a human polyomavirus (JC virus) Science 1978;201:1246-1249. McKeever P, Chronwall B, Houff S, Sever J, Kornblith P, Padgett B, Walker D, London WT. Glial and divergent cells in primate central nervous system tumors induced by JC virus isolated form human progressive multifocal leukoencephalopathy (PML) in: Sever JL, Madden DM, eds., Polyomaviruses and Human Neurological Disease. New York: Alan R. Liss, 1983;239-252. Padgett BL, Walker DL, ZuRhein GM, Varakis J. Differential neurooncogenecity of strains of JC virus, a human polyoma virus, in newborn Syrian hamsters. Cancer Res 1977;37:718-720. Ohsumi S, Motoi M, Ogawa K. Induction of undifferentiated tumors by JC virus in the cerebrum of rats. Acta Pathol 1986;36:815-825. Mandl D, Walker DL, Frisque RJ. Derivation and characterization of POJ cells, transformed human fetal glial cells that retain their permissivity for JC virus. J Virol 1987;61:755-763. Major EO, Mourrain P, Cummins C. JC virus induced owl monkey glioblastoma cells in culture: biolgoical properties associated with the viral early gene product. Virology 1984;136:359-367. Major EO, Vacante DA, Traub RG, London WT, Sever JL. Owl monkey astrocytoma cells in culture spontaneously produce infectious JC virus which demonstrates altered biological properties. J Virol 1987;61:1435-1441. Franks R, Rencic A, Gordon J, Zoltick P, Knobler R, Khalili K. Formation of undifferentiated mesenteric tumors in transgenic mice expressing human neurotropic polyomavirus early protein. Oncogene 1996;12:2573-2578. Small JA, Khoury G, Jay G, Howley PM, Scangos GA. Early regions of JC virus and BK virus induce
305
28.
29.
30. 31. 32.
33.
34.
35.
36.
37.
38.
39.
40.
306
distinct and tissue-specific tumors in transgenic mice. Proc Natl Acad Sci USA 1986;83:8288-8292. Krynska B, Otte J, Franks R, Khalili K, Croul S. Human ubiquitous JCV.CY T-antigen gene induces brain tumors in experimental animals. Oncogene 1999;18:39-46. Gallia G, Gordon J, Khalili K. Tumor pathogenesis of human neurotropic JC virus in the CNS. J Neurovirology 1998;4:175-181 Richardson ER Progressive multifocal leukoencephalopathy. New Engl J Med 1961;265:815-823. Davies JA, Hughes JT, Oppenheimer DR. Richardson's Disease. Quart J Med 1973;167:481-501. Castaigne P, Rondot P, Escourolle R, Ribadeau-Dumas J-L, Cathala F, Hauw J-J. Leucoencephalopathie multifocale progressive et "ghomes" multiples. Rev Neurol 1974;130:379-392. GiaRusso MH and Koeppen AH. Atypical progressive multifocal leukoencephalopathy and primary cerebral malignant lymphoma. J Neurol Sci 1978;35:391-398. Tomatore C, Berger JR, Houff SA, Curfman B, Meyers K, Winfield D, Major EO. Detection of JC virus DNA in peripheral lymphocytes from patients with and without progressive multifocal leukoencephalopathy. Ann Neurol 1992;31:454-462. Vago L, Cinque P, Sala E, Nebuloni M, Caldarelli R, Racca S, Ferrante P, Trabattoni GR, Costanzi G. JCVDNA and BKV DNA in the CNS tissue and CSF of AIDS patients and normal subjects. Study of 41 cases and review of the literature. J Acq Immune Defic Synd Human Retrovirol 1996;12:139-146. Azzi A, De Santis R, Leoncini F, Sterrantino G, Marino N, Mazzotta F, Laszlo D, Fanci R, Bosi A. Human polyomaviruses DNA detection in peripheral blood leukocytes from immunocompetent and immunocompromised individuals. J. Neurovirology 1996;2:411^16. Arthur RR, Dagostin S, Shah KV. Detection of BK virus and JC virus in urine and brain tissue by the polymerase chain reaction. J Chn Microbiol 1989;27:1174-1179. Dorries K, Vogel E, Gunther S, Czub S. Infection of human polyomaviruses JC and BK in peripheral blood leukocytes from immunocompetent individuals. Virology 1994;198:59-70. White III FA, Ishaq M, Stoner G, Frisque RJ. JC virus DNA is present in many human brain samples from patients without progressive multifocal leukoencephalopathy. J Virol 1992;66:5726-5734. Boldorini R, CaldarelH-Stefano R, Monga G, Zocchi M, Mediati M, Tosoni A, Ferrante F. PCR detection of JC virus DNA in the brain tissue of a 9 year old child with pleomorphic xanthoastrocytoma. J Neurovirology 1998;4:242-245.
41.
42.
43.
44.
45.
46.
47.
48.
49.
50.
51.
52.
53. 54.
55.
Rencic A, Gordon J, Otte J, Curtis M, Kovatich A, Zoltick P, Khalili K, Andrews D. Detection of JC virus DNA sequence and expression of the viral oncoprotein, tumor antigen, in brain of immunocompetent patient with oligoastrocytoma. Proc Natl Acad Sci USA 1996;93:7352-7357. Major EO and Traub R. JC vims T protein during productive infection in human fetal brain and kidney cells. Virology 1986;148:221-225. Bollag B, Chuke WF, Frisque, R.J. Hybrid genomes of the polyomaviruses JC virus, BK vims, and simian vims 40: Identification of sequences important for efficient transformation. J Virol 1989;63:863-872. Haggerty S, Walker DL, Frisque RJ. JC vims and simian vims 40 genomes containing heterologous regulatory signals and chimeric early regions: Identification of regions restricting transformation by JC virus. J Virol 1989;63:2180-2190. Dyson N, Buchkovich K, Whyte P, Harlow E. The cellular 107K protein that binds to adenovims El A also associates with the large T antigens of SV40 and JC vims. Cell 1989;58:249-255. Dyson N, Bernards R, Friend SH, Gooding LR, Hassell JA, Major EO, Pipas JM, Van Dyke T, Harlow E. Large T antigens of many polyoma vimses are able to form complexes with the retinoblastoma protein. J Virol 1990;64:1353-1356. Chellapan SP, Hiebert S, Mudryj M, Horowitz JM, Nevins JR. The E2F transcription factor is a cellular target for the RB protein. Cell 1991;65:1053-1061. Helin K, Harlow E, Fattaey AR. Inhibition of E2F-1 transactivation by direct binding of the reinoblastoma protein. Mol Cell Biol 1993;13:6501-6508. Hiebert SW, Chellapan SP, Horowitz JM, Nevins JR. The interaction of pRb with E2F inhibits the transcriptional activity of E2R Genes Dev 1992;6:177-185. Weintraub SJ, Pater CA, Dean DC. Retinoblastoma protein switches the E2F site from positive to negative element. Nature 1992;358:259-261. Raychaudhuri P, Rooney R, Nevins JR. Identification of an ElA-inducible cellular factor that interacts with regulatory sequences within the adenovims E4 promoter. EMBO J 1987;6:4073^081. Farnham PJ, Slansky JE, Kollmar R. The role of E2F in the mammalian cell cycle. Biochima and Biphysica Acta 1993;1155:125-131. Nevins JR. Cell cycle targets of the DNA tumor vimses. Curr Op Genet Dev 1994;4:130-134. Neuman E, Flemington EK, Sellers WR, Kaelin WG. Transcription of the E2F-1 gene is rendered cell cycle dependent by E2F DNA-binding sites within its promoter. Mol Cell Biol 1994;14:6607-6615. Slansky JE, Li Y, Kaelin WG, Farnham PJ A protein synthesis-dependent increase in E2F-1 mRNA
56.
57.
58.
59.
60.
61.
62.
correlates with growth regulation of the dihydrofolate reductase promoter. Mol Cell Biol 1993; 13:16101618. LaThangue NB. DP and E2F proteins: components of a heterodimeric transcription factor implicated in cell cycle control. Curr Opin Cell Biol 1994;6:443^50. Ivey-Hoyle M, Conroy R, Ruber HE, Goodhart PJ, Oliff A, Heimbrook DC. Cloning and characterization of E2F-2, a novel protein with the biochemical properties of transcription factor E2F. Mol Cell Biol 1993;13:7802-7812. Krek W, Livingston DM, Shirodkar S. Binding to DNA and the retinoblastoma gene product is promoted by complex formation of different E2F family members. Science 1993;262:1557-1560. Lees JA, Saito M, Vidal M, Valentine M, Look T, Harlow E, Dyson N, Helin K. The retinoblastoma protein binds to a family of E2F transcription factors. Mol Cell Biol 1993;13:7813-7825. Sardet C, Vidal M, Cobrinik D, Geng Y, Onufryk C, Chen A, Weinberg RA. E2F-^ and E2F-5, two members of the E2F family, are expressed in the early phases of the cell cycle. Proc Natl Acad Sci USA 1995;92:2403-2407. Kaelin WG, Krek W, Sellers WR, DeCaprio JA, Ajchenbaum F, Fuchs CS, Chittenden T, Li Y, Earnham PJ, Blanar MA, Livingston DM, Flemington EK. Expression cloning of a cDNA encoding a retinoblastoma-binding protein with E2F-like properties. Celll992;70:351-364. Li Y, Slansky JE, Myers DJ, Drinkwater NR, Kaelin WG, Farnham PJ. Cloning, chromosomal location, and characterization of mouse E2F1. Mol Cell Biol 1994;14:1861-1869.
63.
64.
65.
66.
67.
68. 69.
70.
71.
Helin K, Lees JA, Vidal M, Dyson N, Harlow E, Fattaey A. A cDNA encoding a pRB-binding protein with properties of the transcription factor E2F. Cell 1992;70:337-350. Girling R, Partridge JF, Bandara LR, Burden N, Totty NF, Hsuan JJ, La Thangue NB. A new component of the transcription factor DRTF1/E2F. Nature 1993;362:83-87. Lee J, Hollenberg SM, Snider L, Turner DL, Lipnick N, Weintraub H. Conversion of xenopus ectoderm into neurons by NeuroD, a basic helix-loop-helix protein. Science 1995;268:836-839. Logan TJ, Jordan KL, Hall DJ. Altered shape and cell cycle characteristics of fibroblasts expressing the E2F1 transcription factor. Mol Cell Biol 1994;5:667678. Johnson DG, Schwarz JK, Cress WD, Nevins JR. Expression of transcription factor E2F1 induces quiescent cells to enter S phase. Nature 1993;365:349-352. Massague J. The transforming growth factor (family. Ann Rev Cell Biol 1990;6:597-641. Roberts AB and Sporn MB. Handbook of Experimental Pharmacology: Peptide Growth Factors and Their Receptors I, VOL. 95.NEW YORK: Springer-Verlag, 1990;419^72. Schwartz JK, Bassing CH, Kovesdi I, Datto M, Blazing M, George S, Wang X-F, Nevins JR. Expression of the E2F1 transcription factor overcomes type (transforming growth factor-mediated growth suppression. Proc Natl Acad Sci USA 1995;92:483^87. Kim T-A, Ravitz M, Wenner C. Transforming growth factor-(regulation of retinoblastoma gene product and E2F transcription factor during cell cycle progression in mouse fibroblasts. J Cell Phys 1994;160:1-9.
307
(c) 2000 Elsevier Science B.V All rights reserved. Cancer and Autoimmunity Y. Shoenfeld and M. E. Gershwin, editors
The Smoking Cancer—Autoimmunity Connection Jacob George and Yehuda Shoenfeld Research Unit of Autoimmune Diseases, Department of Medicine 'B \ Sheba Medical Center, Tel-Hashomer, 52621, Sackler Faculty of Medicine, Tel-Aviv University, Israel
1. INTRODUCTION The pathogenesis of autoimmune diseases is diverse encompassing genetic, hormonal, immunological and environmental factors [1]. Environmental factors include bacterial [2, 3], viral [3] parasitic infections [3, 4] on the one hand, and medication and chemical substances on the other. Demonstrative examples pertaining to the association between chemicals and autoimmunity include: (a) rapeseed oil incriminated in epidemic of scleroderma [5]; (b) silicone breast implants associated with increased production of autoantibodies [6], and clinical manifestation of autoimmune diseases [7]; and (c) exposure to ultraviolet radiation associating with the induction of SLE and its clinical exacerbations [8]. Several mechanisms have been proposed to account for the induction of autoimmune diseases by environmental factors. In this chapter, we discuss the relationship of smoking to the function of the immune system and the possible effects on the pathogenesis of autoimmunity.
2. THE INFLUENCE OF CIGARETTE SMOKE ON THE EFFECTORS OF THE IMMUNE SYSTEM Cigarette smoke has been, and is, a major risk factor for lung carcinoma, cardiovascular disease and chronic obstructive lung disease (reviewed in ref. [9]. Although, the entire spectrum of effects of cigarette smoking on the immune system are not fully realized,
it appears that smoking influences nearly any cellular component. Growing evidence implicates immune mechanisms in the breakdown of the normal pulmonary architecture in smokers, with the subsequent replacement of the alveolar cells by connective tissue. The number of neutrophils present in the bronchial lavage fluid of smokers was claimed to be increased by some [10, 11], whereas, others failed to detect quantitative differences between smokers and nonsmokers [12, 13]. Recruitment of neutrophils mediates local adhesion molecule expression [14] and therefore induces chemotaxis of inflammatory cells to the airway mucosa [15]. The effects of cigarette smoking is not limited to the number of the neutrophils or to their functional state but also to their physical properties. Accordingly, neutrophils have been shown to be sequestered in the lung capillaries [10, 16] due to reduced deformability [17, 18]. This effect is probably exerted by oxidants (aldehydes, epoxides, peroxides, HO2O2 and O^-) present in cigarette smoke and could be ameliorated by prior use of antioxidants [18,19]. Alveolar macrophages from cigarette smokers exhibit reduced responsiveness towards lipopolysacharide (LPS) [20]. This observation was attributed to an inhibited production of TNF-a and IL6 resulting in a hampered resistance towards foreign invading pathogens [20, 21]. Furthermore, cigarette smoking decreases the production of other cytokines such as IL-1 and IL-8 (observed only in some smokers) [21, 22], which are known to contribute to the pathogenesis of the inflammatory reaction. Polyphenol rich glycoprotein (termed TGP) is isolated from cured tobacco leaves and is present in cigarette smoke condensate [23]. This protein stim-
309
ulates the proliferation of peripheral T lymphocytes in murine models and in humans [24]. TGP (in contrast to the classical T-cell mitogens PHA and con-A that provoke significant proliferation of the T cells) activates only approximately 3% of the T cells and therefore exerts an antigenic rather than a mitogenic effect [24]. These effects of TGP, an inherent component of cigarette smoke may aid in understanding the link to autoimmunity which will later be explained. Specific subpopulation of T cells are increased in cigarette smokers. Thus, y8 T cells [25] are more common in bronchial the trees of smokers. They constitute a significant part of the inflammatory response in the bronchial glands of smokers and could represent an enhanced cellular response in these subjects. TGP also contributes to activation of factor XIIdependent pathways [26] (with the subsequent generation of active serine proteases), and inhibition of the classical pathway of complement activation by binding to the rate limiting protein C2 [27]. TGP has been shown to stimulate the proliferation of B cells from the LPS nonresponders C3H\HeJ mice [28] and to induce the differentiation of B cells into IgM, IgG and IgA secreting cells. The immune responses triggered following immunization with TGP in animals consists also of a predominant IgE response in mice [29], neonatal rabbits [30] and guinea pigs [31]. An IgE mediated "wheal and flare" response has also been demonstrated in human volunteers injected intradermally with TGP, suggesting effects of smoking on the humoral immune system.
3. CIGARETTE-SMOKING TRANSITION FROM IMMUNITY TO AUTOIMMUNITY The breakdown of immune surveillance is considered as the initiator of autoimmunity development. The exact mechanisms contributing to this process have not been defined, yet it appears that they are not limited to a single arm of the immune system. Polyclonal Tcell activation has been suggested to play an important role in occurrence of autoimmune disease [32]. Accordingly, cancer patients treated with high doses of IL-2, a T-cell stimulator, are more prone to the development of autoimmune thyroiditis or anti-red blood cell autoantibodies [33]. By analogy, thymectomized mice develop autoimmune disease following stimula-
310
tion with IL-2 [34]. The T-cell mitogenic properties of cigarette smoke could thus serve to enhance the production of IL-2 with the resultant tendency favoring the generation of an autoimmune state. An important mechanism thought to initiate autoimmunity is the polyclonal B-cell activation. It stems from in-vitro observations demonstrating production of rheumatoid factor and anti-DNA antibodies as well as an exacerbated clinical picture in autoimmunity-prone animals following stimulation with B-cell mitogens [32]. The evidence for B-cell mitogenicity of TGP [28] supports this concept. The observations presented above provide the rationale for the causal association between smoking in autoimmunity. Strengthening the laboratory data are clinical findings indicating that least three autoimmune conditions were already reported to be affected by smoking.
4. CLINICAL SUPPORT FOR THE SMOKING AUTOIMMUNITY RELATIONSHIP 4.1. Smoking and Rheumatoid Arthritis Rheumatoid arthritis (RA) is a chronic degenerative joint disease known to be of an autoimmune nature. Heliovaara et al. [35] investigate the association of cigarette smoking with the incidence of rheumatoid arthritis (either seropositive or seronegative) in a cohort of adult Finns. The study engaged 24,445 woman and 28,364 men, followed consecutively from 1966 to 1989. Five hundred and twelve subjects were found at some time to develop RA, 119 of whom were men and 229 were seropositive. A close association was found between smoking and seropositive RA. It was evident that the relative risk for developing seropositive RA was 2.6 in male ex-smokers and 3.8 in current smokers, compared to men who never smoked. In a recent paper by Silman et al. [36], the susceptibility to RA was evaluated by interview questionnaires on the smoking history among 71 monozygotic and 79 dizygotic twin-pairs discordant for RA. The authors found that a strong association existed between smoking history and the incidence of RA in monozygotic twin-pairs (odds ration 12.0, 95% confidence interval 1.78-513), most of whom were concordant for RA and discordant for smoking. Similar trend was obtained with dizygotic twin- pairs (odds ratio 2.5, 95% confi-
dence interval 0.92- 7.87). This study provided further support for the assumption that smoking predisposes individuals with similar genetic susceptibility to RA to develop a clinically overt disease. In an additional study conducted by Symmons et al. [37] in the UK, the authors sought to examine the clinical risk factors for the development of RA, employing a population-based case control patients aged 18-70 years old. The results indicated that smoking obesity and blood transfusions were important environmental triggers for RA. Data presented in an additional paper [38] provided further support for the association of smoking with RA. The authors performed clinical evaluation of 857 subjects and found that smokers with RA were 3.1 times more likely to exhibit rheumatoid factor seropositivity, and 2.4 more likely to have radiographic erosions. Although the association between smoking and RA can still not be explain it is possible that a nonspecific activation of the immune system (a state of polyclonal activation). Thus, IgM rheumatoid factor constitutes only a part of a heterogeneous set of antibodies generated by the immune system in response to cigarette smoking. This effect resembles "nonspecific" polyclonal activation induced following exposure to bacterial LPS. 4.2. Smoking and Goodpasture's Syndrome Goodpasture's syndrome is defined by the combination of hemoptysis and glomerulonephritis. This clinical picture is observed in 75% of the patients harboring antibodies to glomerular basement membrane (GBM) [39]. Anti-GBM antibodies are thought to be actively involved in the generation of pulmonary lesions due to the presence of linear deposits of IgG and complement in the alveolar septa of the affected lungs [39, 40]. The "Goodpasture's antigen" towards which antiGBM antibodies form has been found to reside in the a3 chain of type IV collagen [41]. The corresponding epitope has also been characterized and located within the globular noncollageneous (NCI) domain of the oi3 chain [42]. Recently, it was further sublocalized to the last 36 amino acid residues of its carboxyl terminus. Donaghy et al. [43] investigated the association of cigarette smoking with pulmonary hemorrhage in these patients. Among 51 patients examined, 43 had lung hemorrhage. Forty-seven patients were either
current or previous smokers, 37 smokers were found to suffer from subsequent pulmonary hemorrhage, compared to only 2 out of 11 nonsmokers. No significant difference was evident between the titers of circulating anti-GBM antibodies in smokers and nonsmokers. Moreover, in one patient, resumption of smoking was closely followed by reappearance of lung hemorrhage. It seems probable that pulmonary bleeding is enhanced by smoking regardless of the absolute titers of anti-GBM antibodies. It may be speculated that the mechanical damage precipitated by cigarette smoke results in exposure of the previously concealed antigen/s that could simultaneously induce the production of autoantibodies and allow for the binding of those already present in the circulation. Both effects could result in progression an immune mediated damage (by mechanisms such as complement activation) resulting in pulmonary hemorrhage.
4.3. Smoking and Autoimmune Thyroid Disease Ophthalmopathy occurs in 25-50% of the patients with Graves' disease and its disfiguring propreties may result in complete bUndness [44]. The pathogenesis of this yet unpreventable condition is uncertain to date. However, several points regarding its interplay with the immune system deserve emphasis. The involvement of the humoral immunity in Graves' ophthalmopathy has been recognized by the findings of antibodies to crude preparations of eye muscle and orbital connective tissue [45]. The autoantigen to which the antibodies bind has been characterized as a 64 kD extraocular muscle protein [46]. Evidence for the participation of cellular immunity in the pathogenesis of Graves' ophthalmopathy is the increased serum concentrations of soluble IL-2 receptors marking a T-cell activation [47]. Furthermore, endomysial fibroblasts found in the fatty connective tissue of the orbits express HLA-DR molecules (involved in antigen recognition by T cells) as well as intracellular adhesion molecules 1 (ICAM-1) [48]. The 72 kD heat shock protein is known to induce cellular proliferation and confer protection from stressful stimuli [49]. Indeed, its expression on the cell surface was detected in cultured orbital fibroblasts from patients with severe Graves' ophthalmoathy [50], however, since it is a stress protein it cannot be determined with certainty whether it represents a reaction
311
to the local pressure (i.e., an epiphenomenon) or plays a causal role. It has been proposed [51] that circulating T cells directed against an antigen on thyroid follicular cells, enter the orbit and interact with fibroblasts leading to the production of cytokines. The cytokines are thought to enhance the expression of immunoregulatory proteins such as the 72 kD heat shock protein, ICAM-1 and HLA-DR, to further maintain the ongoing autoimmune process. Additionally, several cytokines (i.e., TGF-^, IFN-y and insulin-like growth factor I) induce production of glycosaminoglycan leading to the emergence of the ophthalmopathy [51]. In this respect, it is interesting to mention the study by Prummel et al. [52] showing that antibodies to hsp-72 were increased both in the sera of Graves' disease patients and in smoking control subjects suggesting that the antibodies may be a marker for autoimmune susceptibility. The association between smoking. Graves' disease and endocrine ophthalmopathy has recently been examined in a case control study of newly diagnosed patients with Graves' disease [53]. Furthermore, a retrospective survey was carried out among 72 patients treated for Graves' disease and admitted due to endocrine ophthalmopathy. Although no effect of smoking on the thyroid hormone levels or the autoantibody titers could be observed, a positive correlation was evident, between smoking and the severity of the ophthalmopathy. The authors have shown that smoking was accompanied by an increased risk of Graves' disease and it enhanced the severity of the ocular manifestations in cases that subsequendy developed endocrine ophthalmopathy during the course of treatment. Hypothyroidism due to Hashimoto thyroiditis (HT) is also of clear autoimmune nature. In a retroscpective study by Fukata et al. [54], 387 women with Hashimoto's thyroiditis were evaluated for smoking history and thyroid functions. The prevalence of hypothyroidism in smokers with HT was 76.4%, whereas only 34.8% of the nonsmokers with HT were hypothyroid. The authors have also tested serum levels of thiocyanate (an antithyroid substance generated by smoking). They found that the highest serum levels of thiocyanate were in patients with HT who smoked and had hypothyroid suggesting that the increase of thiocyanate may contribute to the development of hypothyrodism in HT.
312
4.4. Cigarette Smoking and Cancer The immense impact of cigarette smoking on cancer is highlighted by the observation that 30% of all cancer deaths can be attributed to cigarette smoking. When observed collectively it appears that smokers are twice as likely to die in comparison to nonsmokers, whereas heavy smokers are 4 times more likely. The most important malignancies associated with smoking are within the lung. Over 80% of deaths caused by lung malignancies are directly attributed to smoking and the relative risk of death from lung cancer is 15 in smokers. There is a 22-fold increased risk of lung cancer in current male smokers, and a 12-fold increased risk in current female smokers. An important trend observed in recent years demonstrates an increase in the risk of lung cancer among women, suggesting an increase in the total smoking per years in women. All four types of lung cancer (squamous cell, small cell, large cell and adenocarcinomas) are increased due to cigarette smoking. A second malignancy strongly associated with smoking is the laryngeal carcinoma (10 times more common in male smokers in comparison with nonsmokers), also due to the direct contact with the carcinogenic elements in tobacco smoke. The spectrum of malignancies thought to be causally associated smoking is extending. Currently, it is considered that apart from lung cancer, malignancies of the larynx, hypopharynx, esophagus, bladder, renal pelvis, pancreas andstomach, renal body as well as myeloid leukemia are caused by smoking. Confounding data exists regarding the association between smoking and cancers of the colon and cervix. The strength of data supporting a causal role for smoking in the pathogenesis of cancer derives from the "dose response effect", namely, the increased risk for cancer with increasing exposure extent (total number of smoked cigarette) and time (duration of smoking). Moreover, cessation of smoking is associated with a reduction in the risk for cancer. The major tumorogenic factors found in cigarette smoke include the polyaromatic hydrocarbon subtractions contained in the particulate matter ("tar"). Cigarette tar exerts a dose-dependent effect on carcinogenesis. Whereas tar acts as an initiator of carcinogenesis, other components in cigarette smoke act as promoter that enhance the process. These factors include the
weekly acidic and neutral portions of tobacco smoke condensates. The maximal carcinongenic effect of tobacco smoke occurs in the tissues directly exposed, such as the airway lining epithelium, although additional remote organs are not spared. As an example of the remote cancerous effect, the 2-naphthylamine can be brought, that is concentrated in the urinary bladder and probably by direct exposure, increases the risk for transitional cell carcinoma. As mentioned above, cigarette smoke can exert the carcinongnic effect by a remote effect in the cases of kidney and bladder cancer. In this respect it is important to note that other chemicals (found in rubber, paint and leather) may act to synergize with smoking and increase the likelihood of contracting cancer. Recent data implies that cigarette smoking can also influence the occurrence of liver, gastrointestinal and prostatic cancers. In conclusion, cigarette smoking has been recognized as a major cause of malignancies of various origins. This effect is exemplified in the fact that the extent of exposure determines the magnitude of the risk for cancer. However, cessation of smoking, despite reducing the risk, cannot completely reverse the increased tendency to develop malignancies.
cryptic epitope (e.g., NCI), probably by cigarette smoke, activates the immune system to produce the anti-GBM antibodies and enhance their binding to the exposed autoantigen. This may, in turn, lead to the clinical manifestations of the syndrome. However, as mentioned earlier, the influence of smoking can act to promote both B- and T-cell polyclonal activation with the resultant production of co-stimulatory cytokines, which in turn can precipitate a state of autoimmunity. The findings presented above imply that measures to stop smoking should be taken not only because of the well- known effects of cigarette smoke on the cardiovascular system and cancer, but also because of the possible effects on the initiation and progression of autoimmune conditions.
REFERENCES 1.
2. 3.
4. 5. CONCLUDING REMARKS Autoimmune conditions are the result of a mosaic interplay of factors [1]. As such, it is suggested that the appearance of trigger mechanisms in individuals with "predisposing" immunologic, genetic and hormonal backgrounds may lead to the development of an overt autoimmune disease [1]. This chapter conveys the idea that smoking may be causally associated with the initiation of autoimmunity and its signatures (i.e., the respective autoantibodies). The mechanisms by which cigarette smoking contributes to autoimmunity are unresolved. It is, however, tempting to implicate other well characterized mechanisms such as "altered self to the above model [55]. Thus, a physical damage induced by smoke on certain tissues or native substances may no longer be recognized as self and lead to the production of autoantibodies and subsequently, a full blown autoimmune reaction. A demonstrative example to this theory is the Goodpasture's syndrome where exposure of a
5.
6.
7.
8.
9. 10.
11.
Shoenfeld Y, Isenberg DA. The Mosaic of Autoimmunity. The Factors Associated with Autoimmune Diseases, Chapter 4D. Amsterdam: Elsevier, 1989;135153. Shoenfeld Y, Isenberg DA. Mycobacteria and autoimmunity Immunol Today 1988;9:178-182. Shoenfeld Y, Cohen IR. Infection and autoimmunity. In: Sela M, ed., The Antigens. London: Academic Press, 1987;307-325. Wood JN, Hudson L, Jessel TM, et al. A monoclonal antibody defining antigenic determinants in subpopulations of mammalian neurons and Trypanosoma cruzi parasites. Nature 1982;296:34-38. Tabeunca JM. Toxic allergic syndrome caused by ingestion of rapeseed oil denatured with aniline. Lancet 1981;2:567-568. Bar Meir E, Teuber HC, Lin I, et al. Multiple autoantibodies in pafients with siHcone breast implants. J Autoimmunity 1995;8:267-277. Bridges AJC, Conley G, Wang DE, et al. A clinical and immunological evaluation of women with silicone breast implants. Ann Int Med 1993;118:929-936. Biesecker G, Lavin L, Ziskind M, et al. Cutaneous localization of the membrane attack complex in discoid and systemic lupus erythematosus. N Eng J Med 1982;306:264-270. Skurnik Y, Shoenfeld Y Health effects of cigarette smoking Clin in Dermatol 1998;16:545-556. Hunninghake GW, Crystal RG. Cigarette smoking and lung destrucfion. Am Rev Respir Dis 1983;128:833-838. Regius O, Rajczy K, Gergely I, et al. The effect of smoking on peripheral blood lymphocytes and
313
12.
13.
14.
15.
16.
17.
18.
19. 20.
21.
22.
23.
24.
25.
314
on some immunological parameters in old age. Z Gerontol 1990;23:163-167. Nagai S, Takeuchi M, Watanabe K, et al. Smoking and interleukin-1 activity released from human alveolar macrophages in healthy subjects. Chest 1988;94:694700. Skold CM, Hed J, Eklund A. Smoking cessation rapidly reduce cell recovery in bronchoalveolar lavage fluid, while alveolar lavage fluorescence remains high. Chest 1992;109:989-995. Holtzman MJ, Look KC. Cell adhesion molecules as targets for unraveling the genetic regulation of airway inflammation. Am J Resp Cell Mol Biol 1992;7:246247. Oppenheim J J, Zachariae COC, Mukaida N, et al. Properties of the novel proinflammatory supergene "intercrine" cytokine family. Ann Rev Immunol 1991;9:617-648. MacNee W, Wiggs B, Belzberg AS, et al. The effect of cigarette smoking on neutrophil kinetics in human lungs. N Eng J Med 1989;321:924-928. Drost EM, Selby C, Lannan S, et al. Changes in neutrophil deformability following in vitro smoke exposure; mechanism and protection. Am J Resp Cell Mol Biol 1992;6:287-95. Aoshiba K, Nagai A, Konno K. Nicotine prevents a reduction in neutrophil filterability induced by cigarette smoke exposure. Am J Resp Crit Med 1994;150:1101-1107. Bluhm AL, Weinstein J, Sousa JA. Free radicals in tobacco smoke. Nature 1971;229:500. Yamaguchi E, Itoh A, Fumy a K, et al. Release of tumor necrosis factor (from human alveolar macrophages is decreased in smokers. Chest 1993;103:479^83. Kimberly A, McCrea KA, Ensor JE, et al. Altered cytokine regulation in the lungs of cigarette smokers. Am J Resp Crit Care Med 1994;150:696-703. Brown GP, Iwamoto GK, Monick MM, et al. Cigarette smoking decreases interleukin-1 release by human alveolar macrophages. Am J Physiol 1989;256:C260C264. Becker CG, Dubin T, Wiedemann HP. Hypersensitivity to tobacco antigen. Proc Natl Acad Sci USA 1976;73:1712-1716. Francus T, Klein RF, Staiano-coico L, et al. Effects of tobacco smoke on the immune system. IL TGP stimulates the proliferation of human T cells and the differentiation of B cells into Ig secreting cells. J Immunol 1988;140:1823-1829. Richmond I, Pritchard GE, Ashcroft T, et al. Distribution of gamma delta T cells in the bronchial tree of smokers and non-smokers. J Clin Pathol 1993;46:926-930.
26. 27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
Becker CG. Dubin T. Activation of factor XII by tobacco glycoprotein. J Exp Med 1977;146:457-467. Firpo A, Policy MJ, Becker CG, et al. The effect of tobacco derived products on the human complement system. Immunobiology 1983;164:318-325. Choy JW, Becker CG, Siskind GW. Effects of tobacco glycoprotein (TGP) on the immune system. 1. TGP is a T independent B cell mitogen for murine lymphoid ceUs. J Immunol 1985;134:3193-3198. Francus T, Siskind CW, Becker CG. Role of antigen structure in the regulation of the IgE isotype expression. Proc Naltl Acad Sci USA 1983;80:3430-3434. Becker CG, Levi RL, Zavecs J. Induction of IgE to antigen isolated from tobacco leaves and from cigarette smoke condensate. Am J Pathol 1979:96:249254. Levi R, Zavecs JH, Burke JA, et al. Cardiac and pulmonary anaphylaxis in guinea pigs and rabbits induced by glycoproteins isolated from tobacco leaves and cigarette smoke condensate. Am J Pathol 1982;106:318-325. Schwartz RS. Autoimmunity and autoimmune diseases. In: Paul WE, ed.. Fundamental Immunology. New York: Raven Press, 1993;1033-1097. Sauter NP, Atkins MB, Mier JW, Lechan RM. Transient thyroitoxicosis and persistent hypothyroidism due to acute autoimmune thyroiditis after IL-2 and IFN therapy for metastatic carcinoma—a case report. Am J Med 1992;92:441-443 Andeu-Sanchez JL, Dealboran IM, Marcos MAR, et al. IL-2 abrogates the non responsive state of T cells expressing forbidden T-cell receptor repetoire and induces autoimmune disease in neonatally thymectomized mice. J Exp Med 1991;173:1323. Heliovaara M, Aho K, Aromaa A, et al. Smoking and the risk of rheumatoid arthritis. J Rheumatol 1993;20:1830-1835. Silman AJ, Newman J, MacGregor A. Cigarette smoking increases the risk of rheumatoid arthritis. Results from a nationwide study of disease discordant twins. Arthrit Rheumatol 1996;39:732-735 Symmons DP, Bankhead CR, Harrison BJ, Brennan P, Barrett EM, Scott DG, Silman AJ. Blood transfusion, smoking, and obesity as risk factors for the development of rheumatoid arthritis: results from a primary care-based incident case control study in Norfolk England. Arthrit Rheumatol 1997;40:1955-1961. Saag KG, Cerhan JR, Kolluri S, Ohashi K, Hunninghake GW, Schwartz DA. Cigarette smoking and rheumatoid arthritis severity. Ann Rheum Dis 1997;56:463-469. Bierne GJ, Wagnild HP, Zimmerman SW, et al. Idiopathic crescentic glomerulonephritis. Medicine 1979;56:349-381.
40.
41.
42.
43.
44.
45.
46.
47.
Koffler D, Sandson J, Carr R, et al. Immunologic studies concerning the pulmonary lesions in Goodpastue's syndrome. Am J Pathol 1969;54:293-300. Butkowski RJ, Langeveld JPM, Wieslander J, et al. Localization of the Goodpasture's epitope to a novel chain of basement membrane collagen. J Biol Chem 1987;262:7874-7877. Butkowski RJ, Shen G-Q, Wieslander J, et al. Characterization of type IV collagen NCI monomers and Goodpasture's antigen in human renal basement membranes. J Lab Chn Med 1990;115:365-373. Donaghy M, Rees AJ. Cigarette smoking and lung hemorrhage in glomerulonephritis caused by autoantibodies to glomerular basement membrane. Lancet 1983;2:1390-1393. Teng CS, Yeo PPB. Ophthalmic Graves' disease: natural history and detailed thyroid function studies. BMJ 1977;1:273-275. Atkinson S, Holcombe M, Kendall-Taylor P. Ophthalmopathic immunoglobulin in patients with Graves' ophthalmopathy. Lancet 1984;2:374-376. Miller A, Sikoorska H, Salvi M, et al. Evaluation of an enzyme linked immunoabsorbant assay for the measurement of antibodies against eye muscle membrane antigen in Graves' ophthalmopathy. Acta Endocrinol (Copenh) 1986;113:514-522. Prummel MF, Wiesinga WM, Van der Gaag R, et al. Soluble IL-2 receptor levels in patients with Graves' ophthalmopathy. Clin Exp Immunol 1992;88:405409.
48.
49. 50.
51. 52.
53.
54.
55.
Heufelder AE, Bahn RS. Elevated expression in situ of selectin and immunoglobulin superfamily type adhesion molecules in retroocular connective tissues of patients with Graves' ophthalmopathy. Clin Exp Immunol 1993;91:381-389. Lindquist S. The heat shock response. Ann Rev Biochem 1986;55:1151-1191. Heufelder AE, Wenzel BE, Gorman CA, Bahn RS. Detection, cellular localization and modulation of heat shock proteins in cultured fibroblasts from patients with extrathyroidal manifestation of Graves' disease. J CHn Endocrinol Metab 1991;73:739745. Bahn RS, Heufelder AE. Pathogenesis of Graves' ophthalmopathy. N Engl J Med 1993;329:1468-1475. Prummel MF, Van Pareren Y, Bakker O, Wiersinga WM. Anti-heat shock protein (hsp) 72 antibodies are present in patients with Graves' disease (GD) and in smoking control subjects. Clin Exp Immunol 1997;110:292-295. Winsa B, Mandahl A, Karlsson FA. Graves' disease, endocrine ophthalmopathy, and smoking. Acta Endocrinol 1993;128:156-160. Fukata S, Kuma K, Sugawara M. Relationship between cigarette smoking and hypothyrodism in patients with hashimoto's thyroiditis. J Endocrinol Invest 1996;19:607-612. George J, Levy Y, Shoenfeld Y Smoking and immunity; an additional factor in the mosaic of autoimmunity. Scand J Immunol 1997;45:1-6.
315
© 2000 Elsevier Science B.V All rights reserved. Cancer and Autoimmunity Y. Shoenfeld and M. E. Gershwin, editors
Significance and Regulation of the Expression of MHC class II Molecules on Autoimmune and Neoplastic Thyroid Cells Nitza Lahat, Ariel Miller and Michal A. Rabat Immunology Research Unit, Lady Davis Carmel Medical Center and Rappaport Faculty of Medicine, Technion, Haifa, Israel
1. INTRODUCTION—MHC CLASS II MOLECULES AND THEIR MODULATED EXPRESSION The major histocompatibility complex (MHC), or human leukocyte antigens (HLA) molecules, are membranal, heterodimeric glycoproteins, comprising of a and p polypeptide chains. MHC class II molecules consist of several isotypes (in humans HLA-DR, DP and DQ), which are encoded by a highly polymorphic gene cluster, and expressed as co-dominant alleles [1]. In humans the HLA class II cluster of genes is located on chromosome 6, and spans for at least 1000 kb. This region encodes HLA-DR, -DQ and -DP, and includes genes encoding the a and fi chains as well as pseudogenes. The Of chain is mostly invariant (with the exception of HLA-DQ), whereas the fi chains are highly polymorphic. MHC molecules enable the interaction between the T-cell receptor (TCR) and antigenic peptides, which are previously processed in the cell. Two distinct classes of MHC molecules have been characterized with respect to antigen presentation: class I molecules, which generally present endogenous antigens to cytotoxic T cells, and MHC class II molecules, which are responsible mainly for the presentation of exogenous antigens to helper T cells. Whereas, class I molecules are expressed on all nucleated cells, expression of MHC class II molecules is normally restricted to cells of the immune system, including B lymphocytes, dendritic and langerhans cells, monocytes, tissue macrophages and activated T cells. Nonimmune cells express MHC class II molecules only in abnormal situations, such as viral infection, autoimmune
diseases and malignancies. This expression is coordinated, i.e., HLA-DR, HLA-DQ, HLA-DP, as well as HLA-DM and invariant chain (li) are expressed coincidentally. Not only the genetic composition, but also changes in the amount of surface MHC class II molecules determine the type and magnitude of antigen presentation, and hence the consequences of the immune response [ 2 ^ ] . Therefore, their expression is very carefully regulated. Regulation of immune cells expression of MHC class II molecules differs by cell type. The expression of MHC class II molecules on B cells changes during their developmental stage: Pre-B cells do not express them, whereas basal expression on resting B cells is low and is increased upon activation [5]. Constitutive expression of MHC class II molecules on mature B cells can be modulated mainly by interleukin-(IL)4 [6], prostaglandins [7], glucocorticoids [8], and interferon-y (IFN-y) [9]. Finally, in plasma cells their expression is completely shut off [5, 10-12]. IFN-y is the most potent enhancer of MHC class II molecules on monocytes and macrophages, and a synergistic effect has been observed with tumor necrosis factor a (TNF-of) [13]. MHC class II expression on macrophages can be downregulated by cytokines such as transforming growth factor-^ (TGF-yS) and IL-4 [14]. Nonimmunological cells do not normally express MHC class II molecules. However, their appearance can be induced in vitro mainly by IFN-y, and synergistically with TNF-of, on a wide variety of nonimmunological cells, such as astrocytes, keratinocytes, melanocytes, fibroblasts, endothelial cells, intestinal
317
epithelial cells, and thyrocytes [15-19]. Expression of MHC class II molecules can be induced on tissue cells, including thyrocytes, during viral infection, independent of cytokine effects [20]. In vivo aberrant expression of MHC class II molecules has been observed on autoimmune and malignant tissue cells, including autoimmune and neoplastic thyrocytes.
2. THE ROLE OF MHC CLASS II MOLECULES IN ANTIGEN PRESENTATION Presentation of antigens to TCRs requires complexing of antigenic peptide fragments derived from processed antigen with either MHC class I or class II molecules [21]. Class I molecules are loaded in the endoplasmic reticulum with peptides that are usually derived from antigens synthesized within the cells and processed by the proteozome in the cytosol [22]. Exogenous fragments, processed by professional antigen presenting cells (APCs) arrive to the endozome and interact with MHC class II molecules [23, 24]. Nascent MHC class II molecules in the endoplastic reticulum are protected from binding to peptides due to their association with the invariant chain (li) [25]. Following fusion of MHC class Il-containing vesicles to endozome, the li chains are actively removed with the aid of the nonclassical HLA-DM [26], and MHC class II molecules can then associate with degraded antigenic peptides [27]. It has been suggested that li provide a mechanism, which prevents MHC class II molecules from binding and subsequently presenting endogenous selfpeptides, to CD4-I- T cells. However, despite defense mechanisms such as occupancy of MHC class II by the li, some self-peptides were found to be associated to MHC class II molecules. Thus, discrimination between self and nonself-peptides needs additional regulatory checkpoints for which T cells are probably responsible. Because of the MHC polymorphism, different combinations of peptide/MHC derived from identical proteins are available for T-cell recognition and their subsequent differential activation [4]. As this applies equally to self and foreign proteins, it is a likely explanation for the correlation between certain MHC alleles or haplotypes and predisposition to autoimmunity [28] and cancer [29]. The expression of CD4 generally restricts T-cell responses to peptides presented in the context of MHC
318
class II molecules, whereas CD8-I- T cells show class I restriction. The historical term "helper T cells", relating to T cells expressing CD4 still holds. It designates T cells displaying helper activity as evidenced by lymphokine secretion, which facilitates B-cell differentiation into antibody secreting plasma cells, and activates cytotoxic T cells and natural killer (NK) cells. Thus, recognition of the peptide by the TCR in the context of MHC class II molecule, and the following activation of CD4+ T cells, is dependent on the expression of MHC molecules on APCs, and is critical to the commencement of virtually all immune responses. However, this event has to be supported by an additional signal resulting in the binding of co-stimulatory molecules to their ligand. Necessary co-stimulatory molecules on APCs, such as CD80 (B7.1) CD86 (B7.2) and CD40 have already been characterized [3032]. Peripheral tolerance of T cells is thought to follow contact of antigenic peptide/MHC molecules, occurring in the absence of a second stimulatory signal, and resulting in the induction of anergic state. Absence, overexpression or skewing of co-stimulatory molecules have been connected to autoimmune and neoplastic diseases [33, 34], and naturally, they have become a target for experimental immunotherapy [35, 36]. Aberrant expression of MHC class II molecules, combined with expression of co-stimulatory molecules and defective li regulation in tissue cells, may lead to productive presentation of self antigens and harmful activation of normally paralyzed autoreactive T cells. On tumor cells, expression of MHC class II together with co-stimulatory molecules and reduction in li, may stimulate an effective tumor specific immune response. Attempts to erradicate tumor cells by transfecting them with MHC class II genes, MHC class II inducer genes, and genes encoding co-stimulatory molecules, or depletion of li genes are already under way [36-39].
3. MHC CLASS II EXPRESSION ON AUTOIMMUNE AND MALIGNANT THYROID CELLS 3.1. Regulatory Effects of IFN-y and TNF-a Many investigators have used the thyroid gland as a model for research of autoimmune processes. Autoimmune thyroid diseases are the archetype of organ
specific autoimmune disorders, and shares with them T-cell dependency as a common characteristic. Inappropriate MHC class II expression has been first observed on thyroid cells derived from patients with Graves' autoimmune thyroid disease [40], and lead to the hypothesis that such expression would result in antigen presentation of thyroid autoantigens to T cells, thereby starting an autoimmune response [41]. Expression of MHC class II molecules was found to be common also on malignant thyroid cells [42], and has been recently suggested to represent local antitumor response, which prevents metastatic spread of the malignant cells [43]. We and others have shown that T and inflammatory cell products, such as IFNy alone or synergistically with TNF-of, induced class II expression on normal and malignant thyrocyte cell lines derived from patients with thyroid carcinomas in a variety of in vivo and in vitro systems [19, 44-46]. In contrast, reduction of MHC class II by IFN-y and TNF-of was found in one tumor thyroid cell line, which constitutively expressed these molecules [19]. Although IFN-y was demonstrated to induce HLA-DR in both nonmalignant and malignant thyroid cells, different signal transduction pathways were shown to be utilized, since protein kinase C pathway had stimulatory effects in malignant thyroid cells, but inhibitory effects in normal thyroid cells [47]. 3.2. Relevance of T\imor Suppressor Proteins In addition, recent findings indicate, that tumor suppressor molecules such as retinoblastoma (Rb) and P53 may have a role in regulation of MHC class II antigens in thyroid tumor cells. Induction of MHC class II molecules required the expression of intact tumor suppressor proteins [48,49], but their absence or mutated forms have been suggested to diminish the expression of MHC class II antigens, and thereby reducing the activation of CD4+ cytotoxic T cells and their activity against tumor cells. 3.3. Immune and Nonimmune Mechanisms in MHC Class II Induction Migration of cytokine-secreting immune cells into the thyroid as a result of viral infection may occur, but viral infections can also induce MHC class II expression on thyrocytes independent of immune ac-
tivation. Reovirus, SV40 and cytomegalovirus have been demonstrated to induce MHC class II expression on cultured thyrocytes in the absence of T cells [5052]. A direct correlation between high expression of MHC class II and dense inflammatory infiltration has been observed in autoimmune thyroiditis, but not in most tumor specimen [53]. This suggests that MHC class II expressions on tumor cells, whether virally induced or caused by the neoplastic transformation, may, in many cases, be independent of immunological processes [54], whereas MHC class II expression in autoimmunity is always associated with triggering of immune response. Population studies have demonstrated that thyroid autoimmune diseases, mainly Graves and Hashimoto thyroiditis, are associated with specific MHC class II alleles [55-59]. Associations of MHC class II alleles with thyroid cancer were also observed [42, 48]. In both cases the efficiency with which certain MHC class II allotypes present autoantigens (including tumor antigens) may affect either failure or success to mount productive immune response, and thereby determine the fate of the patient. 3.4. Polymorphism of MHC and Non-MHC Allele Expression in Autoimmune and Malignant Thyroid Diseases We have found enhanced induction of MHC class II molecules by IFN-y and thyroid stimulating hormone (TSH) on thyroid cells derived from rats which were susceptible to autoimmune thyroiditis [44], compared to thyrocytes of nonsusceptible rats. The same phenomenon has been described in thyrocytes from Graves patients [60]. One possible molecular basis for higher inducibility has been provided, by the finding of allelic polymorphism in the promoter of HLA-DQy^ and HLA-DR^ [61, 62]. Such polymorphism may confer differences in expression, inducibility and even tissue specificity of MHC class II molecules. Whereas, hyperinducibility of MHC class II expression on thyroid cells have been suggested to be part of the overall susceptibility to autoimmune thyroid diseases, both high and low induced amounts of these molecules have been observed on malignant thyrocytes [63], but were not correlated to the type and severity of the tumor. Recent data point to non-MHC genes and proteins, that contribute to the susceptibility to thyroid autoimmunity in addition to MHC class II molecules
319
[64]. Potential synergy in conferring susceptibility to Graves' disease between specific alleles of HLA-DR and polymorphism in TSH-receptor codon 52 has been suggested [65].
tic transformation [73-75] may also serve as antigens. If correcdy presented in the context of MHC class II, all these molecules may serve as potential targets for immunotherapy in thyroid cancers.
3.5. Regulatory Effects of Specific Thyroid Associated Molecules
3.6. The Debated Significance of Thyrocytes as Antigen Presenting Cells
The receptor for thyroid stimulating hormone (TSHR), as well as thy roglobulin and thyroid peroxidase (TPO), have been recognized as potential autoantigens that may bind to MHC class II molecules, leading to autoimmunity. The relationship between MHC class II (HLA-DR being the most studied molecule) to these and other specific thyroid molecules, antibodies directed to them and therapeutic agents used in the treatment of thyroid autoimmunity are complex. Auto-antibodies to hormone receptors were found in autoimmune disease such as Graves' and Myastania Gravis, and a structural similarity between the hormone receptor and MHC class II genes was documented [66], suggesting co-regulation. Indeed it has been found, that anti-TSHR monoclonal antibodies induced expression of MHC class II and li proteins in the thyroid with intensity comparable to that of IFN-y, thus suggesting a new role for these autoantibodies in thyroid autoimmunity [66], phenothiazines [67], TSH, triiodothyronine (T3) and thyroxine (T4) [68], as well as methymazole (MMI) and iodide [69], have been found to be involved in the regulation of expression of MHC class II molecules. The therapeutic effectiveness of MMI and iodide has been correlated with their ability to reduce MHC class II [69], although TSH was shown to have both stimulatory [68,44] and inhibitory [47] influences on IFN-y-induced MHC class II expression. The simultaneous expression of TPO and HLA-DR on thyroid cells may be part of the autoimmune triggering. IFN-y has been found to reduce TPO content and to inhibit TSH-induced TPO in thyroid cells, in addition to its MHC class II enhancing effects [70]. From this point of view, this cytokine has both anti- and pro-autoimmune functions. In thyroid cancer the same differentiation antigens (thyroglobulin, TPO and TSHR), may also be presented to T cells in the context of MHC class II molecules, and thus direct the immune response against thyrocytes, to the benefit of the patient. Although in poorly differentiated thyroid carcinomas these antigens may be lost or altered [71, 72], other tumor antigens associated with the neoplas-
It has been hypothesized that intrathyroidal professional APCs acquire soluble thyroid antigens, which were shedded from live thyrocytes or spilled by dead cells. These antigens are processed inside the APCs, complexed with MHC class II molecules and presented to neighboring bypassing T cells [23, 24]. These cells following recognition of MHC/antigen complexes, secrete IFN-y which induce MHC class II on thyrocytes and cause presentation of autoantigens. As T-cell infiltration occurs before expression of thyrocyte MHC class II molecules, such expression is a secondary event or a consequence rather than a cause of the autoimmune response. Support for conventional presentation of thyroid antigens comes from experimental autoimmune thyroiditis, that can be evoked with exogenously administered thyroglobulin [39, 76,77] or TPO [78, 79]. Another line of evidence supports this premise: the distribution of MHC class II molecules on autoimmune thyrocytes correlates with the presence of IFN-y secreting lymphocytes, implying a direct relationship between the two [80]. Principally, the same immunological mechanisms are at work in thyroid tumors, which contain mononuclear cell infiltrates, in this case, to the benefit of the host. Thyroid cells can be easily induced to express MHC class II molecules, but they may lack other characteristics of professional APCs, such as the expression of CO-stimulatory molecules. Failure to deliver CO-stimulatory signals seems to be the main obstacle for the ability of thyroid cells to present antigens. Early interest focused on IL-1, however, conflicting evidence for its synthesis by thyrocytes [81, 82] rendered it an improbable candidate for a costimulatory molecule. Expression of CD80 or CD86 co-stimulatory molecules could not be demonstrated on either nonmalignant [83], or on malignant thyrocytes [84]. However, inflammatory infiltrating cells could provide the co-stimulatory signals necessary for productive immune response directed against the antigen presenting thyrocytes [85]. In contrast, it has been
320
postulated that limited stimulation of CD4+ T cells by thyroid cell expressing MHC class II molecules without CO-stimulatory molecules have an active protective role in prevention of thyroid autoimmunity [86]. The inhibitory effect of IFN-y on the synthesis of thyroid differentiation antigens, mentioned earlier, is in line with this premise. However, in thyroid tumors that do not contain immune-cell infiltrate, the expression of MHC class II alone on the thyroid cell only, is not sufficient to trigger CD4-h T cells, and may lead to detrimental anergy [87]. Expression of other auxiliary molecules, such as li or HLA-DM, may also play a role in the final consequence of MHC class II expression. In Hashimoto thyroiditis strong MHC class II and weak li expression have been observed [88]. This aberration of the antigen loading pathway of the MHC class II would imply that MHC class II molecules could be loaded with endogenous peptides, and support a role for the expression of li in thyroid autoimmunity. Lack of li or its alternate regulation could equally apply to presentation of antigens through MHC class II on professional APCs or thyroid cells. Conflicting data are available as to the actual ability of thyroid cells to present antigens. Presentation of processed viral antigens by human thyroid cells to T cells in a system using influenza peptides have been described [89]. We have found that MHC class II molecules on human cultured thyrocytes were essential for T-cell cytotoxicity directed towards autologous thyrocytes, but inhibited antithyroid natural killing [90]. We have also shown that MHC class II molecules on nonautoimmune thyrocytes stimulated the proliferation of autologous T cells in the high suppressor activity [91]. On the other hand, primary cultures of mouse thyrocytes triggered by IFN-yto express MHC class II, failed to present antigens to self T cells [92, 93]. These variable results could be explained by possible contamination of primary thyroid cultures with professional APCs. We and others, however, confirmed the ability of cloned thyrocytes to trigger syngeneic CD4+ T cells or cloned T cefls [94-96], in the absence of any other APCs. The ability of malignant thyroid cells to activate CD4+ T cells has not yet been studied.
4. THE MOLECULAR BASIS FOR THE REGULATION OF MHC CLASS II EXPRESSION The subject of regulation of MHC class II expression can be discussed in several levels: chromatin structure and methylation of DNA, transcription, posttranscription, promoter structure and its polymorphism. Most of the information gathered until now shows that the transcriptional regulation is the main level of regulation of MHC class II expression. Hence, while we discuss other possible mechanisms, we mostly focus on the transcriptional regulation. 4.1. Chromatin Structure and DNA Methylation To activate the transcription of a gene, specific transcription factors need to bind to their specific sequences on its promoter. The chromatin structure has to be decondensed to allow access of the enormous basal transcription machinery, which includes many proteins. Chromatin remodelling can be achieved by the binding of transcription factors, by the degree of methylation of G and C residues and by acetylation of histone proteins. The use of partial DNase I digestion reveals hypersensitive sites that can be digested only following DNA decondensation which allows access of the nuclease to the DNA. Several specific DNase I hypersensitive sites flanking the MHC class II locus were found in mouse B-cell fines in different developmental stages (pre-B, B and plasma cells). These sites were not found in T cells, fibroblasts or uninduced myelomonocytic cell lines, suggesting that they define a B-cell specific chromatin structure, that is not developmentally regulated [97]. Two other DNase I hypersensitive sites were found in the HLA-DRof promoter in normal, but not in class Il-deficient mutant B cells. These sites were also found in uninduced and induced fibroblasts [98]. In another study two sites were found within the first intron of the HLA-DR gene only in cells that constitutively express HLADR [99]. The specific sites located in the various regions of the HLA-DR gene and its flanking 5'-region could have pointed to some specificity in the regulation of chromatin decondensation, which might allow for HLA-DR transcription. Methylation is considered one of the factors that determine chromatin structure, and is usually exam-
321
ined by the use of methylation-sensitive and -resistant restriction endonucleases, such as Mspl that recognizes the sequence 5'-CCGG-3' and 5'-CmCGG-3', and Hpall that recognizes the sequence 5'-CCGG-3^ but not 5'-CmCGG-3'. Methylated DNA is condensed and inhibits gene expression, while it hypomethylated DNA is usually correlated with open chromatin structure and gene expression. Supporting this paradigm are evidences which find in normal tissue cells that the HLA-DRof gene is hypermethylated, and the only unmethylated region is located in the 5' portion of the gene, next to the promoter. In carcinomas and metastatic lymph nodes, which express HLA-DRof, the gene was found hypomethylated [100]. In a B lymphoblastoid cell line, which expressed HLA-DRa, the gene was hypomethylated compared to the gene in a T lymphoblastoid cell line that did not express it. Moreover, in a hybrid cell line, which expressed the HLA-DRa copy obtained solely from the parental T lymphoblastoid cell line, the gene was unmethylated [101]. In contrast to this paradigm, in different melanoma cell lines one site of methylation located in the first intron of HLA-DRa was methylated when the cells expressed HLA-DRa or were induce to express it [102]. In another study, methylation patterns were examined in several monocytic, B- and T-cell lines that constitutively or inducibly expressed HLADR or were not able to express it. No correlation was found between hypomethylation and HLA-DR expression [103]. In all these cell lines the first intron was hypomethylated, and the promoter region and the coding region were hypermethylated. In the K562 cell fine, which does not express HLA-DRof, the gene was found unmethylated, but a high degree of methylation was found in Colo38 cell line, which express the gene [104]. In addition, some conflicting data refer to correlation between methylation patterns and specific alleles. Methylation patterns of the HLADQ promoter were found to be similar in two cell lines possessing different DQBl alleles [105], but divergent allelic methylation was observed when different B lymphoblastoid cell lines and peripheral blood leukocytes from autoimmune and healthy individuals were assayed [106]. Taken together, many evidences suggest that there is no correlation between the methylation state of the HLA-DR region and the expression of the gene. However, the data are controversial and conflicting, and thus the question "how does chromatin structure reg-
322
ulate MHC class II gene expression?" needs to be further addressed. Some recent evidence suggest that the tumor suppressor retinoblastoma protein (Rb) may enable other transcription factors to the HLA-DRa promoter by modifying its chromatin structure [107]. The NF-Y complex, which binds to the MHC class II promoters as will be later described, has been shown to physically associate with two histone acetyltransferases [108]. This suggests that the acetyltransferases disrupt the local chromatin structure, thereby enabling access of the NF-Y transcription factor to its specific target sequence. 4.2. Post-Transcriptional Regulation Only few evidences indicate a partial role for posttranscriptional mechanisms in the regulation of MHC class II gene expression. A difference in the glycosylation patterns of HLA-DR molecule between autologous B lymphoblastoid and melanoma cell lines was observed [109], suggesting a post-transcriptional modification on MHC class II molecules, that is different between immune cells and tissue malignant cells. Resting T cells, which do not express surface MHC class II molecules, transcribe mRNA for MHC class II genes [110], suggesting a unique T cell post-transcriptional regulatory mechanism. Similarly, hybrid cells generated between human and mouse Bcell lines showed surface expression of both HLA-DR and HLA-DP, but not of HLA-DQ, whereas, normal amounts of the HLA-DQ a and ^ transcripts were present. Thus, the presence of post-transcriptional block specific for HLA-DQ has been postulated [111]. Stability studies of MHC class II mRNA in an IFNy-nduced-macrophage cell line measured half-life values of 16-20 h [112]. In the human B-cell line Raji the half-life value of HLA-DRof mRNA was measured to be about 10 h, while addition of cyclohexamide reduced the half-life value by 8- tolO-fold [113]. This finding could indicate that a post-transcriptional factor might be needed to stabilize HLA-DR mRNA. Taken together these data suggest that a posttranscriptional regulation, although not the main level of regulation, can contribute to the regulation of MHC class II expression, and may partially explain the different modes of expression in different cell types and in malignant vs. nonmalignant cells.
A. Wbox
XI box
X2box
5'-ATCTTGTGT(CCGGACCCTTTGCAAGA]^CCCTTCC^CTAGCAACAGATOCGTCATC
AAA AT ATTTTTqTG ATTGGCC A A AGAbTAATTGkTTTGCATJTTTAATGGTC AGACTCTAT Y box Octamer TACACCCCACATTCTCTTTTCTTTTA
B.
J-*! Figure 1. (A) The structure HLA-DRa promoter. The W, XI, X2, Y boxes are bolded and boxed. The octamer, which is unique to the HLA-DRa promoter is boxed. The TATA box is only bolded. The consensus sequences within the boxes are underlined: the S box within the W box, the CCAAT box within the Y box. (B) The binding of transcription factors to the HLA-DRa promoter. The three complexes primarily regulating HLA-DRa expression are the RFX complex, which binds to the XI box and may also bind to the W box, the X2BP, which binds to the X2 box, the NF-Y, which binds to the Y box. The hXBP-1 and HB16 may compete for the binding of the X2 box, whereas, the YB-1, which may act as a repressor, may compete for the binding of the Y box. Oct-2, a transcription factor that is expressed in B cells, binds to the octamer, located only on the HLA-DRa promoter.
4.3. Polymorphism in the Promoter Region MHC class II structural genes are highly polymorphic, and the allelic variations contribute to the specificity of antigen presentation, diversity of the immune system, as well as to susceptibility to autoimmune and malignant diseases. Allelic polymorphism also exists in the proximal promoter regions of these genes [114-116], and might contribute to differences in expression, inducibility or tissue specificity. Several allelic differences in the HLA-DQB promoter were found, some of them mapping to known critical sequences such as the X box (which will be later discussed). Comparison between two of these allelic promoters using transient expression systems and measuring the transcription of chloramphenicol acetyltransferase (CAT), showed a marked difference in their strength [61]. Polymorphism in the three
DQAl alleles was located to X and Y boxes (to be discussed Later), and differences in their ability to induce transcription in reporter gene system were observed [117]. Furthermore, TNF-a activated one promoter allele, but had little effect on the other two promoter alleles. Similarly, allelic polymorphism was found in the HLA-DRB promoter regions, and transfection of these promoter-constructs into human B cells showed marked differences in their abihty to induce a CAT-reporter gene [118]. Although promoter allelic polymorphism could be an additional level of regulation of the expression of MHC class II molecules, as suggested by these evidences, more research is required to establish such a role, and to determine whether specific promoter alleles are involved in the susceptibility to autoimmunity or malignancy.
323
A. TSH
Figure 2A. The counter effects of TSH and IFN-y on the expression of HLA-DRa in thyrocytes—a proposed model (adopted from ref. [168]). (A) Effects of TSH on HLA-DRa expression in thyrocytes, as suggested by Balducci-Silano [164]. TSH binds to its receptor, decreasing the amount of SSBP-1, while simultaneously increasing the amount of TSEP (the homologue of YB-1), which acts as a repressor. The decreased SSBP-1 does not bind to the single-stranded DNA elements adjacent to the W box, hence other transcription factors cannot easily associate with the HLA-DRa promoter. On the other hand, the increased TSEP represses the activity of the promoter and HLA-DRa expression. This ensures that HLA-DRa is not expressed on the surface of the thyrocyte, possible autoantigens, such as TPO and thyroglobulin cannot be presented to the immune system.
4.4. Structure of the MHC Class II Promoters The cloning of many promoters of the genes coding for MHC class II molecules from different isotypes and species, and comparisons between these sequences, led to the identification of short, very conserved DNA sequences termed "boxes". All MHC class II promoters, as well as related promoters such as the HLA-DM [119] and the invariant chain (li) [120], contain the same boxes arranged in the same order [reviewed in 121-125]. This similarity ensures the coordinated expression of these genes, which is based on common mechanisms of transcription. Four boxes in particular are involved in mediating the transcriptional control of MHC class II molecules. The Y box is a 10-bp motif, which contains the reverse CCAAT sequence. At a conserved distance of about 19-20 bp upstream
324
to the Y box lies the X box, which contains 14 bp. Immediately downstream to the X box, with two nucleotides overlapping, is the X2 box comprised of 8 bp, which contains a sequence similar to either the cAMP response element (CRE) or the TPA response element (TRE). Upstream to the X box a pyrimidine-rich stretch separates the X and the W boxes. The S (or H) box is a 7-bp box included within a 30 bp region called the W (or Z) box, which is 20-21 bp upstream of the X box. Apart from these four boxes, an additional unique motif in the HLA-DRa promoter, is an 8 bp sequence called octamer, which has been shown to mediate Bcell specificity. Transfection experiments, in which specific promoters or promoter elements are tested for their control of the transcription of a reporter gene, e.g., chloramphenicol acyltransferase (CAT), demonstrated that the proximal promoter of MHC class II
Figure 2B. The counter effects of TSH and IFN-y on the expression of HLA-DRa in thyrocytes—a proposed model (adopted from ref. [168]). (B) Effects of IFT^-y on HLA-DRa expression in thyrocytes. IFN-y binds to its receptor and tyrosine phosphorylates the Janus kinases (Jakl and Jak2) and the STAT la transcription factor. STAT la increases the activity of IRF-1 and binds to the CIITA inducible promoter, where together with USF-1 it induces the expression of CIITA. IFN-y decreases the expression of TSEP, thereby allowing the binding of NF-Y, which serves as an activator for HLA-DRa expression. IFN-y also increases the amount of SSBP-1, which binds to the single-stranded DNA elements adjacent to the W box and allows the binding of the other double-stranded transcription factors to the HLA-DRa promoter. CIITA binds to the transcription factors, in particular to RFX, serves as a "master regulator" for the transcription of HLA-DRa (the open arrows indicate increase or decrease in the amount of the indicated protein, P represents phosphorylation).
genes is sufficient and necessary for both the constitutive and the induced expression of these molecules [reviewed in 121-125]. Deletion analysis of specific promoter regions, and mutational analysis of each of the boxes have shown that not only the boxes, but also the exact spaces between them, are required the promoter activity [126]. The spaces, rather than the composition of the bases in them, align the proteins that bind to the boxes on the same plenary axis of the DNA helix, and allow protein-protein interactions that lead to the activation of RNA polymerase II and to the transcription of MHC class II molecules.
4.5. Transcription Factors Transcription factors are proteins that have the ability to recognize specific DNA sequences on gene promoters, bind to them, and then directly or indirectly activate the transcriptional apparatus, which includes RNA polymerase II and other proteins. Many DNA binding proteins have been isolated on the basis of their ability to bind to specific c/^-element sequences in vitro, by using methods such as affinity purification or screening of Xgtl 1 cDNA expression libraries. The multimeric nuclear complex RFX—consisting of at least two subunits—/?FZ5 [127] and RFXAP [128]— binds to the X box on MHC class II promoters.
325
TRAXl [129],NF-X1 [130] and the family of proteins RFX 1,2,3 and 4 [131,132] can also bind to the X box. A^F-F(also called YEBP or CBF) [133, 134] and YB-1 [135] both bind to the Y box and function as either activator or repressor, respectively. X2BP [136], NF-X2 [137], IFNEX [138], hXBPl [139], and HB16 [140] bind to the X2 box. The NF-X2 probably corresponds to the AP-1 complex, which consists of c-Jun and cFos, while both hXBP-1 and HB16 have been shown to be able to heterodimerize with c-Jun. The W-B1 and W-B2 complexes bind to the S box [141,142], as does NF-J [143]. These are examples of proteins that have been isolated and/or characterized to-date. As mentioned, most of these proteins were isolated on the basis of their binding to c/5^-elements in the MHC class II promoters in vitro. However, their role in MHC class II transcription is deduced mostly by indirect evidences, such as a correlation between the expression of the transcription factor and MHC class II genes, the effect of mutations in the promoter on its activity, the affinity of the factor to its binding site, or antisense experiments, which evaluate the effect of reducing the expression of the transcription factor on the expression of MHC class II molecules [122]. However, direct evidence, which demonstrate the role of most transcription factors in vivo is lacking. Such evidence could be provided by a genetic approach, which introduces a transcription factor into a deficient cell or into an in vitro transcription system that lacks the factor, thereby restoring MHC class II expression. Most transcription factors are ubiquitously expressed, and can bind to several other gene promoters. For example, the RFXl-4 proteins, belonging to the RFX family of proteins, can bind to other promoters, such as the hepatitis B enhancer or the mouse ribosomal gene rpLSO [131,132,144] and are probably not involved in the regulation of MHC class II expression. Another example is the NF-Y complex, which binds to the CCAAT sequence. This sequence is located in many gene promoters, such as albumin and thymidine kinase, and is implicated in the control of the expression of these genes [145, 146], as well as in the transcription of the MHC class II genes. Nonetheless, direct evidences or compelling indirect evidences implicate three transcription factors, in the regulation of MHC class II transcription. (A) Electrophoretic mobility shift assays, in which the half-life of protein complexes was measured by competition with either the X box, the X2 box or the Y box.
326
showed that both X2BP and NF-Y bind cooperatively with RFX to the MHC class II promoters, thus stabilizing the DNA-protein complex [147-149]. The RFX complex, therefore, probably acts as an "accessibility factor" that recruits NF-Y and X2BP to the MHC class II promoters via protein-protein interactions. (B) In vitro transcription experiments demonstrate an important role for NF-Y and RFX complexes in the transcription of MHC class II molecules [145, 150]. (C) The crucial role of the RFX complex in the transcription of MHC class II genes is demonstrated in mutated cells that lack this factor and therefore do not transcribe MHC class II genes (see below). A severe immune deficiency disease resulting in MHC class II deficiency commonly termed the bare lymphocyte syndrome (BLS) [122, 151], provides a strong functional evidence for the role of the RFX complex in the regulation of MHC class II expression. Patients with BLS, that suffer from recurrent and lethal infections, are characterized by the lack of MHC class II expression on their B cells, and by the inability of IFN-y to induce MHC class II genes in their tissue cells. Cell fusion experiments between different cell lines derived from BLS patients or MHC class IInegative cell lines divide these cells into at least four complementation groups. In one of the complementation groups (complementation group C) the molecular defect was found to be to a mutation in the RFX5 protein. This mutation abrogated the ability of the RFX complex to bind to the promoter in vivo, and resulted in an unoccupied "bare'' promoter [152,153]. Transfection of cell lines belonging to this complementation group with cDNA of the wild type RFX5 restored the expression of all MHC class II genes [127]. Complementation cloning lead to the isolation of a new transcription factor—MHC class II transactivator (CIITA) [154]. This protein was found to be lacking or mutated in all cell lines belonging to BLS complementation group A, and indeed transfection of these cells with the wild type CIITA restored the expression of all MHC class II genes [154, 155]. Furthermore, CIITA expression was found in all MHC class II positive cells, and this expression could be induced by IFN-y [154]. In addition, shutting off the expression of MHC class II molecules in plasma cells was shown to be mediated by silencing of the CIITA protein expression [156]. In contrast to the RFX proteins, CIITA is thought to be a non-DNA binding transcription factor, since no binding to the MHC class
II promoters could be observed [154]. Its N-terminal region, rich in acidic amino acids, is thought to be the transactivating domain, while the C-terminal domain is responsible for mediating MHC class II specificity, probably via protein-protein interactions with the RFX complex [157, 158]. Based on these data a model was proposed [158], in which CIITA expression is necessary for MHC class II transcription, and serves as an "on-off switch" or a "master regulator". The complex regulation of the CIITA gene expression, which in turn determines the regulation of the MHC class II genes in terms of cellular specificity and magnitude of expression, seems to be controlled by different usage of multiple promoters of the CIITA gene [159]. One of these promoters have been implicated in the regulation of the constitutive expression in dendritic cells, another is specific for the constitutive expression of CIITA in B cells, while a third promoter controls the inducible expression of CIITA in many cell types. In addition, a new protein called IK has been recently cloned, which functions as an efficient inhibitor of IFN-y-induced expression of MHC class II molecules [160]. Stable transfection of human B cells with IK lead to the total disappearance of constitutive MHC class II expression and to a marked reduction of CIITA mRNA, suggesting that IK plays a role in the regulation of CIITA and MHC class II genes [161]. All these evidences imply that an intricate mechanism exists, in which the "master regulator" CIITA is itself under tight regulation. Thus, in order to control MHC class II expression and to allow intervention and treatment of autoimmune or malignant diseases, it is necessary to regulate the expression of CIITA.
5. THE MOLECULAR BASIS FOR THE REGULATION OF MHC CLASS H EXPRESSION IN THYROCYTES Only few studies have looked at the different levels of regulation of MHC class II gene expression in thyroid cells, although the phenomenon of MHC class II induction in autoimmune and malignant diseases is very well documented, as has been described before. In IFN-y-induced macrophages the stability of MHC class II mRNA indicated long-lived transcripts. In contrast, in three different malignant thyroid cell lines the half-life value of HLA-DRa mRNA was
measured between 1.3-7 h [63]. This obvious reduction in the half-life values between immune cells and epithelial malignant cells may suggest that this level of regulation, not yet fully explored, may be an important distinct regulatory mechanism between the normal and aberrant expression of MHC class II molecules. Polymorphism of MHC class II promoter may also influence their expression. However, when the sequence of the HLA-DRof promoter was determined in three malignant thyroid cell lines and in normal thyroid epithQlml cells, which exhibited different levels of HLA-DR expression, no changes or point mutations could be found compared to the published sequence from B cell [63]. Hence, the structure of the promoter in thyroid cells was identical to that of immune cells, and no polymorphism of the promoter was found. Recent evidence show that the same boxes and the same transcription factors that are used for MHC class II gene regulation in B cells and macrophages are also used in thyroid cells. The highly conserved S, X, X2 and Y boxes are necessary for IFN-y-induced expression of HLA-DR in the FRTL-5 rat thyroid cell line [162], as was demonstrated by transfection of reporter gene constructs. We have demonstrated the binding of protein complexes to these elements in human thyroid carcinoma cell lines by gel shift mobility experiments [84]. DNA-binding proteins that occupy the HLA-DRa promoter, which were identified in B cells and macrophages have been found in thyroid malignant cells. We have shown that specific proteins such as RFX5 or YB-1 were expressed constantly, and their levels were not significantly changed after the addition of IFN-y [unpublished data]. This can be explained by their ubiquitous expression and their involvement in the transcription of other genes. However, IFN-y had an effect on the binding of transcription factors to promoter elements. Addition of IFN-y to rat FRTL-5 thyroid cell line resulted in the formation of a novel complex on the HLA-DRa promoter [162], which could be suppresses by methimazole (MMI), previously mentioned as MHC class II inhibitor. Furthermore, the addition of IFN-y-induced an endogenous CIITA transcript, and overexpression of a cDNA construct coding for CIITA in these cells resulted in the increased formation of that novel complex. In contrast, the increase in MHC class II expression and DNAprotein complex formation induced by either IFN-y or CIITA could be reduced by the co-transfection of
327
the specific thyroid Y box protein, TSEP-1, which is homologous to the human repressor protein YB1 [163]. Another protein termed SSBP-1 has been found to positively regulate HLA-DRof transcription in thyroid cells, as was observed when overexpression of its cDNA resulted in the increased expression of HLA-DRa [164]. In addition, transfection of SSBP-1 together with CIITA additively increased endogenous HLA-DRof mRNA levels, which reached those induced by IFN-y alone. Addition of TSH to thyroid cells caused an increase in TSEP-1 levels and a decrease in SSBP-1 levels, whereas, the addition of IFN-y reversed this effect. Thus it seems that TSH prevents expression of MHC class II, in contrast to IFN-y, which simultaneously increases the levels of CIITA and SSBP-1 and decreases the levels of TSEP1, resulting in the increased aberrant expression of HLA-DR. The opposite effects of TSH and IFN-y on the induction of the MHC class II promoter are in accord with inhibitory [47] rather than enhancing [44] effects o TSH on thyroid HLA-DR expression. We have shown that the incubation of thyroid malignant cells with IFN-y increased the levels of CIITA mRNA, and addition of TNF-of had a synergistic effect (unpublished data). The malignant thyroid cell line mentioned earlier, which expresses HLA-DRa constitutively, showed very low levels of expression of the CIITA mRNA. This indicates that CIITA, although a key player in the regulation of MHC class II, does not solely determines MHC class II gene expression in thyroid cells, and other regulatory mechanisms may influence it as well (unpublished data, [165]). In macrophages CIITA is expressed inducibly, and this expression is mediated by the activation of STATl by IFN-y, which leads to the binding of STATl to the CIITA promoter, together with the binding of USF-1 and IRF-1 [ 166]. In the mahgnant thyroid cell lines we have observed increased phosphorylation of STATl after addition of IFN-y, which lasts even after 18 h. In contrast, phosphorylation of STATl in the Bcell line Raji was faintly detected only ten minutes after addition of IFN-y. This indicates that activation of STATl in this immune cell line is a very rapid and transient event. The divergent regulation of HLA-DR molecules in noncancerous and cancerous thyrocytes mentioned before, also suggests different molecular pathways leading to HLA-DR expression.
328
6. CONCLUSIONS The expression of MHC class II molecules on thyroid cells is a crucial event in the process of antigen presentation and induction or inhibition of an immune response. On autoimmune thyrocytes such expression, which may lead to the presentation of self-antigens, could perpetuate thyroid autoimmunity. On thyroid malignant cells such expression may lead to the presentation of self-thyroid or tumor-antigens, which will direct the immune response toward these cells and destroy them, to the benefit of the patient. The basic molecular mechanisms responsible for the expression of MHC class II molecules on thyroid cells share similar features with those regulating their expression in immune cells: the structure of the promoter is similar, the same boxes and similar transcription factors are utilized, and CIITA plays a key role as the "master regulator". However, the fine-tuning of MHC class II expression on thyrocytes may employ additional mechanisms, which have not yet been studied in sufficient depth, and could be different than those employed by immune cells: post-transcriptional mechanisms may lead to shorter half-life values in the thyroid carcinoma cells compared to those of immune cells. Additional transcription factors, which are specifically expressed and regulated in the thyroid cells (e.g., TSEP-1 and SSBP-1), may contribute to the regulation of MHC class II gene expression. Transcription of CIITA could be regulated differently by the use of different promoters, and thereby different transcripts of CIITA could arise. Finally, divergent signal transduction pathways leading to MHC class II expression that were observed in a B-cell line, normal and malignant thyroid cells, could suggest regulatory differences between immune and thyroid cells as well as between normal and malignant thyroid cells. Understanding the mechanisms involved in the regulation of the expression of MHC class II molecules, as well as essential co-stimulatory molecules, may help in intervening and designing a new immunotherapoitic approaches to both autoimmune and malignant diseases.
REFERENCES 1.
Trowsdale T. Genomic structure and function in the MHC. Trends Genet 1993;9:117-122.
2.
3.
4. 5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
Matis LA, Glimcher LH, Paul WE, Schwartz RH. Magnitude of response of histocompatibilityrestricted T-cell clones is a function of the product of the concentrations of antigen and la molecules. Proc Natl Acad Sci USA 1983;80:6019-6023. Guardiola J and Maffei A. Control of MHC class II gene expression in autoimmune, infectious, neoplastic diseases. Crit Rev Immunol 1993;13:247-268. Murray JS. How the MHC selects Thl/Th2 immunity. Immunol. Today 1998;19:157-162. Greenstein JL, Lord EM, Horan P, Kappler JW, Marrrack P. Functional subsets of B cells defined by quantitative differences in surface I-A. J Immunol 1981;126:2419-2423. Noelle R, Krammer PH, Ohara J, Uhr JW and Vitetta ES. Increased expression of la antigens on resting B cells: an additional role for B-cell growth factor. Proc Natl Acad Sci USA 1984;81:6149-6153. PoUa BS, Poljak A, Ohara J, Paul WE, Glimcher LH. Regulation of class II gene expression: analysis in B cell stimulatory factor 1-inducible murine pre-B cell lines. J Immunol 1986;137:3332-3337. Dennis GJ, Mond JJ Corticostreroid-induced suppression of murine B cell immune response antigens. J Immunol 1986;136:1600-1604. Mond JJ, Carman J, Samra C, Ohara J, Finkelman FD. Interferon-(suppresses B cell stimulation factor (BSF-1) induction of class II MHC determinants on B cells. J Immunol 1986;137:3534-3537. McKeam JP, Baum C, Davie JM. Cell surface antigens expressed by subsets of pre-B cells and B cells. J Immunol 1984;132:332-339. Latron F, Jotterand-Bellomo M, Maffei A, Scarpellino L, Bernard M, Strominger JL, Accolla RS. Active suppressor of major histocompatibility complex class II gene expression during differentiation from B cells to plasma cells. Proc Natl Acad Sci USA 1988;85:2229-2233. Dellabona P, Latron F, Maffei A, Scarpellino L, Accolla RS. Transcriptional control of MHC class II gene expression during differentiation from B cells to plasma cells. J Immunol 1989;142:2902-2910. Zimmer T, and Jones PP. Combined effects of tumor necrosis factor-alpha, prostaglandin E2, corticosterone on induced la expression on murine macrophages. J Immunol 1990;145:1167-1175. Loughlin AJ, Woodroofe MN, Cuzner ML. Modulation of interferon-gamma-induced major histocompatibility complex class II and Fc receptor expression on isolated microglia by transforming growth factor-beta 1, interleukin-4, noradrenaline and glucocorticoids. Immunology 1993;79:125-130. Klareskog L, Forsum U. Tissue distribution of class II antigens: presence on normal cells. In: Solheim B,
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
Moller E, Ferrone S, eds., HLA Class II Antigens. New York: Springer-Verlag, 1990;339-348. Kingston AE, Bergsteinsdottir K, Jessen KR, Van Der Meide PH, Colston MJ, Mirsky R. Schwann cell co-cultured with stimulated T cells and antigen express MHC class II determinants without interferon(pretreatment: synergistic effects of interferon-)/ and tumor necrosis factor on MHC class II induction. Eur J Immunol 1989;19:177-183. Davis TF, Martin A, Graves P. Human autoimmune thyroid disease: cellular and molecular aspects. Baillieres Clin Endocrinol Metab 1988;2:911-939. Kraiem Z, Sobel E, Sadeh O, Kinarty A, Lahat N. Effect of IFN-y on DR antigen expression, growth and 3,5,3^ triiodothyronine secretion, iodine uptake and cAMP accumulation in cultured human thyroid cells. J CUn Endocrinol Metab 1990;71:817824. Lahat N, Sheinfeld M, Sobel E, Kinarty A, Kraiem Z. Divergent effects of cytokines on human leukocyte antigen-DR expression of neoplastic and non-neoplastic human thyroid cells. Cancer 1992;69:1799-1807. Tomer Y, Davis TF. Infections and autoimmune endocrine disease. Baillieres Chn Endocrinol Metab 1995;9:47-70. Bevan MJ Antigen recognition. Class discrimination in the world of immunology. Nature 1987;325:192194. Germain RN. MHC-dependent antigen processing and peptide presentation: providing ligands for T lymphocyte activation. Cell 1994;76:287-299. Monaco J J A molecular model of MHC classI-restricted antigen processing. Immunol Today 1992;13:173-184. Neefjes JJ, Ploegh HL. Intracellular transport of MHC class II molecules. Immunol Today 1992;13:179-184. Teyton L, O'SuUivan D, Dickson PW, Lotteau V, Sette A, Fink P, Peterson PAL Invariant chain distinguishes between the exogenous and endogenous antigen presentation pathways. Nature 1990;348:3944. Kropshofer H, Hammerling GJ, Vogt AB. How HLA-DM edits the MHC class II peptide repertoire: survival of the fittest? Immunol Today 1997; 18:7782. Roche PA, Cress well P. Proteolysis of the class IIassociated invariant chain generates a peptide binding site in intracellular HLA-DR molecules. Proc Natl Acad Sci USA 1991;88:3150-3154. Theofilopoulos AN. The basis of autoimmunity: part II genetic predisposition. Immunol Today 1995;16:150-158.
329
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
330
Cabrera T, Ruiz-Cabello F, Garrido F. Biological implications of HLA-DR expression in tumors. Scan. J Immunol 1995;41:398^06. June C, Bluestone L, Nader L, Thompson C. The B7 and CD28 receptor families. Immunol Today 1994;15:321-325. Thompson C. Distinct roles of costimulatory ligands B7-1 and B7-2 in T helper cell differentiation. Cell 1995;81:979-984. Stout RD and Suttles J The many roles of CD40 in cell mediated inflammatory responses. Immunol Today 1996; 17:487^92. Katz J, Benoist C, Mathis D. T helper subsets in insulin dependent diabetes. Science 1995;268:11851188. Wu T, Huang A, Jaffee E, Levitzky H, Pandoll D. A reassessment of the role of B7-1 expression in tumor rejection. J Exp Med 1995;182:1415-1419. Kuchroo V, Das M, Brown J, Ranger A, Zamvils S, Sober R, Weiner H, Nabavi N, GHmcher LH. B7-1 and B7-2 costimulatory molecules activate differentially the Thl/Th2 developmental pathways. Application to autoimmune disease therapy. Cell 1995;80:707-719. Baskar S, Clements VK, Glimcher LH, Nabavi N, Ostrand-Rosenberg S. Rejection of MHC class IItransfected tumor cells requires induction of tumorencoded B7-1 and/or B7-2 costimulatory molecules. J Immunol 1996;156:3821-3827. Ostrand-Rosenberg S. Tumor immunotherapy: the tumor cell as an antigen presenting cell. Curr Opin Immunol 1994;6:722-727. PanelH MC, Wang E, Shen S, Schluter SF, Bernstein RM, Hersh EM, Stopeck A, Gangavalli R, Barber J, Jolly D, Akporiaye ET. Interferon ((IFN() gene transfer of an EMT6 tumor that is poorly responsive to IFN(stimulation: increase in tumor immunogenicity is accompanied by induction of a mouse class II transactivator and class II MHC. Cancer Immunol Immunother 1996;42:99-107. Armstrong TD, Clements VK, Martin BK, Ting JPY, Ostrand-Rosenberg S. MHC class II transfected tumor cells present endogenous antigens and are potent inducers of tumor specific immunity. Proc Natl Acad Sci USA 1997;94:6886-6891. Hanafusa T, Pujol Borrell R, Chiovato L, Russell RC, Doniach D, Bottazzo GF. Aberrant expression of HLA-DR antigen on thyrocytes in Graves' disease: relevance for autoimmunity. Lancet 1983;2:1111-1115. Bottazzo GF, Pujol Borrell R, Hanafusa T, Feldmann M 1983;Role of aberrant HLA-DR expression and antigen presentation in induction of endocrine autoimmunity. Lancet 1983;2:1115-1119.
42.
43.
44.
45.
46.
47.
48.
49.
50.
51.
52.
53.
Boyd CM, Basker JR. The immunology of thyroid cancer. Thyroid cancer, endocrinology and Metabolism, Clinics of North America 1996;25159-179. Knoll MR, Schwab M, Oestreich K, Rumstadt B, Aagmuller E. HLA class II expression in well differentiated thyroid carcinoma. Correlation with clinicopathological features. J Exp Clin Cancer Res 1997;16:177-182. Lahat N, Hirose W, Davies TF. Enhanced induction of thyroid cell MHC class II antigen expression in rats highly responsive to thyroglobulin. Endocrinology 1989;24:1754-1759. Piccinini LA, Mackenzie WA, Platzer M, Davis TF. Lymphokine regulation of HLA-DR gene expression in human thyroid cell monolayers. J Clin Endocrinol Metab 1987;64:543-548. Todd I, Pujol Borrell R, Hammond LJ, Bottazzo GF, Feldmann M. IFN-y induces HLA-DR expression on thyroid epithelium. Clin Exp Immunol 1985;61:265-273. Lahat N, Sobel E, Kraiem Z. Signal transduction pathways leading to HLA-DR expression in normal and malignant thyroid cells. Cancer Res 1993;53:3943-3947. Rigopoulou D, Martinez Laso J, Matinez Tello F, Alcaide JF, Benmamar D, Hawkins F, Amaiz-Villena A. Both class I and class II HLA- antigens are thyroid cancer susceptibility factors. Tissue Antigens 1994;43:281-285. Zeki K, Tanaka Y, Morimoto I, Nishimura Y, Kimura A, Yamashita U, Eto S. Induction of expression of MHC class II antigen on human thyroid carcinoma by wild type p53. Int. J Cancer 1998 75:391395. Neufeld DS, Platzer M, Davis TF. Reovirus induction of MHC class II antigen in rat thyroid cells. Endocrinology 1989, 124:543-545. Khoury EL, Pereira L, Greenspan FS. Induction of HLA-DR expression on thyroid follicular cells by cytomegalovirus infection in vitro. Evidence for a dual mechanism of induction. Am J Pathol 1991;138:1209-1223. Beliore A, Mauerhoff T, Pujol Borrell R, Badenhoop K, Buscema M, Mirakiau R, Buttazzo GF. De novo HLA class II and enhanced HLA class I molecule expression in SV40 transfected human thyroid epithelial cells. J Autoimmun 1991;4:397414. Fisfalen ME, Franklin WA, DeGroot LJ, Cajulis RS, Soltani K, Ryan M, Jones N. Expression of HLA ABC and DR antigens in thyroid neoplasia and correlation with mononuclear leukocyte infiltration. J Endocrinol Invest 1990;13:41^8.
54.
55.
56.
57.
58.
59.
60.
61.
62.
63.
64.
65.
66.
Garrido F, Cabrera T, Concha A, Glew S, RuizCabello F, Stern PL. Tumor development. Immunol Today 1993;14:491-499. Farid NR, Stenszky V. Graves' disease. In: Frid NR, ed., Immunogenetics of Endocrine Disorders. New York: Alan R. Liss, 1988;223-266. Schleusener H, Shernthaner G, Mayr WR, Kotulla P, Bogner U, Finke R, Meinhold H, Koppenhagen K, Wenzel KW. HLA-DR3 and HLA-DR5-associated thyrotoxicosis: two different types of toxic diffuse goiter J Clin Endocrinol Metab 1983;56:781-785. Badenhoop K, Schwarz G, Walfish PG, Drummond V, Usadel KH, Bottazzo GF. Susceptibility to thyroid autoimmune disease: molecular analysis of HLA regions genes identifies new markers for goitrous Hashimoto's thyroiditis. J Clin Endocrinol Metab 1990;71:1131-1137. Yanagawa T, Mangklabruks A, Chang YB, Okamoto Y, Fisfalen ME, Curran PG, DeGroot L. Human histocompatibiUty antigen-DQA 1*0501 allele associated with genetic susceptibility to Graves' disease in a Caucasian population. J Clin Endocrinol Metab 1993;76:1569-1574. Badenhoop K, Schwarz G, Schleusener H, Weetman AP, Recks S, Peters H, Bottazzo GF and Usadel KH. Tumor necrosis factor (gene polymorphism in Graves' disease. J Clin Endocrinol Metab 1992;74:287-291. Sospedra M, Obiols G, Santamaria Babi LF, Tolosa E, Vargas F, Roura-Mir C, Lucas-Martin A, Ercilla G, Pujol-Borrell R. Hyperinducibility of HLA-class II expression of thyroid follicular cells from Graves' disease. J Immunol 1995;154:4213-4222. Andersen LC, Beaty JS, Nettles JW, Seyfried CE, Nepom GT, Nepom BS. Allelic polymorphism in transcriptional regulatory regions of HLA-DQ genes. J Exp Med 1991;173:181-192. Louis P, Eliaou JF, Kerlan-Candon S, Pinet V, Vincent R, Clot J Polymorphism in the regulatory region of HLA-DRB genes correlating with haplotype evolution. Immunogenetics 1993;38:21-26. Neufeld DS, Lahat N, Graves P, Gillon-Peled M, Kraiem Z, Davies TF. HLA-DRof gene regulation in immortalized human thyroid cancer cells. Clin Immunol Immunopathol 1993;67:151-156. Weetman AP, McGregor M. Autoimmune thyroid disease: further developments in our understanding. Endocrine Rev 1994;15:788-830. Cuddihy RM, Schaid DS, Bahn RS. Multivariate analysis of HLA loci in conjunction with thyrotropin receptor codon S2 polymorphism in confessing risk of Graves' disease. Thyroid 1996;6:261-265. Ropars A, Marion S, Takorabet L, Braun J, Charreire J Antibodies specific for human thyrotropin receptor
67.
68.
69.
70.
71.
72.
73.
74.
75.
76.
77.
induce MHC antigen expression in thyroid cells. J Immunol 1994;153:3345-3352. Takorabet L, Ropars A, Stasiuk L, Raby C, Charreire J Phenothiazine-induced increase in thyroid autoantigens and costimulatory molecules on thyroid cells: a pathophysiological mechanism for drug induced autoimmunity? Clin Exp Immunol 1998;111:415-421. Atwa MA, Lukes YD, Salata K, Abo-Haskem EM, El-Kannishy MH, Burman KD. The influence of triiodothyronine, thyroxine, thyrotropin .and methimazole on thyroid cell MHC class II antigen expression. Clin Immunol Immunopathol 1995;76:209-213. Schuffert F, Taniguchi S, Schroder S, Dralle H, VonZur Mahler A, Kohn LD. In vivo and In vitro evidence for iodide regulation of major histocompatibility complex class I and class II expression in Graves' disease. J Clin Endocrinol Metab 1996;81:36223628. Chiovato L, Lopi P, Mariottis, Del-Prete G, De Carh M, Pinchera A. Simultaneous expression of thyroid peroxidase and human leukocyte antigen DR by human thyroid cells: modulation by thyrotropin, thyroid stimulating antibody and interferon gamma. J Clin Endocrinol Metab 1994;79:653-656. Smanik PA, Fithian LJ, Jhiang SM. Thyroid peroxidase expression and DNA polymorphisms in thyroid cancer. Biochem Biophys Res Commun 1994;198:948-954. Ohta K, Endo T, Onaya T. The mRNA levels of thyrotropin receptor, thyroglobulin and thyroid peroxidase in neoplastic human thyroid tissues. Biochem Biophys Res Commun 1991;174:1148-1153. Fabbro D, Di Loreto C, Beltrami CA, Belfiore A, Di Lauro R, Damante G. Expression of thyroidspecific transcription factor TTF-1 and PAX-8 in human thyroid neoplasms. Cancer Res 1994;54:47444749. Guazzi S, Price M, De Felice M, Damante G, Mattel MG, Di Lauri R. Thyroid transcription factor 1 (TTF-1) contains a homeodomain and displays a novel DNA-binding specificity. EMBO J 1990;9:3631-3639. Plachov D, Chowdhury K, Walther C, Simon D, Guenet JL, Gruss P. Pax-8, a murine paired box expressed in the developing excretory system and thyroid gland. Development 1990;110:643-651. Maron R, Zerubavel R, Friedman A, Cohen IR. T lymphocyte line specific for thyroglobulin produces or vaccinates against autoimmune thyroiditis in mice. J Immunol 1983;131:2316-2322. Hirose W, Davies TF. Generation of thyroglobuHnspecific T-cell clones derived from Fl Fisher rats. Immunology 1988;64:107-112.
331
78.
79.
80.
81.
82.
83. 84.
85.
86.
87.
88.
89.
90.
332
Kotani T, Umeki K, Hirai K, Ohtaki S. experimental murine thyroiditis induced by porcine thyroid peroxidase and its transfer by the antigen-specific T cell line. Clin Exp Immunol 1990;80:11-18. McLachlan SM, Atherton MC, Nakajima Y, Napier J, Jordan RK, Clark F, Rees-Smith B. Thyroid peroxidase and the induction of autoimmune thyroid disease. Clin Exp Immunol 1990;79:182-188. Hamilton F, Black M, Farquharson MA, Stewart C, And Foulis AK. Spatial correlation between thyroid epithelial cells expressing class II molecules and IFN(containing lymphocytes in human thyroid autoimmune disease. Clin Exp Immunol 1991;83:6468. Grubeck-Loebenstein B, Buchan B, Chantry D, Kassal H, Londei M, Pirich K, Barrett K, Turner M, Waldhausl W, Feldmann M. Analysis of intrathyroidial cytokine production in thyroid autoimmune disease: thyroid follicular cells produce IL-la and IL-6. Clin Exp Immunol 1989;77:324-330. Miyazaki A, Hanafusa T, Itoh N, Niyagawa J, Kono N, Tarui S, Kiyotaki C, Yoshizaki K. Demonstration of IL-1 beta on perifollicular endothelial cells in the thyroid glands of patients with Graves' disease. J CUn Endocrinol Metab 1989;69:738-749. Tandon N, Weetman AR T cell and thyroid autoimmunity. J Roy Coll Phys Lond 1994;28:10-18. Lahat N, Rabat MA, Sadeh O, Kinarty A, Kraiem Z. Regulation of HLA-DR and co-stimulatory B7 molecules on human thyroid carcinoma cells: differential binding of transcription factors to the HLA-DRa promoter. Thyroid 1998;8:361-369. Jones DE, Diamond AG. The basis for autoimmunity: an overview. Baillieres Clin Endocrinol Matab 1995;9:1-24. Iwatani Y, Amino N, Miyai K. Peripheral self tolerance and autoimmunity: the protective role of expression of MHC class II antigens on non lymphoid cells. Biomed Pharmacother 1989;43:593-605. Baker JR Jr, Fosso CK. Immunological aspects of cancers arising from the thyroid follicular cells. Endocrine Rev 1993;14:729-746. Yu M, Xu M, Savas L, Patwardhan N, Khan A. Discordant expression of HLA-DR and Invariant chain (li): a possible pathogenetic factor in Hashimoto's thyroiditis. 87th Annual Metting of the United States and Canadian Academy of Pathology, 28 February to 6 March 1998, p. 60A. Londei M, Lamb JR, Bottazzo GF and Feldmann M. Epithelial cells expressing aberrant MHC class II determinants can present antigen to cloned human T cells. Nature 1984;312:639-641. Lahat N, Sheinfeld M, Baron E, Sobel E, Kraiem Z. Divergent effects of thyroid HLA antigens on T
91.
92.
93.
94.
95.
96.
97.
98.
99.
100.
101.
and natural killer (NK) cytotoxicity. Autoimmunity 1992;13:201-207. Lahat N, Sheinfeld M, Sobel E, Baron E, Kraiem Z. Class II HLA-DR antigens on nonautoimmune human thyroid cells stimulate autologous T cells with high suppressor activity. Autoimmunity 1990;4:125-133. Ebner SA, Stein ME, Minami M, Dorf ME, Stadecher MJ Murine follicular cells can be induced to express class II gene products but fail to present antigen in vitro. Cell Immunol 1987;104:154168. Minami M, Ebner SA, Stadecher MJ, Dorf ME. The effects of phorbol esters on alloantigen presentation. J Immunol 1987;138:393^00. Hirose W, Lahat N, Platzer M, Schmidt S, Davies TF. Activation of MHC restricted rat T cell by clones of syngeneic thyrocytes. J Immunol 1988; 141:10981120. Kimura H, Davies TF. Thyroid-specific T cells in the normal Wistar rat. II. T cell clones interact with cloned Wistar rat thyroid cells and provide direct evidence for autoantigen presentation by thyroid epithelial cells. Clin Immunol Immunopathol 1991;58:195-206. Weetman AP, Cohen S, Makgoba MW, Borystewicz LK. Expression of an intercellular adhesion molecule, ICAM-1, by human thyroid cells. J Endocrinol 1989;122:185-191. Carson S. DNase I hypersensitive sites flank the mouse class II major histocompatibility complex during B cell development. Nucl Acids Res 1991;19:5007-5014. Gonczy P, Reith W, Barras E, Lisowka-Grospierre B, Griscelli C, Hadam MR, Mach B. Inherited immunodeficiency with a defect in a major histocompatibility complex class II promoterbinding protein differs in the chromatin structure of the HLA-DRA gene. Mol Cefl Biol 1989;9:296302. Peteriin BM, Hardy KJ, Larsen AS. Chromatin structure of the HLA-DR alpha gene in different functional states of major histocompatibility complex class II gene expression. Mol Cell Biol 1987;7:1967-1972. Barbieri R, Rimondi AP, Buzzoni D, Luppi L, Nastruzzi C, Orlando P, Gambari R. Hypomethylation of the human HLA-DR alpha gene in breast carcinomas and autologous metastases. Clin Exp Metastasis 1989;7:417-426. Carrington MN, Salter RD, Cresswell P, Ting JR Evidence for methylation as a regulatory mechanism in the HLA-DR alpha gene expression. Immunogenetics 1985;22:219-229.
102.
103.
104.
105.
106.
107.
108.
109.
110.
111.
112.
113.
114.
Lee JS, O'Neill L. Methylation of the HLA-DR alpha gene is positively correlated with expression. Immunogenetics 1987;26:92-98. Wang Y, Peterlin BM. Methylation patterns of HLADR alpha gene in six mononuclear cell lines. Immunogenetics 1986;24:298-303. Gambari R, Del-Senno L, Barbieri R, Buzzoni D, Gustafsson K, Giacomini P, Natali PG. Lack of correlation between hypomethylation and expression of the HLA-DR alpha gene. Eur J Immunol 1986;16:365-369. Nepom GT, Chung J, West KA. Differential expression of HLA-DQBl alleles in a heterozygous cell line. Immunogenetics 1995;42:143-148. Toyoda H, Redford A, Magalong D. Allele-specific methylation in the 5'-regulatory region of class II DQ beta genes in the human major histocompatibility complex (MHC): relationship to autoimmune disease susceptibility. Dis Markers 1992;10:7-18. Osborne A, Tschickardt M, Blanck G. Retinoblastoma protein expression facilitates chromatin remodeling at the HLA-DRA promoter. Nucl Acids Res 1997;25:5095-5102. Currie RA. NF-Y is associated with the hi stone acetyltransferases GCN5 AND P/CAF. J Biol Chem 1998;273:1430-1434. Alexander S, Hubbard SC, Strominger JL. HLADR antigens of autologous melanoma and B lymphoblastoid cell lines: differences in glycosylation but not protein structure. J Immunol 1984; 133:315320. Caplen HS, Salvadori S, Gansbacher B, Zier KS. Post-transcriptional regulation of MHC class II expression in human T cells. Cell Immunol 1992;139:98-107. De Lerma-Barbaro A, Sartoris S, Tosi G, Nicolis M, Accolla RS. Evidence for a specific posttranslational mechanism controlling the expression of HLA-DQ, but not -DR and -DP molecules. J Immunol 1994;153:4530-4538. Kern MJ, Stuart PM, Omer KW, Woodward JG. Evidence that IFN-gamma does not affect MHC class II gene expression at the post-transcriptional level in a mouse macrophage cell line. Immunogenetics 1989;30:258-265. Maffei A, Perfetto C, Ombra N, Del Pozzo G, Guariola J Transcriptional and post-transcriptional regulation of human MHC class II genes require the synthesis of short-lived proteins. J Immunol 1989;142:3657-3661. Del-Pozzo G, Perfetto C, Ombra MN, Ding GZ, Guardiola J, Maffei A. DNA polymorphism in the 5'-flanking region of the HLA-DQAl gene. Immunogenetics 1992;35:176-182.
115.
116.
117.
118.
119.
120.
121.
122.
123.
124. 125.
126.
127.
128.
129.
Perfetto C, Zacheis M, McDaid D, Meador JW 3rd, Schwartz BD. Polymorphism in the promoter region of HLA-DRB genes. Human Immunol 1993;36:2733. Pinet V, Eliaou JF, Clot J Description of a polymorphism in the regulatory region of the HLA-DRA gene. Human Immunol 1991;32:162-169. Morzycka-Wroblewska E, Munshi A, Ostermayer M, Harwood JI, Kagnoff MR Differential expression of HLA-DQAl alleles associated with promoter polymorphism. Immunogenetics 1997;45:163-170. Louis P, Pinet V, Cavadore P, Kerlan-Candon S, Clot J, Eliaou JF. Differential expression of HLA-DRB genes according to the polymorphism of their regulatory region. C Roy Acad Sci III 1994;317:161-166. Kelly AP, Monacco JJ, Cho S, Trowsdale J A new human HLA-class II related locus, DM. Nature 1991;353:571-573. Brown AM, Wright KL, Ting JPY Human major histocompatibility complex class Il-associated invariant chain gene promoter. Functional analysis and in vivo protein/DNA interactions of constitutive and IFN-gamma-induced expression. J Biol Chem 1993;268:26328-26333. Glimcher LH and Kara CJ Sequences and factors: a guide to MHC class II transcription. Annu. Rev. Immunol 1992;10:13-49. Mach B, Steimle V, Martinez-Soria E, Reith W. Regulation of MHC class II genes: lessons from a disease. Ann Rev Immunol 1996;14:301-331. Benoist C and Mathis D. Regulation of major histocompatibility complex class II genes: X, Y and other letters of the alphabet. Ann Rev Immunol 1990;8:681-715. Ting JPY, Baldwin AS. Regulation of MHC gene expression. Curr Opin Immunol 1993;5:8-16. Cogswell JP, Zeleznik-Le N, Ting JPY. Transcriptional regulation of the HLA-DRA gene. Crit Rev Immunol 1991;11:87-112. Vilen BJ, Cogswell JP and Ting JPY. Stereospecific alignment of the X- and Y-elements is required for major histocompatibility complex class IIDRA promoter function. Mol Cell Biol 1992;11:2406-2415. Steimle V, Durand B, Barras E, Zufferey M, Hadam MR, Mach B, Reith W. A novel DNA binding regulatory factor is mutated in primary MHC class II deficiency (Bare lymphocyte syndrome). Genes Dev 1995;9:1021-1032. Durand B, Sperisen P, Emery P, Barras E, Zufferey M, Mach B, Reith W. RFXAP, a novel subunit of the RFX DNA binding complex is mutated in MHC class II deficiency. EMBO J 1997;16:1045-1055. Itoh L, Y, Peterlin BM, Ting JPY. Affinity enrichment and functional characterization of TRAXl,
333
130.
131.
132.
133.
134.
135.
136.
137.
138.
139.
334
a novel transcription activator and XI-sequencebinding protein of HLA-DRA. Mol Cell Biol 1995;15:282-289. Song ZM, Krishna S, Thanos D, Strominger JL, Ono SJ A novel cyteine-rich sequence-specific DNAbinding protein interacts with the conserved X-box motif of the human major histocompatibility complex class II genes via a repeated Cys-His domain and functions as a transcriptional repressor. J Exp Med 1994;180:1763-1774. Reith W, Ucla C, Barras E, Gaud A, Durand B, Herreo Sanchez C, Kobr M, Mach B. RFXl, a transactivator of hepatitis B virus enhancer I, belongs to a novel family of homodimeric and heterodimeric DNA-binding proteins. Mol Cell Biol 1994;14:1230-1244. Reith W, Herrero Sanchez C, Kobr M, Silacci P, Berte C, Barras E, Fey S, ad Mach B. MHC class II regulatory factor RFX has a novel DNA-binding domain and a functionally independent dimerization domain. Genes Dev 1990;4:1528-1540. Van Huijsduijnen RH, Li XY, Black D, Matthas H, Benoist C, Mathis D. Co-evolution from yeast to mouse: cDNA cloning of the two NF-Y (CP-l/CBF) subunits. EMBO J 1990;9:3119-3127. Sinha S, Maity SN, Lu J, De Crombrugghe B. Recombinant rat CBF-C, the third subunit of CBF/NFY, allows formation of a protein-DNA complex with CBF-A and CBF-B and with yeast HAP2 and HAP3. Proc Natl Acad Sci USA 1995;92:1624-1628. Ting JPY, Painter A, Zeleznik-Le NJ, MacDonald G, Moore TM, Brown A, Schwartz BD. YB-1 DNAbinding protein represses interferon-gamma activation of class II major histocompatibility complex genes. J Exp Med 1994;179:1605-1611. Hasegawa SL, Boss JM. Two B cell factors bind the HLA-DRA X box region and recognize different subsets of HLA-class II promoters. Nucl Acids Res 1991;19:6269-6276. Andersson G, Peteriin BM. NF-X2 that binds to the DRA X2-box is an activator protein. 1. Expression cloning of c-Jun. J Immunol 1990; 145:34563462. Moses H, Panek RB, BenvenisteEN, Ting JPY. Usage of primary cells to delineate IFN-gammaresponsive DNA elements in the HLA-DRA promoter and to identify a novel IFN-gamma-enhanced nuclear factor. J Immunol 1992; 148:3643-3651. Ono SJ, Lioh HC, Davidon R, Strominger JL, Glimcher LH. Human X-box binding protein 1 is required for the transcription of a subset of human class II major histocompatibility genes and forms a heterodimer with c-Fos. Proc Natl Acad Sci USA 1991;88:4309^312.
140.
141.
142.
143.
144.
145.
146.
147.
148.
149.
150.
Kara CJ, Liou HC, Ivashkiv LB, Glimcher LH. A c-DNA for a human cyclic AMP response elementbinding protein which is distinct from CREB and expressed preferentially in brain. Mol Cell Biol 1990;10:1347-1357. Tsang SY, Nakanishi M, Peteriin BM. Mutational analysis of the DRA promoter: cw-acting sequences and trans-acting factors. Mol Cell Biol 1990;10:711719. Cogswell JP, Austin J, Ting JPY. The W element is a positive regulator of the HLA-DRA transcription in various DR-H cell types. J Immunol 1991; 146:13611367. Sugawara M, Scholl T, Mahanta SK, Ponath PD, Srominger JL. Cooperativity between the J and S elements of class II major histocompatibihty complex genes as enhancers in normal and class IInegative patient and mutant B cell lines. J Exp Med 1995;182:175-184. Safarny G, Perry RP Transcription factor RFXl helps control the promoter of the mouse ribosomal protein-encoding gene rpL30 by binding to its a element. Gene 1993;132:279-283. Zeleznik-Le NJ, Azizkhan JC, Ting JPY. Affinity purified CCAAT-box binding protein (YEBP) functionally regulates expression of a human class II major histocompatibility complex gene and type herpes simplex vims thymidine kinase gene. Proc Natl Acad Sci USA 1991;88:1873-1877. Mantovani R, Pessara U, Tronche F, Li XY, Knapp AM, Pasquali JL, Benoist C, Mathis D. Monoclonal antibodies to NF-Y define its function in MHC class II and albumin gene transcription. EMBO J 1992;11:3315-3322. Reith W, Kobr M, Emery P, Durand B, Siegrist CA, Mach B. Cooperative binding between factors RFX and X2BP to the X and X2 boxes of the MHC class II promoters. J Biol Chem 1994;269:20020-20025. Moreno CS, Emery P, West JE, Durand B, Reith W, Mach B, Boss JM. Purified X2 binding protein (X2BP) cooperatively binds the class II MHC X box region in the presence of purified RFX, the X box factor deficient in the bare lymphocyte syndrome. J Immunol 1995;155:4313-4321. Loise-Plence P, Moreno CS, Boss JM. Formation of a regulatory factor X/X2 box-binding protein/nuclear factor-Y multiprotein complex on the conserved regulatory regions of HLA class II genes. J Immunol 1997;159:3899-3909. Durand B, Kobr M, Reith W, Mach B. Functional complementation of major histocompatibility complex class II regulatory mutants by the purified X-box binding protein RFX. Mol Cell Biol 1994;14:6839-6847.
151.
152.
153.
154.
155.
156.
157.
158.
159.
160.
Klein C, Lisowska-Grospierre B, LeDeist F, Fischer A, Griscelli C. Major histocompatibility complex class II deficiency: clinical manifestations, immunologic features, outcome. J Pediatr 1993;123:921928. Kara CJ, Glimcher LH. In vivo footprinting of MHC class II genes: bare promoters in the bare lymphocyte syndrome. Science 1991;252:709-712. Kara CJ, Glimcher LH. Three in vivo promoter phenotypes in MHC class II deficient combined immunodeficiency. Immunogenetics 1993;37:227-230. Steimle V, Otten LA, Zufferey M, Mach B. Complementation cloning of an MHC class II transactivator mutated in hereditary MHC class II deficiency (or bare lymphocyte syndrome). Cell 1993;75:135-146. Kern I, Steimle V, Siegrist CA, Mach B. The two novel MHC class II transactivators RFX5 and CIITA both control expression of HLA-DM genes. Int Immunol 1995;7:1295-1300. Silacci P, Mottet A, Steimle V, Reith W, Mach B. Developmental extinction of major histocompatibility complex class II gene expression in plasmocytes is mediated by silencing of the transactivator gene CIITA. J Exp Med 1994;180:1329-1336. Riley JL, Westerheide SD, Price JA, Brown JA, Boss JM. Activation of class II MHC genes requires both the X box region and the class II transactivator (CIITA). Immunity 1995;2:533-543. Zhou H, Gfimcher LH. Human MHC class II gene transcription directed by the carboxyl terminus of CIITA, one of the defective genes in type II MHC combined immune deficiency. Immunity 1995;2:545-553. Muhlethaler-Mottet A, Otten LA, Steimle V, Mach B. Expression of MHC class II molecules in different cellular and functional compartments is controlled by different usage of multiple promoters of the transactivator CIITA. EMBO J 1998; 16:28512860. Krief P, Augery-Bourget Y, Plaisance S, Mercj MF, Assier E, Tanchou V, Billrd M, Boucheix C, Jasmin C, Azzarone B. A new cytokine (IK) downregulating HLA class II: monoclonal antibodies.
161.
162.
163.
164.
165.
166.
cloning and chromosome locaUzation, Oncogene 1994;9:3449-3456. Vedrenne J, Assier E, Perno R, Bouzinba Segard H, Azzarone B, Jasmin C, Charron D, Krief P. Inhibitor (IK) of IFN-gamma induced HLA class II antigens expression also inhibits HLA class II constitutive expression in the human Raji B cell line. Oncogene 1997;14:1453-1461. Montani V, Shong M, Taniguchi SI, Suzuki K, Giuliani C, Napolitano G, Saito J, Saji M, Fiorentino B, Reimold AM, Singer DS, Kohn LD. Regulation of major histocompatibility class II gene expression in FRTL-5 thyrocytes: opposite effects of interferon and methimazole. Endocrinology 1998; 139:290302. Montani V, Taniguchi SI, Shong M, Suzuki K, Ohmori M, Giuliani C, Napolitano G, Saji M, Fiorentino B, Reimold AM, Ting JPY, Kohn LD, Singer DS. Major histocompatibility class II HLADRa gene expression in thyrocytes: counter regulation by the class II transactivator and thyroid Y box protein. Endocrinology 1998;139:280-289. Balducci-SilanoPL, Suzuki K, Ohta M, Saito J, Ohmori M, Montani V, NapoHtano G, Shong M, Taniguchi SI, Pietrarelli M, Lavaroni S, Mori A, Singer DS, Kohn LD. Regulation of major histocompatibility (MHC) class II human leukocyte antigen DRa gene expression in thyrocytes by single strand binding protein-1, a transcription factor that also regulates thyrotropin receptor and MHC class I gene expression. Endocrinology 1998;139:2300-2313. Lu Y, Boss JM, Hu SX, Xu HJ, Blanck G. Apoptosisindependent retinoblastoma protein rescue of HLA class II messenger RNA IFN-y inducibility in nonsmall cell lung carcinoma cells. Lack of surface class II expression associated with a specific defect in HLA-DRA induction. J Immunol 1996; 156:24952502. Muhlethaler-Mottet A, Di Berardino W, Otten LA, Mach B. Activation of the MHC class II transactivator CIITA by interferon-}/ requires cooperative interaction between STATl and USF-1. Immunity 1998;8:157-166.
335
(c) 2000 Elsevier Science B.V. All rights reserved. Cancer and Autoimmunity Y. Shoenfeld and M. E. Gershwin, editors
Cancer Immunity: A Problem of Self-Tolerance Shohei Hori^ Jocelyne Demengeot^ Antonio Bandeira^ and Antonio Coutinho^ ^Instituto Gulbenkian de Ciencia, Oeiras, Portugal; -^ Unite du Developpement des Lymphocytes, CNRS URA 1961 y Institut Pasteur, Paris, France
SUMMARY This discussion focuses on the implications of recent findings on natural tolerance for the immunotherapy of cancer. It is argued that cancer cells, just like all other cells in the body, are tolerized by active, dominant mechanisms mediated by tissue-specific regulatory T cells which "suppress" inflammatory or otherwise aggressive responses to the antigens they express, even if these are "cancer-specific". It follows that successful immunotherapy of cancer should require prior inactivation of such tolerance mechanisms and cells. Based on the limited knowledge concerning the immunobiology of regulatory T cells, strategies are proposed to achieve that goal, while calling the attention to the possibility that indiscriminate primings with cancer cells may well result in re-inforcement of dominant tolerance mechanisms and cancer progression.
1. INTRODUCTION The close conceptual relationship between immunity to cancer cells and autoimmunity has not always been explicit. Thus, at first glance, the conventional framework would expect two opposite situations: in autoimmune disease, the system undesirably reacts and damages normal self-components, and we should attempt to suppress such responses and re-establish tolerance; in contrast, we thrive to promote aggressive immune responses to cancer cells, based on the notion that such cells express "neo-antigens", towards which conventional wisdom expects no tolerance.
This framework has been altered with the rise of notions proposing that physiological self-tolerance is not, as classically thought, the result of physical or functional elimination of autoreactive cells. Rather, physiological self-tolerance would be the manifestation of a distinct type of immune activity that, instead of eliminating target cells, promotes their survival, growth or functional performance [1, 2]. For these views, a normal cell in the body is recognized as such and "actively" tolerized by the immune system. Obviously, if such a tolerized cell is transformed and becomes a cancer cell expressing novel antigens, they too are recognized by the immune system of the host, and the cells will be the target for two opposing types of immune reactions: one that applies to all normal cells of that type and mediates their maintenance in the body; another, that is directed at the "tumor antigens" and at the elimination of the cells expressing them. Every tumor cell will thus be the target of these two contradictory activities, the relative efficiency of which will determine the endresult: either the "successful" destruction of cancer cells and tumor elimination, or maintenance of selftolerance and tumor progression. In short, even if expressing high levels of tumor antigens, the cancer cell would continue to express a large number of the normal autoantigens that characterize and immunologically define the tissue and are targets for the maintenance of tolerance. In other words, cancer cells are predominantly self, in spite of all neo-antigens they might express. Hence, a solution to the cancer immunity problem must include a proper understanding of immunological natural tolerance.
337
2. RECESSIVE VERSUS DOMINANT TOLERANCE The above problem gains in definition if we now consider the major alternatives for the principle processes that ensure natural tolerance, namely, as currently designated, recessive versus dominant tolerance [1, 2]. The problem is far from "academic" for it has direct implications in the strategies that can be used in "cancer immunotherapy", some of which have progressed into clinical trials [3, 4]. Thus, if the tolerance to self (and thus to cancer cells) is ensured by dominant mechanisms, immunization may lead to results that are precisely the contrary to those intended, namely, to re-inforcement of such mechanisms and to further "protection" of the target cells. If tolerance were recessive, that is, based on the absence of autoreactivities, there would be no reason for this discussion. A logical strategy for cancer vaccination based on such recessive model would be molecular identification of "tumor-specific" antigens, followed by priming with such antigens together with adjuvant and/or inflammatory cytokines, because the model allows immune response only towards such neo-antigens. In contrast, if tolerance is dominant, prior inactivation of such dominant regulatory mechanisms, which obstruct tumor destructive immune responses, is critical for successful cancer vaccination. If such dominant mechanisms are inactivated in advance, then one may even ignore the nature of tumor-specific antigens, because priming even with tissue-specific "normal" antigens should effectively induce aggressive inflammatory immunity towards the tissue that corresponds to the tumor and consequently lead to tumor destruction.
3. THE CASE OF ACQUIRED RESISTANCE TO AUTOIMMUNE DISEASE Among the various systems of experimentally induced autoimmune disease (AID), EAE (Experimental Allergic Encephalomyelitis) is a prime example for this discussion. Some strains of rats and mice, if immunized with myefin basic protein (MBP), one of myelin proteins, in Complete Freunds Adjuvant, develop a severe disease caused by inflammation in the central nervous system, consequent to the activation of CD4 T cells. Disease can be induced also by transfer of
338
purified MBP-specific CD4 T cells, if activated, into nave animals [5]. Amongst other things, these facts demonstrate that normal individuals harbor, throughout life, autoreactive tissue-specific T cells that can readily be activated to aggressive functions and cause disease. Defenders of conventional views, claiming that tolerance is achieved by elimination of all autoreactive lymphocytes, have argued, however, that such observations do not infringe those notions. Thus, it could be considered that such autoreactive T cells are normally not activated because they meet antigen either not at all (ignorance), or on the surface of "non-professional antigen-presenting cells" in a "non-dangerous" context. The very elegant experiments by Lafaille and Tonegawa have now formally disproven this whole set of hypothesis, by demonstrating that anti-MBP TCR transgenic mice harboring a clone of MBP-specific CD4 T cells will spontaneously develop progressive fatal disease, in absolutely physiological conditions of antigen expression and presentation [6]. Their experiments have also shown that relatively low numbers of "regulatory" CD4 T cells, that are physiologically produced in normal animals, are capable of restoring self-tolerance and prevent the development of autoimmune pathology in animals that contain millions of potentially aggressive MBP-specific T cells [7, 8]. Beyond that demonstration of "dominant tolerance" in physiology, the reason to review this particular experimental system in the context of cancer immunity, is the well-established set of observations demonstrating that tolerance can readily be re-inforced and boosted by immunization. This was first suspected from the natural course of EAE, that spontaneously remits if the animal survives acute phase [9]. Moreover, new repeated attempts to re-induce another course of disease symptoms by secondary immunization systematically fail [10]. In other words, a primary activation of aggressive effector cells seems to reinforce the mechanisms that maintain tissue integrity (via inhibition of aggressive responses?). Demonstration that disease "resistance" resulted from activation of regulatory mechanisms was provided in various ways, one of which provided the basis for Cohen's "T cell vaccination" and bears legitimate hopes on future human therapeutic interventions for autoimmune disease. Thus, priming with inactivated specific effector cells [11, 12], even with peptides of the respective TCRs [13,14], activates "resistance" towards attempts
at inducing EAE. Similar observations are available in several other systems of experimentally induced autoimmune diseases [15, 16]. In summary, priming of aggressive effector responses towards self-tissues and cells results in reinforcement of tissue-protective mechanisms that ensure tolerance.
4. DOES PRIMING WITH CANCER CELLS OR ANTIGENS RE-INFORCE TISSUE-SPECIFIC TOLERANCE? Current mainstream strategies in cancer immunotherapy are based on molecular identification of genes for tumor antigens [3], or on transduction of genes for co-stimulatory molecules and/or cytokines into tumor cells, intending to augment "antigenicity" of tumor cells [4]. However, the above observations could be interpreted to suggest a word of caution in such attempts to re-inforce immune responses to tumor cells. Thus, it may be expected that indiscriminate priming regimes will, instead, result in boosting of the physiological tolerant state towards that tissue, that is actually protective of the cancer. Litde is known on the basic aspects of cellular physiology of "regulatory T cells", making it very difficult to establish general rules. It has been established, however, that contact with specific tissue antigens is necessary for generation of tissue-specific regulatory T cells [17, 18]. Moreover, while some regulatory T cells with specificity towards ubiquitously expressed antigens are produced in the thymus and require no peripheral antigen exposure for maintenance, contact of recent thymic emigrants with tissue antigens—if in the presence of those thymusderived CD4 regulatory T cells—results in the "education" to regulatory functions of both CD4 and CDS T cells [1, 19, 20]. We do not know at present the rules of operation for such "infectious, dominant tolerance", but these observations open the possibility that priming, by systemic routes, with cancer cells will recruit new regulatory T cells that have recently exited the thymus and would otherwise have a low probability of reaching the tissue in question (and turn into regulatory functions). From available evidence, it could be expected that priming with cancer cells would be most "tolerogenic" in conditions where de novo T cell
production in the thymus is still abundant, such as in young individuals. Supporting this prediction, there has been a considerable body of evidence showing that cancer patients as well as tumor-bearing animals harbor regulatory (or "suppressor") T cells, which obstruct tumor destructive immune response by effector T cells (mainly by CDS CTL) often in a "tumor-specific" manner, and consequently help tumor progression [21-27]. Therefore, prior inactivation of such regulatory T cells is crucial for successful cancer immunotherapy.
5. SUGGESTIONS ON STRATEGIES TO BREAK DOMINANT TOLERANCE TO CANCER CELLS How can we then achieve effective anti-tumor immunity, while avoiding the risk of emergence of autoimmune diseases? The experimental protocols, which make normal animals suffer from autoimmune disease, seem to give us a clue to approach the problem. It has been shown that treatment of normal adult animals with cyclophosphamide (Cy) or sublethal yirradiation, if coupled with thymectomy, results in development of various organ-specific autoimmune disease, whereas each treatment alone does not induce any disease [2S, 29]. It has been suggested that this drastic effect of Cy and y-irradiation is due to eUmination of regulatory T cell pool from the periphery. Obviously, if the animals are not thymectomized, the pool is eventually restored by thymic emigrants and consequently the animals are free of any autoimmune disease [1,2, 2S, 29]. In addition, it is also shown that repetitive infusion of anti-CD25 monoclonal antibody to normal mice lead to emergence of organ-specific autoimmune disease [30]. Increasing numbers of evidence have shown that regulatory T cells are enriched in CD25^ CD4 T cells in normal mice, which constitute rare population in the periphery (5-10% of CD4 T cells in the spleen and the lymph nodes) [31-35]. Thus, repetitive infusion of anti-CD25 antibody results in specific depletion of such regulatory T cells [30]. The above observations indicate that one can transiently eliminate regulatory T cells by these treatments without emergence of any autoimmune disease, although it is not clear that reduced number of antiCD25 antibody infusion can do the task. Therefore, it could be expected that temporary depletion of reg-
339
ulatory T cells by such treatments should shift the balance between tolerance and destructive immune response against tumor cells to the latter, if followed by adoptive transfer of anti-tumor effector T cells. Alternatively, active vaccination with tumor cells or antigens together with inflammatory cytokines, such as IFN-)/ or IL-12, could be substituted for the transfer of effector T cells, for such molecules are expected to effectively prime recent thymic emigrants into inflammatory phenotypes in the absence of regulatory T cells. A series of experiments by North strongly support this idea by demonstrating that treatment of tumorbearing mice with Cy or sublethal y-irradiation can lead to complete regression of various established tumor, if combined with transfer of tumor-sensitized effector T cells. They have shown that the effect of Cy or y-irradiation is not due to direct cytotoxicity against tumor cells but to elimination of CD4 "suppressor" T cells. Thus, these treatments alone do not induce tumor regression, and co-transfer of peripheral CD4 T cells from tumor-bearing mice inhibits tumor regression [36-39]. In addition, it is also demonstrated that treatment with Cy together with IL-12 can cause complete eradication of established tumors, further supporting the idea [40]. These observations clearly show that Cy or sublethal }/-irradiation treatments, if combined with further immune manipulations, are indeed appropriate therapeutic approaches for cancer immunotherapy, precisely because they contribute to removal of dominant regulatory mechanisms. However, considering non-specific cytotoxic effects induced by Cy and yirradiation, treatments that specifically deplete regulatory T cells, such as infusion of anti-CD25 antibody, are apparently much preferable. Development of cytotoxic or suppressive drugs specifically targeted to regulatory T cells should facilitate development of better strategies for cancer immunotherapy.
REFERENCES
ACKNOWLEDGEMENT
12.
This work was carried out in the context of the CNRS LEA "Genetique et developpement de la tolerance naturelle".
13.
340
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
Modigliani Y, Bandeira A, Coutinho, A. A model for developmentally acquired thymus-dependent tolerance to central and peripheral antigens. Immunol Rev 1996;149:155-174. Saoudi A, Seddon B, Heath V, Fowell D, Mason D. The physiological role of regulatory T cells in the prevention of autoimmunity: the function of the thymus in the generation of the regulatory T cell subset. Immunol Rev 1996;149:195-216. Rosenberg SA. A new era for cancer immunotherapy based on the genes that encode cancer antigens. Immunity 1999;10:281-287 Ockert D, Schmitz M, Hampl M, Rieber ER Advances in cancer immunotherapy. Immunol Today 1999;20:63-65. Zamvil SS, Steinman L. The T lymphocyte in experimental allergic encephalomyelitis. Ann Rev Immunol 1990;8:579-621. Lafaille JJ, Nagashima K, Katsuki M, Tonegawa S. High incidence of spontaneous autoimmune encephalomyelitis in immunodeficient anti-myelin basic protein T cell receptor transgenic mice. Cell 1994;78:399-408 Van de Keere F, Tonegawa S. CD4+ T cells prevent spontaneous experimental autoimmune encephalomyelitis in anti-myelin basic protein T cell receptor transgenic mice. J Exp Med 1998; 188:18751882. Olivares-Villagomez D, Wang Y, Lafaille JJ. Regulatory CD4+ T cells expressing endogenous T cell receptor chains protect myeUn basic protein-specific transgenic mice from spontaneous autoimmune encephalomyelifis. J Exp Med 1998;188:1883-1894. Ben-Nun A, Ron Y, Cohen IR. Spontaneous remission of autoimmune encephalomyelitis is inhibited by splenectomy, thymectomy or ageing. Nature 1980;288:389-390 McFarlin DE, Blank SE, Kibler RF. Recurrent experimental allergic encephalomyelitis in the Lewis rat. J Immunol 1974;113:712-715. Ben-Nun A, Werkerle H, Cohen IR. Vaccination against autoimmune encephalomyelitis with Tlymphocyte line cells reactive against myelin basic protein. Nature 1981;292:60-61. Lider O, Reshef T, Beraud E, Ben-Nun A, Cohen IR. Anti-idiotypic network induced by T cell vaccination against experimental autoimmune encephalomyelitis. Science 1988;239:181-183. Vandenbark AA, Hashim G, Offner H. Immunization with a synthetic T-cell receptor V-region pep-
14.
15. 16.
17.
18.
19.
20. 21.
22.
23.
24. 25.
26.
27.
tide protects against experimental autoimmune encephalomyelitis. Nature 1989;341:541-544. Offner H, Hashim GA, Vandenbark AA. T cell receptor peptide therapy triggers autoregulation of experimental encephalomyelitis. Science 1991 ;251:430432. Cohen IR. Regulation of autoimmune disease physiological and therapeutic. Immunol Rev 1986;94:5-21. Kumar V, Aziz F, Sercarz E, Miller A. Regulatory T cells specific for the same framework 3 region of the Vbeta8.2 chain are involved in the control of collagen Il-induced arthritis and experimental autoimmune encephalomyelitis. J Exp Med 1997;185:1725-1733. Taguchi O, Nishizuka Y. Self tolerance and localized autoimmunity. Mouse models of autoimmune disease that suggest tissue-specific suppressor T cells are involved in self tolerance. J Exp Med 1987; 165:146156. Seddon B, Mason D. Peripheral autoantigen induces regulatory T cells that prevent autoimmunity. J Exp Med 1999;189:877-881. Modigliani Y, Coutinho A, Pereira P, Le Douarin N, Thomas-Vaslin V, Burlen-Defranoux O, Salaun J, Bandeira A. Establishment of tissue-specific tolerance is driven by regulatory T cells selected by thymic epithelium. Eur J Immunol 1996;26:18071815. Cobbold S, Waldmann H. Infectious tolerance. Curr Opin Immunol 1998;10:518-524. Fujimoto S, Greene MI, and Sehon AH. Regulation of the immune response to tumor antigens. I. Imuunosuppressor cells in tumor-bearing hosts. J Immunol 1976;116:791-799. Fujimoto S, Greene MI, Sehon AH. Regulation of the immune response to tumor antigens. II. The nature of imuunosuppressor cells in tumor-bearing hosts. J Immunol 1976;116:800-806. Dye ES, North RJ. Specificity of the T cells that mediate and suppress adoptive immunotherapy of estabUshed tumors. J Leukoc Biol 1984;36:27-37. North RJ. Down-regulation of the antitumor immune response. Adv Cancer Res 1985;45:1-43. Chakraborty NG, Twardzik DR, Sivanandham M, Ergin MT, Hellstrom KE, Mukherji B. Autologous melanoma-induced activation of regulatory T cells that suppress cytotoxic response. J Immunol 1990;145:2359-2364. Rohrer JW, Coggin JH Jr. CD8 T cell clones inhibit antitumor T cell function by secreting IL-10. J Immunol 1995;155:5719-5727. Martinotti A, Stoppacciaro A, Vagliani M, Melani C, Spreafico F, Wysocka M, Parmiani G, Trinchieri G, and Colombo MP. CD4 T cells inhibit in vivo the CD8-mediated immune response against murine
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
colon carcinoma cells transduced with interleukin-12 genes. Eur J Immunol 1995;25:137-146. Barrett SP, Toh BH, Alderuccio F, van Driel IR, Gleeson PA. Organ-specific autoimmunity induced by adult thymectomy and cyclophosphamideinduced lymphopenia. Eur J Immunol 1995;25:238244. Fowell D, Mason D. Evidence that the T cell repertoire of normal rats contains cells with the potential to cause diabetes. Characterization of the CD4"^ T cell subset that inhibits this autoimmune potential. J Exp Med 1993;177:627-636. Taguchi O, Takahashi, T. Administration of antiinterleukin-2 receptor alpha antibody in vivo induces localized autoimmune disease. Eur J Immunol 1996;26:1608-1612. Sakaguchi S, Sakaguchi N, Asano M, Itoh M, Toda M. Immunologic self-tolerance maintained by activated T cells expressing IL-2 receptor alpha-chains (CD25). Breakdown of a single mechanism of selftolerance causes various autoimmune diseases. J Immunol 1995;155:1151-1164. Asano M, Toda M, Sakaguchi N, Sakaguchi S. Autoimmune disease as a consequence of developmental abnormality of a T cell subpopulation. J Exp Med 1996;184:387-396. Suri-Payer E, Amar AZ, Thornton AM, Shevach EM. CD4+CD25+ T cells inhibit both the induction and effector function of autoreactive T cells and represent a unique lineage of immunoregulatory cells. J Immunol 1998;160:1212-1218. Thornton AM, Shevach EM. CD4+CD25+ immunoregulatory T cells suppress polyclonal T cell activation in vitro by inhibiting interleukin 2 production. J Exp Med 1998;188:287-296. Takahashi T, Kuniyasu Y, Toda M, Sakaguchi N, Itoh M, Iwata M, Shimizu J, Sakaguchi S. Immunologic self-tolerance maintained by CD25"^CD4"^ naturally anergic and suppressive T cells: induction of autoimmune disease by breaking their anergic/suppressive state. Int Immunol 1998;10:1969-1980. North RJ. Cyclophosphamide-fascilitated adoptive immunotherapy of an established tumor depends on elimination of tumor-induced suppressor T cells. J Exp Med 1982; 155:10631074. North RJ. Radiation-induced, immunologically mediated regression of an established tumor as an example of successful therapeutic immunomanipulation. Preferential elimination of suppressor T cells allows sustained production of effector T cells. J Exp Med 1986;164:1652-1666. Awwad M, North RJ. Cyclophosphamideinduced immunologically mediated regression
341
39.
342
of a cyclophosphamide-resistant murine tumor: a consequence of eliminating precursor L3T4'^ suppressor T-cells. Cancer Res 1989;49:1649-1654. North RJ, Awwad M. Elimination of cycling CD4"'" suppressor T cells with an anti-mitotic drug releases non-cycling CD8+ T cells to cause regression of
40.
an advanced lymphoma. Immunology 1990;71:9095. Tsung K, Meko JB, Tsung YL, Peplinski GR, Norton JA. Immune response against large tumors eradicated by treatment with cyclophosphamide and IL-12. J Immunol 1998;160:1369-1377.
© 2000 Elsevier Science B.V All rights reserved. Cancer and Autoimmunity Y. Shoenfeld and M. E. Gershwin, editors
Maternal Immune Response to Trophoblast, GTD, and Cancer Eytan R. Bamea and Steven P. Levine SIEP, The Society for the Investigation of Early Pregnancy
The trophoblast is mostly derived from the paternal genome. Variations of this genomic makeup can result in unfavorable consequences. Classical studies conducted by Surani et al. [1] have shown in mice that the absence of the maternal genome in the fertilized tgg leads to the development of a large trophoblast. In contrast, lack of the paternal genome and expression of only the maternal genome led to the development of the embryo, but almost no trophoblast. However, in both instances, this unilateral gene expression is incompatible with life and leads, inevitably, to fetal demise at mid gestation or even earlier. Such evidence supports the necessity of both maternal and paternal genomes as ingredients for successful reproduction. This then raises a fundamental question of how a paternal genome dependent structure—the trophoblast— which has a foreign genetic make up and is in close proximity to the maternal surface, is capable of surviving and thriving, rather than being summarily rejected by the maternal immune system shortly after implantation. Therefore, in the first part of this chapter, we will discuss how the conceptus is viewed by the maternal organism. Is the trophoblast recognized but tolerated by the maternal organism or, conversely, through evasion and masking effects, does it avoid recognition by the immune system, enabhng successful mammalian reproduction? If the second hypothesis is correct and the conceptus survives by avoiding recognition as non self, then it resembles the phenomena seen in patients with cancer. Therefore, in the second part of this chapter, we will discuss the maternal immune response to a mahgnant trophoblast, i.e., gestational trophoblastic disease (GTD). These disorders are believed to be derived from over expression of the paternal genome, dyspermia with lack of maternal component. Lack of the maternal genome altogether in the trophoblastic
tissue yields a conceptus that at this point is completely non-self and, therefore, should be rejected. However, for some reason this does not happen. We will discuss the maternal immune reaction to GTD, and based on these observations, reflect on immunity and pathological pregnancy. In this context, the immune reaction to a variety of cancers that may be found in pregnancy will be examined as well. This is important because of the evidence supporting maternal protection from cancer during pregnancy (as discussed in detail recently in Bamea and Bamea, 1997) [2]. At worst, the prognosis of the patients is not modified by their pregnant condition [3]. What are the resulting effects when the unique situation of modified maternal immune response during pregnancy is combined with the presence of cancer, which by itself is associated with an altered immune response? Paradoxically, instead of the mother becoming more ill, she appears to benefit to some degree from concurrent pregnancy. Moreover, previous pregnancy appears to confer long term protection against cancer.
1. IMMUNE REACTION TO THE NORMAL TROPHOBLAST: A COMBINATION OF TOLERANCE AND EVASION The protection of the trophoblast from a cytotoxic attack may be understood in terms of either a tolerance by the maternal immune system to allopresence or the evasion of the trophoblast from detection by a fully operational immune system. This question has occupied reproductive scientists for many years and true until present, no clear consensus has emerged with respect to the precise answer. Currently, there is evidence to suggest that both mechanisms may contribute to the
343
success of pregnancy. Herein we will briefly review elements that support the validity of those two theories. Experimental models have examined the question of maternal tolerance of the conceptus. It was found that the conceptus itself, represented by amnion or chorion when transplanted into the rat skin, survived for up to 14 days compared to a heterologous skin graft which lasted only 7 days before being rejected. In addition, the decidua (of maternal origin) survived the longest and actually contributed to the survival of the amnion and chorion when transplanted together. This indicates that the conceptus has the ability to blunt, albeit temporarily, the immune system of the intact animal, and further, that the maternal system, represented by the decidua, has a significant role in the enhancing this immune auto-tolerance. Therefore, these observations point to the additive role of the mother and conceptus in allograft survival [4]. What remains rather surprising is the lack of immunologic consequence due to trophoblastic cells migration to the lung, a condition apparently unique to human pregnancies. These cells in the peripheral circulation neither stimulate an inflammatory response nor cause cellular lymphoid infiltration, which in general indicate an immune response to alloantigens. On the other hand, as we will discuss, extravillous trophoblasts express MHC type I antigens.
1.1. Evidence for trophoblastic evasion It is important to determine whether the specialized immune environment created during pregnancy results from a quantitative change in the amount of circulating lymphocytes or from contributions of various immunomodulatory factors. Studies have shown that there are no significant alterations in the relative presence of T and B lymphocytes or in the ratio of T helper/ suppressor cells in the blood and peripheral tissues. However, in the placenta, the inverse may be seen, with relatively more CD8+ cells than CD4+ cells. The number and activity of NK cells in the periphery is decreased, but no changes in their function are seen in the decidua, where the activity is less than half of that seen in the periphery [5]. Because no major quantitative changes in the lymphocyte population are present during pregnancy when compared to non pregnant women, one must explore any qualitative changes in the immune system that
344
may contribute to the unique immune status. It is logical to assume that the observed phenomena are a result of specific immunomodulatory products of fetal origin and intricate interactions within the maternal immune system. The basis for a cytotoxic attack depends upon the histocompatibility of the foreign agent and the response of the maternal host - whether the immune system recognizes it as self or nonself. This discrimination requires the recognition of glycoprotein transplantation antigens on the cell surface, in particular, major histocompatibility complex (MHC) antigens. These include both the monomorphic class I MHCs and the polymorphic class II MHCs which are expressed on B-cells, macrophages, and other gammainterferon treated immunocompetent cells [6]. Human placental villous trophoblasts do not express class I or class II histocompatibility antigens (HLA-A, B, and DR), B2 microglobulin, or H-Y antigens, whereas trophoblasts of the extravillous type may express certain class I MHC antigens. On the other hand, hCG is expressed by the villous trophoblast while it is not expressed by the extravillous trophoblast. These major differences in antigen expression between the two trophoblastic types and locations contribute to the limited trophoblast invasivity at the extravillous site as well as to the lack of immune recognition by maternal lymphocytes in the villous trophoblast, thereby creating the necessary balance between invasion and containment. Studies of human syncitiotrophoblast plasma membranes indicate that monoclonal antibodies and heteroantisera do recognize trophoblast determinants. However, the trophoblast may also express viral antigens that go undetected by the immune system. The existence of a special HLA-G type, a truncated type MHC, may contribute to the recognition of the trophoblast as "self" [7] and protect against NK cells. Unlike the class II MHCs, HLA-G functions as a class I MHC antigen, exhibiting limited polymorphism. This characteristic protects the paternallyderived HLA-G genes from recognition by the immune system as foreign and may restrict the extent of peptide antigen presentation to maternal T cells [8]. Trophoblast cells are also protected from NK mediated lysis by their lack of NK target structures on their surface [9]. Another antigen present on synctiotrophoblasts is the trophoblast-lymphocyte crossreactive antigen (TLX). There has been a lot of controversy regarding the exact nature and significance
of this interaction. This unique trophoblast alloantigenic system is similar but unrelated to HLA antigens. TLX appears to be a part of an allelic antigen system that differs from the previously defined histocompatibility systems. The detection of TLX antigens on the trophoblast cell surface by the maternal immune system may stimulate the production of protective factors such as blocking antibodies that may aid in successful implantation [10]. A typical response in normal pregnancy is the production of blocking factors that inhibit mixed lymphocyte culture. Some of these blocking antibodies may be TLX specific, leading to the possibility that TLX antigens are functioning similarly to transplantation antigens and elicit a protective maternal immune response that protects the developing placenta. In this capacity, the CD46+ antigen may be involved in allowing the interaction of non-self disparate cells, thus allowing sperm egg interaction and implantation of the blastocyst to the endometrium [11]. Immune reactions may be created through raising of monoclonal antibodies (Mabs) against trophoblasts, suggesting that trophoblasts are not immunologically silent. Mabs have been raised against a variety of trophoblastic components in an effort to characterize the immunohistochemical nature of trophoblast populations and to search for trophoblast-specific molecules [12]. Other research indicates that surface antigens on mouse trophoblasts may be masked by an inert sialomucin coating that is immunologically inert, however, this has not yet been proven [13]. Trophoblast derived IFNs may also be a regulator of their own cellsurface antigen expression. IFNs cause an increase in both the expression and shedding of surface antigens [14]. Trophoblast IFNs may also contribute to local immunosuppression by stimulating the secretion of suppresor cells that further aid in immunoregulation [15]. This occurs at the feto-placental interface, resulting in the production of cytokines that enable the embryo to implant and protect the fetus. In vitro studies of IFN-b has shown the suppression of mitogeninduced proliferation on human T and B lymphocytes, lending evidence to the theory that trophoblast IFN induced immunosuppression causes fetal protection against cellular immune response. The maternal immune response and endocrine system cooperate in the maintenance of this cytokine system that protects both the trophoblast and prevents the rejection of the fetus.
The placenta secretes a variety of placenta-specific materials including both proteins and steroid hormones. The placental proteins have a qualitative effect as exhibited by the actions of hCG. hCG acts to inhibit phytohemaglutinin-induced lymphocyte transformation, inhibit mixed lymphocyte culture reaction, and stimulate immunoglobulin synthesis by pokeweed mitogen- activated blood mononuclear cells. In addition to hCG, other large proteins PAPP-A, SP-1, and human placental lactogen (HPL) have been shown to inhibit complement-induced hemolysis, inhibit PHA induced lymphocyte formation, and inhibit mixed lymphocyte culture reaction. The role of PP14 as inhibitor of interleukin 1 has also been suggested [16]. PAPP-A may have a significant effect as an immunosuppressive factor. It has been shown to be produced by normal trophoblast cell cultures and to be greatly reduced in choriocarcinoma cell lines. Trophoblastic fluid from cell cultures of first-trimester human placentas generate suppressor lymphocytes and may contribute to the immunologic tolerance of the fetal allograft [17]. Early pregnancy factor (EPF) may also be an important immunosuppressant although it remains until present poorly defined. In a study by Clark [18], an immunosuppressive material, embryo-associated suppressor factor (EASF), was detected that may correlate with successful implantation. EASF appears to have a direct effect on both T and B cell proliferation, suppression stemming from binding to specific lymphocyte receptors after mitogenic stimulation [19]. In another study, EPF was shown by the rosette-inhibition test to be directly involved in the maintenance of the fetal allograft. EPF may be produced either by the ovary or the placenta in response to a signal from the conceptus and circulating levels in the preimplantation period may indicate the presence of a viable embryo [20]. Because EPF is present in both pregnant and nonpregnant states, its exact role in pregnancy remains elusive. For the past few years we have explored a novel phenomenon, preimplantation factor (PIF) that is only present in pregnancy and which may have an important role in initiating alio- tolerance in mammals. This is a specific embryonal signal that reflects embryonal viability [21- 22]. It is detected shortly after fertilization both in vivo and in embryo cultures and disappears from the circulation when pregnancy fails, weeks before hCG levels start declining [23]. We
345
have identified PIF as being, most likely, a novel oligopeptide. We believe that this factor is capable of modulating the immune system since it is currendy detected by the lymphocyte- platelet binding assay (LPBA) using CD2 antibody which specifically binds T lymphocytes as well as NK cells [24]. Currently, we are aiming to examine the role of this factor by generating antibodies against it and testing whether such antibodies are capable of interfering with pregnancy development, thus establishing its critical role in reproduction. PIF may be an embryonal signal that allows for the initiation of pregnancy. Therefore, a generalized embryo derived signal may be required to initiate the immunological activation that allows for implantation to take place and pregnancy to be successful. In this context, the uterus is a privileged site which however requires involvment of a viable embryo to create a truly accomodating environment. There is also an immunosuppressive response from the effect of placental sex steriods and corticosteroids. Both estrogens and progesterone display evidence of this response. Progesterone is capable of inhibiting PHA-induced lymphocyte transformation or mixed lymphocyte culture reaction and may induce the expression of a lymphocyte blocking factor as well as inhibiting Concanavalin-A stimulated thymidine incorporation by lymphocytes. Progesterone's immunosuppressive properties have been demonstrated both in vivo and in vitro on cell-mediated immune responses, indicating that it may decrease IL-1 action, a stimulator of hCG release [25], and depress lymphocytemonocyte interactions. Estrogens may also enhance the ability of monocytes to phagocytise IgG-coated red blood cells. Blood levels of free corticosteroids are increased in pregnancy and may contribute to the amelioration of several autoimmune conditions such as rheumatoid arthritis. These combined immunosuppressive effects may aid the success of joining the fetus as a homograft to the maternal host [26]. The placenta also expresses regulatory molecules such as growth factors. Receptors for the growth factors, epidermal growth factor (EGF), insulin and insulin-like growth factors (IGF-I and IGF-II) exist on the syncitiotrophoblast surface of the placenta. A receptor for platelet-derived growth factor (PDGF) may also exist on cytotrophoblasts. The EGF receptor serves to bind both EGF and TGF-a. [27]. Suppression of the immune response to the trophoblast surface antigens may be due in part to the
346
production of anti-idiotypic antibodies during pregnancy that negate the effects of anti-HLA antibodies [28]. Immunoglobulin receptors are present in the placenta and are critical for the passage of maternal IgG across the placenta. In addition, large immunoglobulins are not allowed to pass into the fetus, and antipaternal HLA antibodies are selectively removed in the placental sink. Anti-HLA antibodies injected into mice do not attach to the trophoblast, but they do attach to stromal cells and endothelium. Some other anti-HLA antibodies which are not directed against paternal antigens do not pass through the placental barrier, confirming its selectivity. However, leukocytes do pass the placenta in both directions, demonstrating that the placenta is not a true barrier for lymphocytes and, therefore, allowing in certain cases very large molecules passage [29]. Overall, there is evidence that both tolerance, through maternal involvement in pregnancy maintenance and the minimization of the maternal immune response through masking, and evasion are operative throughout pregnancy in a carefully balanced fashion. The alteration of any of those, as seen in clinical situations, leads to the rejection of the conceptus. For instance, patients with autoimmune conditions but normal trophoblast will frequently have a pregnancy loss. Similarly, the presence of a normal maternal environment but defective trophoblast (like a chromosomal abnormality) will result in an equally unfavorable outcome.
2. IMMUNE RESPONSE AND GESTATIONAL TROPHOBLASTIC DISEASE Tumors are analogous to tissue graft in that they are most likely recognized by the immune system, yet through either a tolerance or evasion mechanism, do not elicit a destructive immune response. Clinical evidence shows that individuals with suppressed immune systems are most susceptible to tumor appearance. However, animal experimentation indicates that immune surveillance is directed toward viruses rather than tumors. Because tumors do appear and grow within a host, they must somehow evade an immune response. Tumors may be characteristically poor antigen-presenting cells (APCs), contributing to their nonimmunogenicity. Immune response requires
cell-surface molecules such as the co-stimulator, B7, molecule or cytokines presented by these APCs, especially if the tumor lacks MHC class II antigens. Tumor cells may also lack necessary adhesion molecules such as LFA-1 and -3 or ICAM-1 or present antiadhesive molecules. In addition, like trophoblast cells, they may secrete immunosuppressive TGFb or shed surface antigens [30]. In gestational trophoblastic disease (GTD) and in choriocarcinoma in particular, the malignant trophoblast, like healthy trophoblast, continues to evade the maternal immune response. However, the methods and mechanisms of avoiding this response may differ. For example, in a study by Sunderland [31], 40-70% of the tumor cells studied expressed MHC I antigens, and most of these cells did not express the paternal, polymorphic HLA antigenic determinants (MHC II). Indeed, reports of a specific inhibitory substance to the paternal HLA allotype in patients with GTD have been documented [32]. These studies present a strong case for lack of recognition as nonself. Also, some, but not all, choriocarcinoma cells present HLA-G, a surface antigen presented by normal trophoblast cells. However, other studies indicate that there are no known tumor antigens in GTD that differ from those in normal trophoblast for which an immune response could be elicited [33]. TLX antigens may also be present in choriocarcinoma tissue. If, as stated above, antitrophoblast blocking antibodies are involved in the protection of the trophoblast from the maternal immune response in normal pregnancy, the expression of antigens by choriocarcinoma cells must be important to their survival. While patients with gestational choriocarcinoma rejected skin grafts from inappropriate "first-set" time interval skin from unrelated donors, they tolerated grafts from their husbands or the children of these pregnancies for extended periods of time [34]. In fact, it has been postulated that choriocarcinoma tissue could be supported by response to trophoblast antigens [35]. Therefore, the presence of similar antigens on cells derived at least in part from the paternal genome confer immunity to further reaction against these antigens. Conversely it suggests lack of frank maternal immunosuppression. A common product of both normal trophoblast and choriocarcinoma is the secretion of GM-CSF and CSF-1. All three classical choriocarcinoma cell lines (JEG, JAR, and BeWo) have been shown to secrete
these factors. Antibodies to these substances appear to have an autocrine inhibitory effect on the proliferation of choriocarcinoma cells. However, CSF-1 may be linked to the synthesis of hCG which itself has an immunosuppressive effect on the region surrounding the trophoblast [36]. This is seen also in the early placenta, where incubations with both G-CSF and M-CSF stimulated an increase in hCG secretion [37]. As in normal trophoblasts, the secretion of IFNs may also play a part in local immunosuppression. In both the normal and malignant cases, trophoblast IFN-a and -^ inhibit proHferation. In fact, in a comparison of normal and BeWo cell lines with the addition of 1000 lU/ml of these IFNs, they were much more effective at inhibiting choriocarcinoma cells. In addition, IFN-^ has been shown to inhibit the proHferation of T- and B- lymphocytes, contributing to the immunosuppression of the fetoplacental unit [38]. EPF was discussed as a product of normal pregnancy, but may also be a marker for the diagnosis of malignant trophoblastic tumor. EPF has been detected in the serum of patients with choriocarcinoma and invasive mole by the rosette inhibition test, lending evidence to the altered immune environment present in GTD [39]. As mentioned in the introduction, the state of the immune system may have some correlation with the prevalence of cancer. Based on this argument, if pregnancy would have contributed to the suppression of the maternal immune system, one would expect a heightened susceptibility to cancer during pregnancy. However, the immune system is not suppressed during pregnancy, but rather altered, and may actually contribute to a relative protection against tumor burden. A number of theories have been proposed to explain the role of the immune system in the control of cancer. Evidence of immune intervention in cancer includes postmortem data suggesting more tumors than actually are manifested, presence of lymphoid infiltrate in tumors, spontaneous tumor regression, tumor frequency during immune suppressed life stages such as neonatal period and old age, and increased tumor frequency in immunosuppressed individuals [40]. A particularly striking study indicating the immune protection of pregnancy has been done on NonHodgkin's lymphoma (NHL) patients [41]. This research indicates a much lower occurrence of NHL during pregnancy among reproductive age women. In animal studies, 36-75% of rats inoculated with virally-
347
induced lymphoma during pregnancy did not develop tumors and 20-54% developed tumors half the size of controls. In addition, pregnant rat sera was shown to have an inhibitory effect on the growth of lymphoma cells in vivo and in vitro. A related study [42] does not suggest tumor immunity, but does argue against immune suppression by showing no differences in progression of lymphoma between pregnant and nonpregnant patients. Patients diagnosed with both Hodgkin's disease and NHL were studied and results indicated similar outcomes for both pregnant and nonpregnant subjects. Studies of breast cancer have also provided evidence for the immune protective characteristics of pregnancy. Previous successful pregnancy has been linked with protection against breast cancer later in life. T cells from biparous women, but not T cells from nulliparous women or men, specifically proliferated in response to core peptide sequences of a human breast cancer-associated mucin (MUC-1). Two of the nulliparous women were retested during the first trimester of their first pregnancy, and their T cells proliferated specifically in response to MUC-1 mucin. These observations support the hypothesis that immunization against MUC-1 peptide epitopes during pregnancy may protect against breast cancer and such antibodies may a have a therapeutic role [43]. One proposed explanation for the altered state of immunity observed in pregnancy is a change in cytokine response. This change involves a shift from the Thl paradigm of cytokine response to the Th2 pattern, from humoral to cell-mediated immunity. The results of this is that the preferential activation of either Thl or Th2 cells may cause an immune response alteration [44]. In this chapter, we have examined the immune system in normal pregnancy as it compares to pathologic pregnancy such as GTD or concurrent cancer. From the available data, it appears that the immune reaction to the partial allograft during pregnancy is very complex and involves both tolerance and evasion from immune recognition. Further, it appears that when malignancy is present during pregnancy, specifically of the trophoblast through GTD, the changes in the trophoblastic tissue leading to the malignancy are not sufficient to reactivate the immune system. The only distinguishing features of immunologic activity
348
between normal trophoblast and choriocarcinoma so far described are the reduction in the production of PAPP-A and the presence of class I MHCs , neither of which elicit an immune response. An immune reactivation occurs in most instances of failing pregnancies, which are, in general, rejected through spontaneous abortion. This raises the possibility that GTD may be a very unique tumor. Its ability to survive may be somewhat linked to its sensitivity to treatment by chemotherapy indeed GTD, in practical terms, can be treated successfully in almost 100% of cases. In other instances of cancer during pregnancy, despite the onslaught of growth promoters, which are known to have a major role in cancer development and promotion, and an altered immune response, tumors actually do not progress as expected. In certain cases, pregnancy actually has a protective effect both in the short and long-term. Such a beneficial effect would require the presence of certain protective mechanisms, some of which have recently have been identified. Whether pregnancy actually confers an immune advantage to patients with cancer compared to nonpregnant patients remains an open question. These protective factors may operate to guard the immune system from being affected as is the case in cancer, and through production of specific powerful compounds, would prevent or limit significant cancer cell proliferation. We and others have recently discovered evidence for such protective mechanisms [45-46]. In our studies, we have demonstrated that some of the active factors, embryo derived proteins, specifically control cancer cell and virally induced transformed cells proliferation without affecting normal cells [47]. One of the active compounds was recently sequenced and found to be a novel oligopeptide (Barnea and Leavis, unpublished observations). Whether this oligopeptide is involved in modulating the immune response remains to be established as well. Overall insight into the various protective mechanisms present during pregnancy and which in certain instances confer long term protection against malignancy, are very fruitful avenues of investigation which should be pursued actively. Identification of these compounds and the mechanisms involved will have a major impact on the both the understanding of neoplastic processes and the development of efficacious therapeutic tools against these serious and often fatal condition.
REFERENCES 1.
2.
3.
4.
5. 6. 7.
8.
9. 10.
11.
12.
13.
14.
15.
Surani MAH, Barton SC, Norris ML. Development of reconstituted mouse eggs suggests imprinting of genome during gametogenesis. Nature 1984;308:548. Barnea ER, Barnea JD. The Embryo/Trophoblastic Paradox. In Jauniaux E, Barnea ER, and Edwards R, eds. Embryonic Medicine and Therapy. New York: Oxford University Press, 1997;262-265. Fernandez E, Goldberg J, Johnson E, Rutherford T, and Barnea ER. Cancer and pregnancy: clinical management and biological analogy. In Barnea ER, Check JH, Grudzinskas JG, Maruo T, eds. Implantation and Early Pregnancy in Humans. London: The Parthenon Publishing Group. 1994;357. Johnson PM. Immunology of Human Extraembryonic Fetal Membranes. In Coulam, CB, Faulk, WP, and Mclntyre, JA, eds. Immunological Obstetrics. New York: Norton Medical Books, 1992;178. Claman, Henry. The Immunology of Human Pregnancy. Totowa, NJ: Human Press, Inc. 1993;84. Chaouat, Gerard. The Immunology of the Fetus. Boca Raton, Florida: CRC Press, 1990;2. Barnea ER, Barnea JD. The embryo/trophoblastic paradox. In Jauniaux E., Barnea ER, and Edwards R, eds. Embryonic Medicine and Therapy. New York: Oxford University Press, 1997;262-263. Cross JC, Werb Z, Fisher SJ. Implantation and the placenta: Key pieces of the development puzzle. Science 1994;266;1515. Claman Henry. The Immunology of Human Pregnancy. Totowa, NJ: Humana Press, Inc. 1994;62. Loke, YW. Early human trophoblast. In: Beard RW, Sharp F, eds. Early Pregnancy Loss Mechanisms and Treatment. London: The Royal College of Obstetricians and Gynaecologists, 1988; 165. Johnson PM. Immunology of human extraembryonic fetal membranes. In Coulam CB, Faulk WP, and Mclntyre JA, eds. Immunological Obstetrics. New York: Norton Medical Books, 1992; 180. Johnson PM. Immunology of human extraembryonic fetal membranes. In Coulam CB, Faulk WP, and Mclntyre JA, eds. Immunological Obstetrics. New York: Norton Medical Books, 1992;181. Loke YW. Early human trophoblast. In Beard RW, and Sharp F, eds. Early Pregnancy Loss Mechanisms and Treatment. London: The Royal College of Obstetricians and Gynaecologists, 1988; 163. Mathiesen GA, Ferenc DT, Henrik H, Zdravkovic M, Peterson P, Villadsen J, Zachar V, Ebbesen P. Human trophoblast interferons. Antiviral Research 1993;658;12. Sanyal MK, Brami CJ, Bischof P, Simmons E, Barnea ER, Dwyer JM, and Naftolin F. Immunoregulatory ac-
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
tivity in supernatants from cultures of normal human trophoblast cells of the first trimester. American Journal of Obstetrics and Gynecology 1989;161;2;452. Chard T, and Grudzinskas JG. Placental proteins and steroids and the immune relationship between mother and fetus. In Coulam CB, Faulk WP, and Mclntyre JA. eds. Immunological Obstetrics, 1992. New York: Norton Medical Books, 285 pp. Sanyal MS, Brami CJ, Bischof P, Simmons E, Barnea ER, Dwyer JM, Naftolin F. Immunoregulatory activity in supernantants from cultures of mormal human trophoblast cells of the first trimester. American Journal of Obstetrics and Gynecology. 1989;161;2;448. Clark DA. Host immunoregulatory mechanisms and the success of the conceptus fertilised in vivo and in vitro. In Beard RW, and Sharp F, eds. Early Pregnancy Loss Mechanisms and Treatment. London: The Royal College of Obstetricians and Gynaecologists, 1988;163. Cavanagh ?. An update on the identity of early pregnancy factor and its role in early pregnany. Journal of Assisted Reproduction and Genetics 1997;14;9;493494. Nahhas F, Barnea ER. Human embryonic origin early pregnancy factor before and afer implantation. American Journal of Reproductive Immunology 1990;22;105-108. Barnea ER, Coulam CB. Embryonic signals. In Jauniaux E, Barnea ER, Edwards R, eds. Embryonic Medicine and Therapy. New York: Oxford University Press; 1997;63-76. Roussev RG, Coulam CB, Kaider BD, Yarkoni M, Leavis PC, and Barnea ER. Embryonic origin of preimplantation factor: biological activity and partial characterization. Molecular Human Reproduction 1996;2;883-7. Coulam CB, Roussev RG, Thomasson EJ, Barnea ER. Preimplantation factor (PIE) predicts subsequent pregnancy loss. American Journal of Reproductive Immunology 1995;34;88-92. Barnea ER, Lahijani KI, Roussev RG, Barnea JD, Coulam CB. Use of lymphocyte/platelet binding assay for detecting a preimplantation factor: a quantitative assay. American Journal of Reproductive Immunology 1994;32;133-8. Simon C, Frances A, Piquette G, Hendrickson M, Milki A, Polan ML. Interleukin-1 system in the materno-trophoblast unit in human implantation: Immunohistochemical evidence for autocrine/paracrine function. Journal of Clinical Endocrinology and Metabolism 1994;78;847-854. Chard T, and Grudzinskas JG. Placental proteins and steroids and the immune relationship between mother
349
27.
28.
29. 30. 31.
32.
33. 34. 35.
36.
350
and fetus. In Coulam, CB, Faulk, WP, and Mclntyre, JA, eds. Immunological Obstetrics, 1992. New York: Norton Medical Books, 287 pp. Johnson, PM. Immunology of human extraembryonic fetal membranes. In: Coulam CB, Faulk WP, and Mclntyre JA, eds. Immunological Obstetrics, 1992. New York: Norton Medical Books, 184 pp. Torry DS, Mclntyre JA. Immune regulation in pregnancy: role of idiotype-antiidiotype network. In Coulam CB, Faulk WP, and Mclntyre JA, eds. Immunological Obstetrics, 1992. New York: Norton Medical Books, 218 pp. Claman, Henry. The Immunology of Human Pregnancy. Totowa, NJ: Humana Press, Inc. 1993;65. Roitt I, Brostoff J, Male D. Immunology—Fourth edition. London: Mosby, 1996;20.1-20.7 Sunderland CA, Sasagawa M, Kanazawa K, Stirrat GM, Takeuchi S. An immunohistological study of HLA expression by gestational choriocarcinoma. British Journal of Cancer 1985 Jun;51;6;809814. Berkowitz RS, Goldstein DP and Anderson DJ. Recent advances in understanding the immunobiology of gestational trophoblastic disease. In Miller RK and Thiede HA, eds. Trophoblast Research- Volume 2: Cellular Biology and Pharmacology of the Placenta. New York: Plenum Medical Book Company 1987;126-128. Bast, Hoskins, Young. Principles and Practices of Gynecologic Oncology, 1992;820-821. Bast, Hoskins, Young. Principles and Practices of Gynecologic Oncology, 1992;820-821. Labarrere CA and Faulk WP. Immunopathology of human extraembryonic tissues. In Coulam CB, Faulk WP, and Mclntyre JA, eds. Immunological Obstetrics, 1992. New York: Norton Medical Books, 458 pp. Wegmann TG. The role of lymphohematopoietic cytokines in signalling between the immune and reproductive systems. In Strauss, JF III and Lyttle CR, eds. Uterine and Embryonic Factors in Early Pregnancy, New York: Plenum Press 1991;90-92.
37.
38.
39.
40. 41.
42.
43.
44. 45.
46.
47.
Shigeru M, Saito Y, Motoyoshi K, Saito M, Ichijo M. Localization and production of hM-CSF and G-CSF in human placental and decidual tissues. Proceedings of the International Conference on Placenta, Tokyo, 1990. Mathiesen GA, Ferenc DT, Henrik H, Zdravkovic M, Peterson P, Villadsen J, Zachar V, Ebbesen P. Human trophoblast interferons. Antiviral Research 1993;658;12. Bajahr B, Straube W, Reddeman H. Case observations on the significance of early pregnancy factor as a tumor marker. Zentralb Gynakol 1993;115;3;125-128. Roitt I, Brostoff J, Male D. Immunology—Fourth edition. London: Mosby, 1996;20.1-20.7. loachim HL and Moroson H. Lymphoma and pregnancy: clinical and experimental observations (Meeting abstract). International Association for Comparative Research on Leukemia and Related Diseases, 16th Symposium. Montreal, Quebec, Canada, A46, Jul 11-16;1993. Gelb AB, van de Rijn M, Wamke RA, Kamel OW. Pregnancy-associated lymphomas. A clinicopathologic study. Cancer 1996;Jul 15;78;2;304-10. Agrawal B, Reddish MA, Krantz MJ, Longenecker BM. Does pregnancy immunize against breast cancer? Cancer Research 1995;June 1;55;11;2257-61. Roitt I, Brostoff J, Male D. Immunology—Fourth edition. London: Mosby, 1996; 11.4. Bamea ER, Barnea JD. The embryo/trophoblastic paradox. In Jauniaux E, Barnea ER, and Edwards R, eds. Embryonic Medicine and Therapy. New York: Oxford University Press, 1997;262-265 Lunardi-Iskander Y, Bryant JL, Zeman RA, Ham VH, Samaniego F, Benier, JM, et al. Tumorigenesis and metastasis of neoplastic Kaposi's sarcoma cell line in immunodeficiient mice blocked by a human pregnancy hormone. Nature 1995;375;64-8. Barnea ER, Barnea JD, Pines, M. Control of cell proliferation by embryonal origin factors. American Journal of Reproductive Immunology 1996;35;31824.
© 2000 Elsever Science B. V. All rights reserved. The Decade of Autoimmunity Y. Shoenfeld and M, E. Gershwin, editors
Therapy of Cancer and Autoimmunity: Immuno-modulatory Strategies Based on Modified Dendritic Cells Marc Schmitz and Ernst Peter Rieber Medical Faculty, Technical University of Dresden
1. FUNCTIONAL HALLMARKS OF DENDRITIC CELLS Dendritic cells (DC) were first described in 1868 as Langerhans cells in the skin. Steinman and Cohn identified mouse spleen DC in 1973 and defined their morphology, tissue distribution and function by a number of in vitro and in vivo experiments [1-3]. It is now accepted, that DC represent a population of 'professional' antigen presenting cells (APC) with an extraordinary capacity to initiate primary immune responses [4-6]. They are the main players in the activation of MHC-restricted T cells, the induction of transplant rejection, and the formation of T-dependent antibodies. On the other hand, DC are pivotal in the induction of central tolerance by deletion of self-reactive thymocytes, and, they can be involved in anergizing mature T cells leading to peripheral tolerance.
2. MATURATION STAGES OF DENDRITIC CELLS DC are classified into so called 'immature' and 'mature' DC, that are distinguished by phenotype and function. 'Immature' DC can phagocytose particles [7, 8], although less efficiently than true macrophages. Furthermore, they can form large pinocytic vesicles in which extracellular fluid and solutes are sampled, a process called macropinocytosis. They express receptors that mediate adsorptive endocytosis, including C-type lectin receptors such as the mannose receptor [9] and DEC-205 [10], as well as Fey and VQE receptors. These receptors allow them to efficiently capture
immune complexes and mannosylated antigens [11]. 'Immature' DC are thus well equipped to internalize and process foreign antigens, which subsequently are expressed as MHC-peptide complexes on the cell surface. In particular, macropinocytosis and receptormediated antigen uptake can explain why already picomolar or nanomolar concentrations of antigen are sufficient for presentation by DC. Yet, 'immature' DC display MHC class I and II molecules and accessory signals for T cell activation such as CD40, CD54, CD80 and CD86 only at low density. Therefore, their capacity to initiate primary immune responses in vitro is rather poor. Maturation of DC can be promoted by infectious agents or inflammatory mediators such as LPS or cytokines hke IL-1, GM-CSF and TNFQf. 'Mature' DC are phenotypically characterized by downregulated Fc receptors and mannose receptors and by a reduced ability to take up and to process soluble antigens. However, these cells are now capable of triggering T cell activation by previously captured antigen mainly because they upregulate MHC class I and II molecules, costimulatory molecules including CD40, CD80 and CD86 and adhesion molecules like ICAM-landLFA-3.
3. MIGRATORY CAPACITY OF DENDRITIC CELLS Another important feature of DC is their capacity to migrate through different tissues, although the molecular mechanisms that control this wandering are poorly defined [12]. DC progenitors orginate from bone marrow cells and migrate through the blood to
353
nonlymphoid tissues, where they can be found in an 'immature' stage. These nonlymphoid cells are localized in epithelia (epidermis, gut, etc.) and in interstitial spaces of many solid organs like heart and kidney [4]. Therefore, they are ideally placed to perform a sentinel function in the immune defence. As mentioned above, inflammatory mediators or infectious agents promote their maturation and migration out of nonlymphoid tissues via afferent lymph and blood into T cell-dependent areas of secondary lymphoid tissues such as regional lymph nodes and spleen. Recruitment of DC to sites of antigen challenge and subsequent travel to secondary lymphoid organs is an essential feature of this 'professional' APC.
4. ANTIGEN PRESENTATION BY DENDRITIC CELLS For the generation of a T cell response by DC in secondary lymphoid organs peptide fragments are presented in association with molecules of the major histocompatibility complex (MHC). For activation of CD8+ cytotoxic T cells (CTL), DC have to present antigenic peptides complexed to MHC class I molecules. The majority of class I-presented peptides are generated by degradation of cytoplasmic proteins by a multicatalytic proteolytic unit, the proteasome [13-15]. Dedicated peptides produced in the cytosol are transported across the endoplasmic reticulum (ER) membrane in an ATP-dependent manner by TAP (transporter associated with Ag presentation). Inside the ER, the peptides bind to newly assembled MHC class I molecules and are then transported to the plasma membrane. Usually, only autologous peptides are present on MHC class I molecules, and these are ignored by the immune system. However, when a cell is infected by virus and synthesizes foreign proteins or when it expresses a mutated gene or when a normal gene is overexpressed, it is recognized by CTL. In contrast to CD8+ CTL CD4+ T-helper cells are activated by MHC class Il-bound peptides derived from extracellular antigens. These antigens enter the endocytotic pathway of the APC and are degraded in low pH endosomal compartments into peptide fragments that complex with MHC class II molecules for surface presentation. Recently, exceptions of this classic dichotomy between exogenous and endogenous antigen presentation pathways became apparent.
354
Additional mechanisms were identified whereby exogenously acquired antigens are presented on MHC class I molecules and induce CTL responses ('cross priming') [16-19]. On the other hand, endogenous antigens can enter the MHC class II pathway and generate significant T-helper responses [20, 21].
5. IMMUNO-MODULATION BY DENDRITIC CELLS DC behave like central processing units. They respond to cells and cytokines in their environment and direct the outcome of an immune response. As mentioned above, a key function of DC is priming and activation of a variety of T cells. Induction of effective CTL responses is often dependent on the assistance by Thelper cells [22]. Recent studies have shown that this help is mediated by the interaction of CD40 on the surface of DC with CD40L on activated T-helper cells that greatly increases the efficiency of antigen presentation and the costimulatory capacity of DC [23-25]. In such a way activated DC are able to directly prime CTL precursors. Beside CTL, DC are also found to regulate T-helper cell 1 (Thl) and T helper cell 2 (Th2) differentiation by secretion of the relevant cytokines. For example, DC produce IL-12, a potent immunoregulatory cytokine that plays a pivotal role in the development of Thl-mediated cellular immune responses [26, 27]. Other reports show that DC exposed to IL-10 can induce Th2 responses [28, 29]. DC are also efficient stimulators of B-cell responses [6]. They can enhance proliferation and differentiation of naive and memory B-cells by secretion of IL-12 [30]. Furthermore, by turning T-helper cells into IL-4 and IL-5-producing Th2-cells DC indirectly enhance B cell growth and antibody production.
6. T CELL-MEDIATED ANTITUMOR IMMUNITY Due to their pronounced capacity to prime T cells DC are considered as optimal tools to enhance insufficient T-cell responses against tumors. To initiate a specific cellular defence against tumors, tumor cells must be found wherever they are located in the body and must be recognized by tumor-reactive T lymphocytes, especially by CTL. The frequency of tumor-specific
CTL is usually extremely low and there is little evidence that antitumor immunity is efficiently induced in tumor-bearing hosts [31, 32]. Possible reasons for this immune failure are: (1) the typically small amount of tumor-specific peptides presented as complexes with MHC molecules on tumor cells. (2) These antigens must be recognized by rare T cell clones through T cell receptors that (3) often have only a low affinity. (4) Tumor cells lack costimulatory molecules, that deliver additional signals required by naive T cells for primary activation. Recognition of antigen/MHC complexes in the absence of costimulation not only fails to activate T cells but may lead to a state of anergy [33]. The main challenge is, therefore, to augment the frequency of active, tumor-specific CTL in order to produce an effective antitumor response in vivo and to overcome a possible state of specific anergy or tolerance. The use of DC as adjuvants for MHC class I-restricted antitumor response is a rather novel and particulary promising approach [34-36]. As mentioned above, DC are the only cell population known to date, that is effective to induce a primary response of CD4+ and CD8+ T cells. Once antigen-specific T cells have been activated they can respond to other cell types expressing the appropriate MHC-peptides without the specialized costimulatory signals delivered by DC.
7. CLASSIFICATION OF TUMOR ANTIGENS RECOGNIZED BY T CELLS The identification of antigens recognized by tumorreactive T cells was a cornerstone in tumor immunology. It has provided the opportunity to develop new and effective anticancer therapies [37]. Three different approaches were pursued in order to identify the antigenic peptides presented by MHC class I molecules to tumor-specific CTL. The first method is based on the transfection of recombinant DNA libraries into cells expressing the respective allelic MHC molecule. The transfected cells are screened for their ability to stimulate in vitro-generated tumor-specific CTL, which allows the identification of genes encoding tumor antigens [38]. The second technique consists of the biochemical purification of peptides eluted from HLA molecules which are expressed on tumor cells [39]. In a third approach candidate peptide sequences located within a tumor protein are predicted according
to algorythms which are based on consensus anchor motifs for frequent HLA molecules. They are loaded on APC for in vitro stimulation of T lymphocytes [40]. The tumor antigens described so far can be classified into six groups [41, 42]. The first group represents tumor antigens encoded by genes that are silent in most normal tissues, except testis and placenta, but are expressed in a variety of different tumor types. Examples are the genes encoding MAGE [43, 44], BAGE [45], GAGE [46] and RAGE [47]. These antigens are shared by different tumors and therefore represent promising targets for cancer immunotherapy. The second group comprises differentiation antigens, that are not only expressed in tumor cells but also in the corresponding normal cells. Examples are tyrosinase [48], Melan-A [49], gplOO [50] and CEA [51]. A third group contains antigens encoded by genes that are expressed ubiquitously but are mutated in tumor cells as e. g., CDK4 [52], ^-catenin [53] and bcr-abl [54, 55]. The fourth category comprises antigens encoded by nonmutated genes, that are overexpressed in tumor cells such as Her-2/neu [56, 57] and p53 [58]. The fifth group contains antigens, that derived from oncogenic viruses, like E6 and E7 of human papilloma virus [59] and a sixth group is represented by mucins [60]. At present, the different types of tumor antigens are being evaluated in various strategies to activate antitumor T cells in vivo [61-63].
8. VACCINATION STRATEGIES BASED ON DENDRITIC CELLS An efficient way to induce a specific T-cell response involves loading DC with synthetic peptides, that are recognized by T-helper cells and CTL. A major drawback of this method is the MHC-restriction in peptide-binding that limits the number of treatable patients. In addition, there are only a few peptides known so far which are presented by MHC-class II molecules. This seems to be particularly relevant, since the persistence and extent of cellular immune responses may depend upon T-helper cells reacting against class Il-bound peptides [64]. A further disadvantage could be the in vitro-generation of low avidity T cells with a reduced capacity to lyse target cells [65]. On the other hand, peptide-activated high avidity T cells may be particularly prone to undergo apoptosis [66]. Several strategies have been explored to overcome this
355
problem, including use of low doses of peptide and addition of novel cytokine cocktails during T-cell activation in order to modulate the response. Moreover, synthetic peptides with amino acid substitutions designed to increase their binding efficiency to MHC molecules may be more potent than native peptides for T-cell activation. In the last years, a number of reports demonstrated the efficacy of an antitumor vaccination with peptide-modified DC. Thus, immunization with DC loaded with MHC class I-eluted tumor peptides inhibited tumor progression in mice bearing weakly immunogenic tumors [67]. Also in humans the induction of tumor-directed CTL by peptide- pulsed DC has been shown by several groups [68, 69]. The allelic restriction imposed to selected peptides can partially be bypassed when DC are pulsed with whole tumor proteins. This strategy allows DC to endogenously process the proteins and present MHC class I-restricted peptides by cross priming. In addition, MHC class Il-restricted epitopes for stimulation of Thelper lymphocytes are generated. Furthermore, this method provides simultaneous presentation of several tumor antigens. The effectiveness of this approach was demonstrated in a number of reports. Thus, DC exposed to soluble antigen in vitro were capable of sensitizing antigen-specific T-helper cells from naive mice [70] and could prime antigen-specific CTL. Moreover, vaccination with ^-galactosidase pulsed DC protected mice against a challenge with y^-galactosidasetransduced tumor cells [71]. Defined tumor antigens in form of peptides or proteins appear to be particularly useful in cancer immunotherapy. It obviates the need of tumor tissue which might be important in patients with low tumor burden. Instead of using peptides and proteins DC can be modified by transfection of genes encoding tumor proteins. The use of DC expressing endogenously processed epitopes may be advantageous since these epitopes are expected to be similar to those presented by the tumor cells. In order to deliver tumor antigens to DC various vehicles have been proposed such as viral vectors or naked DNA. Transfection of DC with naked DNA has several advantages. It is possible to express antigens in a form that guarantees natural processing and presentation to T lymphocytes. Furthermore, DNA vaccines are safe, stable, and induce a long-lasting response. For example, lipotransfection of human blood DC with tyrosinase cDNA was shown to induce specific T cells [72]. Another approach for efficient transduc-
356
tion of DC is based on adenoviral [73,74] or retroviral vectors [75] that may contain either the entire gene or only the sequence encoding a human antigenic peptide. The transduction of the entire gene will allow the DC to tailor the tumor proteins in such a way that the best fitting peptides are presented by the respective HLA-molecules. Genetically transduced DC may also express MHC-peptide complexes for extended periods of time. Viral vectors can also be engineered to provide, in addition, the expression of high levels of cytokines such as GM-CSF, IL-12, Interferon-/ or IL-7 that modulate the quality and quantity of the antitumor response. Alternative possibilities to modify DC in vitro include pulsing with unfractionated tumor extracts or tumor-derived RNA. The use of unfractionated tumor material does not require exact knowledge of the effective tumor antigens, and the presence of multiple tumor antigens will reduce the risk of generation of escape mutants [76]. Yet, the use of whole tumor material may increase the risk of autoimmune reactions. The potential benefit of using mRNA coding for total tumor antigens is the possibility to generate appropriate amounts of mRNA even from small tumor fragments. Pulsing of DC with RNA permits translation and subsequent processing of the protein along established cellular pathways. Experimental studies along this line revealed that immunizations with bone marrow-derived DC pulsed with unfractionated tumor extracts or tumor RNA can induce tumor-specific CTL [77]. Furthermore, this therapy could be used for both protection against tumor challenge and for treatment of established tumors. In a poorly immunogenic tumor model a dramatic reduction in lung metastases was observed in mice that were vaccinated with DC pulsed with tumor-derived RNA [78]. In another report DC were generated from peripheral blood mononuclear cells of healthy individuals or from cancer patients and transfected with mRNA coding for carcinoembryonic antigen (CEA). These cells were shown to stimulate a potent CTL response in vitro [79]. Fusion of DC with tumor cells appears to be a particularly attractive strategy since it brings together the immuno-stimulatory capacity of DC and the autochthonous tumor antigens. Such fusion hybrids were shown to generate a strong antitumor activity involving both CTL and T helper cells which led to the rejection of already established metastases [80]. Repeated injections of hybrids between DC and mastocytoma cells prevented
Loading of "professional" antigenpresenting ceils with tumor antigens tumor cell lysate tumor p e p t i c l e \ ^
tumor protein mRNA coding for tumor protein
dendritic cell
cDNA coding for tumor protein In expression vector
Signal 2 V activation of tumorspecific cytotoxic T cells tumor-specific cytotoxic effector cells recognition and lysis of tumor celts
Figure 1. Current strategies to modify dendritic cells for immunotherapy of cancer. DC are either directly loaded with peptides or exposed to tumor cell lysates and tumor proteins. Intracellular synthesis and processing of tumor proteins in DC is reached by transduction of cDNA in an expression vector. DC presenting MHC class I-bound tumor peptides efficiendy activate tumor-specific cytotoxic T cells.
the growth of a pre-established mastocytoma in mice and induced a long-term protection [81]. These different strategies using modified DC as summarized in Figure 1 clearly show that it is possible to protect animals against tumors and to reduce the size of already established tumors. From this it may be concluded that administration of DC activated in vitro by exposure to tumor antigen preparations are also effective in the generation of antitumor immunity in patients.
9. CLINICAL TRIALS WITH MODIFIED DENDRITIC CELLS For a successful immunotherapeutic strategy, it will be important to precisely define the functional stage
of DC in order to determine the most appropriate time points for loading and administering the DC. In the past, preparing the cells in sufficient numbers and in a reasonably pure form was a major problem. Recently, methods have been developed to generate large quantities of pure DC [82]. Currently, human DC are derived either from CD34+ stem cells by in vitro culture in the presence of GM-CSF and TNF-of [83] or from CD 14+ monocytes by cultivating with GM-CSF and IL-4 [84, 85]. Recently, we succeded in the generation of a monoclonal antibody (M-DC8) which allows direct immunomagnetic isolation of circulating DC from human blood. These DC were shown to efficiently induce CTL from melanoma patients as well as from normal donors against a melanoma-associated tyrosinase peptide (86). One established strategy to prepare DC for clinical use is based on leukapheresis followed by separating the PBMC on a automated cell separator and by culturing the plastic adherent cell fraction in serum-free medium containing GM-CSF and IL-4 for seven days. A potential immunotherapy would require ex vivoexpansion of autologous DC from cancer patients, their exposure to tumor antigens, and reinjection into the tumor patients to induce tumor-specific T cells [87]. The most widely used method for generating CTL is to load previously defined immunogenic peptides onto DC prepared from blood of patients who express the appropriate HLA-restricting allele [88]. In man, Hsu et al. [89] have utilized autologous DC directly isolated from the peripheral blood of patients with B-cell lymphoma. In this neoplasm all tumor cells express the identical idiotypic protein on their cell surface that was used as tumor antigen. Each patient received several infusions of autologous antigen-pulsed DC. All treatments were well tolerated, and no side effects were associated with this type of vaccination. All four patients developed a specific cellular response against the idiotypic tumor protein. The antitumor immunity induced was associated with significant tumor regression in two of four patients. In another clinical study Murphy et al. [90] administered DC pulsed with prostate-specific membrane antigen (PSMA) peptides to patients with prostate cancer. Cellular immune responses could be detected, and an average prostate-specific antigen (PSA) decrement was observed. Initial clinical experiences were also made in melanoma patients. Immunotherapy of melanoma has become an attractive possibility since in
357
many melanoma patients autologous CTL were found that recognize distinct MHC class I-restricted tumor antigens. They could be associated with therapeutic or spontaneous regression of established tumors. Recendy, Nestle et al. [91] reported on vaccination of 16 melanoma patients with modified DC. They generated DC by cultivating monocytes prepared from patients blood with GM-CSF and IL-4 and pulsed these cells with a combination of peptides known to be recognized by CTL or with tumor lysates. These DC preparations were repeatedly injected into lymph nodes. No significant toxicity was detected and a partial or complete regression of metastases was observed in 5 out of 16 patients. These data indicate that vaccination of advanced melanoma patients with DC pulsed with tumor peptide or with tumor lysate is well tolerated and is able to induce antitumor immunity. A major component of any immunotherapy should be an intensive analysis of the in vivo response. The efficacy of active immunization with DC can be estimated by two novel methods to quantify CTL. The first sensitive method for the detection and quantitation of blood-derived CTL is an enzyme-linked immunospot (ELISPOT) assay based on measuring the cytokine secretion of antigen-activated T cells [92, 93]. A second, highly sensitive technique is based on the binding of tetrameric MHC- peptide complexes [94-96]. In summary, the first clinical trials indicate that vaccination based on modified DC is a promising strategy to treat established tumors. The main target of this immunotherapeutic approach appears to be the minimal residual disease after conventional therapy of primary tumors.
tolerance as well where they are involved in the induction of anergy or deletion of mature T cells in lymphoid organs. Kurts et al. [98, 99] showed, that MHC class I-restricted cross-presentation of exogenous self-antigens by bone marrow-derived APC can induce tolerance by peripheral deletion of autoreactive CTL through CD95-signalling. There is also evidence that cross-presentation, a mechanism describing MHC class I-restricted presentation of exogenous antigens, is involved in CD8-I- T cell depletion [100]. This means that 'professional' APC may induce autotolerance by presenting self-proteins, derived from the normal turn-over of somatic cells, in a MHC class I-restricted manner to T cells. In animal models, Clare-Salzler et al. [101] observed a significant protection from diabetes when DC isolated from pancreatic lymph nodes of nonobese diabetic (NOD) mice were transferred into pre-diabetic NOD mice. A further illustration of the ability of DC to prevent the development of autoimmunity has been provided by another study where protection from autoimmunity induced by the encephalitogenic autoantigen myelin basic protein (MBP) was achieved by i.v. injection of thymic DC pulsed with the immunodominant peptide of MBP [102]. The concept that vaccination with DC may generate control of an autoimmune response is a challenging prospect for therapy. As certain DC appear to tone down the immune response, vaccines based on these cells could be used to induce tolerance. As nature's adjuvant, DC may be a perfect device for immunization against malignant diseases. In addition, they may turn out to be useful also for the induction of specific tolerance in autoimmune diseases.
10. TOLERANCE INDUCTION BY DENDRITIC CELLS
REFERENCES 1.
Beside their role as potent inducers of primary T cell responses, DC appear to play a crucial role in tolerizing T cells versus self antigens [6]. Recent studies have shown that DC can induce central tolerance in the thymus by deletion of developing autoreactive T cells. For example, Brocker et al. [97] demonstrated in a transgenic mouse model that thymic DC are sufficient to induce a negative selection of thymocytes in vivo. But there seems to be an important role for DC in the establishment of peripheral
358
2.
3.
Steinman RM, Cohn ZA. Identification of a novel cell type in peripheral lymphoid organs of mice. I. Morphology, quantification, tissue distribution. J Exp Med 1973;137:1142-1162. Steinman RM, Cohn ZA. Identification of a novel cell type in peripheral lymphoid organs of mice. II. Functional properties in vitro. J Exp Med 1974;139:380-397. Steinman RM, Cohn ZA. Identification of a novel cell type in peripheral lymphoid organs of mice. III. Functional properties in vivo. J Exp Med 1974;139:1431-1445.
4.
5.
6. 7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
Steinman RM. The dendritic cell system and its role in immunogenicity. Annu Rev Immnunol 1991;9:271-296. Hart DNJ. Dendritic cells: Unique leukocyte populations which contol the primary immune response. Blood 1997;9:3245-3287. Banchereau J, Steinman RM. Dendritic cells and the control of immunity. Nature 1998;392:245-252. Inaba K, Inaba M, Naito M, Steinman RM. Dendritic cell progenitors phagocytose particulates, including bacillus Calmette-Guerin organisms, and sensitize mice to mycobacterial antigens in vivo. J Exp Med 1993;178:479-488. Reis-e-Sousa C, Stahl PD, Austyn JM. Phagocytosis of antigens by Langerhans cells in vitro. J Exp Med 1993;178:509-519. Engering AJ, Cella M, Fluitsma D, Brockhaus M, Hoefsmit ECM, Lanzavecchia A, Pieters J. The mannose receptor functions as a high capacity and broad specificity antigen receptor in human dendritic cells. Eur J Immunol 1997;27:2417-2425. Jiang W, Swiggard WJ, Heufler C, Peng M, Mirza A, Steinman RM, Nussenzweig MC. The receptor DEC-205 expressed by dendritic cells and thymic epithelial cells is involved in antigen processing. Nature 1995;375:151-155. Lanzavecchia A. Mechanisms of antigen uptake for presentation. Curr Opin Immunol996;8:348354. Cella M, Sallusto F, Lanzavecchia A. Origin, maturation and antigen presenting function of dendritic cells. Curr Opin Immunol 1997;9:10-16. Germain RN. MHC-dependent antigen processing and peptide presentation: Providing ligands for T lymphocyte activation. Cell 1994;76:287-299. York lA, Rock KL. Antigen processing and presentation by class I major histocompatibility complex. Annu Rev Immunol 1996;14:369-396. Koopmann JO, Hammerling GJ, Momburg F. Generation, intracellular transport and loading of peptides associated with MHC class I molecules. Curr Opin Immunol 1997;9:80-88. Rock KL, Gamble S, Rothstein L. Presentation of exogeous antigen with class I major histocompatibility complex molecules. Science 1990;249:918921. Huang AY, Golumbeck P, Ahmadzadeh M, Jaffee E, Pardoll D, Levitsky H. Role of bone marrowderived cells in presenting MHC class I-restricted tumor antigens. Science 1994;264:961-965. Kovacsovics-Bankowski M, Rock KL. A phagosome-to-cytosol pathway for exogenous antigens presented on MHC class I molecules. Science 1995;267:243-246.
19.
20.
21. 22.
23.
24.
25.
26.
27.
28.
29.
30.
Watts C. Capture and processing of exogenous antigens for presentation on MHC molecules. Annu Rev Immunol 1997;15:821-850. Nuchtem JG, Biddeson WE, Klausner RD. Class II MHC molecules can use the endogenous pathway of antigen presentation. Nature 1990;343:74-76. Weiss S, Bogen B. MHC class Il-restricted presentation of intracellular antigens. Cell 1991;64:767-776. Ridge JP, Di Rosa F, Matzinger P. A conditioned dendritic cell can be a temporal bridge between a CD4+ T-helper and T-killer cell. Nature 1998;393:474-478. Koch F, Stanzl U, Jennewein P, Janke K, Heufler C, Kampgen E, Romani N, Schuler G. High level IL-12 production by murine dendrite cells: upregulation via MHC class II and CD40 molecules and downregulation by IL-4 and IL-10. J Exp Med 1996;184:741-746. Cella M, Scheidegger D, Palmer-Lehmann K, Lane P, Lanzavecchia A, Alber G. Ligation of CD40 on dendritic cells triggers production of high levels of interleukin-12 and enhances T cell stimulatory capacity: T-T help via APC activation. J Exp Med 1996;184:747-752. Bennett SRM, Carbone FR, Karamalis F, Flavell RA, Miller JFAP, Heath WR. Help for cytotoxic-T-cell responses is mediated by CD40 signalling. Nature 1998;393:478-480. Heufler C, Koch F, Stanzl U, Topar G, Wysocka M, Trinchieri G, Enk A, Steinman RM, Romani N, Schuler G. Interleukin-12 is produced by dendritic cells and mediates T helper 1 development as well as interferon-gamma production by T helper 1 cells. Eur J Immunol 1996;26:659-668. Hilkens CM, Kalinski P, de Boer M, Kapsenberg ML. Human dendritic cells require exogenous interleukin-12-inducing factors to direct the development of naive T-helper cells toward the Thl phenotype. Blood 90; 1997:1920-1926. Liu L, Rich BE, Inobe J, Chen W, Weiner HL. A potential pathway of Th2 development during the primary immune response: IL-10 pretreated dendritic cells prime naive CD4+ T cells to secrete IL-4. Adv Exp Med Biol 1997;417:375-381. Liu L, Rich BE, Inobe J, Chen W, Weiner HL. Induction of Th2 cell differentiation in the primary immune response: dendritic cells isolated from adherent cell culture treated with IL-10 prime naive CD4-IT cells to secrete IL-4. Int Immunol 1998;10:10171026. Dubois B, Massacrier C, Vanbervliet B, Fayette J, Briere F, Banchereau J, Caux C. Critical role of IL12 in dendritic cell-induced differentiation of naive B lymphocytes. J Immunol 1998;161:2223-2231.
359
31.
32.
33. 34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
360
Coulie PG, Somville M, Lehmann F, Hainaut P, Brasseur F, Devos R, Boon T. Precursor frequency analysis of human cytolytic T lymphocytes directed against autologous melanoma cells. Int J Cancer 1992;50:289-297. Mazzocchi A, Belli F, Mascheroni L, Vegetti C, Parmiani G, Anichini A. Frequency of cytotoxic T lymphocyte precursors (CTLp) interacting with autologous tumor via the T-cell receptor: limiting dilution analysis of specific CTLp in peripheral blood and tumor-invaded lymph nodes of melanoma patients. Int J Cancer 1994;58:330-339. Schwartz RH. A cell culture model for T lymphocyte clonal anergy. Science 1990;8:1349-1356. Grabbe S, Beissert S, Schwarz T, Granstein RD. Dendritic cells as initiators of tumor immune responses: a possible strategy for tumor immunotherapy. Immunology Today 1995;16:117-121. Young JW. Dendritic cells as adjuvants for class I major histocompatibility complex-restricted antitumor immunity. J Exp Med 1996;183:7-11. Girolomoni G, Ricciardi-Castagnoli P. Dendritic cells hold promise for immunotherapy. Immunology Today 1997;18:102-104. Boon T, Cerottini JC, Van den Eynde B, Van der Bruggen P, Van Pel A. Tumor antigens recognized by T lymphocytes. Annu Rev Immunol 1994; 12:337365. Van der Bruggen P, Traversari C, Chomez P, Lurquin C, De Plaen E, Van den Eynde B, Knuth A, Boon T. A gene encoding an antigen recognized by cytolytic T lymphocytes on an human melanoma. Science 1991;254:1643-1647. Cox AL, Skipper J, Chen Y, Henderson RA, Darrow TL, Shabanowitz J, Engelhard VH, Hunt DF, Slingluff CL. Identification of a peptide recognized by five melanoma-specific human cytotoxic T cell lines. Science 1994;264:716-719. Cells E, Tsai V, Crimi C, DeMars R, Wentworth PA, Chesnut RW, Grey HM, Sette A, Serra HM. Induction of anti-tumor cytotoxic T lymphocytes in normal humans using primary cultures and synthetic peptide epitopes. Proc Natl Acad Sci USA 1994;91:2105-2109. Robbins PF, Kawakami Y. Human tumor antigens recognized by T cells. Curr Opin Immunol 1996;8:628-636. Van den Eynde BJ, van der Bruggen P. T cell defined tumor antigens. Curr Opin Immunol 1997;9:684693. Traversari C, Van der Bruggen P, Luescher IF, Lurquin C, Chomez P, Van Pel A, De Plaen E, Amar-Costesec A, Boon T. A nonapeptid encoded by human gene MAGE-1 is recognized on HLA-Al
44.
45.
46.
47.
48.
49.
50.
51.
52.
53.
by cytolytic T lymphocytes directed against tumor antigen MZ2-E. J Exp Med 1992;176:1453-1457. Gaugler B, Van den Eynde B, Van der Bruggen P, Romero P, Gaforio J J, De Plaen E, Lethe B, Brasseur F, Boon T. Human gene MAGE-3 codes for an antigen recognized on a melanoma by autologous cytolytic T lymphocytes. J Exp Med 1994;179:921930. Boel P, Wildmann C, Sensi ML, Brasseur R, Renauld JC, Coulie P, Boon T, Van der Bruggen R BAGE: a new gene encoding an antigen recognized on human melanomas by cytolytic T lymphocytes. Immunity 1995;2:167-175. Van den Eynde B, Peeters O, De Backer O, Gaugler B, Lucas S, Boon T. A new family of genes coding for an antigen recognized by autologous cytolytic T lymphocytes on a human melanoma. J Exp Med 1995;182:689-698. Gaugler B, Brouwenstijn N, Vantomme V, Szikora JP, Van der Spek CW, Patard JJ, Boon T, Schrier P, Van den Eynde BJ. A new gene coding for an antigen recognized by autologous cytolytic T lymphocytes on a human renal carinoma. Immunogenetics 1996;44:323-330. Brichard V, Van Pel A, Wolfel T, Wolfel C, De Plaen E, Lethe B, Coulie P, Boon T. The tyrosinase gene codes for an antigen recognized by autologous cytolytic T lymphocytes on HLA-A2 melanomas. J Exp Med 1993;178:489-495. Kawakami Y, Eliyahu S, Sakaguchi K, Robbins PF, Rivoltini L, Yanelli JR, Appella E, Rosenberg SA. Identification of the immunodominant peptides of the MART-1 human melanoma antigen recognized by the majority of HLA-A2-restricted tumor infiltrating lymphocytes. J Exp Med 1994;180:347352. Bakker AB, Schreurs MW, de Boer AJ, Kawakami Y, Rosenberg SA, Adema GJ, Figdor CG. Melanocyte lineage-specific antigen gplOO is recognized by melanoma-derived tumor-infiltrating lymphocytes. J Exp Med 1994;179:1005-1009. Tsang KJ, Zaremba S, Nieroda CA, Zhu MZ, Hamilton JM, Schlom J. Generation of human carcinoembryonic antigen epitopes from patients immunized with recombinant vaccinia-CEA vaccine. J Natl Cancer Inst 1995;87:982-990. Wolfel T, Hauer M, Schneider J, Serrano M, Wolfel C, Klehmann-Hieb E, De Plaen E, Hankeln T, Meyer zum Buschenfelde K-H, Beach D. A pl6 INK4a-insensitive CDK4 mutant targeted by cytolytic T lymphocytes in a human melanoma. Science 1995;269:1281-1284. Robbins PF, El-Gamil M, Li YF, Kawakami Y, Loftus D, Appella E, Rosenberg SA. A mutated p-
54.
55.
56.
57.
58.
59.
60.
61.
62.
63.
64.
65.
catenin gene encodes a melanoma-specific antigen recognized by tumor infiltrating lymphocytes. J Exp Med 1996;183:1185-1192. Chen W, Pease DJ, Rovira DK, You SG, Cheever MA. T-cell immunity to the joining region of p210 BCR-ABL Protein. Proc Natl Acad Sci USA 1992;89:1468-1472. Bocchia M, Korontsvit T, Xu Q, Mackinnon S, Yang SY, Sette A, Scheinberg DA. Specific human cellular immunity to bcr-abl oncogene-derived peptides. Blood 1996;87:3587-3592. Peoples GE, Goedegebuure PS, Smith R, Linehan DC, Yoshino I, Eberlein TJ. Breast and ovarien cancer-specific cytotoxic T lymphocytes recognize the same HER- 2/neu-derived peptide. Proc Natl Acad Sci USA 1995;92:432^36. Fisk B, Blevins TL, Wharton JT, loannides CG. Identification of an immunodominant peptide of HER-2/neu protooncogene recognized by ovarian tumor-specific cytotoxic T lymphocyte lines. J Exp Med 1995;181:2109-2117. Ropke M, Hald J, Guldberg P, Zeuthen J, Norgaard L, Fugger L, Svejgaard A, Van der Burg S, Nijman HW, Melief CJM, Claesson MH. Spontaneous human squamous cell carcinomas are killed by a human cytotoxic T lymphocyte clone recognizing a wildtype p53-derived peptide. Proc Natl Acad Sci USA 1996;93:14704-14707. Ressing ME, Sette A, Brand RMP, Ruppert J, Wentworth PA, Hartmann M, Oseroff C, Grey HM, Melief CJM, Kast WM. Human CTL epitopes encoded by human papillomavirus type 16 E6 and E7 identified through in vivo and in vitro immunogenicity studies of HLA-A 0201-binding peptides. J Immunol 1995;154:5934-5943. Domenech N, Henderson RA, Finn OJ. Identification of an HLA-A 11-restricted epitope from the tandem repeat domain of the epithelial tumor antigen mucin. J Immunol 1995; 155:47664774. Boon T, Gajewski TF, Coulie PG. From defined human tumor antigens to effective immunization. Immunology Today 1995;16:334-336. Rosenberg SA. Cancer vaccines based on the identification of genes encoding cancer regression antigens. Immunology Today;1997;18:175-182. Bona CA, Casares S, Brumeanu TD. Towards development of T-cell vaccines. Immunology Today 1998;19:126-133. Topalian SL. MHC class II restricted tumor antigens and the role of CD4+ T cells in cancer immunotherapy. Curr Opin Immunol 1994;6:741-745. Alexander-Miller MA, Leggatt GR, Berzofsky JA. Selective expansion of high- or low-avidity cy-
66.
67.
68.
69.
70.
71.
72.
73.
74.
75.
totoxic T lymphocytes and efficacy for adoptive immunotherapy. Proc Natl Acad Sci USA 1996;93:4102^107. Alexander-Miller MA, Leggatt GR, Sarin A, Berzofsky JA. Role of antigen, CD8, and cytotoxic T lymphocyte avidity in high dose antigen induction of apoptosis of effector CTL. J Exp Med 1996;184:485-492. Zitvogel L, Mayordomo JI, Tjandrawan T, DeLeo AB, Clarke MR, Lotze MT, Storkus WJ. Therapy of murine tumors with tumor peptide-pulsed dendritic cells: Dependence on T cells, B7 costimulation, and T helper cell 1-associated cytokines. J Exp Med 1996;183:87-97. Bakker ABH, Marland G, De Boer AJ, Huijbens RJF, Danen EHJ, Adema GJ, Figdor CG. Generation of antimelanoma cytotoxic T-lymphocytes from healthy donors after presentation of melanomaassociated antigen-derived epitopes by dendritic cells in vitro. Cancer Res. 1995;55:5330-5334. Van Elsas A, Van der Burg SH, Van der Minne CE, Borghi M, Mourer JS, Melief CJM, Schrier PI. Peptide-pulsed dendritic cells induce tumoricidal cytotoxic T lymphocytes from healthy donors against stably HLA-A* 0201-binding peptides from the Melan- A/Mart-1 self antigen. Eur J Immunol 1996;26:1683-1689. Inaba K, Metlay JP, Crowley MT, Steinman RM. Dendritic cells pulsed with protein antigens in vitro can prime antigen-specific, MHC-restricted T cells in situ. J Exp Med 1990;172:631-640. Paglia P, Chiodoni C, Rodolfo M, Colombo MR Murine dendritic cell loaded in vitro with soluble protein prime cytotoxic T lymphocytes against tumor antigen in vivo. J Exp Med 1996;183:317-322. Alijagic S, Moller P, Artuc M, Jurgovsky K, Czarnetzki BM, Schadendorf D. Dendritic cells generated from peripheral blood transfected with human tyrosinase induce specific T cell activation. Eur J Immunol 1995;25:3100-3107. Gong J, Chen L, Chen D, Kashiwabe M, Manome Y, Kufe D. Induction of antigen-specific antitumor immunity with adenovirus-transduced dendritic cells. GeneTher 1997;4:1023-1028. Song W, Kong HL, Carpenter H, Torii H, Granstein R, Rafii S, Moore MA, Crystal RG. Dendritic cells genetically modified with an adenovirus vector encoding the cDNA for a model antigen induce protective and therapeutic antitumor immunity. J Exp Med 1997;186:1247-1256. Specht JM, Wang G, Do MT, Lam JS, Royal RE, Reeves ME, Rosenberg SA, Hwu P. Dendritic cells retrovirally transduced with a model antigen gene are therapeutically effective against established pul-
361
76.
77.
78.
79.
80.
81.
82.
83.
84.
85.
86.
362
monary metastases. J Exp Med 1997;186:12131221. Nair SK, Boczkowski D, Snyder D, Gilboa E. Antigen-presenting cells pulsed with unfractionated tumor-derived peptides are potent tumor vaccines. Eur J Immunol 1997;27:589-597. Ashley DM, Faiola B, Nair S, Hale LP, Bigner DD, Gilboa E. Bone marrow-generated dendritic cells pulsed with tumor extracts or tumor RNA induce antitumor immunity against central nervous system tumors. J Exp Med 1997;186:1177-1182. Boczkowski D, Nair SK, Snyder D, Gilboa E. Dendritic cells pulsed with RNA are potent antigenpresenting cells in vitro and in vivo. J Exp Med 1996;184:465^72. Nair SK, Boczkowski D, Morse M, Gumming RI, Lyerly HK, Gilboa E. Induction of primary carcinoembryonic antigen (CEA)-specific cytotoxic T-lymphocytes in vitro using human dendritic cells transfected with RNA. Nat. Biotechnol. 1998;16:364-369. Gong J, Chen D, Kashiwabe M, Kufe D. Induction of antitumor activity by immunization with fusions of dendritic and carcinoma cells. Nature Medicine 1997;3:558-561. Lespagnard L, Mettens P, Verheyden AM, Tasiaux N, Thielemans K, Van Meirvenne S, Geldhof A, De BaetseUer P, Urbain J, Leo O, Moser M. Dendritic cells fused with mastocytoma cells elicit therapeutic antitumor immunity. Int J Cancer 1998;76:259258. Siena S, Di Nicola M, Bregni M, Mortarini R, Anichini A, Lombardi L, Ravagnani F, Parmiani G, Gianni AM. Massive ex vivo generation of functional dendritic cells from mobilized CD34-I- blood progenitors for anticancer therapy. Exp Hematol 1995;23:1463-1471 Caux C, Dezutter-Dambuyant C, Schmitt D, Banchereau J. GM-CSF and TNF-a cooperate in the generation of dendritic Langerhans cells. Nature 1992;360:258-261. Sallusto F, Lanzavecchia A. Efficient presentation of soluble antigen by cultured human dendritic cells is maintained by granulocyte/macrophage colonystimulating factor plus interleukin 4 and downregulated by tumor necrosis factor a. J Exp Med 1994;179:1109-1118. Romani NS, Gruner D, Brang E, Kampgen A, Lenz B, Trockenbacher G, Konwalinka PO, Tritsch PO, Steinman RM, Schuler G. Proliferating dendritic cell progenitors in human blood. J Exp Med 1994;180:83-93. Schaekel K, Mayer E, Federle C, Schmitz M, Riethmueller G, Rieber EP. A novel dendritic cell popu-
87.
88.
89.
90.
91.
92.
93.
94.
95.
96.
lation in human blood: one- step immunomagnetic isolation by a specific mAb (M-DC8) and in vitro priming of cytotoxic T lymphocytes. Eur J Immunol 1998;28:4084^093. Schuler G, Steinman RM. Dendritic cells as adjuvants for immune-mediated resistance to tumors. J Exp Med 1997;186:1183-1187. Yee C, Riddell SR, Greenberg PD. Prospects for adoptive T cell therapy. Curr Opin Immuol 1997;9:702-708. Hsu FJ, Benike C, Fagnoni F, Liles TM, Czerwinski D, Taidi B, Engleman EG, Levy R. Vaccination of patients with B-cell lymphoma using autologous antigen-pulsed dendritic cells. Nature Medicine 1996;2:52-58. Murphy G, Tjoa B, Ragde H, Kenny G, Boynton A. Phase I clinical trial: T cell therapy for prostate cancer using autologous dendritic cells pulsed with HLA-A0201-specific peptides from prostate-specific membran antigen. Prostate 1996;29:371-380. Nestle FO, Alijagic S, Gilliet M, Sun Y, Grabbe S, Dummer R, Burg G, Schadendorf D. Vaccination of melanoma patients with peptide-or tumor lysatepulsed dendritic cells. Nature Medicine 1998;4:328332. Herr W, Schneider J, Lohse AW, Meyer zum Buschenfelde KH, Wolfel T. Detection and quantification of blood-derived CD8-I- T lymphocytes secreting tumor necrosis factor a in response to HLAA2.1-binding melanoma and viral peptide antigens. Journal of Immunological Methods 1996; 191:131142. Schmittel A, Keilholz U, Scheibenbogen C. Evaluation of the interferon-( ELISPOT-assay for the quantification of peptide specific T lymphocytes from peripheral blood. Journal of Immunological Methods 1997;210:167-174. Altman J, Moss PAH, Goulder P, Barouch D, McHeyzer-Williams M, Bell JI, McMichael AJ, Davis MM. Direct visuaUzation and phenotypic analysis of virus-specific T lymphocytes in HIV-infected individuals. Science 1996;274:9496. Gallimore A, Ghthero A, Godkin A, Tissot AC, Pluckthun A, Elliott T, Hengartner H, Zinkernagel R. Induction and Exhaustion of Lymphoytic Choriomeningitis Virus-specific cytotoxic T lymphocytes visualized using soluble tetrameric major histocompatibility complex class I-peptide complexes. J Exp Med 1998;187:1383-1393. Callan MFC, Tan L, Annels N, Ogg GS, Wilson JDK, O'Callaghan CA, Steven N, McMichael AJ, Rickinson AB. Direct visualization of antigenspecific CD8+ T cells during the primary immune
97.
98.
99.
response to Epstein-Barr Virus in vivo. J Exp Med 1998;187:1395-1402. Brocker T, Riedlinger M, Karjalainen K. Targeted expression of major histocompatibility complex (MHC) class II molecules demonstrates that dendritic cells can induce negative but not positive selection of thymocytes in vivo. J Exp Med 1997;185:541-550. Kurts C, Kosaka H, Carbone PR, Miller JF, Heath WR. Class I-restriced cross-presentation of exogenous self-antigens leads to deletion of autoreactive CD8(+) T cells. J Exp Med 1997;186:239245. Kurts C, Heath WR, Kosaka H, Miller JF, Carbone FR. The peripheral deletion of autoreactive CD8-I- T cells induced by cross-presentation of self-antigens
100.
101.
102.
involves signaling through CD95 (Fas, Apo-1). J Exp Med 1998;188:415-420. Carbone FR, Kurts C, Bennett SRM, Miller JFAP, Heath WR. Cross-presentation: a general mechanism for CTL immunity and tolerance. Immunology Today 1998;19:368-373. Clare-Salzler MJ, Brooks J, Chai A, Van Herle K, Anderson C. Prevention of diabetes in nonobese diabetic mice by dendritic cell transfer. J Clin Invest 1992;90:741-748. Khoury SJ, Gallon L, Chen W, Russell ME, Hancock WW, Carpenter CB, Sayegh MH, Weiner HL. Mechanisms of aquired thymic tolerance in experimental autoimmune encephalomyehtis: thymic dendriticenriched cells induce specific peripheral T cell unresponsivness in vivo. J Exp Med 1995;182:357-366.
363
(c) 2000 Elsevier Science B.V. All rights reserved. Cancer and Autoimmunity Y. Shoenfeld and M. E. Gershwin, editors
Anti-Idiotypic Therapy In Autoimmunity Dan Buskila^ Mahmoud Abu-Shakra^ and Yehuda Shoenfeld^ Rheumatic Disease Unit, Soroka Medical Center and Ben-Gurion University, Beer Sheva, Israel; ^Department of Medicine 'B\ Sheba Medical Center, Tel-Hashomer, Israel; ^ Sackler Faculty of Medicine, Tel-Aviv University, Israel
1. INTRODUCTION Idiotypes are the antigenic determinants of immunoglobulin molecules that are located in the variable region of the antibodies [1]. Idiotypes are subdivided into those that reside at the antigen binding site, the paratope, of the antibody molecule and those on the areas adjacent to this site, the framework determinants [1]. Anti-idiotypic antibodies are antibodies directed against the idiotypic determinants [1]. They are classified into: (a) Ab2 alpha if they are directed against idiotypes which are distinct from the antigen binding site (paratope) on Abl. The Ab2 alpha anti-idiotypic antibodies recognize Abl framework region antigens. (b) Abl beta if they fit the antigen binding site of the antibody molecule. Jerne [2] proposed the term "internal image" to indicate that anti-idiotype antibodies interact with the binding site of an antibody through structures that resemble the relevant epitope of the antigen, suggesting that external antigens are potentially represented within the immune system as an idiotypic determinant on anti-idiotype antibodies. (c) Ab2 gamma interfere with antigen binding and are directed against idiotypes close to, rather than within the antigen binding site. Their antigen-inhibitable effect is because of steric hindrance with the antigen binding site, (d) Ab3, is the anti-anti-idiotypic antibody which is induced by the presence of Ab2 and it may have binding characteristics similar to Abl. According to the theory of the idiotypic network presented in 1974 [2], all individuals possess thousands of idiotypes reflecting the infinite possibilities
of foreign antigen structure, any antigenic stimulation leads to the production of idiotypes (Abl) and anti-idiotypes (Ab2 and Ab3) as a network of interacting antibodies and the idiotypic determinants of each antibody molecule is complemented by those of another. Under normal physiological conditions, the idiotypic network is thought to have a major role in the regulation of immune responses to external antigens. The antigen stimulate the generation of Abl and then the serologically unique structure of its antigen binding site stimulates the immune system to produce Ab2 which recognize the antigen binding site of Abl and this interaction has a regulatory role on the immune response to the eliciting antigen. The idiotypic network can also be implicated in the production of pathogenic autoantibodies. High titers of pathogenic idiotypes were found in the sera of patients with autoimmune diseases. Increased levels of the pathogenic anti-DNA idiotype 16/6 were detected in the sera of patients with active SLE [3]. Similarly, antiacetylcholine receptor idiotypes and their anti-idiotypic antibodies were identified in the sera of patients with myasthenia gravis [4]. Since the idiotypic network is an important mechanism for controlling the immune repertoire [2, 5, 6], and autoimmune diseases may be attributed to the disturbance of the network [7-8], one may speculate that manipulation of idiotypes (pathogenic, cross-reactive) of autoantibodies (anti-Id immunity) may be effective in the treatment of autoimmune diseases. Indeed, there are encouraging reports coming from another field of medicine, which is using anti-idiotypic antibodies in the treatment of B-cell tumors [9-11].
365
Table 1. Methods of manipulation of autoantibody idiotypes • • •
• •
•
Injection of anti-Id: Anti-Id directly regulates autoantibodies. Direct injection of a common Id: Formation of anti-Id down regulates autoantibodies. Injection of anti-Id conjugated to a cytotoxic agent: (a) Anti-Id targets Ab-producing cells (b) Toxin specifically destroys them Passage of plasma over an anti-Id column: Removal of Ab bearing the common Id. Treatment with poly specific immunoglobulins (IVIG): Anti-idiotypic suppression of autoantibodies mediated by anti-idiotypes present in IVIG. Treatment with Id-specific T cells.
Table 2. Animal models of autoimmunity treated by modulation of autoantibody idiotypes with antiidiotypic antibodies Reference
• • • • • • • •
Experimental systemic lupus erythematosus Murine lupus and lupus nephritis Autoimmune tubulointerstital nephritis Collagen arthritis Experimental autoimmune myastenia gravis Autoimmune uveoretinitis Autoimmune thyroiditis Experimental allergic encephalomyeUtis
[12] [13] [14] [15] [16] [17] [18] [19]
4. ANIJMAL STUDIES In this novel approach to treating B-cell lymphomas and leukemias, anti-idiotype antibodies have as their target a tumor-specific antigen, the idiotype of the cell surface immunoglobulin present on B cells. These results prompted in part the studies and research towards a similar treatment modality in autoimmune diseases. Thus successful in vitro and in vivo manipulations of autoantibody production by anti-idiotypic (anti-Id) antibodies were described in several animal models of autoimmunity [12-19]. In this chapter, we will review the possible beneficial therapeutic effect of anti-idiotypic therapy.
2. ANTI-Id IMANIPULATION OF AUTOANTIBODIES The possible methods by which the idiotype network might be modulated are summarized in Table 1 and in the following sections of this chapter. Included are in vitro studies using peripheral blood lymphocytes from animal models of autoimmunity and human patients with autoimmune diseases, as well as in vivo studies in different autoimmune animals (Table 2) [12-19].
3. IN VITRO ANTI-Id JVIANIPULATION OF AUTOANTIBODIES In vitro studies demonstrating modulation by anti-Id support the theory that anti-Id may modulate autoantibody activity in vivo.
366
Kim et al. [20] have demonstrated that anti-DNA production by anti-DNA-secreting hybridomas can be inhibited by the addition of anti-idiotypes to anti-DNA. In this study, a series of anti-DNA antibody producing hybridomas were obtained by fusing spleen cells from 6-month old ]VIRL/lpr autoimmune prone mice with P3X63-Ag8 myeloma cells. Rabbit anti-idiotype antibodies specific for several of the hybridoma proteins were prepared. It was shown that the anti-Id antibody inhibited immunoglobulin secretion by the hybridoma cells in an Id-specific manner. Inhibition of antibody production was not due to a cytotoxic effect, since the anti-Id, in fact, stimulated proliferation of the hybridoma cells. In order to assess the anti-Id network in murine experimental autoimmune encephalomyelitis (EAE), Id-bearing monoclonal antibodies (mAb) to human myelin basic protein (IVIBF) peptide acetyl 1-9, as well as mAb anti-Id, were developed in EAEsusceptible PL/j mice (H-2u) [21]. These mice recognize IVIBP residues acetyl 1-9 as an encephalitogenic determinant. Reactivities of PL/j Id-bearing mAbs to IVIBP and to IVIBP peptides are identical to those of mAbs generated against the same IMBP peptide in EAE-resistant BALB/C mice (H-2d), even though isotypes of the mAbs differed. By using an inhibitory ELIS A and immunoblotting, it was demonstrated that one PL/j mAb anti-id recognized a public or framework Id, whereas another PL/j mAb-anti Id was directed to a private Id more restricted to the paratopic site. Two Id-bearing PL/j mAbs shared a cross-reactive Id (IdX) on the light chain, and an interstrain IdX was present on both the heavy and light chains of
mAbs raised in PL/j and BALB/C mice to the same MBP peptide. The PL/j mAb anti-Id was capable of cross-regulating the production of Id-bearing mAbs by hybridomas across murine strains. These findings suggest that manipulation of the Id network may provide a means for modifying autoimmune demyelinating diseases of the central nervous system [21].
5. STUDIES OF PERIPHERAL LYMPHOCYTES IN HUMAN AUTOIMMUNE DISEASE Abdou et al. [22] reported that the binding of human anti-DNA antibodies to DNA could be blocked by autologous sera obtained from patients with SLE when their disease was in remission and by the F(ab02 and Fab fragments derived from these sera. The inhibition of binding was interpreted as being due to the presence of anti-idiotypes in the inactive sera that reacted with the binding site of the anti-DNA antibodies present in the sera of patients when their disease was active. Additional findings extending this concept have also been presented [23]. Studies of anti-DNA and anti-F(ab02 antibodies were performed by enzyme-linked immunosorbent assay (ELISA) in 51 patients with SLE [24]. Patients with severe, uncontrolled disease showed high levels of anti-DNA and low levels of anti-F(ab02 antibodies. Patients with quiescent SLE usually showed high levels of anti-F(ab02 and low levels of anti-DNA antibodies. Isolated anti- F(ab02 antibodies from autologous SLE remission serum or from the sera of unaffected siblings of SLE patients showed maximum inhibition in test systems using affinity-purified SLE anti-DNA antibodies reacting with single-stranded DNA. In another study, it was demonstrated that specific anti-idiotypes can suppress the production of anti-DNA antibodies by peripheral blood mononuclear cells from active SLE patients [25]. These authors have developed an ELISA system for measuring in vitro anti-DNA antibody production by peripheral blood mononuclear cells (PBMC) from patients with SLE. Using this technique, the PBMC from 74% of serologically active SLE patients produced levels of anti-DNA antibodies that were increased 2 SD above the mean of 18 ± 9 lU/ml for normal subjects. Furthermore, the addition of 3-1, a monoclonal anti-idiotypic antibody that recognizes a cross-reactive
determinant on anti-DNA antibodies, was shown to specifically inhibit anti-DNA production in vitro. This finding supports previous work that implicates antiidiotypes among the regulatory mechanisms that can control synthesis of anti-DNA antibodies in patients with SLE and previous studies reporting inhibition of idiotypic antibodies by the addition of anti-idiotypic in vitro cultures of human PBMC. Zhou and Whitaker [26] raised a mAb of the IgGl//c isotype against human myelin basic protein (MBP) peptide acetyl 1-9. This mAb, termed F23, reacted with human MBP and human MBP peptides acetyl 1-9,1-14 and 1-44, but not with MBP peptides 10-19, 80-89, or 45-89. According to the guidelines of the molecular recognition theory, a complementary peptide to human MBP peptide 1-9 was synthesized and used to raise murine mAb with anti-Id activity. Two mAb anti-Id, F25F7 and F25C8, both of the IgM/K isotype, were selected for further study. The cross-reactive anti-Id suppressed antibody secretion of Id-producing hybridoma cells in an Idspecific manner, and kinetic studies suggest an intracellular mechanism for the suppression. These crossreactive Id among antibodies to different MBP peptides imply that the same V region genes of /c-L chains are involved in the selection of antibodies to an autoantigen, like MBP, and may play a role in the modulation of immune responses against MBP in certain inflammatory demyelinating diseases [26]. In another study [24], rabbit anti-idiotypic antibodies to human rheumatoid factor (RF) autoantibodies were isolated by affinity chromatograpy on rabbit antihuman IgG Fc sepharose 4B. The anti-idiotypic antibodies bore the "internal image" of the antigen, human IgG. They reacted specifically with multiple human monoclonal and polyclonal IgM-RF, independent of any particular light or heavy chain amino acid sequence. The anti-idiotypes did not react with IgM or IgG proteins lacking RF activity. The experiments in this study [27] determined the potential of the "internal image" antibodies to modulate in vitro lymphocyte functions. The addition of anti-idiotypic antibody to peripheral blood mononuclear cell cultures from patients with rheumatoid arthritis elicited lymphocyte proliferation, but not RF synthesis. The antibody did not induce the proliferation of lymphocytes from a normal individual. Moreover, the anti-idiotype specifically suppressed IgM-RF secretory responses when
367
preincubated with B cells before co-culture with autologous pokeweed mitogen-activated T cells. This study showed that the anti-idiotypic antibodies with the "internal image" of antigen are capable of interacting with B-cell receptors in an antigen-restricted manner, and possess specific immunomodulatory properties [27]. Takeuchi et al. [28], further studied the effect of anti-idiotypic antibody on the in vitro production of RF in rheumatoid arthritis patients with crossreactive idiotypic determinants. Anti-idiotypic antibodies were developed against monoclonal RP (KamRF) by a cell fusion procedure. These antibodies were idiotype-specific. The anti-idiotypic antibody strongly suppressed the in vitro production of RF by lymphocytes from unrelated rheumatoid arthritis patients with cross-reactive idiotypes. These results indicate that anti-idiotype antibody may influence the regulation of RF production in patients with rheumatoid arthritis [28]. Kojima et al. [29] have reported on the suppression of in vitro human antithyroglobulin antibody secretion in Epstein-Barr virus transformed B lymphocytes by private and cross-reactive anti-idiotypic antibodies. It was suggested that interactions between idiotype and anti-idiotype may play a role in the immune regulation of human-chronic thyroiditis [29].
6. ANTI-Ids AS SPECIFIC CARRIERS OF TOXINS Another method by which anti-idiotypes can be employed in the treatment of autoimmune diseases is as specific carriers of toxins. Sasaki et al. [30] have developed a new way of using anti-Id antibodies by conjugating them with cytotoxic agents, NCS (Neocarzinostatin). The conjugates killed Id-positive EBVtransformed-cell clones, resulting in the suppression of anti-DNA production. Later on, the same group demonstrated that this method is capable of manipulating the human anti-DNA system through the specific elimination of anti-DNA Id-positive cells from lymphocytes in the peripheral blood [31]. Following these in vitro studies [27, 28], Harata et al. [29] demonstrated a successful treatment of NZBAVF, mice disease by using anti-Id-conjugated NCS. In this study [32], in vivo administration of antiId antibodies conjugated with NCS brought about an
368
improvement in the survival rate of female NZBAV Fl mice. It also caused a retardation of development of lupus nephritis and decreased the numbers of anti-DNA reproducing cells. The suppression of anti-DNA antibody synthesis was specific and Id-mediated. These results indicate that the use of a limited number of antiId antibodies in combination with a cytotoxic agent may be applicable therapeutically to autoimmune diseases. Saporin is one of the most widely used toxin compounds for immunotoxin preparation. We have recently demonstrated the suppression of experimental systemic lupus erythematosus (SLE) with specific anti-idiotypic antibody-saporin conjugate [12]. The anti-Id treatment was specifically shown to reduce anti-DNA antibodies by a specific hybridoma cell line [12]. The immunotoxin (saporin) had a significantly superior result compared with the anti-Id itself. Yet, although impressive, the effect of the saporin in reducing anti-DNA antibody production and abrogation of SLE manifestations was not better than the anti-Id alone [12]. Valderrama et al. [33] have treated experimental myasthenia with autologous idiotypes linked to muramyl dipeptide. Rabbits were injected with purified acetylcholine receptor (AchR) from Torpedo, California. Polyclonal affinity purified anti-AchR antibodies (Ids) were coupled covalently to muramyl dipeptide and injected back into the same (autologous) rabbits from which the Ids were obtained. Treated animals developed anti-Ids that bound to the F(ab02 fragments of the Ids as demonstrated by ELISA and that also blocked binding of Ids to AchR in a radioimmunoassay. Treated animals showed a protective effect compared to control animals when challenged with a second injection of AchR. No apparent toxicity from the treatment was noted [33].
7. IN VIVO MODULATION OF THE IDIOTYPE NETWORK Subsequent to the encouraging results of the experiments involving in vitro modulation of autoantibody idiotypes by anti-Id treatment, in vivo studies were undertaken. These studies were conducted in animals and included (1) passive administration of anti-Id reagents to experimental animals and (2) immunization of mice against their own pathogenic Id.
8. PASSIVE ADMINISTRATION OF ANTI-Id TO ANIMAL MODELS OF AUTOIMMUNITY In mouse models of lupus, results have been conflicting probably reflecting different influences of various anti-idiotypes on autoimmune mechanisms. In BAV mice, administration of an anti-idiotype directed against a major CRI on anti-DNA antibodies resulted in the disappearance of anti-DNA antibodies bearing the target idiotype and in the prolongation of survival due to a delay in the onset of nephritis [13]. These researchers have identified three dominating Id in NZBAV F mice by the time they develop nephritis at 30 weeks of age: IdX, Id GNl and Id GN2 comprise about 85% of their total serum Ig. While Id GNl and GN2 comprise approximately 50% of the Id deposited in the glomeruli, IdX is detectable on less than 5% of glomerular Ig [34]. While a monoclonal antibody to Id GNl was administered repeatedly to NZBAV F, female mice beginning at 20 weeks of age, the levels of all three Id were significandy suppressed for 10 weeks, during which time disease developed in the controls, but not in the treated mice. Although IdX continued to be suppressed, levels of Id GNl escaped suppression and rose to levels similar to those in the control mice and fatal nephritis rapidly occurred. The Ig eluted from the glomeruli of these mice were composed entirely of Id GN2 Ig. This treatment with anti-Id GNl or with anti-IdX [34] prolonged the lives of the mice by 10 weeks. In contrast to the data described by Hahn and Ebling [13], administrating an anti-idiotype directed against Id-130 (a dominant idiotype of MRL antiDNA antibodies) to MRL mice, augmented the production of the Id-130 idiotype and anti-DNA antibodies [35]. However, Mahana et al. [36] were able to suppress anti-DNA production in MRL mice by the passive transfer of anti-idiotype D23 (an idiotype of a monoclonal polyspecific natural autoantibody reacting mainly with ds-DNA and ss-DNA). These conflicting results can be resolved if we assume that various anti-idiotypes regulate idiotypebearing autoantibidoes in different ways, some acting to suppress idiotype production and others augmenting idiotype expression. The importance of the idiotype network is represented in experimental SLE induced by active im-
munization of naive mice with an anti-DNA idiotype (Abl) emulsified in adjuvant. After 4 months of incubation, the mice generate Ab3 having antiDNA activity. In addition, the mice develop other serological markers for SLE associated with clinical and histopathological manifestations characteristic of the disease [37-39]. To confirm further the etiological role of the idiotype in the experimental model, the mice were treated with specific anti-idiotypic antibodies (anti-Id) which were also conjugated to a toxin-saporin (Immunotoxin [IT]) [12]. Pretreatment of hybridoma cell line producing the anti-anti-Id (antiDNA = (Ab3)) for 48 h with the anti-Id MoAb (Ab2) reduced the production of anti-DNA by 58%, while pretreatment with the IT resulted in 86% decrease in anti-DNA secretion (saporin alone had only 12% effect). The anti-Id MoAb had no effect on the production of immunoglobulin by an unrelated cell line. In vivo treatment of mice with experimental SLE led to a significant decrease in titers of serum autoantibidies, with diminished clinical manifestations. The results were more remarkable when the IT was employed. The anti-Id effect was mediated via a reduction in specific anti-DNA antibody-forming cells, and lasted only while anti-Id injections were given. Discontinuation of the anti-Id injection was followed by a rise in titres of anti-DNA antibodies. No immunological escape of new anti-DNA Ids was noted. These results point to the importance of pathogenic idiotypes in SLE and to the specific potential of implementing anti-idiotypeic therapy, enhanced by the conjugation of the anti-Id to an immunotoxin in particular one with low spontaneous toxicity [12]. The Fl progeny of the cross between SWR and NZB mice (SNFl) develop severe immune complex glomerulonephritis. An idiotypically related family of nephritic antibodies (IdLNFl) has been shown to be important in the pathogenesis of autoimmune glomerulonephritis in these mice. Uner et al. [40] have injected the SNFl mice with rabbit anti-IdLNFl antibodies, which resulted in significant suppression of IdLNFl + Ig(G + M) and IgG production. The decrease appeared to be mediated via significant decreases in the percentage of IdLNFl expressing B cells and CD4 + IdLNFl-specific T cells in the treated SNFl mice compared to the controls [41]. This was accompanied by a significant increase in survival with delayed onset of glomerulonephritis. Surprisingly, there was no difference in the incidence of
369
anti- DNA antibody production between the treated and control SNFl mice. Nordling et al. [41] have recently described a spontaneously occurring inflammatory and erosive joint disease in male DBA/1 mice. These mice have an increased serum antibody level to collagen II in a fraction of the male DBA/1 mice. Administration of antibodies with an anti-idiotypic activity to anti-collagen II antibodies and with an affinity for determinants on isolated synergeneic IgG Fc but not on intact IgG, was shown to interfere with the development of the spontaneous arthritis. In another study [42], collagen-induced arthritis was shown to be suppressed with monoclonal antiidiotypic antibody. Anti-idiotypic treatment has been tried, as well, in autoimmune tubulointerstitial nephritis (TIN) in Brown Norway rats [14]. In vivo injection of anti-TBM (tubular basement membrane) Id before immunization with TBM, resulted in a significant selective suppression of antibodies to the autologous collagenase-solubilized TBM moiety and a corresponding decrease of TIN [14]. Agius and Richman [16] have used isogeneic antiidiotypic monoclonal antibodies to modify experimental autoimmune myasthenia gravis (EAMG) in Lewis rats. Pretreatment with anti-Id not only perturbed this Id-anti-Id network, but also suppressed the overall polyclonal anti-AchR response with resultant protection of actively immunized animals from EAMG [16]. Other studies have confirmed the beneficial effect of anti-Id antibodies on EAMG [43-45]. Experimental autoimmune uveoretinitis (EAU) is induced in rats with injection of S-antigen (S-Ag) in complete Freund's adjuvant (CFA) [46]. de Kozak has shown that injection of rats with the mouse anti-SAg mAb S2D2 either simultaneously with or before SAg challenge led to an anti-idiotypic response and to inhibition of EAU.
9. SYNGENEIC IMMUNIZATION WITH IDIOTYPES Another method for treating animals is by active immunization with the idiotype instead of passive administration of the anti-idiotype. In NZB/W Fl mice, it was found that injection of a monoclonal anti-DNA Id resulted in a decrease of autoantibody levels and a partial improvement of the disease [47]. The effect was
370
transient, however, and anti-DNA antibodies appeared which did not exhibit the injected idiotype. In a different experiment, mice were inoculated with syngeneic anti-DNA IgG together with muramyl dipeptide. It was found that anti-DNA antibody levels were suppressed and that an anti-idiotype specific for the injected IgG appeared [48]. In another study, the immunization of BAV mice with the PME 77 anti-DNA monoclonal antibody (a syngeneic antibody bearing the idiotype present in most B/W sera) was investigated [49]. The PME 77 mAb immunization regimen induced the production of auto-anti-idiotypic antibodies and abrogated the expression of the PME 77 idiotype in B/W-treated mice. In contrast, untreated mice and control B/W mice receiving NZB polyclonal IgG2b which lacked detectable DNA binding capacity, expressed PME 77 idiotypes. These results demonstrate that the expression of idiotypes borne by autoantibodies may be modified through the induction of auto-anti-idiotypic antibodies. Treatment with anti-AchR idiotypic antibodies resulted in improvement of modulation of the immune response of mice to acetylcholine receptor [50].
10. IN VIVO ANTI-IDIOTYPIC THERAPY IN AUTOIMMUNE DISEASES Anti-idiotypic therapy has not been tried in human autoimmune diseases directly. One study used the approach of passage of plasma over an anti-idiotype column which removes antibodies bearing the common idiotype [51]. In this study, an anti-3I Id column was used to remove anti-ds DNA antibodies bearing the 31 Id from patients with SLE. There were no significant side effects. The recent development of 'humanized' murine or rat monoclonal antibodies opens the way for direct injection of Id-bearing or anti-idiotypic antibodies into patients. Intravenous immune globulin (IVIG) exhibits a number of immunomodulatory properties that are mediated by the Fc portion of IgG and by the spectrum of variable (V) regions contained in the immune globulin preparations. Significant progress has been made in understanding the mechanisms by which IVIG exert immunomodulatory effects in the treatment of autoimmune diseases [52, 53] (see Table 3).
Table 3, Possible mechanisms of action accounting for the immunomodulatory effects of IVIG • Neutralization of circulating autoantibodies by anti-idiotypic antibodies in IVIG. • Selection of immune repertoires. • Functional blockage of Fc receptors on splenic macrophages. • Inhibition of complement-mediated damage. • Modulation of the production of cytokines and cytokine antagonists.
Much attention has been given in recent years to the possibility that the immunomodulating effects seen in autoimmune diseases treated with IVIG (intravenous immunoglobulin) may be applied by antiidiotypic antibodies present in the gammaglobulin preparations. Indeed, recent studies strengthen the likelihood that anti-idiotypic antibodies present in IVIG preparations may control autoimmune reactions. Patients who developed antibodies to their own circulating factor VIII can bleed severely. IVIG can block the secretion of such antibodies and this property has been attributed to the presence of naturally occurring anti-Id antibody to the antibody against factor VIII [54-55]. Subsequendy IVIG, prepared from large pools of plasma from normal donors, were found to contain specific anti-idiotypes against a number of disease-related autoantibodies, including antibodies to DNA, thyroglobulin, gastric intrinsic factor [56, 57], peripheral nerve [58], neutrophil cytoplasmic antigens [59], platelet gpIIb/IIIa [60], and membrane antigen of erythroblasts [61]. Dietrich and Kazatchkine [57] found that antiidiotypes in IVIG recognize a cross-reactive idiotype on human anti-thyroglobulin (TG) autoantibodies that was defined by heterologous anti-idiotypic antibodies, termed anti-T44 antibodies. The idiotype was expressed on anti-thyroglobulin IgG of 8 out of 9 patients with Hashimoto's disease but on no IgG of 5 healthy individuals who were tested. Antithyroglobulin autoantibodies expressing the T44 idiotype exhibited restricted epitopic specificity against human thyroglobulin, thus, IVIG contain anti-idiotypic antibodies directed against an immunodominant crossreactive idiotype of human anti-TG autoantibodies. Evans and Abdou [62] have demonstrated that antiidiotypic antibody and its (ab02 fragments prepared from pooled normal human IgG had a partial inhibitory effect on the spontaneous in vitro secretion
of anti-DNA antibodies from blood mononuclear cells of lupus patients. The inhibitory effect was specific for anti-DNA secretion as the anti-idiotype failed to inhibit the spontaneous secretion of anti-tetanus toxoid, in the same culture supernatants [62]. Several lines of evidence demonstrate the presence in IVI G of anti-idiotypes against autoantibodies. These include: 1. F(ab02 fragments from IVIG inhibit the binding of autoantibodies to their autoantigens [54, 58, 63]. 2. F(ab02 fragments with autoantibody activity are specifically retained on affinity columns of sepharose-bound F(aW)2 fragments from IVIG [59, 63, 64]. 3. IVIG contain no antibody specificities against the most common allotypes expressed in the F(ab02 region of human IgG [63]. 4. The binding of IVIG to affinity-purified autoantibodies is specifically displaced by F(ab02 fragments from heterologous polyclonal antiautoantibody anti-idiotypes [56]. The high number of donors contributing to IVIG endows the preparation with anti-idiotypic specificities that may not necessarily be detectable in plasma from single healthy individuals. The IVIG may be efficient in some autoimmune diseases by providing a source of anti-idiotypes with a wide range of specificities brought as interconnected antibody species that may compensate for altered connectivity of the immune network of patients with autoimmune diseases [56]. Indeed, Bakimer et al. [65] have examined the effect of IVIG on the obstetric complication of experimental antiphospholipid syndrome (APS). After showing the binding of IVIG to mouse and human anti-cardiolipin antibodies (ACA) (e.g., the existence of natural anti-idiotypic autoantibodies to ACA), they infused 36 mu-g of IVIG to the tail vein of mice in which experimental APLS was induced by passive transfer of monoclonal mouse ACA (CAR). Mice treated with IVIG had significantly less fetal resorptions when mated, in comparison to untreated mice. The best results were achieved when IVIG was given 2 days after induction of the disease (on day 6 of pregnancy) [65]. Amout et al. [66] have described an interesting patient with a history of habitual abortion, deep venous thrombosis, thrombocytopenia, high titer IgG anticar-
371
diolipin antibodies and a clear positive lupus anticoagulant. She was treated during her seventh pregnancy with high dose IVIG from the third month onwards. Every month, a daily infusion of 400 mg immunoglobulins per kg body weight was given during five consecutive days. The patient's pregnancy ended preterm with a live birth, delivered by caesarian section because of a placental abruption. Each treatment with IVIG resulted in a slight reduction of both anticardiolipin antibodies and lupus anticoagulant levels and in an increase in platelet count. During the six-month observation period, a gradual decline in antiphospholipid antibodies and an increase in platelet count was found. The potential role of anti-idiotypic antibodies present in the IVIG used for treatment was studied. In vitro IVIG were able to reduce the binding of the patient's anticardiolipin antibodies to cardiolipin coated microtiter plates. The presence of anti-idiotypic antibodies in IVIG was further documented by affinity chromatography and by real-time biospecific interaction analysis (BIA) on a BIA-core instrument. Affinity purified anticardiolipin antibodies were retarded on a column of insolubilized IVIG and a weak interaction was found between IVIG and affinity purified patient antiphospholipid antibodies, coupled to the BIA-core biosensor. In addition, the same technology revealed increased levels of anti-antiphospholipid antibodies in the patient's plasma following IVIG therapy. The partial and transient reduction of anti-phospholipid antibody levels observed immediately following each treatment course seems compatible with low affinity complexation of idiotype-antiidiotypes, resulting in an accelerated clearance of the autoantibodies. Despite the low affinity for the patient's idiotypes, the beneficial long term effects observed could be related to an immune regulatory role of these anti-idiotypic antibodies on the synthesis of antiphospholipid antibodies [66]. Lockwood had shown the beneficial effect of IVIG in the management of vasculitis [67]. The author has shown the importance of ANCA idiotypic-antiidiotypic reactions in vitro and demonstrated that these could be influenced by anti-idiotypic determinants present in IVIG. Thus F(ab02 fragments of IVIG could block ANCA binding to antigen, in a dose-dependent fashion. The degree of inhibition was variable, ranging up to 100% for the ANCA-containing sera of certain patients. Similar inhibitory activity could be found in the sera of patients in remission after treat-
372
ment, as well as in occasional patients whose disease remitted spontaneously, without drugs being used [67].
11. IMMUNOMODULATION OF EXPERIMENTAL ANIMAL MODELS OF AUTOIMMUNITY WITH IDIOTYPE-SPECIFIC T CELLS AND ANTIBODIES THAT BIND TO T-CELL RECEPTOR (TCR) Still another approach introduced by Shoenfeld and Mozes [68] utilized T suppressor cells specific to pathogenic idiotypes. Several papers have reported decreased numbers and activity of T cells in several mice models for SLE as well as in other animal models for autoimmune conditions as summarized by Tomer and Shoenfeld [69]. Similarly decreased numbers and activity of Ts cells in humans with SLE and other autoimmune diseases have regularly been reported. If the production of autoantibodies in SLE and other autoimmune states is related to down-regulation of Ts, the reconstitution of Ts cell numbers and activity, and especially the Ts specific to the harmful autoantibody in question, may lead to amelioration of disease manifestations. In fact, several studies have suggested this very possibility [70-72]. In a recent experiment, Ts cells (CD8+) specific to the pathogenic idiotype 16/6 that were MHC-restricted in their function were generated in vitro. The suppressor cells specific for the pathogenic idiotype 16/6 were generated from populations of normal T cells exposed to silica beads coated with SA-1 (16/6 Id+) mAb in vitro [37]. Treatment of BALB/C mice in which SLE was induced experimentally [73] with the Id-specific Ts cells, resulted in a decline in the titers of autoantibodies in the sera and in clinical manifestations (increased ESR, low WBC count, and proteinuria). Furthermore, no immunoglobulin deposits were found in the mesangium of the kidneys in contrast to kidneys of the 16/6 Id-immunized mice treated with control IgM specific Ts cells. It should be noted that this treatment failed once the disease was well established (5 months after immunization with 16/6). These results emphasize the importance of the role played by pathogenic idiotypes in murine SLE and the role Ts cells may play in in-
duction as well as in the treatment of autoimmune conditions. In the same vein, strategies that might specifically block or inactivate helper T cells necessary for the sustained production of anti-DNA pathogenic antibodies may provide specific suppression of disease progression. As discussed earlier, Hahn and her colleagues have raised CD4-I- T-cell clones specific for Id GN2. Their program includes innoculating low doses of anti-Id GN2 to NZBAV Fl mice, harvesting T cells by draining lymph nodes, and obtaining T cells from the spleens of lupus mice with active nephritis. Stimulating these clones with rat concanavalin A supernatant, DNA antigen soluble Id GN2, or hybridoma B cells expressing Id GN2 on their surface, yields T-cell clones which significantly increase the production of Id GN2 IgG anti-DNA in a culture using B cells from the spleens of 16-week-old lupus mice. One of these clones isolated from the spleens of nephritic NZBAV Fl mice (termed TH 27.6), has been characterized [74]. It increases the synthesis of Id GN2 anti-DNA by NZBAV B cells eight fold, whereas it agumented total IgG only twofold. It is an autoreactive clone of the TH2 types: it can be activated by H2^ without addition of DNA, and secretes B-cell rather than T-cell growth factors, including IL-4, IL-5 and II6, but not IL-2. These studies may pave the way for new directions in disease management. Roubata et al. [18] have described the protective immunity against experimental autoimmune thyroiditis induced by a thyroglobulin (Tg)-specific cytotoxic T cell clone and showed that this down-regulation occurred through the generation of anti-Id antibodies (Ab2 Beta) which recognized the paratope of anti-Tg mAb (Abl) specific to the pathogenic epitope of the Tg molecule [18]. Protection from experimental allergic encephalomyelitis (in Lewis rats) was conferred by a monoclonal antibody directed against a shared idiotype on rat T cell receptors specific for myelin basic protein (MBP) [75]. Finally, it was demonstrated by Rohowsky et al. [76] that T-cell clones specific for MBP have the ability to induce proliferative responses in resting T lymphocytes in the autologous mixed lymphocyte culture (AMLC). Modulation of the T-cell receptor from the surface of the clones decreased their AMLC stimulatory ability, indicating that idiotype-like determinants on the T-cell receptor of autoantigen T-cell clones are
capable of triggering anti-idiotypic T-cell responses [76].
12. MODULATION OF THE IDIOTYPE NETWORK WITH ANTI-IDIOTYPIC THERAPY: POSSIBLE MECHANISMS AND THERAPEUTIC PROBLEMS The mechanism of suppression of the idiotype antibody response by the anti- idiotypic antibody is unclear. Two possibilities exist and they entail clonal deletion of B cells and production of suppressor T cells [77-78]. Simple binding of idiotype by the antiidiotype antibody is probably inadequate to explain the mechanism of suppression; the small amount of anti-idiotype necessary for suppression in the above mentioned experiments was greatly exceeded by the amounts of idiotypic antibody produced by immunized control animals [79]. The down-regulation of idiotype expression may be caused by the blocking of immunoglobulin synthesis or by the formation of complexes. For example, it has been suggested that the decrease in the binding affinity of an antibody response is related to the appearance of an auto-anti-idiotype [80]. It is not yet clear if the anti-Id acts directly on B cells to downregulate production of anti-DNA antibodies or if it acts through an idiotypic network involving T cells [80]. Indeed, besides inducing anti-Id Ab, treatment of mice anti-DNA IgG and MDP could also have induced either a depression of Id-specific T-helper cells or a stimulation of Id-bearing T-suppressor cells [48]. support for this view comes from the recent demonstration that administration of an anti-Id Ab to anti-DNA suppresses the pathogenic Ab to DNA NZBAV mice [13]. Future experiments will no doubt add to the better understanding of the mechanism involved in idiotype expression by manipulation of the idiotype network. There are many factors influencing the biological effectiveness of anti-Id treatment. Id manipulation can result in down- or up-regulation of the immune response depending on the time-window of the disease, the age of the animals, the idiotype, the affinity, and the amount of the Id or the anti-Id injected. The biological effectiveness of the treatment also depends on the functional properties of the anti-Id, i.e. whether it mimics the configuration of the antigenic motifs, or whether it interacts with regulatory Id that ensures
373
connectivity between various Id families [31, 48, 80, 81]. Although some studies have shown that antiidiotype administration can suppress the production of anti-DNA antibodies and nephritis, the effect was transient and anti-DNA antibodies appeared which did not bear the injected idiotype [47]. Moreover, in other studies, treatment of mice with anti-idiotypic anti-DNA antibodies was found to have no effect [35]. Yet another problem is the escape from suppression of Id production by anti-Id [13]. Therefore, although administration of anti-Id was effective in reducing an undesirable antibody response after the target Id was present in circulating antibodies, the benefits were limited probably by Id 'switch' or by increased synthesis of pathogenic antibodies bearing a minor Id. Such a change may be prevented by administration of polyclonal or mixed monoclonal anti-Id reagents. More distressing, however, is the fact that anti-Id reagents can augment rather than suppress the secretion of idiotypic antibodies [35]. These conflicting results can be resolved if we assume that various anti-idiotypes regulate idiotypebearing autoantibodies in different ways: some acting to suppress idiotype production and others augmenting idiotype expression. It is clear that modulation of the autoantibodies idiotype-anti-idiotype network will perturb other idiotype-anti-idiotype systems through the connections and cross-reactivities of the idiotypes and antiidiotypes involved. Removal of specific idiotypes will eliminate not only those borne by specific autoantibodies but those on antibodies directed against other auto antigens and bacteria. This might have unpredictable consequences on the body's ability to fight infection.
leg amputation, after the development of the tumor lesion. A lower number of melanoma recurrences and prolongation of survival time were demonstrated in the i.v.Ig-treated groups. In vitro studies revealed that i.v.Ig was found to stimulate the production or IL-12, an anti-tumor and anti-angiogenic cytokine. Moreover, it enhanced NK cell activity, thus explaining its beneficial effect in SCID mice (which lack B and T but possess NK cells). The results indicate that i.v.Ig acts as an anti-tumor agent. Since it has only minor side effects and is used extensively for other clinical conditions, i.v.Ig may be considered as a potential therapy for the prevention of tumor spread in humans.
14. SUMMARY Idiotypes and anti-idiotypes are becoming widely used in various experimental applications in multiple fields of research. Administration of anti-idiotypes has been attempted in order to manipulate immune reactions affecting autoimmune diseases. Immunization with anti-idiotypes and idiotypes may change the autoantibody expression in autoimmune diseases. However, in certain experimental models administration of antiidiotypes and idiotypes may even propagate the induction of autoimmune-like disorders. Despite all the present obstacles, treatment with anti-idiotypic antibodies may well be promising and practical in the future.
REFERENCES 1.
13. IVIG IN CANCER TREATMENT
2.
Autoimmunity and malignancy co-exist frequently, and share etiological and pathological mechanisms. Since the two diseases are similarly treated, we studied the efficacy of i.v. with melanoma or sarcoma cells induced a statistically significant inhibition or metastatic lung foci and prolongation of survival time. Similar results were seen with SCID mice inoculated with SK-28 human melanoma cells. In a different model, melanoma was induced in the foot pad, followed by
3.
374
4.
5.
Pan Y, Yuhasz SC, Amzel LM. Anti-idiotypic antibodies: biological function and structural studies. FASEB J 1995;9:43^9. Jeme NK. Towards a network theory of the immune system. Ann Immunol 1974;125:373-389. Shoenfeld Y Idiotypic induction of autoimmunity: a new aspect of the idiotypic network. FASEB J 1994;8:1296-1301. Cleveland WL, Wasserman NH, Sarangarajan R, Penn AS, Erlanger BR Monoclonal antibodies to the acetylcholine receptor by a normally functioning autoantiidiotypic mechanism. Nature 1983;305:56-61. Paul E, Manhiemer-Lory A, Livneh A. Pathogenic anti-DNA antibodies in SLE: idiotypic families and genetic origins. Int Rev Immunol 1990;5:295-313.
6.
7. 8. 9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
Buskila D, Shoenfeld Y. Anti-DNA idiotype: their pathogenic role in autoimmunity. In: Cruse JM, Lewis RE Jr, eds., Clinical and molecular aspects of autoimmune disease. Concepts Immunopathol, Basel: Karger 1992;8:85-113. Zanetti M. The idiotype network in autoimmunoprocesses. Immunol Today 1985;6:299-302. Burdette D, Schwarts RS. Idiotypes and idiotypic networks. N Engl J Med 1987;317:219-24. Brown SL, Miller RA, Horning SJ, Czerwinski D, Hart SM, McEdlerry R, Basham T, Warnke RA, Merigan TC, Levy R. Treatment of B-cell lymphomas with anti-idiotype antibodies alone and in combination with alpha interferon. Blood 1989;73:641-661. Miller RA, Maloney DG, Warnke R, Levy R. Treatment of B-cell lymphoma with monoclonal antiidiotype antibody. N Engl J Med 1982;306:517-522. Miller RA, Hart S, Samoszuk M, Coulter C, Brown S, Czerwinski D, Kelkenberg J, Ronyston I, Levy R. Shared idiotypes expressed by human B-cell lymphomas. N Engl J Med 1989;321:851-857. Blank M, Manosroi J, Tomer Y, Manosroi A, Kopolovic J, Charcon-Polak S. Suppression of experimental systemic lupus erythematosus (SLE) with specific anti-idiotypic antibody-saporin conjugate. Clin Exp Immunol 1994;98:434^41. Hahn BH, Ebling FM. Suppression of murine lupus nephritis by administration of an anti-idiotypic antibody to anti-DNA. J Immunol 1984; 132:18790. Zanetti M, Mampaso F, Wilson CB. Anti idiotype as a probe in the analysis of autoimmune tubulointerstial nephritis in Brown Morway rat. J Immunol 1984;131:1268-74. Nording C, Holmdahl R, Klareskog L. Down regulation of collagen arthritis after in vitro treatment with a syngenic monoclonal anti-idiotypic antibody to a cross reactive idiotype on collagen II autoantibodies. Immunology 1991;72:486-92. Aguis MA, Richman DR Suppression of development of experimental autoimmune myasthenia gravis with isogeneic monoclonal anti idiotypic antibody. J Immunol 1986;137:2195-8. Koazky DE, Mirshahi M. Experimental autoimmune uveoretinitis: idiotypic regulation and disease suppression. Int Opthamol 1990;14:43-47. Roubaty C, Bedin C, Charriere J. Prevention of experimental autoimmune thyroiditis through the anti-idiotypic network. J Immunol 1990; 144:21672172. Zou SR, Whitaker JN. Specific modulation of T cells and murine experimental allergic encephalomyelitis by monoclonal anti idiotypic antibodies. J Immunol 1993;150:1629-42.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
Kim YT, Puntino E, De Blasio T, Weksler ME, Siskind GW. Anti-idiotype antibody-mediated downregulation of anti-DNA antibody production by hybridoma cells. Cell Immunol 1987;105:65-74. Zhou SR, Whitaker JN. Interstrain cross-reactive idiotypes on monoclonal antibodies to an encephalitogenic myelin basic protein peptide. Clin Immunol Immunopathol 1992;63:74-83. Abdou NI, Wall H, Lindsley HB, Halsey JF, Suzuki T Network theory in autoimmunity. In vitro suppression of serum anti-DNA antibody binding to DNA by antiidiotypic antibody in systemic lupus erythematosis. J Clin Invest 1981;67:1297-1304. Reisman P, Abdou NI. The network theory in autoimmunity: modulation of in vitro anti-DNA antibody secretion by specific autologous anti-idiotype activated T suppressor cells in human systemic lupus erythematosus (SLE) correlation with disease activity (abstract). Clin Res 1983;31:351A. Epstein A, Greenberg M, Diamond B, Grayzel AI;Suppression of anti-DNA antibody synthesis in vitro, by a cross-reactive anti-idiotypic antibody. J CHn Invest 1987;79:997-1000. Zhou SR, Whitaker JN. An idiotype shared by monoclonal antibodies to different peptides of human myelin basic protein. J Immunol 1990; 145:25542560. Fong S, Gilbertson TA, Chen PP, Vaughan JH, Carson DA. Modulation of human rheumatoid factorspecific lymphocyte responses with a cross-reactive anti-idiotype bearing the internal image of antigen. J Immunol 1984;132:1181-1189. Takeuchi T, Hosono O, Koide J, Homma M, Abe T. Suppression of rheumatoid factor synthesis by antiidiotypic antibody in rheumatoid arthritis patients with cross-reactive idiotypes. Arthritis Rheum 1985;28:873-881. Kajima K, Matsuyama T, Tanaka H. Suppression of in vitro human anti-thyroglobulin antibody secretion by private and cross-reactive anti-idiotypic antibodies. Clin Immunol Immunopathol 1986;39:337-344. Sasaki I, Muryoin T, Takai O, Tamate E, Ono Y, Koide Y, Ishida N, Yoshinaga K. Selective elimination of anti-DNA antibody-producing cells by anti-idiotypic antibody conjugated with Neocarzinostatin. J Clin Invest 1986;77:1382-1386. Sasaki T, Tarmate E, Muryoi T, Takai O, Yoshinaga K. In vitro manipulation of human anti-DNA antibody production by anti-idiotypic antibodies conjugated with Neocarzinostatin. J Immunol 1989;142:11591165. Harata N, Sasaki T, Osaki H, Saito T, Shibata S, Muryoi T, Takai O, Yoshinaga K. Therapeutic treatment of New Zealand mouse disease by a limited
375
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
376
number of anti-idiotypic antibodies conjugated with Neocarzinostatin. J Clin Invest 1990;86:769-776. Valderrama R, Eggers AE, Moomjy M, Kao PN, Michl J. Treatment of experimental myasthemia with autologous idiotypes linked to muramyl dipeptide. Clin Exp Immunol 1988;73:123-127. Hahn BH, Ebling FM. Idiotype restriction in murine lupus: high frequency of three public idiotypes on serum IgG in nephritis NZB/NZW Fl mice. J Immunol 1987;138:2110-2118. Teitelbaum D, Rauch J, StoUar BD, Schwartz RS. In vivo effects of antibodies against a high frequency idiotype of anti-DNA antibodies in MRL mice. J Immunol 1984;132:1282-1285. Mahana W, Guilbert B, Avrameas S. Suppression of anti-DNA antibody production in MRL mice by treatment with anti-idiotypic antibodies. Clin Exp Immunol 1987;7:538-545. Mendlovic S, Brocke S, Shoenfeld Y, Ben-Bassat M, Meshorer A, Bakimer R, Mozes E. induction of SLE like disease in mice by a common anti DNA idiotype. Proc Natl Acad Sci USA 1988;85:2260-2264. Blank M, Krup M, Mendlovic S. The importance of the pathogenic 16/6 idiotype in the induction of SLE in naive mice. Scand J Immunol 1990;31:45-52. Blank M, Mendlovic S, Mozes E, Shoenfeld Y. Induction of SLE Hke disease in naive mice with a monoclonal anti-DNA antibody derived from a patient with polymositis carrying 16/6 Id. J Autoimmun 1988;1:683-9. Uner AH, Knupp CJ, Tatum AH, Gavalchin J. Treatment with antibody reactive with the nephritogenic idiotype, IdLNFl, suppresses its production and leads to prolonged survival of (NZBXSWR) Fl mice. J Autoimmun \99A\1\21-AA. NordUng C, Kleinau S, Klareskog L. Down-regulation of a spontaneous arthritis in male DBA/1 mice after administration of monoclonal anti-idiotypic antibodies to a cross-reactive idiotype on anti-collagen antibodies. Immunol 1992;77:144-146. Tarutani S. Collagen-induced arthritis suppressed with monoclonal anti-idiotypic antobody. Microbiol Immunol 1993;37:135-142. Blair DA, Mihovilovic M, Agius MA, Fairclough RH, Richman DP. Human x human hybroidomas from patients with myasthenia gravis: possible tools for idiotypic therapy for myasthenia. Ann NY Acad Sci 1987;505:155-167. Verschuuren JJ, Graus YM, Van-Breda-Vriesman PJ, Tzartos S, De-Baets MH. In vivo effects of neonatal administration of antiidiotype antibodies on experimental autoimmune myasthenia gravis. Autoimmunity 1991;10:173-179.
44.
45. 46.
47.
48.
49.
50.
51.
52.
53.
54.
55.
56.
Sunblad A, Hauser S, Holmberg D, Cazenave PA, Coutinho A. Suppression of antibody responses to acetylcholine receptor by natural antibodies. Eur J Immunol 1989; 19:14251430. de Kozak Y. Regulation of retinal autoimmunity via the idiotypic netowrk. Curr Eye Res 1990;9:193-200. Hahn BH, Ebling FM. Suppression of NZB/NZW murine nephritis by administration of a syngeneic monoclonal antibody to DNA - possible role of antiidiotypic antibodies. J Clin Invest 1983;71:17281736. Zouali M, Jolivet M, Leclerc C, Ravisse P, Audibert F, Eyquem A, Chedio L. Suppression of murine lupus autoantibodies to DNA by administration of muramyl dipeptide and syngeneic anti-DNA. J Immunol 1985;135:1091-1095. Jacov L, Tron F. Induction of anti-DNA auto-antiidiotypic antibodies in (NZBXNZW) Fl mice: posible role for specific immune suppression. Clin Exp Immunol 1984;58:293-299. Souroujon MC, Barchan D, Fuchs S. Analysis and modulation of the immune response of mice to acetylcholine receptor by anti-idiotypes. Immunol Lett 1985;9:331-336. Macleod B, Lewis K, Skchnitzer T, Katz R, Korbet S, Neighbour A, Wong W. Therapeutic immunoabsorption of anti-native DNA antibodies in SLE, clinical studies with a device utiUzing monoclonal anti-idiotypic antibody. Arthritis Rheum 1988;31(suppl):15. Kaveri S, Prasd N, Vassilev T, Hurez V, Pashov A, Lacroix-Desmazes S, Kazatchkine M. Modulation of autoimmune responses by intravenous immunoglobulin (IVIG). Mult Scler 1997;3:121-128. Mouthon S, Kaveri S, Spalter SH, Lacroix-Desmazes S, LeFranc C, Desai R, Kazatchkine M. Mechanisms of action of intravenous immune globulin in immunemediated diseases. Clin Exp Immunol 1996;104:3-9. Sultan Y, Kazatchkine MD, Maisonneuve P et al. Anti-idiotypic suppression to autoantibodies of factor VIII by high-dose intravenous gammaglobulin. Lancet 1984;2:765-768. Timmerman R, Kommesell B, Hasenberg J. Intravenous IgG for patients with spontaneous inhibitor to factor VIII. Lancet 1985;1:273-274. Rossi F, Kazatchkine MD. Anti-idiotypes against autoantibodies in polled normal human poly specific Ig. J Immunol 1989;143:4104-4109. Dietrich G, Kazatchkine MD. Normal immunoglobulin G (IgG) for therapeutic use contain antiidiotypic specificities against an immunodominant diseaseassociated, cross-reactive idiotype of human antithy-
57.
58.
59.
60.
61.
62.
63.
64.
65.
66.
67.
roglobulin autoantibodies. J Clin Invest 1990;85:620625. Van Doom PA, Brand A, Rossi F. On the mechanism of high-dose intravenous immunoglobuUn treatment of patients with chronic inflammatory demyelinating polyneuropathy. J Neuroimmunol 1990;29:57-61. Rossi F, Jayne DR, Lockwood CM. Anti-idiotypes against anti- neutrophil cytoplasmic antigen autoantibodies in normal human polyspecific IgG for therapeutic use and in the remission sera of patients with systemic vasculitis. Clin Exp Immunol 1991;83:298303. Berchtold P, Dale GL, Tani P. Inhibition of autoantibody binding to platelet glycoprotein Ilb/IIIa by antiidiotypic antibodies in intravenous gammaglobulin. Blood 1989;74:2414-2417. McGurie WA, Yang HH, Bruno E. Treatment of antibody mediated pure red-cell aplasia with highdose intravenous gammaglobulin. N Engl J Med 1987;317:1004-1008. Evans M, Abdou NI. In vitro modulation of anti-DNA secreting peripheral blood mononuclear cells of lupus patients by anti-idiotypic antibody of pooled human intravenous immune globulin. Lupus 1993;2:371375. Rossi F, Sultan Y, Kazatchkine MD. Anti-idiotypes against autoantibodies and alloantibodies to VIII :C (anti-hemophylic factor) are present in therapeutic polyspecific normal immunoglobulins. Clin Exp Immunoll988;74:311-316. Sultan Y, Rossi F, Kazatchkine MD. Recovery from anti-VIII: C (antihemophilic factor) autoimmune disease is dependent on generation of anti-idiotypes against anti-VIII: C autoantibodies. Proc Natl Acad Sci USA 1987;84:828-831. Bakimer R, Guilburd B, Zurgil N, Schoenfeld Y. The effect of intravenous gamma-globulin on the induction of experimental antiphospholipid syndrome. Clin Immunol Immunopathol 1993;69:97-102. Amout J, Spitz B, Wittevrongel C, Vanrusselt M, VanAssche A, Vermylen J. High-dose intravenous immunoglobulin treatment of a pregnant patient with an anti-phospholipid syndrome: Immunological changes associated with a successful outcome. Thromb Haemo 1994;71:741-747. Lockwood CM. New treatment strategies for systemic vascuUtis: the role of intravenous immune globulin. Clin Exp Immunol 1996;104:77-82. Shoenfeld Y, Mozes B. Pathogenic idiotypes of autoantibodies in autoimmunity: lesson for new experimental models of SLE. FASBB J 1990;4:26462651.
68.
69.
70.
71.
72.
73.
74.
75.
76. 77.
78.
79.
80.
81.
Tomer Y, Shoenfeld Y. The significance of Tsuppressor cells in the development of auto immunity. J Autoimmun 1989;2:739-758. Smith B, Behan WM, Menzies CB, Behan PO. Experiment autoimmune thyroiditis: affempt to correlate disease development with lymphocyte subset changes. Clin Bxp Immunol 1987;67:319-325. Ellerman KE, Powers JM, Brostoff SW. A suppressor T lymphocyte cell line for autoimmune encephalomyelitis. Nature (Lond) 1988;331:265-267. Pachner AR, Kantor FS. In vitro and in vivo actions of acetylcholine receptor educated suppressor T-cells lines in murine experimental autoimmune myasthenia gravis. Clin Exp Immunol 1984;56:659-668. Blank M, Mendlovic S, Mozes E, Coates ARM, Shoenfeld Y. Induction of systemic lupus erythematosus in naive mice with T cell lines specific for human anti-DNA antibody SA-1 (16/6 Id+) and for mouse tuberculosis antibody, TB/68 (16/6 ID+). Clin Immunol Immunopathol 1991;60:471-473. Ando DG, Scroarz LL, Hahn BH. Mechanisms of T and B cell collaboration in the in vitro production of anti-DNA antibody in the NZB/NZW Fl murine SLE model. J Immunol 1987;138:3185-3190. Owhashi M, Heber Katz E. Protection from allergic encephalomyelitis conferred by a monoclonal antibody directed against a shared idiotype on rat cell receptors specific for myelin basic protein. J Exp Med 1988;168:2153-2164. Rohowasky-Kochan C, Eiman D, Denny T, Oleske J, Cook SD. Induction of autologous mixed lymphocyte culture responses by myelin basic protein-reactive T cell clones. J Neuroimmunol 1994;50:59-70. Kohler H, Kaplan DR, Strayer DS. Clonal depletion in neonatal tolerance. Science 1974;186:643-644. Eichmann K. Idiotypic suppression. II. AmpUfication of a suppressor T cell with anti-idiotypic antibody activity. Eur J Immunol 1975;5:511-516. Hart DA, Wang A, Pawlak LL, Nisonoff A. Suppression of idiotypic specificities in adult mice by administration of anti-idiotypic antibody. J Exp Med 1972;135:1293-1299. Zouali M, Diamond B. Idiotype-mediated intervention in systemic lupus erythematosus. J Autoimmun 1990;3:381-388. Brown CA, Carey K, Colvin RB. Inhibition of autoimmune tubulointerstitial nephritis in guinea pigs by heterologous antisera containing anti-idiotype antibodies. J Immunol 1979;123:2102-2107. Yehuda Shoenfeld and Pnina Fishman. Gammaglobulin inhibits tumor spread in mice. Int Immunol 1999;11:1247-1251.
377
© 2000 Elsevier Science B. V. All rights reserved. Cancer and Autoimmunity Y. Shoenfeld and M. E. Gershwin, editors
Active Specific Immunotherapy of Malignant Diseases—Breaking Tolerance to Self-Antigens with T\imor Associated Antigen Mimics Elvyra J. Noronha, Xinhui Wang, Smruti A. Desai, Dongsheng Zhang, Joerg Willers and Soldano Ferrone Roswell Park Cancer Institute, Bujfalo, NY, USA
1. INTRODUCTION In recent years, there has been a major emphasis on the development and application of active specific immunotherapy for the treatment of malignant diseases [1, 2]. This trend reflects several reasons. First, the realization of the limitations of chemotherapy [3] in the treatment of malignant diseases has stimulated interest in testing alternative therapeutic modalities developed with antitumor associated antigen (TAA) monoclonal antibodies (mAb) and with cytotoxic cells [4-7]. Second, the identification of TAA with antibodies and cytotoxic T lymphocytes (CTL) and the characterization of their molecular properties [8-16] have provided well defined and standardized moieties to be used as immunogens in trials of active specific immunotherapy and as markers to monitor the immune response elicited in immunized patients. Lastly, the significant progress made in our understanding of the molecular events which lead to the development of an immune response [17] and the availability of cytokines [18] involved in these interactions have facilitated the development of immunization strategies to implement active specific immunotherapy of malignant diseases. Since most, if not all, the TAA used as immunogens in patients with malignant diseases are self-antigens [19, 20], one of the major challenges facing active specific immunotherapy of malignant diseases is the development of strategies effective in breaking tolerance to a self-antigen. Among the many approaches, which are being tested, one relies on the immunization of hosts with antigens which are similar, but not identical to the original TAA. The working hypothesis underlying this strategy is that variants of
poorly immunogenic TAA expressed by tumor cells may be immunogenic and may prime an immune response that cross reacts with the original TAA. The immunogens which have been shown to be effective in inducing immunity to a self-antigen include: (i) xenogeneic TAA which display a high degree of homology, but not complete identity in their amino acid sequence with a self-antigen [21, 22]; (ii) peptides derived from the amino acid sequence of the TAA which have been changed in the anchor residues to increase their affinity to MHC class I antigens and/or in amino acids that contact T-cell receptor [23-25]; and (iii) anti-idiotypic (anti-id) antibodies, which bear the internal image of TAA [26]. Since our work has focused on the evaluation of anti-id mAb as immunogens to implement active specific immunotherapy in patients with malignant melanoma [27], in this review we will first briefly discuss the rationale and the advantages and disadvantages of the use of anti-id antibodies as immunogens in active specific immunotherapy of malignant diseases. Then, we will review the results of clinical trials performed in patients with solid tumors, with anti-id antibodies which bear the internal image of TAA expressed by solid tumors. In the third section of this review, we will discuss the clinical significance of the cellular and humoral immunity elicited by anti-id antibodies. Finally, we will describe our approaches to overcome the limitations of active specific immunotherapy of malignant diseases with anti-id antibodies which bear the internal image of TAA. Results obtained with anti-id antibodies related to human TAA systems and in patients with malignant diseases will be the focus of this review. Data obtained
379
Anti-id antibody
Anti-TAA antibody
Figure 1. Mimicry of a TAA determinant by an anti-id mAb. An 'internal image' anti-id mAb, elicited by an anti-TAA mAb, expresses an idiotope displaying a similar, but not identical shape as the epitope recognized by the anti-TAA mAb.
in animal model systems will be described and/or discussed only when they contribute to our understanding and interpretation of findings in humans.
2. TAA MIMICRY BY ANTI-ID ANTIBODIES AND ANTI-ANTI-ID RESPONSE CHARACTERISTICS According to the network theory proposed by Jerne [28], immunization with a given antigen induces antibodies which are termed Abl. The heavy and Ught chain variable regions of an Abl antibody express determinants known as idiotopes (id). The set of idiotopes expressed on an antibody constitutes its idiotype. Idiotopes can elicit anti-id antibodies, known as Ab2. Some anti-id antibodies, indeed a very low percentage of them, mimic the corresponding antigen, since they react with the same portion of the antigen combining site of the Abl antibody which binds the antigen (Figure 1). The antigen mimicry by an antiid antibody reflects, in the large majority of cases, similarities in the conformation between an antigenic determinant expressed on the nominal antigen and an idiotope resulting from the association of the heavy and light chain of an anti-id antibody [29]. Only in a few cases, antigen mimicry by an anti-id antibody reflects homology in an amino acid sequence stretch between the nominal antigen and the heavy or light chain variable regions of an anti-id antibody [30, 31] or an amino acid sequence resulting from the combination of a stretch of the heavy and light chain variable regions of an anti-id antibody [32, 33].
380
Anti-id antibody
Figure 2. Differential ability of a self-TAA and an anti-id mAb mimicking a TAA determinant to elicit a humoral immune response to the self-TAA. A self-TAA is poorly immunogenic due to the deletion during establishment of self-identity, of B-cell clones that recognize the self-TAA with high affinity, anti-id antibodies which are similar, but not identical to the nominal antigen, activate and stimulate B-cell clones which have not been eliminated during the establishment of self- identity, since they recognize the TAA with low affinity. The activated B-cell clones secrete antibodies which fit poorly the determinant(s) expressed on the self-TAA.
In at least three TAA systems, anti-id antibodies have been found to be more effective than the corresponding antigen in breaking tolerance to a selfantigen, since they have elicited antigen binding antibodies, while the corresponding nominal antigen has not [34-41]. The lack of immunogenicity of a self-antigen is likely to reflect the deletion during the establishment of self-identity, of B-cell clones that recognize the antigen with high affinity. In contrast, the immunogenicity of the corresponding anti-id antibody is likely to reflect its ability to stimulate Bcell clones which have not been deleted during the establishment of self-identity, since they secrete antibodies reacting with the corresponding antigen with an affinity below the threshold required for deletion. A schematic representation of this potential mechanism is shown in Figure 2. Anti-id antibodies which are similar, but not identical to the nominal antigen, activate and stimulate B-cell clones secreting antibodies which fit poorly antigenic determinants expressed on the self-antigen. As a result, the reactivity of the secreted anti-anti-id antibodies with the nominal antigen is low, in spite of their high reactivity with the immunizing anti-id antibody. This model is supported by the results of the analysis at the clonal level of the fine specificity of antigen binding anti-anti-id antibodies and corresponding Abl antibodies. The reactivity
Figure 3. Processing and presentation of exogenous and endogenous antigens to CTL by antigen presenting ceils. Peptides are generated from endogenous proteins by the proteasome and transported to the endoplasmic reticulum where they are bound to MHC class I molecules. The peptide-MHC class I antigen complex is transported to the plasma membrane. Exogenous antigen is internalized by phagocytosis or other endocytic mechanisms depending on the size of the molecule. Antigen is then transported into the cytosol by poorly defined mechanisms, and becomes available for binding to MHC class I molecules in the endoplasmic reticulum via the MHC class I pathway.
pattern of antigen binding anti-anti-id mAb resembles, but is not superimposable to that of the corresponding Abl mAb [42-45]. Furthermore, antigen binding anti-anti-id mAb display a lower association constant and/or binding to the nominal antigen than the corresponding Abl mAb, but a similar or higher reactivity with the immunizing anti-id mAb [46-48]. These findings imply that Ab3 antibodies elicited in response to an Ab2 antibody are optimized for binding the Ab2 antibody rather than the antigen [48]. The structural basis of these immunological findings has been provided by two lines of evidence. First, comparison of the amino acid sequence of the heavy and light chain variable regions of antigen binding anti-anti-id mAb and of Abl mAb has shown a high degree of homology but not a complete identity among them [49-52]. Second, the crystallographic analysis of the interaction of a mAb with the hen-egg lysozyme and with an antiid mAb which bears its internal image has indicated that only about 70% of the residues involved in the chemical contacts of Abl mAb with Ab2 mAb are also involved in the contact of Abl mAb with the antigen [53]. This information indicates that one major limitation of active specific immunotherapy of malignant diseases with anti-id antibodies is represented by the low titer and association constant of anti-TAA antibodies elicited in patients. This characteristic of the anti-anti-id response is likely to have a negative impact on the outcome of active specific immunotherapy of malignant diseases with anti-id antibodies.
An additional major limitation of active specific immunotherapy with anti-id antibodies which mimic TAA is represented by the inability of most anti-id antibodies to elicit MHC class I antigen restricted, TAA specific CTL. As schematically summarized in Figure 3, generation of CTL requires presentation by MHC class I antigens of a 9-11 amino acid long peptide which was believed for some time to be derived only from endogenously synthesized proteins (for a review, see [54]). However convincing evidence indicates that a subset of antigen presenting cells, mainly macrophages and dendritic cells, can acquire and present exogenous antigens on MHC class I molecules to T cells (for a review, see [55]). This model accounts for the inability of most anti-id antibodies to elicit HLA class I antigen restricted, nominal antigen specific CTL. Idiotopes which mimic determinants expressed on the nominal antigen result from the association of the heavy and light chains of anti-id antibodies in the large majority of antigenic systems investigated. As a result, the idiotope which mimics the determinant of the nominal antigen is lost upon dissociation of the heavy and fight chain of the anti-id antibody and is not expressed on the peptides derived from the digestion of the heavy and light chains of the anti-id antibody. Therefore, peptides derived from an anti-id antibody are not expected to elicit nominal antigen specific CTL even if they have HLA class I antigen binding motifs and are presented to CTL. An exception to this scenario is represented by those rare cases in which antigen mimicry by the anti-id antibody is mediated by an amino acid sequence stretch of its heavy and/or light chain variable regions. The inability of anti-id antibodies to induce HLA class I antigen restricted, TAA specific CTL in conjunction with the postulated major role of TAA specific CTL in the control of tumor growth [56] account for the waning of tumor immunologists' interest in utiHzing anti-id antibodies as immunogens to implement active specific immunotherapy of malignant diseases. This trend is surprising since the induction of antigen binding anti-anti-id antibodies is associated with a favorable clinical course of the disease in patients with malignancies, as it will be summarized in the next section. Furthermore, evidence in animal model systems and in patients with malignancies, recently reviewed by Livingston [57], indicates that anti-TAA antibodies can control tumor growth.
381
Table 1. Immunological and clinical responses in patients with colorectal carcinoma immunized with anti-id antibodies mimicking the C017-1A/GA733 antigena^ Anti-TAAmAb(Abl)
Anti-id antibody
Carrier and adjuvant
Patients #
Immune response
Clinical response
References
C017-1A
goat
Alum^
30
anti-gp40 Abs (21)^
PR^ (6) SD^ (7)
[58]
C017-1A C017-1A GA733 GA733 17-lA
mAb VF2 mAbBR3 goat goat
Alum Alum or 11-2 Alum Alum Bordetella pertussis
9 57 13 10 6
-
-
anti-gp40 Abs(13) anti-gp40 Abs (7) anti-gp40 Abs (1) anti-gp40 Abs (5) CD4+ T cells (6)
SD (14) NED^ (9)
[59] [60] [61, 62]
mAb h-Ab2
[63]
^ The epitope defined by mAbs C017-1A and GA733 is expressed on a 40 kD glycoprotein associated with colorectal carcinoma. ^ Alum = aluminum potassium hydroxide. ^ (n) number of patients. *^ PR = partial response. ^ SD = stable disease. ^ NED = no evidence of disease. Table 2. Immunological and clinical responses in patients with colorectal carcinoma immunized with anti-id mAb mimicking CEA Anti-TAA mAb
Anti-id mAb
Carrier and adjuvant
Patients #
Immune response
Clinical response
References
8019
3H1
Alum^
23
-
[41,64]
8019
3H1
Alum/QS21
15
anti-CEAAbs(13)^ CD4+ T cells (5) anti-CEA Abs and CD4+T cells (15)
PD^ (6) SD^ (3)
[65]
^ Alum = aluminum potassium hydroxide. ^ (n) number of patients. ^ PD = progressive disease. ^ SD = stable disease.
3. CLINICAL TRIALS WITH ANTI-ID ANTIBODIES IN COLORECTAL CARCINOMA, IN MELANOMA AND IN OVARIAN CARCINOMA Anti-id antibodies which mimic colorectal carcinoma associated antigens, melanoma associated antigens and ovarian carcinoma associated antigens have been tested in cUnical trials. The available information which is summarized in Tables 1-6 contributes to evaluate the usefulness of anti-id antibodies as immunogens to implement active specific immunotherapy in patients with malignant diseases. Before listing the most important conclusions derived from the clinical trials described thus far, we would like to stress that caution has to be exercised in interpreting the results obtained thus far, since most of the anti-id antibodies have been tested only in one center in a limited number of patients. The only exceptions are represented by anti-id mAb which mimic antigenic determinants of
382
the human high molecular weight-melanoma associated antigen (HMW-MAA) and GD3 ganglioside. The anti-id mAb MFll-30, which had been elicited with the anti-HMW-MAA mAb 225.28, and its subclone Mel-1 have been tested in two groups of patients with melanoma by Mittelman et al. [69] and by Pride et al. [72]. The latter investigators have also tested the antiid mAb Mel-2 which has also been used by Quan et al. [71] to implement active specific immunotherapy in patients with melanoma. The anti-id mAb Mel2 had been elicited with the anti-HMW-MAA mAb MEM-136, which recognizes a distinct and spatially distant determinant from that defined by mAb 225.28. Furthermore, the anti-id mAb BEC2, which had been elicited with the anti-GDa gangfioside mAb R24 [78] is being tested in a multicentric clinical trial in patients with lung carcinoma. To the best of our knowledge, this is the only clinical trial to be conducted in a double blind fashion. The results of this trial are expected to provide conclusive evidence about the value
Table 3. Immunological and clinical responses in patients with colorectal carcinoma immunized with anti-id mAb mimicking the gp72 antigen Anti-TAA mAb
Anti-id mAb
Carrier and adjuvant
Patients #
Immune response
Clinical response
References
791T/36 791T/36 791T/36
105AD7 105AD7 105AD7
Alum^ Alum Alum
6 13 6
CTL (4)^ CTL (9) CTL'^ (3)
Survival prolongation
[66] [67] [68]
^ Alum = aluminum potassium hydroxide. ^ (n) number of patients. ^ not clearly indicated that the killing is by CTL but it is not due to NK cell activity. Table 4. Immunological and clinical responses in patients with melanoma immunized with anti-id mAb mimicking HMW-MAA Carrier and adjuvant
Patients #
Immune response
Clinical response
References
19
anti-HMW-MAA Abs(16)^ anti-HMW-MAA Abs(17) anti-HMW-MAA Abs(i) anti-HMW-MAA Abs (5) CTL (12)
CR'^ (1), MR^ (3) Survival prolongation Survival prolongation
[69]
Anti-TAA mAb
Anti-id mAb
225.28
MFll-30^
763.74
MK2-23
763.74
MK2-23
MEM-136
Mel-2
SAF-m8
26
225.28 MEM-136
Mel-1' Mel-2
SAF-m
28
KLH^ BCG^
33 19
[38, 70]
Survival prolongation CR(1),MR(2) SD^ (3) Survival prolongation
[71] [72]
^ mAbs MFl 1-30 and Mel-1 were derived from the same hybridoma. ^ (n) number of patients. ^ CR = complete response. " MR = minor response. ^ KLH = keyhole limpet hemocyanin. ^ BCG = attenuated strain of Mycobacterium bovis. ^ SAF-m = mixture of chemical and bacterial components. ^ SD = stable disease.
of the anti-id mAb BEC2 as an immunogen to implement active specific immunotherapy in patients with an overexpression of GD3 ganglioside in their malignant lesions. No information is available yet about the results of this multicenter trial. Additional limitations to be taken into account when analyzing the published results include: (i) the advanced stage of the disease of most of the patients enrolled in clinical trials to evaluate experimental therapies; (ii) the scanty information about the functional characteristics of the immunized patients' immune system; and (iii) the heterogeneity of the immunized patient populations in terms of tumor load and/or prior therapies. In spite of these limitations, the following conclusions can be drawn from the available information in the literature: (i) Repeated administrations of xenogeneic anti-id antibodies to patients with malignancies have not been associated with side effects in spite of the induction
of high titer antibodies to the constant and variable regions of the immunizing antibodies. Results to be reported elsewhere also suggest that antibodies to the constant regions of the immunizing xenogeneic antiid antibodies do not affect their ability to induce TAA binding anti-anti-id antibodies. These findings argue against the need to reduce the induction of anti-Ig antibodies in immunized patients by utilizing fragments instead of the whole Ig of anti-id antibodies as immunogens. The only side effects experienced by immunized patients have been caused by some of the adjuvants used such as Bacille Calmette Guerin (BCG). (ii) IVIost, although not all the anti-id antibodies which have been tested have induced antibodies to the corresponding TAA in a variable percentage of the immunized patients. The difference in patients' ability to develop TAA binding anti-anti-id antibodies may reflect the different extent of immune suppression
383
Table 5. Immunological and clinical responses in patients with ovarian carcinoma immunized with anti-id mAb mimicking CA125 Anti-TAA mAb
Anti-id mAb
Carrier and adjuvant
Patients #
Immune response
Clinical response
References
OC125
ACA125
-
16
anti-CA125 Abs(9)^ CTL (9)
Survival prolongation
[73]
^ (n) number of patients. Table 6. Immunological and clinical responses in patients with melanoma immunized with anti-id mAb mimicking GD2 or GD3 gangUosides Ganglioside
Anti-TAA mAb
Anti-id mAb
Carrier and adjuvant
Patients #
Immune response
Clinical Response
References
GD2
14.G2a
1A7
QS21^
12
anti-GD2Abs(12)^
CR'^ (1)
[74]
GD2
_
TriGem
QS21
47
anti-GD2 Abs (40)
CR(1) SD(18)
[75]
GD3
R24 R24 R24 R24
BEC2 BEC2 BEC2 BEC2
-
20 14 6 18
anti-GD3 Abs(l) anti-GD3 Abs (3)
-
[3] [76] [76] [77]
GD3 GD3 GD3
BCG^ QS21 KLH^ BCG
anti-GD3 Abs (4)
"
^ QS21 = saponin extract from the bark of the South American soap bark tree Quillaja saponaria monila. ^ (n) number of patients. ^ CR = complete response. *^ SD = stable disease. ^ BCG = attenuated strain of Mycobacterium bovis. ^ KLH = keyhole limpet hemocyanin.
caused by the malignant disease. This possibility is supported by the higher immune response elicited in healthy animals than in patients with melanoma by anti-id mAb which mimic distinct determinants of the HIVIW-IVIAA. Specifically, the anti-id mAb MK2-23 has induced anti-HlVlW-lVIAA antibodies in all the immunized rabbits [79], but in about 60% of patients with melanoma [38, 70]. Furthermore, the anti-id mAb Mel-2 has induced anti-HlVlW-lVIAA antibodies in cynomolgus monkeys [80], but not in patients with melanoma [81]. However, one cannot exclude that these differences reflect the extent of mimicry by anti-id mAb of determinants on human TAA and on the counterpart expressed in the animals used for the immunization experiments. This possibility should be taken into account especially since no significant difference in the level of antibodies to constant regions of the immunizing mouse anti-id mAb has been found between patients who have developed TAA binding anti-anti-id antibodies and those who have not. An alternative, but not exclusive mechanism to explain the difference in the anti-anti-id response of the immunized patients is represented by the inability of some of them to recognize the idiotope which mimics the TAA
384
determinant. Whether the patients' immune response to the internal image of the TAA determinant is HLA linked remains to be determined. This possibility is suggested, at least in some TAA systems, by the difference in the ability of H-2 congenic mouse strains to develop HMW-MAA binding antibodies (unpublished results) following immunizations with anti-id mAb IVIK2-23. The latter bears the internal image of the antigenic determinant defined by anti-HlVlWMAK mAb 763.74 [38, 79, 82]. (iii) The level of TAA binding anti-anti-id antibodies elicited in patients has been found to be low in all the clinical trials. In the GD3 gangUoside system, anti-anti-id antibodies have been found to react with synthetic GD3 ganglioside, but not with GD3 ganglioside expressed on tumor cells [77]. This finding has been suggested to reflect the low avidity of GD3 ganglioside binding anti-anti-id antibodies for membrane bound GD3 ganglioside. The low level and the low association constant of TAA binding antibodies elicited by anti-id antibodies are not likely to reflect malfunction of patients' immune system because of malignant disease induced immune suppression, since similar characteristics have been found in the anti-
Table 7. Sequence of the peptides derived from anti-id mAb Melwith HLA-A2 antigen binding motifs Sequence
Position
Binding score^
LLVLLYSKL YLCCVQSRI
V H F R ^ I (2-10)
54.47 47.99
VL FR2-CDR'^2 (37-45)
^ Binding scores were determined using BIMAS (100). " Framework region; cComplementarity determining region. Table 8. Sequence of peptides derived from HMW-MAA core protein with HLA-A2 antigen binding motifs Sequence QLYSGRLQV VLLHNSVPV QLLTISPLV KMFTLLDVV LLPIQVNPV VLSADHLFV LLFGSIVAV TLLGLSLQV FLEANMFSV LLLALILPL LILPLLFYL
Position in core protein 77 271 430 492 541 916 1063 1389 2217 2234 2238
Binding score^ 222.56 437.48 257.34 300.57 271.94 650.31
TAA boost T o ^ J
1006.20 257.34 273.15 309.05 1355.57
^ Binding scores were determined using BIMAS (100).
anti-id response elicited in healthy animals [46^8]. As discussed in a previous section of this paper, the low reactivity of TAA binding anti-anti-id antibodies with the original antigen reflects the similarity, but not identity with the original TAA, of the anti-id antibody used as an immunogen. If this interpretation is correct, the reactivity of antianti- id antibodies with the TAA used as a target of immunotherapy cannot be enhanced by augmenting the immunogenicity of anti-id antibodies used as immunogens. Furthermore, no information is available about the effect of the degree of antigen mimicry by anti-id antibodies on the characteristics of the anti-anti-id response. Therefore, one cannot predict whether amino acid substitutions in the heavy and/or light chain variable regions of an anti-anti-id antibody to enhance or reduce the degree of antigenic mimicry represents a viable approach to augment the reactivity of anti-anti-id antibodies with TAA. (iv) The immunogenicity of anti-id antibodies in patients with malignant diseases is influenced by several variables. It has been a general experience that, in agreement with data obtained in animal model
Figure 4, Model for the generation of high affinity antibodies to a self-TAA by sequential immunization with a mimic of the self-TAA and with the original self-TAA. Mimics of self-TAA activate B-cell clones secreting antibodies which recognize poorly the epitope(s) on the self-TAA. Somatic hypermutations in the course of an immune response may result in the generation of B-cell clones secreting antibodies with high reactivity with self-TAA. Boosting with the original self-TAA leads to the expansion of these high affinity antibody producing B-cell clones.
systems, the immunogenicity of anti-id antibodies in patients with malignant diseases is enhanced by their administration with an adjuvant [38, 70, 71, 76, 77]. Alum, BCG and QS21 have been used as adjuvants in patients [38, 41, 58-62, 64-72, 74-77]. Whether the three adjuvants differ in their efficacy to enhance the immunogenicity of anti-id antibodies remains to be determined. The dose/injection of anti-id antibodies injected to patients ranges between 0.1 mg and 8 mg. There is general consensus that the optimal dose for immunization is 2 mg of anti-idiotypic antibody/injection. This dose, which had been identified in a dose escalation trial with the anti-id mAb MFll30 in patients with melanoma [69], has been used for most of the anti-id mAb tested in clinical trials. The total dose of anti-id antibody injected to a patient ranges from 0.5 to 56 mg. The requirement for conjugation
385
to a carrier differs among the anti-id antibodies tested. Keyhole limpet hemocyanin (KLH) which is the only carrier used in patients with malignant diseases, has been found to enhance the immunogenicity of some anti-id mAb [70], but to reduce or not to affect that of others [77]. Whether these differences reflect technical reasons and/or the characteristics of the TAA system and/or of the anti-id mAb tested remains to be determined. Different immunization schedules have been tested. The total number of immunizations/patient has ranged from 3 to 26. The frequency of the administrations has ranged between every 1 and 8 weeks. The effect of the immunization schedule on the immunogenicity of anti-id antibodies is not known, since this variable has not been investigated in patients with malignant diseases and has been investigated only to a limited extent in animal model systems [83]. (v) Immunotherapy with anti-id antibodies has been found to have a beneficial effect on the clinical course of the disease, as evidenced by regression of metastatic lesions in a limited number of patients [69, 71, 84] and by survival prolongation of the immunized patients [38,67,69,70,72,73]. The latter has been assessed utilizing historical controls in a limited number of studies [67,77]. In many studies, survival prolongation has been found to be associated with the immune response elicited by anti-id antibodies [38, 69-71,7375] or with the triggering of the idiotypic cascade by anti-TAA antibodies [85-87]. This association argues in favor of a clinical significance of the anti anti-id response elicited in patients with malignant diseases.
4. CLINICAL SIGNIFICANCE OF THE HUMORAL AND CELLULAR ANTI-ANTI-ID IMMUNE RESPONSE ELICITED IN PATIENTS WITH MALIGNANT DISEASES Studies in animal model systems have convincingly shown that anti-anti-id immune responses elicited with anti-id antibodies [88, 89], with anti-TAA mAb [90] or with peptides derived from the amino acid sequence of complementarity determining region (CDR) of antiTAA mAb [90] can induce tumor rejection. These findings support the possibility that the association between improved prognosis and development of a humoral and cellular anti-anti-id response in patients with malignant diseases immunized with anti-id anti-
386
bodies or with anti-TAA antibodies might not be fortuitous, but might reflect an effect-cause relationship. As far as the mechanisms underlying these findings is concerned, the beneficial effect of TAA binding anti-anti-id antibodies on the clinical course of the disease is likely to reflect the complement and cell dependent lysis of tumor ceUs mediated by anti-antiid antibodies and/or inhibition of the function of the corresponding TAA in malignant cells by anti-anti-id antibodies [91, 92]. In contrast, the mechanisms underlying the association between enhancement of T cell mediated immunity in patients treated with antiid mAb or with anti-TAA mAb and the induction of TAA specific CTL by anti-id mAb are not readily apparent. Therefore potential mechanisms which may account for these findings will be discussed in some detail. In one study [86, 87] administration to patients with metastatic colorectal carcinoma, of an anti-TAA mAb has induced T cells reactive with an anti-id mAb which bears the internal image of the TAA. Most, although not all of these T-cell populations recognize also the corresponding TAA, as measured by proliferative assays. The statistically significant association between the development of a T cell response following administration of an anti-TAA mAb and tumor regression raises three questions: how can administration of an anti-TAA mAb induce anti-id antibody reactive T lymphocytes?, how can anti-id antibody reactive T cells effect tumor regression? and how can TAA reactive T cells without detectable in vitro cytotoxic activity cause tumor regression? Jerne's network theory [28], which has been convincingly proven in patients with neuroblastoma [85] and at the clonal level in several antigenic systems [93-95], predicts that administration of an antibody may trigger the idiotypic cascade. As a result, anti-id antibodies, some of which may bear the internal image of the nominal antigen, and anti-anti-id antibodies, some of which may be antigen binding, are generated. Therefore one can envision that anti-TAA mAb induce the formation of anti-id antibodies. The latter, in agreement with results obtained with exogenously administered antiid antibodies in patients [31, 66-68] and in animal model systems [96], induce anti-id antibody reactive T cells. The ability of some of the latter T-cell populations to recognize the nominal antigen has been attributed in the past to the sharing of an amino acid sequence stretch between the nominal antigen and the immunizing anti-id antibody [31]. However, amino
Day 63
o
Q.
O
-i
1:40
1
r
1:160
\
— I
1:640
1:40
1:2560
1
1
1:160
i
1:640
1:2560
SERUM Figure 5. Enhancement by a booster with cultured human melanoma cells of the anti-HMW-MAA immune response triggered by mouse anti-id mAb MK2-23. Rabbits 97-6 and 97-7 were immunized on day 0, 14, 28 and 42 with KLH conjugated mouse anti-id mAb MK2-23 mixed with Freund's adjuvant and on day 56 with irradiated, cultured human melanoma cells Colo 38 (2 x 10^). Pre-immune serum (O) and serum harvested on day 49 (A) did not show any reactivity with Colo 38 melanoma cells in a binding assay (left panel). However, serum harvested on day 63 (right panel) showed a markedly higher reactivity with Colo 38 cells (A) than with B lymphoid cells, L14 (A). Results are expressed as mean ±SD of bound cpm/well obtained with sera from the two rabbits.
Table 9. Amino acid sequence of peptides identified by panning phage display peptide libraries with anti-HMW-MAA mAb 149.53, 225.28, TP61.5 and HMW-MAA binding anti-anti-id mAb GH704 and GH786 mAb
Peptide
Homology with HMW-MAA
149.53
EELHPPGSRAPSIRK SCRWVGIDLYCP
1846 GSRAPISR 1853
225.28
TP61.5 GH704 GH786
HLA Class I allospecificity
Binding score^
~
B*2702 B*2705
1000 5000
RTTPWPWPTTFTQNP GATYWDRTHAAMLPP TQYTRTDPWGLEPPK TVDWKVRMPQAASRF WETSWANVYPTTNYA KYTSGAVHGMPDPLS CRVELNHPRAQIMCR GCIKSHPFVRCP
-
-
NQLPQYMGPAPAYMR
1398 LEPP 1401
-
B*2705 B*4403
1457 SHPV 1460
-
-
A*0201
1000 180
B*2705
1000 90.7
^ Binding scores were determined using BIMAS (100).
387
acid sequence homology between anti-id antibody and the corresponding TAA may not be required for the sharing of a T cell defined epitope, since three examples of recognition of structurally different MHC class I antigen-peptide complexes by a single T-cell receptor have been recently described [97-99]. The anti-id antibody reactive T cells which recognize TAA may control tumor growth by secreting cytokines such as IFN-y that induce CTL proliferation [31]. A mechanism for tumor control by anti-id antibody reactive T cells which do not recognize TAA is suggested by the results obtained in an animal model system. A T-cell line induced by an anti-id mAb could recognize the anti-id mAb bound to tumor cells coated with the corresponding anti-TAA mAb [96]. Therefore one might suggest that TAA binding anti-anti-id antibodies induced by the idiotypic cascade triggered by the administration of an anti-TAA mAb may mediate the binding of anti-id antibodies to tumor cells, anti-id antibodies in turn, may target to tumor cells anti-id antibody reactive T cells which do not recognize TAA. The sequence of events we have suggested for TAA reactive T cells could then take place. In two studies, immunization with anti-id mAb has generated or enhanced the level of cytotoxic cells which lyse autologous tumor cells or tumor cells expressing the TAA mimicked by the immunizing anti-id mAb [66, 67, 72]. In at least one study [72], the cytotoxicity of tumor cells is mediated by MHC class I antigen restricted, TAA specific CTL. The association with an improved prognosis of the disease, of tumor cell cytotoxicity found in patients immunized with anti-id mAb argues in favor of its clinical relevance. This possibility is supported by data obtained in animal model systems [89, 90, 96]. Induction of MHC class I antigen restricted, TAA specific CTL by anti-id antibodies is an unexpected finding, since idiotopes which mimic determinants expressed on TAA result in the majority of cases from the association of the heavy and light chain variable regions of anti-id antibodies. The results described by Pride et al. [72] are therefore noteworthy. These authors have presented rather convincing evidence that anti-id antibodies which mimic HMW-MAA have induced HLA class I antigen restricted, HMW-MAA specific CTL in patients with melanoma, since cytotoxicity of HMW-MAA bearing melanoma cells by CTL is restricted by HLA-A2 antigens and in the few cases tested, is inhibited by anti-HLA class I anti-
388
bodies. In an attempt to identify the peptide(s) which generate(s) CTL and that (those) which are the targets of the immune response, we have analyzed the amino acid sequence of the heavy and light chain variable regions of the anti-id mAb Mel-1 used as an immunogen and that of the HMW-MAA core protein used as a target. This analysis could not be performed with the anti-id mAb Mel-2, which was also used as an immunogen, since no information is available about the amino acid sequence of its heavy and light chain variable regions. Analysis with the Bio-informatics and molecular analysis software (BIMAS) [100] has identified two peptides with HLA-A2 antigen binding motifs in the heavy and light chain variable region of antiid mAb Mel-1. The sequence of the peptides with the binding scores to HLA-A2 antigen is shown in Table 7. Only the peptide LLVLLYSKL derived from the framework region 1 of the heavy chain variable region of anti-id mAb Mel-1 has homology with the amino acid sequence LLQLYSGR from residue 75 to 80 in the HMW-MAA core protein [101]. However, the latter peptide does not have the anchor residues required for binding to HLA-A2 antigen and therefore is not likely to be recognized by HLA- A2 antigen restricted, HMW-MAA specific CTL generated by the anti-id mAb Mel-1. Table 8 lists the peptides with HLAA2 binding motifs derived from the HMW-MAA core protein. These peptides have no homology with the HLA-A2 antigen binding peptides derived from the anti-id mAb Mel-1. Nevertheless HMW-MAA derived peptide(s) may still be recognized by HLA-A2 antigen restricted, HMW-MAA specific CTL elicited by anti-id mAb, since recognition of structurally different MHC class I antigen-peptide complexes by a single T-cell receptor has been recently described [97-99].
5. CONCLUSIONS The results we have summarized provide convincing evidence that mouse and human anti-id antibodies which bear the internal image of human TAA are more effective than the corresponding TAA in breaking unresponsiveness to a self-antigen in patients with malignant diseases. The cellular and/or humoral anti-anti-id response appears to be associated with a favorable clinical response. Whether this association reflects a cause-effect relationship requires double blind, mul-
ticenter clinical trials with a large number of patients with malignant diseases. The clinical trials performed with anti-id antibodies have also identified two major limitations of active specific immunotherapy with anti-id antibodies, i.e., the low reactivity of anti-anti-id antibodies with TAA used as a target and the lack of induction of HLA class I antigen restricted, TAA specific CTL. We will conclude this review by discussing approaches we have been developing in order to overcome these two limitations of active specific immunotherapy with anti-id antibodies As already mentioned, in at least four antigenic systems, antigen binding anti-anti-id mAb have been found to have a high degree, but not complete homology in the amino acid sequence of their heavy and light chain variable regions with the corresponding Abl mAb used to trigger the idiotypic cascade [49-52]. The limited number of residue differences between Abl mAb and anti-anti-id mAb is likely to underlie their reduced reactivity with the nominal antigen. Therefore it is our working hypothesis that somatic mutations which occur in the course of an immune response may increase the homology in the amino acid sequence of the heavy and light chain variable regions of antibodies elicited by anti-id antibodies with those of antibodies elicited by the corresponding TAA. As a result, the mutated antibodies may display a much stronger reactivity with the TAA. Boosters with the original TAA are expected to expand the B-cell population(s) which secrete the mutated antibodies. This working hypothesis suggests the following immunization strategy. A host is first immunized with a mimic of the TAA to break unresponsiveness to a self-antigen. The host is then boosted with the original TAA to expand the population of B-cells secreting antibodies that because of somatic hypermutations display a high, if not complete homology in the amino acid sequence of the heavy and/or light chain variable regions with the antibody elicited by the original TAA (Figure 4). As a result, this immunization strategy is expected to overcome the unresponsiveness to a self-TAA and the weak immune response to a selfTAA elicited by a mimic of this antigen. Our working hypothesis is supported by our recent findings. HMWMAA bearing human melanoma cells do not induce anti-HMW-MAA antibodies in rabbits which express HMW-MAA with an antigenic profile and a tissue distribution similar to those in humans (Figure. 5).
Iniinunodepieted with 1
mAb 376.96
RS 97-6 (63)
kD 213-
119-
• #
83-
•
47 H
t "4 ^
fO
M
ja
5S
< <S i
f^ §-^ ^si *? 2 5^
m ^
^
^ r^ *!2
^ ^ <
1
Figure 6. SDS-PAGE analysis of antigens immunoprecipitated from ^-^^I labeled Colo 38 melanoma cells by sera from a rabbit sequentially immunized with the anti-id mAb MK2-23 and with melanoma cells Colo 38. Rabbit 97-6 was immunized on day 0, 14, 28 and 42 with KLH conjugated mouse anti-id mAb MK2-23 mixed with Freund's adjuvant and on day 56 with cultured human melanoma cells Colo 38 (2 x 10^). Sera harvested before immunization (NRS) and on day 40 [(RS 97-6 (40)] did not immunoprecipitate any components from a Colo 38 cell extract immunodepleted with anti-96K MAA mAb 376.96. In contrast, serum harvested on day 63 [RS 97-6 (63)] immunoprecipitated the HMW-MAA (left panel). Furthermore, serum harvested on day 63 [RS 97-6 (63)] removed HMW-MAA recognized by mAb 763.74 from a Colo 38 cell extract (right panel). The anti-96 kD MAA mAb 376.96 and the anti-HMW-MAA mAb 763.74 were used as controls.
It is likely that the antibodies elicited by the booster with melanoma cells have high association constants since they could immunoprecipitate HIVIW-IVIAA from cultured melanoma cells (Figure 6). To overcome the inability of anti-id mAb to elicit HLA class I antigen restricted, TAA specific CTL, we plan to replace them with peptide mimics of TAA isolated by panning phage display peptide libraries with anti-TAA mAb and with TAA binding anti-anti-id mAb. This strategy bypasses two potential limitations of the approach based on amino acid sequence ho-
389
Sn J GH704,CRVELNHPR
^
GH786, YMGPAPAYM Vj
\ / NOPEPTIM Ti y n i
REFERENCEPEPTTQE,IMDQVPFSV
GH7HCRVELNHFR I GH786, V M O T A P A Y M ^ / R E F E R E N C E PEPTIDE. RRYQKSTCL I NO PEPTIDE ^ *
LOG FLUORESCENCE INTENSITY Figure 7. Stabilization of cell surface expression of HLA-A*0201 antigens on TAP-deficient lymphoblastoid cells T2 by a synthetic peptide identified with anti-anti-id mAb GH786. Human lymphoblastoid T2 cells were incubated with increasing concentrations (0.1-1 mg/ml) of peptides in RPMI 1640 medium supplemented with 10% FBS. Following an overnight incubation at 4°C, cells were harvested , washed twice with PBS-5% FBS-0.2% sodium azide (FACS buffer) and incubated for 30 min at 4°C with anti-HLA-A2, A28 mAb C R l 1-351. Following washing with FACS buffer, cells were incubated for 30 min at 4°C with a 1:100 dilution of a fluorescein isothiocyanate conjugated goat antimouse IgG antibody solution. Cells were then washed with FACS buffer and resuspended in 0.5 ml FACS buffer. Cytofluorometry was carried out using a FACS IV flow cytometer (Becton Dickinson and Co., Mountain View, CA). Histograms shown, represent stabilization of HLA-A*0201 on T2 cells at a peptide concentration of 1 mg/ml. The reference HL A-A* 0201 binding peptide IMDQVPFSV was used as a positive control.
mology between anti-id mAb and nominal antigen to identify peptides to be used as immunogens. First, this approach can be appHed to a very limited number of antigenic systems, since amino acid sequence homology between anti-id mAb and the nominal anitgen is rarely found (for a review, see [103]). Second, a peptide constructed on the basis of its homology with the nominal antigen [30, 31] is not likely to be very immunogenic in patients with melanoma since the corresponding clones are likely to have been deleted. By panning two phage display peptide libraries with a panel of anti-HMW-MAA mAb, we have isolated a number of peptides with distinct sequences. Some display homology with the HMW-MAA core protein amino acid sequence. Furthermore some peptides have HLA class I antigen binding motifs. Representative examples are shown in Table 9, Figurea 7 and 8. The possibility that these peptide mimics of TAA may elicit HLA class I antigen restricted, TAA
390
«8l*^
LOG FLUORESCENCE EVTENSITV Figure 8. Stabilization of cell surface expression of HLA-B*2705 antigens on TAP-deficient lymphoblastoid cells T2 by a synthetic peptide identified with anti-anti-id mAb GH704. HLA-B*2705 transfected human lymphoblastoid cells T2 (T2-B*2705) were incubated with increasing concentrations (0.1-1 mg/ml) of peptides in RPMI 1640 medium supplemented with 10% FBS. Following an overnight incubation at 4oC, cells were harvested, washed twice with PBS-5% FBS-0.2% sodium azide (FACS buffer) and incubated for 30 min at 4°C with anti-HLA-B7 crossreacting group mAb KS4. Following washing with FACS buffer, cells were incubated for 30 min at 4 ° C with a 1:100 dilution of a fluorescein isothiocyanate conjugated goat antimouse IgG antibody solution. Cells were then washed with FACS buffer and resuspended in 0.5 ml FACS buffer. Cytofluorometry was carried out using a FACS IV flow cytometer (Becton Dickinson and Co., Mountain View, CA). Histograms shown represent stabilization of HLA-B*2705 antigens on T2-B*2705 cells at a peptide concentration of 0.5 mg/ml. The reference HLA-B*2705 binding peptide RRYQKSTEL was used as a positive control.
specific CTL is supported by the recognition by CTL of an antibody defined TAA [104] and by the sharing of specificity between T-cell receptors and antibodies [105]. If studies in progress prove the validity of our working hypothesis, then it is likely that the field of TAA mimicry will witness the replacement of anti-id mAb with peptide mimics. The latter will also have the advantages: (i) to be easily synthesized and standardized to meet the regulatory requirements for clinical trials; (ii) to avoid the induction of antimouse Ig antibodies; and (iii) to facilitate the monitoring of humoral and cellular anti-HMW-MAA immunity elicited by active specific immunotherapy.
ACKNOWLEDGEMENTS
15.
This work was supported by PHS grants, CA37959, CA51814 and CA80193 awarded by the National Cancer Institute, DHHS. 16.
REFERENCES 1.
2. 3.
4. 5. 6.
7.
8. 9.
10.
11. 12.
13.
14.
Bystryn J-C, Ferrone S, Livingston P, eds. Specific immunotherapy of cancer with vaccines. Ann NY Acad Sci 1993, Vol. 690. Greten TF, Jaffee EM. Cancer vaccines. J Clin Oncol 1999;17:1047-60. DeVita VT Jr. Principles of chemotherapy. In: DeVita VT Jr., Hellman S, Rosenberg SA, eds, Cancer: Principles and practice of oncology 4th edn. Philadelphia: J. B. Lippincott Co., 1993;276-292. Waldman TA. Monoclonal antibodies in diagnosis and therapy Science 1991;252:1657-62. von-Mehren M, Weiner LM. Monoclonal antibodybased therapy Curr Opin Oncol 1996;8:493-8. Boon T, Coulie PG, Van-den-Eynde B. Tumor antigens recognized by T cells. Immunol Today 1997;18:267-8. Rosenberg SA. A new era for cancer immunotherapy based on the genes that encode cancer antigens. Immunity 1999;10:281-7. Reisfeld RA, Cheresh DA. Human tumor antigens. Adv Immunol 1987;40:323-77. Herlyn M, Koprowski H. Melanoma antigens: immunological and biological characterization and clinical significance. Annu Rev Immunol 1988;6:283-308. Boon T, Cerottini JC, Van den Eynde B, van der Bruggen P, Van Pel A. Tumor antigens recognized by T lymphocytes. Annu Rev Immunol 1994; 12:33765. Henderson RA, Finn OJ. Human tumor antigens are ready to fly Adv Immunol 1996;62:217-56. Pereira S, Van-Belle P, Elder D, Maruyama H, Jacob L, Sivanandham M, Wallack M, Siegel D, Herlyn D. Combinatorial antibodies against human malignant melanoma. Hybridoma 1997;16:11-6. Tureci O, Sahin U, Pfreundschuh M. Serological analysis of human tumor antigens: molecular definition and impUcations. Mol Med Today 1997;3:3429. Figini M, Obici L, Mezzanzanica D, Griffiths A, Colnaghi MI, Winter G, Canevari S. Panning phage antibody libraries on cells: isolation of human Fab fragments against ovarian carcinoma using guided selection. Cancer Res. 1998;58:991-6.
17. 18.
19.
20. 21.
22.
23.
24.
25.
26.
Henderikx P, Kandilogiannaki M, Petrarca C, vonMensdorff-Pouilly S, Hilgers JH, Krambovitis E, Arends JW, Hoogenboom HR. Human single-chain Fv antibodies to MUCl core peptide selected from phage display libraries recognize unique epitopes and predominantly bind adenocarcinoma. Cancer Res. 1998;58:4324-32. Noronha EJ, Wang X, Desai SA, Kageshita T, Ferrone S. Limited diversity of human scFv fragments isolated by panning a synthetic phage-display scFv library with cultured human melanoma cells. J Immunol 1998;161:2968-76. Bell JI. Molecular anatomy of the immune response. Immunol Rev 1998;163:5-10. Oppenheim JJ, Murphy WJ, Chertox O, Schirrmacher V, Wang JM. Prospects for cytokine and chemokine biotherapy. Clin Cancer Res 1997;3:2682-6. Houghton AN. Cancer antigens: immune recognition of self and altered self. J Exp Med 1994; 180:14. Old LJ, Chen YT. New paths in human cancer serology J Exp Med 1998;187:1163-7. Naftzger C, Takechi Y, Kohda H, Hara I, Vijayasaradhi S, Houghton AN. Immune response to a differentiation antigen induced by altered antigen: a study of tumor rejection and autoimmunity. Proc Nad Acad Sci USA 1996;93:14809-14. Overwijk WW, Tsung A, Irvine KR, Parkhurst MR, Goletz TJ, Tsung K, Carroll MW, Liu C, Moss B, Rosenberg SA, Restifo NP. gplOO/pmel 17 is a murine tumor rejection antigen: induction of "selfreactive, tumoricidal T cells using high-affinity, altered peptide Hgand. J Exp Med 1998;188:27786. Bakker AB, van der Burg SH, Huijbens RJ, Drijfhout JW, Melief CJ, Adema GJ, Figdor CG. Analogues of CTL epitopes with improved MHC class-I binding capacity elicit antimelanoma CTL recognizing the wild-type epitope. Int J Cancer 1997;70:302-9. Dyall R, Bowne WB, Weber LW, LeMaoult J, Szabo P, Moroi Y, Piskun G, Lewis JJ, Houghton AN, Nikolic Zugic J. Heteroclitic immunization induces tumor immunity. J Exp Med 1998;188:1553-61. Rivoldni L, Squarcina P, Loftus DJ, CastelH C, Tarsini P, Mazzocchi A, Rini F, Viggiano V, BelH F, Parmiani G. A superagonist variant of peptide MARTl/Melan A27-35 ehcits antimelanoma CD8-h T cells with enhanced functional characteristics: implications for more effective immunotherapy. Cancer Res 1999;59:301-6. Shoenfeld Y, Kennedy RC, Ferrone S, eds. Idiotypes in medicine: Autoimmunity, infection and cancer. Amsterdam: Elsevier Science B.V 1997.
391
27.
28. 29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
392
Ferrone S, Chen ZJ, Liu CC, Hirai S, Kageshita T, Mittelman A. Human high molecular weightmelanoma associated antigen mimicry by mouse anti-idiotypic monoclonal antibodies MK2-23. Experimental studies and cHnical trials in patients with malignant melanoma. Pharmacol Ther 1993;57:25990. Jerne NK. Towards a network theory of the immune system. Ann Immunol Paris 1974;125C:373-89. Braden BC, Fields BA, Ysern X, Dall'Acqua W, Goldbaum FA, Poljak RJ, Mariuzza RA. Crystal structure of an Fv-Fv idiotope-anti-idiotope complex at 1.9 A resolution. J Mol Biol 1996;264:137-51. Pride MW, Shi H, Anchin JM, Linthicum DS, LoVerde PT, Thakur A, Thanavala Y. Molecular mimicry of hepatitis B surface antigen by an antiidiotype-derived synthetic peptide. Proc Natl Acad SciUS A 1992;89:11900-4. Chatterjee SK, Tripathi PK, Chakraborty M, Yannelli J, Wang H, Foon KA, Maier CC, Blalock JE, Bhattacharya Chatterjee M. Molecular mimicry of carcinoembryonic antigen by peptides derived from the structure of an anti-idiotype antibody. Cancer Res 1998;58:1217-24. Bruck C, Co MS, Slaoui M, Gaulton GN, Smith T, Fields BN, Mullins JI, Greene MI. Nucleic acid sequence of an internal image-bearing monoclonal anti-idiotype and its comparison to the sequence of the external antigen. Proc Natl Acad Sci USA 1986;83:6578-82. Pan Y, Yuhasz SC, Amzel LM. anti-idiotypic antibodies: biological function and structural studies. FASEB J 1995;9:43-9. Von Kleist S, Burtin P. On the specificity of autoantibodies present in colon cancer patients. Immunology 1966;10:507-15. Collatz E, Von Kleist S, Burtin P. Further investigations of circulating antibodies in colon cancer patients: on the autoantigenicity of the carcinoembryonic antigen. Int J Cancer 1971;8:298-303. Lo Gerfo P, Herter FP, Bennett SJ. Absence of circulating antibodies to carcinoembryonic antigen in patients with gastrointestinal malignancies. Int J Cancer 1972;9:344-8. Hamby CV, Liao SK, Kanamaru T, Ferrone S. Immunogenicity of human melanoma-associated antigens defined by murine monoclonal antibodies in allogeneic and xenogeneic hosts. Cancer Res 1987;47:5284-9. Mittelman A, Chen ZJ, Yang H, Wong GY, Ferrone S. Human high molecular weight melanomaassociated antigen (HMW- MAA) mimicry by mouse anti-idiotypic monoclonal antibody MK223: induction of humoral anti-HMW-MAA immu-
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
nity and prolongation of survival in patients with stage IV melanoma. Proc Natl Acad Sci U S A 1992;89:466-70. Livingston PO. Approaches to augmenting the IgG antibody response to melanoma ganglioside vaccines. Ann N Y Acad Sci 1993;690:204-13. Chapman PB, Livingston PO, Morrison ME, Williams L, Houghton AN. Immunization of melanoma patients with anti-idiotypic monoclonal antibody BEC2 which mimics GD3 ganglioside: Pilot trials using no immunological adjuvant. Vaccine Res 1994;3:59-69. Foon KA, Chakraborty M, John WJ, Sherratt A, Kohler H, Bhattacharya Chatterjee M. Immune response to the carcinoembryonic antigen in patients treated with an anti-idiotype antibody vaccine. J Clin Invest 1995;96:334^2. Viale G, Flamini G, Grassi F, Buffa R, NataH PG, Pelagi M, Leoni F, Menard S, Siccardi AG. Idiotypic replica of an antihuman tumor-associated antigen monoclonal antibody. Analysis of monoclonal Abl and Ab3 fine specificity. J Immunol 1989;143:433844. Bhattacharya CM, Mukerjee S, Biddle W, Foon KA, Kohler H. Murine monoclonal anti-idiotype antibody as a potential network antigen for human carcinoembryonic antigen. J Immunol 1990; 145:275865. Mariani SM, Armandola EA, Ferrone S. Diversity in the fine specificity and idiotypic profile of mouse anti-HLA-DR monoclonal antibody elicited with the syngeneic anti-idiotypic monoclonal antibody F5830. J Immunol 1991;147:1322-30. Kageshita T, Hirai S, Ono T, Ferrone S. Human high molecular weight-melanoma associated antigen mimicry by mouse anti-idiotypic MAb MK223. Immunohistochemical analysis of the reactivity of antianti-idiotypic MAb with surgically removed melanoma lesions. Int J Cancer 1995;60:33440. Shinji T, Ono R, Ferrone S. Fine specificity and idiotype diversity of a murine anti-HLA-DQw3 monoclonal antibody elicited with a syngeneic anti-idiotypic monoclonal antibody. J Immunol 1990;144:4291-7. Chen ZJ, Ferrone S. Comparison of the binding parameters to melanoma cells of antihuman high molecular weight-melanoma associated antigen (HMWMAA) monoclonal antibodies (mAb) and syngeneic antianti-idiotypic (antianti-id) mAb. Ann N Y Acad Sci 1993;690:398^01. Goldbaum FA, Velikovsky CA, Dall'Acqua W, Fossati CA, Fields BA, Braden BC, Poljak RJ, Mariuzza RA. Characterization of antianti-idiotypic antibod-
49.
50.
51.
52. 53.
54.
55.
56. 57.
58.
59.
60.
ies that bind antigen and an anti-idiotype. Proc Natl Acad Sci U S A 1997;94:8697-701. Caton AJ, Herlyn D, Ross AH, Koprowski H. Identical D region sequences expressed by murine monoclonal antibodies specific for a human tumorassociated antigen. J Immunol 1990;144:1965-8. Garcia KC, Desiderio SV, Ronco PM, Verroust PJ, Amzel LM. Recognition of angiotensin II: antibodies at different levels of an idiotypic network are superimposable. Science 1992;24:257;528-31. Iwasaki Y, Takabatake H, Shinji T, Monestier M, Ferrone S. Structural profile of idiotype, antiidiotype and antianti-idiotype monoclonal antibodies in the HLADQ3 antigenic system. Eur J Immunol. 1994;24:2874-81. Ferrone S. unpublished results, 1997. Fields BA, Goldbaum FA, Ysern X, Poljak RJ, Mariuzza RA. Molecular basis of antigen mimicry by an anti-idiotope. Nature 1995;374:739-42. York lA, Rock KL. Antigen processing and presentation by the class I major histocompatibility complex. Annu Rev Immunol 1996;14:369-96. Rock KL. A new foreign policy: MHC class I molecules monitor the outside world. Immunol Today 1996;17:131-7. Hellstrom I, Hellstrom KE. Tumor immunology: an overview. Ann NY Acad Sci 1993;690:24-33. Livingston PO. The case for melanoma vaccines that induce antibodies. In: Kirkwood JM, editor. Molecular diagnosis, prevention and treatment of melanoma. New York: Marcel Dekker, 1998; 139157. Herlyn D, Wettendorff M, Schmoll E, Iliopoulos D, Schedel I, Dreikhausen U, Raab R, Ross AH, Jaksche H, Scriba M, Koprowski H. anti-idiotype immunization of cancer patients: modulation of the immune response. Proc Natl Acad Sci USA 1987;84:8055-9. Herlyn D, Harris D, Zaloudik J, Sperlagh M, Maruyama H, Jacob L, Kieny MP, Scheck S, Somasundaram R, Hart E, Ertl H, Mastrangelo M. Immunomodulatory activity of monoclonal antiidiotypic antibody to anticolorectal carcinoma antibody CO 17-1A in animals and patients. J Immunother Emphasis Tumor Immunol 1994; 15:30311. Birebent B, Mitchell E, Li W, Akis N, Somasundaram R, Enkhsetseg P, Bloom E, Mastrangelo M, Maguire H, Nair S, Herlyn D. Monoclonal anti-idiotype antibody mimicking the gastrointestinal carcinoma-associated epitope CO 17-1A elicits antigen-specific humoral and cellular immune responses in colorectal cancer patients (in preparation).
61.
62.
63.
64.
65.
66.
67.
68.
69.
70.
Somasundaram R, Zaloudik J, Jacob L, Benden A, Sperlagh M, Hart E, Marks G, Kane M, Mastrangelo M, Herlyn D. Induction of antigen-specific T and B cell immunity in colon carcinoma patients by antiidiotypic antibody. J Immunol 1995;155:3253-61. Herlyn D, Benden A, Kane M, Somasundaram R, Zaloudik J, Sperlagh M, Marks G, Hart E, Ralph C, Wettendorff M, Mastrangelo M. anti-idiotype cancer vaccines: pre-clinical and clinical studies. In Vivo 1991;5:615-23. Fagerberg J, Steinitz M, Wigzell H, Askelof P, Mellstedt H. Human anti-idiotypic antibodies induced a humoral and cellular immune response against a colorectal carcinoma-associated antigen in patients. Proc Natl Acad Sci USA 1995;92:4773-7. Foon KA, John WJ, Chakraborty M, Sherratt A, Garrison J, Flett M, Bhattacharya-Chatterjee M. Clinical and immune responses in advanced colorectal cancer patients treated with anti-idiotype monoclonal antibody vaccine that mimics the carcinoembryonic antigen. Clin Cancer Res 1997;3:1267-76. Foon KA, John WJ, Chakraborty M, Garrison J, Bard V, Bhattacharya-Chatterjee M. CHnical and immune responses in surgically resected colorectal cancer (CRC) patients treated with an anti-idiotype (id) monoclonal antibody that mimics carcinoembryonic antigen (CEA) with or without 5-fluorouracil (5-FU). Proc Amer Soc Clin Oncol 1998; 17:435a. Robins RA, Denton GW, Hardcastle JD, Austin EB, Baldwin RW, Durrant LG. Antitumor immune response and interleukin 2 production induced in colorectal cancer patients by immunization with human monoclonal anti-idiotypic antibody. Cancer Res 1991;51:5425-9. Denton GW, Durrant LG, Hardcasde JD, Austin EB, Sewell HF, Robins RA. Clinical outcome of colorectal cancer patients treated with human monoclonal anti-idiotypic antibody. Int J Cancer 1994;57:10^. Durrant LG, Buckley TJ, Denton GW, Hardcastle JD, Sewell HF, Robins RA. Enhanced cell-mediated tumor killing in patients immunized with human monoclonal anti-idiotypic antibody 105AD7. Cancer Res 1994;54:4837^0. Mittelman A, Chen ZJ, Kageshita T, Yang H, Yamada M, Baskind P, Goldberg N, Puccio C, Ahmed T, Arlin Z, Ferrone S. Active specific immunotherapy in patients with melanoma. A clinical trial with mouse anti-idiotypic monoclonal antibodies elicited with syngeneic antihigh-molecular-weightmelanoma-associated antigen monoclonal antibodies [published erratum appears in J Clin Invest 1991 Feb;87(2):757]. J Clin Invest 1990;86:2136-44. Mittelman A, Chen GZJ, Wong GY, Liu C, Hirai S, Ferrone S. Human high molecular weight-
393
71.
72.
73.
74.
75.
76.
77.
78.
79.
394
melanoma associated antigen mimicry by mouse anti-idiotypic monoclonal antibody MK2-23: Modulation of the immunogenicity in patients with malignant melanoma. Clin Cancer Res 1995;1:705-713. Quan WD, Jr., Dean GE, Spears L, Spears CP, Groshen S, Merritt JA, Mitchell MS. Active specific immunotherapy of metastatic melanoma with an anti-idiotype vaccine: a phase I/II trial of I-Mel-2 plus SAF-m. J Clin Oncol 1997;15:2103-10. Pride MW, Shuey S, Grillo-Lopez A, Braslawsky G, Ross M, Legha SS, Eton O, Buzaid A, loannides C, Murray JL. Enhancement of cell-mediated immunity in melanoma patients immunized with murine antiidiotypic Mabs (MELIMMUNER) that mimic the high molecular weight proteoglycan antigen. Clin Cancer Res 1998;4:2363-70. Wagner U, Schlebusch H, Kohler S, Schmolling J, Grunn U, Krebs D. Immunological responses to the tumorassociated antigen CA125 in patients with advanced ovarian cancer induced by the murine monoclonal anti-idiotype vaccine ACA125. Hybridoma 1997;16:3340. Foon KA, Sen G, Hutchins L, Kashala OL, Baral R, Banerjee M, Chakraborty M, Garrison J, Reisfeld RA, BhattacharyaChatterjee M. Antibody responses in melanoma patients immunized with an anti-idiotype antibody mimicking disialoganglioside GD2. Clin Cancer Res 1998;4:1117-24. Foon KA, Lutzky J, Hutchins L, Kashala O, Garrison J, Reisfeld RA, Teitelbaum A, Chatterjee M. Clinical and immune responses in melanoma patients immunized with TriGem, an anti-idiotype (id) antibody mimicking the disialoganglioside GD2. Proc Amer Soc Clin Oncol 1999, in press. McCaffery M, Yao T-J, Williams L, Livingston PO, Houghton AN, Chapman PB. Immunization of melanoma patients with BEC2 anti-idiotypic monoclonal antibody that mimics GD3 ganglioside: Enhanced immunogenicity when combined with adjuvant. CUn Cancer Res 1996;2:679-686. Yao T-J, Meyers M, Livingston PO, Houghton AN, Chapman PB. Immunization of melanoma patients with BEC2-keyhole Hmpet hemocyanin plus BCG intradermally followed by intravenous booster immunizations with BEC2 to induce anti-GD3 ganglioside antibodies. Clin Cancer Res 1999;5:77-81. Chapman PB, Houghton AN. Induction of IgG antibodies against GD3 ganglioside in rabbits by an anti-idiotypic monoclonal antibody. J Clin Invest 1991;88:186-92. Chen ZJ, Yang H, Liu CC, Hirai S, Ferrone S. Modulation by adjuvants and carriers of the immunogenicity in xenogeneic hosts of mouse anti-idiotypic monoclonal antibody MK2-23, an internal image of
80.
81.
82.
83.
84.
85.
86.
87.
88.
human high molecular weight-melanoma associated antigen. Cancer Res 1993;53:112-9. Chattopadhyay P, Starkey J, Morrow WJ, Raychaudhuri S. Murine monoclonal anti-idiotope antibody breaks unresponsiveness and induces a specific antibody response to human melanoma-associated proteoglycan antigen in cynomolgus monkeys. Proc Natl Acad Sci USA 1992;89:2684-8. Saleh MN, Lalisan-DY J, Pride MW, Solinger A, Mayo MS, LoBuglio AF, Murray JL. Immunologic response to the dual murine anti-Id vaccine Melimmune-1 and Melimmune-2 in patients with high-risk melanoma without evidence of systemic disease. J Immunother 1998;21:37988. Kusama M, Kageshita T, Chen ZJ, Ferrone S. Characterization of syngeneic anti-idiotypic monoclonal antibodies to murine antihuman high molecular weight melanoma-associated antigen monoclonal antibodies. J Immunol 1989;143:3844-52. Chen ZJ, Yang H, Ferrone S. Human high molecular weight melanoma-associated antigen mimicry by mouse anti-idiotypic monoclonal antibody MK2-23. Characterization of the immunogenicity in syngeneic hosts. J Immunol 1991; 147:108290. Mittelman A, Chen ZJ, Liu CC, Hirai S, Ferrone S. Kinetics of the immune response and regression of metastatic lesions following development of humoral antihigh molecular weight-melanoma associated antigen immunity in three patients with advanced malignant melanoma immunized with mouse anti-idiotypic monoclonal antibody MK2-23. Cancer Res 1994;54:415-21. Cheung NK, Cheung lY, Canete A, Yeh SJ, Kushner B, Bonilla MA, Heller G, Larson SM. Antibody response to murine anti-GD2 monoclonal antibodies: correlation with patient survival. Cancer Res 1994;54:2228-33. Fagerberg J, Frodin JE, Ragnhammar P, Steinitz M, Wigzell H, Mellstedt H. Induction of an immune network cascade in cancer patients treated with monoclonal antibodies (abl). II. Is induction of anti-idiotype reactive T cells (T3) of importance for tumor response to mAb therapy? Cancer Immunol Immunother 1994;38:149-59. Fagerberg J, Hjelm AL, Ragnhammar P, Frodin JE, Wigzell H, Mellstedt H. Tumor regression in monoclonal antibody-treated patients correlates with the presence of anti-idiotype-reactive T lymphocytes. Cancer Res 1995;55:1824-7. Herlyn D, Somasundaram R, Li W, Maruyama H. anti-idiotype cancer vaccines: past and future. Cancer Immunol Immunother 1996;43:65-76.
89.
90.
91.
92.
93.
94.
95.
96.
97.
Pervin S, Chakraborty M, Bhattacharya CM, Zeytin H, Foon KA, Chatterjee SK. Induction of antitumor immunity by an anti-idiotype antibody mimicking carcinoembryonic antigen. Cancer Res 1997;57:728-34. Ruiz PJ, Wolkowicz R, Waisman A, Hirschberg DL, Carmi P, Erez N, Garren H, Herkel J, Karpuj M, Steinman L, Rotter V, Cohen IR. Idiotypic immunization induces immunity to mutated p53 and tumor rejection. Nat Med 1998;4:710-2. Chattopadhyay P, Kaveri SV, Byars N, Starkey J, Ferrone S, Raychaudhuri S. Human high molecular weight-melanoma associated antigen mimicry by an anti-idiotypic antibody: characterization of the immunogenicity and the immune response to the mouse monoclonal antibody IMel-1. Cancer Res 1991;51:6045-51. Chattopadhyay P, Starkey J, Raychaudhuri S. Analysis of antitumor antibodies in mice and rabbits induced by monoclonal anti-idiotope antibodies [published erratum appears in J Immunol 1991 Nov 1; 147:3259]. J Immunol 1991;147:2055-62. Lacy MJ, Dombrink KM, Voss-EW J. Quantitative analyses of immune network components. J Immunol 1989;142:3482-8. Hebert J, Bernier D, Boutin Y, Jobin M, Mourad W. Generation of anti-idiotypic and antianti-idiotypic monoclonal antibodies in the same fusion. Support of Jeme's Network Theory. J Immunol 1990;144:4256-61. Baskin JG, Ryan TM, Vakil M, Kearney JF, Lamon EW. Thymus-dependent anti-idiotype and antiantiidiotype responses to a dinitrophenyl-specific monoclonal antibody. J Immunol 1990;145:202-8. Tsuyuoka K, Yago K, Hirashima K, Ando S, Hanai N, Saito H, Yamasaki KM, Takahashi K, Fukuda Y, Nakao K, Kannagi R. Characterization of a T cell line specific to an anti-Id antibody related to the carbohydrate antigen, sialyl SSEA-1, and the immundominant T cell antigenic site of the antibody. J Immunol 1996;157:661-9. Brock R, Wiesmuller KH, Jung G, Walden P Molecular basis for the recognition of two structurally
98.
99.
100.
101.
102.
103.
104.
105.
different major histocompatibility complex/peptide complexes by a single T-cell receptor. Proc Natl Acad Sci USA 1996;93:13108-13. Loftus DJ, Chen Y, Covell DG, Engelhard VH, Appella E. Differential contact of disparate class I/peptide complexes as the basis for epitope crossrecognition by a single T cell receptor. J Immunol 1997;158:3651-8. Zhao R, Loftus DJ, Appella E, Collins EJ. Structural evidence of T cell xeno-reactivity in the absence of molecular mimicry. J Exp Med 1999;189:359-70. Parker KC, Bednarek MA, Coligan JE. Scheme for ranking potential HLAA2 binding peptides based on independent binding of individual peptide sidechains. J Immunol 1994; 152:16375. Pluschke G, Vanek M, Evans A, Dittmar T, Schmid P, Itin P, Filardo EJ, Reisfeld RA. Molecular cloning of a human melanoma-associated chondroitin sulfate proteoglycan. Proc Natl Acad Sci USA 1996;93:9710-5. Schlingemann RO, Rietveld FJ, de-Waal RM, Ferrone S, Ruiter DJ. Expression of the high molecular weight melanoma-associated antigen by pericytes during angiogenesis in tumors and in healing wounds. Am J Pathol 1990; 136:1393-^05. Thanavala Y, Pride MW. Immunoglobulin idiotypes and anti-idiotypes. In: Van Oss CJ, Van Regenmortel MHV, editors. Immunochemistry. New York: Marcel Dekkerlnc, 1994;69-91. Jager E, Chen YT, Drijfhout JW, Karbach J, Ringhoffer M, Jager D, Arand M, Wada H, Noguchi Y, Stockert E, et al. Simultaneous humoral and cellular immune response against cancer-testis antigen NY-ESO-1: definition of human histocompatibility leukocyte antigen (HLA)-A2-binding peptide epitopes. J Exp Med 1998;187:265-70. Stryhn A, Anderson PS, Pederson LO, Svejgaard A, Holm A, Thorpe CJ, Fugger L, Buus S, Engberg J. Shared fine specificity between T-cell receptors and an antibody recognizing a peptide/major histocompatibility class I complex. Proc Natl Acad Sci USA 1996;93:10338-42.
395
© 2000 Elsevier Science B.V. All rights reserved. Cancer and Autoimmunity Y. Shoenfeld and M. E. Gershwin, editors
Antigen-Specific Antitumor Vaccination: Immunotherapy Versus Autoimmunity Lea Eisenbach and Khaled M. El-Shami Weizmann Institute ofSciience, Rehovot, Israel
1. INTRODUCTION ... yet believe me prince, I am not glad that such a sore of time Should seek a plaster by contemn'd revolt, And heal the inveterate canker of one wound By making many. William Shakespeare (King John, Act 5, Scene 2)
2. TUMOR ANTIGENICITY AND IMMUNOGENICITY: AN OVERVIEW A fundamental premise underlying experimental as well as clinical tumor immunology is that an effective antigen-specific immune response can be engendered against cancer. Historically, the difficulty in identifying putative tumor-associated antigens contributed significantly to the recurring skepticism of immunological measures for combating cancer [1]. For example, studies of tumor transplantation in mice at the turn of the century, stimulated great interest when tumors were rejected by apparently compatible animals. More detailed analysis, however, revealed that the targets of such an immune response were hardly tumor-specific antigens, but rather the major histocompatibility antigens, MHC [2, 3]. While these observations laid the foundations for principles of allograft transplantation and rejection [4], inbred mouse strains [5], and MHC-restriction of antigen presentation [6], tumor immunology suffered a significant set back and was abandoned as unrealistic. More convincing evidence for the existence of tumor-specific antigens emerged from landmark stud-
ies by Prehn and Main [7] in the 1950s. These and other investigators demonstrated that tumor-specific immunity could be induced in syngeneic mice by inactivating parental tumor cells through either irradiation or surgical resection [8-12]. Mice vaccinated by inactivated autologous tumor cells were found to acquire the ability to reject a subsequent challenge of live parental tumor cells, in contrast to naive animals which succumbed to a similar challenge. An interesting aspect of this mode of vaccination was its exquisite specificity. Protection was not reactive to distinct tumors, including those which were generated in identical littermates by the application of the same carcinogens. The vaccination/challenge experiments were used to classify murine tumors on the basis of their immunogenicity. An important finding that emerged from such classification was that tumors which exhibited immunogenicity in a vaccination/challenge setting were found to be those induced by identifiable carcinogens [8, 13-15], including chemicals such as methylchloranthrene, ultraviolet irradiation, and oncogenic viruses like SV40, polyoma and adenoviruses. These tumors could be distinguished from tumors which originated "spontaneously" in the absence of identifiable mutagens. These spontaneous murine tumors models mimicked more closely human cancers in the sense that they were usually nonimmunogenic in classical vaccination/challenge experiments. This significant discrepancy in tumor immunogenicity highlighted the concern regarding the suitability of these models, and the observations derived from immunological phenomena thereof, for predicting the immune response in cancer patients [16].
397
Seminal experiments by Boon and colleagues [17, 18] in the 1980s showed that in spontaneous mouse leukemia, even nonimmunogenic murine tumors were capable of generating a protective immune response by the application of chemical mutagenesis. In these studies, rare tumor variants (tum- clones) generated upon in vitro selection in N-methyl-N'nitrosoguanidine, were readily rejected upon transplantation in syngeneic hosts. More strikingly, following their rejection, they induced a protective cytotoxic T-lymphocyte response against a subsequent challenge to the unmanipulated parental clone. These observations implied that the parental tumor was potentially immunogenic and that its expressed antigenic targets were recognizable by the immune system, but to which an effective response had not heretofore been generated. These vaccination studies pointed out that immunogenicity was a property inherent to most experimental tumors and shifted the focal point of interest in tumor immunology from whether, or not, tumor antigens existed at all to the biochemical and genetic characterization of these antigens. Initial attempts at isolating and characterizing tumor-associated antigens relied heavily on the application of monoclonal antibody technology. Notable contributions to tumor immunology were made by this technology, such as the identification of the idiotypes of B-cell tumors [19], and the oncofetal proteins ^-fetoprotein and carcinoembryonic antigen [20, 21], Unfortunately, the low therapeutic efficacy of apparently tumor-selective antibodies overshadowed the initial enthusiasm for this approach to cancer immunotherapy. On the other hand, great strides have been achieved over the past decade which dramatically improved our understanding of molecular mechanisms underlying antigen processing and presentation for T-cell recognition. The notion that peptide fragments derived from both intracellular and exogenous proteins are loaded onto the grooves of MHC class I and II molecules expanded the pool of potential tumor antigens and brought it closer to molecular isolation and characterization [22-24].
398
3. TUMOR-ASSOCIATED ANTIGENS: SELF/ALTERED SELF-PARADIGM A body of data over the past few years have determined that the immune repertoire of cancer patients contains both B and T cells that recognize antigens expressed by autologous cancer cells. Thus, tolerance to human cancer does not effectively delete the immune repertoire against cancer cells. The known universe of immunogenic antigens, defined by structure and function, on human cancers is still small, but is expanding rapidly [25, 26]. The human immune system seems to recognize antigens expressed by normal tissues, and that many epitopes that could potentially be targeted for tumor eradication by T cells or antibodies are indeed representative of normally expressed self-proteins. Tumor-associated autoantigens can be generally divided into three groups. The first group includes tissue specific antigens that are expressed by normal as well as transformed cells, exemplified by the numerous melanoma-specific antigens that have been identified by tumor infiltrating lymphocytes or with activated peripheral blood lymphocytes such as tyrosinase and gplOO [27-33]. Other tumorassociated antigens which fit into this category is the carcinoembryonic antigen (CEA), an oncofetal protein expressed in normal colon epithelium as well as in most gut carcinomas [34]. CEA has been shown to contain a peptide epitope recognized by T cells derived from CEA-immunized patients [35]. Another group which belongs to the category of self-antigens expressed on tumor cells includes those tumor antigens encoded by normal genes that are expressed during ontogony but not, or at negligible levels during adulthood [36-38]. This category of antigens was found to be expressed by a variable proportion, 10-40%, of a limited range of human tumor types. Although expression of these genes by normal tissue appears to be highly restricted, the testis exhibits significant level of expression, where the predominant cells that express those antigens being spermatogonia and primary spermatocytes [39]. A likely explanation for expression of this intriguing group of antigens in cancer cells is gene activation or derepression, with the state of global hypomethylation, generally associated with cancer as well as spermatogenesis, being, at least partially, responsible for the reactivation of these genes [40]. Although most antigens of this group have been characterized in melanoma e.g. MAGE, BAGE and
GAGE family of genes, a number of tumors of other histological types were found to express such antigens. RAGE was recently found to code for an antigen, recognized by CTLs on a human renal cell carcinoma. It was also found to be expressed in the retina, however [41]. A third category of self-antigens encompasses the more generally expressed or overexpressed tumorassociated proteins, such as wild-type p53 [42-46] and Her-2/neu [47-52]. These molecules are upregulated in a broad range of tumors, due to an advantage associated with the expression, or as frequendy observed, overexpression of these growth-promoting proteins. Because of the central role of these gene products in tumorigenesis, they are particularly tantalizing targets for antitumor immunity. They elicit both antibody and T-cell responses. It is noteworthy, however, that there exists two categories of potential rejection antigens that could be considered absolutely tumor-restricted. The first category includes those antigens that are derived from oncogenic viruses. A number of viral antigens have been studied on virally-induced murine tumors and were shown to be relevant for tumor rejection [53-57]. In humans, the best example is the E7 oncoprotein of human papilloma virus (HPV) 16, which is expressed almost ubiquitously in cervical carcinomas. Tumor-specific CTLs have been elicited by in vitro sensitization with E7 peptides presented by HLA-A2 [58]. Moreover, CTLs epitopes derived from latent membrane protein (LMP) 1 of the Epstein-Barr virus, presented on HLA-A2 were also identified. This viral gene is consistenly expressed in a number of nasopharyngeal carcinomas as well as Burkitt's lymphomas [59]. Although virus-associated tumor antigens represent important targets for therapeutic as well as prophylactic cancer vaccines, critical questions need to be addressed before the realization of their potential. First, how the virus avoids immunological elimination at the time of initial infection and the mechanism of immune tolerance to viral antigens in the face of persitent expression in the tumor. Another question relates to the correlation between clearance of the virus or progression to tumorigenesis with activation or tolerance induction among viral antigen-specific T cells. Finally, there are those unique tumor-associated antigens that are derived from regions of ubiquitous proteins that are mutated in tumor cells. These mutation could either generate a novel T-cell epitope, or confer de novo MHC-binding ability to an otherwise low
affinity peptide. The majority of mouse tumor antigens identified to date result from mutations [60, 61]. In humans, mutated tumor-associated antigens were found in genes that might be involved in oncogenesis, such as cyclin-dependent kinase (CDK)4 and y6-catenin genes [62, 63]. Another mutation which may anatogonize apoptosis was recently identified with CTLs specific for human squamous cell carcinoma of the head and neck [64]. This antigen is encoded by a mutated form of the CASP-8 gene, that codes for the protease caspase-8, which is required for the induction of apoptosis through Fas and tumor necrosis factor 1 [65, 66]. Another source of mutated tumor antigens is chimeric proteins encoded by sites of chromosomal translocations, a relatively frequent accompaniment of human leukemogenesis. One such chimeric protein is the myeloid leukemia-associated brc-abl protein, which results from a t(9;22) chromosomal translocation. CD4+ T cells, raised in vitro against a peptide centered on the fusion region of bcr-abl, were found to recognize HLA-DR4 leukemic blasts expressing bcrabl [67]. Tumor antigens resulting from mutations has special importance since they are considered optimal due to their exquisite tumor specificity. However, the fact that they are often unique precludes their use as generic cancer vaccines. In short, detailed analysis of tumor antigens have shown, to date, that most defined tumor antigens are tumor-selective, but not entirely tumor-specific, since physiological expression is also detected in normal tissues. Therefore, tumor antigens are not truly "foreign". Although the boundary between self and nonself is hardly well-defined, the first look at cancer antigens fits more with a self/altered self-paradigm than with the nonself-paradigm for antigens recognized in infectious diseases.
4. SELECTION OF TARGET ANTIGENS FOR ANTITUMOR VACCINATION As outlined above, tumor antigens that might serve as potential targets of antigen-specific cancer vaccines are being defined in several cancers. The optimal development of these vaccines requires identification of the most potent rejection antigens. One of the criteria to be considered in selecting antigens for antitumor vaccination is the precursor frequency of antigenspecific tumor-reactive T cells, since the frequency of
399
T cells reactive with particular tumor antigens would bear great relevance to the in vivo immunogenicity of such antigen. A second criterion concerns the prevalence and heterogeneity of antigen expression by tumor cells, since identifying target antigens that are expressed by a majority of cancers from different individuals would assist in developing antigen-based therapeutic strategies that could be broadly applied. Moreover, the uniformity of antigen expression in the tumor cell population could also influence the efficacy of the vaccine as the outgrowth of tumor antigen loss variants has been observed in both animal models and clinical studies following initially successful immunomodulatory therapy [68-71]. In situ immunophenotyping studies of tumor sections from melanoma patients have demonstrated homogenous staining of MART-1/MelanA but heterogenous staining, with as few as 20% of cells staining positive, for gplOO and gp75 [72, 73]. These results suggest that antigen-based immunotherpy directed against multiple antigens or epitopes maybe necessary to reduce the likelihood of tumor escape due to outgrowth of antigen loss or epitope loss variants. An additional criterion of overarching autoimmune importance is the possibility of induction of autotoxicity and autoimmune disease if antitumor CTLs and antibodies are activated for therapeutic purposes. Given the self-nature of a majority of tumor antigens, the antitumor immune reactivity to them can be viewd as an autoimmune response. Therefore, it is important to evaluate whether immune activation against tumor-selective antigens, whose expression is shared by normal cells, might result in damage of healthy tissues and whether this would trigger chronic autoimmune disease. Before discussing this issue and its implications, it is important to give a brief and comprehensive account of the currendy emplyed antigen-based antitumor vaccination strategies.
5. ANTIGEN-SPECIFIC CANCER VACCINATION STRATEGIES Although autologous tumor cell-based vaccines are currently the major form of cancer vaccines tested clinically [74-78], innovative approaches to antigenspecific vaccinations are underway. The ability to activate immune responses to selected immunodominant tumor epitopes provides for a much greater
400
control in targeting and fine-tuning antitumor immune responses. There is a number of approaches the aims at combining the most potent tumor rejection antigens and the appropriate route or vehicle by which the antigen is delivered to the immune system. A number of strategies have been developed in the past few years in an attempt to optimize cancer vaccines in a rational rather then empirical way. At present, the most widely employed, and the first to be clinically tested, strategy is peptide vaccination, peptide vaccination depends on the loading of empty common HLA alleles on antigen-presenting cells in vivo [79-82]. In poorly-immunogenic murine tumor models, peptides derived from tumor-associated rejection 'self antigens were shown to induce rejection of B16 melanomas [83]. Whereas vaccination with mutated peptide derived from the mouse gap junction protein connexin 37 led to regression of established lung metastasis of Lewis lung carcinoma [80]. Peptide vaccines for a number of cancers are being tested clinically. A phase-I trial using an HLA-A2restricted MAGE-3 peptide reported promising preliminary results in patients with advanced melanoma [84], with some patients undergoing complete remission. A more extensive peptide vaccine trial carried out in melanoma patients evaluated a modified gplOO peptide which exhibited higher binding affinity to HLAA2 molecules than its native counterpart. Induction of melanoma-reactive CTLs by this mode of vaccination did not, however, produce significant clinical responses [85]. In contrast, 41% of patients coinjected with high doses of IL-2 showed partial clinical responses. It is noteworthy that in these two clinical trials, which employed defined HLA class I peptides, there was a poor, if any, correlation between specific antitumor CTL induction and clinical responses. Drawing solid conclusions for these early experiments will have to await the results of more ongoing as well as future clinical trials. Attempts at enhancing peptide vaccine potency has recently focused on the use of autologous dendritic cells charged with tumor-associated peptides [86-88]. In one such study, vaccination of melanoma patients with dendritic cells pulsed with an HLA class -I-restricted peptide together with keyhole limpet hemocyanin as a helper antigen reported some clinical response [89]. Another method currently being evaluated in clinical trials is recombinant viral vaccines. The intrinsic immunogenicity of viruses together with the develop-
ment of techniques to engineer recombinant viruses has engendered broad interest in recombinant viral vaccines. Preliminary results of clinical trials with recombinant viruses engineered to express tumorassociated epitopes are just now beginning to be evaluated [90, 91]. It is too early to assess the efficacy of this mode of vaccination in the context of antitumor immunity. A third approach in antigen-based vaccines involves the use of naked DNA. This approach have engendered immense interest over the past few years (92-94). Due probably to its lack of replicative amplification in vivo, the potency of DNA-based vaccines is less than that of recombinant viral vaccines. However, DNA vaccines have the advantages of safety, the ability to recuit bone marrow-derived antigen presenting cells for tumor antigen presentation [95, 96], and the recently described adjuvanticity of the unmethylated CpG tracts found in the DNA of bacterial plasmid vectors which activate macrophages to produce proinflammatory cytokines such as IL-12. [97, 98]. This latter property is likely to be critical for the ability of DNA vaccines to induce immunity. In short, regardless of the means by which antigenspecific antitumor vaccines are formulated, induction of immunity to autoantigens seems feasible in cancer patients as evidenced by the analysis of recent few observations reported so far from the clinical trials.
6. ANTITUMOR IMMUNITY AND AUTOIMMUNE DISEASE It is becoming increasingly accepted that a large set of antigenic determinants of the self have not induced self-tolerance [99], and that a number of these peptide determinants furnish target structures for immune responses directed against tumors. As illustrated by the results of the hunt for tumor-associated antigens in recent years, tumors do not express mysterious nonself- or neoself-antigens, but rather a set of genes that are part of the self/altered self-repertoire. In fact, the aberrant expression of autoantigens by tumor cells and the possibility of inadvertent induction of autotoxicity as a byproduct of antitumor immunity was evident long before the elucidation of the self-nature of tumor antigens. Paraneoplastic syndromes, a heterogeneous group of immune mediated neuronal degeneration observed in a number of cancer patients
with distinct types of tumors, provided some insight into the increasingly blurred boundary between antitumor immunity and autoimmunity [100]. Paraneoplastic syndromes are triggered when antigens, normally restricted to the nervous system, are aberrantly expressed in a cancer. The immune system recognizes the antigen expressed by the tumor cells and mounts an immune response. This immune response, which was found to effectuate retardation of the growth of the tumor in some cases, would also attack those portions of the nervous system that express the "onconeural" antigen. The result is that the tumor remains small but patients may suffer severe neurological disorders [101, 102]. Further evidence to the coexistence of antitumor immunity and autoreactivity was brought about through observations by Rosenberg and coworkers that in patients with metastatic melanoma who were treated with high-dose interleukin-(IL)-2 immunotherapy, vitiligo, which is a manifestation of normal melanocyte destruction, developed in 15% of those patients who showed significant tumor regression, whereas none of the patients who did not receive the treatment developed vitiligo [103]. Furthermore, autoimmune-related thyroiditis was also observed to associate with an antitumor response in melanoma patients given IL-2, with the incidence of hypothyroidism positively correlating with a favorable antitumor response. [104]. Studies aiming at defining the molecular targets of antimelanoma cytotoxic T lymphocytes showed that those CTLs recognized a series of HLA class-I-restricted antigenic peptides having self-sequences [105]. These findings suggested the existence of a mechanism, shared by antitumor immunity and autoimmune disorders, whereby T cells that recognize normal self-sequences become activated. Animal models have been developed to address the question of whether antigen-specific immunotherapy can induce antitumor effects without autoimmune toxicity when the target antigen is expressed on both tumor cells and normal tissues. In a transgenic mouse model, T cells specific for the env-encoded protein of the murine erythroleukemia tumor FBL were adoptively transferred into tumor-bearing mice expressing the env transgene in peripheral tissues [106]. Remarkably, the FBL tumor was eradicated by the transferred T cells without toxicity to the env-expressing normal tissues of the transgenic mouse. Another approach that projects more accurately the spontaneous nature
401
of human tumors, Speiser and coworkers [107] developed a double transgenic mouse model that expresses the transforming simian virus 40 tumor T antigen and the mock tumor-associated antigen glycoprotein (GP) of the lymphocytic choriomeningitis virus (LCMV) under the rat insulin promoter. These mice develop spontaneous insulinomas and, as a result, succumb to progressive hypoglycemia. Infection of these mice with the LCMV virus induces a strong CTL response that leads to rejection of the tumors and renders the mice normoglycemic. Surprisingly, however, the double transgenic mice did not develop chronic autoimmune insulinitis although not only the tumor cells but also normal ^ cells were targets for CTLs [108]. The reason for this apparent tumor selectivity by the CTL response could be attributed to the transient nature of the CTL response, which abated after clearance of the LCMV infection despite the persistence of antigen expression by both the tumor and the B cells of pancreas. The fact that the CTL activity was limited in time precluded the induction of chronic autoimmune disease, in spite of initial induction of insulinitis, while allowed for the successful in vivo rejection of the established tumor. The PI A antigen of the murine mastocytoma P815 is one of the earliest tumor-associated antigens to be characterized [109]. This antigen was subsequendy found to be expressed on a number of murine tumors as well as the testis and the placenta, a pattern of expression which is similar to that of the MAGE, BAGE and GAGE family of genes that code for tumor antigens recognized by autologous CTLs. The induction of anti-PlA cytotoxic T lymphocytes did not effectuate any autoimmune side effects in male or female mice, with no deleterious effects on either fertility or gestation, respectively [110]. A possible explanation for the normal tissue-sparing CTL response is the lack of expression of MHC class-I molecules on spermatogonia or trophoblasts. Although other unidentified mechanisms might also play a role in the protection of normal tissues. The overexpressed tumor-selective autoantigens present a special case. Vaccine studies in rats in which the generation of HER-2/neu-specific immunity revealed no evidence of autoimmunity [111]. In the adult, HER-2 neu is expressed at low basal levels in a number of normal tissues, including skin, digestive tract epithelium, breast, ovary, hepatocytes and alveoli [112]. When rats were immunized with rat
402
HER-2/neu peptide vaccines, resulting in the generation of HER-2/neu immunity, these tissues showed no histological evidence of lymphocyte infiltration or tissue destruction. The tumor suppressor protein p53 is another molecule which is overexpressed in close to 50% of all human malignancies, which makes it an attractive target for immunotherapy. CTLs specific for the wild-type p53 were generated by immunizing p53 gene-deficient mice with syngeneic p53-overexpressing tumor cells. Adoptive transfer of these CTLs into tumor-bearing p53+/-i- nude mice resulted in complete and permanent tumor eradication. Importantly, this occurred in the absence of any histologically demonstrable damage to normal tissues [113]. At a glance, it looks as if immunization against antigens such as HER-2/neu or p53 does not lead to autoimmune damage in normal tissues, where the same antigen is expressed at low levels. It has recently been shown that recognition of CTL epitopes require the expression of the encoding gene above a certain threshold [114]. In some cases, this threshold may not be reached in normal tissues. This phenomenon may, at least partially, explain the apparent margin of tumor specificity in immunization experiments employing these molecules as target antigens. The tumor specificity should, however, be considered with some caution. The weak expression of such molecules measured at the RNA level in a given type of normal tissue my in fact reflect expression strong enough to exceed the threshold, but only in a small subtype of cells. The scarcity of cell lines derived from normal tissues precludes the ability to test the in vitro susceptibility to lysis by CTLs raised against these widely expressed molecules.
7. CONCLUDING REMARKS Experiments and clinical trials over the past few years have given telltale signals that there might be an operational window of specificity through which antitumor immunity can be triggered against tumor-associated self-antigens without concomitant or subsequent induction of autotoxicity. Further studies need to be done to address this issue both at the experimental and, in due course, at the clinical level. Nonetheless, the risk of inducing damage to normal tissues remains a major concern in the application of antigen-specific immunotherapy against cancer. On the other hand.
the principle that immune reactions to normal tissue antigens can lead to cancer regression has important implications for the development of immunotherapies against cancers that arise in nonessential organs, such as the thyroid, breast, ovary and prostate, which may express tissue-specific antigens that are potential targets for cancer immunotherapy. As in any disease, the administration of a given treatment should wisely weigh the potential gains against the possible induction of untoward effects. A lot of patients, and their doctors, would happily trade off pancreatic cancer with diabetes mellitus, or cancer of the ovary with autoimmune ovarian failure. Despite the diametrically opposing goals of the field of autoimmunity and that of tumor immunology, It is evident that both fields share some common grounds. How self-destructive immune cells become initially activated and propagated during the autoimmune disease is a question that remains largely unanswered. A solution to this conundrum should be readily adaptable to the problem of cancer immunotherapy. Aside from virus-induced tumors, effective immunization against tumors represents an activation of natural autoimmunity to a set of self-antigens that had not induced tolerance during development or at the periphery. Tumors seem to create a barrier that enable them to escape in the face of a specific and quite capable immune response. Understanding the nature of this barrier may reveal what needs to be overcome in the cancer patient to allow the release of the full potential of the immune system to kill the tumor. Insights into the nature of this barrier may come, out of all places, from the field of autoimmunity. Thus, the task ahead is to exploit the resource of the protected nontolerized T- and B-cell repertoire and to learn how responses within it can be harnessed with appropriate antigen presentation. It is not inconceivable that in the future, there will be ways to trigger the immune system to wipe out all the tumor cells in the patient, while leaving normal nontransformed cells untouched.
3.
4.
5.
6. 7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17. REFERENCES 1.
2.
Scott OCA. Tumor transplantation and tumor immunity: a personal view. Cancer Res 1991;51:757763. Gorer PA. The antigenic basis of tumor transplantation. J Pathol Bacteriol 1938:47:231-252.
18.
Rous P. An experimental comparison of transplanted tumor and a transplanted normal Ussue capable of growth. J Exp Med 1910;12:344-365. Medawar PB. The immunology of transplantation. In: Harvey Lectures. New York: Academic Press, 1958;144-176. Snell GD. Congenic resistant strains of mice. In: Morse HC, ed., Origins of Inbred Mice. New York: Academic Press, 1978;119-155. Klein G. Biology of the Mouse Histocompadbility-2 Complex. New York: Springer-Verlag, 1975. Prehn RT, Main JM. Immunity of methylcholanthrene-induced sarcomas. J Natl Cancer Ins 1957;18:769-778. Baldwin RW. Immunity to methylcholanthreneinduced tumors in inbred rats following atrophy and regression of the implanted tumors. Br J Cancer 1955;9:652-657. Foley EJ. Attempts to induce immunity against mammary adenocarcinoma in inbred mice. Cancer Res 1953;3:578-580. Foley EJ. Antigenic properties of methylchloranthrene-induced tumors in mice of the strain of origin. Cancer Res 1953;13:835-837. Gross L. Intradermal immunization of CH3 mice against a sarcoma that originated in an animal of the same hne. Cancer Res 1943;3:326-333. Revesz L. Detection of antigenic differences in isologous host-tumor systems by pretreatment with heavily-irradiated tumor cells. Cancer Res 1960;20:443^51. Khera KS, Ashkenasi A, Rapp F, Melnick JL. Immunity in hamsters to cells transformed in vitro and in vivo by S V40. Tests for antigenic relationship among the papovaviruses. J Immunol 1963; 136:4729^734. Kripke ML. Antigenicity of murine skin tumors induced by ultraviolet light. J Natl Cancer Ins 1974;53:1333-1336. Sjogren HO, Hellstrom I, Klein G. Resistance of polyoma virus immunized mice to transplantation of established polyoma tumors. Exp Cell Res 1961;23:204-208. Hewiu HB, Blake ER, Walder AS. A critique of the evidence for active host defense against cancer based on personal studies of 27 murine tumors of spontaneous origin. Br J Cancer 1976;33:241-259. Van Pel A, Boon T. Protection against a nonimmunogenic mouse leukemia by an immunogenic variant obtained by mutagenesis. Proc Natl Acad Sci USA 1982;79:4718-4722. Van Pel A, Vessiere F, Boon T Protection against two spontaneous mouse leukemias conferred by immunogenic variants obtained by mutagenesis. J Exp Med 1983;157:1992-2002.
403
19.
20.
21.
22.
23.
24.
25. 26.
27.
28.
29.
30.
31.
404
Kwak IW, Campell MJ, Czerwinski DK, Hart S, Miller RA., Levy R. Induction of immune responses in patients with B-cell lymphoma against the surface-immunoglobulin idiotype expressed by their tumors. N Engl J Med 1992; 327:1209-1215. Abelev GI, Perova SD, Khramkova NI, Postinkova SA., Irlin IS. Production of embryonal alpha globulin by transplantable mouse hepatomas. Transplantation 1963;1:174-180. Gold P, Freeman SO. Specific carcinoembyonic antigens of human digestive system. J Exp Med 1965;122:467^68. Townsend A, Bodmer H. Antigen recognition by class-I-restricted T-lymphocutes. Ann Rev Immunol 1989;7:601-624. Germain RN, Marguhes DH. The biochemistry and cell biology of antigen processing and presentation. Ann Rev Immunol 1993; 11:403^50. Germain RN. MHC-dependent antigen processing and presentation: providing ligands for Tlymphocyte activation. Cell 1994;76:287-299. Old LJ., Chen YT. New paths in human cancer serology. J Exp Med 1998;187:1163-1167. Van den Eynde B, Van den Bruggen P. T cell defined tumor antigens. Curr Opin Immunol 1997;4:684693. Kawakami Y, Eliyahu S, Jennings C, Sakaguchi K, Kang X-Q, Southwood S, Robbins PF, Sette A, Appella E, Rosenberg SA. Recognition of multiple epitopes in the human melanoma antigen gplOO associated with in vivo tumor regression. J Immunol 1995;154:3961-3970. Bakker A, Schreurs M, Tafazzul G, De Boer A, Kawakami Y, Adema G, Figdor C. Identification of novel peptide derived from the melanocyte-specific gplOO antigen as the dominant epitope recognized by an HLA.A2.1-restricted antimelanoma CTL line. Int J Cancer 1995;62:97-104. Cox AL, Skipper J, Cehn Y, Henderson RA, Darrow TL, Shabanowitz J, Engelhard VH, Hunt DF, SUngluff CL. Identification of a peptide recognised by five melanoma-specific human cytotoxic T cell fines. Science 1994;264:716-719. Brichard V, Van Pel A, Wolfel T, Wolfel C, De Plaen E, Lethe B, Coufie P, Boon T. The tyrosinase gene codes for an antigen recognized by autologous cytotoxic T-lymphocytes on HLA-A2 melanomas. J Exp Med 1993;178:489-495. Wolfel T, Van Pel A, Brichard V, Schneider J, Seliger B, Meyer Zum Buschenfelde K-H, Boon T. Two tyrosinase nanopeptides recognized on HLA-A2 melanoma by autologous cytotoxic T-lymphocytes. Eur J Immunol 1994;24:759-765.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
Robbins PF, El-Gamil M, Kawakami Y, Stevens E, Yannelli J, Rosenberg SA. Recognition of tyrosinase by tumor infiltrating lymphocytes from patients responding to immunotherapy. Cancer Res 1994;54:3124-3129. Robbins PF, El-Gamil M, Li YF, Topalian SL, Rivoltini L, Sakaguchi K, Appella E, Kawakami Y, Rosenberg SA. Cloning of a new gene encoding an antigen recognized by melanoma-specific HLAA24-restricted tumor-infiltrating lymphocytes. J Immunol 1995;154:5944-5952. Hodge JW. Carcinoembryonic antigen as a target for cancer vaccines. Cancer Immunol Immunother 1996;43:127-134. Tsang KY, Zaremba S, Nieroda CA, Zhu MZ, Hamilton JM, Schlom J. Generation of human cytotoxic T cells specific for human carcinoembryonic antigen epitopes from patients immunized with recombinant vaccinia-CEA vaccine. J Natl Cancer Inst 1995;87:982-990. Van der Bruggen P, Traversari C, Chomez P, Lurquin C, De Plaen P, Van den Eynde B, Knuth A, Boon T. A gene encoding an antigen recognized by cytotoxic T lymphocytes on a human melanoma. Science 1991;254:1643-1647. Van den Eynde P, Peeters O, De Backer B, Gaugler B, Lucas S, Boon T. A new family of genes coding for an antigen recognized by autologous cytotoxic T lymphocytes on a human melanoma. J Exp Med 1995;182:689-698. Boel PC, Wildmann ML, Sensi R, Brasseur J, Renauld P, Coulie P, Boon T, Van den Bruggen P. BAGE: a new gene encoding an antigen recognized by cytotoxic T lymphocytes. Immunity 1995;2:167175. Takahashi K, Shichijo S, Noguchi M, Hirohata M, Itoh K. Identification of MAGE-1 and MAGE-4 proteins in spermatogonia and primary spermatocytes of testis. Cancer Res 1995;55:3478-3482. De Smet C, De Backer O, Faraoni I, Lurquin C, Brasseur F, Boon T. The activation of human gene MAGE-1 in tumor cells is correlated with genome-wide demethylation. Proc Natl Acd Sci USA 1996;93:7149-7153. Gaugler B, Brouwenstijn N, Vantomme V, Szikora J-P, Van der Spek CW, Patard J-J, Boon T, Schrier P, Van den Eynde BJ. A new gene coding for an antigen recognized by autologous cytotoxic T lymphocytes on a human renal cell carcinoma. Immunogenetics 1996;44:323-330. Noguchi Y, Chen YT, Old LJ. A mouse mutant p53 product recognized by CD4+ and CD8+ T cells. Proc Natl Acad Sci USA 1994;91:3171-3178.
43.
44.
45.
46.
47.
48.
49.
50.
51.
52.
53.
54.
Myordoma JI, Loftus DJ, Sakamoto H, De Cesare CM, Appasamy M, Lotze MT, Storkus WJ, Appella E, DeLeo AB. Therapy of murine tumors with p53 wild-type and mutant sequence peptide-based vaccines. J Exp Med 1996;183:1357-1365. Roth J, Dittmer D, Rea D, Tartaglia J, Paoletti C, Levine AJ. p53 as target for cancer vaccines: recombinant canarybox virus vectors expressing p53 protect mice against lethal tumor challenge. Proc Natl Acad Sci USA 1996;93:4781^789. Houbiers JGA, Nijman HW, Burg SHvd, Drijfhout JW, Kenemans P, Velde CJvd, Brand A, Momburg F, Kast WM, Melief C. In vitro induction of human cytotoxic T lymphocyte responses against peptides of mutant and wild-type p53. Eur J Immunol 1993;23:2072-2080. Theobald M, Biggs J, Dittmer D, Levine AJ, Sherman LA. Targeting p53 as a general tumro antigen. Proc Natl Acad Sci USA 1995;92:11993-11998. Yoshino I, Goedegebuure PS, Peoples GE, Parikh AS, DiMaio JM, Lyerly HK, Gazdar AF, Eberlein TJ. HER2/neu-derived peptides are shared antigens among non-small cell lung cancer and ovarian cancer. Cancer Res 1994;54:3387-3392. Disis ML, Smith JW, Murphy AE, Chen W, Cheever MA. In vitro generation of human cytotoxic T cells specific for peptides derived from the Her-2/neu protooncogene protein. Cancer Res 1994;54:10711078. loannides CG, Fisk B, Fan D, Biddison WE, Wharton JT, O'Brian CA. Cytotoxic T cells isolated from ovarian malignant ascites recognize a peptide derived from the HER-2/neu protooncogene. Cell Immunol 1993;151:225-230. Fisk B, Blevins TL, Wharton JT, loannides CG. Identification of an immunodominant peptide of HER-2/neu protooncogene recognized by ovarian tumor-specific cytotoxic T lymphocyte lines. J Exp Med 1995;181:2109-2115. Whiteside TL, Parmiani G. Tumor-infiltrating lymphocytes: their phenotype, functions, and clinical use. Cancer Immunol Immunother 1994;39:15-18. Lustgarten J, Theobald M, Labadie C, LaFace D, Peterson P, Disis ML, Cheever MA, Sherman LA. Identification of Her-2/neu CTL epitopes using double transgenic mice expressing HLA-A2.1 and CD8. Human Immunol 1997;52:109-115. Klamet JP, Kern DE, Okuno K, Holt C, Lilly F, Greenberg PD. FBL-reactive CD8+ cytotoxic and CD4+ helper T lymphocytes recognize distinct Friend murine leukemia virus-encoded antigens. J Exp Med 1989;169:457-467. Tanaka Y, Tavethia MJ, Kalderon D, Smith AE, Tavethia SS. Clustering of antigenic sites recognized
55.
56.
57.
58.
59.
60.
61.
62.
63.
64.
by cytotoxic T lymphocyte clonee in the amino terminal half of SV40 antigen. Virology 1988;162:427436. Kast WM, Offringa R, Peters PJ, Voordouw AC, Meloen RH, Van der Eb AJ, Melief CJM. Eradication of adenovirus El-induced tumors by Elspecific cytotoxic T lymphocytes. Cell 1989;59:603614. Plata F, Langlade-Demoyen P, Abastado JP, Berbar T, Kourilsky P. Retrovirus antigens recognized by cytotoxic T lymphocytes activate tumor rejection in vivo. Cell 1987;48:231-240. Kast WM, Melief CJM. Fine peptide specificity of cytotoxic T lymphocytes directed against adenovirus-induced tumors and peptide-MHC binding. Int J Cancer 1991;6(suppl):90-94. Ressing ME, Sette A, Brand RMP, Ruppert J, Wentworth PA, Hartman M, Oseroff C, Grey HM, Melief CJM, Kast, WM. human CTL epitopes encoded by human papillomavirus type 16 E6 and E7 identified through in vivo and in vitro immunogenicity studies of HLA-A*0201-binding peptides. J Immunol 1995;154:5934-5943. Khanna R, Burrows SR, NichoUs J, Poulsen LM. Identification of cytotoxic T cell epitopes within Epstein-Barr virus (EBV) oncogene latent membrane protein 1 (LMPl): evidence for HLA A2 supertype-restricted immune recognition of EBVinfected cells by LMPl-specific cytotoxic T lymphocytes. Eur J Immunol 1998;28:451-458. Mandelboim O, Berke G, Fridkin M, Feldman M, Eisenstein M, Eisenbach L. CTL induction by a tumor-associated antigen octapeptide derived from a murine lung carcinoma. Nature 1994;369:67-7 L De Bergeyck V, De Plaen E, Chomez P, Boon T, Van Pel A. An intracisternal A particle sequence codes for an antigen recognized by syngeneic cytolytic T lymphocytes on a mouse spontaneous leukemia. Eur J Immunol 1994;24:2203-2212. Wolfel T, Hauer M, Schneider J, Serrano M, Wolfel C, Klehmann-Hieb E, De Plaen E, Hankeln T, Meyer zum Buschenfelde K-H, Beach D. A pl6INK4a-insensitive CDK4 mutant targeted by cytolytic T lymphocytes in a human melanoma. Science 1995;269:1281-1284. Robbins PF, El-Gamil M, Li YF, Kawakami Y, Loftus D, Appella E, Rosenberg SA. A mutated bcatenin gene encodes a melanoma-specific antigen recognized by tumor-infiltrating lymphocytes. J Exp Med 1996;183:1185-1192. Mandruzzato S, Brasseur F, Andery G, Boon T, Van der Bruggen P. A CASP-8 mutation recognized by cytotoxic T lymphocytes on a human head and neck carcinoma. J Exp Med 1997;186:785-793.
405
65.
66.
67.
6S.
69.
70.
71.
72.
73.
74.
75.
406
Boldin MP, Goncharov TM, Goltsev YV, Wallach D. Involvemt of MACH, a novel MORTl/FADDinteracting protease in FAS/APOl- and TNF receptor-induced cell death. Cell 1996;85:SOSSIS. Muzio M, Chimmaiyan AM, Kischel FC, O'Rourke K, Shevchenko A, Ni J, Scaffidi C, Bretz JD, Zhang M, Gentz R, Mann M, Krammer PH, Peter ME, Dixit VM. FLICE, a novel FADD-homologous ICE/CED-3-like protease, is recuited to CD95 (FAS/APO-1) death-inducing signaHng complex. Cell 1996;S5:S17-S27. Ten Bosch GJA, Joosten AM, Kessler JH, Melief CJM, Leeksma OC. Recognition of BCR-ABL positive leukemic blasts by human CD4-I- T cells elicited by primary in vitro immunization with a BCR-ABL breakpoint peptide. Blood 1996;SS:3522-3527. Seung S, Urban, JL, Schreiber H. A tumor escape variant that has lost one major histocompatibility complex class I restriction element induces specific CDS-i- T cells to an antigen that no longer serves as a target. J Exp Med 1993;17S:933-940. Dudley ME, Roopenian DC. Loss of a unique tumor antigen by cytotoxic T lymphocyte immunoselection from a 3-methylchloranthrene-induced mouse sarcoma reveals secondary unique and shared antigen. J Exp Med 1996;1S4:441^47. Lehmann F, Marchard M, Hainaut P, Pouillart P, Sastre X, Ikeda H, Boon T, Coulie PG. Differences in antigens recognized by cytolytic T lymphocytes on two successive metastases of a melanoma patient are consistent with immune selection. Eur J Immunol 1995;25:340-347. Jager E, Ringhoffer M, Altmannsberger M, Arand M, Karbach J, Jager D, Oesch F, Knuth A. Immunoselection in vivo: independent loss of MHC class I and melanocyte differentiation antigen expression in metastatic melanoma. Int J Cancer 1997;71:142147. Chen YT, Stockert E, Tsang S, Coplan KA, Old LJ. Immunophenotyping of melanomas for tyrosinase: implications for vaccine develoment. Proc Natl Acad Sci USA 1995;92:S125-S129. Chen YT, Stockert E, Jungbluth A, Tsang S, Coplan KA, Scanlan MJ, Old LJ. Serological analysis of Melan-A (MART-1), a melanocyte specific-protein homogenously expressed in human melanomas. Proc Natl Acad Sci USA 1996;93:5915-5919. Jaffee EM, Pardoll DM. Considerations for the clinical development of cytokine gene-tranduced cancer vaccines. Methods 1997;12:143-153. Veelken H, Mackensen A, Lahn M, Kohler G, Becker D, Franke B, Brennschneidt U, Kulmburg P, Rosenthal FM, Keller H, Hasse J, Schultz-Seemann
76.
77.
78.
79.
50.
51.
52.
53.
W, Farthmann EH, Mertelsmann R, Lindemann A. A phase-I clinical study of autologous tumor cells plus interleukin-2-gene-transfected allogeneic fibroblasts as a vaccine in patients with cancer. Int J Cancer 1997;70:269-277. Abdel-Wahab Z, Weltz C, Hester D, Pickett N, Veraert C, Barber JR, Jolly D, Seigler HE A phase I clinical trial of immunotherapy with interferongamma gene-modified autologous melanoma cells: monitoring the humoral immune response. Cancer 1997;S0:401-412. Belli F, Arienti F, Sule-Suso J, Clemente C, Mascheroni L, Cattelan A, Sanatonio C, Gallino GF, Melani C, Rao S, Colombo MP, Maio M., Cascinelli, N, Parmiani G. Active immunization of metastatic melanoma patients with interleukin2-transduced allogeneic melanoma cells: evaluation of efficacy and tolerability. Cancer Immunol Immunother 1997;44:197-203. Ellem KA, O'Rouke MG, Johnson GR, Parry G, Misko IS, Schmidt CW, Parsons PG, Burrows SR, Cross S, Fell A, Li CL, Bell JR, Dubois PJ, Moss DJ, Good MF, Kelso A, Cohen Lk, Dranoff G, Mulligan, RC. A case report: immune responses and clinical course of the first human use of granulocyte/macrophage colonystimulating factor-transduced autologous melanoma cells for immunotherapy. Cancer Immunol Immunother 1997;44:10-20. Belione B, Lezzi G, Manfredi A, Protti MP, Deliabona P, Casorati G, Rugarli C. In vitro priming of cytotoxic T lymphocytes against poorlyimmunogenic epitopes by engineered antigenpresenting cells. Eur J Immunol 1994;24:2691269S. Mandelboim O, Vadai E, Fridkin M, Katz-Hillel A, Feldman M, Berke G, Eisenbach L. Regression of established murine carcinoma metastases following vaccination with tumour-associated antigen peptides NatMedl995;ll:1179-llS4. Yamasaki S, Okino T, Chakraborty NG, Adkisson WO, Sampieri A, Padula SJ, Mauri F, Mukherji B. Presentation of synthetic peptide antigen encoded by the MAGE-1 gene by granulocyte/macrophagecolony-stimulating-factor-cultured macrophages from HLA-Al melanoma patients. Cancer Immunol Immunother 1995;40:26S-273. Nair SK, Boczkowski D, Snyder D, Gilboa E. Antigen-presenting cells pulsed with unfractionated tumor-derived peptides are potent tumor vaccines. Eur J Immunol 1997;27:5S9-579. Bloom MB, Perry-Lalley D, Robbins PF, Li Y, el-Gamil M, Rosenberg SA. Identification of tyrosinase-related protein 2 as a tumor rejec-
84.
85.
86.
87.
88.
89.
90.
91.
92.
93.
tion antigen for the B16 melanoma. J Exp Med 1997;185:453^59. Marchand M, Weynants P, Rankin E, Arienti F, Belli F, Parmiani G, Cascinelli N, Bourlond A, Vanwijck R, Humblet Y, Canon J-L, Laurent C, Naeyaert JM, Plagne R, Deraemaeker R, Knuth A, Jager E, Brasseur F, Herman J, Coulei P.G, Boon T. Tumor regression responses in melanoma patients treated with a peptide encoded by gene MAGE-3. Int J Cancer 1995;63:883-88. Rosenberg SA, Yang JC, Schwartzentruber DJ, Hwu P, Marincola FM, Topalian SL, Restifo NP, Dudley ME, Schwarz SL, Spiess PJ, Wunderlich JR, Parkhurst MR, Kawakami Y, Seipp CA, Einhom JH, White DE. Immunologic and therapeutic evaluation of a synthetic peptide vaccine for the treatment of patients with metastatic Nat Med 1998;4:321-327. Grabbe S, Beissert S, Schwarz T, Granstein RD. Dendritic cells as initiators of tumor immune responses- a possible strategy for tumor immunotherapy. Immunol Today 1995;16:117-121. Hsu FJ, Benike C, Fagnoni F, Liles TM, Czerwinski D, Taidi B, Engleman EG, Levy R. Vaccination of patients with B-cell lymphoma using autologous antigen-pulsed dendritic cells. Nat Med 1996;2:5257. Mayordomo JI, Zorina T, Storkus WJ, Zitvogel L, Celluzzi C, Falo LD, Melief CJ, Ildstad ST, Kast MW, Deleo AB, Lotze MT. Bone marrow-derived dendritic cells pulsed with synthetic tumour peptides elicit protective and therapeutic antitumour immunity Nat Med 1995;12:1297-1302. Nestle FO, Alijagic S, Gilliet M, Sun Y, Grabbe S, Dummer R, Burg G, Schadendorf D. Vaccination of melanoma patients with peptide- or tumor lysatepulsed dendritic cells. Nat Med 1998;4:328-332. Chen PW, Wang M, Bronte V, Zhai Y, Rosenberg SA, Restifo NP. Therapeutic antitumor response after immunization with a recombinant adenovirus encoding a model tumor-associated antigen. J Immunol 1995;156:224-231. Wang M, Bronte V, Chen PW, Gritz L, Panicali D, Rosenberg SA. Restifo-NP. Active immunotherapy of cancer with a nonreplicating recombinant fowlpox virus encoding a model tumor-associated antigen. J Immunol 1995;154:4685-4692. Pardoll DM, Beckerlag A-M. Exposing the immunology of naked DNA vaccines. Immunity 1995;3:165-169. Wang B, Merva M, Dang K, Ugen KE, Williams WV, Weiner DB. Immunization by direct DNA inoculation induces rejection of tumor cell challenge. Human Gene Ther 1995;6:407^18.
94.
95.
96.
97.
98.
99.
100. 101. 102.
103.
104.
105.
106.
Ciemik IF, Berzofsky JA, Carbone DP. Induction of cytotoxic T lymphocytes and antitumor immunity with DNA vaccines expressing single T cell epitopes. J Immunol 1996;156: 2359-2367. Doe B, Selby M, Bamet S, Baenzinger J, Walker CM. Induction of cytotoxic T lymphocytes by intramuscular immunization is facilitated by bonemarrow-derived cells. Proc Natl Acad Sci USA 1996;93:8578-8583. Casares S, Inaba K, Brumeau T-D, Steinman RM, Bona CA. Antigem presentation by dendritic cells after immunization with DNA encoding a major histocompatibility complex class-II-restricted viral epitope. J Exp Med 1997;186:1481-1486. Tighe H, Corr M, Roman M, Raz E. Gene vaccination: plasmid DNA is more than just a blueprint. Immunol Today 1998;19:89-97. Roman M, Orozco E, Goodman JS, Nguyen MD, Sato Y, Ronagho A, Kornbluth RS., Richman DD, Carson DA, Raz E. Immunostimulatory DNA sequences function as T helper-1-promoting adjuvants. Nat Med 1997;3:849-854. Sercaz EE, Lehmann PV, Ametani A, Benichou G, Miller A, Moudgil K. Dominance and crypticity of T cell antigenic detrminants. Ann Rev Immunol 1993;11:729-766. Yarbo J, Bomstein R, Masterangelo M. Paraneoplastic syndromes. Semin Oncol 1997;24:265-285. Posner JB, Dalmau J. Paraneoplastic syndromes. Curr Opin Immunol 1997;9:723-729. Darnell RB, DeAngelis LM. Regression of smallcell lung carcinoma in patients with paraneoplastic neuronal antibodies. Lancet 1993;341:21-22. Rosenberg SA, White DE. Vitiligo in patients with melanoma: normal tissue antigens can be targets for cancer immunotherapy. J Immunother 1996; 19:8184. Atkins MB, Mier JW, Parkinson DR, Gould JA, Berkman EM, Kaplan MM. Hypothyroidism after treatment with interleukin-2 and lymphokineactivated killer cells. N Engl J Med 1998;318:15571563. Tsomides TJ, Reilly EB, Eisen HN. Anti-melanoma cytotoxic T lymphocytes (CTL) recognize numerous antigenic peptides having 'self sequences: autoimmune nature of anti-melanoma CTL response. Int Immunol 1997;9:327-338. Hu J, Kindsvogel W, Busby S, Baily MC, Shi YY, Greenberg PD. An evaluation of the potential to use tumor-associated antigens as targets for antitumor T cell therapy using transgenic mice expressing a retroviral tumor antigen in normal lymphoid tissues. J Exp Med 1993;177:1681-1690.
407
107.
108.
109.
110.
408
Speiser DE, Miranda R, Zakarian A, Bachmann MF, Mckall-Faienza K, Odermatt B, Hanahan D, Zinkernagel RM, Ohashi PS. Self antigens expressed by solid tumors do not efficiently stimulate naive or avtivated T cells: implications for immunotherapy. J Exp Med 1997;186:645-653. Ohashi PS, Oehen S, Buerki H, Pircher CT, Ohashi B, Odermatt B, Malissen R, Zinkernagel R, Hengartener H. Ablation of "tolerance" amd induction of diabetes by virus infection in viral antigen transgenic mice. Cell 1991;65:305-317. Amar-Costesec A, Godelaine D, Van den Eynde B, Beaufay H. Identification and characterization of the tumor-specific PI A gene product. Biol Cell 1994;81:195-203. Uytttenhove C, Godfraind C, Lethe B, AmarCostesec A, Renauld J-C, Gajewski TF, Duffour M-T, Warmer G, Boon T, Van Den Eynde, BJ. The expression of mouse gene PI A in testis does not prevent safe induction of cytolytic T cells
111.
112.
113.
114.
against the PI A-encoded tumor antigen. Int J Cancer 1997;70:349-356. Disis ML, Gralow JR, Bemhard H, Hand SL, Rubin WD, Cheever MA. Peptide-based, but not whole protein, vaccines, elicit immunity to HEr-2/neu, oncogenic self protein. J Immunol 1996;156:31513158. Press MF, Cordon-Cardo C, Slamon D. Expression of the HER-2/neu proto-oncogene in normal human adult and fetal tissues.Oncogene 1990;5:953-962. Vierboom MPM, Nijman HW, Offringa R, Van der Voort EIH, Van Hall T, Van den Broek L, Fleuren GJ, Kenemans P, Kast WM, Melief CJM. Tumor eradication by wild-type p53-specific cytotoxic T lymphocytes. J Exp Med 1997;186:695704. Lethe B, Van den Bruggen P, Brasseur P, Boon T. MAGE-1 expression threshold for the lysis of melanoma cell lines by a specific CTL. Melanoma Res. 1997;7(suppl. 2):S83-S88.
(c) 2000 Elsevier Science B.V All rights reserved. Cancer and Autoimmunity Y. Shoenfeld and M. E. Gershwin, editors
Bone Marrow Transplantation for Cancer and Autoimmunity Shimon Slavin and Arnon Nagler Hadassah University Hospital, Ein Kerem, Jerusalem, Israel
1. INTRODUCTION Prior data in experimental animals and man indicated that high dose chemoradiotherapy [1-3], especially myeloablative chemoradiotherapy supported by autologous blood or marrow stem-cell transplantation (autoBMT) [4-12] and allogeneic blood or marrow stemcell transplantation (alloBMT) can result in effective control of autoimmune diseases [13-15]. Indeed, both autoBMT and alloBMT, which are frequently used exclusively to treat hematologic disorders, were recently shown to be effective in patients with life-threatening autoimmune diseases who may respond favorably to either one of the BMT procedures which appear to be most effective in eliminating host hematopoietic compartment, self-reactive immune lymphocytes included [14-22]. There appears to be a two-way relationship between autoimmunity and both autoBMT and alloBMT. Following transplantation, patients may develop complications due to abnormal regulation of the newly developing immune system, thus resulting in autoimmune manifestations of disease. On the other hand, both autoBMT and alloBMT are used more frequently not only for the treatment of an autoimmune disease that accompanies primary malignancy, but also as the primary treatment of life-threatening autoimmune diseases with encouraging results [1922]. In a subsequent chapter, we will review the clinical syndromes where the association between auto and alloBMT and autoimmunity is becoming more intimate.
2. THE RATIONALE FOR THE USE OF autoBMT FOR THE TREATMENT OF AUTOIMMUNE DISORDERS Autoimmune diseases result from self-reactive T lymphocytes and autoantibodies, produced most likely in cooperation with T-cell-dependent B cells. Until recently, nonspecific suppression of self-reactive lymphocytes or the inflammatory process mediated by the ongoing antiself-reactivity represented the main goal of therapy, but in the large majority of cases, neither cure nor remission can be obtained. Patients with severe, life-threatening manifestations of autoimmune diseases such as multiple sclerosis (MS), systemic lupus erythematosus (SLE) and rheumatoid arthritis (RA) may require long-term maintenance immunosuppressive treatment similarly to organ allograft recipients, with all the anticipated side effects related to chronic immunosuppression on the one hand and side effects directly related to the immunosuppressive drugs (e.g., corticosteroids, cytotoxic agents and cyclosporine A (CSA) to mention just a few) on the other. Unfortunately, none of the approaches available todate can offer effective and safe regulation of antiself-reactivity. Clearly, the reinduction of unresponsiveness towards self-antigens remains the yet unaccomplished final goal. Recent data from animal models with induced or spontaneous autoimmune diseases [1-13], as well as clinical observations in patients with autoimmune diseases accompanying a primary malignancies [14-18], suggest that the reinduction of unresponsiveness to self-antigens and alloantigens appears be a realistic goal. However, whereas induction of unresponsiveness to neoantigens (primary response) may be relatively easy to accomplish, even when the ligands
409
presented to the immune systems are strong alloantigens, the reinduction of unresponsiveness in primed recipients with memory cells (secondary response) is much harder to accomplish [23, 24], suggesting in analogy, that the reinduction of unresponsiveness towards self-antigens may be also difficult to accomplish in patients with ongoing autoimmune diseases, since memory cells against self-antigens may be much more difficult to eliminate. In the subsequent report, we will briefly review the basic concepts, the experimental data and the rationale for proposing a potential benefit for autologous blood or marrow transplantation (autoBMT) and allogeneic blood or marrow transplantation (alloBMT) that make us believe that elimination of the autoimmune process may be safely accomplished by the reinduction of selftolerance in patients with life-threatening autoimmune diseases, in conjunction with stem-cell transplantation. Once proven to be feasible, safe and effective, stem-cell therapy may become an important modality for the treatment of otherwise incurable autoimmune diseases.
3. THE RATIONALE FOR THE USE OF alloBMT FOR THE TREATMENT OF AUTOIMMUNE DISORDERS Stem-cell transplantation may help accomplish the reinduction of unresponsiveness to self-antigens since the conditioning prior to the transplantation procedure normally involves myeloablative treatment that results in elimination of host-type immunohematopoietic cells, T cells included, followed by stem-cell rescue which results in regeneration of new T cells tolerant to self-antigens. Hence, if the autograft is T-cell-depleted, newly regenerating T cells are likely to become tolerant to self-antigens since self-reactive T cells, certainly high affinity self-reactive T cells, are likely to undergo apoptosis in status nascendi in the thymus [25]. Similarly, following the use of Tcell-depleted stem-cell allograft, which can also be used for rescue of the myeloablated recipient, it seems very reasonable that both antiself as well as antihost reactivity will be abolished by the aforementioned procedure. Based on the above it can be anticipated that de novo development of the T-cell repertoire from uncommitted progenitor cells in the presence of the autoantigen against which self-reactive T cells
410
are reactive is the best recipe for the reinduction of self-tolerance, similarly to the normal ontogeny of the immune system during induction of self-tolerance during fetal stage. Allogeneic bone marrow transplantation which normally follows myeloablative conditioning can also eliminate spontaneous autoimmunity, as has been shown in (NZBxNZW)Fl, BxSB, (NZBxNZW)Fl females and MRL/lpr mice [13], and more recently in clinical practice [19-22], most likely by a combination of elimination of self-reactive lymphocytes of hostorigin and replacement of genetically susceptible stem cells with normal stem cells of donor origin. Successful elimination of manifestations of autoimmune disease were documented in patients with RA, SLE, hyperthyroidism, dermatitis, vasculitis and Crohn's disease [13-22]. Successful treatment of MS was also reported in a patient with chronic myeloid leukemia following alloBMT, with subjective improvement in symptoms and objective improvement of neurological manifestations of disease and stabilization of MRI [14]. We have also treated one patient with CML with severe psoriasis accompanied by severe psoriatic arthritis and another patient with acute myeloid leukemia and thyroiditis, both successfully treated with alloBMT with complete elimination of signs and symptoms of the underlying autoimmune diseases (>1 year) in parallel with eradication of the primary malignant disease (Slavin et al., in preparation). Resolution of pre-existing autoimmune diseases following alloBMT was recently reviewed by Marmont [21]. As indicated above, in addition to replacement of host stem cells which may be genetically susceptible to develop a particular autoimmune disorder, alloBMT may provide additional potential benefits against selfreactive lymphocytes that may escape chemoradiotherapy. Immunotherapy of autoimmunity by alloreactive donor lymphocytes is mediated by recognition of minor histocompatibility antigens on the cell surface of host lymphocytes by immunocompetent donor T cells. Immunotherapy mediated by donor lymphocyte infusion (DLI) is the most important therapeutic component in the course of alloBMT, also due to elimination of residual host cells by donor alloreactive T cells [26, 27]. It is therefore important to understand the principles of immunotherapy in leukemia, also mediated by DLI, including elimination of normal and malignant lymphocytes by donor T cells, as a model
for documenting the feasibility of ablation of host immune cells by alloreactive donor T cells through a process of graft vs leukemia (GVL) like effects [26, 27]. We have previously established the feasibility of reversing relapse following alloBMT in patients conditioned with myeloablative chemoradiotherapy by DLI [26, 27]. Out data suggests that the major therapeutic component of alloBMT can be attributed to immunocompetent donor T lymphocytes recognizing and eliminating tumor cells of host origin. We have recently demonstrated that similar graft vs host hematopoietic cells, lymphocytes included, may be observed also in patients with nonmalignant disorders, such as genetic diseases (beta thalassemia major) and enzyme deficiency disorders (Gaucher's disease, Hurler's syndrome, etc.) [28, 29]. Therefore, in addition to effective eradication of host-derived hematopoietic cells, we suggest that allogeneic cellmediated immunotherapy (alloCT) inducible with DLI, may also be used to eliminate host-type lymphocytes and genetically susceptible stem cells, autoreactive immune cells included. Hence, the use of alloBMT may be eventually recommended for more effective treatment of severe autoimmune disorders due to combination of the following principles: (1) Elimination of self-reactive lymphocytes with myeloablative chemoradiotherapy; (2) Elimination of genetically susceptible host stem cells and replacement with genetically more resistant stem cells; (3) Re-induction of self-tolerance from uncommitted stem cells, provided that a T-cell-deleted allograft was used or GVHD otherwise controlled; and (4) Elimination of residual self-reactive cells of host origin may be accomplished in patients with no GVHD following transplantation of CD34 enriched stem cells or T-cell-depletion by DLI. Graft vs autoimmunity may be accomplished with no additional DLI in patients receiving a non-T-celldepleted allograft, since there are sufficient T cells in the graft, especially when mobilized stem cells are used, similarly to the procedures used for prevention/treatment relapse [26, 27, 30]. Unfortunately, alloBMT is still considered a risky procedure that may not be yet justified as a routine procedure for patients with autoimmune diseases, especially due to the risks of acute and chronic GVHD, which as of todate can be neither safely prevented nor
adequately treated. It so happens that T-cell-depletion, which appears to be the only method for effective prevention of GVHD, is frequently associated with increased incidence of graft rejection, which further requires intensification of chemoradiotherapy required for prevention of graft rejection as well as using larger stem-cell inocula, to compensate for lack of donor T cells that are known to facilitate graft acceptance [31, 32].
4. AUTOIMMUNE MANIFESTATIONS FOLLOWING autoBMT In 1979, Rappaport et al. [33] described a syndrome of acute graft versus host disease in recipients of syngeneic bone marrow. Subsequently syngeneic GVHD induced by administration of a short course of low dose CSA was reported in rats [34, 35]. A similar occurrence of syngeneic GVHD was also reported in mice [36]. Apparently, induction of syngeneic GVHD in mice may be more difficult to accomplish because other investigators failed to reproduce these results in mice despite repeated efforts [37]. Spontaneous autologous GVHD was also described in man [38-40]. All of the above suggest that under normal circumstances immunoregulatory mechanisms may play an important role in controlling antiself-responses during the ontogeny of T-cell repertoire in the adult host following transplantation of autologous stem cells. The feasibility of induction of autologous GVHD and the existing data in support of direct relationship between GVHD and GVL brought hope that autologous GVHD may be useful for induction of GVL. Indeed, recently, autologous GVHD induced by CSA has been employed in an attempt to control residual disease following autoBMT [41,42] but no objective conclusions or direct measurements possible regarding antileukemic effects and improvement in disease free survival have been reported. Clinical manifestations indistinguishable from GVHD by clinical and pathologic parameters in patients undergoing syngeneic or even autoBMT suggests that imbalance of the reconstituting immune system resulting in antiself-responses may be further exploited in attempt to induce similar GVL or graft vs tumor (GVT) effects in conjunction with minimal residual disease induced by high-dose chemoradiotherapy. Unfortunately, in our own experiments in mice inoculated with murine B-cell leukemia, we failed to
411
show any measurable GVL effects [43]. However, in principle, antitumor responses may be elicited even against weakly immunogenic tumor cells, similarly to antiself-reactivity in autoimmune diseases. Since GVHD correlates with GVL following alloBMT, it remains to be seen whether the untoward autoimmunelike GVHD observed after autologous or syngeneic BMT can be translated to beneficial GVL effects. In this regards, our data suggest that it is not the GVHD per se that induces GVL, but rather donor T cells that can recognize residual tumor cells in the host as alloantigens can be effective in inducing GVL.
5. ALLOIMMUNE OR "AUTOIMMUNE-LIKE" MANIFESTATIONS FOLLOWING alloBMT GVHD is a systemic disease caused by T cells in donor bone marrow attacking antigen-presenting cells and tissues of host origin, often causing acute morbidity and mortality during the first few weeks postBMT. Chronic GVHD may develop several months after BMT. Therefore, GVHD is in fact a purely iatrogenic "autoimmune-like" disease that may affect almost every tissue, with skin, gastrointestinal tract and liver being the primary candidates. Indeed, chronic active hepatitis, vasculitis, autoimmune neuropathies and autoimmune thrombocytopenia, anemia and leukopenia are rather frequent complications. Chronic GVHD may also mimic lichen planus in the mucous membranes, ophthalmoxerostomia (Sjogren's sicca syndrome) and focal or systemic progressive sclerosis (scleroderma), chronic active hepatitis and SLE, to name just a few of the clinical syndromes that may result from acute and chronic GVHD. Interestingly, some of the symptoms are alloimmune (e.g., chronic active hepatitis) whereas others, as will be detailed below, are autoimmune (e.g., reactivity against hematopoietic cells of donor origin in the course of GVHD). In most centers, the incidence of GVHD is still very high, despite the use of various drugs to prevent GVHD, with acute GVHD observed in 50-70% of patients, with severe or occasionally fatal outcome in approximately 20-30% and 10% of the recipients, respectively. Once severe GVHD occurs, there is no effective cure.
412
One possible method to control GVHD while retaining the benefits of donor T cells may include T-cell-depletion at the time of alloBMT, to prevent immediate GVHD while avoiding post-transplant immunosuppressive agents, followed by late infusions of donor blood lymphocytes given in graded increments while controlling for GVHD [27]. Administration of graded increments of DLI as has been used for prevention of relapse in high-risk patients [30]. Several new approaches are currently in the pipelines for down-regulation of donor antihost responses by selective elimination of effector T-cell subsets, regulation of antihost reactivity by veto of alloreactive T cells or using genetically engineered T cells that harbor a suicide gene that can be used to limit their life span [44]. In addition, we have recently developed a new regimen for alloBMT based on the use of nonmyeloablative stem-cell transplantation (NST) [29]. Such a modality, which focuses on elimination of host lymphocytes to prevent rejection, rather on myeloablative therapy, may provide a safer protocol for patients with autoimmune diseases that may be candidates for alloBMT.
6. AUTOIMMUNE MANIFESTATIONS FOLLOWING alloBMT The pathogenesis of autoimmune manifestations postalloBMT may be related to transfer of abnormal Band T-cell clones from the donor or to dysregulation of the newly developing immune system of donor origin in the host across minor or major histoincompatibility barriers, frequently further perturbed by immunosuppressive agents administered to prevent or treat GVHD. The general immune imbalance seen during the first period following alloBMT, which may last several years, may contribute to an acceleration of autoimmune manifestation including organ specific autoimmune dysfunction. In addition cytomegalovirus (CMV) or possible other viral infections have been suggested to be possible important etiologies that may be associated with certain autoimmune phenomena post-alloBMT [45]. CMV disease is associated with various autoimmune manifestations including autoimmune hemolytic anemia, autoimmune granulocytopenia and the formation of autoantibodies [46]. It was found that CMV induces a CD13-specific autoimmunity. CMV-associated host protein CD 13 is immuno-
genie during CMV infeetion in alloBMT [45]. Moreover, CMV-induced CD 13-specific autoimmunity contributes to tissue damage in chronic graft vs host disease (cGVHD) [46]. A specific response against autoantigens associated with infectious virus particles was recently also suggested as a possible mechanism to explain virus-induced autoimmune manifestations. Several autoimmune manifestations have been described following alloBMT. To start with, cGVHD may be considered as an autoimmune disease or rather iatrogenic autoimmune-like disease [47]. Patients with cGVHD suffer from symptoms of xerostomia and xerophtalmia, which are indistinguishable from Sjogren's syndrome, a known autoimmune disorder [4850]. In this syndrome, autoreactive T cells (with slight predominance of CD8+ over CD4+ cells are infiltrating the major salivary glands and autoreacting against ductal epithelial cells expressing HLA-DR antigens [48]. In addition, cGVHD bears clinical similarities to connective tissue diseases, which are characterized by a spectrum of autoantibody formation [49]. The most common autoantibody detected in cGVHD patients is IgM anticytoplasmic factor occurring in 37% of the patients with cGVHD following alloBMT [49]. Thrombocytopenia and lymphopenia are known manifestations of cGVHD, even when all hematopoietic cells are of donor origin. In addition to immune thrombocytopenia, autoimmune hemolytic anemia and autoimmune neutropenia have been reported following alloBMT independently of cGVHD [51-56]. Lee et al. [51] reported a 38-year-old man who developed idiopathic thrombocytopenic purpura (ITP) 8 months following alloBMT, responding to intravenous anti-D immunoglobulin. Autoimmune destruction of platelets has been suggested as a possible mechanism and positive antiplatelet autoantibodies have been reported [52]. In some of the cases, the antiplatelet autoantibodies have been attributed to clonal B-cell expansion, demonstrated by using the immunoglobulin heavy chain rearrangement PCR technique [52]. Increased susceptibility to infections post-alloBMT may result in polyclonal antibody responses, like chronic inflammation, which may be associated with autoimmune syndromes that may be caused by cross-reacting pathogenic antigens. Antibody mediated neutropenia has been also reported post-alloBMT [53]. This syndrome which is distinct from conventional graft rejection, should be included in the differential diagnosis of neutrope-
nia following alloBMT. In contrast to post-alloBMT neutropenia due to graft rejection, intrinsic stemcell failure, infections, GVHD, relapse or druginduced myelosuppression antibody-mediated neutropenia usually responds well to treatment with corticosteroids, plasma exchange, and intravenous immunoglobulin or splenectomy [53]. Autoimmune hemolytic anemia has also been reported following alloBMT. In some cases, autoimmune pancytopenia including autoimmune thrombocytopenia, neutropenia and anemia have been reported [54]. The autoimmune pancytopenia may be due to transfer of antibodies of donor origin and may thus respond to immunosuppressive therapy [55]. Autoimmune hemolytic anemia due to warm antibodies lasting 15 months following alloBMT was reported in a 10-year-old boy with familial WiskottAldrich syndrome [56]. Interestingly, this patient developed a second possible autoimmune manifestation, autoimmune adrenal insufficiency, characterized with diarrhea, fatigue, polyuria and hyperpigmentation of the skin and mucosa as well as electrolyte imbalance and absent Cortisol response to adrenocorticotropic hormone (Addison disease) with positive adrenal antibodies 10 years later [56]. Addison disease is only one example of autoimmune endocrinopathy that have been reported following alloBMT. The most prevalent autoimmune endocrinopathy following alloBMT is autoimmune thyroid abnormalities [57-60]. The most common finding is compensated hypothyroidism with elevated TSH and normal T3 and T4 levels [57, 58]. Clinical hypothyroidism occurs in 1.1% of the patients post-alloBMT usually in the first 2 years post-transplant and in some cases it is associated with cGVHD [57]. In other cases, autoimmune thyroiditis is associated with other autoimmune diseases [59]. Kishimoto et al. [60] reported a case of autoimmune hyperthyroidism post-alloBMT in a patient who previously developed another autoimmune disease, palmoplantar pustular psoriasis. In some of the cases, the autoimmune hypothyroidism was due to anti-thyroglobulin antibodies that did not exist pre-BMT and was transferred from the donor to the recipient by the alloBMT. The donor may have no history of thyroid diseases and shown normal thyroid function while being positive for antithyroglobulin antibodies indicating a subclinical state [59]. Autoimmune thyrotoxicosis has also been reported post-alloBMT [60]. In some of these cases, no
413
autoimmune thyroid disease could be suspected prior to alloBMT and it is therefore conceivable that thyrotoxicosis resulted from transplantation of an abnormal clone of lymphocytes predisposed to the production of thyroid-stimulating autoantibodies, or alternatively, that genetically susceptible donor lymphocytes may have been stimulated by host antigens that may be released due to transplantation-induced tissue damage [58, 60]. Another example of organ specific autoimmune dysfunction post-alloBMT is type-I diabetes, which has been reported to be transferred by donor stem cells to the recipient in the course of alloBMT [61-63]. In one of the reported cases, both the male donor and HLA identical female recipient had insulin-dependent diabetes. The recipient was positive for islet cell antibodies post-alloBMT while negative results were obtained pre-alloBMT. Chimerism studies demonstrated 100% donor male cells, indicating transfer of insulin-dependent diabetes by the donor bone marrow cells as was also shown in experimental animals, indicating that spontaneous autoimmunity may be entirely a stem-cell disease [13]. Additional rare autoimmune manifestations that have been reported following alloBMT are: immunodeficiency that was associated with autoreactive T-cell receptor gamma delta-bearing lymphocytes [64], antiphospholipid syndrome [65] and cold agglutinin disease in which the pathogenic protein was monoclonal IgM-kappa with anti-Pr antigen specificity, probably derived from the engrafted donor lymphocytes [66]. Myasthenia gravis or related acute inflammatory demyelinating polyneuropathy is a devastating autoimmune disease also described following alloBMT [67-70]. In most but not all the reported cases, the underlying disease is severe aplastic anemia and most of the cases also suffered from cGVHD [67-69]. Other underlying diseases were CML and ALL [67]. In most of the cases, the diagnosis of myasthenia gravis was made based on clinical symptoms (proximal muscle weakness and ptosis) and the presence of antiacetylcholine receptor antibodies [67]. The haplotypes HLA B7, B35 and DR2 were commonly associated with such disease manifestations [67-69]. The stem-cell donor may have no history of myasthenia gravis, while being positive for antiacetylcholine receptor antibody, indicating a subclinical or rather genetic susceptibility that may be expressed under favorable conditioning of immune instability in the recipient. In most of the
414
cases, the recipient was negative for the antiacetylcholine receptor antibody prior to alloBMT, indicating adoptive transfer to the recipient by the alloBMT procedure. Another autoimmune neurological disease that was described following alloBMT is acute inflammatory demyelinating polyneuropathy resulting from autoreacting T cells that were probably sensitized in the host against peripheral nervous system myelin [70].
7. THE USE OF alloBMT FOR THE TREATMENT OF CANCER Allogeneic blood or marrow transplantation is the most effective modality to date to eradicate hematologic malignancies in patients at high risk to relapse or resistant to conventional doses of chemoradiotherapy. A standard autoBMT as well as alloBMT appear most suitable in patients with hematologic malignancies and solid tumors sensitive to chemoradiotherapy, since the rescue procedure enables administration of higher than conventional doses of cytoreductive antitumor agents. Following myeloablative chemoradiotherapy supported by autoBMT, however, the rate of anticipated relapse is much higher due to the lack of graft versus leukemia (GVL) effects mediated by alloreactive donor-derived T cells [71]. A number of approaches are available to improve antitumor effects induced by donor T cells, including the use of no or low doses of post-transplant immunosuppressive agents which may help resident T cells to induce their antitumor effects [72-74]. However, this approach has already been proven to be relatively hazardous since recipients of fully matched marrow allografts, let alone less than perfectly matched allografts or matched unrelated allografts, may develop GVHD which may be associated with immediate and late complications with the risk of lethal outcome. Since the GVL effects are mediated by donor alloreactive T cells, GVL effects can also be induced for prevention or treatment of established relapse by administration of DLI [75, 76]. Allogeneic cell-mediated immunotherapy (alloCT) by DLI can be administered in graded increments of donor-derived peripheral blood lymphocytes in order to allow better control of GVHD [76]. We [77, 78] and others [79] have previously documented that by increasing the time interval between
alloBMT and DLI resistance to GVHD increases as well, therefore recipients may occasionally be able to safely receive large inocula of donor-derived PBL with a marked graft versus leukemia (GVL) capacity while completely avoiding severe GVHD. Furthermore, we have recently documented that host-type tumor cells resistant to DLI may still respond to unstimulated or in vitro activated lymphocytes supported in vivo by a short course of well tolerated doses of rIL-2 [76, 78]. The same rational was already successfully applied in clinical practice, as recently shown in a cohort of patients with a variety of hematologic malignancies relapsing following alloBMT [76]. Taken together, our data suggest that alloCT, especially when antileukemia effector cells are activated by rIL-2, may develop into a very effective modality for both treatment and prevention of relapse in patients with resistant disease [75, 76] or at high risk to relapse [80]. The marked therapeutic benefits of alloCT induced by DLI always carry the risk of GVHD, with an incidence and severity that are unpredictable. As such, GVHD is in fact an iatrogenic "autoimmune disease" which may attack in principle any organ or tissue. New approaches to limit the life span of donor-derived T cells in case of uncontrolled GVHD are currently under development. The most promising modality for controlling GVHD, and its incidence after discontinuation of anti-GVHD prophylaxis, is the use of donor T cells transduced with the herpes simplex virus thymidine kinase gene [81]. Genetically modified T cells of donor origin still retain their GVL capacity. Hence, in the event of uncontrolled GVHD these antitumor effector cells can be successfully eliminated by administration of conventional doses of ganciclovir [81]. The feasibility to eliminate safely and consistently GVHD induced intentionally by donor lymphocytes to enhance GVL effects may pave the way for using DLI to treat hematologic malignancies and maybe metastatic solid tumors not curable by any of the currendy available modalities. GVL or possibly the graft versus tumor effect (GVT) of fully mismatched cells that could possess a more effective antitumor potential may be intensified. GVL as well as GVT effects initiated by DLI are most likely induced by the minor histocompatibihty complex (MiHC) and major histocompatibility complex (MHC) incompatibility which may determine the cytotoxic T-lymphocyte precursor activity, as implied by recent investigations in experimental animals and man.
The first successful clinical trials introducing DLI for both the treatment or for prevention of relapse following alloBMT were carried out at Hadassah in Jerusalem, in early 1987 [76]. Our data were subsequendy confirmed in prospective studies in Europe [82] and the USA [83]. Since GVL effects mediated by donor lymphocytes constitute the main therapeutic effect against malignant tumor cells of host origin, we asked whether or not equally potent GVL effects might be inducible following nonmyeloablative stem-cell transplantation, or in other words, can standard alloBMT be replaced by nonmyeloablative conditioning? Accordingly, we have recently developed a new approach to the therapy for diseases treatable by conventional alloBMT, focusing on the use of donor T cells to eradicate malignant and also nonmalignant cells of host origin, thus avoiding the need for myeloablative conditioning [84]. Our protocol was based on minimizing the intensity of the conditioning regimen to the range of nonmyeloablative treatment, followed by infusion of G-CSF-mobilized donor stem cells enriched with circulating T lymphocytes collected by apheresis. The main focus is on intensive short-term immunosuppression with fludarabine and antithymocyte globulin (ATG) with low-dose oral busulfan (8 mg/kg) prior to infusion of blood stem cells. GVL effects were mediated initially by the large number of donor-derived immunocompetent T lymphocytes given together with donor stem cells. GVL effects could be subsequently increased with alloCT by DLI on an outpatient basis. Our preliminary data in nearly 50 patients with standard indications for allogeneic BMT, namely, acute leukemia; chronic leukemia; non-Hodgkin's lymphoma; myelodysplastic syndrome and multiple myeloma indicate that the nonmyeloablative conditioning is extremely well tolerated, with no severe procedure-related toxicity. Transplantation of G-CSF mobilized blood stem cells, with a short course of low dose cyclosporin A as the sole anti-GVHD prophylaxis, resulted in stable partial or complete chimerism in all recipients. In some patients the absolute neutrophil count (ANC) did not decrease below 0.1 x 10^/L whereas some patients never experienced ANC < 0.5 X 10^/L. ANC > 0.5 > 10^/L was reached within 10-32 (median 15) days. Platelet counts did not decrease below 20 x 10^/L in 4 patients who required no platelet support at all; overall platelet counts >20 X 10^/L were achieved within a median of 12
415
days. Severe GVHD (grade III & IV) was the single major complication and the cause of death, in most of the cases only after early discontinuation of CSA. Relapse could frequently be reversed by alloCT. Successful eradication of malignant (as well as genetically abnormal host hematopoietic cells) by allogeneic nonmyeloablative stem-cell transplantation could represent a new approach for safer treatment of a large variety of clinical syndromes whenever an indication for alloBMT exists. Transient mixed chimerism which may protect the host from severe acute GVHD may be successfully reversed post-alloBMT, first by earlier discontinuation of CS A or with graded increments of DLIs late post-alloBMT, thus resulting in eradication of malignant or genetically abnormal progenitor cells of host origin. Our preliminary experience seems promising and suggests that allogeneic nonmyeloablative stem-cell transplantation may result in complete elimination of malignant or genetically abnormal host cells with no or minimal procedure-related toxicity and mortality [84]. For young patients, in contrast to myeloablative allogeneic BMT, allogeneic nonmyeloablative stem-cell transplantation may reduce the incidence of growth retardation and infertility which stems from the unique sensitivity to chemoradiotherapy of the growth centers in the bones, the gonads and testicles. For elderly individuals with a matched donor available, who were denied alloBMT until recently, nonmyeloablative stem-cell transplantation may offer an option for cure with no upper age limit. It remains to be seen whether a similar therapeutic approach can be developed for patients with matched unrelated donors and for patients with no matched donors, as well as for malignancies other than those originating in hematopoietic stem cells. The principle behind the new allogeneic nonmyeloablative stem-cell transplantation protocol, was to maximize transient immunosuppression with nonmyeloablative agents rather than attempt to eradicate all tumor cells or genetically abnormal stem cells which are expected to be eliminated over time by alloreactive T cells of donor origin. Based on our preliminary experience, that needs to be confirmed in a larger series of patients observed for a longer time period, major advantages are to be expected if it can be confirmed that allogeneic nonmyeloablative stem-cell transplantation can safely replace alloBMT. Perhaps even more important, the state of transient or stable
416
mixed chimerism that results from allogeneic nonmyeloablative stem-cell transplantation may eventually help in designing strategies to better control GVHD. One of the questions that needs to be answered is whether, or not, similar GVT effects can be induced against metastatic solid tumors. Several years ago, we used allogeneic BMT to prevent spontaneously occurring lymphosarcoma in (NZBxNZW)Fl mice [85]. Interestingly, effective GVT effects, similar to GVL were documented despite the complete lack of host versus graft and graft versus host responsiveness. Subsequently, we induced GVT effects in a murine model of a transplantable metastasizing mammary solid tumor, resembling human disease (4T1) [86]. The presence of GVT effects was investigated by inoculating 4T1 cells into chimeric mice reconstituted with MiHC or MHC incompatible marrow allografts [86]. Intravenously inoculated pulmonary metastases that resulted in typical widespread lethal disease in all untreated BALB/c or Fl recipients, were completely eliminated following inoculation into DBA/2^BALB/c or C57BL/6-^Fl chimeras (Morecki and Slavin, submitted for publication). Elimination of all metastatic cells was confirmed by adoptive transfer of single-cell suspensions of lung cells obtained from inoculated controls and chimeras, the former, in contrast to the latter, resulting in death of 100% of the secondary recipients. Our data imply that in this animal model allogeneic cells in a stable chimera resisted breast cancer cell metastases. The existence of a GVT effect in a murine model of mammary carcinoma, suggests the possible use of allogeneic cell therapy for prevention and/or treatment of relapse in patients with metastatic breast cancer and possibly other solid tumors, similarly to the already proven GVL effects in hematologic malignancies. We have recently documented possible antitumor responses in 6 patients with documented metastatic breast cancer relapsing following autologous blood stem-cell transplantation, treated with donor lymphocytes obtained from an HLA-matched sibling [87]. Donor lymphocytes were activated with rIL-2 in vitro and in vivo. One of the patients treated with no evidence of disease at the time of alloCT is still event-and disease-free over 5 years past therapy. None of the data presented here shows conclusive evidence for GVT effects comparable to GVL effects in patients with hematologic malignancies. However, in addition to the cumulative experience with blood cancer and the
murine data presented here, the possibility exists that GVT effects might be effective against metastatic solid tumors, especially against minimal residual disease.
8. CONCLUSIONS AND FUTURE DIRECTIONS The use of alloBMT and autoBMT for the treatment of otherwise resistant hematologic malignancies and and certain chemotherapy sensitive solid tumors, respectively, is well established. Our recent observations suggest that GVL and possibly GVT effects may be amplified with alloCT mediated by donor alloreactive lymphocytes which could be further activated with rIL-2. Furthermore, we suggest that equally effective GVL and possibly GVT effects may be induced with a safer alloBMT procedure following nonmyeloablative conditioning, which could open new and safer therapeutic options for patients in need of alloBMT at all age groups. Furthermore, we suggest that many of the benefits that can be accomplished with autoBMT and alloBMT may be applicable for patients with life-threatening autoimmune disorders. Experiments carried out in animal models of human autoimmune disorders suggests that disease manifestations and immunological processes leading to the development of autoimmunity may be reversed by cytoreductive therapy followed by either syngeneic, autologous or preferably allogeneic stem-cell transplantation. Whereas following experimental induction of autoimmunity in animals without pre-existing genetic susceptibility, complete cure and resistance against re-establishment of the autoimmune process can be accomplished following syngeneic stem-cell transplantation, animals with genetic susceptibility and spontaneous autoimmunity may best benefit from alloBMT. The available data suggest that some patients may benefit from autoBMT, preferably T-celldepleted to prevent reinfusion of autoreactive cells, others may require alloBMT for complete eradication of disease manifestation and especially for complete prevention of recurrence of the basic autoimmune process. Clearly, following autoBMT, it seems rational to maximize T-cell-depletion in vivo as well as use purified uncommitted stem cells to prevent disease recurrence from autoreactive lymphocytes introduced with the stem cells.
In considering alloBMT for the treatment of autoimmunity, cumulative data from a cohort of patients treated successfully with alloNST suggests that a lower intensity of nonmyeloablative yet sufficiently immunosuppressive conditioning may be sufficient to provide a window of opportunity for induction of host vs graft transplantation tolerance as a platform for subsequent elimination of residual host hematopoietic cells by alloreactive donor lymphocytes in the course of alloNST or later on an outpatient basis as part of an alloCT program with graded increments of DLI while controlling for GVHD. Future developments using protocols with reduced toxicity and improved efficacy, particularly preventing GVHD by T-cell-depletion and/or stem cell (CD34+) purification, combined with future procedures for better host tolerization to the T-cell-depleted allograft, or alternatively gradual tolerization of donor T cells to the host by using graded increments of donor lymphocytes for continuous eradication of host derived immune cells over a longer period of time, similarly to prevention of relapse in patients with hematologic malignancies, are likely to increase the indication and success rate in utilizing stem-cell transplantation for the treatment of autoimmune diseases which at the present time must be restricted only for patients with severe and Hfethreatening clinical condition in patients resistant to all available modalities.
ACKNOWLEDGEMENTS We thank Baxter International Corporation and The Rich Foundation for supporting our ongoing basic and clinical research in cell therapy. The work was supported by Ryna and Melvin Cohen and carried out in the Max Moss Leukemia Research Laboratory established and supported by his devoted wife Adi Moss. The authors wish to thank Schering AG and Fresenius AG for supporting the clinical research.
REFERENCES 1.
Slavin S. Successful treatment of autoimmune disease in (NZB/NZW)F1 female mice by using fractionated total lymphoid irradiation. Proc Natl Acad Sci USA 1979;76:5274-5276.
417
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
418
Moscovitch M, Rosenmann E, Neeman Z, Slavin S. Successful treatment of autoimmune manifestations in MRL/1 and MRL/n mice using total lymphoid irradiation (TLI). Exp Molec Pathol 1983;38:33-47. Slavin S. Treatment of life threatening autoimmune diseases with myeloablative doses of immunosuppressive agents and autologous bone marrow transplantation—rationale and experimental background. Bone Marrow Transplant 1993;12:85-88. Karussis DM, Slavin S, Ben-Nun A, Ovadia H, Vourka-Karussis U, Lehmann D, Mizrachi-Kol R, Abramsky O. Chronic-relapsing experimental autoimmune encephalomyelitis (CR-EAE): treatment and induction of tolerance, with high dose cyclophosphamide followed by syngeneic bone marrow transplantation. J Neuroimmunol 1992;39:201-210. Karussis DM, Slavin S, Lehmann D, Mizrachi-Koll R, Abramsky O, Ben-Nun A. Prevention of experimental autoimmune encephalomyelitis and induction of tolerance with acute immunosuppression followed by syngeneic bone marrow transplantation. J Immunol 1992;148:1693-1698. Knaan-Shanzer S, Houben P, Kinwel Bohre EPM, Bekkum DW. Remission induction of adjuvant arthritis in rats by total body irradiation and autologous bone marrow transplantation. Bone Marrow Transplant 1992;8:333-338. Slavin S, Karussis D, Weiss L, Vourka-Karussis U, Abramsky O. Immunohematopoietic reconstitution by allogeneic and autologous bone marrow grafts as a means for induction of specific unresponsiveness to donor-specific allografts and modified self in autoimmune disorders. Transplant Proc 1993;25:1274-1275. Karussis DM, Vourka-Karussis U, Lehmann D, Abramsky O, Ben-Nun A, Slavin S. Successful treatment of autoimmunity in MRL/lpr mice with Tcell depleted syngeneic bone marrow transplantation. EOS 1993:XIII:78-79. Slavin S, Karussis DM, Weiss L, Karussis-Vourka U and Abramsky O. Induction of tolerance to alio and self-antigens with syngeneic bone marrow transplantation. Transplant Proc. 1993;25:1274-1275. Karussis DM, Vourka-Kanissis U, Lehmann D, Abramsky O, Ben-Nun A, Slavin S. Immunomodulation of autoimmunity in MRL/lpr mice with syngeneic bone marrow transplantation (SBMT). Clin Exp Immunol 1995;100:111-117. Blank M, Tomer Y, Slavin S, Shoenfeld Y. Induction of tolerance to experimental anti-phospholipid syndrome (APS) by syngeneic bone marrow cell transplantation. Scand. J. Immunol 1995;42:226234. Ikehara S. The prospects for BMT-from mouse to human. In: Ikehara S, Takaku F, Good RA, eds.. Bone
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
Marrow Transplantation. Basic and Clinical Studies. Tokyo-Singapore: Springer-Verlag 1996;302-331. Drakos P, Nagler A, Or R. Case of Crohn's disease in bone marrow transplantation (letter to the editor) Am J Hematol 1993;43:157-157. Nelson JL, Torrez R, Miu Louie F, Choe OS, Strob R, Sullivan KM. Pre-existing autoimmune disease in patients with long-term survival after allogeneic bone marrow transplantation. J Rheumatol 1997;24(suppl 48): 23-29. Sullivan, KM, Furst, DE. The evolving role of blood and marrow transplantation for the treatment of autoimmune diseases. J Rheumatology \991\2A:\-A. Van Bekkum DW, Marmont AM, Tyndall A, Vriesendorp FJ, Apatoff BJ. Severe autoimmune disease: a new target for bone marrow transplantation. Stem Cells 1996;14:460-472. Marmont AM. Immune ablation followed by allogeneic or autologous bone marrow transplantation: a new treatment for severe autoimmune disease? Stem Cells 1994;12:125-135. McAllister LD, Beatty PG, Rose J. Allogeneic bone marrow transplant for chronic myelogenous leukemia in a patient with multiple sclerosis. Bone Marrow Transplant 1997;19:395-397. Fassas A, Anagnastopoulos A, Kazis A. Peripheral blood stem-cell transplantation in the treatment of progressive multiple sclerosis: first results of a pilot study. Bone Marrow Transplant 1997;20:631-638. Marmont AM: Stem cell transplantation for severe autoimmune disorders, with special reference to rheumatic diseases. J Rheumatol 1997;24(suppl 48):13-1. Marmont, A.M. Stem cell therapy for severe autoimmune disease: The present situation. J Hellenic Soc Haematol 1998;1:1-30. Burt RK, Burns W, Hess A: Bone marrow transplantation for multiple sclerosis. Bone Marrow Transplant 1995;16:1-6. Zan-Bar I, Slavin S, Strober S. Induction and mechanism of tolerance to bovine serum albumin after total lymphoid irradiation (TLI). J Immunol 1978;121:1400-1404. Zan-Bar I, Barzilay M, Moscovitch M, Slavin S. Regulation of the immune response in experimental models of autoimmune disorders: resistance of (NZBxNZW)Fl mice to tolerance induction in vivo. Clin Exp Immunol 1983;51:558-564. Kieselow P, Bluethmann H, StaerzUD, Steinmetz M, Von Boehmer H. Tolerance in T cell receptor transgenic mice involves deletion of nonmature thymocytes. Nature 1988;333:742-746. Slavin S, Naparstek E, Nagler A, Ackerstein A, Kapelushnik Y, Or R. Allogeneic cell therapy for
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
relapsed leukemia following bone marrow transplantation with donor peripheral blood lymphocytes. Exp Hematol 1995;23:1553-1562. Slavin S, Naparstek E, Nagler A, Ackerstein A, Samuel S, Kapelushnik J, Brautbar C, Or R. Allogeneic cell therapy with donor peripheral blood cells and recombinant human interleukin-2 to treat leukemia relapse post allogeneic bone marrow transplantation. Blood 1996;87:2195-2204. Aker M, Kapelushnik J, Pugatsch T, Naparstek E, Nagler A, Ben-Naria S, Yehuda O, Amar A, Slavin S, Or R. Donor lymphocyte infusions to displace residual host hematopoietic cells after allogeneic BMT for beta thalassemia major. J Ped Hematol/Oncol 1998;20:145-148. Slavin S, Nagler A, Naparstek E, Kapelushnik Y, Aker M, Cividalli G, Varadi G, Kirschbaum M, Ackerstein A, Samuel S, Ben-Tal O, Eldor A, Or R. Non-myeloablative stem-cell transplantation and cell therapy as an alternative to conventional bone marrow transplantation with lethal cytoreduction for the treatment of malignant and non-malignant hematologic diseases. Blood 1998;91:756-763. Naparstek E, Nagler A, Or R, Slavin S. Allogeneic cell mediated immunotherapy using donor lymphocytes for prevention of relapse in patients treated with allogeneic BMT for hematological malignancies. Clin Transplant 1996;281-290. Reisner Y, Martelli MP. Bone marrow transplantation across HLA barriers by increasing the number of transplanted cells. Immunol Today 1995; 16:437. Bachar-Lustig E, Rachamim N, Li HW, Lan F, Reisner Y. Megadose of T cell- depleted bone marrow overcomes MHC barriers in sublethally irradiated mice. Natl Med 1995;1:1268. Rappaport J, Mihm M, Reinherz E, Lopansri S, Parkman R. Acute graft versus host disease in recipients of bone marrow transplants from identical twin donors. Lancet. 1979;2:717-720. Glazier A, Tutschka PJ, Farmer ER, Santos GW. Graft versus host disease in Cyclosporine A treated rats after syngeneic and autologous bone marrow reconstitution. J Exp Med 1983;158:1. Beschorner WE, Shinn CA, Fischer AC, Santos GW and Hess AD. Cyclosporine-induced pseudo-graft-vshost disease in the early post-cyclosporine period. Transplant 1989;46(suppl):112S-117S. Cheney RT, Sprent J. Capacity of CSA to induce autologous GVHD and impair intrathymic T cell differentiation. T Proceedings 1985;18(1):528530. Chow LH, Mosbach-Ozmen Laurence, Ryffel B, Borel JF. Syngeneic GVHD induced by CSA: a reappraisal. Transplantation 1988;46:1075-1125.
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
50.
Jones RJ, Vogelsang GB, Hess AD. Induction of GVHD after autologous BMT. Lancet 1989; 1:754757. Rizzoli V, Carella AM. Autologous marrow transplantation in ALL: Control of residual disease by masfosfamide and induction of syngeneic GVHD with cyclosporin. Bone Marrow Transplant 1990;6(suppl l):76-78. Yeager AM, Vogelsang GB, JMS RJ. Induction of cutaneous GVHD by administration of CSA in 8 pts undergoing autolgous BMT for AML. Blood. 1992;79:3031-3035. George AJT and Stevenson FK. Prospects for the treatment of B cell tumours using idiotypic vaccination. Int Rev Immunol 1989;4:271-310. Rappaport J, Mihm M, Reinherz E, Lopansri S, Parkman R. Acute graft versus host disease in recipients of bone marrow transplants from identical twin donors. Lancet 1979;2:717-720. Mehta S, Vourka-Karussis U, Mehta J, Shimon S, Weiss L. Failure of cyclosporine to induce graftvs-host disease or graft-vs-leukemia after syngeneic BMT in mice. Leukemia Res 1996:20;941-946. Bonini C, Ferrari G, Verzeletti S, Srvida P, Zappone E, Ruggieri L, Ponzoni M, Rossini S, Mavilio F, Traversari C, Bordignon C. HSV-TK gene transfer into donor lymphocytes for control of allogeneic graft versus leukemia. Science 1997;276:1719-1724. Soderberg C, Larsson S, Rozell BL, SumitranKaruppan S, Ljungman P, Moller E. Cytomegalovirus-induced CD13-specific autoimmunity— a possible cause of chronic graft-vs-host disease. Transplantation 1996;61:600-609. Soderberg C, Sumitran-Karuppan S, Ljungman P, Moller E. CD 13—specific autoimmunity in cytomegalovirus-infected immunocompromised patients. Transplantation 1996 ;61(4): 5 94-600. Parkman R. Is chronic graft-versus-host disease an autoimmune disease? Curr Opin Immunol 1993;5(5):800-803. Hiroki A, Nakamura S, Shinohara M, Gondo H, Ohyama Y, Hayashi S, Harada Mm Niho Y, Oka M. A comparison of glandular involvememt between chronic graft-versus-host disease and Sjogren's syndrome. Int J Oral Maxillofac Surg 1996;25:298-307. Holmes JA, Livesey SJ, Bedwell AE, Amos N, Whittaker JA. Autoantibody analysis in chronic graft-versus-host disease. Bone Marrow Transplant 1989;4:529-531. Mencucci R, Rossi-Ferrini C, Bosi A, Volpe R, Guidi S, Slavi G. Ophtalmological aspects in allogeneic bone marrow transplantation: Sjogren-like syndrome in graft-vs-host disease. Eur J Ophtalmol 1997;7:1318.
419
51.
52.
53.
54.
55.
56.
57.
58.
59.
60.
61.
62.
420
Lee SJ, Churchill WH, Konugres A, Gilliland DG, Antin JH. Idiopathic thrombocytopenic purpura following allogeneic bone marrow transplantation— treatment with anti-D immunoglobulin. Bone Marrow Transplant 1997;19:173-174. Sivakumaran M, Hutchinson RM, Pringle H, Graham S, Primrose L, Wood JK, Lauder L Thrombocytopenia following autologous bone marrow transplantation: evidence for autoimmune aetiology and B cell clonal involvement. Bone Marrow Transplant 1995; 15:531536. Klumpp TR. Antibody-mediated neutropenia following bone marrow transplantation. Int J Clin Lab Res 1993;23:4-7. Bashey A, Owen I, Lucas GF, Amphlett NW, Jones MM, Lawal A, McMullin MF, Mahendra P, Tyfield LA, Hows JM. Late onset immune pancytopenia following bone marrow transplantation. Br J Haematol 1991;78:268-274. Klumpp TR, Caligiuri MA, Rabinowe SN, Soiffer RJ, Murray C, Ritz J, Caligiuri MA. Autoimmune pancytopenia following allogeneic bone marrow transplantation. Bone Marrow Transplant 1990;6:445^47. Latal-Hajnal B, Lips U, Friedrich W, Zachmann M, Berthet F. Addison disease 10 years after bone marrow transplantation for Wiskott-Aldrich syndrome. Eur J Pediatr 1995;154:729-731. Al-Fiar FZ, Colwill R, Lipton JH, Fyles G, Spaner D, Messner H. Abnormal thyroid stimulating hormone (TSH) levels in adults following allogeneic bone marrow transplants. Bone Marrow Transplant 1997;19:1019-1022. Wyatt DT, Lum LG, Casper J, Hunter J, Camitta B. Autoimmune thyroiditis after bone marrow transplantation. Bone Marrow Transplant 1990;5(5):357-361. Thomson JA, Wilson RM, Franklin IM. Transmission of thyrotoxicosis of autoimmune type by sibling allogeneic bone marrow transplantation. Eur J Endocrinol 1995;133:564-566. Kishimoto Y, Yamamoto Y, Ito T, Matsumoto N, Ichiyoshi H, Katsurada T, Date M, Ohga S, Kitajima H, Ikehara S, Fukuhara S. Transfer of autoimmune thyroiditis and resolution of palmoplantar pustular psoriasis following allogeneic bone marrow transplantation. Bone Marrow Transplant 1997; 19:10411043. Lampeter EF, Homberg M, Quabeck K, Schaefer UW, Wemet P, Bertrams J, Grosse-Wilde H, Gries FA, Kolb H. Transfer of insulin-dependent diabetes between HLA-identical siblings by bone marrow transplantation. Lancet 1993;341(8855):12431244. Vialettes B, Maraninchi D. Transfer of insulindependent diabetes between HLA-identical
63.
64.
65.
66.
67.
68.
69.
70.
71.
72.
73.
74.
75.
siblings by bone marrow transplantation. Lancet 1993;342:174. Lampeter EF, McCann SR, Kolb H. Transfer of diabetes type 1 by bone marrow transplantation. Lancet 1997;351:568-569. Bensussan A, David V, Vilmer E, Leca G, Boumsell L. Immunodeficiency after bone marrow transplantation can be associated with autoreactive T-cell receptor gamma delta-bearing lymphocytes. Immunol Rev 1990;116:5-13. Sohngen D, Hey 11 A, Meckenstock G, Aul C, Wolf HH, Schneider W, Specker C, Withold W. Antiphospholipid syndrome complicating chronic graft-versushost disease after allogeneic bone marrow transplantation. Am J Hematol 1994;47:143-144. Tamura T, Kanamori H, Yamazaki E, Ohtsuka M, Hataoka K, Maeda K, Okamoto R, Tanabe J, Fujita H, Hashimoto Y Cold agglutinin disease following bone marrow transplantation. Bone Marrow Transplant 1994;13:321-323. Shimoda K, Gondo H, Harada M, Sano T, Nakamura M, Otsuka T, Okamura S, Niho Y Myasthenia gravis after allogeneic bone marrow transplantation. Bone Marrow Transplant 1994;14:155-156. Melms-A, Faul C, Sommer N, Wietholter H, Muller CA, Ehninger G. Myasthenia gravis after BMT: identification of patients at risk? Bone Marrow Transplant 1992;9:78-79. Grau JM, Casademont J, Monforte R, Marin P, Granena A, Rozman C, Urbano Markez A. Myasthenia gravis after allogeneic bone marrow transplantation: report of a new case of pathogenetic considerations. Bone Marrow Transplant 1990;5:435-437. Eliashiv S, Brenner T, Abramsky O, Shahin R, Agai E, Naparstek E, Steiner I. Acute inflammatory demyelinating polyneuropathy following bone marrow transplantation. Bone Marrow Transplant 1991;8:315-317. Horowitz MM, Gale RP, Sondel PM, et al. Graftversus-leukemia reactions after bone marrow transplantation. Blood 1990;75(3):555-562. Sullivan KM, Storb R, Buckner CD, et al. Graftversus-host disease as adoptive immunotherapy in patients with advanced hematologic neoplasms. N Engl J Med 1989;320:828-834. Stockschlaeder M, Storb R, Pepe M, et al. A pilot study of low-dose cyclosporin for graft-versus-host prophylaxis in marrow transplantation. Brit J Haemat 1992;80:49-54. Bacigalupo A, van Lint MT, Occhini D, et al. Increased risk of leukemia relapse with high-dose cyclosporine A after allogeneic marrow transplantation for acute leukemia. Blood 1991;77:1423-1428. Slavin S, Naparstek E, Nagler A, Ackerstein A, Kapelushnik Y, Or R: Allogeneic cell therapy for
76.
77.
78.
79.
80.
81.
relapsed leukemia following bone marrow transplantation with donor peripheral blood lymphocytes. Exp Hematol 1995;23:1553-1562. Slavin S, Naparstek E, Nagler A, Ackerstein A, Samuel S, Kapelushnik J, Brautbar C, Or R. Allogeneic cell therapy with donor peripheral blood cells and recombinant human interleukin-2 to treat leukemia relapse post allogeneic bone marrow transplantation. Blood 1996;87:2195-2204. Slavin S, Fuks Z, Kaplan HS, Strober S. Transplantation of allogeneic bone marrow without graft vs host disease using total lymphoid irradiation. J Exp Med 1978;147:963-972. Weiss L, Reich S, Slavin S. Use of recombinant human interleukin-2 in conjunction with bone marrow transplantation as a model for control of minimal residual disease in malignant hematological disorders. I. Treatment of murine leukemia in conjunction with allogeneic bone marrow transplantation and IL2-activated cell-mediated immunotherapy. Cancer Invest 1992;10:19-26. Johnson BD, Drobyski WR, Truitt RL. Delayed infusion of normal donor cells after MHC-matched bone marrow transplantation provides an antileukemia reaction without graft-versus-host disease. Bone Marrow Transplant 1993;11:329-336. Naparstek E, Nagler A, Or R, Slavin S. Allogeneic cell mediated immunotherapy using donor lymphocytes for prevention of relapse in patients treated with allogeneic BMT for hematological malignancies. Clin Transplant 1996;281-290. Bonini C, Ferrari G, Verzeletti S, Srvida P, Zappone
82.
83.
84.
85.
86.
87.
E, Ruggieri L, Ponzoni M, Rossini S, Mavilio F, Traversari C, Bordignon C: HSV-TK gene transfer into donor lymphocytes for control of allogeneic graft versus leukemia. Science 1997;276:1719-1724. Kolb HJ, Mittermueller J, Clemm CH, et al. Donor leukocyte transfusions for treatment of recurrent chronic myelogenous leukemia in marrow transplant patients. Blood 1990;76:2462-2465. Collins RH Jr, Shpilberg O, Drobyski WR, et al. Donor leukocyte infusions in 140 patients with relapsed malignancy after allogeneic bone marrow transplantation. J CUn Oncol 1997;15:433. Slavin S, Nagler A, Naparstek E, Kapelushnik Y, Aker M, Cividalli G, Varadi G, Kirschbaum M, Ackerstein A, Samuel S, Ben-Tal O, Eldor A, Or R. Non-myeloablative stem-cell transplantation and cell therapy as an alternative to conventional bone marrow transplantation with lethal cytoreduction for the treatment of malignant and non-malignant hematologic diseases. Blood 1998;91(3):756-763. Moscovitch M, Slavin S. Anti-tumor effects of allogeneic bone marrow transplantation in (NZBxNZW) Fl hybrids with spontaneous lymphosarcoma. J Immunol 1984;132:997-1000. Morecki S, Yacovlev E, Diab A, Slavin S. Allogeneic cell therapy for a murine mammary carcinoma. Cancer Res 1998 (in press). Or R, Ackerstein A, Nagler A, Kapelushnik J, Naparstek E, Samuel S, Amar A, Brautbar C, Slavin. Allogeneic cell mediated immunotherapy for breast cancer after autologous stem-cell transplantation: A clinical pilot study. Cytokines, Cell Mol Ther 1998;4:1-6.
421
© 2000 Elsevier Science B.V. All rights reserved. Cancer and Autoimmunity Y. Shoenfeld and M. E. Gershwin, editors
Postchemotherapy Rheumatism David D'Cruz The Royal London Hospital, Whitechapel London
1. INTRODUCTION In the autoimmune rheumatic diseases, there is an undoubted relationship between rheumatoid arthritis (RA), systemic lupus erythematosus (SLE) and Sjogren's syndrome and the development of lymphomas. In the majority of these patients, the malignancies develop in patients who have had the connective tissue disease for long periods of time and the cumulative risk of developing lymphoma increases in a linear fashion with disease duration. The risk of subsequent lymphoma may be independent of the immunosuppressive agents used to treat these conditions, especially in SLE [1] but this is not so clear cut in RA where some studies suggest that immunosuppressives may be associated with an increased risk of lymphoma [2]. There is however little doubt about the toxicity of cyclophosphamide, especially long term oral therapy, in increasing the risk of leukaemias, lymphomas and bladder cancer [3].
2. CHEMOTHERAPY AND MUSCULOSKELETAL SYMPTOMS Many forms of malignancy are associated with musculoskeletal symptoms and these may be due to direct infiltration of bones, joints or muscles. Paraneoplastic syndromes may also involve the musculoskeletal system and several chapters in this book have already dealt with these phenomena. In the last 5 years, it has been noted that musculoskeletal symptoms may develop following combination chemotherapy for various malignancies, particularly breast cancer. Most of these patients were otherwise relatively healthy with no previous history of rheumatic symptoms.
The first report of this syndrome, termed "postchemotherapy rheumatism" by Loprinzi et al. [4], described 8 patients with breast cancer who all underwent postoperative adjuvant chemotherapy. These regimens were all cyclophosphamide based with the addition of either methotrexate and fluorouracil (CMF), or doxorubicin and fluorouracil (CAP). Two patients also had corticosteroids such as dexamethasone or prednisolone in the regimen. The mean age of these patients was 45 years and all experienced very similar clinical features. Between 2 and 16 months after completing the chemotherapy regimen, these patients experienced generafized myalgia, musculoskeletal aching and polyarthralgia. One patient had symptoms and signs suggestive of synovitis, others had mild peri-articular swelling and another additionally had palmar tenosynovitis and intense morning stiffness. In each case clinical evaluation failed to reveal an overt rheumatological condition. Serologically, one patient had a borderline ANA of 1:40, all were rheumatoid factor negative and the erthryocyte sedimentation rates were all normal. Importantly, bone scans done in 6 out of the 8 patients were normal. On the whole nonsteroidal antiinflammatory agents were ineffective and symptoms generally improved spontaneously after a few months. One patient responded rapidly to a short course of low dose prednisolone. Loprinzi et al. [4] felt that this syndrome represented a previously undescribed noninflammatory rheumatic disorder that was self-limiting. Although they had no data to support this, they felt that these symptoms could occur in as many as 5% of patients completing a combination chemotherapy regimen for breast cancer. This report produced a brisk correspondence and several further cases of postchemotherapy
423
rheumatism were described [5]. There were further reports of the syndrome occurring after chemotherapy for breast cancer but also following treatment for nonHodgkin's lymphoma [6, 7] as well as ovarian cancer [8]. A more recent series by Warner et al. [9] describes 23 women with breast cancer who developed postchemotherapy rheumatism bringing the total number of patients in the literature to 46. They described one group of 8 patients in whom there were no preexisting rheumatic symptoms, and a further 15 who had rheumatic complaints prior to chemotherapy but in whom the symptoms markedly worsened or new features appeared. Four patients in the first group developed a polyarthritis and 3 had fibromyalgia after chemotherapy. The most notable patient in the second group was a woman who had autoimmune haemolytic anaemia prior to her breast cancer but who developed systemic lupus erythematosus 15 years after oophorectomy and chemotherapy. The main difference from Loprinzi et al.'s report was that these patients had a poorer outcome with considerable reduction in functional status from the musculoskeletal symptoms that persisted for long periods of time. The pathogenesis of this postchemotherapy syndrome remains unclear. Various suggestions have included a "steroid withdrawal" effect or a chemotherapy induced menopause [7]. However, not all patients received corticosteroids in their chemotherapy regimen and some patients were postmenopausal or male making the latter hypothesis unlikely. One common factor to all the cases so far appears to be the use of cyclophosphamide and its place in combination chemotherapy regimens [8]. However, intravenous cyclophosphamide, often in high doses is used in the treatment of severe connective tissue diseases and this syndrome of arthralgia and myalgia has not been observed. Admittedly, it would be difficult to distinguish arthralgia from cyclophosphamide and that from the underlying connective tissue disease in these patients. It has been suggested that the importance of the syndrome lies with its early recognition and the avoidance of extensive work-ups for rheumatological diseases and metastatic deposits. However, until the nature of the syndrome becomes clearer, it is unlikely that the need for careful clinical and serological evaluation will be obviated and the possibility of a firm rheumatological diagnosis needs to be considered in each patient.
424
3. ADVERSE EFFECTS OF CHEMOTHERAPY AND RHEUMATIC SYMPTOMS A number of antineoplastic agents are known to have adverse effects that might mimic a rheumatic disease. For example, Raynaud's phenomenon is well described in association with cisplatin, vinblastine and bleomycin [10], and more recently 5-fluorouracil may cause digital ischaemia [11]. Furthermore, bleomycin is also associated with the development of scleroderma [12, 13]. The cutaneous lesions seen in these patients treated with bleomycin are indistinguishable from idiopathic scleroderma where lesional fibroblasts synthesize large amounts of collagen and glycosaminoglycan [13]. In the patients reported by Kerr and Spiera [12], the ANA was positive and they also noted some resolution of symptoms after stopping bleomycin and the addition of corticosteroids. Bleomycin in doses of 400 mgs or more may also result in pulmonary fibrosis, a well recognized feature of scleroderma [14]. The mechanism whereby bleomycin can induce a scleroderma like illness remains unknown but vascular injury is likely to be important. For example, endothelial cell injury is seen as an early lesion in experimental animal models of bleomycin induced pulmonary fibrosis [15]. Tamoxifen is widely used in the therapy of breast cancer patients and may be associated with rheumatic symptoms. For example, in Warner et al.'s [9] report, 9 out of the 23 patients developed rheumatic symptoms shortly after starting tamoxifen. Furthermore, 3 patients developed an inflammatory symmetrical polyarthritis between 2 weeks and 1 year of commencing tamoxifen which resolved on tamoxifen withdrawal [16]. The mechanism by which tamoxifen may induce rheumatic symptoms is unclear but could be related to its antioestrogenic effects. However, against this argument is that raloxifene, a newly licensed selective oestrogen receptor modulator for postmenopausal women, has not so far been associated with these symptoms [17]. Many combination chemotherapy regimens include corticosteroids, often in high doses and osteoporotic vertebral and hip fractures may occur which may be mistaken for pathological fractures from metastatic deposits. Similarly, steroid induced myopathies may initially be mistaken for inflammatory myopathies which may also occur with malignancies.
4. INTERFERON AND AUTOIMMUNITY Interferon may exert many different effects on the immune system including modulation of immunoglobulin production, stimulation of T-cell cytotoxicity, macrophage function and natural killer cell activity (reviewed in [18]). Interferon also has antitumour and antiviral activity and is used in the treatment of a number of viral and malignant conditions. Given the possible effects of interferons on the immune system it is perhaps not surprising that autoimmune disorders have been reported as a consequence of interferon-of therapy. For example, autoimmune haemolytic anaemia, autoimmune thyroid disorders and thrombocytopenic purpura have all been described [18]. Interferon-Qf therapy is also associated with autoantibody production including antibodies to nuclear antigens [19], thyroid antigens and epithelial cells. Ronnblom et al. [20] described a patient with a malignant carcinoid tumour who developed SLE during interferon-Qf therapy. Interestingly, this patient had a further course of interferon-a therapy which resulted in the recurrence of anti-DNA antibodies and clinical evidence of active lupus. This report stimulated the authors to prospectively study 135 patients with malignant carcinoid tumours treated with interferona and they found 25 patients who developed clinical evidence of autoimmune disorders[18]. This included 18 patients with autoimmune thyroid disease, although 16 of these had pre-exisiting thyroid antibodies with normal thyroid function prior to interferon-a therapy. Four patients developed pernicious anaemia with gastric parietal cell antibodies and 2 developed biopsy proven leucocytoclastic vasculitis, 1 of whom also developed antinuclear antibodies (ANA). They also observed that although 16 patients had ANA prior to interferon-Qf therapy, a further 19 developed ANA after this treatment. Another report confirmed this and also noted the development of anti-DNA antibodies in 12 patients with chronic lymphatic leukaemia treated with interferon-a [21]. In another large study of 987 patients with hepatitis C virus treated with interferon-of, 5 patients developed diabetes mellitus, 18 acquired autoimmune thyroid disorders and 3 developed interstitial pneumonia. Interestingly, 1 patient developed SLE, 2 developed RA and 1 developed autoimmune thrombocytopenic purpura [22].
Thus, interferon-Qf is capable of stimulating autoantibody production as well as increasing the risk of developing an autoimmune disease especially autoimmune thyroid disease and less commonly rheumatic diseases such as SLE and RA. How interferon-cy contributes to the development of both autoantibodies and autoimmune disease remains unclear. Lymphoid cells from normal humans stimulated by poke-weed mitogen can, in the presence of interferon-a, produce antibodies with a lupus associated idiotype [23]. Furthermore, interferon-Qf may enhance the presentation of self antigens by Class I and II MHC molecules and also enhance B-cell function, thus increasing the propensity to autoimmunity [18]. Most investigators now recommend that patients treated with interferonOL should be monitored carefully for the development of both autoantibodies and autoimmune diseases.
5. CONNECTIVE TISSUE DISEASES AND COMBINATION CHEMOTHERAPY Recently, our unit has observed 6 patients with haematological malignancy (5 had a lymphoma and 1 had acute myeloid leukaemia) who developed an autoimmune connective tissue disease following combination chemotherapy [24]. Three patients developed SLE and 1 each developed lupus profundus, limited cutaneous systemic sclerosis and Churg-Strauss syndrome. Only 1 of these patients received interferon-of and his SLE developed 5 years after this therapy. These connective tissue diseases manifested themselves between 1 and 63 months after the first chemotherapy course and all cases responded to modest doses of prednisolone and/or hydroxychloroquine, though the patient with Churg-Strauss syndrome received prednisolone and azathioprine. Three of the 6 patients have subsequently died from recurrent malignancy. There are many possible reasons for the development of autoimmune disease following chemotherapy, not least of which is the remote possibility that the lymphoma was a disease manifestation that preceded the appearance of the CTD. The coincidental appearance of the two conditions also cannot be excluded. However, there are more cogent possible explanations. In recent years there has been a change in chemotherapy regimens for malignancies with ever more toxic combinations in the search for effective remission inducing regimens. Taken together, the description of 46
425
patients with postchemotherapy rheumatism and the development of defined CTD following chemotherapy for lymphoma or leukaemia suggests that combination chemotherapy may capable of disturbing the immune system profoundly enough to alter the normal balance of self-tolerance, possibly by altering thymic function, leading to autoimmunity.
5. 6. 7. 8.
9. 6.
CONCLUSION
It seems reasonably clear that combination chemotherapy may be associated with rheumatic manifestations. On the one hand, this may consist of a relatively self-limiting condition characterized by arthralgia and myalgia with negative autoimmune serology and this has been given the name postchemotherapy rheumatism. On the other hand, there may be a rare subgroup of patients who develop an autoimmune connective tissue disease following combination chemotherapy which may represent another facet of the so-called postchemotherapy rheumatism syndrome. In addition, tamoxifen and certain chemotherapy agents such as bleomycin and particularly interferon-c^ may be associated with the development of diseases such as Raynaud's syndrome, scleroderma or SLE as well as nonspecific rheumatic symptoms such as myalgia and polyarthritis/polyarthralgia. The interaction between these drugs and the immune system and their effects on the balance of self-tolerance may yield useful insights into the pathology of the idiopathic connective tissue diseases.
10.
11.
12.
13.
14.
15.
16.
17.
REFERENCES 1.
2.
3.
4.
426
Abu-Shakra M, Gladman DD, Urowitz MB. Malignancy in systemic lupus erythematosus. Arthritis Rheum 1996; 39:1050-1054. Jones M, Symmons D, Finn J, Wolfe F. Does exposure to immunosuppressive therapy increase the 10 year malignancy and mortality risks in rheumatoid arthritis? A matched cohort study. Br J Rheum 1996;35:738-745. George CS, Lichtin AE. Hematologic complications of rheumatic disease therapies. Rheum Dis Clin North Am 1997;23:425^37. Loprinzi CL, Duffy J, Ingle JN. Postchemotherapy rheumatism. J Clin Oncol 1993;11:768-770.
18.
19.
20.
21.
Smith DE. Additional cases of postchemotherapy rheumatism. J Clin Oncol 1993;11:1625-1626. Michl I, Zielinski CC. More postchemotherapy rheumatism. J Clin Oncol 1993;11:2051-2052. Siegel JE. Postchemotherapy rheumatism: is this a menopausal symptom? J Clin Oncol 1993;11:2051. Raderer M, Scheithauer W. Postchemotherapy rheumatism following adjuvant therapy for ovarian cancer. Scand J Rheum 1994;23:291-292. Warner E, Al-Noor K, Shupak R, Bellini A. Rheumatic symptoms following adjuvant therapy for breast cancer. Am J Clin Oncol (CCT) 1997;20:322326. Vogelzang NJ, Bosl GJ, Johnson K, Kennedy B J. Raynaud's phenomenon: a common toxicity after combination chemotherapy for testicular cancer. Ann Int Med 1981;95:288-292. Papamichael D, Amft N, Slevin ML, D'Cruz D. 5fluorouracil induced Raynaud's phenomenon. Eur J Cancer 1998;34:1983. Kerr LD, Spiera H. Scleroderma in association with the use of bleomycin: a report of 3 cases. J Rheumatol 1992;19;294-296. Finch WR, Rodnan GP, Buckingham RB, Prince RK, Winkelstein A. Bleomycine induced scleroderma. J Rheumatol 1980;7:651-659. Kiefer O. Uber die Nebenwirkungen der Bleomycintherapie auf der Haut. Dermatologica 1973;146:229-243. Fasske F, Morgenroth K. Experimental bleomycin lung in mice. A contribution to the pathogenesis of pulmonary fibrosis. Lung 1983; 161:133146. Creamer P, Lim K, George E, Dieppe P. Acute inflammatory polyarthritis in association with tamoxifen. Br J Rheumatol 1994;33:583-585. Walsh BW, Kuller LH, Wild RA, Paul S, Farmer M, Lawrence JB, Shah AS, Anderson PW. Effects of raloxifene on serum lipids and coagulation factors in healthy postmenopausal women. JAMA 1998;279:1445-1451. Ronnblom LE, Aim GV, Oberg KE. Autoimmunity after alpha-interferon therapy for malignant carcinoid tumours. Ann Int Med 1991;115:178-183. Ehrenstein MR, McSweeney E, Swana M, Worman CP, Goldstone AH, Isenberg DA. Appearance of antiDNA antibodies in patients treated with interferon-«. Arthrit Rheumatol 1993;36:279-280. Ronnblom LE, Aim GV, Oberg KE. Possible induction of systemic lupus erythematosus by interferon-a treatment in a patient with a malignant carcinoid tumour. J Int Med 1990;227:207-210. Wandl UB, Nagel-Hiemke M, May D, Kreuzfelder E, Kloke O, Kranzhoff M, Seeber S, Niederle N. Lupus-
22.
like autoimmune disease induced by interferon therapy for myeloproliferative disorders. Clin Immunol Immunopathol 1992;65:70-74. Okanoue T, Sakamoto S, Itoh Y, Minami M, Yasui K, Sakamoto M, Nishioji K, Katagishi T, Nakagawa Y, Tada H, Sawa Y, Mizuno M, Kagawa K, Kashima K. Side effects of high-dose interferon therapy for chronic hepatitis C. J Hepatol 1996;25:283-291.
23.
24.
Schattner A, Duggan D, Naparstek Y, Schwartz RS. Effects of interferon-a on the expression of a lupus idiotype in normal humans. Clin Immmunol Immunopathol 1986;38:327-336. Amft N, Papamichael D, Baguley E, Lister TA, D'Cruz DP. Connective tissue diseases developing after intensive chemotherapy for malignacies (submitted).
427
© 2000 Elsevier Science B. V. All rights reserved. Cancer and Autoimmunity Y. Shoenfeld and M. E. Gershwin, editors
Cyclosporin and Cancer Roberta Priori, Fabrizio Conti and Guido Valesini Universita ''La Sapienza ", Roma, Italy
1. INTRODUCTION Since its discovery in 1970 [1], cyclosporin A (CyA) has progressively gained a central role in the therapeutic approach of organ transplantation. As a matter of fact, CyA propriety to improve patient's and graft survival is now unquestioned. Because of its high selective and reversible action on T lymphocytes, over the past few years CyA use has been spreading also in autoimmune diseases [2], endogenous noninfectious uveitis and, more recently, in some other disorders where activated T cells may play a pathogenetic role, such as inflammatory bowel diseases [3], bronchial asthma [4], atopic dermatitis [5] and chronic urticaria [6].
2. CYCLOSPORIN A: PHARMACOLOGY AND MECHANISMS OF ACTION Cyclosporin A is a neutral, cyclic undecapeptide derived from the soil fungus Tolypocladium inflatum gams. It is lipophilic and very hydrophobic so that it must be solubilized for clinical use. CyA can be administered intravenously or orally with a new microemulsion formulation which has proved to improve absorption and lower inter- and intrapatient variability of bioavailability [7]. The drugs distributes widely in the circulation, it accumulates for 50-60% in red blood cells, and for 10-20% in leukocytes, and the remainder is bound to plasma lipoproteins. In healthy subjects the elimination half-life is approximately 6 h. CyA metabolism takes place in the liver thanks to the cytocrome P-450IIIA system: more than 30 metabolites are known, while it is matter of debate if
some of them still have immunosuppressive or toxic properties. A major elimination pathway for this drug is biliary excretion. Drugs metabolized by the same enzymatic system affect cyclosporin concentration: with the inhibitors—such as ketoconozole, macrolide antibiotics, anphotericin B—the clearance of CyA it decreases, on the contrary it accelerates with the co-administration of P450 inductors—such as phenytoin, rifampicine, trimethoprim-sulphamethoxazole and phenobarbital [8]. CyA binds to cyclophilin, a prolyl isomerase [9, 10], and after slightly restructuring its receptor to form an inhibitory complex, blocks the phosphatase action of calcineurin, which is an essential factor in the T-cell activation pathway. This block leads to the complete inhibition of the translocation of the cytosolic component of the nuclear factor of activated T cell (NF-AT), resulting in a failure to activate the genes regulated by NF-AT transcription factor such as IL2, necessary for T-cell proliferation, and IL-4 and CD40 ligand, necessary for B-cell cooperation [11, 12]. Some evidence suggests that CyA may exert its immunosuppressive and anti-inflammatory action also independently from protein synthesis inhibition, i.e., preventing T-cell receptor-mediated exocitosis from cytotoxic T lymphocytes [13]. It is noteworthy that its global effects on lymphocytes is reversible. The most relevant adverse effect of CyA is renal toxicity which is a common cause of discontinuation both in posttransplant and autoimmune patients [14]. Other side effects can be hypertension, hepatotoxicity, hypertricosis, gingival hyperplasia, paresthesia, tremors and gastrointestinal discomfort. CyA is devoid of myelotoxicity. Moreover experimental animal and human data support the CyA lack of genotoxicity [15].
429
3. THE CARCINOGENICITY OF CYA The use of immunosuppressive drugs bears intrinsically the risk of tumor formation with two basic mechanisms: a genetic one, consisting of a direct effect of the drug on DNA repHcation; and an epigenetic mechanism, including indirect effects on immunological, hormonal, metabolic control of multiple cellular regulatory events [16]. CyA does not seem to be genotoxic [15]: several experimental data have excluded any mutagenic properties [17, 18]. The association of CyA to carcinogenesis is mainly related to its immunosuppressive capacity. It is well known that severe immunosuppression leads to an increased incidence of malignancy, especially virus-related: a minor immune surveillance for transformed cells is associated to the development of a microenviroment more permissive towards chronic oncogenic viral infection [19]. Viral infections are common among immunodeficient patients, first of all Epstein Barr virus (EB V), papilloma and herpes virus [20, 21]. EBV induces B-cell proliferation and, actually, a wide spectrum of EB V-related lymphoproliferative disorders, ranging from infectious mononucleosis to malignant lymphoma, may arise in transplant recipients who have received immunosuppressive regimens containing CyA [22]. The development of EBV-associated lymphoproliferative disorders has been also described in patients with rheumatoid arthritis (RA) treated with CyA [23, 24]. CyA may have a role in allowing a lymphoproliferative disorder to develop as it can abrogates EB V-specific T-cell control [25, 26]. However, at the low dose currently used, CyA, allowing the normal function of these T-cell clones, results in regression of EBV-induced B-cell lines [27]. The disappearance of post-transplant EBV lymphproliferative lesions has been described after reduction or discontinuance of immunosuppression [28]. A similar observation has been reported in patients with autoimmune diseases [29]. Specific markers able to detect at the earUest possible time the development of a lymphoproliferative disorder (LPD) would have great value in clinical setting. Vogl et al. [30] have evaluated the efficacy of tissue polypeptide specific (TSP) antigen for the detection at an early stage of CyA-induced post-transplant LPD: they actually found it increased in serum before LPD diagnosis and decreased after the reduction of immunosuppression and the beginning of tumor regression. The authors concluded that continuous mon-
430
itoring of TSP antigen concentration leads to an early treatment and a better prognosis for patients who had developed a LPD. No information are available about the usefulness of measuring this marker in patients with autoimmune diseases under CyA therapy. 3.1. The Cancerogenicity of CyA: Experience from Transplantations It is rather difficult to ascertain the responsibility of a single immunosuppressive drug in the increased incidence of cancer after transplantation as patient usually adopt a multiple therapy. Many studies have shown that the combined use of several potent immunosuppressive agents is more obviously associated with the development of maUgnancy [31, 32]. In renal transplantation a clear difference in the postoperative course of patients treated with conventional immunosuppressive therapy (azathioprine or azathioprine plus steroids) and those treated with CyA is unlikely [33], even if some authors indicate that the development of lymphoproliferative disorders may occur earlier in subjects using CyA [34]. A similar observation comes from Japan [35]. Gaya et al. [36] analyzed the incidence of de novo maUgnancy in 274 renal transplant recipients who had been followed for 2622 patient-years and found no evidence that CyA treated subjects have an higher risk of cancer in comparison to those treated with conventional immunosuppressive therapy (azathioprine plus steroids). On the contrary, Hiesse et al., comparing the risk of malignancy in a historical group of transplants treated with azathioprine-steroids and those more recently submitted to multiple CyA-based immunosuppressive protocols, found an increased risk of skin cancers in the latter [37]. Previous observations from European [38] and Canadian [39] studies ruled out that lymphoproliferative disorders could be diagnosed more frequently in transplant-recipients using lower-dose of CyA. More recently, it has been [19] demonstrated that low-dose CyA regimen reduces the risk of malignancy in transplant recipients. In this study the majority of cancers were skin carcinomas, and they were observed especially in those patients who had previously received high dose of azathioprine. Azathioprine metabolites are known to have photosensitizing activity in the skin, and in UV light exposed mice more tumors are induced by azathioprine than by CyA [40]. Careful skin examination
should be periodically performed in patients receiving CyA therapy in association with azathioprine. 3.2. The Cancerogenicity of CyA: Experience from Autoimmune Disease The majority of data regarding the risk of neoplasms in patients treated with CyA derives from transplantation recipients while scarce information is available about this issue in patients with autoimmune disorders. Autoimmune diseases have an increased risk of morbidity and mortality linked to the development of neoplasms [41-45]. Which mechanisms underlie this observation is unclear yet, but their knowledge is of outstanding interest to choose a correct therapeutic approach for these disorders. One of the most important target for the next few years is the understanding of the complex relationship between the type and severity of immunosuppression and clonal expansion as well as the link between immunosuppressants and the expression of gene related to cell proliferation, survival and transformation [46]. 3.3. CyA in Rheumatoid Arthritis It is well known that rheumatoid arthritis (RA) is associated with an increased risk of malignancy. In 1978, a large cohort study demonstrated an increased risk of leukemia, lymphoma, and multiple myeloma as well as a significantly increased risk of lung cancer in men, and a lesser risk of stomach and rectal cancer in women [47]. Subsequent studies have generally confirmed the higher incidence of lymphoproliferative and myeloproliferative malignancies in RA. Tennis et al. [48] studied the incidence of mahgnancy in 1210 patient with RA who resulted as having a 3.4- to 4-fold enhanced risk of developing myeloma or lymphoma. Gridley et al. [49] studied 906 men with a diagnosis of Felty syndrome, and discovered in this group a twofold increase in total cancer incidence and a 12.8fold risk for non-Hodgkin's lymphoma. The etiology of neoplasia in RA is poorly understood, the use of immunosuppressive drugs is believed to play a significant role even if not all RA patient who develop lymphoma are treated with cytotoxic agents. Azathioprine has been reported to be associated with an 8to 10-fold increased risk of lymphoproliferative malignancies in RA patients. This risk was present also with cyclophosphamide as well as with methotrexate
therapy, although for the latter the literature consists predominantly of case reports [50]. Furthermore, the risk of B-cell malignancy linked to immunosuppressive drugs seems to be greater in RA than in other disorders [51]. It has been proved that CyA delays the appearance of new erosions and thus slows the progression of joint damage in RA patients [52]. Arellano and ICrupp [53] examined more than 1000 RA patients who were treated with CyA in clinical trials. The investigators found the development of tumors in 17 patients; these malignant tumors consisted of 4 skin cancers (2 basal cell carcinomas, 2 malignant melanomas), B-cell lymphoma in 1 patient and a solid tumor in 12 patients (3 breast cancers, 2 lung cancers, 2 colon cancers, 1 carcinoid tumor, 1 cervix carcinoma, 1 glioma, 1 glioblastoma multiforme, 1 prostate carcinoma). All patients except one received daily dose of CyA not exceeding 5 mg/Kg. The estimation of the RR for all types of malignancies amounts to 3.6. Therefore, RA patients treated with CyA are at an increased risk as compared to those who do not receive this treatment, but in the range for patients receiving disease modifying activity rheumatic drugs. The development of EBV-associated lymphoproliferative disorders has been also described in patients with RA treated with CyA [23, 24]. 3.4. CyA in Systemic Sclerosis The similarity between progressive systemic sclerosis (PSS) and chronic graft-vs-host disease and a growing body of evidence of T-cell activation in both tissues and blood of PSS patients prompted some trials of CyA for this disorder which have shown, in some cases, a partial improvement of skin manifestation [54-59]. In these reports, some of which are isolated or small series of cases, no information are available on the appearance of cancer during or after CyA therapy. On the other hand, an increased risk of malignancy is intrinsically associated with PSS, especially in sites commonly affected by fibrosis like lung and skin [60, 61]. As the standardized incidence ratio (the ratio of observed to expected incidence) for PSS patient is rather high [42] for nonmelanoma skin cancers (i.e., squamous cell cancers) [61] a careful skin examination is advised for those using CyA. In 1990 Merot et al. described the development of cutaneous malignant melanoma in a single patient with systemic
431
sclerosis treated with CyA [62] but, because of the high frequency of this kind of cancer among the general population, it is hard to evaluate CyA contribution to the onset of melanoma in this isolated case. 3.5. CyA in Systemic Lupus Erythematosus Some evidence suggest that patient with systemic lupus erythematosus (SLE) have a higher incidence of malignancy, especially hematopoietic [63-65], breast, lung, and gynecological cancers [66,67] even if not all reports agree with this observation [68, 69]. None of the available lupus cohort studies have demonstrated a clear correlation between immunosuppression and higher cancer risk, but there is a reasonable concern of a possible increased risk with the additional exposure to immunosuppressive drugs. As a matter of fact, a high incidence of cervical atypia in women with SLE treated with cytotoxic drugs has been reported [70]. The use of CyA for the management of SLE has been spreading over the last few years. It has been proved successful in improving disease activity in patient with severe steroid-resistant or dependent SLE [71-74]. More recently Caccavo et al. [75] demonstrated a steroid-sparing effect of CyA combined with a good efficacy in reducing disease activity in 30 SLE patients; no malignancy are reported after 2 years of CyA therapy (2.5-5 mg/Kg/die). Our experience on 58 SLE patients receiving CyA orally as a single treatment or in association with steroids or various other drugs (hydroxiclorochine, methotrexate, azathioprine, cyclophosphamide, thalidomide and intravenous immunoglobulins) for an average of 26 months at the initial dosage of 5 mg/kg/day and progressively reduced to 3 mg/kg/day according to the individual clinical responses, has produced similar results: no cancer developed during treatment and after more than three years of follow-up (unpublished data). However, as cancers with a possible virus-related etiology, such as cervical and vaginal ones, are very often observed in SLE patients [70, 76], it is advisable that females who receive CyA should have cervical smears taken at regular interval; in particular it could be useful the extensive search for human papilloma virus. Similarly, due to an increased incidence of breast cancers in women with SLE [66], careful manual and instrumental examination is suggested periodically in those taking immunosuppressive therapy.
432
3.6. CyA in Psoriasis Since the serendipity which led to the discovery of a possible efficacy of CyA in the treatment of psoriasis [77], a great number of studies on patients with different forms of psoriasis, including psoriasic arthritis, have definitively ratified its effectiveness [78, 79]. The Sandoz Pharma clinical study programme conducted until 1990 on 842 psoriasic patients treated with CyA disclosed the development of 17 cases of malignancy: 6 malignant or pre-malignant skin lesions, 6 solid organ tumors, and 5 lymphoproliferative disorders (3 benign cutaneous lymphoproliferative infiltrations, 1 B-cell lymphoma, which regressed after CyA discontinuation, 1 T-cell lymphoma) [80]. Psoriasis patients developing skin malignancies during the use of CyA in general had been previously treated with PUVA and/or methotrexate [81-83], and it is difficult to determine whether the incidence of skin cancers (estimated as 0.5-0.8/1000 patients per month) is specific to CyA or to previous PUVA therapy, or both [84]. It should be borne in mind that, even if psoriasis can severely affect the quality of life, it is not a life-threatening disease and, therefore, the risk/benefit ratio of immunosuppressive treatment should be carefully evaluated. Patients with previous or concomitant malignancy should not be considered for CyA therapy. Patients treated with CyA should not, as far as possible, receive concomitant immunosuppressive drugs or radiation therapy, including PUVA and UVL; moreover, they should be made aware of the higher risk of overexposure to sunlight [85]. Whenever atypical lesions are seen, whether before or during CyA treatment, a prompt biopsy of the lesion should be performed. Grossman et al. [86] suggested that all female patients should undergo a gynecological examination with a Papanicolau smear before beginning CyA and every 6 months thereafter. The authors advocate that the presence of human papilloma virus infection should be a relative contraindication to CyA treatment.
4. THE CANCEROGENICITY OF CYA: EXPERIENCE FROM OTHER IMMUNE-MEDIATED DISEASES Being effective in the modulation and prevention of experimental autoimmune uveitis [87], the use of CyA
for the treatment of human uveitis has been spreading over the last decade. Guidelines for an optimal use of CyA in noninfectious endogenous uveitis are available [88] where a maximal dose of 5 mg/Kg/die is suggested. In the same report, among the side effects described in 339 patients with endogenous intermediate and posterior uveitis in 15 different clinical studies, no malignancies are reported. It has been described a patient with Behcet's disease who developed fatal high grade lymphoma within 5 month of commencing CyA. CyA has been proposed as a rapid acting alternative or adjunct to other drugs for refractory inflammatory bowel diseases (IBD). Only a high, and potentially more toxic, dosage seems to be effective for severe ulcerative colitis (UC) and fistulous Crohn's disease, therefore CyA may be used as a rescue therapy for short intervals [3]. It is well known that UC bears an intrinsic risk of colonic cancer which would makes the use of an immunosuppressant like CyA for long periods rather worrisome, but as far as we know, no malignancy due to CyA has been reported in patients with IBD, in particular no colonic cancer has been observed either during or after treatment [89, 90]. Among 661 patients (263 under 15 years of age) with idiopathic nephrotic syndrome exposed to CyA (5-6 mg/kg/die) for 435 patient-years, 5 malignancy developed: 2 Hodgkin's lymphoma (HL), 1 renal, 1 uterus adenocarcinoma and 1 bronchus squamous cell carcinoma in a smoker. These malignancies might have been related to CyA induced immunosuppression as well as nephrotic syndrome itself. Actually, the association between HL and nephrotic syndrome has been described [91].
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
REFERENCES 1.
2.
3.
Borel JF. The history of cyclosporin A and its significance. In: White DIG, ed., Cyclosporin A: Proceedings of an International Conference on Cyclosporin A, Cambridge, September 1981. Amsterdam/New York: Elsevier/Biomedical Press, 1982;5-17. Fathman CG, Myers BD. Cyclosporine therapy for autoimmune disease. N Engl J Med 1992;326:16931694. Sandborn WJ. A critical review of cyclosporine therapy in inflammatory bowel disease. Inflam Bowel Dis 1995;1:48-63.
16. 17.
18.
19.
Alexander AG, Barnes NC, Kay AB. Trial of cyclosporin in corticosteroid-dependent chronic severe asthma. Lancet 1992;339: 324-328. Van Joost TH, Heule EM, Marks, JM et al. Cyclosporin in atopic dermatitis: a multicentre placebocontrolled study. Br J Dermat 1994;130:634-640. Toubi E, Blant A, Kessel A, Goland TD. Low-dose cyclosporin A in the treatment of severe chronic idiopathic urticaria. Allergy 1997;52:312-316. Noble S, Markham A. Cyclosporin. A review of the pharmacokinetic properties, clinical efficay and tolerability of a microemulsion-based formulation. (Neoral) Drugs 1995;50:924-941. Mallat A. Cytochrome P-450IIIA, ciclosporine et interactions medicamentouses. Gastroenterol Clin Biol 1992;16:295-298. Handshumacher RE, Harding MW, Rice J, Drugge RJ. Cyclophilin: a specific cytosolic binding protein for cyclosporine A. Science 1985;226:544-547. Takahashi N, Hayano T, Suzuki M. Peptydyl-prolyl cis-trans isomerase is the cyclosporin A-binding protein cyclophilin. Nature 1989;337:473^75. Ho S, Clipstone N, Timmerman L, et al. The mechanism of action of cyclosporin A and FK506. Clin Immunol Immunopathol 1996;80:S40-S45. Rao A, Luo C, Hoagan PG. Transcription factors of the NEAT family: regulation and function. Ann Rev Immunol 1997;15:707-747. Lancki DW, Kaper BP, Fitch FW. The requirements for triggering of lysis by cytolytic T lymphocyte clones.II. Cyclosporin A inhibits TCR-mediated exocitosis by cloned CTL. J Immunol 1989;142:416424. Burke JF, Pirsche JD, Ramos EL, et al. Long-term efficacy and safety of cyclosporin A in renal transplant recipients. N Engl J Med 1994;331:358-363. Olshan AF, Mattison DR, Zwanenburg TS. International commission for protection against environmental mutagens and carcinogens. Cyclosporin A: review of genotoxicity and potential for adverse human reproductive and developmental effects. Report of a Working group on the genotoxicity of cyclosporin A, 18 August 1993. Mutat Res 1994;317:163-173. Ryffel B. The carcinogenicity of cyclosporin. Toxicology 1992;73:1-22. Matter BE, Donatsch P, Racine RR. Genotoxicity evaluation of cyclosporin A, a new immunosuppressive agent. Mutat Res 1982:105:257. Zwanenburg TSB, Suter W, Matter BE. Absence of genotoxic potential for cyclosporin in experimental system. Trans Proc 1988;20:435. Dantal J, Hourmant M, Cantarovich D, et al. Effect of long term immunosuppression in kidney graft recipi-
433
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
434
ents on cancer incidence: randomised comparison of two cyclosporin regimens. Lancet 1998;351:623-628. Klein G, Purtillo D. Summary: Symposium on EBV induced lymphoproliferative diseases in immunodeficient patients. Cancer Res 1981;41:4302-4304. Matas A J, Simmons RL, Najaran JS. Chronic antigenic stimulation, herpes virus infection and cancer in transplant recipients. Lancet 1975:i;1277. Nalesnik MA, Jaffe R, Starzl TE, et al. The pathology of post-transplant lymphoproliferative disorders occurring in the setting of cyclosporin A-prednisone immunosuppression. Am J Pathol 1988;133:173-192. Zijlmans JMJM, Van Rijthoven AWAM, Kluin PM, et al. Epstein Barr virus-associated lymphoma in a patient with rheumatoid arthritis treated with cyclosporin. N Engl J Med 1992: 326:1363. Ferraccioli GF, Casatta L, Bartoli E, et al. EBVassociated Hodgkin's lymphoma in a RA patient treated with methotrexate and CyA. Arthrit Rheumatol 1995:6:867-868, York LJ, Qualtiere LF. Cyclosporin abrogates virusspecific T cell control of EBV induced B cell lymphoproliferation. Viral Immunol 1990;3:127-136. Bird GA, McLachlan SM, Britton S. Cyclosporin A promotes spontaneous outgrowth in vitro of EBVinduced B-cell lines. Nature 1981;289:300. Crawford DH, Edwards JM. Immunity to EBV in cyclosporin A-treated renal allograft recipients. Lancet 1981;i:1469. Starzl TE, Porter KA, Iwatsuki S, et al. Reversibility of lymphoma and lymphoproliferative lesions developing under cyclosporin-steroid therapy. Lancet 1984;i:583-587. Kamel OW, Van de Rijn M, Weiss LM. Reversible lymphomas associated with EBV occurring during methotrexate therapy for rheumatoid arthritis and dermatomyositis. N Engl J Med 1993:328:1317-1321. Vogl M, Griesmacher A, Grimm M, Klepetko W, Muller MM. Tissue polypeptide specific antigen for the detection of lymphoproliferative diseases induced by cyclosporin. J Clin Pathol 1995:48:1039-1044. Wilkinson Ah, Smith JL, Hunsicker LG, et al. Increased frequency of post-transplant lymphomas in patients treated with cyclosporin, azathioprine and prednisone. Transplantation 1989;47:293. Gamier JL, Berger F, Betuel H, et al. Epstein-Barr virus associated lymphoproliferative diseases (B cell lymphoma) after transplantation. Nephrol Dial Transplant 1989;4:818. Cockburn ITR, Krupp P. The risk of neoplasms in patients treated with cyclosporin A. J Autoimmunity 1989;2:723-731. Penn I. The changing pattern of post-transplant malignancies. Transplant Proc 1991;23:1101-1103.
35.
36.
37.
38.
39.
40.
41.
42. 43.
44.
45.
46.
47.
48.
49.
50.
Hoshida Y, Tsukuma H, Yasunaga Y, et al. Cancer risk after renal transplantation in Japan. Int J Cancer 1997;71:517-520. Gaya SBM, Rees AJ, Lechler G, Williams G, Mason PD. Malignant disease in patients with long term renal transplants. Transplantation 1995;59:1705-1709. Hiesse C, Rieu P, Kriaa JR, et al. Malignancy after renal transplantation: analysis of incidence and risk factor in 1700 patients followed during a 25-year period. Transplant Proc 1997;29:831833. European multicentre trial group. Cyclosporin in cadaveric renal transplantation: one-year follow-up of a multicenter trial. Lancet 1983;ii:986. The Canadian multicenter transplant study group: a randomized clinical trial of cyclosporin in cadaveric renal transplant. N Engl J Med 1983;309:809. Kelly GE, Mieckle W, Shell AGR. Effects of immunosuppressive therapy on the induction of skin tumors by ultraviolet irradiation in hairless mice. Transplantation 1987;44:429. Carsons S. The association of mahgnancy with rheumatic and connective tissue diseases. Semin Oncol 1997;24:360-372. Kinlen LK Malignancy in autoimmune diseases. J Autoimmun 1992;5 suppl A:363-371. Valesini G, Priori R, Bavoillot D, et al. Differential risk of non-Hodgkin's lymphoma in Italian patients with primary Sjogren's syndrome. J Rheumatol 1997;24:2376-380. Petterson T, Pukkala E, Teppo L, Friman C. Increased risk of cancer in patients with Systemic lupus erythematosus. Ann Rheum Dis 1992;51:437-439. Airio A, Pukkala E, Isomaki H. Elevated cancer incidence in patients with DM: a population based study. J Rheumatol 1995, 22: 1300-1303. Ferraccioli GF, Bartoli E. Autoimmunity and clonal B cell expansion. CHn Exp Rheum 1996;14(suppl 14):S19. Isomaki HA, Hakulinen T, Joutsenlahti U. Excess risk of lymphomas, leukemia and myeloma in patients with rheumatoid arthritis. J Chron Dis 1978;31:691696. Tennis P, Andrews E, Bombardier C, et al. Record linkage to conduct an epidemiologic study on the association of rheumatoid arthritis and lymphoma in the province of Saskatchewan, Canada. J Clin Epidemiol 1993;46:685-695. Gridley G, MC Laughhn JK, Ekbom A, et al. Incidence of cancer in patients with rheumatoid arthritis. J Natl Cancer Inst 1993;85:307-311. Cibere J, Sibley J, Haga M. Rheumatoid arthritis and the risk of malignancy. Arthrit Rheumatol 1997;40:1580-1587.
51.
52.
53.
54. 55.
56.
57.
58.
59.
60. 61.
62.
63.
64.
65.
66.
67.
Kinlen LJ. Incidence of cancer in rheumatoid arthritis and other disorders after immuno suppressive treatment. Am J Med 1985;78(suppl 1A):4449. Pasero G, Priolo F, Marubini E, et al. Slow progression of joint damage in early rheumatoid arthritis treated with cyclosporin A. Arthrit Rheumatol 1996;39:1006-1015. Arellano F, Krupp P. Malignancies in rheumatoid arthritis patients treated with cyclosporin A. Br J Rheum 1993;32:72-75. Yoccum DE, Wilder RL. Cyclosporin A in systemic sclerosis. Am J Med 1987;83:369-370. Appleboon T, Itzkowitch D. Cyclosporin in successful control of rapidly progressive scleroderma. JAMA 1986;82:886-887. Knop J, Brosman G. Cyclosporin in treatment of progressive systemic sclerosis. In: Schindler R, ed., Cyclosporin in Autoimmune Diseases. Berlin: SpringerVerlag, 1985;199-201. Zachariae M, Halkier-Sorensen L, Heickendorf, et al. Cyclosporin A treatment of systemic sclerosis. Br J Rheumatol 1990;122:677-681. Clements PJ, Lachenbruch PA, Sterz M, et al. Cyclosporin in systemic sclerosis. Arthrit Rheumatol 1993;36:75-83. Gissilinger H, Burghuber OC, Stacher G, et al. Efficacy of Cyclosporin A in systemic sclerosis. Clin Exp Rheum 1991;9:383-390. Abu-Shakra M, Guillemin F, Lee P. Cancer in systemic sclerosis. Arthrit Rheumatol 1993;36:460-464. Rosenthal AK, McLaughHn JK, Gridley G, Nyren O. Incidence of cancer among patient with systemic sclerosis. Cancer 1995;76:910-914. Merot Y, Miescher PA, Balsiger F, et al. Cutaneous malignant melanomas occurring under cyclosporin A therapy: a report of two cases. Br J Dermatol 1990;123:237-239. Menon S, Snaith ML, Isemberg DA. The association of mahgnancy with SLE: an analysis of 150 patients under long term review. Lupus 1993;2:177-181. Lopez-Dupla M, Khamashta M, Pintado Garcia V, et al. Malignancy in SLE: a report of five cases in a series of 96 patients. Lupus 1993;2:377-380. Bhalla R, Ajmani HS, Kim WW, et al. Systemic lupus erythematosus and non-Hodgkin's lymphoma. J Rheumatol 1993;29:1316-320. Ramsey-Goldman R, Mattai SA, Chiu YL, et al. Increased risk of malignancy in patients with systemic lupus erythematosus. J Inv Med 1998;46:217222. Petterson T, Pukkala E, Teppo L, Friman C. Increased risk of cancer in patients with systemic lupus erythematosus. Ann Rheum Dis 1992;51:437^39.
68.
69.
70.
71.
72.
73.
74.
75.
76.
77. 78.
79.
80.
81.
82.
83.
Abu-Shakra M, Gladman DD, Urowitz MB. Malignancy in systemic lupus erythematosus. Arthrit Rheumatol 1996;39:1050-1054. Sweeney DM, Manzi S, Janosky J, et al. Risk of malignancy in female patients with systemic lupus erythematosus. J Rheumatol 1995;22:1478-1482. Nyberg G, Eriksson O, Westberg NG. Increased incidence of cervical atypia in women with SLE treated with chemotherapy. Arthrit Rheumatol 1981;24. 648650. Miescher PA, Miescher A. Combined cyclosporinsteroid treatment of systemic lupus erythematosus. In: Schneider R, ed.. Cyclosporin in Autoimmune Disease. Berlin: Springer-Verlag, 1985. Tokuda M, Kurata N, Mizoguchi A, et al. Effect of low-dose cyclosporin A on systemic lupus erythematosus disease activity. Arthrit Rheumatol 1994;37:551-558. Feutren G, Querin S, Noel LH, et al. Effects of cyclosporin in severe systemic lupus erythematosus. J Pediatr 1987;111:1063-1068. Manger K, Kalden JR, Manger B. Cyclosporin A in the treatment of systemic lupus erythematosus: results of an open clinical study. Br J Rheumatol 1996;35:669-675. Caccavo D, Lagana B, Mitterhofer AP, et al. Longterm treatment of systemic lupus erythematosus with cyclosporin X. Arthrit Rheumatol 1997;40:27-35. Mellmkjaer L, Andersen V, Linet MS, et al. NonHodgkin's lymphoma and other cancers among a cohort of patients with systemic lupus erythematosus. Arthrit Rheumatol 1997;40:761-768. Mueller W, Herrmann B. Cyclosporin A for Psoriasis. N Engl J Med 1979 301:555. Ellis CN, Fradin MS, Messana JM, et al. Cyclosporin for plaque-type psoriasis-results of a multidose, double blind trial. N Engl J Med 1991;324:277-284. Griffiths CEM, Powells AV, McFadden J, et al. Long term cyclosporin for psoriasis. Br J Dermatol 1989;120:253-260. Krupp P, Monka C. Side-effects profile of cyclosporin A in patients treated for psoriasis. Br J Dermatol 1990;36(suppl):47-56. Green C, Hawk JLM. Cutaneous mahgnancy related to cyclosporin A therapy. Clin Exp Dermatol 1993;18:30-31. Bos JD. Meinardi MMHN. Two distinct squamous cell carcinomas in a psoriasis patient receiving lowdose cyclosporin maintenance treatment. J Am Acad Dermatol 1989;21:1305-1306. Oxholm A, Thomsen K, Menne T. Squamous cell carcinoma in relation to cyclosporin therapy of nonmalignant skin disorders. Acta Dermato Vener (Stockholm) 1988;69:89-90.
435
84.
85.
86.
87.
436
Feutren G, Laburte C, Krupp P. Safety and tolerability of cyclosporin A in psoriasis. In Wolff K, ed., Cyclosporin A and the Skin. Proceedings of the Satelhte Symposium to the 2nd Congress of the European Acad Dermatol Venereol, Athens (Greece) 12 October 1991. London Royal Society of Medicine Services, 1992;3-12. Mihatsch MJ, Wolff K. Consensus conference on cyclosporin A for psoriasis. Br J Dermatol 1992;126:621-623. Grossmann RM, Maugee E, Dubertret L. Cervical intraepithelial neoplasia in a patient receiving longterm cyclosporine for the treatment of severe plaque psoriasis. Br J Dermatol 1996;135:147-148. Nussenblatt RB, Salinas-Carmona MC, Gery I, et al.
90.
91.
Modulation of experimental autoimmune uveitis with cyclosporin A. Arch Ophtalmol 1982; 100:1462. BenEzra D, Nussenblatt RB, Timonen P. Optimal use of CyA in endogenous uveitis Berlin, SpringerVerlag. Feagan BG, McDonald JWD, Rochon J, et al. Lowdose cyclosporin for the treatment of Crohn's diseases. N Engl J Med 1994;330:1846-1851. Lichtiger S, Present DH, Kornbluth A, et al. Cyclosporin in severe ulcerative colitis refractory to steroid therapy. N Engl J Med 1994;330:1841-1845. Collaborative study group of Sandimmun in nephrotic syndrome. Safety and tolerability of cyclosporin A in idiopathic nephrotic syndrome. Clin Nephrol 1991;35(suppl 1):S48-S60.
Subject Index
A putative nucleotide binding site (ADIPTGKT) 176 AC A 160 Acanthocytosis nigricans 124 Acanthosis nigracans 270 Acetylcholine receptor 5, 142 aCL 94, 95 Acquired ichthyosis 124 ACR criteria 168 Acromegaly syndrome 123 ACTH 122 Acute and chronic leukaemia 19 Acute inflammatory demyelinating polyneuropathy 414 Acute lymphoblastic 233 Acute lymphoblastic leukaemia (ALL) 34, 96, 135, 228, 414 Acute megacaryocytic (M7) leukemia 34 Acute myelogenous leukemia 42 Acute myeloid leukaemia 94,425 Acute nonlymphoblastic leukemia (ANLL) 34 Addison's disease 4, 5, 413 Adenocarcinoma 181, 267 Adhesion molecules 60 AIDS 97, 161, 182, 183, 187, 254, 266 Alloimmune412 Alveolar cell carcinoma 42 Aminoacyl-tRNA synthetases 85, 89 Amphiphysin 129, 160 Amyloid 45 Amyloid arthropathy 137 Amyloidosis 52, 124, 255, 262, 263 Amyotrophic lateral sclerosis 270 Anaplastic lymphoma 263 ANCA 372 Angiogenesis 193 Angiosarcoma 162 Angiosarcoma of the liver (ASL) 169, 184, 195, 196 Antiacetylcholine receptor antibodies 414 Antiacetylcholine receptor idiotypes 365 Anti-AchR 167, 370 Anti-AChR autoantibodies 225 Antiamphiphysin 128 Anti-anti-id antibodies 384-386, 389 Antibodies to cardiolipin 93 Antibody mediated cell mediated cytotoxicity (ADCC) 11 Anti-CAR 167 Anticardiolipin antibodies (ACA) 371, 372 Anticardiolipin syndrome 235 Anti-CENP-F 177 Anticyclin Bl antibodies 164 Anticytoplasmic antibodies 143 Antidiuretic hormone syndrome (arginin-vasopressin) 122 Anti-DNA 224, 226, 280, 368-370, 373 Anti-DNA antibodies 367, 425
Anti-DNA idiotype (16/6) 143, 372, 365 Antiendomysial autoantibodies 107 Antiendomysium 106 anti-Fas 236 Anti-Fas antibodies 277-279 Antifibrillarin 167 Anti-GBM antibodies 311, 313 Anti-GD3 ganglioside mAb 382 Antigliadin 107 Antigliadin antibodies 106 Anti-GOR antibodies 290 Anti-Hu(ANNA-l) 128, 167 Anti-Hu antibodies 130 Anti-Hu encephalomyelitis 130 Anti-id 382, 386 Anti-id antibodies 380 Anti-id mAb 381, 384, 385, 389 Anti-idiotype 367 Anti-idiotype antibodies 234, 365, 368 Anti-idiotypic therapy 373 Antijejunal antibodies 106 Ami-Jo-1 287 Anti-Jol ab 85 Antilysozyme antibodies 224 Anti-MAG activity 226 Antimalarial 31 Antineutrophil cytoplasmic antibody 51, 52 Antinuclear and antithyroglobulin antibodies 243 Antinuclear antibodies (ANA) 93, 135, 142, 143, 165-167, 255, 286, 423-425 Antinuclear autoantibodies (ANAs) 175 Anti-p53 170 Antiphospholipid antibodies 93, 143, 167, 372 Antiphospholipid syndrome 5, 6, 251, 288, 371 Antiplatelet autoantibodies 413 Anti-Pr antigen specificity 414 Anti-Purkinje cell antibodies APCA 166 Anti-red blood cell autoantibodies 224 Antireticulin 106 Anti-Ri 128, 129, 167 Anti-Ri antibodies 130 Anti-RNP 143 Anti-Ro/SSA antibodies 71 Anti-RyR 167 Anti-Sm 143 Antismooth muscle antibodies 286 Anti synthetase ab 86 Anti-TAA 386 Anti-TAA antibodies 381 Anti-TAA mAb 388 Anti thymocyte globulin (ATG) 415 Anti-thyroglobulin 371
437
Anti-thyroglobulin antibodies 413 Anti-thyroglobulin autoantibodies 3 Antititin 167 Anti-Tr 128, 129 Antitumor immunity 399, 401, 402 Anti-VGCC (voltage gated calcium channel), 128, 129, 167 Anti-VGKC 167 Anti-Yo 128, 129, 167 APO-1 244, 277 APO-1L277 Apoptosis 4, 60, 181, 182, 193, 233, 235, 277-279, 399 APS 98 Arthritis 134, 136, 285 Arthropathies associated with cancer immunotherapy 137 Ascites 197 Aspirin 24 Atopic dermatitis 429 Autoantibodies 106, 141, 159, 175, 205, 223, 224, 234, 243, 255, 267,285,366,412 Autoantigens 106, 160, 234 Autoimmune disease 105, 182, 213, 224, 233, 234, 249, 253, 287, 338, 339, 365, 367, 401, 409, 430, 431 Autoimmune haemolytic anemia (AIHA) 4, 5, 97, 127, 141, 224, 236,281,412,413,424,425 Autoimmune neutropenia 142, 413 Autoimmune rheumatic diseases 111, 423 Autoimmune thrombocytopenia 127, 141, 254 Autoimmune thrombocytopenic purpura 425 Autoimmune thyroid 318 Autoimmune thyroid disease 35, 105, 146, 311, 425 Autoimmune thyroiditis 224, 310, 319 Autoimmunity 3, 223, 236, 244, 253, 254, 286, 309, 313, 337, 358, 397 Azathioprine 19, 23, 26, 34-36, 425, 430-432 B lymphocytes 1, 224, 261, 344 BxSB410 BAV370 B23 175 B23/nucleophosmin 163 B2-glycoprotein I (B2-GPI) 93, 95 Bacille Calmette Guerin (BCG) 383 BAGE 166, 355, 398, 402 Barretts' oesophagus 170, 184 Barrett's syndrome 41 Basal cell 36 Basal cell carcinoma 86, 431 Basic fibroblast growth factor (bFGF) 278 B-cell310,429 B-cell lymphoid malignancies 62 B-cell lymphoma 59, 63, 64, 72, 127, 196, 214, 270, 389, 366, 432 B-cell malignancies 223 bcl-2 7, 37, 57, 60, 61, 244, 278-280, 289, 291 Bcl-xl 278 Behcet's disease 254 Bence Jones proteinuria 263 Benign monoclonal gammopathy 98 Biliary cirrhosis 235 Bladder cancer 423 Bleomycin 424 B-lymphoproliferative disorders 233 Bone-marrow transplantation (BMT) 251, 409
438
brc-abl 399 Breast cancer 41, 42, 45, 193, 160, 161, 169, 179, 181, 182, 184, 185, 187, 195, 198, 213, 423, 424, 431, 432 Breast cancer-associated mucin (MUC-1) 348 Breast lymphoma 268 Bronchial asthma 429 Bronchial carcinoma 52 Bronchial small cell CA 268 Bronchiolar ("alveolar-cell") carcinoma 45 Bronchiolar carcinoma 111 BUBl 176 Budd-Chiari syndrome 127 Burkitt 289 Burkitt's lymphoma 32, 58 Busulfan415 CI 10 C2 10 C2 and C4 deficiency 36 C4 10 CA-125 88,89, 187 CA19-9 187 CA242 187 Calmette-Guerin bacillus immunotherapy 137 Calreticulin 106 Cancer arthritis 133 Cancer of the cervix 268 Cancer of the colon 268 Cancer of the ovary 268 Cancer vaccination 338 Carcinoembryonic antigen (CEA) 264, 267, 355, 356, 398, 398 Carcinogenesis 181, 205, 214 Carcinoid 45, 108 Carcinoma 94, 105, 108 Carcinoma of the bladder 290 Carcinoma of the colon 290 Carcinoma of the pancreas 290 Carcinoma of the breast 143 Carcinoma of the cervix 143 Carcinoma of the esophagus 46 Carcinoma of the head and neck 198 Carcinoma of the lung 94, 95, 143 Carcinoma of the ovary 143 Carcinoma of uterus 290 Cardiolipin 144 Cardiovascular disease 309 CASP-8 399 Caspase 278, 279, 399 Castleman's disease 253 )6-catenin 355 CD 254, 255 CD5-h 226, 227, 228 CD(=CD95) 235 CDllc65 CD22 242 CD3 214 CD34 411 CD34-h 357, 417 CD4 2, 214, 338-340 CD4+ 286, 319, 321, 354, 355, 369, 373, 399, 413 CD4+ cells 344 CD4-hT cells 318
CD4+ T lymphocytes 106 CD40 244, 280, 318, 353, 354 CD40L 354 CD5 6, 241, 242 CD5+ B 37, 244 CD5+B cells 61, 242 CDS 2, 214-216, 339 CD8+ 277, 286, 344, 354, 355, 358, 372, 413 CD8+T cells 318 CD8+ T lymphocytes 106 CD80(B7.1)318, 320 CD80/CD28 60 CD86(B7.2)318, 320 CD86 320 CD95 215, 244, 277, 278, 358 CD95L 277 CDK4 355 cDNA expression libraries 175 cDNA libraries 176 CDR3 225 CEA 168, 187 Celiac disease 264 Cell-cycle 164, 181 CENP-F 160, 165, 176, 178, 179 Centromere 5, 164, 175, 176 Centromere protein 163, 175 Centromere protein F (CENP-F) 164 Cerebellar hemangioblastoma 123 Cervical cancer 34, 269, 270 Cervix carcinoma 35 CGVHD413 Chemotherapy 423, 424, 426 Chlorambucil 23, 26, 270 CHOP 72 Choriocarcinoma 347 Choriomeningitis virus (LCMV) 402 Chromatin 175 Chromosomal aberrations 26 Chromosomal translocations 57 Chronic active hepatitis 412 Chronic fatigue syndrome 175 Chronic graft-vs-host disease 99, 431 Chronic granulocytic leukemia (COL) 34 Chronic HBV infection 197 Chronic hepatitis 164, 165, 285 Chronic liver disease 177, 183, 195 Chronic lymphatic leukemia (CLL) 123, 127, 271, 425 Chronic lymphocytic 86 Chronic lymphocytic leukemia (CLL) 34, 61, 126, 136, 223, 225, 233-236, 241-244, 262, 281, 290 Chronic myelogenous leukemia (CML) 35, 42, 413, 414 Chronic myelomonocytic leukemia 96, leukemia 270 Chronic obstructive lung disease 135 Chronic obstructive pulmonary disease (COPD) 184 Chronic pancreatitis 184, 195 Churg-Strauss syndrome 51,425 Churg-Strauss vascuhtis 94 Cigarette smoke 310 Circulating immune complexes (CIC) 266, 267, 269 Cirrhosis 51, 285, 289 Cisplatin 424 Class 1425
Class II MHCs 344 CLL-B 226, 227 CLL plasmacytoma 268 Clonal deletion theory 223 c-myb37, 161, 175 c-myc 37, 161,175,278 Coeliac disease 105 Coiled bodies 175 Cold agglutinin syndrome 236 Cold agglutinins (CA) 141, 225 Cold lymphocytotoxins 243 Colon cancer 160, 214, 431 Colon cancer 32% 161 Colon carcinoma cells 214 Colonic carcinoma 268 Colorectal adenoma 184 Colorectal cancer 161, 183, 195, 196 Colorectal carcinoma 181, 182, 186, 267, 382, 383 Complement system 2 Connective tissue disease 85 Coombs 236 Coomb's test 144 Corticosteroids 31, 106, 346, 409, 423 CRl 10 cr-abl 355 c-rafRNA37 CRC 184, 187 Crohn's disease 184, 255, 410 Cross-reactive 365 Cross-reactive idiotypes (CRI) 67, 226 Crow-Fukase syndrome 270 Cryoglobulinemia 51, 59, 68, 288 Cryoglobulinemic vasculitis 49 Cryoglobulins 56, 63, 68 CT7 166 CTLs 399-401 Cutaneous granulomatous vasculitis 50 CyclinBl 170 Cyclin-dependent kinase (CDK) 164 Cyclin-dependent kinase (CDK)4 399 Cyclins and CDKs 163 Cyclophosphamide 21, 23, 26, 34, 35, 339, 423, 424, 431, 432 Cyclosporin 87, 429 Cyclosporin A 415 Cyclosporine 19, 26 Cyclosporine A 409 Cystic fibrosis 135 Cytokines 1, 61, 237, 261, 262, 277, 313, 339, 348, 356, 379 Cytomegalovirus (CMV) 319, 412 Cytotoxic 31 Cytotoxic agents 23, 409 Cytotoxic T lymphocytes (CTL) 379 Cytotoxicity 11 Dapsone 107 DBA/2 209 DC 353-357 Death-inducing signaling complex (DISC) 278 Dendritic cells 353, 358 Dermatitis 410 Dermatitis herpetiformis 105, 107, 270 Dermatomyositis 27, 85, 111, 113, 116, 125, 133, 142, 287
439
Dermatomyositis and polymyositis 145 Dermatopolymyositis 83 Desmosomes 5 Diabetes mellitus 235, 425 Disease modifying anti-rheumatic drugs (DMARDs) 19, 23, 26 DNA 5, 206 DNA repair 193 DNA topoisomerase 175 DNA topoisomerase II 163 DNA vaccines 401 Doxorubicin 423 Drug-induced myositis leukemia 86 dsDNA 143, 144, 168, 205 Dukes C colon cancer 184 DVT 95 Dysplastic adenoma 181 E26 virus 205 Early pregnancy factor (EPF) 345 Eaton-Lambert syndrome 142 Ectopic ACTH syndrome 122 ELISA 162 Embryo-associated suppressor factor (EASE) 345 Encephalomyelitis 129 Encephelomyelopathies 166 Endometrial cancer 195 Endometrium 345 Endometrium carcinoma 196 Enterocytes 106 Enteropathy 105 Enteropathy-associated T-cell lymphoma (EATL) 107 Eosinophiha 32 Eosinophilic fasciitis 135 Epidermal growth factor (EGF) 278, 346 Epitope mimicry 234 Epstein-Barr Virus (EBV) 26, 27, 56, 58, 63, 145, 217, 226, 253, 262, 265, 266, 269, 368, 399, 430, 431 ERGB 210 ERGB/FLIl 205, 209, 209 Erythema gyratum repens 125 Erythrocytosis 127 Erythrocytosis syndrome 123 Erythroderma and exfoliative dermatitis 125 Erythromelalgia 125 Erythropoietin (EPO) 123 ESQ 166 Esophageal cancer 198 Esophageal carcinoma 184 Esophagitis 184 Essential thrombocytosis (ET) 35 Estrogen 10, 36 ETS 209 ETS family 205 ETSl 210 ETS2 208 Ewing's sarcoma (EWS) 207 Experimental allergic encephalomyelitis (EAE) 338, 339 Experimental autoimmune encephalomyelitis 366 Experimental autoimmune myasthenia gravis (EAMG) 370 Experimental autoimmune thyroiditis 373 Experimental autoimmune uveoretinitis (EAU) 370 Extramammary Paget's disease 125
440
Fas235, 244, 277,279-281 Fas-associated phosphatase-1 (FAP-1) 278 Fasciitis 134 FasL 277, 280 FasL-Fas 278 Felty's syndrome 20, 23, 24 a-fetoprotein 197, 398 Fibrillarin 163, 165, 175 Fibrinogen 106 Fibrinopeptide A 94 Fibromyalgia 424 Fibromyalgia syndrome 288 Fibrosarcoma 122 Fibrosarcoma cells 214 Fibrosis 42, 45 Florid cutaneous papillomatosis 126 Fluorouracil (CMF) 423 5-fluorouracil 424 Focal glomerulonephritis 121 Follicle center lymphoma 57 Follicular lymphomas 223 Eos 278 G2 176 GABPa 206 GAGE 166, 355, 399,402 Galectin-4 175 Gastic parietal cells 5 Gastric CA 268 Gastric cancer 51, 185, 198 Gastric carcinoma 186, 264 Gastric parietal cell antibodies 425 Gastric pseudolymphomas 237 Gastrointestinal cancer 143 GD2 160 Genetic alterations 58 Generalized lymphoproliferative disease (gld) 281 Gestational trophoblastic disease (GTD) 343, 347, 348 Gliadin 107 Glioblastoma multiforme 431 Glioma 186, 196 y-globulins 33 Glomerulonephritis (GMN) 288 Glomerulopathies 121 Gluten 105 Gluten-free diet 105 Gluten-sensitive enteropathy 107, 170 Glycoproteins 159 GMl 160 GM2 160 GM-CSF 353, 356, 357 Goiter 280 Gold 23 Gold salts 19 Goodpasture's syndrome 5, 311, 313 Gottron's papules 125 gp75 175 gp96 213-218 gpl00 355, 398 Graft vs leukemia (GVL) 411, 414, 415, 417 Graft-vs-host disease 87 Granulocyte-colony-stimulating factor 127
Graves 319, 320 Graves' disease 4, 5, 182, 242, 280, 311, 312 Growth factors 45 Growth hormone (GH) 123 grp78 214 Guillan-Barre syndrome 130, 288 GVHD 411,412, 415, 416 Gynecological cancer 432 Haemolytic anaemia 235, 254 Hairy-cell leukemia 50, 94, 96, 126, 135 HAL-DP 317 Hashimoto thyroiditis (HT) 312, 319 Hashimoto's disease 288 Hashimoto's thyroiditis 5 hBUBRl 176 HCCl 163 hCG 345, 346 HCV286, 287, 289-291 Head and neck cancer 179, 195, 196, 265-267 Heat shock protein HSP70 182, 194, 213 Helicobacter pylori 59-61, 69, 70, 234, 237, 238, 263, 264, 290 Helper!cells 317 Hematologic malignancies 32 Hemoptysis 311 Henoch-Schonlein 51, 94 Henoch-Schonlein purpura/polyarteritis nodosa 270 Hepatic metastases 264 Hepatitis B 177 Hepatitis B surface antigen (HBsAg) 290 Hepatitis B virus 51 Hepatitis C 36, 195 Hepatitis C virus (HCV) 49, 56, 58, 59, 63, 183, 187, 285, 425 Hepatocellular carcinoma (HCC) 51, 123, 143, 164, 169, 183, 195197, 280, 285, 288 Hepatoma 34, 145 HER-2/neu 160, 355, 402 HER-2/neu oncoprotein 175 Herpesvirus-8 (HHV-8) 253 Histiocytic lymphoma 42, 55, 264 Histiocytic necrotizing lymphadenitis 33 Histiocytoma 134 Histones 144, 167, 205 HIV 279 HLA 105, 261, 317, 345, 347, 357, 388, 390, 399^01, 414, 416 HLA class I 389 HLA class II 214 HLA DQ2 107 HLADR2 106 HLA DR3/4 7 HLADRBl 19 HLA system 36 HLA-A2 216 HLA-B27 8 HLA-DM317, 318, 321 HLA-DP 322 HLA-DQ 105, 317,322 HLA-DQ)S 319 HLA-DR 8, 214, 311, 312, 317, 319-322, 327, 328 HLA-DR^319 HLA-DR2 8 HLA-DR3 8, 58, 286
HLA-DR4 8, 137,286,399 HLA-DR5 8 HLA-G 344, 347 HLA-I 286 HNL 290 Hodgkin's disease 23, 31, 32, 65, 94, 121, 125, 127, 129, 130, 142, 233, 263, 271 Hodgkin's lymphoma 33, 86, 124, 126, 128, 142-144, 263, 288 HOM-MEL-2.4 160 Hormonal factors 36 H-ras214 HSP60 217 HSP 70 213-218 HSP72 214, 312 HSP 90 213 HSP 65 10 Hu 160, Hu 166 Human herpes virus-6 59 Human neurotropic virus 297 Human papilloma virus (HPV) 36, 265, 268, 269, 355, 399 Human T-cell leukemia virus (HTLV) type 1 36, 183, 187, 194 Hurler's syndrome 411 Hydroxiclorochine 432 Hydroxyurea 87 Hypercalcemia syndrome 122 Hypernephroma 141 Hyperphosphaturia 123 Hyper-reninemic syndrome 123 Hyperthyroidism 280, 288, 410, 413 Hypertrichosis lanugiosa acquisita 126 Hypertrophic osteoarthropathy 125, 134, 136 Hypo-y-globulinemia 262 Hypoglycemia syndrome 122 Hypophosphatemia 123 Hypothyroidism 280, 288, 312,401, 413 ICAM-1 312,347,353 IDDM4 Idiopathic thrombocytopenic purpura (ITP) 5, 141, 236, 413 Idiotype 8, 9, 224-227, 233, 365, 380, 398 Idiotypic system 2 IFN-y 262, 279-281, 286, 312, 340 IFNs 345 IgA 182, 194,261,264-271 IgA autoantibodies 267 IgA deficient 262 IgA dermatosis 271 IgA nephropathy 121 IgG2-IgG4 deficiency 262 IgM/c 56 IgMk 62, 68 IgMk monoclonal component 61 IL-1 2, 61, 127, 133, 280, 309, 353 IL-1/6 136,280,281 IL-2 2, 7, 61, 65, 71, 99, 137, 286, 310, 400, 429 IL-2r 94 IL-3 61 IL-4 2, 61, 262, 267, 286, 354, 357, 429 IL-5 262, 354 IL-6 2, 61, 94, 127, 133, 262, 309 IL-7 2, 356 IL-8 280, 309
441
IL-10 2, 61, 262, 267, 286, 354 IL-12 262, 340, 354, 356,401 IL-13 61 Immune complex (CIC) 12, 66, 142, 265 Immune thrombocytopenia 413 Immune thrombocytopenic purpura 281 Inmiunization 402 Immunodeficiency disease 262 Immunologic homunculus 6 Immunosuppression 430 Immunosuppressive 46 Immunosuppressive agents 35 Immunosuppressive therapy 34 Immunotherapy 379, 381, 386, 389, 397, 398, 401, 402, 410 Inclusion body myositis (IBM) 85 Inflammatory bowel disease (IBD) 184 Inflammatory myopathy 287, 424 Insulin dependent diabetes 5 InsuHn-dependent diabetes mellitus (IDDM) 105 Insulinitis 402 Insulin-like growth factor (IGF) II 122 Insulin-like growth factor 1312 Insulin-like growth factor-1 (IGF-1) 278 Insulin-like growth factors (IGF-I) 346 Integrin 106, 108 Interferon 35, 285, 425 Interferon-a 87, 426 a-interferon 93, 99, 287 Interferon-)/ (IFN-y) 267, 280, 317-321, 326-328, 356 Interleukin(IL)-10 60 Interleukin-(IL)-la 278 Interleukin-(IL)-lra 133 Interleukin-(IL)-2 immunotherapy 401 Interleukin-(IL)-2 receptor (IL-2R) 209 Interleukin-(IL)-6 254 Interleukin-2 87, 99 Interstitial cystitis 175 Interstitial lung disease 287 Intestinal lymphoma 264 Intestinal vascuhtis 287 Intracellular adhesion molecules 1 (ICAM-1) 311 Intrahepatic chemotherapy 52 Intravenous immune globulin (IVIG) 235, 236, 280, 370-372 Intravenous immunoglobulins 432 K-Irradiation 339, 340 Ischemic colitis 52 Jaccoud's 135 Jchain"J" chain 261 JCV 297-300, 302 Jeme's network theory 386 Jo-15 Jun 278 Kaposi's sarcoma 290 Kawasaki disease 52 Keratinocytes 182 Kidney 95 Kikushi syndrome 33 Kinetochore 176 La(SS-B)5,144
442
LA 95, 97-99 La/SS-B 167 Lambert-Eaton myasthenic syndrome (LEMS) 87, 129, 130 Lamina propria 105 Laminin 106 Langerhans cells 353 Laryngeal carcinoma 265, 312 Latent membrane protein (LMP) 1 399 Latent membrane protein 1 (LMP-1) 27 Leiomyosarcomas 108, 122 Leucocytoclastic vasculitis 425 Leukaemia 20, 23, 31, 34, 46, 82, 96, 125, 135, 136, 141, 143, 195, 196,366,399,410,423,431 Leukaemic arthritis 135 Leukocytoclastic vasculitides 50 Leukocytoclastic vasculitis 49, 287 Leukocytosis 127 Lewis lung carcinoma 400 LFA-353 LH-RH analogues 87 Li-Fraumeni syndrome 170, 181 Lipopolysacharide (LPS) 309-311 Livedo reticularis 287 Liver cancer 179 Liver cirrhosis 59, 135, 165, 195 Liver disease 175 Liver metastases 186, 187 Liver-kidney microsomal antibodies (anti-LKM) 286 1-mycL-myc 160, 161 Long acting thyroid stimulating (LATS) 11 lpr281 LPS 262 Lung cancer 19, 24, 34, 41, 42, 50, 116, 145, 161, 162, 164, 169, 179, 181, 182, 184-187, 194-197, 267, 268, 312, 431 Lung carcinoma 135, 309 Lupus anticoagulant (LA) 94 Lyl+B227 Lyb-1 B 37 Lymph-node hyperplasia 253 Lymphoblastic leukemia 234 Lymphoblastic lymphomas 234 Lymphoblastoid hamartoma 253 Lymphocytic lymphoma 61, 97 Lymphoid follicles/MALT 59 Lymphoma 20, 26, 32, 35, 37, 41, 46, 55, 57, 62, 70-72, 96, 105, 107, 108, 126, 136, 141, 143, 161, 207, 234, 237, 242, 262, 271,423,425,431 Lymphoplasmacytic lymphoma 98 Lymphoproliferation 63 Lymphoproliferative cancer 20, 22, 23 Lymphoproliferative disease 49, 55, 262 Lymphoproliferative disorders 262 Lymphoproliferative neoplasm, 116 Lymphoproliferative tumors 19 Macroglobulinemia 55, 263 Macrophage myofasciitis 85 MAGE 166, 175, 355, 398, 400, 402 MAGE-1 160, 165 MAGE-3 160 Malabsorption 105 Malaria 61
Malignant B-lymphoproliferative disorders 234 Malignant lymphoma 49, 87, 233 MALT lymphoma 58, 59, 69, 70, 234 Maltoma 237, 238 MALTomas 290 Mamma carcinoma 196, 198 Mammary tumors 268 Mantle cell lymphoma 58 Marginal zone B-cell lymphoma (MZL) 63 Mastocytoma 402 MCS 287 mdm2 protein 181 Mediterranean lymphoma 264 Melan-A 355 Melanoma 24, 94, 99, 141, 143, 145, 216, 270, 271, 357, 382-384, 398,400,401,431 Membranous nephropathy 121 Mesotheliomas 122 Metastases 133, 187 Methotremate 34 Methotrexate 19, 23, 26, 34, 432 Methylchloranthrene 397 M gammopathies 33 MGUS 98 MHC 4, 89, 187, 215, 217, 224, 344, 354-356, 397, 416, 425 MHC class I 218, 238, 353, 379, 381, 388 MHC class II 234, 317-322, 324-327, 347, 355 MHC II 2 Mi2b 89 Microvasculitis 85 MIgs62,66,67,71 Minimal change glomerulopathy 121 Mitochondrial antigens 5 Mitosin 176 Mitotic spindle function 193 Mixed connective tissue disease 86 Mixed cryoglobulinemia syndrome 285, 287, 289 Molecular mimicry 63 Mo-MuLV 206 Monoclonal gammopathy 98, 143, 223, 262, 269 Monoclonal paraproteins 23 Monocytoid B-cell lymphomas (MBCL) 58, 63, 64, 65 Mononeuritis multiplex 287 Morning stiffness 19 M-protein 262 MRL281,369 MRL/lpr 366, 410 MRL Ipr/lpr 7 MUCl 160 Mucin MUC-1 159 Mucocutaneous paraneoplastic syndrome 123 Mucosa 105, 107 Mucosal immune system 261 Mucossa-associated lymphoid tissue (MALT) 58, 60, 62, 63, 64, 254, 263, 270, 289 Multicentric reticulohistiocytosis 126 Multiparous women 195 Multiple myeloma (MM) 19, 34, 46, 65, 66, 126, 195, 233, 234, 241-243, 262, 263, 270, 271, 415, 431 Multiple sclerosis 409 Murine leukemia virus 206 Myasthenia gravis (MG) 5, 34, 142, 166, 249, 251, 255, 320, 365
MYB 209 MYC 209, 289 Mycobacterium tuberculosis 10 Mycosis Fungoides 97 Myelin basic protein (MBP) 6, 338, 366, 367, 373 Myelin-associated glycoprotein 269 Myeloablative treatment 410 Myelodesplastic syndrome 23 Myelodysplastic syndrome (MDS) 51, 136 Myeloid leukemia 312 Myeloma 20, 23, 99, 224, 226 Myocardial infarction 135 Myositis 42, 85-89 Myxoedema 280 Myxomas 52 Naked DNA 401 Nasopharyngeal carcinoma 58, 86, 265 Natural autoantibody (NAA) 5, 223, 224, 225, 227, 233 Natural killer (NK) 318 Natural killer cell 106 Natural occurring autoantibodies (NOA) 159 Necrotizing vasculitis 52 Nerve growth factor (NGF) 278 Neurofibromas 122 Neuromyotonia 130 Neuronal 129 Neutropenia 127 New Zealand Black (NZB) 3, 208 New Zealand White (NZW) 208, 209 Nitric oxide (NO) 279 NK cells 107, 214, 216, 277, 344, 346 Nodular and diffuse lymphocytic lymphoma 55 Nodular reticulum cell 55 Nonbacterial thrombotic endocarditis 95 Noncollageneous (NCI) 311 Non-Hodgkin's lymphoma (NHL) 19, 23, 31, 35-37, 41, 46, 49, 51, 56, 58, 59, 70, 72, 82, 86, 94, 95, 97, 107, 126, 136, 142-144, 195, 225, 227, 235, 236, 263, 285, 289, 347, 415, 424,431 Nonsmall-cell lung carcinoma 198 Nonsteroidal anti-inflammatory (NSAID) 31 NOR-90/hUBF 163, 165, 175 NOVA 129 NSAID 24 Nucleolar proteins 168 Nucleoli 175 Nucleophosmin 165 Nude mice 301 Nur77 278 NY-ESO-1 160, 165, 175 NZBxNZW208,410,416 NZBAV 369, 373 NZBAVF 368 NZWxNZB 37 Oat-cell carcinoma 45 Oestrogen 182 0H1,25 OH vitamin D 123 Oncogene v-ETS 205, 206 Oncogenic osteomalacia syndrome 123 Onconeural 129
443
Oncoproteins 159, 160 Ophthalmopathy 311 Opsoclonus/myoclonus 130 Osteomalacia 123 Ovarian adenocarcinoma 86, 87 Ovarian cancer 179, 185, 195, 197, 424 Ovarian carcinoma 196, 268, 382, 384 Ovary cancer 161 Oxidants 309 plg5HER-2/neu j ^ j
p21'"^^ 160, 161 p330^ 176 p53 58, 160, 161, 175, 181, 182, 193, 197, 278, 291, 297, 302, 319, 355, 402 p53 AAb 164, 168 p53 autoantibodies (p53AAb) 181, 182, 285, 187, 193-195, 197, 198 Paclitaxel 87 Palmar fasciitis 126, 133 Pancreas carcinoma 195-198 Pancreatic carcinoma 184 Pancreatic islet cells 5 Panniculitis 126 Papilloma and herpes virus 430 Paraneoplastic 87 Paraneoplastic arthritis 133 Paraneoplastic arthropaties 135 Paraneoplastic cerebellar degeneration (PCD) 129, 130, 166 Paraneoplastic neurologic syndromes 175 Paraneoplastic pemphigus 126, 255 Paraneoplastic syndrome 42, 43, 121, 141, 269, 271, 401, 423 Paraneoplastic vasculitides 49 Parotid lymphomas 58 Paroxismal cold hemoglobinuria 223 Pemphigus 4, 5, 34, 249 Penicillamine 23 Perecarditis 19 Peripheral neuroectodermal tumors (PNET) 207 Peripheral neuropathy 130 Pernicious anaemia 5, 35, 425 Phagocytosis 11 Phenothiazines 320 Pheochromocytoma 52 Phosphatidylinositol 95 Plasma cell dyscrasias/multiple myeloma 99 Plasma cells 106,234,253 Plasma cells dyscresia 33 Plasmacytoma 65, 262, 263, 270 Platelet-derived growth factor (PDGF) 346 Pleuritis 19 PMR 82, 83 POEMS syndrome 253, 270 Polimerase chain reaction (PCR) 57 Poly (G) 144 Poly (I) 144 Polyarteritis nodosa 50-52, 94 Polyclonal activation 7 Polyclonal B-cell activation 56 Polycythemia 126 Polymyalgia rheumatica 50, 81 Polymyositis 5, 85, 111, 113, 142, 287, 288
444
Polyoma 397 Polyphenol rich glycoprotein 309 Postchemotherapy rheumatism 424, 426 Povavirus BKV 298 Praneoplastic vasculitides 50 Premyelocytic leukemia 127 Primary billiary cirrhosis 4, 5 Primary gastric lymphoma 263 Primary IgA nephropathy 270 Progenitor cells 410 Progesterone 182 Progressive sensory neuropathy 270 Progressive systemic sclerosis (PSS) 41-43, 431 Proliferation-associated nuclear protein CENP-F 175 Proopiomelanocortin (POMC) 122 Prostate 184 Prostate cancer 169 Prostate carcinoma 194-196, 198, 431 Prostate-specific antigen (PSA) 357 Prostate-specific membrane antigen (PSMA) 357 Proteases 278, 279 Proto-oncogene 37 Pruritis32, 126 Pseudolymphoma 55, 57, 63, 238, 242 Pseudomalignancies 49, 52 Pseudovasculitides 49, 52 Psoriasis 432 pSS244 PTH 122 Pulmonary fibrosis 24, 135, 146, 424 Pure red cell aplasia (PRCA) 34, 249, 250 Purkinje cells 129 Radiation 163 RAF 209 RAGE 355, 399 Raloxifene 424 Rapidly progressive glomerulonephritis 121 Raynaud 168 Raynaud's phenomenon 52, 66, 94, 168, 24 Raynaud's syndrome 426 Receptor for thyroid stimulating hormone (TSHR) 320 Receptor-bound protein 2 (Grb2) 278 Rectal cancer 431 Reiters syndrome 137 Relapsing polychondritis 254 Renal carcinoma 95 Renal cell carcinoma 51, 270, 399 Reticulosarcoma 55 Reticulum cell sarcoma 55 Rheumatic fever 135 Rheumatoid arthritis (RA) 1, 5, 19, 20, 25, 32, 35, 56, 61, 70, 97, 111, 112, 116, 133, 136, 144, 235, 242-244, 254, 281, 310, 409,410,423,425,430,431 Rheumatoid factor (RF) 12, 56, 57, 61-63, 71, 135, 143, 166, 167, 225, 226, 228, 243, 255, 286, 311, 367, 368, 423 Rheumatoid nodules 24 Ri 160 Ri AAb 166 Ribavirin 285 Ribonucleoprotein 106 rIL-2 415,417
RNP 143, 144 Ro (SS-A) 5, 144, 167, 168 Ro/SS-A antibodies 287 Saliva 261 Salivary IgA 266 S-antigen (S-Ag) 370 Sarcoma 128, 181 Sarcoma cells 214 Scleroderma 5, 41, 45, 86, 111, 124, 145, 162, 270 SCP 166 Secretory IgA (sIgA) 261, 262 Segmental glomerulonephritis 121 Sensory carcinomatous neuropathy 159 Sepsis 36 SEREX 165, 170 SEREX (serological analysis of recombinant cDNA expression libraries of human tumors with autologous serum) 159 Serological analysis of recombinant cDNA expression libraries (SEREX) 175 Serositis 19 Serum IgA 266 Sezary syndrome 97 SG2NA 160 Sicca symptom 285, 288 Sicca syndrome 254, 287 Signal transduction pathway 205 Simian virus 40 402 Sister chromatid exchanges 26 Sjogren's disease 281 Sjogren's sicca syndrome 412 Sjogren's syndrome (SS) 5, 19, 23, 32, 42, 55, 56, 57, 63, 66, 67, 70, 71, 72, 97, 105, 111, 113, 116, 145, 175, 182, 194, 235, 242,254,287,413,423 Sm 143, 144, 167 Small cell carcinoma 267 Small cell lung cancer (SCLC) 128-130, 166, 182, 196 Small-cell lung carcinoma 198 Smokers 164, 184, 312 Smoking 163, 198,309,313 Smooth muscle antibodies 143 Soft-tissue sarcoma 34 Solid tumors 24, 31,34 Solitary plasmacytoma 262 S phase 176 Spi-1 206 Spindle cell carcinomas 122 Spliceosomes 175 Sprue 108 Squamous cell carcinoma (SCC) 34, 36, 45, 184, 267, 279 Squamous cell carcinoma of the head and neck 399 Squamous cell carcinoma of the tongue 290 Squamous-cell carcinoma of the oral cavity 197 SS 56, 57, 63, 66, 67, 70, 71, 72, 116 ssDNA 143, 144, 205 SSX 160, 166 Stem cells 357 Stem-cell transplantation 409, 416, 417 Stiff-man syndrome 129, 130 Still's disease 133 Stomach cancer 179 Stress proteins 218
Subacute cutaneous lupus (SCLE) 32 Subacute sensory neuronopathy (SSN) 166 Superantigen 234 SV40 215, 298, 300, 319, 397 Sweet's syndrome 126, 170 SWISS mice 209 Sympathetic dystrophy syndrome (RSDS) 133, 134 Synovitis 19,423 Systemic lupus erythematosis (SLE) 4-6, 10, 31, 86, 93, 96, 99, H I , 112, 135, 145, 161, 162, 164, 168, 175, 182, 183, 194, 205, 208, 224, 242-244, 249-251, 254, 280, 281, 287, 365, 367-369, 372, 409, 410, 423, 426, 432 Systemic progressive sclerosis (scleroderma) 412 Systemic sclerosis (SSc) 24, 32, 113, 116, 175, 182, 244, 425 >/5-Tcells214, 216, 310 T helper cell 2 (Th2) 354 T lymphocytes 1, 261, 267, 411 T suppressor cells 372 TA 82, 83 Tamoxifen 52, 424 Tar312 T-CD4 85 T-CD8 85 T-cell 213, 215, 217, 218, 310, 340, 355, 388, 410, 425, 429 T-cell leukemia 183 T-cell lymphoma 65, 97, 108, 125, 126, 432 T-cell lymphotropic virus type I (HTLV-1) 136 T-cellreceptor68, 278, 317 TCR 238 Ylh TCR 106 yh TCR-bearing T cells 107 Temporal arteritis 50, 81, 94, 254 TGF2 TGF-Qf 346 TGF-/8 280, 304, 312 TGP309, 310 Th2 348, 354 Thalassemia major 411 Thalidomide 432 T-helpercell 106,354 T-helper cell (Th) 262 T-helpercell 1 (Thl) 354 Thrombocytopenia 127 Thrombocytopenic purpura 425 Thrombocytosis 127 Thromboembolic events 94 Thromboplastin 99 Thrombopoietin 127 Thrombosis 127 Thymectomy 251 Thymic hyperplasia 249 Thymoma 34, 55, 95, 142, 249, 250, 290 Thyroglobulin 5, 224, 373 Thyroid 317, 318 Thyroid antibodies 425 Thyroid autoantibodies 143, 286, 288 Thyroid autoimmunity 321 Thyroid peroxidase (TPO) 320 Thyroid stimulating hormone (TSH) 319, 320 Thyroid stimulation blocking antibodies (TSBAb) 280 Thyroiditis 235, 288, 401
445
Thyroid-Stimulating autoantibodies 414 Thyrotoxicosis 413 TNF-a 94, 267, 278, 280, 286, 309 318, 319, 353, 357 Tobacco265, 312, 313 Tolerance 4, 223, 318, 338, 343, 358 Tonsillar cancers 265 Topoisomerase 5 Topoisomerase I 160, 167, 168 Tracheal chondromata 185 Transcription factors 205, 278 Transforming growth factor ^1 (TGF-)61) 261 Transforming growth-factor-)6 (TGF/6) 106, 317 Transgenic mice 59, 224 Transglutaminase 106 Transitional cell carcinoma 143 Transplantation 27 Trophoblast 343, 345, 347, 348 Trousseau's syndrome 95 TSH 280, 281,413 TSH receptor 5 T-suppressor 205 Tuberculosis 135 Tumor antigens 339 Tumor associated antigen (TAA) 379-381, 383-386, 388, 389 Tumor associated autoantibodies 169 Tumor cell proliferation 177 Tumor immunology 397 Tumor infiltrating lymphocytes (TIL) 214 Tumor necrosis factor a (TNF-a) 317 Tumor necrosis factor (TNF) 2, 127, 214, 279 Tumor necrosis factor (TNF)-a 61 Tumor stress protein 213, 214, 216, 217 Tumor-associated antigens 159, 398 Tumor-associated autoantibodies (TAA) 175 Tumor-derived HSP vaccines 216 Tumor-derived stress proteins 218 Type IV collagen 311 Tyrosinase 160, 175, 355, 398
446
Ul-RNP 167 U3-RNP 165 Ulcerative colitis (UC) 184 ultraviolet B (UVB) 36 Ultraviolet irradiation 397 Urinary bladder cancer 34 Urticaria 287, 429 Uveitis 254
Vaccination 218, 355, 397, 399, 400 Vaccine 213, 214 Vasculitides as adverse reactions to anticancer therapy 49 Vasculitis 19, 35, 49, 50, 83, 126, 182, 285, 288, 372, 410 Ventral nervous system antigen-1 129 VGCC 160 VH4-21 225 Vibrio cholera 264 Vinblastine 424 Vincristine 87 Vitamin D receptor 106 Vitiligo 270, 401 VSV215 Waldenstrom's IgM myeloma 179 Waldenstrom's macroglobulinemia (WM) 34, 82, 98, 164, 226, 233-236, 241-243, 262 Wegener's granulomatosis 51, 52, 182 Wiskott-Aldrich syndrome 413
Xerostomia 413 X-linked lymphoproHferative syndrome 58 Yo 160, 166 Zollinger-Ellison syndrome 196, 199