Synthesis of a One-Bead One-Compound Combinatorial Peptide Library Kit S. Lam and Michal Lebl 1. Introduction The four ...
42 downloads
1199 Views
19MB Size
Report
This content was uploaded by our users and we assume good faith they have the permission to share this book. If you own the copyright to this book and it is wrongfully on our website, we offer a simple DMCA procedure to remove your content from our site. Start by pressing the button below!
Report copyright / DMCA form
Synthesis of a One-Bead One-Compound Combinatorial Peptide Library Kit S. Lam and Michal Lebl 1. Introduction The four general methods to generate and screen a huge combinatorial peptide library +-lo7 peptides) are: biological libraries such as filamentous phage (I), plasmid (2)) or polysome (3) libraries; the “one-bead one-compound” synthetic combmatonal library method or the “Selectlde process” (4-6); synthetic peptide library methods that require deconvolution, such as an iterative approach (7,8), positional scanning (9); orthogonal partition approach (JO), or recurse deconvolution (II); and synthetic library using affinity column selection method (12,13). There are advantages and disadvantages m each of these methods. In general, the main advantages of the biological library method are that large peptides can be displayed on a filamentous phage library, and that large protein folds can be mcorporated into the library. However, the main disadvantage is that biological libraries, in general, are restricted to all L-amino acids. In contrast, the remaining three methods all use synthetic libraries; therefore, o-amino acids, unnatural ammo acids, nonpeptide components, and small rigid scaffoldings can all be incorporated into these libraries. The “one-bead one-compound” library is based on the concept (4,5) that when a solid-phase split synthesis method (4,8,14) is used, each solid-phase particle (bead) displays only one peptide entity although there are approx 1013 copies of the same peptide in the same bead. The resulting peptide-bead library (e.g., lo7 beads) is then screened in parallel using either “on-bead” binding assays (15) or “solution phase-releasable” assays (16) to identify peptide-beads with the desired biologic, biochemical, chemical, or physical properties. The From
Methods
m Molecular Biology, vol 87 Combmatonal Peptrde Edlted by S CablIly 0 Humana Press Inc , Totowa,
Library NJ
Protocols
Lam and Lebl
2
positive peptide-beads are then physically isolated for microsequencing with an automatic protein sequencer. In this chapter, detailed methods for the synthesis of a random “one-bead one-compound” combinatorial peptide library will be described. Chapters 2 and 10 give examples of two general screening methods for such libraries.
2. Materials 2.1. Chemicals 1. Tenta-Gel Resin S-NH, (90-100 pm) resin may be obtained from Rapp Polymere, Tubmgen, Germany (see Note 1). 2. Fmoc amino acids with standard side chain-protectmg groups, N-hydroxybenzotriazole (HOBt), benzotriazolyl-oxy-trisdimethylammo-phosphonmm hexafluorophosphate (BOP), diisopropylethylamme (DIEA), diisopropylcarbodumide (DIC), piperidme, trifluoroacetic acid (TFA), nmhydrm, may be obtained from many different suppliers, such as Bachem (Torrance, CA), Bioscience (King of Prussia, PA), Advanced ChemTech (Louisville, KY), Novabiochem (San Diego, CA), and Peptides International (Louisville, KY) 3. Technical grade solvents such as dimethylformamide (DMF) or dichloromethane (DCM) may be obtained from many different chemical suppliers HPLC-grade DMF for the coupling may be obtamed from Burdock and Jackson, Muskegon, MI. Ethanol, phenol, p-cresole, thioamsole, ethanedithiol, pyndme, and potassium cyanide may be obtained from many different chemical suppliers. 4 0 1 g/mL Nmhydrm in ethanol 5 4 g/mL Phenol m ethanol. 6 10 mM Potassmm cyanide, stock solution. 7. 50% Piperidme m DMF 8. Reagent K: TFAlp-cresolelwaterlthioamsole/ethanedithiol, 82 5*5:5:5*2.5. (v/v/ v/v/v) 9 10% DIEA m DMF. 10 Dimethylsulfoxide (DMSO)/Amsole/TFA, 10:5:85
2.2. Apparatus 1. Polypropylene vials (5-lo-mL) may be purchased from Baxter Scientific Products, McGaw Park, IL. Polyethylene disposable transfer pipets may be purchased from Elkay Products, Shrewsbury, MA. 2 Motorized rockmg platform. 3 Randomization glass vessel (chromatography column 5-6 x 18 cm) fitted with a medmm glass smtered frit connected to vacuum and nitrogen via a two-way valve from below The three positions of the valve are “off,” “vacuum,” or “nitrogen.” 4 Recnculatmg water aspirator or a solvent-resistant vacuum pump with cold trap 5 Nitrogen tank.
One-Bead One-Compound 3. Methods 3.1. Synthesis
of a Linear Pentapeptide
Library
As indicated
earlier, a solid-phase split synthesis method (4,8,14) is used to generate a random peptide library. The composition and final structure of the peptide library depends on the number of amino acids (one or more) used m each coupling cycle and the number of coupling cycles used. The final peptide library may be linear or cyclic, or have specific secondary structures. For simplicity, the method for the synthesis of a linear pentapeptide library with all 19 eukaryotic amino acids except cysteine is given below: 1. Swell 10 g TentaGel Resin S-NH, beads (- 0 25 mEq/g, see Notes 1 and 2) for at least 2 h m HPLC-grade DMF with gentle shaking in a silicomzed flask. 2 Wash the beads twice with HPLC-grade DMF in the slllcomzed randomlzatlon vessel as follows* add 75 mL DMF from the top, gently bubble nitrogen from below through the smtered glass for 2 min, then remove the DMF by vacuum from below (see Note 3). 3 Transfer all the beads to a slllcomzed flask in HPLC-grade DMF Then dlstrlbute the beads into 19 equal allquots. A disposable polyethylene transfer plpet IS extremely useful m the even distribution of the beads mto each polypropylene vial (see Note 4). 4 Allow the beads to settle and remove most of the DMF above the settled bead surface from each polypropylene reaction vial. 5 Add threefold molar excess of each of the 19 Fmoc-protected ammo acids (see Note 5) and threefold molar excess of HOBt to each reaction vial using a mmlma1 volume of HPLC-grade DMF. 6. Add threefold molar excess each of BOP and DIEA to each reaction vial to ml-
tlate the coupling reaction. 7. Cap the reaction vials tightly and rock them gently for 1 h at room temperature
8. To confirm the completion of couplmg reaction, plpet a minute amount of resin from each reaction vial into small borosilicate form ninhydrm test (17) as follows:
glass tubes (6 x 50-mm) and per-
Wash the minute quantity of resin m the small glass tubes (6 x 50-mm) sequentially with the following solvents* DMF, t-amyl alcohol (2-methylbutan-2-ol), acetic acid, t-amyl alcohol, DMF, and ether Add to each tube one drop of each of the following three reagents,(ninhydrin m ethanol (0.1 g/mL), phenol m ethanol (4 g/mL), and potassium cyanide stock solution diluted 50 times with pyridme. Place the tubes m a heating block at 120°C for 2 min. Observe the color intensity of the beadsunder a microscope.
To ensure complete couplmg, every bead from the minute quantity of sample beadsshould be nmhydrin negative, I e , straw yellow color.
4
Lam and Lebl
9 If the couplmg IS mcomplete (some beads remamed purple or brown with nmhydrm test), remove the supernatant from those reaction vials and add fresh Fmocprotected ammo acids, BOP, DIEA, and HOBt mto the reaction vial for addmonal coupling 10. If the couplmg 1s complete (beads remained straw yellow color with nmhydrm test) discard the supernatants of each reaction vial, and transfer and wash all the beads to the randomtzation vessel with technical grade DMF 11 After all the 19 couplmg reactrons are completed, all the beads are transferred to the randomizatton vessel Wash the beads (8 times, 2 mm each) with technical grade DMF 12 Add 75 mL 50% ptpertdme (m DMF) to the randomtzatton vessel to remove the Fmoc protectmg group After 10 mm, remove the ptpertdme and add 75 mL fresh 50% prpertdme. After another 10 mm, wash the beads 8 times wtth techmcal grade DMF and twtce with HPLC-grade DMF 13 Distribute the beads mto each of the 19 reaction vials and carry out the next couplmg reaction as described above 14. After all the randomtzatton steps are completed, remove the Fmoc protectmg group with prpertdine as described above 15 After thorough washing with technical grade DMF (5X) followed by DCM (3X), add 10 mL of reagent K (18) to the randomrzatron vessel for 3 h at room temperature 16. Wash the deprotected resms thoroughly with DCM (3X), followed by technical grade DMF (5X), then once with 10% DIEA to neutralize the resin 17. After thorough washing with technical grade DMF, store the bead library m HPLC-grade DMF at 4°C. Alternatively, the bead library can be washed thoroughly with water and stored in 0.1 M HCl or 0.1 Mphosphate buffer with 0 05% sodmm azide.
3.2. Synthesis
of a Cyclic Peptide Library
The synthesis of a cyclic peptide library (disulfide bond formation) is essentially the same as that of the linear library except that Fmoc-Cys (Trt) is added at the carboxyl as well as amino terminus of the linear random peptide After deprotectton, add a mixture of DMSO/Anisole/TFA (see Subheading 2.1., item 10) into the resin; incubate overnight at room temperature. After thorough washing, store the library at 4°C as described above. 4. Notes 1 We have tested several commerctally available resins for our library synthesis The two satisfactory resins are TentaGel (polyethylene grafted polystyrene beads) and Pepsyn gel (polydimethylacrylamtde beads) Overall, the TentaGel 1spreferable as it is nonsticky and mechanically more stable However, unlike Pepsyn gel, the level of substrtutron of each TentaGel bead is far from uniform Wtth the advent of combmatorral chemistry, we anticipate newer resins entering the market m the near future
One-Bead One-Compound
5
2. TentaGel already has a long polyethylene linker and we do not routmely add additional linker for our library synthesis In contrast, a linker (preferably a hydrophilic lmker) is necessary for the synthesis of a peptide library with polydimethylacrylamide beads. We have used Fmoc-P-alanme and/or Fmocaminocaprorc acid as linkers in the past. However, aminocaproic acid is rather hydrophobic A polyethyleneglycol-based amino acid (Shearwater, Polymers, Huntsville, AL) is probably preferable. 3 All glass vessels should be sdiconized thoroughly prior to use Besides using nitrogen bubbling through the randomization vessel to mix and wash the beads, we have also prepared libraries in hourglass reaction vessels (Peptides International, Louisville, KY), usmg rocking motion to mix the resins. 4. Each polypropylene reaction vial should be engraved with a letter correspondmg to a specific amino acid to ensure no mix-up during the synthesis 5. We often omit cysteines from the synthesis of linear peptide libraries to avoid the complication of intracham and/or interchain crosslinking
Acknowledgments This work was partially supported by NIH grants CA23074 Kit S. Lam is a scholar of the Leukemia Society of America.
and CA17094.
References 1 Scott, J K. and Smith, G. P. (1990) Searchmg for peptide ligands with an epitope library. Science 249,386-390. 2. Schatz, P. (1993) Use of peptide libraries to map the substrate specificity of a peptide-modifying enzyme A 13 residue consensus peptide specifies biotinylation m Escherichia cob Biotechnology 11,1138-l 143. 3. Kawasaki, G. (199 1) Cell-free synthesis and isolation of novel genes and polypeptides. PCT International Patent Application W09 l/05058. 4 Lam, K. S., Salmon, S. E , Hersh, E M., Hruby, V. J , Kazmierski, W. M , and Knapp, R. J. (1991) One-bead, one-peptide: a new type of synthetic peptide library for identifymg bgand-bmdmg activity. Nature 354,82-84 5 Lebl, M., Krchnak, V., Sepetov, N F., Seligmann, B., Strop, P., Felder, S and Lam, K S (1995) One-bead-one structure combmatorial libraries. Bzopolymers 37,177-198. 6 Lam, K S , Lebl, M , and Krchnak, V. (1997) The “one-bead-one-compound” combinatorial library method. Chem. Rev. 97,41 l-448 7 Geysen, H. M , Rodda, S J., and Mason, T J. (1986) A prior-z delmeation of a peptide which mimics a discontmuous antigenic determinant. Mol. Immunol. 23, 709-715. 8. Houghten, R. A , et al. (199 1) Generation and use of synthetic peptide combmatorial libraries for basic research and drug discovery. Nature 354,84-86 9. Dooley, C. T and Houghten, R A (1993) The use of positional scanning synthetic peptide combinatorial libraries for the rapid determination of opioid receptor ligands Life Scl. 56, 1509-1517
6
Lam and Lebl
10. Deprez, B , Willard, X , Bourel, L , Coste, H , Hyafil, F., and Tartar, A (1995) Orthogonal combmatorial chemical libraries J Am. Chem. Sot. 117,5405-5408 11 Erb, E , Janda, K., and Brenner, S. (1994) Recenstve deconvolutton of combmatorial chemtcal ltbraries Proc. Nutl Acad. Scz USA 91, 11,422-l 1,425 12. Zuckermann, R. N , Kerr, J. M , Slam, M A , Banvtlle, S. C., and Santa, D V (1992) Identification of highest-affinity ligands by affinity selection from eqmmolar pepttde mixtures generated by robotic synthesis. Proc Natl. Acad. Scz. USA 89,4505-4509. 13 Songyang, Z., Carraway, K L , Eck, M. J , Harrtson, S C., Feldman, R. A , Mohammadi, M , Schlessmger, J , Hubbard, S. R , Smith, D P , Eng, C., Lorenzo, M. J., Ponder, B. A J , Mayer, B J , and Cantley, L. C (1995) Catalytic spectfrctty of protein-tyrosme kmases 1s crmcal for selecttve stgnallmg Nature 373, 536-539 14. Furka, A., Sebestyen, F., Asgedom, M., and Dtbo, G (1991) General method for rapid synthesis of multicomponent peptide mixtures. Int J Peptzde Protein Res 37,487+93. 15 Lam, K. S and Lebl, M (1994) Selectide technology-bead bmdmg screening Methods f&372-380 16 Lebl, M , Krchnak, V , Salmon, S E., and Lam, K. S (1994) Screenmg of completely random one-bead-one-pepttde libraries for activmes m solution MethodA f&381-387. 17 Kaiser, E., Colescott, R. L , Bossmger, C D., and Cook, P. I. (1970) Color test for detection of free terminal ammo groups m the solid-phase synthesis of pepttdes Anal. Blochem. 34,595-602. 18 King, D. S., Fields, C G , and Fields, G. B. (1990) A cleavage method which mmtmtzes side reactions followmg Fmoc solid phase pepttde synthesis Znt. J. Peptlde Protein Res. 36,255-266.
Enzyme-Linked Calorimetric Screening of a One-Bead One-Compound Combinatorial
Library
Kit S. Lam 1. Introduction In the “one-bead one-compound” combinatorial library method, each bead displays only one chemical compound although there are approx 1013 copies of the same compound in and on the same bead (I-3). With an appropriate detection scheme, compound-beads with specific biological, physical, or chemical properties can be identified, and physically isolated, and then their chemical structure can be determined. In biological systems, one important property that is of interest is the binding property between a ligand and a ligate. The hgate or acceptor molecule could be an enzyme (4-6)) an antibody (1,7,8), a receptor (9,10), a structural protein, or even small molecules (II). Furthermore, the “one-bead one-compound” library method can also be applied to the discovery of ligands that bind to the whole viral particle, bacteria, or mammalian cell by screening for compound-beads that bind to intact cells. When we mix a ligate with an “one-bead one-compound library,” some compound-beads may be coated by the ligate. This interaction can be detected by either a labeled ligate or a labeled secondary probe that recognizes the ligate. Common labels are enzyme, fluorescent probe, color dye, or radionuclide. There are advantages and disadvantages to each of these methods. The choice of detection scheme depends largely on the nature and availability of specific labeled ligates. From our experience, enzyme-linked calorimetric assay is probably the most convenient, economical, and rapid screening method that does not require any elaborate equipment (12). Methods for the preparation of the peptide-bead library are detailed in Chapter 7 of this volume. Details on the enzyme-linked calorimetric screening method will be given in the next sections, From
Methods
m Molecular Bology, Edlted by S CablIly
vol 87 Combmatonal Pep/de 0 Humana Press Inc , Totowa,
7
Library NJ
Protocols
8
Lam
2. Materials All the reagents needed are standard enzyme-linked immunosorbent assay reagents and are readily available from many biochemical and chemical companies. The following buffers are needed for the screening:
(ELISA)
1. PBS-Tween. 8 mM,Na2HP04, 1.5 mMKH2P04, 137mMNaC1,2.7mMKCl,pH 7.2, with 0.1% Tween-20 (v/v) 2 Binding Buffer 16 m&Z Na2HP04, 3 mM KH,PO,, 274 mM NaCl, 5 4 mM KCl, pH 7 2, with 0.1% Tween-20 (v/v) and 0.1% gelatm (w/v). 3 TBS. 2 5 n&Z Trts-HCl, 13 7 mM NaCl, and 0 27 mM KCl, pH 8 0 4. BCIP/Alkalme phosphatase buffer. 1.65 mg 5-Bromo-4-chloro-3-mdolylphosphate (BCIP) m 10 mL of 0 lMTris-HCl, 0 lMNaC1 with 2.34 mMMgCl,, pH 8.5-9 0 5 Gelatin. 0 1% in water 6 6M Guamdme HCl, pH 1 0
3. Methods 3.1. Screening
with an Enzyme-Linked
Ligate
Common enzymes used in ELISA are alkaline phosphatase, horseradish peroxrdase, P-galactosrdase, and glucose oxidase. From our experience the alkaline phosphatase system is more specific and tends to produce the least artifact when we screen a “one-bead one-compound” library. 1 If ligate-alkaline phosphatase complex is not commercially available, one may conmgate the ligate to alkaline phosphatase using bifunctional crosslmkmg reagents Many such reagents are commercially available (e g , Pierce Chemical, Rockford, IL) and standard coupling procedures are supplied by the manufacturers Before screening a library, one has to make sure that the coqugation method does not impair the bmdmg property of the ligate This can usually be accomplished by an ELISA assay using a 96-well plate coated with a known hgand (see
Note 1) 2 Transfer l-10 mL of the bead-library (200,000 to 2 million beads) to a 50lOO-mL polypropylene container Slowly dilute the dimethylformamtde (DMF) by adding an incremental amount of double-distilled water. Wash the beadlibrary thoroughly with double-distilled water m a column (e g., Econo column, Bio-Rad, Hercules, CA) Coat the bead-library with 0 1% gelatin (w/v) m water for at least 1 h. Wash the bead-library with PBS-Tween Transfer the library back into the polypropylene contamer with the bmdmg buffer (see Note 2) Add the ligate-alkaline phosphatase coqugate into the library with gentle mixing for 1 to 24 h at room temperature (see Note 3). 3. Transfer the bead-library to the column and wash the beads thoroughly with PBSTween. Then wash the bead-library one last time with TBS.
Enzyme-Linked
Calorimetric Library Screening
9
Fig. 1. (A) Photomicrograph of a typical enzyme-linked calorimetric bead-library screen; a positive bead is noted in the middle of the micrograph. (B) Single positive beads can easily be retrieved with a handheld micropipet under a dissecting microscope. 4. Transfer and wash the bead-library to lo-20 polystyrene Petri dishes (100 x 20 mm) with the BCIP/alkaline phosphatase buffer (see Notes 4 and 5). More dishes may be needed if the beads are too crowded and there are too many positive beads. Let the enzyme-linked color reaction develop for 30 min to 2 h. Stop the reaction by acidifying the BCIP/alkaline phosphatase buffer with several drops of 1 M HCl. Figure 1A shows the photomicrograph of a typical bead-library screen. 5. With the aid of a light box and a micropipet (e.g., Pipetman PlO, Gilson), transfer the turquoise beads into a small Petri dish. Many colorless beads will also be transferred during this process. 6. Place the small Petri dish of positive beads under a dissecting microscope and pipet individual turquoise beads to a small Petri dish of 6 M guanidine-HCI, pH 1.O (Fig. 1B). At this stage, transfer only the positive beads (see Note 6). After
10
Lam 20-30 mm at room temperature m 6 Mguanidme-HCI, transfer the posmve beads to a dish of double-dtstrlled water. Then prpet each posrttve bead onto a glass filter and msert mto the protein sequencer cartrtdge for mtcrosequencmg (see Notes 7 and 8)
3.2. Screening with an Unlabeled Ligate by Probing with an Enzyme-Linked Secondary Antibody 1 Prepare the library as m Subheading 3.1., item 2. 2 Add the alkaline phosphatase-linked anti-ligate antibody to the bead library and incubate m bmdmg buffer for l-2 h at room temperature 3 Wash the bead-library thoroughly with PBS-Tween and finally once with TBS 4. Add BCIP substrate to the library as described m Subheading 3.1., item 4 5 After 30 mm to 2 h, stop the colortmetrrc reaction by adding several drops of 1 M HCl to each Petri dish. Remove all the color beads from the library over a light box with a mrcropipet These color beads interact with the secondary antibody alone and may be discarded. 6 Recycle the remaining colorless library with the following steps: Incubate the library with 6 M guamdine-HCl, pH 1 .O, 20-30 min, wash 5 times with doubledistilled water, mix the library with DMF for 1 h, wash 5 times wrth double-distilled water, followed by PBS-Tween 7 Add the unlabeled ligate to the bead-library and incubate l-24 h at room temperature 8 Wash the bead-library thoroughly with PBS-Tween 9. Add the alkaline phosphatase-linked antrligate antibody to the bead-library and incubate l-2 h (see Note 3) Then wash the bead-library thoroughly wtth PBSTween and finally once with TBS. 10 Add BCIP substrate to the library as described m Subheading 3.1., item 4. After 30 min to 2 h, stop the colorimetrtc reaction by adding several drops of 1 M HCl to each Petri dish. Since the library has been prescreened with the secondary antibody alone, the posrttve beads Identified at this time should be a result of bmdmg to the ligate and not to the secondary antibody. 11. Isolate those individual posrtive beads for microsequencmg as descrrbed m
Subheading
3.1., items 5,6.
4. Notes 1 For the two-step screening process, instead of using the lrgate/antr-ligate-enzyme system, one may use a biotmylated-ligate/streptavrdm-enzyme system 2. Most of the methods employed m Western blot or ELISA for lowering the background can be applied to the screening of the bead-library We routmely add high salt (2X PBS), 0 1% Tween-20, and 0 1% gelatin to the bmdmg buffer Bovme serum albumin instead of gelatin has also been used successfully. 3 In order to mmimtze the background and false posmves, the concentration of ligate, ligate-enzyme conjugate, or antibody-enzyme conjugate used m the screening should be as dilute as possible Sometrmes lt is advantageous to use a
Enzyme-Linked Colorimetnc Library Screemng
4.
5
6. 7
8
II
small sample of resm (e g., 0.1 mL) to test several levels of reagent concentration before screening a large library It is not uncommon that the concentration of a reagent can be lo-fold more dilute than the optimal concentration recommended for standard ELISA. Although a combmatlon of BCIP and mtroblue tetrazohum (NBT) 1s commonly used m Western blot, we prefer to use BCIP alone. The BCIP/NBT substrate 1s much more sensitive However, NBT can be reduced to formazon and form a dark purple preclpltate on the bead if there IS a trace amount of residual reducmg agent left in the bead-library. Additionally, certain ammo acid sequences such as Asn-Asn-Asn can reduce NBT to formazon m the absence of alkaline phosphatase Furthermore, the formazon deposit on the surface of the bead 1s msoluble in many of the common solvents that we have tested. Therefore, If BCIP/NBT substrates are used, we will not be able to recycle the library for subsequent use or recycle a specific positive bead for confirmatory testmg before sequencing However, under certain circumstances, the tetrazohum salts are useful as a substrate as different tetrazolmm salt generates different colors upon reduction Therefore, a multicolor detection system can be designed for such applxatlons (13) Neither the formazon (when BCIPlNBT are used) nor the indigo (when BCIP alone 1s used) products ~111 affect the microsequencmg results Alkalme phosphatase works best under alkaline condltlons (e g , pH 9 5) However, there 1s a concern about the stability of the llgand-ligate interaction under such condltlon Therefore, depending on the ligate, we routmely adJust the BCIP/ alkahne phosphatase buffer to pH 8.5 to 9.0. In some instances, a dual-color colorlmetrlc detection scheme may be helpful m selectmg the true posltlve beads (13). Since the rate-llmltmg step of the “one-bead one-compound” hbrary method IS the mlcrosequencmg step, one needs to ensure that most of the positive beads submltted to mlcrosequencmg are “true positives.” To further improve the probability of true positlvlty, one may decolorize the posltive beads with DMF and restam the beads m the presence or absence of a competing llgand.
Acknowledgments This work was partially Kit S. Lam is a scholar
supported by NIH grants CA23074
of the Leukemia
Society
and CA17094.
of America
References 1 Lam, K S., Salmon, S. E , Hersh, E M , Hruby, V , Kazmlerskl,
W M , and
Knapp, R. J. (1991) A new type of synthetic peptlde hbrary for ldentlfymg hgandbmdmg actlvlty. Nature 354,82-84 2 Lebl, M , Krchnak, V , Sepetov, N F , Seligmann, B , Strop, P , Felder, S , and Lam, K S (1995) One-bead-one structure combmatorlal libraries Bzopolymen 37,177-198
12
Lam
3 Lam, K S , Lebl, M , and Krchnak, V. (1997) The “One-Bead-One-Compound” combinatorial library method. Chem. Rev 97,41 l-448 4. Wu, .I , Ma, Q N , and Lam, K. S (1994) Identtfymg substrate motifs of protein kinases by a random lrbrary approach Biochemistry 33,14,825-14,833 5. Lam, K. S , Wu, J S , and Lou, Q (1995) Identtfication and characterization of a novel peptide substrate specific for src-family tyrosme kinase Znti. J. Protean Peptlde Res. Q&587-592 6 Lou, Q., Leftwich, M., and Lam, K. S (1996) Identification of GIYWHHY as a novel peptide substrate for human p60c-src protein tyrosme kmase. Bloorg. Med Chem., 4,677-682 7 Lam, K S., Lebl, M., Krchnak, V , Wade, S , Abdul-Lattf, F , Ferguson, R , Cuzzocrea, C , and Wertman, K. (1993) Discovery of D-ammo acid contammg ligands with Selectide Technology Gene 137,13-16 8 Lam, K. S , Lake, D , Salmon, S E , Smtth, J., Chen, M-L., Wade, S., AbdulLatrf, F , Leblova, Z , Ferguson, R. D., Krchnak, V , Sepetov, N. F., and Lebl, M (1996) A one-bead, one-pepttde combmatorial library method for B-cell epitope mapping Methods. A Compamon to Methods m Enzymology 9,482-493 9 Smtth,M H.,Lam,K.S.,Hersh,E M ,andGrtmes,W.(1994)Peptidesequences bmdmg to MHC class I proteins using a synthetic peptide hbrary approach. Mol Immunol 31,1431-1437. 10. Salmon, S E , Lam,K S , Lebl, M , Kandola, A., Khattrt, P , Wade, S., Patek, M , Kocis, P., and Krchnak, V (1993) An orthogonal partial cleavage approach for solution-phase rdenttficatton of biologically active peptides from large chemtcalsynthesized peptide libraries Proc. Nat1 Acad. Scz USA 90, 11,708-l 1,7 12 11. Lam, K. S , Zhao, Z G., Wade, S , Krchnak, V , and Lebl, M (1994) Identtfication of small peptides that interact specifically with a small organic dye Drug Dev. Res 33,157-160 12 Lam, K. S and Lebl, M (1994) Selectide Technology-Bead bmdmg screenmg. Methods 6,372-380. 13 Lam, K. S., Wade, S., Abdul-Latif, F , and Lebl, M. (1995) Application of a dual color detection scheme m the screening of a random combmatorial peptide library J Immunol Methods 180,219-223
3 Synthesis and Screening Combinatorial Libraries
of Positional
Scanning
Colette T. Dooley and Richard A. Houghten 1. Introduction Synthetic combinatorial libraries (SCLs) are collections of very large numbers of synthetic compounds, in which all possible combinations of the burlding blocks used are represented. The development and verification of the utility of combinatorial libraries represent a dramatic advance in the drug discovery process by greatly reducing the time needed to identify new drug leads. Positional scanning (PS) SCLs (Z,2) represent a modified format of the origmal synthetic combmatorial libraries described by this laboratory (3). In contrast to the original libraries, which required several iterative syntheses to identify individual active compounds, this library format provides mformation on the substituent responsible for activity at each varied position withm a structure. Therefore, only a single subsequent synthesis is required. The screening of PS-SCLs, in most instances, permits the identification of the most active substituents at each position of a compound in a single assay.Thus PS-SCLs serve to reduce further the time required to identify new drug leads. PS-SCLs are composed of individual positional SCLs, in which a single position is defined with one substituent while the remaining positions are composed of mixtures of substituents. The defined position is “walked” through the entire sequence of the PS-SCL. Therefore, the number of positional SCLs is equal to the number of residues in each compound of the PS-SCL. It should also be noted that each posrtional SCL, although addressing a single positron of the sequence, represents the same collection of individual compounds For example, a hexapeptide, or a compound with six positions, can be represented as: OIXXXXX, XO,XXXX, XX03XXX, XXO,XX, XXXX05X, or XXXXX06. From
Methods
m Molecular Biology, Edlted by S Cablily
vol 87 Combmatonal Peptrde 0 Humana Press Inc , Totowa,
13
Library NJ
Protocols
14
Dooley and Houghten
Using 20 amino acids (this represents 120 mixtures in total), each peptide mixture contains 3.2 million (205) different sequences, the six positional libraries each contam 64 million hexamers. Peptide PS-SCLs can be prepared with an acetylated N-terminus, as well as with a C-terminal amide or carboxylate. One highly advantageous characterlstlc of the PS-SCLs prepared in this laboratory is that they are free to interact m solution, i.e., they are not bound to any support (beads, glass, phage, and so on), and therefore can be readily screened in any assay system. When used in concert, the data derived from each positional SCL yield Information about the most important substituents for every posltlon. The information IS then used to synthesize individual compounds representing all possible combmations of the most active substituents at each position. This serves to confirm the PS-SCL screening results, as well as to Identify the individual compounds with the highest activities. The preparation of a PS-SCL composed of L-ammo acid hexapeptides is described. This library consists of six separate positional SCLs, each composed of 20 different peptlde mixtures having a single posltlon defined with one of the 20 natural ammo acids (represented as 0)) and the remaining five positions are composed of mixtures of 19 amino acids (represented as X; cysteine is omitted, see Note 1). The six posltlonal SCLs differ only in the location of the defined position A description IS given for the preparation of the library using either Boc or Fmoc chemistries. The choices of procedure depends on the laboratory facilities available, safety, and financial considerations. Methods for screening such a library in a radioreceptor assay are given as an example. Although the methods described here involve the use of peptides, the positlonal scanning concept may be equally applied to a library of any class of compounds m which there are a number of positions that may be systematically altered. PS-SCLs have been prepared composed of decapeptides (4), hexapeptides comprised solely of D-ammo acids (5)) of tetrapeptides comprised of more than 50 L-, D-, and unnatural amino acids (6) and of heterocycles (24). PS-SCLs have been used successfully to identify antigenic determinants recognized by monoclonal antibodies, trypsm inhibitors, opioid receptor llgands, and antlmicroblal compounds. A series of papers on the use of peptlde, peptidomlmetic, polyamme and heterocyclic PS-SCLs in the aforementioned assays have been published by our laboratory (5-15,24). 2. Materials
2.1. Library Synthesis 2.1.1. General Requrements
for Synthesis
1 Resin packets (T-bags) are made with polypropylene Houston TX), using an impulse sealer.
mesh (74 pm, Spectrum,
15
Synthesis and Screenmg 2. T-bags are filled with polystyrene resin, 200 mg, 0.2 mEq. 3. Solvents for all synthetic procedures are dimethylformamide dtchloromethane (DCM) 4 A lyophihzer and somcator are used m the final preparations mixtures.
(DMF)
and/or
of the peptide
2.1.2 t-Boc Synthesis 1. Methylbenzhydrylamine (MBHA) polystyrene resm 2 This synthesis employs N-a-Boc-amino acids with the followmg side champrotecting groups: benzyl is used as the side chain protection for Asp, Glu, Ser, and Thr; 2,4-dmitrophenyl for HIS; Z,chloro-benzyloxycarbonyl (CBZ) for Lys; formyl for Trp, sulfoxide for Met, p-tosyl for Arg; and 2,bromobenzyloxycarbonyl for Tyr 3. DCM and isopropanol (IPA) are used alternatively m wash steps. 4. Trifluoroacettc acid (TFA) is used to remove Boc protecting groups. 5. Dusopropylethylamme (DIEA) is used as a base m neutralization steps 6. Dnsopropylcarbodumide (DIC) and 1-hydroxybenzotnazole (HOBt) are used as coupling reagents 7 Thiophenol, dimethyl sulfide (DMS), ethylenedithiol (EDT), p-cresol, and hydrogen fluoride (HF) gas are used for side cham deprotection, and methanol is used m the wash procedure 8 HF gas and a 24-vessel cleavage apparatus are used for peptide cleavage.
2.1.3. Fmoc Synthesis 1 Polyoxyethylene-grafted polystyrene resin (TentaGel). 2. Fmoc-2,4,dimethoxy-4’(carboxymethyloxy)-benzhydrylam~ne, TFA cleavable linker 3 This synthesis employs Fmoc protected ammo acids with the following side chain protection groups: t-butyl for Ser, Thr, Tyr, Asp, and Glu, trityl for Cys, His, Asn, and Gln, Boc for Lys, and 2,2,5,7,8-pentamethylchroman-6-sulfonyl (Pmc) for Arg. 4. DMF is used in the wash steps 5, Pipendme is used to remove Fmoc protecting groups. 6 DIC and HOBt are used as coupling reagents 7 TFA, trusobutylsilane, water, and “Quick Snap” plastic tubes equipped with a smtered bottom disc (Isolab, Akron, OH) are used for side chain deprotectlon/ cleavage 8 Tert-butylmethylether, hexane and a benchtop centrifuge are required to precipitate and collect peptides
2.2. Screening 2.2.7. Receptor Assay 1 Aqueous buffer, e g ,50 mMTris, 2 Receptor preparation
pH 7 4
76
Dooley and Houghten
3 1-mL Polypropylene tubes wtth caps (Contmental Laboratory Products, San Diego, CA) and 96-well trays (Costar, Pleasanton, CA) 4. Radtoligand. 5. GF/B filtermats, Tomtec harvester, Beta Plate Liquid Scmttllatton Counter, Beta Plate scmtillation fluid (Wallac, Garthersburg, MD).
3. Methods 3.1. Library Synthesis For general procedures on solid phase peptide synthesis, readers are referred to (16) and (17). The peptide mixtures making up the PS-SCLs are synthesized by simultaneous multiple peptide synthesis (SMPS) (18). Mixture posrtions (X) are incorporated by couplmg mixtures of protected ammo acids for pepttdes, or aldehydes, carboxylic acids, and so forth for nonpeptides, using isokmetic coupling of an excess of a predetermined molar ratio, which compensates for the different couplmg rates of the various amino acid derivattves (Table 1). The advantage of using SMPS (also referred to as the T-Bag technology, US. Patent No. 4,63 1,211) is that all wash and deprotection steps may be carried out in a common vessel. For the hexapeptide library, 120 T-bags (resin packets) are made and labeled (see Note 2)
3.1.1. t-Boc Synthesis 1 All bags are washed (approx 4 ml/bag for l-m-square bags) 1X DCM, 2X IPA, 2X DCM This 1s to ensure that the bags do not leak 2 Neutralize bags* 3 x 5% DIEA/DCM, 2 mm; 2X DCM, 2X DMF, 1 mm each 3 Activatton/couplmg (see Subheading 3.1.3. for couplmg procedure and Note 3) 4 Wash bags 1X DMF, 2X DCM 5. Deprotect using a 55% TFA/DCM solution for 30 mm 6 Wash bags 1X DCM, 2X IPA, 2X DCM. 7 Steps 2-6 are repeated for the required number of couplmgs 8 Deprotect the peptide srde chains using (a) DNP removal, 2 5% thtophenol/DMF for 1 h Wash bags 3X DMF, 12X alternating washes of IPA and DCM; and (b) low-HF 60% DMS, 5% EDT, 10% p-cresol, and 25% HF for 2 h at 0” C. Wash bags, 8X alternating washes of IPA and DCM, 4X DMF, 3X DCM, 1X methanol (MeOH). 9 Cleave peptrdes from the resm using 7 5% amsole/HF for 1 h at 0” C 10. Extract pepttdes with water or drlute acetic acid Lyophthze peptide solutions twice and reconstitute in water at lo-20 mg/mL (see Note 4) Mixtures may be stored for prolonged pertods at -20” C (see Note 5).
3.1.2. Fmoc syn thesrs 1 Wash bags. 3X DMF, 3X DCM 2 Couple TFA cleavable lmker to resin (100 mEq), shake overmght
Synthesis and Screenmg Table 1 Molar Ratios
of Amino
17
Acids Used for Coupling
Mixture
Ammo acid Three letter code Ala ASP Glu Phe GUY His Be LYS Leu Met Asn Pro Gln Arg Ser Thr Val Trp T yr
3. 4 5. 6.
7. 8. 9 10. 11
Positions
(X)
Molar ratio
Single letter code A D E F G H I K L M N i R S T V W Y
Boc synthesis 0.55 0 67 0.70 0 49 0 55 0.69 3 34 1 20 0 96 0.44 1.03 0 83 102 1 26 0 54 0 92 2.17 0.73 0.80 18.99
Fmoc synthesis 0.75 1.20 1.oo 0.60 0.70 0.78 2.29 1.oo 0 77 0.71 1.20 0.86 1.oo 1.10 0 72 0.98 1 80 0 70 071 18.87
Wash bags 5X DMF, 1 min Deprotect using 20% prperidme/DMF, 20 mm. Wash bags 5X DMF (1 mm) Acttvatlon/Couplmg (see Subheading 3.1.3. for coupling procedure). Fmocammo acld/DIC/HOBt (5 Eq solution m DMF), 90 mm. Test for coupling completion (see Note 3). Wash bags 5X DMF, 1 mm. Repeat steps 4-7 as necessary Remove resin from bags and place m “Qmck Snap” plastic tubes. Cleave peptides using 1 5 mL of TFA/DCM/H,O/triisobutylsilane 70:20*5.5, for 3 h at room temperature Snap off the tips of the “Quick Snap” tubes and add cleavage solutton to centrtfuge tubes. Precipitate pepttdes with cold (4” C) tert-butylmethylether (30 mL) Centrifuge at 3000g for 10 mm. Dissolve peptides m 15 mL of water, lyophllize pepttde soluttons twice, and reconstitute m water at lo-20 mg/mL (see Note 4). Mtxtures may be stored for prolonged periods at -20” C (see Note 5)
18 Table 2 Coupling
Dooley and Houghten Procedure
for a Hexapeptide
PS-SCL
Couple as O” Coupling Coupling Coupling Coupling Coupling Coupling
step step step step step step
1 2 3 4 5 6
“where 0 = A, or C, or D . bwhere X = A, and D, and E
Bags Bags Bags Bags Bags Bags
101-120 81-100 61-80 41-60 21-40 l-20
Counle as Xb l-100 l-80,101-120 l-60,81-120 l-40,61-120 l-20,41-120 21-120
or Y See Subheading 3.1.3. See Subheading 3.1.3.
3.1.3. Couplmg Procedure 1 The coupling procedure described here is for a hexapeptide PS-SCL. A similar procedure would be used for a library of any peptide length. Bags are labeled 1 to 120, each set of 20 bags represents a particular position m the hexapepttde At each couplmg stage of the synthesis, the bags are separated mto vessels as described m Table 2 2. The 20 bags bemg coupled as 0 (1 of the 20 ammo acids) are separated mto 20 vessels and mdividually coupled to each of the 20 ammo acids (1 = A, 2 = C, 3 = D, and so on) using 0 2 A4 of ammo actd/DCM (6 mL) (with an equimolar concentration of HOBt for asparagine and glutamme), and 0.2 M DIC/DCM (6 mL) for 1 h (6 Eq) 3. Bags being coupled as X are combined m a single vessel and coupled using a mixture of 19 amino acids in ratios described in Table 1 Solutions of ammo acid mixture, DIC, and HOBt (0.5 M, solubihzed m DMF) are mixed to yield a final concentration of 0.167 M 4 The N-terminus of the peptides may be acetylated if desired usmg 0 2 M acetyl tmidazole in DMF (20 Eq).
3.2. Screening and Analysis 3.2.1. Radioreceptor Assay 1. Screening of SCLs requires a high-throughput assay. A 96-well or ELISA format is recommended. Depending on the type of receptor or radiolabel used, adaptmg a known protocol to a 96-well format may require several experiments to optimize assay conditions. It is important to have good separation between total bmdmg and nonspecific bmdmg (ZlOOO cpm) and httle variation between replicates (l-5%). 2. Prepare receptor preparation, a membrane-bound receptor m tissue homogenate is described here as an example Protein content of crude homogenates should be determined using the methods described by Bradford (19) or Lowry (20), as appropriate (see Note 6).
79
Synthesis and Screenmg
Plates 1 and 2
I
1
2
3
4
5
6
7
8
9
10
II
12
2
3
4
5
6
7
8
9
10
11
12
A B C D E F G ~H Plate 3 1 A
B C D E F G H Fig 1. Layout of plates for screening the posttlonal scanning library m a radloreceptor assay. NSB, nonspecific binding, SCI-6, dtluttons of cold hgand for standard curve, TB, total bmdmg Plates 1 and 2 are duplicates. 3 Perform the bmdmg assays m 1-mL polypropylene tubes. A sample plan for this assay IS given m Fig. 1 Usually two replicates are sufftclent for screenmg studies Minimtze ptpetmg by using multichannel pipets or computertzed ptpetmg stations, 4. Determine mterassay and intra-assay variation using standard curves, incubate the radlohgand m the presence of a range of concentrations of an unlabeled hgand (Standard Curve) Reserve one column of each plate for a standard curve (see Fig. 1).
20
Dooley
and Houghten
5. Add peptide mixture (50 pL of 5 mg/mL solution) and the appropriate volumes of buffer, radtohgand, and receptor preparation to each tube. Because of the large size of most assays, it IS recommended that the receptors be added last (see Note 7). 6. Incubate assay tubes until equtlibrmm is reached This is generally longer than the time needed for the unlabeled ligand to reach equillbrmm, and needs to be determmed before the assay (see Note 8) 7 Termmate the reaction by filtration through GF-B filters on a Tomtec Harvester (see Note 9). Wash each sample on the filter with 6 mL of Tris-HCl buffer, at 4” C Count bound radioactivity on a LKB Beta Plate Liqurd Scrntillation Counter, the counts are expressed m counts per mmute (CPM). 8 Process the raw data using spreadsheet software (lotus, Excel, and so forth) Average replicates and express as percent mhtbition* 100 - [(Mean - NSB)/ (TB - NSB) * 1001 Graph data such that there are six graphs (one for each posltton of the hexamer); each graph should contain 20 bars (one for each ammo acid) For certam assays, this data 1s sufficient to identify one, two, or three ammo acids from each of the SIX posittons, which can then be combined to make mdividual peptides (Jee step 9 below). For receptor assays, often too many mixtures are active. Calculate ICsD values (concentration of mixture that mhiblts 50% radioltgand binding) in order to determine the most active mixtures. 9 Perform competitive mhibition assays as above using serial dtlutions of the peptide mixtures. Prepare five threefold dilutions and use the peptide mixture such that six concentrations are tested (e g , 1X mixture, 0.3X mixture, 0.1X mixture, 0 037X mixture, 0.012X mixture, and 0.004X mixture). Calculate IC5a values using the curve-fittmg software, e g , GRAPHPAD (ISI, San Diego, CA) For small combmatorial libraries such as the hexapepttde PS-SCL, IC,, values can easily be determined for all 120 mixtures Rank order the IC,, values for each of the SIX positions, and use these values to choose ammo acids for individual peptides 10 Synthesize all combinations of the most active mixture(s) for each of the six positrons as individual peptides (Table 3) The numbers of individual peptides to be synthesized rises exponentially with the number of amino acids chosen (1 e , one ammo acid from each posmon generates one peptide, two amino acids from each position generates 64 [26] peptides, and three ammo acids for all SIX positions generates 729 [36] peptides) 11 It is important to note that the activity of the individual pepttdes either supports or disproves the connectivity of the most active ammo acid at each position found from the screenmg of the library For example, one of the most active peptide mixtures from the screenmg of a PS-SCL usmg ELISA was AC-XXXPXX-NH,, although none of the resulting individual peptides containing prolme at the fourth position were found to be acttve. However, completron of the iterative process for this pepttde mixture yielded an active indtvtdual pepttde that was completely different from the sequences derived from the PS-SCL (21)
Synthesis and Screenmg
21
Table 3 Example of Individual Sequences Derived from Screening a Hexapeptide Positional Scanning Library Posltlon
oxxxxx xoxxxx xxoxxx xxxoxx xxxxox xxxxxo
Amino acids chosen F AT LV DE W M
Pepttde sequences 1 2 2 2 1 1 8
FALDWM FALEWM FAVDWM FAVEWM FTLDWM FTLEWM FTVDWM FTVEWM
4. Notes 1 Care must be taken when analyzmg data of mixtures containmg cysteme, whtch is mcluded only in the 0 posttton (i.e., CXXXXX, XCXXXX, XXCXXX, XXXCXX, XXXXCX, and XXXXXC) If one of these mixtures IS found to have activity, tt 1s best to iterate (sequentially define the X posmons) or prepare a posittonal scanning hbrary of that mixture 2 The resm swells and shrinks depending on solvent used. Bags should be made large enough to accommodate swelling 3. It 1s important to ensure that all couplmg reactions go to completion. It is htghly recommended that ninhydrm (22) or bromophenol blue (23) monitormg be carrted out on control resins after each coupling. 4 Somcation is used to solubdize mixtures containing hydrophobic amino acids m the defined positions It 1s important to keep the water m the somcator cool, add ice if necessary 5 It 1s recommended that the library be altquoted before storage to avoid freeze and thaw damage. Addmonally, if the library is allquoted mto a 96-well format, the ptpeting required for screening 1s substantially reduced 6 Lowry Method: To 0.1 mL of sample add 0.1 mL of 2N NaOH. Boll at 100” C for 10 min. Cool and add 1 mL of reagant (100 ~012% w/v Na,COa m water, 1 vol 1% w/v CuSo4*5Hz0 m water, and 1 ~012% sodium potassium tartrate m water). Incubate for 10 mm. Add 0.1 mL of Folm reagant, mix, and mcubate for 30 mm Read absorbance at 750 and/or 550 nm. Prepare a standard curve using bovine serum albumin (BSA) and use tt to determine the concentratron of the sample. Bradford Method. Dissolve 100 mg Coomassie Blue G250 in 50 mL of 95% ethanol, mix with 100 mL of 85% phosphoric acid, and make up to 1 L with water. Filter the reagent Ptpet 0 1 mL of sample into test tube, add 5 mL of reagent, and mix Measure absorbance at 595 nm lo-60 min after mtxmg. Prepare a standard curve using BSA and use it to determine the concentration of the sample.
Dooley and Houghten
22
7. Screenmg of this hbrary m an optold radioreceptor assay was optimal at a fmal concentration of 0 4 mg/mL. When screening a new receptor, it is advisable to screen at a high concentration (l-5 mg/mL) and subsequently decrease the concentration if too many mixtures are found to be active 8 The l-mL polypropylene tubes come with plugs m strips of eight We have found that the only way to ensure adequate mtxmg of components 1sto cap all tubes and invert the tray two or three times, tapping both ends to dislodge any solvent from the top or bottom of the tube 9 We have found that soaking filters in polyethylemmme (PEI), as 1s often recommended to reduce nonspecific binding, causes problems when using the filters obtained from Wallac. PEI causes the ink and portions of the filter to stick to the harvester A 5-mg/mL BSA/buffer solution has generally sufficed to muumlze nonspecific bmdmg
Acknowledgments This work
was funded in part by Trega Biosciences,
Pharmaceuticals),
Inc. (formerly
Houghten
San Diego, CA.
References 1 Pnulla, C., Appel, J R , Blanc, P , and Houghten, R A. (1992) Rapid identiftcation of high affmny peptide hgands using positional scanning synthetic peptide combinatorial libraries. BloTeclznzques 13,901-905 2. Dooley, C. T. and Houghten, R. A (1993) The use of postttonal scanning synthetic peptide combmatorial libraries for the rapid determmation of opioid receptor hgands Lzfe Scz 52, 1509-15 17 3 Houghten, R. A., Pnulla, C., Blondelle, S E., Appel, J R., Dooley, C T., and Cuervo, J H. (199 1) Generation and useof synthetic peptide combmatorial libraries for basic researchand drug discovery. Nature 354,84-86 4 Pmllla, C., Appel, J R , and Houghten, R A (1994) Investigation of antigenantibody mteractions using a soluble nonsupport-bound synthetic decapeptide library composedof four trillion sequencesBzochemJ. 301,847-853.
5. Pimlla, C , Appel, J R , Blondelle, S. E., Dooley, C T., Elchler, J , Ostresh, J M., and Houghten, R. A (1994) Versatility of positional scannmgsynthetic combmatorial libraries for the JdentifJcatlon of mdtvidual compounds Drug Dev. Res.33, 133-145 6 Dooley, C T , Bower, A. N , and Houghten, R A (1996) Identification of mu-selective tetrapeptides using a positional scannmgcombmatorial library contaming L-, D- and unnatural ammo acids, m Peptldes Chemutry, Structure and Biology (Proceedmgsof the Fourteenth American PeptzdeSymposium(Kaumaya, P T P and Hodges, R S., eds ), Escom, Leaden,Germany, pp 623,624 7 Pmilla, C , Buencammo, J., Appel, J R., Houghten, R A , Brassard, J A., and Ruggeri, Z M (1995) Two antipeptide monoclonal antibodies that recogmze
adhesive sequences in fibrinogen
Identification
of antlgenlc determinants and
Synthesis and Screenmg
8
9.
10.
11
12.
13
14. 15
16 17. 18
19
20. 21.
23
unrelated sequences using synthetic combmatorial libraries Blamed. Pept. Proterns Nucletc Actds 1, 199-204. Pimlla, C Buencamino, J. Appel, J. R., Hopp, T. P , and Houghten, R A (1995) Mapping the detailed speciftctty of a calcmm-dependent monoclonal antibody through the use of soluble positional scanning combmatonal libraries identification of potent calcium-independent antigens. Mol Diversity 1,21-28. Ostresh, J. M., Husar, G. M., Blondelle, S. E., Dorner, B , Weber, P A., and Houghten, R. A. (1994) “Ltbrartes from libraries”. Chemical transformatton of combmatorial libraries to extend the range and repertoire of chemical diversity. Proc. Nut1 Acad Scl. USA 91,11,138-l 1,142 Perez-Pay&E , Takahashi, E., Mmgarro, I., Houghten, R. A., and Blondelle, S. E. (1996) Use of synthetic combmational libraries to identify pepttde mhtbitors of Ca2’-complexed calmodulm, m Peptides: Chemistry, Structure and Btology (Proceedings of the Fourteenth American Peptzde Symposium) (Kaumaya, P T P and Hodges, R S., eds ), Escom, Leiden, Germany, pp. 303,304 Perez-Pay& E., Houghten, R. A., and Blondelle, S E. (1996) The destgn of selfassemblmg pepttde complexes usmg conformattonally defined ltbrartes, m Techniques tn Protem Chemtstry VII (Marshak, D., ed ), Academic Press, San Diego, CA, pp. 65-7 1. Blondelle, S. E , Houghten, R. A , and Perez-Pay& E (1996). All D-ammo acrd hexapepttde mhlbttors of meltttrn’s cytolyttc activity derived from synthetic combmatonal bbraries J. Mol. Recog. 9, 163-168. Blondelle, S E.,Takahasht, E , Houghten, R. A., and Perez-Pay& E. (1996) Rapid rdentifrcation of compounds having enhanced antimicrobial activity using conformattonally defmed combmatortal ltbrartes. Bzochem. J. 313, 141-147 Dooley , C. T. and Houghten, R A (1995) Identtficatton of mu-selecttve polyamine antagonists from a synthetic combmatorial library, Analgesza, 1,400404 Eichler, J., Lucka, A. W , and Houghten, R A. (1994) Cyclic pepttde template combmatorial libraries Synthesis and identification of chymotrypsin inhibitors, Pept. Res 7,300-307 Steward, J M and Young, J D. (1984) Soled Phase Pepttde Syntheses 2nd ed , U.S.A Pierce Chemtcal Company, Rockford, IL Pennmgton, M. W and Dunn, B. M., eds. (1994) Pepttde Synthesis Protocols Methods in MoEeculur Biology. Humana, Totowa, NJ. Houghten, R A. (1985) General method for the raptd solid-phase synthesis of large numbers of peptides. specificity of antigen-antibody mteraction at the level of mdividual ammo actds Proc. Nat/. Acad. Set. USA, 82,5 13 1-5 135 Bradford, M M. (1976) A rapid and sensitive method for the quantitation of mrcrogram quanttties of protem utibzmg the princtple of protein-dye binding. Anal. Btochem 72,248-254 Lowry, 0. H , Rosebrough, N. J , Farr, A L., and Randall, R J. (195 I) Protein measurement with the Folm phenol reagent J. Btol. Chem. 193,265-275 Pimlla, C , Buencammo, J., Houghten, R A , and Appel, J R (1995) Detailed studies of antibody specificity using synthetic combinatorial libraries, m Vuccznes
Dooley and Houghten
24
1995: Molecular Approaches to the Control of Infectlow Diseases (Brown, F , Chanock, R., Ginsberg, H , and Non-by, E., eds.), Cold Sprmg Harbor Laboratory Press, Cold Spring Harbor, pp 13-17 22 Kaiser, E T., Colescott, R. L., Blossmger, C D , and Cook, P. I. (1970) Color test for detection of free terminal ammo groups m the solid-phase synthesis of peptides. AnaE. Blochem. 34,595-598 23 Krchnak, V , Vagner, J., Safir, P,, and Lebl, M (1988) Nonmvasive contmuous momtormg of solid phase peptide synthesis by acid-base mdtcator. Collect. Czech. Chem Commun. 53,2542-2548. 24 Nefzi, A., Ostresh, J M , Meyer, J -P , and Houghten, R A (1997) Solid phase synthesis of heterocycltc compounds from linear pepttdes. cyclic ureas and thioureas Tetrahedron Lett. 38,93 l-934
4 Synthesis and Screening of Peptide Libraries on Continuous Cellulose Membrane Supports Achim Kramer and Jens Schneider-Mergener 1. Introduction There are different strategies for the construction of soluble and solid phasebound chemrcal peptide libraries. These libraries have been used for the detection of epitopes as well as for the identification of peptides that act as antagonists of medically relevant proteins. We have prepared different types of cellulose-bound peptide libraries by spot synthesis (I), which is a powerful tool for the simultaneous and positronally addressable synthesis of thousands of peptrdes or peptide mixtures bound to continuous cellulose membrane supports. Presently up to 8000 different spots (peptides or peptide mixtures) can be automatically synthesized on a 20 x 30-cm cellulose membrane and screened for ligand binding within l-2 wk. These libraries can be used for the detection of peptides that bind to proteins, metals, and nucleic acids (2). We have mapped several linear and nonlmear antibody epitopes (3-9), and also used this approach for the detection of receptor-ligand interactions For instance, cellulose-bound peptide scanning libraries allowed the detection of the contact sites between tumor necrosis factor-o, and interleukin-6 with its receptors (4,IO). Furthermore, this method proved to be valuable to characterize heat shock protein-peptide mteractlons (II). As another biologically relevant application, these libraries were applied for the study of metal-peptide interactions. For example, we identified technetium-99m binding peptides important for tumor diagnosis (12) and nickelbinding peptides that can be used for the purification of recombinant proteins (3). The synthesis of cellulose-bound peptide libraries is not restricted to L-amino acids. Other building blocks, such as o-amino acids, unnatural ammo acids, and organic compounds, can also be used. Furthermore, the synthesis of From
Methods
m Molecular Bology, Edlted by S CablIly
vol 87 Combmatonal Pepbde 0 Humana Press Inc , Totowa,
25
Library NJ
Protocols
Kramer and Schneider-Mergener
26
Cellulose modification (3.1)
Amino acid coupling (double
couplmg.
15 mm reac(lon
(3.4): bme) \ waslung wrch DMF (3 times, 3 mm)
/ dvng
\ Fmoc deprotecnon Wllb 20 % pqlendme (20 mm)
/ waslung wh methanol (3 mm)
/ waslung wth DMF (5 bmes, 3 mm)
\ stamng wrh BPB waslung wltb methanol (Iwrce, 3 mm)
J
El
Side group cleavage (3.6)
Rg 1. Outhne of the synthesis procedure of cellulose-bound
pepttde libraries
cyclic and branched peptrde libraries can be achieved on cellulose membranes (3,13,14). Described here are protocols for the manual synthesis of a combmatorral peptrde library XXB,B2XX (B = defined position, X = randomized position) (2,15,16), a peptide scanning library, and a mutational analysis of a peptrde eprtope. An outline of the synthesis strategy IS given m Fig. 1. Furthermore, we provide protocols for the screening of these libraries with protein ligands. As an example, we have screened the libraries with the monoclonal antitransforming growth factor-a (TGFa) antibody Tab 2 (Fig. 2). The combina-
Cellulose Membrane Supports A
27
B2 4CDEFGHIKLMNPQRSTVWY A C D E F G H
I
Bli N E I V W Y
Fig. 2. Reaction of the anti-TGFa antibody Tab 2 with different types of peptide libraries. (A) Combinatorial library XXB,B,XX, (B) mutational analysis of the TGFa epitope VVSHFND, (C) TGFa-derived peptide scanning library (7-mers, 6 amino acids overlapping starting with the upper left spot).
torial peptide library XXB ,B,XX allowed the a priori delineation of the TGFa epitope. The peptide scanning library consisting of overlapping peptides spanning the entire TGFa sequence also led to the detection of the epitope. In addition, a mutational analysis substituting each single epitope residue by all 20 gene-encoded amino acids gave interesting insights into the molecular nature of this peptide-antibody recognition. This technique allowed the identification of amino acids that cannot be substituted by other residues and are therefore key residues in antibody binding. A short chapter introduces the Auto-Spot Robot APS 222 (Abimed GmbH, Langenfeld, Germany), which accelerates the spotting steps, thus allowing the semiautomated, parallel synthesis of a high number of peptides. The software for generation of library sequence files, described in this paper, can be purchased from Jerini BioTools GmbH (Berlin, Germany), which also manufactures synthesized libraries.
2. Materials The amino acids (one letter code) are 9-fluorenylmethoxycarbonyl (Fmoc)protected. With the exception of Fmoc-P-alanine-OH (Subheading 2.1.), all amino acids are activated with either pentafluorophenyl (Pfp) or 3-hydroxy2,3-dihydroxy-4-oxobenzotriazolyl (Dhbt). The following side-chain protecting groups are used: trityl for C, H, N, and Q; t-butyl for D, E, S, and T;
28
Kramer and Schneider-Mergener
t-butoxycarbonyl for K and W; and pentamethylchroman sulfonyl for R. All other chemicals should be purchased in their purest quality and used without further purification (see Note 1). All peptide synthesis steps should be carried out in a well-ventilated hood and wtth sufficient protective clothing.
2.1. Modification
of the Cellulose
1 Cellulose paper: Whatman 50 (Whatman, Maidstone, England). 2 Activated p-alamne solution: 0 2 M Fmoc-P-alanme-OH activated with 0 24 A4 DIC (dnsopropylcarbodlimlde) and 0 4 M NM1 (N-methyhmldazole) 3. DMF dlmethylformamlde. 4. Piperidme solution: 20% plperldme m DMF 5 Methanol.
2.2. Definition
of the Spots
1 Fmoc-P-alanme-OPfp solution 0 3MFmoc-P-alanm-OPfp m DMSO (dlmethylsulfoxide). 2 DMF. 3. Plperidine solution 20% plperidine m DMF 4 Methanol. 5. Acetanhydrlde solution A* 2% acetanhydrlde m DMF 6 Acetanhydrlde solution B 2% acetanhydnde, 1% DIPA (dusopropylethylamme) m DMF. 7 BPB-solution A. 0 01% (w/v) bromophenol blue m methanol
2.3. Functionality
Determination
1 BPB-solution B: 0.05% (w/v) bromophenol blue m DMF. 2 Methanol. 3 Plperldine solution. 20% plperldme m DMF.
2.4. Coupling
of the Amino Acids
1 Amino acid solutions* each of the 20 genetlcally encoded ammo acids 1s used as 0 3 A4 solution m NMP (N-methylpyrrolldone) These solutions are stable at -2O’C for several days with the exception of the active ester of argmme, which has to be freshly prepared each working day 2. X-mixture eqmmolar mixture of 17 ammo acids (all 20 genetically encoded ammo acids except cysteme, methlonme, and tryptophane) Use a concentration of 1.5 x (functionality of the spot) per yL. Make use of the result of the calculation of Subheading 3.3. For a functlonahty of 60 nmol per spot, the concentration of the X-mixture has to be 90 mM m NMP MIX the 0 3 M amino acid solutions and dilute with NMP 3. DMF. 4 Piperldine solution* 20% plperldme m DMF 5 BPB-solution A* 0.01% (w/v) bromophenol blue m methanol
29
Cellulose Membrane Supports 2.5. Acetylation
of the N-terminus
1 Acetanhydrlde 2 DMF. 3. Methanol.
2.6. Cleavage
solution B* 2% acetanhydnde,
of the Side-Chain
1% DIPA m DMF
Protecting
Groups
1 Deprotectlon solution: 50% TFA (tnfluoroacetic acid), 3% trusobutylsllane, 2% water, 1% phenol m DCM (dlchloromethane). TFA 1s toxic and very corrosive and should be handled with the greatest caution. Do not mix TFA and DMF waste as it can undergo an exothermlc and explosive reaction Consult your safety officer for approved handling and disposal procedures. 2 DCM. dlchloromethane 3. DMF. 4 Methanol.
2.7. Automated
Spot Synthesis
1. Auto-Spot Robot APS 222 (Ablmed GmbH, Langenfeld, Germany) 2 Software DIGEN (Jerml BloTools GmbH, Berlin, Germany). 3. Peptlde synthesis chemicals of the previous sections.
2.8. Synthesis of a Mutational Peptide synthesis
2.9. Synthesis
of the previous
of a Peptide Scanning
Peptide synthesis
2. IO. Screening
chemicals
Analysis
chemicals
sections.
Library
of the previous
sections.
of the Peptide Libraries
1. Methanol 2 Tns-buffered salme (TBS). 50 mA4 Tns-(hydroxymethyl)-ammomethane, 137mM NaCl, 2 7 mA4 KCl. Adjust the pH to 8 0 with HCl 3 Blocking buffer: dilute blockmg reagent (CRB, NorthwItch, UK) 1*lo m T-TBS and add 10% (w/v) sucrose 4. T-TBS: Tns-buffered salme containmg 0.05% Tween-20, pH 8 0 5 Ligand solution: dilute the protein of interest to a final concentration of 0.1-l pg/mL m blocking buffer (see Note 3).
2.11. Detection
of Ligand Binding
(Alkaline
Phosphatase
Method)
1 T-TBS Tns-buffered salme contammg 0.05% Tween-20, pH 8 0. 2. Blocking buffer. dilute blocking reagent (CRB) 1.10 m T-TBS and add 10% (w/v) sucrose 3. Alkaline phosphatase-labeled antlbody solution. ddute an alkalme phosphataseconjugated antibody, which 1s directed against the primary hgand, 1.lO,OOO m blockmg buffer (see Note 3)
30
Kramer and Schneder-Mergener
4 Nttroblue tetrazolmm (NBT) stock solutton (stable at 4°C for at least 1 yr) dlssolve 0 5 g of NBT m 10 mL of 70% DMF m water 5 Bromochloromdolyl phosphate (BCIP) stock solution (stable at 4°C for at least 1 yr) dissolve 0.5 g of BCIP (dlsodmm salt) m 10 mL of DMF 6 Alkaline phosphatase buffer (stable at 4°C for at least 1 yr). 100 ti NaCl, 5 mM MgCl,, 100 mM Trrs-HCl (pH 9.5). 7 Enzyme substrate solutron add 330 PL of NBT stock solution to 50 mL of alkalme phosphatase buffer Mix well and add 165 uL of BCIP stock solutton. Use wtthm 1 h 8 Stop solution 20 mM EDTA m PBS (phosphate buffered salme).
2.72. Defection
of Ligand Binding (Chemiluminescence
Method)
1 T-TBS Trts-buffered sahne contammg 0.05% Tween-20, pH 8 0 2 Blockmg buffer dilute blockmg buffer stock solutton (CRB, Northwltch, England) 1: 10 m T-TBS and add 10% (w/v) sucrose 3 Peroxtdase-labeled antibody solution dilute a peroxidase-conjugated anttbody, which IS directed agamst the primary ltgand 1 10,000 m blockmg buffer (see Note 3) 4 Detection reagent Just before developmg prepare the detectton reagent (BM Chemtlummescence Western Blottmg Reagents, Boehrmger Mannhelm, Mannhelm, Germany, or ECL Western Blottmg Detection Reagents,Amersham Buchler, Braunschwetg, Germany) according to the given protocols 5 Standard X-ray film and ftlmcassette, developer, water bath, and fixing solution
2.13. Regeneration
of Cellulose-Bound
Pepfide Libraries
1 Water 2 DMF 3 Regeneration buffer A. drssolve urea (480 5 g) and sodturn dodecyl sulfate (10 0 g) m water (800 mL) Make up to 1 L with water, then add 1 mL of 2-mercaptoethanol 4 Regeneration buffer B: mix water (400 mL) with ethanol (500 mL) and add acetic acid (100 mL)
3. Methods In Subheadings 3.1,3.6. we describe the manual synthesis of a combinatorial peptide library of the type XXB,B,XX. Subheading 3.7. contains details about the automated synthesis of peptide libraries using the Spot synthesizer Auto-Spot Robot APS 222 of Abimed GmbH In Subheadings 3.8. and 3.9. the synthesis of a mutational analysis and a peptide scanning library is described. The screening methods of these different peptide libraries are explained in Subheadings 3.10,3.12. Subheading 3.13. describes the regeneration of cellulose-bound peptide libraries.
Cellulose Membrane Supports 3.1. Modification
37
of the Cellulose
1. Mark 400 points as a 20 x 20 matrix on a square piece of cellulose paper (about 20 x 20 cm) usmg a penctl (graphite IS stable against the pepttde synthesis chemrcals) For regular spotting, be sure that the points are visible from the other stde of the paper. 2 Incubate the dry cellulose paper with 12 mL of activated p-alanme solution for 3 h m a sealed metal or glass vessel without shaking. Avoid air bubbles This IS done to mtroduce suitable anchor functions for the subsequent pepttde synthesis The activated p-alanine forms an ester bond with the hydroxyl groups of the cellulose 3. Wash the membrane three times with 50 mL of DMF for about 3 mm each A shaking platform 1s recommended All subsequent DMF washing procedures should be carried out as described here. 4 Cleave the Fmoc protecting groups by treatment of the paper with 50 mL of pipertdine solutton for 20 mm 5 Wash the membrane five times with DMF 6. Wash the membrane twice with 50 mL of methanol for 3 mm All subsequent methanol washing procedures should be carried out as decrtbed here 7. Dry the membrane
3.2. Definition
of the Spots
1 For the second couplmg step, spot 1 uL of Fmoc-P-alanme-OPfp solutron to the predefmed positrons on the cellulose membrane Use the nonmarked stde of the paper Spot at the transparent pencil points A multtstep pipet is recommended. Define an addmonal spot somewhere on the edge of the membrane. This spot will be cut out m order to define the functtonalrty of the spots (see Subheading 3.3.) After 15 mm reaction time repeat the spotting once to assure a complete coupling (15 mm reaction time). 2. Position the membrane carefully face-down m 20 mL of acetanhydrlde solution A. Avoid shaking and an- bubbles. After 2 mm, incubate the membrane face up wrth 50 mL of acetanhydride solution B for 30 mm with shaking. This 1s done to acetylate the amino functtons of the membrane that did not react with the second p-alanme. Thus, defined sites for the following synthesis of the peptlde library can be achieved. 3 Repeat steps 3-6 of Subheading 3.1. 4. Stain the membrane with 50 mL of BPB solution A The BPB solutton should remam yellow and the spots should become blue, owmg to the basic character of the ammo groups of the coupled second p-alanme Treat the membrane untd an equal blue staining of the spots IS reached 5. Wash the membrane wrth methanol for 3 mm 6 Dry the membrane. At this point the synthesis can be interrupted The membrane should be stored u-r a sealed plastic bag at -20°C until the next working day
32
Kramer and Schneider-Mergener
3.3. Functionality
Determination
The randomized positions of a combinatorial peptide hbrary XXB,B,XX are introduced by double coupling an equimolar activated amino acid mixture at 1.5 Eq in proportion to the amino functions (2). This is done to overcome the strong bras of the standard coupling conditions that reflect the different coupling rates of each amino acid. Therefore, the number of free amino functions per spot has to be determined. This does not need to be done for the synthesis of peptide scanning libraries and mutational analyses, since these libraries do not contain randomized positions. I. 2 3. 4 5 6 7.
Cut out the addrtronal spot (see Subheading 3.1., step 1) with a hole puncher. Stam the spot with 1 mL of BPB-solutron B m a 1 5-mL tube untrl saturation Wash three times with about 1 mL of methanol each Dry the spots Destam the spot completely with 1 mL of prperrdme solutron Determine the extinction photometrrcally at a wavelength of 605 nm. Calculate the amount of ammo functrons on the spot using an extmctron coeffrcient of &6a5= 95,000 L mol-’ cm-‘, Presume that each ammo function bmds one bromophenol blue molecule. Usually the membrane carrres about 60 nmol ammo functrons per 0 25 cm’-spot (1 pL creates a soaked area of about 0.25 cm*)
3.4. Coupling
of the Amino Acids
The synthesis of cellulose bound peptides IS done as a cyclic process of double coupling the amino acids, washing with DMF, cleaving the Fmoc protecting groups, washing with DMF and methanol, staining, washing with methanol, and drying. After that, the synthesis of the next position of the peptrdes can be carried out. Work according the synthesis diagram in Fig. 1. Peptides are always synthesized from the C-terminal to the N-terminal position, i.e., for the lrbrary B, +X+X.
XXB,B,XX,
the synthesis
steps are: X + X + Bz +
1. For coupling randomrzed posrtrons X prpet I pL of the X-mixture onto each spot twrce (2 x 15 min reactron time) The couplmg reactron can be followed by a color change from blue to blue-green 2 Repeat steps 3-5 of Subheading 3.2. After that, the membrane IS ready for coupling the next position of the peptrde library (see Note 2) 3 For coupling the B-posrtrons, spot one of the 20 ammo acid solutions twice onto each column (for B2) or each row (for B,) of the 20 x 20 matrrx twice. Use 1 VL per spot (2 x 15 mm reactron time) For a clear bmdmg analysis, an arrangement in alphabetical order IS recommended, 1 e., spot A onto the first column/row and Y onto the 20th column/row Coupling reactions can be followed by color change from blue to blue-green for Pfp esters and yellow for Dhbt esters
Cellulose Membrane Supports 4. After coupling Subheading
3.5. Acetylation 1 2. 3 4.
33
the last position of the peptldes continue with steps 3-5 in
3.1. Do not stam the membrane
of the N-Terminus
Incubate the membrane with 50 mL of acetanhydride B solution for 30 mm Wash the membrane five times with 50 mL of DMF for 3 min Wash the membrane twice with 50 mL of methanol. Dry the membrane.
3.6. Cleavage
of the Side Chain-Protecting
Groups
1 Incubate the membrane with 100 mL of deprotecting solution m a tightly closed box for 2 5 h. After a few seconds the cleaved “tntyl groups” of the cysteme row and column can be observed as yellow spots. After treatment with the deprotection solution the membrane is much less mechamcally stable Therefore, handle the membrane extremely carefully from this point on. 2. Wash 4 times with 50 mL of DCM for 3 mm. 3 Wash three times with 50 mL of DMF for 3 mm. 4 Wash twice with 50 mL of methanol for 3 mm 5. Dry the membrane. 6. Store the membrane at -20°C.
3.7. Automated
Spot Synthesis
The disadvantages of manual synthesis are clear: the high number of synthesis steps are time consuming, the required precision during the pipeting process is not always manually managable. Furthermore the error quote increases with the amount of peptides on the membrane. The laborious pipeting procedure of the peptide library synthesis process led to the development of an automated spot-synthesizer, which allows a maximum amount of precision and reliability for the synthesis. The system Auto-Spot Robot APS 222 was developed by Abimed GmbH especially for the synthesis of peptides on continuous membrane supports and automates the distribution of the amino acid derivatives. The membrane can be divided into several trays and up to 8000 spots can be synthesized simultaneously. This allows the synthesis of a combinatorial peptide library with three defined positions. The system only automates the pipeting procedures, all other steps, such as membrane modification, acetylation, washing, Fmoc-deprotection, and side-chain deprotectlon have to be done manually. The software DIGEN, which can be purchased from Jermi BioTools GmbH, 1s recommended for the generation of sequence files of several types of peptide libraries, such as combinatorial libraries, peptide scanning libraries, mutational analyses of peptides, loop libraries, and so forth. These files can be easily loaded into the Spot-synthesis software of the Auto-Spot Robot APS 222.
34
3.8. Synthesis
Kramer
of a Mutational
and Schneider-Mergener
Analysis
For the manual synthesis of a mutational analysis of a linear peptide use a matrix of 21 x peptide length (Fig. 1). On the first column synthesize the onginal peptide, on the other columns substitute each position of the peptide by all 20 amino acids m alphabetical order. Carry out the peptide synthesis steps as described in the previous sections. Here are some recommendations for the pipeting order. 1 In the first coupling step, ptpet the C-terminal ammo acid of the original peptide onto all rows except the last one 2 Ptpet the same ammo acid onto the first spot of the last column 3 Spot all 20 ammo acids successtvely onto the remaining 20 spots m alphabettcal order 4 Use an analog procedure for the remaining synthesis steps, 1.e , ptpet the subsmutton ammo acids m the second round onto the second row from below, and so on
3.9. Synthesis
of a Pepticfe Scanning
Library
The first step is the derivation of the peptrde sequences from the protein sequence. A peptide length of 12 amino acids and an overlap of 9 amino acids is recommended In Fig. 2 the synthesized peptide sequences derived from the transforming growth factor-a sequence are given. If you choose a higher overlap, the spot number increases, but the information about the minimal hgand binding protein regions is more subtly differentiated. The software DIGEN generates sequence lists of peptide scanning libraries. The manual synthesis of a peptide scanning library requires a much higher degree of concentration than the synthesis of a combmatorial peptide library or a mutational analysis owing to the irregular order of pipeting steps in each synthesis cycle To avoid mistakes, the use of a punch card, which covers the membrane during the pipeting, is recommended. Every hole has to be labeled with the amino acid for the respective spot. This has to be done for each synthesis cycle.
3.70. Screening
of the Peptide Libraries
The screening strategy of the different peptrde libraries depends on various preconditions Is the hgand of interest available m an enzyme-labeled or radioactively labeled form? Is an anti-ligand antibody available in an enzymelabeled or radioactively labeled form? Is the ligand-peptide mteraction expected to have a high or low affinity? In this section, we describe the screening of peptide libraries with a nonlabeled ligand. If you have a labeled ligand available use the Incubating conditions of this section and the developing conditions of one of the next sections depending on your label. If you do not
Cellulose Membrane Supports
35
have a labeled antiligand antibody available, antibody. In this case use the same incubating second and third antibody.
you have to use a third labeled and washing conditions for the
Rinse the membrane with a small volume of methanol for 1 mm This IS done to avoid the precipitation of hydrophobic peptides during the following TBS washing procedure Wash the membrane three times with an appropriate volume of TBS for 10 mm The volume depends on the library and the vessel size The membrane should be sufficiently covered with the solutron.
Block the membrane with the same volume of blocking buffer for about 14 h at room temperature with shaking
Wash the membrane once with the same volume of T-TBS for 10 mm Incubate the membrane with the same volume of hgand solution for 3 h (see Note 3) Wash the membrane three times with the same volume of T-TBS for 10 mm
3.11. Detection
of Ligand Binding
(Alkaline
Phosphatase
Method)
For the detection of high affinity bmdmg peptrdes, such as linear epitopes identified via peptide scanning libraries or mutational analyses of linear antibody epitopes, the alkaline phosphatase method is recommended The BCIP/ NBT substrate generates an intense black-purple precipitate at the site of enzyme binding. The reaction proceeds at a steady state rate, thus allowing control of the development of the reaction. 1. Incubate the membrane with an appropriate volume of alkaline phosphataselabeled antibody solutton for 2 h with gentle agitation The volume depends on the library and the vessel size. The membrane should be suffictently covered with the solution (see Note 3) 2 Wash three times with the same volume of T-TBS for 10 mm each 3 Incubate the membrane with the same volume of enzyme substrate solution Develop the membrane with agitation until the spots are suitably dark (l-30 mm). 4 Stop the reaction by rinsing the membrane with the same volume of stop solution three times for 3 min each. The EDTA in the stop solution chelates the Mg2+ ions, which are essential for alkalme phosphatase activity (see Note 4).
3.12. Detection
of Ligand Binding
(Chemiluminescence
Method)
For the detection of low affinity binding peptides, such as peptide mixtures in a library XXB ,B,XX, the chemiluminescence method is recommended The chemiluminescence method is a highly sensitive detection method, has short exposure times ranging from a few seconds to 1 h, and avoids the use of radioactivity. The lummiscence reaction reaches its maximum after l-2 min and is relatively constant for 20-30 min. After 1 h the signal intensity decreases to about 60-70% of maximum.
36
Kramer and Schneider-Mergener
1, Incubate the membrane with an appropriate volume of peroxldase-labeled antlbody solution for 2 h with agitation. The volume depends on the library and the vessel size. The membrane should be sufflclently covered with the solution (see Note 3) 2 Wash three times with the same vol of T-TBS for 10 mm each. 3. The following steps should be carried out m a dark room* incubate the membrane with 75 pL/cm2 of detection reagent for about 1 min Make sure that each part of the membrane 1scovered with detection solution 4 Insert the membrane protein side up mto a film cassette that 1slined with a plastic film Cover the blot with a transparent plastic film 5. Switch off the light, place a sheet of film onto the membrane, and close the cassette. Expose for 60 s. 6 Immediately replace the exposed film with a new one, reclose the cassette, and develop the exposed film at once. The developing process can be followed by using red safelights. 7 Expose the second film for a suitable time (up to 1 h) estimated from the signal intensity on the first film (see Note 5). 3.13.
Regeneration
of Cellulose-Bound
Pep tide Libraries
After probing, the cellulose peptide libraries can be regenerated using the following procedure. The membrane can then be reprobed with the same or with a different ligand of interest. With care the membrane may be regenerated and reprobed several times. The success of the regeneration should be checked (see Note 6). Do not allow the membrane to dry out before regeneration. 1. Wash the membrane three times with water for 10 mm The volume used for this and the followmg steps should be the same as m Subheading 3.10., step 1 or Subheading 3.11., step 1. 2. Wash the membrane three times with DMF for 10 mm Prolong the DMF washmg time, if the dye cannot be removed during the given time 3. Wash the membrane twice with water for 10 mm. 4. Incubate the membrane with regeneration buffer A for 10 mm Repeat this step twice 5. Incubate the membrane with regeneration buffer B for 10 mm Repeat this step twice 6. Wash the membrane twice with methanol for 10 min 7 If the membrane 1snot immediately reprobed, then dry the membrane and store it at -20°C
4. Notes 1 The purity of DMF and NMP is a critical point m peptide synthesis, for both DMF and NMP can degrade to give free ammes These ammes lead to premature Fmoc-deprotection or decomposltlon of ammo acid active esters. This ~111reduce
Cellulose Membrane Supports
2.
3
4.
5
6.
the yield of full length peptide and cause byproduct formation, thus, only DMF and NMP free of amines should be used. To test the purity add 10 ltL of 1% bromophenol blue solution m DMF to 1 mL of NMP or DMF in an 1 S-pL tube and mix thoroughly. Allow to stand for 5 mm and then observe the color. yellow indicates satisfactory to use, yellow/green or green/blue means do not use, purchase a better one. Bromophenol blue staining (Subheading 3.2., step 4). the Intensity of stainmg varies depending on the last spotted ammo acid. Some ammo acids, such as cysteine, aspartrc acid, glutamic actd, and asparagine stain only weakly Alanme, glycine, and prolme stam more strongly than others. These differences may serve as an internal control for correct pipeting. The incubation and washing condittons for the ligand of interest (Subheading 3.10.) and the second antibodies (Subheadings 3.11. and 3.12.) have to be optimized for each system. In general, if you do not get any srgnal or your signals are too weak there are several posstbilities to optimize: a. Increase the ligand and/or antibody concentrations. b Prolong the incubation time with ligand to overnight at 4°C. c. Prolong the mcubation time with secondary antibody to 3 h. d. Shorten the washing times, use washing buffer without Tween-20. e. Shorten the blockmg time to 3 h. If the background IS too high, try the followmg changes: a. Increase the detergent concentration m washing buffer. b Increase the washmg times and/or the washing volumes. Cysteme-containing peptides sometimes cause a signal m the alkaline phosphatase detection system (Subheading 3.11.), which IS not a result of bmdmg to the conjugated antibody, but probably is caused by a catalytic reaction of the thiol group of the cysteme side chain with the bromochloroindolyl phosphate substrate, which forms the product. If you get those spots colored, remember this reaction and synthesize on your next membrane control peptides, m which cysteine is substituted by the physrcochemically related ammo acid serme Another possibility to circumvent this problem is to use the chemiluminecence detection method. In the chemiluminescence detection method (Subheading 3.12.) somettmes clear spots on a black background appear. In this case the ligand and/or secondary antibody concentrations are much too high. On the spots, which carry a high amount of antibody conjugate, all the substrate is used up before the X-ray film can be placed on the membrane, resulting in clear spots Wash extensively with T-TBS and try to redetect, or regenerate the membrane and incubate with lower concentrations of proteins. The success of the regeneration should be checked after each regeneration by incubating with only the secondary antibody and subsequent detection If you have used a directly labeled ligand, repeat the detection procedure after regeneratron. In some cases very strongly bmdmg proteins cannot be removed from the membrane.
38
Kramer and Schneider-Mergener
Acknowledgments This work was supported by the BMBF, DFG, and Fonds der Chemlschen Industrie. We thank Beret Hoffmann and Christlane Landgraf for excellent technical assistance.
References 1 Frank, R (1992) Spot synthesis. an easy technique for the positionally addressable, parallel chemical synthesis on a membrane support Tetrahedron 48, 9217-9232. 2. Kramer, A., Volkmer-Engert, R , Maim, R , Remeke, U , and SchneiderMergener, J (1993) Simultaneous synthesis of peptide libraries on single resin and contmuous membrane supports: identification of protem, metal and DNA bmdmg peptide mixtures. Pept Reh. 6,3 14-3 19. R., Landgraf, 3 Kramer, A , Schuster, A , Remeke, U., Maim, R , Volkmer-Engert, C , and Schnetder-Mergener, J . (1994) Combmatorial cellulose-bound peptide libraries: screening tool for the identification of peptides that bmd hgands with predefmed specificity. Methods f&388-395 4. Remeke, U., Sabat, R , Kramer, A., Stigler, R -D., Seifert, M , Michel, T., Volk, D., and Schneider-Mergener, J (1995) Mapping protem-protein mteractions using hybritope and peptide scanning libraries. Mol. Dzverszty 1,141-148. 5 Schneider-Mergener, J., Kramer, A , and Remeke, U (1996) Peptide libraries bound to contmuous cellulose membranes. tools to study molecular recognition, m Combinatorial Llbrarles, (Cortese, R , ed.), W de Gruyter, Berlin, pp 53-68 6 Kramer, A , Vakalopoulou, E., Schleunmg, W.-D , and Schneider-Mergener, J (1995) A general route to fingerprint analyses of peptide-antibody mteractions using a clustered ammo acids peptide library* comparison with a phage display library. Mol. Immunol. 32,459-465 7 Kramer, A. and Schneider-Mergener, J (1995) Highly complex combmatortal cellulose-bound peptide libraries for the detection of antibody epitopes, m Peptides 1994 (Mala, H L S., ed ), ESCOM, Leiden, pp 475,476 8 Stigler, R., Rdker, F , Katmger, D., Elliot, G., Hohne, W , Henklem, P , Ho, J X , Kramer, A , Nugel, E , Porstmann, T , and Schneider-Mergener, J (1995) Characterization of the Interaction between a Fab fragment against gp4 1 of HIV- 1 and Its peptide epitope using a peptide epitope library and molecular modellmg Protezn Eng. $471479 R., Ehrhard, B , Hohne, W , Kramer, A., Hellwig, J., and 9. Volkmer-Engert, Schneider-Mergener, J (1994) Preparation, analysis and antibody bmdmg studies of simultaneously synthesized soluble and cellulose-bound HIV- 1 p24 peptide epttope libraries Lett. Pept. Sci. 1,243-253. 10 Weiergraber, 0 , Schneider-Mergener, J , Grdtzmger, J , Wollmer. A., Kuster, A., Exner, M., and Hemrich, P C. (1996) Use of immobilized synthetic peptides for the identification of contact sites between human mterleukm-6 and its receptor FEBS Lett 379,122-126
Cellulose Membrane Supports
39
11. Riidtger, S , Germeroth, L., Schneider-Mergener, J., and Buckau, B (1997) Substrate spectfrcny of the DnaK chaperone determined by screening cellulose-bound pepttde libraries EMBO J. 16,1501-1507 12. Malm, R , Steinbrecher, A , Semmler, W., Noll, B , Johannsen, B., Frommel, C , Hohne, W., and Schneider-Mergener, J (1995) Identification of technetium-99m binding peptides usmg cellulose-bound combmatortal peptide libraries J Am Chem. Sue. 117,11,821-l 1,822. 13. Wmkler, D., Schuster, A , Hoffmann, B., and Schneider-Mergener, J. (1995) Synthesis of cyclic pepttde libraries bound to contmuous cellulose membrane supports, m Peptzdes 1994 (Mata, H L S., ed ), ESCOM, Letden, pp. 485,486 14 Wmkler, D , Stigler, R , Landgraf, C., Hellwig, J , and Schneider-Mergener, J (1995) Determination of the bmdmg conformations of peptide epttopes usmg cyclic peptide libraries m, Peptzdes 1995 (Kaumaya, P. T P and Hodges, R. S., eds.), ESCOM, Leaden, pp 315,316 15. Geysen, H. M , Rodda, S J , and Mason, T J (1986). A prlorl delmeation of a peptide which mimics a discontmuous anttgemc determinant. Mol. Immunol. 23, 709-715. 16 Houghten, R A , Pmilla, C , Blondelle, S E , Appel, J R , Dooley, C T , and Cuervo, J H. (1991) Generation and use of synthettc peptide combinatorial libraries for baste research and drug discovery. Nature 354,84-86.
5 Peral kylation “Libraries from Libraries”: Chemical Transformation of Synthetic Combinatorial Libraries John M. Ostresh, Barbara Darner, and Richard A. Houghten 1. Introduction 1.1. Soluble Combinatorial Libraries Synthetic combmatorial libraries (SCLs) consisting of millions of compounds are proving to be a powerful source for the identification of novel biologically active compounds (see ref. 1-3). Individual compounds having potent biological activities can now be rapidly identified from pools containing millions of other compounds (4-9). As first presented by this laboratory, nonsupport-bound SCLs have been shown to be usable m virtually any assay system. In an expansion of SCL concepts and diversities, the original peptide SCLs have recently been transformed using a “libraries from libraries” approach (7,10,11a) to yield peptidomimetic and organic libraries having entirely different physical, chemical, and biological properties relative to the peptide SCLs used as starting materials. The screening of a SCL composed of 50 million peptidomimetics (7) has yielded individual active compounds that had no homology to those found in the starting SCLs. We describe here improved methods (10) developed for the transformation of such libraries. Two synthetic approaches are generally used for the incorporation of multiple functionalities at diverse positions within a SCL. The “divide, couple, and recombine” (DCR) synthesis methods (9), also know asthe “split resin” method (12, see also Chapter l), was originally developed for use in the synthesis of peptide SCLs. This synthesis method involves the couplmg of reactants to individual portions of the resin followed by thorough mixing of the resin This From
Methods
m Molecular Edlted
by
B/o/ogy, S CablIly
vol 87 Combmatonel 0 Humana
41
Press
Peptrde
Inc , Totowa,
Llbrery NJ
Protocols
42
0s tresh, D&-net-, and Hough ten
method allows the generation of approximately equrmolar mixtures of compounds since, inherent to the physical process of aliquoting the resin, each resin bead contains only one compound (12). A second synthesis method, termed the “rsokinetic ratio” method, uses a predefmed ratio of incoming reagents at each reaction incorporating a posttion of diversity to accomplish approximately equimolar incorporation of each substituent m each of the mixture positions (13,14, see also Chapter 3). This latter method offers the advantage that a mixture of reagents can be mcorporated readily at any position in a sequence. The determination of chemical ratios, however, requires advance knowledge of the reactron kinetics of the incoming reagents Two approaches employed for the structural deconvolution of active compounds from assay data usmg nonsupport-bound SCLs are illustrated in Fig. 1 (representative data usmg L-amino acids are shown) Both the “iterative” (I) and the “posrtronal scanning” (2) approaches have been used to identify individual active compounds in a wide variety of SCLs and assays.
1.2. Iterative
Deconvolution
Method method (Fig. 1A) is illustrated
The iterative deconvolutron with a tetrapeptide SCL, designated OXXX-NH2 (where 0 represents a defined amino acid at that positron, and X represents a mixture of amino acids at each of the other positions). The SCL is first screened to identify active mixtures. Since for each mrxture within the hbrary the amino acrd in the first position 1s defined, actrve mixtures yield the necessary ammo acid at that position. The remaining three positions are then identified sequentially through an iterative process of synthesis and screening. This process is completed within 6-10 wk, since three separate iterative synthesis steps are required.
1.3. Positional
Scanning
Deconvolution
Method
The positional scanning (PS) approach (Fig. 1B) involves the screening of four separate single-defined position SCLs to individually identify the most effective amino acids at each position of the sequence. A complete tetrapeptide PS-SCL consrsts of four sublibraries (designated OXXX-NH,, XOXX-NH,, XXOX-NH*, and XXXO-NH,), each of which has a single-defined amino acid at one positron and a mixture of ammo acids at each of the other three posrtions. Each sublibrary contains the same peptides, which are pooled so that for each sublibrary the defined amino acid is m a different position. When consrdered in concert, the mformatron from a single screenmg assay is used to rdentrfy individual active sequences. This process of screening, identifying, and synthesizing individual compounds can be completed in 2 wk or less, since only one syntheses step IS required to confirm the activity of individual com-
43
Peralkyla tion Iterative
A AXXX
CXXX
au RXXX
B _ WXXX
YXXX
Positional Scanning AXXX
CXXX
WXXX
YXXX
S&Ctbl
A RAXX
VI,
RCXX
w RLXX
_ RWXX
RYXX
XAXX
XCXX
,, xwxx
.s XLXX
lxyxxl
Selection zzi!t
1, XXAX
RWAX
RWCX
,a RWLX
_ RWWX
Al..
XXLX
8. XXWX
XXYX
XXXW
XXXY
RWYX Sdectlon
J RWCA
:: RWCC
XXXA
m RWCK
I
, RWCW
RCWY
XXXC
PI.. Selection
Selection
Syntheds
RWCK
RWCK
Fig 1 Representative deconvolution of a tetrapeptide combinatorial Iterative approach (B) Positional scanning approach pounds. PS-SCLs above.
are prepared using the chemical
1.4. Peralkylation-Peptidomimetic
Positional
library
(A)
ratio approach described
Scanning
Libraries
The libraries from libraries approach allows the generation of peptidomimetic SCLs through the chemical transformation of existing peptide SCLs. Both iterative and positional scanning SCLs have been used as starting materials for the generation of peptidomimetic SCLs. Peralkylations (using methyl iodide, ethyl iodide, alkyl bromide, benzyl bromide, naphthylmethyl bromide), reductions, and combinations of the two reactions have been carried out (7,lOJl).
The use of a wide variety of chemical transformations permits a range of peptidomimetic libraries to be readily generated, thus greatly expanding the chemical diversity available. The chemical transformation of an existing library to generate a second library from which highly active individual compounds can be identified is illustrated here. This concept, as well as the synthesis methods described (see Chapters 1,3, and 8) and deconvolution methods described here, is easily applied to other reactions. The distinct advantage of the soluble nature of nonsupport-bound SCLs over other methods is that membrane-bound
Ostresh, D&net-, and Houghten
44
and whole cell assays can also be used. Furthermore, based solely on the structural similarities of compounds within each active pool or sublibrary, the deconvolution methods described here allow the chemical structure of peptldlc, peptidomimetic, and orgamc compounds to be determined. The transformation of a PS-SCL made up of 7,3 11,616 tetrapeptides synthesized from 52 amino acid derivatives (17 L-, 15 D-, and 20 “unnatural”) is used here to illustrate the increased diversity obtained using the libraries from libraries concept. The tetrapeptide PS-SCL can be transformed, while still attached to the resin used in its syntheses, into a peralkylated tetrapeptrde PS-SCL (Fig. 2). Thus procedure is described below (10).
2. Materials All reagents are available WI) and used as received.
from Aldrich
Chemical
Company
(Milwaukee,
2. I. Trityla tion 1 5% Dusopropylethylamme m drchloromethane (v/v) 2. Dichloromethane 3. 0.077 M Trlphenylmethyl chloride (trnyl chloride) m 90% dimethylformamlde/ 10% dlchloromethane (v/v) 4. Dusopropylethylamme. 5. Dlmethylformamide
2.2. Bromophenol
Blue Test
1 5% Dusopropylethylamme m dichloromethane (v/v) 2 Dlchloromethane 3 0.62 mM Bromophenol blue m dlchloromethane.
2.3. Peralkyla tion 1 2. 3. 4 5
Anhydrous tetrahydrofuran 0 5 M Lithium t-butoxide m tetrahydrofuran Dlmethylsulfoxlde. 1 5 A4 Alkyl bromide m dimethylsulfoxlde Isopropanol
2.4. Trityl Removal 1. 2 3 4 5
Dlmethylsulfoxide Isopropanol Drchloromethane Methanol 2% Trifluoroacetic
acid in dlchloromethane
(v/v)
45
Peralkyla tion
1) Trltyl chloride 2) LIthum I-butoxlde 3) Ally1 bromide
1) Trlfluoroacetlc acld 2) Hydrogen fluoride
Ftg 2 Reactton scheme for the peralkylatton of one posmonal subhbrary from a tetrapeptlde PS-SCL R, represents the stde chain of a defined amino actd R, represents the side chains of a mixture of ammo acids
3. Methods In the peralkylation method described here, peptide mixture resins (13) have been synthesized in polypropylene mesh packets by the chemical ratio approach on methylbenzhydrylamine polystyrene resin using simultaneous multiple peptide synthesis techniques (15) and BOC chemistry. 3.7. Trifyl Protection 1. Neutrahze the resin packets having free N-terminal ammo groups by washing twice with 5% dnsopropylethylamme m dtchloromethane Enough solvent is used to completely cover the resm packets 2 Wash the resin packets once with dlchloromethane 3 Add 0 077M trityl chloride (5 Eq) m dtmethylformamlde/dtchloromethane (9 1) containmg diisopropylethylamine (29 Eq)
Ostresh, Ddrner, and Houghten
46
4 Shake the resin packets on a reciprocatmg shaker for 3 h 5 Wash the resm packets with dlmethylformamrde 6 Repeat steps 1-5 mm1 the reactton is complete (generally after 3-4 repetmons, see Note l), as determmed by the nondestructive bromophenyl blue test (16)
3.2. Bromophenol
Blue Test
1 Neutraltze the resm packets three ttmes with 5% dtlsopropylethylamme in dlchloromethane 2. Wash the resin packets three trmes wrth dtchloromethane to remove excess base 3 Cut open each resm packet and place a small ahquot of resin (1 mg or less) mto a test tube 4 Reseal the resm packets 5 Add 150 pL dmhloromethane to each resm abquot 6 Add 30 PL of 0 62 mM bromophenol blue m dlchloromethane (0 42 g/L) to each resin aliquot 7 Vortex the resin ahquots briefly 8 Examme the resm beads and solution Blue beads mdmate incomplete couplmg (16) Complete couplmg (~99%) IS mdicated by yellow resm beads (normally with a slight trace of green) and yellow supernatant
3.3. Peralkylation
of Resin-Bound
Peptides
1. Dry the resin packets overmght under htgh vacuum 2 Add 0 5 M ltthmm t-butoxlde (20 Eq per avallable amrde) under anhydrous condmons (see Note 2) 3 Shake for 15 mm at room temperature. 4 Remove the base solution by cannulatlon (or decanted If working m a glove box) 5. Add 1.5 M alkyl bromide (60 Eq per available amide) m DMSO 6 Shake the reaction mixture on a rectprocatmg shaker for 2 h at room temperature 7 Remove the alkylatlon solutron 8 Repeat steps 2-7 two times. 9 Wash the resin packets three times with dtmethylformamlde. 10. Wash the resin packets twice with lsopropanol 11 Wash the resin packets three times with dtchloromethane 12 Wash the resin packets once with methanol 13 Dry the resin packets under hrgh vacuum 14 Check the reactlon completion at this point (Jee Note 3) Repeat steps 2-13 as necessary Normally, the alkylatlon reaction IS complete followmg 4-5 treatments
3.4. Removal
of the Trityl Protecting
Group
1 Wash the resin packets three times with drmethylformamlde 2. Wash the resin packets twice with lsopropanol 3 Wash the resin packets three times with dmhloromethane.
47
Peralkyla t/on
4 Remove the trttyl protecting group by two treatments with 2% trtfluoroacetlc acid in DCM (once for 3 mm, once for 30 mm). 5, Wash the resin packets three times with dlmethylformamlde. 6. Wash the resin packets twtce with tsopropanol. 7 Wash the resin packets twice with dichloromethane 8 Wash the resin packets once with methanol 9. Dry the resin packets overnight under high vacuum The peralkylated pepttdes can then be cleaved from the resm
4. Notes 1 Trttylatton reaction conditions can be altered (i.e , solvent varted, etc ) to promote completion of the reaction. 2 For the peralkylatton reaction, anhydrous conditions must be maintained. Preferably, a glove box IS used 3. It is recommended that control peptide resms having defined sequences that are the same length as the library pepttdes be added to all reactions to serve as analytical controls for the final product. Sufficient resin (100 mg or more) should be used such that multiple ahquots can be cleaved and analyzed as necessary to momtor the completeness of the alkylatton reaction. If alkylatton of the control compounds 1s mcomplete, the peralkylation reaction can be repeated and the reaction time prolonged as necessary. 4 Some side chain modiftcatton is to be expected during the peralkylatton Similar modiftcattons have been described for permethylated hbrartes (7) In our expertence, cysteme, aspartic acid, glutamic acid, and htsttdme derivatives have led to multiple products upon peralkylatlon, and therefore have not been used m most of the peralkylated pepttde ltbrartes we have prepared. 5. The alkylation method 1s easily adapted for use wtth other alkylatmg reagents However, actdolytlc cleavage resultmg m shortened sequences has been seen wtth permethylated pepttdes In addition, peralkylatton wtth bulky alkylating reagents such as benzyl bromide 1s more difficult to drive to completton.
Acknowledgment This work maceuttcals),
was funded by Trega Biosciences, San Diego, CA.
Inc. (formerly
Houghten
Phar-
References 1. Pmilla, C , Appel, J. R., Blondelle, S. E., Dooley, C T , Etchler, J , Ostresh, J. M , and Houghten, R A. (1994) Versatlltty of posttlonal scannmg synthetic combmatorial libraries for the identtftcatton of mdividual compounds Drug Dev Res 33, 133-l 45 2. Pmilla, C , Appel, J , Blondelle, S E., Dooley, C. T , Ddrner, B , Etchler, J , Ostresh, J M , and Houghten, R A (1995) A review of the utthty of pepttde combinatorial libraries Bzopolymers 37,221-240
48
Ostresh, Ddrner, and Houghten
3 Gallop, M. A , Barrett, R W , Dower, W J , Fodor, S. P A , and Gordon, E M. (1994) Appltcattons of combmatortal technologies to drug discovery 1 Background and peptide combinatorial libraries. J. Med. Chem. 37,1233-1251, 4 Blondelle, S. E., Perez-Pay& E , Dooley, C T , Pmilla, C., and Houghten, R A (1995) Chemical combmatortal Itbrartes, pepttdomimettcs and pepttde diversity. Trends Anal. Chem 14,83-92 5. Blondelle, S E , Takahashi, E , Dmh, K. T., and Houghten, R A (1995) The antimicrobtal activity of hexapeptides dertved from synthetic combinatortal libraries J. Appl. Bactertol. 78,39-46 6 Blondelle, S. E., Takahashi, E , Weber, P. A , and Houghten, R A (1994) Identification of antimicrobial peptides using combmatortal ltbraries made up of unnatural ammo acids. Anttmtcrob. Agents Chemother 38,2280-2286. 7 Ostresh, J. M., Husar, G M , Blondelle, S E , Dorner, B , Weber, P A , and Houghten, R. A. (1994) “Ltbrartes from Itbrartes”: chemtcal transformatton of combmatortal libraries to extend the range and repertoire of chemtcal dtverstty Proc. Natl. Acad. Set. USA 91,11,138-l 1,142 8. Houghten, R. A., Appel, J. R., Blondelle, S E , Cuervo, J. H , Dooley, C. T , and Pmilla, C. (1992) The use of synthetic peptide combmatortal ltbraries for the identtficatton of bioactive peptides Btotechniques 13,412-421, 9 Houghten, R. A., Pmilla, C , Blondelle, S E , Appel, J. R , Dooley, C. T , and Cuervo, J H. (199 1) Generation and use of synthetic peptide combmatortal ltbraries for basic research and drug discovery. Nature 354,84-86. 10 Dorner, B , Ostresh, J. M., Husar, G M., and Houghten, R. A. (1995) Extending the range of molecular diversity through amtde alkylation of peptide libraries, m Pepttdes 94: Proceedmgs of the 23rd European Peptide Sympostum (Maia, H. L. S , ed ), Escom, Letden, pp 463,464. 11. Cuervo, J. H., Wettl, F., Ostresh, J. M., Hamashm, V. T., Hannah, A. L., and Houghten, R. A. (1995) Polyalkylamme chemical combmatortal libraries, m Peptides 94: Proceedmgs of the 23rd European Pepttde Sympostum, (Maia H. L. S , ed.), Escom, Leaden, pp 465,466. 1 la.Nefzi, A , Ostresh, J. M., Meyer, J -P , and Houghten, R A. (1997) Solid phase synthesis of heterocycbc compounds from lmear peptides* cyclm ureas and thioureas Tetrahedron Lett. 38,931-934. 12 Lam, K S , Salmon, S. E., Hersh, E M., Hruby, V J , Kazmierskt, W M., and Knapp, R J. (1991) A new type of synthetic peptide library for ldentlfymg ligandbmdmg activity Nature 354,82-84 13 Ostresh, J M , Winkle, J H , Hamashm, V. T , and Houghten, R A (1994) Peptide libraries. determmation of relative reaction rates of protected amino acids m competitive couplmgs Btopolymers 34, 168 l-1 689. 14. Etchler, J and Houghten, R A. (1993) Identificatton of substrate-analog trypsm inhibitors through the screening of synthetic peptide combinatorial libraries Bzochemistry 32,11,035-l 1,041
Peralkyla tion
49
15 Houghten, R. A. (1985) General method for the rapld solld-phase synthesis of large numbers of peptldes speclflclty of antigen-antibody mteractlon at the level of mdwldual ammo acids Proc. Natl. Acad. Set. USA 82,5 131-5 135 16. Krchrkk, V., VBgner, J., Safk, P , and Lebl, M (1988) Nonmvaslve contmuous monitoring of solid-phase peptlde synthesis by acid-base indicator Co11 Czech Chem. Comm. 53,2542-2546
Introduction to Combinatorial Solid-Phase for Enzyme Activity and Inhibition
Assays
Morten Meldal 1. Introduction 1.1. Determining the Specificity of Proteolytic Enzymes Proteolytlc enzymes are often present as major factors m viral, bacterial, and parasitic infections Therefore, an interest in inhibitors of proteolytlc enzymes has been expressed by the pharmaceutical industry, and the mvestment in the development of specific enzyme mhlbltors remains an important challenge. This chapter describes combinatorial approaches to the characterization of enzyme specificity and identification of enzyme inhibitors or lead compounds by direct visual inspection of resin beads containing both a good substrate and a portion mixing llbrari of inhibitors (I). The catalytic site of proteolytic enzymes has traditionally been characterized through the use of small substrates that provide mformatlon about preference for certain amino acids in each subsite covered by the substrate. The enzyme reaction has been followed by determining the formation of cleavage products either by HPLC or by use of chromogenic substrates that change absorbance on cleavage. Alternatively, sensitive internally quenched fluorogenic substrates provided an efficient method for determination of the kinetic parameters (2). The most efficient quenched substrates were of the “long-range resonance energy transfer” type (3). The extent of quenching is dependent on the spectral overlap of the chromophores and only donor/acceptor pairs with complete overlap between emission and absorption are useful for quenching over long distances. In particular, the following pairs have been proven valuable: Abz/Dnp (2-aminobenzoyl/2,4-dimtrophenyl [4]), Edans/ Dabcyl (5(2’-aminoethyl)aminonaphthalene sulfonic acid/4-(4’-dlmethylFrom
Methods
m Molecular Bology, E&ted by S CablIly
vol 87 Combmatonal PeptIde 0 Humana Press Inc , Totowa, 51
Library NJ
Protocols
52
Me/da/
aminobenzeneazo) benzoic acid IS]), and the Abz/Tyr(NO,) (2-aminobenzoyll 3-nitrotyrosine [6]). Usmg substrates with many ammo acids between donor and acceptor it is possible to map all subsites of a protease with a series of single substitution analogs (100-200) to a good reference substrate (6). This approach frequently requires the synthesis of a large variety of different compounds, a laborious process, which in part has been circumvented by using solid-phase multiple synthesis techniques. The kinetic data obtained m this way are informative and provrde an accurate picture of the proteolytic activity with small substrates (7). However, there are two questions that may be raised concerning such results. First, the results will always be biased by the untial selection of the parent substrate and do not address the problem of nonadditrvity between subsrte activities (8). Second, the use of small substrates in pure enzyme-buffer solution may not reflect the sttuatton observed in viva in which tertiary structure, membrane environment, and cofactors may influence the activity and specificity of the enzyme dramatrcally For the complete analysis of proteolytic enzymes it is, therefore, important to investigate the enzymes with a combinatorial display of peptides from which the enzyme may itself select superior substrates Previously, when new enzymes were investigated for their substrate specificity, different proteins were first used as substrates to find possible cleavage sequences (9). Proteins display a small library of possible cleavage sites, and once a cleavage site has been identified by sequence analysis, small analog substrates can be synthesized to study the specificity m detail (7). This method is similar to the application of a large library of substrates from which the enzyme is allowed to select its preferred substrates. However, the resulting picture of the enzyme specificity is much more complete when a large nonbiased hbrary without any particular terttary structure is used. 2. The Use of Combinatorial Peptide to Analyze Enzyme Specificity
Libraries
Combmatorial displays of peptides may be generated as mixtures in solution or as libraries in which the substrates are linked to the solid phase The generation of a multitude of compounds IS most conveniently accomplished by sitedirected or compartmentalized synthesis. The PIN method synthesis on a matrix of polyethylene rods (IO), spot synthesis on paper (Chapter 4, ref. 1 l), and the lithographic light-directed synthesis on sihcon chips (12) are all site-directed synthesis protocols with a predetermined fixed number of compounds, whereas the T-BAG method synthesis on beaded resin compartmentalized in envelopes of polypropylene net (13) and multiple-column peptide synthesis (MCPS [14,15]) are compartmentalized synthesis protocols m which it is posstble to increase the diversity almost infmltely by portion mixing, 1.e , by poolmg, mixing, and redistributing the resin between coupling steps. The results obtained
lntroductlon to Sol/d-Phase Assays
53
with hbrarles from site-directed synthesis are easy to deconvolute from the knowledge of the synthesis protocol for each position, whereas portion mixing libraries have to be analyzed to be deconvoluted. In the case of resin-bound substrates, isolation and sequencing of the 30-50 most reactive substrates yields a statrstrcal drstrlbutron of preferences for particular types of ammo acids m each subsite of the enzyme. Some subsites may be completely specific for one or two, others for a range of hpophilic ammo acids, for example. Some subsites may be found to be essentially unspecific with all amino acids present (Id,1 7)
In contrast to other biomolecules that simply exert their action by binding a partrcular ligand (18), all enzymes are characterized by their conversion of a substrate mto a product and the study of this process requires information about the structure of both the substrate and product. This is true for all classes of enzymes. A proteolytic enzyme may cleave, e.g , an assembly of decapeptldes in solution, at several different posrtrons and it is not easy to align sequence data from such a cleavage mixture in a useful way. The application of a sohdphase assay using the portion mixing libraries, m which each bead contams a unique potential substrate, has allowed the enzyme reaction to be carried out simultaneously with each bead as a separate reactor for the enzyme reaction. The monitoring of an enzyme reaction on different substrates linked to resin beads requires an easy detection method, and one of the most versatile for the detection of proteolytic activity has been the use of substrates contaming a fluorescence donor and an acceptor, which quenches the fluorescence in a distance-dependent manner (3) By use of such quenched substrates, which has the fluorogenic probe attached to the C-terminal of the substrate where it IS covalently linked to the solid support and the quencher attached to the N-terminal end, the beads containing the most active substrates may be identlfied by visual inspection (16,19). The AbzlTyr(N0,) pair IS probably the most efficiently quenched at neutral or slightly basic pH, and this pair was selected for the convenient synthesis of quenched substrate libraries and for visualization in a fluorescence stereomicroscope of active substrates linked to the solid phase. Beads containing active substrates can be collected and analyzed by sequence analysis for their content of both substrate and C-terminal cleavage product. Sequence determination may be achieved by many different methods, ranging from conventional sequencing to various methods of mass spectroscopy to nuclear magnetic resonance (NMR) studies on single beads. Particularly useful are ladder sequencing (20,21) and ladder synthesis (22) in combmation with mass spectrometry. However, m our experience the most reliable method for peptide libraries is still Edman-degradation, which can be combined with determination of molecular mass by MALDI-TOF MS (matrix-assisted laser
54
Meldal
desorptlon lomzatlon time of flight mass spectrometry). Currently, the syntheSIS of protease substrate, inhibitor, and glycopeptide libraries, with capping m each couplmg step and C-terminal methionme for deconvolution and cyanogen bromide release (22), respectively, is under development m our laboratory. Using these methods m combmatlon with MALDI-TOF MS will facilitate the deconvolutlon process tremendously. The use of solid-phase assays, which are often employed for the mvestlgation of llgand-bmdmg proteins, has not previously been found to be useful m the characterlzatlon of enzymatic reaction specificity. This IS mamly because the enzyme performs a transformation of the binding substrate into a product and the study of this process requires the structural investigation of both the substrate and the product. When polystyrene-based resins or ELBA plates are used as the solid support, they are not permeable to the enzymes, and the enzymes have to perform their reaction catalysis on the surface accessible molecules. Only a small fraction of bound substrates (~0 3% on polystyrene-based resins) are exposed for cleavage (23), and the minute amounts of product formed make detection and structural analysis problematic.
3. Polyethylene
Glycol Polyamide
Copolymers
Recently new polyethylene glycol-based polymers with an open structure were introduced for solid-phase reactions with biomolecules (24-26). These polyethylene glycol polyamide (PEGA) copolymers are permeable to the enzymes including glycosyltransferases (27) and proteolytlc enzymes, which can enter into the gel-like polymeric network and perform their catalytic reactions on substrates linked to the solid phase The content of 90% PEG leads to high swelling potentials m most solvents ranging from toluene to water and the swelled resin appears as a firm, tense material (26) The apphcatlon of these new blocompatible polymers m portion mixing library solid-phase enzyme assays IS the basis of this chapter and Chapters 7-9. Enzyme inhibitor assays have traditionally been performed by allowmg putative inhibitors to compete with an enzyme substrate for binding to the active site of the enzyme. The requirement IS that the inhibitor IS not itself a substrate for the enzyme Often the mhlbltors used for inhibition of proteolytlc enzymes are compounds not related to peptldes or peptldes m which a substrate has been converted mto an inhibitor by converting the sclsslle peptlde bond into, e.g , reduced bonds, carbon-carbon bonds, or other modifications, which may even be transitlon-state analogs. The permeable PEGA resins have allowed this type of assay to be confmed to the volume of single beads and have thus opened the possibility of defining inhibitors for serme proteases by combinatorial approaches (I). Particularly useful is a new solid-phase mhlbltor assay m which each bead contains the same substrate and one unique putative inhibitor that
Introduction to Sol/d-Phase Assays
55
may or may not mhlblt the cleavage of the substrate. By this approach beads in which the enzyme remains inactive can be identified and the structure of the contained inhibitor analyzed. Owmg to the very small volume of a single bead the consumption of proteolytic enzyme per compound assayed IS very limited. The method can be used m an iterative process m which more effective inhibitors may be identified in secondary libraries. Once inhibitors are found their inhibitory activity must be confirmed by MCPS and assaying m solution. Libraries for solid-phase assays have been prepared for other types of enzymes such as cruzipain (cysteine protease [17]) and matrix metalloproteinases. References 1 Meldal, M and Svendsen, I. (1995) Direct vlsuahzatlon of enzyme mhlbltors using a portion mixing inhibitor hbrary containing a quenched fluorogemc peptlde substrate 1. Inhibitors for subtlllsm Carlsberg J Chem Sot Perkm Truns 1, 1591-1596. 2. Yaron, A , Carmel, A , and Katchalskl-Katzlr, E (1979) Intramolecularly quenched fluorogemc substrates for hydrolytic enzymes Anal Blochem 95, 228-235 3. Forster, T (1948) Intramolecular energy transfer and fluorescence, Ann Phys. 6, 55-75. 4. Juhano, L , Chagas, J R , Hlrata, I Y , Carmona, E., Sucuplra, M., Ohvelra, E. S , Ollvelra, E. B , and Carmago, A C M (1990) A selective assay for endoohgopeptldase A based on the cleavage of fluorogemc substrate structurally related to enkephalm Blochem. Biophys. Res Commun 173,647-652 5 Wang, G. T. and Krafft, G. A. (1992) Automated synthesis of fluorogemc protease substrates, design of probes for Alzhelmer’s disease-associated proteases Bzoorg Biomed Chem Lett 2,1665-1668. 6. Meldal, M and Breddam, K (1991) Anthramlamlde and mtrotyrosme as a donor acceptor pan m internally quenched fluorescent substrates for endopeptidasesmulticolumn peptlde synthesis of enzyme substrates for subtlhsm Carlsberg and pepsin Anal Blochem 195, 141-147 7 Gr@n, H , Meldal, M., and Breddam, K. (1992) Extensive comparison of substrate preferences of two subtlhsms as determined with peptlde substrates which are based on the principle of intramolecular quenching. Biochemzstry 31,601 l-601 8. 8 Gran, H. and Breddam, K (1992) Interdependency of the binding subsltes m Subtilism. Biochemzstry 31, 8967-897 1 9. Svendsen, I (1976) Chemical modiflcatlons of the subtllisms with special reference to the bmding of large substrates A review Carlsberg Res Commun 41, 237-29 1. 10. Geysen, H. M , Meloen, R. H., and Bartelmg, S J (1984) Use of peptlde synthesis to probe viral antigens for epitopes to a resolution of a single ammo acid Pm. Natl. Acad Scl USA f&3998-4002
56
Meldal
11 Frank, R (1992) Spot-synthesis-an easy technique for the positlonally addressable, parallel chemical synthesis on a membrane support Tetrahedron 48, 9217-9232 12 Fodor, S P A., Read, J L , Plrrung, M C , Stryer, L , Lu, A T , and Solas, D. (1991) Light-directed, spatially addressable parallel chemlcalClsyntheslsSclence 251,767-773 13 Houghten, R A (1985) General method for the rapid solid-phase synthesis of large numbers of peptldes Speclflclty of antigen-antibody mteractlon at the level of mdlvldual ammo acids Proc Nat1 Acad Set USA 82,5 13 1-5 135, 14 Holm, A and Meldal, M. (1989) Multiple column peptlde synthesis, m Pepllcles f988, Proceedings of the 20th European Peptide Symposmm, (Jung, G and Bayer, E eds.), Berlin, Walter de Gruyter, pp. 208-210 15 Meldal, M., Helm, C B , BoJesen, G , Jacobsen, M H , and Helm, A (1993) Multiple column peptlde synthesis, part 2(1,2) Znt. J. Pept. Protezn Res. 41, 250-260 16 Meldal, M , Svendsen, 1 , Breddam, K., and Auzanneau, F I (1994) PortIonmlxmg peptlde hbrarles of quenched fluorogemc substrates for complete subsite mapping of endoprotease speclflclty . Proc Natl. Acad. Scl. USA 91,33 14-33 18 17 Juhano, M A , Nery, E D , Scharfstem, J , Meldal, M , Svendsen, I , Walmsley, A , and Juhano, L (1997) Characterlzatlon of substrate speclficlty of the maJor cysteme protease (cruzlpam) from trypanosoma cruzl .I. Blol Chem., m press 18 Lam, K S , Salmon, S E , Hersh, E. M , Hruby, V J , Kazmlerskl, W M , and Knapp, R J. (199 1) A new type of synthetic peptlde library for identifying hgandbinding activity. Nature 354,82-84 19 Meldal, M. (1994) Multiple column synthesis of quenched solid-phase bound fluorogeruc substrates for characterlzatlon of endoprotease specificity. Method3 6,417-424. 20 Chalt, B. T , Wang, R , Beavls, R. C., and Kent, S B. H (1993) Protein ladder sequencmg. Science 262,89-92 21. Bartlet-Jones, M., Jeffery, W A , Hansen, H F , and Pappin, D. J C (1994) Peptide ladder sequencing by mass spectrometry usmg a novel, volatile degradation reagent Rapid Commun. Mass Spectrom. 8,737-742 22 Youngquut, R S , Fuentes, G R , Lacey, M P., and Keough, T. (1995) Generation and screening of combmatorlal peptlde llbrarles deslgned for rapid sequencmg by mass spectrometry J. Am Chem. Sot 117,3900-3906 23 Vagner, J., Krchnak, V., Sepetov, N F , Strop, P , Lam, K S , Barany, G , and Lebl, M. (1994) Novel methodology for dlfferentlatlon of “surface” and “mterior” areas of polyoxyethylene-polystyrene (POE-PS) supports. appllcatlon to library screening procedures, m Innovatcon and PerspectweJ rn Sol&d Phase Synthesis (Epton, R , ed ), Mayflower Worldwide Llmlted, Kmgswlnford, UK, pp 347-352 24 Meldal, M (1992) PEGA: A flow stable polyethylene glycol dlmethyl acrylamlde copolymer for solid phase synthesis Tetrahedron Lett. 33,3077-3080
Introduction to Solid- Phase Assays
57
25. Meldal, M , Auzanneau, F. I., and Bock, K. (1994) PEGA, Characterization and application of a new type of resm for peptide and glycopeptlde synthesis, m Innovatlon and Perspectives in Solid Phase Synthesis (Epton, R., ed.), Mayflower Worldwide Limited, Kmgswmford, UK, pp 259-266 26 Auzanneau, F I., Meldal, M , and Bock, K (1995) Synthesis, characterization and btocompattbibty of PEGA resms. J Pept. Scz. 1,31-44. 27 Meldal, M , Auzanneau, F.-I , Hmdsgaul, 0 , and Palclc, M M. (1994) A PEGA resin for use m soltd phase chemtcal/enzymatlc synthesis of glycopeptrdes J. Chem Sot. Chem. Common 1849.1850.
Preparation of Biocompatible for Library Syntheses
Resins
Marten Meldal 1. introduction The open structure of the blocompatrble polyethylene glycol polyamide copolymer (PEGA resin) IS presented in Fig. 1, exemplified by the applicatron of the commercrally available bn+2-ammopropyl-PEG,900. With the use of this PEGIgOa, permeability wrth proteins up to 50 kDa has been achreved, as demonstrated by gel permeation chromatography (I). A resin-bound fluoroescencequenched peptrde substrate showed 80% cleavage with subtrhsin Carlsberg (MW 27 kDa) m 1 h and the cleavage went to completion in -2 h. The resin could also be used for glycopeptrde assembly using bovine p-( l-+4)-galactosyl transferase (MW 43/49 kDa) to transfer galactose to the 4-posrtron of GlcNAc (2) In this example, the drffusron and reorientation of the enzyme inside the polymer network was a rate-hmitmg factor for the reactton, which could, however, be brought to completron in 72 h This indicates that the reaction was performed at the practical limit of protein size for preparative enzyme reactions in this resin. PEGA resins perform excellently in solid-phase assays of biomolecular reactions. Furthermore, they are transparent and no light IS absorbed above 250 nm, so they can be used with a variety of different chromophores and fluorescent probes for detection of bromolecular reactions.
2. Materials I
Polymers with longer crosslmkers, PEGdooO,PEGGoooand PEG,,,,, avarlable from Fluka as the underrvatized PEGS, have been prepared for the study of larger proteins in the mass range >-250 kDa (3). The PEGA resins can be prepared by bulk polymerization followed by grmdmg and srevmg of the polymer Into approprrately srzed partrcles or It can be polymerrzed m an inverse suspension polymerFrom
Methods
in Molecular &o/ogy, E&ted by S CablIly
vol 87 Combmatonal Pephde 0 Humana Press Inc , Totowa,
59
Library NJ
Protocols
60
Meldal
D~acryloyl
bts-aminopropyl
PEG
Monoacryloyl
bls ammopropyl
PEG
N-b+. SO4 )z SPAN 20 Heptane cc14 40
JNH, I
m
-90% Free
PEG
amino
group
Nl+
Ftg 1. Preparation of PEGA resin contammg PEG tam by the partial acryloylatton procedure.
lzation under zero gravity (see Note 1) condnions leading to uniformly sized beads (150-250 mm). 2 Various types of PEGA-supports have recently become available from Polymer Laboratories. The suspenston polymerizatton IS carried out m a relatively mexpensive glass reactor composed of a three-necked cylmdrtcal glass reactor with four longitudinal depresstons along the side and a stirrer with two sets of tilted parallel sturer blades as described by Arshady (4) 3 Bts-ammo-PEGS for the preparation of the crosslmker monomer are available m sizes up to MW 2000 (see Note 2), and longer bls-ammo-PEGS are most conveniently prepared by conversion of long-chain PEGS mto the bts-chloride, followed by substitution with potassmm phthaltmlde and treatment with hydrazme hydrate It is also possible to use sodium azrde as a nucleophile, but the subsequent reductton to amme IS more cumbersome and the process 1s not suited for large scale. Several kinds of PEGA polymers have been described (I), and for btochemical assays m water the best 1s a polymer obtained by partial acryloylatton (0 4-O 5 Eq per - NH2) of the brs-ammo-PEG and mixing the monomers with 5-10 weight % acrylamide The synthesis of bls-ammo-PEG IS exemplified with PEG,,,, and polymertzations with PEGA1aaO for library work (1,3)
61
Biocompa tible Resms 3. Methods 3.1. Preparation of Amino Polyethylene Glycols 3.1.1. Preparation of bis-Chloro-Polyethylene Glycol6000
(1)
1. Melt 50 g (8.3 nmol) PEG6aa0 b y heating in an oil bath at 100°C followed by dropwise additron of thronyl chloride (3.65 mL, 50 mmol) within 30 mm 2. Stir the reaction mixture at 100°C overnight, and then cool to room temperature 3 Place the reaction mixture m an ice bath and slowly add 200 mL drethylether with rapid sturmg for 15 min. The product, his-chloro-PEG, precipitates 4 Filter the precipitate, wash rt with ether, and dissolve in 50 mL dichloromethane (DCM). 5. Remove some of the DCM zn V~CUO and repreclpltate the bib-chloro-PEG with ether. 6. Filter the precipitate, wash rt with ether, and dry UI wcuo to give one (46 g 92%). r3C NMR at 75 MHz, (CDCl,): 42 6(Cl-CH,-CH2-), 71 3 (Cl-CHz-CH2-) For PEG&rating material 61 .7(HO-CH2-CHz-), 72 S(HO-CH2-CH2-)
3.1.2. Bis- Ph thal/mido- Polye thylene Glycol6000
(2)
1 Suspend 22g (3.7 mmol) bls-chloro-PEG,,a and 20.5 g (56 7 mmol) potassium phthalimide in 60 mL dry DMF (NWdimethyl formamide). 2 Slowly heat the suspension to 5O”C, add 150 mg tetradecyl trlmethylammomum bromide, and heat the mixture to 110°C m an argon atmosphere for 4 h 3. Filter off the precipitate and slowly add ether to the clear filtrate with sturmg. Then, stir for another 30 min m an ice bath after the preclprtatlon 1s completed. 4. Filter the preciprtate and wash rt with ether. 5 Dissolve the precipitate m 60 mL DCM. 6 Filter off the insoluble impuritres and concentrate the filtrate. 7. Precipitate the resulting Bzs-phthabmzdo-PEG from the DCM solution by addition of ether 8. Filter the Bwphthalimzdo-PEG/ether mixture and wash the precipitate with ether 9. Dry the PEG-phthalrmlde wz vacua to yield two (20 g, 90%) 13C NMR at 75 MHz, (CDC13)* 37.1 (Pht-N-CH,-CH,-), 67.8 (N-CH,-CH,-), 133.8 (Pht), 132.0 (Pht), 123 1 (Pht), 168 1 (C=O)
3.1.3. Bis-Am/no-Polyethylene
Glycoi 6000 (3)
1 Heat under reflux 41 g (6 6 mmol) bls-phthahmldo-PEG and 20.5 mL (414 mmol) hydrazme hydrate (4 14 mmol) in 150 mL absolute alcohol for 12 h. 2. Cool the reaction mixture to room temperature, then filter off the insoluble rmpurules and wash the filter with DCM. 3. Concentrate the filtrate and precipitate the product by addmon of ether in an ice bath 4. Filter the precipitate, redissolve the precipitate in 60 mL DCM, and remove the msoluble lmpurmes by filtration
62
Me/da/
5 Concentate the f&rate and slowly add ether to precipitate the &s-amino-PEG product 6. Filter the product, wash, and dry in vucuo to yteld 36 g of 3 (90%) t3C NMR at 75 MHz, (CDCI,). 41 8 (NH*-CH,-CH2), 73.5 (NH*-CH2-CH2-).
3.2. Monomer
Preparation 3.2.1. Synthesis of Parlrally
and Polymerization Acryloylated
Partially acryloylated PEG IS prepared polymerization apparatus.
(AC&
77 PEG,,,,
to be used directly
in an 850-mL
1 Add dropwrse a solutton of 1.8 mL acryloyl chlortde (0.39 Eq per -NH2 group) m 30 mL DCM to a solutton of 58 g PEG 19oo(29 mmol) m 40 mL DCM whtle starring at 0°C 2 Incubate the reactton mixture for 1 h at 20°C 3 Concentrate the reactton mtxture Concentration of the reactron mixture gives a crude (Acr),, 77-PEG,900 as an opalescent colorless stocky 011 4 Use the same procedure to prepare partially acryloylated polymers of PEG4ac0, PEGGOOO,and PEGSOOO
3 2.2. Polymerization Procedure Using a Suspension Polymerization Apparatus 1 Purge a mixture of N-heptane-carbon tetrachlorrde (6 4, v/v, 470 mL or 138 mL) with argon for 5 mm m the polymertzatton flask (850 mL) 2. Warm up the solutton to 70°C (gee Note 3) and adJUSt the sturmg speedto 1000 rpm (see Note 4). 3 During this period, purge a mixture of the 60-g parttally acryloylated PEG monomet-/95ml water wtth argon. Add 10 g acrylamtde, and after a further 5 mm of purgmg, add to the mtxture of monomers a solutton of sorbttan monolaurate m 2 5 mL DMF and a solution of 750 mg ammonmm persulfate m 2.5 mL water Rapidly pour the mixture mto the polymertzatton flask and leave rt for 2 mm 4 Add 2 mL TEMED (N,N,N’,N’,-tetramethyl ethylene diamme), and a stocky point 1sreached wtthin 30 s 5 After about 5 more mm, resuspendm the reactton mtxture Someof the resm will accumulate at the top of the polymerlzatlon flask durmg the sticky pertod This IS resuspendedby stnrmg at 1500 rpm and then allowing the reaction to proceed under 1000 rpm, stnrmg at 70°C for 3 h 6. Allow the resin to cool. 7 Filter off the resm, washtt twice wrth ethanol, then wtth water, and passtt through a steel mesh(l-mm* holes) (seeNote 5) 8 Transfer the resm back to the filter, wash twice with 2 vol ethanol, and dry successtvely under low vacuum (water pump) and htgh vacuum (lyophtlyzer) for a period of 2 d
Blocompa tible Restns
63
9 Use the same procedure to prepare polymers contammg PEG,,,,, PEG6sa0, and PEGsma (some dtfftculttes might occur when polymers contammg PEG,,,, are prepared)
3.23. Estimation of Polymer Supported Amino Group by the Fmoc Release Method 1. Take 50 mg of dried ammo resin m a plastic syringe and swell rt m DMF 2 Filter off excess DMF Add 10 mg Dhbt-OH (3,4-dlhydro-4-oxoI ,2,3-benzotrtazo-3-yl-OH) and 35 mg Fmoc-Gly-OPfp (fluorene-9-ylmethyloxycarbonyl-Gly-0-pentafluorophenyl) dtssolved m 1 mL DMF. Incubate for 30 mm. 3 Filter the resm and wash 3X wrth 1 mL DMF, twrce wtth 1 mL 5% DIPEA-DMF, 3X with 1 mL DMF, and 3X with 1 mL DCM 4 Dry under vacuum for 6 h. 5 Accurately weigh 5-10 mg dry resin mto a plastic tube, add 6-10 mL 20% prperrdme m DMF, and mrx 6 Measure the OD of the solutton at 290 nm The ammo group capacity can be determmed from a standard curve
4. Notes Zero gravity IS ensured by adjustment of the density of the organic phase by addition of tetrachloromethane tf the aqueous phase 1s smkmg and hexane d tt IS floating The final swellmg of the resm IS dependent on the drstrrbutlon of chain length m the commerctal starting PEG polymer. Broad drstrlbuttons result m less swelling The temperature must be kept close to 70°C m order to avord agglomerates of beads. The size and size drstrrbutron of beads are very dependent on the exact order of events, amounts of reagents, strrrmg, temperature, and geometr;’ of the polymerrzer If small beads are formed they can be removed by srevmg through a 200-mm steel mesh.
References 1 Auzanneau, F I , Meldal, M , and Bock, K (1995) Synthesis, characterlzatton and biocompattbrltty of PEGA resms. J. Pept. Sci. 1,31-44 2 Meldal, M., Auzanneau, F -I , Hmdsgaul, 0 , and Palctc, M M (1994) A PEGA resin for use m solid phase chemlcal/enzymattc synthesis of glycopepttdes J Chem Sot Chem Commun. 1849,185O 3 Renil, M. and Meldal, M (1996) The Influence of PEG-crosslmkers on permeable PEGA-resins for large btomolecules J. Pept Scl., to be submitted 4 Arshady, R (1991) Beaded polymer supports and gels J. Chromatogr 586, 181-197
Intramolecular Fluorescence-Quenched Substrate Libraries Morten Meldal 1. Introduction As described in Chapter 6, the most versatile fluorescence-quenched pan with respect to both ease of synthesis and efficiency of energy transfer IS the Abz/ Tyr(3-NO,) pair (2-ammobenzoyl/3-nitrotyrosme). The synthesis of the surtably protected buildmg blocks that can be used m a flexrble way m multrple-column peptide synthesis (MCPS) mvolves the preparation of Fmoc-Tyr(NOJ-OH (fluorene-9-ylmethyloxycarbonyl-Tyr(NO,)-OH) and Fmoc-Lys(Boc-Abz)OPfp (Fmoc-Lys(tert-butyloxycarbonyl-Abz)-O-pentafluorophenyl ester) as described (m Subheadings 2.2.1,2.2.4.). The Fmoc-Tyr(NOJ-OH can be activated zn sztu since protection of the acidtc phenol IS drffrcult and any acylatron of the nitrotyrosme side-chain during syntheses 1s completely reverted m the subsequent treatment with prperrdme. The MCPS 1s particularly useful for portion mixing since all that IS needed is to add a mixing chamber above the open columns of the synthesizer. A detailed procedure for the synthesis of a fluorescence-quenched substrate library IS described below and demonstrated for the serme protease subtiltsm Carlsberg substrate with the structure H-Y(N02)X’X2PX3X4X5K(Abz)-(PEGA) where X can be any of the 20 naturally encoded ammo acids. Prolme has been inserted to direct the cleavage since prolme IS only accepted m S,; however, rt 1s not a requrrement to dnect the cleavage and subsequent substrate libraries have been randomized m all positions It is important to compare the results obtained by the library assay with those found in solutron assays with soluble substrates. Such results may present minor drfferences m certain subsites as rn the case of P2’ with subtrlism From
Methods
m Molecular B/o/ogy, vol 87 Combmafonal Pepfrde Edlted by S CablIly 0 Humana Press Inc , Totowa,
65
Ljbrary NJ
Profocots
Meldal
66
Carlsberg, where valme gives the fastest reaction in solution whrle glutamic acid IS preferred in the solid-phase assay, although valines were found among the fastest reactions even in the beads. This contradictron indicates that behavior of the enzyme may depend on the mrcroenvironment, e.g., membranes, cofactors, and so forth. The soluble substrates are most conveniently synthestzed by multiple-column peptlde synthesis as described m Subheading 3.4. (I).
2. Materials 2.1. General 1 Mtxmg of resm IS achteved etther by nitrogen bubbling or by mechamcal shakmg 2 A sample manual ltbrary synthesizer has been descrtbed prevtously m detail (2) It IS composed of a cylmdrrcal Teflon reactor wtth 20 columns and a resm-mtxmg chamber above Two washmg heads wrth 20 outlet tubes connected to drspensmg bottles delrver (DMF) and prpertdme, respecttvely, and are mounted on a metal frame A sealed lid IS fitted at the top of the reactor with an 0-rmg when the
hbrary IS turned upside down for resm mixing on a mechanrcal shaker Reagents
3
4.
5. 6.
are removed from the bottom of the reactor by applying a vacuum to the column outlets. A sample and mexpensrve alternatrve IS a series of 20 syrmge synthestzers connected to a vacuum waste flask via manual two-way valves and Teflon tubmg (3), m this case the resin must be mechamcally transferred to a bottle for mixing between couplmg steps The most versatile chemistry for the constructron of libraries IS the use of preformed Fmoc-ammo acid-OPfp ester (4,5) building blocks since these are stable m DMF solutron at -20°C for the period of a complete synthesis, and stock solutions can be made. Furthermore, addition of catalysts, such as Dhbt-OH (3,4dlhydro-4-oxo- 1,2,3-benzotrrazo-3-yl-OH), HOBt (1 -hydroxybenzotrrazol), or HOAt (7-aza-I -hydroxybenzotrrazol) readily converts the Pfp-ester into hrghly reactive intermediates The couplmg of single nonacttvated ammo acid derivatives, such as the FmocTyr(NO,)-OH, IS conveniently performed by the zn sztu procedure using TBTU (0-benzotrrazo-1 -yl-N,N,N’,N’-tetramethyl uromum tetrafluoroborate, [6]) Reagents are purchased from Bachem (Bubendorf, Switzerland), Novabrochem (Bad Soden, Germany), or synthesized as described in Subheadings 2.2.1,2.2.4. Preparatron of btocompattble polyethylene glycol polyamide copolymers (PEGA resin) IS described m Chapter 7
2.2. Preparation
of Fluorogenic
Building
Blocks
2 2.1. Synthesis of 2-tert -9utyloxycarbonylamlno 1, Drssolve the followmg
reagents m 50 mL DMF
Benzoa te
5 1 6 g BoczO (236 mmol), 25 9
g anthranrhc acrd (189 mmol), and 50 mL trrethylamme few minutes gas evolutron IS commenced at 20°C until the gas evolution 1s ceased
(360 mmol). Within a
Leave the mixture for a pertod of 24 h
IM Fluorescence-Quenched
Llbranes
67
2 Verrfy that the reaction 1s completed using thm layer chromatography on srhca gel plates (TLC) by elutron with ethyl acetate (EtOAc). 3 Treat the mrxture wrth charcoal and filter through celrte that has been rinsed wrth DMF. 4. Remove all the DMF WIVQCUOat 30°C. 5. Dtssolve the residue m water and acrdify the solutron to pH 2.0 with crtrrc acid 6 Extract the product with 2X 200 mL drchloromethane. 7. Extract the combined organic phase 3 times with 100 mL water 8. Dry the organic phase wrth filtered sodrum sulfate, filter, concentrate, and drssolve m 100 mL of drethyl ether 9. Add petroleum ether until the product, 2-tert-butyloxycarbonylammo benzoate, IS crystallized and filter off the product. 10 Recrystallize the crude material from 50% aqueous ethanol to give 35 g (8 1%) of pure Boc-anthramlrc acid, mp 149-150°C ‘H-NMR at 500 MHz (CDCI,) ppm (J Hz), Boc, 1 54, H3,8 11 (7.7), H4,7 57 (7.7,7.5); H5,7 04 (7 5,8 4), H6,8 48 (8 4); Boc, 1 55; COOH, 10 02
2.2 2. Synthesis of 3,4-Dihydro-4-oxo-7,2,3-Benzotriazol-3-y/ 2-tert-Butyloxycarbonylamino Benzoate (Boc-Abz-ODhbt) 1 Dissolve 2 37 g 2-tert-butyloxycarbonyl ammobenzorc acrd (10 mmol) m 15 mL of DCM and 5 mL of tetrahydrofurane (THF) 2. Cool the mixture to -5°C and add 2 06 g (10 mmol) DCCI (N,W-dicyclohexyl carbodumtde) 3 After 5 mm add 1.63 g (10 mmol) Dhbt-OH, and star the mrxture at -5°C for 1 h and then at 4°C for 16 h. 4 Alter the reaction mrxture and remove the solvents zn uacuo 5 Crystallize the product by addition of 30 mL drethyl ether. 6. Filtration affords 3 7 g (97%) Boc-Abz-ODhbt, which ISpure according to HPLC. mp 155-156°C ‘H-NMR at 500 MHz (CDCls). ppm (J Hz), H3,8.48 (7 7), H4, 7.72 (7 7,7.4), H5,7 I9 (7.4,7 8); H6,8.61 (7.8); H5’, 8.32 (7 4); H6’, 8 10 (7.4, 7.7, 1.2), H7’, 7 93 (7 7,7 8), H8’, 8.42 (7 8, 1.2), Boc, 1 52, NH, 9.58
2.2.3. Syntheses of N”-(Fluoren-9-yl-Methoxycarbonylj-NE-(2-tertButyloxycarbonylamino Benzoyl) L-lysine Pentafluorophenyl ester (Fmoc-Lys(BocAbz)-OPfp) 1 Dissolve 2.0 g Fmoc-Lys(Boc)-OH (4.27 mmol) m 20 mL TFA (trrfluoro acetic acid), concentrate the solution, and lyophrllze 2. Drssolve the resulting or1 in 10 mL DMF and add to rt a solutron made of 1 63 g Boc-Abz-ODhbt (4 27 mmol) and 5.4 mL NEM (4-ethyl morpholme) (42.7 mmol) m 20 mL DMF. 3 Stir the solutron at room temperature for 1 h, then keep overnight at -20°C 4. Concentrate the solutron and purify the Fmoc-Lys(BocAbz)-OH by VLC (vacuum lrqmd chromatography) using frrst, light petroleum ethyl acetate
68
Meldal
1 1 (500 mL), then hght petroleum ethyl acetate acetic acid 10.10 1 to yield the free acid (2 02 g, 81%). 5. Dissolve 1 28 g of Fmoc-Lys(BocAbz)-OH (2 19 mmol) and 0.40 g Pfp-OH (2 19 mmol) m 5mL THF, cool to 0°C 6 Add 0 45 g (2 19 mmol) DCCI and stir the solution at 0°C for 1 h, then leave at -20°C overnight 7 Filter the reaction mixture, concentrate, and purify by VLC (light petroleum ethyl acetate 4 1) to yield the Fmoc-Lys(BocAbz)-OPfp, ‘H-NMR at 500 MHz (CD(&) 1.51 (9 H, s, Boc), 1 55 (2 H, m, H,), 1 72 (2 H, m, Hd), 1 93 (1 H, m, Hb), 2.08 (1 H, m, Hi,), 3 45 (2 H, m, H,), 4 20 (1 H, t, Fmoc), 4 35-4 47 (2 H, m, Fmoc), 4.73 (1 H, m, H,), 5 49 (I H, d, NH,), 6.41 (1 H, t, NH,), 6 91 (lH, t, Abz), 7 28 (2 H, t, Fmoc), 7 34-7.41 (5 H, m, Abz and Fmoc), 7 56 (2 H, d, Fmoc), 7.75 (2 H, d, Fmoc), 8.32 (lH, d, NH,&
22.4. N”-Fluoren-Bylmethyloxycarbonyl-3-Nitrotyrosine Dissolve 3 39 g H-Tyr(NO,)-OH (15 mmol) m 50 mL water containing 3 98 g sodium carbonate (38 mmol) and 20 mL dioxane. Dissolve 5 20 g of Fmoc-OSu (15 5 mmol) m 20 mL dioxane and add it dropwise at 0°C to the H-Tyr(NO,)-OH solution from step 1 Stir the mixture for I h at O’C and 3 h at 20°C Remove the dioxane zn vacua and dilute the residue to 50 mL with water Extract the byproducts with diethyl ether and acidify the solution with citric acid Collect the precipitate by filtration and dry tt Extract the product with ethyl acetate, filter off msoluble material, and crystallize it by adding -3 vol petroleum ether and coolmg Collection of the crystallme material by filtration and washing with petroleum ether affords 6.09 g of product (91% yield) mp 145-148, ‘H-NMR at 500 MHz (CDCl,) ppm (J Hz), 01-H, 10 52; H2,4 ‘72 (5 0,6 0,7 0 Hz), H3,3 12 (13 5,6 0), H3’, 3 26 (13 5,5 0); H5,7 96, H5’, 7 35 (8.0); H6’, 7.12 (8 0), Fmoc, 4 24 (6 5); 4 45 (6 5, 10.5), 4 54 (6 5,lO 5), 7.37 (7 0), 7 44 (7.5,7 0), 7.54 (7 5,7 5), 7 81 (7 5)
3. Methods
3.7. Library Synthesis 3.1.1.
Preparation
The following
of Substrate procedure
Libraries
demonstrates
H-Y(N02)XLX2PX3X4X5K(Abz)-(PEGA) procedure
can be applied for any proteolytic
by Portron synthesis
Mixing
of the substrate
library
for subtihsin Carlsberg. The same substrate
1 Swell 3 g (0 23 mmol/g) PEGA,sea (see Subheading transfer it to the multiple-column library generator
library. 2.1., step 6) m DMF and
IM Fluorescence-Quenched
Llbrar\es
69
2. Add to each column 40 mg Fmoc-Lys(BocAbz)-OPfp (0 051 mmol) and 8 mg Dhbt-OH (0.050 mmol) m 700 FL DMF. Leave for 3 h 3 Remove the reagents and wash the resin with 6X 16 mL DMF and then with one ~0120% prperidine in DMF. 4 Treat the resin wrth 20% prpertdme for 20 mm and wash wrth 8X 16 mL DMF 5. Add to each column 3 eq of the 20 Fmoc-ammo acid-OPfp esters and 8 mg DhbtOH in 700 FL DMF, respectively 6 Gently agitate the synthesizer for 3 h. 7 Wash and deprotect the resin as described m steps 3 and 4 8 Wash the resin with 6X I6 mL DMF and add 50 mL DMF to cover the columns as well as one-third of the mrxmg chamber. 9 Frt the closed lid, turn the synthesizer upside down, and agitate tt vrgorously (see
Note 1) 10 Mount the synthesrzer on a mechanical shaker and agitate it for a further 30 mm 11 Turn the synthesizer upright, open it, and empty by suctton. 12 The resin is now evenly dtstributed among the columns Remove the DMF and wash the resm twrce wtth 16 mL DMF 13. Repeat twice the couplmgs of the 20 mdrvidual ammo acids, by repeating the aforementioned process of ammo acid couplmg, deprotectton, and mtxmg 14 Couple the resin m all the columns with 52 mg Fmoc-Pro-OPfp (0 10 mmol) and 16 mg Dhbt-OH (0 10 mmol) 15 Wash, deprotect, and remove the reagents. Then, wash the columns again with 8X 16mLDMF 16 Dissolve 3 eq (0 10 mmol) of the 20 mdtvtdual Fmoc-ammo acid-OPfp (or -0Dhbt m the case of Ser and Thr) esters and 16 mg (0 10 mmol) Dhbt-OH m 700 PL DMF and add tt to the 20 wells of the library synthesizer 17 Gently agitate the synthesizer for a period of 3 h, wash the resm wrth DMF, and deprotect as descrrbed m steps 6 and 7 18 Wash the resin 6X 16 mL DMF, fill the synthesizer with 50 mL of DMF, and close with a hd sealed with an O-ring 19 Turn the synthesizer upside down, vtgorously agitate it for 2 min, and agitate for another 30 mm with a shaker 20 Deprotect the resin as descrtbed above and perform two cycles of coupling with 20 Fmoc-ammo acid-OPfp esters, deprotectron, and mixing 21. Dissolve 1024 mg Fmoc-Tyr(NOJ-OH (2.3 mmol) m 14 mL DMF, add 0.731 mg TBTU (2 3 mmol) and 287 pL NEM (2.3 mmol) (see Note 2) Leave for 10 mm 22 Distribute the mixture equally between the 20 columns of the synthestzer 23 After 2 h remove the reaction mrxture and wash the columns with 8 vol DMF and 8 vol DCM 24 Transfer the resin to a glass vessel and dry rt 25 Deorotect the oeottde hbrarv with 95% TFA for 15 mm.
Melclal 26 Remove the TFA, wash the resm with 95% TFA, and treat it for 2 5 h with 95% TFA 27 Wash the peptlde library successively with 95% acetlc acid, DMF, 5% dllsopropylethylamme (DIPEA) m DMF, DMF, and DCM 28. Dry the resin on a lyophlhzer before commencmg the enzyme assays. 3.2. Enzyme
Assays
The enzyme reaction is carried out in a tube at lo-fold the enzyme concentration required for the solution assays to compensate for general decrease In rate of reaction imposed by the gel matrix. The single beads may be collected and the reaction quenched during the progress of enzyme reaction as they reach an intermediate level of fluorescence. However, it is much preferred to allow the enzyme reaction to progress for an appropriate period of time and then to quench the reaction m the entire library. The degree of conversion in the individual bead is then a semiquantltatlve estimation of the substrate reactivity. The solid-phase substrate library assay is illustrated for subtilisin Carlsberg and a similar study has been performed with the much more specific enzyme cruzlpam isolated from the parasite trypanosoma Cruzi (7). The increased specificity IS clearly reflected in the result of the solid-phase assay. 3.2.1.
Substrate
Library
Assay
1 Treat 300 mg of the swelled PEGA-bead library with the chosen enzyme usmg appropriate enzyme condltlons For example, when subtihsin Carlsberg IS used, 5 x 10m7M of the enzyme is incubated for 45 mm m the presence of 50 mM blcme, 2 mA4 CaCI, at pH 8 5 2 Stop the enzyme reaction (for example, 2% TFA IS used to quench subtlhsm Carlsberg and then the mixture IS neutralized with sodium hydrogen carbonate) 3. Wash the resm with water, pH 8 5. 4. Pick up from the slurry of resin m water 0.75 mL (-70,000) beads and spread them m the center of a glass plate 5 Using fluorescence microscopy (excltatlon 320 nm, emlsslon 420-500 nm), pick up the most fluorescent beads, appearmg with a broad rmg of fluorescence around a darker nucleus, and transfer them to a dry area m the glass periphery 6 Collect the mdlvldual beads with a dry glass rod (see Note 3) and transfer them to a sequencing filter for sequence analysis 7 Sequence analysis yields the complete peptlde sequence as well as the C-terminal part of the cleaved peptide still attached to the resin The C-terminal sequence rndlcates the site of the cleaved bond. 8 The conversIon per minute IS calculated as an approximate rate of hydrolysis for each substrate 9 An example of isolated substrates, indicating a statistical preference dlstrlbutlon between permitted ammo acids for each subslte of the enzyme cavity, 1spresented
IM Fluorescence-Quenched
Libraries
71
10 1’ 5
0 ACDEFGHIKLMNPQRSTVWY
Fig. 1. The distribution of amino acids in the respective subsites of subtilisin Carlsberg. Particular important subsites are S4 where only lipophilic amino acids are accepted and S 1 where Leu and Phe are preferred. S3 is not selective. S 1’ prefers small polar amino acids, and S2’ prefers a glutamic acid. in Fig. 1. The most active substrates (pH 5.2) and Y(NO,)LGPFNEK(Abz) studies in solution (8).
3.3. Peptide Sequencing on Single Beads
in this case are Y(NO,)FQPLDVK(Abz) (pH 8.5), both in agreement with previous
of Abz/Tyr(3-NO,,)
Substrates
I. Sequence analyses by Edman-degradation is suggested to afford a good signal to noise ratio using large beads (250-400 pm diameter). The beads are directly placed on a sequencing filter and inserted into the amino acid sequencer. Both the nitrotyrosine and the 2-amino benzoic acid are quantitatively released in the first cycle of Edman-degradation and analyzed. When no other amino acid is detected a cysteine is assumed. Repetitive yield of detected amino acids decreases with the cycle number in spite of the fact that the substrates are bound to the solid phase. From the ratio of X1 and X5 in the second cycle it is possible to generate a semiquantitative estimate of the enzymatic conversion obtained for each substrate as a function of the time of reaction. At least 5% of cleavage is required for the determination of the cleavage site (1,2).
3.4. Confirmation of Substrates
of the Results
by Multiple-Column
Synthesis
3.4.1. MCPS of Model Substrates by Substitution of Y(NO,)FQPLDEK(ABz)GD (see Table 1) 1. Pack 30 mg PEGA-resin (0.19 mmohg) already derivatized with hydroxymethyl benzamide and esterified with Fmoc-Asp(tBu) into each column of a 96-column Teflon synthesis block containing PFTE (polyfluorinated polyethylene) filters at the bottom.
Meldal
72 Table 1 Kinetic Data on Cleavage at pH 8.5
of Selected
Substrates
in Solution
kcatKn
Compound 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20
Sequence Y(NO,)FQPLDEK(Abz)GD Y (NO,)MQPLDEK(Abz)GD Y(NO,)YQPLDEK(Abz)GD Y(NO,)VQPLDEK(Abz)GD Y(NO,)IQPLDEK(Abz)GD Y(N02)FRPLDEK(Abz)GD Y (NO,)FVPLDEK(Abz)GD Y(NO,)FTPLDEK(Abz)GD Y(NO,)FQALDEK(Abz)GD Y(NO,)FQRLDEK(Abz)GD Y(NO,)FQLLDEK(Abz)GD Y(NO,)FQKLDEK(Abz)GD Y(NO,)FQELDEK(Abz)GD Y(NO,)FQFLDEK(Abz)GD Y(NO,)FQPADEK(Abz)GD Y(NO,)FQPLAEK(Abz)GD Y(NO,)FQPLDVK(Abz)GD Y(NO,)FQPLDDK(Abz)GD Y(N02)IAPLATK(Abz)GD Y(NO,)LQPASEK(Abz)GD
mk-‘mm-’
32,000 11,000 7400 3800 4100 83,000 3 1,000 35,000 290,000 45,000 22,000 130,000 620 930 1300 220,000 200,000 16,000 210,000 8400
2 Synthesize the substrates in 22 of the columns simultaneously with other unrelated synthesis m the residual 74 columns 3 Deprotect the resin m the 96 colums with 40 mL of 20% pipertdme m DMF for 1.5 mm and wash successively with DMF (3X 4.5 mL), Dhbt-OH m DMF (300 mg, in 40 mL), and DMF (3X 45 mL) 4. Dissolve Fmoc-Gly-OPfp (8 mg, 3 Eq/column) and Dhbt-OH (3 mg, 3 Eq/ column) m DMF (300 l.tL/column), then add the mixture to the resm. 5. Leave the reaction for a period of 2 h with agitation, and remove the reagents by suction 6 Deprotect and wash the resin as described m step 3 7 Dissolve Fmoc-Lys(Boc-ABz)-OPfp (13 mg, 3 Eqkolumn) and Dhbt-OH (3 mg, 3 Eq/column) m 300 pL DMF, then add the mixture to the resin 8. Leave the reaction for a period of 18 h with agitation, then remove reagents by suction. 9 Repeat the cycle of washing, deprotectlon, and coupling as described above for Fmoc-Gly-OPfp using the appropriate Fmoc-ammo acid-OPfp esters according to the identified substrate sequences
IM Fluorescence-Quenched
Libraries
73
10. After the last coupling-deprotectton-washing cycle activate 735 mg (1 64 mmol) Fmoc-Tyr(NOz)-OH for 15 mm at room temperature with TBTU (526 mg, 1 64 mmol) and NEM (205 pL, 1 64 mmol) m 30 mL DMF Then, add the solution to the resm Leave for 24 h 11. Remove the reagents by suction, wash the resin with 6X 45 mL DMF, deprotect with 2X 40 mL 20% ptpertdme in DMF (2 mm and 15 mm), and then successively wash with 6X 45 mL DMF and 5X 45 mL DCM. 12. Dry the resin under high vacuum. 13. Treat the resm with 95% aqueous TFA for 2 h Then remove the TFA by suctton 14. Wash the resin with 6X 45 mL DCM, and then 3X 45 mL DMF, and neutralize with 2X 40 mL 2% ptpertdme in DMF. Fmally, wash the resin with 6X 45 mL DMF and 6X 45 mL DCM 15 Dry the resin zn vacua. 16 Cleave off the peptldes with 0 1M NaOH solutton 350 pL/column for 2 h. 17 Elute the product from the column and neutralize wuh O.lM HCI 18. Dissolve the peptides m a small amount of DMF and purtfy by HPLC
3.5. Enzyme Hydrolysis Use the enzyme and a variety of peptide substrate concentrattons to determine the kinetic profile of hydrolysis of each of the selected substrates (an example IS shown m Table 1). 4.
Notes
1 It is important to ensure extensive mixing between couplmg steps by both mtenstve manual shaking as well as prolonged mechamcal shaking 2. If Boc-Tyr(3-N0.J IS used for the final couplmg the library must be treated with piperidine after the final TFA treatment to revert stde-chain acylatton 3 The beads contam different substrates and are usually not quenched to the same extent It therefore takes practice to dtfferenttate beads that are less well quenched from active beads. The active beads appear wtth an tlluminated rmg-shaped periphery in contrast to less well quenched beads, whtch are uniformly tllummated
References 1 Meldal, M , Svendsen, I , Breddam, K , and Auzanneau, F I (1994) Porttonmixing peptide libraries of quenched fluorogemc substrates for complete subsite mapping of endoprotease specificity. Proc. Natl. Acad. Scz. USA 91,3314-3318 2 Meldal, M (1994) Multtple column synthesis of quenched solid-phase bound fluorogemc substrates for charactertzatton of endoprotease spectfictty Methods 6,417-424. 3 Peters, S , Meldal, M , and Bock, K (1996) Recent development m glycopeptrde synthesis, in Modern Methods in Carbohydrate Syntheses (Khan, S H., O’Netll,
R. A., eds ), Harwood Academic Publishers, Amsterdam, pp. 352-377
Meldal 4 Dryland, A and Sheppard, R C (1988) peptide synthesis Part II. A system for continuous flow sohd phase peptlde synthesis using fluorenylmethoxycarbonylammo acid pentafluorophenyl esters Tetrahedron 44,859-876 5. Klsfaludy , L and Schon, I. (1983) Preparation and applications of pentafluorophenyl esters of 9-fluorenylmethyloxycarbonyl amino acids for peptide synthesis Synthesis 325,326. 6 Knorr, R , Trzeclak, A., Bannwarth, W., and GIllessen, D (1989) New coupling reagents m peptlde synthesis Tetrahedron Lett. 30, 1927-l 930 7. Juhano, M A , Nery, E D , Scharfstem, J , Meldal, M , Svendsen, I., Walmsley, A., and Juhano, L (1996) Characterization of substrate speclficlty of the maJor cysteine protease (cruzlpam) from trypanosoma cruzl .I. Blol. Chem , m press 8 Grpm, H , Meldal, M , and Breddam, K. (1992) Extensive comparison of substrate preferences of two subtdlsms as determined with peptlde substrates which are based on the prmclple of mtramolecular quenching. Bcochemutry 31,601 l-60 18.
9 The Solid-Phase
Enzyme Inhibitor
Library Assay
Morten Meldal 1. Introduction Synthesis of a portion mixing library of putative inhibitors in a resin already containing a good fluorescence-quenched substrate, which may have been defined with substrate libraries as described in Chapter 8, provides a method for direct detection of inhibitory activity (1). Beads containing potential inhibitors remained dark while enzyme cleaved the substrate in beads containmg noninhibitors, resulting m a dramatic increase m fluorescence. The dark beads can be collected and analyzed by sequence analysis. The o-amino acids are usually not accepted in the PI subsite. It is therefore reasoned that incorporation of a single o-ammo acid in the center of an L-amino acid sequence m a portion mixing library would yield a set of compounds that would be likely to show some inhibitory activity. A beaded PEGA-resin is substituted with a mixture of Fmoc-Lys(Boc)-OH (fluorene-9-ylmethyloxycarbonyl-Lys-(tert-butyloxycarbonyl)-OH) and the base labile linker, 4-hydroxymethyl benzoic acid, which acts as a protecting group while assembly of the substrate is performed using Fmoc-amino acid-OPfp (pentafluorophenyl) esters. The side chain of Lys is deprotected and reacted with Boc-Abz-ODhbt (Boc-2-aminobenzoyl3,4-dihydro-4-oxo1,2,3benzotriazo-3-yl-ester). The substrate is assembled with Pfp-esters and N-acetylated using Ac-ODhbt (Acetyl-ODhbt) Two-thirds of the functional groups are reserved for the syntheses of the inhibitor library. The hydroxymethyl benzamide is esterified with Fmoc-Val-OH, and using all encoded Fmoc-amino acid-OPfp esters, a library with the structure X1X2X3x4X5X6 (where X indicates an L-amino acid and x, a o-amino acid) is assembled on the Val after transfer of the resin to the 20-column peptide library generator (2) described m Chapter 8. The completed library is deprotected with From
Methods
m Molecular Edlted
by
Biology, S CablIly
vol 87 Comb/n&or/al 0 Humana
75
Press
Pep/de
Inc , Totowa.
Library NJ
Protocols
76
Me/da/
0.000 0
400
800
1200
1600
Time (Min) Fig. 1. The release of nitrotyrosine using a dilute solution of subtilisin Carlsberg by elution of a column of PEGA resin containing an inhibitor library and a fluorescencequenched substrate.
TFA (trifluoroacetic acid) (see Note 1). Release of peptides from beads with sodium hydroxide and analysis by MALDI-TOF MS (matrix-assisted laser desorption ionization time of flight mass spectrometry) indicated the assembled library to contain pure peptides. The library is packed into a column and treated for 24 h by slow elution with dilute enzyme, e.g., subtilisin Carlsberg solution, and the reaction is monitored as shown in Figs. 1 and 2 (see Notes 2 and 3). After 24 h only very few beads still remain dark and these are collected and sequenced. The elution protocol is performed in order to follow the reaction and to limit peptide transfer reactions (see Note 4). Searching for subtilisin Carlsberg peptide inhibitors we found that inhibitory peptide sequences were surprisingly different in their structure; they could not be aligned and did not have a lot in common with the substrate specificity except for the general lipophilic character. There was a preference for Cys(tBu) (Cys tert-butyl) as the n-amino acid but other o-amino acids were found as well (see Note 5). According to the substrate cleavage the best inhibitor was AMMC(tBu)MIV. Other inhibitor sequences that resulted in less than 50% substrate cleavage were VFNiVWV, IIIC(tBu)NYV, WMVfLHV, PVVnIFV, and PFYiQIV (1). Inhibitors linked to a solid phase present at high pseudo concentration may behave differently when the assay is carried out in solution. Some of the inhibitors identified and some designed peptides were therefore synthesized by MCPS (multiple-column peptide synthesis) and their inhibitory activity studied in solution. They were tested for their inhibitory activity on the
Solid-Phase
Enzyme
Inhibitor
77
Fig. 2. The progress of the enzyme reaction in beads containing a substrate and a library of different putative peptide inhibitors with one o-amino acid. The reaction was monitored through a fluorescence microscope. Beads still dark after 24 h are col-
lected and analyzed. hydrolysis of Abz-FQPLDEY(NO,)D by determination of ICsO at a substrate concentration of 7 yM, and an enzyme concentration of 28 nM. The best inhibitors were those that also were superior in the library assay. Thus the superior inhibitory activity (IC,, = 3.1 yM) was observed with
78 AMMC(tBu)MIV, and 7).
Meldal also found to be most active
m the library
(see Notes
6
2. Materials 1. Syringe synthesizer composed of a 20-mL syringe with a Teflon filter connected to a vacuum waste bottle with Teflon tubing and a two-way Teflon valve u3] and Chapter 8) 2. PEGA resin: for preparation see Chapter 7 3 Reagents preparation and source, see Chapter 8.
3. Methods 3.1. Synthesis of the Inhibitor 3.7. f. Syrtthesrs of the Substrate
Library Contarning Beads
1 Pack I 17 g PEGA,, resm (0 27 mmol) m a syringe synthesizer 2 Swell the resm in DMF (NJ+dlmethyl formamlde). 3 Wash the resin with two vol 20% pipendme/DMF and then with DMF Remove excess solvent 4 Make a solution composed of 6 1 mg hydroxymethyl benzcnc acid (1 5 Eq) and 63 mg Fmoc-Lys(Boc)-OH (0.5 Eq) in 11 mL DMF Activate It for 5 mm with 173 mg (2 Eq) TBTU (0-benzotnazo-I-yl-Nfl,IV’fl’-tetramethyl uromum tetrafluoroborate ) and 68 yL (2 Eq) NEM (4-ethyl morpholine) and add it to the resin. React the mixture for 24 h 5 Wash the resin with DMF and dichloromethane (DCM). 6 Treat the resin for 20 min with 2 vol 50% TFAlDCM. 7. Wash the resm with DCM and DMF 8 Allow the free ammo groups of the lysine side chains to react with Boc-AbzODhbt ( 154 mg , -3 Eq dissolved m DMF) 9 Cleave the Fmoc-group with 20% pipenidme/DMF for 10 mm and wash. 10 Continue with peptide synthesis using Fmoc-ammo acid OPfp esters (3 Eq) with ad&on of a catalytic amount of Dhbt-OH (-5 mg) to generate the substrate peptlde. For example, the substrate peptlde of subtlhsm Carlsberg was synthesized to generate Ac-Y(NO,)FQPLAVK(Abz)-PEGA (I). Acetylation of the peptide IS performed with Ac-ODhbt (I I Eq) 11. Wash the resin with DCM and suck It dry 12 Treat the resin with 0.1 MNaOH m the syrmge 13 Wash the resin with water. 14. Freeze-dry the resin.
3.1.2. Synthesis of Combina tonal Inhibitor Library 1 Dissolve 570 mg Fmoc-Val-OH (4 Eq) m 12 mL DCM Activate with 500 mg (4 Eq) MSNT (l-mesltylenesulfonyl-3-nltro-1,2,4-triazme) and 102 pL N-methyl lmldazole (3 Eq) Then, add the solution to the resin and leave it for 27 h.
Solid- Phase Enzyme lnhibrtor
79
2. Wash the resin with DCM and DMF 3 Cleave the Fmoc-group with 20% pipertdme and wash 4 Use a sample of resin to analyze the ratio between Val and the ammo acids of the substrate 5. Transfer the resin to a 20-column library generator with a mixing chamber above the columns and vacuum and pressure regulation of reagent flow as previously described (2) 6 Synthesize a hexa-peptide library containing u-ammo acids at posmon 4 by standard procedures as descrrbed above usmg Pfp esters (3 Eq), Dhbt-OH catalyst, and 2-6 h coupling times The Fmoc-D-amino acids (3 Eq) are activated with TBTU and NEM for 15 mm prior to addition to the resin 7 In each cycle after the Fmoc cleavage turn the synthesizer upside down and mix the resin by vigorous agitation on a shaking table 8 Wash the resin with DMF and DCM. 9 Treat the resin with three portions of 95% aqueous TFA (10 mm, 10 mm, and 5 h) 10 Wash the resin with DMF, 1 ~0120% plperidme/DMF, DMF, and DCM 1 I Freeze dry the resin. 12. Collect a few beads from a swelled sample, cleave each bead with base, and neutralize the filtrate 13 Analyze the filtrate by MALDI-TOF mass spectrometry. Single peaks should be detected m the mass range 700-l 100.
3.2. Isolation
of Beads
Displaying
Specific
Enzyme
Inhibitors
1 Pack 200 mg library resin into a syringe column 2 Elute the column with the enzyme m the proper buffer condition (I e , elution with subtdism Carlsberg IS done m an enzyme concentration of 5 x 10m8M, m 50 mA4 btcme and 2 mM CaCl* at pH 6 0 for 24 h. 3. Follow the reaction by the UV absorbtion of the effluent at 425 nm (Fig. 1) and by mspectton of resin aliquots under a fluorescence microscope (excitation 320 nm, emtssion 420-500nm) (Fig. 2) 4 Terminate the reaction by filtering and washing with water, 2% aqueous TFA, water, 2% NaHCOs, and water. 5 Freeze dry the resin 6 Make up 25-mg ahquots and plate them as a slurry m water on a small Petri dish for collection of beads under the fluorescence microscope 7. Transport the dark beads to the dry glass m the periphery 8 Collect individual beads with the dry end of a closed capillary, and place them on a filter for sequence analysis 9. Results showing putative resin-bound mhlbttors are exemplified m Table 1
3.3. MCPS
of Putative
Enzyme
Inhibitors
1 Synthesize peptides on 60 mg/column Macrosorb diamine and hydroxymethyl benzorc amide
resm derlvatized with ethylene
Meldal
80 Table 1 Synthetic Inhibitors and Their IC,,-Values with Subtilisin (2.5 x 1 Om8M) and the Substrate ABz-FQPLDEY(N02)D-OH % Substrate Structure
IIIc(tBu)NYVF KMMpISVF KMMpMVVF PVVnIFVF VFNIVWV MMMpMMMF AMMc(tBu)MIVF
cleavage m the library 24% -h -b -0 24% -c 22%
Carlsberg (7 x 1 O-7 ma ICsO-Values from solution assay (cLM> Weak 2000 400 95 91 55 3.1
0 Small letters indicate o-ammo acids 6 Combmatlons of motifs from Identified mhlbltors ‘ Designed soluble mhlbltor A solution of subtlhsm Carlsberg (10m6 M) and the substrate (ABz-FQPLDEY(NO,)D-OH, 7 x lo-” M) were prepared m the enzyme buffer (50 mM blcme and 2 mM CaCl, at pH 6 0) a5 well as 1 mg/mL of the peptlde mhlbltor m DMF Then, 100 mL of the substrate solution and 25 PL of the enzyme solution were added to 825-870 PL of the buffer solution, mixed, and the hydrolysis was followed at 25°C The mltlal fluorescence background of the mixture was recorded and found to be 10% of the fluorescence at complete hydrolysis The Influence of the mhlbltor on the mltlal rate of hydrolysis was determined by addltron of increasing amounts of mhlbltor soluttons (5,20, and 50 pL) and the KS0 was determined A solution of the mhlbltor MMMpMMMF was treated with enzyme (lo-’ A4) and no degradation was observed by HPLC
Attach the first ammoacid by the MSNT procedure(see Subheading 3.1.2., step l), peptide assembly is carried out by MCPS as described m Subheading 3.1.2. A standardFmoc-ammo acid-Pfp ester (3 Eq)/Dhbt-OH protocol with 20% pipendme in DMF for deprotection asdescribedm Subheading 3.1.2., step 6 1sused Couple the o-ammo acidsas the free acids(3 Eq) by zrzsztuactivation with TBTU Cleave the protecting groups off the resin by treatment for 2 h with 95% aqueous TFA Filter the resin, wash it with 95% aqueousTFA, DCM, 20% piperidme, DMF, and DCM Dry the resin and cleave the peptides off the resin m a 2-h reaction with sodium hydroxide (0 1 M) Filter off the releasedpepttdes, wash the resm. The solutions were neutrahzed to pH 7 0 on pH paper with HCl(0 1 M), and the peptides were lyophilized Extract the crude products with DMF and analyze by analytical HPLC (40-mm gradient from 20-100% acetonitrile m 0 1% ag TFA) All the compoundselute as a smgle major peak with the correct mass by ES-MS (electrospray mass spectrometry)
87
Solid-Phase Enzyme lnhibrtor
9 Purify crude products to homogeneity by preparative HPLC and analyze whether the resulting peptlde has the right composltlon according to ammo acid analysis
3.4. Solution Inhibitor Assay 3.4.1. Sol&Ion Assay of the Enzyme lnhrbitors Exemplified for Subtllisin Carlsberg 1. Make up the followmg solutions a. Enzyme buffer solution as above (see Subheading 3.2., step 2), b. Enzyme m its buffer solution, c Fluorescence-quenched pan peptide substrates, and d. The putative peptide mhlbltors
2. Mix the enzyme with the fluorescence-quenched pair substrate. 3 Add increasing amounts of Inhibitor to the enzyme/substrate
solution
4. Determine the ICSO of the reactlon
4. Notes 1 Inspection
under fluorescence
microscope
revealed the beads to be completely
and uniformly dark owing to the quenching by nltrotyrosme. 2 The mtrotyrosine release was very fast in the initial 20 min of the reaction and then the rate decreased. 3 By inspection of the beads after 1 h, it was found that most beads were completely fluorescent, however, a surprlsmgly large number of beads still were quite dark, indicating that the peptldes m those beads competed for binding of the enzyme. 4. Batchwise treatment with the enzyme gave similar results 5. In all beads some cleavage of the substrate was observed, as could be expected with the relatively broad specificity presented by subtlllsms However, the inhibitors had not been cleaved to any measurable degree This result was confirmed in solution where the inhibitors were stable in the presence of high
concentrations of subtihsm Carlsberg for a period of 24 h. 6. It was quite dlfflcult to evaluate some of the inhlbltory compounds in a solution assay owing to then highly hpophihc character leading to essentially insoluble compounds. 7 The result with the more specific enzyme cruzlpam gave 20- to 30-fold higher inhibitory activity for the best inhibitors
5. Concluding
Remarks and Future Perspectives
This and the previous chapters have described a new approach to the characterization of the substrate specificity of proteolytlc enzymes and to a direct definition of enzyme inhibitors employmg the strength of combinatorial chemistry. It was demonstrated that a single D-amino acid can confer complete stab&y against a proteolytlc enzyme. The method 1s general and can be apphed with different proteolytic enzymes Different inhibitory elements like dlpep-
Meldal tide epoxides or ammo phosphonic acids may also be used. It is completely independent of prior knowledge of enzyme specificity or structure of natural inhibitors of the enzyme. Provided suitable visual or other detection methods can be developed the method is even more general and can be used for the detection of substrates and inhibitors for virtually any enzyme that can penetrate into the PEGA polymer network. Other porous supports such as dextrans or supported polyamides may be mvestigated for similar applications. The resulting mhibltors can be used for the preparation of second generation inhibitor libraries with nonencoded amino acids in order to further increase the Inhibitory activity This could be particularly important in the case of proteases like cruzipam from the parasite Trypanosoma cruzz, which showed alignment and sequence homology of the identified inhibitors, allowmg for a more mtellegent design of the mhibttor library. The rate-limitmg step m the generation of mformation about enzymes and their inhibitors by the present method is the peptide sequence analysis The development of more general methods, such as ladder synthesis of the library on a biologically stable and inert spacer combined with MALDI-TOF MS (4), holds a lot of promise for an increase m the efficiency and for the scope of this combinatorial approach even with other classes of resin-bound compound libraries. Another enzyme field that could prosper from a combinatorial solid-phase approach is the investigation of glycosyltransferases. Libraries of glycopeptides or oligosaccharides could be synthesized using combmations of chemical couplmgs and enzymatic reactions with different glycosyl transferases. Libraries of putative glycosyl transferase mhibitors may in a similar manner be synthesized in a PEGA-resin containing a glycosyl acceptor and the inhibitory effect on the transfer of labeled donor-substrates may be investigated
References 1 Meldal,
M and Svendsen, I (1995) Direct visualization
of enzyme inhibitors
using a portion mixing mhrbitor library contammg a quenched fluorogemc peptide substrate. 1 Inhibitors for subttllsm Carlsberg J. Chem Sot., Perkzn Trans 1,1591-1596 2 Meldal, M (1994) Multiple column synthesis of quenched solid-phase bound fluorogeruc substrates for charactertzation of endoprotease spectftctty. Methods 6,417-424. 3. Peters, S., Meldal, M., and Bock, K (1996) Recent development m glycopepttde synthesis, m Modern Methods In Carbohydrate Synthesw (Khan, S H and
O’Neill,
R. A , eds ), Harwood Academic Publishers, Amsterdam, pp. 352-377
4 Youngquist, R S , Fuentes, G R , Lacey, M P., and Keough, T (1995) Generatron and screenmg of combinatorral pepttde libraries designed for rapid sequencmg by mass spectrometry J. Am. Chem Sot 117,3900-3906.
10 Determination of Peptide Substrate Motifs for Protein Kinases Using a “One-Bead One-Compound” Combinatorial Library Approach Kit S. Lam 1. Introduction Protein phosphorylation is one of the more than 100 known posttranslational modifications of proteins (1-4). There are more than 240 protein phosphorylation sites reported (5), and many protein kinases have been cloned and expressed. The sues of phosphorylation are usually serine, threonine, tyrosine, or occastonally histrdine. The two major classes of protein kmases are serme-threonine protein kmase and protein tyrosme kinase. Substrate motifs for several serme-threonine kinases are known (S), and they are often confined to a linear motif. In contrast, little is known about the substrate speclficity of protein tyrosine kinases (PTKs) and peptide substrates based on the autophosphorylatron sue of these enzymes are often very inefficient, with a K, m the high micromolar to millimolar range. It was not until recently when combinatorial peptide library approaches were used that some novel and relatively more efficient peptide substrates for some PTKs were discovered (6-8). Songyang et al. (6) synthesized a biased random peptide library with the following general structure: MXXXXYXXXXAKKK, where X = all 15 ammo acids except Tyr, Trp, Cys, Ser, and Thr. The peptide mtxtures were phosphorylated in vitro with a specific PTK and unlabeled ATP. The phospho-peptldes were then isolated by a ferric chelation column. The eluted peptides were then sequenced concurrently (6; see also Chapter 11). Therefore, the resulting motif 1s a summation of the sequences of all the peptides recovered. We (7,8), on the other hand, used the “one-bead one-compound” library method by incubating a totally random peptide-bead library (e.g , XXXXXXX, where X = all 19 amino acids except Cys) with [T-~~P]ATP and a specific protein kmase. The From
Methods
m Molecular Bology, vol 87 Combmafonal PepMe Edited by S Cabilly 0 Humana Press Inc , Totowa,
83
Ltbraiy
NJ
Profocols
84
Lam
[32P]-labeled peptrde-beads were then localized by autoradrography, isolated, and mrcrosequenced individually. Peptide substrates with multiple motifs can be identified usmg this method. Although we bmlt the followmg discussion on methodologies for determining phosphorylatron motifs, the “one-bead onecompound” library approach, in principle, can also be apphed to the determrnation of substrate motrfs for other post-translational modifications, such as glycosylatlon, ribosylatron, and methylation.
2. Materials 2.1. Chemicals/Buffers 1 MES buffer 30 mI4 2-(N-morpholino) 2 3 4 5
ethanesulfonlc acid, 10 mM MgC12, 0 4
mg/mL bovme serum albumin (BSA), pH 6 8 [Y-~~P]ATP (25 Wmmol) IS available from many sources. Washing buffer. 0 68 M NaCl, 13 mM KCl, 40 mM Na,HPO,, 7 mM KH,PO,, pH 7.0,0.1% Tween-20 (v/v) OlMHCl 1 5% agarose (w/v) m Hz0 Melt the agarose, then keep at 70-75°C
2.2. Reagents,
Supplies,
and Equipment
1 Many protein kmases are commerctally available from many sources 2 Glogos II autoradrogram markers are obtained from Stratagene, La Jolla, CA. 3 Low gellmg temperature Sea Plaque agarose can be obtained from FMC BtoProducts, Rockland, ME 4. X-ray film (e g , Kodak X-OMAT LS) 5 Dissecting mtcroscope
3. Methods 1 Transfer l-5 mL of the bead hbrary (200,000-l,OOO,OOO beads) to a 20-mL polypropylene container Slowly dilute the drmethylformamtde (DMF) by addmg an incremental amount of double-distilled water Wash the bead hbrary thoroughly wtth double-distilled water followed by MES buffer m a dtsposable polypropylene column. 2 Transfer the bead library to a 5-10 mL polypropylene screw-cap veal To 1 mL of settled bead, add 1 mL of 2X MES buffer contammg 0 2 FM [y-s2P]ATP and protein kmase (see Note 1). Cap the reaction vial tightly and put on a rockmg platform for l-5 h at room temperature with gentle rockmg 3. Transfer the [32P]-labeled bead library to a disposable polypropylene column and wash the resins thoroughly with washing buffer, then double-dtstllled water 4 Transfer the bead library to a glass tube wrth 5 mL of 0 1 M HCl and heat to 100°C for 15 mm (see Notes 1 and 2). 5 Wash the acid-treated bead library thoroughly m a disposable column with washmg buffer
Peptide Substrate Motifs
Fig. 1. A typical autoradiogram
85
of a [“*PI-labeled
peptide-bead library.
6. Resuspend each of the 0.5mL bead library in 30 mL of hot 1.5% agarose solution (70-75”C), carefully pour the bead suspension onto a clean glass plate (16 x 18 cm), and air dry overnight at room temperature (see Note 3). Tape the Glogos II autoradiogram markers on each corner of the glass plates. 7. Expose the immobilized bead to X-ray film with an intensifying screen for 20-30 h at room temperature and develop the film. Figure 1 shows the result of a typical autoradiograph. 8. Align the autoradiograph with the Glogos II autoradiograph markers on the glass plate. Excise the area of the dried agar with beads corresponding to the dark spots on the film. 9. Transfer all the excised dried agar with beads to 30 mL of hot 1.5% agarose solution (70-75’C) for 15 min. Replate the beads, expose, and develop the autoradiogram as described above. 10. Under a dissecting microscope, localize an individual bead that is labeled with [32P]. Add a drop of water over the positive bead to swell the agarose. Dislodge the bead with a 27-gage needle and transfer the positive beads to a Petri dish of water (see Note 4). Il. Under a microscope, transfer individual beads onto a glass filter and insert into the protein sequencer cartridge for microsequencing.
4. Notes 1. Although purified protein kinase may not be necessary for the screening, it should be free of other protein kinases, phosphatase, or ATPases. If there are some con-
86
I.
‘.
Lam tammated serme/threonme kmases m the enzyme preparation, one may consider treating the [32P]-labeled bead library with 1 M NaOH at 58°C for 1 h, smce under this condition, all seryl and threonyl phosphate will be hydrolyzed and a considerable portion of tyrosyl phosphate ~111 remam intact Treatment of [32P]-labeled bead library with 0 1 M HCl at 100°C for 15 mm is extremely important to mnnmize background label. Under such conditions, all [Y-~*P] ATP and histidy phosphate, but not tyrosyl, seryl, or threonyl phosphate, ~111be hydrolyzed Avoid loading too many beads (<0.5 mL settled beads) onto one glass plate as the agar/bead layer tends to peel off when too many beads are tmmobtlized Try to filter all the buffers and rinse all the contamers before use as any contamtnated particulate matter may trap [32P] causing arttfacts on autoradtogram Often with the aid of the dtssectmg microscope, one can differentiate a labeled bead from a contaminated particle
Acknowledgments This work was partially supported by NIH grants CA23074 and a grant from the National Science Foundatron (MCB-95062 is a scholar of the Leukemia Society of America.
and CA17094, 17). Kit S . Lam
References 1 Yan, S C. B , Brmnell, B W., and Wold, F (1989) Post-translational modtfrcations of proteins. some problems left to solve Trends Biochem. Scz. 14,264-268 2. Han, K K. and Martmage, A. (1992) Post-translational chemical modification(s) of protems. Int. J. Biochem. 24, 19-28 3 Han, K. K and Martmage, A (1992) Posstble relatlonshtp between codmg recognmon ammo acid sequence motif or residue(s) and post-translational chemical modification of protems. Int. J. Blochem. 24, 1349-l 363. 4 Krichna, R. G and Wold, F (1993) Post-translational modrfication of proteins. Adv. Enzymol. 67,265-298 5 Pearson, R B and Kemp, B E (1991) Protem kmase phosphorylatton sate sequences and consensus specific motifs. tabulations Methods Enzymol 200, 62-8 1. 6 Songyang, Z , Carraway, K L , Eck, M J , et al (1995) Catalytic specificity of protein-tyrosme kmases is critical for selective signalling Nature 373,536-539 7 Wu, J , Ma, Q N , and Lam, K S (1994) Identifymg substrate motifs of protem kinases by a random library approach Bzochemrstry 33, 14,825-14,833. 8. Lam, K S., Wu, J S , and Lou, Q (1995) Identification and charactertzation of a novel peptide substrate specific for src-family tyrosme kmase. Zntl J. Protezn Pept Res 45,587-592
11 The Use of Peptide Library for the Determination of Kinase Peptide Substrates Zhou Songyang
and Lewis C. Cantley
1. Introduction Protein phosphorylation plays a crucial role in regulating a plethora of intracellular biologrcal activities. Because protein phosphorylation is a reversible reaction, it allows living cells to reset to the basal state rapidly after stimulation. There are hundreds of protein kinases involved in this general signaling machinery. These kinases are classified into three drfferent categories based on then abihtles to phosphorylate serine/threonine, or tyrosme, or both residues A comparison of primary sequences of protein kinases has indicated that the catalytic site (the kmase domain) is highly conserved, suggesting a common ancestor for these kinases (I) However, different kmases have evolved to function distinctly in response to diverse cellular stirnub. The specificities of protein kinases has thus become a critrcal issue m understanding signal transduction. The specificity of a protein kinase IS governed by a number of factors, mcluding the intracellular locahzation of the kmase and its substrates. The most important factor IS the specificity of the kinase domain. Studies of protein Serl Thr kinases, including CAMP-dependent protein kinase (PKA) , indicate that the kinase domain recognizes specific primary sequences around the phopshorylatton site (2,3) The specificities of a few protein Ser/Thr kmases have been verified by ammo acid substitutions on the basis of known in vrvo substrates. However, this conventional approach has several drawbacks. First, it is extremely expensive and time-consummg to synthesize and assay all the possible substitutions Since 9-12 amino acids of the substrate peptide are likely to contact the active site cleft of a kinase (3), there are approx 2O’O or 1Or3 distinct peptrdes to From
Methods
m Molecular Biology, vol 87 Comb/natona/ PepWe Edlted by S CablIly 0 Humana Press Inc , Totowa,
87
Library NJ
Protocols
88
Songyang and Cantley
consider. Second, this method is less applicable to cases in which the in vivo targets of protein kinases have not yet been identified To overcome these problems, several new strategies based on combinatorial chemistry have been used. One approach takes advantage of a technique that simultaneously synthesizes large numbers of degenerate peptides on a solid matrix (4,5, and Chapters 10 and 12). The specificity of the assayed kinase can be deduced by decoding (e.g., sequencing) immobilized peptides However, this approach may be problematic because substrate phosphorylation on solid matrices may be different from that in solution. Therefore, peptide substrates identified from these methods may not be physiologically relevant. We have developed an oriented peptide library technique to rapidly determme optimal sequences for protein kmases based on a strategy similar to that used for Src-homology 2 (SH2) domains (6,7). The kmase of interest 1s added to a soluble mixture of billions of distinct peptrdes, each of identical length and orientation, with only a single ammo acid capable of being phosphorylated located in the middle. The small fraction of phosphorylated peptides IS quantitatively separated from the bulk of nonphosphorylated peptides and the mixture is sequenced. A comparison of the abundance of amino acids at each degenerate position surrounding the phosphorylation site to the abundance at the same position m the starting mixture indicates preferred amino acids at each position. This technique not only predicts an optimal sequence from a single experiment without prior knowledge of in vivo phosphorylation sites, but also provides information about the relative importance of each position for selectivity and which amino acids are tolerated. In this chapter, we will focus on this oriented peptide library technique.
2. Materials 2.1. Chemicals 2.1 1. Standard Reagents for Peptlcie Synthesis and Sequencing See Chapters 1,3,4,8
and 13 for details
2 1.2. Protein Kmase Assay 1. Kmase buffer for SerlThr kmases 50 mM Tris-HCl, 10 mM MgC12, 1 mM dithiothreuol (DTT) 2 Kmase buffer for Tyr kmases 50 mM Tns-HCl, IO mMMnC&, 1 mM DTT 3. ATP and [Y-~*P]-ATP.
2.1.3. DEAE Column 1 DEAE sephacel (Sigma, St Louis, MO) 30% Acetrc acid
2
89
Determlna t/on of Kmase Substrate 2.1.4. Ferric Column I 2 3. 4 5 6.
Immodlacetlc acid (IDA)-coupled agarose beads (Pierce, Rockford, 20 m&Z Femc chlorfde. Buffer A: 50 mMMES, 1 MNaCl, pH 5.5. Buffer B 2 mM MES, pH 6.0, or dlstllled HZ0 Buffer C. 500 mM NH4HC0,, pH 8.0 100 mMEDTA, pH 8 0
2.2. Equipment 1. 2. 3. 4
IL)
and Supplies
Peptide synthesizer (ABI 43 IA) and sequencer (ABI 477A) Peristaltic pumps Polypropylene columns or syringes Speed-Vat.
3. Methods The method specificities of mining motifs the degenerate peptides.
shown here has been used successfully m determining substrate many protein kmases Similar to our earlier approach m deterfor SH2 domains (6), this procedure quantitatively separates phosphopeptide products from the bulk of nonphosphorylated
3.1. Design of Degenerate
Peptide Libraries
Peptide libraries for protein kinases could be classified by the number of fixed residues. For instance, primary libraries are those that only use amino acids capable of being phosphorylated (Tyr, Ser, or Thr) to fix and orient the libraries. Secondary libraries fix additional residues that are preferred by some kinases (e.g., Ser-Pro for cyclin-dependent kinases). The most important criteria in designing the peptide libraries for protem kinases are the following: 1. Proper orientation of the peptlde library for protein kmases, this 1s easily achieved because the ammo acids capable of being phosphorylated (Tyr, Ser, and Thr) can be used to orient the library For example, the followmg peptlde hbrary (primary library, Ser Degenerate Library) was constructed for serme/threonme kinases. Met-Ala-Xxx-Xxx-Xxx-Xxx-Ser-Xxx-Xxx-Xxx-Xxx-Ala-Lys-LysLys, where Xxx indicates all ammo acids except Trp, Cys, Tyr, Ser, or Thr (7) Ammo acids capable of being phosphorylated were omitted at all degenerate posltlons to ensure that the only potential site of phosphorylatlon was the Ser at residue 7 Each degenerate position was thus fixed relative to the Ser and the phosphorylated peptldes were m phase when sequenced To design a secondary
library, a second residue m addltlon to the amino acid capable of being phosphorylated IS fixed For example, this secondary library (Ser-Pro library) constructed for cyclin-dependent kmases: Met-Ala-Xaa-Xaa-Xaa-Xaa-Ser-Pro-
was
90
Songyang and Cantley
Xaa-Xaa-Xaa-Ala-Lys-Lys-Lys, where Xaa indicates all ammo acids except Trp and Cys (7) 2 Selection of ammo acids at the degenerate positions. As discussed above, ammo acids capable of being phosphorylated (Tyr, Ser, and Thr) are usually avoided m the degenerate positions for primary libraries However, for secondary libraries, Tyr, Ser, and Thr can be included m the degenerate positions because phosphorylation of these residues at the degenerate position is negligible In the case of Ser-Pro library, the chance of having Ser and Pro adJacent to each other at the degenerate positions is quite small (~5 x 18-*, -1 5%) Thus, peptides phosphorylated at positions other than the fixed one would not interfere with the sequencing of oriented peptides For all peptide libraries, Trp and Cys have been omitted to avoid problems with sequencing and oxidation These two residuescould be substituted mto specific locations once the optimal peptides have been determined. If 15 different ammo acids are present m any one of the eight degenerate positions (for primary libraries), the total theoretical degeneracy of the library is 158= 2,562,890,625 A primary peptide library for tyrosme kmases(Tyr-Kmase Substrate Library) was constructed m this fashron by except that residue 7 was Qr (8) 3 Other general considerations The length of the pepttde libraries can vary, but the number of degeneratepositions should not exceed 15 A library of 15 degenerate positions already has2015different molecules We start with a library contammg eight degeneratepositions becausefour residuesN-terminal and four C-terminal to the phosphorylation site This is the region most likely to be involved m catalytic recognition basedon the motifs that had beendetermined for protem kmases Placmg a short leading sequencebefore the degenerateposmonsis generally benefmtal. Taking the Ser Degenerate Library (Met-Ala-Xxx-Xxx-Xxx-Xxx-SerXxx-Xxx-Xxx-Xxx-Ala-Lys-Lys-Lys), for example, the Met-Ala sequenceat the N-terminus of the peptide libraries provides two ammo actds to verify that peptides from this mixture are being sequenced Sequencing of these two residues also allows quantification Slmrlarly, the Ala at residue 12 makes It possible to quantify and estimate how much peptide has been lost during sequencing The poly-Lys tail prevents wash-out durmg sequencing and improves the solubility of the mixture (no solubility problems occurred at neutral pH and 5 mg/mL concentration)
3.2. Peptide
Library
Synthesis
Synthesis of the degenerate peptide lrbrartes IS accomplished according to the standard BOP/HOBt coupling protocols using a Pepttde BtoSyntheslzer (ABI 43 1A). 1 At the degenerateposmons,add equal moles of 15 different Fmoc-blocked ammo acids simultaneously at a IO-fold excessto the couplmg resm. The ratio of input Fmoc-blocked ammo acrds sometimesneedsto be adjusted on different synthesizers to achieve an even distribution of degenerate amino acids.
91
De termlna tion of Klnase Substrate
2. Deprotect and cleave the resms by trtfluroacettc acid (TFA) 3 Sequence the pepttde libraries to confirm that all ammo acids are present at stmtlar amounts (within a factor of 3) at all degenerate posmons.
3.3. Protein Khases:
Preparation
and Kinase Assays
Protein kinases used m this study can be obtained through different sources (see Note 1). Kmase reactions can be performed with soluble or immobilized kinases 1 Add the protein kmase to 300 pL of solutton containmg 1 mg of degenerate pepttde mtxture, 100 pMATP with a trace of [Y-~*P]-ATP (roughly 6 x lo5 cpm) m kmase buffer 2 Incubate at 2530°C for 2 h to phosphorylate roughly 1% of the pepttde mixture 3 Terminate the reaction with the addition of acetic acid to a final concentratton of 15%.
3.4. Phosphopeptide Separation 3.4.1. Purification of Peptde L/brat-/es on DEAE Column After an mcubation period at 25”C, the peptide supernatant diluted with 300 PL of 30% acetic acid.
is removed
and
1 Add the mixture to a I -mL DEAE-sephacel column prevtously equthbrated with 30% acetic acid. 2. Elute the column with 30% acetic acid (9) Drscard the first 600 uL flow through and collect the next 1 mL (see Note 2) 3 Lyophihze the collected fractton on a Speed-Vat
3.4.2. Ferric Chela t/on Column A ferric chelation column (IDA beads) IS used for separation of phosphopeptides (see Note 3). This column has been used m the past to separate tryptic phosphopeptides of phosphorylated proteins from the bulk of nonphosphorylated tryptic peptides (10,11) However, we discovered that in order to accomplish a quantitative removal of the nonphosphorylated peptides from the phosphopeptides without loss of a subfraction of phosphopeptrdes, it is necessary to change the loading and elution conditions from published procedures. A typical running profile is shown m Fig. 1. 1 Charge a mI -mL mL/mm 2 Wash with 8 mL 3 Wash with 6 mL 4 Wash agam with
column of IDA beads with 5 mL of 20 mM ferric chloride at 0 5 of water at 1 mL/min of buffer C at 1 mL/mm. 6 mL of water
92
Songyang and Cantley 50000
40000
30000
20000
10000
0
0
4
8 Fraction
12 (mL)
1 6
2 0
Ftg 1 Quantrtatrve separatron of nonphosphorylated and phosphopeptrdes on a ferric-chelatmg column Approximately 1% of the peptldes m the Tyr-Kmase Substrate Ltbrary were phosphorylated by polyoma mrddle T/pp60c-src. After separatmg the [y-3ZP]-ATP from the peptides on a DEAE-Sephacel column the peptrde mixture was loaded on a column of ferrtc-IDA beads (see Methods) The column was eluted with 5 mL of buffer A, 5 mL of buffer B, 4 mL of buffer C, and 2 mL of 100 n&I EDTA (pH 8 0) All elutrons were at 0.5 mL/mm and 0 5-mL fractions were collected The amount of peptrde at each fraction was estimated by absorbency at UV 280 nm (fractions l-10) and phosphopeptrde was estimated by radroactrvrty Less than 0 1% of the total nonphosphorylated peptldes eluted at fractions 11-14 as Judged by Tyr at cycle 7 m the sequence of thts mixture Greater than 90% of the radroactivtty applied eluted m fractions 11-14 5. Equrhbrate with 6 mL of buffer A 6 Dissolve the dried sample of peptrdelphosphopeptrde mixture m 200 /.tL of buffer A and load onto the ferrrc column 7 Wash the column with 5 mL of buffer A followed by 5 mL of buffer B or H,O at 0 5 mL/mm 8. Elute the phosphopeptrdes with 4 mL of buffer C 9 Elute Fe+s with 100 mM EDTA, pH 8.0 10 Collect the buffer C eluate, which contains phosphopeptrde, and lyophrlrze several times to get rid of most of the ammonmm bicarbonate salt. Resuspend the phosphopeptide mixture m water, adJust to neutral pH, and sequence
Determinatjon
of Kinase
3.5. Sequencing
Substrate
93
and Data Analysis
Sequencmg of the phosphopeptlde mixture reveals the abundance of ammo acids at each degenerate posltlon. It is also necessary to sequence the original peptide library mixture. To determme the optimal peptide motif for a protein kinase, m theory, the abundance of each ammo acid at a given cycle in the sequence of the phosphopeptlde mixture could be divided by the abundance of the same amino acid at the same cycle of the starting mixture. In this way, varlatlons m the abundance of ammo acids at a particular residue (i e., residue 3, the first degenerate residue) in the startmg mixture or variations m yield of ammo acids in the sequencer are divided out. If the kmase 1s msensltlve to the ammo acid at residue 3 (i.e., four residues N-terminal of the phosphoserine), then the relative abundance of all ammo acids at this cycle in the phosphopeptlde mixture will be the same as m the starting mixture, and all bars in the graph will have equal height. In some experiments in which only approximately 0.5% of the total mixture is phosphorylated, a correction should be made for the -0.1% of the nonphosphorylated peptldes that are eluted with buffer C. The contamination with nonphosphorylated peptldes can be estimated from the quantity of Ser (or Tyr) at cycle 7 since residues do not show up if phosphorylated. Control experiments are conducted m which the peptldes are subjected to a mock phosphorylatlon. The same column protocol is used and the fractions in which phosphopeptldes usually elute are collected and sequenced These fractions are usually rich m Asp and Glu at every degenerate cycle, presumably owing to interaction of these residues with the Fe 3+, The ammo acid abundance at each cycle from this control 1s subtracted from the kinase experiment to correct for the background. To calculate the relative preference of amino acids at each degenerate position, the corrected data are then compared to the starting mixture to create the ratios of abundance of ammo acids. The sum of the abundance of each amino acid at a given cycle 1s normalized to 15 or 18 (the number of ammo acids present) so that each amino acid would have a value of 1 in the absence of selectivity at a particular position. In theory, any value greater than 1 should indicate preference for the correspondmg ammo acid However, because of the complexity of the data and calculation, we found that values higher than 1 5 are generally reliable. The whole process 1s summarized as following: 1 Normalize the amount of each amino acid at the degenerate positIons. we routinely normalize the total amount of ammo acids (m plcomoles) of a degenerate position to that of the first degenerate position a. P(IJ) indicates amount for ammo acid j at position I for the kmase experiment.
94
Songyang and Cantley
b Pi indicated normalized P(IJ) c hZ(lJ) = P(lJ) x Sum(Pl)lSum(Pi), 2. Normalize sequences of the control experiment and orlgmal peptide library as m
step 1 a.
mdlcates the normahzed amount for ammo acid J at posltlon I m the control experiment b Rn(iJ) indicates the normalized amount for ammo actd J at position 1 in the orlgmal peptide library 3 Subtract the control experiment values from the kmase experiment Pn(i~) - K x Cn(lj), K can be calculated by the relative amount of fixed Ser or Tyr, K = P(ser)lC(ser) 4 Calculate the relative abundance A(IJ) = [I - K x Cn(l~)]lRti(~~) 5. Normahze to the total number of amino acids mcluded at the degeneratepositlon. AIZ(IJ) = A(IJ) x lS/Sum[AlJ] A~(I,J) representsthe enrichment value for ammo acid J at position 1 CIZ(IJ)
After the calculation, graphic plots showmg enrichment values of amino acids at all degenerate positlons can be generated to reveal the substrate preference for mdivldual protein kmases. In Fig. 2, the speclflclty of PKA determined with the primary Ser degenerate peptlde library (MAXXXXSXXXXAKKK) was plotted usmg the Kaleidagraph program Ultimately, confidence m this procedure 1sprovided by the reproduclbihty of the results obtained with a given kinase and by consistency of predlcted optimal substrates with known substrates of the same protein kinases.
3.6. Using the Predicted Optimal Peptide Substrates Signal Transduction by Protein Kinases 3.6.1. Predictmg Kmase Substrates
to Study
The optimal substrates deduced from this method are extremely useful in predicting the in VIVO targets of various protem kmases. In particular, this Fig 2. (seeoppoJltepage) Substrate specificity of CAMP-dependent protem kmase detected by the degeneratepeptlde library The phosphopeptideproduced by phosphorylatmg the Ser-Kmase Substrate Library with PKA were sequenced Each box mdlcates the relative abundanceof the 15 amino acids at a given cycle of sequencing For example, box A IScycle 3, the first degenerateposItIon m the hbrary mixture. Cycle 7 (not shown) ISthe site of phosphorylatlon (phosphoserme) Therefore, boxes A, B, C, and D mdlcate ammo acid preferences at -4, -3, -2, and -1 N-termmal of the phosphorylatlon site and boxes E, F, G, and H mchcatepreferences at +l , +2, +3, and +4 C-termlnal of the phosphorylatlon site The columns represent average values from two Independent experiments The bars mdlcate the differences between the two experiments. Abbreviations for ammo acid residues are A, Ala, D, Asp; E, Glu, F, Phe, G, Gly, H, His, I, Ile, K, Lys, L, Leu, M, Met, N, Asn, P, Pro; Q, Gln, R, Arg, S, Ser, T, Thr, V, Val, Y, Tyr
Determlna t/on of Kmase Substrate
A I 0
ARNDEQGHILKMFPV c!;c,c
ARNDEQGHILKMFPV
Ill 9 8 7
2
6
; 1 P
5 4
1
3 2 1 0
Cl
ARNDEQGHILKMFPV
ARNDEQGHILKMFPV
3
10 9 8 1 6 5 4 3 2 1 0
ARNDEQGHILKMFPV
II
ARNDEQGHILKMFPV
c&L 3 H
ARNDEQGHILKMFPV C&k
0
96
Songyang and Cantley
method can rapidly identify previous
knowledge
the optimal
of the kinase.
peptide substrates of a kinase without One can take these
optJma1
peptJde
sequences to search protein databases using Blast, Fasta, or Findpatterns in the Genbank GCG program (GCG). Matched proteins are likely in vivo substrates of the kmase studred Meanwhrle, one can also scan the sequence of a protein to see whether rt contains any potential phosphorylatlon sites for a given protein kmase Both approaches provide a shortcut in understanding signaling pathways regulated by the protein kmases.
3.6.2. Developing
Inhibitors of Protein Kinases
The predicted optimal peptrde substrates can facilitate the design of mhibrtors of protein kinases. First, peptide or peptlde mrmetrc inhibitors can be made based on the optJma1 peptrdes.
Second, the optJma1 peptides
specific probes to screen chemical structural
analysis
of kmases
assure a basis for modeling protein kinase-mediated
llbrartes for potential
complexed
with their optimal
and designing
can be used as
inhibitors.
Moreover,
peptides would
drugs that specifically
intervene
also
m
signaling.
4. Notes 1 Most commonly, the klnases of mterest are overexpressed as recombinant proteins Jn bacteria and eukaryotm cells For most kmases, expression Jn insect cells (sf9 cells) usmg baculovlruses Js desirable and often yields active enzymes Expressed protein kmases can be purified by conventJona1 IJquJd chromatography (e.g., FPLC), affinity chromatography, or simple JmmunoprecJpJtatJon. The amount of enzyme required to phosphorylate enough peptJdes for sequencing varJes and depends on the specJfJc actJvJty of JndJvJdual kinases In general, we use microgram quantities of kinases Jn our experiments. 2 Under these condJtJons, peptide mixtures are in the void volume because of then poly-Lys tall, whJle ATP and denatured proteJn kJnases are retaJned on the column. In inJtJa1 experiments the fractions from the column were analyzed for peptide, phosphopeptlde, [Y-~~P]-ATP, and 32P04 by phosphocellulose (P81) paper, TLC, or SDS PAGE It was determJned that after the first 600 PL void volume, the next 1 mL contamed both phosphorylated and nonphosphorylated peptJdes but was free of [Y-~~P]-ATP SJncethe peptide fraction ISfree of [Y-~~P]-ATP, the radJoactJvJty Jn this fractron provJdes an inJtJa1estimate of the fraction of the total peptlde mixture that was phosphorylated 3 Although the ferrm chelation column efficiently separatesphosphorylated peptJdesfrom the unphosphorylated species,a small percentage(-0 1%) of degenerate unphosphorylated peptides rJch Jn acJdJc amJno acJds are also copurJfJed becausethese peptides can bind weakly to the ferrJc column ThJs could be a problem for peptide 1JbrarJesfor whJch acJdJcresJdues(Asp and Glu) are fixed. In order to lower the background, acidic resJduesshould be avoJded at the fixed posJtJonsof peptJde 1JbrarJesIf acJdJc amJno acJds must be Included at the
Determma t/on of Kmase Substrate
97
fixed posmons, one could increase the pH of buffer A to 6 5 and reduce the volume of IDA beads It IS important to purify enough phosphopeptides (e g , up to 1% input peptide ltbrary) for sequencing such that phosphorylated peptides are m great excess of the contaminating unphosphorylated pepttdes In a reaction m which 1% of the pepttde mrxture IS phosphorylated, the total quantity of phosphopepttdes IS (1 8 mA4) x (0 3 mL) x (0.01) = 5 4 nmol. Typically, about l-2 nmol of phosphopeptide mixture 1s added to the sequencer. This means that m a cycle m which all 15 residues are equally abundant, the yield of each ammo acid 1s (1 nmol) x (l/15) = 60 pmol
Acknowledgment We thank Dan LIU, Kermit reading of this manuscript.
L. Carraway,
and Anhco Nguyen
for critical
References 1. Hanks, S K , Qumn, A. M., and Hunter, T. (1988) The protein kmase family. conserved features and deduced phylogeny of the catalytic domains Sczence241, 42-52. 2 Glass, D B., Cheng, H. C , Mueller, L M., Reed, J., and Walsh, D A (1989) Primary structural determmantsessentialfor potent mhibmon of CAMP-dependent protein kmase by mhtbitory peptides correspondmg to the active portion of the heat stable inhibitor protem J. Bzol Chem 264,8802-88 10 3. Kmghton, D R., Zheng, J H , Ten Eyck, L F , Xuong, N H , Taylor, S S , and Sowadski, J. M (1991) Structure of a pepttde mhtbitor bound to the catalytic subunit of cychc adenosmemonophosphate-dependentprotein kinase. Sczence 253,414-420. 4 Geysen, H M., Meloen, R H , and Barteling, S J (1984) Use of peptide syntheSISto probe viral antigens for epitopesto a resolutton of a single ammo acid Proc. Natl. Acad. Scl USA 81,3998-4002 5 Wu, J., Ma, Q , N , and Lam, K S (1994) Identifying substratemotifs of protein kinasesby a random library approach Biochemistry 33, 14,825-14,833 6. Songyang, Z., Shoelson,S E , Chaudhurt, M , Gtsh, G , Pawson,T , Haser,W G., King, F , Roberts, T , Ratnofsky, S , Lechletder, R J , Neel, B. G , Barge, R B., FaJardo,J E , Chou, M M ,Hanafusa,H., Schaffhausen,B., and Cantley, L. C. (1993) SH2 domains recognize specific phosphopeptidesequences Cell 72,767-778 7 Songyang, Z , Blechner, S , Hoagland, N., Hoekstra, M F , Ptwmca, W H , and Cantley, L. C (1994) Use of an oriented pepttde library to determine the optimal substratesof protem kmases.Curr Blol. 4,973-982 8 Songyang, Z , Carraway III, K L , Eck, M J , Harrison, S C , Feldman, R A , Mohammadi, M , Schlessmger,J , Hubbard, S R , Smith, D P , Eng, E , Lorenzo, M J , Ponder, B A. J , Mayer, B J , and Cantley, L C. (1995) Catalytic spectficity of protem-tyrosme kmases IS crtttcal for selective stgnalmg Nature 373, 536-539
98
Songyang and Cantley
9. Kemp, B E , BenJammi, E , and Krebs, E G (1976) Synthetic hexapeptide substrates and inhibitors of 3’.5’-cycltc AMP-dependent protein kmase Proc. Nat1 Acad. Scl. USA 73,1038-1042 10 Muszynska, G , Andersson, L , and Porath, J. (1986) Selective adsorption of phosphoprotems on gel-tmmobilized ferric chelate. Bzochemzstry 25,6850-6853 11 Muszynska, G , Dobrowolska, G , Medm, A , Ekman, P , and Porath, J 0 (1992) Model studies on rron(III) ion affinity chromatography II Interaction of tmmobtlized u-on(N) tons wtth phosphorylated ammo acids, pepttdes and proteins. J Chromatogr. 604,19-28,
12 Analysis of Protein Kinase Substrate Specificity by the Use of Peptide Libraries on Cellulose Paper (SPOT-Method) Werner J. Tegge and Ronald Frank 1. Introduction Protein phosphorylation by protein kinases is the most important regulatory mechanism of cell function and signal transduction. In general, protein kinases exhibit specificities that are often primarily determined by the ammo acrds around the phosphorylation sites (I). Identification of amino acids that contribute to substrate motifs are essential for the understanding of signal transduction pathways and for the development of specific peptide substrates and inhibitors. Many investigations with large numbers of individual peptides have been conducted m order to find high-affinity substrates as well as mhrbrtors (2). Peptide libraries offer the possibility to investigate the sequence dependence of the phosphorylation more thoroughly and systematically and may even allow the a priori delineation of peptide substrates of uncharacterized protein kinases. Recently, two new approaches have been described in this respect. Lam and coworkers have used one-bead one-peptide libraries of rmmobilized pentapeptides and heptapeptides comprismg millions of individual sequences (3) generated by the method of “spht synthesis” (4) (for a detailed description of the method see Chapter 10 m this volume). Songyang, Cantley, and coworkers have described an approach that uses a soluble library of 15mer peptides containing 8 degenerate positions adjacent to serine or tyrosine to evaluate substrate motifs of several serine/threomne and tyrosme kinases (5,6) [Chapter 11 m this volume). We have developed a new method for the systematm mvestigation of the sequence-dependent specificity of protein kinases with peptide librarres on celFrom
Methods
in Molecular Edlted
by
B/ology, S CablIly
vol 87 Combrnatoual 0 Humana
99
Press
Pephde Library
Inc , Totowa,
NJ
Protocols
100
Tegge
and frank
lulose paper, which is based on the SPOT-method (7) described in detail in a previous volume of this series (8) (see also Chapter 4). The method allows the identification of the major determining amino acids of substrate motifs and the systematic evaluation of every position. CAMP- and cGMP-dependent protein kmases (hereafter termed PKA and PKG, respectively) have been used as model enzymes for an evaluation of our method (9). PKA has a well-defined substrate recogmtion motif. Thus, the literature data could serve as a measure of the performance of our approach and as a valuable guide during the development of the assay conditions. Both kmases are closely related to each other and share many similar features. While PKA displays a well-defined specificity with the general motif RRXS(A)X for substrate or inhibitory peptides (IO), PKG seems to have a less well-defined recogmtion sequence (11,12) In our mvestigations we used an iterative approach of constructing peptide libraries arranged m arrays of subhbrarres that contam two defined amino acids each, similar to the mimotope strategy by Geysen et al. (13). The best amino acrd combination from a particular array was used throughout m the next one The first generation had the general structure AC-XxX12XxX, where X represents positions with equal distributions of all 20 natural ammo acids (cysteine was used in its acetamidomethyl-protected form). The whole array represents a library of all 2.56 x 1O’O possible octamers and each sublibrary with defined amino acids at positions 1 and 2 consists of 6.4 x lo7 sequences. Incubation with PKA gave a phosphorylation pattern with basic amino acids at positions 1 and 2 (Fig. 1). The sublibrary containing arginine at both positions shows particularly high activity. This is m agreement with results from soluble peptides, in which the general motif RXXRR/KXSX has been identified for this kinase. The two adjacent amino acids argmine-arginme m the middle seems to be the most strongly determining part of the whole motif. The second array had the general structure AC-XXXRR12X In this case the sequences with serme or threonine at position 2 gave the highest signals (Fig. 2). The discrimination of the enzyme at position 1 is much weaker. By applying this strategy, we have evaluated every position of the octamertc sequence with both kinases and extended the sequences to decameric peptides. Promising peptides have been resynthesized in larger amounts by standard solid-phase peptide synthesis and enzyme kinetics have been determmed. The decameric sequences that we obtained for PKG showed substrate specificites that were better than the ones known at that time Exchange of serine for alanine resulted in a PKG-inhrbitor wtth htgh affinity and specificity (W. Tegge and W. R. G. Dostmann, unpublished results). It should be kept in mind, though, that the approach presented here selects for substrates with a high V,,,,, rather than for a low K,,, which IS desired for good inhibitors. Further N- and C-terminal extensions of the length of the peptides to 14mers did not improve the substrates over decamers.
AC*D
E
F
GHIKLMNPQRSTVWY
Y W V T s R
Y W V T S R
Q
Q
P N M L K I Ii
P N
M L K I I-I G F E D c* A
G P I3 D c* A AC*DEPGHIKLMNPQRSTVWY
Position1 Fig. 1. Upper: PhosphorImager scan of the paper with the array AC-XXXl2XXX after phosphorylation by PKA. Four hundred sublibraries are arranged in a format of 16 x 25. The rows are arranged in an order so that 20 consecutive spots have a particular amino acid at position 1, and position 2 is one of the 20 amino acids, both positions being varied in alphabetical order (according to the single letter code). Lower: Quantified pattern of the 400 spots from the upper array, generated with the “Spectral” option of the program Core1 Chart. The shading of each square corresponds with a linear dependence to the amount of phosphorylation of the corresponding spot on the paper. C* = Cys(Acm).
101
102
Tegge and Frank AC*DEFGHIKLMNPQRSTVWY Y
Y
W V
W
T s R
Q P N M L K I
H G F E D C* A
/,
,
,
,
/,
AC*DEFGHIKLMNPQRSTVWY
Position 1 Fig. 2. Quantified by PKA.
pattern of the phosphorylation
of the array AC-XXXRR12X
The iterative strategy described above is only an example. Of course, other procedures can be used for the delineation of the peptide motif. For example, it may be advantageous to predefine the position and the identity (e.g., serine or tyrosine) of the amino acid to be phosphorylated. With libraries of the structure XnS and SXn and/or XnY and YXn, the relative importance of N- and C-terminal positions to the substrate recognition and the question of whether a yet uncharacterized protein kinase belongs to a family of serine/threonine or tyrosine kinases may be evaluated. For a detailed discussion of such strategies see the chapter by Frank in this series (8) and references cited therein. It should be considered that the SPOT procedure has a certain amount of scattering (up to 30%). In cases in which small differences between sublibraries of interest have been found, a reevaluation with an array presenting these sequences severalfold seems advisable before descisions about the structure of the next sublibrary array are being made. It should also be kept in mind that the amount of radioactivity incorporated into a particular sublibrary may be the result of the summation of a high number of sequences with rather low specificities rather than of a few sequences with very high activity, which is nor-
Peptide L/brat-/es on Cellulose Paper
103
mally assumed for the plannmg of the next array. Furthermore, the slgnificance of a residue at a certain position is influenced by the amino acids around it. These aspects imply that the final “optimal sequence” that has been found by such an interative approach may depend on the search strategy employed and may not necessarily be the best possible one. It can be expected, though, that it contains at least the major contributors to a motif. Our SPOT approach has the advantage that every amino acid at every posltion of the sequence can easily be evaluated and compared without special technical considerations. This is important d, for example, not the identlfication of the best substrate motif but rather the largest differences between substrate properties for related enzymes is the major goal. Also, If more than one phosphorylation site IS present m a sequence, their mdlvldual function as a phosphate acceptor needs to be evaluated. For this purpose individual spots can easily be punched or cut out of the array and analyzed. Peptide quantities per spot are in the range of 4-5 nmol, which is sufficient for microsequencing and/or amino acid analysis. In general, for a successful application of methods based on short linear peptides, the site of phosphorylatlon (or generally the chemical modlflcation) and at least some of the major contributors for the recognition motif must be accommodated mto the length of the peptide that 1s evaluated. It should also be kept in mind, that only linear determinants are being identified. Interactions through secondary and/or tertiary structures that seem to be important for some classes of enzymes cannot be investigated with short peptides. In conclusion, the SPOT approach can be expected to be generally applicable to the elucidation of protein kinase specificity and to the investigation of other enzymatic transformations.
2. Materials The followmg materials and procedures work very well with PKA and PKG. For other kinases certain modifications may be necessary. The quantities are given for an assay involving one SPOT paper of standard size (8 x 12 cm). With an array of 425 spots the paper contains approx 2 pmol of peptide. 1 SPOT papers with hbranes or peptlde arrays according to the desired strategy (for the generatlon of these papers see ref. 8 and Chapter 4). 2. Reactlon troughs with a hd, maybe of plexiglass of adequate thickness for shlelding against the P-radiation of 32P The Inner dlmenslons should be slightly larger than the paper A very useful device 1s the Beta Work Box from Amersham (Amersham Buchler, Braunschwelg, Germany), outer dimensions 18.5 x 115 x 80 mm, Code RPN 1539 The box can be used during the incubation and washing procedures of the SPOT papers and for storing the radloactlve sheets
104 3 4
5
6
7 8. 9
10 11.
12
Tegge and Frank An mcubatton chamber adjusted to 30°C contammg a rocker for agitating the paper in the reactton trough durmg the incubation wtth the kinase. A solutton of 10 rnM ATP, 100 pL per assayare required Dissolve ATP disodrum salt hydrate at 5 7 mg/mL m HZ0 Freeze stock solutions at -20°C. The stock should not be used for more than about 4 wk A solutton of activator of surtable concentration, d required (e g , 10 mM CAMP or cGMP in H,O, always prepare fresh, because CAMP and cGMP hydrolyze rapidly). 250 mL Incubation buffer 50 mM MOPS, 200 mM NaCl, 1 mM MgAcetate, 0 4 mM EGTA, 1 mg/mL bovine serum albumin (BSA), pH 6 9 (adjusted with IN NaOH) Prepare fresh Set 8 mL of the buffer aside [Y-~~P]ATP (6,000 CYmmol, Amersham) 1 L of a 1M solutton of NaCl. 100 mL of a stripping solutton 4 M guamdme hydrochlortde, 1% SDS, 0 5% P-mercaptoethanol, for the removal of background, d desired Preparefresh, dissolve with warmmg. A somcation bath with adjustable temperature Access to a PhosphorImager or StormSystem (Molecular Dynamics, Krefeld, Germany), or an X-ray film of sufficient size in combmatton with a flatbed scanner for the generation of a radtoactivrty image The program ImageQuant (Molecular Dynamics) can be usedfor the quanttfication of radioactivity The option “Spectral” of the program Core1 Chart (part of the Core1 Draw program package) can be used for a convenient graphical presentation of the data (seeFig. 1 and 2).
3. Methods 1, Place the dry paper with the pepttde array to be investigated into the mcubation trough, moisten the paper with a few mL of ethanol, washtwice each with 50 mL mcubation buffer and keep overmght m 100 mL of this buffer at room temperature (see Note 1). 2 Decant the buffer, add the 8 mL buffer that were set aside (see Subheading 2., step 6) and premcubate the paper at 30°C for a sufficient time (seeNote 2) 3. Add 100 pL of 10 mM ATP and 100 FL eachof the appropriate stock solutronsof addittonal activators, if required (e.g , CAMP or cGMP) (seeNote 3) 4. Add lo-100 @I [Y-~~P]-ATP with the appropriate safety precautions for workmg with strong P-radiation 5 Start the reaction by adding the kmase Drstrtbute the enzyme m the mcubatton buffer quickly and thoroughly Final enzyme concentrations in our assayswere 12 5 nM and 4 nM for PKA and PKG, respectively 6 Incubate the mixture for 10 mm at 3O’C wtth slight agttation 7 Decant the buffer solutton and wash the paper 10 times with 100 mL each of 1M NaCl 8. Wash several times with H20, add 100 mL of the stripping solution, and somcate the paper for 1 h at 40°C to decreasethe background level (seeNote 4).
PeptIde
Libraries
on Cellulose
Paper
105
9 Wash the paper several times with water and ethanol, and then dry it (see Note 5) 10 Determine the radioactivity with the PhosphorImager or Storm system. Exposure times of the screen depend on the amount of radtoacttvity used and mcorporated Several h to 1 d was usually sufficient m our mvestlgations If no such system is avatlable, use an X-ray film and scan the film after development 11 Quantify the spots with the program ImageQuant by integrating uniformly sized circular areas that are positioned m the centers of the spots Transfer the data (“sum above background,” with background set to “0“) to the program Core1 Chart for a graphical presentation
4. Notes 1 The ethanol treatment assures a good solubihzation of the peptides m the aqueous buffer If this step IS not carried out and the buffer is added to the dry paper, the pepttde spots appear as white areas on the paper and it may take several h or even d until they are completely solubilized Treatment with the mcubation buffer overmght blocks the paper that might otherwise adsorb the kmase If the blocking is carried out for several days, it should be done at 5°C to prevent the growth of microorgamsms, unless the buffer contams preservative 2 The wet paper contams approx 2 mL of buffer Addition of another 8 mL brings the volume to 10 mL A premcubation period of at least 1 h should be used If the trough has been kept at SC, extend that period of time The trough has a fairly high heat capacity so that it takes a considerable time to warm tt up to 30°C 3 If the catalytic subunit of PKA is being used, no CAMP or any other activator needs to be added. PKG contains the regulatory unit as part of the primary structure and requires the addition of cGMP at a final concentration of 100 pA4. 4 This step may not be necessary if fresh and clean buffers and enzymes are bemg used. If small radioactive spots appear on or between the peptide spots after scanrung the paper, include step 8 mto the procedure 5 Drying can be carried out by leavmg the paper uncovered for about 1 h, or if the process shall be speeded up, by using an electrical hair dryer
References 1 Kemp, B E and Pearson, R B (1990) Protein kmase recognition sequences motifs Trends Blochem. Scz 15,342-346 2 Pearson, R B and Kemp, B E (1990) Protein kmase phosphorylation site sequences and consensus specificity motifs: tabulation Methods Enzymol 200, 62-8 1 3 Wu, J , Ma, Q N , and Lam, K S (1994) Identifymg substrate motifs of protein kinases by a random library approach Bzochemzstry 33, 14,82514,833 4. Furka, A , Sebestyen, F , Asgedom, M , and Dibo, G (1991) General method for rapid synthesis of multicomponent pepttde mixtures Int. J Pept Protem Res 37, 487-493.
706
Tegge and frank
5 Songyang, Z , Blechner, S , Hoagland, N., Hoekstra, M. F , Ptwmca-Worms, H., and Cantley, L C (1994) Use of an oriented peptrde library to determine the opttmal substrates of protein kmases Curr. Bcol 4,973-98 1 6 Songyang, Z. (1995) Catalytic specrftctty of protein tyrosme kmases IS critical for selective srgnallmg Nature 373,536-539 7 Frank, R (1992) Spot-synthesis an easy technique for the posittonally addressable, parallel chemical synthesis on a membrane support Tetrahedron 48, 92 17-9232 8 Frank, R and Overwm, H. (1996) SPOT-syntheses epttope analysts with arrays of synthetic peptrdes prepared on cellulose membranes III, Methods in Molecular Biology, vol 66: Epltope Mappmg Protocols (Moms, G. E , ed ), Humana, Totowa, NJ, pp 149-169 9. Tegge, W , Frank, R , Hofmann, F., and Dostmann, W R G (1995) Determmation of cychc nucleottde-dependent protein kmase substrate specificity by the use of peptlde lrbrartes on cellulose paper Blochemlstry 34,10,569-10,577 10 Glass, D B , Cheng, H -C , Mende-Muller, L., Reed, J , and Walsh, D A (1989) Primary structural determinants essenttal for potent mhtbmon of CAMP-dependent protein kmase by inhibitory peptrdes correspondmg to the active portion of the heat-stable mhrbrtor protein J Blol Chem 264,8802-8810 11 Butt, E , Abel, K , Krueger, M , Palm, D., Hoppe, V , Hoppe, J , and Walter, U (1994) CAMP- and cGMP-dependent protein kmase phosphorylatton sites of the focal adhesion vasodtlator-stimulated phosphoprotem (VASP) in vitro and m mtact human platelets J Blol. Chem 269, 14,509-14,517, 12 Glass, D B (I 990) Substrate spectfrctty of the cycbc GMP-dependant protein kmase in, Peptzdes and Protem Phosphorylatlon (Kemp, B E , ed ), CRC, Boca Raton, FL, pp 209-238 13. Geysen, H. M and Mason, T J (1993) Screenmg chemxally synthesized pepttde ltbrartes for btologxally-relevant molecules Bzoorg Med Chem. Lett 3, 397-404
13 Generation of Multiuse Peptide Libraries for Functional Screenings Channa K. Jayawickreme, and Michael R. Lerner
Shiranthi
P. Jayawickreme,
1. Introduction The range of applications for large-scale synthetic molecule libraries (1-7) can be expanded if the constituents can be liberated locally from their supportmg matrix in a controlled manner so that fractions are available for multiple independent tests, free of interference from other constituents of the library. A method was developed to study the functional responses arlsing from mdrvidual constituent beads m a synthetic combmatorial peptide library by introducing the multiuse peptide library (MUPL) concept (8). In the MUPL method (Fig. l), peptides are liberated from their supports m a dry state so that the problem of signal interference caused by mixing of peptlde molecules, particularly agonists and antagonists, is avoided. In addition, the pepttdes are released rn a controlled manner so that fractions are available for repetitive screens, thus elimmating the need for iterative library analysis and resynthesis Since the liberated constituents are not constrained by the tethered linkers, the molecules are free to assume their native conformations. These unique features of an MUPL has enabled the use of large-scale synthetic molecule libraries for functional screening (8-10). Successful conversron of a synthetic peptide combinatorial hbrary (SPCL) mto a MUPL was accomplished (II) by way of three developments A novel dry-state severmg method was used to release peptrdes from their solid supports. This mvolves a trifluoroacetic acid (TFA)-based gas phase cleavage procedure followed by a neutralization of acid salts using gaseous NHJH,O to allow the released peptide to remam attached to its source bead A lurker with slow release kinetics for gaseous TFA, e.g., a 4-methylbenzhydrylamme From
Methods
m Molecular Edlted
Bology,
by S CablIly
vol 87 Combmatonal 0 Humana
107
Press
Pepfrde
Inc , Totowa,
Llbraty NJ
Protocols
108
Jayawickreme,
Jayawickreme, and Lerner
Beads with Linkers
100-200 pmols
Multi Use Peptide
Library
I
Thousands of discrete molecules are free to move, but remains in an ordered manner
Fig. 1. Schematic representation
of the generation of multiuse peptide libraries.
(MBHA) linker (12) was chosen. This allows partial amounts of peptide to be released from the microcarrier beads so that the beads could be used for repetitive studies. Fmoc chemistry (13-15) was employed to synthesize the peptides on nontraditional Fmoc linkers, so that side chain protective moieties could be released by TFA independent of severing the peptide-linker bond. Methods and materials for the construction of MUPLs are described below.
2. Materials
2.1. Pep tide Synthesis 1. Fmoc-amino (Pmc)-OH,
acids: Fmoc- Ala-OH, Fmoc-Asn(Trt)-OH,
Fmoc-Arg(Pmc)-OH, Fmoc-Asp(OtBu)-OH,
Fmoc-o-Arg Fmoc-
109
Multiuse Peptide Ljbranes
2 3. 4 5 6. 7. 8 9 10. 11 12. 13.
Gln(Trt)-OH, Fmoc-Glu(OtBu)-OH, Fmoc-Gly-OH, Fmoc-His(Trt)OH, Fmoc-Ile-OH, Fmoc-Leu-OH, Fmoc-Lys(Boc)-OH, FmocMet-OH, Fmoc-Nle-OH, Fmoc--he-OH, Fmoc-n-Phe-OH, Fmoc-Pro-OH, Fmoc-Ser(tBu)-OH, Fmoc-Thr(tBu)-OH, Fmoc-Trp (Boc)-OH, Fmoc-n-Trp(Boc)-OH, Fmoc-Tyr(tBu)-OH, Fmoc-ValOH (Novabtochem, CA). 2-[ l H-Benzotriazol-yl)1 ,1,3,3-tetramethyl uronium hexafluorophosphate (HBTU) (Peptides International, Louisville, KY). I-Hydroxybenzotriazole (HOBt) (Peptides International). N&-Dtmethylformamtde (DMF) Plpertdme (Applied Btosystems, Foster City, CA) Methylbenzhydrylamme (MBHA) resin with 0 95 mmols/g substttutron (Novablochem) N,W Dnsopropylethylamme (DIEA) (Applied Biosystems). Dichloromethane (DCM) N-Methylpyrroltdone (NMP). Tnfluoroacetic acid (TFA) (Applied Btosystems). 20% (v/v) Ptperidme m NMP 0.45 MHBTU/ 0.45 MHOBt m DMF. Lyophllizer
2.2. Deprotection 1 2 3. 4. 5.
of Side Chain Groups
Methanol. DCM NMP 50% (v/v) DCM/methanol Cleaving reagent: 2 mL of 90% TFA/S% water.
thloamsole/2.5%
ethanedtthtol/2.5%
2.3. HPLC Analysis 1 HPLC Pharmacia (Prscataway, NJ) SMART system 2. Column Sephasrl Cl8 SC 2 l/10 reverse phase column (2 1 x 100 mm) 3. Buffer A: 0.1% TFA/water. Buffer B 0 085% TFA/acetomtrile 4. Separations. peptides were separated using a linear gradient of buffer A to buffer B. Peptldes were eluted at a flow rate of 180 mL/mm with a gradient of 1040% B for 20 mm Pepttdes were detected at 214 nm.
2.4. Ninhydrin 1. 2. 3. 4
Solution Solution Solution Methanol
Test
1 Phenol/ EtOH (7 3). 2, 0 2 mM KCN in pyridine. 3: 0.28 M Nmhydrm in EtOH wash. methanol/acetic acid (30.1).
Jayawickreme,
110 5 6 7 8 9
and Lerner
60% Ethanol m water. DMF Speed-Vat 13 x loo-mm screw-cap glass tubes. Disposable polystyrene cuvets
2.5, Preparation 1 2 3 4 5 6 7
Jayawickreme,
of Multiuse Peptide Libraries
Polypropylene rings Polyethylene sheet (Glad Clmg Wrap, First Brands, Danbury, CT) Glass dessicator Metal spatula TFA. Vacuum lme (150-250 mm Hg) 28% Ammonmm hydroxide in water
3. Methods
3.1. Peptide Synthesis All peptides can be synthesized on MBHA-polystyrene resm (substrtutron level 0.95 mmol/g) using Fmoc chemistry (13-15) as described below. 1 Transfer 0 25 g of MBHA resin to a reaction vessel and wash 6 x 10 mL NMP 2 Dissolve 1 mmol of derivatized ammo acid m 2 5 mL of NMP and add 2 0 mL of DMF containmg 0.45 M HBTU and 0 45 M HOBt to the ammo actd solutton. 3 Mix the amino acid/HBTU/HOBt solutton for 10 mm and then transfer to the resin, which has been washed with NMP 4 Add 2.0 mmol(0 35 mL) of DIEA to the resin solution and allow reaction to proceed for 30 mm at room temperature while mixing. 5 Filter the resin, rinse 6 x 10 mL NMP, and remove 2 mg of beadsfor quantitative ninhydrm testing (16) 6 If couplmgefficiency is >99%, deprotect the resin If <99%, repeatcoupling step 7 Deprotect the resm by a 5-mm treatment followed by an addmonal 15-mm treatment with 20% ptperidme/NMP 8. Wash 6 x 10 mL NMP and remove 2 mg for nmhydrm test 9. If deprotectron efficiency IS299%, start the activation and coupling for the next ammo acid. 10 After couplmg of the last ammo acid, deprotect the resin wtth 20% ptpertdme/ NMP for 5 mm followed by an addttional 30-mm treatment I1 Wash the resin 6 x 10 mL NMP Transfer the resin to a smtered glassfunnel and apply suction If necessaryuse more NMP for transferrmg 12 Wash the resin 3 x 20 mL DCM, wash 3 x with 20 mL MeOH 13 Remove the peptide resin and dry m a lyophihzer for 4 h. 14 Store under mtrogen if not cleaving immediately
111
Mu/fuse Peptide Libraries 3.2. Ninhydrin
Test
I 2 3 4 5
Prpet -2 mg (-50 PL) of peptlde resm mto a clean screw-cap glass tube Add 2.0 mL DMF, mix, let stand for 3 mm, and aspnate off the DMF. Wash the beads 3 x 3 mL of methanol. Dry the beads m a speedvac Add solutron 1 (75 yL), solution 2 (100 pL), and solutron 3 (75 pL) Heat the mixture at 100°C for 5 mm on a heat block or water bath. 6. Immediately after the mcubatton add 4.8 mL of 60% aqueous ethanol wtth vtgorous mixing 7 Once the pepttde resin has settled transfer 1 mL of supernatant mto drsposable polystyrene cuvets. Measure absorbance at 570 nm and calculate the couplmg efficiency
3.3. Construction
of Synthetic
Peptide Combinatorial
Libraries
Construct synthetic peptrde combmatonal libraries using MBHA polystyrene resin (substitution level 0.95 mmol/g) and Fmoc chemistry (as described in Subheading 3.1. to construct peptides on MBHA resin) in combmatron with srmultaneous multiple peptide synthesis (4,5). A divide, couple, and recombine process used to synthesize the bombesm SPCL and a-MSH-SPCL (see Subheading 3.7.) is shown rn Figs. 2 and 3. Couple all Fmoc-ammo actds to MBHA linkers as described above (Subheading 3.1.) using the HBTU/HOBt activation procedure and deprotect the resin with 20% piperidine/NMP.
3.4. Deprotection
of Side Chain Groups
For the preparation of MUPLs, side chain protection groups attached to the ammo acids in SPCLs are cleaved using the foliowmg procedure. 1 Stir lo-100 mg of peptlde bearing resin in cleavmg reagent at room temperature for 1 h 2 Filter the cleaving reagent and wash the beads thoroughly 1 x 3 mL of 90% TFA, 2 x 3 mL DCM, 2 x 3 mL NMP, and 3 x 3 mL methanol 3 Dry the peptide beads m a lyophtlizer for 6 h.
3.5. Preparation
of Multiuse Peptide Libraries
1 Suspend the beads m a 50% (v/v) solutton of DCM/methanol 2 Apply the beads m ahquots of 500-1000 to dtfferent locatrons on a polyethylene sheet stretched taut between two polypropylene rmgs. Use 1000-5000 beads for primary screens An dry the beads for approx 20 mm At this stage beads should stay attached to the polyethylene sheet 3. Spread the beads with a metal spatula to distribute them evenly on top of the entire sheet After spreadrng, we have occasronally observed some two-
112 1 Ala Aw Asn Asp Gln Glu GJY His Ile Leu LYS Met Phe Pro Ser Thr Trp TYr Val
2
3
4
5
6
Ala Aw Asn Asp Gln Glu GIY His Leu Ile Leu Val 1Gly 1His 1Leu FZ NH2 LYS Tr P Met Phe Pro Ser Thr Tw Tv Val
Fig. 2. Bombesm-multiuse peptrde library The library was constructed based on bombesm fragment 8-l 4 First and second positrons were filled by all combmattons of 19 L-ammo acids and the seventh posrtton was filled by four L-ammo acids to generate a library consisting of 1444 distinct pepttde sequences dtmenstonal clumpmg of a few beads within the monolayer, but tt does not appear to interfere with the experiment Transfer the polypropylene rings contammg beads to a desstcator and dry under vacuum (m a lyophrhzer) for 1 h Remove the desrccator from the lyophrhzer and transfer 10 mL of 100% TFA to the bottom of the desiccator, connect to a vacuum line (150-250 mm Hg) for 10 mm, and then seal Do not let the vacuum fall below 100 mm Hg as this may cause condensation of TFA droplets on the polyethylene sheets. Allow the reaction to proceed for 2-20 h at room temperature (20-25°C) to the desired amount of cleavage depending on the appltcatton (see Notes l-3). Following exposure to TFA, transfer the dish to a new desiccator and dry under vacuum for 1 h Transfer 10 mL of 28% ammomum hydroxide solutron to the destccator, connect to the vacuum hne (150-250 mm Hg) for 10 mm, and seal. Allow the neutrahzatton reaction to proceed for 20 mm and then dry the beads under vacuum for 1 h. Remove ammonium hydroxide from the desiccator and dry the beads under vacuum for 1 h
Muhuse Pepticie Libraries
113
a-MSH 1 23 4 567 Ac-Ser-Tyr-Ser-Met-Glu-Hls-PhbArg-Trp-Gly-Lys-P~-Val-NH7
1
2
3
4
0
9
5
Sub-library LLL
+
DLL
-b
LDL
+
QDL
+
LLD
+
DLD
+
LOD
+
DDD
+
Ala A% GlU Gln HIS Leu LYS Met Phe Pro Ser Thr Tw Tyr
Ala Aw ASP Gln HIS Leu LYS Met Phe Pro Ser Thr Tw TYr
* 4
Phe D-Phe Phe D-Phe
10
Arg
TrP
Arg
W
II-Arg
Trp
D-Arg
TrP
11
12
13
6
7
8
9
Pro
Val
Ala Au Asn Asp Gln GIU ‘JY His Ile g:
Phe D-Phe Phe D-Phe
Arg
D-Trp
Arg
D-Trp
D-Arg
D-Trp
D-Arg
D-Trp
8-mer
Library
9-mer
Library
Lys
NH2
Met Phe Pro Ser Thr Tw W Val Nle
Frg 3 a-MSH-multmse peptide library. The hbrary constructron was based on the a-MSH-[5-131 sequence Posrtron 10 was substrtuted by 20 L-ammo acrds. For the 9-mer library, positrons 5 and 6 were subsmuted by 14 selected L-amino acids and m the 8-mer and 7-mer librarres, positions 5 and 5-6 respectively, were omitted For all lrbrarres, the C-terminal sequence -Lys-Pro-Val-NH2 was kept unchanged Because of the mabthty of characterizing the chlrahty of ammo acids by standard sequencing procedures, the hbrarres were synthesrzed m 8 subpools depending on the optical rotation, D or L, at posmons 7,8, and 9 As shown m the figure, these 8 subpools were designated as LLL, DLL, LDL, DDL, LLD, DLD, LDD and DDD. Each of these subpools contained 3920,280, and 20 combmatrons of peptlde analogs, respectrvely, for g-met-, 8-mer and 7-mer lrbrarres, and each subpool was screened independently so that the chn-alrty of the ammo acids in posmons 7,8, and 9 of the positive peptrdes identified could be designated unambrguously. The total number of structural analogs m the 9-mer, 8-mer, and 7-mer libraries were 31,360,2240, and 160, respectrvely.
10 Cut the polyethylene sheet around the rim for eventual applications. 11 Use rmmedrately or store m the desiccator under vacuum for later use
114
Jaya wickreme, Jaya wickreme, and Lerner
3.5.1. Construct/on of Bombesm-MUPL A bombesm-MUPL was constructed to investigate the importance of Trp8 m bombesin (Trpl m bombesm-8-14) to induce biological activity at the bombesm receptor. See the next chapter for a description of screening of this library. Bombesm-MUPL was constructed as described below 1 Weigh 0 25 g of MBHA resin (0 95 mmol/g) mto four reaction vessels and couple Leu, Met, Pro, and Trp as described under peptlde synthesis (Subheading 3.1.). 2 Remove all beads from the reaction vessels, mix, and combme mto one reaction vessel. 3 Deprotect the resin and sequentially couple Leu, HIS, Gly, and Val in the same reaction vessel 4 Deprotect the resin, remove the beads from the reaction vessel, and divide equally into 19 reaction vessels Couple the 19 ammo acids as shown m position 2 of
Fig. 2 5 Deprotect all the resins and remove the beads from all the reaction vessels mto a beaker, mix well, and divide equally into 19 reaction vessels Couple the 19 ammo acids as shown m position 1 of Fig. 2
6. Deprotect all the resins and remove the beads from all the reaction vessels mto a beaker, mix well, wash, and dry the beads as described under peptlde synthesis
(Subheading
3.1.)
7 Deprotect the side chain protection groups as described m Subheading
8. Then convert the SPCL to a MUPL as described m Subheading
3.4.
3.5.
The functional screening of this MUPL for ldentlfmg hgands that activate the murme bombesm receptor is described in the next chapter.
3 5.2. Construct/on of a-MSH-MUPL The a-MSH-MUPL was constructed for the purpose of dlscovermg a-MSH antagonists and to study their structure-function relationships As shown here, careful design and construction of MUPLs for structure-function analysis can generate valuable information regarding peptide-receptor interactions (see Chapter 14). The a-MSH-MUPL was constructed as described below. 1 Weigh 2.0 g of MBHA resin (0 95 mmol/g) and sequentially couple Val, Pro, and Lys as described under peptlde synthesis (Subheading 3.1.) 2 Deprotect the resin and remove the beads from the reactlon vessels and divide equally mto 20 reaction vessels Couple the 20 ammo acids as shown m position 6 of Fig. 3 3 Deprotect all the resins and remove the beads from all the reaction vessels mto a beaker, mix well, and divide equally into 8 reaction vessels Couple the next 3 ammo acids in positions 5,4, and 3, which are either L- or D-Trp, Arg, and Phe, independently m 8 reaction vessels
Muhuse Peptide Libraries
115
4. Deprotect the beads m each reaction vessel and save a portton as a 7-mer library. 5. Hereafter treat beads m each reaction vessel separately to couple amino acids m posmons 2 and 1. Dtvtde beads from a single vessel equally mto 14 reactron vessels. Couple the 14 ammo acids as shown in posttton 2 of Fig. 3. 6 Deprotect all the resms and remove beads from all the reactton vessels into a beaker, mix well, and save a portion as an 8-mer library 7 Divide each deprotected 8-mer hbrary equally mto 14 reactron vessels Couple the 14 ammo acids as shown m posmon 1 of Fig. 3. 8 Deprotect all the resms and remove the beads from all the reaction vessels mto a beaker, mix well to obtain the 9-mer hbranes, and dry the beads as descrtbed under pepttde syntheses (Subheading 3.1.). 9 Deprotect the side chain protectton groups for each 7-mer, 8-mer, and 9-mer library as described in Subheading 3.4. 10 Convert each of these SPCLs to MUPLs as described m Subheading 3.5. The functional screening perform structure-function Chapter 14.
of this MUPL to Identify lrgands studies for the a-MSH receptor
and Its usage to 1s described in
4. Notes A multmse combmatorral pepttde library (MUPL) concept can be used to release small portions of the molecules m successron from large-scale synthetic molecule libraries constructed on solid supports with appropriate linkers. Since the cleavage IS carried out m a solutron-free envrronment, the cleaved compounds are localized to the original beads, and when exposed to the screening media, the molecules are released as soluble molecules that are free to assume their native conformations. This avoids the diffusion of compounds away from the beads while being cleaved and allows srmultaneous cleavage of thousands of beads not separated by a physical boundary without mtermtxmg with each other It also allows the compounds on the beads to functtonally interact with the targets free of interferences from the nerghboring (agomst/antagomst) molecules 2 The amount of pepttde released from these library beads determines the local concentration of indrvtdual peptlde and, hence, the detection limit of a response The amount of pepttde needed to be released can be controlled by the gas phase cleavage time This was illustrated by demonstrating that gaseous TFA would cleave the amide bond anchoring synthetic pepttde with slow kmettcs Lrtorm- (a bombesin receptor agonist) bearing beads (8) were sprmkled on to a polyethylene sheet stretched between two polypropylene rings and exposed to the acid. Samples were removed at specific times and the amounts of released pepttde were quantified by HPLC analysts (8). The amount of peptide released from the library beads was estrmated relatrve to the rate of btorm released from htormMBHA beads as shown m Fig. 4. Stmllar results have been described prevtously (9) for a-MSH and des-Ac-a-MSH release from CGMSH-MBHA and desAC-CX-MSH-MBHA beads The results demonstrate that bond cleavage (8) IS a
Jaya wickreme, Jaya wlckreme, and Lerner
116
80
60 40 20
0
5
10
8 _m c z aI 0 a
15
Retention
time (mm)
6
2
4 Cleavage
6
8
10
12
time (hours)
Fig. 4. Analysts of synthettc lltorm released from polystyrene beads by the gas phase cleavage procedure. (A) HPLC fracttonatron of 500 pmol of lttorm standard (B) HPLC fractionation of synthetic lrtorm cleaved from 225 beads by exposure to gaseous TFA for 6 h (C) kinetics of bond cleavage as determmed by measurmg the amount of litorm released from the beads upon exposure to gaseous TFA
Multruse Pep trde 1/brar/es
117
time-dependent process m which 15% of the peptlde on a bead IS cleaved after 10 h exposure to gaseous TFA. An approximately linear relationship was observed between peptlde release and gas phase cleavage time. 3. The data show that multmse pepttde libraries can be powerful tools for mvestlgatlons involvmg mdrvrdual assessments of large numbers of peptides These ltbraries have two strengths. Fwt, their constttuent pepttdes can be screened for functronal properties without cross-mterference as highlighted by the use of melanophore-based pigment translocatlon assay. Second, sufficient peptldes from constttuent beads can be obtained for numerous sequential rounds of analysis makmg rt feasrble to determine how large numbers of speclfrc peptldes behave m a variety of assays. This property was used to home m on beads bearmg peptldes of interest and to identify these peptides wrthout the need for iterative purrftcatton procedures mvolvmg the constructron and screening of ever finer peptrde libraries The potential applications of MUPLs are broad. Two examples are they could aid m the search for new therapeutic agents targeted at transmembrane signaling proteins, and their applicability to Petri dish-style assays may prove useful rn tdenttfymg new antrbtotrcs or cell growth mhtbnors
Acknowledgments We thank Gerard F. Grammskl, Mark Quillan, Alison Roby-Shemkovrtz, Lina Golovyan, Kristine Harris, T. McClintock, and LOUIS Marotti for their contributions,
References 1 Geysen, H. M , Meloen, R. H , and Bartelmg, S. J (1984) Use sis to probe viral antigens for epttopes to a resolution of a single Natl. Acad Scl. USA 81,3998-4002. 2. Fodor, S P A., Read, J L., Pm-ung, M C., Stryer, L , Lu, A (1991) Lrght-directed, spatially addressable parallel chemical
of peptlde syntheammo acid. Proc. T , and Solas, D. synthesis Sczence
251,767-773 3. Furka, A , Sebestyen, F., Asgedom, M., and Dlbo, G (199 1) General method for rapid synthesis of multtcomponent peptide mrxtures Int J. Pept Protein Res. 37, 487-493. 4 Lam, K. S , Salmon, S E , Hersh, E. M., Hruby, V J , Kazmlerskr, W M , and Knapp, R. J. (199 1) A new type of synthetic peptlde library for identifying bgandbmdrng actrvrty. Nature 354,82-84 5 Houghten, R A , Pnulla, C , Blondelle, S E , Appel, J R , Dooley, C T , and Cuervo, J H. (1991) Generation and use of synthetic peptlde combmatorlal bbrartes for basic research and drug discovery. Nature 354,84-86. 6 Gallop, M A., Barrett, R. W., Dower, W. J., Fodor, S P. A., and Gordon, E M. (1994) Appltcattons of combmatorlal technologres to drug discovery 1. Background and peptlde combmatortal libraries J. Med Chem. 37,1233-l 25 1. 7 Gordon, E M , Barrett, R. W., Dower, W J., Fodor, S. P. A., and Gallop, M. A (1994) Appbcatrons of combmatonal technologtes to drug discovery 2. Com-
118
8
9
10.
II 12. 13.
14 15
16
Jayawickreme,
Jayawrckreme, and Lerner
bmatorlal organic synthesis, hbrary screenmg strategies, and future directions. J. Med Chem. 37,1385-1401. Jayawlckreme, C K , Grammski, G. F , Qmllan, J M , and Lerner, M R. (1994) Creation and functional screemng of a multi-use peptlde library Proc Natl. Acad Scz USA 91,1614-1618. Jayawickreme, C K , Qmllan, J M , Grammskl, G F., and Lerner, M R (1994) Discovery and structure-function analysis of a-melanocyte-stimulating hormone antagonists. J. Bzol. Chem. 47,29,846-29,854 Qmllan, J M , Jayawickreme, C K , and Lerner, M. R (1995) Cotnbinatorlal diffusion assay used to ldentlfy topically active melanocyte-stlmulatmg hormone receptor antagomsts Proc. Natl. Acad. Scl USA 92,2894-2898 Jayawlckreme, C. K and Lerner, M. R. (1993) Generation and screening of mobile peptide libraries FASEB /. 7, A 1237 (abstract). Matsueda, G R and Stewart, J. M. (1981) A p-Methylbenzhydrylamme resin for Improved sohd-phase synthesis of peptide amides Peptzdes 2,4.5-50. Fields, G B , Tlan, Z , and Barany, G. (1992) Prmciples and practice of solid phase peptlde synhesls, m Synthetzc Peptldes: A User’s Guide (Grant, G A., ed.), Freeman, New York, pp 77-l 83 Fields, G B and Noble, R L. (1990) Solid phase peptlde synthesis utilizing 9-fluorenylmethoxycarbonyl ammo acids Znt J. Pept Protein Res. 35,161-214 Fields, C. G., Lloyd, D H., Macdonald, R. L , Otteson, K. M , and Noble, R. L. (199 1) HBTU actlvatlon for automated Fmoc solid-phase peptide synthesis. Pept. Res. 4,95-101. Sarm, V. K., Kent, S. B H , Tam, J P , and Memfreld, R B (1981) Quantitative monitormg of solid-phase peptlde synthesis by the nmhydrm reaction Anal Biochem. 117.147-157
Functional Screening of Multiuse Using Melanophore Bioassay Channa K. Jayawickreme, and Michael R. Lerner
Shiranthi
Peptide Libraries
P. Jayawickreme,
1. Introduction This chapter describes the apphcation of recombinant melanophores to study cellular responses artsmg from individual beads of a multmse peptide library (MUPL). In the melanophores, a cell hne derived from Xenopus Zuevis skin, pigment dispersion can be effected via actrvation of adenyl cyclase (1,2) or phospholipase C (3), while pigment aggregation results from inhibition of adenyl cyclase (4,5). It has been shown that melanophore cells contain a wide range of G,-protems (6) that facilitate the coupling of numerous foreign G-protein coupled receptors (GPCRs) m melanophores (Fig. 1). Smce both states of intracellular pigment dtstrtbutton (dispersion or aggregation) are easily detectable, numerous recombinant GPCRs, such as the bombesm receptor (7), can be studied by momtormg ligand-mediated melanosome translocation (3). The pigment translocation assay is an attractive tool for functional screening of MUPLs due to the ability of melanophores to functionally express numerous exogenous GPCRs. Therefore the recombinant melanophores allow MUPLs to be screened for the presence of new agonists or antagomsts and for elucidating principles govermng molecular mteractrons It is expected that apphcations of MUPLs in conjunction with functional assays will enhance both basic scientific research and the rates of drug discovery and development In this chapter, we describe the methods developed for the apphcation of a MUPL for discovermg novel agonists to the murine gastrin releasing pepttde (bombesin) receptor (8) and antagonists to Xenopus laevzs a-melanocyte stimulating hormone (a-MSH) receptor (9,10) using the melanophore bioassay.
From
Methods
m Molecular B/ology, vol 87 Combmatorral PepOde Ed&d by S Cablily 0 Humana Press Inc , Totowa,
119
Library NJ
Protocols
120
Jaya wickreme, Jaya wickreme, and Lerner
Fig. 1. In the melanophores, pigment dispersion can be effected via activation of adenyl cyclase or phospholipase C, while pigment aggregation results from inhibition of adenyl cyclase.
2. Materials 2.1. Propagation
of Melanophores
1. Fibroblast growth medium: 250 mL L-15 (Sigma, St. Louis, MO), 100 mL fetal calf serum (Gibco-BRL, Gaithersburg, MD), 5 mL L-glutamine (200 mM, GibcoBRL), 10 mL penicillin/streptomycin (5000 units/ml, Gibco-BRL), 35 mL water. 2. Fibroblast-conditioned medium: Plate Xenapus laevis fibroblasts at a density of 1:200. Collect medium when they are -20% confluent (-4-5 d) and 100% confluent (6-7 d). Filter, combine the two crops and use in the primary culture of melanophores. 3. 0.7X Phosphate-buffered saline (PBS); 0.14 g KH,PO,, 0.81 g Na,HPO,, 0.14 g KCl, 5.6 g NaCl in 1000 mL ddH,O. 4. Trypsinization solution; 0.05% trypsin, 0.5 mM EDTAs4Na in 0.7X PBS.
2.2. Expression
of Recombinant
DNA in Melanophores
1. Gene Pulser apparatus (Bio-Rad, Hercules, CA); capacitance setting of 960 pF; voltage setting 400 V. 2. Electroporation cuvet (0.4-cm gap, Bio-Rad). 3. 70% PBS. 4. 0.7X L-15 supplemented with 20% calf serum. 5. Plasmid DNA for the receptor of interest.
2.3. Video Image Analysis 1. Oncore Image software (Oncor Inc, Bethesda, MD). 2. Videk digitizing camera (Videk, Canandaigua, NY), resolution: 1300 x 1000 pixels. Process the gray images on a MacIIfx computer using programs written in the command language of Oncor-Image software (II),
Melanophore
121
Bioassay
3. Methods 3.7. Propagation
of Melanophores
Routinely passage confluent become confluent -7-14 d.
dishes of melanophores
at a ratio of 1: 10. Cells
1 Seed 1-2 x lo6 cells per 225cm2 flask. Grow cells at 27’C or room temperature m the dark. These cells do not require CO, exchange. 2. Feed cells every 4 d (35 mL of conditioned media per 225cm2 flask) 3 When confluent, wash cells with 70% PBS and detach by trypsmtzation (-3 mm incubation with 3 mL of trypsm solutton). 4 Inactivate trypsin by adding 0 7X L-15 supplemented with 20% calf serum 5 Collect cells by centrifugation at 2000g for 5 min. 6 Resuspend cells in growth medium and seed new flasks
3.2. Expression
of Recombinant
Transrent expression of plasmid electroporation . 1 2 3 4. 5 6.
7 8 9
DNA in Melanophores DNA in melanophores
was carrred out by
Wash cells with 70% PBS and detach by trypsmizatton (-3 mm). Inactivate trypsm by adding 0 7X L-15 supplemented with 20% calf serum Collect cells by centrifugatton at 2000g at 4°C for 5 min Resuspend the cell pellet m me-cold 70% PBS and repeat the recentrtfugatlon as above. Remove supernatant, count the number of cells usmg a hemocytometer, and resuspend m ice-cold 70% PBS at a density of lo-14 x lo6 cells/ mL. Add l-40 1.18(in ~20 PL volume) of plasmid DNA to an Eppendorf vial, transfer 400 pL of cells, and incubate on ice for 20 mm. Vortex the cell/DNA suspension l-2 times during this mcubatton. Trtturate the cells and transfer into a prechilled electroporatton cuvet and electroporate the cells Immediately after the electoporation transfer the cells mto fibroblast-conditioned media and plate cells m Petrt dishes or well plates as needed. Assay the cells anywhere from l-4 d after electroporation. Using this procedure, a transfectton efficiency of 30-80% could reliably be obtained
3.3. Screening
of MUPLs for Agonists
Xenopus Zuevzs dermal melanophores expressing GPCRs were used for functional screening of MUPLs. The methodology used for the screening of bombesin-MUPL to discover new agonists for the murme bombesm receptor 1s described below (also see Figs. 2 and 3A-C). Bombesm receptor (7) plasmid DNA (pJG3.6BR) (3) was transiently expressed in melanophores by electroporation (8).
122
Jaya wickreme, Jaya wickreme, and Lemer
J-’
MUPLS
Agonist/Antagonist screening
Structure Determination
ABCD......
Fig. 2. MUPL beads are placed on the polyethylene film facing down on the agarose bed, which is layered on top of melanophores expressing recombinant receptors. Pigment dispersion induced by peptide analogs is monitored by video image subtraction. Single beads responsible for positive signals are collected, and sequenced. 1. Electroporate 40 pg of plasmid DNA (pJG3.6BR) into melanophores. 2. After the electroporation, seed l-l 5 million cells into 60-mm tissue culture plates in 5 mL of fibroblast-conditioned media and incubate at 27°C for 72 h. 3. For an experiment, remove media from the dish and replace with 3.5 mL of 0.9% Sea Plaque agarose prepared in fibroblast-conditioned media containing 2 nM melatonin.
Fig. 3. (see opposite page) Screening the bombesin multiuse peptide library for agonists using melanophore cells expressing the bombesin receptor. (A-C) Selection of positive beads; (A) round 1, approx 5000 peptide beads were applied, (B) round 2, approximately 500 peptide beads selected from responding areas identified in round 1, (C) round 3, 52 peptide beads selected from responding areas identified in round 2. (D-F) and (G-I) Responses of recombinant melanophore cells to peptide from beads 6 and 7 at 25,35, and 45 min, respectively.
Melanophore
Bioassay
123
724
Jaya wickreme, Jaya wickreme, and Lerner
4 Leave the plate m the dark for 60 mm, and place the bombesm-MUPL beads on the polyethylene film facing down on the agarose bed as shown m Fig. 2 Use up to 6000 beads for primary screenrng. The diffusion distance of the agarose layer is between 1.4 and 1 6 mm It takes 5-10 mm for pigment disperston to be seen 5. Soon after placmg the MUPL beads, momtor the pigment dispersion mduced by peptide analogs by video imaging (II) using Oncor-Image software 6 Use video image subtraction to detect pigment dtspersion induced by peptide analogs, Figure 3A shows a video image analysis resultmg from 30 mm exposure to the MUPL. Cells to which peptide agonists had diffused dispersed their melanosomes, as evidenced by the multrple and overlappmg red circles 7 After screenmg, freeze the tissue culture plate contammg the cells and beads for a mmlmum of 2 h at -20°C. 8. Prepare a template of the subtracted image to the same size as the 60-mm dish Place rt underneath and mark the areas correspondmg to the positive responses 9. While the plate is still frozen, peel away the polyethylene sheet from the frozen agarose layer The beads will remam embedded m the frozen agarose layer 10. Align the template on the underside of the tissue culture plate where the circles can be easily identified. 11. Retrieve the beads withm the boundanes of the circles by suckmg them up mto a pipet tip with the aid of a pipetman 12. Transfer the beads to a glass plate and wash three times with 50% (v/v) methanol/ dichloromethane (DCM). Additional washing with N-methylpyrrohdone (NMP) removes any agarose or residual protems attached to the beads. 13. Then transfer the beads to a polyethylene sheet prepared as descrrbed earher For the secondary screens, use 50-500 beads. Figure 3B shows a video image analySISresulting from secondary MUPL screenmg performed with approx 500 beads collected from selected responding areas 14 Repeat steps 7-13 to perform a tertiary screen rf necessary to isolate smgle beads Figure 3C shows a video image analysis resultmg from tertiary MUPL screemng performed wtth approx 50 beads collected from selected respondmg areas 15. Collect the single beads responsible for positive signals, wash with NMP, DCM, and methanol, place on a glass fiber filter, and sequence usmg an Applied Biosystems 476A sequencer (see Notes 1 and 2).
3.4. Screening
of MUPLs for Antagonists
The application of MUPLs to ldentlfy antagonist peptldes is illustrated by screening a-MSH-MUPL to discover novel antagonists for Xenopus laevis a-MSH receptor (Fig. 4A-C). 1. Plate l-l.2 million cells into 60-mm tissue culture plates m 5 mL of fibroblastcondmoned media and mcubate at 27“C for 48 h. 2. For an experiment, remove medium from the dish and replace with 3.5 mL of 0 9% Sea Plaque agarose prepared in fibroblast-conditioned media contammg 2.0 nM a(-MSWl nM melatonm.
0 min
30 min
0 min
30 min
0 min
30 min
15 min
25 min
35 min
Fig. 4. Screening the a-MSH-MUPL to identify antagonists. (A-C) Primary screening of o-MSH-MUPL; (A) 9-mer t.Lt.-sublibrary; (B) 9-mer tot,-sublibrary; (C) 9-mer boo-sublibrary. Approximately 1500 MUPL beads were applied; video images taken at 0 min and 30 min are shown. (D) Secondary screening. Approximately 40 peptide beads collected from 12 responding areas identified in the primary screening of the 9-mer tot.-sublibrary; video images taken at 0 and 30 min are shown. (E) Responses of melanophore cells to peptide from a single bead selected from the secondary screening of 9-mer 1.~1, pool at 15,2.5, and 35 mitt, respectively.
125
Jaya wlckreme, Jaya wukreme, and Lerner
126 Table 1 Bombesin Agonists of Multiuse Pepticie
Discovered Libraries
by Functional
Screening
Pepttde sequence
EGO
Trp-Ala-Val-Gly-His-Leu-Met-NH, Trp-Phe-Val-Gly-His-Leu-Met-NH* Ala-Trp-Val-Gly-His-Leu-Met-NH, Phe-Ala-Val-Gly-His-Leu-Met-NH* Phe-Phe-Val-Gly-His-Leu-Met-NH;? His-Tyr-Val-Gly-His-Leu-Met-NH, Met-Ile-Val-Gly-His-Leu-Leu-NH,
18 nM 33 nM 25pM 79pM 12pM 14 PM 36 pM
3 After 1 mm place the a-MSH-MUPL beads on the polyethylene film facing down on the agarose bed Use up to 4000 beads for primary screenmg. The diffusion distance of the agarose layer 1s between 1 4 and 1 6 mm It takes 15-30 mm to see the antagonist responses 4 Soon after placmg the MUPL beads, monitor the pigment translocation induced by peptide analogs by video imaging (II) using TLC-Image software (Biological Detection Systems, PA) as described for agonist screening. 5 Follow steps 7-15 described m Subheading 3.3. to isolate single beads responsible for antagonist responses and then to sequence them (see Notes 1 and 2)
4. Notes I
Individual beads isolated from agonist and antagonist screens are sequenced to obtain thetr sequences To verify the stucture and to determine the potencies of these peptides they can be synthesized m the traditional manner (9) and doseresponse curves can be generated using 96-well format melanophore bioassay (9) The peptide sequences obtamed for bombesin agonists and a-MSH antagonists together with their potencies are shown m Tables 1 and 2 2 As the peptides dtffuse away from the MUPL beads they interact with the melanophores Therefore the circular colored responses of melanophores to agonist or antagonist arise from a single bead at the centers of the circles For two selected positive beads from the bombesm-MUPL, as pepttdes diffuse from their source beads, the circles of darkened pigment cells enlarged with time as seen m Fig. 3D-F and G-I For a-MSH antagonists each lightened circle arises from a single bead at its center. An example of how the antagonists block the a-MSH response over time is illustrated m Fig. 4E m which the images were taken at 15,2.5, and 35 mm after bead application The rates at which the circles of responding cells grow m response to exposure to peptides from mdividual beads are proportional to their potencies (9). The results approximate a linear correlation which can be used to directly predict EC50 values for future peptides without the need for then resynthesis and retesting
Melanophore
Bioassay
Table 2 Novel a-MSH Antagonists Discovered of Multiuse PeDtide Libraries
727
by Functional
Screening
Peptlde sequence
Ic,o
153N-6 153N-8 154N-5 155N-8
Met-Pro-o-Phe-Arg-o-Trp-Phe-Lys-Pro-Val-NH2
llf7
Ala-~eu-D-PHE-~RG-D-TRP-~HE-~YS-~RO-~AL-~~2
21
MET-PHE-ARG-D-TRP-PHE-LYS-PRO-VAL-NH2 GLN-ALA-D-PHE-ARG-D-TRP-PHE-LYS-PRO--AL-NH,
37+13 83 f 2.5 nM
161N-8
PRO-GLN-D-PHE-ARG-D-TRP-PHE-LYS-PRO-VAL-NH2 ALA-PHE-D-ARG-D-TRP-PHE-LYS-PRO--AL-NH:! SER-GLN-D-PHE-D-RP-PHE-LYS-PRO-VAL-NH2
154N-8 155N-6 176N-2 153N-3 154N-3 155N-I 155N-4
SER-~RP-D-PHE-~RG-d-TRP-~HE-~YS-~RO-~AL-~~2 TRP--ARG--HE-d-ARG--TRP-SER--LYS-PRO-vAL-NH2
PRO-PHE-D-ARG-TRP-SER-LYS-PRO--AL-NH*
ALA-ARG-PHE-D-ARG-TRP-SER-LYS-PRO--AL-NH* TRP-TRP-PHE-D-ARG-TRP-ALA-LYS-PRO--AL-NH?
k
12
nM nM nM
85 + 60 nM 180+60 nM 200+ 120nM 210 f 80 nM 320f75 nM I.1 f03 pM 2.4+14 pM 25 kO.6 I.LM
Acknowledgments We thank Gerard F. Graminski, Mark Quillan, Alison Roby-Shemkovitz, Lina Golovyan, Krrstine Harris, T. McClintock, and LOUIS Marottt for their contributions. References 1. Potenza, M. N., Grammskr, G F , and Lerner, M R. (1992) A method for evaluating the effects of ligands upon G, protein-coupled receptors using a recombinant melanophore-based bra-assay. Anal. Biochem 206,3 15-322 2 Potenza, M N. and Lerner, M. R. (1992) A rapid quantrtatrve bra-assay for evaluating the effect of lrgands upon receptors that modulate CAMP levels m a melanophore cell line. Pigment Cell Res. 5,372-378. 3 Grammskt, G. F., Jayawtckreme, C. K., Potenza, M. N , and Lerner, M. R. (1993) Pigment dlsperston m frog melanophores can be induced by a phorbol ester or strmulatlon of a recombinant receptor that activates phospholtpase C 1. Bzol. Chem. 268,5957-5964
4. Damolos, A , Lerner, A. B , and Lerner, M. R (1990) Action of light on frog pigment cells m culture Pigment Cell Res. 3,38-43 5. Potenza, M N., Grammski, G F , Schmauss, C , and Lerner, M R (1994) Functional charactertzatton of human D2 and D3 dopamine receptors J. Neuroscz. 14, 1463-1476 6 Karne, S., Jayawrckreme, C K , Nguyen, T. P , Anderson, M L., and Lemer, M. R. (1991) Charactertzatton of G-protems m Xenopus Melanocytes, 21st Annual
128
7
8
9
10.
11
Jaya wrckreme, Jaya wickreme, and Lerner
Meeting of Society for Neuroscience, New Orleans, LA Neuroscience Abstracts 17,607 Battey, J. F , Way, J. M , CorJay, M H , Shaplra, H , Kusano, K , Harkms, R , Wu, J M., Slattery, T., Mann, E , and Feldman, R I. (1991) Molecular clonmg of the bombesm/gastrm-releasmg peptlde receptor from Swiss 3T3 cells Proc Nat1 Acad. Sc1 USA f&395-399 Jayawlckreme, C K , Grammskl, G F , Qulllan, J M , and Lerner, M R (1994) Creation and functlonal screening of a multi-use peptlde hbrary Proc Nat1 Acad. Sc1. USA 91,1614-1618 Jayawlckreme, C. K , Qulllan, J M., Graminskl, G F., and Lerner, M. R (1994) DIscovery and structure-function analysis of a-melanocyte-stimulating hormone antagonists. J. Biol. Chem. 47,29,846-29,854. QuIllan, J. M , Jayawlckreme, C K , and Lerner, M. R (1995) Combmatorlal dlffuslon assay used to ldentlfy toplcally active melanocyte-stlmulatmg hormone receptor antagonists Proc. Nat1 Acad Sc1 USA 92,2894-2898 McClmtock, T S , Grammskl, G F , Potenza, M N , Jayawlckreme, C K , Roby-Shemkovltz, A , and Lerner, M R. (1993) Functional expresslon of recombinant G-protein-coupled receptors momtored by video Imaging of pigment movement in melanophores Anal. Blochem. 209,298-305.
15 The Basic Structure of Filamentous Phage and Its Use in the Display of Combinatorial Peptide Libraries Shmuel Cabilly 1. The Phage Virion The filamentous phage constitutes a large number of male-specific bacteriophage having similar shape, size, and lifecycle. The most studied phage are f 1, fd, and Ml 3, all of which Infect E colz cells through their F pill. This group of F-spectfic phage share 98% homology in their DNA sequence. Their nme codmg genes (coding for ten proteins), as well as then two mtergenic regions, are ordered and oriented in the same way. The phage particle has a filamentous shape of 930-nm in length, a diameter of 6.5nm, and contains a ssDNA of about 6400 bp, packaged within five coat proteins named pVII1, ~111, pV1, pVI1, and pIX (Fig. 1). The major coat protein, pVII1, wraps the phage DNA with 2800 of its copies arranged m a helical symmetry (I). When the phage DNA is elongated as a result of DNA insertion, the number of pVII1 copies mcreases to compensate for the increased length. (2,3). At the proximal end of the virion (the first to cross the membrane when the phage leaves the host cell), five copies of pVI1 and of pIX form a 308, plug structure. These are two small hydrophobic peptides, 33 and 32 kDa, respectively, that play a role in the early stages of phage assembly, where they serve as a nucleus for the subsequent deposition of pVII1 (Fig. 2) In their absence, almost no phage particles are formed (4,5). The distal end of the virion termmates with five copies of pII1 and of pVI(6-8). These protems are required for terminating the deposition of pVII1 during phage assembly and for anchoring the phage to the bacterium pili (5). Negative staining of phage particles shows that pII1 and pV1 form a cylindrical shape with a pointed end, and pII1 extends further as a thm protrusion (9). From
Methods
m Molecular E&ted
by
Bology, S CablIly
vol 87 Combmatonal 0 Humana
129
Press
PepMe
Inc , Totowa,
Lhrary NJ
Protocols
130
Cabilly
pVll
pVlll
PlX
pVI
pill
NH?+
Fig. 1. A “fish scale” structure of filamentous phage. Symbols: O-library tion sites; gray- hydrophobic surface; white- hydrophilic surface.
plV gated channel
PlX
p
‘>uter
DVII
do8 \u
Trx ’
%
cell
pVII1
cell
0
+
pV
assemly
membrane
plll
Inner
inser-
-
-p;,-
membrane
-
RF
ssDNA
Fig. 2. Assembly of the phage virion and its release from E. coli cells.
2. Assembly
of Phage Virion and Its Release from E. co/i Cells
Adsorption of phage particles to E. coli cells occurs through the interaction between the amino terminus domain of pII1 and the bacterium pili. Then after, in an unknown manner that could involve retraction of the pilus, the whole particle transverses the outer cell membrane, strips off its pVII1 over the inner
Structure of Filamen tous Phage
137
membrane, and the ssDNA penetrates into the cytoplasm where it replicates into dsDNA-the phage replicative form (RF). Once the phage coat proteins are produced by E. coli, they move to the bactermm inner cell membrane and associate with it. The circular ssDNA phage particles propagate m the bacterium cytoplasm via a rolling circle mechanism and the particles assume a rodlike structure when bound to dimers of the phage protein pV. A complex of proteins, including the bacterium-encoded thioredoxin (TrxA), the phage p 1, pVII, and pIX, anchor the ssDNA particle to the inner cell membrane and mltiate the assembly of the phage particle and its passage through the inner membrane. In the assembly process, pV is replaced by the major coat proteins (5) and the process terminates with the assembly of pV1 and ~111.The phage crosses the outer membrane through specific gated channels that consist of lo-12 copies of pIV (10) (Fig. 2). There is a requirement for specific fitness between the phage major coat protein and the channel protein pIV (II), thereby, changes made in pVII1 or pIV might interfere with the release of the phage. 3. Display of Peptides on the Phage Coat Proteins Of the five coat proteins, ~111,pV1, and pVII1 have been used for displaying peptides on the phage virion pII1 is the longest coat protein Its sequence consists of 406 amino acids (excluding the leader sequence) hooked to the virion surface through 23 hydrophobic amino acids in its carboxy terminus (12). The protein contains two glycine-rich flexible segments. The first, (GGGSE),GGGT, is located 70 amino acids downstream from the N-terminus, and the second, (GGGS),(GGGSE),(GGGS),GSG, is located 215 amino acids downstream the from N-terminus. The domain between the two glycine-rich segments is required for anchoring the phage to the tip of the bacterium pilus, and the upstream region is required for phage penetration (13,14). Smith was the first to demonstrate that the amino terminus of ~111,which protrudes away from the phage surface, can tolerate insertions of foreign polypeptides (15). His findings and those that followed (16,17) paved the way for the generation of phage display peptide libraries (l&20), for the display of other proteins, such as, various forms of Ab fragments, Ab libraries (21,22), cytokmes (23), receptors (24,25), lectins (26)) protease inhibitors (27,28), DNA-binding proteins (29)) enzymes (30,3I), cDNA expression libraries (32,33), and more. Unlike ~111,pVII1 is a small protein of 50 amino acids. A short segment of five amino acids at its ammo terminus is exposed to the surrounding medium The rest of the molecule has a helical structure with the following three domains: an acidic ampiphatic domain of 14 amino acids; a hydrophobic domain of 20 ammo acids; and a basic ampiphatic domain of ten amino acids. This unique structure enables the deposition of pVII1 molecules, one on top of the other and over the phage DNA m the form of “fish scales” (Fig. 1). An
Cabilly appropriate insertion site for displaymg foreign peptides is at the junction between the first segment of five amino acids and the followmg ampiphatlc domain (34). The length of peptides displayed by pVII1 is limited to 5 to 6 amino acids, unless intact molecules of pVII1 are also present on the surface of the phage vinon (see below). Longer peptides interfere with the phage propagation, probably by affecting the specific interaction between pVII1 and the gated channel or because of unfavorable mteractions with pVI1 or pIX at the mitral stages of assembly (9,35). pII1 can tolerate the insertion of longer peptides, however, displayed peptides may affect the phage assembly or block its adsorption to the E. cull pili (36), and some of the fused peptides decrease the phage propagation rate (see Chapter 16). The number of displayed peptides on the phage virion is m accordance with the number of the fused coat protemsfive on pII1 and about 2800 on pVII1 This multiplicity of peptide display is advantageous for some purposes, but it limits our ability to use the phage for distinguishmg between phage-displaying peptides with different bmdmg affnuties or to select for phage-displaying peptides with improved affinities (20,37). To reduce the number of peptides displayed on each virion, the coat proteins molecules that are fused to the displayed peptides are expressed in the presence of excess copies of intact coat protein. This kmd of double expression has been carried out in two ways. by constructing a phage genome that codes for the two forms of the coat protein; or by a double transfection of E. coli with a phagemid coding for the fused coat protein and with a helper phage that gives rise to the intact coat protein as well as to the rest of the phage proteins (37) Diluting the number of peptides displayed by pVII1 to tens or hundreds of copies enables the construction of phage libraries displaying peptides that are longer than six ammo acids (34) and the display of proteins having a much higher molecular weight (38). Similar dilation of peptides displayed on pII1 enables the production of phage displaymg a single peptide. Truncated forms of pII1 lacking their ammo terminus region, which IS responsible for phage anchoring (to pill) and/or penetration, are properly assembled on the phage virlon Since not all five pII1 are required for phage mfectivity , the truncated form can be used to display foreign peptides while the coexpressed intact pII1 restores the phage infectivity (39-41) Another way to restore the mfectlvity of phage displaying a truncated pII1 is carried out by linking back the missmg part of the pII1 Based on this, Duenas and Borrebaeck (41) developed an approach for the selection of specific phage-displaying peptldes According to then approach, a phagemid expression library of antibodies is constructed by tailoring the genes coding for the
Structure of Fhmenfous
Phage
733
antibody repertoire to the S-end of a truncated pII1 gene Expressing the library in E. colz containing helper phage that does not produce pII1 results m the release of noninfective virions that display the antibody library. When an antigen, coupled to the missmg domam of the truncated ~111, is added to these virions, infectivity is restored only to those displaying the specific antibodies. A similar approach was apphed for cDNA selection (33). pVI is the only coat protein that exposes its carboxy termmal end to the surroundmg medium (8). So far, pVI was used for displaying a cDNA expression library (42)
4. Prospective The enormous length of the filamentous phage affects the bmdmg properties of the displayed peptides and is responsible for its high nonspecific bmding to various matrices. In addition, due to the enormous molecular weight of the phage, the molar concentration of the displayed peptide is too low for the induction of biological activity and detection in most cases. The filamentous phage can be shortened to a particle containmg a DNA of 221 bp coated with 95 copies of pVII1 (mimphage) (10). Though we are mcapable of generating single peptides that are carrying their own coding genes, a construction of miniphage peptide libraries that are selected according to the Duenas and Borrebaeck approach is probably the next step forward
Acknowledgments I would like to thank Judith Heldman for her help m the preparation chapter and to the Rash1 foundation for their financial support
of this
References 1. Day, L. A., Marzec, C J , Relsberg, S. A., and Casadevall, A (1988) DNA packaging in ftlamentous bacteriophages Annu. Rev Brophys. Blophys. Chem. 17,509-539 2 Glucksman, M. J., BhattacharJee, S , and Makowskl, L. (1992) Three-dimentional structure of a clonmg vector, X-ray diffraction studies of filamentous bactertophage Ml3 at 7 8, resolution J. Mol. Blol. 226,455-470 3. Model, P. and Russel, M (1988) The Bacterzophage, vol 2 (Calender, R , ed ), Plenum, New York 4 Lopez, J. and Webster, R. E (1983) Morphogenests of filamentous bacteriophage fl: Onentatton of extruston and production of polyphage Vzrology 127,177-193 5 Russel, M. (1991) Filamentous phage assembly Mol. Mzcrobzol. 5, 1607-1613 6 Slmons, G F M , Veeneman, G H., Konmgs, R N H , Van Boom, J. H , and Schoenmakers, J G. G. (I 98 1) Gene IV, gene VII and gene IX of phage M 13 code for minor capstd proteins of the vu-ton. Proc. Natl. Acad Scz. USA 78, 4194-4198
134
Cablily
7 Makowskr, L ( 1992) Terminating a macromolecular helix, Structural model for the minor proteins of bactertophage Ml 3. J. MoZ Blol. 228,885-898 8 Makowskt, L (1993) Structural constramts on the display of foreign pepttdes on ftlamentous bacteriophage Gene 128,5-l 1 9 Specthrre, L , Bullttt, E , Hormcht, K., Model, P , Russel, M , and Makowskt, L (1992) Constructton of mtcrophage vartant of ftlamentous bacteriophage J Mol. Blol 228,720-124 IO Kazmterczak, B. I , Mtelke, D L , Russel, M , and Model, P. (1994) pIV, a ftlamentous phage protein that medtates phage export across the bacterial cell envelope, forms a multtmer J. Mol. Bzol 238, 187-198 11 Russel, M (1993) Protein-protein mteactions durmg ftlamentous phage assembly J Mol.Biol. 231,689-697 12 Armstrong, J , Perham, R N , and Walker, J E (1981) Domain structure of bacteriophage fd adsorptron protein FEBS Let? 135, 167-172 13 Stengele, I., Bross, P., Graces, X , Gtray, J., and Rasched,I Dtssectton of funtional domains m phage Fd adsorptton protein J. Mol Blol. 212, 143-149 14 Bradbury, A and Cattaneo, A. (1995) The useof phage display m neurobrology Trends Neurosci 18,243-249 15 Smtth, G. P (1985) Ftlamentous fusion phage. novel expression vectors that dtsplayed cloned antigens on the vtrton surface. Sczence228,1315-1317. 16. Parmley, S F and Smith, G P. (1988) Anttbody-selectable ftlamentous fd phage vectors affunty purtftcatton of target genes Gene 73,305-3 18 17 de la Cruz, V.F , Laa, A A , and McCutchan, T F (1988) Immungemctty and epttope mapping foreign sequencesvia a genetically engineered ftlamentous phage J. Blol. Chem. 263,43 18-4322. 18. Scott, J K and Smith, G. P. (1990) Searching for pepttde bgands with an epttope library. Science 249,386-390 19 Devlm, J J , Pangamban,L C , and Devlin, P E (1990) Random peptrde ltbrartes: A source of spectftc protein bmdmg molecules Science 249,404-406 20 Cwtrla, S. E., Peters, E A , Barrett, R W , and Dower, W. J (1990) Pepttdes of phage. A vast library of pepttdes for identifying ltgads Proc. Nat1 Acad Scl. USA 87,6378-6382 2 1 Barbas, III, C. F , Kang, A. S., Lerner, R. A., and Benkovic, S. J (199 1) Assembly of combinatorral antibody ltbrartes on phage surfaces The gene III sue. Proc, Nat1 Acad Sci USA 88,7978-7982 22 Ntsstm, A., Hoogenboom, H R., Tomlmson, I. M., Flynn, G , Mrdgley, C , Lane, D., and Winter, G. (1994) Antibody fragments from a ‘single pot’ phage display library as immunochemical reagents. EMBO J. 13,692-698 23 Gram, H , Strutmatter, U , Lorenz, M , Gluck, D , and Zenke, G. (1993) Phage display asa rapid geneexpressionsystem: productton of btoacttve cytokme-phage and generation of neutraltzmg monoclonal antibodies J Immunol. Methods 161, 169-176
Structure of F//amen tous Phage
135
24. Robertson, M. W. (1993) Phage and Escherzchia ~021 expression of the human htgh affinity immunoglobulm E receptor a-subumt ectodomain 1. BloZ. Chem. 268,12,736-12,743 25, Scarselli, E., Esposito, G., and Trabom. C. (1993) Receptor phage. Display of functional domams of the human high affimty IgE receptor on the M 13 phage surface. FEBS Lett. 329,223-226. 26 Swimmer, C., Lehar, S M , McCafferty, J., Chiswell, D J , Blattler, W A , Guild, B C. (1992) Phage display of ncm B chain and its smgle bmdmg domams system for screening galactose-bindmg mutants Proc. Natl. Acad. Scz. USA 89,3756-3760. 27 Pannekoek, H., van MeiJer, M., Schleef, R R , Loskutoff, D. J , and Barbas, C F III. (1993) Functional display of human plasmmogen-activator inhibitor 1 (PAI1) on phages. novel perspectives for structure-function analysis by error-prone DNA synthesis. Gene 128,135-140. 28 Roberts, B L , Markland, W., Ley, A C., Kent, R. B., White, D. W., Guterman, S. K., and Ladner, R. C (1992) Directed evolution of a protein: selection of potent neutrophil elastase inhibitors displayed on Ml3 fusion phage Proc. Nat1 Acad. Sci USA 89,2429-2433. 29 Rebar, E J and Pabo, C 0 (1994) Zinc finger phage affinity selection of fingers with new DNA-binding specificities Science 263,67 l-673, 30 McCafferty, J , Jackson, R. H., and Chiswell, D J (1991) Phage enzymes: expression and affnuty chromatography of functional alkaline phosphatase on the surface of bacteriophage. Protein Eng. 4,955-961 31 Corey, D. R., Shiau, A. K , Yang, Q., Janowski, B. A., and Craik, C S. (1993) Trypsm display on the surface of bacteriophage Gene 128,129-134 32 Crameri, R. and Suter, M (1993) Display of biologically active proteins on the surface of filamentous phages: a cDNA cloning system for selection of functional gene products linked to the genetic mformation responsible for their production Gene 137,69-75. 33 Gramatikoff, K., Georgiev, 0 , and Schaffner, W. (1994) Direct mteraction rescue, a novel filamentous phage technique to study protein-protein mteractions Nucletc Acids Res 22,5761-5762. 34 Felci, F. (1991) Selection of antibody hgands from a large library oligopeptides expressed on a multivalent exposition vector. J. lMol Bzol. 222,30 l-3 10 35 Greenwood, J , Willis, A E., and Perham, R. N. (1991) Multiple display of foreign peptides on a filamentous bacteriophage J. Mol. Biol. 220,821-827 36. Smith, P G. (1993) Surface display and peptide libraries Gene 128,1,2. 37 Lowman, H. B., Bass, S H., Simpson, N., and Wells, J A. (1991) Selectmg highaffinity binding proteins by monovalent phage display Biochemutry 30, 10,832-10,838. 38 Kang, A S., Barbas, C F , Janda, K D , Benkovic, S J , and Lerner, R A (1991) Linkage of recognmon and replication functions by assembling combmatorial antibody Fab libraries along phage surface. Proc Nat1 Acad. Scl USA 88,4363-4366
136
Cab/l/y
39 Bass, S., Greene, R , and Wells, .I. A (1990) Hormone phage* An enrichment method for variant protems wtth altered bmdmg properties Protems: Struct. Funct. Genet. 8,309-3 14. 40. Lowman, H. B and Wells, J A (1993) Affmlty maturation of human growth hormone by monovalent phage drsplay J. Mol. Bzol 234,564-578 41 Duenas, M. and Borrebaeck, C A. K (1994) Clonal selection and ampltftcatron of phage displayed anttbodtes by lmkmg antigen recognmon and phage repllcatton Biotechnology 12,999-1002 42 Jespers, L S , Messens, J H., De Keyser, A., Eeckhout, D., Van Den Brande, I , Gansemans, Y. G , Lauwereys, M J , Vlasuk, G. P., and Stanssens, P E (1995) Surface expresston and ltgand-based selectton of cDNA fused to filamentous phage gene VI. Biotechnology 13,378-382
16 Construction and Use of a 20-mer Phage Display Epitope Library Baruch Stern and Jonathan
M. Gershoni
1. Introduction Epitope libraries provide an extremely efficient means for epitope mapping and the development of novel diagnostic markers. Filamentous phage fd-tet expression systems have been developed in order to construct such libraries contaming tens to hundreds of mlllions of random peptlde sequences that can be screened for their abihty to bind particular antibodies (I). In essence these phage-expressed peptides mimic the determmants of the antigen that are recognized by the antibodies. The fUSE5 vector derived from phage fd-tet can be propagated m plasmid form in media containmg tetracycline; it does not kill its host nor depend on continual infection for its propagation (2). We have used the method described below to construct several epitope libraries, clonmg a 60-nucleotide-long random sequence (correspondmg to a 20-amino acid random sequence) into the pII1 gene of phage fd-tet, fUSE5 vector. PI11 is a minor coat protein essential for phage infectivity. It is located at the tailing end of the phage and is generally more flexible and exposed than most other regions of the phage. This enables it to not only tolerate epitope insertions but also make the various epitopes accessible for recognition (for a detailed description see ref. 3) The libraries generated in our laboratory have proven to be an excellent source for peptides. Our hbraries, each containing 5 x lo* individual clones, represent only a fraction of the full complexity of 20-mer epitopes (ca. 10z6 combinations). Nonetheless, the total diversity and representation of the shorter peptides (because of the overlapping sequences) 1sincreased many fold. Thus, for example, each 20-mer clone consists of 15 overlappmg 6-mers, 14 overlapFrom
Methods
m Molecular Bfology, vol 87 Combmatonal Peptrde Edlted by S Cablily 0 Humana Press Inc , Totowa,
137
Library NJ
Protocols
138
Stern and Gershoni
pmg 7-mers, 13 overlapping 8-mers, and so forth. Therefore, in a library made up of lo8 clones the entire repertoire of 6- and 7-mer epitopes can be well represented (6 4 x lo7 and 1.3 x lo9 combinations, respectively), and longer peptides are represented also but to ever decreasing degrees In addition, the fact that the shorter sequences are flanked by randomly variant residues is another advantage since this increases the chance of achieving optimal binding conformations. A 20-mer hbrary might also allow presentation of discontinuous secondary and possibly tertiary conformation-dependent eprtopes. Finally, we have found that by using this library and analyzing varieties of phages that bind a specific MAb one can also learn much of the molecular requirements for epitope recognition. 2. Materials In all the procedures listed we recommend using either molecular biology grade or analytical grade reagents and generally all stocks should be kept sterile until use. 2.7. Library
Consfrucfion
1 DNA purification solutions (solutions I and II should be prepared fresh)* a Solution I. 25% (w/v) glucose, 50 mM Trts-HCl, pH 8 0, 10 mM EDTA (ethylenedtammetetraacetic acid), pH 8 0 b. Solution II 0 2 M NaOH, 1% (w/v) SDS. c Solutton III* 60 mL 5 M potassmm acetate, 1 I 5 mL glacial acetic acid, 28 5
mL HZ0 Store at 4°C and use cold. 2 Super broth 32 g Bacto-tryptone, 20 g yeast extract, 5 0 g NaCl Dissolve m 1 L water and adjust to pH 7 5 with NaOH Autoclave 3 Lysozyme (Sigma, St Louts, MO). 4 TE buffer 10 mA4Tris-HCI, pH 8.0, 1 rniW EDTA pH 8.0 5 Isopropanol 6. Cesmm chlortde 7 Ethidmm bromide solution. 10 mg/mL m water 8 Agarose (SeaKem GTG) 9. EDTA stock solution. 0 5 M, pH 8 0 m water, adjusted with NaOH 10 Trts-HCI buffer 1 M, pH 8 0, adjusted with concentrated HCI 11 3 OM Sodium acetate (NaOAc), pH 5 2, adjusted with glacial acetic acid. 12 Tetracychne. 20 mg/mL m water and stertltzed by filtration. 13 PhenoUTE phenol equilibrated with TE buffer, ensure that the pH >7 4 (7) 14 Chloroform/I chIoroform/tsoamylalcohol(24~ 1) 15 Phenol/Chloroform eqmhbrate phenol/TE with an equal volume of chloroform/I. 16 Restrictton enzyme S&I is supplied with 10X restnctton buffer and 100X bovme serum albumin (BSA) (New England Btolabs, Beverly, MA). 17 Synthetic oltgonucleotide 5’-end labeling ktt (#K009) (Fermantas Molecular Biology Instruments, Vtlmus, Lithuania) or alternative
ZO-mer Phage Display Epltope Library
739
18. Olrgonucleotrdes. ON93(5’GAGCCAGTGCATCA(NNK),sTCGCTAACAGG TGGGTCTG3’) ON16(5’ ACCCACCTGTTAGCGA3’) ON17(5’ TGATGCACTGGCTCCGT3’) 19. T4 DNA lrgase (#202S) (New England Brolabs) 20. Glycerol solutron: 10% glycerol (w/v) m water 2 1. HEPES (N-2-hydroxyethylprperazme-IV’-2-ethane sulfomc acrd): 100 mM, pH 7 0 stock solutron 22, LB broth 10 g/L Bacto-tryptone, 5 g/L yeast extract, and 10 g/L NaCl Drssolve in 1 L water and adJust the pH to 7 0 with NaOH Autoclave 23, LA agar plates add 20 g Bacto agar to 1 L of LB broth 24 SOB media* 20 g Bacto-tryptone, 5 g yeast extract, 0 58 g NaCl, 0.19 g KCl. Drssolve m 1 L water, divrde mto lOO-mL portions, and autoclave Add 1 mL of 2M Mg2+ solution (1 M MgCl,, 1 M MgS04, in water, filter sterilized) to each bottle 25. SOC medra. add to each SOB bottle (100 mL), 1 mL of autoclaved 2M glucose (store at room temperature) 26 0.2-cm Electropotatron cuvets. 27 Electroporator. gene pulser (#1652078), pulse controller (# 1652098), capacitance extender (#1652087) (Bio-Rad Laboratories, Hercules, CA) 28. PEG/NaCl* 33% (w/v) polyethelene glycol 8000/3 3M NaCl m water and autoclaved. 29. Tris-buffered salme (TBS): 50 mM Trrs-HCI, pH 7 5, 150 mM NaCl 30. 2X TY medium 16 g/L Bacto-tryptone, 10 g/L yeast extract, and 5 g/L NaCl drssolved m water and autoclaved. 3 1. Kanamycm. 50 mg/mL m water and sterrlrzed by ftltratron. 32 Terrific broth 12 g Bacto-tryptone, 24 g yeast extract, and 4 mL (5.04 g) glycerol are dissolved in 900 mL water and added to 100 mL of separately autoclaved potassium phosphate buffer (0 17 M KH2P04, 0 72 M K2HP04, pH 7.8). 33. TBS/azide* TBS supplemented with 0 02% (w/v) NaN, 34 LA/Kane LA plates supplemented wrth kanamycm (50 pg/mL) 35 LAltet. LA plates supplemented with tetracycline (20 ug/mL) 36 Conical polypropylene 15-mL (120 x 17-mm) screw-cap test tubes (Sarstedt, Numbrecht, Germany), # 62 553 042 PS) 37 14-mL Polypropylene (17 x loo-mm), round-bottom test tubes with cap (Falcon, Becton Dickmson, Lmcoln Park, NJ, #2059). 38. Quick-seal centrifuge tubes* 16 x 76-mm (Beckman Instruments, Palo Alto, CA, #3424 13) 39 50-mL hinge-cap tubes (Kontron, Switzerland, #900370).
2.2. Biopanning 1 AffmiPure rabbit antimouse IgG, Fc fragment-specific antibody (Jackson ImmunoResearch Laboratories, West Grove, PA).
(RbaMIgFc)
140
Stern and Gershoni
2. Elutton buffer 0 1M HCl, pH adJusted to 2 2 with glycme, and 1 mg/mL BSA added The solution is filter sterrlrzed and stored at 4°C 3. Bovme serum albumin (BSA) fraction V* 50 mg/mL is dissolved m TBS and stored at -20°C. 4 Blockmg solution: 0 25% (w/v) gelatm dissolved m TBS 5 Neutralizing solution: 1M Tris-HCl, pH 9 1. 6 LAlKan as described m Subheading 2.1., item 35. 7 6-well cluster plate (Costar, Cambridge, MA, #3506)
2.3. Phage Selection 1 Nitrocellulose membranes. NC 45, cellulose nitrate (E), 0.45 km (Schlercher and Schuell, Dassel, Germany, #40 1- 169) 2 MllhBlot-S system (MilliPore Corporation, Bedford, MA, #MBBDS0480) 3 Evaporated milk: spray-dried skim milk, 1 5% fat (Marvel, Birmingham, England) or alternative. 4 HRP-goat antimouse whole IgG (GtaMIgHRP) (Jackson ImmunoResearch Laboratories) 5 TMB membrane peroxrdase substrate system (Kirkegaard and Perry Laboratories, Gaithersburg, MD) 6. ECL rmmunodetectlon (Amersham International, Buckmghamshire, UK) 7 100 x 16-mm Round-bottom screw-cap tube (Bibby Sterilm, Stone, England, #142AS). 8. U-bottom sterile 96-well plates (Cornmg Glass Works, Corning, NY, # 25850) 9 Flat-bottomed 96-well plates (Corning Glass Works, # 25860).
2.4. Sequencing 1 Ollgonucleotide primer 5’-CCCTCATAGTTAGCGTAACG-3’ for sequencing 2 30% Acrylamlde solution 28 5% (w/v) acrylamide, 1.5% (w/v) NjV’ methylene his-acrylamide. Solution is stored m the dark at 4°C. 3 Sequencmggel 38 x 50 cm apparatus(Blo-Rad Laboratories). 4 X-ray Btomax MR 2 film (Eastman Kodak Company, Rochester, NY) 5 Wizard Ml3 DNA purification system (Promega, Madison, WI) 6. DNA sequencmgkit (#70770), Sequenaseversion 2 0 (United States Biochemical, Cleveland, OH).
2.5. Bacterial Strains and Bacteriophage E. coli K802: E co11MC1061.
F-el4-(mcrA-)
Vectors
galK2 galT22 m&B1 A(lac)6 or LacYI supE44 hsdr2 mcrA, rfbDl mcrB1 hsdR2 (rk - mk+) (5). F araD139 A(ara-leu)7696 AlacX74 galVgalKhsdR2 (rk-mk+) mcrB1 rpsL (Stf) (6).
ZO-mer Phage Display Eprtope Library E. coEi K91Kan:
fUSE5 Vector
141
A h- derivative of K-38; it is Hfr Cavalli and has chromosomal genotype thi. It has the “mini-Kan hopper” element, a kanamycin-resistant transposon without its own transposase gene, inserted in the 1acZ gene (3). A kmd gift from George Smith.
3. Methods 3.1. Constructing the Library Our epitope libraries were constructed m the fUSE5 vector. This is a derivative of the fd-tet phage that contams a frame shift mutation introduced mto the gene III cloning site, resulting in a defective protein and the production of noninfectious particles. Restormg the reading frame is accomplished by clonmg synthetic oligonucleotides of the correct size into gene III (3). Much of the following protocol is based on that developed by George Smith (University of Missouri). We constructed our library using a 93-base oligonucleotide containing a 60-nucleotide degenerate sequence flanked by two nondegenerate sequences. Two additional short oligonucleotide sequences were designed to base pair with the nondegenerate flanking regions and create sticky overhangs complementary to the vector. After the three ohgonucleotides were annealed, they were ligated with fUSE5 and transformed mto an E. coli strain (“fill m” of the gap is not necessary, however, is possible as $2 leaves a 3’ overhang). 3.1.1. fUSE5 Vector Preparation Constructmg epitope libraries requires tens of micrograms of purified fUSE5 vector. Unfortunately, when attempting to prepare fUSE5 using two different commercially available kits for large-scale preparation of plasmid DNA, extremely low yields of vector are obtained with a hrgh degree of chromosomal DNA contamination. We found that our best yields of fUSE5 were obtained by combining a method for the large-scale purification of cosmid DNA (8) with the method for purification of closed circular DNA by equilibrium centrifugation in CsCl-ethidium bromide gradients (4). 1. Inoculate a colony of E. colz KS02 containing the fUSE5 vector m a 2-L flask contammg 500 mL of super broth, supplemented with 20 pg/mL tetracyclme. Grow overnight at 37°C with vrgorous shaking. 2 Pellet the cells at 5,OOOg for 10 min (4°C). Resuspend the pellet in 20 mL of cold solutton I; the pellet can be manually disrupted with a pipet. Makmg sure there are no bacterial aggregates left, add some lysozyme crystals (approx 3-5 mg), mix carefully, and leave for 10 mm at room temperature (see Note 1)
Stern and Gershoni 3. Add 60 mL of solutton II and mix Immediately by swu-lmg (do not shake vlgorously). Chill for 10 min on ice The solution will become VISCOUSand a yellowish aggregate of cellular debris may form 4 Qmckly add 45 mL Ice-cold solutzon III, mix immediately as m step 3, and return the bottle to the me for an additional 30 mm 5 Centrzfuge at 4000g for 15 mm at 4”C, (Sorvall GSA rotor) Carefully decant the clear supernatant through a few layers of gauze mto a clean bottle, avotdmg the transfer of the pellet and debris Recentrifuge the supernatant (15 mm at 4000g at 4°C) and collect the cleared supernatant Measure the volume of the supernatant and add 0 6 vol zsopropanol to zt Invert the bottle several times to mix and mcubate on ice for 30 mm. Centrifuge at 6OOOg for 20 mm at 4°C to pellet the preczprtate, which is heavy and pellets easily Dram the supernatant and resuspend the pellet m TE (see Note 2). 6 When a Beckman 65 rotor 1s used, resuspend each DNA pellet m 4 mL of TE, and pool the DNA m a 50-mL hinge-cap tube. Suppose the volume of DNA solutzon measures y mL Add 0.1~ mL of ethldmm bromide solutzon and 1 ly g of CsCl (the volume will Increase by 25-30%) Mix to dissolve the CsCl, and place tube m the dark for 30 mm, during which a precipitate wzll form. Spm the tube at 6000g for 5 mm at 20-25°C (the debris may either float or sink) Carefully transfer only the clear reddish solutzon mto Quick-seal test tubes In order to completely fill the tubes use a comparable TE + CsCl + ethzdmm bromide solutzon (i.e., without DNA) Seal the tubes, place them m the rotor and centrifuge at 176,OOOg for 48 h at 20°C. 7 At the end of the run remove the tube and illuminate with a long-wavelength UV lamp (~320 nm), two bands should become visible Insert an 18-gage, 1 5-m needle into the upper part of the tube (to let au m) Connect a second 21-gauge, 1.5-m needle to a 1 0- or 3 0-mL syringe (verify that the plunger of each syringe 1s operating smoothly before inserting zt mto the tube) and insert zt slrghtly below the lower band Slowly draw off the lower band, avoiding the upper band. Position the tube above a disposable beaker and disconnect the syringe from the needle. Transfer the DNA mto a comcal 15-mL screw-cap tube. Measure the volume and mark its level on the surface of the test tube. Add 1 5 mL tsopropanol per 1.O mL CsClIDNA solution, vortex at medium speed for 10 s, and allow the phases to separate. Remove the upper, pmk phase Add TE to the mark mdzcatmg the orzgmal volume, and repeat extraction of ethzdmm bromide three addztzonal times until the lower phase becomes colorless, each time adding TE as necessary (see Note 3) Use a plpet to measure the volume and transfer the solution to a 15mL polypropylene, round-bottom tube with a cap Add 2.5 vol fresh TE per mL, mix, and then add 2 vol ethanol (e g , 3 5 mL of DNA solution + 7 0 mL ethanol) Vortex and incubate the tube at -20°C for at least 1 h. Centrifuge at 15,OOOg for 20 mm (Sorvall SS34 rotor), decant all of the ethanol, and resuspend the DNA pellet m 300 pL of TE DNA concentration can be determined by electrophoreszs on an agarose gel and tztratlon of the sample comparmg twofold dzlutzons against a hHzndII1 standard Dispense 270 PL TE containing 30 pg of fUSE5
20-mer Phage D/splay Epltope Library
143
into Eppendorf tubes, add 30 pL NaOAc + 600 pL ethanol, mix, and store at -20°C DNA will remain stable for at least 2 yr 8. Each alquot can be used for the productton of a library For this, pellet the 30 pg of vector, resuspend in water, and proceed to S’I digestion
3.1.2. SfiI Digestion of fUSE5 fUSE5 is a directronal clonrng vector having two 5”zI sites .3’) with different overhanging 3-base 3’ ends (5’ . I . GGCCNNNNNGGCC.. Inserts are spliced into this vector after a 14-bp stuffer 1s removed by @I cleav-
age (3). 1 Reaction mix (total volume 300 p.L)+ 50 pL fUSE 5 (30 pg) 3 0 pL BSA (100X) 30 pL restriction buffer 10X 15 pL S’I (150 U) 202 pL Hz0 (sterihzed by autoclave and filtered) 2. To mix, flick the tube several times, microfuge briefly, and incubate the reaction at 50°C for 2 h (overnight may improve the digestion efficiency) (see Notes 4 and 5). 3. Add to the reaction mix 3 pL of 0 5 M EDTA and 197 /.tL Hz0 Vortex briefly and extract once with phenol/TE and once with chloroform/I 4 Increase the volume of the DNA solution to 8 10 pL with TE. Add 90 nL NaOAc and 540 uL isopropanol, and mix by mvertmg the tube several trmes. Incubate on ice for 20 mm. 5. Microfuge for 20 mm and discard the supernatant, Recentrifuge the pellet for an addrtional minute, and using a drawn Pasteur prpet (or gel-loading tip), carefully remove all remaining traces of isopropanol (see Note 6) 6 Add 1.O mL of cold 70% ethanol and mix by inversion of the tube several times Microfuge for 5 mm and discard the ethanol Microfuge the pellet for an addttional minute, and remove all the remaining traces of ethanol as m step 5 7. Dissolve the pellet m 450 pL TE, add 50 pL of NaOAc and 1.O mL ethanol, mix by inversion, and chill on ice for at least 1 h. 8 Microfuge for 20 mm, wash the pellet (as m steps5 and 6), and dissolve it m 120 pL of TE (see Note 7)
3.1.3. Preparmg Annealed Ohgonucleotides
and Ligation
The use of 3 oligonucleotrdes 1s based on the approach of Cwirla et al (9). The oligonucleotide ON93 (see Subheading 2.1., item 19) used for the construction of the libraries contamed degenerate sequences according to the formula: NNKx20 (N consrstmg of a mixture of eqmmolar amounts of G, A, T, and C, and K of equimolar amounts of G and T). The two additional half-site
Stern and Gershom
144
oligonucleotides were ON 16 and ON 17. Thus, the amino acid sequence corresponding to the conserved regions was: G A S A S (20-a a Insert) S L T G G S A mixture was prepared of the three ollgonucleotides that were annealed, and was ligated with S’I cleaved fUSE5. This resulted in circularized DNA molecules surroundmg a single-stranded gap (correspondmg to a 60-nucleotide-long degenerate sequence). 3 1.3.1
PHOSPHORYLATION
1. The three ohgonucleotlde can be phosphorylated usmg a synthetic oligonucleotlde S-end labeling kit according to the manufacturers instructions (Fermantas Molecular Biology Instruments), carrying out several 50-pmol reactlons slmultaneously for each of the ohgonucleotldes Followmg heat mactivatlon of the enzyme no further steps are taken to purify the ollgonucleotldes and these are subsequently stored at -20°C. 3.1.3.2.
ANNEALING REACTION
1. Reactlon Mix (total volume 25 pL) I 0 pL ON93 (2.5 pmole) 2.5 I.IL ON16 (6 25 pmole) 2.5 FL ON17 (6.25 pmole) 5 .O pL 5X reactlon buffer (from DNA sequencing kit) 14pL Hz0 Anneal by heatmg m a heating-block for 10 mm at 68”C, remove the block from its holder, and let the tubes cool m an ice water bath, begin preparing the llgatlon reaction 3.1 3.3. LIGATION 1 a Reaction mix 12 p.L SfiI digested fUSE5 (3 0 pg) 25 pL total annealed ollgonucleotlde mix 142 yL H20. Heat the tube for 5 mm at 43°C and equilibrate the tube for 1 mm m a 16°C water bath b. Add 20 pL hgatlon buffer 10X 1 0 pL T4 DNA llgase (400 U) Mix gently by flicking the tube several times, mlcrofuge briefly, and incubate the llgatlon reaction at 16°C overnight (see Notes 8 and 9) 2 The next day add 160 PL H20. 40 yL NaOAc
ZO-mer fhage D/splay Epltope Library
3. 4
5. 6
145
800 yL ethanol Mix and Incubate 2 h at -20°C Microfuge 20 min, and remove the ethanol. Add 1.0 mL of cold 70% ethanol, mix by mvertmg the tube several times, and centrifuge for 5 mm. Discard the ethanol, microfuge 1 mm, and using a drawn Pasteur pipet remove all traces of the ethanol Resuspend the pellet m 10 pL of TE. Pool the legations before electroporation.
3.1.4. Preparing Electrocompe ten t Cells This procedure
is as described
m
ref. 7.
Day 1: 1. Dispense 500 mL super broth to each of two 2-L flasks and autoclave Prewarm to 37°C. 2. Inoculate 2.5 mL of LB with a smgle colony of E. colz MC1061 Grow m a 37°C shaker incubator overmght with vigorous aeratton. 3. Prepare, autoclave, and precool m refrigerator: 100 mL glycerol solution 15LoflmMHEPES(pH7.0). 4 Prechill sterilized 50-mL hmge-capcentrifuge tubes and all centrifugation bottles 5 Precool Sorvall SS34 and GS3 rotors (or their equivalents) Day 2: 1. Inoculate each flask containing 500 mL of prewarmed super broth with 1 mL of the overnight culture from d 1. Grow with vigorous aeration to an OD6s0of 0.6-0.7. Chill the flasks for 15 min in a large pan of ice water. From here on, everything is done in the cold. 2 Pour the culture mto precooled GS3 centrifuge bottles, centrifuge at 5000g for 15 mm at 4°C 3 Decant the supernatant, and using a Pasteurptpet remove all traces of the growth medium 4. Add to each bottle 500 mL of me-cold 1 mMHEPES and swirl the bottles untrl the pellet has been resuspended.Collect the cells as m steps 2 and 3. 5 Add to the cells m both bottles a total of 500 mL ice-cold 1 mM HEPES. Swirl the bottles until the pellet has been resuspendedand pool the cells mto a single bottle. Collect the cells as m steps 2 and 3. 6 Add 20 mL of an ice-cold glycerol solution Swirl the bottle until the pellet has been resuspendedand transfer the cells to a prechilled sterile hinge-cap centrtfuge tube. 7 Centrifuge the cells at 5000g for 15 mm at 4°C m a SS34 rotor 8 Repeat step 3
146
Stern and Gershom
9 Add 1.2 mL of ice-cold glycerol solution Swu-I the tube until the pellet has been resuspended Typically the volume will be approx 2 0 mL (if a smaller volume IS obtained add glycerol solution)
3.7.5. Nectroporation
(Day 1).
1. a. Prewarm to 37°C two 2-L flasks each containing 700 mL of LB b Precool on ice. 0 2-cm electroporatlon cuvets, the cuvet holder, and 40 Eppendorf tubes (1 5 mL). Place the chamber on a sheet of plastic m a contamer filled with ice. c Set the electroporator at 2 5 kV, 25 pF, and 400 fi d Set up a rack with 36 15mL tubes, each contammg 2 mL SOC that has been supplemented with 0 2 pg/mL tetracyclme Prewarm to 37°C. Prepare a supply of sterile glass S-inch Pasteur pipets, dropper bulbs, and two plpets suited for 2 5-FL and 50-60-pL volumes (see Note 10) 2 Place 50 pL of electrocompetent cells in an Ice-cold Eppendorf tube Add 2 5 pL of the llgatlon product (typlcally a quarter of the llgatlon), gently flick the tube five times, and return to the ice for 1 mm MeanwhIle remove a cuvet from the ice, put the dropper bulb on one of the Pasteur plpets, open one of the tubes of SOC, put the plpet m, and draw up some of the SOC (leave the cap of the tube face up on the bench) 3 Plpet the DNA/cell mixture directly into the bottom of one of the Ice-cold cuvets Tap the cuvet bottom several times on the bench to brmg the cells to the bottom, put the cuvet m the shde holder, and “zap” with the electroporator. 4 Quickly remove the cuvet from the holder, Immediately adding the prewarmed SOW0 2 pg/mL tet medrum to the cuvet MIX the solution by plpetatlon three times using a Pasteur plpet and transfer the cells to the open test tube. Replace the tube cap and vigorously shake it m a shaker incubator for 1 h at 37°C (phenotypic expression see Note 11) 5. To obtain a 5 x 10s library, the electroporatlon should be repeated 36 times, 1.e , 36 x 50-yL allquots Additionally, we recommend doing a final electroporatlon with 2 5 PL of the self-ligated DNA. 6 Followmg the phenotyplc expression period, remove a mlmmal sample from two or three test tubes to determine the titer of the library Split the 36 electroporatlons mto two groups of 18 test tubes and transfer the content of each group into one of the two 2-L flasks contaimng 700 mL of (prewarmed to 37’C) LB broth that has been supplemented with 20 pg/mL tetracycline Vigorously shake the flasks m a 37°C shaker incubator for 14-16 h 7. Determination of the hbrary titer: prepare four IO-fold dilutions of the minimal samples taken m the previous step into SOC medium. Carefully spot three 3-yL dots of each dilution on LAltet and allow the dots to dry Place the plates m a 37°C mcubator overnight and count the colomes on d 2. Most often there appear S- to lo-fold more colonies of the recombmants m relation to the electroporatlon
20-mer Phage Display Epltope Library
147
of self-ltgated vector. Smgle colomes will be visible on the 10-3-dtlutton spots indicating that there are approx IO* recombmant clones m the library.
3.1.6. Phage Purification (Days 2-4) Day 2: 1 The day after the electroporations, transfer the contents of the flasks to centrifuge bottles (Sorvall GS3 rotor or tts equivalent) and centrifuge at 6000g for 20 mm at 4OC 2. Transfer the supernatant to clean bottles and centrifuge them at 10,OOOg for 20 mm at 4°C in a GS3 rotor 3. Avordmg the small bacterial pellet, pour the cleared supernatant mto a graduated cylinder, note the volume, and transfer mto a 2-L flask that contams a sterile spur bar. Place the flask on a magnettc stirrer. 4. While sttrrmg, add 0.4 vol PEG/NaCl solutton to the phage solutton (1 L phage solution + 400 mL PEG/NaCl), star for 5 mm ((the solution will turn sbghtly turbid) Remove the flask and store at 4°C overnight Day 3: 1 Swirl the contents of the flask several times and divide tt mto several 50-mL hinge-cap tubes. Centrifuge the tubes m a Sorvall SS34 rotor (or its equivalent) at 27,OOOg for 20 mm at 4’C (we recommend using two centrifuges and ftllmg each tube twice wtth the phage + PEG/NaCl solution). Decant the supernatant, carefully avotdmg the phage pellet, and resuspend the pellet m 3 mL of TBS/aztde. For best results resuspend the phage pellets at 4°C for several h or overnight (see
Note 12). 2. Pool the resuspended phages from 8 tubes mto a single tube, centrifuge at 6000g for 5 mm at 4”C, and transfer the cleared supernatant to a clean tube. The tubes may be rinsed with an addtttonal 6 mL TBS/aztde making a total volume of 30 mL Add to that 15 mL PEG/NaCl, mix by inversion several times, and store the tube at 4’C overnight Day 4:
Centrifuge the tubes at 27,000g for 20 mm at 4°C. Discard the supernatant and resuspend the pellet m 2 mL of TBWazide.
3.1.7. Library Ampl/fica t/on Day 1: Prepare: a Two 2-L flasks with 500 mL of prewarmed with 50 pg/mL kanamycin
2X TY medium Supplement each
148
Stern and Gershom b Inoculate 5 mL of LB contammg 100 pg/mL kanamycm to prepare a “starter culture ” Shake overnight at 37°C
with K91Kan cells
Day 2: Here tlmmg 1s of the essence. One must prepare a stock of bacteria to be infected and a second culture of bacterta to be used later for amplification. 1 a. Inoculate
10 mL of prewarmed
terrtftc broth wtth
100 yL of the overnight
“starter culture” (K9 1Kan) and vigorously shake in a shaker incubator at 37°C b. After 60 mm inoculate the two flasks contammg 500 mL prewarmed 2X TY wrth 500 uL of the overnight “starter culture” and grow at 37°C with vigorous shaking 2 When the IO-mL culture gets quite turbid (after approx 2.5 h), start reading the OD,,, of l/10 dtlutton using a spectrophotometer When the OD 600 of a l/l0 dilution reaches 0 2, stop shakmg the flasks and allow the sheared F-pm to regenerate for 15 mm 3 Add the resuspended phages (see Subheading 3.1.6., d 4) to the IO-mL culture, allow 15 mm at room temperature for adsorption, and inoculate each large flask with half the bacterta/phage mixture Grow at 37°C for 6 h with vigorous shaking
(see Note 13) 4 To purify the ampltfted ltbrary repeat phage purtflcatton steps (Subheading 3.1.6.), only resuspend the phage pellet obtamed m the end m 7 mL TBS/aztde
(rather than 2) Transfer the library to a 15-mL screw-cap tube and store at 4’C The titer of the amplified library should be 1013-1014 phages/mL (see Note 14)
3.2. Biopanning Screening the bacteriophage library by the method known as biopanning is the crucial step in locating the epltope of an antibody. A simple and efficient method was devised for screening the vast mrxtures of randomly expressed pepttdes, enabling us to specifically identify binding phages following a single round of affinity purification. We carried out our biopannmg in three steps The first step is adsorption of an antimouse IgG, Fc fragment-specific antibody to a polystyrene well. The second step 1s the addition of the specific MAb to the anti-Fc-coated well, the MAb binding through its Fc fragment and leaving the Fab free to bind bacteriophages. The final step is addmg the library to the immobrlized immunocomplex. When panning we generally use an aliquot of the library contaming approx lOI’ phages. Nonbinding bacteriophages are removed by repeated washes and those phages binding to the MAbs are then eluted and tested. 3 2.1. P/ate Coa tmg Procedure 1 Ptpet 700 PL of TBS contammg 35 1.18of RbaMIgFc onto the bottom of a 35-mm ttssue culture 6-well cluster plate Place the plate m a humidified box at 4°C overnight on a rocker
20-mer Phage Display Epltope Lrbrary 2 The next day discard the excess solutton and immediately add the blockmg solution, completely ftllmg the wells. Incubate the plate for 2 h at room temperature 3 Wash the dish rapidly five times using TBS Fill each well halfway, swirl the liquid m the plate, and pour the contents mto a smk Slap the plate face-down on a clean piece of paper towel to remove residual fluid. Add to each well 700 pL of TBS/O 025% gelatm contammg 10 pg of a specific MAb, and put the plate m a humrdrfted box, rock the plate gently at room temperature for 4 h.
3.2.2. Affinity Selection 1. Wash the coated plates rapidly SIX times with TBS, each time slapping the plate face-down on a clean piece of paper towel Add 700 pL of TBS contammg IO” infectious particles Put the plates m a humidified box and incubate the box at 4°C overnight, shaking gently on a rocker 2 The next day remove the solutton containing the phages using a plpet and wash the plate rapidly 10 times m TBS (as described nbove) To elute the spectfically bound phages, add 400 pL elutton buffer and shake gently on a rocker for 10 mm at room temperature to dtssociate the immunocomplexed MAblphage and/or MAb/antl-Fc fragment annbodies (in either case the phage will retam its mfectivity) (see Note 15) 3. Transfer the solution containing the phages mto an Eppendorf tube contammg 75 pL of neutralizing solutton (see Note 15) 4 To improve the yield of phages, steps 2-3 can be repeated, dtsregard the washing step 5 Pool both phage soluttons
3.2.3. Multiple Rounds of Biopannmg The method that has been described above involves a single step of biopanning. This in many cases will detect numerous phages capable of reacting with a specific antibody wrth various affinities However, to find the phages with the highest affinities, a second and third round of panning are recommended. When carrying out more than a single round of biopanning, one must also be aware that a library can contain phages that for no obvious reason are able to multiply much faster than the rest, thereby enabling them to dominate in a liquid cell culture We were able to overcome this problem in the following manner 1 Amplify the phages after a round of btopanmng by platmg the phages at a density of 2-3 x lo4 on a 90-mm LA plate (tttratton and platmg of phages were done as described m Subheading 3.3.1.) 2 Remove the large plaques with the end of a Pasteur plpet 3 Collect the soft agarose layer by scraping tt off the bottom nutrient layer using a mtcroscope slide Pulvertze the collected agarose by injecting It through an 18-gage, 1.5-m needle connected to a IO-mL syringe directly mto a 50-mL
150
4 5 6
7
8 9.
Stern and Gershom hinge-cap test tube contammg 20 mL TBS Wash the syringe wtth an addmonal 10 mL TBS. Seal the closed tube with a layer of Parafrlm to ensure that tt accidentally does not open, and place rt horizontally on a rocker at 4°C overnight Centrifuge at 6000g for 20 mm at 4°C. Carefully collect the supernatant and prectpttate the phages with 0.4 vol PEG/NaCl solutron Mix well and incubate on ice 4 h . Centrtfuge m a SS34 rotor at 27 ,OOOgfor 20 mm at 4°C Discard the supernatant carefully mamtammg the mtegrtty of the pellet. Resuspend the pellet in 5 mL TBS/azide If several plates are used phages can be pooled at this stage Centrifuge at 5OOOg for 5 mm at 4’C and transfer the cleared supernatant to a clean tube. Add 0 4 vol PEG/NaCl, mix by mvertmg several times, and place at 4°C for 4 h or overmght. Centrtfuge at 27,OOOg for 20 mm at 4°C. Dtscard the supernatant and resuspend the pellet m 1 mL of TBS/aztde For the next round of panning (as described prevtously) use 25% of the phage solutron and store the rest (4’C) for future use
3.3. Phage Selection We generally plate the phages at a maximal density of 400 bacteriophages/ plate and pick 100 or more plaques, which are then propagated individually, purified and concentrated, and transferred to a nitrocellulose membrane. Sub-
sequently, the membrane is probed with the appropriate antibody enabling us to detect phages that bind to the specific antibody being tested. Selecting phages after a single round of panning usually generates a drversity of epitopes that bind the MAb with various affrmties. Through consecuttve rounds of biopanning and amplification, posittve phages can be selected and enriched Carrying out three or more rounds of biopanning will generally select the phages that have the strongest affinity to the antibody. This might be a single phage type or sometimes a few.
3.3.1. P/a ting Bacterrophages 1. Determine the titer of phages from the first round of selectton tn the followmg manner. a. Inoculate 2 5 mL of LB with a single colony of E. co/i K91Kan. Grow m a 37°C shaker incubator and vigorously shake overnight b. Prepare 0.5% agarose dissolved m water (brmg to a boll and cool to 50°C) In a 100 x 16-mm round-bottom screw-cap tube put 200 l.tL of the overnight culture and 3 5 mL of the agarose Roll the test tube brrefly between both hands and qutckly pour its contents onto a prewarmed LAlKan plate Prepare three lo-fold dtluttons of the phages and once the plates have dried spot three 3 l.tL drops of each dtlutton on the plate After the drops dry, incubate the plates at 37°C overnight, by which time tiny turbid plaques will become VIStble. Calculate the ttter of the phages.
20-mer Phage Display Epltope Library
151
2. Prepare an overmght culture as described in step la. Inoculate 10 mL of prewarmed terrific broth in a 125 mL flask with 200 pL of the cells, and vigorously shake at 37°C. When the IO-mL culture becomes quite turbtd (after approx 2.5 h), start reading the ODhOs of l/10 dtlutions. When the OD 600of a l/10 dtlutton reaches 0.2, stop shaking the flask and allow the sheared F-pili to regenerate for 15 mm 3 To plate the phages remove and place the cap of a 100 x 16-mm round-bottom screw-cap tube on the bench facing upward and lean the tube on the cap almost horrzontally Lay 200 pL of the cells 1 cm from the tube openmg and add to the drop of cells a phage solution containing 300-500 phages (about 20-10 pL) Raise the tube to a vertical posmon and the drop will slide to the bottom of the tube. Replace the cap and incubate for 15 mm at room temperature Plate as described above, step lb
3.3.2. Propagating Single Plaques 1. Inoculate 2.5 mL of LB with a single colony of E. coli K91 Kan. Vtgorously shake m a 37°C shaker incubator overnight. 2 The next day fill a U-bottom sterile 96-well plate with 200 pL of terrific broth containing a loo-fold dilution of the E. colz K91Kan overnight culture. Stab single plaques using sterile toothpicks and transfer them to the wells of the plate. Secure the plates m a humidified box and shake overnight gently, to avoid crosscontammatton of wells, 37°C (see Note 16). 3. Centrifuge the plates at 15OOg for 20 mm at room temperature and transfer m a sterile manner (avoiding the bacterial pellet) 125 pL of the supernatant to a flatbottomed 96-well plate already contaming 50 pL of PEG/NaCl solution. Trtturate the solution m the tip several times, mixing well Incubate the plates at 4°C for 2 h and save the angina1 plates containing the bacterial pellet The latter will be used as master plates and should be sealed with parafilm and stored at 4’C. 4 Centrifuge the plates at 15OOg for 20 mm at room temperature. To remove the bulk of the fluid invert the plate mto a biohazard bag, collectmg the waste for disposal. The residual fluid IS removed by slapping the plate gently face-down on several layers of paper towels. Then resuspend the pellet in a total of 100 yL TBS
3.3.3. Probing the Phages 1 Prepare mtrocellulose membrane blots by applying 8OyL aliquots from each well to a MilliBlot-S system usmg a vacuum transfer system. 2. Block membranes m TBS/lO% evaporated milk solutton by rocking them for 1 h at room temperature. 3. After a brief wash m TBS, incubate the membrane in TBS/l% evaporated milk contaimng 1 pg/mL antibody at 4”C, overnight, with gentle rocking. 4 Wash the membrane five times for 5 mm each in TBS Add TBS/ 1% evaporated milk containing GtaMIgHRP (use correct dllutlon according to manufacturers’ recommendation) and incubate it for 1 h at room temperature, with gentle rockmg.
Stern and Gershom 5 Wash the membrane five times for 5 mm each m TBS 6 The positive stgnals can be detected either by the TMB membrane peroxidase substrate system or by ECL tmmunodetection
3.4. DNA Sequencing I 2
3 4
5
Inoculate 2 5 mL of LB supplemented with 50 pg/mL kanamycm with a single colony of E. colz K91 Kan cells, and grow m a 37°C shaker incubator overnight For sequencing 16 phages,maculate 40 mL of terrific broth with 400 pL of the above overnight culture, mix, and dispense2 5-mL ahquots mto sixteen 100 x 16-mm round-bottom screw-cap tubes. Using sterile toothpicks inoculate each tube with the phage that 1sto be sequencedand grow for 6 h m a 37°C shaker incubator For preparation of ssDNA from the phageswe recommendthe Promega Wizard M I3 DNA Purtficatton System To determine the sequenceof the random peptide-encoding segment,the smglestranded phage DNA was sequencedusing a specific antisenseoligonucleotide primer (see Subheading 2.4., item 1). It is also recommendedthat the sequencmg reactions be set up accordmg to the protocol supplied by the Sequenaseversion 2.0 DNA sequencingkit. For clear resolutton of the required sequenceswe recommend a 6% sequencing gel 38 x 50-cm run at 1800 V for approx 2.5-3 0 h The gel IS then dried and exposed to X-ray Btomax MR 2 film for up to 48 h
4. Notes 1 Preparation of fUSE5 vector from frozen bacterial pellets was found to be very mefftctent Thus all plasmid preps were performed on fresh bacteria 2 Yields of fUSE5 plasmid were at times as low as lo-20 pg/500 mL from an overnight culture grown m super broth Therefore, we advise storing the DNA of single large preparations m NaOAc/ethanol at -20°C while several more large preps are produced To obtain clearly vtstble bands m the CsCl gradients, we generally place m each ultracentrtfuge tube the equivalent of two or three large preparations. 3. In the event that the phasesdisappearadd a few gramsof CsCl and mix This ~111 causephasesto separateonce more. 4. At times fUSE5 DNA samplesseemedto undergo degradation rather quickly when kept under standardconditions Therefore along with the S’I digestion we recommend preparing a control of the DNA samplewtthout the enzyme (with all other reagentspresent). 5. After digestion 1scompleted, run the followmg on a 0.8% agarosegel a sample from digested DNA, a sample of undigested DNA, and a marker (we use hHzndII1) 6 The 14-bp stuffer ISremoved by tsopropanolpreclpltation That is why one should take special care to remove all traces of the supernatant and subsequent70% ethanol wash solutton.
ZO-mer Phage Display Epltope Library
153
7. At ttmes the pellet can be difficult to resuspend When this occurs the DNA solution can be warmed to 42°C for 30 mm to help dtssolve the DNA. 8. An ice bucket filled with water precooled to 16°C can be used. The ligation mixes are placed in a Styroform float m the water and the bucket IS placed covered at 4°C overmght 9 To obtain a 5 x lo8 library, nine ltgattons are carried out, while a l/10 reaction IS a self-ltgatron control contammg a mix of fUSE5 vector, ON16, and ON17 10 Emprrically we found that 2.5 pL of the bgatton reactron (0 75 pg covalently close-gapped fUSE5) produce IO7 transformants m the following protocol 11 The low levels of tetracyclme are not enough to affect sensitive cells but are enough to induce expression of the tetracyclme-resistance gene on the fUSE5 vector. Therefore, successfully electroporated cells will be ready to be challenged by a high concentratron of tetracycline following the phenotyptc expressron period 12 We also tried centrrfugmg the phages using either the Sorvall GSA or GS3 rotors at 10,000 and 8OOOg, respectively, for 50 mm However, using both those rotors reduced our yield of phages to 10% of the total phages, while 90% remained m the supernatant 13 We do not amplify the library for longer periods of time, since some ltbrartes contain phages that replicate at extremely fast rates, which enables them to quickly dominate the culture These phages contain inserts of the correct size They were discovered when an aliquot of the library was plated on LA/Kan and a few plaques became visible after 3 h of mcubatron, rncreasmg m stze after an overnight mcubatton The other plaques on the other hand were much smaller and were barely visible even followmg an overmght mcubatton 14 In an effort to test the diversity of our library, mdtvidual clones were prcked at random and sequenced A varrety of sequences were obtamed, almost all contammg a 60-nucleottde-long insert. However, shorter sequences were also found, though to a much lesser degree These sequences exrst because the 93-base-long oligonucleottde contammg the degenerate sequences had not been purified from a gel before clonmg Therefore, smce factors affectmg clonmg depend exclusively on compatible sticky ends and msertton m the correct reading frame, a recombmant mfectrous particle encoding sequences anywhere between 0 and 20 ammo acids could be formed regardless of the length of the degenerate sequence 15 Check the pH of both the elutton buffer (pH 2 2) and the neutraltzmg solutron (pH 9.1) before use The mixture of the two comes out pH 7 O-8 5. One can use pH indicator paper for this test 16 Plaques will be tmy and extremely drfftcult to see When prckmg the isolated plaques we found tt easiest to hold the plate up to the light m order to see them clearly
References I Parmley, S F and Smith, G P (1988) Antibody selectable ftlamentous fd phage vectors affunty purrfrcatron of target genes Gene 73,305-3 18.
154
Stern and Gershonr
2. Scott, J K. and Smith, G P (1990) Searchmg for peptide ligands with an epitope library Science 249,386-390 3 Smith, G. P and Scott, J K (1993) Libraries of pepttdes and proteins displayed on filamentous phage Methods Enzymol. 217,228-257. 4. Sambrook, J , Frttsch, E. F , and Maniatts, T (1989) Molecular Clonmg: A Laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Sprmg Harbor, NY 5 Raleigh, E A and Wilson, G (1986) Escherichuz colz K-12 restricts DNA contaming 5-methylcytosme Proc. Natl. Acad. Scl. USA 83,9070-9074. 6 Huynh, T V., Young, R. A , and Davis, R W (1985) Constructmg and screemng cDNA librartes m agtl0 and hgtll m DNA Clonmg, vol. I (Glover, D M , ed ), IRL Press, Oxford, England, pp 56-110. 7. Smith, G P. (1992) Cloning zn j7JSE Vectors (edition of February 10, 1992), A Laboratory Manual. University of Missouri, Columbia, MO 8 Little, P F. R (1987) Choice and use of cosmid vectors m DNA Clonmg, vol III (Glover, D. M., ed.), IRL, Oxford, pp. 19-42 9 Cwu-la, S E , Peters, E A., Barret, R W , and Dower, W J. (1990) Peptides on phages a vast library of peptides for tdentifymg bgands Proc. Natl. Acad. Scz. USA 87,6378-6382
17 Construction of Disulfide-Constrained Random Peptide Libraries Displayed on Phage Coat Protein VIII Alessandra
Luzzago and Franc0 Felici
1. Introduction Proteins III and VIII of filamentous phage coat (I) have been reported as suitable for the construction of phage-displayed peptide libraries (2-4). Protein VIII (pVII1) is the major coat protein, present m approx 2700 copies per phage particle, and its amino-terminus tolerates insertions of up to six amino acids (5-7). Larger peptide inserts can be displayed only when a two-gene system is used (6,8), thus obtaining hybrid phage particles containing both recombinant and wild-type proteins. The high copy number of recombinant pVII1 molecules per phage particle provides a highly sensitive system, and linear and constrained peptide libraries in pVII1 have been successfully used for the selection of specific hgands for several different monoclonal and polyclonal antibodies (9). Constrained random peptide libraries, in which the number of possible conformations that a linear peptide can assume is limited, could lead to the selection of binders with increased affinity. Using invariant cysteme residues flanking the randomized inserts is a simple way of accomplishing such a constraint. The presence of disulfide bonds in the recombinant proteins can be verified when pVII1 is used as molecular vector, since the wild-type pVII1 sequence does not contain any cysteine residue (JO). The protocol that follows describes the construction of a cystemeconstrained random nonapeptide library in pVII1, using the pC89 phagemid vector (8), which contains gene VIII under the control of the IPTG-inducible LAC promoter. From
Methods
M Molecular Edlted
by
Bo/ogy, S CablIly
vol 87 Combmatord 0 Humana
155
Press
Peptide
Inc , Totowa.
Ltbrary NJ
Protocols
Luzzago
156
and Felice
2. Materials
2.1. Preparation
of Oligonucleotide
Inserts
1 Template ollgonucleotlde 5’ GCTTTTGCTGGATCCCCGCA(N),,GCAGAA TTCACCCTCAGCAG 3’ 2 Pruner ohgonucleotlde. 5’ CTGCTGAGGGTGAATTCTGC 3’ 3 5X SOH buffer. 200 mM Tns-HCI, pH 7.5,50 mM MgCl*, 250 mM NaCl 4. dNTPs (Pharmacla, Uppsala, Sweden) 5 Klenow subunit of DNA polymerase I, 5 U/pL (Boehrmger, Mannhelm, Germany) 6 NuSleve GTG agarose (FMC BloProducts, Rockland, ME). 7 5X TBE buffer: 0 45 M Tns-borate, 0 0 1 M EDTA 8 9 U/pL BumHI (Boehrmger Mannhelm). 9 10 U&L EcoRI (Boehrmger Mannheim). 10 11
12 13
14 15 16 17 18. 19
RestrIction
enzyme
2.2. Preparation I 2 3 4. 5. 6
buffer B (Boehrmger
Mannhelm)
10 mCl/mL [a-32P]-dATP (-3000 Wmmol, Amersham, Little Chalfont, UK) Restriction enzyme buffer M (Boehrmger Mannhelm) 30% Acrylamldeibls-acrylamlde stock mix prepare by dlssolvmg 29 g of acrylamlde (Sigma), I g N,N’-methylene-bls-acrylamlde (Sigma, St Louis, MO) in water, final volume 100 mL 10% Ammomum persulfate (Sigma), prepared m water and stored at 4°C TEMED (Sigma) Gel-loading buffer* 0 25% bromophenol blue (Sigma), 0 25% xylene cyan01 FF (Sigma), 30% glycerol in water TE: 10 mMTns-HCl, pH 7 4, 1 mMEDTA, pH 8.0 Mlllex 0 22-ym filters (Mllllpore, Bedford, MA) Sephadex G50 (Pharmacla)
of Recipient
Vector
10 pg pC89 Vector DNA (8) 9 UlpL BumHI (Boehrmger Mannhelm) 10 U&L EcoRI (Boehringer Mannhetm). Restriction enzyme buffer B (Boehrmger Mannhelm). DNA molecular weight marker III (Boehrmger Mannhelm). Gene Clean II kit (BIO 101, La Jolla, CA)
2.3. Ligation 1 Purified inserts and vector 2. 1 U/pL T4 DNA hgase, with supplied buffer (Boehrmger Mannhelm) 3 Gene Clean II kit (BIO 101)
2.4. Preparation
of Competent
Cells and Electrotransformation
1 Bacterial strain XLl-blue (Stratagene, La Jolla, CA) 2 LB Medium. prepared by dlssolvmg 10 g of Bacto-tryptone, 5 g of Bacto-yeast extract and 10 g of NaCl in water, adjustmg the pH to 7.0 with 5N NaOH and adJustingthe volume to 1 L with water Sterlllze by autoclavmg
Dwlfide-Constrained
Peptide
157
Libraries
3. Amptcillm stock solution* 50 mg/mL m 50% ethanol stored at -20°C 4 Ampicdlm LB agar plates (150 mm) contammg 1% glucose and 50 pg/mL Ampicillm. 5. Tetracyclme, stock solution 20 mg/mL m 50% glycerol stored at -20°C m hghttight containers 6 Tet LB agar plates (90 mm) contammg 20 pg/mL tetracycline. 7 Glycerol (Ultrapure, BRL, Gaithersburg, MD) 8. 0.2-cm Gene pulser cuvets (Bio-Rad, Hercules, CA). 9 Gene pulser apparatus (Bio-Rad) 10 , SOC medium* 2% Bacto-tryptone, 0.5% Bacto-yeast extract, 10 mM NaCl, 2.5 mM KCl, 10 mM MgCl,, 10 mM MgS04, 20 mM glucose 1 I IPTG stock solution 30 mg/mL m water, stored at -20°C 12. X-gal stock solutton. 30 mg/mL m dimethylformamide, stored at -20°C. 13. LB agar plates (90 mm) containing 50 pg/mL Ampiclllm, 40 pg/mL IPTG, and 40 pg/mL X-gal
2.5. Library Amplification
and Titration
1 2 3 4 5 6. 7. 8
LB medium contammg 50 pg/mL Ampicilhn Glycerol (Ultrapure BRL). M 13K07 helper phage (Pharmacia) PEGINaCl: 20% PEG 8000,2 5M NaCl. TBS/NaNs. 50 mMTris-HCl, pH 7 5,150 mM NaCl, 0 02% NaNs Cesmm chloride (Sigma-Aldrich, Steinheim, Germany) Bacterial strain’ XL1 -blue (Stratagene), Terrific broth* 12 g of Bacto-tryptone, 24 g of Bacto-yeast extract, and 4 mL of glycerol m 900 mL of distilled water Autoclave on liquid cycle. Allow to cool to 6O’C and then add 100 mL of a sterile solution of 0 17M KH2P04, 0 72M K2HP0, 9 LB agar plates containing Ampicrllm, IPTG, and X-gal (Subheading 2.4.)
2.6. Identification 1. 2. 3 4 5 6 7. 8
of Disulfide
Bonds in pVll/-Displayed
Peptides
2 x 10” Ampictllm Transducing Units (TU) of Cesmm chloride-purified phage. Myoglobm molecular weight marker (Sigma) Stock acrylamide: 49% acrylamide, 0.5% NAN’-methylene-his-acrylamide. Stock buffer: 3 MTris-HCl, pH 8 3. Glycerol TEMED Ammomum persulfate (25%) Cathode buffer. 17 9 g Tricme (Sigma), 12 1 g Tris base, 1 g SDS, water to a final volume of 1 L. 9 Anode buffer. 0 3 M Tris-HCl, pH 8 3 10 2X Sample buffer. 2 mL 10% SDS, 2 mL 50% glycerol, 170 pL lMTris-HCl, pH 8 0,630 pL H20, 200 yL 2% bromophenol blue.
158
Luzzago and Felice
11 Blotting buffer 14.4 g glycme, 3 g Trts base, 200 mL methanol, water to a final volume of 1 L 12 Immobilon PVDF Transfer Membrane (Mrlhpore) 13 Genie electrophorettc blotter apparatus (IDEA Screntrftc Company, Corvahs, OR) 14 2-Mercaptoethanol 15 50 m&f Potassium-phosphate buffer, pH 8.5. 16. DIG protem detection kit (Boehrmger Mannhelm)
3. Methods 3.1. Preparation
of Oligonucleo
tide inserts
1 Ohgonucleotrde annealing mix 200 pmol of each ohgonucleotlde, primer, and template with 40 pL of SOH buffer and add water to a final volume of 200 pL. Heat at 65°C for 5 mm and then leave 5 mm at room temperature. Perform the annealing, m trtphcate, m Eppendorf tubes 2 Synthesize double-stranded ohgonucleotrdes by adding to each tube 40 pL of dNTPs (2.5 mM concentratton of each deoxynucleotide) and 10 pL of Klenow Incubate for 2 h at 37’C (see Note 1). 3 Run 10 pL of the reaction mixture on a 4% NuSleve agarose gel m 0 5X TBE buffer m parallel with 10 pmol of single-stranded template ohgonucleotide A difference m mtgration between the two samples should be clearly visible 4 Collect together the three samples and make one phenol, one phenol/chloroform, and one chloroform extractlon, followed by three ether extractions (II) Dry the sample in a speed-vacuum apparatus 5 Resuspend the pellet m water, add 50 pL of restrictton enzyme buffer B, 200 U of EcoRI and 200 U of BamHI m a final volume of 500 pL Incubate at 37°C for 7-8 h 6 Make one phenol, one phenol/chloroform, and one chloroform extraction, followed by three ether extractions Dry the sample m speed-vacuum and resuspend the pellet m 100 pL of water. 7 Take 1 pL of the digested mserts and mix with 6 pL of restriction enzyme buffer M, 1 pL of 32P-labeled dATP, 1 pL of 10 mMdGTP, 28 pL of water, and 1 pL of Klenow, and incubate 30 mm at room temperature. 8 Prepare a 0 5-mm thtck, 25-cm long 20% nondenaturmg polyacrylamtde gel m 1X TBE by mixmg 33 3 mL of acrylamide stock, 10 mL of TBE 5X, 6 35 mL of water, 350 pL of 10% ammomum persulfate, and 35 pL of TEMED 9 Load the digestion product, diluted 1 1 with 50% glycerol, m a large central slot, add 8 pL of gel-loading buffer to the radiolabeled Insert, and load mto two slots at both srdes of the central one (1.5 pL each) Run at 150 V at 4°C until the fast blue is close to the end of the gel (it will take more than 12 h) 10 Wrap the gel m Saran Wrap and expose to X-ray film for 1 h wtth an mtenstfymg screen.
Disulf/de-Constrained
Peptide Llbranes
759
11 Using a scalpel, excise the piece of polyacrylamide contammg the doubledigested fragment, which can be identified through the two flankmg radloactlve bands (see Note Z), break mto small pieces, and transfer to a tube 12. Add enough TE to cover the acrylamide fragments and shake it overnight at room temperature 13 Filter through 0 22-pm Mlllex filter and concentrate m speed-vacuum to reach a final volume of 100 PL 14 Plug a plastic 2-mL prpet with a little cotton or glass wool. Fdl the plpet with swollen G50 up to 0.5 cm from the top, avoiding the formation of air bubbles. Wash the column with 5 mL of water 15. Add the sample to the top of the column and let it be absorbed Add 200 pL of water and let it be absorbed. 16 Add water and collect 250~pL ahquots (approx 6 drops). The double-stranded Insert should elute m fractions 3-6 (see Note 3). 17. Collect the fractions, dry m the speed-vacuum, and resuspend m 50 FL of water Run 5 pL on a 4% agarose gel prepared as described m step 3
3.2. Preparation
of Recipient
Vector
1 Mix 10 pg of pC89 vector with 40 U of EcaRI, 40 U of BarnHI, 20 yL of buffer B, and water to a final volume of 200 FL Incubate for 5 h at 37°C (see Note 4) 2 Load 10 pL of the digestion mixture on a 1% agarose gel m parallel with pC89 undigested vector and a DNA molecular weight marker. The digested product should appear as a single band of approx 3500 bp 3 Purify the digested vector with Gene Clean II kit, according to the manufacturer’s instructlons, and resuspend m water m a final volume of 50 pL
3.3. Ligation 1 Set up a pilot experiment by combmmg 100 ng of digested vector and the purlfied fragment at different ratios (for example, try 1X, 2X, 5X molar excess of the insert), m a total volume of 20 FL, containing 2 pL of IOX ligation buffer and I pL of T4 hgase. As a control also make a hgatlon with all the components except the DNA Insert. Incubate overnight at 15°C 2 Run the ligated mixtures on a 1% agarose gel, next to 100 ng of linearized vector (see Note 5) 3, Set up the ligation by scaling up 10 times the chosen condltlon components 4. Desalt and purify the ligation product using Gene Clean II kit, according to the manufacturer’s instructions, and resuspend m water m a final volume of 50 pL
3.4. Preparation
of Competent
Cells and Electroporation
1. Streak XLl-blue bacteria on Tet LB agar plates and grow overmght at 37°C 2 Inoculate a smgle colony m 10 mL of LB contaimng 20 ,ug/mL of tetracycline, and grow overnight at 37°C
160
Luzzago
and Fehci
3. Transfer the overmght culture in 1 L of LB and grow, with vigorous shaking, at 37°C untrl the culture reaches an OD6s0 of 0.5-O 8. Use big flasks (for example, 3-5 L) to allow the culture to aerate. 4. Chdl the flask m Ice for 10 mm and centrifuge m a cold rotor at 4000g for 15 mm All the subsequent steps should be performed keeping the bacterial pellet m me and using me-cold water (see Note 6) 5. Resuspend the pellet m lo-20 mL of water by vigorous pipetmg and then add water to a total volume of 1 L and centrifuge as above 6. Resuspend the pellet as m step 5 and then add water, up to a final volume of 0 5 L Centrifuge as above 7 Resuspend the pellet m 30 mL of 10% me-cold glycerol and centrifuge 8 Resuspend the pellet m 10% glycerol m a fmal volume of 5 mL, freeze m alrquots m lrqmd nitrogen, and store at -80°C (see Note 7). 9 Distribute 1-5 PL ahquots of the ltgatlon product m 20 Eppendorf tubes and keep on me Chill the cuvets m ice 10 Thaw competent cells m ice and distribute 50 yL mto the DNA-contammg Eppendorf tubes 11 Set the Gene Pulser apparatus at 2 5 kV, 25 I.LF and the Pulse Controller Unit at 200 &2 12. Transfer the cells-DNA mixture to an me-cold cuvet, insert m the apparatus, and apply one pulse 13 Add immediately 1 mL of SOC medium mto the cuvet and transfer the cell suspension to a 250-mL flask 14 Repeat the electroporatton for all the remammg samples, collecting them altogether in the flask. Incubate at 37°C with agitation for 1 h 15 Make an appropriate ddutron of the cell suspension (for example, 1.1000) and plate aliquots (10, 30, 100,300 pL) on Amp-Xgal-IPTG plates (see Note 8) 16 Plate the undduted cell suspension m an appropriate number (to obtain 5 x 1055 x lo6 colonies per plate) of Amp LB agar plates (150 mm) and incubate overmght at 37°C
3.5. Library Amplification
and Titration
1. Collect the bacteria by scraping the colonies, add LB containing 50 wg/mL Amp and 10% glycerol (approximately 10 mL for each plate), and pool altogether 2 Dilute an ahquot of cell suspension in 2 L of LB, containmg 50 pg/mL Amp, to reach an ODeoa of 0 05. Incubate at 37°C with vigorous shaking until the OD6ao 1s between 0.2 and 0 3 (approx 2-3 h) Store the remaining cell suspension in ahquots at -80°C (see Note 9) 3 Infect the culture with Ml 3K07 helper phage (multiplicity of mfection=20) and add IPTG (800 PL of the stock solution per L of culture) Grow with vigorous shaking at 37°C for 5 h. 4 Centnfuge the culture m a Sorvall at 8600g for 30 mm and recover the supernatant 5 Add to the supernatant 500 mL of PEG/NaCl, mix, and incubate overnight at 4°C
D/sulfide-Constrained
Peptide L/brat-/es
761
6 Centrtfuge m Sorvall at 4°C (8600g) for 1 h, eliminate the supernatant, and resuspend the phage-contammg pellet m 20 mL of TBS/NaN, Transfer the phage suspension mto a polycarbonate tube. 7 Incubate the phage suspension in a water bath at 70°C for 1 h, cool in ice for 5 mitt, and then centrifuge for 1 h m Sorvall at 17,500g to eliminate cell debris 8 Collect the supernatant mto a new tube, add 5 mL of PEG/NaN,, and Incubate at 4°C for 2 h. 9 Centrifuge m Sorvall for 30 mm at 17,500g to pellet the phage 10. Resuspend the pellet m 20 mL of TBS/NaN, (see Note 10). 1 I. Add 9 g of CsCl to the phage suspension and transfer mto two SW40 polyallomer tubes F111the tubes with lsototuc TBS/CsCl solutton, equilibrate the tubes, and centrifuge at 208,OOOg for 48 h at 19°C Stop without using the brake. 12. Collect the phage band (top band) with a syrmge and transfer to a polycarbonate tube, fill the tube with TBS, and centrifuge at 220,OOOg for 4 h at 4°C m a 70 TI rotor. 13 Discard the supernatant and resuspend the pellet m 1 mL of TBS/NaN,. 14 Inoculate XLl-blue cells m 10 mL of terriftc broth and incubate at 37°C with vigorous agitation until a 1 10 dtlutton of the culture reaches an OD,,, of 0 15 15 Titrate the phage by making appropriate dtluttons of the amphfred hbrary m TBS/ NaN, and mrx 10 yL of each dilution with 200 pL of cells 16. Incubate for 15 mm at 37°C without agitation and 30 mm at 37°C with vigorous shaking 17. Spread on Amp-Xgal-IPTG plates and incubate overnight at 37°C
3.6. Identification
of Disulfide
Bonds in p W-Displayed
Peptides
1 Prepare a 0.5-mm thick, 20-cm long Trtcme gel (see Note 11) with the followmg composmon running gel contammg 4 2 mL glycerol, 3 3 mL H,O, 7 5 mL stock buffer (see Subheading 2.4., item 4), 7 5 mL acrylamlde stock (16 3% final), 200 /.tL ammonmm persulfate (25%), and 20 pL TEMED, stacking gel contammg 1 mL acrylamtde stock, 6 4 mL HzO, 100 pL ammomum persulfate (25%), and 10 pL TEMED 2. Prepare phage samples m duplicate by mtxmg 1 x 10” TU with 10 uL of sample buffer m a final volume of 20 pL Boll samples for 2 mm and load onto the gel. Load 20 pL of molecular weight marker reconstituted as described by the manufacturer Fill the upper chamber with cathode buffer and the lower chamber with anode buffer and run the gel overnight at 130-140 V until the blue 1s at a 3-cm distance from the bottom end of the gel. 3 After electrophoresis, transfer the proteins onto Immobtlon Membrane by using a Genie apparatus, according to the manufacturer’s mstructton (see Note 12) 4 Cut the membrane m two parts and incubate one piece m 2% (v/v) 2-mercaptoethanol in potassium-phosphate buffer. Detect free SH groups on both pieces using the DIG protein-detection kit, according to the manufacturer’s mstructton (see Note 13)
Luzzago and Fehci 4. Notes 1 In our expertence, for this purpose Klenow works more efficiently than polymerase-chain reactron (PCR) and m this way, overampltfrcation of particular classes of ohgonucleotide templates IS mmimized 2 Quite often it is also possible to visualize the digested products by puttmg the gel on a thin-layer chromatography sheet with a fluorescent marker and illummatmg with a UV lamp (300-nm wavelength) The digested products usually run lust above the xylene cyan01 dye 3. It 1s possible to monitor the elutton by exctsmg part of the radioacttve band from the polyacrylamtde gel, and testing the fracttons through measuring 32P content with a beta counter 4 It 1s Important to obtam a complete double-digested vector DNA, m order to avoid recncularization of the plasmid m the hgation step This can be checked by performmg m parallel the EcoRI and BamHI digestions separately, checkmg that they are complete 5 In the control ligation reaction, only unhgated linear vector should be visualized, while m the others a reasonable amount of ctrculartzed DNA should be present 6 The protocol descrtbed 1s essentially that reported by Dower et al (12) It is important to use high-quality water to wash the cells We have also found an increase of the transformation efficiency by using (when possible) new flasks and new centrifuge tubes, which were washed once with distilled water and then sterilized by autoclavmg. 7 The preparation of competent cells with a high efficiency of transformation is extremely important for constructmg a high complexity library. Generally, following the method described here, we have obtained an average efficiency of lo9 transformants/yg of supercoiled pC89 vector DNA, using XLl-blue bacterial strain Competent cells should be tested for thetr efftctency of transformatton using supercoiled pC89 vector DNA at vartous concentrations. A pilot transformation with the ltgatton product IS also necessary to determine how much hgation mixture should be used in each electroporation and the number of electroporation rounds necessary to obtain a high-complextty library. 8. Titration on Amp-Xgal-IPTG plates allows assessment of the total number of recombinant clones and the percentage of blue colonies that contain productive inserts pC89 phagemid vector contains an m-frame fusion of the pVII1 gene to the a-peptide of E colz P-galactosidase, then codmg sequences being separated by an amber stop codon (8) XLl-blue 1s a suppressor strain, thus the expression of pVIII-a-peptide fusion protems results m correspondmg blue colonies on Xgal-IPTG mdtcator plates. After the overnight mcubatton, plates can be left for a few hours at 4”C, to better visuahze the blue color 9 Library amplification can thus be performed again at any time, starting from the frozen cell suspension. 10 Cesmm chloride purifrcatton descrtbed m the subsequent steps IS necessary when a single selected phage has to be assayed for the presence of dlsulftde bonds m the recombmant pVII1 proteins For ltbrary preparation, an alternatrve to cesmm
Dmdfide-Constrained
Peptide Libraries
763
chloride gradient is to repeat steps 7 and 8, finally resuspendmg the phage pellet m 1 mL of TBS/NaN, In both cases the library can be stored at -80°C, m ahquots contammg 7% DMSO 11 Phage electrophoresis through Tricme gel allows separation of recombinant pVII1 protein from wild-type pVII1 The method is a modified version of the original protocol (13)) accordmg to R Perham (personal commumcation), 12. Any other protem-transfer apparatus is also suitable. Note that pVII1 is a small and quite hydrophobic protein and its retention by the membrane can represent a problem We have found that Immobilon has the highest pVIII-binding capabtlity among several different kinds of membranes that we have tested (mtrocellulose, nylon, etc ) Before using Immobilon for protein blot, wet the membrane m methanol for a few seconds, then immerse m water and fmally m blotting buffer: do not allow the membrane to dry until protems have been transferred onto it. 13 It should be possible to visualize m the reduced membrane a band correspondmg to recombinant pVIII, smated at approximately the level of the 6 3 kDa band of the marker. No visible correspondmg band m the nonreduced counterpart will mdicate that the peptide inserts of a specific phage clone are Indeed constrained by disulfide bonds
Acknowledgments We thank Janet Clench for lingulstlc
revlslon of the manuscript.
References 1 Model, P and Russel, M (1988) Filamentous bacteriophage, m The Bacteriophages 2 (Calendar, R , ed.), Plenum Press,New York, pp 375-456 2. Scott, J. K and Smith, G P. (1990) Searching for peptide hgands with an epitope library. Science 249,386-390 3 Winter, J (1994) Bactertophage display Pepttde libraries and drug discovery. Drug Dev Res 33,71-89 4 Fehci, F , Luzzago, A , Monaco, P., Nicosia, A , Sollazzo, M., and Trabom, C. (1995) Peptide and protein display on the surface of filamentous bacteriophage, m Biotechnology Annual Revzew,vol. 1 (El-Gewely, R , ed ), Elsevier Science B V , Amsterdam, pp. 149-183 5 Ilyichev,A. A ,Minenkova,O O.,Tat’kov, S. I ,Karpyshev,N N ,Eroshkm, A M., Petrenko, V A., and Sandachshiev,L S (1989) Production of a viable variant of the Ml3 phage with a foreign peptide inserted mto the basic coat protein Dokl. Acad. Nauk. USSR307,481-483 6 Greenwood, J , Wilhs, A. E , and Perham, R. N. (1991) Multiple dtsplay of foreign peptides on a filamentous bacteriophage peptides from Plasmodlum falclparum cncumsporozoite protein as antigens J Mol Biol. 220,821-827 7 Iannolo, G , Mmenkova, 0 , Petruzzelh, R., and Cesarem,G (1995) Modifying filamentous phage capsid. Limits m the size of the maJor capstd protem J. Mol. Bd. 248,835--844
164
tuzzago
and Felm
8 Fell& F , Castagnoh, L , Musacchlo, A , Jappelh, R , and Cesarem, G (1991) Selection of antlbody llgands from a large hbrary of ohgopeptldes expressed on a multivalent exposltlon vector J Mel Biol. 222,301-310 9 Cortese, R , Fellcl, F , Galfrk, G , Luzzago, A., Monaco, P., and Nlcosla, A. (1994) Epltope dlscovery with peptlde hbraries displayed on phage. Trends Bzotechnol 12,262-267. 10. Luzzago A., Fellcl F , Tramontano A , Pessl A., and Cortese R. (1993) Mlmlckmg of discontinuous epltopes by phage-duplayed peptides, I Epltope mapping of human H ferrltm usmg a phage library of constrained peptldes Gene 128,5 1-57 11 Sambrook, J , Frltsch, E. F , and Mamatls, T. (1989) Molecular Clonzng. A Laboratory Manual, 2nd ed Cold Spring Harbor Laboratory, Cold Spring Harbor, NY 12 Dower, W. J , Miller, J F , and Ragsdale, C. W (1988) High efficiency transformation of E.coll by high voltage electroporatlon. Nucleic Acids Res 16, 6127-6145. 13 Shagger, H and von Jagow, G (1987) Tncme-sodium dodecyl sulfate-polyacrylamlde gel electrophoresls for the separation of proteins m the range from 1 to 100 kDa Anal. Biochem. 166,368-379
Conformational MimicryThrough Random Constraints Plus Affinity Selection Guangming
Zhong
1. Introduction The use of peptides as antagonists to block certam biological reactions or as vaccine components to elicit immune responses reactive with native antigens may be improved if a peptide sequence is imposed with appropriate conformational constramts that allow the peptide to best mimic the structure as it appears m the native protein. However, searching for the appropriate constramts for a given peptide is always a challenge. The conventional approach relies on the biophysical determination of native protein tertiary structures (I), which is not always practical. In this chapter, I describe an alternate strategy called random constraints plus affinity selection (RCAS) to search for the appropriate conformattonal constraints for a given peptide. This strategy takes advantage of the capability of phage display systems to display a large diversity of genetically encoded structures on the phage surface (2,3). Using the phage display system, random conformational constraints can be imposed onto a given peptide even without prior knowledge of the conformational structure of the protein from which the peptrde is derived. The appropriate conformational constraints that allow the peptide to best mimic its native structure are then selected based on the affinity of the constrained peptides to the natural receptors. The RCAS strategy starts with fusing degenerate nucleotide sequences that are coding for random constraints imposed onto a given epitope sequence to a phage coat protein gene to generate a large library of phage clones. Each phage clone in the library displays on the vrrion surface the epitope sequence imposed with a constraint specified by one of the coding sequences in the degenerate mixture. The known epitope sequence 1s thus presented in a diversity of conFrom
Methods
m Molecular Biology, Edlted by S CablIly
vol 87 Combmatorfal Pwpbde 0 Humana Press Inc , Totowa,
165
Lfbrary NJ
Protocols
166
Zhong
figurations. Potential bmding proteins would be native receptors or conformatlonally dependent monoclonal antibodies (MAbs) raised with native an&ens, such as chlamydial orgamsms, which may recognize antigen only in Immunopreclpltatlon assay but not m Western blot assay. These receptors or Abs are used to select out of the library those constrained peptides with the highest bmding affinity. The bmdmg peptides are thus enriched for conformations that mimic the native epltope. Finally the selected phage can be propagated and used directly to block the receptor function or as lmmunogens to assess the immunogemc fitness of the surface-borne peptides. The example I ~111 describe 1s about how to use the RCAS to improve the Immunogenic fitness of a protective epltope, that is, how to enhance the capability to induce antigen reactive antibodles (4,5) One can also use the same approach to improve or alter other blologlcal activities of a given sequence, such as searching for antagonist activity from an agonist sequence. 2. Materials
2.1. Filamen tous Phage Cloning
Vectors
f88-4 1sa pVII1 fusion-based filamentous phage vector that IS available from G. P Smith at the Umverslty of Missouri, Columbia, MO (see Note 1). Although there are many well-estabhshed fllamentous phage vectors available both from other research laboratorles and commercially, I recommend the use of f88-4 because it can display hundreds of copies of foreign peptldes on each virlon, which allows direct evaluation of the dlsplayed peptides (see Note 2)
2.2. Oligonucleotide
Synthesis
The aim is to install a disulfide bridge to bring the known epitope peptide sequence into a loop with random twists. As shown in the middle panel of Fig. 1, one cysteine is placed on each side of the epltope sequence and each cysteme IS surrounded by randomized residues (see Note 3) The N-termmal potential cysteine position has 50% chance to be a serine and 50% a cysteme. Two partially overlapping ohgonucleotldes should be synthesized to include the coding mformatlon for all the above features (Fig. 1, top and middle panels). The forward primer starts with HlndIII restriction site followed by the coding regions for the random constraints and the N-terminal portion of the known epltope sequence, which overlaps with the backward primer. The forward primer sequence is. S-CTA .AGC .TTT GCC .NNK TSC NNK .AGC GAT GTA .GCA .GGC .T TA.CAA.AAC .GAT .-3’. The backward primer should be complementary to the forward primer and starts with PstI site followed by the coding regions for
Conforma tional Mimicry S-CTA. AGC.T’ll.GCC.
167
NNK.TSC. NNK. AGC.GAT.GTA.GCA.GGC.llACAA.AACGAT. ----t CAT.CGT.CCG.AAT.G~.~GG.CTA.GGT.TGT.TGT.NNM,ACA,NNM,GGACGT. Cl-T.5
Regions
for imposing
constraints
AA.CGG.NNM.ASG.NNM.TCG.CTA.CAT.CGT.CCO.A,NNM,G
Signal Peptidase cleavage site
(3
Epitope
Sequence
Region
b
Hvbrid Wild-type
Recombinant
oham
pVlll gene
Wild-type
pVlll gene
Recombinant
pVlll
pVlll
Fig. 1. Construction of a phage display library with random constraints imposed on an epitope sequence. The two oligonucleotide sequences are shown in the top panel. After filling in, the double-strand insert is digested with Hind111 and PstI. The Hind111 and PstI restriction sites of vector f884 are spliced to the degenerate insert digested with the same two enzymes, giving the nucleotide sequence coding for the recombinant pVII1 containing at its N-terminus the known epitope sequence flanked by the two random constraint regions (middle panel). Amino acids are in single letter codes and X stands for any of the 20 amino acids. In the bottom panel, the open circles on the hybrid phage represent wild-type pVII1, and the filled circles represent recombinant pVII1 with a foreign peptide fused at the N-terminus. The genes coding for them are represented by the open and filled boxes, respectively. the random constraints and the C-terminal portion The backward primer sequence is: 5’-TTC.TGC.AGG.MNN.ACA.MNN.TGT.TGT.TGG.ATC.GTT. TTG.TAA. GCC.TGC-3’. N stands for an equimolar otides; K for an equal mixture of G and T; M for an S for an equal mixture of G and C. See Fig. 1 for the tion after the two oligos are filled in.
of the epitope sequence.
mixture of all four nucleequal mixture of A and C; complete coding informa-
168
Zhong
2.3. Bacterial Strains The MC 106 1 strain IS used as the frozen electrocompetent cells for transfection. MC1061 1s F and has genotype araD139 A(araABC-Zeu)7696 AZacI74 gall? galK- hsr- hsm+ m-A thl. The significant markers are hsr- hsd, which means restrictionless but modification-plus; and streptomycin resistance. K-9 1 cells are used to amplify phages. K-91 is a h- derivative of K-38; it is Hfr Cavali and has chromosomal genotype thi
2.4. Biotinylation
of MAbs
The receptors or Abs are labeled with biotm as follow. 20 PL of the purified protein (2 mg/mL) is adjusted to pH 8.0-9.0 in a siliconized 1 S-mL tube by adding 4 4 FL 1 M NaHC03. Sulfosuccnnmidyl-6-(biotmamido) Hexanoate (Pierce, Rockford, IL) is dissolved at 0 5 mg/mL in 2 mM sodium acetate buffer and 20 PL IS immediately added to the antrbody solution. Coupling is allowed to progress 2 h at room temperature and terminated by adding 200 l.rL 1 M ethanolamine (adjusted to pH 9.0 with HCI) and mcubatmg an additional 2 h at room temperature. Carrier protem (20 yL 50 mg/mL dialyzed bovine serum albumin [BSA, cat# A-3912, Sigma, St. Louis, MO]) is added and the reaction mixture is diluted with 1 mL TBS (see Subheading 2.5.) and concentrated and washed 3X with TBS on a 30-kDa centricon (Amicon, Beverly, MA). The concentration of the biotinylated antibody (bio-MAb) is calculated from the final volume (usually
2.5. Solutions,
Buffers,
and Media
NZY medium: For making IX medrum, dissolve 10 g NZ amine A, 5 g yeast extract, and 5 g NaCl in 1 L water, adjust to pH 7 5 wrth NaOH, autoclave, store at room temperature; for making 1 L NZY agar medium, autoclave 11 grams of Bacto-agar in 500 mL distilled water, and add to 500 mL 2X NZY medium, pour about 20 mL per IOO-mm Petri dash after mixing and addition of antlbrotlcs Tetracycline is used at 20 ug/mL for solution medium and 40 yg/mL for plates SOC medium Dissolve 20 g Bacto-tryptone, 5 g yeast extract, 0.58 g NaCI, and 0.19 g KC1 m 1 L water, autoclave m lOO-mL abquots m 125-mL bottles To each 100 mL, add 1 mL of 2 M Mg*+, and 1 mL of 2 A4 glucose, store at room temperature. NAP buffer Autoclave 90 mL of 88 mM NaCl, add 10 mL of stertle 0.5 M NH,H2P0, and adjust pH to 7 0 with NH,OH PEG/NaCl solutron’ MIX 100 g polyethylene glycol (PEG) 8000, 116 9 g NaCl, and 475 mL of water, heatmg to dissolve all the sobds
Blocking solution 5 mg/mL dialyzed BSA, 0.1 M NaHCO,, 0 1 ug/mL streptavidm, and 0.02% NaN,, filter sterilize and store in refrigerator
Conforma tronal Mm/cry
169
6. TBS: For 10X stock, 1 5 M NaCl and 0.5 A4 Tris-HCl (pH 7.5), autoclave and store at room temperature; TBS/Tween can be made by dilutmg 0.5 mL of Tween20 m 100 mL 1X TBS; TBS/gelatin contains 0.1% gelatin 7 Elution buffer 0.1 N HCl adjusted to pH 2.2 with glycme, 1 mg/mL BSA; store in refrigerator 8 Acrylamide extraction buffer: OSMNH,OAC, 10 mMMg(OAC)*, 1 mMEDTA, and 0 1% SDS; store in refrigerator.
3. Methods 3.1. Construction of a Phage Library Displaying an Epitope Sequence with Randomly Imposed Conformational Cons train ts 1. Synthesize the partially overlapped ohgonucleotide sequences as described m Materials (see Note 3) The oligos should be purified on polyacrylamide gels. 2. The partially overlappmg oligos are filled m by PCR reaction (see Note 4), which is carried out m 1X PCR buffer contammg an equal molar ratio of the two oligos, 100 p&Z dNTPs, and 2 U of Tuq polymerase The PCR profile consists of an mitral denaturation at 95°C for 3 mm followed by 5 cycles at 48°C for 1 mm, 72°C for 1.5 mm, and 95°C for 30 s. The full-length PCR products are then extracted once with phenol and once with chloroform, and precipitated with ethanol 3. Digestion of the PCR product with HzndIII and PstI is as follows: Both Hind111 and PstI work equally well in React II buffer (BRL, Gaithersburg, MD). Fivefold to tenfold excess of enzyme should be used to cut PCR products The digested products should also be cleaned on polyacrylamide gels 4 Polyacrylamide gel purification of the digested PCR products IS as follows. Run DNA samples in a preparatory acrylamide/TBE gel; stain the gel with ethldmm bromide and excise the regions with the desired size; cut the gel into little pieces and weigh the net weight to determine the volume; add 2 vol acrylamide extraction buffer to the gel pieces m a sealed tube, shake the tube overmght at room temperature, microfuge to remove the gel pieces and precipitate the DNA with ethanol. One can also use the various glasswool-based methods (e.g , Gene Clean II kit from BiolOl) to purify DNA from gels. 5. Digestion of vector DNA IS as follows The double-strand RF DNA from the vector filamentous phage-infected bacterial cells is purified using the same techniques used for purifying other plasmid DNAs (9). The vector DNA IS digested first with Hind111 and then with WI, although both enzymes work equally well m the same buffer (see Note 5). The stuffer fragments cleaved from the vector DNA can be removed by washing three times through centricons (see Subheading 2.4.). 6 Ligation is performed as follows: The digested, purified PCR products (Inserts) are ligated mto the lmearized vector DNA usmg standard ligation methods (9) The ligation reaction contains 5 yg/mL vector DNA, a twofold molar excess of the insert, and 10 U/mL T4 DNA ligase in ligation buffer.
170
Zhong
7 Transfectlon of MC1061 with the hgatlon product IS as follows To achieve high efflclency of transfectlon, the ligation product is transfected mto cells by 50-100 separate electroporatlons (ZO), the transfected cells are propagated m ten 1-L flasks containing 100 mL of NZY/tet medium at 37°C with vigorous shakmg for 24 h. The cultures are pooled and the virlons purified (IO), and the concentration of mfectlous particles 1s determmed by tltermg on NZY/tet plates (see Note 6)
3.2. Affinity MA&s (10)
Selection
With the Conformation-Dependent
1 A 60-mm polystyrene Petri dish 1s coated with 2 mL 0 1 M NaHCO, contammg 100 pg/mL streptavldm (Pierce, Chlcago, IL) and the dish 1s mcubated overnight at 4°C 2. On the next day, the streptavldm solution 1s poured off and the dish IS filled with blocking solution 3. After blockmg 2 h at room temperature, the dish is washed with TBS/Tween to remove free avldm. The bio-MAbs are then added to the dish and the dish 1s incubated overnight at 4°C. 4 After the dish 1s washed, 1 mL TBS with 10 PM btotin 1s added to the dish to block excess avldm sites After mcubatlon at room temperature for l-2 h, an aliquot of the hbrary phage produced above IS added to the MAb-bound dish The phage-MAb bmdmg IS carried out at 4°C overnight 5 The bound phages are eluted with 400 yL elutlon buffer after the dish IS washed 5-10 times with TBWTween (see Note 7) The eluate 1s immediately neutralized to pH 7.0 usmg 1 MTrls (pH 9 1) This IS called the first eluate 6 Half of the first eluate IS amplified m K91 cells m NZY/tet medium (see Note 8) and the phages m the supernatants are collected by preclpltatlon with PEG/NaCI 7 Repeat steps l-5 as above except using the amphfled phage in step 6 as input. 8 Only 25% of the second eluate 1s amphfled. 9. For the third round of affinity selection, the amphfled phage is incubated with blo-MAbs overnight at 4’C and the phage-MAb mixture IS apphed to the avldmcoated dish for lo-30 mm at room temperature The bound phage IS eluted as in step 5 after the dish 1s washed 5-10 times with TBWTween (see Note 9) 10 Plate the bacteria mfected with the thud eluate phages and pick up multiple clones (about 20 each sample) for sequencmg
3.3. Analysis
of the Constraints
Selected from the Library
1 Allgnmg the sequences from the third eluate, one should fmd some motif sequences m the two randomized regions flanking the known epltope sequence when the conformation-dependent MAbs are used for selection The nonconformation-dependent MAb or mock selected phages should not show such motif (see Note 10) 2 Directly bmd using ELISA to verify the specificity of the selection Microplates are coated with the motif phages as well as nonmotlf phages (as negative control), and the blo-MAbs are used to bind the lmmobihzed phages The specific
Conforma tlonal M/m/cry
171
bmdmg is visualized with enzyme-ConJugated avldm plus substrate Only the motif phage can be recognized by the conformation-dependent MAbs 3. Since the conformatlon-dependent mAbs can bmd to both the native antigen and the motif phage, one can then use either of them as the competitor to inhibit the bmdmg of the other m what 1s called a competition ELISA 4. For functional evaluation of the constrained peptldes for lmmunogemc fitness, the phage can be used as immunogensto evoke host immune responses,and the antibodies can be evaluated for their capability to neutralize infectivity of the correspondmg organisms(seeNote 11) 5. Chemical constructlon of the constrained epitope sequenceselectedthrough the RCAS approach: Since It IS not convenient to use phage-borne peptldes as antagomstsor vaccine components, it 1simportant to chemically rebuild the constrained peptides (seeNote 12)
4. Notes 1. The f88-4 vector 1sderived from fd-tet (6-g), which hasa tetracycline-resistance determmant, by adding a synthetic recombinant gene VIII with HJndIII and PstI restriction sitesthat allow foreign DNA to be fused to its coding sequence Transcription of the recombinant gene is controlled by an isopropyl-l -thio-P-Dgalactopyranoslde-inducible tat promotor, whereas the wild-type gene VIII is transcripted constltutlvely, when both are expressed,the phageparticles are covered with a mosaic of wild-type and recombinant pVII1 molecules as shown in Fig. 1, bottom panel The rationale for building f88-4 vector with a synthetic pVII1 geneis that the wild-type pVII1 can only tolerate lessthan six foreign ammo acids inserted at its N-terminus Therefore one cannot generate pep&de hbrarles with peptldes longer than SIX residuesusing the wild-type pVII1 gene To overcome the difficulty, one can either use a phagemld system or install a synthetic pVII1 gene 2 Fllamentous phages as clonmg vectors for making pep&de libraries were described m detail by G P Smith et al. (6,7). The most obvious advantage of using fllamentous phagesas vectors is that the foreign peptldes can be displayed on the surface of the vn-ions Such surface-displayed peptldescan be then selected by receptors (3). The nucleotlde sequencescoding foreign peptldesare often fused to either the phage minor coat protein III (~111)gene or the major coat protein VIII (pVII1) gene When pII1 is used as the fusion partner, l-5 copies of the foreign peptlde are expected to be expressedon each vlrion while the pVII1 vector can display hundreds of copies of foreign peptldes on each phage 3. When ollgos are deslgned, more randomized codons may be placed around the potential cysteme codons (seeFig. 1). In such a way, the known epitope sequence can be dlsulflde bonded in more diversified configurations and hasmore chances to mimic the native conformation One can also vary the positions where the cystemesare located, which provides more flexlbdlty for the epltope sequenceto adopt different conformations Finally, it hasbeen demonstratedthat the number and type of intervening ammo acids can affect the formation of dlsulfide loops m
172
4
5
6
7
8
9.
10.
11
12
Zhong two-cysteme pepttdes (II). By varying both the number of randomtzed residues and the posittons of cystemes, it is possible to overcome the potential difficulties that some known epttope sequences may have m forming d&fide loops One can also use other DNA polymerases (e.g , Klenow) to fill in the two mixtures of randomized obgos, which m some cases, may generate more homogeneous products Different DNA synthesis methods should be tried when too much loop formatton 1s found m the double-strand DNA products since the loopcontaining DNA IS likely not viable during transformation HzndIII usually requires longer nucleottde sequences on both sides of the enzyme recognmon site to efftciently cleave the recognmon site Therefore, to achieve complete cleavage of the vector DNA, it 1s wtse to cut with HrndIII first followed by PstI It 1s also important to keep a long enough space upstream of the HzndIII recognmon site when designing the oltgos The primary library size IS often less than 1 billton clones. This 1s hmtted by the transfection efficiency and other factors Nevertheless, the practical size is sufftcient for RCAS strategy since the degeneracy in RCAS IS much less than that m completely randomized libraries During the three-round selection processes, the selection stringency can be adjusted by varying the washing condmons mcludmg the concentratton of detergents, wash times and duration of each wash, and the concentrattons of the MAbs and input phages. If the goal IS to select tight binders, more stringent selection condmons (higher selection pressure) should be applied Generally speaking, three rounds of selection are sufficient to enrtch motif-contammg clones However m some cases, more rounds of selection may be required For each ampltftcatton, especially the ampltftcatton of the first eluate, tt IS tmportant to allow each single phage to have a chance to mfect a bacterial cell m order not to lose the selected clones during ampltfication Therefore, an mduction period and high bactermmlphage ratio should be used For the final round selection, one can mix phage with bio-MAbs first and then pull out the MAb-bound phage using the immobthzed avidm. In such a way, one can more precisely adjust the ratio of the input phage over the MAbs. However this strategy is mapproprtate for the first two rounds since the potential avtdm bmdmg phage cannot be eliminated by the strategy Enrichment can be measured by comparmg the ytelds of each rounds However, phage yield enrichment IS Just suggestive, and a good enrichment does not automatically guarantee a successful selection of motif sequences For evaluation of unmunogemc fitness, the more important parameter one should look for is the crossreactivity of the antibodres with the native antigens instead of the absolute titers of the antibodies The peptide-specific antibody titer may not be very high since numerous other phage surface epitopes may be more nnmunogemc. Our experience suggests that it is not easy to chemtcally rebuild the constraints m some cases For the purpose of DNA vaccine development, we are trying to rebuild the constraints m eukaryottc cells by transferring the constrained peptidecoding regions to a eukaryotic expression vector
Conformational
Mimicry
173
Acknowledgments This work was supported by a scholarship award and an operating grant (MT-14134) from the Canadian Medical Research Council to the author.
References 1 Btdart, J M , Troalen, F , Ghillam, N. R , Razafmdratsita, A , Bohuon, C., and Bellet, D (1990) Peptide lmmunogen mimicry of a protein-specific structural epitope on human chortogonadotropm. Sczence 248,736-739 2. Scott, J. K and Smtth, G. P (1990) Searchmg for peptide ligands with an epttope library Sczence 249,386-390 3. Parmley, S. F and Smith, G P (1988) Antibody-selectable frlamentous fd phage vectors affmny purtfication of target genes Gene 73,305-3 18 4 Zhong, G M., Smith, G. P , Berry, J., and Brunham, R C. (1994) Conformatronal mimicry of a Chlamydial neutralization epttope on filamentous phage J. Bzol. Chem. 269,24,183-24,188 5 Zhong, G M , Toth, I , Reid, H D , and Brunham, R C (1993) Immunogemcrty evaluation of a lipidic ammo acid based synthetic peptide vaccine for Chlamydza trachomatzs. J. Immunol. 151,3728-3736 6 Smith, G. P (1987) Filamentous phages as cloning vectors, m Vectors A Survey of Molecular Cloning Vectors and Thezr Uses (Rodrquez, R L and Denhardt,
D., eds ), Butterworth Publishers, Stoneham, MA, pp 61-85 7 Smith, G P (1991) Surface presentation of protein epttopes using bacteriophage expression systems Czur Opm Biotechnol. 2,668-673 8 Smith, G P. (1988) Frlamentous phage assembly: morphogenetlcally defective mutants that do not kill the host. Vzrology 167, 156-165 9 Sambrook, J , Frrtsch, E F , and Mamatrs, T. (1989) Molecular Clonzng A Lahoratory Manual, 2nd ed Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.
10 Smith, G P and Scott, J K (1993). Libraries of peptides and proteins displayed on frlamentous phages Methods Enzymol. 217,228-257. I1 Zhang, R. and Snyder, G H (1989) Dependence of formation of small dlsulfide loops m two-cysteine peptides on the number and types of intervenmg ammo acids J Bzol. Chem. 264,18,472-18,479
19 The Use of Combinatorial Libraries to Identify Ligands That Interact with Surface Receptors in Living Cells Shmuel Cabilly, Judith Heldman, Eliahu Heldman, and Ephraim Katchalski-Katzir 1. Introduction Interactions between combmatorial libraries and various selector proteins, such as antibodies and receptors, have been demonstrated either in solution (I) or while the selector proteins were bound to a solid support (Z-5). Before the mtroduction of the library to a selector protein, the latter is purified m order to avoid nondesirable interactions between various members of the library and nonrelevant contaminants. However, purification of some proteins 1sdifficult to achieve, and might be deleterious to then biological activity. It is therefore important to develop methods that employ combinatorial libraries in combmation with nonpurified or partially purified selector proteins. In this regard, Jayawrckreme and Lerner developed a technique for screening combmatorial libraries employing recombinant receptors expressed m the plasma membrane of transfected melanophors (6,7 and Chapters 13,14). Their technique is based on the biological activity of the expressed receptors and it enables the selection of library members with agonistic or antagonistic activities. Here we describe a method that we used for identifymg peptides that bind specifically to the ml subtype of the muscarinic acetylcholine receptor (mlAChR). Five subtypes of the muscarimc acetylcholine receptors (mAChR) have been described so far (8,9). The receptors belong to the family of proteins with seven transmembrane domains, and their ligand binding site is located m the transmembrane domains (10). To identify specific peptide sequences that bind specifically to one of the mAChR subtypes, we incubated cells From
Methods
II) Molecular Biology, vol 87 Comblnatonal Pepbde Edlted by S CablIly 0 Humana Press Inc , Totowa,
175
Library NJ
Protocols
176
Cabilly, Heldman, and Kafchalskr-Kafzir
overexpressing the ml AChR with a phage-display peptide library After removing the nonbound phage, we used N-methyl scopolamine (NMS), an antagonist that binds mAChR with high affinity (Kd of 2 x 10-r”n/T), to release, through competitron, the specrfically bound phage. The technique described here IS suitable for the search of ligands with improved specificities and ligands with different binding affinities from the existing ones. In the present example, acetylcholme, the natural ligand for mAChR, binds to all the mAChR subtypes. Lrgands that bmd selectrvely to each of the receptor subtypes might be of a great value as they may help m elucidating different physiological functions mediated by the different AChR subtypes Using the present technique we isolated phage clones displaying peptides that bind specifically to the mlAChR.
2. Materials 1 Receptor-expressmg cells Cells expressmg the target receptor for the combmatorlal library screenmg, e g , cells transfected wrth the coding gene to that receptor (see Note 1). 2 Cells that are similar to the receptor-expressing cells but do not express that receptor, e g , parental cells (see Note 1) 3 A known lrgand to the aforementioned receptor (see Note 2) 4 Phage-drsplay library Any peptlde library displayed on pII1 (see Note 3) 5. Bacterra. E. colz K9 1Kan strain, kindly given by George Smith (see Note 4) IS a I- derlvatrve of K-38, kanamycm resistant, an Hfr Cavalh having the chromosomal genotype thr (II) 6 Tissue culture medium (see Note 5) Dulbecco’s Modrfred Eagle’s Medmm (DMEM) 7 Complete tissue culture medium. DMEM supplemented wrth 10% fetal calf serum, 2 mMglutamme, 100 U/mL pemclllm, 100 pg/mL streptomycm, and 200 pg/mL genetrcm. 8 HEPES-buffered medium DMEM contaming 1 mg/mL bovine serum albumm (BSA) Fraction V (Sigma, St. Lotus, MO), 20 mM HEPES, pH 7 4 (see Note 6) 9 NZY medrum* 10 g NZ amme A, 5 g yeast extract, 5 g NaCl m 1 L dlstrlled water. Adjust the pH to 7 5 with NaOH and autoclave 10 NZY plates. 10 g NZ amme A, 5 g yeast extract, 5 g NaCl, and 10 g agar m 1 L drstllled water Adjust the pH to 7 5 wrth NaOH and autoclave. 11 Super broth 32 g Bacto-tryptone, 20 g yeast extract, 5 g NaCl m 1 L drstrlled water. Adjust the pH to 7 5 wrth NaOH and autoclave 12 Phosphate-buffered saline (PBS) 8 g NaCl, 0 2 g KCl, 1 15 g Na2HP04 7H,O, and 0 2 g KH,PO, m 800 mL dlstrlled water. Adjust the pH to 7.4 with HCl and fill with water up to I L 13 PBWBSA 1% BSA m PBS 14 8 M Urea m 0.0 I M glycme, pH 3.0
Surface Receptors in Livrng Cells
177
15. PEG/NaCI: 100 g PEG (polyethylene glycol) 8000 (Sigma), 117 g NaCl, and 475 mL dlstllled water (final volume 600 mL) To facdltate the solublhzatlon of PEG crystals, heat the solution for a short time 16 Kanamycm stock solution of 50 mg/mL (Boehrmger, Mannhelm, Germany) For use in nutrient media, dilute the stock solution l/500 to a concentration of 10 yglmL. 17. Ampiclllm stock solution Dissolve 20 mg/mL Amplclllm m dlstllled water, dlspense mto 1-mL aliqouts and store at -20°C. For use m nutrient media, ddute the stock solution to a concentration of 20 pg/mL. 18 Tetracyclme stock solution (20 mg/mL) Autoclave 10 mL glycerol When cool, add to it 10 mL of filter-stenllzed solution of tetracycline (40 mg/mL) dissolved m water. Store at -20°C For use in nutrient media, dilute the stock solution to a concentration of 20 lg/mL. 19 Tetracycline stock solution for mductlon of the tetR gene. Dilute the tetracycline stock solution 111000 in 1 mL water (to a concentration of 20 pg/mL) and store at -20°C 20 Tissue culture 24-well plates (Nunc, Denmark) 21 90 x 15 Petri dish (Mmlplast, Em-Shemer, Israel) 22 140 x 10 Petri dish (Falcon, Plymouth, UK). 23 50-mL conical tubes with cap (Mimplast) 24. 30-mL Oak Ridge tubes (Sorval, Wilmington, DE) 25. Round-bottom polypropylene test tubes with cap, 17 x 100 mm (Falcon # 2059) 26 Centricon 30 concentrators (Amlcon, Beverly, MA)
3. Methods 3.1. First Cycle of Phage Biopanning I 2 3 4 5 6. 7. 8. 9.
Culture the receptor-expressing cells to confluency m a 24-well tissue culture plate contaming 1 mL of the complete tissue culture medmm. Wash the cells with 1 mL HEPES-buffered medium three times Add, to the washedcells, 1 mL of HEPES-buffered medium contammg lOI transducmg umts (TU) of phage library Incubate the cells for 1 h at 37°C Rinse wells 10X at room temperature by addltlon and lmmedlate removal of 1 mL HEPES-buffered medium each time. Elute the phage by mcubatmg the cells with 1 mL of urea solution for 10 mm at room temperature Collect the supernatant into a Centrlcon 30 concentrator, add 1 mL PBS, and centrifuge at 2500g until the volume decreasesto about 50 PL (see Note 7) Pipette 2 mL of PBYBSA mto the Centricon concentrator and centrifuge as described m step 7 Repeat step 8 and transfer the concentrated and washed phage to an Eppendorf tube Keep the phage at 4°C until you usethem
778
Cabilly, Heldman, and Katchalskr-Katzir
10 Grow K91Kan E coli cells from a freshly grown colony in 2 mL NZY medium supplementedwith 50 l,tg/mL kanamycin, m round-bottom polypropylene tubes Shake the cells at 250 rpm at 37°C until an ODs5aof 0 7 1sreached (about 4 h). 11 Take out a sample of 2 pL from the eluted phage (step 9) for titermg the phage TU (see Subheading 3.3.) 12 Add the rest of the eluted phage to 1 mL bacteria taken from the 2-mL culture (prepared m step 10). Incubate the cells at 37°C for 10 mm without shaking to allow phage mfectton 13 Shake the cells vigorously for 50 mm at 37°C (seeNote 8) If the peptide library is displayed on phage that confer bacteria with a resistanceto tetracyclme add to the culture 10 l.tL of 20 PglmL tetracyclme (see Note 9) 14 Plate the infected bacteria onto three ICcm-diameter Petri dishescontammg NZY agar and the appropriate anttbtotics for which resistance1sconferred by the phage 15 Incubate the bacteria at 37°C for 24 h 16. Pipette 10 mL of PBS to each Petri dish, use an L-shaped bent Pasteur pipet to scrape the bacterta mcludmg the adJacent phage, and transfer the ltquid to a 30-mL Oak Ridge tube 17 Pellet the bacteria at 4°C for 10 mm at 14,OOOg 18. Collect the supernatant mto another 30-mL Oak Rtdge Tube and heat it at 65°C for 20 mm 19 Centrifuge again asdescribed m step 17 20 Collect the supernatant mto 30-mL Oak Ridge tubes and add l/6 vol PEG/NaCl solutton. Mix thoroughly by multiple inversions and place the tube overmght at 4°C. 21. Spur down the phage at 27,OOOgfor 15 mm 22 Aspirate the supernatantextensively, resuspendthe pellet in 1 mL PBS, and transfer the phage to an Eppendorf tube. 23 Add l/6 vol PEG/NaCl solution, mix thoroughly by repeated mversions, and place the tube on Ice for 1 h 24. Spm down the phage m a microfuge for 10 mm. 25. Aspirate off all the supernatant and resuspendthe pellet m 100 pL PBS 26 Titer the phage TU (seeSubheading 3.3.).
3.2. Subsequent
Cycles of Biopanning
1 Grow a tissue culture of the receptor-expressmg cells to confluency m a 24-well tissue culture plate contammg 1 mL of the complete tissueculture medium 2 Grow the parental cells as described m step 1 3 Wash the receptor-expressmg cells with 1 mL HEPES-buffered medium three ttmes 4 Add to the washedcells 1 mL of HEPES-buffered medium contaming 10tOphage that were eluted, amplified, and tttered tn the first cycle of biopannmg
(Subheading
3.1., step 26)
5 Incubate the ttssue culture cells with the phage for 1 h at 37°C (see Note 10)
Surface Receptors in Living Cells
179
6 Rinse the plates 10 times at room temperature by addmon and immediate removal of 1 mL HEPES-buffered medrum 7 Add to the cells 1 mL of HEPES-buffered medium containing the known llgand and incubate the cells for 1 h at 37°C The known bgand releases the specific phage-drsplaymg peptrde vra competrtion. 8. Transfer the medium that contains the released phage to a tissue culture plate containing the parental cells, after removing the growth medium from the latter. 9 Incubate the released phage wrth the parental cells for 30 mm at 37°C to adsorb nonspecrfrc phage. 10 Collect 1 mL medium from the parental cells and concentrate rt to 50 PL usmg a Centricon concentrator. 11 Titer phage TU as described in Subheading 3.3. 12 Carry out two more cycles of biopannmg using the receptor-expressmg cells and the parental cells (steps 4-11) and titer the phage TU of each cycle (see Notes 11 and 12).
3.3. Titering
Phage Transducing
Units
1 Grow K9lKan E. coEl from a fresh colony as described m Subheading 3.1., step 10 2. Abquot 9 FL PBS mto several Eppendorf tubes. Add 1 PL of the phage suspension to the first tube, and perform decimal dilution by consecutive transfer and mixing of 1 p.L phage solution from one tube to the next (see Chapter 20, note 10) 3 Add 100 yL bacteria, prepared in step 1, to each tube of phage dilution and mcubate at 37°C without shaking for 10 min 4. Shake the cells vtgorously for 50 min at 37°C If the peptrde library IS displayed on phage that confer bacteria with a resistance to tetracycline you should add to the culture 10 pL of 20 p.g/mL tetracycline 5 Plate the infected bacteria onto 9-cm diameter Petri dish containing NZY agar and the appropriate antibiotics 6 Incubate the Petri dishes at 37°C for 24 h. 7 Count the number of colonies and multiply that number by the drlutron factor
3.4. Specificity Peptides
Assay for Phage That Display Receptor-Binding
1. Grow K91Kan E. colz cells as described m Subheading 3.1., step 10 2 Infect the bacteria with about 100 phage TU from the last panning and plate them in 9-cm NZY agar plate as described in Subheading 3.3., steps 3-6. 3. Pick up about 20 individual colonies, grow each clone m 50-mL tubes contammg 15 mL super broth medium supplemented with antrbrotrcs, and shake them overnight at 37°C 4 Centrifuge the bacteria at 4000g for 20 min 5. Collect individual supernatants into 30-mL Oak Ridge tubes and add 2 5 mL of PEG/NaCl solutron Mix thoroughly by multiple mversrons and place the tubes overnight at 4’C
Cabilly,
180
Heldman,
and Ka tchalski-Ka
tzir
6 Spin down the phage at 27,000g for 15 mm 7 Aspirate the supernatant extensively, resuspend the pellet m 1 mL PBS, and transfer the phage to an Eppendorf tube
8 Heat the tubes to 65°C for 20 mm 9 Spin down bacterlal cell debris m a mlcrofuge (top speed) for 10 mm. 10 Collect the supernatants from all the tubes mto another set of Eppendorf tubes. 11 Add 170 yL of PEG/NaCl solution to each of the tubes, mix thoroughly by repeated mverslons, and place the tube on Ice for 1 h 12. Spin down the phage m a microfuge for 10 mm 13 Aspirate off all the supernatants and resuspend each pellet m 100 pL PBS 14 Titer the TU (see Subheading 3.3.) of all the phage clones and store them at 4°C 1.5. Grow the receptor-expressmg cells and the parental cells as described m Subheading 3.2.,step 1 To analyze the bmdmg speclflcity of the selected phage, prepare for each clone two wells of receptor-expressing cells and two wells of the parental cells In addition, prepare two wells of receptor-expressing cells and two wells of parental cells for the use of control phage bmdmg (we use the phage library as the control). 16 Prepare 4 mL of HEPES-buffered medium contammg lO*O phage TU/mL from each of the isolated clones as well as 4 mL of HEPES-buffered medium contam-
mg 1O’OTU/mL of the control phage 17 Add 1 mL of phage preparation to the each of the two tissue culture plate contammg the receptor-expressmg cells and the two plates of the parental cells. Incubate the tissue culture cells with the different phage clone for 1 h at 37°C (see
Note 10). 18 Rmse the plates 10X at room temperature by addltton and immediate removal of 1 mL HEPES-buffered medium. 19 Add 1 mL of HEPES-buffered medmm contammg the known hgand to one of the receptor-expressing cell plates and to one of the parental cell plates, and mcubate the cells for 1 h at 37°C.
20 Add 1 mL of HEPES-buffered
medmm to the other remaining plates contammg
the receptor-expressing cells and the parental cells, and Incubate the cells for 1 h at 37°C 21 Collect the media from all the plates and titer the phage TU.
3.5. Determination
of Phage-Display
Peptide Sequences
The amino acid sequence of the phage-displayed peptide IS deduced by sequencing the phage ssDNA at the site of library insertion. One can use a commercial DNA isolation kit. We found that phage ssDNA isolated by PEG precipitation followed by phenol/chloroform extraction and ethanol precipltation is sufficient for sequencing. 1 Based on the titration assay (Subheading
3.4., step 21), grow each of the posltlve clones m 2 mL super broth supplemented with the appropriate antlblotlcs at 37°C overnight
Surface Receptors in Lwmg Cells
181
2. Spm the cells m an Eppendorf mmrofuge (top speed) for 10 s and collect the supernatant mto another 2-mL Eppendorf tube 3 Add l/6 vol PEG solution, mix thoroughly, and place the tube on Ice for 1 h. 4 Pellet the phage by spmnmg in a mlcofuge for 15 mm. 5. Aspirate the supernatant and resuspend the phage pellet m 100 pL TE 6 Repeat steps 3-5. 7. Add 50 ltL phenol, vortex, then add 50 pL chloroform 8. Spm in a microfuge for 5 min and collect the aqueous phase mto another Eppendorf tube. 9 Add 50 PL chloroform, vortex, spin as above, and agam collect the aqueous phase. 10. Add 10 FL of 3 MNa-Acetate, pH 5 0, mtx, add 200 pL ethanol, mtx, and keep overnight at 4’C I1 Spm the tubes for 15 mm m a mtcrofuge. 12 Aspn-ate the supernatant, add 1 mL of 70% ethanol, and spin as in step 10. 13. Aspirate the supernatant to the last drop and dry the DNA either on the bench or m a Speed-Vat. 14 Suspend the DNA in 10 ltL TE 15 To sequence the DNA use a primer that anneals downstream the library site of msertion, such as 5’- TGAATTMCTGTATGAGG-3’ (suggested by George Smith)
4. Notes 1. Receptor-expressmg cells* we used transfected Chmese Hamster ovarian cells (CHO) that overexpress the m 1AChR or other subtypes of the mAChR To absorb the nonspecific members of the phage library we used the CHO parental cells. We assume that other cell types are also suitable for the same purposes. Overexpressmg transfected cells are advantageous over cells expressmg the normal number of receptors in the use of combinatorial phage libraries 2 Releasing the specific phage is done by competition with a hgand. Therefore, it 1s preferable to use a ligand with high affimty. 3. We use a phage library that displays the peptides on the pII1 protem expressed m l-5 copies on each phage (depending on the library type) In pVII1 librartes hundreds of peptide copies are displayed on each phage creating a very high avidity to the selector protein Thus, when usmg the pVII1 library we suggest to go through several biopannmg cycles applying urea (as mdmated m Subheading 3.1., step 6) for phage elution Instead of high-affinity ligand elution. 4 Other male E. COZEstrains have been used for phage mfectlon, however, the K91 strain has about 5 pdt/bactermm while most of the other strams have 0 5 p111/ bacterium 5 Any appropriate tissue culture media can be used instead of DMEM. 6. The HEPES 1s added to keep the pH constant since treatment of cells IS done outside the incubator 7 It takes about 30 min to reduce the volume of hquid m the Centricon concentrator to about 50 pL Due to the unique structure of the Centricon concentrator,
182
8. 9 10
11. 12.
Cabilly, Heidman, and Ka tchaiski-Ka tzir extended time of centrifugatlon ~111 not decrease the volume of the concentrated hqutd to less than 50 pL This mcubatron time enables syntheses of phage proteins that are necessary to confer antibiotic resistance to the host bacteria. At this concentratron, 0.2 pg/mL, tetracycline induces the tetR gene promoter without arresting protein synthesis. We chose this temperature because the presence of AChR on the cell surface 1s stable at 37°C However, this might not be the case for other receptors Therefore, the condmons set for mteractton between the peptlde library and the tissue culture cells should avord receptor mternallzatron or release, e g , by lowermg the mcubatron temperatures. Do not discard any of the remammg phage that are left after each cycle You may fmd it necessary to repeat certam bropanning cycles Although a rise m the phage TU from one bropannmg cycle to the next mdrcates amphfrcatron of the specific phage-dtsplaymg peptrdes, we found that this IS not always the case Therefore, even tf amphftcatton 1s not observed m the first two cycles, we suggest to go ahead wrth the third cycle of biopannmg
Acknowledgment This work
was supported
by the Rash1 foundatron
References 1 Dooley, C T and Houghten, R A (1993) The use of posmonal scanmg synthetrc peptrde combmatorlal libraries for the rapid determmatton of optotd receptor hgands Life Scz 52,1509-1517 2 Lam,K S.,Salmon,S E,Hersh,E M,Hruby,V J,Kazmrersky,W.M,and Knapp, R. J (1991) One-bead, one pepttde: a new type of synthetic peptrde library for ldenttfymg hgand-bmdmg activity Nature 354,82-84 3 Jacobs, J W. and Fodor, P. A (1994) Combmatortal chemistry-apphcatlons of light-directed chemical synthesis Trends Biotechnol 12, 19-26 4 Scott, J. K. and Smith, G P (1990) Searching for peptrde ltgands wrth an eprtope library Science 249,386-390 5 Cwula, S E., Peters, E A., Barrett, R W , and Dower, W. J (1990) Peptldes of phage* A vast library of pepttdes for identifying llgands Proc Natl. Acad Scl USA 87,6378-6382 6. Potenzam, M. N , Grammskr, G. F , and Lerner, M. R (1992) A method for evaluating the effects of hgands upon G, protem-coupled receptors using a recombtnant melanophore-basedbioassay. Anal. Bzochem. 206,315-322 7 Jayawrckreme, C. K ,Grammskr,G G ,Qmllan, J M , andLerner,M R (1994) Creatron and functional screeningof a multr-use peptrde library Proc Nat1 Acad Scr USA 91,1614-1618 8 Hulme, E C., Budsall, N. J., and Buckley N J (1990) Muscarmlc receptor subtypes Annu Rev Phamacol Tox~ol 30,633-673
Surface Receptors in Liwng Cells 9 Bonner, T. I (1989) The molecular basis of muscarmlc receptor dlverslty Trends Neuroscz 12,148-15 1 10 Jurgen, W. (1993) Molecular basisof muscarimc acetylcholme receptor function Trends
Pharmacol
Scl 14,308-3
I3
11 Smith, G. P and Scott, J K. (1993) Llbrarles of peptides and protems dlsplayed on filamentous phage Methods Enzymol 217,228-257.
20 Screening Phage Display Peptide Libraries on Nitrocellulose Membranes Shmuel Cabilly, Judith Heidman, and Ephraim Katchalski-Katzir 1. Introduction The procedure of using phage display libraries involves several cycles of phage biopanning (1-3). In each of these cycles, a selector protein is mcubated with the phage library, and members of the library displaymg peptides that interact with the selector protein are selected and amplified m E. colz cells. Multiple cycles of biopannmg are required in order to increase the number of the specific clones over the background levels, since the imtial ratio between nonspecific members of the library (the size of the library repertoire) and members that are specific for a single binding protein is usually m the order of lo6 or more. The process of multiple cycles of selection, however, may affect the repertoire of variant peptides that bind to the selector protein because it creates biased preference to (a) peptides with the highest affinity, and (b) peptides that do not interfere with the phage propagation rate (see Chapter 16). Obtaining a high number of variant peptides that bmd to a selector protein helps m deducmg their consensus sequences. In addition, it enables the analysis of sequential motifs that are involved m the anchoring of peptides to proteins characterized by a wide range of peptide recognition, such as HLA molecules and chaperons (d-6). Repertoires of variant epitopes or mimotopes might also be helpful m developing vaccmes to certam viruses or organisms that alter then antigenic epitope as a way to escape the immune sysem (7,8). To increase the repertoire of selected variant peptides, phage libraries were screened on nitrocellulose membranes (NC). For the purpose of screening, the NC membranes were laid either over colonies of infected bacteria grown m nutrient agar plates (5) or over a population of phage plaques and the positive From
Methods
,n Molecular Biology, Edlted by S CablIly
vol 87 Combmatonal PeptIde 0 Humana Press Inc , Totowa,
185
Ljbrary NJ
Protocols
Cahlly, Heldman, and Katchalsh-Katzir
186
clones tmmunodetected on the NC membrane (9, and Chapter 2 1). In this chapter we describe a modification of the membrane methods. Bacteria, infected by phage, are grown over two layers of membranes that are placed over a nutrient agar The upper membrane contams pores that allow phage, but not bacteria, to pass through while the lower one is a mtrocellulose membrane treated with antibodies to the filamentous phage. When the bacteria grow to form colonies, the upper membrane is kept as a rephca while the lower one 1s used to immunodetect phage clones that bind to the selector protein. Owing to the large ratio between the library repertoire and each of its specific members we recommend to use this screening method after one or two cycles of regular btopannmg. The method can also be adapted to search for specific peptide sequences that undergo posttranslational modifications (e g., phosphorylation)
2. Materials 2.1. Phage
Biopanning
1 Phage library We used a pII1 phage display peptide hbrary (kmdly given by George Smith, University of Mtssouri), which dtsplays five copies of peptides over each of the phage particles The pVII1 library (available from Franc0 Fehct, IRBM, Rome), which displays hundreds of copies over the phage surface should be suitable as well for screening by this technique 2 Bacteria E. coli K9lKan strain (kindly given by George Smith) is a h-derivative of K-38, kanamycin resistant, an Hfr Cavalh having the chromosomal genotype thi (IO) 3. A solution of 0 1 M NaHCO,, pH unadjusted (the obtained pH is 8 4-8.6) 4 A solution of 0.1 M NaHCO, at pH 9 3 (adjusted with NaOH) 5 Phosphate-buffered salme (PBS) 8 g NaCl, 0 2 g KCl, 1 15 g Na2HP04 7H,O, and 0.2 g KH2P0, m 800 mL dtstilled water Adjust the pH to 7 4 with HCl and fill to 1 L with water
6. A solution of 0.5% Tween-20 in PBS 7 BSA blocking solution: 50 mg bovme serum albumin (BSA) fraction V (Sigma, St. Lams, MO) m 50 mL of 0 1 M NaHCOs at pH 9 3 Store at -20°C. 8. Dialyzed PBS/BSA 2 mL BSA blockmg solution dialyzed against 1 L PBS (to remove restdual btotm from the BSA). Store at -20°C. 9 Hemoglobm blockmg solution 0 5 g hemoglobin (Sigma) m 50 mL PBS. 10 Strepavidm 100X stock solution 1 mg Strepavidm (Sigma) m 1 mL water. Store at -20°C 11 NHS biotmylatmg reagent 1 mg NHS (Btotmamtdocaproate N-hydroxysuccmimtde ester, Sigma) m 1 mL dtmethylformamide Can be stored at -20°C for no more than 2 wk 12. 10% Sodium aztde. 13 Tris base 10 mL solution of 2 M Tris base. Do not adJust the pH 14. Elutton buffer 0 1 N HCl adjusted to pH 2 2 with 0 1M glycme
Screening on Nitrocellulose Membranes
187
15. PEG/NaCl. 100 g PEG (polyethylene Glycol) 8000 (Sigma) and 117 g NaCl m 475 mL distilled water (final volume 600 mL). To facilitate solubllizatlon of the PEG crystals, heat the solution for a short time 16 NZY plates Dissolve 10 g NZ amme A, 5 g yeast extract, 5 g NaCl, and 11 g agar in 1 L distilled water Adjust the pH to 7 5 with NaOH and autoclave 17 NZY medium* Dissolve 10 g NZ amme A, 5 g yeast extract, and 5 g NaCl m 1 L distilled water Adjust the pH to 7 5 with NaOH and autoclave. 18 Kanamycm stock solution of 50 mg/mL (Boehrmger, Mannhelm, Germany) For use in nutrient media, dilute the stock solution l/500 to a concentration of 10 pg/mL. 19. Amplcillm stock solution Dissolve 20 mg/mL Amplclllm m distilled water, dispense mto I-mL allqouts and store at -20°C For use in nutrient media, dilute the stock solution to a concentration of 20 pg/mL. 20 Tetracyclme stock solution (20 mg/mL). Autoclave 10 mL glycerol. When cool, add to it 10 mL of filter-sterilized solution of tetracycline (40 mg/mL) dissolved m water. Store at -2O’C. For use in nutrient media, dilute the stock solution to a concentration of 20 bg/mL 21 Tetracycline stock solution for tetR gene mductron Dilute the tetracyclme stock solution l/1000 in 1 mL water (to a concentration of 20 pg/mL) and store at -20°C. 22. 30-mm Tissue culture plates (Nunc, Denmark) 23 90 x 15 Petri dish (Mimplast, Em-Shemer, Israel). 24 140 x 10 Petri dish (Falcon, Plymouth, UK) 25 Round-bottom polypropylene test tubes with cap, 17 x 100 mm (Falcon #2059) 26. 30-mL Oak Ridge tubes (Sorval, Wllmmgton, DE).
2.2. Screening of Phage Display Libraries on Nitrocellulose Membranes 1 Polyvmyhdene fluoride membrane filters (PVDF), 142-mm diameter (GVWP, Mllllpore, Bedford, MA) 2 Nltrocellulose membranes BA 85, 132 mm (Schlelcher and Schuell, Dassel, Germany) 3 Rabbit anti-Ml3 antibodies, ammonium sulfate precipitated, resuspended m PBS to the original volume, and dialyzed against PBS (see Note 1) 4 Glass beads 4-6-mm Diameter (Heinz Herenz, Hamburg, Germany), 5. A solution of 0 05% Tween-20 m PBS 6. Super broth* Dissolve 32 g Bacto-tryptone, 20 g yeast extract, and 5 g NaCl m 1 L distilled water Adjust the pH to 7 5 with NaOH and autoclave 7 HRP-Strepavidm conjugate (Sigma) 8 Enhanced chemllummescence (ECL) detection system (Amersham, Buckmghamshire, UK) 9 Alkaline phosphatase-strepavldm conjugate (Sigma) 10 SaranWrap 11 X-ray film cassette 12 X-ray films
Cabrlly, Heldman, and Ka tchalski-Katz/r
788
13 Microtlter ELISA plates* Immunosorb 96well plate (Nunc) 14 Flat-bottom 96well plate. MIcrotest III TM-tissue culture plate (Falcon). 15 Ethanolamme-buffered salme (EBS) 5X stock solution: Mix 15 mL monoethanolammeand 169.5 g NaCl m 800 mL dlstllled water. Then add 0 52 g MgCI,*6H,O, adjust the pH to 9.5 with HCl, and bring the volume to 1 L with distilled water 16 A solution of 3 N NaOH 17 TE 10 mMTris-HCl, pH 7 4, 1mMEDTA 18 DNA sequencmgprimer 5’- TGAATTTTCTGTATGAGG-3’
3. Methods 3.1. Biopanning
3.1.1. Biotinylatlon of Selector Proteins 1 Dialyze 100 pg of the purified selector protem (seeNote 2) at a concentration of 1 mg/mL agamst0 1 M NaHC03 at 4°C (an efflclent method for dialyzmg small volumes of lrquld IS suggestedm Note 3) 2 Transfer the dialyzed protein to an Eppendorf tube, add 2.5 pL of NHS blotmylatmg reagent, and Incubate the reaction mixture for 2 h at room temperature (see Note 4) 3 Dialyze the blotmylated protein agamst PBS at 4°C overnight 4. Add a solution of 10% sodium azlde to a concentration of 0.02% and keep at 4°C
3.1.2 First Round of Blopannlng Plpet 1 mL of 0 1 M NaHCO, solution at pH 9 3 containing 10 pL of 1 mg/mL strepavldin mto a 30-mm polystyrene Petri dish (beeNote 5) Place the dish inside a humidified chamber at 4°C for 24 h or more. Make up a mixture of the selector protein and the phage library as follows. a 1O’Otransducing units (TU) of the phage library 1 PL b 2 7 pg blotmylated selector protem 2 7 PL (see Note 6) c Dialyzed PBS/BSA 26 3 pL Incubate over mght at 4°C. Grow K91Kan E colz cells (see Note 7) from a freshly grown colony m 2 mL NZY medium supplemented with 50 pg/mL kanamycm, m round-bottom polypropylene tubes Shake the cells at 250 rpm at 37“C until an OD,,, of 0 7 1s attained (about 4 h) Remove the strepavldm solution from a Petri dish (prepared m step 1) and add 4 mL of BSA blockmg solution for 30 mm at room temperature. Wash the Petri dish three times with 4 mL of 0 5% Tween-PBS Add 1 mL of 0 5% Tween-PBS to the library/selector protem mixture (step 2) and immediately pour the mixture mto the strepavldm-coated Petri dish Shake the dish gently at room temperature for 30 mm (At this stage, complexes of the blotmylated selector protem bound to phage displaying the specific peptides are attached to the surface of the plate through the strepavldm)
Screemng
on Nitrocellulose
Membranes
189
8. Pour off the unbound phage. 9. Add 2 mL of 0 5% Tween-PBS, shake the dish gently for 10 mm at room temperature, and then pour the Iiqmd off (Use a clean paper towel to remove residual hqurd from the edge of the dish wall). 10. Repeat the washing procedure for 10 times 11. Add 300 pL elutron buffer and shake the Petri dish for about 10 mm (see Note 8) 12. Transfer the eluted phage to an Eppendorf tube and neutralize the pH by adding 17 pL of 2 A4 Trrs base solution. Mix rmmediately. 13 Take out a sample of 2 pL for phage TU trtering (see Subheading 3.1.3.). 14 Add the rest of the eluted phage to the culture of 1 mL bacteria prepared m step 3. Incubate at 37°C for IO min wrthout shaking to allow phage Infection. 15. Shake the cells vigorously for 50 mm at 37°C (see Note 9) 16 Plate the infected bacteria onto three 15-cm-diameter Petrt dishes contammg NZY agar and the appropriate antibiotics (for which resistance is conferred by the phage) 17. Incubate the bacteria at 37°C for 24 h. 18 Prepare an L-shaped bent Pasteur pipet and use it to scrape the bacteria from each Petri dish Add about 10 mL PBS to each plate and collect the bacteria to Oak Ridge tubes 19. Spm down the bacteria at 14,000g for 10 mm at 4°C. 20 Transfer the supernatant mto another Oak Rrdge tube and place it m a 65°C water bath for 20 mm to kill residual bacteria. 21 Centrifuge again as in step 19 22 Transfer the supernatant into an Oak Ridge tube and add l/6 vol PEG/NaCI MIX thoroughly by multiple mversions and place the tube for 4 h at 4°C 23 Spm down the phage at 27 ,OOOgfor 15 mm 24. Aspirate the supernatant to the last drop, resuspend the pellet in 1 mL PBS and transfer the phage to an Eppendorf tube. 25 Add l/6 vol PEG/NaCI solution, mix thoroughly, and place the tube on Ice for 1 h 26. Spin down the phage m a mlcrofuge (top speed) for 10 mm 27 Aspirate off all the supernatant and resuspend the pellet m 100 FL PBS contaming 0.02% sodmm azide 28. Titer the phage TU (see Subheading 3.1.3.)
3.1.3.
Titering
Phage
Transducing
Units
1. Grow K91Kan E. colz from a fresh colony as described m Subheading 3.1.2., step 3. 2 Aliquot 9 pL PBS mto several Eppendorf tubes The number of the tubes should be m accordance with the expected phage TU. Usually the TU yield is 1012 for amplified phage and 104-lo6 for phage eluted from the strepavidin-coated plates (see Note 9). Add 1 f.tL of the phage suspension to the first tube and perform decimal dilution by consecutive transfer and mixing of 1 pL phage from one tube to the next 3. To each tube of phage dilution add 100 pL of bacteria (prepared in step 1) and incubate at 37°C Leave for 10 mm without shaking and then shake the cells vigorously for 50 mm at 37°C
190
Cab/l/y, Heldman, and Katchalski-Katiir
5. Plate the mfected bacterra onto 9-cm-drameter Petri dish contammg NZY agar and the appropriate antrbrotrcs (see Note 10). 6 incubate the Petri dishes at 37°C for 24 h 7 Count the number of colonies and multiply by the dtlutron factor.
3.1 4. Subsequent Rounds of Phage Panning 1 Mix lOto TU of phage from the previous panning with 1 pg of the brotmylated selector protein 2 Add a dialyzed solution of PBS/BSA to 30 p.L 3 Follow Subheadings 3.1.2., steps 3-28. 4 Determine the phage TU
3.2. Screening of Phage Display Libraries on Nitrocellulose Membranes 3.2.1. Preparing Petri Dishes for Bacteria Plating 1 Soak a 132-mm NC membrane m 10 mL PBS contaming anti-Ml3 antibodies for 10 mm at room temperature We used the antibodies m a dtlutron of l/1000 For optrmum results we suggest to try out several dilutions You may use an empty Petri dish as a vessel for treating the membranes (see Note 11) 2 Remove the membrane and soak it m 10 mL of hemoglobm blocking solution (there is no need to rmse the membrane prior to the blockmg) 3. Lay the membrane over a 13-cm Petri dish containing NZY agar supplemented with the appropriate antrbrotics 4 Lay a PVDF membrane over the NC membrane The size of the Mllhpore PVDF membrane filters is slightly larger than that of the NC, therefore trim the membrane contour to the appropriate size. 5 Mark the positron of the PVDF membrane over the NC membrane at the edge of the membranes by making three spots located at unequal distances from each other Marking can be done by punching the membranes with a needle or by a waterproof marker
3.2.2. Platmg of Bacteria 1 Grow K91Kan bacteria as described m Subheading 3.1.2., step 3. 2 Infect the bacteria with up to lo5 phage TU/l mL per plate Infection of bacterra is described m Subheading 3.1.2., steps 14-16 3 Plate the infected bacteria over the PVDF membrane using glass beads and mcubate the plates overnight at 37°C
3.2.3. lmmunodetection
of Specrfic Peptrdes by the Selector Protem
1 Carefully transfer the PVDF membrane, colonies facing up, to another 13-cm NZY plate Keep the membrane at 4°C
Screening on Nltrocellulose Membranes
191
2 Remove the NC membrane and wash It three times with 20 mL of 0 05% TweenPBS at room temperature 3 Incubate the membrane with 10 mL of PBS contammg 1% hemoglobm and 1 pg/ mL of the blotmylated selector protein at 4°C overnight 4 Wash the NC membrane as m step 2 5 Durmg the washmg steps dilute the HRP-strepavldm conjugate m PBS (see Note 12). 6 Incubate the membrane with 10 mL PBS contammg HRP-strepavldm conjugate for 1 h at room temperature 7 Wash the membrane as described m step 4 8. Add the ECL detection reagents according to the manufacturer’s protocol (see Note 13) 9 Mark an X-ray film as m Subheading 3.2.1., step 5, expose the film, and develop 10 Overlay the marks on the film with those at the PVDF membrane to identify positive E cob colonies Use toothpicks to transfer the posmve clones onto another nutrient agar plate 11 If the colonies grown at step 2 are too crowded, collect the bacteria under each of the identified zones, make up a seriesof decimal dilution m 100 pL NZY medmm, and plpet 10 pL of dilutions lo-“ to 10m6 onto a PVDF membranethat was laid over an NC membranem an NZY agar plate as described m Subheading 3.2.1. Then, repeat steps l-10 to identify and isolate colonies of positive bacteria 12. Grow each of the positive clones m a 96-well flat-bottom plate containing 200 pL super broth supplemented with the appropriate antlblotlcs Wrap the plate with SaranWrap to avoid evaporation and incubate the plate overnight at 37°C. 13. Coat an Immunosorb 96-well plate with 100 pL ant]-Ml3 antibodies diluted l/1000 (seeNote 1) m a solution of 0 1 M NaHCO, at pH 9 3. Incubate the plate either 2 h at 37’C or overnight at 4°C. 14 Wash the plate three times with a solution of 0 05% Tween m PBS 15. Use a 12-channel plpetor to transfer 100 FL of the bacteria culture from the 96-well culture plate to the ant]-Ml3 precoated microtlter ELISA plate (In our hands,the bacteria m the culture medium did not interfere with the ELISA results; however, we suggestto transfer the upper level of the culture medium to avoid most of the bacteria). Incubate the plate either 2 h at 37°C or overnight at 4°C 16 Remove the culture medium from the wells and add 400 yL of hemoglobin blocking solution Incubate at room temperature for 30 min 17 Wash the wells three times with 0.05% Tween m PBS. 18. Add to each of the wells 100 mL of the blotmylated selector protein at a concentration of 1 mg/mL m PBS. Incubate 1 h at 37°C or overnight at 4°C. 19 Wash the plate asm step 15 20. Add alkalme phosphatase-streptavldmdiluted according the manufacturer 21. Wash the plate three times with 0 05% Tween m PBS and once with EBS 22 Add 100 mL of p-mtrophenol phosphateat a concentration of 0 4 mg/mL m EBS Place at 37°C until a sufficient color is developed
Cabilly, Heldman, and Katchalski-Katzir
192 23 24
Add 20 mL of 3 N NaOH to terminate the reaction Use an automated ELBA plate reader at 405 nm to record the results
3.2.4. Determlnatlon of Peptlde Sequences That Bind to the Selector Protein The amino acid sequence of the phage-displayed pepttde 1s deduced by sequencing the phage ssDNA at the site of library Insertion. To Isolate the DNA one can use a commercial DNA purtftcatton kit. We found that phage ssDNA isolated by PEG precipitation followed by phenol/chloroform extraction and ethanol precipitation is sufficiently purified for sequencmg (see Chapter 19, Subheading 3.5 ).
4. Notes 1. Ftlamentous phage are very rmmunogemc m rabbits After a second 1nJectron of the Ml3 phage we obtained an ELBA titer of 10m5 The antrbodtes are also commercially available 2 The selector protein should be purified to avoid the selection of irrelevant phagedrsplaymg peptides. If you use monoclonal antibodies as your selector protein, we suggest that the antibodies should be purified from hybrrdoma cells, cultured m a serum-free tissue culture medium As&es fluid that is not purrfred over an antigen affinity column might contam up to 15% of irrelevant antibodies and we experienced problems using rt 3 The suggested chamber for dtalyzmg small volumes of liquid conststs of two main parts A detached cap of the 1 S-mL Eppendorff tube that has a shape of an open barrel when placed upside down and a short sleeve (2-3 mm) cut out from the upper rim of an Eppendorf (using a razor blade). Ptpet mto the open cap 100-200 pL of the protein solution that should be dialyzed, cover the open side of the Eppendorf cap with a dtalysrs membrane (2 x 2 cm), seal the membrane over the cap with the short sleeve, and place the cap in a vessel contammg the dialysis solutton Sealing the membraneover the cap requires some practice We found that 1 h of stnrmg IS sufficient to dialyze 90% of the salt m the chamber. To collect the dialyzed solutton, extend the narrow end of a Pasteur prpet over a flame and break the tip Connect the prpet to a rubber bulb, pull out some air from the bulb, then, pierce the dialysis membraneanddraw out the dialyzed fluid 4 The procedure has been used for antibody btotmylatlon However, various proteins are brotmylated to a different extent and the useof these condtttons mtght affect the acttvtty of some proteins. Therefore, after brotmylatron use a peroxrdase or alkaline phosphatase-stepavrdmconlugate to monitor the brotmylatton and analyze the actrvity of the btotmylated protein If needed, you mtght be required to adJustthe brotmylatron condrtrons (time and concentratron). 5 Different sizes of petri dishes have been used for panning, from 60-mm tissue culture plates (e g , Falcon) to mrcrotlter wells
Screening on Nitrocellulose Membranes
193
6. The first cycle of bropanmng is crucial for the panning success smce each of the phage-displayed peptrde sequences IS represented by only a few hundred copies Therefore, the concentration of the selector protein should be relatively hrgh even at the expense of adsorbing low-affinity peptides 7 Other male E. C&E strains have been used for phage mfection. However, the K91 strain is preferred since it has about 5 pm/bacterium while most of the other strains have 0.5 prlr/bactermm 8 You may apply more stringent conditions to elute the phage by adding 300 mL of 8 M urea, pH 3.0, shaking the plate for 10 mm, and removing the urea by Centricon 30 concentrator (see Chapter 19, Subheading 3 1., step 7) 9. If the phage library confers bacteria with a resistance to tetracycline add 10 pL of 20 p.g/mL tetracycline to 1 mL culture medium At the concentratton of 0 2 pg/mL tetracyclme Induces the tetR gene promoter wrthout arresting protein syntheses. 10 Usually we plate only bacteria that were infected by three consecutive dilutions of the phage where we expect that one of the dilutions will give rise to about 100 colonies per plate. To titer the TU of eluted phage (Subheading 3.1.2., step 13), we plate bacteria that were infected wtth the first two dilutions We use only these two concentrations smce the expected TU of the first biopanning cycle 1s 104-105 11 Pretreatment of the mtrocellulose with antifilamentous phage antibodies increases the density of phage that bmd to the membrane and reduces the background levels upon immunodetectron 12. The results of immunodetectton vary at different HRP-strepavidm comugate dilutions To optimize the extent of the drlutions, it IS suggested to make a dot-blot analysis of the biotmylated selector protein at different protein concentrations and the HRP-strepavidin conjugate at different dilutions 13. One is not limited to the use of the ECL detection system Other rmmnodetection reagents that precipitate and stain the biotmylated protein directly on the NC membrane work as well, e g , alkaline phosphatase-strepavidm conjugate reactmg with bromo chloro indolylphosphate (BCIP), and nitro blue tetrazolmm WW
Acknowledgment This work was supported by the Rash1 foundation. References 1 Parmley, S F. and Smith, G. P (1988) Antibody selectable filamentous fd phage vectors. affinity puriftcation of target genes Gene 73,305-318 2 Scott, J. K and Smith, G P (1990) Searching for pepttde ligands with an eprtope library. Science 249,386-390. 3 Cwirla, S E., Peters, E A., Barrett, R. W , and Dower, W J (1990) Peptides of phage* A vast library of peptides for identifying hgands Proc. Nat1 Acad Scz USA87,6378-6382
194
Cabilly, Heldman, and Katchalski-Katzir
P , Tolba, K , Balm, D , Hrgelm, J , Takacs, B., 4 Hammer, J., Valsasnmi, and Sinlgaglta, F (1993) Promtscuous and alleleo-specific anchors m HLA-DR-binding pepttdes Cell 74, 197-203. 5 Blond-Elgumdr, S., Cwula, S. E , Dower, W J , Lrpshutz, R J., Sprang, S R , Sambrook, J F , and Gethmg, M-J H. (1993) Affinity panning of a library of peptrdes drsplayed on bacterrophage reveals the bmdmg specrfrcrfy of Blp Cell 75717-728 6 Gragerov, A , Zeng, L , Zhao, X., Burkholder, W , and Gottesman, M E (1994) Specificity of DnaK-pepttde bmdmg .I Mol. Blol 235,848-854 7 Keller, P M , Arnold, B A , Shaw, A R , Tolman, R L , Van Mrddlesworth, F., Bondy, S , Rusreckr, V. K., Koemg, S., Zolla-Pazner, S ,Conard,P., Emuu, E A., and Conley, A J. (1993) Identlftcatton of HIV vaccine candtdate peptrdes by screenmg random phage epttope hbrartes VU-ology 193,709-7 16 8 Estaqurre, J., Gras-Masse H , Bouttllon, C , Ametsen J-C., Capron. A., Tartar, A , and Aurrault, A (1994) The mtxotope. a combmatorral pepttde library as a T cell and B cell rmmunogen Eur J. Immunol 24,2789-2795 9. Folgort, A., Taft, R , Meola, A., Fehcl, F , Galfre, G , Cortese, R , Monaco, P , and Ntcosia, A. (1994) A general strategy to tdentrfy mtmotopes of pathologtcal anttgens using only random peptide lrbrartes and human sera EMBO J 13, 2236-2243 10 Smith, G. P and Scott, J K (1993) Lrbrarres of peptrdes and proteins displayed on frlamentous phage. Methods Enzymol 217,228-257
21 Identification
of Disease-Specific
Epitopes
Antonella Folgori, Alessandra Luzzago, Paolo Monaci, Alfred0 Nicosia, Riccardo Cortese, and Franc0 Felici 1. Introduction Phage-displayed peptide hbrartes (I) constitute a powerful and effective source for the rsolation of peptide mimics of antibody epttopes. Such pepttdes represent positrve images of the natural antigens and are, therefore, able to mrmrc some of then blologrcal properttes (2). We have developed a methodology to identify phage-borne peptides mimicking disease-specific epitopes that does not requrre either the availabrltty of or mformatton on the ortgmal antigen (which can even be unknown). This application of phage-displayed pepttde libraries opens new routes for the identification and characterization of reagents useful for dtagnosrs, prognosis, and prevention of diseases. In princtple, the distmguishmg feature of sera from patients affected by an infectious disease is the presence of a populatron of antibodies specific for the etrological agent. Selectmg a phage peptide hbrary usmg a patient’s serum wtll provide a mixture containmg posrtive phage clones; some of these will interact with antibodies normally present tn the serum, whrle others will be specific for the immune response to the etiological agent The use of sera that are not drsease-related (we ~111 call them “negative”) will allow discrimination between these two kinds of specifictty. The entire procedure hence mvolves a three-step protocol: affimty selection wtth one disease-spectftc serum; rsolatron of positive clones through screening with other patients’ sera; and tdentrficatron of disease-specific peptrde mrmrcs through counterscreening with several different negative sera. The arm of this strategy is to progresstvely reduce the complexrty of the populatton of phagedisplayed peptides to obtain a subset of clones that are able to react with most patient sera and not with sera from normal indtvtduals From
Methods
m Molecular Ecology, vol 87 Combmator/a/ Peptrde Edlted by S CablIly 0 Humana Press Inc , Totowa,
195
Library NJ
Protocols
Folgori et al
796 2. Materials 2.1. Affinity-Selection
of Phage
Peptide
Libraries
Using
Sera
2 1.1. Ammonrum Sulfate Precrpltatlon of Serum Antibodies 1 Ammonium sulfate 2 Phosphate-buffered salme (PBS) 8 g NaCl, 0.2 g KCl, 1.15 g Na,HPO,*7H,O, 0.2 g KH,P04, add Hz0 to 1 L The pH should be 7 4 (if necessary, adJUSt with HCl) 3 PBS containmg 0 02% NaN,
2 1.2. Preparation of UV-Killed Gamer Phage 1 M13K07 (Pharmacla, Uppsala, Sweden).
2 PBS (see Subheading
2.1 .l., item 2)
3 Petri dishes (diameter. 150-mm) 4 UV Stratahnker 2400 (Stratagene, La Jolla, CA) 5 NaN3, 5% stock solution
2.1 3. Bead-Coating
Procedure
1 Magnetic beads (Dynabeads M-450, Tosyl Activated, Dynal A.S). 2 Borate buffer* 50 m&f, pH 9 5 3 Antihuman Fc polyclonal antibody (Immunopure goat antlhuman Fc-specific unconjugated, Pierce, Rockford, IL) 4 Magnetic apparatus (Dynal) 5 PBWBSA 1X PBS, 0 1% Bovine serum albumin (BSA) 6 PBS/BSA/Tween 0 1 1X PBS, 0 1% BSA, 0 1% Tween-20
Ig(
2.1.4. Phage Selection 1 2 3 4 5 6 7 8
PBS/BSA/Tween 0.1 (see Subheading 2.1.3., item 6) Magnetic apparatus (Dynal) PBSIBSAITween 0 5. 1X PBS, 0 1% BSA, 0 5% Tween-20 Ml3K07 UV-killed phage (prepared as described m Subheading 3.1.2.) PBWTween 0 5: 1X PBS, 0 5% Tween-20 Elutlon buffer. 0 1N HCl adJusted to pH 2 2 with glycme, 1 mg/mL BSA 2 A4 Tns-HCl, pH 9 0 Amplclllm, X-gal, isopropyl P-D-thiogalactopyranoside (IPTG) plates* 50 pg/mL amplclllm, 35 yg/mL X-gal, 35 pg/mL IPTG, L-agar plates
2.2. Screening
of Affinity-Selected
Phage
2 2 1. Preparation of Bacteria/ Ceils for Phage Infection 1 XLl-blue E. toll strain (Stratagene) 2 Terrific broth (TB) with tetracycline. I2 g of Bacto-tryptone, 24 g of Bacto-yeast extract, and 4 mL of glycerol m 900 mL of dIstilled water. Autoclave on hquld
ldentificatlon of Dsease-Specific
Epltopes
197
cycle; allow to cool to 60” and then add 100 mL of a sterile solution of 0 17 M KH*PO,, 0 72 1w K,HPO,, and 20 yglmL of tetracyclme.
2.2.2. Phage Rescue and Plating of Phagemid Clones as Plaques 1 2. 3 4 5 6 7 8. 9 10
XLl-blue TB cells (prepared as described m Subheading 3.2.1.). 230 x 230-mm L-agar plates contammg 50 yg/mL ampiclllm, 1% glucose. M13K07 helper phage LB. 10 g/L Bacto-tryptone, 5 g/L Bacto-yeast extract, 10 g/L NaCl, pH 7 0 Autoclave on hquid cycle LB containing 50 pg/mL ampictllm LB containing 50 pg/mL ampicillm and 15% glycerol BBL top agar: 10 g/L Trypticase (BBL), 5 g/L NaCl, 10 g/L agar, pH 7 2 IPTG, L-agar plates 15-cm diameter L-agar plates contammg IPTG (35 pg/mL final concentration). Nitrocellulose filters (Schleicher & Schuell, Dassel, Germany, BA85,O 45 pm) IPTG, X-gal, L-agar plates. IO-cm diameter L-agar plates contaming 35 pg/mL IPTG, 35 pg/mL X-gal
2.2.3. lmmunodetection
of Positive Clones
1 3Chr paper (Whatman) 2. Immunoscreenmg buffer (I-buffer)* 1X PBS, 0.1% Nomdet P40,5% nonfat dry milk, 0 05% NaN, 3 PEG-concentrated M 13 phage prepared as follows a Make suitable dilutions of Ml3 phage stock using phage buffer (22 mM KH,PO,, 50 mh4 Na,HPO,, 85 mA4 NaCl, 1 mM MgSO,, 0 1 mM CaCI,, 0 1% gelatin) b Infect 200 PL of XLl-blue TB cells with 10 l.tL of the drlution, incubate 15 min at 37°C without shakmg, and plate onto L-agar plates c Take single plaque, add 100 pL of phage buffer, and supermfect a small (lo-50 mL) culture of XLl-blue TB cells d. Grow for 3-4 h at 37°C with vigorous shaking. e Dilute the culture up to 2 L with TB and Incubate overnight at 37°C. f Centrifuge for 30 mm, 42OOg (GS-3 rotor) at 4”C, and recover the supernatant. g. Precipitate M 13 phage by adding PEG 8000 and NaCl solution (4% and 0 5 M final concentrations, respectively) and incubate on ice for 4 h at 4°C h. Centrifuge for 40 mm, 4200g (GS-3 rotor) at 4’C, and resuspend phage pellet m 200 mL of 1X TBS (50 mM Tris-HCl, pH 7.6,150 mM NaCl) I. Incubate phage suspension 20 mm at 70°C m a water bath Centrifuge for 30 mm, 8400g (GSA rotor), and collect supernatant J Precipitate phage again by adding PEG 8000/NaCl to the resulting supernatant and incubate on ice for 2 h at 4°C k Centrifuge for 30 mm, 8400g (GSA rotor) at 4”C, and resuspend phage pellet m 20 mL of 1X TBS Titrate the phage as plaque forming units (phage titer should be around 10” phage/mL).
198
Folgori et al
4. Bacterial extract prepared as follows* a Grow XLl-blue bacteria m TB overnight at 37°C. b Centrifuge and resuspend the bactertal pellet m l/100 of the orlgmal volume of 1X PBS, 0 05% NaNs c Break the cells by French press, lysls, or somcation (or through other means), and store m aliquots at -20°C 5 Washing buffer (W-buffer). 1X PBS, 0 1% NP40 6 Alkaline phosphatase-conjugated secondary antibody For human sera use goat antihuman IgG Fc specific (Sigma, St Louis, MO) diluted 1 5000 m I-buffer 7 Substrate buffer: 100 mM Tris-HCl, pH 9.6, 100 mM NaCl, 5 mM MgCl, 8. Developing solution. add 66 pL of a 50 mg/mL stock solution of NBT (mtro blue tetrazolmm) m 70% NJ’-dimethylformamide and 33 l.tL of a 50 mg/mL stock solution of BCIP (5-bromo-4-chloro-3-mdolyl phosphate) in 100% N,N’dimethylformamide, to 10 mL of substrate solution.
2.2.4. /den trfication of Single Positwe Plaques 1 2 3 4 5 6 7 8 9 10
Phage buffer (see Subheading 2.2.3., item 3) XLl-blue TB cells (prepared as described m Subheading 3.2.1.) 50 pg/mL Ampicillm, 1% glucose, L-agar plates. LB contammg 50 pg/mL ampicillm, 1% glucose M13K07 helper phage LB medium BBL top agar IPTG, L-agar plates IPTG, X-gal, L-agar plates. Nitrocellulose filters (Schleicher and Schuell, BA85,O 45 pm)
2.3. Identification of Disease-Specific Epitopes 2.3.1. Small-Scale Prepara t/on of Phage Superna tan t 1, 2 3 4 5 6
Phage buffer (see Subheading 2.2.3., item 3) XLl-blue TB cells (prepared as described m Subheading 50 pg/mL Ampicillm, 1% glucose, L-agar plates LB containmg 50 pg/mL ampicillm M 13K07 helper phage. IPTG, 30 mg/mL stock solution m HZ0 (store at -20°C).
3.2.1.)
2.3.2. ELBA Usmg Sera 1 Multiwell plates (Immuno plate Maxisorp, Nunc) 2. Coating buffer. 50 mMNaHCOs, pH 9.6 3 Monoclonal antibody 57Dl (3) This antibody recognizes the N-terminal portton of the minor capsid protein (~111) of Ml3 phage It was generated by immunization of rats with a suspension of Ml 3 phage particles. Supernatant from 57Dl
ldentlficatlon of Disease-Specific
4 5. 6 7 8 9 10. 11. 12 13.
Epltopes
799
hybrtdoma 1sprecipttated using 50% (NH&SO,, dissolved m 1X PBS, and dialyzed Finally the antrbody IS immunopurrfred on protem G-Sepharose Washmg buffer. 1X PBS, 0 05% Tween-20. Blockmg solution: 5% nonfat dry milk, 0 05% Tween-20, 0 02% NaNs m 1X PBS Phage supernatants prepared as described m Subheading 3.3.1. XLl-blue bacterial extract (prepared as described m Subheading 2.2.3., item 4) PEG-concentrated Ml3 phage (prepared as described m Subheading 2.2.3, item 3) Supernatant from unrelated rat hybridoma cells. Alkalme phosphatase-conjugated secondary antibody For human sera use goat antrhuman IgG Fc specific (Sigma) diluted 1 5000 m blockmg solutton Substrate buffer. 10% diethanolamme, 0.5 mMMgCl,, 0.05% NaN,, adjusted to pH 9.8 with HCl Developing solution* 1 mg/mL of p-nitrophenyl phosphate m substrate buffer. Automated ELISA reader
2.3.3. Large-Scale Pun ftca t/on of Phagemid Clones 1 LB contammg 50 pg/mL ampictllm and 1% glucose, 2 LB containmg 50 pg/mL ampicillm 3. IPTG Prepare a 30 mg/mL stock solution m HZ0 and use at 0 1 nu’t4 final concentratton 4. M13K07 helper phage 5. PEG 8000 (Sigma) 6 Tris-buffered salme (TBS)* 50 mMTrts-HCl, pH 7 6, 150 mMNaC1 7 SW40 polyallomer tubes 8. TBS/CsCl solution 31% w/w CsCl m TBS 9. Polycarbonate capped tubes 10. 1X TBS/0.02% NaNs
2.3.4. Cross-Inhibition 1. 2. 3. 4, 5. 6. 7. 8. 9.
Assay
Multiwell plates (Immuno plate Maxtsorp, Nunc). TBS (see Subheading 2.3.3., item 6) CsCl-purified phage prepared as described m Subheading 3.3.3. Washing buffer: 1X PBS, 0.05% Tween-20 Blocking solutton 5% nonfat dry milk, 0 05% Tween-20, 0 02% NaN, m 1X PBS PEG-concentrated Ml3 phage (prepared as described m Subheading 2.2.3., item 3) XLI-blue bacterial extract (prepared as described m Subheading 2.2.3., item 4). Alkaline phosphatase-conjugated, goat antihuman IgG Fc-specific Ab (Sigma) Substrate buffer. 10% diethanolamme, 0 5 mMMgCl,, 0 05% NaN,, adjusted to pH 9.8 wtth HCl
200
Folgon
10 Developing solution 1 mg/mL of p-nltrophenyl 11 Automated ELISA reader
3. Methods 3.1. Affinity-Selection
et al.
phosphate In substrate buffer
of Phage Peptide Libraries
Using Sera
Serum antIbodIes are partially purified through ammonium sulfate preclpltatlon and tethered on beads using an antl-human secondary antlbody (see Note 1) The serum-coated beads are then used to affinity select phage from peptlde libraries based on the pVII1 expression system (#,5) (see Note 2) In most cases multiple rounds of affinity selection and phage amphflcation are necessary to eliminate nonspecific clones and to identify high-affmlty llgands for monoclonal antibodies or other homogeneous ligates (6) However, when sera are used for affinity selection, multtple rounds can lead to enriching phage clones that are recognized only by particular subsets of antibodies, and disease-specific ones might not be included among these. Hence, it 1s advisable to reduce to a minimum the number of selection rounds (in most cases one round 1s enough), and probe at once a large number of selected clones through immunoscreemng phage plaques to ldentlfy those that are posltlve (see Subheading 3.2.) 3.1 I Ammomum 1 2 3 4 5
Sulfate
Preclpltatlon
of Serum
AntIbodIes
Add 0 729 g of (NH&SO, to 3 mL of serum Rotate the tubes at room temperature until the salt 1s dissolved Incubate the tubes for 1 h at 4°C rotatmg the tubes throughout and then for 1 h on ice Centrifuge at 8OOOg, 4°C for 1 h m Corex tubes Resuspend the pellet m the original volume (3 mL), using PBS, by rotating the tubes at 4°C
6. Dialyze for 1 h agamst 1 L of PBS/O.02% NaN, Repeat 4x 7 Store frozen in ahquots at -20°C
3.1.2.
Preparation
1. Dilute
a purlfled
of UV-Killed
Carrrer Phage
phage preparation
at about lOI particles/ml m PBS (see through reading the AZG9
Note 3) Measure the number of partlcles/mL particles/ml
= AzG9x dilution factor x 6 x 10’6/8700
2. Distribute ZO-25pL drops on Petri dishes (150-mm diameter) An automatic dlspenser (for example, Eppendorf 4780) can be used, m order to save time and avoid plpet contammatlon 3 Perform 2-3 cycles of lrradlatlon with the Stratalmker at 200,000 pJ 4 Collect the lrradlated phage, add 0 05% NaN,, and store m I-mL allquots at 4°C 5. Check phage survival by titrating It both as Kanamycm transducmg units and plaque forming units Phage titer should be less than 10’ phage/mL
lcientifrcatlon of Disease-Specific
Epltopes
201
3.1.3. Bead-Coa tmg Procedure 1. Transfer 500 yL of throughly mixed magnetic beads stock suspension into an Eppendorf tube Insert the tube into the magnetic apparatus and eliminate hquld 2. Resuspend the beads m 1 mL of borate buffer, mix, and ellmmate the supernatant as above. 3 Resuspend the beads in borate buffer contaming 75 pg of antihuman Fc polyclonal antibody m a final volume of 1 mL and incubate for 24 h at room temperature on a rotating wheel 4. Discard supernatant using the magnetic apparatus and transfer the beads mto a Falcon tube m 10 mL of PBS/BSA. Wash the magnetic beads by rotating at 4”C, once for 10 mm, three times for 30 min, and then overnight After each washing step, Insert the tubes contammg the beads into the appropriate magnetic apparatus, removmg the supernatant (see Note 4)
3.1.4. Phage Selection 1 Transfer coated magnetic beads mto Eppendorf tubes, adding 300 yg of ammomum sulfate-preclpltated serum antibodies (see Subheading 3.1.1.) m PBS/BSA/ Tween 0.1, in a total volume of 1 mL. Incubate on a rotating wheel at 4°C for 12-16 h 2 Wash the beads 4x, 30 mm each time at 4°C with PBS/BSA/Tween 0.1; use 10 mL for each wash 3 Resuspend the magnetic beads m PBS/BSA/Tween 0 5, contammg 1 x lOI particles of UV-killed M 13K07, in a volume of 1 mL and put on a rotating wheel for 3-4 h at 4°C 4. Add 2 x 10” library phage particles, pVIII-9aa (4) or pVIII-9aaCys (5) to the above mixture and leave for 12-16 h at 4°C with gentle agitation 5 Remove unbound phage, washing the beads 6-7 times with 10 mL of PBS/Tween 0.1 at 4”C, 10 min each time, removing all liquid off beads after each wash using the magnetic apparatus 6 Elute bound phage by incubating the beads with 0.5 mL of elutlon buffer for 30 mm with gentle agitation at room temperature. 7 Transfer the eluate mto an Eppendorf tube and neutralize, adding 50 FL of 2M Tns-HCl, pH 9 0. 8 Titrate eluted phage as transducing units on amplclllm, X-gal, IPTG plates
3.2. Screening
of Affinity-Selected
Phage
To allow rapid and efficient identification of positive clones among large numbers of phage (105-106) we developed a method for the immunodetection of phage clones plated as plaques on filters (see Note 5). A phagemldcontaining bacterial population supermfected with helper phage 1s used to obtain phage plaques on a bacterial lawn; the positive plaques are then ldentlfied through lifting onto mtrocellulose filters and probing with crude sera. More than one patient’s serum can be used for the screening, as there will be a greater fraction of disease-specific ones among the corresponding “common”
202
Folgorl et al.
positive clones. Immunoscreemng procedure 1s further exploited positlvlty of the clones with patient sera.
to reconfirm
3.2.1. Preparatton of Bacterial Cells for Phage Infection 1 Inoculate XLl-blue bacterial cells from a fresh plate of mmtmal medmm m 20-30 mL of TB containmg 20 pg/mL tetracycline 2 Grow, wtth vigorous shakmg, at 37°C until OD,,, = 1 7 measured on a 1.10 dilutton of the culture m TB (corresponding to a concentratton of viable cells of about 5 x lo9 cells/ml) 3 Incubate the cells for further 15 mm at 37°C wrth gentle agitation to allow pm regeneration and use for infection within 60 mm (XL1 -blue TB cells)
3.2.2. Phage Rescue and Plating of Phagemid Clones as Plaques 1 Infect 1 mL of XLl-blue TB cells with selected phage Incubate at 37°C 15 mm without agitation and for a further 30 mm with vtgorous shakmg 2. Plate infected cells onto 50 pg/mL amptcillin, 1% glucose, L-agar plates and incubate overmght at 37°C Usually 105-lo6 cells are plated per 230 x 230-mm plate 3 Scrape bacterial cells from plate surface using 10 mL of LB medium containing 50 pg/mL amptcillm and 15% glycerol Store m ahquots at -20°C 4. Dilute an altquot of scrapedcells m 10 mL of LB containing 50 yglmL amprcillm to reach an OD6e0= 0 05 Incubate, with shaking, at 37’C until OD600= 0 25 Leave for a further 15 mm at 37°C wtthout shaking 5 Transfer 0 5 mL of the culture mto an Eppendorf tube and infect with M13K07 helper phage at a multtpltcity of mfectton (m o 1 ) of 20-50. Incubate for 15 mm at 37°C without agitation, and for a further 45 mm wtth vtgorous shaking 6 Spm for 5 mm in mtcrofuge Discard supernatant, resuspendm 1 mL of LB, and spm again, repeat three times to eliminate all nonadsorbedhelper phage Resuspend the pellet m 1 mL of LB 7 Mix 0 6 mL of XLI-blue TB cells with 30 l..tL of a 10m2dilution of the resuspended bacteria m LB Add 15 mL of melted top agar (from a water bath set at 50°C) and pour onto LB, IPTG plates (15-cm diameter, seeNote 6) It is tmportant to use well-dried plates 8 Lay mtrocellulose filters on the plates and incubate at 37°C overnight 9 To measure the titer and percentage of blue clones (4), plate a ddutton of the supermfectedbacterta (usually 10m6) wtth 0 2 mL of XLI-blue TB cells and 5 mL of top agar onto LB, IPTG, X-gal plates (lo-cm diameter)
3.2.3. lmmunodetectlon
of Positwe Clones
1 Mark the filters with a needle and then peel them off the plates Place the filters between two sheetsof 3Chr paper and roll them to remove excessbacteria 2. Block the filters wrth I-buffer for 2 h at room temperature, changmg the buffer four times (see Note 7)
ldentificatton of Disease-Specific
Epltopes
203
3. Prepare the serum-mix. 1 50-l 100 serum dilution m I-buffer, 5 x 10” particles/ mL of PEG-concentrated Ml3 phage, 20 pL/mL of XLl-blue bacterial extract Typically 20 mL of this mtx are used per filter. 4. Premcubate the mixture 2 h at room temperature on a rotating wheel and then add it to the blocked filters. 5. Incubate overnight at 4°C with gentle agitation 6. Wash the filters 10X at 4°C with W-buffer, 10 mm each time with agttation 7 Add to each filter 20 mL of I-buffer contammg the alkaline phosphataseconjugated secondary antibody and Incubate for 4 h at 4°C with gentle agitation 8. Wash the filters with W-buffer as described in item 6 9 Wash the filters once m substrate buffer, then incubate filters m developing solution at room temperature (typically 15 mL are used per filter) 10 Stop reaction by washing with HzO.
3.2.4. Identification of Single Positwe Plaques 1 Mark positive clones on filters by making holes with a needle (use 1 2 x 40-mm needles). 2 Posmon filter under the plate (or carefully lay it on the agar surface), collect phage clones by aspirating a portion of top agar that corresponds to the posmve signals using a Pasteur ptpet, and transfer to 200 pL of phage buffer 3 Heat at 70°C for 20 min and then centrifuge for 10 min in mtcrofuge to remove bacterial debris from the phage suspension (store at 4°C). 4 Infect XLl-blue TB cells with dilution of the phage suspension and incubate for 15 mm without agitation and for a further 30 mm with vigorous shaking at 37°C 5. Plate onto LB, 50 pg/mL amprctllin, 1% glucose plates and mcubate overnight at 37°C. 6. Pick some colomes (50-200) with a toothpick and inoculate altogether m 2 mL of LB containing 50 pg/mL ampicillin Grow at 37°C with vigorous shaking until ODesO = 0 25 7. Leave for a further 15 mm at 37°C wtthout shaking, and supermfect 0 5 mL of the culture with helper phage M 13K07. 8. Incubate for 15 mm at 37°C without agitation, and for a further 45 min with vigorous shaking 9 Centrifuge 5 mm m microfuge. Discard supernatant and wash the pellet three times with 1 mL of LB. Finally, resuspend the pellet in 1 mL of LB 10. Mix 0 2 mL of XLl-blue TB cells with 50 pL of a 10e4 dilutton of the resuspended bacteria m LB Add 5 mL of melted top agar and pour onto LB, IPTG (see Note 6) and LB, IPTG, X-gal plates (lo-cm diameter) 11 Lay mtrocellulose filters on the LB, IPTG plates and incubate at 37°C overnight. 12 Proceed to immunoscreenmg (see Subheading 3.2.3.)
3.3. Identification of Disease-Specific Epitopes In the last step of the strategy for selecting disease-specific epltopes the positive clones are tested for their reactivity
in ELISA
against a large number
Folgon
et al.
of positive and negative sera. This counterscreenmg is accompltshed through a procedure that is more sensitive and quantitattve than plaque immunoscreening and that does not require further purification of the phage supernatants (3). Phage particles displaymg pepttdes as fusion with the major coat protein pVII1 are tethered on the surface of microplate wells through a monoclonal antibody specific for the N-terminus of the minor capsid protein pII1 (see Note 8). Binding of serum antibodies to phage-displayed peptides is then revealed by using alkaline phosphatase-conjugated secondary antibody. A further characterization of the specrfic clones can be accomplished through crosscompetition, in order to classify the selected phage clones on the basrs of therr abtlity to react with the same anttbodtes. 3 3 I Small-Scale
Preparation
of Phage
Supernatant
1. Pick phage from single plaques using Pasteur ptpets and transfer them to mtcrotubes contammg 200 yL of phage buffer. 2 Heat at 70°C for 20 mm and then centrifuge for 10 mm m microfuge to remove bacteria from the phage suspenston 3 Use dtluttons of the phage-containing supernatant to Infect XLl-blue TB cells Phage suspension can then be stored at 4’C 4 Incubate for 15 mm without agitation and for a further 30 mm with vtgorous shaking at 37°C 5. Plate onto LB, 50 j.tg/mL amptctllm, 1% glucose plates and incubate overnight at 37°C. 6 Inoculate single colonies m 2 mL of LB contammg 50 pg/mL amprcillm, and grow at 37’C with vigorous shaking until OD6e0 = 0 25 7 Leave for a further 15 min at 37°C with very gentle agitation 8 Supermfect with helper phage M13K07 (m.o.1 = 30) and add IPTG (0.1 mM final concentration), mix gently for 10 mm, and then incubate at 37°C for a further 5 h wtth strong agttatton. 9 Transfer cultures into microtubes, spm m mtcrofuge to eltmmate bacterta, and store the phage supernatant at 4°C. Usually titers are above 1 x lOi TU/mL. 3 3.2. ELISA
Using
Sera
1 Aliquot mto each well of multiwell plates 100 pL of purified MAb 57Dl dtluted m coatmg buffer (see Note 9) Incubate for 12 h at 4°C 2 Discard the MAb and wash ten times with washing buffer 3 Add 250 pL/well of blockmg solution and incubate plates at 37°C for 1 h Coated plates can then be used rmmedtately or stored at -20°C for several weeks 4 Add to each well a mixture of 50 pL of blockmg buffer and 50 pL of cleared phage supernatant (see Subheading 3.3.1.). 5 Allow phage parttcles to bmd to the coated MAb for 1 h at 37°C 6 Premcubate 1 pL of serum m 100 pL of blockmg buffer contammg 2 5 pL of XLl-blue bactertal extract, about 5 x 10” pfu of PEG-concentrated Ml3 phage
Identification of Disease-Specific
7. 8 9 10 11 12 13
Epitopes
205
and 5 ltL of supernatant from unrelated rat hybrtdoma cells, for 1 h at room temperature. In this step, serum-contained antibodies directed against wild-type phage, bacterial contammants, and rat anti-p111 MAb are titrated. Discard phage supernatant from coated plate and wash wells 10X with washing buffer Add 100 pL/well of the premcubated serum mx and Incubate plate at 4°C for 12 h. Discard and wash wells 10x with washing buffer. Add 100 uL/well of alkaline phosphatase-coqugated secondary antibody, diluted 1*5000 m blocking solution, and incubate at 4°C for 4 h Wash plates ten times with washing buffer, and one more time with substrate buffer. Add 100 l.rL/well of developmg solution to reveal alkaline phosphatase reaction. The results are recorded as the difference between AdO5and A6s5by an automated ELISA reader.
3.3.3. Large-Scale
Purifica t/on of Phagemid Clones
1 Inoculate a single phagemrd-contammg colony into 10 mL of LB containing 50 l.tg/mL ampbllm, 1% glucose, and grow overnight at 37°C (glucose represses the expression of the pVII1 gene under the control of the lac promoter) 2 Dilute the overnight culture m 500 mL of LB containing 50 pg/mL Amptcillm to obtain an OD6c0 = 0 05 and grow at 37°C m a 2-L flask with vtgorous shaking until OD6c0 = 0.25. 3 Leave for a further 15 mm at 37°C with very gentle agitation Add IPTG (0.1 mA4 final concentration) to induce the pVII1 expressron from the lac promoter and superinfect with helper phage M13K07 (m o i = 30) Mix and leave for 15 mm at 37°C with no agitation to allow mfectron. Culture is then incubated at 37°C for 5 h with strong agrtatton 4. Centrifuge the bacteria/phage suspension for 30 min, 4000g (GSA rotor) at 4”C, and recover the supernatant. 5. Precipitate phage particles by adding PEG 8000 and NaCl solution (4% and 0.51w final concentrations, respectively), and mcubate on ice for 4 h. 6 Recover phage pellet by centrnfugation for 30 mm, 10,OOOg (GSA rotor) at 4°C and resuspend It in l/10 of the original volume with 1X TBS. 7. Incubate phage suspension for 30 mm at 70°C m a water bath to denature contaminating bacterial proteins, which are then removed by centrtfugation for 30 min, 12,000g (SS-34 rotor) at 4°C. 8 Precipitate phage agam by adding PEG 8000/NaCl to the resulting supernatant and incubate on ice for 2 h 9. Centrifuge for 30 mm, 12,000g (SS-34 rotor), 4”C, and resuspend phage pellet m 10 mL of 1X TBS. Centrifuge agam for 15 mm at 8OOOg(SS-34 rotor) to remove msoluble material 10 Dissolve 4 5 g of CsCl mto phage supernatant Transfer phage/CsCl suspension into a SW40 polyallomer tube, fill it with isotonic TBS/CsCl solution, and centrifuge at 173,000g for 48 h at 20°C.
Folgon et al.
206
11 Stop gradient without using the brake, and collect phage band (top band) Transfer to a polycarbonate capped tube, fill with TBS, mix, and centrifuge at 184,OOOg for 4 h at 4’C m 70 Ti rotor. 12 Stop the gradient with the brake Remove all supernatant and resuspend pellet m 500 pL of 1X TBUO 02% NaN, 13 Read AZ6s of a 1.50 dilution of phage suspension m TBS and determme the number of phage particles/ml particles/ml
3.3.4. Cross-Inhibit/on
= Aze9 x dilution factor x 6 x 10i6/3488
Assay
1. Aliquot into each well of multtwell plates 100 pL of TBS containing 2 x lOLo CsCl-purified phage particles (see Note 10) Incubate for 12 h at 4°C 2 Wash several times with washing buffer and block with 250 pL/well of blocking solution for 2 h at room temperature. 3 Dilute sera m blockmg buffer containing 1 x 10” Ml3 phage particles/ml, 50 pL/mL of XLl-blue bacterial extract, and 2 x 10’ ’ particles/ml of CsCl-purified mhibltor phagemtd clone. Premcubate overnight at 4°C 4. Discard blockmg solution from plate, add the premcubated serum mixture to the phage-coated wells, and incubate for 3 h at 4°C. 5 Wash extensively with washing buffer 6 Add 100 pL/well of alkalme phosphatase-conjugated secondary antibody, diluted 1 5000 in blocking solution, and allow to incubate at 4°C for 2 h 7 Wash plates several times with washing buffer, and once more with substrate buffer 8 Add 100 pL/well of a 1 mg/mL solution of p-mtrophenyl phosphate m substrate buffer to reveal alkaline phosphatase reaction.
4. Notes 1. Alternative methods can be used for affinity selection, for example, serum antibodies can be directly coated on the surface of polystyrene beads (7) The protocol described m Subheading 3.1. gives better results, probably because the serum antibody molecules are oriented on the beads’ surface through the use of the secondary antibodies, thus avoiding the partial denaturation that may occur m direct coating process 2 Peptlde libraries fused to the major coat protein (pVII1) display from tens up to several hundred pepttdes per phage particle This feature proved to be, when selecting with sera, a great advantage over other display systems 3. It is very important that the number of particles/ml is not higher than 1013, otherwise the phage ~111 not be efficiently killed 4 The coated beads can be stored at 4°C (adding 0 02% NaN,); m case of long storage (more than 2 wk), wash 3 times with 10 mL of PBS/BSA (5 mm each time) Just before use
ldenfifrcation
of Dsease-Specific
Epitopes
207
5. Specific detection of phage fusion proteins with sera by colony blottmg 1s ham-
6
7 8
9.
10
pered by cross reactlvlty of human sera with bacterial and/or phage proteins The lmmunoscreemng procedure described here reduces the background and Increases the signal to noise ratio. Instead of using LB, IPTG plates for the lmmunoscreemng, mtrocellulose filters can be soaked m LB contammg 35 pg/mL IPTG, air dried for 10 mm, and then layered onto L-agar plates When required, blocked mtrocellulose filters can be stored m plastic bags at 4°C for few days. The use of the anti-p111 monoclonal antibody m ELISA with crude phage supernatants slgmficantly reduces the background deriving from mteractlon of serum antibodles with bacterial proteins or other contaminants present m the culture Alternatively, CsCl-purified phage clones can be directly coated on ELISA plates usmg 10’“-lO1l phage particles m 100 pL of coating buffer per well, leaving the plates overnight at 4°C The optimal MAb concentration to be used for coating is experimentally determined for each batch of purlfled antibody through coating ELISA plates with serial dilutions of MAb 57D1, thus ldentlfymg the lowest concentration giving the highest slgnal Phage competition can also be performed using the anti-p111 ELISA system (see Subheading 3.3.2.) and nonpurified phage supernatants prepared directly from bacterial cultures In this case, phage fl-I 1 I (3) should be used as helper m the preparation of the competing phage to avoid signal reduction caused by Its bmdmg to the coated antibody fl-1 I I 1s an fl mutant bearing a substltutlon of the glutamlc acid at posltlon 5 of pII1 with a glycme, such mutation Impairs bmdmg of the mAb 57-Dl to pII1
Acknowledgments We thank Janet Clench for lmguistlc
rewslon of the manuscript.
References Smith, G P and Scott, J K (1993) Llbrarles of peptldes and proteins displayed on fllamentous phage. Methods Enzymol. 217,228-257. Cortese,R , Monaci, P., NIcosla, A , Luzzago, A., Fehcl, F , Galfrt?, G., Pessl, A , Tramontano, A , and Sollazzo, M (1995) Identiflcatlon of blologlcally active peptides using random libraries displayed on phage. Curr. Opm. Blotechnol. 6,73-80. Dente, L., Cesarem, G., Michell, G , Felice, F., Folgorl, A , Luzzago, A., Monaco, P., Nicosla, A., and Delmastro, P (1994) Monoclonal antibodies that recogmze filamentous phage Useful tools for phage display technology Gene
148,7-13 Fehci, F , Castagnoll, L , Musacchlo, A., Jappelh, R , and Cesarem, G (1991) Selection of antibody hgands from a large library of ohgopeptldes expressed on a multivalent exposltlon vector J. Mol. Biol 222,301-310
208
Folgori
et al.
5 Luzzago, A., Fehcl, F , Tramontano, A , Pessi, A , and Cortese, R (1993) Mrmrckmg of discontmuous eprtopes by phage-displayed pepttdes, I. Eprtope mapping of human H ferrttin usmg a phage library of constrained peptrdes Gene 128, 51-57. 6. Scott, J. K. and Smith, G P (1990) Searchmg for peptide hgands with an epttope library Sczence 249,386-390 7 Folgorl A , Taft, R., Meola, A , Felrcr, F , GalfrC G , Cortese, R , Monaco, P , and Nrcosia, A (1994) A general strategy to identify mrmotopes of pathologrcal antigens usmg only random peptlde hbrarles and human sera EMBO J. 13, 2236-2243.
22 Identification of Peptide Ligands for the Antigen Binding Receptor Expressed on Human B-Cell Lymphomas Markus F. Renschler,
William J. Dower, and Ronald Levy
1. Introduction B-cell lymphomas are malignancies of B-lymphocytes In most cases they express surface rmmunoglobulin receptors (sIgR) with an antrgen binding sate determined by the heavy and light chain variable regions. This antigen bmdmg site of the sIgR is an ideal tumor marker since it is unique to the tumor cells and shared among all the tumor cells from each individual. It can thus be used as a target for rmmunotherapy. Indeed monoclonal antibodies raised against the antigen bmdmg site (“idiotype”) of the Ig receptor can arrest the growth of lymphoma cells m vitro (I) and can induce complete tumor regressions and durable remissions in patients with lymphoma (2,3) The sIgR can be obtained m small quantities by lysing the tumor cells, or in larger quantities by establishing a hybridoma that secretes the sIgR. The purified receptor then lends itself not only for the study of novel targeted therapeutics, but also for the identification of natural or surrogate antigens to which it binds, Such antigens may be important in studying the etiology of lymphomas. If peptides can be found to bmd specifically to the sIgR, multimeric forms of such hgands can crosslink the receptors and activate the process that leads to programmed cell death or apoptosrs. Peptides can be synthesized easily and tend to be less immunogenic than monoclonal antibodies One potential advantage of employmg custom peptides rather than custom monoclonal antibodies lies in our ability to rapidly screen random peptide libraries containing a large number of peptrdes with diverse amino acid composition for the identification of the biologically active surrogate ligands. From
Methods
m Molecular Biology, vol 87 Combrnafonal Peptrde Edlted by S Cablily 0 Humana Press Inc , Totowa,
209
Lkvary
NJ
Protocols
210
Renschler, Dower, and Levy
Peptide hbraries contammg millions to billions of random peptides displayed on the filamentous bacteriophage fd-tet have been used successfully to identify hgands for a variety of receptors (4-10). The peptides are displayed on the phage as ammo-terminal fusion proteins with the minor coat protein pII1 or the major coat protein pVII1. The libraries are generated by inserting a collection of degenerate oligonucleotides with equimolar mcorporation of all four bases at every position into gene III or VIII of the double-stranded rephcative form of the phage (usually only G or T are mcorporated at every third position to reduce the number of stop codons). The ligated DNA is electroporated mto E toll, m which the phage can be propagated. Commonly, the inserted oligonucleotldes encode random peptides between 6 and 20 ammo acids m length. Only natural ammo acids can be mcorporated. Cychc peptides can be displayed by mcluding the codons for two cystemes m the ohgonucleotides inserted. Each phage displays approx 3-5 copies of the same peptide on ~111. In pVIII display libraries, wild-type pVII1 provided by helper phage is mcorporated mto the phagemid m addition to several hundred copies of peptide-pVIII fusion proteins, displaying the peptide at the ammo-terminus. The fusion protein 1s provided by the library phagemid under the regulation of an inducible promoter. The pVII1 display of peptides IS useful in the identification of ligands m which the pII1 libraries failed, since the high copy number of peptides lurked in a single structure through the phage increases the avidity of the phage bmdmg to the target. The ammo acid sequence of pII1 or pVII1 displayed peptides can be deduced easily by sequencing the single-stranded phage DNA. To identify the phage that display ligands to a receptor, the phage contained m the library have to be affinity purified. This is achieved by a process called panning, m which the library is incubated wtth immobilized receptor. The phage that display the peptide hgands can then be captured by the immobtlrzed receptor. The unbound phage are washed off, and the bound phage are eluted with acid. The recovered phage can be amplified by growth in E. coli for subsequent rounds of panning to further enrich for the binding phage After several rounds of panning, mdividual phage isolates are tested for their bmdmg to the receptor and to control receptors m an enzyme-linked immunoabsorbent assay (ELISA), or by colony lifts. Once specifically bmdmg phage are identified, the amino acid sequence is determined by DNA sequencing of the phage. Finally, peptides correspondmg to consensus sequences of the recovered phage are synthesized and tested for their binding to the receptor and for biologic activity Using this methodology we have identified ligands of the antigen binding site of purified sIgR from patients wrth lymphoma and from the human B-cell lymphoma cell line SUP-B8 (9). In this chapter, we will describe the methods needed for the identification of peptide ligands for the sIgR of patients with
lden tifica tion of Peptide Llgands
211
B-cell lymphoma. First, the purification of sIgR from hybrldomas established from tumor cells will be shown, followed by the panning protocol used in the identification of peptlde hgands with random peptlde libraries displayed on bacteriophage. An ELISA to determine the binding specificity of isolated phage clones will be explained. Methods to evaluate the binding of synthetic peptldes to purified sIgR and tumor cells follow. Finally, strategies to make peptlde multimers and methods to evaluate the effect of the peptide ligands on the tumor cells will be demonstrated. 2. Materials 2.1. Purification of Surface lmmunoglobulin from Tumor Cells 2.1.1. Establish Single Cell Suspension of Tumor Cells from Biopsy Ma terra/ 1 Tumor biopsy specimenm sterdesaline (alert surgeon to maintain sterility and to 2 3. 4 5 6. 7 8
put specimen into salme, not formalin) The biopsy material may be shipped overnight via express mall on ice (not dry ice, since cells should not freeze). Processmg media RPM1 with 5% fetal calf serum (FCS), 100 U/mL penmlhn, and 100 pg/mL streptomycm Sterile scalpel blade (#22 or others). Sterile metal tissue sieve, approx 40 mesh Nylon mesh, e.g , Nltex monoscreen (Falrmont Fabrics, Hercules, CA). Attach the nylon mesh to a small funnel and autoclave Sterile 12-mL syringe Sterile Petri dish Sterile 50-mL centrifuge tube
2.1.2. fuse Tumor Cells with a Mouse Myeloma Heterohybridoma Complete media (CM). RPM1 with 10% FCS, supplemented with 2 mM glutamme, 100 U/mL pemclllm, and 100 pg/mL streptomycin (see Note 1) Hanks Balanced Salt Solution (HBSS) without Ca2+ or Mg2+ IMDM/HMT. Iscove’s Modified Dulbecco’s Medium (IMDM) with 15% FCS, 2 mM L-glutamine, 0 1 n&f hypoxanthine, 0.4 pA4 methotrexate, 16 @4 thymidine (1X HMT) (made by diluting 50X HMT stock [Sigma, St Louis, MO] 1.50 with above media). IMDM/HT: IMDM with 15% FCS, 2 mM L-glutamme, 0.1 mM hypoxanthme, 16 FM thymidme (1X HT) (made by diluting 50X HT stock (Sigma) 1:50 with above media) 40% w/v Polyethylene glycol 1500 (PEG 1500, BDH Laboratory Supplies, Poole, UK) m HBSS, made by adding 3 mL HBSS to 2 g PEG in a glass tube, and autoclavmg the tube (see Note 2) 96-Well flat-bottom tissue culture plates. K6H6B5 cells (American Type Culture Collection [ATCC] , Rockvllle, MD).
212
Renschler, Dower, and Levy
8. At least 5 x 10’ log-phase K6H6B5 cells, growing in complete media. They should be at a density of approx 3-7 x IO5cells/ml with greater than 80% viability as determmed by trypan blue exclusion 9 Tumor cells as prepared m Subheading 3.1.1., ideally 1 x lo8 cells. 10 Insulated cup or Styrofoam contamer to serve asa 37°C water bath m the lammar flow hood
2.1.3. Screen the Hybridoma for Product/on of slgR
6
7 8 9 10. 11
12 13.
Microtiter ELISA plates. Goat anti-human IgM or IgG unlabeled antibody Goat anti-human K- or h-horseradishperoxidase (HRP)-conJugated anttbody Supernatants from fusion (see Subheading 3.1.2.) 0 05 M Carbonate buffer, pH 9 6. 0.015 M sodium carbonate (1 59 g anhydrous Na,CO,/L), 0.035 M sodiumbicarbonate (2 93 g NaHCO,/L), store at 4°C for no longer than 2 wk Phosphate-buffered salme(PBS) I 9 mMNaH,PO, (0 23 g anhydrous NaH,PO,/ L), 8 1 mM Na2HP04 (1 15 g anhydrous Na,HPO,/L), 154 mA4NaCl(9 0 g/L), pH 7 2-7 4 (adJustwith 1 M NaOH or 1 M HCI). Blocking buffer PBS, 50 g/L nonfat dry milk (from grocery store) PBS, 1% bovme serum albumm (BSA). 10 g/L BSA ELISA wash buffer. normal salme, 0.5% Triton X-100* 5 mL Triton X-100/L, 9 g NaCllL water. 50 mM citrate buffer, pH 4 0 5 25 g citric acid monohydrate per 500 mL, adJust pH to 4.0 wtth approx 10 mL 3 N NaOH ABTS dye solution. 15 mg/mL ABTS (2,2’-azmo-di-(3-ethylbenzthtazolmesulfonate, Boehrmger Mannhelm, Indianapolis, IN) m water or citrate buffer Store at 4°C m dark Make fresh every month Hydrogen peroxide, 30% Substrate solution: prepare fresh before use: 10 mL citrate buffer plus 0.1 mL ABTS dye solution plus 3.3 pL 30% hydrogen peroxide
2.1.4. Affinity Purify sigh’ Complete media (see Subheading 2.1.2., item 1) T175 tissue culture flasks 500-mL, 0 48-ym Filter sets 2 A4Tris base (approx. at pH 10 0) Spectra/Por*4 dialysis membranetubmg, molecular weight cutoff 12,000-14,000 (Spectrum Medical Industries, Houston, TX), with appropriate clamps 6 For the purification of IgGs. a. Protem A-sepharose CL 4B (Pharmacia Fme Chemicals, Piscataway, NJ) b Tris-HCl buffered saline. 0 05 MTris,0.15 MNaCl,pH 8 6 (6 06 g Tris, 8 76 g NaCl m 800 mL water, add 10 M HCI to pH 8 6 and add water to 1 L) c Elution buffers 1 2. 3 4 5
/den tifica tion of Pep tide Ligands
213
1 0 1 M Cttric acid, 0 2 MNa2P04, pH 3.5, 2 O.O5MGlycme-HCl,O.lSMNaCl,pH2 3(5.6gglycme-HC1,8 76gNaCl m 800 mL water, add 10 M HCl to pH 2.3, bring to 1 L wtth water). d. 1 x lo-cm chromatography column 7 For the purtfrcatron of IgMs a Cyanogen bromide activated sepharose 4B, (Pharmacta Fme Chemicals) b 30 mL Buchner funnel with coarse smtered glass filter (Krmax, Vineland, NJ) c Tube rotator d Mouse antihuman IgM monoclonal antrbody We use our own lD12 monoclonal antibody (see Note 3). e Couplmg buffer 0 2 M NaHCOs, 0 5 A4 NaCl, pH 9 0 f 50mMTris-HCI,pH80,05MNaCl. g. Sodrum acetate buffer. 0 1 M NaAcetate, pH 4.0,O 5 M NaCl h 02MGlycme,50rn&ZTris,pH8.0,05MNaCl i 1 m M HCl, pH 3 0 (Dilute 38% (12 M) stock 1 12,000) J Elutron buffer 0 1 M glycme-HCI, pH 2.4
2.2. Panning
with Phage
Libraries
2.2.7. lmmobilrzatlon of Receptor on Plates 1 Purrfred sIgR 2 Mrcrottter 96-well ELISA plates. 3 PBS (see Subheading 2.1.3., item 6). 4 PBS, 1% BSA (Ace Subheading 2.1.3., item 8) 5 0.05M Carbonate buffer, pH 9.6 (see Subheading 2.1.3, item 5) 6 12-posrtion microtest manifold with self-refillmg syringe (Wheaton, NJ) or 12-channel ELISA plate washer (Corning, Corning, NY) 7 Goat antrhuman IgG or IgM anttbody coqugated to HRP.
Mrllville,
2.2.2. Screening plll Phage Libraries 1 pII1 Phage libraries (see Chapters 16,17 or ref. II for detailed protocols on phage library construction). 2 Cold PBS (see Subheading 2.1.3., item 6). 3 Binding buffer. PBS, 0.1% BSA 4. Elutton buffer: 0 1 N HCl, pH adJusted to 2.2 with glycme, 0.1% BSA 5 2 A4 Trrs base, pH unadjusted 6 E colz K91 cells (ATCC) 7. LB medium, per L 5 g Bacto-yeast extract, 10 g Bacto-tryptone, 5 g NaCl, 1 mL 1 N NaOH , autoclaved . 8 lo-cm LB agar plates with tetracycline (20 yglmL). 5 g Bacto-yeast extract, 10 g Bacto-tryptone, 5 g NaCl, 15 g Bacto agar, 1 mL 1 NNaOH m 1 L, autoclave and cool to 6O”C, then add tetracyclme, 20 mg/L, mix, and pour mto lo-cm bacterial plates
Renschler, Dower, and Levy
214
9 15-cm LB agar plates with tetracycline (20 pg/mL) made as above 10. 20% (200 g/L) Polyethylene glycol (PEG) 8000,2 5 MNaCl Autoclave to solublhze PEG
2.3. Screening
Phage Isolates for Binding
Specificity
1. Titer plate from the third or fourth round output with approx 100 colomes per plate 2 Sterile toothplcks. 3. PBS,0 1% BSA 4 ELISA plates coated with alternating rows of sIgR and control sIgR and blocked with PBS, 1% BSA (see Subheading 3.2.1., item 1) 5. Horseradish peroxldase (HRP)-conJugated sheep anti-Ml3 antibody (Pharmacla) 6 ELISA substrate solution (see Subheading 2.1.3., item 13)
2.4. DNA Sequencing
of Phage
1 1 mL Overnight culture of phage-Infected bacteria 2 Sequenase Version 2 0 DNA sequencing kit (Umted States Blochemlcals, Cleveland, OH) 3 pII1 Sequencing primer (5’-CGA TCT AAA GTT TTG TCG TCT-3’) 4 Prep-A-gene DNA purification kit (Blo-Rad, Hercules, CA). 5 6% Polyacrylamlde/7 M urea/TBE gel (38 x 50 cm)
2.6. Evaluation Ligands
of Binding
Specificity
of Synthetic
Peptide
1 HPLC-purified synthetic peptlde with a carboxytermmal extension, such as glygly-lys, with the &-ammo group of lysme blotmylated before synthesis of the peptide. 2 Purlfled s&R, purified control sIgR 3 Mlcrotlter ELISA plates 4 Streptavldin or avldm. 5. HRP-conJugated goat antihuman IgG or IgM antlbody 6 ELISA reagents as m Subheading 2.13. 7 Tumor cells m single cell suspension 8 Streptavldm-phycoerythrm (Becton-Dlckmson, San Jose, CA). 9. PBS, 1% BSA, 0.05% azlde (PBS/BSA/azlde) 10 RPM1 medmm with 5% FCS 11 Flcoll-Paque (Pharmacla Biotech) I2 PBS, 1% paraformaldehyde
2.6. Multimerization
of Peptide Ligands
1 HPLC-purified synthetic peptlde with a carboxytermmal gly-lys, with the E-amino group of lysine blotmylated peptlde
extension, such as glybefore synthesis of the
215
ldenfification of Pepticfe Lfgands 2. Avtdin or streptavtdm. 3. Normal salme or PBS
2.7. Evaluation
of Effects of Peptide Ligands on Tumor Cells
1 Tumor cells in single cell suspensron 2 Trrs-buffered salme wtth Tween/BSA (TBST/BSA). 3
8 9.
10 11. 12 13 14 15
10 mM Tns-HCl, 150 mM NaCl, pH 8 O,O.l% Tween-20,1% BSA. NP-40 lysrs buffer 137 mM NaCl, 20 mM Tns-HCl, pH 8 0, 2 mM EDTA, 1 mMphenylmethyl-sulfonyl fluorrde (PMSF-caution, extremely toxic), 1 mM Na3V04, 1% NP-40, 10% glycerol, 10 pg/mL leupeptm, 1 pg/mL aprotinm Anti-phosphotyrosme antibody 4GlO (Upstate Brotechnology, Lake Placid, NY) Goat arm-mouse IgG-blotm (Southern Biotechnology Assoc, Bummgham, AL). Streptavldm-HRP (Vector Laboratones, Burlmgame, CA) Nitrocellulose transfer membrane, 0 45-pm pore size, BA85 (Schlelcher and Schuell, Keene, NH) PBS (see Subheading 2.1.3., item 6), 100 mM sodmm orthovanadate (Na,VO,) 100X stock solution Cold PBS, 1 mMNa3V04 Dilute 100 mMNa,VO, 1 100 m PBS and put on ice Peptide hgand multlmer (see Subheading 3.6.) 8% SDS-PAGE gel. SDS sample buffer (5X). 312 5 mM Trrs base, 10% glycerol, 11 5 % SDS, 500 mM DTT or 25% 2-mercaptoethanol, pH to 6 8,0 1% bromophenol blue Transfer buffer. 0 039 M glycme, 0.048 M Trls base, 0 0375% SDS, 20% (v/v) methanol Gel blot paper GB002 (Schlelcher and Schuell) ECL Western blotting reagents and film (Amersham Lrfe Sctence, Arlmgton Heights, IL).
3. Methods 3.1. Purification
of Surface lmmunoglobulin
from Tumor Cells
Despite advances m recombinant protein techniques, hybridoma technology remains the first choice for the productron of sIgR from patients with B-cell lymphoma. The steps from biopsy materral to the purrfied s&R are outlined in Fig. 1. First, the biopsy specimen 1s gently disrupted to obtain tumor cells in single cell suspension. The tumor cells are fused with a murme myeloma fusion partner The fused cells are plated into 96-well plates and grown m selectrve media. The productron of sIgR of the correct Ig lsotype 1s measured by ELISA of the supernatants The clones secreting the correct isotype are expanded to 24-well plates, and their productron level 1s assessed by ELISA The highest producmg clone is then expanded to large flasks The tissue culture supernatants contammg the sIgR are harvested. In the final step, the sIgR 1s affmlty purified from the trssue culture supernatant. These steps are detailed below.
Renschler, Dower, and Levy
276 1
Tumor Cell Suspension c
2
Tumor Cell Fusion with BYK6H6 Mouse Myeloma Fusion Partner 4 3
Hybndoma Growth m 96 Well Plates 4
4
ELISA Screenmg for Tumor sIgR Expressron c
5
Selectron of Highest Producing Hybndomas and Expansron 4 6
Harvesting of sIgR Contammg Culture Supematant 4
7
Affunty Punficatron of sIgR from Hybndoma Supematants
Fig 1 Isolatton, productron,
and purification
of B-cell lymphoma sIgR protein
3.7.7. Estabilsh Slngie Ceil Suspension of Tumor Ceils from Biopsy Ma teriai Wear gloves for your protection when handling human specimens All tissue culture work 1s performed using aseptic techmques m a lammar flow hood The lymph node sample IS transferred mto a sterile Petri dash m a lammar flow hood, cut into thm shces, and minced with a stertle scalpel Add a small amount of processmg medta to the &sue and force the pieces through the stertle metal sieve mto another sterile Petrr dash usmg the flat end of a sterile syrmge plunger Transfer the cells to a 50-mL centrifuge tube and centrtfuge for 10 mm at 300-500g (1000-1500 rpm) m a benchtop centrifuge Resuspend the cell pellet m processing media and pass through the sterile nylon mesh Remove a small altquot for a cell count The remainder of the cells are used for the rescue fusion with the mouse myeloma fusion partner
217
/den tifrca t/on of Peptide Ligands 3.1.2. Fuse Tumor Cells with a Mouse Myeloma Heterohybridoma This protocol has been modified
from our previously
published
method (12).
1 Prewarm the PEG solutron and HBSS solutron to 37°C m a water bath 2 Pellet the tumor cells by centrifuging them for 7-10 mm at 300-5OOg at room temperature Resuspend them m 10 mL HBSS (see Note 4). 3 From the cell count of the tumor cells (see Subheading 3.1.1., item 5), determme the number of K6H6B5 cells needed for the fuston. 4 The ratio of tumor cells to K6H6B5 cells should ideally be 2 1, with a minimum of I:1 and a maxtmum of 3.1 Thus for every 1 x lo6 tumor cells, 0 5 x lo6 K6H6B5 cells are needed (see Note 5). 5 Abquot the appropriate number of K6H6B5 cells mto a 50-mL centrtfuge tube 6. Wash the tumor cells m one tube and the K6H6B5 m another tube by pelletmg the cells at 300-500g for 7-10 mm, decantmg or aspirating the supernatant, and resuspending the cells in 40 mL HBSS 7 Repeat step 6, but resuspend the cells m 20 mL HBSS. 8. Pool the resuspended tumor cells and K6H6B5 cells mto one 50-mL centrifuge tube. 9. Pellet the cells again at 300-500g for 7-10 mm. Aspirate off all fluid from the cell pellet. 10 From here on, the followmg steps should be performed wrth the tubes immersed in an Insulated beaker or Styrofoam container filled with 37°C warm water 11. With the tube capped, resuspend the cells by tapping the tube vrgorously with the finger. 12 Qmckly add 1.5-2 mL of prewarmed (to 37’C) 40% PEG in HBSS This should be done by allowmg the PEG to pour down the side of the tube to evenly coat the cells. 13. Swirl the tube gently to mix the PEG with the cells, for 1 5-2 min The ttme the cells are exposed to PEG IS crmcal, so use a timer. 14. After 1 5-2 mm, add 1 mL HBSS every 1.5 s untrl the total volume IS 10 mL. Continue to swirl the tube, agrtatmg the cells gently with the tip of the prpet while addmg the HBSS medmm 15. Quickly refill the water in the Insulated cup or mm1 bath with fresh water at 37’C to mamtam a constant temperature of 37°C. 16. Add 2 mL of HBSS approximately every 1.5 s, to a total volume of 45 mL, again gently swirling to mix 17. Pellet the cells at 300-4OOg for 7-10 minutes 18. Resuspend the cells m IMDM/HMT (see Subheading 2.1.2., item 3) at a concentration of 1 25 x lo6 to 1 5 x lo6 cells/ml 19. Plate the cells into 96-well flat-bottom tissue culture plates by addmg 0 2 mL/ well. 20. Place the cells mto a CO, mcubator (5-7% CO,, 37°C)
218
Renschler, Dower, and Levy
21 The next workmg day, examme the cells for bacterial contammation. After that, mmimize the disturbance of the cells by leaving them m the Incubator undtsturbed until they need to be fed or split 22 Check the fusion for hybrid growth after 7-10 d 23. Feed the cells by addmg 20-100 pL of IMDM/HT media (see Subheading 2.1.2., item 4) to each well on day 9 or 10, accordmg to cell growth and evaporation Assay the supernatants for production of the right isotype by ELISA 2 d after feeding with IMDM/HT Expand the cells into 24-well plates and subsequently to flasks m IMDM/HT when the media turns yellow After 1 to 2 media changes, change media to RPMI-based complete media (see Subheading 2.1.2., item 1)
3 1.3. Screen the Hybndoma for Production of slgR 1 Coat the ELISA plate with the goat antihuman IgG or IgM antibody (dependmg on the isotype of the patient’s tumor) by adding 50 x yL/well unconJugated antibody diluted m carbonate buffer to 10 ,ug/mL Incubate overnight at 4°C or for 2 h at room temperature Wash ELISA plate by immersmg it mto a bucket of ELISA wash buffer and fhckmg out the wash buffer mto the sink. Repeat eight ttmes Block the ELISA plate by adding 100 pL blockmg buffer Incubate for 30 mm at room temperature. Wash with ELISA wash buffer eight times Take blocked ELISA plates to lammar flow hood and transfer 50 pL supernatant from each well of the hybrrdomas growmg m 96-well culture plates using a multtchannel pipetor and sterile pipet tips If there are very few wells growing, the supernatants can be transferred one by one Be careful not to contammate the hybridomas . 6 Incubate for 45 mm Wash with ELISA wash buffer eight times 7 Add second step horseradish peroxidase-labeled goat anti-light chain antibody (either goat anti-h or goat anti-@, diluted 1:lOOO to 1 5000 (dependent on antibody) m PBS, BSA, 50 pL/well. Incubate 45 mm at room temperature Wash with ELISA wash buffer eight times 8 Add substrate buffer, 100 pL/well Read OD at 405-490 nm after 30 mm. 9 The cells from the wells that give a strong signal are expanded sequentrally from 96-well plates to 24-well plates and then mto flasks Freeze an ahquot of cells from the 24-well plates and store m liquid nitrogen (as m Note 4) 10 Rescreen the supernatants when the media turns yellow m the 24-well plates, by repeatmg steps 1-8 This time however, add 100 pL of supernatant from each clone mto one well m the top row of the plate, and then serially dilute the supernatant into blockmg buffer by removing 50 FL/well from the top row and adding tt to 50 FL blockmg buffer m the next row Mix and repeat the dilution to the next row In the left-most column mclude a standard Ig at a known concentration (10 or 20 pg/mL). Perform the ELISA as outlined above The concentration of the sIgR m the supernatant can then be approximated usmg least squares regression
Identrf~cat~on of Peptide Ligands
279
11. Carry forward approxtmately five of the highest producing clones, and rescreen 1-2 wk later for sIgR production levels
3.7.4. Affinity Purify s/g/? 1 The best clone is then grown m T175 flasks The media 1s removed when it becomes yellow, and the adherent cells are gently flushed off the flasks with a stertle Pasteur pipet. Approximately 100 mL fresh complete media IS added to each flask Centrifuge the spent media at 1500g (2500 rpm) m 250-mL centrifuge tubes for 15-20 min. Filter the supernatants through a 0.4%pm filter, and store at 4°C until ready to purify the sIgR 2. For purification of IgGs (this protocol is modified from Oi[13]): a Swell 1.5 g protein A-Sepharose CL4B m Tris-buffered salme, pH 8 6 Pour the slurry (now 5-6 mL) mto a suitable chromatography column Use 1-3 mL per column b Go through the elutlon step once to clean column Add lo-15 mL elutton buffer, pH 2 3, to the column Subsequently wash column with 50 mL Trisbuffered salme. c Adjust filtered tissue culture supernatant to pH 8 6 with dilute NaOH. d. Run pH-adjusted supernatant through the column The capacity of the column is up to 10 mg per mL beads It is convenient to run 500-I 000 mL supernatant over the column, to recover l-5 mg of sIgR. e. Wash the column wrth loo-150 mL Tris-buffered salme, pH 8 6 f Save a fractron of the supernatant, the flowthrough, and the wash flowthrough for troubleshootmg Elute sIgR with 10 mL of the citric acid elutron buffer (pH 3.5) first. Collect g fractions into spectrophotometer cuvets and measure the OD,,, If no protein is recovered, elute with 10 mL glycme elutron buffer, pH 2 3 Save samples with OD2s0 > 0.1, neutralize with 30 pL 2 M Tris base per mL eluate, and pool samples For pure products of human IgG, the conversion from OD2s0 to IgG concentration in mg/mL is as follows OD,s,/l
43= IgG concentratron m mg/mL
h. Add eluate into dialysis tubing, clamp, and dialyze into l-2 L PBS overnight at 4”C, change to fresh PBS the next day, and dialyze for another day 3. For purification of IgMs a Couplmg of the anti-IgM antibody to the sepharose (see Note 3) 1 The day before couplmg, dialyze the appropriate amount of anti-IgM antibody mto couplmg buffer overnight at 4°C Bring to a concentration of 2 mg/mL. 2. Swell 1 g CNBr-activated Sepharose 4B m 100 mL 1 mMHC1, pH 3.0, m a beaker for 15 mm The gel will swell to a volume of approx 3.5 mL (XY Note 6).
220
Renschler, Dower, and levy 3
Pour gel mto a Buchner funnel with smtered glass filter and wash gel rapidly with 200 mL 1 mMHC1, pH 3 0, then wtth 100 mL coupling buffer to bring pH to 9 0 4 Transfer the gel lmmedtately to a screw-cap plastic tube containing 3.5 mL of the monoclonal anti-IgM antibody at a concentratron of approx 2 mg/mL m couphng buffer. (The ratio of monoclonal anttbody to gel should be 2 0 mg per mL gel, thus for the 3 S-mL gel, approx 3 5 mL (7 0 mg) antibody are needed m the tube before the gel 1s added). 5 Cap the tube tightly and rotate end-over-end for 2 h at room temperature or overnight at 4°C 6. Transfer the gel to a Buchner funnel wtth smtered glass filter Aspirate dry and measure the OD,,, of the aspirate to check the coupling efftctency Compare the OD,,, of the startmg maternal to that of the aspirate More than 90% conjugation should be obtained 7 Incubate the gel m 200 mL 0.2 M glycme pH 8 0 buffer for 2 h to block the excess active groups 8 Transfer the gel to a Buchner funnel wtth smtered glass filter Aspirate dry and expose the gel to 3 cycles of alternatmg 0 1 M sodium acetate buffer with 50 mMTris buffer, pH 8 0, to wash away the unbound protem 9 Wash the gel with 200 mL PBS. 10 Apply the gel to a suitable chromatography column. Clear the column wtth 15 mL elution buffer (0.1 M glycme-HCl, pH 2.4), and wash the column with 100 mL PBS b Purtfrcatron of the human IgM from supernatants usmg this affinity column 1 Run filtered tissue culture supernatant through the antihuman IgMsepharose column In contrast to Protein A purtftcation of IgGs, the pH does not need to be adjusted. The capacity of the column 1s approximately 2-3 mg It is convenient to run 500-1000 mL supernatant over the column, dependent on the IgM concentration of the supernatant. 2 Wash the column with 100-150 mL PBS 3. Save a fraction of the supernatant, the flowthrough, and the wash flowthrough for troubleshootmg 4 Elute the IgM with 15 mL elutton buffer (0 1 M glycme-HCl, pH 2 4) Collect fractions into spectrophotometer cuvets and measure the OD2s0 Save samples with OD2s0 > 0.1, neutralize with 30 uL 2 M Trts base per mL eluate, and pool samples For pure products of human IgM, the conversion from OD,,, to IgM concentration m mg/mL is as follows OD,s,/l 185= IgM concentratton m mg/mL 5. Dialyze antibody into PBS (as m Subheading 3.1.4., step 2h) c. For all purified sIgRs, check the purity by exammmg the proteins on a reducmg and nonreducmg 8% SDS-polyacrylamlde gel, and confirm the protem concentratton obtamed by OD2s,, and by any standard protein assay, such as the BCA assay from Pierce by followmg the manufacturer’s recommendations (see also vol 32 of this series, Chapter 2)
221
Men tifica tion of Peptide Ligands 1. Round
Apply
Phage
Immobilized
slgR
+ Elute
+
Titer A (Output)
4 Amplify
-+
Titer B (Input
2. - 4. Round
Library
next round)
4
YYYYYY I Elute
-w
Titer C
Amplify I
+
Titer E
x2 l l l
Control
slgR
Elute
+
Titer D
4 Pick Individual Colonies Screen for binding specificity Sequence DNA
Fig. 2. Affinity purification of phage displaying ligand through multiple rounds of panning on immobilized sIgR.
3.2. Panning
with Phage Libraries
(see Note 7)
The methods in this section are adapted from Cwirla (71, Dower (II), and Renschler (9). The strategy for panning with random peptide libraries on bacteriophage is outlined in Fig. 2. The sIgR is immobilized on ELISA plates. The phage library is applied to the coated and blocked ELISA plate. After incubation, the unbound phage are washed off, while the bound phage are eluted with acid. A small aliquot of the eluted phage is titered to determine the amount of phage recovered (Titer A). The phage are amplified by overnight growth in E. coli. Phage are purified from the bacterial culture and are titered to determine their concentration (Titer B). In subsequent rounds, the amplified output from the previous rounds is split, and a fraction is applied to sIgR-coated
222
Renschler, Dower, and Levy
ELISA wells, while another fraction 1s applied to class-matched control sIgRcoated wells. After washing off unbound phage, bound phage are eluted from both the sIgR and the control sIgR. The eluted phage from both are titered (Titers C and D), and enrichment durmg the panning process is expressed as a ratio of the sIgR output titer (Titer C) and the control sIgR output titer (Titer D): enrichment = Titer C/Titer D. Only the phage eluted from the sIgR are amplified, titered (Titer E), and used for the next round. After three to four rounds of panning, individual phage isolates can be amplified from the bacterial plates used to titer the output, and are used m phage ELISAs to determine the binding specificity. Specifically binding isolates are then subjected to DNA sequencing. The DNA sequence of the phage allows one to deduce the amino acid sequence of the peptide displayed Each of the steps is outlined below in detail.
3.2.1. Immobilization of Receptor on P/a tes 1 It is important to achieve the highest density of sIgR on the surface of the ELISA plate This is done by testmg the bmdmg conditions that lead to optimal coating of the microtiter ELISA plates. Coat microtiter plate with 50 uL per well of sIgR at 20,10,5,2 5, and 1 0 ug/mL m PBS and at the same concentrations m carbonate buffer (Subheading 2.1.3., item 5) for 1 h at 37°C Wash plate with PBS, block for 1 hour at 37°C with PBS, 1% BSA, wash, and detect coating by adding 50 pL of a goat antihuman IgG or IgM antibody (dependent on isotype of the patient’s sIgR) coqugated to HRP, diluted 1’1000 to 1 5000 m PBS, 1% BSA. After 1 h, develop with ABTS substrate buffer as described in Subheading 3.1.3., step 8 Use the lowest concentration that gives the maximum signal m the optimal buffer for pannmg with phage or phagemtd libraries. 2 For the actual panning, coat 6 wells in one row of a 96-well ELISA plate for each library and sIgR to be screened with 50 PL sIgR. Leave blank rows m-between wells to be screened with different libraries or coated with different sIgRs to
minimize
contamination.
Incubate for 1 h at 37°C Wash the plate with PBS by
filling the wells to the top with the 12-position microtest manifold hooked up to a self-refillmg syrmge (Subheading 2.2.1., item 6), then flicking out the PBS into the smk If you use the Corning 12-channel ELISA plate washer, the wells can be aspirated dry with the washer. Repeat 8 times. Block the plates by filling the coated wells with PBS, 1% BSA, and mcubatmg them for 1 h at 37°C Repeat the wash with PBS and use them for incubation with the phage library
3.2.2. Screening pill Phage Libraries 1 Preparation Streak E. ~011 K91 fresh K91 bacteria contamination The wtth a single colony
bacteria on an LB-plate. For each round of panning, grow from a single colony picked from the stock plate to avoid day before the screening, 5 mL of LB medium are maculated of K9 1 bacteria from the stock plate, and grown overmght at
Identification of PeptIde L/gancfs
2
3.
4.
5.
223
37°C with shaking On the day of the screen, 20 ml LB medmm are maculated with 1 mL of the overnight culture m a lOO-mL flask and grown to OD6c0 = 0.5 Centrifuge bacterta at 15OOg (2500 rpm) in a desktop centrifuge for 5 mmutes Resuspend in 2 mL LB medium (10X concentrated K91) Incubation with phage library Use plugged aerosol-resistant ptpet tips for all phage work a. Dilute 1000 library equtvalents mto 600 pL PBS/O 1% BSA (If the library has 5 x lo8 independent recombmants, then the total number of phage added m 1000 library equivalents would be 5 x 10” transducing units [ml) BSA is used m all the bmdmg buffers to decrease the recovery of BSA-specific clones that may bmd to the BSA on the ELISA plate b Add 100 pL mto each of the 6 wells coated with sIgR and blocked with PBS/ 1% BSA c. Cover the plate wrth parafrlm and incubate at 4°C for 2 h (see Note 8). Washing. a. In the first round, wash the wells gently by filling with cold PBS and asprratmg approx five times After the first round the washmg can be more vigorous (see Note 9) b In the second round, wash as above, then add cold PBS and incubate at 4°C for 30 mm, then repeat the first washing step In the thud and fourth round, the PBS should no longer be cold, and washing can be even more vigorous. Elution and phage tnermg a. Add 100 ltL glycme-HCl elutron buffer to each well Incubate for 10 mm at room temperature. b. Aspirate elution buffer from each well and pool m a mtcrocentrtfuge tube (total of 600 FL). c Immedtately neutralrze with 35 pL 2 M Trrs base. d Titer the phage eluate to determine the number of phage recovered by preparing lo-fold serial drlutrons of phage m LB medium. Change prpet tips at each dilution step. Add 100 PL diluted phage from 3 drlutions each to 100 ,uL 10X concentrated K91 cells Expect approx lo6 TU after the first round, lo7 TU after the second round, and greater than lo8 TU after the third and fourth round if there is enrichment for phage binding to the sIgR specrftcally. Incubate at 37°C without shaking for 20 mm Plate 100 pL onto IO-cm LB-tetracycline plates. Grow overnight at 37°C The next day, count the colonies Use the plate that has about 100 colonies to determine the titer The total number of phage per mL 1s colony count x dilution factor (e.g., 105) x 20 TU. The factor of 20 1s derived from the amount of phage used to infect K91 cells (l/10 of 1 mL of diluted phage, of which half is plated onto the LB-tetracyclme plates) Amphficatton. a Add 600 pL of the neutralized eluted phage to 600 pL 10X concentrated K91 cells (Subheading 3.2.2., step 1). Incubate at 37°C for 20 mm without shaking.
224
Renschler, Dower, and Levy
b. Plate 400 yL of the infected K91 cells to each of three 15-cm LB-tet plates c. Incubate overnight at 37°C The next day the plates should be covered with a lawn of small colomes 6 Phage isolatton a Add 10 mL LB media to each of the three 15-cm bacterial plates Incubate for 10 mm at room temperature b Gently scrape the bacteria off the plates using a sterile spreader, aspirate the media with a ptpet, and pool the media from all three plates c. Centrifuge bacterial suspension at 12,000g for 15 mm. The phage will remam m the supernatant d Transfer the cleared supernatant to a clean centrifuge tube and add 0 2 vol 20% PEG/2 5 M NaCl to precipttate the phage Mix well and incubate on ice for 1 h. e Centrrfuge at 12,000g for 15 mm Remove the supernatant, bemg careful to remove as much of the PEG as posstble Resuspend the pellet m 1 mL PBS t Heat the phage suspension for 15 mm m a 70°C water bath to kill the remammg bacteria g Titer the amplified output as m Subheading 3.2.2., step 4d Store the amphfled output at 4°C for up to 24 h, or at -20°C mdefnutely 7 Subsequent rounds of panning Use lOi to 10” TU of the amphfied phage for the next two rounds of panning, following the same procedure as for the first round If there is significant enrichment (phage recovered from sIgR phage recovered from control sIgR > 10) after the third round, a fourth round may be omitted, or may be performed using l/l0 of the number of phage used m the previous round as the Input This helps to reduce the background From the second round on, the titer plates used to determme the number of phage recovered can be saved for later use m the characterization of recovered clones With successive rounds of panning, one should also see mcreasmg recoveries, mdrcatmg that enrichment for certam phage is occurrmg This does not guarantee, however, that enrichment of spectftcally bmdmg phage is occurrmg Specificity is evaluated with the use of phage ELISAs (see Note 10).
3.3. Screening
Phage Isolates for Binding
Specificity
The recovered clones from phage library panning can be characterized m an ELISA, in which the binding of amplified and harvested phage clones to tmmobiltzed sIgR and control sIgRs is detected wtth an antiphage anttbody (14) sIgR and control sIgR are coated onto the surface of plastic microtiter ELISA plates. Unoccupied sites are blocked wtth BSA to avoid the binding of plasticspecific clones The phage are added and allowed to come to an equilibrium with the tmmobilized receptors. The plate IS washed, and bound phage IS detected with HRP-labeled sheep anti-M 13 antibody. ABTS substrate is added to visualtze the bound antibody (see Note 12).
Ident/fication of PeptIde Ligands
225
Using a sterrle toothpick, pick up mdrvidual colonies from the titer plates used to determine the amount of phage recovered in the last round of panning Transfer the colony to 2-3 mL LB-media with tetracyclme (20 mg/L) and grow overmght at 37°C m a shaker Coat microtiter ELISA plates with alternating rows of sIgR and a control sIgR, and block with PBS, 1% BSA (see Subheading 3.2.1., step 1) Take the overmght culture and spin down bacteria m a microcentrifuge for 5 mm at 18,500g (15,000 rpm) Apply 50 pL of this supernatant to each of 4 wells, 2 wells coated with sIgR, 2 wells coated with control sIgR. Thus each clone takes up a square of 4 wells on the ELISA plate. If the signal is too high, dilute the supernatant 1.5 or 1:lO m PBS, 0.1 % BSA. If the signal is too weak, the phage from 1 mL of an overnight culture can be concentrated by precipitation with 0.2 ~0120% PEG, 2 5 M NaCl followed by 30 mm incubation on ice The phage are pelleted by centrifugation m a microcentrifuge at 18,500g (15,000 rpm) for 15 mm. The pellet IS resuspended m 0.5 mL PBS, 0.1% BSA for the ELISA Add 50 pL of concentrated phage to each well m a similar fashion If purified and titered phage stocks are used, add 2-5 x lo9 TU to each well. Incubate for 2 h at 4°C Wash wells with PBS Add 50 pL HRP ConJUgated rabbit anti-Ml3 antibody diluted 1.3000 to each well, and incubate for 1 h at 4°C. Wash wells with PBS and add 100 pL ABTS ELISA substrate solution (see Subheading 2.1.3., item 13). After 30 mm, read the OD405-490wrth a microtiter plate reader Clones that give at least a twofold stronger signal from the sIgR than the control sIgR are subjected to DNA sequencing (see Notes 13 and 14)
3.4. DNA Sequencing
of Phage
The amino acid sequence of the peptrdes displayed by the deduced by DNA sequencing of the gene III, where the library was inserted (see Note 15). Standard single-stranded dideoxy tocols are employed. A variety of commercial DNA isolation to purify single-stranded DNA template for DNA sequencing. the Prep-A-Gene kit to be simple, fast, and reliable.
3.4. I Smgle-Stranded
binding clones is oligonucleotide sequencmg prokits are available We have found
DNA Preparatton
1. Grow pII1 clones as m Subheading 3.3. m a small, 2-5-mL overnight culture 2 Add 1 3 mL of the overnight culture of mdividual clones to a mtcrocentrtfuge tube and centrifuge at 18,500g (15,000 rpm) for 15 mm 3 Add 500 pL Prep-A-Gene bmdmg buffer to new microcentrifuge tubes Transfer 1 .OmL of the supernatants to the tubes filled with binding buffer Invert several times and Incubate at room temperature for 5 mm with intermittent mversion of tubes to lyse the phage particles.
Renschler, Dower, and Levy
226 4 Add 15 PL of Prep-A-Gene
matrix to each tube. Vortex tubes to resuspend the
matrix and incubate at room temperature for 10 mm with intermittent
mixing
5 Centrifuge the tubes for 30 s m a nncrocentrrfuge at 18,500g (15,000 rpm) to pellet the matrix Aspirate the supernatant. Add 250 ILL 1 M NaC104 (binding buffer diluted 1.6) to each tube and vortex to suspend the pellets. 6. Centrifuge for 30 s to pellet the matrix and aspirate the supernatant Repeat the 1 M NaC104 wash. 7. Resuspendthe pelleted matrix m 250 yL Prep-A-Gene wash buffer by vortexmg. Centrifuge to pellet the matrix, aspirate the supernatant, and repeat this wash two more times. Be careful to remove all the supernatantafter the last wash. 8. Resuspendthe matrix m 40 l.tL Prep-A-Gene elution buffer by vortexmg Incubate for 5 mm at 37°C m a water bath to elute the DNA. Centrifuge for 30 s to pellet the matrtx and carefully remove the single-stranded DNA-contammg supernatantto a clean tube Analyze 5 pL by agarosegel electrophoresis A band should be visible
3.4 2. Smgle-Stranded
DNA Sequencing
1 Sequence the single-stranded template DNA using the dideoxy method and Sequenase2 0 The pII1 sequencingprimer anneals40 basepairs downstream of the 3’ BstXI clonmg site in fAFF1 For detailed mstructronson DNA sequencing, seeChapter 16, Subheading 3.4. (15). 2 Load the sequencing reactions on a 6% polyacrylamtde/7 M urea/TBE gel and run the gel until the bromophenol blue has migrated off the gel Expose X-ray film and read the sequencethe next day
3.5. Evaluation of Binding Pepticle Ligands
Specificity
of Synthetic
From the amino acid sequences of the specifrcally binding clones, a consensus sequence can be identified. If there are poorly conserved residues among the sequences, mutagenesrs libraries can be made to better define the crrtrcal residues (9, see also Note 16). The ammo acid sequence of a phage isolate that is closest to the consensus is then chosen for a synthetic peptide bgand. The binding specificity can be evaluated in an ELISA as well as with flow cytometry.
3.5.1. ELISA 1 The microtiter ELISA plate is coated with 50 pL/well streptavidm or avldm at 10 pg/mL in carbonate buffer (Subheading 2.1.3., item 5) for 2 h at room temperature or overnight at 4°C The plate 1swashed with ELISA wash buffer
(Subheading
2.1.3., item 9)
2 Block the plate with either PBS, 1% BSA, or PBS, 5% nonfat milk for 30 mm at room temperature Wash the plate with ELISA wash buffer
Identification of Peptide Llgands
227
3 Add 50 pL of the synthetic biotmylated peptide m PBS or salme at a concentration of 10 yglmL, and incubate for 30 minutes at room temperature. Wash the plate with PBS 4. Add 50 p,L sIgR at 5 p.g/mL in PBS, 1% BSA. Incubate for 1 h at room temperature. Wash with PBS. 5. Add 50 pL of an HRP-conjugated goat antihuman IgG or IgM antibody and develop ELISA as in Subheading 3.1.3. (see Note 17).
3.5.2. Flow Cytometry 1. Thaw the tumor cells frozen in hqmd nitrogen m smgle cell suspensron (see Note 4), wash them once m RPMI, 5% FCS, resuspend them m 2 mL of the same, and layer them on top of 5 mL Ficoll m a 15mL centrifuge tube 2 Centrifuge at 1OOOg (2000 rpm) for 30 min. The dead cells will mtgrate to the bottom of the tube, while the live lymphocytes will remam at the interface between the ficoll and the RPM1 Aspirate the cells from the interphase with a Pasteur pipet. Wash the cells twice in PBS/BSA/azide. Resuspend the cells in PBS/BSA/azrde and count them 3 Ahquot 1 x lo6 cells mto 5 mL tubes, centrifuge at 500g (1500 rpm) to pellet cells, and pour out supernatant. 4 Add 50 pL biotmylated peptide at 20 pg/mL and incubate for 30 mm on ice 5. Wash cells twice in PBSlBSAlazide 6 Add streptavidm-phycoerythrm, 25 yL per sample, and incubate for 30 mm on ice 7 Wash cells twice m PBS/BSA/azide Resuspendcells m 0 4 mL PBS/BSA/azrde if they will be analyzed within an hour, or m 0 4 mL PBS, 1% paraformaldehyde if they are to be analyzed later 8 Analyze by flow cytometry, gatmg on lymphocytes (seeNote 18)
3.6. Mulfimerlzation of Peptide Ligands We have shown that monomeric synthetic peptide ligands have no effect on B-lymphoma cells (9). Several strategies to generate peptide ligand multimers have been employed, resulting in active peptide dimers or tetramers that crosslink sIgR. The crosslinking triggers a signal transduction cascade that leads to cellular protein tyrosine phosphorylation, extracellular acidification (16), inositol phosphohpid hydrolyses, protem kmase C activation, and ultrmately to programmed cell death or apoptosis. 3.6.1. Strategies to Generate Peptide Mu/timers at the Synthetic Level 1 Synthesis of a tandem repeat peptide, m which the bmdmg motif is contained twice m the peptrde, separatedby 6 glycmes. For example, a hgand for the human lymphoma cell lure SUP-B8 is YSFEDLYRR (9) A tandem repeat peptide we have found to be actrve IS YSFEDLYRRGGGGGGYSFEDLYRR
Renschler, Dower, and Levy 2 Synthesis of a “MAP”
peptide (multiple antigen peptide) tetramer on branching lysines according to the method of Tam (17,18), m which the peptide is extended on both the a- and E-ammo groups of lysmes Because of solubihty concerns, we have only gone to tetrameric structures.
3.6.2. Strategies to Link Monomeric Peptldes Synthesis of a monomer with the carboxytermmal extension GGC, followed by oxidation of the monomeric structures to dimeric structures 2 Synthesis of monomeric peptides with the carboxytermmal extension GGK, with the E-ammo group of lysme biotmylated before synthesis of the peptide This avoids a biotmylation reaction that would biotmylate lysmes m the active portion of the peptide The peptide monomer IS then mixed with streptavidm or avidm at least at a 4 1 molar ratio and rotated for 30 mm at room temperature This results m an active tetrameric structure. The advantage of this approach is that for the price of one synthesis, you obtain a biotmylated monomerrc peptide that can be used to assess bmdmg m an ELISA or by flow cytometry, and a multimeric peptide that can crosslmk sIgR and can be used to assess biological activity.
3.7. Evaluation
of Effects of Peptide Ligands on Tumor Cells
Antiproliferative effects of the peptide hgand multimers can be determmed when lymphoma cell lines are available. However, it is difficult to grow most lymphoma tumors. As an alternative to measurmg antiproliferative effects, early events m the srgnal transduction cascade that follow sIgR crosslmking and that ultrmately lead to apoptosis can be measured in tumor cells. The mduction of cellular protein tyrosine phosphorylation within minutes of sIgR crosslmking correlates with clmical responses seen m patients treated with antridiotypic monoclonal antibodies (19), and can be measured by Western blotting of cell lysates (9,19,2/J). The method will be described m this section. Other early trrggermg events that could be measured include changes in mtracellular calcium and changes m extracellular acidification rates (16). 1 Thaw cells rapidly, resuspend m 12 mL CM (Subheading 2.1.2., item l), and centrifuge for 5 mm at 500g (1500 rpm) Remove supernatant Wash again m 10 mL CM. Resuspend m 10 mL CM 2 Count cells and resuspend at 2 x lo6 cells/ml Ahquot 1 mL per sample mto 1%mL tubes and mcubate at 37°C for 60 mm m a water bath. 3 Activate cells with antibody or peptides at 37”C, using a goat anti-IgM or IgG antibody (dependent on isotype of the tumor) at 10 pg/mL as a positive control, an irrelevant class-matchedantibody at 10 pg/mL asa negative control, and peptide hgand dimers or tetramers as well as scrambled control peptide hgands at 5 @Z concentratton Add the antibodies or peptides to the cells and incubate at 37°C for 30 s, 1, 2, 5, 10, and 15 mm to establish a time course of the cellular tyrosme phosphorylation. One seesvariation in peak protein tyrosine phosphory-
identification of PeptIde Ligands
4
5 6.
7 8. 9 10 11
12.
13
229
latlon from tumor to tumor wlthm that range. Start with the samples that have the longest incubation times first, and incubate the samples with shorter incubation times in the meantime. Stop the reactlon by adding 10 mL cold PBS, 1 mM sodium orthovanadate Na,VO,, a phosphatase inhibitor, and put tubes on ice until the reactions of all samples have been stopped Centrifuge all stimulated cells at 500g (1500 rpm) for 5 mm m a centrifuge cooled to 4°C. Remove supernatants Wash cells with 10 mL cold PBS, 1 mM Na3V0,, and centrifuge at 5OOg (1500 rpm) for 5 mm at 4°C Remove supernatants (wipe out tube carefully to remove all supernatant) and invert tube on a rack to dry out Lyse cells by adding 100 pL per tube of NP-40 lys~sbuffer contammg Na,VO, Incubate 1 h on ice or overnight at 4’C Transfer to mlcrocentrlfuge tubes Centrifuge 10 mm at 18,500g (15,000 rpm) at 4°C Keep supernatants,discard pellets Add 20 pL of the supernatant to 5 pL SDS sample buffer, boll for 5 mm, and apply 20 pL to an 8% SDS PAGE gel Freeze the remainder of the lysate at -80°C Electrotransfer proteins from polyacrylamlde gel to nltrocellulose* Transfer the gel to a glass dish contammg transfer buffer and place the mtrocellulose membrane underneaththe gel, letting It soak Soak SIXsheetsgel-blot paper, place m a semidry gel blotter, place mtrocellulose with gel on top into blotter, cut off unnecessarygel and mtrocellulose with a scalpel or sharprazor blade, and place three soakedgel-blot paper sheetson top of gel Remove air bubbles by rolling a plpet over the blot. Electrotransfer for 2 h according to the manufacturer’s mstructlons (seealso vol 32 of this series,Chapter 24) Remove the mtrocellulose and incubate overnight m PBS, 5% nonfat milk
(Subheading
2.1.3., item 7)
14. Incubate blot with the goat antimouse IgG-blotm antibody diluted 1.5000 m TBST/BSA for 1 h at room temperature. 15. Wash the blot 3X by gently rocking it in 100 mL TBST/BSA for at least 15 mm each wash 16 Incubate blot with streptavldin/HRP diluted 1: 10,000 m TBST/BSA for 30 mm 17. Wash the blot 3X with TBST/BSA for at least 15 min each wash 18. Blot nitrocellulose dry with blottmg paper 19 Add 10 mL ECL reagentsmixed 1: 1 and Incubate for 1 mm 20 Blot dry with blottmg paper, wrap in cellophane, and expose film for approx 1 mm This film will serve asa control to show equal loadmg of all the wells, since the goat antlmouse IgG-blotm antibody crossreacts with a protein of 76 kDa apparent molecular massin all samples. 21 Incubate blot m TBST/BSA overnight on a rocker at room temperature 22 Incubate mtrocellulose blot for 2 h at room temperature with antlphosphotyrosme antibody 4G 10 diluted in TBST/BSA to 0.04 pg/mL
Renschler, Dower, and Levy 23. Wash the blot three times with TBST/BSA for at least 15 mm each wash 24 Incubate blot with the goat antimouse IgG-biotm antibody diluted 1*5000 m TBST/BSA for 1 h at room temperature 25. Wash the blot three times by gently rocking it in 100 mL TBST/BSA for at least 15 mm each wash 26 Incubate blot with streptavidm/HRP diluted 1 10,000 m TBST/BSA for 30 mm 27 Wash the blot three times with TBST/BSA for at least 15 mm each wash 28 Blot mtrocellulose dry with blotting paper 29 Add 10 mL ECL reagents mixed 1.1 and incubate for 1 min. 30 Blot dry with blottmg paper, wrap m cellophane, and expose film for approx 1 mm
The samples treated with a crosslinking antibody or with crosslinking peptide hgand multimers should show a strong induction of tyrosme phosphorylation of many proteins with different molecular masses, whereas the untreated, control antibody or control peptide treated samples should show only few proteins with phosphotyrosines.
4. Notes 4.1. Purification
of Surface lmmunoglobulin
from Tumor Ceils
1 When purifying IgGs, especially if using supernatants from a hybridoma with low human IgG production, it is possible to get significant contamination with bovine IgG from the fetal calf serum that will copurify using protein affinity chromatography In that case, we recommend the usage of low-Ig FCS Because of the added expense, we do not use low-Ig FCS otherwise 2 The supplier of the PEG used m the fusion IS important. We have had good results with the PEG from BDH 3 The ID12 murme monoclonal antihuman IgM antibody that we use for affinity purification of human IgM has been unusually good in binding and m releasmg the human IgM product However, the coupling ratio of antibody to sepharose is critical for good performance. Thus, when purifying IgMs, it may be possible to recover no IgM from the affinity chromatography column even though the hybridoma is producing adequate amounts of IgM In that case it may be helpful to evaluate input and output of the column as well as the flowthrough of the washmg step Using an ELISA, one can see if the protein did not bmd to the column, if it came off during the wash, or if it is still attached to the column. If the protein is not recovered from the column, one could try to make another sepharoseantihuman IgM column using a lower coupling ratio of 1 or
lcientifica tion of Pep tide Llgands
231
water bath, washed once in complete media, resuspended in 40 mL complete media, and incubated for 1 h at 37°C m the incubator. Thawed cells are subsequently used for the fusion as described m Subheading 3.12. 5. The K6H6B5 fusion partner is itself a non-Ig-secreting hybrid cell origmally made by fusing the mouse myeloma NS-I with the tumor cells from a patient with lymphoma. It therefore contams human chromosomes and results in subsequent human fusions that are more likely to retain other human chromosomes, retaining their production of the human Ig protein In experienced hands, the fusion is successful m >75% of specimens. Repeated attempts at fusing the tumor cells with the heterohybridoma K6H6B5 are recommended should the first attempts fail to yield clones, or to yield producmg clones However, there are some patients whose tumors cannot be fused, even after repeated attempts 6. While column preparation can be scaled up, we do not recommend to use columns with more than 4 mL slurry. Larger columns can make it impossrble to elute the sIgR off the column
4.2. Panning
with Phage Libraries
Avoid contamination problems Use aerosol-resistantpipet tips, work neatly, and clean out pipetors with alcohol periodically Use a fresh batch of bacteria for each round of amplification 8 Incubation of the phage libraries for greater than 2 h at 4°C does not improve recovery of specifically bmdmg clones, but may actually increasethe recovery of nonspecifically binding clones 9 The first round of panning has to be done the most carefully. Phage lost m the first round cannot be recovered Thus the washing conditions in the first round should be the least stringent, using cold PBS, and the least vigorous In subsequent rounds, the vigor of the washing step and the temperatureof the washbuffer can be increasedm a stepwtsefashion. 10 Increasing recoveries of phage from round to round are usually seen, although the increasemay not be specific, 1.e , the recovery from the sIgR is increasing as well as the recovery from the control sIgR However, specifically binding clones may still be found m the panning output. Thus, we go through four rounds of panning if there IS no specific enrichment, and then evaluate the resultant clones for bmdmg specificity with phage ELISAs We screen 24-48 clones If no specifically binding clones are identified, chances are they were not amplified or present m the library and we use another library If only a few specifically bmding clones are identified, larger numbers of clones can be screened with phage lifts, m which bacterial colomes Infected with phageare lifted onto mtrocellulose filters (a,11 seeaZso Chapters 20,21). The mtrocellulose filters are then blocked, and incubated with sIgR. The sIgR bound to the filters is detected with alkaline phosphatase-conjugatedgoat antihuman IgG or IgM antiserum. A double lift allows differential screening using a control sIgR as well as the sIgR of Interest. Only specifically binding clones are then picked from the original bacterial plate, grown, and tested in a phage ELISA. 7
232
Renschler, Dower, and Levy If there is specific enhancement (greater than lo-fold difference m recoveries from the sIgR than the control sIgR), we stop the panning and screen mdividual isolates with a phage ELISA Sometimes a single clone will predommate In that case clones from earlier rounds are screened for their bmdmg specificity and then subjected to DNA sequencmg
4.3. Screening
Phage Isolates
11 An alternative method for the screenmg of a large number of phage isolates are phage lifts, described m detail by W Dower (II) 12 It is not always possible to identify peptide hgands for the sIgR expressed on lymphoma cells with 8-mer and 1Zmer pII1 phage libraries In some cases, we were successful by screening pII1 libraries displaymg cychc peptides. A further option is to screen the receptors with pVII1 phagemid libraries, which are described m Chapters 17,21 In some cases, we had to resort to plasmid libraries m which pepttdes are dtsplayed as C-terminal fusion proteins with LacI to identify peptide hgands (21) Diversity seems to be of major importance. We have had to screen up to 1 8 x IO” independent recombinants to fmd a smgle hgand m some cases. 13 If only nonspecifically bmdmg clones are identified, one can try to pan the library m the presence of excess control protein m solution Other formats n-r which a biotmylated receptor IS free m solution durmg the panning and then captured on streptavidm-coated plates can be tried as well (4,ZO) 14 If the clones identified do not bmd to either sIgR or controls sIgR, overgrowth with wild-type phage or phage without library Inserts may be the problem. The DNA of a few isolates should be sequenced to see if they have inserts.
4.4. DNA Sequencing
of Phage
15 Because a single clone may have outgrown other clones, it IS advisable to first sequence only about 5-10 of the specifically bmdmg clones from a given round If there IS no diversity m the sequences, clones from earlier rounds can be screened. In some cases, we had to go back to the second round of panning to get anythmg but the predominant clone.
4.5. Evaluation of Binding Peptide Ligands
Specificity
of Synthetic
16. Ammo acids that are not very homologous among the hgands identified for a given sIgR can be better defined by screening mutagenesis libraries (9) These hbraries are generated m pII1 phagemrd vectors by base for base mutagenesis of the library ohgonucleotide. For each position in the library oltgonucleotide, the base that encodes the ammo acid of the consensus sequence IS mcorporated 70%, while the remaining 30% are split equally among the three other bases Codons of ammo acids that are not clearly defined are left entirely random, incorporating A, C, G, and T equally at the first two positions of the codon, and G and T equally at the third position This mutagenesis scheme results m a bias towards the con-
ldenfifrcation
of Peptic/e Ligands
233
sensus sequence, yet allows for sufficient varlablhty that poorly defined residues can be better defined. With pII1 phagemid libraries, monovalent display is possible, allowing the selection of higher affinity peptlde lzgands. The resultant libraries are panned as described m this chapter, and speclflcally binding clones are evaluated by phage ELISA or phagemld lifts 17 Some sIgRs from patient tumors will bind to blocked ELISA plates In that case, their bindmg to the lmmoblhzed peptlde cannot be measured m the way outlmed here. Instead, the plate IS coated with the antlbody and blocked. The blotmylated peptlde 1sadded in PBS, 1% BSA, and subsequently visualized with streptavldmHRP diluted 1 1000 m PBS, 1% BSA However, some peptldes are inherently sticky to blocked ELISA plates as well. 18 If blotmylated monomeric peptldes fall to stain tumor cells with the protocol described, tetramers can be preformed with streptavldm-phycoerythrm, and then used to stain tumor cells m one step Stamzng the cells at room temperature or at 37°C may also Improve the stammg
Acknowledgments We thank S. Cwirla for the critical review of this manuscript and B . Taldl for improving the rescue hybridoma protocol. M. Renschler was a Berlex Oncology Foundation Fellow at Stanford University when this work was performed. R. Levy IS an American Cancer Society Clinical Research Professor. This work was In part supported by USPHS grants CA33399, CA34233, and CA66437
References 1. Pennell, C. and Scott, D. ( 1986) Lymphoma models for B cell actlvatlon and tolerance. IV Growth mhlbltlon by anti-Ig of CH31 and CH33 B lymphoma cells Eur J. Immunol. 16,1577-1581. 2 Miller, R A, Maloney, D G., Warnke, R , and Levy, R. (1982) Treatment of B-cell Iymphoma with monoclonal antz-ldlotype antzbody N. Engl. J Med. 306, 517-522 3 Maloney, D G., Levy, R , and Miller, R. A (1992) Monoclonal anti-ldlotype therapy of B cell lymphoma, m Btologzc Therapy of Cancer Updates vol 2, number 6 (De Vita, V T , Hellman, S , and Rosenberg, S A , eds.), Llppmcott, Phlladelphla, PA, pp l-9 4. Scott, J K and Smith, G P (1990) Searchmg for peptlde lzgands with an epztope hbrary Sczence 249,386-390 5 Oldenburg, K R , Loganathan, D , Goldstem, I J , Schultz, P G., and Gallop, M. A. (1992) Peptlde hgands for a sugar-bmdmg protein Isolated from a random peptzde library Proc Nat1 Acad. Scz. USA 89,5393-5397. 6 Devlm, J J., Pangamban, L C., and Devlin, P E (1990) Random peptide Izbrarles: a source of specific protein bmdmg molecules Sczence 249,404-406 7 Cwlrla, S E., Peters, E A., Barrett, R W , and Dower, W J (1990) Peptldes on phage A vast library of peptldes for ldentlfymg hgands Proc Nat1 Acad. Scz. USA 87.623-638.
234
Renschler, Dower, and Levy
8 Blond,E. S ,Cwlrla, S E , Dower, W J.,Lipshutz,R. J , Sprang, S R , Sambrook, J F , and Gethmg, M J. (1993) Affmity pannmg of a library of peptides displayed on bacteriophages reveals the bmding specificity of BiP Cell. 75,7 17-728. 9 Renschler, M F , Bhatt, R R , Dower, W J., and Levy, R. (1994) Synthetic peptide hgands of the antrgen binding receptor induce programmed cell death m a human B-cell lymphoma. Proc Natl. Acad. Scl. USA 91,3623-3627 10 Scott, J. K., Loganathan, D., Easley, R B , Gong, X , and Goldstein, I. J (1992) A family of concanavahn A-binding pepttdes from a hexapeptide eprtope library Proc Natl. Acad. Scl. USA 89,5398-5402 11 Dower, W J and Cwirla, S. E. (1994) Epitope mapping using libraries of random peptrdes displayed on phage, m Peptlde Antigens (Wisdoms, G. B , ed ), IRL Press at Oxford Umversrty Press, Oxford, UK, pp 219-243. 12 Carroll, W. L., Thtelemans, K , Ddley, J., and Levy, R. (1986) Mouse x human heterohybrtdomas as fusion partners with human B cell tumors J Zrnmunol Methods 89,61-72 13 01, V T and Herzenberg, L A (1980) Immunoglobulm-producing hybrid cell lines, m Selected Methods wz Cellular Immunology (Mishell, B B. and Shngis, S M., eds ), WH Freeman, San Francisco, pp. 368-370 14. Barrett, R W , Cwirla, S E , Ackerman, M S , Olson, A M , Peters, E A , and Dower, W. J. (1992) Selective enrichment and characterization of high affinity ltgands from collections of random peptrdes on ftlamentous phage Anal. Blochem. 204,357-364. 15. Sambrook, J., Fritsch, E F , and Mamatis, T (1989) Molecular Clonzng, A Laboratory Manual, Cold Sprmg Harbor Laboratory, Plamview , NY 16 Renschler, M. F , Wada, H G , Fok, K S., and Levy, R (1995) B-lymphoma cells are activated by peptide hgands of the antigen bmdmg receptor or by anti-idiotypic antibody to induce extracellular acidiftcatton Cancer Research, 55,5642-5647 17. Tam, J P (1988) Synthetic peptide vaccme design Synthesis and properties of a high-density multrple antrgemc peptrde system. Proc. Nat1 Acad. Sci. USA 85, 5409-5413. 18 Tam, J. P and Lu, Y A (1989) Vaccine engineering enhancement of immunogemctty of synthetic peptide vaccmes related to hepatitis m chemically defined models consistmg of T- and B-cell epitopes Proc Nat1 Acad. Sci. USA 86, 9084-9088. 19 Vutst, W. M J., Maloney, D G , and Levy, R. (1994) Lymphoma regression induced by monoclonal anti-idiotypic antibodies correlates with then ability to induce immunoglobulm signal transduction and is not prevented by tumor expression of high levels of BCL-2 protein Blood 83,899-906 20 Schick, M R , Nguyen, V Q , and Levy, S (1993) Anti-TAPAantibodies mduce protein tyrosme phosphorylation that IS prevented by Increasing mtracellular thiol levels J Zmmunol 151, 1918-1925 21 Cull, M G , Miller, J F , and Schatz, P J. (1992) Screening for receptor bgands using large libraries of peptides linked to the C termmus of the lac repressor, Proc Natl. Acad Sci USA 89,1865-1869
23 Major Histocompatibility Complex Allele-Specific Peptide Libraries and Identification of T-Cell Mimotopes Marc A. Gavin and Michael J. Bevan 1. Introduction We descrrbe here a method for generating large libraries of random pepttdes that may be screened for T-cell antigens (1). These libraries make use of the discovery of sequence motifs common to the peptides bound to a particular major hlstocompatibility complex (MHC) molecule (2). The motifs consist of a restricted peptide length and two or three fixed ammo acids required for peptide binding to MHC (anchor motifs) (2-4). Thus the libraries, comprised of a particular motif with the remaining ammo acids randomized, are MHC allele-specific and are useful for T-cells restricted to MHC molecules with known anchor motifs. A degenerate oltgonucleotide encoding the random peptide is cloned mto the prokaryotic expression vector pMAL-c, such that the peptides are expressed as C-terminal fusions to maltose bmdmg protein (MBP) This allows for their purification by amylose column chromatography and factor X, restriction protease cleavage (5). Factor X, cleaves after the tetrameric recognition sequence Ile-Glu-Gly-Arg (IEGR), thus peptides are released without amino-terminal additions. Large preparations of complex pools of peptides may be fractionated by reverse-phase HPLC. By screening the mdividual fractions for T-cell reactivity, the fingerprint of a T-cell receptor’s (TCR) fine specificity can be visualized (I ,6). The peptides can also be detected m factor X,-treated bacterial lysates when the antigen-expressing clone 1srepresented at less than 10m3.Thus, by performing successive rounds of screening, the clone of interest may be isolated and the sequence of the peptide (mtmotope) determined by sequencing its cloned oligonucleotide (I). From
Methods
m Molecular Dology, Edlted by S CablIly
vol 87 Combmatofral Pept!de 0 Humana Press Inc , Totowa,
235
Ljbrary NJ
Protocols
236
Gavin and Bevan
2. Materials 2.1. Preparation
2 2 3. 4 5. 6 7 8 9 10 11 12
13 14. 15
16
and Cloning of Insert DNA
Plasmld vector pMAL-c (New England BroLabs, Beverly, MA) This vector 1s not included m the most recent catalogs, however rt is still avarlable upon request. The current vector, pMAL-c2, cannot be used because rt does not contam a restriction site immediately 5’ of the protease site Endonuclease restrrctron enzymes and buffers (New England BtoLabs) Razor blades, Glass beads for DNA purtfrcatron (such as Qraex, Qragen, Chatsworth, CA) Apparatuses for runnmg agarose and polyacrylamide gel electrophorests Trrs-EDTA (TE) solutron* 10 mM Tris-HCI pH 8.0, 1 m&I ethylenediammetetraacetrc acid (EDTA) Ammomum acetate solutron. 0 5 M ammonmm acetate, 1 mM EDTA 0 45-pm Spin-X filters (Costar, Cambndge, MA) Sodmm acetate: a stock solutron of 3 M, pH 5.2 Magnesium chlorrde 5X Sequenase reactron buffer 200 mA4 Trrs-HCl, pH 7 5, 100 mM MgCl*, 250 mA4 NaCl (United States Brochemtcal, Cleveland, OH) dNTPs: a mixture of dATP, dTTP, dCTP, and dGTP, 25 m&Z each. Drthrothrertol (DTT), 1 A4 stock solution: Dissolve 3 09 g of DTT m 20 mL of 0 .O1 M sodium acetate, pH 5.2 Sterilize by filtration. Dispense mto 1-mL ahquots and store at -20°C. Escherzchza colz DNA polymerase-Klenow fragment (New England BtoLabs). T4 DNA hgase and the enzyme assay buffer (New England BtoLabs) LB agar plates Dissolve m 950 mL of deionized water. 10 g Bacto-tryptone, 5 g Bacto-yeast extract, 10 g NaCl, and 15 g Bacto-agar AdJust the pH to 7.0 with 5 N NaOH (about 0 2 mL), add water up to 1 L, and autoclave for 20 mm Cool to about 5O”C, add the approprrate antrbrotrcs, and pour mto plates LB/amptcillm 50 pg/mL amprcrllm m LB agar.
2.2. E. coli Transformation
and Library Storage
1 E. colt strains (see Subheading 3.2.1.) a TBl JM83 hsdR(rk- mk+) b DHSa (supE44AlacU169 (~80lacZAM15)hsd17recAlendAlgyrA96th~lrelA1) 2 SOC medium Drssolve m 950 mL of deionized water. 20 g Bacto-tryptone, 5 g Bacto-yeast extract, 0.5 g NaCl, and 15 g Bacto-agar. Add 10 mL of a 250 m&f solution of KCl, adJust the pH to 7 0 wrth 5 N NaOH (about 0.2 mL), add water up to 1 L, and autoclave for 20 mm Cool to about 60°C and add 20 mL of a sterile 1 A4 solutron of glucose Just before use add 5 mL of a sterile solutron of 2 M&l,. 3 Glycerol stock solutron at a concentratron of 40% (v/v) 4. -40 primer. supplied wtth Sequenase (United States Brochemtcal)
237
Major His tocompa tlbility Complex 5. LBGA. LB supplemented wrth 2 mg/mL glucose and 50 pg/mL amprcrllm. 6. 48-Well plates
2.3. Preparation
of the HPLC-Fractionated
Library
1 Isopropyl-B-u-throgalactopyranosrde (IPTG) stock solution Prepare a solution of 1 M IPTG m water, stertlrze by filtration, dispense into 1-mL aliquots, and store at -20°C 2 Lysis buffer 20 mM Trts-HCI, pH 8 0,200 mA4 NaCl, 1 mM EDTA 3 50-mL Conical-bottom tissue culture tubes 4 Lysozyme 5. Amylose resin (New England BroLabs) 6. 2.5 x IO-cm columns equrpped with a stopcock 7. Column buffer (CB) 20 mMTrrs-HCl, pH 7 4,200 mM NaCl, 1 mM EDTA 8 Maltose CB elutron solutron. containing 10 mM maltose. 9 3MM Paper. 10 Coomassie stain: 25% methanol (v/v), 8% acetic acid (v/v), 67% dH,O (v/v), and 2 5 mg/mL Coomasste Brilliant Blue R-250. 11 Coomassie destaining solution 25% methanol(v/v), 8% acetic acid (v/v), 67% dH20 (v/v) 12. Bradford reagent or commercially available kits for determining protein concentration 13 Factor X, (New England BtoLabs) 14 C 18 cartridges (Sep-Pak Plus, Mrlhpore, Mtlford, MA) 15. Centrrprep 10 (Amicon, Beverly, MA) 16. Trrfluoroacetrc acid (TFA) . 17 A solutron of 0.1% TFA 18 A solution of 80% acetomtrile, 0 1% TFA 19 A solution of 70% acetomtrile, 0 1% TFA 20. Cl8 column, 300-A pore, 5-urn bead. 21. Fraction collector equipped to hold tubes that can be racked m a 96-well format 22. Individual cluster tubes (Costar, Cambridge, MA). 23. 10 x 75-mm Glass tubes (Baxter, McGaw Park, IL)
2.4. Peptide Storage and Screening 96-Well
U-bottom
2.5. Isolating
with T-Cells
plates,
Clones Expressing
Mimotopes
1 1g-Gage needle 2 A repeat prpetor (Eppendorf Repeater with 0 5-mL Combltlps, Hamburg, Germany) 3. Phosphate-buffered salme (PBS) dissolve m water 8 g NaCl, 0.2 g KCl, 1 15 g Na2HP0,*H20, 0 2 g KH2P04. Adjust the pH to 8.0 and add water to 1 L 4 PBS-EDTA solution PBS supplemented with 1 mM EDTA.
238
Gavm and Bevan
5 Lysosyme solution. A solution of PBS-EDTA lysosyme 6 96-Well flat-bottom plates 7 96Well V-bottom plates
supplemented with 0 5 mg/mL
3. Methods 3.1. Preparation and Cloning of Insert D/VA 3.1 1. Vector Preparation In order to generate a peptide without N-terminal additions, it 1s necessary that tts first ammo acid follow the argmme of the factor X, site (IEGR). The vector pMAL-c contains a StuI restriction site that makes a blunt cut following the arginine codon, however, for higher cloning efficiency, the insert DNA should be ligated to two sites with 4-base overhangs. Thus, for this protocol, the oligonucleotide IS inserted between the BamHI site that precedes the protease sequence and the PstI site. The insert DNA reintroduces the protease sequence (Fig. 1) 1 Digest 3 pg of the plasmid pMAL-c DNA with PstI and BumHI Both enzymes can be included m the same buffer (NEBuffer 3 or BumHI unique buffer, see New England BioLabs catalog) 2 Purify the lmearlzed vector away from the excised DNA by 1% agarose gel electrophoresis Cut out the correct band (-6 1 kb) from the gel with a clean razor blade and purify the DNA by electroelution or glass beads. 3. Bring the final linear DNA preparation to lo-50 ng/pL TE
3.1.2. Ohgonucleotide
Design and Preparation
This protocol is based on that of Hill (7). We recommend that this detailed descriptron of cloning degenerate DNA be consulted should unanticipated problems arise 1 A single degenerate obgonucleotide with an 8-IO-bp palmdromic 3’ end is required The palindrome contains a PstI restriction site, and the S-end contains the BumHI site nested by a few nonpalmdromlc nucleotides Followmg the BumHI sue IS the sequence encoding the factor X, site, the degenerate peptide, and three stop codons Degenerate codons are encoded by NNS rather than NNN for a more even distribution of ammo acids and the exclusion of stop codons (N = G, A, T, C; S = G, C). Thus, for an H-2Db restricted library (Fig. l), the ohgonucleotlde IS as follows S-CGT GGATCC ATC GAG GGT AGG NNS NNS NNS NNS AAC NNS NNS NNS ATS TAA TAA TGA CTGCAG TC-3’ 2 Preparations of large oligonucleotides are often contaminated with shorter fragments, thus, it is necessary to purrfy the DNA by HPLC (offered by many DNA synthesis facllmes) or denaturing polyacrylamide gel electrophoresls (PAGE)
Major Histocompa t/bil/ty Complex factor X
P tac
pMAL-c .a-
239
ma/E
~2-26
-Y
@amHI- IEGR XXXXNXXXd***-
PSI -...a
Fig 1. Schematic representation of the plasmid construct for an H-2Db-restrrcted pepttde library. The translatron of the cloned ohgonucleotrde is shown m capttahzed Italics, where X = a degeneratecodon encoding 20 amino acids and * = a stop codon.
3 4. 5. 6
7
8. 9. 10.
11
For the latter, a 10% gel with 7 Murea is used, andthe excised gel slice is crushed and soaked overmght at 37°C m ammonium acetate solutton Remove the gel fragments with 0.45~pm Spin-X filters, and repeat elutton for a few hours with fresh ammomumacetate solution Combme the eluates and extract wtth phenol/ chloroform followed by an extraction with chloroform alone. Add sodium acetate (pH 5.2) to a final concentratton of 0.3M, and magnesiumchloride to 10 mM, and preclpttate with ethanol. Resuspendat 0.5-l pg/pL m dHzO Bring 2-3 pg oligonucleotide to 10 l.tL dH,O. Incubate at 70°C for 5 mm and add 1.5 FL 5X Sequenasereactton buffer Cool to room temperature and let sit for 60 mm. Add premixed. 64 ~.LLdH,O, 12 l.t.L 5X Sequenasereaction buffer, 2 FL dNTPs (from a mixture of 25 mA4 each), 6.7 pL DTT (0 1 M), and 5 U E coli DNA polymerase-Klenow fragment Incubate 30-60 mm at room temperature Stop by addmg EDTA to a final concentration of 10 mM and sodium acetate to 0 3 M Extract with phenol/ chloroform, precipitate with ethanol, wash with 70% ethanol, and resuspendin 90 FL dHzO Add 10 /.tL 10X restriction endonucleasebuffer (NEBuffer 3 or BarnHI unique buffer). Save 10 yL for PAGE analysis Cut 10 pL wtth PstI, 10 yL with BumHI, and the remamder with both enzymes for 6 h at 37°C Use IO-40 U enzyme per pg DNA. Analyze the uncut and the three cut samplesby 10% PAGE For a nonamer peptide, the uncut sampleshould give a 130-bp fragment, the BumHI digest should give a slightly smaller fragment, the PstI digest shouldbe 65 bp, and the BamHIPstI fragment should be noticeably smaller. If this pattern is not observed it 1s likely that the origmal template oligonucleotide was not pure enough and contamed shorter fragments Gel purify the remaining BarnHI-MI fragment as described for the ortgmal oligonucleotide but wrthout urea
3.7.3. Ligation First the optimum molar ratio of insert to vector DNA then larger scale ligatlons are performed.
is established
and
1 In final volumes of 5 pL 1X hgatton buffer, mix 10 ng lmear vector with 0,O.l) 03,1,33,andlOngmsertDNA
240
Gavin and Bevan
2. Add T4 DNA ligase and Incubate at 16°C overnight 3 Transform competent E. colz as described below and plate ahquots of the transformants on LEVampicrllm plates. The maxrmal hgatron effrcrency is hkely to be observed at a vector insert molar ratio of 1 3 (0 3 ng insert) 4 Set up a larger hgation of the optrmal ratio, such as 500 ng vector with 15 ng Insert in 100 pL hgatron buffer
3.2. E. coli Transformation and Library Storage 3.2 1. Competent E. coil and Transformat/on The TB 1 E. colz strain 1s recommended by New England BtoLabs, and both TBl and DHSa were adequate in our hands For good library representation, high numbers of transformants are required, thus we recommend that great care be taken in preparing competent E. coZi or that competent E. coli are purchased as such. Both electroporatron and heat shock are acceptable methods of transformatron, however, larger numbers of clones are more easrly obtained by electroporation owing to the high density of E. coli and the higher quantities of DNA that can be mcorporated. For electroporatton, tt 1s important that the lrgattons be precipitated with ethanol and resuspended m dH*O. 1 Transform E. co11according to a predetermmed or manufacturer’s protocol 2 Followmg heat shock or electric pulse, add 1 mL SOC medium and incubate at 37”C, 200 rpm agrtatton for 45-60 min. Do not allow the bacteria to recover for more than 1 h because the clones will begin to rephcate.
3 Plate serial dilutions of the culture starting with 50 pL on LB/amp plates. 4 Add an equal volume of sterile glycerol stock to the remaining culture. Snapfreeze wrth an ethanol/dry ice bath and store at -80°C 5 The followmg day, count the colonies and calculate the total number of stored transformants.
6 Repeat hgations and transformatrons untrl adequate numbers of clones are obtained and stored Mrmotopes can easily be detected in severely underrepresented bbrarres (I) However, the degree of peptrde dependency for T-cell actrvatron can vary greatly, as we have recovered one cytotoxrc T-lymphocyte (CTL) clone that did
not respond to any of 1 8 x lo6 peptrdes in a library of lo9 possible sequences (6). The number of clones should be tailored to the number of random posrtions and the precise appllcatron of the library.
3.2.2. Assessmg the QuaMy of the Library 1 Pick several clones from the above plates and prepare the plasmrd DNA by a
mmiprep procedure. 2 Sequence the insert DNA using the -40 pnmer (see Subheading 3.53.) 3 Check to see d there IS one msert per plasmrd and that they are m frame wrth
MBP and the factor X, sate Determine the ratro of productrve clones to total clones
Major Histocompa tlbility Complex 3.2.3. See&g
241
and Expanding Transforman ts
The clones are expanded m sterile 48-well plates m 0.75 mL LBGA per well. The numbers of clones per well should depend on the size and complexity of the library. With a library of seven random positions and two fixed anchor residues, a considerable proportion of the peptides may not bind the specific MHC, allowing for high complexity in these pools. We have not tried pools more complex than 3900 clones/well, in which mlmotopes were easily detected in factor X,-treated bacterial lysates (I) (see Note 4). 1 Work on a clean bench with a Bunsen burner maintaining an air current 2. Thaw the frozen transformants on ice. 3 Dilute all of the bacteria into the total volume LBGA required to fill the 48-well plates at 0 75 mL per well. 4 To confirm the absolute size of the library, plate a predicted 50-100 clones on a few LB/amp plates and count the colonies the following day. 5 Aliquot the clones This IS most accurately done with a 12-channel, 3OO+L pipetor Load the plpetor with 8 tips, skipping every third channel Set to 250 pL, and dispense three allquots per row A 5-mL plpet IS also adequate, if controllmg 0 75-mL volumes is not a dlfflculty 6. When all of the clones are seeded, close the gap between the lid and plate with tape to prevent evaporation Wrap the tape the full circumference of the plate leaving a l-cm gap on one side for aeration. 7 Secure the plates to the table of a shaker/incubator They can be taped to a test tube rack, taped to the table, or taped to each other m a stack and secured into an Erlenmeyer flask holder 8. Culture 12-14 h at 37”C, 200 rpm agitation
3.2.4. Pooling and Storing the Library The library is stored m the 48-well plates for isolating mimotopes, and m more complex pools for larger preparations of HPLC-purified peptides. For this latter application, the highest complexity we have used IS 186,000 clones per 43 HPLC fractions. Because different mlmotopes could be detected in consecutive fractions (6), we recommend either lower complexity or higher HPLC
resolution. 1 The following day remove 250 pL from each well and pool the cultures of a predetermined number of wells, such as all the wells from a single plate Using a 12-channel pipetor loaded with 8 tips, plpet the cultures into a single trough and transfer to a 50-mL tube 2. Add glycerol stock to make a final concentration of 20% (v/v) and mix well 3 Ahquot into 2-mL freezer vials, snap-freeze, and store at -80°C (see Note 1). 4. To the remaining 48-well cultures add 0.5 mL 40% glycerol using the 12-channel pipetor and mix well If two sets of 48-well plates are desired, split the volume of each well between two plates (see Note 1)
242
Gavin and Bevan
5 Tape the lids down and place mdtvtdually at -80°C Once the cultures have frozen, stack the plates, wrap m plastic wrap, and return them to the freezer.
3.3. Preparation
of the HPLC-Fractionated
Library of peptide can be obtained from 1 L of culture. The
One to two milligrams following protocol is for a medium-sized preparation that should last for several T-cell assays. Thts protocol is based on that of Rtggs (5).
3.3.1. From Protein Induction to Factor X, Cleavage 1, Inoculate 250 mL LBGA with two vials of the more complex pools. 2. Culture at 37°C) 250 rpm agitatton, until the OD6, = 0.5. 3. Add IPTG to make a concentratton of 0.3 n-&f m order to induce fusion protein synthesis and contmue mcubation for 3 h 4 Resuspend pelleted bacteria (20 min, 4000g) in 10 mL ice-cold lysis buffer Transfer to a 50-mL conical-bottom tissue culture tube. 5 Add lysozyme to a final concentratton of 0 5 mg/mL, and incubate at 4°C for 30 min 6 Freeze the bacteria, overnight at -20°C is best The column should be run the same day the bacteria are thawed Placing the bacteria at -80°C until frozen is also adequate 7. Prepare the amylose resin columns (2.5 x 10 cm), equtpped with a stopcock At 4”C, ptpet resm (9 mL final bed volume) into the columns and wash with 8 column volumes of CB 8 Thaw the bacteria m cold water and somcate on ice until no longer vtscous The lysozyme-freeze/thaw step will lyse most of the bacterta. Somcatton is to shear the DNA A lower somcator setting is adequate, such as medmm amplitude, 50% pulses for 1-2 mm. To prevent foaming, keep the ttp centered, vertical, and 1 cm from the bottom of the tube 9 Centrifuge the lysate m a swmgmg bucket rotor at 14,OOOg, 30 mm, 4°C (10,000 rpm in a Beckman SW28) 10 Ddute supernatant to 50 mL wtth ice-cold CB. Vacuum filter through a 0.22~ym filter if slightly cloudy 11. At 4”C, pass the lysate through the columns at 1 mL/mm, followed by 8 column volumes of Ice-cold CB. Save the flowthrough It may be difficult to handle many columns at once, divide this task into manageable numbers of columns 12. Elute MBP-peptide fusion protein wtth the maltose CB solutton, collectmg ten 2-mL fractions. 13 Mtx the fractions by mvertmg the tubes, spot 5 ltL each onto 3MM paper, and an dry Stain the paper m a small tray with Coomassie stain for 30 s and destam thoroughly with the Coomasste destaining solution 14 Pool the fractions that contain protem and determine the protein concentration for a few of the pools (Bradford method or commerctally available kits) The fusion protein should elute at 1-3 mg/mL, and 250-mL cultures should yield 20-25 mg fusion protein
Major His tocompa t/bill ty Complex
243
15. Add factor X, at 2.5-5 pg per mg fusion protein. Mix well and incubate at room temperature overnight (see Note 2)
3.3.2. Preparation for HPLC These steps may be performed at room temperature. The peptides are removed from MBP by membrane filtration, and desalted by adherence to Cl 8 cartridges. Prewetting the cartridges with acetonitrrle is important to remove the air and make the Cl8 accessible to peptide binding
2. 3
4
5 6
7 8.
9.
10
Separate the peptides from MBP by lo-kDa membrane filtration. If the Centriprep 10 is used, centrifuge at 3000g m a swinging bucket rotor After all of the solution has been filtered, rmse a few more milliliters of dH20 through the membrane. The Sep-Pak Plus cartridges (step 3 below) may be prepared during the centrifuge spins. Add TFA to the
3.3.3. HPLC Gradients The peptides are then fractionated by reverse-phase HPLC using an acetonrtrrle gradient rn 0.1% TFA and a Cl 8 column. In a preparation of the H-2Dbrestricted library in which 186,000 peptides were fractionated into 43 1-mL fractions (flow rate = 1 mL/mm), elution of single peptides into consecutive
244
Gavrn and Bevan
fractions was not uncommon (6). Resolution may be improved by usmg a slower flow rate such as 0 25-0.5 mL/min. For this library, the peptldes eluted between 10 and 50% acetomtrile. This window may differ depending on the length of the peptide and the hydrophoblcity of the anchor residues. 1. The optimal gradient for each library should be empmcally degree of resolution should be tailored for the hbrary’s
determined and the
specific purpose
A pilot
preparation of one peptlde pool can be used several times to optimize the HPLC conditions
2 The fraction collector should be equipped to hold tubes that can be racked in a 96-well format These tubes can be supported by 10 x 75mm glass tubes inserted mto the fraction collector
3 After running the HPLC gradient, freeze the fractions at -80°C and lyophlllze overnight The cluster tubes can be held mdivldually m a Speed-Vat rotor The followmg day, be sure to break the vacuum as slowly as possible to prevent pellet disruption, 4 Collect the tubes m the 96-well rack and resuspend the peptldes m dH,O. For the hbrary described above (250-mL cultures), 0 25-0.5 mL per fraction 1s recommended Using a 300~pL 12-channel plpetor, mix each row to resuspend the pellets and always change the tips between each row. Slhcomzed tips may be used to mmimlze peptlde loss
3.4. Peptide Storage and Screening
with T-Cells
The best way to quantitate the purified peptldes IS with a T-cell assay. We have only conducted 5’Cr-release assays with CTL for mimotope detection. 1 Estimate the concentration of Individual
peptldes m the HPLC fractions Assum-
mg 100% factor X, cleavage, a 250-mL culture of 100,000 clones yielding 25 mg fusion protem should produce 0 6 mg peptlde (MBP-peptide = 43 kDa, peptides are approx 1 kDa or 6 ng per clone If a single peptlde clone migrates to a single HPLC fraction, a fraction resuspended in 0.5 mL water contams 12 nM each peptide 2 Set up a T-cell assay to identify posmve fractions CTL commonly detect peptides at l-10 pM. For the hbrary described above, start with a 1 10 or 1 20 dilution of each fraction 3 Titrate the positive fractions m another T-cell assay and calculate the total number of assays that can be conducted with the library 4 Dilute the HPLC fractions accordmgly and ahquot part or all mto 96-well U-bottom plates, always using fresh tips. Wrap the stacked plates m plastic wrap and freeze at -80°C (see Note 3)
3.5. Isolating
Clones Expressing
Mimotopes
For this screemng procedure, mimotopes are detected m factor X,-treated bacterial lysates. Because of the short half-hfe of peptldes m this environment,
Major Histocompatibihty
Complex
245
factor X, cleavage IS performed at 4°C for 4-5 h immediately preceding the T-cell assay We recommend that all 96-well plates be labeled on the plates themselves rather than the lids (see Note 4).
3.5.1. First Round of Screemng 1. Thaw the 48-well plates containing the expanded hbrary cultures at room temperature or 37°C. 2 Label mlcrocentrifuge tubes, one per well, with the plate number and the row/ column deslgnatlon of each well 3 Fill the tubes with 1 mL LBGA and inoculate with 40 FL of each well. If the tubes are supported by a 16 x 5-hole plastic rack, a 12-channelplpetor with 8 tips can be used 4 Close the tubes and puncture the tops with an 18-gageneedle 5. Secure the racks to the table of an Incubator and culture at 37”C, 250 rpm agltatlon to ODeoO= 0 5 The OD of mdivldual cultures can be checked and returned to their mlcrocentrlfuge tubes. Checkmg 2 or 3 from different parts of the rack IS adequate 6 Add 10 pL IPTG (30 mM) to each tube using a repeat plpetor equipped to dlspense lo-pL ahquots and a yellow tip. The IPTG solution can be injected through the hole pierced on the top of each tube 7 Continue incubation for an additional 4 h 8 Pellet the bacteria in a mlcrocentrlfuge (30 s, top speed)and aspirate the media 9 By vortexmg at high speed,resuspendeach pellet m 200 pL of the Mg2+- and Ca2+-free lysozyme solution 10 Incubate at 4°C for 30 mm followed by three freeze/thawmgs Freeze at -80°C and thaw m cold tap water For the final freezing, place at -20°C overnight 11. Thaw and briefly vortex each tube Pellet the Insoluble material at top speed for 5 min 12. Aliquot 40 FL of each lysate mto 96-well U-bottom plates The pellet 1sviscous from chromosomal DNA and might be drawn mto the pipet tip. If this occurs, the pellet can be easily removed from the tube and discarded with the tip. Run the pellet along the side of the tube to release extra lysate solution Three to four screenscan be derived from this preparation 13. Freeze the plates at -80°C. 14 To screen for posltlve wells, thaw a set of plates and proceed to Subheading 3.5.2., step 13
3.5.2. Subsequent Rounds of Screening 1. Serially dilute the E coli from the positive wells m LB broth and plate on LB/ amp plates Save the LB dllutlons at 4’C 2 The following day, determme the density of bacterja m the LB dllutlons from colony counts 3 From the LB dilution of appropriate bactermm density, seed a 96-well flatbottom plate with 100 pL LBGAlwell such that the positive clone would be
Gavm and Bevan
4
5
6
7 8 9 10
11
12
13
14 15
16
represented by 5-7 copies If the postttve wells contained 1000 clones, seed 5000-7000 bacteria in these plates Grow 24 h at 37°C without agitation and with humidity to prevent culture evaporation Placing a pan of water m the incubator is adequate Twtce during this mcubatron, gently vortex each plate to resuspend the bacteria. Practice vortexmg mock plates at a low setting, trying to keep the solution from touchmg the lid Fill an equal number of 96-well V-bottom plates with 120 l.tL LBGA, 0.5 n&! IPTG Add 60 /LL of each overnight culture to these plates and incubate in the same fashion for 3-4 h Add 100 !JL LBGA to the remammg flat-bottom cultures and store at 4°C wrapped m plastic wrap These cultures will last for several weeks at 4”C, and identtftcatron of the postttve wells can be completed m the followmg 2-3 d Pellet the bacteria m the V-bottom plates using a centrifuge equipped with plate holders (400-5OOg, 5 mm). Discard the supernatant by shakmg the plate once vigorously upside down over a sink Vortex the plates at high speed to resuspend the bacteria m the remammg medta and freeze overnight at -20°C The followmg day, remove the V-bottom plates from the freezer, add 120 uL cold PBS-EDTA solution to each well with a 12-channel pipetor, and leave at room temperature to allow the frozen pellets to thaw Vortex gently at a low settmg to mix, only after practicmg vortexmg a 96-well V-bottom plate contaming 150 PL water without splashing onto the hd Freeze/thaw the plates five add&tonal times Transferring between -80°C and room temperature 1s adequate, however do not forget about the plates when thawmg, lysates contam many proteases. Briefly and gently vortexmg each plate when the wells are nearly completely thawed helps expedite this step If lysate splashes onto the lid, remove the hd and wipe with a paper towel to prevent well-to-well contamination For the final freezing, place at -2O’C overnight The same day the T-cells are ready for the screening assay, thaw the plates and pellet the insoluble material (400-5OOg, 10 mm) Transfer 40 PL into 96-well U-bottom plates with a 12-channel pipetor, always changing tips Freeze the V-bottom plates containing the remaining lysates and pellets m case additional lysate 1s needed Dilute 5 pg factor X, into 1 1 mL PBS and ahquot 10 uLlwel1 To prevent wellto-well contammation use a 12-channel pipetor, always changing tips, or use the repeat pipetor. Mix by vortexmg gently. Incubate at 4°C for 4-5 h Add antigen-presenting cells (5’Cr-labeled target cells) to each well Incubate at room temperature for 30 mm, add T-cells, and complete the T-cell assay. Identify positive wells and proceed to Subheading 3.5.2., step 1 For the first round of screening, each postttve represents a unique mtmotope, and for subsequent rounds only a single positive per plate is pursued. Once the complexity of the positive wells 1s below 5-10 clones, streak the posttlve cultures on LB/amp plates and pick individual colonies to seed the flat-
Major His tocompa tlbility Complex
247
bottom plates (Subheading 3.5.2., step 3) For this last round of screenmg, a shorter expansion period, a 1-h IPTG mductton, and a 1-h factor X, reaction has been sufficient.
3.5.3. Determining and Interpreting Mimotope Sequences 1 Prepare plasmid DNA from the positive clones according to a standard munprep procedure 2. Sequence the DNA using the -40 primer, which primes from the la&a region towards the cloned ohgo Use a 6% sequencing gel and run the xylene cyan01 two-thuds the length of the gel 3. To determine a universal mimotope sequence, several mimotopes must be isolated for each of at least three T-cell clones directed against the same epitope Each T-cell clone will reveal its own TCR contact motif and a synthettc peptide containing all of the motifs may be very similar to the natural epttope (1,8)
4. Notes 1 Because of differences m growth rates among a populatton of bacterial clones, the library should not be expanded rn the 48-well format after the nntial overnight expansion, nor should the pooled clones stored m freezer vials be grown for the purpose of generating additional aliquots. If the 48-well plates will be screened several times, it is advisable to ahquot them into 2-3 plates, or perhaps several 96-well plates, to mnnmize the numbers of freeze/thawmgs each glycerol stock is subjected to 2. We have tried to improve the peptide yield m factor X,-treated lysates with various protease inhibttors, most of which do not inhibit factor X, The inhibitors we have tried are amastatm, aprotmm, bestatin, EDTA, leupeptm, and pepstatm Only EDTA had an appreciable effect on peptide yield, and is therefore included at 1 mM. With the current protocol, 0 l-l% of the peptide that would be recovered by amylose chromatography is detected by CTL m factor X,-treated lysates. 3 Repeated freeze/thawing of the HPLC-fractionated library should also be mnnmized Certain peptides may be lost more rapidly than others due to adherence to plastic Aliquotmg the library from the collected fractions into several sets of U-bottom 96-well plates is recommended If the fractions are to be screened with several T-cell lines m one day, these ahquots can be made to contain enough peptrde for all T-cells and aliquoted into additional plates immediately before adding the antigen-presenting or target cells 4. The authors have found that 96-deep-well titer plates (Beckman 140504) are more efficient than 48-well plates (see Subheadings 2.2., 3.2.3., 3.2.4., and 3.5.1.), normal 96-well plates (see Subheadings 2.5. and 3.5.2.) or microcentrifuge tubes (see Subheading 3.5.1.) for culturing and mampultmg multiple E coli samples, Two small glass beads are placed in each well to help agitate the medrum while m the shaker incubator as described (9). The beads may also aid in homogemzmg the freeze/thaw lysates while vortexmg (see Subheadings 3.5.1. and 3.52.) Aluminum foil tape (Scotch 425-3) is useful for sealing these 96-deep-well plates
248
Gavin and Bevan
Acknowledgments We thank Beverley Dere, Andres Grandea III, and Paul Riggs for their asslstance In refining this protocol.
References 1 Gavm, M A , Dere, B , Grandea, A G III, Hogqmst, K A , and Bevan, M J. (1994) MaJor histocompattbthty complex class I allele-specific peptide libraries tdentiftcation of pepttdes that mimic an H-Y T cell epttope Eur J Zmmunol 24, 2124-2133 2 Falk, K , Rotzschke, O., Stevanovtc, S , Jung, G., and Rammensee, H. G (1991) Allele-specific motifs revealed by sequencing of self-pepttdes eluted from MHC molecules Nature 351,290-296 3 Jameson, S C and Bevan, M J (1992) Dtssection of maJor histocompattbihty complex (MHC) and T cell receptor contact residues m a Kb-restricted ovalbumm pepttde and an assessment of the predictive power of MHC-bmdmg motifs Eur J Immunol 22,2663-2667 4. Shtbata, K.-I , Imarat, M., Van Bleek, G M , Joyce, S , and Nathenson, S G (1992) Vesicular stomatttis virus anttgemc octapeptide N52-59 is anchored mto the groove of the H-2Kb molecule by the side chains of three ammo acids and the main chain atoms of the ammo terminus Proc Nat1 Acad Scz USA 89, 3135-3139 5 Riggs, P. (1992) Expression and purificatton of maltose bmdmg protein fustons, m Current Protocols zn Molecular Biology (Ausebel, F M., eds.), John Wiley & Sons, New York, set 16.6 6. Gavin, M A. and Bevan, M J (1995) Increased peptide promiscuity provides a rational for the lack of N-regions m the neonatal T cell repertoire lmmunzty 3, 793-800 7 Hill, D. E (1989) Mutagenesis wtth degenerate oltgonucleottdes. Creating numerous mutations m a small DNA sequence, m Current Protocols m Molecular Biology (Ausubel, F M., eds ), John Wiley & Sons, New York, sec. 8 2A. 8 Greenfield, A , Scott, D., Penmsl, D , Ehrmann, I , Ellis, P , Cooper, L , Sampson, E , and Koopman, P (1996) An H-YDb epttope is encoded by a novel mouse Y chromosome gene Nat Genet 14,474&478 9 Ng, W L , Schummer, M , Ctrisano, F D., Baldwin, R L , Karlan, B Y , and Hood, L (1996) High-throughput plasmid mmt preparations facthtated by mtcromixing Nucleic Acids Res 24,5045-5047
24 Phage Display of Peptide Libraries on Protein Scaffolds Henry B. Lowman 1. Introduction Early examples of phage-display hbrarres were used to identify short, linear peptide eprtopes that could bind an antrbody or other target (1,2). Phage display offers a means not only to identify such pepttdes, but also to select highaffinity protein variants with improved affinity and specrftcrty, by randomrzation of specrfrc residues wrthm then binding eprtopes for receptors or other target molecules. Examples of such affinity- or specrftctty-improved proteins have included human growth hormone, zinc fingers, protease mhibrtors, ANP, and antibodies (reviewed m 34). Since the btoactivity of such molecules IS related to their fractional occupancy of a receptor or other bmdmg target, higher-affinity and higher-specrficrty variants have the potential to improve the effectiveness of and lower the dosage required for these molecules m therapeutic applications. Rapid and efficient selection of phage-displayed protein variants for improved binding to target molecules requires that the protein be secretable m Escherichza coli as a fusion to a phage protein, that a diverse library of variants be generated that 1s free of an excessive background of (wild-type) bmdingphage, that enrichment of displaying phage over nonbinding or weakly binding variants can be carried out with an immobilized target molecule while avotdmg potential effects of avtdrty and nonspecific binding, and that pooled or clonally isolated binding-phage variants can be conveniently assayed for relative affinities. Successtve rounds of mutagenests and selection have yielded, for example, a growth hormone variant improved to approx 1 pM affinity for its receptor, starting with 1 nM m the wild type (5,6), as well as affmityimproved protease mhibttors (7,8), and antibodies (9JO). The organization of From
Methods
tn Molecular Edlted
by
Biology, S CablIly
vol 87 Combmatoual 0 Humana
249
Press
Peptrde
Inc , Totowa,
Library NJ
Protocols
250
Lowman
ATC
GAC
TAC ___AAG .,,
Stop codon
mutagenesis
I TAA
TAA
TAA
TM
Random
mutagenesis
I NNS
NNS
NNS ..t NNS .._
Fig. 1. Scheme for construction of random peptide libraries on a protein scaffold. The gene encoding the protein to be displayed is fused to the C-terminal domain of Ml3 g3p. For each library of variants, the starting gene is first mutated with stop codons (TAA). These constructs then serve as templates for random mutagenesis, for example using NNS codons (see Note 2). this chapter follows the chronological path for construction, sorting, and assays of such libraries. The monovalent phage display (II) procedures described here will assume as a starting point the availability of an Ml 3-origin-containing phagemid construct (examples of which are discussed elsewhere in this volume), having a gene for the binding protein fused to the C-terminal domain of gene III from Ml 3, a secretion signal sequence, and an appropriate promoter, such as the E. coli alkaline phosphatase promoter (Fig. 1). A helper phage (such as Ml 3K07) provides all of the wild-type phage proteins (including gene III protein, g3p), for packaging and infectability of phagemid-containing virions. By limiting expression of the g3-fusion protein and providing wild-type g3p, such that only one copy of g3-fusion protein is displayed per 100-1000 virions,
Phage Display on Protem Scaffolds
251
monovalent display is achieved on a statistical basis. In this way, avidity effects are avoided, an important requirement for efficient selection of high-affinity variants (12-15; Lowman and Wells, unpublished observations). Generation of the randomized library is described using a single-stranded template (ssDNA) directed procedure. The sites of mutagenesis are chosen based on structural and/or functional studies, such as alanine scanning or natural sequence variation (e.g., of IgG hypervariable regions). The use of nondisplaying constructs (containing stop codons at sites of randomization) as the mutagenic ssDNA template for each library is an alternative to the doublestranded cassette mutagenesis method described elsewhere (1.5). The enrichment procedure described is based upon use of nonspecifically adsorbed target protein on polystyrene plates, although a variety of immobilization techniques have been described. The enrichment ratio of displaying versus nondisplaying phagemids is used as a measure of progress in sortmg the highest affinity variants. Finally, phage-ELISA assays (16) are described as a means of evaluating the relative affinities of phagemid pools or isolated clones. 2. Materials 2.1. Starting Phagemid for Stop-Template Constructions Phagemid construct contammg the gene of interest fused to the Ml3 g3p C-terminal domam (resrdues 249-406), phage and plasmtd origins of replication,
2. 3 4
5 6. 7
8 9
10 11
and the B-lactamase gene (for ampictllm [Amp] selection). An analogous construct should also be prepared (for a negative control) containing the chloramphenicol transacetylase gene (Cam), but not p-lactamase, and lacking the gene for the bmdmg protein to be randomized E. coli strain CJ236 (17). Helper phage M13K07 (Promega Corp , Madison, WI; ZS,19). 2YT medium 16 g/L tryptone, 10 g/L yeast extract, 5 g/L NaCl, autoclaved Water (sterile), 1 L, chtlled to 4°C. 10% Glycerol (sterile), 100 mL, chilled to 4°C. LB plates 10 g/L NaCl, 5 g/L yeast extract (Dtfco, Detroit, MI), 10 g/L tryptone, 15 g/L agar Autoclave, cool to <6O”C, and add anttbiotics as required: 50 pgImL amprcrllrn (for phagemtd propagatton and colony counting), or 12 pg/mL chloramphemcol (for counting nondrsplaymg phagemid colonies, and for strain CJ236), or 5 pg/mL tetracycline (for strain XLl-Blue) Pour into Petri plates PBS (sterile) 137 mMNaCl,3 mMKCl,8 mMNa,HPO,, 1 5 mMKH,PO, Add HCl to pH 7.2. Autoclave. TE* 10 mMTrts-HCl, pH 7 6,l mrMEDTA Phenol-chloroform: 50% phenol (Gibco-BRL, Gmthersburg, MD), 50% chloroform (Mallincrodt, Chesterfield, MO), equilibrated with 10 mA4Trts-HCl, pH 7.6 Ribonuclease A (Sigma, St. Louis, MO), 5 mg/mL.
252 12 13 14 15
Lowrnan Ethanol, chilled to 4°C 70% Ethanol, chilled to 4°C. PEG-NaCl solution* 200 g/L PEG-8000,146 8 M Ammonmm acetate, sterile-filtered
2.2. Stop Template for Library
g/L NaCl, Dissolve, then autoclave
Construction
1 Mutagemc TAA ohgos. 30 pM in water, gel-punfled. Ohgodeoxynucleotides are designed for stop-codon mutagenesis to have a TAA stop codon at each codon to be randomized No more than 4-6 codons are mutated per library if the hbrary is to be complete (see Note 1) 2 10X Kmase buffer 700 mMTris-HCI, pH 7 6, 100 mM MgCl, 3 10 mM ATP (Pharmacla, Piscataway, NJ). 4 T4 polynucleotlde kmase (New England Biolabs, Beverly, MA) 5 25 mM dNTPs: 25 mM dATP, 25 mM dGTP, 25 mM dCTP, and 25 mM dTTP (Pharmacla) 6. 10X mutagenesrs buffer. 500 mM Tns-HCl, pH 7.6, 500 mM NaCl, 100 mM WC12 7 tRNA. 10 mg/mL yeast Phe tRNA (Sigma) m TE, stored at -20°C. 8 SOC medium* 2YT medium (see above) contaming 2 5 mMKC1, 10 mM MgCl,, 10 mM MgS04, and 20 mM glucose 9 E ~012stram XLl-Blue, competent for electroporatron (Stratagene, La Jolla, CA; ref. 20)
2.3. Library
Construction
1 Mutagemc NNS oligos 30 pM m water, gel-purified For hbrary constructions, all 20 amino acids can be encoded by using oligodeoxynucleotides with degenerate codons NNS (a mix of A, G, C!, and T m the first two positrons, and a mix of G and C m the thud position [see Note 21). It IS also useful to mclude a unique restriction site for each library ohgo where possible This allows libraries to be distmgmshed by restriction digests, but more Importantly, rt allows vartants from an exrstmg or previously selected library to be restrtctton-selected out when they contaminate a new lrbrary , 2 25 mM dNTPs 25 mM dATP, 25 mM dGTP, 25 mM dCTP, and 25 mM dTTP
2.4. Affinity
Sorting the Library
1 Target protein, 10 pg per ELISA or sorting plate to be used. 2 Carbonate buffer 50 mM NaHCOs, pH 9.6 3 Milk block 5% Carnation skrm milk m 25 mMsodium carbonate buffer, pH 9 6, made fresh before use 4 Phage binding buffer: PBS (see above), 0 5% bovine serum albumin (Sigma), 0 05% Tween-20. 5. Wash solutron PBS contammg 0.05% Tween-20. 6 Nunc Maxisorp ELISA plates 7 Nunc low-protem-bmdmg F plates
Phage
D/splay
2.5. Analysis
on Protein of Binding
253
Scaffolds Affinities
1 Phage anttbody-HRP conJugate (Pharmacta), or anttphage antibody and secondary antibody-HRP conJugate 2. Phosphate-citrate buffer 25 mM cttrrc acid, 50 mM Na2HP04, HCl to pH 5 0 3. OPD substrate solution 1 tablet (10 mg) of OPD (o-phenylenedtamme, Stgma), 4 l.tL (30%) H202, added to 10 mL of phosphate-citrate buffer per ELISA plate, made fresh just before use 4. 2 5M H,S04 (use cautton dispensing and disposing)
3. Methods 3.1. Starting
Phagemid
for Stop-Template
Construction
Template DNA for mutagenesis (dU-ssDNA) 1s prepared for mutagenesis by the method of Kunkel(17). Starting with the wild-type phagemid construct, a stop template is prepared for each library of variants before randomization (Fig. 1). 3. I 1. Transformation
of E co11 by Electroporatlon
This procedure is used for transforming ssDNA (dU) template preparations (using CJ236 cells) as well as for transforming the subsequently produced dsDNA libraries (using XL-l Blue cells) Electroporatron provides the high efficiency of transformation needed for diverse libraries (see Note 1) 1 Pick a single colony of E colz strain CJ236, and maculate 5 mL of 2YT contammg 30 yglmL of chloramphemcol. 2. Incubate overnight with shaking at 37°C 3 Inoculate 1 L of 2YT contammg 30 pg/mL of chloramphemcol with 1 mL of the overnight culture 4. Incubate wtth shaking for 3 h, or until the cell density reaches 0 5 OD,,a 5. Pellet the cells by spmnmg 10 mm at lO,OOOi: at 4’C. 6 Discard the supernatant, and resuspend the pellet m 500 mL of me-cold water 7 Pellet the cells by spmnmg 20 mm at 10,OOOgat 4°C 8. Dtscard the supernatant, and resuspend the cells m 80 mL of ice-cold water 9. Pellet the cells by spmnmg m 2 ahquots, 10 min at 7000g at 4”C, using minimal or no braking. 10 Carefully remove and discard the supernatant and resuspend m 40 mL of ice-cold 10% glycerol 11 Pellet the cells by spmnmg m 1 tube, 20 mm as m step 9 12 Carefully remove and discard the supernatant 13 Using only the remammg hqutd on the walls of the tube, resuspend the cells by vortexmg The competent cells should be at a density of at least 200 OD,,, Cells can be ahquoted (40 pL for routine mutagenesis or 400 pL for hbrartes) and used tmmedtately, or frozen on dry ice and stored at -80°C for months
254
Lowman
14 Mix 40 PL (for routme mutagenesis) or 400 pL (for library constructions, see Subheading 3.3., step 3) of glycerol-cells with 0.5-l 0 pmol of DNA on ice 15 Place the mix mto a 0 2-cm gap electroporatlon cuvet (Blo-Rad, Hercules, CA) on ice 16. For use with the Bio-Rad Gene Pulser, Insert the cuvet in the holder and electroporate at 2 5 kV, usmg the pulse-extender 200-Q resistor and 25-pF capacitor 17 Remove the cuvet and lmmechately add 1 mL of SOC medium 18 Transfer to a sterile culture tube and incubate 1 h at 37°C with shakmg. 19. Plate 0 1 mL and lo-fold dilutions onto LB plates containing ampicillin and incubate at 37°C 12-16 h
3 1 2. Preparation of dU-ssDNA Template Stop-codon templates are made for each library to be mutated. The stop codon TAA substantially reduces hybridization bias with use of the NNS codon degeneracy because in the subsequent mutagenesis (see Subheading 3.3.) only TAG (amber) and TAC (Tyr) can base-pair with 2 out of the three posItIons of this codon. Since any nonmutated templates will contain stops, it also prevents background (wild-type) contamination. 1 Pick a single colony from a CJ236/phagemld transformation for dU-ssDNA template (Subheading 3.1.1., step 19) mto 5 mL 2YT medium contammg 50 pg/mL ampmllin, 30 yg/mL chloramphemcol 2 Incubate at 37°C with shaking until a density of 0 3 ODGoO1s reached 3 Add M13K07 helper phage to give 2 x lo9 PFU/mL (plaque-formmg umts per mL) final concentration 4 In a 250-mL flask, add starting culture to 25 mL of 2YT medmm contammg 50 pg/mL ampiclllm, 30 pg/mL chloramphemcol 5 Shake overnight (12-16 h) at 37°C. Pellet cells 6 Precipitate phage by addmg l/5 vol PEG-NaCl sol&Ion, Incubate 5 mm at room temperature Spin 5 mm in a microfuge at 10,OOOg. 7 Resuspend in 1 mL of PBS Spm 5 mm m a mlcrofuge and discard pellet 8 Repeat the preclpltatlon, steps 6 and 7 9 Resuspend in 0 6 mL of TE with 0 1 mg/mL rlbonuclease A 10 Incubate at room temperature, 20-30 mm 11 Phenol,chloroform extract the phage solution three times, or until supernatant is clear and free of debris. 12. To the supernatant, add l/4 vol 8 M ammonium acetate (no carrier tRNA), and 2 5 vol ethanol Stand 20 mm at room temperature 13 Pellet DNA, wash with 70% cold ethanol, and dry on Speed-Vat 14 Resuspend DNA pellet m 200 pL of TE This should give a template concentratlon of 0 l-O.2 pg/pL (i.e., 0 05-O 10 pmol/pL ssDNA for a 5-kb plasmld) dU-ssDNA template As the efficiency of electroporatlon can be 109/vg, 1 yL of template preparation can generate up to lo* transformants
Phage Display on Protein Scaffolds
255
3.2. Stop Template for Library Construction 3.2.1. Phosphorylate Oligonucleotides 1. Mix, m a SOO-FL mlcrofuge tube, 7 PL of oligo solution (0.01 OD/pL = 0.36 mg/ mL = 48 PA4 of a 20-mer), 3 PL of 10X kmase buffer (see above), 1 pL of 10 mM ATP, 18 PL of water, and 1 PL of polynucleotlde kinase 2 Incubate 1 h at 37°C 3 Freeze products overnight, or proceed lmmechately with the mutagenesis reaction.
3.2.2. Mutagenesis Reaction 1 Mix, m a 500~pL tube, 3 1 pL of water, 2 PL of dNTPs, 2 PL of ATP, 5 PL of 10X mutagenesis buffer, 4 I.IL of dU-ssDNA template (0 06 pmol/pL), and 4 pL kmased ohgo solution (xe Subheading 3.2.1.) 2. Heat a 250-mL beaker of water to 70-80°C (see Note 3) Float the annealing mixture for 5 min. 3. Cool to room temperature 5 mm, and spm down the hquid. 4 Cool on Ice 5 min before adding enzymes 5. With tube on ice, add 1 FL of T4 DNA ligase 6 Add 1 PL of T7 DNA polymerase on ice 7 Incubate at room temperature for 1 h, then at 4°C for 2 h, or overnight 8 Bring volume to 150 pL with TE, and freeze or proceed
3.2.3. Extract Mutagenesis Product 1 Extract the mutagenesis products with one-half vol phenol.chloroform. Repeat 2-3 times until aqueous layer IS clear and no residue is seen at interface 2. Add l/4 vol of 8 M ammonium acetate, 3 yL (optional) of tRNA (10 mg/mL) solution . 3 Add 2 5 vol ethanol; incubate at room temperature 10 mm. 4 Spin 10 min at 12,000g in microfuge; remove supernatant 5. Wash pellet with 0.3 mL of 70% ethanol. 6 Spin 3 mm and remove supernatant 7. Dry the pellet (usually mvlslble, unless tRNA was added) m a speed-vat for 10 min. 8 Resuspend ssDNA pellet in 15 JJL of TE, and allow to dissolve at least 10 mm at room temperature 9 Store at -20°C; or proceed immediately
3.2.4. Transformation
of Mutagenesis Products
1 Transform the mutagenesis products mto XLI-Blue cells as described (see Subheading 3.1.1.) 2 Plate onto LB/ampicillin plates, for sequencing, or for phage-ELISA screening (see Subheading 3.5.)
256
Lowman
3.3. Library Construction Constructton of the randomtzed phagemid library follows the procedure described for site-directed mutagenests above. Here, the template for each library must be a “stop-codon” template tailored for the particular sttes to be mutated. The mutagenic oligos contain NNS codons at each position to be randomized (see Fig. 1, Note 2). I
For each hbrary, prepare dU-ssDNA template from the correspondmg stop-codon construct (see Subheading 3.1.). 2 Perform mutagenesis reactions with the NNS mutagemc 011gos (see Subheading
3 Transform
3.2.)
the mutagenests products into XLI-Blue
cells (see Subheading
3.1.1.)
4 Followmg the recovery step (see Subheading 3.1.1., step lS), remove 20 l.tL from each transformation mix and perform eight IO-fold serial dilutions. Plate onto LB/amplcillm plates for colony countmg The number of colonies must be greater than the library dlverstty for complete representation (see Note 1) 5 Add the remammg 0 98 mL of transformation mix to 25 mL of 2YT contammg 50 ug/mL of amptcillm (for phagemtd selectton), 17 yg/mL tetracyclme (for XLl-Blue selection), and 2 x lo9 PFU/mL of helper phage K07. 6 Incubate 12-16 h at 37°C with shaking
3.4. Affinity
Sorting the Library
This is the affinity-enrichment cycle for sorting high-affinity proteins displayed on phage. The cycle should be repeated until the desired affinity is obtained, or until sequencing of phagemid clones tndtcates that the library has converged to a consensus or a single clone (see Fig. 2, Notes 4 and 5). 3.4. I. ELISABortmg
Plate
Preparation
1 For each library to be sorted, use a separate Nunc Maxlsorp plate Coat a set of 8 wells with 100 ILL of a 1 pg/mL solution of target protein carbonate buffer 2 Incubate overnight at 4°C or 2 h at room temperature. Subject to stabthty of the target protein, the plates may be stored at 4°C for days or weeks 3 Remove the coatmg solution, and block the 8 coated wells as well as 8 noncoated wells (as a negative control) with 0 2 mL each of milk block. 4 Incubate 2 h at room temperature 3.4.2.
Fresh Cells for Phage
Counting
and Propagation
1 Start an XLl-blue culture for mfectlon at least 8 h m advance, or use an overnight culture to start a fresh culture 2-3 h m advance Pick a single colony from a <2-week-old plate (or add 25 uL from an overnight culture) mto 25 mL of 2YT containing 17 yglmL tetracycline
257
Phage Display on Protern Scaffolds A Dlsplaylng
Phagemlds
Non-displaymg
(ld°CFU.
Am:
(IdoCFU.
)
Incubate
phagemlds
Can?
)
on plate with lmmoblked
target
Wash away non-binders 1 El&
with acid
1 J\ Propagate with helper Phase
Count CFU (Amp and Cam) from starhng m#x and from &ate
Fig. 2 (A) Outhne of affimty enrichments Dlsplaymg and nondlsplaymg (control) phagemlds are mixed and incubated with target Following elution, phage are used to infect fresh cells for propagatron and for colony countmg, to determine the enrichment ratlo ([Amp/Caml,l,,,d/[Amp/Cam],,,,,). (B) Typical profile of the enrichment ratio as a function of the number of selection cycles (see Note 5) 2 Incubate with shaking at 37’C for 6-8 h (Ideally, cells ~111 be at a density of 0 S-O.6 ODeo0 when used for infection)
3.4.3.
Prepare
Library
Phage
from Overmght
Cultures
1 Pellet cells (see Subheading 3.3., step 6) 10 mm at 10,OOOg Discard pellet. 2 To the supernatant, add l/5 vol PEG/NaCl solution Incubate 10 mm at room temperature 3 Pellet phage (10 mm at 10,OOOg). Discard supernatant and, using the hquld remaining on the sides of the tube, suspend and remove pellet to a 1 5-mL mlcrofuge tube
Lowman 4. Spin the pellet 2-3 mm m a mrcrofuge and remove as much PEG-NaCl solution as possible 5 Resuspend pellet m 100-1000 FL PBS Allow 5 mm for pellet to dissolve, vortex 6 Spm out debris (If any) and transfer to a fresh tube if necessary 7 Repeat steps 2-6 two more times, to obtain a cleaner phage pellet (should appear white) 8 Resuspend final pellet m 500-1000 pL PBS and store at 4°C until needed. 9 Estimate phage concentratton by readmg OD,,, of an altquot of phage (1 OD,,, = approx 1 .l x lOI3 phage/mL for a 5-kb phagemid) 10 Adjust concentratton to 1013 phage/mL
3.4.4. Phage Binding and El&/on 1 Mix phage solutton m a screw-cap polypropylene tube 890 pL of phage bmdmg buffer, 100 ,uL of 10’ ’ phage/mL Cam phagemtd (nonbmdmg control phagemid), 10 pL of library phage sample (lO’“/mL) 2 Remove milk block solution and wash once with wash solution (Subheading
3.4.1., step 4). 3 Add 100 pL of phage solutton to each of the 8 coated wells and each of the 8 uncoated wells of the Maxisorp plate 4. Incubate 1 h at room temperature 5 Remove phage solutron and wash 10 times wtth wash solutton 6. Add 100 FL/well of wash solutton 7 Incubate plate 10 mm at room temperature 8 Repeat steps 5-7 several times to select for an appropriate number of phage (see Note 4) 9 Add 100 pL/well of a solutton of 100 n-J4 HCl 10 Incubate 5 mm at room temperature 11 Remove the HCl solution (contammg phage) and immediately neutrabze with l/3 vol 1 MTrls, pH 8 0. 12. Add half the eluted vol to 5 vol fresh XLI-Blue cells (see Subheading 3.4.2.) 13. Incubate 1 h at 37°C with shakmg 14 For propagation of phage for the next round of sorting, Inoculate mto 25 mL of 2YT contammg 2 x IO9 PFU/mL M13K07 helper phage, 16 p.g/mL of tetracycline and 50 pg/mL of ampiclllm 15 Incubate at 37°C overnight wrth shaking and prepare phage as described above for the next cycle of enrtchment. 16 Repeat the cycle (Subheadings 3.4.1,3.4.4.) until the enrichment ratio (as assayed below, see Subheading 3.4.5.) has reached a maximum (see Note 5)
3.4.5. Assay of Phage Enrichment This procedure
1s used to count colony-forming
units (CFU)
for an estrmate
of the enrichment of binding phage over nonbinding phage m each round of selection
(see Fig. 2, Note 5)
Phage Display on Protein Scaffolds
259
1 Add 180 yL of bmdmg buffer to 2 x 8 wells of a Nunc F plate. 2 Altquot 20 pL of the starting phage mixture to the first well of column 1, and 20 yL of the eluted phage mixture to the first well of column 2 (1 e., a IO-fold dllution of phage). 3 Perform lo-fold serial dilutions by transferrmg 20 pL from each row to the next row. 4 Add 180 pL of fresh XLI-Blue (ODG,c 0 3-O 5) cells to 2 x 8 wells of a second Nunc F plate. 5. Transfer 20 p.L from each well on the first plate to the correspondmg well of the second, mlxmg with up-and-down prpetmg 6 Shake the second plate at 37°C for 1 h 7 Using a multichannel pipetor, carefully spot 10 FL from each well onto an LB/ ampicillin plate (to count displaying, library phage), and onto an LB/chloramphenicol plate (to count nondisplaying, CAT phage) 8. Incubate overnight at 37°C and count colonies. 9. Calculate the ratio, Rl of amptcillin-resistant colonies to chloramphemcolresistant colomes (Amp/Cam) start, and the ratio R2= (Amp/Cam)eluted The enrichment is R2/Rl (see Fig. 2B)
3.5. Analysis
of Binding
Affinities
Once phage llbrarles have been sorted, relative affmlttes of the phage pools or of the isolated phage clones are assayed Thts procedure is based on the
phage-ELBA assay described by Cunningham et al. (16). 3.5.1. Normalza tion of Phage Concentrations To measure relative affinities malize the phage concentrations
of phage variants, it is first necessary to nor-
(Fig. 3A).
1 Coat and block 3 x 8 wells per library or control phage (for triplicate assay of each hbraty) of a Maxisorp plate (see Subheading 3.4.1.) 2. In a separate plate (e.g , Nunc F plate), prepare threefold serial dtlutions of the phagemtd stock, starting with a lo-fold dilution in phage binding buffer Volume of each well should be at least 110 pL. 3. Remove milk block from coated plates and wash once with wash solution 4 Ahquot 100 pL each of phage dilution from the F Plate to correspondmg wells on the Maxisorp plate 5. Incubate at room temperature, 1 h. 6 Meanwhile, make up 10 mL per plate of an appropriate dtlutlon of antlphage antibody-HRP (horse radish peroxtdase) conjugate, or antiphage anttbody and secondary antibody-HRP conjugate, m phage-bmdmg buffer 7 Remove bmdmg solutions Rinse 10 times with wash buffer 8 Add 80 pL of antibody solutton to each well 9 Incubate at room temperature 10 min
260
+t
1 ;
‘-
/
06
j;b 06
5 6 z ;: i w
/
a 04 L? ‘: 02
/ 0
/ Ezl -7 -6 -5 -4 -3 -log (Phage Dilution
06 06 04
-1
0 -2
-1 Factor)
0
\
02 l-ilL+A -12 -11
\ -10 -9 -5 -7 log [Compelltor)
-6
-5
Fig. 3 (A) Phage-ELISA for normabzatton of dtsplaymg-phage concentrations Here, for example, two different phagemid preparations differ in concentration by a half log umt, as indicated by the dilution series (see Note 4) (B) Phage-ELISA for determmation of relative affmltles Here, the two phagemid preparations have been normalized, and competed with soluble target over a range of 10-6-10-“M The I&s so determined correspond to 1 nM (sohd line) and 10 nM (dashed lure) 10 Meanwhile, mix OPD solution (see Subheading 2.5., item 3) 11 Remove antibody solution and rmse Maxisorp plate 10X with wash buffer 12 Add 80 yL of OPD substrate solution to rows B-H, being careful not to crosscontammate the wells 13 Develop 5-30 mm as needed for a clear development of color 14. Stop development by adding 40 pL of 2.5 M H,SO, per well 15 Read ODJg2 using a plate reader 16 The EC& is determmed usmg a computer program (Ace Note 6)
3.5.2. Competitwe Displacement
Phage ELBA
Once the EC,, for phage bmdmg to target has been determined for each library pool and control, the relative affinities can be measured as
Phage &splay on Protein Scaffolds
261
(IC&brary]/IC,, [control]) by a competitive phage-ELISA (see Fig. 3B). It is advisable to monitor carefully the affinities of variants as the libraries are sorted, in order to Insure that the selection process is stringent enough (see Note 4) to obtain the desired affinity. Furthermore, it may become necessary to employ restriction selection (6J5) against undesired or contaminatmg clones of high affimty (see Note 7) 1
2. 3
4.
5. 6. 7
Make a 1-mL solution of each phageclone or pool to be tested m phage-binding buffer at the concentration corresponding to the respecttve EC,, Set up a Maxisorp plate as described (see Subheading 3.4.1.) Ahquot soluble competitor (target protein) m a Nunc F plate, 8 threefold dilutions starting at 10X the maximum concentration to be tested, 20 FL per well. The dilutions are best prepared in bulk in mtcrofuge tubes, then dispensed to the plate To each well of soluble competitor, add 180 pL (for a lo-fold dilution from the stocks prepared above) of phage solution (m bindmg buffer) to give 80% maximal binding as determined above (see Subheading 3.51.) Transfer 100 pL from each well of the Nunc F plate to the Maxlsorp plate Develop as above (see Subheading 3.5.1., steps 5-16; Note 6) The ICsOs are compared as a measure of relative affinity.
4. Notes 1 The number of independent transformants obtained m constructron of a random peptide library should ideally exceed the DNA diversity of the library by a factor of lo- to 100-fold (IS) While this does not guarantee the diversity of the library is complete, it does make it likely that most sequences are represented (see also Note 2). For example, tf 4 sites are randomized with 32 possible codons, 1 05 x lo6 codon combinations are possible, and 107-lo8 transformants are needed to Insure that each possible peptide is present m at least one copy (10) 2 The choice of how to randomize codons is dependent on which ammo acids are desired and what level of diversity 1s needed NNS codon randomtzatton provides all 20 amino acids encoded by only 32 of the 64 possible biological triplets. Thus, a library of four randomized codons has a potential diversity of 324 = 1.05 x 1O6triplet combmatrons encodmg only 204 = 1 6 x lo5 peptrdes A lesser degree of diversity per codon may be desirable tf more positions are to be randomized. For example, NYC (where Y = C/T) codon degeneracy yields only eight codons encoding a biased set of mostly hydrophobic side chains. In addition, algorithms have been described for developing “mtelhgent” biased codon distributions (21). 3 A useful approximation to the ideal annealing temperature is given emptrically by the temperature for specific PCR-prtmmg, Tp (21) This can be calculated as described by TP (“C) = 22 + 1 46(nAT + 2noC), where ?rAr 1s the number of A or T bases m the oligo, and bloc IS the number of G or C bases (22) 4 The selection process can be aided for high-affinity binders by lengthening the period of mcubation of phage with target (equilibrium competitton), and by
Lowman lengthemng the period of washmg away weak or nonbmdmg variants (kmetic competition) For example, a protem-protem interaction of nMaffmity will typically have an t,,, of dlssoclation on the order of 30 mm, and Improvements m affinity ~111often result from slower off-rates (6) 5 The enrichment cycle IS contmued, with momtormg of the enrichment ratio and/ or the relative affmlty of the hbrary pool, until the enrichment ratio reaches a maximum In theory, this ratio should approach a plateau, corresponding to the enrichment obtamable for the smgle highest-affinity variant (convergence of the hbrary to a single sequence) However, m practice, the enrichment may rise durmg several cycles, then declme (Fig. 2B). This may occur as a result of expresslon bias m display of the bmdmg protein, or from other m vlvo selection processes It 1stherefore desirable to begm sequencmg samples from each library as soon as the enrichment ratlo rises above that of the starting (wild-type) display phage. Analysis of sequence convergence has been dlscussed elsewhere (6,15,23). Iterative mutation durmg the sorting process 1s also possible (24) 6 It IS useful to fit the ELISA competltlon (or data to a generic saturation curve, of the form y = (n-6)/( 1 + 10 [c(rl-r)l), where a and b are the maximum and mmlmum plateau values, respectively, c 1s the slope of the curve at its mldpomt, d IS the I& (or EC,,) of the dtsplacement (or tltratlon), and x 1sthe log of the competitor concentration (or phage dllutlon factor) For normahzatlon of display-phage concentratlons, the ELISA data 1s plotted as a function of -log(dllutlon factor) Once a curve has been fit to the data, a point, e g , at 80% saturation, can be determined for normahzatlon of the concentrations (Fig. 3A). Subsequently, a competition assay with soluble target protem 1s used to determine the relative affmlty (IC,,) of mteractlon (Fig. 3B) 7 A problem commonly encountered m the sorting of phage libraries displaying high-affinity hgands IS the contammatlon of new hbrarles by high-affmty phage isolated from previously sorted libraries. Since the enrichment of phage for binding to a target can hterally retrieve one clone out of a library of lo6 or more different phage variants (6)) it 1s prudent to take precautions against contammatlon beyond standard aseptic techmques These include, for example, use of aerosol-barrier plpet tips, frequent (70% ethanol) cleaning of plpetors, avoidance of msertmg obJects into solution bottles, and use of disposable plpets and containers whenever possible
Acknowledgments I thank Brian Cunmngham and James Wells for helpful dlscusslons and suggestlons on the manuscript. References 1 Parmley, S F and Smith, G P (1988) Antibody-selectable fllamentous fd phage vectors’ affinity purification of target genes. Gene 73,3053 18 2 Devlm, J J , Pangamban, L C., and Devlm, P. E (1990) Random peptide llbraries a source of specific protein bmdmg molecules Sczence 249,404-406
Phage Display on Protein Scaffolds
263
3 Wells, J. A and Lowman, H B (1992) Rapid evolution of peptlde and protein bmdmg properties in vitro. Curr. Opm. Struct. Blol. 2,597-604. 4 Clackson, T. and Wells, J A (1994) In vitro selection from protein and peptlde libraries. Trends Blotechnol. 12,173-184 5 Lowman, H B., Bass, S H , Simpson, N , and Wells, J A. (1991) Selecting highaffinity bmdmg proteins by monovalent phage display Biochemistry 30, 10,832-10,838 6 Lowman, H B and Wells, J. A. (1993) Affinity maturation of human growth hormone by monovalent phage display. J Mol. Biol 234,564-578 7. Roberts,B.L.,Markland,W,Ley,A.C,Kent,R.B,Whlte,D W.,Guterman,S.K, and Ladner, R. C. (1992) Dlrected evolution of a protein Selection of potent neutrophll elastase inhibitors displayed on Ml3 fusion phage Proc N&l. Acad Scz
USA 89,2429-2433 8 Denms, M S. and Lazarus, R. A. (1994) Kumtz domain mhlbltors of tissue factor-factor VIIa. II Potent and specific inhibitors by competltlve phage selection
J. Biol. Chem 269,22,137-22,144. 9 Hawkins, R E , Russell, S. J , and Winter, G (1992) SelectIon of phage antlbodles by binding affinity J Mel Biol 220,889-896 10 Barbas, C F. III, Hu, D , Dunlop, N , Sawyer, L., Cababa, D., Hendry, R M., Nara, P L., and Burton, D. R (1994) In vitro evolution of a neutrahzmg human antibody to human immunodeflclency virus type 1 to enhance affmlty and broaden strain cross-reactlvlty Proc Natl Acad. Scz. USA 91,3809-3813 11 Bass, S , Greene, R , and Wells, J A. (1990) Hormone phage An enrichment method for variant proteins with altered binding properties Protezns 8,309-3 14 12 Cwirla, S E , Peters, E A , Barrett, R. W , and Dower, W J. (1990) Peptldes on phage: A vast hbrary of peptldes for identifying hgands. Proc. Natl. Acad. Scl.
USA 87,6378-6382 13 Barbas, C. F III, Kang, A. S , Lerner, R A , and Benkovlc, S J. (1991) Assembly of combmatorlal antibody libraries on phage surfaces. the gene III site Proc. Nutl
Acad. Sci. USA g&7978-7982 14 Stratton-Thomas, J R , Mm, H Y , Kaufman, S. E , Chlu, C Y., Mullenbach, G. T , and Rosenberg, S. (1995) Yeast expresslon and phagemld display of the human urokinase plasmmogen activator epldermal growth factor-like domam Protein
Eng. 8,463-470 15 Lowman, H B. and Wells, J A (1991) Monovalent phage display. a method for selectmg variant proteins from random hbrarles Methods 3,205-216 16 Cunningham, B. C., Lowe, D G , Ll, B , Bennett, B D , and Wells, J. A (1994) Production of an atrlal natnuretic peptide variant that IS specific for type A receptor. EMBO J. 13,2508-25 15 17 Kunkel, T A , Bebenek, K., and McClary, J. (1991) Efficient site-directed mutagenesis using uracll-containmg DNA Methods Enzymol 204,125-l 39 18. Messing, J. (1983) New Ml3 Vectors for Clonmg Methods Enzymol 101,20-78 19. Vlerra, J and Messmg, J (1987) Production of single-stranded plasmld DNA Methods Enzymol. 153,3-l 1,
Lowman
264
20. Bullock, W. 0, Fernandez, J M., and Short, J M (1987) XLl-Blue A hrgh efficiency plasmxd transformmg recA Escherrchta coli stram with betagalactostdase selection Bzotechnzques 5,376-378 21 Arkin, A P and Youvan, D C (1992) An algorithm for protem engmeermg Stmulatrons of recursive ensemblemutagenesis Proc Natl. Acad Scz USA 89, 7811-7815. 22 Wu,D Y ,Ugozzoh,L ,Pal,B K ,Qran,J ,andWallace,R B.(1991)Theeffect of temperature and length on the specrfrcity and efficiency of amphfrcatton by the polymerase chain reaction DNA Cell Bzol. 10,233-238 23 Matthews, D J and Wells, J. A (1993) Substrate phage selectton of protease substratesby monovalent phage dtsplay Science 260, I 113-l 117 24 Stemmer, W C (1994) Rapid evolutron of a protein m vitro by DNA shufflmg Nature
370,389-391.
25 Displaying Libraries of Conformationally Constrained Peptides on the Surface of Escherichia co/i as Flagellin Fusions Zhijian Lu, Brian C. Tripp, and John M. McCoy 1. Introduction A number of systems have been developed over recent years that allow the selection of sequences with desired bindmg specificities from highly diverse, randomly generated peptlde libraries (I-3), When a member of a peptlde hbrary mteracts with a target blomolecule during one of these selections, both its pnmary sequence and its conformation play Important roles m the recogmtlon process However, typically in these systems the peptides are tethered to one end of a fusion partner protein, where they possess many degrees of conformatlonal freedom. These flexible peptides may possess lower affinities for their target molecules than the same peptldes presented as part of a folded native protein structure or in a more constrained cyclic structure (4-7). To circumvent this problem, various “protein scaffolds” have been proposed to help small peptides retain their conformations by restricting chain flexibility (8-10). Crystallographic and NMR studies of the Escherichza coli thioredoxm structure reveals that its active-site sequence, -Cys,,Gly,,Pro&ys,,-, forms a tight, disulfide-constrained loop on the protein’s surface (11,12). This loop is a highly permissive site for the insertion of a wide variety of peptlde sequences, and these insertions usually do not interfere with the proper folding of the molecule (13). Peptides inserted mto this site have both their N- and C-termim tethered to the rigid and stable tertiary fold of thloredoxin Itself, and furthermore, two cysteme residues flankmg the peptide insertion point within the thloredoxin active site have the potential of forming a dlsulflde bond (14), which could further reduce conformational freedom. The structural constraints imposed on active-site peptlde msertlons make thloredoxin a very attractive From
Methods
m Molecular B/o/ogy, vol 87 Combmatonal Peptrde Edlted by S Cabil y 0 Humana Press Inc , Totowa,
265
Library NJ
Protocols
266
Lu, Tripp, and McCoy
choice as a protein scaffold In addition, soluble thioredoxin fusions, including many active-site msertions, can be readily produced in E. coli at very high levels (13)) facilitating subsequent structural analyses of the “active” bmdmg conformations of peptides of interest. Because thioredoxm is a cytosolic protein, tt IS easiest to envision its use in the constructton of cytoplasmtc peptrde libraries. Indeed, a 20-ammo acid random peptide library constructed wtthm the thioredoxm active-site loop was recently successfully utilized m conjunction with a yeast “mteraction-trap” to yield peptides with affinity to human Cdk2 (25). However, it would also be desirable to display thioredoxm peptide libraries on the E. colz cell surface to enable development of “panning” techniques, analogous to those used with phage-display peptide libraries (16) To address this concept, we explored the possibility of fusing the thioredoxm scaffold mto flagellm, a protem that constitutes the major structural component of the E coli flagellum (17). We found that the entire thioredoxin molecule could be Inserted into flagellm (18), replacing part of a central, nonessential, solvent-exposed domain (19,20) The resulting chtmertc protein (FLITRX) was exported to the cell surface, where it not only assembled into partially functional flagella, but also retained the solvent accessibility for the thioredoxin active-site loop. We constructed a dodecapeptide library within the FLITRX thioredoxm active sate and developed a “panning” technique, which was used successfully for selectmg mdtvidual peptides with affinities for immobilized antibody targets (18). The purpose of this chapter is to provide a protocol for readers who wish to use the FLITRX peptide library to map monoclonal antibody epitopes. It should also be noted that peptide epttope sequences identified with the FLITRX library can be reinserted mto the active-site loop of native thioredoxm to obtain soluble monomeric fusions. In addition, we also describe the procedures used m the origmal construction of the FLITRX fusion as a guide for the future insertion of other proteins mto bacterial flagellin. For a more detailed overview of the technology, please refer to the article by Lu et al. (18)
2. Materials 2.7. Apparatus
and Special Reagents
1 A rotary platform shaker 2 A shaking water bath set to 25°C. 3 Noncoated polystyrene &sue culture dishes (60 mm in diameter, from Nunc, Roskilde, Denmark) 4 90-mm and 150-mm Plastic Petri dishes (Fisher, Pittsburgh, PA) 5 90-mm and 150-mm Diameter mtrocellulose membrane filters (M&pore, Bedford, MA, HAHY 13750 and HAHY 08250) 6 96-Well flat-bottom tissue culture plates (Costar, Cambridge, MA, 3596)
Displaying Libraries
267
7. a-Methyl D-mannoside (methyl a-D-mannopyranoslde, Sigma Chemical, St Louis, MO, M6882) 8. 1251-labeled protein A (DuPont NEN, Boston, MA, NEX-146) 9 Rabbrt antimouse IgG polyclonal antibody (Zymed, South San Francisco, CA, 616500) 10 Murine antrhuman IL-8 monoclonal antibody HIL8-NR7 (Devaron, Dayton, NJ, 104-12-2). II. Purified monoclonal antibody wtth unknown epitope 12. E co11 strain G1724, a healthy nonmotile prototroph that may be used as a host cell for pL expression vectors (13) Note: this strain (avarlable from Genetrcs Institute, Cambridge, MA, InvrtroGen, San Diego, CA, or the American Type Culture Collection, Rockvllle, MD) is sensitive to both amplclllm and tetracycline 13. E colz strain GI808, which is wild-type with respect to flagellar synthesis and cell mot&y (18). Note. thusstram (avarlable from Genetics Institute) is sensitive to both amplclllm and tetracyclme. 14. E coli strain G1826, which carrresdeletronsm the fliC (flagellm) and motB genes (18) Note* this strain (available from Genetics Institute) is sensmveto amplclllm but resistant to tetracyclme 15. pGIS-104, which carries the gene for E. colt flagellm under the transcriptional control of the pL promoter (28) (available from Genetics Institute) 16 pFLITRX, which carries the gene for a functional fusion of flagellm and thloredoxm under the transcriptional control of the pL promoter (18) (available from Genetics Institute) 17. pALTrxA-781, which carries the genefor E. coli thloredoxm under the transcriptional control of the pL promoter (13) (available from Genetics Institute) 18. “LO-T”, a frozen stock (10’ ’ cells/vial) of G1826 cells transformed with a population of pFLITRX plasmrds(18) The plasmlds harbor a dodecapeptide library (drverslty. 1 8 x 108) Inserted mto the throredoxm active site (available from Genetics Institute)
2.2. Stock Solutions 1. 2% Casammoacids (CAA): Dissolve 20 g of casammoacids (Drfco, Detroit, MI, Certrfied grade) m 1 L deromzed water Autoclave the solution 2. 10X M9 Salts*Dissolve 60 g Na,HPO,, 30 g KH,PO,, 5 g NaCl, and 10 g NH&l m 800 mL deromzed water, adJUSt pH to 7 4 with NaOH, brmg the volume up to 1 L. Autoclave the solutron. 3. 10X M9 Salts with glycerol Drssolve 60 g Na2HP0,, 30 g KH*PO,, 5 g NaCl, and 10 g NH&l m 700 mL deionized water, add 100 mL glycerol, adJustpH to 7 4 with NaOH, bring the volume up to 1 L Autoclave the solution 4. 20% Glucose: Dissolve 20 g of glucose m deionized water and bring the final volume up to 100 mL. Filter sterilize the solution 5 10 mg/mL Amprcrllin (Amp). Dissolve 1 g of amptctllm (sodmmsalt, Srgma) m 100 mL of deionized water Filter sterilize the solutron
268
lu,
Trlpp, and McCoy
6
10 mg/mL Tetracycline (Tet) Dtssolve 100 mg of tetracyclme (Sigma) m 10 mL 75% v/v ethanol/water 7 10 mg/mL L-tryptophan (Trp) Dissolve 1 g of L-tryptophan (Sigma) m 100 mL hot deionized water. Filter sterihze the solution 8 20% a-Methylmannoside Dissolve 20 g of a-methylmannosrde m detomzed water and bring the final volume up to 100 mL Filter sterilize the solution 9. Other stock solutions 1 M MgCl, (autoclaved), 1 M CaCl, (autoclaved), 10% w/v NaN,, 5 M NaCl (filter sterilized), and 1 M Trts-HCl, pH 7 5
2.3. Working Solutions
and Media
1 IMC/Amp/Tet Mix 100 mL CAA, 100 mL 10X M9 salts, 25 mL 20% glucose, 1 mL 1 M MgCl,, 0 1 mL 1 M CaCl,, 10 mL Amp, 0 5 mL Tet, and 770 mL sterile deionized water For IMC/Amp medium omit the tetracyclme solution 2 CAA/Amp/Tet plates Autoclave 20 g casammo acids and 15 g agar (Difco) m 870 mL deionized water Add the followmg solutions after autoclavmg and allowing to cool to 60°C 100 mL 10X M9 salts, 25 mL 20% glucose, 1 mL 1 M MgCl,, 0 1 mL 1 M CaCl,, 10 mL Amp, and 0 5 mL Tet Pour the plates at 55°C For IMC/Amp plates omit the tetracyclme solution. 3 CAA/Amp/Tet/Trp plates Autoclave 20 g casammo acids and 15 g agar (Difco) m 870 mL detomzed water Add the following solutions after autoclavmg and allowing to cool to 60°C 100 mL 10X M9 salts, 25 mL 20% glucose, 1 mL 1 M MgCl,, 0 1 mL 1 M CaCl,, 10 mL Trp, 10 mL Amp, and 0 5 mL Tet Pour the plates at 55°C 4 LB/Tet Autoclave 10 g tryptone (Difco), 5 g yeast extract (Difco), and 10 g NaCl m 1000 mL deionized water After coolmg add 0.5 mL Tet For LB medium omit the addition of tetracycline solution 5 LB/Tet plates Autoclave 10 g tryptone, 5 g yeast extract, 10 g NaCl, and 15 g agar m 1000 mL detomzed water After cooling to 60°C add 0.5 mL Tet and pour the plates at 55°C For LB plates omit the addition of tetracycline solution 6 High-density plasmtd growth media (HPM/Amp) Add 10 mL 10X M9 salts with glycerol, 0 1 mL 1 M MgCl,, 0 01 mL 1 M CaCl,, and 1 mL Amp to 89 mL sterilized deiomzed water Add 0 05 mL Tet if required 7 5X Cell bmdmg buffer Dissolve 5 g powdered skim milk m 60 mL sterile deionized water, add 15 mL sterile 5 MNaCl, 25 mL 20% a-methylmannosrde 8 Blockmg buffer Add 20 mL of 5X cell bmdmg buffer to 80 mL IMC/Amp/Tet 9 Washmg media Add 25 mL 20% a-methylmannoside to 475 mL IMC/Amp/Tet 10 Cell-lysmg buffer Dissolve 2 g powdered skim milk m 183 mL sterile deionized water, then add 10 mL 1 M Trts-HCl, pH 7.5,6 mL 5 M NaCl, 1 mL 1 MMgCI,, 0 4 mL 10% NaN,, 200 pg DNase, and 8 mg lysozyme 11. Antibody-bmdmg buffer Dissolve 10 g powdered skim milk m 920 mL deionized water, then add 30 mL 5 M NaCl and 50 mL 1 M Tris-HCl, pH 7 5 12. Falter-washing buffer: Add 30 mL 5 M NaCl and 50 mL 1 M Trts-HCl, pH 7 5 to 920 mL deiomzed water 13 TE buffer 10 mA4 Tris-HCl, pH 8.0, 1 mMEDTA
Dlsplayrng Libraries 3. Methods 3.7. Maintaining
269
the E. coli Strains and the “LO-T”
Library
1 Streak out G1808 or G1826 on LB or LB/Tet plates, respectively, and culture at 37°C (see Note 1). Streak out pFLITRX/GI826 or pGIS-104/GI826 on CAA/ Amp/Tet plates and culture at 30°C. pALTrxA-781/GI724 should be grown on CAAlAmp plates at 30°C 2. Inoculate single colonies of G1808 or G1826 in LB or LB/Tet media respectively, grow at 37°C until saturation. Add 1 mL of 50% stenllzed glycerol solution to 1 mL of each culture, and store at -80°C m 2-mL Corning cryo-vials. 3 Inoculate single colonies of pFLITRX/GI826, or pGIS-104/GI826 in IMC/Amp/ Tet media, grow at 30°C until saturation Inoculate IMC/Amp media with pALTrxA-781/GI724, grow at 30°C until saturation. Add equal volumes of 50% stenllzed glycerol to the cultures, and store at -80°C as above (see Note 2) 4 Inoculate the entire contents of a LO-T master vial (100 OD&vlal, 10’ ’ cells) mto 1 L of IMC/Amp/Tet and Incubate at 30°C with shaking at 2.50 rpm until saturation Allquot the bacteria either into duplicate master hbrarles (1-mL aliquots of 10” cells, 100 OD&mL, a concentration achieved by brief centnfugatlon of the bacteria), or mto workmg libraries (1-mL allquots of 1O’O cells, 10 OD,,,/mL) Add equal volumes of 50% sterilized glycerol to the libraries, and store at -80°C (see Note 3) 5 To prepare plasmids, grow pGIS-104/GI826 or pFLITRX/GI826 m HPM/Amp/ Tet at 30°C for at least 18 h with vigorous shaking (250 rpm) pALTrxA-781/ G1724 can be grown m HPM/Amp (no tetracycline) Plasmlds may be prepared from these cultures usmg standard protocols (21).
3.2. Mapping
Monoclonal
Antibody
Epitopes
1 Inoculate 1 ahquot of the working library (10 ODSJO, lO*O cells) into 100 mL IMC/Amp/Tet. Grow the culture at 25°C overnight with shaking (200 rpm) 2 Add 5 mL of the overnight culture to 100 mL of fresh IMC/Amp/Tet containing 100 pg/ mL Trp Grow the culture at 25°C for 6 h with shaking (200 rpm) (see Note 4). 3. During the 6-h induction period prepare two antibody-coated dishes for each antibody being studied (see Note 5) Add 1 5 mL deionized water to each 60-mm tissue culture dish and to this add 20 pg of the antibody. Spread out the antibody solution and keep the dishes gently agitated at room temperature (60 rpm) for 2 h. Cover the dishes with hds to maintain sterility, and to prevent evaporation 4. Pour off the antibody solution and rinse the dishes once with 5 mL sterde delonized water. Then add 10 mL of blocking buffer to each dish (see Note 6) and shake the dishes at 60 rpm until use. 5 At the end of the 6-h mductlon step, measure the OD,,, (ideally it should read between 0.8 and 1 2). MIX 1 part of 5X cell binding buffer with 4 parts of the induced FLITRX library culture and place 10 mL of the mixture into each coated dish
270
Lu, Tripp, and McCoy
6 Shake the dishes at 60 rpm for 1 mm, then leave them sitting stationary at room temperature for 1 h. Do not Jar or move the dishes durmg this period (see Note 7) Because the bacterial flagella are shear sensitive all subsequent washing steps MUST be performed very gently with mnnmal Jarrmg 7 Pour off the bacterial culture, slowly pipet 10 mL of wash buffer mto each dish at a marked spot along the rim (see Note 8), shake the dishes at 60 rpm for 5 mm, then discard the wash buffer by pipeting or aspiration 8 Repeat the washing step four more times Make sure that each time the wash buffer is added slowly to the same marked spot on the dashes. 9 After the fifth wash, leave only 0 4 mL solution in each dish and dissociate the bound bacteria by vortexmg the dishes vigorously for 30 s with the lids held tightly on Then rmse the dishes with 5 mL IMC/Amp/Tet twice, combmmg the rmse solutions with 100 mL of fresh, sterile IMC/Amp/Tet media Also rinse the lids with 1 mL IMC/Amp/Tet if they appear to be splattered with liquid from the vortexmg step, and also add this to the fresh IMC/Amp/Tet media 10 Incubate the eluted bacteria m the IMC/Amp/Tet media m a 25°C water bath shaker overnight at 200 rpm (see Note 9). This completes the first round of selection Steps 3-10 are illustrated m Fig. 1. 11 On the following mornmg, measure the OD,,, of the culture If it IS less than 0 1, let it grow further If it IS greater than 0 1, adjust the cell density to 0.1 m a total volume of 100 mL IMC/Amp/Tet and then add Trp to 100 yg/mL Culture the bacteria again at 25°C for 6 h with shaking (200 rpm). 12 Repeat steps 3-10 to perform additional rounds of selection. Usually a total of three rounds of selection are sufficient for epitope mapping At the end of the last round, culture the bacterra until saturation m IMC/Amp/Tet media (see Note 10). 13 Inoculate 10 mL IMC/Amp/Tet to 0 05 OD,,,/mL with fresh saturated culture from the final round of selection Incubate at 30°C with shakmg until the OD550 reaches 0.6, then make three different dilutions (1 60,000, 1 30,000, and 1 20,000) wrth IMC/Amp/Tet, or prepare approprrate serial dilutions. 14 Evenly distribute 0 2 mL of the culture dilutions onto 150-mm CAAlAmplTet plates with a glass spreader Target 4000 nonoverlappmg colonies on each 150-mm plate, spread 4 plates for each dtlutlon. Leave the plate covers ajar for 30 min at room temperature to allow excess liquid to evaporate. Then incubate the plates upside down at 30°C overnight 15. When colonies have grown to 0 5-mm m diameter (usually the next mornmg) chtll the plates at 4°C for 1 h (see Note 12) In the meantime, premcubate an equal number of 150-mm CAA/Amp/Tet/Trp plates at 30°C. 16 Usmg a ballpoint pen or a soft pencil, individually mark 150-mm tntrocellulose filter membranes at three nonsymmetrical intervals along therr circumference (see Note 13) Center and slowly lay down each filter, with the markings facing down, onto the top of the colonies present on the chilled CAA/Amp/Tet plates (master plates) Let the filters sit on the plates for 5 mm to allow for complete wetting and good contact with the colonies. If necessary gently press out any an bubbles Trace exactly the posittons of the filter numbermg and alignment markmgs onto
Displaying Libraries
271 BIND ANTBODY
BLOCK
PLATE
BlNDFLITRXLIBRARY
,
BLUTE BOUND CELLS BY MECHANICAL AGITATION GROW UP ELUIED OVERNIGHT
CELLS
+
WASH
OFF’ UNBOUND CELLS (5x)
Fig. 1. A diagram illustrating
17.
18. 19. 20.
21. 22.
23. 24.
steps 3-10, Subheading
3.2.
the outside of the agar plate with a felt-tip pen, to facilitate later alignment of filters, master plates, and autoradiograms. Using a pair of flat-bladed forceps, gently lift the filters away from the CAA/ Amp/Tet plates and place them down on the prewarmed CAA/Amp/Tet/Trp plates with the bacterial colonies (and pen markings) facing up. Incubate the plates with the filters at 30°C for 5 h (see Note 14). In the meantime, incubate the master plates at 30°C to allow the original colonies to grow back to 0.5-l mm in diameter, then store these regrown master plates at 4°C. Take the filters off the CAA/Amp/Tet/Trp plates and place them in the cell-lysing buffer at room temperature with gentle agitation overnight (see Note 15). The next morning wash the filters three times with filter-washing buffer, 15 min each time, to remove excess cell-lysing solution and bacterial debris. Place the filters in 20 mL antibody-binding buffer containing 1 pg/mL of the monoclonal antibody used for the selection. This amount of solution should be sufficient for each 150-mm membrane. Keep the solution gently agitated at room temperature for 2 h, and keep it covered to prevent evaporation. Wash the filters again three times with the filter-washing buffer, 15 min each time. Put the filters into antibody-binding buffer containing 1 pg/mL secondary antibody, e.g.,rabbit antimouse IgG (presorbed with GI808 lysate to remove any E. c&-reactive antibodies). Leave at room temperature with gentle shaking for 2 h. Again wash the filters three times with the filter-washing buffer, 15 min each time. Incubate the filters with ‘251-labeled protein A solution (a 1:2000 dilution of 12sIlabeled protein A into the antibody-binding buffer) for 2 h at room temperature with shaking (see Note 16).
Lu, Tripp, and McCoy
272
Plate out 40+X E.coli cells. 0
I
30 oc over night
Replica-transfer
the colonies.
Place on CANAmpTTrp GWAmpKrp
colony-side
plates,
up, grow at 30
oc.
1
After 6 hours growth, take out the membranes.
I, 2, 3, 4, 5,
Lyse Bind Bind Bind Expose
the the the 125
cells. 1st antibody (e.g. mouse mAb IgG). 2nd antibody (Rabbit anti mouse IgG). I-labeled protein-A. to X-ray film, identify the “hit” colonies.
Fig. 2. A “flow-chart” for identifying Subheading 3.2. for details.
individual
“hit” colonies. See steps 14-26,
buffer, 15 min each time. After the final 25. Wash the filters 3X with filter-washing wash, tape one edge of each filter to a piece of Whatman 3MM filter paper and air dry the filters. Cover the filters and 3MM filter paper with a large piece of Saran Wrap plastic film, taping the free edges to the reverse side of the filter paper (see Note 17). Position radiolabeled or luminescent markers to allow for later registration of autoradiograms and filters. 26. Expose to X-ray film using an enhancer screen at -80°C overnight. Develop the film and, if necessary, make longer or shorter exposures. Steps 14-26 are illustrated in Fig. 2. 27. Align the autoradiograms to the master plates using the radiolabeled or luminescent markers, the three pen marks on each filter, and the felt-tip pen marks on the master plates. Mark the positions of the colonies on the master plates that correspond to the positive signals on the autoradiograms with a felt-tip pen,
Displaymg Libraries
273
28 Pick the posltlve colonies with sterile toothpicks and inoculate 5 mL HPM/Amp/ Tet. Grow the bacteria overnight at 30°C to saturation m roller tubes with lids 29. Perform plasmid mml-preps (21). 30 Sequence the plasmld DNA across the region coding for the inserted peptldes Use a primer with the sequence* S-GACAGTTTTGACACGGATGT-3’ for the top strand and a primer with the sequence. S-TCAGCGATTTCATCCAGAAT3’ for the bottom strand (see Note 18).
3.3. Insertion
of Peptides into Thioredoxin
This section describes the insertion of individual peptides of interest (e.g., those discovered by the epitope mapping procedure described m Subheadings 3.2. and 3.3.) into the active site Cys-Gly-Pro-Cys of wild-type, native E. colr thioredoxin. Thioredoxm active-site loop fusions can usually be produced at high levels in a soluble form in E. coli strain G1724, with the inserted peptides remaining solvent accessible (13). The peptide inserts m such thioredoxin active-site loop fusions are also thought to retam the origmal conformations that they had adopted as FLITRX inserts. High-level production of thioredoxm active-site loop fusions facilitates subsequent biochemical or structural analyses. For a complete description of the use of the thioredoxin expression system, consult the protocols of McCoy and LaVallle (22). The procedures discussed below are also applicable to the creation of FLITRX peptlde insertions, for example if the pFLITRX plasmld is used m conjunction with pools of randomized oligonucleotides (18). Experiments outlined in this section involve the use of many standard molecular biology techniques. Existing protocols may be consulted for further details (21). 1. Cleave 10 pg of pALTrxA-781 with endonuclease CspI (Stratagene, La Jolla, CA, an lsoschlzomer of RsrII) m the manufacturer’s supplied buffer. This step linearizes the plasmld at a unique CspI site m the region encoding the active site of thloredoxm (see Note 19) 2. Extract with phenol and precipitate the DNA fragment with ethanol usmg exlsting protocols. 3 Redissolve the plasmld DNA preclpltate m 50 pL of 50 mMTns-Cl, pH 8 0, 10 mM MgC& buffer, and dephosphorylate the 5’-ends by Incubating with 1 unit of calf intestinal alkaline phosphatase for 5 mm (see Note 20) Extract with phenol and precipitate the DNA with ethanol to inactivate the phosphatase. 4 Gel purify the linear plasmid away from any uncut vector by electrophoresis on a 5% native polyacrylamlde gel followed by electroelutlon, phenol extraction, and ethanol precipitation 5. Design and prepare the coding and complementary strands of oligonucleotldes encoding the peptlde insertion of interest, with ends compatible with the sticky ends generated by CspI restriction cleavage As an example, the sequences for a pair of DNA ollgos coding for a (Ser)6 peptlde msertlon would be*
274
Lu, Tnpp, and McCoy 5’-GT CCA TCA TCA TCA TCA TCA TCA G-3’ 3’-GT AGT AGT AGT AGT AGT AGT C CAG-5’
6.
7
8.
9. 10
11
12
Note that the above design puts a prolme and a glycme at the N- and C-termml of the inserted hexapeptlde, respectively (see Note 21). Separately phosphorylate the S-ends of 100 pmol of each ohgonucleotlde with T4 kmase for 30 mm, using the manufacturer’s supphed buffer m a volume of 20 FL Heat to 90°C for 10 mm to terminate the reaction and then chill on ice Combine m one tube both phosphorylated oligonucleotldes in a final volume of 100 FL of annealing buffer (50 mMTns-HCl pH 8 0,lO mM MgC12) Anneal the complementary strands by heating to 90°C for 5 mm, followed by a slow coolmg step to ~30°C over a period of =l h Ligate a 1.1 molar ratio of the phosphorylated, annealed ohgonucleotlde duplex to the purified, lmeanzed, and dephosphorylated plasmld Incubate overnight at 15°C with T4 DNA llgase, using the manufacturer’s supplied buffer (see Note 22). Transform strain G1724 with the ligation mixture by electroporatlon Plate the bacteria on CAA/Amp plates and Incubate at 30°C (see Note 23) Pick transformant colonies with toothpicks, grow cells m HPM/Amp media overnight for plasmld mmlpreps, and verify the construction by restriction enzyme analysis and agarose gel electrophoresls. Inoculate IMC/Amp media with a fresh overnight culture of a verified candidate clone to 0 05 OD550 and grow at 37°C until the OD550 reaches 0 5 Add L-Trp to 100 pg/mL and continue growth at 37°C for 4 5 h Pellet and resuspend the cells to 10 OD,,,/mL m the lysls buffer (50 n-&J TrisHCl, pH 8, containing 1 mM of p-ammobenzamldme and 1 mM phenylmethylsulfonyl fluoride) Lyse the cells in a French pressure cell and then centrifuge the cell lysate m a mlcrofuge at 13,000 rpm for 10 mm Carefully transfer the supernatant mto a separate tube and resuspend the pellet m an equal volume of the lysls buffer (22) Analyze these fractions by SDS-PAGE
3.4. Fusion of Thioredoxin
Within E. coli F/age//in
The experiments outlined m this sectlon involve the use of many standard molecular biology techniques. Consult existing protocols for details (21). 1 Cleave 25 pg of pGIS-104 with endonuclease Sty1 m the manufacturer’s supplied buffer (see Note 24) 2 Extract with phenol and precipitate the DNA fragments with ethanol 3 Redissolve the DNA precipitate m 250 yL of buffer containing 20 mMTns-HCl, pH 8 0,O 6 MNaCl, 12 5 mMMgC12, 12.5 mMCaC1, 4 Add 12 5 units of slow BAL31 nuclease (IBI, New Haven, CT) to the DNA fragment solution and incubate at 30°C for exonuclease digestion Under these conditions the cut Sty1 ends ~111be trimmed back at approx 4 bp/mm (see Note 25) 5 Remove 50-FL ahquots for phenol extraction and ethanol precipitation (same as step 2) at 5, 10,20,40, and 80 mm followmg the start of the exonuclease reaction
Displaying Libraries
275
pGIS-104 flogellin flngellin, tbioredoxin
dispensible inserted
region into dispensible
region
Fig. 3. Plasmid maps of pGIS- 104 and pFLITRX. 6. Combine the DNA fragment solutions, redissolved in TE buffer, from all five time points. 7. Cleave the DNA fragment mixture to completion with endonuclease AflIII in the manufacturer’s supplied buffer (see Note 26). 8. Extract with phenol and precipitate the DNA fragments with ethanol. Redissolve the DNA in TE buffer. 9. Run the DNA sample on a native (i.e., nonurea) 5% polyacrylamide gel and recover the fragments in the 1500-l 700- (pool I) and 3000-3200- (pool II) base pair ranges by electroelution. 10. Cleave 15 pg pALTrxA-78 I-PLC20 (18) to completion with NdeI and SfiI in the manufacturer’s supplied buffer (other genes may be substituted for thioredoxin at this step if desired, ensure that translational terminators are absent). 11. Extract with phenol and precipitate the DNA fragments with ethanol. Redissolve in TE. 12. Treat the DNA sample with the Klenow fragment of DNA polymerase, using the manufacturer’s supplied conditions for creating flush ends, and supplementing with excess dNTPs (250 pMeach). 13. Run the flush-ended DNA sample on a polyacrylamide gel and recover the 397-base pair TrxA-PLC20 DNA fragment (TrxA fragment) by electroelution. 14. Ligate pool I, pool II, and TrxA fragment together using T4 DNA ligase using the manufacturer’s supplied conditions. The strategy behind this procedure and the resulting plasmid is shown in Fig. 3 (see Note 27). 15. Transform G1826 with the ligation products from step 13. Plate the transformants onto CAA/Amp/Tet plates.
276
Lu, Tnpp, and McCoy
16 Follow steps 15-27, Subheading 3.2., using a PLC-20 specific polyclonal antiserum (18) to identify clones that express fusions m which the PLC-20 epttope is solvent accessible (An antibody to any peptrde of interest inserted wnhm flagellm using this protocol may be substituted for the PLC-20 specific polyclonal antiserum used
4. Notes 1 These strams of bacteria are derived from strain G1724 (13), whose production of c1 repressor, controlled by a Trp promoter, decreases slightly at temperatures above 30°C 2 Because transcriptton of the FLITRX gene m G1826 (m both pFLITRX and the FLITRX LO-T hbrary) is controlled by the Trp promoter, both plasmtd and hbrary should be propagated m media that does not contam tryptophan We recommend Trp-free CAA-based media for plasmid growth, and for the outgrowth prior to mduction of protein expression 3. A master peptide library, LO-T, comprising ahquots of 100 OD,,, (about 10” E co11 cells), should be mamtamed m order to preserve library diversity Working library ahquots may be prepared and may contain fewer cells, but always several fold more than the total library diversity (1 e , 1 8 x log) We recommend that working libraries always be prepared from an original master library and not from another working ltbrary . 4 Adding L-tryptophan at this step starts the mductton process, whtch results m bacteria generatmg surface flagella At the temperature used (25°C) the pL promoter 1s only partially induced, and most bacteria survive the mductton process. (A full pL induction can kill host E. colt cells ) 5 Plates coated with the anti-IL-8 monoclonal anttbody HIL8-NR7 may be prepared for use as a control. 6. Blocking buffer contains a-methyl mannoside to prevent E. colz from bmdmg to the ohgosacchartdes present on glycosylated antibody molecules via mteractions with cell-surface fimbriae (23-25) 7 This is the step where the peptide loops present on bacterial flagella bmd the MAb coated on the plate 8. Adding the solution at one spot on the plate edge helps to mmlmize loss of bound bacteria and MAb caused by mechamcal shear forces 9. The rinse solutions should contain a number of FLITRX/LO-T library members that specifically bmd to the MAb on the plate, as well as some nonspecifically bound bacteria. At this pomt, relatively few bacteria are left m the rmse solutton, and these have had their flagella fibers sheared off Thus, they must be regrown overnight. 10. Usually three rounds of selectton are enough for epttope mappmg Only very occasionally IS a fourth round needed Typically, l-10% of the eluted bacteria are hits after three rounds of selection.
Displaying Libraries
277
11 If the surfaces of the agar plates are covered with too much liquid, colomes will smear mto or mix with one another, If thus happens, or d the colomes on the master plates are simply too crowded, a secondary screening can be performed. Brlefly, hit colonies on the master plates are streaked out onto CAA/Amp/Tet plates and grown overmght at 30°C. Then several single colomes from each streak are picked with toothplcks to inoculate secondary master plates (a short l-cm-long patch 1s the format we use for this inoculation, which allows for an easier comparison of the relative signal intensities of different hits) Followmg an overmght growth at 3O”C, the bacteria can be replica-transferred to mtrocellulose membranes for mductlon and probing according to steps 15-27 of
Subheading
3.2.
12. Chilling the plates arrests colony growth (overlappmg colonies are undesirable) and helps them subsequently to adhere to mtrocellulose filters. 13. We have found that the mk from a ballpoint pen 1sless likely to wash off from the membrane durmg later rinse steps 14. The growth and induction of E. toll on top of the porous membrane results m some of the FLITRX proteins being lmmoblllzed on the membrane These proterns can be later visualized by antibody-based staining techniques 15 The lysozyme disrupts the E coli cell membranes,while the DNase breaks up the viscous genomlc DNA The skim milk is the blocking reagent of choice to prevent nonspecific adsorption of antlbodles durmg the later probmg steps, 16. The filters also carry lmmoblhzed E. colz peroxidase and phosphataseactivities Thus detectlon of mAb bmdmg with a secondary antlbody ConJugatedwith horseradish peroxldase or alkaline phosphatasewill result m all colomes appearing as hits. A phosphataseenzyme mhlbitor such aslevamlsole might be useful for AP conjugates, although we have had llmlted successwith this approach The best signal-to-noise ratio hasbeen obtained with 1251-radlolabeled protem A, and for this purposethe secondary antibody should be derived from rabbits becauseof Its high affinity to protein A (26) 17. The Saran Wrap prevents contamination of the film surface by the filters, and also prevents them from adhering to the film. 18. The 5’+3’ primer lies approx 55 basesupstream from the region coding for the random peptlde dodecamer The reverse strand primer lies approx 25 basesdownstream of the region encoding the random dodecapeptlde. The usual encoded peptlde sequenceobtained 1s’ -CGP(X),,GPC-, where X 1sany of the 20 common ammo acids. The hits from the panning over monoclonal antibody HIL8NR7 should demonstrate the consensusHis-Pro-Lys-Phe (IS). 19 The pFLITRX plasmld hasthe sameunique RsrIUCspI site as thloredoxm m Its genecodmg for Cys-Gly-Pro-Cys region of the FLITRX chlmenc protein When constructing random peptlde libraries, the CspI-dlgested and dephosphorylated pFLITRX plasmld DNA should also be purified by acrylamlde gel electrophoresis to remove undigested plasmlds
278
Lu, Tripp, and McCoy
20 Complete 5’-end dephosphorylation of DNA fragments requires only a small amount of calf mtestmal phosphatase and a short mcubatton Excessive treatment with this enzyme could damage the protruding ends of DNA fragments 21. In general, random libraries of DNA 01~0s for insertion mto thtoredoxm or FLITRX genes are generated by synthesizing the sense-strand chemically, with fixed end sequences contammg AvaII sites The complimentary DNA strands are then synthesized by annealing a primer to the fixed region of the 3’ end of the sense strand, followed by PCR or Klenow fragment treatment to generate the rest of the random region and the other fixed end regton (18). The resultmg mixture of ohgo duplexes are then cut with AvaII endonuclease to obtain a pool of doublestranded ohgos wtth ends complimentary to the sticky ends generated by CspI dtgestton For constructing the particular dodecapepttde library m pFLITRX (LOT), we used the followmg ohgonucleottdes (18)* ohgo 1 S-GACTGACTG*GTCCG(XNN)‘*G*GTCCTCAGTCAGTCAG-3’ ohgo 2. 5’-CTGACTGACTGAGGACC-3’
22.
23
24.
25 26. 27
Note that a prolme and a glycme are introduced mto the N- and C-termun of the peptides, respectively. The ends of the double-stranded DNA ohgos are complimentary in a head-to-tall fashion, and a high molar ratio of ohgos to plasmid DNA will result m a high frequency of multiple copies of oligo duplexes inserted mto the plasmid Electroporation is necessary to transform plasmtd libraries into E colz hosts. Only strain G1826 should be used with the pFLITRX plasmid random pepttde hbrartes, because this strain does not express wild-type flagellm This procedure will cut at two Sty1 sites within a region of E co/z flagellin that is not critical for its self-assembly mto functional flagella This digestion will result m a large fragment, and a very small fragment, which is of no further use This procedure generates a diverse sets of DNA fragments of varying length due to different degrees of exonuclease digestion from the two ends This procedure generates two populations of DNA fragments, each of which bears a blunt end and an overhanging AflIII end. During ligation, mdividual DNA fragments m pools I and II are scrambled and reJoined at the AflIII site, leading to an increasing variety of deletions with regard to the two Sty1 sites in flagellm gene Meanwhile, the deletions are filled m by the TrxA fragment, resultmg m a whole spectrum of thioredoxm replacement m the flagellm center region
References 1 Smith, G. P. (1985) Ftlamentous fuston phage. novel expresston vectors that dtsplay cloned antigens on the vu-ion surface Sczence, 228, 13 15-l 3 17 2. Scott, J K. and Smith, G P. (1990) Searching for peptide hgands with an epttope library Sccence 249,386-390
Displaying Libraries
279
3 Clackson, T and Wells, J. A. (1994) In vitro selection from protein and peptldc llbrarles. Trends Bzotechnol 12, 173-184 4. Janm, J. and Chothla, C (1990) The structure of protem-protem recogmtion sites. J. Bzol. Chem. 265,16,027-16,030 5 O’Neil, K T., Hoess, R H , Jackson, S A , Ramachandran, N S , Mousa, S A , and DeGrado, W F (1992) Identlflcatlon of novel peptlde antagomsts for GPIIb/ IIIa from a conformationally constrained phage peptlde library Protezns, 14, 509-5 15 6 Hruby, V J. (1993) Conformation and topological conslderatlons m the design of blologlcally active peptldes Bzopolymers, 33, 1073-1082 7. McLafferty M. A, Kent, R. B , Ladner, R C., and Markland, W (1993) Ml3 bacteriophage dlsplaymg dlsulflde-constrained mlcroproteins Gene, 128,29-36 8. Nord, K., Nilsson, J,, Nllsson, B ., UhlCn, M., and Nygren, P -A. (1995) A combmatorial library of an a-helical bacterial receptor domain. Protezn Eng f&601-608. 9. Blanchi, E.,Folgorl, A , Wallace,A ,Nlcotra, M ,Acall, S , Phahpon, A , Barbato, G , Bazzo, R , Cortese, R , Fehcl, F., and Pessl, A. (1995) A conformatlonally homogeneous combinatorial library J Mol Biol. 247, 154-160. 10 McConnell S J and Hoess, R H (1995) Tendamistat as a scaffold for conformatlonally constrained phage peptlde hbraries J Mol Bzol 250,460-470 11. Katti, S K , LeMaster, D M , and Eklund, H. (1990) Crystal structure of thloredoxm from E toll at 1.68 angstroms resolution J Mol Bzol. 212,167-184 12 Dyson, H J., Glppert, G P., Case, D A , Holmgren, A , and Wright, P E. (1990) Three-dImensiona solution structure of the reduced form of Escherzchza colz thloredoxm determined by nuclear magnetic resonance spectroscopy Bzochemzstry 29,4129-4136. 13. LaVallle, E R., Dlblaslo, E. A , Kovaclc, S , Grant, K. L , Schendel, P F., and McCoy, J M (1993) A thloredoxm gene fusion expression system that clrcumvents mcluslon body formation m the E coli cytoplasm BzolTechnology 11, 187-193. 14 Holmgren, A (1985) Thloredoxm Ann. Rev Bzochem 54,237-271 15. Colas, P , Cohen, B , Jessen, T , Grlshma, I , McCoy, J , and Brent, R (1996) Genetic selection of peptlde aptamers that recogmze and mhlblt cyclm-dependent kmase 2. Nature 380,548-550 16 Scott, J K and Craig, L (1994) Random peptlde libraries Curr. Opin. Bzotechnol 5,40-48. 17 Wilson, A R. and Beverldge, T J (1993) Bacterial flagellar filaments and their component flagellms Can J Mzcrobzol 39,45 l-472 18 Lu, Z., Murray, K. S , Van Cleave, V., LaVallle, E R., Stahl, M L., and McCoy, J M. (1995) Expression of thloredoxm random peptlde hbrarles on the Escherzchza coli cell surface as functional fusions to flagellm, a system designed for exploring protein-protein mteractlons. BzolTechnology 13,366-372 19. Namba, K., Yamashlta, I , and Vonderviszt, F. (1989) Structure of the core and central channel of bacterial flagella. Nature 342,648-654.
280
Lu, Tripp,
and McCoy
20 Kuwajtma, G (1988) Construction of a munmum-size functional flagellin of Escherichza colz J. Bacterial 170,3305-3309. 21 Sambrook, J , Frttsch, E F , and Mamatts, T. (1989) Molecular Clonzng A Laboratory Manual, 2nd ed Cold Sprmg Harbor Laboratory Press,Cold Spring Harbor, New York 22 McCoy, J M and LaVallte, E R. (1994) Expresston and purtficatlon of thioredoxm fuston protems, m Current Protocols zn Molecular Biology (Janssen, K , ed.), Wiley, New York, Unit 16 8. 23 Dtderichsen, B (1980) flu, a metastable gene controllmg surface properties of Eschewhza colt J Bactenol. 141,858-867 24. Ofek, I and Beachy, E H. (1978) Mannose bindmg and epttheltal cell adherence of Escherlchla co11 Infect Immun 22,247-254 25 Ponmah, S , Endres, R 0 , Hasty, D L , and Abraham, S N (1991) Fragmentation of E colz type 1 ftmbriae exposes cryptic o-mannose-bmdmg sites J Bacterzol 173,4195-4202 26 Harlow, E and Lane, D (1988) Antzbodles. A Laboratory Manual Cold Sprmg Harbor Laboratory, Cold Spring Harbor, New York
26 Combinatorial
Peptide Library as an lmmunogen
J. Estaquier, J.-C. Ameisen, C. Auriault, H. Gras-Masse, and A. Tartar
C. Boutillon,
1. Introduction For the past few years, combmatorial chemistry has become a rapidly expanding field in medicmal chemistry (1-3). Obtaining large numbers of structurally diverse compounds represents a major apphcation of combmatorial chemistry, and such divergent libraries are used m the identification of possrble candidate molecules, employing various screemng methodologies. We have designed and synthesized a completely different type of combinatorial libraries, referred to as “mixotope” or “convergent libraries .” These libraries, composed of closely related peptides mixture, collectively present to the immune system a defined antigemc determinant together with its variable motifs. A typical example is the principal antigenic determinant susceptible of eliciting neutralizing antibodies to the human immunodeficiency vu-us (HIVl), the causative agent of acquired immunodeficiency syndrome (AIDS) This antigemc determinant (epitope), located m the third hypervariable domain (V3) of the HIV surface glycoprotem, gp 120, consists of 32-35 ammo acids located between two invariant cystemes lurked by a disulfide bridge (4). In this region, differences exceeding 50% can be found between isolates; thus, recombinant proteins and peptides derived from different isolates have been shown m general to induce antibodres that neutralize only particular subtypes of HIV-l. To recruit simultaneously the broadest part of the repertoire capable of recogmzing not only the known isolates, but also the most probable mutants, we have proposed the use of a mixotope designed from the natural variability of the V3 loop sequence (5). Our initial hypothesis was that molecular structures involved m the immune recognmon exhibit a much broader recogmtion pattern than
From
Methods
m Molecular Bology, Edited by S CablIly
vol 87 Combmatonal Peptrde 0 Humana Press Inc , Totowa,
281
Library NJ
Protocols
282
Estaquier et al.
usually considered, being able to tolerate vartations m several positions of the epttope. After alignment of a serves of V3 sequences, we have selected in each position the most represented ammo acids, with a threshold of 8% In the degenerated positions, each ammo acid was represented m equimolar amount, in order to allow the characterization of the construct by determination of the ammo acid composition. This first mixotope was 22-25 residues long and contamed a mixture of 7.5 x lo5 closely related peptides that were obtained m a single synthesis by mcorporatmg simultaneously 1-6 ammo acids m each positions. The immunogenicity referred to as the abiltty of antigens to induce an immune response was investigated m different animal models (rabbit, mouse, and rat) to determine and explore the potentiality of such a peptide mtxture (5-7). The capacity of the immune system to elicit a specific response depends on the existence of recognition mechanisms mediated by a population of T- and B-lymphocytes that express a wide range of antigen-specific receptors. Unlike B-cells, which recognize antigens as soluble native protein antigens, T-lymphocytes recognize antigens as denatured or partially degraded proteins (peptides) associated with molecules encoded by the major histocompatibillty complex (MHC) class II and class I. Class II molecules associated with pepttde epitopes are expressed on the surface of speciahzed antigen-presenting-cells (APC) (8), such as dendrmc cells, and recognized by CD4 T-cells, whereas, the complexes of peptides and class I molecules are expressed on the surface of any nucleated cells and recognized by CD8 T-cells. The generation of an effective and specific immune response to foreign antigens is regulated by the htstocompatibility molecules of an individual (9). The T CD4 helper, MHC class II-restricted response, controls the expansion and maturation of antibodyproducing B-cells and of the T CD8 cytotoxtc, MHC class I-restricted response, which is responsible for the destruction of the infected cells. Each mdtvidual has a very large number of B- and T-cell receptors of different antigenic specificities, but has only a limited set of the highly polymorphtc MHC molecules. In order to present foreign antigens to the T-cells, this limited set of MHC molecules must be able to interact with a wide repertoire of unknown antigens. The existence of high diversity of MHC molecules in the human population on one hand, and a restricted number of MHC molecules m each given mdividual on the other, raises a major problem in antigen recognition and vaccine strategy. Our V3 peptide libraries was found to be strongly immunogenic in all tested animals when injected in the absence of a carrier protein. The ltbrary elicited a broadly crossreacttve antibody response, however, the antibodies were V3 specific. Antisera were able to recognize the HIV-l gp 120 protein, as well as a
lmmunogen Peptide Library
283
family of individual V3 sequences related to the mixotope, but not a divergent V3 sequence, nor unrelated peptides. Among the interesting potential applications, peptide libraries may allow generation of T- and B-cells with distinct specificity and thus can bypass the requirement for a carrier protein that is often necessary to elicit an immune response to a peptide antigen. Fme analysis of the cellular immune response indicated that T-cells from mixotopeimmunized animals could be specifically restimulated by mdividual V3 sequences related to the V3 peptide library, and that restimulation resulted m the secretion of various cytokine secretion profiles. The possible use of such combmatorial constructs for the development of vaccines raises important questions. Immunization with a large peptide library may lead to an interplay between agonist and antagonist peptides that may induce an immune response (i.e., the cytokine profile) that IS very different from that elicited by a unique peptide sequence (10). It appears important to determme the minimal level of diversity able to ehcit the production of such crossreactive antibodies, and the maximal level of diversity still able to generate a specific immune response (II). A major aspect of mixotope immumzation is to investigate the risk of losing immunogenrcity and/or specificity when mcreasmg the complexity of the immunizmg mixture, and to open the immune repertoire to such an extent that it could result m autoimmumty.
2. Materials 2.1. Mixotope Synthesis 2.7.7. Peptide Synthesis 1 Applied Biosystems model 430A peptide synthesizer (Applied Blosystems, Foster Crty, CA) 2 p-Methylbenzhydrylamme-resin (0.72 mmol/g) (Applied Blosystems) 3 tBoc-ammo acid derivatives (Propeptide, Vert-le-Petit, France) The side cham protecting groups are: Asp(O-cyclohexyl), Cys(4-methyl-benzyl), Glu (0-cyclohexyl), His(2,4-duutrophenyl), Lys(2-chloro-benzyloxycarbonyl), Met(sulfoxlde), Arg(tosyl), Ser(O-benzyl), Thr(O-benzyl), Trp(formyl), and Tyr(2-bromobenzyloxycarbonyl) 4 2-( lH-benzotnazole-1 -yl)-1 ,1,3,3-tetramethyluromum (HBTU) (Propeptide). 5 1-Hydroxy-benzotriazole (HOBT) Acres Organrcs, Geel, Belgium 6. Trifluoroacetic acid (TFA). 7 Dlmethylsulfoxide 8. N-methyl-Z-pyrrohdmone (NMP). 9 NJ-dimethylformamlde (DMF). 10 N,Wdiisopropylethylamine (DIEA) and dichloromethane (CHzCl,) were distilled in our laboratory.
Estaquier et al.
284 2.1.2. Deprotection(s) 1. 2. 3. 4. 5. 6. 7. 8. 9. 10.
and Cleavage
20% 2-Mercaptoethanol, 5% DIEA in DMF. 50% TFA in CH,Cl,. 10% Acetic anhydride, 5%DIEA in CH,&. 10% Piperidine in DMF. Dimethylsulfide. p-Thiocresol. p-Cresol. Hydrogen fluoride. Teflon-Kel-HF appartus (ASTI, Courbevoie, France). Diethylether.
2. I. 3. Pep tide Cycliza tion 1. 0.1 M Ammonium
acetate, pH 8.6.
2.1.4. Peptide Purification 1. Sephadex GlO column (Pharmacia, Uppsala, Sweden).
2.1.5. Amino Acid Analysis 1. 6NHCl. 2. 5% Phenol in H,O. 3. Amino acid analyzer (Beckman,
Palo Alto, CA)
2.2. Analysis of Mixotope lmmunogenicity 2.2.7. lmmuniza tion 1. Phosphate-buffered saline (PBS). 20 mA4 K2HP04, pH 7.5; 150 mM NaCl. 2. Freund’s complete adjuvant (FCA) and Freund’s incomplete adjuvant (IFA) (Difco, Detroit, MI). 3. Glass container. 4. Mice or rats for immunzation.
2.2.2. Recovery of Lymphocytes 1. 2. 3. 4. 5. 6. 7.
Equipment for dissection. RPM1 1640. Syringes (5,lO mL). Blutex membrane. Lympholyte M gradiant (Cedarlane, Hornby, Canada). Polystyrene conical tube (Falcon, 15 mL and 50 mL). Culture medium: RPM1 1640 containing 20 mM HEPES, 10% heat inactivated fetal calf serum, 100 U penicillin, 100 pg streptomycin, 1 mM pyruvate, 1 mM glutamine, and 5 x 1O-’ A4 P-mercaptoethanol. 8. Scrubbed nylon fibre (Travenol, France). 9. A humified CO2 incubator set to 37°C.
lmmunogen
Peptide
285
Library
2.2.3. Detection of Antigen-Specific Antibodies Through Enzyme-Linked ImmunoSorbent Assays
(ELISA)
1. 2. 3. 4. 5. 6. 7.
Coating buffer: 50 mM NaHC03 at pH 9.6. Peptide or protein antigens (I-10 yglmL) in the coating buffer. Phosphate-buffered saline (PBS) containing 0.05% Tween-20. ELISA plates (Maxisorp, Nunc, Denmark). Serum from immunized animals. Peroxidase-conjugated antibodies raised against rat or mouse immunoglobulins. Peroxidase substrate: Orthophenylenediamine (Sigma),10 mg/mL in 100 mM phosphate buffer solution, pH 5.5 containing 10 uL H,O, (30%). Prepare just when needed. 8. A multichannel spectrophotometer.
2.2.4. Detection Through T-Cell 1. 2. 3. 4. 5. 6. 7. 8. 9.
of Antigen-Specific T-Cell Proliferation Assays
Responses
96-Well culture plates (Falcon). Mitogens (Con A, 5 ug/mL). Antigens (0.1-50 ug/mL). “H-thymidine (Amersham, specific activity, 25 Ci/mmol). Source of ionizing irradiation (60Co y-irradiator, Philips RT). Glass fiber filter strips (Skatron, Lierbyen, Norway). Multiharvester (Skatron). Liquid scintillation. p Counter (LKB, Wallac, Turku-Finland).
2.25. Detection of the functional Capacity of Antigen-Specific Responses Through Analysis of the Cytokine Profile by ELBA Protocol 1. 2. 3. 4. 5. 6. 7. 8. 9.
T-Cell
Coating buffer: 100 mM NaHCO,, pH 8.2. Phosphate-buffered saline (PBS) and Tween-20 at 0.05%. Bovine serum albumin (BSA, fraction V). PBSIBSA, at 3% BSA in PBS. ELISA plates (Maxisorp, Nunc). Pairs of cytokine monoclonal antibody (Pharmingen, San Diego, CA). Recombinant cytokines. Avidin peroxidase (Sigma). Peroxidase substrate (see Subheading 2.2.3., item 7).
3. Methods 3.1. Design
of Mixotopes
The example of the mixotopes design that we present in this chapter is based on the set of the V3 sequences described by La Rosa et al. (12) (see Note 1). Although it has been demonstrated that some sites in the V3 loop of HIV dis-
286
Estaquier et al.
play significant linked mutations, none IS completely exclusive; we considered the set of 235 sequences as sultable to undertake a mlxotope approach. I
Ahgn the different sequences of a varrant protem (we used 235 dtfferent V3 loop sequences located between the two cysteme resrdues) 2 Calculate the occurrence of the different ammo acrds found m each posrtron of the protem 3 Using these values, design a consensus pepttde that contams m each positron the most frequent ammo actds (m the most degenerated posrtton of the V3 sequences, the selected ammo acid was still present m I10 of the 235 sequences) 4 In order to design a series of mixotopes with mcreasmg complextty, several threshold frequencres of ammo acid occurrence can be defined For a defined threshold value, m each posttton of the sequence all ammo acids that have a frequency of occurrence higher than this threshold value are incorporated m an eqmmolar ratio (Fig. 1) When the threshold occurrence ratio decreases, the number of peptrdes present m the mixtures increases sharply, correspondmg respectrvely to 8 pepttdes (mtxo 50/235), 552,960 peptrdes (mrxo 15/235), 27,396 brllton pepttdes (mrxo 5/235) (Table 1)
3.2. Mixotope Synthesis 3.2.1. The Synthesis of the Mlxotopes Using the t6odBenzyl Scheme (13) 1 Carry out all the acttvatron procedures m all the couplmg cycles using the HBTUI HOBT method m NMP in the presence of DIEA 2 Perform the synthesis of each mlxotope manually or automatically according to the approach adopted 3 Use the two different approaches to prepare the combmatortal pepttde libraries accordmg to their complexity Limit the use of the split technique (see Subheading 3.2.2.) to the less degenerated mrxotopes (here, mrxo 501235, mrxo 301235, and mrxo 201235) and use the “mix” technique (see Subheading 3.2.3.) for the htghly degenerated mtxotopes (here, mrxo 15/235, mrxo 10/235, mrxo 81235, and mrxo 5/235) 4 A typtcal couplmg procedure split strategy 1s as follows pet form the acylatton steps with a fourfold excess of actrvated ammo acids (m comparison with the functronalized resin) using HBTU (fourfold excess) and HOBT (fourfold excess) m the presence of DIEA (12-fold excess) m a mixture of 33% (by vol) NMP m DMF for a period of 90 mm at room temperature 5. A typical coupling procedure m the mix strategy IS as follows: during each cycle, to avoid preferential mcorporatton of those ammo acids having the most favored couplmg kinetics, perform a first acylatton step with one equivalent of actrvated ammo acid mixture (m comparrson with the functtonaltzed resin) using HBTU (one equivalent) and HOBT (one equivalent) m the presence of DIEA (fourfold excess) m a mixture of 33% (by volume) NMP m DMF for a period of 90 mm at room temperature
High degree of
....
amfno acid variability in a functional epitope
Di
Cl
81
DP
C2
82
D3
c3
A
c4
1
Design of a mixotope : incorporation of the amino acids having a frequency of Occurence higher than a defined threshold
Synthesis
: Resin
-A
1+ Cl
+
l
D1
+
. . ..
D2
CP
D3
A-81 A-02 2 peptides
A - B1 - Cl A-Bj-C2 A-B2-Cj
A - 81 -Cl- D1 A - 81 - Cl- D2 A - 81 -Cl- D3
A-B2-C2
A - ES, - C2- 01
4 peptides
A-B1 -Q-D? A-B? -Q-D3 A - 82 - Cl- DI A - Bp - Cl- Dp A-B2-Cl-D3 A-B~-CPDI A-Bz-Q-Dp A-Bz-Cz-D3 8 pephdes
1 Immunization
1 Broadly related
reactivlty of the sera to several individual sequences to the variable functional epitope
Fig 1 Concept of mixotope
287
Mixotope convergent combmatorial peptide library
Esfaqurer et a/. Table 1 Name, Composition, and Number of Peptides Contained Within Four V3-Derived Mixotopes Used as lmmunogens in Our Experimentsa
C~KPNNN’IHKSIHIGPGHAFY~IG~~ CIRPNNNTKKSIHIGPGKAl~~‘ll~~~I RG
1
IGDIKQAHC
x
A
CIHPNNNTRKSIHIGPGRAFYl 1 s KKG R
VI
1 hl R P N s
C~KPNNNTKKSIHIGPGRAPYlTGEIlG~lR~AH~ I SS IKRGLrM Y VSNR HI. G I’ v AIQ N b Y 1%
“The N- and C-terminal
IGDIKQAHC
A
rGFI ED KR
IGDIRQAHL 1 N
552960 K
::
L
KVIHAHEDVI-NNM NVL AKR 1 I, I+ RK YV rQ W A DN G
cystemes are lmked by an mtramolecular
K R
Y R
27,396 b1lliow
V
dlsulflde bridge
With a thresholdfrequencyof 50 amongthe 235Isolates(50/235),threeposltlonsareIdent{fled (posItIons
10, 11, and 22), m which two drfferent ammo acids exhlblt
frequencies
of
occurenceequalor higherthan this value In the correspondmg mlxotope,referredto as“mrxo 50/225,” 2 ammo acids are simultaneously mcorporated m each of these three posIttons durmg the synthesis,leadmgto a mixtureof 2 x 2 x 2 = 8 peptldestn equlmolarratio Whenthe threshold frequencyof occurenceI$ decreased to 30 m 235, the number of degenerated posIttons Increases from 3 to 5 (posmons 10, 11,22,25, and 30) and m two of these posItIons (11 and 20), three ammo acids instead of two are above the threshold The correspondmg mlxotope, referred to as “mlxo 30/235”, consists of a mixture of 2 x 3 x 2 x 3 x 2 = 72 different peptldes
6 Perform the secondacylatlon stepwith a threefold excessof activated ammo acid mixture (m comparison with the functlonallzed resin) using HBTU (threefold excess) and HOBT (threefold excess) m the presenceof DIEA (ninefold excess) m a mixture of 33% (by vol) NMP m DMF for a period of 90 mm at room temperature
3 2.2 The Split Method In this method, mltially described by Furka et al. (I#), the peptldyl-resin 1s diwded mto as many parts as the number of different ammo acids to be mcorporated. Consequently, this strategy Imposes a manual process. 1. At the degeneratedpositions, each couplmg is performed mdlvldually and manually m a separate reaction vessel and with a single ammo acid Couplmgs are
lmmunogen Peptrde Library
289
performed twice using a threefold excess of the acylatmg mixture. Thus method has the advantage of avoiding competmon between several activated specres and allows a perfect control of the storchrometry of the mixture. 2. After couplings have been forced to completion, mix again the different peptrdylresms before the next deprotectlon step (see Note 2)
3.2.3. The Mix Method In this case, an equimolar predefined mixture of each amino acid present m a degenerate position is directly coupled to the peptldyl-resin. A major risk is to favor the mcorporatron in the mixture of the amino acids that have the most favorable coupling rates This 1s mainly the case when, as 1s usual m peptide synthesis, a large excess of coupling agent is used compared to the ammo groups available on the resin The protocol explained below can be adapted to the automatic peptide synthesizer, and except for the gaps, where the synthesis must be stopped in order to withdraw a part of the resin from the reaction vessel, all the concerned mixotopes can be prepared in a fully automated manner, using the tBoc/Benzyl scheme. 1 Use one equivalent of acylatmg mixture per eqmvalent of peptrdyl-resin durmg each first coupling step, to avoid this risk 2 During the recouphng step, use a threefold excess of the acylatmg mrxture, so that if a selective mcorporatron occurs, It ~111only involve the hmrted number of ammo groups that remam unacylated after the first step
3.2.4. Deprotection(s)
and Peptide Cleavage
1. Remove the N-terminal tBoc group of 1 g protected peptrdyl-resin, first with 50% TFA m CH,Cl, for 2 mm and then with the same solvents for 20 mm, then acetylate the free NH,-terminal function wrth 10% acetrc anhydride, 5% DIEA m CH,Cl, for 10 mm After assembly of the complete protected peptrde chains, take Into account the protectrons of certain lateral chains of the mrxotopes. 2. If the mixotope contains Hrs(2,4-dnutrophenyl), remove the 2,4-duntrophenyl protecting group twice wrth 20% 2-mercaptoethanol, 5% DIEA m DMF for 2 h If not, pass to the followmg step 3 If the mtxotope contains Trp(formyl), remove the formyl protectmg group twice with 10% piperidme in DMF for 2 h If not, pass to step 4 4. Dry the protected peptidyl-resm 5. If the mrxotope contams Met(sulfoxrde), deprotect the sulfide function of the lateral cham m a Teflon-Kel-HF apparatus accordmg to the following manner. in low concentratron of HF m drmethylsulfide (161, in the presence of p-cresol and p-throcresol(2565.7.5.2 5 by vol) (10 mL/g of peptidyl-resm) for 2 h at 0°C If not, pass to step 7 6 Remove the drmethylsulfrde by vacuum evaporation.
290
Estaquler et al.
7. Remove the remammg protecting groups and cleave the mtxotope from the resm by a high-HF procedure m HF,p-cresol, andp-throcresol(90 7.5.2 5 by volume) (10 mL/g of pepttdyl-resin) for 1 h at 0°C 8 Remove the HF by vacuum evaporatron 9. Prectpttate the free mrxotope m dry me-cooled drethylether (50 mL) and wash rt twice wrth the same solvent by centrrfugatron (100 mL each) to extract the residual scavengers and byproducts 10 Drssolve the mrxotope m neat TFA (5 mL) and precipitate it by pouring into dry me-cooled dtethylether (300 mL)
3.2.5. Peptide Cychzation (Intramolecular Ligation of the Two Invariant Cysteines by a Disulfrcie Bridge) 1 After centrrfugatron of each mrxotope, dissolve m 5% acetic acid m HZ0 and lyophtltze 2 Dissolve the mixotope to 0.5 x 10m3M m 0 1 M ammonmm acetate, pH 8 6 3 Submit the solutton to an oxidation for 48 h at room temperature to form the mtramolecular drsulfide brtdge 4 Concentrate the solutron under vacuum and lyophrbze
3.2 6. Peptide Purification Owing to the heterogeneity of the mixtures, tt might be tmposstble (except for the consensus peptide and the mrxo 501235) to use any purification procedure with a high resolution power without being at risk of losing at least part of then components. The only common feature to all peptides contained in the mlxotopes is an average mol wt of kDa, which allows ellmmatlon of smaller mol wt contaminants by gel filtratton 1 Dissolve each crude lyophtlrzate of mtxotope m 5 mL 5% acetic acid in H20. 2 Load onto a sephadex GlO column (40 cm x 2 5 cm) eqmhbrated rn the same solvent, using a flow rate of 30 mL/h 3. Momtor the effluent at 230 nm and pool the fractrons corresponding to the first peak
3.2.7. Amino Acid Analysis The only possible analytical control of the most complex ammo acid composition (17) (see Note 3).
products IS their
1 Hydrolyze 1 mg of each of the mtxotopes with 1 mL of 6 N HCI and 20 mL of 5% phenol in HZ0 at 110°C for 24 h under vacuum in evacuated sealed tubes. 2 Quantify the ammo acids (on a Beckman amino acid analyzer model 7300 wrth nmhydrme detectron, for example) and compare the amino actd composmons to the expected theoretical cornpositrons to evaluate the rusk of preferentral incorporation(s), m relation to the synthetic strategy adopted
lmmunogen Peptide Library 3.3. Analysis of Mixofope 3.3.1. lmmuniza tion
291 lmmunogenicify
Elicitation of an immune response often requires mlxmg the antigen with an adJuvant. The adjuvant ensures that the antigen 1s released slowly into the arnmal’s clrculatlon, and that antigen-presenting cells are activated in such a way that they closely Interact with and provide costimulatory signals to antlgen-specific CD4 T-cells. There are different routes of antigen administration, such as intramuscular (rm), intravenous (IV), mtradermal (id), mtraperltoneal (lp), and subcutanous (SC) injection of the antigen or oral administration (see Note 4). Repeated injections increase the immune response and the generation of Immune memory. An emulsion of water m 011 containing a heat-killed mycobacterium (FCA), is used for the first injection, followed by a simple oil adjuvant (IFA) Boosting the animal results in the mductlon of a large antigenspecific response. 1 Mix 1 vol of PBS containing 5-50 pg antigen with 1 vol of Freund’s adJuvant (FCA or IFA) to form an emulsion of IFA m glass container. Vortex vigorously or mix thoroughly by passing the liquid repeatedly through a syringe needle until a compact mixture 1s formed 2 InJect 0.2-O 4 mL of the antigen lm, id, and SC(rat or mice) 3 The period between mjectlons can be variable but m general a delay of 3 wk represents a good strategy to ehclt both B- and T-cell responses
3.3.2. Preparation of Immune Serum Serum should be separated from cells as soon as possible after the collection of blood. Small quantity of blood is required to monitor the antibody response 1 2 3 4 5
Allow blood to clot at room temperature (about 1 h) Leave at 4°C for 4 h; at that time, the clot 1s contracted Detach the clot and take the serum. Centrifuge the serum at 45Og at 4°C for 10 mm Store the serum ahquots at -2O’C
3.3.3. Recovery of Lymphocytes Immune cells elicited after antigen immumzatlons are focused m secondary lymphoid organs, mainly the draining lymph nodes and spleen Organs are removed aseptlcaly 1 wk after the last antigen inJection to ensure maximal lymphocyte recovery. The lymphocytes are isolated by density gradient sedlmentatlon and then fractionated into B- and T-cells A negative selection procedure based on the removal of unwanted cells IS recommended to avoid possible changes m cell function as a consequence of binding of antibody to
Estaquier cell surface molecules B-cells (and other adherent whtle the majority of T-cells do not
cells) bmd to nylon
et al fiber
1 K111 the immumzed animal and remove spleen or drammg lymph nodes aseptically 2 Disrupt organs using the top of a syrmge on a stertle blutex membrane 3 Wash with RPM1 1640 (15-25 mL) and pass cell suspension through the blutex membrane disposed on the polystyrene conical tube (Falcon) 4 Centrifuge at 450g for 10 mm at 18°C. 5 Discard the supernatant 6 Resuspend cells (equrvalent to l-2 spleens) m 10 mL of RPM1 1640 7 Place 5 mL of Lympholyte M mto each comcal tube and on top of it layer slowly the cell suspension, taking care not to disturb the bottom dense layer 8. Centrifuge at 1200g for 30 mm at 20°C (temperature control is important) 9. Viable lymphocytes accumulate as a white disk, erythrocytes and dead cells sedlment to the bottom of the tube 10 Transfer the lymphocytes mto a new tube and wash the cells twice with a large volume of RPM1 1640 by centrtfugation at 450g 11 Resuspend the cells m medium with FCS 12 Pack mto a syrmge column 1 g nylon fiber (sterilized by autoclavmg) 13 Wash the column with medium and then incubate at 37°C for 20 mm 14 Wash the column agam. 15. Suspend the lymphocytes in 1 mL medmm and apply to the column lo8 cells/g of fiber Allow the sample to enter the nylon fiber and then seal the syringe bottom 16 Add 1 mL of medium, seal the syringe top, and incubate at 37°C for 30 mm 17 Pass through the nylon fiber 15 mL of medmm maintained at 37°C and collect the nonbound T-cells When spleen lymphocytes are used, the yield should be about 50% of the total number of cells.
3.3.4 Detect/on of Antigen-Speclf/c AntIbodIes Through Enzyme-Linked ImmunoSorbent Assays
(ELBA)
1 Ptpet 100 pL antigen (peptrdes or proteins) solutron mto each well of the ELISA plate and incubate overnight at 4°C (this coats the wells with antigen) 2 Wash the wells two times wtth PBSlTween 3 Invert the plate over a sink and tap it briskly 4 Prepare multiple drlutrons of the serum to make a titration m PBS/BSA Add 100 pL, m duplicate, per well Cover the plate and incubate tt at room temperature for 2 h 5 Wash the plate at least four times with PBYTween 6. Add peroxtdase-conjugated anti-tmmunoglobulm m PBS/BSA (100 ltL per well) In general, a conjugate dilution of 112000 to l/5000 works well Cover the plate and incubate for 2 h at room temperature. 7 Wash at least 4X with PBS/Tween
lmmunogen PeptIde Library
293
8. Add 100 pL of substrate, and Incubate at room temperature for 20-30 mm 9 Add 50 uL HCI to each well and read the absorbency at 492 nm
3 3.5. Detect/on of Antigen-Specific T-Cell Responses Through T-Cell Prolifera t/on Assays 1 Incubate 2-5 x IO5 purified T-cells with 2 x IO5 spleen or thymus syngeneic irradiated (30 gy) antigen-presentmg cells with antigens m triplicate m a total vol of 200 pL in flat-bottom 96-well plates Incubate m a humidrfied CO, incubator at 37°C 2. Add ?H-thymidme (18.5 kBq, 25 p.L/wells) after 2 d of culture for 18 h for mitogens (Con A) restrmulation to measure cell proliferation 3 Add 3H-thymtdme (18 5 kBq, 25 FL/wells) after 4 d of culture for 18 h for peptide and protein restimulation 4. Harvest the cells onto glass fiber filter strips usmg a multiharvester. 5. Dry the glass fiber filter overmght at room temperature 6 Measure mcorporation of “H-thymidme into DNA m liquid scmtillation (see
Note 5).
3.3.6. Detection of the Functional Capacity of Antigen-Specrfic T-Cell Responses Through Analysis of the Cytokine Profile by ELISA Protocol The mduction of humoral (antibody) or cell-mediated (T-cells) immune responses is controlled at the level of T-cells by their capacity to secrete cytokines. Secretion of mterleukin-2 (IL-2) and gamma-interferon (IFN-y) by THl cells promotes macrophage activation, induces cell-mediated immunity and delayed-type hypersensitivity, and is effective at controllmg Intracellular infectious pathogens. TH2 cells secrete IL-4, IL-5, and IL-lo, which favor optimal activation of B-cells to secrete antibody and promote mast-cell and eosinophil activation, and are most effective at controlling extracellular infectious pathogens (19,20). 1. Dilute purified anticytokme-capture MAb to l-2 pg/mL m coating buffer 2 Add 50 pL to wells and incubate overnight at 4°C Wash the plate two ttmes with PBSlTween and wipe out excess of PBS over a towel 3. Block with PBS/BSA, 200 pL per well Incubate 30 mm at 37°C 4 Wash the plate with PBSfTween. 5 Add standards and samples at 100 pL per well 6 Incubate either 2 h at 37”C, or overmght at 4°C. 7. Wash the plate at least four times with PBS/Tween. 8. Add the second biotinylated anticytokine-detectmg MAb (l-2 pg/mL), 100 pL per well. Incubate at room temperature for 1 h 9 Wash the plate at least four times with PBS/Tween
294
Estaquier et al
10 Dilute avldm-peroxldase accordmg to manufacturer’s recommendation and add 100 uL per well Incubate at room temperature for 30 mm. 11 Wash the plate at least four times with PBS/Tween 12 Add substrate, 100 pL per well 13 Stop the reaction by adding 1 N HCl or H,S04 and read the absorbency at 492 nm
4. Notes 1 As the mixotope approach is not suitable when variabllmes m the various posltions along the sequence are lurked events, we have disregarded the sequences correspondmg to the “BRU” family, m which the QR insert m the N-terminal part of the GPG motive Introduced a bias m the alignment and could be associated to different replacement rules. 2. An mterestmg charactertstrc of thts kmd of approach, which has been enhghtened by Furka (ZS), is that only a umque peptide sequence can be synthesized on each bead of Merrifield resin This dramatically hmns the possible degeneracy of a mixture prepared by the split techmque to the number of beads used during the synthesis. Typically, synthesis is performed on a mdlimolar scale using beads that carry from 10 to 100 prcomol of peptide. This means that lo’-10’ beads are used In the case of the most degenerated mixotope (S23.5 mixotope), assuming that each bead carries a different peptide, a mmimum of 100 mol of peptidylresin (roughly 100 kg) should be required! 3 Additionnal analytical characterization may be performed by the followmg* a Mass spectrometry. A solution proposed by Jorg Metzger (18) relies on the confrontation of the mass spectrum with a calculated profile representing the distribution of all the possible masses This analysis has the advantage of bemg able to analyze in its entirety the mixture, and to be independent of the chemical behaviors of its mdividual components, except possible quenching effect, He was able to characterize a 24,575component nonapeptide library, but both parameters, number of components and length, are crucial Indeed, our mixture that contams 750,000 related peptides was distributed m 186,624 component families presenting 186,624 different masses and possessing 23, 24,25, or 26 residues, with a mass repartition within four partially overlappmg gaussian peaks (from 2240 to 2812, from 2353 to 2925, from 2524 to 3096, and from 2637 to 3209). Our IS spectrometer was equipped with quadrupole that is able to determine masses with a maximum around 2000 As the masses contained m our peptide library are found above this limit, we have access only to double-, triple-, and quadruple-charged quasi-molecular ions. molecular mass was calculated for each species from the spacing between all the multicharged ions As the molecular mass distribution of our library occurs over a wide range, the quadruple- and triple- charged peaks partially overlap. By using a high orifice voltage (+120 V), we have been able to obtain a spectrum m which the double-charged quasi-molecular ions are observable whereas the expected four-centrords shape was not distmct.
/mmunogen Peptide hbrary
295
b. Plasma Desorption Mass Spectrometry: This techmque, although capable of less resolution than IS, allows drrect observation of the singly charged molecular ions. This method shows a multilobular profile within the expected range 4 The immune response depends on the dose of antigen, the nature of the adJuvant, and the route of immumzation. Although this represents an oversimplified statement, hrgh doses of antrgens as well as mtravenous and oral immunizatron routes often induce an antrbody response (the result of a TH2 cytokme response) and fall to elicit a wide range of immune effector rnechamsms, m particular cellular rmmumty (the result of a THI cytokine response). 5 The level of 3H-thymrdme mcorporation should not be regarded as an obligate reflection of cell prohferatron; m particular conditions, activated cells synthesrze DNA but are blocked m the G2 phase of the cell cycle and/or undergo actrvatronInduced death by apoptosrs (21). Therefore, measurements of DNA synthesis should be accompamed by countmg viable cells over the length of culture period if a true estimate of cellular prohferatron is to be obtained Acknowledgments I would hke to thank E. Varo for typing the manuscript. Thus work was supported by Instrtut National de la Sante et de la Recherche MCdrcale (INSERM), Centre National de la Recherche Scientifrque (CNRS), Agence Nationale de la Recherche sur le Soda (ANRS), and by an ANRS fellowship to J.E.
References 1 Scott, J K and Smith, G. P (1990) Searching for peptrde ligands with an eprtope hbrary Science 249,386-390 2 Devlm, J. J, Panganiban, L C , and Delvm, P. E. (1990) Random peptrde hbrarres a source of specrfrc protein bmdmg molecules. Sczence 249,404-406 3 Wrllard,X ,Pop, I., Bourel, L , Horvath, D , Baudelle, R., Melnyk,P.,Deprez, B., and Tartar A. (1996) Combmatorial chemistry. a rational approach to chemical diversity. Eur. J. Med Chem 31,97-98. 4. Rusche, J. R., Javarhran, K , McDanal, C , Petro, J , Lynn, D L , Grrmarlha, R , Langlois, R. C., Arthur, L 0 , Frshmger, P J , Putney, S. D , and Matthews, T. J. (1988) Antibodies that inhibit fusion of human rmmunodefrcrency virus-infected cells bmd a 24-ammo acid sequence of the viral envelope, gp 120 Proc. Natl. Acad Sci USA 85,3 198-3202
5 Gras-Masse, H , Amersen, J. C , Boutillon, C , Rouaix, F , Bossus, M , Deprez, B., Neyrmck, J , Capron, A , and Tartar, A (1992) Synthetrc vaccines and HIV-l hypervarrabrhty A mrxotope approach. Pept Res 5,2 11-2 17 6 Estaqurer, J , Grass-Masse, H , Boutrllon, C , Ameisen, J C , Capron, A , Tartar, A , and Auriault, C (1994) The mrxotope acombmatorral peptrde library as a T cell and B cell rmmunogen. Eur. J. Immunol 24,2789-2795.
296
Estaquier et al.
7 Estaquler, J., Boutlllon, C , Georges, B., Amelsen, J C , Tartar, A , and Aunault, C (1996) A combmatorlal peptlde library around the human immunodeficlency virus (HIV-l) V3 domain leads to dlstmct T helper cell responses J Pept Scl ,2, 16.5-175 8 Brodsky, F M and Guaghardl, L E (1991) The cell biology of antigen processmg and presentation Annu. Rev Immunol 9,707-744 9 Benacerraf, B and McDevltt, H 0 (1972) Hlstocompatlbdlty-linked immune response genes Sczence 175,273-279 10 Evavold B D., Sloan-Lancaster, J , and Allen, P M (1993) Tickling the TCR selective T-cell functions stimulated by altered peptlde hgands lmmunol Today 14,602-607
11 Boutlllon, C , Dlesls, E., Rommens, C., Tartar, A , and Gras-Masse, H. (1995) Combmatorlal lmmunogens How far can we go? Proceeduzgs of the 23rd European Pep&e SympoJlum. (Maia, H., ed.), ESCOM, Leaden, Netherlands pp 845,846 12. LaRosa, G., Davlde, J , Wemhold, K , Waterbury, J., Profy, A , Lewis, J , Langlois, A , Dreesman,G , Neal, R , Bobswell, R N , Shadduck, P , Halley, L , Karplus, M , Bolognesl, D , Matthews, T , Emma,E , and Putney , S. ( 1990) Conserved sequenceand structural elementsm the HIV- 1 prmclpal neutrahzmg determinant. Sczence249,932-935 13 Memfield, R. B (1963) Sohd phase synthesis The synthesis of a tetrapeptlde J Am Chem Sot. 85,2149-2154 14. Furka, A., Sebestyen, F., Asgedom, M., and Dlbo, G (1990) General methdod for rapid synthesisof multtcomponent peptlde mixtures Int J Pept Protem Res 37, 487-493. 15. Furka, A , Sebestyen, F , Asgedom, M , and Dlbo, G (1988) Cornucopia of peptides by synthesis, in 14th International Congress of Biochemistry, Prague, Czechoslovakia 5,47 (Abstract) 16. Tam, J P , Heath, W F , and Mernfleld, R. B (1983) SN2 deprotectlon of synthetlc peptldes with a low concentration of HF m dlmethylsulfide: evidence and apphcatlon m peptlde synthesis J Am. Chem Sot 105,6442-6455 17. Stevanovlc, S. and Jung, G (1993) Multiple sequenceanalysis pool sequencmg of synthetic and natural peptlde llbralnes. Anal Bzochem. 212,212-220 18. Metzger, J., Wlesmuller, K , Gnau, V , BrunJes,J , and Jung, G (1993) Ion-spray massspectrometry and high performance llquld chromatography-Mass spectrometry of synthetic peptlde libraries Angew. Chem Int. Ed Engl. 32,894-896 19. Bottomly, K (1988) A functlonal dichotomy m CD4+ T lymphocytes Immunol Today 9,268-273 20. Mosmann, T , Schuacher, N , Rudd, R , O’Garra, A., Fong, T , Bond, M , Moore, K , Sher, A., and Florentmo, D (1991) Diversity of cytokme synthesis and functlon of mouseCD4 T cells Immunol Rev 123,209-229 21. Estaquier, J., Idzlorek, T., and Amelsen, J C. (1994) Apoptosls, AIDS, and mfectlous diseasesImmunol Rev 142,9-5 1