CHAPTER1
Antibiotic
Resistance
Stephen
Profiling
J. Hammonds
1. Introduction Antibiotic resistance is not an absol...
110 downloads
1636 Views
17MB Size
Report
This content was uploaded by our users and we assume good faith they have the permission to share this book. If you own the copyright to this book and it is wrongfully on our website, we offer a simple DMCA procedure to remove your content from our site. Start by pressing the button below!
Report copyright / DMCA form
CHAPTER1
Antibiotic
Resistance
Stephen
Profiling
J. Hammonds
1. Introduction Antibiotic resistance is not an absolute property. Even within a single species, strains can exhibit different degrees of antibiotic resistance. When a bacterium is tested for resistance, it should be compared, quantitatively with a standard.This standardmay be the resistanceof a wild-type strain, a typical strain, or a “type” strain, appropriate to the test strain. Most commonly in these studies, large numbers of test isolates are screened for their resistance on one or more antibiotics. The test strains may be mutant or recombinant derivatives of a known parental strain, or they may be fresh isolates from an independent source. The degree of resistance is quantified by incorporating known concentrations of an antibiotic into solid growth medium. The bacterial test strains are then inoculated onto the medium. After a period of growth, the plates are examined for growth and the lowest antibiotic concentration that inhibits the growth of each bacterium is determined. This measureis the minimum inhibitory concentration (MIC). This is then compared with the observed MIC of a standard strain or with a reference threshold value (I). This is an accurate quantitative technique that uses well-established culture and test methods. In addition, the expected MIC values for many different species of bacteria are readily available in the literature (2). The method described here is suitable for bacterial species commonly used in genetic studies and genetic engineering, such as Escherichia coli. The technique is readily adaptable to other species by adjusting the media and culture conditions appropriately. However, the effect of such changes on the activity of the antibiotic should be consideredcarefully (seeNote 1). From: Methods In Molecular Biology, Vol 46: Dagnostlc Bacteriology Protocols Edited by J Howard and D M. Whltcombe Humana Press Inc , Totowa, NJ
1
Hammonds
2
The technique described is based on the standard method used in the United Kingdom for determination of the sensitivity of the pathogenic bacteria to antibiotics. It forms the basis of the well-known “breakpoint” method for sensitivity testing, widely employed in diagnostic bacteriology laboratories. The antibiotics that are most appropriate for testing against the various species of pathogenic bacteria may be found in Lambert and O’Grady (2). The technique may also be used to determine the sensitivity of bacteria to a range of antibiotics to obtain a pattern of antibiotic sensitivities known as an antibiogram. These antibiograms may be used in bacterial taxonomy.
2. Materials 1. Phosphate-buffered saline (PBS): 20 mi!4 sodium phosphate, pH 7.4, 0.85% (w/v) NaCl. Sterihze by autoclaving at 121°C for 15 min. Store at 4°C indefinitely, but warm to room temperature before use as a culture diluent, because the viabthty of some strains can be affected by cold diluent. 2. Phosphate buffer: 20 mM sodium phosphate, pH 7.0. Sterilize by autoclaving at 121°C for 15 min and store indefimtely at 4°C. 3. Antibiotics: 1 mg/mL in sterile 20 mM phosphate, pH 7.0. Sterilize by filtration through a 0.22~pm filter and store for up to 24 h at 4°C. Any antibiotics may be used, but solubihty in water 1scrucial. This may require the use of antibiotrc salts (see Note 2). Antibiotic preparations supplied for clinical use are often unsuitable, because they are sometimes inactive in vitro. Furthermore, they often contam additional, nonantibiotic substances that could interfere with the assay. Details of the stability and storage conditions can be obtained from the suppliers. In general, though, the undissolved powders should be kept desiccated, m the dark and at low temperature. 4. Liquid medium: Any rich medmm suitable for the organism under study. For many strains, tryptone soya broth (TSB), also known as tryptrcase soy broth, is suitable. 5. Test agar: Mueller-Hmton agar and dragnostic sensitivity agar have been developed specifically for antibiotic testing purposes and are commercially available. Dtssolve the agar mix according to the manufacturer’s mstructions and heat to 100°C for 5-10 min to dissolve the solids. Adjust the pH to exactly 7.4 and autoclave at 121°C for 15 mm. Allow the agar to cool and keep it, molten, at 45°C until required. Prepare the molten agar on the day of use. Other media can be used but be sure that the components of such media have no interfering effects on antibiotic activity (see Note 1).
Antibiotic
Resistance
Profiling
3
3. Method 1. Inoculate 10 mL of TSB with the test strains. Always mclude at least one control or reference strain (often the parental strain from which the test isolates were derived). 2. Grow the cultures at then optimal temperature to early stationary phase (usually 18-24 h). Vary the mcubation temperature and time as appropriate to the strain. The anticipated cell density is 10’ viable cells/ml. 3. Dilute the cultures 1 in 100 in PBS (see Note 3). 4. Immediately before use, prepare a series of five lo-fold dilutions of the antibiotic in 20 mM phosphate. Always use a fresh tip for each dilution to avoid carryover of concentrated antibiotic solution to dilute. 5. Dispense 2 mL of each dilution mto premarked Petri dishes. Also, pipet 2 mL of neat antibiotic solution and 2 mL of phosphate buffer only into two more dishes. 6. Dispense 18 mL of molten agar mto each dish and thoroughly mix in the antibiotic by swirling the plate on the bench. 7. Allow the agar to set at room temperature and chill the plates at 4°C to harden the media. 8. Dry the plates m a plate-drying oven at 55°C for 20 min. 9. Spot each of the diluted cultures onto each of the antibiotic dilution plates, using sterile loops or applicator sticks (see Notes 1 and 3). Be sure to mark the onentatton of the plates to allow later identification of the spots. It may be helpful to use a template where many spots are to be tested. 10. Invert the plates and incubate them under the appropriate conditions (typically, 37°C for 18-24 h). 11. Examine the surface of the plates and determine the lowest concentration of antibiotic that inhibits growth of each strain (MIC). Ensure that the control and/or reference strains have produced the anticipated results. 12. Determine the MIC more accurately by using a twofold dilution series of antibiotrc, starting with the dilution above the MIC. 4. Notes 1. The activity of many antibiotics 1s significantly affected by the physical and chemical conditions in the bacterial culture medium (3): a. Acid conditions, which arise by fermentation of carbohydrate m the medium, may reduce the activity of lincomycin, erythromycin, cephaloridine, and the aminoglycosides; b. Alkaline conditions reduce the activity of methicillin, cloxacillin, fucidin, and the tetracyclmes; c. Anaerobic conditions reduce the activity of ammoglycosides;
Hammonds d. Aerobic conditions reduce the activity of metronidazole; e. Divalent cations such as magnesium and calcmm reduce the activity of aminoglycosides and tetracyclines against Pseudomonas aeruginosa; and f. Pyrtmidines and related compounds reduce the acttvtty of sulfonamtdes and trimethoprtm. 2. Some antibrotics are insoluble in water in the form of the base. However, tt is often the case that soluble salts exist for these antibiotics (e.g., erythromycin lactobionate, trimethoprim lactate, and polymyxin sulfate). It is sometimes also possible to dissolve the base m a minimal volume of 0. 1M NaOH (e.g., nitrofurantoin, nalidixtc acid, and the sulfonamides), or O.lM HCl (e.g., rifampicm), or ethanol (e.g., chloramphenicol, erythromycin) before dilution to the required volume with 20 mM phosphate buffer. Details of the solubibty and other properties of antibiotics may be found m The Merck Index (4). 3. The concentration of the moculum is less important in the agar incorporation technique than in other methods. However, too high a concentration of bacteria does cause a sigmftcant reduction in the activity of sulfonamides. Consequently, the correct dilution of bactertal suspension must be used.
References 1 Phillips, I. (1991) A guide to sensitivity testing. Report of the working party on antibiotic sensitivity testing of the British Society for antimicrobial chemotherapy J. Antimicrob Chemother 27(Suppl. D), l-50. 2 Lambert, H. P. and O’Grady, F (1992) Antibiotic and Chemotherapy, 6th ed Churchill Livingstone, Edinburgh, UK. 3. Houang, E T., Hince, C , and Howard, A. J. (1983) The effect of composition of culture media on MIC values of antibiotics, in Antibiotics: Assessment of Antimicrobial Activity and Resistance (Russell, A. D. and Quesnel, L B , eds ), Academic, London, pp. 3 l-48. 4 Budavari, S. (1989) The Merck Index. Merck, Rahway, NJ.
CHAPTER2 Bacteriocin l)rone
Typing
L. Pitt and Michael
A. Gaston
1. Introduction
Bacteriocins are proteins produced by bacteria which are lethal for other members of the same species and, occasionally, for other species. In general, bacteriocins are active in very low concentrations against specific strains. This property has been widely utilized for the identification of types of strains within several bacterial species and most methods are based on the inability of a strain (indicator) to grow on an agar surface that has previously supported the growth of the bacteriocin producer strain. Bacteriocin typing is a simple, but powerful, technique to distinguish between strains of bacterial species but is often overlooked in favor of more technically sophisticated methods. At its simplest level no stored reagents or even reference strains are required, as a collection of isolates can be tested against each other for bacteriocin production/sensitivity. The information gained in this way is likely to be less valuable than that obtained with an established reference typing method but may be sufficient for the identification of unique strains in an outbreak situation. 1.1. Nomenclature
The naming of bacteriocins has been problematic. Some workers prefer to use the term bacteriocin of, for example, Klebsidu or Pseudomonas, whereas others refer to klebocin or pyocin, respectively. This trivial form of nomenclature is widely used but the discovery of new bacteriocins may lead to taxonomic confusion. From’ Methods m Molecular B/ology, Vol. 46. E&ted by J Howard and D. M Whltcombe
5
D!agnost/c Bacteriology Protocols Humana Press Inc , Totowa, NJ
Pitt and Gaston 1.2. Characterization
Bacteriocins are a large heterogeneous group of antibiotic substances that differ greatly in their molecular size and their resistance to heat, chloroform, and proteolytic enzymes. Three basic groups have been defined: 1. Cohcin-like agents ranging 111molecular size from 3 x lo6 to 1 x lo8 Daltons; 2. Bacteriophage-like particulate bacteriocins that resemble phage tails, e.g., R (retractile) and F (flexuous) pyocins of Pseudomonas aeruginosa; and 3. Low molecular weight bactenocms, also called mlcrocins, which are bactericidal peptldes (I-3)
1.3. Activity
Spectra
The bacteriocins of Gram-negative bacteria often have a narrow spectrum of activity. In contrast, the bacteriocins produced by Gram-positive bacteria have a broad host range and are sometimes active on taxonomitally unrelated genera (4). of Action The modes of action of some bacteriocins have been established. For example, colicins cause specific inhibition of protein synthesis or induce a single endonucleolytic break in RNA, whereas others inhibit DNA synthesis (5). Some bacteriocins inhibit macromolecular synthesis by uncoupling electron transport systems or cause disruption of the permeability barrier of the cell wall by enzymatic action, as is the case with the megacins of Bacillus megaterium. Specific receptors are required for the adsorption of bacteriocins and resistant strains often lack, or have occluded, surface receptors. Receptors that have been identified include glycoproteins, outer membrane proteins, and lipopolysaccharides. 1.4. Mode
1.5. Resistance
and
Tolerance
A bacteriocin is inactive against strains possessing the same bacteriocinogenic factor. These factors may be plasmid borne or chromosomal. Strains may produce more than one type of bacteriocin, but the immunity of producer strains to bacteriocins is often extremely specific and they may be sensitive to a closely related bacteriocin. Some bacteria produce a specific inhibitor protein that complexes with the bacteriocin and protects the producer strain from its action. Alternatively, immunity may be associated with the inability of the producing bacterium to adsorb homologous bacteriocin (6). A distinction should be made
Bacteriocin
Typing
7
between resistant and tolerant strains; the former do not adsorb bacteriotin, as do tolerant strains, but the lytic action is blocked subsequently. 1.6. Practical Considerations The inhibition of strains by bacteriocins can be confused with the action of bacteriophages and vice versa. In some strains this can be further complicated by the simultaneous production of both bacteriocin and bacteriophage. A simple way to distinguish between the two groups is to prepare a logarithmic dilution series of a suspension containing the inhibitor and spot a sample of each dilution onto the indicator strain. Inhibition owing to bacteriocins will generally only be visible to a dilution of lo3 or lo4 and will “fade out,” whereas bacteriophages will usually be active to at least a dilution of lo7 and will show individual plaques at high dilutions. 1.7. Typing Schemes Bacteriocin typing schemes can be classified as active or passive methods. In the first, the bacteriocins produced by the test (field) strains are detected by their activity on a panel of standard indicator strains, whereas in the second method, bacteriocins from a set of producer strains are tested for activity on the field strains. The discrimination achieved by either method should be determined by experiment as well as the stability (reproducibility) of the patterns of inhibition. Schemes with high reproducibility will allow patterns to be designated as types, but this is impractical for those schemes that exhibit excessive variation on repeated testing. Three different methodological approaches have been used for routine typing of isolates. The original method of “scrape and streak” (7), described in Section 3.3., is not commonly used today because it is too labor-intensive; it takes 3 d to complete and reactions can be equivocal. Essentially, the bacteriocin-producing strain is grown in a streak across the diameter of an agar plate. Following incubation, this growth is removed and the indicator strain is inoculated at a right angle over the original streak. Bacteriocin activity is evidenced by inhibition of the indicator strain. In the lysate method (B), described in Section 3.2., bacteriocins of a producer strain are induced by mitomycin C and cell free lysates are spotted onto lawns of the indicator strain. This method is not widely used, perhaps because of the need to prepare lysates that not only require stan-
8
Pitt and Gaston
dardization of bacteriocin concentration but also deteriorate on storage. The influence of bacteriophages that are also induced by mitomycin C can be reduced by UV irradiation of the lysate, but this is a time-consuming and variable procedure. The principle of the overlay method (9) (see Section 3.1.) is that spots of a dense suspension of bacteria containing preformed bacteriocin are allowed to grow for a short period in which more bacteriocin is formed. The thin agar layer serves to concentrate the bacteriocins around and under the spot of growth. Bacteriocin activity is visualized by inhibition of the growth of the indicator strain contained in the overlay; diffusion is enhanced by the use of soft agar. This method also allows the differentiation of low molecular weight diffusible bacteriocins from the particulate high molecular weight structures by their inhibition zone diameters. The major advantages of this procedure over others is the rapidity and the clarity of reactions that can be obtained. 1.8. Prior Considerations The choice of methodology for bacteriocin typing is greatly influenced by the growth characteristics of the species to be examined and the equipment available. We recommend that the following factors are determined by experiment in order to optimize conditions for a particular species. 1.8.1. Media Some media constituents are inhibitory to bacteriocin production. For example, bile acids are antagonistic to Proteus mirabilis bacteriotins (10) and, therefore, McConkey agar is unsuitable for bacteriocin typing of this species. Other compounds that have been reported to affect bacteriocin synthesis include casein, amino acids, manganese, and sugars, particularly glucose (4). The addition of enzyme inhibitors such as iodoacetic acid has been advocated to improve the clarity of inhibition reactions (11). 1.8.2. Temperature Bacteriocins are often produced in higher yield if the strain is incubated at a temperature slightly below the growth optimum. This serves two purposes; first, it reduces the amount of cell growth and, second, it delays the production of bacteriocin, inactivating substances such as proteases.
Bacteriocin
Typing
9
1.8.3. Induction Most bacteriocins may be recovered in higher yield if an inducing agent is used. Mitomycin C is the agent most commonly used. This compound damages DNA and, as a result, a complex cellular mechanism, the SOS regulatory system, is activated. DNA repair occurs in the absence of template instruction resulting in the creation of many nonsense or deletion mutations. Lysis of these mutants occurs at a rapid rate with a release of cellular contents that include bacteriocins and lysogenic phages. Most workers have used mitomycin C to induce bacteriocin production in liquid media but care should be taken to rule out the contribution of phage in the lysate to the inhibition zone formed on agar lawns of susceptible bacteria. Anaerobiosis can also induce bacteriocin synthesis and nitrate can be incorporated into a growth medium to encourage anaerobic growth of Pseudomonas (nitrate acts as an alternative electron acceptor when cleaved by nitrate reductase to produce molecular oxygen). Bacteriocininactivating substances may also be suppressed by anaerobiosis and receptors may not be synthesized in the absence of oxygen.
2. Materials 1. Nutrrent broth and solid media appropriate to the growth requirements of the species (see Note 1). In the agar overlay method, add 0.5 g of bacterrologrcal grade agar to 100 rnL of 1% (w/v) peptone, boil for 15 mm to dissolve the agar, and sterilize at 121°C for 15 min. Drspense into sterile bijoux bottles in 2.5-mL volumes. 2. Mitomycin C: 100 ug/mL in sterile water, store m lOO-200~yL aliquots in foil-wrapped bottles at -70°C. Discard the stock after 6 mo and do not refreeze. This 1s a hazardous agent and appropriate safety precautions should be taken. 3. Saline: 0.2M in distilled water. Sterilize by autoclavmg and store at room temperature. 4. Chloroform (see Note 2). 5. Multipomt inoculator (see Note 3). 6. Membrane filters: 0.45 urn pore size, sterilizing grade.
3. Methods 3.1. Agar-Overlay Method (Fig. 1) 1. Pipet 10 mL of molten agar into g-cm diameter Petri dishes. Allow the agar to set and dry the surface at 37°C for 15 min. Store plates m a sealed plastic bag at 4°C overnight.
Pitt and Gaston
10 Bacteriocin
Bacteriocin
productlon
Fig. 1. Bacteriocm
detection
typmg by the method of Fyfe et al. (9).
2. At the same time, grow the bacteriocin-producing strams overnight on nutrient agar plates. 3. Disperse 5-10 colonies with a cotton swab m 2 mL of sterile distilled water to give a smooth suspension of approximately lOlo cfu/mL. 4. Dispense the suspensions into wells of a sterile reservoir block and apply spots of 0.3-0.5 pL with a multipomt moculator onto the surface of the lo-mL agar plates. 5. Incubate plates at a suitable temperature (see Note 4). 6. Remove plates from incubator and, m a fume hood, invert the agar surface for 15 min over filter paper pads (30 x 30 mm) that have been impregnated with 0.5 mL of chloroform (see Note 5). 7. Place the plates, open, in a 37OC incubator for 30 min to dry the surface and dispel all chloroform vapor. 8. Add 0.05 mL of a log-phase broth culture of an indicator strain to 2.5 mL of molten overlay agar at 50°C. 9. Mtx gently and pour the total volume rapidly over the entire surface of the plate. 10. Incubate the plate overnight at the optimal temperature for growth and record zones of inhibition.
3.2. Lysate
Method
1, Grow the producer strains m broth overnight.
Bacteriocin
Typing
11
2. Dilute 200 p,L of thts broth culture into 2 mL of fresh broth and incubate the tubes m a shaking water bath at an appropriate temperature until logphase growth is achieved (see Note 6). 3. Add mitomycin C to a final concentration of 1.Ol.tg/niL and continue the incubation, with shaking, for 6 h. There is usually an inmal increase in turbidity followed by a decline. 4. Add 0.5 mL of chloroform and shake the tubes vigorously. 5. Leave the tubes at room temperature for 15 min to allow the phases to separate. 6. Centrifuge the tubes at 5OOOgfor 20 min and recover the aqueous phase. 7. Filter the supernatant through a sterilizing grade membrane filter (0.45 pm) and store at 4°C. 8. Make a dilution series of filtrate in l-mL volumes of saline. Make lo-, 50-, loo-, 200-, 400-, 800-, lOOO-,and lO,OOO-fold dilutions m I-mL volumes of saline. 9. Pour a lawn of 2.5 mL of overlay agar (5O’C) containing 0.05 mL of a logphase broth culture of the indicator strain over the surface of a dried (25 rnL) nutrient agar plate. 10. Allow the soft agar to set and dry the surface at 37°C for 10 min. 11, With a micropipet, dehver 20 l.tL of each of the dilutions of lysate onto the agar surface. 12. Leave the plate open to dry for 10 mm. 13. Incubate the test plate overnight at an appropriate temperature. 14. Calculate the bacteriocm titer: For these purposes, the titer is defined as the highest dilution of lysate that inhibits the growth of the indicator strain, and is expressed as the number of bacteriocin U/20 FL. Multiply this figure by 50 to give the number of U/r& For the typing of clinical isolates, dilute each lysate to give a standard predetermined bacteriocin concentration (see Note 7). 1. 2. 3. 4. 5. 6. 7.
3.3. Scrape and Streak Method (Fig. 2) Grow the producer strain to log-phase in broth medium. Inoculate, with a sterile cotton swab, a strip (approx 1 cm wide), across the diameter of an agar plate. Incubate the plate overnight at a suitable temperature (see Note 4). Scrape off the growth with a microscope slide, taking care not to damage the surface of the agar. Expose the agar surface to chloroform vapor for 15 mm (see Section 3.1., step 6). Leave the plate open, m air, for 15 min to drive off all chloroform. Prepare log-phase broth cultures of the indicator strains.
Pitt pnd Gaston --
Fig. 2. Bacteriocin typing by the method of Abbott and Shannon (7). 8. Dispense 50-p,L volumes into a multiwell plastic block or microtitration tray. 9. Streak the indicator strains at right angles across the area of agar originally covered by the producer strain (see Note 8). 10. Incubate at the optimal growth temperature and record the inhibition reactions as posmve or negative (see Note 9). 3.4. Interpretation of Bacteriocin Typing Bacteriocin typing is most often performed with reference to established type schemes and therefore the protocol for the identification of types will depend on the species under investigation. For example, for aeruginosa, the activity of pyocins produced by field strains on a panel of eight indicator type strains and five subtype strains is recorded as + or -, and the pattern of inhibition is matched with a standard table that defines 105 types (12). Patterns of strains not contained in the table may be given arbitrary type designations and these can be used as part of a local database to classify subsequent isolates. In theory, the number of types may only be limited by the number of possible combinations of 13 indicators. This approach to bacteriocin typing is restricted to systems that have high reproducibility, as excessive variation in patterns will invariably place the same isolate in different types on repeated tests. For some species, however, the type is determined by the profile of the bacteriocins produced by the field strain against a panel of indicator P.
Bacteriocin
Typing
13
strains as well as the sensitivity of the field strain to bacteriocins produced by a set of standard strains. This form of production/sensitivity (P/S) typing is used for Proteus spp (13) and P. cepacia (14). Field strains are allocated a P/S type according to a reference table. The use of short numerical codes or mnemonics has been advocated where a large number of reactions are compared (15). For example, a strain with a type pattern with nine indicators of “+-+ --+ +--” would be coded 375 (+-+ = 3, --+ = 7, and +-- = 5) as each combination of reactions within each triplet is identified by a number. Alternatively, each indicator in the triplet may be numbered 4,2,1, respectively, and so +-+ would = 5, --+ = 1, and +-- = 4; reactions with all indicators in the triplet would be coded 7, and so on. 4. Notes 1. The agar for the growth of the bacteria should be formulated to give a clear medium, especially for the overlay method, and it should support the confluent growth of the species under test. 2. Plastic Petri dishes can be used for bacteriocin typing if care is taken with the chloroform treatment stage (see also Note 5). Previously, most workers used glass plates but these are fragile, and require washing and sterilizing. 3. The multipoint inoculator should deliver 19 or 36 discrete spots. If this equipment is not available the spots can be applied with a micropipet or with a l-mm diameter loop. Manual application of cultures is best achieved with the aid of a paper backing template cut to the diameter of the Petri dish and marked with equally spaced dots. 4. For fast-growing bacteria, incubate for 5-6 h at 5-7°C below the optimum growth temperature. Growth should be minimal after incubation and just visible to the naked eye. 5. Ensure that the chloroform does not come into contact with the plastic plate. Clouding of the plastic, with subsequent melting, will occur owing to chloroform vapor. This is reduced if the volume of chloroform and time of exposure is kept to a minimum. 6. The turbidity may be monitored spectrophotometrically, but for most fastgrowing aerobic species, 1.5-3 h is optimal. 7. Some bacteriocins may give consistently weak inhibition zones even at high concentrations. Double-agar layered plates are not necessary for all species and a conventional seeded lawn is often suitable. 8. The streak of the indicator strain may be made to the midpoint of the original inoculum of the producer strain or entirely across the agar surface. A variety of mechanical aids have been developed to facilitate the simulta-
14
Pitt and Gaston
neous cross-streaking of a number of indicator strains. The simplest is a comb of loops fixed at a right angle in a metal rod with a handle. 9. Zones of inhibition are sometrmes not clear and may be difficult to read. Reactions can vary from full inhibition through a thinning of growth to the presence of isolated colonies in the inhibition zone. This may be minimized by diluting the broth culture of the indicator strain 1 m 10 or 1 m 100. Phage activity is occasronally seen m the inhibition zone as patches of incomplete lysis. References 1. Konisky, J. (1982) Colicins and other bacterrocms with estabhshed modes of action, in Annual Revtew of Microbiology (Starr, M P., ed.). Annual Reviews, Inc., Palo Alto, CA, pp 125-144 2. Bradley, D. E. (1967) Ultrastructure of bacteriophages and bacteriocins. Bacterial Rev. 31,230-314
3. Baquero, F. and Moreno, F. (1984) The microcms
FEMS Microbial.
Lett 23,
117-124 4 Tagg, J. R., Dajani, A S., and Wannamaker, L W. (1976) Bacterrocms of Grampositive bacteria Bacterial. Rev 40,722-756.
5. KeIl, D. B , Clarke, D. J., and Morris, J. G (1981) Proton coupled information transfer along the surface of biological membranes and the mode of action of certain cohcins. FEMS Mtcrobiol Lett. 11, 1-12 6. Levisohn, R., Komsky, J., and Fomura, M. (1968) Interactron of cohcms with bacterra1 cells. IV. Immunity breakdown studied with colxins la and lb. J. Bactenol 96,811-821. 7. Abbott, J. D and Shannon R. (1958) A method of typing Shigella sonnei using colicine production as a marker J. Clin Pathol. 11,71-77. 8. Falkiner, F. R and Keane, C. T. (1977) Epidemiological information from active and passive pyocine typing of Pseudomonas aeruginosa. J. Med Microbial. 10, 447-459 9. Fyfe, J. A. M , Harris, G., and Govan, J. R. W. (1984) Revised pyocm typing method for Pseudomonas aeruginosa. J Clin. Mtcrobiol. 20,47-50. 10. George, R. H. (1975) Comparison of different medra for bacterrocin typing of Proteus mirabilis J. Clin Pathol. 28,25-28
11. Darrell, J. H. and Wahba, A H (1964) Pyocme-typing
of hospital strains of
Pseudomonas aeruginosa. J. Cltn Pathol. 17,236-242 12. Govan, J. R. W. (1978) Pyocin typing of Pseudomonas aeruginosa, in Methods in Microbiology, vol. 10 (Bergan, T. and Norris, J., eds.), Academic, London,
pp. 61-91. 13 Senior, B W (1977) Typing of Proteus strains by proticme production and sensrtivity. J. Med Mtcrobiol 10,7-17. 14. Govan, J. R. W. and Hams, G (1985) Typing of Pseudomonas cepacta by bacteriocin susceptibility and production. J. Clin Microbial. 22,490-494. 15. Farmer, J. J. (1972) Epidemiological differentration of Serratia marcescens typing by bacteriocin production. Appl. Microbtol. 23,218-225
CHAPTER3
Bacteriophage
Typing
@-one L. Pitt and Michael
A. Gaston
1. Introduction Bacteriophages (phages) are viruses that infect bacteria. Susceptibility to infection by particular phages varies between strains within a species, and this property can be exploited to construct highly discriminatory schemes for the type identification of strains in epidemiological studies. Part of the success of the technique is due to the simple methodology involved. Production and handling of bacteriophages requires nothing more than a competent aseptic technique and a basic understanding of their characteristics and life cycle. 1.1. Bacteriophage Life Cycle Phages infect bacteria by attachment to specific receptors and injection of nucleic acid into the cell. In the extracellular state, a phage exists as a metabolically inert particle or virion, which is a protein coat (capsid) surrounding nucleic acid, DNA or RNA. The nucleic acid may be doubleor single-stranded, in a linear or circular configuration (1,2). The following two situations may arise on injection of phage DNA into the host cell: 1. The DNA may become stably integratedinto the bacterial chromosome. This is referred to as Zysogeny, and phages capable of this are termed temperate phages.In lysogeny, a small proportion of host cells do express the phagegenesand somelysis and hberation of phageprogeny occur, 2. The DNA may enter a rephcative cycle, leadrngto the death of the host and the production of new phage particles. These Zytic or virulent wild phageslyse the bacteria at the end of the rephcative cycle and releasea From Methods m Molecular Biology, Vol 46. Edtted by J Howard and D M Whltcombe
15
Dlagnostlc Bacteriology Protocols Humana Press Inc , Totowa, NJ
16
Pitt
and
Gaston
large number of daughter phage particles that infect neighboring cells. This process leads to the formation of aplaque or visible inhibition of growth of the host cell (3). The host range of a phage is governed by a number of complex factors. The appropriate receptors must be accessible to the phage and, following infection, the phage DNA must evade host restriction and modification enzymes, which recognize foreign DNA and prevent its incorporation into the bacterial genome. Furthermore, bacteria that have previously been lysogenized by a phage are immune to lysis by related phages. 1.2. Practical
Considerations
Phages may be modified or adapted to exhibit different host ranges from parent phages by propagation in different hosts of the same species, In general, phage typing systems based on adapted phages are
more reproducible and strain specific than those that utilize wild or temperate phages. Phage typing schemes can offer very high levels of discrimination between strains, although reproducibility is a recurring problem. For many species, a large number of phages with different specificities can be isolated readily from both the environment and lysogenic cultures. This number may be reduced by study of lytic spectra to form manageable sets for phage typing. Phages are easy to handle in a laboratory with only basic equipment and can, in most cases, be propagated to produce large volumes of high titer stock that can be stored at 4°C for many years. Lytic reactions are not usually difficult to read and can be recorded in a manner that allows isolates to be readily compared with each other. of a Phage-Typing Scheme The development of a phage scheme can be divided into a number of stages. 1.3. Development
1.3.1.
Selection
of Strains
for the Isolation
of Phages
The selection of the initial strains to be used for the isolation of phases and for the panel of test strains is one of the most important steps in the estab-
lishment of a typing set. The larger the number of strains and the more representative they are of the overall population, the greater the chance of selecting a suitable set of typing phages. Schemes either can be developed as primary classification systems or as secondary typing meth-
Bacteriophage
Typing
17
ods, and these strategies require different sets of strains on which to develop and evaluate the scheme. 1.3.2. Isolation of Candidate Phages If environmental sources are available, then try as many varied sources as possible. For example, sewage treatment plants, animal waste material, general farm slurry, and water. 1.3.3. Evaluation and Selection of Most Efficient Typing Set In order to achieve a selection of typing phages that give good discrimination, candidate phages must be evaluated on a large panel of test strains. This gives rise to a large amount of data requiring careful analysis. In fact, the selection of typing phages is the most difficult part of establishing a phage scheme, There is no substitute for subjective analysis of the data, but there are relatively simple objective methods that can greatly ease the burden of analysis. We suggest the following approach to selection. 1. Discard phages with unsatisfactory lytic reactions. Many phages give very turbid plaques that would be inappropriate in a routine typing set. 2. Discard phages that only lyse a small percentage of strains (<5%). 3. Discard phages that exhibit rapid loss of titer (see Note 1). 4. Perform numerical analysis with the Jaccard coefficient (4). Similarity data and dendrograms are a quick route to the discarding of phages with very similar lytlc patterns (5,6). 5. Perform subjective analysis of lytic reactions of the remaining phages. It may be useful to do a more extended analysis with a provlslonal typing set before choosing a final set. 1.3.4. Statistical Approaches to Phage Selection There are a number of computer applications that can aid the selection of tests for phage typing schemes. Briefly, some of the approaches used by taxonomists for the interpretation of biochemical tests can be extremely useful in the analysis of lytic reactions. The operational taxonomic unit, conventionally a bacterial strain, is replaced by a phage, and the characters, usually the results of biochemical tests (positive or negative) are replaced by the results on test strains: A positive result is scored if one of the panel of test strains is lysed by the phage. In the context of choosing suitable typing phages, numerical taxonomy is essentially a negative selection procedure: It is a useful indicator of related phages, most of which can be excluded from a typing set on the basis of redundancy.
Pitt and Gaston
18
The positive selection of phages is best carried out sequentially, starting with the most discriminatory phage. This is the phage with the highest separation figure. The separation figure is the number of positive reactions multiplied by the number of negative reactions. Thus, given a set of 100 strains, the maximum separation figure is 50 x 50 = 2500, so the most useful phage is the one that reacts with approximately 50% of the strains. This parameter is easy to calculate and is a useful datum on individual phages. A more powerful approach is to use a computer program that will choose phages sequentially, starting with the most discriminatory isolate, and adding phages so as to maximize the number of strain pairs distinguishable by the partial set (7). 1.3.5. Storage of Strains
and Phages
Once the scheme has been finalized, all the propagating strains and the phages must be freeze-dried. This not only provides a useful safety net should a strain or phage be lost but also is a valuable source of reference material for quality control purposes. 1.3.6. Interpretation
of Phage-Typing
Results
The critical factors governing the interpretation of phage-typing results are discrimination and reproducibility. In an ideal scheme the pattern of lysis shown by isolates would be compared and any differences would indicate that the isolates are different strains. Schemes that utilize phages specific for a particular receptor site, such as the Vi polysaccharide of Salmonella typhi, are relatively reproducible and minor differences in patterns between isolates may be indicative of distinct strains. Furthermore, highly reproducible phage lytic patterns can be assigned a reference type number, and all isolates giving the samephage sensitivity pattern are designated as that type (8). For example, there are 106 internationally recognized phage types of S. typhi, each type being defined by a different phage pattern. In practice, few typing schemesreach this ideal and care must be used in interpreting the results of phage typing, All new schemesmust be assessed for their ability to discriminate between strains, i.e., to give the same pattern of lysis on isolates representing the same strain and to give different patterns on epidemiologically unrelated isolates. It is essential that the efficacy of a new scheme is established on a well-characterized collection of strains. The analysis of this data will establish how much
Bacteriophage
19
Typing
flexibility should be allowed in the interpretation of lytic patterns. This “flexibility” is introduced by applying a reaction difference rule (9). A reaction difference is defined as a difference between a strong positive (++) and a negative (-) reaction. The number of reaction differences that are allowed before a pair of isolates are considered distinct is determined by analyzing the variation in lytic patterns shown on repeated typing of isolates that represent the same strain. It follows that the more flexibility that is allowed, the less discriminatory power the scheme has. The reproducibility of a phage typing scheme must be established by repeat typing of stored isolates. Until the scheme has been shown to be reliable, comparisons can only be made between isolates typed in the same “run,” i.e., on the same day, on the same batch of media, and with the same phage preparations. This chapter describes methods for the isolation of phages from a variety of sources and techniques for quantifying phage activity on appropriate host strains. In addition, we describe protocols for the purification and propagation of phage. Last, we present methods for the examination of lytic spectra of the bacteriophage typing set and their use in phage typing.
2. Materials 1. Nutrient broth or solid media appropriate to the species (see Note 2). To solidify media, add bacteriological grade agar to nutrient broth to 1.5% (w/v); for soft agar overlays, use 0.5% (w/v). Sterilize by autoclaving at 121°C for 15 mm. 2. Double-strength nutrient broth. 3. Mitomycin C: Prepare a stock solution of 100 pg/mL in sterile water, store in 100-200 PL aliquots in foil-wrapped bottles at -70°C. Discard the stock after 6 mo, do not refreeze. 4. Chloroform. 5. Multiloop applicator (see Note 3). 6. Membrane filters: 0.22 pm pore size, sterile.
3. Methods 3.1. Isolation of Phage 3.1.1. From Sewage 1. Mix 5 mL of a 24 h composite of raw, untreated, settled sewage with 5 rnL of double-strength nutrient broth. 2. Add 0.1 mL of broth culture of a host strain and incubate overnight at 3o”c.
20 3. 4. 5. 6. 1. 2. 3. 4.
1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 1. 2. 3.
Pitt and Gaston Add 2 mL of chloroform (see Note 4), and mix vigorously for 30 s. Centrifuge at 4000g for 20 min. Remove the aqueous supernatant with a Pasteur pipet to a fresh contamer. Filter the supernatant through a 0 22-pm membrane filter and store at 4OC 3.1.2. From Lysogenic Cultures Dilute an overnight broth culture, 1 in 100, in fresh broth and incubate for 1 h at its optimal growth temperature in a water bath. Add mitomycin C (see Note 5) to give a final concentration of 1.O p,g/mL and incubate for 4-6 h. Remove the cells by centrifugation at 5OOOg. Filter the culture supernatant through a 0.22~pm membrane filter and store at 4°C. 3.2. Assay of Phage Activity 3.2.1. Surface Titration To eight 75 x 10 mm sterile tubes add, aseptically, 0.9 mL of nutrient broth. To the first tube, add 0.1 mL of phage filtrate. Change the pipet tip and mix the contents gently, taking care not to form bubbles. Transfer 0.1 mL to the next tube and repeat the dilution process along the series. Using a Pasteur pipet, flood -2 mL of log phase broth culture over the surface of a nutrient-agar plate. Remove and discard the excessfluid and leave the plate open at room temperature for 20-30 mm to dry. Starting at tube 8, remove 20 pL of fluid and carefully dispense it onto the surface of the agar plate (on a level surface) taking care not to form bubbles or touch the agar. Repeat the process downward to tube 1. Ensure that the drops are evenly spaced around the plate and that they do not run over the edge of the agar Replace the tip and spot 20 pL of undiluted phage filtrate on to the seeded agar. Leave the plate open at room temperature for the spots to dry and replace the lid. Incubate at 30°C overnight (see Not,: 6). Score the phage/host reaction as described in Section 3.2.2., step 7. 3.2.2. Double Agar Layer Prepare a series of dilutions of the phage as m Section 3.2.1. Add 0.1 mL of broth culture of the host strain to 3 mL of soft agar at 45°C. Workmg efficiently (do not allow the soft agar to set m the tube), rmx the
Bacteriophage
4. 5. 6. 7.
8.
Typing
21
contents of the tube by gentle mversion, and pour the bacterial suspension over the surface of an agar plate. Allow the soft agar to set and dry the surface at 37°C for 30 mm. Spot 20 p,L of each phage dilution carefully onto the agar surface. Incubate overnight at 30°C. Examine the lawn of growth for phage activity. Score each spot using the following classifications: a. Confluent lysis (CL): Inhibition of all growth within dilution spot; b. Semiconfluent lysis (SCL): Less complete with irregular edges and may mclude some growth within the area of lysis but no individual plaques; c. Opaque lysis (OL): Complete lysis covered by apparently resistant bacterial overgrowth; d. ++: more than 50 discrete plaques; e. +: 20-50 plaques; f. +: less than 20 plaques; -: no lysis; and t : I: mhibmon of growth usually seen at low phage dilutions. To determine the phage titer, record the number of countable, discrete plaques present in a dilution spot and multiply this number by the dilution and the volume to express the plaque forming units (pfu) per mL. For example: 48 plaques are present on the lOA dilution (the spot from the sixth IO-fold dilution) the titer is calculated as 48 x lo6 x 50 (20 mL volume = l/50 mL) = 2400 x lo6 or 2.4 x lo9 pfu/mL. Ignore spots with fewer than 10 plaques and count the preceding dilution. Some phage workers prefer to standardize phage concentrations to routine test dtlutron (RTD, see Note 7), but other laboratories favor the use of standard titers.
3.3. Purification of Phage Newly isolated phage suspensions from sewage or lysogenic strains may contain more than one variety of phage. This usually results in the
presence of different plaque morphologies on the host strain (see Note 8). Individual plaques must be purified to ensure a homogeneous phage population for subsequent propagation. Several phage strains can be isolated from each enrichment. 1. Using a sterile toothpick or bacteriological wire, touch the center of a well-isolated plaque and inoculate 1 mL of sterile broth in a glass tube. Agitate the inoculator vtgorously to ensure adequate transfer of the phage into the broth. 2. Prepare a series of lo-fold dilutions of the phage in sterile broth. 3. Spot 20-pL volumes of each dilution onto lawns of the host strain.
22
Pitt and Gaston
4. Incubate overnight at 30°C. 5. Examine the plate for purity of the plaques. 6. Repeat this process twice more and retain the last single plaque isolation for propagation.
1. 2. 3. 4. 5. 6. 7. 1. 2. 3. 4. 5. 6. 7. 8. 9.
3.4. Propagation of Phage 3.4.1. Broth Culture Grow the host strain in broth overnight and transfer 0.1 mL of saturated culture to 12 mL of fresh broth. Incubate the fresh culture at 37°C for 30 min, with shaking. Add 0.1 mL of phage (see Note 9) to the broth culture. Reincubate at 30°C with gentle or intermittent shaking for 6 h. Incubate for longer penods, depending on the growth characteristics of the host strain. Add 1 mL of chloroform (see Note 4) and shake gently. Centrifuge at 4000g for 20 min and filter the supernatant. Titrate the filtrate on the host strain (see Note 10). 3.4.2. Soft Agar Melt 10 mL of soft nutrtent agar and cool it to 45OC. Add 0.1 mL of log-phase broth culture of the host strain and 0.1 mL of phage at RTD (see Note 7). Pipet 7.5 mL of this to the surface of a large (14 cm) nutrient agar plate. Leave for 5 min to set. Incubate at 30°C overnight. Flood the agar surface with 10 mL of nutrient broth and break up the softagar layer with a sterile bent glass rod or Pasteur pipet. Transfer the fluid to a sterile bottle and wash the agar surface with a further 10 mL of broth. Pool the washings and ensure that the agar is broken up by rapid pipetmg. Centrifuge the supernatant at 8OOOgand filter it. Determine the phage titer.
3.5. Lytic Spectra Phages in a typing set are best compared and characterized for host range by the determination of their lytic spectra (see Note 11). 1. Make a 1 in 10 dilution of the phage in broth and spot 20 mL on lawns of each of the propagating strains m the phage set. 2. After incubation at 30°C overnight, record the lytic reactions, 3. Prepare lo-fold dilutions of the phage (to titrate) and spot all the dilutions onto each of the susceptible strains. Incubate and calculate titer.
Bacteriophage
23
Typing Bacteria
PHAGE 100x RTD Stook 1 Dilute to RTD fill block 1 Em
Dry 30 \
MULTI
LOOP
INOCULATOR
InI”
/
P”W.. - UOOL I ciz? Incubate
I
0
30
c
Read
reactlons
Fig. 1. Generalized scheme for phage typing of bacteria. 4. Score the reactions as follows: a, 5: Titer equivalent to titer on homologous propagating strain; b. 4: 10-l to 1O-2of homologous; c. 3: 10T3to 10-4 of homologous; d. 2: lo9 to lo-6 of homologous; e. 1: Weak lyttc reaction; and f. I: Inhibition only.
3.6. Phage Typing
of Isolates
Figure 1 illustrates the stages in the phage typing of isolates. 1. Prepare 2 mL of phage stocks at 100 x RTD and keep at 4OC (replace every 6 mo). 2. Prepare small patches of the host strains on agar plates by “painting” an area with a sterile swab dipped in log-phase broth culture.
Pitt and Gaston
24
3. Inoculate the center of each with 20 mL of the appropriate phage stock. 4. Incubate the plates overnight and check that each phage gives semiconfluent lysis on its host strain. 5. Dilute each phage to RTD (prepare 4 mL of this dilution). 6. Transfer 1-2 mL of RTD phage to a sterile perspex container with wells. 7. Grow the bacterial test strains, m broth, to log phase and prepare lawns of each on agar plates. 8. Apply phages with the aid of a multiloop applicator (see Note 3) and after drying, incubate overnight. 9. Record phage lytic reactions for each strain.
3.7. Reaction
Difference
Rule
1, Select 100 isolates and type them at RTD with the phage set. 2. Record the lytic reactions and make subcultures in storage medmm. 3. Store cultures at 4°C for 1 mo, and prepare fresh broth cultures at the end of this period. 4. Repeat the phage typing and record the reactions. 5. Prepare a histogram plot of the numbers of pairs of isolates (first and second typing) that exhibit 0 strong differences in lytic pattern (++ vs -), 1 difference, 2 differences, and so on. 6. The reaction rule is set as the number of differences that must be allowed so that at least 90% of the pairs of each isolate are considered “the same.” 7. Phage type sets of pairs of isolates of the same species from the same specimen, sequenttal tsolates from the same patient, and variants (antibiotic, biochemical) of the same strain as tests of clinical or biological reproducibility. Repeat the histogram to determine difference rule allowed. 4. Notes 1. Some phages are not very stable and titers may deteriorate rapidly on storage. Exclude these from the phage set or check their titers more regularly. 2. For nutritionally unexacting bacteria, peptone- or tryptone-based media are satisfactory. The nutrient quality of the medium may be increased by the addition of beef or yeast extract, specific amino acids, or serum. Calcium ions are required for optimal activity of some phages. 3. The most commonly used applicator was designed by Lidwell (10). It is available commercially from Leec Laboratories (Nottingham, UK). Phages may be applied manually, but this is extremely labor intensive for a large number of isolates. 4. Some phages are sensitive to chloroform, and in these casesthis treatment should be avoided. Enrichments are often more successful if chloroform is left out. Efficient centrifugation and the availability of disposable filters make it unnecessary to use chloroform regularly.
Bacteriophage
25
Typing
5, Mitomycin C is a mutagenrc agent and gloves must be worn when handling. The compound deteriorates in solution and is extremely light sensitive. 6. Phage activity is usually maximal at temperatures below the growth optimum for the host species. Overgrowth of the host strain may make it difficult to discern minute plaques and a lower incubation temperature can help to minimize this. 7. RTD is the highest dilution of phage that just fails to give confluent lysis of the host strain in a plate assay. This is used to standardize different phages in a typing set to ensure similar lytic activity, because some phages of high titer may have a low RTD and vice versa. Phage concentrations of 10, 100, or 1000 x RTD are used for some bacterial typing schemes. For soft-agar propagation, if the RTD is 10U3then 10 /.tL of phage stock should be added to 10 mL of soft agar to give final concentrations equivalent to RTD on a titration plate. 8. Heterogeneity of plaque morphology on a host strain may be due to phage mutation and not only to different phages. Plaque morphology of pure phages may also vary on different host strains. 9. The ratio of phage to bacterial cells is crucial for successful propagations. A ratio of at least 2:l is advisable, but this should be determined expenmentally. Thus, the phage titer and the viable count of the host strain (at the time of the addition of phage) should be carefully quantified. 10. Titers of lo8 to lOlo pfu/mL usually can be achieved, for most enterobacterial phages, by broth propagation; titers below this are unsatisfactory and the propagation should be repeated by varying incubation times and phage:bacteria ratios. Phages are easily spread in aerosols, so stocks should be prepared with a reasonable degree of spatial or temporal separation. 11. It is important to ensure that each batch of propagations of a phage has identical lytic propertles to the original stock. This is checked by determining its lytic spectrum on the propagating host strains of the typing set. Batches exhibiting major discrepancies from the original must be discarded, as they may contain mutated phage. Volumes (0.1 mL) of the propagation should be lyophilized and stored in the dark for reference. When required, reconstitute phage in 0.1 mL of broth and make up to 1 mL.
References 1. Ackermann, H W. and Dubow, M. (1987) Viruses of Prokmyotes, vol. 2, CRC, Boca Raton, FL. 2 Ackermann, H. W., Auduner, A., Berthiaume,L., Jones,L. A., Mayo, J. A., and Vidaver, A. K. (1978) Guidelines for bacteriophagecharactenzatlon.Adv. Virus Rex 23, I-24.
3. Adams, M. H (1959) Bacteriophage, IntersciencePublishersInc., New York.
Pitt and Gaston
26
4. Jones, D. and Sackin, M. J. (1980) Numerical methods in the classification and identification of bacteria with especial reference to the Enterobacteriaceae, in Microbiological Classification and Identification (Goodfellow, M. and Board, R. G , eds.), Society of Applied Bacteriology-Academic Press, London, pp. 73-106. 5. Gaston, M. A. (1987) Isolation and selection of a bacteriophage typing set for Enterobacter
cloacae. J Med. Microbial.
24,285-290.
6. Gaston, M. A. (1987). Evaluation of a bacteriophage-typing batter cloacae. J. Med. Microbial.
scheme for Entero-
24,291-295.
7. Willcox, W. R. and Lapage, S. P. (1972) Automatic construction of diagnostic tables. Comput. J. 15,263-267. 8. Anderson, E. S. and Williams, R. E. 0. (1956) Bacteriophage typing of enteric pathogens and staphylococci and its use in epidemiology. J. Clin Pathol. 9,94-127. 9. Williams, R. E. 0. and Rippon, J. E. (1952) Bacteriophage typing of Staphylococcus aureus. J. Hyg. (Camb) 50,32O-353.
10. Lidwell, 0. M (1959) Apparatus for phage-typing of Staphylococcus aureus. Mon. Bull. Ministr. Health l&49.
Recommended
Reading
Bradley, D. E. (1971) A comparative study of the structure and biological properties of bacteriophages, in Comparative Virology (Maramorosch, K. and Kurstak, K., eds.), Academic, New York, pp. 207-253. Nicole, P. (1964) La lysotypie de Sulmonellu typhi. Son prmcipe, sa technique, son application a l’epidemiologie de la fi&vre typhoide, in The World Problem of Salmonellosis (van Oye, E., ed.). Dr. W. Junk, Publishers, The Hague, The Netherlands, pp. 67-88. Anderson, E. S. (1964) The phage typing of Salmonellae other than S. typhi, in The World Problem of Salmonellosis (van Oye, E., ed.). Dr. W. Junk, Publishers, The Hague, The Netherlands, pp, 89-l 10.
CHAPTER4 The Analysis of Bacterial by SDS Polyacrylamide Electrophoresis Menelaos
Proteins Gel
Costas
1. Introduction Polyacrylamide gel electrophoresis (PAGE) of proteins has been used increasingly during the past decade in the examination of bacteria for both comparative purposes and in the study of their protein biochemistry at the molecular level. The most popular of the techniques employed, discontinuous SDS-PAGE, was first described by Laemmli (I) as a method for the separation of polypeptides in complex mixtures and the determination of their molecular weights. Sodium dodecyl sulfate (SDS) is an anionic detergent that binds to a polypeptide in proportion to its size. When treated with SDS and a reducing agent, polypeptides become rods of negative charge, but with equal charge densities. The intrinsic charge on polypeptides is effectively overwhelmed by SDS binding thus allowing their migration and separation solely according to size. The SDS-PAGE technique separates proteins by the more conserved parameter of molecular weight and thus appears to detect broader taxonomic relationships, especially at the species and subspecies levels, than methods based on charge parameters. One-dimensional SDS-PAGE offers the combination of high-resolution and good reproducibility and thus has clear advantages over the lower resolving nondenaturing systems and the lower reproducibility of both gradient-PAGE and isoelectric focusing. The theoretical background for the SDS-PAGE From Methods m Molecular Biology, Vol 46: Diagnostrc Bacteriology Protocols Edlted by J Howard and D M Whltcombe Humana Press Inc , Totowa, NJ
27
28
Costas
technique has been described in detail elsewhere (2,3) and is not considered further in this chapter. The method described here has been adapted specifically for use in the comparative analysis of bacterial protein patterns. For such studies, large numbers of samples across numerous gels may be required and therefore, gel-to-gel reproducibility is of the utmost importance. Although, broadly based on the methods of Laemmli (I), the method described here has been significantly altered for this application. In particular, the use of slab gels rather than tubes enables more samples to be compared on a single gel. Many of the problems that may be encountered in this adapted version are those of the generic method and these have been detailed in an earlier volume of this series (4).
2. Materials 2.1. Apparatus 1. A vertical slab electrophoresis unit (see Fig. 1). The Hoefer SE 600 (Hoefer Scientific Instruments, San Francisco, CA) and others based on this design, e.g., LKB 2001 (Pharmacia-LKB Biotechnology, Uppsala, Sweden) can be recommended. Both provide an internal cooling coil that can be used to maintain a constant temperature throughout the tank and across the gels. More basic versions can be made in a workshop but must be manufactured to precise specifications. In particular, the apparatus must be long enough to allow for a loo-mm resolving gel plus a stacking gel of 10 mm and space for the sample wells; most standard units are about 16 x 18 cm. 2. A reliable power pack for running the gels. Multiple gels may be run m parallel and 30 mA/gel is required so the power pack must be suitable for the anticipated number of gels to be run at any time.
2.2. Stock Solutions All solutions used in the production of polyacrylamide gels should be prepared volumetrically using chemicals of the highest quality. Use Analar grade or equivalent (unless otherwise stated). Use deionized water with a resistivity greater than 10 MQ/cm for the preparation of all solutions. Store all the solutions for up to 1 mo at 4”C, except where otherwise stated. Ensure that cold solutions have equilibrated to room temperature before use. 1. Sample lysis buffer (2X): 4% (w/v) SDS, 20% (v/v) glycerol, 2% (v/v) 2-mercaptoethanol, 70% (v/v) stacking gel buffer (see step 4) and the
Analysis
of Bacterial
Proteins
29
Fig.1, Vertical slab gel apparatus. The model shown is the Hoefer SE 600 and is shown here with gel cassettesand the upper reservoir in place. A heatexchanger can be added for cooled systems. Courtesy of Hoefer Scientific Instruments (San Francisco, CA).
2. 3. 4. 5.
remainder is deionized water (see Note 1). Add Bromophenol blue (Electran grade) to 0.001% (w/v) to act as a tracking dye. Hydrochloric acid (5M): Prepare a volume of accurately diluted HCl to be used for all pH adjustments. Separating gel buffer: 1.5M Tris-HCl, pH 8.8. 17.5 mL of the HCl stock is required per 200 mL of buffer (see Note 2). Stacking gel buffer: 0.5M Tris-HCl, pH 6.8. 9.5 mL of the HCl stock is required per 100 mL of buffer (see Note 2). Acrylamide monomer solution (30:0.8): 29.2% (w/v) acrylamide monomer (Electran grade l), 0.8% (w/v) N,N’-methylenebisacrylamide (Electran grade) in deionized water. The total acrylamide content (T) is 30% (w/v) and the ratio of crosslinker to acrylamide monomer, Cnis = 2.67% (w/w). This solution is highly toxic and should be handled accordingly.
30
Costas
6. SDS: 10% (w/v) m deionized water. 7. Ammomum peroxodisulfate solution: 10% (w/v) (Electran grade). Make a fresh solution prior to each use. 8. N,N,N’,N’-tetramethylethylenediamine (TEMED): Use Electran grade, store at room temperature. 9. Tank (reservoir) buffer (10X): 250 mM Tris, 1.92M glycine, 1% (w/v) SDS. Dilute lo-fold before use (make a large batch). The pH should be 8 3 without adjustment. 10. Staimng/fixing solution: 25% (v/v) methanol, 10% (v/v) glacial acetic acid, 0.1% (w/v) Coomassie brilliant blue R-250 in deionized water. Filter through Whatman (Maidstone, UK) No. 1 paper before use. 11. Destaining solution: 25% (v/v) methanol, 10% (v/v) glacial acetic acid in deionized water. 12. Phosphate-buffered saline (PBS): One tablet of Dulbecco A (Oxoid, Basingstoke, UK) contaimng 0.8 g NaCI, per 100 mL of deiomzed water, pH 7.3. 13. Lysozyme: 0.1% (w/v) m deionized water. 14. Lysostaphm: Supphed as a lyophilized powder. 15. Sodmm phosphate: 10 mM sodium phosphate, pH 7.2.
1. 2. 3. 4. 5.
6. 7.
3. Methods 3.1. Sample Preparation Harvest bacterial cells grown on solid media from plates using a glass loop or a plastic/glass scraper (see Note 3) and transfer the cellular material to distilled water or PBS at 4°C. Collect the cellular material by centnfugation (25OOg) for 30 min at 4OC. Bacteria grown in liquid culture can be harvested directly from the broth using these same conditions (see Notes 4-7). On ice, resuspend the resulting pellet in 1 mL of PBS or distilled water in a microcentrifuge tube and recentrifuge as in step 2. Remove and discard the washing liquor to give a pellet of cellular material. Do not overwash the cells, as losses in yield and quality can occur by autolysis, especially when using water. For Gram-negative bacteria, add an equal volume of lysis buffer to the cell material and incubate for 5-10 min in a heating block at 100°C (see Note 8). Determine empirically the appropriate incubation time for each strain m order to maximize cell lysis. Add an equal volume of deionized water and heat the sample at 100°C for a further 5-10 min. For most Gram-positive bacteria, preincubate the cells in lysozyme at 37°C. In other casesphysical or chemical methods may be needed for cell
Analysis
8.
1.
2.
3. 4. 5,
6.
7. 8. 9. 10. 11.
of Bacterial
Proteins
31
disruption (see Note 9). The exact length of incubation (30-60 min) depends on the bacteria under study and should be determined by experiment. After cell wall digestion, these samples can be treated as for Gramnegative bacteria by the addition of lysis buffer and heating (see step 5). Centrifuge the lysed samples m a microcentrifuge at 11,600g for 10 min to remove cell debrts. Store the supernatant contammg the soluble whole-cell proteins at -40°C. 3.2. Preparation of Polyacrylamide Gels Assemble the gel cassettesas instructed by the manufacturer using clean glass plates (16 x 18 cm). Wipe the surfaces with acetone to ensure they are grease free. Place a small filter paper label with a unique gel number m the bottom left corner of each cassette.Ensure the cassette1ssealed usmg a thin film of soft white paraffin on the outside halves of the two 1S-mm thickness spacers (see Note 10). Combine, m a side-arm flask, 30 mL of acrylamide stock solution, 22.5 mL separating gel buffer, and 36.15 mL of deionized water. This makes 90 mL of separatmg gel mix and 1ssufficient for two 10% (w/v) acrylamrde gels of 160 x 180 x 1.5 mm (see Note 2). Degas the solution using a vacuum pump (10 mbar) for 3 min. While swirling the solution gently to ensure good mixing, add 0.9 mL of 10% (w/v) SDS stock, 0.45 mL of 10% ammonium peroxodisulfate and 45 pL TEMED. Pour two gels, deliver 10-mL volumes of the acrylamide/buffer mixture to each assembly alternately to ensure that the gel matrices are as similar as possible. If possible, use an electric, automated pipet filler to enhance the speed and reproducibility of the gel pouring. When the mixture reaches 30 mm from the top of the plates, carefully insert blank PTFE (Teflon) combs projecting 35 mm into the gel cassettes. Avoid trapping air bubbles and gradually lower the combs to form a horizontal top surface (see Note 11). Place the cassettesin a 20°C water bath; gel polymerization occurs after about 12 mm. After about 1 h, carefully remove the blank combs and thoroughly wash the gel surface with deionized water. Pour an overlay of tank buffer over the surface and allow the gel to polymerize fully overnight. The following day, wash the gel surface with deionized water, invert the assembly, and allow it to drain. Prepare the stacking gel mtx in a sidearm flask. For two gels (20 mL), mix 3.33 mL of acrylamide stock, 5 mL of stacking gel buffer, and 11.37 mL of deionized water. This gives a final concentration of 5% acrylamide.
32
Costas
12. Degas the mixture as in step 3. 13. Add 200 l.tL of 10% (w/v) SDS, 100 PL of 10% (w/v) ammoniumperoxodisulfate, and 20 pL TEMED. Gently swirl the mixture as before. 14. Insert PTFE combs with 15-20 wells 25 mm into the assembly, leaving 10 mm for the stacking gel, 15. Pour the stacking gel onto the separating gel and fill the assembly to the top. Ensure that no air bubbles get trapped beneath the teeth of the comb. 16. Allow the gel to set for 1 h. 17. Remove the combs, wash the sample wells thoroughly with deionized water, and fill them with reservoir buffer. 1,
2. 3. 4.
5.
3.3. Sample Application and Electrophoresis Load the wells with 5-15 pL of the protein extracts using a microsyringe (20 pL) with a repeater, or a micropipet. This amount can vary depending on the protein concentration of the samples (see Note 12). Do not use the three outer wells on each side of a 20-well gel as these are prone to edge distortion or “smihng,” which can result in patterns that are out of alignment with the remainder of the gel and difficult to compare with other gels. Load a 12.3-78 kDa molecular mass marker set (Electran grade) for the calculation of the protein molecular masses.In addition, load a standard whole-cell bacterial sample for estimating gel-to-gel reproducibility and to allow comparison between gels. After loading, remove the gels from the assembly/pouring stand, and place them in the running apparatus. Ensure that the top reservoir cannot leak. Fill the upper and lower buffer chambers with tank buffer (see Note 13). Electrophorese the gels at a constant current of 60 mA (30 mA/gel) and a constant temperature of 15°C. Use a refrigerated recirculator to maintain the temperature. To improve the temperature distribution, place the whole tank assembly on a magnetic stirrer with a spin bar in the lower reservoir. Run the gels until the tracking dye has migrated 100 mm down the length of the separation gel (about 4 h + 10 min). Use a transparent insert with a line scored at the appropriate distance held on the outside of the front plate. The gel length is critical if valid gel-to-gel comparisons are to be made. In addition, the electrophoresis parameters can be helpful indicators of gel reproducibility. Under these conditions, for a fully loaded pair of gels, the initial voltage should be 80-100 V and the final voltage 280-300 V. The gels should take about 230-250 min to migrate 100 mm.
3.4. Protein Visualization 1. After electrophoresis, remove the gel assembliesfrom the tank and separate the plates.
Analysis
of Bacterial
Proteins
12
33
345678
Fig. 2’.Electrophoretic protein patterns of the type strains of different bacteria illustrating clear differences in background pattern between the various species: 1, Proteus mirabilis; 2, Proteus vulgar-is; 3, Morganella morganii; 4, Providencia alcalifaciens; 5, Providencia stuartii; 6, Providencia rettgeri; 7, Providencia rustigianii; and 8, Providencia heimbachue. 2. Carefully transfer each gel to an appropriate tray (e.g., a clean Tupperware box) and add stain/fixer sufficient to cover the gel. 3. Fix and stain the gels, with gentle agitation, overnight (16 h). 4. Remove the stain solution and replace it with destain solution. 5. Wash the gels with gentle agitation at room temperature. Several changes of destain solution are required to produce a clear background. 6. Dry the gels between dialysis membrane sheetson a slab gel dryer such as the LKB 2003 (see Note 14). 3.5. Analysis of Electrophoretic Patterns A typical one-dimensional whole-cell bacterial protein pattern can contain up to 50 or 60 discrete bands of differing intensity. An example is shown in Fig. 2. It is therefore extremely difficult to objectively estimate the similarity between patterns. Although such comparisons can be
34
Costas
made by simple visual inspection, more recently, densitometers have been used to record both quantitative and qualitative data from tracks on gels. The data can then be entered directly (via an interface) or indirectly (manual entry) into a computer for further analysis. This aspect of the use of electrophoretic protein patterns for bacterial classification and identification is still comparatively underdeveloped with very few laboratories able to fully implement even semiautomated systems. Densitometers can also be interfaced to an integrator for the calculation of migration distances and relative quantities of individual components. Software that can perform integrator functions and is able to run on microcomputers is widely available thus negating the need for specialized equipment such as an integrator. If the calculation of molecular size is all that is required then a simple plot of logI of molecular weight against the migration distance (R$ of a set of standard proteins should be made. The molecular weight of an unknown polypeptide can then be determined from this plot (5). Bacteria are extremely varied with respect to their protein patterns. The strains of some species have a very homogeneous protein content with little variation in banding pattern. Thus the pattern is speciesspecific and can act as an identification marker. Others, notably members of the Enterobacteriaceae and some Gram-negative fermenters, show a high degree of protein pattern heterogeneity although this is often limited to “the major band region” located, most often, in the central area of these patterns (Fig. 3). The upper and lower areasor “background pattern” are often characteristic of the species (Fig. 2). In such cases the whole of the pattern, including the variable region (often the major bands), can be used to type or fingerprint within a species and the partial “background pattern” can be used to assign a strain to a species. A diagram illustrating these terms is shown in Fig. 4. In other groups, Helicobacter pylori for example, variation is found among the finer, secondary bands, with the major bands being species-specific. The methods by which protein patterns of bacteria can be analyzed forms a separate and complex subject. Detailed reviews have been published elsewhere (6,7), 4. Notes 1. Numerous formulations for the basic samplebuffer describedin Section 2.2.1. havebeenpublished,All arevariants on a theme as they contain the samecomponentsbut at differing concentrations.Dlthiothreitol, at a different concentration,can be usedin place of 2-mercaptoethanol(8).
Analysis
of Bacterial
Proteins
35
Fig. 3. Electrophoretic protein patterns of strains of Cumpylobacter representing a number of different electropherotypes and showing the degree of heterogeneity in the major band region. hyointestinalis
2. The separation and stacking gel solutions are made up in the manner described in Sections 2.2.3. and 2.2.4. to ensure reproducibility, It has been found that adjustment of pH in Tris solutions using HCl and a pH electrode/meter may be subject to pH drift. This has been noted even with specially manufactured “Tris electrodes.” The method by which pH is adjusted may differ among different workers. This may have a considerable effect on the final separation. 3. Do not use a cotton wool swab to collect cell material because of the possibility of contamination with cotton fibers, 4. A single universally applicable method for the growth and preparation of bacterial samples for 1-D PAGE cannot be defined because of the diverse nature of bacteria, their nutritional requirements, and the chemical composition of their cellular structure. 5. The cultivation medium together with the gaseous conditions and the growth temperature, as well as any other definable culture condition, should all be selected to encourage optimal growth of the bacteria under examination. Where studies of bacterial strains with differing nutritional requirements or cultural conditions are contemplated, these should be
Costas
36 10
1 4
Background pattern
Major band regton
Background pattern
0
F
2 06
$ ifi 2 0.4 E 2 0.2
J 0I , 0
_----d--i
--_-----s-w-
Lmear background I
20
I
40
I
Position
60
I
80
I
100
(mm)
Fig. 4. Absorbance trace of typical bacterial electrophoretic protem pattern illustratmg the terms “background pattern” and “major band region” as used in this chapter. defined, at a minimum level, to be suitable for the most fastidious bacteria included in the study, In some cases it will be extremely difficult if not impossible to include some groups within a single study, e.g., strictly anaerobic together with strictly aerobic bacteria. Fundamental differences in the energy production systems are usually reflected taxonomically and therefore the need to compare such groups would be unlikely. If comparisons of the resulting protein patterns are to be made, once selected, the growth medium and culture conditions should be kept constant and applied to all bacteria within a study. 6. The quality of a bacterial sample can be assessedby the banding pattern produced after electrophoresis. Studies should always begin with an examination of a small but representative group of bacterial samples prepared from growth on different media and under different conditions. Thus, for some groups, better samples may be forthcoming if the bacteria are grown on rich agar plates. In other cases a liquid medium may be more suitable because tt may suppress the production, or allow the dissolution, of extracellular polysacchartdes or capsular material that can result in
Analysis
of Bacterial
Proteins
37
poorly resolved or smeared protem banding patterns. The use of liquid culture has the advantage that it allows for a more controllable harvesting of cell material at a particular growth phase. However, sohd culture is, m general, more convenient and contaminants are detected more easily. In addition, it often leads to a higher yield especially for aerobic bacteria. The inoculum used in either solid or liquid culture should be fresh and should be subcultured a number of times at regular intervals before use. 7. Studies of pattern variation and reproducibility with age of culture, medium composition, and other culture variables should be made. It is also advisable to check the reproducibility of the techmque and of the system by culturing separately isolates derived from a single strain (colony) and prepared independently. 8. Heating of the samples is used to both destroy proteolytic activity and aid in cell breakage, protem solubilization, and SDS binding. 9. The method of sample preparation employed is dependent to a large extent on the susceptibility of the bacteria under study to differing cell-breakage methods. Broadly, there are two types of cell breakage methods: chemical and physical (mechanical). Most Gram-negative bacteria are susceptible to breakage by SDS directly and some are so fragile that cell wall and membrane rupture can be accomplished simply by changes in the osmotic conditions. In contrast, Gram-positive bacteria pose much greater problems and are relatively more robust and less amenable to chemical breakage. In some cases enzymatic pretreatment with bacteriolytic enzymes can be effective. Lysozyme can be used to break down the cell walls of many Gram-positive bacteria (9). More specifically, the lytic enzyme lysostaphin is extremely effective with the species Staphylococcus awem (10). Strains of S. aurexs can be broken by incubation in a solution containing 60 p.g of lysostaphin in 1 mL of 10 mM sodium phosphate buffer at 37OC.Acetone is able to chemically disrupt the cell walls of a number of Gram-positive bacteria but must be evaporated before final solubilization (II). Samples prepared in this way showed similar protein patterns when compared with those generated by sonicatlon and bead agitation. Most of these methods can be used on small quantities of cell biomass (i.e., 50-100 mg wet wt) and are particularly suitable for pathogenic bacteria as the material can be maintained in a closed environment, is killed chemically or by accompanying heat treatment, and does not produce aerosols, thus diminishing potential biohazard problems. Physical/mechanical methods, apart from somcation (which can be scaled downward using a microprobe) invariably require larger volumes of cell biomass but may be the only effective alternatives for some Gram-positive bacteria. In addition to sonication, these include blending or grinding with
38
10. 11.
12.
13. 14.
Costas abrasives (e.g., glass beads) (II) and the use of pressure methods such as the French press (12). All produce cell breakage but will require subsequent solubilization for use in denaturing systems.Cell-breakage methods have been reviewed by Coakley et al. (13). Where studies on specific cellular components such as outer membrane or cell envelope proteins are undertaken, then differential centrlfugatlon techniques may be required for subcellular fractionation after cell breakage (14-16). Selective chemical treatments effective against specific elements of these components may also be required, e.g., Sarkosyl (I 7). In some more delicate bacteria, H. pylori for example, it has been found that harvested material placed directly (i.e., without washing) into the lysis buffer produces better samples (Z8). Gels are usually cast to a thickness of 1.5 mm, although 1 and 0.75 mm spacers are available. An overlay of water-saturated lsobutanol can be used in place of the blank comb (5) and can produce a sharp interface. When comparisons between sets of gels is contemplated, this method should not be used because the length of the separation gel 1sdifficult to standardize because of vanatlons in the degree of mixing at the interface. It is also difficult to pour consistent lengths of separation gel owing to shrinkage on polymerization when using the overlay method. This is overcome when using a blank comb and displacement method of pouring. Some workers determine the protein content of their samples by the methods of Bradford (19) or Lowry et al. (20), and then standardize the loading of samples. However, this procedure is not necessary as the protein content can be determined empirically followmg electrophoresis. The tank buffer 1sused in both the upper and lower electrode reservoirs. It is discarded after each run from the upper reservoir but may be retained for up to five or six runs in the lower reservoir. Gels can be fixed and then stained separately if desired. Various formulations and protocols for destaining are available, some use a concentrated destain for a more rapid removal of unbound stain followed by a weaker destain. The relative concentration of the components of the destaining solution will also affect the size of the gel after stammg. Gels may be subject to shrinking or stretching, depending on the destain used.
References 1. Laemmli, U. K. (1970) Cleavageof structural proteins during the assembly of the head of bacteriophage T4. Nature 227,680-685.
2. Andrews, A. T. (1986) Electrophoresis* Clinical Applications.
Theory, Techniques, and Biochemicaland
Oxford University Press, Oxford, UK.
Analysis
of Bacterial
Proteins
39
3. Hames, B. D. (1981) An introduction to polyacrylamide gel electrophoresis, in Gel Electrophoresis of Proteins* A Practical Approach (Hames, B. D. and Rickwood, D., eds.), IRL Press, Oxford, UK, pp. 1-91. 4. Smith, B. J. (1984) SDS polyacrylamrde gel electrophoresis of proteins, in Methods in Molecular Biology Vu1 I: Protews (Walker, J. M., ed.), Humana, Clifton, NJ, pp. 41-55 5 Separation of proteins on the basis of molecular weight: SDS gel electrophoresis (1990) in Hoefer Electrophoresis Catalog and Exercises 19961991, Hoefer SCIentific Instruments, San Francisco, CA, pp. 123-127. 6 Costas, M. (1992) Microcomputers in the comparative analysis of one-dimensional electrophoretic patterns, in Microcomputers in Bzochemistry: A Practical Approach (Bryce, C. F A., ed ), IRL Press at Oxford University Press, Oxford, UK, pp 189-213 7. Costas, M. (1992) Classification, identification and typing of bacteria by the analysis of their one-dimensional polyacrylamide gel electrophoretic protein patterns, in Advances in Electrophoresis, vol. 5 (Chrambach, A., Dunn, M J , and Radola, B. J., eds.), VCH, Weinhelm, Germany, pp. 351-408 8. Mortensen, J. E , LaRocca, M. T., Steiner, B., and Ribner, B. (1987) Protein fingerprinting for the determination of relatedness m Acinetobacter calcoaceticus subspecies anitratus isolated from patients in a surgical intensive care unit. Infect. Control 8,512-515.
9. Jackman, P. J. H. and Pelczynska, S. (1986) Characterization of Corynebacterium group JK by whole-cell protein patterns. J. Gen. Microbial. 132, 1911-1915. 10 Costas, M., Cookson, B D., Talsania, H. G , and Owen, R J. (1989) Numerical analysis of electrophoretlc protein patterns of methicillin-resistant strains of Staphylococcus aureus. J Clin. Mtcrobtol 27,2574-258 1. 11. Bhaduri, S. and Demchlck, P. H. (1983) Simple and rapid method for disruption of bacteria for protein studies. Appl. Environ. Microbial. 46,941-943. 12. Kersters, K. and De Ley, J. (1975) Identification and grouping of bacteria by numerical analysis of their electrophoretic protein patterns J Gen. Microbial. 87,
333-342. 13. Coakley, W. T., Bater, A. J., and Lloyd, D. (1977) Disruption of micro-organisms, in Advances in Microbial Physiology, vol. 16 (Rose, A. H. and Tempest, D. W., eds ), Academic, London, pp 279-341. 14. Ames, G. F -L. (1974) Resolution of bacterial proteins by polyacrylamide gel electrophoresrs on slabs. J. Biol. Chem. 249,634-644. 15. Lugtenberg, B., Meijers, J , Peters, R , Van Der Hoek, P., and Van Alphen, L. (1975) Electrophoretic resolution of the major outer membrane protein of Escherichia coli K12 mto four bands. FEBS Lett 58,254-258 16 Overbeeke, N. and Lugtenberg, B (1980) MaJor outer membrane proteins of Escherichca coli strains of human origin J. Gen. Microbial 121,373-380. 17. Dinsmoor, M J., Ebersole, J E., and Gibbs, R. S. (1990) Protein banding patterns of the outer membrane-enriched fraction of Bacteroides bivtus J. Clin. Microbial.
28,405408.
40
Costas
18 Costas, M., Morgan, D. D , Owen, R. J., and Morgan, D R. (1991) Differentiation of strains of Helicobacterpylori by numertcal analysis of 1-D SDS-PAGE protein patterns: evidence for post-treatment recrudescence. Epidem Infect. 107,607-617 19. Bradford, M. M. (1976) A rapid and sensrtrve method for the quantitation of microgram quantities of protein utrlizing the principle of protein-dye binding. Anal. Biochem. 72,248-254
20. Lowry, 0. H., Rosebrough, N J., Farr, A L., and Randall, R J (1951) Protem measurement with the Folm phenol reagent. J. Blol. Chem. 193,265-275.
CHAPTER5
Lipopolysaccharide
Chemotyping
Henrik
Chart
1. Introduction Lipopolysaccharide (LPS), traditionally termed somatic antigen or O-antigen, forms an integral part of the outer membrane of Gram-negative bacteria. In general, LPS consists of essentially three parts: 1. A hydrophobic portion, lipid A, which is composed of long-cham fatty acids and which anchors LPS molecules into the outer membrane; 2. The core region; and 3. The long-chain LPS, which IS comprised of polymers of oligosaccharide units and contains the epitopes involved in LPS serotyping reactions.
The LPS of Salmonella typhimurium (Fig. 1) can be used to illustrate the general relationship among lipid A, LPS core, and long-chain LPS. The lipid A of S. typhimurium LPS is composed of a disaccharide comprising two molecules of n-glucosamine linked to three phosphate groups. Attached to theseare saturatedfatty acid chains of P-hydroxymyristic acid, lauric acid, myristic acid, and palmitic acid. The core region contains 2-keto-3-deoxy-manno-octonate, galactose, glucose, N-acetyl-o-glucosamine, and phosphate. The long-chain LPS is made from repeating units of oligosaccharides comprising abequose,mannose, galactose, and glucose. For many Gram-negative bacteria the structure of lipid A and core LPS is highly conserved. However, considerable heterogeneity can exist in the sugar composition of the subunits that comprise the long-chain moiety of LPS, and in the number of repeating subunits per chain; this variation in LPS structure forms the basis for the various chemotypes observed in Gram-negative bacteria. From* Methods m Molecular B/ology, Vol. 46 E&ted by* J Howard and D. M Whkombe
41
Dfagnostlc Bacteriology Protocols Humana Press Inc , Totowa, NJ
ethanolamine
ethanolamme
GAL
NAG
0
GLU
RHA
Repeating
8
-oGAL
8
GLU
n
unit of O-chain
Core
A nose 63 @
H
nose
@@ety@ucosarnme
Lipid A
@osphate
2~to-3~eoxy-mannoQctonate
Fig. 1. Diagrammatic representation of the molecular structure of LPS expressed by S. typhimurium. distinct regions of lipid A, core, and repeating subunits.
Note the three
Lipopolysaccharide
Chemotyping
43
Prior to the elucidation of the chemical structure of various lipopolysaccharides, extensive variation in the chemotypes of bacteria had been demonstrated in the course of characterizing pathogenic bacteria based on their “serotype.” Sera prepared to the “O-antigens” of strains of, for example, Salmonella spp and Escherichia coli proved invaluable for the differentiation of strains of these organisms into serogroups and serovars. In addition to chemical analysis and serotyping, LPS chemotypes can be examined using the technique of sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) in association with a silver stain specific for carbohydrate (I). LPS can be separated from bacterial proteins using proteinase K (2) and, since, the lipid A gives LPS molecules an overall negative charge, these polymers migrate towards the anode when placed in an electric field. The lattice present in SDS-PAGE gels separatesLPS chains into molecules of similar chain lengths that migrate in discrete bands. When stained, these bands appear as rungs in a ladder with each “rung” differing by one oligosaccharide unit. The patterns produced by various strains of bacteria form the basis of LPS chemotyping. This chapter describes the methods and techniques necessary for extracting LPS from bacteria and the subsequent analysis by SDS-PAGE and silver staining. For a detailed description of the procedures involved in performing SDS-PAGE, the reader is referred to Chapter 4 of this book. 2. Materials
1. Culture media: Grow the bacteriausing mediasuitablefor the speciesunder investigation. Bacteria grown in broth or on agar can be used. 2. SDS-PAGE solubilization buffer: 62.5 mM Tns-HCI, 10% (v/v) glycerol, 3% (w/v) SDS, 5% (v/v) mercaptoethanol, and 0.01% (w/v) bromophenol blue. 3. SDS-PAGE solubilization buffer/proteinaseK: SDS-PAGE buffer containing 100 pg of proteinaseK/30 pL. 4. Silver stain fixing solution: 40% (v/v) methanol, 5% (v/v) acetic acid. 5. Silver stain oxldizmg solution: 0.7% (w/v) periodic acid m fixing solution. 6. Silver nitrate: 20% (w/v) In deionized water. 7. Ammonium solution (concentrated). 8. O.lM NaOH.
44
Chart
9. Silver staining solution: 28 mL of O.lM sodmm hydroxide mixed with 2 mL of ammonium hydroxide followed by 5 mL of 20% silver nitrate solution. Make the volume up to 150 mL with deionized water, mix, and use wrthin 5 min of preparation. 10. Silver stain developer solutron: 50 mg citric acid, 0.5 mL formalin in 1 L deionized water (prepared freshly). 11. Gel storage solutron: 10% (v/v) acetic acid. 12. Sodium sulfite solution: 20% (w/v) in deionized water.
3. Methods 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12.
3.1. Bacterial Culture and Preparation of LPS Streak the bacteria onto agar plates. Select representative colonies and inoculate broth or plate cultures. For the analysis of broth-cultured bacteria, harvest 1 mL of saturated bacterial suspension at 12,000g for 10 mm m a preweighed Eppendorf tube. Discard the supernatant and remove all the excess liquid wrth a tapered piece of filter paper. For agar-grown bacteria, transfer a loop full of culture to preweighed Eppendorf tubes. Reweigh Eppendorf tubes and calculate the weight of the bacteria; a cell mass of l-2 mg IS sufficient for most species of bacteria (see Notes 1 and 2). Add SDS-PAGE solubihzation buffer to give a final concentration of 1 mg of bacterial mass per 30 pL of solubihzation buffer. Seal the tubes with screwcaps and mix with a vortex mixer to ensure that the bacterra are in suspension. Incubate the tubes in a boiling water bath for 10 min with occasional mixmg; this step ensures that the major outer membrane protems denature and become accessrble to subsequent proteinase K digestion. Meanwhile, prepare a fresh set of Eppendorf tubes contammg 30 p,L of SDS-PAGE solubrlization buffer with 100 pg of protemase K. Remove the tubes (step 9) from the boiling water bath and transfer 30 FL of bacterial suspension to the tubes containing the 30 PL of solubilization buffer/proteinase K. Seal the tubes with screwcaps and mcubate them at 60°C for at least 2 h.
During the proteinase K digestion, prepare an SDS-PAGE gel. 3.2. Analysis of LPS by SDS-PAGE 1. Prepare a 12.5% SDS-PAGE gel with a 4.5% stacking gel (see Chapter 4; see Notes 3 and 4).
Lipopolysaccharide
Chemotyping
45
2. Remove the bacterial preparations from the 60°C incubatorandcentrifugeat
12,OOOg for 5 s in order to collect condensationfrom the walls of the tubes. 3. Load 30 p.L of preparation per lane of the gel. 4. Apply a constant current of 50 mA until the dye-line reaches a point 1 cm from the bottom of the gel. 5. Wearing rubber gloves, remove the gel from the glass plates, place it in a clean plastic box containing approximately 200 mL of fixing solution and mix gently for 2 h to overnight (see Note 5). 3.3. Gel Staining Gel staining should be carried out near the photographic equipment as
the silver-stained bands reach and pass their optimum quickly (see Note 6). 1. Remove the fixing solutron from the gel, replace it with 100 mL of oxidizing solution, and rock for 5 min. 2. Remove the oxidizing solution and wash the gel with approximately 200 mL of deionized water (three times for 15 min). 3. During the last washing step, prepare the silver stain (see Note 7) and dis-
pense it mto another clean plastic box (with a tightly fitting lid). 4. Carefully transfer the gel into the staining solution, put the lid on the box, and rock for 10 min. 5. Discard the staining solution and wash the gel with deionized water (three times for 10 min). 6. During the last washing step, prepare 1 L of developing solution (see Note 8) and place 200 mL into a third clean plastic box. 7. Transfer the gel to the box containing developing solution and rock the box by hand while holding over a light box. 8. When the LPS bands have become fully stained, place the gel into 10% (v/v) acetic acid for storage. 3.4. Photographing Gels 1. Set up a camera containing Polaroid 55 film (provides a print and a negative), with a 1:5,6,f= 105 mm lens; use a setting off= 22 and a Wratten ND filter (1 .OO). 2. Prepare a tray containing 20% (w/v) sodium sulfite. 3. As the LPS bands reach the desired level of staining, carefully place the gel on light box, excluding any air bubbles, and photograph it. 4. Soak the negatives m sodium sulfite solution for 15 min. 5. Wash the negatives in running tap water, rinse in deionized water, and hang them to dry.
It may be necessary to take a series of photographs during the development reaction.
46
Chart
Fig. 2. Examples of LPS chemotypes as detected by proteinase K digestion and SDS-PAGE/silver staining of LPS prepared from S. enteritidis (lanes 1 and 2), E. coli (lane 3), and Y. enterocolitica (lane 4). Note the ladder pattern created by long-chain LPS polymers separating into bands comprising chains with similar repeating sugar units (lane 1). This contrasts with the LPS chemotype obtained with a bacterium unable to express LPS (lane 2). Considerable variation can be detected in the numbers and migration of LPS bands (lanes 1 and 3), and in certain bacteria LPS profiles may not migrate as discrete bands (lane 4). 3.5. Results Examples of LPS chemotypes are shown in Fig. 2. Lane 1 shows longchain LPS, expressed by S. enteritidis, with chains composed of equal numbers of sugar units separating together to give a banded profile resembling the rungs of a ladder (see Note 9). Lipid A-core LPS migrates very near the dye-front and stains very intensely, appearing as an almost black region. The profile in lane 2 shows the LPS from a strain of S. enteritidis that does not express long-chain LPS; although LPS “rungs” cannot be detected, lipid A-core can be seen as a black band on the dyeline. Gram-negative bacteria express LPS with a diverse range of carbohydrate chain lengths. For example, compare the LPS expressed by S. enteritidis (lane 1) with that of a strain of E. coli (lane 3). The profile
Lipopolysaccharide
Chemotyping
47
illustrated in lane 4 shows an LPS profile obtained with a strain of Yersinia enterocolitica belonging to serogroup 09. Note that the LPS migrates as only two bands near the dye-line, whereas the remaining carbohydrate moiety, as stained by the silver staining reaction, does not migrate as discrete bands (see Note 10). 4. Notes 1. The amount of bacterial mass required to give a perfect LPS profile may depend on the speciesof bacteria under investigation. LPS extracted from 500 ltg of bacterial mass can be used for an initial investigation, and this preparation can be serially diluted across a gel to determine the optimal loading. 2. LPS profiles can be obtained from single bacterial colonies if sufficiently large. 3. Because of the sensitivity of the silver staining reaction, the smallest particles of dust entering SDS-PAGE gel solutions appear on gels as black dots that can cause black streaks down gels. These dust particles can be avoided by wiping gel plates with a soft brush prior to assembly. Also, when preparing SDS-PAGE gels, mix all gel constituents, with the exception of the TEMED catalyst, in a beaker prior to passage through a Millipore filter (0.45 pm pore size) into a dust-free Buchner flask. Following degassing, the catalyst can be added and the gel solution transferred into the assembled gel plates. 4. Although perhaps not directly related to the analysis of bacterial LPS, it should be noted that SDS-PAGE gel plates and microsyringes used for the analysis of LPS can become impregnated with proteinase K. If these are used for the subsequent analysis of bacterial proteins, digestion of proteins can occur and results in protein profiles that are lacking high molecular weight bands. 5. SDS-PAGE gels should always be handled with latex gloves to avoid fingerprints appearing on the stained gel. Also, during the various washing and staining steps, avoid touching the center of the gel because pressure marks can also appear when gels are stained. 6. When staining LPS gels, the staining reaction reaches an optimum and then continues to develop resulting in an over stained gel. Although placing gels in 10% (v/v) acetic acid stopsthe development reaction, LPS bands gradually fade and become unsuitable for photographing. Photographing gels at the optimal point in gel staining gives the best results. 7. In the preparation of the silver stain ensure that the ammonia solution is comparatively fresh and ensure that the dissolved ammonia has not evapo-
Chart
48
rated during prolonged storage. The use of a weak ammonia solution results in a brown-black precipitate when the silver nitrate solution is mixed with the ammomum hydroxide-sodium hydroxide solution. This can be rectified to some degree by the addition of more ammonium hydroxide. 8. When preparing developing solution ensure that the formalin is fresh. With prolonged storage, dissolved formaldehyde evaporates from solutions of formalm and the use of this reagent results in poor development of the silver stain reaction. 9. When interpreting LPS profiles, bear in mind that the rungs of the LPS ladder relate to the degree of chain polymerrzatron and not molecular mass. Although bands mtgratmg near the top of the gel are composed of larger LPS molecules than those migrating lower down in gel profiles, there is no direct “linear” correlation between molecular mass and distance traveled by bands. 10. For certain species of bacteria, the LPS profile may appear smeared. This may be caused by mcomplete digestion with protemase K and can be remedied by extendmg the duration of reaction with proteinase K. References 1. Tsai, C. M. and Frasch, C E (1982) A sensitive silver stain for detecting lipopolysaccharide in polyacrylam~de gels. Anal. Biochem. 119, 115-l 19.
2. Hitchcock, P. J. and Brown, T. M. (1983) Morphological heterogeneity among Salmonella hpopolysaccharide J Bacterial 154,269-277
chemotypes in silver-stamed polyacrylamide
gels.
CHAPTER6
of Bacterial
Analysis Outer Membrane Henrik
Proteins
Chart
1. Introduction The cell envelope of Gram-negative bacteria comprises an inner and an outer membrane separated by a layer of peptidoglycan (Fig. 1). The inner membrane is the site of biochemical reactions involved in respiration and oxidative phosphorylation, and the synthesis of structural membrane components. In contrast, the outer membrane forms a physical barrier between the inside of the bacterial cell and the external environment, and contains elements involved in the binding and transmembrane transportation of components required for bacterial biochemistry. Proteins play major roles in the structure and function of the outer membrane, some of which are described in Table 1. Certain proteins are always present in the outer membrane (regardless of the bacterial environment) and are considered to be expressed “constitutively.” These include some of the pore-forming proteins that make up the general pores involved in the passage of molecules across the outer membrane, and lipoprotein that anchors the outer membrane to the peptidoglycan layer (Table 1). In contrast, certain outer membrane proteins are synthesized and inserted into the outer membrane only under certain environmental conditions, and are termed “inducible.” These inducible proteins include, for example, those involved in high affinity iron sequestering, the uptake of phosphate and vitamin Bi2 (Table 1). From Methods m Molecular Biology, Vol 46. Dlagnostlc Bacteriology Protocols Edited by. J Howard and D M Whrtcombe Humana Press Inc., Totowa, NJ
49
MAP
Oufef
1111111
membrane
Pe,otidog/ycan hnef
Porin
Inducible proteins
proteins
Major outer membrane proteins
membrane
CFEI
Membrane associated proteins
0
Minor outer membrane proteins
Fig. 1. Schematic representation of the cell envelope of Gram-negative bacteria. The outer membrane (OM) is a lipid bilayer into which are inserted major outer membrane proteins (MOMPs), inducible proteins (IP), and transmembrane pore proteins in addition to several minor proteins. Certain bacterial species express membrane-associated proteins in the form of surface layers.
Table 1 Outer Membrane Proteins Constitutive proteins
Mol mass, kDa 7.2
Lipoprotein OMP A OMPC OMP F OMPD Phage T receptor
33-35 36-38 36-38 34-38 26
Function Anchoring outer membrane peptidoglycan General pore for hydrophilic General pore for hydrophilic General pore for hydrophilic General pore for hydrophilic Uptake of nucleosides
Growth conditions for induction or derepression
Mol mass, kDa
PHO E
Phosphate limitation
37-40
LAM B
Presence of maltose
47-50
BTUB CIR FHUA FEC A FEPA
VrtaminBlz Ferric Iron Ferric iron Ferric iron Ferric iron
limitation limitation limitation limitation
60 74 78 80 81
FIU
Ferric iron limitation
83
Inducible proteins
Phage/plasmid
Mol mass, kDa
LOM TRAT
Prophage lambda Prophage lambda
20.5 25
Protein-2
Prophage PA2
38
Protein K COLV
Plasmid Plasmid
40 74
Phage/plasmidencoded proteins
Membrane-associated proteins
Mol mass, kDa
Fimbriae
12-20
Flagella Surface layers
70 N/A
to solutes solutes solutes solutes
Function Pore for uptake of polyphosphates Pore for uptake of maltose and maltodextrins Uptake of vitamm B,, Uptake of ferric iron??? Receptor for ferrichrome Receptor for ferric citrate Receptor for ferric enterochelin Uptake of ferric iron??? Function Unknown Surface exclusion, prevents F-factor carrying donor cells from forming stable mating aggregates Replaces existing phage receptor pore-protein with a new nonreceptor general pore-protein ???? Ferric aerobactin Function
Attachment to eukaryotic cells and various surfaces Structures used for motility Protection from phagocytosis???
52
Chart
Some of the methods used to obtain outer membrane proteins may also isolate membrane-associated protein structures, such as flagella, fimbriae, and surface protein layers (1) (Table 1). Methods for the analysis of these proteins are presented in the later sections of this chapter. For further information concerning bacterial outer membrane proteins, the reader is referred to the reviews by Inouye (2) and Lugtenberg and Van Alphen (3). Over the years, workers studying bacterial outer membrane proteins have inadvertently created considerable confusion in the nomenclature used to identify and label these proteins; to help clarify this confusion, the reader is referred to the review by Osbourne and Wu (4). This chapter describes some procedures used for the examination and characterization of outer membrane proteins. The methods described have been developed for use with Escherichia coli and some experimental parameters may need to be altered to suit other bacteria. For the examination of inducible outer membrane proteins, bacteria need to be cultured in specialized media that will result in the expression of proteins of interest. As an example, the outer membrane proteins involved in the high affinity uptake of iron by E. coli are described. This involves the culture of E. coli under inducing conditions (in the presence of an iron chelator), isolation of outer membrane proteins, protein quantitation, and, after sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE, described in Chapter 4), analysis of the protein profile. 2. Materials 1. Culture media: For the examination of constitutive outer membrane proteins, bacteria should be grown m a medium suitable for the species under mvestigation; for example, strains of E. coli grow well in nutrient broth, tryptrcase soy broth, and brain heart infusion broth. Prepare sohd media by the addition of agar to 1.5% (w/v). In this case, the culture medium is trypticase soy broth (TSB) supplemented with desferrioxamine (Desferal, CIBA-Geigy Ltd., Horsham, Sussex, UK) at a final concentration of 1 mg/mL. The appropriate amount of Desferal is first dissolved in a small volume of sterile TSB and sterilized by Millipore filtration (0.45 pm) and added to the remainder of the sterile medium. For other strains or media, different concentrations of Desferal may be required. Empirically determine this concentration before starting a set of experiments on a novel organism. 2. 25 mM Tris-HCI, pH 7.4. 3. 25 mA4Tris-HCl, pH 7.4, 1 mM EDTA.
Bacterial 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14.
15.
Outer Membrane
Proteins
53
Sodium lauryl sarcosinate (Sarkosyl, BDH Ltd., Poole, Dorset, UK). 10 mM Tris-HC1 pH 7.4,2% (w/v) SDS, 10% (v/v) glycerol. Lowry protein standard: 1 mg/mL bovine serum albumin (BSA). Lowry solution A: 2% (w/v) Na2C03 in O.lM NaOH. Lowry solution B: 0.5% (w/v) CuS04 in 1% (w/v) Na-K tartrate. Lowry solution C: 1 mL of solution B in 50 mL of solution A (prepare immediately before use). Lowry solution D: 1N Folm-Ciocalteau reagent. 0.15MNaCl. Broth-Saline: 0.15M NaCl containing 10% (v/v) TSB. SDS-PAGE solubilizatlon buffer: 62.5 mM Tris-HCl, 10% (v/v) glycerol, 3% (w/v) SDS, 5% (v/v) mercaptoethanol, 0.01% (w/v) bromophenol blue, A centrifuge, with: a. A 6 x 250 mL rotor, capable of acentrifugal force of 5000g at a constant temperature of 4°C; and b. An 8 x 50 mL rotor, capable of a centrifugal force of 45,000g at a temperature of 4°C. A sonicator, with a 1-cm diameter sonic probe, capable of generating 150 W such as a Model W-250 from Heat Systems-Ultrasonics Inc. (New York).
3. Methods 3.1. Bacterial Culture 1. Streak the bacteria on to agar plates and select representative colonies for inoculating culture broths. 2. Grow the bacteria in 10 mL of iron-replete TSB (37OC, 16 h, static). 3. Add the entire 10 mL of culture to 150 mL of iron-replete TSB m a 250mL flask and incubate for 3 h (37”C, static). 4. Aseptically remove 10 mL of bacterial culture and pellet the cells by centrifugation at 5000g for 15 min m a sterile centrifuge tube. 5. Resuspend the bacterial pellet in broth-saline and determine the absorbance at 621 nm (A&. Estimate the cell density using a standard graph, plotting culture AhZ1agamst viable count. 6. Use the broth-saline suspension to inoculate 150-r& vol of TSB containing Desferal using an initial bacterial density of lo6 bacteria/ml. 7. Incubate for 6 h at 37”C, with shaking (120 rpm). 8. Harvest the bacteria by centrifugation at 5000g for 30 min at 4OC. 9. Wash the bacterial pellets in 100 mL of ice-cold 25 mM Tns-HCl, pH 7.4. 10. Recentrifuge (step 8), and store the pellets at -30°C.
3.2. Preparation
of Outer Membranes
1. Place an 8 x 50 mL centrifuge rotor at 4°C to cool. Thaw the bacterial pellets and keep them on ice.
Chart
54
Sonicator probe Sonicator vessel Bacterial suspensio
-Ice
bath
Fig. 2. The use of sonication as a means of breaking bacteria. Placing the sonicator probe close to the bottom of the sonicator probe increases the efficiency of cell rupture, and immersing the sonicator vessel in ice protects the bacterial suspension from excessive heating. 2. Place 20 mL of ice-cold 25 mM Tris-HCl, pH 7.4, in 50-mL centrifuge tubes, and bury in ice. 3. Resuspend the bacterial pellets in 5 mL of ice-cold 25 mM Tris-HCl, pH 7.4, containing 1 mM EDTA and transfer them to the sonication vessel (see Notes 1 and 2). 4. Insert the sonication probe into the bacterial suspension (Fig. 2) and clamp the sonication vessel so that the probe tip is approximately 5 mm from the bottom of the vessel (see Note 3); ensure that the sonication vessel is surrounded with ice. 5. Sonicate (150 W) for 3 min (see Notes 4-7). 6. Pour the sonicated bacteria into the prechilled 20-mL volumes of 25 rnM Tris-HCI pH 7.4. 7. Pellet any residual whole bacteria by centrifugation at 5OOOgfor 30 min at 4OC, no brake. 8. Decant the supernatant, containing the bacterial envelopes, into fresh centrifuge tubes ensuring that whole bacteria do not pass across.
Bacterial
Outer Membrane
Proteins
55
9. Harvest bacterial envelopes by centrifugation at 45,OOOgfor 1 h at 4°C. During this centrifugation step, switch on the spectrophotometer and set the wavelength to 280 nm. 10. After centrifugation, discard the supernatants, invert the tubes, and allow them to drain (see Note 6). 11. Resuspend the envelope pellets in 1 mL of 25 mA4Tris-HCI, pH 7.4, using a l-n& Gilson (Paris, France) pipet with a 1-mL plastic tip. 12. Add 19 mL of 25 mM Tris-HCl, pH 7.4, and mix. 13. Place a portion of the mixture into a quartz cuvet and measure the absorbance (AZ&. Calculate the protein concentration based on the formula: 1 absorbance unit (A2s0) is approximately equivalent to 1 mg/mL of protein; multrply the absorbance by 20 to give the total protein content of the cell envelope preparation. 14. Return the contents of the cuvet to the centrifuge tube and solubilize the inner membranes by adding 20 FL of Sarkosyl (5) for every milligram of protein. 15. Securely cap the tubes and attach them, horizontally, to a shaker and mix vigorously (200 rpm) at room temperature for 30 min. 16. Harvest the outer membranes by centrifugation at 45,000g for 1 h at 4”C, and discard the supernatants. 17. Wash the pellets in 30 mL of ice-cold 25 mM Tris-HCl, pH 7.4, and recover the outer membranes by centrifugation at 45,OOOg,4°C for 1 h, as before. 18. Resuspend the outer membrane pellet in 20 I.LL of 25 rnM Tris-HCl, pH 7.4, and determine the protein content using the Lowry method (6), as described in Section 3.4., and store at -30°C. 3.3. Other
1. 2. 3. 4. 5. 6. 7. 8.
Cell Envelope Structures and Proteins 3.3.1. Membrane-Associated Proteins Grow bacteria by spreading onto a g-cm agar plate. Incubate the bacteria at the appropriate temperature for the appropriate length of time. Harvest the cell by scraping them off the surface into a 1.5-n& Eppendorf tube with a screwcap. Resuspend the bacterial harvest in 1.5 mL of 0.15M NaCI. Incubate at 60°C for 30 min. Pellet the bacteria by centrifugatron at 12,500g for 10 min. Remove and retain the supernatant. Determine the protein content (see Section 3.4.) prior to storage at -1OOC or below.
Chart
56 3.3.2. Pore-Forming 3.3.2.1. HEAT MODIFIABLE PROTEINS
Proteins
Certain bacterial proteins occur as complexes in the cell envelope. For example, pore-forming proteins (porins) exist in the outer membrane as complexes comprising three or four subunits arranged to form a channel through which various solutes may pass. At room temperature, these complexes remain intact and are too large to enter a 12.5% separation gel, and these proteins are not observed. However, at higher temperatures, depending on bacterial species, these protein complexes dissociate into their constituent protein subunits which have molecular masses that permit them to enter 12.5% SDS-PAGE separation gels. This heat modifiable property is particularly characteristic of porin proteins. 1. Prepare five replicate outer membrane protein preparations (60 l.tg of protein in 60 j.tL of solubilizatton buffer). 2. Incubate the samples for 10 min at 20,40,60, 80, or 100°C. 3. Pulse-spm the tubes to collect the condensation. Samples are now ready for SDS-PAGE. 3.3.2.2. PEPTIDOGLYCAN ASSOCIATION
Pore-forming proteins are transmembrane and are linked noncovalently to the peptidoglycan layer. This method can be used to determine whether specific outer membrane proteins are peptidoglycan associated. 1, Thaw the bacterial envelope preparations. 2. Resuspend each pellet in 20 mL of 10 mM Tris-HCl, pH 7.4, containing 2% (w/v) SDS and 10% (v/v) glycerol. 3. Incubate the preparations at 60°C for 30 min. 4. Collect the peptidoglycan and associated outer membrane proteins by centrifugatton at 45,OOOgfor 1 h at 4°C. 5. Resuspend the resultant pellet m 200 FL of Tris-HCl, pH 7.4. 6. Perform a protein assay and analyze preparations by SDS-PAGE. 3.4. Quantification of Protein Using the Lowry Method 1. Dilute 1 mL of protem standard in 4 mL of deionized water to give 5 mL of solution containing 200 pg/rnL BSA. 2. Place 0.25 mL (50 pg of BSA), 0.50 mL (100 pg of BSA), 0.75 mL (150 /Lg of BSA), and 1 mL (200 pg of BSA) of preparation Into 10-r& test tubes, and make each of the first three tubes up to 1 mL with deionized water, a fifth tube with 1 mL of deionized water alone constitutes the blank. 3. For preparations of membrane proteins, mix 20 PL of preparation with 0.98 mL of deionized water.
Bacterial
Outer Membrane
Proteins
57
4. To each tube add 5 mL of Lowry reagent C, mix well, and allow to stand for 10 min. 5. To each tube add 0.5 mL of IN Folin-Ciocalteau reagent and mix well. Leave tubes to stand for 30 min for color development. Meanwhile, switch on a spectrophotometer set to measure the absorbance at 500 nm (Asac) and allow instrument to stabilize. 6. Calibrate the spectrophotometer using the deionized water blank and measure the absorbance (A,,,) of standard and test samples. 7. Plot a standard graph with A 500on the “Y” axis and the protein concentration of standard preparations on the “X” axis, this should produce a straight line through the origin. 8. To determine the protein concentration of the membrane preparations, assay the samples and read the values from the standard graph. Multiply this value by 50 to give the concentration of protein in mg/mL, whtch is equivalent to pg/pL. If the protein concentrations of membrane preparations exceed the highest point on the standard graph, dilute the samples in deionized water and retest. 3.5. Analysis of Proteins by SDS-PAGE 3.5.1. Gel and Sample Preparation 1. Prepare an SDS-PAGE gel comprising a 12.5% separation gel and a 4.5% stacking gel. 2. Prepare the outer membrane samples in a 0.5-mL Eppendorf tube by mixing 60 pg of outer membrane protein preparation with SDS-PAGE solubilization buffer to give a final volume of 60 pL (see Note 8). 3. At the same time, prepare a set of protein molecular weight standards with a range of 14.4-97.4 kDa. 4. Heat the samples in a boiling water bath for 10 min; pierce the tops of the Eppendorf tubes to prevent the tops from popping open. 5. Pulse-spin the tubes in a centrifuge at 12,000g for 5 s to collect any condensation, and load 30 uL of preparation (30 ug of protein) per well 6. Run the gel at 50 mA until the dye-line has reached a point 1 cm from the end of the gel. 7. Remove the gel from the apparatus, stain with Coomassie blue, and destain prior to examinatton of protein profiles using a light box. 3.5.2. Determining the Molecular Weight of Proteins by SDS-PAGE 1. Measure the relative mobility (distance migrated by protein/distance migrated by dye-line) of the protein standards and sample proteins. 2. Plot the loglo of the molecular mass of the protein standards (Y-axis) against their relatrve mobility.
Chart 3. Use the standard curve thus generated to determine the sizes of the proteins in the samples. For optimal determination of the molecular mass of proteins of interest, adjust the protein loading to give very fine bands for which the relative migration can then be most accurately measured. This is particularly necessary for determinmg the molecular mass of the major outer membrane proteins that migrate as wide bands when applying 30 FL of outer membrane protein preparation per lane. It should be emphasized that SDS-PAGE can only give an estimate of molecular weight, and the values can not be considered as absolute. Beware of repeatedly freezmg and thawing the samples (see Note 9).
3.6. Typical
Results
and Their Interpretation
Take care when analyzing outer membrane proteins as certain cell-associated external structures can be visualized on SDS-PAGE and may complicate the analysis (see Note 10). The profiles in Fig. 3 show the outer membrane protein profiles of strains of Vibrio cholerae (lane l), E. coli (lane Z), Salmonella enteritidis (lane 3); note that these organisms express 1,2 and 3 major outer membrane proteins (MOMPs), respectively (arrowed). With reference to the
migration of standard proteins (lane S), the molecular masses of these outer membrane proteins were determined (see Note 11). Each class of protein is discussed separately later. 3.6.1. Inducible
Proteins
Certain outer membrane proteins are only expressed in the presence or absence of a specific compound (see Table 1). When strains of E. coli are grown in iron-replete media, iron-regulated outer membrane proteins are not expressed (Fig. 3, lane 6); however, under iron restriction, at least four iron-regulated outer membrane proteins, of 78, 81,84, and 96 kDa, are produced (bracketed in Fig. 3, lane 7). 3.6.2. Heat-Modifiable
Proteins
Lanes 3 and 4 of Fig. 3 show the outer membrane protein profiles of a strain of S. enteritidis, following incubation at 100” and 37”C, respectively. Note the presenceof three MOMPs in the high temperature-treated sample, whereas the porin proteins OMP C, OMP F, and OMP A did not
enter the gel when incubated at the lower temperature. 3.6.3. Peptidoglycan
Linkage Figure 3 (lane 5) shows that a strain of S. enteritidis expresses two outer membrane proteins that are linked to peptidoglycan. These two proteins,
Bacterial
Outer Membrane 1
2
3
Proteins 4
5
59 6
7
a
Fig. 3. SDS-PAGE profiles of bacterial outer membrane proteins stained with Coomassie blue. Strains of V. cholerue (lane l), E. coli (lane 2), and S. enteritidis (lane 3) express one, two, and three MOMPs respectively. The three MOMPs of S. enteritidis are heat modifiable because all three are observed when outer membranes were incubated at 100°C prior to SDS-PAGE (lane 3), whereas these outer membrane proteins did not enter the separation gel when preincubation was carried out at room temperature (lane 4). Two of these outer membrane proteins (OMP C and OMP F) were shown to be peptidoglycan associated (lane 5). When grown in iron-replete media, the strain of E. coli does not express iron-regulated outer membrane proteins (lane 6). However, when grown in the presence of Desferal, four iron-regulated outer membrane proteins are expressed (bracketed in lane 7). Protein standards are indicated in kilodaltons.
termed OMP C and OMP F, respectively, are the subunits of pore-forming proteins that also possess heat-modifiable properties (see Section 3.6.2.). 4. Notes 1. When sonicating bacteria, enclose the sonic probe in a category 3, negative-flow hood to draw potentially harmful bacterial aerosols away from the operator.
Chart 2. When disruptmg bacteria by somcation, use a thick-walled glass tube (as shown in Fig. 2) and 5 mL of bacterial suspension. Do not use larger volumes of preparation, because the efficiency of disruption decreases as the volume of liquid increases. 3. Make sure probe is not m contact with the vessel or the glass may shatter. 4. As the bacteria disrupt, the suspension becomes clear and the probe becomes visible. If the bacteria do not disrupt readily, place the sonication vessel on tee to cool and repeat the sonication after 10 min. 5. When preparing large quantities of outer membrane proteins, process bacteria m batches and do not combine the bacterial yields from several flasks into a single sonication vessel. The efficiency of sonication decreases as the bacterial density increases. If certain speciesof bacteria are difficult to disrupt, decreasing the bacterial density may facilitate cell breakage. 6. Following sonicatron of bacteria, whole cells are recovered by centrifugation and the supernatant removed for the isolation of cell envelopes; considerable care must be taken to ensure that whole cells do not enter the cell envelope fraction. The successof this step can be assessedby examining the cell envelope pellet followmg centrtfugation. A completely clear pellet is indicative of a pure envelope pellet. However, a translucent dot in the center of the envelope pellet suggests the presence of whole bacteria and resuspension of the pellet and subsequent centrifugation at 5000g for 30 min at 4°C is recommended. 7. Certain species of bacteria, such as those belonging to the genus Klebsiella, produce capsules that cause sonicated bacterial preparations to become very viscous. This viscosity interferes with the sonic disruption of bacteria and the sedimentation of unbroken cells. Sonicatmg replicate preparations of diluted bacterial suspensions facilitates the disruption of bacteria. The centnfugation and washing stepsfor removing whole bacteria may need to be repeated several times to ensure an envelope pellet free from capsular material and whole bacteria. 8. For SDS-PAGE, mix 60 pg of protein preparation wtth sufficient solubilizatton buffer to give a final volume of 60 pL, Followmg mcubation at 100°C for 10 min, collect the condensation by brief centnfugation and load 30 /JL of preparatton per lane of the SDS-PAGE gel; the protein loading can be altered, depending on protein band resolution. 9. The process of preparmg outer membranes releases cell-associated proteases that may digest certain outer membrane proteins and cause artifacts m protein proftles. The action of proteolytic enzymes on membrane proteins can go unnoticed. However, as outer membrane preparations are repeatedly thawed and frozen in the courseof analyzmg replicate SDS-PAGE profiles, protems affected by proteases are digested and become poorly
Bacterial
Outer Membrane
Proteins
61
resolved, appearing as fuzzy bands. If proteolysts of membrane proteins is suspected, protein digestion can be prevented by mcorporating protease inhibitors in solutions used during the preparation and storage of outer membranes. For general purposes, 1 miI4 phenyl-methyl-sulfonyl-fluoride (PMSF) and 1 m&I (EDTA) can be used. PMSF and many other protease inhibitors are extremely toxic and should be prepared freshly in small quantities and used with considerable care. 10. Some of the procedures used for the examination of outer membrane protein; may also isolate membrane-associated protein structures such as flagella, fimbnae, and surface protein layers (Table 1). The protein constituents of these structures will appear on SDS-PAGE gels as bands that might be mistakenly considered true outer membrane proteins. Flagella and fimbriae can be readily isolated from a variety of bacterial species, and examination of bacteria for these structures may help to elucidate the outer membrane topography. 11. A separation gel comprismg 12.5% acrylamide can be used to examme most outer membrane
proteins; however, proteins with molecular
weights
of approximately 20 kDa or less should be examined using a 20% separation gel (see Chapter 4). Conversely, proteins of greater than 100 kDa should be examined usmg a 10% separation gel.
References 1. Beveridge, T J. and Graham, L L. (1991) Surface layers of bacteria Microbic/. Rev. 55,684-705.
2. Inouye, M. (1979) Bacterial Outer Membranes, Biogenesisand Function. Wiley, New York. 3. Lugtenberg, B and Van Alphen, L (1983) Molecular architecture and functioning of the outer membrane of Escherichia coEiand other Gram-negative bacteria. Biothem. Biophys. Acta 737,51-l 15 4 Osbourne, M. J. and Wu, H. C P. (1980) Proteins of the outer membrane of Gramnegative bacteria. Annu. Rev Microbial 34,369-422. 5. Filip, C., Fletcher, G., Wulff, J. L , and Earhart, C. F. (1973) Solubilization of the cytoplasmm membrane of Escherichia coli by the ionic detergent sodium-lauryl sarcosinate. J. Bacterial. 115,717-722. 6. Lowry, 0 H., Rosebrough, N , Farr, A., and Randall, R (1951) Protein measurement with the Folin phenol reagent. J. Biol Chem 193,265-275
CHAPTER7
Multilocus Patrick
Boerlin
Enzyme
Electrophoresis
and Jean-Claude
Piffaretti
1. Introduction Multilocus enzyme electrophoresis (MEE) has been used extensively in the past in eukaryotic, and occasionally, prokaryotic genetics. It was only recently that the usefulness of MEE in bacterial genetics, systematits, and epidemiology, has been clearly demonstrated, essentially by the pioneering work of Selander and coworkers (1-3). Since then, numerous authors have been successfully applying MEE to an increasing number of bacteria. In MEE, cellular extracts are submitted to gel electrophoresis under nondenaturing conditions and enzymes are detected with specific staining methods (4,5). When beginning to study a new organism, one starts by looking for demonstrable enzymatic activities among a limited set of isolates with one or two electrophoresis buffer systems. Enzymes common to many species like those from the tricarboxylic acid cycle, peptidases, esterases, or those known to work well for related taxa are first examined. Less commonly used enzymes may have to be considered until enough different enzymes can be observed (15-30 is optimal). In MEE, starch gels are preferred to other electrophoresis media, such as polyacrylamide, agarose, or cellulose acetate. It has the great advantage over polyacrylamide of being nontoxic, and it is the only medium with which thick gels can be cut into several sheets, allowing three or four different enzymatic stains per gel. The migration of a protein in such gels is a function of its molecular mass, electrical charge, and conformation (4). These properties directly depend on its amino acid sequence. Thus, microbial strains From. Methods m Molecular Biology, Vol 46: Dfagnostrc Bacterrology Protocols Edlted by: J Howard and D. M Whltcombe Humana Press Inc., Totowa, NJ
63
64
Boerlin
and Piffaretti
exhibiting differences in the migration rate of an enzyme are considered to have different alleles at the corresponding gene locus. Because of their low significance among bacteria, posttranslational modifications and the fact that an enzymatic activity may be related to several loci are usually not taken into account in the interpretation of the results. Not all mutations at the DNA level have consequences for the amino acid sequence and modifications of the latter do not necessarily change the molecular mass of a protein or its charge and conformation under experimental conditions. Thus, strains showing identical migration patterns for one enzyme (electromorph) will not be distinguished by MEE, but may in fact have different alleles at that genetic locus. Electrical charge and conformation of a protein are also dependent on the pH and chemical composition of the gel and buffer. Thus, isoenzymes migrating at the same rate in one electrophoresis buffer system may be distinguished in another. Several buffer systems must therefore be tested on an extensive set of strains before a judicious choice of the most discriminative electrophoresis conditions for each enzyme can be made. This may also help to improve the sharpness of bands and allow the estimation of the overall variability at each locus. This choice is particularly important if distinction of closely related strains is intended, and usually results in the use of several buffer systems for one single study. In spite of these theoretical limitations, the diversity revealed by MEE is sufficient to allow differentiation of numerous electrophoretic types within a single microbial species (the combination of all electromorphs observed for a strain is called an electrophoretic type [ET]). This makes MEE a very powerful typing method for epidemiological research. In such studies, only the loci showing polymorphisms are used. The enzymes studied in MEE are usually metabolic enzymes not subject to direct selective pressure and thus to evolutionary convergence. The assessment of the allelic composition of microbial strains with MEE over a large number of enzyme loci and under optimal electrophoretic conditions gives an account of their respective overall genomic constitution and can be used in population genetics or taxonomy at the species level and below. For this purpose, an extensive set of randomly chosen detectable enzymes (15-30) should be used. The estimates of genetic relationships between ETs representing genotypes are usually well correlated with those from other more cumbersome methods, such as DNA-
Multilocus
Enzyme Electrophoresis
65
DNA reassociation experiments (6,7), MEE is therefore not only a very effective method for delineation of strains in epidemiology but also a powerful method in microbial population genetics. However, the diversity revealed by MEE is usually too high to infer information at the genus level or higher. In practice, bacterial isolates are purified to homogeneity and grown to provide sufficient material for analysis. The cells are lysed and the enzymes separated on starch gels using a variety of buffer systems. The gels are sliced in sheets and various enzyme activity stains performed on different slices of each gel. This enables strain to strain comparisons to be made for a range of genetic loci and gives an estimate of the relatedness of the isolates. 2. Materials 1. 2. 3. 4. 1.
2.1. Preparation of Cellular Extracts Lysate buffer (8): 10 n&I Trrs-HCI, 1 mA4 EDTA, 0.5 rnA4 NADP, pH 6.8. Store for several weeks at 4°C. Somcator with mrcrotrp. lo-mL Glass tubes with thick walls, such as Corex centrifuge tubes. Deep freezer (-SOY). 2.2. Electrophoresis Acrylic plastic molds for horizontal gels (17.7 cm width x 18.8 cm length
x 1 cm depth) 2. Hydrolyzed starch: The quahty of starch is cntrcal for use in MEE (starch hydrolyzed for gel electrophoresls from Connaught [Toronto, Ontario, Canada] IS optimal). 3. One-liter Erlenmeyer flasks with thick walls. 4. Several sets of electrophoresis apparatus consrstmg of two acrylic plastic tanks (23 cm x 9 cm x 5 cm hrgh) with platinum electrodes. These tanks are stuck parallel one to another on an acrylic plastic plate at a distance of 12 cm (Fig. 1, see Note 1). 5. Whatman (Maldstone, UK) Filter no. 3 cut in small pieces of 6 x 9 mm. 6. Amaranth solution: 1 mg/mL in lysate buffer. 7. Sponge wicks (20 x 20 cm). 8. Metal pans with bases slightly larger than surface of the gel mold. 9. Electrophoresls and gel buffers listed in Table 1.
These five buffer systems represent a good starting point when dealing with a new organism. Other buffer systemscan be found in Selanderet al. (8).
Boerlin
66
and Piffaretti
wick
Cathode
Spongb wick
Fig. 1. Schematic
representation
Anode
of the electrophoresis
system.
Table 1 Five Basic Buffer Systems for MEE Buffer system A B
C F
G
Electrophoresis buffer 83.2 g Trls base, 33.09 g citric acid monohydrate in 1 L water, pH 8.0 27 g Tris base, 18.07 g citric acid monohydrate, m 1 L water, pH 6.3 adjusted with NaOH 18 5 g boric acid, in 1 L water, pH 8.2 adjusted with concentrated NaOH 12 1 g Tris base, 11.6 g maleic acid, 3.72 g EDTA disodium, 2 03 g MgClx. 6Hz0 in 1 L water, pH 8.2 adjusted with 5.15 g NaOH 18.14 g KHzPOd, in 1 L water, pH 6.7 adjusted with concentrated NaOH
2.3. Staining
of Enzymatic
Gel buffer Electrophoresis buffer A diluted 1 29 in water, pH 80 0.97 g Tris base, 0.63 g citric acid monohydrate, m 1 L water, pH 6.7 adjusted with NaOH 9.21 g Tris base, 1.05 g citric acid monohydrate, in 1 L water, pH 8.7 Electrophoresis buffer F, diluted 1:9 in water, pH 8.2
1 5 g K2HP04, 0 25 g citric acid monohydrate, in 1 L water, pH 7.0
Activities
1. Slicing tray: an acrylic plastic plate (24 x 12 cm) with two higher rims (24 cm x 4 mm x 1 mm high, Fig. 2). 2. Metal saw, the blade of which has been replaced with a tightened thin wire (such as a violin or guitar string).
Multilocus
Enzyme Electrophoresis
67
Fig. 2. Method for slicing the gels. The plate for applying a regular pressure on the gel has been omitted for the sake of clarity. 3. Small plastic boxes resistant to acetone and other solvents (approx 20 x 10 x 1 cm high). 4. Agarose. The following stock solutions (indicated by footnote b in Table 2) in items 5-15 are used for several staining procedures and can be kept at 4°C for several weeks. 5. Tris: 0.2M Tris-HCl, pH 8.0. Unless otherwise stated, this is the Tris solution used in the buffers m Table 2. 6. Phosphate buffer: 10 mIt4 phosphate buffer, pH 7.0. 7. Glycine buffer: O.lM glycme, pH 7.5 (adjusted wrth KOH). 8. MgCl,: O.lM MgC12 in distilled water. 9. MnClz: 0.25M MnClz in distilled water. 10. NAD: 1% (w/v) NAD solution. 11, NADP: 1% (w/v) NADP disodium salt solution. 12. Phenazine methosulfate (PMS): 1% (w/v) in water. 13. Dimethylthiazol tetrazolium (MTT): 1.25% (w/v) in water. This product is very difficult to dissolve at this concentration and is used as a suspension rather than as a solution. Mix well before use. 14. Fixing solution: Acetic acid, methanol, and water (1:5:5). Keep at room temperature. 15. Buffers, solutions, substrates, and chromogen as described in Table 2. Depending on substances,chemicals have to be stored at room tempera-
Table 2 Staining Soluttons for 3 1 of the Most Studied Enzymes in Bactenologya ACO, aconitase, EC 4 2 1 3
ACP, acid phosphatase, EC 3.1.3 2 ADK, adenylate kmase, EC 2 7.4.3
aG, a-glucosidase, EC 3 2 1.20 ALDH, alanine dehydrogenase, EC 14.1.1 ALP, alkaline phosphatase, EC 3.1.3.1 CAT, catalase, EC 1.11.1.6
EST, esterases, EC 3 1 1.1 FUM, fumarase, EC 4 2.1.2 GDl, GD2, glutamate dehydrogenase, EC 1.4.1 2, EC 1.4 1.4 G6P, glucose 6-phosphate, dehydrogenase, EC 1.1 1.49 GOT, glutamate oxalate transaminase, EC 2.6 1.1 GPl , GP2, glyceraldehydephosphate dehyrogenase, EC 1 2 1 12, EC 12.1 9 HEX, hexokinase, EC 2.7 1 1
15 mL Tris-HCl,b 10 mL MgC12,b20 mg cis-aconitic acid, 5 U isocitric dehydrogenase purtfied from porcine heart, 1 mL NADP,b 0 7 mL PMSb 0 7 mL MTTb 50 mL 0.05M sodmm acetate pH 8.5, 50 mg a-naphthyl actd phosphate monosodium, 50 mg ~jlns~~~~~KaChosphosphate monosodmm, 20 mg 25 mL Tn~-Hcl,~ 1 mL MgCl,,b 100 mg glucose, 25 mg ADP, 0.5 mL NADP,b 1 mg hexokmase from bakers yeast, 15 U glucose 6-phosphate dehydrogenase from the yeast To&z, 0.7 mL PMS,b 0 7 mL MTTb 10 mL 0 1M phosphate-citrate buffer pH 4.0, 10 mg 4-methylumbelhferyl-a-n-glucostde 50 mL phosphate buffer,b 50 mg t.-alanine, 2 mL NAD,b 0 5 mL PMSb 1 mL MTTb 50 mL of 50 mM Tns-HCLb pH 8 5,1 g NaCl, 2 mL MgCl,,b 2 mL MnC12,b 50 mg P-naphthyl acid phosphate monosodium, 100 mg polyvmylpyrrohdone, 50 mg Fast blue BB salt Solution I* 50 mL of water containing 60 uL of a 30% (v/v) hydrogen peroxide solution, Solution II. 25 mL of a 2% (w/v) potassium femcyanide solution (freshly made) mixed Just before use with 25 mL of a fresh 2% (w/v) ferric chlorate hexahydrate solution 40 mL phosphate buffer,b 2 mL 1% (w/v) substrate solution,c 25 mg Fast blue RR salt 25 mL Tri~-Hcl,~ 50 mg fumaric acid-potassium salt, 50 U mahc dehydrogenase from pigeon breast muscle, 2 mL NAD,b 0.7 mL PMS,b 0.7 mL MITb 50 mL Tris-HCl,b 200 mg L-glutamic acid, 2 mL NAD for GDl or 2 mL NADPbfor GD2,0.5 mL PMSb 1 mL M’ITb 50 mL Tns-HChb 1 mL MgCl,,b 100 mg glucose 6-phosphate disodium salt hydrate, 1 mL NADP,b 0.5 mL PMS,b 1 mL MITb 50 mL Tns-HCLb200 mg L-asparticacid monosodmm salt, 140mg a-ketoglutartc acid disodmmsalt, 200 mg Fast blue BB salt 40 mL Tns-HCLb100mg fructose 1,6-diphosphate tetra (cyclohexylammomum)salt, 50 mg NazHAs047Hz0, 10U aldolasefrom rabbit muscle,2 mL NADb for GPl or 1 mL NADPb for GP2,O 5 mL PMSb 1 mL M’ITb 50 mL glycine buffer,b 2 mL MgCl,,b 200 mg n-glucose, 50 mg ATP, 10 U glucose6-phosphatedehydrogenasefor the yeast Ton&, 1 mL NADP,b 0 5 mL PMS,b 1 mL M’ITb
Table 2 (contznued) IDH, isocitrate dehydrogenase, EC 1.1 142 IPO and NDH, (see Section 3.6.) LDH, lactate dehydrogenase, EC 1.1.1.27 LAP, leucine ammopeptidase, EC 3.4.11 1 MDH, malate dehyrogenase, EC 1.1.1.37 ME, mahc enzyme, EC 1.1.1.40 MPI, Mannose-phosphate isomerase, EC 5.3.1.8
NSP, nucleoslde phosphorylase, EC 2 4 2.PEPl, PEPZ, peptldases, EC 3.4.-.-
PGI, phosphoglucose isomerase. EC 5.3.1.9 PGM, phosphoglucomutase, EC 5.4.2.2
50 mL Tri~-Hcl,~ 2 mL MgClz,b 2 mL 1M oL-isocitric acid trisodium salt, 1 mL NADP,b 0.5 mL PMS,b 1 mL MTTb 50 mL Tri~-Hcl,~ 2 mL MgClz,b 2 mL NAD,b 1 mL NADP,b 0.5 mL PMS,b 1 mL M’ITb 50 mL glycine buffer,6 330 mg oL-lactic acid lithmm salt, 2 mL NAD,b 0.5 mL PMS,b 1 mL MTTb 50 mL O.lM KH2P0, pH 5 5 (adjusted with NaOH), 1 mL MgCl,,b 30 mg L-leucine-j3-naphthylamlde hydrochloride, 30 mg Fast black K salt 40 n-L Tns-HClp 6 mL 2M malic acid:’ 2 mL NAD,b 0.5 mL PMS,b 1 mL MTTb 40 mL Tris-HCl,b 2 mL MgCl,,h 6 mL 2M mahc acld,d 2 mL NADP,b, 0 5 mL PMSb 1 mL MT?’ 25 mL Tris-HCl,b 1 mL MgC12,b 10 mg mannose 6-phosphate barium salt, 10 U glucose 6-phosphate dehydrogenase from the yeast Tortula, 50 U phosphoglucose isomerase type X from yeast, 2 mL NAD,b 1 mL NADP,b 0.7 mL PMS! 0.7 mL Ml? 25 mL phosphate buffer,b 20 mg mosine, 2 U xanthine oxldase from milk, 0.7 mL PMS,b 0.7 mL MTTb 25 mL Tri~-Hcl,~ 10 mg horseradish peroxidase type I, 10 mg snake venom from Crotalus atrox, 20 mg leucyl-glycyl-glycme for PEP1 or 20 mg phenylalanyl-leucine for PEP2 or 20 mg of any other smtable oligopeptlde, 0.5 mL MnC12,b 10 mg Odlamsldme dihydrochloride 25 mL Tris-HCl,b 0 5 mL MgCl,,b 1 mL NADP,b 10 mg fructose 6-phosphate dlsodium salt, 3 LJ glucose 6-phosphate dehydrogenase for the yeast Tort&a, 0.7 mL PMS,b 0.7 mL MTTb 5 mL Tns-HCLb 5 mL MgC12,b 25 mL water, 0.5 mL NADP,b 5 mg a-o-glucose l-phosphate disodium salt hydrate,e 50 U glucose 6-phosphate dehydrogenase from the yeast Torhda, 0.7 mL PMS,b 0.7 M’I?’ 30 mL Tri~-Hcl,~ 10 mL MgC12,b 15 mg 6-phosphoglucome acid barium salt, 1 mL NADP,b 0.5 mL PMS,b 1 mL MTTb 50 mL phosphate buffer,b 2 mL NAD,b 50 mg L-threonine, 0 5 mL PMS,b 1 mL MTTb
6PG, 6-phosphogluconate dehydrogenase, EC 1.1.1.44 THD,b threomne dehydrogenase, EC 1.1.1.103 aI’hesesolutions are those describedby Harris andHopkmson (5) and Selanderet al (S), slightly modified. EC numbers are those from the Enzyme Commission of the IntematlonalUnion of Bmchenustry bSeestock soluttons in Section 2 3 c1% (w/v) Solution in acetone of a-naphtyl acetate, P-naphtyl acetate, cr-naphtyl propionate, P-naphtyl propionate, a-naphtyl butyrate, or P-naphtyl butyrate. d268 g DL-malic acid and 16gNaOH m 100 mL water Caution: potentially dangerous reaction. ePreparatlon of G-1259 from Sigma contains enough glucose 1,6-dlphosphate lmpurltles for catalyzing PGM assay
Boerlin
70
and Piffaretti
ture, between 0” and 5°C or below OOC,following manufacturer’s instructions, Many of them represent a serious health hazard (irritating, corrosive, mutagenic, or carcinogenic) and must be handled with great care. Always wear gloves when staining gels and a mask when weighing some particularly dangerous substances (e.g., chromogens like PMS and MTI’).
3. Methods 1. 2. 3. 4. 5. 6. 1. 2. 3.
4.
3.1. Lysate Preparation Grow cells under optimal conditions for the organism to be studied until late log phase (see Note 2). Harvest the cells by centrifugation of the liquid culture or by scraping the plates. Resuspend the cells m 2 mL lysate buffer, transfer them mto glass tubes with thick walls, and chill on ice (from this point on, keep the samples on ice). Somcate the samples with a microtip plunged deep into the cell suspension. Use two sonication bursts of 30-40 s each and allow an interval of at least 30 s for cooling (see Notes 3 and 4). Pellet the cellular debris by centrifugation at 2O,OOOg,4OCfor 20 min, and distribute the supernatants containing the soluble enzymes into ahquots of approx 200 pL (see Note 5). Freeze them rapidly at -80°C. 3.2. Preparation of Starch Gels Thoroughly mix 400 mL of gel buffer with 45.7 g of hydrolyzed starch in a 1-L Erlenmeyer flask until the suspension becomes homogenous. Heat the rmxture over a Bunsen burner under constant and vigorous hand swirling until the suspensionbegins to boil and vapor develops (see Note 6). Degas the gel mix for -1 min or until only a few large air bubbles come out of the suspension and quickly pour it into the mold. If some au bubbles are trapped in the gel, quickly remove them with a Pasteur pipette before the starch sets (see Notes 6 and 7). Allow the gel cool at room temperature for 2 h and wrap it in a Saran plastic film. Avoid trapping air between the film and the gel. Store the gel overnight at 4’C before use (see Note 8).
3.3. EZectrophoresis 1. Thaw the lysates to be used and keep them on ice (see Note 9). 2. Pour 300-400 mL electrophoresis buffer (same system as gel buffer) m each tank of an electrophoresis apparatus. Immerse one sponge wick in each reservoir. 3. Fill a pan with ice.
Multilocus
71
Enzyme Electrophoresis
4. Unwrap half of a gel and cut a slit through it with a scalpel at a distance of 5 cm from the shorter side of the mold. 5. Place close to the slit, a ruler marked with 20, 6 mm-wide slots each separated by a gap of 3 mm. 6. Holding it with a pair of small forceps, dip a piece of Whatman filter (6 x 9 mm) into the amaranth solution and blot away the excess liquid on a clean paper towel. If the filter is overloaded, its contents may contaminate the neighboring sample. 7, Hold the right side of the slit open with a spatula and insert the filter paper into it to the bottom and right side of the mold. 8. Soak the next filter paper with the first lysate in the same way (without amaranth, which may inhibit enzymatic activity) and place it into the slit 3 mm on the left of the first filter. 9. Load all the samples on the gel (a total of 18 lysates) and use the last place on the left border for a second filter with amaranth. 10. Place the gel between the two tanks (samples on the cathode side) and use sponge wicks to connect the gel to the buffer. Lay the edge of the cathode wick on the gel surface only a few millimeters from the sample slit and the anode wick in the analogous position at the other end of the gel. 11. Cover the assembly with plastic film. 12. Place a third wet piece of sponge wick over this plastic film m the free space between the two first wick ends and cover with a second layer of plastic film. 13. Place an ice-filled pan over the gel assembly (see Fig. 1). 14. Apply a constant voltage for 4-8 h to the gel: Use 130 V for buffer systemA, 150 V for system B, 250 V for system C, and 100 V for systemsF and G. 15. Electrophorese the gel until the amaranth dye migrates 8 cm (see Notes 10 and 11).
3.4. Slicing
the Gel
1. After electrophoresis, remove the ice pan, all sponge wicks, and plastic foils. 2. Place the mold on a table and cut a slit through the gel symmetrically to the one containing the filters. Remember to cut a corner of the central portion to mark its original orientation (see Note 12). 3. Carefully take the central part of the gel between the slits out of the mold and remove the filter papers. 4. Dry the bottom of the gel on a clean paper towel and place it between the two rims of the slicing tray. Avoid trapping air bubbles under the gel as this may cause holes in the slices. 5. Put a plate slightly bigger than the gel on it and hold it with one hand, ensuring a slight but regular pressure on the whole surface. Apply the wire
Boerlin
72
and Piffaretti
of the modified saw on the rims of the tray and slowly drive it horizontally through the gel (see Fig. 2). A regular movement IS important to obtain even slices. 6. Remove the thicker upper part of the gel (retain it for subsequent slices) and carefully take the thin slice off the tray by inserting one hand under one edge, slowly lifting it and inserting your other hand under the other edge. 7. Put the slice in a labeled plastic box. For this purpose, first lay its central part down, and then the sides. Avoid trapping an bubbles under the starch (this 1sparttcularly tmportant if an agar overlay IS to be poured on later). Remember to put the slice in the correct orientation. 8. Place the rest of the gel back on the tray and slice it agam in the same way. A total of three or four slices can be cut from each gel.
3.5. Staining
Procedures
The recipes of Table 1 are those most commonly used with bacteria. Numerous other staining methods for enzymes not mentioned here may be found in Murphy et al. (4), Harris and Hopkinson (5), and Selander et al. (8). 1.
2.
3. 4.
1. 2. 3.
3.5.1. General Staining Method Mix the various components with the liquid buffer in a 100~mL Erlenmeyer flask a few minutes before use, except for the chromogens (PM% MTT, Fast black K salt, U-dianisidme, and Fast blue salts), which must be added at the very last moment (some are light sensitive or may create a high background if mixed too long before use). Pour the solution onto the gel, and incubate m the dark at 37°C until appearance of clearly distinguishable bands. Slow shaking is helpful for a more rapid and regular color development but is not necessary. Development may take 5 mm to several hours, depending on the enzyme actrvrty and quality of lysates. Stop the reactions by carefully rinsing the gel slice under water and covermg tt with fixing solution. After staining and interpretation of the results, wash the boxes thoroughly, finishing with a 1:l mixture of alcohol and acetone. 3.5.2. Preparation of an Agarose Overlay Boll 0.5 g agarose in 25 nL of 0.2iU Tris-HCl, pH 8.0, m a mrcrowave oven until dissolved and cool to 60°C. Pour this agarose solutton into the corresponding stammg solution and mix gently. Pour evenly onto the gel slice and allow it to set at room temperature before incubating (see Note 13).
Multilocus
73
Enzyme Electrophoresis 3.5.3. Specific Staining
Methods
1. Aconitase staining: a. Prepare an agarose overlay and incubate m the dark until dark blue bands appear. b. Stop the reaction before background becomes too dark. 2. Acid phosphatase staining: a. Prepare the liquid stain (the fast black K salt may not readily dissolve) and add it to the gel slice. b. Incubate, preferably on a shaker. Bands are orange on a light background. 3. Adenylate kinase stainmg: a. Prepare an agarose overlay. b. Incubate in the dark until dark blue bands appear. c. Stop reaction before background becomes too dark. 4. a-Glucosidase stainmg: a. Cut a piece of Whatman no. 3 to the size of the gel shce and lay it onto the slice. b. Pour staining solution on it. c. Regularly check under a long-wave UV lamp (340 nm) for the appearance of fluorescent bands. d. A picture of either the gel or the filter can be taken on a UV transillummator for a permanent record. 5. Alanine dehydrogenase staining: a. Prepare the liquid stain and add it to the gel slice. b. Incubate as appropriate. Bands are blue on a light background. 6. Alkaline phosphatase staining: a. Prepare the liquid stain and add it to the gel slice. b. Incubate as appropriate. Bands are purple on a light background. 7. Catalase staining: a. Pour solution I on the gel slice and incubate 15 mm at room temperature. Gently shake two or three times during incubation. b. Rinse several times m water. c. Add solution II and mix gently. d. Stop the reaction by rinsing with water and covering with fixing solution as soon as white bands clearly appear on a blue-green background. 8. Esterase staining: a. Add the substrate solution and fast blue RR to the buffer just before pouring on the gel. Fast blue RR may not dissolve readily. b. Incubate, preferably on a shaker. The color of bands depend on the substrate and vary from bluish to pink.
74
Boerlin and Piffaretti
9. Fumarase staining: a. Prepare an agarose overlay. b. Incubate in the dark until dark blue bands appear. c. Stop the reaction before background becomes too dark. 10. Glutamate dehydrogenase staining: a. Prepare the liquid stain and add rt to the gel slice. b. Incubate as appropriate. Bands are blue on a light background. 11. Glucose 6-phosphate dehydrogenase staining: a. Prepare the liquid stain and add tt to the gel slice. b. Incubate as approprtate. Bands are blue on a light background. 12. Glutamate oxalate transaminase staining: a. Prepare the liquid stain (the fast blue BB may not dissolve readily), and add it to the gel slice. b. Incubate, preferably on a shaker. Bands are blue-purple on a brown background. 13. Glyceraldehyde-phosphate dehydrogenase staining: a. Prepare the liquid stain and add it to the gel slice. b. Incubate as appropriate. Bands are blue on a light background. 14. Hexokinase staining: a. Prepare the liquid stain and add it to the gel slice. b. Incubate as appropriate. Bands are blue on a light background. 15. Isocitrate dehydrogenase staining: a. Prepare the liquid stain and add it to the gel slice. b. Incubate as appropriate. Bands are blue on a light background. 16. Indophenyl oxidase (IPO) and “nothing dehydrogenase” staining: a. Prepare an agarose overlay. b. Incubate as appropriate. IPO appears as pale bands on the blue background (if necessaryexpose the gel to light to enhance Intensity of background). NDH (“nothing dehydrogenase”) is a dehydrogenase of unknown substrate that appears as dark blue bands, if present. 17. Lactate dehydrogenase staining: a. Prepare the liquid stain and add it to the gel slice. b. Incubate as appropriate. Bands are blue on a light background. 18. Leucine aminopeptidase staining: a. Prepare the liquid stain and add rt to the gel slice. The fast black K salt may not dissolve readily. b. Incubate, preferably on a shaker. Bands are purple on an orange background. 19. Malate dehydrogenase staining: a Prepare the liquid stain and add it to the gel slice. b. Incubate as appropriate. Bands are blue on a light background.
Multilocus
Enzyme Electrophoresis
75
20. Malic enzyme staining: a. Prepare the liquid stain and add it to the gel slice. b. Incubate as appropriate. Bands are blue on a light background. 21. Mannose-phosphate isomerase staming: a. Prepare an agarose overlay. b. Incubate in the dark until dark blue bands appear. c. Stop the reaction before background becomes too dark. 22. Nucleoside phosphorylase staining: a. Prepare an agarose overlay. b. Incubate in the dark until dark blue bands appear. c. Stop the reaction before background becomes too dark. 23. Peptidase staining: a. Prepare the liqutd stain; add the MnCl, Just before use. Ensure that the peptide is entirely dtssolved by mixing on a magnetic stirrer before using the staining solution. b. Add agarose solution and pour onto the gel. Bands are orange on a light background. Many different oligopeptides can be used that may detect other peptidases. 24. Phosphoglucose isomerase staining: a. Prepare an agarose overlay. b. Incubate in the dark until dark blue bands appear. c. Stop the reaction before background becomes too dark. 25. Phosphoglucomutase staining: a. Prepare an agarose overlay. b. Incubate in the dark until dark blue bands appear. c. Stop the reaction before background becomes too dark. 26. 6-Phosphogluconate dehydrogenase staining: a. Prepare the liquid stain and add it to the gel slice. b. Incubate as appropriate. Bands are blue on a light background. 27. Threonine dehydrogenase staining: a. Prepare the liquid stain and add it to the gel slice. b. Incubate as appropriate. Bands are blue on a light background.
of the Gels Colored bands appear where the enzyme has migrated and mobility patterns (electromorphs) for each isolate on the same gel are compared one to another. Electromorphs are numbered in order of decreasing mobility. When several bands appear for each isolate in one staining procedure, patterns of bands are recorded as a whole and interpreted as resulting from only one genetic locus, unless bands can clearly be assigned to specific loci. With esterases,for example, some bands corresponding 3.6. Interpretation
76
Boerlin
and Piffaretti
to diverse loci can clearly be recognized owing to their affinity for different substrates. Be careful in the interpretation and the identification of enzyme staining. Some staining procedures may detect enzyme activities other than those expected. For example, in Listeria and Aeromonas species at least, glutamic-pyruvic transaminase-specific staining (GPT, not cited in Table 2) reveals in fact alanine dehydrogenase activity (ALDH). In other bacteria, an NDH with unidentified substrate may appear on gels stained for other enzymes. This NDH can nevertheless be recognized as such on gels stained for IPO. This is practically the only reason to perform this staining. Otherwise, the IPO electromorphs can be read on gels stained for other enzymes. Absence of enzymatic activity is scored as a 0 but should be verified with different, freshly made lysates. Small differences in mobility may be overlooked if the corresponding isolates are not side by side on the gel. Furthermore, small deformations may occur as well as a smiling effect. This is why comparison between isolates should be made by eye rather than by direct measurement of relative mobility on the gel (RF). A first gel usually gives an approximation of electromorphs for each isolate. Different runs are nevertheless needed for their exact determination, The final number of gels required depends on diversity at the corresponding loci and extent of differences in mobility between the electromorphs. The combination of electromorphs observed for the whole set of enzymes studied characterizes each strain and is called an ET. As few as 8-12 enzymes may be sufficient for epidemiological typing if the genetic diversity is high within a population. Nevertheless, it is better to study 15-30 loci to avoid bias in the estimation of the overall genomic relationships between strains. It may be difficult to detect enzyme activities for a large enough number of loci in some fastidious organisms, or the enzymes tested may not show a sufficient variability for the purpose of the study. In this case, other staining methods, not described here, may be useful (4,.5,8). Great differences exist between prokaryotes and diploid or polyploid eukaryotes in the interpretation of the observed patterns (4,5,8). The reader is referred to classical works in population genetics (9) for the choice of the best suited statistical method for the final analysis of his data. Hierarchical clustering methods (single-, average-, and completelinkage clustering and centroid sorting) or multivariate analyses (principal component analysis, principal coordinate analysis) can be used to obtain a graphical model of the relationships between ETs. Good exam-
Multilocus
Enzyme Electrophoresis
77
ples of such analyses as well as estimation methods for genetic diversity can be found in Selander et al. (8) and Ochman et al. (1). 1. 2. 3.
4.
5. 6.
7. 8.
9. 10.
4. Notes Other horizontal electrophoresis rigs can be used for starch electrophoresis but the one presented here represents a cheap alternative to the commercially avatlable ones. Cells can be grown m broth or on solid medium. As much as 1 L or more of broth culture or l-20 plates may be needed, depending on the organism. Optimal conditions for sonication may vary from one type of somcator to another and also depend on the organism used. Keep the tubes in an ice cooling bath durmg the whole procedure to avoid heat denaturation of the enzymes.If working with pathogens, beware of potential aerosol formation. Ultrasound treatment for preparation of lysates may be replaced by other methods, such as vortexmg suspended cells together with glass beads in a glass tube, repeated freezmg and thawing, or freezing and grinding the cells with a mortar. Caution with pathogens: Live organisms may still be present m the extracts and filtering of the lysates through 0.22 u.rn may be advisable. The point at which heating must be stopped may vary from one starch batch to another. It also depends on the buffer system used. Regular swuling 1simportant for good heat distribution and to avoid burned starch stickmg to the bottom of the flask. The starch concentratton, for instance, may have to be modified depending on the starch batch, following instructions given by the manufacturer. Altering the boiling or degassing time may improve some gels. An “undercooked” gel is mostly sticky, soft, and wet. An overheated gel 1sbrittle, may stick to the mold, and usually presents an uneven surface after coolmg. Overcooked starch may bum on the bottom of the Erlenmeyer or bubble out of the flask during degassing. Wash the Erlenmeyer flask immediately with hot water. Starch is very difficult to remove once dry. Some Erlenmeyer flasks do not tolerate heat and vacuum, so be sure to use one with thick Pyrex or Duran walls. Gels can possibly be used on the day they have been poured, but should be kept at least a few hours at 4°C. Fresh gels tend to be damp and sticky and may be difficult to handle. Gels kept for more than 24 h at 4°C tend to dry and give unsatisfactory results. The lysates can be frozen and used several times, depending on stability of the enzymes being studied. Electrophoresis can also be carried out at lower voltage overnight in a cold room, but with a possible loss in resolution. Fresh ice may be needed after 2-4 h at room temperature. The moment at which the run should be stopped
78
Boerlin
and Piffaretti
depends on the enzymes tested. Some enzymes run quickly, others very slowly. The amaranth dye, visible through the sides of the mold, is used as a reference to standardize electrophoresis condittons. 11. With some buffer systems,the gel may shrink during electrophorests leadmg to separatron of the slit where samples have been loaded. Such gels can not be used because of the resulting deformation of the migration line. This problem can be overcome by inserting one or several thin plastic sticks at one extremity of the gel to compress it. This IS better done before beginning the electrophorests. 12. Under the electrophoresis conditions described, most enzymes run in anodal direction but some rare exceptions may be observed. Thus, when starting study of a new orgamsm, It may be wise to cut the sample slit m the middle of the gel and to stain it on both sides of the slit. 13. With agarose overlays, always cool the agarose stock to 60°C and add it to the stain solution, not vice versa. Preparing the overlay in this way and using cooled agarose, prevents the enzymes m the stain mix and the gel from denaturing.
Other nonspecific loss of staining may occur. Changes in water quality may affect staining, as might traces of detergents on glassware. References 1. Ochman, H., Whrttam, T. S , Caugant D. A, and Selander, R. K. (1983) Enzyme polymorphisms and genetic population structure m Escherichia coli and Shigella. J. Gen. Microbial.
129,2715-2726.
2. Ochman, H. and Selander, R. K (1984) Evidence for clonal population structure m Escherichia
cob. Proc. Natl. Acad. Sci. USA 81, 198-201.
3. Selander, R. K. and Levm, B. R. (1980) Genetic diversity and structure m Eschenchia coli populations. Science 210, 545-547. 4 Murphy, R. W., Sites, J W., Buth, D. G , and Haufler, C. H. (1990) Proteins I isoenzyme electrophoresis, in Molecular Systematlcs (Hillu, D. M. and Morritz, C., eds.), Sinauer, Sunderland, MA, pp. 45-126. 5. Harris, H. and Hopkinson, D. A. (1976) Handbook of Enzyme EZectrophoresis in Human Genetics. Elsevier, New York 6. Selander, R. K. and Musser, J M. (1990) The populatron genetics of bactenal pathogenesis, in Molecular Basis of Bacterial Pathogenesis (Iglewsky, B. H. and Clark, V. L., eds.), Academic, Orlando, FL, pp. 1 l-36. 7. Boerlin, P., Rocourt, J., and Piffaretn, J.-C (1991) Taxonomy of the genus Listeria by using multilocus enzyme electrophoreas. Intern. J System. Bacterial 41,59-64 8. Selander, R. K., Caugant, D. A., Ochman, H., Musser, J. M., Gilmour, M. N., and Whrttam, T. S (1986) Methods of multilocus enzyme electrophoresis for bacterial population genetics and systematics Appl Environ Microbial 51, 873-884. 9. Sneath, P. H. A. and Sokal, R. R (1973) Numerical Taxonomy. Freeman, San Francisco, CA.
CHAPTER8
Fast Atom Bombardment-Mass Spectrometry David
B. Drzwker
1. Introduction Mass spectrometry (MS) is a chemical analytical technique that can yield data in the form of a spectrum of peaks of differing relative intensities and over a range of mass-to-charge (m/z) values. Such data permit calculation of molecular weight and molecular structure. The technique has been used widely in microbiology for many years. Molecules are separatedin a high vacuum electromagnetic field following ionization which traditionally was by electron impact (EI) or by chemical ionization (CI) with a reagent gas. Recently, a new method for ionization of analyte has been devised, fast atom bombardment (FAB). The latter uses large atoms, such as xenon, to ionize solute by transfer of collisional energy. Fast atom bombardment-mass spectrometry (FAB-MS) is a chemical analytical tool that microbiologists have used to identify and quantitate dansyl amino acids obtained in the N-terminal analysis of proteins (1) for verification and correction of the primary sequences of proteins deduced from their corresponding DNA sequences (2) and for analysis of lipids. FAB-MS has assisted sequencing of poly-p-hydroxy fatty acids (3) and membrane and cell envelope lipids. It has elucidated structures of aminophospholipids (4) and di- and tetra-ether analogs of phosphatidic acid, archaetidic, and caldarchaetidic acids in an archebacterium (5).
From: Methods m Molecular Wology, Vol 46: D/agnosf/c Bacteriology Protocols Edited by. J Howard and D M Whitcombe Humana Press Inc , Totowa, NJ
79
80
Drucker 1.1. Principle
of FAB-MS
FAB-MS is a relatively new form of MS in which atoms of xenon or argon are used to bombard nonvolatile molecules, thus ionizing them. The FAB-MS technique (Fig. 1) ionizes molecules with relatively little fragmentation compared with EI methods. FAB-MS is applicable to a wide range of biochemicals of interest to microbiologists. It is particularly well suited to surface-active compounds, such as polar lipids (6-8) and has been used for analysis of phospholipids for chemotaxonomic purposes (9,lO). FAB-MS can provide data on complex mixtures of polar lipids and other compounds, in the form of relative peak intensities for known ions. For bacterial chemotaxonomic analyses (6-1 I), FAB-MS requires less sample preparation than gas chromatography, is faster, and provides at least an order of magnitude more peaks per sample. Many other forms of MS ionize samples by techniques that result in extensive destruction of molecules that produces a characteristic fragmentation pattern of peaks. This assists identification of pure compounds but makes it impossible to identify mixtures. However, FAB ionizes molecules gently without extensive breakdown of molecules. Each component of a mixture tends to produce just one major peak so that a mixture of compounds may be analyzed. In other words, a series of peaks of known masses may individually be ascribed to particular individual polar lipids in a mixture. Traditionally, analyte would require component separation, e.g., with on-line gas chromatography, before performing any MS. One other attraction of using FAB-MS of polar lipids for taxonomic purposes is that all bacteria are amenable to analysis and data collected so far indicate that most genera and species have phospholipids correlating with specific taxonomic groups. Such phospholipids are highly diagnostic. Comparison of quantitative analyses also permits typing of strains, 1.2. Bacterial
Polar
Lipids
FAB-MS is applicable to a wide range of compounds, but surface active, polar lipids are especially well seen in spectra, The term “polar lipid” can be applied fairly loosely to include: 1. Carboxylic acids: CH3(CH2),COOH chain, or cyclopropane
derivatives;
and their unsaturated, and
branched-
Fast Atom Bombardment-Mass
Spectrometry
81
Fig. 1. Kratos Concept IS mass spectrometer used for FAB-MS (courtesy of Kratos plc). 2. Phospholipids that may be regarded as derivatives of phosphatidic acid (glycerol esterified at carbons 1 and 2 to carboxylic acids and at carbon 3 to phosphate). A typical phospholipid has a diacylglycerol backbone linked to phosphate that in turn is linked to -H (in phosphatidic acid), or to various “head groups” such as glycerol, serine, ethanolamine, or choline (Fig. 2) in phosphatidyl-glycerol (PG), -serine (PS), -ethanolamine (PE), or -choline (PC), respectively. Other phospholipids include lysylphosphatidylglycerol (LPG), phosphatidyl inositol (PI), diglycosyldiglyceride (DGDG), diphosphatidylglycerol (DPG), and acylphosphatidylglycerol (acylPG). Although many other microbial lipids have been described, the lipids shown in Fig. 2 are those most commonly encountered and a knowledge of their structure is vital for interpretation of spectra. During FAB-MS, some molecular fragmentation occurs, but these minor fragmentation ions are usefully diagnostic for polar head group and fatty acyl substituents. To detect PC, positive-ion spectra are favored, otherwise negative-ion spectra for the anions are favored. 1.3. Outline of Experimental Steps The technique of FAB-MS as applied to bacterial samples is really a collection of procedures:
82
Drucker CH2 - OCOR’ I CH - OCOR2
CH2 - OPO - x
I 0-
Fig. 2. Phospholipid structures:H, phosphatidic acid (PA); CH$ZH,N+(CH,),, phosphatidyl choline (PC); CH2CH2NH2, phosphatidylethanolamine (PE); CH,CH(OH)CH,OH, phosphatidylglycerol (PG); and CH,CH(NH,)COOH, phosphatidylserine (PS). 1. First, test microorganisms must be obtained m pure culture and characterized using appropriate tests. 2. Suitable culture media must be selected for sample growth. If a range of different species is to be studied, a medium and culture conditions applicable to all the test organisms should be selected. Otherwise, apparent differences between strains may actually be a response to differing experimental conditions. 3. After growth, cells must be harvested and washed free of culture medium by resuspension in buffer followed by centrifugation. 4. Cells can now be lyophilized. This step is not essential as a prelude to hpid extraction but does enable standard dry weights to be analyzed. 5. Lipid extraction should avoid all risk of contammatton with extraneous lipid whether from the skin or glassware. Lipid solvents will remove traces of lipid from glassware but use of plasticware or bottle cap rubber liners must be avoided. Lipid extracts are washed and dried. At this stage (and earlier at the freeze-dried cell stage) the procedure may be interrupted. 6. Extracts can be stored at -20°C until analyzed. 7. Samples are mixed with an organic fluid, “matrix” immediately prior to mass spectrometric analysis. 8. FAB-MS analysis takes only a few minutes but yields large amounts of data that list masses present and relative intensities of peaks of the mdividual masses. 9. The final stage is data analysis that is a lengthy procedure if data are analyzed manually. Much time can be saved by using a computer. Data analysis is initially qualitative to identify the peaks present. Quantitative analysis then follows and aims to compare similarity of strains, Subsequently, it is
Fast Atom Bombardment-Mass
Spectrometry
83
possible to produce tables of normalized results for carboxylate anions and/ or phospholipids for publication or other purposes.
2. Materials 1. 5% (v/v) Horse blood brain-heart infusion (BHI) agar: Prepare from sterile horse blood and reconstituted commercially available dehydrated BHI medium. 2. Sterile cotton wool swabs. 3. Universal bottles (1 oz screwcap bottles). 4. Chloroform-methanol (1:2 [v/v]): Prepare fresh from analytical grade reagents. 5. Phosphate-buffered saline (PBS): Use commerctally available tablets dissolved in an appropriate volume of distilled water. It is not necessary for the PBS to be sterile. 6. Spherical flask, 50 mL, for rotary evaporator. 7. Gloves: These must be solvent resistant. 8. Sterile distilled water. 9. m-Nitrobenzyl alcohol. 10. Nitrogen gas. 11. Kratos (Trafford Park, Manchester, UK) Concept IS mass spectrometer. 12. Personal computer. 13. Computer software for setting up databases (dBase IV) and comparing analyses statistically (SPSS/PC+). All glassware and other vessels must be scrupulously clean and lipid free. Rinse with chloroform-methanol to remove lipids.
3. Methods 3.1. Culture and Harvesting 1. Check the identity and ensure the purity of the cultures to be used. 2. Inoculate multiple plates to produce confluent lawns of growth after 48 h incubation at 37*C (see Notes l-3). 3. Dampen the cotton wool swabs in PBS to ensure good transfer of bacteria after swabbing. 4. Harvest all the plates for each strain into a single Universal bottle containmg 10 mL of PBS. Collect the cells by gently rubbing a moist swab across the growth while rotating the tip (see Note 4). 5. Swirl the swab in PBS to release the cells. 6. Collect the dense suspension by centrifugatton at 3000g for 20 min. 7. Wash the cells by resuspending the pellets in 10 mL of PBS and centrifugation as in step 6. 8. Repeat the wash using 10 mL of sterile distilled water (see Note 5).
84
Drucker
3.2. Lyophilization Although wet cells can be used, lyophilized cells allow easier longterm storage and standardization of cell mass for analysis. 1. Freeze the cell pellets at -20°C (see Note 6). 2. Lyophilize under vacuum (lO-* Torr) until completely dry. 3. Samples can now be stored in screwcap bottles at ambient temperature. 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14.
1. 2. 3. 4. 5. 6.
3.3. Lipid Extraction Using an analytical balance, weigh out 10 mg of lyophilized cells. Add the weighed cells to a glass Universal. Add 2 mL of extraction solvent to 10 mg cells. Mix with a vortex mixer and leave to stand with occasional remixing for 4 h. Remove the undissolved sediment by centrifugation at 3000g for 20 mm. Transfer the extract to a fresh glass Universal. Repeat the extraction adding fresh solvent to the pellet Pool the supernatants. Dry the pooled extracts by rotary evaporation at 50°C. Redissolve the extracted lipid by solution in 1 mL chloroform. Wash with 1 mL of distilled water. Dry the lower chloroform layer, first in a rotary evaporator then m a vacuum desiccator over silica gel. Before tightly capping the bottles, gas them with nitrogen. Store the lipid samples at -20°C until a batch for analysis has been completed. 3.4. FAB-MS Analysis Prepare sample for FAB-MS by resuspendmg/dispersing weighed sample (0.2-0.3 mg) in 10 mL of matrix fluid, m-nitrobenzyl alcohol. Place the sample m matrix fluid onto the copper probe used to introduce samples to the mass spectrometer. Insert the probe mto the sample port of the mass spectrometer for analysis. Perform FAB-MS analysis. This step will usually be performed by a trained instrument operator (see Note 7). Decide whether a nominal mass spectrum (Table 1) or an accurate mass spectrum (Table 2) is required. The latter provides m/z values to several decimal places; the former provides integers only (see Note 8). Decide whether to round off or to truncate nominal masses. If a peak is rounded up, its nominal m/z value will be Incorrect. This problem can be overcome by truncating accurate masses.
Fast Atom Bombardment-Mass
Spectrometry
85
7. Perform correction for matrix fluid that is important because certam peaks are artifactual and arise from matrix fluid. The best policy is to request both a nominal mass analysis for strain comparison and an accurate mass analysis. This assistsdetection of lipids like PS; PS/33:0 has an m/z value of 748.5, whereas acyl PG/30:0 has a value of 962.0. 8. Derive analyses as the means of multiple scans. 9. Decide whether you want data to be returned on disc and/or as hard copy. Data analysis is described next. 3.5. Data Analysis 3.5.1. Types of Data Partial printouts of data are shown in Tables 1 and 2, respectively, for nominal (calculated using integer atomic weights for elements) and accurate masses (based on accurate atomic weights of elements). Spectra are reproduced in Fig. 3 for E. coli, Pseudomonasfluorescens, and Proteus vulgaris. Before identifying individual peaks first make a general check of the printout. 3.5.1.1. NOMINAL MASS SPECTRUM (TABLE 1) 1. Identify which spectra are associated with which samples. The sample identification numbers “28DD0007 Scan 1 (Av 30-38 Acq)” enable spectra to be assigned to specific samples analyzed. In this example, rune scans (30-38) have been averaged. 2. Confirm that spectra are anionic or cationic as desired. In the example negative-ion FAB-MS has been carried out as indicated by “-FAB.” 3. Confirm that the first column of data represents the peak number in order of ascending m/z (mass to charge) value. 4. Confirm that the second column of data reveals m/z value (mass). 5. Confirm that the third column lists absolute values for intensity of individual peaks. 6. Confirm that the fourth column tabulates data for peaks normalized to the most intense peak as “relative peak intensity.” 7. Confirm that there is no peak of m/z 305 owing to meta-nitrobenzyl alcohol (NBA) following successful subtraction of peaks from a pure NBA sample that has been analyzed separately. 3.5.1.2. ACCURATE Miss SPECTRUM (TABLE 2) 1. Examine the number of peaks. No peaks are pooled so that more peaks should be detected than for a nominal mass spectrum (see Note 7).
Table 1 FAB-MS Partial Spectrum Prmtout of Nominal Values and Corrected for Presence of Matrix Peaks0 Peak
Mass
140 142 143 145 147 148 155 156 157 158 159 161 166 169 170 171 172 173 174 175 176 177 185 186 187 189 190 191 200 201 203 211 212 213 214 215 217 245 258 259 267
206 208 209 211 213 214 221 222 223 224 225 227 232 235 236 237 238 239 240 241 242 243 251 252 253 255 256 257 266 267 269 277 278 279 280 281 283 311 324 325 333
Intensity 587483 704220 929706 1158939 4202125 1134709 756077 74083 1 969195 704887 2214498 1280913 757266 663162 1049046 960528 989353 5645686 1501340 27509824 7746633 1112520 558657 555173 1591135 3274698 849455 1070417 650990 584504 654184 1058058 620103 1586972 689295 1512027 914377 5634.9 1437240 8003 52 1510812
86
Percent
Flags
2.1 2.6 3.4 4.2 15.3 4.1 2.7 2.7 3.5 2.6 8.0 4.7 2.8 2.4 3.8 3.5 3.6 20.5 5.5 100.0 28.2 4.0 2.0 2.0 5.8 11.9 3.1 3.9 2.4 2.1 2.4 3.8 2.3 5.8 2.5 5.5 3.3 20 5.2 2.9 5.5
N N N N N N N N N N N N N N N N N N N NS N N N N N N N N N N N N N N N N N N N N N
Table 1 (continued) Peak
Mass
Intensity
Percent
Flags
268 273 280 281 282 283 284 285 287 294 296 299
334 339 346 347 348 349 350 351 353 360 362 365
600650 579936 1645425 677827 1149978 1158834 428642 1 1347968 559649 915082 587070 854977
22 2.1 60 2.5 4.2 4.2 15.6 4.9 2.0 3.3 2.1 3.1
N N N N N N N N N N N N
“28DD0007 Scan 1 (Av 30-38 Acq) is a unique identifier for a sample, analysesof which are the averageof 9 acquired spectra “-FAB LRP” refersto analysis in the negative-Ion mode Arbitrarily, the most intense peak is called 100% and intensities of other peaks are calculated relatively.
2. Exclude any NBA peaks. Automatic correctlon for NBA IS not possible because the accurate mass of NBA will differ slightly when measured to several decimal places in two different analyses. Thus, NBA peaks will always be present. 3. Use values for the accurate mass, even if not very accurate in reality, to confirm correct truncation of values in nominal mass data. 4. Use accurate masses to seek any instrument “drift” in between standard calibration samples being analyzed.
3.5.1.3. IDENTIFICATION
OF COMPOUNDS
In Fig. 3 (see p. 90), relative intensities of peaks of nominal m/z values
are shown graphically. Detailed interpretation is discussed elsewhere (68). However, in general, it is possible to identify classes of compounds. 1. Note peaks owing to phospholipid at m/z > 550. 2. Note the additional peaks owing to carboxylate anions in the range 200350 m/z. 3. Note other peaks to be sought, such as peaks in the intermediate range
(350-550) owing to acylglycerol formed by loss of polar head groups and, possibly, phosphate. 4. Note any peak at m/z 305 that is characteristic of NBA as described earlier. 3.5.2.
3.5.2.1. QUALITATIVE
Data
Interpretation
ASSESSMENT
1. Using nommal peak m/z values for carboxylate anions (provided in Table 3 on p. 91), calculate possible identities of individual peaks of m/z c 350. In
FAB-MS
Table 2 Partial Spectrum Printout of Accurate Mass Valuesa
Peak
Mass
Width
Intensity
Percent
Flags
236 272 284 285 324 326 327 329 332 343 347 348 349 350 351 352 355 356 358 369 370 371 372 373 374 375 378 392 393 395 396 397 398 399 404 410 411 412 413 414 418
680 0490 662 0908 654.1437 653.1493 634.0912 633.1006 632.1134 630.1080 628.0870 623.1471 621 1232 620 1253 619 1289 618.1328 617.1243 616.1203 615 0966 614.1108 612.1020 606.1308 605 1217 604.1204 603.1249 602.1265 601.1163 600 1131 598 1039 590.1338 589.1428 588 1416 587.1326 586 1259 585.0848 584.1128 580 0948 576 1148 575 1274 574.1262 573.1126 572.1148 570.1098
13 13 13 14 13 13 14 14 13 13 13 14 15 15 14 14 13 14 13 13 14 15 14 14 13 14 13 14 14 15 14 14 13 14 13 14 14 14 14 14 13
5683 20829 7854 16209 8886 5950 12291 11015 7557 6071 8468 27010 73674 182945 36699 86808 7221 24064 8492 7327 16193 41987 28821 70133 12578 28988 11153 20233 42069 107301 16004 36601 5733 12332 6778 18157 43695 117954 15526 35203 11728
2.0 7.4 2.8 58 32 21 4.4 3.9 27 2.2 3.0 9.6 26 2 65.0 13.0 30 8 2.6 8.5 3.0 2.6 5.8 14 9 10.2 24.9 45 10.3 4.0 7.2 14.9 38 1 57 13.0 2.0 4.4 24 64 15.5 419 5.5 12.5 4.2
N N N N N N N N N N N N N N N N N N N N N N N N N N N N N N N N N N N N N N N N N
88
Peak 429 442 443 445 448 474 478 483 509 512
519 553
Mass 5661830 5611276 560.1309 558.1155 556.0905 546.1105 544.1103 542.0852 532.0703 530.0797 528.0636 518.0749
Table 2 (contmued) Width Intensity 13 13 14 13 14 14 14 14 13 14 14 13
8620 9623 26165 15613 6621 13281 8887 5799 9224
12067 5756 9368
Percent
Flags
3.1 3.4 9.3 55 24 47 3.2 21 3.3 4.3 2.0 3.5
N N N N N N N N N N N N
a19DDO001 Scan: 1(Av 112-122 Acq) 1sauniqueldentlfierfor a sample.Dataare averagedfrom 11acquiredscans“-FAB LRP” refers to negative-ion mode
this table, peaks of stated m/z are interpreted as having a particular number of carbon atoms, unsaturatlons, and oxygen atoms. For example, the peak of m/z 195 has the value expected for a 12 carbon acid with two double bonds in the carbon chain, namely, dodecdienoate or Cl2 2, but is not hydroxylated-thus, it has no oxygen atom in the alkyl sldechain. Conversely, the anion of m/z 201 has a hydroxyl substltuent but is not unsaturated (viz. OH-Cl1 o). 2. Using nominal m/z values for phosphohpid anions (Table 4 on p. 92), calculate possible identities of individual peaks of m/z > 550. In Table 4, the m/z values of mdlvidual phospholipids appear as data in the table. The left-hand column refers to the combined carbon atoms and unsaturations of the two acyl substituents. For example, 26:l refers to a total of 26 carbon atoms shared between two acyl substituent groups with a single unsaturatlon between them. An unsaturation can be owing to a cyclopropane ring as well as owing to an ethylenic bond. The columns each represent data for a different class of polar lipid. An m/z value of 746.5 might be caused by the anion of PE/36:0 that is PE with acyl substituents of a total of 36 carbon atoms, no additional oxygen atom and no unsaturations. It will be noted that PE and PS, which have a single mtrogen atom in the molecule, have nommal m/z values that are even integers. On the other hand, PG and LPG, for example, have odd nominal m/z values. This 1sa consequence of the absence of an odd number of atoms of nitrogen in PG or LPG. This can be useful diagnostically. 3. Recognize when m/z values refer to lipids that have the same nominal mass. A typical problem that arises is that m/z 704.5 might represent the anion of PS/30: 1 or PE/33:0. 4. Resolve ambiguities m peak identifications (see Note 9).
Drucker
90
100 -
899
674 688
600
000 m/s
ml
Fig. 3. FAB-MS anionic spectrum for polar lipids of E. coli, Ps. jluorescens, and Pr. vulgaris (from top downward), adapted from Heller et al. (7). For cationic positive-ion spectra, similar considerations apply but there are a number of differences: 1. Look for a base peak that will be [M + HI+, i.e., of m/z one integer greater than molecular weight. Frequently peaks of higher m/z are found due to such ions as [M + Na]+. This decreasesthe value of positive-ion FAB-MS in phospholipid analysis. 2. Look for peaks owing to PC. This is important because cationic spectra do preserve the molecular structure of PC, which 1sdemethylated in negativeion spectra. 3.5.2.2.
QUANTITATIVE
ASSESSMENT
For analysis of some specimens, no quantitative assessment may be necessary because detection of a particular polar lipid may be all that is required (see Note 10). If a taxonomic comparison between strains is required (6,10), then the following operations may be undertaken:
Table 3 Interpretation of Nominal m/z Values for Carboxylate Anions m/Z
195 197 199 201 209 211 213 215 223 225 227 229 237 239 241 243 251 253 255 275 265 267 269 271 277 279 281 283 285 291 293 295 297 299 307 309 311 313 321 323 325 335 337 339
Carbon atoms
Unsaturation
12 12 12 11 13 13 13 12 14 14 14 13 15 15 15 14 16 16 16 15 17 17 17 16 18 18 18 18 17 19 19 19 19 18 20 20 20 19 21 21 21 22 22 22
2 1 0 0 2 1 0 0 2 1 0 0 2 1 0 0 2 1 0 0 2 1 0 0 3 2 1 0 0 3 2 1 0 0 2 1 0 0 2 1 0 2 1 0
Additional
atoms of oxygen 0 0 0 1 0 0 0 1 0 0 0 1 0 0 0 1 0 0 0 1 0 0 0 1 0 0 0 0 1 0 0 0 0 1 0 0 0 1 0 0 0 0 0 0
92
Drucker Table 4 Interpretation of Nominal m/z Values for Phospholipid Anions Acyl R’ +R” 25.0 26.1 26:0 27.1 27:0 28.1 28 0 29:l 29:0 30: 1 30:o 31:l 31.0 32 1 32.0 33 1 33:o 34.1 34.0 35.1 35 0 36:l 36:0
PG
PE
LPG
PI
DGDG
*DPG
PS
623 5 635 5 637 5 649 5 651.5 663 5 665 5 677.5 679.5 691.5 693.5 705.5 707 5 719.5 721 5 733 5 735.5 747 5 749.5 761.5 763.5 775.5 777 5
592 5 604.5 606.5 618.5 620 5 632.5 634.5 646.5 648.5 660.5 662.5 674 5 676 5 688 5 690 5 702 5 704.5 716 5 718.5 730.5 732 5 744 5 746 5
751.5 763 5 765.5 777 5 779 5 791.6 793 6 805.6 807 6 819 5 8216 833 6 835.6 847 6 849.6 861.6 863.6 875 6 877.6 889.7 891 7 903.7 905 7
7115 723.5 725.5 737.5 739 5 751.5 753.5 765.5 767.5 779 5 781.5 793 5 795.5 807 5 809.5 821.5 823.5 835 5 837 5 849.6 8516 863.6 865.6
793.5 805 5 807 6 819 6 821 6 833.6 835 6 847 6 849 6 861 6 863 6 875 6 877.6 889.6 891.7 903.7 905 7 917 7 919 7 9315 933 7 945 7 947 7
1327.7 1351.7 1355 7 1379 7 1383.7 1407 7 14117 1435.7 1439 7 1463 7 1467.7 1491.5 1495.7 1519 7 1523 7 1547 7 1551.7 1574.7 1579.7 1603 7 1607 7 1631.7 1635.7
636.5 648.5 650 5 662.5 664.5 676 5 678 5 690 5 692 5 704 5 706.5 718 5 720.5 732 5 734.5 746 5 748.5 760.5 762.5 774 5 776.5 788.5 790.5
1. If replicate samples have been analyzed, exclude peaks not present in all samples. This will eliminate very small noise peaks. 2. Check that matrix substance peaks have been subtracted from the spectra. 3. Average replicate analyses. 4. Normalize data. 5. Analyze data. 6. Produce similarity matrices or other statrstrcal output. 7. Print out tables of data selected for publication, To analyze the data for taxonomic purposes, methods for gas liquid chromatography (GLC) data analysis are suitable. Alternatively, discriminant analysis may be used. More information on taxonomic data analysis is presented elsewhere (IO). To perform these analyses, software, such as dBase IV, SPSS/FC+, Minitabs, and IBM Stats, may prove
Fast Atom Bombardment-Mass
Spectrometry
93
useful. It is also advisable, initially, to work through the stages manually. This will permit appreciation of difficulties that might otherwise be overlooked. In principle, there is no reason why a sample should not be analyzed and identified automatically, using a computer to compare the data with those for known strains in a library of data. This approach has long been used in GLC studies. 4. Notes
Notes l-4 refer to anionic spectra. 1. BHI is a rich medium that permits growth of most organisms so that comparison of data will be independent of medium used. In other words, differences will be owing to differences in strains not differences m growth medium. In any series of experiments, use the same stock of dehydrated medium in order to avoid differences caused by batch variation m medium constituents or source. 2. Organisms that are obligately anaerobic or capnophilic (“like carbon dioxide”) will require an appropriate gaseous environment. Some rmcroorganisms will not grow at 37°C but use of a different temperature will per se result in modification to lipid compositions (9). 3. For strongly growing species, four plates will be adequate. For slowgrowing species, 12 or more plates will be required in order to obtain sufficient growth. 4. Great care should be taken not to harvest agar! However, the use of blood agar, by virtue of its color, should prove helpful here. 5. Water is potentially disruptive of cells but does remove salts that could lead to incorrect dry cell weight measurement. 6. MS parameters will be determined by the instrument operator, but suitable ones for the Kratos Concept are: a. A scan rate of 3 s per decade (this is the time taken to scan peaks between masses 100 and 1000); b. A voltage of 6 kV potential at ion source (this is to optimize sensitivity of the instrument); c. A mass range of 1500 downward (this will be high enough to detect massesof phospholipids); d. Choice of negative-ion spectra for anions (negative ions formed from the molecule to be analyzed); or e. Positive-ion spectra for cations (positive ions formed from the molecule to be analyzed by H+ or Na+).
94
Drucker
7. If two peaks have m/z values of 249.2 and 249.3, they will be recorded as two separate ions in accurate mass spectra. However, in a nominal mass spectrum, both peaks would be truncated or rounded to 249 and a single peak for the pooled ions would be calculated. 8. It is vital to appreciate the fact that: a. Accurate massesprobably are not very accurate m practice and cannot actually be used to determine an empirical formula; b. Nominal massesfor certain lipids can be rounded up rather than down unless truncated values are requested; and c. Correction for matrix peaks (from m-nitrobenzyl alcohol) is possible. 9. There are several ways to resolve this problem: a. Linked scanswould perform fragmentation spectra on separated molecular to provide structural information; b. Accurate mass measurement might reveal the slightly different accurate mass when the three oxygen atoms of serine are present; c. The presence or absence of unsaturated acids will be obvious when the carboxylate region of the spectrum is examined; and d. Serine and ethanolamine yield polar group anion peaks of different m/z values-below m/z 200. The base peak [M-H]- should be accompanied by a peak, perhaps small, at [M-H-serine]- or at [M-H-ethanolamine]-. 10. If many strains are to be examined, numerical data analysis proves useful. Ideally, a computer expert should advise on transfer of electronic data in a suitable compatible format between the mass spectrometer and the PC or main frame computer.
References 1. Beckner, C. F. and Caprioli, R. M. (1983) Protein N-terminal analysis using fast atom bombardmentmassspectrometryAnal. Biochem. 130, 328-333. 2 Gibson, B. W. and Biemann, K. (1984) Strategy for the mass spectrometric verification and correction of the primary structures of proteins deduced from their DNA sequences. Proc. Nat/. Acad Sci. USA 81,1956-1960 3. Ballistreri, A., Garozzo, D., Giufrrda, M., Impallomeni, G., and Montaudo, G (1989) Sequencing bacterial poly(beta-hydroxybutyrate-co-beta-hydroxyvalerate) by partial methanolysis, high-performance liqurd chromatography fractronation, and fast atom bombardment massspectrometryanalysis.Macromolecule 22,2107-2111 4. Kramer, J. K. G., Sauer, F. D , and Blackwell, B. A (1987) Structure of two new ammophospholipids from Methanobacterium thermoautotrophicum. Biochem. J 245,139-143. 5. Nishihara, M. and Koga, Y (1989) Natural occurrence of archaetidic acid and caldarchaetidic acid (di- and tetra-ether analogs of phosphatidic acid) in the archaebactermm Methanobacterium thermoautotrophicum. Biochem Cell Biol. 68, 91-95.
Fast Atom Bombardment-Mass
Spectrometry
95
6. Aluyi, H. S. A., Boote, V., Drucker, D. B., Wilson, J. M., and Ling, Y. H. (1992) Analysis of polar lipids from some representative enterobacteria, Pleszomonas and Acinetobucter by fast atom bombardment mass spectrometry. J. Appl. Bact. 73, 426-432. 7. Heller, D. N., Murphy, C. M., Cotter, R J., Fenselau, C., and Uy, 0. M. (1988) Constant neutral loss scannmg for the characterizatron of bacterial phospholipids desorbed by atom bombardment. Anal. Chem. 60,2787-279 1. 8 Pramanik, B. N., Zechman, J. M., Das, P. R., and Bartner, P. L (1990) Bacterial phospholipid analysis by fast atom bombardment mass spectrometry. Biomed. Muss Spectrom. 19, 164-170. 9. Aluyi, H. S. A., Boote, V , Drucker, D. B., and Wilson, J. M. (1992) Fast atom bombardment-mass spectrometry for bacterial chemotaxonomy influence of culture age, growth temperature, gaseous environment and extraction technique. J. Appl. Butt. 72, 80-86.
10 Platt, J. A., Uy, 0. M., Heller, D N., Cotter, R. J , and Fenselau, C. (1988) Computer-based linear regression analysis of desorption mass spectra of microorganisms. Anal. Chem. 60,1415-1419 11. Heller, D. N , Cotter, R J., and Fenselau, C. (1987) Profilmg of bacteria by fast atom bombardment mass spectrometry Anal Chem 59,2806-2809
CHAPTER9
Pyrolysis
Mass Spectrometry
Roger Freeman, Penelope R. Sisson, and Clive S. Heatherington 1. Introduction Pyrolysis of microorganisms yields complex mixtures of products that can be analyzed quantitatively by mass spectrometry (MS). The resulting mass spectra represent transient bacterial “fingerprints” that can be compared mathematically for relatedness. The method has potential for identification, classification, and typing of bacteria with a high degree of resolution and speed. The principle of pyrolysis mass spectrometry (PyMS) is simple. A small sample of organic matter is heated rapidly in a vacuum, using the Curie point technique, so that the sample is vaporized. The vapor (pyrolyzate) is ionized as it passesacross a beam of low energy electrons. The pyrolyzate is then collected as an ion cloud in a charged chamber and accelerated through holes in a series of charged plates to focus it. The ions within the sample are then separated in a quadrupole mass spectrometer, amplified by an electron multiplier detector, and recorded at unit mass intervals on both a hard and floppy disk. Early PyMS studies were hampered by the expense of PyMS hardware; the slow, manual sample loading processes; inherent instability in the mass spectrometers then available, leading to a lack of reproducibility; and a lack of suitable statistical techniques and computer software with which to analyze the results. The recent development of a low-cost, fully automated machine, coupled with sophisticated statistical software (I) has led to a re-appraisal of PyMS for the characterization of microorganisms (2-6). From Methods In Molecular Brology, Vol. 46 Diagnosf/c Bacteriology Protocols Edrted by. J Howard and D. M Whltcombe Humana Press Inc , Totowa, NJ
97
98
Freeman,
Sisson, and Heatherington
Most recent studies have employed a Horizon Instruments 200X pyrolysis mass spectrometer (Horizon Instruments Ltd., Heathfield, Sussex, UK) and the following account and methodology refers to the use of that machine. 2. Materials 1. Collections of similar microorganisms from a suspected outbreak of infection, epidemiologically unrelated “wild” isolates, and reference strams of the same species or subspecies. 2. Sufficient quantities of freshly prepared appropriate media and provision of suitable incubation conditions for the organisms to be pyrolyzed (see Note 1). 3. V-shaped Ni-Fe pyrolysis foils (Curie point 530”(Z), pyrolysis tubes and O-ring seals (Horizon). Allow six foils, tubes, and 0-rmgs per organism to be examined, including unrelated isolates and reference strains. 4. Four liters of liquid nitrogen per pyrolysis run. 5. A suitable automated pyrolysis mass spectrometer, such as the Horizon Instruments 200X pyrolysis mass spectrometer equipped with ring sampler carousel and dedicated software package (PYMENU, Horizon) and Genstat 5 (Numerical Algorithms Group Ltd., Oxford, UK). 6. A hot air oven.
3. Methods 3. I. Preparation of Microorganisms For most studies prepare replicate subcultures of each organism (including unrelated isolates and reference strains) and pyrolyze them as separate groups to allow a measure of machine-reproducibility to be ascertained. 1. Select a well-isolated, representative colony of each organism and transfer it with a sterile loop to inoculate two plates of the chosen medium (see Note 1). 2. Spread each plate to obtain well-isolated single colonies. 3. Incubate all the plates for the requisite time under suitable conditions (see Note 1). 3.2. Preparation of Samples for Pyrolysis 1. Place each foil part way into a pyrolysis tube so that the end of the foil onto which the material ~111be loaded is protruding. 2. Sample each subculture in triplicate using a sterile wn-e loop and apply material from representative colomes to the protrudmg end of the pyroly-
Pyrolysis
Mass Spectrometry
99
sls foils, ensurmg that the material 1s placed near the center of the foil. Take care to avoid contamination with the growth medium. Prepare six additional foils from one of the subcultures to be used as warmup samples when setting up the pyrolysis run (see Note 2). 3. Place the tubes vertically into a Perspex or wooden rack. 4. Place the loaded racks into a hot air oven at 80°C for 5 min. 5. Insert the foils fully into the pyrolysis tubes, ensuring that they are advanced to a standard depth by using the insertion tool provided (Horizon). 6. Fit each assembled tube with an O-ring collar to seal against the machme vacuum system. 7. Load the tubes onto the rmg carousel, which holds up to 150 tubes. The sequence should be sample 1, sample 2, sample 3, sample n, repeated three times over (see Note 3). 3.3. PyMS The machine operates automatically and examines each tube in order as the carousel progresses. Each tube is taken into the sample chamber and creates a sealed connection with the pyrolyzer unit. An alternating current is passed through the radio frequency (RF) coil and this excites
the metal ions in the alloy of which the foil is composed. The process generates heat. Within 4 s the alloy reaches its Curie point, a temperature
determined by and characteristic of the alloy composition. For the Ni-Fe foils used here, this temperature is 530°C. Pyrolysis is effectively instantaneous and therefore secondary thermal degradation is minimized, thus making the pyrolyzate characteristic and reproducible. The pyrolyzate is then ionized in the source of the mass spectrometer by passing through a 25-eV beam of electrons. The ionized vapor is collected in a charged chamber, focused, and accelerated through holes in a series of charged plates and then the individual mass ions are filtered and scanned by the quadrupole mass spectrometer, finally to be detected by an electron multiplier. The PYMS 200X (Horizon) will then automatically record ion counts at unit mass intervals from 5 l-200 onto the hard disk of the computer, together with the pyrolysis sequence number and total ion count for each sample. 1. Pyrolyze the six warmup samples first to ensure that ion counts of between 5 X 10’ and 6 x lo6 are achieved. The amount of material reqmred on the foil to produce these ion counts will vary (see Note 2). 2. Analyze the test samples by inserting them into the chamber,
Freeman,
100
3.4. Standard
Data
Sisson, and Heatherington Analysis
The pyrolysis data are examined with a specific analytical package (PYMENU; Horizon) that utilizes Genstat 5 (Numerical Algorithms Group). The analytical pathway pursued will vary according to the problem to be addressed.However, all analyses are preceded (automatically) by two important data processes. 3.4.1. Normalization
The mass ion counts for each sample are corrected for variations in sample amounts. This is achieved on a simple proportionate basis, so that all total mass ion counts are corrected back to a common baseline. Any subsequent variations between samples in the presence-absence of individual mass ions, the intensities of mass ions or the ratios within a spectrum of mass ions one to another are therefore valid and not simply owing to differing amounts of material on the foils. 3.4.2. Ranking
of Mass Ions in Order of Discrimination
The software is designed to examine each mass ion (masses 51-200) for its usefulness in discriminating between labeled groups. Each labeled group cornprizes three foils. Those mass ions found to show little variation within a group (of three foils) compared to their variations between groups are ranked as potentially highly discriminatory, compared to those that vary as much, if not more, within a group compared to between groups. The most discriminatory (normalized) mass ions are then subjected to principal component (PC) and canonical variate (CV) analysis as the basis of achieving maximal discrimination between groups. The performance of PyMS on a machine controlled by PYMENU and Genstat 5 will automatically generate the data file (labeled as “psd” file) required for the following analysis. 1. Access the PYMENU-Genstat 5 program. 2. Under “File” select “Open Spectral File.” 3. Select the relevant file (labeled as “psd”). There usually will be a prompt
Identifying the file and the number of samples.Accept the file, 4. Open “Analysis” and select “Set up Method.” 5. Select “Edit.” 6. Check that the “Sample grouping type” line is in the ““ABCABCABC”
format. 7. Accept the format by keying F5. 8. From “Analysis” select “Multivariate.”
Pyrolysis
Mass Spectrometry
101
9. Select “Statmean MVA” from the offered menu. 10. Accept the proffered file setup (i.e., unedited for this stage) by keying F5. 11. Wait, as the program automatically proceeds through prompts such as “Analyzing characteristicity” and so on until the prompt “Multivariate analysis completed” appears. 12. Select “3D display” and note the new file name allocated to your analyzed data that will be based on the original psd filename but with the addendum A, B, C, and so on. 13. Press “Escape.” 14. From “File” select “Quit to DOS” and accept the prompt. 15. Type in “Edit res\filename.res” and return. 16. Scroll down the file looking for: a. PCCV means: Each triplicate subculture is now represented by a single point (the mean of the triplicate foil data) denoted as a letter and its appropriate paired subculture companion by another letter. In most datasets these are usual1 the upper and lower casesof the same letter, but large datasetscreaterB, la ling problems (see Note 4). b. Group average cluster analysis: Immediately beneath this heading is a dendrogram compiled by processing the PCCV data through Unweighted Pair Group Method with Averages (UPGMA) analysts. c. Minimum spanning tree. 17. Print out the file, or at least the three sections mentioned earlier. 18. On the PCCV means ordination diagram, join up the appropriate subculture pairs (e.g., A with a, B with b, etc.). The outputs form the basis of most PyMS analyses of collections of microorganisms. The appropriate applications of each output to the different problems to be addressed is dealt with later. However, two further analytical methods need to be added. 3.5. Editing Datasets Datasets can be edited, commencing at step 5 in Section 3.4. 1. Press the downward arrow until the blue box containing the datagroups changes color to gray. 2. Using the right arrow key, proceed along the datagroups changing the symbols of the groups to be removed by overwriting with a common but presently unused symbol, for instance “X.” 3. Key the downward arrow again until the box reverts to a blue color. 4. Key F5 to accept the edited dataset. 5. From Analysis select “Multivariate.” 6. Select “Statmean MVA” from the proffered menu.
102
Freeman,
Sisson, and Heatherington
7. When the dataftle 1spresented on screen perform “Delete, for mstance, X,” and then F5 to accept the now-edited file. 8. The computer will now automatically reanalyze the edited dataset and produce another file that is accessedand printed for exammation as described earher, commencmg at Section 3 4.2., step 11.
3.6. Comparisons of Only Two Groups Occasionally a dataset contains only two labeled groups, for instance a deliberately constructed direct comparison of two organisms in order to examine identity, or the final two organisms in a much-edited but originally larger dataset. In both instances, it is wise to increase the chances
of good discrimination by examining many samples from the two groups. In the latter case (a dataset originally containing several groups but now
reduced to only two) it is advisable to edit the dataset as in Section 3.5. and label all samples from each group as the same, thus producing a group with six or more samples. It is also possible to permute larger datasets by editing and deleting and to produce a series of “one-to-one” comparisons. 1. Proceed as in Section 3.4.2., until step 5. 2. Perform any editing necessary to reduce the dataset to only two groups (either of which may contain many replicates). 3. Key F5 to accept the dataset. 4. From Analysis select Multivariate. 5. Select “Stats MVA” (Note: not Statmean MVA on this occasion). 6. Complete any editing by the deletion step outlined earlier. 7. Key F5 to accept the dataset. 8. Allow the program to run to completion, 9. Access and print out the file as described in Section 3.4.2., step 17). 10. At the very end of the file is a section headed “PCCVX Histogram,” beneath which is a statement “CV mean,” below that are two figures, one of which is a minus value, but that will be otherwise identical. These represent the differences between the means of the canonical variate functions of the two groups when added together (ignormg the minus sign). The figure produced is essentially a value for x2 with one degree of freedom. Hence, values of greater than 3.84, 6.63, and 10.84 indicate confidence limits of significance of difference of 95, 99, and 99.9%, respectively.
3.7. Applying the Data Analyses to Outbreak Epidemiology 1. Analyze the full dataset as in Section 3.4.
Pyrolysis
Mass
Spectrometry
103
2. Inspect the ordination diagram (PCCV means), having Joined up the appropriately paired duplicate subcultures of the same organism, and identify organisms outlying the main cluster. 3. Edit the data relating to the identified outliers from the original dataset and re-analyze. 4. Inspect the ordination diagram from the “daughter” dataset, looking for further outhers. 5. Re-edit and re-analyze until the endpoint is reached in which the edited database contains a number of organisms in which there is as much difference between two organisms as between subcultures of the same organism. In essence this means that the lengths of the lines joining up appropriately paired subcultures are as long as the distances between the subcultures of different organisms. 6. Regard the final collection of organisms in step 5 as mdistmgulshable by PyMS and, therefore, a putative strain. 7. If necessary,perform a series of “one-to-one” analyses based on the differences m canonical variate means (Section 3.6.), looking sequentially at all possible combinations of the organisms comprising the suspected strain to achieve a series of mathematically based statementsof similarities and dlfferences to precise confidence limits. 3.8. Taxonomic
Studies
No editing of the datasets will be required for this purpose because the essence of taxonomy is the determination of the overall relationships of the organisms in the dataset. The UPGMA dendrogram output is the data presentation most familiar to taxonomists. The inclusion of duplicated subcultures allows a measure of the degree of difference inherent in the method for the examined batch on the day in question. Differences greater than this are likely to be significant. As with all taxonomic examples it is essential to use a verifiable, representative, and unweighted collection of microorganisms as the basis of the study. 3.9. Identification
Early attempts to use PyMS for identification of specific bacterial species, subspecies or types tried to match the spectral data of an “unknown” strain with those in a data library. This approach foundered because minor variations in culturing, sample preparation, and analysis all contributed to imperfect long-term reproducibility. This precludes the merging of
104
Freeman, Sisson, and Heatherington
different machine batches, Recently, mathematical algorithms have been described that can be applied as correction factors and that are based on internal standards incorporated into every separate batch (7). For identification within a limited context it is simpler to pyrolyze “unknowns” along with reference strains and to “identify” the unknown by its copresence in the area of the ordination diagram occupied by one of the reference strains.
4. Notes 1. PyMS will detect differences between samples whether these are phenotypic or genotypic. It is essential to standardize as many variables as possible when culturing bacteria for PyMS analysis so that phenotypic differences are mimmrzed. Any drfferences remaining are therefore likely to be “genotypic.” To achieve this: a. Use media that are as simple and “bland” as possible and that easily support growth of the organisms being investigated. b. Always culture the batch to be examined on the same medium, under the same atmospheric conditions, at the same temperature, and for the same length of time. c. Do not use media that stressthe organism concerned into differing phenotypes, particularly enzyme production, since the induction of such characters often dominates the cell’s metabolism to the extent that the subtler differences being sought in typing are obscured. d. Conversely, the presence or absence of a particular product under defined cultural circumstances may be the purpose of a PyMS analysis, but is must be done purposefully with this result in mind. e. Even so, some organisms, most notably members of the Entersbacteriaceae, will vary in phenotype in an uncontrollable manner and fine discrimination with PyMS in this group can be frustrated. f. Additionally, organisms with very long growth cycles (e.g., mycobacteria) and with more than one form (e.g., the sporing bacilli) may pose problems, although excellent and useful results can be achieved with both (8,9). 2. There is a band of pyrolysis ion counts that, albeit fairly broad, should be adhered to. If an excessive amount of material is pyrolyzed, the high peaks may mask subtle differences between relatively abundant massions because the intergroup variatron is too large. Conversely, rf the ion counts are low because of too little sample being present on the foil, some peaks may then be undetectable for this reason alone and this may form a spurious difference. Normalization (see Section 3.4.) will compensate for most such problems as long as the total ion count for a sample lies between the values given in Section 3.3., step 1. Achieving this is a purely empirical exercise and the “warmup” cultures (see Section 3.2., step 1) are necessaryfor this.
Pyrolysis
Mass Spectrometry
105
Even more experimentation is necessary for liquid cultures. It may be necessary to apply liquid material several times onto the same area of foil, interrupted by drying inbetween, in order to concentrate sufficient material to generate an adequate mass ion count. 3. Arranging the samples in the order (assuming triplicate foils/sample) sample 1, sample 2, sample 3, . ..sample n, sample 1, sample 2, sample 3, will minimize the effects of any changes in the physical configurations of the PyMS machine during the run. 4. In large datasets,PYMENU will exhaust the alphabet, other common signs, and the Greek alphabet as it tries to assign a different symbol to each labeled group. Occasionally, this creates problems in being able to edit out symbols and, consequently, edit the dataset. At present this problem can only be avoided by forethought (for instance, creating smaller batches so that full editing is permissible), but it is intended to be overcome in the near future.
References 1 Aries, R. E., Gutteridge, C. S., and Ottley, T. W. (1986) Evaluation of a low-cost, automated pyrolysis mass spectrometer. J. Anal. Appl. Pyrolysis 9,8 l-98. 2. Magee, J T., Hindmarsh, J. M., Burnett, I. A., and Pease, A. (1989) Epidemiological typing of Streptococcus pyogenes by pyrolysis mass spectrometry J. Med. Microbial.
30,213-278.
3. Freeman, R., Goodfellow, M., Gould, F. K., Hudson, S. J., and Lightfoot, N. F. (1990) Pyrolysis mass spectrometry for the rapid epidemiological typing of clinically significant bacterial pathogens. J. Med. Microbial. 32,283-286. 4. Sisson, P. R., Freeman, R., Lightfoot, N. F., and Richardson, I. R (1991) Incrimination of an environmental source of a case of legionnaires’ disease by pyrolysis mass spectrometry. Epidemiol. Infect. 107,127-132. 5. Sisson, P. R., Freeman, R., Magee, J. G., and Lightfoot, N. F. (1991) Differentlation betweenmycobacteriaof the Mycobacterium tuberculosiscomplex by pyrolysis mass spectrometry. Tubercle 72,206-209. 6 Gould, F. K., Freeman, R., Sisson, P. R., Cookson, B. D., and Lightfoot, N. F. (1991), Inter-strain comparison by pyrolysis mass spectrometry in the investigation of Staphylococcus aureus nosocomialinfections. J. Hosp. Infect. 19,41-48. 7. Kelley, T and Berkeley, R. C W. (1992) The use of algorithmic correction to pyrolysis mass spectrometric data in the identification of bacteria by library matching. Abstr. 121st Ord. Meeting Sot. Gen. Microbial., 78 8. Slsson, P. R., Kramer, J. M., Brett, M M., Freeman, R , Gilbert, R. J., and Lightfoot, N. F. (1992) Application of pyrolysis mass spectrometry to the investigation of food-poisoning and non-gastrointestinal infection associated with Bacillus species and Clostridium perjringens. Int. J. Food Microbial. 17,57-66. 9 Sisson, P R., Freeman, R , Magee, J. G , and Lightfoot, N. F (1992) Rapid differentiation of Mycobacterium xenopi from mycobacteria of the Mycobacterium avium-intracellulare complex 355-357
by pyrolysis
mass spectrometry
J. Clin. Path01 45,
CHAPTER10
The Direct Immunofluorescent Filter Technique (DIFT) Rohan
Kroll
1. Introduction Many areas of analytical microbiology that deal with biological materials (e.g., medicine and the food, water, and pharmaceutical industries) need methods of detecting and identifying microorganisms that can give results in a few hours rather than the many days required for conventional methods. The Direct Immunofluorescent Technique (DIET) can be used to detect rapidly pathogens, spoilage, or indicator organisms in a variety of samples or enrichment broths. The DIFT has several features in common with the Direct Epifluorescent Filter Technique (DEFT) (see Chapter 11). Both rely on the use of fluorescent stains with the direct visual detection of the organisms by epifluorescent microscopy. Depending on the nature of the sample, the cells are either fixed to a glass microscope slide or, like DEFT, the samples are filtered to collect and concentrate the organisms on the surface of a membrane to increase the sensitivity and allow easier microscopical examination. Unlike DEFT, which usually is used for enumeration, DIFT is used primarily for detection/identification (i.e., for the presence or absence of a particular organism in a sample). 1.1. Background to the DIFT The DIET has much older origins than the DEFT (see Chapter 11). Fluorescent antibody conjugates (FAb) were first produced over 50 yr ago and were applied to the detection of Sulmonellae in foods over 30 yr From Methods m Molecular Bology, Vol. 46 D/agnost/c Bacteriology Protocols Edlted by: J Howard and D. M. Whltcombe Humana Press Inc., Totowa, NJ
107
108
Kroll
ago (I) with many subsequent modifications (2). The basic principle is to exploit the specificity of antibodies to bind to antigenic determinants on the cell surface. Fluorescent compounds are conjugated to the antibody so that when the antibody binds to the target cell, the organism can be visualized by epifluorescence microscopy. Because of the antibody specificity, nontarget cells will not bind the FAb and will therefore not fluoresce. Both polyclonal and, more recently, monoclonal antibodies can be conjugated to a range of different fluorochromes, e.g., rhodamine and Texas red, but fluorescein is most commonly used. Indirect detection can also be used where the primary microorganism specific antibody is not fluorescently labeled but is detected when it binds to the organism using a secondary FAb specific for the primary immunoglobulin (e.g., antimouse). These approaches have been developed to give successful rapid identification/detection methods for a range of different organisms, e.g., Salmonella (1,2), Listeria monocytogenes (3), Escherichia coli 0157(4), Legionella pneumophila (5), Vibrio cholerae (6), and Cryptosporidium oocysts (7), Giardia cysts (7), and Campylobacter spp.
(8) from waters, enrichment broths, food samples, or fecal specimens. A standardized DIFT procedure therefore cannot be described because the optimal conditions, e.g., method of cell fixing, the temperature, pH, and ionic conditions during antibody binding and subsequent washing, need to be determined with every system using exhaustive positive and negative controls. 1.2. Limitations
to the DIFT
DIFT undoubtedly can be used as a rapid (-1 h) method of detecting/ identifying microorganisms in pure culture or from enrichment cultures or, with filtration, directly on some types of sample, e.g., water, milk, or meat homogenates. However, the technique does not appear to be in widespread routine use (2). This may be because a stable and reliable commercial supply of FAb is not always available. A most critical factor is the specificity of the antibody and, in practice, there can be a significant number of false-positive results and, to a lesser extent, false-negative results (2), particularly with inexperienced operators. The possible reasons for this lie outside the scope of this chapter, but relate to the complex immunochemistry of many microorganisms. Microscopyfatigue in operators has also contributed to resistance to the more widespread use of DIFT, particularly as FAb reactions can be faint. Unlike
Direct Immunofluorescent
Filter
Technique
109
the DEFT, samples for DIFT have to be incubated for l-2 d to increase the number of target organisms to detectable levels which reduce its overall rapidity. However, with some samples (e.g., filtered water, milk) the DIFT can be applied directly (4), although interfering debris can be a problem at low cell densities. One limitation is that when applied directly to samples, FAbs cannot distinguish between viable and nonviable cells, although the use of tetrazolium dyes and cell elongation techniques can help (5,9). 1.3. Recent Developments The microcolony DEFT approach (seechapter 11) may help with some of the limitations to the wider use of DIFT, that is, microscopy fatigue and the occurrence of unacceptable numbers of false positives. This has been used with some success for the detection of Salmonella spp. and L. monocytogenes (IO,ll), although some sensitivity problems were encountered with the latter. However, in spite of the rapidity and reasonable reliability of this approach, it is still comparatively technically demanding and labor intensive. A parallel approach to DIFT has been developed recently. Synthetic oligonucleotides can be labeled, like antibodies, with fluorescent compounds and targeted at specific rRNA sequences (12). The sequencing of rRNA is a powerful approach for determining the phylogenetic relationships of microorganisms (13). Oligonucleotide probes can be designed against the conserved or variable regions, and the latter can be highly specific, By coupling different fluorescent dyes to different probes and using different excitation and emission filters, different organisms can be identified by epifluorescent microscopy in the same sample. There seems little doubt that this approach has considerable potential for improving the specificity of detection by fluorescence. However, for many routine applications, other improvements are needed. The sensitivity of the DIFT is limited by the volume of sample that can be filtered and the area of the slide or membrane that can be examined readily. This is a problem with food samples and restricts the sensitivity of the DIFT to >104 cfu/g. Thus, if trying to detect pathogens with DIFT or fluorescent oligonucleotides, the samples still have to be incubated to increase the number of target organisms to detectable levels. The DIFT is still technically demanding and requires the use of tiring fluorescence microscopy. These factors must be improved to enable this approach to gain wider acceptance. Perhaps
the use of flow cytometry and fluorescently labeled antibodies (5,14) or oligonucleotides will help to overcome some of these problems by introducing a degree of automation with higher sensitivity.
1.4. Basis of the Method A small sample from an enrichment culture is transferred to a microscope slide and the cells are fixed to the slide. A fluorescent antibody solution is added and after sufficient time for the antibodies to bind to the
target organisms, excess antibody is washed off. The slide is then examined for fluorescing cells by epifluorescence microscopy. Some samples can be filtered to collect the microorganisms and the organisms stained with the fluorescent antibody in situ. This allows the direct examination
of some samples (e.g., water) without the need for enrichment incubation of the samples.
2. Materials 1. Polytetrafluoroethylene (PTFE)-coated microscope slides, preferably with wells. 2. A specified FAb (see Notes 1 and 2) conjugate in a suitable buffer (e.g., PBS). 3. A method of fixing the cells to the slides (e.g., acetone or mild heat). 4. A suitable wash buffer (usually PBS sometimes containing surfactant, e.g., 0.1% Tween-20). 5. A correctly set up epifluorescent mrcroscope filter with a xl00 oil immersion lens and xl0 eyepiece. 6. Nonfluorescent immersion 011.
3. Method 1. Transfer 10-50 pL of an enrichment culture to a microscope slide (see Notes 3 and 4). Alternatively, an isolated colony from a plate can be emulsified in a few milliliters of PBS, or a dilute cell suspension or sample can be filtered. 2. Fix the cells to the slide (e.g., using mild heat or by immersron m acetone for 10 min). 3. Add the FAb conjugate (lo-20 pL on slides, 50-70 uL on membranes)
and incubatefor 30 min at 25OC. 4. Wash off the excess conjugate, e.g., three washes with PBS (see Note 5). 5. Allow to air dry. 6. Add a drop of Immersion oil and examine the slide (or filter) for fluorescmg cells. The cells can be counted if required (see Note 6).
Direct
Immunofluorescent
Filter
Technique
111
4. Notes Many of the factors critical to the success of the DEFT (see Chapter 11) also apply to the DIFT (e.g., clean glassware, filter sterilized reagents to remove debris and other contaminants, a properly set up microscope). The particular potential problems that pertain to the DIFT are: 1. A good reliable and stable supply of specific antibody (polyclonal or monoclonal) is essential for effective execution of this technique. 2. The FAb conjugate must be purified and be as free as possible from unconjugated antibody or fluorescent label. 3. Both positive and negative control cultures need to be included in the procedure. 4. The cells are usually fixed directly onto a glass slide. This usually means that only a small sample can be used. With enriched cell cultures this does not present a problem and dilution of the culture may even be necessary. However, for the direct examination of water and some foods, it is preferable to pass as large a volume as possible through a filter. 5. The optimum conditions of FAb staining and washing must be established with each FAb/organism combination. These include pH, buffer strength and composition, FAb concentration, time, temperature, and humidity of mcubation with the FAb and the subsequent washing steps. 6. The correct dichroic mirror for different fluorochromes must be used. Because the fluorescence can be faint, examination m a darkened laboratory is often essential.
Acknowledgment The views expressed in this chapter represent the author’s personal opinions and do not reflect the view or policies of the Ministry of Agriculture, Fisheries, and Food. References 1. Georgala, D. L. and Boothroyd, M. (1964) A rapid immunofluorescence technique for detecting Salmonellae in raw meat. J. Hygiene 62,319-327. 2. Thomason, B. M. (1981) Current status of immunofluorescent methodology for Salmonellae. J. Food Protect. 44,381-384.
3. McLauchlin, J and Pmi, P. N. (1989) The rapid demonstration and presumptive identification of Llstena monocytogenes in food using monoclonal antibodies in a direct immunofluorescence test (DIPT). Lett. Appl. Microbial. 8,25-28 4. Tortorello, M. L. and Gendel, S. M. (1993) Fluorescent antibodies applied to Direct Epifluorescent Filter Technique for microscopic enumeration of Eschenchia coli 0157.H7 in milk and juice J. Food Protect. 56,672-677.
112 5. Vesey, G., Nightingale, A., James, D., Hawthorne, D L., and Colbourne, J. S. (1990) Rapid enumeration of viable Legionella pneumophila serogroup 1 Lett Appl. Microbial. 10,113-l 16. 6. Xu, H. S., Roberts, N. C., Adams, L. B., West, P. A. Sielbeling, R. J., Huq, A., et al. (1984) An indirect fluorescent antibody staining procedure for detection of Vibrio cholerae serovar 01 cells m aquatic environmental samples J Muzroblol. Meth. 2, 221-231. 7. Vesey, G , Slade, J. S., Byrne, M., Shepherd, K., and Fricker, C R (1993) New techniques for the detection of protozoan parasites in water, in New Techniques in Food and Beverage Microbiology (Kroll, R. G., Grlmour, A, and Sussman, M , eds.), Blackwell, Oxford, UK, pp 101-l 14.. 8. Hodge, D. S., Prescott, J. F., and Shewen, P. E. (1986) Direct rmmunofluorescence microscopy for rapid screening of Campylobacter enteritis. J. Clm. Microbial. 24, 863-865. 9 Roszak, D. B. and Colwell, R. R. (1987) Metabolic activity of bacterial cells enumerated by direct viable count. Appl. Environ. Microbial. 53,2889-2983. 10 Rodrigues, U. M. and Kroll, R. G. (1990) Rapid detection of Salmonella in raw meats using a fluorescent antibody-mlcrocolony technique. J. Appl. Bacterial. 68, 213-223. 11. Sheridan, J. J., Walls, J., McLauchlm, D., McDowell, D., and Welch, R. (1991) Use of a microcolony technique combined with an indirect immunofluorescence test for the rapid detection of Listeria in raw meat Lett. Appl. Microbial. 13, 140-144 12. Zarda, B., Amann, R., Wallner, G , and Schleifer, K.-H (1991) Identification of single bacterial cells using digoxigenin-labeled, rRNA-targeted oligonucleotides. J. Gen. Microbial. 137,2823-2830. 13. Olsen, G. J., Lane, D J , Glovannom, S. J., Pace, N. R , and Stahl, D. A (1986) Microbial ecology and evolution: a ribosomal RNA approach Annu. Rev. Microbiol. 40,337-365.
14. Tyndall, R. L., Hand, R E., Mann, R. C., Evans, C., and Jernigen, R (1985) Application of flow cytometry to detection and characterisation of Legionella spp. Appl. Environ. Microbial
49,852-857.
CHAPTER11
The Direct Epifluorescent Technique (DEFT) Rohan
Filter
KrolZ
1. Introduction Food, water, pharmaceutical, and medical microbiology ideally need methods of detecting, identifying, and quantifying microorganisms that can give results within a few hours. The many days needed for conventional enrichment, plating, and biochemical/serological methods to give results do not enable problems to be identified soon enough to allow the appropriate remedial action to be implemented. New methods must produce rapid, accurate, and reliable estimates of total viable microbial numbers, spoilage, or indicator organisms or to identify the presenceof pathogens. 1.1. The Development of the Direct Epifluorescent Filter Technique Total viable counts (TVCs) are used widely by the food and related industries for assessing the general hygienic status of samples, although there is continuing debate about their significance. The Direct Epifluorescent Filter Technique (DEFT) was developed as a rapid (-30 min) method for obtaining estimates of the TVCs of raw milk (I), although subsequently the method has been shown to be of use for other applications (2,3). Previously, microscopical examination of milk was done by the Breed smear in which small (irreproducible) samples were stained with methylene blue. However, since milk is now collected, processed, and distributed under refrigeration, more sensitive methods are required. Furthermore, methylene blue does not distinguish between viable and nonviable bacteria. From. Methods m Molecular Biology, Vol. 46: D/agnost!c Bacteriology Protocols E&ted by J. Howard and D M Whttcombe Humana Press Inc , Totowa, NJ
113
114
Improvements were achieved by a number of modifications. First, enzyme/detergent treatment of the sample facilitates the use of NucleporeTMfilters to collect the microorganisms on the same focal plane. In addition, the organisms are separatedfrom much of the interfering sample materials (e.g., somatic cell debris) and this reduces the amount of background interference significantly. Second, the application of a fluorescent stain (acridine orange) allows “active” and “nonactive” cells to be distinguished (2). This is probably owing to the differential reaction of the dye with the nucleic acids within the cells (see Section 1.3.). In combination with epifluorescent microscopy, which allows the examination of opaque surfaces, such as filters, these adaptations have improved the sensitivity of detection to -5 x lo3 colony forming units (cfu)/mL. A good correlation between DEFT counts and TVCs can be obtained at this and higher cell densities. However, in order to maintain this correlation, strict adherence to the specified conditions is required (4). Because counting by eye is tedious and labor intensive, image analysis systems have been applied and found to give comparable, if slightly less sensitive results (5,6). Another improvement has been the development of automated systems for sample preparation, reagent dispensing, filtration, microscopy, and image analysis that helps to standardize and simplify the operation of the DEFT (4,7). 1.2. Other Foods The DEFT can generate rapid counts in a range of other foods, such as meats, fish, vegetable products, and rinse waters (8,9). However, foods with a high fat or particulate content (like ice cream and pate) are not suitable for DEFT analysis. The basic method is the same except the sample must be pretreated. A food sample (e.g., 10 g) is homogenized in a suitable diluent (e.g., 90 mL peptone water) using a Stomacher. The large particulate matter is allowed to settle out; it is preferable to prefilter a sample of this homogenate, to remove more particulates, through a 20-50 mm nylon mesh sterilized in situ in an in-line filter holder. A sample of this (e.g., 10 mL) is then treated the same as a raw milk sample. For meat samples, it may be better to use alcalase instead of trypsin (10). The initial sample dilution, when preparing the homogenate, reduces the sensitivity of the DEFT slightly.
Direct
Epifluorescent
Filter 1.3. Other
Technique
115
Applications
The DEFT can give rapid estimates of the numbers of molds (II), yeasts (12,13), and spores (14), and it can be used for monitoring the contamination of food processing surfaces (15). Another important potential application is the use of DEFT for detecting irradiated foods (16). In nonirradiated foods, DEFT counts and TVCs should be comparable, but in irradiated foods, the DEFT counts should exceed the plate counts (except with heat-treated foods). This is because organisms will still fluoresce orange when they have been killed by irradiation and the DEFT will overestimate the number of viable cells present in such circumstances. The reasons for this are not known but relate to the complex interaction of acridine orange with the nucleic acids. It is believed that acridine orange intercalates into double-stranded nucleic acids (dsNA) and fluoresces green. When it binds to single-stranded nucleic acids (ssNA), dye-dye interactions cause metachromasia and result in orange fluorescence. Thus “active” cells fluoresce orange, whereas “nonactive” cells show up green. Among other reasons, this is related to the higher RNA content of actively growing cells (17). However, this is a complex phenomenon also governed by the penetration of the dye into the cell and the relative amounts of the different types of nucleic acid within the cell. Heat (and irradiation) can affect substantially these factors and alter the fluorescent patterns so the DEFT cannot give reliable results with heat-treated or irradiated foods (18). New fluorescent dyes have been developed for differentiating live and dead yeasts (19), but no reliable stain to replace acridine orange has yet been found that would enable the DEFT to count viable bacteria in heat-treated samples. 1.4. Related
Methods
The DEFT can only give estimates of total microbial load. The information about the types of bacteria present is extremely limited, although yeasts and fungi can be distinguished readily. However, some information about the general types of bacteria present can be generated using a modification of the DEFT. This involves growing microcolonies of bacteria in situ on the Nuclepore TMfilters using the broad specificity of selective agars (20). In this method, the homogenized food samples are not treated with the enzyme and detergent mixture (which would inhibit
microcolony formation) and the homogenate is filtered directly. This limits the volume of sample (e.g., 2-10 mL of a meat homogenate) that can be filtered reliably. The filters are placed (shiny side up) on the surface of different selective agarsand incubated for 4-6 h. The filters are returned to the filter towers, stained in the normal way, and the microcolonies counted. This approach can be used successfully to give reliable estimates of the numbers of coliforms, pseudomonads, or staphylococci/micrococci in a variety of foods in a working day. The method is only applicable to raw foods; to give reliable results with samples containing damaged cells (e.g., heat-treated foods) requires the introduction of a resuscitation step, but this detracts from the rapidity of the method (21). One advantage to the microcolony techniques is that the microcolonies stain brightly and they can be distinguished readily from any background material and easily counted. Because of their size, a X40 objective can be used that substantially reduces the microscope factor and increases sensitivity, although this sensitivity is not high enough for some applications. However, this approach is being explored by a pharmaceutical company for rapidly enumerating pseudomonads in process water (22). Improvements in the automatic of sample preparation and automatic counting methods are being made. A prototype automated and sensitive method for counting acridine orange stained microcolonies has been described (23). Another development that, like DEFT, relies on the direct detection of fluorescently labelled cells, could make significant advances in the rapid enumeration of microorganisms in foods. Flow cytometry has been used for many years in cytology. Improvements in cytometer design now enable them to successfully count bacteria in pure cultures. The method has the potential for complete automation, high rates of sample throughput, and the sensitive and rapid counting of bacteria. The particular advantage of flow cytometry is that because of the way the sample is presented (in a free falling stream encasedin a sheath fluid), every bacterium should be examined. The use of the coincident detection of different parameters (e.g., light scatter, fluorescence) can give a high degree of discrimination. The light from the sample can be detected sensitively by photomultipliers and the data subjected to rapid and sophisticated signal processing by computers. However, the direct application of flow cytometry to foods is not without problems because of the small size of sample that can be conveniently processed and to interference from particulate matter that reduces sensitivity (24). With improved sample
Direct Epifluorescent
Filter
Technique
117
preparation and novel dyes, however, these problems should not prove insurmountable. 1.5. Outline of the Method Milk samples are treated with an enzyme and detergent solution to allow them to be filtered. The cells are collected on the filter, stained with acridine orange, and washed with citric acid buffer and isopropanol. The filters are dried and the orange fluorescent cells counted under oil immersion using an epifluorescent microscope. Although the DEFT has many steps, up to five samples can be processed at the same time and the whole process only takes approx 30 min to give a result, compared to the 3 d required by aerobic plate counts. When performed properly, the DEFT should give a good agreement with plate counts (correlation coefficient >0.9) and there should be a linear agreement over the range 104-lo7 cfu/mL. At the lower end of the detection limits, the degree of scatter increases and the DEFT tends to overestimate the plate count. This is probably owing to nonrandom counting of fields as operators tend to search for fields containing organisms to count. At higher counts, DEFT can underestimate, probably owing to crowding, but this is of little practical consequence with milk and other foods. The method described here has slight modifications to that originally described (I), but it gives comparable results with less reagent use (25). 2. Materials 2.1. Reagents Sterilize all solutions by filtration through 0.22+m filters (see Notes 1 and 2). 1. Triton X100: 0.1 and 0.5% (v/v) stock solutions. 2. Trypsin reconstitutedto the manufacturer’sinstructions.Preparefresheach time or storealiquots frozen. Keep on ice prior to use. 3. Acridine orangesolution: 0.025% (w/v) in O.lM sodium citrate buffer, pH 6.6 (seeNote 3). Store in a foil-covered or dark glassbottle. 4. Sodium citrate buffer: 100mM pH 3.0 5. Isopropanol. 6. Nonfluorescent immersion oil. 2.2. Equipment 1. NucleporeTMpolycarbonatefilters: 25 mm diameter,0.6 pm pore size. 2. Glass microscopeslides and coverslips.
118
Kroll
3. 4. 5. 6. 7. 8.
Well washed sterile pipetes (1, 5, 10 nL). Water bath at 50°C. Suitable filtration holders and towers. Timer. Vortex mixer. A vacuum pump (water driven or electrical) fitted with a trap and a three way tap with a vent to the atmosphere. 9. A properly set up epifluorescent microscope with xl00 oil immersion objective and x10 eyepieces fitted with the correct dichroic mirror.
3. Method 1. Thoroughly mix the milk sample and transfer 2 to 0.5 mL trypsin solution (see Note 4). 2. Add 2 mL of 0.5% Trnon Xl00 solution and vortex thoroughly (see Note 5). 3. Incubate in a water bath for 10 min at 50°C with occasional mixing (see Note 5). 4. Place a filter (shiny side up) in the filter holder and assemblethe filter tower. 5. Apply the vacuum and filter 5 mL of 0.1% Triton Xl00 solution (prewarmed to 50°C). 6. Mix the sample again using the vortex mixer and filter the sample under vacuum (see Notes 6 and 7). 7. Wash out the sample tube with 5 mL of prewarmed 0.1% Triton Xl00 and filter this. 8. Release the vacuum and equalize to air. 9. Add 1 n-L of acridme orange solution to the surface of the filter, wait 30 s, and reapply the vacuum. 10. Filter 2 mL of 100 mM sodium citrate buffer, pH 3.0. 11. Filter 1 rnL, of isopropanol. 12. Remove the filter from tower using forceps, with vacuum still applied and au dry by gently blowing across the filter. 13. Place small drop of immersion oil (see Note 8) on a glass microscope slide and place the filter (shiny side up) on the oil drop. Add another drop of oil onto the filter and place a coverslip on top. 14. Press firmly but gently on the covershp to flatten the membrane. Place another drop of immersion oil on top of the coverslip and examme by epifluorescent microscopy (see Notes 9 and 10). 15. Count the brightly orange or yellow/orange fluorescing bacteria in each microscope field. Fields must be selected randomly and the number of fields that should be counted depends on the number of bacteria in each field. For fields with: O-10 bacteria, count 15 fields; 1l-25 bacteria, count 10 fields; 26-50 bacteria, count 6 fields; 51-75 bacteria, count 3 fields; 76-100 bacteria, count 2 fields. If there are more than 100 orgamsms m a
Direct
Epifluorescent
Filter
Technique
119
field, dilute the sample and retest it. 16. For the DEFT count to give a good correlation with plate counts, the counting must be a clump count: Count any organisms m pairs, chains, and small groups as one organism unless they are separated by more than a cell length. 17. Calculate the DEFT count by multiplying the mean clump count per field by the microscope factor. The microscope factor is: [Area of membrane through which sample was filtered (mm2)/ Area of mtcroscope field of view (mm2)] x volume of sample (mL)
4. Notes 1. All solutions must be sterilized through 0.22~urn pore size filters mto clean sterile bottles. This removes microbrological contammation and other particulate matter that can fluoresce and interfere with counting. In addition, all bottles, caps, filter towers, and so on must be cleaned thoroughly to reduce contammation by particulate matter. The solutions can be stored unopened for several months. Once opened, store them at +4OC for up to a week. 2. Freshly prepared reagents give the best results. 3. A proper safety assessmentshould be made on all the chemicals used, but take particular care with acrrdine orange, which is known to bind to nucleic acids and 1stherefore a potenttal mutagen. 4. A control sample (no milk) must be run regularly to check for any contamination of the system. 5. Always vortex mix the sample several times and incubate at 50°C + 1“C m a water bath for exactly 10 min. Incubated for longer, the bacteria start to lyse. With less than 10 min incubation, the sample will not filter properly. 6. Always control the filtration with a three-way valve to release the vacuum at the appropriate pomts. 7. Use membrane supports with the lowest resistance to flow, but which give good support to the membrane. 8. The immersion oil must be nonfluorescent. 9 Make sure the rmcroscope is properly aligned, preferably with a 100 W mercury bulb, and keep the objective lens clean, 10. It is essential that the microscope factor 1sdetermined for each equipment set up.
Acknowledgment The views expressed in this chapter represent the author’s personal
opinion and do not reflect the views or policies of the Ministry of Agriculture, Fisheries and Food.
120
Kroll References
1. Pettipher, G. L., Mansell, R., McKinnon, C. H., and Cousms, C. M. (1980) Rapid membrane filter on epifluorescent microscopy techmque for the direct enumeration of bacteria in raw milk. Appl. Environ. Microbial. 39,423-429. 2. Pettipher, G. L. (1983) The Direct Epifluorescent Filter Technique for the Rapid Enumeration of Mtcroorganisms. Research Studies Press, Letchworth, UK. 3. Denyer, S. P. and Lynn, R. (1987) A sensitive method for the rapid detection of bacterial contammants in Intravenous fluids. J. Parenteral Sci. Technol. 41,60-66. 4. Easter, M C., Kroll, R. G., Farr, L., and Hunter, A. C. (1987) Observatrons on the introduction of the DEFT for the routine assessment of bacteriological quality. J Sot. Dairy Technol. 40, 100-103 . 5. Pettipher, G. L. and Rodrigues, U. M. (1982) Semi-automated countmg of bacteria and somatic cells m milk using epifluorescent microscopy and television image analysis. J. Appl. Bacterial. 53,323-329. 6. Jaeggi, N. E., Simes, U., and Hughes, D. (1989) Evaluation of a television image analyser as an aid to estimation of microbral numbers in food using the direct epifluorescent filter technique. Food Mtcrobiol. 6,85-91. 7. Pettipher, G. L., Watts, Y. B., Largford, S. A., and Kroll, R. G. (1992) Preliminary evaluation of COBRA, an automated DEFT instrument, for the rapid emuneratron of micro-organisms in cultures, raw milk, meat and fish Lett. Appl. Microbial. 14, 206-209. 8. Pettipher, G. L. and Rodrrgues, U. M. (1982) Rapid enumeration of microorganisms in foods by the Direct Epifluorescent Filter Technique. Appl. Environ. Microbial. 44,809-8 13. 9. Hunter, A. C. and McCorquodale, R. M. (1983) Evaluation of the direct epifluorescent filter technique for assessing the hygiene condition of milking equipment. J. Dairy Res. 50,9-16.
10. Walls, I., Sheridan, J., and Levett, P. (1989) A rapid method of enumerating microorganisms from beef using an acridine orange direct count technique. Irish J. Food Sci. Technol. 13,23-3 1. 11. Pettipher, G. L., Williams, R. A., and Gutteridge, C. S (1985) An evaluation of possible alternative methods to the Howard Mould Count. Lett. Appt. Microbial. 1, 49-52. 12. Rodrigues, U. M and Kroll R. G. (1986) Use of the direct epifluorescent filter technique for the enumeratton of yeasts. J. Appl. Bacterial. 61, 139-144 13. Rowe, M. T. and McCann, G. J. (1990) A modified direct epifluorescent filter technique for the detection and enumeration of yeast in yoghurt. Lett. Appl. Microbial. 11,282-285. 14 Kelly, A F. and Kroll, R. G. (1987) Use of the direct epifluorescent filter technique for the enumeration of bacterial spores J. Appl Bacterial. 63,545-550 15. Holah, J. T , Betts, R P., and Thorpe, R. H. (1988) The use of direct epifluorescent microscopy (DEM) and the direct epifluorescent filter technique (DEFT) to assess microbial populations on food contact surfaces. J Appl. Bacterial. 65,215-222
Direct Epifluorescent
Filter
Technique
121
16. Betts, R P., Farr L., Bankes, P., and Stringer, M. F. (1988) The detection of irradrated foods using the Direct Epifluorescent Filter Technique. J. Appl. Bucteriol 64, 329-335.
17. Back, J. P. and Kroll, R. G. (1991) The differential fluorescence of bacteria stained with acridine orange and the effects of heat J Appl. Bacterial. 71,5 l-58. 18. Pettipher, G. L and Rodrigues, U. M. (1981) Rapid enumeration of bacteria in heat-treated milk and milk products using a membrane filtration-epifluorescent microscopy technique J. Appl Bacterial. 50, 157-166. 19. Hutcheson, T. C., McKay T., Farr, L., and Seddon, B. (1988) Evaluation of the stain viablue for the rapid enumeration of viable yeast cells. Lett. Appl. Microbial. 6,85-88. 20. Rodrigues, U M. and Kroll, R. G. (1988) Rapid selective enumeration of bacteria in foods using a microcolony eprfluorescence microscopy technique. J. Appl. Bactenol. 64,65-78.
21. Rodrigues, U. M. and Kroll, R G. (1989) Microcolony eplfluorescence mrcroscopy for selective enumeration of injured bacteria in frozen and heat-treated foods. Appl. Environ. Microbial.
55,778-787.
22. Newbury, J. (1991) Analysis of high-quality pharmaceutical grade water by a direct epifluorescent filter technique microcolony method. Lett. Appl Microbial 13,29 l-293 23. Kroll, R. G , Pinder, A. C., Purdy, P. W., and Rodrigues, U. M. (1989) A laser-light pulse counting method for automatic and sensitive counting of bacteria stained with acridine orange. J. Appl. Bacterial. 66, 161-167. 24. Patchett, R A., Back, J. P., Pmder, A. C., and Kroll, R. G (1991) Enumeration of bacteria m pure cultures and in foods using a commercial flow cytometer. Food Microbial. 8, 119-125. 25. Rodrigues, U M. and Kroll, R. G. (1985) The direct epifluorescent filter technique (DEFT); increased selectivity, sensitivity and rapidity J. Appl. Bacterial 59,493-499.
CHAPTER12 Use of Commercially Available ELISA Kits for Detection of Foodborne Pathogens Barbara
J. Robison
1. Introduction To understand the principle of an immunoassay, one must be familiar with the antibody-antigen relationship. An antigen is a molecule that, when injected into an animal, will elicit an antibody response. Antigens may be proteins, polypeptides, or carbohydrates (glycolipids or glycoproteins), and each antigen may contain one, or numerous, antigenic determinants or epitopes (1). The antibody molecules that are produced as a result of exposure to the antigen are a group of serum glycoproteins, or immunoglobulins, made by B lymphocytes. There are several classes of immunoglobulins, including IgG, IgA, IgM, IgD, and IgE. The IgG molecule is by far the most common, and its structure is shown in Fig. 1. The variable region of the antibody molecule is the portion that accounts for its unique specificity, and it is this portion that possessesthe antigen binding sites. This unique recognition of an antigen by an antibody is the principle that makes the immunoassay such a powerful diagnostic tool. In order to visualize the reaction between an antibody and an antigen, a detectable label of some sort must be bound to one of the molecules. These labels include radioactive isotopes, fluorescent molecules, enzymes, latex particles, chemiluminescent compounds, and so on. Of these, enzyme labels are most useful, because they are not hazardous, they have long shelf lives, and the enzyme property of substrate turnover provides an From Methods m Molecular Bology, Vol 46: Dlagnostlc Bacteriology Protocols Edlted by: J. Howard and D M Whltcombe Humana Press Inc , Totowa, NJ
123
Robison
124 Antigen
BIndIng
Sites
Fc
Fig. 1. The basic structure of IgG amplification effect in the assay. Several factors must be considered when selecting an enzyme label. These include: 1. 2. 3. 4. 5.
Commercial availability; Enzyme stability; Absence of the enzyme in the sample to be tested; Ease of measurement of the enzymatic activity; and A high turnover rate.
Some of the enzymes most commonly found in assay systems are alkaline phosphatase, horseradish peroxidase, and beta-galactosidase. Assays employing these enzyme-labeled molecules are called enzyme-linked immunosorbent assays (ELISAs). ELISAs which are designed to detect bacterial antigens, such as Organon Teknika’s (Durham, NC) SalmonellaTekTM or Listeria-TekTM, require the use of antibodies that recognize specific epitopes from these organisms. Either monoclonal or polyclonal antibodies may be used for this purpose. Obviously, the success of any ELISA assay is dependent on the quality of the antibodies used in the test. Monoclonal antibody technology (2) is a form of genetic engineering resulting in the production of specific antibodies by specialized tissueculture lines. To produce a monoclonal antibody, animals (usually mice)
ELBA
Kits and Foodborne
Pathogens
are immunized with the relevant antigen (heat-treated whole bacterial cells, flagella, and so on). Once the animals are producing sufficient antibodies, their spleens are removed and a cell suspension is prepared. These spleen cells are fused with a myeloma cell line (e.g., SP2/0) by the addition of polyethylene glycol (PEG), which promotes membrane fusion. Only a small percentage of cells fuse successfully. The fusion mixture is then set up in culture with medium containing “HAT” (hypoxanthine, aminopterin, and thymidine). Aminopterin is a toxin that blocks a metabolic pathway. This pathway can be bypassed if the cell is provided with the intermediate metabolites hypoxanthine and thymidine. Spleen cells can grow in HAT medium, but myeloma cells have a metabolic defect and cannot use the bypass pathway. As a result, the unfused spleen cells in the culture die naturally after l-2 wk; the myeloma cells are killed by the HAT; fused cells, or hybridomas, survive, as they have the immortality of the myeloma cell line and the metabolic bypass capability of the spleen cells. Some hybridomas will also secrete antibodies, and these culture supernatants are screenedfor the production of the specific monoclonal antibody desired. This is usually accomplished by using an ELISA assay. Once the desired antibody is found, the antibody-producing hybridoma is cloned, and a continuous supply of monoclonal antibody is assured. This entire process takes 3-4 mo and is shown in Fig. 2. The major advantages of monoclonal antibodies are their homogeneity and specificity, their ability to maintain these characteristics over time, and their ability to be produced in large quantities. Polyclonal antibodies offer alternatives to monoclonals. Polyclonal antibodies are produced by injecting animals (primarily rabbits or goats) with the antigen preparation. By repeating the injections at regular intervals, a secondary immune response can be provoked, and large amounts of antibody are produced by the animal. The animal is then bled and crude serum obtained. Because the crude serum contains antibodies to a number of different antigens, it must be purified to obtain the relevant antibodies. This can be achieved by affinity purification, a procedure in which the antiserum is passedover a column containing the specific antigen (3). In this manner, a relatively specific antiserum is obtained. The major advantages of polyclonal antibodies are that they are easily produced and usually have good sensitivity. In addition, polyclonal antibodies recognize multiple epitopes on the relevant antigen rather than just one, as with monoclonals.
126
Robison
PEG
spleen cells (HAT resistant) \?
Aculture culture in in HAT +
4,
test for positive wells
clone antibody producers I
Fig. 2. Monoclonal antibody production. The ELBA technique was first published in 197 1 by two independent groups, Engvall and Perlmann (4) in Sweden, and van Weemen and Schuurs (5) in Holland. ELISA assays are basically class&d as either competitive or noncompetitive, depending on whether the technique involves a reaction step in which unlabeled antigen and enzyme-labeled antigen compete for a limited number of antibody binding sites, or whether the antigen or antibody to be measured is allowed to react alone with an excess of immune reactant (6). Generally, of the two techniques, the noncompetitive ELISA is inherently more sensitive than the competitive version, when sensitivity is not limited by the detection of the enzyme label.
ELISA
Kits and Foodborne
Pathogens
127
Regulatory agencies (FDA, USDA) have specified that pathogens such as Salmonella and Listeria monocytogenes should be absent from processed food products. In order to meet this specification, a single bacterial cell must be detected from the sample. Currently, commercial ELISA kits need 105-lo6 cells/ml for detection of these organisms. In order to reach the level of detection of the ELISA, the target organisms must be grown in a series of enrichment broths. These broths typically inhibit competing bacteria while allowing the pathogenic species to multiply. Organon Teknika provides two commercial ELISA kits to detect bacterial pathogens in foods. They are Salmonella-Tek, which detects the presence of Salmonella in foods and feeds, and Listeria-Tek, which recognizes organisms of the genus Listeria. The technique used to detect bacterial antigens in foods is a version of the noncompetitive ELISA called the double antibody sandwich. In this configuration, relevant antibody is adsorbed onto the surface of the wells of a microtiter plate (Fig. 3). The sample is then added, and the microtiter plate is incubated. If antigen is present, it will bind to the antibody on the well. Following a wash step to remove unbound antigen, an enzyme-labeled antibody (conjugate) is added, which also binds to the antigen, After a wash step to remove unbound conjugate, the substrate is added. In the presenceof the enzyme, the substrateis converted to a colored end product. After a specified period of time, the reaction is stopped by adding a stop solution. The color intensity is measured on a spectrophotometer at a specified wavelength, and a numerical result is obtained. 2. Materials 1. Microtiter plate holderand micro-ELISA strips coated with monoclonal antibodiesthat recognizea 30,000Dalton proteinspecific to the genusListeria (7). Thecoatedplateis packagedin foil with a desiccantpack.Storeat 24°C. 2. Monoclonal antibody specific for Listeria
sp. conjugated to horseradish
peroxidase.The conjugatedantibody is lyophilized; rehydrateit with conjugate diluent. This reagent is stable for 30 d at 2-8OC. 3. Conjugate diluent: Phosphate-buffered salme (1.25 g/L anhydrous Na2HP04, 0.18 g/L NaH2P04 +H20, 8.59 g/L NaCl) containing 10% (v/v) mouse serum, 0.05% (v/v) Tween-20, 0.1 mg/mL gentamicm sulfate, 0.16 mg/rnL cinnamaldehyde, and 0.025 mg/mL Food Drug and Cosmetic (ID&C) red dye No. 2 (also called amaranth). Store at 2-8°C. 4. Positive control: A lyophihzed preparation of heat-treated Listeria monocytogenes.
Rehydratewith 1 mL of sterile distilled water. The rehydrated
control is stable for 60 d at 2-8OC.
Robison
128 loo
7 l uu
j&I
r
Fig. 3. The double antibody sandwich ELISA for measuring antigens. 5. Negative control, containing lyophilized preparation of nonfat dry milk. Rehydrate wtth 2 mL of sterile distilled water. The rehydrated control IS stable for 60 d at 2-8°C. 6. Wash solutron (50X concentrate): 50% (v/v) glycerol and 2.5% (v/v) Tween-20 m distilled water. Dilute the wash concentrate by mixing 10 mL of 50X wash with 490 mL distilled water. 7. Tetramethylbenzldme substrate solutions (TMB A and B): TMB A contains 0.4 g/L 3,3’,5,5’, tetramethylbenzidine in dimethylformamide. TMB B
ELISA
8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22.
23.
24.
25.
Kits and Foodborne
Pathogens
129
consists of 0.2% hydrogen peroxide m a citric acid buffer. Combine the two solutions 1:l at the time of use (prepared substratesolution). The exact formulations of TMB A and B are proprietary. Stop solution: 4M sulfuric acid. Perforated plate sealers to cover plate durmg incubations. Clamp and rod to reseal opened microtiter pouch. ELISA plate reader with 450-nm filter. ELISA manual or automated washer. Incubators, 37’ and 30°C. Multichannel pipet, 50-200 pL. Single channel pipet 50-200 pL. Disposable micropipet tips. Reservoir troughs. Hot plate or boiling water bath. Glass screwtop test tubes, 16 x 150 mm. Sterile distilled water. Ferric ammonium citrate: 5% (w/v) in distilled water. Filter sterilize and store at 2-8°C. Modified Fraser Broth: 52 g/L UVM medium (BBL) and 3 g/L hthmm chloride in distilled water, Dispense 225~mL aliquots into flasks. Autoclave at 120°C for 15 mm. Just before use, aseptically add 2.25 mL of a filter-sterilized stock solution of ferric ammonium citrate (8). Buffered Listeria Enrichment Broth (BLEB): 36.1 g/L Listeria Enrichment Broth (BBL), 9.6 g/L disodium phosphate, and 1.35 g/L monopotassmm phosphate in distilled water. Dispense lo-mL portions into 16 x 150 mm test tubes, Autoclave at 121°C for 15 mm. Modified Oxford Medium (MOX): 57.5 g/L Oxford Medium Base (Difco, Surrey, UK) in distilled water. Heat to boiling to dissolve agar completely. Autoclave at 121OC for 10 mm. Mix and cool to 50°C. Rehydrate a vial of modified Oxford Antimicrobic Supplement (Drfco 0218-60-5) with 10 mL of sterile distilled water. Rotate the vial m an end-over-end motion to dissolve the contents completely. Add the contents of the vial to the 1 L of tempered sterile Oxford medium base. Mix well and pour mto sterile Petri dishes. LPM agar: 50.5 g/L LPM Agar Base (BBL) m distilled water. Heat with frequent agitation and boil for 1 min to completely dissolve the powder. Autoclave at 121°C for 15 min, then cool to 46°C. Aseptically add filter-sterilized moxalactam solution (20 mg/L in O.lM potassium phosphate buffer, pH 6.0) before pouring into sterile Petri dishes (9).
130
1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18.
19.
Robison 3. Method Add 25 g of product to 225 mL of modified Fraser broth. Blend or stomach as required for thorough mixing. Larger amounts of food product may be used as long as the 1: 10 ratio of product to broth is maintained. Incubate at 30°C for 24-26 h. Remove the broth and mix it well. Pipet 0.1 mL of incubated broth mto 10 mL BLEB. Incubate this tube at 30°C for 24-26 h. Remove the BLEB tube from the incubator and mix well. Transfer a 1-mL aliquot to a clean glass screwtop test tube. Heat the sample m a boiling water bath or in an autoclave (lOO”C, flowmg steam) for 20 mm and cool to ambient temperature. Fit the ELISA kit strip holder with the required number of Micro-ELISA strips. Allow one well for each sample and Include three wells for controls. Pipet 100 pL of the samples and controls into then assigned wells. Include two negative controls and one positive control per assay(see Notes 1 and 2). Pipet 100 pL of conjugate mto each of the wells containing samples or controls. Do not allow the pipet tip to touch the well contents. Cover the plate with a plate sealer and mix the well contents by gently tapping the plate. Incubate at 37°C for 1 h (see Note 3). Remove the plate from the incubator. Aspirate the well contents into a waste flask using a manual or automated ELISA washer. Fill the wells with approx 0.2-0.3 mL of 1X wash solution. Remove the solution by aspiration. Wash and aspirate the wells in this manner six times (see Note 4). Pipet 100 pL of prepared TMB substrate solution into each well and mcubate at ambient temperature (20-25°C) for 30 mm. Pipet 100 l.tL of stop solution into each well. Read the plate immediately on an ELISA reader. Blank the reader on air (without strip holder and strips) and then read the absorbance of the solution m each well at 450 nm (see Note 5). Calculate the mean negative control value (xNC). This value should be ~0.30. The positive control value must be >0.70. All controls must be within these limits for the test to be considered valid, Calculate the cutoff value by addmg 0.15 to the mean negative control value (0.15 + xNC). Samples are considered to be presumptive posrtives if the sample absorbance is greater than or equal to the cutoff value. Test samples are considered negative if the sample absorbance is less than the cutoff value. Confirm presumptive positive ELISA results by streaking the BLEB broth onto MOX and LPM agar plates,
ELISA
Kits and Foodborne
Pathogens
131
20. Pick suspicious colonies and biochemically characterize them, either using conventional culture procedures or Micro-ID Listeria. Negative results by ELISA require no further testing. 21. Return unused reagents to 2-8°C for storage (see Note 6).
4. Notes Although the ELISA procedure is simple and straightforward, some precautions must be taken to ensure that the assay is successful. The following suggestions apply to the Organon Teknika ELISAs designed to detect foodborne pathogens. 1. When pipeting samples, use a new tip for each sample. Be sure that the pipet is calibrated properly (i.e., that the delivery volume is accurate). Avoid touching the rim or top of the well with pipet tips. Take care when pipeting to avoid splashing droplets into adjacent wells. Use separatepipets for dispensing conjugate and substrate. Reagents, especially the substrate, should not come into contact with metal. 2. Use sterile distilled or deionized water to reconstitute the kit controls. Allow the kit components and reagents to reach ambient temperature before use. Ensure that containers are clean. Rinse with distilled water if necessary. 3. Check the temperature of the incubator periodically. Ensure the incubation times are within 5 min of the specified time. For substrate incubation, be absolutely accurate. Cover plates or strips to prevent evaporation, except during substrate incubation. 4. Wash the plate according to the manufacturer’s directions. After the final wash, be sure that all wash solution is aspirated from the wells. If an automated washer is used, be certain that the dispenser aspirator heads are functioning properly. Do not scratch the well surfaces with the washer heads. Do not allow the wells to dry. 5. Be sure that the correct wavelength (450 nm) is used in the reader. Allow the reader to warm up sufficiently before reading a plate. Be sure to blank the reader on air with no strips or plate present. Be sure the well bottoms are free of fingerprints, droplets, and dust particles. 6. Store unused reagents at 2-8OC. Label reconstituted reagents with dates and store according to the manufacturer’s recommendations. 7. Be sure that equipment (reader, washer, etc.) is regularly serviced and cleaned.
References 1. AOAC
Workshop on Immunoassays nants, King of Prussia, PA
(1990) Zmmunodetection of Food Contami-
132 2 Antczak,
Robison D. F (1982) Monoclonal
antibodies*
technology
and potential
use.
JAVMA lS(lO), 1005-1010. 3. Garvey, J. S., Cremer, N E., and Sussdorf, D. H. (1977) Dissociation from insoluable antigen adsorbents (affinity chromatography), m Methods in Immunology, 3rd ed., W. A. Benjamin, Reading, MA. 4. Engvall, E. and Perlmann, P (1971) Enzyme-linked rmmunosorbent assay (ELISA). Quantitative assay of immunoglobulin G. Immunochemistry 8,871-874 5 van Weemen, B. K. and Schuurs, A. H W. M. (197 1) Immunoassay usmg antigen enzyme conjugates. Fed. Eur. Biochem. Sot. Lett E(3), 232-236. 6 Maggio, E. T. (ed.) (1980) Enzyme-linked immunosorbent assay (ELISA) theoretical and practical aspects, m Enzyme-Immunoassay, CRC, Boca Raton, FL, pp 168-173. 7. Mattmgly, J. A., Butman, B. T , Plank, M. C., Durham, R. J., and Robison, B. J. (1988) Rapid monoclonal antibody-based enzyme linked immunosorbent assay for detection of Listerla in food products. JAOAC 71,679-681 8. Fraser, J. A. and Sperber, W. H (1988) Raprd detection of Listeria spp in food and environmental samples. J. Food Prot. 51, 762-765. 9. McLain, D. and Lee, W. H. (1989) FSIS methodfor the isolation and identificatron ofllsteria monocytogenesfromprocessed meat andpoultry products. USDA/FSIS Microbiology Division Laboratory Communication No 57, Bettsville, MD.
CHAPTER13
Detection of Foodborne Pathogens Using DNA Probes and a Dipstick Format E. Patrick
Groody
1. Introduction The contamination of food with organisms, such as Salmonella, Listeria, and Escherichia coli, continues to be an area of concern for consumers and food producers. Historically, the identification of such organisms has been done using conventional culture methods and biochemical techniques. These methods, although still considered by most to be the “gold standard” for microbial identification, can often be time consuming and laborious to perform. In addition, these methods can also be complicated by the heterogeneous nature of food microflora and the subjective nature of many microbiological and biochemical techniques. During recent years, many new methods have been developed for detecting foodborne pathogens. These methods no longer rely on conventional microbiological and biochemical techniques. Instead, DNA probes or immunological reagents are used to screen for the presence of the organism of interest. Such new methods have helped improve the objectivity of test methods as well as reduce the time required to test many food products. DNA probe based methods have become increasingly popular in recent years. These methods typically employ short nucleic acid fragments to detect an organism’s unique nucleic acid sequence. Such methods offer a variety of advantages, including sensitive nonradioactive detection and elimination of the need to isolate the target organism. In addition, by carefully selecting the nucleic acid target (i.e., RNA or DNA, From: Methods In Molecular Biology, Vol. 46’ D/agnost/c Bacterrology Protocols Edited by J Howard and D. M. Whitcombe Humana Press Inc., Totowa, NJ
133
Groody and so on) and the probe sequences,the specificity of the technique can be adjusted to fit the needs of particular applications. For example, when the detection of a single species is desired (i.e., Staphylococcus aureus), probes may be designed such that all strains of S. aureus can be detected without detecting other organisms belonging to the genus Staphylococcus. Alternatively, when broader inclusivity is desired, as in the case of a screening test for Salmonella, sets of probes that detect many different Salmonella species can be employed. The overall format of DNA probe tests generally involve five basic steps. In most cases, cultural enrichment of the test sample is required in order to increase the number of organisms to detectable levels. Once the cultural enrichment is complete, the assay is then completed by lysing the target organisms, hybridizing the probes to the targets, immobilizing the probe-target complex onto a solid support, and detecting the immobilized probe-target complex. In order to develop a DNA probe test, an extensive understanding is required of the polynucleotide sequences of the intended target organism, genetically related organisms, and other organisms that might be encountered in the test sample. Generally, sequenceinformation for such organisms can be found in various databases,however, often it is necessary to supplement this information with additional laboratory experiments. Once the nucleic acid sequencesof the target organisms are determined, probes that are complementary to these sequences are designed and then produced by a variety of chemical or biological methods. Candidate probes are then tested using extensive panels of organisms in order to demonstrate that the desired specificity properties have been achieved. If necessary, probe specificity can be refined during the assay development process by carefully controlling the time of incubation, and the pH, salt concentration, and temperature of the medium used during incubation of the probes with the test sample. Numerous DNA probe assays for the detection of foodborne pathogens, such as Listeria (I), Salmonella (2,3), and E. coli (4), have been developed. Initially, most such methods had limited utility owing to the use of isotopic signal generating systems and complex assay formats. More recently, however, a variety of format improvements and the development of more sensitive nonradioactive detection methods have helped to broaden the application of probe-based methods (5,6). A number of commercially available kits for detecting Salmonella, E. cob, List-
Dipstick
Detection
of Bacteria
135
and Yersinia are now available from companies such as GENE-TRAK systems (Framingham, MA). These products have greatly enhanced the utility of probes for use in routine food testing in commercial testing laboratories. A schematic representation of a typical DNA probe test for the detection of Salmonella in food is shown in Fig. 1. In this test, a dipstick format is employed. The probes used consist of a mixture of capture probes and detector probes. The capture probes contain two specific binding regions. The first region contains a Salmonella-specific nucleic acid sequence. The second region contains a polydeoxyadenylate tail. This serves to link the probe target complex to a polydeoxythymidylate-
eria, S. aureus, Campylobacter,
coated solid support. Similarly, the detector probes also contain Salmo-
nella-specific sequences, These sequences are labeled with fluorescein groups that serve to bind an antibody-enzyme conjugate to the immobilized probe-target complex. After removal of all of the excess reactants and cellular debris, the plastic dipstick containing the immobilized probetarget complex is added to a substrate-chromogen mixture in order to generate a highly colored product when Salmonella is present in the original test sample. 2. Materials
All materials required for detection of Salmonella in food products can be purchased in kit form (Calorimetric
GENE-TRAK
Salmonella
Assay) from GENE-TRAK systems. 1. Lysrs solutton: 0.75M NaOH. 2. Neutralization solution: 2M Tris-HCl, pH 7.5. 3. Salmonella probe solution:l-2 pg/mL capture probe, l-5 ug/mL detector probe in 1.05M Trts-HCl, pH 7.5, 0.5 rnM EDTA, 0.05% (w/v) BSA, 0.005% (v/v) NP-40. Probe solution should be stored at 2-8OC. 4. Wash solution: 50 mM Tris-HCI, pH 7.5, 2 mM EDTA, 100 rnM NaCl, 0.1% (v/v) Tween-20. 5. Enzyme conjugate: Anttfluorescein antibody conjugated to horseradish peroxidase. Conjugate should be stored at 2-8°C. 6. Diluted enzyme conjugate solution: This should be prepared immediately before use (during step 10 of the assayprocedure). Dilute the enzyme conjugate concentrate loo-fold with wash solutron. Do not store the diluted enzyme conjugate for longer than 60 min. 7. Substrate solution: Urea peroxide in aqueous buffer. Store at 2-8OC in a dark container. Do not expose to light.
136
Groody COLORIMETRIC
DNA PROBE ASSAY
HYBRIDIZATION
SAMPLE LYSIS Target
rRNA
ADD PROBES Reporter
Probe F-dA Target
TAILED rRNA
CAPTURE
PROBE
ADD DIPSTICK
WASH, ADD CONJUGATE
Antibody
i
WASH, ADD SUBSTRATE/CHROMOGEN
DETECTION
Fig. 1, A schematic representation of the steps required to detect SuZmonelZu using the DNA probe test. 8. Chromogen solution: Tetramethylbenzidine in organic solution. Store at 2-8°C. 9. Substrate/chromogen reagent: This IS prepared Immediately before use (step 14 of the assayprocedure). Add 2 vol of substrate solution to 1 vol of
Dipstick
10.
11. 12. 13. 14. 15. 16. 17. 18. 19.
Detection of Bacteria
137
chromogen solution (0.75 mL is needed for each sample). Do not store this reagent for longer than 60 min. Stop solution: 2M sulfuric acid. Caution: Solution is corrosive and should be handled with extreme care. Spills should be wiped up immediately. Do not allow to come in contact with skin. Wash all exposed areas immediately with copious amounts of water. Dipsticks (poly-dT coated): Store at room temperature in a dessicated container. Positive control (suspension of killed Salmonella typhimurium sufficient to give an OD at 450 nm equal to 1.0 or greater). Store at 2-8OC. Negative control (suspension of killed Citrobacterfreundii, concentration sufficient to give an OD at 450 nm ~0.1). Store at 2-8OC. Lactose broth from Difco Laboratories (Detroit, MI) (7) (see Note 1). Tetrathionate (TT) broth from Difco Laboratories (7) (see Note 1). Selenite cysteine (SC) broth from Difco Laboratories (7) (see Note 1). Gram-negative (GN) broth from Difco Laboratories (7) (see Note 1). A supply of 12 x 75-mm glass test tubes. Photometer capable of reading the OD at 450 nm of a solution in 12 x 75-mm tubes (available from GENE-TRAK systems). 3. Methods
3.1. Cultural
Enrichment
of Samples
This section describes a protocol for bacterial enrichment of raw meat and raw milk samples. Variations of this procedure for use with other foods are described in the Notes section. 1. Homogenize 1 vol of the food sample in 9 vol of lactose broth. For enrichment of other samples, see Note 2. 2. Incubate the mixture for 22-24 h at 35°C (pre-enrichment culture). 3. Remove the pre-enrichment culture from the incubator and mix well. 4. Transfer 1 mL of pre-enrichment culture to 10 mL of TT broth. Transfer a second 1-mL aliquot to 10 mL of SC broth. Both broths are required to ensure that acceptable titers of various Salmonella can be obtained. Failure to use both broths may lead to inaccurate results with some strains of Salmonella. 5. Incubate the ‘IT and SC broths for 16-18 h at 35°C (for other foods, see Note 3). 6. Remove the TT and SC cultures from the incubator and transfer 1 mL of each culture to separate tubes, each containing 10 mL of GN broth in order to increase the titer of Salmonella (if present) to detectable levels. Although, in some cases, Salmonella can be detected directly for the TT
138
Groody
and SC broths, broad screening of many different food types is most accurately conducted by using the complete enrichment scheme. Failure to do so could lead to an increase in the incidence of false negative results. 7. Incubate the GN cultures for 6 h at 35°C (for other foods, see Note 4) and then remove 0.25 mL of each GN culture to perform the probe assay. 1. 2.
3. 4. 5. 6. 7. 8. 9. 10. 11. 12.
13.
3.2. Assay Procedure Equihbrate a water bath at 65°C (see Note 5). Prepare four wash basins each containmg 300 mL of wash solution. Place one wash basin in the 65°C water bath. The remaining three wash basins should be left at room temperature. Allow all of the reagents to warm to room temperature before use (see Note 5). MIX all of the GN cultures thoroughly before use. For each sample to be tested, add 0.25 mL of each respective GN culture (one from TI and one from SC for each food sample) to a 12 x 75-mm glass tube. Total test sample volume should be 0.5 ml/food sample. Set up the positive and negative controls. Mix the positive control and negative control reagents thoroughly before use. Add 0.5 mL of positive control and 0.5 mL of negative control to separate 12 x 75-mm glass tubes. Add 0.1 mL of lysis solution to each tube. Shake the tubes thoroughly and Incubate at room temperature for 5 min. Add 0.1 n-L of neutralization solution to each tube and shake all the tubes thoroughly. Cover the tubes and place them in the 65°C water bath. Incubate at 65°C for 15 min. When the 15-min incubation is complete, add 0.1 mL of probe solution to each tube. Cover the tubes and incubate for 15 min at 65°C. When the 15-min mcubation is complete, remove the cover from the tubes and add a plastic poly-dT coated dipstick to each tube. Incubate the dipsticks in the tubes for 1 h at 65°C. During the l-h mcubation step, dilute the enzyme conjugate solution (see Section 2.). Do not store the diluted solution for longer than 60 min. For each sample to be tested, add 0.75 mL of diluted enzyme conjugate solution to a separate 12 x 75-mm glass test tube. After incubation of the dipsticks with the test samples for 1 h, remove the dipsticks from the tubes and place them 111the wash basin at 65°C; wash them with gentle shaking for 1 min. Remove the dipsticks from the wash basm and place them in one of the wash basins at room temperature. Wash them with gentle shaking at room temperature for 1 min. Blot the dipsticks on absorbent paper and then add them to the tubes contaming the diluted enzyme conjugate. Incubate the dipsticks m enzyme conjugate at room temperature for 20 min.
Dipstick
Detection of Bacteria
139
14. During the 20-mm mcubation, prepare enough substrate/chromogen reagent for each sample being tested (see Section 2.). Do not store the combined reagents for longer than 60 min. 15. Add 0.75 mL of substrate/chromogen mixture to a separate 12 x 75mm glass tube for each sample being tested. 16. When the mcubation of the dipstick with the enzyme conJugate is complete, remove the dipsticks from the tubes and wash them sequentially in the remainmg two wash basins for 1 min each. Do not wash in the wash solutions used in the previous steps. 17. Blot the dipsticks on absorbent paper and place them in the tubes containing the substrate-chromogen mixture. Incubate the dipsticks in the tubes for 20 min at room temperature. 18. Remove the dipsticks from the tubes and discard them. 19. Add 0.25 mL of stop solution to each tube containing the substrate-chromogen mixture. Shake the tubes thoroughly to make sure all the reagents are completely mixed. 20. Determine the OD of each solution at 450 nm. Samples are considered positive if the absorbance reading exceeds the OD of the negative control by at least 0.1 OD unit. The OD of the negative control must be 10.1 at 450 nm, and the OD of the positive control should be >I .Oat 450 nm (see Note 5). Positive samples should be confirmed by appropriate biochemical confirmation tests (7). 4. Notes 1. Alternative cultural enrichment media may be used but are not recommended by the kit manufacturer. 2. Other foods can be enriched as described m BAM/AOAC guidelines (7). 3. Samples from other foods should be incubated for 6 h. 4. Samples from other foods should be incubated for 12-18 h. 5. Care should be taken to ensure that all reagents are maintained at the appropriate temperature. In particular, the water bath must be maintamed at 65 f 1OCfor proper results. Failure to do so may result in high backgrounds and false positive results if the temperature is too low, or low signal and false negative results if the temperature is too high. References 1. King, W., Raposa,S., Warshaw, J., Johnson,A , Halbert, D , and Klinger, J. D. (1989) A new colonmetric DNA hybridization assayfor Listena in foods. ht. J. Microbial.
f&225-232.
2. Fitts,R., Diamond,M., Hamilton, C., andNeri, M. (1983)DNA-DNA hybridization assayfor detection of Salmonella spp. in foods. Appl. Environ. Microbial 46, 1146-1151.
140 3. Flowers, R. S., Klatt, M. Silliker, J. H. (1987) DNA foods. J. Assoc. 08 Anal. 4 Hill, W. E. (1981) DNA Escherichia coli m human
Groody J., Mozola, M A., Curiale, M S , Gabis, D. A., and hybridization assay for the detection of Sulmonellu in Chem. 70,521-529.
hybrldizatron method for detecting enteropathogenic isolates and its possible application to food samples. J
Food Safety 3,233-247
5. Hsu, H. Y., Chan, S W., Sobel, D. I., Halbert, D N , and Groody, E. P. (1991) A calorimetric DNA hybridization method for the detection of Escherichiu co11 in foods. J. Food Prot. 54,249-2X 6 Wilson, S. G., Chan, S., Deroo, M , Vera-Garcia, M., Johnson, A., Lane, D., and Halbert, D. N. (1990) Development of a calorimetric second generation nucleic acid hybridization method for the detection of Salmonella in foods and a comparison with conventional culture procedure. J. Food Prot. 55, 1394-1398. 7 U S Food and Drug Administration (1991) Bucteriologuxzl Mznual, 7th ed. Association of Official Analytical Chemists, Arhngton, VA
CHAPTER14 Preparation
of Bacterial
Jane Bickley
Genomic
DNA
and Robert J. Owen
1. Introduction The isolation of genomic DNA from a microorganism generally comprises three stages: cultivation of the cells, disruption to release cell contents, and chemical purification of the DNA. Two widely used methods for the preparation of bacterial DNA are those described by Marmur (I) and Kirby (2), but procedures are frequently modified to suit the particular organisms under study. The best DNA isolation techniques produce good yields of pure, high molecular weight, largely double-stranded DNA. It may be problematic to obtain sufficient DNA from some bacteria if they are difficult to grow or to break open, or if they have small genome sizes. The DNA should be free of contaminating macromolecules, such as RNA, protein, polysaccharide and chemical compounds, and also any residual plasmid DNA. Some breakage of the DNA is inevitable during cell lysis and chemical purification, but care should be taken to minimize mechanical shearing, and to inhibit enzymic degradation, principally by deoxyribonucleases (DNAses). Fortunately, the latter enzymes are heat labile and are readily inhibited by a lack of magnesium ions. DNAse activity could result in single strand breaks or nicks, weakening the DNA strands and making them more susceptible to shearing and hence to a reduction in molecular weight. Low molecular weight DNA precipitates as fibers less readily than DNA of high molecular weight, so native DNA with an intact double helical structure is the required end product. From Methods m Molecular Biology, Vol 46 D/agnostic Bacteriology Protocols Edited by J Howard and D M. Whltcombe Humana Press Inc , Totowa, NJ
141
142
Bickley and Owen
The Marmur method (I) involves disruption of cells and then dissociation of protein from nucleic acids by treatment with sodium perchlorate and denaturation in chloroform and isoamyl alcohol. Ribonucleic acids are removed by treatment with RNAse and remaining nucleic acids are precipitated with ethanol and isopropanol. The limitations of this method are low recovery of DNA, shearing of DNA, and presence of some residual contaminating macromolecules, particularly proteins and polysaccharides. Phenol is more effective than chloroform as a deproteinizing agent and is used in the method described by Kirby (2). Phenol effectively inhibits nucleases, and DNA preparations low in protein contamination can be obtained without the need for a large number of chloroform deproteinization steps. Although there are many methods described for the preparation of bacterial genomic DNA, generally derived from the Marmur and Kirby protocols outlined earlier, the more recent use of guanidinium isothiocyanate provides a method that is both rapid and simple, and is applicable to both Gram-positive and Gram-negative bacteria (3). The method described here uses guanidinium isothiocyanate, EDTA, and sarkosyl (GES). Guanidinium isothiocyanate (GIC) is a strong protein denaturant. Its chaotrophic properties inactivate endogenous nucleases and aid in the disruption of bacterial cell walls. EDTA chelates divalent cations that are normally required for nuclease activity, whereas sarkosyl is a detergent and removes lipids from the cell membrane, causing disruption. Gram-negative bacteria are lysed within a few minutes of mixing with GES reagent, whereas Gram-positive bacteria require prior treatment with lysozyme or some other lytic enzyme. Subsequent to cell lysis, the ammonium acetate/chloroform step stabilizes the nucleic acids and precipitates proteins mto an insoluble layer between the two phases.The ammonium acetatesalts-out proteins, ensuring that a firm band of insoluble protein and cell debris forms at the aqueous liquid/chloroform interphase. This allows the removal of the relatively viscous DNA solution without disturbing the interphase, Addition of a precise amount of isopropanol ensures that only high molecular mass DNA is precipitated on gentle mixing. Following isopropanol precipitation, the DNA is washed three times in 70% ethanol. When the proportion of ethanol to water is 70:30, both organic and inorganic contaminants are removed, but the DNA IS not
Preparation
of Bacterial
Genomic DNA
143
redissolved. Finally, the DNA is dried under vacuum, redissolved in distilled water or a suitable buffer, and stored at 4°C. The GIC extraction method is rapid and convenient for purifying DNA in high yields from small quantities of Gram-positive and Gram-negative bacterial cells. It can be carried out in half a day, although the DNA must be left to redissolve overnight. The resulting DNA is of high purity, and can be used very successfully in procedures such as restriction endonuclease digestion and DNA-DNA and DNA-RNA hybridizations. Gram-positive bacteria require an additional incubation step with a suitable lytic enzyme and, in some cases, it may be necessary to carry out further purification steps to the DNA, lengthening the procedure slightly. Various modifications are discussed in the Notes section and cited at the appropriate stages of the method. Otherwise, this method offers a simple, reliable, and very rapid way of obtaining DNA from a wide range of bacteria for use in molecular biological techniques.
2. Materials 1. For initial culture of bacteria, use the richest possible medium. Select the growth medium and incubation conditions to give efficient rates of growth and a high yield of cells. For Helicobacter pylori, for example, use brainheart mfusron agar, supplemented with 5% (v/v) horse blood and 1% (v/v) isovitalex. Grow bacteria under optimum conditions. These may be in liquid culture with aeration, as lawns on soled media, or by some other special method depending on the organism to be used. 2. TE: 10 mM Tris-HCl, 1 mM EDTA, pH 8.0. Store at 4OC. 3. Lysozyme: 50 mg/mL m TE buffer. Make fresh and warm for 10 min at 37°C before use. This step is required for Gram-positive bacteria only. 4. GES reagent: 5M GIC, O.lM EDTA, 0.5% (v/v) sarkosyl. For 100 mL, dissolve the solid GIC and EDTA in about 20 mL distilled water at 65°C. Add 1.7 mL of 30% sarkosyl. Mix well, adjust the volume to 100 mL, and store at room temperature. 5. Ammonium acetate: 7.5M. Store at 4OC. 6. Chloroform/isoamyl alcohol mixed in the ratio 24: 1. Store at 4°C. 7. Isopropanol: Store at 4°C. 8. 70% (v/v) ethanol: Store at 4°C.
3. Method
(see Fig. 1)
1. For Gram-negative bacteria grown in liquid culture, spin broths down by centrrfugation at 1OOOgfor 15 min. Use a broth culture of 40-50 uL to obtain a pellet approximately the size of a rice grain. For Gram-negative
E
/ Gram
poslt~ve
culture
Gram
H
negatrve
culture
B
Cells
Lysostaphln
or
treatment
37"C,
G.E.S.
Lysozyme 30 mrns.
reagent 0.5
Redissolve
In
100
pl
d7stllled
7.5M
0.25
_
-1
v= v*
3 t7mes
with
70% ethanol
to
Isopropanol 0.4
ml
acetate ml
Leave on Ice 10 m7ns
Transfer
1 ml cold
Amnon7um
ml
water
*
Wash
lyse
the
upper
a new Eppendorf
layer tube
ChloroformfZ-pentanol Mix.
Fig. 1. Rapid isolation of chromosomal DNA by the GES method.
(24:l) Spin
for
10 mrns.
0 5 ml
Preparation
2. 3. 4. 5.
of Bacterial
Genomic DNA
145
bacteria grown on solid medium, scrape the growth from the plate with a plastic spatula, and obtain a similar sized pellet (see Note 1). In both cases, resuspend the bacterial cells in 100 pL of TE buffer in McCartney bottles (see Note 2). For Gram-positive bacteria, obtain the cell pellet m the same way but incubate in 100 pL fresh lysozyme in TE buffer for 30 min at 37°C (see Note 3). Harvest all cultures at the end of the exponential growth phase. Add 0.5 mL of GES reagent to the harvested cells and resuspend thoroughly, mixing well until cells are lysed. Add 0.25 mL of cold 7.5M ammonium acetate and 0.5 mL of chloroform reagent, mix well, and leave on ice for 10 min. Transfer the mixture to 1.5-mL Eppendorf tubes and centrifuge in a microfuge at fast speed for 10 min. Transfer the supernatant to a fresh Eppendorf tube and add 0.54 vol of cold isopropanol, mixing well to precipitate the DNA. Typically, add 0.43 mL of isopropanol to 0.8 mL of supernatant.
6. Pellet the DNA by centrifugation
in a microfuge
for 2 min.
7. Remove the waste with a Pasteurpipet. Avoid drawing the DNA into the pipet. 8. Wash the DNA three times with 70% ethanol: Use a pipet to dispense and remove the ethanol. At each wash, be sure to remove as much of the 70% ethanol as possible.
9. Dry the DNA under vacuum for approx 10 mm. 10. Redissolve the DNA in 100 pL sterile distilled water or 1X TE buffer overnight at 4OC.Measure the absorbance values at 230,260, and 280 nm, using quartz cuvets, to obtain the ratios 230:260 and 280:260. For pure DNA, these ratios should be approx 0.5 (see Note 4). The approximate concentration of the DNA can be calculated from the 260 nm reading; a 260 nm absorbance reading of 1.Ois equivalent to approximately 47 pg/rnL DNA.
4. Notes 1. When harvesting bacterial growth from solid media with a plastic spatula, care must be taken not to scrape up agar from the plate. The spatula can then be used to transfer the bacterial cells into TE buffer or directly into GES reagent. Gloves must be worn and care taken when using GIC because it is poisonous. 2. For some bacteria (e.g., Helicobacter pylori), cell suspensions may be made directly into GES reagent, without the need for prior resuspension in TE buffer. 3. The cell disruption stage of the DNA preparation procedure can prove to be the most difficult because some cell walls are extremely resistant, especially those of Gram-positive
bacteria. Gram-positive
walls are relatively thick
146
Bickley and Owen
structures consisting of peptidoglycans, teichoic and teichuromc acids, and polysaccharrdes. In contrast, the Gram-negative wall has several layers that include a thin layer of pepttdoglycan and an outer membrane with polysacchatlde attached. Considerable variation exists between different bacterial groups in the chemical structure of the various categories of polymers present in the cell wall. This is an important factor contributing to the ease or difficulty of achieving lysis. Some Gram-positive organisms may not be lysed by lysozyme and require the addition of other lytic enzymes. For example, Streptococci are treated with mutanolysin, and Staphylococci with lysostaphin, as outlined in the following: a. Mutanolysm m TE glucose: i. TE glucose: 100 mM Tns-HCl, 10 mM EDTA, 25% (w/v) glucose, pH 7.0. Store frozen. ii. Prepare a 2 mg/mL stock solution of mutanolysin in TE glucose. Dilute l/100 for a 20 pg/mL enzyme solution and store frozen at -20°C. Add 100 uL of this mutanolysm solution to the bacterial cells, resuspend, and incubate in a 37°C water bath for 1 h. Then contmue from Section 3., step 2. b. Lysostaphm: 1. Resuspend cells of Staphylococcus aureus, for example, in 100 pL lysostaphin (50 pg/rnL) in O.lM sodium phosphate at pH 7.0. Incubate the suspensions at 37°C for 30 mm, before adding the GES reagent. Continue then from Section 3., step 2. 4. The purity of DNA obtained by the GES method is assessedby optical density readings and electrophoresis in agarose gels, to show that the samples are essentially free of contaminating protems, RNA, and other molecules that absorb at 260 nm. The product will contain some RNA, but this does not necessarily affect subsequent use of the DNA, e.g., in digest analysis (see Note 5). Digestion of DNA with restriction enzymes to yield a characteristic band pattern can be used to show that the DNA is double stranded and free of residual GIC and other enzyme-inhibiting molecules. In some cases,however, additional purification of DNA may be required, for example, in the estimation of base compositions (mol % G + C), or DNA-DNA hybridization. This can be done by adding purification steps to the basic GES method, but may result in a substantial drop in the final yield of DNA. The first additional step 1sIntroduced after the sample has been mtxed with ammonium acetate and chloroform reagent, and has been spun down. Transfer the supernatant to a clean Eppendorf tube and add an equal volume of phenol. Mix well and leave on ice for 10 min. Spin the
Preparation
of Bacterial
Genomic DNA
147
tubes in a microfuge at top speed for 10 min. Extract the upper aqueous phase twice with chloroform. As m the standard procedure, precipitate the DNA by the addition of isopropanol, wash it three times with 70% ethanol, and dry it down under vacuum. Redissolve the DNA overmght m 300 p,L RNAse SET solution (50 l.tg/ mLRNAseAm60 mMTris-HCl,pH8.3, 150mMNaCl,7.5 mMEDTA). Add l/100 vol of 5M NaCl(3 uL) and proteinase K (20 mg/mL stock) to a final concentration of 50 pg/mL and incubate at 50°C for 1 h. Proteinase K destroys endonucleases that may degrade DNA. Extract the samples twice with phenol, twice with chloroform, and dialyze them against 1X TE for at least 3 h at 4”C, usmg dialysis tubing. The purity of the DNA samples can then be assessed by measurement of their optical densities at 230,260, and 280 nm as before. 5. Depending on the DNA concentration, a volume containing 5 l.tg DNA is used for restriction digestion, typically 5-10 FL of DNA sample. Occasionally, DNA prepared using this method may not be digested by some endonucleases, e.g., HindIII. This may be owing to residual GIC affecting the activity of the enzyme. An alternative method of DNA preparation can be applied in such cases, for example, the cetyltrimethylammomum bromide (CTAB) method (4).
Acknowledgments
We thank D. G. Pitcher for his developmental work on the GES method, and J. Hernandez for the preparation of Fig. 1. References 1. Marmur, J. (1961) A procedure for the isolation of deoxyribonucleic acid from micro-organisms J Mol. Biol. 3,208-218 2 Kirby, K. S. (1964) Isolation and fractionation of nucleic acids. Progr. Nucl. Acids Rex 3, 1. 3. Pitcher, D. G., Saunders, N. A., and Owen, R. J. (1989) Rapid extraction of bacterial genomic DNA with guanidium throcyanate. Lett. Appl. Microbial. 8,151-156 4 Wilson, K. (1987) Preparation of genomic DNA from bacteria, in Current Protocols m Molecular Biology (Ausubel, F. M., Brent, R Kingston, R. E., Moore, D. D., Smith, J. A., Seidman, J. G., and Struhl, K.), Wiley, New York, pp. 2 4.1.. 2.4.2.
CHAPTER15
Pulsed Field Gel Electrophoresis Alan
J. Hillier
and Barrie
E. Davidson
1. Introduction The technique of pulsed field gel electrophoresis (PFGE) enables researchers to separate linear DNA fragments of up to 10 Mb. The technique was first described by Schwartz and Cantor (I) and differs from conventional gel electrophoresis by requiring the DNA molecules periodically to change their direction of migration. 1.1. Types of PFGE
Several types of PFGE have been described, all of which utilize the basic principle of applying an electric field alternately in two different directions. Their difference lies in the manner in which the alternating electrical fields are generated. The original pulsed field gradient gel electrophoresis system of Schwartz and Cantor (1,2) and orthogonal field-alternation gel electrophoresis (OFAGE; 3) utilize arrays of point electrodes that yield nonhomogeneous electric fields and nonlinear lanes in the final migration pattern. In transverse alternating field electrophoresis (TAFE) the gel is run in a vertical position and the electric field is applied at an angle to the face of the gel plates (4,5). This eliminates the distortion of DNA migration seen with OFAGE. Field inversion gel electrophoresis (FIGE; 6) involves a periodic inversion of the electric field. Forward movement of the molecules is obtained by using either a shorter pulse time or a lower field strength for the reverse direction. FIGE results in linear migration of DNA, yielding linear lanes, but DNA mobilities are not always monotonic with size for From Methods m Molecular Biology, Vol 46: Diagnostrc Bacterrology Protocols Edited by J. Howard and D M Whltcombe Humana Press Inc , Totowa, NJ
149
150
Hillier
and Davidson
DNA molecules > 2 Mb, i.e., DNA molecules that differ markedly in size can sometimes comigrate in FIGE (6). Contour-clamped homogeneous electric field (CHEF) electrophoresis, first described by Chu et al. (7), utilizes multiple electrodes arranged along a closed contour and clamped to predetermined electric potentials equal to those calculated to be generatedby two parallel, infinitely long electrodes. Thus, at any position within the contour, the potential will be equal to that generatedby two infinite electrodes. This arrangement overcomes the distortion of migration of DNA caused by nonhomogeneous electric fields. One of the systems described by Chu et al. (7) generated a homogeneous electric field that alternated between two orientations 120” apart. The principles of the CHEF system were further advanced by Clark et al. (8) who developed a programmable, autonomously controlled electrode gel electrophoresis (PACE) system that allows independent regulation of 24 electrodes in a hexagonal array. This system allows the magnitude, orientation, homogeneity, and duration of the electric field to be controlled precisely and results in a better resolution of DNA fragments over an extensive size range. of DNA Molecules A number of factors are known to affect the resolution of linear DNA fragments by PFGE. These include the topology of the DNA, the time interval between reorientation of the electric field (pulse time), the angle at which the alternating electric fields are applied (reorientation angle), the field strength, the gel concentration, and the temperature at which the electrophoresis is run. A comprehensive analysis on the effect of these variables on DNA migration has been performed by Birren et al. (9). Linear and circular DNA molecules of the same size migrate differently in PFGE. Open circular DNA molecules do not enter the gel matrix. Thus, most bacterial chromosomes, which are circular, and the nonsupercoiled form of plasmids are not amenable to analysis by PFGE unless the DNA is linearized by treatment with a restriction endonuclease. Supercoiled circular plasmid DNA enters the gel and molecules of different sizes can be resolved. Because the mobilities of isometric linear and supercoiled circular DNA molecules are different and exhibit different responses to variations in pulse time, linear molecules cannot be used as standards in PFGE for determining the sizes of supercoiled circular plasmid molecules. 1.2. Factors
Affecting
Resolution
Pulsed Field Gel Electrophoresis
151
The pulse time has a major effect on the mobility of the DNA molecules. Thus, the pulse time used in any PFGE application depends on the size range of DNA molecules being separated. Generally speaking, the larger the molecule the longer the pulse time required for resolution. At any given pulse time, DNA molecules greater than an upper limit do not have sufficient time to reorient to the changing electric field and therefore migrate along the line of the average electric field. These DNA molecules are not resolved. Conversely, molecules less than a lower limit become completely reoriented in the direction of the electric field and so move as in conventional electrophoresis. These molecules usually migrate off the end of the gel. Thus, these upper and lower limits of DNA fragment size define the useful range of separation for any given pulse time. In practice, this range can be significantly extended in a given PFGE separation by varying the pulse time during the electrophoresis. In commercial PFGE apparatuses the pulse times for a separation can be preprogrammed over a wide range, sometimes using computerdriven algorithms, to achieve optimal separation of molecules in a chosen size range. Reorientation angles of less than 90” do not give effective separation of large DNA molecules (7). This is presumably because the DNA molecules easily become oriented midway between the two applied fields (10). Most CHEF systems have a reorientation angle that is set to 120”. However, in PACE systems, it is possible to vary the reorientation angle. Variation between 105” and 165” has no effect on the resolution of large DNA molecules (9) but at smaller angles the mobility of the DNA is increased (9,lO). This behavior can be exploited to shorten the run time required to separate large DNA molecules (9,lO) and in this case may lessen losses due to shearing. The mobility of the DNA increases with increasing temperature of electrophoresis, thus permitting shorter run times. However, the resolution of fragments is reduced at the higher temperatures (9). Because the effect of temperature on fragment mobility is more pronounced with PFGE than in conventional electrophoresis, there is a need for good temperature control. Similarly, increasing the field strength increases the migration of DNA molecules, but decreasesthe resolution obtained. Increasing the gel concentration decreasesthe mobility of all sizes of DNA molecules, thus improving resolution. Some band sharpening may also occur because of the difference in agarose concentration between
Hillier
152
and Davidson
the electrophoresis gel and the agarose containing the digested sample. However, the size range of the fragments separatedis decreased at higher agarose concentrations as is the size of the DNA undergoing optimal resolution (9). 1.3. Models
to Explain the Migration of DNA During PFGE
Properties
A number of models have been proposed to explain the migration of DNA molecules observed during PFGE. An early model of Southern et al. (I 1) argues that DNA molecules move through the gel in a fully extended conformation and that reorientation of the field by an angle >90° causes the molecules to reorient with their former trailing ends as the new leading ends. The reptating chain model (12-14) predicts that DNA molecules move through a tube in the gel in a serpentine motion, with each step forward in a random direction, but with a bias in favor of the electric field direction. A third model predicts that the molecules move through the gel like a flexible chain moving through a lattice of obstacles (1516). More recently, the DNA has been proposed as moving through the gel as a deformable bag (17). This model provides guidelines for setting experimental parameters in PFGE. 1.4. Applications
of PFGE
PFGE has provided a means of analyzing the genome of bacteria that could not be studied by classical genetic techniques, as well as providing additional information for well-studied genera (18). Physical maps of the genome from many bacterial genera have been constructed by the use of PFGE to separate large restriction fragments generated by digestion with infrequently cutting restriction enzymes (19). The information used to construct a physical map of the genome also provides information on the size and shape (circular vs linear) of the bacterial genome (19-26). The physical maps generated by PFGE can be used to construct genetic maps by hybridization of cloned genes to restriction fragments that have been mapped on the physical map (20,27,28). Comparison of the physical and genetic maps can also be used to study rearrangements, insertions, and deletions in the chromosomes of related strains and species (19,29). In addition, the genetic maps can be used to study the functional arrangements of genes in the bacterial genome (30) and the apparently nonrandom location of functionally related genes (19).
Pulsed Field Gel Electrophoresis
153
The pattern of restriction fragments obtained by digestion of bacterial genomes with restriction enzymes which cut the genome infrequently has been successfully applied to the identification of strains of bacteria (31-36). Similar approacheshave also been used in epidemiological studies of pathogens isolated from various geographical centers (34,36,37). 1.5. Procedures Described in this Chapter Methods for the preparation of high molecular weight genomic DNA in situ in agarose plugs, digestion (partial and complete) of the DNA with restriction endonucleases, and resolution of the resulting fragments in pulsed field gels are presented in this chapter. A procedure is also described for two-dimensional PFGE. DNA is digested with a restriction endonuclease and the resulting DNA fragments are resolved by electrophoresis in the first dimension. The resolved fragments are located, digested with a second restriction endonuclease, and the products of the double digestion resolved by a second electrophoresis step. This procedure is useful in the construction of chromosomal maps. Electrophoresis conditions used to resolve DNA fragments of various sizes are also discussed. 2. Materials 2.1. Reagents for the Preparation of DNA in Agarose Plugs 1. Chloramphenicol: 4% (w/v) stock solution in 95% ethanol. Store at -20°C for up to 2 mo. 2. Tris/NaCl buffer: 10 mM Tris-HCl, pH 7.6, 1M NaCl. Autoclave and store indefinitely at room temperature. 3. EC lysis buffer: 6 mMTris-HCl, pH 7.6, lMNaC1,lOO mM EDTA (adjusted to pH 7.6 with NaOH), 1% (w/v) N-lauryl sarcosine. Autoclave and store indefinitely at room temperature. Immediately before use, add 1 mg/mL lysozyme (-50,000 Wmg). 4. Agarose: 2% (w/v) low gelling temperature agarose (e.g., FMC Sea plaque) in Tris/NaCl buffer. Dissolve the agarose by microwave treatment or by boiling for 15 min, then equilibrate at 42OCfor use. Note that this agarose is used only for the preparation of plugs containing bacterial cells and that a different type and concentration of agarose 1sused to prepare the agarose gels for electrophoresis. 5. ES buffer: 500 rnM EDTA (adjusted to pH 9-9.5 with NaOH), 1% (w/v)
N-lauryl sarcosme.Autoclave and storeindefinitely at room temperature,
154
Hillier
and Davidson
6. ESP buffer: 0.1% (w/v) protemase K (-20 Wmg) in ES buffer. Prepare immediately before use. 7. TE buffer: 10 mA4Tris-HCl, pH 8.0, 1 mM EDTA, pH 8.0. Autoclave and store indefinitely at room temperature. 8. Phenylmethylsulfonyl fluoride (PMSF): Prepare a stock solution of 140 rnJ4 (25 mg/mL) in 95% ethanol. Store at 4OCfor up to 12 mo. Immediately before use, dilute to 1 mM in TE (70 pL stock solution into 10 mL of TE). Caution: PMSF is an inhibitor of serine proteases and is therefore poisonous. 9. Block-molds: These are usually supplied as strips with the PFGE equipment. The molds must be completely clean and nuclease free. Before use, seal the underside with sticky tape and chill the assembly to make the blocks set more quickly when poured. This should produce a homogeneous block wrth no tendency of the cells to settle to the bottom. 2.2. Reagents for Restriction Endonuclease Digestion 1. Restriction endonucleases: Usually supplied at 10 U/pL. Some manufacturers supply high concentration enzymes specifically for use with pulsed field gels. 2. Restrictron endonuclease buffers (10X concentrates): Supplied with the enzymes. Recipes are usually supplied in the manufacturer’s catalog. Larger volumes may be required m order to equilibrate agarose plugs m buffer and magnesium-free buffers are required for the protocols involving partial digestion. 2.3. Reagents for the Preparation and Ebctrophoresis of Agarose Gels 1, 0.5X TBE buffer: 45 mM Tris, 45 mM boric acid, 1 mM EDTA, pH 8.3 (38). 2. 0.5X TPE buffer: 40 mM Tris-phosphate, 4 rniV EDTA, pH 8.6 (38). 3. Agarose: l&1.2% (w/v) analytical grade agarose dissolved m electrophoresis buffer (0.5X TBE or 0.5X TPE) as described m Section 2.1, and cooled to 60°C prior to casting the gel. 4. Ethidium bromide: 0.5 pg/mL in electrophoresis buffer, for staining gels after electrophoresis. 5. PFGE apparatus and controller: The electrophoresis tank must be level. To generate reproducible results, a constant gel temperature is important, so the running buffer is cooled. Electrical field switching and programmable pulse time are achieved by an electronic controller. 2.4. Molecular Weight Size Markers for PFGE The size of DNA fragments separated by PFGE is determined by comparison of the mobilities of the fragments with those of known standards.
155
Pulsed Field Gel Electrophoresis
High molecular weight DNA standards,in agaroseplugs, which are available commercially include: 1. Concatamers of bacteriophage h DNA (size range 48.5 kb to -1 Mb in multiples of 48.5 kb). 2. Chromosomes of Saccharomyces cerevisiae (225 kb to 2.2 Mb). 3.1. Preparation
3. Methods of DNA In Situ in Agarose
Plugs
3.1.1. Growth of Cells 1. Dilute an overnight culture of cells grown in a rich medium (e.g., 2YT broth [39] for E. coli, Ml7 [40] for streptococci or lactococci) 1:lOO in fresh medium and grow to an A,,, of 0.6 (-lo* cells/ml). 2. Add chloramphenicol to a fin al concentration of 100 p,g/mL (1:40 dilution of the stock) and incubate for an additional 1 h (see Note 1). 1. 2. 3. 4. 5. 6.
3.1.2. Incorporation of Cells into Agarose Plugs Harvest the cells from 1 mL of culture by centrifugation for 30-60 s in a microfuge. Resuspend the cells in 1 mL of Tris/NaCl buffer and centrifuge as in step 1. Resuspend the pellet in 300 pL of Tris/NaCl buffer. Raise the temperature of the cell suspension to 42”C, add an equal volume of 2% agarose (at 42”(Z), and mix by prpeting up and down. Dispense -100 PL of the agarose/cell suspension into each well of the molds (-5 x 2 x 10 mm as supplied by Pharmacra-LKB, Uppsala, Sweden), taking care not to produce bubbles. Allow the agarose to solidify by placing the molds on a level shelf m the fridge or resting them on ice for 5-10 min. Plugs with a lo-fold higher DNA concentration can be made for certain procedures, such as two-dimensional PFGE: Resuspendthe cells from 10 mL of culture in the 300 pL of Tris/NaCl buffer prior to the addition of agarose. 3.1.3. Preparation
of DNA In Situ in Agarose Plugs
Most of the procedures that involve the preparation and washing of plugs are conveniently performed in sterile 50-mL polypropylene centrifuge tubes. 1. Carefully expel the agarose plugs from the mold into 2 mL of EC lysis buffer, and incubate them overnight at 37OC.Take care to ensure that the plugs are well separated and fully submerged in the buffer. 2. Transfer the plugs to the same volume of ESP buffer and incubate at 37OC for 48-72 h.
Hillier
and Davidson
3. Transfer the plugs to 2 mL of PMSF, incubate at 25OCfor at least 4 h, and repeat the procedure with another 2 mL of PMSF for 16 h at 25OC. 4. Wash the plugs with TE at 25°C (three washes of 2 h with 20 mL of buffer each time). The plugs can be used at this stage for restriction endonuclease digestions (see Section 3.2.), or stored. Store the plugs at 4°C either in TE for short-term requirements (up to 1 mo) or in 500 m&f EDTA (pH 8.0) for long-term storage (up to 12 mo, and possibly longer). With prolonged storage, smaller DNA molecules such as plasmids will diffuse out of the block mto the surrounding buffer. 3.2. Digestion of the DNA with Restriction Endonucleases Set up the digestions as follows (see Note 2). 1. 2. 3. 4. 5. 6.
3.2.1. Digestion with a Single Enzyme Wash an agarose plug with TE at 0°C (2 x 20 mL for 25 mm each). Wash the plug with 1X restriction endonuclease digestion buffer at 0°C (two washes of 25 mm with 10 mL of buffer each time). Swirl the tube occasionally during these washes to ensure mixing of the liquid phase. Transfer the plug to parafilm and use a sterile scalpel to cut it in slices. A slice of l-2 mm thick is adequate for most digestions. Transfer the slice to an autoclaved 2-mL microfuge tube containing lo20 U of restriction endonuclease m 100 l,tL of 1X buffer. Digest the DNA by incubating for a minimum of 3 h at the appropriate temperature (see Note 3). Wash the slices in 1.5 mL of electrophoresis buffer for 25 min at 0°C. Alternatively the slices may be washed in TE and stored as described m Section 3.1.3., bearing in mind that small DNA digestion fragments are prone to loss by diffusion out of the agarose.
3.2.2. Partial Digestion of DNA in Agarose Plugs The following procedure is based on the method of Albertson et al. (41) (see Note 4). 1. Incubate a slice of an agarose block (Section 3.2-l.) and 5-20 U of enzyme in 100 ltL of 1X magnesium-free restriction endonuclease buffer for 2 h at 0°C. 2. Add MgClz to a final concentration of 0.5 r&f and incubate for 1 h at the appropriate temperature. 3. Stop the reaction by replacing the buffer with 1.5 mL of cold electrophoresis buffer and placing at 0°C (see Note 5).
Pulsed Field
157
Gel Electrophoresis
3.2.3. Digestions
for Two-Dimensional
PFGE
Isolation of restriction fragments in excised agaroseblocks after PFGE and their redigestion in situ with a second enzyme has been extremely useful in the construction of chromosomal maps for a number of bacteria (21,27,42-44) (see Note 6). 1, Digest the DNA in agarose with restriction endonuclease 1 as described in Section 3.2.1.) using slices of plugs containing 10 times the DNA concentration (see Section 3.1.2.). 2. Apply samples of the same digest to adjacent lanes and separate the fragments by PFGE through high quality 1% (w/v) agarose (see Note 7). 3. After electrophoresls, recover the gel on a transparent gel lifter and cut the gel lengthways with a scalpel between the two lanes containing the dlgestion products, Stain one portion of the gel with ethidmm bromide and photograph it with UV illumination, alongside a ruler. 4. Use the resulting information to excise bands of interest from the unstained portion of the gel (e.g., after placing the gel lifter on top of a sheet of premarked graph paper). For subsequent ease of handling, the length of an excised block should not exceed 20 mm. 5. Wash the excised agarose blocks (-15 x 8 x 4 mm) at 37°C with occasional swirling (two washes of 1 h in 20 mL of TE). 6. Wash the agarose block twice with 10 mL of restrictlon endonuclease buffer under the same conditions. 7. Transfer each agarose block to an autoclaved 2-mL microfuge tube containing 80 U of restriction endonuclease 2 in 800 PL of buffer and incubate at the appropriate temperature for 16 h. Increase or decrease the incubation volume proportionately for smaller or larger agarose blocks, maintaining the same enzyme concentration. 8. After digestion, equilibrate the blocks m electrophoresis buffer (see Section 3.2.1.). 9. Electrophorese the double digestion products, as described in Section 3.3., through 1.2% (w/v) agarose. It will be necessary to excise a portion of the agarose from the origin region to allow the insertion of the agarose blocks. If these blocks are placed in the gel such that the second direction of mlgratlon is at 90” to the first (i.e., the top of the block becomes the leading edge of the block for the second dimension), the different agarose concentrations in the blocks and the gel (1 .Oand 1.2%, respectively) will give band sharpening and enhanced sensitivity. 10. Seal the blocks in position with molten low gelling temperature agarose. Include a sample of each single digest and the double digest in the gel to enable accurate interpretation of the results.
158
Hillier
and Davidson
Fig. 1. (A) Two-dimensional PFGE separation of the DNA fragments generated by SmaI-MZuI and MZuI-SmaI double digests of Borrelia burgdorferi 212 chromosomal DNA. The left half of the gel shows the products from SmaI fragments, separated by PFGE in the first dimension in the direction of the arrow, and then digested with MM; the right half shows the products from MZuI fragments, separated by PFGE in the first dimension in the direction of the arrow, and then digested with SmuI. The individual lanes contain h DNA concatamers (lane h), a Hind111digest of h DNA (lane h), and B. burgdorferi 212 chromosomal DNA digested with MZuI + SmuI (lane l), SmaI (lane 2), and MZuI (lane 3). The pulse times for the second dimension were 3 s for 10 h, 5 s for 9 h, and 25 s for 3 h. 11. After electrophoresis, stain the gel with ethidium bromide and photograph it with UV illumination. An example illustrating the application of two-dimensional PFGE to the mapping of the chromosome of Borreliu burgdor-eri is shown in Fig. 1. 3.3. Elec tophoresis 3.3.1. Preparation and Loading of Agarose Gels 1. Pour the molten l.O-1.2% (w/v) agarose (see Section 2.3.) into the gel casting stand. Preparation of agarose in 0.5X TBE buffer is satisfactory for routine use.
Pulsed Field Gel Electrophoresis
159
B
kb
t
310 -, 133I=
s
88.6-
-
-A
7
2
.-0
B Gd
44.323.1-
-
0 -
0
i-0
Od Oe
%
&=sD
b c
00
-B
d--F e-
-E
Oi
k
F-K 0 nl
9.4-
-
6.6-
-
0 P
P==
Fig. 1, (B) Schematic representation of the results shown in (A). The uppercase letters alongside the open fragments and along the top show the locations of the SmaI and MM single-digest fragments, and the italic lowercase letters show the locations of the double-digest fragments. Stippled spots indicate partial digestion products, and closed bands indicate h DNA size markers. Numbers on the left are sizes of the size markers at the positions shown by the bars (reproduced from ref. 21 with permission). 2. Position the well forming comb approx 2 mm above the surface of the gel forming stand and approx 1 cm from one of the ends. 3. Allow the agarose to cool at room temperature for -45 min and carefully remove the comb. 4. Place the agarose slice containing the DNA (see Section 3.2.1.) on the flat end of a small sterile spatula and insert it in the well with the assistanceof a Pasteur pipet having a sealed end. Avoid trapping air bubbles underneath the slice or carefully draw out any trapped air from behind and below the block, using a fme gage needle attached to a syringe. 5. Seal the blocks m position with molten low gelling temperature agarose in 0.5X TBE.
Hillier
160
and Davidson
3.3.2. Electrophoresis Conditions The electrophoresis conditions will depend on the size of the fragments to be separated, the size of the gel, and the type of apparatus used. The use of ramped pulsed times, wherein the pulse time is varied during the electrophoresis run, gives improved resolution of fragments in a particular size range. For a CHEF apparatus with a fixed reorientation angle of 120” (e.g., BioRad [Richmond, CA] CHEF-DRII electrophoresis apparatus) and 1.0-l .2% agarose gels, we have used field strengths of 6 V/cm for 16-22 h at 15°C. An indication of the required pulsed times are given. 1. For DNA fragments m the range 8-100 kb, use a ramped pulse ttme of l-5 s. 2. For DNA fragments m the range 50-240 kb, use a ramped pulse time of l-20 s. 3. For DNA fragments in the range 200-800 kb, use a ramped pulse time of 40-80 s. 3.3.3. Detection of DNA Fragments 1. Immerse the gel in electrophoresis buffer contammg 0.5 pg/mL ethidium bromide for 20 min. 2. Destain the gel for 30 mm m dtstilled water. 3. Bands are visible at this stage under UV illummation. 4. For clearer results (reduced background staining), destain the gel overnight at room temperature (4°C for fragments of less than 10 kb) in dtstilled water.
4. Notes 1. The chloramphenicol is added to arrest the imtiation of DNA replication, because there is evidence that DNA molecules containing replication forks remain in the well during PFGE (45). 2. Successful execution of the procedures described m this section, particularly in Section 3.2.3., requires particular care to avoid the contammation of plugs with deoxyribonucleases. An effective way to ensure this is to perform all mampulations of plugs and slices with sterile implements on a nucleasefree surface of fresh parafilm. Thus, plugs can be transferred satisfactorily with spatulasthat are stored in alcohol and flamed before use, or with Pasteur pipets that are freshly sealed and shaped for the purpose m a flame. 3. If desired, a number of slices can be digested m the same tube, or a larger slice can be digested and then cut into smaller pieces. Under these circumstancesit may be necessary to increase the quantity of buffer and enzyme. There are considerable differences between restriction endonucleases in the ratio of their activities in agarose plugs and in solution, The catalogs of
Pulsed Field Gel Electrophoresis
4.
5. 6.
7.
some of the commercial supphers of restriction endonucleases, e.g., New England Biolabs (Beverly, MA), contain useful information on this point. Because of the relatively slow rate of diffusion of restriction endonuclease molecules through agarose compared with their rates of digestion, short incubation ttmes achieve complete digestion of a fraction of the DNA molecules rather than partial digestion of them all. One way around this is to allow an inactive enzyme to diffuse mto the slice in the absence of Mg2+, then to initiate digestion by adding Mg2+. The small Mg2+ ton diffuses rapidly. When using an enzyme for the first time it is prudent to perform a number of incubations that span a range of enzyme and/or Mg2” concentrations to ensure that the desired partial digestion is obtained. This section describes the procedure for a two-dimensional gel using restriction enzyme 1 for the first digestion and restriction enzyme 2 for the second. To maximize the mapping data that can be obtained from this method, the reciprocal two-dimensional gel using the enzymesin the reverse order should also be performed. The use of 0.5X TEE buffer (see Section 2.2.) for electrophoresis at this step results in poorer resolution of fragments, but may enhance subsequent digestion of the DNA with the second enzyme.
Acknowledgments We thank Lloyd R. Finch and the members of the Hillier, Davidson,
and Saint Girons Laboratories for their assistance in developing our PFGE techniques. References 1. Schwartz,D. C and Cantor, C. R (1984) Separationof yeastchromosome-sized DNAs by pulsed field gradrentgel electrophoresis.Cell 37,67-75. 2. Schwartz,D. C., Saffran, W , Welsh, J., Haas, R., Goldenberg, M., and Cantor, C. R. (1983) New techniques for purrfying large DNAs and studying their properties and packagmg. Cold Spring Harbor Symp. Quant. Biol. 47, 189-195 3. Carle, G. F. and Olsen, M. V. (1984) Separation of chromosomal DNA molecules from yeast by orthogonal-field-alternation gel electrophoresis. Nucleic Acids Res. 14,5647-5664.
4. Gardiner, K., Laas, W., and Patterson, D. (1986) Fractionation of large mammalian DNA restrictron fragments using vertical pulsed-field gradient gel electrophoresis. Somatic Cell Mol. Genet. 12,185-189. 5. Gardiner, K. and Patterson, D. (1988) Transverse alternating electrophoresis. Nature 331,371,372.
6 Carle, G. F., Frank, M., and Olsen, M. V. (1986) Electrophoretic separations of large DNA molecules by periodrc inversion of the electric field. Science 232,65-68.
262
Hillier
and Davidson
7. Chu, G., Vollrath, D., and Davis, R W. (1986) Separation of large DNA molecules by contour-clamped homogeneous electric fields. Science 234, 1582-1585. 8. Clark, S. M., Lai, E., Birren, B W., and Hood, L (1988) A novel Instrument for separating large DNA molecules with pulsed homogeneous electric fields Sczence 241,1203-1205.
9. Birren, B. W , Lai, S. M., Clark, L., and Simon, M. I. (1988) Optimized conditions for pulsed field gel electrophoretic separations of DNA. Nuclerc Acids Res. 16, 7563-7582.
10. Cantor, C R., Smith, C L., and Mathew, M. K. (1988) Pulsed-field gel electrophoresis of very large DNA molecules. Ann. Rev Brophys. Chem. 17,287-304. 11. Southern, E M., Anand, R., Brown, W. R. A , and Fletcher, D. S. (1987) A model for the separation of large DNA molecules by crossed field gel electrophoresis. Nucleic Acids Res. 15,5925-5943.
12 Lerman, L. S and Frisch, H. L (1982) Why does the electrophoretic mobtllty of DNA in gels vary with the length of the molecule? Biopolymers 21,995-997. 13. Lumpkin, 0 J , Dejardin, P., and Zimm, B. H (1985) Theory of gel electrophoresis of DNA. Biopolymers 24,1573-1593. 14. Slater, G. W. and Noolandi, J. (1989) Effect of nonparallel alternating fields on the mobility of DNA in the biased reptatton model of gel electrophoresis. Electrophoresis
10,413428.
15. Deutsch, J. M. (1988) Theoretical studies of DNA durmg gel electrophoresis. Sclence 240,922-924 16. Deutsch, J. M. and Madden, T. L. (1989) Theoretical studies of DNA during gel electrophoresis. J. Chem. Phys. 90,2476-2485. 17. Chu, G. (1991) Bag model for DNA migration during pulsed-field electrophoresis Proc. N&l. Acad Sci USA 88, 11,071-l 1,075. 18. Holloway, B. W. (1993) Genetics for all bacteria. Annu Rev. Microbrol. 47, 659-684.
19. Krawiec, S. and Riley, M. (1990) Organization Microbial.
of the bacterial chromosome.
Rev. 54,502-539.
20. Smith, C. L. and Condemine, G. (1990) New approaches for physical mapping of small genomes. J. Bacterial. 172, 1167-l 172. 21. Davidson, B E., MacDougall, J., and Saint Girons, I (1992) Physical map of the linear chromosome of the bacterium Borrelia burgdotferi 212, a causative agent of Lyme disease, and localization of rRNA genes. J. Bucteriol. 174,3766-3774. 22. Old, I. G., MacDougall, J., Saint Guons, I., and Davidson, B E. (1992) Mapping of genes on the linear chromosome of the bacterium Borrelm burgdorferi: possible locations for its origin of replication. FEMS Microbial Lett 78,245-250. 23. Suwanto, A. and Kaplan, S. (1989) Physical and genetic mapping of the Rhodobacter sphaeroides 2.4.1 genome: presence of two unique circular chromosomes. J. Bactenol. 171,58X)--5859. 24. Suwanto, A. and Kaplan, S. (1989) Physical and genetic mapping of the Rhodobacter sphaeroides 2 4.1 genome’ genome size, fragment identification, and gene localization. J. Bacterial 171,5840-5849
Pulsed Field
Gel Electrophoresis
25. Leblond, P., Redenbach, M , and Cullum, J. (1993) Physmal map of the Streptomyces lwdans 66 genome and comparrson with that of the related strain Streptomyces coelicolor A3(2). J. Bacterial. 175,3422-3429. 26. Michaux, S., Paillisson, J., Carles Nurit, M. J., Bourg, G , Allardet Servent, A., and Ramuz, M (1993) Presence of two independent chromosomes in the Brucella melitensis 16M genome. J. Bactenol. 175,701-705 27. Tulloch, D L., Finch, L R , Hillier, A. J , and Davidson, B. E. (1991) Physical map of the chromosome of Lactococcus lactis subsp. lactis DLl 1 and localization of SIX putative rRNA operons J. Bactenol. 173,2768-2775 28 Hantman, M. J., Sun, S , Ptggot, P. J., and Daneo Moore, L. (1993) Chromosome organization of Streptococcus mutans GS-5. J Gen. Microbial. 139, 67-77. 29. Kohara, Y., Akiyama, K., and Isono, K (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomrc library. Cell 50,495-508. 30. Zeigler, D. R. and Dean, D. H. (1990) Orientation of genes in the Bacillus subtilis chromosome, Genetics 125,703-708. 31 Tanskanen, E. I , Tulloch, D L., Hillier, A. J., and Davidson, B. E. (1990) Pulsed-field gel electrophoresis of SmaI digests of lactococcal genomtc DNA, a novel method of strain Identification Appl Environ Microbial 56, 3 105-3 111. 32 Gordillo, M. E., Singh, K V , and Murray, B. E. (1993) Comparison of ribotyping and pulsed-field gel electrophoresis for subspecres drfferentiatron of strains of Enterococcus faecalu. J. Clm. Microbial 31, 1570-1574. 33. Gordrllo, M E., Singh, K. V , Baker, C. J., and Murray, B. E. (1993) Typing of group B streptococci: comparrson of pulsed-field gel electrophoresis and conventional electrophoresis J Clin Microbial. 31, 1430-1434. 34. Poh, C. L. and Lau, Q. C. (1993) Subtyping of Neisseria gonorrhoeae auxotype-serovar groups by pulsed-field gel electrophoresis. J. Med. Microbial. 38,366-370. 35. Saulnier, P., Bourneix, C., Prevost, G., and Andremont, A. (1993) Random amplified polymorphic DNA assay is less drscriminant than pulsed-field gel electrophoresis for typing strains of methicillin-resistant Staphylococcus aureus. J, Clin. Microbial. 31,982-985. 36 Schlichting, C., Branger, C., Fournier, J. M., Witte, W., Boutonnier, A , Wolz, C., et al (1993) Typing of Staphylococcus aureus by pulsed-field gel electrophoresis, zymotyping, capsular typing, and phage typmg: resolution of clonal relationships. J. Clin. Microbial 31,227-232. 37. Buchrieser, C., Brosch, R , Catrmel, B., and Rocourt, J. (1993) Pulsed-field gel electrophoresis applied for comparmg Listeria monocytogenes strains mvolved in outbreaks. Can J. Microbial. 39,395401 38. Sambrook, J , Fritsch, E. F., and Maniatls, T. (1989) Molecular Cloning: A Laboratory Manual, 2nd ed , Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. 39. Miller, J. H. (1972) Experiments in Molecular Genetics, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. 40 Terzaghi, B. E. and Sandine, W. E. (1975) Improved medium for lactic streptococci and their bacteriophages. Appl. Microbial 29,807-813.
Hillier
and Davidson
41. Albertson, H. M., LePaslier, D , Abderrahrm, H., Dausset, J., Cann, H., and Cohen, D. (1989) Improved control of partral DNA restriction enzyme digest m agarose using limiting concentrations of Mg++. Nucleic Acids Res. 17, 808. 42. Pyle, L and Finch, L R. (1988) A physical map of the genome of Mycoplusma mycoides Y with some functional loci. Nucleic Acids Res. 16,6027-6039. 43. Cocks, B. G., Pyle, L. E., and Finch, L. R. (1989) A physical map of the genome of Ureaplasma urealyticum 960T with rrbosomal RNA loci. Nucleic Acids Res. 17, 6713-6719. 44. Bautsch, W. (1988) Rapid physical mapping of the Mycoplasma mobile genome by two-dimensional field inversion gel electrophoresis techniques. Nucleic Acids Res. 16, 11,461-11,467. 45. Pyle, L. E. and Finch, L. R. (1988) Preparation and FIGE separation of infrequent restriction fragments from Mycoplasma mycoides DNA. Nucleic Acids Res 16, 2263-2268.
CHAPTER16
Application of Total DNA Restriction Pattern Analysis to Identification and Differentiation of Bacterial Strains Luciana
Giovannetti
and
Stefano
Ventura
1. Introduction Total DNA restriction pattern analysis is one of the techniques commonly used to identify and group bacteria (I-11). This technique can be used to separate species belonging to the same genus (12,13) or to distinguish highly similar bacterial strains within the same species or subspecies (14-16). Restriction pattern analysis is based on the well-known feature of bacterial restriction endonucleases, namely, that they cut the double strand of DNA when they recognize short specific sequences.Fragments obtained by the digestion of chromosomal DNA with a restriction endonuclease can be separated by electrophoresis generating a band pattern that constitutes the stable “fingerprint” of a single bacterial strain, since the number and location of the restriction sites are specific to each genome GWV.
Electrophoresis of restriction digests can be performed either on agarose or polyacrylamide gels. The latter method, which is the one described in this chapter, has a very high resolution power and can separate DNA molecules that differ by as little as 0.2% in length. Coupled with the ultrasensitive silver staining (17), this method gives the high resolution of low molecular weight DNA fragments that is essential for accurate restriction pattern analysis. From Methods m Molecular Biology, Vol 46. Dagnostfc Edlted by. J. Howard and D M Whitcombe Humana
165
Bacteriology Protocols Press Inc , Totowa, NJ
166
Giovannetti
and Ventura
The electrophoretic pattern of restriction fragments, reflecting the structure of the genome, can be used to evaluate the similarity among microorganisms. With this approach, strains are assigned to groups based on their electrophoretic pattern. This type of analysis has an established application in epidemiological (10,16,18-20) and taxonomic studies (11,21). Compared with other molecular techniques used to identify microorganisms (such as those using in vitro DNA amplification or the hybridization of nucleic acids directly extracted from the environment), restriction pattern analysis has the obvious drawback that it requires the isolation and cultivation of a bacterial clone in order to obtain a sufficient amount of pure, high molecular weight DNA. Nevertheless, it makes it possible to discriminate between strams that are so similar as to be practically indistinguishable by other approaches (10). Thus, it allows the taxonomic relationships among subspecies, pathovars, or very similar bacterial species to be studied (18,19,22-2.5). Exhaustive descriptions of nucleic acid separation techniques by polyacrylamide gel electrophoresis are given elsewhere (26-29). This chapter describes only the electrophoresis of genomic restriction digests for the purpose of bacterial strain identification. The size of the nucleic acids that can be separated by polyacrylarmde gel electrophoresis varies from 6 basepairs (bp) to over 3000 bp and depends on the concentration of the monomer acrylamide in the matrix. Increasing the relative percentage of the crosslinking agent bisacrylamide causes a pronounced decreasein pore size but is not recommended as it also increases the brittleness and decreasesthe transparency of the gels. In this technique, electrophoresis is performed with a vertical apparatus (Figs. 1 and 2). Resolution of restriction fragments of the appropriate size range (between 200 and 2500-3000 bp) is obtained on a discontinuous polyacrylamide slab gel consisting of a 7.5% (w/v) polyacrylamide running gel (or separation gel) with a 4% (w/v) stacking gel cast on top. In order to analyze fragments of a different size range, different acrylamide concentrations or gel dimensions might be necessary. To obtain reproducible results it is essential to set up a highly standardized procedure. Indeed, the most reliable results are obtained comparing samples in the samegel or in gels prepared from the same working solutions and run together using a multislab apparatus.
Total DNA Restriction
167
Pattern Analysis
back plate
Fig. 1.
Gel castrngsandwich.
I
elctrodes
reservoir
Fig. 2. Vertical electrophoresisapparatus. Restriction pattern analysis consists of the following independent procedures: isolation and purification of high molecular weight bacterial genomic DNA, digestion of DNA with a restriction endonuclease, separation of restriction fragments by SDS-PAGE, silver staining of the polyacrylamide gel, and analysis of electrophoretic patterns. Extraction of genomic DNA is described in detail elsewhere in this book and will not be treated here.
168
Giovannetti
and Ventura
For this application, restriction endonucleases recognizing a 6-bp sequence are usually preferred. This is because most of them give a relatively low number of DNA fragments (unlike endonucleasesrecognizing shorter sequences).Under the experimental conditions described later, the number of fragment bands in the selected range (200 to 2500-3000 bp) should not exceed 150 to obtain good separation and precise band identification. A preliminary experiment with a number of endonucleases is therefore needed to find those most suitable for a given group of bacteria. 2. Materials of DNA Restriction
1. 2. 3. 4. 5. 6. 1.
2. 3. 4. 5. 6.
2.1. Preparation Digests Commercially available solutions of restriction endonucleases recognizing a 6-bp sequence. Store at -20°C. Commercially available incubation buffer solutions suitable for each restriction endonuclease (concentrated lo-fold). Store at -2OOC. Distilled water: Sterilize by autoclavmg. 3M NaCl: Sterilize by autoclavmg. Ethanol: 95% (v/v) in water. Store at -2OOC. TE buffer: 10 mil4 Tris-HCI, 1 mJ4 EDTA, pH 8. Sterilize by autoclaving. 2.2. Polyacrylamide Electrophoresis Vertical slab gel apparatus (Figs. 1 and 2): 1S-mm thick gels give a good resolution of restriction fragments and are strong enough to handle without nsk of damaging them. In our lab, optimal fragment resolution is obtained with a gel mold that IS 280-mm long and 165-mm wide. The stacking gel houses 20 wells, 4-mm wide. The amounts of reagents specified in this chapter refer to such a gel. A power pack supplying a constant current throughout the run 1sessential. Loading solutton: 0.25% (w/v) Bromophenol blue, 15% (w/v) Ficoll (approx mol. wt. 400,000). Upper buffer: 0.5M Tris-HCl, 0.4% (w/v) SDS, pH 6.8 (see Note 1). Lower buffer: 1.5M Tris-HCl, 0.4% (w/v) SDS, pH 8.8 (see Note 1). Acrylamide stock solution: 30% (w/v) Acrylamide, 0.8% (w/v) N,N’methylenbisacrylamide. Filter through Whatman (Maidstone, UK) paper No. 1. Store at 4°C for a few months m a dark glass bottle. The pH should be 7 or less, since acrylamide and methylenbisacrylamtde are slowly converted to acrylic acid and bisacrylic acid at higher pH values. Caution: Acrylamide and bisacrylamide are neurotoxic substances that have a cumulative effect. They are absorbed through the skin. Always wear gloves and a mask when weighing powdered reagents. Polyacrylamide
Total DNA Restriction
7. 8. 9. 10. 11. 12.
Pattern
Analysis
169
is considered to be nontoxic but it must be handled with care because some unpolymerized acrylamide can still be present. Ammonium peroxodisulfate (persulfate): 10% (w/v) aqueous solution. Store for up to 1 wk at 4°C (see Note 2). N,N,N’,N’-tetramethylethylenediamine (TEMED). Store at 4°C. Running gel mix: 34.5 mL of distilled water, 17.5 mL of acrylamide stock solution, 17.5 mL of lower buffer. Stacking gel mix: 6.1 mL of distilled water, 1.3 mL of acrylamide stock solution, 2.5 mL of upper buffer. TEB (5X) (concentrated electrophoresis buffer): 54 g/L Tris, 27.5 g/L boric acid, 20 mL/L 0.5 h4 EDTA, pH 8. If needed, adjust to pH 8.3 with boric acid or Tris (see Notes 1 and 3). Size marker: A DNA molecular weight marker for the range 100-3000 bp is needed. There are many suitable markers on the market. We suggest the Boehringer (Mannheim, Germany) DNA molecular weight marker VI. Store at -2OOC on arrival; once thawed store at 4OC.
2.3. Gel Staining Because silver ions precipitate in the presence of very low amounts of chloride, double distilled water is necessary for the preparation of the following solutions. 1. 2. 3. 4.
Fixing solution: 50% (v/v) ethanol, 10% (v/v) acetic acid. Washing solution 1: 25% (v/v) ethanol, 10% (v/v) acetic acid. Washing solution 2: 10% (v/v) ethanol, 0.5% (v/v) acetic acid. Silver nitrate solution: 1.9 g/L AgNO,. Filter through Whatman paper No. 42. 5. Developer: 7.5 mL/L of 37% (w/v) formaldehyde, 0.75M NaOH. Add the formaldehyde to the solution immediately before use. 6. Enhancing solution: 7.5 g/L Na2C0s. 7. Storing solution: 25% (v/v) ethanol, 8% (v/v) acetic acid, 10% (v/v) glycerol. 2.4. Restriction Pattern Analysis 1. Scanning equipment: A high resolution scanning densitometer connected to a computer for automatic data acquisition, We use a Pharmacia-LKB (Uppsala, Sweden) 2222 Ultroscan XL laser scanner connected to an 80286 PC computer with mathematical coprocessor installed. 2. Software: Pharmacia-LKB GSXL; this package drives the Ultroscan scanner and integrates absorbance traces. Ashton-Tate dBASE IV or another database or electronic sheet program. SAS/STAT or another package for statistical analysis (see Note 4).
170
1.
2. 3. 4.
5. 6. 7. 8.
Giovannetti
and Ventura
3. Methods 3.1. Preparation of DNA Restriction Digests For a typical 100~pL reaction, mix in a sterile 1.5mL microfuge tube: lo-pg high molecular weight genomic DNA (m a volume of up to 88 l.tL), 10 ltL of 10X enzyme buffer, 2-10 pL (20-100 U) restriction endonuclease (mix the stock enzyme solution before dispensing), sterile water to 100 PL. Add the enzyme last. Mix the digestion mixture and spin down droplets from the tube wall. Incubate overnight at 37°C. Carefully cap the tubes to avoid evaporation of the small reaction volume. At the end of incubation, add l/10 vol of 3M NaCl and 2 vol of chilled 95% (v/v) ethanol, mix by inverting the tube, spm briefly to collect the liquid, and store the samples at -2OOC for at least 4 h. Centrifuge the samples m a microfuge at 11,500g for 12 min at 4°C. If a refrigerated centrifuge 1s not available, room temperature is acceptable. Place the tubes m the rotor with the cap attachment hinge always facing out so that pellets that might not be visible after drying, will always form along the side of the tube directly below the hmge. Discard the supernatant and drain the residual drops on the tube lip with a paper towel. Cap the tubes with Parafilm, puncture with a needle, and desiccate the pellets in a vacuum desiccator until the ethanol has completely evaporated (see Note 5). Resuspend each pellet in 13 pL of sterile TE buffer. Dispense the buffer dropwise over the pellet. If a pellet is not visible, pour the buffer along the tube wall from the point where the hinge is attached. Incubate for 10 min at 50°C to ensure that the DNA dissolves. Spin down the droplets and store at 4°C (see Note 6).
3.2. Preparation of Samples for Electrophoresis 1. To each digest sample, resuspended m 13 pL, add 2 p.L molecular weight marker DNA, contammg 30 ng DNA (see Notes 7 and 8). 2. Add 5 pL of loading buffer, mix, and eject the disposable tip mto the sample tube. The tip will be used to load the sample mto the well. 3.3. Ebctrophoresis 3.3.1. Gel Preparation 1. Thoroughly clean the glass plates, the spacers, and the comb with glassware detergent and warm water, rmse with distilled water, and dry. Before assembly, rinse them with ethanol and dry m a dust free place. There IS no need to silicomze the gel plates for gels of 1.5 mm or greater thickness.
Total DNA Restriction
Pattern
Analysis
171
2. Assemble the glass plate sandwich with spacers (Fig. 1). Clamp the sandwich with large bulldog clips, leaving some space between the clips and the sandwich edges. 3. Seal these edges with molten 1% (w/v) agarose dispensed through a Pasteur pipet. 4. On one of the glass plates, mark the level of the running gel, leaving about 2 cm for the stacking gel between the bottom of the wells and the top of the running gel. 5. Prepare the running gel (7.5% [w/v] acrylamide) and stacking gel (4% [w/v] acrylamide) mixes in beakers kept on ice to avoid fast polymerization. 6. Degas running gel mix. 7. Add 400 PL of 10% (w/v) ammonmm peroxodisulfate and 40 p.L of TEMED. Mix gently. 8. Using a 60-mL syringe and holding the sandwich at an angle, pour in the gel along the bottom edge from the top, inserting the nozzle a short dlstance between the plates. Be quick but avoid bubbling. As the gel level increases, straighten the plates to the vertical. Pour the gel to the level marked. 9. Overlay 2-3 mm of water on top of the running gel with a hypodermic syringe without disturbing the gel surface. 10. Allow the gel to set for at least 1 h at room temperature. 11. After the gel has set, remove the water layer by turning the mold upside down. 12. Degas the stacking gel mix. 13. Add 100 FL of 10% (w/v) ammonium persulfate and 10 PL of TEMED. Mix gently. 14. Pour the stacking gel over the polymerized running gel directly from the beaker and immediately place the comb m posltlon. 15. Let the gel set for at least 1 h at room temperature. If the electrophoresls is not done immediately, at this stage the sandwich can be wrapped in a plastic bag and stored for 24 h at 4°C. 3.3.2. Gel Loading and Electrophoresis 1. Remove the lower spacer and fit the gel mold to the electrophoresis apparatus. Make sure apparatus is disconnected before doing this! To avoid leaks of electrophoresls buffer from the upper reservoir, the gasket that ensures contact with the back plate can be coated with a small amount of silicone grease. 2. Fill reservoirs with fresh 1X TEB buffer and remove air bubbles trapped below the gel with a bent Pasteur pipet. 3. Remove the comb very slowly to avoid breaking the narrow acrylamide partitions that separate the wells. Carefully wash the wells with a syringe
Giovannetti
172
and Ventura
filled with TEB buffer. Take care in this operation that unpolymerized acrylamide does not remam in the wells, as this would cause a distorted migration. 4. Load the samples with an automatic pipet, inserting the tip between the plates. Work carefully and quickly to avoid diffusion of the sample into the stacking gel. Dispense only the exact sample volume, because an air bubble could drag some of the sample out of the well, causing cross contammation. 5. Run the gel at 15 mA (constant current), until the dye reaches the running gel, then increase to 17 mA (see Note 9). 6. Stop the electrophoresis when the dye comes out of the bottom of the gel (see Note 10). 3.4. Gel Staining Wear gloves when handling polymerized gels because fingerprints “developed” by silver nitrate.
are
1. Open the mold by msertmg a spatula between the two glass plates. The slab gel will stick to one plate. 2. Cut the stacking gel off and wipe off any fragments of polyacrylamide. 3. Place the glass plate with the gel on the bottom of a clean glass box. 4. Gently flush the gel with 500 mL fixing solution: This should be enough to detach the gel from the plate. Remove the plate without folding the gel. 5. Cover the box to keep dust from entering and gently agitate for 1 h. If staining cannot be done immediately, store the gel m this solution overnight without agitation. 6. Discard the solution by aspiration and repeat the wash with 400 mL of fixing solution for 30 min, wtth gentle agitation. 7. Remove and discard the fixing solution; soak the gel in two changes of 400 mL washing solution 1, for a total of 60 min, with gentle agitation. 8. Remove and discard the washing solution 1, and repeat with two changes of 400 mL washing solution 2, for a total of 60 mm, with gentle agitation. 9. Soak the gel in 500 mL silver nitrate solution for at least 2 h, increasing the agitation. 10. Thoroughly rinse the gel with distilled water for lo-20 s. 11 Add 400 mL developer and incubate with agitation. Staining should be completed in about 10-15 min. 12. Place the gel in 400 mL enhancing solution for 1 h with gentle agitation. 13. Transfer the gel to storing solution until the following day to give the solution time to impregnate the matrix, making the gel less brittle and easier to handle. A typical result is shown in Fig. 3.
Total DNA Restriction
Pattern
Analysis
173
2176 1766
1230 1033
653 517 453 394
298 1 2 3 4 5 6 7 8 9 IO 111213141516 M
Fig. 3. Polyacrylamide gel containing 16 total DNA restriction digests of Azospirihm spp., obtained with the restriction endonuclease BgZII. Samples No. 13 and 16 are restriction digests of the same strain received from two different laboratories. Note the last lane (M) containing the molecular weight marker and the bands of this marker present in all samples. 14. Photograph the gel. This provides a permanent record and will be used to produce prints on a transparent support for recording absorbance traces with a scanning device. 15. Wet gels can be stored for a few months in sealed flat transparent polyethylene bags. 3.5. Restriction Pattern Analysis Total DNA restriction pattern analysis can be used to identify and monitor a single bacterial strain or to study the relationships among similar bacteria. Each of these uses requires a specific type of analysis.
174
Giovannetti
and Ventura
3.5.1. Recognition of a Single Bacterial Strain Because the restriction pattern is stable and separates very similar and related strains, it functions like a fingerprint (2, IO). To confirm the identity of an isolate, the visual comparison of its restriction pattern with that of a pure culture of the reference organism is usually sufficient (20). The use of an internal weight marker, as described earlier, allows patterns from different gels to be compared (7,30).
3.5.2. Analysis
of Genome Similarities
Among Related Bacteria To evaluate the similarity among restriction profiles, the absorbance trace of each electrophoretic band pattern must be recorded, followed by a computerized analysis of the acquired data (see Note 4). 1. Scan the gels or prints on transparent film using the Ultroscan XL laser scanner with the following parameters: rectangular lme beam 800 by 50 pm; each lane scanned two times, obtaining a 1.6-mm scan wrdth; record the absorbance at 40-pm intervals along the track. Performing duplicate or triplicate scans of adjacent zones of the same lane allows the reading of a larger area of the track, and gives a more reliable result (12). 2. Using the program GSXL, data from Ultroscan are automatically collected and stored on disc. 3. Use the GSXL program to integrate each scan by calculating the theoretical Gaussian absorption peak that best fits the scanned band. The program automatically calculates the base line. 4. If necessary, manually adjust the integration results using GSXL options. 5. Record band pattern data, consisting m the position and width of each band, m one file for each pattern. 6. Normalize restriction patterns with dBASE IV (see Note 11): This is done by aligning the corresponding peaks of the marker DNA bands present in each pattern. These bands divide the gel mto segments. The corresponding segments in all patterns are mathematically stretched or contracted accordmg to a reference pattern (see Note 12). 7. After the alignment IS completed, delete marker DNA band values. 8. Using dBASE IV, compare all couples of normalized patterns applying the snnilatity coefficient of Dice, S, = 2u/(2a + u), where a is the number of band matches between two patterns and u the number of mrsmatches between the same two patterns (31) (see Notes 13 and 14). 9. A tolerance value (which widens the bands) is necessaryto compensate for lrmited unproportional distortions m the gel. Calculate the amount of this tolerance by comparmg two patterns of the same sample, or two tracks with the molecular marker DNA alone. Common values range from O.l0.2% of running gel length.
Total DNA Restriction
175
Pattern Analysis strain
cluster 1 2
I
9 10
1
1
11 4 5 3
2
1
7 12
3
a 6 15
13; 14
0.4
0.5
0.6
0.7
0.8
0.9
l6
I
4
1.0
SD
Fig. 4. UPGMA dendrogram obtained from analysis of Azospirillum spp. restriction pattern shown in Fig. 3. Patterns were analyzed in the interval delimited by the 298 and 1230 bp molecular weight marker bands. 10. Cluster the strains by the UPGMA (unweighted pangroup method using arithmetic averages), analyzmg the matrix of S, values with the CLUSTER and TREE procedures of the SAS/STAT package (32). The UPGMA algorithm forms clusters of samples that can be presented as a dendrogram (Fig. 4) (32) (see Note 4).
4. Notes 1. 2. 3. 4.
Carefully check the pH of stock solutions. Store ammonium persulfate in a desiccator and discard hydrated batches. Do not reuse electrophoresis buffer 1X TEB. Although we have performed the electrophoretrc restriction pattern analyses using several independent programs, the use of an integrated software package specrfrcally designed for comparative analysrs of electrophoretic patterns will simplify and speed up this laborious task (33). Two efficient
Giovannetti
176
5. 6. 7. 8. 9. 10. 11. 12.
13. 14.
and Ventura
and up-to-date packages are GelCompar by Applied Maths (Kortrijk, Belgium) and GelManager by BioSystematica (Prague, Czech Republrc). Ethanol must be completely evaporated from DNA samples, otherwise tt prevents samples from dropping to the bottom of the wells durmg gel loading, and causes curved bands. Any particulate matter must be eliminated from the samples to avord streaky bands or tracks. Overloaded wells will give poor resolution and distorted band patterns. To avoid large differences in the concentration of weight marker DNA from lane to lane, dilute the stock so that each sample receives the same quantity of DNA m 2 l.tL. Slight increases in voltage during electrophoresis can cause gel overheating leading to pattern distortton. In our lab, the electrophorests takes about 18 h. Sometimes a longer run gives a better distribution of bands along the gel: This should be determined by a trial experiment. The work with dBASE IV should be done by a dBASE application that automatically performs the various tasks: pattern normalization, pattern editing, calculation of So values, result prints. Normalization of electrophoretic pattern could be also done inserting a reference sample at intervals on each gel. This sample can be a molecular weight marker DNA or a selected restriction dtgest: The latter, giving a much more composite pattern, should allow a more accurate normalization when using an automated procedure (33). When comparing samples from two or more gels, tt is necessary to have some samples repeated in all gels in order to check the reproducibilrty. Instead of the Dice coefficient (So), other similarity coefficients can be applied, like the simple matching coefficient (S,,) (12), or the Jaccard coefficient (SJ.,(9,12), or others (34,35). A different approach to pattern comparison, which does not require the identification of band posrtions, can be applied, m which shape or overlap of the absorbance traces are compared with the Pearson product-moment correlation coefficient (r) (3,8,22). Other procedures, which differ at some step of the restriction pattern analysis, have been described (9,21,30,36). References
1 Mielenz, J. R., Jackson, L. E , O’Gara, F , and Shanmugam, K. T. (1979) Fingerprinting bacterialchromosomalDNA with restrictionendonucleaseEcoRI: comparison of Rhizobium spp. and identification of mutants. Can. J. Microbial 25,803-807. 2. Bjorvatn, B., Lund, V., Kristiansen, B. E , Korsnes, L , Spanne, O., and Lindqvist, B. (1984) Applications of restriction endonuclease fingerprinting of chromosomal DNA of Neisseria meningitidis J. Clin Microbial. 19,763-765.
Total DNA Restriction
Pattern Analysis
177
3. Hookey, J. V., Waitkins, S. A., and Jackman, P. J. H. (1985) Numerical analysis of Leptospira DNA-restriction endonuclease patterns. FEMS Microbial. Lett. 29, 185-188. 4. Glynn, P., Higgins, P., Squartini, A., and O’Gara, F. (1985) Strain identification in Rhizobium trifolii using DNA restriction analysis, plasmid DNA profiles and intrinsic antibiotic resistances. FEMS Microbial. Lett. 30, 177-182. 5. Allardet-Servent, A., Bourg, G., Ramuz, M., Pages, M., Bellis, M., and Roizes, G. (1988) DNA polymorphism in strains of the genus Brucella. J. Bacterial. 170, 4603-4607. 6. Giovannetti, L., Ventura, S., Bazzicalupo, M., Fani, R., and Materassi, R. (1990) DNA restriction fingerprint analysis of the soil bacterium Azospirillum. J. Gen. Microbial. 136, 1161-l 166. 7. Degli-Innocenti, F., Ferdani, E., Pesenti-Barih, B., Dani, M., Giovannetti, L., and Ventura, S. (1990) Identification of microbial isolates by DNA fingerprinting: analysis of ATCC Zymomonas strains. J. Biotechnol , 13,335-346. 8. Hernandez, J., Owen, R. J., Costas, M., and Lastovica, A. (1991) DNA-DNA hybridization and analysis of restriction endonuclease and rRNA gene patterns of atypical (catalase-weak/negative) Campylobacterje]uni from paediatric blood and faecal cultures. J. Appl. Bactenol. 70,71-80. 9. Borr, J. D., Ryan, D. A. J., and MacInnes, J. I. (1991) Analysis of Actinobacillus pleuropneumoniae and related organisms by DNA-DNA hybridization and restriction endonuclease fingerprinting. Znt. J Syst. Bacterial. 41,121-129. 10. Baloga, A. 0. and Harlander, S. K. (1991) Comparison of methods for discnmination between strains of Listeria monocytogenes from epidemiological surveys. Appl. Environ. Microbial. 57,2324-233 1. 11. Giovannetti, L., Fedi, S., Gori, A., Montaini, P., and Ventura, S. (1992) Identification of Azospirillum strains at the genome level with total DNA restriction pattern analysis. System. Appl. Microbial. l&37-41. 12. Owen, R. J., Costas, M., and Dawson, C. (1989) Application of different chromosomal DNA restriction digest fingerprints to specific and subspecific identification of Campylobacter isolates. J. Clin. Mtcrobiol. 27,2338-2343. 13. Ventura, S., Giovannetti, L., Gori, A., Viti, C., and Materassi, R. (1993) Total DNA restriction pattern and quinone composition of members of the family Ectothiorhodospiraceae. System. Appl. Microbial. 16,405-410. 14. Kristiansen, B. E., Sorensen, B., Simonsen, T., Spanne, O., Lund, V., and Bjorvatn, B. (1984) Isolates of Neisseria meningitidis from different sites in the same patient: phenotypic and genomic studies, with special reference to adherence, piliation, and DNA restriction endonuclease restriction pattern. J. Infect. Dis. 150,389-396. 15. Mugnai, L., Giovannetti, L., Ventura, S., and Surico, G. (1994) The grouping of strains of Pseudomonas syringae subsp. savastanoi by DNA restriction flngerprmting. J. Phytopathol. 141, 16. Kristiansen, B. E., Bjorvatn, B., Lund, V., Lindqvist, B., and Holten, E. (1984) Differentiation of B 15 strains of Neisseria meningitidis by DNA restriction endonuclease fingerprinting J. Infect. Dis X0,672-676.
178
Giovannetti
and Ventura
17. Sammons, D. W., Adams, L. D., andNlshizawa, E. E (1981) Ultrasensitive silverbased color staining of polypeptldes in polyacrylamlde gels. Electrophoresis 2, 135-141. 18. Peterson, E. M. and De La Maza, L. M. (1988) Restriction endonuclease analysis of DNA from Chlamydia trachomatis biovars. J. Clin. Microbial. 26,625-629 19. McCormick, W. A., Stevenson, R. M W., and MacInnes, J. I. (1990) RestrIction endonuclease fingerprinting analysis of Canadian Isolates of Aeromonas salmonicida.
Can. J. Microbial.
36,24-32.
20. Wesley, I. V. and Ashton, F. (1991) Restriction enzyme analysis of Listeria monocytogenes strains associated with food-borne epidemics. Appl. Environ. Microbial. 57,969-975. 21. StAhl, M., Molin, G., Persson, A , AhrnC, S., and Sdhl, S. (1990) Restriction endonuclease patterns and multlvariate analysis as a classification tool for Luctobaclllus spp Int. J. Syst. Bacterial 40, 189-193 22 Ramos, M. S and Harlander, S. K (1990) DNA fingerprinting of lactococci and streptococci used in dairy fermentation. Appl. Microbial Biotechnol., 34,368-374. 23. Bialkowska-Hobrzanska, H., Jaskot, D , and Hammerberg, 0. (1990) A method for DNA restriction endonuclease fingerprinting of coagulase negative staphylococci. J. Microb. Meth 12,41-49. 24. Hartmann, A. and Amarger, N. (1991) Genotypic diversity of an indigenous Rhlzobium meliloti field population assessed by plasmid profiles, DNA fingerprinting, and insertion sequence typing Can J Mrcroblol. 37,600-608. 25. Owen, R. J., Bickley, J., Moreno, M., Costas, M., and Morgan, D R. (1991) Biotype and macromolecular profiles of cytotoxin-producing strains of Hellcobacter pylori from antral gastric mucosa. FEMS Microbial. Lett. 79, 199-204. 26 Ogden, R. C. and Adams, D. H (1987) Electrophoresis in agarose and acrylamide gels, in Guide to Molecular Cloning Technzques, vol. 152 (Berger, S L. and Kimmel, A. R , eds.), Academic, Orlando FL, pp. 61-90. 27. Sambrook, J., Frltsch, E F., and Maniatis, T (1989) Molecular Cloning. A Luboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. 28 Walker, J. M. (ed.) (1984) Methods in Molecular Biology, Vol. 2: Nucletc Acrds Humana, Clifton, NJ. 29. Walker, J. M. (ed ) (1988) Methods in Molecular Biology, Vol 4: New Nucleic Acid Techniques, Humana, Clifton, NJ. 30 Forbes, K J., Bruce, K D., Jordens, J. Z , Ball, A., and Pennington, T. H. (1991) Rapid methods in bacterial DNA fingerprinting J. Gen. Microbial 137,205 l-2058 3 1. Sneath, P. H. A and Sokal, R. R (1973) Numerical Taxonomy The Principles and Practice of Numerical Classification, Freeman, San Francisco 32. SAS Institute Inc (1987) SASISTAT Guide for Personal Computer, Version 6, Author, Cary, NC. 33 Vauterm, L. and Vauterin, P (1992) A new system for standardization and obJective comparison of electrophoresls patterns: application m bacterial identification, m Proceedings of the Conference on Taxonomy and Automated Identification of Bacteria (Schindler, J., ed.), Prague, Czech Republic, pp 19-22.
Total
DNA
Restriction
Pattern
Analysis
179
34. Gentzbittel, L. and Nicolas, P (1989) A basic program to construct evoluttonary trees from restriction endonuclease data. J. Hered 80,254 35 Gentzbittel, L. and Nicolas, P. (1990) Improvement of “a BASIC program to construct evolutionary trees from restriction endonuclease data” with the use of PASCAL J Hered 81,491,492 36. Sorensen, B., Falk, E S , Wisloff-Nilsen, E , Bjorvatn, B., and Kristiansen, B. E (1985) Multivariate analysis of Neisserm DNA restriction endonuclease pattern J Gen. Microbial. 131,3099-3 104.
CHAPTER17
Determination Gene Restriction Francine
Grimont
of rRNA Patterns
and Patrick
A. D. Grimont
1. Introduction The development of molecular biology has opened the way to new approaches to bacterial identification and typing. Nucleic acids carry the information encoding the bacterial diversity. They can be sequenced easily and, even when undetermined, their sequences can be quickly compared by molecular hybridization. In addition, short sequences on double-stranded DNA are recognized by restriction endonucleases as cleavage sites. The number and position of these endonuclease-specific restriction sites on a DNA molecule determine the number and the sizes of the fragments generated by cleavage. The development of agarose gel electrophoresis for the separation of DNA fragments allows the comparison of restriction patterns of plasmid (I) and chromosomal DNA (2). Total restriction patterns of bacterial genomic DNA are often too complex to interpret. One solution to this problem has been to use restriction enzymes that cut the DNA only rarely to generate a small number of restriction fragments, and resolve them by pulse field gel electrophoresis (see Chapter 15). A second solution (3), and the one described here, is to reduce the pattern complexity using Southern blotting and hybridization. Suitable probes for this procedure can be random DNA sequences(4) or parts of known genes (5). Most often, the application of a gene probe is limited to the bacterial species from which the probe derives. However, some common repeated sequenceshave been found in phylogenetically related species (6). Our present knowledge is that no gene is more uniFrom Methods m Molecular Brology, Vol 46’ D/agnost/c Bacteriology Protocols E&ted by J Howard and D M. Whitcombe Humana Press Inc , Totowa, NJ
181
182
Grimont
and Grimont
versa1 than rRNA genes (7). rRNA sequences (or their corresponding genes) contain some extremely conserved regions that can hybridize to rRNA genes of bacteria irrespective of their phylogenetic position. It is then possible to characterize, identify, and type bacteria by studying their rRNA gene restriction patterns (8). The determination
of rRNA gene
restriction patterns has also been termed ribotyping (9). The protocols described in this chapter detail optimized methods for the extraction of bacterial DNA, the cleavage of DNA with restriction endonuclease and agarose gel electrophoresis of DNA fragments, the
transfer of DNA transfer onto a membrane, and hybridization with a nonradioactive nucleic acid probe, We describe the use of two nonradioactive probes for ribotyping, these are: 1. The acetylaminofluorene (AAF) rRNA probe (Eurogentec, Seramg, Belgium) in which Escherichia coli 16 + 23s ribosomal RNA has been reacted (by the manufacturer) with N-acetoxy-N-2-acetylaminofluorene leading to the covalent bmding of the AAF hapten to the carbon at posttion 8 of the guanine residue. This modified rRNA (AAF-rRNA) is recognized by an antiguanosme-AAF monoclonal antibody and the complex formed can be visualized through an immunoenzymatic reaction (10). 2. E. coli 16 + 23s RNA (Boehringer Mannheim, Mannheim, Germany) is labeled by the user with horseradish peroxidase (HRP) (ECL Gene detection system,Amersham International, Amersham, UK). This probe is detected with hydrogen peroxide (substrate for peroxidase) and lummol producing on oxidation a blue light that is detected by autophotography by use of a blue-light-sensitive film (II).
2. Materials 2.1. Gram-Negative Bacterial Lysis 1. TES buffer: 0.05M Trts-HCl, pH 8.0, 0.05M EDTA, and O.lM NaCl (store at room temperature after autoclaving at 120°C for 30 min). 2. Sodium dodecyl sulfate (SDS): 25% (w/v) solution. 3. Pronase:20 mg/rnL in distilled water, self-digested at 37OCfor 2 h to remove contaminating proteins (store at -20°C). 2.2. Gram-Positive Bacterial Lysis 1. TE buffer: 10 r&I Tris-HCI, pH 8.0, 1 mM EDTA, pH 8.0 (autoclave at 120°C for 20 min and store at room temperature), 2. TEST buffer: 10 mMTris-HCl, pH 8.0,5 mMEDTA, 1 mMNaCl,O.5% (v/v) Triton X-100 (autoclave at 120°C for 20 min, store at room temperature). 3. Lysozyme: Store at -20°C; prepare fresh for each use.
rRA?A Gene Restriction
Patterns
183
4. Proteinase K: 20 mg/mL solution, predigested by incubation at 37OCfor 2 h (store at -2OOC). 5. N-Lauroyl sarcosine (sarcosyl): 20% (w/v) solution (store at room temperature). 6. Mutanolysme (M-1-muramidase): 1 U&L in TE buffer (store at -20°C). 7. Pronase: 20 mg/mL in distilled water, self-digested at 37°C for 2 h. Store at -20°C. 8. Guanidine isothiocyanate solution: 5M guanidine isothiocyanate, 100 nM EDTA, 1M NaCl. Store at room temperature.
2.3. Purification
1.
2. 3. 4.
of DNA TES-saturated phenol: To 1 kg of phenol, add 1 L of TES buffer and 1 g of &hydroxyquinolme, melt m a water bath at 50-60°C. Store liquefied phenol at 4°C. Before use, shake and pour mto a separation funnel, let the two phases separate, and collect the bottom phenol phase. Caution: Phenol is highly corrosive, Always wear gloves and protective glasses. Phenol/chloroform/isoamyl alcohol mixture: Mix 25 parts of saturated phenol with 24 parts of chloroform and one part of isoamyl alcohol. Store at 4°C in the dark. Cold absolute ethanol-store at -20°C. Sodium acetate: 3M, adjusted to pH 5.2.
2.4. Cleavage and Agarose
of DNA with Restriction Endonuclease Gel Electrophoresis of DNA Fragments
1. Restriction endonucleases supplied in concentrated form (usually 10 U/pL) by the manufacturer in a buffer contammg 50% (v/v) glycerol. Store at -20°C. 2. Incubation buffers are usually supplied by the manufacturer. Their concentration is 10 times the final concentration. Store at -20°C. 3. Sterile distilled water. 4. TBE electrophoresis buffer (10X concentrate): 0.89M Tris-base, 0.89M boric acid, 25 mM EDTA, pH 8.0. Dilute stock solution 1: 10 with distilled water (about 2-3 L of working solution are needed per run). 5. Agarose: The agarose should be of low electroendosmose coefficient. In a 500~mL Erlenmeyer flask, pour 200 mL electrophoresis buffer (1X) and 1.6 g agarose. Melt by boiling in a microwave oven (no magnetic bar!) or in a boiling water bath or on a hot plate (with magnetic stirring). Swirl the melted solution to ensure homogeneity of agarose concentration, let it cool to about 5O”C, and either pour it on the castmg plate or keep it in a 50°C water bath until used. 6. Loading buffer (10X concentrate): 20% (v/v) Ficoll 400, 0.07% (w/v) Bromophenol blue, 7 0% (w/v) SDS (store at 4OCor -2OOC)
184
Grimont
and Grimont
7. DNA molecular weight markers: To interpolate the size of DNA fragments, It is necessary, among the samples loaded onto the gel, to have several lanes of DNA fragments of known sizes.The followmg restriction digests of 3Lphage DNA require hybridization with labeled h DNA: Hind111cleavage of hCIts857 yields seven fragments of 23,130,9416,6682,4361,2322, 2027, and 564 bp; Hind111plus EcoRI double cleavage of h DNA gives 12 fragments of 21,226, 5148, 4973, 4268, 3530, 2027, 1904, 1709, 1375, 947, 831, and 564 bp. Size marker Raoul I (Appligene, Illkirch, France) containing 22 fragments of 48,502, 18,520, 14,980, 10,620, 9007, 7378, 5634, 4360,3988,3609,2938,2319, 1810, 1416, 1255, 1050, 903,754, 686, 554, 375, and 234 bp requires hybridization with labeled pBR322 DNA. For rRNA gene restriction patterns, it is also possible to use as standard restriction digest of total DNA from a strain for which the sizesof the fragments hybridizing with rRNA are known. For best curve fitting on the computer, it 1s essential that standard fragments be numerous and evenly distributed in the range of observed sizes. 8. Ethidium bromide, 10 mg/mL m distilled water (10,000~). Store m the dark at 4°C for up to several weeks. Ethidium bromide is known to be strongly mutagenic and should be handled with due care (always wear gloves). 9. Sterile 0.7~mL Eppendorf tubes and microplpet tips. 10. Water bath at 37OCor heating block. 11. Horizontal electrophoresis apparatus: A “submarine” or “submerged” system in which the whole gel is submerged in buffer during electrophoresis. 12. Power supply: Any power supply delivering direct current is suitable. The experiments described in this chapter are run at 40 V. 13. UV transillummator with an emission peak about 312 nm (mask or goggles should be available to protect face and eyes of operator). 14. Instant camera: Polaroid MP4 camera fitted with an orange filter and either type 667 film (highly sensitive) or type 665 film (slower but produces both negatives and prints). Alternatively, a video capture system comprising a CCD camera, a computer with a video capture board, a 256-Gray level monitor, and a high resolution printer can be used. 2.5. Vacuum Transfer of DNA Fragments to Membrane 1. Vacuum blotting unit: We have used the LKB 2016 VacuGene vacuum blotting system The system contains* a. A vacuum unit (base and frame) connected to a vacuum pump; b. A polyethylene porous screen restmg on the mner rim of the base unit. The screen acts as a support for the transfer membrane, the mask, and the gel; and
rRNA
2.
3. 4. 5. 6.
Gene
Restriction
Patterns
185
c. A polyethylene mask to be placed on top of the screen, overlapping the membrane edges. Before use, the mask should be cut to make a window for the gel (the window should be 3-10 mm smaller than the gel). The mask ensures that the full effect of the vacuum is concentrated on the gel. Transfer membrane: Nylon membranes are preferred over nitrocellulose sheets because they are alkali resistant, resistant to tearing, and can be stripped and rehybridlzed several times. Hybond N (Amersham) membranes are used for AAF-rRNA hybridization and Hybond N + (positively charged) (Amersham) for enhanced chemiluminescence (ECL) gene detection system (see Note 14). Membranes containing nitrocellulose would require a neutralization step before transfer. Crop the membrane to a size about 5 mm larger than the window in the mask. Depurination solution: 0.25M HCl. Denaturation solution: 1.5M NaCl, OSM NaOH (filter through a 0.45~pm membrane before use). SSC (20X concentration): 3M NaCl, 0.3M trisodium citrate, pH 7.6. Autoclave at 120°C for 20 min and store at room temperature. Transfer solution: 1.5M NaCl, 0.25M NaOH. Filter through a 0.45~pm membrane.
2.6. Hybridization
with M-Labeled
rRNA
Probe
1. Carrier DNA: Herring or salmon-sperm DNA solution at 10 mg/mL. Thoroughly dissolve in sterile distilled water and shear by somcation to obtain fragments averaging 500 bp. Store in aliquots at -2OOC. 2. AAF-labeled rRNA probe (Eurogentec). Store at -20°C (keeps well for at least 1 yr). The source of rRNA IS E. coli. 3. AAF-labeled pBR322 DNA (Eurogentec). To be used if the fragment size standards derive from pBR322 (e.g., Raoul I from Apphgene). 4. SSC (20X concentrate): 3M NaCl, 0.3M trisodium citrate, pH 7.6. 5. KH2P04 stock solution: 200 rnM, pH 8.0 (adjusted with 1M Na2HP04). Sterilize by filtering through a 0.45~pm membrane. Store at 4°C. 6. EDTA: 0.5 M, pH 8.0. Autoclave at 120°C for 20 min and store at 4’C. 7. FPG (50X concentrate): 1% (w/v) Ficoll 400, 1% (w/v) polyvinyl-pyrrolidone, 1% (w/v) glycine in distilled water. Mix well and store at -20°C. 8. Prehybrldization solution: 2X SSC, 5X FPG in distilled water. Add 1 mL denatured herring sperm DNA solution (boil for 10 min and cool by immersion in ice). 9. Hybridization solution (2X concentrate): 4X SSC, 2X FPG, 50 mMKH,PO,, 4 mM EDTA pH 8.0,1% (w/v) SDS, 20% (w/v) PEG 6000. Store at -20°C. 10. Washing buffer A: 2X SSC, 0.1% (w/v) SDS. 11. Washing buffer B. 0.1X SSC.
186 12. 13. 14. 15.
Grimont
and Grimont
Shaking water bath at 65°C or hybridization incubator. Shaker at room temperature. Plastic sealer. Wrapping plastic. 2.7. Immunoenzymatic
Detection Probes Anti-AAF monoclonal antibody (Eurogentec). The antibody is a mouse IgG. Antimouse-IgG alkaline phosphatase-conjugated antibodies (Eurogentec). Maletc acid buffer: O.lM maleic acid, 0.15M NaCI, adjust to pH 7.5 with 1M NaOH at 20°C. Maleic acid/Tween-20 washing buffer: Maleic acid buffer with 0.3% (w/v) Tween-20. Casein solution (10% [w/v] stock): Dissolve 10 g of casem (Merck [Darmstadt, Germany] ref. 2242 or BDH ref. 44020--see Note 18) in 80 mL of maleic acid buffer and adjust the volume to 100 mL with maleic acid buffer. Blocking solution (1% [w/v] casem m maleic acid buffer): Dilute 1: 10 the 10% casein solution in maleic acid buffer pH 7.5 (see Note 18). Alkalme phosphatase buffer: 100 n-&f Tris-HCI, 100 mM NaCl, 50 mM MgCl,, and adJust to pH 9.5 at 20°C with 1M NaOH. 5-bromo-4-chloro-3-indolyl-phosphate (BCIP): 5% (w/v) in dimethyl formamide (DMF). Store the powder at -20°C indefinitely, and the solution at 4°C for up to 3 mo, in an amber or foil-covered vial to protect it from light. Nitro-blue-tetrazolium (NBT): 7.5% (w/v) in DMF/distilled water (3:l mixture), store protected from light at 4°C for up to 3 mo. Keep the powder at 4°C. Developer (50 mL): Just prior to use, mix 150 nL of BCIP stock and 200 p,L of NBT stock to 50 mL of alkaline phosphatase solution.
of Acetylaminofluorene-Labeled
1. 2. 3. 4. 5.
6. 7. 8.
9. 10.
2.8. Direct Nucleic Acid Labeling with Peroxidase and Hybridization (ECL System, Amersham) 1. Hybond-ECL (nitrocellulose, RPN 202OD,Amersham) or Hybond N+ (nylon, RPN 202OB, Amersham) membrane. 2. Ribosomal 16 + 23s from E. coli. 3. ECL direct nucleic acid labelmg system: HRP complexed with a positively charged polymer, and glutaraldehyde solution (complete system RPN 3000 or 3001; refill pack RPN 3005, Amersham). 4. Heating block at 55°C.
rRNA
Gene Restriction
Patterns
5. Hybridization solution: To the hybridization buffer that is supplied in the kit (RPN 3000,3001, or 3005) add NaCl to a final concentration of 0.42M. Once the NaCl is dissolved, heat the buffer to 50°C and add 5% (w/v) blocking agent. Mix thoroughly by magnetic stirring for 1 h. 6. Primary wash buffer contaming urea: 6ikfurea, 0.4% (w/v) SDS, 0.5X SSC. Store for up to 3 mo at 4°C. 7. Secondary wash buffer: 2X SSC. Store for up to 3 mo at 4°C.
2.9. Detection
by ECL of Peroxidase-Labeled (ECL System, Amersham)
Probes
1. Detection reagents: (RPN 3000 or 3001; refill pack RPN 3004 or 2105): Detection reagent 1, and detection reagent 2. 2. Film Hyperfilm-ECL (Amersham) and X-ray film cassette. 3. Wrapping plastic.
3. Methods 3.1. DNA Extraction In order to yield readable and reproducible rRNA gene restriction patterns after cleavage by restriction endonucleases, the extracted DNA must be of high molecular weight and free from inhibitors that might interfere with endonucleases. 1. Starting from a fresh culture, inoculate Erlenmeyer flasks or tubes containmg 2-150 mL of a rich liquid medium (e.g., tryptic soy broth) or Roux bottles or plastic cell culture bottles containing 120-150 mL of a rich solid medium. 2. Grow Gram-negative bacteria to stationary phase (18 h), but harvest Gram-positive bacteria before the end of the exponential phase of growth (see Note 1). 3.1.1. Lysis of Gram-Negative Bacteria (12) 1. Centrifuge the bacteria at 10,OOOgfor 30 min and resuspend thoroughly in 10mL of TES buffer by repeated pipeting. Collect culture from solid medmm in a Roux flask by adding 10-20 mL TES buffer and a spoonful of sterile glass beads. Rock the flask to detach the bacteria. 2. To 10 mL bacterial suspension, add 400 pL of 25% SDS and 25 pL of pronase solution to give final concentrations of 1% and 50 pg/mL, respectively (see Note 2). 3. Mix thoroughly and incubate at 37°C for 1 h. The solution should become homogeneously viscous. Take care not to shear the chromosomal DNA (see Note 5).
Grimont
188
and Grimont
3.1.2. Lysis of Gram-Positive Bacteria (13) 3.1.2.1. METHOD WITH LYSOZYMEAND PROTEINASE K (SEE NOTE 3) 1. Centrifuge 40 mL of bacterial cell suspensron at 10,OOOgfor 15 mm. 2. Wash the pellet with TE buffer. 3. Centrifuge as in step 1, resuspend the pellet m 5 mL TEST buffer, and mix thoroughly. 4. Add 10 mg of lysozyme (2 mg/mL final concentration) and incubate at 37OCfor 30 min. 5. Add 100 pL of proteinase K (0.4 mg/mL final concentration) and 250 FL of sarcosyl solution (1% final concentration), mix thoroughly, and mcubate at 37°C for 1 h or until complete lysis 1sachieved. 3.1.2.2. METHOD WITH MUTANOLYSINE, PRONASE, AND GUANIDINE ISOTHIOCYANATE (SEE NOTE 3) 1. Centrifuge 40 mL of bacterial cells (see Section 3.1.2.1.) step 1) and resuspend the pellet in 2 mL TEST buffer. 2. Add 250 p,L of mutanolysine solution (or 250 U) and incubate at 37°C for 30 min. 3. Add 44 pL of 20 mg/mL pronase and 140 pL of sarcosyl20%, mix, and Incubate at 37°C for 1 h. 4. Add 5 mL of 5M guanidme isothiocyanate solution and mcubate at 45OC for 1 h.
3.2. Purification
of DNA
1. To the bacterial lysate, add an equal volume of phenol-chloroform mixture, mix thoroughly but gently (see Note 5) to obtain a milky homogenous emulsion. Caution: Phenol is highly corrosive. Always wear gloves and protective glasses. 2. Centrifuge at 4OOOgfor 10 min to separate the aqueous phase containing the nucleic acids (upper phase) from the organic phase (lower phase) and the proteins found at the interface. 3. Carefully collect the aqueous phase avoidmg the interface material. 4. To the collected aqueous phase, add an equal volume of phenol-chloroform mrxture. MIX well, centrifuge at 4000g for 5 min, and collect the aqueous upper phase. 5. Repeat the phenol/chloroform extraction until there is no longer a whrte interface. Where appropriate, carbohydrate extraction can be done at this stage (see Note 4). 6. To the aqueous phase, add two volumes of cold ethanol. MIX slowly the ethanol/water and spool the precipitated DNA using a glass rod or a Pasteur pipet; squeeze off the excess fluid against the wall of the tube and scrape the precipitate into a fresh tube.
rRNA
Gene Restriction
Patterns
189
7. If the DNA 1sin the form of small filaments, collect DNA by centrifugation at 10,OOOgfor 15 min at 4OC;discard the supernatant, wash the pellet in 70% ethanol, and dry m a vacuum desiccator. If the yield of DNA is low, precipitation will occur upon freezing at -2OOC for 2 h or at -7OOCfor 30 mm. 8. Dissolve the DNA precipitate in 1 mL of TE buffer in an Eppendorf tube
(add severaldrops of chloroform to avoid bacterial growth) and rock the tube until the DNA is dissolved. 3.3. Estimation of DNA Concentration and Quality Control of DNA
For restriction analysis, DNA should be of the highest molecular weight possible and very pure (see Notes 4, 5, and 1la). 1. Measure the absorbance at 260, 280, and 300 nm of 1:20 diluted DNA sample. The DNA concentration in mg/mL is obtained by subtracting absorbance at 300 nm from absorbance at 260 nm m the diluted sample. The absorbance ratio AZ6dA2s0 should be around 1.8-l -9. Ratios below 1.7 indicate significant protein contammation (see Note 1la). 2. To check the apparent molecular size of the native DNA, run a sample of undigested DNA on an agarose gel and stain with ethidium bromide. Fragments below 10 kb in size indicate significant shearing of the DNA (see Notes 5-9). 3.4. Cleavage of DNA with Restriction Endonuclease 1. Calculate and record the volumes of each reagent required in each restriction digest. Each digest of 25 PL should contain 2-5 pg of DNA in a volume of 20 pL. If necessary, dilute the DNA with distilled water to achieve this concentration. 2. Add 2.5 pL of the appropriate 10X restriction enzyme buffer and mix well, 3. Allow 5-50 U of enzyme for each tube (l-10 U/pg of DNA). Initially, add only half the required enzyme, mix, and pulse spin in a microcentrifuge. Never allow the enzyme concentration to be greater than 10% because the glycerol in the storage buffer affects the enzyme activity. If the restriction enzyme required comes to more than 10% of fmal volume, use a higher concentration of restriction enzyme. 4. Incubate at the recommended temperature (usually 37”C), in a water bath for 2 h. 5. Add the remainder of the enzyme and incubate for an additional 2 h. It is not necessary to stop the reaction by adding EDTA or by heating. The reaction mixture can be stored at -20°C, until you are ready to run the gel. 6. Prior to electrophoresis, add 2.5 pL of 10X loading buffer and pulse spin to gather the contents of the tube to the bottom.
190
Grimont
and Grimont
3.5. Agarose Gel Electrophoresis of DNA Restriction Fragments
To separate fragments of 0.7-20 kb, use 0.8% agarose gels. 1. Wash the casting plate and seal it with plastic tape. 2. Pour in the melted agarose(200 mL of 0.8% agarosein 1X TBE) and insert the comb. The gel thickness should be about 5 mm. Make sure that no bubbles are trapped in the gel. Allow it to set at room temperature (about 30 min). 3. Remove carefully the plastic tape and the comb. 4. Place the casting tray carrying the gel m the electrophoresis tank: The end with the wells should be at the cathode (minus sign). 5. Pour electrophoresis buffer (working solution) into the tanks to cover the gel to a depth of about 5 mm. 6. Using a micropipetor, load the whole of each sample into a different well. Load molecular weight standards in one or more of the lanes. 7. Run at 35-40 V for 16 h. Ensure that the current is 50-60 mA and that the dye migrates in the right direction. 8. Transfer the gel mto a tank containing 1 l,tg/mL ethidmm bromide m 1 mM EDTA or TBE buffer for about 30 mm. Destaining in the same solution without ethidium bromide may enhance the contrast. 9. Photograph the gel under UV illumination, with a ruler alongside. The patterns obtained are total DNA restriction patterns. Patterns produced by different isolates can be compared visually (see Notes 9-12). 3.6. Vacuum
Transfer
of DNA
Fragments
to Membrane
Although the original Southern method (3) is still widely used, the procedure detailed here uses vacuum blotting and nylon membranes that e improve the speed of transfer and resolution of the final bands. In addition, nylon is more robust and can be handled easily (see Notes 14-16). Always wear gloves to avoid fingerprints and grease marks on the filter. 1, Immerse the gel in 0.25M HCI for 5-10 min at room temperature. Carefully remove and discard the used HCl.
2. Rinse the gel twice with distilled water. 3. Immerse the gel in the NaOH-denaturmg solution for 30 min (see Note 17). 4. Rinse with distilled water. 5. Follow the manufacturer’s instructions to prepare the vacuum blotting unit: Place the screen on the inner rim of the base unit. 6. Crop the transfer membrane to the size of the gel and soak it in 2X SSC. 7. Place the wet membrane on the screen and overlay with a plastic mask
rRNA Gene Restriction
8. 9. 10. 11. 12. 13.
14.
Patterns
191
which has a window cut to a size slightly smaller than the membrane, so that the mask overlaps (by about 5 mm) the edges of the transfer membrane. Very carefully remove the gel from the denaturing bath and place it, well side down, on the transfer membrane. Align the upper side of the wells on the mask window rim. Avoid air bubbles between the gel and the membrane. Fit the top frame of the apparatus and apply a vacuum (55 cm HzO). Cover the gel with 100 mL transfer solution. After transfer (about 60 min), mark the positions of the wells using a pencil or a pin on the side opposite to that with the DNA and remove the membrane (see Note 15). Rinse the membrane with 2X SSC for 2 mm. Leave the membrane in a drying oven (37°C) for about 10 min. Fix the DNA on the membrane by heating for 1 h at 80°C in an oven, or (nylon membrane only), fix the DNA by UV crosslinking: Wrap the nylon membrane in Saran WraprM, place the membrane DNA side down on a standard UV transilluminator, and turn on the UV (about 305 nm) for 2-5 min. Store the membranes wrapped in filter paper and aluminum foil at room temperature m a dry place. They can be stored almost indefinitely.
3.7. Hybridization with AAF-Labeled rRNA and Immunoenzymatic Detection Three steps are required (10,13): Prehybridization (saturation) to avoid nonspecific binding of the probe on the membrane, hybridization, and washing. The last two steps are strongly influenced by the temperature and the ionic strength of solutions. The hybridization temperature will be determined by the phylogenetic proximity of the studied strains with E. coli (if the probe derives from this species): Use 65°C for Enterobacteriaceae and 60°C for Gram-positive bacteria. One or two 20 x 17 cm membranes can be hybridized in a sealable plastic bag, or up to four membranes in a hybridization incubator tube, Best results are obtained when hybridization and antibody reactions are carried out in a hybridization incubator. However, the different washing steps are often more thoroughly done in plastic boxes (see Note 17).
3.7.1. Prehybridization 1. Immerse the transfer membranes in 100 mL of prehybridization solution (in a plastic box with cover or in a special tube for use in a hybridization mcubator).
192
Grimont
and Grimont
2. Add 1 mL of denatured herring sperm DNA (boiled for 10 min at 1OO”C,and quickly cooled on ice) to obtain a final concentration of 100 pg DNA/mL. 3. Incubate at 65°C for 1 h with shaking. 3.7.2. Hybridization 1, Dilute the hybridization solutron: Mix 5 mL of sterile distilled water and 5 mL of 2X hybridization solution. 2. To this solution, add 100 PL of herring sperm DNA and, if needed (to visualize molecular weight standard Raoul I), 1 pg of AAF-labeled pBR322 (final concentration 100 ng/mL). Denature both DNAs by boiling at 100°C for 10 min and cooling them rapidly on ice. 3. Add 2.5-5 pg of the AAF-labeled rRNA probe (final concentration 250500 ng/rnL). 4. Mix well and pour into the hybridization incubator tube or the sealable bag (eliminate the air bubbles, when sealing the bag). 5. Incubate at the chosen temperature (65” or 60°C depending on the bacterial group studied) for 16 h with shaking. Place the bags in a box containing water: The box is itself in a water bath with a weight on top of the box. 3.7.3. Washing 1. Remove the membranes and wash with shaking three times for 15 min in a box with 200 mL of washing buffer A at the same temperature as for the hybridization. 2. Wash once for 15 mm with 200 mL of washing buffer B at room temperature with shaking. This washing should be omitted when the probe and restricted DNA are from phylogenetically remote organisms (e.g., E. coli rRNA probe used against Gram-positive bacterial DNA). 3.7.4. Immunoenzymatic Detection of AAF Probes
3.7.4.1. SATURATION 1. Wash the membranes in 200 mL of maleic acid/Tween-20 washing buffer for 5 min at room temperature in a clean plastic box. 2. Incubate the membranes in 20 mL of blocking solution for 30 min at room temperature with shaking. 3. Wash twice for 10 min m 100 mL of maleic acid/Tween-20 washmg buffer in clean boxes.
3.7.4.2. BINDING
OF ANTI&IF
MONOCLONAL
ANTIBODY
1. Dilute the anti-AAF monoclonal antibody m 10 mL of blocking solution (1 pg/mL final concentration). 2. Pour the anti-AAF monoclonal antibody into the sealable bag or the hybridization tube containing the membranes. 3. Incubate at room temperature for 2 h with shaking.
rRNA
Gene Restriction
Patterns
193
4. Wash three times for 10 min at room temperature in 100 mL of maleic acidflween-20 washing buffer with shaking in clean boxes.
3.7.4.3. BINDING OF ANTIMOUSE CONJUGATED
IGG ALKALINE
PHOSPHATA~E-
ANTIBODIES
1. Dilute the antimouse IgG alkaline phosphatase-conjugated antibodies in 10 mL of blocking solution (1 pg/mL final), and pour into the sealable bag or the hybridization tube. 2. Wash three times for 10 min at room temperature in 100 mL of maleic acid/Tween-20 washing buffer with shaking.
3.7.4.4. ENZYMATIC DETECTION 1, Prepare 250 mL of alkaline phosphatase buffer (pH 9.5) (see Section 2.7., step 7) and wash the membranes in 200 mL for 10 min at room temperature with shaking. 2. Just before use, prepare 50 mL of developer for each membrane. 3. Place the membrane m a clean plastic box (see Note 20) and pour on the developer. Work preferably in the dark. 4. Closely monitor the progressof the enzymaticreaction that develops between 5-60 min. When a purple color appears, stop the reaction by washing the membrane in distilled water. Dry in the dark (see Notes 13,14,17-19). 3.8. Hybridization with Peroxidase-Labeled &WA and Detection by ECL (ECL System) 3.8.1. Labeling of the Probe The probe is labeled with the enzyme HRP following the manufacturer’s instructions. 1. For one membrane, heat 600 ng of rRNA from E. coli (diluted to 10 ng/pL in the water that is supplied with the kit) at 55°C for 10 min and cool on ice for 5 min. Spm briefly (5 s). 2. Add to the cooled rRNA an equal volume (60 pL> of labeling reagent (HRP). 3. Add 60 PL glutaraldehyde solution to crosslink the HRP to the probe. Briefly (1 s) mix by vortexing. 4. Spin for 5 s and incubate at 37°C for 10 min (if not used immediately, this can be held on me for lo-15 min). 3.8.2. Prehybridization and Hybridization (11) 1. Place the membrane in the hybridization buffer (30 mL) and carry out a prehybridization incubation at 42OC wrth shaking for 1 h. 2. Add the labeled DNA probe to the hybridization buffer and mix gently, 3. Continue the incubation with agitation at 42°C overnight.
194
1. 2. 3. 4. 5. 6. 1.
2. 3. 4. 5. 6. 7.
Grimont
and Grimont
3.8.3. Washing After hybridization, remove the membrane, place it in a clean box containing 700 mL of primary wash buffer prewarmed to 42°C. Incubate at 42°C for 20 min with shaking and discard the primary wash buffer. Repeat with 700 mL of fresh primary wash buffer. Discard the primary wash buffer and replace with secondary wash buffer. Incubate for 5 min at room temperature with agitation, Repeat the secondary wash. 3.8.4. Detection of the Label Immediately before use, mix equal volumes of detection reagent 1 (contaming hydrogen peroxide, the substrate for peroxidase) with detection reagent 2 (containing lurnmol, which produces blue light upon oxidation). The light output is increased by the presence of an enhancer, so that it can be detected on a blue-light-sensitive film. Drain the excess buffer from the membrane and pour 25 mL of mixed detection reagents onto the face of the membrane carrying the DNA. Incubate for precisely 1 mm at room temperature. Drain off the excess detection buffer and wrap the membrane in Saran WrapTM, avoiding air pockets. Place the membrane, DNA side up m a cassettewith a sheet of autoradiography film on top. Close the cassetteand expose for 1 min. Work as quickly as possible. Remove film and immediately replace it with a fresh piece of unexposed film, and reclose film cassette.Start a timer. Develop the first film, immediately. Determine the exposure time of the second film from the appearance of the first developed film. Generally, a 20-min exposure is sufficient with an ECL-labeled-RNA probe.
3.9. Determination of DNA Fragment Sizes Band migration, i.e., the distance between the trace of the well and a band corresponding to a DNA fragment can be measured by eye with a ruler on the stained membrane (when AAF-labeled t-RNA has been used) or on photographs. In our experience, this measurement is responsible for a 1.5% error in fragment size. Alternatively, the picture of the stained membrane or photograph can be electronically captured by use of a handscanner, flat-bed scanner, or video camera interfaced to a microcomputer through a videocapture board. The best choice is a system that would generate a Tagged Image File Format (TIFF) picture with 256 gray lev-
rRNA Gene Restriction
Patterns
195
els. The tags associated with a TIFF image contain all necessary image parameters. TIFF images stored on a 3.5” disk can be viewed on either Apple Macintosh or IBM PC machines with color screens and appropriate software. A program should be able to measure migration distances (e.g., in pixels). The error of one such measurement is about one pixel that corresponds in average to less than 0.5% of molecular size. Standard fragments exhibit a curvilinear relationship between the mobility of the bands and their molecular sizes. In our laboratory, Schaffer and Sederoff’s algorithm (14) relating molecular size to reciprocal of mobility is currently used. Such an algorithm can easily be adapted for use on any microcomputers. Fitting of standard bands and unknown is by least squares and the percent error is less than 1% (15). 1.
2. 3.
4. 5.
6.
4. Notes Ensure that the test culture 1spure, especially with exacting or slow growing bacteria (e.g., Legionella, Brucella, Haemophilus spp.), which might be susceptible to overgrowth with fast growing bacterial contaminants. Prior to the DNA preparatron, check the culture by spotting a drop of bacterial suspension on a solid ordinary medium on which the studied bacterium is not expected to grow (e.g., nutrient agar). The suspensions can be stored frozen until used. Gram-negative bacteria are easily lysed by detergents such as SDS (12) or sodium hydroxide (Z6). Concomitant proteinase treatment is likely to improve the yield. The cell wall of Gram-positive bacteria can be very difficult to disrupt and often requires murolytlc enzyme treatments (e.g., lysozyme, mutanolysine, achromopeptidase) followed by action of chaotropic agents (I7- 22). It is sometimes necessary to sensitize the cell wall by growing the bacteria m the presence of penicillin (2I), cycloserine (23), or a mixture of oL-threonine and glycine. Lysis is often easier when bacteria are in the exponential phase of growth. Some bacterial strains produce polysaccharides that coprecipltate with DNA. Remove these contaminants by precipitation with cetyl trimethylammonium bromide (24). Degradation of DNA by nucleasesor shearmg should be avoided by chelating divalent cations with EDTA and gentle handling of the DNA solution, respectively. Extracted bacterial DNA using these protocols should be at least 50 kb in length. If no DNA can be observed on gel electrophoresis, a larger volume of starting culture may be required. If a pellet 1sobserved after centrlfugation
196
7.
8.
9. 10.
11.
Grimont and Grimont of the phenol-chloroform- “lysed bacterial suspension” mixture, this indicates that cell lysis has been inefficient. Occasionally in some species (Enterobacter cancerogenus, Bacillus cereus), bacterial nucleases overcome inhibition by EDTA. Use guanidine isothiocyanate in the lysing procedure or boiling m the presence of enough NaCl to avoid DNA denaturation (followed by dialysis) may destroy those nucleases. If the problem affects the DNA of common bacterial strains, then review all basic DNA handling procedures (sterile glassware, EDTA concentration, heated RNAse, use of gloves, etc.). High molecular weight DNA can be observed as a slow migrating band. A fuzzy spot of fast migrating RNA may be observed, but this does not interfere with the experiment. RNAse treatment can be used to eliminate this. The pattern of cleaved fragments should be compared to a successful restriction pattern obtained earlier with the chosen endonuclease (hence, the need to keep a photographic record). If a smear of lower molecular size with no visible bands is observed, there may be inherent endonuclease in the DNA preparation (see Note 7). Test this by incubation in the absence of restriction enzyme. However, it is possible, that this enzyme is unsuitable for study of this strain, although it may be appropriate for other bacterial DNAs. DNA cleavage problems: a. To eliminate salts and traces of phenol or other inhibitors and improve enzymatic digestion, carry out a microdialysis of DNA on a filter (Millipore type VS, diameter 2.5 cm; pore size 0.025 pm): Place the filter (bright side up) onto TE buffer (30 mL) in a Petri dish and carefully deposit a small volume of DNA (less than 100 pL) on the floating membrane. Dialyze for 20 min. This is often sufficient to remove inhibitors, but a further phenol-chloroform treatment and ethanol precipitation step prior to microdialysis may be required. b. If no cleavage (or partial cleavage) is observed, there may be contamination with inhibitory substances (SDS, phenol, traces of ethanol) in that particular preparation, especially if the endonuclease has been observed to cleave other DNA samples efficiently. Remove suspected contaminants asdescribed earher (seeNotes 4 and 1la), However, if all the DNA samples of a bacterial species are resistant to cleavage, the property may be associated with the species and that enzyme/species combination is unsuitable for these studies. Finally, some bacterial DNA (e.g., Legionella) can only be cleaved with high (8- to lo-fold higher) endonuclease concentrations. Highly concentrated endonucleases (lofold the ordinary concentration) are provided by some suppliers,
rRNA Gene Restriction
Patterns
197
12. Overloaded gels can yield a smear (extending from high to low molecular size) with barely distinguishable bands. This will still give good results after hybridization. 13. Weak or nonexistent signals can be causedby a number of things. First, bacteria phylogenetically remote from E. coli (e.g., Gram-positive bacteria, spirochetes, and archebacteria) may not hybridize efficiently to the probe. Second, the hybridization temperature or washing conditions may have been too stringent. Adjust the stringency by lowering the temperature or altering the NaCl concentration in the wash solutions. An alternative solution to the above problems is to prepare 16 + 23 S rRNA from a bacterium phylogenetically closer to the studied bacteria and label with ECL system. 14. Nylon membranes vary widely in quality among manufacturers. Quality variation among batches has also been observed. Check the membrane using a positive control, such as E. coli DNA samples. 15. Do not change the transfer conditions unnecessarily. Poor results can arise from excessivetransfer times. Other causesof inefficient transfer include poor vacuum, dirty screen in the vacuum blotter, and incorrect transfer solutions. Occasionally, but rarely, there have been problems with the AAF-r-RNA kit. 16. Positively charged nylon membranes may give excessive background staining with our AAF-rRNA hybridization and immunoenzymatic visualization protocols. Other types or brands of nylon membrane may lead to high backgrounds and should be tested with the protocols detailed in this chapter before switching. 17. Insufficiently clean boxes in the washing, hybridization, and immunoenzymatic detection steps can cause high backgrounds. 18. Ensure that the casein is properly dissolved in malerc acid buffer and always use the recommended grade of commercial casem, to avoid elevated backgrounds. 19. Excessive alkali treatment can cause membrane surface damage and lead to high backgrounds. 20. Avoid carryover, or contamination with hybridization buffer or wash buffer prior to detection elevates background staining. 21. Standard fragments exhibit a curvilinear relationship between the mobility of the bands (M) and their molecular sizes (L). Linear models have been proposed that more or less fit with experimental data. Logarithmic relationship (25): logL=a+bM
Fitting of standards and unknown bands is done by the least squares method. This formula gives the least accurate interpolation, with a percent error > 8% (15).
198
Grimont
and Grimont
Cubic spline (26): L=exp(a+bM+cM2+dM3) Although the fitting of standards is exact, that of unknown bands (least squares method) has an error ranging from l-2% (1.5). Molecular size vs reciprocal of mobrhty (1#,15,27,28): Several vat-rations of Southern’s reciprocal relationship (28) have been proposed. Schaffer and Sederoff s formula (Z4) is used for a global fit (Le., uses all standard fragments): L-L,=a/(M-MO)
where Lo and IV, are correction parameters. Fitting of standard bands and unknown 1sby least squares and the percent error is less than 1% (15). Elder and Southern’s modified formula (15) ts used for local fit (i.e., uses the three or four standard fragments that are closest in srze to the unknown fragment): where p is an ad hoc parameter. This relationship has been found most accurate with an error c 0.1% (15).
Acknowledgment This work has been supported by the European Community, contract BIOT-CT9 l-0294.
References 1. Meyers, J. A., Sanchez, D., Elwell, L. P , and Falkow, S. (1976) Simple agarose gel electrophoretic method for the identification and characterization of plasmrd deoxyribonuclerc acid. J Bactenol. 127, 1529-1537. 2. BovC, J. M. and Saillard, C. (1979) Cell biology of sprroplasma, in The Mycoplasma, vol. 3 (Whitcomb, R. F and Tully, 3. G., eds.), Academic, New York, pp. 83-153. 3. Southern, E. M. (1975) Detection of specific sequences among DNA fragments separated by gel electrophoresis. J. Mol. Biol. 98,503-517. 4. Tompkins, L. S., Troup, N., Labigne-Roussel, A , and Cohen, M. L (1986) Cloned random chromosomal sequences as probes to identify Salmonella species. J. Infect. Dis 154156-162.
5. Ogle, J. W , Janda, M., Woods, D. E., and Vasrl, M. L. (1987) Characterization and use of a DNA probe as an epidemlologlc marker for Pseudomonas aerugmosa. J. Infect. Du. 155, 119-126.
6 Versalovic, J., Koeuth, T., and Lupskr, J R (1991) Distribution of repetitive DNA sequences in eubacteria and application to fingerprintmg of bacterial genomes Nucleic Acids Res. 19,6823-683
1.
rRNA
Gene Restriction
Patterns
199
7. Fox, G. E., Stackebrandt, E., Hespell, R. B., Gibson, J , Maniloff, J., Dyer, T. A., et al. (1980) The phylogeny of prokaryotes. Science 209,457463. 8 Grimont, F. and Grrmont, P. A D (1986) Ribosomal ribonucleic acid gene restriction patterns as potential taxonomic tools. Ann. Inst. Pasteur/Microbial. 137B, 165-175 9. Stull, T , LiPuma, J. J , and Edlind, T D (1988) A broad-spectrum probe for molecular epidemiology of bacteria. ribosomal RNA J Infect. Dis 157,280-288. 10. Grimont, F., Chevrier, D , Grimont, P. A. D., Lefevre, M , and Guesdon, J.-L. (1989) Acetylaminofluorene-labeled ribosomal RNA for use m molecular epidemiology and taxonomy. Res. Microbial. 140,447-454 11. Koblavi, S , Grimont, F., and Grimont, P. A D (1990) Clonal diversity of Vibrio cholerae 01 evidenced by rRNA gene restriction patterns. Res Microbial. 141, 645-657.
12. Brenner, D J., McWhorter, A. C., Leete Knutson, J. K , and Steigerwalt, A. G. (1982) E. vulneris: a new species of Enterobacteriaceae associated with human wounds. J Clin. Microbial. 15, 1133-1140 13. Grimont, F. and Grimont, P. A. D (1991) DNA fingerprinting, in Nucleic Acid Techniques tn Bacterial Systemattcs (Stackebrandt, E. and Goodfellow, M., eds.), Wiley, Chichester, UK, pp 249-279. 14. Schaffer, H. E and Sederoff, R R. (198 1) Improved estimation of DNA fragment length from agarose gels Anal. Biochem. 115, 113-122. 15. Elder, J. K. and Southern, E. M. (1983) Measurement of DNA length by gel electrophoresis II: comparison of methods for relating mobility to fragment length Anal. Biochem. 128,227-23 1 16. Beji, A., Izard, D., Gavmi, F., Leclerc, H , Leseme-Delstanche, M., and Krembel, J (1987) A rapid chemical procedure for isolation and purification of chromosomal DNA from Gram-negative bacilh. Anal. Biochem. 162, 18-23. 17. Barsotti, 0, Renaud, F., Freney, J., Benay, G., Decoret, D., and Dumont, J. (1987) Rapid isolation of DNA from Actinomyces Ann. Inst Pasteur/ Microbial.
138,529-536
18. Champomier, M -C , Montel, M.-C, Grimont, F., and Grimont, P A D (1987) Genomic identification of meat lactobactlli as Lactobacillus sake Ann Znst Pasteur/Mtcrobtol.
138,751-758.
19 Ezaki, T. and Suzuki, S. (1982) Achromopeptidase for lysis of anaerobic Grampositive cocci. J. Clin. Microbial 16,844-846. 20. Lippke, J. A , Strzempko, M N , Raia, F F , Simon, S. L., and French, C K (1987) Isolation of intact high-molecular-weight DNA by using guanidine isothiocyanate. Appl Environ
Mtcrobtol.
53,2588,2589.
21. Rocourt, J., Grimont, F , Grimont, P. A. D., and Seeliger, H. P. R. (1982) DNA relatedness among serovars of Listeria monocytogenes. Curr Microbial. 7, 383-388.
22. Thompson, J and Gillespie, D. (1987) Molecular hybrization with RNA probes in concentrated solutions of guanidine thiocyanate Anal Bcochem. 163, 281-291.
Grimont
and Grimont
23. L&y-Frebault, V., Grimont, F., Grimont, P. A. D., and David, H. L. (1984) Deoxyrrbonucleic acid relatedness study of Mycobacterium fallax Int. J. Syst. Bacterial.
34,423-425. 24. Francino, O., Pinol, J., and Cabre, 0. (1987) Precipitation of DNA by cetyl-trimethylammonium bromide to avoid coprecipitation of salts. Application of the method of recovery of Drosophila DNA following adsorption to hydroxyapatite. J. Biochem. Biophys. Methods 14,113-l 80. 25. Fisher, M. P. and Dingman, C. W. (1971) Role of molecular conformation in determining the electrophoretic properties of polynucleotides in agarose-acrylamide composite gels. Biochemistry 10, 1895-1899. 26. Parker, R. C. (1977) Conversion of crrcular DNA to linear strands for mapping, in Methods in Enzymology, vol. 65 (Grossman, L. and Moldave, K., eds.), Academic, New York, pp. 415-430. 27. Plikaytis, B. D , Carlone, G. M., Edmonds, P., and Mayer, L.W. (1986) Robust estimation of standard curves for protein molecular werght and linear-duplex DNA base-pair number after gel electrophoresis. Anal. Biochem. 152,346-364. 28. Southern, E. M. (1979) Measurement of DNA length by gel electrophoresis. Anal Biochem. 100,3 19-323.
CHAPTER18 Preparation of Nonradioactive DNA Probes Adrian
Eley and Kevin M. Oxley
1. Introduction This chapter describes a simple method of making DNA probes with a nonisotopic label. The development of this type of new technology has, for example, created novel ways of detecting and identifying pathogenic microorganisms, which has led to a re-evaluation of methodological approaches in the diagnostic microbiology laboratory. At the same time, the move away from radioisotopes with all associated safety hazards has allowed DNA probe technology in general to become more accessible and more user friendly. A DNA probe can be manufactured from either chromosomal or extrachromosomal DNA and in this example we discuss one made from plasmid DNA. A number of procedures are involved (see Fig. l), although the first two are not described in detail here: 1. Growth of the plasmid-containing bacteriain broth culture; 2. Bacterial lysis and plasmid extraction; 3. Separationof plasmid vector and insert; 4. Purification of insert DNA; 5. Measurementof insert DNA; 6. Nonisotopic labeling of DNA; and 7. Verification of chemiluminescentDNA by hybridization, In our description that follows, we have used commercially available systems for purification, measurement, and nonisotopic labeling of DNA. From: Methods in Molecular Ecology, Vol 46: Diagnostrc Bacterrology Protocols Edtted by: J. Howard and D M Whttcombe Humana Press Inc , Totowa, NJ
201
202
Eley and Oxley
8
/
I----
6 \
Fig. 1. A flow diagram showing all stages in DNA probe production from growth of bacteria to hybridization. Key: 1, plasmid extraction; 2, separation of plasmid and vector; 3 and 4, insert purification; 5, measurement of insert DNA; 6, nonisotopic labeling of DNA; 7, hybridization; 8, probe development. Further details of reagents and procedures will be found in handbooks and guidelines supplied with the kits. Use at least analytical throughout.
2. Materials grade water with a resistance of cl7 MQ
1. L Broth: 1% (w/v) bacto-tryptone, 0.5% (w/v) bacto-yeast extract, 1% (w/v) NaCl, pH 7.0. Aliquot, autoclave, and store at room temperature. 2. Ampicillin: 10 mg/mL stock. Store at 4°C for several weeks. 3. TE buffer: 10 mM Tris-HCl, 1 n&I EDTA, pH 8.0. Autoclave and store at room temperature. 4. Ribonuclease: Dissolve at a concentration of 10 mg/mL in 10 n&f TrisHCl, pH 7.5,15 mMNaC1, and boil for 15 min. Store in aliquots at -20°C. 5. Restriction endonucleases: Supplied at lo-200 U&L. Store at -2OOC.
Nonradioactive
DNA Probes
203
6. Restriction buffers: Supplied by the enzyme manufacturer. “Universal” buffers such as “One-Phor-All” (supplied by Pharmacia, Uppsala, Sweden) are also available, although not every enzyme works optimally in these buffers, and it is advisable to check with the manufacturer’s datasheet. 7. EDTA: 0.5M stock, pH 8.0. 8. Agarose: Use molecular biology or electrophoresis grade. 9. TAE buffer (X50): 2M (242 g) Tris base, 57.1 mL glacial acetic acid, 100 mL 0.5M EDTA. Make up to 1 L with water (pH 8.0). Autoclave and store at room temperature. Dilute to a 1X solution for use. 10. Hi&III digested h DNA: (eight fragments: 23,130, 9416, 6557, 4361, 2322,2027,564, and 125 bp). 11. Loading dye (X6): 0.25% (w/v) bromophenol blue, 0.25% (w/v) xylene cyan01 ff, 30% (v/v) glycerol in water. Store at 4°C. 12. Ethidium bromide: 10 mg/mL stock solution diluted to 1 yg/mL for use. Keep in a dark bottle or aluminum foil wrapped container and store at room temperature. 13. TNE buffer (X10): 100 m&f Tris-HCl, 10 mM EDTA, 1M NaCl, pH 7.4. Autoclave and store at room temperature. 14. Stock dye solution: 10 mg Hoechst 33258 (Hoefer, Newcastle-underLyme, UK) in 10 mL water. Store at 4°C and protect the container from light by wrapping in aluminum foil. 15. Reference standard DNA: Prepare a set of reference DNA standards from calf thymus DNA (e.g., Hoefer) 1 mg/mL stock solution using TNE buffer as diluent. The following concentrations are usually adequatefor a range of assays: 25 pg/mL Low reference standard Medium 100 p.g/mL High 250 pg/mL Store for up to 6 mo at 4OC. 16. The Geneclean@kit (Stratagene, Luton, UK) which includes Glassmilk (a suspension of silica matrix in water), 4M NaI, and 10X concentrate of “new wash” buffer containing NaCl, Tris-HCl, Tris-OH, and EDTA. 17. New wash buffer: Add 14 mL of “new wash” to 280 mL of water and 310 mL of absolute (100%) ethanol, mix, and store at -20°C between uses. 18. Glassmilk: Resuspend the insoluble silica matrix by vigorous vortexing. If the Glassmilk has dried out, add an equal volume of sterile water. Store the Glassmilk tube on its side to aid the resuspension of the matrix. 19. The ECL direct nucleic acid labeling and detection system (Amersham, Little Chalfont, UK): Hybridization buffer supplied in the ECL kit
204
Eley and Oxley
requires the addition of NaCl (analytical grade) and 5% (w/v) blocking agent for effective hybridization of the probe. If the optimum NaCl concentration is not known or has not been determined, then 0.5M NaCl generally gives acceptable results. Mix the blocking agent (supplied) into the buffer slowly and thoroughly using a heated magnetic stirrer at 65°C for at least 1 h. Aliquot into 20 mL volumes and store at -20°C for up to 3 mo. 20. Saline sodium citrate (SSC; 20X concentrate): 3M NaCl, 0.3M sodium citrate, pH 7.0. Dilute as appropriate. 21. Primary wash buffer: 6M urea, 0.4% (w/v) SDS, 0.5X SSC. Store at 4°C for up to 3 mo. Prewarm to 42OCbefore use. The stringency of the buffer may be mcreased by using a lower final SSC concentration, for example, 0.1X SSC instead of 0.5X SSC. 22. Secondary wash buffer: 1X SSC.
3. Methods 3.1. Separation of PLasmid Vet tor and Insert (see Note 1) As an example, we have chosen to label the 7.5 kb Universal chlamydial plasmid from Chlumydia truchomatis serovar Ll 44 OLN, which has been inserted into Escherichia coli pCTL 12a. 1, Grow the organism in 10 mL L broth at 37°C overnight in the presence of 20 pg/rnL ampicillin, or another selective agent appropriate to the clone of interest. 2. Prepare the plasmid (insert and vector) using the method of Bnnboim and Doly (I). 3. Following ethanol precipitation, resuspend the plasmid pellet in 50 l.tL of TE buffer with RNase at a concentration of 50 pg/rnL. Incubate this mixture at 37°C for 30 min to remove any residual RNA. 4. In order to excise the chlamydial insert from the vector, use a restriction endonuclease (in this case,PstI). Mix 20 pL of plasmid solution, 40 pL of sterile ultrapure water, 8 pL of 10X One-Phor-All buffer (Pharmacia), 12 pL of PstI (2500 U). Ensure that the reaction is well mixed before addmg the restriction enzyme. 5. Incubate the digest at 37°C for 4 h and add 1.6 pL of 0.5M EDTA, pH 8.0, to stop any further digestion. 6. Prepare an agarose gel to demonstrate the separation of vector and insert DNA. Pour a 0.7% agarose solution in TAE buffer (see Note 2) into a 76 x 80 mm gel tray and leave to set with a sample comb in place. 7. When the gel has set, remove the comb, place the tray in the gel tank, and fill the tank with TAE; add sufficient buffer to cover the gel surface by 1 mm.
Nonradioactive
DNA Probes
205
8. Add 10 FL of sample plus 2 pL of loading dye to all wells but one; to the remaining well add 7 p.L of Hi&III digested h DNA, 2 FL of loading dye, and 3 pL of water. 9. Typically, electrophorese for 90 min at 80 V. 10. Stain the gel wtth 1 l.tg/mL ethidmm bromide for 30 min (see Note 3). 11. Wash the gel in water for 2 min. When the gel is viewed on a UV transilluminator, it should now be possible to see two clear bands of DNA in the gel; in this example, the larger band is the insert and the smaller one IS the vector DNA.
3.2. Purification of Insert DNA Using the Geneclean Kit (see Note 4) 1. Excise the DNA band(s) from the agarose gel using a sterile scalpel blade and place into a microfuge tube (see Notes 5 and 6). 2. Add 2.5 to 3 vol of 4M NaI and incubate the tube at 55°C for 5-10 min, until the agarose has completely dissolved. Mix occasionally to speed up this process. 3. Add 5 pL of the insoluble silica matrix stock solution or Glassmilk, vortex, and incubate for 5 min at room temperature to bind the DNA. Mix every l-2 min to ensure that the Glassmilk remains in suspension(see Notes 7 and 8). 4. Centrifuge for 5 s at 11,600g to pellet the Glassmilk/DNA complex and remove the supernatant. 5. Add 1 mL of “new wash” buffer, vortex to resuspend the pellet and centrifuge for 5 min at 11,600g. Remove the supernatant and wash an additional two times. 6. After removing the supernatant from the third wash, centrifuge for 5 s and carefully remove any remaining “new wash” with a pipet to avoid diluting the eluate. 7. Elute the bound DNA by resuspending the pellet with TE buffer, water, or low salt buffer. Use a volume appropriate for the quantity of fragment to be recovered; a concentration of >lO ng/pL. 8. Incubate the tube at 55°C for 3 min and centrifuge for 30 s. 9. Carefully remove the supernatant (see Note 9) containing the eluted DNA and place in a new tube. For a lo-20% increase in recovery of DNA, perform a second elutton. Store the DNA solution at -20°C (see Note 2).
3.3. Measurement of Insert DNA Using a Fluorometer (see Notes 10 and 11) DNA estimations should be performed using a dedicated minifluorometer (e.g., Hoefer) designed specifically to detect relative fluorescence at 460 nm. DNA assays are based on the binding of the dye bisbenzi-
Eley and Oxley
midizole that increases the excitation spectrum to peak at 365 nm, and for the emission spectrum to peak at 458 nm; in the absence of DNA, the emission spectrum peaks at 492 nm. RNA does not compete with DNA for binding with the dye, and therefore the presence of RNA in the sample does not interfere with the quantitation of DNA. 1. Turn on the instrument and allow it to warm up and stabilize for at least 15 min before use. 2. Prepare 50 mL of 1X TNE buffer, add 5 pL of stock dye solution (see Note 12), and filter through a 0.22~pm Millipore filter. Prepare fresh solution daily. 3. Pipet 2 pL of the working dye solution into the dedicated glass cuvet. Wipe the cuvet carefully to remove all moisture and grease. Insert the cuvet mto the cuvet well and zero the instrument. Always place the cuvet in the same orientation in the well. 4. Using a micropipet, add 2 l,tL of DNA standard (see Note 13) to the cuvet and mix thoroughly with the pipet without introducing bubbles into the solution. Adjust the scale knob until the display readout matches the concentration of the standard. The concentration of the standard should be similar to the expected concentration of the sample DNA. 5. Repeat steps 3 and 4 until the reference standard readout reproducibly matches the concentration of the standard. 6. Wash out the cuvet with 2 mL of working dye solutton. Add an additional 2 mL and zero the mstrnment. Pipet 2 pL of sample DNA, mix thoroughly, and measure in the instrument. The concentration of the sample is the first readmg given by the instrument in units of l.tg/rnL. 7. If the sample concentration is significantly higher or lower than the calibrating standard, then recalibrate the instrument using a more appropriate standard DNA dilution.
3.4. Nonisotopic Labeling of Insert DNA (see Notes 14 and 15) One of the newer methods of nonisotopic labeling uses the principle of chemiluminescence (see Fig. 2), which is described later. The total amount of DNA required to make the probe is primarily determined by the size of the blotted membrane being probed. The minimum amount of DNA that should be labeled using the enhanced chemiluminescence (ECL) kit is 100 ng in 10 PL. The final probe concentration for hybridization should be 10 ng/mL for all membrane sizes. A hybridization volume of 0.25 mL of buffer/cm2 should be used which can be
Nonradioactive
DNA Probes
207
Hybond-N+ Peracid salt
Oxidized Product
n
Enhancer
u
Labelled .Probe
2H, 0
Hyperfilm-ECL
Fig. 2. The principle of the enhanced chemiluminescence reaction (reproduced with kind permission of Amersham International plc, Amersham, UK).
reduced to 0.125 r&/cm2 for large blots. For example: A 7 x 8 cm membrane will require: 56 cm2 x 0.25 = 14 mL of hybridization buffer
therefore, 140 ng of DNA probe will need to be labeled. A 20 x 20 cm membrane will require: 400 cm2 x 0.125 = 50 mL of hybridization buffer
therefore, 500 ng of DNA probe will be needed. These calculations are designed for hybridizations carried out in bags or boxes. If membranes are to be hybridized in rotary hybridization ovens, the volume of buffer, and the corresponding amount of DNA probe required may be reduced by half. 1. Using the water that is supplied in the ECL kit or ultrapure sterile water, dilute the DNA to 10 ng/mL of hybridization buffer (see Note 16). Prepare a volume of at least 20 pL.
Eley and Oxley 2. Boil the DNA m a water bath for 5 min to convert the double strands to single strands. 3. Immediately place the DNA on ice for 5 min. Briefly, spin the microfuge tube (10 s, 11,600g) to collect all the liquid at the bottom of the tube. 4. Add an equal volume of DNA labelmg reagent (see Note 17) (which contains positively charged horseradish peroxidase [HRP]) to the DNA and mix thoroughly with the pipet. 5. Add the same amount of glutaraldehyde solution (see Note 17) and briefly vortex. 6. Centrifuge for 5 s and incubate for 10 min at 37°C. The probe is now ready for use and does not require purification. If the probe is not used immediately it can be kept on ice for lo-15 min; alternatively, a stock solutton can be labeled and stored in aliquots at -20°C for 3 mo. 3.5. Verification of Probe Production by Hybridization and Detection of Chemiluminescent Signal
The probe can be hybridized to crude or pure DNA that has been applied by dot or Southern blotting on nitrocellulose or nylon membranes (see Note 18). Known quantities and types of target DNA will serve as positive and negative controls to ensure that the probe is functional and specific. 1. 2.
3. 4.
3.5.1. Hybridization Preheat the prepared hybridization buffer to 42°C with occasional mixmg for up to 30 min (see Note 19). Place the blot in hybridization buffer (0.25 n&/cm2 of membrane) and carry out a prehybridization for 30-60 mm at 42°C. When using hybridization bags, make sure all au bubbles are expelled. Failure to do so may prevent the subsequent binding of the probe and cause the appearance of white patches on the autoradiography film. Remove up to 10 mL of the prehybridization buffer and add the labeled DNA probe; mix gently and add to the blot. Incubate overnight with continuous agitation, preferably m a hybridization oven or shaking water bath at 42°C (see Note 20).
3.5.2. Washing the Membrane 1. Preheat the primary wash buffer to 42°C with occasional mixmg to redissolve any crystals of SDS. 2. Remove the blot from the hybridization medium, place in a clean container, and cover with an excessof primary wash buffer (2 mL/cm2). 3. Incubate at 42°C with agitation for exactly 20 mm. The blot must be able to move freely within the container.
Nonradioactive
DNA Probes
4. Discard the wash buffer and replace with an equal volume of fresh primary wash buffer. Incubate as in step 3 for 20 min. 5. Discard the wash buffer. Place the blot in a fresh container and add an excessof secondary wash buffer (at least 2 mL buffer/cm2). Incubate with agitation for 5 min at room temperature. 6. Repeat once more with fresh buffer. The blot may be left in the final wash buffer for up to 30 min or stored overnight, wetted with secondary wash buffer, in a sealed bag at 4°C.
3.5.3. Signal Generation IDetection All steps should be carried out in a darkroom. 1. Mix an equal volume of detection reagent 1 with detection reagent 2 to give a total volume of 0.125 r&/cm2 (see Note 17). 2. Remove excess secondary wash buffer by blotting the membrane onto filter paper and transfer it to a fresh container with the side carrying the DNA uppermost. Do not allow the membrane to dry out. 3. Add the mixed detection reagents and gently rock the container to ensure that the membrane is completely covered. 4. After 1 min, remove the membraneand drain off the excessdetection reagents. 5. Working quickly, wrap the membrane in clingfilm and gently smooth out any air bubbles. 6. Place the membrane, DNA side up, in a film cassette, and under a darkroom safety light place a sheet of blue-light-sensitive autoradiography film (e.g., Hyperfilm-ECL) on top of the blot, close the cassetteand expose for 1 min (see Note 21). 7. Remove the film, immediately replacing it with another sheet of ECLhyperfilm and reclose the film cassette. 8. Develop the first piece of film immediately using standard photographic solutions. The second exposure time will depend on the strength of the signal on the first exposure. If the initial image was strong, develop the second film within 5-10 min; if weak, leave for up to 1 h. 4. Notes 1. If you need to separate an insert from a vector, it is particularly advantageous if they differ markedly in size,so that there will be no contamination of insert with vector. 2. Do not use Tris/borate/EDTA (TBE) buffers in gels if you wish to recover DNA from them, as it has been shown that some TBE buffers may have a deleterious effect on recovery. However, the Geneclean II kit contains a TBE modifier that is added to the NaI to aid the melting of TBE agarose gels and neutralizes the inhibitory effect of TBE buffers. If DNA is not
210
3. 4.
5. 6. 7. 8.
9. 10.
11.
12.
Eley and Oxley binding as expected to Glassmtlk, even when isolating DNA from gels containing TAE buffer, the addition of l/10 volume of TBE modifier to the NaI/DNA mixture will often increase the binding of DNA to the silica. Ethidium bromide is a powerful mutagen and is moderately toxic; therefore, gloves should be worn at all times when handling this chemical. There are a number of other techniques available for DNA purification from agarose gels including the use of low melting point agarose, electroelution of DNA into dialysis bags (2), as well as commercial kits such as Geneclean. Of all these techniques, we have found Geneclean to give the most efficient recovery of DNA, especially for small plasmids (cl5 Kb). Newer commercial kits are now available that claim to increase the efficiency of DNA recovery, although they have not been tested by us. When using a scalpel blade to excise a DNA band, take specral care to avoid damage to the surface of the transilluminator. Alternatively, place the gel on a piece of clear plastic or perspex before excising the band. To minimize damage to DNA, use longwave UV light for as short a time as practical. Glassmilk will bind approximately l-2 pg DNA/5 FL of suspension. Binding of DNA to Glassmilk occurs rapidly; therefore it is not usually necessary to contmue this incubation for longer than 5 min. However, if the volume of the binding reaction is greater than 1.5 mL, allow a 15-min binding time with mixing every 2-5 min. Any carried-over Glassmilk will not interfere with subsequent use of DNA and the DNA will not bind to it in solutions containing less than 3M salt. A fluorometer is very easy to use for accurate and rapid quantification of DNA, and results are not affected by RNA. However, if purity of the sample is in doubt, especially with protein contamination, it would be advisable to use a UV spectrophotometer and measure absorption at 260 and 280 nm (2). The ratio between these readings (ODZ6dOD,s,) provides an estimate of the purity of the nucleic acid; pure preparations of DNA have an absorbance value of 1.8. The reading at 260 nm alone, allows the concentration of DNA in the sample to be measured such that an OD of 1 corresponds to approximately 50 pg/mL for double-stranded DNA. When using the fluorometer, it is important to remove all ethidmm bromide from the test DNA, since it quenchesthe fluorescence and will give an underestimate of the true reading. This can be achieved using the Geneclean kit, In general, results are more accurate with purified DNA, since increased concentrations of salt or SDS both interfere with the final estimate. The fluorescent dye, bisbenzimidizole (Hoechst 33258) is toxic and a possible carcinogen, and should be handled with care and proper safety precautions.
Nonradioactive
DNA Probes
211
13. Phage lambda, plasmid DNA, or a sample of your own purrfied DNA preparation can also serve as reference standard DNA. 14. The ECL kit can only be used to label DNA probes of >300 bp. Probes smaller than 300 bp have reduced sensitivity owing to the decreasing number of labelmg sites. 15. Newer amplification technology such as the polymerase chain reaction can amplify small pieces of DNA, which, when labeled using the methods described earlier, could serve as DNA probes (probes should be >300 bp). However, the DNA sequence of the segment to be amplified would have to be known and these probes tend to be small. We have successfully used such a probe of 517 bp. 16. For chemiluminescent labeling, the concentratron of salt in the sample should not exceed 10 miI4. 17. DNA labeling reagent, glutaraldehyde and detection reagents 1 and 2 are all supplied in the ECL kit. 18. Use positively charged nylon membranes (e.g., Appligene or Hybond N+, Amersham) with the ECL kit. Nitrocellulose membranes are not as easy to use because of their brittle nature. 19. A specially optimized hybridization buffer is included m the ECL kit that ensures efficient hybridization and protects peroxidase label during this step. A rate enhancer is also included in the buffer to generate additional sensitivity. The buffer requires the addition of blocking agent (supplied) and NaCl. 20. During hybridization and washing of the membrane, do not exceed a temperature of 42”C, because higher temperatures are detrimental to the enzyme component of the DNA labeling reagent. 21. When handling autoradiographic film, wear powder-free gloves as powder from gloves can inhibit
the ECL reaction and lead to blank patches on
films. Do not allow the autoradiographic film to come into contact with the signal developing reagents as this causes dark patches to appear. References 1. Birnboim, H C. and Doly, J. (1979) A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucleic Acids Res 7, 15 13-1523. 2. Sambrook, J., Fritsch, E. F , and Maniatis, T. (1989) Quantitation of DNA and RNA, in Molecular Cloning-A Laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, p. E5.
CHAPTER19
Preparation
of Bacterial Michael
Plasmid
DNA
lldly
1. Introduction Methods for isolation of small plasmids (usually cloning vehicles) from genetically characterized strains of Enterobacteriaceae (Exherichia coli and Salmonella) are well established (1-3). This chapter seeks to complement them by describing reliable basic methods for detecting and isolating larger, native, plasmids from less well-characterized bacteria. The methods presented here were developed for isolating plasmids from the Gram-negative bacterium LegioneZZapneumophila. Like the enteric bacteria, L. pneumophila belongs to the gamma-division of the Proteobacteria (4), but differs markedly from them in many respects. Its DNA is AT rich (GC = 38 mole%) (5), and its cell wall is less susceptible to lysozyme (6), owing to its distinctly different structure. The protocols presented herein are similar to those used for isolating plasmids from bacteria belonging to a wide range of very different genera, e.g., Mycobacterium (7), Rhizobium (8,9), and may be used as the basis of techniques for plasmid isolation from yet different species. The majority of plasmids so far encountered in bacteria are present in the cell as covalently closed circular molecules of double-stranded DNA, and the methods given rely on this property. In some cases, however, most notably in Streptomyces (IO,II) and Borrelia (12), linear plasmids have been observed. These are best examined by very different methods, such as pulsed field gel electrophoresis, which is discussed elsewhere in this volume. Plasmid cloning vectors are designed to replicate to high copy number and plasmid DNA cornprizes a major fraction of total cellular DNA. Most From Methods m Molecular Biology, Vol. 46’ D/agnostm Bacteriology Protocols E&ted by: J. Howard and D. M Whltcombe Humana Press Inc , Totowa, NJ
213
of them have been derived from natural plasmids that replicate freely in the bacterial cytoplasm and independently of many cellular controls. Indeed, many of these plasmids can continue to replicate in the absence of host protein synthesis, and, in such cases, plasmid yields can be maximized by the use of antibiotic amplification (2,3). In contrast, many native plasmids, especially large ones, have tightly regulated replication and low copy numbers (sometimes as low as one copy per cell). In these circumstances, the chromosomal DNA forms the vast majority of cellular DNA and the methods employed to separate and enrich plasmid DNA from chromosomal DNA, though qualitatively similar to those used in isolation of small plasmids, must be both gentler and more effective (13). The characteristics exploited to separate plasmid DNA are its supercoiled nature (14) and, to a lesser extent, its lower molecular weight and structural complexity. When the pH of a cell extract is raised to above 12, the hydrogen bonding between the antiparallel strands of the DNA molecules is disrupted and the DNA becomes nominally single stranded. On rapid neutralization of the solution, plasmid molecules, unlike the chromosomal DNA, are able to renature because of the topological constraints that limit unwinding. The ability of DNA molecules to renature after base-induced unwinding is dependent on the pH attained, and for this reason, the alkaline solutions employed in the methods presented here are accurately buffered, rather than obtained by adding unbuffered hydroxide-based solutions. Furthermore, precipitation of the denatured chromosomal DNA is encouraged by increasing ionic strength and by inducing the consequent coprecipitation of detergent. In addition, intercalating agents such as ethidium bromide can be used to change the density of the DNA. The less supercoiled a DNA molecule, the greater the amount of ethidium bromide that can intercalate. Thus, highly supercoiled molecules can be separated from less supercoiled DNA by equilibrium centrifugation in cesium chloride density gradients. The main method of cell lysis and plasmid DNA extraction presented here is a modified version of the protocol of Portnoy et al. (15). Extra care is taken in the preparation of the alkaline denaturing solution (8) and the plasmid is precipitated from the neutralized, cleared lysate with polyethylene glycol (16). It gives good yields of intact plasmid of at
Preparation
of Bacterial
Plasmid
DNA
215
least 148 kb (98 MDa) from E. coli, Pseudomonas aeruginosa, and Legionella sp. The plasmid DNA from these lysates is viewed on an agarose gel before further purification by equilibrium density gradient centrifugation. This method is reported to work well for plasmids of up to 530 kb (350 MDa) from Agrobacterium tumefaciens, Klebsiella sp., Salmonella typhi, Staphylococcus sp., Streptococcus sp., Yersinia enterocolitica, marine Vibrio sp., and other halophiles (17). An alternative method, slightly modified from that of Kado and Liu
(18), is also described. It is simpler and less tedious for screening multiple isolates but often yields nicked and partially degraded plasmid DNA. 2. Materials Many of the chemicals used are toxic and/or corrosive and should be used with appropriate precautions (see Note 1). 2.1. Main Method 1. Tris-acetate buffer (50X concentrate): 2M Trrs base, 10 n&I EDTA 5% (v/v) glacial acetic actd; pH adjusted to 8.0 with acetic acid. Aliquot and sterilize by autoclaving. 2. Tris-EDTA (TE) solution (10X concentrate): 100 miI4 Tns-HCl, pH 8.0, 10 mM EDTA. Ahquot and sterilize by autoclaving. 3. EDTA: OSM in drsttlled water, pH 8.0. Maintain the mixture at approxrmately pH 8.0 using NaOH, or the EDTA will not dissolve. Aliquot and sterilize by autoclaving. 4. Tris-HCl, pH 7.0: 2M m distilled water. Aliquot and sterilize by autoclaving. 5. Sodium chloride: 5M in distilled water. Aliquot and sterilize by autoclaving. 6. Sucrose: 60% (w/v) m distilled water. Aliquot and sterilize by autoclaving. 7. Phenol: Either buy molecular biology grade buffered (pH 8.0) phenol or equilibrate high quality phenol (19): Combine 100 g phenol, 44 mL of 1M Tris-HCl pH 8.0, 5.5 mL of water, 5.5 mL of m-cresol, 0.2 mL of 2mercaptoethanol, and 0.11 g of 8-hydroxyquinoline. Mix well and allow it to settle ovemrght. Store in a light-proof container at 4OC. 8. Lysozyme: 20 mg/mL in ice-cold 10 mM EDTA pH 8.0. Prepare unmediately before use. 9. Proteinase K: Store desiccated as a powder at 4°C. 10. Ribonuclease A: 10 mg/mL m stenle distilled water, heat at 95°C for 10 min to inactivate other contaminating activities such as DNAse. Store in small aliquots at -2OOC. These aliquots can be refrozen and re-stored several times without loss of activity.
216
Tully
11. Ribonuclease T1: I strongly prefer the solution in ammonium sulfate supplied by USB. Store at 4°C. Prior to use, dilute microliter amounts to 50,000 u/mL. 12. Ethidium bromide: 10 mg/mL in distilled water. Store at 4°C in the dark. Ethidium bromide is mutagenic, so take great care when handling such solutions. Inactivate ethidium bromide solutions before discarding them (3). 13. Sodium dodecyl sulfate (SDS): 10% (w/v) in distilled water. Sterilize by filtration (0.45pm membrane filter) and store at room temperature. 14. Polyethylene glycol6000 (PEG 6000): 50% (w/v) in distilled water. Allow the bubbles to rise and filter the solution through a 0.45~ym membrane filter. Divide the solution into 20-mL aliquots and store at -2OOC. 15. Sodium acetate: 3M in distilled water, adlust the pH to 5.2 with glacial acettc acid. Aliquot, sterilize by autoclaving, and store at room temperature. 16. Loading buffer (5X concentrate): 20% (w/v) Ficoll, 0.3% (w/v) Bromophenol blue. Aliquot and store at -2OOC. 17. Tris-acetate-sucrose: 30% sucrose in 1X Tris-acetate buffer. Prepare aseptically from sterile stock solutions and sterile distilled water. 18. Lysis buffer: 4% (w/v) SDS in 50 mM Tris, 10 mM EDTA, pH 12.45. Prepare fresh each day from sterile stock solutions. Warm the mixture to 37°C and measure the pH. If necessary, adjust the pH to 12.45 by the careful addition of microliter amounts of 10MNaOH. Keep the solution warm and mix well between additions, so that the SDS does not precipitate. 19. Cesium chloride (CsCl): molecular biology grade solid. 20. Iso-butanol saturated with CsCl solution: Mix iso-butanol with a small volume distilled water and add solid CsCl until no further crystals dissolve. Store at room temperature. 21. Ethanol: 100%. 22. Bacterial strains: Several sets of strains carrying plasmids of defined size are available from the Plasmid Reference Laboratory (London, UK); or from the Plasmid Reference Center (Stanford University, Stanford, CA). Strain E. coli 39R861 (NCTC 50192) is espectally useful as it carries four plasmids of apparent molecular weights 148, 63.6, 36.2, and 6.96 kb (98, 42,23.9, and 4.6 MDa) (20). A useful product for sizing smaller plasmids is a supercoiled ladder DNA standard (Gibco-BRL [Gaithersburg, MD] product 520-5621SA), which contains plasmid DNA of defined sizesfrom 2-16 kb (1.32 and 10.6 MDa). 23. pH Meter and electrode: It 1sessential to use a pH meter with digital or narrow-range analog display connected to a temperature-compensation probe and a semimicro electrode that responds to Tris accurately and that survives prolonged use at pH 12.5 or above. Always calibrate the pH meter with standards at pH 7, pH 10, and finally, pH 12.45 (9).
Preparation
of Bacterial
Plasmid
DNA
217
24. A microfuge that 1s capable of 13,000g with capacity for 2 mL screwcapped microfuge tubes. 25. Flat bed submerged electrophoresis equipment with ports for recirculation of buffer. 26. Pastets or other make of disposable Pasteur plpet with a fine tip are particularly useful for removmg supernatants. Glass Pasteur pipets are not adequate and will require the additional use of glass capillary tubing to remove the last drops of supernatant. 2.2. Kado
and Liu Method
1. Lysis buffer: 0.6 g Tris base, 3.0 g SDS in 90 mL sterile distilled water. Adjust the pH to 12.6 with approx 1.6 mL of 2h4 sodium hydroxide solution. Prepare fresh each day. 2. Unbuffered phenol/chloroform: Molecular biology grade phenol mixed with an equal volume of chloroform. 3. Methods 3.1. Plasmid
Extraction-Main
Method
1. Harvest about 2 mL of saturated broth culture. 2, Resuspend the bacterial cell pellet in 30 pL of Tris-acetate-sucrose and leave at room temperature for 5 min. 3. Add 10 pL of lysozyme (20 mg/mL), vortex thoroughly, and leave on ice for 30 min. 4. Add 0.6 mL of lysls buffer to a sterile 2-mL screwcapped centrifuge tube, add the cell suspension using a fine-tip Pastet, and mix by sucking up and down two or three times. Invert the tube several times to complete the mixing. 5. Incubate the tubes in a 40°C water bath for 20 mm. 6. Add 30 /& of 2M Tris-HCl pH 7.0 containing 500 pg/mL ribonuclease A and 500 U/mL ribonuclease T1, cap the tubes, and mix by gentle inversion (see Note 2). 7. The viscosity of the mixture will change; at this point, add 170 pL of 5M NaCl and gently invert the tubes several times to mix (see Note 3). 8. Leave the tubes at room temperature for 30 min, followed by incubation on ice for at least 4 h. 9. Centrifuge the tubes at 13,000g at 4OC. 10. Carefully pour off the supernatant into a conical 1.5 mL screwcap tube. Do not try to obtain all the supernatant by using a pipet. If any cell debris is carried over, recentrifuge the tubes and transfer the supernatant to another fresh tube to ensure that the lysate is thoroughly cleared.
218
Tully
11. Estimate the volume and add 114volume of sterile 50% PEG solution. Mix well by inverslon, and store the tubes on ice overnight. 12. Centrifuge the tubes at 13,000g for 15 min, with the tube labels facing the outside of the rotor. 13. Pour off as much of the viscous supernatant as you easily can and spin again for 3 mm. 14. Use a Pastet to remove the remainder of the supernatant; take care not to remove the pellet. 15. Dissolve the plasmid m 30 pL of 1X Tris-acetate buffer; keep the tubes on ice for several hours with occasional gentle shakmg of the tube to ensure that the pellet has completely dissolved. 16. Run -10 pL of this preparation on an agarose gel. 3.2. Plasmid Extraction-Kado and Liu Method For more rapid screening, or in some cases where the main method does not give good results, the following slight modification of the Kado and Liu (18) method is worth trying and replaces steps 1-15 of the main method. 1. Harvest log phase, broth-cultured cells to give 50 @ wet volume. Determine, by experiment, the amount of culture required for this. 2. Resuspend the bacterial pellet in 250 p.L of 1X Tris-acetate buffer and transfer it to a 2 mL screwcap centrifuge tube. 3. Add 500 pL of Kado and Liu lysls buffer to the bacterial suspension and mix carefully by inversion. 4. Heat the tube at 50-65OC (optimized by experiment) for 20 min in a water bath and cool to room temperature. 5. Add 1 mL of phenol-chloroform mixture and mix by repeated inversion (see Note 3). 6. Centrifuge the tubes at 13,OOOgfor 3 min and collect the supematant. 7. Mix 20-50 pL of supematant with 10-20 pL of loading buffer for gel electrophoresis. A 2-mm thick comb IS required for these volumes. 3.3. Electrophoresis
Appropriate gels for analysis of theseplasmids are 3-4 mm thick horizontal 0.7% agarosegels, containing 1X Tris-acetate buffer and 0.5 pg/mL of ethidium bromide. This technique is not suitable for the sizing of plasmids (seeNote 4). 1. Suspend an appropriate quantity of agarose m dlstllled water and leave to stand for 5 mm at room temperature.
Preparation
of Bacterial
Plasmid
DNA
219
2. Dissolve the agarose by boiling for 10-20 min (a microwave is particularly useful for this). Mix the solution thoroughly. 3. Allow the gel to cool for 5-10 min at room temperature and equilibrate to 50°C in a water bath. 4. Add Tris-acetate and ethidmm bromide stock concentrates to 1X and 0.5 pg/rnL final concentrations, respectively, and mix well. 5. Prepare a gel mold by taping the edges and pour in the agarose solution. Insert a comb with the appropriate number of wells for the samples to be analyzed, and allow the gel to set. 6. Mix the DNA samples with l/5 vol of loading buffer and load the plasmids, one to each well. 7. Electrophorese the gel at 25 V for 30 min and then at 80 V for 2-4 h.
1.
2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14.
3.4. Purification by Equilibrium Density Gradient Centrifigation To the supernatant obtained at step 15 of a scaled up Modified Portnoy technique or from step 6 of the Kado and Liu method (see Note 5), add l/9 volume of 5M NaCl and l/4 volume of 50% PEG solution. Mix well by inversion and store on ice at 4OCovernight. Collect the precipitate by centrifugation at 10,OOOgfor 15 min at 4°C and meticulously remove all of the supernatant. Dissolve the precipitate in a minimal volume of 1X TE and transfer the DNA solution to a sterile Oak Ridge type centrifuge tube. Several (up to 6) replicate preparations can also be pooled at this stage (see Note 5). Accurately adjust the volume to 10 mL with 1X TE. Add exactly 10 g CsCl to each lo-mL vol and invert the tube gently several times to dissolve the salt. Add 0.8 mL of 10 mg/mL ethidium bromide solution and mix. Centrifuge the tubes at room temperature at 15,000g for 10 min. Transfer the deep red clear liquid into an ultracentrifuge tube (16 x 76 mm), using a long Pasteur pipet fitted into a Pi-pump or similar. Avoid transferring any of the debris floating on the surface. Balance the tubes to within 0.1 g, using water or CsCl solution (10 g of CsCl to 10 mL of water). Seal the tubes carefully and place them, balanced, in the appropriate (vertical or angled) rotor of an ultracentrifuge. Centrifuge the samples at 100,OOOgat 16-18°C for 48-72 h. Carefully remove the tubes from the rotor; avoid disturbing the gradient. Illuminate the tubes with UV light at 310 or 366 nm. Two bands of red material should be visible; the lower band is plasmid DNA. Clamp the tube and pierce the top to permit the entry of air.
220
Tully
15. Harvest the plasmid DNA using a 2-mL syringe and 19-g needle: Puncture the tube just below the level of the plasmid band, and draw out the solution that contains this material. 16. Transfer the plasmid-containing liquid into a long thin tube (Nunc 3-63452 is ideal), addan equal volume of CsCl-saturatediso-butanol, and mix thoroughly. 17. Separate the phasesby centrifugatton; the ethidmm bromide partitions into the organic phase. 18. Remove and safely dispose of the orgamc upper phase. 19. Repeat the orgamc extraction several times to ensure complete removal of the ethidium bromide (three or four extractions usually suffice). 20. Dilute the final aqueous material with 3 vol of 1X TE! and 10 vol of cold 98-100% ethanol m a sterile centrifuge tube of appropriate size. Store overnight at -20°C. 21. Recover the DNA by centrifugation at 15,OOOgfor 15 min at 4°C. 22. Wash the pellet once with ethanol and allow it to dry. 23. Redissolve the DNA in a mimmal volume of 1X TE. Ribonuclease removal may be necessary at this stage (see Note 2). 3.5, Estimation of the Plasmid DNA Concentration Estimate the concentration of the plasmid DNA by dilution series and comparison with DNA dilutions of known concentrations. 1. Serially dilute the test DNA in 1X TE buffer. 2. Spot 5 or 10 pL of each dilution onto a Petri plate of 1% agarose in 1X TE buffer containing 5 pg/mL ethidium bromide; include a series of dilutions of plasmid DNA of known concentration. 3. Allow the drops to dry and place the plate on a 310 or 366 nm wavelength transilluminator. 4. Compare the fluorescence of the spots visually or after photography. 4. Notes 1. Throughout these protocols, corrosive and toxic chemicals are used and due care is required. The use of screwcapped containers and centrifuge tubes throughout is advised. In scaling up the mam method, however, decanting of supernatant at stage 13 of the main extraction method is often easier from tubes lacking any constriction at the neck. When handling phenol-containing solutions or waste, wear two pairs of surgical gloves: Skin contact with phenol, especially when mixed with alkaline solutions, should be treated immediately by washing the area with cold running water and seeking medical advice. 2. The use of ribonuclease is sometimes avoided in plasmid isolation techniques (2) because of the subsequent difficulty of its removal. Its use is
Preparation
of Bacterial
Plasmid
DNA
221
essential for isolating plasmids from Legionella by the cleared lysate method (unpublished observations; 21), and aids the detection of small plasmids during electrophoresis by reducing background. If the plasmid is to be used later in a procedure in which any trace of ribonuclease is likely to be detrimental, then add SDS to 0.1% and proteinase K to 50 pg/mL. Incubate at 45OC for 1 h. Transfer the solution to a 2-mL Sarstedt tube, extract once with an equal amount of buffered phenol and once with chloroform. Precipitate the DNA using 0.1 vol of 3M sodium acetate and 2 vol of ethanol. After overnight storage at -20°C, recover the plasmid by centrifugation at 13,000 rev/min for 15 min, wash once with ethanol, dry, and redissolve in 1X TE buffer. 3. The avoidance of shearing the large plasmid molecules is important throughout these procedures. With the exception of step 4 of the clearedlysate method, transfer all plasmid-containing solutions by decanting or, for smaller volumes, use Gilson (Paris, France) or similar pipets fitted with large-bore tips (Alpha Laboratories [Eastleigh, Hants, UK] “Cell-saver tips” LW 1018). Loading of samples into wells in electrophoresis gels is most easily accomplished using 50-pL micropipets and a micropipet filler (Fisons catalog no PMR-400-E or Clay-Adams no. 4555). 4. The electrophoresis protocol is optimized to allow the detection of plasmids. Though migration of plasmids in these conditions is size-dependent, calibration of the gels to permit accurate sizing is not adequate. For Legionella plasmids of 45-150 kb (30-100 MDa) to obtain linear plots of log migration/log MW, use 0.4% agarose gels (very fragile!) without ethidium bromide. Stain the DNA for 45 min at room temperature by immersing the gel in 1X TE buffer containing 0.5 pg/mL ethidmm bromide. Wash the gel several times in 1 mM EDTA to reduce background. The background is more homogeneous, however, and photographs are clearer when the agarose gel contains ethidium bromide. The interpretation of multiple plasmid bands is dealt with in refs. 22 and 23. 5. These small-scale methods can be scaled-up at least lo-fold, but in both protocols the ratio of microbial cells to lysis reagents must be kept to those indicated, otherwise the precipitation of chromosomal DNA is incomplete and cell extracts become unmanageably viscous. Concentration of plasmid DNA can always be accomplished at a later stage by precipitation with alcohol or PEG. Provided that there is not too much residual chromosomal DNA, it is difficult to overload cesium chloride gradients.
References 1 Davis, L. G., Dibner, M. D., andBattey,J. E. (1986) Basic Methods in Molecular Biology. Elsevier, New York. 2. Perbal,B. (1988)A Practical Guide to Molecular Clomng. 2nded.Wiley, New York.
Tully
222
3. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning-A Luboratory Manual. 2nd ed. Cold Spring Harbor, NY. 4. Fry, N. K., Warwick, S., Saunders, N. A , and Embley, T M. (1991) The use of 16s ribosomal RNA analyses to investigate the phylogeny of the family Legionellaceae. J. Gen. Microbial 137, 1215-1212. 5. Brenner, D. J., Steigerwalt, A. G., Weaver, R. E., McDade, J. E., Feeley, J. C, and Mandel, M. (1978) Classification of the Legionnaires’ disease bacterium: an interim report. Curr. Microbial. 1,71-75. 6 Amano, K. and Williams, J. D. (1982) Peptidoglycan of Legionella pneumophila: apparent resistance to lysozyme hydrolysis correlates with a high degree of peptide cross-linking. J. Bacterial. 153, 520-526. 7. Crawford, J. T. and Falkinham, J. 0. (1990) Plasmids of the Mycobacterium avium complex, in Molecular Biology of the Mycobacteria (McFadden, J. J , ed ), Surrey University Press, London, pp. 97-l 19. 8 Casse, F., Boucher, C., Julliot, J. S., Mrchel, M., and DCnarie, J. (1979) Identification and characterization of large plasmids in Rhizobium meliloti using agarose gel electrophoresis. J. Gen. Microbial. 113, 219-242. 9. Hogrefe, C. and Friedrich, B. (1984) Isolation and characterization of megaplasmid DNA from lithoautotrophic bacteria. Plasmid 12, 161-169 10. Hirochika, H., Nakamura, K., and Sakaguchi, K. (1984) A linear DNA plasmid from Streptomyces rochei with an inverted terminal repetition of 614 base parrs EMBO J. 3,761-766.
11. Kinashi, H., Shlmaj, M., and Sakar, S. (1987) Giant lmear plasmids m Streptomyces which code for antibiotic biosynthesis genes. Nature 328,454-456. 12. Barbour, A. G. (1988) Plasmid analysis of Borrelia burgdorjki, the Lyme disease agent. J. Clin. Microbial. 26,475-478. 13. Gowland, P. C. and Hardman, D. J (1986) Methods for isolating large bacterial plasmids. Microbial. Sci. 3,252-254. 14. Grinsted, J. and Bennet, P. M (1988) Plasmid Technology, 2nd ed., Academic, London. 15. Portnoy, D. A., Moseley, S. L., and Falkow, S. (1981) Characterization of plasmids and plasmid-associated determinants of Yersinia enterocolitica pathogenesis. Infect. Immunol. 31, 775-782.
16 Humphreys, G O., Willshaw, G. A, and Anderson, E. S. (1975) A simple method for the preparation of large quantities of plasmid DNA. Biochim Biophys. Acta 383,457-463.
17. Crosa, J. H. and Falkow, S. (1993) Plasmids, m Manual of Methods for General Microbiology (Gerhardt, P , Murray, R. G E., Wood, W A., and Krieg, N. R., eds.), American Society for Microbiology, Washington, DC, pp. 266-282. 18. Kado, C. I. and Liu, S. T. (1981) Rapid procedure for detection and isolation of large and small plasmids J Bacterial 145, 1365-1373 19. Crouse, G. F., Frischauf, A.-M., and Lehrach, H. (1983) An integrated and simplified approach to cloning into plasmids and single stranded phages. Methods Enzymol. 101,78-89
Preparation
of Bacterial
Plasmid
DNA
223
20. Threlfall, E. J , Rowe, B., Ferguson, J. L., and Ward, L. R (1986) Characterizatron of plasmids conferring resistance to gentamicin in strains of SaZmonella typhimurium phage type 204~ isolated in Britain. J. Hyg. (Camb) 97,419-426. 21 Johnson, S. R. and Schalla, W. 0 (1982) Plasmrds of serogroup 1 strains of Legionella pneumophila Curr. Microbial 7, 143-146 22. Kieser, P. (1984) Factors affecting the isolation of CCC DNA from Streptomyces lividans and Escherichia coli. Plasmid 12, 19-36. 23. Waterhouse, K. V., Swain, A., and Venables, W. A. (1991) Physical characterization of plasmids m a morpholine-degrading mycobactermm. FEMS Microblol. Lett. 80,305-3 10.
CHAPTER20
Plasmid Profile Typing and Plasmid Fingerprinting E. John
Threlfall
and Neil
Woodford
1. Introduction Plasmids are extra-chromosomal molecules of deoxyribonucleic acid (DNA) capable of autonomous replication. Such molecules have been identified in many bacterial genera and usually exist as covalently closed circular (CCC) molecules. Plasmids range in size from less than one megaDalton (MDa) to several hundred MDa. One megaDalton of doublestranded DNA is equivalent to 1500 bp or 1.5 kilobases (kb, see Note 1). Many plasmids code for properties such as resistance to antimicrobial drugs or heavy metals, or for the production of toxins or siderophores, which directly or indirectly enhance the virulence of their host strains for humans or animals; other plasmids have no obvious phenotypic properties and are regarded as “cryptic.” Although the former “virulence-associated” plasmids have been of particular importance to medical microbiologists, in recent years the importance of bacterial plasmids in molecular epidemiology has become increasingly recognized. In particular, the identification of plasmids in bacterial strains by agarose gel electrophoresis in terms of their numbers and molecular weight has provided invaluable information that has been used on numerous occasions to supplement the traditional forms of bacterial typing, such as serotyping and phage typing. For example, in Salmonella plasmid profile typing has been successfully used on a national level for the differentiation of S. muenchen (1) and on an international level for the differentiation of S. gold-coast (2) and From Methods In Molecular Bfology, Vol 46. Dlagnosbc Bacteriology Protocols Edlted by J Howard and D M. Whltcombe Humana Press Inc , Totowa, NJ
225
Threlfall
and Woodford
S. bertu (3,4j. The technique has also been used for the subdivision of some phage types of S. typhimurium (5) and S. enteritidis (6,7). The principles of agarose gel electrophoresis are based on the fact that DNA is negatively charged and therefore migrates to a positive pole in an electric field. An agarose gel acts as a molecular sieve and, under the influence of an electric field, DNA molecules migrate through the gel matrix at a rate proportional to their molecular weight. Although in most bacterial cells plasmid DNA is present in the form of CCC molecules, introduction of a single nick into either of the two strands can result in the formation of open-circular (OC) molecules in which the circular form is maintained only by the single closed strand. If both strands are nicked, the circular form is lost completely and the plasmid opens into its linear (L) form. It is possible that all three structural forms of plasmid DNA may be present in one cell. Although this does not affect charge, it does affect the molecular sieving when plasmids are analyzed by agarose gel electrophoresis, as each form migrates at different rates. In general, CC DNA travels at a faster rate and therefore further than OC. Likewise, OC DNA travels at a faster rate than linear. A single plasmid can therefore theoretically appear as three separate bands on a gel. The two methods described herein, which have been specifically adapted for the screening of large numbers of strains for plasmid DNA for epidemiological typing, minimize the formation of OC and linear DNA, although the possibility of such forms being present must always be taken into account. The first protocol described is based on the alkaline lysis method (8). This method is based on the resistance of CCC plasmid DNA to high pH, whereas chromosomal DNA is not covalently closed and is sheared into linear fragments during the extraction process. Following denaturation at high pH and rapid neutralization with sodium or potassium acetate, chromosomal DNA is precipitated leaving the CCC plasmid DNA in solution. Plasmid DNA can then be precipitated by the addition of alcohol. Although used mainly for Gram-negative bacteria, the method can be modified for extracting plasmid DNA from Gram-positive organisms. These modifications are to digest the cell wall peptidoglycan by incubation with either lysozyme or lysostaphin plus lysozyme. For plasmid fingerprinting, ribonuclease (RNase) and protease are used to purify plasmid DNA preparations by digesting RNA and protein, respectively. The main disadvantage of this method is that there is almost invariably some
Plasmid
Fingerprinting
227
“carryover” of chromosomal DNA that, if in excess, can mask plasmids of approximately 8 MDa and may also adversely affect subsequent restriction enzyme fingerprinting procedures. The second method, based on that described by Kado and Liu (9), is probably that which is now most widely used and is particularly applicable to Gram-negative bacteria. This method combines high pH with incubation at an elevated temperature (55”C), which has the effect of reducing the level of chromosomal DNA in the final preparation. In this method, contaminating residual proteins are removed from solution by extraction with a mixture of phenolchloroform-isoamyl alcohol. Like the alkaline lysis method, the method of Kado and Liu can be adapted for the extraction of plasmids from Gram-positive organisms. After extraction, the plasmid DNA is separated by agarose gel electrophoresis and visualized under ultraviolet (UV) illumination after staining with ethidium bromide. Although plasmids may be of the same or similar molecular weight, this does not necessarily mean that they are identical, or even related. Plasmid fingerprinting provides a method for the molecular comparison of plasmids of similar molecular weight and may also be used for identifying areas of similarity in plasmids of different molecular weights. The method is dependent on the ability of specific restriction endonucleases (restriction enzymes) to cut both strands of plasmid DNA molecules at specific palindromic sites (usually four to six nucleotides in length), thereby converting CCC plasmid DNA to a number of fragments of linear DNA. The number of linear fragments produced will depend on the number of target sites in a particular plasmid for a particular restriction endonuclease. The actual frequency with which a particular enzyme cuts a given piece of DNA is influenced by a number of factors that include the percentage of G + C bases in the DNA to be cut and in the target sequence for the enzyme. In practice, for meaningful results and for ease of analysis, it is desirable to digest plasmids with enzymes that produce 5-10 linear fragments. However, as the digest pattern or “fingerprint” that will be obtained for a particular plasmid is often unknown, enzymes are chosen for use either on an empirical basis or on the basis of a particular strategy (10). This strategy has been applied, for example, to the molecular comparison of serotype-specific plasmids from several SuZmoneZZaserotypes including S. typhimurium, S. enteritidis, and S. dublin (ll), and also to the characterization of plasmids of different molecular weights
Threlfall
and Woodford
from a range of S. enteritidis phage types (12). Although providing a detailed molecular fingerprint of plasmid DNA, in practice, plasmid fingerprinting is time consuming and, in strains with several plasmids, the results can be extremely difficult if not impossible to interpret. Because of this, for epidemiological investigations, the technique is recommended more for the characterization and comparison of only a small number of strains than for routine use. The two methods described for plasmid profile typing often leave traces of reagents, such as sodium dodecyl sulfate (SDS) or phenolchloroform and unwanted cellular constituents, such as proteins, RNA, or cell wall debris that can adversely affect the action of restriction endonucleases. However, with some relatively minor modifications aimed at enhancing the purity of the plasmid DNA preparation, the methods can be adapted easily to provide suitably pure CCC plasmid DNA for digestion with restriction endonucleases. The alkaline lysis method can be adapted to allow extraction of plasmids from a wide variety of Gram-negative bacterial species,including Acinetobacter, Aeromonas, Enterobacter, Escherichia coli, Klebsiella, Proteus, Providencia, Pseudomonas, Salmonella, Serratia, Shigella, Vibrio cholerae, and Yersinia. In addition, the method can be readily adapted to extract plasmids from Enterococcus spp. and some other Gram-positive organisms, including Staphylococcus aureus, coagulasenegative staphylococci, Bacillus cereus, and Listeria monocytogenes.
When adapting the method for specific microorganisms, it is the initial stage that is altered generally. In particular, the concentration of lysozyme may need to be increased (e.g., for L. monocytogenes) and lysostaphin may also need to be added (e.g., for coagulase-negative staphylococci). The incubation time may also have to be extended to ensure adequate lysis of the organisms following the addition of alkaline SDS. The method of Kado and Liu is used extensively for the extraction of plasmids from members of the Enterobacteriaceae. It has also been used for other Gram-negative bacteria including Pseudomonas spp., and for L. monocytogenes. As with the alkaline lysis method just described, the method of Kado and Liu can be adapted for the extraction of plasmids from staphylococci by the addition of lysozyme (S. aureus) or lysozyme plus lysostaphin (coagulase-negative staphylococci) to the lysis buffer.
Plasmid
229
Fingerprinting
2. Materials 1. 2. 3. 4. 5. 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16.
2.1. Major Equipment Microcentrifuge, preferably with interchangeable heads for centrifuging 12 or 14 microcentrifuge tubes and capable of centrifuging at 6500 and 13,000 rpm. Horizontal electrophoresis tanks with appropriate gel trays and combs. A reliable power supply UV transilluminator. Blender. 2.2. Consumables 1.5~mL Microcentrifuge tubes (see Note 2). Tips for micropipets. Autoclave and dry before use. Agarose (Sigma [St. Louis, MO] Type II Medium EEO is a good choice for general use). Solution I for Gram-negatives: 25 mM Tris pH 8.0,50 rnA4glucose, 1 mM EDTA, containing 5 mg/mL lysozyme. Solution I for Enterococci and other Gram-positives: 10 mM Tris-HCl, pH 8.0, 1 mM EDTA, containing 25% (w/v) sucrose and 10 mg/mL lysozyme (see Note 3). Lysozyme: Store powder at -2O”C, add to buffers shortly before use. Solution II: 200 mM NaOH, 1% (w/v) SDS. Dilute freshly from 2M NaOH and 10% SDS stocks. Solution III (5iW3M potassium acetate, pH 4.8): Dissolve 29.44 g of potassium acetate m 60 mL distilled water; add 11.5 mL of glacial acetic acid and adjust the final volume to 100 mL with distilled water. Solution IV: 50 mil4 Tris-HCl, pH 8.0,O. 1% (w/v) sodium acetate. Ribonuclease (RNase): 1 mg/mL in distilled water. Heat at 80°C for 10 min to destroy any contaminating DNase activity. Restriction endonucleases: Store at -20°C. Restriction endonuclease buffer: Usually supplied by the enzyme manufacturer. Store at -20°C. Recipes for the buffers are always available from the enzyme supplier. Phenol/chloroform/uoamyl alcohol: 50 g of phenol crystals, 48 mL of chloroform, 2 mL of isoamyl alcohol, 10 mL TE (10 mM Tris-HCl, 1 mM EDTA, pH 8.0). Store at 4°C in a dark bottle. Shake before use, TE Buffer: 10 mM Tris-HCl, 1 mM EDTA pH 8.0. Loading buffer: 0.05% (w/v) bromophenol blue in 60% (w/v) sucrose. Proteinase K: 1 mg/mL; store m aliquots at -20°C.
Threlfall
and Woodford
17. Kado and Lm suspending buffer: 50 mZt4Tris-HCl, 1 mM EDTA, pH 8.0. Store at room temperature. 18. Kado and Liu lysis buffer: 3% (w/v) SDS, 50 mMTris, pH 12.45. Store at room temperature. 19. Ammonium acetate: 7.5M in distilled water. 20. Electrophoresis buffer (TBE; 5X concentration): 54 g/L Tris base, 27.5 g/L boric acid, 20 mL of 0.5M EDTA (pH 8.0). 21. Ethidium bromide: 5 mg/mL stock, store in a foil-wrapped bottle at room temperature. Dilute to 1 mg/mL for staining gels. Caution: Take great care when handling ethidium bromide since it is a powerful mutagen. Always wear gloves and inactivate ethidium bromide solutions before disposal (13). 22. Molecular weight markers: For restriction digested plasmids, linear markers such as bacteriophage lambda DNA cut with HindIII, PstI, or EcoRI should be used. These can be purchased commercially or prepared “in house” using the digestion methods described. In addition, there are other commercially available standards, such as a kilobase ladder in which each successive band is 1 kb larger than the previous one. For undigested plasmids, it is essential to use similar plasmids because circular DNA migrates differently from linear DNA of the same molecular weight. Two widely used strains of E. coli harboring a variety of plasmids are: strain 39R861, NCTC accession no. 50192 (14) and strain V517, NCTC accession no. 50193 (15). Strain 39R861 (E. coli K12 Flat+ nalidixic acid-resistant) carries plasmids of 98,42,23.9, and 4.6 MDa (approx 147, 63,36, and 6.9 kb); V5 17 carries plasmids ranging from 1.4 to 36 MDa. 3. Methods 3.1. Preparation of Partially Purified Plasmid DNA by Alkaline Lysis 1. Grow organisms in 2.5 mL Nutrient Broth (NB) for 18 h (overnight) at 37OC(28°C for Yersinia) with gentle aeration. Alternatively, grow organisms overnight on blood or nutrient agar plates. MacConkey plates are not suitable because plasmid yield is greatly reduced. 2. Transfer approx 0.75 mL of culture to a sterile 1.5-r& microcentrifuge tube and centrifuge at 10,600g (13,000 rpm) for 2 mm. For solid-grown bacteria, harvest a small amount of bacteria (“rice-grain”-sized pellet) directly into Solution I and resuspend. 3. Discard the supematant, ensuring that the pellet is as free from the growth medium as is possible. 4. Resuspend the pellet m 100 pL of Solution I appropriate for organisms being studied (see Note 3).
Plasmid
Fingerprinting
231
5. Incubate as appropriate: For Gram-negative organisms, 0°C for 30 min; for enterococci and other Gram-positive organisms (mcludmg S. aureus and coagulase-negative staphylococci), 37OC for 35 mm. 6. Add 200 l,tL of Solution II. Mix by gentle inversion until the cells lyse. The solution should become clear. 7. Add 150 p,L of ice-cold Solution III. Mix by gentle inversion (see Note 4). The chromosomal DNA forms a white, msoluble clot. 8. Centrifuge at 10,600g (13,000 rpm) for 5 mm and transfer the clear supernatant (approx 400 PL) to a fresh microcentrtfuge tube (see Note 5). Discard the pellet. 9. Add 1 mL of ice-cold 95% (w/v) ethanol and mix by gentle inversion, 10. Chill the suspension at -2OOC for at least 30 min. 11. Centrifuge at 10,600g (13,000 rpm) for 2 min; remove the supernatant with a pipet and discard. 12. Dissolve the precipitate m 100 yL of Solution IV. 13. Add 2 vol (200 p.L) of ice-cold 95% (w/v) ethanol. Chill at -20°C for 15 min. 14. Centrifuge at 10,600g (13,000 r-pm)for 2 mm; remove the supernatant with a pipet tip and discard. 15. Dissolve the precipitate in 50 PL of TE buffer. 16. Add 10 FL of loadmg buffer (see Section 2.2.). Load 2O+L aliquots onto 0.7% (w/v) agarose gels. For subsequent restriction digestion: 1. After step 11, repeat steps 9, 10, and 11. 2. Dissolve the precipitate m 39 l.tL of sterile distilled water and 1 ~J.Lof ribonuclease (RNase, 1 mg/mL). For Gram-positive organisms, also add 1 ltL of proteinase K solution (1 mg/mL). 3. Incubate at 37°C for 15 mm before beginning the restriction fingerprinting protocol or before storing DNA at -2OOC. 3.2. Preparation of Partially Purified Plasmid DNA by the Method of Kado and Liu 1. Grow and harvest the bacteria as in Section 3.1. 2. Resuspend the pellets in 20 l.tL of suspension buffer. 3. Add 100 l,tL of lysis buffer. Mix by brief agitation. 4. Incubate at 55°C for 30-60 min (30 mm for SulmoneZlu spp. and E. c&i, 60 min for Gram-positive organisms). 5. Add 100 pL of phenol-chloroform-isoamyl alcohol. Emulsify by shaking briefly.
Threlfall
and Woodford
6. Separate the phases by centrifugation (5-15 min m microcentrifuge at maximum speed). 7. Remove upper aqueous phase (35-90 pL) to a fresh microcentrifuge tube. If the aqueous phase is not clear, recentrifuge the rmxture. 8. Add 10 pL of loading buffer and load 30-35 pL onto a 0.7% (w/v) agarose gel. For restriction enzyme fingerprinting: 1. After step 6 , add 0.5 vol of 7.5M ammonium acetate (NH4Ac) and 3 vol 95% (w/v) ethanol. 2. Incubate for at least 30 min at -2O”C, or for 18 h at 4°C. 3. Centrifuge at 10,600g (13,000 rpm) for 6 min and discard the supernatant. 4. Dry and dissolve the precipitate in 39 p,L of sterile distilled water and 1 /JL of RNase
( 1 mg/mL).
5. Incubate at 37°C for 15 mm before mttiating restriction fingerprinting protocol or before storing at -20°C for subsequent analysis.
1. 2. 3. 4.
5. 6.
3.3. Examination of PZasmid DNA by Agarose Gel EZectrophoresis Tape the ends of a gel tray appropriate for the electrophoresis tank and number of samples (typically 15 cm wide x 10 cm long). Prepare a 0.7% agarose suspension m 0.5X TBE, boil the mixture m a microwave until the agarose has dissolved, and allow the solution to cool to 55°C. Pour the gel into the tray, position the well-forming comb, and allow the gel to set at room temperature. Load the samples containing dye and electrophorese, typically at 100 V, until the blue dye has migrated about 80-90% of the gel length. Always load at least one marker lane in each gel. For uncut plasmids, use plasmids prepared from the marker strains by the same method as those under investigation. Stain the gel for 30 min in distilled water containing ethidium bromide at 1 l.tg/rnL. Destam 111distilled water for 10 mm and photograph under UV-illumination.
3.4. Estimation of PZasmid Sizes 1. Measure the distances migrated by the test plasmids and the marker plasmids. 2. Plot a calibration curve of “log MDa vs distance traveled” (or “log kb vs distance traveled”). 3. Use this curve to estimate the sizes of the test plasmids.
Plasmid
233
Fingerprinting 3.5. Plasmid
Fingerprinting
1. In a fresh sterile reaction tube, mix 3 FL of the appropriate 10X restriction buffer, 25 pL of plasmid DNA, and 2 pL (lo-20 U) of restriction enzyme. Ensure that the buffer and DNA are well mixed before adding the enzyme. Less DNA can be used if the plasmid preparation is concentrated; make up the remaining volume with sterile distilled water. 2. Incubate the reaction at the appropriate temperature (usually 37°C) for a minimum of 3 h. The digestion time can safely be extended to overnight (18 h). 3. Add 5 l.tL of loading buffer, vortex briefly and pulse spin to collect the liquid at the base of the tube. 4. Load the entire 35 p.L on an agarose gel. 5. Load approximately 1 pg of digested lambda DNA as a marker. 6. Run a gel (0.8% agarose). Electrophorese at 90 V for 2-3 h or at 15-20 V overnight (see Note 6). 7. Stain, destain, and photograph the gel. 8. Estimate the sizesof the fragments produced in the same way as for circular plasmids. 3.6. Data
Interpretation
3.6.1. Plasmid
Profile
Typing
For plasmid profile typing, it is important to realize that the method is restricted to bacteria that carry plasmids and furthermore, is only of limited use in species in which the majority of isolates possess only one plasmid. For example, in salmonellas plasmid profile typing is of only limited value in S. enteritidis, a serotype in which the majority of isolates carry a single plasmid of 38 MDa. It is also important to realize that the method is not absolute. For example, the presence of plasmids of the same approximate molecular weight in two or more strains does not necessarily mean that the strains are epidemiologically related. The plasmids may be unrelated at the molecular level (that is, have different “fingerprints” when digested with restriction enzyme). Alternatively, the same plasmid may be present in unrelated strains as the result of interstrain transfer (R factor transfer). It is therefore essential to assess the results of plasmid profile typing in relation to available epidemiological data and, in particular, to carry out further tests to see whether strains of the same “plasmid profile” are related in terms of, for example, serotype and phage type.
Threlfall
and Woodford
Nevertheless, plasmid profile typing has proved an invaluable adjunct to other typing methods in support of epidemiological investigations. For results to be used in an epidemiological context, it is therefore essential to ensure that strains that are spatially separated on a gel and those that have apparently identical plasmid profiles are indeed identical. Because of unavoidable fluctuations in the migration of CCC plasmid DNA during electrophoresis, it is therefore advisable to run apparently identical strains in adjacent lanes. It is also important, after preliminary screening, to use at least two gel concentrations, one (0.5-0.6%) to separate plasmids of high molecular weight (>60 kb), and one (O&1.0%) to accurately size plasmids with molecular weights of less than 15 kb. 3.6.2. Plasmid Fingerprinting As with plasmid profile typing, plasmid fingerprinting restricted to plasmid-carrying strains. Of necessity, the interpretation of plasmid fingerprints should be made in relation to epidemiological criteria. For example, the method should be used when it is necessary to confirm the molecular relatedness of plasmids of similar molecular weights in apparently sporadic isolates; it should not be necessary to fingerprint plasmids that are clearly unrelated in terms of their molecular weights, nor is it necessary to fingerprint all plasmids of similar molecular weights in an outbreak situation. In conclusion, for both plasmid profile typing and plasmid fingerprinting, it must be emphasized that these are methods that should be used in support of other typing methods, and not for the primary differentiation of strains in outbreak situations. 1. 2. 3. 4.
4. Notes The actual equivalence varies with the base composition of the DNA; 1.5 kb 1s approximately equivalent to 1 MDa for DNA of 50% G + C. In many laboratories, it 1s now mandatory to use mlcrocentrlfuge tubes with screwcaps for the centrlfugation of viable cultures, although the best results seem to be obtained with those with “flip-tops.” For S. aureus, add 40 mg/mL lysozyme. For coagulase-negative staphyloCOCCI,add 40 mg/mL lysozyme and 1 mg/mL lysostaphin. Never vortex the preparations before the bacterial chromosomal DNA has been removed because sheared chromosomal DNA can be carried through into the final preparation easily.
Plasmid
235
Fingerprinting
5. Avoid all the precipitate, because this contains chromosomal DNA, proteins, and SDS, all of which could have a deleterious effect on later analysis. 6. The concentration of agarose used can be altered when the number and size range of fragments generated is known. It should be noted that, unlike CCC plasmid DNA, small linear fragments may migrate faster than the tracking dye, For this reason, it is therefore advisable to terminate the run before the dye front reaches the end of the gel.
References 1 Schmidt, T. J., Barret, J. S., Schrader, J. S , Scherach, C S., McGee, H P., Feldman, R. A., and Brenner D. J. (1982) Salmonellosis associated with marijuana. A multi-state outbreak traced by plasmid fingerprinting. N. Engl J. Med. 306, 1249-1253. 2. Threlfall, E. J., Hall, M. L M , and Rowe, B. (1986) Salmonella gold-coast from outbreaks of food-poisonmg in the British Isles can be differentiated by plasmid profiles J. Hyg. 97, 115-122. 3. Threlfall, E. J , Hall, M. L M , Ward, L R., and Rowe, B (1992) Plasmid profiles demonstrate that an upsurge in Salmonella berta in Humans in England and Wales is associated with imported poultry meat. Eur. J. Epidemiol. 8,27-33. 4. Olsen, J. E., Brown, D. J., Baggesen, D. L., and Bisgaard, M. (1992) Biochemical and molecular characterization of Salmonella enterica serovar berta and comparison of methods for typing. Epidemiol. Infect. 108,243-260 5. Wray, C., Mclaren, I., Parkinson, N. M., and Beedell, Y. (1987) Differentiation of Salmonella typhtmurium DT204c by plasmid profile and blotyping. Vet. Rec. 121,514-516.
6. Brown, D. J , Baggesen, D. L., Hansen, H B., Hansen, H. C., and Bisgaard, M. (1994) The characterization of Danish isolates of Salmonella enterica serovar Ententidis by phage typmg and plasmid profiling: 1980-1990. APMZS 102,208-214. 7. Threlfall, E. J., Hampton, M. D., Chart, H., and Rowe, B. (1994) Use of plasmid profile typing for surveillance of Salmonella enteritidis phage type 4 from humans, poultry and eggs. Epidemiol. Infect. 112,25-3 1. 8. Birnboim, H. C. and Doly, J. (1979) A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucleic. Acids Res 7, 1513-1523. 9. Kado, C. I and Liu, S.-T. (1981) Rapid procedure for detection and isolation of large and small plasmids. J Bact 145, 1365-1373 10. Platt, D. J , Chesham, J. S., Brown, D. J., Kraft, C A , and Taggart, J. (1986) Restriction enzyme fingerprinting of enterobacterial plasmids: a simple strategy with wide application. J Hyg. 97,205-210 11. Platt, D. J., Taggart, J , and Heraghty, K A. (1988) Molecular divergence of the serotype-specific plasmid (pSLT) among strains of Salmonella typhimurium of human and veterinary origin and comparisonof pSLT with the serotype specific plasmids of S. ententidrs and S dublin. J. Med. Mtcrobiol. 27,277-284.
Threlfall
and Woodford
12. Brown, D. J., Threlfall, E. J., Hampton, M. D., and Rowe, B. (1993) Molecular characterization of plasmids in Salmonella enteritidis phage types. Epidemiol Infect. 110,209-216.
13. Bensaude, 0 (1988) Ethidium bromide and safety. Trends Genet. 4,89. 14. Macrina, F. L., Kopecko, D J., Jones, K. R., Ayers, D. J., and McCowen, S. M. (1978) A multiple plasmid-containing Escherichia coli: convenient source of plasmid srze reference molecules. Plasmid 1,417-420. 15. Threlfall, E. J., Rowe, B., Ferguson, J. L., and Ward, L. R. (1986) Characterization of plasmids conferring resistance to gentamicin and apramycin m strains of Sulmonella typhimurium phage type 204~ isolated in Britain. J Hyg. 97,419-426.
CHAPTER21
Polymerase Chain Reaction for the Detection of Listeria Species and Listeria monocytogenes Kenneth
W. S&ens
1. Introduction Traditional methods for the identification of some bacterial species can be time consuming and often necessitate the isolation of pure cultures before further characterization may be undertaken. Advances in molecular biology have allowed the identification of bacterial species by virtue of the unique nature of the DNA of a species, often using methods based on the hybridization of DNA probes. These methods, however, are often time consuming in themselves, but recently the development of a new technique, the polymerase chain reaction (PCR) (I), has seen a new approach to bacterial identification that is rapid, accurate, and easy to perform compared with earlier DNA probe tests. The basis of the PCR is illustrated in Fig. 1 and is described more fully in a number of texts devoted to the technique (2,3). Essentially, two oligonucleotides are used in the reaction which will bind to a region of the bacterial genomic DNA, which is unique to the species of interest. These oligonucleotides act as primers during the PCR to allow the specific amplification of a DNA fragment corresponding to the region of the genome lying between the sites at which they bind. During the amplification reaction the template strands are denatured at 95°C. Primers are annealed at a suitable temperature (usually 45-60°C) and the intervening DNA is synthesized at 72°C (the optimum for Taq polymerase activity). From Methods m Molecular Biology, Vol 46: Dagnostm EdlIed by J Howard and D M Whltcombe Humana
237
Bacteriology Protocols Press Inc., Totowa, NJ
238
Siggens
e
TARGET PCR i..- k..+-. .
DNA
PRIMER
NEW DNA
This cycle of temperatures is repeated up to 20-40 times to amplify the DNA fragments in the reaction to a level that will be detectable by agarose gel electrophoresis. Only if the DNA of the bacterial species of interest is present in the sample will the oligonucleotides be able to prime
Detection
of Listeria
monocytogenes
239
the synthesis of a DNA fragment of a size diagnostic of the species in question. PCR-based methods of this nature have been used to identify an ever-increasing number of bacterial species, including Mycobacterium leprae (4), Eschericia coli (5,6), Staphylococcus aureus (7), and Listeria monocytogenes (8-10). My laboratory developed one of the first PCR-based tests for L. monocytogenes (8), and this is used in this chapter to illustrate the apphcation of the PCR to bacterial identification; the methods and principles are more widely applicable and can be adapted to form the basis of a test for any species for which unique DNA sequence is currently available or which could be generated by sequencing. Although in general the PCR uses only one primer pair to produce a single-amplified DNA fragment, the reaction can actually use several primer pairs to produce multiple fragments (hence the term “multiplex” PCR). In fact, the L. monocytogenes test uses a complement of five primers to produce up to three fragments depending on the actual nature of the bacterral sample being tested. The primer interactions and their DNA products are illustrated in Fig. 2. This chapter describes the methods for analyzing a putative L. monocytogenes culture or colony using a PCR-based test that first amplifies specific fragments and then analyzes the sizes of these fragments by agarose gel electrophoresis in order to determine whether the sample is L. monocytogenes or one of the other species of Listeria. This chapter describes the use of the PCR in the identification of a particular bacterial species. The reaction components (particularly the
Fig. 1. (opposite page) Principle of DNA amplification using PCR. The
target DNA is the region of the genomeselectedfor amplification, its length being defined by the distance between the 5’ ends of the two oligonucleotide primers that bind specifically to this region of DNA. In the first cycle, the two strands of DNA are separated by denaturation at 95°C. The two primers are then allowed to bind to their homologous sites by lowering the reaction temperature to the annealing temperature and are then extended at 72°C by Taq DNA polymerase that mcorporates dNTPs to produce double-stranded copies of the original target region. During subsequent cycles of denaturation, annealing, and extension there is an exponential accumulation of a DNA fragment (represented by solid boxes and arrows) corresponding to the region of DNA flanked by the 5’ ends of the primers.
240
Siggens -
939bp
-
16s
rRNA
408bp-
u1
-
702bp
-
LMl b HLYO LM2
Fig. 2. Detection of L. monocytogenes by PCR. The test 1s based on a multiplex PCR containing five primers, namely Ul, U2, LIl, LMl, and LM2. The interactions of these primers are shown, the arrows denoting the direction of synthesis of new DNA. Ul and U2 are derived from DNA sequences representing highly conserved domains of the 16s rRNA genes of all bacterial species. These primers result in the formation of a 40%bp fragment with all bacterial DNA samples and their function is to confirm that DNA ampllficatlon has occurred in any given test reaction. The LIl primer is a region of the 16s rRNA genes that is specific to the genus Listeria. The formation of a 93%bp fragment indicates that the test sample contains DNA from at least one Listeria species. The LMl and LM2 primers are derived from the listeriolysin 0 gene of L. monocytogenes (HLY 0). The formation of a 702-bp fragment, together with the other two fragments, indicates that the test sample contains L. monocytogenes DNA. primers) and the conditions for thermal cycling are relevant to this identification test only, and systems applicable to the detection of other bacteria will employ their own parameters. It is beyond the scope of this
chapter to consider the ways in which the PCR can be used to identify other bacteria, but there are two excellent books devoted to the subject of PCR (2,3) that will guide the reader through the establishment of an efficient test using PCR. In theory, any bacterial species should be amenable to identification by a PCR test provided that a unique sequence of DNA can be identified that will allow discrimination from all other species.
Detection of Listeria
monocytogenes
2. Materials 2.1. Oligonucleotide
241
Primers
1. Ul : 5’-CAGCMGCCGCGGTAATWC-3’ 2. U2: 5’-CCGTCAA’ITCMTAGTlT-3’ 39 LI 1: 5’-CTCCATAAAGGTGACCCT-3’ 4. LMl: 5’-CCTAAGACGCCAATCGAA-3’ 5. LM2: 5’-AAGCGCTTGCAACTGCTC-3’ M denotes A or C; W denotes A or T; R denotes A or G. These primers were synthesized on an Applied Biosystems (Warrington, UK) 380B synthesizer using standard protocols; they could also be obtained commercially from any of the companies offering custom oligonucleotide synthesis.
2.2. Buffers
and Stock Solutions
1. PCR buffer (10X stock): 500 mM KCl, 100 mM Tris-HCl, pH 8.3, 15 mA4 Mg&, 0.01% (w/v) gelatin. Store frozen in ahquots. 2. dNTP mix: 2 mJ4 dATP, 2 mM dCTP, 2 mM dGTP, 2 mM dlTP. Store frozen in aliquots. This mixture is prepared by dilution of 100 mM dNTP stock solutions that are commerctally available. 3. Primers: Stock solutions of each primer at 1 mg/mL in safe water. Store frozen in aliquots. Prepare working solutions at a concentration of 0.1 mg/mL by dilution of the aforementioned stocks and store frozen. 4. AmpliTuq DNA polymerase, available from Perkm Elmer (Norwalk, CT). 5. TBE (10X stock): 0.5M Tris, 0.5M boric acid, 0.025M EDTA. 6. Loading dye: Mix 5 mL 10X TBE, 4 mL glycerol, 1 mL water (deionized and autoclaved), 5 mg Bromophenol blue. 7. PhiX174-HaeIII DNA markers: Available commercially. 8. Ethidium bromide: 5 mg/mL in water. Caution: Ethidium bromide is a powerful mutagen and potential carcinogen-always wear gloves when handling the solid or liquids containing the chemical. Ethidium bromide solutions can be purchased from commercial sources; ethidium bromide tablets containing preweighed amounts of the chemical can be purchased. These forms represent the safest way of preparing the stock solution.
3. Methods 3.1. Preparation of Cell Lysate for PCR 1. To prepare a crude cell lysate from a putative colony, remove a small amount of the colony wtth a toothpick or a loop and add to 100 pL of water in an Eppendorf tube. Heat the sample at 110°C for 5 mm in a heated water
242
Siggens
bath containing polyethylene glycol liquid (PEG 200). Store lysates frozen for long-term storage (see Note 1). 2. To prepare a crude cell lysate from a bacterral culture, centrifuge a sample of the culture at 13,OOOgfor 2 min to pellet the bacteria. Transfer a small quantity of cells to 100 uL of water and processas in step 1 to produce a cell lysate. 3.2. PCR 1. Use 50 pL reaction volumes m small Eppendorf tubes of a size and shape compatible with the thermal cycler m use. Add the following components in order: 23 pL water; 5 yL 10X PCR; 5 pL dNTP mix; 3 pL each of Ul, U2, LIl, LMl, and LM2 primers (0.1 mg/mL solutions); 2 pL crude DNA lysate; and 0.2 pL AmphTuq DNA polymerase (see Notes 2 and 3). 2. Overlay the reaction mixture with mineral oil prior to thermal cyclmg (see Note 4). 3. Perform thermal cycling m a Perkm Elmer DNA Thermal Cycler or an equivalent machine. Program 30 cycles of 95°C for 1 mm, 50°C for 2 s, and 72°C for 1 mm. During the first cycle, prolong the denaturing (95°C) step to 4 min and, after the last cycle, make the extension (72°C) step 5 min longer. Program the machme to maintam the samples at 4°C until the PCR products can be analyzed by gel electrophoresis.
3.3. Agarose
Gel Electrophoresis
1. Prepare a 1.5% agarose (SeaKem ME) gel containing 1X TBE and 0.1 pg/mL ethidium bromide. Caution: Wear gloves. 2. Add 5 pL of loading dye to the finished PCR. Do not remove the mineral oil, add the dye by pipetmg it onto the inside wall of the tube and centnfuge briefly to mix it into the aqueous phase. 3. Load an appropriate volume of the sample into the well of the gel (e.g., 10 pL in a 2-mm well). Load a suitable amount of the DNA markers into a well flanking the sample wells. 4. Run the gel in 1X TBE, contammg ethidmm bromide at the concentration used m the gel, at a voltage suitable for your gel apparatus (e.g., 5-10 V/cm). Run rt until the bromophenol blue has migrated approxrmately twothirds of the length of the gel 5. Photograph the gel using a UV transrlluminator to visualize the DNA bands.
3.4. Interpretation
of Results
A typical gel photograph is shown in Fig. 3. The presence of a single band (408 bp) formed as a result of priming by the Ul-U2 primers indicates that the PCR occurred successfully-if the PCR does not produce a Ul-U2 product then this indicates that either the reaction did not contain
Detection
of Listeria 1
monocytogenes 2
3
4
5
243 6
7
8
9
938bp 702bp
408bp
Fig. 3. Gel result for analysis of nine bacterial samples. PCR was carried out on these nine samples using the primers shown in Fig. 2. Tracks 1,2,5,6, and 7 are samples of Listeria other than L. monocytogenes. Tracks 3 and 4 are samplesof L. monocytogenes.Tracks 8 and 9 are samplesof non-Listeria species. The minor bands that are not of the predicted size are nonspecific PCR products that can sometimes be produced but do not interfere with the test.
any (or insufficient) bacterial DNA, or the Taq DNA polymerase was not fully active. The former could be owing to operator error or it could be owing to insufficient release of DNA as a result of poor lysis or too few bacteria in the lysate. The latter may result from a failure to add a required reaction component or from the presence of factors in the lysate that inhibit the activity of Taq DNA polymerase. All of the DNA samples being tested should produce this control band because the Ul-U2 oligonucleotides represent highly conserved regions of the bacterial 16s rRNA genes (II) (see Note 5). The presence of only two bands (408 and 938 bp), formed as a result of priming by the U 1-U2 and the Ul -LI 1 primers, respectively, indicates that the sample contains DNA of one of the Listeria species other than L. monocytogenes. The LIl primer is complementary to a region of the 16s rRNA gene that is specific to members of the Listeria genus (12). The presence of three bands (408,702, and 938 bp), formed as a result of priming by the U 1-U2, LM 1-LM2, and U 1-LIl primers, respectively, indicates that the sample contains DNA from L. monocytogenes. The
244
Siggens
702 bp band is produced by priming by LMl and LM2 at specific sequences present in the listeriolysin 0 gene of L. monocytogenes (13). These sequences are not present in the other known Lisferia species. Each sample, therefore, can be assigned as non-Listeria or Listeria species, but not L. monocytogenes or L. monocytogenes. 4. Notes 1. Crude cell lysates of bacteria have been found to be suitable for use m the PCR. It is important that not too much of a colony is added to the water for lysis, because components of the bacterial debris produced by lysis may have an inhibitory action in the PCR. As a rule, the maximum amount of cells transferred on a loop should be no more than just visible to the naked eye. Experimentation by the operator will give a better feel for how little needs to be taken with the loop in order to get a positive result in the PCR. It is often the case that a good lysate can be prepared by simply touching a toothpick to the colony, stirring the toothpick in the water, and doing the heat lysis step. 2. The volume specified in the methods for the PCR can be scaled down to save on costs. Note, however, that the thermal transfer properties of the reaction are dependent on the volume. Altering the volume may, therefore, affect the reproducibility of the reaction. The size of reaction required is also dependent on the size of the sample wells used for gel electrophoresis and on the number of gel analyses required. The smallest volume suitable for the PCR is approx 10 FL, which will produce sufficient DNA for a single analysis on a gel. In general, at least several, and often many, bacterial samples are analyzed at once and therefore it is easier and more accurate to prepare a larger mix of reaction components. All of the reaction components (excluding the DNA lysate) sufficient for the number of samples are mixed in a single tube and then dispensed into the reaction tubes. The DNA lysatesare then added to each aliquot and the PCR is processed as described. This method is the preferred route for even small numbers of samplesbecause it reduces the pipeting errors. Do not scale down the volume of lysate but simply add 0.5-l .OpL /9 pL of reaction mix. 3. It is vital that reaction products are not allowed to cross-contaminate the component solutions. After amplification, each reaction tube may contain millions of copies of the target regions; if only a small number of these amplified DNA molecules are allowed to contaminate a stock solution then these will act as templates in any reactions set up using the contaminated stock and will produce false results. For this reason, a number of points must be observed:
Detection
of Listeria
monocytogenes
245
a. Use only a clean sterile tip when pipeting from a tube of a reaction component-never use a tip more than once when pipeting these components; b. Establish two working areas (ideally in separate labs or at least on individual bench areas): One for the setting up of reactions and the handling of nonamplified components, and the other for handling of the amplified reactions and gel analysis; and c. If possible, designate sets of pipetors to the two separate working areas, because these instruments can contaminate through the formation of aerosols. It is not necessary to use positive displacement pipets. 4. To prevent evaporation during thermal cycling, the PCRs have a mmeral oil overlay. The easiest way to add this is to use a dropper, adding one to two drops to each sample tube. It is sufficient that the surface of the reaction mix is completely covered with oil; too much oil may slow the thermal transfer and thereby adversely alter the performance of the PCR, resulting in poorer yield or nonspecific bands. For the purpose of analyzing PCRs by gel electrophoresis, it is not necessary to remove the oil after thermal cycling. The loading dye is added to the reaction as described and the sample for the gel can be removed by inserting the pipet tip down through the oil layer to the bottom of the sample layer. The oil adhering to the outside of the tip can be either wiped off with a tissue or, more easily, can be dispersed by putting the end of the tip into the electrophoresis tank buffer away from the wells-you will see the oil disperse like a small oil slick. The sample can then be loaded into the well. 5. The sequences for primers Ul and U2 were published by Lane et al. in 1985 (II). They are derived from two regions of the 16s rRNA genes that are almost perfectly conserved among all of the organisms inspected for the original publication. It is an assumption that these primers will act as primers for all PCR involving amplification of bacterial DNA. It is possible that a small number of bacterial species will not contain the appropriate target priming sites, and may therefore fail to generate a “universal” product. This possibility is likely to occur rarely, if ever, and the operator would be alerted to the potential problem by repeated failure to amplify this product,
References 1. Saiki, R. K., Gelfand, D. H , Stoffel, S., Scharf, S. J., Higuchi, R., Horn, G. T , et al. (1988) Primer directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239,487-491 2. Erlich, H. A. (ed.) (1989) PCR Technology, Principles and Applications for DNA Amplification. Stockton, New York. 3 Innis, M. A., Gelfand, D. H., Sninsky, J J., and White, T. J. (eds.) (1990) PCR Protocols. A Guide to Methods and Applications. Academic, London.
Siggens 4. Hartskeerl, R A., DeWit, M. Y L., and Klatser, P R. (1989) Polymerase chain reaction for the detection of Mycobacterium leprae. J Cert. Microbtol. 135, 2357-2364. 5. Olive, D. M. (1989) Detection of enterotoxtgenic Escherrcta colt’ after polymerase chain reaction amplification with a thermostable DNA polymerase. J. Clin Microbial 27,261-265. 6. Wernars, K , Delfgou, P. S , Soentoro, P. S., and Notermans, S (1991) Successful approach for detection of low numbers of enterotoxigemc Eschencta coli m minced meat by using the polymerase cham reaction, Appl Env. Microbial. 57, 1914-1919 7 Wilson, I G., Cooper, J. E , and Gilmour, A (1991) Detection of enterotoxigenic Staphylococcus aureus in dried skimmed milk: use of the polymerase chain reaction for amplification and detection of staphylococcal enterotoxm genes entB and entC1 and the thermonuclease gene nut Appl Env Mtcrobiol. 57,1793-1798 8. Border, P. M , Howard, J J , Plastow, G S., and Siggens, K W (1990) Detection of Ltsteria species and Listeria monocytogenes using polymerase chain reactron Lett. Appl. Microbial 11,158-162. 9 Bessesen, M. T., Luo, Q , Rotbart, H A., Blaser, M. J , and Elhson, R. T., III (1990) Detection of Listeria monocytogenes by usmg the polymerase chain reaction Appl. Env. Microbrol 56,2930-2932. 10 Wernars, K., Heuvelman, C. J., Chakraborty, T., and Notermans, S. H. W (1991) Use of the polymerase chain reaction for direct detection of Ltsteria monoLytogenes in soft cheese. J. Appl Bact. 70, 121-126 11 Lane, D. J., Pace, B , Olsen, G J., Stahl, D. A., Sogin, M L , and Pace, N R (1985) Rapid determination of 16s ribosomal RNA sequences for phylogenetic analyses. Proc. Nat1 Acad. Sci USA 82,6955-6959. 12. Stackenbrandt, E and Curiale, M. (1988) Detectton of Ltsterra Eur. Patent Appl #88308820.5. 13. Mengaud, J., Vicente, M. F., Chenevert, J., Pereua, J. M , Geoffrey, C., GicquelSanzey, B., et al. (1988) Expression in Eschericza coli and sequence analysis of the listeriolysin 0 determinant of Listeria monocytogenes Infect. Immun. 56,766-772
CHAPTER22
Development of Bacterial Species-Specific DNA Probes Based on Ribosomal RNA Genes Using PCR Terry J. Smith, Mqjella Maher, Frank Gannon, and Michael T. Dawson 1. Introduction DNA probes are being used increasingly to detect and identify microorganisms, particularly pathogenic bacteria in a variety of areas. These include medicine, the food industry, and the environment. Various strategies have been used to develop DNA probes for specific bacteria that include the use of genes for antigenic determinants and virulence factors, randomly cloned DNA fragments, high copy number sequences including insertion elements, and ribosomal RNA (rRNA) genes (1-7). The sequencesused for DNA probes ought to be both highly abundant as well as specific for the organism of interest. Therefore, rRNA is a potential target for the development of DNA probes. In bacteria, the DNA encoding rRNA is arranged in an operon consisting of three genes, which represent 16S, 23S, and 5s RNAs (seeFig. 1A) and are cotranscribed as a single 30s precursor RNA and subsequently processed (for review see ref. 8). Operons encoding rRNA are present in up to 10 copies in bacteria (9-I]), whereas during active cell growth and division the abundance of rRNAs can be as high as lo4 copies per cell. They are essential constituents of prokaryotic and eukaryotic ribosomes and, because of their pivotal role in translation, they are highly conserved in structure and are functionally homologous in all organisms. However, within the rRNA genes there are regions of conserved sequence among speciesinterspersedwith regions of sequencevariation (12,13). The rRNAs From: Methods m Molecular Biology, Vol 46: Dlagnostlc Edtted by’ J J Howard and D M Whltcombe Humana
247
Bactenotogy Protocols Press Inc , Totowa, NJ
248
Smith
Al
SPACER
4 1 6”
c -----
VA
7
~
v9
et al.
* 23s
SFACER
------R';
Fig. 1. Schematic representation of a prokaryotic ribosomal RNA operon. (A) Each rRNA operon consists of three genes, 16S, 23S, and the 5s genes. The positions of the intergemc or spacer region and the Al and Bl primers are indicated. (B) The 16s gene showing the constant (C; m) and variable (V; n ) regions. The positions of the PCR primers used to amplify the Vl region (Ul and U2) and the V6 region (Rl and R2) are indicated. (C) The 16S/23S spacer region is represented with the adjacent C and V regions of the 16s and 23s genes indicated. The positions of the Al and Bl primers are shown. form stable secondary structures that consist of stem and loop structures,
the conserved regions forming the stems, whereas the variable regions form the loops (1415). The constant and variable regions of microorganisms can be compared to each other for homology (13,16) and can be used to establish evolutionary relationships and draw phylogenetic trees (17,18). We have developed a general strategy in which polymerase chain reaction (PCR) primers derived from the constant regions of the 16s rRNA gene are used to amplify and sequenceacross the intervening variable regions (5). Using this strategy, variable (V) regions can be arnpli-
fied from any Eubacterium using universal primers from the neigboring constant regions (Fig. 1B). By sequence alignment, we have found that
the Vl and V6 variable regions of the 16s rRNA gene are often good
Bacterial
Species-Specific
DNA Probes
249
12345676910
347 -
Fig. 2. PCR amplified ribosomal RNA spacers.PCR productsfrom a variety of Listeriu speciesand a panel of other microorganisms. 1. L monocytogenes; 2. L. innocua; 3. L. welshimeri; 4. L. murrayi; 5. Escherichia coli; 6. Bacillus subtilis; 7. Bacillus cereus; 8. Salmonella typhi; 9. Salmonella enteritidis; 10. Streptococcus faecalis.
targets for the design of species-specific DNA probes, as they tend to show sequencevariation even among closely related bacterial species (7). A second, related strategy involves the amplification of the variable spacer regions between the 16s and 23s genes, using universal primers from the constant 3’ region of the 16s and the constant 5’ region of the 23s genes, respectively (6; see Fig. 1C). Because spacer regions have no known structural function, our rationale is that these regions are under less selective pressure and ought to be more variable. The spacer regions can be amplified by PCR giving rise to one or more DNA fragments (Fig. 2). The size of the spacer region varies between genera and even species, although most species of the same genus have similar sized fragments (see Fig. 2, lanes l-4). Some organisms have more than one size of spacer fragment depending on whether tRNA genes (8) are present in some copies of the spacer region (see lanes 5,7, and 10 in Fig. 2). Such amplified products are unsuitable for direct sequencing because they represent a number of fragments. The DNA sequence of the variable regions can then be determined by direct sequence analysis of the PCR product or, in the case of multiple products, by subcloning PCR products prior to sequencing. The sequences of the spacer region of closely related organisms can then be compared in order to generate species-specific DNA probes. Homology alignments to rRNA sequencesin the Genbank and European Molecular Biology Laboratory (EMBL) databases can also be carried out using available sequence analysis software packages, which facilitates the construction of phylogenetic trees.
250
Smith
et al.
2. Materials PCR reagents and stock buffers must be prepared in sterile deionized water dedicated for PCR. This can be made up or purchased from outside sources (e.g., Sigma, St, Louis, MO). Sterile water stocks,reagents,and stock buffers should be stored away from possible sources of contamination. 1. 2. 3. 4. 5. 6.
7.
8.
9. 10. 11. 12. 13. 14.
KCl: 1M. MgCI,: 1M. Tris-HCl: lM, pH 8.8. Triton X-100: 10% (v/v). Deionized H20. PCR buffer (10X concentrate): 100 mM Tris-HCI (pH 8.8), 500 n&f KCl, 1% (v/v) Triton X-100,40 mMMgC12 (see Note 1). Falter sterilize the 10X buffer, dispense into 120- or 240~PL aliquots (sufficient for lo-20 reactions, depending on usual number of reactions carried out; see Note 2), and store at -20°C. Thaw each aliquot once only and discard any remamder (see Note 3). dNTPs: A mixture of all four dNTPs at 1.25 mM each in deionized water. Dilute from commercially supplied, buffered stock solutions (100 mM). Filter sterilize, dispense into 150-300~pL aliquots (lo-20 reactions), and store frozen, Use each ahquot once and discard (see Notes 2 and 3). PCR primers: 100 ng/pL. Filter sterilize, dispense into lOO-200~pL aliquots, and store frozen (see Notes 2 and 4). The sequencesof the umversal spacer primers Al and Bl are as follows and their positions are shown in Fig. 1A$: Al Forward: AGTCGTAACAAGGTAGCCG and Bl Reverse: T/C A/G T/C TGCCAAGGCATCCACC. The universal primers for amplification of the Vl (a) and V6 (b) regions of the 16s are as follows and their positions are shown in Frg. lb: a. Rl Forward: AATTGAAGAGTTI’GATCATG and R2 Reverse: ACATI’ACTCACCCGTCCGGC. b. Ul Forward: ACGCGAAGAACCTTACC and U2 Reverse: CATGCAGCACCTCTCTC. Mineral oil. Tuq DNA Polymerase: 5 U/pL. Agarose of a grade suitable for the preparation of high concentration gels on which to separate small fragments (e.g., Nu-Steve from FMC products), Electrophoresrs buffer (10X concentrate): 0.5M Trrs, 0.5M boric acid, 0.025M EDTA. Sample loading buffer (10X concentrate): 50% (v/v) 10X TBE, 40% (v/v) glycerol, 0.025% (w/v) Bromophenol blue. PCR magic preps.
Bacterial
Species-Specific
DNA
Probes
251
3. Methods 3.1. PCR Amplification Use the primers A 1 and B 1 to amplify the variable intergenic spacer region (see Fig. 1). This strategy can also be used to amplify variable regions within the 16s gene. Use 100~pL reaction volumes (see Note 5). Take great care to avoid cross-contamination of different bacterial isolates (see Note 3). 1, Make up a PCR reaction cocktail as follows: Per reaction lOj.lL 10X buffer (see Note 1) 15 pL dNTP mix (1.25 m1I4) 16s primer (100 ng/pL) 1 PL 23s primer (100 ng/pL) 1 FL 0.2 pL Tuq DNA polymerase (5 U1p.L) 71.8 pL Hz0 filtered (see Note 6)
10 reactions (see Note 5) 1lOpL 165 pL 11 pL 11 p.L 2.2 pL 789.8 pL
2. Dispense 99 pL of cocktail to 0.5~mL Eppendorf tubes (see Note 6). 3. Overlay cocktail with three drops of light mineral oil (sufficient to cover the whole reaction surface). 4. Add 1 pL of an overnight liquid culture of bacterra (see Note 7). 5. Lyse the bacterial cells by incubating the mixture for 10 min at 95°C (see Note 8). 6. Subject the samples to 35 cycles of the followmg PCR conditions: Denaturation at 95°C for 30 s; annealing temperature at 50°C for 1 min (see Note 9); extension at 72°C for 1 min. 7. Analyze the PCR products by agarose gel electrophoresis (e.g., on 2.5% Nu-Sieve gel). The results of PCR amplification of spacers using primers A 1 and B 1 from a variety of organisms are shown in Fig. 2. 3.2. Purification of PCR Product Sequence Determination Once the PCR reaction has been completed, the reaction products must be column purified prior to direct PCR sequencing. This removes the excess primers, desalts, purifies, and concentrates the PCR product.
for Direct
1. Transfer the aqueous portion of the PCR products to a fresh tube, avoiding the mineral oil. 2. To 10 p.L of PCR product add agarose gel loading buffer and analyze on a 2.5% Nu-Sieve agarose gel.
252
Smith et al. 5'
Species
A
Species
B
Species
A
Species
B
Forward
Primer
Probe 3'
AAATGACGGTACCAACAGAAGAAGCGACGGCTAAATACGTC : : : : : : : : :::::::::::: : : : : :::::::::::::: : :::::::: AAATGACGGTACCAACAGAATAAGCGACGGCTAAATACGGGACCAGCAGC A n A
CGCGGTAATAGCTATGTGCACAGGCTTATCGCGAATTATGTGGCATTATC : : : : : ::::::::::::::*:::::::::::::::::::::::::::::: CGCGGTAATAGCTATGTCCACAGGCTTATCP
3'
5' Reverse
pr her
Fig. 3. Clustal analysis of two closely related bacterial sequences. Identical bases are indicated by ( : ) between the bases, whereas base differences are indicated by ( A ) under the nucleotides. Potential PCR primers and DNA probe sequences are indicated. 3. Purify the remaining DNA using “PCR magic preps” (Promega, Madison, WI) and resuspend the DNA m 50 yL sterile water (see Note 10). 4. Carry out nucleotide sequencmg reactions according to published methods (19) or sequencing kit manufacturers instructions, e.g., T7 sequencing kit (Pharmacia, Uppsala, Sweden). 5. Alternatively solid phase sequencing can be carried out on the PCR products using magnetic beads (Dynal, Oslo, Norway) according to the manufacturer’s protocol. 3.3. Sequence Analysis and Alignments Access to a VAX computer with Genbank and EMBL databases is desirable to be able to carry out sequence homology searches and alignments. Alternatively, PCs can be used with CD ROM drives. 1. Using a VAX system, enter the DNA sequences mto files. 2. Using sequence analysis software packages, such as Staden, GCG, or INCBI (Irish National Centre for BioInformatics, Tnmty College, Dublin), carry out homology analysis against the sequence databases (EMBL, Genbank) and ascertain which sequences are most closely related, 3. Carry out a homology alignment analysis such as Clustal V (20,21) against sequence entries from closely related organisms m order to identify unique sequences (an example of this is shown in Fig. 3). 4. Using sequences unique to the species or genus of interest, design PCR primers with a nucleotide difference at the 3’ end of one primer (see Notes 11 and 12; see Fig. 3).
Bacterial
Species-Specific
DNA
Probes
253
5. Design DNA probes for hybridization with nucleotide differences in the center of the oligonucleotide (see Note 13; see Fig. 3). 3.4. Optimization of PCR Amplification and Probe Hybridization Once specific PCR primers and probes have been designed and synthesized, they must be tested on the organism of interest and closely related organisms to validate them and optimize the conditions that ensure their correct specificity. This involves modifying PCR annealing temperatures, cycle number as well as hybridization, and washing temperatures for the oligonucleotide probe. 1. Calculate the T, for the ohgonucleotides (see Note 9). 2. Set up a number of parallel PCR reactions and vary the final concentration of MgC12 between 1 and 10 mM. Use an annealing temperature 5°C below the T, (T, - 5°C). 3. Using the optimum MgCl, concentration and an annealing temperature of T,,,- 5OC,PCR amplify the target sequence from the organism of interest and closely related orgamsms or organisms likely to be found in the same sample and that may result m false positive signals. 4. If amplification occurs where known sequence differences occur, increase the annealing temperature (or reduce the number of cycles) until specificity is achieved. 5. In the case of specific detection using DNA probes, carry out the hybridization and washes at T, - 5°C initially and increase these if necessary to obtain signal specificity. 4. Notes 1. Although there are a variety of PCR buffers in the literature that can be used, Taq polymerase enzyme is provided with a 10X reaction buffer by manufacturers and these are generally satisfactory. Different buffers seem to work equally well and the choice appears to be laboratory preference generally rather than any particular advantage. If optimization is a critical factor for extreme sensitivity, reaction buffer components can be altered to suit particular primer sets and target sequences. Some PCR uses require specific buffers, and for these readers, should consult specialist PCR books, The conditions for PCR amplification have been optimized with respect to MgClz concentration for the universal rRNA Vl, V6, and spacer primers (sequences given in Section 2.). Determine the optimal MgCl, concentration for other primer sets by performing a set of reactions with different MgCl, concentrations from l-l 0 mA4.
254
Smith
et al.
2. For setting up multiple PCR reactions of a number of cultures (or DNA) it is advisable to make up a single PCR reaction cocktail for the number of reactions, includmg negative and positive controls, plus one or two extra reactions to allow for pipeting errors. 3. Contammation in PCR is a major problem, and to mmimize this a number of precautions should be taken, These include aliquoting solutions to be used in the reaction and only using each aliquot once. Positive displacement pipets and/or filter tips should also be used to minimize the risk of cross contamination owing to aerosols. 4. If the same set of primers will be used for all PCR reactions, the primers can be pooled, aliquoted, and stored frozen. 5. PCR reaction volume can be reduced to as little as 10 PL. This reduces the amount of dNTPs and Tuq polymerase required with a resultant cost reduction, However, this makes handling and pipetmg of the samples difficult, especially if small numbers are involved. 6. If the volume of culture or DNA to be added to the cocktail is greater than 1 pL, the volume of water to be added to the cocktail must be adjusted accordingly and the volume of cocktail to be ahquoted to each PCR reaction tube. 7. One microliter of a standard overnight culture contains approx l@-lo6 organisms. 8. In the case of Gram-positive bacteria, an additional proteinase K digestion step is necessary. This can be done by incubation of 1 p,L of culture sample, in the PCR cocktail made up without Taq polymerase containing 1 PL of proteinase K (10 mg/mL stock) at 55”C, followed by heating to 95°C for 10 min to inactivate the proteinase K prior to addition of Tuq polymerase to each PCR tube. Alternatively, the bacteria can be proteinase K digested in water (1 pL of 10 mg/mL stock), the solution heated to 95OCfor 10 min, and then PCR cocktail added to 100 l,tL. 9. If using other primer sets, estimate their T,s: Roughly, add 2°C for every A or T, and 4°C for every G or C. Alternatively, a number of computer programs are available that can calculate the exact annealing temperatures by nearest-neighbor analysis. 10 Up to three PCR reactions can be pooled for purification with PCR Magic Prep columns which increases the amount of DNA for sequencing. 11. Primer specificity is primarily determined by sequence identity at the 3’ end of the oligonucleotide. Primers with base mismatches at the 3’ end, whereas they will anneal to the target sequence, will extend very inefficiently as the 3’ base mismatch mterferes with (Tuq) DNA polymerase mediated extension. DNA polymerase requires double-stranded DNA to attach and because the last (mismatched) base is not hybridized to the
Bacterial
Species-Specific
DNA Probes
255
target DNA, the enzyme cannot extend efficiently. Base mismatches found between different species or genera can thus be used to obtain specific amplification of only those target sequences from organisms with a perfect match. 12. Whereas a single nucleotlde mismatch is sufficient to obtain specific PCR amplification, more than one mismatch in one or both primers results in better specificity in the amplification. The more bases unique to the organism of interest that are included in the primers, the better. 13. For DNA probes, discrimination of mismatches is more efficient if they are positioned in the center of oligonucleotides, rather than at either end. Hybridization and washing conditions can then be chosen that will favor the retention of the probe to only perfect matches. Thus, the probe will be washed off sequences with even a single nucleotide difference.
References 1. Matsuo, K., Yamaguchi, R., Yamazaki, A., Tasaka, H., and Yamada, T. (1988) Cloning and expression of the Mycobacterium bovis BCG gene for extracellular alpha antigen. J. Bacterial. 170, 3847-3854. 2. Yamaguchi, R., Matsuo, K., Yamazaki, A., Abe, C., Nagai, S., Terasaka, K., and Yamada, T. (1989) Cloning and characterisation of the gene for immunogemc protein MPB64 of Mycobacterium bovis BCG. Infect. Immunol. 57,283-288. 3. Leimeister-Wachter, M , Haffner, C., Domann, E., Goebel, W., and Chakraborty, T. (1990) Identification of a gene that positively regulates expression of listeriolysin, the major virulence factor of Listerta monocytogenes. Proc. Natl. Acad. Sci. USA 87,8336-8340.
4. Hiney, M. P., Dawson, M T., Smith, P. R., Gannon, F., and Powell, R. (1992) DNA probe for Aeromonas salmonicida. Appl. Environ. Microbial. 58, 1035-1042. 5. Eisenach, K. D., Crawford, J. T., and Bates, J. H. (1988) Repetitive DNA sequences as probes for Mycobacterium tuberculosis. J. Clin. Microbial. 26,2240-2245. 6. Barry, T., Powell, R., and Gannon, F. (1990) A general method to generate DNA probes for microorganisms. Biotechnology 8,233-236. 7. Barry, T., Colleran, G , Glennon, M., Dunican, L. K., and Gannon, F. (1991) The 16S/23S ribosomal spacre region as a target for DNA probes to Identify Eubacteria. PCR Meth. Appl. 1,51-56. 8 King, T. C., Sirdeskmukh, R., and Schlessinger, D (1986) Nucleolytic processing of ribonucleic acid transcripts in procaryotes. Microbial. Rev. 50,42845 1. 9. Kenerley, M. E , Morgan, E. A., Post, L., Lindahl, L , and Nomura, M. (1977) Characterisation of hybrid plasmids carrying individual ribosomal ribonucleic acid transcription units of Escherichia coli. J. Bacterial 132,931-949. 10. Kiss, A., Sain, B., and Venetianer, P. (1977) The number of rRNA genes in Es&erichia coli. Febs Lett. 79,77-79.
11. Canard, B. and Cole, S. T (1989) Genome organization of the anaerobic pathogen Clostridium
perfringens
Proc. Natl. Acad Sci. USA 06,6676-6680.
Smith et al.
256
12. Gray, M. W., Sankoff, D., and Cedergren, R. J. (1984) On the evolutionary descent of organisms and organelles: a global phylogeny based on a highly conserved structural core in small subunit nbosomal RNA. Nucleic Acids Res 12,5837-5852. 13 Neefs, J. M., Vander Peer, Y , Hendnks, L., and de Wachter, R (1990) Compilation of small rrbosomal subumt RNA sequences. Nuclerc Acids Res. 18(Suppl.), 2237-2317. 14. Gutell, R. R , Weiser, B., Woese, C. R., and Noller, H F. (1985) Comparative anatomy of 16S-hke ribosomal RNA. Prog. Nucleic Acid Res. Mol. Blol. 32, 155-216. 15. Brosms, J., Dull, T. J., Sleeter, D., and Noller, H. F. (1981) Gene orgamsatron and primary structure of a ribosomal RNA operon from Escherichia coli. .I. Mol. Biol. 148,107-127.
16. Dams, E , Hendriks, L , Vander Peer, Y., Neefs, J M., Smits, G., Vandenbempt, I , and de Wachter, R (1988) Compilatron of small ribosomal subunit RNA sequences. Nucleic Acids Res. 16(Suppl.), 87-173 17. Olsen, G. J., Lane, D J , Giovannom, S J., Pace, N., and Stahl, D. A (1986) Microbial ecology and evolution: a ribosomal RNA approach. Annu. Rev. Microbial. 40, 337-365. 18. Fox, G. E. and Stackebrandt, E. (1987) The applicatron of 16s rRNA cataloguing and 5s rRNA sequencing in bacterial systematics Meth. Microbial. 19,405-458. 19. Casanova, J -L , Pannetier, C., Jaulin, C., and Kourilsky, P. (1990) Optimal conditions for directly sequencing double-stranded PCR products with Sequenase. Nucleic Acids Res. 18,4028. 20 Higgins, D. G. and Sharp, P. M. (1988) A package for performing multiple sequence alignment on a microcomputer. Gene 73,237-244. 21. Higgins, D. G., Bleasby, A. J., and Fuchs, R. (1992) Improved software for multiple sequence alignment. CABZOS 8, 189-191
CHAPTER23
Identification of Microorganisms Using Random Primed PCR Alan
J. Mileham
1. Introduction Polymerase chain reaction (PCR) can be usedto identify microorganisms in at least two basic ways. The first method depends on a knowledge of DNA sequence unique to the organism under study and provides a specific means of identifying that organism. This method is discussed elsewhere in this volume and can be used to identify a target organism even in small numbers in mixed cultures. The second method has an absolute requirement for a pure culture of the target organism but requires no knowledge whatsoever of the DNA sequence of that organism. This method depends on random priming of the PCR using an oligonucleotide primer (or pair of primers) of arbitrary sequence and is the subject of this chapter. The fidelity of the hybridization of an oligonucleotide primer to a denatured DNA template, depends on the length and base composition of the primer and the annealing temperature and salt concentration used in the reaction. For specific hybridization during PCR, annealing temperatures within 5°C of the theoretical melting temperature (T,) of the primer are used. As a “rule of thumb,” T, values can be estimated by assuming that an A or T base contributes 2°C to the T,, whereas a C or G base contributes 4°C. There are also several commercially available computer programs designed to estimate the T, of any given oligonucleotide sequence. If a DNA molecule in the sample contains a sequence that is very similar to that of the primer, annealing between the primer From* Methods m Molecular Wology, Vol 46 Dlagnostrc Bacteriology Protocols Edlted by: J Howard and D M. Whltcombe Humana Press Inc , Totowa, NJ
257
258
Mileham
and this site is possible, especially at vast primer excess or at temperatures below the theoretical melting temperature of the primer. This is termed “mismatch” as one or more of the bases of the primer is annealed or “matched” with an inappropriate base on the template DNA (G should always pair with C and A with T). Once such a mismatch annealing has taken place and new DNA extended from the primer by PCR, subsequent cycles of PCR involving this new molecule will not involve mismatch as the primer sequence and not the differing target template sequence, has been locked into the end of the new molecules. This is especially important to bear in mind when dealing with samples that are dilute or contain very few authentic primer binding sites. Here, relative primer and dNTP concentrations are so high in the early rounds of PCR that very rare mismatch interactions may occur and be extended even at annealing temperatures that would be expected to disallow such interactions. The PCR products derived from mismatched annealings are then amplified normally. This can lead to difficulties in interpreting results in conventional PCR but provides the basis of the novel system of strain identification discussed here. Three publications (1-3) in 1990 and 199 1 outlined different methodologies and detection systems aimed at the production of a pattern of PCR products specific for a particular combination of organism, oligonucleotide primer, and reaction conditions. These patterns constitute PCR fingerprints and it is possible to envisage the development of computer databases for particular primers and reaction conditions that would allow the rapid identification of unknown microorganisms using a standard technique. The method known as Random Amplified Polymorphic DNA or RAPD (2), has become the most widely used system and is the focus of this chapter (see Note 1). RAPD is a PCR-based system that can be used to provide DNA fingerprints to identify differences between strains and species. The process uses single primers of arbitrary sequence,usually 10 bases long, and these can be used on any DNA target irrespective of any knowledge of its DNA sequence.This offers a substantial time saving advantage as the DNA region need not be identified, cloned, and its sequence determined before it can be used as a DNA marker. DNA is made up of an ordered sequence of four constituent bases, thus the sequence of a random primer 10 bases long should occur once
Identification
of Microorganisms
259
every 41° or approx l,OOO,OOObasepairs (bp) on any target DNA template. Bacterial genomes are about 5,000,OOObp and so would be expected to carry five copies of any random lo-base sequence.To form a PCR product, two such binding sites should be present on opposite strands of a target DNA template so that PCR will copy the region between the priming sites. This should occur about every 4,000,OOObp, as primer pairs can be in one of four possible orientations with respect to each other on opposite strands of a DNA molecule, and so the average size of a PCR product amplified by RAPD, assuming specific binding between primer and target DNA, would be expected to be 4,000,OOObp. However, PCR products over 2000 bp are amplified with decreasing efficiency and so products of 4,000,OOObp do not occur. Thus, the PCR products formed by RAPD are rarely the results of bona fide annealing of the primer used. Two primers must anneal probably by mismatch within 2000 bp of each and in the correct orientations in order for the reaction to proceed. At high primer concentrations mismatch priming can arise, at least transiently, even at temperatures above the primer’s theoretical T,. The presence of high levels of dNTPs and DNA polymerase will favor the extension of the mismatched primer and this stabilizes the association between the primer and its target sequence. The newly synthesized PCR products now carry an authentic primer molecule at both ends and so subsequent cycles of PCR will be the result of specific and not mismatch annealing. The closer the similarity between the mismatch and the authentic primer binding sites, the more likely that this site will promote a PCR product. Once a spectrum of PCR products begins to appear in the reaction, those that are extended most efficiently (generally short sequences) will be preferentially amplified and become part of the final RAPD profile. Thus specific PCR products will be made by the RAPD process and these will be consistent for a given DNA sample using a particular primer under the specified PCR conditions (see Note 2). The pattern of PCR products seen after agarose gel electrophoresis of an RAPD analysis is termed an RAPD profile and differences in the RAPD profiles of even closely related individuals can be seen using appropriate primers. Different primers produce different RAPD profiles with the same DNA sample, but several primers may have to be tried before one is found that shows a significant difference between two related DNA samples. Small differences between the DNA of different species or individuals can be detected by RAPD analysis. Single base
Mileham differences and small deletions or insertions would be expected to both destroy and create binding sites for primers, resulting in differences in
the RAPD profiles. DNA samples from different members of a strain or species should all have identical and unique RAPD profiles provided that an appropriate primer is used, and these will differ from those of other strains or species. This forms the basis of a species/strain identification system and RAPD fingerprinting has now been successfully applied to a variety of organisms, including bacteria (I-13), fungi, plants, and animals. 2. Materials 2.1. OZigonucZeotide
Primers
These are routinely 10 bases long, of at least 50% G/C content and lacking in internal symmetry. Primers are usually used singly but can be
used in pairs if this produces a more informative profile. Kits each containing
20 such primers
are commercially
available
from Operon
(Alemeda, CA). 2.2. Buffers
and Stock
Solutions
1. PCR buffer (10X stock): 100 mM Tris-HCl, pH 8.3,500 mM KCl, 15 rniV MgCl,, 0.01% (w/v) gelatm. Store frozen m ahquots of 500 PL.
2. dNTP Mix (10X stock): 2 mM dATP, 2 mM dCTP, 2 rniI4 dGTP, 2 m&Z 3. 4. 5. 6. 7. 8.
dTTP. 100 mM stocks solutions are available commercially. Store frozen in aliquots of 500 pL. Primer (10X stock): Dilute the appropriate lo-mer to 2 pJ4 and store frozen in aliquots of 500 pL if in frequent use (see Note 3). AmpliTaq DNA polymerase: Commercially available from Perkin Elmer (Norwalk, CT). TBE buffer (10X stock): 0.5M Tns, 0.5M boric acid, 0.025M EDTA. Loading dye mix (10X stock): 50% (v/v) 10X TBE, 40% (v/v) glycerol, 0.025% (w/v) Bromophenol blue. Molecular weight markers: These are commercially available and should be chosen to give standard bands in the 0.1-3 kb range. Ethidium bromide: 5 mg/mL solution m water. Caution: Ethidium bromide is a known mutagen and a possible carcinogen. Always wear gloves when handling the solid solutions of ethidium bromide or gels that have been soaked in such solutions. Exercise great care when weighing out the solid; use a fume hood, face mask, gloves, and protective clothing.
Identification
of Microorganisms
261
9. Bacterial buffer: Any standard buffer designed for the drlution of bacterial cultures will be satisfactory, e.g., M9 salts, or Oxoid maximum recovery diluent. 10. Water: Sterile deionized and/or distilled. 11. Mineral oil: Commercially available.
3. Methods 3.1. Preparation of Cell Lysates for PCR Pure cultures of the bacterium under study are required for RAPD analysis. 1. Centrifuge 1 mL of a stationary phase liquid culture in a 1S-mL Eppendorf tube at 11,600g in a microcentrifuge for 5 min. Alternatively, a single colony of the test bacterium can be resuspended in 1 mL bacterial buffer, and then processed similarly (see Note 4). 2. Aspirate and discard the supernatant. 3. Resuspend the pellet in 1 mL bacterial buffer and pellet the cells as before. 4. Aspirate and discard the supematant. 5. Resuspend the pellet in 0.5 mL of sterile water. 6. Place the tube of washed cells in a boiling water bath for 10 min. The lid of the tube may pop open during this treatment. This can be avoided by puncturing the lid with a syringe needle. 7. Centrifuge the sample at 11,600g for 5 min. 8. Transfer the supematant to a fresh tube and estimate the DNA concentration by measuring the absorption of the solution at 260 nm (AZ&, using a UV spectrophotometer. 9. Adjust the DNA solution to AZ6c= 0.15, using sterile water and use 5 pL of this solution for each RAPD analysis. If a UV spectrophotometer is not available, a “rule of thumb” would be to dilute the DNA solution by 1.5. 10. Store lysates at -2OOC (see Note 3). 1. 2. 3. 4.
3.2. PCR Carry out standard reactions in 0.5~mL Eppendorf tubes in a final volume of 25 l.tL (see Note 5). Add, in the following order: 12.5 uL water, 2.5 pL 10X buffer, 2.5 pL 10X dNTP, 2.5 pL 10X primer, 5 pL bacterial DNA, and 0.5 U (0.2 pL> AmpliTuq DNA polymerase. Overlay the reaction mix with a drop of mineral oil. Place the tubes in a thermal cycler. If several strains are to be analyzed at the same time using the same primer, then it is easier to make a premix containing all the reaction components necessary except for the bacterial
Mileham DNA, for up to 20 tubes (see Note 6). Dispense 20 pL of this premix mto each tube and then add 5 JJ.Lof the relevant bacterial DNA. 5. Program the thermal cycler for 45 cycles of 1 min at 94OC, 1 min at 36OC, and 2 min at 72OC!,using the fastest available transition times between each temperature phase. After the reaction is completed, hold the reaction tubes at 4°C until the operator IS ready to begin agarose gel electrophoresis. 1. 2. 3.
4. 5.
6.
3.3. Agarose Gel Electrophoresis Make up an appropriate volume of 1.5% (w/v) agarose (SeaKern, Rockland, ME) containing 1X TBE and 0.2 mg/L ethrdium bromide. Caution: Wear gloves. Heat to dissolve the agarose, cool to 55OC,and cast an appropriately sized gel according to the manufacturer’s instructions. Add 2.5 pL 10X loading dye to the side wall of each reaction tube and mix the dye mto the reaction by briefly spinning the tubes m a microcentrifuge using the “pulse” button, There is no need to remove the mmeral oil (see Note 7). Load an appropriate volume of the sample onto the gel (e.g., 10 pL in a 2 x 1 mm well) and run molecular weight markers in the end tracks. Electrophorese the gels in 1X TBE buffer contammg 0.2 mg/L ethidium bromide (Caution: Wear gloves) at an appropriate voltage for the apparatus (e.g., 7.5 V/cm) until the Bromophenol blue has migrated about 75% of the length of the gel. Take a photograph of the gel on a UV transillummator to visualtze the DNA or use an alternative image recording device.
of Results The band pattern following agarose gel electrophoresis of an RAPD sample is specific for the test microorganism and primer combination under the conditions used in the PCR (see Note 2). The pattern of bands on the gel constitutes an RAPD profile or fingerprint for the test microorganism and this can be compared to those of known microorganisms, using the same primer and PCR conditions, in order to identify the test microorganism. A number of factors could lead to a failure to produce an RAPD profile: 3.4. Evaluation
1. The primer used is unsuitable for the target organism, 2. The concentratron of DNA is too low (indicates poor lysis), 3. PCR has been inhibited by a factor introduced with the DNA sample (see Note 4).
Identification
of Microorganisms
263
Fig. 1. RAPD analysis of two presumptive Salmonella isolates. PCR conditions were as in Section 3.2. Lanes l-9 used primer GCCAGGGACA; lanes 10-l 8 used primer GTGGCCGTGC. The samples were as follows: lanes 1 and 10, Escherichia coli; lanes 2 and 11, Citrobacter; lanes 3 and 12, presumptive Salmonella “A”; lanes 4 and 13, S. thompson; lanes 5 and 14, presumptive Salmonella “B”; lanes 6 and 15, S. senftenberg; lanes 7 and 16, S. ugona; lanes 8 and 17,s. mbanduku; and lanes 9 and 18 were no DNA controls. The presence of bands in the no DNA controls is probably owing to traces of bacterial DNA in the AmpliTaq DNA polymerase that indicates that such controls have no real use in RAPD analysis. The results indicate that both unknowns are Salmonellae and that unknown “A” is probably S. mbandaku. 4. A component(s) in the reaction was limiting. 5. Ethidium bromide was not included in the gel or running buffer.
The first and the last two points can be addressed to some extent by using reference DNA samples that have previously been shown to produce good RAPD profiles with the primers used (positive control) and DNA molecular weight markers. The failure to even visualize the molecular weight markers would indicate the lack of ethidium bromide, whereas the failure of the positive control alone would indicate a limiting component in the reaction mix, or that the primer used does not specify PCR products from the DNA of the test organism. Figure 1 shows the RAPD profiles of two unknown presumptive SuZmoneZZue using two different primers along with those of reference Salmonellae, Escherichia coli, and a Citrobacter. This test indicated that
Mileham
264
one of the unknown organisms was Salmonella mbandaka. Retesting this isolate with antisera confirmed this identification. 4. Notes 1. Two other systems for generating DNA fingerprints using PCR with random primers have been described. Both methods generate a greater number of bands than RAPD and so are more likely to show species or strain specific fingerprints for a particular primer, but both are more complicated to use than RAPD. Welsh and McClelland (I) used a two-stage PCR regime and primers of 20 or 34 nucleotides in length, ran the products on 5% polyacrylamide gels containing 50% urea, and visualized fingerprints by autoradiography. Fingerprints often contain more than 10 bands. Caetano-Anolles et al. (3) demonstrated a fingerprinting system named DNA amplification fingerprinting (DAF). This mvolved using single random primers between 5 and 21 nucleotides m length in a single stage PCR and visualizing the products using silver stained polyacrylamide gels. The fingerprints generated usually contain more than 10 bands. The method of Williams et al. (2) uses the simplest system of visualizing fingerprints (agarose/ethidium bromide gels) and has become the most widely used system.However, if a greater number of bands in a fingerprint is required for a more rigorous identification, the method of Welsh and McClelland is a consistently used alternative. 2. Several factors can affect the final RAPD profile of a particular organism using a particular primer (I#, 15). These include: a. The temperature and ramp rates used in the PCR. b. The concentration of the primer in the reaction. c. The concentration of the DNA in the reaction. d. The concentration of magnesium ions m the reaction. This sensitivity of RAPD to slight changes m these parameters underlines the need to use standardized PCR conditions (master mixes) and known internal control DNAs if RAPD results are to be scored with confidence. Typically, profiles have l-6 bands and several primers may have to be tested before one is found that is suitable for the identification of the organism under investigation. A more rigorous identification may be provided by the combined results of RAPD profiles using several different primers. Different RAPD profiles can also be generated by using pairs of primers in a single reaction. 3. It may be very important to store stocks of primers and lysates correctly for long-term usage. Operon, the suppliers of commercially available
Identification
of Microorganisms
265
lo-mer kits, advise that the rehydrated primers should be immediately aliquoted and lyophilized prior to long-term storage at -2OOC. My own experience of primers suggests that concentrated solutions last for several months when stored at -20°C without any noticeable deterioration in activity. However, I do not have any long-term experience of primers as short as 10 nucleotides in length. Pure DNA solutions are stable for several months at 4”C, but as crude lysates are used in this type of analysis it may be safer to store DNA preparations at -20°C. This will minimize the risk of lysate deterioration through, for example, the presence of low levels of nucleases. 4. There is a danger that if too many cells are used in the production of a lysate, or if significant amounts of agar are transferred from an agar plate when producing lysates directly from a colony of cells, the PCR will be inhibited and no RAPD profile seen. It is always better to use what the operator might believe to be too few cells than too many cells. When using cells directly from a colony, sufficient cells are transferred by merely touching a colony with a sterile toothpick and agitating this in the 1 mL of bacterial buffer prior to lysate production. The safest option, if time allows, is to follow the procedure from a liquid culture. 5. Because PCR is such a powerful technique that can produce DNA fingerprints by amplifying tiny amounts of DNA, it is unusually sensitive to errors owing to contaminating DNA molecules even at a very low level. This means that not only must pure cultures be used in these analyses, but that all steps must be taken to avoid cross-contamination of unamplified DNA with traces of amplified DNA. Potentially, a single molecule of amplified DNA could be preferentially amplified in a reaction using the same primers used in its formation if the test DNA lacks bonafide primer binding sites. Measures to minimize the chances of such contamination include: a. Physically separated laboratory areas for setting up reactions and for handling amplified reactions. b. Using separatepipeting devices for handling amplified and unamplified DNA as aerosols can lead to the contamination of the pipet barrels. Some people prefer to use positive displacement pipets for this work. c. Always using fresh pipet tips for each step in setting up reactions, particularly when using stock solutions. 6. When several strains are being analyzed together (this is common because unknowns are usually run with reference Iysates), it is easier and safer to make up a premix of all reaction components (10X buffer, 10X primer, 10X dNTP, water, and AmphTuq DNA polymerase) necessary for one more reaction than the number of tests to be performed (this allows for
Mileham
266
pipeting discrepancies and ensures that there is sufficient premix for each test), The use of a premix ensures that each reaction is as similar as possible, and minimizes errors owing to pipetmg small volumes. 7. Mmeral 011is used to overlay the reactions to prevent evaporation. This is most conveniently added using a “dropper” bottle; a single drop (about 50 l,tL) is sufficient to cover the surface of the reaction mix. Always use the same amount of oil m all tubes because differences in the volumes between individual tubes could result in different thermal transfer properties and thus mconsistent results. Mineral oil can either be removed by chloroform extraction or, more conveniently, left m place prior to loadmg reactions on gels. In the latter case, simply add the 10X loading buffer onto the side walls of the reaction tubes following PCR and briefly spin the tubes m a microcentrifuge using the “pulse” button. The reaction/loadmg dye mix can then be removed from the tube by pushing a micropipet through the oil layer in its “expressed” position and then slowly pipeting the sample. Usually, a drop of oil chngs to the outside of the pipet tip. This can either be removed by wiping with a tissue or, more conveniently, by dipping the pipet mto the gel tank briefly before loading. In the latter case, the oil detaches from the pipet tip and disperses on the surface of the electrophoresis buffer. The latest thermal cyclers from Perkin Elmer provide heating for the tube lids. This means that the whole reaction tube now is at the same temperature and makes the use of mineral oil unnecessary.
References 1. Welsh, J. and McClelland, M (1990) Fmgerprmting genomes using PCR with random primers. Nucleic Acids Res. l&7213-7218. 2. Williams, J G. K., Kubelik, A. R , Livak, K. J., Rafalski, J. A , and Tingey, S. V (1990) DNA polymorphisms amplified by arbitrary primers are useful as genetic markers. Nucleic Aads Res. 18,6531-6535. 3 Caetano-Anolles, G., Bassam, B. J., and Gresshof, P. M. (1991) DNA amplification fingerprintmg usmg very short arbitrary oligonucleotide primers Biotechnology 9, 553-556. 4. Akopyanz, N., Bukanov, N. O., Westblom, T. U., and Berg, D E. (1992) PCR-based RFLP analysis of DNA sequence diversity in the gastric pathogen Helicobacter pylori. Nucleic Acids Res. 20,6221-6225.
5. Akopyanz, N., Bukanov, N. 0, Westblom, T. U., Kresovich, S., and Berg, D. E (1992) DNA diversrty among clinical isolates of Helicobacter pylon detected by PCR-basedRAPD fingerprinting Nucleic Acids Res 20,5 137-5 142 6. Cancilla, M. R., Powell, I. B., Hilher, A. J., and Davidson, B. E (1992) Rapid genomic fingerprinting of Luctococcus luctis strains by arbitrarily primed polymerase chain reaction with P32 and fluorescent labels. Appl. Environ. Microbial. S&1772-1775
Identification
of Microorganisms
267
7. Mazurier, S , Van de Giessen, A., Heuvelman, K., and Wernars, K. (1992) RAPD analysis of Cumpylobacter isolates-DNA fingerprinting without the need to purify DNA. Lett Appl. Microblol. 14,260-262. 8. Mazurier, S. I , Audurrer, A., Marqet-Van der Mee, N., Notermans, S., and Wernars, K. A. (1992) A comparative study of randomly amplified polymorphic DNA analysis and conventional phage typing for epidemial studies of Listeria monocytogenes isolates. Res. Mwrobiol. 143,507-512. 9. Mazurier, S. I. and Wernars, K A. (1992) Typing of listena strains by random amplification of polymorphic DNA. Res Microbial. 143,499-505 10. McMillin, D. E. and Muldrow, L. L. (1992) Typing of toxic strains of Clostridium d@cile using DNA fingerprints generated wrth arbttrary polymerase chain reaction primers. FEMS Microbial. Lett. 92,5-10. 11. Menard, C., Brousseau, R., and Mouton, C. (1992) Application of polymerase chain reaction with arbitrary primer (AP-PCR) to strain rdentrfication of Porphyromonas (Bacteroides) gingiualis. FEMS Microbial. Lett. 95, 163-168. 12. Brousseau, R., Samtonge, A., Prefontaine, G., Masson, L., and Cabana, J. (1993) Arbitrary primer polymerase chain reaction, a powerful method to Identify Bacillus thuringlensis serovars and strains. Appl. Environ. Microbial. 59, 114-l 19. 13. Myers, L. E., Silva, S. V P. S., Procumer, J. D., and Little, P. B. (1993) Genomrc fingerprinting of Haemophzlus somnus isolates by using a random-amplified polymorphic DNA assay. .I Clm. Microbial. 31,512-517. 14. Kernodle, S P., Cannon, R. E., and Scandalios, J. G. (1993) Concentration of primer and template quantitatively affects products in random-amplified polymorphic DNA PCR BioFeedback 14,362-363. 15. Ellsworth, D. L, Rittenhouse, K. D , and Honeycut, R. L (1993) Artifactual variation m randomly amplified polymorphic DNA banding patterns. BioTechniques 14,214-217
CHAPTER24 Ligase
Chain
Reaction
George H. Shimer, Jr. and Keith
C. Backman
1. Introduction The ability to detect low numbers of DNA target sequences has been greatly enhanced by the development of geometric amplification techniques, most of which employ enzymatic methods to replicate a target DNA or RNA sequence in an autocatalytic fashion. These techniques have become so widely used that a new journal, PCR Methods and Applications, has arisen in an attempt to consolidate literature relevant to polymerase chain reactions (PCR) (I) and other amplification technologies. Ligase chain reaction (LCR), the method detailed in this chapter, is capable of detecting low levels of a specific nucleic acid sequence in the presence of a vast excess of other DNA sequence information. It was first described in 1989 (2-7) and employment of a thermostable DNA ligase was reported shortly thereafter in conjunction with nonradioactive detection (8). The ability of LCR to distinguish single-base mismatches between the oligonucleotide probes and the target DNA sequence at the point of ligation demonstrates the potential of LCR in sequence-specific detection (9). A schematic of LCR is presented in Fig. 1. The two pairs of complementary oligonucleotide probes A, A’ and B, B’ are selected such that they will hybridize in a contiguous fashion on the target DNA sequence. Only oligonucleotides A’ and B are phosphorylated at their S-ends. This phosphorylation is accomplished chemically during DNA synthesis through the use of a phosphorylating phosphoramidite or enzymatically From* Methods m Molecular Biology, Vol 46’ D/agnostrc Bacterrology Protocols Edited by J Howard and D M Whltcombe Humana Press Inc , Totowa, NJ
269
270
Shimer and Backman A
1’ T
D AB.1
--
A
1’
B 1’
1
I --
AW-T’
A
8’
Fig. 1. LCR: (A) A large molar excess of two sets of complementary oligonucleotide probes are provided (A plus A’, and B plus B’) such that A and B can hybridize adjacently on the desired target strand T’, and A’ and B’ can hybridize adjacently on the complementary strand T. (B) The mixture is denatured at high temperature, separating all species into single strands. (C) Upon cooling, the probes hybridize to any target that may be present. (D) Adjacently hybridized probes are joined by the action of DNA ligase. The products of the reaction (A joined to B, or A’ joined to B’) are functionally equivalent to new target strands (T or T’), effectively doubling the number of targets initially present. The process can be repeated, and such repetitions result in exponential growth in the number of target equivalents. with T4 polynucleotide kinase. In addition, probes A’ and B are usually one or two bases shorter at their 3’-ends than the A and B’ oligonucleotides. This combination of phosphorylation and length of complementary sequence in the probe pairs ensures that only the desired ligation product can be geometrically amplified. A solution containing thermostable DNA ligase, probes, and target DNA is heated and cooled, allowing the target sequence to organize the probes in the correct orientation so that they can be joined by the DNA ligase. The resulting ligation product is an oligonucleotide that can serve as a DNA target for aligning complementary oligonucleotide probes durmg subsequent rounds of temperature cycling. Repetition of this process results in geometric accumulation of ligated product that can be described by the expression:
Ligase Chain Reaction
271 P@,(l
+a)
(1) where P,is the amount of ligated product formed, T, is the initial amount of target, a is the efficiency of each cycle of amplification, and II is the number of cycles. As a result of this amplification, the lower limit of detection for LCR employing just DNA ligase and probes is approximately 1000 target DNA sequences. However, Thermus thermophilus ligase can perform (probably inefficient) template independent ligation reactions (10-12). Once an event of this kind has occurred, the product is indistinguishable from an authentic one. It is therefore essential to perform a no template reaction that exactly mirrors the template dependent amplification. This chapter focuses on communicating the basic knowledge necessary to perform successful LCR assays.
2. Materials All chemicals should be reagent grade or better and solutions made using reverse-osmosis purified HZ0 (see Note 1). 1. A tsmperature cycling machine. 2. Dilution buffer (TE): 10 mM Tris-HCl, 1 mM EDTA, pH 8.0. 3. Oligonucleotide probes, typlcally 15-25 nucleotides in length (see Note 2). These should be punfled either by high-performance liquid chromatography (HPLC) (13) or gel electrophoresis (14) and dissolved at 10-100 pmoles/pL in sterile water or TE (for a single-stranded 15mer, 10 pmoles is about 50 ng). 4. Background DNA: Nuclease-free calf thymus DNA or human placental DNA at 100 ng/pL in TE. 5. Terminal deoxynucleotidyl transferase (TdTase). 6. TdTase buffer (5X concentrate, supplied by the enzyme manufacturer): 0.5M K-cacodylate (pH 7.2), 10 mM CoC&, 1 mM dithiothreitol (DTT). 7. [a-32P]-3’-dATP: 5000 mCtimo1. 8. Sephadex G-50: Swollen and equilibrated in TE according to the manufacturer’s instructions. 9. Thermostable DNA ligase: Cloned thermostable ligase from T. thermophilus HB8 (15-17), available from Epicentre Technologies (Madison, WI) or Molecular Biology Resources Inc. (Milwaukee, WI), The enzyme is stable for 4 wk at 4°C in 1X LCR buffer + 0.5 mM NAD+ (see Note 3). 10. LCR buffer (10X concentrate): 0.4M N-[2-hydroxyethyll-piperazme-N’[3-propanesulfonic actd] (EPPS), pH 7.8 (adjusted with KOH--see Note
272
11. 12. 13. 14. 15. 16. 17. 18. 19. 20.
Shimer
and Backman
3), O.&I4 KCl, O.lM NH&l, O.lM MgCl,, 10 ug/mL acetylated bovine serum albumin (BSA). Store at 4°C (see Note 4). Nicotinamide adenine dinucleotrde (NAD): 10 mM aqueous solution. Stop solution: 98% (v/v) deionized formamide, 2% (v/v) OSM EDTA, 0.005% (w/v) Bromophenol blue, 0.005% (w/v) Xylene cyanol. Tris-Borate-EDTA (TBE) electrophoresis buffer (10X concentrate): 0.8M Tris, 0.8M boric acid, 10 r&I EDTA, pH 8.0. Urea solution: 50% (w/v) in 1X TBE. Acrylamide stock solution: 19% (w/v) acryiamtde monomer, 1% (w/v) bisacrylamide, 50% (w/v) urea m 1X TBE. Store at 4OC in the dark. Ammonium persulfate (APS): 25% (w/v), prepared freshly for each use. TEMED: Electrophoresis grade. Liquid scintrllation counter (LSC) cocktarl: Use an aqueous based cocktarl. Scintillation counter. Speed Vat drying centrrfuge.
3. Methods 3.1. [32P]-Labeling of Oligonucleotides Label either primer B or A’ at the 3’ end (18). 1. Combine 4 uL water, 4 PL 5X TdTase buffer, 1 pL oligonucleotide at 100 pmol/pL, 10 FL [a-32P]-3’-dATP, and 1 j.tL TdTase. 2. Incubate the reactron at 37°C for 1 h. 3. Heat the reaction at 90°C to inactivate the enzyme. 4. To separate the unincorporated [a-32P]-3’-dATP from the labeled oligonucleotide, load the reaction onto a 1-mL Sephadex G-50 column. 5. Wash the column with TE (200 uL at a time). 6. Collect fractions into 1.5~mL Eppendorfs (2 drops per fraction). 7. Add 1 pL of each fraction to 4 mL of LSC cocktarl and count. 8. Pool the fractrons from the first peak that contains labeled oligonucleotide and dry them in a Speed Vat Concentrator. 9. Redissolve the oligonucleotide in 100 pL of water. 3.2. LCR 1. Typically, for a master mrx sufficrent for four reactions (see Note 5), mix 7.3 pL 10X LCR buffer, 4.3 PL 10 mM NAD+, 4.3 pL probe A at 10 pmol/pL, 4.3 j.tL probe A’ at 10 pmol/p.L, 3.7 j.tL probe B at 10 pmol/uL, 4.3 JJLprobeB’ at 10 pmol/pL, 12.0pL [32P]-labeledprobe B at 0.5 pmol/ pL, 19.8 PL H20, and 60.0 j.tL total. 2. Transfer 14.0 JJL of this mixture into each of four siliconized 0.65~mL Eppendorf tubes.
Ligase Chain
Reaction
273
3. Add 3.0 pL of background DNA plus target DNA into two tubes and an equal amount of background DNA solution with no target DNA into the remaining two tubes. 4. Heat the samples to 100°C for 2 min to denature the target DNA and cool to room temperature. 5. Centrifuge to collect the samples in the bottom of the tube and cool on ice for several minutes. 6. Add 1.2 x lOA U (3.0 pL) of the ligase solution (see Note 3) to each tube on ice and overlay the solutions with 10 uL of mineral oil. 7. Briefly centrifuge the reactions at room temperature before transferring them to the temperature cycling apparatus. 8. Cycle the samples between 90 and 55°C for the required number of cycles. With the Coy model 50 TempCycler, use a ramp time of 0.01 s, with soak times of 30 s at the upper and lower temperatures. 9. After the desired number of cycles, briefly centrifuge the samples at room temperature following the 55°C segment of the cycle. 10. Remove
aliquots
(typically,
1.4 pL) into 2.0 pL of stop buffer.
11, Replace the tubes and continue the cycling reactions. 12. Remove samples from subsequent cycles (generally at 3-cycle intervals) in the same manner. 3.3. Detecting and Quantitating the Extent of Ligation 1. Prepare a 10 or 15% acrylamide gel (20 x 40 x 0.04 cm), containing 50% urea and 1X TBE. For a 10% gel, mix equal volumes of the 50% urea stock and the 19:l acrylamide stock and for a 15% gel, use l/4 volume urea solution with 3/4 volume acrylamide stock. Inittate gel polymerization with 1 l.tL each of APS and TEMED per milliliter of gel. 2. Heat the stopped reactions at 95OC for 2-3 min, before loading them on the gel. 3. Resolve the ligated and unligated probes by electrophoresis at 18 W for 45 min. 4. Following electrophoresis, cover the gel in plastic wrap and expose it to X-ray film at -8OOC. 5. After developing the film, the extent of ligation/amplification can be observed. 6. Align the autoradiograph with the ongmal gel and excise the regions representing the ligated and unligated oligonucleotides from each reaction, 7. Place each slice in 4 mL of aqueous-based LSC cocktail and count them. Correct the counts by subtracting the separate backgrounds for the LSC instrument and a zero-ligation control lane from the gel. No correction for quenching is necessary.
274
Shimer
and Backman
Fig. 2. Resolution of LCR products. An autoradiograph of LCR products resolved by denaturing polyacrylamide gel electrophoresis is shown. The position of the ligated and unligated material is indicated; the ligated material runs as a doublet because, under the gel conditions employed, insufficient heat is generated to completely denature the double-stranded ligated product. Lane A is an uncycled control sample with lo6 targets. It demonstrates that doublestranded, unligated probes are not present under these gel conditions. In lanes B through H, the results of LCR with no added targets are shown. In lanes I through P, the results with lo6 added targets are shown. Samples were removed at cycles 15 (I), 18 (B and J), 21 (C and K), 24 (D and L), 27 (E and M), 30 (F and N), 33 (G and 0), and 36 (H and P). 8. Calculate the ratio of counts in the ligated band to the total for that reaction. 3.4. Results 1. The results of a typical LCR assay performed according to the methods just presented is displayed in Fig. 2. As can be observed, the production of a ligated product appears 12 cycles before the appearance of a target independent ligation product in the assay tubes containing zero targets. 2. Figure 3 shows the quantitative results obtained through LSC with varying amounts of initial DNA targets compared with the results obtained in assays with only zero targets. LCR performed in this manner can easily discriminate between lo4 initial DNA targets and zero targets and the amount of ligated product at any given cycle number is dependent on the number of initial DNA targets.
Ligase Chain React ion
c130 $25
-
220 M 15
-
10
-
5
12
0 104 105 106
14
16
275
TARGETS TARGETS TARGETS TARGETS
18
20 22 24 CYCLE NUMBER
26
28
30
Fig. 3. Quantitation of LCR products. LCR was run using various amounts of target. Bands from the gel were excised and analyzed by LX. The percentage of probes joined as a function of cycle number is graphed for various numbers of targets present imtially.
4. Notes 1. The importance of maintaining cleanliness in preparing reagents for use in the LCR, as in any other autocatalytic amplification technology, cannot be overemphasized. Because LCR generates billions of copies of functional DNA targets and is capable of detecting asfew as 1000 targets, the potential of carrying over ligated product to future assays presents an opportunity for false-positive results. Many arttcles dealing with this problem in the context of PCR have appeared in the literature (19-21). Unfortunately, the most common practice of usmg UV irradiation to crosslmk DNA, thereby rendering it inactive as target, is inefficient for short oligonucleotides that present few opportunities for generating photochemtcally induced pyrimidine-pyrtmidine dimers (22). Our experience has been that maintaining a separate working area, actually a separate room, coupled with the use of dedicated, positive displacement pipets equipped with disposable tips and plungers or air displacement pipets equipped with aerosol barrier tips for preparing assays,is adequate in eliminating false positive signals generated from carryover contamination.
276
Shimer and Backman
2. Oligonucleotides ranging in length from 15-35 bases have been successfully used and typically, the two pairs of probes have theoretical melting temperatures between 60 and 70°C. The theoretical melting temperature is calculated using nearest-neighbor thermodynamic values (23-25) under conditions of 80 mA4salt and the concentration of probes used in the LCR (83 niV). A number of computer programs are available, and we have successfully used “OLIGO” (National Biosciences, Hamel, MN). Although the LCR buffer contains other cations such as NH4+ and Mg*+, the melting temperatures calculated with these algorithms agree within several degrees of the measured melting temperatures performed in LCR buffer with the BSA omitted (unpubhshed results). Because T. thermophifus DNA ligase has limited stability at temperatures > 95OC (unpublished results), avoid probe pans with melting temperatures of approx > 75°C. The concentration of the oligonucleotides can be determined spectrophotometrically in combination with dinucleotide and mononucleotide extinction coefficients (26,271, and the OLIGO program can also calculate these. A rough way to estimate oligonucleotide concentration is that 1 unit of absorbance at 260 nm is equivalent to 20 pg/mL. 3. Thermostable DNA ligase from T. thermophilus HB8 was first described by Takahashi et al. (28) and we currently use a cloned source of this DNA ligase (15-17). Thermostable DNA ligase isolated from T. thermophilus HB8 is available commercially from Epicentre Technologies and Molecular Biology Resources. Because the DNA ligase activity assays that we employ (29) and the assayscited by the manufacturers are not equivalent, a comparison of specific activities is not possible. Employing the DNA ligase assay described by Barker et al. (29), we use 1.2 x 10” U of DNA ligase in a 20-PL LCR assay. With the cloned enzyme, this number of units corresponds to a final DNA ligase concentration of 2 ti m the LCR assay, calculated employing the method of Bradford (30), with BSA as a standard, and molecular weight of 76,913 Daltons for T. thermophilus DNA ligase (16). Prepare working ligase solutions by diluting the 50% glycerol concentrated stock enzyme to a concentration of 4 x 10m7U/pL in LCR buffer supplemented with 0.5 rnit4 NAD+. This solution retains full activity for 4 wk when stored at 4°C. 4. We routinely perform LCR employing EPPSasthe buffer becauseit possesses a relatively low ApK, as a function of temperature. However, the LCR also works using Tris (2,4,6,7,9) or MOPS, 3-(N-morpholinopropanesulfonic acid) (unpublished results) but not potassium phosphate (unpublished results) as the buffer. EPPS is titrated with KOH because Na+ is inhibitory to T. thermophilus DNA hgase (28).
Ligase Chain
277
Reaction
5. Because small changes in efficiency of ligation (see Eq. [l]) can lead to large differences in the amount of product formed in this geometric amplification scheme,it is best to mix a single assaysolution consisting of buffer, probes (including the [32P]-labeled probe), and NAD+ that is sufficient to run the desired number of assays.This solution is then aliquoted into separate assays followed by the addrtion of the necessary amounts of background DNA, with and without target DNA, and ligase. Because target independent ligation results in product formation in the absence of any targets, it is necessaryto run controls containing everything but target DNA.
References 1. Saiki, R. K., Schraf, S., Faloona, F., Mullis, K. B., Horn, G. T., Erlich, H. A., and Arnheim, N. (1985) Enzymatic amplification of j3-globin genomic sequences and restriction site analysis of sickle cell anemia. Science 230, 1350-1354. 2. Backman, K. C. and Wang, C.-N. J. (1989) Methodfor Detecting a Target Nucleic Acid Sequence. European Patent Office #A2 0 320 308. 3. Royer, G. P., Cruickshank, K. A., and Morrison, L. E. (1989) Template-Directed Photoligation. European Patent Office #A2 0 324 616 4. Wallace, B. R. (1989) Method of Amplifying and Detecting Nucleic Acid Sequences. European Patent Office #A2 0 336 73 1. 5. Wu, D. Y. and Wallace, R. B. (1989) The ligation amplification reaction (LAR): amplification of specific DNA sequences using sequential rounds of template-dependent ligation. Genomics 4,560-569. 6. Orgel, L. E. (1989) Ligase Bused Amplification Method. World Intellectual Property Organization #WO 89109835. 7. Richards, R. M. and Jones, T. (1989) Method and reagents for detecting nucleic acid sequences. World Intellectual Property Organization, WO 89112696. 8. Bond, S., Carrino, J., Hampl, H., Hanley, K., Rinehardt, L., and Laffler, T. (1990) New methods of detection of HPV, in Papillomaviruses in Human Pathology: Recent Progress in Epidermoid Precancers, vol. 78 (Monsonego, J., ed.), Raven, Paris. 9. Barany, F. (1991) Genetic disease detection and DNA amplification using cloned thermostable ligase. Proc. Natl. Acad. Sci. USA 88, 189-193. 10. Barringer, K., Orgel, L., Wahl, G., and Gingeras, T. R. (1990) Blunt-end and single-stranded ligations by Escherichia coli ligase: influence on an in vitro amplification scheme Gene 89,117-122. 11 Takahashi, M. and Uchida, T. (1986) Thermophilic HB8 DNA hgase: effects of polyethylene glycols and polyamines on blunt-end ligation of DNA. J. Biochem. 100,123-131. 12. Wetmur, J. G. and Davidson, N. (1968) Kinetics of renaturation of DNA. J. Mol. Biol.
31,349-370.
13. Wu, R., Wu, N.-H., Hanna, Z., Georges, F., and Narang, S. (1984) Purification and sequence analysis of synthetic oligodeoxyribonucleotides, in Oligonucleotide Synthesis: A Practical Approach (Gait, M. J., ed.), IRL Press, Oxford, UK, pp. 135-151,
278
Shimer and Backman
14. Ikuta, S., Chattopadhyaya, R., and Dickerson, R. E (1984) Reverse-phase polystyrene column for purification and analysis of DNA oligomers. Anal. Chem. 56, 2253-2256. 15. Backman, K. C., Rudd, E. A., Lauer, G., and McKay, D. (1990) Isolating Thermostable Enzymers European Patent Office #A2 0 373 962. 16. Lauer, G., Rudd, E. A , McKay, D. L., Ally, A., Ally, D., and Backman, K C (1991) Clonmg, nucleotide sequence, and engineered expression of Thermus thermophilus DNA hgase, a homolog of Escherichia coli DNA hgase. J. Bactenol. 173,5047-5053 17. Barany, F. and Gelfand, D. H. (1991) Cloning, overexpression and nucleotide sequence of a thermostable DNA ligase-encoding gene. Gene 109, l-l 1 18 Tu, C -P. D. and Cohen, S. N. (1980) 3’-End labeling of DNA with [a-32P]cordycepm5’-triphosphate. Gene 10, 177-183. 19 Kwok, S and Hlguchi, R (1989) Avoiding false posmves with PCR Nature 339, 237-238 20 Sarkar, G. and Sommer, S. S. (1990) Shedding light on PCR contamination. Nature 343,27. 21. Kitchm, P. A., Szotyroi, 2 , Fromholc, C., and Almond, N. (1990) Avoidance of false positives. Nature 344,201. 22. Sarkar, G. and Sommer, S. S. (1991) Parameters affecting susceptibihty of PCR contammation to UV inactivation Biotechniques 10, 589-594. 23. Schildkraut, C. and Lifson, S. (1965) Dependence of the melting temperature of DNA on salt concentration Biopolymers 3,195-208. 24. Breslauer, K. J., Frank, R , Blocker, H , and Marky, L. A. (1986) Predicting DNA duplex stability from the base sequence. Proc Natl. Acad. Sci. USA 83, 3746-3750. 25. Frier, S. M., Kierzek, R , Jaeger, J. A., Sugimoto, N., Caruthers, M. H., Neilson, T., and Turner, D H. (1986) Improved free-energy parameters for predictions of RNA duplex stability. Proc. Natl. Acad Sci. 83,9373-9377. 26. Fasman, G. D (ed ) (1975) Handbook of Biochemistry and Molecular Btology, Vol. I: Nucleic Acids CRC, Cleveland, OH. 27 Studier, F. W (1969) Conformational changes of single stranded DNA. J. Mol Biol. 41, 189-197. 28. Takahashi, M., Yamaguchi, E., and Uchida, T. (1984) Thermophilic DNA ligase. J. Biol. Chem. 259, 10,041-10,047 29. Barker, D. G., Johnson, A. L., and Johnson, L.H. (1985) An improved assay for DNA ligase reveals temperature-sensitive activity in cdc9 mutants of Saccharomyces cerevisiae. Mol. Gen. Genet. 200,458-462.
30. Bradford, M. M. (1976) A rapid and sensitive method for the quantitatron of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Btochem. 72,248-254.