ADVANCES IN
Applied Microbiology VOLUME 36
This Page Intentionally Left Blank
ADVANCES IN
Applied Microbiology Ed...
24 downloads
1016 Views
18MB Size
Report
This content was uploaded by our users and we assume good faith they have the permission to share this book. If you own the copyright to this book and it is wrongfully on our website, we offer a simple DMCA procedure to remove your content from our site. Start by pressing the button below!
Report copyright / DMCA form
ADVANCES IN
Applied Microbiology VOLUME 36
This Page Intentionally Left Blank
ADVANCES IN
Applied Microbiology Edited by
SAUL L. NEIDLEMAN Vacaville, California
ALLEN I. LASKIN Somerset, New Jersey
VOLUME 36
Academic Press, Inc. Horcourt Brace Jovanovich, Publishers
San Diego New York Boston London Sydney Tokyo Toronto
This book is printed on acid-free paper. @ Copyright 0 1991 BY ACADEMIC PRESS, INC. All Rights Reserved. No part of this publication may be reproduced or transmitted in any form or by any means, electronic or mechanical, including photocopy, recording, or any information storage and retrieval system, without permission in writing from the publisher.
Academic Press, Inc. San Diego, California 92101 United Kingdom Edition published by ACADEMIC PRESS LIMITED 24-28 Oval Road, London NWI 7DX
Library of Congress Catalog Card Number:
ISBN 0-12-002636-8 (alk. paper)
PRINTED IN THE UNITED STATES OF AMERICA 91929394
9 8 7 6 5 4 3 2 1
59- 13823
CONTENTS Microbial Transformations of Herbicides and Pesticides
DOUGLAS J . CORKAND JAMES P . KRUEGER I. Introduction ....................................................... I1. History of Microbial Conversions..................................... I11 Entry and Movement of Herbicides in the Environment ................ IV Taxonomy of Degradative Organisms ................................. V. Kinetics of Biodegradation by Microorganisms ........................ VI . Factors Affecting Biodegradation Kinetics ............................. VII . Biochemical Mechanisms of Aerobic Chloroaromatic Metabolism ....... VIII . Cometabolism ...................................................... IX Biochemical Mechanisms of Anaerobic Aromatic Metabolism ........... X. Molecular Biology of Degradative Microorganisms ..................... XI . Molecular Biology of Chloroaromatic Degradation ..................... XI1 Dicamba Biodegradation: A Case Study ............................... XI11 Growth Kinetics in Liquid Culture ................................... References .........................................................
. .
.
. .
1 2 4 5 7 10 21 29 32 36 37 44 49 63
An Environmental Assessment of Biotechnological Processes
M . S . THAKUR. M . J . KENNEDY.AND N . G . KARANTH I . Introduction ....................................................... I1. Ecological Consequences of the Release of Microorganisms ............. 111 Risk Assessment .................................................... IV Case Studies ....................................................... V. The Regulation of Biotechnological Processes ......................... VI . Conclusions ........................................................ References .........................................................
. .
67 69 73 75 80 82 83
Fate of Recombinant Escherichia coli K-12 Strains in the Environment
GREGGBOGOSIANAND JAMES F. KANE
. Introduction .......................................................
I I1. I11. IV. V. VI .
Construction and Properties of pBR322 ............................... Fate of E. coli and Related Organisms in Water ........................ Fate of E. coli and Related Organisms in Soil .......................... Fate of E . coli and Related Organisms in Sewage ....................... Fate of E . coli K-12in the Mammalian Intestinal Tract .................. V
87 89 100 104 108 113
vi
CONTENTS
.
VII Alternative Detection Methods for Recombinant Organisms in the Environment ....................................................... VIII . Conclusions ........................................................ References .........................................................
120 121 123
Microbial Cytochromes P-450 and Xenobiotic Metabolism
F . SIMASARIASLANI
. . . .
I Introduction ....................................................... I1 General Properties of Cytochromes P-450 ............................. 111 Microbial Cytochromes P-450........................................ IV Conclusion ......................................................... References .........................................................
133
134 139 173 174
Foodborne Yeasts
T . DEAK I. I1. I11. IV . V. VI .
Introduction ....................................................... Characteristics and Classification of Yeasts ............................ Ecology of Yeasts ................................................... Specific Habitats .................................................... Methods of Isolation and Enumeration ................................ Methods of Identification ............................................ References .........................................................
179 180 183
194 228 234 258
High-Resolution Electrophoretic Purification and Structural Microanalysis of Peptides and Proteins
ERIKP . LILLEHOJ AND VEDPAL s. MALIK I . Introduction ....................................................... I1. Polyacrylamide Gel Electrophoresis .................................. 111. Structural Analysis of Proteins Directly Eluted from One- and Two-Dimensional Polyacrylamide Gels ............................... IV . Structural Analysis of Proteins Electroblotted from One- and Two-Dimensional Polyacrylamide Gels ............................... V. Electrophoretic Micropreparative Procedures as Part of a Comprehensive Purification Strategy ................................................
280 281 290 303 315
CONTENTS
vii
VI . Applications of Microsequence Analysis of ElectrophoreticallyPurified Proteins ........................................................... VII . Quality Control of Recombinant Proteins .............................. VIII Prospective Directions .............................................. References .........................................................
318 323 327 329
INDEX ................................................................... CONTENTSOF PREVIOUSVOLUMES ...........................................
339 361
.
This Page Intentionally Left Blank
Microbial Transformations of Herbicides and Pesticides DOUGLASJ. CORK*AND JAMES P. KRUEGER~ *Department of Biology Illinois Institute of Technology Chicago, Illinois 60616 'Fitch, Even, Tabin and Flannery Chicago, Illinois 60603 I. Introduction 11. History of Microbial Conversions 111. Entry and Movement of Herbicides in the Environment
IV. Taxonomy of Degradative Organisms V. Kinetics of Biodegradation by Microorganisms VI. Factors Affecting Biodegradation Kinetics A. Structure B. Solubility C. Adsorption/Desorption D. Adaptation Rate E. Moisture, Temperature, and Nutrients F. Rates of Chloroaromatic Degradation VII. Biochemical Mechanisms of Aerobic Chloroaromatic Metabolism A. Demethylation B. Dehalogenation C. Ring Cleavage D. Chlorocatechol Metabolism VIII. Cometabolism IX. Biochemical Mechanisms of Anaerobic Aromatic Metabolism X. Molecular Biology of Degradative Microorganisms XI. Molecular Biology of Chloroaromatic Degradation Cloning of Pseudomonas Genes in the Escherichia coli Vector, pUC XII. Dicamba Biodegradation: A Case Study XIII. Growth Kinetics in Liquid Culture A. Effect of Dicamba Concentration B. Dependence of Activity on pH C. Effect of Temperature D. Growth Kinetics in Soil E. Growth Chamber Study F. Field Study References
I. Introduction
The use of xenobiotics has increased during recent decades. Herbicide and pesticide usage has benefited modern society by improving the quality and quantity of the world's food supply, while keeping the cost 1 ADVANCES IN APPLED MICROBIOLOGY. VOLUME 36 Copyright 0 1991 by Academic Press, Inc. All rights of reproductionin any form reserved.
2
DOUGLAS J. CORK AND JAMES P. KRUEGER
of that food supply reasonable. However, increased usage of chemicals has resulted in environmental concerns. Microorganisms in soil and water can transform many synthetic organic chemicals. The development and integration of microbes or their activities with the use of herbicides and pesticides can enhance the beneficial effects of chemical usage while eliminating some of the environmental concerns. Microbes can provide a means to eliminate unwanted residues from the environment, protect previously susceptible crops from herbicide or pesticide damage, and provide a source of genetic material for the development of herbicide-resistant crops or pesticide-producing plants. A fundamental understanding of a microbe’s degradative kinetics under various conditions, its biochemical systems, and its molecular biology are vital in maximizing the potential benefits of its use. II. History of Microbial Conversions
Microbial transformations have long been beneficial to mankind. More recently, these transformations have had environmental and chemical applications. Over billions of years, microorganisms have evolved an extensive range of enzymes, pathways, and control mechanisms in order to degrade a wide array of aromatic compounds. Microorganisms have been isolated that can degrade benzene (Dagley et a]., 1964), phenol (Feist and Hegeman, 1969), naphthalene (Davis and Evans, 1964), salicylate (Chakrabarty, 1972), toluene (Chakrabarty, 1976), and p- and m- hydroxybenzoate (Johnson and Stanier, 1971). There are a few instances in which catabolic pathways have evolved that are specific for chlorinated substrates (Dorn and Knackmuss, 1978a; Gibson, 1978). Haloaromatic-assimilating strains have been obtained by (1)enrichments from nature, (2) in vivo genetic manipulations, and (3) in vitro genetic manipulations. Enrichments have been used to show the involvement of microbes in the degradation of synthetic compounds such as 2 &dichlorophenoxyacetic acid (2,4-D) (Bollag et al., 1968; Loos, 1975) 2,4,5-trichlorophenoxyacetic acid (2,4,5-T) (Rosenberg and Alexander, 1980), atrazine (Kaufman and Kearney, 1970),and some isomers of polychlorinated biphenyls (Ahmed and Focht, 1972).Pure cultures of bacteria that have been enriched for, isolated, and characterized can utilize 2chlorotoluene, 3-chlorotoluene, 3,4-dichlorotoluene, 2,4-dichlorobenzoate, 3 &dichlorobenzoate, and 5-chlorosalicylate as sole carbon and energy sources for growth (Vandenbergh etal., 1981; Pierce etal., 1983; Crawford e t a / . , 1979). The first report of in vivo construction of a catabolic pathway for the mineralization of chloroaromatic compounds was conducted with
TRANSFORMATIONSOF HERBICIDES AND PESTICIDES
3
Pseudomonas sp. strain B13 and Pseudomonas putida mt-2, using 4chlorobenzoate (Reineke and Knackmuss, 1978). Strains were isolated that could degrade 3- and 4-chlorobenzoate. Similar methods have been used by others to develop strains that grow on 3-chlorobenzoic acid (Chatterjee et al., 1981) and 3,5-dichlorobenzoic acid (Chatterjee and Chakrabarty, 1982). Techniques such as plasmid-assisted molecular breeding have been used to develop a microbe capable of degrading 2,4,5-T (Kellogg et al., 1981). Advances in technologies associated with molecular biology have resulted in the construction of haloaromatic-degrading organisms. Organisms have been constructed that have the ability to degrade chlorosalicylate and chlorobenzoate (Lehrbach et al., 1984). For example, a strain of Pseudomonas sp. has been manipulated to completely mineralize dichloronaphtalene or convert it to the corresponding dichlorosalicylate (Durham and Stewart, 1987). The bioremediation industry is an excellent example of the application of degradative organisms to environmental cleanup. Table I lists TABLE I COMPANIES DEVELOPING XENOBIOTIC-DEGRADING MICROBES Company/location
Application
Advanced Mineral Technology/Golden, Colorado Air Products and Chemicals/Trexlertown, Pennsylvania Amgen/Thousand Oaks, California Battelle/Columbus, Ohio Bioclean/Bloomington, Minnesota BiotechnicalCambridge, Massachusetts Chemical Waste ManagemenKhicago, Illinois Celgene/Summit, New Jersey Ciba-Geigy/Greensboro, North Carolina Detox/Dayton, Ohio Dow/Midland, Michigan Ecova/Redmond, Washington Flow/Orange, California G.E./Schenectady, New York Genex/Gaithersburg, Maryland Groundwater Technology/Norwood, Massachusetts Homestake Mining/Reno, Nevada IGTKhicago, Illinois
Heavy metals Organics Trichloroethylene Chlorinated aromatics Pentachlorophenol Phenol Toxic waste Chlorinated aromatics Herbicides Organics Chlorophenols Solvents Sewage Polychlorobiphenyl Toxic waste Solvents Cyanide Coal Tars, sulfides, chlorinated aromatics Dicamba Herbicides Chlorinated aromatics Herbicides
IITRUChicago, Illinois Monsanto/St. Louis, Missouri Occidental ChemicaUGrand Island, New York Sandoz Crop Protection/Des Plaines, Illinois
4
DOUGLAS J. CORK AND JAMES P. KRUEGER
some of the companies involved in bioremediation and their applications. Others have used degradative organisms as a source of genetic material for the development of herbicide-resistant plants. Glyphosate and bromoxynil degradative genes have been transferred via Agrobacterium tumefaciens to produce resistant tobacco and other plant species (Stalker et a]., 1988).
Ill. Entry and Movement of Herbicides in the Environment
Herbicides enter the soil and water as a result of direct. application and runoff from plant surfaces, as an integral part of the weeds killed by them, via aerial transport and deposition because of earlier volatilization, via wind drift or wind-blown soil particles with adsorbed residues, from spillage, from water used to clean equipment, and from disposal of packing. Figure 1 illustrates the routes of entry of herbicides into the Aerial transport spillage, washing, and disposal of containers
Wind-drift Photodecomposition
-, mineralorganic
Transport in soil
s
.*-
Desorption and diffusion
Chemical transformation
Microbial transformation
Leaching
FIG.1. Entry and transformationof herbicides in the environment (Torstensson,1988).
TRANSFORMATIONSOF HERBICIDES AND PESTICIDES
5
environment and some of the transformations that take place. Once in the environment, herbicides are subject to photochemical, chemical, and biological effects capable of causing transformations in the compound’s chemical structure. Biological and nonbiological processes work together to degrade herbicides. In nature it is difficult to distinguish between the two modes of degradation in most cases (Ashton, 1982).Though some reactions are clearly nonbiological, such as photolysis, others, such as hydrolysis, can be either nonbiological or biologically mediated. Examples of reactions that can transform herbicides in the environment are shown in Table 11. Mineralization or complete biodegradation of an organic molecule in water and soil is almost always a consequence of microbial activity. Few abiotic mechanisms in nature totally convert organic compounds to inorganic products (Alexander, 1981).Whether or not a herbicide is adsorbed, absorbed, activated, inactivated, persistent, short-lived, mobile, stationary, or will eventually constitute a residue problem may depend upon its transformation by soil microorganisms. The microbial metabolism of herbicides can be classified as indicated in Table 111. IV. Taxonomy of Degradative Organisms
Microbes that are natural components of soil and water environments are potential agents for the biological transformations of aromatic compounds that enter the ecosystem. Microorganisms usually occupy a TABLE I1
REACTIONSTHATCANTRANSFORM CHEMICALS IN THE ENVIRONMENT Category Photo1ysis Hydrolysis Oxidation Dehalogenation Deamination Decarboxylation Methyl oxidation Hydroxylation Sulfur oxidation Reduction Oxime metabolism Ester cleavage C-N cleavage C-S cleavage C-Hg cleavage S-N cleavage
Example Aldrin Diazinon 2,4-D
Chlorophenols Aniline Bifenox Isopropylnaphtha Dicamba Aldicarb DDT Aldicarb Malathion Alachlor Benthiocarb Ethylmercury Oryzalin
Reference Matsumura (1982) Matsumura (1982) Sandrnann and Loos (1988) Steiert et al. (1987) Zeyer et al. (1985) Leather and Foy (1977) Yoshida and Kojima (1978) Smith (1974) Andrews et al. (1971) Pfaender and Alexander (1972) Jones (1976) Paris eta). (1975) Tiedje and Hagedorn (1975) Ishikawa et al. (1976) Kimura and Miller (1964) Golab et al. (1975)
6
DOUGLAS J. CORK AND JAMES P. KRUEGER TABLE 111 GENERAL CLASSIFICATION OF THE MICROBIAL METABOLISM OF HERBICIDES"
Reaction type Enzymatic
Nonenzymatic
a
Description Incidental metabolism: herbicide does not serve as an energy source Metabolism by generally available enzymes Metabolism due to generally present broad-spectrum enzymes (hydrolases, oxidases, etc.) Metabolism due to specific enzymes present in many microbe species Analog-induced metabolism (cometabolism) Metabolism by enzymes utilizing substrates structurally similar to pesticides Catabolism: herbicide serves as an energy source Herbicide or part of the molecule is readily available source of energy for microbes Herbicide is not readily utilized; some specific enzyme must be induced Detoxification metabolism Metabolism by resistant microbes Participation in photochemical reactions Contribution through pH changes Contribution through production of inorganic and organic reactants Contribution through production of cofactors
From Matsumura (1982).
volume of less than 0.1% of the soil, but are responsible for numerous transformations that cycle elements and energy in nature. Microbial densities may be as high as lo9 per gram of soil, with a biomass up to several tonnes per hectare (Torstensson, 1988). The microbial population exists in a dynamic equilibrium formed by interactions of abiotic and biotic factors that can be altered by modifying environmental conditions. Microbes are able to degrade a wide variety of chemicals, from simple polysaccharides, amino acids, proteins, lipids, etc. to more complex material such as plant residues, waxes, and rubbers. Some important degradative bacteria that occur in water and soil environments are described in Table IV. Pseudomonas strains are extremely common and are often the predominant members of the populations selected from natural sources, such as soil, polluted waters, and sediments, for their ability to grow on single compounds as sole carbon sources (Ribbons and Williams, 1982). Pseudomonas strains are facultative aerobes, as some can use nitrate as a terminal acceptor for a limited number of substrates. Aerobically grown pseudomonads can be described as Gram-negative unicellular rods,
TRANSFORMATIONSOF HERBICIDES AND PESTICIDES
7
TABLE IV CLASSIFICATION OF DEGRADATIVE BACTERIA THATOCCUR IN WATER AND SOIL' ~~~
Description
Family
Gram-negativeaerobic rods and cocci
Facultatively anaerobic Gram-negativerods Endospore-forming Grampositive rods and cocci ~
~
~
~~~~~
~
~
Genus
Pseudomonadaceae
Pseudomonas, Xanthomonas
Azotobacteraceae Rhizobiaceae Methylococcaceae Neisseriaceae -b Enterobacteriaceae
Azotobacter Rhizobium, Agrobacterium Methylomonas, Methylococcus Momxella, Acinetobacter Alcaligenes, Flavobacteriurn Escherichia, Enterobacter, Serratia, Proteus Aerornonas Bacillus
Vibrionaceae Bacillaceae ~
From Bergey's Manual of Systematic Bacteriology (1984). Affiliation uncertain.
with the long axis straight or curved, but not helical. They do not form spores, stalks, or sheaths. The energy-yielding metabolism is respiratory, never fermentative or photosynthetic. All use molecular oxygen as a terminal oxidant, except for several that can use denitrification as an alternative anaerobic respiratory mechanism. All are chemolithotrophs, though some are facultative chemolithotrophs that use Hzas an energy source (Stanier et al.,1966).The genus falls into five main groups by the criterion of ribosomal RNA homology [Table V). The predominant biological feature of the pseudomonads is their biochemical diversity [Stanier et a]., 1966). Strains of Pseudomonas spp. are capable of utilizing over 100 different compounds. Pseudomonas spp. have been reported as being capable of growing on alkanes, mono- and polycyclic hydrocarbons, salicylate, heterocyclics, phenolics, and aliphatic and aromatic halogenated compounds (Ribbons and Williams, 1982).Table VI lists some of the catabolic activities of Pseudomonas spp. and other degradative organisms. V. Kinetics of Biodegradation by Microorganisms
Microorganisms grow in a wide spectrum of physical and chemical environments. Growth of microorganisms and other physiological activities are a response to the physiochemical environment. Growth rate, like a chemical reaction rate, is a function of chemical concentration.
DOUGLAS J. CORK AND JAMES P. KRUEGER
8
TABLE V CLASSIFICATION OF PSEUDOMONAS SPECIES INTO RNA HOMOLOGY GROUPS" rRNA homology group ~
% GC in DNA ~
67 59-63 61-62 61-66 63-64 66 67-68 65 69 69 67 62 62-64 66-67 66 67 66-68
1
2
3 4 5
a
Species
~~
P. aeruginosa P. fluorescens P. putida P. stutzeri P. rnendocina P. alcaligenes P. cepacia P. caryophylli P. pseudomallei P. mallei P. acidovorans P. testosteroni P. facilis P. diminuta P. vesicularis P. rnaltophilia Xanthomonas sp.
From Ribbons and Williams (1982).
The relationship between growth rate and substrate concentration can be described by the Monod model: where p is the specific growth rate, pmaxis the maximum specific growth rate, S is the substrate concentration, and Ks is a constant equal TABLE VI BACTERIA THATCANDEGRADE CHLOROAROMATIC COMPOUNDS Organism
Substrate
Reference
Alcaligenes denitrificans Pseudomonas cepacia Bacillus circulans Alcaligenes sp. Pseudornonas sp. Pseudomonas putida Bacillus brevis Alcaligenes eutrophus Flavobacterium sp. Arthrobacter sp. Pseudomonas sp. Pseudomonas maltophilia
2&Dichlorobenzoate 2.4.5-T Metolachlor 1,3-Dichlorobenzene Atrazine 3-Chlorobenzoate 5-Chlorosalicylate 2,4-D Pentachlorophenol 4-Chlorobenzoic acid 3,5-Dichlorobenzoate Dicamba
Van Den Tweel et 01. (1987) Chatterjee et al. (1982) Saxena et a]. (1987) DeBont et al. (1986) Behki and Khan (1986) Chatterjee et al. (1981) Crawford et al. (1979) Perkins and Lurquin (1988) Steiert et al. (1988) Marks et 01. (1984) Reineke and Knackmuss (1980) Fujimoto and Cork (1991)
TRANSFORMATIONSOF HERBICIDES AND PESTICIDES
9
to the substrate concentration when p = 0 . 5 ~ The ~ ~specific . growth rate can be calculated by the following equation: fd
= In 2Ip
where td is the time required to double cell mass or cell number. A graphic representation of the Monod model is shown in Fig. 2. Some physical and biological meaning can be attributed to the two constants in the Monod model. The value of P m m is the maximum specific growth rate in a given chemical medium at specified temperature and pH. The value of K, is inversely proportional to the affinity the microorganism has for the substrate (Wang et al., 1979). When the concentration of a utilizable organic substrate is considerably in excess of the bacterium’s K, value, logarithmic or exponential kinetics of growth occurs. If the cell density is so great that the quantity of substrate is insufficient to support a significant increase in cell mass, then the kinetics of disappearance of organic chemicals present at high levels (in excess of K,) is zero order, or linear with time. Two patterns of kinetics can be envisioned when a single bacterial species is provided with a mineralizable substrate at concentrations below the K, value. In the first pattern, there is no increase in cell number either because the concentration of substrate is too low to
Substrate Concentration FIG.2. The Monod model for microbial growth.
10
DOUGLAS J. CORK AND JAMESP. KRUEGER
support growth, or because the initial cell number is too large, relative to the quantity of organic compound, to permit an appreciable increase in cell mass. At constant biomass and limiting substrate levels, the rate is proportional to the concentration of substrate; this is typical of firstorder kinetics. In the second pattern, few cells of the active species are present initially. Under these conditions the bacteria will grow, but at a rate that falls constantly with diminishing substrate concentrations. A growth pattern in which there is an increasing cell number encountering a decreasing nutrient resource resembles the classical logistic growth curve (Alexander, 1985). The kinetics expected at different chemical concentrations and cell numbers are shown in Fig. 3. The shapes of the curves for chemical disappearance that coincide with these kinetics are illustrated in Figs. 4 and 5. VI. Factors Affecting Biodegradation Kinetics
The rate of microbial decomposition of a chemical in soil and in liquid medium is mediated by three factors: (1)the availability of the chemical to the microorganism or enzyme system that can degrade it, (2) the quantity of these microorganisms or enzyme systems, and (3) the
Monod nithout growtt
First order
/
order
Monod
Logarithmic
(with growth)
Initial Substrate Concentration
FIG. 3. Kinetic models as a function of initial substrate concentrationand bacterial cell density (Alexander, 1985).
TRANSFORMATIONSOF HERBICIDES AND PESTICIDES
11
Time FIG. 4. Disappearance curves for chemicals that are mineralized as related to firstorder, zero-order, and Monod growth kinetic models (Alexander, 1985). 1
Time
FIG.5. Disappearance curves for chemicals that are mineralized as related to logistic, logarithmic, and Monod kinetic models (Alexander, 1985).
12
DOUGLAS J. CORK AND JAMES P. KRUEGER
activity level of these organisms or enzyme systems. The availability of a chemical to a microbial population in soil or liquid medium is determined by the physical properties of that chemical. The chemical’s structure and its resulting solubility in water, dissolution rate, and adsorption/desorption characteristics in soil are properties that determine availability (Bollag, 1974,Goulding et a]., 1988;Alexander, 1981;Stucki and Alexander, 1987;Ogram et a]., 1985).Biodegradation rates of available organic substrates have been shown to be directly related to microbial biomass and the activity of that biomass (Anderson, 1984).Environmental factors such as pH, temperature, soil moisture level, and soil composition are important regulators of microbial activity, and therefore of the degradation rate of a chemical (Vaishnav and Babeu, 1987). A. STRUCTURE The introduction of substituents on a benzene ring influences its degradation considerably. Minor alterations in structure frequently cause a drastic change in the susceptibility of such compounds to biotransformations. Introduction of polar groups such as OH, COOH, and NH2 may provide the microbial system a site of attack. Halogen or alkyl substitutions tend to make the molecule more resistant to biodegradation (Bollag, 1974).Degradation rates of chlorine-substituted aromatic compounds are dependent on the position of the substituents and the degree of substitution (Goulding et a]., 1988). Table VII shows that monochlorosubstituted isomers were generally degraded more rapidly than di- or trichloro derivatives. Monochlorophenols were more rapidly assimilated than monochlorobenzoic acids. Both 3,4- and 3,sdichlorophenols were more difficult to degrade than 2,3-,2,5-, and 2,6-dichlorophenols. Dichlorobenzene isomers were completely degraded whereas dichlorobenzoic acids were less efficiently removed due to the position of the chlorines.
.
B SOLUBILITY In general, compounds with low water solubility tend to be more resistant to microbial degradation than are compounds of higher water solubility. Chemicals having low solubilities in water may not provide sufficient carbon to support microbial growth. Low ambient concentrations of substrate may result in a decreased penetration rate into the cell and too few molecules per unit time to allow enough energy for the organism to maintain itself (Alexander, 1981).To mineralize or grow on substrates having low solubilities in water, microorganisms may require
TRANSFORMATIONS OF HERBICIDES AND PESTICIDES
13
TABLE VII DEGRADATION RATESAND PERCENTAGE REMOVALOF CHLOROSUBSTITUTED AROMATIC COMPOUNDSO Substrate
Removal (Yo)
2-Chlorobenzoic acid 3-Chlorobenzoic acid 2-Chlorophenol 4-Chlorophenol 2,6-Dichlorobenzoic acid 3,5-Dichlorobenzoic acid 2,6-Dichlorophenol 2,3-Dichlorophenol 2,5-Dichlorophenol 3,4-Dichlorophenol 3,5-Dichlorophenol l&Dichlorobenzene 1,3-Dichlorobenzene 1,4-Dichlorobenzene
100 100 100 100 52 81 100
100 100 44 52 100 100 100
Removal rate (mg/liter/hour)
Incubation time (hours)
4.10 1.57 5.10 4.80 2.57 1.65 4.80 4.60 2.10 0.53 1.04 NDb ND ND
96 96 96 96 168 168 72 72 144 168 168 96 96 96
From Goulding et al. (1988).
Rate not calculated.
some physiological adaptations. Bacteria may facilitate the uptake of poorly soluble compounds by producing emulsifiers [Guerra-Santos et ~ l .1984). , Modification of the cell surface may increase its affinity for hydrophobic substances and thus facilitate their absorption (Neufeld et QI., 1980) Organisms may grow only at the expense of the compound dissolved in solution. Therefore, the rate of dissolution of such chemicals would govern the rate of their biodegradation [Stucki and Alexander, 1987). C. ADSORPTION/DESORPTION The binding of xenobiotics to soil may involve various interactions such as ionic or covalent bonds, van der Waals forces, hydrogen bonds, charge transfer, and hydrophobic bonds. Each contributes not only to the binding but also to the extent of the subsequent release (Dec and Bollag, 1985). In most cases, herbicides and pesticides reversibly partition between the soil solution and soil organic matter (Karickhoff, 1981). The adsorption/desorption characteristics of a chemical in soil may determine its availability to degradative organisms. Comparison of the half-lives of the chemical with data describing its adsorption showed that there was a direct correlation between the amount of
14
DOUGLAS J. CORK AND JAMES P. KRUEGER
chemical in solution and the rate of dissipation (Torstensson, 1988). When pesticides such as paraquat and diquat are intercalated into clay, they are isolated from the degrading organisms and protected form intracellular degradation (Burns and Audus, 1970;Weber and Coble, 1968).Other authors have indicated that pesticide sorption might either enhance or decrease microbial degradation rates in soil (Ogram et al., 1985).Because bacteria themselves may be sorbed, it is conceivable that bacteria and herbicides may be sorbed on adjacent locations on the soil surface, thereby facilitating the scavenging of the chemical by the sorbed bacteria. Three models have been proposed by Ogram et al. (1985)to describe the effects of sorption of bacteria and 2,4-D on the biological degradation rates of 2,4-D. The sorption of 2,4-D and bacteria were characterized by the following equations: For 2,4-D, S = KDC For bacteria,
Ns = KBNW where S and Ns are the amounts of 2,443 and bacteria, respectively, sorbed on soil; KD and KB are the respective sorption coefficients; and C and Nw are the solution-phase concentrations of 2,4-D and bacteria, respectively. The first model states that only 2,4-D in solution is degraded and that it is degraded only by bacteria in solution. The model is expressed as follows: dTldt = - K,CN,W where dTldt is the change in mass of pesticide over time, K, is the degradation rate coefficient, and W is the volume of water in the system. Model 2 states that bacteria in a given phase only degrade 2,4-D in that phase. This model is expressed as follows: dTldt =
-
(K,CN,W
+ K,,SN,M)
where K,, is the rate coefficient for degradation in sorbed phase and M is the mass of soil. The third model states that only 2,4-D in solution is available for degradation but bacteria in both sorbed and solution phases would be capable of degrading 2,4-D. This model is as follows: dTldt = - (K,CN,W
+ KswCNsM)
where K,, represents the combined effects of the rates at which sorbed bacteria encounter 2,4-D, take it up, and then mineralize it to COz.
TRANSFORMATIONS OF HERBICIDES AND PESTICIDES
15
If model 1 is correct, then K, (degradation rate coefficient) should be constant with varying soil/solution ratios and for different soils. For 2,4-D, K , increased with increasing soil/solution ratios. As the soil solution ratio increases, sorption of both bacteria and 2,4-D should increase. The increase in K, with increasing soil/solution ratios suggests that sorbed 2,4-D was being degraded or that sorbed bacteria may have been degrading 2,4-D. If model 2 accurately describes the situation, then K,, values (rate coefficient for degradation in sorbed phase) should be the same for all soils. As sorption of both 2,4-D and bacteria increased in various soils, the calculated values of K,, decreased, suggesting there may have been at least partial protection of 2,4-D from degradation when it was sorbed. , and K,, (combined degradation rate If model 3 is correct, then K coefficient) will be constant with varying soil types and soil/solution ratios. This model describes the data for 2,4-D. Sorbed 2,443 was completely protected from biological degradation and sorbed and solutionphase bacteria degraded solution-phase 2,4-D with almost equal efficiencies (Ogram et a]., 1985).
D. ADAPTATION RATE An understanding of adaptations of microbial communities to organic chemical exposure is critical for predicting chemical degradative ratios. The mineralization of many organic compounds by microorganisms is often preceded by an acclimation period. The acclimation period is the time interval during which biodegradation is not detected. The acclimation time required for a microbial population to degrade a chemical can be influenced by the rate and frequency of exposure to that chemical. Soil microorganisms have been shown to degrade 2,4-D more rapidly after repeated exposure to 2,4-D (Torstensson, 1988).A graphic representation of the effects of repeated applications of a herbicide is shown in Fig. 6. High or low concentrations of a chemical may increase the acclimation period. The acclimation period for degradation in soil of the herbicide picloram increased as its concentration increased (Grover, 1967).High concentrations of a chemical may be toxic or inhibitory to the microbial populations present. At low concentrations of the compound, the long acclimation may be the result of slow growth of the mineralizing organisms or low concentrations of substrate (Wiggins and Alexander, 1988). Additionally, evidence exists that one compound may shorten the acclimation period needed before another is degraded. The acclimation of sewage microflora to 3-chlorobenzoate or 4-
16
DOUGLAS J. CORK AND JAMES P. KRUEGER
Time FIG.6. Effect of repeated herbicide application on acclimation (Torstensson, 1988).
chlorobenzoate reduced the acclimation time for mineralization of other monosubstituted aromatic hydrocarbons (Haller, 1978). The adaptation process may involve one or a combination of (1)induction or derepression of enzymes specific for degradation pathways of a particular compound; (2) a random mutation in which new metabolic capabilities are produced, allowing degradation that was previously not possible; or (3) an increase in the number of organisms in the degrading population (Aelion et al., 1987). An induction signal may come from the chemical substrate itself or from other chemicals present. It has been reported that the phenylurea herbicide monuron could induce an acylamidase in Bacillus sphaericus that is capable of hydrolyzing the herbicide linuron, although monuron itself is not a substrate (Engelhardt et al., 1973). An acclimation period may result from the time required for the appearance of a new genotype after a mutation or genetic exchange occurring during exposure to the compound. For example, adaptation of Acinetobacter calcoaceticus to the degradation of aniline has been attributed to a mutation in the natural population with the involvement of a plasmid-carried gene (Wyndham, 1986).Studies in the mineralization of 4-nitrophenol indicated that the acclimation time resulted from the time needed for a small population to become suffi-
17
TRANSFORMATIONS OF HERBICIDES AND PESTICIDES
ciently large to give detectable loss of the chemical (Wiggins and Alexander, 1988).In this study, the growth of mineralizing organisms was affected by predation by protozoa and competition for inorganic nutrients.
E. MOISTURE, TEMPERATURE, AND NUTRIENTS It is the environment that actually controls the biodegradation process and has a greater influence on the process than microorganisms per se (Vaishnav and Babeu, 1987).Inhibition of microbial activity by a low or high temperature and extremes of pH may result in the persistence of potentially mineralizable compounds. Soil composition, percentage of organic matter, nutrient levels, and moisture levels are important regulators of microbial degradative activity. The kinetics of 2,4-D degradation for soil samples incubated at four moisture tensions and four temperatures is shown in Table VIII. Degradation occurred by a slow first-order reaction (slow phase), which, under some conditions, was followed by a rapid first-order reaction (fast TABLE VIII EFFECTS OF SOILMOISTURE TENSION AND TEMPERATURE ON THE RATE OF 2,4-D DECOMPOSITION IN SOIL INCUBATED WITH 25 pg 2,4-D PER GRAMOF SOILa
Temperature (“Cl 20
27
30
35
a
Moisture tension
Decomposition rate (Ccg/g/day)
(bas1
Duration of slow phase (days)
Slow phase
Fast phase
0.10 0.33 0.50 1.00 0.10 0.33 0.50 1 .oo 0.10 0.33 0.50 0.00 0.10 0.33 0.50 1.00
36 >90 >90 >90 28 90 >90 >90 >63 >63 >63 >42 >42 >42 >42 >42
0.123 0.075 0.038 0.026 0.230 0.140 0.128 0.075 0.238 0.125 0.126 0.253 0.151 0.117 0.127 0.058
0.887
From Parker and Doxtader (1983).
* No fast phase observed.
-b
18
DOUGLAS J. CORK AND JAMES P. KRUEGER
phase). The rate of decomposition of 2,4-D decreased with increasing soil moisture tensions for temperatures between 20 and 35°C. The decrease was a result of the reduced activity of the 2A-D-degradingmicroorganisms arising form decreased water availability and increased 2,4-D solution concentration (Parker and Doxtader, 1983). The effects of soil water content and soil temperature on the degradation of 2,4,5-T are shown in Table IX. The optimal temperature for 2,4,5-T degradation was 30°C and the optimal soil water content was 25% (Chatterjee et a]., 1982). Generally, chemicals were found to have biodegraded to a greater extent in waters enriched with both nutrients and microbes than in those receiving either amendment alone (Vaishnav and Babeu, 1987). Table X illustrates that effects of nutrient and microbial additions on first-order biodegradation rate constants and half-lifes of selected chemicals in natural waters. A sufficient microbial population capable of utilizing the chemical is also important for biodegradation. For example, the soil degradation of the herbicide 2,4,5-T was increased by increasing the concentration of a 2,4,5-T-degradingorganism (Table XI).
F. RATESOF CHLOROAROMATIC DEGRADATION Degradative organisms have been isolated that can transform a number of chloroaromatic compounds. The rates at which pure cultures of TABLE IX EFFECTS OF SOILMOISTURE AND TEMPERATURE ON THE DEGRADATION OF 2,4,5-T IN SOIL TREATED WITH 1000 pg/g 2,4,5-T AND INOCULATED WITHP. Cepacia AC1100"
Incubation temperature
Soil water
2,4,5-T
content
degradation
("C)
(%I
(%Ib
20 30 37 42 30 30 30 30 30
20 20 20 20 15 25 50 75 90
52 73 56 32 78 95 89 58 57
, From Chatterjee et al. (1982). As determined by GC analysis.
19
TRANSFORMATIONSOF HERBICIDES AND PESTICIDES TABLE X
EFFECTSOF NUTRIENT AND MICROBE ADDITION ON FIRST-ORDER RATECONSTANTSAND HALF-LIVES OF CHEMICALS IN LIQUIDMEDIUM" Acclimated microbes added
Nutrients and acclimated microbes added
NDb
ND
0.029 (24) 0.009 (77)
0.008 (87) 0.044 (16) 0.016 (43)
0.082 ( 8) 0.062 (11) 0.031 (22) 0.018 (39)
Nutrients added
Chemical Benzene t-Butylbenzoate Hexadecane Naphthalene
ND
From Vaishnav and Babeu (1987). Half-lives are given in parentheses. No difference from controls.
these organisms degrade various chlorinated compounds in liquid medium and in soil have been determined in a number of cases. Figure 7 shows the release of I4CO2from I4C-labeled 2,4-D incubated with a culture of Alcaligenes sp. Up to 40% of the substrate radiocarbon was mineralized to COz in 20 hours (Amy et al., 1985). A pure culture of Pseudomonas cepacia ACllOO has been isolated that is capable of growing on 2,4,5-T as its sole source of carbon and energy (Karns et al., 1984).After a 24-hour incubation of 0.1 mM 2,4,5-T with P. cepacia in liquid medium, 83% of the chloride was released. Soil contaminated with as much as 20,000 pg of 2,4,5-T per gram of soil showed greater than 90% degradation after six weekly treatments with P. cepacia. Furthermore, a strain of P. putida has been isolated that can degrade 3-chlorobenzoate (Chatterjee et al., 1981).After a 48-hour incubation of 7.5 mM 3-chlorobenzoate with P. putida, about 80% of the TABLE XI EFFECT OF MICROBIAL CONCENTRATION ON 2,4,5-T DEGRADATION IN SOILo Organisms per gram of soil ~-
2,4,5-T
degradation
(%Ib
~~
5 5 5 5
0
2.2 x 105 2.2 x 10" 2.2 x 107 ~~
Incubation period (days)
~
From Chatterjee et 01. (1982). As determined by GC analysis. Not detectable.
NDC 50 66 81
20
DOUGLAS J, CORK AND JAMESP. KRUEGER
Time (Hours)
FIG.7. Release of 14C02from a culture of Alcaligenes incubated with [14C]2,4-D (Amy et al., 1985).
chloride was released as inorganic chloride into the medium. Additionally, three species of Pseudomonas sp. were isolated that were capable of utilizing the herbicide atrazine as a sole carbon source (Behki and Khan, 1986). Strains were able to increase in cell number when incubated with atrazine as a sole carbon source (Table XII). Strains of Bacillus sp., Fusarium sp., and Mucor sp. have been identified that can transform the herbicide metolachlor, but cannot completely mineralize it (Saxena et al., 1987).Organisms were able to transform up to 70% of the metolachlor present at a concentration of 50 pg/ml. TABLE XI1
GROWTHOF PSEUDOMONAS STRAINS ON ATRAZINE AS A SOLE CARBONSOURCEO Viable celldm1 ( x 10’) Strain
Initial
After 14 days
192 195 555
1.48 3.10 2.42
19.40 16.72 14.90
a
From Behki and Khan (1986).
21
TRANSFORMATIONSOF HERBICIDES AND PESTICIDES
VII. Biochemical Mechanisms of Aerobic Chloroaromatic Metabolism
The majority of aromatic compounds are converted by bacteria to catechol or protocatechuate (Figs. 8 and 9). Catechol and protocatechuate become starting substrates for subsequent oxidative cleav-
06 CHOH-COOH
CO-COOH COOH
L- tryp tophan
anthracene
CO-CHZ-CHNH2-COOH
benzaldehyde
6 benzoate
benzene
formylkynurenine
1
0"'
CO-CH2-CHNHZ-COOH
L-kynurenine
phenol FIG.8. Aromatic compounds that can be converted to catechol (Gottschalk,1979).
DOUGLAS 1. CORK AND JAMES P. KRUEGER
22
co-coou
CI10H-COOH
OH
013
p-hydroxybenzoyl formate
p-hydroxy-lmandelate
HOCOOH
HO COOH
p- toluat e
OH
P-hY droxybenzaldehyde I
0
shikimat e
I
COOH
benzoate
quinate
OH
J
{OOH
o - O O H
OH
oti
ite
G OOHC H 3
benzoate
OH
protocatechuate FIG. 9. Aromatic and hydroaromatic compounds that can be converted to protocatechuate (Gottschalk, 1979).
age reactions. Chlorinated aromatic compounds can be converted to catechol, protocatechuate, or their corresponding chlorocatechol or protocatechuate by reactions described in Table 11. For example, various soil bacteria have been reported to cleave the ether linkage of 2,4-D to produce 2,4-dichlorophenol (Beadle and Smith, 1982). The catabolism of 2-chloroaniline involves 3,6-dioxygenation to yield 3-chlorocatechol (Latorre et a]., 1984). Also, nonselective dioxygenation was responsible
TRANSFORMATIONS OF HERBICIDES AND PESTICIDES
23
for the conversion of chlorinated benezoates into the respective catechols (Reineke and Knackmuss, 1978). Two processes that are especially important in the initial degradation of chloroaromatic compounds are demethylation and dehalogenation. A. DEMETHYLATION A demethylase enzyme that converts 4-methoxybenzoate to 4hydroxybenzoate has been characterized (Bernhardt et a]., 1975). The 4-methoxybenzoate-O-demethylase is a multienzyme system described as an iron-containing and labile-sulfur-containing monooxygenase. The demethylase enzyme consists of an NADH-dependent reductase and a monooxygenase. The NADH reductase contains FMN and an ironsulfur complex. The iron-sulfur complex appears to be essential for the catalytic function of the reductase and may mediate the transfer of electrons from NADH to the monooxygenase. The monooxygenase appears to be a dimer containing an iron-sulfur chromophore. A proposed mechanism of action for the demethylase enzyme system is shown in Fig. 10.
B. DEHALOGENATION A crucial point in the biodegradation of chloroaromatic compounds is the removal of halogen substituents from the organic compound. Dechlorination mechanisms can be classified as follows: (1) displacement of halogen through hydrogen, (2) displacement of halogen by hydroxyl, (3) oxygenolytic halogen-carbon bond cleavage, and (4) chloride elimination from nonaromatic intermediates. Halogen removal may occur at an early state of the degradative pathway with reductive, hydrolytic, or oxygenolytic elimination of the chlorosubstituent. Alternatively, nonaromatic structures may be generated that spontaneously lose the halide. Displacement of halogen through hydrogen is mainly an anaerobic process and is also referred to as reductive dechlorination. Anaerobic microbial consortiums have been shown to remove chloride without alteration of the aromatic ring (Suflita et al., 1982). Dechlorination occurred under methanogenic conditions, appeared to be enzymatic, and it occurred after induction and because of a low substrate K, of 67 pM. Loss of activity at temperatures above 39°C was observed, and the enzyme exhibited a high degree of substrate specificity. The reducing power required for reductive dechlorination was obtained from the hydrogen produced in the acetogenic oxidation of benzoate. Aerobic
24
DOUGLAS J. CORK AND JAMES P. KRUEGER
I R-H
1
R H
s
-' 1 \\
' 'FeIII\'/'FeIII(II)< -S-
Reductase eFel I I
nooxygenase
(oxld ized)
T
1
1- '
H
H20
\
2e- 0 H H FIG.10. Proposed reaction mechanism of the 4-methoxybenzoate monooxygenase (0-demethylase)enzyme system (Bernhardt et al., 1975).
TRANSFORMATIONS OF HERBICIDES AND PESTICIDES
25
reductive dechlorination has also been demonstrated with a strain of Alcaligenes denitrificans incubated with 2,4-dichlorobenzoate (Van Den Tweel et al., 1987). It has been demonstrated that a halogen can be directly replaced on a benzene ring by a hydroxyl group (Johnston et al., 1972). Other studies have shown that 4-chlorobenzoate is converted to 4-hydroxybenzoate before being degraded via the protocatechuate pathway (Chapman, 1975). The mechanism of the dehalogenation process has been determined by experiments using "Oz and Hz180 (Marks et a]., 1984; Muller et a]., 1984). Data indicated that the dechlorination reaction utilizes water, not molecular oxygen, as the hydroxyl donor. The results showed that the conversion of 4-chlorobenzoate to 4-hydroxybenzoate proceeded via a hydrolytic cleavage of the carbon-chlorine bond. Oxygenolytic halogen-carbon bond cleavage is another mechanism to remove halogen substituents from haloaromatic compounds. The mechanism involves the fortuitous dehalogenation of the substrate by a dioxygenase enzyme. This method of dehalogenation has been demonstrated by a Pseudomonas sp. that degrades 2-fluorobenzoate (Milne et al., 1968).Dehalogenation was the result of nonselective dioxygenation by a benzoate 1,2-dioxygenase. The mechanism is illustrated in Fig. 11.
/"
NADHz
FIG.11, Dehalogenation by nonselective dioxygenationby a benzoate 1,2-dioxygenase (Milne et al., 1968).
26
DOUGLAS J. CORK AND JAMES P. KRUEGER
Chloride elimination can occur after ortho cleavage of chlorocatechols. Some compounds, such as 3-chlorobenzoate, may only be dehalogenated after ring fission (Dorn and Knackmuss, 1978b).Chloride appears to be eliminated spontaneously after the carbon-halogen bond has been labilized through isomerases or reductases (Reineke and Knackmuss, 1988). Studies on the cyclosiomerase enzyme in the metabolic pathway of 3-chlorobenzoate indicated that dehalogenation was a secondary reaction of the cycloisomerization of halomuconic acid (Schmidt and Knackmuss, 1980).
C. RINGCLEAVAGE The aromatic rings of catechol and protocatechuate are cleaved via the reactions of the ortho- or meta-cleavage pathways illustrated in Figs. 1 2 and 13. The reactions of the catechol and protocatechuate branch are catalyzed by different enzymes. There is, for example, a catechol-1,2oxygenase and a protocatechuate-4,5-oxygenase. The products of either cleavage, cis, cis-muconate and 3-carboxy-cis,cis-muconate, yield in two subsequent reactions the first common intermediate, 4-oxoadipate enol lactone. This compound is degraded further to yield succinate and acetyl-CoA. The channeling of diverse compounds into a few central pathways benefits the microbe by simplifying regulatory circuits, genetic control, and reducing energy requirements (Harayama et al., 1987). The meta-cleavage pathway uses catechol-2,3-dioxygenaseto open the ring adjacent to the hydroxyl groups. Further metabolism leads to the formation of pyruvate, formate, and acetaldehyde. The catabolism of catechol produced during the metabolism of naphthalene by PseudoI I I O ~ Q Sspp. has been shown to involve the meta pathway in which the first reaction was catalyzed by catechol-2,3-dioxygenase (Barnsley, 1976). Toluene and substituted toluenes have also been shown to be degraded via the meta pathway (Chatfield and Williams, 1986). Oxygenase enzymes are responsible for the incorporation of the oxygen molecule directly into the organic substrate to yield hydroxyl groups. Oxygenases are classified as either dioxygenases or as monooxygenases. The monooxygenases are also referred to as hydroxylases or mixed-function oxidases. The dioxygenases catalyze incorporation of two atoms of oxygen, and the monooxygenases incorporate only one atom. Most dioxygenase enzymes characterized contain Fe(I1) but have no labile sulfur. Several dioxygenase enzymes that have been crystallized are nonheme iron proteins and others, such as tryptophan dioxygenase,
27
TRANSFORMATIONSOF HERBICIDES AND PESTICIDES
protocatechuate
catechol
4
COOH COOH
D -carboxy
cis, cis-muconate
c o=c HooC o ,
c=o
Y-carboxy-
muconolactone
4-oxoadipate
en%
,
;~~~3c;~;~
lactone
CoA
succinate
succinyl-CoA
FIG.1 2 . Reactions of the ortho-cleavage pathway. 1, Catechol 12-oxygenase; 2, muconate-lactonizing enzyme; 3, muconolactone isomerase; 4 , protocatechuate 3,4oxygenase; 5, carboxymuconate-lactonizingenzyme; 6, carboxymuconolactone decarboxylase; 7,oxoadipate enol lactone hydrolase; 8, oxoadipate succinyl-CoA transferase; 9,oxoadipyl-CoA thiolase (Gottschalk, 1979).
are heme enzymes (Metzler, 1977).The dioxygenase enzyme is typically made up of four subunits with a molecular weight of about 40,000 each (Crawford et al.,1975;Que et al.,1981).Dioxygenase enzymes are active when the iron is in the ferrous form. The formation of a Fe(II)-02 complex may be an essential first step. A proposed mechanism is as follows: Fe(I1)-0, + Fe(III)+-02 + Fe(II1) (ferriheme) (oxygenated complex) 02- (attacking reagent)
28
DOUGLAS J. CORK AND JAMESP. KRUEGER
catechol
protocatechuate
noH COOH
\CHO
2-hydroxymuconic
H o o c ~ ~ ~ o H CHO
2-hydroxy semialdehyde
6
oxopent-4-enoate
carboxvpentenoate
HOOC HCOH"~ E'O
CH3
COOH
oxovalerate
+
\
rCH. COH
r
1
4& pyruvate
MCOOH
CH3
c=o
I COOH
oxovalerate
acetaldehyde
2 pyruvate FIG. 13. Dissimilation of cathechol and protocatechuate by the pathways involving meta cleavage. 1, Catechol 2,3-oxygenase; 2, muconic semialdehyde hydrolase; 3, 2oxopent-4-enoic acid hydrolase; 4, oxovalerate aldolase; 5, protocatechuate 4,soxygenase; 6, carboxymuconic semialdehyde hydrolase; 7, 2-oxo-4-carboxypent-4-enoic acid hydrolase; 8, oxovalerate aldolase (Gottschalk, 1979).
Monooxygenase enzymes are classified as external or internal. Monooxygenases that require a cosubstrate in addition to the substrate being hydroxylated are known as external monooxygenases. If the substrate being hydroxylated also serves as the cosubstrate, then the monooxygenase is classified as internal. Most internal monooxygenases contain flavin cofactors and are devoid of metal (Metzler, 1977). A well-
TRANSFORMATIONS OF HERBICIDES AND PESTICIDES
29
characterized monooxygenase is salicylate hydroxylase. Salicylate hydroxylase is a flavoprotein that catalyzes the hydroxylation and simultaneous decarboxylation of salicylate (White-Stevens and Kamin, 1972). The enzyme contains one FAD and one polypeptide chain per 57,200 molecular weight, and exhibits a strong specificity for substrates bearing hydroxyl and carboxyl substituents at the ortho position.
D. CHLOROCATECHOL METABOLISM Chlorocatechols are generally degraded by an ortho fission pathway. Meta cleavage of chlorocatechols may result in toxic or dead-end intermediates (Reineke et al., 1982). Normal dioxygenase and cycloisomerase enzymes exhibit low activity for halogenated substrates (Schmidt and Knackmuss, 1980). However, dioxygenase and cycloisomerase enzymes that have a high affinity for chloroaromatic substrates have been identified (Dorn and Knackmuss, 1978b). In Pseudomonas sp. strain B13, catechol and chlorocatechols were assimilated via two separate othro-cleavage pathways (Reineke and Knackmus, 1988). Correspondingly, two types of isofunctional enzymes for ring fission were found. Pyrocatechase I was present in cells grown on benzoate and was highly specific for catechol. Pyrocatechase I1 was induced when S-chlorobenzoate was the growth substrate. Pyrocatechase I1 had a high activity for the chlorosubstituted benzene. Two types of isofunctional enzymes were also found for cycloisomerization of cis,cis-muconate and cis,cischloromuconate. Cycloisomerase I was highly specific for cis,cismuconate whereas cycloisomerase I1 had high activity for 2chloromuconate and 3-chloromuconate. The proposed metabolisms of 3-chlorobenzoic acid and 4-chlorocatechol are shown in Fig. 14. A number of microbes have been isolated and identified that can metabolize 2,4-D (Bollag et al., 1968; Fisher et al., 1978; Sandmann and Loos, 1988; Don and Pemberton, 1981).A proposed metabolic pathway for the degradation of 2,4-D is shown in Fig. 15. The ether linkage of 2,4-D is cleaved by enzymes present in various soil bacteria (Bollag et al., 1968). The resulting 2,4-dichlorophenol is converted to chlorocatechol by a phenol hydroxylase. VIII. Cornetabolism
The term cometabolism implies the concomitant but incomplete oxidation of a nongrowth substrate during the growth of a microorganism on a utilizable carbon and energy source. Characteristics of cometabolism are that (1)the energy derived from oxidation of the cometabolite
30
DOUGLAS J. CORK AND JAMESP. KRUEGER
HO
COOH
J
6.” c1
5.
HO COOH
c1
QooH
4
3
COOH
HC
c1 HOOC HOOC
c1-
J
5
Rc
COOH (COOS 6 CH2
, c=o /COO13
I1 HC
,/ C H 2 C=O
TCA cycle
H0OC-CH2-C0-C~-~~-~00~
FIG. 14. Proposed catabolic route of 3-chlorobenzoic acid to maleoyl acetic acid and proposed pathway for the metabolism of 4-chlorocatechol (Schmidt and Knackmuss, 1980; Chatterjee et al., 1981).
alone does not support microbial growth, (2) transformations of the cometabolite involve advantageous utilization of existing nonspecific enzyme systems, (3) utilization of the cometabolite is associated with increased oxygen consumption, and (4) production of waste products is stochiometrically related to the disappearance of the cometabolite (Hul-
TRANSFORMATIONS OF HERBICIDES AND PESTICIDES
31
2.44
ac<
L-alanine
c1
HOOC
HOOC\ HOOC QIC1
"OCQ
H
O
O
:
&
j
"-'
HOOC i
COOH
HoocQo
"""'0 \;"' HOOC
\
HooC HOOC
Succinic acid
COSCoA
HOOC Chlorosuccinic a c i d
FIG.15. Pathway for the degradation of 2,4-D (Fisher et a]., 1978).
bert and Krawiec, 1977). The basis for cometabolism is the supply of energy, cofactors, or metabolites at various levels, from the transformation of one substrate, to processes such as substrate transport, enzyme biosynthesis, or functioning involved in the transformation of a second substrate (Torstensson, 1988). Cometabolism is effected by a number of bacterial genera that are widespread in natural ecosystems (Horvath and Alexander, 1970).
32
DOUGLAS J. CORK AND JAMES P. KRUEGER
Evidence is available that cometabolism may be an important phenomenon in the breakdown of herbicides and pesticides (Alexander, 1967). Halogen-substituted organic compounds have been reported to be subject to cometabolism by a variety of bacteria unable to multiply at the expense of these substrates (Smith and Cain, 1965). An example of the cometabolism of 2,3,64richlorobenzoate is shown in Fig. 16. The cometabolism of 1-and 2-chloronaphthalene, monochlorophenol, propachlor, alachlor, and cycloate has also been reported (Morris and Barnsley, 1982; Spokes and Walker, 1974; Novick and Alexander, 1985). IX. Biochemical Mechanisms of Anaerobic Aromatic Metabolism
Anaerobes may possess capacities to degrade some xenobiotic compounds that are considered recalcitrant under aerobic conditions. Numerous studies have shown that substituted benzoates, including
"0 COOH
cI CI
OH
I
clocl OH CI
FIG. 16. Possible pathways for the formation of 3,5-dichlorocatechol resulting from cometabolism of 2,3,6-trichlorobenzene (Horvath, 1971).
TRANSFORMATIONS OF HERBICIDES AND PESTICIDES
33
chlorinated aromatics and nitro- and aminoaromatics, aromatic hydrocarbons, and phenolic compounds can be broken down under anaerobic conditions by bacteria (Grbic-Galic and Vogel, 1987; Knoll and Winter, 1987; Sleat and Robinson, 1984; Zeyer et al., 1986). Anaerobic conditions are created when oxygen consumption exceeds supply. Examples of anoxic ecosystems include soils with impeded drainage, soil subsurfaces, stagnant water, some groundwater, municipal landfills, sewage treatment digesters, industrial plants that produce methane from organic waste, the alimentary tract of animals, and sediments of the ocean and other bodies of water. The anaerobic metabolic fate of organic compounds and their mineralization to COz (and CH4) depend on the availability of light or inorganic electron acceptors such as NO3-, SO4’-, or COz. The anaerobic degradation of aromatic compounds can be carried out by (1) photosynthetic anaerobic metabolism, (2) metabolism by nitrate-reducing bacteria, (3) anaerobic dissimilation through sulfate respiration, (4) anaerobic fermentation, and (5) anaerobic fermentation by an undefined methanogenic consortium (Evans and Fuchs, 1988). Organic compounds can serve as the major source of electrons and carbon for the purple phototrophic, nonsulfur bacteria belonging to the family Rhodospiraceae (Berry et al., 1987). A large variety of aromatic compounds were shown to be degraded by the photosynthetic bacterium Rhodopseudomonas palustris (Harwood and Gibson, 1988). A reductive pathway for the anaerobic photocatabolism of benzoate by photosynthetic bacterium has been proposed (Fig. 17). Nitrate-reducing bacteria couple the oxidation of organic compounds with water to the exergonic reduction of nitrate via nitrate to N2 or NH3. Energy is derived mainly from electron transport phosphorylation during nitrate respiration, and cell carbon is derived from breakdown products of the organic compound. Microbial catabolism of aromatic compounds under anoxic conditions and in the presence of nitrate has been reported by several authors (Nozawa and Maruyama, 1988; Braun and Gibson, 1984; Taylor and Heeb, 1972; Zeyer et al., 1986).An example of anaerobic catabolism of aromatic compounds by denitrifying bacteria is shown in Fig. 18. Sulfate-reducing bacteria couple the oxidation of organic compounds with water to the exergonic reduction of sulfate via sulfite to sulfide. Energy is derived mainly from electron transport phosphorylation during sulfate reduction. Cell carbon is derived from breakdown products of the organic compound. Sulfate reducers are responsible for degradation of organic matter in marine environments that contain approximately 27 mM sulfate (Evans and Fuchs, 1988). High levels of sulfate may completely inhibit the degradation of haloaromatic substrates.
34
DOUGLAS J. CORK AND JAMES P. KRUEGER
0
\ COOH
$. Metabolic pool FIG.17. Proposed reductive pathway for the photocatabolism of benzoate by Rhodopseudomonas palustris (Berry et al., 1987).
However, the degradation of simple alkyl phenols occurred faster under sulfate-reducing conditions. The metabolism of p-cresol under sulfatereducing conditions involved initial hydroxylation of the aryl methyl group to form p-hydroxybenzyl alcohol. This intermediate was subsequently completely mineralized (Suflita et a]., 1988). Fermentative microorganisms derive their energy from substratelevel phosphorylation reactions. Organic compounds serve as electron donors and acceptors. Microbes have been isolated that could fermentatively degrade resorcinols (Tschech and Schink, 1985). Bacterial methanogenesis is a process common to many anoxic ecosystems. This strictly anaerobic process is associated with the decom-
TRANSFORMATIONSOF HERBICIDES AND PESTICIDES
0 COOH
35
0 COOH
OH
OH
\ 0/ COOH
OH
OH
HO
OH FIG. 18. Anaerobic catabolism of aromatic compounds by the denitrifying bacteria Pseudomonas sp. strain PN-1 (Berry et al., 1987).
position of organic matter in anoxic muds and sediments, and in anaerobic sewage digesters (Zeikus, 1977). Methane bacteria are able to use only a few simple compounds to support growth: COZ + 4H2 + CH4 + 2H20 4HCOOH + CH4 + 3CO2 + 2HZO 4CHaOH + 3CH4 + COz + 2Hz0 CHJOOH + CH4 + COZ
36
DOUGLAS J. CORK AND JAMES P. KRUEGER
Because these organisms can use only simple compounds to support growth, they must rely on syntrophic associations with fermenters that degrade complex organic compounds into usable substrates. Normally, the syntrophic associations between methane bacteria and fermenters are obligatory. Some microorganisms have evolved enzyme systems that degrade benzoid structures under anaerobic conditions through reduction of the benzene ring followed by cleavage. Anaerobic hydroxylation of benzene and toluene to phenol and p-cresol has been demonstrated (Evans and Fuchs, 1985).The reactions involved are endergonic with most electron acceptors and therefore require energy or a positive electron acceptor: toluene + HzO+ p-cresol + Hz benzene + HzO+ phenol + Hz
Go = + 7 1 kJ/mol Go = + 7 3 kJ/mol
Reductive dehydroxylation or dehalogenation are often used as energyyielding reactions. A stable methanogenic bacteria consortium was enriched from sludge and was found capable of dehalogenating and often mineralizing a variety of halobenzoates to CH4 and COz.The primary degradative event was the removal of aryl halide from the aromatic ring (Suflita et a]., 1982).An anaerobic methanogenic consortium was shown to be responsible for the reductive metabolism of 2,4,5-T (Suflita et d.,1984). Dechlorination of 2,4,5-T occurred at the para position. X. Molecular Biology of Degradative Microorganisms
Plasmids are autonomous genetic elements that replicate independently of the chromosome and encode a wide range of functions in many bacteria. Many plasmid-determined bacterial characteristics are important in medicine, agriculture, and the environment. Such characteristics include (1)virulence properties and antibiotic resistance, (2) the ability of nitrogen-fixing Rhizobium strains to nodulate roots of legumes, (3) antibiotic production by Streptomycetes, and (4) the metabolism of xenobiotic compounds. Degradative plasmids represent a group of naturally occurring plasmids that code for the enzymes capable of dissimilation of complex organic compounds. Many such compounds are toxic to the microorganism. The presence and expression of genes carried by degradative plasmids allow the host cell to quickly reduce the toxic concentration of the substrate. Degradative plasmids may encode a complete degradative pathway, such as that for xylene or toluene, or partial degradative steps, such as those taking naphthalene to salicylate (Farrell and Chakrabarty,
TRANSFORMATIONSOF HERBICIDES AND PESTICIDES
37
1979). Properties of some typical degradative plasmids are given in Table XIII. Genes for catabolic steps in a degradative pathway may evolve in different microorganisms followed by their assembly on the same plasmid in a single organism (Farrell and Chakrabarty, 1979). There is now evidence that transposable elements, rearrangements of genetic material, and transfers between unrelated strains can all contribute to the assembly of new degradative plasmids (Broda et al., 1981). Geneticengineering techniques have been used to construct plasmids that code for the catabolism of haloaromatic compounds (Rojo et al., 1987; Ramos et al., 1987; Reineke and Knackmuss, 1979; Reineke et a]., 1982). The evolution of new degradative capacities has also been accelerated by the use of plasmid-assisted molecular breeding (Kellogg et al., 1981). The transmissible nature of the genes specifying the dissimilation of xenobiotic compounds may lead to a rapid spread of degradative capabilities in the microbial population once a degradative plasmid has evolved (Chakrabarty, 19 72).
XI. Molecular Biology of Chloroaromatic Degradation
The molecular mechanisms of chloroaromatic compound degradation have been well defined for a number of different systems. Plasmid DNA is responsible for encoding complete degradative pathways, for compounds such as xylene or toluene, or partial degradative steps, such TABLE XI11 OF SOMETYPICAL DEGRADATIVE PLASMIDS PROPERTIES
P1asmid ____
SAL TOL PJPl PJP~ pJP3 CAM XYL pAC31 pAC25
pwwo
NAH XYL-K
Molecular mass ( x los Da)
Degradative pathway _____~
Reference
~
Sa1icy1ate Xylene/toluene 2-4-D 2,4-D 2,4-D Camphor Xylene 3,5-Dichlorobenzoate 3-Chlorobenzoate Toluene Naphthalene Xyleneltoluene
40, 48, 55 75 58 36 52 150 10 72 68 117
46 90
Chakrabarty (1976) Chakrabarty (1976) Fisher et al. (1978) Don and Pemberton (1981) Don and Pemberton (1981) Chakrabarty (1976) Chakrabarty (1976) Chatterjee and Chakrabarty (1982) Chatterjee et al. (1981) Broda et al. (1981) Chakrabarty (1982) Chakrabarty (1982)
38
DOUGLAS J. CORK AND JAMES P. KRUEGER
Chromosomal
Bsnzoala Did Dshydrogenare
6
+
-4
OH
OH
CI
K k
4-ClC
Plasmid CI
0 COOH
ds -Denel~.ans
Chromosomal? Plasmid or
[
trans .Dienslsctone
0
1[
Maleylacetate Maleylacelale Reduclase
% :;c m :(H i3 - Keloadipale
'I
FIG. 19. Mechanism of 3-chlorobenzoate degradation in Pseudomonos sp. (Chakrabarty et al., 1989).
TRANSFORMATIONSOF HERBICIDES AND PESTICIDES
39
as the conversion of naphthalene to salicylate (Farrell and Chakrabarty, 1979). One of the most complete outlines of the genetic organization and regulation of chloroaromatic metabolism has come from studies of the dissimilation of 3-chlorobenzoate (3-Cba), 2,4-dichlorophenoxyacetic acid, and 2,4,5-trichlorophenoxyaceticacid (Chakrabarty et al., 1989). The latter two phenoxy alkanoic acids have long been used as herbicides. All three compounds are similar by the presence of a carboxy moiety and chloride ions. The degradation of 3-chlorobenzoate employs the use of plasmid-encoded, as well as chromosome-encoded, enzymes (Fig. 19). As documented previously, the initial step involves the use of a dioxygenase, which is subsequently followed by ortho cleavage and ultimate conversion to succinate. Subcloning experiments have shown that plasmid pAC27 encodes a chlorocatechol degradative pathway that consists of three enzymes: (1) pyrocatechase 11, (2) muconatelactonizing enzyme 11, and (3) hydrolase 11. All three genes are clustered on a 4.2-kb BglII fragment (Fig. 20). 2,4-D degradation has been delineated in Alicaligenes eutrophus (Don et al., 1985).The complete mechanism is shown in Fig. 21. The initial reaction is catalyzed by a monooxygenase and is followed by a hydroxylase-mediated catalysis. These steps are chromosomally mediated. Subsequent steps have been shown to be plasmid encoded. Ring breakage occurs via the ortho-cleavage pathway. Physical mapping of this plasmid has been established by transposon mutagenesis (Weightmann et al., 1984). Degradation of 2,4,5-T is accomplished by chromosomal genes of P. cepacia strain ACllOO (Sangodkar et al., 1988). Through a series of enzymatic steps, 2,4,5-T is completely mineralized to COz. In an effort to delineate this
&A
=+.
I.
BgSc
l Bg
l B
- clc B
(ORF3)
.I 1.
HS
I
I
P
P
ck D
I S
I Bg
FIG. 20. Organization of plasmid pAC27-encoded chlorocatechol degradative (clc) genes involved in the dissimilation of 3-chlorobenzoate. Steps A, B, and D are mediated by clc A, clc B, and clc D, respectively, encoding pyrocatechase 11, muconate-lactonizing enzyme 11, and hydrolase 11. The location of the promoter is indicated by the arrow. The initiation codon of clc B overlaps with the stop codon of clc A. The restriction sites are designated as follows: Bg, BgllII; Sc, SacII; B, BarnHI; H, HindIII; S, Salk P, PstI (Chakrabarty et al., 1989).
DOUGLAS J. CORK AND JAMESP. KRUEGER
40 OCH-COOH IfdA 2,4-D
.&aE;lLe OH
OH
(&&ichlorccatechol
HYDROXYIASE CI MONOOXYGENASE CI 2,4-D 2,CDichlorophenol
CI
2,4-Dichloro- cis, cismuconate CI
’COOH trsn~CHLORODIENELACTONE ISOMERASE
0
1
tfdE
Chlorornaleylacetate
T
I
CHLORODIENELACTONE
‘ P 2 C O O H
0
p-Ketoadipate
FIG. 21. Proposed pathway for the degradation of 2,4-Dby Alcaligenes eutrophus JMP134(pJP4)(Don et a]., 1985).
operon, transposon mutagenesis with Tn5 was used to generate mutants blocked in 2,4,5-T degradation. Using this technique, a mutant (PT88) was isolated. This mutant was capable of producing a bright red compound in growth medium in the presence of glucose and 2,4,5-T. Subsequently, culture supernatants were analyzed by gas chromatography and mass spectroscopy to reveal 5-chloro-2-hydroxy hydroquinone [CHQJ These and other experiments led to the conclusion that CHQ
TRANSFORMATIONSOF HERBICIDES AND PESTICIDES
41
must be an obligatory intermediate of 2,4,5-T degradation. When mobilizing a cosmid-clone bank of the ACllOO genome into PT88 (CHQ-), a hybrid cosmid (pUS1) carrying a 25-kb insert was discovered. This insert complemented the CHQ- phenotype of PT88. Southern hybridization experiments have shown this 25-kb insert to have a chromosomal origin (Fig. 22).
pus1
c1
-
-
5 - CHLORO 2 - HYDROXY 1.4 BENZOQUINONE (RED)
FIG.22. Genetics of degradation of 2,4,5-T in AC1100. Broken arrows indicate unidentified conversions. Bold arrow indicates the nonenzymatic reaction occurring because of a block in CHQ metabolism in PT88.Hatched bars represent cloned ACllOO chromosomal DNA complementing PT88.Arrows in PUS1 and pUS1029 show the direction of transcription of chq gene(s). Hyphenated bar in PUS1029 shows the deletion. The restriction sites are designated as follows: B, BarnHI, Bg, BflII; C, CIaI; H, HindIII; P, PstI; R, EcoRI; S , SalI; X, XbaI; Xh, XhoI (Sangodkar eta]., 1988).
42
DOUGLAS J. CORK AND JAMES P. KRUEGER
Plasmid-encoded enzymes have been implicated in the breakdown of the herbicide dicamba (3,6-dichloro-2-methoxybenzoicacid) by Pseudomonas strains. This assertion has been substantiated by the instability of the dicamba-degrading phenotype when these strains are grown in rich medium in the absence of dicamba. In addition, induced loss of the phenotype occurs when strains are treated with mitomycin C (Krueger, 1989). This phenomenon was observed by Chakrabarty et al. (1989) with 2,4,5-T-degrading P. cepacia. In soil treatment studies, AClOO cells with 2,4,5-T-degradative abilities rapidly disappeared from the soil samples once the 2,4,5-T levels diminished. Plasmid-borne phenotypes are often lost through segregational instability in the absence of the appropriate selection pressure. OF Pseudomonas GENES IN THE Escherichia CLONING coli VECTOR,pUC
In order to delineate the genes responsible for chloroaromatic degradation, researchers have used a variety of cloning vehicles. For cloning large inserts, bacteriophage vectors such as the A phage (Charon 4A) may be used. With this technique, inserts of up to 7-20 kb may be cloned without disrupting the viability of the phage. Cosmid vectors allow the insertion of up to 45-kb fragments, with the added advantages of phage packaging and propagation and plasmidlike replication. The genetic delineation of 2,4,5-T degradation in P. cepacia has been achieved through the use of the broad-host-range cosmid vector pCP13 (Chakrabarty et al., 1989). When smaller fragments are to be cloned, commercial plasmid preparations are ideal. One such vector, pUC, has been used to study several genes in the polychlorinated biphenyl degradation pathway found in a strain of P. cepacia (Khan and Walia, 1990). This group of plasmids, developed from the single-stranded bacteriophage M13, provides easy selection of recombinant Escherichia coli clones (Fig. 23). Selection of recombinant clones is twofold: First, the presence of the 0-lactamase gene codes for the enzyme, which is able to break down the R-lactam ring of penicillin analogs, namely, ampicillin. Thus, only transformed E. coli cells containing the plasmid will be viable in the presence of this antibiotic. Second, the polylinker region of pUC is located within the lac z gene of the lactose operon. The lac z gene of pUC codes for only a portion of the active R-galactosidase enzyme. When present in an E. coli host (strains JM103 or JM101) containing the AM15 (a partial deletion of the lac z gene) mutation on the F’ episome, complementation of both protein products results in a fully active R-galactosidase molecule. Upstream of lac z in pUC is the promoter/operator region
43
TRANSFORMATIONSOF HERBICIDES AND PESTICIDES Taq I
coding sequence for B-galactor idarc
Mae I1 Hae I1
Teq I
ATG ACC ATG ATT ACG M T KC(xiG GGA T CCG K GACCTG CAG CCA AGClTG G€A CTG
Mlfipll&X€13
ATG ACC ATG A T ACG CCA AGCTTG GGC TGC AGG TCG ACT CTA GAG GAT C C c m (irr,AGCTCG M T TCA C K G@2
Lmm
PSI
s.11 Aal
h n
f i i
A
Brmm
SIII
~
I
Srml
FIG.23. The multiple cloning sites of M13mp7,8,9,10,11and pUC 7,8,9,12,13 (Messing, 1983).
u
UHrm
Xrml
44
DOUGLAS J. CORK AND JAMES P. KRUEGER
of the lactose operon. The above-mentioned host strain also contains the lacIQ mutation, resulting in the overproduction of lactose repressor protein. Thus, the operon may be induced by lactose or a lactose analog (IPTG).In the presence of such as isopropyl-8-D-thiogalactopyranoside (X-gal), IPTG and 5-bromo-4-chloro-3-indoyl-R-~-galactopyranoside host cells containing pUC reveal a blue color (a colored product from X-gal cleavage) upon colony formation on Luria broth (LB) plates at 37°C. When, however, the insert is cloned within this polylinker sequence, disruption of the 8-galactosidase-coding sequence results, yielding an inactive portion of R-galactosidase. Recombinant clones then are distinguished from nonrecombinant transformants by their lack of blue color. Due to its inducible characteristic, pUC plasmids may also be used as expression vectors (Steele, 1983). A fragment cloned within the lac z region may be induced to form a fusion polypeptide. A limitation to the use of these plasmids is that the lac regulatory region does not contain the UV 5 mutation, and is therefore subject to catabolite repression in the presence of glucose (Messing, 1983). In order to remedy this problem, Messing (1983) developed a growth medium without glucose, which thereby allows induction of the desired gene products. XII. Dicamba Biodegradation: A Case Study
Twenty of the leading United States pesticide manufacturers are listed in Table XIV. Structures of some important herbicides are shown in Fig. 24, and some important physical and chemical properties of dicamba are given in Table XV. Dicamba is used as a pre- and postemergent herbicide for the control of annual and perennial broadleaf weeds and several grassy weeds. Dicamba is similar in herbicidal action to phenoxy alkanoic acid herbicides, such as 2,443, but belongs to the class known as the benzoics. The specific mode of action of dicamba is unknown. The symptomatology produced (abnormalities in flowering and in leaf and stem formation) indicates that dicamba acts to limit the transport or action of auxins in plants. Resistant plant species absorb, translocate, and metabolize dicamba, whereas susceptible species cannot easily do so. Dicamba is synthesized in a series of reactions starting with 1,2&trichlorobenzene (Fig. 25) Dicamba is chemically stable and there is considerable evidence suggesting that the degradation of dicamba in aerobic soils and water is biologically mediated (Harger,1975; Smith, 1973; Smith and Cullimore, 1975; Scifres et al., 1973).Aerobic soil metabolism studies have demonstrated that dicamba is metabolized to C02 and that 3,6-dichlorosalicylate is the major metabolite (Harger, 1975; Smith, 1973). However, the
TRANSFORMATIONSOF HERBICIDES AND PESTICIDES
45
TABLE XIV TWENTY LEADING UNITED STATESPESTICIDE MANUFACTURERSO Abbott Laboratories American Cyanamid Company BASF Wyandotte Corporation Chevron Chemical Company Ciba-Geigy Corporation Dow Chemical Company E.I. du Pont de Nemours and Company Elanco Products Company Fermenta Plant Protection Company FMC Corporation Hoechst-Roussel Company ICI Americas Inc. Mobay Chemical Corporation Monsanto Company Nor-Am Chemical Company Rhone-Poulenc Inc. Rohm and Hass Company Sandoz Crop Protection Corporation Uniroyal Inc. Valent USA Corporation From Crop Protection Chemicals Reference (1989).
TABLE XV PHYSICAL AND CHEMICAL PROPERTIES OF DICAMBA Empirical formula: Molecular weight: Physical state: Color: Odor: Melting point: Boiling point: Specific gravity: Vapor pressure (25°C): Dissociation constant: PK~: OctanoUwater coefficient: Flash point: Hydrolysis: Oxidation: Strong acid: Strong base: Solubility of dicamba acid (gramdliter of water at 25%): Solubility of dicamba Na salt (grandliter of water at 25°C): Solubility of dicamba K salt (gramslliter of water at 25'c):
CBHBCIZO~ 221.04 Crystalline solid White Odorless 114-116°C Decomposes at >200°C 1.57 3.41 x mm Hg 1.16 X lo-' 1.94 0.1 150°C Stable Stable Resistant Resistant 6.5 360 480
46
DOUGLAS J. CORK AND JAMES P. KRUEGER
CI CH,
METOLACHLOR
CGN
l
2,4-D
CH,OCH,NCCH,CI
I
OH
BROMOXYNIL
ALACHLOR
FIG.24. Structures of some important herbicides.
identification of biological factors involved in the metabolism of dicamba has not been accomplished. There are no previous reports in the literature on the metabolism of dicamba by a pure culture of microorganisms. Increased bacterial growth and increased O2 consumption have been reported when soil organisms capable of growth on o-anisate were grown on dicamba in the presence of this compound (Ferrer et a]., 1985). However, no analytical data on the disappearance of dicamba were presented. The biological degradation of dicamba has been investigated and documented by Krueger et al. (1989, 1990, 1991; Krueger, 1989). As mentioned previously, this chloroaromatic compound affects the growth of annual and perennial broadleaf weeds, as well as several grassy weeds. Unfortunately, dicamba affects the growth of certain commerical crops, namely, soybean. Using I4C-labeled dicamba, Krueger demonstrated the ability of Pseudomonas species to completely miner-
47
TRANSFORMATIONSOF HERBICIDES AND PESTICIDES
6+ @ 6 3,4-dichlorophenol
CI
CI
distilled off
-
CI
pressure
CI
pressure OH', MeOH
Q: J COOH
3.6-dichlorosalicylate
CI
COOH
dicamba
cl&~H~=-~ OCH3
CI
FIG.25. Chemical synthesis of dicamba.
alize dicamba to ' * C 0 2 . Through thin-layer chromatography and highpressure liquid chromatography, Krueger and Cork proposed a pathway for microbe-mediated dicamba degradation (Fig. 26). By the structure of the intermediates and the absence of anaerobic metabolism of dicamba, the mechanism of dicamba degradation is thought to be similar to those previously discussed.
48
DOUGLAS J, CORK AND JAMES P. KRUEGER
co <x)(IH
+ g . - - + c Q 2
OH
0
cl
FIG.26. Proposed pathway for the degradation of dicamba (Krueger, 1989).
Bacteria capable of utilizing the herbicide dicamba as a sole carbon source were obtained by enrichment from soil and water with a long history of dicamba exposure. Three strains that grew rapidly in liquid medium containing dicamba were identified by biochemical tests and by GC analysis of whole cell fatty acid profiles as follows: strain DI-6, Pseudomonas sp.; strain DI-7, Moraxella sp.; and strain DI-8, Pseudomoms sp. The organisms isolated that degrade dicamba represent genera that are commonly found in water, soil, and sewage and are often responsible for the decomposition of man-made chemicals in the environment. Members of the genus Pseudomonas are known to possess a wide range of degradative activities and have the ability to develop new degradative activities. Long-term intermittent exposure (approximately 25 years) of microbes to dicamba in the storm water retention ponds at the dicamba manufacturing facility appears to have provided the selective conditions necessary to develop dicamba-degrading capabilities. An excellent example of the development and spread of herbicide-degrading activity has been demonstrated for phenoxyacetic acid herbicides. A large number of the different genera that have been isolated are capable of degrading these herbicides (Helling et al., 1981).
TRANSFORMATIONS OF HERBICIDES AND PESTICIDES
49
XIII. Growth Kinetics in Liquid Culture
When dicamba-degrading organisms (strains DI-6, DI-7, and DI-8) were grown in liquid media containing 1000 pg/ml dicamba, an average of 97% of the chloride was released after 30 hours (Table XIV). The absorbance at 274 nm (wavelength of maximum absorbance for dicamba) decreased to zero. Chloride release and the decrease in absorbance at 274 nm indicate complete removal of dicamba. Radioassay of the media indicates that up to 80% of the substrate carbon is mineralized to COz (Fig. 27). The substrate carbon remaining in the media was probably incorporated into cell biomass because the cell number increased (Table XVI). Initial reactions in the metabolism of dicamba by microorganisms and subsequent increases in biomass require an expenditure of energy by the microbe. The evolution of l4COZfrom phenyl-labeled [14C]dicambasuggests that dicamba is fragmented to compounds that are channeled into oxidative cycles (the Krebs cycle) from which the organism can derive useful energy. Mineralization of 2,4-D to COz, with a corresponding increase in biomass, has also been demonstrated. Up to 40% of the substrate radiocarbon from 2,4-D was mineralized to COz in 20 hours. (Amy et a]., 1985). 80'
70
..
60. m
250. C
8
a 30.
....QY, ,.,-0. .........
2010.
6
.... ........... ........ ............... Control .................. 5....... ...A/
.'
..........
20 30 Time (Hours) FIG.27. Removal of soluble 14C from liquid medium containing 1000 pg/ml (14C]dicamba by three dicamba-degradingstrains and an uninoculated control. 0
10
DOUGLAS J. CORK AND JAMES P. KRUEGER
50
TABLE XVI GROWTH KINETICSOF DICAMBA-DEGRADING ORGANISMS I N LIQUIDCULTURE CONTAINING 1000 pg/ml OF (14C]DICAMBA
Strain DI-6
DI-7
DI-8
Time (hours) 0 6 24 30 0 6 24 30 0 6 24 30
Viable cells perm1
2.1 x 7.5 x 1.3 x 6.8 X 7.8 x 8.5 X 9.8 X 1.0x
lo8 108 109
lo9 107
lo8 10’ 109
1.ox lo8
1.4 X lo8 1.1x 109 1.0x 109
Absorbance (274 nm)
Dicamba (pg/ml)”
2.36 2.38 NDc ND 2.38 2.56 ND ND 2.43 2.56
818 828 <10
ND ND
Based on absorbance at 274 nm. Based on chloride release. ND, Not detectable; limit of detection = 10 j&d
Total chloride (pg/ml)
Removal
0 26 325 334 0 15 296 315 0 11 151 290
0 8.1 101.2 104.0 0 4.7 92.2 98.1 0 3.4 47.0 90.3
(%lb
dicamba.
A. EFFECTOF DICAMBACONCENTRATION
The dicamba-degrading strain DI-6 (Pseudomonas sp.) was inoculated into media containing 100, 500, 600, 800, 1000, or 1500 pg/ml of [14C]dicamba.The media were radioassayed and cell dry weights were determined at 0, 6, 16, 20, 24, and 30 hours. A comparison of dicamba degradation kinetics at different dicamba concentrations is shown in of 0.1325 ocTable XVII. The maximum specific growth rate (pmax) curred at a concentration of 1160 pg/ml dicamba. One-half the maximum specific growth rate is 0.0663, which corresponds to a Ks concentration of 750 pg/ml of dicamba (Fig. 28). The maximum dicamba mineralization rate of 24.63 pg/ml/hour occurred at 1000 pglml dicamba (Table XVII), Increasing concentrations of dicamba prolonged the initial lag phase. Other authors have also observed a prolonged lag phase with cells grown on increasing concentrations of chlorobenzene (Reineke and Knackmuss, 1984). The specific growth rate of strain DI-6 decreased when the dicamba concentration was increased from 1000 to 1500 pg/ml. The hyperbolic Monod function does not describe this growth rate and substrate relationship for toxic or inhibitory compounds. The Haldane modification
51
TRANSFORMATIONSOF HERBICIDES AND PESTICIDES TABLE XVII COMPAMSON OF DICAMBA DEGRADATION KINETICSAT DIFFERENT DICAMBA CONCENTRATIONS IN LIQUID CULTURE Dicamba concentration (CLg/ml)
Dicamba mineralization (pg/ml/hour)
Specific growth rate
Doubling time (hours)
100 500 600 800 1000 1500
0.25 5.25 10.75 24.63 42.75 21.25
0 0.0347 0.0385 0.0578 0.1386 0.0815
ND" 20 18 12 5 8.5
(I
Lag phase (hours) ND 4 5 5 13 15
No doubling in cell dry weight detected.
+
0.1L h a x
0.1: 0.12 0.1 1 0.1 t
- 0.09 5
(u
c
2m 3
+
0.Of 0.07 1
+
.
0 . 0 0 y 100 300
,
..
500
. 700
kS
- 1-1-1-1 900 110(
1300
1500
Substrate Concentration (pg/rnl)
FIG.28. Growth kinetics of dicamba-degradingstrain DI-6 on dicamba liquid medium.
52
DOUGLAS J. CORK AND JAMES P. KRUEGER
of the Monod equation has been used to describe the toxic effects of pentachlorophenol (Klecka and Maier, 1985). The Haldane modification is as follows:
+ + S2/Ki)
p = pmax(s/KS S
where Ki is the inhibition constant. The sharp decline in specific growth rate from 1000 to 1500 pg/ml dicamba is not described by this equation. More data at higher concentrations are needed to further evaluate this equation.
B. DEPENDENCE OF ACTIVITY ON pH Dicamba-degradingcultures (DI-6,DI-7 and DI-8) were used to inoculate liquid media containing 1000 pg/ml [14C]dicambaat pH 4.0, 5.0, 6.0, 7.0, and 8.0. Cultures were incubated at 30°C on a shaker and aliquots of each medium were radioassayed at zero time and at 24 hours. The effect of pH on dicamba-degrading activity in liquid culture is shown in Table XVIII.All three organisms removed approximately the same amount of substrate 14C at pH 7.0 and 8.0. The ability to remove substrate I4C decreases when pH is decreased. However, strain DI-8 was TABLE XVIII ACTIVITY OF DICAMBA DEGRADERS AT VARIOUS pH VALUES IN 1000 p g h l [ ''C]DICAMBA LIQUID MEDIUM
Strain DI-6
Initial PH 4.0 5.0
6.0
DI-7
DI-8
7.0 8.0 4.0 5.0 6.0
Substrate carbon removed after 24 hours
(%I 1.6 21.5 38.9
61.6 61.1 0.0 1.0 37.0
7.0
70.0
8.0 4.0 5.0 6.0 7.0 8.0
66.0 31.8 31.0 30.7
65.6 66.0
TRANSFORMATIONS OF HERBICIDES AND PESTICIDES
53
able to remove 31.8% of the substrate 14C even at pH 4.0. The ability of these organisms to degrade dicamba over a wide range of pH values may make them useful for removing dicamba from a wide variety of aquatic and soil environments. C. EFFECTOF TEMPERATURE Dicamba-degrading strains DI-6, DI-7, and DI-8 were inoculated into media containing 1000 pg/ml [14C]dicamba.Cultures were incubated at 5,15, 25,30, 35, and 40°C and the media were radioassayed at 0,6, 24, 30, and 48 hours. The removal rates of dicamba at those temperatures are compared in Fig. 29. The optimum temperature for removal of dicamba for all three strains is 30°C. Strain DI-6 had a wider temperature
+
C+.rin
Temperature (“c)
FIG.29. Rate of dicamba mineralizationby dicamba-degradingorganisms as a function of temperature.
54
DOUGLAS J. CORK AND JAMES P. KRUEGER
activity range, as the removal rates were similar at 25 and 30°C. Dicamba removal rates were low at 5 and 15°C. However, organisms were not killed at low temperatures, as dicamba removal was evident when the temperature was brought to 30°C after 30 hours. All strains were killed when incubated at 40°C.
D. GROWTHKINETICSIN SOIL Kenyon loam soil [Table XIX) was treated with ['4C]dicamba to yield a concentration of 3.4 pg/gram dicamba in moist soil. This is equivalent to an application rate of approximately 2 lb/acre when incorporated into two inches of soil. Treated soil (50 g dry equivalents) was added to serum bottles and inoculated with strain DI-6, DI-7, or DI-8. Bottles were sealed and incubated in the dark at 25°C. At 1 , 3 , 7 , 1 4 ,and 2 1 days all samples were flushed with COz-freeair. After 2 1 days, Exhaust air was bubbled through 1.5 NKOH to trap 14C02. soil was analyzed for dicamba and 3,6-dichlorosalicylic acid according to the Sandoz Crop Protection Corporation GC residue method AM0766.
An average of 63.7% of the dicamba applied to soil was metabolized to CO, in the inoculated soils, compared to only 2.2% in the uninoculated soils after 2 1 days (Fig. 30). The highest degradation rates occurred between zero time and 1 day in all of the inoculated treatments. GC
analysis indicates nearly complete removal (98% or greater) of dicamba
TABLE XIX PROPERTIES OF KENYON LOAMSOIL Soil property evaluated Organic carbon (a/") Organic matter (%) (calculated from % organic carbon] Cation exchange capacity (mEqi100 g) pH (in deionized water] 75% of 0.33-bar level (grams of water/100 g dry soil] Bulk density (g/cm3) Sand(%) Silt (Yo) Clay [%I Textural class Bacteridgram of soil Fungilgram of soil Actinomycetes/gram of soil
Result 2.2 3.8 20.4 6.2 24.2
1.6 34.0 41.0
25.0
Loam 6.3 x 105 3.2 x lo4 2.6 X lo5
TRANSFORMATIONSOF HERBICIDES AND PESTICIDES
55
70
Strain #6 Strain #8 Strain #7
60
50
d" 0 0
c
40
P
-N .-
EJ a, C
5 c
30
C a,
2 a, a
20
10
0 10
20
Time (Days) FIG. 30. Mineralization of ['4C]dicamba to ''C02 in soil inoculated with dicambadegrading organisms.
and greatly reduced accumulation of 3,6-dichlorosalicylic acid after 2 1 days (Table XX). In the uninoculated control, 66.2% of the applied dicamba remained and the concentration of 3,6-dichlorosalicylic acid was equivalent to 19.7% of the applied dicamba. Dicamba mineralization by microorganisms in soil might also be influenced by the soil composition, nutrient levels, percentage of organic matter, and temperature.
DOUGLAS J. CORK AND JAMES P. KRUEGER
56
TABLE XX GC ANALYSIS OF DICAMBA-TREATED SOIL 21 DAYSAFTERINOCULATION WITH DICAMBA-DEGRADING ORGANISMS~ Dicamba (&gram moist soil)
3,6-Dichlororsalicylic acid (pg/gram moist soil)
DI-6
NDb
0.014
DI-7
0.019 0.067 2.250
0.075 0.260 0.670
Strain
DI-8 Uninoculated a
Initial concentrationof dicarnba was 3.4 Fg/g of moist soil. Not detectable:limit of detection for dicarnba and 3,6-dichlorosalicylic acid was 0.01p g / g each.
E. GROWTHCHAMBER STUDY Pots of Wisconsin clay loam soil (Table XXI) were treated with dicamba to yield the following concentrations (pounddacre): 0,0.5, 4.0, and 8.0. Treated soils were incubated at 15'C for 2 weeks. After 2 weeks, pots from each treatment rate were inoculated with strain DI-6, DI-7, or DI-8. Pea seeds (a dicamba-susceptible plant species) were planted in pots immediately after inoculation and 2 and 5 days after inoculation. After 2 1 days, pea seedlings were harvested and weighed. The concentration of dicamba in soil was determined by high-pressure liquid chromatography (HPLC) analysis of the soil at inoculation and at 1 and 5 days after inoculation (Krueger et af., 1991). TABLE XXI PROPERTIES OF WISCONSIN CLAYLOAMSOIL Soil property evaluated
Result
Organic carbon (yo] Organic matter (%) [calculated from % organic carbon) pH (in deionized water) pH (in 0.01M CaCl2] 75% of 0.33-bar level (grams of water/100 g dry soil) Sand (%) Silt (%) Clay (YO) Textural class Bacteria/gram of soil Fungi/gram of soil Actinomycetes/gram of soil
4.6
8.0 6.8
6.5 20.7 67 0
33 Clay loam 7.6 X lo6 4.0 x 104 8.4 x 105
57
TRANSFORMATIONSOF HERBICIDES AND PESTICIDES
Inoculation of dicamba-treated soil with dicamba-degrading organisms resulted in a higher percentage emergence and increased total pea seedling weight for all treatment groups (Tables XXII-XXIV). Pea seedlings planted immediately after inoculation had significantly higher weights over the uninoculated controls at the 0.5- and 4.0-lb/acre rates. Pea seedlings planted 2 or 5 days after inoculation had significantly higher weights over the uninoculated controls at all rates. Some treatments at the 0-lb/acre rate showed lower than expected percentage emergence. Factors such as seed quality and age, position of the pot in the incubator, temperature variation in the incubator, and shading may all contribute to the variability in these types of experiments. Though the general trends support the stated conclusions, more replicates are needed to confirm these trends. Dicamba-degrading organisms were able to decrease the herbicidal activity of dicamba quickly at all concentrations to a level wherein pea seedlings could survive. Any alteration in the structure of dicamba will decrease its herbicidal activity, so extensive metabolism is not neces-
TABLE XXII
WEIGHTSOF PEASEEDLINGS PLANTED IN DICAMBA-TREATED SOILIMMEDIATELY AFTER INOCULATIONWITH DICAMBA-DEGRADING ORGANISMS" Weight of roots (grams)
Total weight (grams)
Emergence
Strain
Weight of leaves and stems (grams1
DI-6 DI-7 DI-8 Uninoculated DI-6 DI-7 DI-8 Uninoculated DI-6 DI-7 DI-8 Uninoculated DI-6 DI-7 DI-8 Uninoculated
2.22 2.22 2.78 1.84 1.74 2.35 2.18 0 0 0 0.43 0 0 0 0 0
3.18 2.69 2.59 2.36 1.81 2.45 2.56 1.08 1.17 1.17 1.98 1.18 1.07 0.64 0.82 0.62
5.40 4.91 5.37 4.20 3.55 4.80 4.74 1.08 1.17 1.17 2.41 1.18 1.07 0.64 0.82 0.62
88 100 100 63 63 100 100 0 25 13 38 13 25 0 0 0
Dicamba concentration (lb/acre) 0
0.5
4.0
8.0
(YO)
'Soil inoculated with dicarnba degraders 14 days after dicamba treatment; pea seedlings harvested 2 1 days after inoculation.
58
DOUGLAS J. CORK AND JAMES P. KRUEGER TABLE XXIII WEIGHTS OF PEA SEEDLINGS PLANTED IN DICAMBA-TREATED SOIL 2 DAYSAFTER INOCULATION WITH DICAMBA-DEGRADING ORGANISMS'
Dicamba concentration (lb/acre) 0
0.5
4.0
8.0
Weight of roots (grams)
Total weight [grams)
Emergence
Strain
Weight of leaves and stems (grams)
DI-6 DI-7 DI-8 Uninoculated DI-6 DI-7 DI-8 Uninoculated DI-6 DI-7 DI-8 Uninoculated DI-6 DI-7 DI-8 Uninoculated
1.54 1.73 2.69 1.60 1.35 2.08 1.92 0.11 1.15 1.76 1.98 0 0.99 1.67 1.61 0
2.55 2.39 3.02 2.16 1.70 2.70 2.24 1.20 2.70 2.46 2.51 1.61 2.22 1.48 2.11 0.85
4.09 4.12 5.71 3.76 3.05 4.78 4.16 1.31 3.85 4.22 4.49 1.61 3.21 3.15 3.72 0.85
50 25 100 50 50 100 100 25 75 100 100 0 50 100 50 0
(%I
Soil inoculated with dicamba degraders 14 days after dicamba treatment; pea seedlings harvested 19 days after inoculation.
sary. Organisms were able to survive and have activity in the presence of naturally occurring microfauna in a soil and at a temperature at which dicamba persistence is sometimes a problem. Dicamba-degrading organisms may be useful as a crop inoculum to protect previously susceptible crops and therefore increase the range of crops on which dicamba can be used. HPLC analysis for dicamba confirms that dicamba is rapidly removed in inoculated soil at all concentrations (Table XXV). The half-life of dicamba in soil was reduced dramatically (<1 day) at all concentrations. The half-life of dicamba in other aerobic soil studies, wherein no inoculation was used, has been reported to vary from 17 to 45 days, depending on the soil tested (Smith, 1974).
F. FIELDSTUDY A field study was conducted at a typical midwestern field site located in northern Illinois. Soil characteristics are presented in Table XXVI. Each of the following amounts (pounddacre) of dicamba were sprayed
59
TRANSFORMATIONS OF HERBICIDES AND PESTICIDES TABLE XXIV WEIGHTS OF PEASEEDLINGS PLANTED I N DICAMBA-TREATED SOIL5 DAYSAFTER INOCULATIONWITH DICAMBA-DEGRADING ORGANISMS"
Dicamba concentration (lblacre) 0
0.5
4.0
8.0
Weight of roots (grams)
Total weight (grams)
Emergence
Strain
Weight of leaves and stems (grams)
DI-6 DI-7 DI-8 Uninoculated DI-6 DI-7 DI-8 Unin ocu 1ated DI-6 DI-7 DI-8 Uninoculated DI-6 DI-7 DI-8 Uninoculated
2.07 1.28 1.37 2.06 2.44 2.36 1.38 0.83 1.38 1.59 0 0 1.04 1.80 2.02 0
2.71 1.66 2.08 2.71 3.18 2.36 1.79 2.03 2.51 1.99 1.90 1.34 1.95 2.08 2.62 1.13
4.78 2.94 3.45 4.77 5.62 4.72 3.17 2.86 3.89 3.58 1.90 1.34 2.99 3.88 4.64 1.13
75 50 75 100 100 100 75 50 75 75 25 0 25 75 100 0
(%I
'Soil inoculated with dicamba degraders 14 days after dicamba treatment;pea seedlings harvested 16 days after inoculation.
TABLE XXV FIRST-ORDER RATE CONSTANTS AND HALF-LIVES OF DICAMBA I N SOILINOCULATED WITH DICAMBA-DEGRADING ORGANISMS Initial dicamba concentration (lb/acre) 0.5
4.0
8.0
Strain
First-order rate constant
tl/z (days)
Uninoculated DI-6 DI-7 DI-8 Uninoculated DI-6 DI-7 DI-8 Uninoculated DI-6 DI-7 DI-8
0.17 0.96 0.97 2.93 0.30 1.55 1.32 1.43 0.33 1.52 19.36 1.31
4.0 0.7 0.7 0.2 2.3 0.4 0.5 0.4 2.1 0.4 0.1 0.5
60
DOUGLAS J. CORK AND JAMESP. KRUEGER TABLE XXVI PROPERTIES OF KANESVILLE LOAMSOIL Soil property evaluated
Result
Organic carbon (Yo] Organic matter (Yo) (calculated from Yo organic carbon] Cation exchange capacity (mEq/100 g] pH (in deionized water) 75% of 0.33-bar level (grams of water/100 g dry soil) Bulk density (g/cm3) Sand (Yo) Silt (Yo] Clay (%I Textural class
2.6 4.4 22.9 6.6 24.0 1.3 24.0 50.0 26.0 Loam
onto the entire surface of 12 plots each (2 x 4 feet plots): 0,0.5,2.0, and 8.0. All plots were allowed to incubate 2 weeks to simulate a preemergent treatment. After 2 weeks, plots from each treatment rate were inoculated with strain DI-6, DI-7, and DI-8. Organisms were incorporated into the soil by tilling the plots to a 5-inch depth. One row of soybeans (dicamba-susceptible species) was planted in each plot at 0,7, and 32 days after inoculation. Plants were grown to maturity and harvested. The number of plants and their weights and lengths were recorded. Dicamba-degrading organisms were able to protect soybeans planted in dicamba-treated soil from dicamba injury in field test plots. Differences were most dramatic in the 8.0-lbiacre rate in which the uninoculated plots did not show any germination or subsequent stand of soybeans (Table XXVII). In this treatment, strain DI-6 provided the greatest dissipation of dicamba as measured by the soybean bioassay. The lack of significant differences at the lower concentration rates was probably due to higher than average rainfall. Heavy rain may have leached dicamba away from the root zone and lowered the dicamba concentration below an effective level at the lower rates, thereby decreasing treatment differences. Dicamba degradative activity in the field represents a significant step toward the practical application of dicamba-degrading organisms. Degradation occurred in a typical midwestern agricultural soil (Kanesville loam) exposed to natural air and soil temperatures in the presence of naturally occurring soil microfauna. Results of this field study indicate that dicamba-degrading organisms have a strong potential for use as a crop inoculum.
TRANSFORMATIONSOF HERBICIDES AND PESTICIDES
61
TABLE XXVII HEIGHT AND WEIGHT OF MATURE SOYBEANS PLANTED IN SOIL TREATED WITH 8.0 Ib/acre DICAMBA Average weight
Strain
Average number of stemsa
(lb)
Average stem height (inches)
Uninoculated DI-6 DI-7 DI-8 Uninoculated DI-6 DI-7 DI-8 Uninoculated DI-6 DI-7 DI-8
0 3 0 0 0 5 2 0 0 8 3 2
0 2.1 0 0 0 3.4 0.1 0 0 1.6 0.1 0.1
0 32.58 0 0 0 27.70 3.22 0 0 16.38 5.27 5.50
Days after inoculation 0
7
32
Average of three plots.
The ability of strains DI-6, DI-7, and DI-8 to rapidly mineralize a wide range of dicamba concentrations over a range of pH and temperature values in liquid medium demonstrates their potential for use in spill cleanup. All three strains were able to mineralize up to 80% of the substrate carbon in dicamba to COz in 2 1 days. No metabolites of environmental concern were formed. Strain DI-6 mineralized 1000 pg/ml dicamba at a rate of 24.63 pg/ml/hour. The maximum specific growth rate of 0.1386 occurred at 1160 pg/ml dicamba and the K, concentration was 750 pg/ml dicamba. Because these organisms are the result of natural selection and adaptation, their release into the environment should not be a concern. Dicamba-degrading strains were able to metabolize dicamba in several different soils in the presence of naturally occurring soil organisms. Strains DI-6, DI-7, and DI-8 showed the ability to rapidly mineralize dicamba in Kenyon loam soil. An average of 63.7% of the dicamba applied to soil was metabolized to COz in the inoculated soil, compared to only 2.2% in the uninoculated soil after 21 days. Greatly reduced concentrations of 3,6-dichlorosalicylate were evident in inoculated soils. The half-life of dicamba in Wisconsin clay loam soil treated with 0.5, 4.0, or 8.0 lb/acre of dicamba and inoculated with dicambadegrading strains was reduced to less than 1 day. Dicamba-degrading organisms were able to metabolize dicamba at lower concentrations in
62
DOUGLAS J. CORK AND JAMES P. KRUEGER
soil than in liquid medium, If dicamba metabolism is occurring in the liquid phase of the soil, then the actual concentration of dicamba in a given liquid-phase microenvironment around a soil particle may be high. The higher dicamba concentration in a given microenvironment may enhance dicamba degradation. Dicamba-degrading organisms have excellent potential as a crop inoculum to protect susceptible plant species from dicamba damage. Dicamba-degrading organisms were able to protect pea seedlings (dicamba-susceptible species) from dicamba in soil treated with up to 8.0 lb/acre dicamba. Pea seedlings planted immediately after inoculation had significantly higher weights over uninoculated controls at the 0.5- and 4.0-lb/acre rates. Pea seedlings planted 2 or 5 days after inoculation had significantly higher weights over uninoculated controls at all rates. Dicamba metabolism occurred at low temperature (15"C),which demonstrates the ability of these organisms to remove dicamba herbicidal activity in cooler climates, where dicamba persistence is sometimes a problem. Dicamba-degrading organisms were able to protect soybeans (dicamba-susceptible species) planted in dicamba-treated soil from dicamba injury in field test plots under natural conditions. Differences were found in the 8.0-lb/acre rate, where the uninoculated plots did not show any germination or subsequent stand of soybeans. The normal application rate of dicamba is 0.125 to 0.5 lb/acre. Growth in plots where 8.0 lb/acre was applied represents a 16- to 80-fold safety factor over the normal application rate. Dicamba degradative activity in the field represents a significant step toward the practical application of dicamba-degrading organism. Results of the field study indicate that dicamba-degrading organisms have a strong potential for use as a crop inoculum. Dicamba-degrading organisms could provide the genetic material needed for the development of dicamba-resistant crop species. Plasmidcontaining dicamba degraders would be important tools for genetic analysis and gene cloning. Dicamba would be an excellent candidate for expanded usage on currently susceptible crops due to its efficacy and unlikely occurrence of dicamba resistance arising in weed species. In conclusion, the widespread use of xenobiotics has been reviewed, with special emphasis given to usage and detoxication of haloaromatic herbicides and pesticides. Although all xenobiotics cannot be degraded as rapidly as the herbicide dicamba presented in the case study, we feel that the approach summarized for the degradation of dicamba provides a useful model for the enrichment, isolation, and characterization of transformation kinetics of most xenobiotic-degrading microorganisms. It has become apparent that microorganisms that successfully degrade
TRANSFORMATIONSOF HERBICIDES AND PESTICIDES
63
xenobiotics have wide-ranging applications in such diverse areas as the transformation of important agricultural compounds and the bioremediation of toxic land-filled compounds. ACKNOWLEDGMENTS Selected parts of Section XI were taken from Mr. Clyde Danganan’s M. S. thesis at IIT. He is presently pursuing his Ph. D. in Dr. A. M. Chakrabarty’s lab at the University of Illinois, Chicago, on a Ford Foundation Minority Fellowship. We appreciate the continued assistance of Dr. Benjamin Stark, IIT Department of Biology, in the area of recombinant DNA technology.
REFERENCES Aelion, C. M., Swindoll, C. M., and Pfaender, F. K. (1987).Appl. Environ. Microbiol. 53, 2212-2217.
Ahmed, M., and Focht, D. D. (1972).Can. J. Microbiol. 19,47-52. Alexander, M. (1967).“Agriculture and the Quality of Our Environment,” pp. 331-342. Am. Assoc. Adv. Sci., Washington, D.C. Alexander, M. (1981).Science 211, 132-138. Alexander, M. (1985).Environ. Sci. Technol. 18,106-111. Amy, P. S., Schulke, J. W., Frazier, L. M., and Seidler, R. J. (1985).Appl. Environ. Microbiol. 39, 1237-1245. Anderson, J. P. (1984).Soil Biol. Biochem. 16,483. Andrews, N. R., Bagley, W. P., and Herret, R. A. (1971).J. Agric. Food Chem. 19,727-730. Ashton, F. M. (1982).“Biodegradation of Pesticides,” pp. 117-129. Plenum, New York. Barnsley, E. A. (1976).J. Bacteriol. 125,404-408. Beadle, C. A., and Smith, A. R. (1982).Eur. J. Biochem. 123,323-332. Behki, R. M., and Khan, S. (1986).J. Agric. Food Chem. 34,746-749. “Bergey’s Manual of Systematic Bacteriology” (1984).Williams & Wilkins, Baltimore, Maryland. Bergmann, J. G., and Sanik, J. (1957).Anal. Chem. 29,241-243. Bernhardt, F., Pachowsky, H., and Staudinger, H. (1975).Eur. J. Biochem. 57,241-256. Berry, D.F., Francis, A. J., and Bollag, J. M. (1987).Microbiol. Rev. 51,43-59. Bollag, J. M. (1974).Adv. Appl. Microbiol. 18,75-130. Bollag, J. M., Briggs, G. G., and Dawson, J. E. (1968).J. Agric. Food Chem. 16,829-833. Braun, R.,and Gibson, D. T. (1984).Appl. Environ. Microbiol. 48,102-107. Broda, P., Downing, R., Lehrbach, P. McGregor, I., and Meulien, D. (1981).“Molecular Biology, Pathogenicity, and Ecology of Bacterial Plasmids,” pp. 511-517. Plenum, New York. Burns, R. G., and Audus, L. J. (1970).Weed Res. 10,49-58. Chakrabarty, A. M. (1972).J. Bacteriol. 112,815-823. Chakrabarty, A. M. (1976).Annu. Rev. Genet. 10,7-30. Chakrabarty, A. M., Sangodkar, U. M. X., Aldrich, T. L., Hargland, R. A., Johnson, J., Rothmel, R. K., and Chapman, P. J. (1989).Acta Biotechnol. 9,301-316. Chapman, P. J. (1975).Abstr. Annu. Meet. Am. SOC.Microbiol. p. 192. Chatfield, L. K., and Williams, P. A. (1986).J. Bacteriol. 168,878-885. Chatterjee, D. K.,and Chakrabarty, A. M. (1982).Mol. Gen. Genet. 188,279-285 Chatterjee, D. K.,Kellogg, S. T., Hamada, S., and Chakrabarty, A. M. (1981).J. Bacteriol. 146.639-646.
DOUGLAS J, CORK AND JAMES P. KRUEGER
64
Chatterjee, D. K., Kilbane, J. J,, and Chakrabarty, A. M. (1982).Appl. Environ. Microbiol. 44,514-516.
Crawford, R. L., Hutton, S. W., and Chapman, P. J. (1975).J. Bacteriol. 121,794-799. Crawford, R. L., Olsen, P. E., and Frick, T. D. (1979).Appl. Environ. Microbiol. 38, 379-384.
“Crop Protection Chemicals Reference” (1989).Chem. Pharm. Press, New York. Dagley, P. S., Chapman, P. J., Gibson, D. T., and Wood, J. M. (1964).Nature (LondonJ 202, 775-778.
Davis, J. I., and Evans, W. C. (1964).Biochem. J. 91,251-261. DeBont, J. M., Vorage, M. W., Hartmans, S., and Van Den Tweel, W. J. (1986).Appl. Environ. Microbiol. 52,677-680. Dec, J., and Bollag, J, (1988).Soil Sci. SOC.Am. J. 52,1366-1371. Don, R. H., and Pemberton, J. M. (1981).J. Bacteriol. 991,681-686. Don, R. H., Weightmann, A. J., Knackmuss, H. J., Timmis, K. N. (1985).J. Bacteriol. 161, 85-90.
Dorn, E., and Knackmuss, H. J. (1978a).Biochem. J. 174,85-94. Dorn, E., and Knackmuss, H. J. (1978b).Biochem. J. 174,73-84. Durham, D.R., and Stewart, D. B. (1987).J. Bacteriol. 169,2889-2892. Engelhardt, G., Wallnofer, P. R., and Plopp, R. (1973).Appl. Microbiol. 26,709. Evans, W. C., and Fuchs, G. (1988).Annu. Rev. Microbiol. 42,289-317. Farrell, R., and Chakrabarty, A. M. (1979).“Plasmids of Medical, Environmental and Commercial Importance,” pp. 97-109. Plenum, New York. Feist, C. G., and Hegeman, G. D. (1969).J. Bacteriol. 100,869-877. Ferrer, M. R., Moral, A. D., Ruiz-Berraquero, F., and Ramos-Cormenzana, A. (1985). Chemosphere 14,1645-1648. Fisher, P. R., Appleton, J., and Pemberton, J. M. (1978).J. Bacteriol. 135,798-804. Fujimoto, S., and Cork, D. J. (1991,August). Sac. Ind. Microbiol. Annu. Meet., Philadelphia, Pennsylvania. Gibson, D. T. (1978).“Microbial Transformations of Aromatic Pollutants,” pp. 187-204. Pergamon, New York. Golab, T.,Bishop, C. E., Donoho, A. L., Manthey, J. A., and Zornes, L. (1975).Pestic. Biochem. Physiol. 5,196-204. Gottschalk, G. (1979).“Bacterial Metabolism,” pp. 113-140. Springer-Verlag, New York. Goulding, C., Gillen, C. J., and Bolton, E. (1988).J. Appl. Bacteriol. 65,1-5. Grbic-Galic, D., and Vogel, T. M. (1987).Appl. Environ. Microbiol. 53,254-260. Grover, R. (1967).Weed Res. 7,61-67. Guerra-Santos, L., Kappeli, O., and Fiechter, A. (1984).Appl. Environ. Microbiol. 48, 301-305.
Haller, H. D. (1978).J. Water Pollut. Control Fed. 50,2771-2777. Harayama, S.,Mermod, N., Rekik, M., Lehrbach, P. R., and Timmis, K. N. (1987). J. Bacteriol. 169, 558-564. Harger, T. R. (1975).Ph.D. Thesis, Univ. of Kentucky, Lexington. Hawood, C. S., and Gibson, J. (1988).Appl. Environ. Microbiol. 54,712-717. Helling, C. S., Kearney, P. C., and Alexander, M. (1971).Adv. Agron. 23, 147-240. Horvath, R. S.(1971).J. Agric. Food Chem. 19,291-293. Horvath, R. S., and Alexander, M. (1970).Appl. Microbiol. 20,254-258. Hulbert, M. H., and Krawiec, S.(1977).J. Theor. Biol. 69,287-291. Ishikawa, K., Nakamura, Y . ,and Kuwatsuka, S.(1976).Nippon Moyaku Gakkaishi 1,49. Johnson, B. F., and Stanier, R. Y. (1971).J. Bacteriol. 107,468-475. Johnston, H. W., Briggs, G. G., and Alexander, M. (1972).Soil Biol. Biochem. 4,187-190. Jones, A. S. (1976).J. Agric. Food Chem. 24, 115-117. Karickhoff, S. (1981).Chemosphere 10,833-846.
TRANSFORMATIONSOF HERBICIDES AND PESTICIDES
65
Karns, J. S.,Kilbane, J. J., Chatterjee, D. K., and Chakrabarty, A. M. (1984).“Genetic Control of Environmental Pollutants,” pp. 3-21. Plenum, New York. Kaufman, D. D., and Kearney, P. C. (1970).Residue Rev. 32,235-265. Kellogg, S.T., Chatterjee, D. K., and Chakrabarty, A. M. (1981).Science 214, 1122-1135. Khan, A. A.,Walia, S. K. (1990).Appl. Environ. Microbiol. 56,956-962. Kimura, Y., and Miller, V. L. (1964).J. Agric. Food Chem. 12, 253-257. Klecka, G. M., and Maier, W. J. (1985).Appl. Environ. Microbiol. 49,46-53. Knoll, G., and Winter, J. (1987).Eur. J. Appl. Microbiol. Biotechnol. 25,384-391. Krueger, J, P. (1984).M.S. Thesis, Illinois Inst. Technol., Chicago. Krueger, J. P. (1989).Ph.D. Thesis, Illinois Inst. Technol., Chicago. Krueger, J. P., Butz, R. G., Atallah, Y. H., and Cork, D. J. (1989).J. Agric. Food Chern. 37, 534-538.
Krueger, J. P., Butz, R. G., and Cork, D. J. (1990).J. Ind. Microbiol. 5,147-152. Krueger, J. P., Butz, R. G., and Cork, D. J. (1991).J. Agric. Food Chern. (in press). Latorre, J., Reineke, W., and Knackmuss, H. J, (1984).Arch. Microbiol. 140,159-165. Leather, G. R., and Foy, C. L. (1977).Pestic. Biochem. Physiol. 7,437-442. Lehrbach, P. R., Zeyer, J., Reineke, W., Knackmuss, H. J., and Timmis, K. N. (1984). J. Bacteriol. 158,1025-1032. LOOS,M. A. (1975).“Herbicides: Chemistry, Degradation,” pp. 1-128. Dekker, New York. Marks, T. S., Smith, A. R., and Quirk, A. V. (1984).Appl. Environ. Microbiol. 48,10201025.
Matsumura, F. (1982).“Biodegradation of Pesticides,” pp. 67-85. Plenum, New York. Messing, J. (1983).Methods Enzymol. 101,20-78. Metzler, D.E. (1977).“Biochemistry,” pp. 615-625. Academic Press, New York. Miller, L., and Berger, T. (1985).“Hewlett-Packard Application Note,” 228-41. HewlettPackard, Palo Alto, California. Milne, G. W., Goldman, P., and Holzman, J. L. (1968).J. Biol. Chem. 243, 5374-5376. Morris, C. M., and Barnsley, E. A. (1982).Can. J. Microbiol. 28, 73-79. Muller, R., Thiele, J., Klages, U., and Lingens, F. (1984).Biochem. Biophys. Res. Commun. 124,178-182.
Neufeld, R. J., Zajic, J. E., andGerson, D. F. (1980).Appl. Environ. Microbiol. 39,511-517. Novick, N. J., and Alexander, M. (1985).Appl. Environ. Microbiol. 49,737-743. Nozawa, T., and Maruyama, Y. (1988).I. Bacteriol. 170,5778-5784. Ogram, A. V.,Jessup, R. E., Ou, L. T., and Rao, P. C. (1985).Appl. Environ. Microbiol. 49, 582-587.
Paris, D. F., Lewis, D. L., and Wolfe, N. L. (1975).Environ. Sci. Technol. 9,135-138. Parker, L. W., and Doxtader, K. G. (1983).J. Environ. Qual. 12,553-558. Perkins, E. J.,and Lurquin, P. F. (1988).J. Bacteriol. 170,5669-5672. Pfaender, F. K., and Alexander, M. (1972).J. Agric. Food Chem. 20,842-846. Pierce, G. E., Robinson, J. B., and Colaruotolo, J. R. (1983).Dev. Ind. Microbiol. 24, 499-507.
Que, L., Wisdom, J., and Crawford, R. L. (1981).J. Biol. Chern. 256,10941-10944. Ramos, J.L., Wasserfallen, A., Rose, K., and Timmis, K. N. (1987).Science 235,593-596. Reineke, W., and Knackmuss, H. J. (1978).Biochim. Biophys. Acta 542,412-423. Reineke, W., and Knackmuss, H. J, (1979).Nature (London) 277, 385-386. Reineke, W., and Knackmuss, H. J. (1980).J. Bacteriol. 142,467-473. Reineke, W.,and Knackmuss, H. J. (1984).Appl. Environ. Microbiol. 47, 395-402. Reineke, W., and Knackmuss, H. J. (1988).Annu. Rev. Microbiol. 42,263-287. Reineke, W., Jeenes, D. J., Williams, P. A., and Knackmuss, H. J. (1982).J. Bacteriol. 150, 195-201.
Ribbons, D. W., and Williams, P. A. (1982).“Genetic Engineering of Microorganisms for Chemicals,” pp. 211-231. Plenum, New York.
66
DOUGLAS J. CORK AND JAMES P. KRUEGER
Rojo, F., Peiper, D. H., Engesser, K. H., Knackmuss, H. J., and Timmis, K. N. (1987).Science 238,1395-1398.
Rosenberg, A., and Alexander, M. (1980).J. Agric. Food Chem. 28,297-302. Sandmann, E. R., and Loos, M. A. (1988).Can. J. Microbiol. 34,125-130. Sangodkar, U. M. X., Chapman, P. J., and Chakrabarty, A. M. (1988).Gene 71,267-277. Saxena, A., Zhang, R., and Bollag, J. M. (1987).Appl. Environ. Microbiol. 53,390-396. Schmidt, E.,and Knackmuss, H. J. (1980).Biochem. J. 192,339-347. Scifres, C. J., Allen, T. J., Leinweber, C. J., and Pearson, K. H. (1973).J. Environ. Qual. 2, 306-309.
Sleat, R., and Robinson, J. P. (1984).J. Appl. Bacteriol. 57,381-394. Smith, A. E. (1973).J. Agric. Food Chem. 21,708-710. Smith, A. E. (1974).J. Agric. Food Chem. 22,601-605. Smith, A., and Cain, R. B. (1965).J. Gen. Microbiol. 41,XVI. Smith, A. E., and Cullimore, P. G. (1975).Weed Res. 15, 59-62. Spokes, J. R., and Walker, N. (1974).Arch. Microbiol. 96,125-134. Stalker, D. M.,McBride, K. E., and Malyj, L. D. (1988).Science 24,419-422. Stanier, R. Y., Pallerone, N. J., and Doudoroff, M. (1966).J. Gen. Microbiol. 43, 159-271. Steele, R. E. (1983).Focus 8,3-30. Steiert, J. G., Pignatello, J. J., and Crawford, R. L. (1987).Appl. Environ. Microbiol. 53, 907-910.
Steiert, 1. G., Thoma, W. J., Ugurbic, K.,and Crawford, R. L. (1988).J. Bacteriol. 170, 4954-4957.
Stucki, G., and Alexander, M. (1987).Appl. Environ. Microbiol. 53, 292-297. Suflita, J. M., Horowitz, A., Shelton, D. R., and Tiedje, J. M. (1982).Science 218,115-116. Suflita, J. M., Stout, J., and Tiedje, J. M. (1984).J. Agric. Food Chem. 32,218-221. Suflita,J. M., Gibson, S . A., and Beeman, R. E. (1988).J. Ind. Microbiol. 3, 179-194. Taylor, B. F.,and Heeb, M. J. (1972).Arch. Microbiol. 83,165-171. Tiedje, J. M., and Hagedorn, M. L. (1975).J. Agric. Food Chem. 23,77-81. Torstensson, L. (1988).Outlook Agric. 17,120-124. Tschech, A., and Schink, B. (1985).Arch. Microbiol. 143,52-59. Vaishnav, D. D., and Babeu, L. (1987).Bull. Environ. Contam. Toxicol. 39,237-244. Vanderbergh, P. A., Olsen, R. H., and Colaruotolo, J. F. (1981).Appl. Environ. Microbiol. 42,737-739.
Van Den Tweel, W. J., Kok, J. B., and DeBont, J. A. (1987).Appl. Environ. Microbiol. 53, 810-815.
Wang, D. I., Cooney, C. L., Demain, A. L., Dunnill, P., Humphrey, A. E., and Lilly, M. D. (1979).“Fermentation and Enzyme Technology,” pp. 57-97. Wiley, New York. Weber, J. B. (1977).“Science,” pp. 59-71. South. Weed Sci. SOC.,Auburn, Alabama. Weber, J. B., and Coble, H. D. (1968).J . Agric. Food Chem. 16,475-478. Weightmann, A. J.,Don, R. H., Lehrbach, P. R., and Timmis, K. N. (1984).“Genetic Control of Environmental Pollutants,” p. 47.Plenum, New York. White-Stevens, R. H., and Kamin, H. (1972).J. Biol. Chem. 247,2358-2370. Wiggins, B. A., and Alexander, M. (1988).Appl. Environ. Microbiol. 54,2803-2807. Wyndham, R.C. (1986).Appl. Environ. Microbiol. 51, 781-789. Yoshida, T., and Kojima, H. (1978).Chemosphere 6,497-501. Zeikus, J. G.(1977).Bacteriol. Rev. 41, 514-541. Zeyer, J., Wasserfallen, A., and Timmis, K. N. (1985).Appl. Environ. Microbiol. 50, 447-453.
Zeyer, J., Kuhn, E. P., and Schwarzenbach, R. P. (1986).Appl. Environ. Microbiol. 52, 944-947.
An Environmental Assessment of Biotechnological Processes M. S. THAKUR,* M. J. JSENNEDY,~~' AND N. G. KARANTH" * Fermentation Technology and Bioengineering Discipline Central Food Technological Research Institute Mysore-570013, India Industrial Processing Division Department of Scientific and Industrial Research Petone, New Zealand I. Introduction A. Historical Perspective B. Potential Benefits C. Hazards and Problems to Date D. Motivation 11. Ecological Consequences of the Release of Microorganisms A. Dispersion of Microorganisms in the Environment B. Survival of Microorganisms in the Environment C. Genetic Exchange in the Environment 111 Risk Assessment Direct Risk to Humans IV. Case Studies A. Food Bioprocesses B. Pharmaceutical and Enzyme Bioprocesses C. Waste Treatment D. Chemical Bioprocesses E. Mining F. Agriculture V. The Regulation of Biotechnological Processes The Problems of Regulating Biotechnology VI. Conclusions References
I. Introduction
Biotechnology has many definitions (Smith, 1988),which is a reflection on its diverse range of applications. Coombs (1986) defines biotechnology as the application of organisms, biological systems, or biological processes to manufacturing and service industries.
Present address: Industrial Development-Wellington, Department of Scientific and Industrial Research, Lower Hutt, New Zealand.
67 ADVANCES IN APPLIED MICROBIOLOGY, VOLUME 36 Copyright 0 1991 by Academic Press, Inc. All rights of reproduction in any form reserved.
68
M. S. THAKUR ET AL.
A. HISTORICAL PERSPECTIVE
Mankind has been harnessing biological processes for thousands of years. For example, the ability of yeast to make alcohol in the form of beer was known to the Sumerians and Babylonians before 6000 BC (Demain and Solomon, 1981). Mankind has also been trying for a similar period of time to manipulate the genetic content of animals and plants by cross-breeding. For example, a Babylonian tablet dating back to about 4000 BC gives the pedigree of five generations of horses, showing how characteristics of the head and mane were transmitted; stone carvings from ancient Egypt show men cross-pollinating the date palm, the obvious purpose of which is to improve the quality of fruit (Winchester, 1977).
However, it has not been until this century that mankind has learned to change purposefully the genetic content of organisms in a direct way without depending on the process of reproduction. Mutations in DNA were induced in the laboratory by means of X-rays as early as 1927, and later a wide range of mutagenic radiations and chemical mutagens were developed (Hopwood, 1981). The 1970s saw a quantum leap in mankind’s ability to manipulate the genetic content of an organism, with the first successful experiment in gene cloning occurring in 1973 (Antebi and Fishlock, 1986).
B. POTENTIAL BENEFITS The potential benefits of genetic engineering are numerous. The current benefits are primarily in medicine and agriculture. In medicine, the development of human insulin, human growth hormone, tissue plasminogen activator, and numerous vaccines stands out. In agriculture, there is interest in developing plants resistant to heat, cold, frost, insects and pests, herbicides, metals, salt, and drought (Demain, 1986). Some biotechnology products, such as bovine growth hormone, are of dubious benefit. Public pressure and the overproduction of milk or meat may slow or stop the commercialization of animal growth hormones. AND PROBLEMS TO DATE C. HAZARDS
Mankind, unfortunately, has not had an unblemished track record when it comes to the effect of technology on the environment. Several serious chemical accidents have occurred in the past decade due to the improper use of technology. No one can forget the tragedies of the poisonous gas leak in Bhopal, the radiation leak at the Chernobil nuclear power plant, and the Exxon Valdez oil spill in Alaska. In a broad sense,
ENVIRONMENTAL BIOLOGICAL PROCESSES
69
biotechnology already has had several adverse environmental effects, including “killer” bees (Mellon, 1988), the poisonous Lenape potato (Wickelgren, 1989), the Japanese beetle (Smith and Hardley, 1926), the European gypsy moth (Forbush and Fernald, 1896), the Chinese chestnut blight (Merkel, 1906), Dutch elm disease (Huber, 1987), and antibiotic-resistant varieties of pathogenic organisms (Slater, 1985; Levy, 1986).
D. MOTIVATION Recent advances in genetic engineering have created the potential for large benefits to society, but they have also meant that many genetically novel organisms are interacting with the environment. The hazards and risks associated with the release of new organisms into the environment and also the hazards of traditional biotechnology have not been fully understood. In numerous cases, many of the important data on environmental interactions are not known. This article summarizes the ecological consequences and potential risks of the release of traditional and genetically modified organisms into the environment. Each major biotechnology process area is then evaluated with respect to the hazard it may pose to the environment. Finally, the structure and some of the problems involved in the regulation of these processes are outlined as starting points for further investigation. II. Ecological Consequences of the Release of Microorganisms
There are two main areas for concern when introducing a new species into the environment or into a part of the environment where it has not previously been present. The first concern is that the new species will display traits that negatively affect the environment or other species within it. The second concern is that genetic traits in the released organism will be transferred to other organisms, which will further disrupt the ecological balance. Most environmental releases follow the pattern of release, dispersion, survival, and then interaction with the environment. The interaction can be on a physical or genetic level. A. DISPERSION OF MICROORGANISMS IN THE ENVIRONMENT
The three major pathways of environmental dispersion are air, water, and vectors. Vectors are moving solid surfaces and may be either biological or physical. Viable airborne microorganisms can be transported by
70
M. S.THAKUR ET AL.
wind currents over a long distance and their survival may be prolonged through association with aerosols, soil, or other particles. Microbial transport in surface water or groundwater is difficult to predict because of its dependence on complex physical mechanisms, such as attachment to particles. Biological dispersion is either in the intestinal tract, in the hemolymph or salivary glands, or on the body surface of a variety of vertebrate and invertebrate animals. Physical dispersion is on the surface or in internal spaces of man-made material, equipment, or vehicles (Barnthouse and Palumbo, 1986).
B. SURVIVAL OF MICROORGANISMS IN THE ENVIRONMENT When a species is introduced into a new ecosystem in which no ecological barrier exists, its population reaches a considerable level in a short time (Pimmentel, 1985). This applies to microorganisms, for example, the introduction of Chinese chestnut blight into American chestnut trees (Merkel, 1906);to plants, for example, the introduction of the ragwort plant into New Zealand pasture; to insects, for example, the introduction of the Japanese beetle into the United States (Smith and Hardley, 1926); and to animals, for example, the introduction of the European rabbit into Australia (Stead, 1935).The reasons for such population explosions can be found in the factors that effect organism survival in the environment. The survival of all microorganisms depends upon a number of environmental conditions, for example, temperature, sunlight, moisture, nutrients, and biological interactions (Barnthouse and Palumbo, 1986). Other important factors affecting the survival of introduced microorganisms include competition among microorganisms sharing the same ecosystem and dispersion of the microorganism. Toxin production is a pathogenic trait for which there is no known survival feature (Levy, 1986).
Levy (1986) lists the following mechanisms and requirements for survival of microorganisms released into a new environment: (1) adherence to human tissue, (2) colonization on a human or animal body, (3) trace amounts of iron and other essential elements, (4) resistance to the antimicrobial activity of serum, and (5) formation of a capsule to resist adverse conditions in the new environment. Once established, some microorganisms can survive even in meager environments for long periods of time. For example, Vibrio cholerae is reported to have longterm persistence in potable and brackish water (Huq et al., 1983; Roberts eta]., 1982).
ENVIRONMENTAL BIOLOGICAL PROCESSES
71
C. GENETIC EXCHANGEIN THE ENVIRONMENT Once release, dispersion, and then survival within the new environment has occurred, the organism is capable of transferring its genetic traits to other members of the ecosystem. Although the designers of most novel organisms would prefer very little genetic exchange to take place, this cannot be guaranteed, as there are numerous examples of genetic exchange within the environment. The potential for gene transfer is quite large. Genes can be transferred between the same species. Burton et al. (1974) showed the transfer of multiple-drug-resistance plasmids between different strains of Staphylococcus aureus in the kidneys of mice. Gene transfer can occur between members of the same genus. Hartmann et al. (1979) have shown that, in a mixed culture of Pseudomonas sp. strain B13 and Pseudomonas putida mt2, the TOL plasmid was transferred from P. putida mt2 to Pseudomonas sp. strain B13. Gene transfer can occur between different genera. Grabow and Prozeski (1973) studied the transfer of multiple-drug-resistance plasmids in the bacterial population of the tertiary treatment stage of a wastewater treatment plant. It was shown that drug-resistance plasmids were transferred between Escherichia coli and Salmonella typhi in vitro and that, in the wastewater, there was a threefold increase in coliforms carrying drug resistance. In mixed bacterial infections of burn tissue, Roe et al. (1971) found that the plasmid P I , carrying resistance to carbenicillin, was transferred between the genera Escherichia, Pseudomonas, Proteus, and Klebsiella. A postulated pathway of gene exchange between microorganisms can be seen in Fig. 1. Gene transfer can occur between microorganisms and plants. For example, an Agrobacterium sp. can transfer some of its plasmid DNA to dicot plant cells. Industrially important stains of Agrobacterium include Agrobacterium tumefaciens and Agrobacterium rhizogenes (Chilton et al., 1983). Gene transfer can occur between microorganisms and animals and, more significantly, between microorganisms and man. Smith (1975, 1977) showed that a high frequency of R-factor (gene) occurred in vivo in sheep rumens. The R-factor gene occurred by transfer from E. coli, and the same result was observed in pigs and calves and in the human gastrointestinal tract. Most of the above examples occurred in the laboratory or under man-made conditions. However, there are many examples of gene transfer in the natural environment. For example, gene transfer between E.
72
M. S. THAKUR ET AL.
VMENTl
Bordetella
1 ANIMAL HOSTS I
I
Rhodospirillum
I
I
Bacteroides
FIG.1. Postulated pathways of genetic exchange between microorganisms. Adapted from Sayler and Stacey (1986).
coli strains within the intestinal tract, the natural environment for E. coli, has been reported (Marshall and Levy, 1980; Marshal et al., 1981; Petrocheilou et al., 1976).Transfer of plasmids on normal skin surface is also known (Lacey and Richmond, 1974). Lacy and Leary (1975a,b) demonstrated the transfer of drug-resistance plasmid RP1 from Pseudomonas aeruginosa to E. coli and from E. coIi to Pseudomonas glycinea on a plant surface. Renney et al. (1982) suggested that the environmental conditions occurring on the plant surface are suitable for plasmid transfer.
ENVIRONMENTAL BIOLOGICAL PROCESSES
73
Hada and Sizemore (1981)reported that more plasmid-containing bacteria were found in polluted coastal areas and that bacteria isolated from unpolluted areas had fewer plasmids. Similarly, more plasmidcontaining Pseudomonas species isolates were detected from a polluted area of a river than from a nearby unpolluted site (Burton et al., 1982). Plasmid transfer among soil microorganisms is assumed to occur regularly and to be of significance (Slater, 1985).Weinberg and Stotzky (1972)showed that a gene can be transferred between E. coli strains in soil. Schift and Klingmuller (1983)showed that the broad-host-range plasmid pRDl carried by E. coli could transfer to just over 1% of the total soil population. The most significant negative effect of gene exchange in the environment to date has been the transfer of antibiotic-resistance genes to organisms harmful to man. This problem is widespread. Bacteria resistant to antibiotics have been isolated in numerous places, for example, in hospital waste, raw sewage, water receiving sewage effluent (Fontain and Hoadley, 1976;Linton et al., 1974;Bell et al., 1981;Corliss et al., 1981;Sturtevant and Feary, 1969;Grabow and Prozesky, 1973),sediment from an off-shore sewage dump site (Timoney et al., 1978),coastal sediments (Grabow et al., 1975;Goyal and Hoadley, 1979),marine water (Smith, 1970, 1971;Feary et al., 1972;Smith et al., 1974;Goyal and Hoadley, 1979),estuaries and rivers (McNicon et al., 1980;Kelch and Lee, 1978),fisheries (Watanabe et al., 1971;Aoki et al., 1973),animal feed, abattoirs (La Font et al., 1981;Goyal and Hoadley, 1979),p h t s and soil (Talbot et al., 1980;Cole and Elkan, 1979),and drinking water (Armstrong et a]., 1981). In 1984,in West Bengal, India, 90,000people were seriously affected and 3290 died due to acute diarrhea. This epidemic was spread over the entire state of West Bengal and in 13 districts of Orissa, Assam, and Tripura. The National Institute of Cholera and Enteric Diseases in Calcutta suggested that the epidemic was due to new strains of virulent, antibiotic-resistant bacteria that were being generated by local ecological factors. These bacterial strains were resistant to ampicillin, tetracycline, and chloromycetin. Similar cases were also observed in Bastar in the state of Madhya Pradesh, India (Thakur, 1988).
Ill. Risk Assessment
Risk may be defined as a measure of the likelihood and severity of harm and is generally assessed through three types of investigations (A1 Bourquin and Seidler, 1986):(1)exposure assessment (determining the
74
M. S. THAKUR ET AL.
conditions of exposure), (2) hazard identification (attributing adverse effects to the hazard), including dose-response assessment (relating exposure to effects), and (3) risk characterization (estimating overall risk). A useful descriptive model for the risk absessment of a biotechnology application was presented in a report by the U.S. Office of Technology Assessment in 1981. The report suggests a series of events that need to be considered in the assessment (Fiksel and Covello, 1986): 1. Formation: The creation of genetically altered microorganisms through deliberate or accidental means. 2. Release: The deliberate release or accidental escape of some of these microorganisms into the environment. 3. Proliferation: The subsequent multiplication, genetic reconstruction, growth, transport, modification, and death of these microorganisms in the environment, including possible transfer of genetic material to other microorganisms. 4. Establishment: The establishment of these microorganisms within an ecosystem niche, including possible colonization in human or other biota. 5. Effect on humans and ecological effects: Human or ecological effects occur, due to the interaction of the organisms with some host or environmental factor.
The hazardous situations that may arise are described by Krimsky and Fraenkel (1985) as follows: 1. A novel organism might be released into the environment with unpredictable and possible irreversible effects on the environment. 2. The release of a new microbial agent may infect humans or animals. 3. A conventional pathogen might have its host range broadened. 4. A rapid rise in application of large-scale biotechnological processes could result in bioeffluent that would place additional stress on the quality of land and water resources. 5. Organisms engineered to perform useful functions in the environment might produce adverse secondary effects of an unanticipated nature.
DIRECTRISK TO HUMANS
To evaluate the risk potential to humans we must first take into account how these microorganisms gain entry into humans. Humans have a natural protection against most bacterial infections, i.e., the skin and stomach. The skin maintains the sterile internal environment of
ENVIRONMENTAL BIOLOGICAL PROCESSES
75
human beings. Bacteria gain entry through abrasions and cuts in the skin. A similar kind of barrier exists throughout the intestinal tract and mucous membranes. Naturally occurring bacteria have intrinsic traits that aid in their ability to colonize, and protect against competitive colonization by invading potential pathogens (Levy, 1986). Human infection depends on four major interacting factors (Levy, 1986): (1)the intrinsic traits, including pathogenicity, of the organisms, (2) the numbers of invasive organisms, (3) the health of the individual, and (4) the first and second lines of antimicrobial defense. Human infections can occur with low doses of pathogen (Levy, 1986). For example, infection has been reported with a dose of just 10 microorganisms (tularemia; see Table I). An indirect measure of infection potential can be obtained from an evaluation of the relative frequency of various organisms in causing laboratory-acquired infection (see Table 11; the two entries for Streptococcus result from independent studies). A more direct measure would be the number of cases of infection per number of total exposures, but often these data are not available. There are several lists that classify microorganisms based on their hazards to humans. For example, the working group on “Safety in Biotechnology of the European Federation of Biotechnology” has accepted a classification of microorganisms based on their pathogenicity (Kuenzi et al., 1985; Frommer et al., 1989).These classifications provide a good starting point for the evaluation of the risk involved in the release of a microorganism into the environment. IV. Case Studies
Genetically engineered organisms are being exploited to develop processes for the production of many important biologics. Some of the bioprocesses that might use genetically engineered organisms are TABLE I INFECTIOUS DOSEREQUIREDFOR DISEASE TO OCCUR”
Disease or agent
Route
Dose
Tularemia Shigella flexneri Anthrax Typhoid fever Cholera Escherichia coli
Inhalation Inhalation Inhalation Ingestion Ingestion Ingestion
10 180 1300
Adapted from Levy (1986).
1o5 1o8 108
76
M. S . THAKUR ET AL. TABLE I1
KNOWN LABORATORY-ACQUIRED INFECTION FROM 1930 TO 19744 Disease or agent
Number of cases
Number of deaths
Brucellosis Typhoid Tularemia Tuberculosis Streptococcus Leptospirosis Salmonellosis Relapsing fever Anthrax Erysipeloid Diphtheria Streptococcus Rate bite fever Glander Syphilis Cholera Plague Neisseria meningitides Pseudomonas pseudomallei Clostridium Tetanus toxin Mixed infection Dermatomycosis Coccidioidomycosis Histoplasmosis Sporotrichosis Blastomycosis
423 256 225 176 78 68 48 45 45 43 33 29 21 20 15 12 10 8 8 6
5 20 2 2 4
5 5
161 93 71 12 11
0 0
2 5 0 0
1 0 0
0 4 4 1 0 0 0 0 0
2 1 0 2
From Levy (1986).
(1) food bioprocesses, (2) pharmaceutical and enzyme bioprocesses, (3) waste treatment, (4) chemical bioprocesses, (5) mining, ( 6 )and agri-
culture. A. FOODBIOPROCESSES
A wide variety of food products are made by utilizing the action of microorganisms. Many of these processes have been practiced for thousands of years, for example, the production of cheese, beer, wine, and vinegar. The main hazard involved with the use of microorganisms in food bioprocesses is the contamination of the food product with toxic chemicals. There are many examples of serious illness and, more rarely,
ENVIRONMENTAL BIOLOGICAL PROCESSES
77
death occurring due to the consumption of food contaminated with toxigenic fungi (Smith, 1985). Though contamination of food products can be avoided, many industrial strains of microorganisms produce toxic compounds. For example, Maing et al. (1973) and Yokotsuka et al. (1967) investigated several industrial strains of Aspergillus spp. used in food fermentation. About 30% of these strains produced aflatoxinrelated compounds. The use of a genetically engineered yeast has already caused problems in the food industry. In Japan, the Kitono Homare Shuzo company stopped making sake using a yeast fused with a killer yeast that would destroy any invading microorganisms. This was because of the danger of the killer yeast contaminating other fermentation tanks, necessitating the establishment of a separate facility (Martin, 1989).
B. PHARMACEUTICAL AND ENZYME BIOPROCESSES Biotechnology enables manufacture of a wide range of drugs, therapeutics, and enzymes. Microbial enzyme products must meet strict specifications with regard to toxicity and other safety aspects geared toward protecting the manufactury workers (Aunstrup et al., 1979). Most enzyme products cannot be made 100% pure and may contain potentially harmful compounds from the fermentation broth, because purification is rarely completely effective. For example, toxic phospholipase C, which is formed by several pathogenic bacteria, along with other unknown toxins may be present in crude preparations of microbial enzymes or other products (Aunstrup et al., 1979).Like all proteins, enzymes are antigenic and may cause an allergic reaction-the most important factor is the amount of “dust” that arises from handling the enzyme. Enzyme preparations should preferably be encapsulated in an inert material (Aunstrup et al., 1979; Harris and Rose, 1972). Historically, the most visible problems involving enzymes and human health have been in the production of detergent proteases. These problems, involving enzyme dusts, have now been solved by encapsulation technology, but the problem was severe enough to lead to the formation of guidelines by an ad hoc committee on enzyme detergents of the Medical Sciences Division of the United States National Academy of Sciences (Ward, 1983). Another problem occurs in the area of vaccine production. Extreme care is required in the inactivation of the virus to ensure that no residual live virus is present in the vaccine (Jawetz et al., 1974). Genetic engineering may enable us to bypass this hazard. The gene that encodes for the viral coat protein can be placed on a plasmid in a bacterium, thereby
78
M.S.THAKUR ET AL.
enabling the bacterium to produce the viral protein in large quantities through conventional fermentation (Paul, 1981).However, this leads to another problem, which also affects other protein products. All products, especially those for human use, should be free of bacterial DNA, and the complete removal of DNA from many products is a problem. Complex analytical procedures are often required to verify that the product is indeed nucleic acid free. C. WASTETREATMENT In wastewater treatment, organisms are used in an effluent stream that enhances their growth, thereby helping them break down organic materials. Microorganisms and their activity are used to detoxify and degrade sewage and industrial wastes (Andern and Lockett, 1914; Jones, 1976). The activated sludge process, developed early in this century, has depended on indigenous microorganisms in the waste stream. However, today, inoculum cultures for use in waste treatment are marketed by about 20 companies all over the world (Gamer, 1979). Efforts are underway to improve the efficiency of treatment plants by adding specially cultured or genetically engineered bacteria (Krimsky and Fraenkel, 1985).Pseudomonas putida endowed with multiple compatible plasmids from other strains, giving unique multisubstrateutilizing capabilities, has been patented (Chakrabarty, 1974). The specific plasmids were for octane, xylene, m-xylene, camphor, and salicylate degradation. Microorganisms have been developed on a laboratory scale for degrading industrial organic compounds such as polychlorinated biphenyl and the herbicide 2,4,5-trichlorophenoxyacetic acid (2,4,5-T) (Krimsky and Fraenkel, 1985). The degradation of many xenobiotic compounds (Best et al., 1985) is often the result of concerted metabolic activity by different members of a stable, highly interactive microbial community (Senior et al., 1976). Slater (1985) reported that a haloaromatic compound can be degraded by microorganisms. Dorn et al. (1974) isolated Pseudornonas sp. strain B13, which can grow on benzoate. In the case of wastewater treatment, the microorganisms may have a direct man-made pathway into the environment. Some policy managers are concerned that novel organisms developed for sewage treatment may constitute a new form of pollution (Johnston, 1981).
D. CHEMICAL BIOPROCESSES Various acids, solvents, and other chemicals have been manufactured by microbial fermentation. According to Eveleigh (1981), microorganisms currently produce about 200 substances of commercial value.
ENVIRONMENTAL BIOLOGICAL PROCESSES
79
Problems may arise if the microorganism used to produce a valuable product is a pathogen. Production of gibberellic acid in a solid medium by Gibberellafujikuroi, which is a pathogen to the rice plant, may pose a problem to rice crops if proper care has not been taken to remove the plant pathogen in downstream processing. Another example of a plant pathogen is Xanthomonas campestris, which produces xanthan. Zaugg and Swartz (1982)have noted that the biochemical industry has a poorer record than the pharmaceutical industry in areas related to worker safety and environmental protection.
E. MINING Bacteria have been used to leach metals from low-grade ores of copper and uranium. The genus Thiobacillus is commonly used for this purpose (Norris and Kelly, 1982;Tuovinen, 1986).Zaugg and Swartz (1982) cite the following potential hazards in the use of organisms in the mining industry: 1. Bacterial leaching operations that generate large quantities of sulfuric acid acidify water supplies. 2. Thiobacillus and related species may acquire the ability to infect humans by natural interaction with pathogenic organisms. 3. Metals concentrated by bacteria from dilute mine water can accumulate in the food chain.
F. AGRICULTURE 1. Microorganisms
The deliberate release of microorganisms to control plants and insects is of great significance, because widespread dispersion of the microorganisms is practiced. Currently, 13 microbial pesticide agents are approved and registered with the Environmental Protection Agency. These 13 organisms are marketed in 75 different products for use in agriculture, forestry, and insect control (Betz et al., 1983). Bacillus thuringiensis carries a gene that codes for a protein called Bt toxin. The protein breaks down in the gut of some insects to form poisonous polypeptides, disrupting the gut membrane and eventually killing the insect (Wickelgren, 1989).The release of the plant pathogen Puccinia chondrillina has been used successfully to control skeleton weed in Australia (Klingman and Coulson, 1982). [For a list of the genetically engineered microorganisms that have been approved (or are under consideration) by the United States Environmental Protection Agency under the Toxic Substances Control Act for field tests, see the publication by the National Wildlife Federation (1990).]
80
M. S.THAKUR ET AL.
2. Plants, Insects, and Animals
Numerous trials of genetically engineered plants are now underway. [For a list of genetically engineered plants that have been approved (or are under consideration) by the United States Department of Agriculture under the Federal Plant Pest Act for field tests, see the publication by the National Wildlife Federation (1990).] The potential problem with genetically altered plants is that changes in the genetic structure might enable production of toxic products. Wickelgren (1989)states that a new gene might alter a plant’s ability to produce toxins either by increasing levels of the plant’s natural toxin or by coding for a new toxic product. Shuffling of genes has elevated levels of natural plant toxins in the past, according to J. Doyle, Director of the Agriculture and Biotechnology project of the Environmental Policy Institute in Washington, D.C. In 1980,he noted that scientists bred a new kind of potato that had an increased concentration of toxin. The USDA later pulled the poisonous “Lenape” potato off the market (Wickelgren, 1989). In 1973, plant breeders produced by accident a corn cultivar that was highly susceptible to a common leaf fungus, and corn crops in the United States, from Louisiana to Maine, were destroyed (Mellon, 1988). A transgenic organism is defined as an organism engineered to contain DNA from dissimilar parent organisms. Transgenic mice, pigs, cows, sheep, fish, and insects have been produced. Animals are genetically modified to produce leaner meat with improved nutritional properties. Attempts are being made to produce drugs such as blood clot-dissolving enzymes in mice or cows. Some scientists are interested in producing leaner pork by introducing a growth hormone gene into pigs. Unexpectedly, the pigs containing the growth hormone gene were arthritic, blind, and lacked competent immune systems (Mellon, 1988). An inadvertent effect was caused when traditionally genetically modified “killer” bees caused 700 deaths in Central and South America. V. The Regulation of Biotechnological Processes
The potential hazards resulting from the release of genetically engineered organisms into the environment were initially raised at the Gordon Research Conference on Nucleic acids in July, 1973 (Hartl, 1985).One of the early local initiatives for regulation of recombinant microorganisms was a 3-week moratorium by Cambridge, Massachusetts, on recombinant DNA research at the Massachusetts Institute of Technology and Harvard University. Later in 1976,Cambridge passed an ordinance for the safe use of microorganisms (Huber, 1987).Today
81
ENVIRONMENTAL BIOLOGICAL PROCESSES TABLE 111 THEUNITEDSTATESFEDERAL BIOTECHNOLOGY FRAMEWORK"
Agency
Status
United States Department of Agriculture
United States Environmental Protection Agency United States Food and Drug Administration United States National Institutes of Health
Jurisdiction
Plant Pest Act
Plant pests
Virus-Serum Toxin Act Federal Insecticide, Fungicide, and Rodenticide Act Toxic Substances Control Act Food, Drug, and Cosmetic Act
Animal biologics Pesticides
Guidelines for research involving DNA molecules
Chemical substances Food, drugs, biologics, and cosmetics Organisms produced by certain modern techniques
Organisms currently regulated Plants, invertebrate animals, and microorganisms Microorganisms Microorganisms
Microorganisms Plants, animals, and microorganisms Plants, animals, and microorganisms
Adapted from Mellon (1988).
there is an extensive network of agencies and regulations governing the use of genetically modified organisms (see Table 111). THEPROBLEMS OF REGULATING BIOTECHNOLOGY The regulations governing biotechnology are complex and government approval is required for field testing genetically novel organisms. These regulations have led to high costs and long delays for companies wishing to test new products in the environment. For example, due to the strict regulation of biotechnological products in the United States Genentech encountered needless delays and expenses while the USDA and FDA argued for more than a year over which agency should regulate the company's new bovine interferon (Huber, 1987). The regulations attempt to strike a balance between protecting the environment and man while at the same time not stifling new advances and benefits to society. One of the consequences of the comprehensive regulation of biotechnology in some countries is that often these regulations are avoided
82
M. S. THAKUR ET AL.
by conducting trials in other countries, where regulation is not as strict. For example, researchers at Oregon State University went to New Zealand to conduct field trials against the insect-borne Sindbis viruses that plague animals (Huber, 1987). Some biotechnology companies are collaborating with Japanese companies so that tests can be conducted abroad without United States government involvement (Huber, 1987). VI. Conclusions
Rapid advances in genetic engineering since the 1970s have created the potential for large benefits to society through the development of novel organisms and new products. The development of these organisms has been so successful that there has been a rapid increase in the number of government-approved releases of genetically engineered organisms over the past few years. However, this potential is balanced by the introduction of new problems and potential hazards. Historically, mankind has not dealt well with the introduction of new technology or species into the environment, and many inadvertent negative effects have been observed. Biotechnology is no exception to this. One of the most significant problems facing the release of a novel organism into the environment is a lack of data. One of the major concerns is that a significant amount of gene exchange occurs between various species. Bacterial antibiotic resistance provides the most spectacular example of this. If we cannot adequately describe in detail the effects of the release on the environment, then the risk associated with an exposure cannot be assessed. To protect public safety and the environment, the United States and many other countries have created a number of regulatory agencies and regulations. These regulations try to set a balance between overburdening the industry with excessive requirements that limit the development of many beneficial products and avoiding environmental damage and risks to the public health. Unfortunately, strict regulations in some countries have led to exposure to unknown risks in other countries that lack adequate regulations. ACKNOWLEDGMENT
The authors gratefully acknowledge the use of facilities at the Massachusetts Institute of Technology and the University of Maryland, Baltimore County, in the preparation of this article.
ENVIRONMENTAL BIOLOGICAL PROCESSES
83
REFERENCES A1 Bourquin, and Seidler, R. (1986).In “Biotechnology and the Environment, Research Needs” (G. S . Omenn and A. H. Teich, eds.), pp. 18-69.Noyes Data Corp., Park Ridge, New Jersey. Andern, E., and Lockett, W. T. (1914).J. SOC.Chem. Ind. 33,1122-1124. Antebi, E., and Fishlock, D. (1986).“Biotechnology: Strategies for Life.” MIT Press, Cambridge, Massachusetts. Aoki, T., Eugusa, S . , and Watanabe, T. (1973).Jpn. J. Microbiol. 17,7-12. Armstrong, J. L., Shigeno, D. S . , Caomiris, J. J., and Seidler, R. J.(1981).Appl. Environ. Microbiol. 42,277-283. Aunstrup, K., Andereson, O., Falch, E. A,, and Nielsen, T. K. (1979).In “Microbial Technology” (H. J. Pepper and D.Perlman, eds.], pp. 281-309. Academic Press, New York. Barnthouse, L. W., and Palumbo, A. V. (1986).In “Biotechnology Risk Assessment, Issues and Methods for Environmental Introductions” (J. Fiksel and V. T. Covello, eds.), pp. 109-128. Pergamon, New York. Bell, J. B., Macrae, W. R., and Elliott, G.E. (1981).Appl. Environ. Microbiol. 42,204-210. Best, D. J., Jones, J., and Stafford, D. (1985).In “Biotechnology Principles and Application” (I. J. Higgins, D.J. Bes, and J. Jones, eds.), pp. 213-256. Blackwell, Oxford. Betz, F., Levin, M., and Rogul, M. (1983).Recomb. DNA Tech. Bull. 6,135-141. Burton, G. C., Hirch, D. C., Blenden, D. C., and Zeigler, J. L. (1974).In “The Normal Microbial Flora of Man” (F. R. Skinner and J. G . Carr. eds.), pp. 241-253. Academic Press, London. Burton, N. F., Day, M. A., and Bull, A. T. (1982).Appl. Environ. Microbiol. 44,1026-1029. Chakrabarty, A. (1974).U S . Pat. 3,813,316. Chilton, M. D., Defronon, A., and Fraley, R. (1983).Miami Winter Symp. 15th Abstr. Cole, M. A., and Elkan, G. H. (1979).Appl. Environ. Microbiol. 37,867-870. Coombs, J.(1986).“Dictionary of Biotechnology,” Elsevier, New York. Corliss, T. L., Cohen, P. S . , and Cabelli, V. J. (1981).Appl. Environ. Microbiol. 41, 959-966.
Demain A. L. (1986).“Lecture Notes in Industrial Microbiology Course 20.821.” Mass. Inst. Technol., Cambridge. Demain, A. L., and Solomon, N. A. (1981).In “Industrial Microbiology and the Advent of Genetic Engineering.” Freeman, San Francisco, California. Dorn, E., Hellwing, M., Reineke, W., and Knackmuss, H. J. (1974).Arch. Microbiol. 99, 61-70.
Eveleigh, D. E. (1981).Sci. Am. 245, 155-178. Feary, T. W., Sturtevant, A. B., and Linkford, J. (1972).Arch. Environ. Health 25,215-220. Fiksel, J. R., and Covello, V. T. (1986).In “Biotechnology Risk Assessment, Issues and Methods for Environmental Introductions” (J. Fiksel and V. T. Covello, eds.), pp. 8-9. Pergamon, New York. Fontain, T. D., and Hoadley, A. W. (1976).Health Lab. Sci. 13,238-245. Forbush, E. H., and Fernald, C. H. (1896).“The Gypsy Moth, Portheria Dispar.” (Linn) Wright & Potter, Boston, Massachusetts. Frommer, W., Ager, B., Archer, L., Brunius, G., Collins, C. H., Donikian, R., Frontali, C., Hamp, S.,Houwick, E. H., Kuenzi, M. T., Kramer, P., Lagast, H., Lund, S . , Mahler, J. L., Normand-Plessier, F., Sargeant, K., Tuijnenburg Muijs, G., Vranch, S. P., and Werner, R. G. (1989).Appl. Microbiol. Biotechnol. 309,541-552.
a4
M. S. THAKUR ET AL.
Gasner, L. L. (1979).In “Microbial Technology” (H. J. Pepper and D. Perlman, eds.), pp. 211-222. Academic Press, New York. Goyal, S. M., and Hoadley, A. W. (1979).Rev. Microbiol. 10, 50-58. Grabow, W. 0.K., and Prozesky, 0. W. (1973).Antirnicrob. Agents Chernother. 3, 175180.
Grabow, W. 0. K., Prozeski, 0.W., and Burger, J. S. (1975).Water Res. 9 777-782. Hada, M. S.,and Sizemore, R. K. (1981).Appl. Environ. Microbiol. 41,199-202. Harris, R. G., and Rose, T. J. (1972).Br. Pat. 1,343,963. H a d , D. L. (1985).In “Engineered Organisms in the Environment: Scientific Issues” (H. 0. Halvorson, D. Pramer, and M. Ragul, eds.), pp. 83-88. Am. SOC.Microbiol., Washington, D.C. Hartmann, J., Reineke, W., and Knackmuss, H. J. (1979).Appl. Environ. Microbiol. 37, 421-428.
Hopwood, D. A. (1981).In “Industrial Microbiology and the Advent of Genetic Engineering.” Freeman, San Francisco, California. Huber, P.W. (1987).Technol. Rev. Nov./Dec., pp. 57-65. Huq, A., Small, E. B., West, P. A., Huq, M. I., Rehman, R., and Colwell. R. R. (1983).Appl. Environ. Microbiol. 45,275-283. Jawetz, E., Melnick, J. L., and Adelberg, E. A. (1974).Review of Medical Microbiology,” 11th Ed. Lange Med. Publ., Los Altos, California. Johnston, J. B. (1981).Proc. Genet. Eng., Int. Conf. Reston, Va. 4, 184-191. Battelle Mem. Inst., Seattle, Washington. Jones, G. L. (1976).Process Biochern. 11,3-5. Kelch, W. J., and Lee, J. S. (1978).Appl. Environ. Microbiol. 36,450-456. Klingman, D. L., and Coulson, J. R. (1982).Plant Dis. 66,1205-1209. Krimsky, S., and Fraenkel, A. H. (1985).In “Comprehensive Biotechnology” (M. MooYoung, ed.), Vol. 4,pp. 609-632. Pergamon, New York. Kuenzi, M., Assi, F., Chemiel, A., Collins, C. H., Donikian, M., Dominguez, J. B., Financsek, L., Fogarty, L. M., Frommer, W., Hasko, F., Hovland, S., Houwink, E. H., Mahler, J. L., Sandkvist, A., Sargent, K., Sloover, C., and Tuijnenburg Muijs, G. (1985).Appl. Microbiol. Biotechnol. 21,1-6. Lacey, R. W., and Richmond, M. H. (1974).Ann. N.Y.Acad. Sci. 236,395-412. Lacy, G. H., and Leary, J. V. (1975a).J. Gen. Microbiol. 88,49-57. Lacy, G. H., and Leary, J. V. (1975b).Ann. N.Y.Acad. Sci. 236,395-412. La Font, J.P., Guillot, J. F., Chaslus-Dancla, E., Dho, M., and Eucher-Lahan, M. (1981). Bull. Inst. Pasteur [Paris) 79,213-231. Levy, S.R. (1986).In “Biotechnology Risk Assessment, Issues and Methods for Environmental Introductions” (J. Fiksel and V. T. Covello, eds.), pp. 56-74. Pergamon, New York. Linton, K. B., Richmond, M. A., Bevan, R., and Gillespie, W. A. (1974).1. Med. Microbiol. 7,91-102.
McNicon, L. A., Aziz, K. M. S., Huq, I., Kaper, J. B., Lockman, H. A., Remmers, E. F., Spira, W. M., Voll, M. J., and Colwell, R. R. (1980).Antirnicrob. Agents Chernother. 17, 477-483.
Maing, I. V., Ayers, A. C., and Koehler, P. F. (1973).Appl. Environ. Microbiol. 25, 1015-1017.
Marshal, B., and Levy, S.B. (1980).Nature [London) 286,524-525. Marshal, B., Schluederberg, S., Tachibana, C., And Levy, S.B. (1981).Gene 14,145-154. Martin, C. C.(1989).Genet. Eng. News 9(8),1-15. Mellon, M. (1988).“Biotechnology and the Environment: A Primer on the Environmental
ENVIRONMENTAL BIOLOGICAL PROCESSES
85
Implications of Genetic Engineering,” pp. 12-64. Nat. Biotechnol. Policy Cent. Environ. Qual. Div., Nat. Wildl. Fed., Washington, D.C. Merkel, H. W. (1906).N.Y. Zool. SOC.Annu. Rep. 10,97-103. National Wildlife Federation (1990).“The Gene Exchange,” Vol. 1(1),pp. 1-11. Natl. Wildl. Fed., Washington, DC. Norris, P. R., and Kelly, D. P. (1982).In “Microbial Interactions and Communities” (A. T. Bull and J. H. Slatter, eds.), pp. 443-474. Academic Press, New York. Paul, J. K. (1981).”Genetic Engineering Applications for Industry,” Chemical Technology Review, No. 197.Noyes Data Corp., Park Ridge, New Jersey. Petrocheilou, V. J., Grinsted, J,, and Richmond, M. H. (1976).Antimicrob. Agents Chemother. 10, 753-761. Pimmentel, D. (1985).In “Engineered Organisms in the Environment: Scientific Issues” (H. 0. Halvorson, D. Pramer, and M. Ragul, eds.), pp. 129-140. Am. SOC.Microbiol., Washington, D.C. Renney, D. C., Kally, W. J., and Robert, W. P. (1982).In “Microbial Interactions and Communities” (A. T. Bull and J. H. Slatter, eds.), pp. 287-322. Academic Press, New York. Roberts, N. C., Siebeling, R. J., Kaper, J. B., and Brandford, H. B., Jr. (1982).Microb. Ecol. 8, 299-312.
Roe, E., Jones, R. J., and Lowbury, E. J.L. (1971).Lancet i, 149-152. Sayler, G., and Stacey, G. (1986).In “Biotechnology Risk Assessment, Issues and Methods for Environmental Introductions” (J. Fiksel and V. T. Covello, eds.), pp. 35-74. Pergamon, New York. Schift, W., and Klingmuller, W. (1983).Recomb. DNA Tech. Bull. 6,101-102. Senior, E., Bull, A. T., and Slater, J. H. (1976).Nature [London) 263,476-479. Slater, J. H. (1985).In “Engineered Organisms in the Environment: Scientific Issues” (H. 0. Halvorson, D. Pramer, and M. Ragul, eds.), pp. 83-88. Am. SOC.Microbiol., Washington, D.C. Smith, H. W. (1970).Nature [London) 228,1286-1288. Smith, H. W. (1971).Nature [London) 234, 155-156. Smith, J. E. (1985).In “Comprehensive Biotechnology” (M. Moo-Young, ed.), Vol. 4,pp. 543-585. Pergamon, New York. Smith, J. E. (1988).In “Biotechnology” (J. E. Smith, ed.), pp. 1-10. Arnold, London. Smith, L. B., and Hardley, C. H. (1926).U.S.Dep. Agric., Circ. No. 363,1-66. Smith, M. G.(1975).Nature [London) 261,348. Smith, M. G. (1977).J. Med. Microbiol. 10,29-35. Smith, P. R., Farrel, E., and Dunican, K. (1974).Appl. Microbiol. 27,983-984. Stead, D. G. (1935).“The Rabbit in Australia.” Winn, Sydney. Sturtevant, A. B., and Feary, T. W. (1969).Appl. Microbiol. 18,918-924. Talbot, H. W., Yamamoto, D. Y., Smith, M. W., and Seidler, R. J. (1980).Appl. Environ. Microbiol. 39,97-104. Thakur, M. S. (1988).Nat. Summer Inst. Sir Hari singh Gour Univ., Sagar [M.P.), India Pap. Timoney, J. F., Port, J., Giles J., and Spanier, J. (1978).Appl. Environ. Microbiol. 36, 465-472.
Tuovinen, 0. H. (1986).In “Workshop on Biotechnology for the Mining, Metal-Refining and Fossil Fuel Processing Industries” (H. L. Ehrlich and D. S. Holmes, eds.), pp. 65-72. Wiley (Interscience), New York. Ward, 0. P. (1983).In “Microbial Enzyme and Biotechnology” (W. M. Fogarty, ed.), pp. 251-288. Appl. Sci., London.
86
M. S. THAKUR ET AL.
Watanabe, T., Aoki, T., Ogata, Y., and Eugusa, S. (1971).Ann. N.Y. Acad. Sci. 182, 383-410. Weinberg, S. R., and Stotzky, G. (1972).Soil Biol. Biochem. 4,171-180. Wickelgren, I. (1989).Sci. News 136(8),113-128. Winchester, A. M. (1977).“Heredity: An Introduction to Genetics,” 3rd Ed. Barnes & Noble, New York. Yokotsuka, T., Sasaki, M., Kikuchi, T., Asao, Y., and Nabuhara, A. (1967). Nippon Nogei Kagaku Kaishi 41,32-38. Zaugg, R. H., and Swartz, J. R. (1982). Recomb. DNA Tech. Bull. 5, 7-13.
Fate of Recombinant Escherichia coli K-12 Strains in the Environment GREGGBOGOSIANAND JAMES F. KANE Animal Sciences Division Monsanto Company St. Louis. Missouri 63198 I. Introduction 11. Construction and Properties of pBR322 A. Conjugational Transfer of pBR322 B. Stability of pBR322 C. Factors Affecting Conjugational Transfer 111. Fate of E. coli and Related Organisms in Water Conjugational Transfer with Organisms Inhabiting Water IV. Fate of E. coli and Related Organisms in Soil A. Survival in Sterile Soil B. Survival in Nonsterile Soil C. Conjugational Transfer with Organisms Inhabiting Soil V. Fate of E. coli and Related Organisms in Sewage Conjugational Transfer with Organisms Inhabiting Sewage VI. Fate of E. coli K-12 in the Mammalian Intestinal Tract Conjugational Transfer with Organisms Inhabiting the Mammalian Intestinal Tract VII. Alternative Detection Methods for Recombinant Organisms in the Environment VIII. Conclusions References
I. Introduction
The advent of modern recombinant DNA techniques has ushered in an era of increasing use of engineered organisms for the production of desired proteins and other types of products. Most commonly, such production systems employ Escherichia coli K-12 strains containing recombinant plasmids derived from pBR322. The number of literature and patent reports of such systems is increasing rapidly, and E. coli protein production systems are now used on a commercial as well as a research scale. Typically, commercial production of proteins from recombinant strains of E. coli involves large-scale fermentation of the production strain. These industrial fermentations range in size from hundreds of liters to tens of thousands of liters, with culture densities attaining 1 X lo9 to 1 X 10" cells/ml (Calcott eta]., 1988). (or more] recombinant E. coli cells The prospect of up to 1 x being inadvertently released into the environment during some type of catastrophic industrial accident has ignited considerable interest in the 87 ADVANCES IN APPLIED MICROBIOLOGY, VOLUME 36 Copyright 0 1991 by Academic Press, Inc. All rights of reproduction in any form reserved.
88
GREGG BOGOSIAN AND JAMES F. KANE
determination of the likely consequences of such an event. Such interest has centered on whether recombinant E. coli K-12 strains can survive in natural environments and whether the recombinant plasmid they contain can be transferred to indigenous inhabitants of these environments. All of the studies to date have failed to grapple with the far more complicated question of what the environmental impact would be of such survival or transfer if it were to occur. This article is a review of the scientific literature dealing with the survival of E. coli K-12 strains containing recombinant plasmids derived from pBR322 and the potential to transfer such plasmids to other organisms in the environment. Studies involving transfer from other species of organisms or of other types of plasmids are included when pertinent. In addition, factors affecting such transfer are also considered. The environments covered in this review are soil, water, sewage, and the mammalian intestinal tract. Since the advent of recombinant DNA research, several more general reviews that have been published cover aspects not included here (Curtiss et al., 1977; Chatigny et al., 1979; Sharples, 1983; Stotzky and Babich, 1984, 1986; Rissler, 1984; Strauss et al., 1986; Regal, 1987;Roszak and Colwell, 1987; Tiedje eta]., 1989). The E. coli strain K-12 was isolated in 1922 from the feces of a convalescent diphtheria patient at the Stanford Medical School (Bachmann, 1987). The strain was stocked in the culture collection of the bacteriology department at Stanford, and was used as an E. coli standard in microbiology courses in that department. Years of laboratory cultivation led to the loss of the K and 0 antigens from this strain (I. Orskov and Orskov, 1960; F. Orskov and Orskov, 1961). Many subsequent studies, reviewed in this article, demonstrated that strains of E. coli K-12 did not persist in nonsterile water, soil, sewage, or the conventional mammalian intestinal tract. These studies indicated maximal survival times of approximately 15 days in water, 20 days in soil, 10 days in sewage, and 3-6 days in the intestinal tract of normal hosts. In considering the survival of E. coli K-12 strains in environments such as these, and the potential for transfer of recombinant plasmids from these strains to indigenous microbial inhabitants of such environments, several points should be kept in mind. The conjugative transfer of pBR322 or its derivatives requires several conditions. First, a conjugative plasmid is required to mediate conjugative pore formation. Second, a mobilization plasmid is required to provide trans-acting components of the transfer complex. Third, the pBR322 plasmid or derivative thereof has to contain functional born and nic sites (see later) involved in
ENVIRONMENTAL FATE OF RECOMBINANT E. coli K-12
89
transfer. Additionally, the only known habitat for E. coli is the intestinal tract of warm-blooded vertebrates (Brenner, 1984; Stanier et al., 1986). The presence of E. coli in soil or water is taken as evidence of recent (within 1 to 2 days) fecal contamination (Geldreich, 1966). Finally, as discussed in this review, E. coli K-12 is a strain not suited for survival in sewage or the mammalian intestinal tract. These features place E. coli K-12 strains at’a distinct disadvantage in environments outside the laboratory. When compounded with the stringent conditions required for gene transfer plus the limitations of pBR322-type plasmids, it is not surprising that the transfer of recombinant plasmids from strains of E. coli K-12 to indigenous inhabitants of water, soil, sewage, or normal intestinal tracts, in their natural environments, has never been demonstrated. II. Construction and Properties of pBR322
The plasmid pBR322 (Bolivar et al., 1977) is one of the most widely used cloning vehicles because of the extensive body of information on its structure and function (reviewed in Balbas et al., 1986, 1988). pBR322 consists of three distinct segments: a gene encoding tetracycline resistance, a gene encoding ampicillin resistance, and an origin of DNA replication. The tetracycline-resistance gene is derived from the naturally occurring R-factor pSCl01. The mechanism of action of this gene product places it in the class C tetracycline-resistance group, in that tetracycline is actively excluded from the cell. The ampicillinresistance gene is derived from the transposon Tn3. This gene encodes a TEM-1-P-lactamase, which catalyzes the conversion of penicillins to inactive penicilloic acids by hydrolysis of the p-lactam ring. pBR322 contains a relaxed (associated with replication proteins in vivo) origin of replication derived from pMB1. Plasmids pMBl and ColEl have essentially identical origins of replication; the only difference is a 2base-pair inversion (this is found at coordinates 2731-2732 on pBR322). Thus, pBR322 is said to have a ColEl-type origin of replication. In addition to the origin of DNA replication (ori), adjacent sequences from pMBl are also present on pBR322. These include the basis of mobility site (bom) and the site at which the plasmid DNA is nicked prior to transfer (nic), both of which are involved in conjugational transfer, and the repressor of primer (rop) gene. The rop gene encodes the 63-amino-acid Rop protein, which participates in the negative regulation of the frequency of initiation of DNA replication at ori (Cesareni et a]., 1984).
90
GREGG BOGOSIAN AND JAMES F. KANE
A. CONJUGATIONAL TRANSFER OF pBR322 Conjugational transfer is a process by which plasmid DNA is transferred (or mobilized) from one cell to another, usually with cells of the same species. The conjugative transfer of plasmid DNA is a complex process, requiring the concerted action of many gene products (reviewed in Clark and Warren, 1979; Willetts and Wilkins, 1984; IppenIhler and Minkley, 19861. Many large conjugative plasmids (such as F) are capable of autonomous transfer, whereas much smaller plasmids (such as ColE1) can only be transferred from a donor cell that also contains a conjugative plasmid. The role of the conjugative plasmid in mobilization of other plasmids seems to be to provide pilus-mediated cell contact and to mediate conjugation pore formation. As stated above, ColEl is a nonconjugative but mobile plasmid that contains two DNA segments, mob and bom, that are involved in mobilization (Warren et al., 1978). This plasmid appears to be transferred whole and unaltered, with no reports of cointegrates forming between ColEl and resident conjugative plasmids. The transfer of ColEl is an active rather than passive process, because Mob- derivatives of ColEl have been found. The conjugational mobility of ColEl appears to require both a diffusible gene product(s), encoded by the mob gene(s),and a mobility site on the plasmid DNA, designated born. The Mob- derivatives of ColEl can be mobilized if the donor cell also contains the plasmid ColK. Apparently, the ColK plasmid encodes a similar diffusible product(s) that is capable of complementing the missing mobilization factor(s) of the Mob- ColE1. Derivatives of ColEl that are Bomcannot be transferred. This deficiency cannot be complemented by an intact ColK plasmid. Another site on ColE1, termed nic, serves as the origin of conjugational transfer; as mentioned previously, it is the site at which the ColEl DNA is nicked prior to transfer. The nic site is located within the born site (Warren et al., 1978). 1. Function of the Mob Site
To test whether pBR322 can be mobilized, a series of biparental and triparental matings were performed (Bolivar et al., 1977). A biparental mating is one in which the conjugative plasmid and the nonconjugative plasmid coreside in one strain (the donor), and a second strain containing a chromosomal marker serves as the recipient. Selection is made for the presence of the resistance markers on the nonconjugative plasmid and the chromosomal marker of the recipient. For the biparental matings, E. coli K-12 strain C600 containing two plasmids was mated with the nalidixic acid-resistant E. coli K-12 strain SF185. In one set of
ENVIRONMENTAL FATE OF RECOMBINANT E. coli K-12
91
matings, C600 contained both the Mob+ plasmid ColEl and either the conjugative plasmid F-Km (of the FI incompatibility group) or the conjugative plasmid Rldrd (of the FII incompatibility group). Conjugative plasmids are classified into incompatibility groups on the basis of their inability to coexist in the same cell (Datta, 1979);in general, identical or related plasmids are incompatible and heterologous plasmids are compatible. Equal amounts of Luria broth (L-broth) cultures of both C600 containing either of the plasmid pairs and SF185 were mixed and held with no agitation for 24 hours at 37°C. In this type of biparental mating, ColEl was transferred to SF185 at a frequency of about 0.5 transfers/ cell124 hours. In the second set of biparental matings, C600 contained both pBR322 and either the F-Km or Rldrd conjugative plasmids. The mating with SF185 was performed in the same manner. In this case, no transfer of pBR322 to SF185 could be detected (< 1 X transfers/ cell124 hours). From this result, it was concluded that pBR322 was Mob-. A triparental mating is one in which the conjugative plasmid resides in one strain (the donor), the nonconjugative plasmid to be tested for mobilization resides in another (the intermediate), and a third strain carrying a chromosomal marker serves as the final recipient. The triparental mating thus tests for the ability of the conjugative plasmid to be transferred to the intermediate and there mobilize the nonconjugative plasmid for transfer to the final recipient. Selection is made for the resistance markers present on the nonconjugative plasmid and the chromosome of the final recipient. In this case, six different donors were tested, namely, E. coli K-12 strain J5-3, containing one of the following conjugative plasmids: F-Km (of the FI incompatibility group), Rldrd (of the FII incompatibility group), R144 (of the Ia incompatibility group), N3 (of the N incompatibility group), Sa (of the W incompatibility group), or RSF1040 (of the X incompatibility group). Two intermediate strains were tested, E. coli K-12 strains C600 or ~ 1 7 7 6containing , pBR322. The final recipient was E. coli K-12 strain W1485-1 (nalidixic acid resistant). The three strains (donor, intermediate, and final recipient) were grown at 37OC in L-broth containing diaminopimelate (DAP) and thymine to a density of 1-9 x lo8 celldml, and equal volumes of each culture were mixed and held at 37°C without agitation for 1, 4, or 24 hours before selective plating. In all cases, no transfer of pBR322 to W1485-1 could be detected (<1x transfers/cell/N hours). As a control, an intermediate strain containing the Mob+ plasmid pRSF2124 (ColE1 with an ampicillin-resistance gene) was used; this plasmid was transferred to W1485-1 at a frequency of 1 x lo-* transfers/cell/4 hours.
92
GREGG BOGOSIAN AND JAMES F. KANE
The observations of Bolivar et al. (1977)were confirmed and extended in a subsequent paper (Young and Poulis, 1978). A biparental mating was performed using strain C600 containing the conjugative plasmid F and pBR322 as the donor and a streptomycin-resistant derivative of C600 as the recipient, The strains were grown in minimal medium to midlogarthmic phase, equal quantities mixed, and held at 37°C with gentle shaking for 1 hour. Although the recipient cells were found to have received the F plasmid at a frequency of 8 X 10-1 transferslcelll hour, no transfer of pBR322 to the recipient could be detected (<2 x transfers/cell/hour). Two Mob+ control plasmids were used, pSF2124 and pGM706; both are ColEl with antibiotic-resistance elements. In identical biparental matings, pSF2124 was transferred to the recipient cells at a frequency of 1.4 x 10-1 transfers/cell/hour and pGM706 was transferred to the recipient cells at a frequency of 5 X lo-’ transfers/cell/hour. Next, Young and Poulis investigated the effect of the Mob+ ColK plasmid on the mobilization of pBR322 by conjugative plasmids. The E. coli K-12 strain GWllO containing the conjugative plasmid R64drdll (of the Ia incompatibility group], the Mob+ ColK derivative ColK235, and pBR322, as well as C600 containing the conjugative plasmid F and ColK235 and pBR322, were used as donors in biparental matings with streptomycin-resistant C600 as recipient, as described above. The R64drdll factor transferred to the recipient cells at a frequency of about 3 x 10-1 transfers/cell/hour; the F factor was transferred to the recipient cells at a frequency of 8 x 10-1 transfers/ cell/hour. In the presence of F and ColK235, no transfer of pBR322 to the transfers/cell/hour). However, recipient could be detected (<2 x in the presence of R64drdll and ColK235, the recipient cells received pBR322 at a frequency of 6 x lo-’ transfers/cell/hour. The pBR322 was found to have been transferred unaltered. From the results of the first biparental mating, it was concluded that a diffusible product(s) encoded by the mob gene(s) of ColEl (in this case, the ColEl derivatives pSF2124 or pGM706) was required for efficient mobilization of these ColEl derivatives by F or R64drdll. Furthermore, pBR322 was found to be defective; it does not carry the required mob gene(s) involved in ColEl transfer. From the result of the second biparental mating, it was concluded that ColK could provide the missing factor(s) in trans for R64drdll but not for F. Although the F factor mobilized ColEl effectively, it mobilized ColK very poorly (Hardy, 19751, suggesting that the conjugative factors from F and ColK were incompatible in effecting transfer. The nature of the mob region on ColEl has recently been elucidated (Boyd et al., 1989). The region was found to be composed of four
ENVIRONMENTAL FATE OF RECOMBINANT E. coli K-12
93
structural genes, all of which were required for mobilization of ColEl by the conjugative plasmid R64drdll. The four genes were designated mbeABCD; the mbeA gene encodes a 517-amino acid protein of molecular weight 58,000, the mbeB gene encodes a 172-amino acid protein of molecular weight 20,000, the mbeC gene encodes a 107-amino acid protein of molecular weight 13,000, and the mbeD gene encodes a 77-amino acid protein of molecular weight 9000. Similar proteins were found to be encoded by the corresponding region on ColK; these four genes were designated mbkABCD (Boyd et al., 1989). ColA is another colicinogenic plasmid with a mob region similar to that of ColEl and ColK (Morlon et al., 1988a);in the presence of R64drdl1, a derivative of the Born+ Mob- plasmid pUC8 carrying the ColA Mob+ region could be mobilized (Morlon et a]., 1988b). Presumably, pBR322 could be mobilized in the presence of a conjugative plasmid such as R64drdll and the Mob+ plasmid ColA. The four genes in the mob region of ColA were designated mbaABCD (Boyd et al., 1989). 2. Function of the bom and nic Sites
In addition to the diffusible factors encoded by the mob genes, the bom and nic sites on pBR322 were shown to be essential for mobilization by conjugative plasmids (Twiggand Sherratt, 1980).A derivative of pBR322 was constructed in which the HaeII fragment B was deleted; this is a deletion of 622 base pairs between the HaeII sites at coordinates 1731 and 2353 of pBR322, and includes the bom and nic sites as well as the rop gene. The resulting plasmid was designated pAT153. As a result of the deletion of the rop gene, the copy number of pAT153 was 1.5 to 3-fold higher than the parental plasmid pBR322. Biparental mating experiments were performed with pBR322 and pAT153; in this report, the E. coli K-12 strains used were not identified and the mating conditions were not specified. In the first biparental mating, the donor strain contained the conjugative plasmid R64drdll and either pBR322 or pAT153; no transfer of either nonconjugative plasmid to the recipient strain could be detected (<8 x transfers/cell for pBR322, and <1 x lop5 transferdcell for pAT153). In the second biparental mating, the donor strain contained R64drdll and the Mob+ plasmid ColK and either pBR322 or pATl53. With this donor strain, pBR322 was transferred to the recipient strain at a frequency of 9 X lo-’ transfedcell but no transfer of pAT153 to the recipient strain could be detected transferdcell). An additional biparental mating was done (<4 x with a derivative of ColE1, which lacked the same HaeII fragment: transfer of this plasmid was also undetectable. Thus, deletion of the bom
94
GREGG BOGOSIAN AND JAMES F. KANE
and nic sites rendered ColEl Mob- and eliminated the ColK-dependent R64drdll-mediated transfer of pBR322. The function of the bom and nic sites on pBR322 was further investigated by Covarrubias et al. (1981), who flipped the orientation of the HaeII fragment B to create the plasmid pBR3286. Biparental matings were performed with E. coli K-12 strain J53 containing either the conjugative plasmid R64drdll or R64drdll plus the Mob+ plasmid ColK, as well as either pBR322 or pBR3286, as the donor and E. coli K-12 strain J54 (nalidixic acid resistant) as the recipient. For the matings, the donor and recipient strains were grown in L-broth at 37°C until a density of 1 x 10' cells/ml was reached; the cultures were then mixed in a 1: 10 ratio of donor to recipient, respectively, and held without shaking at 37OC for 90 minutes prior to plating on a selective medium. In the presence of R64drdl1, no transfer of either pBR322 or pBR3286 to strain J54 could be detected (c2.5 x lo-' transfers/cell/90 minutes for transfers/cell/90 minutes for pBR3286). In pBR322, and C5.7 X the presence of both R64drdll and ColK, pBR322 was transferred to transfers/cell/90 minutes, but no strain J54 at a frequency of 6.4 x transfer of pBR3286 to strain J54 could be detected (<5.6 x transfers/cell/90 minutes). It was concluded that the orientation of the bom and nic sites relative to ori was crucial to the conjugational transfer of pBR322. Further investigations on the bom and nic sites were performed by Finnegan and Sherratt (1982) (Table I). They compared the activity of the diffusible gene products from the Mob+ plasmids ColK and ColEl on the transfer of pBR322. The ColEl mob gene products were provided by the plasmid pGJ28, a ColD replicon carrying the ColEl mob genes; pGJ28 was used as the source of the ColEl mob genes because ColEl and pBR322 (which has a ColEl-type origin of DNA replication) cannot coexist in the same cell. Three duplicate sets of biparental matings were performed for this analysis. The matings were carried out by mixing equal volumes of mid-logarithmic-phase L-broth cultures of donor cells TABLE I
FREQUENCY OF TRANSFER OF pBR322 AS A FUNCTION OF THE Mob+ PLASMID Conjugative plasmid R64drdll F'-lac-pro R388
Mob+ plasmid
Recipient
ColK pGJZE(ColE1) pGJ28(ColEl)
CSH27 CSH5l CSH51
Frequency of transfer of pBR322 8x
5.4
X
and 4.2 x lo-' >1 lo-* and 1.6 X low4
lo-'
ENVIRONMENTAL FATE OF RECOMBINANT E. coli K-12
95
with stationary-phase L-broth cultures of recipient cells, and holding the cells at 37°C for 2-3 hours without agitation prior to plating on selective medium. In this investigation, the identity of the E. coli K-12 strain used as donor was not reported. In the first set of biparental matings the donor strain contained the conjugative plasmid R64drdl1, the Mob+ plasmid ColK, and pBR322, and the recipient strain was CSH27; pBR322 was transferred to CSH27 at frequencies of 8 x lo-' and 4.2 x lo-' transfers/cell/2-3 hours. In the second set of biparental matings the donor strain contained the conjugative plasmid F' lac pro, the Mob+ plasmid pGJ28, and pBR322, and the recipient strain was CSH51; in both duplicate matings, pBR322 was transferred to CSH51 at a frequency of >1 transfer/cell/2-3 hours (i.e., all of the recipient cells had received at least one pBR322 molecule). In the third set of biparental matings the donor strain contained the conjugative plasmid R388 (of the W incompatibility group), the Mob+ plasmid pGJ28, and pBR322, and the recipient strain was CSH51; pBR322 was transferred to CSH51 at frequencies of 5.4 x lop4 and 1.6 x transfers/cell/2-3 hours. From these results, it was concluded that pBR322 can be mobilized from cells containing a conjugative plasmid and a plasmid providing the products of the mob genes from either ColK or ColE1. Additionally, these workers made deletion derivatives of pBR322, which narrowed the location of the born and nic sites down to a 141-base-pair HhaI fragment between coordinates 2 2 1 1 and 2352. In contrast to the results of Covarrubias et al. (1981),it was found that the orientation of the born and nic sites relative to ori made no difference on conjugational transfer. Finnegan and Sherratt suggested that Covarrubias et al. may have flipped a DNA fragment that resulted in an inactivated born site. 3. Deletion Derivatives of pBR322
A widely used derivative of pBR322 that lacks the rop gene and the born and nic sites is pBR327 (Soberon et al., 1980). This derivative was generated by partially digesting pBR322 with EcoRII to remove the fragment between coordinates 1441 and 2501, followed by treatment with S1 nuclease and religation to yield a plasmid that had lost a total of 1089 base pairs. This new plasmid, pBR327, was sequenced across the region of the deletion. The following DNA sequence was found:
***
GGCGCATCTCGGGCCGCGTTGCTG
I
I
2520 The coordinates given below the sequence are those of pBR322. The 1420
96
GREGG BOGOSIAN AND JAMES F. KANE
deletion end points lie within the 3-base-pair joint highlighted by the asterisks above the sequence; because of a 3-base-pair duplication in the region of the deletion end points, the exact location of the deletion end points could not be assigned. Because pBR327 lacks the rop gene, the copy number was elevated relative to that of pBR322; by one estimate, the copy number of pBR322 was 18 and that of pBR327 was 51 (Covarrubias et al., 1981).In addition, pBR327 lacks the born and nic sites, and so should not be mobilized under conditions that do mobilize pBR322. As stated above, this was the case for pAT153, a pBR322 derivative with a similar deletion of the born and nic sites (Twigg and Sherratt, 1980).Two biparental mating experiments with pBR327 confirmed this expectation (Covarrubias et al., 1981).The biparental matings were performed with E. coli K-12 strain J53 containing either the conjugative plasmid R64drdll or R64drdll plus the Mob+ plasmid ColK, as well as pBR327, as the donor and E. coli K-12 strain J54 (nalidixic acid resistant) as the recipient. For the matings, the donor and recipient strains were grown in L-broth at 37°C until a density of 1 x 10’ cells/ml was reached; the cultures were then mixed in a 1: 10 ratio of donor to recipient, respectively, and held without shaking at 37°C for 90 minutes prior to plating on a selective medium. In the presence of R64drdl1, no transfer of pBR327 to strain J54 could be detected (<7.8 x transfers/cell/90 minutes). In the presence of both R64drdll and ColK, no transfer of pBR327 to strain J54 could be detected (<4.8 x lo-’ transfers/cell/90 minutes). Control matings with pBR322 resulted in transfer in the presence of both R64drdll and ColK. In summary, the conjugational transfer of pBR322 requires three separate components: 1. Intact born and nic sites on the pBR322 plasmid molecule. 2. The four proteins encoded by the mbeABCD genes of a ColEl plasmid, or the similar proteins from a ColK or a ColA plasmid. 3. A conjugative plasmid. 4. Conjugational Transfer of Portions of pBR322
There have been two reports of transfer of portions of pBR322 in the presence of only a conjugative plasmid. Dougan et al. (1978) carried out a series of biparental matings in which the donor was either E. coli K-12 strain C600 or strain ~ 1 7 7 6each , containing both pBR322 and either the conjugative plasmid Rldrd or the conjugative plasmid R64-11 (of the Ia incompatibility group), or the conjugative plasmid N31 (of the N incompatibility group), and the recipient was strain SF185. The donor and recipient strains were grown at 37°C in L-broth containing DAP and thymine to densities of about 2.5 x lo7 cells/ml, and equal volumes of
ENVIRONMENTAL FATE OF RECOMBINANT E. coli K-12
97
each culture were mixed and held at 37°C without agitation for 6 hours before selective plating. With the donors that contained conjugative plasmid R64-11 or N31, no transfer of pBR322 to strain SF185 could be detected (<1 X lo-' transfers/cell/6 hours). However, with the donors that contained conjugative plasmid Rldrd, ampicillin resistance was transfers/ transferred to strain SF185 at a frequency of about 1 x cell/6 hours. An explanation for this observation was provided by Gealt et al. (1985), who performed a triparental mating using E. coli K-12 strain ~ 1 7 8 containing 4 the conjugative plasmid R100-1 as the donor, E. coli K-12 Dap- strain ~ 2 6 5 containing 6 pBR322 as the intermediate, and E. coli K-12 strain ~ 1 9 9 7(Dap+ and nalidixic acid resistant) as the recipient. The cultures were grown independently in L-broth prior to mixing; equal volumes of each culture (containing about 1.5 x 10' cells/ml of the intermediate, and about 2 X lo9 celldm1 of the donor and recipient) were mixed and held without agitation for 25 hours at 37°C before plating on a selective medium. Under these conditions, ampicillin resistance was transferred to ~ 1 9 9 at 7 a frequency of about 1 X lop4 transfers/cell/25 hours. Examination of the plasmid DNA present in the ampicillin-resistant ~ 1 9 9 7derivatives revealed that a cointegrate had formed between pBR322 and R100-1, consisting of the entire ampicillin-resistance element of pBR322 and all of R100-1. Thus, conjugational transfer of whole plasmids cannot always be detected by antibiotic resistance alone. In the absence of a mobilization plasmid, only segments of pBR322-derived plasmids can be transferred by conjugative plasmids; such segments can include antibiotic resistance genes, yielding false positive results. B. STABILITY OF pBR322
The maintenance and genetic stability of pBR322 has been investigated in a variety of studies. The presence of pBR322 had no effect on the efficiency of plating the E. coli K-12 strain ~ 1 7 7 either 6 on Luria agar (L-agar) containing DAP and thymine, or on M9 salts-casamino acid agar containing DAP and thymine, and no effect on the survival of ~ 1 7 7 6 in DAP-less media (Bolivar et al., 1977). There have been reports of plasmid loss when cultures of plasmid-containing cells were grown either in nutrient-limited chemostats or in batch cultures for over 30 generations. In glucose-limited or phosphate-limited chemostats without antibiotic selection, pBR322 was lost from E. coli K-12 strains W3110, W5445, and HBlOl after about 30 generations (Godwin and Slater, 1979; Jones et al., 1980;Wouters et al., 1980). Similarly, Vernet et al. (1985) found that in a phosphate-limited chemostat without antibi-
98
GREGG BOGOSIAN AND JAMES F. KANE
otic selection, pBR322 was lost from E. coli K-12 strain BW270 after about 25 generations. These results were in contrast to those of Noack et al. (1981), who observed that in glucose-limited or nitrogen-limited chemostats without antibiotic selection, pBR322 was stable for 75 generations in E. coli K-12 strains GY2354 or GM31. These apparent differences in plasmid stability likely can be attributed to different host cells and growth-limiting conditions. It would not be unexpected that the cellular responses to phosphate limitation would be different from those of glucose or nitrogen limitation. However, glucose limitation was common to the work of both Noack et al. and Jones et al., so it is worth examining their results more closely. Noack et al. used a limiting glucose concentration of 0.05% in a medium containing 0.01% casamino acids and the trace metals iron and manganese. Jones et al. used 0.02% glucose, with only the amino acids required by the hosts and calcium as supplements. Though these apparent differences in stability may implicate the role that the host strain has in this process, one should not discount the variations in the media used by these investigators as a possible explanation for the discrepancies. Chiang and Bremer (1988)examined the stability of pBR322 and some of its derivatives in the E. coli B/r strain HB117 grown in batch cultures. In these experiments the strain was inoculated into L-broth without antibiotics and was grown to maximal density and subcultured into fresh L-broth. Growth and subculturing were repeated over a 3- to 4-day time period. Under these growth conditions, pBR322 was lost from the cells within 60 generations. In addition to the question of the maintenance of pBR322, it is also important to determine the integrity of the plasmid DNA in the cells after extended periods of growth. Noack et al. (1981) isolated pBR322 from cells grown 75 generations in a chemostat and found that the plasmid was structurally unaltered. These results suggested that the maintenance of the plasmid in the majority of the population for such a long period of time did not predispose the plasmid to structural changes. In the chemostat experiments conducted by Jones et al. (1980), only 1% of the E. coli population retained pBR322 after 30 generations; nevertheless, plasmid DNA isolated from these cells did not differ in any respect from the parental pBR322. Thus, despite a condition that favored the loss of plasmid, no structural changes could be detected. Similar results were obtained by Reinikainen and Virkajarvi (1989)from strain HBlOl containing pBR322. After 300-400 generations in an Lbroth chemostat containing ampicillin (the growth-limiting factor in this case was unknown), the pBR322 plasmid was genetically stable.
ENVIRONMENTAL FATE OF RECOMBINANT E. coli K-12
99
C. FACTORS AFFECTING CONIUGATIONAL TRANSFER The biparental and triparental matings described above were all carried out under similar laboratory conditions. For the most part, both donor and recipient strains were grown at 37°C in L-broth, and were mixed in L-broth and held without agitation or with very gentle agitation at 37°C in order to facilitate conjugational transfer. Obviously, these conditions do not mimic those that would be encountered in natural environments. Studies on plasmid transfer in natural environments, or under conditions approximating natural environments, will be discussed in more detail below. There have been a number of studies addressing the question of what factors may affect conjugational transfer (reviewed in Holloway, 1979; Reanney et al., 1983; Freter, 1984). The rate of transfer of a variety of conjugative plasmids between E. coli K-12 strains has been shown to be affected by the growth rates of the donor and recipient strains, the state of aerobiosis, and the temperature. Plasmid DNA transfer was much more rapid with cells in the midlogarithmic phase of growth than in the stationary phase (Ozeki et al., 1962; Broda et al., 1977; Cullum et al., 1978; Levin et al., 1979), although the rate of cell-to-cell contact formation dropped more slowly as the cultures entered stationary phase (Cullum et al., 1978). Conjugational transfer rates were found to be relatively insensitive to cell density and to the donor-to-recipient ratio (Levin et al., 1979). The rate of transfer of conjugative R-factors was unaffected by aerobic versus anaerobic mating conditions (Moodie and Woods, 1973). The transfer of the conjugative plasmid Rldrd-19 between E. coli K-12 strains was found to proceed well at temperatures of 27-37"C, poorly at temperatures of 17-22"C, and not at all at 15°C (Singleton and Anson, 1981). In laboratory experiments with mixed populations of E. coli strains, either plasmid free or containing conjugative or nonconjugative plasmids, the plasmid-containing cells were quickly relegated to minority status but were never lost (Stewart and Levin, 1977; Levin and Stewart, 1980; Helling et al., 1981). The presence of a nonconjugative plasmid did not affect the ability of E. coli K-12 strains to participate in conjugation (Levin and Rice, 1980). In natural populations of E. coli, the occurrence of strains containing conjugative plasmids was low (about 20%), but was the same as it had been in the so-called preantibiotic era (Hughes and Datta, 1983); the difference was that in the postantibiotic era, conjugative plasmids were observed to almost always carry genes encoding resistance to a broad variety of antibiotics. The point is that the
100
GREGG BOGOSIAN AND JAMES F. KANE
presence of such plasmids did not impart any advantage to the cell in natural populations (Stewart and Levin, 1977; Levin and Stewart, 1980), and therefore plasmid-containing cells constituted a low proportion of the total population. This low frequency of occurrence of conjugative plasmids in natural populations of E. coli was consistent with the observation that such populations exhibited a low rate of genetic recombination (Selander and Levin, 1980). The type of pili encoded by the conjugative plasmid had a significant effect on the relationship between conjugational transfer rates and the physical state of the mating medium (Bradley, 1981). With donors that contained conjugative plasmids from the Ia,K, FII, H1, J, V, or com9 incompatibility groups, the pili produced were flexible and the rate of conjugational transfer was unaffected by liquid versus surface matings. With donors that contained conjugative plasmids from the C, D, TI or X incompatibility groups, thick flexible pili were produced and the rate of conjugational transfer was 50-250 times greater with surface matings than with liquid matings. With donors that contained conjugative plasmids from the M, N, P, U, or W incompatibility groups, rigid pili were produced and the rate of conjugational transfer was 2000-30,000 times greater with surface matings than with liquid matings. Similar results were observed with other species of bacteria (Genthner et al., 1988). The relative effectiveness of a variety of mating methods was assessed with several species of bacteria, confirming these other studies (Walter et a]., 1987). Finally, for conjugational transfer to occur, the donor must be able to survive under the conditions of the environment where the mating is to take place. This is a relatively simple condition to meet under laboratory conditions, but may not be the case in natural environments. The fate of E. coli K-12 strains, with and without pBR322-derived plasmids, in the environment will be discussed in each of the sections below. In addition, the conversion of such strains to viable donors, via the receipt of the necessary conjugative and mobilization plasmids, will also be considered. Ill. Fate of E. coli and Related Organisms in Water
The inability of E. coli and related species of bacteria to survive in natural sources of water has been examined by a variety of investigators. In general, the approach is to determine the viable cell count of the test strain in untreated water as well as in a sterilized sample of the water. Liang et al. (1982) determined the survival of a number of Enterobacteriaceae in lake water. When Salmonella typhimurium was added to
ENVlRONMENTAL FATE OF RECOMBINANT E. culi K-12
101
lake water at an initial concentration of 4.2 x lo4 cells/ml, the number of viable cells dropped to 33 celldm1 after 6 days and to undetectable levels after 8 days. When sterile lake water was used, the number of viable organisms remained at about 1 x lo4 cells/ml for the first 5 days, dropped to about 1 X lo3 celldm1 by day 15, and remained at that level through day 20 (the end of the study). It was concluded that other organisms present in nonsterile lake water subjected the S. typhimurium cells to predation, parasitism, lytic enzymes, or toxins, and thus negatively impacted the viability of the test strain. In a similar study Flint (1987) measured the survival of a nalidixic acid-resistant E. coli K-12 strain in untreated river water upstream and downstream of a sewage treatment plant. No analyses of these two water sources were provided, but the time required to decrease the viable cell count by 2 logs (= tg9) was different. With the upstream water source, the tg9 was 2.5 days, whereas in the downstream water the tg9 was 6 days. When the E. coli K-12 strain was inoculated into autoclaved samples of the water sources, the viable cell count remained constant for >ZOO days. It is important to note that the cells did not grow appreciably in this water and at best increased their numbers by approximately twofold. Flint also reported that the rates of cell death were temperature dependent. With a starting concentration of approximately 1 x lo6 cells/ml, the number of viable cells dropped to undetectable levels in 2 days at 37"C, 4 days at 25"C, 8 days at 15"C, and 15 days at 4°C. In sterile river water with an initial concentration of about 1 x lo6 cells/ml, the number of viable cells remained constant over a period of 260 days (the end of the study) at 4 and 15"C, and for 14 days (the end of the study) at 25°C; at 37"C, the number of viable cells dropped to undetectable levels in 8 days. In similar studies with Pseudomonas cepacia and Alcaligenes sp., survival was enhanced when the water samples were supplemented with substrates specifically degraded by the test organism (Steffan et a]., 1989).
The impact of a plasmid on the survival of E. coli has also been examined. Flint reported that the patterns of cell death in his studies were unaffected when the cells contained the conjugative plasmids Rldrd-19 (of the FII incompatibility group) or R144-3 (of the I incompatibility group). Schilf and Klingmuller (1983) reported that plasmidbearing strains of E. coli were unable to survive in nonsterile pond water at various temperatures. Two strains of Enterobacteriaceae, one containing the conjugative plasmid pRD1 and the other containing the conjugative plasmid RP4, as well as E. coli K-12 strain J5 containing the conjugative plasmid RP4 and E. coli K-12 strain JC5466 containing the conjugative plasmid pRD1, were individually added to nonsterile pond
102
GREGG BOGOSIAN AND JAMESF. KANE
water to a concentration of 5 x lo5 celldml; indigenous bacteria were present in the pond water at a concentration of 8.7 x lo4 cells/ml. Under these conditions, the plasmid-bearing Enterobacteriaceae declined by three orders of magnitude in 17-18 days at 4°C and in 8 days at 20°C; the two E. coli K-12 strains declined by three orders of magnitude in 15-22 days at 4°C and in 8 days at 20°C. The levels of the indigenous flora remained constant for the duration of the experiment. Similar results were reported by Smith et al. (1974) with E. coli in seawater and Sanchez and Toranzos (1989) with E. coli K-12 strain DHI containing a derivative of pBR322 (with a small insert) suspended in a diffusion chamber in a river. WITH ORGANISMS INHABITING WATER CONJUGATIONAL TRANSFER
In addition to the question of how long it takes E. coli to die in the environment, there is the additional question of the capacity for genetic transfer by conjugation in these milieu. Toranzo et al. (1984) isolated a variety of bacterial species (from the genera Aeromonas, Citrobacter, Vibrio, and Enterobacter) containing from 1to 5 plasmids (from 1.5 to 90 MDa) with various antibiotic-resistance markers from freshwater fish. These microorganisms were grown overnight in trypticase soy broth and mixed with E. coli K-12 strains at a ratio of 1:2. These mating mixtures were left at 25°C for 18 hours before measuring the number of E. coli that received a plasmid. Based on their experimental description, the cell densities in these tests would have been between 1 x 10' and 1 x 10' cells/ml (both donor and recipient) of broth. These investigators reported relatively low transfer frequencies of about 3 X lo-' to 3 X lo-* transfers/cell/l8 hours, despite the optimized conditions for transfer. Additionally, the indigenous donors only transferred one plasmid and in each case it was the largest in the donor cell. Thus, these conjugative plasmids did not effectively mobilize the other resident plasmids in the donor cells. Many E. coli strains isolated from natural water sources, however, contained conjugative plasmids. In British rivers containing insufficiently treated human sewage, about 50% of the E. coli isolates were resistant to at least one of six tested antibiotics (Smith, 1970);the number of isolates resistant to each antibiotic exhibited the following pattern: ampicillin S- streptomycin > tetracycline > neomycin > chloramphenicol S- nalidixic acid. About 86% of the chloramphenicolresistant isolates were able to transfer this resistance to an F- E. coli K-12 strain, and about 48% transferred the resistance to a S. typhimurium phage type 29 strain. Although the details of the experimental
ENVIRONMENTAL FATE OF RECOMBINANT E. coli K-12
103
procedures were lacking, Smith reported that the transfer of the other antibiotic resistances to an F- E. coli K-12 strain was about 60% for the tetracycline-resistant isolates, 100% for the neomycin-resistant isolates, about 65% for the ampicillin-resistant isolates, about 60% for the streptomycin-resistant isolates, and 0% for the nalidixic acid-resistant isolates. The nalidixic acid resistance was concluded to be chromosomally determined. About 8% of the total E. coli population in a river was found to contain R-factors (Shaw and Cabelli, 1980).In laboratory filter matings for 1hour at 35OC with E. coli K-12 strain CSH26 (nalidixic acid resistant) as recipient, about 50% of these R-factor-containing river isolates were able to transfer the R-factor (at a frequency of about 1 X lo-* transfers/cell/hour). About 10% of R-factor-containing river isolates of Enterobacteriaceae (including strains of E. coli, Klebsiella pneumoniae, Proteus vulgaris, Proteus mirabilis, Enterobacter sp., and Salmonella sp.) were able to transfer the R-factors in laboratory matings to an E. coli K-12 recipient (Kralikova et al., 1983).A different approach to study conjugational transfer to an environmental situation was used by Gowland and Slater (1984).In their experiments, donor and recipient E. coli K-12 strains were suspended in dialysis bags and placed in pond water. The transfer of an R-factor was observed at a frequency of 1-2 x transfers/cell/l92 hours. However, the detection of transfer required cell concentrations of >1 x 10'' celldm1 (for both donor and recipient) of pond water in the bag. When the cell concentration in the dialysis bag was lowered to 1 x 10' cells/ml, no conjugational transfer could be detected even after 360 hours. Trevors and Oddie (1986) reported that with E. coli K-12 strain MA527 containing a conjugative R-plasmid as the donor, and K-12 strain C600 (nalidixic acid resistant) as the recipient, no transfer of the R-factor was observed in sterile stream water at 30, 22, or 15°C. When the water was supplemented with nutrient broth to a final concentration of 0.32% transfer was observed at all temperatures at a frequency of about 3 X loT5 transfers/cell/48 hours. In sterile river water at 15 or 25OC, when an E. coli K-12 strain containing either conjugative plasmid Rldrd-19 or R144-3 was used as the donor and an E. coli K-12 nalidixic acid-resistant strain was used as the recipient, no transfer was observed. Part of the explanation for these observations may be that E. coli grown in water has fewer outer membrane proteins than does E. coli grown in a rich medium, and thus water-grown cells may be less amenable to conjugation pore formation (Chai, 1983). The transfer of R-factors from E. coli K-12 strains to bacteria indigenous to water has also been examined (Schilf and Klingmuller, 1983). The E. coli K-12 strains J5 and JC5466, containing a broad-host-range
104
GREGG BOGOSIAN AND JAMESF. KANE
conjugative plasmid (either RP4 or pRDl), were mated on solid media (tryptone agar plates) at 37°C for 16 hours with individual strains of bacteria isolated from either a pond or a brook. Over 600 bacterial isolates were tested. Approximately 17.3% of the bacteria from water were found to be potential recipients for both conjugative plasmids; most of these were members of the Enterobacteriaceae. The frequency of transfer ranged from 1 X to 5 X lop6transfers/cell/l6 hours. Using the same E. coli K-12 donors, the matings were repeated in nonsterile pond water. The E. coli K-12 donors were added to a concentration of 1 x 10' celldm1 and the indigenous bacterial recipients, initially present at 8.7 x lo4 cells/ml, were raised to 3 x lo7 cells/ml by adding bacteria from the same source propagated in L-broth. Under these conditions, no transfer of either conjugative plasmid to the indigenous bacterial recipients could be detected (<3.3 x lo-' transfers/cell/24 hours). It was further demonstrated that strains bearing either of the conjugative plasmids declined with time in nonsterile pond water. In the study by Flint (1987) described above, conjugational transfer was tested in nonsterile river water with donors containing the conjugative plasmids Rldrd-19 (of the FII incompatibility group) or R144-3 (of the I incompatibility group). No transfer was detected. This is significant because these plasmids produce flexible pili that appear to be most suited for forming conjugational pairs in a liquid medium (Bradley, 1981). It is also worth noting that the cells did not grow in this medium and in fact exhibited a steady loss in viability, suggesting that conjugation requires more favorable conditions. IV. Fate of E. coli and Related Organisms in Soil
Soil is a very complex natural environment whose many variables have been shown to have significant effects on microbial viability and on transfer of genetic information between microorganisms (reviewed in Stotzky, 1986; Fredrickson and Seidler, 1989; Stotzky et a]., 1989). The survival of introduced organisms in soil has been addressed by a number of investigators. A. SURVIVAL IN STERILE SOIL When E. coli K-12 strain W3110 containing the conjugative plasmid R702 was suspended in L-broth and introduced into sterile soil, the initial concentration of approximately 5 x l o 4 cells/g of soil increased to about 3 x 10' cells/g by day 3, and remained at that level until day 1 7
ENVIRONMENTAL FATE OF RECOMBINANT E. coli K-12
105
(the end of the study) (Devanas et al., 1986b).In the absence of nutrient addition (i.e., saline instead of L-broth as the diluent), the cells remained viable but the increase in cell number was much less marked. The same behavior was exhibited by the E. coli K-12 strain DU1040 (nalidixic acid resistant) containing the conjugative plasmid RlOO derivatives pRR226 or pDU202, and the E. coli K-12 strain ~ 1 7 7 con6 taining the pBR328 derivative pESO19. Similar results were found with E. coli K-12 strain HB101, either plasmid free or containing the plasmid pBR322 or pBR322 with an 800-base pair insert into the ampicillinresistance gene. The viable cell number of these strains increased from 1 X lo5 cells/ml to about 1 x 10' cells/ml, and then remained at that level for 27 days (the end of the study) (Devanas et al., 1985a; Devanas and Stotzky, 1986). These results suggest that E. coli can survive and grow in sterile soil provided some additional nutrients are supplied. B. SURVIVAL IN NONSTERILE SOIL
Sterile soil is not likely to be found in nature. Therefore, it is important to assess the capability of Enterobacteriaceae to compete with indigenous soil microbes for survival. In a silty loam soil of pH 6.7, S. typhimurium introduced at approximately 1 x lo8 cells/g of soil decreased to about 2.5 x lo3 cells/g by day 1 4 (the end of the study) (Liang et al., 1982). Introduced E. coli K-12 strains decreased approximately 2 logs from an initial concentration of about 5 x lo4 cells/g of soil by day 24 [the end of the study) (Devanas et al., 1986b). This particular soil contained a total of about 5 x lo7 indigenous organisms per gram, of which about 1 x lo5 to about 1 x lo6 were Gram-negative organisms. No transfer of any of these plasmids from the E. coli strains to the indigenous organisms was detected. When E. coli K-12 strain HB101, with or without a plasmid, was inoculated into nonsterile soil, the viable cell count decreased from 1 x lo5 cells/ml to undetectable levels in 2 1 days if the initial inoculum was composed of saline. Viable cells remained through 27 days (the end of the study) with little or no decrease in numbers if the initial inoculum was composed of L-broth. Differences in survival in nonsterile soil have been observed with other strains of E. coli K-12 (Devanas et al., 1985b). In an abstract, Sjogren (1989) reported that an environmentally derived multiple-antibiotic-resistant strain of E. coli survived for over 2 years in a sandy loam soil maintained at 10°C and at saturating moisture. These results demonstrated that E. coli does not compete effectively with indigenous microorganisms in soil, and that colonization of soil by E. coli is an improbable event.
106
GREGG BOGOSIAN AND JAMES F. KANE
C. CONJUGATIONAL TRANSFER WITH ORGANISMS INHABITING SOIL 1. Conjugational Transfer in Sterile and Nonsterile Soil
In a recent study of the conjugational transfer of an R-factor from the E. coli K-12 strain HBlOl to a strain of Rhizobium fredii in sterile soil, the maximum transfer was found to occur at 28"C, with a soil moisture content of 8% of field capacity, a pH of 7.25, clay at 15%, and organic matter at 5% (Richaume et al., 1989).Conjugational transfer of R-factors between E. coli K-12 strains was higher in aerobically incubated soil than in anaerobically incubated soil (Trevors and Starodub, 1987), and was not observed in soil with a pH below 4.7 (Krasovsky and Stotzky, 19873,although no difference was seen in the pH range from 6.15 to 7.45 (Trevors and Starodub, 1987). In a study of conjugation and transfer of chromosomal markers between E. coli K-12 strains in sterile soil, the clay mineral montmorillonite was found to enhance growth and conjugation, but the clay mineral kaolinite did not (Weinberg and Stotzky, 1972). However, in liquid mating experiments with E. coli K-12 strains, montmorillonite was found to inhibit conjugational transfer of Rldrdtransfers/cell/24 hours to 19 (from a transfer frequency of 2.2 x 1.2 x lo-* transfers/cell/24 hours, at 22°C) (Singleton, 1983).Soil moisture is known to be critical; transfer of an R-factor between E. coli K-12 strains did not occur in sterile soil below a moisture level of 25% of field capacity, whereas it did occur at a frequency of about 1 x transferdcell at a moisture level above 25% of field capacity (Devanas et al., 1986a).The optimum soil moisture content for E. coli K-12 matings was determined to be from 60 to 80% of field capacity (Trevors and Starodub, 1987). The metabolic state of the donor is also important; preincubation of a donor E. coli K-12 strain in soil for 7 or 14 days reduced the transfer of the conjugative plasmid RP4 to Pseudomonas aeruginosa (Devanas, 1989). Addition of nutrients to the soil usually had a positive effect. With E. coli K-12 strain MA527 as the donor and E. coli K-12 strain C600 (nalidixic acid resistant) as the recipient, no transfer of a conjugative R-factor was observed in a sterile sandy loam at pH 7.2 (Trevors and Oddie, 1986);when nutrient broth was added to the soil to a level of 0.32% transfer was observed. In this case, the transfer exhibited a temperature response. The frequencies were 9.8 x lo-' transfers/cell/24 hours at 15"C, 2.5 x transfers/cell/24 hours at 22"C, and 1.4 x transfers/cell/24 hours at 30°C. It was subsequently shown that the addition of nutrient broth to sterile soil enhanced the survival of E. coli K-12 donors, recipients, and transconjugants (Trevors, 1987). However, in nonsterile soil no transfer of a
ENVIRONMENTAL FATE OF RECOMBINANT E. coli K-12
107
conjugative R-factor occurred between E. coli K-12 strains either with or without a 5% L-broth supplementation (Devanas et al., 1986a).Transfer of a conjugative plasmid (this plasmid was not described in the paper) between an E. coli K-12 donor and a nalidixic acid-resistant E. coli K-12 recipient was observed in both sterile and nonsterile soil (Berg and Trevors, 1990). In the nonsterile soil, the E. coli donor and recipient cells were added to a concentration of about 1 x lo5 to 1 x lo6 cells/g of soil. The frequency was 1.7 x transfers/cell/24 hours at 30°C. 2. Laboratory versus in Situ Conjugational Transfer
In a laboratory liquid mating, an E. coli K-12 strain was found to be capable of transferring a variety of F' plasmids to a soil isolate of Pseudomonas fluorescens biotype IV at a frequency of about 1 x transfers/cell/2 hours (Mergeay and Gerits, 1978).However, the transfer of a plasmid from E. coli to an indigenous soil organism in situ has never been observed. The transfer of R-factors from E. coli K-12 strains to bacteria indigenous to soil has been examined in detail (Schilf and Klingmuller, 1983). The E. coli K-12 strains J5 and JC5466 containing a broad-host-range conjugative plasmid (either RP4 or pRD1) were mated on solid media (tryptone agar plates) at 37OC for 16 hours with individual strains of bacteria isolated from agricultural soil. Over 600 bacterial isolates were tested. Approximately 1.3% of the bacteria from soil were found to be potential recipients for both conjugative plasmids; most of these were members of the Pseudomonadaceae. The frequency of these to 4.5 X transfers/cell/l6 exchanges ranged from 7.1 x hours. Using the same E. coli K-12 donors, the matings were repeated in nonsterile soil. The E. coli K-12 donors were added to a concentration of 1 x 10' cells/g of soil and the indigenous bacterial recipients were raised to 1 x 10' cells/g of soil by adding bacteria from the same source propagated in L-broth. Under these conditions, no transfer of either conjugative plasmid to the indigenous bacterial recipients could be detected (
108
GREGG BOGOSIAN AND JAMES F. KANE
in 77 days at 4°C and in 37 days at 20°C;the plasmid-bearing P.fluorescens strain declined by two orders of magnitude in 220 days at 4°C and in 70 days at 20°C.The two E. coli K-12 strains declined by four orders of magnitude in 72-90 days at 4°Cand in 32-42 days at 20°C.The levels of the indigenous flora remained constant for the duration of the experiment. In a different experiment, with an E. coli K-12 strain as donor and a P. aeruginosa strain as recipient (both introduced into the soil for the mating), the conjugative plasmid RP4 was transferred to the recipient both in sterile and nonsterile soil, but not to any of the indigenous soil organisms (Devanas and Stotzky, 1987). The same was observed with various E. coli strains containing several different types of plasmids, as discussed in the preceding paragraph (Devanas et al., 1986b). The E. coli K-12 strain J53 was capable of transferring the conjugative plasmid RP4 in nonsterile soil to a variety of added recipients (strains of E. coli K-12,Enterobacter aerogenes, K.pneumoniae, P. vulgaris, and P. aeruginosa) (Devanas et al., 1988),but not to indigenous soil organisms. In a related area, the generalized transducing bacteriophage P1 has been found to be capable of transducing chromosomal markers between E. coli K-12strains added to sterile and nonsterile soil, but not to any indigenous soil organisms (Zeph et al., 1987,1988;Zeph and Stotzky, 1988,1989). Whereas conjugational transfer between E. coli and microorganisms indigenous to the soil can be readily demonstrated in the laboratory, no transfers have been reported to occur in nonsterile soil. This is a significant point and indicates that the nonsterile soil environment does not support this type of gene transfer. In almost every case in which transfer has been reported, the cell numbers of donor and recipient required are exceptionally high relative to the numbers generally found in the environment. V. Fate of E. coli and Related Organisms in Sewage
Sewage streams and treatment plants, and water contaminated with raw or insufficiently treated sewage, are environments particularly conducive to the survival and growth of E. coli. As such, studies on the transfer of genetic material in sewage are of special interest when considering the potential of recombinant plasmids to spread to environmental organisms. Survival of E. coli and related organisms in sewage, and transfer of naturally occurring and recombinant plasmids, have been examined in a variety of situations. In a laboratory-scale waste treatment facility, E. coli K-12 strain DP5OsupF was lost at a rate of 1-2 logs/day (Sagik and Sorber, 1979).
ENVIRONMENTAL FATE OF RECOMBINANT E. coli K-12
109
The survival of S . typhimurium in raw sewage was followed in a shaking flask maintained at 30°C (Liang et al., 1982). In nonsterile sewage, with an initial inoculum of about 1 x lo4 celldml, the number of surviving organisms dropped to undetectable levels by day 10 of the study. In sterile sewage with the same initial inoculum, the number increased to about 1 x lo6 organisms by day 4, and held at that level until day 12 (the end of the study). Grabow et al. (1973) reported that R+ E. coli strains were found to survive better than R- strains in sewage maturation ponds, and to increase in number during sewage treatment (Grabow et a]., 1975);however, no difference in the survival of R+ versus R- E. coli strains was observed in dialysis bags immersed in rivers or lakes (Grabow et al., 1975). Free pBR322 DNA was shown to be degraded in raw sewage with a half-life of 2 minutes (Phillips et al., 1987). CONJUGATIONAL TRANSFER WITH ORGANISMS INHABITING SEWAGE The occurrence of transferable R-plasmids in sewage has been examined by a number of investigators (reviewed in Grabow et al., 1974; Kralikova et al., 1986; Gealt, 1988). In one study, a municipal sewage stream was found to contain about 1 x lo6 E. coli cells/ml, and a hospital sewage stream contained about 5 x lo5E. coli cells/ml; of these cells, about 20% contained R-factors (Grabow and Prozesky, 1973). About 50% of the R-factor-containing strains from the hospital isolates, and about 28% from the municipal isolates, were able to transfer the Rfactors in laboratory matings to a plasmid-free fecal E. coli isolate (nalidixic acid-resistant strain E25); in this study, the matings were performed by mixing overnight nutrient broth cultures and holding them at 37°C for 24 hours without agitation. A related study found that R-factors occurred in about 88% of the organisms from hospital sewage and in about 43% from municipal sewage (Fontaine and Hoadley, 1976). These R-factors could be transferred in in vitro matings to E. coli strain 1932 (obtained from the Centers for Disease Control) from about 62% of the hospital R+ isolates and from about 91% of the municipal R+ isolates. These investigations further demonstrated transfer (at a frequency of about 1 x loM4transferdcell)of R-factors from unidentified indigenous fecal coliforms to Salmonella cholerae-suis in an in vitro sewage system. In this test the recipient cells were present at high levels (4 to 5 logs higher) compared to the indigenous donors. Another study found coliforms in hospital and domestic sewage at levels of 4.8 X lo5to 7.6 X lo7 cells/ml; of 1000 antibiotic-resistant isolates, 413 were able to transfer their resistance to a laboratory recipient, again using optimized in vitro conditions (Linton et al., 1974). Grabow et al. (1975) isolated R+ E. coli strains from a river and were able to transfer the R-factors in laboratory
110
GREGG BOGOSIAN AND JAMES F. KANE
matings to fecal E. coli strain E25 at frequencies of about 1 X transferdcell in nutrient broth and 1 x transfers/cell in sterile wastewater. One river isolate was observed to carry out such a transfer at a 10-fold higher frequency at 20°C than at 37°C. Beaucage et al. (1979) reported that fecal isolates of E. coli and K. pneumoniae containing R-factors that were isolated from rats were able to transfer those Rfactors to strains of E. coli K-12. In this study the recipients and donors were grown overnight in brain-heart infusion broth from a starting concentration of approximately 1 x lo7 celldm1 to final densities of 1 x lo9 cells/ml. The E. coli K-12 was reported to receive the R-factor, but transfer frequencies were not recorded. A total of 865 sewage isolates of R-factor-containing Salmonella spp. were tested in laboratory matings with a nalidixic acid-resistant strain of E. coli K-12 (Alcaide and Garay, 1984). The matings were performed in L-broth for 18 hours at 37°C without agitation. About 30% of the Salmonella sewage isolates were able to transfer their R-factors to the E. coli recipient, at frequencies of about 1 x to 2.5 x transfers/ ce11/18 hours. Sewage isolates of E. coli containing R-factors were used as donors in laboratory filter matings for 24 hours at 37°C with E. coli K-12 strain J53 (nalidixic acid resistant) as recipient; about 50% of the E. coli sewage isolates were able to transfer their R-factors to the E. coli K-12 recipient at frequencies of about 1 x transfers/cell/24 hours (Abdul and Venables, 1986). A study was performed on the survival of transconjugants in a mixture of sterile sediment and sterile seawater obtained from a sewage sludge marine dump site (Stewart and Koditschek, 1980). The donor was E. coli strain W510, an R+ river isolate, and the recipient was a nalidixic acid-resistant strain of E. coli K-12. Both donor and recipient were added to the sterile sediment and seawater mixture at an initial level of about 1 x 10' cells/ml; these levels dropped to about 1 x lo4 cells/ml by day 4 of the study, and held at that level until day 28 (the end of the study). Transconjugants were detected after 24 hours, although no frequencies were determined. The viable cell number of the transconjugants remained at a constant level in the sediment until the end of the study. The transfer of an R-factor from E. coli to fecal organisms was studied using an E. coli K-12 strain containing the conjugative plasmid R1 (of the FII incompatibility group) as donor (Corliss et al., 1981);the recipients were 22 fecal isolates of E. coli and one fecal isolate of Citrobacter freundii. Laboratory filter matings were performed for 1 hour at 37°C; the R1 plasmid was transferred to all of the recipients at frequencies of to about 1 x transfers/cell/hour. The transconabout 1 x
ENVIRONMENTAL FATE OF RECOMBINANT E. coli K-12
111
jugants so obtained were backcrossed to E. coli K-12 strain CSH26 by the same mating method; the E. coli transconjugants transferred the R1 plasmid to CSH26 at frequencies of about 1 x to about 1 x transfers/cell/hour, and the C. freundii transconjugant transferred the R1 plasmid to CSH26 at a frequency of about 1 x 10-1 transfers/cell/ hour. An R+ sewage isolate of E. coli was used as donor and a river isolate of E. coli was used as recipient in a study of the effects of temperature on conjugational transfer (Altherr and Kasweck, 1982). In laboratory matings in L-broth for 1hour, the R-factor was transferred at frequencies of transfers/cell/hour at 15"C, about 1 x transfers/ about 4 X cell/hour at 20°C and 25"C, about 4 x transfers/cell/hour at 30°C, and about 1 x lo-' transfers/cell/hour at 35°C. When the matings were performed in a membrane diffusion chamber suspended in a settling tank in a sewage treatment plant, the transfer frequencies were about transfers/cell/hour at 22°C and about 1 x transfers/ 3.2 X cell/hour at 29.5"C. When the membrane diffusion chambers were suspended in a river about 500 m downstream from a sewage plant effluent transfers/cell/hour at point, no transfer could be detected [<3.1 x 18°C and <7.6 x lo-* transfers/cell/hour at 28.5"C). Similar findings were found in a study of the effect of temperature, pH, and cations on conjugational transfer in wastewater (Khalil and Gealt, 1987). Mach and Grimes (1982) used membrane diffusion chambers suspended in a settling tank of a sewage treatment plant to examine the transfer of R-factors from noncoliform sewage isolates to clinical specimens or sewage isolates of E. coli. In this case, both donor and recipient were present at approximately 1 x lo6 to 1 x lo7 cells/ml. When the donor was a sewage isolate of Salmonella enteritidis, the transfer fretransfers/cell/3 hours. When the donor quency was about (1-3) x was a sewage isolate of P. mirabilis, the transfer frequency was slightly lower at (0.4-1) x transfers/cell/3 hours. Alternatively, with an R+ E. coli strain as donor and a sewage isolate of Shigella sonnei as recipient under the same mating conditions, the transfer frequency was about (0.4-1) x transfers/cell/3 hours. These results demonstrate the capacity of the indigenous microorganisms to participate in conjugational transfer even when inoculated at relatively low cell densities. Transfer of the plasmid pBR325 [which is pBR322 carrying an additional gene encoding chloramphenicol acetyltransferase (Balbas et al., 1988)l in sterile wastewater was studied by Gealt et al. (1985), who performed a triparental mating using E. coli K-12 strain ~ 1 7 8 4 containing the conjugative plasmid R100-1 as the donor, E. coli
112
GREGG BOGOSIAN AND JAMES F. KANE
K-12 Dap- strain KA1661 containing pBR325 as the intermediate, and E. coli K-12 strain ~ 1 9 9 7(Dap+ and nalidixic acid resistant) as the
recipient. The cultures were grown independently in L-broth and then washed prior to mixing; equal volumes of each culture (containing about 1 x 10’ cells/ml of the intermediate, donor, and recipient) were mixed in sterile wastewater and held without agitation for 25 hours at 37°C before plating on a selective medium. Under these conditions, ampicillin resistance was transferred to ~ 1 9 9 at 7 a frequency of about 7x transfers/cell/25 hours. Examination of the plasmid DNA present in the ampicillin-resistant ~ 1 9 9 7derivatives revealed that a cointegrate had formed between pBR322 and R100-1, consisting of the entire empicillin-resistance element of pBR322 and all of R100-1. Using a sewage isolate of Enterobacter cloacae as recipient in an otherwise identical mating, transfer of ampicillin resistance as a cointegrate with transfers/cell/25 R100-1 occurred at a frequency of about 1 x hours. Using a sewage isolate of E. coli as recipient, transfer of ampicillin resistance as a cointegrate with R100-1 occurred at a frequency transfers/cell/25 hours. When the same matings were of about 1 x performed in L-broth instead of sterile wastewater, ampicillin resistance was transferred as a cointegrate with R100-1 at frequencies of transfers/cell/25 hours to the E. coli K-12 strain ~ 1 9 9 7 about 2 x recipient, about 1 x lov5transfers/cell/25 hours to the E. cloacae reciptransfers/cell/25 hours to the sewage E. coli ient, and about 4 x recipient. Similar triparental matings were performed using either a sewage isolate of R+ E. coli or a sewage isolate of R+ K. pneumoniae as donor, E. coli K-12 strain GM31 containing the plasmid pBR325 as interme7 acid resistant) as recipient diate, and E. coli K-12 strain ~ 1 9 9 (nalidixic (McPherson and Gealt, 1986). The matings were performed in either L-broth or sterile wastewater for 25 hours at 37°C without agitation. In L-broth, ampicillin resistance was transferred as a cointegrate with R100-1 at frequencies of about 1 x lop6to about 1 x transfedcell/ 25 hours to the E. coli K-12 strain ~ 1 9 9 recipient, 7 and in sterile wastetransfers/cell/ to about 1 x water at frequencies of about 1 x 25 hours. Several studies have been published on the transfer of recombinant plasmids in laboratory-scale waste treatment facilities. A triparental mating was performed in such a facility, using E. coli K-12 strain ~ 1 7 8 4 containing the conjugative plasmid R100-1 as the donor, E. coli K-12 strain HBlOl containing the plasmid pHSVlO6 as the intermediate, and E. coli K-12 strain ~ 1 9 9 7(nalidixic acid resistant) as the recipient (Mancini et al., 1987). The plasmid pHSVlO6 is a pBR322 derivative
ENVIRONMENTAL FATE OF RECOMBINANT E. coli K-12
113
carrying the herpes simplex virus thymidine kinase gene. Under these conditions, ampicillin resistance was transferred to the recipient; some of these transconjugants had also acquired the thymidine kinase gene. In all cases, transfer occurred as a cointegrate with the R100-1 plasmid. It was observed that at least 1 x 10’ donor cells/ml were required before any transfer could be detected. A similar mating was performed using only the E. coli K-12 strain HBlOl containing the plasmid pHSVlO6 and an uncharacterized mixture of indigenous sewage organisms (Gealt et al., 1988). Transfer of the thymidine kinase gene to some of the indigenous organisms was detected, although whether this occurred as a cointegrate was not stated. Presumably, suitable donors and recipients were present in the original population of indigenous organisms. A strain of P. putida containing the recombinant plasmid pDlO survived in a laboratory-scale waste treatment facility for 8 weeks (the end of the study) (McClure et al., 1989).Some of the indigenous sewage organisms were found to have picked up genes from the pDlO plasmid. VI. Fate of E. coli K-12 in the Mammalian Intestinal Tract
From the beginning of the recombinant DNA era, one of the major concerns raised was that the use of E. coli as a host organism posed a significant risk of unintentional release via the alimentary tract of humans. Accidental ingestion by molecular biologists of recombinant strains of E. coli is still considered the most likely route of escape of cloned genetic material. Although E. coli K-12 strains are not likely to survive in the environment of the mammalian intestinal tract (see below), there is concern that recombinant genetic material could be transferred to indigenous intestinal flora and become widely disseminated in those organisms. The studies reviewed below suggest that E. coli K-12 strains do not survive in the mammalian intestinal tract long enough to participate in active conjugational transfer. The E. coli K-12 strain was isolated in 1922 from the feces of a convalescent diphtheria patient at the Stanford Medical School (Bachmann, 1987). It should be noted here that the designation “K-12” is a strain catalog number, and does not indicate anything about the K antigen of the strain. Ordinarily, E. coli strains are serologically determined by their 0, K, and H antigens. However, that is not possible with the K-12 strain, as years of laboratory cultivation have led to the loss of detectable 0 and K antigens (1. Orskov and Orskov, 1960; F. Orskov and Orskov, 1961);the K-12 strain does have the H antigen, of a serological type designated H48. Furthermore, it has been observed that though the K-12 strain of E. coli is pathogenic when injected intravenously, intra-
114
GREGG BOGOSIAN AND JAMES F. KANE
peritoneally, or intracranially in mice, it is from 1 x lo3to 1 x 104-fold less pathogenic than are wild-type strains of E. coli (Levy et al., 1978). Numerous studies have shown that E. coli K-12 lacks the pili, fimbriae, or adhesins necessary for adhesion to mammalian intestinal cells (Smith and Huggins, 1976, 1980; Williams et al., 1978; Clancy and Savage, 1981; Hull et al., 1981; Laux et al., 1986; Karch et al., 1987). In addition to having lost the 0 and K antigens normally found on the outer surfaces of wild-type strains of E. coli, the K-12 strain of E. coli is presumed to have lost the ability to produce the pili and fimbriae required for adhesion to mammalian intestinal cells; of course, E. coli K-12 strains do produce other types of pili and fimbriae (Eisenstein, 1987).
Colonization of the mammalian intestinal tract by E. coli is a complex and surprisingly poorly understood process (Cohen and Laux, 1985). It is presumed that colonization involves binding between bacterial adhesins and intestinal receptors. During replication, some colonized bacteria are sloughed off into fecal material, thus the persistence of a specific bacterium in feces is taken as evidence of colonization by that bacterium. In conventional mammals (i.e., those not germ-free or treated with antibiotics), the normal intestinal organisms occupying the sites of colonization also affect the ability of introduced organisms to become established (Caugant et al., 1981; Duval-Iflah et al., 1981; Onderdonk et al., 1981). The E. coli inhabitants of mammalian intestines fall into two groups, those that persist over a long period of time (many months), termed residents, and those that persist for a short period of time (a few days to a few weeks), termed transients (Sears et al., 1950). It has been observed that resident strains of E. coli always eventually disappear and are replaced by new resident strains of E. coli. Cultures of E. coli strains isolated from the feces of human volunteers, and then swallowed in large numbers by those same volunteers months to years later, were often recovered from the feces but did not become established as residents (Sears et a]., 1950). It has been observed that the antagonism of a resident strain of E. coli against an inoculated strain of E. coli is abolished if the intestine is supplied with a fermentable carbon source which the inoculated strain can use but the resident strain cannot (Ozawa and Freter, 1964). Several studies have demonstrated the crucial role plasmids play in the ability of strains of E. coli to colonize the mammalian intestinal tract. The plasmid ColV has been associated with pathogenicity in calves, and ColV' strains are better able to survive in the human intestinal tract than are ColV- strains (Smith and Huggins, 1976, 1978, 1980); these properties were not found to be associated with the plasmid ColE.
ENVIRONMENTAL FATE OF RECOMBINANT E. coli K-12
115
Although ColV-containing strains were more pathogenic in the peritoneum (Finn et al., 1982), the presence of ColV did not increase the survival of E. coli K-12 strains in the human intestinal tract (Smith, 1978). Clancy and Savage (1981) reported that E. coli K-12 strains containing ColV exhibited two- to threefold greater adherence to mouse intestinal epithelium in vitro than did isogenic ColV- strains. The plasmid ColIb, found in a human enteropathogenic strain of E. coli, was necessary for the adhesion of this strain to human intestinal mucosa in vitro (Williams et al., 1978). When the ColIb plasmid was transferred to a nalidixic acid-resistant strain of E. coli K-12, the strain was able to adhere to human intestinal mucosa cells. Pathogenic strains of E. coli expressed adherence properties not often found in normal intestinal isolates. Two types of pili were associated with these adherence properties, and when the structural genes for the pilin proteins were cloned onto a plasmid and put into an E. coli K-12 strain, the transformant had the adherence properties of pathogenic strains (Hull et al., 1981). Other pathogenic strains of E. coli were found to contain a large plasmid associated with the formation of a certain type of fimbria (Karch et al., 1987). When the plasmid was moved into a K-12 strain of E. coli, the same fimbriae were made and the transformants were able to adhere to cultured human intestinal cells. It was concluded that the large plasmid contained the fimbrial structural genes, or regulatory genes necessary for their expression, or both. A similar plasmid, carrying the structural gene for the glycoprotein K88 adhesin subunit of a type of fimbria, was moved into an E. coli K-12 strain; the transformant expressed the fimbriae and was able to adhere to mouse intestinal cells in vitro (Laux et al., 1986). The plasmid effect on survival in the human intestinal tract appears to be dependent on the properties of the plasmid with respect to the external structures that it can control. In this regard it is not surprising that the presence of R-factors has been shown to affect negatively the survival of fecal E. coli isolates in the human intestine in vivo (Anderson, 1974). The question of whether E. coli K-12 strains are able to colonize the mammalian intestinal tract has been directly addressed by a number of investigators. In one study with a single human volunteer, seven different E. coli K-12 strains were individually tested (Smith, 1975). All seven strains contained antibiotic-resistance markers; one was prototrophic and the others had various auxotrophies. In this human volunteer, the initial resident E. coli were present at a level of about 1 X lo7 cells/g of feces. The test organisms were orally administered in doses of about 1 x lo9 organisms. All seven test strains persisted for 3 to 4 days and then were no longer detectable. The levels of the resident E. coli organ-
116
GREGG BOGOSIAN AND JAMES F. KANE
isms were unaffected. A nalidixic acid- and streptomycin-resistant derivative of the E. coli K-12 strain W3110 was orally administered in a dose of about 1 x lolo organisms to a human volunteer, and persisted for 9 days (Williams, 1977). In another test with four human volunteers, E. coli K-12 strain ~ 1 7 7 with 6 or without the plasmid pBR322 was orally administered in doses of about (1-2) x lolo organisms (Levy and Marshall, 1979). The E. coli K-12 strains were recovered from the feces of these volunteers for up to 4 days after administration. A further test with four human volunteers involved the oral administration of about 1 x lolo cells of E. coli K-12 strain ~ 1 6 6 with 6 or without the plasmid 6 a typical E. coli pBR322 (Levy et al., 1980; Levy, 1984). Strain ~ 1 6 6 is K-12 strain, not debilitated like ~ 1 7 7 6 In . this test, the E. coli K-12 strains were recovered for up to 6 days after administration. The conclusion from all of these tests is that strains of E. coli K-12 are unable to colonize the conventional human intestinal tract. Several similar studies have been performed with rats and mice. It was observed that though a wild-type E. coli K-12 strain could colonize 6 germ-free rats and mice, the debilitated E. coli K-12 strain ~ 1 7 7 could not (Wells et al., 1978). Other studies confirmed that the debilitated E. coli K-12 strains ~ 1 7 7 and 6 DP50supF were killed in the conventional mouse intestine (Freter et al., 1979,1983a). The E. coli K-12 strainx1666 was not killed in the conventional mouse intestine, but did pass through without any multiplication. Germ-free mice were colonized by E. coli K-12 strain ~ 1 6 6 but 6 not by strain ~ 1 7 7 6Germ-free . mice fed E. coli K-12 strain ~ 1 7 7 6with or without the plasmid pBR322 cleared both strains in 18-24 hours (Levy and Marshall, 1979). A variety of streptomycin-resistant strains of E. coli K-12 were able to colonize streptomycin-treated mice (Cohen et al., 1979; Myhal et al., 1982).A test with conventional mice involved the oral administration of about 1 x lolo cells of E. coli K-12 strain ~ 1 6 6 with 6 or without the plasmid pBR322 (Levy et al., 1980; Levy, 1984). In this test, the E. coli K-12 strains were recovered for up to 6 days after administration, but did not colonize the mice. Laux et al. (1982) pretreated mice with doses of streptomycin for 4 days, at which point the indigenous population was reduced from lo8 cells/g of feces to <10 cells/g. The mice were inoculated with a streptomycin-resistant strain of E. coli K-12 and were maintained on streptomycin treatment. Under these conditions, E. coli K-12 was able to colonize the intestinal tract and to persist at a level of about (1-5) x lo8 organismdg of feces. Apparently, E. coli was the only facultative microorganism measurable in the fecal samples. A strain of E. coli K-12 containing the plasmid pBR322 was orally administered in a dose of about 1 X 10' organisms to conventional, germ-free, and antibiotic-
ENVIRONMENTAL FATE OF RECOMBINANT E. coli K-12
117
treated mice (Smith et al., 1985).The strain did not colonize the conventional mice, but did colonize the germ-free and antibiotic-treated mice, persisting at a level of about 1 x lo7to 1 x 10' organisms/g of feces. The conclusion from these tests was that though E. coli K-12 strains could not colonize conventional mice, they could colonize germ-free or antibiotic-treated rats and mice. Presumably, strains of E. coli K-12 are unable to compete with indigenous mammalian intestinal organisms for sites of colonization; however, E. coli K-12 strains are not completely defective in colonization ability. CONJUGATIONAL TRANSFER WITH ORGANISMS INHABITING THE MAMMALIAN INTESTINAL TRACT Transfer of R-factors in mammalian intestines has been detected in a variety of investigations. In the conventional human intestinal tract, transfer of R-factors from fecal strains of E. coli to fecal strains of S . sonnei has been observed (Farrar et al., 1972).When human fecal isolates of E. coli were made R+ and reingested orally, no transfer of the R-factor to indigenous flora was seen unless the human volunteers were treated with antibiotics to which the R-factor encoded resistance (Anderson et al., 1973). A human volunteer with a resident E. coli population of about 1 x lo6 to 1 x lo7 organismdg of feces was orally administered about 1 x l o l o E. coli containing an F-tetR plasmid; 24 hours later, 20 transconjugants per gram of feces were detected, but 48 hours later no transconjugants were detected (E. S. Anderson, 1975). Following a regime of tetracycline treatment, a human volunteer was found to have a resident E. coli population with an R-factor encoding tetracycline resistance; 9 months later, the same strain was still resident, but an additional resident strain of E. coli that was identified contained the same R-factor (Petrocheilou et al., 1976). Transfer of R-factors from fecal isolates of E. coli to resident E. coli strains has been observed in pigs (Gyles et al., 1978)and from Serratia liquifaciens to fecal isolates of E. coli in germ-free rats (Duval-Iflah et al., 1980).In laboratory matings, a strain of E. coli K-12 was capable of transferring an R-factor to a fecal isolate of E. coli, and vice versa (Corliss et al., 1981).In a study of genetic exchange of nonplasmid DNA, the exchange of chromosomal markers between E. coli K-12 strains (where the donor was an Hfr, F', or F strain) was observed in germ-free mice (Jonesand Curtiss, 1970). Both chromosomal and plasmid DNA were found to be rapidly degraded by nucleases in the intestinal tracts of rats (Maturin and Curtiss, 1977). Several factors have been identified that affect the transfer of R-factors in the mammalian intestine. Multiplication of both donors and recipi-
118
GREGG BOGOSIAN AND JAMESF. KANE
ents was found to be required for R-factor transfer in germ-free and in conventional mouse intestines; this was true for transfer from E. coli to K. pneumoniae and Shigella flexneri as well as for transfer from S. flexneri to E, coli (Kasuya, 1964). Transfer of R-factors from E. coli to S. typhimurium in conventional mouse intestines was observed only if both donors and recipients were capable of multiplication (Guinee, 1965).The number of donors orally administered is also important. In a study of the transfer of an R-factor from a fecal E. coli isolate to a resident E. coli strain, no transfer was observed with an oral dose of about 1 x 10' organisms, whereas transfer was observed with an oral dose of about 1 x 10' organisms (Smith, 1969). The transconjugants did not persist for more than 6 days and the R- residents were unaffected. It was observed that the presence of Bacteroides fragilis in the intestinal tract inhibits conjugational transfer between E. coli strains [ J. D. Anderson, 1975), but a later study contradicted this finding (Duval-Iflah et al., 1980).
The transfer of nonconjugative plasmids in the mammalian intestine has been examined in numerous studies. An E. coli K-12 strain containing a nonconjugative plasmid encoding tetracycline resistance, and containing as well the conjugative plasmid F, I+, or A2+, was orally administered in doses of about 1 x 10' organisms to human volunteers. The E. coli K-12 strains did not persist for more than 4 days and no transfer of tetracycline resistance to resident E. coli strains was observed (Smith, 1975).A nalidixic acid- and streptomycin-resistant derivative of the E. coli K-12 strain W3110 containing the plasmid ColV was orally administered in a dose of about 1 x 1010 organisms to a human volunteer; the ColV plasmid was transferred to resident strains of E. coli (Williams, 1977). Apparently, a triparental mating had occurred involving a conjugative plasmid from one of the resident E. coli strains. The debilitated E. coli K-12 strain ~ 1 7 7 6containing , pBR322, was administered to a human volunteer in a dose of about 2.3 x W0 organisms; individual isolates of this strain from the feces of this volunteer were shown not to have picked up any conjugative plasmids in transit (Levy and Marshall, 1979). The prototrophic E. coli K-12 strain ~ 1 6 6 6con, taining pBR322, was administered to a human volunteer in a dose of about 1 X 10" organisms and persisted for 6 days; no transfer of pBR322 to any indigenous fecal organisms was detected (Levy et al., 1980). An E. coli K-12 strain ~ 1 6 6 6containing three plasmids-the conjugative plasmid pLM2 (of the P incompatibility group), the conjugative plasmid pSL222-4 (of the FII incompatibility group), and the plasmid pBR322-was administered to human volunteers and conventional mice; the strain persisted for 3.5-6 days in these subjects. The
119
ENVIRONMENTAL FATE OF RECOMBINANT E. coli K-12
conjugative plasmid pSL222-4 was transferred to endogenous fecal bactransferddonor cell ingested. This teria at a frequency of about 1 x rate of transfer is probably an overestimate, as it included new recipients that had arisen by multiplication. Transfer of the conjugative plasmid pLM2 and the plasmid pBR322 to endogenous fecal bacteria was not detected (<1 x lo-'' transfers/donor cell ingested) (Marshall et al., 1981; Levy and Marshall, 1981).In germ-free mice, the transfer of the conjugative plasmid Rldrd-19 between E. coli K-12 strains was actually inhibited when the donor also contained the plasmid pBR322 (Freter et al., 1983b). In germ-free mice, when E. coli K-12 strain ~ 1 6 6 6 containing pBR322 was present at a level of about 1 x 10" organismdg of feces, along with a mixture of four human fecal E. coli strains at a level organismdg of feces, no transfer of the plasmid of about 1 x pBR322 to any of the fecal E. coli isolates was observed (Levy, 1984). A series of studies in human volunteers yielded some insight into the factors affecting transfer of nonconjugative plasmids (Levine et a]., 1983a,b; Levy, 1984; see also Table 11). In the first experiment, a fecal TABLE I1 CONJUGATIONAL TRANSFER I N THE INTESTINALTRACT Experiment
E. coli strain tested Tetracycline administered Colonization occurred Transconjugants formed Nonconjugative plasmid Mobilization plasmid Conjugative plasmid
1
OF
HUMANS~
3
2
4
5
Fecal
Fecal
Fecal
Fecal
K-12
Yes
Yes
Yes
No
Yes
Yes
?
?
?
No
Yes
No
Yes
No
No
None
pBR325
pBR325
pBR325
pBR325
PJBK~~
None"
From residentd
None"
Nonec
From residente
None'
F
F
F
~
For each experiment, E. coli was orally adminstered to the volunteers. pJBK5 is a derivative of the mobilization plasmid ColE1. The presence or absence of a mobilization plasmid was not specifically determined; the absence of such was inferred from the observed lack of transfer. Because transfer did occur, a mobilization plasmid was presumably picked u p from a resident organism. A conjugative plasmid was detected in these strains, presumably from a resident organism. 'The presence or absence of a conjugative plasmid was not specifically determined; the absence of such was inferred from the observed lack of transfer.
120
GREGG BOGOSIAN AND JAMES F. KANE
E. coli strain was transformed with the plasmid pJBK5, which is a plasmid ColEl derivative with a gene encoding resistance to tetracycline. This strain was orally administered to 15 human volunteers, followed by treatment with tetracycline for 10 days. Under these conditions, the donor strain was able to colonize all of the humans volunteers. After 10 days, 9 (60%) of the human volunteers had transconjugants in their feces, although these transconjugants did not persist for more than 3 days. Apparently, a triparental mating had occurred, involving a conjugative plasmid from the indigenous flora. Indeed, such a conjugative plasmid was detected in the transconjugants. In the second experiment, a fecal E. coli strain was transformed with the plasmid pBR325, which is a pBR322 derivative with a gene encoding chloramphenicol resistance. This strain was orally administered to 15 human volunteers, followed by treatment with tetracycline for 10 days. Under these conditions, no transconjugants were detected. In the third experiment, the conjugative plasmid F-ampR was added to the fecal E. coli strain containing pBR325, and this strain was orally administered to 20 human volunteers. After a 10-day tetracycline treatment, 13 (65%) of the human volunteers had transconjugants in their feces, which persisted for 1-6 days. The fourth experiment was a repeat of the third experiment, with the omission of the tetracycline treatment. Under these conditions, no transfer of the pBR325 was detected. The fifth experiment was a repeat of the third experiment, with an E. coli K-12 strain being substituted for the fecal E. coli strain. In this case, even in the presence of tetracycline, the donor was cleared from the feces in 5 days or less; no transconjugants could be detected. It was concluded from these studies that transfer of pBR325 to indigenous human intestinal flora does not occur when the donor is an E. coli K-12 strain, nor does it occur with fecal E. coli strains as donors in the absence of tetracycline treatment. VII. Alternative Detection Methods for Recombinant Organisms
in
t h e Environment One of the most difficult technical aspects of studying the transfer of genetic material to organisms in complex environments is the detection of transconjugants, particularly if the frequency of transfer is relatively low. In all of the studies cited above, genes encoding resistance to one or more antibiotics were used to mark the donors, the recipients, and the genetic material being tested for transfer; some of the studies also employed chromosomal genotypic markers to distinguish donors and recipients from one another and from indigenous microorganisms. All of these studies had inherent limitations imposing lower limits of detec-
ENVIRONMENTAL FATE OF RECOMBINANT E. coli K-12
121
tion, which imparted a relatively low sensitivity to the measurements. The highest levels of sensitivity required the use of test strains that could be plated on media containing antibiotics in concentrations and combinations allowing for the growth of the fewest number of microorganisms indigenous to the habitat being studied (Mallory et al., 1982). A variety of other techniques have been developed, meant to be used either alone or in conjunction with standard marking methods, which can raise the level of sensitivity, including immunological techniques, radioactive markers, fluorescent markers, DNA fingerprinting, nucleic acid hybridization, biotinylated probes, bioluminescence, and a variety of techniques to detect proteins encoded by the DNA being tested for transfer (reviewed in Jain et al., 1988; Newman, 1989).A set of bacteriophages that has been assembled permits rapid biotyping of E. coli K-12 strains, distinguishing them from other strains of E. coli (van Leeuwen et al., 1979). Transposons have been employed to raise detection limits in soil studies (Frederickson et al., 1988).A colorimetric method using the enzyme 2,3-catechol dioxygenase has shown promise in studies involving soil and sewage (Lyon and Walter, 1989). One of the newest techniques, involving the use of the polymerase chain reaction (PCR), has been demonstrated to increase the level of sensitivity dramatically (Chaudhry et al., 1989). Raising the limits of detection in such studies will permit more sophisticated experiments to be designed, leading to a better understanding of the transfer of genetic material in complex environments. VIII. Conclusions
Strains of E. coli K-12 do not persist in nonsterile water, soil, sewage, or the conventional mammalian intestinal tract. The studies reviewed here reported maximum survival times, under optimal conditions, of about 15 days in water, about 20 days in soil, and about 10 days in sewage. It was observed that strains of E. coli K-12 were unable to adhere to mammalian intestinal cells and did not colonize the conventional mammalian intestinal tract; they were cleared in 3-6 days from conventional human and mouse intestines. The E. coli K-12 strains were able to colonize germ-free or antibiotic-treated rats and mice, but not antibiotictreated humans. The presence of conjugative and nonconjugative plasmids was observed to impart an additional disadvantage to E. coli K-12 strains in these environments, particularly in the mammalian intestinal tract. For the conjugational transfer of pBR322 or a derivative of pBR322, several conditions must be met. The pBR322 plasmid must have intact
122
GREGG BOGOSIAN AND JAMESF. KANE
born and nic sites; a derivative such as pBR327, which lacks these two sites, is unable to be transferred. The pBR322 plasmid must be in a donor strain that also contains both a conjugative plasmid and a plasmid that can provide the four mob gene products necessary for transfer; in the absence of the mob gene products, a few studies have demonstrated the low-frequency transfer of portions of pBR322 plasmids as cointegrates with conjugative R-factors. The donor strain must be able to not only survive, but actually to multiply in the environment in which the transfer is to occur; conjugation does not occur in the absence of growth. The donor strain must retain the pBR322 plasmid; in the absence of selective pressure, pBR322 is rapidly lost from host E. coli K-12 strains. The conjugational transfer of pBR322 or derivatives of pBR322 from strains of E. coli K-12 to indigenous inhabitants of water, soil, sewage, or the mammalian intestinal tract, in their natural environment, has never been demonstrated. Given the stringent conditions required, coupled with the limitations of pBR322 and E. coli K-12 strains, this is not an unexpected result. Particularly clear is the observation that E. coli K-12 strains do not survive in these environments. These results are reassuring from the point of view of using recombinant E. coli K-12 strains in large-scale fermentations. Of course, negative results such as these do not mean that, in the event of an accidental release of a recombinant E. coli K-12 strain, there is an absolute certainty that transfer of the plasmid to indigenous inhabitants of the release site will not occur. What is lacking in all of the studies to date is any systematic appraisal of the possible consequences of such transfer events. Such an appraisal must take into account the nature of the substance being produced by the recombinant organism. An array of other questions remains to be answered as well, including the mechanism of death of E. coli K-12 strains in the environment and the impact of various environmental factors. The fate of recombinant E. coli K-12 strains in the environment is an important and interesting issue that will continue to attract increased attention.
ACKNOWLEDGMENTS We gratefully acknowledge the assistance of Lynn Backus for performing dozens of literature searches and Randy Hastings for photocopying hundreds of articles. Michael Heitkamp provided a great deal of material for the section on the mammalian intestinal tract, and engaged in many helpful discussions with us. Ray Seidler of the United States Environmental Protection Agency Environmental Research Laboratory provided us with several relevant EPA manuals and other material.
ENVIRONMENTAL FATE OF RECOMBINANT E. coli K-12
123
REFERENCES Abdul, P., and Venables, W. A. (1986). Occurrence of R-plasmids in porcine faecal waste and comparison of their transfer rates in laboratory mating systems and anaerobic digesters. Appl. Microbiol. Biotechnol. 24, 149-152. Alcaide, E., and Garay, E. (1984). R-plasmid transfer in Salmonella spp. isolated from wastewater and sewage-contaminated surface waters. Appl. Environ. Microbiol. 48, 435-438. Altherr, M. R., and Kasweck, K. L. (1982). In situ studies with membrane diffusion chambers of antibiotic resistance transfer in Escherichia coli. Appl. Environ. Microbiol. 44,838-843. Anderson, E. S. (1975). Viability of, and transfer of a plasmid from, E. coli K-12 in the human intestine. Nature (London) 255, 502-504. Anderson, J. D. (1974). The effect of R-factor carriage on the survival of Escherichia coli in the human intestine. J. Med. Microbiol. 7, 85-90. Anderson, J. D. (1975). Factors that may prevent transfer of antibiotic resistance between gram-negative bacteria in the gut. J. Med. Microbiol. 8,83-88. Anderson, J. D., Gillespie, W. A., and Richmond, M. H. (1973). Chemotherapy and antibiotic-resistance transfer between enterobacteria in the human gastro-intestinal tract. J. Med. Microbiol. 6,461-473. Bachmann, B. J. (1987). Derivatives and genotypes of some mutant derivatives of Escherichia coli K-12. In “Escherichia coli and Salmonella typhimurium: Cellular and Molecular Biology” (J. L. Ingraham, K. B. Low, B. Magasanik, M. Schaechter, and H. E. Umbarger, eds.), pp. 1190-1219. Am. SOC.Microbiol., Washington, D. C. Balbas, P., Soberon, X.,Merino, E., Zurita, M., Lomeli, H., Valle, F., Flores, N., and Bolivar, F. (1986). Plasmid pBR322 and its special-purpose derivatives-a review. Gene 50, 3-40. Balbas, P., Soberon, X., Bolivar, F., and Rodriguez, R. L. (1988). The plasmid, pBR322. In “Vectors: A Survey of Molecular Cloning Vectors and Their Uses” (R. L. Rodriguez and D. T. Denhardt, eds.), pp. 5-41. Butterworth, Stoneham, Massachusetts. Beaucage, C. M., Fox, J, G., and Whitney, K. M. (1979). Effect of long-term tetracycline exposure (drinking water additive) on antibiotic-resistance of aerobic gram-negative intestinal flora of rats. Am. J. Vet. Res. 40, 1454-1457. Berg, G., and Trevors, J. T. (1990). Bacterial conjugation between Escherichia coli and Pseudomonas spp. donor and recipient cells in soil. J. Ind. Microbiol. 5, 79-84. Bolivar, F., Rodriguez, R. L., Greene, P. J., Betlach, M. C., Heyneker, H. L., Boyer, H. W., Crosa, J. H., and Falkow, S. (1977).Construction and characterization of new cloning vehicles. 11. A multipurpose cloning system. Gene 2,95-113. Boyd, A. C., Archer, J. A. K., and Sherratt, D. J. (1989). Characterization of the ColEl mobilization region and its protein products. Mol. Gen. Genet. 217,488-498. Bradley, D. E. (1981). Conjugative pili of plasmids in Escherichia coli K-12 and Pseudomonas species. In “Molecular Biology, Pathogenicity, and Ecology of Bacterial Plasmids” (S. B. Levy, R. C. Clowes, and E. L. Koenig, eds.), pp. 217-226. Plenum, New York. Brenner, D. J. [1984). Facultatively anaerobic rods. In “Bergey’s Manual of Systematic Bacteriology” (R. N. Krieg, ed.), Vol. 1,pp. 409-423. Williams & Wilkins, Baltimore, Maryland. Broda, P., Cullum, J., and Collins, J. F. (1977). Plasmid spread through Escherichia coli populations. In “Plasmids: Medical and Theoretical Aspects” (S. Mitsuhashi, L. Rosival, and V. Krcmery, [eds.), pp. 469-472. Avicenum, Prague.
124
GREGG BOGOSIAN AND JAMES F. KANE
Calcott, P. H., Kane, J. F., Krivi, G. G., and Bogosian, G. (1988). Parameters affecting production of bovine somatotropin in Escherichia coli fermentations. Dev. Ind. Microbiol. 29, 257-266. Caugant, D. A., Levin, B. R., and Selander, R. K. (1981). Genetic diversity and temporal variation in the E. coli population of a human host. Genetics 98,467-490. Cesareni, G., Cornelissen, M., Lacatena, R. M., and Castagnoli, L. (1984). Control of pMBl replication: Inhibition of primer formation by Rop requires RNAI. EMBO J. 3, 13651369. Chai, T.-J. (1983).Characteristics of Escherichia coli grown in bay water as compared with rich medium. Appl. Environ. Microbiol. 45, 1316-1323. Chatigny, M. A., Hatch, M. T., Wolochow, H., Adler, T., Hresko, J., Macher, J., and Besemer, D. (1979). Studies on release and survival of biological substances used in recombinant DNA laboratory procedures. Recomb. DNA Tech. Bull. 2, 62-67. Chaudhry, G. R., Toranzos, G. A., and Bhatti, A. R. (1989). Novel method for detecting genetically engineered microorganisms in the environment. Appl. Environ. Microbiol. 55, 1301-1304. Chiang, C.-S., and Bremer, H. (1988). Stability of pBR322-derived plasmids. Plosmid 20, 207-220. Clancy, J., and Savage, D. C. (1981). Another colicin V phenotype: In vitro adhesion of Escherichia coli to mouse intestinal epithelium. Infect. Immun. 32, 343-352. Clark, A. J., and Warren, G. J. (1979). Conjugal transmission of plasmids. Annu. Rev. Genet. 13, 99-125. Cohen, P. S., and Laux, D. C. (1985). E. coli colonization of the mammalian colon: Understanding the process. Recomb. DNA Tech. Bull. 8, 51-54. Cohen, P. S., Pilsucki, R. W., Myhal, M. L., Rosen, C. A., Laux, D. C., and Cabelli, V. J. (1979).Colonization potentials of male and female E. coli K-12 strains, E. coli B, and human fecal E. coli strains in the mouse GI tract. Recomb. DNA Tech. Bull. 2, 106-1 13. Corliss, T. L., Cohen, P. S., and Cabelli, V. J. (1981). R-plasmid transfer to and from Escherichia coli strains isolated from human fecal samples. Appl. Environ. Microbiol. 41,959-966. Covarrubias, L., Cervantes, L., Covarrubias, A., Soberon, X., Blanco, A., Kupersztoch-Portnoy, Y. M., and Bolivar, F. (1981). Construction and characterization of new cloning vehicles. V. Mobilization and coding properties of pBR322 and several deletion derivatives including pBR327 and PBR328. Gene 13,25-35. Cullum, J . , Collins, J. F., and Broda, P. (1978). The spread of plasmids in model populations of Escherichia coli K-12. Plasmid 1, 545-556. Curtiss, R., 111, Clark, J. E., Goldschmidt, R., Hsu, J. C., Hull, S. C., Inoue, M., Maturin, L. J., Sr., Moody, R., and Pereira, D. A. (1977). Biohazard assessment of recombinant DNA molecule research. In “Plasmids: Medical and Theoretical Aspects” (S. Mitsuhashi, L. Rosival, and V. Krcmery, eds.), pp. 375-387. Avicenum, Prague. Datta, N. (1979). Plasmid classification: Incompatibility grouping. In “Plasmids of Medical, Environmental and Commercial Importance” (K. N. Timmis and A. Puhler, eds.), pp. 3-12. Elsevier/North-Holland, Amsterdam. Devanas, M. A. (1989). The metabolic state of donor and recipient cells affects conjugation frequencies and plasmid transfer to indigenous bacteria in soil. Abstr. Annu. Meet. Am. SOC.Microbiol. p. 353. Devanas, M. A., and Stotzky, G. (1986). Fate in soil of a recombinant plasmid carrying a Drosophila gene. Curr. Microbiol. 13, 279-283. Devanas, M. A., and Stotzky, G. (1987).Survival and conjugal transfer of plasmid RP4 from
ENVIRONMENTAL FATE OF RECOMBINANT E. coli K-12
125
Escherichia coli to Pseudomonas aeruginosa in soil: Effect of clay minerals and nutrients. Abstr. Annu. Meet. Am. SOC.Microbiol. p. 303. Devanas, M. A., Rafaelli-Eshkol, D., Kambysellis, M., and Stotzky, G. (1985a). Fate in soil of a recombinant plasmid carrying a Drosophila gene. Abstr. Annu. Meet. Am. SOC. Microbiol. p. 218. Devanas, M. A., Rafaelli-Eshkol, D., and Stotzky, G. (1985b). Survival and recovery of plasmid-containing strains of Escherichia coli from soil. Abstr. Annu. Meet. Am. SOC. Microbiol. p. 218. Devanas, M. A., Harsell, C., Wu, C., and Stotzky, G. (1986a). Plasmid transfer in Escherichia coli in sterile and nonsterile soil. Abstr. Annu. Meet. Am. SOC.Microbiol. p. 241.
Devanas, M. A., Rafaeli-Eshkol, D., and Stotzky, G. (1986b). Survival of plasmidcontaining strains of Escherichia coli in soil: Effect of plasmid size and nutrients on survival of hosts and maintenance of plasmids. Curr. Microbiol. 13, 269-277. Devanas, M. A., Arroyo, C., Aspiras, M., Berger, A., Bernard, A., Deleo, J., Gutzmore, J., Metha, N., and Stotzky, G. (1988). Intergeneric conjugal transfer of RP4 in soil. Abstr. Annu. Meet. Am. SOC.Microbiol. p. 298. Dougan, G., Crosa, J. H., and Falkow, S. (1978). Mobilization of the Escherichia coli plasmid ColEl (colicin E l ) and ColEl vectors used in recombinant DNA experiments. J. Infect. Dis. 137, 676-680. Duval-Iflah, Y., Raibaud, P., Tancrede, C., and Rousseau, M. (1980). R-plasmid transfer from Serratia liquefaciens to Escherichia coli in vitro and in vivo in the digestive tract of gnotobiotic mice associated with human fecal flora. Infect. Immun. 28, 981-990. Duval-Iflah, Y., Raibaud, P., and Rousseau, M. (1981). Antagonisms among isogenic strains of Escherichia coli in the digestive tracts of gnotobiotic mice. Infect. Immun. 34,957-969. Eisenstein, B. I. (1987). Fimbriae. In “Escherichia coli and Salmonella typhimurium: Cellular and Molecular Biology” (J. L. Ingraham, K. B. Low, B. Magasanik, M. Schaechter, and H. E. Umbarger, eds.), pp. 84-90. Am. SOC.Microbiol., Washington, D.C. Farrar, W. E., Jr., Edison, M., Guerry, P., Falkow, S., Drusin, L. M., and Roberts, R. B. (1972). Interbacterial transfer of R factor in the human intestine: In vivo acquisition of R-factor-mediated kanamycin resistance by a multiresistant strain of Shigella sonnei. J. Infect. Dis. 126, 27-33. Finn, T. M., Arbuthnott, J. P., and Dougan, G. (1982). Properties of Escherichia coli grown in vivo using a chamber implant system. J. Gen. Microbiol. 128, 3083-3091. Finnegan, J., and Sherratt, D. (1982). Plasmid ColEl conjugal mobility: The nature of bom, a region required in cis for transfer. Mol. Gen. Genet. 185, 344-351. Flint, K. P. (1987). The long-term survival of Escherichia coli in river water. J. Appl. Bacteriol. 63, 261-270. Fontaine, T. D., and Hoadley, A. W. (1976). Transferable drug resistance associated with coliforms isolated from hospital and domestic sewage. Health Lob. Sci. 13,238-245. Fredrickson, J. K., and Seidler, R. J. (1989). Evaluation of terrestrial microcosms for detection, fate, and survival analysis of genetically engineered microorganisms and their recombinant genetic material. U.S. Environ. Prot. Agency Doc. EPA-600/3-89043. Fredrickson, J. K., Bezdicek, D. F., Brockman, F. J., and Li, S. W. (1988).Enumeration of Tn5 mutant bacteria in soil by using a most-probable-number-DNA hybridization procedure and antibiotic resistance. Appl. Environ. Microbiol. 54, 446-453. Freter, R. (1984). Factors affecting conjugal plasmid transfer in natural bacterial communities. In “Current Perspectives in Microbial Ecology” (M. J. Klug, and C. A. Reddy, eds.), pp. 105-114. Am. SOC.Microbiol., Washington, D.C.
126
GREGG BOGOSIAN AND JAMES F. KANE
Freter, R., Brickner, H., Fekete, J., O’Brien, P. C. M., and Vickerman, M. M. (1979). Testing of host-vector systems in mice. Recomb. DNA Tech. Bull. 2,68-76. Freter, R.,Brickner, H., Fekete, J., Vickerman, M. M., and Carey, K. E. (1983a).Survival and implantation of Escherichia coli in the intestinal tract. Infect. Immun. 39,686-703. Freter, R., Freter, R. R., and Brickner, H.(1983b).Experimental and mathematical models of Escherichia coli plasmid transfer in vitro and in vivo. Infect. Immun. 3 9 , 6 0 4 4 . Gealt, M. A. (1988). Recombinant DNA plasmid transmission to indigenous organisms during waste treatment. Water Sci. Technol. 20, 179-184. Gealt, M. A., Chai, M. D., Alpert, K. B., and Boyer, J. C. (1985). Transfer of plasmids pBR322 and pBR325 in wastewater from laboratory strains of Escherichia coli to bacteria indigenous to the waste disposal system. Appl. Environ. Microbiol. 49, 836-841. Gealt, M. A., Cleveland, P., and Vettese, M. (1988).Transfer of genetically engineered DNA sequences (GEDS) to indigenous wastewater bacteria in a laboratory-scale treatment facility. Abstr. Annu. Meet. Am. SOC.Microbiol. p. 254. Geldreich, E. E. (1966). “Sanitary Significance of Fecal Coliforms in the Environment,” Publ. WP-20-3. Cincinnati Water Res. Lab., US.Dep. Inter., Cincinnati, Ohio. Genthner, F. J., Chatterjee, P., Barkay, T., and Bourquin, A. W. (1988). Capacity of aquatic bacteria to act as recipients of plasmid DNA. Appl. Environ. Microbiol. 54,115-117. Godwin, D., and Slater, J. H.(1979). The influence of the growth environment on the stability of a drug resistance plasmid in Escherichia coli K-12.J. Gen. Microbiol. 111, 201-210. Gowland, P. C., and Slater, J. H.(1984). Transfer and stability of drug resistance plasmids in Escherichia coli K-12. Microb. Ecol. 10,1-13. Grabow, W. 0. K., and Prozesky, 0. W. (1973). Drug resistance of coliform bacteria in hospital and city sewage. Antimicrob. Agents Chemother. 3, 175-180. Grabow, W. 0. K., Middendorff, I. G., and Prozesky, 0. W. (1973). Survival in maturation ponds of coliform bacteria with transferable drug resistance. Water Res. 7, 15891597. Grabow, W. 0. K., Prozesky, 0. W., and Smith, L. S . (1974). Drug resistant coliforms call for review of water quality standards. Water Res. 8,1-9. Grabow, W. 0. K.,Prozesky, 0. W., and Burger, J. S . (1975). Behavior in a river and dam of coliform bacteria with transferable or nontransferable drug resistance. Water Res. 9, 777-782. Grabow, W. 0. K., van Zyl, M., and Prozesky, 0. W. (1976). Behavior in conventional sewage purification processes of coliform bacteria with transferable or non-transferable drug resistance. Water Res. 10,717-723. Guinee, P. A. M. (1965). Transfer of multiple drug resistance from Escherichia coli to Salmonella typhirnurium in the mouse intestine. Antonie van Leeuwenhoek 31, 314-322. Gyles, C., Falkow, S., and Rollins, L. (1978). In vivo transfer of an Escherichia coli enterotoxin plasmid possessing genes for drug resistance. Am. J. Vet. Res. 39, 14381441. Hardy, K. G. (1975). Colicinogeny and related phenomena. Bacteriol. Rev. 39,464-515. Helling, R. B., Kinney, T., and Adams, J. (1981).The maintenance of plasmid-containing organisms in populations of Escherichia coli. J. Gen. Microbiol. 123, 129-141. Holloway, B. W. (1979). Plasmids that mobilize bacterial chromosomes. Plasmid 2,1-19. Hughes, V. M., and Datta, N. (1983). Conjugative plasmids in bacteria of the “preantibiotic” era. Nature (London) 302, 725-726. Hull, R. A., Gill, R. E., Hsu, P., Minshew, B. H.,and Falkow, S . (1981). Construction and
ENVIRONMENTAL FATE OF RECOMBINANT E. coli K-12
127
expression of recombinant plasmids encoding type I or n-mannose-resistant pili from a urinary tract infection Escherichia coli isolate. Infect. Immun. 33,933-938. Ippen-Ihler, K. A., and Minkley, E. G. (1986). The conjugation system of F, the fertility factor of Escherichia coli. Annu. Rev. Genet. 20,593-624. Jain, R. K., Burlage, R. S.,and Sayler, G. S. (1988).Methods for detectingrecombinantDNA in the environment. CRC Crit. Rev. Biochem. 8,33-84. Jones, I. M., Primrose, S. B., Robinson, A., and Ellwood, D. C. (1980).Maintenance of some ColEl-type plasmids in chemostat culture. Mol. Gen. Genet. 180, 579-584. Jones, R. T., and Curtiss, R., 111 (1970). Genetic exchange between Escherichia coli strains in the mouse intestine. J. Bacteriol. 103, 71-80. Karch, H., Heesemann, J., Laufs, R., O’Brien, A. D., Tacket, C. O., and Levine, M. M. (1987). A plasmid of enterohemorrhagic Escherichia coli 0157:H7 is required for expression of a new fimbriae antigen and for adhesion to epithelial cells. Infect. Immun. 55, 455-461.
Kasuya, M. (1964). Transfer of drug resistance between enteric bacteria induced in the mouse intestine. J. Bacteriol. 88, 322-328. Khalil, T. A., and Gealt, M. A. (1987). Temperature, pH, and cations affect the ability of Escherichia coli to mobilize plasmids in L broth and synthetic wastewater. Can. J. Microbiol. 33, 733-737. Kralikova, K., Krcmery, V., Sr., and Krcmery, V., Jr. (1983). Incidence of gentamicinresistant bacteria and those with R plasmids, transferable to E. coli K-12, in municipal waste waters. Recomb. DNA Tech. Bull. 6, 98-100. Kralikova, K., Krcmery, V., Sr., and Krcmery, V., Jr. (1986). Antibiotic resistance and transferable resistance in Enterobacteriaceae in municipal waste waters. Recomb. DNA Tech. Bull. 9, 59-64. Krasovsky, V. N., and Stotzky, G. (1987). Conjugation and genetic recombination in Escherichia coli in sterile and nonsterile soil. Soil Biol. Biochem. 19, 631-638. Laux, D. C., Cabelli, V. J., and Cohen, P. S. (1982).The effect of plasmid gene expression on the colonizing ability of E. coli HS in mice. Recomb. DNA Tech. Bull. 5 , l - 5 . Laux, D. C., McSweegan, E. F., Williams, T. J., Wadolkowski, E. A., and Cohen, P. S. (1986). Identification and characterization of mouse small intestine mucosal receptors for Escherichia coli K-12 (K88ab). Infect. Immun. 52, 18-25. Levin, B. R., and Rice, V. A. (1980).The kinetics of transfer of nonconjugative plasmids by mobilizing conjugative factors. Genet. Res. 35, 241-259. Levin, B. R., and Stewart, F. M. (1980). The population biology of bacterial plasmids: A priori conditions for the existence of mobilizable nonconjugative factors. Genetics 94,425-443.
Levin, B. R., Stewart, F. M., and Rice, V. A. (1979). The kinetics of conjugative plasmid transmission: Fit of a simple mass action model. Plasmid 2, 247-260. Levine, M. M., Kaper, 7. B., Lockman, H., Black, R. E., Clements, M. L., and Falkow, S. (1983a). Recombinant DNA risk assessment studies in humans: Efficacy of poorly mobilizable plasmids in biologic containment. J. Infest. Dis. 148, 699-709. Levine, M. M., Kaper, J. B., Lockman, H., Black, R. E., Clements, M. L., and Falkow, S. (1983b).Recombinant DNA risk assessment studies in man: Efficacy of poorly mobilizable plasmids in biologic containment. Recomb. DNA Tech. Bull. 6,89-97. Levy, S. B. (1984). Survival of plasmids in Escherichio coli. In “Genetic Manipulation: Impact on Man and Society” (W. Arber, K. Illmensee, W. J. Peacock, and P. Starlinger, eds.), pp. 19-28. ICSU Press, Paris. Levy, S. B., and Marshall, B. (1979).Survival of E. coli host-vector systems in the human intestinal tract. Recomb. DNA Tech. Bull. 2, 77-80.
128
GREGG BOGOSIAN AND JAMES F. KANE
Levy, S. B., and Marshall, B. (1981). Risk assessment studies of E. coli host-vector systems. Recomb. DNA Tech. Bull. 4,91-98. Levy, S. B., Sullivan, N., and Gorbach, S. L. (1978). Pathogenicity of conventional and debilitated Escherichia coli K-12. Nature (London) 274, 395-396. Levy, S. B., Marshall, B., and Rowse-Eagle, D. (1980). Survival of Escherichia coli hostvector systems in the mammalian intestine. Science 209, 391-394. Liang, L. N., Sinclair, J. L., Mallory, L. M., and Alexander, M. (1982). Fate in model ecosystems of microbial species of potential use in genetic engineering. Appl. Environ. Microbiol. 44, 708-714. Linton, K. B., Richmond, M. H., Bevan, R., and Gillespie, W. A. (1974). Antibiotic resistance and R factors in coliform bacilli isolated from hospital and domestic sewage. J. Med. Microbiol. 1, 91-103. Lyon, F., and Walter, M. (1989). A colorimetric assay for use in detecting, tracking, and enumerating genetically engineered microorganisms in the environment. Abstr. Annu. Meet. Am. SOC.Microbiol. p. 353. McClure, N. C., Weightman, A. J., and Fry, J. C. (1989). Survival of Pseudomonas putida UWCl containing cloned catabolic genes in a model activated-sludge unit. Appl. Environ. Microbiol. 55, 2627-2634. Mach, P. A., and Grimes, D. J. (1982). R-plasmid transfer in a wastewater treatment plant. Appl. Environ. Microbiol. 44, 1395-1403. McPherson, P., and Gealt, M. A. (1986). Isolation of indigenous wastewater bacterial strains capable of mobilizing plasmid pBR325. Appl. Environ. Microbiol. 51, 904909. Mallory, L. M., Sinclair, J. L., Liang, L. N., and Alexander, M. (1982). A simple and sensitive method for assessing survival in environmental samples of species used in recombinant DNA research. Recomb. DNA Tech. Bull. 5, 5-6. Mancini, P., Fertels, S., Nave, D., and Gealt, M. A. (1987). Mobilization of plasmid pHSVlO6 from Escherichia coli HBlOl in a laboratory-scale waste treatment facility. Appl. Environ. Microbiol. 53,665-671. Marshall, B., Schluederberg, S., Tachibana, C., and Levy, S. B. (1981). Survival and transfer in the human gut of poorly mobilizable (pBR322)and of transferable plasmids from the same carrier E. coli. Gene 14, 145-154. Maturin, L., Sr., and Curtiss, R., 111 (1977). Degradation of DNA by nucleases in intestinal tract of rats. Science 196, 216-218. Mergeay, M., and Gerits, J. (1978). F’-plasmid transfer from Escherichia coli to Pseudomonas fluorescens. J. Bacteriol. 135, 18-28. Moodie, H. L., and Woods, D. R. (1973). Anaerobic R factor transfer in Escherichia coli. J. Gen. Microbiol. 76, 437-440. Morlon, J., Chartier, M., Bidaud, M., and Lazdunski, C. (1988a). The complete nucleotide sequence of the colicinogenic plasmid ColA. High extent of homology with ColE1. Mol. Gen. Genet. 211, 231-243. Morlon, J., Sherratt, D., and Lazdunski, C. (1988b).Identification of functional regions of the colicinogenic plasmid ColA. Mol. Gen. Genet. 211,223-230. Myhal, M. L., Laux, D. C., and Cohen, P. S. (1982). Relative colonizing abilities of human fecal and K-12 strains of Escherichia coli in the large intestines of streptomycintreated mice. Eur. J. Clin. Microbiol. 1, 186-192. Newman, A. R. (1989).Tracking genetically engineered microorganisms. Anal. Chem. 61, 1001-1003. Noack, D., Roth, M., Geuther, R., Muller, G., Undisz, K., Hoffmeier, C., and Gaspar, S. (1981). Maintenance and genetic stability of vector plasmids pBR322 and pBR325 in Escherichia coli K-12 strains grown in a chemostat. Mol. Gen. Genet. 184, 121-124.
ENVIRONMENTAL FATE OF RECOMBINANT E. coli K-12
129
Onderdonk, A., Marshall, B., Cisneros, R., and Levy, S. B. (1981). Competition between congenic Escherichia coli K-12 strains in vivo. Infect. Immun. 32, 74-79. Orskov, F., and Orskov, I. (1961). The fertility of Escherichia coli antigen test strains in crosses with K-12. Acta Pathol. Microbiol. Scand. 51,280-290. Orskov, I., and Orskov, F. (1960). The H antigen of the “K-12” strain. A new E. coli H antigen: H 48. Acta Pathol. Microbiol. Scand. 48,47. Ozawa, A., and Freter, R. (1964).Ecological mechanism controlling growth of Escherichia coli in continuous flow cultures and in the mouse intestine. J. Infect. Dis. 114, 235-242.
Ozeki, H.,Stocker, B. A. D., and Smith, S. M. (1962). Transmission of colicinogeny between strains of Salmonella typhimurium grown together. J. Gen. Microbiol. 30, 201-221.
Petrocheilou, V., Grinsted, J., and Richmond, M. H. (1976). R-plasmid transfer in vivo in the absence of antibiotic selection pressure. Antimicrob. Agents Chemother. 10, 753-761.
Phillips, S. J., Dalgarn, D. S., and Young, S. K. (1987). Recombinant DNA in wastewater: Plasmid degradation kinetics. Abstr. Annu. Meet. Am. SOC.Microbiol. p. 303. Reanney, D. C., Gowland, P. C., and Slater, J. H. (1983). Genetic interactions among microbial communities. Symp. SOC.Gen. Microbiol. 34, 379-422. Regal, P. J. (1987). Models of genetically engineered organisms and their ecological impact. Recomb. DNA Tech. Bull. 10, 67-85. Reinikainen, P., and Virkajarvi, I. (1989). Escherichia coli growth and plasmid copy numbers in continuous cultivations. Biotechnol. Lett. 11,225-230. Richaume, A., Angle, J. S.,and Sadowsky, M. J. (1989).Influence of soil variables on in situ plasmid transfer from Escherichia coli to Rhizobium fredii. Appl. Environ. Microbiol. 55,1730-1734.
Rissler, J. F. (1984). Research needs for biotic environmental effects of geneticallyengineered microorganisms. Recomb. DNA Tech. Bull. 7, 20-30. Roszak, D. B., and Colwell, R. R. (1987). Survival strategies of bacteria in the natural environment. Microbiol. Rev. 51, 365-379. Sagik, B. P., and Sorber, C. A. (1979). The survival of host-vector systems in domestic sewage treatment plants. Recomb. DNA Tech. Bull. 2,55-61. Sanchez, E. J., and Toranzos, G. A. (1989). In situ survival of two strains of genetically engineered microorganisms. Abstr. Annu. Meet. Am. SOC.Microbiol. p. 354. Schilf, W., and Klingmuller, W. (1983).Experiments with Escherichia coli on the dispersal of plasmids in environmental samples. Recomb. DNA Tech. Bull. 6,101-102. Sears, H. J., Brownlee, I., and Uchiyama, J. K. (1950). Persistence of individual strains of Escherichia coli in the intestinal tract of man. J. Bacteriol. 59, 293-301. Selander, R. K., and Levin, B. R. (1980).Genetic diversity and structure in Escherichia coli populations. Science 210,545-547. Sharples, F. E. (1983). Spread of organisms with novel genotypes: Thoughts from an ecological perspective. Recomb. DNA Tech. Bull. 6,43-56. Shaw, D. R., and Cabelli, V. J. (1980). R-plasmid transfer frequencies from environmental isolates of Escherichia coli to laboratory and fecal strains. Appl. Environ. Microbiol. 40, 756-764.
Singleton, P. (1983). Colloidal clay inhibits conjugal transfer of R-plasmid Rldrd-19 in Escherichia coli. Appl. Environ. Microbiol. 46, 756-757. Singleton, P., and Anson, A. E. (1981). Conjugal transfer of R-plasmid Rldrd-19 in Escherichia coli below 22°C. Appl. Environ. Microbiol. 42, 789-791. Sjogren, R. E. (1989). Soil survival of Escherichia coli: Laboratory microcosms and field plots. Abstr. Annu. Meet. Am. SOC.Microbiol. p. 353.
130
GREGG BOGOSIAN AND JAMES F. KANE
Smith, C., Jr., Milewski, E., and Martin, M. A. (1985).The effect of colonizing mice with laboratory and wild type strains of E. coli containing tumor virus genomes. Recomb. DNA Tech. Bull. 8,47-51. Smith, H. W. (1969).Transfer of antibiotic resistance from animal and human strains of Escherichia coli to resident E. coli in the alimentary tract of man. Lancet 1, 11741176.
Smith, H. W. (1970).Incidence in river water of Escherichia coli containing R factors. Nature (London) 228,1286-1288. Smith, H. W. (1975).Survival of orally administered E. coli K-12 in alimentary tract of man. Nature (London) 255, 500-502. Smith, H.W. (1978).Is it safe to use Escherichia coli K-12 in recombinant DNA experiments? J. Infect. Dis. 5, 655-660. Smith, H. W., and Huggins, M. B. (1976).Further observations on the association of the colicine V plasmid of Escherichio coli with pathogenicity and with survival in the alimentary tract. 1. Gen. Microbiol. 92,335-350. Smith, H. W., and Huggins, M. B. (1978).The effect of plasmid-determined and other characteristics on the survival of Escherichia coli in the alimentary tract of two human beings. J. Gen. Microbiol. 109,375-379. Smith, H. W., and Huggins, M. B. (1980).The association of the 018,K1, and H7 antigens and the ColV plasmid of a strain of Escherichia coli with its virulence and immunogenicity. J. Gen. Microbiol. 121,387-400. Smith, P. R., Farrell, E., and Dunican, K. (1974).Survival of R+ Escherichia coli in sea water. Appl. Microbiol. 27,983-984. Soberon, X.,Covarrubias, L., and Bolivar, F. (1980).Construction and characterization of new cloning vehicles. IV. Deletion derivatives of pBR322 and pBR325. Gene 9, 287-305.
Stanier, R. Y., Ingraham, J. L., Wheelis, M. L., and Painter, P. R. (1986).“The Microbial World,” pp. 439-452. Prentice-Hall, Englewood Cliffs, New Jersey. Steffan, R. J., Breen, A., Atlas, R. M.,and Sayler, G. S. (1989).Monitoring genetically engineered microorganisms in freshwater microcosms. 1.Ind. Microbiol. 4,441-446. Stewart, F. M., and Levin, B. R. (1977).The population biology of bacterial plasmids: A priori conditions for the existence of conjugationally transmitted factors. Genetics 87,209-228.
Stewart, K. R.,and Koditschek, L. (1980).Drug-resistance transfer in Escherichia coli in New York bight sediment. Mar. Pollut. BuH. 11,130-133. Stotzky, G. (1986).Influence of soil mineral colloids on metabolic processes, growth, adhesion, and ecology of microbes and viruses. In “Interactions of Soil Minerals with Natural Organics and Microbes” (P. M. Huang and M. Schnitzer, eds.), pp. 305-428. Soil Science Society of America, Madison, Wisconsin. Stotzky, G., and Babich, H. (1984).Fate of genetically-engineered microbes in natural environments. Recomb. DNA Tech. Bull. 7, 163-188. Stotzky, G., and Babich, H. (1986).Survival of, and genetic transfer by, genetically engineered bacteria in natural environments. Adv. Appl. Microbiol. 31,93-138. Stotzky, G.,Devanas, M. A,, and Zeph, L. R. (1989).Methods of studying bacterial gene transfer in soil by conjugation and transduction. U.S. Environ. Prot. Agency Doc. EPA-60013-89-042.
Strauss, H. S., Hattis, D., Page, G., Harrison, K., Vogel, S., and Caldart, C. (1986).Genetically-engineered microorganisms: 11. Survival, multiplication, and genetic transfer. Recomb. DNA Tech. Bull. 9,69-88.
ENVIRONMENTAL FATE OF RECOMBINANT E. coli K-12
131
Tiedje, J. M., Colwell, R. K., Grossman, Y. L., Hodson, R. E., Lenski, R. E., Mack, R. N., and Regal, P. J. (1989). The planned introduction of genetically engineered organisms: Ecological considerations and recommendations. Ecology 70,298-315. Toranzo, A. E., Combarro, P., Lemos, M. L., and Barja, J. L. (1984). Plasmid coding for transferable drug resistance in bacteria isolated from cultured rainbow trout. Appl. Environ. Microbiol. 48, 872-877. Trevors, J. T. (1987). Survival of Escherichia coli donor, recipient, and transconjugant cells in soil. Water Air Soil Pollut. 34,409-414. Trevors, J. T., and Oddie, K. M. (1986). R-plasmid transfer in soil and water. Can. J. Microbiol. 32, 610-613. Trevors, J. T., and Starodub, M. E. (1987). R-plasmid transfer in nonsterile agricultural soil. Syst. Appl. Microbiol. 9, 312-315. Twigg, A. J., and Sherratt, D. (1980). Trans-complementable copy-number mutants of plasmid ColE1. Nature (London) 283, 216-218. van Leeuwen, W. J., van Embden, J. D. A., and Guinee, P. A. M. (1979). Identification of E. coli K-12 derivatives by means of bacteriophages. Recomb. DNA Tech. Bull. 2, 36-40. Vernet, T., McDonald, I. J., Cameron, D. R., and Visentin, L. P. (1985).Stable maintenance in chemostat-grown Escherichia coli of pBR322 and pACYC184 by disruption of the tetracycline resistance gene. Biosci. Rep. 5, 29-37. Walter, M. V., Porteous, A., and Seidler,R. J. (1987).Measuring genetic stability in bacteria of potential use in genetic engineering. Appl. Environ. Microbiol. 53, 105-109. Warren, G. J., Twigg, A. J., and Sherratt, D. J. (1978).ColEl plasmid mobility and relaxation complex. Nature (London) 274, 259-261. Weinberg, S. R., and Stotzky, G. (1972). Conjugation and genetic recombination of Escherichia coli in soil. Soil Biol. Biochem. 4, 171-180. Wells, C. L., Johnson, W. J., Kan, C. M., and Balish, E. (1978). Inability of debilitated Escherichia coli ~ 1 7 7 to 6 colonize germ-free rodents. Nature (London) 274, 397. Willetts, N. S., and Wilkins, B. (1984). Processing of plasmid DNA during bacterial conjugation. Microbiol. Rev. 48, 24-41. Williams, P. H. (1977). Plasmid transfer in the human alimentary tract. FEMS Microbiol. Lett. 2, 91-95. Williams, P. H., Sedgwick, M. I., Evans, N., Turner, P. J., George, R. H., and McNeish, A. S. (1978). Adherence of an enteropathogenic strain of Escherichia coli to human intestinal mucosa is mediated by a colicinogenic conjugative plasmid. Infect. Irnmun. 22, 393-402. Wouters, J. T. M., Driehuis, F. L., Polaczek, P. J., van Oppenraay, M.-L. H. A., and van Andel, J. G. (1980).Persistence of the pBR322 plasmid in Escherichia coli K-12 grown in chemostat cultures. Antonie van Leeuwenhoek 46, 353-362. Young, I. G., and Poulis, M. I. (1978). Conjugal transmission of cloning vectors derived from ColEI. Gene 4, 175-179. Zeph, L. R., and Stotzky, G. (1988). Transduction by bacteriophage P1 in soil. Abstr. Annu. Meet. Am. SOC.Microbiol. p. 298. Zeph, L. R., and Stotzky, G. (1989). Use of a biotinylated DNA probe to detect bacteria transduced by bacteriophage P I in soil. Appl. Environ. Microbiol. 55, 661-665. Zeph, L. R., Onaga, M. A., and Stotzky, G. (1987).Transduction in soil. Abstr. Annu. Meet. Am. SOC.Microbiol. p. 303. Zeph, L. R., Onaga, M. A., and Stotzky, G. (1988). Transduction of Escherichia coli by bacteriophage PI in soil. Appl. Environ. Microbiol. 54, 1731-1737.
This Page Intentionally Left Blank
Microbial Cytochromes P-450 and Xenobiotic Metabolism F. SIMASARIASLANI Central Research and Development Department E. 1. du Pont de Nemours and Company, lnc. Wilmington, Delaware 19880 I. Introduction 11. General Properties of Cytochromes P-450 111. Microbial Cytochromes P-450 A. Procaryotic Cytochromes P-450 B. Eucaryotic Cytochromes P-450 IV. Conclusion References
I. Introduction
Cytochromes P-450, which are a special class of heme-containing multicomponent enzymes, are widely distributed in mammalian, plant, and microbial systems. These enzymes have been the subject of numerous extensive reviews in the past. For some of the more recent articles, readers are referred to reviews by Guengerich (1987),Dawson and Smith Eble (19861, and Black and Coon (1987). Due to their versatility and wide distribution in biological systems, cytochromes P-450 have been recognized to play a central role in the oxidative metabolism of chemicals of pharmaceutical, agricultural, and environmental significance. Although numerous mammalian cytochromes P-450 have been extensively studied, detailed research on their microbial counterparts for many years has been limited to the P-450 systems of Pseudomonas putida and to some extent to Saccharomyces cerevisiae. However, during the past few years more attention has been focused on other microbial cytochromes P-450, and a number of procaryotic and eucaryotic P-450 enzymes of microbial origin have now been purified to homogeneity and studied in detail. The studies have emphasized the central role of these enzymes, similar to their mammalian counterparts, in the oxidation of chemicals of an endobiotic and xenobiotic nature. Considering current concern about the fate of various recalcitrant xenobiotic chemicals in the environment, the significant role that oxidative enzymes (such as P-450) play in the toxification/detoxification of chemicals cannot be overemphasized. It is therefore this author’s intention to present herein the most recent information available on various microbial P-450 enzymes so that this article may serve as a reference for those investigators interested in such enzymatic systems. 133 ADVANCES IN APPLIED MICROBIOLOGY. VOLUME 36 Copyright 6 1991 by Academic Press, Inc. All rights of reproduction in any form reserved.
134
F. SIMA SARIASLANI
II. General Properties of Cytochromes P-450
The reduced CO adducts of all cytochromes P-450 generate distinct spectra by absorbing maximally between 447 and 452 nm. Cytochromes P-450 are usually multicomponent systems and require the participation of other ancillary proteins for their catalytic functions. There are basically two major types of P-450 systems reported to date (Fig. 1).The system identified in the cytoplasmic reticulum of eucaryotic organisms (Type I), consists of a FAD- and FMN-containing reductase for transport of electrons from NADPH to the P-450 component. In this type of organization, electrons are donated from NADPH to the NADPH-cytochrome P-450 reductase that cycles between one- and three-electron reduced forms. The NADPH-cytochrome P-450 reductase is composed of two domains, a small hydrophobic domain in the N-terminus region that binds both the membrane and the P-450 component, and a large hydrophilic domain that contains the C-terminus and binds both flavins. In this case, the flow of electrons occurs from FAD to FMN and then to the P-450 component in two sequential one-electron steps. It appears that one reductase can transfer electrons to more than one P-450 component
Type I1
Reductase
FIG.1. The arrangement of various components within Type I and Type I1 cytochromes P-450.
MICROBIAL CYTOCHROME P-450
135
in mammalian systems (Black and Coon, 1987). The microsomal P-450 enzymes exhibit broad and overlapping catalytic activities and are perhaps the most nonspecific enzymes known. In contrast, the second type of P-450 system (Type 11),which has been identified in mitochondria and bacteria, generally possesses very tight substrate specificities. Type I1 P-450 systems, in addition to a FADcontaining reductase, use a small redox iron-sulfur protein (ferredoxin) for transfer of electrons to the terminal P-450 component. Figure 2 depicts the prosthetic nature of the protein components involved in electron transport in Type I1 P-450 systems. A third type of organization of P-450 components has been reported by Fulco and co-workers for the P-450 system of Bacillus megaterium (Nahri and Fulco, 1987).In this bacterium a catalytically self-sufficient P-450, which does not require the presence of ancillary electron transport proteins, performs its oxidative reactions in the presence of the reduced pyridine nucleotide. Cytochromes P-450 contain a single iron porphyrin IX (heme) prosthetic group ligated to the apoprotein by a unique cysteine thiolate bond. Figure 3 depicts the structures of various adducts of P-450 enzymes. All P-450 enzymes studied to date have a common catalytic
R
Prosthetic group of the reductase component (flavin adenine dinucleotide)
FIG.2.
Prosthetic group of the ferredoxin component (the [2Fe-2S1
Prosthetic group of the cytochrome P-450 component (heme, protoporphyrin IX) The prosthetic nature of various components of Type I1 cytochromes P-450.
136
F. SIMA SARIASLANI
NA
Xm,-394nm
Enzyme
B
418 nm
Enzyme
450 nm
Enzyme FIG. 3. (A] The high-spin ferric cytochrome P-450with an absorption maximum of -394 nm. (B) The low-spin ferric cytochrome P-450with an absorption maximum of -418 nm. (C) The GO-bound ferrous cytochrome P-450,which exhibits the characteristic absorption at -450 nm. Adapted from Black and Coon (1987),with permission.
cycle (Fig. 4) through which they reductively cleave molecular oxygen and bring about hydroxylation of their substrates. The sequence of events of the P-450 catalytic cycle, during which many unusual shortlived intermediates are formed, is summarized as follows: 1. In the first step, substrate binding occurs. This step is thought to be very rapid and in most cases changes the spin state of iron from low (hexacoordinate) to high (pentacoordinate), giving rise to a Type I spectrum. In the case of low-spin P-450 enzymes, this step facilitates the subsequent electron uptake. On the other hand, P-450 enzymes isolated in high-spin form do not need substrate binding for reduction. 2. In the second step, the flavoprotein reductase donates one electron and reduces the substrate-bound iron complex to generate a ferrous high-spin enzyme complex. 3. In the third step, molecular oxygen binds the ferrous enzyme complex and the unstable ternary oxy complex is formed. 4. A second electron transfer from the flavoprotein reductase in the fourth step generates the peroxo intermediate.
MICROBIAL CYTOCHROME P-450
137
5. During the fifth step, heterolysis of the 0-0 bond produces one molecule of water and a reactive intermediate. Indirect approaches have been used to establish the exact nature of this unstable intermediate. For example, binding and reduction of molecular oxygen in the native P-450 catalytic cycle can be circumvented by a variety of artificial twoelectron oxidizing agents such as alkyl hydroperoxidases and iodosylbenzene. These biomimetic reactions, which do not need NAD(P)H or molecular oxygen, are not inhibited by carbon monoxide (Groves, 1985; Tabushi, 1988; Okamoto et aJ., 1989). In these reactions the peroxide oxygen is transferred to the substrate. The catalytic intermediate generated in this case is more stable than that generated in the native P-450 cycle and has therefore allowed investigators to propose structures such as the oxoiron(1V) porphyrin cation radical or oxoiron(V) complex as the unstable intermediate of the native P-450 cycle (Imai eta]., 1989). 6. In the final step of this catalytic cycle, substrate oxygenation occurs and the low-spin ferric enzyme becomes available for a second cycle.
-
Reactions catalyzed by various cytochromes P-450 have recently been reviewed by Guengerich (1990). These reactions include:
Substrate (S) Fe"' ferric low spin
Fe&(S) femc high spin
Fe'h (S)
t
ferrous high spin
t
A
NAD(P)H e
1
FIG.4. The catalytic cycle of cytochromes P-450.
138
F. SIMA SARIASLANI
C-H -C-OH FIG.5. Carbon hydroxylation by cytochromes P-450(Ortiz de Montellano, 1989).
1. Carbon hydroxylation, during which an alkane is converted to a primary, secondary, or tertiary alcohol (Ortiz de Montellano, 1989; Groves and Subramanian, 1984) (Fig. 5). 2. Heteroatom oxygenation, which has been shown with compounds containing nitrogen and sulfur (Neal and Alpert, 1982; Frederick et al., 1982) (Fig. 6). 3. Dealkylation (heteroatom release), which involves either oneelectron abstraction from the heteroatom or hydrogen atom abstraction (Guengerich, 1984) (Fig. 7). 4. Epoxidation of olefins and aromatic rings, which is thought to be a stepwise reaction involving discrete radical and/or cationic intermediates. Epoxidation of olefins is usually accompanied by retention of stereochemistry (Guengerich and Macdonald, 1984) (Fig. 8). 5. Oxidative group migration (NIH shift), which can be indicative of epoxidation; however, direct transfer of substituents can also occur (Daly et al., 1972; Miller and Guengerich, 1982) (Fig. 9). 6. Dehydrogenation, in which the substrate loses Hz, similar to reactions observed with dehydrogenases (Ortiz de Montellano, 1989; Bocker and Guengerich, 1986) (Fig. 10). 7 . Mechanism-based inactivation includes a variety of reactions, such as heteroatom oxygenation, heteroatom release, epoxidation, and oxidative group migration. Intermediates-formed, such as acetylenes and terminal olefins, can inactivate the P-450 enzymes (Bocker and Guengerich, 1986; Ortiz de Montellano and Correis, 1984). 8. Reduction processes, which in some cases involve two-electron processes, occur with polyhalogenated methanes (carbon tetrachloride and halothane), azo dyes, nitro groups, N-oxides, and epoxides (Pohl et al., 1984) (Fig. 11). 9. Another type of reaction that has recently been attributed to P-450 enzymes is the stepwise reductive cleavage of xenobiotic hydroperoxides and biologically occurring hydroperoxides as outlined in Fig. 12 (Coon and Vaz, 1988).
In the following discussions, procaryotic and eucaryotic cytochromes P-450of microbial origin will be reviewed separately.
-c-
-
-C-O FIG.6. Heteroatom oxygenation by cytochromes P-450(Neal and Alpert, 1982).
MICROBIAL CYTOCHROME P-450
OH
-
- R-CH
[R-Cl
I
-
RH
139
+
O=C\
/
FIG.7. Heteroatom release (dealkylation) by cytochromes P-450(Guengerich, 1984).
/
~
>c = c\
A/
\
/c-c\
FIG.8. Epoxidation by cytochromes P-450(Guengerich and Macdonald, 1984).
R1\
,c=c\
/ R2
-\ /R' / c - C\-R2
FIG. 9. Oxidation group migration by cytochromes P-450 (Miller and Guengerich, 1982).
CH-CHC=C FIG. 10. Dehydrogenation by cytochromes P-450(Ortiz de Montellano, 1989).
+ leC- R c. + R FIG.11. Reduction by cytochromes P-450(Pohl et al., 1984).
-
XRR'COOH XRCO + R'H FIG. 12. Reductive cleavage of hydroperoxides by cytochromes P-450(Coon and Vaz, 1988).
ill. Microbial Cytochromes P-450
A. PROCARYOTIC CYTOCHROMES P-450
Procaryotic P-450 enzymes are generally multicomponent soluble systems that fall within the Type I1 category (Fig. 1) with respect to the organization of their electron transfer components. These P-450 systems were extensively reviewed by Sligar and Murray (1986). The majority of these enzymes are either extremely substrate specific or act only on a limited number of structurally related substrates. However, isolated examples of procaryotic P-450 enzymes with a different redox component organization or with versatile catalytic activities have also been
140
F. SIMA SARIASLANI
reported. Various procaryotic P-450 systems, which are involved in xenobiotic oxidation, are reviewed below: 1. Pseudomonas putida
Cytochrome P-450 systems have been identified in various strains of P. putida (Unger et al., 1986a). a. Pseudomonas putida (ATCC 17453). The cytochrome P-450 (P450,,,) system of P. putida involved in stereo- and regiospecific hydroxylation of camphor at the 5-eXO position (Fig. 13A) has been studied
(A)
P. pulida (Wild type) v
9
&.-
5-Exo ( 100%)
Camphor (B) P. pulida (Y96 mutant)
-
5-Exo (92%)
6-Ex0 (4%) 3-EXo (4%)
5-Exo (82%)
6-Ex0 (15%)
3-Exo (2.5%)
5-Exo ( 6 3 % )
6-Ex0 (31%)
347x0 (6%)
5-Exo (45%)
6-Ex0 (47%)
3-Exo (2.5%)
9-Hydroxy (0.1%)
(A) P. pufida (Wild type)
-
9-Hydroxy (0.5%)
l-CH3-norcamphor
(B) P. pufida (Y96 mutant)
-
(A) P. pulida (Wild type)
Norcamphor
(B) P. pufida (Y96 mutant)
-
$-Ex0 (36%)
6-Exa (41%)
3-Exo (23%)
FIG.13. (A] Oxidation of camphor, l-CH,-norcamphor, and norcamphor by P-450,., of Pseudornonas putida. (B) Oxidation of camphor, l-CH3-norcamphor, and norcamphor by P. putida (Y96 mutant) (Atkins and Sligar, 1988,1989).
MICROBIAL CYTOCHROME P-450
141
in great detail. Comprehensive reviews discussing this cytochrome P-450 system and its crystal structure have previously been published (Sligar and Murray, 1986; Poulos, 1986). Herein, the most recent information on this P-450 system will be reviewed. This multicomponent system, which was initially identified and characterized by Gunsalus and co-workers in the 1960s (Hedegaard and Gunsalus, 1965), is currently being studied in several laboratories. The P-45OC,, system is composed of a 45,000-Da cytochrome P-450 [P450cam), a 11,726-Da [2Fe-2S] ferredoxin (putidaredoxin), and a 48,000Da FAD-containing NADH-specific ferredoxin reductase (putidaredoxin reductase). Each of these components has been studied in great detail (Unger et a]., 1986b). The crystal structure of P-45OC,, has been resolved with highresolution X-ray crystallography (Poulos, 1986). Elucidation of the P-45OC,, structure has made considerable contributions to the advancement of our understanding of the mechanism of action of P-450 enzymes. These studies have shown that P-45OC,, is an asymmetrical, 30-kthick triangular prism-shaped protein with 1 2 helical segments (A-L), which contribute to 45% of its structure, and four antiparallel p pairs. The heme, which is completely surrounded by the protein, is positioned between helix L [proximal helix) and helix I (distal helix). The substrate is buried in an internal pocket above the heme distal surface adjacent to the oxygen-binding site. The orientation of camphor in the active site allows for contact between its C5 and the activated iron-bound oxygen atom for the production of the 5-eXOhydroxycamphor. The structures of both camphor-bound and camphorfree forms of P-45OC,, have been studied in detail (Poulos, 1988). In the camphor-free P-45OC,,, the substrate pocket of the enzyme is filled with five water molecules. In addition, a sixth water molecule forms a ligand with the heme iron at L6. No significant conformational changes are observed upon binding of the substrate to the enzyme. Raag and Poulos (1989) studied the X-ray structure of the ternary complex between CO, camphor, and P-45OC,, and showed that whereas camphor maintains its nonbonded contact with CO, it moves about 0.8 A, allowing the oxygen atom of the CO molecule to nestle in the enzyme’s groove. Crystallography studies have also indicated that the high stereo- and regiospecificity of P-45OC,, are achieved through specific interaction of several amino acid residues, with the substrate, at the active site of the enzyme (Poulos et al., 1987).In particular, studies with camphor-bound P-450 have indicated the presence of a hydrogen bond between the carbonyl moiety of camphor and the active site residue tyrosine-96. In
142
F. SIMA SARIASLANI
addition to X-ray crystallography, site-directed mutagenesis has been used to study the mechanism of camphor hydroxylation by P-45Ocam. Recently, Atkins and Sligar (1988, 1989) described the influence of the site-specific mutation of three active site residues-valine-295, valine247, and tyrosine-96-on the regiospecificity of P-45OCamduring oxidation of camphor and two of its analogs, 1-CH3-norcamphorand norcamphor (Fig. 13B). Replacement of tyrosine-96 by phenylalanine (mutant Y96F), through site-directed mutagenesis, destroys the strict regiospecificity observed in camphor oxidation (Fig. 13B). In addition to 5-exohydroxycamphor, 6-exo-, 3-eXO-, and 9-hydroxycamphors were also formed during camphor oxidation by this mutant. On the other hand, oxidation of norcamphor and l-CH,-norcarnphor by the wild-type P . putida usually results in the formation of several hydroxylated metabolites. Hydroxylation of norcamphor by the Y96F mutant generated similar metabolites, except that hydroxylation at the 3-position was significantly increased (from 2.5 to 23%). A similar effect was observed when 1-CH3-norcamphor was used as substrate for this mutant. These results underline the directive role played by the putative hydrogen bond between the substrate and tyrosinel96 of the active site in the regiospecificity of P-450,,,-catalyzed reactions. Atkins and Sligar (1989) have also studied the effect of hydrophobic interactions between substrate and the active site of P-45OCa, by changing valine-295 to isoleucine (mutant V295I) and valine-247 to alanine (mutant V247A). When camphor binds the enzyme, these residues are in contact with its 8,9-gem-dimethyl groups and 6- and 10-carbon atoms. It was concluded that these hydrophobic interactions had negligible effects on the control of regiospecificity of camphor hydroxylation by P-45OCa,. On the other hand, because hydroxylation of camphor analogs (1-CH3-norcamphor and norcamphor) was influenced by these mutations, Atkins and Sligar (1989) proposed that the steric bulk of the side chain of alanine-247 affects substrate orientation in these reactions. Recently Imai et al. (1989) showed that threonine-252 plays an important role in camphor hydroxylation by P-450,,, . When threonine-252 was replaced by alanine or valine, the reaction was uncoupled and HzOz was produced from Oz. As a result, the amount of 5-exohydroxycamphor produced was appreciably decreased. On the other hand, when threonine-252 was replaced by serine, the monooxygenase activity was not impaired. Based on these results, Imai et al. proposed that uncoupling of oxygen and subsequent HzOz production is due to the lack of a hydroxyl side chain in alanine and valine in the mutant enzyme.
MICROBIAL CYTOCHROME P-450
143
As mentioned above, P-45OCa, is a multicomponent system that, in addition to the P-450 component, requires participation of NADH, putidaredoxin, and putidaredoxin reductase for substrate turnover. In an interesting study, Smith Eble and Dawson (1984) substituted putidaredoxin reductase and putidaredoxin with an artificial electron mediator such as phenazine methosulfate (PMS) and studied the hydroxylation of camphor by this system. In this reaction, in which transfer of electrons from NADH to P-45OC,, was mediated by PMS, 5-exohydroxycamphor was formed as the reaction product. Addition of 2,3dimercaptopropanol or putidaredoxin to the NADH/PMS/P-45OCa, system was accompanied by a 4- or a 20-fold increase in product formation, respectively. These effects were enhanced dramatically when O2was constantly bubbled through the system. These studies provided the first example of an oxygen-dependent P-450-catalyzed reaction in which an artificial electron mediator replaced the indigenous redox proteins. Molecular biology studies have revealed that the CAM plasmid in P. putida PpGl encodes for the enzymes involved in the early steps of camphor oxidation (Koga et al., 1985, 1989; Unger et al., 1986b). These include 5-exo-hydroxycamphor dehydrogenase (camD gene), and the three P-45OCa, components, putidaredoxin reductase (camA), putidaredoxin (camB), and P-450,,, (camC). The genes form the camDCAB operon and are under negative control by the camR gene located immediately upstream from the camD gene (Koga et al., 1986). In an independent study, Peterson et al. (1990) reported that a 2.2 x lo3 base pair BamHI-StuI fragment from camphor-grown P. putida cells contained two open reading frames that encode for putidaredoxin and putidaredoxin reductase. A potential transcription termination site was found 3' to the putidaredoxin-coding region. The sequence coding for the FAD-binding site in the reductase is close to the N-terminus (residues 6-24), whereas the NADH-binding site lies between residues 151 and 169. Both genes were subcloned and were independently expressed in Escherichia coli. When the rare start codon of GTG of putidaredoxin reductase was changed to ATG, an 18-fold increase in the level of expression of this protein was observed (Peterson et al., 1990).This is a significant finding because it allows isolation of a large amount of protein for detailed biochemical studies. In addition to 5-ex0 hydroxylation of camphor, P-45OC,, has been used for other types of reactions. Reductive dehalogenation of chloropicrin, polyhalomethanes, and chloronitromethanes was accomplished by whole cells of P. putida containing P-45OCa, (Castro et al., 1983, 1985). The final product of chloropicrin degradation was nitromethane
144
-
F. SIMA SARIASLANI
-
C13CNOz CIZCHNOZ CICHzNOzCH3NOz FIG.14. Oxidation of chloropicrin to nitromethane by Pseudomonas putida containing P-450 cam (Castro et al., 1983, 1985).
(Fig. 14). Trichloronitromethane and chloroform were the fastest and the slowest reacting substrates, respectively. Castro et al. (1988) later compared the stoichiometries and kinetics of reduction of trichloromethane, bromotrichloromethane, carbon tetrachloride, ethylene dibromide, and 1,2-dibromo-3-chloropropaneby iron(I1) deuteroporphyrin IX, rat liver P-450PB,P-45OCam,and whole cells of P. putida. Polyhalomethanes underwent reductive hydrogenolysis in all systems studied. Quantitative conversion of the vicinal halides by all the P-450 systems studied resulted in the formation of olefins (Fig. 15). These studies indicated that halides that undergo a quick bond cleavage step exhibit a steric inhibition effect on P-45OCam,whereas the mammalian P - 4 5 0 ~ ~ remains unaffected. Castro et al. concluded that the heme moiety in P-450~ could ~ be more accessible than the heme in P-45Oca,. b. Pseudomonas putida (PpG777). A second cytochrome P-450 system, which is induced by linalool and performs the first two steps of linalool oxidation (Fig. 16), has been identified in P. putida (incognita, strain PpG777) (Ullah et al., 1990). This three-component system consists of a 43,700-Da FAD-containing reductase (reductaseu,), a 12,800Da ferredoxin with a [2Fe-2S] cluster (ferredoxinli,), and a 44,800-Da P-450 component (P-4501~~). In reconstituted systems in which putidaredoxin reductase was used with P-45Oljn and ferredoxinli,, hydroxylation of linalool occurred at less than 10% of the rate observed with the native component. The second product of the linalool hydroxylation reaction is 8-oxolinalool, which is also mediated by the linalool monooxygenase system. In spite of certain similarities, P-450cam and P-45O1in possess distinct physical properties. Hoa et al. (1989)investigated the pressure-induced spectral changes in these cytochrome P-450 systems. P-4501~~ is much more stable under increasing pressure compared to P-45Ocam. On the other hand, although formation of P-42Olin was accompanied with precipitation of the protein and its unfolding, interconversion of P-45Ocam to P-42OCa, occurred without loss of its tertiary structure. Hoa et al.
FIG.15. Conversion of vicinal halides to olefins by various P-450 systems (Castro et al., 1988).
145
MICROBIAL CYTOCHROME P-450
Linalool
8-Hydroxy lindool
8-Oxolinalool
FIG.16. Oxidation of linalool by P-4501i, of Pseudomonas putida (incognita) (Ullah et al., 1990).
(1989) proposed that p-4501in possesses a rigid structure but that P450,,, is more elastic. 2. Bacillus megaterium
Independent studies in two laboratories with two separate strains of B. megaterium have resulted in identification of two vastly different cytochrome P-450 systems in this organism. a. Bacillus megaterium (ATCC 14581). Extensive studies performed in Fulco’s laboratory at the University of California in Los Angeles have led to the characterization of a unique cytochrome P-450 from B. megaterium (ATCC 14581) (Miura and Fulco, 1975; Matson and Fulco, 1981) that hydroxylates both long-chain fatty acids and their corresponding amides and alcohols. The position of the hydroxyl group on the substrate molecule regulates its oxidation by this P-450 enzyme. The 0-1,w-2, and w-3 monohydroxy products of the unsubstituted and saturated fatty acids cannot act as substrates for the enzyme. Among the saturated fatty acids, the order of activity for hydroxylation of the substrates was c15 > c16 > c14 > C17 > c13 > C18 = C12. For amides this order was C14 > Clz > C15 > c16 and for alcohols it was c 1 4>c 1 3 = c15 > C12 > CIS. Kim and Fulco (1983) investigated the effect of 19 barbiturates on P-450 induction in B.megaterium and found that 13 of these chemicals induced the enzyme. Among the substrates tested, secobarbital, thiamylal, and methohexital were very good inducers. Kim and Fulco reported that the enzyme induction was higher with lipophilic substrates. At least three distinct P-450 enzymes are induced by phenobarbital in B. megaterium. One of these P-450 enzymes, P-45OBM-1,which is a 47,439-Da enzyme with 410 amino acids (Schwalb et a]., 1985),has recently been cloned (He eta]., 1989).P-450BM-1exhibits 27% sequence homology to P-450,,, but is four amino acids smaller. Fulco and co-workers concluded that P - 4 5 0 ~belongs ~ - ~ to a new gene family. This enzyme is distinct from P-45oBM-3,which will be discussed
146
F. SIMA SARIASLANI
later. The catalytic function of P-450BM-1is still unknown; however, this P-450 exhibits fatty acid monooxygenase activity in the presence of iodosylbenzene diacetate. Recent studies in Fulco’s laboratory have concentrated on the third enzyme of this series, designated P-450BM-3. P - 4 5 0 ~ ~is3a unique single-component enzyme system that performs the NADPH-dependent oxygenation of a variety of fatty acids in the absence of other electron transport proteins. Due to the presence of noncovalently bound FAD and FMN in its structure, P-450BM-3 possesses a distinctive absorption spectrum in the 450- to 475-nm region. This enzyme contains both a P-450 and a NADPH:P-450 reductase component in a single protein. Phenobarbital induces cytochromes P-450 in other strains of B. megaterium that cross-react with P-45oBM-3 antibodies. Nahri and Fulco (1987) showed that when the substrate-bound P-45oBM-3 is subjected to limited trypsin digest, two domains (polypeptides) with molecular weights of 66,000 and 55,000 are formed. The 66,000-Da domain, which contains the FAD and the FMN moieties, performs the NADPH-dependent reduction of cytochrome c and is derived from the C-terminus of P-450BM-3. Three heme-containing peptides (TI, TII, and TIII) constitute the 55,000Da domain. All these peptides exhibit the characteristic spectral properties of P-450 in the presence of CO and dithionite. The 55,000-Da TI component, which binds substrate, contains the N-terminus of P-450BM-3. The TI1 and TI11 components do not bind substrate and lack the first 9 and 15 amino acids of the N-terminus of P-450BM-31respectively. When P-~~CIBM-~ was digested in the absence of substrate, only the 54,000-Da TI1 and the 53,500-Da TI11 peptides were generated, indicating that perhaps one or more residues of the first nine N-terminus amino acids of P-45oBM-3 are involved in substrate binding. Following cloning and sequencing of the self-sufficient P-450BM-3, Wen and Fulco (1987) succeeded in expressing this gene constitutively in E. coli. Because this recombinant constitutive protein could not be induced by phenobarbital, they introduced the cloned gene back into B. megaterium and observed that although its expression was constitutively repressed, it was induced by phenobarbital. Based on these results Wen and Fulco proposed that perhaps interaction of phenobarbital with a repressor-type molecule, which is absent in E. coli, is a prerequisite for P-450BM-3 induction. After sequencing a 5-kb DNA fragment that contained the P-45oBM-3 gene, Ruettinger et al. (1989) estimated a molecular weight of 117,641 for the self-sufficient protein. The P-450 domain of P-450BM-3 exhibits homology (25%) with the fatty acid o-hydroxylase of P-450 family IV. On the other hand, the reductase domain of this enzyme exhibits 33%
MICROBIAL CYTOCHROME P-450
147
sequence homology with the NADPH:reductases of mammalian liver. Although both P-450 and the reductase domains of P-450BM-3 define new gene families, they contain highly conserved regions that exhibit up to 50% sequence homology with their mammalian counterparts. S1 mapping of the mRNA for P-45oBM-3 indicated a nucleotide length of 3339 2 10 bases for this molecule. Wen et al. (1989) recently examined the effects on gene expression of 5' and 3' deletion derivatives obtained from a 1.6-kb DNA fragment that includes the regulatory region and 88 bases of the N-terminus of P-450BM-3. They concluded that the P-450BM-3 gene, which is under positive control, requires binding with at least one trans-acting factor, probably a protein, to activate transcription from the P-450BM-3promoter. Barbiturates might facilitate binding of this protein with the gene to exert their inducer effect. It is also possible that barbiturates either increase the rate of the protein synthesis or retard its degradation. Additionally, barbiturates might also facilitate the release of the protein from the cell membrane and thus make it accessible to plasmid or chromosomal DNA in the cytoplasm. Detectable expression of P-45oBM-3 is achieved only when a minimum of 0.6-0.7 kb of chromosomal DNA, immediately upstream from the translation start site of the BM-3 gene, is present. Boddupalli et a]. (1990),who have recently overexpressed P-45oBM-3 in E. coli, have shown the hydroxylation of palmitic acid by this recombinant P - ~ ~ O BatMa- rate ~ of 1600 mol/min/mol of heme. Lauric and myristic acids were hydroxylated, regardless of their initial concentrations, into two metabolites. A 1:l stoichiometry of oxygen or NADPH consumed per molecule of substrate oxidized was observed with these substrates. However, when palmitic acid was used as substrate, the ratio of oxygen or NADPH consumed per molecule of substrate oxidized was dependent on the concentration of the substrate used. At high concentrations (>zoo p M ) ,monohydroxylation of palmitic acid resulted in the formation of three metabolites and a stoichiometry of 1:l was observed for oxygen and palmitic acid consumption. When lower concentrations (<50 pM) of palmitic acid were used, additional metabolites were formed and a stoichiometry of 3:l was observed for oxygen and palmitic acid consumption. Boddupalli et al. have concluded that some of the metabolites formed in this case can undergo additional hydroxylation to yield polyhydroxy or hydroxyketone products. b. Bacillus megaterium (ATCC 13368). The Second P-450 system (P-450,,,) identified in B. megaterium (ATCC 13368) by Berg et al. (1975) has been studied in far less detail. P-450me, performs the NADPH-dependent 15P-hydroxylation of 3-oxo-A4 steroids. In an attempt to identify the P-450me, inducer, Berg and Rafter (1981)examined
148
F. SIMA SARIASLANI
a number of substrates and classical mammalian P-450 inducers. They concluded that none of the substrates tested could act as the inducer for the enzyme. However, it is noteworthy that the medium used for cultivation of this bacterium contains soybean extract. Therefore, based on findings in our laboratory, which will be discussed later, the possibility that one of the ingredients in the soybean extract might act as the inducer for P-450megshould be considered. In contrast to P-450BM-3, P-450megis a multicomponent system and has been resolved into three components (Berg et al., 1976). These components consist of a reductase (megaredoxin reductase), which was identified as a 55,000-Da NADPHdependent FMN-containing flavoprotein, a 13,000-Da ferredoxin (megaredoxin), and a 52,000-Da terminal P-450 component (P-45Omeg).Table I summarizes the steroid substrates utilized by P-450meg. Berg et al. (1979) have shown that adrenal ferredoxin and either adrenal ferredoxin reductase or rabbit microsomal P-450 reductase can replace megaredoxin and megaredoxin reductase in P-450BM.3-reconstitutedassays. 3. Xanthobacter s p .
A cytochrome P-450 system that performs the NADPH-dependent hydroxylation of cyclohexane to cyclohexanol was identified by Trower et al. (1985). This cyclohexane-inducible P-450 is multicomponent and catalyzes oxidative reactions on a variety of hydrocarbons, as shown in Table I1 (Warburton et al., 1990). Compounds such as alkyl-substituted cycloalkanes, a bicyclic terpene, some aromatic hydrocarbons, and heterocyclic structures act as substrates for this P-450 system. On the other hand, P-menthane, straight chain alkanes, and dicyclohexyl are not oxidized. 4. Acinetobacter calcoaceticus
Growth on n-hexadecane as the sole carbon and energy source induces cytochromes P-450 in a variety of Acinetobacter strains (Asperger et al., 1981).When A. calcoaceticus cells are grown in a defined medium with n-hexadecane as the sole source of carbon, a particulate P-450 enzyme can be obtained after treatment with EDTA/lysozyme (Asperger et al., 1985a) or Triton X-100 (Muller et a]., 1989). However, addition of n-hexane to organisms growing in a complex medium results in the production of a mixture of soluble P-450/P-420. The membrane-bound n-hexadecane-inducible P-450 system of A. calcoaceticus is multicomponent (Asperger et al., 1985a) and has been resolved into a highly purified P-450, and into partially purified preparations of ferredoxin and ferredoxin reductase components. In reconstitution experiments using these components, long-chain n-alkanes were oxi-
TABLE I HYDROXYLATION OF VARIOUS STEROIDS BY CELL-FREE EXTRACTSOF Bacillus megoteriuma Substrate 4-Androstene-3 ,I7-dione Testosterone Progesterone 20a-Hydroxyprogesterone 17a-Hydroxyprogesterone Deoxycorticosterone Corticosterone Estrone Estradiol Estriol Dehydroepiandrosterone Pregnenolone 5a-Dihydrotestosterone Ba-Androstane-3a,17/3-doil SP-Pregnane-3a,ZOa-doil 5a-Androstane-3a,17/3-3,17-disulfate Adapted from Berg et al. (1976). with permission.
Hydroxylated product 15/3-Hydroxyandrostenedione 15/3-Hydroxytestosterone 6P-Hydroxyprogesterone 15P-Hydroxyprogesterone 15j3-Hydroxy-20a-dihydroprogesterone 15/3,17a-Dihydroxyprogesterone 15j3-Hydroxydeoxycorticosterone 15/3-Hydroxycorticosterone Not metabolized Not metabolized Not metabolized Not metabolized Not metabolized Not metabolized Not metabolized Not metabolized Not metabolized
Specific enzyme activity (nmol/mg protein/30 min] 0.7 0.4 0.4 1.6
1.4 1.5 2.0
0.06
150
F. SIMA SARIASLANI TABLE I1 SUBSTRATE SPECIFICITY OF CYCLOHEXANE HYDROXYLASE IN CELL EXTRACTSOF Xanthobacter sp."
Substrate
Specific activity (nmol O2 consumed/min/mg protein)
Cyclohexane Cyclopentane Cyclooctane Cyclodecane Methylcyclohexane Ethylcyclohexane Methylcyclopentane Ethylcyclopentane Benzene Toluene Octane Decane Undecane Dodecane Hexadecane Methylenecyclohexane l-Methyl-l,4-~yclohexadiene Cyclohexene Cyclohexene oxide p-Menthane Pinane Pyrrolidine Dicyclohexyl Quadricyclane NADPH oxidase
22.9 16.5 6.7 3.8 14.4 3.4 11.9 9.4
5.1 3.9 <0.9 <0.9 <0.9 <0.9 <0.9 6.2 15.7 46.5 25.1 co.9 10.9 12.5 <0.9 7.8 2.5
From Warburton et al. (1990),with permission.
dized. Induction of P-450 by an intermediate of the w-oxidation of n-alkanes was ruled out when the primary and secondary alcohols, n-alkanoic acids, and also amines could not act as inducers for A. calcoaceticus P-450 (Kleber et ai., 1985). However, induction by different ketones and olefins was observed. In addition to n-alkanes, longchain phenylalkanes, ethylbenzene, toluene, xylenes, biphenyl, and indene induce high levels of cytochrome P-450 in A. calcoaceticus (Kleber et a]., 1985; Asperger et al., 1985b). The low-spin P-450 system of A. caicoaceticus, which has a molecular weight of 52,000, has an absolute requirement for NADH. Binding studies with this P-450 system indicate formation of a Type I1 difference
151
MICROBIAL CYTOCHROME P-450
spectrum when octylamine is used as substrate. However, such spectral changes were not detected in the presence of n-alkanes or aniline (Muller et al., 1989). 5. Moraxella sp.
A soluble cytochrome P-450 system is induced in Moraxella sp. GU2 following its growth on guaiacol or 2-ethoxyphenol (Dadas et al., 1985). This enzyme performs the side chain hydroxylation of guaiacol, generating catechol and formaldehyde. 6. Rhizobium japonicum
Several cytochromes P-450 of unspecified function have been reported in R. japonicum (Dus et al., 1976). These enzymes have been observed both from symbiotic cells grown anaerobically in a nitrateorganic medium and from aerobically grown cells. Some of these cytochromes have exhibited significant cross-reactivity with antibodies from P-450,,, (Dus et al., 1976)and the mammalian P - 4 5 0 ~(Appleby ~.~ and Daniel, 1965). 7. Actinomyces
A number of cytochromes P-450 enzyme systems with versatile catalytic functions have been reported in various microorganisms belonging to Actinomycetes. These systems are discussed below: a. Sacchropolyspora erythraea. This organism, which was previously classified as Streptomyces erythreus, catalyzes the hydroxylation of 6-deoxyerythronolide B to erythronolide B (Fig. 17). Two cytochromes P-450, one iron-sulfur protein and two NAD(P)H-dependent ferredoxin reductase components, were isolated from this organism (Shafiee and Hutchinson, 1987,1988).These enzymes were proposed to 0
6-Deoxyerythronolide B
Erythronolide B
FIG.17. Conversion of6-deoxyerythronolideB to erythronolideB by the P-450system of Sacchropolyspora erythraea (Shafiee and Hutchinson, 1987,1988).
152
F. SIMA SARIASLANI
be involved in hydroxylation of 6-deoxyerythronolide; however, because the catalytic activities reported for in vitro-reconstituted assays are extremely low (4.8-13 mol/hour/mg protein), the in vivo involvement of these components in hydroxylation of 6-deoxyerythronolide is questionable. b. Streptomyces carbophilus. 3-Hydroxy-3-methylglutaryl coenzyme A reductase (HMG-CoA reductase) is one of the key enzymes in cholesterol biosynthesis. Inhibition of this enzyme therefore might play a role in control of cholesterol biosynthesis. One of the selective inhibitors of HMG-CoA reductase is Pravastatin sodium, which is generated by hydroxylation of compactin (sodium ML-236B carboxylate). Compactin (Fig. 18) induces two immunologically indistinguishable cytochromes P-450 (P-450,,a-1 and P-450,,a.2) in S . carbophilus (Matsuoka et al., 1989). These P-450 enzymes have molecular weights of around 46,000 and contain 46 and 47% hydrophobic residues in their amino acid compositions. c. Streptomyces setonii. A cytochrome P-450 that 0-demethylates the lignin-related compounds veratrole and guaiacol (Fig. 19) has been reported in S. setonii (Sutherland, 1987). d. Streptomyces sp. The presence of a gene encoding for a P-450like protein in a Streptomyces sp. was recently reported by Horii et al. (1990). This gene (chop), which is located upstream of the cholesterol oxidase (choA) gene, encodes for a protein containing 381 amino acids and with a molecular weight of 41,668. A certain degree of homology can be detected between the chop gene and the other reported cytochrome P-450 genes. Examination of extracts of the wild-type organism and a recombinant Streptomyces lividans carrying the chop gene revealed the presence of the characteristic CO difference spectrum in both organisms. These authors have speculated that this cytochrome P-450 might be involved in cholesterol oxidation in Streptomyces sp. No enzymatic activity has yet been demonstrated for this protein.
...’
N a C 0 0 7 OH
T
HO
.8;‘ ’
FIG.18. Hydroxylation of compactin to pravastatin sodium by the P-450 system of Streptomyces carbophilus (Matsuoka et al., 1989).
153
MICROBIAL CYTOCHROME P-450
Veratrole Guaiacol FIG. 19. 0-Demethylation of veratrole and guaiacol by the P-450 system of Streptomyces setonii (Sutherland, 1987).
e. Streptomyces griseolus. In addition to a constitutive cytochrome P-450 (P-45OcoN), two soluble and immunologically distinct cytochromes P-450 (P-450su1 and P-45OSu2)with molecular weights of 46,000 have been identified in S. griseolus (ATCC 11796) (Romesser and O'Keefe, 1986; O'Keefe et al., 1988). These multicomponent enzymes, which are induced by sulfonylurea herbicides, perform various types of oxidative reactions on these xenobiotics. Representative reactions catalyzed by P-45OSul and P-45OSu2are shown in Fig. 20. Two small sulfonylurea-induced ferredoxins (Fd-1 and Fd-a), each containing a single [3Fe-4S] cluster, have also been purified and characterized in s. griseolus (O'Keefe et al., 1990). Cloning and sequencing of the genes for these proteins have indicated that the gene for Fd-1
Chlorsulfuron COOCH3
6
SOzNHCONH
4 '
4"'
N-
p;> CH3
SUl , su2
su1 *
* pN-jH3 N-
COOH
CH20H
CH3
Sulfometuron methyl
SUl , su2
/ Chlorimuron ethyl
OCH-3
by SU2
E$' OH
FIG.20. Oxidation of selected sulfonylurea herbicides by the P-450 system of Streptomyces griseolus. From J. A. Romesser (personal communication), with permission.
154
F. SIMA SARIASLANI
(sauB) is located downstream of the gene for P - 4 5 0 and ~ ~ that ~ the gene ~ ~ deduced . amino acid for Fd-2 (subB) follows the gene for P - 4 5 0 ~The sequences of each of these proteins have indicated a molecular weight of -7000 for these proteins. Recently Omer et al. (1990) cloned, sequenced, and expressed the ~ ~ ~ The deduced genes encoding for P-450sul (suaC) and P - 4 5 0 (subC). amino acid sequences of the suaC and subC genes were compared to that of P-45OCam.Only a few amino acids in the N-terminus region of the three P-450 enzymes (residues 1-62 in P-45OCam)are conserved. However, strong homology is observed in the C-terminus part of the proteins, particularly with residues associated with O2 binding (residues 244-252), with an unknown function (residues 284-290), and with the heme pocket (residues 350-366). The highest level of homology was observed in the regions involved in the attachment of the heme moiety to the apoprotein. For example, the P-45OCamsequences for the thiolate-proximal ligand of the heme, the pocket surrounding it, and the amino acid residues (Arg-112, Arg-299, and His-355) providing the hydrogen bonds for the propionate groups of the heme are highly conserved in P-450sul and P-450suz. Omer et al. (1990) reported an overall homology of 29.7 and 29.4% to P-450BM-1 and 25.9 and 27.8% to P45OCamfor P - 4 5 0 and ~~~ P-450suz, respectively. Comparison of the amino acid sequences of P - 4 5 0 ~ and ~ ~P - 4 5 0 ~ ~ ~ with the P-450 (105C1) gene a Streptomyces sp. (see Section III,A,7,d) showed greater than 40% homology among these genes, indicating that they belong to the same gene family. However, because less than 30% homology was observed for P-450su1 and P-450suz compared with other reported P-450 sequences, these two P-450 genes were assigned to a new gene family and designated P-450 105A1 and P-450 105B1, respectively. In addition, in light of the fact that the DNA sequences encoding for both P - 4 5 0 and ~ ~ ~P-450su2 show strong homologies in cross-hybridization and in dot plot comparison studies, Omer et al. (1990) proposed that suaC and subC genes might have originated from one another by a gene duplication event. Recent genetic studies (Harder et al., 1990) have shown that both P - 4 5 0 ~and ~ ~P-450suz possess similar substrate specificities and are induced by sulfonylurea as well as phenobarbital. Deletion mutants of S . griseolus, which lack the structural genes for P - 4 5 0 ~ and ~ 1 its ferredoxin Fd-1 (suaC and suaB, respectively), metabolize sulfonylurea compounds at a very slow rate compared to the wild-type strain. These mutants metabolize sulfonylureas through induction of P-45OSuz and its ferredoxin Fd-2. Aniline significantly enhances the induction of P450s~ when ~ added to cells in addition to sulfonylurea. This effect is less distinct with P-450su1.
MICROBIAL CYTOCHROME P-450
155
f. Streptomyces griseus. We have been studying the enzymatic systems of another Streptomyces species, i.e., S . griseus (ATCC 13273), which is involved in the oxidation of a diverse array of xenobiotics. It should be noted that the P-450 system of S. griseus (P-45OsOy)is vastly different from the P-450 system of S. griseolus ( P - 4 5 0 and ~ ~ ~P - 4 5 0 ~ ~ ~ ) discussed above. For a summary of the various reactions catalyzed by S. griseus, readers are referred to a previous article (Sariaslani et al., 1989a). Our studies have shown that growth of S. griseus in a soybean flourenriched medium induces a multicomponent cytochrome P-450 enzyme system (P-45OsOy)that enables this organism to mediate diverse reactions (Sariaslani and Kunz, 1986). This soluble cytochrome P-450, which can also be induced with the isoflavonoid constituent of soybean flour, genistein, mimics its mammalian counterparts in its ability to oxidize a diverse array of structurally unrelated xenobiotics. The 47,500-Da P-45OsOythat has been purified to homogeneity (Trower et al., 1989a) differs from its other procaryotic counterparts in that it exists in high-spin state in the absence of its substrate. A limited number of substrate-free high-spin cytochromes P-450 have previously been identified from rat liver (Patten et al., 1986) and rabbit liver sources (Haugen and Coon, 1976).The spin state of P-45osOyis dependent upon the pH of its supporting buffer. Further research is required to unravel the exact mechanism of spin-state shift in P-45OsOy. Involvement of P-45OS0, in the oxidative reactions performed by S. griseus was confirmed when a special mutant of S. griseus (AMY mutant) was used. AMY mutants, which do not produce aerial mycelia, are sometimes spontaneously generated during the complex life cycle of Streptomyces. An AMY mutant of S. griseus that grew rapidly in soybean flour-enriched medium did not produce cytochrome P-450 during its various stages of growth. These cells could not perform the oxidative reactions commonly observed with the wild-type organism (Sariaslani et al., 1989b; Sariaslani and Stahl, 1990). Reconstitution experiments have indicated that P-450soyis a multicomponent enzyme system. Homogeneous preparations of P-45OsO,, in addition to NADPH, required the presence of spinach ferredoxin reductase and spinach ferredoxin for substrate turnover. In these reconstituted assays, P-45OsOyperformed a variety of reactions such as aromatic, benzylic, and alicyclic hydroxylations, 0-dealkylation, N-oxidation, nonaromatic double-bond epoxidation, and N-acetylation on a diverse array of xenobiotics (Trower et a]., 1989b). Selected examples of reactions catalyzed by P-45OsOyare listed in Table 111. We have recently observed that P-45OsOymimics mammalian P-450 systems (White et al., 1984) in producing multiple products during
F. SIMA SARIASLANI
156
TABLE 111 SELECTED EXAMPLES OF REACTIONSPERFORMED BY CYTOCHROME P-450,,, Streptornyces griseus Substrate Aromatic hydroxylation Benzene Chlorobenzene Toulene Naphthalene Biphenyl 17P-Estradiol Benzo[a]pyrene Aniline Alicyclic hydroxylation Cyclohexane Benzylic oxidation Toluene 0-Dealkylation 7-Ethoxycoumarin Nonaromatic double-bond epoxidation Precocene I1 N-Acetylation Aniline
OF
Product(s) Phenol [catechol and hydroquinone (with partially purified P-450,,,)] 2-Chlorophenol; 4-chlorophenol 2-Methylphenol 1-Naphthol 2-Hydroxybiphenyl; 4-hydroxybiphenyl 2-Hydroxyestradiol; 4-hydroxyestradiol plus an unidentified hydroxyestradiol 3-Hydroxybenzo[a]pyrene plus other unidentified hydroxylated benzo(a)pyrenes 2-Aminophenol; 4-aminophenol Cyclohexanol Benzaldehyde 7-Hydroxycournarin cis- and trans-precocene dihydrodiols Acetanilide
camphor oxidation (Sariaslani et al., 1990). The major reaction product identified was 6-endo-hydroxycamphor (60%). Other minor metabolites were identified as 3-endo-hydroxycamphor (2%), 5-endohydroxycamphor (7%), and 5-exo-hydroxycamphor (9%) (Table IV). As mentioned before (Section 111, A,l), high-resolution X-ray crystallographic studies and site-directed mutagenesis with P-45OCa, have indicated that the presence of tyrosine-96 is required for hydrogen bonding between the active site and the carbonyl moiety of camphor (Atkins and Sligar, 1988). Alignment of the P-45OsO,amino acid sequence with that of P-45OCa, indicated that tyrosine-96 is not conserved in P-450,,, (M. K. Trower and F. S. Sariaslani, unpublished observations). Because it is generally believed that procaryotic and eucaryotic P-450 enzymes possess similar tertiary structures, it can be assumed that absence of this residue in P-450,,, contributes to its lack of regio- and stereoselectivity in camphor oxidation. We have exploited the metabolic capabilities of S. griseus in xenobiotic metabolism for activation of promutagenic chemicals (Sariaslani
157
MICROBIAL CYTOCHROME P-450 TABLE IV
OF VARIOUS HYDROXYLATED CAMPHORS PRODUCED BY PROCARYOTIC AND SUMMARY EUCARYOTICSYSTEMS'
P450-origin
Hydroxylated camphors
Pseudomonas putida P-450,.,, wild type
Pseudomonas putida, mutant Y96F 4
5-eXO-
(92%)
OH
4
5
6-exoR+S (4%)
3-eXO(4%)
OK&
Rabbit liver, P-450~~2
4
OH
OH 5-eXO-
(14%)
3-endo(16%)
O
(0.1%)
+ other unidentified hydroxylated camphors (7%)
5-endo(63%)
OH
5-eXO(9%)
5
9-hydroxy
OH
3-endo-
5-endo-
(2%)
(7%)
6-endo(60%)
Adapted from Sariaslani et ol., 1990, with permission.
and Stahl, 1990). In these studies, S. griseus cells enriched in P-45OsO, replaced the rat liver microsome (S9)fraction in a modified Salmonella/ Ames plate incorporation assay. The S. griseus whole cells activated a variety of polycyclic aromatic hydrocarbons, aromatic amines, and small aliphatic molecules (Tables V and VI). The activated promutagens in turn reverted Salmonella typhimurium strains TA98 and TA1538. The P-45Os0,-enriched cells activated promutagens such as 3,3'-
TABLE V MUTAGENIC ACTIVITY IN Salmonella typhimurium STRAIN TA98"
Cell paste"
Supernatantb Chemicals
Und
1:2
1:lO
1 : 100
Und
1:2
1:lO
1: 100
42* 2.7* 4.7* 2.5* 2.6* 1.1 4.2* 0.4
2.5* 2.1* 1.0 1.9 2.3* 1.1 1.4 0.3
1.o 1.7 1.3 1.0 1.2 1.7 0.6
1.0 1.0 1.0 1.0 1.0 1.3 2.2* 1.1
35* 33* 18* 9.2* TNTC * 2.3* NT 0.3
26* 24* 11* 10* 16* 5.8* NT 1.7
11* 39* 8* 7.6*
2.4* 1.4* 1.1 4.8*
4.3* 1.5
4.4* 0.9
2.6* 1.5
0.8 1.2
14* 0.9
18* 1.4
20* 1.7
1.8 0.6
3.5* 0.8
1.6 1.o
1.5 1.0
Aromatic amines
I2
W cn
3,3'-Dimethylbenzidine 3,3'-Dimethoxybenzidine Benzidine 2- Aminoacetylfluorene 2- Aminoanthracene 2.4-Diaminotoluene
4-Aminobipheny l 4-Chloro-2-nitroaniline
1.o
NT
NT
2.2* NT 1.0
1.8 NT 0.7
Polycyclic aromatics Benzo[a]pyrene
7.12-Dimethylbenzanthracene Small aliphatics Chloropicrin N-Nitrosodimethy lamine
2.5* 1.8
1.9 3.8*
1.6 2.8*
6.8* 1.3 0.9 1.8
From Sariaslani and Stahl (1990),with permission. Results expressed as mutagenic ratios from at least two experiments. All results marked with asterisks reflect a greater than twofold increase in induced revertants compared to control; Und, undiluted test material, and 1: 2, 1 : 10, and 1: 100 are dilutions thereof. NT,Not tested; TNTC, too numerous to count. a
TABLE VI MUTAGENIC ACTIVITY IN Salmonella typhirnuriurn STRAIN TA1538" ~
~~
Supernatantb Chemicals
Cell pasteC
Und
1:2
1:lO
1: 100
Und
46* 2.7* 17* 5.4* 0.2 1.2 1.8 0.6
2.9* 3.8* 2.9* 2.6* 0.4 1.1 1.6 0.6
1.2 2.2* 1.8 1.8 0.6 NT 1.4 0.8
1.1
1.7 1.4 1.6 1.3 NT 0.8 1.3
28* 23* 86* TNTC* 22* 1.2
2.6* 1.3
3.3* 1.6
2.6* 1.0 1.1
1:2
1:lO
1; 100
23* 53* 16* 19* 12* NT
1.2 1.7 1.5 12* 1.2
NT
0.2
NT 1.3
1.4
NT 1.8
2.6* 1.8
18* 0.3
17* 0.7
19* 1.2
4.5* 0.8
1.0
0.9
1.9
Aromatic mimes 3,3'-Dimethylbenzidine 3,3'-Dimethoxybenzidine Benzidine 2-Aminoacetylfluorene 2-Aminoanthracene 2,4-Diaminotoluene 4-Aminobiphenyl 4-Chloro-2-nitroaniline
NT
40* 28* 30* 18* 53*
NT
NT
Polycyclic aromatics Benzo[alpyrene
7,12-Dimethylbenzanthracene Small aliphatics N-nitrosodimethy lamine ~~~~~~
1.0
1.1 ~
2.4*
1.0
~
From Sariaslani and Stahl (1990),with permission. Results expressed as mutagenic ratios from at least two experiments. All results marked with asterisks reflect a greater than twofold increase in induced revertants compared to control, Und, undiluted test material, and 1:2, 1 :10,and 1 :100 are dilutions thereof. NT, Not tested; TNTC, too numerous to count.
160
F. SIMA SARIASLANI
dimethylbenzidine, 3,3’-dimethoxybenzidine,2-acetylaminofluorene, benzidine, 2-aminoanthracene, 2,4-diaminotoluene, 4-aminobiphenyl, benzo[a]pyrene, chloropicrin, and N-nitrosodimethylamine. Of the promutagens tested, 7,12-dimethylbenzanthracene and 4-chloro-2nitroaniline were not activated by S. griseus cells. In parallel tests, rat liver microsomes failed to activate N-nitrosodimethylamine. Results obtained in this study underline the catalytic similarity that exists between rat liver cytochromes P-450 and S. griseus P-450,,,. In a recent study we have shown that genetically engineered strains of S. griseus containing an inactivated genetic marker can both activate promutagenic chemicals and also report their presence (Buchholz et al., 1991) (Table VII). Results obtained in these studies underline the potential of the S. griseus enzymatic system for use as an activator and reporter of promutagenic chemicals. As mentioned above, P-450,,, of S. griseus is a multicomponent system that requires the participation of a ferredoxin reductase and a ferredoxin for transfer of reducing equivalents for NAD(P)Hto the terminal P-450 component. We have identified a soybean flour-inducible 7Fe ferredoxin (S. griseus ferredoxin) in extracts of S. griseus; this ferredoxin can couple electron transfer between spinach ferredoxin reductase and P-450,,, in in vitro-reconstituted assays (Trower et al., 1990a). This protein contains a [3Fe-4S] and a [4Fe-4S] cluster and is the first 7Fe ferredoxin identified that appears to possess a catalytic function. The complete primary structure of S. griseus ferredoxin has been determined by Edman degradation of the whole protein and peptides obtained through enzymatic digestions (Trower et a]., 1990b).This protein contains 105 amino acids and has a calculated molecular weight, including seven irons and eight sulfurs, of 12,291. Analysis of the primary structure of S. griseus ferredoxin has indicated a high degree of homology (73%) to that of the 7Fe ferredoxin from Mycobacterium smegmatis. The binding domain for the Fe-S clusters lies in the N-terminus region and exhibits more than 50% homology with other reported 7Fe ferredoxins. This homology is particularly striking because the cysteine residues that are involved in binding the two Fe-S clusters are all conserved. We have recently identified a soybean flour-induced NADHferredoxin reductase in soluble extracts of S. griseus (Ramachandra and Sariaslani, 1990). This NADH-dependent ferredoxin reductase, which is now partially purified, has an absolute requirement for Mg2+ and can couple electron flow to P-450,,, through the intermediacy of S. griseus ferredoxin, adrenodoxin, and the ferredoxins from spinach and Clostridium pasteurianum.
161
MICROBIAL CYTOCHROME P-450 TABLE VII
SUMMARY OF MUTAGENIC RATIOSFOR Streptomyces griseus STRAINSH69 AND FS2 FOR CHEMICALS TESTED AT 200pg/ml CONCENTRATION^ Mutagenic ratio Chemical Acetonitrile 9-Aminoacridine 2-Aminoanthracene Ascorbic acid 1,2-Benzanthracene 2,3-Benzanthracene Benzene" Benzidine Benzo[a]pyrene Biphenyl Butylated hydroxytoluene Caffeine Catechol Chlorobenzene 2-Chloroethanol 1,3-Dichloropropane
9,10-Dimethyl-1,2-benzanthracene 1,4-Dioxane Ethidium bromide Glycine Hydroquinone Mannitol
N-Methyl-N'-nitro-N-nitrosguanidine Mutagen ICR-291 Naphthalene Nitrobenzene 2-Nitrofluorene p-Nitrophenol Phenol Phenolphthalein Potassium chloride cis-Stilbene trans-Stilbene Toulene Vanillin
Source
H69
FS2
Fisher Sigma Sigma Fisher Aldrich Aldrich Sigma Sigma Sigma Aldrich Sigma Calbiochem Sigma Aldrich Aldrich Kodak Sigma Aldrich Baker Fisher Sigma Sigma Sigma Polysciences Sigma Baker Aldrich Sigma Sigma Kodak EM Sciences Aldrich Aldrich Aldrich Sigma
7.84 2.56 2.19 0.27 3.30 0.72 1.89 9.84 6.23 0.62 0.20 1.10 0.98 1.84 1.48 1.19 8.46 0.97 Toxicb 1.10 0.35 0.99 2.50 1.83 1.55 1.61 4.16 0.84 0.44 1.34 0.36 0.09 1.45 0.56 1.22
0.025 1.40 4.07 0.16 4.83 0.52 10.10 9.40 3.3 0.67 0.15 1.09 0.23 0.51 5.23 2.76 1.88 5.55 Toxicb 2.25 0.16 0.59 2.24 3.00 1.42 3.49 1.51 0.60 0.16 0.93 0.07 0.16 1.38 0.87 1.52
Benzene was used at 100 pglml concentration. Cells from ethidium bromide stage I1 flasks failed to grow or generate spores.
162
F. SIMA SARIASLANI
To date, P-450,,, is the only reported procaryotic cytochrome P-450 that resembles its mammalian counterparts in its broad substrate specificity and also in its ability to activate promutagenic chemicals. Further biochemical and molecular studies for unraveling the exact mechanism of action of this interesting protein are currently being pursued in our laboratory and, through collaborative efforts, in other laboratories. B. EUCARYOTIC CYTOCHROMES P-450 Microbial eucaryotic P-450 enzymes generally fall within the Type I category with respect to the organization of their redox components (Fig. 1).The particulate and unstable nature of microbial eucaryotic cytochromes P-450 has rendered them difficult to isolate and purify. It is therefore not surprising that only a limited number of eucaryotic cytochromes P-450 have been purified to homogeneity and studied in detail. The most thoroughly studied microbial eucaryotic cytochromes P-450 are the enzymes from S. cerevisiae and Candida albicans. 1. Saccharomyces cerevisiae
Previous reports had indicated that, following semianaerobic growth of S. cerevisiae on glucose, a microsomal cytochrome P-450 ( P - 4 5 0 1 4 ~ ~ ) is induced in this fungus (King et al., 1982; King and Wiseman, 1987). The low-spin, 58,000-Da P-45014DM catalyzes the NADPH-dependent 14a-demethylation of lanosterol to 4,4-dimethyl-5a-cholesta-8,14,24trien-38-01 (Fig. 21), which is an essential reaction in the ergosterol biosynthesis pathway. The P-45014DM possesses broad substrate specificity and oxidizes a wide array of complex molecules, such as benzo[a]pyrene, R-naphthylamine, and cyclophosphamide. In addition to the P-45014DM obtained from semianaerobically grown S. cerevisiae, Aoyama et al. (1981) have reported the presence of an immunologically and catalytically similar P-450 in the microsomal fractions of aerobically grown yeast. Diniconazole is a potent fungicide and a strong inhibitor of the 14ademethylation reaction in fungi. Yoshida et al. (1986) have shown that the inhibitory effect of this fungicide is due to its interaction with P-45014DM. While both R(-) and S(+) isomers of diniconazole inhibit P-45014DMjthe R(-) isomer is a much more effective inhibitor than is the S( +) isomer. Spectral studies have revealed that although both isomers interact with P-45014DM through their azole moieties, their P-450 complexes respond differently to CO addition. The R( -)/P-45014DMcomplex reacts very slowly and its conversion to CO/P-45014DM is incomplete, whereas the s(+)/P-45014DMcomplex reacts readily. It therefore
163
MICROBIAL CYTOCHROME P-450
HO
p-
1
OH t3H
O 'H
t
J
HO
~ ~Saccharomyces cereFIG. 21. 14a-Demethylation of lanosterol by the P - 4 5 O I 4 of visiae. After Aoyama et al. (1989), with permission.
appears that the more effective herbicide produces a much tighter complex with P-45014DM. Recently, Aoyama et al. (1989) examined the interaction of lanosterol, 3-epilanosterol, 3-oxolanosta-8,24-diene, 3-methylenelanost-8-ene, and lanosterol acetate with P - 4 5 o l 4 (Fig. ~ ~ 22). Among the substrates examined, 14a-demethylation was observed with 3-epilanosterol and 3oxolanosterol but 3-methylene and 3-acetate derivatives could not serve as substrates for the enzyme. Based on these results, Aoyama et al. (1989) suggested that formation of a hydrogen bond between the 3hydroxyl group of the substrate and a specific amino acid in the active site of the enzyme might be a prerequisite for the catalytic activity. Immunologic studies with specific antibodies to P-45014DM have shown that this enzyme, which is essential for ergosterol biosynthesis in yeast, is constitutively expressed in various Saccharomyces strains (Kaergel et al., 1990.) The P-45014~M from different species of Saccharomyces are immunologically different but possess a few common antigenic sites. During cloning and sequencing of P-45014DM, Kalb et a ] . (1987) reported the identification of an open reading frame of 530 codons consisting of the structural gene and the flanking regions for lanosterol 14ademethylase of S. cerevisiae. This single-copy gene is essential for the yeast's aerobic growth. Examination of the deduced amino acid se-
164
1
F. SIMA SARIASLANI
2
3
4
5
FIG.22. Structures of various lanosterol derivatives examined with the P-45014D~ of Saccharomyces cerevisiae. 1, Lanosterol; 2, epilanosterol; 3, 3-oxolanosta-8,24-diene; 4, 3-methylenelanost-8-ene; 5, lanosterol acetate. From Aoyama et al. (1989),with permission.
quence of P-45014DM has revealed the presence near the N-terminus of a hydrophobic segment that may be a transmembrane domain. Comparison of this sequence with those of eight other eucaryotic cytochromes P-450 has indicated that P-45014DM is the first member of a new P-450 gene family that is designated P-45OL1 (Kalb et al., 1987). In addition, the data have indicated that P-45014DMexhibits more homology to its mammalian counterparts than to the procaryotic enzymes. The NADPH-cytochrome P-450 reductase of S. cerevisiae was purified to apparent homogeneity by Aoyama et al. (1978). This 83,000-Da component, which contains 1 mol of FAD and 1 mol of FMN, reduces P-45014DM and the cytochrome b, of S. cerevisiae. Addition of this NADPH-cytochrome P-450 reductase to reconstituted assays with rabbit liver P-450 enzymes facilitates N-demethylation of benzphetamine. Presence of a second P-450 in S. cerevisiae was reported by Yoshida et al. (1985).This P-450 ( P - 4 5 0 ~ ~was 1 ) obtained from a mutant strain of S. cerevisiae that could not perform the 14a-demethylation of lanosterol. Studies on the spectral properties of partially purified P - 4 5 0 ~ ~have 1 revealed that the absorption spectrum of the oxidized cytochrome is similar to that of a native low-spin P-450 bound to a strong nitrogenous ligand such as pyridine or 1-methylimidazole, It has therefore been proposed that the sixth coordination ligand of P - 4 5 0 might ~ ~ ~ contain a nitrogen, for example, from histidine, instead of a water molecule or an oxyamino acid as is seen with other P-450 enzymes (Yoshida et al., 1985).The P - 4 5 0 ~ enzyme ~1 is the only example of a P-450 containing a nitrogenous ligand as the sixth ligand to the heme (Fig. 23). Although P - 4 5 0 ~ ~is1immunologically indistinguishable from P-45014DM,it exhibits no catalytic activity toward lanosterol (Aoyama et al., 1987) and interacts differently with diniconazole, which is a specific inhibitor of P-45014~~.
MICROBIAL CYTOCHROME P-450
Heme environment of cytochromes P-450
165
Heme environment of P-450,,,
FIG.23. Comparison of the heme environment of P-450 enzymes with that of P-45OScl (Yoshida et al., 1985).
Functional differences between P-45014DM and P - 4 5 0 ~raise ~ ~ the question as to the similarities and/or differences in the primary structures of the two proteins. Because peptide maps of P - 4 5 0 1 4 ~and ~ P4 5 0 ~generated ~ ~ , by limited proteolysis, were very similar, cloning and sequencing of the genes for the enzymes was pursued as a means of identifying subtle differences between these two proteins. Following cloning and sequencing of both P-45014DM and P-450SG1, Ishida et a]. (1988) showed that only one amino acid, glycine-310, was substituted by aspartate in P-45OScl. This is a highly significant finding because it indicates that a single amino acid substitution can have drastic effects on an enzyme’s catalytic activity. Further studies by these investigators revealed that a single amino acid substition does not always lead to this enzyme’s inactivation. For example, analysis of the amino acid sequence of P-45014DMfrom another S. cerevisiae mutant (mutant DBY939), which performs the l4a-demethylation reaction, revealed that although in this protein asparagine-433 was substituted by lysine, the 14a-demethylase activity was not affected. 2. Candida
Presence of cytochromes P-450 involved in xenobiotic metabolism has been reported in three different species of Candida. a. Candida albicans. A 51,000-Da microsomal cytochrome P-450 purified from C. albicans performs the NADPH-dependent 14ademethylation of lanosterol in the presence of dilauroylphosphatidylcholine and oxygen (Hitchcock et al., 1989a,b).Similar to P - 4 5 O l 4 ~ ~ from S. cerevisiae and the rat liver enzyme, this P-450 performs the entire three-step reaction of lanosterol oxidation to yield 4,4dimethyl-5a-cholesta-8,14,24-trien-3-01. Because the catalytic activity of this enzyme, when lanosterol was used as substrate, was lower than those observed with Saccharomyces and rat liver enzymes, Hitchcock et al. (1989b) proposed that perhaps the true substrate for this enzyme is
166
F. SIMA SARIASLANI
24-methylene-24,25-dihydrolanosterol,rather than lanosterol. The specificity of P-45014DM from C. albicans differs from its S. cerevisiae counterpart in that the Candida enzyme possesses a very tight substrate specificity and cannot oxidize other structurally diverse substrates in reconstituted assays (Hitchcock et al., 1989b). Two allelic forms of the P-45014DM gene were isolated from C. albicans using a S. cerevisiae P-45014DM probe (Kirsch et al., 1988). Expression of these genes in either S. cerevisiae or C. albicans resulted in an increase in the P-45014DM concentration, followed by resistance to the inhibitors of the P-45014DM such as imidazole antifungal drugs. Lai and Kirsch (1989) determined the nucleotide sequence of C. albicans P-45014DM and found a very high degree of homology between the Saccharomyces and the Candida enzymes. Based on these results they concluded that the P-45014DM genes from S. cerevisiae and C. albicans are closely related. b. Candida tropicalis. A hydrocarbon-inducible cytochrome P-450 (P-450alk) has been identified in C. tropicalis (Lebeault et al., 1971; Gmunder et al., 1981).The P-450alk is induced by n-alkanes with at least 10 carbon atoms and by long-chain alkenes and alcohols. The P-450alk, which catalyzes the NADPH-dependent oxidation of fatty acids and hydrocarbons at their w-position (Table VIII), has been resolved into P - 4 5 0 , NADPH cytochrome c reductase, and thermostable lipid fractions. In reconstitution experiments the NADPH-cytochrome P-450
TABLE VIII SUBSTRATE SPECIFICITY OF CYTOCHROME P-450a1k
FROM
Candida tropicalis"
Compound tested
Specific activity (nmol product/min/mg protein)
Laurate Myristate Undecanoate Decanoate Palmitate Stearate Octanoate Hexanoate Hexadecane Decane Octane
3.1 2.8 2.3 2.2 1.2 0.9 0.8 0.5 0.8 0.2 0.2
Adapted from Lebeault et al. (1971),with permission.
MICROBIAL CYTOCHROME P-450
167
reductase and the lipid fractions could be replaced by the corresponding fractions from rat liver microsomes. The spin state of P-450alk is dependent on the ionic strength of the supporting buffer (Mansuy et al., 1980). Increase in the ionic strength of this buffer was accompanied by about 30% conversion of the low-spin enzyme to high spin. Conversely, when the ionic strength of the medium was decreased, the original high-spin enzyme was converted to low spin. Additionally, hydrophobic alcohols converted the high-spin P-45Oa1k to the low-spin enzyme. Binding of nitrogenous ligands, isocyanides, and phosphines to the ferric and ferrous enzyme induces spectral changes similar to those reported for other P-450 enzymes. Mansuy et al. (1980) have indicated that a high proportion of P-45Oa1k is in high-spin state in C. tropicalis microsomes. Because addition of the substrate, tetradecane, to P-45oalk was not associated with detectable spectral changes, Mansuy et al. (1980) speculated that a cofactor, which is lost during enzyme preparation, might be required for transport of tetradecane to the active site of the enzyme. The NADPH-cytochrome P-450alkreductase fraction was purified by various chromatography steps (Bertrand et al., 1980). The 76,000-Da pure enzyme contains 1 mol of FAD and 1 mol of FMN per mole of enzyme. Sanglard and Loper (1989) studied the gene coding for P-450alk and showed that expression of the P-450alk gene of C. tropicalis in S. cerevisiae endows the latter organism with the ability to o-oxidize lauric acid. The deduced amino acid sequence for P-45Oa1k showed very low homology when compared with nine known P-450 gene families. It was therefore concluded that this gene was the first member (Al) of a new gene family (L11) Reexamination of the genomic library of the P-45Oa1kgene has recently revealed the presence of other P-450 genes in this library (Sanglard and Fiechter, 1989). A second tetradecane-inducible P-450 gene identified in this library was designated P-45Oa1k2to distinguish it from the originally isolated P-450 (P-45Oa1kl).Because other P-450 genes are present in this library, Sanglard and Fiechter have concluded that the heterogeneity exhibited in this gene family resembles that usually seen in higher eucaryotes. c. Candida rnaltosa. The third P-450 identified in a Candida species is a membrane-bound n-alkane-hydroxylating enzyme from c. maltosa that hydroxylates long-chain n-alkanes to their corresponding fatty alcohols (Schunch et al., 1989). Candida maltosa resembles other eucaryotic systems in containing a P-450 and a NADPH-cytochrome c reductase component. Cloning of this enzyme has shown that it consists of 521 amino acids, two putative transmembrane segments in the N-
168
F. SIMA SARIASLANI
terminus, which presumably function to anchor the protein to the lipid bilayer, and a characteristic heme-binding sequence in the C-terminus region. This P-450 exhibits strong homology with the alkane-inducible P-450 gene from C. tropicalis. 3. Fusarium oxysporum
Presence of a very stable cytochrome P-450 enzyme system, composed of three P-450 isozymes, has been reported in F. oxysporum (Shoun et al., 1983). This soybean oil/soybean flour-inducible P-450 system, which catalyzes the NAD(P)H-dependent oxidation of fatty acids such as lauric acid at w - l , w - 2 , and w-3 positions, has been found in both soluble and particulate fractions of F. oxysporum. At least three cytochromes P-450, a NADPH-cytochrome c reductase, a NADHferricyanide reductase, and a cytochrome b5 have been identified in these cells (Shoun et al., 1989a). Concomitant induction of these components with cytochromes P-450 has led Shoun et al. to propose a role for them in the reactions performed by cytochrome P-450 of F. oxysporum. Growth of the organism in a medium containing glycerol, in addition to the soybean derivatives, resulted in the induction of high levels of the particulate enzyme that was associated with high-activity fatty acid hydroxylase. Shoun et al. (1985) proposed that the soluble cytochromes P-450 might be orginating from the particulate fractions during enzyme preparation. Recent studies in the same laboratory (Shoun et al., 1989b) have shown that a soluble P-450, of unspecified function, is induced in this fungus in the presence of nitrate or nitrite. This P-450 is sensitive to high aeration rates. When nitrate was replaced by ammonium chloride, only the particulate P-450 was induced. 4. Cunninghamella bainieri (echinulata)
Whole cells of C. bainieri possess broad substrate specificity and perform the aromatic hydroxylation and the N- and 0-demethylation of a variety of xenobiotic substrates. Ferris et al. (1973) have proposed that a P-450 enzyme system, similar to the enzymes found in liver microsomes, is responsible for these reactions. Whole cells of C. bainieri hydroxylate naphthalene, aniline, anisole; N-demethylate aminopyrine; 0-demethylate 4-nitroanisole; and perform reduction of nitro and azo groups. Preliminary experiments revealed hydroxylation of benzo[a]pyrene by particulate fractions of C. bainieri. The nature of the inducer for this P-450 is obscure; however, it is noteworthy that the medium used for this organism’s growth contains soybean. The possibility therefore exists that, similar to S. griseus cytochrome P-450,,, (see
MICROBIAL CYTOCHROME P-450
169
Section III,A,7,f), one of the ingredients in soybean might act as the inducer of P-450 in C. bainieri. Further investigations by Ferris et al. (1976) confirmed that the aryl hydroxylase activity of C. bainieri is due to the presence of a P-450 enzyme system in this organism. This P-450 system, which appears to be composed of P-450 and NADPHcytochrome c reductase components, has a strict requirement for NADPH [Ferris eta)., 1984). Independent studies by Gibson et al. (1984a) have shown the presence of a particulate P-450 enzyme system in C. bainieri that Ndemethylates codeine. Various substrates such as codeine, norcodeine, diazepam, and tetradecane acted as the enzyme’s inducer. The Ndemethylation of codeine in crude extracts required the presence of NADH, NADPH, and Fez+. The stability of the P-450 was increased when it was stored at 4°C in a nitrogen atmosphere, allowing kinetic studies to be performed [Gibson et al., 1984a). Formation of the chemically labile carbinolamine intermediate and therefore involvement of a C-oxidation mechanism during P-450-mediated codeine oxidation was suggested through 13C NMR studies [Gibson et al., 1984b) [Fig. 24). 5. Aspergillus ochraceus
An inducible P-450 system was identified in A. ochraceus [Ghosh and Samanta, 1981). This enzyme catalyzes the NADPH-dependent hydroxylation of progesterone at the C,, position (Fig. 25). Because in vitro
CHa
Norcodeine
N- Hydroxymethyl codeine
FIG.24. Oxidation of codeine by the P-450enzyme of Cunninghamella bainieri (Gibson et al., 1984bj.
F. SIMA SARIASLANI
170 COCHpR
COCHpR
0
Progesterone (R=H) Substance S (R=OH)
1la-Hydroxyprogesterone (R=H) 11-epi-Hydrocortisone (R=OH)
FIG.25. Hydroxylation of progesterone by the Aspergillus ochraceus P-450system (Ghosh and Samanta, 1981).
hydroxylation of progesterone was detected only when both postmitochondrial supernatant and microsomal fractions were combined, Ghosh and Samanta (1981) proposed a multicomponent nature for this P-450 system. Further research is required to elucidate the exact nature of this enzymatic system. 6. Nectria haematococca Some fungi are relatively tolerant to the phytoalexin toxins produced by many plant tissues. Van Etten's group (Matthews and Van Etten, 1983; Desjardins et a]., 1984; Desjardins and Van Etten, 1986) have shown that resistance of the plant pathogen fungus, N. haematococca, to this toxin is due to the presence of a cytochrome P-450 system in this organism. This microsomal P-450 system, which has been resolved into P-450 and NADPH-cytochrome P-450 reductase fractions, performs the demethylation of the pea's major phytoalexin, pisatin (Fig. 26). The relatively high rate of pisatin detoxification by microsomal preparations of N. haematococca, 20 nmol/min/mg protein, is indicative of the role that this enzyme might have in the virulence of this fungus in pea. Although the unstable nature of the P-450 component prohibited its purification to homogeneity, the 84,000-Da NADPH reductase com-
Pisatin
3,6a-di hydroxy-8,9met hylenedioxypterocarpan
FIG.26. Demethylation of pisatin by the P-450 enzyme of Nectria haernatococca (Desjardins and Van Etten, 1986).
MICROBIAL CYTOCHROME P-450
171
ponent has been completely purified. The catalytic activity in reconstituted assays was restored when the NADPH reductase of N. haematococca was added to the extracts. Addition of the NADPH reductase from rat liver microsomes to these assays was far less effective in restoring the activity (Desjardins and Van etten, 1986). Although the enzyme was NADPH dependent, addition of NADH to reconstituted assays containing NADPH stimulated the substrate turnover. 7. Trichosporon cutaneum
Presence of cytochrome P-450, NADPH-cytochrome c-reductase, and cytochrome b5 fractions was reported in T. cutaneum cells grown under conditions of oxygen limitation (Laurila et al., 1984). This microsomal P-450 performs the demethylation of aminopyrine at a rate of 0.9nmol/ nmol P-450/min. The physiological role of this P-450 system was proposed to be related to changes in lipid composition of the cells as a consequence of ethanol formation. 8. Claviceps purpurea Ambike et al. (1970) have reported on the presence of microsomal cytochrome P-450 and cytochrome b5 in C. purpurea; these cytochromes have been implicated in alkaloid biosynthesis. Further research is required to identify various components and the catalytic role of this P-450 enzyme. 9. Cyanidum caldarium
The unicellular red alga, C. caldarium, possesses an oxygenase enzyme system that is involved in the biosynthesis of phycobilin from heme (Fig. 27) (Cornejoand Beale, 1988).This oxygenase system can be classified as a P-450 system because of the nature of its components and its catalytic activity. Although this unique oxygenase is obtained from an algal source, it exhibits the attributes of procaryotic P-450 systems. This enzymatic system, which is soluble in nature, has been resolved into three fractions (fractions 1-111). In vitro activity in reconstituted assays requires the presence of all three fractions, molecular oxygen, substrate, NADPH, and a second reductant. The 22,000-Da fraction I, which appears to be a ferredoxin-like component, can be replaced by commercially available ferredoxins such as that from Porphyra umbilicalis and, to a lesser extent, by spinach ferredoxin. The 38,000-Da fraction 11, the monooxygenase component, is the heme-binding component. The difference between this monooxygenase and the other reported P-450 systems is that in the C. caldarium enzyme system, heme is
F. SIMA SARIASLANI
172
CH \
CH3
Biliverdin IXa CHZ
CH2
CH2
CH2
COOH
COOH
I
I
I
I
y
3
Protoheme H3C
Phycocyanin FIG.27. Oxidation of protoheme by the oxygenase of Cyanidium caldarium (Cornejo and Beale, 1988).
the substrate and not the cofactor for the P-450. The presence in this fraction of a reduced CO-adduct absorption spectrum, similar to other reported P-450 enzymes, has not been shown yet. The 37,000-Da fraction I11 is a ferredoxin-linked cytochrome c reductase. Replacement of fraction I11 with spinach ferredoxin-NADP+ oxidoreductase in reconstituted assays resulted in very low catalytic activity. Fraction I11 has not been obtained in homogeneous form and it is therefore not clear whether it is a flavoprotein. Compounds such as ascorbate, isocorbate, phenylenediamine, and hydroquinone serve as the secondary reductant in this reaction. Cornejo and Beale (1988)have suggested that the second reductant might possess a nonenzymatic function such as trapping hydroxyl radicals generated by other reaction components. 10. Lodderomyces elongisporus
An alkane-inducible P-450 system was reported in this yeast (Riege et al., 1981).The low-spin P-450 of L. elongisporus is particulate and its reduced CO adduct exhibits an absorption maximum at 447nm. The NADPH-cytochrome P-450 reductase of this system has been purified to homogeneity and has been shown to have a molecular weight of 79,000, with one FAD and one FMN. Hydroxylation of n-hexadecane by
MICROBIAL CYTOCHROME P-450
173
the reconstituted system was enhanced when nonionic detergents such as Prawozell WON-100 were added to the mixture, suggesting a possible role for lipids in this P-450-dependent alkane oxidation (Honeck et a]., 1982).
IV. Conclusion
Microbial communities play a significant role in the degradation of novel man-made chemicals that are constantly released into our environment. Discovery of several new procaryotic and eucaryotic cytochromes P-450 in recent years has underlined their ubiquitous distribution in microbial systems. The fact that these enzymes are involved in the degradation of various natural and synthetic chemicals is indicative of their significance in such reactions. As chemical industries continue the production and release of various chemicals into our environment, the next decade or so will undoubtedly witness the discovery of other microbial cytochromes P-450 involved in xenobiotic degradation. Development of new procedures for purification of unstable and membrane-bound (particulate) enzymes has allowed characterization of a number of new microbial P-450 enzymes in recent years. To date, our information about most of these enzymes is very scant; however, with new powerful spectroscopic and molecular techniques at our disposal, unraveling the mechanism of action of at least some of these enzymes in the near future in inevitable. During the past decade we have witnessed an explosion of activites in harnessing the enzymatic potential of microorganisms as biocatalysts for various organic syntheses. The information outlined in the preceding pages reveals the diversity of the catalytic activities of microbial cytochromes P-450. Some of these enzymes possess very tight substrate specificities and others are capable of oxidizing a wider range of structurally diverse substrates. The inherent regio- and stereospecificities exhibited by most cytochromes P-450 are indicative of their potential for application in biocatalytic processes. Techniques such as molecular modeling and site-directed mutagenesis, which will allow production of “designer” cytochromes P-450 with desired selectivity and efficiency, could be instrumental in establishing these enzymes as industrial biocatalysts. Another potential application for cytochromes P-450 is employment of some of the microbial enzymes, which can mimic mammalian cytochromes P-450, such as the procaryotic P-450,,, from S . griseus and the eucaryotic P-45014DMfrom S. cerevisiae, in the development of convenient test systems for the detection of mutagenic chemicals. The advan-
174
F. SIMA SARIASLANI
tages of employing such test systems include, but are not limited to, the ease of preparative scale production of the microbial cytochromes P-450, the reduced dependence on animals for such studies, and the relative low cost of these preparations compared to those from mammalian sources. ACKNOWLEDGMENT
I thank R. G. Stahl, Jr., Muralidahra Rarnachandra, and Michael Trower for critically reading the manuscript and Donna King and Law6 Kurych for assistance in typing. REFERENCES Ambike, S. H., Baxter, R. M., and Zahid, N. D. (1970).Phytochemistry 9,1953-1958. Aoyama, Y., Yoshida, Y., Kubota, S., Kurnaoka, H., and Furumichi, A. (1978).Arch. Biochem. Biophys. 185,362-369. Aoyama, Y., Okikawa, T., and Yoshida, Y. (1981).Biochim. Biophys. Acta 665,596-601. Aoyarna, Y., Yoshida, Y., Nishino, T., Katsuki, H., Maitra, U. S., Mohan, V. P., and Sprinson, D. B. (1987).J. Biol. Chem. 262,14260-14264. Aoyama, Y., Yoshida, Y., Sonoda, Y., and Sato, Y. (1989).Biochirn. Biophys. Acta 1006, 209-213.
Appleby, C. A., and Daniel, R. M. (1965).In “Oxidases and Related Redox Systems” (T. E. King, H. S. Mason, and M. Morrison, eds.), pp. 515-528. Univ. Park Press, Baltimore, Maryland. Asperger, O., Naumann, A,, and Kleber, H.-P. (1981).FEMS Microbiol. Lett. 11,309-312. Asperger, O.,Muller, R., and Kleber, H.-P. (1985a).Dev. Biochem. 27,447-450. Asperger, O.,Stuwer, B., and Kleber, H.-P. (1985b).Appl. Microbiol. Biotechnol. 21, 309-312.
Atkins, W. M., and Sligar, S. G. (1988).J. Biol. Chem. 263, 18842-18849. Atkins, W. A., and Sligar, S. G. (1989).J. Am. Chem. SOC.111,2715-2717. Berg, A.,and Rafter, J. J. (1981).Biochem. J. 196, 781-786. Berg, A., Carlstrom, K., Gustafsson, J. A., and Ingelrnan-Sundberg, M. (1975).Biochem. Biophys. Aes. Commun. 66,1414-1423. Berg, A., Gustafsson, J. A., Ingelman-Sundberg, M., and Carlstrom, K. (1976).J. Biol. Chem. 251,2831-2838.
Berg, A., Ingelrnan-Sundberg, M., and Gustafsson, J. A. (1979).Acta Biol. Med. Ger. 38, 333-344.
Bertrand, J. C., Gilewics, M., Bazin, H., and Azoulay, E. (1980).Biochem. Biophys. Res. Commun. 94,889-893. Black, S. D., and Coon, M. J. (1987).Adv. Enzymol. 60,35-87. Bocker, R., and Guengerich, F. P. (1986).J. Med. Chem. 29, 1596-1603. Boddupalli, S. S., Estabrook, R. W., and Peterson, J. A.(1990).J. Biol. Chem. 265,42334239.
Buchholz, S. E., Orner, C. A., Viitanen, P. P., Sariaslani, F. S., and Stahl, R. G., Jr. (1991). Submitted for publication. Castro, C. E.,Wade, R. S., and Belser, N. 0. (1983).J. Agric. Food Chem. 31, 1184-1187. Castro, C. E., Wade, R. S., and Belser, N. 0. (1985).Biochemistry 24,204-210. Castro, C. E., Yokoyama, W. H., and Belser, N. 0. (1988).J. Agric. Food Chern. 36,915-919. Coon, M. J., and Vaz, A. D. N. (1988).Prog. Clin. Biol. Res. 274,497-507.
MICROBIAL CYTOCHROME P-450
175
Cornejo, J. and Beale, S.I. (1988).J. Biol Chem. 263, 11915-11921. Dadas, A., Gal, D., Barrelle, M., Sauret-Ignazi, G., Sterjiades, R., and Pelmont, J. (1985). Arch. Biochem. Biophys. 236,585-592. Daly, J. W., Jerina, D. M., and Witkop, B. (1972).Experientia 28,1129-1149. Dawson, J. H., and Smith Eble, K. (1986).Adv. Inorg. Bioinorg. Mech. 4,1-64. Desjardins, A. E., and Van Etten, H. D. (1986).Arch. Microbiol 144,84-90. Desjardins, A. E., Matthews, D. E., and Van Etten, H. D. (1984).Plant Physiol. 75,611-616. Dus, K., Goewert, R., Weaver, C. C., Carey, D., and Appleby, C. A. (1976).Biochem. Biophys. Res. Commun. 69,437-445. Ferris, J. P., Fasco, M. J., Stylianopoulou, F. L., Jerina, D. M., and Jeffrey, A. M. (1973). Arch. Biochem. Biophys. 156,97-103. Ferris, J. P., MacDonald, L. H., Patrie, M. A., and Martin, M. A. (1976).Arch. Biochem. Biophys. 175,443-452. Ferris, J. P., Aleksejczyk, R. A., and Martin, M. A. (1984).Biochemistry 23,3370-3371. Frederick, C. B., Mays, J. B., Ziegler, D. M., Guengerich, F. P., and Kadlubar, F. F. (1982). Cancer Res. 42,2671-2677. Ghosh, D., and Samanta, T. B. (1981).J. Steroid Biochem. 14,1063-1067. Gibson, M., Soper, C. J., and Parfitt, R. T. (1984a).Anal. Chim. Acta 163, 175-183. Gibson, M., Soper, C. J., Parfitt, R. T., and Sewell, G. J. (1984b).EnzymeMicrob. Technol. 6, 471-475.
Gmunder, F. K., Kappeli, O., and Fiechter, A. (1981).Eur. J. Appl. Biotechnol. 12, 135142.
Groves, J. T. (1985).J. Chem. Educ. 62,928-931. Groves, J. T.,and Subramanian, D. V. (1984).J. Am. Chem. SOC.106,2177-2181. Guengerich, F. P. (1984).Annu. Rev. Nutr. 4,207-232. Guengerich, F. P. (1987).Prog. Drug Metab. 10, 1-54. Guengerich, F. P.(1990).CRC Crit. Rev. Mol. Biol. 25,97-153. Guengerich, F. P., and Macdonald, T. L. (1984).Acc. Chem. Res. 17,9-16. Harder, P. A., O’Keefe,D. P., Romesser, J. A,, Leto, K. J,, and Omer, C. A. (1991).Mol. Gen. Genet. (in press). Haugen, D. A., and Coon, M. J, (1976).J. Biol. Chem. 251,7929-7939. He, J.-S., Ruettinger, R. T., Liu, H.-M., and Fulco, A. J. (1989).Biochim. Biophys. Acta 1009,301-303.
Hedegaard, J., and Gunsalus, I. C. (1965).J. Biol. Chem. 240,4038-4043. Hitchcock, C. A., Brown, S. B., Evans, E. G. V., and Adams, D. J. (1989a).Biochem. J. 260, 549-556.
Hitchcock, C. A., Dickinson, K., Brown, S. B., Evans, E. G. V., and Adams, D. J. (1989b). Biochem. J. 263,573-579. Hoa, G. H., Primo, C. D., Donadaine, I., Sligar, S. G., Gunsalus, I. C., and Douzou, P. (1989). Biochemistry 28,651-656. Honeck, H., Schunch, W.-H., Riege, P., and Muller, H.-G. (1982).Biochem. Biophys. Res. Commun. 106,1318-1324. Horii, M., Ishizaki, T., Paik, S., Manome, T., and Murooka, Y. (1990).J. Bacteriol. 172, 3644-3653.
Imai, M., Shimada, H., Watanabe, Y., Matsushima-Hibiya, Y . , Makino, R., Koga, H., Horiuchi, T., and Ishimura, Y.(1989).Proc. Natl. Acad. Sci. U S A . 86, 7823-7827. Ishida, N., Aoyama, Y., Hatanaka, R., Oyama, Y., Imajo, S., Ishiguro, M., Oshima, T., Nakazato, H., Noguchi, T., Maitra, U. S., Mohan, V. P., Sprinson, D. B., and Yoshida, Y.(1988).Biochem. Biophys. Res. Commun. 155,317-323. Kaergel, E., Aoyama, Y., Schunck, W.-H., Mueller, H.-G., and Yoshida, Y. (1990).Yeast 6, 61-67.
176
F. SIMA SARIASLANI
Kalb, V. F., Woods, C. E., Turi, T. G., Dey, C. R., Sutter, T. R., and Loper, J. C. (1987).DNA 6, 529-530.
Kim, B. H., and Fulco, A. J. (1983).Biochem, Biophys. Res. Commun. 116,843-850. King, D. J., and Wiseman, A. (1987).In “Enzyme Induction, Mutagen Activation and Carcinogen Testing in Yeast” (A. Wiseman, ed.), pp. 115-167. Harwood, New York. King, D. J., Azari, M. R., and Wiseman, A. (1982).Biochem. Biophys. Res. Commun. 105, 1115-1121.
Kirsch, D. R., Lai, M. H., and O’Sullivan, J. (1988).Gene 68,229-237. Kleber, H.-P., Muller, R., and Asperger, 0. (1985).FEMS Symp. 23,89-95. Koga, H., Rauchfuss, B., and Gunsalus, I. C. (1985).Biochem. Biophys. Res. Commun. 130, 412-417.
Koga, H., Aremaki, H., Yamaguchi, E., Takeuchi, K., Horiuchi, T., and Gunsalus, I. C. (1986).J. Bacteriol. 166,1089-1095. Koga, H., Yamaguchi, E., Matsunaga, K., Aramaki, H., and Horiuchi, T. (1989).J. Biochem. (Tokyo) 106,831-836. Lai, M. H., and Kirsch, D. R. (1989).Nucleic Acid Res. 17,804. Laurila, H., Kappeli, O., and Fiechter, A. (1984).Arch. Microbiol. 140, 257-259. Lebeault, J., Lode, E. T., and Coon, M. J. (1971).Biochem. Biophys. Res. Commun. 42, 413-419.
Mansuy, D., Carlier, M., Bertrand, J., and Azoulay, E. (1980).Eur. J. Biochem. 109, 103108.
Matson, R. S., and Fulco, A. J. (1981).Biochem. Biophys. Res. Commun. 103,531-535. Matsuoka, T., Miyakoshi, S.,Tanszawa, K., Nakahara, K., Hosobuchi, M., and Serizawa, N. (1989).Eur. J. Biochem. 184,703-713. Matthews, D. E., and Van Etten, H. D. (1983).Arch. Biochem. Biophys. 224,494-505. Miller, R. E., and Guengerich, F. P. (1982).Biochemistry 21,1090-1097. Muira, Y., and Fulco, A. J. (1975).Biochim. Biophys. Acta 388,305-317. Muller, R., Asperger, O., and Kleber, H.-P. (1989).Biomed. Biochim. Acta 48,243-254. Nahri, L. O.,and Fulco, A. J. (1987).J. Biol. Chem. 262,6683-6690. Neal, R. A., and Alpert, J. (1982).Annu. Rev. Pharmacol. Toxicol. 22,321-339. Okamoto, T., Sasaki, K., and Tachibana, M. (1989).Bull. Inst. Chem. Res., Kyoto Univ. 67, 169-195.
O’Keefe,D. P., Romesser, J. A., and Leto, K. J. (1988).Arch. Microbiol. 149,406-412. O’Keefe,D. P., Gibson, K. J., Emptage, M. H., Lenstra. R., Romesser, J. A., Litle, P. J., and Omer, C. A. (1991).Biochemistry 30,447-455. Omer, C. A., Lenstra, R., Litle, P. J., Dean, C., Tepperman, J. M., Leto, K. J., Romesser, J. A,, and O’Keefe,D. P. (1990).J. Bacteriol. 172,3335-3345. Ortiz de Montellano, P. R. (1989).Trends Pharmacol. Sci. 10,354-359. Ortiz de Montellano, P. R., and Correis, M. A. (1984).Annu. Rev. Pharmacol. 23,481-503. Patten, J. C., Ning, S. M., Lu, A. Y. H., and Yang, C.S.(1986).Arch. Biochem. Biophys. 251, 629-638.
Peterson, J. A., Lorence, M. C., and Amarneh, B. (1990).J. Biol. Chem. 265,6066-6073. Pohl, L. R., Schulick, R. D., Highet, R. J., and Georger, J. W. (1984).Mol. Pharmacol. 25, 318-321.
Poulos, T. L. (1986).In “Cytochrome P-450,Structure, Mechanism and Biochemistry” (P. R. Ortiz de Montellano, ed.), pp. 505-523. Plenum, New York. Poulous, T. L. (1988).Adv. Inorg. Biochem. 7, 1-36. Poulos, T. L., Finzel, B. C., and Howard, A. J. (1987).J. Mol. Biol. 195, 687-700. Raag, R.,and Poulos, T. L. (1989).Biochemistry 28,7586-7592.
MICROBIAL CYTOCHROME P-450
177
Ramachandra, M., and Sariaslani, F. S. (1990).Abstr. Annu. Meet. Am. SOC. Microbiol. p. 272.
Riege, p., Schunck, W.-H., Honeck, H., and Mueller, H.-G. (1981).Biochem. Biophys. Res. Commun. 98,527-534. Romesser, J. A., and O’Keefe, D. P. (1986).Biochem. Biophys. Res. Commun. 140,650659.
Ruettinger, R. T., Wen, L. P., and Fulco, A.J. (1989).J. Biol. Chem. 264, 10987-10995. Sanglard, D., and Fiechter, A. (1989).FEBS Lett. 256,128-134. Sanglard, D., and Loper, J. C. (1989).Gene 76, 121-136. Sariaslani, F. S.,and Kunz, D. A. (1986).Biochem. Biophys. Res. Commun. 141,405-410. Sariaslani, F. S.,and Stahl, R. J., Jr. (1990).Biochem. Biophys. Res. Commun. 166, 743-749.
Sariaslani, F. S . , Trower, M. K., and Buchholz, S. E. (1989a).Dev. Ind. Microbiol. 30, 161-171.
Sariaslani, F. S., Trower, M. K., and Kunz, D. A. (1989b).Biocatalysis 2,151-160. Sariaslani, F. S.,McGee, L. R., Trower, M. K., and Kitson, F. G. (1990).Biochem. Biophys. Res. Commun. 170,456-461. Schunck, W. H., Kargel, E., Gross, B., Wiedmann, B., Maeursberger, S . , Kope, K., Kiebling, U., Strauss, M., Gaestel, M., and Mueller, H.-G. (1989).Biochem. Biophys. Res. Commun. 161,843-850. Schwalb, H., Narhi, L. O., and Fulco, A. J. (1985).Biochim. Biophys. Acta 838,302-311. Shafiee, A., and Hutchinson, C. R. (1987).Biochemistry 26,6204-6210. Shafiee, A., and Hutchinson, C. R. (1988).J. Bacteriol. 170,1548-1553. Shoun, H., Sudo, Y., Seto, Y., and Beppu, T. (1983).J. Biochem. (Tokyo) 94,1219-1229. Shoun, H., Sudo, Y., and Beppu, T.(1985).J. Biochem. (Tokyo) 97,755-763. Shoun, H., Sudo, Y., Sato, K., and Beppu, T. (1989a).Agric. Biol. Chem. 53,2153-2161. Shoun, H., Suyama, W., and Yasui, T. (1989b).FEBS Lett. 244,ll-14. Sligar, S.G., and Murray, R. I. (1986).In “Cytochrome P-450,Structure, Mechanism and Biochemistry” (P. R. Ortiz de Montellano, ed.), pp. 429-504. Plenum, New York. Smith Eble, K., and Dawson, J. H. (1984).Biochemistry 23,2068-2073. Sutherland, J. B. (1987).Appl. Environ. Microbiol. 52,98-100. Tabushi, I. (1988).Coord. Chem. Rev. 86,l-42. Trower, M. K., Buckland, R. M., Higgins, R., and Griffin, M. (1985). Appl. Environ. Microbiol. 49, 1282-1289. Trower, M. K., Sariaslani, F. S., and Kitson, F. G. (1989a).Biochem. Biophys. Res. Commun. 157,1417-1422. Trower, M. K., Sariaslani, F. S . , and O’Keefe, D. P. (1989b).J. Bacteriol. 171, 1781-1787. Trower, M. K., Emptage, M. H., and Sariaslani, F. S.(1990a).Biochim. Biophys. Acta 1037, 281-289.
Trower, M. K., Marshall, J. E., Doleman, M. S . , Emptage, M. H., and Sariaslani, F. S. (1990b).Biochim. Biophys. Acta 1037,290-296. Ullah, A. H., Murray, R. I., Bhattacharyya, P. K., Wagner, G. C., and Gunsalus, I. C. (1990). J. Biol. Chem. 265,1345-1351. Unger, B. P.,Gunsalus, I. C., and Sligar, S. G. (1986a).J. Biol. Chem. 261, 1158-1163. Unger, B. P.,Sligar, S. G., and Gunnsalus, I. C. (1986b).Bacteria 10,557-589. Warburton, E. J., Magor, A.M., Trower, M. K., and Griffin, M. (1990).FEMS Microbiol. Lett. 66. 5-10.
Wen, L. P., and Fulco, A. J. (1987).J. Biol. Chem. 262,6676-6682. Wen, L. P.,Ruettinger, R. T., and Fulco, R. J. (1989).J. Biol. Chem. 264, 10996-11003.
178
F. SIMA SARIASLANI
White, R. E., McCarthy, M. K., Egeberg, D., and Sligar, S. G. (1984).Arch. Biochem. Biophys. 228,493-502. Yoshida, Y., Aoyama, Y., Nishino, T., Katsuki, H., Maitra, U. S . , Mohan, V. P., and Sprinson, D. B. (1985).Biochern. Biophys. Res. Cornrnun. 127,623-628. Yoshida, Y., Aoyama, Y., Takano, H., and Kato, T. (1986).Biochern. Biophys. Res. Comrnun. 137,513-519.
Foodborne Yeasts T. DEAK Department of Microbiology University of Horticulture and Food Industry Budapest, H-1118, Hungary I. Introduction 11. Characteristics and Classification of Yeasts 111. Ecology of Yeasts
A. Sources and Vectors of Contamination B. Intrinsic Properties of Foods C. Extrinsic Parameters D. Implicit Parameters E. Processing and Preservation IV. Specific Habitats A. Fruits and Vegetables B. Fruit Juices and Soft Drinks C. Alcoholic Beverages D. High-Sugar Products E. Cereals and Bakery Products F. Meat, Poultry, and Fish G. Dairy Products H. Fermented, Salted, and Acid-Preserved Foods V. Methods of Isolation and Enumeration A. Sample Preparation B. Methods of Enumeration C. Media D. Selective Procedures E. Novel Techniques VI. Methods of Identification A. New and Improved Identification Methods B. The Simplified Identification Method C. Description of Main Groups of Foodborne Yeasts References
I. Introduction
Yeasts are undoubtedly the most important microorganisms exploited by mankind. Their traditional application stems from the end products of alcoholic fermentation, i.e., ethanol and carbon dioxide, which are exploited on a large scale in industrial processes for producing bread, wine, beer, other alcoholic beverages, and ethanol itself (Rose, 1977). In addition to these items, a variety of other metabolic products of yeasts have been used commercially (e.g., enzymes, vitamins, lipids, and carotenoids), and the whole cell mass is also produced in large quantities for baker’s yeast and fodder yeast (Rose, 1979; Dziezak, 1987). 179 ADVANCES IN APPLIED MICROBIOLOGY, VOLUME 36 Copyright 8 1991 by Academic Press, Inc. All rights of reproduction in any form reserved.
180
T. DEAK
With the advent of modern biotechnology, newer methods for the exploitation of yeasts have been developed, such as utilization of waste products and natural substrates (hydrocarbons and methanol) for the production of yeast cell mass (Phaff, 1986; Berry et a]., 1987). By the methods of genetic manipulation (recombinant DNA techniques and protoplast fusion), yeast metabolism can be altered to produce foreign proteins (Spencer et al., 1983). By the same techniques, industrialproduction strains used in traditional processes can be improved (Panchal et al., 1984; Snow, 1985; Alexander, 1986). Compared to their great economic contribution, the disadvantages yeasts present to humans are of secondary importance. Only few species can be considered as human pathogens, and none of them is known to cause food intoxication (Hurley et a]., 1987). Undoubtedly, fresh and processed foods and other industrial raw materials and products are liable to yeast spoilage. Yeasts normally play a small role in spoilage; however, conditions favorable to their growth can be a major factor in deterioration and may cause great economic loss. This can be the case, for example, with acidic or high-sugar-content foods in which bacterial competition is restricted. Yeast activity often results in dramatic events as a consequence of alcoholic fermentation, yielding excessive amounts of carbon dioxide. Subtle changes can be equally undesirable. In order to avoid these problems and to control yeast spoilage, both the properties of the yeast involved and the environmental factors influencing its activity must be studied (Peppler, 1977; Miller, 1979). The present article aims to update the state of knowledge on the ecology of food spoilage yeasts and the methods of studying them. It is not intended to be an exhaustive review, as the subject has been covered by a number of excellent reviews and treatises (Walker and Ayres, 1970; Walker, 1977; Beuchat, 1978, 1987; Phaff et a]., 1978; Miller, 1979; Rhodes, 1979; Peppler, 1980; Skinner et al., 1980; Davenport, 1981). Recently an excellent review chapter has appeared comprehensively covering the role of yeasts in food spoilage (Fleet, 1990). II. Characteristics and Classification of Yeasts
Yeasts are traditionally characterized, classified, and identified by morphological and physiological criteria (Kreger-van Rij, 1987). To these, new criteria have been introduced concerning the biochemistry and molecular biology of yeast cells. Data on the chemical composition of cell walls, capsular polysaccharides, whole cell hydrolysates, antigenic determinants, and enzyme patterns provide valuable information for yeast taxonomy (Phaff, 1984). However, the most important ap-
FOODBORNE YEASTS
181
proach is the determination of DNA base composition and homology, as well as the sequence of ribosomal RNA, which can be used to elucidate not only the degree of relatedness but also to reveal evolutionary connections (Walker, 1985;Kurtzman and Phaff, 1987;Blanz and Unseld, 1987).
Molecular taxonomy has reformed yeast classification and has become of prime importance to the distinction of species. However, the sophisticated biochemical and genetic methods cannot be applied in routine identification procedures, and the classification of yeasts among other fungi is still primarily based upon characteristics of sexual reproduction (von Arx, 1981;von Arx and van der Walt, 1987).Criteria used for the description and classification of yeasts have been described in detail by van der Walt and Yarrow (1984)and summarized recently by Kreger-van Rij (1987).In the following discussion, only those morphological and physiological criteria will be mentioned and will be referred to later in the description of foodborne yeasts and their identification. From a taxonomic point of view, yeasts are not homogeneous and their taxonomy is not stable. For practical purposes, yeasts may be defined as unicellular fungi in which vegetative reproduction occurs mainly by budding. Although a single cell is the predominant form of yeasts, some yeasts produce filaments like other fungi. These may be well-developed true hyphae or chains of cells forming pseudohyphae. These forms, collectively called yeastlike organisms, are borderline between filamentous fungi and unicellular yeasts. Moreover, many filamentous fungi can be induced to form a yeast phase, and some pathogenic fungi are also dimorphic in that they form yeastlike cells in the invaded tissue (Shepherd et al., 1985;de Hoog et al., 1987). It seems that during evolution, adaptation to unicellular life forms may have occurred several times among groups of fungi. Consequently, yeasts can be assigned to different fungal taxa. Those yeasts that form spores by sexual reproduction can be classified accordingly to the appropriate fungal division. The so-called true yeasts are traditionally considered a group of ascomycete fungi. However, the endogenous formation of sexual spores in these yeasts differs substantially from the characteristic development of ascospores in that yeasts lack dicaryotic ascogenous hyphae and ascocarps. Hence, this group of yeasts can be considered as a separate division of fungi for which the names Endomycota (Barr, 1983) or Zymomycota (Novak, 1981)have been suggested. The mode of spore formation varies among true yeasts. Cells of Saccharomyces are diploid and directly transform into sporangia when the
182
T.DEAK
spores form. In Zygosaccharomyces, conjugation between independent haploid cells precedes sporangium formation, whereas in Torulaspora, conjugation occurs between the mother cell and its bud. Other modes of sporulation can also be found in other genera. Spores may remain in the sporangium until the time of germination, or spores may easily be liberated from sporangia (e.g., in Kluyveromyces). This can be of diagnostic value, as well as the shape of the spores (e.g., spherical, kidney, or needle). Sometimes spores are surrounded with a brim that gives them a hat or saturn shape (e.g., in many Pichia). Although the morphological features of spores play an important role in yeast classification, they can be properly studied only by electron microscopy. Moreover, for a variety of reasons, spores are not consistently formed. When the yeast strain is haploid and heterothallic (i.e., the opposite mating types can be found in separate colonies), spore formation does not occur in isolated culture. Even many homothallic yeasts often require special conditions to induce spore formation. Hence, many yeasts are known, and in fact have been first described, in asexual form, called the anamorph (or imperfect) state, as compared to the teleomorphic (perfect) state, in which the yeasts reproduce sexually by the formation of spores. Unfortunately, a yeast often bears different names in the two states: the teleomorphic name is used to describe the species and the anamorphic name reduces to a synonym (e.g., Hanseniaspora uvarum, whose anamorph is Kloeckera apiculata). Some yeasts reproduce sexually by teliospores and others reproduce by basidia. These yeasts clearly show basidiomycetous affinity; moreover, they may also form hyphae with clamp connections. Some of them are true basidiomycetes, whereas others are more similar to the smuts. They are usually isolated in the anamorphic state because selfsporulating strains are rare. Their haploid anamorphs have been grouped in various imperfect genera such as Rhodotorula, Cryptococcus, and Sporobolomyces. The characteristic mode of yeast asexual propagation is budding. According to modern terminology introduced for fungi, budding is a type of conidiation (von Arx, 1979),and the buds are blastoconidia. Several types of budding occur among yeasts. Notable is bipolar budding (annelloconidiation), which lends the cell a peculiar lemon shape (e.g., in Hanseniaspora). Otherwise, yeast cells are mostly round, oval, or cylindrical. When certain strains form septate hyphae, buds may arise from them, or sometimes the hypha breaks up into arthroconidia. This is actually what happens with the single cells in the genus Schizosaccharomyces, wherein the characteristic vegetative reproduction is called fission, and no budding cells occur.
FOODBORNE YEASTS
183
Of the physiological criteria used for classifying and identifying yeasts, the most important are fermentation and assimilation, although a number of other properties are also generally considered. Mention should be made of two tests that recently have become important for the distinction of basidiomycetous yeasts. These are the diazonium blue B (DBB)and the urease color reactions (Hagler and Ahearn, 1981).They are especially useful criteria for the characterization of imperfect yeasts that do not reproduce sexually. Efforts to form homogeneous genera of imperfect yeasts according to their connection with, or affinity to, perfect counterparts have not yet been fully successful. It has been suggested that the genus Candida should retain only the endomycetous anamorphic species (van der Walt, 1987;Weijman et al., 1988).This largest yeast genus has become a reservoir of all imperfect forms that cannot be assigned to any other genera. Even the former Torulopsis species have been merged with Candida because the formation of pseudohyphae appeared to be an unreliable character (Yarrow and Meyer, 1978). Thus, the taxonomy of yeasts is far from complete; moreover, the frequent changes of names and classification may result in a confusing situation. Ill. Ecology of Yeasts
The modern concept of microbial ecology considers every food item as a habitat of microorganisms. Every food has a characteristic microflora, which is a specific association of microorganisms. The origin, development, and succession of this association are governed by environmental ecological factors that influence the physiological expression of the genetic constitution of the microbial cells. Raw and processed foods become contaminated by microorganisms from the environment. Only a part of this primary microflora will survive under the selective pressures exerted by the internal and external environments of foods. Those microorganisms will be favored that possess the proper physiological attributes to respond the ecological determinants. Interactions among microorganisms also influence the development of microbial colonization. Eventually, a particular microbial community will develop. If the environmental factors permit, this characteristic microflora will turn into a specific spoilage association. All of these dynamic changes are determined by the ecological factors of a given food. The ecological principles of food microbiology outlined above were laid down by Mossel and Ingram (1955)and are now widely accepted (ICMSF,1980;Hobbs, 1986).The same general principles can be related
184
T.DEAK
to yeasts occurring in foods. In the following sections, ecological determinants are discussed as they relate specifically to foodborne yeasts. In doing this, five groups of ecological parameters will be considered: (1)sources and vectors of contamination, (2) intrinsic, abiotic properties of foods, (3) extrinsic, abiotic factors of storage and transportation, (4) processing and preservation, and (5) biotic, implicit properties of microorganisms. AND VECTORS OF CONTAMINATION A. SOURCES
Yeasts can be found in most natural habitats, such as soil, plants, animals, and fresh and marine water. Many reviews have dealt with the relationship of yeasts with their natural environments. Phaff et al. (1978)presented a broad overview of yeasts associated with soils, water, plants, and animals. These topics have been updated recently by Phaff and Starmer (1987),Hagler and Ahearn (1987),and Hurley et al. (1987). From an ecological point of view, these natural habitats are ubiquitous and are general sources of contamination of foods. Several yeast species are typical inhabitants of soil ( e g , Schwanniomyces and Lipomyces species), and a much larger variety of yeast occurring in soil represents the yeast flora associated with plants and animals above the surface. For these yeasts, soil serves more as a reservoir than as a specific habitat. Hanseniaspora species, for example, occur very commonly in orchard and vineyard soils and get there from fruits that fall to the ground. Some vegetables may be directly contaminated by yeasts from soil. Insects are the most important vectors in the distribution of yeasts in nature. Mechanisms of yeast distribution by insects, animals, air, and water have been reviewed by Davenport (1976). Yeasts are often intimately associated with some insects; e.g., bark beetles have been shown to be the sources of several yeast species (Kreger-van Rij, 19841. Drosophila and honeybees are important vectors of yeast dissemination in foods. Specific sources of contamination are previously spoiled food materials, and transporting containers and processing equipment may serve as transmitters in facilities that fail to maintain satisfactory hygienic measures. Geotrichum was involved in a well-documented case of “machinery mold” contamination (Eisenberg and Cichowicz, 1977; Splittstoesser et al., 1977). It has also been proved that the main sources of Saccharomyces wine yeast are the winery equipment, presses, and barrels (Rosini et al., 1982).
FOODBORNE YEASTS
185
B. INTRINSIC PROPERTIES OF FOODS Intrinsic parameters are those physical, chemical and structural properties inherent in foods that primarily determine the fate of the microbial population in the foods. With respects to yeasts, the most important intrinsic factors are water activity, nutrients, and acidity. 1. Water Activity
In food microbiology, the availability of water for microorganisms is generally expressed in terms of water activity, a,, which relates to the concentration of solutes in a food (Brown, 1976; Tilbury, 1980b). The majority of yeasts are somewhat less sensitive to the lowering of a, than most bacteria and can grow at minimum a, values, around 0.95-0.90. A particular group of yeasts is of special importance for being able to grow at much lower a, values in the presence of high concentrations of either sugar or salt. These yeasts, which have long been called “osmophilic,” are important spoilage organisms in certain foods. The term, however, is misleading for two reasons. The osmotic pressure is not directly related to the physiology of these yeasts, and they do not really require a high solute concentration for growth, but rather are able to thrive at low a, values. Hence, the term “xerotolerant” has been coined to describe these yeasts (Anand and Brown, 1968). In the earlier literature an extremely low a, tolerance of yeast, 0.620.65, was recorded (for a survey see Jermini and Schmidt-Lorenz, 1987a). Later investigations did not confirm these data. Two other surveys have been published (Tokouka et al., 1985; Jermini et al., 1987),but neither noted yeast growth at a, 0.7 or below, and out of some 140 freshly isolated strains, only four grew better at a, 0.91 than at higher a, values. Values of less than 0.7 a, not only inhibited yeast growth but also caused slow death of cells, with a decimal reduction time of 57-445 hours at a, 0.626 (Jermini and Schmidt-Lorenz, 1987a). The principal xerotolerant yeasts are species of the genus Zygosaccharomyces. The most common is Zygosaccharornyces rouxii, strains of which showed a minimum a, 0.76 for growth, whereas optimum was above 0.95. Other Zygosaccharornyces species occur less frequently in foods and show less a, tolerance, e.g., Zygosaccharornyces bailii did not grow below a, 0.85 (Jermini et al., 1987). Tokouka et al. (1985) listed some 30 yeast species that showed a certain degree of sugar tolerance in that growth occurred in the a, range 0.912-0.876. They were isolated from high-sugar-containing foods. In addition to Z. rouxii, Zygosaccharomyces bisporus, Candida lactis-condensi, Debaromyces
186
T.DEAK
hansenii, Pichia anomala, Schizosaccharomyces octosporus, Schizosaccharomyces pombe, Torulaspora delbrueckii, and several Candida species were listed. The minimum a, value of growth is influenced by the nature of the solute and by other ecological factors (e.g., temperature). Growth of Z. rouxii ceases at a, 0.85 when salt is used to lower the a,, whereas the minimum value for growth is less in the presence of sugars. Conversely, D. hansenii, Candida krusei, and some other yeasts are noted for their high salt tolerance. The physiological basis of xerotolerance in yeasts is attributed to the synthesis and intracellular accumulation of polyols (glycerol, arabitol, and erythritol) at low a, values. Polyols are thought to be compatible solutes, both compensating for the concentration difference across the cell membrane and allowing the metabolic enzymes to function (Brown, 1978). 2. Nutrients
A comprehensive review concerning the nutrients used by yeasts was presented by Rose (1987).The most important nutrients for yeasts are carbohydrates, which serve as both growth and energy sources. The aerobic utilization of a substance for growth is called “assimilation” by zymologists. Fermentation means the anaerobic metabolism of carbohydrates to ethanol and carbon dioxide. The term “yeast” is often associated with fermentation; however, nearly half of the presently known yeast species lack the ability to ferment sugars. Only a few sugars, mostly hexoses and oligosaccharides, can be fermented by yeasts. The range of carbon sources that are utilized aerobically is much wider, and includes hexoses, pentoses, alcohols, organic acids, and some other carbon compounds. Differences in the fermentation and assimilation of carbon sources are important diagnostic characters in yeast taxonomy and identification. The ability to decompose complex carbohydrates is restricted to a few yeast species. Utilization of starch is of particular interest for industrial production of yeast cell mass (single-cell protein, SCP) from starchcontaining agricultural wastes. Schwanniomyces and Lipomyces species possess enzymes with various amylase activities. The former can only partially utilize starch for lack of debranching enzyme activity; the latter is able to utilize starch completely. Saccharomyces cerevisiae and Candida utilis are unable to hydrolyze starch. A special biotype of S. cerevisiae (formerly recognized as a separate species, Saccharomyces diastaticus) can, however, completely hydrolyze starch (McCann and Barnett, 1986).
FOODBORNE YEASTS
187
Pentose utilization, particularly fermentation of xylose, may be potentially a useful property of some yeasts for the industrial production of ethanol from the hydrolysis products of hemicellulosecontaining plant materials. Other possible carbon sources for SCP production by yeasts are hydrocarbons, and several yeasts are able to grow on these substances (Barnett et al., 1983; Phaff, 1986). A number of yeasts show pectolytic activity, although the enzymes responsible for this differ among the species (Sanchez et al., 1984; Call et al., 1985). Both organic and inorganic sources of nitrogen can be utilized by yeasts for growth. Although very few species can hydrolyze proteins extracellularly, short peptides can be transported into the cell and utilized intracellularly (Yamada and Ogrydziak, 1983). Amino acids, amines, and urea are suitable nitrogen sources for practically all yeasts, as are inorganic ammonium salts. Nitrate utilization is, however, confined to certain species or genera of yeasts, and this is a valuable diagnostic character used for identification purposes. In addition to basic carbon and nitrogen sources, inorganic microelements and small amounts of complex organic growth factors, mostly vitamins, may be required for the growth of yeasts. These requirements are normally fulfilled adequately in natural substances and foods. Yeasts vary widely in their requirements for minerals and growth factors. Many species synthesize all of the necessary vitamins for growth and propagate vigorously in vitamin-free media. Others require certain vitamins, and this can be used for identification purposes (Barnett et al., 1983). Biotin appears to be the most commonly required vitamin; some species require niacin, thiamine, pantothenic acid, folic acid, riboflavin, or m-inositol. Certain yeasts are notable for their exacting properties, e.g., a strain of S. octosporus grows poorly in synthetic media unless supplemented with adenine. Dekkera (and Brettanomyces) species require high concentrations of thiamine for growth. 3. Acidity
Most yeasts tolerate a wide range of pH and grow readily at values between 3 and 8. In general, yeasts prefer a slightly acidic medium, with an optimum pH between 4.5 and 6.5. Yeasts show a remarkable tolerance to pH. Many species, such as C. krusei, Pichia membranaefaciens, Brettanomyces intermedius, and Saccharomyces exiguus, are able to grow at pH values as low as 1.3-1.7 (Pitt, 1974). This tolerance depends on the type of the acidulant; organic acids are more antimicrobial than inorganic acids. Of the former, propionic acid is more inhibitory than acetic, lactic, or citric acid (Walker, 1977). Moon (1983) found that 20 mM propionate, 150 mM acetate, and 350 mM lactate caused 50%
188
T. DEAK
reduction of growth rate in yeasts isolated from spoiled fermented foods. The effectiveness of an acid depends on the lowering of pH and on the specific antimicrobial property of the acid, which is carried by the undissociated molecule. Consequently, the pH and the pK, value of an acid strongly influence the antimicrobial activity. The physiological basis of the effect of pH on yeasts is not yet completely understood. It is generally believed that the maintenance of a proton gradient across the plasma membrane against a constant intracellular pH of about 6.5 is vital for a yeast cell (Borst-Pauwels, 1981). The ability of yeasts to grow at low pH may depend on energy-requiring transport systems that pump protons out of the cell, thus preventing acidification of the cell interior (Deak, 1978).The pH of the environment affects appreciably other physiological behaviors of the yeast cell, such as heat tolerance and resistance to chemical compounds. C. EXTRINSICPARAMETERS The two most important factors in the external environment of a food affecting yeast growth and activity are temperature and oxygen levels, or more generally, the surrounding atmosphere. 1. Temperature
The temperature relations of yeasts have been reviewed by Watson (1987),and this topic will be covered here only briefly. The vast majority of yeasts live in a range of diverse habitats whose temperature domain falls between 0 and 45°C. Accordingly, most yeasts can be classified as mesophiles on the basis of temperature limits for growth. Quite a number of yeasts are capable of growing around 0°C and even a few degrees below zero, as well as at 25-30 "C. Some other yeasts, among them many Cryptococcus and Candida species, exhibit an optimum growth temperature below 20°C. These can justifiably be considered phychrophilic. At the other extreme, there exist only a few yeasts (all associated with the digestive tract of animals) whose minimum temperature for growth is above 20°C and whose maximum temperature is about 46-48°C. These are called thermophiles, although their cardinal temperatures for growth are not comparable with those of obligate thermophilic bacteria. Of the common foodborne yeasts, Kluyveromyces strains are noteworthy for their relative high maximum growth temperature of around 42-45°C. Otherwise, many yeasts do not grow at or above 37°C and this sometimes serves as a useful diagnostic property for some species.
FOODBORNE YEASTS
189
The temperature of growth is influenced by other environmental factors. It is a general phenomenon that the optimum temperature for growth is elevated in solutions of high sugar or salt concentration. In a study by Jermini and Schmidt-Lorenz (1987c), examples were given for growth of xerotolerant yeasts of the shift of cardinal temperatures toward higher values with decreasing a,. In normal media the minimum temperature was 4°C for the strains studied; at a, values less than 0.92, none of them grew below 6°C. On the other hand, an increase of solute concentration (up to 60% w/w glucose) raised the maximum growth temperature by 4-6°C up to 42°C. 2. Atmosphere Composition
Contrary to common belief, yeasts are basically aerobic organisms. Some genera (e.g., Cryptococcus and Rhodotorula) are strict aerobes, whereas others are facultative and can also carry out an alcoholic fermentation. Characteristic members of yeast genera, such as Saccharomyces and others, when submerged in liquid, bring about a vigorous fermentation of sugars but soon stop growth and propagation for lack of available oxygen. This is because all yeasts require molecular oxygen for the synthesis of certain cellular constituents, such as unsaturated fatty acids and sterols (Rose, 1987). Facultative yeasts switch their metabolism from aerobic respiration to fermentation and vice versa, depending on the availability of molecular oxygen (the so-called Pasteur effect), or on the concentration of glucose (the Crabtree effect) (Fiechter et al., 1981; Lagunas, 1981). A peculiar group of yeasts (Dekkera species and their anamorphs, Brettanomyces) ferment glucose more rapidly under aerobic than anaerobic conditions (the so-called Custer’s effect; Carrascosa et al., 1981). Fermenting yeast species have a selective advantage over the strictly aerobic species, and it is these that can thrive under low oxygen tension in beverages and in deeper layers of thick food pieces, where they may cause fermentative spoilage of products. Certain fermentative yeasts appear to be rather insensitive to high levels of carbon dioxide. Brettanomyces species have been found to be the most COz-tolerant yeasts and are the main spoilage yeasts of carbonated beverages. Candida intermedia, P. anomala, and Z. bailii also tolerated about 0.5 MPa pressure of dissolved COz (Ison and Gutteridge, 1987). Certain Saccharomyces strains used in champagne production are able to ferment under high pressures of COz. The factors relating to the resistance or sensitivity of yeasts to carbonation are not fully understood. Growth and metabolic activity are both adversely affected in most yeasts at pCOz values above 0.3 MPa (Jones and Greenfield, 1982).
190
T. DEAK
D. IMPLICIT PARAMETERS Implicit parameters refer to the genetically determined physiological attributes of microorganisms whose ultimate expression is the ability and rate of growth under a given set of environmental (extrinsic and intrinsic) conditions. In addition, the interactions among members of a population, particularly antagonistic and synergistic effects on each other, are also considered as important biotic, implicit determinants. Growth of yeasts that primarily propagate vegetatively by budding can be described in a manner analogous to unicellular, dividing bacteria, and the increase in cell number or cell mass with time can be characterized by the specific growth rate ( p )or the mean generation time (tg).
Relatively few studies have been made on growth of yeasts on natural substrates. The growth kinetics of yeasts has been mainly studied in batch and continuous cultures in connection with their industrial application (Fiechter et al., 1987).To a good approximation, yeast growth can be characterized with a growth rate in the range of 0.17-0.35/hour ( t g , 4-2 hours), although some yeasts grow much more slowly ( e g , Brettanomyces species). In general, the growth rates of yeasts are slow compared with those of bacteria, and mold growth is much slower than that of yeasts. This gives a certain advantage to bacteria over yeasts in colonization of most foods. However, under certain conditions, e g , in acidic or high-sugar-containing food, yeasts can easily overgrow bacteria. In plant materials, cellulose and starch hydrolysis by molds is often followed by the development of yeasts that are only able to utilize the hydrolysis products of these polysaccharides. This and many other examples can be cited for interactions between yeasts and other microorganisms (Phaff et a]., 1978). These interactions are either based on differences in the metabolic capabilities to compete for available nutrients, or in the physiological constitution (sensitivity or resistance) related to metabolic products or environmental factors affecting growth. Ethanol produced by fermenting yeasts is a well-known example of an antagonistic metabolic product that inhibits bacteria and yeasts. Worth mentioning is the production of killer toxins by many yeasts, because these are not only likely to affect yeast populations in natural habitats, but can also be exploited in the industrial use of yeasts (Young, 1981; Heard and Fleet, 1987). E. PROCESSING AND PRESERVATION
Perhaps the most dramatic changes in the composition of the microflora of a food happen during its processing, which brings about great modifications in the physical and chemical conditions. Preservation by
FOODBORNE YEASTS
191
heat treatments or addition of chemicals may kill the majority of cells present or select for resistant types of microorganisms. 1. Heating
In general, the heat resistance of yeasts is about the same as that of vegetative cells of bacteria. Beuchat (1981a,b) indicated that death of most yeast cells occurred within 30 minutes at 50°C or 10 minutes at 60°C. Put et al. (1976) made a comprehensive study of the heat resistance of 120 yeasts representing some 30 species isolated mainly from soft drinks. Their method was to determine the survival of buffered yeast suspensions of about lo5 cells/ml at pH 4.5 from 55 to 65°C for 10 and 20 minutes. These conditions were chosen because yeast populations often do not show linear survival curves enabling one to determine the decimal reduction time (D) and its temperature dependence (z value) (Barillere et a]., 1985a,b). These authors concluded that about half of the strains studied did not survive 10 minutes at 62.5"C and none survived heating for 20 minutes at 65°C. Strains of S. cerevisiae showed the highest heat resistance in that they survived 10 minutes at 65°C. In addition to S. cerevisiae, strains of Kluyveromyces marxianus, Z. bailii, and Z. rouxii also showed moderate degrees of heat resistance, surviving 20 minutes at 62.5"C. In order to overcome the uncertainties caused by tailing of survival curves, Reichart (1979) devised a new method to measure and calculate D and z values. By applying this method it was found that the D value for the most sensitive yeasts (e.g., Cryptococcus strains) was less than 1 minute at 50"C, whereas most yeasts showed a lethality at 55°C with a D value of 0.6-4.6 minutes, and the z value ranged from 3 to 7°C (Torok and Reichart, 1983). These ranges of D and z values have also been measured by other authors (Barreiro et al., 1981; Juven et a]., 1980; Splittstoesser et a]., 1986). Spores of yeast possess considerably more heat resistance than do vegetative cells. Put and De Jong (1982a,b) showed that spores exhibited a heat resistance 50- to 350-fold greater than vegetative cells. Splittstoesser et al. (1986) confirmed this finding and showed that the D value at 55°C was 106 minutes for S. cerevisiae spores compared to 0.9 minutes for vegetative cells. In addition to the differences in types and origin of strains and the extent of sporulation, the main factors influencing heat resistance are the composition and pH of the heating medium. The heat resistance of yeasts is influenced in solutions containing sugars and/or salt. Sucrose in 15 to 60% concentrations protected yeasts against heat inactivation, and this was attributed to the dehydration of cells caused by solutes (Corry, 1976). Salt behaved similarly only in lower concentrations (up
192
T. DEAK
to 6%) but in higher concentrations it enhanced the heat inactivation of some yeasts (Beuchat, 1981a). It appeared that the protective effect of salt against heat inactivation correlated with the growth tolerance to NaC1; for example, P. membranaefaciens, lssatchenkia orientalis, and D. hansenii possessed higher heat resistance in the presence of salt, but salt enhanced the heat destruction of Rhodotorula rubra. Compared to heat resistance in various solutions, yeasts are much more resistant to dry heat. Scott and Bernard (1985) obtained for several yeasts D values of 1to 2 minutes at temperatures of 110-125°C, with z values from 9 to 13°C. Decrease of pH, addition of preservatives, and organic acids generally increase the rate of heat destruction of yeasts (Beuchat, 1981b). Lowering the pH from 5 to 2.5 caused, without exception, more rapid inactivation. Potassium sorbate and sodium benzoate in concentrations of 0.1 to 1.0% and organic acids (citric, malic, and especially acetic acid) in concentrations of 0.1 to 3% acted synergistically with heat. This effect can clearly be demonstrated in model systems; however, Beuchat (1982) pointed out that rates of inactivation were not markedly affected by various concentrations of citric, malic, and tartaric acids normally found in fruit juices and purees. Moreover, the protective effect of certain natural components and/or added sugar against heat inactivation could reduce the synergistic effect of preservatives and organic acids (Beuchat, 1983a). Ethanol sensitizes yeasts to heat, which is advantageous to product stabilizing achieved by hot filling of bottled table wines (Splittstoesser et al., 1975). Heating may cause not only direct destruction of yeast but also a sublethal stress for those cells that immediately survived heat treatment (Beuchat, 1984).These stressed and injured cells may recover or may die subsequently, depending on the circumstances. This phenomenon can be advantageous to the quality and shelf life of the food product. The slow die-off of heat-injured yeast has been demonstrated in dried vegetables and other commodities whose previous processing included a certain degree of heat treatment. On the other hand, recovery for demonstration and enumeration of injured cells requires optimum growth conditions, and these were subject of detailed studies (Stecchini and Beuchat, 1985). 2. Freezing
Compared to heat inactivation, the effects of reduced temperature and freezing on yeast have received less attention. Yeasts in general survive freezing in high percentages of the inital viable cell number. Indeed, freezing and freeze-drying are effective and routinely used methods for
FOODBORNE YEASTS
193
the preservation and storage of yeast strains in culture collections (Kirsop and Snell, 1984). This involves quick freezing close to the temperature of liquid nitrogen (-196°C) or at least to -80°C by applying deep freezer apparatuses. For food preservation and in commercial practice, relatively higher temperatures in the range of -15 to -25°C are applied and are attained at much slower freezing rates. Under these circumstances, the survival ratio is less and the freezing injury is higher. This is mainly attributed to the formation of internal ice crystals and/or crystallization in the environment, causing intracellular dehydration and membrane damage (Ingram and Mackey, 1976). In addition to the cooling rate and freezing temperature, the extent of cell death and low-temperature injury depends on many other factors, such as species and strain differences, pH, and solute concentration. In general, food constituents such as sugars, starch, amino acids, and proteins have a protective action, whereas organic acids and preservatives enhance the lethal effect of freezing and thawing and the slow inactivation during frozen storage. The effect of the thawing and warming rates is difficult to separate from the direct effect of freezing itself. During slow thawing, recrystallization of ice is considered as a major cause of further injury. Repeated freezing and thawing cause increased inactivation of cells (Meyer et al., 1975).Osmotolerant yeasts, which possess a particular membrane structure and metabolic system for osmotic regulation (Brown, 1978; Morgan and Witter, 1980), are more sensitive to the lethal effect of freezing than are other yeasts. In a recent study, Jermini and Schimdt-Lorenz (1987b) showed that a single freezing to -25°C and thawing after 24 hours caused an approximate reduction of viable cells of Z. rouxii. After 4 months storage at -25"C, only 1 5 to 40% of cells originally present survived. Repeated freezing and thawing (five or six times] reduced the viability of 0.1% or less. 3. Preservatives
The commonly used food preservatives, benzoic acid, sorbic acid, and sulfuric acid, are weak acids with undissociated lipophilic forms that easily penetrate the cell membrane (Cole and Keenan, 1986; Warth, 1986).
The maximum tolerated levels of benzoic and sorbic acids ranged from 0.5 to 1 mM for H. uvarum, P. anomala, K. marxianus, and S. cerevisiae, whereas other yeasts, such as I. orientalis, S. pombe, Z. bailii, and Saccharomycodes ludwigii were more resistant, tolerating 3 to 4 mM (Warth, 1985). Resistance to these preservatives was often associated with resistance to SOz in a concentration range of 0.05-
194
T. DEAK
2.8 mM. This may be due to common nonspecific effects on cell membrane functions and energy generation (Detik and NovBk, 1972a; Freese et aI., 1973), although preservatives may also have specific actions (Liewen and Marth, 1985). The main inhibitory effect of sorbic acid and benzoic acid was to reduce cell yield, and at higher concentrations the growth rates and lag times were also affected. In contrast, SO2 did not greatly inhibit cell yield and growth rates but produced extended lag times (Warth, 1985). When used in their acceptable concentrations, the organic preservatives do not kill microorganisms but inhibit their proliferation (Restraino et al., 1982). On the other hand, free SOz can cause rapid loss in cell viability (Schimz, 1980). Inhibition of growth may cease when the effective concentration decreases due to breakdown and metabolism (Deak and NovBk, 1972b) or chemical binding (King et al., 1981).Certain yeasts, such as S. Iudwigii and Z . bailii, show notable resistance to preservatives. This can be explained by the induction of an active transport system that pumps preservative molecules out of the cells (Warth, 1977). In the case of SOz it was suggested that resistance was partly due to the ability of yeast cells to produce and excrete acetaldehyde, which binds sulfite (Stratford et aI., 1987). Ethanol, although not considered as a preservative in the strict sense, has a well known antimicrobial effect that is exploited in the production of alcoholic beverages intimately associated with yeasts. Yeasts differ widely in their capacity to produce and tolerate ethanol (Casey and Ingledew, 19861. Ethanol tolerance is related to membrane composition (Thomas et al., 1978; D’Amore and Stewart, 1987) and membrane function coupled to proton transport (Juroszek eta]., 1987),whereas the rate and capacity of ethanol production depend on the levels and activities of key enzymes involved in alcoholic fermentation (Sharma and Tauro, 1987).
IV. Specific Habitats
The specificity of yeast habitats in foods is determined by the ecological factors discussed previously. Governed by the ecological determinants, each specific group of food becomes colonized by a characteristic microflora. In this environment, yeasts are associated with other microorganisms (molds and bacteria) and often are in the minority, especially in relation to bacteria. In the following discussion our interest will be focused exclusively on yeasts, Some foods are rich in nutrients and do not exhibit any restrictive conditions and hence contain a wide variety of yeasts. Others are highly
FOODBORNE YEASTS
195
selective and contain only a few species. Some yeasts are ubiquitous and commonly occur in all kinds of foods. Other species are regularly associated with a given type of food, and these are, in most cases, but not necessarily, the dominant and prevailing species of the yeast flora. Still other yeasts may occur occasionally in a given habitat and their occurrence can be considered fortuitous. It should be noted that the composition of yeast communities is affected by the changes of selective pressures during processing and storage; however, the succession of species can equally be a characteristic course. Distribution of yeasts in foods has been gathered from numerous surveys made by various workers. Several extensive reviews and detailed studies on the association of yeasts with raw and processed foods have been published [do Carmo-Sousa, 1969; Last and Price, 1969; Walker and Ayres, 1970; Phaff et a]., 1978; Phaff and Starmer, 1980; Skinner et a]., 1980), and the taxonomic treatises also provide information on the origin of specific yeast isolates (Lodder, 1970; Kreger-van Rij, 1984). Barnett et al. (1983) compiled lists and keys for yeasts in foods, wine, beer, and nonalcoholic beverages. The following discussion will be directed to specific associations of yeasts with ecologically determined main types of foods, and covers predominantly the literature since 1970. Literature data are summarized in a tabulated form (Table I). A. FRUITS AND VEGETABLES Fruits and vegetables are fresh, living, or moribund, withering parts of plants, rich in nutrients. The determining ecological factor differentiating fruits and vegetables is the pH, which ranges from 3 to 5 in fruits, and this together with high levels of soluble carbohydrates makes them primary habitats for yeasts and molds. Vegetables, on the other hand, have a somewhat higher pH, which renders them more susceptible to bacterial invasion (Deak, 1979; ICMSF, 1980; Brackett, 1987). Yeasts form a part of the natural microflora of most fruits and vegetables, although their relative proportion varies from commodity to commodity and is influenced by environmental, harvesting, and storage conditions (Dennis and Buhagiar, 1980). The population of yeasts on sound fruits has been the subject of numerous studies. Davenport (1976) carried out extensive microecological surveys in English orchards and vineyards. Sources of yeasts included all parts of apple trees and vine plants as well as soil, air, and animal vectors. The main conclusion was that yeasts may differ quantitatively and qualitatively according to the parts examined, and the microflora also differed according to the season, cultivar, and site. Nevertheless, certain yeast
TABLE I
OCCURRENCE OF COMMON FOODBORNE YEASTSPECIES' Species Conodido dbicons
Fresh fruits and vegetables Grapes (13)
Nonalcoholic beverages Soft drinks
Alcoholic beverages
Hi&-sugar products
Grains and cereal products
Must (67)
(96.111)
-
Soft drinks (111). mango juice (125) Soft drinks
Condido contorelli
-
(96,111,112) -
Candido cotenuloto
-
Condido opicola
Condido boidinii
Fruits (129)
Must (140)
Refined sugar
-
(128.140). raisins (34)
Wine (67.140). beer (4,140) Wine (34,67), must (140) Apple juice (10) Wine (34), sherry (67)
-
m
Condido diddensioe
-
Soft drinks (111)
Condido etchellsii
-
Soft drinks (132), apple
-
Must (671, wine (70)
juice (10) Condido globmto
-
Mango juice (125)
Wine (34). must (67,106)
Dates (137)
Apple juice (10). Must (67). wine (70). beer (53) soft drinks
-
Dairy products Cheese (38)
Fermented and preserved foods Fish sauce (29)
Dairy products (127)
Dairy products
Olives (48)
11271
Jam (128)
-
Shellfish (14)
Dairy products
Beef (32), poultry (140). sausage (711, shellfish (14) Beef (57). fish (59).shellfish
Cheese (140)
(1271
Sugar (140)
Raw sugar (137). dried fruits (73). syrups (128) Molasses (921, raw sugar -
Cocoa fermented (101)
-
Olives (48)
Sausage (71)
-
-
Poultry (59).fish (59), shellfish
-
Soy sauce (87). brine (42). pickles (24). olives (137) Brine (121,idli
-
Beef (32), fish
-
-
(14,1401
(134)
(14)
(137)
Candido inconspicua
Beef (32). shellfish (14) Beef (23). sausage (19)
-
CL
W
Meat, fish, and shellfish
Cheese (127)
(103,137)
Cocoa (fermented) [lol), salad
(841
Condido intermedio
Corn (16.35)
Soft drinks (96,111)
Wine (67,701
Molasses (92)
-
Sausage (191, beef (23.57), shellfish (20). poultry (591
Yoghurt (1271, cheese (115)
dressing (17) Chilled salads 164)
Condido loctis-condensii
Condido magnolioe
Condida norvegica
Condida pampsilosis
Red currants (341 -
Corn (16.35)
Soft drinks (132)
Wine (70). must 1671
Soft drinks (132)
Must (49)
Softdrinks (111) Cider (1401,
Soft drinks (96,111)
winery (31,1401 Must and wine (67,70),palm sap (21, must 11061
Wine (671, sake (141). beer
Candida rugoso
Condensed milk (140), refined sugar (1281.dried fruits (731, candies (129) Concentrated {uices (1901 -
Molasses (92)
-
Bread (119)
-
-
1881
Condida sake
Strawberries (151,figs (94). corn (34)
Soft drinks (96,111,1121
Wine (34,67,70), winery (11.311. must (931, beer (4)
Sugar cane (1)
-
Condida stelloto
Grapes (33,50), figs 11371, apples 1101. fruits (122,123,137) Corn (16). rice (137). tropical fruits (100)
Soft drinks 174,961
Must (491, wine (44,54,55, 63.67.70.79)
Molasses (92)
-
Wine (34,671. beer (88). palm sap (21, baker’s yeast 146)
Molasses (921, raw sugar (137)
Condida tropicolis
Fruit juices (7.10,ll. 96,125)
Shellfish (14)
Shellfish (141, beef (321 Beef (611, poultry 1591, sausage (18,19,71], fish (28.1031, shellfish (20,651 Beef (32). poultry (59). sausage (71)
Cheese (139)
Brine (42). salad dressing (96)
Dairy products (1271
Brine (121, olives (1371, salads (64) Olives (48)
-
Cheese (38)
Cheese (115,124). yoghurt (5.511, butter (1401
Shellfish (14). beef (32,611
-
Shellfish (141, beef (23)
-
Pickles (241, brine (87,1401, tape 1301, cocoa (fermented) (101).salads (17,64,107) Pickles (351, olives (48)
Cocoa (fermented) (1011, fermented food (113,134). salads (64) Cocoa (fermented) (1011
Grains (120). dough (1091
Shellfish (14) beef (23). fish 1591
Cheese (38,139)
Fermented fish (107). idli (134). brine
(continued )
TABLE I (Continued) Species
Fresh fruits and vegetables
Nonalcoholic beverages
Alcoholic beverages
Condido versotilis
Corn (35)
Soft drinks l132), apple juice (10)
Wine (67.70)
Condida vini
Fruits (122,123)
Soft drinks (84)
Condido zeylonoides
Grapes (341, fruits
Wine (34,67,70, 78,136), winery (80). beer (531, baker’s yeast (461 Wine (3467.78)
-
High-sugar products
Grains and cereal products
Raw sugar (1371, concentrated juice (128) Molasses (92)
-
Beef (23,32,57)
-
Beef (32)
Flour ( 1 2 0 )
(122,123)
Citeromyces motritensis
Cryptococcus olbidus
Wine (141)
Corn (35). wheat (68). fruits (10,15,33,34), tropical fruits
Soft drinks (132)
Wine (67)
-
Molasses (92). refined sugar (128) -
Meat. fish, and shellfish
Grains and flour (120)
Beef (23,32,57,61), sausage (32). lamb (72). meat (5).fish (65.103) Beef (23). shellfish, (14)
Dairy products
Fermented and preserved foods
Cheese (127), yoghurt (126)
Soy sauce (87), brine (42)
-
Salads (9)
Dairy products (127)
Cocoa [fermented) (1011
Dairy products (127)
Olives (48)
-
Beef (23.32.61), sausage (711, seafood (59,65,103)
Soy sauce (87). salads (64)
(1001
Cryptococcus humicolus
Cryptococcus lourentii
Grapes (93). apples (101, tropical fruits (1001 Corn (35,76), strawberries (151, grapes 150)
Soft drinks (111) Wine (141)
-
-
Beef (23.32). seafood (65)
Dairy products (51
Cocoa (fermented) (1011
__
Must (491, wine (671, winery (11)
-
Grains (68.120)
Beef (32,57,61), lamb (72). seafood (65)
Cottage cheese (13). dairy products (5)
Salads (64)
Debammyces hansenii
Corn (35). Fruit juices grapes (50). (10,37,96,125) fruits (33,1291, tropical fruits (62,100)
Debammyces polymorphus Dekkero onomnla
Grapes (67)
Must (67.106), wine (34,701, beer 141, winery (11,341, baker's yeast (46)
Molasses (92). raw sugar (1,128), jam (60.129), syrups (22). confections (90)
Bread (3)
Beef (32,57,61), Milk (39). sausage YOghUfi (18,19.32,137), (126,127), ham (21). fish cheese (27,28,103.137), (40.44.45. shellfish 89,114,124, 127) (14.20)
Wine (70) Beer (4.53.961, Iambic beer
Dried fruit (73)
Dough (61
Sausage (71)
-
Cider (10) Soft drinks (58.96)
-
Soft drinks (96)
Beer (4,531, wine (67,701, Iambic (1351, must (93) Wine (34,671. beer (88)
Salad dressing (17). olives (48). brine (42), idli (1341, dosa (118). cocoa (fermented) (1011
-
-
-
-
-
-
Brine (12) -
(1351
Dekkero intermedia
Endomyces fibuliger
Tropical fruits
-
(100)
-
Dough (1091, bread (119)
L (D (D
Geeotrichum candidum
Corn (35). grape rot (521, tomato rot
Honseniaspom occidentalis
Apples (10). grapes (64)
Honseniaspom osmophila
Grapes (93)
Hanseniosporn uvarum
Grapes Fruit juice (33,54,75,102), (37,125,137), sofi fruits cider (10). (15,50,122,123), drinks (37) figs (69), oranges (133)
-
-
Fruit juice (105), palm sap (2)
-
WI Winery (31). Concentrated must (671, juice (137). wine (70) raisins (34) Apple juice (10) Must (49,637.93). wine (70) Must (49,63,106), wine (44,45,70, 1361, winery (31). beer (4,531
Dried figs (137)
-
-
Sausage (18.191, ham (21)
-
Cheese (38,40391, milk (391, yoghurt (137) -
Cocoa (fermented) (1011, fermented food (30,107) Cocoa (fermented) (1011 Cocoa (fermented) (1011 Cocoa (fermented) (1011 Cocoa (fermented) (101)
(continued )
TABLE I (Continued) Species Hyphopichia burtonii
Fresh fruits and vegetables Dates (108)
Nonalcoholic beverages Soft drinks (37) fruit juice
Alcoholic beverages Must (67)
High-sugar products
Grains and cereal products
Meat, fish, and shellfish
-
Grains (68). flour (120). bread
Ham (211, beef (23). seafood
11191
112.51
lssotchenkio orientolis
Corn (161, Soft drinks (84,111), fruit grapes (33.50). fruits juice (10,125) (122.123).
Issatchenkia terricolo
tropical fruits (100.137.138) Apricot (34)
Mango juice (1251
Kluyveromyces Ioctis
Figs (94)
Kluyveromyces marxianus
Fruits (122,123) Soft drinks (84) apple juice
Must (49,671, Molasses (92). wine (70,811, dried figs winery (31). (137) beer (88). baker's yeast (461 Must (49), winery (31) Sherry (67) Sugar cane (1)
Dough (121)
(651
Shellfish (14), poultry (591
-
Sausage (19)
-
Beef (23)
0 0
(961
Kluyveromyces thermotolernns
Grapes (64)
Lodderomyces elongisporus
Grapes (93)
Fruit juice
Molasses (92). sugar cane (1,8),dried figs (137)
Wine (67.70)
Raw sugar (1371, marzipan (128). raisins
(10.96)
1129)
Metschnikowia pulcherrima
Grapes (75,1021 fruits (10,33,62.122. 123).corn (35)
Soft drinks (96.1 11,112) Cider (10).
mango juice (125)
Concentrated juices (137) Wine (54,55,70), Raisins (34) winery (311, must (67) Must (141)
Fermented and preserved foods
Dairy products (127).cheese (25,139)
Fermented fish (1071, SOY sauce (871, tape (301, silage (82) Cocoa (fermented) (10,101), brine (34,42,137), idli (134)
Yoghurt (51). cheese (139)
-
N
Must (1061, wine (671, beer (4,881
Dairy products
-
-
Shellfish (14). beef (23)
Sausage (19)
Fermented food (1131
Yoghurt (126). cheese (25,114,124). cream (137) Cocoa Kefir (25,41), (fermented) yoghurt (511. cheese (1101 (25,38,40, 45,114,131) Cheese (25)
-
-
Pichio anomolo
Corn (16.35). Fruit juice grapes (33,341, (37.105). soft fruits drinks (10,100,122, (111.112)
Wine (34.54.67, 70.78), winery (311,beer (53,961
Dried fruits (731,
Grains (68).flour (1201
molasses
Poultry (59,137). sausage (71). shellfish (14)
Cheese (127). yoghurt (127)
(92).
confections
123)
1129)
Pichio conodensis
Must (67). wine (70)
Pichio etchellsii
-
Pichio farinoso
Figs (94). apples
FNit juice (37)
-
(10)
Concentrated juices (137)
Wine (34,67). palm sap (2) Wine (34,671, palm sap (2)
Grains (120)
-
-
-
Flour (68)
Beef (32) -
Olives (12,481, tape (30). idli (134). pickles (24). cocoa (fermented) (101).soy sauce (87) Pickles (24). silage (82). tape (30) Olives (48) Soy sauce (871, cocoa (fermented) (1011
Pichia fermentons
Oranges (1331,
Soft drinks (96,1301, apple juice (10)
N
s
Pichia guilliermondii
Pichia jadinii
Pichia membmnoefaciens
Corn (351, figs (137), fruits (1OSO) -
Grapes (33.75.93).
fruits (34,69,94,137),
corn (16)
Must (67). wine (34.70.78), beer (53)
Wine (67,70), palm sap (2). beer (88) (111,112,130) Apple juice (10) Must (67). wine (34,701, beer (4,53). baker’s yeast (46) FNit juices Must (67.93), (96,111,112, wine (31.34.70, 125) 781, beer (4,53). cider Fruit juices (37). soft drinks
Raisins (34). molasses (92). raw sugar (137) Refined sugar
Wheat (68)
-
(128)
Beef (571, shellfish (14)
Cheese (89). milk (131)
(641
Sausage (711, seafood (65), shellfish (14)
Concentrated juices (128)
Dairy products
Pickles (34), brine (n), olives (48) Pickles (34)
1127)
Cane sugar (1). Bread (119). flour molasses (120) (92). raisins
Fish (59,103). beef (32)
Cheese (40.89)
Salads (13,961, olives (48). brine (12). cocoa (fermented]
Cheese (131)
Brine (12,137)
Dairy products
Tape (30), brine
(341
(101
Palm sap (2). must (49,67)
Pichio ohmeri
Cocoa (fermented) (101)salads
(1011
Raw sugar (1371.
confections 11291
Pichio subpelliculoso
Apples (10)
Winery (11). must (67,101)
Raw sugar (1371, dried fruits (73)
Dough (6)
-
(127)
(42,137) ~
(continued)
TABLE I (Continued) Species
Fresh fruits and vegetables
Nonalcoholic beverages
Rhodosporidium infirmominiatum
Corn (35)
Rhodotomla glutinis
Grapes (75.93) Orange juice 171 hits (10.15,33,100). corn (35)
Rhodotomlo minuta
Grapes (67,931
Apple juice (10)
Rhodotomlo mucilaginosa
Corn (35,761,
Orange juice (7)
-
Alcoholic beverages
High-sugar products
Grains and cereal products
Winery (11)
-
-
Palm sap (21, must (67,106), winery 111,311,wine (701.beer (4). baker's yeast (461
-
Wheat (681,flour (120)
-
-
Wine (34.67,70). winery (11,311, baker's yeast (46)
-
-
Must (36,641. wine (43)
-
nks
Must and wine (34,54,55, 63,74,79, 93.106.136). palm sap (21, sake (66).beer 188.1041
N
0
N
fruits (10,15,96,100]
Sacchammyces bayonus
Grapes (36.64)
Sacchammyces cerevisiae
Grapes (31,3334, 64,751, tropical fruits (100,137)
soft
(47,971
-
Honey (95). Dough (6,1091, raisins (1291, bread (119). confections flour(120) (90).apple concentrate (34)
Meat, fish, and shellfish
Dairy products
Fermented and preserved foods
Beef (23.61). lamb (72). seafood (65) Beef Milk (1241, (23,32,57,61), cheese (38). fish Yo&& (1261 (5,27.59,103), poultry (137). seafood (5665)
Salads (64)
Beef Dairy products (23.32.57.61). (1271 sausage (8.71). fish (103). poultry (591 Sausage (18.71) Cheese (131: fish (27.59.103). meat (23.32,57). shellfish (56,65)
Olives (48). salads (64)
-
Poultry (59). shellfish ( 2 0 )
Olives (48). salads (64)
Salads (64). salad dressing 1171
Cocoa (fermented] (101) Cheese (25,1241, Cocoa kefir (41). (fermented) YOghUrt (101.110). fermented fish (51,126) (1071,dosa (1181,olives (48.137),salad dressing (17) -
Soacchammyces exiguus
Cherries (96)
Softdrinks (111)
Must and wine
Molasses (128)
Bread (119). dough (86,109)
Poultry (59,1371, shellfish (14), beef (23)
-
-
-
(67.70.741. beer (4,88,96)
Kefir (41)
Cocoa (fermented) (101), idli (134). brine (42). salads 19.13)
Soacchammyces kluyveri
Grapes (34)
Soft drinks
Sacchammycodes ludwigii
Grapes (50)
Apple juice (10)
Wine (34.67,70)
Olives (12)
(112,130)
Must (49,124), wine (55,67,70,80),
cider (101, palm sap (21. beer (41 Must (67)
Schizosocchmmyces octosporus
Candies (1371, honey (95). molasses
Filled bakery goods (116)
(1291 N 0
Schizosacchoromyces pombe
Grapes (36.75)
Must (36.124), wine (67), palm =P (21
Raisins (341, cane juice
Filled bakery goods (116)
-
(1371.
Cocoa (fermented) (1011
molasses Spombolomyces roseus
Rice (15,851, corn (76). fruits
ToNlaspom delbrueckii
Grapes (50,671, apple (10,961
Wine (141)
(92.129) -
-
Sausage (71)
Cheese (13)
-
(10,15,33,100)
Trichospomn cutaneum
Grapes (341, apples (101, oranges (137)
Soft drinks (111.112)
Must (74.106). wine
Orange concentrate
l54,70,831,
(601,
winery (11,341
molasses (92.95). raw sugar (137). honey (95). raisins (129)
Must (67). baker's yeast 1461
-
Bread (3,119)
-
Cheese (25,139)
Cocoa (fermented) (101).brine 142)
-
Sausage ~18.19.211, beef (23). fish 1591
Milk (39)
Cocoa (fermented) (101). dosa (118),salads (641, dressing 1171
(continued )
TABLE I (Continued) Species Trichosporon pullulons
Fresh fruits and vegetables Fruits (10,341
Nonalcoholic beverages Mango juice (1251
Alcoholic beverages Winery (311, must (67)
High-sugar products -
Grains and cereal products Grain and flour (1201
Meat, fish, and shellfish
Dairy products
Beef (32.57.61). ham
__
l21.23.711. lamb (72).fish
(1011.
(14.20.65)
-
Yorrowio lipolytica
Strawberries
N
0
Zygosocchoromyces boilii
&
Molasses (92)
-
-
-
-
-
(111,112)
(961
Zygooscus hellenicus
Soft drinks
Winery (31). wine (67) Wine (67)
Grape rot (52) Grapes (33.67). fruits (10.34)
Soft drinks (140) Must (49,671, Soft drinks (97,111)* fruit juices (61.96)
wine (141) Must (74).wine (34.67.70, 77,78,79.136), palm sap (2)
Fruit concentrate
Bread (119)
Beef (23.32)
-
Dairy products
(1271 Beef (5,32.57.61), Milk (124). sausage (71). cheese seafood (65) (5.13.25.40) Beef (57). shellfish (14)
-
Cocoa (fermented) fermented food (113). idli (1341, salads (64)
(28).shellfish
Wickerhamiella domercqioe
Fermented and preserved foods
-
Salads (64,961, mayonnaise (831
-
Salad dressing (96.1171.
(34,67,128),
pickles (42.1371.
dried fruits l137), molasses
cocoa (fermented) (~OI), salads
(921
19)
Zygosocchoromyces bisporus
Grapes (67). apples (10)
Soft drinks
Wine (70)
(111,112)
lam (961. syrups (22). raw sugar
Filled bakery goods (116)
(101)
(1371.
molasses (129).fruit concentrate Zygosocchoromyces fermentati Zygosacchoromyces microellipsoides
Grapes (64)
Soft drinks
Must (106)
(1281 -
-
(96,111,112) -
Soft drinks (84,111,112, 130).fruit juices (96)
Must (67).wine (1411
Molasses (92)
Cocoa (fermented)
Flour (68)
Zygosocchommyces rouxii
Grapes (34)
-
Wine (34,671
Syrups (22,26,60,
1371, molasses (92,129). raisins (1291, marzipan
Filled bakery goods (116)
Beef (23)
-
Cocoa (fermented) (101). fermented fish (107), SOY sauce (871, brine (42)
(60).
confections (901
Numbers in parenetheses are references: (1)Andersonet al. (1988); (2)Atputharajah et al. (1986); (3)Azar et al. (1977);(4) Back (1987); (5) Banks and Board (1987);(6) Barber et al. (1983);(7) Barreiro et al. (1981); (8)Barwald and Hamad (1984); (9) Baumgart (1982);(10) Beech and Carr (1977); (11)Belin (1979);(12) Brackett (1987);(13) Brocklehurst and Lund (1985); (14) Buck et al. (1977); (15) Buhagiar and Barnett (1971);(16) Burmeister and Hartman (1966); (17) Cantoni and Comi (1988); (18) Comi and Cantani (1980a); (19) Comi and Cantoni (1980b); (20) Comi and Cantoni ( 1 9 8 0 ~ )(21) ; Cami and Cantoni (1983);(22) Comi and Cantoni (1984);(23) Comi and Cantoni (1985); (24) Comi et al. (1981a); (25) Comi et al. (1981b);(26) Comi et al. (1982); (27) Comi et al. (1984);(28) Comi et al. (1983); (29) Crisan and Sands (1975); N
cn
(30) Cmnket 01. (1977); (31) Cuinier (1980); (32) Dalton et al. (1984);(33) Davenport (1976); (34)Dehk (1988);(35) Deakand Beuchat (1988);(36) Delfini (1985); (37) Dragoni and Comi (1985); (38) El-Bassiony et al. (1980);(39) Engel (1986a); (40) Engel (1986b); (41) Engel et al. (1986); (42) Etchells et al. (1975);(43) Farris and Ruggin (1985); (44) Fleet et al. (1984); (45) Fleet and Mian (1987); (46) Fowell(l965);(47) Gardini and Guerzoni (1986);(48) Garrida Fernandez et al. (1985); (49) Goto (1980);(50) Goto and Yokotsuka (1977);(51) Green and Ibe (1987); (52) Guerzoni and Marchetti (1987);(53) Hardwick (1983); (54) Heard and Fleet (1986a); (55)Heard and Fleet (1986b); (56) Hood (1983); (57) Hsieh and Jay (1984); ( 5 8 )Ison and Gutteridge (1987);(59) Jay (1987); (60)Jermini et al. (1987); (61) Johamsen et al. (1984); (62)Juven et al. (1984); (63) Khayyat et 01. (1982); (64) Kobatake and Kurata (1980b); (65) Kobatake and Kurata (1980a);(66) Kodama and Yoshizawa (1977); (67) Kunkee and Goswell (1977); (68) Kurtzman et al. (1970); (69) Lachaise (1977); (70) Lafon-Lafourcade (1983); (71) Leistner and Bem (1970); (72) Lowry and Gill (1984); (73) Madan and Gulati (1980); (74) Mauricio et al. (1986);(75) Messini et al. (1985);(76)Middelhoven and van Baalen (1988); (77) Mindrik (1980); (78) Mintirik (1981);(79) Mintirik (1983); (80)Mindrik and Navara (1977);(81)Moline (1984);(82) Moon and Ely (1979);(83) Muys (1971); (84) Muzikar (1984); (85)Nakase and Suzuki (1985); (86) Ng (1976);(87) Noda et al. (1982); (88)Novellie and de Schaepdrijver (1986);(89) Nunez et al. (1981); (90).OrszAghova and Kieslingerovd (1984); (92) Parfait and Sabin (1975);(93) Parish and Carol1 (1985);(94)Pignal et al. (1985);(95) Poncini and Wimmer (1986); (96) Put et al. (1976); (97) Put and De Jong (1982b); (100) Rale and Vakil(1984);(101)Ravelomanana et 01. (1985); (102)Rosini et al. (1982);(103) Ross and Morris (1965); (104) Rbcken (1983); (105) Rockenet 01. (1981); (106) Ruizet al. (1986); (107)Sakai et al. (1983);(108) Saliket al. (1979); (109) Salovaara and Savolainen (1984); (110) Sanchez et al. (1984); (111)Sand (1974); (112) Sand et al. (1976); (113) Sandhu and Waraich (1984);(113a) Sand and van Grinsven (1976b);(114) Schmidt and Lenoir (1980); (115) Seham et al. (1982); (116) Seiler (1980); (117) Smittle and Flowers (1982); (118) Soni et al. (1986); (119) Spicher (1986); (120) Spicher and Mellenthin (1983); (121) Spicher et al. (1979); (122) Stallarovd (1976); (123) Stollarovh (1982); (124) Suarez and Inigo (1982); (125) Suresh et al. (1982); (126) Suriyarachchi and Fleet (1981);(127) Tilbury et 01. (1974); (128) Tilbury (1976);(129) Tokouka et al. (1985); (130) Torok and Deik (1974);(131) Tzanetakis et al. (1987); (132) Uchida et al. (1980); (133) Vacek et al. (1979);(134) Venkatasubbaiah et 01. (1985);(135) Verachtert and Dawoud (1984); (136) Vojtekovi and Minirik (1985); (137) Walker and Ayres (1970); (138) Warnasuriya et 01. (1985); (139) Zein et 01. (1983);(140)Kreger-van Rij (1984); (141) Barnett et 01. (1983).
206
T.DEAK
groups were common to all stages of apple and grape development and these could be considered as resident microorganisms. These possess characteristics that enable them to survive and reproduce on the plant habitats. The main resident species on apple are H. uvarum, Metschnikowia pulcherrima, D. hansenii, Sporobolomyces roseus, and Cryptococcus albidus. Yeast phases of Aureobasidium pullulans and Cladosporium herbarum (black yeasts) are also permanent members of the microflora. Mature and sound grapes harbor most frequently M. pulcherrima, H. uvarum, Candida stellata, D. hansenii, Rhodotorula glutinis, P. membranaefaciens, 1. orientalis, P. anomala, S. cerevisiae, and Z . bailii. In contrast to the resident organisms, a large number of various species may become transient members of the microflora. Their occurrence depends mostly on dissemination by animal vectors and they can survive if conditions are favorable. About 20 to 30 species have been reported as transients from apples and grapes [Davenport, 1976). Extensive research has been conducted on the distribution of yeasts on grapes (Davenport, 1974; Goto and Yokotsuka, 1977; Rosini et al., 1982; Messini et al., 1985). The flora consists of both fermentative and oxidative species, represented by H. uvarum and M. pulcherrima, respectively. Although a number of other yeasts can also be found on the skin of the grapes (e.g., C. albidus, R. glutinis, D. hansenii, C. stellata, and P. membranaefaciens), S. cerevisiae is not among the main resident organisms and its population increases only after the grapes begin to mature. Studies of grape yeasts have been mostly conducted in connection with the fermentation of must, and will be considered further in a discussion of wine yeasts. Detailed investigations on the frequency and dominance of natural yeast species on various fruits grown in temperate zones (cherries, red and white currants, and plums) showed that H. uvarum, M. pulcherrima, and Candida vini formed the permanent and ubiquitous cornponent of the associations. Additionally, s. cerevisiae, P. anomala, K. marxianus, C. stellata, I. orientalis, and Candida zeylanoides were found frequently (StollarovB, 1976, 1982). Strawberries appeared to differ from other fruits in the predominance of cryptococci. Buhagiar and Barnett (1971) found C. albidus (45Y0), Cryptococcus laurentii (32%), and Cryptoccus macerans (7%) among the yeast isolates from sound strawberries, with Candida fragariorum, H. uvarum, and R. glutinis (2-4% each) and five other species in the minority. The dominant species, i.e., Hanseniaspora guilliermondii, M. pulcherrima, and D. hansenii, from a Mediterranean fruit, pomegranate, were similar to those found on fruits of temperate zones (Juven et al., 1984). Tropical fruits (pineapple, banana, kiwi, papaya, etc.) harbored a
FOODBORNE YEASTS
207
mixed yeast flora consisting of P. anomala, Pichia guilliermondii, Pichia sydowiorum, T. delbrueckii, Candida versatilis, and Candida apicola as well as species commonly found on other fruits, S. cerevisiae, H. guilliermondii, R. glutinis, and C. albidus (Tokouka et al., 1985; Rale and Vakil, 1984; Warnasuriya et al., 1985). Lachaise (1977) found in figs a specialized yeast, Candida fructus, but the fermentative spoilage was caused by P. guilliermondii, P. membranaefaciens, Hanseniaspora valbyensis, H. uvarum, Candida sorboxylosa, C. stellata, and I. orientalis. Pignal et al. (1985) showed an intimate interaction between the yeast flora of figs and the fruit-inhabiting drosophilas. Common species were H. valbyensis, P. membranaefaciens, Endomycopsella vini, Candida pseudointermedia, and others. Spoilage of fresh fruits usually results from the fermentative activity of yeasts; nevertheless, a wide variety of poorly or nonfermenting yeasts have been described from rotting oranges, mangos, and dates (Vacek et al., 1979; Salik et al., 1979; Suresh et al., 1982). Species such as M. pulcherrima, D. hansenii, I. orientalis, Hyphopichia burtonii, Trichosporum cutaneum, and others were frequent; however, the fermentation was brought about by H. uvarum or H. valbyensis, P. guilliermondii, Pichia fermentans, Pichia kluyveri, and to a lesser extent S. cerevisiae. Yeasts are also normal colonizers of vegetables, although the predominant microorganisms on healthy, fresh vegetables are usually bacteria. Yeast activity becomes apparent when circumstances become favorable to them, e.g., during the lactic acid fermentation of vegetables (see later). Yeast populations on vegetables range from less than lo3 up to and above lo6 per gram. Basidiomycetous yeasts usually dominate the population; among them several new species have been described, e.g., Bullera crocea and Bullera armeniaca on cauliflower and cabbage (Buhagiar et al., 1983). Fresh corn was mainly inhabited by Rhodotorula ingeniosa, C. laurentii, S. roseus, Sporidiobolus salmonicolor, and R. rubra (Middelhoven and van Baalen, 1988). Besides the predominating basidiomycetous yeasts (R. rubra, R. glutinis, C. albidus, and C. laurentii) Deak and Beuchat (1988) also found a range of fermenting ascomycetous yeasts on sweet corn, although they were present as a minority in the population (H. uvarum, C. intermedia, Candida oleophila, P. guilliermondii, and 10 other species). In agreement with the preceding findings, Nakase and Suzuki (1985) found ballistospore-forming basidiomycetous yeasts in 86% of all yeasts on leaves and stems of the rice plant. Sporobolomyces roseus, B. crocea, and Bullera alba were the most frequent, with some Bullera strains
208
T. DEAK
probably representing yet undescribed species. Although the yeasts, with few exceptions, are not capable of attacking plant tissues, certain yeasts have been associated with decay of fruits and vegetables. Best known is the role of Geotrichum candidum in causing sour rot in tomato (Moline, 1984), but certain other yeasts (H. uvarum, C. stellata, I. orientalis, and E. vini) have been associated with sour rot disease of grapes (Guerzoni and Marchetti, 1987). It should be warned that fresh fruits and vegetables may transmit human pathogenic yeasts. Of 254 vegetable and 186 fruit samples from markets in Delhi, 5 contained Cryptococcus neoformans (Pal and Mehrotra, 1985). Candida albicans (as its synonym Candida stellatoidea) has been reported on grapes (Parish and Caroll, 1985).
B. FRUITJUICES AND SOFTDRINKS Microbiological spoilage of nonalcoholic beverages is mostly due to yeasts. This is because soft drinks meet the growth requirements of yeasts while providing an unsatisfactory ecological niche for most other microorganisms (Berry, 1979; Deak, 1980). Yeast growth shows up as sediment, haze, deposit, and off-taste. If fermentation occurs, it may result in blowing up of cans or exploding of bottles. The cause of spoilage can rarely be ascribed to fruit juice concentrates or syrups and other ingredients, but more often it is found in the processing line itself. Critical foci of contamination are the proportioning pumps, holding tanks, and bottle washers (Sand et al., 1976). Based on 3600 samples collected during a 4-year period, Sand (1974) established a relationship between the keeping quality of soft drinks and contamination of the processing equipment. Yeasts occurring most frequently in line samples were also found in bottled beverages. Candida species boidinii, intermedia, sake, apicola, and parapsilosis and P. anomala and Yarrowia lipolytica were isolated in high frequency from raw materials. Torulaspora delbrueckii, consistently occurred on equipment and raw materials but was rarely encountered in bottled beverages. Spoilage was caused most frequently by S. cerevisiae, which originated mainly from materials used for beverages. Sand and van Grinsven (1976a,b) made a comprehensive study of bottled beverages produced in various countries. They isolated some 30 species; the most frequent isolates were S. cerevisiae, Z. bailii, Z. bisporus, Zygosaccharomyces florentinus, Zygosaccharoromyces fermentati, Zygosaccharomyces microellipsoideus, C. stellata, C. parapsilosis, Brettanomyces naardensis, Dekkera intermedia, and P. anomala. Torok and Deak (1974) isolated, in decreasing order of their frequencies, S.
FOODBORNE YEASTS
209
cerevisiae, P. fermentans, Candida lambica, and Saccharomyces kluyveri from Hungarian soft drinks. Zygosaccharomyces rouxii, Z. microellipsoideus, and P. guilliermondii were represented by single isolates. Muzikar (1984),summarizing results of many years of study of nonalcoholic beverages, also stated that the most frequent yeasts found were T. delbrueckii, Z. microellipsoideus, D. hansenii, Candida inconspicua, C. vini, and I. orientalis. Dragoni and Comi (1985)reported that 40% of natural juices made from peaches, pears, and apricots was contaminated by yeasts, most frequently by H. uvarum, D. hansenii, Candida haemulonii, P. guilliermondii, and Pichia etchellsii, whereas P. anomala, H. burtonii, T. delbrueckii, Z. rouxii, Z. bisporus, and Z. bailii occurred occasionally. By combining the addition of preservatives and a mild heat treatment (pasteurization), the storage life of soft drinks can be greatly increased. The necessary heat treatment can be based on the heat resistance of the spoilage yeasts. This topic has been intensively studied by Put et al. (1976) and was discussed earlier in this review. The spoilage potential has been evaluated in model fruit drink systems (Gardini and Guerzoni, 1986; Cole et al., 1987; Ison and Gutteridge, 1987) and from these studies it can be concluded that the most notorious spoilage organisms in nonalcoholic beverages are S . cerevisiae, D. anomala, and Z. bailii for their high resistance to pH, COz pressure, preservatives, and heat. C. ALCOHOLIC BEVERAGES Production and consumption of alcoholic beverages have continuously aroused the interest of human beings since the earliest times. A tremendous variety of these drinks has evolved and yeasts are the principal contributors in the production of each of them. The most important beverages are, also from an economic viewpoint, wine, beer, and distilled spirits (Rose, 1977). 1. Wine
Wine microbiology has been the subject of a large number of studies. Much interest has been focused on the composition and succession of yeast flora on ripening grapes, in the course of fermenting must, in the bottled wine, and also in and around the winery and wine cellars. Several reviews have appeared on these topics (Kunkee and Goswell, 1977;Lafon-Lafourcade,1983;Goswell, 1986b).A list of yeasts found on grapes, in must, in wines, and on winery equipment has been compiled by Kunkee and Amerine (1970)and was revised and updated by Kunkee and Goswell (1977) and Lafon-Lafourcade (1983).
210
T. DEAK
After crushing, grapes contain a large number of yeasts. Numerous studies on the growth of yeasts during wine fermentation have shown that the early to middle stages of must fermentation are dominated by a mixed flora of non-Saccharomyces yeasts indigenous to grapes, such as H. uvarum, C. stellata, 1. orientalis, M. pulcherrima, and P. anomala (Davenport, 1974; Rosini et al., 1982; Fleet et al., 1984; Parish and Caroll, 1985; Heard and Fleet, 1986a). The yeast flora follows a definite succession during fermentation, which can be characterized by one or more dominating species. The determining factor in the composition of the yeast flora is the increase of alcohol concentration after the onset of fermentation. Hanseniaspora uvarum predominates in early stages of must fermentation in Middle European and California wineries, whereas other apiculate yeasts, such as Hanseniaspora osmophila, are commonly found in early must from grapes of warmer regions, e.g., Spain, Southern Italy, Israel, and the southeastern United States (Parish and Caroll, 1985). In Japan, H. uvarum also represents the major yeast in must, making up 40 to 72% of the population. Candida stellata is also widely distributed (13 to 19%). Metschnikowia pulcherrima, reported as a major yeast in musts in Europe, was isolated in small numbers only (Goto and Yokotsuka, 1977). Addition of sulfur dioxide brings about a rapid decrease in total counts of yeasts and a reduction in wild yeast species. Saccharomycodes ludwigii was, however, isolated in high frequencies from sulfited must (Minarik and Navara, 1977; Goto, 1980). Saccharomyces cerevisiae rarely occurs in large numbers in early must. Its main sources are the surfaces of various winery equipment rather than grapes (Belin, 1979; Cuinier, 1980; Rosini et al., 1982).As the fermentation progresses, wild yeasts die off due to their sensitivity to ethanol at concentrations of 2-6% (v/v), but S. cerevisiae proliferates and completes the fermentation (Fleet et al., 1984). This general picture does not change much even if starter strains of S. cerevisiae have been inoculated (Heard and Fleet, 1985). However, as the temperature of fermentation increases above 25OC, S. exiguus and Z . bailii become dominating (Mauricio et al., 1986), and if the temperature decreases to 10°C, the growth and survival of non-Saccharomyces yeasts may greatly increase (Heard and Fleet, 1988). Studies carried out in different part of the world on the natural succession of species during fermentation revealed the same general pattern; however, minor differences can be noted (Ethiraj et al., 1979; Vojtekovti and Mintirik, 1985; Ruiz et al., 1986; Heard and Fleet, 1986a). After the completion of fermentation, any further yeast activity is harmful to the quality of wine. The majority of yeasts are removed from
FOODBORNE YEASTS
211
wine by racking, filtration, and other cellar procedures. If the wine is kept in bulk, spoilage may be caused by Dekkera species and S. ludwigii; both impact the flavor of the wine (Goswell, 1986b).The major spoilage yeasts in wine stored in tanks or barrels are film-forming species such as C. vini, C. zeylanoides, Candida rugosa, 1. orientalis, and P. membranaefaciens (Minarik, 1981). It is to be noted that a special type of wine (sherry) can be produced if the wine is kept under a film of yeast that is composed of special biotypes of S. cerevisiae (Farris and Ruggin, 1985; Sancho et al., 1986; Goswell, 1986a). In the bottle, even a very moderate growth of yeast is unacceptable because it results in clouds, deposits, and poor flavor. Production lines are usually contaminated by various yeasts that can get into the bottled wine. In addition to Z. bailii, frequent spoilage yeasts in bottled wine are S. cerevisiae, C. rugosa, P. membranaefaciens, C. vini, and others (Minarik et al., 1983). Many studies have been carried out to determine the spoilage potential of these yeasts and to assess the maximum acceptable number of yeast cells in wine. The main inhibitory factor to yeast growth is ethanol content. Wild and wine yeasts are usually inhibited at 12% ethanol, but Z. bailii is more tolerant. Moreover, it shows a pronounced resistance to food preservatives (Thomas and Davenport, 1985). Zygosaccharomyces bailii contamination originates partly from habitats in the winery (Minarik, 1983), but mainly from concentrated grape juice used in wine production (MinBrikand Hanicovh, 1982). This species can be considered the main causative agent of serious spoilage of bottled wine (Minarik, 1980).It has been demonstrated that only a few viable cells in a bottle of wine may be sufficient to cause spoilage (Deak, 1986b). 2. Beer
The two main types of beer, lager and ale, are fermented with different strains of yeasts that have traditionally been considered separate species of Saccharomyces, uvarum (S. carlsbergensis) and cerevisiae, respectively. The two types can be distinguished by physiological differences. Lager yeast is a bottom fermentor and has the ability to produce an extracellular enzyme, a-galactosidase, with which it ferments the disaccharide melibiose and the trisaccharide raffinose. The top-fermenting S. cerevisiae is unable to ferment melibiose; only the fructose part of the raffinose molecule is fermented after splitting by invertase. In addition, lager strains tend to flocculate and settle at the bottom of the fermenter and top-fermenting strains are less flocculant. Though the latter are able to ferment at higher temperatures (up to 37-38"C), the lager yeasts exhibit a maximum of 34°C (Stewart, 1987).
212
T. DEAK
Though these differences are straightforward regarding the industrially used brewing strains, there is a problem classifying them on the basis of minor and inconsistent physiological differences as contrasted with the high degree of DNA relatedness. Based on DNA homology, taxonomists have lumped a number of former Saccharomyces species into one, S. cerevisiae (Kreger-van Rij, 1984). Recently, however, redetermining DNA relatedness, Vaughan-Martini and Martini (1987) reestablished the species Saccharomyces bayanus and suggested that Saccharomyces pastorianus (S. uvarum, S. carlsbergensis) may represent a natural hybrid between this and S. cerevisiae. Owing to its low pH (about 4.0),the boiling of wort, and the addition of hops, beer is an inhospitable medium for most bacteria, and only some lactic acid bacteria and wild yeasts can grow in it. Wild yeasts produce turbidity and flavor defects. One of the most obnoxious wild yeast contaminants is Saccharomyces diastaticus (now considered as a biotype of S. cerevisiae), which can ferment the dextrins of beer and produce an off-odor as well. Postcontamination of beer rarely causes serious problems; contamination of pitching yeast is, however, a great risk, and wild yeasts at this stage are less readily distinguishable. A number of methods suitable for identification of such infecting organisms have been developed, and these will be mentioned later. Wild yeasts can be divided into two groups: Saccharomyces and non-Saccharomyces. Of 120 strains of wild yeasts, Back (1987) identified 18 species other than Saccharomyces, and two Saccharomyces species other than S. pastorianus. The latter were S. exiguus and S. cerevisiae (nonbrewing strains, previously called S. bayanus, S. chevalieri, S. ellipsoideus, and S. diastaticus). The most frequent other yeast species were P. anomala, P. membranaefaciens, D. hansenii, C. sake, R. glutinis, and Dekkera claussenii. Ale and lager beer are not only made by different strains of brewery yeasts, but also differ in wild yeast contamination. In top fermentation, the most frequent wild yeasts are Pichia media, C. vini, and Candida ishiwadae; the bottom-fermenting strains are S. cerevisiae (Rocken and Marg, 1983). The commonest procedure for preservation of beer is heat pasteurization. Canned and bottled beers are pasteurized at about 60°C, for a time sufficient to destroy vegetative bacteria and yeasts. In draft beer sold in vats or barrels unpasteurized, a broader variety of wild yeasts may develop and cause problems if the beer is not kept cold enough. The majority of spoilage yeasts are Saccharomyces species, and only 20-30% of wild yeasts are members of other genera, such as Dekkera lintermedia, anomala, claussenii, and lambica), Candida (inconspicua and vini), Pichia (fermentans, membranaefaciens, jadinii, and
FOODBORNE YEASTS
213
anomala), H. uvarum, D. hansenii, and T. delbrueckii (Rocken, 1983; Back, 1987; Lawrence, 1988). Lambic is a special Belgian beer with a sour taste obtained by spontaneous fermentation of a grain mash made from barley and wheat. Microorganisms that are considered spoilage organisms in classical beer production are considered here as necessary and normal microbes that contribute to attaining the typical lambic flavor. The fermentation starts with maltose nonfermenting yeasts (e.g., Hanseniaspora spp.); the main fermentation is dominated by S. pastorianus and other Saccharomyces species, and during the long period of lagering, Dekkera (Brettanomyces) species determine the development of flavor (the most frequent Dekkera species are anomala, intermedia, lambica, and abstines) (Verachtert and Dawoud, 1984). Another type of drink is sorghum beer, a traditional African beer made by lactic acid and alcoholic fermentation. A quite varied yeast flora has been found in sorghum beer, although S. cerevisiae usually predominates. Sometimes S. exiguus is the dominant yeast. These are accompanied by a moderate population of a number of other yeasts, such as K. marxianus, P. guiIIiermondii, Endomyces fibuliger, I. orientalis, C. rugosa, Clavispora Iusitaniae, Pichia fabianii, Candida tropicalis, P. membranaefaciens, D. hansenii, and Geotrichum capitatum (Novellie and de Schaepdrijver, 1986). 3. Other Alcoholic Beverages
There are many alcoholic beverages fermented from fruit juices other than grape must or brewed from cereals other than barley. They are mainly of regional types and are called various names, such as sake, ginger, cider, toddy, pulque, etc. These have been reviewed by Rose (1977) and Stewart (1987), and only a few recent publications will be cited here. Sake is the traditional alcoholic beverage in Japan prepared from a steamed rice mass (moromi) digested first by molds (koji) then fermented by yeasts (Kodama and Yoshizawa, 1977). The starter (moto) contains a special variety of S. cerevisiae, which differs from the brewer’s, wine, distillery, and other industrially used S. cerevisiae races. Cider is the fermented juice of apples produced in England and also in some countries of continental Europe, in the United States, and in Australia. Beech and Davenport (1970a) and Beech and Carr (1977) published comprehensive reviews on the role of yeasts in cider making. Similar to the fermentation of grapes, the yeasts of significance in cider making are the weakly fermenting H. uvarum and the strongly ferment-
214
T.DEAK
ing S . cerevisiae. In the pressed fruit juice and in the early stages of fermentation, a number of other yeasts, M. pulcherrima, S . ludwigii, and Dekkera spp. may be found. If concentrated juice is used, Z. bailii and Z. rouxii also occur. Film yeast, e.g., P. membranaefaciens, can often be found on the surface of cider stored in woden vats. However, under good manufacturing practice most spoilage problems can be avoided. Certain yeasts, however, are the cause of disorders even in the best managed factories. Carr (1984)points out that H. uvarum imparts an off-flavor, and S . ludwigii causes a spoiled appearance in bottled cider. A variety of palm wines are produced in subtropical and tropical regions. Atputharajah et al. (1986)demonstrated that S.cerevisiae dominated in coconut palm sap (toddy) fermentation. In addition, a wide range of yeast occurred, of which Pichia ohmeri, S . pombe, P. guilliermondii, P. membranaefaciens, Candida valida, C. parapsilosis, and Hanseniaspora occidentalis were frequently found. Yamagata et al. (1980)isolated 925 yeast strains from coconut and nipa palm wine (tuba), of which 584 strains were S.cerevisiae. It can be considered the dominant yeast species associated with palm sap. This topic is reviewed in more detail by Okafor (1978). Basic alcoholic fermentation is also brought about by S . cerevisiae in the production of distilled spirits. Different types of cereal grains (malted and unmalted barley, corn, and rye) serve as raw materials for the fermentation of whiskies. Distilleries have their preferred yeast strain of S. cerevisiae. Rum is fermented from cane juice, syrup, or molasses primarily by S . cerevisiae; however, S . pombe is best suited for the fermentation of rums with a heavy aroma (Bluhm, 1983).
D. HIGH-SUGAR PRODUCTS Traditional dried foods (e.g., dehydrated vegetables, flour, pasta, and milk powder) generally contain less than 25% moisture and have an a, less than 0.60. These are shelf-stable for an indefinite time provided they remain dry. Among these are several high-sugar products, such as cookies, toffees, candies, chocolates, and refined sugars. Other foods contain between 15 and 50% moisture and have an a, between 0.60 and 0.85.These are called intermediate-moisture foods, and usually they are also stable at ambient temperature for a long period (Jay, 1978).Many high-sugar-containing foods fall into this category, e.g., honey, jam, marmalade, marzipan, jelly, fudge, dried fruits, fruit concentrates, and fruit syrups. Certain other intermediate-moisture foods (fermented sausage, dry cheese, soy sauce) will be mentioned in their respective groups
FOODBORNE YEASTS
215
of foods. The stability of high-sugar products depends on a number of factors, including a,, pH, presence of preservatives, mode of packaging, and conditions of storage. In any case, they are susceptible to spoilage only by xerophilic molds and xerotolerant yeasts (Corry, 1987; Tilbury, 1980a,b). At low a, values the growth rate of these organisms is very slow, hence spoilage in products may become apparent only after many months ( Jermini and Schmidt-Lorenz, 1987a). If, however, a high-sugar product is stored in an atmosphere of high relative humidity, a slightly diluted surface layer develops due to hygroscopy and this may permit a significantly faster growth. Earlier investigators reported strains of many yeast genera as spoiling agents of low-a, products (Onishi, 1963). This was partly due to the great confusion in the nomenclature and taxonomy of these yeasts and partly to the uncertainty of measuring and expressing the degree of sugar tolerance (Jermini et al., 1987; Jermini and Schmidt-Lorenz, 1987a). However, the most frequently isolated strains from high-sugar products have been those yeasts that are presently classified in the genus Zygosaccharomyces. Tokouka et al. (1985) and Jermini et al. (1987) isolated exclusively Z . rouxii from honey. In addition to Z. rouxii, Poncini and Wimmer (1986) found strains of 7’.delbrueckii, S. cerevisiae, S. octosporus, and even Metschnikowia reukauffii in honey. Jermini et al. (1987) isolated 28 strains of osmotolerant yeasts from various spoiled high-sugar products (honey, fruit juice concentrates, marzipan, syrups, etc.). All were identified as Z. rouxii, except for two strains of Z. bailii and one each of T. delbrueckii and D. hansenii, but these originated from products (orange concentrate, fitness drink, and canned figs) of relatively higher a, values (0.835-0.91), whereas strains of Z. rouxii occurred in products with a , values as low as 0.631. Though they survived, growth did not occur below a, 0.76. Tokouka et al. (1985) demonstrated that only Z. rouxii, Z . bisporus, and C. lactis-condensi grew better at a, 0.91-0.95 than at 0.986, and these were considered “osmophilic.” Jermini et al. (1987) found only a single strain of Z. rouxii possessing similar properties. Tokouka et aJ. (1985) collected a variety of xerotolerant yeasts from different highsugar products. Zygosaccharomyces rouxii was most often found in sugar and molasses, and single isolates of S. octosporus, S. pombe, Torulaspora globosa, and Candida mannitofaciens were also isolated. From jams, D. hansenii, P. anomala, Candida silvicola, and Rhodotorula mucilaginosa were isolated; in candied fruits, Z . rouxii, C. lactiscondensi, T. delbrueckii, and S. cerevisiae occurred, whereas P. anomala, T. delbrueckii, and C. tropicalis were found in confectionary
216
T. DEAK
products. Orszaghova and KieslingerovL (1984) isolated only Z. rouxii from defective confectionary products and fermented candied fruits. These strains as well as collection strains of D. hansenii and S. cerevisiae grew well in a medium with an a, of 0.75. In dried fruits, not only xerotolerant strains but survivors of not distinctly xerotolerant yeasts may occur from the original microflora of fresh fruit. Madan and Gulati (1980) found Pichia species (ciferrii, subpelliculosa, polyrnorpha, and anornala), S. cerevisiae, and C. etchellsii on raisins, dates, and cashew nuts, and the most frequent were Pichia angusta and C. lactis-condensi. Tokouka et al. (1985) isolated Kluyveromyces therrnotolerans, S . roseus, and S. pombe from raisins and dried dates. Refined sugar is among the foods that contain the least number of microorganisms. White crystalline sugar may contain as an average 100 to 200 bacteria and only 1 to 3 yeasts per 10 grams (Klaushofer et al., 1971).Microbial growth occurs, however, during the production of both cane and beet sugar, and yeasts, too, find optimum conditions for growth in the juices during the preparatory stages of production. Although both sugar cane and sugar beets are highly contaminated raw materials, most microorganisms are destroyed during processing. Raw sugar becomes contaminated with sugar-tolerant yeasts that build up during the continuous operation of the mills (Tilbury, 1980b). The a, of raw sugar may vary widely, from 0.575 to 0.825, and both fructophilic and “osmophilic” yeasts (Z. rouxii, D. hansenii, C. etchellsii, Candida versatilis, and Candida gropengiesseri) and nonosmophilic yeasts (P. anornala, Pichia farinosa, and S . cerevisiae) can be found in raw cane sugar (Tilbury, 1980b). Barwald and Hamad (1984) isolated yeasts from juice samples taken over the whole production process from two cane sugar factories. The 23 strains belonged to 9 genera and 11species; however, only 7 strains of K. marxianus present in nearly all samples were of technical importance because of their heat tolerance at 55°C. The other yeasts were either not thermo- or xerotolerant or did not assimilate sucrose. Garcia and Alcina (1981) also noted Kluyverornyces and Brettanornyces strains that were able to grow at 40°C; however, their importance in sugar production cannot be compared to the thermophilic bacteria and dextran-forming leuconostocs. Anderson et al. (1988) isolated thermotolerant yeasts from sugar cane that were able to ferment sucrose at temperatures above 40°C. The majority (80%) of strains proved to be K. marxianus and Kluyverornyces lactis, some of which grew up to 47OC. One or two isolates of P. angusta, S. cerevisiae, D. hansenii, P. rnernbranaefaciens, G . capitaturn, and C. oleophila also occurred.
FOODBORNE YEASTS
217
E. CEREALS AND BAKERYPRODUCTS Yeast are common on all cereals although they represent only a minority of the microbial flora. They are present in the range of lo2 to lo4 per gram. According to Richter and Thalman (1983), about 68% of 178 different samples (oats, barley, wheat, corn, and rye) studied was contaminated with yeasts. During storage of cereals, seasonal fluctuations of the viable counts were observed; in winter, great reduction was found. Drying also caused a reduction in the yeast population. In this study the following genera of yeasts were represented: Candida, Cryptococcus, Pichia, Hanseniaspora, Rhodotorula, Sporobolornyces, Saccharornyces, and Trichosporon. Because the milling procedures remove the outer parts (hulls of the kernels), flours have an even lower level of microbes. The microbial population depends, however, on the grade of milling, and is higher on lower grade flour and whole-grain meal. Kurtzman et al. (1970) found that C. albidus, the most commonly found species on wheat, did not get into wheat flour. A relatively small number of yeast species was represented in wheat and flour. Pichia anornala, H. burtonii, and the yeastlike mold A. pullulans were common to both wheat and flour. Additional species from wheat were C. laurentii, R. glutinis and Geotrichum fermentans, and species from flour were S. cerevisiae, P. farinosa, and an unidentified species of Candida. In a more recent study, Spicher and Mellenthin (1983) compared the yeast flora of wheat and rye and that of flours milled from them. A greater number of species was found on wheat than on rye, but the case was just the opposite with flours. Of 14 species identified, 7 were found on both cereal grains and flours (C. albidus, R. ingeniosa, R. glutinis, P. rnembranaefaciens, P. anornala, T. cutaneurn, and H. burtonii). Four species occurred only on grains (C. laurentii, C. stellata, P. canadensis, and S. sahonicolor), and C. zeylanoides, S. cerevisiae, and T. pullulans were observed only in flours. These contaminants originated most probably from the milling machinery. For the production of bread, rolls, and some sweet goods, leavening is accomplished by using yeasts. Doughs are prepared with special selected strains of industrially produced baker’s yeast (S. cerevisiae), used in the form of compressed yeast cakes, liquid yeast cream, or active dry yeast, which are added in most cases directly to the flour (straight dough process; for details see Spicher 1983). Wild yeasts from flour always occur in small numbers in doughs left for leavening, but rarely if ever cause problems because of the overwhelming abundance of baker’s yeasts.
218
T.DEAK
The traditional sour dough fermentation has remained in use only for rye and mixed-grain breads. In the sour dough starters, yeasts occur together with lactic acid bacteria. The common yeast species are S. cerevisiae, S . exiguus (and its anamorph C. holmii), Pichia saitoi, and I. orientalis (Spicher et al., 1979).The yeast contributors may vary in sour dough starters used in different parts of the world. In the special “San Francisco sour dough,” S. exiguus is predominant, with S. cerevisiae in the minority (Sugiharaet al.,1971; Ng, 1976).In Iran, T.delbrueckii and D. hansenii (Azar et al., 1977) are used, and in Finland, S. cerevisiae, S. exiguus, C. stellata, S. unisporus, and E. fibuliger (Salovaara and Savolainen, 1984) are responsible for sour dough leavening. Organisms originating from flour and dough are normally inactivated during baking. Microbial spoilage of baked goods is mainly due to contamination after baking. Sliced bread is particularly susceptible to contamination (Seiler, 1980). Spoilage of bread is mainly caused by bacilli producing rope and molds developing dark spots. Yeasts and yeastlike organisms are responsible for developing white spots in the crumb (“chalky bread”). This is caused by E. fibuliger, H. burtonii, and Z. bailii (Spicher, 1984). Other yeast species, such as S. cerevisiae, T. delbrueckii, P. membranaefaciens, and C. parapsilosis may also occur (Spicher, 1986). In bakery products with coatings and fillings or ingredients (nuts, raisins, and jam) added after baking, contamination with S. cerevisiae and more often with xerotolerant yeasts (Z. rouxii, Z . bisporus, S. pombe, and S. octosporus) may cause fermentative spoilage (Seiler, 1980).
F. MEAT,POULTRY, AND FISH The main ecological determinants (nutrients, moisture content, and pH) of fresh meat, poultry, fish, and seafoods, as well as of processed products, are adequate to support the growth of all microorganisms, of which bacteria prevail. As chilling and refrigeration are indispensable conditions for storage of meat and meat products, temperature is the most important factor in controlling the types of microorganisms that develop on them and may cause spoilage. Yeasts contribute only a small but permanent proportion of the natural microflora developing on meat. The ability of yeasts to grow at low temperature, at high salt concentration, and under semianaerobic conditions enables them to proliferate in refrigerated, cured, and vacuumpackaged meat and meat products. Yeasts, however, are not considered to be of great importance in the spoilage of these foods.
FOODBORNE YEASTS
219
Numerous studies have been conducted on yeasts in meat, frankfurters, poultry, and shrimp, and these have been reviewed by Jay (1987). Recently, several surveys have been made on the composition of yeast flora on meat, and these will be considered in the following discussion. On meat stored at refrigeration temperatures down to -5"C, surface desiccation inhibits bacterial growth, and under these conditions yeast development may prevail. Lamb loins wrapped in plastic film and stored at -5°C developed a yeast microflora that consisted of C. laurentii, Rhodosporidiurn infirmo-miniatum, T. pullulans, and C. zeylanoides. Cryptococcus laurentii formed 90% of the population (Lowry and Gill, 1984). Yeast flora recovered from minced beef contained C. laurentii, C. sake, C. zeylanoides, C. parapsilosis, and, to a lesser extent, C. albidus, D. hansenii, and Yarrowia lipolytica. After 14 days storage at 4OC, the first three species also prevailed but D. hansenii became dominant (Johannsen et al., 1984). Earlier, Baxter and Illston (1976) also found C. Iaurentii, D. hansenii, and P. guiIIiermondii as psychrotrophic yeasts on meats, and Barnes et al. (1978) described a similar mycoflora on stored turkey carcasses. The population of psychrotrophic yeasts (C. laurentii, C. zeylanoides, and T. pullulans) increased during refrigerated storage. Banks and Board (1987) described that although the composition of the flora was similar, the population of yeasts differed on various meat products. Low populations (io2-iO4 per gram) were recovered from bacon and some types of fresh sausages; yeasts attain a high number (i04-i06 per gram) in minced meats, burgers, poultry meat, and other types of fresh sausages. The most frequent psychrotrophic yeasts isolated from these chilled foods were also C. zeylanoides, D. hansenii, Y . lipolytica, C. rugosa, C. humicola, C. laurentii, and R. glutinis. Comi and Cantoni (1985) established that the low level (lo3 per gram) of yeasts on various meat products (150 samples) increased to 105-106 in 7 days and 106--107 per gram in 14 days. In the yeast flora of fresh meat, Candida spp. (35%) and Trichosporon spp. (25%) predominate. Their ratio reversed during refrigerated storage (Trichosporon, 60%; Candida, 2 1 l O / ~ ) , and members of Cryptococcus and Rhodotorula spp. increased. Hormoascus platypodis and Lipornyces starkeyi present in fresh samples were absent from refrigerated samples. On poultry meat no consistent differences were noted in the yeast flora as compared to that of red meat (Jay, 1987). It is evident from the literature that yeasts form an indigenous component of the microbial association of meats and meat products. This is inevitable, as they occur throughout the meat processing. In a detailed study, Dalton et al. (1984) showed that D.hansenii, C. zeylanoides, C.
220
T. DEAK
vini, Cryptococcus curvatus, and R. mucilaginosa occurred in the slaughterhouse, in the air, and on the equipment in the chilled storage rooms, as well as on fresh sausage and minced beef samples. Pichia membranaefaciens, C. lourentii, Leucosporidium scottii, and C. humicola were in smaller number but were also regularly recovered. Trichosporon cutaneum, R. glutinis, R. mucilaginosa, and C. laurentii occurred mainly in slaughter equipment and in air, whereas Candida mesenterica, Pichia carsonii, and Y.lipolytica appeared to contaminate the sausage through added ingredients. The increase of the yeast population during cool storage shows that these organisms contribute to the changes leading to spoilage, although yeasts are rarely the direct cause and determining factors in spoilage of meats and meat products. Comparison of characteristics of yeasts recovered from fresh and spoiled ground beef showed few differences (Jay and Margitic, 1981; Hsieh and Jay, 1984). Ground beef that underwent spoilage contained a broader spectrum of yeasts, but the indigenous species, C. zeylanoides, P. fermentans, and Y.lipolytica, remained dominant. Of the strains recovered, 60-80% belonged to the genus Candida, and some 20 species were represented by one or few isolates. In the preparation of sausages, the various ingredients used may add contaminants to the original microflora. Curing of certain meat products (ham and bacon) brings about substantial changes in the chemical composition of meat and consequently in the microflora. Yeasts occur frequently on fermented sausages and country-cured hams. They can contribute to the improvement of flavor of cured meats but also may spoil these products. Debaromyces hansenii occurred most frequently, and C. rugosa, Candido catenulata, and Y.lipolytica were also often recovered from cured meat products (Leistner and Bem, 1970; Monte et al., 1986). Comi and Cantoni (1980b, 1983) attributed some importance to the proteolytic and lipolytic activities of certain yeast species in the curing of hams and the ripening of sausages. Debaromyces hansenii, H. burtonii, T. cutaneum, and Trichosporon pullulans possessed highest activity. Salt-tolerant yeasts (D. hansenii, C. parapsilosis, and R. mucilaginosa) can develop on the surface of salami casing, but probably do not influence the ripening of dry sausages (Comi and Cantoni, 1980a). Fish and shellfish provide excellent substrates for the growth of microorganisms because of high water activity, neutral pH, and the high level of soluble nutrients. Typically, bacterial populations are the dominant part of the microflora. The incidence of microorganisms in seafoods is influenced mainly by two environmental factors, viz. the pollution of the water from which these animals are harvested and the temperature of storage and transportation.
FOODBORNE YEASTS
221
Though present in smaller numbers than bacteria, yeasts are fairly widely distributed in the sea and also in fresh water (Morris, 1975; Hagler and Ahearn, 1987), and a large number of species can be isolated from marine and freshwater animals. The earlier literature has been surveyed by Jay (1987). Though some marine yeasts are thought to be pathogenic to their hosts, it appears that most are saprophytes. There is little evidence to suggest an important role of yeasts in the spoilage of stored fish and shellfish. Some recent reports, however, indicate that psychrotrophic yeasts may contribute to certain deleterious, even proteolytic, changes (Kobatake and Kurata, 1983a; Comi et al., 1983, 1984). There were no indications that a characteristic yeast flora exists for different types of fish. Ross and Morris (1965) found similar yeast flora on 16 types of fish, with more than 50% predominance of D. hansenii, followed by C. inconspicua and C. parapsilosis. Recent studies revealed that the more frequently isolated yeasts from fish and shellfish are typical representatives of those species prevalent in water, such as red yeasts (R. glutinis, R. mucilaginosa, and Rhodotorula pallida), other basidiomycetous yeasts (C. albidus, R. infirmo-miniatum, T. cutaneum, T. pullulans, and Cryptococcus humicolus), and C. parapsilosis, C. zeylanoides, Y.lipolytica, and P. guilliermondii (Kobatake and Kurata, 1980a; Hood, 1983). Buck et al. (1977), in a broad survey on shellfish, noted the presence more than 30 species, among which a number of human-associated yeasts occurred (C. albicans, C. parapsilosis, C. tropicalis, and c. glabrata). G.
DAIRY
PRODUCTS
Yeasts are important in the dairy industry for three main reasons: (1)they play an essential role in the processing of certain fermented products and in the ripening of certain cheeses; (2) yeasts can be respon-
sible for spoilage of milk and dairy products; and (3) yeasts can be used to ferment whey, a major by-product of cheesemaking (Marth, 1987). Milk is an excellent substrate for growth of many microorganisms, including yeasts. Fresh, raw milk contains varying numbers of yeasts, depending on the milking hygiene. Raw milk held at refrigerator temperature allows the growth of psychrotrophic strains. Engel ( 1986a,c) reported that all of 128 raw milk samples contained yeast in low numbers (i02-i04 per ml). Cryptococcus curvatus was isolated most frequently, followed by G . candidum, T. cutaneum, and D. hansenii. In raw milk samples, P. membranaefaciens and Y . lipolytica also occurred, and K. marxianus/K. lactis represented only 5% of the yeast
222
T. DEAK
population. The pasteurization process eliminates most microorganisms except thermoduric bacteria. Yeasts in pasteurized market milk originate from secondary contamination. The two main dairy products in which yeast activity plays a major role are fermented milk products and cheese. Some fermented milk products, e.g., kefir and kumiss, result from a mixed fermentation of lactic acid bacteria and lactose-fermenting yeasts. Kefir is cultured from grains that contain a tight symbiotic mixture of lactic acid bacteria and yeasts. From the grains, lactose-fermenting strains of K. lactis (Candida kefir) were isolated, but nonlactose fermenting species also occurred, such as Saccharornyces unisporus, S. cerevisiae, and S. exiguus (Engel, 1984; Engel et al., 1986). Yoghurt is produced all over the world, and although it is prepared only by lactic acid starters and may be frozen or pasteurized, it always contains yeasts, which may be troublesome. The spoilage of yoghurt is well documented (Suriyarachchi and Fleet, 1981; Green and Ibe, 1987). In recent years the introduction of fruit and flavors into yoghurts has amplified the risk of spoilage by yeasts. Tilbury et al. (1974) found D. hansenii, C. versatilis, C. intermedia, and P. anornala most frequently in various flavored yoghurts. In a study by Suriyarachi and Fleet (1981), D. hansenii together with K. rnarxianus were the most frequently isolated species, followed by S. cerevisiae, R. rubra, K. lactis, C. versatilis, Pichia toletana, and I. orientalis. In another survey (Green and Ibe, 1987), the species of highest count and incidence were C. lusitaniae, Kluyveromyces fragilis, and I. orientalis, and S. cerevisiae, C. rugosa, Rhodotorula, Sporobolomyces, and Debaromyces spp. were isolated in low incidence. Yeasts contribute to the ripening of some cheeses by metabolizing lactic acid and raising the pH of the cheese, which enables proteolytic bacteria to grow. Yeast activity is important both within and on the surface of soft-cheese types (blue cheese, Gorgonzola, Camembert, etc.). Nunez et al. (1981)made a thorough study of the blue cheese production and ripening processes. From milk and curd, P. ferrnentans, S. unisporus, G. capitatum, and G. candidurn were isolated. During ripening, P. mernbranaefaciens and P. ferrnentans predominated in the interior of cheeses, and D. hansenii and G. candidurn predominated on the cheese surface. In Camembert cheese there was no difference between the inner and outer yeast flora (Schmidt and Lenoir, 1980). A total of 193 strains were isolated from fresh Camembert cheese. Kluyveromyces rnarxianus (Candida pseudotropicalisj and K. Iactis (Candida sphaerica) dominated, and D. hansenii, S. cerevisiae, and C. versatilis were also well
FOODBORNE YEASTS
223
represented. After ripening, 482 strains were identified. The main species were lactose-fermenting K. lactis, K. marxianus, and D. hansenii. Yeasts can be found as contaminants on different cheese varieties. Tilbury et al. (1974) found D. hansenii most frequently, and also C. versatilis, C. intermedia, and P. anomala on cheddar, cream, and cottage cheeses. Suarez and Inigo (1982) isolated C. rugosa, G. capitatum, T. delbrueckii, S. cerevisiae, C. inconspicua, and K. marxianus from Mahon cheese. In a Greek cheese, P. membranaefaciens and P. fermentans were most frequently found, with only a few isolates of K. marxianus and S. cerevisiae (Tzanetakis et al., 1987). Although yeasts are mostly beneficial in the ripening of cheeses and contribute to their flavor, excessive growth of yeast may cause undesirable organoleptic changes and may lead to softening. Moreover, under poor hygienic conditions, C. albicans, an opportunistic pathogenic yeast, may occur in cheese (El-Bassiony et al., 1980). In a German fresh cheese type, G. candidum infected one-third of the samples and impaired taste and flavor when counts exceeded lo4 per gram. Other yeasts were also frequently found, such as K. marxianus, P. membranaefaciens, Y . lipolytica, and D. hansenii (Engel, 1986b). Other dairy products are also not exempt from yeasts. Ice cream and similar frozen dairy desserts readily support microbial growth if a break occurs in the low storage temperature. Cream desserts normally contain yeasts, of which P. anomala and C. versatilis were found frequently (Tilbury et al., 1974). The disposal of cheese whey is a continuing and growing problem in the dairy industry. There is an abundant literature describing the possibilities for the use of whey both for SCP and lactase enzyme production. For these purposes, selected strains of K. marxianus [C. pseudotropicalis) and K. Jactis have been primarily employed (Gomez and Castillo, 1983; Moulin et al., 1983; Decleire et al., 1985; for review see Berry et a]., 1987).
H. FERMENTED, SALTED, AND ACID-PRESERVED FOODS 1. Fermented Foods
Vegetables and certain fruits are often preserved by salting, acidifying, or fermentation. The most commonly fermented vegetables in Europe and North America are cabbage, cucumbers, and olives, but a range of other products can be preserved similarly (Fleming, 1982). Lactic acid fermentation takes place in a salt brine and creates a highly
224
T. DEAK
selective environment in which only yeasts can compete with lactic acid bacteria, Indeed, yeasts are always active in vegetable fermentations. In general, two main groups of yeast play a role in fermentation. Some yeasts develop in the brine and bring about a secondary fermentation as long as fermentable sugars are available. When these are exhausted, other yeasts develop on the surface during the postfermentation stage and oxidize the acids produced by bacterial fermentation. The composition of the yeast flora depends on the method of manufacturing the product. In salt-stock pickles with high-salt concentrations (up to 15%), the yeast flora differs from that of vegetables prepared in low-salt brine (less than 5%). Extensive studies carried out in the 1950s revealed the composition and succession of species in these fermentation, and the data have been summarized by Pederson (1971), Etchells et al. (1975), and Fleming (1982). The principal species of fermentative yeasts, in succession, in highsalt cucumber brines are C. versatilis, C. lactis-condensii, Pichia subpelliculosa, S. exiguus, T. delbrueckii, Z. bailii, C. etchellsii, and P. anomala. The principal oxidative yeasts, forming a film on the surface, are D. hansenii, P. ohmeri, 2. rouxii, and I. orientalis. Several other fermentative and oxidative yeasts may be present in smaller numbers. The yeast flora of dill pickles prepared in low-salt brine are different from the high-salt flora. Issatchenkia orientalis predominates, and Pichia jadinii, P. guilliermondii, P. fermentans, and C. rugosa also occur (Deik, 1988). The yeast flora in sauerkraut, olives, and other vegetable fermentations is considered grossly similar. However, in a recent study, Garrido Fernandez et al. (1985) described a somewhat different picture regarding Spanish-type black olives, from which were isolated and identified 20 different yeast species. Debaromyces hansenii occurred most frequently (38.5%),followed by P. membranaefaciens, Williopsis mrakii, P. anomala, Candida boidinii, and Candida diddensiae. The other species occurred in a less than 5% ratio. Spoilage of fermented vegetables has been often attributed to yeasts. Spoilage may occur by softening of the product due to enzymatic breakdown or by bloating due to gaseous fermentation. Yeasts do not possess a full set of pectinolytic enzymes, although many of them produce pectinesterase and polygalacturonase, which contribute to the breakdown of plant tissues, resulting in spoilage. This has been proved for S. cerevisiae, S. kluyveri, and P. anomala, which cause softening of olives (Vaughn et al. 1972). Oxidative yeasts growing on the surface of brine utilize the lactic acid developed and provide an environment
'
FOODBORNE YEASTS
225
suitable for other spoilage microorganisms (Etchells et al., 1975).Sorbic acid was found effective in inhibiting the growth of film-forming yeasts (Liewen and Marth, 1985). Silages used for animal feed are prepared by a basically lactic acid fermentation. This is associated with yeasts that partly cause alcoholic fermentation, but which also can be harmful by assimilating lactic acid and ethanol. From the vast literature on silages, only two recent publications concerning yeasts will be mentioned. Engel (1986a) found that the most frequent yeast species in corn, grass, and mixed silage were P. fermentans, I. orientalis, S . cerevisiae, and G. candidum, whereas T. cutaneum and P. membranaefaciens represented only a small part of the yeast population. The predominant yeast flora of maize silage was also shown to consist of P. fermentans, I. orientalis, S . exiguus, and Saccharomyces dairensis. Successively, D. hansenii, P. anomala, and G. candidum were also encountered in the oxidative breakdown of organic compounds (Middelhoven and van Baalen, 1988). The fermentation of cocoa beans is essential in order to remove the mucilaginous pulp around the beans. This is essentially a mixed fermentation in which yeasts are always associated with lactic acid bacteria. Ravelomanana et al. (1985)recently summarized investigations on the traditional cocoa fermentation and compared the results obtained from different cocoa-producing areas of the world. The yeast flora were found to be similar despite the differences in area, weather, and technology. Yeasts that occurred in large numbers were H. uvarum, S . cerevisiae, P. membranaefaciens, P. fermentans, and 1. orientalis. In addition, P. anomala, D. hansenii, and T. pullulans were also often found, and the presence of some 30 other species seemed to be a matter of chance. It has been shown that yeasts with certain pectinolytic activity are involved in the degradation of the pulp, viz. S . cerevisiae, D. hansenii, and Candida norvegensis (Sanchez et al., 1984). 2. Oriental Fermented Foods
In the Orient, blends of vegetables are fermented and often include rice, nuts, and fish. Traditional fermented products are also those prepared from molded masses of cereals, legumes, rice flours, and especially soybeans. Though many of these indigenous fermented foods originated in ancient times, it is only recently that scientific knowledge has been gained about them. However, some traditional ethnic foods have not yet been studied. Some oriental fermented foods are still manufactured on a small scale or are prepared in the home. The production of a few of them has, however, developed into a large industry. The importance of these foods is increasingly recognized, and this is shown
226
T. DEAK
by the growing number of treatises on the subject (Beuchat, 1983b, 1987; KO, 1982; Wood, 1982; Hesseltine, 1983). Beuchat (1987) presented a comprehensive survey on the mycology of this highly varied group of fermented products. Depending on their composition and method of preparation, molds, lactic acid and other bacteria, or yeasts dominate in the fermentation and determine the character of the product. Most often, however, a mixed fermentation takes place, or the food is first fermented by molds followed by a secondary lactic acid, alcoholic, or mixed fermentation (KO, 1982). Yeasts often play an essential role, or are inevitable companions and sometimes contaminants and spoilage organisms in the various fermentations of indigenous foods. Space limitation does not permit a comprehensive survey, hence only some recently reported examples will be given. Burong isda is a fermented fish and rice mixture. Sakai et al. (1983) isolated 484 yeast strains of different types from this food. The dominant species were S. cerevisiae, C. tropicalis, C. parapsilosis, Pichia strasburgensis, P. carsonii, and Z. rouxii. The latter two occurred only in products with high salt content (5.4%). Idli and dosa are types of bread produced from a mixture of milled rice and legumes. Leavening is due to lactic acid bacteria alone or in combination with yeasts. Soni et al. (1986) found S. cerevisiae, D. hansenii, and T. cutaneum in dosa, whereas, according to Venkatasubbaiah et al. (1985), a more varied yeast flora contribute to the fermentation of idli, viz. P. anomala, C. glabrata, C. tropicalis, C. sake, D. hansenii, I. orientalis, S. exiguus, and T. pullulans. Ragi is not a food but is used as a starter for the fermentation of other foods. Ragi itself is a molded rice flour cake that contains various fungi and yeasts with amylolytic and proteolytic activity. A fermented product, tape ketan, made by inoculation of ragi, contained a mold, Chlamydomucor oryzae (Amylomyces rouxii), and H. burtonii as main contributors. Other yeasts found were E. fibuliger, P. canadensis, P. anomala, P. subpelliculosa, Saccharomycopsis malanga, and C. parapsilosis (Cronk et al., 1977). Another starter used for a Chinese rice pudding fermentation contained a Rhizopus species and some yeasts, such as P. anomala (Wei and Jong, 1983). The best known starter is koji, which is used for the fermentation of various soybean products. While koji contains exclusively one or more selected Aspergillus strains, which are responsible for the hydrolysis of starch, the soy sauce inoculated with koji undergoes a secondary fermentation carried out mainly by yeasts (Wood, 1982). The most important soy sauce yeasts are Z. rouxii, D. hansenii, and C. versatilis, all tolerating the high-salt concentration of the soy brine (about 18%). Some
FOODBORNE YEASTS
227
other yeasts, such as P. farinosa, P. anomala, C. albidus, C. tropicalis, and H. burtonii are occasionally observed in the first stage of fermentation (Noda et al., 1982; Mizunoma, 1984; Sugiyama, 1984). The distribution of yeasts in a number of other indigenous fermented foods have been reviewed by Sandhu and Waraich (1984), who isolated from 341 samples of 11fermented foods and beverages 508 yeast strains representing 26 species from the genera Candida, Debaromyces, and Rhodotorula. The most frequently occurring yeasts were Issatchenkia terricola (7.9Y0), followed by C. sake (5.6%), T. pullulans (5%), and a mold, Sporothrix, with a yeast phase called Candida fragicola. 3. Acid-Preserved Foods
Certain foods are preserved by vinegar with added salt, with or without a preservative. These include marinated fishes, vegetables, mayonnaise, and salad dressing. Mainly lactic acid bacteria and yeasts can cause spoilage in these products (Smittle, 1977). An example is described by Comi et al. (1981a), who found yeasts responsible for the deterioration of pickled mushrooms. Pichia anomala represented 95% of the isolates, and C. etchellsii, C. parapsilosis, and P. canadensis were also found. They all tolerated 20% NaCl (an a, value of 0.845). Mayonnaise and salad dressings are oil-in-water emulsions that are preserved by the addition of acetic acid, resulting in a pH less than 4. The water phase contains about 5-10% salt, conferring a low aw. Though various other ingredients, particularly spices and eggs, introduce contaminating microorganisms, these products represent a highly selective environment in which only a few contaminants survive. Kurtzman et al. (1971) as well as Smittle and Flowers (1982) found only Z. bailii in spoiled samples. When mayonnaise and salad dressings are used in the preparation of various delicatessen products, the ingredients used open new opportunities for spoilage, and these products must be kept under refrigeration (below 10°C) during storage. Nevertheless, several cases of spoilage caused by yeasts have been described. Brocklehurst et al. (1983) and Brocklehurst and Lund (1985) found S. exiguus, S . dairensis, and P. membranaefaciens, which were able to grow and produce gas in mayonnaise-based salads. Baumgart (1982) described s. exiguus, C. vini, and Z. bailii in spoiled delicatessen foods. Cantoini and Comi (1988) found Candida inconspicua, C. parapsilosis, D. hansenii, S . cerevisiae, R. mucilaginosa, and T. cutaneum in spoiled mayonnaise salads. A wider range of yeasts contaminated chilled potato and macaroni salads and Chinese dumplings (gyoza), most probably due to the less
228
T. DEAK
preventive methods of preparation. Kobatake and Kurata (1980b, 1983b) found C. intermedia, C. sake, Y . lipolytica, R. glutinis, R. minuta, A. mucilaginosa, T. cutaneum, T. pullulans, C. albidus, C. laurentii, and R. infirmo-miniatum in these products. The majority of yeasts were psychotrophic; some of them (R. infirmo-miniaturn, Trichosporon spp.) were even psychrophilic, and many showed proteolytic and lipolytic activities. Compared to mayonnaise and salad dressings, margarine is a waterin-oil emulsion and constitutes an equally selective environment for yeasts and molds. Only the aqueous phase of margarine contains milk solids and salt, and is susceptible to spoilage if the emulsion is not fine enough. In this case, Y . lipolytica and G . candidum can cause spoilage (Muys, 1971). V. Methods of Isolation and Enumeration
The methods and media for isolation and enumeration have been the subject of several treatises (Speck, 1976; Jarvis, 1978; Davenport, 1980b). Recently, a special workshop was held in Boston, Massachusetts, on methods for the mycological examination of food (King et al., 1986).Comparative studies made prior to the workshop and discussions during it resulted in a comprehensive survey of mycological techniques and recommendations for the standardization of methods and media. In the following discussion, the proposed standard methods for sample preparation, isolation, enumeration, and selective techniques will be surveyed. A. SAMPLE PREPARATION In most cases a sample is investigated to obtain an estimate of the size and/or the composition of the yeast population of a food under study. The sample taken for this purpose should represent the whole portion of the food or even a lot or consignment of food. Methods of sampling have been thoroughly discussed (ICMSF, 1986), hence only the preparation of samples is outlined below. For purposes of enumeration, the general procedure is to weigh an aliquot of the food, bring it into suspension, and prepare suitable dilutions before plating. To minimize sampling error, the sample size should be as large as practical. For most foods a 1: 10 ratio of sample to diluent is adequate (Jarvis and Shapton, 1986a). In some cases, for example, with dried foods, which absorb water, a larger ratio should be applied.
FOODBORNE YEASTS
229
Pretreatment of food samples is not a usual practice. It has been shown, however, that in many natural substrates, such as soil particles, leaves, or grapes, yeasts are present in microcolonies firmly adhering to the sample surface (Beech and Davenport, 1970b), and in these cases pretreatment by soaking, shaking, or ultrasonication allows better recovery of yeasts (Martini et al., 1980; Rosini et al., 1982). For certain foods, consideration should be given to the recovery of sublethally injured cells (Beuchat, 1984). For this reason application of a peptone water diluent is more effective than using sterile distilled water, although the latter is sufficient in most cases ( Jarvis and Shapton, 1986b). Another situation when a diluent of special composition may be necessary is in the case of foods with low a, values. In monitoring these, concentrated diluents containing 20-40% (w/w) glucose or sucrose should be used to protect sensitive yeast cells (Seiler, 1986a). As to the method of homogenization, no significant differences can be found between stomaching and blending (Hastings et al., 1986a). In general, neither technique should be applied for more than 2 minutes. In the absence of mechanical devices, even shaking by hand can be used with satisfactory results, although it is not easy to achieve uniform treatment in repeated investigations (Deak et al., 1986a). Dilution and inoculation should be carried out soon after homogenizing. Food debris will sediment within a few minutes, and this time of settling has no significant effect on yeast recovery (DeBk et al., 1986a). B. METHODS OF ENUMERATION Enumeration of yeasts is based on the presupposition that individual colonies that developed on or in the medium arose from single cells. Although this is generally accepted, it may not always be the case (aggregates of buds often occur with yeast). Nevertheless, the colonyforming units (CFUs) are a good approximation for the number of cells encountered. Two methods are widely applied for the enumeration of yeasts, i.e., the spread plate technique and the pour plate technique. For spread plating, 0.1-0.3 ml of inoculum is distributed over the surface of the solidified agar medium by a glass hockey stick. Plates should be prepared the previous day and allowed to dry on the surface while stored at room temperatue (or prepared at least 4 hours in advance and dried at 37°C).Pour plates are prepared by mixing 1ml of inoculum with about 15 ml of melted agar medium cooled to 45-47°C. Opinions differ as to the advantages of the spread plate versus pour plate techniques. In general, however, no significant difference can be observed in the performance of the two methods (Koburger and Norden,
230
T. DEAK
1975). Comparative studies presented at the Boston workshop showed convincing evidence that yeast recovery from foods is significantly enhanced by the spread plate method as compared with pour plating (Ferguson, 1986a,b; Deak et al., 1986b). This is probably due to the increased availability of oxygen and the avoidance of thermal shock, both effects allowing better growth conditions, especially for stressed cells. Another point is that both bacterial and mold colonies can be distinguished from yeasts more easily on the surface; moreover, some differences of yeast colony types can also be facilitated. One limitation of the spread plate method is that it cannot be used with low yeast counts (less than one cell in 10 ml). In this case, pour plating or the most probable number (MPN) method can be applied, which allows a larger inoculum size. However, it has been repeatedly shown that the MPN technique gave significantly higher counts than did other enumeration techniques (Koburger and Norden, 1975; Deak et al., 1986~). This can be partly attributed to the use of the liquid medium, which allows better resuscitation of stressed cells, but is mainly due to the low level of statistical significance of the MPN method (Jarvis, 1978). A modification of the method utilizing agar plates (plate-MPN technique) is similarly biased, giving consistently higher counts than those obtained by surface plating (Hastings et al., 1986b). Neither the liquid nor the plate-MPN technique allows direct isolation of yeasts. When even lower numbers of cells are encountered, as in soft drinks or wines, membrane filtration is the method of choice for enumeration. By applying membranes (a 0.5-pm pore diameter is appropriate for retaining yeasts) and a necessary device for filtration, yeast cells can be concentrated from large quantities of liquid. When the membrane is put on the surface of an agar medium, colonies will form after incubation. The precision of the method is comparable to, or higher than, that of other enumeration techniques (Deak et al., 1986~). It is generally accepted that for enumeration of yeasts an incubation temperature of approximately 25OC is appropriate. Frequently the ambient room temperature (20-22"C) can also suffice. Under these conditions yeast colonies develop in 2-3 days, but it is recommended that counts be taken after 5 days of incubation. When slow-growing yeast species (e.g., Brettanomyces) are suspected, an extended incubation period may be necessary. C. MEDIA For the growth of most yeasts in pure culture, simple media such as glucose yeast extract (GYE) agar or plate count agar (PCA) generally suffice. Several commercially available media give reproducible results
FOODBORNE YEASTS
231
and are stable and easy to prepare. In addition to the media mentioned above, tryptone glucose yeast extract (TGY) agar or potato dextrose agar (PDA) can also be used as general-purpose media for the cultivation of yeast. However, from the discussion at the Boston workshop, it appears that some media traditionally used for the cultivation of yeast, such as malt extract agar (MEA) and Sabouraud dextrose agar (SDA) have proved inferior to those mentioned earlier. Problems may be encountered when yeasts are to be enumerated and isolated from samples containing a mixed microflora, e.g., from foods. In these cases selective or differential media should be applied, and there is a wide variety of these. Specialists at the Boston workshop reported some 15 different media to be routinely used for enumeration of fungi and yeasts from foods. Davenport (1980b) compiled an even longer list of media. There is, however, no single medium that would be satisfactory for the examination of all foods, and sometimes specific properties of the food are to be considered for choosing the most appropriate medium. In general, for selective enumeration and isolation of yeast from a mixed population of foods, the medium of choice should fulfill two functions: inhibition of bacterial growth and prevention of spreading of molds. Media acidified after melting to pH 3.5 with tartaric acid can successfully control bacterial growth and allow development of most yeasts. Other organic acids (citric and lactic) can also be used for pH adjustment whereas phosphoric and hydrochloric acids appear more inhibitory to yeasts. Acidified PDA or TGY agar are quite appropriate when the food to be examined also has a low pH, such as fruit purees, soft drinks, or wines (Deik et al., 1986a,c; Anderson and Moberg, 1986; Beuchat and Nail, 1985). However, certain bacteria, such as lactobacilli, are able to develop on acidified media, which, moreover, may adversely affect stressed yeast cells, which have an increased sensitivity to low pH (Nelson, 1972; Beuchat, 1986). It has been shown repeatedly that acidified media are less suitable for enumeration of yeasts from nonalcoholic foods than are media containing an antibacterial antibiotic (Beuchat, 1979; Koburger, 1970; Deak et al., 1986b). One of the first media of this kind contained oxytetracycline (OGY) (Mossel et a]., 1970). This antibiotic is, however, heat sensitive and cannot be added to the medium before autoclaving. Certain antibiotics are more heat stable and easier to handle, e.g., chloramphenicol, chlortetracycline, and gentamicin (Jarvis, 1973; Mossel et a].,1975). In food samples heavily loaded with bacteria, a combination of two antibiotics may be necessary (Koburger and Rodgers, 1978). If the samples being tested contain rapidly growing and spreading molds (e.g., Rhizopus or Mucor spp.), dichloran and/or rose bengal can
232
T.DEAK
be applied to retard spreading and to restrict colony size. Media of this kind are dichloran rose bengal chlortetracycline (DRBC) agar (King et al., 1979), rose bengal chloramphenicol chlortetracycline (RBCC) agar (Baggerman, 1981),and rose bengal chlortetracycline (RBC)agar (Jarvis, 1973). Though the inclusion of these mold inhibitors does facilitate enumeration of yeasts (Henson, 1981;DeBk, et al., 1986b),rose bengal in combination with antibiotics may suppress the development of some yeasts, especially if they are already injured (Banks et al., 1985; Williams, 1986a,b; Dijkmann, 1986). Results of comparative studies indicate that none of the currently used media is the best for enumerating yeasts in all foods. Even if some statistically significant differences can be found among the media, these may not be of practical importance (Beckers et al., 1986; Hastings et a]., 1986b). Acidified or antibiotic-supplemented media can be equally appropriate for the recovery of yeasts from specific food samples. However, in terms of inhibiting spreading of molds, DRCB is slightly superior to other media (Seiler, 1986b; Kellen et a]., 1986; Rogers and Guarino, 1986). D. SELECTIVE PROCEDURES
Sometimes the quantitative enumeration of specific yeasts is required from a mixed population of microorganisms or other yeasts. This can be approached by applying inhibitory compounds (selective media) or media containing nutrients, allowing the development only of certain types of yeast (elective media). Many media have been developed for purposes of selective isolation of yeasts and these have been surveyed by Beech and Davenport (1971). Selective media are often used in the brewing industry for the detection of wild yeast contamination in pitching yeast. For this purpose a number of selective and differential media have been devised, such as lysine agar, crystal violet agar, carbol fuchsin sulfite agar, and others, and these have been reviewed by Lin (1975),Ingledew and Casey (1982), and Back (1987). In a recent comparative study, Rocken and Marg (1983) showed that non-Saccharomyces yeast contamination could be detected reliably on lysine agar, cupric sulfate agar, or panthothenate agar. More problematical is the detection of wild Saccharomyces among brewery strains of Saccharomyces. None of the media available gives consistent results (Rocken and Schulte, 1986; Back, 1987). There is less in the literature on a reliable procedure for the differentiation of wine yeasts in the winery. A medium containing 12% (v/v)
FOODBORNE YEASTS
233
ethanol and 150 mglliter bisulfite was developed by Kish et al. (1983) to suppress the growth of non-Saccharomyces yeasts and to allow counting of Saccharomyces wine strains during the early stages of must fermentation. The medium, however, was not completely selective for wine yeasts. Heard and Fleet (1986b) found that lysine agar consistently detected non-Saccharomyces yeasts during wine fermentation. Rodrigues (1987) developed an identification system based on selective media. Another medium, molybdate agar, fortified with 0.125%calcium propionate, was found useful for the routine isolation and differentiation of a variety of yeasts from mixed flora, including large numbers of fungi and actinomycetes, inhabiting tropical fruits (Rale and Vakil, 1984). Techniques can be devised for the detection of a single yeast species or genus. Phaff et al. (1978) described several examples of these. Dekkera (anamorph Brettanomyces) species can be isolated from spoiled wines by using a medium containing 100 mg/liter cycloheximide and 10 mg/liter thiamine to meet the specific vitamin requirement of these yeasts. The lactose-fermenting Kluyveromyces species can be isolated from whey and dairy sources on a medium containing lactose as a single carbon source and at an elevated incubation temperature of 45OC. The fodder yeast P. jadinii (anamorph C. utilis) contaminants in baker's yeast can be demonstrated by the ability of the former to assimilate nitrate. A rather broad group of yeasts possesses the physiological property of tolerating a low a,. These xerotolerant species are able to grow at rather high sugar and/or salt concentrations, and for their detection a medium, DG18, containing 18% glycerol proved to be very suitable (Hocking and Pitt, 1980). Comparative studies showed that the recovery of yeasts on this medium was greater than on DRBC or other media (Dijkmann, 1986).
E. NOVEL TECHNIQUES
In recent years a number of rapid instrumental and automated techniques have been developed for the detection and estimation of microorganisms, among them yeasts. These include radiometry, microcalorimetry, membrane filtration, epifluorescent microscopy, impedimetry, bioluminescence, and immunological methods ( Jarvis and Easter, 1987). Some of these techniques appear particularly useful for detecting yeast cells and their activity. Radiometric analysis of metabolic activity (Hatcher et al., 1977), electric measurement of cell growth via changes in conductivity or impedance (Evans, 1982; Henschke and Thomas, 1988), and determining cell mass by the bioluminescent ATP
234
T.DEAK
method (LaRocco et al., 1985; Graumlich, 1985; Pate1 and Williams, 1985), all allow continuous automatic monitoring using commercially available instruments. The main advantage of these techniques is that they assess not only the microbial quality of a food but also provide a way of predicting the shelf life. Specific immunological methods, e.g., the enzyme-linked immunosorbent assay (ELISA)has also been adapted to the detection of yeasts (Kuniyaki et al., 1984) Two improvements of traditional enumeration techniques have increased the rapidity and efficiency of counting. One is the spiral plate technique (Zipkes et a]., 1981);the other is hydrophobic grid membrane filtration (Brodsky et al., 1982). Though both were found useful with yeasts, they require specialized equipment. Of the microscopic methods, microcolony counting (Andrews, 1982) suffers from the disadvantage of manual operation. The direct epifluorescent technique has been automated, but the filtration is still labor intensive (Koch and Gibson, 1986; Rodrigues and Kroll, 1986). Jarvis and Easter (19871, while acknowledging the many advantages of these novel techniques, emphasized the need for further improvements and practical experience before the methods can be widely accepted for practical applications. VI. Methods of Identification
Accurate identification of yeast isolates is an essential part of the analysis of the yeast flora of a food in an ecological study. Identification of species allows technologists to evaluate the spoilage potential of yeasts by contrasting their physiological properties to the ecological attributes of the food system. It is obvious that proper identification of yeasts occurring in foods would form a sound ecological basis for the improvement of processing technology and product quality. The traditional method of yeast identification requires thorough expertise, and is a complex, time-consuming, and expensive procedure. In contrast to classification, which considers data obtained by sophisticated methods of molecular biology and biochemical analysis (Kurtzman and Phaff, 1987), identification of yeasts is generally based on morphological and physiological features that can be determined by routine diagnostic tests. Traditional identification procedures rely heavily upon morphological characteristics of sexual reproduction, whereas physiological characteristics (fermentation and assimilation properties] are mainly considered for the determination of species (van der Walt and Yarrow, 1984; Kreger-van Rij, 1987; Lachance, 1987).
FOODBORNE YEASTS
235
A. NEWAND IMPROVED IDENTIFICATION METHODS Taxonomy of yeasts is being reformed by modern methods of molecular biology and biochemistry. Improvements of identification lag behind these developments. Recently, newer methods and more advanced techniques of identification have been developed and differ from the traditional techniques. These are based on fingerprinting of nucleic acids (Hoeben and Clark-Walker, 1986; Lachance et al., 1986; Dubourdien et al., 1987); electrophoresis of chromosomal DNA (Viljoen et a]., 1988), proteins (van Vuuren and van der Meer, 1987; Kim et al., 1988), and enzymes (Brousse et a]., 1985; Sidenberg and Lachance, 1986; Yamada et al., 1987); and gas-chromatographic analysis of amino acids (Vasconcelos and Chaves des Neves, 1985) and cellular lipids (Viljoen et a]., 1986; Kock and van der Walt, 1986; Cottrell et al., 1986; Tredoux et a]., 1987a). None of these methods can be used for routine identification as yet. Although both nucleic acid sequencing and restriction enzyme pattern analysis are sensitive methods for distinguishing and comparing strains of a species, they cannot be applied for identification of broad groups of yeasts; moreover, the methods require laborious biochemical preparatory work and sophisticated equipment. Electrophoresis of total soluble proteins has been used to distinguish strains within a single species. Comparison of various enzymes by electrophoresis and isoelectric focusing in polyacrylamide gels seems more promising, but identification of yeasts at the species level requires complementary use of more sensitive techniques, e.g., the enzymogram technique (Drawert and Bednar, 1984). The gas chromatography of lipids cannot be performed without expensive apparatus and computerized data bases; moreover, the fatty acid composition of cells is strongly influenced by the cultivation conditions (Smit et a]., 1987). The traditional identification method, though it is the only one acceptable for taxonomical purposes, requires considerable experience and skill in the performance and evaluation of some 90 specified tests. The determination of a large number of characteristics is hardly a feasible task in industrial practice for routine identification of hundreds of strains. Efforts have been made to facialitate the identification by computerizing strain data (Tredoux et a]., 1987b; Tong et a]., 1988), and generating keys by computer (Barnett et al., 1983; 1985; Kirsop et a]., 1986; COMPASS, 1986). These computer-assisted identification systems also require numerous (50-80) tests and can be applied provided a program and all data are at hand.
236
T. DEAK
Within the past decade, manual and automated commercial systems have been developed (e.g., API ZOC,Uni-Yeast-Tek, Quantum 11, Automicrobic, and others), offering convenience, ease of storage, and rapid and reliable identification (Land et a]., 1984; Salkin et al., 1985; Land and Salkin, 1987; Lin and Fu-Jen, 1987). All of these manual and instrumental systems have been devised to provide identification only for clinically important yeasts, including in their data bases only 20-40 species. Attempts to adapt them to the identification of foodborne yeasts have been only partially successful. They could be used for identification of nonclinical yeasts provided their data bases were extended and a few basic tests were included in the kits (Subden eta]., 1980; Schmidt, 1980; Deak and Beuchat, 1987). The above problems led some food mycologists to elaborate simple schemes for identification of yeast isolates. These make use of morphological observations on selective media and under the light microscope, and/or integration of ecological data and selected determinative tests (Beech et al., 1968; Davenport, 1979; Rodrigues de Miranda, 1984; Pitt and Hocking, 1985). These keys, specially designed for the most important foodborne yeasts, consider only a small number of species and rely on a few tests, hence their correctness in identification is strongly limited. The requirement of a rapid and clear-cut identification system for a wide range of foodborne yeast remains a real need.
B . THESIMPLIFIED IDENTIFICATION METHOD For monitoring food quality and technology and for ecological surveys of foods, one is interested in the general profile of the yeast flora and the dominant species, whose physiological attributes determine the fate of food under given environmental conditions (Mossel, 1971; Deak, 1979). Although foods represent widely diverse niches from a microecological point of view, the occurrence in foods of many yeasts that have adapted to their specific habitats is highly improbable (Davenport, 1977; Phaff and Starmer, 1980). Hence it is possible to select yeasts that have been found only in foods and devise for these a simplified identification scheme by carefully selecting those traditional diagnostic tests that are most efficient for discriminating yeasts. The elaboration of simplified keys for foodborne yeasts has been described in detail (Deak, 1986a; Dehk and Beuchat, 1987). Two keys have been developed; one covers a wide range of foodborne yeasts (over 200 species) and the other is restricted to the most frequently occurring species. In the following discussion, a revised and improved version of a restricted and simplified identification scheme will be described.
FOODBORNE YEASTS
237
The key presented herein is restricted to those yeast species that occur most frequently in foods. The selection of these species is based on an extensive survey of the literature since the 1950s. A list of 215 species reported from foods has been compiled (Detlk and Beuchat, 1987). In that list, 43 yeast genera are represented, 10 of them by a single species only. Occurrence of some 80 species was registered only once; many others occurred infrequently. According to the type of food, the greatest number of yeasts resides on fruits, fruit products, and beverages (wine and soft drinks), from which about a hundred yeast species were described. Some 60-70 species form the yeast flora on meat and meat products, but only about 30 species can be found in foods, which offer a more restricting environment, such as salted, brined, and fermented products, as well as those containing high sugar concentration. (The yeast flora of specific foods was discussed under Section IV.) In all, about 60-70 species can be considered as commonly associated with various foods, encountered mainly in spoilage. It is these for which an identification key has been constructed by applying simplified identification methods. The simplified identification method consists of selected tests that form the basis of a master key, leading to subgroups, and then, within each subgroup, a dichotomic key is given, leading to species. The majority of tests are traditional carbohydrate assimilations performed by the pour plate auxanographic method. The following carbohydrates are arranged (five per petri dish) on inoculated and solidified yeast nitrogen base medium (Difco):maltose, raffinose, galactose, cellobiose, trehalose (plate l), mannitol, erythritol, inositol, melibiose, and xylose (plate 2). Observations are made for 7 days of incubation at 25-28°C. In addition to sugar assimilation, fermentation of glucose, splitting of urea, and assimilation of nitrate are tested. Glucose fermentation is indicated by gas formation in 2% glucose broth in Durham tubes. Urease activity is tested in freshly prepared urea broth (Difco) incubated for 4 hours at 37"C, and nitrate assimilation is tested on agar slants according to the method of Pincus et al. (1988). These basic biochemical tests are further supplemented by morphological observation for the occurrence of sexual spores, arthroconidia, and true and pseudohyphae. Microscopic observation is made using unstained wet mounts and potato agar slide cultures. No specific procedures are to be made to demonstrate formation of sexual spores, as this trait is not used in the key. However, spores can sometimes be observed during microscopic investigation, and this is then a valuable piece of information for identification. Formation of conjugation tubes and clumping of cells are often hints of sexual formation of spores. In addi-
238
T.DEAK
tion to microscopic morphology, macroscopic properties of growth are also considered and are ascertained without further tests (e.g., color of colony or formation of pellicle). The routine regime of work followed for the application of the simplified methods has been described previously (DeBk and Beuchat, 1987). Two petri dishes and three test tubes are used to examine one strain for the above characters, and having read the results and followed the entries of the key, identification can be arrived at in most cases. In a few cases other tests are also necessary to complete identification (e.g., growth at 37°C;growth in the absence of added vitamins), and these can be performed after the basic investigations are done. The standard methods of identification as described by Lodder (1970)and Kreger-van Rij (1984)can be applied for these tests. For the sake of simplicity the master key is arranged in such a way that as a first step a group characterized by a single specific property is split and the remaining species are further divided by other characters, forming further subgroups. Eventually, five tests are used for separating six subgroups, each containing on the average 13 species. The rest of the tests are used for identification within each subgroup. Individual identification keys for each of the six subgroups formed by the master key are arranged in the familiar dichotomous fashion (Table 11).The physiological and morphological characters are listed (left column, Table 11), for which results can be adequate (positive; middle column) or inadequate (negative; right column). In either case, the answer may be a number referring to another entry in the key, or it may be the name of a species, with which the unknown strain can be identified with high probability. The accuracy of identification depends mainly on the certainty of results of the five basic tests. An erroneous reading of a result leads to a subgroup within which the final identification is also mistaken or improbable. It should be noted that if a small battery of tests is used, there is a certain risk of the misidentification of the organisms. Moreover, the simplified scheme includes only selected yeast species, and even correct results differring from those in the keys might occur sometimes. Hence, species identification should not be based only on those features included in the key. The number of data available always exceeds that considered in the key. To confirm identification, all data are to be compared with the characters of the likely identified species. To facilitate this, the most probable properties of species are summarized in a tabulated form (Table 111).
TABLE I1 KEYSFOR SIMPLIFIED IDENTIFICATION OF YEASTS RESTRICTEDTO COMMON FOODBORNE SPECIES~ Characterb Master key 1. Urease 2. Erythritol 3. Nitrate 4. Cellobiose 5. Mannitol Group 1: urease + 1. Red colony 2. Nitrate 3. Inositol 4. Galactose 5. Raffinose 6. Maltose 7. Arthroconidia 8. True hyphae 9. Nitrate 10. Raffinose 11. Nitrate 12. Pseudohyphae
Group 2: eythritol + 1. Nitrate 2. Maltose 3. Galactose 4. Maltose 5. True hyphae 6. Galactose 7. Raffinose 8. Glucose fermentation 9. Galactose
Positive
Negative
Group 1 Group 2 Group 3 Group 4 Group 5
2 3 4 5 Group 6
2
6 5
n
Y.
Rhodosporidium infirmominiatum Rhodotorula glutinis Rhodotorula mucilaginosa 7 8 9
Trichosporon pullulans Schizosaccharornyces pombe Cryptococcus albidus Cryptococcus humicolus 2
3
Pichia anomala 5 6
Hyphopichia burtonii 8
Debaromyces polymorphus Pichia farinosa
4
Sporobolomyces roseus Rhodotorula minuta Yarrowia lipolytica 11 10
Trichosporon cutaneum Schizosaccharomyces octosporus 12 Cryptococcus laurentii 4 Candida boidinii Pichia subpelliculosa 9 7
Endomyces fibufiger Candida diddensiae Debaramyces hansenii Candida cantarelli (continued )
TABLE I1 (Continued) Characte?
Positive
Negative
+
Group 3: nitrate 1. Acetate produced 2. True hyphae 3. Glucose fermentation 4. Maltose 5. Maltose 6. Galactose 7. Trehalose 8 . Cellobiose 9. Mannitol 10. Galactose
3
2
Dekkera intermedia
Dekkera anomala
5
4
Pichia canadensis 6
Wickerhamiella domercqiae 9
7 Candida versatilis Pichia jadinii 10
Candida magnoliae
8
Candida etchellsii Citeromyces matritensis Candida lactis-condensii Candida norvegica
N
0
+
Group 4 cellobiose 1. Acetate produced 2. True hyphae 3. Bipolar budding 4. Large cells 5. Maltose 6. Raffinose 7. Maltose 8. Hyphae 9. Pellicle 10. Growth at 37°C 11. True hyphae 12. Glucose fermentation 13. Trehalose 14. Growth at 37°C 15. Pseudohyphae 16. Reddish colony
3
2
Dekkera intermedia
Dekkera anomala
6 5
4
Saccharomycodes ludwigii Hanseniaspora osmophila 7 8 9
10
Pichia ohmeri Zygoascus hellenicus Zygosaccharomyces fermentati Kluyveromyces lactis 15
Candida tropicalis Metschnikowia pulcherrima
Hanseniaspora uvarum 14
13 12 11
Candida intermedia Pichia guilliermondii Debnromyces hansenii Kluyveromyces marxianus 16
Pichia etchellsii Candida sake
+
N
*
Group 5: mannitol 1. Glucose strongly fermented 2. Conjugation 3. Raffinose 4. Maltose 5. Large cells 6. Pseudohyphae 7. Growth at 37°C 8. Raffinose 9. Germ tubes 10. Trehalose 11. Maltose 12. Arthroconidia 13. Growth at 37°C 14. Maltose 15. Trehalose
"
L
3 Zygosaccharomyces microellipsoideus Zygosaccharomyces rouxii Zygosaccharomyces bailii 7 8
Kluyveromyces marxianus Candida albicans 11
Kluyveromyces thermotolerans Geotrichum candidum 14 Candida catenulata Candida zeylanoides
" 1
11
6
4 5 Zygosaccharomyces bisporus 10 Candida sake 9
Lodderomyces elongisporus Candida apicola Torulaspora delbrueckii 13 15 Candida rugosa Candida vini
L
Group 6: mannitol 1. Large cells (>5 pm) 2. Galactose 3. Melibiose 4. Conjugation 5. Raffinose 6. Raffinose 7. Trehalose 8. Maltose 9. Pseudohyphae 10. Growth at 37°C 11. Xylose 12. Growth without vitamins 13. Trehalose
2
3 Saccharomyces pastorianus 5 Zygosaccharomyces microellipsoideus 7 8
Saccharomyces kluyveri 10 11
Pichia fermentans Issatchenkia orientalis Candida glabrata
4 Saccharomyces bayanus Saccharomyces cerevisiae 6
Zygosaccharomyces bisporus 9
Candida stellata Saccharomyces exiguus 13 Pichia membranaefaciens 12
Issatchenkia terricola Candida inconspicua
See text for explanation of key. Characters include assimilation of substrates (cellobiose, erythritol, galactose, inositol, maltose, mannitol, melibiose, nitrate, raffinose, trehalose, and xylose); urease +, hydrolysis of urea. a
I
h X
>
3 a m
+ c
rn a 0
e
-E .-
24
.-I
M
A
W
u
U
-0
m
n
I
242
Debaromyces polymorphus Dekkera anomala Dekkera intermedia Endomyces fibuliger Geotrichum candidum Hanseniaspora occidentalis Hanseniaspora osmophila Hanseniaspora uvarum Hyphopichia burtonii Issatchenkia orientalis Issatchenkia terricola Kluyveromyces lactis Kluyveromyces marxianus Kluyveromyces thermotolerans Lodderomyces elongisporus Metschnikowia pulcherrima Pichia anomala Pichia canadensis Pichia etchellsii Pichia farinosa Pichia fermentans Pichia guilliermondii Pichia jadinii Pichia membranaefaciens Pichia ohmeri Pichia subpelliculosa Rhodosporidium infirmominiatum Rhodotorula glutinis Rhodotorula minuta Rhodotorula mucilaginosa Saccharomyces cerevisiae
Acetate, filament Acetate Spores hat shaped
- - - -
- - - -
+ +++++ + +-+++
- - - - - - -
- - - - - - - - - - - - - v -
_ _ _ ++ ++++-
-++++ + + + +
-
+ + v + + v - v v - v v
- - - -
+ + v + v + + v + +
+++++
v
v - - v + v v + v + + v v + v v
+ - - v +
+- ++-++
- - - - -
- - v v v
+--++ +--++
- - - v - v v + + - v - - - - v + - - v v v v - v - + - - v - v - - - + - - v - v v - - - - - + - v v v
- -
v - -
- -
+--
- -
++-
- - + + - + - t v - v v - +
+ + - +
- - - -
- - - - - - -
v - -
Apiculate Apiculate Apiculate Spores hat shaped Spores round Spores round Spores round, esters Spores round, esters Spores round Spores round Spores needle shaped Spores hat shaped Spores hat shaped Spores round Spores round Spores hat shaped Spores hat shaped Spores hat shaped Spores roundihat shaped Spores round/hat shaped Spores hat shaped Amylo + , slimy Amylo -, slimy Amylo Amylo -, slimy Spores round, lysine (continued)
TABLE I11 (Continued) Properties" Species
Saccharomyces bayanus Saccharomyces pastorionus Saccharomyces exiguus Saccharornyces kluyveri Saccharomycodes ludwigii Schizosaccharomyces octosporus Schizosaccharomyces pombe Sporobolomyces roseus Torulaspora delbrueckii Trichosporon cutaneum Trichosporon pullulans Wickerhamiella domercqiae Yorrowia lipolytica Zygooscus hellenicus Zygosaccharomyces bailii Zygosacchoromyces bisporus Zygosaccharomyces fermentati Zygosaccharomyces microellipsoides Zygosaccharomyces rouxii
a b c d e
-_--
v v
--__
f g h i j
+ v - + v + + + + v
k l m n o
- - - - -
+----
- - - - - - + + + - - - - - -
_ - -
v v
++++- +----
p q r s t
+ + + + + +
u v w x y
Spores round, lysine Spores round, lysine Spores round, lysine Spores round, lysine + Apiculate Spores round Spores round Amylo Spores round
- v v v - v v v v - - - v + v - - v - - v +
+--++
+ - - + v
+ + v v + v v v + v + v + v v
- - + - +
_ _
+ - + v +
- - _ -
+ +-+++ +++++
_ - - -
+ --_ ++ - - - - + - _ _ - +
v - -
- - v - - - - - - + - v v + v + v v + - v - v v + v v v + _ - v - - - - - -
- - - - -
-_--
+
Spores round Spores roundthat shaped
- + - v v + + - v v + - - v + - - v v + + + + v - + + v v - v v -
- - - - -
- - - - - - - - -
+----
+---+ ++-++ + - - - v + - V V +
Other
_-
v - -
Spores round Spores round Spores round Spores round Spores round
a a, Urease; b, erythritol; c, nitrate; d, cellobiose; e, mannitol; f , maltose; g, raffinose; h, galactose; i, trehalose; j, melezitose; k, melibiose; 1, lactose; m, rhamnose; n, xylose; 0,inositol; p. fermented glucose; q, cycloheximide;r, without vitamin; s, growth at 3%; t, 50% glucose; u, arthroconidia; v, true hyphae; w, pseudohyphae; x, pellicle; y, red colony. Notation in the table body has the following meaning: +, positive; -, negative; v, variable reaction; Amylo: starch production.
FOODBORNE YEASTS
245
C. DESCRIPTION OF MAINGROUPS OF FOODBORNE YEASTS The groups are described in the order of the groups of the key in Table 11. 1. Urease-Positive Yeasts
The first group includes urease-positive yeasts, among them all basidiomycetous species considered. As interesting as they are from a taxonomical standpoint, the small groups of basidiomycetous yeasts have little practical importance to the food industry. The basidiomycetous character can be indicated by the formation of dicaryotic hyphae with clamp connections and more unequivocally by the development of basidia or thick-walled teliospores. Most basidiomycetous yeasts are, however, heterothallic and the different mating types develop separate colonies. Hence, sexual reproduction can be observed only rarely. Nevertheless, the DBB color reaction and the urease test have proved to be a useful way of revealing the basidiomycetous character of anamorphic forms (Hagler and Ahearn, 1981). The positive color reactions often coincide with the formation of carotenoid pigments, mucoid colonies, or ballistoconidia, and with the lack of fermentation. Based upon these traits, the basidiomycetous nature of an anamorphic yeast can easily be recognized even in the absence of a known teleomorphic (perfect) state (Weijman et al., 1988). According to the rules of yeast nomenclature, a species has to bear the name of the teleomorph, whenever it is known. Accordingly the basidiomycetous species may belong to the genera Sporidiobolus, Rhodosporidium, Leucosporidium, Filobasidium, and others (van der Walt, 1987). However, as a rule, they are isolated from natural sources in their anamorphic forms, whose names are better known, such as Sporobolomyces, Rhodotorula, and Cryptococcus. Proposals have been made that the genus Candida be restricted only to ascomycetous anamorphs, and those former Candida species possessing basidiomycetous characters have been transferred to the genus Rhodotorula or Cryptococcus (van der Walt, 1987; Weijman et al., 1988).Of the foodborne yeasts, only about 15% are of basidiomycetous species. They are mostly associated with plant materials and occur infrequently; however, a few species are rather common and widespread in various foods. The red-colored and often mucoid colonies of Rhodotorula species easily catch the eye. The most common species is R. glutinis, which has been reported from fruits, vegetables, grains (Spicher and Mellenthin, 1983; Rale and Vakil, 1984; Messini et al., 1985; Parish and Caroll, 1985;
246
T. DEAK
DeAk and Beuchat, 1988), alcoholic and nonalcoholic beverages (Put et al., 1976; Lafon-Lafourcade, 1983; Ruiz et al., 1986; Back, 1987), milk, dairy products (Suarez and Inigo, 1982; Fleet and Mian, 1987),fresh and chilled meat, poultry, fish, seafoods (Comi and Cantoni, 1985; Banks and Board, 1987; Jay, 1987), and chilled salads (Kobatake and Kurata, 1980b). The somewhat less frequently observed species R. mucilaginosa (R. rubra) and R. minuta, as well as the similarly red-pigmented S. roseus, are mainly found on fruits and in fruit products (Buhagiar and Barnett, 1971; Rale and Vakil, 1984; De6k and Beuchat, 1988),as well as on meat and in meat products (Johannsen et al., 1984; Comi and Cantoni, 1985; Jay, 1987). The most important physiological property of these species is their capability of growth at low temperatures (Davenport, 1980a). In turn, their heat resistance is low (for R. mucilaginosa the D value at 51°C was in the range of 30 minutes) (Beuchat, 1983a). Although some Rhodotorula strains are able to grow at a 10% NaCl concentration and possess lipolytic activity (Comi and Cantoni, 1985),they are not among the determining spoilage yeasts in foods. The Cryptococcus species are characterized by the assimilation of inositol and glucuronate (Barnett et al., 1983). This holds true for R. infirmo-miniatum, which has a Cryptococcus anamorph. These yeasts share the food habitats with the rhodotorulas, and are mostly found in fruits, juices, must, vegetables (Buhagiar and Barnett, 1971; Parish and Caroll, 1985; Deak and Beuchat, 1988), grains, flour (Kurtzman et al., 1970; Spicher and Mellenthin, 1983), meat, poultry, fish (Dalton et al., 1984; Lowry and Gill, 1984; Jay, 1987), and sometimes in cheese and chilled salads (Banks and Board, 1987; Kobatake and Kurata, 1980a). The most frequenty observed species are C. albidus and C. laurentii. Among cryptococci there are a number of psychrotrophic and even psychrophilic strains growing in the temperature range from 0 to 5°C (Kobatake and Kurata, 1980b). Cryptococcus humicolus has been transferred from the genus Candida and develops both true hypha and pseudohypha. The genus Trichosporon is characterized by true hyphae breaking into arthroconidia as well as by a budding yeast phase. The morphologically similar genus, Geotrichum, is distinguished by its negative urease reaction and lack of budding cells (Weijman, 1979). Two species of Trichosporon, cutaneum and pullulans, are fairly widespread in various foods (Buck et al., 1977; Spicher and Mellenthin, 1983; Suresh et al., 1982; Sandhu and Waraich, 1984; Johannsen et a]., 1984; Ravelomanana et al., 1985). They possess extracellular enzymes, proteases, lipases, and pec-
FOODBORNE YEASTS
247
tinases, and often contribute to spoilage (Kobatake and Kurata, 1983b; Comi and Cantoni, 1983). In addition to the basidiomycetous yeasts, two endomycetous genera are exceptional in that they also give positive urease reactions (but are negative in the DBB test). These genera are Yarrowia and Schizosaccharomyces, which are also peculiar in other respects. The yeast Y. lipolytica has long been known for its ability to split fats. It occurs frequently on meat and meat products, butter, mayonnaise, salad dressings, and cheese (Muys, 1971; Kobatake and Kurata, 1980a,b; Hsieh and Jay, 1984; Brocklehurst and Lund, 1985; Banks and Board, 1987), and is also often isolated from fruits and soft drinks (Sand, 1974; Put et al., 1976). Since the discovery of its mating types, the species has been classified in various perfect genera such as Endomycopsis, Saccharomycopsis, and eventually Yarrowia (van der Walt and von Arx, 1980). The yeast Y. lipolitica forms budding cells, pseudohyphae, and septate hyphae, is nonfermentative, and assimilates only erythritol and mannitol but none of the common mono- and disaccharides (Barnett et a]., 1983). The genus Schizosaccharomyces belongs to the group of vigorously fermenting classical yeasts, from which it differs by the mode of vegetative reproduction called fission. Budding never occurs. The cell wall composition of these species also differs from the rest of the yeasts, and studies on 5 S ribosomal RNA have revealed that this genus represents a separate phylogenetic branch among yeasts (Walker, 1985). It has been proposed to split the four recognized species into three separate genera (Schizosaccharomyces, Octosporomyces, and Hasegawaea; von Arx and van der Walt, 1987), but for convenience the single former name is retained here. Schizosaccharomyces species are characterized by strong fermentation of sugars, They require vitamins for growth and often develop poorly on many media and in assimilation tests. Spores are formed after conjugation of cells and this is accompanied by the synthesis of starchlike compounds whose presence in the mature sporangia can easily be demonstrated using iodine solution. Schizosaccharomyces species develop well at 37°C and slightly above. They are xerotolerant, particularly S . octosporus [Octosporomyces octosporus), whose occurrence is mainly confined to high-sugar-containing products (Tokouka et al., 1985; Poncini and Wimmer, 1986).More widespread and frequent is S. pombe, which often occurs in must and wine and is able to convert malic acid to ethanol and C02 (Delfini, 1985). It is rather resistant to sulfur dioxide and preservatives (Warth, 1985).
248
T. DEAK
2. Erythritol-Assimilating Yeasts
The second group is split from the rest of the yeasts by the assimilation of erythritol, which is a fairly stable property. Of the yeasts grouped here, D. hansenii is variable in this trait, and, if negative, it keys out in group 4. Debaromyces hansenii is one of the most common foodborne yeasts. It is characterized by small spherical cells in which a single spore may develop. Hence, it is not easily observable under the microscope; however, colonies become brown when spores develop abundantly. The anamorphic state, Candida famata (Torulopsis candida), is frequently found. Debaromyces hansenii ferments poorly if at all, whereas a similar but less frequent species. Debaromyces polymorphus shows rather strong fermentation. Debaromyces hansenii typically occurs in salt-containing foods such as cured meats, ham, sausages (Comi and Cantoni, 1980a, 1983; Dalton et al., 1984), fermented olives, brined vegetables (Ravelomanana et al., 1985; Garrido Fernandez et al., 1985), and soy sauce (Mizunoma, 1984). It grows in 21% (w/w) NaCl or 50% (w/w) glucose concentrations and its minimum a, value for growth is 0.65 (Tilbury, 1980b). The species is equally common in cheeses and other dairy products (Schmidt and Lenoir, 1980; Fleet and Mian, 1987), fish, shellfish (Jay, 1987), high-sugar products (Tokouka et al., 1985), fruit juices, must, wine, and beer (Suresh et al., 1982; Dragoni and Comi, 1985; Back, 1987). It is rather sensitive to heat; Beuchat (1981a) measured a D value of 1 2 minutes at 48°C. Debaromyces polymorphus has been found in ham and sausage (Leistner and Bem, 1970), wine (Lafon-Lafourcade, 1983), and dough (Barber et al., 1983). Two yeasts in this group, P. anomala and P. subpelliculosa, are better known as Hansenula species; however, Kurtzman (1984) proposed to merge the two genera. Both species strongly assimilate nitrate. Pichia anomala can be distinguished by its ability to grow without added vitamins. It primarily assimilates galactose, whereas P. subpelliculosa does not; in turn, the latter produces more abundant pseudohyphae and often also true hyphae. Spores, when they develop, are hat-shaped. The two species share similar habitats, such as fruits, must, wine, and fermented and pickled vegetables (Etchells et al., 1975; Rale and Vakil, 1984; Dragoni and Comi, 1985; Ravelomanana et al., 1985; Brackett, 1987). Of the two, P. anomala is found more frequently. Both are moderately xerotolerant (minimum a, for growth is 0.75; Tilbury, 1980b) and may occur in raw sugar, molasses, and confectionery products (Tokouka et al., 1985). Pichia subpelliculosa has been found in dough (Barber et
FOODBORNE YEASTS
249
al., 1983), and P. anomala has been found in grains, flour (Spicher and Mellenthin, 1983), poultry, beer, and soft drinks (Put et al., 1976; Hardwick, 1983;Jay, 1987).It possesses a moderate tolerance to preservatives (Warth, 1985). Another nitrate-assimilating yeast in this group is C. boidinii. Its additional distinguishing property is the long, cylindrical shape of its cells, forming well-developed pseudohyphae. Candida boidinii occurs in soft drinks, wine, and beer (Sand et al., 1976; Kunkee and Goswell, 1977; Back, 1987), and also in fermented olives (Garrido Fernandez et al., 1985) and dairy products (Tilbury et al., 1974). Candida diddensiae is characterized by its irregular cell shape and pseudohyphae. It has been recovered from meat, fish, and shellfish (Buck et al., 1977; Hsieh and Jay, 1984; Jay, 1987), as well as olives and soft drinks (Sand, 1974; Garrido Fernandez et al., 1985). Candida canterellii and P. farinosa do not produce pseudohyphae and have rather narrow assimilation spectra. Both can be found in must and wine (Kunkee and Goswell, 1977),the former in jams, dairy products, and shellfish (Tilbury et al., 1974; Tilbury, 1976; Buck et a]., 1977), the latter in soy sauce, fruits, and fermenting cocoa (Noda et al., 1982; Pignal et al., 1985; Ravelomanana et a]., 1985). Hyphopichia burtonii and E. fibuliger are characterized by producing true hyphae. In their filamentous form they are typical representatives of the so-called yeastlike organisms. Both are frequent in dough and bread (Spicher, 1986), as well as in certain oriental fermented foods (Cronk et al., 1977; Sakai et al., 1983). They also occur on fruits and in beverages (Rale and Vakil, 1984; Dragoni and Comi, 1985). Endomyces fibuliger is strongly lipolytic and may cause spoilage of cooking oil (Spicher, 1984). 3. Nitrate-Assimilating Yeasts
Assimilation of nitrate is a very stable property among yeasts and is used for distinguishing the third group in the simplified identification system. Nevertheless, the peculiar group of Dekkera (anamorph Brettanomyces) species is variable in this property and a positive reaction may be masked by acid production when tested on an indicatorcontaining medium, according to Pincus et al. (1988). A remarkable property of the yeasts in the genus Dekkera is their acetic acid production, which lends an easily recognizable odor to their cultures. These species ferment glucose aerobically and grow very slowly in all media. They develop only tiny colonies that are short-lived due to acid production. All species are confined to beverages, especially
250
T. DEAK
beer and soft drinks (Back, 1987; Verachtert and Dawoud, 1984; Ison and Gutteridge, 1987). Perhaps the most frequently seen species is D. intermedia, and of the several other species with rather similar characteristics, D. anomala is recognizable by its branching filamentous cells. Each Dekkera species has its anamorph counterpart in the genus Brettanomyces (Jong et al., 1985). Of the nitrate-positive yeasts considered in group 3, two species, W. domercqiae and P. canadensis do not ferment sugars. Cells of the former are very small, only 2-3 pm in diameter. Spore formation is rare; the anamorph is known as C. domercqiae. The species occurs infrequently; nevertheless it has been found in various foods, including dairy products (Tilbury et al., 1974), meat (Dalton et al., 1984), and wine (Kunkee and Goswell, 1977). Pichia canadensis ,and the fermenting P. jadinii were previously classified as Hansenula. Both are more frequent in their anamorphic states, Candida melini and C. utilis, respectively. They can be found in various foods, for example, wine, fermented vegetables, and dairy products, though neither is common (Tibury et al., 1974; Lafon-Lafourcade, 1983; Comi et al., 1981a). Candida utilis is a well-known fodder yeast produced in large scale on molasses and agricultural wastes (Berry et al., 1987).
A number of common foodborne Candida species belong to this group. Most of them were previously described as Torulopsis because they do not form pseudohyphae. This was considered an unstable property, and the former Torulopsis genus was merged with Candida (Yarrow and Meyer, 1978), with the consequence that the latter became very large and heterogeneous. Further proposals have been made that the genus Candida should retain only endomycetous anamorphs (Weijman et a]., 1988). Of the species considered here only one, Candida glabrata, is known in teleomorphic form: Citeromyces matritensis. This and the other Candida species (versatilis, lactis-condensi, etchellsii, and magnoliae), with the exception of C. norvegica, possess a certain degree of xerotolerance. They grow in 11% (w/w) NaC1; C. etchellsii grows even in 21% NaCl concentration, and C. lactis-condensi and C. matritensis grow in 57% (w/w) glucose (a, 0.865) concentration; in sucrose-glycerol syrup the minimum a, for growth was found to be 0.7 (Tilbury, 1980b). These species can often be found in foods with high sugar and salt concentrations (brines, concentrates, soy sauce, dried fruits) (Etchells et a]., 1975; Tilbury, 1976; Madan and Gulati, 1980; Noda et al., 1982),but they also frequently occur in fruit juices, wine, and dairy products (Goto, 1980; Suriyarachchi and Fleet, 1981; Lafon-Lafourcade, 1983).
FOODBORNE YEASTS
251
Candida versatilis, C. magnoliae, and C. norvegica has been found in meat and shellfish (Buck et al., 1977; Dalton et al., 1984; Comi and Cantoni, 1985). 4. Cellobiose-Assimilating Yeasts
The fourth group of the simplified identification system comprises yeasts that are negative in the previous tests (urease hydrolysis and erythritol and nitrate assimilation), but do assimilate cellobiose. Only one species, C. sake, is variable in this respect, and, if negative, it falls into the next group. In turn, three yeasts discussed previously may be considered here, too, i.e., D. hansenii, if it fails to assimilate erythritol, and D. anomala and D. intermedia, if their nitrate assimilation is negative. The characteristic cell morphology (apiculate, lemon-shaped cells) easily distinguishes the yeasts that bud in a bipolar configuration. The unusually large cells (over 10 pm in diameter) set S . ludwigii apart from the rest of the apiculate yeasts belonging to the genus Hanseniaspora. Slight differences can be found among Hanseniaspora species, and all have an anamorphic phase called Kloeckera. Saccharomycodes ludwigii and the Hanseniaspora species ferment strongly. The former possesses a high resistance to sulfur dioxide, but has low ethanol tolerance (Minarik and Navara, 1977; Goto, 1980). Hanseniaspora species also tolerate less than 6% (v/v) ethanol and are most frequently found at the start of the spontaneous fermentation of grape must (Parish and Caroll, 1985). The most common species, H. uvarum (K. apiculata), also occurs in beer, soft drinks, fruit juices, and on fresh fruits (Stollarova, 1976; Suresh et al., 1982; Hardwick, 1983; Dragoni and Comi, 1985). The habitat of S . ludwigii is confined exclusively to beverages, particularly wine and cider (Carr, 1984; Heard and Fleet, 1986a; Back, 1987). The ability to assimilate raffinose divides into two groups the rest of the yeasts considered in the fourth group of the key. Vigor of fermentation and formation of pseudohyphae and pellicle are the useful distinguishing characteristics for the identification of species. For example, D. hansenii ferments weakly or not at all, and usually forms a thick pellicle on the surface of liquid media, although it does not develop pseudohyphae. The species in the genera Kluyveromyces and Zygosaccharomyces strongly ferment glucose. In the genus Kluyveromyces, spores are mostly bean-shaped and liberate easily from the sporangium. However, heterothallism often precludes spore formation and the anamorphs are well known as Candida species. A number of previously described
252
T. DEAK
Kluyveromyces species were lumped into a single one, K. marxianus, based on sexual hybridization and DNA homology studies. Due to this, however, most characteristics of the species become variable and the identification is difficult. Recently, some species have been reinstated, and both K. marxianus (synonyms K. fragilis and K. bulgaricus; anamorphs C. kefir and C. pseudotropicalis) and K. lactis (C. sphaerica) are recognized. Both species are capable of utilizing lactose; hence they are most often found in cheese and other dairy products (Schmidt and Lenoir, 1980; Engel et al., 1986; Fleet and Mian, 1987), Kluyveromyces marxianus, which is moderately xerotolerant and rather heat resistant (D, 60°C, for ascospores is 30 minutes in 10% sucrose solution; Put and De Jong, 1982b), may occur in molasses and sugar cane (Barwald and Hamad, 1984) as well as in must and wine (Kunkee and Goswell, 1977). A third species, Kluyveromyces thermotolerans, keys out in the next group because it does not utilize cellobiose, whereas Z. fermentati is a unique species among Zygosaccharomyces in that it assimilates cellobiose. Conjugating cells are often observed and this enhances identification. The species is uncommon and mostly found in must, wine, and soft drinks (Sand et al., 1976; Khayyat et al., 1982; Ruiz et al., 1986). Well-developed pseudohyphae are one of the distinguishing characteristics for four species treated here. Pichia ohmeri and C. intermedia also produce pellicles, but P. guilliermondii and C. steatolytica do not. The two Pichia species are usually heterothallic and are often found as nonsporing anamorphs, C. guilliermondii var. guilliermondii and C. guilliermondii var. membranaefaciens, respectively. The latter and C. steatolytica also produce true hyphae. The teleomorph of C. steatolytica has been recently described as Zygoascus hellenicus (Smith, 1986), but no teleomorph is yet known for C. intermedia. Pichia guilliermondii is the most frequently found member of this group in foods; it occurs in fermenting vegetables, soft drinks, wine, seafoods, syrups, and cane juice (Torok and DeAk, 1974; Buck et a]., 1977; Tilbury, 1976; Garrido Fernandez et al., 1985). Pichia ohmeri has been found in similar products (Goto and Yokotsuka, 1977; Tokouka et al., 1985; Atputharjah et al., 1986). Candida intermedia occurs frequently on meat and meat products, as well as in dairy products and beverages (Tilbury et al., 1974; Sand et al., 1976; Comi and Cantoni, 1985; Jay, 1987). Zygoascus hellenicus has been found in grapes and wine, as well as beef and shellfish (Buck et al., 1977; Goto, 1980; Hsieh and Jay, 1984; Guerzoni and Marchetti, 1987). Another four species occurring frequently in foods assimilate cellobiose but not raffinose. Candida tropicalis produces true hyphae, P. etchellsii and C. sake produce pseudohyphae, and M. pulcherrima does
FOODBORNE YEASTS
253
neither; on the other hand, its colonies turn reddish-brown when lipidcontaining chlamydospores developed. The commonest species of this group is C. tropicalis, which occurs in fresh and fermented fruits and vegetables (Suresh et al., 1982; Rale and Vakil, 1984), beverages (Put et al., 1976), and meat and dairy products (Zein et al., 1983; Jay, 1987). Candida sake is mostly found in soft drinks, wine, fermented foods (Sand, 1974; Sandhu and Waraich, 1984; Parish and Caroll, 1985; DeAk and Beuchat, 1988), and meat (Johannsen et al., 1984). Metschnikowia pulcherrima can be nearly always isolated from grape and must, and other fruits and fruit juices (Rosini et al., 1982; Suresh et al., 1982; Heard and Fleet, 1986a). Pichia etchellsii occurs less frequently in beverages, black olives, and beef, and is rather xerotolerant (Dalton et al., 1984; Dragoni and Comi, 1985; Garrido Fernandez et al., 1985). 5. Mannitol-Assimilating Yeast
The fifth group consists of yeasts assimilating only mannitol of the basic substrates included in the master key (Table 11).In this group, two genera of classical, strongly fermenting yeasts, Zygosaccharomyces and Torulaspora, are of particular importance in foods. Both were at one time considered to be Saccharomyces, but were split from this genus on the basis of a primarily haploid life cycle, whereas the genus Saccharomyces retained the primarily diploid species. The mode of sexual reproduction varies. In Zygosaccharomyces, conjugation between independent haploid cells usually precedes spore formation, whereas in Torulospora, conjugation occurs between mother cell and bud. In Saccharomyces, the diploid cells directly transform into sporangia. These features are not always easily observed and the identification of species by physiological criteria is also difficult because most of these criteria become variable after amalgamating a number of species on grounds of DNA homology, especially in S. cerevisiae and T. delbrueckii. In addition to the traditional identification tests, other criteria, not included in the simplified key, may greatly help identification. These are growth on lysine and ethylamine as well as in the presence of cycloheximide and 50% glucose. Some selective media applied in the brewery and in wine microbiology for distinguishing wild yeasts are based on these and similar criteria, and can be equally useful in identification. The Zygosaccharomyces species all grow on lysine and ethylamine and in the presence of 50% glucose. Zygosaccharomyces bailii and Z. bisporus are highly resistant to acetic acid and grow in a medium containing 1%acetate, whereas Z. rouxii does not. The delimitation of these species on the basis of utilization of sugars is uncertain. Zygosac-
254
T. DEAK
charomyces bailii is very resistant to preservatives (Thomas and Davenport, 1985; Warth, 1986); it grows on media containing 400 mglliter benzoic acid or 300 mg/liter sorbic acid, whereas Z. bisporus does not. Cells of Z. bailii are fairly large (diameter over 5 pm) compared to other Zygosaccharomyces species. Zygosaccharomyces bisporus and Z. microellipsoides are far less common in foods than are Z. bailii and Z. rouxii. The highly xerotolerant Z. bisporus is mostly confined to high-sugar products (Comi and Cantoni, 1984; Tilbury, 1976), but can be also found in beverages (Put et al., 1976), and Z. microellipsoides mostly occurs in soft drinks and wine (Sand et al., 1976; Kunkee and Goswell, 1977). With both species the assimilation of mannitol is variable and they may show up in the next group. Zygosaccharomyces rouxii is undoubtedly the most important and most frequent xerotolerant yeast; some strains are even xerophilic (Tokouka et al., 1985; Jermini and Schmidt-Lorenz, 1987a). It is often the sole yeast isolated from high-sugar products such as honey, syrups, dried fruits, and others (Tilbury, 1976; Comi and Cantoni, 1984; Tokouka et al., 1985; Jermini et al., 1987), and also from high-saltcontaining foods such as soy sauce (Noda et al., 1982; Tokouka et a]., 1985). Nevertheless, it often occurs in foods with a higher a,, for example, cheese and meats (Barnett et al., 1983; Comi and Cantoni, 1985).
The outstanding property of Z. bailii is its high tolerance and even adaptation to preservatives, which makes this organism a notorious spoilage agent in soft drinks and wine (Minarik, 1980; Sand, 1980; Warth, 1986) and in chemically preserved foods such as mayonnaise and salad dressing (Put et al., 1976; Smittle and Flowers, 1982; Baumgart et al., 1983). It is less xerotolerant than other Zygosaccharomyces species, although it frequently occurs in concentrates (Tilbury, 1976; MinArik and Hanicova, 1982). Other foods in which it has been found include bread, fermented cocoa, and fresh fruits (Ravelomanana et al., 1985; Vojtekova and Minarik, 1985; Spicher, 1986). Torulaspora delbrueckii is the only species of the genus that is widespread in foods. It commonly occurs in fruits, grapes, must, wine, soft drinks, beer, fermented vegetables, and sometimes high-sugar products and cheese (Sand et al., 1976; Tilbury, 1976; Suarez and Inigo, 1982; Ravelomana et al., 1985; Heard and Fleet, 1986a; Back, 1987; Jermini et al., 1987). Its cells are fairly small, especially compared to those of S . cerevisiae. Pseudohyphae are not produced. The species grows well on lysine, hardly or not at all on ethylamine, and also grows well in and even in 75% (w/w) glucose; the minimum a, for growth is 0.865
FOODBORNE YEASTS
255
(Tilbury, 1980b) and the temperature range is 5-40°C (Spicher, 1984). Its anamorph is known as Candida colliculosa. In its physiological properties and food niches occupied, K. thermotolerans is rather similar to T. delbrueckii. The two species differ in the mode of sexual reproduction, which is, however, not always observable. Kluyveromyces thermotolerans assimilates lysine and also ethylamine, and its anamorph is Candida dattila. In addition to the foods listed for T. delbrueckii, K. thermotolerans can be found in meat and shellfish (Bucket al., 1977; Lafon-Lafourcade, 1983;Comi and Cantoni, 1985; Put et al., 1976; Tokouka et al., 1985). A number of common Candida species belong to the fifth group. With the exception of C. apicola (formerly Torulopis apicola), each species produces pseudohyphae; C. albicans sometimes produces true hyphae. Fermentation is poor or lacking, although C. albicans and C. sake ferment strongly. The assimilation spectrum of a species is rather narrow. Perhaps the most frequently found species is C. parapsilosis, which has been found in all types of foods (Kobatake and Kurata, 1980a,b; LafonLafourcade, 1983; Johannsen et al., 1984; Spicher, 1986; Deak and Beuchat, 1988). Its relationship to the teleomorph Lodderomyces elongisporus has long been debated, but Hamajima et al. (1987) found convincing evidence that one form of C. parapsilosis corresponds to the anamorphic state of L. elongisporus, but other strains do not. Candida zeylanoides, C. catenulata, and C. rugosa are rather common in meat and meat products and also in wine (Kunkee and Goswell, 1977; Dalton et al., 1984; Banks and Board, 1987). Candida rugosa can be found in dairy products (Suarez and Inigo, 1982);C. vini and C. apicola occur in fruits and beverages (Suresh et al., 1982; Lafon-Lafourcade, 1983), and the latter is also found in high-sugar products (Tilbury, 1976). Candida albicans is the commonest human pathogenic yeast. It can easily be diagnosed by the development of germ tubes and chlamydospores. As the species now includes the former species C. claussenii and C. stellatoidea, which are mainly saprophytes, the frequent occurrence on foods of a yeast now called Ca. albicans is not surprising. It has been found in grape must, wine, soft drinks, cheese, beef, and shellfish (Sand, 1974; Buck et al., 1977; El-Bassiony et al., 1980; Dalton et al., 1984; Parish and Caroll, 1985). An easily distinguishable species in this group is a yeast-like organism, G. candidum, which produces true hyphae that break into arthroconidia, but never budding cells. In this and the negative urease reaction it sharply differs from Trichosporon. It occurs frequently in various foods, mostly in vegetables and dairy products and sometimes
256
T.DEAK
in meat products (Comi and Cantoni, 1983;Engel, 1986a;Guerzoni and Marchetti, 1987;DeAk and Beuchat, 1988). 6. Mannitol- and Cellobiose-Negative Yeasts
Yeasts falling into the sixth group are negative in all characteristics used in the master key and some of them also in most conventional physiological tests, which renders their identification rather difficult. The most important yeasts of all, the Saccharomyces species, key out in this group. Their main distinguishing characteristic is vigorous fermentation. Three species are common in foods: S. cerevisiae, S. exiguus, and S. kluyveri. The latter two species can be easily identified by their specific assimilation pattern. Unfortunately, this does not hold for S. cerevisiae, which includes some 20 former Saccharomyces species, and consequently most of its physiological properties are equivocal. The former species were distinguished primarily by sugar fermentation properties, which, however, proved to be inconsistent (Lodder, 1970). On the other hand, based on DNA homology, they appeared very closely related (Yarrow and Nakase, 1975). The present species, S. cerevisiae, appears to be a mixture of a number of natural biotypes and even hybrids. In contrast to wild strains, those adapted to, selected for, and exploited in industrial processes can be considered biotypes with definitive physiological properties. In the winery and brewery, the former species names Saccharomyces chevalieri (does not ferment maltose), S. bayanus (does not ferment galactose), S. cerevisiae (ferments only the fructose part of raffinose), and S. carlsbergensis (ferments raffinose and melibiose completely) have clear meaning. Recently, also on grounds of DNA reassociation studies, VaughanMartini and Martini (1987)newly delimited the species S. cerevisiae and S. bayanus and considered Saccharomyces pastorianus (synonym S. carlsbergensis) a natural hybrid of the two species. Unfortunately, the fermentative and assimilative properties are not consistent with the DNA/DNA homologies, and these species cannot be differentiated by physiological properties reliably. Nevertheless, in the key, traditional distinguishing characters are included for the provisional differentiation of these Saccharomyces species. Saccharomyces cerevisiae (and the similar species) can often be recognized by the large cell shape (6 x 13 pm). Neither S.cerevisiae nor S. exiguus develops on lysine and ethylamine, but S . kluyveri does. Saccharomyces cerevisiae is an indispensable organism for the production of a wide variety of alcoholic beverages, leavened bakery goods, and fermented foods (Berry et al., 1987).In many other cases it is a spoilage
FOODBORNE YEASTS
257
organism with a rather high heat resistance conferred by spores (D, 60°C, is 42 minutes; Put and De Jong, 1980), and a low pH tolerance conferred by vegetative cells (growth at pH 1.4; Pitt, 1974). Wine strains possess high resistance to SO2 (minimum inhibitory concentration 1.2 mM; Warth, 1985). The minimum a, for growth was stated to be 0.917 (55% w/w sucrose; Jermini and Schmidt-Lorenz, 1987a). It most frequently causes spoilage problems in soft drinks, fruit juices, bottled wine and beer, yoghurt, and cheese (Schmidt and Lenior, 1980; Suriyarachchi and Fleet, 1981; Put and De Jong, 1982a; Minarik et al., 1983; Back, 1987); sometimes it causes spoilage in bakery and meat products (Jay, 1987; Spicher, 1986). Saccharomyces exiguus is a special yeast used in sour doughs (Spicher, 1983),kefir (Engel et al., 1986), and certain types of beer (Novellie and Schaepdrijver, 1986); it causes spoilage in soft drinks, wine, and delicatessen salads (Put et al., 1976; Lafon-Lafourcade, 1983; Brocklehurst et al., 1983; Baumgart et al., 1983). It is often found on meat and fish (Buck et al., 1977; Comi and Cantoni, 1985). Saccharomyces kluyveri is less frequently found and its occurrence is mostly confined to soft drinks and wine (Torokand DeBk, 1974; Sand et al., 1976;Kunkee and Goswell, 1977). The rest of the yeasts grouped here are characterized by very restricted assimilation spectra and fermentative capabilities. Candida stellata is most active, strongly fermenting glucose and assimilating raffinose. It occurs commonly in fruits, must, and wine (Goto, 1980; Put et al., 1976; Heard and Fleet, 1986a), as well as on beef and shellfish (Buck et al., 1977; Comi and Cantoni, 1985).Neither this species nor C. inconspicua and C. glabrata produce pseudohyphae, and formerly they were considered Torulopsis species. Candida glabrata possesses some degree of xerotolerance and may occur in molasses and concentrated fruit juice (Kreger-van Rij, 1984),and is also frequently found on fish and shellfish (Bucket al., 1977; Jay, 1987). Candida inconspicua has also been found on meat (Dalton et al., 1984) and in various beverages (Hardwick, 1983; Lafon-Lafourcade, 1983; Muzikar, 1984). Both pseudohyphae and pellicles are produced by the two Pichia and two Issatchenkia species included this group. Although they can be differentiated by the mode of formation of sexual spores, this is not easily observed and anamorphic states are usually found. Pichia membranaefaciens (C, valida) ferments glucose very weakly. It is widespread in nearly all kinds of food, especially in fermented vegetables, alcoholic and nonalcoholic beverages, cheese, meat products, and delicatessen salads (Fleet et al., 1984; Brocklehurst and Lund, 1985;Garrido Fernandez et al., 1985; Back, 1987; Ravelomana et al., 1985; Dalton et
258
T. DEAK
al., 1984; Engel, 1986a, Messini et al., 1985). Pichia fermentans (C. lambica) is less common. It has been found in fresh meat (Hsieh and Jay, 1984), fermented cocoa (Ravelomanana et al., 1985), and more often in beverages (Torok and DeBk, 1974; Lafon-Lafourcade, 1983; Hardwick, 1983).
Issatchenkia orientalis [C. krusei) is very common in foods. Its only distinguishing property is that it grows well without added vitamins, unlike I. terricola. Though the latter species has been found in fruits and wine (Goto, 1980; Suresh et al., 1982), the former always occurs in fermented vegetables, fruits, fruit juices, wine, dairy products, and less frequently in dough and meat products (Suresh et al., 1982; Spicher, 1986; Fleet et al., 1984; Muzikar, 1984; Ravelomana et al., 1985; Jay, 1987). REFERENCES Alexander, N. J. (1986).Genetic manipulation of yeasts for ethanol production from xylose. Food Technol. 40(10),99-103. Anand, J.C., and Brown, A. D. (1968).Growth rate patterns of the so-called osmophilic and non-osmophilic yeasts in solutions of polyethylene glycol. J. Gen. Microbiol. 52, 205-212.
Anderson, C . B., and Moberg, L. J. (1986).Comparison of DRBC, OGY and PDA media for enumeration of yeasts in beverage products. In “Methods for the Mycological Examinations of Food” (A. D. King, Jr., J. I. Pitt, L. R. Beuchat, and J. E. L. Corry, eds.), pp. 164-166. Plenum, New York. Anderson, P. J., McNeil, K. E., and Watson, K. (1988).Isolation and identification of thermotolerant yeasts from Australian sugar cane mills. J. Gen. Microbiol. 134,16911698.
Andrews, D. W. (1982).A note on a microcolony method for the rapid detection of yeast using Euchrysine 2GNX. J. Appl. Bacteriol. 52,117-118. Atputharajah, J. D., Widanapathirana, S., and Samarajeewa, U.(1986).Microbiology and biochemistry of natural fermentation of coconut palm sap. Food Microbiol. 3,273280.
Azar, M., Ter-Sarkissian, N., Ghavifek, H., Ferguson, T., and Ghassemi, H. (1977).Microbiological aspects of sangak bread. J. Food Sci. Technol. 14,251-254. Back, W. (1987).Nachweis und Identifizierung von Fremdhefen in der Brauerei. Brauwelt 127,735-737.
Baggerman, W. I. (1981).A modified rose bengal medium for the enumeration of yeasts and moulds from foods. Eur. J. Appl. Microbiol. Biotechnol. 12,242-247. Banks, J. G., and Board, R. G. (1987).Some factors influencing the recovery of yeasts and moulds from chilled foods. Int. J. Food Microbiol. 4,197-206. Banks, J. G., Board. R. G., Carter, J., and Dodge, A. D. (1985).The cytotoxic and photodynamic inactivation of micro-orgaanims by Rose Bengal. J. Appl. Bacteriol. 58,391400.
Barber, S.,Baguena, R., Martinez-Anaya, M. A., and Torner, M. J. (1983).Microflora of wheat flour bread. I. Identification and functional properties of microorganisms of industrial sour doughs. Rev. Agroquim. Technol. Aliment. 23, 52-562.
FOODBORNE YEASTS
259
Barillere, 7.-M., Mimouni, A., Dubois, C . , and Bidan, P. (1985a).Thermoresistance de souches de levures isolees de vins 1. Influence des conditions experimentales sur la forme des courbes de survie. Sci. Aliments 5,365-378. Barillere, J.-M.,Dubois, C., and Bidan, P. (1985b).Thermoresistance de souches de levures isolees de vins 2. Theories de la thermoresistance-Modeles mathematiques. Sci. Aliments 5,607-617. Barnes, E. M., Impey, C. S., Geeson, J. D., and Buhagiar, R. W. M. (1978).The effect of storage temperature on the shelf-life of eviscerated air-chilled turkey. Br. Poult. Sci. 19,77-84.
Barnett, J. A., Payne, R. W., and Yarrow, D. (1983).“Yeasts: Characteristics and Identification.” Cambridge Univ. Press, Cambridge, England. Barnett, J. A., Payne, R. W., and Yarrow, D. (1985).“Yeast Identification Program.” Cambridge Micro Software, Cambridge Univ. Press, Cambridge, England. Barr, M. E. (1983).The ascomycete connection. Mycologia 75,l-13. Barreiro, J. A., Vidaurreta, J. L., Boscan, L. A., Mendoza, S., and Saiz, E. (1981).Resistancia termica de Candida tropicalis y Rhodotorula rubra en jug0 de naranja. Arch. Latinam. Nutr. 31,463-470. Barwald, G., and Hamad, S. H. (1984).The presence of yeasts in Sudanese cane sugar factories. Zuckerindustrie 109, 1014-1016. Baumgart, J. (1982).Verderb von Feincost-Salaten. Fleischwirtschaft 61,1353-1355. Baumgart, J., Weber, B., and Hanekamp, B. (1983).Mikrobiologische Stabilitat von Feinkosterzeugnissen. Fleischwirtschaft 63,93-94. Baxter, M., and Illston, G. M. (1976).Psychrotrophic meat spoilage fungi within a freezing works. N.Z. Vet. J. 24,177-180. Beckers, H. J., de Boer, E., Dijkman, K. E., Hartog, B. J., van Kooij, J. A., Kuik, D., Mol, N., Nooitgedagt, A. J., Northolt, M. D., and Samson, R. A. (1986).Comparison of various media for the enumeration of yeast and molds in food. In “Methods for the Mycological Examinations of Food” (A. D. King, Jr., J, I. Pitt, L. R. Beuchat, and J. E. L. Corry, eds.), pp. 66-76. Plenum, New York. Beech, F. W., and Carr, J. G. (1977).Cider and Perry. In “Economic Microbiology. Vol. 1: Alcoholic Beverages” (A. H. Rose, ed.), pp. 139-313. Academic Press, London. Beech, F. W., and Davenport, R. R. (1970a).The role of yeasts in cider making. In “The Yeasts” A. H. Rose and J. S. Harrison, eds.), Vol. 3,pp. 73-146. Academic Press, New York. Beech, F. W., and Davenport, R. R. (1970b).In “Ecology of Leaf Surface Microorganisms” (T. F. Preece and C . H. Dickinson, eds.),pp. 139-157. Academic Press, London. Beech, F. W., and Davenport, R. R. (1971).Isolation, purification and maintenance of yeasts. In “Methods in Microbiology” (C. Booth, ed.), Vol. 4, pp. 153-182. Academic Press, London. Beech, F. W., Davenport, R. R., Goswell, R. W., and Burnett, J. K. (1968).Two simplified schemes for identifying yeast cultures. In “Identification Methods for Microbiologists, Part B” (B. M. Gibbs and D. A. Shapton, eds.), pp. 151-175. Academic Press, London. Belin, J. M. (1979).Les levures d’un chai du Maconnais. Vitis 18,40-48. Berry, D. R., Russel, I., and Stewart, G. G., eds. (1987).“Yeast Biotechnology.” Allen & Unwin, London. Berry, 1. M. (1979).Yeast problems in the food and beverage industry. In “Food Mycology” (M. E. Rhodes, ed.), pp. 82-90. Hall, Boston, Massachusetts. Beuchat, L. R., ed. (1978).“Food and Beverage Mycology.” AVI, Westport, Connecticut. Beuchat, L. R. (1979).Comparison of acidified and antibiotic supplemented potato dex-
260
T. DEAK
trose agar from three manufacturers for its capacity to recover fungi from foods. J. Food Prot. 42,427-428. Beuchat, L. R. (1981a).Effects of potassium sorbate and sodium benzoate on inactivating yeasts heated in broths containing sodium chloride and sucrose. J. Food Prot. 44, 765-769. Beuchat, L. R. (1981b).Synergistic effects of potassium sorbate and sodium benzoate on thermal inactivation of yeast. J. Food Sci. 46,771-777. Beuchat, L. R. (1982).Thermal inactivation of yeasts in fruit juices supplemented with food preservatives and sucrose. J. Food Sci. 47,1679-1682. Beuchat, L. R. (1983a).Influence of water activity on growth, metabolic activities and survival of yeasts and molds. J. Food Prot. 46,135-141. Beuchat, L. R. (1983b).Indigenous fermented foods. In “Biotechnology. Vol. 5: Food and Feed Production with Microorganisms” (H.-J. Rehm and G. Reed, eds.), pp. 447-528. Verlag Chemie, Weinheim. Beuchat, L. R. (1984).Injury and repair of yeasts and molds. In “The Revival of Injured Microbes” (M. H. E. Andrew and A. D. Russel, eds.), SOC.Appl. Bacteriol. Symp. Ser. No. 12,pp. 293-308. Academic Press, London. Beuchat, L. R. (1986).Consideration of media for enumerating injured fungi. In “Methods for Mycological Examinations of Food” (A. D. King, Jr., J. I. Pitt, L. R. Beuchat, and J. E. L. Cory, eds.), pp. 168-171. Plenum, New York. Beuchat, L. R., ed. (1987).“Food and Beverage Mycology,” 2nd Ed. Van Nostrand, New York. Beuchat, L. R., and Nail, B. V. (1985).Evaluation of media for enumerating yeasts and molds in fresh and frozen fruit purees. J. Food Prot. 48,312-315. Blanz, P. A., and Unseld, M. (1987).Ribosomal RNA as a taxonomic tool in mycology. In “The Expanding Realm of Yeast-Like Fungi” (G.S. de Hood, M. T. Smith, and A. C. M. Weijman, eds.), pp. 247-258. Elsevier, Amsterdam. Bluhm, L. (1983).Distilled beverages. In “Biotechnology. Vol. 5: Food and Feed Production with Microorganisms” (H.-J. Rehm and G . Reed, eds.), pp. 447-476. Verlag Chemie, Weinheim. Borst-Pauwels, G . W. F. H. (1981).Ion transport in yeast. Biochim. Biophys. Acta 650, 88-127. Brackett, R. E. (1987).Vegetables and related products. In “Food and Beverage Mycology” (L. R. Beuchat, ed.), 2nd Ed., pp. 129-154. Van Nostrand, New York. Brocklehurst, T. F., and Lund, B. M. (1985).Yeasts as a cause of spoilage of chilled delicatessen salads. J. Appl. Bacteriol. 59,ii. Brocklehurst, T.F., White, C. A,, and Dennis, C. (1983).The microflora of stored coleslaw and factors affecting the growth of spoilage yeasts in coleslaw. J. Appl. Bacteriol. 55, 57-63. Brodsky, M. H., Entis, P., Entis, M. P., Sharpe, A. N., and Jarvis, G. A. (1982).Determination of aerobic plate and yeast and mould counts in foods using an automated hydrophobic grid-membrane filter technique. J. Food Prot. 45,301-304. Brousse, M., Bataill6, N., and Broucherie, H. (1985).Identification of glycolytic enzyme polypeptides on the two-dimensional protein map of Sacchoromyces cerevisiae and application to the study of some wine yeasts. Appl. Environ. Microbiol. 50,951-957. Brown, A. D. (1976).Microbial water stress. Bacteriol. Rev. 40,803-846. Brown, A. D. (1978).Compatible solutes and extreme water stress in eucaryotic microorganisms. Adv. Microb. Physiol. 17,181-242. Buck, J.D., Bubucis, P. M., and Combs, T. J. (1977). Occurrence of human-associated yeasts in bivalve shellfish from Long Island sound. Appl. Environ. Microbiol. 33, 370-378.
FOODBORNE YEASTS
261
Buhagiar, R. W. M., and Barnett, J. A. (1971).The yeasts of strawberries. J. Appl. Bacteriol. 34, 727-739.
Buhagiar, R. W. M., Yarrow, D., and Barnett, J. A. (1983).Bullera crocea and Bullera armeniaca, two new yeasts from fruit and vegetables. J. Gen. Microbiol. 129,31493155.
Burmeister, H. R., and Hartman, P. A. (1966).Yeasts in ensiled high-moisture corn. Appl. Microbiol. 14,35-38. Call, H. P., Haarding, M., and Emeis, C. C. (1985).Screening for pectinolytic Candida yeasts: Optimisation and characterization of the enzymes. J. Food Biochem. 9,193210.
Cantoni, C., and Comi, G. (1988).I lieviti e i prodotti di gastronomia. Ind. Aliment. 27, 649-651.
Carr, I. G. (1984).Spoilage of cider. J. Appl. Bacteriol. 57,x. Carrascosa, J. M., Viguera, M. D., Nunez de Castro, I., and Scheffers, W. A. (1981). Metabolism of acetaldehyde and Custers effect in the yeast Brettanomyces abstinens. Antonie van Leeuwenhoek 47,209-215. Casey, G. P., and Ingledew, W. M. (1986).Ethanol tolerance in yeasts. CRC Crit. Rev. Microbiol. 13, 219-290. Cole, M. B., Franklin, J. G., and Keenan, M. H. J. (1987).Probability of growth of the spoilage yeast Zygosaccharomyces bailii in a model fruit drink system. Food Microbiol. 4, 115-119. Cole, M. B., and Keenan, M. H. J. (1986).Synergistic effects of weak acid preservatives and pH on the growth of Zygosaccharomyces bailii. Yeast 2,93-100. Comi, G., and Cantoni, C. (1980a).Flora blastomicetica superficiale di insaccati crudi stagionati. Ind. Aliment. 19,563-569. Comi, G., and Cantoni, C. (1980b).I lieviti in insaccati crudi stagionati. Ind. Aliment. 19, 857-860.
Comi, G., and Cantoni, C. (1980~). Lieviti in molluschi lamellibranchi. Ann. Microbiol. Enzimol. 30,97-102. Comi, G., and Cantoni, C. (1983).Presenza di lieviti nei prosciutti crudi stagionati. Ind. Aliment. 22,102-104. Comi, G., and Cantoni, C. (1984).Alterazioni in sciroppi con amarene. Ind. Bevande 13, 79-83.
Comi, G., and Cantoni, C. (1985).Lieviti e carni. Ind. Aliment. 24,683-687. Comi, G., Cantoni, C., and Traldi, C. (1981a).Osservazione su un alterazione da lieviti in alcune salamoie di funghi. Ind. Aliment. 20,455-458. Comi, G., Ruffoni, B., Denozza, D., and Cantoni, C. (1981b).Yeast contamination of fungal inoculum for Gorgonzola production. Ristor. Collett. S(ll),99-101. Comi, G., Cantoni, C., and Traldi, C. (1982).Conservazione di sciruppi con alte conzentrazioni di succheri. Ind. Bevande 11,169-171. Comi, G., Ruffoni, B., Cantoni, C., and Pesino, L. (1983).Ecological studies on yeasts in water and on fish in Lake Maggiore. Arch. Vet. Ital. 34,l-19. Comi, G., Cantoni, C., Rosa, M., and Cattaneo, P. (1984).Yeasts and fish deterioration. Ristor. Collett. 9(12),65-73. COMPASS (1986).“Computer Service Handbook.” Natl. Collect. Yeast Cult., Inst. Food Res., Norwich, England. Corry, J. E. L. (1976).The effect of sugars and polyols on the heat resistance and morphology of osmophilic yeasts. J. Appl. Bacteriol. 40,269-276. Corry, J. E. L. (1987).Relationships of water activity to fungal growth. In “Food and Beverage Mycology” (L. R. Beuchat, ed.), 2nd Ed., pp. 51-99. Van Nostrand, New York.
262
T. DEAK
Cottrell, M., Kock, J. L. F., Lategan, P. M., and Britz, T. J. (1986).Long-chain fatty acid composition as an aid in the classification of the genus Sacchoromyces. Syst. Appl. Microbiol. 8,166-168. Crisan, E. V., and Sands, A. (1975).Microflora of four fermented fish sauces. Appl. Microbiol. 29, 106-108. Cronk, T. C., Steinkraus, K. H., Hackler, L. R., and Mattick, L. R. (1977).Indonesian tap6 ketan fermentation. Appl. Environ. Microbiol. 33, 1067-1073. Cuinier, C. (1980).Origine des levures assurant l’elaboration d’un vin blanc de Touraine. Identification des species. Connaiss. Vigne Vin 14,111-126. Dalton, H. K.,Board, R. G., and Davenport, R. R. (1984).The yeast of British fresh sausage and minced beef. Antonie van Leeuwenhoek 50,227-248. D’Amore, T., and Stewart, G. G. (1987).Ethanol tolerance of yeast. Enzyme Microb. Technol. 9,322-330. Davenport, R. R. (1974).Microecology of yeasts and yeast-like organisms associated with an English vineyard. Vitis 13,123-130. Davenport, R. R. (1976).Distribution of yeasts and yeast-like organisms from aerial surfaces of developing apples and grapes. In “Microbiology of Aerial Plant Surfaces” (C. H. Dickerson and T. F. Preece, eds.), pp. 325-359. Academic Press, London. Davenport, R. R. (1977).Integrated taxonomic and ecological studies of yeasts and yeastlike organisms. Proc. Spec. Symp. Yeast, 5th, Port 11, pp. 97-98. Keszthely, Hung. Davenport, R. R. (1979).Experimental ecology and identification of microorganisms. In “Identification Methods for Microbiologists” (F. A. Skinner and D. W. Lovelock, eds.), 2nd Ed., pp. 258-277. Academic Press, New York. Davenport, R. R. (1980a).Cold-tolerant yeast and yeast-like organisms. In “Biology and Activities of Yeasts” (F. A. Skinner, S . M. Passmore, and R. R. Davenport, eds.), pp. 215-230. Academic Press, London. Davenport, R. R. (1980b).An outline guide to media and methods for studying yeasts and yeast-like organisms. In “Biology and Activities of Yeasts” (F. A. Skinner, S . M. Passmore, and R. R. Davenport, eds.), pp. 261-278. Academic Press, London. Davenport, R. R. (1981).Yeasts and yeast-like organisms. In “Smith’s Introduction to Industrial Mycology,” (A. H. S . Onions, D. Allsopp, and H. 0. W. Eggins, eds.), pp. 65-92. Arnold, London. DeBk, T. (1978).On the existence of H+-symport in yeasts. A comparative study. Arch. Microbiol. 116,205-211. Delk, T. (1979).The ecology of microorganisms on fruits and vegetables. In “Food as an Ecological Environment for Pathogenic and Index Micro-organisms” (K. SobolewskaCeronik, E. Ceronik, and S . Zaleski, eds.), Vol. 1,pp. 107-131.Acad. Agric., Szczecin, Poland. Delk, T. (1980).Hygienic and technological consideration of yeasts in the soft drink industry. Act0 Aliment. Acad. Sci. Hung. 9,90-91. Delk, T. (1986a).A simplified scheme for the identification of yeasts. In “Methods for the Mycological Examination of Food” (A. D. King, Jr.,J. I. Pitt, L. R. Beuchat, and J. E. L. Corry, eds.), pp. 278-293. Plenum, New York. DeBk, T. (1986b).Microbiological stability of bottled wines. Abstr. Int. Congr. Microbiol., 14th. IUMS, Manchester p. 95. Dehk, T. (1988).Experimental Microbial Ecology of Foods. D.Sc. Thesis, Hung. Acad. Sci., Budapest. (In Hung.) DeBk, T., and Beuchat, L. R. (1987).Identification of foodborne yeasts. J . Food Prot. 50, 243-264.
DeBk, T., and Beuchat, L. R. (1988).Evaluation of simplified and commercial systems for identification of foodborne yeasts. Int. J. Food Microbiol. 7, 135-145.
FOODBORNE YEASTS
263
DeBk, T., NovBk, E. K. (1972a). Effect of sorbic acid on the carbohydrate fermentation and oligosaccharide splitting enzymes of yeast. Acta Aliment. Acad. Sci. Hung. 1, 173186. DeBk, T., and NovBk, E. K. (1972b). Assimilation of sorbic acid by yeasts. Acta Aliment. Acad. Sci. Hung. 1,87-104. Debk, T., and Reichart, 0. (1986). Unacceptable levels of yeasts in bottled wine. In “Methods for the Mycological Examination of Food” (A. D. King, Jr., J. L. Pitt, L. R. Beuchat, and J. E. L. Corry, eds.), pp. 215-219. Plenum, New York. DeBk, T., Tabajdi-PintBr, V., and Fbbri, I. (1986a). Evaluation of blending, stomaching and shaking for mold counts in flour. In “Methods for the Mycological Examination of Food” (A. D. King, Jr., J. I. Pitt, L. R. Beuchat, and J. E. L. Corry, eds.), pp. 10-11. Plenum, New York. DeBk, T.,Torok, T., Lehoczki, J., Reichart, O., Tabajdi-PintBr, V., and FBbri, I. (1986b). Comparison of general purpose media for the enumeration of molds and yeasts. In “Methods for the Mycological Examination of Food” (A. D. King, Jr., J. L. Pitt, L. R. Beuchat, and J. E. L. Corry, eds.), pp. 114-119. Plenum, New York. Debk, T., Nagel, V., and Fabri, I. (1986~).Sensitivity and precision of methods for the enumeration of yeasts in wine. In “Methods for the Mycological Examination of Food” (A. D. King, Jr., J. I. Pitt, L. R. Beuchat, and J. E. L. Corry, eds.), pp. 166-168. Plenum, New York. Decleire, M., van Huyhn, N., and Motte, J. C. (1985). Hydrolysis of lactose solutions and wheys by whole cells of Kluyveromyces bulgaricus. Eur. J. Appl. Microbiol. Biotechnol. 21, 103-107. de Hoog, G. S., Smith, M. T., and Weijman, A. C. M., eds. (1987).“The Expanding Realm of Yeast-Like Fungi.” Elsevier, Amsterdam. Delfini, C. (1985). Spontaneous malo-alcoholic fermentations: A technological danger in hot temperate regions. Enotecnico 21, 119-126. Dennis, C., and Buhagiar, R. W. M. (1980). Yeast spoilage of fresh and processed fruits and vegetables. In “Biology and Activities of Yeasts” (F. A. Skinner, S . M. Passmore, and R. R. Davenport, eds.), pp. 123-133. Academic Press, London. Dijkmann, K. E. (1986). Merits and shortcoming of DG18, OGY, OGGY and DRBC media for the examination of raw meats. In “Methods for the Mycological Examination of Food” (A. D. King, Jr.,J. L. Pitt, L. R. Beuchat, and J. E. L. Corry, eds.), pp. 120-123. Plenum, New York. do Carmo-Sousa, L. (1969). Distribution of yeasts in nature. In “The Yeasts” (A. H. Rose and J. S . Harrison, eds.), Vol. 1,pp. 79-105. Academic Press, London. Dragoni, I., and Comi, G. (1985). Presenza di muffe e lieviti in succhi di frutta prodotti industrialmente. Ind. Bevande 14, 599-601. Drawert, F., and Bednar, F. J. (1984). Nutzung des ADH-polymorphismus bei verschiedenen Saccharomyces-arten zur taxonomischen Zuordnung. Chem. Mikrobiol. Technol. Lebensm. 8,105-108. Dubourdien, D., Sokol, A., Zucca, J., Thalouarn, P., Datte, A., and Aigle, M. (1987). Identification des souches de levures isolBes de vins par l’analyse de leur ADN mitochondrial. Conn. Vigne Vin 21, 267-278. Dziezak, J. D. (1987). Yeasts and yeast derivatives: Applications. Food Technol. 41(2), 122-125.
Eisenberg, W. V., and Cichowicz, S . M. (1977). Machinery mold indicator organisms in food. Food Technol. 31(2), 52-56. El-Bassiony, T. A., Atia, M., and Aboul Khier, F. (1980). Search for the predominance of fungi species in cheese. Assiut Vet. Med. J. 7, 173-184.
264
T. DEAK
Engel, G. (1984). Mikrobiologische Charakterisierung von Kefir. Mykologie. Dtsch. Mo1k.Ztg. 105,1338-1340. Engel, G. (1986a). Hefen und Schimmelpilze in Futtermitteln, Rohmilch und Milchprodukten. Dtsch. Mo1k.-Ztg. 107, 1286-1292. Engel, G. (1986b). Vorkommen von Hefen in Frischkase-Organoleptische Beeinflussung. Milchwissenschaft 41, 692-694. Engel, G. (1986~).Hefen in Silagen und Rohmilch. Milchwissenschaft 41,633-637. Engel, G., Krusch, U., and Teuber, M. (1986). Mikrobiologische Zusammensetzung von Kefir I. Hefen. Milchwissenschaft 41,418-421. Etchells, J. L., Fleming, H. P., and Bell, T. A. (1975). Factors influencing the growth of lactic acid bacteria during the fermentation of brined cucumbers. In “Lactic Acid Bacteria in Beverages and Food” (J. G. Carr, C. V. Cutting, and G. C. Whiting, eds.), pp. 281-305. Academic Press, London. Ethiraj, S., Suresh, E. R., and Onkarayya, H. (1979). Nature of yeasts present on grapes grown in South India and in their wines. Vitis 18, 161-164. Evans, H. A. V. (1982). A note on two uses for impedimetry in brewing microbiology. J. Appl. Bacteriol. 53, 423-426. Farris, G. A., and Rugin, M. A. (1985). Composizione blastomicetica dei “Flor” della Malvasia di Bosa. Vignevini 12, 39-41. Ferguson, R. B. (1986a). Comparison of spread and pour plate methods for enumerating yeasts and molds in dry foods using DRBC medium. In “Methods for the Mycological Examination of Food” (A. D. King, Jr., J. I. Pitt, L. R. Beuchat, and J. E. L. Corry, eds.), pp. 49-52. Plenum, New York. Ferguson, R. B. (1986b). Comparison of spread and pour plate methods for enumerating yeasts and molds in dry foods using OGY medium. In “Methods for the Mycological Examination of Food” (A. D. King, Jr., J. I. Pitt, L. R. Beuchat, and J. E. L. Corry, eds.), pp. 53-55. Plenum, New York. Fiechter, A., Fuhrmann, G. F., and Kappeli, 0. (1981). Regulation of glucose metabolism in growing yeast cells. Adv. Microb. Physiol. 22, 123-183. Fiechter, A., Kappali, O., and Meussdoerffer, F. (1987). Batch and continuous culture. In “The Yeasts. Vol. 2: Yeasts and the Environment” (A. H. Rose and J. A. Harrison, eds.), pp. 99-129. Academic Press, London. Fleet, G. H. (1990).Food spoilage yeasts. In “Yeast Technology” ( J . F. T. Spencer and D. M. Spencer, eds.), pp. 124-166. Springer-Verlag, Berlin. Fleet, G. H., and Mian, M. A. (1987). The occurrence and growth of yeasts in dairy products. Int. J. Food Microbiol. 4, 145-155. Fleet, G. H., Lafon-Lafourcade, S., and Ribereau-Gayon, P. (1984). Evolution of yeasts and lactic acid bacteria during fermentation and storage of Bordeaux wines. Appl. Environ. Microbiol. 48, 1034-1038. Fleming, H. P. (1982). Fermented vegetables. In “Economic Microbiology. Vol. 7: Fermented Foods” (A. H. Rose, ed.), pp. 227-258. Academic Press, London. Fowell, R. R. (1965). The identification of wild yeast colonies on lysine agar. J. Appl. Bacteriol. 28, 373-383. Freese, E., Sheu, C. W., and Galliers, E. (1973). Function of lipophilic acids as antimicrobial food additives. Nature (London) 241, 321-325. Garcia, C. E., and Alcina, M. Y. (1981). Flora microbiologica predominante en el bagazo de cana de azucar. Acta Cient. Venez. 32,177-183. Gardini, F., and Guerzoni, M. E. (1986). Valutazione del potenziale degradativo dei lieviti colonizzanti uno stabilmento di bevande. Ind. Bevande 15, 367-373. Garrido Fernandez, A., Duran Quintana, M. C., and Garcia Garcia, Y. P. (1985). New aerobic fermentative process to control the spoilage called “alambrado” in the elabo-
FOODBORNE YEASTS
265
ration of natural black olives in brine. In “Strategies in Food Quality Assurance: Analytical, Industrial and Legal Aspects” (W. Baltes, P. B. Czedik-Eysenberg, H. Deelstra, P. Dirinck, W. Ooghe, and W. Pfannhauser, eds.), Vol. 2, pp. 205-210. De Sikkel, Antwerp. Gomez, A., and Castillo, F. J. (1983). Production of biomass and /3-o-galactosidase by Candida pseudotropicalis grown in continuous culture on whey. Biotechnol. Bioeng. 25,1341-1357. Goswell, R. W. (1986a). Microbiology of fortified wines. Dev. Food Microbiol. 2, 1-20, Goswell, R. W. (1986b). Microbiology of table wines. Dev. Food Microbiol. 2, 21-65. Goto, S . (1980). Changes in the wild yeast flora of sulfited grape musts. J. Inst. Enol. Viticult., Yamanashi Univ. 15, 29-32. Goto, S., and Yokotsuka, I. (1977).Wild yeast population in fresh grape musts of different harvest time. J. Ferment. Technol. 55, 417-422. Graumlich, T. R. (1985). Estimation of microbial populations in orange juice by bioluminescence. J. Food Sci. 50,116-117, 124. Green, M. D., and Ibe, S. N. (1987). Yeasts as primary contaminants in yoghurts produced commercially in Lagos, Nigeria. J. Food Prot. 50, 193-198. Guerzoni, E., and Marchetti, R. (1987). Analysis of yeast flora associated with grape sour rot and the chemical disease markers. Appl. Environ. Microbiol.53, 571-576. Hagler, A. N., and Ahearn, D. G. (1981). A rapid DBB test to detect basidiomycetous affinity of yeasts. Int. J. Syst. Bacteriol. 31, 204-208. Hagler, A. N., and Ahearn, D. G. (1987).Ecology of aquatic yeasts. In “The Yeasts. Vol. 1: Biology of Yeast” (A. H. Rose and J. S . Harrison, eds.), 2nd Ed., pp. 181-205. Academic Press, London. Hamajima, K., Nishikawa, A., Shinoda, T., and Fukazawa, Y. (1987). Deoxyribonucleic acid base composition and its homology between two forms of Candida parapsilosis and Lodderomyces elongisporus. J. Gen. Appl. Microbiol. 33, 299-302. Hardwick, W. A. (1983). Beer. In “Biotechnology. Vol. 5: Food and Feed Production with Microorganisms” (G. Reed, ed.), pp. 165-229. Verlag Chemie, Weinheim. Hastings, J. W., Tsai, W. Y. J., and Bullerman, L. B. (1986a). Comparison of stomaching versus blending in sample preparation for mold enumeration. In “Methods for the Mycological Examination of Food” (A. D. King, Jr., J. I. Pitt, L. R. Beuchat, and J. E. L. Corry, eds.), pp. 7-9. Plenum, New York. Hastings, J. W., Tsai, W. Y. J., and Bullerman, L. B. (1986b).Comparison of general purpose mycological medium with a selective mycological medium for mold enumeration. In “Methods for the Mycological Examination of Food” (A. D. King, Jr., J. I. Pitt, L. R. Beuchat, and J. E. L. Corry, eds.), pp. 94-96. Plenum, New York. Hatcher, W. S., Dibenedetto, S . , Taylor, L. E., and Murdock, D. I. (1977). Radiometric analysis of frozen concentrated orange juice for total viable microorganisms. J. Food Sci. 42,636-639. Heard, G. M., and Fleet, G. H. (1985).Growth of natural yeast flora during the fermentation of inoculated wines. Appl. Environ. Microbiol. 50, 727-728. Heard, G. M., and Fleet, G. H. (1986a).Occurrence and growth of yeast species during the fermentation of some Australian wine. Food Technol. Aust. 38,22-25. Heard, G. M., and Fleet, G . H. (1986b). Evaluation of selective media for enumeration of yeasts during wine fermentation. J. Appl. Bacteriol. 60,477-481. Heard, G. M., and Fleet, G. H. (1987). Occurrence and growth of killer yeasts during wine fermentation. Appl. Environ. Microbiol. 53, 2171-2174. Heard, G. M., and Fleet, G. H. (1988).The effects of temperature and pH on the growth of yeast species during the fermentation of grape juice. J. Appl. Bacteriol. 65, 23-28.
266
T. DEAK
Henschke, P. A., and Thomas, D. S . (1988).Detection of wine-spoiling yeasts by electronic methods. J. Appl. Bocteriol. 64,123-133. Henson, 0.E. (1981).Dichloran as an inhibitor of mold spreading in fungal plating media: Effects on colony diameter and enumeration. Appl. Environ. Microbiol. 42,656-660. Hesseltine, C. W. (1983).Microbiology of oriental fermented foods. Annu. Rev. Microbiol. 37,575-601.
Hobbs, G. (1986).Ecology of food microorganisms. Microb. Ecol. 12,15-30. Hocking, A. D., and Pitt, J. I. (1980).Dichloran-glycerol medium for enumeration of xerophilic fungi from low-moisture foods. Appl. Environ. Microbiol. 39,488-492. Hoeben, P., and Clark-Walker, G. D. (1986).An approach to yeast classification by mapping mitochondria1 DNA from Dekkero/Brettonornyces and Eeniella genera. Curr. Genet. 10,371-379. Hood, M. A. (1983).Effects of harvesting waters and storage conditions on yeast populations in shell fish. J. Food Prot. 46,105-108. Hsieh, D. Y., and Jay,J. M. (1984).Characterization and identification of yeasts from fresh and spoiled ground beef. Int. J. Food Microbiol. 1,141-147. Hurley, R., de Louvois, J., and Mulhall, A. (1987).Yeasts as human and animal pathogens. In “The Yeasts. Vol. 1:Biology of Yeasts” (A. H. Rose and J. S . Harrison, eds.), 2nd Ed., pp. 207-281. Academic Press, London. ICMSF (International Commission on Microbiological Specification for Foods) (1980). “Microbial Ecology of Foods,” Vols. 1 and 2. Academic Press, New York. ICMSF (International Commission on Microbiological Specification for Foods) (1986). “Microorganisms in Foods. 2 . Sampling for Microbiological Analysis: Principles and Specific Applications,” 2nd Ed. Blackwell, Oxford. Ingledew, W. M., and Casey, G. P. (1982).The use and understanding of media used in brewing mycology. 1. Media for wild yeasts. Brewer’s Dig. 57(3),18-22. Ingram, M., and Mackey, B. M. (1976).Inactivation by cold. In “Inhibition and Inactivation of Vegetative Microbes” (F. A. Skinner and W. B. Hugo, eds.), pp. 11-151. Academic Press, London. Ison, R. W., and Gutteridge, C. S . (1987).Determination of the carbonation tolerance of yeasts. Lett. Appl. Microbiol. 5, 11-13. Jarvis, B. (1973).Comparison of an improved rose bengal chlortetracycline agar with other media for the selective isolation and enumeration of moulds and yeasts in foods. J. Appl. Bocteriol. 36, 723-727. Jarvis, B. (1978).Methods for detecting fungi in foods and beverages. In “Food and Beverage Mycology” (L. R. Beuchat, ed.1, pp. 471-504. AVI, Westport, Connecticut. Jarvis, B., and Easter, M. C. (1987).Rapid methods in the assessment of microbiological quality; experiences and needs. J. Appl. Bocteriol. Syrnp. Suppl. 63,115-126. Jarvis, B., and Shapton, N. (1986a).Effect of sample size on variance of mold and yeast counts from hard cheese and skim milk powder. In “Methods for the Mycological Examination of Foods” (A. D. King, Jr., J, I. Pitt, L. R. Beuchat, and J, E. L. Corry, eds.), pp. 1-3. Plenum, New York. Jarvis, B., and Shapton, N. (1986bl.A comparison between peptone and Ringer solution with polysorbitan diluents on the enumeration of molds and yeasts from hard cheese and skim milk powder. In “Methods for the Mycological Examination of Foods” (A. D. King, Jr., J. I. Pitt, L. R. Beuchat, and J. E. L. Corry, eds.), pp. 14-16. Plenum, New York. Jay, J. M. (1978).Meats, poultry and seafoods. In “Food and Beverage Mycology” (L. R. Beuchat, ed.), pp. 129-144. AVI, Westport, Connecticut. Jay, J. M. (1987).Meats, poultry and seafoods. In “Food and Beverage Mycology” (L. R. Beuchat, ed.), 2nd Ed., pp. 155-173. Van Nostrand, New York.
FOODBORNE YEASTS
267
Jay, J. M., and Margitic, S. (1981).Incidence of yeasts in fresh ground beef and their ratios to bacteria. J. Food Sci. 46,648-649. Jermini, M. F. G., and Schmidt-Lorenz, W. (1987a). Growth of osmotolerant yeast at different water activity values. J. Food Prot. 50, 404-440. Jermini, M. F. G., and Schmidt-Lorenz, W. (1987b).Influence of frozen storage and thawfreeze stresses on the viability of osmotolerant yeasts. J. Food Prot. 50, 414-417. Jermini, M. F. G., and Schmidt-Lorenz, W. ( 1 9 8 7 ~ )Cardinal . temperatures for growth of osmotolerant yeasts in broths at different water activity values. J. Food Prot. 50, 473-478.
Jermini, M. F. G., Geigen, O., and Schmidt-Lorenz, W. (1987). Detection, isolation and identification of osmotolerant yeasts from high-sugar products. J. Food Prot. 50, 468-472.
Johannsen, E., Niemand, J. G., Eagle, L., and Bredenhann, G . (1984). Yeast flora of nonradurized and radurized minced beef-a taxonomic study. Int. J. Food Microbiol. 1, 217-227.
Jones, R. R., and Greenfield, D. F. (1982). Effect of carbon dioxide on yeast growth and fermentation. Enzyme Microb. Technol. 4,210-223. Jong, S. C., Lee, F. L., and Bengston, L. (1985). Direct evidence of relationship between Dekkera and Brettanomyces. Mycotaxon 23,271-273. Jong, S. C., Holloway, L., McManus, C., Krichevsky, M. I., and Rogosa, M. (1988).Coding of strain features for computer-aided identification of yeasts. Mycotaxon 31,207-219. Juroszek, J. R., Raimbault, O., Feuillat, M., and Charpentier, C. (1987). A new method for determination of ethanol tolerance in vinification yeasts: Measurement of glucoseinduced proton movement. Am. J. Enol. Vitic. 38, 336-341. Juven, B. J., Kanner, J., and Weisslowicz, H. (1980).Influence of orange juice composition on the thermal resistance of spoilage yeasts. J. Food Sci. 43,1047-1076. Juven, B. J., Gagel, S., Saguy, I., and Weisslowitz, H. (1984). Microbiology of spoilage of a perishable pomegranate product. Int. J. Food Microbiol. 1, 135-139. Kellen, L. A., Smidt, T. M., Hannon, G. B., and Olson, K. E. (1986). Comparative study of media for the detection and enumeration of molds and yeasts. In “Methods for the Mycological Examination of Foods” (A. D. King, Jr.,J. I. Pitt, L. R. Beuchat, and J. E. L. Corry, eds.), pp. 103-106. Plenum, New York. Khayyat, N., Arroyo, V., and Somavilla, J. F. (1982). Yeast microflora of the wines of the Yecla region. Alimentaria 135, 39-43. Kim, Y.-N., Cho, H.-Y., Kim, J.-H., Yoon, S.-K., and Byun, S.-M. (1988). Differentiation of yeast species by techniques of electrophoresis and immunodiffusion. Korean J. Food Sci. Technol. 20, 90-94. King, A. D., Jr., Hocking, A. D., and Pitt, J. I. (1979). Dichloran-rose bengal medium for enumeration and isolation of molds from foods. Appl. Environ. Microbiol. 37, 959964.
King, A. D., Jr., Ponting, J. D., Sanshuck, D. W., Jackson, R., and Mihara, K. (1981). Factors affecting death of yeast by sulphur dioxide. J. Food Prot. 44,92-97. King, A. D., Jr., Pitt, J. I., Beuchat, L. R., and Corry, J. E. L., eds. (1986). “Methods for the Mycological Examination of Food.” Plenum, New York. Kirsop, B. E., and Snell, J. J. S. (1984). “Maintenance of Microorganisms. A Manual of Laboratory Methods.” Academic Press, London. Kirsop, B. E., Painting, K. A., Henry, J. E., Fernandes, M., Prescott, E. H., Braid, I., and Foster, P. (1986).On-line computer assisted identification of yeasts. Abstr. Int. Congr. Microbiol., Manchester 14th, p. 75. Kish, S., Sharf, R., and Margalith, P. (1983). A note on a selective medium for wine yeasts. J. Appl. Bacteriol. 55, 177-179.
T. DEAK Klaushofer, H., Hollaus, F., and Pollach, G. (1971). Microbiology of beet sugar manufacture. Process Biochem. 6(6), 39-41. KO, S. D. (1982). Indigenous fermented foods. In “Economic Microbiology. Vol. 7: Fermented Foods” (A. H. Rose, ed.), pp. 15-39. Academic Press, London. Kobatake, M., and Kurata, H. (1980a).Yeast contamination in chilled raw seafoods. J. Food Hyg. SOC.Jpn. 21, 197-206. Kobatake, M., and Kurata, H. (1980b). Yeast contamination in chilled salad and Gyoza from retail market. J. Food Hyg. SOC.Jpn. 21, 189-196. Kobatake, M., and Kurata, H. (1983a). Determination of yeasts isolated from chilled household foods and raw seafoods. J. Food Hyg. SOC.Jpn. 24, 525-531. Kobatake, M., and Kurata, H. (1983b).Proteolytic and lypolytic activities of psychrophilic and psychrotrophic yeasts isolated from chilled household foods and raw seafoods. J. Food Hyg. SOC.Jpn. 24,532-539. Koburger, J. A. (1970). Fungi in foods. I. Effect of inhibitor and incubation temperature on enumeration. J. Milk Food Technol. 33,433-434. Koburger, J. A., and Norden, A. R. (1975).Fungi in foods. VII. A comparison of the surface, pour plate and most probable number methods for the enumeration of yeasts and molds. J. Milk Food Technol. 38, 745-756. Koburger, J. A., and Rodgers, M. F. (1978). Single and multiple antibiotic-amended media to enumerate yeasts and molds. J. Food Prot. 41, 367-369. Koch, H. A., and Gibson, R. R. (1986).Fluorescence microscopy procedure for quantitation of yeasts in beverages. Appl. Environ. Microbiol. 52, 599-601. Kock, J. L. F., and van der Walt, J. P. (1986). Fatty acid composition of Saccharomyces lindner. Syst. Appl. Microbiol. 8, 163-165. Kodama, K., and Yoshizawa, K. (1977). Sake. In “Economic Microbiology. Vol. 1: Alcoholic Beverages” (A. H. Rose, ed.), pp. 423-475. Academic Press, London. Kreger-van Rij, N. J. W., ed. (1984). “The Yeast, a Taxonomic Study,” 3rd Ed. Elsevier, Amsterdam. Kreger-van Rij, N. J. W. (1987). Classification of yeasts. In “The Yeasts. Vol. I : Biology of Yeasts” (A. H. Rose and J. S. Harrison, eds.), pp. 5-61. Academic Press, London. Kuniyaki, A. H., Rous, C., and Sanderson, J. L. (1984). Enzyme-linked immunosorbent assay (ELISA) detection of Brettanomyces contaminants in wine production. Am. J. Enol. Vitic. 35, 143-145. Kunkee, R. E., and Amerine, M. A. (1970). Yeasts in wine making. In “The Yeasts. Vol. 3: Yeast Technology” (A. H. Rose and J. S. Harrison, eds.), pp. 5-71. Academic Press, London. Kunkee, R. E., and Goswell, R. W. (1977). Table wines. In “Economic Microbiology. Vol. 1: Alcoholic Beverages” (A. H. Rose, ed.), pp. 315-385. Academic Press, London. Kurtzman, C. P. (1984). Synonomy of the yeast genera Hansenula and Pichia demonstrated through comparison of deoxyribonucleic acid relatedness. Antonie van Leeuwenhoek 50,209-217. Kurtzman, C. P., and Phaff, H. J. (1987). Molecular taxonomy. In “The Yeasts. Vol. 1: Biology of Yeasts” (A. H. Rose and J. S. Harrison, eds.), pp. 63-94. Academic Press, London. Kurtzman, C. P., Wickerham, L. J., and Hesseltime, C. W. (1970). Yeasts from wheat and flour. Mycologia 62, 542-547. Kurtzman, C. P., Rogers, R., and Hesseltine, C. W. (1971). Microbiological spoilage of mayonnaise and salad dressings. Appl. Microbiol. 21, 870-874. Lachaise, D. (1977). Niche separation of African Lissocephala within the Ficus drosophilid community. Oecologia 31, 201-214.
FOODBORNE YEASTS
2 69
Lachance, M.-A. (1987). Approaches to yeast identification. In “Yeast Biotechnology” (D. R. Berry, I. Russel, and G. G. Stewart, eds.), pp. 33-51. Allen & Unwin, London. Lachance, M.-A., Phaff, H. J., Starmer, W. T., Moffit, A,, and Olson, L. G. (1986). Interspecific discontinuity in the genus Clavispora Rodriquez de Miranda by phenetic analysis, genomic deoxyribonucleic acid reassociation, and restriction mapping of ribosomal deoxyribonucleic acid. Int. J. Syst. Bacteiol. 36, 524-530. Lafon-Lafourcade, S. (1983). Wine and brandy. In “Biotechnology. Vol. 5: Food and Feed Production by Microorganisms” (H.-J. Rehm and G. Reed, eds.), pp. 81-163. Verlag Chemie, Weinheim. Lagunas, K. (1981).Is Saccharornyces cerevisiae a typical facultative anaerobe? Trends Biochem. Sci. 6,201-208. Land, G. A., and Salkin, I. F. (1987). Uncommon yeastlike zoopathogens and commercial systems for their identification. Mycopathologia 99, 155-171. Land, G. A., Stotler, R., Land, K., and Staneck, J. (1984).Update and evaluation of the Auto Microbic yeast identification system. J. Clin Microbiol. 20,649-652. LaRocco, K. A., Galligan, P., Littel, K. J., and Spurgash, A. (1985). A rapid bioluminescent ATP method for determining yeast contamination in a carbonated beverage. Food Technol. 39(7),49-52. Last, F. T., and Price, D. (1969).Yeasts associated with living plants and their environs. In “The Yeasts. Vol. 1: Biology of Yeasts” (A. H. Rose and J. S. Harrison, eds.), pp. 183-218. Academic Press, London. Lawrence, D. R. (1988). Spoilage organisms in beer. In “Developments in Food Microbiology” (R. K. Robinson, ed.), Vol. 3, pp. 1-48. Elsevier, Amsterdam. Leistner, L., and Bem, Z. (1970). Vorkommen und Bedeutung von Hefen bei Pokelfleischwaren. Fleischwirtschaft 50, 350-351. Liewen, M. B., and Marth, E. H. (1985). Growth and inhibition of microorganisms in the presence of sorbic acid: A review. J. Food Prot. 48, 364-375. Lin, C. C.S., and Fu-Jen, B. S. (1987). Conventional and rapid methods for yeast identification. CRC Crit. Rev. Microbiol. 14, 273-284. Lin, Y. (1975). Detection of wild yeasts in the brewery. Efficiency of differential media. J. Inst. Brew. 81, 410-417. Lodder, J., ed. (1970). “The Yeasts. A Taxonomic Study.” North-Holland Publ., Amsterdam. Lowry, P. D., and Gill, C. 0. (1984). Development of a yeast microflora on frozen lamb stored at -5°C. J. Food Prot. 47, 309-311. McCann, A. K.,and Barnett, J. A. (1986). The utilization of starch by yeasts. Yeast 2, 109-115. Madan, M., and Gulati, N. (1980).Yeast flora of some dried fruits. Microbios Lett. 15(58), 73-75. Marth, E.H. (1987).Dairy products. In “Food and Beverage Mycology” (L. R. Beuchat, ed.), 2nd. Ed., pp. 175-209. Van Nostrand, New York. Martini, A., Frederichi, F., and Rosini, G. (1980). A new approach to the study of yeast ecology of natural substrates. Can. J. Microbiol. 26,856-859. Mauricio, J. C., Moreno, J., Medina, M., and Ortega, J. M. (1986). Fermentation of “Pedro Ximenez” must at various temperatures and different degrees of ripeness. Belg. J. Food Chern. Biotechnol. 41(3), 71-76. Messini, A,, Balloni, W., and D’Afflitto, N. (1985). Use del sodio dodecil-solfato nelo studio ecologico dei lieviti delle uve. Riv. Vitic. Enol. 38, 471-479. Meyer, E. D., Sinclair, N. A,, and Nagy, B. (1975). Comparison of the survival and metabolic activities of psychrophilic and mesophilic yeasts subjected to freeze-thaw stress. Appl. Microbiol. 29, 739-744.
2 70
T. DEAK
Middelhoven, W. J., and van Baalen, A. H. M. (1988). Development of the yeast flora of whole-crop maize during ensiling and during subsequent aerobiosis. J. Sci. Agric. 4 2 , 199-207.
Miller, M. W. (1979). Yeasts in food spoilage: An update. Food Technol. 33(1), 76-80. Minarik, E. (1980). Saccharomyces bailii-Erreger von Trubungen in Weinen mit Restsiisse. Mitt. Klosterneuburg 30, 238-240. Minarik, E. (1981).Zur Okologie von Hefen und hefeartigen Mikroorganismen abgefullter Weine. Wein-Wissenschaft 36, 280-285. Minirik, E. (1983). Levures de contamination des vines embuteillkes. Bull. O.I.V. 56, 414-419.
Minirik, E., and Hankova, A. (1982). Die Hefeflora konzentrierter Traubenmoste und deren Einfluss auf die Stabilitat der Weine. Wein-Wissenschaft 37, 187-182. Minarik, E., and Navara, A. (1977). Zur Vorkommen von Saccharomycodes ludwigii Hansen in geschwetelten alkoholarmen Jungweinen. Mitt. Klosterneuburg 27, 1-3. Minarik, E., Silhanova, Z., and Jungova, 0. (1983).Kontaminierende Hefen von Fass- und Flaschenweinen Sudmahrens. Mitt. Klosterneuburg 33, 193-196. Mizunoma, T. (1984). Progress in the microbiology of soy sauce making. J. Brew. SOC.Jpn. 79,802-810.
Moline, N. E. (1984). Comparative studies with two Geotrichum species inciting postharvest decays of tomato fruit. Plant Dis. 68, 46-48. Monte, E., Villaneuva, J. R., and Dominquez, A. (1986).Fungal profiles of Spanish country cured hams. Int. J. Food Microbiol. 3, 355-359. Moon, N. J. (1983). Inhibition of the growth of acid tolerant yeasts by acetate, lactate and propionate and their synergistic mixtures. J. Appl. Bacteriol. 55, 453-460. Moon, N. J., and Ely, L. 0. (1979). Identification and properties of yeasts associated with the aerobic deterioration of wheat and alfalfa silages. Mycopathologia 69, 153-156. Morgan, J. W., and Witter, L. D. (1980). Stability of the plasma membrane of Saccharomyces rouxii and its relationship to glucose tolerance. Appl. Environ. Microbiol. 39, 928-930.
Morris, E. 0. (1975).Yeasts from the marine environment. J. Appl. Bacteriol. 38,211-223. Mossel, D. A. A. (1971).Physiological and metabolic attributes of microbial groups associated with foods. J. Appl. Bacteriol. 34, 91-118. Mossel, D. A. A., and Ingram, M. (1955). The physiology of microbial spoilage of foods. J. Appl. Bacteriol. 18, 232-268. Mossel, D. A. A., Kleynen-Semmeling, A. M. C., Vincentine, H. M., Beerens, H., and Catsavas, M. (1970). Oxytetracycline-glucose-yeast extract agar for selective enumeration of molds and yeasts in foods and clinical materials. J. Appl. Bacteriol. 33, 454-457.
Mossel, D. A. A., Vega, C. L., Put, and H. M. C. (1975). Further studies on the suitability of various media containing antibacterial antibiotics for enumeration of moulds in food and food environments. J. Appl. Bacteriol. 39, 15-22. Moulin, G., Malige, B., and Galzy, P. (19831. Blanced flora of an industrial fermenter: Production of yeast from whey. I. Dairy Sci. 66, 21-28. Muys, G. T. (1971). Microbial safety in emulsions. Process Biochem. 6(6), 25-28. Muzikar, V. (1984). Incidence and significance of yeasts in nonalcoholic beverages. In “Microbial Associations and Interactions in Food” (I. Kiss, T. Deak, and K. Incze, eds.), pp. 247-251. Akademiai Kiadb, Budapest. Nakase, T., and Suzuki, M. (1985). Ballistospore-forming yeasts found on the surface of the Japanese rice plant, Oryza sativa 1. J. Gen. Appl. Microbiol. 31,457-474. Nelson, F. E. (1972). Plating medium pH as a factor in apparent survival of sublethally stressed yeasts. Appl. Microbiol. 24, 236-239.
FOODBORNE YEASTS
271
Ng, H. (1976).Growth requirements of San Francisco sour dough yeasts and baker’s yeast. Appl. Environ. Microbiol. 31,395-398. Noda, F., Hayashi, K., and Mizunuma, T. (1982).Influence of pH on inhibitory activity of acetic acid on osmophilic yeasts used in brine fermentation of soy sauce. Appl. Environ. Microbiol. 43, 245-246. NovBk, E. K. (1981).“Selecta Fungorum. Selected Chapters of Mycology.” Univ. Hortic., Budapest. (In Hung.) Novellie, L., and de Schaepdrijver, P. (1986).Modern developments in traditional African beers. Prog. Ind. Microbiol. 23, 73-157. Nunez, M., Medina, M., Gaya, P., and Dias-Amado, C. (1981).Les levures et les moissures dans le fromage bleu de Carbales. (Yeasts and moulds of Carbales blue cheese.) Lait 61,62-79.
Okafor, N. (1978).Microbiology and biochemistry of oil-palm wine. Adv. Appl. Microbiol. 24,237-256.
Onishi, H. (1963).Osmophilic yeasts. Adv. Food Res. 12, 53-94. Orszhghova, V., and Kieslingerova, N. (1984).Problems related to the microflora of confectionery products. In “Microbial Associations and Interactions in Food” (I. Kiss, T. Deak, and K. Incze, eds.), pp. 265-270. Akad6miai Kiad6, Budapest. Pal, M., and Mehrotra, B. S. (1985).Studies on the isolation of Cryptococcus neoformons from fruits and vegetables. Mykosen 28,200-205. Panchal, C. J., Russel, I., Sills, A. M., and Stewart, G. G. (1984).Genetic manipulation of brewing and related yeast strains. Food Technol. 38(2),99-106, 111. Parfait, A., and Sabin, G. (1975).Yeast isolated from molasses and cane juice. Ind. Aliment. Agric. 92,27-29. Parish, M.E., and Caroll, D. E. (1985).Indigenous yeasts associated with muscadine (Vitis rotundifolia) grapes and musts. Am. J. Enol. Vitic. 36, 165-169. Patel, P. D., and Williams, A. P. (1985).A note on estimation of food spoilage yeasts by measurement of adenosine triphosphate (ATP) after growth at various temperatures. J. Appl. Bacteriol. 59,133-136. Pederson, C. S. (1971).“Microbiology of Food Fermentations.” AVI, Westport, Connecticut. Peppler, H. J. (1977).Yeast properties adversely affecting food fermentations. Food Techno]. 31(2),62-65. Peppler, H. J. (1980).In “Food Microbiology: Public Health and Spoilage Aspects” (M. P. Defiguiredo and D. F. Splittstoesser, eds.), pp. 427-454. AVI, Westport, Connecticut. Phaff, H. J. (1984).DNA, enzymes and cell wall. In “The Yeasts. A Taxonomic Study” (N. J. W. Kreger-van Rij, ed.), 3rd Ed., pp. 17-24. Elsevier, Amsterdam. Phaff, H. J. (1986).Ecology of yeasts with actual and potential value in biotechnology. Microb. Ecol. 12,31-42. Phaff, H. J.. and Starmer, W. T. (1980).Specificity of natural habitats for yeasts and yeast-like organism. In “Biology and Activities of Yeasts” (F. A. Skinner, S. M. Passmore, and R. R. Davenport, eds.), pp. 79-102. Academic Press, London. Phaff, H. J., and Starmer, W. T. (1987).Yeasts associated with plants, insects, and soils. In “The Yeasts. Vol. 1: Biology of Yeasts” (A. H. Rose and J. S. Harrison, eds.), 2nd Ed., pp. 123-180. Academic Press, London. Phaff, H. J., Miller, M. W., and Mrak, E. M. (1978).“The Life of Yeasts,” 2nd Ed. Harvard Univ. Press, Cambridge, Massachusetts. Pignal, M.-C., Lachaise, D., and Couturier, G. (1985).Les Levures des figues et des drosophiles associ6es en foret de Tai (Cote d’Ivoire). Acto Oecol. 6,223-233. Pincus, D.H., Salkin, I. F., Hurd, N. J., Levy, I. L., and Kemna, M. A. (1988).Modification of
272
T. DEAK
potassium nitrate assimilation test for identification of clinically important yeasts. J. Clin. Microbiol. 26, 366-368. Pitt, J. I. (1974). Resistance of some food spoilage yeasts to preservatives. Food Technol. Aust. 26, 238-241. Pitt, J. I., and Hocking, A. D. 1985). “Fungi and Food Spoilage.” Academic Press, Orlando, Florida. Poncini, L., and Wimmer, F. L. (1986).Characterization of yeasts (Blastomycetes) in some Fijian honeys. Acta Aliment. Pol. 12, 143-151. Put, H. M. C., and De Jong, J. (1980).The heat resistance of selected yeasts causing spoilage of canned soft drinks and fruit products. In “Biology and Activities of Yeasts” (F. A. Skinner, S. M. Passmore, and R. R. Davenport, eds.), pp. 181-241. Academic Press, London. Put, H. M. C., and De Jong, J. (1982a).The heat resistance of ascospores of four Saccharomyces spp. isolated from spoiled heat processed soft drinks and fruit products. J. Appl. Bacteriol. 52, 235-244. Put, H. M. C., and De Jong, J. (1982b). Heat resistance studies on yeasts-Vegetative cells versus ascospores-Erythromycin inhibition of sporulation in Kluyveromyces and Saccharomyces species. J. Appl. Bacteriol. 53, 73-79. Put, H. M. C., De Jong, J., Sand, F. E. M., and van Grinsven, A. M. (1976).Heat resistance studies on yeast spp. causing spoilae in soft drinks. J. Appl. Bacteriol. 40, 135-152. Rale, V. B., and Vakil, J. R. (1984).A note on an improved molybdate agar for the selective isolation of yeasts from tropical fruits. J. Appl. Bacteriol. 56, 409-413. Ravelomanana, R., Guiraud, J. P., Vincent, J. C., and Galzy, P. (1985). The yeast flora of cocoa bean fermentation in the Ivory Coast. MIRCEN J. 1, 319-326. Reichart, 0.(1979).A new experimental method for the determination of the heat destruction parameters of microorganisms. Acta Aliment. Acad. Sci. Hung. 8, 131-155. Restaino, L., Lenovich, L. M., and Bills, S. (1982).Effects of acids and sorbate concentrations on the growth of four osmophilic yeasts. J. Food Prot. 45,1138-1142. Rhodes, M. E., ed. (1979). “Food Mycology.” Hall, Boston, Massachusetts. Richter, U., and Thalman, A. (1983). Beobachtungen iiber Hefen in Futtergetreide. Landwirtsch. Forsch. 36,260-269. Rodrigues, S . B. (1987).A system for identifying spoilage yeast in packaged wine. Am. J. Enol. Vitic. 38, 273-276. Rodrigues, U. M., and Kroll, R. G. (1986). Use of the direct epifluorescent filter technigues for the enumeration of yeasts. J. Appl. Bacteriol. 61, 139-144. Rodrigues de Miranda, L. (1984). Yeast. In “Introduction to Foodborne Fungi” (R. A. Samson, E. S. Hoekstra, and C. van Oorschot, eds.), 2nd Ed., pp. 192-205. CBS, Baarn, Netherlands. Rocken, W. (1983). Fremdehefennachweis in der obergaringen Braurei mit dem Pantothenat-Agar. Monatsschr. Brau. 36(2),65-69. Rocken, W., and Marg, C. (1983).Nachweis von Fremdehefen in der obergarigen Brauerei. Vergleich verschiedener Nachrboden. Monatsschr. Brau. 36, 276-279. Rocken, W., and Schulte, S . (1986). Nachweis von Fremdehefen. Bringen der Kupfersulfat-Agar und der 37°C-Test Fortschritte beim Nachweis von Fremdhefen? Brauwelt 126,1921-1927. Rocken, W., Finken, E., Schulte, S . , and Emeis, C. C. (1981). The impairment of cloud stability of orangeade by yeasts. Z . Lebensmdnters. -Forsch. 173,26-31. Rogers, J. A., and Guarino, P. S. (1986). Comparison of antibiotic-containing media and media supplemented with dichloran and rose bengal for isolation and enumeration of fungi in spices. J. Food Prot. 49, 815-817.
FOODBORNE YEASTS
2 73
Rose, A. H., ed. (1977).“Economic Microbiology. Vol. 1:Alcoholic Beverages.” Academic Press, London. Rose, A. H., ed. (1979).“Economic Microbiology. Vol. 4: Microbial Biomass.” Academic Press, London. Rose, A. H. (1987).Responses to the chemical environment. In “The Yeasts. Vol. 2:Yeasts and the Environment” (A. H. Rose and J. S . Harrison, eds,), 2nd Ed., pp. 5-40. Academic Press, London. Rosini, G., Frederichi, F., and Martini, A. (1982).Yeast flora of grape berries during ripening. Microb. Ecol. 8,83-89. Ross, S. S.,and Morris, E. 0. (1965).An investigation of the yeast flora of marine fish from Scottish coastal waters and a fishing ground off Iceland. 1. Appl. Bacteriol. 28, 224234.
Ruiz, A. I., Pelago, R., Arroyo, V., and Inigo, B. (1986).Fermenting agents for grape musts in the Autonomic Community of Madrid. Alimentaria No. 173,53-56. Sakai, H., Caldo, G. A., and Kozak, M. (1983).Yeast flora in red burong isda a fermented fish food in the Philipines. 1.Agric. Sci. 28, 181-185. Salik, H.,Rosen, B., and Kopelman, I. J. (1979).Microbial aspects of the deterioration process of soft dates. Food Sci. Technol. 12,85-87. Salkin, I. F., Schadov, K. H., Bankaitis, L. A., McGinnis, M. R., and Kemna, M. E. (1985). Evaluation of Abbot Quantum I1 yeast identification system. J. Clin. Microbiol. 22, 442-444.
Salovaara, A., and Savolainen, J. (1984).Yeast type isolated from Finnish sour rye dough starters. Acta Aliment. Pol. 10,241-245. Sanchez, J., Guiraud, J. P., and Galzy, P. (1984).A study of the galacturonase activity of several strains isolated from cocoa. Eur. J. Appl. Microbiol. Biotechnol. 20,262-267. Sancho, E. D., Hernandez, E., and Rodriguez-Navarro, A. (1986).Presumed sexual isolation in yeast populations during production of sherrylike wine. Appl. Environ. Microbiol. 51, 395-397. Sand, F. E. M. J. (1974).An ecological survey of yeasts within a soft drinks plant. Proc. Int. Symp. Yeasts, 4th, Hochsch. Bodenkult., Vienna Part I, pp. 263-264. Sand, F. E. M. J. (1980).Zygosaccharornyces bailii: An increasing danger to soft drinks. Brauwelt 120,418-425. Sand, F.E. M. J., and van Grinsven, A. M. (1976a).Investigation of yeast strains isolated from Scandinavian soft drinks. Brauwissenschaft 29, 313-355. Sand, F. E. M. J., and van Grinsven, A. M. (1976b).Comparison between the yeast flora of Middle Eastern and Western European soft drinks. Antonie van Leeuwenhoek 42, 523-532.
Sand, F. E. M. J., Kolfschoten, G. A., and van Grinsven, A. M. (1976).Yeasts isolated from proportioning pumps employed in soft drink plants. Brauwissenschaft 29, 294298.
Sandhu, D. K., and Waraich, M. K. (1984).Distribution of yeasts in indigenous fermented foods with a brief review of literature. Kavata Trans. Mycol. SOC.India 12(2),73-85. Schimz, K. L. (1980).The effect of sulfite on the yeast Saccharomyces cerevisiae. Arch. Microbiol. 125,89-95. Schmidt, J. L. (1980).Evaluation d’une methode rapide d’assimilation des sucres (API 50 CH) en vue de l’identification des levures. Ann. Technol. Agric. 29,47-52. Schmidt, J, L.,and Lenoir, J. (1980).Contribution a I’etude de la flore levure du fromage de Camembert. h i t 60,272-282. Scott, V. N., and Bernard, D. T. (1985).Resistance of yeast to dry heat. J. Food Sci. 50, 1754-1755.
2 74
T. DEAK
Seham, M., Sheleih, M. A,, and Saudi, A. M. (1982). Occurrence of yeasts in someEgyptian dairy products. J. Egypt. Vet. Med. Assoc. 42(3), 5-11. Seiler, D. A. L. (1980). Yeast spoilage of bakery products. In “Biology and Activities of Yeasts” (F. A. Skinner, S. M. Passmore, and R. R. Davenport, eds.), pp. 135-152. Academic Press, London. Seiler, D. A. L. (1986a). Effect of diluent and medium water activity on recovery of yeasts from high sugar coatings and fillings. In “Methods for the Mycological Examination of Food” (A. D. King, Jr., J. I. Pitt, L. R. Beuchat, and J. E. L. Corry, eds.), pp. 162-163. Plenum, New York. Seiler, D. A. L. (1986b). A collaborative exercise comparing media for enumerating fungi in foods. In “Methods for the Mycological Examination of Food” (A. D. King, Jr., J. I. Pitt, L. R. Beuchat, and J. E. L. Corry, eds.), pp. 83-85. Plenum, New York. Sharma, S., and Tauro, P. (1987). Detection and biochemical characterization of fast and slow ethanol-producing yeasts. MIRCEN J. 3, 155-160. Shepherd, M. G., Poulter, R. T. M., and Sullivan, P. A. (1985). Candida albicans: Biology, genetics and pathogenicity. Annu. Rev. Microbiol. 39, 579-614. Sidenberg, D. G., and Lachance, M. A. (1986). Electrophoretic isoenzyme variation in Kluyveromyces populations and revision of Kluyveromyces marxianus (Hansen) van der Walt. Int. J. Syst. Bacteriol. 36, 94-102. Skinner, F. A., Passmore, S. M., and Davenport, R. R., eds. (1980).“Biology and Activities of Yeasts.” Academic Press, London. Smit, E. J., Westhuizen, J. R. J., van der Kock, J. L. F., and Lategan, P. M. (1987). A yeast identification method: The influence of culture age on the cellular long-chain fatty acid composition of three selected basidiomycetous yeasts. Syst. AppJ. Microbiol. 10, 38-41.
Smith, M. T. (1986). Zygoascus hellenicus gen.nov., sp.nov., the teleomorph of Candida hellenica (C. inositophila, C. steatolytica). Antonie van Leeuwenhoek 52, 27-37. Smittle, R. B. (1977). Influence of pH and sodium chloride on the growth of yeasts isolated from high acid food products. J. Food Sci. 42, 1552-1553. Smittle, R. B., and Flowers, R. S. (1982). Acid tolerant microorganisms involved in the spoilage of salad dressings. J. Food Prot. 45, 977-983. Snow, R. (1985). Genetic engineering of a yeast strain for malolactic fermentation of wine. Food Technol. 39(10), 96-101. Soni, S. K., Sandhu, D. K., Vilkhu, K. S., and Kamra, N. (1986). Microbiological studies on dosa fermentation. Food Microbiol. 3,45-53. Speck, M. L., ed. (1976). “Compendium of Methods for the Microbiological Examination of Foods.” Am. Public Health Assoc., Washington, D.C. Spencer, J. F. T., Spencer, D. M., and Smith, A. R. W. (1983). “Yeast Genetics. Fundamental and Applied Aspects.” Springer-Verlag, New York. Spicher, G. (1983). Baked goods. In “Biotechnology. Vol. 5: Food and Feed Production with Microorganisms” (H.-J. Rehm and G. Reed, eds.), pp. 1-80. Verlag Chemie, Weinheim. Spicher, G. (1984). Die Erreger der Schimmelbildung bei Backwaren. 111. Einige Beobachtungen uber die Biologie der Erreger der “Kreidekrankenheit” des Brotes. Getreide, Mehl Brot 38,178-182. Spicher, G. (1986).Neue Erkentnisse iiber die Erreger der “Kreidekrankenheit” des Brotes und Moglichkeiten zur Wchstumsverhinderung. Brot Backwaren 34,208-213. Spicher, G., and Mellenthin, B. (1983). Zur Frage der mikrobiologischen Qualitat von Getreidevollkornerzeugnissen. 111. Die bei Speisegetreide und Mehlen auftretenden Hefen. Dtsch. Lebensrn.-Rundsch. 79, 35-38. Spicher, G., Schroder,R., and Scollkammer, K. (1979).Die Mikroflora das Sauerteiges. VII.
FOODBORNE YEASTS
275
Untersuchungen uber die Art in “Reinzuchtsauern” auftretenden Hefen. Z. Lebensm.Unters. -Forsch. 169, 77-81. Splittstoesser, D. F., Lienk, L. L., Wilkinson, M., and Stamer, J. R. (1975).Influence of wine composition on the heat resistance of potential spoilage microorganisms. Appl. Microbiol. 30, 369-373. Splittstoesser, D. F., Groll, M., Downing, D. L., and Kaminski, J. (1977). Viable counts versus the incidence of machinery mold (Geotrichum) on processed fruits and vegetables. J. Food Prot. 40, 402-405. Splittstoesser, D. F., Leasor, S. B., and Swanson, K. M. J. (1986). Effect of food composition on the heat resistance of yeast ascospores. J. Food Sci. 51, 1265-1267. Stecchini, M., and Beuchat, L. R. (1985). Effects of sugars in growth media, diluents and enumeration media on survival and recovery of Saccharomyces cerevisiae heated in peach puree. Food Microbiol. 2, 85-95. Stewart, G. G. (1987). Alcoholic beverages. In “Food and Beverage Mycology” (L. R. Beuchat, ed.), 2nd Ed., pp. 307-354. Van Nostrand, New York. Stollarova, V. (1976). Vorkommen von Hefen und hefeartigen Mikroorganismen auf einigen Obstarten in der Umgebung von Nitra. Mitt. Klosterneuburg 26,173-178. Stollarovi, V. (1982). The presence of yeasts and yeast-like microorganisms on cherry fruits (Cerasus aviurn /L/ Moench). Biologia (Bratislava) 37, 11 15-1 120. Stratford,M., Morgan, P., and Rose, A. H. (1987). Sulphur dioxide resistance in Saccharomyces cerevisiae and Sacchoromycodes Judwigii. J. Gen. Microbiol. 133,2173-2179. Suarez, J. A., and Inigo, B. (1982). Contribution to study of Mahon cheese. 11. Yeasts microflora. Chem., Mikrobiol. Technol. Lebensm. 7, 173-179. Subden, R. E., Cornell, R., and Noble, A. C. (1980). Evaluation of API 2OC clinical yeast identification system for must and wine yeast identification. Am. 1. Enol. Vitic. 31, 364-366.
Sugihara, T. F., Kline, L., and Miller, M. W. (1971). Microorganisms of the San Francisco sour dough bread process. I. Yeasts responsible for the leavening action. Appl. Microbiol. 21, 456-458. Sugiyama, S. I. (1984). Selection of microorganisms for use in the fermentation of soysauce. Food Microbiol. 1, 339-347. Suresh, E. R., Onkarayya, H., and Ethiraj, S. (1982). A note on the yeast flora associated with fermentation of mango. J. Appl. Bacteriol. 52, 1-4. Suriyarachchi,V. R., and Fleet, G. H. (1981).Occurrence and growth of yeasts in yoghurts. Appl. Environ. Microbiol. 42, 574-579. Thomas, D. S., and Davenport, R. R. (1985). Zygosaccharomyces bailii-A profile of characteristics and spoilage activities. Food Microbiol. 2, 157-169. Thomas, D. S.,Horsack, J. A., and Rose, A. H. (1978).Plasma-membrane lipid composition and ethanol tolerance in Saccharomyces cerevisiae. Arch. Microbiol. 117, 239-245. Tilbury, R. H. (1976). The microbial stability of intermediate moisture foods with respect to yeasts. In “Intermediate Moisture Foods” (R. Davies, G. G. Birch, and K. J. C. Pasker, eds.), pp. 138-165. Appl. Sci., London. Tilbury, R. H. (1980a). Xerotolerant (osmophilic) yeasts. In “Biology and Activities of Yeasts” (F. A. Skinner, S. Passmore, and R. R. Davenport, eds.), pp. 153-180. Academic Press, London. Tilbury, R. H. (1980b). Xerotolerant yeasts at high sugar concentrations. In “Microbial Growth and Survival in Extremes of Environment” (G. W. Gould and J. E. L. Corry, eds.), pp. 103-128. Academic Press, London. Tilbury, R. H., Davis, J. G . , French, S., Imrie, F. K. E., Campbell-Lent, K., and Orbell, C. (1974). Taxonomy of yeasts in yoghurts and other dairy products. Proc. Int. Symp. Yeasts, 4th, Honsch. Bodenkult., Vienna Part I, pp. 265-266.
276
T. DEAK
Torok, T., and Deak, T. (1974).A comparative study on yeasts from Hungarian soft drinks and on the methods of their enumeration. Int. Syrnp. Yeasts, 4th, Honsch. Bodenkult., Vienna Part I, pp. 151-152. Torok, T., and Reichart, 0. (1983).Thermal inactivation kinetics of sugar-tolerant yeasts. Eur. J. Appl. Microbiol. Biotechnol. 17, 191-196. Tokouka, K., Ishitani, T., Goto, S., and Komagata, K. (1985).Identification of yeasts isolated from high-sugar foods. J. Gen. Appl. Microbiol. 31,411-427. Tredoux, H. G., Kock, J. L. F., Lategan, P. M., and Muller, H. B. (1987a).A rapid identification technique to differentiate between Saccharomyces cerevisiae strains and other yeast species in the wine industry. Am. J. Enol. Vitic. 38,161-164. Tredoux, H. G., Polqiete, T. R., and Tracey, R. P. (1987bl.A computer program as an aid in the identification of yeast strains. J. Microbiol. Methods 7, 131-138. Tzanetakis, N., Litoponeon-Tzanetaki, E., and Manolkidis, K. (1987).Microbiology of kopanisti, a traditional Greek cheese. Food Microbiol. 4,251-256. Uchida, A., Kaneshi, T., and Kuwabara, Y. (1980).Yeasts in carbonated beverages. Jpn. J. Hyg. 35,380. Vacek, D. C., Starmer, W. T., and Heed, W. B. (1979).Relevance of the ecology of citrus yeasts to the diet of Drosophila. Microb. Ecol. 5,4349. van der Walt, J. P. (1987).The yeasts-A conspectus. In “The Expanding Realm of Yeast-Like Fungi” (G. S. de Hoog, M. T. Smith, and A. C. M. Weijman, eds.), pp. 19-31. Elsevier, Amsterdam. van der Walt, J. P., and von Arx, J. A. (1980).The yeast genus Yarrowia gen.nov. Antonie van Leeuwenhoek 46,517-521. van der Walt, J. P., and Yarrow, D. (1984).Methods for the isolation, maintenance, classification and identification of yeasts. In “The Yeasts, a Taxonomic Study,” (N. J. W. Kreger-vaan Rij, ed.), pp. 45-104. Elsevier, Amsterdam. van Vuuren, H. J. J., and van der Meer, L. (1987).Fingerprinting of yeasts by protein electrophoresis. Am. J. Enol. Vitic. 38,49-53. Vasconcelos, A. M. P., and Chaves des Neves, H. J. (1985).Characterization of Saccharomyces sp. through determination of amino acid profiles by capillary gas chromatography. J. High Resolut. Chrornatogr. 8,547-550. Vaughan-Martini, A., and Kurtzman, C. P. (1985).Deoxyribonucleic acid relatedness among species of the genus Saccharomyces sensu stricto. Int. J. Syst. Bacteriol. 35, 508-511.
Vaughan-Martini, A., and Martini, A. (1987).Three newly delimited species of Saccharomyces sensu stricto. Antonie van Leeuwenhoek 53,77-84. Vaugh, R. H., Stevenson, K. E., Dave, B. A., and Park, N. C. (1972).Fermenting yeasts associated with softening and gas-pocket formation in olives. Appl. Microbiol. 23, 316-320.
Venkatasubbaiah, P., Dwarakanath, C. T., and Sreenivasa, M. V. (1985).Involvement of yeast flora in idli batter fermentation. J. Food Techno]. India 22,88-90. Verachtert, H., and Dawoud, E. (1984).Microbiology of lambic-type beers. J. Appl. Bacteriol. 57,xi. Viljoen, B. C., Kock, J. L. F., and Lategan, P. M. (1986).Long-chain fatty acid composition of selected genera of yeasts belonging to the Endomycetales. Antonie van Leeuwenhoek 52,45-51. Viljoen, B. C., Kock, J. L. F., and Coetzee, D. J. (1988).Orthogonal-field alternation gel electrophoresis banding patterns of some asporogenous yeasts and their respective ascosporogenous states. Sys. Appl. Microbiol. 10,228-230. Vojtekova, G., and Minarik, E. (1985).Veranderungen der Zusammensetzung der Hefe-
FOODBORNE YEASTS
277
flora von Trauben, Mosten und Weinen im Weinbaugebiet der Kleinen Karpaten in einem Zeitraum von 20 Jahren. Mitt. Klosterneuburg 35(3), 82-88. von Arx, J. A. (1979). Propagation in the yeast and yeast-like fungi. In “The Whole Fungus” (9. Kendric, ed.), Vol. 2, pp. 555-556. Natl. Mus. Can. for the Kananaskis Found., Ottawa. von Arx, J. A. (1981). “The Genera of Fungi Sporulating in Pure Culture,” 3rd Ed. Cramer, Vaduz. von Arx, J. A., and van der Walt, J. P. (1987).Ophiostomatales and Endomycetales. In “The Expanding Realm of Yeast-like Fungi” (G. S. de Hoog, M. T. Smith, and A. C. M. Weijman, eds.], pp. 167-176. Elsevier, Amsterdam. Walker, H. W. (1977). Spoilage of food by yeasts. Food Technol. 31(2), 57-61, 65. Walker, H. W., and Ayres, J. C. (1970). Yeasts as spoilage organisms. In “The Yeasts. Vol. 3: Yeast Technology” (A. H. Rose and J. S. Harrison, eds.), pp. 463-527. Academic Press, London. Walker, W. F. (1985). 5 S ribosomal RNA sequences from Ascomycetes and evolutionary implications. Syst. Appl. Microbiol. 6,48-53. Warnasuriya, D., Liyanage, A. W., Weeerawansa, G. G., Athauda, P. K., and Jayatissa, P. H. (1985). Isolation and characterization of yeasts of some fruits and fruit products of Sri Lanka. J. Natl. Sci. Counc. Sri Lanka 13, 71-75. Warth, A. D. (1977). Mechanism of resistance of Saccharomyces bailii to benzoic acid, sorbic acid and other weak acids used as food preservatives. J. Appl. Bacteriol. 43, 215-230.
Warth, A. D. (1985). Resistance of yeast species to benzoic and sorbic acids and to sulfur dioxide. J. Food Prot. 48, 564-569. Warth, A. D. (1986).Preservative resistance of Zygosaccharomyces bailii and other yeasts. CSIRO Food Res. Q. 4 6 , l - 8 . Watson, K. G. (1987). Temperature relations. In “The Yeasts. Vol. 2: Yeasts and the Environment” (A. H. Rose and J. S. Harrison, eds.), pp. 41-71. Academic Press, London. Wei, D.-L., and Jong, S.-C. (1983). Chinese rice pudding fermentation: Fungal flora of starter cultures and biochemical changes during fermentation. J. Ferment. Technol. 61, 573-579.
Weijman, A. C. M. (1979). Carbohydrate composition and taxonomy of Geotrichum, Trichosporon and allied genera. Antonie van Leeuwenhoek 45,119-127. Weijman, A. C. M., Rodrigues de Miranda, L., and van der Walt, J. P. (1988).Redefinition of Candida berkhout and the consequent emendation of Cryptococcus kiitzing and Rhodotorula harrison. Antonie van Leeuwenhoek 54,545-553. Williams, A. P. (1986a). A comparison of DRBC, RBC and MEA media for the enumeration of molds and yeasts in pure culture and in foods. In “Methods for the Mycological Examination of Food” (A. D. King, Jr., J. I. Pitt, L. R. Beuchat, and J. E. L. Corry, eds.), pp. 85-89. Plenum, New York. Williams, A. P. (1986b).A comparison of DRBC, OGY and RBC media for the enumeration of yeasts and molds in foods. In “Methods for the Mycological Examination of Food” (A. D. King, Jr., J. I. Pitt, L. R. Beuchat, and J. E. L. Corry, eds.), pp. 89-91. Plenum, New York. Wood, 9. J. B. (1982). Soy sauce and miso. In “Economic Microbiology. Vol. 7: Fermented Foods” (A. H. Rose, ed.), pp. 39-86. Academic Press, London. Yamada, T., and Ogrydziak, D. M. (1983). Extracellular acid proteases produced by Saccharomycopsis lipolytica. J. Bacteriol. 154, 23-31. Yamada, Y., Aizawa, K., Matsumoto, A., and Nakagawa, Y. (1987). Significance of the
278
T. DEAK
co-enzyme-Q system in the classification of yeasts and yeast-like organisms. 22. An electrophoretic comparison of enzymes in strains of species in the fission yeast genera Schizosaccharornyces, Octosporornyces and Hasegawaea. J. Gen. Appl. Microbiol. 33,363-369.
Yamagata, K., Fujita, T., Sachez, P. C., Takahashi, R., and Kozaki, M. (1980).Yeasts isolated from coconut and nipa tuba in the Philippines. Trans. Mycol. SOC.Jpn. 2, 469-476.
Yarrow, D., and Meyer, S. A. (1978).Proposal for amendment of the diagnosis of the genus Candida berkhout nom.cons. Int. J. Syst. Bocteriol. 28,611-615. Yarrow, D., and Nakase, T. (1975).DNA base composition of species of the genus Saccharomyces. Antonie van Leeuwenhoek 41,81-88. Young, T. W.(1981).The genetic manipulation of killer character into brewing yeast. J. Inst. Brew. 87,292-295. Zein, G. N., Moussa, A. M., Abou-Zeid, M. M., Gomaa, E. A., and Nofel, A. (1983).Studies on Kareish cheese in the local markets of Monoufia. I. Yeast content. Egypt. J. Dairy Sci. 11,317-319. Zipkes, M. R.,Gilchrist, J. E., and Peeler, J. T. (1981).Comparison of yeast and mold counts by spiral, pour and streak plate methods. J. Assoc. Off. Anal. Chem. 64,1465-1469.
High-Resolution Electrophoretic Purification and Structural Microanalysis of Peptides and Proteins ERIKP. LILLEHOJ* AND VEDPALS. MALIK+ *Cambridge Biotech Corporation Rockville, Maryland 20850 'Philip Morris Research Center Richmond, Virginia 23261 I. Introduction 11. Polyacrylamide Gel Electrophoresis
A. Theory and Development B. SDS-PAGE C. Two-Dimensional Polyacrylamide Gel Electrophoresis 111. Structural Analysis of Proteins Directly Eluted from One- and Two-Dimensional Polyacrylamide Gels A. Peptide Mapping, Epitope Mapping B. Protein Detection C. Photoaffinity Labeling D. Recovery of Proteins E. The Edman Degradation Cycle F. Automated Amino Acid Sequenators G. Radiochemical Peptide Mapping and Sequence Analysis H. Interference with Sequence Analysis IV. Structural Analysis of Proteins Electroblotted from One- and Two-Dimensional Polyacrylamide Gels A. Protein Electroblotting B. Microanalysis of Electroblotted Proteins C. Microsequence Analysis with Glass Fiber D. Microsequence Analysis with PVDF V. Electrophoretic Micropreparative Procedures as Part of a Comprehensive Purification Strategy A. One-Dimensional SDS-PAGE B. Two-Dimensional SDS-PAGE VI. Applications of Microsequence Analysis of Electrophoretically Purified Proteins A. Oligonucleotide Probes and Gene Cloning B. Polypeptide Processing, Homology Searches C. Peptide Antisera VII. Quality Control of Recombinant Proteins A. Expression Systems B. Protein Denaturation-Renaturation C. NH,-Terminal Methionine D. Posttranslational Modifications E. Fidelity of Translation VIII. Prospective Directions References
279 ADVANCES IN APPLIED MICROBIOLOGY, VOLUME 36 Copyright 0 1991 by Academic Press, Inc. All rights of reproduction in any form reserved.
280
ERIK P. LILLEHOJAND VEDPAL S.MALIK
1. Introduction
Substantial technical advance has occurred in the past 30 years toward the purification and structural analysis of proteins. Traditional methods of protein purification have relied upon the physicochemical properties of the protein of interest, often taking advantage of one or more unique characteristics that could be exploited to remove unwanted contaminants. Thus, a general feature emerged whereby each protein, or class of proteins, required its own particular purification scheme. It is now apparent that this strategy cannot be systematically applied to the study of the majority of proteins, particularly those of great biological significance that are present in only trace amounts. Rather, what is needed are generic procedures enabling the protein chemist to isolate a multitude of different proteins in a form amenable to subsequent structural analyses. In this regard, several techniques are now routinely being applied to achieve this goal, in particular the practice of protein purification by high-resolution two-dimensional polyacrylamide gel electrophoresis (PAGE), electrotransfer to a chemically inert membrane, and high-sensitivity amino acid sequence determination. Two-dimensional PAGE in the presence of the anionic detergent sodium dodecyl sulfate (SDS) is presently the most powerful analytical technique available to examine the dynamics of protein expression during complex biological processes such as differentiation, development, and neoplastic transformation. Until recently, manipulation of the small amounts of proteins resolved on two-dimensional gels without serious losses restrained this procedure as a suitable alternative to existing purification techniques. New methods of amino acid microsequencing as a result of instrument miniaturization and enhanced detection of phenylthiohydantoin (PTH) amino acids now enable the sensitivity of sequencing (10pmol) to approach that of protein detection on two-dimensional polyacrylamide gels (1-10 ng by silver staining, equivalent to 0.05-0.5 pmol of a 50,000-Da protein). The purpose of this review is to provide historical perspectives of the developments of SDS-PAGE, protein electroblotting, and direct amino acid microsequencing, with special emphasis on those qualities that led to the evolution of a unified procedure for routine isolation and primary structural determination of proteins at the subnanomole level. We have directed the content herein primarily toward those individuals from other disciplines who require a concise reference source for application to their particular interests, yet who may be unfamiliar with state-of-theart protein purfication and analytical technologies. This topic has also
PEPTIDE AND PROTEIN PURIFICATION AND ANALYSIS
281
been reviewed by Kent et al. (1987), Wilson (1988), and Simpson et aJ. (1989). Other sources that may be consulted are exclusively concerned with modern techniques of two-dimensional SDS-PAGE (Young and Anderson, 1982; Klose, 1983; Pearson and Anderson, 1983; Celis and Bravo, 1984; Dunbar, 1987a,b; Dunn, 1987; Endler et al., 1987), protein electroblotting (Gershoni and Palade, 1983; Towbin and Gordon, 1984; Bers and Garfin, 1985; Beisiegel, 1986), and/or amino acid microsequence analysis (Tschesche, 1983; Bhown, 1983; Shively, 1986a; Wittmann-Liebold et aJ., 1986; Walsh, 1987; Matsudaira, 1989). II. Polyacrylamide Gel Electrophoresis
A. THEORY AND DEVELOPMENT Electrophoresis has historically been the standard method of choice to analyze the homogeneity of a peptide or protein mixture. The technique is founded upon the observation that proteins possess a charge and will therefore move directionally under the influence of an electric field when placed in a solution with a suitable matrix to provide a nonreactive support and minimize convective forces. Although initial matrices used for this purpose consisted of paper, starch, or agarose, the unique porosity and rigidity of polyacrylamide has led to its almost universal use as the material of choice for electrophoretic purposes. Polyacrylamide is formed by the copolymerization of acrylamide and a cross-linking agent such as N,N’-methylene bisacrylamide (bis). Ammonium persulfate or riboflavin is used as a source of free radicals, with N,N,N’,N’-tetramethylethylenediamine(TEMED) or 3dimethylaminopropionitrile as a catalyst. Gel formation occurs by a two-step process. First, ammonium persulfate in aqueous solution yields a persulfate free radical that transfers an unpaired electron to TEMED, which in turn acts as an electron carrier to activate acrylamide monomers to a free-radical state (Bio-Rad, 1984). These acrylamide monomers polymerize into long chains that randomly incorporate the cross-linking bis monomer to produce a matrix containing pores of defined sizes. By adjusting either the concentration of acrylamide and/ or the degree of cross-linking, the effective pore size can be controlled. Gels with acrylamide concentrations between 3.5 and 40% can be prepared to separate most proteins (Chrambach and Rodbard, 1971). Crosslinking with high concentrations of bisacrylamide, however, is counterproductive and alternative agents, e.g., N,N’-diallyltartardiamide, are recommeded (Chrambach and Rodbard, 1981). When PAGE is used in a strictly zonal electrophoretic manner, proteins are
282
ERIK P. LILLEHOJ AND VEDPAL S. MALIK
separated by their native conformation on the basis of not only their charge and molecular weight, but also structural interaction with the gel itself. PAGE has been used in both continuous and discontinuous (disc) buffer systems. The former uses a uniform buffer solution of constant pH throughout the gel and buffer reservoirs. The pH is chosen to be within the normal limits imposed by pH-dependent protein precipitation (generally, pH 3-10), yet near the PI values of the proteins present in the sample to maximize the relative charge differences and hence the resolution between them. The major disadvantage of continous PAGE systems is the poor resolution obtained with relatively large sample volumes. This problem was solved with the advent of disc electrophoresis, which utilizes a two-gel/two-buffer system to effectively reduce the volume and concentrate the sample as it migrates. The two-gel system consists of an upper (stacking) gel containing relatively large pores and a lower (resolving) gel with smaller pores. The two-buffer system is formulated so the pH of the buffer in the upper gel is less than that in the lower gel and running buffer. The pH values of the sample buffer and upper gel are equivalent. The running buffer also contains a weak acid with a pK, at or near the pH of the upper gel. In the disc system of Orenstein (1964) and David (1964), the buffer is tris(hydroxymethy1) aminomethane (TRIS) adjusted with HC1 to pH 6.7 in both the upper gel and sample buffer, and to pH 8.9 in the lower gel; glycine (pKa 9.6) serves as the weak acid (Fig. 1). In the presence of an electric field, the mobility of the glycinate ions is dictated by an equilibrium that exists between the poorly dissociated, low-mobility form at pH 6.7 and the anionic form with greater mobility at the higher pH. As the chloride and glycinate ions enter the sample buffer from the upper gel, a localized voltage gradient develops between the highly mobile leading chloride ions and the trailing glycinate ions. As this moving boundary sweeps past the proteins in the sample buffer, they acquire a mobility intermediate between that of the chloride and glycinate ions and consequently become stacked one above the other at the glycine/chloride boundary. Upon reaching the high-pH conditions of the lower gel, the mobility of the glycine ions surpasses that of the proteins such that the latter become unstacked and migrate in a uniform voltage gradient according to their charge and molecular weight. The basic principles of this discontinuous gel system have been experimentally adapted to other buffer systems covering the range of pH values between 3.5 and 9.5 (Reisfeld et a]., 1962; Williams and Reisfeld, 1964; Hedrick and Smith, 1968; Paterson and Strohman, 1970; Gabriel, 1971; Rodbard and Chrambach, 1971) and were used to develop a computer program to generate over 4000 different discontinuous buffer systems (Jovin, 1973a,b,c).
PEPTIDE AND PROTEIN PURIFICATION AND ANALYSIS Reservoir buffer h e . pH 8.3)
283
0
Stacking gel In Tris-HCl.pH 6.7
Proteins stacked Proteins fractionating in the resolving gal
Reservoir buffer (Tris- lycine. pH 8 . f )
6
GlycineI chloride boundary
(a) ( b) (C) FIG.1. Theory of discontinuous polyacrylamide gel electrophoresis before application of the electric field [a), during sample migration through the stacking gel [b), and during sample migration through the separating gel (c). Reproduced from Hames and Rickwood (1981),with permission.
B. SDS-PAGE
Because the migration of proteins in continuous or discontinuous polyacrylamide gels is influenced by both their molecular weight and charge, two methods have been developed to analyze protein migration solely under the influence of molecular weight. The first utilizes a technique developed by Ferguson (1964)whereby the relative mobility (Rf) of the protein of interest is determined on gels of different acrylamide concentrations. The Ferguson plot is a graphic analysis of protein Rf versus acrylamide concentration. A linear relationship exists between the slope of the Ferguson plot (KR)and the molecular weight of the protein in its native conformation (Hedrick and Smith, 1968). In most circumstances, however, it is necessary to perform electrophoresis after the proteins have been exposed to a denaturation agent to (1)obtain accurate estimation of molecular weight and (2) dissociate oligomeric protein complexes into their constituent subunits. SDS was used for this purpose initially by Shapiro et al. (1967) and subsequent studies by Weber and Osborn (1969), utilizing a phosphate (continous) buffer system, demonstrated, within molecular sieving limits of the gel, an inverse, linear relationship between the Rf values of a set of proteins and the logarithms of their molecular weight (Fig. 2). Although the exact mechanisms producing this relationship to molecular weight are unclear, SDS binds to proteins at a constant weight ratio (1.4 grams of SDS per gram of protein), inducing a conformational change to random coil, rod-shaped structures with nearly equal charge densities. A reducing
ERIK P. LILLEHOJ AND VEDPAL S.MALIK
284
buffer front
200
I00 80
60 40
20 .-
E : 10
c
J
0
8
0
2
4
6 8 10 I2 14 Distance of migration (cm)
16
FIG. 2. Calibration curves of protein molecular weight plotted on a logarithmic scale on the ordinate versus distance of migration on the abcissa using 5, 10, or 15% total acrylamide concentrations and the SDS-containing discontinuous buffer system of Laemmli (1970). Reproduced from Hames and Rickwood (19811,with permission.
agent (P-mercaptoethanol or dithiothreitol), added to reduce intra- and interchain disulfide bonds, and heat are used to promote complete denaturation. The molecular weight of an unknown protein can therefore be deduced by coelectrophoresis of a series of protein standards with known molecular weights. A comprehensive list of commercially available protein standards has been published (Lillehoj and Malik, 1989). In actuality, this represents the protein’s apparent molecular weight, because its mobility is influenced by additional factors, such as the extent of glycosylation (see below). The most popular discontinuous buffers containing SDS are those of Laemmli (1970),utilizing the TRIS-glycine system described above,
PEPTIDE AND PROTEIN PURIFICATION AND ANALYSIS
285
and of Neville (1971),based on a TRIS-borate buffer. Under ideal conditions, these disc systems are capable of resolving proteins over a broad molecular weight range that differ in size by less than 2% (Rogers et a]., 1986). Figure 3 illustrates a separation of 37,500- and 38,000-Da proteins on a disc SDS-PAGE gel. However, disc polyacrylamide gels are handicapped in their ability to resolve polypeptides less than 15,000-20,000 Da. As pointed out by Wyckoff and co-workers (1977), SDS itself is stacked during electrophoresis in discontinuous buffers and the sizes of SDS micelles approach those of small peptide-SDS complexes, causing protein streaking at high acrylamide concentration (Schagger and von Jagow, 1987). Alternative PAGE systems have thus been developed to analyze small-molecular-weight polypeptides of biological interest either naturally occurring or generated, for example, by proteolytic cleavage for peptide mapping (see below). A modified Laemmli procedure incorporating 8 M urea and a high ratio of bisacrylamide to acrylamide monomer was used to resolve peptides from 20 to 150 residues in length (2500 to 17,000 Da) (Swank and Munkres, 1971). Other gel systems utilizing urea and/or increased cross-linking concentrations have been similarly described (Campbell et al., 1983; Hashimot0 et a]., 1983). The effect of urea is to decrease the gel pore size, probably as a consequence of interference with hydrogen bond formation between acrylamide monomers during polymerization. DeWald et al. (1986) described a continuous buffer gel system, devoid of urea, capable of resolving polypeptides in the range of 2000-200,000 Da. Increasing the mobility of glycine by replacement of TRIS with am-
FIG. 3. Separation of proteins of similar molecular weight by discontinuous SDSPAGE. [35S]Methionine-labeledmouse major histocompatibility complex class I proteins were immunoprecipitated and analyzed on an 11% SDS-PAGE gel according to the system described by Laemmli (1970).Three individual proteins were resolved. Their apparent molecular weights are indicated and were determined from a calibration curve prepared by coelectrophoresis of prestained protein standards. The maximum discernable resolution was achieved between the 37.5-and 38-kDa proteins, which differ in molecular weight by 1.3%. Reproduced from Rogers et al. (1986),with permission.
286
ERIK P. LILLEHOJ AND VEDPAL S. MALIK
mediol was used to enhance the separation of polypeptides down to 6000 Da (Wyckoff et al., 1977) and down to 1500 Da by further refinement using a linear 10-30% gradient acrylamide gel (Bothe et al., 1985).
Others have replaced glycine with alternative trailing ions, for example, 2-morphineethanesulfonic acid (Kyte and Rodriguez, 1983). Anderson and co-workers (1983) used a temporary stacking step provided by acetate ions interspersed between leading sulfate and trailing chloride ions to separate effectively polypeptides between 2500 and 90,000 Da. The use of Tricine instead of glycine allowed resolution of proteins in the range of 1000-100,000 Da using 10% total acrylamide plus 3% cross-linker (Schagger and von Jagow, 1987). Furthermore, the absence of urea and glycine was argued to make this procedure ideally suited for preparative purification of proteins in a form amenable to microsequence analysis. Tsugita et al. (1982) described a continuous PAGE system capable of separating peptides and proteins in the range of 200-100,OOO Da using a volatile buffer, triethylamine/formic acid at pH 11.7. Covalent modification of protein amino groups with trisulfonylpyrene isothiocyanate conferred a strongly negative charge, effectively replacing SDS and allowing proteins to be separated according to their molecular weight. Additionally, this charge modification was claimed to increase the extraction of proteins from the gel matrix, allowing them to be easily concentrated and desalted by evaporation in a form suitable for amino acid composition and NH2-terminal amino acid sequence analyses. A second commonly recognized limitation of SDS-PAGE is its inability to predict accurately the molecular weight on proteins containing various posttranslational modifications, particularly gly cosylation. Glycoproteins consistently exhibit reduced mobility compared to nonglycosylated proteins of closely similar molecular weights, probably as a consequence of their diminished binding to SDS resulting in reduced net charge on a weight basis. Because the difference between observed and actual molecular weight values decreases with increasing acrylamide pore size (Segrest et al., 1971; Leach et al., 1980), it has been proposed that more accurate molecular weight values of some glycoproteins can be estimated by plotting their apparent molecular weight at various acrylamide concentrations and extrapolating to the asymptotic minimal value (Segrest et al., 1971). More accurate estimation of glycoprotein molecular weight has also been reported using SDS gradient acrylamide gels in lieu of fixed acrylamide concentration gels (Lambin and Fine, 1979). Leach et al. (1980),however, were unable to arrive at a similar conclusion. Rather, the results of their studies demonstrated that
PEPTIDE AND PROTEIN PURIFICATION AND ANALYSIS
287
gel filtration chromatography in the presence of denaturants (i.e., 6 M guanidinum chloride) was the most reliable method to predict the molecular weight of a glycoprotein. C. TWO-DIMENSIONAL POLYACRYLAMIDE GELELECTROPHORESIS Most proteins are present in complex mixtures that contain hundreds or thousands of individual components. For example, individual cells have been estimated to contain 10,000 different proteins ranging in abundance from a few hundred to over lo9 molecules per cell (Bravo and Celis, 1982; Pollard, 1984), although others have placed this upper estimate one order of magnitude lower (Duncan and McConkey, 1982). Electrophoresis on a one-dimensional SDS-PAGE gel is normally capable of resolving approximately 100 individual bands (Patton et al., 1990). Most of these bands, however, contain multiple protein species. Many techniques have been developed to increase the capacity of protein separation on a single slab gel by performing two different electrophoretic separations in tandem, with the second being performed perpendicularly to the first. The initial method described by Smithies and Poulik (1956) utilized two-zone electrophoretic processes in starch gel that were similar in nature and thus only able to moderately increase the resolution obtained with a single-dimension gel. The development of electrophoretic procedures capable of independently separating proteins on the basis of charge or size alone led several investigators to design two-dimensional protocols combining a charge-based separation in cylindrical gels in the first dimension, followed by either PAGE (Kenrick and Margolis, 1970) or SDS-PAGE (MacGillivray and Rickwood, 1975) on slab gels. Iborra and Buhler (1976) subsequently devised a two-dimensional system whereby proteins were initially separated on the basis of charge by isoelectric focusing (IEF) on polyacrylamide slab gels in the presence of urea, followed by discontinous SDS-PAGE using the Laemmli gel system. It was O’Farrell (1975), however, who introduced a high-resolution two-dimensional technique that today remains one of the most powerful tools for analytical and preparative separations of proteins from complex biological mixtures. Such two-dimensional gels can identify 100200 different proteins by Coomassie blue staining, 500-1000 proteins by silver staining, or 1000-2000 proteins by autoradiography (Bravo and Celis, 1982; Dunbar, 1987a; Patton et a]., 1990; Krauss et a]., 1990). Figure 4 illustrates a typical two-dimensional gel pattern of a complex protein mixture. Gel systems utilizing larger size formats and multiple gels with overlapping charge and molecular weight fractionation ranges
288
ERIK P. LILLEHOJAND VEDPAL S.MALIK
E F -I
92.5
69
55
43
2 X
30
13
FIG. 4. Two-dimensional gel electrophoresis of 14C-labeled HeLa cell proteins. Proteins were separated by IEF in the horizontal direction and SDS-PAGE in the vertical direction. The migration of molecular weight standards is indicated on the right in kilodaltons. Reproduced from Bravo and Celis (1982),with permission.
have reportedly given resolution of up to 10,000 different proteins (Krauss et al., 1990). The sensitivity of this procedure is remarkable. Polypeptides derived from rare mRNAs and comprising as little as O.OOOO~-O.OOO~%of the total cellular protein can be detected using autoradiographic techniques (O’Farrell, 1975; Garrels, 1979; Bravo and Celis, 1982). The two-dimensional procedure developed by O’Farrell combines protein separation on the basis of charge by IEF in a cylindrical polyacrylamide gel in the presence of urea in the first dimension, followed by SDS-PAGE using a gradient polyacrylamide slab gel with the Laemmli system in the second dimension. IEF is normally performed in a nonrestrictive matrix, commonly agarose or large-pore polyacrylamide,
PEPTIDE AND PROTEIN PURIFICATION AND ANALYSIS
289
containing highly mobile carrier ampholytes consisting of a group of small-molecular-weight, zwitterionic, aliphatic polyamino/polycarboxylic acids with varying isoelectric points (Vesterberg, 1976).Under the influence of a potential difference, they migrate to a position in the gel where their net charge is zero, thus generating a pH gradient, with the most acidic ampholytes located near the anode and the most basic near the cathode. Similarly, because the charge of a protein is determined by the sum of the charges of the individual amino acid side chains (in addition to chemical groups added posttranslationally, e.g., phosphate and carbohydrate), the protein will also migrate to a position in the pH gradient where it has no net charge. The pH at this position is opertionally defined as the pl of the protein. Although IEF is theoretically an equilibrium procedure that reaches completion when protein migration ceases, it is practically difficult to achieve zero mobility because the protein’s velocity asymptotically decreases as it approaches its pl (An der Lan and Chrambach, 1981). It is therefore more appropriate to refer to the apparent PI of a given polypeptide under defined conditions of ampholytes, ionic strength, temperature, and time. Carrier ampholytes are available from a variety of commercial sources or can be synthesized in the laboratory to cover a broad pH range (Vinogradov et a]., 1973), generally between 2 and 11. In practice, however, the distribution of polypeptides across the pH gradient is not linear, because most proteins possess pl values in the range of 5-7 (Patton et al., 1990).Proteins outside of this range, particularly those with a basic pl, can be resolved by nonequilibrium pH gel electrophoresis (O’Farrell et a]., 1977;Willard et al., 1979).Another difficulty of two-dimensional electrophoresis is the variability associated with different sources of ampholytes, which hinders the ability to assign accurately PI values to individual proteins. Such problems include: (1)discontinuities in the pH gradient, (2) electrofocusing drift, (3) nonreproducible precast gels, and (4) difficulty in stabilization of widerange pH gradients (An der Lan and Chrambach, 1981;Hanash and Strahler, 1989).Internal charge standards prepared by progressive carbamylation of a purified protein, e.g., creatine phosphokinase (Anderson and Hickman, 1979), to produce a uniform series of charge isomers, provide a means to determine the relative pl of a particular protein. The advent of polyacrylamide gels containing immobilized pH gradients (Hanash and Strahler, 1989)has also alleviated some of these problems. Patton et al. (1990) have identified seven critical factors necessary for obtaining highly reproducible, high-resolution twodimensional gel patterns: (1)incorporation of a thread into the IEF gel, (2)use of large-format (22 x 22 cm) gels, (3) use of an ampholyte mixture, which broadens the pH 5-7 range, (4) shortening the second-
290
ERIK P. LILLEHOJ AND VEDPAL S. MALIK
dimension separation time, (5) use of high-quality reagents, (6) maintaining constant temperature (20-23OC) during the second-dimension separation, and (7) use of a sensitive protein detection method. Other problems arise when two-dimensional gel electrophoresis, using either equilibrium or nonequilibrium electrofocusing in the first dimension, is incapable of resolving certain types of proteins. In these special circumstances, alternative gel systems have been developed. Traditionally, ribosomal proteins have been separated in a manner involving discontinuous gel electrophoresis at pH 8.6 in the first dimension, followed by continuous gel electrophoresis at pH 4.5 (Kaltschmidt and Wittmann, 1979; Howard and Traut, 1973). Datta et al. (1988) have designed an acid-urea gel for the first dimension and SDS-PAGE in the second as an aid to the identification of Escherichia coli ribosomal proteins. Histones are a class of very basic proteins that have also been difficult to separate by the classical two-dimensional procedure of O’Farrell. Hoffmann and Chalkley (1976) described an acid-urea gel system incorporating detergent in the second dimension, and Sinclair and Rickwood (1981) reported an acid-urea gel followed by an SDS separation at high pH to successfully separate histones. Other types of two-dimensional gels have been devised to analyze nuclear proteins (Orrick et al., 1973).
Ill. Structural Analysis of Proteins Directly Eluted from One- and Two-Dimensional Polyacrylamide Gels
PAGE systems have been used for several years for preparative isolation of proteins for primary structural analysis. The earliest of these investigations utilized polypeptides purified by one-dimensional SDSPAGE for subsequent peptide and epitope mapping studies. Later, as the sensitivity of amino acid detection methods increased, proteins were recovered by diffusion, electrodialysis, or electroelution in sufficient quantities to permit amino acid composition and NH2-terminal sequence analysis by Edman degradation. Further enhancements in the detectability of amino acids using radiolabeled proteins spawned the development of radiochemical methods of primary structural analysis. This section will briefly outline the historical developments of these primary structural techniques as they were applied to proteins isolated from one-dimensional polyacrylamide gels. Following this, recent advances in protein recovery from one- and two-dimensional polyacrylamide gels using novel electroblotting and microsequencing techniques will be summarized.
PEPTIDE AND PROTEIN PURIFICATION AND ANALYSIS
291
A. PEPTIDE MAPPING, EPITOPEMAPPING Peptide mapping is a technique to analyze peptide fragments generated from an intact protein for the purpose of comparing the amino acid sequences of different gene products. High-resolution separation techniques, such as reversed-phase high-performance liquid chromatography (HPLC),are capable of resolving peptides with a single amino acid substitution. Epitope mapping is an extension of this method used to analyze particular antibody-binding sites on a protein antigen. Peptide fragments can be generated using a variety of different chemical or enzymatic procedures as listed in Table I. Judicious choice of the proper protein cleavage agent will expedite and facilitate peptide/epitope mapping studies, because the frequency at which a particular peptide bond occurs in the polypeptide chain dictates the sizes of the peptides generated. For example, cleavage with formic acid tends to produce relatively large fragments because the aspartyl-proline bond is found at an average frequency of once per 400 residues (Sonderegger et al., 1982b). Proteolytic cleavage by trypsin, in contrast, often results in peptides less than 15-20 amino acids in length. Thus, an initial cleavage with formic acid, for instance, can be used to preliminarily localize a particular TABLE I
REAGENTSTO PRODUCEPEPTIDEFRAGMENTS FROM INTACT PROTEINS~ Type of reagent Chemical
Enzyme
a
Peptide bond cleavedb
Reagent Cyanogen bromide (CNBr) 2-(2-Nitrophenylsulfony1)-3’-methyl3’-bromindolenine skatole (BNPSskatole), N-chlorosuccinimide/urea, iodobenzoic acid Nitrothiocyanobenzoic acid Hydroxylamine Formic acid
Methionyl-X Tryptophanyl-X
Trypsin Staphylococcus aureus VB Endoproteinase Arg-C Endoproteinase Asp-C Endoproteinase Lys-C Chymotrypsin, themolysin, pepsin, papain, clostripain, thrombin
Arginyl-X, lysyl-X Glutamyl-X Arginyl-X Aspartyl-X Lysyl-x Nonspecific
Adapted from Spande et 01. (1970),Han et X denotes any amino acid.
01.
X-Cysteiny1 Asparaginy1-glycine Aspartyl-proline
(1983),and Kessey (1987)
292
ERIK P. LILLEHOJAND VEDPAL S. MALIK
peptide or epitope to a general region of the protein as well as to produce a substrate for further cleavage by typsin, to give a less complicated array of peptides than would be generated by direct trypsin cleavage of the intact protein. Once peptides have been produced, they are separated in a manner that allows their further characterization. Fractionation by one- or twodimensional gel electrophoresis has been a popular method of choice for several reasons. First, as indicated above, recent technical advances have permitted the resolution of small peptides on polyacrylamide gels. This is particularly useful for epitope mapping because antigenic determinants tend to occur once every 50-100 amino acid residues along the polypeptide chain (Luzio and Jackson, 1986]. Second, the separated peptide fragments can be accurately characterized according to their molecular weight and PI. If the amino acid sequence of the intact protein is known (e.g., those generated by recombinant DNA procedures), one may be able to predict the region of the protein from which the peptide was derived based on the specificity of the cleavage agent employed. Finally, the peptides can be recovered by electroelution or, more efficiently, by electrotransfer to a suitable matrix for antigenic or structural characterization. As will be discussed below, amino acid composition and NH2-terminal amino acid microsequence analysis have been successfully performed on proteins purified by such means. Historically, the earliest forms of structural characterization of proteins purified by polyacrylamide gel electrophoresis were peptide mapping techniques using either chemical- or protease-based cleavage protocols. In both cases, the proteins being analyzed were either directly electroeluted from the gel matrix or treated in situ and reelectrophoresed on a second gel at a right angle relative to the first separation. Typical examples of the latter using chemical reagents are cyanogen bromide (CNBr) (Lam and Kasper, 1979; Nikodem and Fresco, 1979), hydroxylamine (Lam and Kasper, 1979; Saris et al., 1983), formic acid (Wacker et a]., 1981; Sonderegger et a]., 1982a,b; Rittenhouse and Marcus, 19841, N-chlorosuccinimide (NCS)/urea (Lischwe and Ochs, 1982), and 2-(2-nitrophenylsulfonyl)-3’-methyl-3’-bromindolenine (BNPS)-skatole (Detke and Keller, 1982). Cleveland et al. (19771 produced SDS-PAGE peptide maps of the major bacteriophage T4 head protein following electroelution of [ 14C]leucine-labeledprotein and digestion with Staphylococcus aureus V8 protease. A similar procedure was used by Tijssen and Kurstak (1979) employing dansylated structural proteins of densonucleosis virus. Peptide mapping by in situ protease digestions has been described by Cleveland et al. (1977), Bordier and Crettol-Jarvinen (1979),Lam and Kasper (1980a,b),and Tijssen
PEPTIDE AND PROTEIN PURIFICATION AND ANALYSIS
293
and Kurstak (1983). In these methods, the protein of interest was first separated by SDS-PAGE and the region of the gel containing the protein was excised and layered over a second SDS-PAGE gel. A solution of the particular proteolytic enzyme was then layered over this gel slice and coelectrophoresed with substrate into the stacking gel, where digestion was allowed to proceed and the products separated in the resolving gel of the second dimension. The utility of this procedure is made feasible by the fact that many proteolytic enzymes are active in the presence of SDS (Gooderham, 1984) and, in fact, some degree of substrate denaturation enhances the accessibility of peptide bonds to the enzyme. B. PROTEIN DETECTION Comprehensive bibliographies of polypeptide detection methods have been compiled (Hames and Rickwood, 1981; Kodak, 1985) and will be briefly summarized here. The most common method of visualizing protein in polyacrylamide gels is staining and the most popular protein stain is Coomassie blue G-250, an organic dye that binds to polypeptides by hydrophobic interactions. Coomassie blue staining is sensitive to about 1 pg/cm2. Other protein stains are amido black 10B, fast green FCF, nigrosine, uniblue A, and Ponceau S. Staining methods using these dyes are all based upon direct physical adsorption to the protein. An alternative principle utilizes photographic principles with metal stains such as silver (Oakley et al., 1980; Merril et al., 1981; Morrissey, 1981) and nickel (Yudelson, 1984).The advantage offered by these techniques is that they are much more sensitive than dye adsorption methods, routinely detecting as little as 5-10 ng/cm2. In addition to these general staining reagents, specific procedures have been developed to detect special types of proteins, including (1) glycoproteins (Zacharius et al., 1969; Wardi and Michos, 19721, (2) phosphoproteins (Cutting and Roth, 19731, (3) lipoproteins (Raymond et al., 1966; Naito et al., 19731, (4) nucleoproteins (Dahlberg et a]., 19691, (5) proteins with accessible sulfhydryl groups (Yamamoto et al., 1978; Zelazowski, 1980),and (6) collagens (McCormick et a]., 1979). Ultrasensitive visualization of proteins in polyacrylamide gels has also been achieved using fluorescent staining techniques, and a number of fluorophores have been employed for labeling either prior to (Ragland et al., 1974; Stephens, 1975; Barger et a]., 1976; Chen-Kiang et al., 1979; Tijssen and Kurstak, 1979) or following (Hartman and Udenfriend, 1969; Carson, 1977; Jackowski and Liew, 1980) electrophoresis. Autoradiography and fluorography of radiolabeled proteins separated chiefly on slab gels provide additional sensitive detection methods (see below).
294
ERIK P. LILLEHOJ AND VEDPAL S. MALIK
C. PHOTAFFINITY LABELING The utility of two-dimensional gel electrophoresis can be significantly enhanced if the protein of interest can be specifically identified on the gel. Antibody or chromogenic substrates can be used for this purpose. Photoaffinity labeling of certain proteins in a mixture before their resolution may also overcome the obstacle of identification. Purification of the photoaffinity-labeled glucagon receptor by gel electrophoresis from rat liver plasma membrane has been described (Horuk et al., 1984).Photoaffinity-labeled human P-adrenergic receptor migrated on SDS-PAGE at a mass equivalent to 68 kDa (Fraser et a]., 1987).Using photoaffinity labeling with [32P]8-azido-cAMPand two-dimensional gel analysis, 26 electrophoretic variants of CAMP-binding proteins were identified in six different tissues of the marine mollusk Aplaysia californica (Palazzollo et al., 1989).Fluorography of SDS-PAGE gels on which photoaffinity-labeled human testosterone-binding globulin was analyzed showed two subunits, 52.2 and 48.6kDa (Danzo et al., 1989). The level of charge heterogeneity in the aryl hydrocarbon receptor was analyzed by two-dimensional gel electrophoresis after photoaffinity la(Perdew beling with 2-azido-3-[1251]iodo-7,8-dibromodibenzo-p-dioxin and Hollenback, 1990). Direct photoaffinity-labeling techniques do cross-link nucleotides to many nucleotide-binding proteins ( Jansson and Eriksson, 1990).S-Adenosylmethionine has been used to photoaffinity label several methyltransferases (Billich and Zoecher, 1987;Som and Friedman, 1990). Many proteins are modified in vivo by covalent attachment of certain coenzymes. Prosthetic groups such as biotin, lipoic acid, and 4’phosphopantheine are linked to very few proteins. The ligases that covalently attach these coenzymes to proteins recognize specific amino acid sequences of the target protein. Protein segments recognized by a coenzyme ligase can be fused to a protein of interest and the fusion protein can be specifically labeled by growth of cell cultures in the presence of labeled coenzyme. The fusion protein can then be detected and/or purified by specific binding to the appropriate ligand. Biotin has been used for posttranslational labeling of proteins. The carboxyl-terminal protein segments are conserved in those proteins biotinylated by biotin ligase. Proteins from translational fusions of heterologous genes to the biotinylation-specific carboxyl-terminal sequences yield a molecule that is biotinylated in vivo (Cronan, 1990). The biotinylation sequence is 75 amino acids long and functions in both Saccharomyces and E. coli. Fusion proteins can be labeled with [3H]biotin in vivo and purified by binding to immobilized monomeric avidin followed by elution with buffers containing free biotin. The labeled protein can also be located on two-dimensional gels by fluorography.
PEPTIDE AND PROTEIN PURIFICATION AND ANALYSIS
295
D. RECOVERY OF PROTEINS
Purification of proteins by SDS-PAGE in a form suitable for amino acid analysis has been successfully performed for several years. The most common procedures for recovering proteins from gels include passive diffusion or electroelution. In the first case, the gel segment containing the protein of interest is immersed in a suitable solvent, for example, formic acid (Tsugita et al., 1987), acetic acid (Veronese et al., 1987), sodium hydroxidehhiodiglycol (Manabe et al., 1982), or triethylamine (Shoji et a]., 1986), and the protein is extracted by diffusion. A less time-consuming practice has been to place the gel segment in electrophoresis buffer, extract the protein with an applied potential difference,and collect it on a dialysis membrane (Mardian and Isenberg, 1978; Hanaoka et al., 1979; Bhown et al., 1980; Otto and Snejdarkova, 1981; Mendel-Hartvig, 1982; Walker et al., 1982; Hunkapiller et al., 1983,1984a;Hunkapiller and Lujan, 1986) or a protein-binding gel such as hydroxylapatite (Ziola and Scraba, 1976; Guevara et al., 1982) Figure 5 illustrates the hydroxylapatite/polyacrylamideslab gel used by Guevara et al. (1982) to recover electrophoretically separated proteins. Akaiwa (1982) has cited over 30 literature references pertaining to these
spacer
1
( 1 5 mm thick)
5.6 om
I1
upper phase
middlephase
lower phase
e.[Cm
15.0 em
b
Bottom (Anode end
FIG.5. Diagrammatic illustration of the hydroxylapatite-polyacrylamide slab gel used to isolate proteins. The upper phase consists of powdered polyacrylamide containing the protein of interest previously resolved on preparative two-dimensional gels. The middle phase consists of hydroxylapatite. The bottom phase consists of SDS-polyacrylamide. The protein migrates from the upper phase into the middle phase and is bound by the hydroxylapatite, from which it is recovered by elution with sodium phosphate in a glass column. Reproduced from Guevara et al. (1982),with permission.
296
ERIK P. LILLEHOJ AND VEDPAL S. MALIK
procedures. As popular as they have been, however, they suffer from the drawback of being unsuitable for use with a large number of different proteins and of low recoveries, Kelly et al. (1983)have determined that the major cause of low protein yields during electrophoretic elution is depletion of SDS from the buffer and have thus recommended preincubation of the gel slice in 5% SDS prior to elution. Alternatively, polyacrylamide gel systems have been devised containing unique cross-linking agents that allow the gel matrix to be solubilized under appropriate conditions. Gels prepared with N’,Nbisacrylcystamine (Hansen, 1977) are dissolved with reducing agents such as P-mercaptoethanol or dithiothreitol. Alkaline conditions have been used to dissolve gels cross-linked with ethylene diacrylate (Choules and Zimm, 1965). Periodic acid will solubilize polyacrylamide cross-linked with N’,N-diallytartardiamide (Anker, 1979;Tas et al., 1979),and either periodic acid (O’Connell and Brady, 1977;Tas et al., 1979) or alkali (Mendel-Hartvig, 1982) will solubilize N‘-Ndihydroxyethylenebisacrylamide gels. Although proteins in SDSPAGE gels can easily be recovered using these reagents, they have not generally been applied to protein purification for primary structural studies due to the high concentration of acrylamide monomer that must be removed, amino acid modifications, and introduction of contaminants that interfere with the Edman chemistry and/or high-performance liquid chromatography (HPLC) identification of the released amino acids (see below). Polypeptides resolved by one-dimensional SDS-PAGE have also been purified using special electrophoretic instrumentation capable of continuous collection at the bottom of the gel. A variety of such devices have been described (see, e.g., Jovin et al., 1964;Ryan et al., 1976; Koziarz et al., 1978;Akaiwa, 1982;Hediger, 1986). Many of these suffered from problems related to inadequate heat dissipation, gel deformation, and low protein resolution. A commercially manufactured instrument utilizing short, small-diameter polyacrylamide gels and capable of continuous, microflow elution is available that circumvents many of these difficulties (HPEC; Applied Biosystems, Foster City, California). Sheer et al. (1990)have demonstrated the feasibility of this apparatus for micropreparative electrophoretic isolation of proteins suitable for peptide mapping and NH2-terminal amino acid sequence analyses.
E. THEEDMANDEGRADATION CYCLE A variety of procedures have been developed for the purpose of obtaining an amino acid sequence, but it was Edman (1950)who introduced a set of chemical reactions for the sequential removal of amino
PEPTIDE AND PROTEIN PURIFICATION AND ANALYSIS
297
acids from the NHz-terminus of a polypeptide chain; this procedure remains the most popular today. The Edman degradation cycle consists of three steps: (1)initial coupling of phenylisothiocyanate (PITC)to the a-amino group under basic conditions, (2) cleavage of the NHz-terminal amino acid via cyclization in acidic conditions, and (3) conversion of the anilinothiazolinone (ATZ) amino acid derivative to the more stable PTH derivative. These reactions are illustrated in Fig. 6. Due to a variety of factors such as physical protein loss, chemical side reactions, differential chemical reaction rates, NH2-terminal blockage, acid-catalyzed proteolysis, and incomplete coupling and cleavage, the yield of individual PTH amino acids from the polypeptide chain is always less than complete. Initial yield refers to the yield of PTH amino acid at cycle number 1compared to the total amount of protein applied to the reaction. Repetitive yield (RY) refers to the cumulative yields at successive degradation cycles. For a given pair of the same amino acid, RY is mathematically described by the following equation (Applied Biosystems, 1986):
RY = looyo x
e(ln Yj-ln Yi)
0 - i1-I
where e is the natural logarithm base and In Yi and Yj are the natural logarithms of PTH amino acid peaks at cycles i and j, respectively (with j > i). The average RY of the sequence analysis is the arithmetic average of the individual amino acid RY values. Because RY is always less than 100% as the degradation process proceeds, a gradual increase occurs in the fraction of the preceding residue, overlapping with the released PTH amino acid. In practical terms, this restricts the Edman degradation to a maximum of approximately 70 residues of continuous sequence (Allen, 1981).
F. AUTOMATED AMINOACIDSEQUENATORS Edman and Begg (1967) developed an instrument capable of automated Edman degradation of a protein sample in a solvent film on the inner walls of a rotating vessel. This spinning-cup sequencer was capable of handling nanomole quantities of protein but suffered from problems related to sample loss during washings and extractions, particularly with small peptides. Polybrene (1,5-dimethyl-1,5diazaundecamethylene polymethobromide) was introduced to reduce this problem (Tarr et a]., 1978; Klapper et a]., 1978). Further improvements in instrument design, HPLC analysis of the released PTH amino acids, and use of high-quality reagents and solvents enabled the spinning-cup sequencer to produce sequence data on subnanomole
298 A.
ERIK P. LILLEHOJ AND VEDPAL S. MALIK
coupling
--
+ Hp-CH-CO-NH-CH-CO-NH-CH-CO-
Ph-N=C=B
I
I
R1
I
R2
->
R3
8
II
Ph-NH-C-MI-CH-CO-NH-CH-CO-NH-CH-CO-
I
R1
B.
I
I
R2
--
R3
Cleavage 8
II Ph-NH-C-NH-CH-CO-NH-CH-CO-NH-CH-CO-
I
I
R1
I
R2
+
Oh-NH-C=N-CH-CO
--
R3
--
*H~N-CH-CO-~-CH-CO-
I
I
I
R2
R3
R1
C.
H+
-
conversion
r8 i+
Ph-NH-C=N-CH-CO
8
HzO
H+
->
II
Ph-NH-C-NH-CH-COOH
I
I
->
R1
R1 8
II
rci
Ph-N-CO-CH-NH
I
+ HzO
R1 FIG. 6. Reactions of the Edman degradation cycle. (A) In the coupling step, phenylisothiocyanate (Ph-N+S) reacts with the a-amino group of the NH2-terminal amino acid. (B) In the cleavage step, the ATZ derivative is formed by cyclization and release of the NH,-terminal amino acid. (C) In the conversion step, the ATZ derivative is converted to the more stable PTH derivative via the intermediate phenylthiocarbamyl amino acid. R1,R2, and R3 indicate different amino acid side chains.
PEPTIDE AND PROTEIN PURIFICATION AND ANALYSIS
299
quantities of protein (Wittmann-Liebold, 1973; Hunkapiller and Hood, 1978,1980; Shively, 1981). Concurrent with the development of the spinning-cup sequenator, other procedures were developed for covalent attachment of polypeptides to solid supports for sequence analysis. These solid-phase sequencing techniques utilized the Edman reaction chemistry on proteins attached though their NH,-terminal, COOH-terminal, or internal amino acid residues. Specific coupling procedures (Laursen, 1977) and the current status of automated solid-phase sequencing (Machleidt, 1983; L'Italien, 1986) have been reviewed. However, it was not until the introduction of the gas-liquid solid-phase protein sequencer (commonly referred to as the gas-phase sequencer) by Hewick et al. (1981; Hunkapiller et al., 1986; Hunkapiller, 1988) that useful sequence information on as little as 5 pmol of protein was obtained. This enabled for the first time direct microsequence analysis of peptides and proteins purified by two-dimensional gel electrophoresis and electroblotted onto appropriate supports. A variety of amino acid microsequenators utilizing either gas- or liquid-phase solvent delivery systems are commercially available (Table 11). The gas-phase sequenator replaced the spinning cup of the EdmanBegg instrument with a cartridge containing a reaction chamber with a glass-fiber disk, in which the protein is embedded and through which flow liquid and vapor-phase reagents of the Edman chemistry. A similar instrument with minor modifications was described by Sively and coworkers (Hawke et al., 1985; Shively, 1986b). Improved gas-phase miTABLE I1 COMMERCIALLY AVAILABLE AMINO ACIDMICROSEQUENATORS~ Manufacturer
Sample attachment
Solvent delivery
Applied Biosystems, Foster City, California Chelsea Instruments, London, England Herbet Knauer GmbH, Berlin, Germany MilliGedBiosearch, Burlington, Massachusetts Porton Instruments, Tarzana, California, and London, England
Noncovalent
Liquid or gas phase
Noncovalent
Gas phaseb
Noncovalent
Liquid and gas phases"
Covalent
Liquid phase
Noncovalent
Gas phase
'Adapted from Knight (1989). Can be modified for liquid delivery. Solvents are delivered as liquids and converted to gas phase in the reaction chamber.
300
ERIK P. LILLEHOJ AND VEDPAL S . MALIK
crosequence analysis of low-picomole quantities of proteins was achieved by replacing the conventional cartridge with a continuousflow reactor containing Polybrene-coated porous glass beads (Shively et al., 1987). One problem with all of these sequencers is that they are mutually incompatible, thus limiting selection of the appropriate sequencing method to the particular instrument available. In an effort to circumvent this obstacle, Wittmann-Liebold and co-workers (1986; Wittmann-Liebold, 1983, 1986) designed a multipurpose sequencer combining a different version of automated degradation in a modular fashion, allowing interchange of cup, column, cartridge, or other reaction chambers for liquid-, solid-, or gas-phase sequence analysis. Further advancements in sequenator design and improvements in the sensitivity of PTH amino acid analysis should permit sequence determination in the low-femtomole range (Kent et al., 1987). PEPTIDE MAPPING AND SEQUENCE ANALYSIS G. RADIOCHEMICAL Difficulties in obtaining sufficient quantities of biologically important protein present in trace amounts have provoked technological advance in the development of high-sensitivity microanalytic methods of protein analysis. Initially, radiochemical microsequencing techniques were developed using existing instrumentation applied to nonradioactive proteins. They were particularly well adapted to primary structural characterization of proteins purified by SDS-PAGE. In this manner, amino acid sequence information was obtained from a variety of different proteins, most notably those of immunologic interest that are located on the surface of eucaryotic cells. However, the utility of this procedure was limited in its application to other types of proteins. Later, as a new generation of microsequencers and chromatographic instruments was developed, interest in radiosequence methodologies waned. Two different approaches to radiochemical amino acid sequence analysis have been undertaken. The first utilized 35S-labeledPITC during Edman degradation, followed by chromatography in the presence of unlabeled PTH amino acids, and liquid scintillation counting to identify the radioactive residue (Jacobs and Niall, 1975).Detection of radiolabeled PTH amino acid derivatives produced by this method was approximately 100-fold more sensitive than conventional methods available at the time. However, this method has not proved to be more sensitive than conventional sequence analysis using the gas-phase sequenator (Beyreuther et al., 1983). Alternatively, radiochemical sequence determination based upon in vitro biosynthetic incorporation of 35S-labeledand/or 3H-labeled amino
PEPTIDE AND PROTEIN PURIFICATION AND ANALYSIS
301
acids into polypeptides, electrophoretic purification of the labeled proteins, and subsequent Edman degradation in the spinning-cup sequencer has been more useful. Specific details of the methodology have been extensively reviewed (Coligan and Kindt, 1981;Coligan et al., 1983).Briefly, eucaryotic cells maintained in culture are exposed to a medium containing a single or few selected radioactive amino acids for a period of several hours, allowing uptake into intracellular amino acid pools and incorporation into newly synthesized proteins. Following cell disruption, the radioactive proteins are purified from other radiolabeled components and are subjected to primary structural analysis in the presence of unlabeled carrier proteins. With polypeptides containing a single labeled amino acid, determination of the positions of that particular residue in the primary sequence is accomplished by simply quantitating the amount of radioactive ATZ derivative released at each cycle of the Edman degradation, without the need for PTH amino acid identification. The sequence data obtained in this manner, however, are limited to the extent at which that particular amino acid occurs in the NH2 terminus of the polypeptide. Conversely, use of multiple amino acids as a group in the labeling process increases the amount of sequence information obtained in a single sequence determination but necessitates identification of the released radioactive PTH amino acid residues. Radiosequence analysis has also proved useful in the identification of posttranslational modifications, for example, by using [32P]orthophosphateto delineate sites of tyrosine phosphorylation (Patschinsky et al., 1982). H. INTERFERENCE WITH SEQUENCE ANALYSIS Two major problems that hamper amino acid sequence analysis are (1)introduction of contaminants during protein purification, interfering
with the Edman chemistry and/or subsequent PTH amino acid analysis, and (2) protein modification. For instance, degradation products from Coosmasie blue (Shoji et al., 1986;Wilson, 1988)may cause artifactual HPLC peaks in the first several Edman degradation cycles. High concentrations of glycine used in the Laemmli gel system may also interfere with PTH amino acid identification, and other buffer systems, for example, 10 mM 3-(cyclohexylamino)-l-propanesulfonic acid (CAPS) (Matsudaira, 1987),have been used to avoid this problem. Some of these contaminants are removed during the destaining process or can be extracted by additionally rinsing the gel in several changes of deionized, high-purity water (Shoji et a]., 1986).The period of staining and destaining, however, should be minimized in consideration of the acid lability
302
ERIK P. LILLEHOJ AND VEDPAL S.MALIK
of the aspartyl-proline peptide bond. Alternatively, selective protein precipitation with organic solvents, such as 90% methanol or ethanol at -20°C for 4-18 hours, has been used (Hunkapiller and Lujan, 1986; Ratajczak et al., 1988). The drawbacks of this method include: (1)a minimum of at least 1 pg of protein, (2) a requirement for SDScontaining buffers to achieve resolubility of some proteins, (3) substantial losses, and (4) variable recoveries. Pearson et al. (1987; Pearson, 1986) and Simpson et al. (1987,1989) have investigated reverse-phase HPLC techniques to further purify and consistently recover proteins from SDS-PAGE gel electroeluates in high yield. The most refractory of modifications is NH2-terminal blockage, rendering the protein inaccessible to Edman degradation. The NH2terminal blockage may either occur naturally or be generated during purification. For example, high concentrations of urea at elevated pH and temperature conditions result in carbamylation of primary amino groups by cyanate ions. A variety of nonurea polyacrylamide gel systems to purify proteins over a broad molecular weight range prior to sequencing have been developed (Tsugita et al., 1982; Anderson et a]., 1983; DeWald et al., 1986).Other chemical modifications that have been observed are cyclization of NHz-terminal glutamine residues, or oxidation, and formation of lactones (Allen, 1981).Residual-free radicals and oxidants present in the gel after acrylamide polymerization will destroy tryptophan, histidine, and methionine (Hunkapiller and Lujan, 1986). This effect can be minimized by letting the gels set overnight, prerunning the gels, degassing gel solutions to reduce the amount of catalyst needed for polymerization, or adding an antioxidant such as sodium thioglycolate (Hunkapiller and Lujan, 1986; Simpson et al., 1989).Other recommendations include (1)using a high proteidgel ratio that will not sacrifice resolution and (2) storage of gel solutions with mixed-bed ion exchangers to remove unwanted ions and avoid premature polymerization. Hunkapillar and co-workers (1983, 1986) have emphasized the need for careful attention to the source and quality of chemicals to minimize protein modification during electrophoresis. Specific recommendations regarding the preparation and purification of reagents and solvents for protein microsequencing have been published (Hunkapiller and Kim, 1986). In spite of attempts to minimize NH2-terminal modification during purification, most proteins exist as NHz-terminally blocked molecules in their native biological state (Benjamin et a]., 1989).Examples of these types of alterations include acetyl, formyl, pyroglutamyl, and pyrrolidone carboxylic acid groups (Allen, 1981). Chemical and enzymatic procedures exist to remove selectively some of these groups without
PEPTIDE AND PROTEIN PURIFICATION AND ANALYSIS
303
peptide bond cleavage, but these are not universally applicable to all proteins. Alternatively, gas chromatography, mass spectrometry, or nuclear magnetic resonance spectrometry can be used to identify the blocking groups. Another type of natural posttranslational modification that requires chemical derivatization prior to sequence analysis is amino acid cross-linking. The most common of such cross-links is disulfide bond formation between cysteine residues. These are generally broken by reduction and alkylation or oxidation. Cross-links between lysine and lysine, lysine and glutamic acid, and tyrosine and tyrosine have also been observed (Allen, 1981).
IV. Structural Analysis of Proteins Electroblotted from One- and Two-Dimensional Polyacrylamide Gels
The major limitation that initially hindered the use of twodimensional polyacrylamide gels for purification of proteins in a form suitable for primary structural analysis was the upper limit on the quantity of protein that could be isolated. With one-dimensional SDSPAGE, preparative-scale isolations were readily obtained, as with the apparatus described by Akaiwa (1982). By the very nature of their design, however, two-dimensional gel systems have proved less amenable to scale-up strategies. Typical protein loads accommodated in this case are on the order of 0.1 mg if maximum resolution is to be maintained (Benjamin et a ] . , 1989). Under these conditions, the problems inherent to electroelution (i.e., protein modification and sample loss) are magnified to a degree that limits the utility of the gel extraction techniques discussed above. Moreover, charge microheterogeneity introduced by posttranslational glycosylation (Fig. 7) reduces the proteinto-gel ratio, further complicating electroelution procedures. Two technologies have now matured sufficiently so as to have achieved solutions to these problems. First, recent developments in electroblotting techniques have introduced new protein binding matrices capable of withstanding the harsh chemical reagents used in the Edman degradation procedure. Second, a new generation of protein microsequenators has been introduced based upon the Edman chemistry, yet these are sufficiently sensitive to obtain sequences at the picomole range. Proteins purified electrophoretically and blotted to inert membranes can be directly submitted to microsequence analysis. The remainder of this review will examine these technological developments and their applications and consider what future prospects hold for further advancements.
304 a
ERIK P. LILLEHOJAND VEDPAL S. MALIK E Y
FIG.7. Protein microheterogeneity produced by variations in glycosylation. A rabbit antiserum against a synthetic peptide corresponding to the COOH terminus of the human T cell leukemia virus type I outer surface membrane glycoprotein gp46 was used to detect this molecule on immunoblots prepared from viral proteins electroblotted from one- or two-dimensional SDS-PAGE gels. (A) Immunoblot of a one-dimensional gel. A major immunoreactive protein at 46 kDa was detected. (B) Immunoblot of two-dimensional gel. IEF was performed in the horizontal direction and SDS-PAGE in the vertical direction. Nine immunoreactive spots were detected at 46 kDa varying in PI from 5.5 to 7.0. The migration of molecular weight standards is indicated on the right. This charge heterogeneity was due to variations in carbohydrate because deglycosylation with endoglycosidase F produced a single immunoreactive spot.
A. PROTEIN ELECTROBLOTTING
Although polyacrylamide is a superior support for resolving complex protein mixtures, it is often unsuitable for subsequent characterization of the separated proteins. Many investigators have thus developed methods for vectoral transfer of polypeptides from SDS-PAGE gels onto appropriate solid matrices in a form that facilitates not only their visualization but also immunological and physicochemical evaluation. Nitrocellulose was the first such support utilized for these purposes (Towbin et al., 1979; Renart et al., 1979). Protein binding to this membrane is mediated by hydrophobic (Schneider, 1980)and/or electrostatic (Farrah et al., 1981) forces, although not all polypeptides bind equally well. In
PEPTIDE AND PROTEIN PURIFICATION AND ANALYSIS
305
particular, low-molecular-weight polypeptides (less than 20 kDa) were found to be poorly retained on nitrocellulose (Burnette, 1981; Lin and Kasamatsu, 1983) using electrotransfer conditions appropriate for blotting of higher molecular weight proteins. Addition of methanol to the transfer buffer increases its capacity for low-molecular-weight proteins (Gershoni and Palade, 1982). Otter et al. (1987) developed a two-stage electroblotting procedure that efficiently transfers both highand low-molecular-weight components. Additional determinants (e.g., glycosylation and/or disulfide bond reduction, membrane pore size, and presence of organic solvents) may also influence the extent of protein immobilization (Miribel and Arnaud, 1988). A variety of other membrane supports have been introduced subsequently. Chargemodified nylon has been shown to possess a higher binding capacity and to retain some polypeptides that do not bind to nitrocellulose (Gershoni and Palade, 1982; Miribel and Arnaud, 1988), although other workers have disputed these claims (Pluskal et al., 1986). In addition to its greater mechanical strength compared to nitrocellulose, protein binding to nylon occurs mainly through ionic interactions and permits electrotransfers in the absence of methanol. Proteins immobilized on transfer membranes may be visualized with any of a number of staining reagents. A summary of protein staining techniques on nitrocellulose, nylon, and polyvinylidene difluoride (PVDF) membranes has been published (Pluskal et al., 1986). Glass fiber, nitrocellulose, and PVDF are compatible with classic stains such as Coomassie blue, amido black, India ink, Ponceau S , and silver particles. Nylon membranes, on the contrary, produce extremely high background staining using amido black or colloidal gold particles. Staining with colloidal metal particles is more sensitive than dye-binding procedures: about 1 ng/mm2for iron and less than 1 ng/mm2for gold (Moeremans et al., 1985a,b). Segers and Rabaey (1985) reported the latter was capable of detecting more protein spots than was silver staining on nitrocellulose electroblots of two-dimensional polyacrylamide gels. All of these visualization methods are compatible with amino acid compositional and sequence analyses (see below). In other cases, wherein staining dyes may interfere with other techniques (such as tryptic peptide mapping), reversible staining with Ponceau S (Salinovich and Montelaro, 1986; Montelaro, 1987) or direct visualization of unstained proteins by transillumination (Reig and Klein, 1988) may prove beneficial. Recovery of electroblotted proteins from membranes after separation by SDS-PAGE has been accomplished by two methods. In the first, the membrane is dissolved in a suitable organic solvent and the protein is
306
ERIK P. LILLEHOJ AND VEDPAL S. MALIK
recovered in a form suitable for immunization (Knudsen, 1985) or primary structure determinations (Anderson, 1985).Alternatively, electrotransferred proteins can be eluted off the membrane under conditions that maintain the integrity of the support. Parekh et al. (1985) obtained the highest elution efficiencies from nitrocellulose using nonpolar solvents (50% pyridine or 40% acetonitrile). Yuen et al. (1989) reported extraction of 60% of p-lactoglobulin A from PVDF using 70% isopropanol/5% trifluoroacetic acid. Szyewczyk and Summers (1988) reported optimum elution of proteins electroblotted to PVDF using a detergent mixture consisting of 2% SDS/lYoTriton X-100. Polypeptides bound to poly(4-vinyl-N-methylpyridiniumiodide) (P4MVP)-coated glass-fiber paper were recovered using a solution of 80% formic acid (Bauw et al., 1988, 1989). A systemic survey of protein purification by preparative electroblotting onto a variety of membranes revealed a most efficient elution from nitrocellulose, nylon, or PVDF with acetonitrile and from glass-fiber membranes with formic acid (Montelaro, 1987). These procedures are useful for generating enzymatic or chemical cleavage fragments for peptide mapping and/or internal amino acid sequence studies. Judd (1987) obtained analytical fingerprints of peptides following direct radioiodination and cleavage on nitrocellulose. Scott and co-workers (1988) recovered peptide fragments generated by in situ CNBr digestion of PVDF-electroblotted immunoglobulins that were subsequently separated by reelectrophoresis and were electroblotted and analyzed by NHz-terminal microsequencing. Other workers have described a similar strategy to procure primary structural information of NHz-terminally blocked proteins after in situ protease digestion and recovery of peptides from the membrane (see below). B , MICROANALYSIS OF ELECTROBLOTTED PROTEINS
The ability to electroblot proteins from one- or two-dimensional polyacrylamide gels to chemically inert membranes permits established procedures of primary structural analysis to be performed at picomole levels. Both amino acid composition and NH2-terminal sequence information are essential parameters in the characterization of an unknown protein. Compositional data also provide an estimation of protein quantity. Microdetermination of amino acid composition has now been accomplished on PVDF (LeGendre and Matsudaira, 1988; Nakagawa and Fukuda, 1989; Plough et al., 1989; Santucci et al., 1989; Tous et al., 1989; Yuen et al., 1989) and glass-fiber (Vandekerckhove et al., 1985; Bauw et al.,1987; Bergman and Jornvall, 1987a; Eckerskorn et al.,1988) supports. Furthermore, the same protein-containing bot that was ini-
PEPTIDE AND PROTEIN PURIFICATION AND ANALYSIS
307
tially used for sequence analysis can be hydrolyzed in situ and the amino acid composition of the remaining unsequenced protein can be determined (Hildebrandt and Fried, 1989). Theoretically, other types of posttranslational modifications, for example, glycosylation and acylation, should be identifiable and characterizable by a similar method. C. MICROSEQUENCE ANALYSIS WITH GLASSFIBER
The greatest application of two-dimensional polyacrylamide gel electrophoesis and electroblotting to chemically inert membranes is the direct amino acid microsequence. Figure 8 diagrams the principles of this process. Amino acid sequencing of proteins electroblotted to nitrocellulose or nylon membranes is unavailable because these membranes are incompatible with the chemical reagents and solvents used in the
n/
BLOT TIN G
'
""'
E)
I
MIGRATION OF PROTEIN
4
STAINING
4 4
APPLICATION IN SEQUENATOR
SAMPLE IN CARTRIDGE
FIG. 8. Diagrammatic illustration of the two-dimensional gel/electroblotting/microsequencing process. The protein sample is resolved by IEF in the first dimension, SDSPAGE in the second dimension, and electrotransferred to an inert support (activated paper shown here) as indicated on the right side of the figure. As shown on the left, proteins migrate out of the polyacrylamide gel and are retained on the support. Their position is revealed by staining; the appropriate segment of the support is excised and placed in the reaction cartridge of a gas-phase sequenator. Reproduced from Aebersold et al. (1986a), with permission.
308
ERIK P. LILLEHOJ AND VEDPAL S. MALIK
Edman degradation chemistry. Originally, the glass disk in the reaction cartridge of the gas-phase sequencer was coated with Polybrene, and proteins in solution were directly applied to it, then dried and subjected to sequence analysis. Vandekerckhove et al. (1985) were the first to obtain sequence data from a protein electroblotted onto glass-fiber sheets in the cartridge. Sperm whale myoglobin separated by SDSPAGE was transferred to Polybrene-coated glass fiber and was successfully sequenced through the first 18 NH2-terminal residues. Internal amino acid sequences of actin were also obtained from peptides after S. aureus V8 protease digestion, separation on one-dimensional polyacrylamide gels, and electroblotting to the Polybrene-coated glass fiber. Because Polybrene leads to a high level of background staining with Coomassie blue, these peptides were visualized by either Coomassie blue staining of the gel before transfer or fluorescamine staining of the electroblotted glass membrane. Bergman and Jornvall (1987b) visualized proteins in the gel with 1 M KC1 and electroblotted only those regions containing the protein of interest, prior to sequence analysis. Walsh et al. (1988) determined the NH2-terminal sequences of several Halobacterium marismortui proteins isolated by two-dimensional polyacrylamide gel electrophoresis, transferred to Polybrene-coated glass fiber, and directly visualized on the membrane with the fluorescent stain 33'-dipentyloxacarbocyanine iodide (DPOCC). Andrews and Dixon (1987)reported a procedure for in situ alkylation of cysteine residues on Polybrene-coated glass fiber for direct microsequence analysis. A variety of other modifications of glass fiber have been developed to increase protein-binding capacity and allow direct protein staining on the membrane. Table I11 lists the different electroblotting and polypeptide detection techniques that have been reported and compares the initial and repetitive yields of the sequences obtained. Bauw et al. (1987) and Vandekerckhove et al. (1987) replaced Polybrene with poly(4-vinyl-N-methylpyridiniumiodide) to improve membrane binding and changed the electrotransfer buffer to enhance protein gel elution. In this manner, Nicotiana plumbaginifolia proteins separated by two-dimensional SDS-PAGE and visualized by fluorescamine staining were partially sequenced. Eckerskorn et al. (1988) prepared a silylated glass fiber with blotting and staining characteristics superior to those of polybase-coated glass. The protein-binding capacity of this membrane was reported to be approximately 70 pg/cm2compared to 20-40 pg/cm2 for Polybrene- or P4VMP-modified glass. Furthermore, silylated glass fiber could be directly stained with Coomassie blue for detection of electroblotted proteins. Aebersold et al. (1986a) and subsequently Moos et al. (1988) immobilized SDS-PAGE-separated proteins on glass fiber
PEPTIDE AND PROTEIN PURIFICATION AND ANALYSIS
309
that had been activated by acid etching alone or subsequently modified for ionic interaction with either 3-aminopropyltriethoxy silane (APglass) or N-trimethoxysilylpropyl-N,N,N-trimethylammonium chloride (QA-glass). Bound proteins were detected on the membranes by Coomassie blue or DPOCC staining. Fifteeen different peptides or proteins isolated on one- or two-dimensional gels in amounts between 5 and 140 pmol were sequenced for 9-21 amino acids (Aebersold et a]., 1986a). Figure 9 illustrates the electroblotted profile of a mixture of standard proteins from this study and subsequent NH2-terminal sequence analysis through the first three cycles of one of the proteins (soybean trypsin inhibitor). Aebersold et al. (1986a, 1988) also introduced covalent attachment of proteins electroblotted from polyacrylamide gels to 1,4-diphenylenediisothiocyanate (D1TC)-modifiedglass fiber. This concept was based upon previous techniques for covalent coupling of proteins to supports for solid-phase sequencing, but which were unsuitable for handling small quantities of proteins. Proteins electroblotted directly onto DITC glass through primary amino groups were detected with the fluorescent stain 7-(diethylamino)-3-[4-[(iodoacetyl)amino]phenyl]-4-methylcoumarin (DCIA). Using this technique, NH,-terminal sequences of 10 different proteins in the range of 5-60 pmol were reported. With the advent of solid-phase sequence analysis coupled with micropreparative isolation techniques, it is now possible to begin investigating alternative reaction conditions of the standard Edman chemistry (Kent et al., 1987). For example, more stringent washing solvents (e.g., neat trifluoroacetic acid) and higher flow rates that would normally be incompatible with noncovalently bound proteins can be employed to remove more effectively sample contaminants and shorten the cycle time. D. MICROSEQUENCE ANALYSIS WITH PVDF
In 1986, a new hydrophobic PVDF-based transfer membrane (Immobilon-P, Millipore, Bedford, Massachusetts) with superior protein-binding capacity, chemical resistance, and mechanical rigidity was described (Pluskal et al., 1986). This membrane was also compatible with the conventional protein-staining reagents (Coomassie blue, amido black, India ink), making it ideally suited as an electroblotting support. Matsudaira (1987) was the first to apply this support to obtain NH2-terminal amino acid sequences of low-picomole amounts of electroblotted proteins. The average initial and repetitive yields ranged from 30 to 100% and 88 to 93% respectively for myoglobin and p-lactoglobulin. Xu and Shively (1988) modified the procedure of Matsudaira to
TABLE I11 CHARACTERISTICS OF ELECTROBLOTTING MEMBRANES IN DECT AMINOACIDMICROSEQUENCING
Electrotransfer conditions Matrixa Activated GF
Reference Walsh et al. (1988)
Aebersold et al. (1986a)
Derivatized GF, Polybrene
Bergman and Jornvall
Buffer
Protein detection
Time (volts)
Sequencingb IY
RY
NR
25 mM TRIS, pH 8.4, 0.5 mM DTT 1-5% acetic acid, 0.5% NP-40 40 mM NH,HCO,, pH 8.8
1 hour (150-200 mA),4 hours (650 mA) 3-12 hours (70 V)
Coomassie blue
NR
Coomassie blue
61-74%
92-96%
6 hours (3 W)
KCI
8-48%
94-98%
25 mM TRIS, pH 8.4, 0.5 mM DTT 50 mM borate, pH 8.0
1 hour (150-200 mA), 4 hours (650 mA) 20 hours (3 V/cm)
50 mM TRIS, 50 mM
8 hours (35 V)
Fluorescamine, DPOCC Fluorescamine, Coomassie blue Fluorescamine
50%
91-96%
2 hours (50 V)
DPOCC
61-76%
93-94%
10-90 minutes (50 or
Coomassie blue
40-70 minutes (50 V)
Autoradiography
38-78Yo
92-93Yo
2-5 hours (mA/cmZ)
Coomassie blue, amido black, Ponceau S
50%
93-96Vo
(1987a)
Walsh et al. (1988)
cr W
Vandekerckhove et al. (1985)
0
P4VMP
Bauw et al. (1987)
AP, QA
Aebersold et al. (1986a)
Moos et al. (1988)
Xu and Shively (1988)
Silicone
Eckerskorn et al. (1988)
borate 25 mM TRIS, pH 8.3, 10 mM glycine, 0.5 mM DTT 25 mM TRIS, 10 mM glycine, 0.5 mh4 DTT, or 10 mM CAPS, 0.5 mM DTT 25 mM TRIS, pH 8.3 192 mM glycine 50 mM borate, pH 9.0
loo V)
1-48Y0,C 57-86%d
NR
DITC
Aebersold et al. (1988)
PVDF
Pluskal et al. (1986)
Matsudaira (1987)
LeGendre and Matsudaira (1988)
Walsh et al. (1988)
Xu and Shively W
Y CL
(1988)
Nokihara et al. (1988)
Benjamin et al. (1989)
24 mM N-
ethylmorpholine, pH 8.3 25 mM TRIS, 192 mM glycine, 15-20% methanol 10 mM CAPS, pH l l . O , l O Y o methanol 25 mM TRIS, pH 8.4, 192 mM glycine, 15% methanol 25 mM TRIS, pH 8.4, 0.5 mM DTT
25 mM TRIS, pH 8.4, 192 mM glycine 25 mM TRIS, pH 8.3, 192 mM glycine, 15% methanol 10 mM CAPS, pH 11.0, 10%
2 hours (50 V)
DCIA
1-2 hours (70 V)
10-30 minutes (500 mA)
Coomassie blue, amido black, Ponceau S Coomassie blue
30-100%
84-98Yo
NR
Coomassie blue
70-8Ovo
NR
1hour (150-200 mA), 4 hours (650 mA)
NR
90-94%
1.7 hours (25-30 V)
Fluorescamine, Coomassie blue, DPOCC, amido black Coomassie blue
20-6Oyo
92-94yo
2 hours (7 V/cm)
DHOC
10-30 minutes (90 V)
Coomassie blue, Ponceau S
50-6OYo
83-96Yo
1 6 hours (70 V)
Coomassie blue
80-85%
88-94%
20-4Oyo
NR
NR
92-94yo
NR
NR
methanol Yuen et al. (1989)
10 mM CAPS, pH 11.0
a Abbreviations: P4VMP. poly(4-vinyl-N-methylpyridinium iodide: AP, aminopropyl; QA, N-trimethoxysilylpropyl-N,N,N-trimethylammonium chloride; DITC, 1,4-diphenylenediesotbiocyanate; PVDF, polyvinylidene difluoride; DTT, dithiothreitol; CAPS, 3-(cyclohexylamino)-l-propanesulfonic acid; DPOCC, 3,3'-dipentyloxacarbocyanine iodide; DCIA, 7-(diethylamino)-3-[4-[(iodoacetyl)amino]phenyl]-4-methylcoumarin: DHOC, 3,3'-dihexyloxacarbocyanine iodide. IY, Initial yield: RY, repetitive yield; NR, not reported. Laemmli (1970),gel electrophoresis system. Jovin (1973a,b,c), gel electrophoresis systems.
0.00
3 !
a
0.OC
J b
a
0" 0
0.oc C
c
2
15
10
Minutes
PEPTIDE AND PROTEIN PURIFICATION AND ANALYSIS
313
achieve higher transfer yields by precoating PVDF with Polybrene prior to transfer and optimizing the electroblotting conditions. Considering the amounts of proteins resolved on SDS-PAGE gels, electroblotted to PVDF, and the initial sequencing yields, these authors reported overall yields of 20-30% for soybean trypsin inhibitor and bovine serum albumin and 50-60% for P-lactoglobulin. Compared to glass-fiber membranes, PVDF offered the advantages of (1)no preactivation or chemical modification, (2) lack of band spreading during the transfer step, (3) the ability to visualize immobilized proteins with staining reagents, and (4) lower backgrounds during PTH amino acid analysis. A multitude of other recent literature reports have described NHzterminal sequence determinations of proteins separated by polyacrylamide gel electrophoresis and electroblotted to PVDF membranes (LeGendre and Matusdaira, 1988; Nokihara et al., 1988; Reig and Klein, 1988; Scott et al., 1988; Szyewczyk and Summers, 1988; Walsh et al., 1988; Waters et al., 1988; Xu and Shively, 1988; Benjamin et al., 1989; Plough et al., 1989;Simpson et al., 1989; Yuen et al., 1989).As listed in Table 111, a variety of protein electrotransfer and detection conditions have been used with this support. Blotting buffers have consisted of CAPS or TRIS either containing or devoid of glycine. Blotting times have generally been on the order of one to several hours, and currents in the range of 200-600 mA, although shorter transfer times have also been successful (Matsudaira, 1987; Yuen et al., 1989). The list of protein detection reagents employed with PVDF includes Coomassie blue, amido black, Ponceau S , fluorescamine, DPOCC, and 3,3’-dihexyloxycarbocyanine iodide. Depending on the particular protein and electroblotting conditions, amino acid sequencing data reported by these investigations have varied between 20 and 100% initial yields and 83 and 98% repetitive yields. As indicated above, in some cases, low initial yield values may reflect partial NHz-terminalblockage incurred during purification, and specific
FIG.9. Electroblotting and microsequencing analysis after two-dimensional gel electrophoresis. (A) A mixture of E. coli p-galactosidase (a),bovine serum albumin (b),bovine carbonic anhydrase (c), soybean trypsin inhibitor (d), sperm whale myoglobin (e),and bovine a-lactalbumin (f) was resolved on a two-dimensional gel, electroblotted to an activated glass-fiber support, and stained with Coomasie blue. The region containing soybean trypsin inhibitor was excised and subjected to microsequencing in the gas-phase sequencer. (B) HPLC analysis through the first three degradation cycles. Background peaks are indicated by numbers. Released amino acids (a, b, and c) are identified by the singleletter code (D, Asp; F, Phe; V, Val). The identified sequence was Asp-Phe-Val. Reproduced from Abersold et al. (1986a). with permission.
314
ERIK P. LILLEHOJ AND VEDPAL S. MALIK
procedures have been employed to minimize this effect. Most proteins, however, exist as NH,-terminally blocked molecules in their native biological state. In these instances, three approaches have been taken to obtain internal amino acid sequence information. In the first, proteins resolved by preparative two-dimensional polyacrylamide gels were cut out of the gel, digested in the gel slice with trypsin with the resulting peptides separated on a second single-dimension SDS-PAGE gel, electroblotted to PVDF, and sequenced (Kennedy et al., 1988a,b).An example of this approach used to obtain internal amino acid sequence data from actin is shown in Fig. 10. The other two methods have utilized on-membrane chemical or enzymatic cleavage followed by either direct, in situ microsequence analysis of the unseparated peptides or fragment
B 45
92-
66-
45 -
-
C
-
31 -
21 -
-(
NHz 6)VAALVODNGSGMXKAGFA
-(6) -(6)
VAALVh VAALVODNGSGMXKA
-(226)MiTAASSSSLEKSYELPDGQ
14 31-
-(95)
LRVAPEEHPVLLTEA
(318)ITALAPPTMKIKI IAPP <(169)GVf\LPHAlLRLDLAGRDL
FIG.10. Internal amino acid sequence analysis of Aplysio colifornica actin. (A) Onedimensional SDS-PAGE gel of partially purified actin (indicated by the arrow). The migration of molecular weight markers is indicated on the left. The actin band was excised and digested in situ with Staphylococcus aureus V8 protease at substrate:enzyme ratios of 50 : 1 (B) or 10 : 1 (C). The peptides were separated by SDS-PAGE, transferred to PVDF membrane, stained with Coomassie blue, excised, and subjected to gas-phase sequence analysis. Deduced sequences are indicated by the single-letter amino acid codes. Numbers in parentheses indicate the beginning position of the peptide in the complete actin sequence. The arrow in C indicates undigested actin. Reproduced from Kennedy et 01. (1988a),with permission.
PEPTIDE AND PROTEIN PURIFICATION AND ANALYSIS
315
recovery and separation prior to sequencing. The former strategy is applicable if the cleavage sites occur relatively infrequently in the polypeptide such that mixed sequences of two or three peptides are obtained (Simpson and Nice, 1984; Bauw et al., 1988; Uyttenhove et a]., 1988; Simpson et al., 1989). The sequences of the individual peptides can be determined based upon their respective repetitive yields. Alternatively, peptide fragments have been eluted off of the membrane, separated by reversed-phase HPLC, and sequenced individually. Bauw and coworkers (1989) recovered sequenceable amounts of tryptic peptides from P4VMP-coated glass fiber or PVDF supports using formic acid. Aebersold et al. (1987) added a small amount (5%) of acetonitrile to the digestion buffer to promote release of tryptic peptides from nitrocellulose. These authors obtained an overall peptide recovery of 50-60% in a form suitable for NH2-terminal amino acid sequence analysis. V. Electrophoretic Micropreparative Procedures as Part of a Comprehensive Purification Strategy
Although two-dimensional polyacrylamide gel electrophoresis is one of the most powerful tools for separation of proteins from complex biological mixtures, in many cases the quantity of protein that can be effectively recovered by this procedure in a single step is less than the minimum amount needed for sequence analysis. The long-term goal of many laboratories is directed toward increasing the sensitivity of amino acid sequencing to reach this lower limit of protein detectability (110 ng) on two-dimensional gels (Kent et al., 1987). Before such techniques replace methods currently in use, an alternative strategy has been to combine conventional biochemical procedures with SDSPAGE to purify rare peptides and proteins from crude starting materials. Several examples have already been mentioned above. This section will briefly review additional instances wherein a multistep purification strategy incorporating one- or two-dimensional polyacrylamide gel electrophoresis, usually as the final step, has been used to prepare polypeptides in a form suitable for microsequence analysis. A. ONE-DIMENSIONAL SDS-PAGE The high specificity of immunologically based purification methods, in many cases, has been exploited in conjunction with one-dimensional polyacrylamide gel electrophoresis to isolate a variety of proteins for structural analysis, particularly by radiochemical methodologies. The presence of radiolabeled amino acids in the protein greatly facilitates
316
ERIK P. LILLEHOJAND VEDPAL S. MALIK
both its purification and interpretation of the structural results. In those cases in which a specific antibody has been developed to the protein of interest, the radioactive protein can often be substantially purified in a single, high-yielding step by affinity chromatography or immunoprecipitation. A final step of SDS-PAGE can subsequently achieve purification of the protein of interest from contaminants nonspecifically bound to immunoglobulin, or associated polypeptide chains of an oligomeric protein complex. For example, NH2-terminal sequences of the mouse class I (Maloy et al., 1980; Mole et al., 1982) and human class I1 (Hurley et al., 1982; Kuo et al., 1984) major histocompatibility complex proteins were determined following purification on antibody affinity columns and SDS-PAGE. Both proteins naturally exist as heterodimers that cannot be separated under the conditions required for binding to affinity columns. Once purified from other cellular contaminants, however, the constituent polypeptide chains were resolved by preparative SDS-PAGE. Peptide mapping of radiolabeled proteins isolated from SDS-PAGE gels of immunoprecipitated antigens has also proved to be an ultrasensitive method for comparing the primary structures of different proteins (Lillehoj et a]., 1984, 1985). Separation of the labeled peptides by reversed-phase HPLC (Fig. 11) offers the advantages of reproducibility, high resolution, rapid analysis, and ease of quantitation. By comparison of appropriately radiolabeled peptides generated with specific cleavage agents (e.g., 3H-labeledarginine and 3H-labeledlysine peptides produced by trypsin digestion),it is thus theoretically possible to examine the entire primary sequences of different proteins, with the exception of the unlabeled COOH-terminal peptide. In this manner, one can quickly establish, for instance, whether a particular recombinant protein is identical to its native counterpart without the need for a complete amino acid sequence. B. TWO-DIMENSIONAL SDS-PAGE
Although two-dimensional polyacrylamide gel electrophoresis often completely resolves proteins on a single gel, it is limited in the quantity of total protein that can be separated. Densitometric analysis of Coomassie blue-stained two-dimensional gels containing the maximum protein load without sacrificing resolution has revealed that the most abundant protein constitutes approximately 1 pg of material (Anderson eta]., 1985). Several approaches have been taken to increase the yield of rare polypeptides isolated on two-dimensional gels from crude starting material. Aebersold and co-workers (1986b) modified the conventional
PEPTIDE AND PROTEIN PURIFICATION AND ANALYSIS
-
*H-AQ H - Z D ~
OO
20
40 60
317
A
80 100 120 140 160 180 200 220 FRACTION NUMBER
FIG.11. Radiochemical peptide map analysis of mouse major histocompatibility complex proteins H-2Dd and H-2Ld. Proteins were labeled by biosynthetic incorporation of [3H]arginine (A) or [3H]lysine (B) and were immunoprecipitated from cell extracts with specific antisera and further purified by preparative SDS-PAGE on an 11% polyacrylamide gel. Radiolabeled proteins were recovered by passive elution from the gel slice and digested with trypsin; the resulting peptides were separated by reversed-phase HPLC with the indicated gradient of CH3CN.Identical peptides coeluted in the same fraction number. Arrows indicate the peptide differences among the two proteins. Reproduced from Lillehoj et 01. (1985),with permission.
technique to obtain quantities of proteins from whole cell lysates sufficient for microsequencing. Several (e.g., five) first-dimension IEF gels were used to resolve the crude cell extract, and the sections of the gels containing the protein of interest, predetermined from analytical experiments, were cut out and placed in tandem across the width of a single SDS-PAGE gel. Following electrophoresis in the second dimension and electroblotting, the regions of the glass-fiber membrane containing the protein of interest were recovered and placed together in the reaction cartridge of the sequenator. Benjamin et al. (1989) obtained a more concentrated solution containing rat liver membrane glycoproteins by
318
ERIK P. LILLEHOJ AND VEDPAL S. MALIK
prefractionation on concanavalin A lectin and gel filtration chromatography columns prior to two-dimensional polyacrylamide gel electrophoresis. Yuen et al. (1988) compared two different modes of microbore HPLC fractionation with a single HPLCISDS-PAGE procedure for protein purification prior to microsequencing. For very complex protein mixtures (rabbit muscle crude extract) with less than 1 pg of starting material, these authors found both methods comparable. VI. Applications of Microsequence Analysis of Electrophoretically Purified Proteins
Microsequence analysis of proteins can be used to gain fundamental insights into many experimental systems concerning development, differentiation, neoplastic transformation, and genetic variability. Quantitative computer-analyzed two-dimensional gel electrophoretograms of cellular proteins provide specific characteristics of molecular weight, PI, and protein quantity that, in total, constitute a cell fingerprint (Blose and Hamburger, 1985). Comparison of fingerprints of normal and oncogenic cells, for example, may reveal alterations in protein expression associated with transformation. Similar studies applied to genetic diseases, tissue-specific gene expression, and cellular responses to stress, hormones, growth factors, or drugs will aid in the classification of unique protein markers affiliated with specific types of gene expression. Once identified, they can be isolated and sequenced. Specific examples of microanalytic techniques applied to primary structural studies of proteins include (1)generation of oligonucleotide probes for molecular cloning of genes, (2) verification of functional open reading frames, (3) identification of proteolytic cleavage sites within precursor polyproteins, (4) searching data bases to identify unknown proteins, (5) generation of antipeptide antibodies, (6) epitope mapping, and (7) quality control in the manufacture of recombinant proteins. A. OLIGONUCLEOTIDE PROBES AND GENECLONING A unique sequence of only a few amino acids can be used to synthesize an oligonucleotide probe, which can be used to isolate the gene that codes for the whole protein. The gene can then be sequenced and back-translated to obtain the complete amino acid sequence of the protein. Amino acid sequence and X-ray crystallographic data can be represented graphically with computer-generated images, allowing insight into the details of enzyme-active sites. Analogs of active sites or
PEPTIDE AND PROTEIN PURIFICATION AND ANALYSIS
319
other molecules that inhibit the activity of such an active site can then be rationally designed. Automated instruments are routinely used to synthesize short tracts of single-stranded DNA. These readily available oligonucleotides of defined sequence allow the isolation of cloned copies of the corresponding gene by the polymerase chain reaction (Sambrook et al., 1989). Because the genetic code is degenerate (Table IV), a collection of all possible DNA sequences must be synthesized to ensure that at least one of the probes will be completely homologous to the corresponding gene. The following hexapeptide and corresponding oligonucleotide sequences illustrate this point: hexapeptide:
oligonucleotides:
degeneracy:
Met-Asn-Phe-Tyr-Val-Trp- Ala T A T T T A T AUG AA TT TA GT TGG GC C C C G G C C l X 2 X 2 X 2 X 4 X 1 X 4
The sequence contains three codons with twofold ambiguity and two codons with fourfold ambiguity. By ommitting the last (3’) wobble base of the alanine codon, a pool of 32 degenerate oligonucleotides, each 20 nucleotides in length, will represent all possible sequences that can code for the amino acid sequence. Only one of these oligonucleotides in this degenerate pool is an exact match for the sequence in the desired DNA. In this manner, Reyes et aJ. (1981) used two sets of oligonucleotide probes based upon the amino acid sequence of the H-2Kb protein to isolate a corresponding cDNA. The first consisted of a mixture of eight different 16-base long probes corresponding to all possible coding sequences for amino acids 51-56 and the second represented four different 11-base-long probes for residues 58-61. However, because three of the most common amino acids (arginine, serine, and leucine) are each encoded by six different codon triplets, the number of individual probes needed for this procedure may be large. For example, Bell et al. (1984) required a set of 256 different 23-base-long oligonucleotides to clone the insulin-like growth factor I1 gene. It is therefore worthwhile to identify and use amino acid sequences that contain residues with no or minimal codon redundancy, for instance, methionine or tryptophan, which each have a single codon. Internal sequences generated by CNBr or BNPSskatole, which cleave on the COOH-terminal side of methionine and tryptophan, respectively, are particularly useful in this regard. Two
TABLE IV COWNTABLE(NUCLEAR GENES) Amino Acid -Alanine -kginine -Asparagine -Aspartic acid -Cysteine -Glutamine -Glutamic acid -Glycine -Histidine -1soleucine -Leucine -Lysine -Methionine (start) -Phenylalanine -Proline -Serine -Threonine -Tryptophan -Tyrosine -Valine
Three-letter code
Single-letter code
Ala
A R N D C
k g
Asn ASP CYS Gln Glu GlY His Ile Leu LYS Met Phe Pro Ser T h TrP Tyr Val
Q E G H I L K M F P S T
4 6
2 2 2 2 2 4
2 3 6
2 1 2 4 6 4
Y
1 2
V
4
W
Codon
Frequency
uuu UUC UUA UUG
Phe Phe Leu Leu
ucu ucc
CUU CUC CUA CUG
Leu Leu Leu Leu
ccu ccc
AUU AUC AUA AUG GUU GUC GUA GUG
Ser Ser Ser Ser
UAU UAC UAA UAG
Tyr TYr stop stop
UGU UGC UGA UGG
CCA CCG
Pro Pro Pro Pro
CAU CAC CAA CAG
His His Gln Gln
CGU CGC CGA CGG
Ile Ile Ile Met (start1
ACU ACC ACA ACG
Thr Thr Thr Thr
AAU AAC AAA AAG
Asn Asn LYS LYS
AGU AGC AGA AGG
Val Val Val Val
GCU GCC GCA GCG
Ala Ala Ala Ala
GAU GAC GAA GAG
ASP ASP Glu Glu
GGU GGC GGA GGG
UCA UCG
PEPTIDE AND PROTEIN PURIFICATION AND ANALYSIS
321
separate pools of oligonucleotides are synthesized if amino acids with six possible codons must be used. For example, in the case of leucine, one pool containing the condons CTA, CTG, CTT, and CTC and the other containing TTA and TTG will avoid two incorrect codons, TTT and TTC, both of which code for phenylalanine. A different approach has been to use a single probe, with hybridization specificity conferred by increased length. Examples of this technique are found in the cloning of the human insulin receptor gene (Ullrich et al., 1985) and the human coagulation factor VIII gene (Toole et al., 1984; Wood et al., 1984). In the case of the insulin receptor, preparative SDS-PAGE was used as the last step for purification of the constituent a and p chains, and NH2-terminal sequences from them were used to prepare single 63-base-long (achain) and 54-base-long (p chain) oligomeric probes. In some cases, the homology of single, long synthetic probes can be increased by consideration of the known codon bias exhibited by particular organisms. For example, based upon an internal amino acid sequence from a tryptic peptide of a yeast ubiquitin protein hydrolase, Miller et al. (1989) designed a 53-base oligonucleotide probe based upon yeast-preferred codon usage to clone the corresponding gene. The advantages and disadvantages of cloning strategies using multiple short probes versus a single long probe have been discussed (Lathe, 1985). “Guessmers” are pools of oligonucleotides with degeneracies that encompass only a subset of the possible codons at each position. If a sufficiently long stretch of amino acid sequence is available, the length of the oligonucleotide probe can be increased. A single probe 30-70 nucleotides in length that represents the combination of likely condons in the authentic gene can be used (Sambrook et al., 1989). Use of 2,6diaminopurine in oligonucleotide gene probes increases the hybrid stability (Brennan and Gumport, 1985). Synthetic probes with a neutral base, such as inosine, at positions of ambiguity will pair equally with all four bases. Because most amino acids are specified by codons that differ only at the third position and two of the three nucleotides of each codon are a perfect match, the increased stability of hybrids formed by longer oligonucleotides more than compensates the negative effect of inosine. Selection of a codon at the position of ambiguity is made by keeping the following considerations in mind. 1. The sequence of CpG is underrepresented in eucaryotic DNA and
may therefore be eliminated (Sood et al., 1981; Ohno, 1988). 2. The codons that are most commonly used for a particular amino
acid with the organism under study are often used (Sambrook et al., 1989; Campbell and Gowri, 1990).
322
ERIK P. LILLEHOJ AND VEDPAL S. MALIK
3. Specific gene families may favor certain codons. 4. The sequence should not have regions of internal complementarity
that would reduce hybridization efficiency. Sambrook et al. (1989) entertained the possibility of synthesizing a small pool of two to eight guessmers that contain all possible choices at certain positions. However, the strength of hybridization generated by the correct probe could be decreased if guessmers consist of too many oligonucleotide subsets (Touchet et a]., 1987). Use of only a subset of potential codons introduces a bias against the detection of genes with a different codon usage. Degenerate oligonucleotides corresponding to conserved regions of the catalytic domains of protein kinases have been used to clone transcripts encoding homologues in mammals (Hanks, 1987),yeast (Levin et al., 1987), and plants (Lawton et al., 1989). Mixed oligonucleotide primers to two conserved regions of the protein have been used in the polymerase chain reaction for the isolation of conserved genes, such as succinate dehydrogenase (Gould et a]., 1989). Conserved amino acid residues (motifs) in groups of functionally related proteins can be found by protein sequence data base searches using modern computer technology (Ingrosso et al., 1989; Altschul and Lipman, 1990; Smith et al., 1990).
A final consideration in choosing synthetic oligonucleotide probes is the type of library to be screened. cDNA libraries derived from oligo(dT)-primed mRNA, in many cases, contain reverse transcripts truncated at the 5’ end of the gene and should therefore be hybridized with probes corresponding to amino acid sequences from the COOHterminus of the protein. Synthetic oligonucleotides to be used as primers for preparing cDNA libraries should be given the same consideration. Primers complementary to the COOH-terminal coding region have been used to prepare near full-length cDNAs (Sood et al., 1981). B. POLYPEPTIDE PROCESSING, HOMOLOGY SEARCHES
Beyreuther et al. (1983) and Gassmann et al. (1989) utilized microsequence data to identify the correct open reading frame of bacterial genes. In other cases, bacterial and viral open reading frames are transcribed as polycistronic mRNAs encoding precursor proteins that are posttranslationally cleaved into smaller, functional polypeptides. The position of the cleavage sites within such polyproteins can be determined from the NH2-terminal sequences of the individually purified polypeptides (Lee et al., 1984; Lightfoote et al., 1986; Veronese et al., 1987; Lillehoj et al.,
PEPTIDE AND PROTEIN PURIFICATION AND ANALYSIS
323
1988). Radiochemical techniques generating partial NH2-terminal sequences have also proved invaluable in establishing the relatedness between different gene products of multiple gene families [Clement and Shevach, 1981;Kuo et al., 1984). Because the chance for random matching of even a small number of residues within a stretch of 20-30 amino acids is very small, sequence information can be used to search any of several available data bases (e.g., the Dayhoff protein sequence data base, the Protein identification resource from the National Biochemical Research Foundation, the Swiss-Prot data base from EMBL, or the G.B. trans protein data base from GENEBANK)to identify previously characterized homologous proteins [Bauw et al., 1987, 1989; Kennedy et al., 1988a,b).The availability of two-dimensional gel protein data bases also permits identification of structurally related proteins based upon electrophoretic comigration [Kennedy et al., 1988a). Several computeranalyzed two-dimensional gel data bases are now being established (Anderson et al., 1981; Lee et a]., 1988; Celis et al., 1989; Garrels and Franze, 1989; Neidhardt et al., 1989; Sweatt et al., 1989; Krauss et a ] . , 1990).
C. PEPTIDE ANTISERA Micropreparative techniques of protein isolation, although sufficient for amino acid sequencing, do not yield adequate quantities necessary for other purposes, for example, antibody production. As an alternative approach, synthetic peptides corresponding to the sequence available have been prepared and in turn used to produce antisera that react with the native protein. In this regard, peptide antigens from the NHZterminus of the protein are superior immunogens compared to those derived internally (Palfreyman et al., 1984). It has been suggested that the ends of a polypeptide chain may be conformationally more flexible and thus capable of reacting with a greater fraction of peptide antibodies [Walter, 1986). Antibodies against synthetic peptides corresponding to internal amino acid sequences can be used for epitope mapping studies. Peptide antibodies reactive with native proteins have also been used to identify molecular isoforms that arise as a consequence of posttranscriptional [Lew et a]., 1986) or posttranslational (Sutcliffe et a]., 1980) modifications. VII. Quality Control of Recombinant Proteins
A variety of proteins produced by recombinant DNA procedures have been accepted by regulatory agencies for therapeutic or diagnostic purposes. Examples include human insulin growth hormone, tissue plas-
324
ERIK P. LILLEHOJ AND VEDPAL S.MALIK
minogen activator, and interferon (Malik, 1989).Many more recombinant proteins are expected to become commercially available within the next decade and sales of biotechnology companies are expected to increase by 250% during this time (Burrill, 1989).Quality control of the manufacture of these recombinant products will accordingly become more important in the biotechnology industry. This includes the demonstration of not only homogeneity at the protein level, but also lack of nonproteinaceous contaminants such as lipids, polysaccharides, endotoxins, nucleic acids, and infectious viruses. The techniques described in this review are ideally suited to perform these tasks. Two-dimensional gel electrophoresis provides a quick and convenient method to establish both the level of expression of a recombinant protein in crude fermentation media and the purity of the product after scale-up purification. Primary structural analyses (peptide mapping, ,amino acid composition, and amino acid sequencing) of the protein electroblotted from two-dimensional gels provide a means to confirm that the recombinant product is identical to the natural polypeptide. Several other techniques not covered in this review that have also been used to verify the authenticity of a recombinant protein are COOHterminal amino acid sequencing, circular dichroism, optical rotatory dispersion, and carbohydrate analysis, where applicable. A. EXPRESSION SYSTEMS
Bacteria are the most commonly used organisms for expression of eucaryotic genes because the technology is most advanced for these hosts and high levels of production (up to 25% of total protein) can be achieved (Marston, 1986). However, procaryotic expression systems exhibit structural modifications that may alter the biological activity of the foreign protein, particularly under the conditions that lead to high expression levels. Eucaryotic expression systems, in many cases, provide correct posttranslational modifications, but the level of protein production is lower, 3 4 % of total protein from yeast and milligram/ liter concentrations from mammalian cells. On the negative side, however, many mammalian cell lines require serum-conditioned growth media to supply essential nutrients. The high protein content of such media often complicates purification of the expressed protein. B. PROTEIN DENATURATION-RENATURATION
For a recombinant protein to possess the same biological activity as its native counterpart, it must be properly folded into the correct tertiary structure. Because the amino acid sequence of a polypeptide determines
PEPTIDE AND PROTEIN PURIFICATION AND ANALYSIS
325
its final three-dimensional structure, it is imperative for the recombinant protein to possess the correct primary structure, including amino acid sequence and disulfide bonds. Most foreign polypeptides produced in bacteria, however, accumulate as insoluble inclusion bodies and stringent denaturation conditions that destroy tertiary structure are required for purification. Certain solubilization reagents, for example, high concentrations of urea, must be used cautiously to prevent NH2terminal blockage or other modifications that may interfere with primary structure determination or protein activity. Furthermore, most heterologous proteins are expressed in a reduced state in the bacterial cytoplasm and incorrect disulfide bonds may spontaneously form upon extraction. For a recombinant protein to regain biological activity after solubilization, it must return to its native conformation by a thermodynamic process of renaturation. This requires both correct folding into its proper three-dimensional structure and accurate disulfide bond formation. The number of cysteine residues present in the recombinant polypeptide influences the ease with which proper disulfide bonding occurs. For example, human growth hormone with only four cysteines contained the proper secondary structure and disulfide cross-links when expressed in E. coli (Hsuing et al., 1986). In this case, peptide mapping studies were instrumental in assigning the disulfide bond arrangements. Other polypeptides with a larger number of cysteines are less easily refolded (Halenbeck et al., 1989). C. N H z - T METHIONINE ~ ~ ~ ~ ~ ~ In E. coli, translation is generally initiated by N-formylmethionine, which is usually different from the authetic NHz terminus of the foreign protein. Although bacterial enzymes exist that deformylate and remove the NHz-terminal methionine residue, a certain fraction of the recombinant protein may retain these unnatural modifications, thus generating a heterogeneous mixture of molecules. Recombinant proteins containing this extra amino acid are potentially immunogenic (Glasbrenner, 1986). Tryptic peptide mapping by reversed-phase HPLC has been used to identify the extra methionine-containing peptide and resolve it from the native NHz terminus (Garnick et al., 1988). A variety of cloning vectors have also been devised that generate recombinant polypeptides containing NHz-terminal leader sequences that can be removed by site-specific chemical or enzymatic reagents to produce the authentic foreign protein (Hsuing et al., 1986; Hopp et al., 1988; Miller et al., 1989; Sabin et al., 1989). Recombinant proteins may also have truncated NH2 and/or COOH termini as a result of intracellular proteolysis (Hopp et al.,1988). A specific E.coli proteinase, La, has been shown to be responsible for at
326
ERIK P. LILLEHOJ AND VEDPAL S. MALIK
least part of this effect. Variant bacterial strains with reduced endogenous proteolytic activity may be used to control host-mediated protein degradation. Heterogeneous termini also result from alternative translation initiation at internal methionine codons and premature translation termination.
D. POSTTRANSLATIONAL MODIFICATIONS Procaryotic hosts cannot perform many of the modifications exhibited by eucaryotic proteins, particularly N-linked glycosylation. Direct consequences of this effect are (1)protein inactivity if oligosaccharides are required for in vivo function, (2) reduced serum half-life, and (3)altered immunogenicity (Marino, 1989). Yeast, insect, and mammalian cell expression systems do perform glycosylation, although use of these expression systems may not eliminate these problems because the types and extent of sugar moieties added may not exactly duplicate those of the native molecule. There is also debate whether glycosylation microheterogeneity exhibited by natural mammalian glycoproteins should be completely defined before considering the utility of a corresponding recombinant product. Comparative peptide mapping of glycopeptides derived from recombinant and native proteins may aid in establishing whether correct oligosaccharide structures have been added (Garnick et a]., 1988). Proteolytic cleavage of the NHz-terminal signal sequence from a secreted protein can be directly verified by amino acid microsequence analysis. Although eucaryotic signal sequences on recombinant proteins have been shown to be correctly processed by bacterial secretion systems, the yield of the secreted product is often low (Gray et al., 1985). Eucaryotic polypeptides fused to procaryotic signal sequences are produced in greater amounts. Hsiung et aJ. (1986)and Takahara et al. (1988) used a cloning vector capable of in-frame fusion of foreign genes immediately following the E. coli ompA signal peptide for high-level expression of the human superoxide dismutase and growth hormone genes, respectively. In both cases, secretion of active, recombinant products with NHz-terminal amino acid sequences identical to their native protein counterparts was demonstrated. Stetler and co-workers (1989) utilized yeast signal peptides to express functional human secretory leukocyte protease inhibitor in Saccharomyces cerevisiae. Amino acid microsequence analysis demonstrated the presence of several forms of the secreted recombinant proteins arising as a result of correct and incorrect NHz-terminal proteolytic processing.
PEPTIDE AND PROTEIN PURIFICATION AND ANALYSIS
327
E. FIDELITY OF TRANSLATION
Foreign proteins expressed in heterologous host cells under conditions favorable to overexpression may demonstrate altered codon bias compared to native polypeptides (Ernst, 1988). Other concerns arise as a consequence of “growth media-related phenomena,” such as translational substitution of methionine by norleucine (Garnick et al., 1988). It is therefore important to assess the complete primary structural characteristics of the recombinant protein to ensure that it is identical to its natural homologue. Current regulatory guidelines surrounding this issue recommend state-of-the-art procedures, for example, one- and twodimensional polyacrylamide gel electrophoresis, reversed-phase HPLC, peptide mapping, amino acid composition, and amino acid sequence analyses. The ability to directly sequence recombinant polypeptides from two-dimensional gel electroblots will undoubtably become more instrumental in industrial quality control procedures as commercially manufactured proteins become more prevalent in the health care setting. VIII. Prospective Directions
Amino acid sequencing has traditionally improved over time as a consequence of advancements in purification of small amounts of protein as well as optimization of all aspects of the sequencing process itself. In this review, we have attempted to provide historical perspective of the technical developments that have culminated in the most successful strategy used to obtain sequence data from the smallest amounts of proteins possible, namely: (1) purification by one- or twodimensional gel electrophoresis, (2) electroblotting to membrane supports, (3) direct gas-phase microsequencing, and (4) reversed-phase HPLC analysis of PTH amino acids. Improvements in any of these steps will further contribute toward successful sequencing of smaller quantities of protein. Presently, two-dimensional gel electrophoresis and silver staining are the most powerful methods for isolation and visualization of polypeptides in nanogram amounts from complex biological mixtures. Although not specifically discussed in this review, microbore HPLC offers an alternative high-resolution purification technique to achieve the same goal, particularly with peptides too small to be resolved by SDS-PAGE (Wilson et al., 1986; Simpson et al., 1989). Recently, a new two-dimensional technique, termed chromatophoresis, was developed whereby proteins are first separated by reversed-phase HPLC followed by direct sample transfer to a SDS-PAGE gel for the
328
ERIK P. LILLEHOJ AND VEDPAL S. MALIK
second dimension (Nugent et al., 1988).High-voltage capillary electrophoresis and open-column liquid chromatography are emerging techniques that may soon surpass two-dimensional gel electrophoresis in their capacity to resolve protein mixtures. Once more sensitive detection methods have been developed, these latter two procedures have the potential for achieving protein separations at the single-cell level. The electroblotting process will improve as membrane supports are developed that allow efficient immbolization of all peptides and proteins regardless of their molecular weight, charge, extent of glycosylation, hydrophobicity, etc. Newer membranes producing improved repetitive yields are clearly needed. More sensitive on-membrane detection reagents will be required as smaller and smaller amounts of proteins are separated. In this regard, protein visualization based upon phase-contrast transillumination has recently been applied to polypeptides electroblotted onto PVDF membranes in preparation for microsequencing (Pickett et al., 1990).Membranes allowing covalent attachment processes are the most promising because they can be used with a variety of sequencing chemistries to shorten the reaction cycle and increase the sensitivity of PTH amino acid detection. Limitations imposed by solid-phase sequencing, for example, low yields of amino acids at coupling sites, could possibly be overcome by novel “hybrid” membranes allowing reversible covalent attachment without protein loss in the noncovalently bound state. Other types of supports are required to quantitatively recover peptides and proteins after electrotransfer for further structural analyses. Gas-phase sequenators are currently capable of obtaining up to 70 residues of sequence information from a few nanomoles of protein (Hunkapiller et a]., 1984b).Some degree of increased instrument performance may be possible by further modifications of both hardware and software components (Hawke et al., 1985;Kent et al., 1987).However, the greatest challenge to increased sensitivity of automated protein sequencing using the Edman technique lies in PTH amino acid determination. The limits of current microsequencing techniques are restricted to 1-5 pmol of protein primarily as a consequence of the sensitivity of PTH analysis (Kent et a]., 1987). Progress in this area is needed to surpass the picomole sequencing barrier. Computer-assisted analyses of conventional (absorbance) chromatographic data provide some improvement. Furthermore, novel, more sensitive (e.g., fluorescent) sequencing reagents and protocols are being investigated to increase the sensitivity of detecting PTH amino acids (Jin et al., 1986;Kent et al., 1987;Salnikow et al., 1987).Experimental systems utilizing mass spectrometry have reported PTH amino acid sensitivities in the femtomole
PEPTIDE AND PROTEIN PURIFICATION AND ANALYSIS
329
range, with sample analysis times approximately 10% of those required by HPLC methods (Hunkapiller et al., 1984b). Fast-atom bombardment mass spectrometry (FABMS) is a powerful technique that can be directly applied to amino acid sequence determination of proteins derived from recombinant DNA procedures (Kelly, 1988). FABMS is based upon ionization, fragmentation, and characterization of different ions of a given molecule that are subsequently identified based upon their characteristic charge-to-mass ratio. FABMS determination of the molecular weights of peptide fragments from a recombinant protein, when compared to the predicted values derived from the nucleotide sequence, can be used to verify the theoretical translation sequence. Future technological advances in conventional as well as novel microsequencing techniques will undoubtedly provide new tools for investigating protein structure and lead to fundamental insights into complex biological problems. REFERENCES Aebersold, R. H., Teplow, D. B., Hood, L. E., and Kent, S. B. H. (1986a).J. Biol. Chem. 261, 4229-4238.
Aebersold, R., Leavitt, J., Hood, L., and Kent, S. (1986b).In “Methods of Protein Microcharacterization. A Practical Handbook” (J. E. Shively, ed.), pp. 277-294. Humana Press, Clifton, New Jersey. Aebersold, R., Leavitt, J., Saavedra, R. A., Hood, L. E., and Kent, S. B. H. (1987).Proc. Natl. Acad. Sci. U.S.A. 84,6970-6974. Aebersold, R. H., Pipes, G. D., Nika, H., Hood, L.. E., and Kent, S. B. H. (1988).Biochemistry 27,6860-6867. Akaiwa, S. (1982).Electrophoresis 3, 321-325. Allen, G.(1981).“Sequencing of Proteins and Peptides.” Elsevier, Amsterdam. Altschul, S. F., and Lipman, D. J. (1990).Proc. Natl. Acad. Sci. U.S.A. 87,5509-5513. An der Lan, B., and Chrambach, A. (1981).In “Gel Electrophoresis of Proteins. A Practical Approach” (B. D. Hames and D. Rickwood, eds.), pp. 135-188. IRL Press, Oxford. Anderson, B. L., Berry, R. W., and Telser, A. (1983).Anal. Biochem. 132, 365-375. Anderson, N.L., and Hickman, B. J. (1979).Anal. Biochem. 93,312-320. Anderson, N.L., Taylor, J., Sandora, A. E., Coulter, B. P., and Anderson, N. G. (1981).Clin. Chem. 27,1807-1820. Anderson, N. L., Nance, S. L., Tollaksen, S. L., Giere, F. A., and Anderson, N. G. (1985). Electrophoresis 6,592-599. Anderson, P. J. (1985).Anal. Biochem. 148,105-110. Andrews, P. C., and Dixon, J. E. (1987).Anal. Biochem. 161,524-528. Anker, H. S. (1979).FEBS Lett. 7,293. Applied Biosystems (1986).“ABI User Bulletin,” No. 10.Applied Biosystems, Inc., Foster City, California. Barger, B. O., White, F. C., Pace, J. L., Kemper, D. L., and Ragland, W. L. (1976).Anal. Biochem. 70,327-335. Bauw, G., De Loose, M., Inze, D., Van Montagu, M., and Vandekerckhove, J. (1987).Proc. Natl. Acad. Sci. U S A . 84,4806-4810.
330
ERIK P. LILLEHOJ AND VEDPAL S. MALIK
Bauw, G., Van den Bulcke, M., Van Damme, J., Puype, M., Van Montagu, M., and Vandekerckhove, J. (1988).J. Protein Chem. 7, 194-196. Bauw, G., Van Damme, J., Puype, M., Vandekerckhove, J., Gesser, B., Ratz, G. P., Lauridsen, J. B., and Celis, J. E. (1989). Proc. Natl. Acod. Sci. U.S.A. 86, 7701-7705. Beisiegel, U. (1986).Electrophoresis 7, 1-18. Bell, G. I., Merryweather, J. P., Sanchez-Pescador, R., Stempien, M. M., Priestley, L., Scott, J., and Rall, L. B. (1984).Nature (London) 310, 775-777. Benjamin, T., Niu, C. N., Parmelee, D. C., Yu, B., Roller, P. R., and Thorgeirsson, S. S. (1989). Electrophoresis 10,447-455. Bergman, T., and Jornvall, H. (1987a). Eur. J. Biochem. 169,9-12. Bergman, T., and Jornvall, H. (1987b). In “Methods in Protein Sequence Analysis. 1986” (K. A. Walsh, ed.), pp. 311-316. Humana Press, Clifton, New Jersey. Bers, G., and Garfin, D. (1985). BioTechniques 3, 276-288. Beyreuther, K., Bieseler, B., Bovens, J., Dildrop, R., Neifer, K., Stuber, K., Zaiss, S., Ehring, R., and Zabel, P. (1983).In “Modern Methods in Protein Chemistry: Review Articles” (H. Tschesche, ed), pp. 303-325. de Gruyter Press, New York. Bhown, A. S. (1983). “CRC Handbook of ProteinIPeptide Sequence Analysis: Current Methodologies.” CRC Press, Boca Raton, Florida. Bhown, A. S., Mole, J. E., Hunter, F., and Bennett, J. C. (1980). Anal. Biochem. 103, 184-190.
Billich, A., and Zoecher, R. (1987).Biochemistry 26, 8417-8423. Bio-Rad (1984). “Acrylamide Polymerization-A Practical Approach,” Bull. No. 1156. Bio-Rad Lab., Richmond, California. Blose, S. H., and Hamburger, S. A. (1985).BioTechniques 3, 232-236. Bordier, C., and Crettol-Jarvinen, A. (1979).J. Biol. Chem. 254, 2565-2567. Bothe, D., Simonis, M., and von Dohren, H. (1985). Anal. Biochem. 151,49-54. Bravo, R., and Celis, J. E. (1982). Clin. Chem. 28, 766-781. Brennan, C. A., and Gumport, R. I. (1985). Nucleic Acid Res. 16, 305-319. Burnette, W. N. (1981).Anal. Biochem. 112, 195-203. Burrill, G. S. (1989).BioPharm 2(Nov./Dec.), 52-56. Campbell W. H., and Gowri, G. (1990). Plant Physiol. 92,1-11. Campbell, W. P., Wrigley, C. W., and Margolis, J. (1983).Anal. Biochern. 129, 31-36. Carson, S. D. (1977). Anal. Biochem. 78, 428-435. Celis, J. E., and Bravo, R. (1984). “Two-Dimensional Gel Electrophoresis of Proteins. Methods and Applications.” Academic Press, Orlando, Florida. Celis, J. E., Ratz, G. P., Madsen, P., Gesser, B., Lauridsen, J. B., Brogaard-Hansen, K. P., Kwee, S., Holm-Rasmussen, H., Nielsen, H. V., Cruger, D., Basse, B., Leffers, H., Honore, B., Moller, O., and Celis, A. (1989).Electrophoresis 10, 76-115. Chen-Kiang, S., Stein, S., and Udenfriend, S. (1979).Anal. Biochern. 95, 122-126. Choules, G. L., and Zimm, B. H. (1965). Anal. Biochem. 13, 336-344. Chrambach, A., and Rodbard, D. (1971).Science 172,440-451. Chrambach, A., and Rodbard, D. (1981).In “Gel Electrophoresis of Proteins” (B. D. Hames and D. Rickwood, eds.), pp. 92-134. IRL Press, Oxford. Clement, L. T., and Shevach, E. M. (1981).In “Contemporary Topics in Molecular Immunology” (F. P. Inman and W. J. Mandy, eds.), Vol. 8 , pp. 149-185. Plenum, New York. Cleveland, D. W., Fischer, S. G., Kirschner, M. W., and Laemmli, U. K. (1977). J. Biol. Chem. 252,1102-1106. Coligan, J. E., and Kindt, T. J. (1981).1.Immunol. Methods 47,1-11. Coligan, J. E., Gates, F. T., 111, Kinball, E. S.,and Maloy, W. L. (1983).Methods Enzymol. 91, 413-434.
PEPTIDE AND PROTEIN PURIFICATION AND ANALYSIS
331
Cronan, J. E., Jr. (1990).J. Biol. Chem. 265,10327-10333. Cutting, J. A., and Roth, T. F. (1973).Anal. Biochem. 54,386-394. Dahlberg, A. E., Dingman, C. W., and Peacock, A. C. (1969).J. Mol. Biol. 41, 139147.
Danzo, B. J., Bell, B. W., and Black, J. H. (1989).Endocrinology (Baltimore) 124,28092817.
Datta, D. B., Changchien, L. M., Nierras, C. R., Strycharz, W. A., and Craven, G. R. (1988). Anal. Biochem. 173,241-245. Davis, B. J. (1964).Ann. N.Y. Acad. Sci. 121,404-427. Detke, S., and Keller, J. M. (1982).J. Biol. Chem. 257, 3905-3911. DeWald, D. B., Adams, L. D., and Pearson, J. D. (1986).Anal. Biochem. 154,502-508. Dunbar, B. S.(1987a).BioTechniques 5,218-226. Dunbar, B. S. (1987b). “Two-Dimensional Electrophoresis and Immunological Techniques.” Plenum, New York. Duncan, R., and McConkey, E. H. (1982).Clin. Chem. 28, 749-755. Dunn, M. J. (1987).J. Chromatogr. 418, 145-185. Eckerskorn, C., Mewes, W., Goretzki, H., and Lottspeich, F. (1988).Eur. J. Biochem. 176, 509-519.
Edman, P. (1950).Acta Chem. Scand. 4,283-293. Edman, P., and Begg, G. (1967).Eur. J. Biochem. 1,80-91. Endler, A.T., Young, D. S., and Tracy, R. P. (1987).Cancer Invest. 5, 127-149. Ernst, J. F. (1988).Trends Biotechnol. 6,196-199. Farrah, S. R., Shah, D. O., and Ingram, L. 0. (1981).Proc. Natl. Acad. Sci. U.S.A. 78, 1229-1232.
Ferguson, K. A. (1964).Metab., Clin. Exp. 13,985-1002. Fraser, C. M., Chung, F. Z., and Venter, J. C. (1987).1. Biol. Chem. 262, 14843-14846. Gabriel, 0.(1971).Methods Enzymol. 22,565-577. Garnick, R. L., Solli, N. J., and Papa, P. A. (1988).Anal. Chem. 60,2546-2557. Garrels, J. I. (1979).J. Biol. Chem. 254, 7961-7964. Garrels, J. I., and Franze, B. R. (1989).J. Biol. Chem. 264, 5283-5298. Gassmann, G. S., Kramer, M., Gobel, U. B., and Wallich, R. (1989).Nucleic Acids Res. 17, 3590.
Gershoni, J. M., and Palade, G. E. (1982).Anal. Biochem. 124,396-405. Gershoni, J. M., and Palade, G. E. (1983).Anal. Biochem. 131,1-15. Glasbrenner, K. (1986).J. Am. Med. Assoc. 255,581-587. Gooderham, K. (1984).In “Methods in Molecular Biology” (J. M. Walker, ed.), Vol. 1, pp. 193-202. Humana Press, Clifton, New Jersey. Gould, S. J., Subramani, S., and Scheffler, I. E. (1989).Proc. Natl. Acad. Sci. U.S.A. 86, 1934-1938.
Gray, G. L.,Baldridge, J. S., McKeown, K. S., Heyneker, H. L., and Chang, C. N. (1985). Gene 39,247-254. Guevara, J., Jr., Chiocca, E. A,, Clayton, F. C., von Eschenbach, A. C., and Edwards, J. J. (1982).Clin. Chem. 28, 756-758. Halenbeck, R., Kawasaki, E., Wrin, J., and Koths, K. (1989).BioTechnology 7,710-715. Hames, B. D., and Rickwood, D. (1981).“Gel Electrophoresis of Proteins. A Practical Approach.” IRL Press, Oxford. Han, K. K., Richard, C., and Biserte, G. (1983).Int. J. Biochem. 15,875-884. Hanaoka, F., Shaw, J. L., and Mueller, G. C. (1979).Anal. Biochem. 99,170-174. Hanash, S. M., and Strahler, J. R. (1989).Nature (London) 337,485-486. Hanks, S. K. (1987).Proc. Natl. Acad. Sci. U.S.A. 84,388-392.
332
ERIK P. LILLEHOJ AND VEDPAL S. MALIK
Hansen, J. N. (1977).Anal. Biochem. 76,37-44. Hartman, B. K.,and Udenfreind, S.(1969).Anal. Biochem. 30,391-394. Hashimoto, F., Horigome, T., Kanbayashi, M., Yoshida, K., and Sugano, H. (1983).Anal. Biochem. 129,192-199. Hawke, D. H., Harris, D. C., and Shively, J. E. (1985).Anal. Biochem. 147,315-330. Hediger, M. A. (1986).Anal. Biochem. 142,445-454. Hedrick, J. L., and Smith, A. J. (1968).Arch. Biochem. Biophys. 126,155-164. Hewick, R. M., Hunkapiller, M. W., Hood, L. E., and Dreyer, W. J. (1981).J. Biol. Chem. 256,7990-7997.
Hildebrandt, E., and Fried, V. A. (1989).Anal. Biochem. 177,407-412. Hoffmann, P., and Chalkley, R. (1976).Anal. Biochem. 76,539-546. Hopp, T. P., Prickett, K. S., Price, V. L., Libby, R. T., March C. J., Cerretti, D. P., Urdal, D. L., and Conlon, P. J. (1988).BioTechnology 6,1204-1210. Horuk, R., Beckner, S., Lin, M., and Wright, D. E. (1984).Prep. Biochem. 14,99-121. Howard, G. A., and Traut, R. R. (1973).FEBS Lett. 29,177-180. Hsuing, H. M., Mayne, N. G . , and Becker, G. W. (1986).BioTechnology 4,991-995. Hunkapiller, M. W. (1988).In “CRC Handbook of ProteidPeptide Sequence Analysis: Current Methodologies” (A. S. Bhown, ed.), pp. 87-117. CRC Press, Boca Raton, Florida. Hunkapiller, M. W., and Hood, L. E. (1978).Biochemistry 17,2124-2133. Hunkapiller, M. W., and Hood, L. E. (1980).Science 207,523-525. Hunkapiller, M. W., and Kim, C. S. (1986).In “Methods of Protein Microcharacterization. A Practical Handbook” (J. E. Shively, ed.), pp. 329-334. Humana Press, Clifton, New Jersey. Hunkapiller, M. W., and Lujan, E. (1986).In “Methods of Protein Microcharacterization. A Practical Handbook” (7. E. Shively, ed.), pp. 89-101. Humana Press, Clifton, New Jersey. Hunkapiller, M. W., Lujan, E., Ostander, F., and Hood, L. E. (1983).Methods Enzymol. 91, 227-236.
Hunkapiller, M. W., Strickler, J. E., and Wilson, K. J. (1984a).Science 226, 304-311. Hunkapiller, M., Kent, S., Caruthers, M., Dreyer, W., Firca, J., Giffin, C., Horvath, S., Hunkapiller, T., Tempst, P., and Hood, L. (1984b).Nature (London) 310,105-111. Hunkpiller, M. W., Grandlund-Moyer, K., and Whiteley, N. W. (1986).In “Methods of Protein Microcharacterization. A Practical Handbook” (J. E. Shively, ed.), pp. 223247.Humana Press, Clifton, New Jersey. Hurley, C. K., Shaw, S., Nadler, L., Schlossman, S.,and Capra, J. D. (1982).J. Exp. Med. 156,1557-1562.
Iborra, F., and Buhler, J. M. (1976).Anal. Biochem. 74,503-511. Ingrosso, D., Fowler, A. V., Bleibaum, J., and Clarke, S.(1989).J. Biol. Chem. 264,2013120139.
Jackowski, G., and Liew, C. C.(1980).Anal. Biochem. 102,321-325. Jacobs, J. W., and Niall, H. D. (1975).J. Biol. Chem. 250, 3629-3636. Jansson, O.,and Eriksson, S.(1990).Biochem. J. 269, 201-205. Jin, S.,Chen, G. X., Palacz, Z., and Wittmann-Liebold, B. (1986).FEBS Lett. 198,150-154. Jovin, T. M. (1973a).Biochemistry 12,871-879. Jovin, T. M. (1973b).Biochemistry 12,879-890. Jovin, T. M. (1973~). Biochemistry 12,890-898. Jovin, T. M., Chrambach, A., and Naughton, M. A. (1964).Anal. Biochem. 9,351-369. Judd, R. C. (1987).Anal. Biochem. 160,306-315. Kaltschmidt, E., and Wittmann, H. G. (1970).Anal. Biochem. 36,401-412.
PEPTIDE AND PROTEIN PURIFICATION AND ANALYSIS
333
Kelly, C., Totty, N. F., Waterfield, M. D., and Crumpton, M. J. (1983). Biochem. Int. 6, 535-544.
Kelly, J. W. (1988). BioTechnology 6, 125-129. Kennedy, T. E., Gawinowicz, M. A., Barzilai, A., Kandel, E. R., and Sweatt, J. D. (1988a). Proc. Natl. Acad. Sci. U.S.A. 85, 7008-7012. Kennedy, T. E., Wager-Smith, K., Barzilai, A., Kandel, E. R., and Sweatt, J. D. (1988b). Nature (London) 336,499-500. Kenrick, K. G., and Margolis, J. (1970). Anal. Biochem. 33, 204-207. Kent, S., Hood, L., Aebersold, R., Teplow, D., Smith, L., Farnsworth, V., Cartier, P., Hines, W., Hughes, P., and Dodd, C. (1987). BioTechniques 5, 314-321. Kessey, J. (1987) “Biochemica Information. A Revised Biochemical Reference Source.” Boehinger Mannheim Biochemicals, Indianapolis, Indiana. Klapper, D. G., Wilde, C. E., 111, and Capra, J. D. (1978). Anal. Biochem. 85, 126131.
Klose, J. (1983). In “Modern Methods in Protein Chemistry: Review Articles” (H. Tschesche, ed.), pp. 49-78. de Gruyter, New York. Knight, P. (1989). BioTechnology 7, 1075-1076. Knudsen, K. A. (1985). Anal. Biochem. 147,285-288. Kodak (1985). “Kodak Products for Gel Electrophoresis,” Publ. No. JJ-11.Eastman Kodak Co., Rochester, New York. Koziarz, J. J., Kohler, H., and Steck, T. L. (1978). Anal. Biochem. 86, 78-89. Krauss. M. R., Collins, P. J., and Blose, S. H. (1990).BioTechniques 8, 218-223. KUO,M.C., Li, X. M., Marti, G. E., Sachs, J. A,, Sogn, J. A., Coligan, J. E., and Kindt, T. J. (1984). Immunogenetics 19, 27-37. Kyte, J., and Rodriguez, H. (1983). Anal. Biochem. 133, 515-522. Laemmli, U. K. (1970). Nature (London) 227,680-685. Lam, K. S., and Kasper, C. B. (1979). J. Biol. Chem. 254, 11713-11720. Lam, K. S., and Kasper, C. B. (1980a). J. Biol. Chern. 255, 259-266. Lam, K. S., and Kasper, C. B. (1980b). Anal. Biochem. 108,220-226. Lambin, P., and Fine, J. M. (1979).Anal. Biochem. 98,160-168. Lathe, R. (1985).J. Mol. Biol. 183,l-12. Laursen, R. A. (1977). Methods Enzymol. 47, 277-288. Lawton, M. A., Yamamoto, R. T., Hanks, S. K., and Lamb, C. J. (1989).Proc. Natl. Acad. Sci. U.S.A. 86,3140-3144. Leach, B. S., Collowan, J. F., Jr., and Fish, W. W. (1980). Biochemistry 19, 5734-5741. Lee, C., Hu, S. E., Lok, M. S., Chen, Y. C., and Tseng, C. C. (1988). BioTechniques 6, 216-224.
Lee, T. H., Coligan, J. E., McLane, M. F., Sodroski, J. G., Popovic, M., Wong-Staal, F., Gallo, R. C., Haseltine, W., and Essex, M. (1984). Proc. Natl. Acad. Sci. U.S.A. 81, 75797583.
LeGendre, N., and Matsudaira, P. (1988). BioTechniques 6, 154-159. Levin, D. E., Hammond, C. I., Ralston, R. O., andBishop, J. M. (1987).Proc. Natl. Acad. Sci. U.S.A. 84,6035-6039. Lew, A. M., Margulies, D. H., Maloy, W. L., Lillehoj, E. P., McCluskey, J . , and Coligan, J. E. (1986). Proc. Natl. Acad. Sci. U.S.A. 83, 6084-6088. Lightfoote, M. M., Coligan, J. E., Folks, T. M., Fauci, A. S., Martin, M. A., and Venkatesan, S. (1986).J. Virol. 60, 771-775. Lillehoj, E. P., and Malik, V. S. (1989). Adv. Biochem. Eng./Biotechnol. 40, 19-71. Lillehoj, E. P., Walsh, W. D., Potter, T., Lee, D. R., Coligan, J. E., and Hansen, T. H. (1984). J. Immunol. 133,3138-3142.
334
ERIK P. LILLEHOJ AND VEDPAL S. MALIK
Lillehoj, E. P., Myers, N. B., Lee, D. R., Hansen, T. H., and Coligan, J. E. (1985).J. Immunol. 135,1271-1275.
Lillehoj, E. P., Salazar, F. H. R., Mervis, R. J., Raum, M. G., Chan, H., Ahmad, N., and Venkatesan, S. (1988).J. Virol. 62, 3053-3058. Lin, W., and Kasamatsu, H. (1983).Anal. Biochem. 128,302-311. Lischwe, M. A., and Ochs, D. (1982). Anal. Biochem. 127,453-457. L’Italien, J. J. (1986). In “Methods of Protein Microcharacterization. A Practical Handbook” (7. E. Shively, ed.), pp. 329-334. Humana Press, Clifton, New Jersey. Luzio, J. P., and Jackson, P. (1986). In “CRC Handbook of Immunoblotting of Proteins” (0.J. Bjerrum and N. H. H. Heegaard, eds.), Vol. 2, pp. 13-23. CRC Press, Boca Raton, Florida. McCormick, P. J., Chandrasekhar, S., and Millis, A. J. T. (1979). Anal. Biochem. 97, 359-366.
MacGillivray, A., and Rickwood, D. (1975).In “Isoelectric Focusing” (J. P. Arbuthnott and J. A. Beeley, eds.), pp. 254-260. Machleidt, W. (1983).In “Modern Methods in Protein Chemistry: A Review” (H. Tschesche, ed.), pp. 267-302. de Gruyter, New York. Malik, V. S. (1989).Adv. Appl. Microbiol. 34, 263-306. Maloy, W. L., Hammerling, G . , Nathenson, S. G., and Coligan, J. E. (1980). J. Immunol. Methods 37,287-299. Manabe, T., Kojima, K., Jitzukawa, S., Hoshino, T., and Okuyama, T. (1982). Clin. Chem. 28,819-823.
Mardian, J. K. W., and Isenberg, I. (1978). Anal. Biochem. 91, 1-12. Marino, H. M. (1989). BioPharm 7(Mar.), 18-33. Marston, A. 0. (1986). Biochem. J. 240, 1-12. Matsudaira, P. T. (1987).J. Biol. Chem. 262, 10035-10038. Matsudaira, P. T. (1989). “A Practical Guide to Protein and Peptide Purification for Microsequencing.” Academic Press, Orlando, Florida. Mendel-Hartvig, I. (1982).Anal. Biochem. 121, 215-217. Merril, C. R., Danau, M. L., and Goldman, D. (1981). Anal. Biochem. 110, 201-207. Miller, H. I., Henzel, W. J., Ridgway, J. B., Kuang, W. J., Chisholm, V., and Liu, C. C. (1989). BioTechniques 7, 698-704. Miribel, L., and Arnaud, P. (1988). J. Immunol. Methods 107,253-259. Moeremans, M., Danneels, G., and De Mey, J. (1985a). Anal. Biochem. 145, 315-321. Moeremans, M., De Raeymaeker, M., Daneels, G., and De Mey, J. (1985b).Anal. Biochem. 153,18-22.
Mole, J. E., Hunter, F., Paslay, J. W., Bhown, A. A., and Bennett, J. C. (1982).Mol. Immunol. 19,l-11.
Montelaro, R. C. (1987). Electrophoresis 8, 432-438. MOOS,M., Nguyen, N. Y., and Liu, T. Y. (1988).J. Biol. Chem. 263,6005-6008. Morrissey, J. H. (1981). Anal. Biochem. 117, 307-310. Naito, H., Wada, M., Ehrhart, L. A. and Lewis, L. A. (1973). Clin. Chem. 19, 228-234. Nakagawa, S., and Fukuda, T. (1989). Anal. Biochem. 181,75-78. Neidhardt, F. C., Appleby, D. B., Sankar, P., Hutton, M. E., and Phillips, T. A. (1989). Electrophoresis 10, 116-121. Neville, D. M. (1971).J. Biol. Chem. 246, 6328-6334. Nikodem, V., and Fresco, J. R. (1979). Anal. Biochem. 97, 382-386. Nokihara, K., Beck, R., and Herbst, F. (1988). Anal. Lett. 21,1371-1382. Nugent, K. D.,Slattery, T. K., Lundgard, R. P., Wehr, C. T., Seiter, C. H., and Burton, W. G. (1988). BioChromatography 3, 168-173.
PEPTIDE AND PROTEIN PURIFICATION AND ANALYSIS
335
Oakley, B. R., Kirsch, D. R., and Morris, N. R. (1980).Anal. Biochem. 105, 361-363. O’Connell, P. B. H., and Brady, C. J. (1977). Anal. Biochem. 76, 63-73. O’Farrell, P. H. (1975).J. Biol. Chem. 250, 4007-4021. O’Farrell, P. Z., Goodman, H. M., and O’Farrell, P. H. (1977).Cell (Cambridge, Mass.) 12, 1133-1142.
Ohno, S. (1988). Proc. Natl. Acad. Sci. U.S.A. 85, 9630-9634. Orenstein, L. (1964).Ann. N.Y. Acad. Sci. 121, 321-349. Orrick, L. R., Olson, M. 0. J., and Busch, H. (1973). Proc. Natl. Acad. Sci. U.S.A. 70, 1316-1320.
Otter, T., King, S. M., and Witman, G. B. (1987). Anal. Biochem. 162, 370-377. Otto, M., and Snejdarkova, M. (1981). Anal. Biochem. 111, 111-114. Palazzollo, M., Katz, F., Kennedy, T. E., and Schwartz, J. H. (1989). J. Neurobiol. 20, 746-761.
Palfreyman, J. W., Aitcheson, T. C., and Taylor, P. (1984). J. Immunol. Methods 75, 383-393.
Parekh, B. S., Mehta, H. B., West, M. D., and Montelaro, R. C. (1985).Anal. Biochem. 148, 87-92.
Paterson, B., and Strohman, R. C. (1970). Biochemistry 9,4094-4105. Patschinsky, T., Hunter, T., Esch, R. S., Cooper, J. A., and Sefton, B. M. (1982).Proc. Natl. Acad. Sci. U.S.A. 79,973-977. Patton, W. F., Pluskal, M. G., Skea, W. M., Buecker, J. L., Lopez, M. F., Zimmermann, R., Belanger, L. M., and Hatch, P. D. (1990).BioTechniques 8, 518-527. Pearson, J. D. (1986). Anal. Biochem. 152, 189-198. Pearson, J. D., DeWald, D. B., Zurcher-Neely, H. A., Heinrikson, R. L., and Poorman, R. A. (1987). In “Methods in Protein Sequence Analysis, 1986” (K. A. Walsh, ed.), pp. 295-302. Humana Press, Clifton, New Jersey. Pearson, T. W., and Anderson, N. L. (1983). Methods Enzymol 92,196-220. Perdew, G. H., and Hollenback, C. E. (1990).Biochemistry 29, 6210-6214. Pickett, S. C., Johnson,R. F., Miller, M. F., and Barker, D. L. (1990).Am. Biotechnol. Lab. 8, 34-40.
Plough, M., Jensen, A. L., and Barkholt, D. (1989).Anal. Biochem. 181, 33-39. Pluskal, M. G., Przekop, M. B., Kavonian, M. R., Vecoli, C., and Hicks, D. A. (1986). BioTechniques 4,272-282. Pollard, J. W. (1984). In “Methods in Molecular Biology” (J. M. Walker, ed.), Vol. 1, pp. 81-96. Humana Press, Clifton, New Jersey. Ragland, W. L. (1976).Anal. Biochem. 70, 327-335. Ragland, W. L., Pace, J. L., and Kemper, D. L. (1974).Anal. Biochem. 59, 24-33. Ratajczak, T., Brockway, M. J., Hahnel, R., Moritz, R. L., and Simpson, R. J. (1988). Biochem. Biophys. Aes. Commun. 151,1156-1163. Raymond, S., Miles, J. L., and Lee, J. C. J. (1966). Science 151, 346-347. Reig, J. A., and Klein, D. C. (1988). Appl. Theor. Electrophoresis 1, 59-60. Reisfeld, R. A., Lewis, U. J., and Williams, D. E. (1962).Nature (London) 195, 281-283. Renart, J., Reiser, J., and Stark, G. R. (1979). Proc. Natl. Acad. Sci. U.S.A. 76, 31163120.
Reyes, A. A., Johnson, M. J., Schold, M., Ito,H., Ike, Y.,Morin, C., Itakura, K., and Wallace, R. B. (1981). Immunogenetics 14, 383-392. Rittenhouse, J., and Marcus, F. (1984).Anal. Biochem. 138,442-448. Rodbard, D., and Chrambach, A. (1971).Anal. Biochem. 40,95-134. Rogers, M. J., Siwarski, D. F., Shacter, E., Maloy, W. L., Lillehoj, E. P., and Coligan, J. E. (1986).J. Immunol. 137, 3006-3012.
336
ERIK P. LILLEHOJ AND VEDPAL S. MALIK
Ryan, T. E., Woods, G. M., Kirkpatrick, F. H., and Shamoo, A. E. (1976).Anal. Biochern. 72,359-365.
Sabin, E. A., Lee-Ng, C. T., Shuster, J. R., and Barr, P. J. (1989).BioTechnology 7,705-709. Salinovich, O., and Montelaro, R. C. (1986).Anal. Biochem. 156,341-347. Salnikow, J., Palacz, Z., and Wittmann-Liebold, B. (1987).In “Methods in Protein Sequence Analysis, 1986” (K. A. Walsh, ed.), pp. 247-260. Humana Press, Clifton, New Jersey. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989).“Molecular Cloning.” Cold Spring Harbor Lab., Cold Spring Harbor, New York. Santucci, A., Lozzi, L., Bracci, L., Petreni, S., Rustici, M., Soldani, P., and Neri, P. (1989). Ital. J. Biochem. 38,349-359. Saris, C. J. M., Van Eenbergen, J., Jenks, B. G., and Bloemers, H. P. J. (1983).Anal. Biochem. 132954-67.
Schagger, H., and von Jagow, G. (1987).Anal. Biochern. 166,368-379. Schneider, Z. (1980).Anal. Biochern. 108,96-103. Scott, M. G.,Crimmins, D. L., McCourt, D. W., Tarrand, J. J., Eyerman, M. C., and Nahm, M. H. (1988).Biochem. Biophys. Res. Commun. 155,1353-1359. Segers, J., and Rabaey, M. (1985).Protides Biol. Fluids 33,589-591. Segrest, J. P., Jackson, R. L., Andrews, E. P., and Marchesi, V. T. (1971).Biochem. Biophys. Aes. Commun. 44,390-395. Shapiro, A. L., Vinuela, E., and Maizel, J. V. (1967).Biochem. Biophys. Aes. Commun. 28, 815-820.
Sheer, D.G.,Yamane, D. K., Hawke, D. H., and Yuan, P. M. (1990).Pept. Res. 3,97-104. Shively, J. E. (1981).Methods Enzymol. 79,31-48. Shively, J. E. (1986a).“Methods of Protein Microcharacterization. A Practical Handbook.” Humana Press, Clifton, New Jersey. Shively, J. E. (1986b).In “Methods of Protein Microcharacterization. A Practical Handbook” (J. E. Shively, ed.), pp. 195-222. Humana Press, Clifton, New Jersey. Shively, J. E., Miller, P., and Ronk, M. (1987).Anal. Biochem. 163,517-529. Shoji, S.,Ichikawa, M., Yamaoka, T., Funakoshi, T., and Kubota, Y. (1986).J. Chromatogr. 354,463-470.
Simpson, R. J., and Nice, E. C. (1984).Biochem. Int. 8,787-791. Simpson, R. J., Moritz, R. L., Nice, E. E., and Grego, B. (1987).Eur. J. Biochem. 165,21-29. Simpson, R. J., Moritz, R. L., Begg, G. S., Rubira, M. R., and Nice, R. C. (1989).Anal. Biochern. 177,221-236. Sinclair, J., and Rickwood, D. (1981).In “Gel Electrophoresis of Proteins” (B. D. Hames and D. Rickwood, eds.), pp. 189-218. IRL Press, Oxford. Smith, H. O., Annau, T. M., and Chandrasegaran, S. (1990).Proc. Natl. Acad. Sci. U.S.A. 87,826430.
Smithies, O., and Poulik, M. D. (1956).Nature (London) 177,1033. Som, S., and Friedman, S. (1990).J. Biol. Chem. 265,4278-4283. Sonderegger, P., Jaussi, R., Christen, P., and Gehring, H. (1982a).J. Biol. Chem. 257, 3339-3345.
Sonderegger, P., Jaussi, R., Gehring, H., Brunschweiler, K., and Christen, P. (1982b).Anal. Biochem. 122,298-301. Sood, A. K., Pereira, D., and Weissman, S. M. (1981).Proc. Natl. Acad. Sci. U S A . 78, 616-620.
Spande, T. F., Witkop, B., Degani, Y., and Patchornik, A. (1970).Adv. Protein Chem. 24, 97-260.
Stephens, R. E. (1975).Anal. Biochem. 65,369-379.
PEPTIDE AND PROTEIN PURIFICATION AND ANALYSIS
337
Stetler, G. L., Forsyth, C., Gleason, T., Wilson, J., and Thompson, R. C. (1989).BioTechnology 7,55-60. Sutcliffe,J. G., Shinnick, T. M., Green, N., Liu, F. T., Niman, H. L., and Lerner, R. A. (1980). Nature (London) 287,801-805. Swank, R. T., and Munkres, K. D. (1971).Anal. Biochem. 39,462-477. Sweatt, J. D., Kennedy, T. E., Wager-Smith, K., Gawinowicz, M. A., Barzilai, A., Karl, K. A., and Kandel, E. R. (1989).Electrophoresis 10, 152-157. Szyewczyk, B., and Summers, D. (1988).Anal. Biochem. 168,48-53. Takahara, M., Sagai, H., Inouye, S . , and Inouye, M. (1988).BioTechnology 6,195-198. Tarr, G. E., Beecher, J. F., Bell, M., and McKean, D. J. (1978).Anal. Biochem. 84, 622627.
Tas, J., de Vries, C. J., and Berndsen, R. G. (1979).Anal. Biochem. 100,264-270. Tijssen, P., and Kurstak, E. (1979).Anal. Biochem. 99,97-104. Tijssen, P., and Kurstak, E. (1983).Anal. Biochem. 128,26-35. Toole, J.J., Knopf, J. L., Woznez, J. M., Sultzman, L. A., Buecker, J. L., Pittman, D. D., Kaufman, R. J., Brown, E., Shoemaker, C., Orr, E. C., Amphlett, G. W., Foster, W. B., Coe, M. L.,Knutson, G. J., Fass, D. N., and Hewick, R. M. (1984).Nature (London) 312, 342-347.
Touchet, N., Chardin, P., and Tavitian, A. (1987).Proc. Natl. Acad. Sci. U.S.A. 84, 8210-8214.
Tous, G. I., Fausnaugh, J. L., Akinyosaye, O., Lackland, H., Winter-Cash, P., Victoria, F. J., and Stein, S. (1989).Anal. Biochem. 179,50-55. Towbin, H., and Gordon, J. (1984).J. Immunol. Methods 72, 313-340. Towbin, H., Staehelin, T., and Gordon, J. (1979).Proc. Natl. Acad. Sci. U.S.A. 76,43504354.
Tschesche, H. (1983).“Modern Methods in Protein Chemistry: Review Articles.” de Gruyter, New York. Tsugita, A., Sasada, S., van den Broek, R., and Scheffler, J. (1982).Eur. J. Biochem. 124, 171-176.
Tsugita, A., Ataka, T., and Uchida, T. (1987).J. Protein Chern. 6,121-130. Ullrich, A., Bell, J. R., Chen, E. Y., Herrera, R., Petruzzelli, L. M., Dull, T. J., Gray, A., Coussens, L., Liao, Y. C., Tsubokawa, M., Mason, A., Seeburg, P. H., Grunfeld, C., Rosen, 0. M., and Ramachandran, J. (1985).Nature (London) 313,756-761. Uyttenhove, C., Simpson, R. J., and Van Snick, J. (1988).Proc. Natl. Acad. Sci. U.S.A. 85, 6934-6938.
Vandekerckhove, J., Bauw, G., Puype, M., Van Damme, J., and Van Montagu, M. (1985). Eur. J. Biochem. 152,9-19. Vandekerckhove, J., Bauw, G., Van Damme, J., Puype, M., and Van Montagu, M. (1987).In “Methods in Protein Sequence Analysis, 1986” (K. A. Walsh, ed.), pp. 261-275. Humana Press, Clifton, New Jersey. Veronese, F. M., Rahman, R., Copeland, T. D., Oroszlan, S . , Gallo, R. C., and Sarngadharan, M. G. (1987).AIDS Res. Hum. Retroviruses 3,253-264. Vesterberg, 0.(1976).In “Isoelectric Focusing” (N. Catsimpoolas, ed.), pp. 53-76. Academic Press, New York. Vinogradov, S . N., Lowenkron, S . , Andonian, M. R., Bagshaw, J., Felgenhauer, K., and Pak, S . J.(1973).Biochem. Biophys. Res. Commun. 54,501-506. Wacker, H., Jaussi, R., Sonderegger, P., Dokow, M., Ghersa, P., Hauri, H. P., Christen, P., and Semenza, G. (1981).FEBS Lett. 136,329-332. Walker, J. E., Auffret, A. D., Carne, A., Gurnett, A., Hanisch, P., Hill, D., and Saraste, M. (1982).Eur. J. Biochem. 123,253-260.
338
ERIK P. LILLEHOJ AND VEDPAL S. MALIK
Walsh, K. A. (1987).“Methods in Protein Sequence Analysis, 1986.” Humana Press, Clifton, New Jersey. Walsh, M. J., McDougall, J., and Wittmann-Liebold, B. (1988).Biochemistry 27, 68676876.
Walter, G. (1986).J. Immunol. Methods 88,149-161. Wardi, A. H., and Michos, G. A. (1972).Anal. Biochem. 49,607-609. Waters, M., Evans, E., and Blobel, G. (1988).J. Biol. Chem. 263,6209-6214. Weber, K., and Osborn, M. (1969).J. Biol. Chem. 244,4406-4412. Willard, K. E., Giometti, C. S., Anderson, N. L., O’Connor, T. E., and Anderson, N. G . (1979).Anal. Biochem. 100,289-294. Williams, D. E., and Reisfeld, R. A. (1964).Ann. N.Y. Acad. Sci. 121,373-381. Wilson, K. J. (1988).In “CRC Handbook of Protein/Peptide Sequence Analysis. Current Methodologies” (A. S. Bhown, ed.), pp. 1-33. CRC Press, Boca Raton, Florida. Wilson, K. J., Hong, A. L., Brasseur, M. M., and Yuan, P. M. (1986).BioChromatography 1, 106-111.
Wittmann-Liebold, B. (1973).Hoppe-Seyler’s Z. Physiol. Chem. 354,1415-1431. Wittmann-Liebold, B. (1983).In “Modern Methods in Protein Chemistry: Review Articles’’ (H. Tschesche, ed.), pp. 229-266. de Gruyter, New York. Wittmann-Liebold, B. (1986).In “Methods of Protein Microcharacterization. A Practical Handbook” (7. E. Shivly, ed.), pp. 249-277. Humana Press, Clifton, New Jersey. Wittmann-Liebold, B., Salnikow, J., and Erdmann, V. (1986).“Advanced Methods in Microsequence Analysis.” Springer-Verlag, New York. Wood, W. I., Capon, D. J., Simonsen, C. C., Eaton, D. L., Gitschier, J., Keyt, B., Seeburg, P. H., Smith, D. H., Hollingshead, P., Wion, K. L., Delwart, E., Tuddenham, E. G. D., Vehar, G. A., and Lawn, R. M. (1984).Nature (London) 312,330-337. Wyckoff, M., Rodbard, D., and Chrambach, A. (1977).Anal. Biochem. 78,459-482. Xu,Q.Y., and Shively, J. E. (1988).Anal. Biochem. 170,19-30. Yamamoto, K., Okamoto, Y., and Sekine, T. (1978).Anal. Biochem. 84,313-318. Young, D.S.,and Anderson, N. G. (1982).Clin. Chem. 28, 737-1092. Yudelson, J. (1984).BioTechniques 2,42-47. Yuen, S.W., Hunkapiller, M. W., Wilson, K. J., and Yuan, P. M. (1988).Anal. Biochem. 168,5-15.
Yuen, S. W., Chui, A. H., Wilson, K. J., and Yuan, P. M. (1989).BioTechniques 7, 74-82. Zacharius, R. M., Zell, T. E., Morrison, J. H., and Woodlock, J. J. (1969).Anal. Biochem. 30, 148-152.
Zelazowski, A. J. (1980).Anal. Biochem. 103,307-312. Ziola, B. R., and Scraba, D. G. (1976).Anal. Biochem. 72,366-371.
INDEX
Alcaligenes herbicides and pesticides and, 19,
A
Acetic acid foodborne yeasts and, 227,249,253 protein analysis and, 295 Acid-preserved foods, foodborne yeasts and, 227-228 Acidification, foodborne yeasts and, 223, 231-232
Acidity foodborne yeasts and, 180,185, 187-188,190,249
protein analysis and, 297 Acinetobacter calcoaceticus herbicides and pesticides and, 16 microbial cytochromes P-450and, 148, 150-151
Actin, protein analysis and, 308,314 Actinomyces, microbial cytochromes P-450and, 151-162 Actinomycetes, foodborne yeasts and, 233 Adaptation foodborne yeasts and, 181,254 herbicides and pesticides and, 61 Adaptation rate, herbicides and pesticides and, 15-17 Adrenal ferredoxin, microbial cytochromes P-450and, 148 Adsorption, herbicides and pesticides and, 12-15 Affinity chromatography, protein analysis and, 316 Agriculture biotechnological processes and, 76, 79-80
microbial cytochromes P-450and, 133 Agrobacterium, biotechnological processes and, 71 339
25,39
recombinant E. coli K-12and, 101 Alcohol foodborne yeasts and, 179,186,210 microbial cytochromes P-450and, 138, 145,150,166-167
Alcoholic beverages, foodborne yeasts and, 179 ecology, 194,196-205,209-214 identification, 246,256-257 Alcoholic fermentation, foodborne yeasts and, 179-180 ecology, 189,194 specific habitats, 213,225-226 Aliphatics, microbial cytochromes P-450 and, 158-159 Alkane, microbial cytochromes P-450 and, 138,148,150,166,168,173 Alkylation, protein analysis and, 303, 308
Amides microbial cytochromes P-450and, 145 protein analysis and electroblotting, 306,308-309, 313-315
microsequence analysis, 322-323 purification, 316 quality control of recombinant proteins, 325-326 structural analysis, 290,292, 296-299,302
Amines, microbial cytochromes P-450 and, 150,157-158 Amino acid sequences, protein analysis and, 280-281,327 electroblotting, 305,307-309, 313-315
340
INDEX
microsequence analysis, 318-319, 321-324 PAGE, 286,289 purification, 315-316
quality control of recombinant proteins, 325-328
structural analysis, 291-292, 294, 296-297,299-301
Amino acids foodborne yeasts and, 187,193,235 microbial cytochromes P-450and eucaryotes, 163,165,167 procaryotes, 141,145-146,152,154, 156
protein analysis and, 325,328 electroblotting, 306-307 microsequence analysis, 318-321 purification, 315 structural analysis, 295-297, 300-301,303
recombinant E. coli K-12 and, 89, 93,98
Ampicillin, recombinant E. coli K-12 and, 98 Ampicillin resistance biotechnological processes and, 73 recombinant E. coli K-12 and, 105,112 pBR322,89,91,97 water, 97,102-103
AMY mutants, microbial cytochromes P-450and, 155 Anaerobic aromatic metabolism, herbicides and pesticides and, 32-36 Ancillary proteins, microbial cytochromes P-450and, 134-135 Anilinothiazolinone, protein analysis and, 297,301 Animals biotechnological processes and, 80-82 foodborne yeasts and, 184,195 Antibiotic resistance biotechnological processes and, 69, 73,82
herbicides and pesticides and, 36 recombinant E. coli K-12and, 105,109,
herbicides and pesticides and, 42 recombinant E. coli K-12 and, 116-117, 121
selection, 97-98 Antibodies microbial cytochromes P-450and, 146, 151,163
protein analysis and, 291,294,316, 318,323
Antigens biotechnological processes and, 77 foodborne yeasts and, 180 microbial cytochromes P-450and, 163
protein analysis and, 291,316,323 recombinant E. coli K-12 and, 88, 113-114
Apoprotein, microbial cytochromes P-450 and, 135,154 Aromatic amines, microbial cytochromes P-450and, 158-159 Aromatics herbicides and pesticides and, 2, 5, 12-13,16
anaerobic aromatic metabolism, 32-36
microbial cytochromes P-450and, 157-159,168
Ascomycetous yeasts, 207,245 Aspergillus, biotechnological processes and, 77 Aspergillus ochraceus, microbial cytochromes P-450and, 169-170 Assimilation, foodborne yeasts and, 183, 186
identification, 237,246-257 Atmosphere, foodborne yeasts and, 188-1 89
Aureobasidium pullulans, foodborne yeasts and, 206,217 Automated amino acid sequenators, protein analysis and, 297,299-300 Autoradiography, protein analysis and, 287-288,293
115,120 pBR322,92,97,99 water, 102-103
Antibiotics, see also specific antibiotic foodborne yeasts and, 231-232
B Bacillus, herbicides and pesticides and, 16,20
341
INDEX Bacillus megaterium, microbial cytochromes P-450and, 135, 145-149
Bacteria biotechnological processes and, 92 case studies, 77-79 ecology, 71,73 leaching, 79 risk assessment, 74-75 foodborne yeasts and, 180,227,231 dairy products, 222 ecology, 185,190-191 fish, 221 meat, 219-220 specific habitats, 194-195, 212,216, 218
herbicides and pesticides and, 2,7,36, 46,48
anaerobic aromatic metabolism, 33-36
chloroaromatic metabolism, 21-22.29
cometabolism, 31-32 kinetics of biodegradation, 8-10, 13-15
microbial cytochromes P-450and, 135, 148
protein analysis and, 322,325-326 recombinant E. coli K-12 and, 100, 102-104,107,114,119
Bacteroides fragilis, recombinant E. coli K-12and, 118 Basidiomycetes, foodborne yeasts and, 182-183,207,221,245,247 Beer, foodborne yeasts and, 179 identification, 249-251,254,257 specific habitats, 194,196-203, 209, 211-213
Benzene, herbicides and pesticides and, 2,22,25,29
Benzoate biotechnological processes and, 78 herbicides and pesticides and, 23,25, 29,32-33
adaptation rate, 15-17 chloroaromatics, 18-20 moisture, 17-18 nutrients, 17-19 temperature, 17-18 Bioremediation, herbicides and pesticides and, 3,63 Biotechnological processes, environment and, 67-68,82 case studies, 75-76 agriculture, 79-80 chemical bioprocesses, 78-79 food bioprocesses, 76-77 mining, 79 pharmaceutical bioprocesses, 77-78 waste treatment, 78 ecology, 69 dispersion, 69-70 genetic exchange, 71-73 survival, 70 hazards, 68-69 motivation, 69 regulation, 80-82 risk assessment, 73-74 human, 74-76 Biotechnology foodborne yeasts and, 180 protein analysis and, 323-324 Biotin, protein analysis and, 294 Biparental mating, recombinant E. coli K-12and, 90-96,99 Bisacrylcystamine, protein analysis and, 296
bom sites, recombinant E.coli K-12and, 88-90,93-96
Brettanomyces, foodborne yeasts and ecology, 187,189 identification, 249-250 methods for isolation, 230,233 specific habitats, 208,216 Bt toxin, biotechnological processes and, 79 Budding, foodborne yeasts and, 182,190 Bullera, foodborne yeasts and, 207
Beverages, foodborne yeasts and identification, 237,246,249,251-255, 257-258
specific habitats, 195-205, 208-209, 227 Biodegradation, kinetics of, herbicides and pesticides and, 7-15
C
Camphor, microbial cytochromes P-450 and, 140-143,156
342
INDEX
Candida foodborne yeasts and, 183 acid-preserved foods, 227-228 dairy products, 222-223 ecology, 185-186.188-189 fermented foods, 224, 226-227 fish, 221 identification, 239-242, 245-246, 248-253,255,257 meat, 219-220 specific habitats, 196-198, 206-211, 213-218 microbial cytochromes P-450 and, 165-168 Candida albicans foodborne yeasts and, 208,222,255 microbial cytochromes P-450 and, 162, 165-166 Candida rnaltosa, microbial cytochromes P-450 and, 167-168 Candida tropicalis, microbial cytochromes P-450 and, 166-167 Carbohydrate, foodborne yeasts and, 186, 195,237 Carbon foodborne yeasts and, 186-187, 233 herbicides and pesticides and, 2 , 6 anaerobic aromatic metabolism, 33 chloroaromatic metabolism, 23, 25-26 cometabolism, 29 dicamba degradation, 48 growth kinetics, 49, 52-53, 60-61 kinetics of biodegradation, 12, 19-20 microbial cytochromes P-450 and, 138, 141-142,148,166 recombinant E. coli K-12 and, 114 Carbon dioxide, foodborne yeasts and, 179-180,186,189,209,247 Carbon monoxide, microbial cytochromes P-450 and, 134, 137, 141, 152, 162, 172
Catabolism, herbicides and pesticides and, 2, 7, 37 Catalysis herbicides and pesticides and, 23, 26, 29,39 microbial cytochromes P-450 and, 134-137,173 Actinomyces, 151-153, 155,157
eucaryotes, 162-167, 172 procaryotes, 139, 142-143, 146, 148 protein analysis and, 297 recombinant E. coli K-12 and, 89 cDNA, protein analysis and, 322-323, 329 Cellobiose, foodborne yeasts and, 240, 251-253 Cellobiose-negative yeast, 256-258 Cereal, foodborne yeasts and, 195-205, 213-214,217-218, 225 Chemical bioprocesses, 76,78 Chemostats, recombinant E. coli K-12 and, 97-98 Chloramphenicol, recombinant E. coli K-12 and, 102,120 Chloramphenicol acetyltransferase, recombinant E. coli K-12 and, 111 Chloride herbicides and pesticides and, 20, 23, 26, 35,49 protein analysis and, 282, 286 Chlorine, herbicides and pesticides and, 2, 12, 19, 23, 25, 33 Chloroaromatics, herbicides and pesticides and, 2 , 8 degradation, 18-20,37-44,46 metabolism, 21-23 chlorocatechols, 29-31 dehalogenation, 23, 25-26 demethylation, 23-24 ring cleavage, 26-29 3-Chlorobenzoate, herbicides and pesticides and, 15, 19, 26, 29 4-Chlorobenzoate, herbicides and pesticides and, 3,19, 25 3-Chlorobenzoic acid, herbicides and pesticides and, 3, 29 Chlorocatechol, herbicides and pesticides and, 22, 26, 39 5-Chloro-2-hydroxy hydroquinone (CHQ), herbicides and pesticides and, 40-41 Cholesterol, microbial cytochromes P-450 and, 152 Chromatography, see also Gas chromatography; High-performance liquid chromatography foodborne yeasts and, 235 herbicides and pesticides and, 40, 47-48,54,56
343
INDEX microbial cytochromes P-450 and, 167 protein analysis and, 300, 303, 316, 318,328 Chromosomes foodborne yeasts and, 235 herbicides and pesticides and, 36, 39,41 microbial cytochromes P-450 and, 147 recombinant E. coli K-12 and, 117,120 pBR322,90-91 soil, 106, 108 water, 103 Citeromyces, foodborne yeasts and, 198, 242,250 Citrobocter freundii, recombinant E. coli K-12 and, 110-111 Claviceps purpureo, microbial cytochromes P-450 and, 171 Cloning biotechnological processes and, 68 herbicides and pesticides and, 42-44,62 microbial cytochromes P-450 and, 145-146,153,163,165,167 protein analysis and, 318-322, 325 recombinant E. coli K-12 and, 89, 115 Clostridium caldarium, microbial cytochromes P-450 and, 160 Cocoa, foodborne yeasts and, 225,249, 254,258 Codeine, microbial cytochromes P-450 and, 169 Colonization foodborne yeasts and, 183,190, 194 recombinant E. coli K-12 and, 114-117, 120-121 Cometabolism, herbicides and pesticides and, 29-31 Competitive colonization, biotechnological processes and, 75 Conjugation, foodborne yeasts and, 182, 247,253 Conjugational transfer, recombinant E. coli K-12 and, 88,121-122 mammalian intestinal tract, 113, 117-120
pBR322,89-97,99-100 sewage, 109-113 soil, 106-108 water, 102-104
Contamination, foodborne yeasts and, 185,208,211,216,218,222 Coomassie blue, protein analysis and, 308-309,313 p-Cresol, herbicides and pesticides and, 34,36 Cryptococcus, foodborne yeasts and, 182, 188 acid-preserved foods, 228 dairy products, 221 fermented foods, 227 identification, 239, 242, 245-246 meat, 219-220 specific habitats, 198, 206-208, 217 Cunninghamella bainieri, microbial cytochromes P-450 and, 168-169 Cyanidum caldorium, microbial cytochromes P-450 and, 171-172 Cyanogen bromide, protein analysis and, 291-292,306, 319 Cycloisomerization, herbicides and pesticides and, 26, 29 Cysteine microbial cytochromes P-450 and, 135, 160 protein analysis and, 303, 308, 325 Cytochromes p-450, 133, 173-174 eucaryotes, 162-173 procaryotes, 139-151 properties, 134-139
D Dairy products, foodborne yeasts and, 195-205,221-223,233 identification, 248-250, 252-255, 257-258 Dealkylation, microbial cytochromes P-450 and, 138-139 Death, biotechnological processes and, 76-77 Debaromyces, foodborne yeasts and, 185-186 acid-preserved foods, 227 dairy products, 221-222 fermented foods, 224-227 fish, 221 identification, 239, 242-243,248, 251
344
INDEX
meat, 219-220 specific habitats, 199,206-207,209, 212-213,215-216
Dechlorination, herbicides and pesticides and, 23,25 Degradation, see also Biodegradation; Edman degradation cycle biotechnological processes and, 78 foodborne yeasts and, 225 herbicides and pesticides and, 2-7 anaerobic aromatic metabolism, 33-34,36
chloroaromatics, 29,37-44 dicamba, 44-49 growth kinetics, 50,53-54,57-63 microorganisms, 36-37 microbial cytochromes P-450and, 143, 147,160,173
recombinant E. coli K-12and, 101,109 Dehalogenation herbicides and pesticides and, 23, 25-26,36
microbial cytochromes P-450and, 143 Dehydration, foodborne yeasts and, 191, 193
Dehydrogenases, microbial cytochromes P-450and, 138-139 Dekkem, foodborne yeasts and, 187,189, 233
identification, 240,243,249-250 specific habitats, 199,208,211, 213-214
Deletion, microbial cytochromes P-450 and, 147,154 Deletion derivatives, recombinant E. coli K-12and, 95-96 Demethylation herbicides and pesticides and, 23-24 microbial cytochromes P-450and, 162-165,169,171
Denaturation, protein analysis and, 284, 324-325
Denitrification, herbicides and pesticides and, 7,33 6-Deoxyerythronolide B, microbial cytochromes P-450and, 151 Desorption, herbicides and pesticides and, 12-15 Detoxification biotechnological processes and, 78
microbial cytochromes P-450and, 133, 170
Diaminopimelate (DAP), recombinant E. coli K-12and, 91,96-97 Diazonium blue B, foodborne yeasts and, 183,245
Dicamba, herbicides and pesticides and degradation, 42,4448 growth kinetics, 49-62 Dichloran rose bengal chlortetracycline, foodborne yeasts and, 232-233 2,4-Dichlorophenoxyaceticacid, herbicides and pesticides and, 2, 39, 4449
chloroaromatic metabolism, 22,29 kinetics of biodegradation, 14-15, 17-18
3,6-Dichlorosalicyclic acid, herbicides and pesticides and, 54-56, 61 Diffusion, protein analysis and, 290,295 Diniconazole, microbial cytochromes P-450and, 162,164 Dioxygenation, herbicides and pesticides and, 22,25-27,29,39 3,3’-Dipentyloxacarbocyanine iodide (DPOCC), protein analysis and, 308-309,313
1,4-Diphenylenediisothiocyanate(DITC), protein analysis and, 309,311 DNA biotechnological processes and, 68,71, 78,80-81
foodborne yeasts and, 181,212,235, 252-253,256
herbicides and pesticides and, 8, 37 microbial cytochromes P-450and, 146-147,154
protein analysis and, 319,321,323,329 recombinant E. coli K-12and, 87-88, 121
mammalian intestinal tract, 113,117 pBR322,89-90,94-95,97-99
sewage, 109,112
E Ecology, biotechnological processes and, 69-74
345
INDEX Edman degradation cycle, protein analysis and, 328 electroblotting, 303,308-309 structural analysis, 290,296-302 Electroblotting, protein analysis and, 280-281,317,324,327-328
microsequence analysis, 307-315 structural analysis, 290,299,303307
Electroelution, protein analysis and, 290, 292,295,302-303
Electrofocusing, protein analysis and, 289-290
Electron transport herbicides and pesticides and, 33-34,36
microbial cytochromes P-450and procaryotes, 139,143,146,160 properties, 134-136, 138 Electrophoresis, see also Polyacrylamide gel electrophoresis; SDS-PAGE foodborne yeasts and, 235 protein analysis and, 318-323, 328 Electrotransfer, protein analysis and, 280, 292,305-306,313,326
Endomyces fibuliger, foodborne yeasts and identification, 221,239,243 specific habitats, 199,213,218,226 Endomycetous yeasts, 247,250 Energy foodborne yeasts and, 186,188 herbicides and pesticides and, 2, 26, 29,49
anaerobic aromatic metabolism, 34,36
cometabolism, 29, 31 microbial cytochromes P-450and, 148 Enterobacter, recombinant E. coli K-12 and, 108,112 Enterobacteriaceae, recombinant E. coli K-12 and, 100-105,107 Enumeration methods, foodborne yeasts and, 229-230,232,234 Environment biotechnological processes and, see Biotechnological processes foodborne yeasts and, 180 ecology, 183,189-190,193 identification, 236-237
specific habitats, 195,220,224, 227-228
herbicides and pesticides and, 2-7, 36, 48,53,61
microbial cytochromes P-450and, 133, 173
recombinant E. coli K-12and, see Recombinant Escherichia coli K-12 Environmental Protection Agency, biotechnological processes and, 78,81
Enzymes biotechnological processes and, 76-78,80
foodborne yeasts and, 180 ecology, 186-187,194 identification, 235,246 specific habitats, 223-224 herbicides and pesticides and, 2,30,36 chloroaromatic degradation, 39,42 chloroaromatic metabolism, 23, 26-29
kinetics of biodegradation, 10,12,16 microbial cytochromes P-450and, 133, 173
Actinomyces, 151-153, 155,160 Bacillus megaterium, 146,148-149 eucaryotes, 162-172 procaryotes, 151 properties, 135-138 Pseudomonas putida, 139,141 protein analysis and, 318,325 electroblotting, 306,314 structural analysis, 291,293,302 recombinant E.coli K-12and, 101,121 Epitope mapping, protein analysis and, 290-292,318,323
Epoxidation, microbial cytochromes P-450and, 138-139,155-156 Erythritol, foodborne yeasts and, 239, 248-249,251
Escherichia coli biotechnological processes and, 71-73 herbicides and pesticides and, 42-44 microbial cytochromes P-450and, 143, 146
protein analysis and, 290,294, 325-326
Escherichia coli K-12,recombinant, see Recombinant Escherichia coli K-12
346
INDEX
Establishment, biotechnological processes and, 74 Ethanol foodborne yeasts and, 179 ecology, 186-187,190,192,194 identification, 247, 251 methods for isolation, 233 specific habitats, 211, 225 microbial cytochromes P-450 and, 171 Eucaryotes microbial cytochromes P-450 and, 133, 156,162-173 properties, 134, 138 protein analysis and, 300-301, 321, 324,326 Evolution, foodborne yeasts and, 181 5-exo-hydroxycamphor, microbial cytochromes P-450 and, 141-143, 156
F FAD herbicides and pesticides and, 29 microbial cytochromes P-450 and eucaryotes, 164, 167, 172 procaryotes, 141-144,146 properties, 134-135 Fast-atom bombardment mass spectrometry, protein analysis and, 329 Fatty acids foodborne yeasts and, 189 herbicides and pesticides and, 48 microbial cytochromes P-450 and, 145-145,166,168 Ferguson plot, protein analysis and, 283 Fermentation biotechnological processes and, 77-78 foodborne yeasts and, 179-180,183 alcoholic beverages, 209-211, 213-214 dairy products, 221-223 ecology, 186-189 fermented foods, 223-227 identification, 237, 248-249, 251-254,256-258 methods for isolation, 233 specific habitats, 195-208, 216, 218
herbicides and pesticides and, 33, 36 protein analysis and, 324 recombinant E. coli K-12 and, 87, 122 Ferredoxin, microbial cytochromes P-450 and, 135 eucaryotes, 171-172 procaryotes, 141,144, 148,153-154, 160 Ferredoxin reductase, microbial cytochromes P-450 and, 148, 151, 155,160 Fish foodborne yeasts and, 195-205, 218, 220-221 fermented foods, 225-226 identification, 246, 249, 252, 255, 257 recombinant E. coli K-12 and, 102 Fission, foodborne yeasts and, 182, 247 Flavoprotein, microbial cytochromes P-450 and, 148,172 Flavoprotein reductase, microbial cytochromes P-450 and, 136 Fluorescamine, protein analysis and, 308, 313 Fluorescence, protein analysis and, 308-309 FMN, microbial cytochromes P-450 and, 134,146,148,164,167,172 Food and Drug Administration, biotechnological processes and, 81 Food bioprocesses, 76-77 Foodborne yeasts, 179-180 classification, 180-183 ecology, 183-184 acidity, 187-188 atmosphere, 189 implicit parameters, 190 nutrients, 186-187 processing, 190-194 temperature, 188-189 water activity, 185-186 identification, 234 cellobiose-assimilating yeasts, 251-253 cellobiose-negative yeasts, 256-258 erythritol-assimilating yeasts, 248-249 mannitol-assimilating yeasts, 253-256 mannitohegative yeasts, 256-258
INDEX new methods, 235-236 nitrate-assimilating yeasts, 249-251 simplified methods, 236-244 urease-positive yeasts, 245-247 isolation, 228-234 specific habitats, 194-205 acid-preserved foods, 227-228 alcoholic beverages, 209-214 cereal, 217-218 dairy products, 221-223 drinks, 208-209 fermented foods, 223-227 fish, 218,220-221 fruits, 195, 206-208 high-sugar products, 214-216 meat, 218-220 vegetables, 195, 206-208 Formation, biotechnological processes and, 74,77 Formic acid, protein analysis and, 286 electroblotting, 306, 315 structural analysis, 291-292, 295 Fractionation, protein analysis and, 292, 318
Freezing, foodborne yeasts and, 192-193 Fruit, foodborne yeasts and, 184,233 identification, 237, 245-249, 251, 253-255,258 specific habitats, 195-208, 216, 223 Fruit juices, foodborne yeasts and identification, 246, 250-251, 253, 257-258 specific habitats, 208-209, 213-214 Fungi biotechnological processes and, 77 foodborne yeasts and, 181, 226,231,233 microbial cytochromes P-450 and, 170 Fusariurn, herbicides and pesticides and, 20 Fusariurn oxysporurn, microbial cytochromes P-450 and, 168
G P-Galactosidase, herbicides and pesticides and, 42, 44 Gas chromatography foodborne yeasts and, 235 protein analysis and, 303
347
Gene cloning, protein analysis and, 318-3 22 Gene products, recombinant E. coli K-12 and, 90 Gene transfer herbicides and pesticides and, 4 recombinant E. coli K-12 and, 89, 102, 120 mammalian intestinal tract, 113, 117 sewage, 108 soil, 104, 108 Genetic engineering biotechnological processes and, 68-69, 80,82 case studies, 75, 77-78, 80 herbicides and pesticides and, 37 microbial cytochromes P-450 and, 160 Genetic exchange biotechnological processes and, 71-73 herbicides and pesticides and, 16 Genetic manipulation, foodborne yeasts and, 180 Genetic stability, recombinant E. coli K-12 and, 97-98 Genetics biotechnological processes and, 68-69, 74,81 foodborne yeasts and, 181, 183 herbicides and pesticides and, 2, 36-37,39,42-44,62 microbial cytochromes P-450 and, 143, 147,153-154,163,166-167 protein analysis and, 318-319, 322 recombinant E. coli K-12 and, 89, 93, 95-96,100 Geotrichum, foodborne yeasts and, 184 dairy products, 221 identification, 241-242, 246, 255 specific habitats, 199, 208, 213, 216-217,225,228 Gibberella fujikuroi, biotechnological processes and, 79 Glass fiber, protein analysis and, 307-313,315,317 Glucose foodborne yeasts and, 189, 229 identification, 237, 248-249, 251, 253-254,257 herbicides and pesticides and, 40, 44
348
INDEX
microbial cytochromes P-450and, 162 recombinant E. coli K-12and, 97-98 Glucose yeast extract, foodborne yeasts and, 230 Glycinate, protein analysis and, 282 Glycine, protein analysis and, 282, 284-286,301,313
Glycoprotein protein analysis and, 286-287, 293, 317,326
recombinant E.coli K-12and, 115 Glycosylation, protein analysis and electroblotting, 303,305,307 PAGE, 284,286 quality control of recombinant proteins, 326,328
Growth factors, protein analysis and, 318-319
Growth hormones, biotechnological processes and, 68,80 Growth kinetics foodborne yeasts and, 190 herbicides and pesticides and, 49-63
H Habitats, foodborne yeasts and, 188 identification, 236,251 specific habitats, 194-228 Hae I1 fragment, recombinant E. coli K-12 and, 93-94 Haloaromatics biotechnological processes and, 78 herbicides and pesticides and, 2-3, 25, 33,37,62
Halobenzoates, herbicides and pesticides and, 36 Halogen, herbicides and pesticides and, 23,25-26
Hanseniaspora, foodborne yeasts and, 184,193
fermented foods, 225-226 identification, 240,243,251 specific habitats, 199,206-207, 209-210,213-214,217
Hansenula, foodborne yeasts and, 248 Hazards, biotechnological processes and, 68-69,80,82
case studies, 76,79 risk assessment, 74-75 Heat, foodborne yeasts and, 191-192, 209,231,248,252
tolerance, 188,216 Heme, microbial cytochromes P-450and, 133,135
eucaryotes, 168,171 procaryotes, 141,144,146,154 Heme enzymes, herbicides and pesticides and, 26 Herbicides, microbial cytochromes P-450 and, 153,163 Herbicides and pesticides, transformations of, 1-2 anaerobic aromatic metabolism, 32-36 chloroaromatic degradation, 37-44 chloroaromatic metabolism, 21-23 chlorocatechols, 29-31 dehalogenation, 23,25-26 demethylation, 23-24 ring cleavage, 26-29 cometabolism, 29-32 degradative microrganisms, 36-37 dicamba degradation, 44-48 growth kinetics in liquid culture, 49-50
dicamba concentration, 50-52 field study, 58,60-63 growth chamber study, 56-59 pH, 52-53 soil, 54-56 temperature, 53-54 herbicide movement, 4-5 history of microbial conversions, 2-4
kinetics of biodegradation, 7-12 adaptation rate, 15-17 adsorption, 13-15 chloroaromatic degradation, 18-20 desorption, 13-15 moisture, 17-18 nutrients, 17-19 solubility, 12-13 structure, 12-13 temperature, 17- 18 taxonomy of degradative organisms, 5-7
Heteroatom release, microbial cytochromes P-450and, 138-139
349
INDEX High-perfomance liquid chromatography (HPLC) herbicides and pesticides and, 47, 56,58 protein analysis and, 325, 327-328 electroblotting, 315 purification, 316, 318 structural analysis, 291, 296-297, 301-302 High-sugar-content foods, foodborne yeasts and, 180,185,190 identification, 237,247-248, 250, 254-255 specific habitats, 195-205, 214-216 Homology foodborne yeasts and, 181,212, 252-253,256 herbicides and pesticides and, 7-8 microbial cytochromes P-450 and eucaryotes, 164,166, 168 procaryotes, 145-147,152,154,160 protein analysis and, 319, 321-323, 327 Human growth hormone, biotechnological processes and, 68-69 Humans, risk to, biotechnological processes and, 74-76, 78 Hybridization foodborne yeasts and, 212,252,256 herbicides and pesticides and, 41 protein analysis and, 321-322, 328 Hydrocarbons foodborne yeasts and, 180,187 herbicides and pesticides and, 16, 33 microbial cytochromes P-450 and, 148, 157,166 protein analysis and, 294 Hydrogen herbicides and pesticides and, 23 microbial cytochromes P-450 and, 138, 141-142,154,156,163 protein analysis and, 285 Hydrogenolysis, microbial cytochromes P-450 and, 144 Hydrolysis foodborne yeasts and, 186-187,190, 226 herbicides and pesticides and, 5, 16, 24,25
protein analysis and, 307 recombinant E. coli K-12 and, 89 Hydroperoxides, microbial cytochromes P-450 and, 138-139 Hydrophobicity herbicides and pesticides and, 13 microbial cytochromes P-450 and, 134, 142,152,167 protein analysis and, 293, 304, 328 4-Hydroxybenzoate, herbicides and pesticides and, 23, 25 Hydroxylation herbicides and pesticides and, 28-29, 34,36 microbial cytochromes P-450 and, 136, 138 Actinornyces, 151-152,155-156 eucaryotes, 167-170, 172 procaryotes, 145,147-149, 151 Pseudornonas putida, 140,142,144 Hyphae, foodborne yeasts and, 181-182, 248-249,252 Hyphopichia burtonii, foodborne yeasts and fermented foods, 227 identification, 239, 243, 249 specific habitats, 200, 207, 209, 217-218,220
I Immunoglobulins, protein analysis and, 306,316 Incompatibility group, recombinant E. coli K-32 and, 91,100,104,110,118 Infection, biotechnological processes and, 75-76,79 laboratory-acquired, 75-76 Inhibition foodborne yeasts and ecology, 185,187,190,194 methods for isolation, 231-232 specific habitats, 211, 225 herbicides and pesticides and, 15, 17, 33, 50, 52 microbial cytochromes P-450 and, 137, 152,162,164,166 protein analysis and, 313, 321,326 recombinant E. coli K-12 and, 106, 119
350
INDEX
Insects biotechnological processes and, 79-82 foodborne yeasts and, 184 Insulin, biotechnological processes and, 68 Intestinal tract, recombinant E. coli K-12 and, 88-89,113-121 Iron herbicides and pesticides and, 23, 26-27 microbial cytochromes P-450 and, 135-136 eucaryotes, 169 procaryotes, 141,144, 151,160 protein analysis and, 305 recombinant E. coli K-12 and, 98 Isoelectric focusing foodborne yeasts and, 235 protein analysis and, 287-289, 317 Issatchenkia orientalis, foodborne yeasts and cereal, 218 dairy products, 222 fermented foods, 224-226 identification, 241, 243, 245, 247-248 specific habitats, 200, 206-207, 209-211,213 Issatchenkia terricola, foodborne yeasts and, 227,241,258
K Kenyon loam soil, herbicides and pesticides and, 54 Kinetics herbicides and pesticides and biodegradation, 7-20 field study, 58, 60-63 growth chamber study, 56-59 liquid culture, 49-56 microbial cytochromes P-450 and, 144, 169 Klebsiella, biotechnological processes and, 71 Klebsiella pneumoniae, recombinant E. coli K-12 and, 103, 108,110, 112, 118 Kluyveromyces, foodborne yeasts and dairy products, 222-223
ecology, 188,191, 193 identification, 240-241, 243, 251-252, 255 methods for isolation, 233 specific habitats, 200-201, 203, 206, 221
L Laboratory-acquired infection, biotechnological processes and, 75-76 lac z gene, herbicides and pesticides and, 42.44 Lactate, foodborne yeasts and, 188, 224 Lactic acid, foodborne yeasts and acid-preserved foods, 227 fermented foods, 223-226 specific habitats, 207, 212-213, 218, 222 P-Lactoglobulin, protein analysis and, 306,309,313 Lactose foodborne yeasts and, 222-224, 233, 252 herbicides and pesticides and, 4 2 , ~ Lanosterol, microbial cytochromes P-450 and, 162-166 Leaching, biotechnological processes and, 79 Ligands microbial cytochromes P-450 and, 141, 154,164,167 protein analysis and, 294 Lipids foodborne yeasts and, 235, 253 microbial cytochromes P-450 and, 166-168,171,173 protein analysis and, 324 Lipolysis, foodborne yeasts and, 220, 228, 246 Lipomyces, foodborne yeasts and, 186, 219
Lodderomyces elongisporus foodborne yeasts and, 200, 241, 243, 255 microbial cytochromes P-450 and, 172-173
INDEX M Machinery mold contamination, foodborne yeasts and, 184 Malt extract agar, foodborne yeasts and, 231
Mammalian intestinal tract, recombinant E. coli K-12 and, 88-89, 113-121 Mannitol, foodborne yeasts and, 241, 253-256 Mannitol-negative yeasts, 256-258 Mapping, see also Epitope mapping; Peptide mapping herbicides and pesticides and, 39 microbial cytochromes P-450 and, 147 protein analysis and, 285, 290 Mass spectrometry, protein analysis and, 303,328 Mass spectroscopy, herbicides and pesticides and, 40 Mating foodborne yeasts and, 245, 247 recombinant E. coli K-12 and, 102, 108, 117
biparental, 90-96, 99 liquid, 100, 107 sewage, 109-113 surface, 100 triparental, 91,97, 99,111-112, 118, 120 water, 104 Mayonnaise, foodborne yeasts and, 227-228,254 Meat, foodborne yeasts and, 195-205, 218-220 identification, 237, 246-249, 252-255, 257-258 Messenger RNA microbial cytochromes P-450 and, 147 protein analysis and, 288, 322 Methane, herbicides and pesticides and, 33,35-36 Methanol, protein analysis and, 302, 305 Methionine, protein analysis and, 319, 325-327 Metschnikowia, foodborne yeasts and identification, 240, 243, 252-253 specific habitats, 200, 206, 210, 214-215
351
Microbial cytochromes P-450, see Cytochromes P-450 Microflora, foodborne yeasts and, 183, 231 specific habitats, 194-195, 206, 216, 218-220 Microsequence analysis, protein and, 280-281,326-329 applications, 318-323 electroblotting, 303, 306-315 purification, 315, 317-3 18 structural analysis, 290, 292, 299-300, 302 Microsomes, microbial cytochromes P-450 and, 135 eucaryotes, 162,165,167-168, 170-171 procaryotes, 148, 157, 160 Mineralization, herbicides and pesticides and, 2-3, 5, 39,46 anaerobic aromatic metabolism, 33-34,36 growth kinetics, 49-51, 55, 61 kinetics of biodegradation, 12, 14-17,20 Mining, biotechnological processes and, 76, 79 mob sites, recombinant E. coli K-12 and, 90-96,122 Moisture herbicides and pesticides and, 17-18 recombinant E. coli K-12 and, 105-106 Monooxygenase herbicides and pesticides and, 26, 28-29,39 microbial cytochromes P-450 and, 142, 144,146,171 Moraxella herbicides and pesticides and, 48 microbial cytochromes P-450 and, 151 Morphology, foodborne yeasts and classification, 180, 182 identification, 234, 237-238, 246, 251 Multiple-drug resistance, biotechnological processes and, 71 Mutagenesis biotechnological processes and, 68 herbicides and pesticides and, 39-40 microbial cytochromes P-450 and, 142, 156,158-159,161,173
352
INDEX
Mutation biotechnological processes and, 68 herbicides and pesticides and, 16, 40,44
microbial cytochromes P-450and, 142, 154,157,164-165
Mycobacterium smegmatis, microbial cytochromes P-450and, 160
herbicides and pesticides and, 36 microbial cytochromes P-450and, 138, 164,167,169
recombinant E.coli K-12 and, 98 Nuclear magnetic resonance, protein analysis and, 303 Nucleotides microbial cytochromes P-450and, 135, 147,166
N NADH herbicides and pesticides and, 23 microbial cytochromes P-450and, 137 eucaryotes, 168-169,171 procaryotes, 141,143,150-151 NADPH, microbial cytochromes P-450 and, 134,137 eucaryotes, 162,164-172 procaryotes, 146-148,151,155 Nalidixic acid resistance, recombinant E. coli K-12and mammalian intestinal tract, 115-116, 118 pBR322,90-91,97 sewage, 110,112 soil, 105,107 water, 101-103
Naphthalene, herbicides and pesticides and, 26,36,39 National Institute of Health, biotechnological processes and, 81 Nectrio hoematococca, microbial cytochromes P-450and, 170-171 Neomycin resistance, recombinant E. coli K-12and, 102-103 NH2, see Amides nic sites, recombinant E. coli K-12and, 88-90,93-96
Nitrate foodborne yeasts and, 187,233,237, 240,248-251
herbicides and pesticides and, 6,33 microbial cytochromes P-450and, 151, 168
Nitrocellulose, protein analysis and, 304-307,315
Nitrogen foodborne yeasts and, 187,237
protein analysis and, 294,321,328 Nutrients foodborne yeasts and, 185-187,195 herbicides and pesticides and, 17-19 0
Olefins, microbial cytochromes P-450 and, 138,144,150 Oligonucleotide probes, protein analysis and, 318-322 One-dimensional SDS-PAGE, protein analysis and, 315-317 Open reading frames microbial cytochromes P-450and, 143
protein analysis and, 318,322 Organic acids, foodborne yeasts and, 192-193,231
Oriental fermented foods, foodborne yeasts and, 225-227 Osmophilic yeasts, 185,215-216 Oxidation foodborne yeasts and, 206,224 herbicides and pesticides and, 21,25, 29,33,49
microbial cytochromes P-450and, 133, 135,137,173
Actinomyces, 153,155-156 eucaryotes, 162,164-167,169,173 procaryotes, 140,142-148. 150 protein analysis and, 302 Oxidative group migration, microbial cytochromes P-450and, 138-139 Oxygen foodborne yeasts and, 188-169,230 herbicides and pesticides and, 7, 25-27,30,33,46
microbial cytochromes P-450and, 136-137,171
353
INDEX eucaryotes, 165,171 procaryotes, 141-143, 154 Oxygenation herbicides and pesticides and, 26 microbial cytochromes P-450and, 138, 146,171
Oxytetracycline, foodborne yeasts and, 231
P PAGE, see Polyacrylamide gel electrophoresis Palmitic acid, microbial cytochromes P-450and, 147 Pathogens biotechnological processes and, 69-70, 74-75,77,79
foodborne yeasts and, 180-181,221, 223,255
microbial cytochromes P-450and, 170 recombinant E. coli K-12and, 113-115 pBR322,recombinant E.coli K-12and, 88-89,120-122
conjugational transfer, 90-97, 99-100 mammalian intestinal tract, 116 sewage, 109 stability, 97-98 Pea, microbial cytochromes P-450and, 170
Pea seedlings, herbicides and pesticides and, 56-59,62 Pectinolysis, foodborne yeasts and, 224-225
Penicillin herbicides and pesticides and, 42 recombinant E. coli K-12and, 89 Peptide mapping, protein analysis and, 285,306
quality control of recombinant proteins, 324-327
structural analysis, 290-292, 296, 300-301
Peptides microbial cytochromes P-450and, 146, 160,165
protein analysis and, 323,325-329 electroblotting, 306,308-309, 314-315
PAGE, 281,285-286 purification, 315-316 structural analysis, 290-293, 297, 299,302-303
Pesticides biotechnological processes and, 79,81 transformations of, see Herbicides and pesticides, transformations of PH foodborne yeasts and, 231,257 ecology, 187-188,191-193 specific habitats, 195,208,212,215, 220,227
herbicides and pesticides and growth kinetics, 52-53,56,60-61 kinetics of biodegradation, 9,12,17 microbial cytochromes P-450and, 155 protein analysis and, 282,289-290, 302 recombinant E. coli K-12and, 105-106, 111
Pharmaceutical bioprocesses, 76-79 Phenobarbital, microbial cytochromes P-450and, 145-146,154 Phenols, herbicides and pesticides and, 2, 33-34,36
Phenotype, herbicides and pesticides and, 41-42 Phenylisothiocyanate, protein analysis and, 297,300 Phenylthiohydantoin amino acids, protein analysis and, 280,313, 327-328
structural analysis, 297,300-301 Phosphorylation, herbicides and pesticides and, 33-34 Photoaffinity labeling, protein analysis and, 294 pl, protein analysis and, 289,292 Pichia, foodborne yeasts and acid-preserved foods, 227 dairy products, 221-223 ecology, 186-187,189,193 fermented foods, 224-227 identification, 239-241, 243,248-250, 252-253,257-258
meat, 219-220 specific habitats, 200,206-218 Plants biotechnological processes and, 80-81 foodborne yeasts and, 184
354
INDEX
Plasmids biotechnological processes and, 71-73, 77-78
herbicides and pesticides and, 3,16, 36-37
chloroaromatic degradation, 37,39, 42,44
growth kinetics, 62 microbial cytochromes P-450and, 143 recombinant E. coli K-12and, 87-89,
structural analysis, 290-291, 293, 296-297,299,301
Polysaccharides, foodborne yeasts and, 180,190
Polyvinylidene difluoride, protein analysis and, 328 electroblotting, 305-306, 309,311, 313-315
mammalian intestinal tract, 115-
Posttranslational modification, protein analysis and, 286,307 microsequence analysis, 323-324 quality control of recombinant proteins,
120 pBR322,90-100 sewage, 108,111-113 soil, 104-108 water, 101-104
structural analysis, 301,303 Potato dextrose agar, foodborne yeasts and, 231 Poultry, foodborne yeasts and, 195-205,
122
Plasminogen activator, protein analysis and, 323-324 pMB1, recombinant E . coli K-12and, 89 Pollution biotechnological processes and, 73,78 herbicides and pesticides and, 6 Polyacrylimide gel electrophoresis (PAGE),protein analysis and, 280-283,327
electroblotting, 303-315 SDS-PAGE, 283-287 structural analysis, 290-303 two-dimensional PAGE, 287-290 Polybrene, protein analysis and, 297,300, 308,313
Polycyclic aromatics, microbial cytochromes P-450and, 158-159 Polymerase chain reaction protein analysis and, 319,322 recombinant E.coli K-12and, 121 Polymerization, protein analysis and, 281,285,302
Polyols, foodborne yeasts and, 186 Polypeptides biotechnological processes and, 79 herbicides and pesticides and, 29,44 protein analysis and, 327 electroblotting, 304-306, 308,315 microsequence analysis, 322-323 PAGE, 285-286,288-289 purification, 316 quality control of recombinant proteins, 324-327
326-327
218-219,246,249
Preservation, foodborne yeasts and ecology, 190-194 identification, 247,254 specific habitats, 195-205, 209,211, 215
Procaryotes microbial cytochromes P-450and, 133, 139-140,148,150-151,173
Actinomyces, 151-162 Bacillus megaterium, 145-149 Pseudomonas putida, 140-145 protein analysis and, 324,326 Processed foods, foodborne yeasts and, 180,183,190-195,208
Progesterone, microbial cytochromes P-450and, 169-170 Proliferation biotechnological processes and, 74 foodborne yeasts and, 194 Promutagenic chemicals, microbial cytochromes P-450and, 160,162 Proteases biotechnological processes and, 77 protein analysis and, 292,306,326 Protein biotechnological processes and, 77-79 foodborne yeasts and, 180,187,193, 235
herbicides and pesticides and, 26, 42,44
microbial cytochromes P-450and, 134-135
355
INDEX Actinomyces, 151-154, 160, 162 Bacillus megaterium, 146-147, 149 eucaryotes, 165, 168, 170 Pseudomonas putida, 141,143-144 recombinant E. coli K-12 and, 87,103, 115,121 pBR322,89,93,96 Protein analysis, 280-281 electroblotting, 303-306 glass fiber, 307-313 microanalysis, 306-307 PVDF, 309,313-315 microsequence analysis, 318, 322-323 gene cloning, 318-322 PAGE, 281-283 SDS-PAGE, 283-287 two-dimensional, 287-290 prospective directions, 327-329 purification, 315 one-dimensional SDS-PAGE, 315-317 two-dimensional SDS-PAGE, 316-318 quality control of recombinant proteins, 323-327 structural analysis, 290 automated amino acid sequenators, 297,299-300 detection, 293 Edman degradation cycle, 296-298 mapping, 291-293 photoaffinity labeling, 294 recovery of proteins, 295-296 sequences, 300-303 Proteolysis foodborne yeasts and, 220-222, 226, 228
microbial cytochromes P-450 and, 165 protein analysis and, 285, 318 quality control of recombinant proteins, 325-326 structural analysis, 291, 293, 297 Proteus, biotechnological processes and, 71 Protocatechuate, herbicides and pesticides and, 21-22, 25-26 Pseudomonas biotechnological processes and, 71-73 herbicides and pesticides and, 3, 6-8 chloroaromatic degradation, 39,42-44
chloroaromatic metabolism, 25-26,29 dicamba degradation, 46, 48 growth kinetics, 50 kinetics of biodegradation, 16-17, 19-20 recombinant E. coli K-12 and, 101, 106-108,111,113 Pseudomonas putida biotechnological processes and, 78 herbicides and pesticides and, 3 microbial cytochromes P-450 and, 133, 140-145,157 Psychrophilic yeasts, foodborne yeasts and, 228,246 Psychrotrophic yeasts, foodborne yeasts and, 219,221,228,246 pUC, herbicides and pesticides and, 42-44
Puccinia chondrillina, biotechnological processes and, 79 Purification, protein analysis and, 280, 286,324-325,327 electroblotting, 306, 313-314 microsequences, 318-32 3 SDS-PAGE, 315-318 structure, 296, 299-302 Putidaredoxin, microbial cytochromes P-450 and, 141, 143 Putidaredoxin reductase, microbial cytochromes P-450 and, 143-144 PVDF, see Polyvinylidene difluoride Pyrocatechases, herbicides and pesticides and, 29,39
R R-factor, recombinant E. coli K-12 and, 106,110,117,122 R-factor gene, biotechnological processes and, 71 Radiochemical methods, protein analysis and, 290,300-301,306,323 Radiolabeling, protein analysis and, 290, 293,316 Raffinose, foodborne yeasts and, 211, 251-252,257 Recombinant Escherichia coli K-12, environment and, 87-89,121-122
356
INDEX
alternative detection methods, 120-121 C600,90-92,96,103 ColEI, 89-95 ColK, 92,94-96 ColV, 114-115,118 intestinal tract, 113-117 conjugational transfer, 117-1 20 pBR322,89 conjugational transfer, 90-97, 99-100 stability, 97-98 sewage, 108-109 conjugational transfer, 109-113 SF185,90-91,94,96-97 soil, 104-105 conjugational transfer, 106-108 sterile, 104-105 water, 100-102 conjugational transfer, 102-104 Recombinant proteins, quality control of, 323-327 Reductase, microbial cytochromes P-450 and, 146-148,167,172 Reduction, microbial cytochromes P-450 and, 138-139 Refrigeration, foodborne yeasts and, 218-219,221 Release, biotechnological processes and, 74,79 Renaturation, protein analysis and, 324-325 Repetitive yield, protein analysis and, 297,309 Replication herbicides and pesticides and, 36,42 recombinant E. coli K-12 and, 89,94, 114 Residents, recombinant E. coli K-12 and, 114 Residue herbicides and pesticides and, 2, 5-6 microbial cytochromes P-450 and, 143, 154 Rhizobium, herbicides and pesticides and, 36 Rhizobium fredii, recombinant E. coli K-12 and, 106 Rhizobium japonicum, microbial cytochromes P-450 and, 151 Rhizopus, foodborne yeasts and, 226
Rhodopseudomonas pal ustris, herbicides and pesticides and,33 Ahodosporidium, foodborne yeasts and identification, 239,243,245-246 specific habitats, 202, 215, 219 Rhodotorula, foodborne yeasts and, 182, 192 acid-preserved foods, 227-228 dairy products, 222 fermented foods, 227 identification, 239, 245-246 meat, 219-220 specific habitats, 202, 206-207, 212, 217 Ribosomal RNA foodborne yeasts and, 181,247 herbicides and pesticides and, 7-8 Rice biotechnological processes and, 79 foodborne yeasts and, 207,225-226 Ring cleavage, herbicides and pesticides and, 26-29 Ring fission, herbicides and pesticides and, 29,44 Risk assessment, biotechnological processes and, 73-76,82 rop gene, recombinant E. coli K-12 and, 89,93,95-96 Rose bengal chloramphenicol chlortetracycline, foodborne yeasts and, 232 Rose bengal chlortetracycline, foodborne yeasts and, 232
S Sabouraud dextrose agar, foodborne yeasts and, 231 Saccharomyces foodborne yeasts and, 181 acid-preserved foods, 227 dairy products, 222 ecology, 184,187,189,193-194 fermented foods, 224-225 identification, 241,244,253,257 methods for isolation, 232-233 specific habitats, 202-203, 208-214, 217-218 protein analysis and, 294
357
INDEX Saccharomyces cerevisiae foodborne yeasts and acid-preserved foods, 227 dairy products, 222-223 ecology, 186,191 fermented foods, 224-226 identification, 243,253,256 specific habitats, 202,206-208, 210-218
microbial cytochromes P-450and, 133, 162-166,173
protein analysis and, 326 Saccharornycodes ludwigii, foodborne yeasts and, 240,251 Saccharornycopsis, foodborne yeasts and, 226,247,256
Sacchropolyspora erythraea, microbial cytochromes P-450and, 151-152 Safety, biotechnological processes and, 77,79
Salicylate, herbicides and pesticides and, 2,7,20,36,39
Salmonella microbial cytochromes P-450and, 157 recombinant E. coli K-12 and, 109-111 Salmonella typhi, biotechnological processes and, 71 Salmonella typhimurium microbial cytochromes P-450and, 157-159
recombinant E.coli K-12and, 100-102, 105,109,118
Salt, foodborne yeasts and, 223,228,233 ecology, 185,189,191-192 identification, 237,250,254 specific habitats, 224,226 Salt tolerance, foodborne yeasts and, 186, 192,226
Sample preparation, foodborne yeasts and, 228-229 Schizosaccharomyces, foodborne yeasts and, 182 identification, 239,244,247 specific habitats, 203, 214-216 SDS-PAGE, protein analysis and, 280, 283-288,327
electroblotting, 303-304, 308,313-314 microsequence analysis, 321 one-dimensional, 315-31 7 purification, 315
structural analysis, 290,292-296, 300, 302
two-dimensional, 316-318 Selection foodborne yeasts and, 189,224, 227-228
recombinant E. coli K-12 and, 90-91 Selective pressure foodborne yeasts and, 183,195 herbicides and pesticides and, 42,48 recombinant E. coli K-12 and, 122 Selective prodedures, foodborne yeasts and, 232-233 Sequences, see also Amino acid sequences; Microsequence analysis foodborne yeasts and, 235 microbial cytochromes P-450and eucaryotes, 163,165-168 procaryotes, 145-147, 153-154 protein analysis and, 280, 322, 326-327
electroblotting, 306-307 purification, 315-3 17 structural analysis, 291,300-303 recombinant E. coli K-12 and, 95-96 Serratia liquifaciens, recombinant E. coli K-12 and, 117 Sewage biotechnological processes and, 73,78 herbicides and pesticides and, 35,48 recombinant E. coli K-12 and, 88-89, 108-109,121-122
conjugational transfer, 109-113 water, 101-102 Sexual reproduction, foodborne yeasts and, 181-183,235,245 Shigella, recombinant E. coli K-12and, 111,117-118
Single-cell protein, foodborne yeasts and, 186-187,223
Site-directed mutagenesis, microbial cytochromes P-450and, 142,156 Sodium dodecyl sulfate, see SDS-PAGE Soil biotechnological processes and, 70,73 foodborne yeasts and, 184,195,229 herbicides and pesticides and, 2,5-7 anaerobic aromatic metabolism, 33 chloroaromatics, 22,29,42 dicamba degradation, 44,46,48
358
INDEX
growth kinetics, 53-62 kinetics of biodegradation, 10,12-15, 17-19
recombinant E. coli K-12and, 88-89, 104-105,121-122
Soil moisture, herbicides and pesticides and, 12,17-18 Sorption, herbicides and pesticides and, 14-15
Soybean foodborne yeasts and, 225 herbicides and pesticides and, 60-62 microbial cytochromes P-450and, 148, 155,160,168-169
Spoilage, foodborne yeasts and, 180 acid-preserved foods, 227 dairy products, 221-222 ecology, 183,185,188-189 fermented foods, 224-225 fish, 221 meat, 219-220 specific habitats, 207,209,211-213, 215,218
Sporangia, foodborne yeasts and, 181-182,247,251,253
Spore formation, foodborne yeasts and, 181-182,191,237,247,250
Sporidiobolus, foodborne yeasts and, 207, 245
Sporobolomyces, foodborne yeasts and, 182
identification, 239,244-246 specific habitats, 203,206-207,
Streptomyces carbophilus, microbial cytochromes P-450and, 152 Streptomyces griseolus, microbial cytochromes P-450and, 153-154 Streptomyces griseus, microbial cytochromes P-450and, 155-162, 168,173
Streptomyces setonii, microbial cytochromes P-450and, 152-153 Streptomycetes, herbicides and pesticides and, 36 Streptomycin resistance, recombinant E. coli K-12and, 92,102-103,116,118 Sucrose, foodborne yeasts and, 216,229 Sugar, see also High-sugar-content foods foodborne yeasts and, 233 ecology, 185-186,189,191-193 identification, 247-248, 253,256 specific habitats, 215-216, 224 Sulfate herbicides and pesticides and, 33-34 protein analysis and, 286 Sulfonylurea, microbial cytochromes P-450and, 153-154 Sulfur herbicides and pesticides and, 23,26 microbial cytochromes P-450and, 135, 138,151,160
Sulfur dioxide, foodborne yeasts and, 193-194,210,247,251,257
Surface mating, recombinant E. coli K-12 and, 100
216-217,222
T
Stability, recombinant E. coli K-12and, 97-98
Staphylococcus aureus biotechnological processes and, 71 protein analysis and, 292,308 Starch, foodborne yeasts and, 186,190, 193,226
Sterile soil, recombinant E. coli K-12and, 104-106,108
Steroids, microbial cytochromes P-450 and, 147-149 Storage, foodborne yeasts and, 195, 217-218,220
Streptococcus, biotechnological processes and, 75 Streptomyces, microbial cytochromes P-450and, 152,154
Taxonomy foodborne yeasts and, 180-181,183 identification, 235,245 specific habitats, 195,215 herbicides and pesticides and, 5-7 TEMED, protein analysis and, 281 Temperature biotechnological processes and, 70 foodborne yeasts and dairy products, 221,223 ecology, 188-189, 191-193 identification, 246,252 methods for isolation, 230,233 specific habitats, 211,214,216,218, 220
INDEX herbicides and pesticides and chloroaromatic metabolism, 23 growth kinetics, 53-55, 57-58, 60-62
kinetics of biodegradation, 9,12, 17-18
protein analysis and, 290 recombinant E. coli K-12and, 99,101, 103,106,111
Tetracycline, biotechnological processes and, 73 Tetracycline resistance, recombinant E. coli K-12and, 89,102-103 mammalian intestinal tract, 117, 119-120
Tetradecane, microbial cytochromes P-450and, 167,169 Thawing, foodborne yeasts and, 193 Thiobacillus, biotechnological processes and, 79 Toluene, herbicides and pesticides and, 2,26,36-37
Torulaspora, foodborne yeasts and, 182-183,185
cereal, 218 dairy products, 223 fermented foods, 224 identification, 241,244,250,253-255, 257
specific habitats, 203,207-209, 213, 215
Toxicity, biotechnological processes and, 76-77
Toxins biotechnological processes and, 70,80 microbial cytochromes P-450and, 170 recombinant E. coli K-12and, 101 Transgenic organisms, biotechnological processes and, 80 Transients, recombinant E. coli K-12and, 114
359
dairy products, 221 fermented foods, 225-227 identification, 239,244,246,255 meat, 219-220 specific habitats, 203-207, 217 Trichosporon cutaneum, microbial cytochromes P-450and, 171 Triethylamine, protein analysis and, 286, 295
Triparental mating, recombinant E. coli K-12and, 91,97,99 mammalian intestinal tract, 118,120 sewage, 111-112 TRIS, protein analysis and, 282,284-285, 313
Trypsin microbial cytochromes P-450and, 146 protein analysis and, 291-292, 314 Tryptic peptides, protein analysis and, 315,321,325
Tryptone glucose yeast, foodborne yeasts and, 231 Two-dimensional PAGE,protein analysis and, 280-281,287-290 electroblotting, 305-307, 309,314 microsequence analysis, 318,323 purification, 315-31 8 quality control of recombinant proteins, 324,327-328
structural analysis, 290,292,299 Tyrosine microbial cytochromes P-450and, 141-142,156
protein analysis and, 301,303
U Urea foodborne yeasts and, 187 protein analysis and, 325
Translation, protein analysis and,
PAGE,285,287-288,290
326-327,329 2,4,5-Trichlorophenoxyaceticacid
structural analysis, 292,302 Urease, foodborne yeasts and, 183,
biotechnological processes and, 78 herbicides and pesticides and, 2-3 anaerobic aromatic metabolism, 36 chloroaromatic degradation, 39-42 kinetics of biodegradation, 18-19 Trichosporon, foodborne yeasts and acid-preserved foods, 227-228
245-247,255
V Vaccine, biotechnological processes and, 68,77
360
INDEX
Vectors, foodborne yeasts and, 184,195 Vegetables, foodborne yeasts and, 195-208,223-225,227
identification, 245-246, 248,252-255, 258
Vibrio choleroe, biotechnological processes and, 70 Virus, biotechnological processes and, 77-78
Vitamins, foodborne yeasts and, 187,233, 258
W Waste treatment, biotechnological processes and, 76,78 Water biotechnological processes and, 70,73,
Xanthobocter sp., microbial cytochromes P-450and, 148,150 Xanthomonos compestris, biotechnological processes and, 79 Xenobiotic metabolism, microbial cytochromes P-450and, see Cytochromes P-450 Xenobiotics biotechnological processes and, 78 herbicides and pesticides and, I, 13,32 degradation, 36-37 growth kinetics, 62-63 Xerotolerant yeast ecology, 185-186,189 methods for isolation, 233,247-248, 250,253-254,257
specific habitats, 215-216, 218 Xylene, herbicides and pesticides and, 36-37
79
foodborne yeasts and, 185-186, 220-221
herbicides and pesticides and, 2,4-7 anaerobic aromatic metabolism, 33 dicamba degradation, 44,48 growth kinetics, 60 kinetics of biodegradation, 12 recombinant E. coli K-12 and, 88-89, 100-104,121-122
Water molecules, microbial cytochromes P-450and, 141,164 Weeds biotechnological processes and, 79 herbicides and pesticides and, 4,44,
Y Yarrowio Iipolytica, foodborne yeasts and identification, 239,244,247 specific habitats, 204,208,219-221, 223,228
Yeast biotechnological processes and, 68,77 foodborne, see Foodborne yeasts microbial cytochromes P-450and, 162 protein analysis and, 324
46,62
Wickerhamiella domercqii, foodborne yeasts and, 204,240,244,250 Wine, foodborne yeasts and, 184 identification, 247-255, 257-258 methods for isolation, 230-233 specific habitats, 195-206, 209-211 X
X-ray crystallography, microbial cytochromes P-450and, 141-142, 156
2 Zygoascus hellenicus, foodborne yeasts and, 204,241,244,252 Zygosocchoromyces, foodborne yeasts and, 182 cereal, 218 ecology, 185-186,189,i9i,i93-i94 fermented foods, 224,226 identification, 240-241, 244,251-254 specific habitats, 204-206, 208-211, 214-216
CONTENTS OF PREVIOUS VOLUMES Volume 26
Volume 27
Microbial Oxidation of Gaseous Hydrocarbons Ching-Tsang Hou
Recombinant DNA Technology Vedpal Singh Malik Nisin A. Hurst
Ecology and Diversity of Methylotrophic Organisms A. S . Hanson Epoxidation and Ketone Formation by C1Utilizing Microbes Ching-Tsang Hou, Ramesh N. Patel, and Allen I. h s k i n Oxidation of Hydrocarbons by Methane Monooxygenases from a Variety of Microbes Howard Dalton
The Coumermycins: Developments in the Late 1970s John C. Godfrey Instrumentation for Process Control in Cell Culture Robert J. Fleischaker, James C. Weaver, and Anthony J. Sinskey Rapid Counting Methods for Coliform Bacteria A. M. Cundell
Propane Utilization of Microorganisms Jerome J. Perry
Training in Microbiology at Indiana University-Bloomington L. S. McClung
Production of Intracellular and Extracellular Protein from n-Butane by Pseudomonos butanovora sp. nov. Joji Takahashi Effects of Microwave Irradiation on Microorganisms John A. Chipley Ethanol Production by Fermentation: An Alternative Liquid Fuel N. Kosaric, D. C. M. Ng, I. Russell, and G. C. Stewart
INDEX
Volume 28
Immobilized Plant Cells P. Brodelius and K. Mosbach Genetics and Biochemistry of Secondary Metabolism Vedpal Singh Malik
Surface-Active Compounds from Microorganisms D. G. Cooper and J. E. Zajic INDEX
361
Partition Affinity Ligand Assay (PALA): Applications in the Analysis of Haptens, Macromolecules, and Cells Bo Mattiasson, Matts Ramstorp, and Torbjorn G. I. Ling
362
CONTENTS OF PREVIOUS VOLUMES
Accumulation, Metabolism, and Effects of Organophosphorus Insecticides on Microorganisms Rup La1 Solid Substrate Fermentations K. E. Aidoo, A. Hendry, and B. J. B. Wood Microbiology and Biochemistry of Miso (Soy Paste) Fermentation Sumbo H. Abiose, M. C. Allan, and B. J. B. Wood INDEX
Volume 29
Stabilization of Enzymes against Thermal Inactivation Alexander M. Klibanov Production of Flavor Compounds by Microorganisms G. M. Kempler
Volume 30
Interactions of Bacteriophages with Lactic Streptococci Todd B. Klaenhamrner Microbial Metabolism of Aromatic-Hydrocarbons Carl E. Cerniglia
Polycyclic
Microbiology of Potable Water Betty H. Olson and Laslo A. Nagy Applied and Theoretical Aspects of Virus Adsorption to Surfaces Charles P. Gerba Computer Applications in Applied Genetic Engineering Joseph L. Modelevsky Reduction of Fading of Fluorescent Reaction Product for Microphotometric Quantitation G. L. Picciolo and D. S. Kaplan INDEX
New Perspectives on Aflatoxin Biosynthesis J. W. Bennett and Siegfried B. Christensen Volume 31
Biofilms and Microbial Fouling W. G. Characklis and K. E. Cooksey Microbial Influences: Fermentation Process, Properties, and Applications Erick J. Vandamme and Dirk G. Derycke Enumeration of Indicator Bacteria Exposed to Chlorine Gordon A. McFeters and Anne K. Camper Toxicity of Nickel to Microbes: Environmental Aspects H. Babich and G. Stotzky INDEX
Genetics and Biochemistry of Clostridium Relevant to Development of Fermentation processes Palmer Rogers The Acetone Butanol Fermentation B. McNeil and B. Kristiansen Survival of, and Genetic Transfer by, Genetically Engineered Bacteria in Natural Enviornments G. Stotzky and H. Babich Apparatus and Methodology for Microcarrier Cell Culture S. Reuveny and R. W. Thoma
CONTENTS OF PREVIOUS VOLUMES
363
Naturally Occurring Monobactams William L. Parker, Joseph O’Sullivan, and Richard B. Sykes
Antitumor Anthracyclines Produced by Streptomyces peucetius A. Grein
New Frontiers in Applied Sediment Microbiology Douglas Gunnison
INDEX
Ecology and Metabolism of Thermothrix thiopara Daniel K. Brannan and Douglas E. Caldwell Enzyme-Linked Immunoassays for the Detection of Microbial Antigens and Their Antibodies John E. Herrmann The Identification of Gram-Negative, Nonfermentative Bacteria from Water: Problems and Alternative Approaches to Identification N. Robert Ward, Roy L. Wolfe, Carol A. Justice, and Betty H. Olson
Volume 32
Clonal Populations with Special Reference to Bacillus sphaericus Samuel Singer Molecular Mechanisms of Viral Inactivation by Water Disinfectants A. B. Thurman and C. P. Gerba Microbial Ecology of the Terrestrial Subsurface William C. Ghiorse and John T. Wilson
Applications and Mode of Action of Formaldehyde Condensate Biocides H. W. Rossmoore and M. Sondossi
Microbial Corrosion of Metals Warren P. Iverson Economics of the Bioconversion of Biomass to Methane and Other Vendable Products Rudy J. Wodzinski, Robert N. Gennaro, and Michael H. Scholla Microbial Production of Butanediol Robert J. Magee and Nain Kosaric
The Cellulosome of Clostridium thermocellum Raphael Lamed and Edward A. Bayer
Froam Control in Submerged Fermentation: State of the Art N. P. Ghildyal, B. K. Lonsane, and N. G. Karanth
INDEX
The
Volume 33
2,3-
Microbial Sucrose Phosphorylase: Fermentation process, Properties, and Biotechnical Applications Erick J. Vandamme, Jan Van Loo, Lieve Machtelinckx, and Andre De Laports
Occurrence and Mechanisms of Microbial Oxidation of Man],Sanese Kenneth H. Nealson, Bradley M. Tebo, and Reinhardt A. Rosson Recovery of Bioproducts in China: A General Review Xiong Zhenping INDEX
Volume 34
What’s in a Name?-Microbial Secondary Metabolism J. W. Bennett and Ronald Bentley
3 64
CONTENTS OF PREVIOUS VOLUMES
Microbial Production of Gibberellins: State of the Art P. K. R. Kumar and B. K. Lonsane
Economy in Enzyme Production and Starch Hydrolysis B. K. Lonsone and M. V. Ramesh
Microbial Dehydrogenations of Monosaccharides Milo8 Kulhdnek
Methods for Studying Bacterial Gene Transfer in Soil by Conjugation and Transduction G. Stotzky, Monica A. Devanas, and Lawrence R. Zeph
Antitumor and Antiviral Substances from Fungi Shung-Chang Jong and Richard Donovick Biotechnology-The Golden Age V. S. Malik INDEX
Volume 35
Production of Bacterial Thermostable a-Amylase by Solid-state Fermentation: A Potential Tool for Achieving
Microbial Levan Youn W.Han Review and Evaluation of the Effects of Xenobiotic Chemicals on Microorganisms in Soil R. J. Hicks, G. Stotzky, and P. Van Voris Disclosure Requirements for Biological Materials in Patent Law Shung-Chong Jong and Jeannette M. Birmingham INDEX