Hemostasis
3
1 Hemostasis Components and Processes K. John Pasi 1. Introduction Hemostasis is a host defense mechanis...
58 downloads
1375 Views
3MB Size
Report
This content was uploaded by our users and we assume good faith they have the permission to share this book. If you own the copyright to this book and it is wrongfully on our website, we offer a simple DMCA procedure to remove your content from our site. Start by pressing the button below!
Report copyright / DMCA form
Hemostasis
3
1 Hemostasis Components and Processes K. John Pasi 1. Introduction Hemostasis is a host defense mechanism that protects the integrity of the vascular system after tissue injury. It works in conjunction with other inflammatory, immune, and repair mechanisms to produce a coordinated response. Hemostatic systems are generally quiescent, but following tissue injury or damage these systems are rapidly activated. Hemostasis has evolved to accommodate the conflicting needs of maintaining vascular integrity and free flow of blood in the vascular tree. Given the high pressures that exists in arterial circulation, it is clearly important that procoagulant mechanisms exist that can minimize blood loss from a site of vascular damage as rapidly as possible. However, this powerful procoagulant response must be localized to prevent unwanted thrombosis and controlled to prevent thrombosis in the slower low-pressure venous circulation. As a result of these competing needs, hemostasis has evolved as a patchwork of interrelated activating and inhibiting pathways that can either promote or suppress other elements of the overall process. Hemostasis has therefore evolved to integrate five major components: vascular endothelium, platelets, coagulant proteins, anticoagulant proteins, and fibrinolytic proteins. The coordinated hemostatic response ultimately produces a platelet plug, fibrin-based clot, deposition of white cells at the point of injury and activation of inflammatory, and repair processes, maintenance of blood flow, and vascular integrity. 2. Overview of Hemostasis All components of the hemostatic mechanism exist under resting conditions in an inactive form. A diagrammatic representation of the overall hemostatic From: Methods in Molecular Medicine, Vol. 31: Hemostasis and Thrombosis Protocols Edited by: D. J. Perry and K. J. Pasi © Humana Press Inc., Totowa, NJ
3
4
Pasi
response is shown in Fig. 1. Following injury, there is immediate vasoconstriction and reflex constriction of adjacent small arteries. This slows blood flow into the damaged area. The reduced blood flow allows contact activation of platelets. On activation by tissue injury (or other agonists), platelets undergo a series of physical, biochemical, and morphological changes. Platelets adhere to exposed connective tissue, mediated in part by the von Willebrand factor (vWF). Collagen exposure and local thrombin generation (see Subheading 6.) lead to the release of platelet granule contents. Release of platelet granule contents, which include adenosine diphosphate (ADP), serotonin, and fibrinogen, further enhances platelet activation, formation of platelet aggregates, and interaction with other platelets and leukocytes. This process leads to the formation of the initial platelet plug. The vascular endothelium also undergoes a series of changes moving from its resting phase (with predominantly anticoagulant properties) to a more active procoagulant and repair phase. In concert with these cellular changes, inactive plasma coagulation factors are converted to their respective active species by cleavage of one or two internal peptide bonds. In sequence, these active factors generate thrombin, which leads to formation of fibrin from fibrinogen (to stabilize the platelet plug), crosslinking of the fibrin formed (via activation of factor XIII), further activation of platelets, and also activation of fibrinolytic pathways (to enable plasmin to dissolve fibrin strands in the course of wound healing). Additionally, thrombin interacts with other nonhemostatic systems to promote cellular chemotaxis, fibroblast growth, and wound repair. 3. Components of the Hemostatic System
3.1. Vascular Endothelium Vascular endothelium is the monolayer of cells that line the inner surface of blood vessels. Since an uninterrupted vascular tree is necessary for survival, the ability of the vasculature to maintain a nonleaking system is essential. If a vessel is disrupted and leakage occurs, the coagulation system and platelets close the defect temporarily until cellular repair of the defect takes place. If a vessel is occluded by thrombus, blood flow may be re-established by lysing the clot or recanalizing the occluded vessel. These properties are the main functional characteristics of the vascular endothelial cell. Endothelial cells are attached to and rest on the subendothelium, an extracelluar matrix secreted by the endothelial cells. Subendothelium is composed of collagen, elastin, mucopolysaccharides (including heparan sulfate, dermatan sulfate, chrondroitin sulfate), laminin, fibronectin, vWF, vitronectin, thrombospondin, and occasionally fibrin. All these components are synthesized by the endothelial cells. Together, endothelium and subendothelium form a
Hemostasis
5
Fig. 1. A flow diagram representing the major events in the process of overall hemostasis.
selectively impermeable layer, resistant to the passive transfer of fluid and cellular elements of blood, but permeable to gases. Cells may pass through the endothelium at sites of inflammation by a process of adherence and then migration between endothelial cells. Subendothelium can act as a physical barrier in the absence of endothelial cells. Endothelial cells have multiple functions as outlined below (1).
3.1.1. Maintenance of Blood Flow Endothelial cells influence vascular tone, blood pressure, and blood flow by induction of vasoconstriction and vasodilatation. This is achieved by secretion of renin, endothelin, endothelial-derived relaxing factor (EDRF) or nitrous oxide, adenosine, prostacyclin, and surface enzymes that convert or inactivate other vasoactive peptides, such as angiotensin and bradykinin.
3.1.2. Antiplatelet and Anticoagulant Properties Intact endothelial cells are intrinsically nonthrombogenic, exerting a powerful inhibitory influence on hemostasis by a range of factors that they either
6
Pasi
synthesize or express on their surface. For example, platelets adhere to subendothelium rather than endothelial cells. This is due to endothelial production of components that inhibit platelet aggregation, such as prostacylin, EDRF, and adenosine. Cell-surface heparan sulfate enhances the effect of antithrombin in forming thrombin–antithrombin complexes. Perhaps the major anticoagulant properties of endothelium are via the endothelial expression of thrombomodulin and tissue factor pathway inhibitor (TFPI). Thrombomodulin enhances the ability of thrombin to activate protein C. Enhancement of protein C activation leads to increased inactivation of factor Va and factor VIIIa. Endothelium also secretes protease nexin 1. This inactivates thrombin by covalent binding to the thrombin active site. This complex formation is enhanced by heparan sulfate.
3.1.3. Coagulant Properties In contrast to the above, in the setting of damage to blood vessels, the endothelium functions as an important component to coagulation pathways. Central to this role is endothelial cells production of tissue factor in response to injury. In addition, they bind factors IX, X, V, high-mol-wt kininogen (HMWK), contain factor XIII activity, and produce endothelin to induce vasoconstriction. Importantly, endothelial cells also produce the natural inhibitor of tissue factor mediated coagulation, TFPI.
3.1.4. Fibrinolytic Properties Endothelial cells secrete several components active in fibrinolysis. These include plasminogen activators and plasminogen activator inhibitor. These components are bound to the endothelial cell surface to enable assembly of active complexes.
3.1.5. Repair Properties Endothelial cells are capable of significant repair of blood vessels. Simple minor injuries are repaired by migration of adjacent cells and subsequent endothelial cell proliferation. More severe vessel wall injuries require migration and proliferation of smooth muscle cells and fibroblasts. Endothelium secretes components that are active in the repair process by enhancing smooth muscle migration and fibroblast function. These include a protein resembling platelet-derived growth factor, vascular permeability factor, and fibroblast growth factor. Endothelial cells are also responsive to platelet-derived endothelial growth factor and transforming growth factor β.
3.1.6. Interactive Properties The endothelium interacts with leukocytes. This is critical in the migration of leukocytes into area of inflammation. Adhesion molecules present on both endothelial cells and leukocytes mediate this interaction.
Hemostasis
7
4. Platelets Platelets are nonnucleated fragments of cytoplasm that have a crucial role in primary hemostasis. They are derived from bone marrow megakaryocytes and are smooth biconvex disks of approx 1–4 mm diameter. Normal circulating numbers are approx 140–400 × 109/L.
4.1. Production In the production of platelets, megakaryocytes undergo specialized cellular division. The megakaryocyte nucleus divides, but the cell itself does not divide (endomitosis) (2), although there is formation of new membrane and cytoplasmic maturation. This cytoplasmic maturation includes development of platelet-specific granules, membrane glycoproteins, and lysosomes. Mature megakaryocytes are therefore variably polyploid, with up to 64 N. They are large at approx 60 µm diameter. As a part of the endomitosis process, there is increased membrane. This excess membrane is accommodated by invagination. The invagination process continues, thereby clipping off individual platelets (cytoplasmic fragmentation) from the main megakaryocyte body. It is suggested that circulating megakaryocytes undergo cytoplasmic fragmentation in the pulmonary capillary bed. Megakaryocyte maturation is controlled in a simple negative feedback loop, under the influence of the growth factor thrombopoietin and cytokines, such as interleukin-3 (IL-3) and interleukin-11 (IL-11). When platelet production is increased, megakaryocytes undergo a more rapid cytoplasmic maturation than nuclear maturation. Under such circumstances, platelets may be produced from octaploid or even tetraploid cell megakaryocytes. Such platelets are often larger than normal and more metabolically active. Once released from the bone marrow, platelets are sequestered in the spleen for 24–48 h. The spleen may contain upto 30% of the normal circulating mass of platelets. Significant platelet pools may also exist in the lungs. The normal life-span of platelets is approx 8–14 d. Platelets are removed from the circulation by the reticuloendothelial system on the basis of senescence rather than by random utilization. However, there is a small fixed component that exists owing to random utilization of platelets that maintain vascular integrity.
4.2. Structure Stylized structural features are shown diagrammatically in Fig. 2. A range of glycoproteins molecules partially or completely penetrate cell-membrane lipid bilayer. These glycoprotein molecules function as receptors for different agonists, adhesive proteins, coagulation factors, and for other platelets. Important membrane glycoproteins are listed in Table 1 with their associated functions.
8
Pasi
Fig. 2. Stylized structural features of the platelet. See text for decription of individual components. Table 1 Important Platelet Membrane Glycoproteins Glycoprotein Ia IIa Ic Ib/IX IIb/IIIa IV V
103 copies/platelet
Receptors
2–4 5–10 3–6 25–30 40–50
Collagen Fibronectin, laminin Fibronectin, laminin vWF, thrombin Fibrinogen, vWF, Fibronectin, vitronectin Collagen, thrombospondin Thrombin
The most abundant glycoproteins on the platelet surface are glycoproteins IIb and IIIa. These two glycoproteins form a heterodimer and carry receptors for adhesive proteins (fibrinogen, vWF, fibronectin). The IIb-IIIa complex is a member of the integrin family of adhesion receptors. Glycoprotein Ib contains a receptor for vWF and thrombin. This receptor is essential in the platelet vessel wall interaction. The cell membrane also has importance as a source of phospholipid (prostaglandin synthesis), site of calcium mobilization, and localization of coagulant activity to the platelet surface.
Hemostasis
9
Platelet structure is complex (3). Below the plasma membrane lies a peripheral band of microtubules, which function as the cellular cytoskeleton. The microtubules maintain the discoid shape in the resting platelet, but disappear temporally (disassemble?) on platelet aggregation. The surface-connected canalicular system is an extensive system of plasma membrane invaginations. This system vastly increases the surface area across which membrane transport occurs and through which platelet granules discharge their contents during the secretory phase of platelet aggregation. The dense tubular system probably represents the smooth endoplasmic reticulum. It is thought to be the site of prostaglandin synthesis and sequestration/release of calcium ions. Platelets contain many organelles (mitochondria, glycogen granules, lysosomes, peroximsomes) and two types of platelet-specific storage granules: dense bodies (d-granules) or a-granules. The contents of the platelet-specific granules are released when platelets aggregate. Dense bodies contain 60% of the platelet storage pool of adenine nucleotides (such as adenosine diphosphate) and serotonin. Dense body adenine nucleotides do not readily exchange with other adenine nucleotides in the platelet metabolic pool. α-Granules contain multiple different proteins. These proteins may be platelet specific or proteins that are found in the plasma or other cell types (such as coagulation factors). The major contents of α-granules are vWF, platelet factor 4, β-thromboglobulin, thrombospondin, factor V, fibrinogen, fibronectin, platelet derived growth factor, high-mol-wt kininogen, and tissue plasminogen activator inhibitor-1.
4.3. Function Platelets are crucial components of the hemostatic system. When a vessel wall is damaged, platelets escaping from the circulation immediately come into contact with and adhere to collagen and subendothelial bound vWF (through glycoprotein Ib). Glycoprotein IIb-IIIa is then exposed, via the binding of vWF. This forms a second binding site for vWF. In addition with glycoprotein IIb– IIIa exposure, fibrinogen may be bound promoting platelet aggregation. Within seconds of adhesion to the vessel wall, platelets undergo a shape change, owing to ADP released from the damaged cells or other platelets exposed to the subendothelium. Platelets become more spherical and put out pseudopods, which enable platelet–platelet interaction. The peripheral microtubules become centrally apposed forcing the granules toward the surface and the surface-connected canalicular system. Platelets then undergo a specific release reaction of their granules, the intensity of the release reaction being dependent on the intensity of the stimulus. With the shape change, there is also further exposure of the glycoprotein IIb–IIIa complex and further fibrinogen binding. Since fi-
10
Pasi
brinogen is a dimer, it can form a direct bridge between platelets or act as a substrate for the lectin-like protein thrombospondin. With the enhancement of platelet–platelet interaction, platelet aggregation ensues. Platelet aggregation causes activation, secretion, and release from other platelets, so leading to a self-sustaining cycle that results in the formation of a platelet plug. The binding of agonists to also leads to a series of signal transduction events that mediate the platelet release reaction (see Fig. 3) (4). Agonist receptor interaction activates guanine nucleotide binding proteins (G-protein) and hydrolysis of plasma membrane phospholipids (phosphotidyl inositides) by phospholipase C (PLC). Inositol triphosphates that are formed act as ionophores, and mobilize calcium ions into the cytosol from the dense tubular system, and lead to an influx of calcium from outside. Diacylglycerol, also formed within the G-protein/PLC pathway, activates protein kinase C, which in turn phosphorylates a 47-kDa contractile protein. Together with the calciumdependent phosphorylation of myosin light chain, these reactions induce contraction and secretion of granule contents. Cyclic AMP/adenyl cyclase exert regulatory control over these reactions (high levels of cAMP reduce cytosol calcium concentration) and are in turn regulated by G-protein activity. In addition, prostaglandin (cyclic endoperoxides and thromboxane A2) synthesized from membrane phospholipids may bind to specific receptors and further stimulate these processes. Platelet α-granules contain several coagulation factors (such as factor V, fibrinogen, and high-mol-wt kininogen). On secretion from the α-granule, these factors reach high local concentrations. Platelets provide a local phospholipid surface for these factors to work on, particularly factor V. This procoagulant activity of platelets is not seen in resting platelets.
4.4. Antigens Platelets have a number of antigens on their surface specific to platelets. Many of the platelet-specific antigens are associated with platelet membrane glycoproteins (HPA IA—glycoprotein IIIa). Platelets also express HLA class I antigens and ABO blood group antigens. 5. Coagulation Factors 5.1. Thrombin Thrombin is the cornerstone of hemostasis. Prothrombin, its precursor, is a vitamin K dependent plasma of mol wt 71 kDa (579 amino acids). Thrombin is crucial to the conversion of fibrinogen to fibrin. It is the most potent physiological activator of platelets causing shape change, the generation of thromboxane A2, ADP release, and ultimately platelet aggregation. Thrombin also activates the cofactors of coagulation factor V, factor VIII, and factor XIII.
Hemostasis
11
Fig. 3. Signal transduction events that mediate the platelet-release reaction. The intermediate processes lead to the phosphorylation of 47kD protein and myosin light chain, which together contract and lead to secretion of platelet granule contents.
Thrombin bound to thrombomodulin is a potent activator of protein C. In addition to its procoagulant and anticoagulant activities, thrombin also has important roles in cellular growth, cellular activation, and the regulation of cellular migration.
5.2. Tissue Factor This is an integral transmembrane protein of mol wt 45 kDa (263 amino acids) coded for by a short gene of 12.4 kb on chromosome 1. It is found on the surface of vascular cells, but is also constitutively expressed by many nonvascular tissues. It can be upregulated on monocytes and vascular endothelium by inflammatory cytokines or endotoxin. Tissue factor (thromboplastin) binds and promotes activation of factor VII, and is required for the initiation of blood coagulation. It acts as a cofactor enhancing the proteolytic activity of factor VIIa toward factor IX and factor X. It binds factor VII via calcium ions.
5.3. Factor V This is a plasma glycoprotein of mol wt 330 kDa (2224 amino acids) coded for by a complex 25 exon 80-kb gene on chromosome 1. It is a critical cofactor
12
Pasi
in coagulation, which in its activated form facilities the conversion of prothrombin to thrombin. In Factor V, the rate of conversion of prothrombin to thrombin is 200,000- to 300,000-fold. Factor V circulates as a single-chain protein in a precursor inactive form. It is converted into an active two-chain form by thrombin or factor Xa. Thrombin cleaves factor V at three separate sites. Following cleavage, the two chains are linked via a divalent metal ion bridge. Binding to phospholipid surfaces occurs via the light chain. Factor V is inactivated by activated protein C and its cofactor protein S. Although it is predominantly synthesized in the liver (plasma factor V), megakaryocytes also synthesize factor V, which is stored in platelet α-granules (platelet factor V). Platelet factor V, which is released on platelet activation, accounts for approx 20% of total factor V. Factor V has a binding protein in platelets (multimerin), which is analogous to vWF for factor VIII. Plasma concentration of factor V is about 7–10 µg/mL with a half-life of approx 12 h.
5.4. Factor VII This is a vitamin K dependent plasma glycoprotein and serine protease of mol wt 50 kDa (406 amino acids) coded for by a 13-kb gene on chromosome 13. It has 10 N-terminal glutamic acid residues that are terminal γ carboxylated to form the Gla domain. Calcium binding properties of factor VII are crucial to its normal function and biological activity. Factor VII is involved in the initiation of blood coagulation, forming a complex with tissue factor to generate an enzyme complex that activates factor X and factor IX. Factor VII is activated by cleavage of the Arg153–Ile153 peptide bond. Activators include thrombin, activated factor X, and activated factor IX. Activated factor VII has no catalytic activity until bound to tissue factor. It circulates at a concentration of 0.5 µg/mL and half-life of 4–6 h.
5.5. Factor VIII This is a plasma glycoprotein of approx mol wt 360 kDa (2351 amino acids) coded for by a complex 26 exon 186-kb gene on the X chromosome. It has a domain structure that is very similar to that of factor V and is related to the copper protein ceruloplamsin. However, unlike factor V, the large B domain is not required for coagulant activity. Factor VIII is one of the largest and least stable coagulation factors with a complex polypeptide composition, circulating in plasma in a noncovalent complex with vWF. vWF functions to protect factor VIII from premature proteolytic degradation and concentrate factor VIII at sites of vascular injury. Factor VIII functions as a cofactor for factor IX, facilitating the conversion of factor X to factor Xa. Factor VIII increases the rate of conversion of factor X to Xa by factor IX by 200,000-fold.
Hemostasis
13
Liver synthesized single-chain molecule factor VIII is cleaved shortly after synthesis, circulates as a heterodimer, and comprises an 80-kDa light chain linked through a divalent metal cation bridge to a heavy chain (90–200 kDa). Variable amounts of the B domain remain after this initial cleavage. On activation by thrombin (or factor Xa), factor VIII is cleaved at Arg372, Arg740, and Arg1689, the Arg740 cleavage removing residual B domain remnants. This cleavage yields a 90-kDa heavy chain. A rate-limiting Arg372 cleavage yields two smaller 50 and 40 kDa fragments, both of which are essential for factor VIII clotting activity. At the same time, a small fragment is cleaved that removes vWF from factor VIII. Activated factor VIII is very unstable and rapidly loses cofactor function, owing to subunit disassociation. Inactivation of factor VIII also occurs via activated protein C and its cofactor protein S, by cleavage at Arg336 and Arg562. Plasma concentration of factor VIII is about 100–200 ng/mL and half-life of approx 12 h.
5.6. Factor X This is a vitamin K-dependent plasma glycoprotein and serine protease of mol wt 59,000 coded for by a 22-kb gene on chromosome 13. It has 11 N-terminal glutamic acid residues that are terminal γ carboxylated to form the Gla domain. Calcium binding properties of factor X are crucial to its normal function and biological activity. It is a central component in the common pathway of blood coagulation. Factor X is synthesized as a single chain, but exists in plasma as a heavy and light chain linked by a single disulfide bond. It is activated by cleavage of the Arg51–Ile52 peptide bond. Activators include activated factor VII/tissue factor complex and activated factor IX/factor VIII complex in the presence of calcium ions. Factor Xa, in conjunction forms a complex on phospholipid surfaces with factor V to form the prothrombinase complex. This complex converts prothrombin to thrombin. Factor X is inhibited by antithrombin and α2macroglobulin. Factor X circulates at a concentration of 8–10 µg/mL and has a half-life of approx 36 h.
5.7. Factor IX This is a vitamin K-dependent plasma glycoprotein and serine protease of mol wt 57,000 (415 amino acids) coded by a 34-kb gene on the long arm of the X chromosome. It is the largest of the family of vitamin K dependent proteins. Twelve N-terminal glutamic acid residues are terminal γ carboxylated to form the Gla domain. Calcium binding properties of factor IX are crucial to its normal function and biological activity.
14
Pasi
Factor IX circulates as a single-chain polypeptide. Activation occurs via cleavage of two peptide bonds, Arg145–Ala146 and Arg180–Val181, by either activated factor XI or activated factor VII, complexed to tissue factor. Arg180–Val181 cleavage is rate-limiting. Cleavage into factor IXa generates a heavy and light chain bound together via a single disulfide bond. A 24 amino acid activation peptide is removed during cleavage. Together with factor VIII, factor IXa can then proceed to activate factor X. In addition, factor IXa may also activate factor VII. The plasma factor IX concentration is about 5 µg/mL with a half-life of approx 24 h.
5.8. Factor XI This is plasma glycoprotein and serine protease of mol wt 160 kDa coded by a 23-kb gene on chromosome 4. Factor XI is a homodimer, comprising two identical subunits bound together by disulfide bond, that circulates bound to high-mol-wt kininogen. The plasma factor XI concentration is about 5 µg/mL with a half-life of approx 72 h. Factor XI is cleaved to active factor XIa by activated factor XII in the presence of high-mol-wt kininogen. Activation cleavage occurs within each subunit at Arg369–Ile370 in a region bounded by a disulfide linkage, so yielding two heavy chains and two light chains in the active molecule. Only the light chains possess catalytic activity. Factor XIa activates factor IX in the presence of calcium. No specific additional cofactors are required for this reaction. Both factor XI and factor XIa bind to platelets.
5.9. Factor XII This is a plasma glycoprotein and serine protease of mol wt 80 kDa (596 amino acids) coded for by a 12-kb gene located on chromosome 5. Factor XII has a half-life of approx 2 d and a plasma concentration of approx 30 µg/mL. In the process of contact activation factor XII is absorbed on to negatively charged surfaces and undergoes limited proteolysis at specific sites to yield active factor XII'. This slowly converts prekallikrein to kallikrein, which specifically cleaves factor XII to yield fully active factor XIIa. In addition, factor XIIa can autoactivate factor XII. Factor XIIa can activate factor XI to promote downstream activation of the coagulation cascade.
5.10. Factor XIII This is a tetramer of two a and b chains. The b chains function as the carrier for the a chains. On activation by thrombin, factor XIII crosslinks fibrin and other proteins involved in the clot via a transglutamase reaction. The factor XIIIa subunit has a plasma concentration of 15 µg/mL and the b subunit a concentration of 14 µg/mL.
Hemostasis
15
5.11. von Willebrand Factor (vWF) This is a multimeric glycoprotein of basic subunit of 400 kDa mol wt (2813 amino acids) coded for by a large complex gene of 178-kb on the short arm of chromosome 12. vWF is an important component in primary platelet hemostasis. Following translation, it undergoes extensive intracellular processing and exists as a series of multimers of the basic subunit, ranging from mol wt 800 to 20,000 kDa. It is produced in both endothelium and megakaryocytes. Endothelial cells secrete a vWF into the plasma constitutively, but store the majority of vWF synthesized (in Wieble Palade bodies) for regulated secretion. Platelet vWF is released from α-granules locally when they aggregate. vWF functions: as a carrier protein for coagulation factor VIII and as an adhesive protein involved in endothelial-platelet interaction, via platelet surface membrane glycoprotein Ib and IIb–IIIa complex. Its function as an adhesive protein is particularly important in situations of high shear stress. 6. Coagulation Cascade The classic “waterfall” hypothesis for coagulation proposes the intrinsic and extrinsic pathways (see Fig. 4) (5,6). The intrinsic system assumes that exposure of contact factors (factor XII, high-mol-wt kininogens, prekallikrein) to an abnormal/injured vascular surface leads to activation of factor XI, which in turn activates factor IX. Activated factor IX, in the presence of its cofactor factor VIII, then activates factor X to factor Xa in the presence of phospholipid. In turn, factor Xa, with its cofactor factor V, together form the prothrombinase complex, which converts prothrombin to thrombin. Thrombin then converts fibrinogen to fibrin. The extrinsic system assumes that factor VII and tissue factor, released from damaged vessels, directly activate factor X, and coagulation factor lying below factor X in the final common pathway. The division into extrinsic and intrinsic systems and the ability to test these two systems in the laboratory (the prothrombin time and activated partial thromboplastin time, respectively) have been valuable in understanding clinical bleeding problems, but fail to represent accurately what happens in in vivo hemostasis. This may be shown by considering the following points. First, patients who have an inherited deficiency of factor XII, prekallikrein or highmol-wt kininogen have no clinical bleeding problems, yet have extremely prolonged activated partial thromboplastin times. This clinical observation demonstrates that these proteins are probably not important components of blood coagulation in vivo and, therefore, should not be included in an in vivo consideration of blood coagulation. Similarly, factor XI deficiency is not always associated with bleeding and its role is therefore unclear, whereas patients with factor VII deficiency bleed abnormally, although they have an intact intrinsic system. Third, factor VII–tissue factor is known to activate not
16
Pasi
Fig. 4. Classic “waterfall” hypothesis for coagulation with the intrinsic, extrinsic, and final common pathways. Although useful in understanding coagulation pathways in in vitro clotting assays this schema does not accurately represent in vivo coagulation processes.
only factor X, but also factor IX. In the classic waterfall, this activation is not required. Fourth, tissue factor is a natural constituent of many nonvascular cells. Tissue factor on such cells is able to initiate blood coagulation. These points suggest a more central role for the tissue factor–factor VII complex. Additionally, the identification of an endogenous inhibitor of tissue factor-induced coagulation (tissue factor pathway inhibitor; TFRI) and an increased understanding of its properties have led to a questioning of traditional dogmas (7). The revised cascade is outlined in Fig. 5. This revised cascade is believed to represent more accurately the processes that occur in vivo (7–9). Coagulation is initiated when tissue damage at the site of the wound exposes blood to tissue factor, produced constitutively by cells beneath the endothelium. Factor VII binds tissue factor forming the tissue factor–factor VII complex. This complex directly activates factor X to factor Xa and some factor IX to factor IXa. It is not clear what proteases initially activate factor VII in this complex, but once coagulation is activated, other proteins are able in turn to activate factor VII, including factor Xa and VIIa. This provides a mechanism for further amplification and acceleration of coagulation.
Hemostasis
17
Fig. 5. The revised coagulation pathway. See text for details. Note the central role of TFPI and absence of contact factors.
Once formed, the complex of the factor VIIa, tissue factor, and factor Xa binds TFPI forming a quaternary complex. This TFPI binding inhibits further generation of factor Xa and factor IXa by tissue factor–factor VIIa complex. Under these conditions, further factor Xa can only be generated by the factor IXa, factor VIIIa pathway. By this point in coagulation activation, enough thrombin usually exists to be able to activate factor VIII to factor VIIIa (generated by direct activation of factor Xa by factor VII–tissue factor). With activation of factor VIIIa and using the initial generation of factor IXa (by tissue factor–factor VIIa), the factor IXa, factor VIIIa route is able to move forward and allow further factor Xa generation to proceed. Further augmentation of factor IX activation is produced via thrombin activation of the factor XI pathway. This is proposed to be a process that occurs later in coagulation. The revised cascade assumes that tissue factor–factor VIIa is responsible for the initial generation of factor Xa and thrombin, sufficient to activate factor V, factor VIII, and platelet aggregation locally. Following inhibition by TFPI, the
18
Pasi
amount of factor Xa produced is insufficient to maintain coagulation, and therefore, factor Xa generation must be amplified using factor IXa and factor VIIIa to allow hemostasis to progress to completion. Unlike the waterfall hypothesis, the revised hypothesis does not assume that initial generation of factor Xa and thrombin is the end of the hemostatic process. Rather it assumes that following initial generation the hemostatic response must be reinforced and/or consolidated by a further progressive generation of factor Xa and thrombin. This allows the hypothesis to encompass the competing influences of inhibitors of coagulation, blood flow washing away activated coagulation factors, and also thrombin-activated fibrinolysis. Additionally, it does not all factor known to be involved in blood coagulation. The revised hypothesis also allows a better explanation of bleeding seen in hemophilia A and hemophilia B. In these two conditions, bleeding occurs both spontaneously (intrinsic system) and after trauma (extrinsic system), which cannot easily be reconciled on the classical waterfall hypothesis. Using the revised schema, it is clear that without factor VIII or factor IX, bleeding will ensue because the amplification and consolidating generation of factor Xa is insufficient to sustain hemostasis. 7. Anticoagulant Pathways Natural, physiological anticoagulants fall into two broad categories, serine protease inhibitors (SERPINS) and those that neutralize specific activated coagulation factors (protein C system). These systems are of major physiological significance. They are active from the very outset of the coagulation process and often brought fully into play before fibrin deposition has occurred.
7.1. Serine Protease Inhibitors (SERPINS) Serpins include many of the key inhibitors of coagulation, such as antithrombin, heparin cofactor II, protein C inhibitor, plasminogen inactivators, and α2antiplasmin. Of these, antithrombin is perhaps the most important (10). AT is a single-chain glycoprotein of mol wt 58,000 (432 amino acids) coded for on chromosome 1. It will inhibit all the coagulation serine proteases (II, VII, IX, X, XI, XII), but it is its antithrombin and anti-Xa activity that are physiologically important. AT activity/inhibition is increased 5- to 10,000-fold in the presence of heparin and other sulfated glycosaminoglycans. Heparin is not normally found in the circulation, and physiologically, antithrombin probably binds to heparan sulfate on the vascular endothelial cells.
7.2. Protein C System Factors Va and VIIIa are powerful cofactors in coagulation-enhancing activity of serine proteases. Both Va and VIIIa are specifically inactivated by
Hemostasis
19
components of the protein C pathway. Protein C is the key inactivating enzyme (11). It is a single-chain vitamin K-dependent protein synthesized by the liver. Together with its cofactor, protein S it inactivates factors Va and VIIIa. Thrombin generated during coagulation binds to thrombomodulin (Tm) on the surface of vascular endothelial cells. Thrombin/Tm complex is a potent activator of Protein C, Tm accelerating Protein C activation approx 20,000fold. Protein C is activated by cleavage at Arg169–Leu170. Activated protein C (APC) is inhibited by the specific inhibitor, protein C Inhibitor (PCI) and since it is a serine protease, it is inhibited by antithrombin. Protein S, the cofactor for protein C, is vitamin K-dependent. It circulates in plasma as a single-chain glycoprotein of mol wt 60,000 and is synthesized by the liver, endothelial cells, and megakaryocytes. Approximately 60% of protein S is complexed to C4b binding protein, Only the unbound or “free” protein S is physiologically active. 8. Fibrinolysis Fibrinolysis principally exists to ensure that fibrin deposition in excess of that which is required to prevent blood loss from damaged vessels is either prevented or degraded and removed (12). Plasminogen, the inactive form of the enzyme plasmin, has a mol wt of 92 kDa (790 amino acids), and is synthesized in the liver and coded on chromosome 6. Plasminogen contains five homologous looped structures called “kringles,” four of which contain lysine binding sites through which the molecule interacts with its substrates and its inhibitors. Internal autocatalytic cleavage occurs during activation of plasminogen with the release of an activation peptide. This changes the N-terminus from containing a glutamic acid residue (Glu-plasminogen) to a form that contains a lysine residue (Lys-plasminogen). Conversion of plasminogen to plasmin can occur via two routes. Most activators cleave plasminogen at Arg560 to generate a two-chain protein Glu-plasmin, the two chains linked by a single disulfide bridge. The light chain is derived from the C-terminus of the protein and contains the active serine catalytic site, whereas the heavy chain is derived from the N-terminus and contains the kringle domains. Glu-plasmin is functionally inactive, since its lysine binding sites are masked. It is activated when it is converted to Lys-plasmin by autocatalytic cleavage between Lys76–Lys77. This cleavage exposes the lysine binding sites on the kringle domains, dramatically increasing the affinity of the protease for fibrin. Both Glu-plasmin and Lys-plasmin attack the Lys76-Lys77 bond to form Lys-plasminogen. This is capable of binding to the fibrin clot before it develops protease activity, and it is, therefore brought into close proximity with the physiological activators. Plasminogen is activated by a number of endogenous proteins. Of these, tissue plasminogen activator (t-PA) is perhaps the most important. t-PA is synthe-
20
Pasi
sized primarily by vascular endothelial cells although many other cells, are capable of its synthesis. t-PA is synthesized as a single-chain glycoprotein (sctPA) and contains two kringle domains through which it binds fibrin. Although sct-PA has significant proteolytic activity, its biological activity is low until bound to fibrin. When bound, its affinity for plasminogen is increased approx 400-fold. Plasmin generated is capable of cleaving sct-PA into a two-chain tPA. Two-chain t-PA has more exposed binding sites and a significantly increased activity through increased binding of fibrin and plasminogen. t-PA has a short half-life (5 min) and is rapidly cleared from the circulation. sct-PA and tct-PA are inhibited by the SERPIN plasminogen activator inhibitor type 1 (PAI-1). A second inhibitor of t-PA, plasminogen activator inhibitor type 2 (PAI-2) is found in plasma in significant amounts during pregnancy. Normally free t-PA is rapidly inactivated because of an excess of PAI1 and any free plasmin generated is rapidly inactivated by α2-antiplasmin. A second endogenous activator of fibrinolysis is urokinase. Urokinase is synthesized as an essentially inactive single-chain protein (scu-PA/pro-urokinase). It must be converted to the two-chain form (tcu-PA or U-PA) before it is functionally active. scu-PA is converted to tcu-PA (U-PA) by plasmin and kallikrein. tcu-PA activates plasminogen to plasmin by a cleaving at Arg560– Val561. Inhibition of the active enzyme occurs via PAI-1, PAI-2, and also by protease nexin 1. Although urokinase can activate plasminogen in plasma it is thought that its major role is an extravascular activator of plasminogen, especially where tissue destruction or cell migration occurs. 9. Summary Hemostasis is clearly a complex interactive system involving numerous components. The revised hypothesis of coagulation has helped to unify the whole process. The recent improved understanding has in part been brought about by improved knowledge of the individual components of the different elements of the overall process of hemostasis and cellular repair. Although increasing by appreciated to be complex, attempts have been made to model and reproduce this system in vitro to validate research findings and increase understanding of the interactions. For all its complexity, many of these models of hemostasis, both laboratory and mathematical, have proven to be useful, and show that for all the interactions and complexity of different systems combined with flow and cellular interaction, we do have a considerable understanding of the processes of hemostasis. Suggested Reading Bloom, A. L., Forbes, C. D., Thomas, D. P., and Tuddenham, E. G. D. (1994) Haemostasis and Thrombosis, 3rd ed. Churchill Livingstone, Edinburgh, UK. Tuddenham, E. G. D. and Cooper, D. N. The Molecular Genetics of Haemostasis and its Inherited Disorders. Oxford Medical Publications, Oxford, UK.
Hemostasis
21
References 1. Cines, D. B., Pollak, E. S., Buck, C. A., Loscalzo, J., Zimmerman, G. A., McEver, R. P., Pober, J. S., Wick, T. M., Konkle, B. A., Schwartz, B. S., Barnathan, E. S., McCrae, E. R., Hug, B. A., Schmidt, A. S., and Stern, D. M. (1998) Endothelial cells in physiology and in the pathophysiology of vascular disorders. Blood 91, 3527–3561. 2. Gerwitz, A. (1995) Megakaryocytopoiesis: the state of the art. Thomb. Haemostasis 74, 204–209. 3. White, J. G. (1994) Anatomy and structural organisation of the platelet, in Hemostasis and Thrombosis: Basic Principles and Clinical Practice (Coleman, R. W., et al., eds.), 3rd ed., J. B. Lippencott Co., Philadelphia, PA. 4. Levy-Toledano, S., Gallet, C., Nadel, F., Bryckaert, M., Macloug, J., and Rosa, J.-P. (1997) Phosphorylation and dephosporylation mechanisms in platelet function: a tightly regulated balance. Thromb. Haemostasis 78, 226–233. 5. Macfarlane, R. G. (1964) An enzyme cascade in the blood clotting mechanism and its function as a biochemical amplifier. Nature 202, 498,499. 6. Davie, E. W. and Ratnoff, O. D. (1964) Waterfall sequence for intrinsic blood clotting. Science 145, 1310–1312. 7. Broze, G. J. Jr., Warren, L. A., Novotny, W. F., Higuchi, D. A., Girrad, J. J., and Miletich, J. P. (1988) The lipoprotein associated coagulation inhibitor that inhibits the factor VII-tissue factor complex also inhibits factor Xa: insight into its possible mechanism of action. Blood 71, 335–343. 8. Furie, B. and Furie, B. C. (1992) Molecular and cellular biology of blood coagualtion. N. Engl. J. Med. 326, 800–806. 9. Rapaport, S. I. and Rao, L. V. (1995) The tissue factor pathway: how it has bevome a “prima ballerina.” Thromb. Haemostasis 74, 7–17. 10. Perry, D. J. (1994) Antithrombin and its inherited deficiencies. Blood Rev. 8, 35–37. 11. Dadhlback, B. (1995) New molecular insights into the genetivcs of thrombophilia: resistance to activated Protein C caused by the Arg506 to Gln mutation in factor V as a pathogenic risk factor for venous thrombosis. Thromb. Haemostasis 74, 139–148. 12. Collen, D. and Lijen, H. R. (1991) Basic and clinical aspects of fibrinolysis and thrombolysis. Blood 78, 3114–3124.
Isolation of DNA and RNA
25
2 Isolation of DNA and RNA David J. Perry 1. Introduction Blood samples for most coagulation tests are collected into 3.8% trisodium citrate in a ratio of 1 part anticoagulant to 9 parts blood. Whole-blood samples for DNA isolation can be stored at –50°C and the DNA prepared at a later stage. A more convenient method requiring less freezer space is to store buffy coats—the interface between the red cells and the plasma that is seen following centrifugation of whole blood. This latter method also allows isolation of the plasma fraction. There are numerous methods for isolating DNA. The methods described in this Chapter are routinely used to prepare high molecular weight DNA for Southern blot analysis or for amplification by the polymerase chain reaction (PCR) technique. The first method employs a phenol/chloroform step to denature proteins, whereas the second employs a salt precipitation step to precipitate proteins. Both methods can be readily adapted to processing small-volume samples (e.g., 100 µL). The first method has been successfully used to isolate DNA from a wide variety of cells, including whole blood, buffy coats, platelets, various cell lines, spleen, lymph nodes, and bone marrow. As with the isolation of DNA, there are many techniques for isolating RNA from a wide variety of cells, some of which can be adapted to allow the simultaneous isolation of both RNA and DNA. Many of the methods in current use employ strong chaotropic agents (e.g., guanidinium thiocyanate) to disrupt cellular membranes and inactivate intracellular RNases. The method described has been in routine use for several years and generates high-quality RNA suitable for a wide variety of uses. A number of commercial kits are now available for rapid RNA isolation, e.g, RNeasy™ kit (Qiagen Ltd, UK). Although often more expensive than “in-house” methods, these kits are capable of isolating highFrom: Methods in Molecular Medicine, Vol. 31: Hemostasis and Thrombosis Protocols Edited by: D. J. Perry and K. J. Pasi © Humana Press Inc., Totowa, NJ
25
26
Perry
quality RNA from a wide variety of cells, including whole-blood, leukocyte buffy coats, platelets, and tissue-culture cells. Methods are also included in this chapter for the isolation of lymphocytes and platelets from whole blood. 2. Materials Molecular-grade reagents should be used whenever possible. Sterile disposable polypropylene is used for most steps, but if glassware is used, it should be baked at 280°C for at least 3 h to inactivate any RNases.
2.1. Isolation of Mononuclear Cells from Whole Blood 1. Phosphate-buffered saline: 120 mM NaCl, 2.7 mM KCl, 10 mM phosphate buffer, pH 7.4. Autoclave before use and store at 4°C. 2. Density gradient medium, e.g., Histopaque 1077 (Sigma).
2.2. Isolation of Platelets from Whole Blood 1. Phosphate-buffered saline: 120 mM NaCl, 2.7 mM KCl, 10 mM phosphate buffer, pH 7.4. Autoclave before use and store at 4°C. 2. 38–40% Bovine serum albumin (BSA).
2.3. DNA Isolation Using the Phenol/Chloroform Method (1) 1. Sucrose lysis buffer: sucrose 0.32 M, 1% (v/v) Triton X-100, 5 mM MgCl2, 10 mM Tris-HCl, pH 7.5. Store at 4°C. 2. TE: 10 mM Tris-HCl, pH 8.0, 1 mM EDTA, pH 8.0. Autoclave before use. 3. Nuclear lysis buffer: 0.32 M lithium acetate, 2% (w/v) lithium dodecyl sulfate (LiDS), 10 mM Tris-HCl, pH 8.0, 1 mM EDTA, pH 8.0. Store at room temperature. 4. Phenol: Equilibrated phenol for both DNA and RNA isolation can be purchased commercially (e.g., CamLabs, Cambridge, UK) and avoids many of the potential risks associated with its use. If crystalline phenol is used, 0.1% hydroxyquinoline should be added as an antioxidant and it should be extracted initially with 1 M Tris-HCl, pH 8.0, and then repeatedly with 0.1 M Tris-HCl, pH 8.0, until the pH of the aqueous phase is 8.0 (2). Phenol should be stored at 4°C. 5. Phenol:chloroform: A 1:1 mixture phenol and chloroform is made by mixing equal volumes of chloroform and equilibrated phenol. This may be purchased ready prepared from a number of manufacturers (e.g., CamLabs). Store at 4°C.
2.4. DNA Isolation Using the Salt-Precipitation Method (3) 1. Sucrose lysis buffer–see Subheading 2.3.1. 2. TKM 1: low-salt buffer–10 mM Tris-HCl, pH 7.6, 10 mM KCl, 10 mM MgCl2, 2 mM EDTA. 3. TKM 2: high-salt buffer–10 mM Tris-HCl, pH 7.6, 10 mM KCl, 10 mM MgCl2, 0.4 M NaCl, 2 mM EDTA. 4. 6 M NaCl: This is a supersaturated solution.
Isolation of DNA and RNA
27
5. 20% SDS: Dissolve 20 g SDS in 100 mL distilled water at 65°C. Store at room temperature.
2.5. Isolation of Total Cellular RNA (4) 1. Solution D: 50 g guanidinium thiocyanate (GTC), 58.6 mL of distilled water, 3.52 mL 0.75 M trisodium citrate, 5.28 mL 10% sarkosyl NL30. Incubate at 65°C to dissolve the GTC. Store at room temperature for up to 3 mo. Immediately before use, add 3 5 µL of β-mercaptoethanol to 5 mL of solution D. 2. 2 M NaOAC, pH 4.0. Store at 4°C. 3. Phenol:chloroform (4:1): water-saturated phenol, pH 4.0 chloroform (4:1). This can be purchased commercially (e.g., CamLabs). Store at 4° C.
3. Methods 3.1. Isolation of Mononuclear Cells from Whole Blood 1. Dilute 10–20 mL of whole blood 1:1 with ice-cold PBS. 2. Carefully layer onto an equal volume of the appropriate density gradient medium, e.g., Histopaque 1077, in a 30-mL sterile tube. 3. Centrifuge at 600g for 30 min at 22°C. 4. Carefully collect the cellular interface using a sterile Pasteur pipet and re-suspend the cells in 50 mL of ice-cold PBS. 5. Centrifuge at 800g for 30 min at 22°C to pellet the cells. 6. Re-suspend the cells in 1 mL of ice-cold PBS and store on ice until use.
3.2. Isolation of Platelets from Whole Blood (see Note 8) 1. Platelet rich plasma (PRP) is prepared from whole blood by centrifuging 10 mL of whole blood at 600g for 10 min at 22°C. (The leukocyte count of PRP is generally <0.2 × 109/L if carefully prepared.) 2. Carefully aspirate the PRP and layer onto 1 mL of 38% or 40% albumin. 3. Centrifuge at 1800g for 20 min at 22°C. The albumin acts as a cushion onto which the platelets will form a lawn. 4. Collect the platelet lawn and carefully resuspend in 10 mL of PBS. 5. Centrifuge at 1800g for 20 min at 22°C to pellet the platelets. 6. Carefully decant the supernatant and resuspend the platelet pellet in 1 mL of PBS.
3.3. DNA Isolation Using the Phenol/Chloroform Method (1) 1. Add 10 mL of anticoagulated whole blood to 90 mL of ice-cold sucrose lysis buffer, invert several times to mix and store on ice for 15 min. See Note 1 for use of smaller volumes. 2. Centrifuge the samples at 1000g for 10 min at 4°C. Decant the supernatant into a beaker and vigorously resuspend the pellet in 4.5 mL of TE, pH 8.0. The supernatant is potentially infectious and should be disposed of accordingly. 3. Lyse the cell pellet by adding 10 mL of nuclear lysis buffer and gently rotating the sample on a mechanical rotator at approx 250 rpm until a clear viscous solution is obtained. Samples can be frozen at this stage for processing at a later date.
28
Perry
4. Add 5 mL of buffer-saturated phenol/chloroform and mix on a mechanical rotator for 10 min (see Notes 2 and 3). 5. Centrifuge the samples at 1000g for 5 min at 20°C to separate the phases. Carefully remove the upper aqueous phase to a clean tube using a wide-bore pipet. Avoid aspirating any of the lower phase which contains phenol/chloroform and denatured proteins. 6. Add 5 mL of chloroform to the aqueous phase and mix on a mechanical rotator for 5 min. 7. Centrifuge the samples at 1000g for 5 min at 20°C to separate the phases. Carefully remove the upper aqueous phase to a clean tube using a wide-bore pipet. 8. Precipitate the DNA by adding 21/2 vol of ethanol and gently inverting the tube. Collect the DNA onto a sealed sterile glass Pasteur pipet, briefly rinse in 70% ethanol and re-suspend in 50 µL of sterile, distilled water or TE, pH 8.0. The DNA samples are stored at 4°C for 2–3 d to allow the DNA to go into solution and then stored at –20°C.
3.4. DNA Isolation Using the Salt-Precipitation Method (3) 1. Add 5 mL of whole blood to 20 mL of sucrose lysis buffer and mix by inverting several times. 2. Centrifuge the samples at 1000g for 10 min at 4°C. Decant the supernatant into a beaker and add 5 mL of TKM 1 to the pellet. Centrifuge the samples at 1000g for 10 min at 4°C. 3. Decant the supernatant and resuspend the pellet in 0.8 mL of TKM 2. Transfer the content into 2-mL labeled Eppendorf. Add 25 µL of 20% SDS to the tube and gently mix. Incubate at 57°C in a waterbath/heating block for 30 min. 4. Transfer the Eppendorf(s) into a benchtop rack and add 300 µL of 6 M NaCl, mix thoroughly. Centrifuge in a benchtop microfuge at maximum speed (13,000 rpm) for 10 min. 5. Transfer the supernatant into a clean 2-mL Eppendorf and add an equal volume of chloroform and mix by inversion. Centrifuge at 7,000 rpm for 5 min. 6. Transfer the supernatant into a sterile 20-mL tube and place on ice. Add an equal volume of ice-cold absolute ethanol and gently invert to precipitate the DNA. Collect the DNA onto a sealed sterile glass Pasteur pipette, rinse briefly in 70% ethanol and re-suspend in 500 µL of sterile, distilled water or TE, pH 8.0. The DNA samples are stored at 4°C for 2–3 d to allow the DNA to go into solution and then stored at –20°C.
3.5. Isolation of Total Cellular RNA (4) (see Notes 5 and 6) 1. Reusupend the mononuclear pellet from 10 mL of whole blood in 1.6 mL of solution D and vortex vigorously for 30 s. Split into 2 × 800 µL aliquots in 2-mL Eppendorfs (see Note 7). 2. To each tube add 80 µL of 2 M NaOAc, pH 4.0 and vortex briefly to mix. 3. Add 800 µL water-saturated phenol, pH 4.0 to each tube and vortex briefly to mix. 4. Add 160 µL chloroform:isoamyl alcohol (24:1) to each tube and vortex briefly to mix. Leave one ice for 15 min.
Isolation of DNA and RNA
29
5. Centrifuge in a benchtop microfuge at 13,000 rpm for 10 min. Collect the upper aqueous layer and transfer to a clean 2-mL Eppendorfs. 6. Add 800 µL of propan-2-ol to each tube and place at –20°C for 1–2 h (or overnight). 7. Centrifuge in a benchtop microfuge at 13,000 rpm for 10 min. Remove the supernatant and resuspend each pellet in 300 µL of solution D. Pool pairs of tubes. 8. Add 600 µL of propan-2-ol and place at –20°C for 1–2 h. 9. Centrifuge in a benchtop microfuge at 13,000 rpm for 10 min. Remove the supernatant and resuspend the pellet in 400 µL of TE, pH 8.0. 10. Check the yield and quality of the RNA by electrophoresing 5–10 µL in a 1.5% agarose gel in 1X Trios-Borate-EDTA (TBE). The 28S and 18S (and sometimes the 5S) ribosomal bands should be clearly visible.
For long-term storage, the RNA should be precipitated by adding 21⁄2 vol of ethanol and 1/10 vol of 3 M NaOAc and then placed at –70°C. 4. Notes 1. For packed cells, i.e., samples in which the plasma has been removed, 5 mL of packed cells is added to 45 mL of cell lysis buffer. Whole blood samples which have been frozen are thawed at 37°C and the tubes rinsed thoroughly with cell lysis buffer. For small volumes (100–200 µL) of blood, packed cells, leukocyte buffy coats, and so on, the cells should be lysed in 1.5 mL of cell lysis buffer, centrifuged in a benchtop microfuge at 12,000 rpm for 30 s, the supernatant carefully aspirated, and the lysis step repeated. The pellet should be resuspended is 100–200 µL of TE, pH 8.0 and the nuclei lysed by adding twice the volume of nuclear lysis buffer and vortexing the sample for 10–20 s. The lysed cells are then extracted once with 200 µL of phenol-chloroform and once with 200 µL of chloroform and the DNA precipitated by adding either 21/2 volume of ice-cold ethanol or an equal volume of prop-2-ol. The DNA is collected by centrifugation at 12,00 rpm in a microfuge for 30 s, washed carefully in 1 mL of 70% ethanol, allowed to dry at room temperature and then re-suspended in 50 µL of TE, pH 8.0. 2. Isoamyl alcohol (IAA) is commonly included in preparations of chloroform as a 24:1 (v/v) mixture to prevent foaming. However, this is not a problem using the techniques described and is not routinely included. 3. Phenol is extremely toxic and should be handled with care in a fume hood, wearing suitable protective clothing including goggles. 4. All solutions for RNA isolation must be treated with DEPC (diethylpyrocarbonate). Tris-containing solutions cannot be treated in the manner and should be made using DEPC-treated water and then autoclaved. 5. To make DEPC-treated water add 1 mL of DEPC to 1 L of distilled water. Incubate at 37°C overnight and then autoclave. Store at room temperature. 6. DEPC is a potential carcinogen and must be handled with care. 7. Cells may be lysed in Solution D and then stored at –70°C until convenient. We have combined with subsequent processing by the RNeasy™ kit, with great success.
30
Perry
8. Various commercial density gradient media, e.g., Nycodenz, which permit the isolation of a highly purified platelet fraction from whole blood.
References 1. Bell, G. I., Karman, J. H., and Rutter, W. J. (1981) Polymorphic DNA region adjacent to the 5' end of the human inuslin gene. Proc. Natl. Acad. Sci. USA 78(9), 5759–5763. 2. Maniatis, T., Fritsch E. F., and Sambrook, J. (1989) Molecular Cloning: A Laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 3. Lahiri, D. K. and Nurnberger, J. I. (1991) A rapid non-enzymatic method for the preparation of HMW DNA from blood for RFLP studies. Nucleic Acids Res. 19, 5444. 4. Chomczynski, P. and Sacchi, N. (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162, 156–159.
Amplification of DNA and RNA by PCR
31
3 Amplification of DNA and RNA by PCR David J. Perry 1. Introduction The polymerase chain reaction (PCR) has revolutionized many areas of medicine, including hemostasis. Although this volume is not devoted to PCR, many of the chapters employ the technique at some point to amplify specific DNA or RNA sequences. This chapter, therefore, provides a brief outline of the techniques and methods for the amplification of both DNA and RNA. It should be remembered that no single protocol will be suitable for all PCR reactions and that optimization of the reaction is necessary whenever a new PCR reaction is undertaken. Further information on PCR can be found in one of the many textbooks on the subject that are available. PCR involves a complex series of chemical reactions in which a defined sequence of DNA (or a cDNA) is enzymatically amplified, resulting in the accumulation of many millions of copies of the original sequence. In each cycle, both strands are templates for the generation of two new duplex molecules. Repeated cycles of amplification, therefore, lead to a theoretical doubling of the number of target molecules in each round of synthesis. Each cycle of amplification is initiated by melting of the double-stranded DNA template (denaturation) to generate a single-stranded DNA template, followed by the annealing of short synthetic oligonucleotide primers that flank the sequence of interest. Finally, an in vitro DNA synthesis extension using a thermostable DNA polymerase, copies the DNA template, generating a double-stranded DNA molecule. For the amplification of RNA sequences, an additional step is required to convert the single-stranded RNA into a single-stranded cDNA, which is then suitable for amplification by PCR.
From: Methods in Molecular Medicine, Vol. 31: Hemostasis and Thrombosis Protocols Edited by: D. J. Perry and K. J. Pasi © Humana Press Inc., Totowa, NJ
31
32
Perry
2. Materials All materials/reagents should be prepared with sterile distilled water and reserved for PCR. Aerosol resistant tips and dedicated pipets minimize the risk of contamination.
2.1. Amplification of DNA 1. Genomic DNA: 100–500 ng (see Note 1). 2. 20 mM dNTP mix: A mix of dNTPs (dATP, dCTP, dGTP, and dTTP) is prepared in distilled water and stored at –40°C. The initial concentration of each dNTP in the reaction mix (assuming a 100 µL reaction) is 200 µM, i.e., 20 mM diluted 100-fold. Ready prepared stocks of dNTPs are available from many sources and are convenient and reliable. These must be diluted and mixed before use to generate a master mix. 3. 10X PCR buffer (see Note 2): There are a numbers of buffers for use in PCR and many of these are dependent upon the specific thermostable DNA polymerase. Buffers are generally made up as a 10X stock, divided into 500-µL aliquots and stored at –20°C to –70°C until required. Buffers are frequently supplied by the manufacturer with a specific DNA polymerase. In general we find that one of the following buffers generates excellent results: Buffer 1 (10X): 100 mM Tris-HCl, pH 8.4, 500 mM KCl, 1% Triton X-100 Buffer 2 (10X): 160 mM (NH4)2SO4, 670 mM Tris-HCl, pH 8.8, 0.1% Tween-20 4. 25 mM MgCl2: Many 10X buffers include MgCl2 at a concentration of 15 mM (final concentration 1.5 mM). However, in some cases adjustment of the Mg concentration may increase the yield and/or specificity of the final PCR product. We therefore routinely add the Mg separately (see Notes 3 and 4). 5. Synthetic oligonucleotide primers: Diluted in water to 100 pmoles/µL (see Note 5). 6. Thermostable DNA polymerase diluted to 1 U/µL in 1X PCR buffer (see Note 6). 8. DMSO: DMSO to a final concentration of 10% is included in some amplification reactions (see Note 7). 7. Mineral oil (Sigma). 9. Thermal cycler, e.g., Perkin-Elmer.
2.2. Reverse Transcription and Amplification of RNA 2.2.1. Reverse Transcription of RNA Molecular biology grade reagents and RNAse-free sterile disposable plasticware should be used wherever possible. All chemicals/reagents should be reserved for RNA use only. All solutions should be DEPC-treated or made from DEPC-treated solutions. Disposable gloves should be worn at all times. 1. 5–50 ng of total cellular RNA or X-Xng of mRNA (see Note 8). 2. Reverse transcription primer: 50 pmoles/µL. This may be the downstream amplification primer for the subsequent PCR or an Oligo (dT)15-17 primer (see Note 9). 3. 20 mM dNTPs (dATP, dCTP, dGTP, dTTP): Make up at a 20 mM stock solution and store at –20°C to –70°C.
Amplification of DNA and RNA by PCR 4. 5. 6. 7. 8.
33
10X PCR buffer: 100 mM Tris-HCl, pH 8.4, 500 mM KCl (see Note 10). 25 mM MgCl2. AMV (Avian myeloblastosis virus) reverse transcriptase: 25 U/µL. RNAse inhibitor: RNAsin 5 U/µL (Promega). DEPC-treated water (see Note 11).
3. Methods 3.1. PCR Amplification of DNA Many PCR reactions require optimization to ensure efficient and specific amplification of the target DNA sequence. The following protocol provides a starting point that has proven successful in our hands for the amplification of many target sequences. Modifications and optimization of the reactions are covered in the notes section. In a 0.5-mL sterile, thin-walled PCR tube, combine: 1. 10 µL of 10X PCR buffer. 2. 6 µL 25 mM MgCl2. This results in a final concentration of magnesium in a 100 µL PCR reaction volume of 1.5 mM. If a magnesium-containing PCR buffer is used, this step should be omitted. 3. 1 µL of 20 mM dNTP stock: Final concentration of each dNTP is 200 µM. 4. 2 µL of primer mix containing 100 pmoles of each amplification primer (see Note 5). 5. XX µL of sterile, distilled water. The precise volume is dependent upon the actual concentration of the DNA, dNTPs and primers but the final volume of the entire reaction will be 100 µL. The water should be added prior to step 6. 6. Place on the surface of a UV transilluminator for 10 min. 7. Add X µL of DNA (~500 ng–1 µg). The precise volume is dependent on the DNA concentration. 8. Add 1–2 U of a thermostable DNA polymerase. 9. Mix gently and spin briefly in a microcentrifuge to pellet any drops of fluid that may be adherent to the sides of the tube. 10. Overlay with 100 µL of mineral oil and place in a programmable heating block preheated to 94°C. In some PCR blocks, the use of a heated lid prevents evaporation and therefore eliminates the need for oil. 11. Amplification: An initial denaturation is usually carried out at 94°C for 5 min (see Note 12). This ensures that all the double-stranded DNA is single-stranded prior to amplification. The reaction is then cooled as rapidly as possible to the annealing temperature, which allows the single-stranded DNA template to bind to the amplification primers. The annealing temperature is dependent on many variables, including the length and sequence of the amplification primers, but a useful starting point if using 20-mer amplification primers is 50°C. The tubes should remain at this temperature for 5 s. The temperature is then raised to the extension temperature usually 72–74°C. The extension times depend on the size of the fragment being amplified, but a useful starting point is to assume an exten-
34
Perry
sion rate of 1 kb/min. In practice, much shorter extension times can be used without any problem. Finally the temperature is raised to 94°C to denature the doublestranded DNA. The cycle is then repeated. Most templates will require 30–40 rounds of amplification. 12. Following amplification, the PCR reaction is carefully removed to a clean tube, taking care not to carry over any oil. 5–10 µL of each amplification is then run on an agarose gel to check the efficiency and specificity of the reaction.
3.2. Amplification of Total Cellular RNA The amplification of RNA is preceded by a reverse transcription step, which generates a single-stranded DNA molecule that is complementary to the original RNA. In the subsequent amplification reaction, the single-stranded DNA is converted to a double-stranded DNA molecule by the action of the DNA polymerase.
3.2.1. cDNA Synthesis In a sterile, 0.5-mL Eppendorf, combine: 1. 100–500 ng of total cellular RNA. The precise volume will depend on the concentration of the RNA. 2. 20 pmoles of the downstream amplification primer or 50 pmoles of an oligo (dT)15–17 primer. If the downstream amplification primer is used as a primer for the reverse transcription, it should be purified before use either by HPLC or by gel electrophoresis (see Note 13). 3. 200 µmoles of each dNTP (dATP, dCTP, dGTP, dTTP). 4. 2 µL of 10X PCR buffer (100 mM Tris-HCl, pH 8.3, 500 mM KCl). 5. 6 µL of 25 mM MgCl2. 6. Incubate at 65°C for 10 min, then place on ice and add 20 U of RNAsin and 20 U of AMV reverse transcriptase. 7. DEPC-treated sterile water to 20 µL. 8. Incubate at 20°C for 10 min, 42°C for 60 min, and finally at 95°C for 10 min to inactivate the reverse transcriptase. 9. Following reverse transcription, samples are stored on ice until required or frozen at –80°C.
3.2.2. PCR Amplification of Single-Stranded cDNA Combine the following in a 0.5-mL thin-walled, sterile Eppendorf: 1. 2–20 µL of the reverse transcription reaction. The precise volume depends on the frequency of the particular RNA species that is being amplified. For rare RNA species, the entire reverse transcription reaction may be required. 2. 8 µL of 10X PCR buffer (see Note 14). 3. 2 µL 25 mM MgCl2. 4. 100 pmoles of each amplification primer.
Amplification of DNA and RNA by PCR
35
5. Sterile water to 100 µL. 6. The amplification reactions are heated to 100°C for 5 min and then allowed to cool to 20°C for 2 min to allow the primer to anneal to the single-stranded DNA. This is conveniently performed in the PCR block. 2.5 U of a thermostable DNA polymerase is then added to each tube, e.g., Amplitaq, and the samples overlaid with 100 µK of light mineral oil. The samples are then incubated at 70°C for 10 min to allow the generation of a double-stranded DNA molecule, followed by 40 cycles of PCR. 7. Following amplification 8–10 µL of each reaction is run on agarose gel to check the efficiency and specificity of the reaction.
4. Notes 1. a. PCR can be used to amplify DNA from many sources, e.g., genomic DNA, plasmid DNA, bacterial DNA, and so on. For the amplification of cloned DNA as little as 10–20 ng may be sufficient. As a general guide, the amount of DNA used as a template should be increased as the complexity of the source increases. b. The fidelity of an amplification reaction is dependent on a number of variables including the DNA concentration. Any errors introduced in the first few cycles will be amplified in subsequent cycles. The fraction of the final product that contains a mutation is inversely proportional to the number of initial DNA molecules. If the number of starting DNA molecules is small, it may be advisable to use a DNA polymerase with proofreading ability. 2. a. When all else fails, the following buffer is often useful: 670 mM Tris-HCl pH 8.8, 166 mM (NH4)2SO4, 67 mM MgCl2, 1.5 mg/mL bovine serum albumin and 100 mM b-mercaptoethanol. Store the inorganic solution at room temperature and add the BSA and b-ME immediately before use. The high concentration of Mg2+ often results in nonspecific products. b. Many manufacturers include gelatin (final concentration 0.01%) or Triton X100 (final concentration 0.1%) in the buffer to stabilize the enzyme during thermal cycling. Inclusion of such components may increase the efficiency of the amplification reaction. 3. a. dNTPs bind to Mg2+ in a 1:1 molar ratio, i.e., 0.8 mM dNTPs will bind 0.8 mM Mg2+. Therefore, in an amplification mix containing a final Mg2+ concentration of 1.5 mM, only 0.7 mM Mg2+ (1.5–0.8 mM) is “free” and active as a cofactor for the DNA polymerase. If the concentration of dNTPs is increased, e.g., in long-range PCR, then the amount of bound Mg2+ increases and the functionally active free Mg2+ decreases. In such cases there may be insufficient Mg2+ for the enzyme to function. It is important, therefore, that if the concentration of dNTPs in a reaction mix is increased, the concentration of Mg2+ is also increased. b. To prevent misincorporation of nucleotides, it is important the all four dNTPs are present in equal concentration. 4. The concentration of Mg2+ in the PCR mix is one of the key variables affecting both yield and specificity. High Mg2+ concentrations lead to nonspecific
36
Perry
amplification by stabilizing priming at incorrect template sites. Furthermore, high Mg2+ concentrations may also stabilize double-stranded DNA therefore reducing the yield of the final PCR product. Low Mg2+ concentrations may also affect the yield of the final PCR product as Mg2+ is required as a cofactor for the DNA polymerase (see Note 3). 5. a. Primer design has become greatly simplified by development of various computer programmes, e.g., Lasergene and Oligo 4. and in our experience very few primer pairs fail to work having been designed using such programmes. b. The length of a primer can vary between 17–26mers. For PCR from complex sources such as genomic DNA, 20–26mers allow amplification of specific sequences. In contrast if the template is simpler then shorter primers, e.g., 17mers may suffice. There are a number of rules that should be observed when designing primers, e.g., GC content, avoiding 3' complementary ends, and so on. For a guide to the design of primers, the reader is referred to one of the many excellent PCR primers available. c. The concentration of primers in the PCR mix should be similar unless asymmetric PCR is being performed. Primers are usually received resuspended in distilled water and their concentration is given. If primers are received freeze dried they should be resuspended in 100–500 µL of distilled water. If the concentration of the primers is unknown this can be calculated by measuring their optical density (OD) at 260nm (1 OD260 = 40 µg of single-stranded oligonucleotide). We routinely mix relevant primer pairs, such that 2 µL of the mix contain 100 pmoles of each primer and scale up the mix so that we have enough of the primer mix for 50 or 100 amplifications, e.g.: Primer A: Concentration = 400 µM (= 400 pmol/µL) Primer B: Concentration = 500 µM (= 500 pmol/µL) Therefore, a mix comprising 0.25 µL of Primer A + 0.2 µL of Primer B + 1.55 µL of distilled water will contain 100 pmol of each primer in a final volume of 2 µL. To make sufficient primer mix for 100 separate amplifications these volumes are multiplied by 100, i.e., 25 µL of Primer A + 20 µL of Primer B + 155 µL of water. 6. Thermostable DNA polymerases isolated from a variety of bacteria are now available for use in the PCR process. In many cases the choice is dictated by availability and price. However, some DNA polymerases, e.g., “Vent” and “Pfu,” have a 3'–5' proofreading exonuclease activity that can significantly reduce the number of misincorporation errors that occur during PCR. Such enzymes are, extremely useful if the number of starting template molecules are small or if the final PCR product is to be cloned and expressed. Enzymes with 3'–5' proofreading exonuclease activity should not be used for allele-specific amplification and similarly they cannot be used (without modification of the final PCR product) if the amplified product is to be cloned using a T-vector, e.g., “TA Cloning System” (Invitrogen) as the product contains no overhangs. 7. DMSO to a final concentration of 10% may increase the efficiency and/or specificity of some DNA polymerases. However, there are some reports that DMSO
Amplification of DNA and RNA by PCR
8.
9.
10.
11.
12.
13.
37
may be inhibitory to certain DNA polymerases and it is not, therefore, routinely included in our amplification reactions. The quality of the RNA is crucial in RT-PCR. Techniques for isolating RNA from a wide variety of cells are now available. Total cellular RNA is adequate for the vast majority of experiments and rarely do we find any necessity to isolate mRNA species. Reverse transcription of RNA using the downstream amplification primer used subsequently for the PCR is routinely used and generates excellent results for a wide variety of templates. However, Oligo(dT)15–17 (50 pmol) can also be used with similar results. We do not routinely use an RT-specific buffer but instead the KCl-based PCR buffer. For most situations this appears to work satisfactorily. For some experiments it may be necessary to use an RT-specific buffer. Such buffers are frequently supplied with the reverse transcriptase enzyme Diethyl pyrocarbonate (DEPC) is a suspected carcinogen and should be used with care in a fume hood. DEPC should not be used directly in Tris-based solutions but such solutions can be made with DEPC-treated water (see Chapter 1). The efficiency and specificity of the PCR can often be improved by the use of a “hot start.” A “hot start” involves omitting a key component from the PCR mix, e.g., DNA polymerase, and denaturing the sample at 94–100°C for 5 minutes. The missing component is then added directly to the tube and then overlaid with mineral oil or the heated lid lowered. Oligonucleotides for use in reverse transcription experiments are purified before use. This is most easily achieved by HPLC purification but an alternative approach involves electrophoresis in 20% denaturing polyacrylamide gels followed by elution. 50 cm × 20 cm × 1 mm 20% polyacrylamide gels are cast using 72 g urea, 75 mL of 40% acrylamide (19:1 acrylamide/bisacrylamide) and polymerized with 150 µL of TEMED and 150 µL of 25% ammonium persulphate (gel volume = 150 mL). A 5-well comb with 200 µL wells is used. Gels are pre-run at 60 W for 30 min before use. Approximately 0.02 µmol of crude oligonucleotide is mixed with 0.5 vol of loading buffer (95% formamide, 20 mM EDTA, 0.05% bromophenol blue, 0.05% xylene cyanole) in a final volume of 100–150 µL, incubated at 100°C for 5 min, and loaded onto the gel. Gels are run at 60 W constant power in 1X TBE until the bromophenol blue dye front has reached the end of the gel. The plates are then separated and the DNA visualized by UV shadowing. Bands of the correct size are excised, placed in a 2-mL Eppendorf, and crushed with a pipet tip. 1.5 mL of water is added and the DNA eluted into the distilled water by vigorous shaking (in an orbital shaker at 250 rpm) at 37°C for 24 h. The DNA is then placed in dialysis tubing (SpectraPor No. 6 dialysis tubing) and dialyzed against distilled water for 48 h at 4° C, changing the water every 12 h. The oligonucleotide is then freeze-dried, re-suspended in 50–100 µL of distilled water, and quantitated by measuring its OD260. From the formula: (OD260 × dilution × 40/309 × mer) × 103
38
Perry
where “mer” is the length of the oligonucleotide and “dilution” the dilution of the oligonucleotide prior to measuring its OD260, the concentration of the oligonucleotide can be established. So, for example, if 20 µL of a 26-mer oligonucleotide is diluted to 1 mL and its OD260 is 0.449 then the concentration of the oligonucleotide is 118 µM (0.118 mM), which equals 118 pmol/µL. 14. This is usually the same buffer used in the reverse transcription reaction, unless a reverse transcriptase specific buffer has been used.
Suggested Reading Erlich, H. A. (1989) PCR Technology: Principles and Applications for DNA Amplification. Stockton Press, London. McPherson, M. J., Hames, B. D., and Taylor, G. R (1995) PCR 2: A Practical Approach. IRL, Oxford, UK. White, B. A. (1993) PCR Protocols. Humana Press, Totowa, NJ.
Direct Sequencing
39
4 Direct Sequencing of PCR Products David J. Perry 1. Introduction Sequencing is an increasingly important part of the analysis of a polymerase chain reaction (PCR) product and is used in many areas of hemostasis. The protocols described in this chapter have been used to sequence many different PCR templates and provide high-quality, reproducible sequence data. In general, the most important part of sequencing a PCR product is the quality of the DNA template and in particular ensuring that it is free from any contaminating amplification primers or dNTPs. Residual amplification primers that may be present in a sequencing reaction can act as sequencing primers, making the final sequence unreadable. A number of approaches have been taken to try to overcome this problem. Initially, PCR products were cloned and then sequenced. However, cloning is time-consuming even with the use of PCR-specific cloning vectors, and furthermore, a single clone provides sequence data on only a single DNA molecule. Subsequent developments allowed “direct” sequencing of amplified DNA following purification of the PCR products. There are countless physical methods for purifying a PCR product prior to sequencing, e.g., GeneClean™, Sephadex G50 chromatography, agarose gel electrophoresis, and so on. To some extent the success of these methods is dependent on the size of the PCR product. GeneClean, for example is ideal for purifying PCR products that are greater than 500 bp in length but is of little value for products that are less than 400 bp. An entirely different approach to generating single-stranded DNA involves the use of asymmetric PCR in which one of the amplification primers is present in limited amounts, such that one primer is exhausted and linear amplification then takes place or alternatively the PCR product forms the basis of a second PCR in which only one amplification primer is present. From: Methods in Molecular Medicine, Vol. 31: Hemostasis and Thrombosis Protocols Edited by: D. J. Perry and K. J. Pasi © Humana Press Inc., Totowa, NJ
39
40
Perry
Two different protocols are covered in this chapter. The first involves radiolabeling a “nested” sequencing primer, i.e., one that is internal to the amplification primers, with either [γ32P]-dATP or [γ33P]-dATP and which is then used to sequence a purified PCR template. The advantage of this technique is that it allows sequence data to be derived up to the sequencing primer, which may be of value when sequencing short PCR products. The second method involves [α35S]-dATP rather [γ-32P]-dATP and nested sequencing primers. However, in contrast to the first method, the primer is not radio-labelled but instead [35S]-dATP is incorporated during the sequencing reaction. Direct solid-phase sequencing of PCR products using biotinylated primers is covered in a separate chapter. 2. Materials All reagents are molecular grade of equivalent. Many of the sequencing reagents are available commercially in kit form, e.g., Sequenase v2 (Amersham Life Sciences). Although the method described is for sequencing using a labeled oligonucleotide sequencing primer, methods are also included for the use of a nonlabeled primer and the incorporation of the radioisotope during the sequencing reaction.
2.1. Direct Sequencing of PCR Generated Templates Using 5'-Labeled Oligonucleotide Primers Direct sequencing of PCR products using a 5'-labeled oligonucleotide primer involves five separate steps: 1. 2. 3. 4. 5.
5'-labeling of the oligonucleotide primer. Purification of the PCR product to provide a template for sequencing. Annealing of the primer to the template. Extension-termination reactions. Casting, running, fixing, and drying the sequencing gel.
2.1.1. 5'-Labeling of Oligonucleotide Sequencing Primers Using T4 Polynucleotide Kinase Synthetic oligonucleotides for use as sequencing primers can be labeled at their 5'-terminus using T4 polynucleotide kinase: 1. Synthetic oligonucleotide primer: 25 pmol/µL in water (see Note 1). 2. 10 X T4 polynucleotide kinase (T4 PNK) buffer: 700 mM Tris-HCl, pH 7.6, 100 mM MgCl2, 5 mM dithiothreitol (DTT). Store at –20°C. 3. Bovine serum albumin at 10 mg/ mL. 4. [γ32P]-dATP (5000 Ci/mmol) (see Note 2). Available from a variety of sources, e.g., Amersham Life Sciences. 5. T4 polynucleotide kinase: 10 U/µL. 6. Distilled water.
Direct Sequencing
41
2.2. Purification of PCR Products for Sequencing A variety of methods are available for the purification of PCR products prior to sequencing. The methods listed below have all been used with great success. For products greater than 500 bp, GeneClean (or similar) is the method of choice.
2.2.1. Purification of PCR Products by Sephadex G50 Chromatography 1. Sephadex G50 (Pharmacia): Preswollen and stored at 4°C in TE, pH 8.0. 2. TE, pH 8.0: 10 mM Tris-HCl, 1 mM EDTA, pH 8.0. 3. 1-mL syringe in which the plunger has been removed and the end of the syringe plugged with glass wool 4. 100 µL of crude PCR product.
2.2.2. Purification of PCR Products Using GeneClean II DNA is bound to a glass matrix, washed, and then eluted. Any small DNA fragments, e.g., primers, remain bound to the glass matrix and only the larger DNA fragments are eluted. 1. GeneClean II Kit (BIO 101 Inc, La Jolla, California). GeneClean contains “Glass Milk”–a DNA binding matrix, 6 M sodium iodide (NaI) and a concentrated “wash solution.” Before use, the wash solution must be reconstituted by mixing 14 mL of the provided concentrate with 280 mL of distilled water and then adding 310 mL of 100% ethanol. This should be stored at –20°C.
2.2.3. Purification of PCR Products by Agarose Gel Electrophoresis PCR products are run in low gelling (melting) temperature agarose. The band of interest is excised and purified either by GeneClean II or by a “freezethaw” method. 1. 2. 3. 4. 5. 6. 7. 8. 9. 10.
Low gelling temperature agarose (available from many laboratories). 1X Tris-Acetate-EDTA (1X TAE): 0.04 M Tris-acetate, 0.001 M EDTA (see Note 3). TE, pH 8.0: 10 mM Tris-HCl, 1 mM EDTA, pH 8.0. TE-saturated phenol (see Note 4). Chloroform. Ethidium bromide 0.5 µg/mL (see Note 5). 7.5 M Ammonium acetate. Absolute ethanol. Sterile, distilled water. Sucrose loading buffer: 40% sucrose (w/v), 0.25% bromophenol blue (w/v), and 0.25% xylene cyanole (w/v).
2.2.4. Purification of PCR Products by Selective Precipitation In this method large DNA fragments are selectively precipitated and then purified, whereas free primers and dNTPs remain in solution.
42 1. 2. 3. 4.
Perry 7.5 M Sodium acetate. Absolute ethanol. 70% ethanol. Sterile, distilled water.
2.3. Annealing Primer to Template and Sequencing of the PCR Product Sequencing of the purified PCR template involves annealing the 5'-labeled primer to the purified single-stranded DNA template and then performing the extension-termination reactions. 1. Sequencing primer (concentration 1 pmol/µL) labeled at its 5'-end with [γ32P]dATP. 2. 5X Reaction buffer: 200 mM Tris-HCl pH 7.5, 100 mM MgCl2, 250 mM NaCl. Store at –20°C. Thaw before use and keep on ice. 3. Purified DNA template–at least 150 ng. 4. 0.1 M Dithiothreitol (DTT). Store at –20°C. Thaw before use and keep on ice. 5. T7 DNA Polymerase (e.g., Sequenase v2.0; 14 U/µL). Store at –20°C. Do not remove from the freezer—aliquots should be removed as required directly into the prechilled sequencing master mix. 6. Enzyme dilution buffer: 100 mM Tris-HCl, pH 7.5, 5 mM DTT, 0.5 mg/mL bovine serum albumin. Store at –20°C. Thaw before use and keep on ice. 7. Termination mixes (see Note 6). Store at –20°C. Thaw before use and keep on ice until required. ddGTP termination mix: 50 mM NaCl, 80 µM dGTP, 80 µM dATP, 80 µM dCTP, 80 µM dTTP, and 8 µM ddGTP ddATP termination mix: 50 mM NaCl, 80 µM dGTP, 80 µM dATP, 80 µM dCTP, 80 µM dTTP, and 8 µM ddATP ddTTP termination mix: 50 mM NaCl, 80 µM dGTP, 80 µM dATP, 80 µM dCTP, 80 µM dTTP, and 8 µM ddTTP ddCTP termination mix: 50 mM NaCl, 80 µM dGTP, 80 µM dATP, 80 µM dCTP, 80 µM dTTP, and 8 µM ddCTP 8. 5X dGTP Labeling mix: 7.5 µM dGTP, 7.5 µM dCTP, 7.5 µM dTTP. 9. Stop solution: 95% formamide (v/v), 20 mM EDTA, 0.05% bromophenol blue (w/v), 0.05% xylene cyanol (w/v).
2.4. Casting and Running the Sequencing Gel/Fixing and Drying the Gel 1. 40% premixed acrylamide/bisacrylamide in a ratio of 19:1 (available from many manufacturers). 2. Urea. 3. 25% Ammonium persulphate freshly prepared. 4. N,N,N',N'-tetramethylethylenediamine (TEMED). 5. Distilled water.
Direct Sequencing 6. 7. 8. 9. 10. 11. 12.
43
10X Tris-Borate-EDTA (TBE). Duck-billed tips for loading the gel Sequencing plates (40/50 cm × 20 cm). Silanizing solution, e.g., dimethylchlorosilane (Sigma). 2 L of 5% methanol/5% acetic acid in water. Whatman 3MM paper. Autoradiograph film, e.g., Kodak.
3. Methods 3.1. Direct Sequencing of PCR Generated Templates Using 5'-Labeled Oligonucleotide Primers
3.1.1. 5'-Labeling of Oligonucleotide Sequencing Primers Using T4 Polynucleotide Kinase Twenty-five pmol of sequencing primer is labeled in a final volume of 25 µL. This is sufficient for 25 separate sequencing reactions. 1. Place a 1.5-mL sterile Eppendorf on ice and add: X µL of water [the exact volume will vary depending upon the concentration of the oligonucleotide but the final volume of the reaction should be 25 µL], 25 pmol of sequencing primer in a volume of X µL, 2.5 µL of 10X T4-PNK buffer, 1 µL of bovine serum albumin, 7.5 µL (75 µCi) of [γ32P]-dATP. Add 1 µL (10 U) of T4-polynucleotide kinase. 2. Incubate at 37°C for 60 min and then at 85°C for 15 min to inactivate the T4 PNK. 3. Use 1 µL (1 pmol) of the labeled oligonucleotide per template. The labeled primer may be safely stored at –20°C for 7–10 d but its usable life-span is limited by the short half-life of the [32P]-dATP. Purification of the labeled template away from the unincorporated radio-nucleotide is unnecessary.
3.2. Purification of PCR Products for Sequencing 3.2.1. Purification of PCR Products by Sephadex G50 Chromatography 1. Plug the end of a 1-mL disposable plastic syringe with glass wool and pack with Sephadex G50 (Pharmacia-LKB Ltd.) preswollen with TE, pH 8.0. 2. Place the syringe into a 15-mL tube (e.g., Falcon) and centrifuge at 200g for 3 min. 3. Apply the crude PCR product to the top of the syringe. 4. Centrifuge at 200g for 3 min. 5. Collect the eluate which contains the purified PCR product. 6. Evaporate under vacuum to reduce the volume, e.g., in a Speedivac. Final volume should be ~7 µL.
3.2.2. Purification of PCR Products for Sequencing Using GeneClean II (see Note 7) 1. Add 3 vol of 7 M NaI to the crude PCR product. This is generally 540 µL of NaI for 80 µL of the PCR product.
44
Perry
2. Vortex the Glass Milk until all the contents are in suspension and then add10 µL to the NaI-PCR solution and place on ice for 20 min. The samples should be inverted several times during this period to keep the Glass Milk in suspension. 3. Pellet the Glass Milk by spinning in a microcentrifuge at 12,000 rpm for 5 s. 4. Carefully aspirate the supernatant and discard. 5. Add 500 µL of cold wash solution to the Glass Milk and vortex to resuspend the Glass Milk. Efficient re-suspension of the Glass Milk is extremely important 6. Pellet the Glass Milk by spinning in a microcentrifuge at 12,000 rpm for 5 s. Carefully aspirate the supernatant and discard. 7. Repeat the wash/spin step twice. After the second spin, spin the tube again to pellet any remaining wash solution, carefully aspirate and discard. 8. Add 20 µL of distilled water to the Glass Milk and resuspend the pellet. 9. Incubate at 55°C for 20 min. Spin at 12,000 rpm for 30 s. Carefully remove the supernatant to a clean tube. A second elution can be performed but in practise the additional yield of DNA is very small.
3.2.3. Purification of PCR Products by Agarose Gel Electrophoresis 1. Pour a 10 × 5 × 0.5 cm, 1% low gelling temperature agarose gel in 1X TAE containing ethidium bromide 0.5 µg/mL. Use a comb or well former that creates wells capable of holding 50–60 µL. 2. Submerge the gel in chilled 1X TAE. 3. Add 10 µL of sucrose loading buffer to 100 µL PCR product and load into the wells of the gel. 4. Electrophoresis is performed at no more than 5–10 V/cm otherwise the gel will melt!
Electrophoresis can be performed at room temperature but the electrophoresis times can be shortened either by running the gel at 4°C or by placing the electrophoresis apparatus onto a bed of ice. 5. When the xylene cyanole dye has migrated to the end of the gel, place the gel onto the surface of a UV transilluminator, the surface of which has been previously covered with Saran Wrap™. Visualize and excise the band of interest under low power UV light and place into a sterile Eppendorf. 6. To denature the gel matrix and release the DNA, place the gel slice at –80°C for 5 min and then at 37°C for 10 min. Repeat this step once. 7. Centrifuge the gel slice in a benchtop microfuge at 12,000 rpm for 20 min. 8. Collect the supernatant, extract once with an equal volume of TE-saturated phenol and once with equal volume of chloroform. 9. Precipitate the DNA by adding 1/10 vol of 7.5 M ammonium acetate, 2 1/2 vol of ethanol, and place the sample at –80°C for 20–30 min in a microfuge. 10. Collect the DNA by centrifugation at 12,000 rpm for 10 min, wash the DNA pellet in 400 µL 70% ethanol and finally resuspend in 20 µL of sterile distilled water. Use 7 µL for the sequencing reaction.
Direct Sequencing
45
3.2.4. Purification of PCR Products by Selective Precipitation 1. In a sterile 1.5-mL Eppendorf, add 100 µL of the PCR reaction to 50 µL of 7.5 M sodium acetate and 100 µL of absolute ethanol. 2. Incubate at 20°C for 5 min then centrifuge in a benchtop microfuge at 12,000 rpm for 15 min. It is important that the precipitation is carried out at 20°C (room temperature) but not at 4°C. Lower temperatures will allow some of the primers to precipitate. 3. Carefully aspirate the supernatant leaving the DNA pellet on the side of the Eppendorf. 4. Add 400 µL of 70% ethanol to the pellet, vortex briefly, and then centrifuge in a benchtop microfuge at 12,000 rpm for 5 min. Carefully aspirate the supernatant. 5. Dry the pellet under vacuum, e.g., Speedivac, and resuspend in 20 µL of distilled water.
3.3. Annealing Template and Primer 1. To anneal the labeled primer to the purified double-stranded DNA template, combine: 1 pmol (1 µL) of the radiolabeled sequencing primer (see Note 8), 7 µL of the purified DNA template (at least 150 ng) is required and 2 µL of 5X reaction buffer. 2. Heat to 100°C for 5 min and then rapidly chill in liquid nitrogen or a dry-ice/ methanol bath. 3. Allow to thaw on ice, briefly spin to pellet any condensation, and keep on ice until required.
3.4. The Sequencing Reactions There are two methods described here. The first involves the use of a radiolabeled primer (32P) and the other an unlabeled primer but the isotope (35S) is incorporated during the sequencing reaction.
3.4.1. Sequencing Using a Radiolabeled Primer 1. Prepare a sequencing master mix on ice (total volume = 5.5 µL × the number of reactions) comprising: 1 µL 0.1 M DTT, 2.5 µL of sterile water and 2 µL (3 U) of diluted Sequenase (diluted 1+7 in enzyme dilution buffer). Add 5.5 µL to each annealed template-primer. 2. Aliquot 2.5 µL of each termination mix in either 0.5–1.5-mL Eppendorfs or more conveniently into the wells of a sequencing microtiter plate. Keep at 4°C but prior to use warm to 37°C for 3–5 min. 3. Add 3.5 µL of the annealed template-primer (step 1) to each of the four termination mixes. Incubate at 37°C for 5 min. 4. Add 4 µL of stop solution to each well or Eppendorf and place at 4°C until ready to load.
3.4.2. Sequencing Using a Nonlabeled Primer and [α-35S]-dATP 1. Prepare a sequencing master mix on ice (total volume = 5.5 µL × the number of reactions) comprising: 1 µL 0.1 M DTT, 2 µL of diluted dGTP labeling mix (diluted
46
2. 3.
4. 5.
Perry 1+4 in sterile water (see Note 9), 0.5 µL [α-35S]-dATP (1000-1500 Ci/mmol), and 2 µL (3 U) of diluted Sequenase (diluted 1+7 in enzyme dilution buffer). Incubate at room temperature for 5 min. While step 2 is incubating, aliquot 2.5 µL of each termination mix in either 0.5– 1.5-mL Eppendorfs or more conveniently into the wells of a sequencing microtitre plate and place at 37°C for 3–5 min. Add 3.5 µL of the annealed template-primer (step 1) to each of the four termination mixes. Incubate at 37°C for 5 min. Add 4 µL of stop solution to each well or Eppendorf and place at 4°C until ready to load.
3.5. Casting and Running the Sequencing Gel/Fixing and Drying the Gel 1. Wash the gel plates carefully with detergent, rinse in deionized water, and dry with lint-free tissues. 2. To remove any grease, wipe each plate with an alcohol-moistened tissue and allow to dry. 3. Apply 1–2 mL of silanizing solution to one of the plates (commonly the “eared” plate) and allow to dry in a fume cupboard. 4. Assemble the plates according to the manufacturer’s instructions and place on one side. 0.4 mm spacers are generally used. 5. To prepare a 100 mL 6% denaturing gel, combine 15 mL of 40% acrylamide (19:1 acrylamide:bisacrylamide), 10 mL of 10X TBE, 42 g of urea and water to 100 mL (see Note 10). Cover with cling film and place on a magnetic stirrer until the urea has dissolved. 6. To initiate polymerization, add 140 µL of 25% ammonium persulfate and 140 µL of TEMED. Aspirate the solution into a 50-mL syringe, attach a 0.4-µm filter and slowly inject the gel mix between the gel plates. Insert a comb between the gel plates and allow the gel to polymerize for at least 60 min. 7. Carefully remove the comb and assemble the sequencing apparatus. 8. Fill the buffer reservoirs with 1X TBE and flush out the wells of the gel with buffer. 9. Prerun the gel at 35–50 W for 30 min. 10. Denature the sequencing reactions by heating to 100°C for 3 min and then place on ice (see Note 11). 11. Flush the wells of the gel and load the samples. It is convenient to load the first and second lanes with an identical sample, e.g., the “A” mix of reaction 1, or to miss a lane after the first four lanes have been loaded. In this way the autoradiograph can be easily orientated. 12. Run the gel for as long as needed then stop. Carefully separate the plates and immerse the gel, still attached to one of the glass plates into 2 L of fixing solution (see Note 12). 13. Transfer the gel onto 3MM paper, cover with Saran Wrap and dry under vacuum at 80°C. 14. Autoradiograph overnight.
Direct Sequencing
47
4. Notes 1. Crude oligonucleotides may be used without purification and frequently provide excellent results. Many suppliers of oligonucleotides frequently offer a facility for purification of the crude oligonucleotide either by HPLC or occasionally by polyacrylamide gel electrophoresis (PAGE). It is probably worthwhile using this facility if a particular oligonucleotide is to be used as a sequencing primer. The following method using 20% denaturing polyacrylamide gels has been used with great success in our laboratory for the purification of synthetic oligonucleotides and is included for those who are interested in purifying the own oligonucleotides. 50 cm × 20 cm × 1 mm 20% polyacrylamide gels are cast using 72 g urea, 75 mL of 40% acrylamide (19:1 acrylamide/bisacrylamide) and polymerized with 150 µL of TEMED and 150 µL of 25% ammonium persulphate. A 5-well comb with 200 µL wells is used. Gels are pre-run at 60 W for 30 min before use. Approximately 0.02 µmol of crude oligonucleotide is mixed with 0.5 vol of loading buffer (95% formamide, 20 mM EDTA, 0.05% bromophenol blue, 0.05% xylene cyanole) in a final volume of 100–150 µL, incubated at 100°C for 5 min and loaded onto the gel. Gels are run at 60 W constant power in 1X TBE (0.045 M Tris-Borate, 0.001 M EDTA) until the bromophenol blue dye front reaches the end of the gel. The plates are then separated, and the DNA visualized by UV shadowing. Bands of the correct size are excised, crushed in an Eppendorf and the DNA eluted into distilled water by vigorous shaking at 37°C for 24 h followed by dialysis (Spectra/Por No. 6 dialysis tubing) in distilled water for 48 h at 4°C. Oligonucleotides are then freeze-dried, re-suspended in 50–100 µL of distilled water and quantitated by measuring their OD260. 2. [γ32P]ATP is a high energy β emitter and appropriate safety measures must be taken. 3. TAE is routinely used both to prepare agarose gels and as a running buffer if DNA is to be isolated from a gel. TBE gels should be avoided. 4. Phenol is extremely toxic and must be handled with great care. Gloves, masks and safety glasses must be worn. Phenol must be handled in a fume hood. 5. Ethidium bromide is a potent carcinogen and teratogen and must be handled with great care. 6. Although termination mixes can be prepared from the solid reagents it is much easier to purchase them ready made, usually as part of a kit. 7. “GeneCleaning”of PCR products can also be used to prepare a template for sequencing using [α-35S]-ATP. 8. If using [α-35S]-ATP to sequence then the primer is not labelled but the isotope is incorporated during the sequencing reactions. In this case increasing the primer concentration to 10 pmol/µL yields optimal results. 9. The precise dilution of the dGTP labelling mix is dependent upon how close to or away from the primer, sequence data is required. For sequences close to the primer, the labelling mix may be diluted 1+10 or 1+20. For sequences far from the primer the volume of the labelling mix should be increased or a Sequence Extending Mix included (see manufacturer’s recommendations).
48
Perry
10. The amounts of sequence data that can be read on a single gel can be increased by a variety of methods, e.g., wedge gels, buffer gradient gels, etc. The easiest is the wedge gel. For this a small additional spacer is placed at the bottom of the two gel plates to force the plates apart. Many manufacturers provide wedge shaped spacers. The volume of gel mix must be increased if using a wedge gel, e.g., 150 mL instead of 100 mL and similarly the volumes of TEMED and ammonium persulphate must also be increased. 11. If microtiter sequencing plates are used to perform the sequencing reactions rather than Eppendorfs, the plate can be floated on a thin film of water to denature the samples and then placed on ice. 12. Gels are generally soaked for 30–45 min but wedge gels may require longer, e.g., 60 min. Inadequate fixing leads to poor drying and the gel is often sticky and adheres to the autoradiographic film.
Suggested Reading Griffin, H. G. and Griffin, A. M. (1993) DNA Sequencing Protocols. Humana Press, Totowa, New Jersey. McPherson, M. J., Hames, B. D., and Taylor, G. R. (1994) PCR 2: A Practical Approach. IRL, Oxford, UK.
Solid-Phase Sequencing
49
5 Solid-Phase Sequencing of Biotinylated PCR Products with Streptavidin-Coated Magnetic Beads David J. Perry 1. Introduction A novel approach to generating high-quality single-stranded DNA involves solid-phase sequencing. A biotin group is incorporated at the 5'-end of one of the amplification primers and as a result becomes incorporated into PCR product during the amplification reaction. The DNA can then be immobilized onto streptavidin-coated paramagnetic beads, simultaneously removing buffers, dNTPs, and unincorporated PCR primers. By alkali denaturation, the immobilized double-stranded DNA is converted into a single-stranded template, which can then be purified away from its complementary strand, avoiding any competition in the subsequent sequencing reaction. Although the protocol detailed in this chapter is designed to purify and sequence PCR products, the method is broadly applicable to the solid-phase sequencing of many other templates, e.g., plasmid DNA. Solid-phase sequencing can be used with many types of DNA polymerase including T7 DNA polymerase, e.g., Sequenase, and is also readily adaptable to automated sequencing using a variety of different formats, e.g., Dye primers and dye terminators. As a result it is now the method of choice in many laboratories for generating high-quality sequence data from PCR amplified templates (see Note 1). 2. Materials Direct sequencing of a biotinylated PCR product involves 5 stages: 1. Biotinylation of the PCR product (see Note 2). 2. Purification of the biotinylated PCR product. From: Methods in Molecular Medicine, Vol. 31: Hemostasis and Thrombosis Protocols Edited by: D. J. Perry and K. J. Pasi © Humana Press Inc., Totowa, NJ
49
50 3. 4. 5. 6.
Perry Alkali denaturation of the double-stranded PCR product. Annealing of the single-stranded template and sequencing primer. Sequencing of the single-stranded DNA template. Gel electrophoresis.
2.1. Purification of the Biotinylated PCR Product 1. 100 µL biotinylated PCR product. 2. 1X and 2X Binding and washing buffer (BWB). 2X BWB 10 mM Tris-HCl, pH 7.5, 1 mM EDTA, 2 M NaCl. 3. TE pH8.0: 10 mM Tris-HCl, pH 8.0, 1 mM EDTA. 4. Streptavidin-coated magnetic beads (e.g., Dynal). 5. Magnetic separation unit, e.g., Dynal MPC® magnet.
2.2. Generation and Purification of Single-Stranded DNA 1. 2. 3. 4.
0.1 M NaOH: Freshly prepared immediately before use. Distilled water 1X and 2X Binding and washing buffer (BWB). TE pH 8.0: 10 mM Tris-HCl, pH 8.0, 1 mM EDTA.
2.3. Annealing of Template and Primer 1. Purified, single-stranded template bound to streptavidin-coated beads. 2. 10–20 pmol of a “nested” sequencing primer (see Note 3). 3. 5X reaction buffer: 200 mM Tris-HC,l pH 7.5, 100 mM MgCl2, 250 mM NaCl (see Note 4).
2.4. Labeling and Sequencing Reaction 1. 2. 3. 4.
5. 6. 7. 8. 9. 10.
Annealed template-primer 10 µL. 0.1 M DTT. [α-35S]-dATP 1000–1500 Ci/mmol (e.g., Amersham). T7 DNA Polymerase (e.g., Sequenase v2.0 14 U/µL). Store at –20°C. Do not remove from the freezer—aliquots should be removed as required directly into the prechilled sequencing master mix. Enzyme dilution buffer: 100 mM Tris-HCl, pH 7.5, 5 mM DTT, 0.5 mg/mL bovine serum albumin. Store at –20°C. Thaw before use and keep on ice. dGTP labelling mix: 5X 7.5 µM dGTP, 7.5 µM dCTP, 7.5 µM dTTP diluted “1+5” in distilled water prior to use (see Note 5). ddA termination mix: 80 µM dGTP, 80 µM dATP, 80 µM dCTP, 80 µM dTTP, 8 µM ddATP, 50 mM NaCl. ddC termination mix: 80 µM dGTP, 80 µM dATP, 80 µM dCTP, 80 µM dTTP, 8 µM ddCTP, 50 mM NaCl. ddG termination mix: 80 µM dGTP, 80 µM dATP, 80 µM dCTP, 80 µM dTTP, 8 µM ddGTP, 50 mM NaCl. ddT termination mix: 80 µM dGTP, 80 µM dATP, 80 µM dCTP, 80 µM dTTP, 8 µM ddTTP, 50 mM NaCl.
Solid-Phase Sequencing
51
11. Stop solution: 95% formamide, 20 mM EDTA, 0.05% bromophenol blue, 0.05% xylene cyanol.
2.5. Casting and Running the Sequencing Gel/Fixing and Drying the Gel 1. 40% premixed acrylamide/bisacrylamide in a ratio of 19:1 (available from many manufacturers). 2. Urea. 3. 25% Ammonium persulphate freshly prepared. 4. N,N,N’,N’-tetramethylethylenediamine (TEMED). 5. Distilled water. 6. 10X Tris-Borate-EDTA. 7. Duck-billed tips for loading the gel 8. Sequencing plates (40/50 × 20 cm). 9. Silanizing solution, e.g., dimethylchlorosilane (Sigma). 10. 2 L of 5% methanol/5% acetic acid in water. 11. Whatman 3MM paper. 12. Autoradiograph film, e.g., Kodak.
3. Methods 3.1. Purification of the Biotinylated PCR Product Twenty microliters of streptavidin-coated magnetic beads are sufficient to generate enough single-stranded DNA template for 3–5 sequencing reactions from a 50 µL PCR amplification. 1. To prepare the magnetic beads for use vortex the stock of beads to ensure they are thoroughly resuspended. Remove 20 µL into a 1.5-mL Eppendorf and place in the magnetic separation unit for 30 s. The volumes should be scaled up depending upon how many PCR templates are to be prepared. 2. Carefully remove the supernatant using a micro-pipet and then add 50 µL of 1X BWB. Vortex very briefly to mix (2–3 s) and then place in the magnet for 30 s.
Remove the supernatant and add 50 µL of 2X BWB. Vortex briefly to mix. 3. Add the resuspended beads to 50 µL of the (100 µL) PCR reaction and place on a rotator (to keep the beads suspended) for 15–20 min at room temperature (see Note 6). During this time the biotinylated PCR product will bind to the streptavidin-coated magnetic beads (and also to any free biotin or free biotinylated primer; see Note 7). 4. Place the Eppendorf in the magnetic separation unit for 30 s and carefully remove the supernatant. 5. Add 10 µL of freshly made 0.1 M NaOH and briefly vortex to mix. Incubate at room temperature for 15 min without shaking. 6. Place the Eppendorf in the magnetic separation unit for 30 s, remove the supernatant and transfer to a clean tube. The supernatant contains the nonbiotinylated single-stranded DNA and should be kept (see Note 8).
52
Perry
7. Add 100 µL of 0.1 M NaOH to the beads, vortex briefly, place in the magnetic separation unit for 30 s. Carefully remove the supernatant and pool with that from step 5. 8. Add 100 µL of 1X BWB to the beads. Vortex briefly to mix and then place the Eppendorf in the magnetic separation unit for 30 s. Carefully remove the supernatant and discard. 9. Repeat step 8 but using 100 µL of TE, pH 8.0. 10. Finally re-suspend the beads in 20 µL of distilled water. Store at 4°C. Do not freeze. Use 4–7 µL for each sequencing reaction.
3.2. Annealing of Template and Primer 1. Mix 4–7 µL of single-stranded template DNA, 2 µL of 5X reaction buffer, 1 µL (5–10 pmol) of a purified “nested” sequencing primer (see Note 9) and X µL of distilled water. The final volume should be 10 µL. 2. Heat to 60°C for 5 min and cool to 30°C at 2°C/min. This is conveniently performed in a PCR block using a programable ramp time. Briefly spin to pellet any condensation and place on ice.
3.3. Extension/Termination Reactions 1. Aliquot 2.5 µL of each termination-reaction mix into a microtitre sequencing tray (or 0.5–1.5-mL Eppendorfs) and store at 4°C. Prewarm at 37°C for 5 min before use. 2. Prepare a “Master Mix”on ice for the number of templates to be sequenced and store on ice. The master mix comprises 1 µL 0.1 M DTT, 0.5 µL [α-35S]-dATP, 2 µL diluted dGTP labeling mix and 2 µL of Sequenase v2 diluted “1+7” in ice-cold dilution buffer. 3. Add 5.5 µL of the master mix to each of the annealed template-primers on ice. Incubate at room temperature for 3–5 min. 4. Add 3.5 µL from step 3 to each of the termination mixes and place at 37°C for 5 min. 5. Add 4 µL of the formamide-dye stop mix to each well (or Eppendorf). Sequencing reactions may be frozen at this stage at –20°C or run immediately.
3.4. Casting and Running the Sequencing Gel/Fixing and Drying the Gel Sequencing reactions are run in 6% denaturing polyacrylamide gels at 40– 50°C. This minimizes any secondary structure and ensures the DNA remains single-stranded. 1. Wash the gel plates carefully with detergent, rinse in deionized water, and dry with lint-free tissues. 2. To remove any grease, wipe each plate with an alcohol-moistened tissue and allow to dry. 3. Apply 1–2 mL of silanizing solution to one of the plates (commonly the“eared” plate) and allow to dry in a fume cupboard. 4. Assemble the plates according to the manufacturer’s instructions and place on one side. 0.4 mm spacers are generally used.
Solid-Phase Sequencing
53
5. To prepare a 100 mL 6% denaturing gel, combine 15 mLof 40% acrylamide (19:1 acrylamide:bisacrylamide), 10 mL of 10X TBE, 42 g of urea and water to 100 mL (see Note 10). Cover with cling film and place on a magnetic stirrer until the urea has dissolved. 6. To initiate polymerisation add 140 µL of 25% ammonium persulfate and 140 µL of TEMED. Aspirate the solution into a 50-mL syringe, attach a 0.4-µm filter and slowly inject the gel mix between the gel plates. Insert a comb between the gel plates and allow the gel to polymerise for at least 60 min. 7. Carefully remove the comb and assemble the sequencing apparatus. 8. Fill the buffer reservoirs with 1X TBE and flush out the wells of the gel with buffer. 9. Prerun the gel at 35–50 W for 30 min. 10. Denature the sequencing reactions by heating to 100°C for 3 min and then place on ice (see Note 11). 11. Flush the wells of the gel and load the samples. It is convenient to load the first and second lanes with an identical sample, e.g.. the “A” mix of reaction 1, or to miss a lane after the first four lanes have been loaded. In this way the autoradiograph can be easily orientated. 12. Run the gel for as long as required. Carefully separate the plates and immerse the gel, still attached to one of the glass plates into 2 L of fixing solution (see Note 12). 13. Transfer the gel onto 3MM paper, cover with SaranWrap and dry under vacuum at 80°C. 14. Autoradiograph overnight.
4. Notes 1. This and previous chapters have concentrated upon direct sequencing of PCR products. Sequencing is frequently used to obtain data from genetic material that has been cloned, for example, M13 or a plasmid vector. We sometimes find the necessity to clone and sequence PCR products, e.g., to separate two alleles to obtain their individual sequence data. There are numerous methods for cloning PCR products and we routinely use a commercial cloning kit “TA Cloning– Invitrogen.” Sequencing of cloned materials is often easier than sequencing PCR products and the reader is encouraged to read one of the many volumes that are available and which address this subject. 2. Biotinylation of the amplification primers is carried out during their synthesis. 3. Sequencing primers may require purification before us especially if the synthesis has been inefficient and there are a lot of contaminating small sequences. 4. Although sequencing reagents can be purchased individually it is considerably easier to purchase a kit. The methods outlined in this chapter are based on Sequenase v2 and the Sequenase Sequencing Kit. 5. The precise dilution varies upon how close to or how far from the sequencing primer data is required. To read close to the primer increase the dilution, e.g., 1+9 or 1+14, 1+19. To read further from the primer, use the labeling mix undiluted. 6. The optimal incubation time depends upon the length of the nucleic acid to be bound. Short DNA fragments (<30 bases) bind very quickly (<10 min), whereas longer fragments (1 kb+) may require longer (up to 60 min) at 43°C or 25°C overnight.
54
Perry
7. PCR reactions (100 µL) should be performed using 50 pmol of each amplification primer. The biotinylated primer may require purification before use on a NAP-10 column to remove any free biotin. This can be performed as follows: resuspend the freeze-dried biotinylated oligonucleotide in 1ml of sterile water and dilute a 100 µL aliquot to 1 mL with distilled water. Remove the top of a NAP-10 column (Pharmacia) and pour off the fluid. Remove the lower cap and clamp the column in a stand. Wash the column with 3 × 5 mL of 10 mM sodium phosphate buffer pH 6.8. After the third wash add the oligonucleotide and allow it to enter the column matrix. Elute the purified oligonucleotide using 4 × 1 mL of 10 mM sodium phosphate buffer pH 6.8, collecting 1 mL fractions into 1.5-mL Eppendorfs. Freeze dry and resuspend each fraction in 100 µL of sterile water. Run 5 µL of each fraction in a 1.5% agarose gel in 1X TBE containing ethidium bromide 0.5 µg/mL. Pool aliquots which contain oligo-nucleotide (usually fractions 2 + 3) and measure the OD260. Calculate their concentration from: Concentration = (OD260 × 40 × dilution/309 × mer) × 103 µM 8. To sequence the non-biotinylated strand, neutralise the alkali supernatant with 1/10 vol of 3 M sodium acetate, pH 5.2, and 21/2 vol of ethanol. Incubate at –20°C for 2 h. Centrifuge at 12,000 rpm in a benchtop microfuge. Wash the pellets twice with 70% ethanol, dry, and finally redissolve in 5 µL of sterile water. 9. If the upstream primer is biotinylated then sequence using a reverse sequencing primer. DMSO 1–2 µL may be included in the annealing reaction for sequencing templates with strong secondary structure. 10. The amount of sequence data that can be read on a single gel can be increased by a variety of methods, e.g., wedge gels, buffer gradient gels, etc. The easiest is the wedge gel. For this a small additional spacer is placed at the bottom of the two gel plates to force the plates apart. Many manufacturers provide wedge shaped spacers. The volume of gel mix must be increased if using a wedge gel, e.g., 150 mL instead of 100 mL and similarly the volumes of TEMED and ammonium persulphate must also be increased. 11. If microtiter sequencing plates are used to perform the sequencing reactions rather than Eppendorfs, the plate can be floated on a thin film of water to denature the samples and then placed on ice. 12. Gels are generally soaked for 30–45 min but wedge gels may require longer, e.g., 60 min. Inadequate fixing leads to poor drying and the gel is often sticky and adheres to the autoradiographic film.
Suggested Reading Biomagnetic Techniques in Molecular Biology. Technical Handbook, 2nd ed. Dynal, Oslo, Norway. Griffin, H. G. and Griffin, A. M. (1993) DNA Sequencing Protocols. Humana Press, Totowa, New Jersey. McPherson, M. J., Hames, B. D., and Taylor, G. R. (1994) PCR 2: A Practical Approach. IRL, Oxford, UK.
Automated DNA Sequencing
55
6 Automated DNA Sequencing Helen L. Devereux 1. Introduction The polymerase chain reaction (PCR), first published by Mullis and Faloona in 1987 (1), has become an invaluable molecular biology tool in both research and routine applications. The combination of PCR with the chain-termination sequencing technique developed by Sanger et al. in 1977 (2) and the automation of both these techniques, has enabled DNA sequencing to also become widely used in a variety of research areas. Automated DNA sequencing involves cycle sequencing using a DNA thermal cycler which incorporates four different fluorescent dye labels (for A, C, T, and G) into DNA extension products using either 5'-dye labeled primers (dye primers) or 3'-dye labeled dideoxynucleotide triphosphates (dye terminators). Briefly, a cycle sequencing protocol will consist of a denaturation step; a primer annealing step and an extension step (extension of second strand until incorporation of dideoxynucleotide triphosphate [ddNTP] halts extension). This will result in DNA fragments of one, two, three, etc. nucleotide bases in length, each labeled with the corresponding dye for the specific nucleotide. For example, a sequence of ACTAAG will yield fragments of: A1 AC2 ACT3 ACTA1 ACTAA1 ACTAAG 4
1
= dye label for A = dye label for C 3 = dye label for T 2
4
= dye label for G
These fragments are then run on a polyacrylamide gel and, due to the mobility of DNA through polyacrylamide gels, the smaller fragments will run faster From: Methods in Molecular Medicine, Vol. 31: Hemostasis and Thrombosis Protocols Edited by: D. J. Perry and K. J. Pasi © Humana Press Inc., Totowa, NJ
55
56
Devereux
and so be detected first by an argon-ion laser, which detects fluorescence from the four different dyes. Each dye emits light at a different wavelength when excited by the laser, so that all four colors can be detected in one gel lane. Two types of chemistry can be used for automated sequencing—dye primer and dye terminator. With dye terminators, each of the ddNTPs is labeled with a different fluorescent dye. The main advantages are that all sequencing reactions are performed in one tube and an unlabeled primer can be used. With dye primers, extension products are identified by using the same primer labeled with the four different dyes in four separate reactions. The products from these four reactions are then combined and loaded into one gel lane. The main advantages are slightly longer read lengths and more even signal intensities among the bases. However, with the development of the new BigDye™ terminators it is currently considered that dye terminator chemistry is now reasonably comparable to dye primer chemistry for read length and signal intensities. The type of chemistry chosen depends on the sequencing application, but, in general, BigDye™ terminators are more useful for low to high sequencing throughput and detection of 50:50 mutations, and BigDye primers are more useful for the detection of smaller percentages of mutations. 2. Materials All reagents should be prepared with sterile distilled water and molecular biology grade reagents should be used.
2.1. Purification of DNA Templates Before Cycle Sequencing Single-stranded and double-stranded DNA templates and PCR products can all be sequenced using this technology (see Note 1). There are various methods available for the purification of DNA. For single-stranded DNA, high quality DNA can be prepared using paramagnetic beads (Dynabeads®) or Qiagen QIAprep® M13 spin columns. For double-stranded DNA suitable templates can be prepared by caesium banding methods or Qiagen QIAprep® Spin Miniprep spin columns. For PCR products, Qiagen QIAquick® Spin Purification spin columns or Amicon Microcon 100 microconcentrators provide high quality templates.
2.2. Cycle Sequencing 1. PE Applied Biosystems BigDye™ Terminator/Primer Ready Reaction Kit with AmpliTaq® DNA Polymerase, FS; Terminator/Primer premix, pGEM-3Zf(+) double-stranded DNA control template, 0.2 µg/µL and -21 M13 sequencing primer (forward), 0.8 pmol/µL. 2. Sequencing primer (see Note 2). 3. Purified template DNA.
Automated DNA Sequencing
57
4. Distilled water. 5. Mineral oil (see Note 3).
2.3. Purification of Extension Products After Cycle Sequencing 1. 3 M Sodium acetate, pH 4.6 (see Note 4). 2. 95% Ethanol. 3. 70% Ethanol.
2.4. Loading Buffer 1. Deionized formamide. 2. 25 mM EDTA (pH 8.0). 3. Blue dextran (see Note 5).
2.5. Polyacrylamide Sequencing Gels Polyacrylamide gels can be made from their basic chemical constituents but because of the hazards of solid acrylamide, it is usually preferable to use one of the many ready-prepared solutions now available. 1. 40% Acrylamide FMC BioProducts Accugel™ 29:1 (acrylamide-bisacrylamide) (see Note 6). 2. Urea. 3. 10X TBE buffer. 4. Distilled water. 5. 10% Ammonium persulphate (APS). 6. TEMED.
Alternatively a commercially available sequencing pack can be used, e.g., FMC BioProducts Long Ranger Singel™ Pack. This is a self-contained pack with clip dividers which contains Long Ranger gel solution (see Note 7), 1X TBE buffer, APS, TEMED, urea, and a filter. 3. Methods 3.1. Purification of Template DNA (see Note 8) This is done according to manufacturer’s instructions. The recommended final concentrations prior to sequencing are: Single-stranded DNA Double-stranded DNA PCR product
0.1 µg/µL 0.2 µg/µL 10–30 ng/µL
0.5–1.0 µL/sequencing reaction 1.5–2.5 µL/sequencing reaction 3.0–6.0 µL/sequencing reaction
3.2. Cycle Sequencing 3.2.1. BigDye™ Terminators 1. Thaw premix stock and other reagents on ice and protect terminators from light as much as possible.
58
Devereux
2. Mix the following reagents in a thin-walled 0.2-mL microcentrifuge tube (see Note 9): 8 µL of BigDye™ Terminator Ready Reaction mix, 0.5–6.0 µL DNA Template (precise volume dependant on concentration), 1 µL of primer (3.2 pmol/µL) and distilled water to 20 µL (see Note 10). 3. Mix well and spin briefly. 4. If using the 480 thermal cycler, or similar, overlay the reaction mixture with one drop of light mineral oil (see Note 3). 5. To cycle sequence DNA on the GeneAmp 2400, 9600 or 9700: Place the tubes in the cycler and set the volume to 20 µL. Rapid thermal ramp to 96°C, 96°C for 10 s, rapid thermal ramp to 50°C, 50°C for 5 s. Rapid thermal ramp to 60°C, 60°C for 4 min. Repeat for 25 cycles and hold at 4°C. 6. To cycle sequence DNA on the 480 or similar: Place the tubes in the cycler preheated to 96°C. Rapid thermal ramp to 96°C then 96°C for 30 s. Rapid thermal ramp to 50°C then 50°C for 15 s. Rapid thermal ramp to 60°C then 60°C for 4 min. Repeat for 25 cycles. Hold at 4°C.
3.2.2. BigDye™ Primers 1. Thaw premix stocks and other reagents on ice. 2. Aliquot the following volumes into microcentrifuge tubes appropriate for the thermal cycler being used (see Note 9): Ready Reaction Premix DNA template Total volume
A (µL) C (µL) 4 4 1 1 5 5
G (µL) T (µL) 8 8 2 2 10 10
(See Note 11). 3. If using the 480 thermal cycler, or similar, overlay the reaction mixture with one drop of light mineral oil (see Note 3). 4. To cycle sequence DNA on the GeneAmp 2400, 9600 or 9700: Place the tubes in the cycler and set the volume to 10 µL. 5. Rapid thermal ramp to 96°C for 10 s. Rapid thermal ramp to 55°C for 5 s. Rapid thermal ramp to 70°C for 60 s. Repeat for 15 cycles. Then rapid thermal ramp to 96°C for 10 s. Rapid thermal ramp to 70°C for 60 s. Repeat for 15 cycles. Hold at 4°C. 6. To cycle sequence DNA on the 480 or similar: Place the tubes in the cycler preheated to 95°C. Rapid thermal ramp to 95°C for 30 s. Rapid thermal ramp to 55°C for 30 s. Rapid thermal ramp to 70°C for 60 s. Repeat for 15 cycles. Then rapid thermal ramp to 95°C for 30 s. Rapid thermal ramp to 70°C for 60 s. Repeat for 15 cycles. Hold at 4°C.
3.3. Purification of Extension Products After Cycle Sequencing 3.3.1. BigDye™ Terminators 1. Spin down extension products in a microcentrifuge. 2. For each reaction prepare a 1.5-mL microcentrifuge tube by adding: 2 µL 3 M NaOAc, pH 4.6 (see Note 4), and 50 µL 95% ethanol.
Automated DNA Sequencing
59
3. Transfer the entire 20µL extension product to the ethanol solution. If using mineral oil, this must be removed first (see Note 12). 4. Vortex and place on ice for 10 min. 5. Centrifuge at maximum speed in a microcentrifuge (13,000 rpm) for 15–30 min. 6. Carefully remove the ethanol with a pipet (see Note 13). 7. Add 250 µL 70% ethanol to the pellet (see Note 14). 8. Do not vortex, but just remove ethanol with a pipet (see Note 13). 9. Dry the pellet so that no ethanol remains (see Notes 15 and 16).
3.3.2. BigDye™ Primers 1. To a 1.5-mL microcentrifuge tube add 80 µL of 95% ethanol. 2. Add the extension products from each of the four tubes (A, C, T, and G) to the ethanol. Any mineral oil must be removed first (see Note 12). 3. Place on ice for 10–15 min. 4. Centrifuge at maximum speed in a microcentrifuge (13,000 rpm) for 15–30 min. 5. Carefully remove the ethanol with a pipet (see Note 13). 6. Add 250 µL 70% ethanol to the pellet (see Note 14). 7. Spin for 5 min in a microcentrifuge at 13,000 rpm 8. Carefully remove the ethanol with a pipet (see Note 13). 9. Dry the pellet (see Notes 15 and 16).
3.4. Loading the Samples 1. Prepare a loading buffer by combining deionised formamide and 25 mM EDTA, pH 8.0, containing 50 mg/mL Blue dextran in a ratio of 5:1 formamide to EDTA/ Blue dextran. 2. Resuspend the sample in 6 µL of the loading buffer. 3. Vortex and spin briefly. 4. Heat the samples at 95°C for 2 min to denature. Place on ice until ready to load. 5. Load 0.75–1.5 µL into a each lane of the gel (see Notes 17 and 18).
3.5. Polyacrylamide Sequencing Gel Preparation 3.5.1. 40% 29:1 Acrylamide (see Note 6) 1. Prepare 10X TBE buffer by dissolving 540 g Tris-base, 275 g orthoboric acid, and 37 g disodium EDTA in 3.5 L of water. Adjust the pH to 8.3 and make up the volume to 5 L. 2. In a class II cabinet, combine 18 g urea, 5.625 mL 40% acrylamide stock (to prepare a 4.5% sequencing gel), 5 mL 10X TBE buffer and 25 mL distilled water 3. Stir until all urea has dissolved. 4. Adjust the volume to 50 mL with distilled water. 5. Filter the solution through a 0.2-µm filter and degas for a minimum of 5 min. 6. Clean and assemble glass plates according to manufacturer’s instructions (see Note 19). 7. Add 250 µL of freshly made 10% APS (see Note 20).
60
Devereux
8. Add 30 µL TEMED and mix gently. 9. Pour the gel and leave for a minimum of two hours to polymerize. 10. Assemble gel in automated DNA sequencer and run and analyse sequence according to manufacturer’s instructions.
3.5.2. FMC BioProducts Long Ranger Singel™ Pack 1. Mix according to manufacturer’s instructions and pour through the filter directly from the pack.
4. Notes 1. The quality of the sequencing results will be directly proportional to the quality of the starting DNA. It is essential to purify all templates before cycle sequencing in order to generate good quality sequence. 2. The sequencing primer should be at least an 18-mer. Avoid primers with long runs of single bases. Melting temperatures above 45°C are recommended. Avoid primers which have secondary structure or that can form dimers. Universal primers can be used for cloned products. 3. If the DNA thermal cycler is not a Perkin Elmer GeneAmp 2400, 9600, 9700, or similar then mineral oil will have to be added to the cycle sequencing reaction to prevent evaporation. The newer type of cyclers listed above have heated lids, which eliminate the need for mineral oil. 4. Magnesium chloride can also be used instead of sodium acetate, but sodium acetate seems to be more effective at removing the excess dye terminators which can cause a large “dye blob” at the start of the sequence. Sodium acetate is not necessary for the purification of dye primers after cycle sequencing. 5. Blue dextran is added to aid loading of the sample. 6. 29:1 Acrylamide to bisacrylamide has been found to give better automated sequencing results than 19:1 acrylamide to bisacrylamide. 7. This polyacrylamide can provide a longer read length than other polyacrylamides, up to approx 700 bases as compared to approx 500 bases. 8. Purified DNA concentration estimations can be done using a spectrophotometer. However, estimation by running the product on an agarose gel next to a standard of known concentration is suitable for automated DNA sequencing applications. 9. For the PE GeneAmp 2400, 9600, and 9700 or similar thermal cyclers use 0.2mL thin-walled microcentrifuge tubes. For other cyclers, including the PE 480 thermal cycler, use 0.5-mL thin-walled microcentrifuge tubes. Thin-walled tubes must be used as the reactions will not work in normal microcentrifuge tubes. 10. Always include the control DNA template in each kit with every set of samples to be sequenced: 8 µL BigDye™ Terminator Ready Reaction Mix, 2 µL pGEM3Zf(+) double-stranded DNA control template at 0.2 µg/µL, 4 µL of -21 M13 primer (forward) sequencing primer at 0.8 pmol/µL and 6 µL of distilled water. 11. Prelabeled universal primers can be used with the BigDye™ Primer Ready Reaction Kits or specific PCR primers can be sent to PE Applied Biosystems to be labeled with their four dyes. Each Ready Reaction Premix used here contains the relevant labeled primer.
Automated DNA Sequencing
61
12. An effective way to remove mineral oil from cycle sequence extension products is as follows: Pipet the entire contents of the microcentrifuge tube (extension products and oil) onto a piece of parafilm (approx 10 cm in length). Lift parafilm slightly so that solution rolls gently down the film. The solution containing extension products will separate from the mineral oil and can be added to the ethanol solution. 13. Extra care should be taken when removing ethanol from the pellet as it is unstable and may be lost. 14. This step is not usually necessary, but sequence quality appears to be improved when it is included. 15. The pellet may or may not be visible at this stage. This seems to have no effect on sequence quality. 16. The pellet may be stored for a number of weeks at –20°C or colder, but after the loading buffer has been added it is recommended that it is used within a few hours. 17. If loading more than approx 20 samples it is recommended that all odd lanes are loaded first, the samples allowed to run into the gel for 5 min, and then the even lanes are loaded. The sequencing run can then be started. 18. The control DNA template (pGEM-3Zf(+)) included in the kit should always be loaded in lane 1. This ensures that the analysis software package always has a good quality sequence to start to track the gel with. 19. In order to prevent background fluorescence it is essential that glass plates are cleaned only with a mild solution of Alconox and distilled water and rinsed thoroughly with distilled water. If background fluorescence becomes a problem or if a sequence appears “smeared” in certain regions of the plate or if “red rain” (when longer runs cause the bottom of the gel to begin to break down) becomes a problem, then the following wash is recommended: Wash in 1 M nitric acid and rinse with large quantities of distilled water. Soak in 0.2 M sodium hydroxide (NaOH) for 15 min and rinse with large quantities of distilled water. This wash should not be used frequently as it may affect the quality of the plates. 20. 10% APS is 0.1 g APS dissolved 0.9 mL distilled water. This solution can be stored for a number of weeks at 4°C, but for automated DNA sequencing it is recommended that it is prepared fresh each day.
Acknowledgments The author would like to thank PE Applied Biosystems and Ms. L. Huckett for their continued, and valuable assistance. References 1. Mullis, K. B. and Faloona, F. A. (1987) Specific synthesis of DNA in vitro via a polymerase catalysed chain reaction. Methods Enzymol. 155, 335–350. 2. Sanger, F., Nicklen, S., and Coulson, A. R. (1977) DNA sequencing with chain terminating inhibitors. Proc. Natl. Acad. Sci. USA 74, 5463–5467.
Silver Staining
63
7 Detection of DNA by Silver Staining David J. Perry and Flora Peyvandi 1. Introduction Silver stains are widely used for the detection of both proteins and nucleic acids in acrylamide gels or on various membranes. They have several advantages over conventional staining methods, including the ability to detect very small amounts of material, while avoiding the hazards of other detection systems, such as ethidium bromide or radio-isotopes. The method described in this chapter has been used extensively in combination with both single-stranded conformation polymorphism analysis (SSCP) and Heteroduplex analysis to screen DNA for mutations. 2. Materials All reagents must be prepared with deionised water (see Note 1). All solutions should be at room temperature other than the developer which should be at 4°C. To stain a standard 50 cm × 20 cm sequencing gel requires 1.5–2 L of each solution. Gel bonding solution, e.g., Bind Silane (3 µL in 1 mL of 0.5% acetic acid in 95% ethanol). Dimethylchlorosilane. Fix/stop solution: 10% acetic acid. Silver nitrate staining solution: 2g AgNO3 (silver nitrate), 3 mL 37% formaldehyde (H2CO). Deionized water to 2 L. 5. Developer: 60 g anhydrous Na2CO3 (sodium carbonate), 3 mL 37% formaldehyde (H2CO), 400 µL Na2S2O3:5H2O (sodium thiosulfate). Deionized water to 2 L. Chill to 4°C. 6. Stop solution: 5% acetic acid (v/v). 1. 2. 3. 4.
3. Methods 1. Prior to casting the acrylamide gel, one of the plates should be silanized by pipetting 2 mL of dimethylchlorosilane on to the plate, spreading it over the surface of the plate From: Methods in Molecular Medicine, Vol. 31: Hemostasis and Thrombosis Protocols Edited by: D. J. Perry and K. J. Pasi © Humana Press Inc., Totowa, NJ
63
64
2. 3.
4. 5.
6.
7. 8.
9.
Perry and Peyvandi with a lint-free tissue and then allowing it to dry at room temperature in a fume hood. To encourage the gel to adhere to the other plate apply 1 mL of “Bind Silane” to the plate and wipe over the entire surface. Allow to dry at room temperature and then wipe the plate 4× with 95% ethanol to remove any excess solution. Allow to dry. Carry out the electrophoresis, e.g., SSCP analysis. Separate the gel plates and place the gel adherent to one plate in a developing tank. Cover the gel with fix/stop solution for 20 min. The gel may be left in this indefinitely if processing is delayed. Solutions should not be poured directly onto the gel but into a corner of the tray. Remove the fix/stop solution but do not discard. This is required again in a later step. Wash the gel 3× in distilled water using the same volume as the fixative, i.e., 1.5–2 L. Gently pour in the silver nitrate solution and allow the gel to stain for 30 min. Remove the gel and briefly rinse (<10 s) in distilled water to remove any silver nitrate on the surface of the gel (see Note 2). Gently pour in half of the pre-chilled developer solution and slowly agitate. Observe carefully and as soon as the solution loses some of its clarity or the bands begin to appear, replace it with fresh solution. Repeat this until the DNA bands become visible after 2–5 min or background staining become too intense. As soon as the desired intensity of bands is achieved, stop development by pouring in the fix/stop solution (see step 4 and Note 3). Fix/stop for 5 min. The solutions will foam because of the interaction between the acetic acid and sodium carbonate. Rinse the gel in deionized water. Allow to drain and photograph on a light box. To reuse the glass plates and to remove any trace of the bound gel, immerse the gel in 10% sodium hydroxide overnight. Rinse carefully in deionized water. Wash with detergent and rinse thoroughly. The quality of silver staining is dependent on many variables including the purity of the reagents and the quality of the water (see Note 4).
4. Notes 1. The water used in silver staining must be ultrapure. Any contaminants will affect the quality of the final result. 2. The duration of the rinse step is critical. The total time from immersion of the gel to immersion in developer solution should not exceed 20 s. If the rinse step exceeds 20 s, then the staining procedure should be repeated. 3. Pour in the fix/stop solution directly into the developer. 4. If the gel appears very yellow after staining, then it was probably in the developer too long. As soon as the developer loses its clarity, replacing it with fresh significantly improves the quality of the final result. If no bands are visible, this may be a problem with the original electrophoresis, the quality of the water, or inadequate rinsing following staining. If the background staining is excessive, this is usually because excess silver nitrate is present (therefore, rinse the gel for longer prior to adding the developer solution) or development is too long (stop the reaction as soon as the bands of interest appear).
Promoter Studies in Hemostasis
65
8 Promoter Studies in Hemostasis Peter R. Winship and Jonathan R. K. Spray 1. Introduction In recent years the technique of gene cloning, coupled with the application of polymerase chain reaction (PCR)-based procedures, has greatly facilitated the production of cloned genomic material encompassing the putative promoter regions of genes involved in the hemostatic process. These recombinant vectors provide the raw material for reporter gene studies and DNA footprinting analysis; two of the three most frequently used in vitro procedures to study promoter function. The third of these methods to be described in this chapter, band shift or electrophoretic mobility shift assay (EMSA), normally uses synthetically produced double-stranded oligonucleotide sequences corresponding to specific areas of interest within the promoter region. Reporter gene analysis (Fig. 1) exploits the extreme ease and sensitivity of detection of certain proteins, which, although stable in mammalian cells, are not endogenously expressed. Recombinant vectors containing putative promoter regions cloned upstream of the genes encoding such proteins (e.g., Firefly luciferase, Chloramphenicol Acetyl Transferase and β Galactosidase; 1–3) are constructed and transfected into an appropriate cell line. If the putative promoter sequence under investigation possesses transcriptional activity it will drive the production of reporter gene mRNA and ultimately of the reporter protein itself. This protein accumulates within the cells and levels can then be measured in the cell lysate following harvesting and cell lysis. Quantitative analysis and comparison of reporter gene protein levels produced under a number of different conditions is therefore made possible. Using a panel of recombinant vectors containing test promoter sequences with common 3' ends (between the natural transcriptional and translational start-points) but progressively deleted from a common progenitor 5'-end allows areas of potential tranFrom: Methods in Molecular Medicine, Vol. 31: Hemostasis and Thrombosis Protocols Edited by: D. J. Perry and K. J. Pasi © Humana Press Inc., Totowa, NJ
65
66
Winship and Spray
Fig. 1. Reporter gene assay.
scriptional importance to be defined. These studies can be further refined to assess the effect of specific transcription factors by transfection of the reporter gene constructs in the presence or absence of expression vectors encoding the
Promoter Studies in Hemostasis
67
appropriate transactivator and noting the differential change (if any) in level of accumulated reporter protein. In contrast, DNaseI footprinting and EMSAs give more precise positional information about the nature of any DNA protein interactions in the promoter under investigation. The two methods rely initially on the specific binding of a DNA probe radiolabeled at one end (Probe sizes: 200–800 bp in DNase I footprinting; 20–100 bp in EMSAs) to proteins present in a nuclear extract prepared from an appropriate tissue or cell line. In DNase I footprinting (Fig. 2), the bound probe is subjected to a limiting digestion with the endonuclease DNaseI such that in a given population of DNA molecules a high proportion will be cleaved just once. Regions of DNA bound with a protein present in the nuclear extract are, however, protected from this endonucleolytic cleavage. The digested samples are then size-fractionated by polyacrylamide gel electrophoresis (PAGE) under denaturing conditions. Comparison with control samples not incubated with nuclear extract then allows the identification of DNA sequences bound with protein (and therefore protected from endonucleolytic cleavage), which are characterized by a gap or “footprint” in the ladder of bands. Following the incubation of radiolabelled EMSA probes with nuclear extract and subsequent size fractionation by PAGE, the presence of a DNA protein complex is indicated by a retarded or “shifted” band on the autoradiograph relative to the faster migrating DNA fragment on it’s own (Fig. 3). A reduced intensity of the “shifted” band in the presence of a molar excess of a homologous, double stranded but unlabelled competitor probe in the binding reaction helps eliminate the possibility that the observed complex is not simply the result of a non-specific interaction. The precise nature of the bound protein may then be elucidated by the technique known as “supershifting” (4). Briefly, in addition to binding with nuclear extract the EMSA probe is also incubated with an antibody to a known transcription factor. If the antibody recognizes and binds to the protein bound to the DNA probe, then this larger tripartite complex will be further retarded in mobility relative to the bipartite DNA-protein complex and can be visualized as a “supershifted” band by PAGE and autoradiography. Purified recombinant or fusion proteins can also be used to identify the protein component of a specific DNA–protein complex. In the absence of a suitable antibody or purified protein , additional information about the precise nature of the DNA protein interaction can still be obtained by attempting to “compete off” the specific signal with a cold competitor probe corresponding to the binding site consensus sequence of a candidate transcription factor. 2. Materials All reagents should be prepared in deionized or distilled water using chemicals of Analar grade or its equivalent unless otherwise stated, and stored at room temperature.
68
Winship and Spray
Fig. 2. DNaseI footprinting.
2.1. Reporter Gene Assays 1. Plasmids: Vectors containing appropriate regions of the promoter under investigation (see Note 1) are first constructed in a plasmid encoding a suitable reporter
Promoter Studies in Hemostasis
69
Fig. 3. Electrophoretic mobility shift assay. gene, in this instance Luciferase (a range of these vectors are available commercially). Reporter gene constructs to be used for the calcium phosphate transfection procedure described below must be purified from caesium chloride gradients
70
2.
3. 4.
5. 6.
7.
Winship and Spray or to an equivalent degree of purity by alternative methods. Preparations of expression vectors encoding transcription factors and any plasmids used as nonspecific DNA must be of a similar purity. Store at 4°C. Cell lines and media: The mammalian liver carcinoma cell line HepG2 is maintained in minimum essential medium supplemented with 10% bovine fetal serum, 2 mM L-glutamine, 1X nonessential amino acids and 100 iu/mL-100 µg/mL penicillin-streptomycin. Complete media is stored at 4°C but must be supplemented with additional L-glutamine every 3–4 wk. See Note 2 for choice of cell line. 0.25 M CaCl2: Filter sterilize through 0.22-µm filter. 2X BBS: 50 mM NN’-Bis-(2-hydroxyethyl)-2-amino-ethane sulphonic acid, 280 mM NaCl, 1.5 mM Na2HPO4. Adjust pH to 7.02 with NaOH. Sterilize using a 0.22-µm filter and store in aliquots at –20°C. Phosphate buffered saline (PBSE)/EDTA: 137 mM NaCl, 2. 7 mM KCl, 4.3 mM Na2HPO4, 1.4 5 mM KH2PO4, 0.5 mM EDTA pH 7.4. Cell Lysis buffer: 25 mM Tris-phosphate pH 7.8, 2 mM DTT, 2 mM 1,2diaminocyclohexane-N,N,N,N’-tetraacetic acid, 10% glycerol, 1% triton X-100. Available from Promega as a 5X stock solution; store at –20°C. Luciferase Assay Reagent: 20 mM tricine, 1.07 mM (MgCO3)4Mg(OH)2, 2.67 mM MgSO4, 0.1 mM EDTA, 33.3 mM DTT, 270 µM coenzyme A, 470 µM luciferin, 530 µM ATP, pH 7.8. Available from Promega. Stable in solution at – 20°C for 1 mo and –70°C for 1 yr.
2.2. Preparation of Nuclear Extract 1. Homogenization buffer: 0.25 M sucrose, 15 mM Tris-HCl, pH 7.9, 60 mM KCl, 15 mM NaCl, 2 mM EDTA, 0.5 mM EGTA, 0.15 mM spermine, 0.5 mM spermidine, 1 mM DTT, 5 µg/mL aprotinin (5 mg/mL stock in H2O; store at –20°C), 0.4 mM PMSF (120 mM stock in ethanol; store at –20°C), 5 µg/mL pepstatin A (5 mg/mL stock in ethanol; store at –20°C), 2 mM benzamidine (320 mM stock in H2O; store at –20°C). Use solution (chilled to 4°C) immediately. 2. 2.6 M Sucrose buffer: as homogenization buffer except 2.6 M sucrose. 3. 2.1 M Sucrose buffer as homogenization buffer except 2.1 M sucrose. 4. Nuclear lysis buffer: 10 mM HEPES pH 7.6, 100 mM KCl, 3 mM MgCl2, 0.1 mM EDTA, 10% glycerol, 1 mM DTT, 0.1 mM PMSF, 2 mM benzamidine, 5 µg/mL aprotinin, 5 µg/mL pepstatin A. Add the protease inhibitors and DTT just before use; the remaining components are stable in solution at 4°C. 5. Dialysis buffer: 25 mM HEPES pH 7.6, 40 mM KCl, 0.1 mM EDTA, 1 mM DTT, 10% glycerol, 0.1 mM PMSF, 2 mM benzamidine, 5 µg/mL aprotinin. Add the protease inhibitors and DTT just before use; the remaining components are stable in solution at 4°C.
2.3. DNase I Footprinting 2.3.1. Preparation of Radiolabeled Probe 1. Oligonucleotides: Oligonucleotides are synthesized on an Applied Biosystems Model 394 DNA/RNA synthesizer (Perkin Elmer Applied Biosystems,
Promoter Studies in Hemostasis
2. 3. 4. 5.
71
Warrington, Cheshire, UK). After deprotection the oligonucleotides are resuspended in approx 400 µL deionized water. The addition of 0.1 vol, 5 M LiCl, and 2–2.5 vol ethanol facilitates precipitation from the aqueous solution. Resuspend the resultant precipitate in deionized water at a concentration of approx 2 mg/mL. Store at -20°C. T4 Polynucleotide kinase and buffer (10X stock): 700 mM Tris-HCl, 100 mM MgCl2, 5 mM DTT, pH 7.6 (available from New England Biolabs). Taq Polymerase (e.g., Bioline, UK): use an experimentally determined optimal buffer for the specific PCR reaction being performed. Store at –20°C. Radiochemical and deoxynucleotides: [γ-32P]dATP 3000 ci/ mMol, 10 mci/mL. e.g., Amersham. Use within 14 d of activity date. dATP, dCTP, dGTP, dTTP: 100 mM stock solutions (available from many manufacturers, e.g., Pharmacia). Store at –20°C.
2.3.2. Gel Purification and Elution of Probe 1. Native polyacrylamide gel: 6% polyacrylamide (19:1 acrylamide: N, N’ methylene bisacrylamide). 20 cm × 20 cm × 1 mm thick. 2. Gel running buffer (1X TBE): 10X TBE stock is 0.9 M Tris base, 0.89 M boric acid, 5 mM EDTA pH 8.3. 3. Sample loading buffer: 30% Ficoll-400, 1X TBE, 0.05% bromophenol blue, 0.05% xylene cyanol FF. 4. Elution buffer: 0.5 M ammonium acetate, 10 mM magnesium acetate, 1 mM EDTA, 0.1% SDS.
2.3.3. Binding Reaction and DNaseI Digestion 1. 5X Binding Buffer: 125 mM HEPES, pH 7.6, 200 mM KCl, 5 mM DTT, 50% Glycerol. Store at–20°C. 2. Poly dI-dC. 1 mg/mL stock solution (Pharmacia). Store at –20°C. 3. RQ1 RNase free DNaseI (Promega).
2.3.4. Denaturing Polyacrylamide Gel Electrophoresis 1. Denaturing polyacrylamide gel: 6% polyacrylamide, (19:1 acrylamide: N, N’ methylene-bis-acrylamide), 7 M urea. 50 cm × 20 cm, 0.4 mm thick. 2. Gel running buffer (1X TBE): 10X TBE stock is 0.9 M Tris base, 0.89 M boric acid, 25 mM EDTA, pH 8.3. 3. Denaturing gel loading buffer: 95% (v/v) formamide, 20 mM EDTA, 0.05% (w/v) bromophenol blue, 0.05% (w/v) xylene cyanol FF.
2.4. Electrophoretic Mobility Shift Assay 1. Oligonucleotides: Oligonucleotides are synthesized on an Applied Biosystems Model 394 DNA/RNA synthesizer. After deprotection the oligonucleotides are resuspended in approx 400 µL deionized water. The addition of 0.1 vol, 5 M LiCl, and 2–2.5 vol ethanol facilitates precipitation from the aqueous solution. Resuspend the resultant precipitate in deionized water at a concentration of approx 2 mg/mL. Store at –20°C.
72
Winship and Spray
2. Radiolabel: [γ-32P]dATP 3000 ci/mMol, 10 mci/mL, e.g., Amersham. Use within 14 d of activity date. 3. T4 Polynucleotide Kinase and buffer (10X stock): 700 mM Tris-HCl, 100 mM MgCl2, 5 mM DTT pH 7.6 (available from New England Biolabs). 4. 20X Annealing Buffer: 1 M KCl. 5. 5X EMSA Binding Buffer: 50 mM Tris-HCl pH 7.5, 20% v/v glycerol, 5 mM MgCl2, 2.5 mM EDTA, 2.5 mM DTT, 0.25 mg/mL poly dI-dC. Store in aliquots at –20°C. Add DTT from a 1 M stock solution (stored at –20°C) immediately before use.
2.5. Polyacrylamide Gel Electrophoresis 1. Native polyacrylamide gel: 4% acrylamide (80:1 acrylamide: N, N’ methylenebis-acrylamide), 20 cm × 20 cm, 1-mm thick. 2. Gel running buffer (0.5X TBE): 10X TBE stock is 0.9 M Tris base, 0.89 M boric acid, 25 mM EDTA pH 8.3.
3. Methods 3.1. Reporter Gene Analysis It is extremely difficult to provide a definitive method for this type of analysis given the dependency on cell line and the activity of the promoter under investigation. The method described below, modified from previously described procedures (5,6), is that which we use for analyzing the promoters of a number of genes encoding proteins which participate in the hemostatic process.
3.1.1. Calcium Phosphate Transfection 1. Twenty-four hours prior to transfection, HepG2 cells from an approx 80% confluent culture are seeded into 6-well plates (9.6 cm2 wells) such that at the time of transfection each well will be approx 25% confluent. Use 2 mL of complete medium per well. 2. To 100 µL of 0.25 M CaCl2, add 2.5–3.5 µg reporter gene plasmid, 1.25–1.5 µg expression plasmid of a specific transactivator (if appropriate) and make the total amount of nucleic acid up to 5 µg with a carrier plasmid (see Note 3). Add dropwise an equal volume of 2X BBS (equilibrated to room temperature), mix briefly and allow to stand for precisely 1 min. Add dropwise to the cells. Immediately return to either a 3% (for optimal transfection efficiency) or 5% humidified CO2 incubator at 36–38°C for 15–20 h (see Note 4). 3. Remove the transfection solution and wash three times with 1–2 mL of PBSE. Add 2 mL of complete medium and incubate (5% humidified CO2 incubator; 36–38°C) for 48–60 h.
3.1.2. Harvesting 1. Remove media and wash once with 1–2 mL PBSE. Add 1 mL PBSE and scrape cells off the well surface using a rubber policeman.
Promoter Studies in Hemostasis
73
2. Transfer the suspended cells into a 1.5-mL Eppendorf tube and centrifuge in a microfuge (11,600g; 13,000 rpm) for 2 min. 3. Resuspend the cell pellet in 100 µL cell lysis buffer. Incubate at room temperature for 60 min. 4. Centrifuge (11,600g; 5–10 min) and retain cell supernatant. Store extract (in microtiter plates for convenience if 96-well format luciferase assays are to be carried out) at –70°C.
3.1.3. Luciferase Assay 1. Thaw cell extract and luciferase assay reagent; equilibrate both to room temperature. 2. Add 20 µL of each cell extract under investigation to a well of a white polystyrene flat bottomed microtiter plate (e.g., Microlite 1™). Add 100 µL luciferase assay reagent, measure peak output in an appropriate luminometer (e.g., Dynatech ML3000) and derive a mean value for light output (in relative light units) over the peak period (normally in the range 30–90 s). Although automatic injection facilities are not required for monitoring the reaction it is advisable to simultaneously add the luciferase assay reagent and measure the light output. 3. Cell extracts can be normalized for transfection efficiency although certain problems may be experienced with some procedures (see Note 5).
3.2. Preparation of Nuclear Extract We have successfully used the following method, a slight modification of those originally described by Graves et al. (7) and Gorski et al. (8), to prepare nuclear extract from either freshly prepared rat liver or material stored at –70°C for one month. See Note 6 for an alternative procedure which we have used for preparing material from cultured mammalian cell lines. 1. The liver sample (5 g; we normally process two samples simultaneously and pool prior to the dialysis step) is finely minced using a sharp razor blade, rinsed with TBS and the liquid removed by filtering through sterile gauze. 2. Add 15 mL of chilled homogenisation buffer and homogenise the resultant suspension (10 strokes in a 10 mL Dounce Homogenizer). Filter the homogenate through sterile gauze and add NP40 to a final concentration of 0.5% (v/v). 3. The homogenization and filtration procedure is then repeated and the final homogenate resuspended (by vortexing) in an equal volume of prechilled 2.6 M sucrose buffer. 4. A nuclear pellet is obtained by layering this homogenate over 10 mL of 2.1 M sucrose buffer in a 38.5 mL polyallomer centrifuge tube and centrifuging at 100,000g, 0°C for 45 min (Beckman SW27 or SW28 swing bucket rotor; 27,000 rpm). 5. Resuspend the nuclear pellet in 4 mL prechilled nuclear lysis buffer and determine the OD260 content (U/mL) by assaying a 1:200 dilution in 0.5% SDS (w/v). Additional nuclear lysis buffer is then added to dilute the sample down to 20 OD260 U/mL. 6. Nuclear lysis is achieved by the gradual addition of 0.1 vol 4 M (NH4)2SO4 with constant stirring for 30 min at 4°C.
74
Winship and Spray
7. Nuclear debris is then removed by centrifugation at 100,000g at 0°C for 30 min in 26.3 mL polycarbonate tubes with cap assemblies using a Beckman 70Ti rotor (45,000 rpm). 8. Nuclear proteins are precipitated by the gradual addition (over approx 15 min) of sufficient solid (NH4)2SO4 to raise the concentration by a further 0.3 g/mL. The solution is then incubated on ice for a further 30 min to facilitate complete precipitation of proteins. 9. Centrifuge the precipitated nuclear proteins (100,000g at 0°C for 30 min. Beckman 70Ti fixed angle rotor; 45,000 rpm). Resuspend the protein pellet in dialysis buffer (use 1 mL per 10 mL of nuclear lysis buffer originally used). At this stage material can be pooled if two (or more) liver samples have been prepared in parallel (see step 1 above). 10. Dialyse against two changes of 250 mL dialysis buffer for a total of 4 h at 4°C. Alternatively, we find that the sample can be dialysed overnight and then for a further two hours once the buffer solution has been changed 11. Transfer the dialyzed solution to 1.5-mL Eppendorf tubes and centrifuge in a microfuge (11,600g, 5 min) to remove any precipitate which may have formed during dialysis. 12. Divide the supernatant into 50-mL aliquots, snap-freeze in liquid nitrogen and store long-term in liquid nitrogen or at –70°C. 13. The extract can be quantified by either the Lowry or Bradford protein assay methods (9,10) using 5, 10, and 20 µL of extract. Typically, 2–4 mL of extract derived from 10 g liver tissue would have a protein concentration in the range 1–3 mg/mL.
3.3. DNaseI Footprinting A number of methods have been described that differ in the precise composition of the binding buffer, incubation time of, and temperature at which binding (of protein to DNA probe) takes place. Alternative methods for achieving limited DNaseI digestion of the probe following incubation with nuclear extract have also been described. We will present a footprinting protocol that we have found to be both robust and reproducible.
3.3.1. Preparation of Radiolabeled Probe 1. One of the two oligonucleotide primers to be used in the PCR reaction is 5' end labeled using T4 polynucleotide kinase in a 10 µL reaction volume comprising: 0.1 vol 10X buffer, 5 pmol primer, 1.5 µL γ32P ATP, 5–10 U T4 Kinase. Incubate at 37°C for 15–30 min. 2. The PCR reaction is set up in a total volume of 50 µL containing 0.1 vol 10X PCR buffer, 5 pmol labeled primer in the 10 µL kinase reaction buffer (see above), 5 pmol unlabeled primer in the previously optimized buffer and reaction conditions for the chosen primer and template combination. It should be noted that the addition of the radiolabeled primer in kinase reaction buffer automatically makes the final PCR buffer 2 mM in MgCl2. This must be taken into account when
Promoter Studies in Hemostasis
75
optimizing the PCR conditions. See Note 7 for a set of PCR conditions we use which appear to be widely applicable when amplifying from plasmid templates.
3.3.2. Gel Purification and Elution of Probe 1. Add 0.1–0.2 vols sample loading buffer to the PCR product and size fractionate on a 20 cm × 20 cm (1-mm thick) 4–6% native polyacrylamide gel in 1X TBE at 200 V for an appropriate amount of time depending on the expected fragment size (see Note 8). Use 1-cm wide square-tooth wells. 2. Dismantle the gel apparatus, cover gel with cling film and expose to x-ray film for 5–10 min. Locate the position of the PCR fragment on the gel by overlaying the autoradiograph and excise the appropriate gel fragment with a scalpel blade. 3. Determine the approximate volume of the gel slice by weighing (assume a density of 1 g/mL for these purposes), add 2 vol elution buffer and incubate at 37°C overnight on a rotating platform. For convenience the gel slice should have a volume of no more than approximately 200 µL; this then allows the entire procedure to be carried out in a single 1.5-mL or 2-mL Eppendorf tube. Transfer the acrylamide/elution buffer mixture to the barrel of a 1-mL syringe plugged with siliconised glass wool. Place the syringe into a 15-mL tube such that it rests on the rim and recover the eluant following centrifugation at 1,600g for 2 min. 4. Transfer the eluant to a 1.5-mL Eppendorf tube. Add 0.1 vol 3 M sodium acetate and 2.5 vol ethanol; precipitate the DNA by incubation at –70°C for 30 min. Centrifuge in a microfuge (11,600g, 10 min), remove supernatant, add 200 µL 70% ethanol and recentrifuge (11,600g, 5 min) after vortexing briefly. It is convenient at this stage to check both pellet and supernatant with a mini monitor to ensure reasonable yield and efficient precipitation of the radiolabeled probe. 5. Resuspend initially in 50 µL distilled water. Adjust concentration to 20,000 cpm/µL as measured either in a scintillation counter or by holding 1 µL in a pipet tip immediately in front of the window of a hand-held mini monitor. The probe can be stored in this state at –20°C for up to 2 wk.
3.3.3. Binding Reaction and DNaseI Digestion We will present a method which we find reproducible; alternative reaction conditions which may be required in some circumstances are discussed in Note 9. 1. Into a 1.5-mL Eppendorf tube add 18 µL 5X binding buffer, 3 µg poly dI-dC, 30 µg nuclear extract (or an equivalent volume of dialysis buffer in the negative control) and distilled water to make the final volume 89 µL. Incubate at room temperature for 5–10 min. 2. Add 1 µL probe (20,000 cpm/µL) incubate at room temperature for 30 min. 3. Dilute RNase free DNaseI in 100 mM CaCl2. 4. We find it appropriate at this stage to optimize conditions by titrating four amounts of DNaseI: 0, 0.01, 0.1, and 1.0 U. To each 90 µL sample add appropriate amounts of DNaseI (diluted in 100 mM CaCl2 immediately before use) and/or 100 mM CaCl2 solution to give a final volume of 100 µL and final concentration
76
Winship and Spray
of 10 mM CaCl2 containing either 0, 0.01, 0.1, or 1 U of DNaseI. Mix by pipetting and incubate at room temperature for 30 s. Stop the reaction by the addition of an equal volume of phenol/chloroform/isoamyl alcohol (25:24:1 v/v). Vortex immediately and ensure complete mixing. 5. Centrifuge for 5 min in a microfuge (11,600g) and transfer the top (aqueous) phase to a fresh Eppendorf tube. Ethanol precipitate by adding 0.1 vol 3 M sodium acetate plus 2 vols., ethanol and incubating at –70°C for 30 min. Centrifuge (11,600g; 10 min), discard the supernatant and wash the DNA pellet with 400 µL 70% ethanol. Recentrifuge (11,600g; 5 min) and air dry the pellet.
3.3.4. Preparation of A+G Marker Track We find that the most reliable method of preparing a suitable marker track to allow the position of footprints to be determined is to follow a rapid method used for cleaving at A and G residues in Maxam-Gilbert sequencing (11). We routinely prepare sufficient material for four marker tracks. 1. To 4 µL (80,000 cpm) of probe in a 1.5-mL Eppendorf tube add 4 µL 1 mg/mL poly dI-dC and 6 mL distilled water. 2. Add 3 µL 8.8% formic acid and incubate at 37°C for 7 min. Stop the reaction by chilling to 0°C. 3. Add 150 µL 1 M piperidine at 0°C and incubate at 90°C for 30 min. 4. Add 1.2 mL 1-butanol, mix by vortexing for 30 s and then pellet the DNA by centrifugation in a microfuge (11,600g for 2 min). 5. Ensure complete removal of supernatant prior to resuspending the DNA pellet in 150 µL 1% SDS. Add 1–2 mL 1-butanol, mix by vortexing for 30 s, and centrifuge for 2 min at 11,600g. 6. Remove supernatant completely and allow the pellet to air dry. Store for up to 2 wk at –20°C.
3.3.5. Denaturing Polyacrylamide Gel Electrophoresis 1. Prepare a 20 cm × 50 cm (0.4-mm thick) 6% denaturing polyacrylamide gel using a 16 well square-toothed comb. 2. Resuspend each individual DNA pellet in 3 µL of denaturing gel loading buffer (use 12 µL for the marker) and denature by incubating at 90°C for 5–10 min. 3. Load 3 µL of each sample (including marker) on the gel and size fractionate at 38 W (1200–1500V) for an appropriate amount of time according to the region of interest (see Note 10). 4. Dismantle the gel apparatus. Fix the gel in an aqueous solution of 10% (v/v) methanol, 10% (v/v) acetic acid for 10–20 min. Transfer the gel onto 3MM filter paper (Whatman), cover with Saran Wrap™ and dry down at 80°C under vacuum. Autoradiograph at –70°C with intensifying screen and preflashed film.
3.4. Electrophoretic Mobility Shift Assay We will present the basic method for EMSA indicating the stage at which either unlabeled competitor oligonucleotide or antibody should be added when carrying out competition band shift and supershift assays respectively.
Promoter Studies in Hemostasis
77
3.4.1. Preparation of Radiolabeled Probe We will describe the method we normally use for making radiolabeled double-stranded probes from complementary oligonucleotides (20–40 bp in length). Larger probes can be made essentially by the same method described for the production of probes used in DNA footprinting (see Subheadings 3.3.1., 3.3.2., and Notes 7 and 11). 1. 5'-end label 12–15 pmol (approx 100 ng of a 20 bp oligonucleotide) of one of the 2 complementary oligonucleotide primers in a 10 µL final reaction volume containing 1 µL 10X Kinase buffer, 3 µL γ32P ATP and 5–10 U T4 polynucleotide kinase. 2. Incubate at 37°C for 20 min. 3. Heat denature the enzyme at 90°C for 10 min.
3.4.2. Annealing and Gel Purification of Probe 1. To the kinased oligonucleotide (or an equivalent amount of unlabeled oligonucleotide if a double-stranded competitor oligonucleotide is required) add 1 µL 20X annealing buffer, a fivefold molar excess of unlabeled complementary oligonucleotide and sufficient distilled water to give a final volume of 20 µL. 2. Incubate at 90°C for 10 min and then allow annealing to take place as the solution cools down to room temperature. 3. The annealed probe is now purified exactly as described in Subheading 3.3.2., except that to allow for the difference in size of the probes for footprinting and EMSA an 8 or 10% native polyacrylamide gel is used and the samples size fractionated for approx 1 h at 200V. The eluted probe is resuspended in distilled water at a final concentration of 10,000 cpm/µL. The position of an unlabeled fragment can be determined either by UV shadowing or in relation to the position of it’s homologous radiolabeled counterpart in an adjacent track. As a rough guide, 20 bp double-stranded DNA fragments migrate at approximately the same rate as bromophenol blue under these conditions.
3.4.3. Binding Reaction The components of the binding reaction and conditions under which binding takes place together with the conditions of electrophoresis have a profound effect on whether or not particular components of the nuclear extract are able to bind (see Notes 12 and 13). We present the most robust set of conditions which we have found for the binding of liver-specific transcription factors but some degree of experimental optimization for specific applications must be anticipated. 1. In a final volume of 19 µL, mix together 4 µL 5X EMSA binding buffer, 2 µg poly dI-dC and 10–20 µg nuclear extract. If required, NaCl should be added at this stage to adjust the final concentration to 50 mM. Incubate at room temperature for 10 min.
78
Winship and Spray
2. Add 1 µL (10,000 cpm) of probe and incubate at room temperature for 30 min. When competition or supershift assays are being performed, a 10- to 200-fold molar excess of cold competitor oligonucleotide or antibody respectively should be added at this stage. In the case of supershift assays increase the pre-incubation time to 2– 6 h. The final volume should remain at 20 µL; lower the volume in which prebinding takes place, but aim, if possible, to reduce this to no less than 18 µL.
3.4.4. Polyacrylamide Gel Electrophoresis As previously stated the composition of the size-fractionation gel will determine whether specific DNA-Protein complexes can be visualized (see Note 13). 1. Prepare a 20 cm × 20 cm, 1-mm thick 4% acrylamide (80:1 acrylamide:N, N’ methylene-bisacrylamide) gel containing 2.5% v/v glycerol in 0.5X TBE. Use a 16-well square-tooth comb. 2. Prerun the gel for 20 min at 200 V. 3. Load samples (do not add any loading buffer) and size-fractionate at 200 V for 90 min. 4. Dismantle the gel plates, transfer the gel onto 3MM paper (Whatman), cover with Saran Wrap™ and dry down at 80°C under vacuum. 5. Autoradiograph overnight using pre-flashed film and intensifying screen at –70°C if necessary.
4. Notes 1. Cloning promoter fragments into the reporter gene vector: a. We always ensure that the 3'-end of the cloned promoter fragment is located between the start sites of transcription and translation of the gene under investigation. This allows the production of reporter gene protein from the intended translation start site in the reporter vector while eliminating the risk of any incorrect translational initiation from within the cloned promoter fragment itself. b. A panel of reporter gene constructs is produced in which the promoter fragments have 3'-ends conforming to the conditions outlined in item a above and a series of different 5' boundaries. In this way, comparisons can be made between the different constructs and regions of potential regulatory importance defined. 2. Factors influencing choice of cell type include ease of transfection and maintenance together with the tissue of origin in relation to known tissue expression sites of the gene under investigation. HepG2 conforms to the above criteria and with it’s liver epithelial cell origin is probably the most commonly used cell line for the study of genes encoding proteins involved in the haemostatic process. 3. Carrier plasmid is used to both equalize the total amount of DNA in each transfection and adjust the overall DNA concentration to a level previously determined to give optimal transfection efficiency. Carrier plasmid should ideally be completely “neutral” and not contain sequences showing homology to known binding sites for mammalian transcription factors. Sonicated herring testes DNA
Promoter Studies in Hemostasis
4.
5.
6.
7.
79
can be used in place of plasmid but the relatively impure commercially available preparations may adversely affect transfection efficiencies. The calcium phosphate precipitation transfection procedure we use is based on an optimized method for HepG2 cells described by O’Mahoney and Adams (6). This method recommends the use of a low (3%) CO2 atmosphere during transfection originally described by Chen and Okajama (5). In our experience use of the standard 5% CO2 level at this stage does not severely compromise the transfection resulting in an approximate twofold reduction in efficiency. A number of options are available for normalizing reporter gene assays, each of which have relative advantages and disadvantages depending on the specific circumstances under which they are used. Determination of the total protein content in the cell lysates using the Lowry assay (9) essentially normalises for cell number, i.e., for a combination of starting cell number and harvesting efficiency. It should be stressed that this method will not of course control for transfection efficiency in each test sample. The most commonly used procedure to normalize for both cell number and transfection efficiency involves co-transfecting each test sample with an identical amount of a second reporter gene plasmid (e.g., β-galactosidase). The amount of this second reporter gene construct accumulated in the cell lysate is then measured by standard procedures (12). Unfortunately, this procedure is invalid in experiments assessing the effects of specific transactivators on the test promoter if the promoter driving expression of the second reporter gene is itself transactivated by the same factor(s). Furthermore, it has recently been reported that the cotransfection of a β-galactosidase expression vector together with the Luciferase test construct inhibited luciferase activity in a dose dependent manner, presumably owing to competition for the recruitment of limiting amounts of transcription factors (6). The only currently available procedure to overcome the limitations of the above method involves determining the amount of reporter gene plasmid DNA present in the cell lysate by dot blotting and hybridisation with a suitable radiolabeled probe. If transfection efficiencies are extremely low, then a more sensitive, quantitative PCR-based procedure may be required instead. The method we describe is suitable for the preparation of nuclear extract from both whole tissue and cultured mammalian cells. However, we find that the alternative, and much more rapid procedure described by Andrews and Faller (13) gives comparable results for nuclear extract prepared from cultured mammalian cells. We find the following PCR method to be widely applicable for the purposes of amplification with one radiolabeled primer: In a final volume of 50 µL add 1 ng plasmid template (or 1 µg genomic DNA can be tried if cloned sequences are not available), 10 µL radiolabeled primer (5 pmol) in kinase reaction buffer, 5 pmol unlabeled second primer, 200 µM final dNTPs 0.1 vol 10X buffer (166 mM ammonium sulfate, 670 mM Tris-HCl, pH 8.8, 100 mM 2-mercaptoethanol, 1 mg/mL bovine serum albumin—add the 2-mercaptoethanol and bovine serum albumin just before use) and 1 U Taq polymerase (Bioline). Overlay the samples with liquid paraffin. In a Perkin Elmer DNA synthesizer model 480 the samples are
80
8.
9.
10.
11. 12.
13.
Winship and Spray amplified under the following conditions: The DNA is initially denatured by heating at 95°C for 7 min followed by 30 rounds of primer initiated DNA synthesis comprising a 1 min, denaturation step at 94°C, annealing at 55°C for 1 min and finally a 2 min elongation stage at 72°C. To help determine the appropriate gel percentage and duration of electrophoresis the following information may prove useful: xylene cyanol FF comigrates with DNA fragment sizes of 460 and 260 bp on 3.5 and 5% native polyacrylamide gels respectively; the corresponding figures for bromophenol blue being 100 and 65 bp. An alternative binding buffer which we have also used successfully was originally described by Eul et al. (14) and has the following composition: 20 mM HEPES, pH 7.9, 50 mM KCl, 3.5 mM MgCl2, 2 mM DTT, 15% glycerol. Reactions are carried out in a 10 µL volume and incubated for 25 min at either 0, 20, or 37°C. The length of time for which the samples are size-fractionated is dependent on which region of the probe is being analyzed. By way of guidance, on a 6% denaturing polyacrylamide gel the bromophenol blue and xylene cyanol FF marker dyes comigrate with DNA fragments of approx 26 and 106 bp, respectively. We have successfully prepared and used probes up to approx 100 bp in length. Larger probes than this are not in our experience suitable for use in band shift assays. Alternative EMSA binding reaction conditions include: a) The Eul et al. footprinting buffer described in Note 8; b) 10 mM HEPES pH 7.8, 4% Ficoll400, 40 mM KCl, 2 mM MgCl2, 0.5 mM DTT; and c) 20 mM HEPES pH 7.9 at 40C, 1.5 mM MgCl2, 0.2 mM EDTA, 25% glycerol, 0.5 mM DTT. An alternative and widely used gel running buffer for EMSAs is a low ionic strength buffer comprising 6.7 mM Tris, pH 7.9, 3.3 mM sodium acetate, 1 mM EDTA. The gel itself is 4% polyacrylamide (80:1 acrylamide: N, N’ methylenebis-acrylamide), 2.5% (v/v) glycerol in the above buffer.
References 1. De Wet J. R., Wood K. V., DeLuca M., Helinski D. R., and Subramami, S. (1987) Firefly luciferase gene: structure and expression in mammalian cells. Mol. Cell. Biol. 7, 725–737. 2. Gorman C. M., Moffat L. F., and Howard B. H. (1982) Recombinant genomes which express chloramphenicol acetyl transferase in mammalian cells. Mol. Cell. Biol. 2, 1044–1051. 3. Alam J. and Cook J. L. (1990) Reporter genes: application to the study of mammalian gene transcription. Anal. Biochem. 188, 245–254. 4. Kristie T. M. and Roizman B. (1986) α4, the major regulatory protein of herpes simplex virus type 1, is stably and specifically associated with promoter-regulatory domains of alpha genes and of selected other viral genes. Proc. Natl. Acad. Sci. USA 83, 3218–3222. 5. Chen C. and Okayama H. (1987) High-efficiency transformation of mammalian cells by plasmid DNA. Mol. Cell. Biol. 7, 2745–2752. 6. O’Mahoney J. V. and Adams T. E. (1994) Optimisation of experimental variables influencing reporter gene expression in hepatoma cells following calcium phosphate transfection. DNA Cell Biol. 13, 1227–1232.
Promoter Studies in Hemostasis
81
7. Graves B. J., Johnson P. F., and McKnight S. L (1986) Homologous recognition of a promoter domain common to the MSV LTR and the HSV tk gene. Cell 44, 565–576. 8. Gorski K., Carnerio M., and Schibler U. (1986) Tissue-specific in vitro transcription from the mouse albumin promoter. Cell 47, 767–776. 9. Lowry O. H., Rosebrough N. J., Farr A. L., and Randall R. J. (1951) Protein measurement with the Folin phenol reagent. J. Biol. Chem. 193, 265–275. 10. Bradford M. M. (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilising the principle of protein dye binding. Anal. Biochem. 72, 248–254. 11. Maniatis T., Fritsch E. F., and Sambrook, J. (1989) Molecular Cloning: A Laboratory Manual, 2nd ed. Cold Spring Harbor Press, Cold Spring Harbor, NY, pp. 13.96–13.97. 12. Herbomel P., Bourachot B., and Yaniv M. (1984) Two distinct enhancers with different cell specificities co-exist in the regulatory region of polyoma. Cell 39, 653–662. 13. Andrews N. C. and Faller D. V. (1991) A rapid micropreparation technique for extraction of DNA-binding proteins from limiting numbers of mammalian cells. Nucleic Acids Res. 19, 2499. 14. Eul J., Meyer M. E., Tora L., Bocquel M. T., Quirin-Stricker C., Chambon P., and Gronemeyer H. (1989) Expression of active hormone and DNA-binding domains of the chicken progesterone receptor in E.coli. EMBO J. 8, 83–90.
Clotting Factors
85
9 Detection of Mutations and Polymorphisms in Clotting Factors by Denaturing Gradient Gel Electrophoresis Rainer Schwaab and Winfried Schmidt 1. Introduction In the last few years a number of methods have been developed that, in combination with the PCR method (1), have vastly improved the detection of mutations and polymorphisms. The most frequently used screening methods for mutation hunting in bleeding disorders are denaturing gradient gel electrophoresis (DGGE) (2), single-strand conformation polymorphism (SSCP) (3), and chemical mismatch cleavage (4). This chapter gives an introduction to the theory and practice of DGGE that facilitates the establishment of this mutation screening method. The DGGE method is generally able to detect point mutations, small deletions, and insertions by melting PCR amplified DNA fragments into single strands at different positions in a denaturing gradient gel. Every DNA fragment consists of one or more sequence areas that melt into single strands cooperative at a specific temperature (Tm). According to this phenomenon, these sequence areas are also called melting domains. The specific melting temperature of such a domain is influenced by interactions between the complementary strands and between adjacent bases of one strand. Based on this network of interaction, a single base pair change not only increases or decreases the melting temperature at this base position, but also changes the cooperative melting behavior of the whole melting domain. The neighboring melting domains are distinctly separated from each other by a rapid temperature change occurring within a few base pairs. In addition, melting domains in general vary in length between 25 and several hundred From: Methods in Molecular Medicine, Vol. 31: Hemostasis and Thrombosis Protocols Edited by: D. J. Perry and K. J. Pasi © Humana Press Inc., Totowa, NJ
85
86
Schwaab and Schmidt
base pairs and normally melt into single strands at a temperature of 65°C to 80°C (5). Within the electrophoresis, these melting temperatures can be achieved by a combination of a constant temperature (60°C) and by a linearly increasing denaturing gradient. Based on this knowledge, Lerman and Fischer developed the DGGE method, which allows the identification of mutations by comparing the different melting behaviors of wild-type DNA and a patient’s DNA on a denaturing gradient gel (5). Since the practical conditions of an optimum separation of DNA fragments can only be found by practice—which takes time and money—Lerman and Fischer then started to develop calculation programs (MELT87; SQHTX) for DGGE (6), which relied on the work of Poland (7), Fixman and Freire (8), and Gotoh and Tagashira (9). These programs allow one to find theoretically the optimum melting domain for a DNA fragment and also help to calculate whether any mutation within this DNA fragment can be identified under specific running conditions (gel running time, voltage, the scope of denaturing gradient). The results of the programs can be influenced by varying the amplification primers’ position. One further advantage of the DGGE method is the introduction of a GC-clamp on one site of the amplification product during the PCR reaction (10). This additional GC-attachment very often helps to unite two or more melting domains to a large one, with the consequence that the whole fragment can now confidently be screened for a sequence variation at one time. If this does not work, it might be that the mutations in the higher melting domain are not detectable during DGGE. Like the DGGE without a GC-clamp, the primers’ position, and additionally the effect of the GC-clamp attached to the 5'-site or the 3'-site of the amplification product, influences the results of the MELT87 and the SQHTX program (6). As we mentioned above, DGGE begins with preliminary theoretical work. While the MELT87 program assists in calculating a single melting temperature for a DNA region (exon), which is to be screened for mutations (Fig. 1) (10), the SQHTX program compares the melting temperature (running distance) of the wild-type with any mutated DNA fragment on a gradient gel in this region (11) (Fig. 1). According to these theoretical results, specific amplification primers (of which one bears a GC-clamp on its 5'-end) are synthesized flanking this DNAregion. After PCR reaction of a wild-type DNA, the double-stranded amplification products are composed of two different melting regions: a GC-region with a very high melting point and a lower melting domain, which is to be screened for mutations (10) (Figs. 1 and 2). The optimal running conditions of these products are then tested by running several so-called “travel schedule gels” (Fig. 3). At 2-h intervals, a sample is
Clotting Factors
87
Fig. 1. Schematic representation of DGGE. The first lane shows the heteroduplex results of a wild-type and a mutated DNA separated on a denaturing gradient gel, the second lane represents the separation of two mixed wild-type DNAs (homoduplexes). Comparing both results shows that the wild-type mixture melts at one position, because only homoduplexes of the same kind are formed. In contrast to this, the mixture of wild-type and mutated DNA show four different bands: the two different heteroduplexes and the original homoduplexes. The position of the two heteroduplexes always lies above the melting point of the homoduplexes. The mutated original homoduplex may be positioned above or below the wild-type homduplexes. At their melting point, the single strands are still held together by the GC-clamp, shown as a thick line.
loaded onto a travel schedule gel, which consists of a linearly increasing denaturing (urea/formamide) gradient. Electrophoresis runs under constant voltage
88
Schwaab and Schmidt
Fig. 2. Graphic demonstration of the melt map (MELT87) and the displacement map (SQHTX-program) of the factor VIII gene exon 16. MELT87: While the X-axis indicates the base position in the PCR fragment, the Y-axis left indicates the melting temperature (Tm [°C]) of each of these bases calculated by MELT87. The thin line represents the heterogenous melting behavior of the amplification product (composed of exon 16) and the flanking intron sequences, but without any GC-clamp. The solid line represents changes in the fragment’s melting behavior when a GC-clamp is connected to its 5'-site. As a consequence of this, the melting temperature of the first 40 bases, representing the GC-clamp, shows values of about 95°C, which then drop to a melting temperature of 69°C. This value keeps the rest of the amplification product and the exon 16 constant. SQHTX: The y-axis on the right site gives the displacement temperature (deltaT°C) for each base position of the same exon 16 PCR-fragment, including the GC-clamp. The dashed line shows that the displacement temperature goes from delta T 0°C (GC-clamp) up to about delta T 0.4°C, which exists in the whole exon 16 region. Since we know that under practical conditions the lower limit of displacement is deltaT = 0.1°C (= delta 0.3% denaturing concentration = 0.1 cm running distance in the gel), we can now detect all possible (point) mutations within the fragment of interest. The arrows show the position of three mutations detected in an analytical gel under these conditions (Fig. 4).
for 24 h. Under the right running conditions, one of the loaded wild-type DNA sample starts retarding to the gel. Its position is determined by a specific urea concentration which melts the lower melting domain of the double-stranded DNA into single strands all at once (Fig. 3, lanes 5 and 6, with an optimal running time of 20–22 h). Both strands are still connected by the high melting
Clotting Factors
89
Fig. 3. Results of a travel schedule gel showing the optimum running conditions of an amplification product, including exon 16 of the factor VIII gene. PCR products amplified from one wild-type DNA have in part successively been loaded onto gel from the right to the left 6 times at 2 h intervals (lane 2–7). According to the length of the running time, bands reach a denaturing concentration, which then causes the lower melting domain to melt into single strands. At this concentration, bands begin to focus and adhere in the gel (lane 4–7). However, the optimum running time (20–22 h) is represented by lane 5 and 6. In these lanes, bands are shown the first time to be most retarded and most distinctive. To demonstrate that a running time of 20–22 h is correct, an exon 16 amplification product with a point mutation was loaded successively (lanes 14–19) along with the normal amplification product - from left to right. In contrast to the wild-type PCR product, the best difference in running behavior can be observed after 20–22 h (lanes 5, 6 compared to lanes 15, 16). Lanes 8–13 show the advantage of analyzing heteroduplex formation between a wild-type and a mutant DNA fragment. Samples loaded from left to right separate on gel in 4 different bands representing two different homoduplexes and two different heteroduplexes. The heteroduplex bands differ very soon from homoduplexes, thus allowing a better mutation identification in critical cases.
GC-clamp, which allows the staining of the amplification product with ethidium bromide, making it visible on an UV transilluminator. When the running conditions (the gel gradient, the voltage and the running time) have been correctly established for a DNA fragment spanning a specific
90
Schwaab and Schmidt
Fig. 4. Analytical gel of the factor VIII gene exon 16 after heteroduplex formation of mutated patients’ DNA samples with a wild-type band. Mutations can be identified by any additional bands above the normal band (lanes 3–9). Controls, that is heteroduplex formation of two different wild-type PCR products, can be seen in lanes 2 and 10. Lanes 1 and 11 show a size marker produced by an HindIII digest of phiX174 DNA.
gene region, these conditions can now be used to run analytical gels for mutation screening (Fig. 4). Before loading the analytical gel, we form heteroduplexes between two patients’ PCR fragments or between a wild-type and a patient’s PCR product. As a control, heteroduplex formation between two wildtype PCR fragments is carried out. When gel electrophoresis and staining are completed, mutations can now be seen by identifying bands in addition to the normal control band (Fig. 4). The motive of the heteroduplex formation is to increase the sensitivity of the DGGE system. It produces two additional (heteroduplex) bands and therefore, allows detection of mutations that do not change the melting behavior of the wild-type and the mutant homoduplexes (Fig. 4). Although it takes some initial effort to establish the optimum electrophoresis conditions for every DNA fragment that has to be analyzed, once the method has been established, DGGE is a very fast, reliable, and sensitive method for identifying sequence variations.
Clotting Factors
91
Besides the chemical mismatch cleavage (CMC) (4) and the single-strand conformation polymorphism (SSCP) (3), the DGGE method described in this chapter is one of the most routine techniques for the analysis of inherited diseases or in a search for polymorphic sequences in linkage studies. It also shows the same, or almost the same, highly reliable sequence variation detection as the CMC, which is supposed to be the most accurate screening method. Once a mutation is identified, carrier diagnosis and prenatal diagnosis can be carried out by DGGE instead of by direct sequencing of the PCR products (12,13). The accuracy of the DGGE method can also be used by its ability to detect heterozygotes as well as mosaicisms. Since the efficiency of mosaicism detection has already been improved by many different applications, that are, e.g., detecting dominant TCR-gamma gene rearrangements at tumor clone densities that are as low as 0.1% (14), chimerism study after allogenic bone marrow transplantation with a detection limit of 1% (15) and mitchondrial mutation research (16), the method can also be used now to find mosaicisms in coagulation disorders. The routine application of DGGE is simple, with no radioactive labelling for signal detection needed. Once the method is established, the analysis is rapid and many samples can easily be screened at the same time, which has not only been the case for hemophilia A (17,18), but also for mutations in the factor IX-gene (hemophilia B) (19), the von Willebrand gene (20), the protein C gene (21), the protein S gene (22), and the factor V gene (23). However, in spite of all these advantages, this method is not optimal for every case of mutation screening. DGGE demands a substantial amount of theoretical and practical work for each DNA fragment, it should only be used if the same gene in many DNA samples is screened for mutations. DGGE only shows sufficient accuracy when the fragments in mutation detection are no larger than 350 bp. As a consequence, exons larger than 350 bp must be divided into two small overlapping amplifications. There are also some genes with a high GC-content, a factor that prevents melting of the double-stranded DNA into single strands in the gradient gel. Again, an alternative screening procedure must be selected. Another possibility besides CMC is SSCP. However, since this method is probably the least accurate in detecting sequence variations (24) and this method should only be used in our opinion if no other screening method is available, or if it is not important to find all possible mutations, or if finding the mutation in the shortest time (e.g., carrier diagnosis) is the priority. 2. Materials 2.1. PCR: Equipment 1. A thermal cycler. 2. Gilson or Eppendorf pipets with tips. If tips are only touched with gloves, autoclaving is not necessary. Filter tips are now also available. 3. 0.5 mL or 0.2 mL microcentrifuge tubes.
92
Schwaab and Schmidt
2.2. PCR: Reagents 1. A Taq DNA polymerase without any specific modifications (Pharmacia, Boehringer, etc.). If other Taq polymerases are used, the manufacturer should be asked which buffer conditions are applicable. Store polymerase at –20°C. 2. A 10X PCR buffer is normally included with the Taq polymerase. If this is not available a suitable 10X buffer comprises: 100 mM Tris-HCl, pH 8.8, 500 mM KCl, 15 mM MgCl2, 0.1% Triton X-100. Aliquot into 1 mL volumes and store at –20°C. 3. dNTP mix: 2 mM of dATP, dGTP, dCTP, dTTP in distilled water. Liquid stocks of single dNTPs are sold by many companies (e.g., Pharmacia, Boehringer). Aliquot and store at –20°C. 4. Mineral oil (e.g., Sigma molecular biology grade M5904) if using a thermocycler without a heated lid. 5. 300 ng/µL specific oligonucleotide primer without GC-clamp, 19–22 bp in length. 6. 900 ng/µL specific oligonucleotide primer (19–22 bp) with GC-clamp (39 bp: CGCCCGCCCCGCCCGCCGCCCGCCCCGCCCGCCGCCCGC). 7. Genomic DNA dissolved in TE (10 mM Tris, 1 mM EDTA, pH 8.0). A suitable dilution is 500 ng/mL. Store at 4°C. 8. 10X TAE buffer for agarose gels: 0.4 M Tris-HCl, 0.2 M sodium acetate, 10 mM EDTA, pH 7.4.
2.3. DGGE Equipment 1. An electrophoresis apparatus (Hoefer SE 600; glass plates 180 mm × 160 mm; spacer thickness 0.75 mm). The Hoefer SE 600 was originally developed to separate proteins, but can also perform DNA gel runs. 2. Power supply. 3. A coil to heat a water bath and a circulation pump to keep a constant gel temperature of 60°C during gel run. 4. A gradient mixer together with a magnetic stirrer and a butterfly intravenous infusion set for pouring the denaturing gradient gel. (The needle should have an outside diameter of 1.9 mm and be connected to a tube). 5. A microsyringe for loading the samples onto the gel. 6. A peristaltic pump for circulating the buffer between the upper and the lower tanks of the electrophoresis unit to prevent significant pH shifting during electrophoresis. 7. An UV transilluminator. 8. A gel documentation system to photograph gels (e.g., Polaroid camera). 9. A personal computer loaded with Lerman’s calculation programs MELT87 and SQHTX. The SQHTX program requires a personal computer with a mathematical coprocessor or with a Pentium processor. 10. MELT87 (10). 11. SQHTX (11).
2.4. DGGE Solutions 1. 10X TAE buffer, pH 7.4. 2. 40% formamide deionized with a mixed-bed resin that is afterwards filtered through a normal solution filter (Schleicher and Schüll).
Clotting Factors
93
3. 1X loading buffer: 20% Ficoll 400, 10 mM Tris-HCl, pH 7.8, 1 mM EDTA, pH 8.0, 0.1% orange G. 4. 40% polyacrylamide stock solution (acrylamide:bisacrylamide = 37.5:1). 5. 100% denaturing polyacrylamide stock solution: 7.0% polyacrylamide (using the 40% polyacrylamide stock), 7.0 M urea, 40% formamide dissolved in 1X TAE buffer, pH 7.4. 6. 0% denaturing polyacrylamide stock solution: 7.0% polyacrylamide (using the 40% polyacrylamide stock) dissolved in 1X TAE buffer, pH 7.4. 7. 10% ammonium persulphate stock solution. 8. TEMED. 9. Ethidium bromide stock solution (10 mg/mL).
All stock solutions should be prepared with deionized or distilled water and stored at 4°C. Ammonium persulfate stock solution should be stored at –20°C. 3. Methods 3.1. Amplification Amplification primers determined by the computer programs are synthesized on an oligonucleotide synthesizer (ABI) or ordered from a company. In either case primers are purified over high-pressure liquid chromatography (HPLC). 1. Prepare on ice the following: 10 µL 10X PCR buffer, 10 µL dNTP mix, 500 ng genomic DNA, 50 pmol oligonucleotide primer, 50 pmol oligonucleotide primer with GC-clamp, 2.5 U Taq DNA polymerase and add distilled water to a volume of 100 µL. 2. After mixing, overlay the PCR solution with mineral oil, and carry out the amplification on a thermocycler (Cetus or Biometra; without a heatable lid) according to the following conditions: an initial denaturation at 94°C for 420 s, followed by denaturing 94°C for 35 s, annealing at 50–57°C for 120 s and extending at 72°C for 60 s + 3 s/cycles. On the final step the extension time should be extended to 600 s. 3. After amplification check the specificity of the reaction by running 1/10th of the PCR product on a 2% agarose gel.
3.2.Travel Schedule Gel After amplification, the theoretical DGGE running conditions found by the computer programs need to be adapted to the practical running conditions. To do this, several denaturing gradient gels (travel schedule gel), which differ as to variation in the urea gradient, the voltage and the running time, need to be carried out respectively for several different amplification products. Since a strong correlation between theoretical and practical values exists, one could try to run analytical gels directly according to the theoretical data. Denaturing gradient gels can be run successfully in a Hoefer SE 600 electrophoresis unit
94
Schwaab and Schmidt
which is attached to a circulating water bath set to a constant temperature of 60°C (Fig. 5). This temperature is always used for travel schedule and analytical gels. To prepare the gel: 1. Clean the glass plates of the gel apparatus scrupulously, first with warm water then with iso-propanol and finally with distilled water. 2. Fix the glass plates within the fixation equipment by slightly greasing the bottom of the glass plates. 3. Take 10 mL of the 0% and of the 100% polyacrylamide stock solution and prepare the required solutions for the gradient gel (for instance: prepare a 40% and a 60% denaturing solution for a denaturing gradient gel that ranges between 40% and 60%). 4. Add 5.0 µL TEMED and 100 µL of 10% ammonium persulphate solution to each of the prepared solutions. Then pour the solution of the higher concentration into the anterior chamber of the gradient mixer (characterized by an output channel) and that of lower concentration into the posterior chamber. Place the gradient on a magnetic stirrer with a stirring bar inside the anterior chamber. Stir bar rapidly, while taking care that no air bubbles are produced. To avoid the use of a peristaltic pump, it is very important that the gradient mixer be positioned on a higher level than the glass plates within the fixation equipment. For the connection between gradient mixer and glass plates, use a butterfly intravenous infusion set consisting of a needle with a 1.9 mm outside diameter connected to a tube of 1.9 mm. The free end of the tube is connected to the output channel; the butterfly needle is placed between the glass plates. 5. Start pouring the gel: first open the channel between both mixer chambers and then the output channel. 6. When finished, put the sample comb between the glass plates and allow the gel to polymerize for about 2 h. 7. In the meantime mix 1/5 of the PCR products (amplified from one isolated wildtype DNA) with the loading buffer. 8. At the end of the 2 h, remove the sample comb from the polymerized gel and fix the glass plates in the electrophoresis unit. 9. Fill the buffer tanks with running buffer (1X TAE, pH 7.4), put gel into the electrophoresis unit and start a prerun to heat the buffer to 60°C. 10. When the buffer has reached 60°C, stop the prerun and load one wild-type sample onto the gel by a microsyringe and start electrophoresis again (e.g., 25 V for a 25–45% urea/formamide gradient gel). This and all other samples should be denatured (by heating on a thermocycler using a two step cycle: denature at 96°C for 10 min, then keep at 55°C for 10 min) before loading onto the gel. 11. Load additional PCR samples of the same probe five times at 2 h intervals. 12. After 24 h running time, stop the gel run. 13. Stain the gel with the ethidium bromide solution (stock solution diluted 1:10.000) for 1 h and evaluate the gel on a UV transilluminator.
Clotting Factors
95
Fig. 5. Assembled equipment for DGGE. Top left, pump that circulates buffer from lower to upper buffer tank of the gel electrophoresis. Bottom left, water bath set at 60°C that circulates water from bath through electrophoresis tank. Top right, power supply. Center right, gel electrophoresis (Hoefer SE 600). Bottom right, magnetic stirrer. 14. If the amplification products loaded at different times onto the gel shows neither a distinct pattern nor a retarded running behaviour, then start another travel schedule gel using a slightly different denaturing gradient and/or voltage. If the right running time has been found, the bands change from a diffuse to a distinct pattern due to a focus on the gradient and a conspicuous retardation. In the example shown in Fig. 3, the optimum running time is 20–22 h (lanes 5 and 6). These running conditions can now be used to run analytical gels for mutation screening.
3.3. Heteroduplex Formation and Analytical Gel 1. Pour the gel as noted for the travel schedule gel. Prior to loading the amplification product, form heteroduplexes between one wild-type PCR product and the patient’s PCR product or, sometimes better, between two different patients’ products (see Subheading 4.3., Notes 25 and 26).
96
Schwaab and Schmidt
2. To create the heteroduplex, mix: 10 µL (80 ng) of a PCR-fragment amplified from wild-type DNA with 10 µL (80 ng) of a patient’s PCR product. Use the same amplification primers for both products. Add sample buffer equal to onethird of this volume. 3. Heat the samples on a thermocycler using a two step cycle: denature at 96°C for 10 min, then keep at 55°C for 10 min. 4. Load the heteroduplex samples onto the analytical gel and start the gel run, using the running conditions optimized by the travel schedule gel. 5. After the gel run is completed, stain and evaluate gel as noted for the travel schedule gel.
4. Notes 4.1. Programs and PCR 1. If no single melting domain of one PCR fragment can be created—for instance the 5' or 3' DNA sequence is unknown or the DNA fragment melts in two or more domains in spite of testing all possible primers’ positions—then only (single) nucleotide changes in the lowest melting can be identified with any accuracy. As the wild-type and the mutated DNA fragments migrate through the gradient gel, they reach a position where the concentration of the denaturing agent equals the melting temperature (Tm) of their lowest melting domain. As a result, the two different fragments separate into single strands due to the difference in base sequences at different denaturing concentrations. If a single nucleotide change lies in the second melting domain, the lowest melting domain will melt at the same gel position for both wild-type and mutated DNA. If the gel run continues, DNA fragments slowly continue to migrate within the gel until they reach a second specific denaturing concentration, which results in melting in the higher melting domain. However, since migration of wild-type and mutated DNA is very slow and it takes a long time before the second melting occurs, differences in the melting of wild-type and mutated DNA are difficult to detect. If there is no chance of getting a single melting domain within one amplification product and DGGE needs to be performed, the original PCR product must be divided into two PCR fragments. Alternatively, DNA fragments can be screened with a different mutation screening method, e.g., the chemical mismatch cleavage. 2. If many DNA samples need to be amplified routinely, amplification primers (particularly the primer with the GC-clamp) should be ordered in large amounts (minimum scale 0.2 µmol). In addition new primers should be ordered before the old ones are used, because the quality of the primers sometimes vary and you may need to reject the first shipment. 3. An effective amplification primer should be 19–23 bp long (minus the GC-clamp) with a well-balanced composition of bases. 4. A primer should not be able to hybridize with itself or with its partners over a distance longer than 4 bases. 5. The 5' and the 3' external ends of one primer should not be complementary to more than one base of the external end of the other primer.
Clotting Factors
97
6. The Tm of each amplification primer optimally lies between 56°C and 60°C. Programs are available for determinating primers’ Tm. However, we have found that a rough calculation according to Tm of bases (A and T = 2°C; C and G = 4°C) may suffice. 7. We have found that the same basic amplification conditions can be used for each amplification reaction. To optimise the different reactions, it is sufficient to change the annealing temperature. 8. Amplification reactions with a GC-clamp on one of the amplification primers’ end give better results when the time of each annealing reaction is longer than an ordinary amplification reaction. We found an annealing time of 2 min to be sufficient. 9. If different thermocyclers are used, the annealing time often has to be changed to achieve the same amplification reaction. 10. You can also try to use smaller amounts of amplification primers and of DNA template. In any case DGGE results also depend on having a PCR product without any background bands or high background smear.
4.2. Travel Schedule and Analytical Gel 11. Acrylamide stock solutions (0% and the 100% denaturing solution) should be prepared in large amounts, because every new preparation varies slightly from the original one. When new solutions need to be prepared, running parameters must be checked with reference samples or with travel schedule gels. This is also very important for the analytical gel runs. 12. When opening the output channel of the gradient mixer to pour the gel, the gel sometimes sticks in the tube. In this case tap the tube. 13. Pour the gel slowly (about 5 min). This helps to prevent air bubbles in the gel and results in an even gradient. 14. When gel has been poured in the evening, but will not be used until the next morning, polymerized gel should be covered by cling film to prevent drying. 15. Instead of Orange G, other dyes can be used for the loading buffer, e.g., bromphenol blue or xylene cyanol 16. The temperature of the electrophoresis puffer should be controlled before every gel run. Optimally, a thermometer will show the buffer’s temperature during the whole electrophoresis process. 17. The recommended buffer temperature is 60°C, since this temperature is close to the melting temperature of the melting domains. 18. To determine the running time of the travel schedule gel, always use constant voltage. In our experience, more distinct bands are obtained when a longer running time rather than a higher voltage is used. For best results use a voltage range between 25–60 V. 19. We found that a 20% difference in the denaturing gradient between the gel’s top and bottom seems to be reasonable. 20. The variables in the travel schedule gel - voltage, running time, and gradient are dependent upon the size and base content of the amplification products. 21. If available, a PCR sample whose mutation has already been identified should be loaded onto every analytical gel as a positive control.
98
Schwaab and Schmidt
22. The ethidium bromide solution used for staining the gels is known to be carcinogenic. Always use gloves when handling the solution. In addition, safety glasses are recommended when stock solutions are prepared.
4.3. Heteroduplex Formation 23. Heteroduplexes can also be formed overnight. Heat samples for 5 min at 96°C in a closed water bath, switch the power off, and let water cool down to room temperature overnight. 24. When two different patients’ PCR products are used to form heteroduplexes and this sample has a deviating band pattern, we must still determine which PCR product bears the mutation. This mutation can be localized by directly sequencing both PCR products or by forming two new heteroduplexes in which each patients’ DNA is mixed with a wild- type DNA and run with a new analytical gel. 25. Heteroduplex formation improves the detection of mutations: a. It allows the simultaneous analysis of two amplification products from two patients. b. It produces two additional bands, by allowing the detection of mutations that do not change the melting behavior of wild-type or mutated homoduplexes. Sometimes the running behavior of a mutated DNA fragment cannot be distinguished from the wild-type DNA. One possible situation could be a (point) mutation, which results in an identical, but reversed, base pairing (A/T->T/A) that has no influence on the melting behavior of its adjacent bases. In case of heteroduplex formation, the formed heteroduplexes, which now present a T/T and A/A mismatch base pair, respectively, differ much more in melting behavior than the original double-stranded DNA. This results in a completely different melting behavior of the heteroduplexes to the homoduplexes. An example of the different melting behaviors of hetero- and homoduplexes (representing exon 16 of the factor VIII gene and originating from several patients) is shown in Fig. 4. When one of the DNAs used for heteroduplex formation resulted in a completely different base pairing, we were able to identify four different bands in the analytical gel: two homoduplexes and two heteroduplexes (lanes 3, 4, 6, 7, and 8). When the wild-type and the mutated homoduplexes were similiar in melting behavior, we were able to identify only three different bands, one homoduplex and two heteroduplexes (lanes 5 and 9). 26. Genes or polymorphims exist that only show a respective small spectrum of mutations (e.g., Factor V Leiden only has one mutation) or alleles. In these cases you must form heteroduplexes between a patient and a wild-type DNA and not between two patients’ samples, otherwise the mutation or polymorphism remain undetectable.
4.4. Modifications of DGGE 4.4.1. Constant Denaturant Gel Electrophoresis (CDGE) Another modification in the DGGE protocol is a denaturant gel electrophoresis that is constant (CDGE) (25). Mutant and wild-type DNA fragments are
Clotting Factors
99
separated in a constant urea/formamide concentration that must at least be optimized by running a perpendicular gel or a travel schedule gel. Up until now, this method has not been used to identify sequence variations in coagulation disorders. 27. CDGE avoids the routine use of a gradient by selecting a denaturant concentration at which maximum separation between the wild-type and mutated fragments can be achieved. 28. Like DDGE, the use of CDGE requires a careful selection of optimum conditions, which not only comprises the determination of the denaturant concentration by a perpendicular gel or a travel schedule gel but also the theoretical data (melting behaviour and the displacement [delta T°C]) calculated on the computer programs MELT87 and SQHTX. 29. Screening is fast, requiring 2–4 h of electrophoresis after PCR. The running time needed will depend on the band resolution required. A wide separation between wild-type and mutated DNA can be achieved by longer running times. In addition, bands seem to show a more diffuse pattern than in DGGE. 30. We personally favor DGGE over CDGE method. If the melting profile of a PCR fragment is not optimal, it seems more likely that differences in running behavior are more easily detected in a denaturing gradient than under constant gel conditions.
4.4.2. Temperature Gradient Gel Electrophoresis (TGGE) Temperature gradient gel electrophoresis (TGGE) is a temperature-based variation of DGGE (26). Instead of a chemical gradient, denaturation is performed on an apparatus especially made for this purpose. TGGE is also in use now for mutation screening in protein C deficiency (27). 31. Compared to DGGE and CDGE, TGGE eliminates complex chemical interactions in the gel matrix. The great advantage of this technique is that separated bands can be isolated from a nondenaturing gel, which facilitates further work, such as recloning, reamplification or direct sequencing. 32. Like DGGE and CDGE, the optimum melting conditions of the TGGE-method for any DNA fragment are only found by both the calculation programs and practice. 33. A further disadvantage of this system is that it is not possible to run several gels per run.
4.4.3. GC-Clamp The efficiency of DGGE is greatly enhanced by attaching a GC-clamp to a DNA fragment. This section of the chapter describes some alternative methods for the synthesis of a high melting domain. Since the synthesis of GC-primers, 60–70 bp in length, is costly, a simple method has been developed by Top (28) that allows the incorporation of a universal 50-bp GC-clamp in any amplified DNA fragment during PCR. To do this, PCR is carried out with the specific primers A and B, which are comple-
100
Schwaab and Schmidt
mentary to the target sequence to be amplified. In addition, primer B contains a 15-bp linker sequence at the 5' end, which is incorporated into the amplified fragment. Then a second PCR is carried out, using primer A and a third primer C composed of the 15-bp linker sequence at its 3' end and the conventional GC-clamp. The combination of both PCRs results in the amplification of the original genomic DNA and the 50-bp GC-clamp. The advantage of this method is that the universal primer (primer C) can be used for every PCR reaction. An alternative to GC-clamps is the use of psoralen derivative primers called “ChemiClamp” primers (29). Besides the specific sequence, one amplification primer is modified by adding two additional adenines at its 5' site and by attaching a 5-(w-hexyloxyl)-psoralen to them. After amplification, the (doublestranded) PCR products are placed directly on an UV source (UV transilluminator, 365 nm) at room temperature for 15 min. During exposure time, both strands of the PCR product will be firmly crosslinked. Psoralens react by forming covalent bonds with the pyrimidine bases of nucleic acids. 34. Although the Top method does at least reduce the costs of amplification primers, the introduction of the GC-clamp in conjunction with a second amplification reaction seems too laborious for routine DGGE use. 35. As an alternative to adding additional adenines to the 5' site of one primer as cited in Costes et al. (29), one could try varying primer positions to get sequence specific adenines on this position. 36. Compared to the GC-tailed primers, amplification with psoralen-clamped primers reduces the background smear in the analytical gel significantly. 37. However, the crosslinking between the single-stranded DNAs of the PCR product is not complete. For, when separating psoralen-crosslinked DNA fragment on a denaturant gradient gel, two bands are visible: the crosslinked PCR product and the single strands. This effect may hinder the correct interpretation of the bands, especially when using multiplex PCR.
4.4.4. Multiplex Analysis Multiplex PCR cannot only be used for CMC and SSCP, but also for DGGE as already demonstrated for cystic fibrosis (30). Since the procedure is very difficult, it has not yet been applied to analyze coagulation disorders. 38. It is very difficult to carry out multiplex PCR combined with DGGE as a mutation screening method. Simultaneous amplification and DGGE analysis of pools of exon fragments require that the annealing temperature of the primers in the PCR reaction, the range of denaturants in the gradient and the running time are in harmony. In addition, the Tm of the fragments analysed under these conditions must differ sufficiently for them to separate during electrophoresis.
Clotting Factors
101
4.4.5. Staining of Gels Beside the ethidium bromide solution there are several other less-carcinogenic chemicals available now for staining polyacrylamide gels. One very sensitive method is the silver-staining method, originally developed for PCR-SSCP (31). However, since the method is laborious and its sensitivity is not always required, a good alternative is the use of SYBR (sold by FMC or Biozyme Germany). Staining DNA bands with SYBR is not as sensitive as silver-staining, but using UV-light at 254 nm and a special photographic filter (SYBR Green Gel Stain Photographic Filter; Bio-Rad), this method is more sensitive than ethidium bromide. In contrast to ethidum bromide, the application of SYBR also results in a more uniform stain of the gels. 39. Although silver staining is laborious to handle, it is a useful method in identifying minute traces of a mutated DNA mixed with wild-type PCR products. This is a situation found in haemophilia A, in which mosaicism can occur (32). Others applications in which tiny amounts of mutant DNA must be detected admist wildtype DNA are, for instance, in the case of chimerism studies after allogenic bone marrow transplantation (12) and mutations in the mitochondrial genome (16).
4.4.6. Bio-Rad System An alternative to the DGGE electrophoresis unit descibed above is the electrophoresis system D-GENE, available from Bio-Rad. This sytem specifically constructed only for DGGE and CDGE, is a compact system that offers all the necessary components. Figure 6 gives a survey of the complete electrophoresis system. In combination with the computer program MacMELT (MELT87) adapted to MacIntosh computers, this compact DGGE system is a simple and easy way to perform DGGE rapidly in the laboratory. 36. If additional accessories (a larger gradient mixer and a casting stands which allows pouring of 10 gels at the same time) are bought for this electrophoresis, many samples can be screened in a relatively short time. 37. The gradient mixer of the D-GENE system is unusual in handling. If another gradient mixer has been used up to now, it may be a good idea to stay with the same gradient mixer. If a change in the system is preferred, conditions have to be adapted accordingly. 38. This system does not come with a SQHTX program. However, to get optimum separation of amplification products, the SQHTX program should be used first in any case.
Acknowledgments Figures 1–5 were produced from ref. 33 with permission of Oxford University Press. Figure 6 was produced with permission of Bio-Rad.
102
Schwaab and Schmidt
Fig. 6. Description of major components of the D-GENE electrophoresis unit BioRad. 1. Lower buffer tank. 2. Lid with temperature controller. 3. Core. 4. Comb gasket holder. 5. Sandwich clamps. 6. Casting stand with sponge. 7. Stopcock. 8. Combs and spacer set. 9. Alignment card. 10. Gradient delivery system. 11. Filler spacer.
References 1. Mullis, K. B. and Faloona, F. A. (1987) Specific synthesis of DNA in vitro via a polymerase-catalyzed chain reaction. Methods Enzymol. 144, 335–350. 2. Myers, R. M., Maniatis, T., and Lerman, L. S. (1987) Detection and localisation of single base changes by denaturing gradient gel elctrophoresis. Methods Enzymol. 155, 501–527. 3. Orita, M., Iwahana, H., Kanazawa, H., Hayashi, K., and Sekiya T. (1989) Detection of polymorphisms of human DNA by gel electrophoresis as single-strand conformation polymorphisms. Proc. Natl. Acad. Sci. USA 86, 2766–2770. 4. Cotton, R. G., Rodrigues, N. R., and Campbell, R. D. (1988) Reactivity of cytosine and thymine in single-base pair mismatches with hydroxylamine and osmiumtetroxyde and its application to the study of mutations. Proc. Natl. Acad. Sci. USA 85, 4397–4401. 5. Fischer, S. G. and Lerman, L. S. (1983) DNA fragments differing by single basepair substitutions are separated in denaturing gradient gels: correspondence with melting theory. Proc. Natl. Acad. Sci. USA 80, 1579–1583. 6. Lerman, L. and Silverstein, K. (1987) Computational simulation of DNA melting and its application to denaturing gradient gel electrophoresis. Methods Enzymol. 155, 482–501. 7. Poland, D. (1974) Recursion relation generation of probability profiles for specific-sequence macromolecules with long-range correlations. Biopolymers 13, 1859–1871. 8. Fixman, M. and Freire, J. J. (1977) Theory of melting curves. Biopolymers 16, 2693–2704.
Clotting Factors
103
9. Gotoh, O. and Tagashira, Y. (1981) Stabilities of nearest-neighbour doublets in double-helical DNA determined by fitting calculated melting profiles to observed profiles. Biopolymers, 20, 1033-1042. 10. Sheffield, V. C., Cox, D. R., Lerman, L. S., and Myers, R. M. (1989) Attachment of a 40-base- pair G+C-rich sequence (GC-clamp) to genomic DNA fragments by the polymerase chain reaction results in improved detection of single-base changes. Proc. Natl. Acad. Sci. USA 86, 232–236. 11. Abrams, E. S., Murdaugh, S. E., and Lerman, L. S. (1990) Comprehensive detection of single base changes in human genomic DNA using denaturing gradient gel electrophoresis and a GC clamp. Genomics 7, 463–475. 12. Rosatelli, M. C., Dozy, A., Faa, V., Meloni, A., Sardo, R., Saba, L., Kan, Y. W., and Cao, A. (1992) Molecular characterization of beta-thalassemia in the Sardinian population Am. J. Human Genet. 50, 422–426. 13. Attre, O., Vidaud, D., Vidaud, M., Amselem, S., Lavergne J. M. and Goossens, M. (1989) Mutations in the catalytic domain of human coagulation factor IX: rapid characterization by direct genomic seuqencing of DNA fragments displaying an altered melting behaviour. Genomics 4, 266–272. 14. Wood, G. S., Crooks, C. F., and Uluer, A. Z. (1995) Lymphomadoid papulosis and associated cutaneous lymphoproliferative disorders exhibit a common clonal origin. J. Invest. Dermatol. 105, 51–55. 15. Muniz, E. S., Plassa, F., Amselem, S., Goossens, M., and Vernant, J. P. (1994) Molecular analysis of polymorphic loci to study chimerism after allogeneic bone marrow transplantation. Heteroduplex analysis in denaturing gradient gel electrophoresis: a new approach to detecting residual host cells. Transplantation 57, 451–456. 16. Lombes, A., Diaz, C., Romero, N. B., Ziegler, F., and Fordeaum, M. (1992) Analysis of the tissue distribution and inheritance of heteroplasmic mitochondrial DNA point mutations by denaturing gradient gel electrophoresis in MERRF syndrome. Neuromuscul. Disord. 2, 323–330. 17. Higuchi, M., Antonarakis, S. E., Kasch, L., Oldenburg, J., Economou-Petersen, E., Olek, K., Arai, M., Inaba, H., and Kazazian, H. H., Jr. (1991) Molecular characterization of mild- to-moderate hemophilia A: detection of the mutation in 25 of 29 patients by denaturing gradient gel electrophoresis. Proc. Natl. Acad. Sci. USA 88, 8307–8311. 18. Kogan, S. and Gitschier, J. (1990) Mutations and a polymorphism in the factor VIII gene discovered by denaturing gradient gel electrophoresis. Proc. Natl. Acad. Sci. USA 87, 2092–2096. 19. Satoh, C., Takahashi, N., Asakawa, J., Hiyama, K., and Kodaira, M. (1993) Variations among Japanese of the factor IX gene (F9) detected by PCR-denaturing gradient gel electrophoresis. Am. J. Hum. Genet. 52, 167–175. 20. Lavergne, J. M., De Paillette, L., Bahnak, B. R., Ribba, A. S., Fressinaud, E., Meyer, D., and Pietu, G. (1992) Defects in type IIA von Willebrand disease: a cysteine 509 to arginine substitution in the mature von Willebrand factor disrupts a disulphide loop involved in the interaction with platelet glycoprotein Ib-IX. Brit. J. Haematol. 82, 66–72.
104
Schwaab and Schmidt
21. Gandrille, S., Alhenc-Gelas, M., Gaussem, P., Aillaud, M. F., Dupuy, E., JuhanVague, I., and Aiach, M. (1993) Five novel mutations located in exons III and IX of the protein C gene in patients presenting with defective protein C anticoagulant activity. Blood 82, 159–168. 22. Gandrille, S., Borgel, D., Eschwege-Gufflet, V., Aillaud, M., Dreyfus, M., Matheron, C., Gaussem, P., Abgrall, J. F., Jude, B., Sie, P. Toulon, P., and Aiach, M. (1995) Identification of 15 different candidate causal point mutations and three polymorphisms in 19 patients with protein S deficiency using a scanning method for the analysis of the protein S active gene. Blood 85, 130–138. 23. Emmerich, J., Alhenc-Gelas, M., Gondrille, S., Fiessinger, J. N., and Aiach, M. (1994) A new case of familial thrombofilia: resistance to the effect of activated protein C. Presse Med. 23, 1285–1287. 24. Dianzani, I., Camaschella, C., Ponzone, A., and Cotton R. G. H. (1993) Dilemmas and progress in mutation detection. TIG 9, 403–405. 25. Borresen, A. L., Hovig, E., Smith-Sorensen, B., Malkin, D., Lystad, S., Andersen, T. I., Nesland, J. M., Isselbacher, K. J., and Friend, S. H. (1991) Constant denaturant gel electrophoresis as a rapid screening technique for p53 mutations. Proc. Natl. Acad. Sci. USA 88, 8405–8409. 26. Riesner, D., Steger, G., Zimmat, R., Owens, R. A., Wagenhöfer, M., Hillen, W., Vollbach, S., Henco, K., and Steger, G. (1989) Temperature-gradient gel electrophoresis of nucleic acids: analyses of conformations transitions sequence variations and protein-nucleic acid interaction. Electrophoresis 10, 377–389. 27. Hernandez, A., Uhrberg, M., Enczmann, J., Witt, I., Reitsma, P. H., and Wernet, P. (1995) Rapid identification of gene defects in protein C defiency by temperature gradient gel electrophoresis. Blood Coagul. Fibrinolysis 6, 23–30. 28. Top, B. (1992) A simple method to attach a universal 50-bp GC-clamp to PCR fragments used for mutation analysis by DGGE. PCR Methods Appl. 2, 83–85. 29. Costes, B., Girodon, E., Ghanem N., Chassignol, M., Thuong, N. T., Dupret, D., and Goossens, M. (1993) Psoralen-modified olignonucleotide primers improve detection of mutations by denaturing gradient gel electrophoresis and provide an alternative to GC clamping. Human Mol. Genet. 2, 393–397. 30. Costes, B., Fanen, P., Goossens, M., and Ghanem N (1993) A rapid, efficient, and sensitive assay for simultaneous detection of multiple cystic fibrosis. Human Mut. 2, 185–191. 31. Dockhorn-Dworniczak, B., Dworniczak., B., Brömmelkamp, L., Bülles, J., Horst, J., and Böckler, W. W. (1991) Non-isotopic detection of single strand conformation polymorphism (PCR-SSCP): a rapid and sensitive technique in diagnosis of phenylketonuria. Nucleic Acid. Res. 19, 2500. 32. Higuchi, M., Kochan, L., and Olek, K. (1988) A somatic mosaic for hemophilia A detected at the DNA-level. Mol. Biol. Med. 5, 23–27. 33. Michaelides, K., Schwaab, R., Lalloz, M. R. A., Schmidt, W., and Tuddenham, E. G. D. (1995) Mutational analysis: new mutations, in PCR II: A Practical Approach (Taylor, G. R., McPherson, M. J., and Hames, B. D., eds.), IRL, Oxford, UK, pp. 255–288.
Screening for DNA Mutations by SSCP
105
10 Screening for Mutations in DNA by Single-Stranded Conformation Polymorphism (SSCP) Analysis David J. Perry 1. Introduction A single-stranded DNA fragment may adopt several different conformations (conformers) which affect its electrophoretic mobility. The mobility of singlestranded DNA in a nondenaturing gel is dependent on both fragment length and secondary structure, which is sequence-dependent. As a result, changes in sequence may affect the conformation of the single-stranded DNA and under appropriate conditions, the differing conformations can be resolved from each other, thereby allowing an underlying sequence variation to be detected. The detection of sequence variations/mutations by studying the mobility of singlestranded DNA was first described by Orita in 1989 (1) and the technique is known as single-stranded conformation polymorphism (SSCP) analysis. There are countless modifications of the original technique, all of which attempt to increase the number of sequence variations that can be detected. One such modification, included in this chapter, involves the use of Mutation Detection Enhancement (MDE) gels. SSCP is useful for the detection of mutations/polymorphisms in PCR fragments of between 150 and 400 bp. To detect large fragments by SSCP analysis, it may be necessary to digest the fragment with a series of restriction enzymes to generate smaller fragments. Alternatively, additional primers may be used to generate a series of smaller but overlapping PCR fragments. An interesting modification of the SSCP technique involves biotinylation of one the amplification primers, which allows the subsequent purification of the PCR product by binding to streptavidin-coated magnetic beads. The purified fragment can then be digested sequentially with a series of restriction enzymes. In each case From: Methods in Molecular Medicine, Vol. 31: Hemostasis and Thrombosis Protocols Edited by: D. J. Perry and K. J. Pasi © Humana Press Inc., Totowa, NJ
105
106
Perry
the undigested fragment remains bound to the magnetic beads, but the digested fragment is “free” and can be screened for mutations (2). Following electrophoresis the DNA fragments must be visualized. Two protocols are included, one of which uses radiolabeled PCR products followed by autoradiography of the dried gel and the other involves silver-staining of the wet gel (see Chapter 7). 2. Materials 2.1. Radiolabeling of PCR Products with [γ-32P]dCTP Enzymatic amplification by PCR is a well-established technique and there are many books available that cover the method and its variations in some detail. An introduction to PCR and some of the ways in which the reaction can be optimized is included in this volume. The protocol for radiolabeling PCR products included here assumes some knowledge of PCR. Some methods for labeling PCR products involve end-labeling the amplification primers with polynucleotide kinase and [γ-32P]ATP. However, this is a more labor-intensive method and unsuitable for large PCR products, which are subsequently to be digested prior to electrophoresis as internal digestion products are not labeled. The method described involves incorporation of a radionucleotide into the PCR product during the amplification reaction. 1. PCR reagents: see Chapter 2. 2. [32P]dCTP (1000–3000 Ci/mmol) (Amersham plc) (see Note 1). 3. Light mineral oil (e.g., Sigma).
2.2. Standard Polyacrylamide-Based SSCP Gels 1. 50% Acrylamide—N,N’-Methylenebisacrylamide (99:1) stock solution. Make by dissolving 99g of acrylamide and 1g of N,N’-Methylenebisacrylamide in 150 ml of distilled water at 65°C. When the acrylamide has dissolved make the volume of the solution up to 200 ml with distilled water. Store at 4°C (see Notes 2 and 3). 2. 10X TBE (Tris-Borate-EDTA): 108 g Tris base, 55 g orthoboric acid, 7.4 g Na2EDTA dissolved in 1 L distilled water. 3. Loading buffer/Stop solution: 95% formamide (v/v), 10 mM NaOH, 0.25% bromophenol blue (w/v), 0.25% xylene cyanole (w/v). 4. TEMED. 5. 10% Ammonium persulfate, freshly prepared immediately before use.
2.3. MDE-Based SSCP Gels 1. MDE gel solution (AT Biochem). Comes as a 2X solution. 2. 10X Tris-Borate-EDTA. 3. Loading buffer/stop solution: 95% formamide (v/v), 10 mM NaOH, 0.25% bromophenol blue (w/v), 0.25% xylene cyanole (w/v).
Screening for DNA Mutations by SSCP
107
4. TEMED. 5. 10% Ammonium persulfate, freshly prepared immediately before use.
3. Methods 3.1. Radiolabeling PCR Products with [γ-32P]dCTP Twenty microliters amplification reactions or less are ideal for labeling PCR products with [32P]dCTP as only a small fraction of the reaction is subsequently run on a gel. 1. Prepare a master PCR mix equal to the number of amplification reactions required containing all the reagents required for the amplification reaction. This should include water, primers, buffer, dNTPs, the appropriate concentration of Mg and the DNA polymerase. An example of a 100 µL master mix suitable for 5 × 20 µL amplification reactions contains: 100 pmoles of each amplification primer, 200 µM of each dNTP, 10 µL of 10X PCR buffer (15 mM MgCl2, 100 mM Tris-HCl pH 8.8, 500 mM KCl, 1% Triton X-100 [v/v]), 2.5 U of a thermostable DNA polymerase, e.g., Amplitaq and water to 90–95 µL, the precise volume of water depending upon the DNA concentration. 2. Add 1 µL of [32P]dCTP for every 100 µL of the master mix and then carefully pipet into 20-µL aliquots (see Note 1). 3. Add 1–2 µL of DNA (100–250 ng) to each tube and then overlay with 20 µL of light mineral oil. 4. Place the samples in the PCR block and carry out 35–40 rounds of amplification. 5. Following amplification, place the samples at –20°C until the fluid phase but not the oil is frozen. The oil can then be carefully removed and disposed of. As the latter is radioactive it must be disposed of accordingly.
3.2. “Standard” SSCP Gels (see Note 4) 1. 40 cm × 20 cm glass gel plates are washed with detergent, rinsed in deionized water and wiped dried with lint free tissues. Any grease is removed by wiping each plate with an ethanol-soaked tissue and then allowing it to dry. 2. Siliconize the “eared” plate by pipetting 2 mL of dimethylchlorosilane on to the plate, spreading it over the surface of the plate with a lint-free tissue and then allowing it to dry at room temperature in a fume hood 3. Assemble the plates using 0.4 mm spacers according to the manufacturer’s instructions. 4. Mix together in a beaker 12 mL of 50% acrylamide solution, 10 mL of 10X TBE and water to 100 mL (see Note 4). Add 130 µL of TEMED and 130 µL of 25% ammonium persulphate and mix quickly. Aspirate the solution into a 50-mL syringe, attach a 0.45-µm filter and pour the gel into the assembled plates. 5. Insert a 0.4-mm gel comb containing 24-wells and allow the gel to polymerize for at least 60 min. 6. Assemble the gel plates and the electrophoresis apparatus according to the manufacturer’s instructions and pre-run the gel for 30 min in 1X TBE at a constant voltage of 500 V (see Notes 4 and 5).
108
Perry
7. Add 2 µL of the radiolabeled PCR product to 8 µL of loading buffer and heat at 95°C for 5 min and then rapidly cool by placing on ice for 2–3 min. Load 2 µL onto the gel using disposable “Duck billed” tips. A radiolabeled marker should be included in lane 1; this allows the orientation of the subsequent autoradiograph to be determined. A nondenatured PCR product should be run in lane 2 (see Note 6). 8. Carry out the electrophoresis at room temperature at constant voltage (500 V). 9. Following electrophoresis, allow the pates to cool then carefully separate the gel plates and transfer the gel to Whatman 3MM paper by carefully placing a sheet of the paper on top of the gel and smoothing it over the surface of the gel. Carefully lift the paper starting at one corner and the gel will adhere to the paper. Cover the gel with a sheet of Saran Wrap™ and dry under vacuum at 80°C for 1–2 h. 10. Expose the dried gel to a sheet of X-ray film for 2–5 d in an appropriate cassette.
3.3. MDE-SSCP Gels 1. Wash 40 cm × 20 cm glass gel plates with detergent, rinse in deionized water and wipe dried with lint free tissues. Remove any grease by wiping each plate with an ethanol-soaked tissue and allow to dry. Siliconize one of the two plates (the “eared” plate) by pipetting 2 mL of dimethylchlorosilane on to the plate, spreading it over the surface of the plate with a lint-free tissue, and then allowing it to dry at room temperature in a fume hood. 2. Electrophoresis is carried out in a vertical fashion. Assemble the gel plates using 0.4-mm spacers according to the manufacturer’s instructions. 3. For 100 mL MDE gel mix: combine 25 mL of 2X MDE gel solution with 6 mL of 10X TBE and make up to 100 mL with deionized water (see Note 7). 4. Add 40 µL of TEMED and 400 µL of 10% ammonium persulphate and mix thoroughly. 5. Pour the gel between the tilted gel plates using a 50-mL syringe fitted with a 0.45-µm filter. Insert a 20-well comb with 0.5-cm teeth and clamp the top of the gel plates around the comb with bulldog clips. Place the gel horizontally and allow to polymerize for at least 60–90 min at room temperature. 6. When the gel is polymerized, carefully remove the comb and remove any adherent polymerized gel. 7. Mount the gel into the sequencing apparatus. Fill the apparatus/buffer chambers with 0.6X TBE. Carefully flush out the wells. 8. Prerun the apparatus for 20–30 min at 6–8 W constant power at room temperature. A cooling fan may be directed at the gel to ensure that the gel does not overheat. 9. Add 1–2 µL of PCR product to 9 µL of stop solution and incubate at 94°C for 5 min, then place the denatured DNA samples onto ice for 2–3 min. 10. Rinse the wells and load 2–3 µL of each PCR product. A radiolabeled marker should be included in lane 1, which allows the orientation of the subsequent autoradiograph to be determined. A double-stranded DNA control sample should also be included. Do not heat-denature this and use a nondenaturing loading buffer. 11. Run at 6–8 W constant power for 12–14 h at room temperature. The precise electrophoresis times must be determined for each PCR product.
Screening for DNA Mutations by SSCP
109
12. When the electrophoresis is complete, remove the gel plates and separate. Transfer the gel to a sheet of Whatman 3 MM paper and cover with Saran Wrap. Dry the gel under vacuum at 80°C. Expose to X-ray film using standard techniques.
4. Notes 1. [32P]dCTP is strongly radioactive and must be handled with care. Workers using any radio-isotope must have training in their safe use and facilities must be available for the safe disposal not only of the isotope but also any contaminated solutions, pipet tips, Eppendorfs, etc. Obviously if silver staining is to be used, it is not necessary to radiolabel the PCR product! Because of our concerns over the radioactivity, silver staining is now our method of choice for detecting DNA fragments on SSCP gels. 2. Acrylamide and bisacrylamide are potent neurotoxins, mutagens, and teratogens and should, therefore, be handled with care. Always wear masks, gloves, and safety glasses during handling of these reagents especially when in the powder form and in a fume hood. 3. Allow the solution to warm to room temperate before use and any crystalline acrylamide/bisacrylamide will go back into solution. 4. Their are many variations of the SSCP technique. The original method used gels that contained glycerol, but we have found that this is not necessary. We do not routinely carry out the electrophoresis at 4°C, although in some cases a mutation may only be detected by electrophoresis at 4°C. The concentration of acrylamide and the ratio of acrylamide:bisacrylamide is important and this may be require optimization for a particular PCR fragment. The methods outlined is a good starting point to begin screening for mutations. 5. The precise voltage is dependent on many variables including the size of the PCR fragment. 500 V is suitable for an overnight run of fragment between 200 and 400 bp. We routinely use a fan aimed at the electrophoresis apparatus to cool the system. 6. Single-stranded DNA molecules may adopt more than one conformation and so gels may contain a number of bands. In addition, re-annealing of single-stranded fragment may occur giving rise to a double-stranded product. A nondenatured PCR product should be run on each gel to identify the position of this fragment. It is generally weaker than the single-stranded fragments. 7. 0.5X MDE is generally recommended as a starting point for MDE-SSCP gels, but it may be of value to use other concentrations of MDE between 0.4 and 0.7X.
References 1. Orita, M., Suzuki, Y., Sekiya,T., and Hayashi, K. (1989) Rapid and sensitive detection of point mutations and DNA polymorphisms using polymerase chain reaction. Genomics 5, 874–879. 2. Michaelides, R., Schwaab, R., Lalloz, M. R. A., Schmidt, W., and Tuddenham, E. G. D. (1995) Mutational analysis: new mutations, in PCR 2: A Practical Approach. IRL, Oxford, UK.
110
Perry
Suggested Reading Hayashi, K. (1991) PCR-SSCP: A simple and sensitive method for detection of mutations in genomic DNA. PCR Methods Appl. 1, 34–38. Leren, T. P., Solberg, K., Rodningen, O. K., Ose, L., Tonstad, S., Berg, K. (1993) Evaluation of running condions for SSCP analysis: application of SSCP for detection of point mutations in the LDL receptor gene. Genomics 3, 159–162. Takahashi-Fujii, A., Ishino, Y., Shimada, A., and Kato, I. (1993) Practical application of fluorescence-based image analyszer for PCR single-stranded conformation polymorphism analysis used in detection of multiple point mutatiohns. PCR Methods Appl. 2, 323–327.
Factor VII Gene
111
11 Screening for DNA Heteroduplexes in the Factor VII Gene Using Ethylene Glycol Gel Electrophoresis of Solvent-Treated 32P-Labeled PCR Products Peter Baker 1. Introduction Sequencing exon by exon to identify mutations is both laborious and time consuming. Screening techniques have been sought to identify mutations without the need for this. Rapid detection of single base changes have focused on identification of the heteroduplex formed when wild-type and mutant come together (1–3). Enzymes have been employed to cleave the heteroduplex at the mismatch site, but this obviously needs the bases to be known prior to commencement (1). A second option is to detect the change by monitoring the affect on melting temperature of the double-stranded DNA and its subsequent migration during denaturing gel electrophoresis (2). Third, chemicals can be employed that bind to the mismatch site, allowing immunochemical labeling of the products for identification (3). All these techniques have their limitations and no one method will detect all mutations (4–6). The technique described here has been modified from an original report by Ganguly et al. (7) using [α-32P]dCTP incorporated into the PCR products and then run on a polyacrylamide gel containing ethylene glycol and formamide to induce bends in heteroduplexes and so alter electrophoretic mobility. This chapter describes its value in screening for mutation in the human factor VII gene. FVII acts as a key zymogen in the hemostatic pathway leading to clot formation and endothelial repair. Tissue factor (TF) exposed by vascular injury binds to the zymogen causing cleavage of the molecule into a two chain active form (FVIIa). It is the TF:FVIIa complex that in turn activates factors VII, IX, and X to initiate thrombin generation and clot formation. Cases of elevated From: Methods in Molecular Medicine, Vol. 31: Hemostasis and Thrombosis Protocols Edited by: D. J. Perry and K. J. Pasi © Humana Press Inc., Totowa, NJ
111
112
Baker
FVII leading to cardiovascular disease have been reported while deficiency has a variable bleeding outcome or paradoxically thrombotic manifestations (8,9). 2. Materials 2.1. PCR Materials All reagents supplied by Sigma (Poole, UK) or BDH Laboratory Supplies (Poole, UK) unless otherwise stated. 1. PCR primers. Synthesized oligonucleotides conforming to general production rules (see Note 1) reconstituted in UV treated H2O and stored at –20°C. 2. 10X PCR buffer: 500 mM KCl, 10 mM Tris-HCl, pH 8.3. Store at –20°C. 3. 25 mM MgCl2: Store at –20°C. 4. 20 mM dNTP’s: Dilute 100 mM stocks (available from many sources) 1+4 and store at –20°C. 5. Thermostable DNA polymerase, e.g., AmpliTaq (Perkin Elmer): 5 U/µL. Store at –20°C. 6. [α-32P]dCTP (Amersham, UK). Store at 4°C (see Note 2). 7. 10X TBE buffer: 121 g Tris 121, 61.8 g Boric acid, 7.4 g Na2EDTA. Distilled H2O to 1 L. Store at room temperature. 8. 10 mg/mL Ethidium bromide. 9. 1.5% Agarose gel in 1X TBE buffer (see Note 3). 10. PCR Loading buffer: 0.25% (w/v) bromophenol blue, 0.25% (w/v) xylene cyanol, 20% sucrose (w/v). 11. Molecular weight markers. ØX174-HaeIII Digest (New England Biolabs, Hitchin, UK). 12. Chromatography paper (Whatman International Ltd, Maidstone, Kent, UK). 13. Saran Wrap™. 14. TEMED. 15. 25% Ammonium persulfate, freshly prepared immediately before use. 16. 30% Acrylamide:bisacrylamide (19:1) (see Note 4). 17. Tris-Taurine-EDTA (TTE) buffer: 89 mM Tris, 15 mM Taurine, and 0.5 mM Di-sodium EDTA. Prepare by combining 21.4 g Tris base, 3.7 g Taurine, 0.372 g Na 2EDTA, and make up to 2 L with distilled H2O. Store at room temperature. 18. Gel loading buffer for acrylamide electrophoresis: 20% ethylene glycol (v/v), 30% formamide (v/v), 0.025% xylene cyanol (w/v), and 0.025 % bromophenol blue. Store at room temperature 19. Acrylamide gel mix is prepared by combing 20 mL of 30% acrylamide, 10 mL of ethylene glycol, 13.27 formamide, 50 mL TTE buffer and distilled water. Filter through a 0.45-mm syringe filter prior to use (see Note 4) 20. 100 mM EDTA. 21. Gel apparatus: Sequencing-type apparatus is used and available from many suppliers. Plates should measure 40–50 cm × 20 cm.
Factor VII Gene
113
3. Methods 3.1. PCR Reactions Reaction conditions will vary according to the target DNA sequence being amplified, however standard PCR cycling times can be found in any text and provide a point from which to start (see Note 5). 1. Twenty microliter amplification reactions are performed and consist of: 16 µL of UV H2O, 2 µL of 10X PCR buffer, 1.2 µL of 25 mM MgCl2, 0.2 µL 20 mM dNTP’s, 0.2 µL of each amplification primer at 50 pmol/µL, 0.4 µL DNA (1 µg) (see Note 6), 0.2 µL [α-32P]dCTP, and 0.4 µL (2 U) of a thermostable DNA polymerase (see Note 7). Overlay with mineral oil. Appropriate negative and positive controls should be included in each batch of amplifications. In addition, include 1–2 samples that do not have the radiolabeled nucleotide present in the amplification mix. 2. Transfer to a thermal cycler and incubate at 95°C for 5 min to denature the doublestranded DNA and carry out 40 cycles of amplification comprising: 94°C for 10 seconds, 54–60°C for 10 s (depending upon the primers) and 74°C for 10 s. On the last cycle the extension time should be increased to 10 min. 3. Check the efficiency of the amplification reaction by mixing 5 µL of the unlabeled PCR products with 1 µL of loading buffer and running on a 1.5% agarose gel in 1X TBE. Run for 10–15 min at 90 V using molecular weight markers in Lane 1 to identify correct product size. 4. Visualize under UV light, photograph for permanent record.
3.2. Gel Preparation 1. Prepare the gel plates by washing thoroughly, first with a mild detergent, wiping dry with lint-free tissues, and then wiping over with 90% methanol. Coat one plate with dimethylchlorosilane and allow to dry. 2. Assemble the gel apparatus using 1-mm spacers. 3. Prepare the acrylamide/ethylene glycol/formamide gel mix and add 130 µL TEMED and 130 µL of 25 ammonium persulfate to initiate polymerization. Draw up the solution into a 50-mL syringe and inject into the space the two glass plates. Insert a 12-tooth comb (0.5-cm wide teeth). Clamp the top of the gel and allow to polymerize for at least 90 min. Assemble the apparatus, fill the upper buffer reservoir with 0.25X TTE and lower buffer reservoir with 1X TTE. Prerun the gel at 45 W (constant power) for 15 min. 4. Add 18 µL of each PCR product to 2 µL of 100 mM EDTA and incubate at 98°C for 5 min then 68°C for 60 min (see Note 8). 5. Add 4 µL of the PCR/EDTA mix to 4 µL of loading buffer. Load onto the pre-run gel and run for 2–4 h at room temperature depending on the size of the PCR product. 6. Separate the gel plates and transfer to chromatography paper (see Note 9). Place a layer of Saran Wrap over the gel and transfer to a gel dryer. Dry for 2 h at 80°C under vacuum. 7. Remove the Saran Wrap and expose to X-ray film (Fuji RX) in an intensifier cassette overnight at room temperature before being developed.
114
Baker
3.3. Interpretation of Results PCR products can be seen as distinct bands, heteroduplex formation leading to differential mobility of the mismatch pairing. The longer the products are run the greater the separation (see Fig. 1). Normal control DNA should be run at the same time for comparison. Limitations of the technique are its inability to differentiate heteroduplexes if the mutation occurs within 50 bp of the end of the amplified fragment. The benefits of these modifications from the original report are shorter running times and easier handling associated with a smaller gel, and greater visibility of the altered heteroduplex when 32P is incorporated. 4. Notes 1. Oligonucleotide synthesis should be performed according to the common guidelines available. Use of primer pairs already documented as producing the DNA fragment of interest will save time. Computer programs are now available commercially that will produce matching primer pairs most likely to succeed. These take into account factors such as oligonucleotide length, G/C content, and primer pair homology. All these factors will affect the oligonucleotides ability to anneal specifically to the target sequence. 2. 32P is one of the highest energy radio nucleotides encountered in the laboratory. Precautions should be taken to minimise exposure to it. All work should be performed in a dedicated radioactive area shielded by 1 cm perspex (Plexiglas). Clothing including overalls, glasses and gloves should be worn with appropriate dosimeters i.e. those for monitoring the body and finger tips. 3. 1.5 % agarose gel is sufficient to differentiate PCR products when used in conjunction with suitable molecular weight markers. HaeIII digested ØX174 DNA gives a range of fragments spanning 1353-72 bp 4. Acrylamide:bisacrylamide is toxic and potentially carcinogenic. It can be absorbed via the skin and through inhalation. It should be used in well ventilated areas with gloves and mask. 5. Cycling times and conditions, as with primer design, play a key role in the amplification of a single DNA fragment. Annealing temperatures can be calculated to obtain maximal specificity in the reactions with the primer pair being used. Also buffer concentrations, particularly Mg2+ concentration will affect yield. Normal DNA amplification is recommended before patient samples are investigated. 6. DNA quality and concentration will vary according to source. Phenol/Chloroform extracted peripheral blood leukocytes were used in this instance, exact amounts being calculated by measuring the DNA absorbance at 260nm. Too much template will inhibit amplification. 7. The volumes of the reagents for a single 20 µL PCR are small and it is considerably easier to prepare a master mix containing all reagents minus the DNA. This can then be aliquoted into individual amplification tubes and the DNA added. 8. Once the PCR products have been incubated at 68°C to induce maximal heteroduplex formation, a sample can be run on normal 1.5% agarose gel prior to loading to confirm they are still intact.
Factor VII Gene
115
Fig. 1. An acrylamide/ethylene glycol/formamide gel showing Exon 5 of the human factor VII gene: Lane 1 Normal, Lanes 2 and 3 show two patients with a single basepair substitution at codon 115 [115 CAC → CAT]. 9. Separation of the glass plates can be made easier by inserting a scalpel blade, or similar, between them and gently levering. If the plates are first allowed to cool then the gel will be easier to handle. The gel should stick to the plate not coated with dimethyldichlorosilane. If this doesn’t happen it can still be removed with care!
References 1. Shenk, T. E., Rhodes, C., Rigby, P. W. J., and Berg, P. (1975) Biochemical method for mapping mutational alterations in DNA with S1 nuclease: the location of deletions and temperature sensitive mutations in Simian virus 40. Proc. Natl. Acad. Sci. USA 72, 989–993. 2. Lerman, L. S. and Silverstein, V. (1987) Computational simulation of DNA melting and it’s application to denaturing gradient gel electrophoresis. Methods Enzymol. 155, 482–501. 3. Novack, D. F., Casna, N. J., Fischer, S. G., and Ford, J. P. (1986) Detection of single base-paired mismatches in DNA by chemical modification followed by electrophoresis in 15% polyacrylamide gels. Proc. Natl. Acad. Sci. USA, 83, 586–590.
116
Baker
4. Dodgson, J. B. and Wells, R. D. (1977) Action of single-stranded specific nucleases on model DNA heteroduplexes of defined size and sequence. Biochemistry 16, 2374–2379. 5. Myer, R. M., Maniatis, T., and Lerman, L. S. (1987) Detection and localisation of single base changes by denaturing gradient gel electrophoresis. Methods Enzymol. 155, 501–527. 6. Ganguly, A., Rooney, J. E., Hosomi, S., Zeiger, A., Prockop, D. J. (1989) Detection and location of single-base mutations in large DNA fratgments by immunomicroscopy Genomics 4, 530–538. 7. Ganguly, A., Rock, M. J., and Prockop, D. J. (1993) Conformation-sensitive gel elctrophoresis for rapid detection of single-base differences in double-stranded PCR products and DNA fragments: evidence for solvent-induced bends in DNA heteroduplexes. Proc. Natl. Acad. Sci. USA 90, 10,325–10,329. 8. Meade, T. W. (1983) Factor VII and ischaemic disease: epidemiological evidence. Haemostasis 13, 178-185. 9. Tuddenham, E. G. D, Pemberton, S., and Cooper, D. (1995) Inherited factor VII deficiency: genetics and molecular pathology. Thromb. Haemostasis 74(1), 313–321.
Hemophilia A
117
12 Detection of Mutations Causing Hemophilia A Using an In Vitro Coupled Transcription and Translation System Chike Ononye and P. Vincent Jenkins 1. Introduction Mutation detection in the factor VIII gene is complicated by the size and complexity of the gene—186 kb spanning 26 exons. The exons vary in size from 69 bp to 3106 bp and the introns from 207 bp to 32.4 kb (1). The first mutations to be identified in the factor VIII gene involved mutations at Taq I restriction sites (an enzyme that contains the mutational CpG dinucleotide within its recognition sequence) or were large deletions detected by Southern blotting (2). Small deletions, substitution, and missense mutations proved more difficult to detect as these appear to be randomly distributed throughout the factor VIII gene. For these reasons, therefore, many laboratories involved in carrier detection in Hemophilia A have used an indirect procedure known as gene tracking or linkage analysis. This involves the use of various polymorphic markers (RFLPs and VNTRs) to follow the segregation of the defective factor VIII gene through individuals in a family (This is not covered in this chapter, but an excellent review on the subject is available [3]). Several factors limit this technique, primarily the need for intervening family members, the need for a proband to be present, the occasional need for paternity testing, and the frequent occasions where all polymorphic markers prove to be uninformative. Furthermore, it adds little to our understanding of the mutations that underlie Hemophilia A. To simplify the detection of mutations in the factor VIII gene, we have employed a technique known as coupled transcription and translation (TNT) to From: Methods in Molecular Medicine, Vol. 31: Hemostasis and Thrombosis Protocols Edited by: D. J. Perry and K. J. Pasi © Humana Press Inc., Totowa, NJ
117
118
Ononye
screen the FVIII cDNA, isolated from peripheral blood lymphocytes, for mutations. The TNT system offers an alternative for other eukaryotic in vitro translations. As a one-tube technique, it by-passes many of the steps required by other systems by incorporating RNA synthesis into the translation mix. The value of this approach is illustrated by its use in the detection of mutations in other disorders, e.g., Duchenne’s and Becker muscular dystrophy (4–6), cystic fibrosis (7), polycystic kidney disease (8), breast cancer (9), and neurofibromatosis (10). The approach detailed in this chapter involves isolating the 9 kb factor VIII mRNA from peripheral lymphocytes, reverse transcribing this, and then amplifying the cDNA by nested PCR in a series of overlapping segments. A T7 promoter is attached to the 5' amplification primer that is in-frame with the cDNA and will, under the appropriate conditions allow in vitro translation. The protein expression products are labeled with 35S-methionine, separated on a gel, and visualized by autoradiography. Any aberrant protein product indicates a possible mutation in the segment of mRNA from which it is derived. This aberrant product may even be mapped to an area of a segment. Once a candidate segment (or segment area) is identified in a family or patient, the DNA can be sequenced for definitive proof of mutation. 2. Materials 2.1. Lymphocyte Separation 1. Histopaque 1077: Density 1.077 g/L: (Sigma, Poole Dorset, UK). 2. Phosphate-buffered saline (PBS): 10 mM potassium phosphate buffer, 138 mM NaCl, 2.7 mM KCl, pH 7.4. (Sigma). 3. 50-mL conical tubes, e.g., Falcon tubes. 4. Sterile plastic pipets.
2.2. RNA Extraction 1. RNA Easy kit (Qiagen) (see Note 1).
2.3. Reverse Transcription 1. 5X RT Buffer: 250 mM Tris-HCl, pH 8.3, 375 mM KCl, 15 mM MgCl2. (Gibco, Gibco-BRL, Life Technologies Ltd., Paisley). 2. 100 mM DTT (Gibco BRL, Life Technologies Ltd., Paisley). 3. 5 mM dNTPs. 4. 200 U/mL M-MLV reverse transcriptase (Gibco-BRL, Life Technologies Ltd., Paisley). 5. 50 U/mL RNAse inhibitor (Boehringer Mannheim). 6. DEPC-treated water. 7. Sterile, RNAse-free Eppendorfs.
Hemophilia A 8. 9. 10. 11.
119
Total cellular target RNA: 1 µg 50 µL in DEPC H2O. TE buffer, pH 8.0: 10 mM Tris HCl, pH 8.0, 0.1 mM EDTA. Oligonucleotide primers at 50 pmol/µL (see Note 2). Heating block.
2.4. Polymerase Chain Reaction 1. 5 U/µL Taq DNA polymerase (Bioline). 2. PCR buffer: 0.8 g Trizma base, 0.22 g NH4SO4, and 0.67 mL 1 M MgCl2. Dissolve in 8 mL TE buffer, pH 8.0. Adjust pH to 8.8 with concentrated HCl. Make up to 10 mL with TE. Autoclave and dispense into 0.5-mL aliquots. Store at –20°C. Immediately before use, thaw an aliquot and add 3.5 µL of β-mercaptoethanol and 17 µL of 5% BSA (w/v). 3. BSA solution (Sigma). 4. Oligonucleotide primers at 50 pmol/µL (see Tables 1 and 2). 5. 0.5-mL sterile Eppendorfs. 6. TE buffer, pH 8.0: 10 mM Tris-HCl, pH 8.0, 0.1 mM EDTA. 7. Light mineral oil (Sigma). 8. 1.5% Agarose gel in 1X TBE containing ethidium bromide 0.5 µg/mL.
2.5. Translation and Termination 1. A commercially available kit is used for the translation and termination reaction: Coupled Reticulolysate Systems (Promega). The kit includes T N T rabbit reticulolysate, TNT reaction buffer, TNT T7 polymerase, control DNA, and amino acid mixtures (minus methionine). 2. Nuclease-free water. 3. RNAsin ribonuclease inhibitor 40 U/µL (Promega). 4. 35S methionine (1,000 Ci/mmol) at 10 mCi/mL (Amersham). 5. Protein loading buffer: 2 mL glycerol (v/v), 2 mL 10% SDS, 0.25% bromophenol blue, 2.5 mL 4X stacking gel buffer and 0.5 mL β-mercaptoethanol. Store at room temperature. Add the β-mercaptoethanol immediately before use. 6. 4X Stacking gel buffer: 6.06 g Tris base and 4 mL 10% SDS. Bring the volume to approx 100 mL with water. Adjust pH to 6.8 with 12 N HCl and adjust volume to 100 mL. Store at room temperature. 7. 5% Stacking gel: 225 mL 40% acrylamide:bisacrylamide (19:1) (see Note 3), 1.75 mL water, 444 µL 4X stacking gel buffer, 28 µL 10% ammonium persulphate (prepared immediately before use), and 5 µL TEMED. The volumes of reagents are sufficient for a 0.75-mm thick gel measuring 100 mm × 70 mm. 8. 15% SDS polyacrylamide separating gel: 2.68 mL water, 2.82 mL 40% acrylamide:bisacrylamide solution (see Note 3), 1.9 mL separating gel buffer, 112 µL 10% ammonium persulphate (prepared immediately before use). 9. Separating gel buffer (see Note 4): 18.17 g Tris base and 4 mL 10% SDS. Bring the volume to approx 100 mL with water. Adjust pH to 8.8 with 12 N HCl and add water to a final volume of 100 mL. Store at room temperature.
120
Ononye
Table 1 First Round PCR Primersa Primer name
mRNA segment
Primer sequence
1W 1X 2W 2X 5W 5X 6W 6X
1 1 2 2 5 5 6 6
5'-GGG AGC TAA AGA TAT TTT AGA GAA G 5'-TTC CTA CCA ATC CGC TGA GG 5'-AGA AGC GGA AGA CTA TGA TG 5'-TTG CCT AGT GCT AGG GTG TC 5'-ACC CAC CAG TCT TGA AAC GC 5'-TCC ATA TTG TCC TGA AGC TG 5'-TTC ATT TCA GTG GAC ATG TG 5'- GGC TTC AAG GCA GTG TCT GC
aSegments 3 and 4 span exon 14 and encode the B domain of factor VIII. This region is amplified directly from genomic DNA. bAdapted from Naylor et al. (11).
Table 2 Second Round PCR Primersa Primer name
mRNA segment
Primer sequence
1Y
1
1Z 2Y
1 2
2Z 5Y
2 5
5Z 6Y
5 6
6Z
6
5'-GGA TCC TAA TAC GAC TCA CTA TAG GAA CAG ACC ACC ATG GAG AAG AAT TAA CCT TTT GCT TCT C 5'-CAG CAG CAA TGT AAT GTA CC 5'-GGA TCC TAA TAC GAC TCA CTA TAG GAA CAG ACC ACC ATG TCT GAA ATG GAT GTG GTC AGG 5'-AAG CTT CTT GGT TCA ATG GC 5'-GGA TCC TAA TAC GAC TCA CTA TAG GAA CAG ACC ACC ATG ACT CTT CAG TCA GAT CAA GAG 5'-CTC TAA TGT GTC CAG AAG CC 5'-GGA TCC TAA TAC GAC TCA CTA TAG GAA CAG ACC ACC ATG CAT CTA CAT GCT GGG ATG AGC 5'-AAG GTA GAA GGC AAG CCA GG
aA
T7 promoter is incorporated in the upstream primer (underlined).
10. SDS-polyacrylamide 10X running buffer: 30 g Tris base, 144 g glycine, and 100 mL 10% SDS. Adjust the volume to 1 L with distilled water. 11. Protein markers, e.g., Rainbow markers (Amersham). 12. Organic scintillant, e.g., Amplify™ (Amersham). 13. Fixing solution: 5% acetic acid (v/v), 15% methanol. 14. X-ray film.
Hemophilia A
121
3. Methods 3.1. Lymphocyte Isolation 1. Collect 10 mL of whole blood using EDTA as an anticoagulant (see Note 5). 2. Dilute with an equal volume of PBS and carefully layer onto 10 mL Histopaque 1077 in a 50-mL conical tube. 3. Carefully transfer to a centrifuge without disturbing the layers and spin at 2000 rpm for 20 min at room temperature. 4. After centrifugation, remove from the centrifuge without disturbing the layers and aspirate the cellular interface with a sterile plastic pipet and transfer to a fresh 50-mL Falcon. 5. Make up to 30 mL with cold PBS and invert several times to mix. 6. Spin at 2000 rpm for 10 min, carefully decant the supernatant and freeze the cellular pellet at –70/80°C. The RNA is not to be isolated immediately.
3.2. RNA Extraction Total RNA is prepared using the Qiagen RNAEasy kit. Extraction procedure is carried out as per manufacturers instructions.
3.3. Reverse Transcription The following protocol outlines the procedure to screen the factor VIII coding sequences from mRNA by protein translation and termination (TNT) (see Note 6). 1. Perform all reactions in duplicate including duplicate negative controls in which TE buffer is used to replace the total cellular RNA. 2. Thaw RNA samples on ice. RNA samples are generally eluted/re-suspended in 50 µL DEPC-treated water. 3. To 5 µL of each RNA sample, add 1.5 µL of TE buffer and 1 µL of the inner, downstream amplification primer. 4. Heat the RNA/primer mixture to 65°C and snap-cool on ice. 5. Prepare an RT-mix on ice by adding the following to a 1.5-mL Eppendorf (given volumes are per sample or reaction: 4 µL 5X RT buffer, 5 µL dNTPs, 2 µL 100 mM DTT, 0.5 µL RNAse inhibitor, and 1 µL of M-MMLV reverse transcriptase. 6. Add 12.5 µL of the RT-Mix to the snap-cooled reaction mixture, mix, and incubate at 42°C for 60 min.
3.4. Amplification of the FVIII cDNA 3.4.1. First Round PCR 1. Prepare a PCR mix on ice consisting of: 5 µL 10X PCR buffer, 5 µL of the upstream amplification primer (Primer W, see Table 1), 4 µL of the downstream amplification primer (Primer X, see Table 1), 0.5 µL (2.5 U) Taq DNA polymerase, and 16 µL of TE, pH 8.0. 2. Add the 30 µL of the primary PCR mix to the RT product on ice. 3. Mix well and overlay with oil.
122
Ononye
4. Place in a PCR block and denature the samples by incubating at 93°C for 3 min and then carry out 30 cycles of PCR consisting of: 93°C for 60 s (denaturation), 55°C for 30 s (annealing) and 72°C for 60 s (extension). On the final step the extension time should be increased to 5 min (at 72°C).
3.4.2. Second Round PCR 1. Prepare a second round PCR mix on ice consisting of: 27.5 µL of TE, pH 8.0 buffer, 5 µL 10X PCR buffer, 5 µL dNTPs, 5 µL (50 pmol/µL) upstream amplification primer (Primer Y; see Table 2), 5 µL (50 pmol/µL) downstream amplification primer (Primer Z; see Table 2), and 0.5 µL (2.5 U) Taq DNA polymerase. 2. Add 2 µL of the first round PCR product to the second round PCR mix. Mix well and overlay with oil. 3. Place in a PCR block and denature the samples by incubating at 93°C for 3 min and then carry out 30 cycles of PCR consisting of: 93°C for 60 s (denaturation), 55°C for 30 s (annealing) and 72°C for 60 s (extension). On the final step the extension time should be increased to 5 min (at 72°C). 4. Following amplification run a 5-µL aliquot on a 1.5% agarose gel in 1X TBE to check the specificity and efficiency of the amplification.
3.5. Translation and Termination 1. Prepare a TNT mix consisting of: 12.5 µL TNT rabbit reticulolysate, 1 µL TNT buffer, 0.5 µL T7 TNT polymerase, 0.5 µL amino acid mix (minus methionine), 0.5 µL RNAsin, 7 µL nuclease-free water, and 2 µL 35S methionine. 2. Add 1 µL of the second-round PCR product to 24 µL of the TNT mix and Incubate at 30°C for 60 min. 3. After incubation, remove 5 µL of the product and add to 20 µL of protein loading buffer. 4. Denature at 100°C for 2 min. 5. Load and run 5 µL of the denatured product on a 15% SDS-polyacrylamide gel. The remainder of the translation reaction may be stored at –20°C. 6. To prepare the SDS-polyacrylamide gel, pour the separating gel mix into the assembled gel plates, leaving sufficient space above the gel for the stacking gel to be added later. 7. Gently overlay the gel mix with 0.1% SDS. 8. After polymerization is complete (15–20 min), remove the overlay and rinse the surface of the separating gel initially with water to remove any unpolymerized acrylamide and then with a small volume of 4X stacking gel bufffer. 9. Fill the remaining space with stacking gel mix and insert the comb immediately. 10. After the stacking gel has polymerized (30 min), remove the comb and rinse the wells with 10X SDS-polyacrylamide running buffer to remove unpolymerized acrylamide. Run the gel in 1X SDS-polyacrylamide running buffer. 11. Typically, electrophoresis is carried out at a constant current of 15mA in the stacking gel and 30mA in the separating gel until the bromophenol blue begins to run off the gel.
Hemophilia A
123
Fig. 1. Autoradiograph showing the results of a TNT analysis. M, size marker. Lanes 1, 3, and 5, controls. Lanes 2, 4, and 6, patient samples. Lanes 1 and 2 correspond to segment 3, lanes 3 and 4 correspond to segment 5; and lanes 6 and 7 correspond to segment 7 of the FVIIIc DNA (see text). In lane 7, a faster moving band is clearly seen compared to the major band seen in lane 6. The mutation in this patient arises from a 2bp deletion at position 6875 within the FVIII cDNA (exon 25), resulting in the creation of a premature stop codon. A minor band sometimes seen with segment 6 is also visible in lane 6. 12. Following electrophoresis, separate the gel plates and immerse the gel in fixing solution for 30 min and then in Amplify™ for 30 min. 13. Dry the gel under vacuum at 60°C for 30 min. Expose the gel to X-ray film for 1–7 h at –70°C or 6–12 h at room temperature. 14. The results of a screen of the factor VII cDNA for mutations, in the presence of a mutation that leads to the formation of a truncated protein, should be clearly visible on the autoradiograph (see Fig. 1).
4. Notes 1. Numerous methods are available for isolating total cellular RNA, but the RNAeasy kit is convenient and provides high-quality RNA. 2. The outer downstream amplification primer is used as a primer for the reverse transcription reaction. 3. Acrylamide is a potent neurotoxin and must be handled with care. 4. The gel buffer is radioactive and must be disposed of accordingly. 5. Do not use blood samples for RNA isolation that are more than 2–3 d old. 6. Exon 14 and the 5' and 3' untranslated regions of the FVIII are amplified directly from genomic DNA.
124
Ononye
References 1. Green, P. M, et al. (1991) Genetics and molecular biology of haemophilia A & B. Blood Coag. Fibrinol. 2, 539–565. 2. Tuddenham, E. G. D. (1993) Flipping the tip of the X. Nat. Genetics 5, 209. 3. Peake, I. R., et al. (1993) Report of a joint WHO/WFH meeting on the control of haemophilia: carrier detection and prenatal diagnosis. Blood Coag. Fibrinol. 4, 313–344. 4. Gardner, R. J., et al. (1995) The identification of point mutation in Duchenne muscular dystrophy patients by using reverse transcription PCR and the protein truncation test. Am. J. Human Genetics 57, 311–320. 5. Tuffery, S., et al. (1996) Four novel dystrophin point mutations: detection by protein truncation test and transcript analysis in lymphocytes from Duchenne muscular dystrophy patients. Eur. J. Human Genetics 4, 143–152. 6. van Essen, A. J., et al. (1997) The clinical and molecular genetic approach to Duchenne and Becker muscular dystrophy: an updated protocol. J. Med. Genetics 34, 805–812. 7. Romey, M. C. (1996) Transcript analysis of CFTR frameshift mutations in lymphocytes using the reverse transcription-polymerase chain reaction technique and the protein truncation test. Human Genetics 98, 328–332. 8. Peral, B., et al. (1997) Identification of mutations in the duplicated region of the polycystic kidney disease 1 gene (PKD1) by a novel approach. Am. J. Human Genetics 60, 1399–1410. 9. De Benedetti, V. M., et al. (1996) Screening for mutations in exon 11 of the BRCA1 gene in 70 Italian breast and ovarian cancer patients by protein truncation test. Oncogene 13, 1353–1357. 10. Heim, R. A., et al. (1995) Distribution of 13 truncating mutations in the neurofibromatosis 1 gene. Human Mol. Genetics 4, 975–981. 11. Naylor, J. A., Green, P. M., Montandon, A. J., Rizza, C. R., Giannelli, F. (1991) Detection of three novel mutations in two haemophilia A patients by rapid screening of whole essential region of factor VIII gene. Lancet 337, 635–639.
The Human Antithrombin Gene
125
13 Screening for Mutations in the Human Antithrombin Gene by Hydrolink D-5000™ and MDE™ Gel Electrophoresis David J. Perry 1. Introduction The polymerase chain reaction (PCR) provides a rapid method for generating a large amount of a defined region of DNA without recourse to cloning. However, direct sequencing of this amplified material is tedious, time-consuming, and frequently generates large amounts of normal sequence data. Based on the PCR technique, a number of screening methods for detecting DNA mutations have been developed and a number of these are described in this volume. Many of these techniques are dependent on the formation of heteroduplexes during the amplification reaction, i.e., mixed double-stranded DNA molecules in which one strand is derived from the normal allele and the other from the mutant or altered allele. The heteroduplexes can exhibit a variety of changes in their physical properties and can be readily detected by a variety of techniques. In the many cases, such heteroduplexes can be detected without the use of radiolabeling. A novel polymer–Hydrolink D5000–specifically designed for the electrophoretic separation of double-stranded DNA fragments, has been shown to be capable of readily detecting heteroduplex formation following PCR (1,2). More recently, the introduction of a unique polymer termed mutation detection enhancement (MDE) has been shown to be superior to Hydrolink D5000 in the detection of DNA mutations (3).
From: Methods in Molecular Medicine, Vol. 31: Hemostasis and Thrombosis Protocols Edited by: D. J. Perry and K. J. Pasi © Humana Press Inc., Totowa, NJ
125
126
Perry
2. Materials 2.1. Mutation Detection Using Hydrolink D-5000 Gels 1. Hydrolink D-5000 gel solution (AT Biochem). Comes as an 1X solution (see Note 1). 2. 10X Tris-Borate-EDTA (TBE): 108 g Tris base, 55 g orthoboric acid, 7.4 g Na2EDTA dissolved in 1 L distilled water. 3. Ethidium bromide: Stock solution at 10 mg/mL in distilled water. 4. 10% Ammonium persulfate solution–freshly prepared. 5. TEMED. 6. Dimethylchlorosilane, e.g., Sigma. 7. 10X sample loading buffer: 50% sucrose, 0.6% Orange G (see Note 2). 8. Gel apparatus, e.g., Bio-Rad.
2.2. Mutation Detection Using MDE Gels 1. MDE gel solution (AT Biochem). Comes as an 2X solution. 2. 10X Tris-Borate-EDTA (TBE): 121 g Tris, 55 g orthoboric acid, 7.4 g Na2EDTA dissolved in 1 L distilled water. 3. Urea (optional). 4. Ethidium bromide: Stock solution at 10 mg/mL in distilled water. 5. 10% Ammonium persulfate solution–freshly prepared. 6. TEMED. 7. Dimethylchlorosilane. 8. 10X sample loading buffer: 50% sucrose, 0.6% Orange G. 9. Gel apparatus, e.g., Bio-Rad.
3. Method 3.1. Hydrolink-D-5000 Gel Electrophoresis 1. Wash 20 cm × 20 cm glass gel plates with detergent, rinse in deionized water and wipe dry with lint-free tissues. Remove any grease by wiping each plate with an ethanol-soaked tissue and allow to dry. Siliconize one of the two plates (the “eared” plate) by applying 1–2 mL of dimethylchlorosilane and allowing to dry at room temperature in a fume hood. 2. Electrophoresis is carried out in a vertical fashion. Assemble the gel plates using 1-mm spacers with all but the top edge sealed with waterproof tape. With a commercial vertical electrophoresis system, sealing of the gel edges with tape may not be required and the manufacturer’s recommendations should be followed. 3. Prepare the gel by mixing 5 mL of 10X TBE with 44.4 mL of the Hydrolink D5000 gel solution. Add 50 µL of TEMED and 750 µL 10% ammonium persulphate and pout the gel between the tilted gel plates using a 50-mL syringe fitted with a 0.4-µm filter. Insert a 20-well comb (1-mm thickness) with 0.5-cm teeth and clamp the top of the gel with bulldog clips. Place the gel horizontally and allow to polymerize for at least 60–90 min.
The Human Antithrombin Gene
127
4. Assemble the gel apparatus, fill the buffer reservoirs with 1X TBE and pre-run the gel for 30 min at 200 V. 5. Denature the PCR products prior to loading by heating to 95°C for 3 min and then slowing cooling to 37°C over 20–30 min (see Note 3). This is most conveniently carried out using a programable heating block with an adjustable ramp time. 6. Mix 12–16 µL of each PCR reaction with 2–3 µL of loading buffer and load using a micropipet and disposable tips (see Notes 2, 4, and 5). Electrophoresis is performed at 200 V at room temperature until the Orange-G dye front has reached the end of the gel (see Notes 6 and 7). 7. Separate the gel plates and soak the gel in 1X TBE containing ethidium bromide 0.5 µg/mL for 20–30 min (see Notes 8–10). Place the gel onto the surface of a transilluminator covered with Saran Wrap™ and visualize the DNA bands under UV light.
3.2. MDE Gel Electrophoresis 1. 20 cm × 20 cm glass gel plates are prepared and assembled as detailed in Subheading 3.1. 2. Prepare a 1X gel mix by combining 25 mL of 2X MDE gel solution, 3 mL 10X TBE (final concentration 0.6X TBE), 3.75 g urea (optional) and deionized water to 50 mL. The reagents should be gently mixed until the urea, if included, has gone into solution. 3. Add 50 µL of TEMED and 750 µL of 10% ammonium persulphate to initiate polymerization and pour the gel between the tilted gel plates using a 50-mL syringe fitted with a 0.4-µm filter. Insert a 20-well comb (1-mm thickness) with 0.5-cm teeth and clamp the top of the gel apparatus with bulldog clips. The gel is placed horizontally and allowed to polymerise for at least 60–90 min. 4. Assemble the apparatus, fill the buffer reservoirs with 0.6X TBE and pre-run the gel for 30 min at 20 V/cm. 5. Denature the PCR products prior to electrophoresis by heating to 95°C for 3 min and then slowing cooling to 37°C over 20–30 min. This is most conveniently carried out using a programmable heating block with an adjustable ramp time. 6. Mix 12–16 µL of each PCR reaction with 2–3 µL of loading buffer and load into the wells of the gel using a micropipet and disposable tips. Electrophorese at room temperature at 200 V until the Orange-G dye front has reached the end of the gel. 7. Separate the gel plates and soak the gel in 0.6X TBE containing ethidium bromide 0.5 µg/mL for 20–30 min. Place the gel onto the surface of a transilluminator covered with Saran Wrap™ and visualize the DNA bands under UV light.
3.3. Interpretation of Results (see Fig. 1) 1. Both Hydrolink D-5000 and MDE gels appear to detect most if not all insertion/deletion type mutations but vary in their ability to detect single base pair substitutions. 2. Heteroduplex fragments generally migrate slower than the homoduplex fragments and usually stain at 25–30% of the intensity of the homoduplex bands. The two
128
Perry
Fig. 1. Hydrolink D5000 gel showing the results of screening for mutations in exons 3 (3a + 3b), 3b, 4, and 5 of the antithrombin gene. PCR amplified fragments were electrophoresed at 200 V for 3 h in a 100% (1X) Hydrolink D5000 gel and then stained with ethidium bromide. Lanes 1, 5, 9, and 11 contain controls whilst lanes 6, 7, 8, and 12 contain amplified DNA from patients with antithrombin deficiency. By extending the electrophoresis times for the exon 3 fragments (lanes 2–4) to 6 h, the mutations in these fragments were clearly visible. In contrast to the results shown on this gel, agarose-gel electrophoresis showed only a single fragment in all cases.
heteroduplex bands may migrate as a single band. Depending upon the mutation up two four-bands may be seen: mutant/mutant homoduplex, normal/normal homoduplex, mutant/normal heteroduplex, and normal/mutant heteroduplex. 3. The pattern of bands obtained may provide some indication of the underlying mutation. Analysis of a series of mutations in the human antithrombin gene showed that single base-pair substitutions were associated with the presence of only one additional DNA band whereas small insertions/deletions were associated with presence of two additional bands. 4. MDE gels may be used in single-stranded conformation polymorphism (SSCP) analysis. 5. The method as described can detect mutations and polymorphisms in heterozygous individuals. If however, an individual is homozygous for a mutation or polymorphism then heteroduplexes will not be generated. The technique can, therefore, be modified by including an additional step prior to the denaturation/ renaturation step. Ten microliters of the test PCR product is mixed with 5 µL of a wild-type control and denaturation/renaturation then performed .
The Human Antithrombin Gene
129
4. Notes 1. The gel mix as shown results in a “1X” final concentration of Hydrolink D-5000 or MDE and is suitable for the majority of applications. In some cases reducing this to 0.5X may be useful. 2. Only sucrose-containing loading buffers should be used. 3. The most important aspect of this method is the quality of the PCR product. If additional bands are present when the PCR product is run on an agarose gel, or the amplification is weak or the bands are not sharp then the results obtained from the Hydrolink D-5000 or MDE gels will be disappointing. The inclusion of urea at a nondenaturing concentration (7.5%) often sharpens the bands. 4. Lane 1 should always contain a molecular weight marker. 5. Suitable positive controls should always be included. 6. Electrophoresis times are very much dependent upon fragment size. However, 3 h at 200 V for a 1X gel is a suitable starting point. 7. For fragments between 1–1.5 kb in length, electrophoresis times of 6–8 h may be necessary. Long gels, e.g., 40 cm × 20 cm allow longer electrophoresis times and may facilitate the detection of mutations. In such cases, additional gel mix will be required. However, the optimum PCR fragment seize for resolving mutations appears to be between 200 to. For larger fragments digestion with various restriction enzymes to produce smaller fragments may be necessary or alternatively the use of additional primers to amplify smaller fragments may be required. 8. Do not allow gels to soak for long periods of time in ethidium bromide/TBE–it soaks up the buffer and increases in size quite dramatically! If excessive background staining of gels is noted, the gels may be destained by soaking in deionized water for 30–60 min 9. The reagents are potentially toxic and should be treated in the same way as acrylamide-based gel solutions. 10. Ethidium bromide is a potential mutagen and should be handled with care. Solutions containing ethidium bromide must be disposed of appropriately. 11. Ethidium bromide detects bands that contain 150–250 ng DNA. Silver staining increases the sensitivity approx fivefold allowing the use of thinner gels and less sample loading. If silver staining of gels is planned then it is important that the gel should be “bound” to one of the glass plates, for example using “Bind Silane” to facilitate subsequent handling of the gel.
References 1. Keen, J., Lester, D., Inglehearn, C., Curtis, A., and Bhattacharya, S. (1991) Rapid detection of single base mismatches as heteroduplexes on Hydrolink gels. Trends Genetics 7, 5. 2. Perry, D. J. and Carrell, R. W. (1992) Hydrolink gels: a rapid and simple approach to the detection of DNA mutations in thromboembolic disease. J. Clin. Pathol. 45, 158–160. 3. Soto, D. and Saraswati, S. (1992) Improved detection of mutation in the p53 gene in human tumors as single-stranded conformation polymorphs and doublestranded heteroduplex DNA. PCR Methods Appl. 2, 96–98.
Chemical Cleavage of Mismatch Method
133
14 Detection of Mutations in Hemophilia A Patients by Chemical Cleavage of Mismatch Method Naushin H. Waseem, Richard Bagnall, Peter M. Green, and Francesco Giannelli 1. Introduction Hemophilia A is an X-linked disorder that leads to a defect in blood coagulation. This is caused by mutations in the factor VIII gene, which results in its activity being reduced or abolished in the blood-clotting cascade. The factor VIII gene is 186 kb long with 26 exons, varying from 69 bp (exon 5) to 3106 bp (exon 14) (1). The factor VIII mRNA is 9028 bases in length with a 7053 nucleotides long coding region (2). Various methods have been used for the detection of hemophilia A mutations. The more widely used are as follows: 1. Denaturing gradient gel electrophoresis (DGGE): This is based on the ability of mutations to reduce the melting temperature of DNA domains resulting in altered mobility on a formamide and urea gradient polyacrylamide gel. This method can detect any sequence change but for detecting factor VIII mutations it requires 41 PCR to amplify 26 exons of factor VIII gene and the putative promoter region. The maximum length of the PCR product is 600–700 bp and must have appropriate melting domain structure. Some splicing signal regions were not screened by this procedure (3). 2. Single-strand conformation polymorphism (SSCP): This method is based on the fact that single-stranded DNAs differing in a single nucleotide will acquire different conformations and so have different mobilities on a polyacrylamide gel. Various exons of factor VIII are amplified using polymerase chain reaction (PCR) and subjected to electrophoresis. The exon showing an altered electrophoretic mobility is then sequenced (4). This method requires at least 41 amplifications to scan the entire factor VIII coding region as PCR products must be between 100300 bp for efficient screening. From: Methods in Molecular Medicine, Vol. 31: Hemostasis and Thrombosis Protocols Edited by: D. J. Perry and K. J. Pasi © Humana Press Inc., Totowa, NJ
133
134
Waseem et al.
In both of the aforementioned procedures the PCR products containing the mutation are identified but the position of the mutation is not determined. 3. Chemical cleavage of mismatch: In order to develop a rapid and fully effective procedure for the detection of hemophilia A mutations, the method of chemical cleavage of mismatch (CCM) was combined with analysis of the traces of factor VIII mRNA present in the peripheral blood lymphocytes. The method of CCM has the advantage that it detects any sequence change even in long DNA segments (1.5–1.8 kb) and indicates the position of mismatch within the segment. The entire mRNA can be screened in few overlapping segments and offers a chance of detecting mutations occurring in any region of the gene, including internal region of the long introns by virtue of their effect on the structure of the mRNA, thus allowing a gain not only in the speed, but also in the completeness of mutation detection. A further advantage of mRNA analysis is that it provides direct evidence of the effect gene mutation may have on the structure of the gene transcript. In the basic procedure the factor VIII message and appropriate segments of a patient gene are specifically amplified and compared with similar products amplified from control RNA. The patient and control PCR products are then hybridized to form a heteroduplex and treated with hydroxylamine and/or osmium, which modify C or T residues, respectively. The DNA is then cleaved with piperidine at the modified base and analyzed on a denaturing polyacrylamide gel. From the size of the cleavage fragments, the position of the mutation is estimated and the relevant exons sequenced (5). To aid the visualization of DNA on the acrylamide gel the DNA is either radioactively or fluorescently labeled. This chapter describes the methods used in the detection of mutations by fluorescent chemical cleavage of mismatch method (FCCM).
The factor VIII message, except the large exon 14, is reverse transcribed with AMV reverse transcriptase and amplified with Tfl DNA polymerase into four overlapping segments (Fig. 1). Exon 14 is amplified from genomic DNA as two additional segments so that the entire coding region is represented in six overlapping segments. The promoter region (segment 7) and the polyadenylation signal region (segment 8) are also amplified from the genomic DNA. The promoter region overlaps with segment 1 (Fig. 1). The promoter region and polyadenylation signal region are sequenced directly whereas the rest of the segment are processed through FCCM. Three different fluorescent labeled dUTPs are used to label the segments: segment 1 and 2 with green, segment 3 and 4 with blue, and segment 5 and 6 with yellow. Similar segments are amplified from either control RNA or cloned factor VIII cDNA using biotinylated primers and fluorescent dUTPs. The patient and the control products are then hybridised to form heteroduplexes in two multiplex reactions. The heteroduplexes are then captured on streptavidin coated magnetic beads and treated with hydroxylamine and osmium followed
Chemical Cleavage of Mismatch Method
135 Fig. 1. Schematic diagram of factor VIII cDNA showing segments 1–8. Open bars represent primary PCR whereas filled bars are nested PCR. Segments 3 and 4, promoter region (segment 7) and polyadenylation signal region (segment 8) are amplified from DNA.
135
136
Waseem et al.
Fig. 2. Diagrammatic representation of steps involved in the fluorescent chemical cleavage of mismatch method.
136
Chemical Cleavage of Mismatch Method
137
by treatment with piperidine (Fig. 2). The products are analyzed on an ABI PRISM 377 DNA sequencer. 2. Materials
2.1. Lymphocyte Isolation 1. Histopaque-1077 is supplied by Sigma (cat. no. 1077-1). 2. Phosphate-buffered saline (PBS): 10 mM potassium phosphate buffer, 138 mM NaCl, 2.7 mM KCl, pH 7.4.
2.2. RNA Isolation 1. Various RNA isolation kits are available commercially. We have used two RNA isolation kits; (a) Purescript RNA isolation kit from Gentra (cat. no. R-5500A) and (b) RNA isolator from Genosys (cat. no. RNA-ISO-050). 2. Isopropanol. 3. Chloroform.
2.3. RT-PCR and PCR 1. Primers: The primers used for amplification are listed in Table 1. The four RTPCR fragments are labeled 1, 2, 5, and 6. The outer primers are called A and B whereas the nested ones are given C and D as suffix. Segments 3, 4, 7, and 8 are amplified from DNA and therefore, require only one pair of primers each. The nested and the segment 3 and 4 primers are also synthesized with biotin at their 5'-end and are marked with an asterisk in the table. A working solution of primers at 100 ng/mL is kept at 4°C and primer stocks are kept at –20°C. 2. Access RT-PCR System is supplied by Promega (cat. no. A1250). The kit is stored at –20°C. 3. Fluorescent deoxynucleotides : Fluorescent deoxynucleotides for labelling PCR products can be obtained from Perkin Elmer Applied Biosystems. [F]dUTP set (cat. no. P/N 401894) contains 12 nmol of [TAMRA]dUTP, 3 nmol of [R110]dUTP, and 3 nmol of [R6G]dUTP. These are stored as 2-ÂL aliquots at –20°C in the dark to avoid repeated freezing and thawing.
2.4. Chemical Cleavage of Mismatch 1. Hydroxylamine hydrochloride (Sigma, cat. no. H 2391): A 4 M solution is prepared and titrated to pH 6.0 with diethylamine (Sigma, cat. no. D 3131). Because very little hydroxylamine (20 µL/reaction) is required for the reaction a rough guide to prepare a 4 M solution, pH 6.0, is: weight (in mg) of hydroxylamine divided by 0.28 gives the volume of water to be added. This value times 0.2 to 0.3 gives the volume of diethylamine to be added to the solution to reach pH 6.0. The volume of diethylamine to be added varies from batch to batch and should be titrated for every batch. Hydroxylamine is highly
138
Waseem et al. Table 1 Sequence of the Primers Used in the Amplification of the Eight Segments from the Factor VIII cDNA 1A 1B 1C* 1D* 2A 2B 2C* 2D* 3A* 3B* 4A* 4B* 5A 5B 5C* 5D* 6A 6B 6D* 7A 7B 8A 8B
2.
3.
4. 5.
GGGAGCTAAAGCTATTTTAGAGAAG CAACAGTGTGTCTCCAACTTCCCCAT GAGAAGATTAACCTTTTGCTTCTC CCTACCAATCCGCTGAGGGCCATTG GAAGAAGCGGAAGACTATGATGATG GCCTAGTGCTACGGTGTCTTGAATTC CTGATTCTGAAATGGATGTGGTCAGG GGGAGAAGCTTCTTGGTTCAATGGC AGAGTTCTGTGTCACTATTAAGACCC TCTGAGGCAAAACTACATTCTCTTGG CAAGGACGTAGGACTCAAAGAGATGG CACCAGAGTAAGAGTTTCAAGACAC CTTCAGTCAGATCAAGAGGAAATTGAC GAAGTCTGGCCAGCTTTGGGGCCCAC TATGATGATACCATATCAGTTGAAATG CTCTAATGTGTCCAGAAGCCATTCCC TTCATTTCAGTGGACATGTG CAGGAGGCTTCAAGGCAGTGTCTG TAGCACAAAGGTAGAAGGCAAGC GGATGCTCTAGGACCTAGGC AAGAAGCAGGTGGAGAGCTC GCAGTGACCATTGTCCTGTCAGAC GAGTGTCCATCTTGCTATTCAGTGCC
toxic and should be handled in a fumehood and protective laboratory clothing should be worn. Osmium tetroxide: A 4% solution can be obtained from Sigma (cat. no. O 0631). A working solution of osmium tetroxide is 0.4% osmium in 2% pyridine (Sigma, P 3776). A fresh solution of osmium should be made each time it is required as it has a short half-life. Fresh stock solution should be purchased every 2–3 mo. Osmium is very toxic and should be handled in a fumehood. Protective laboratory clothing should be worn at all times during handling. Formamide loading dye: Deionized formamide containing 10 mg/mL dextran blue. Formamide from Amresco and Sigma give no background fluorescence when used as loading dye on ABI PRISM 377 DNA Sequencer. Piperidine: A 1 M solution of piperidine (Aldrich, cat. no. 10409-4) is prepared in formamide loading dye. 10X Hybridization buffer: 3 M NaCl in 1 M Tris-HCl, pH 8.0. This is stored at room temperature.
Chemical Cleavage of Mismatch Method
139
Table 2 Sequence of the Primers Used for the Detection of Intron 22 Iversion in Factor VIII Gene 22A 22C 23A 23C
TGGATCTGTTGGCACCAATG CGAGGAAATTCCACTGGAAC GGCAATGTGGATTCATCTGG CATGGAGTTGATGGGCTGTG
6. 2X Binding buffer: 2 M NaCl, 0.4% Tween 20, 0.1 mM EDTA , 10 mM Tris-HCl, pH 8.0, stored at room temperature. 7. TE 8.0: 10 mM Tris-HCl, pH 8.0, containing 0.1 mM EDTA, autoclaved, and stored at room temperature.
2.5. Fluorescent Dye Terminator DNA Sequencing 1. ABI PRISM™ Dye Terminator Cycle Sequencing Ready Reaction Kit (cat. no. P/N 4022078) is supplied by Perkin Elmer Applied Biosystems and is stored as 4-µL aliquots at –20°C. 2. Absolute and 70% ethanol. 3. 3 M sodium acetate, pH 4.6. 4. 40% Acrylamide:bisacrylamide stock solution. 5. Sequence Navigator software from ABI.
2.6. Detection of Intron 22 Inversions Primers used for the amplification of exon 22–26 or 23–26 are listed in Table 2. 3. Methods
3.1. Isolation of Lymphocytes Histopaque 1077 is a mixture of polysucrose and sodium diatrizoate at a density of 1.077 g/mL. When anticoagulated blood is layered on Histopaque 1077, polysucrose aggregates the erythrocytes and granulocytes and they rapidly sediment. At low speed centrifugation, erythrocytes, and granulocytes form a pellet, the mononuclear cells remain at the interface of plasma–Histopaque 1077 and the platelets are removed at the washing step. 1. In a 50-mL polypropylene conical tube add 10 mL of Histopaque 1077. Gradually overlay an equal volume of anticoagulated blood. This can be facilitated by tilting the centrifuge tube containing Histopaque so that the blood trickles down
140
2. 3.
4. 5.
Waseem et al. the side of the tube. It is essential that Histopaque and the blood are at room temperature. Centrifuge at 400g at room temperature for 20 min. Transfer the opaque layer of lymphocytes at the interface with a disposable plastic Pasteur pipet into a fresh 50-mL centrifuge tube and add 35 mL of phosphate buffered saline. Centrifuge at 400g for 10 min at room temperature. Resuspended the lymphocyte pellet in either 600 µL of Cell Lysis Solution (Gentra) for the isolation of RNA/DNA or 1 mL of RNA Isolator (Genosys, UK) for the isolation of RNA. This can either be used immediately for the isolation of RNA and DNA or stored at –70°C until later use.
3.2. Isolation of DNA and RNA There are a number of kits available commercially for the isolation of DNA and RNA from a clinical sample, however, we have found that in our hands a combination of two RNA isolation kits actually works much better. Although this modification, sometimes, compromises the quality or the yield of DNA, it is enough for few PCRs. The blood is processed according to the protocol described in Purescript kit, which gives us a mixture of DNA and RNA. The DNA from this solution can be spooled out. The solution containing mostly RNA is then processed with RNA isolator.
3.2.1. Isolation of DNA 1. Thaw out lymphocyte in cell lysis solution at room temperature (if frozen) and add 200 µL of protein-DNA precipitation solution (Gentra). Invert gently about 10-15 times and place the tube on ice for 5 min. 2. Centrifuge at 16,000g for 3 min and transfer the supernatant to a fresh 1.5-mL microfuge tube. 3. Add 600 µL isopropanol and mix the sample 10–15 times. At this step, DNA should form a clump. Remove the DNA with a yellow tip and transfer it into a 1.5-mL microfuge tube containing 100 µL 70% ethanol (Save the rest of the solution for the isolation of RNA). 4. Centrifuge the DNA at 16,000g for 3 min. 5. Decant the ethanol and air dry the DNA pellet for 5–10 min at room temperature. 6. Resuspend the DNA in 50 µL of TE 8.0 and store at 4°C.
3.2.2. Isolation of RNA 1. Centrifuge the solution from step 3 above at 16,000g for 5 min at room temperature. 2. Decant the supernatant and wash the pellet with 100 µL 70% ethanol and repeat step 1. 3. Decant ethanol, flick spin again and aspirate traces of ethanol with a yellow tip. Allow it to airdry for 10–15 min and resuspend it in 50 µL RNA hydration solu-
Chemical Cleavage of Mismatch Method
4. 5. 6. 7. 8. 9.
141
tion (Gentra). If DNA could not be spooled out above, save 10 µL of this solution as a source of DNA for PCR amplification. Add 500 µL of RNA isolator (Genosys) to the rest of the solution. Add 100 µL chloroform and mix gently 15 times and incubate for 15 min at room temperature. Centrifuge at 16,000g for 15 min at room temperature. Transfer the upper aqueous phase to a fresh 1.5 microfuge tube and add 250 µL isopropanol. Mix and incubate for 10 min at room temperature. Centrifuge at 16,000g for 10 min at room temperature. At this stage RNA should be visible as translucent pellet. Wash pellet with 70% ethanol. Repeat step 6, airdry the RNA pellet and dissolve it in 50 µL RNA hydration solution (see Note 2).
3.3. RT-PCR For reverse transcription and amplification of four out of the eight segments from factor VIII mRNA we use Access RT-PCR System. In this kit the reverse transcription by AMV reverse transcriptase and initial 10 cycles of amplification by Tfl DNA polymerase is performed in a single tube (primary PCR) (see Note 3). An aliquot is then amplified for another 30 cycles with nested primers (secondary PCR). Two of the four segments (segments 1 and 5 and 2 and 6) are multiplexed in the primary PCR so in total we have two primary and four secondary PCRs. 1. Add 5 µL 5X reaction buffer, 0.5 µL 10 mM dNTPs, 3.0 µL 25 mM MgSO 4, 2.5 µL of 100 ng/mL primer 1A, 1B, 5A, 5B, 0.5 µL AMV reverse transcriptase, 0.5 µL Tfl DNA polymerase, 100–200 ng RNA. Make up the volume with RNase-free water to 25 µL. Set up a second RT-PCR substituting primer 1A, 1B, 5A, 5B for 2A, 2B, 6A, and 6B. 2. Overlay with mineral oil and place the tubes in controlled temperature block equilibrated at 48°C and incubate for 1 h and proceed immediately to thermal cycling reactions: 93°C for 30 s, 65°C for 30 s, 68°C for 5 min for 10 cycles. 3. To set up the secondary PCR, add 2.5 µL of 10X Tfl buffer, 0.5 µL of 10 mM dNTPs, 1.5 µL of 25 mM MgSO4, 2.5 µL of 100 ng/mL primer XC & XD (x is the segment number), 0.5 µL Tfl I , 0.4 µL [F]dUTP, 14.5 µL water, 2.5 µL of primary PCR. This reaction mix is also used for the amplification of segment 3 and 4 from DNA (see Note 4). 4. Set up the cycling conditions as follows: 94°C for 5 min and 30 cycles of 93°C for 30 s, 65°C for 30 s, 72°C for 3 min. 5. For amplification from control RNA or cloned factor VIII cDNA (referred to as probe from now on) use the same recipe except use biotinylated primers. The products should be gel purified before using in the fluorescent chemical cleavage of mismatch method (see Note 6).
142
Waseem et al.
3.4. Fluorescent Chemical Cleavage of Mismatch Method 3.4.1. Preparation of Hybrids 1. Set up the hybridization as follows: 3 µL 10X hybridization buffer, 30 ng each of the probe 1, 3, and 6 (the other multiplex will be 2, 4, and 5), 100–300 ng of target 1, 3, and 6. Make up the volume to 30 µL with TE 8.0. 2. Incubate at 95°C for 5 min and 65°C for 1 h (see Note 7). 3. Ten microliters of streptavidin coated magnetic beads (a 50% suspension is supplied) are required to bind the biotin tagged products per reaction. Take out the required volume and wash twice with 2X binding buffer. Resuspend in three times the original volume of the beads with 2X binding buffer. 4. Add 30 µL of the washed streptavidin beads to each reaction. Incubate 15 min at room temperature. 5. Place the tube on a magnetic stand to pellet the beads and aspirate the supernatant.
3.4.2. Hybrid Modification and Cleavage 3.4.2.1. HYDROXYLAMINE 1. Resuspend in the beads in 20 µL of 4 M hydroxylamine, pH 6.0 (see Subheading 3.). 2. Incubate 2 h at 37°C. 3. Pellet the streptavidin beads on a magnetic stand and wash the beads with TE 8.0 and proceed to Subheading 3.4.2.3. (see Note 9).
3.4.2.2. OSMIUM 1. Resuspend the beads from step 5 above in 20 µL 0.4 % osmium, 2% pyridine, and incubate for 15 min at 37°C. 2. Pellet the streptavidin beads on a magnetic stand and wash with TE 8.0.
3.4.2.3. CLEAVAGE OF DNA
Add 5 µL of piperidine/formamide loading dye to the reaction and incubate at 90°C for 30 min (see Note 10).
3.5. Analysis of the Products from FCCM on ABI PRISM 377 DNA Sequencer 3.5.1. Preparation and Loading of Polyacrylamide Gel 1. Clean the glass plates with 3% Alconox. After rinsing them with water, wipe them with isopropanol-soaked lint-free tissue paper. 2. Set up the glass plates on the cassette, with notched plate at the bottom. 3. Prepare the following mix for the acrylamide gel for 12-cm plates (see Note 11): Water 12 mL 40% acrylamide:bisacrylamide stock 3 mL
Chemical Cleavage of Mismatch Method
4.
5. 6. 7. 8. 9.
143
Urea 9.2 g Amberlite mixed bed resin 0.5 g Stir for 5–10 min. Filter the solution through a 0.2-µm filter and add 2 mL 10X TBE, 47 µL 10% ammonium per sulfate (APS), 33 µL TEMED, and pour the solution at the top end of the plates. Allow it to set for 15–30 min and save the rest of acrylamide solution to check for its polymerization (see Note 12). Pre-run the gel for 15 min at PR 12A-1200 or PR 12A-2400. Load 2 µL of the sample from step C above. Dilute rox GS-2500 1:5 in formamide loading dye. Heat it at 92°C for 2 min and use 2 µL of this as a marker. Electrophorese the gel on GS12A-1200 or GS12A-2400 for 4 h. Analyze the gel using Genescan software (Fig. 3).
3.6. Analysis of the Promoter and Polyadenylation Signal Region Samples with mutations in the promoter or polyadenylation signal region of factor VIII have reduced levels or no transcripts. Therefore, RNA samples that fail to amplify or do not give any mismatch bands should be screened for the mutations in these regions. Segment 7 (promoter region) and segment 8 (polyadenylation signal region) are amplified in the same way as above (Subheading 3.3., step 4) except no FdUTP is added. The primers used for amplification are shown in Table 1. The PCR products are gel purified and sequenced with one of the primers used for amplification.
3.7. Sequence Analysis for Mutation Detection 3.7.1. Setting Up the Sequencing Reaction 1. From the size of the mismatch fragment estimate the position of the mutation from either end of the segment. 2. Amplify either the same segment from a new RT-PCR or amplify the relevant exons (see Note 15). 3. Gel purify the products (see Note 16). 4. Set up the sequencing reaction as follows: Dye terminator mix 4 µL, primer 0.8 pmol, DNA (200–400 ng) water to 10 µL. Overlay with mineral oil. 5. Start the following thermal cycling condition: 96°C for 30 s, 50°C for 15 s, 60°C for 4 min, 25 cycles and hold at 4°C. 6. Transfer the content of the reaction tube to a fresh tube and add 1 µL 3 M sodium acetate, pH 4.6 and 25 µL ethanol. Mix and incubate on ice for 10 min. 7. Centrifuge at the maximum speed for 15 min at room temperature. 8. Wash pellet with 70% ethanol. Vortex to resuspend for about 30 s. This is very crucial in removing un-incorporated nucleotides. 9. Repeat the centrifugation step (step 7).
144
Waseem et al.
Fig. 3. Gel image of mismatch products obtained by Genescan software on ABI PRISM 377 DNA Sequencer. Lane M: Genescan 2500 Rox marker, lanes 1 and 6: Patient 4265 with mutation at 1798 G to T leading to 50 nt deletion in mRNA, lanes 2 and 7: patient 4262 with mutation at 1763, A to G (see Note 14), lanes 3 and 8: patient 4243 with mutation at 1801 A to G Lanes 4 and 9: patient 4229 with mutation at 1636 C to T, Lanes 5 and 10 are controls.
Chemical Cleavage of Mismatch Method
145
10. Discard the supernatant and air dry the pellet for 10 min at room temperature. 11. Resuspend in 2 µL of formamide loading dye. Just before loading heat the sample at 92°C for 2 min.
3.7.2. Preparation of Polyacrylamide Gel 1. Clean and set up the glass plates as described above (Subheading 3.5.). 2. Prepare 4.25% acrylamide mix as follows: Urea 18 g 40% Acrylamide:bisacrylamide gel mix 5.3 mL Water 27 mL Amberlite mixed bed resin 0.5 g Stir for 5–10 min. Filter through 0.2-µm filter and add 5 mL 10X TBE, 250 µL 10% APS, and 35 µL TEMED. 3. Immediately pour it between the plates from the top end, pressing the plates to avoid bubbles. 4. Allow it to set for 30–60 min at room temperature. 5. Pre-run the gel for 15 min on PR 2X A. 6. Load the samples from step 11 in Subheading 3.7.1. and electrophorese for 7 h on R 2X A.
3.7.3 Sequence Analysis 1. To start the sequence analysis program double click on the gel file from the sequence run. 2. Check the tracking of the lanes of the gel. If the tracking is altered then make new sample files using generate sample files from gel menu. 3. Quit sequence analysis program and open Sequence Navigator program for the analysis of mutations. 4. Import relevant sequences together with the published factor VIII sequence and compare them using Comparative or Clustal program from Alignment menu.
3.8. Preliminary Detection of Intron 22 Inversion in Factor VIII Gene Forty five percent of the severe haemophilia A patients have inversions in their factor VIII gene involving intron 22 resulting in the factor VIII coding sequence ending at exon 22 (6) and leading to segment 6 amplification failure. To distinguish this from other causes (e.g., partial gene deletion) factor VIII message across the junction of exon 22 to 23–26 is reverse transcribed and amplified. As a positive control exon 23 to 26 are also reverse transcribed and amplified (Fig. 4). 1. Set up the following RT-PCR reaction: 5 µL 5X reaction buffer, 0.5 µL 10 mM dNTPs, 1.5 µL 25 mM MgSO4, 2.5 µL each of 100 ng/mL primer 22A and 6B,
146
146 Waseem et al.
Fig. 4. Schematic diagram showing the distal segment of factor VIII mRNA and two stage amplification reactions for locating the gene inversion involving intron 22. Open bars represent the primary PCR whereas filled bars are the secondary PCRs.
Chemical Cleavage of Mismatch Method
2. 3.
4.
5.
147
0.5 µL AMV reverse transcriptase, 0.5 µL Tfl DNA polymerase. Make up the volume with water to 25 µL. Set up an identical reaction except use 23A instead of 22A. Incubate at 48°C for 1 h followed by 10 cycles of 93°C for 30 s, 60°C for 30 s, 68°C for 5 min. For the secondary PCR add 2.5 µL 10X Tfl buffer, 0.5 µL 10 mM dNTP, 1 µL 25 mM MgSO4, 2.5 µL each of primer 22C and 6D, 0.5 µL Tfl DNA polymerase, 14.5 µL water, 2.5 µL primary PCR. Use 23C instead of 22C for the other RT-PCR. The thermal cycling conditions are 94°C for 5 min, and 30 cycles of 93°C for 30 s, 60°C for 30 s, 72°C for 3 min and finally 72°C for 5 min to complete the extension of all the products. Analyze the PCR products on a 1% agarose gel.
4. Notes 1. Blood as old as three days at room temperature can be used for the isolation of RNA. Although the yield of RNA is low it is usually good enough for the RT-PCR. 2. We normally analyse our RNA on 1% agarose gel before starting the RT-PCR. To 2 µL RNA solution add 2 µL bromophenol/glycerol dye (0.1% bromophenol blue in 30% glycerol). Heat it at 65°C for 5 min and load on the gel. Two, sometimes three, ribosomal RNA bands are visible under UV light. 3. Some types of mutations, e.g., nonsense or frameshift make the transcript unstable. To overcome this, increase the number of cycles in primary PCR from 10 to 30. 4. Fluorescent dUTP and dCTP lowers the efficiency of PCR. Avoid using too much fluorescent dUTP in the PCR reaction. 5. The thermal cycling conditions given here are for Perkin Elmer thermocyclers. 6. We use cloned factor VIII from Genentech as a probe to amplify segment 1, 2, 5, and 6. Segment 3, 4, 7, and 8 are amplified from normal DNA. 7. Hybrids of target and control DNA can be stored at –20°C for upto 3 d. 8. Osmium tetroxide is a strong oxidizing agent, avoid undue exposure to the air. 9. Hydroxylamine and osmium reaction can either be performed separately or can be combined. To do that, first do the reaction with hydroxylamine then osmium followed by piperidine cleavage step. Follow the reaction until Subheading 3.4.2.1. then start the osmium reaction as described in the protocol. 10. On a Genescan gel a couple of fluorescent bands appear approx 150–200 bp. These are the degraded fluorescent moieties from the fluorescence dUTPs. They can be removed from the reaction mixture by ethanol precipitation. Perform the cleavage step with aqueous 1 M piperidine at 90°C for 30 min. Add 1/10 vol of 3 M sodium acetate, pH 4.6 and 2.5 vol of ethanol. Place the tube
148
11.
12.
13.
14. 15. 16.
Waseem et al. in dry ice for 5 min, spin at maximum speed for 10 min in a microfuge. Wash the pellet with 70% ethanol, air dry, and resuspend in 5 µL of formamide loading dye. Twelve-centimeter plates give good separation of most of the mismatch bands. However, samples which have large mismatch products are better separated on 36-cm plates. The manufacturer of ABI PRISM 377 DNA sequencer recommend the gel to age for 2 h before loading the samples, However, we find that 15 min setting time with a shork-tooth comb is enough. Gels left to set for more 2 h run slower. More accurate sizing of the mismatched products on a Genescan gel will require internal standards. For this purpose GS 2500-Rox diluted 1:400 in formamide loading dye should be in used in place of formamide loading dye at the cleavage step. A T nucleotide mispaired with G is not modified by osmium if preceded by G at the 5'-end and will only show up in the hydroxylamine reaction (7). Fluorescent DNA sequencing requires more template than 35S dATP sequencing. Do not even attempt to sequence from a poor PCR. For gel purifying the PCR product, remove the relevant band from the low melting agarose gel and add equal volume of water. Heat at 70°C for 10 min, this keeps it in solution. Several matrices are available commercially, e.g., Geneclean (BIO101), PCR purification kit (Promega), centrisep column (Amicon), which can be used for the purification of DNA from this gel.
References 1. Gitschier, J., Wood, W. I., Goralka, T. M., Wion, K. L., Chen, E. Y., Eaton, D. H., Vehar, G. A., Capon, D. J., and Lawn, R. M. (1984) Characterization of the human factor VIII gene. Nature 312, 326–330. 2. Toole, J. J., Knopf, J. L., Wozney, J. M., Sultzman, L. A., Buecker, J. L., Pittman, D. D., Kaufman, R. J., Brown, E., Shoemaker, C., Orr, E. C., Amphlett, G. W., Foster, W. B., Coe, M. L., Knutson, G. J., Fass, D. N., and Hewick, R. M. (1984) Molecular-cloning of a cDNA-encoding human antihemophilic factor. Nature 312, 342–347. 3. Higuchi, M., Antonarakis, S. E., Kasch, L., Oldenburg, J., Economou-Petersen, E., Olek, K., Arai, M., Inaba, H., and Kazazian, H. H. (1991) Molecular characterisation of mild-to-moderate hemophelia A: detection of the mutation in 25 of 29 patients by denaturing gel electrophoresis. Proc. Natl. Acad. Sci. USA 88, 8307–8311. 4. Orita, M., Iwahana, H., Kanazawa, H., Hayashi, K., and Sekiya, T. (1989) Detection of polymorphisms of human DNA by gel-electrophoresis as single-strand conformation polymorphisms. Proc. Natl. Acad. Sci. USA 86, 2766–2770. 5. Naylor, A., Green, P. M., Montandon, A. J., Rizza, C. R., and Giannelli, F. (1991) Detection of three novel mutations in two haemophilia A patients by
Chemical Cleavage of Mismatch Method
149
rapid screening of whole essential region of factor VIII gene. Lancet 337, 635–639. 6. Naylor, J. A., Green, P. M., Rizza, C. R., and Giannelli, F. (1992) Factor VIII gene explains all cases of haemophilia A. Lancet 340, 1066,1067. 7. Forrest, S. M., Dahl, H. H., Howells, D. N., Dianzani, I., and Cotton, R. G. H. (1991) Mutation detection in phenylketonuria using the chemical cleavage of mismatch method: Importance of using probes from both normal and patient samples. Am. J. Hum. Genet. 49, 175–183.
Inversion Mutation Analysis
151
15 Inversion Mutation Analysis in Hemophilia A by Restriction Enzyme Analysis and Southern Blotting Chike Ononye and P. Vincent Jenkins 1. Introduction Intron 22 of the factor VIII gene contains a 9.5kb region of DNA that is repeated on at least two other locations telomeric to, and at least 500 kb from, the gene. These regions are termed intron 22 homologous regions (int22h) (1) and contain the Factor VIII associated gene (F8A). The underlying cause of the disease in approximately 40% of all severe hemophilia A patients is an inversion event between the int22h within the factor VIII gene and the distal or proximal copy of int22h 5' of and telomeric to the gene, causing a separation of exons 1–22 and 23–24 of the factor VIII gene. This inversion event is a result of intrachromosomal homologous recombination between the intragenic int22h-1 and either of the two extragenic int22h-2 or int22h-3 regions. Because int22h-1 lies in the opposite orientation to the two extragenic copies, this recombination event results in the central intervening portion of DNA being “inverted” from its original orientation, thus disrupting the factor VIII gene. Some individuals may have more than two int22h region, which can also participate in causing an inversion. These inversions are thus sporadic and may occur in families that have had no previous history of hemophilia. Detection of the inversion event in hemophilia A patients has been described using BclI restriction of genomic DNA followed by a Southern blot assay using a probe (p482.6) derived from intron 22 of the factor VIII gene (2,3). This method has been used by many centers as well as ourselves in detecting this mutation in our patients for carrier status (4,5) and prenatal diagnosis (4). This technique has provided a means to identify a definitive From: Methods in Molecular Medicine, Vol. 31: Hemostasis and Thrombosis Protocols Edited by: D. J. Perry and K. J. Pasi © Humana Press Inc., Totowa, NJ
151
152
Ononye and Jenkins
mutation in families previously uninformative on RFLP analysis. Furthermore, no intervening family members are required to provide a diagnosis. Inversion analysis is the first test for carrier diagnosis and genetic counseling for severe hemophilia A. The method described for inversion analysis uses Southern blotting, but a PCR-based analysis of the inversion has recently been described and should considerably simplify the detection of the inversion (6). 2. Materials 2.1. Restriction Enzyme Digestion of DNA 1. 2. 3. 4. 5. 6.
BclI (10 U/µL) (Boehringer Mannheim). Deionized water. 10X Restriction enzyme buffer. DNA samples including appropriate controls (see Note 2). 0.5-mL Eppendorf. Water bath or heating block at 50°C.
2.2. Preparation of Agarose Gels Ethidium bromide 0.5 µg/mL (see Note 1). 10X TBE electrophoresis buffer, pH 8.0. Deionized water. DNA grade agarose, e.g.. SeaKem® LE agarose Gel casting apparatus and combs. Wells must be capable of holding at least 50 µL. Submarine gel electrophoresis equipment. 6X Sucrose loading buffer: 40% sucrose (w/v), 0.25% bromophenol blue, and 0.25% xylene cyanol FF. Store at 4°C. 8. 10% SDS. 9. Molecular weight makers, e.g., λ DNA digested with HindIII or SmaI. 1. 2. 3. 4. 5. 6. 7.
2.3. Southern Blotting 1. 0.25 M HCl. 2. Denaturing buffer: 1.5 M NaCl, 0.5 M NaOH. Store at room temperature. 3. Neutralization buffer: 0.5 M Tris-HCl, 1.5 M NaCl. Adjust pH to 7.3 with 10 M NaOH. Store at room temperature. 4. 20X SSC: 175.3 g NaCl, 88.2 g sodium citrate. Make up to 1 L with distilled water and adjust the pH to 7.0 with 10 N NaOH. Store at room temperature. 5. Rotary shaker. 6. 3MM Whatman paper. 7. Clingfilm. 8. Apparatus for Southern blotting. 9. Paper towels/tissues. 10. Nylon membrane, e.g., Hybond N+. Amersham (Amersham, UK). 11. UV transilluminator.
Inversion Mutation Analysis
153
2.4. Probe Labeling 1. 2. 3. 4. 5. 6.
0.5 M EDTA. DNA labeling kit, e.g., Megaprime, Amersham (Amersham, UK). Deionized water. Geiger counter suitable for β-emission detection. [α-32P]dCTP: 9.25 MbQ/25 µL, e.g., Amersham (see Note 3). Probe for labeling: p482.6 (see Note 4).
2.5. Hybridization, Washing, and Autoradiography 1. 20% SDS. 2. 20X SSC: 175.3 g NaCl, 88.2 g sodium citrate. Make up to 1 L with distilled water and adjust the pH to 7.0 with 10 N NaOH. 3. Hybridization oven (Hybaid, UK). 4. 3MM Whatman paper. 5. 65°C Water bath. 6. Autoradiograph cassette. 7. Church’s buffer: 0.5 M Na2HPO4, 1 mM EDTA, 7% SDS, and 1% bovine serum albumin (BSA). Store at room temperature. 8. Clingfilm. 9. Crushed ice. 10. Distilled H2O. 11. Geiger counter suitable for β-emission detection. 12. Radioactively labeled probe (see Subheading 2.4.). 13. Washing solution: 1000 mL of 4X SSC/0.1% SDS. Prepare by mixing 200 mL of 20X SSC, 5 mL of 20% SDS to 800 mL of dH2O. Prewarm before use to room temperature. 14. Sandwich box. 15. Orbital shaker. 16. X-Ray film, e.g., Kodak X-OMAT S.
3. Methods 3.1. Restriction Enzyme Digestion 1. 2. 3. 4. 5.
For inversion analysis, 10 µg of genomic DNA is required per patient Add the appropriate volume of the DNA sample to a 0.5-mL Eppendorf tube. Add water to 36 µL. Add 4 µL of 10X restriction buffer. Add 10 U of BclI and incubate overnight at 50°C For a shorter digestion, add 40 U of BclI and incubate at 50°C for 3–4 h.
3.2. Agarose Gel Electrophoresis 1. Prepare a 25-cm long 0.5% agarose gel by mixing 1.5 g of DNA grade agarose with 300 mL of 1X TBE buffer. 2. Heat the agarose mixture in a microwave or on a hot plate until the agarose has completely dissolved.
154
Ononye and Jenkins
3. Cool to about 50°C by swirling under a cold running tap. 4. Add 20 µL of ethidium bromide, mix and pour into the gel casting tray. Insert the comb and allow the gel to set for at least 60 min prior to use. 5. While the gel is setting, prepare the restriction enzyme digests for electrophoresis by adding 1.5 µL of 10% SDS and 10 µL of sucrose loading buffer to each sample. 6. Prepare the molecular weight marker by adding 0.5 µg of the maker to 15 µL of dH2O and 5 µL of sucrose loading buffer. 7. Place the agarose gel in the submarine gel electrophoresis tank, and submerge the gel to a depth of 2–3 mm in 1X TBE. 8. Load molecular weight markers in lane 1 and the digested DNA controls in lanes 2 and 3. 9. Load the unknown samples in the remaining wells. 10. Carry our the electrophoresis at room temperature at 70 V overnight or 50 V for 48 h (see Note 5). 11. After electrophoresis, visualize the gel on a transilluminator to ensure adequate separation. There should be at least 2 cm between the 22010 bp and 13282 bp bands of the mol-wt marker.
3.3. Southern Blotting 1. After running the gel and ensuring adequate separation, remove excess gel by cutting vertically around the lanes and horizontally 5 cm above and below the 48502 bp and 9688 bp marker bands, respectively. 2. Depurinate the gel by immersing it completely with 0.25 M HCl. Place on a rotary shaker at low speed for 15 min. 3. Denature the gel by removing the HCl and completely immersing the gel in denaturing buffer. Place on a rotary shaker at low speed for 60 min. 4. Neutralize the gel by removing the denaturing buffer and completely immersing it with neutralizing buffer. Place on a rotary shaker at low speed for 90 min. 5. During neutralization, set up the Southern blotting apparatus (see Fig. 1) and pour an excess of 20X SSC into the base. Prepare a wick from 3MM paper and saturate with 20X SSC. 6. After neutralization is complete, place the gel on the blotting base, ensuring that no air bubbles are trapped between the wick and gel. 7. Cover all exposed areas of wick with clingfilm to reduce the risk of evaporation of the transfer buffer. The clingfilm should extend to the edges of the gel to ensure that no areas of wick are left exposed. 8. Prepare 500 mL of 2X SSC. 9. Cut an area of nylon membrane to the dimensions of the gel and thoroughly soak it in 2X SSC. 10. Cut three pieces of 3MM Whatman paper to the dimensions of the gel and soak them in 2X SSC. 11. Place the soaked nylon membrane on the gel ensuring that there are no trapped air bubbles.
Inversion Mutation Analysis
155
Fig. 1. Diagram illustrating the Southern blot apparatus. 12. Place the soaked pieces of Whatman one after the other onto the membrane on the gel again, ensuring no air bubbles are trapped. 13. Place a stack of tissues approx 4 cm high onto the Whatman Paper, and a similar stack of paper towels onto the tissues. 14. Place a suitable glass plate on the whole assembly and a weight of approx 500 g onto the glass plate. 15. Allow transfer to take place overnight (12–16 h). 16. Dismantle the stack and before lifting the membrane from the gel, mark it with a soft pencil to indicate the blot number and origin. 17. Lift the membrane, briefly wash briefly in 2X SSC to remove any adherent agarose and allow to dry by resting it on a sheet of Whatman paper. 18. Fix the DNA onto the blot permanently by UV illumination for 2 min on each side.
3.4. Probe Labeling 1. 25 ng of probe is labeled with [α-32P]dCTP using the “Megaprime” DNA labeling kit according to the manufacturer’s instructions. There is no requirement to separate the labeled probe from unincorporated nucleotide or unlabeled probe.
3.5. Hybridization of Nylon Membranes with Labeled Probe 1. Switch on the hybridization oven at least 30 min before commencing this stage, set at 65°C. 2. Roll up the dried nylon hybridization membrane and place it into a hybridization bottle. Ensure the DNA side is facing inwards. 3. Place the Church’s buffer in a water bath to prewarm to 65°C. 4. Prehybridize using a excess of Church’s buffer approx 10 mL for a small bottle and 20 mL for a large bottle. 5. Prehybridize for at least 2 h. 6. Denature the labeled probe for 5 min at 100°C and then place immediately on ice to cool.
156
Ononye and Jenkins
Fig. 2. Autoradiograph showing the results of inversion analysis in 6 patients. Lane 1 shows a distal inversion pattern seen in a severely affected male (VIII:C<1u/dL) with bands of 20kb, 17.5kb, and 14kb. Lanes 2 and 6 show a normal pattern (bands of 21.5kb, 16kb, and 14kb). Lanes 3 and 5 show the results for two female carriers of the distal inversion. 7. After prehybridization is complete, remove the original Church’s buffer and replace with a smaller amount of the prewarmed buffer. Use 5 mL for a small bottle or 7.5 mL for a large bottle. 8. With appropriate radiation protection, pipette the labeled probe directly into the buffer. Do not allow it to touch the nylon membrane first. 9. Return hybridization bottle to the oven and hybridize overnight. 10. Remove the hybridization bottle from the oven. Take out the nylon membrane using a pair of tweezers and place in a sandwich box. 11. Pour in 300–400 mL of washing solution (at room temperature) and place the sandwich box on a shaker for 10 min. 12. Pour out the wash solution, retaining the nylon membrane in the sandwich box. Repeat this step. 13. Check the nylon membrane with a Geiger counter. If counts exceed 10 cpm, then proceed with step 14. 14. Pour out the wash solution, retaining the nylon membrane in the sandwich box and replace with the pre-warmed wash solution at 65°C. Place on a shaker for no more than 5 min. 15. Pour off the wash solution and very briefly dry on Whatman paper. 16. Wrap the blot in clingfilm. Ensure that no air bubbles are present. 17. In a dark room, place the blot between two sheets of X-ray film, taping it securely to one, and place in an autoradiograph cassette. 18. Place the cassette at –70°C or below for at least 48 h before developing the first film.
3.6. Interpretation of Results The results of inversion analysis by Southern blot analysis are shown in Fig. 2.
Inversion Mutation Analysis
157
4. Notes 1. Ethidium bromide is a powerful mutagen and should be handled with care. 2. Known DNA samples should be included as controls. These should include examples of the proximal and distal inversions. 3. Radio-isotopes should be handled with care and only by appropriately trained personnel. All pipet tips, buffers, etc., must be disposed of appropriately. 4. The probe is prepared by purifying a 0.9 kb EcoRI/SstI fragment or a 9.6 kb fragment derived from a complete EcoRI digest of p486.2. The clone is available from the American Type Culture Collection (ATCC) (12301 Parklawn Drive, Rockville, MD). 5. It is important that adequate electrophoresis times are used. The fragments of importance are large and close to each other and may not be adequately resolved with short electrophoresis times.
References 1. Naylor, J. A., et al. (1995) Investigation of the factor VIII intron 22 repeated region and associated inversion junctions. Human Mol. Genetics 7, 1217–1224. 2. Lakich, et al. (1993) Inversions disrupting the factor VIII gene are a common cause of haemophilia A. Nature Genetics 5, 236–241. 3. Lillipcrap, D. P. (1990) Variation of the Non-Factor VIII sequences detected by a probe from intron 22 of the factor VIII gene. Blood 75, 139–143. 4. Ononye, C. et al. (1997) Carrier detection and prenatal diagnosis by intron 22 inversion analysis of the factor VIII gene. Haemophilia l, 204–206. 5. Jenkins, P. V., et al. (1996) Analysis of intron 22 inversions of the factor VIII gene in severe haemophilia: implications for genetic counselling. Blood 84, 2197–2201. 6. Liu, Q., Nozari, G., and Sommer, S. S. (1998) Single-tube polymerase chain reaction for rapid diagnosis of the inversion hotspot of mutation in Hemophilia A. Blood 92, 1458–1459.
Hemophilia B Mutational Analysis
159
16 Hemophilia B Mutational Analysis Peter M. Green 1. Introduction Since the cloning of the factor IX gene in 1982 (1), there have been several strategies employed for the identification of mutations in the mutationally heterogeneous hemophilia B population. Initially, such strategies inevitably employed Southern blotting to screen for gross deletions (2) or restriction site alterations (3), and cloning of the patients genomic DNA (4). However, with the advent of polymerase chain reaction (PCR) using a thermostable DNA polymerase (5), cloning has become superfluous, and factor IX mutations can be identified simply by direct DNA sequencing of PCR-amplified sections of the factor IX gene (6). From 1988 onwards, a new method of screening PCR products for mutations was developed in our laboratory (7) based on the chemical cleavage of mismatch method which was first used on cloned DNA (8). This procedure, capable of detecting 100% of mutations, is useful for screening a large number of patients who are all expected to have different mutations, prior to sequencing the PCR product. However, it is probably quicker simply to sequence the products straightaway if only a handful of patients are to be examined (6). The primers used to amplify the factor IX gene have been designed flanking each of the eight exons so that, typically, about 100 bp 5' of the exon is amplified to include the putative branch site consensus required for splicing, and about 40 bp 3' of the exon to allow for variable sequencing signals close to the primer. The exceptions are exon a, where the PCR product includes the promoter region (9) up to approx –400, exons b and c, which are amplified in one product as the intron is very small, and exon h where the 3' primer is positioned just beyond the stop codon. For completeness, a further product is amplified around the polyadenylation signal in the 3' untranslated region. From: Methods in Molecular Medicine, Vol. 31: Hemostasis and Thrombosis Protocols Edited by: D. J. Perry and K. J. Pasi © Humana Press Inc., Totowa, NJ
159
160
Green
Fig. 1. This scheme shows the basic steps in the chemical cleavage of mismatch protocol. The filled circles at the end of the probe indicates the 32P label.
The chemical cleavage of mismatch technique requires a hybrid to be formed between the test PCR product (amplified from patient DNA) and a normal product (Fig. 1). If a mutation is present anywhere within this hybrid, then there
Hemophilia B Mutational Analysis
161
will be a mismatched base. Mismatched cytosine residues will be modified by incubating with hydroxylamine hydrochloride, while mismatched thymine residues will be modified by incubation with osmium tetroxide. Any such modified strands of DNA can then be cleaved by piperidine at the site of modification and the resulting products run out on a denaturing polyacrylamide gel. Suitably radiolabeled DNA will then be seen after exposure to X-ray film. The size of any cleaved band indicates the distance, from one end or the other, of the mismatched base and hence the mutation, which can then be targeted for sequencing. 2. Materials 2.1. PCR 1. PCR primers: 5a: ACAAGCTACAGGCTGGAGAC (-475 to -455) and 3a: TCTAAAAGG CAAGCATACTC (163 to 144) 5b2: TTGGCTTTCAGATTATTTGG (6216 to 6235) and 3c: CCCACATAA TTCTCATATGTTTC (6759 to 6737) 5d: ATCCCAATGAGTATCTACAGG (10311 to 10331) and 3d: GGGAAACTT TGAACCATGAG (10547 to 10528) 5e: CCCCAATGTATATTTGACCCATAC (17571 to 17592) and 3e: GCTGAA GTTTCAGATACAGA (17849 to 17830) 5f: AAGTGACAAGGATGGGCCTCAATC (20266 to 20289) and 3f2: GAA ACTTGCCTAAATACTTCTC (20688 to 20667) 5g2: CATTTCTGCCAGCACCTAGAAGCC (29922 to 29945) and 3g: AAA GAGCTAGTGGTGCTGCAG (30199 to 30179) 5h2: GCCAATTAGGTCAGTGGTCC (30730 to 30749) and 3h2: GATTAG TTAGTGAGAGGCCCTG (31436 to 31415) Store working solution of 10 ng/µL at 4°C, and stock solution for long term at –20°C. 2. 10X PCR buffer: 670 mM Tris-HCl, pH 8.8, 166 mM ammonium sulfate, 67 mM magnesium chloride, 100 mM β-mercaptoethanol, 1.7 mg/mL bovine serum albumin (BSA). Aliquot and store at –20°C. Working aliquot can be kept at 4°C. 3. dNTP mix: Make a mix of 2 mM of each dNTP diluted in TE in one tube. Store at –20°C. Working solution can be kept at 4°C. 4. TE: 10 mM Tris-HCl, pH 8.0, 0.1 mM EDTA. Store at room temperature. 5. Taq polymerase (5 U/mL). Store at –20°C. 6. Mineral oil.
2.2. GeneCleaning of PCR Products 1. GeneClean™ Kit from Bio 101 (distributed in UK by Stratech Scientific) (see Note 1).
2.3. Chemical Cleavage of Mismatch 1. γ-32[P]-dATP (Amersham). 2. Polynucleotide kinase (BCL).
162
Green Table 1 Preparation of Dideoxy Rermination Mixes Stock solutions
A mix
C mix
G mix
T mix
0.5 mM dCTP 0.5 mM dGTP 0.5 mM dTTP 0.05 mM ddATP 0.05 mM ddCTP 0.05 mM ddGTP 0.05 mM ddTTP TE Final volume
80 µL 80 µL 80 µL 0.8 µL — — — 260 µL 500 µL
80 µL 80 µL 80 µL — 80 µL — — 180 µL 500 µL
0 µL 80 µL 80 µL — — 80 µL — 180 µL 500 µL
80 µL 80 µL 80 µL — — — 80 µL 180 µL 500 µL
3. 20 mg/mL Mussel glycogen (BCL) as carrier. 4. 10X Hybridization buffer: 1 M Tris-HCl pH 8.0, 3 M NaCl. 5. Hydroxylamine solution: 4 M hydroxylamine hydrochloride (Sigma) titrated to pH 6.0 by adding approx 0.3 vol of diethylamine (Sigma). These chemicals are toxic and should be handled in a fume cupboard. The solution should be made up fresh each time. 6. Osmium solution: 0.4% osmium tetroxide, 2% pyridine (Sigma). Osmium tetroxide is best purchased as a 4% solution (Sigma) and diluted fresh each time. Store solution at 4°C and replace every 2–3 mo as it goes off rapidly. Again, handle in a fume cupboard. 7. 70% Ethanol, 30% 0.3 M sodium acetate. 8. Piperidine solution: 1 M piperidine in water. Keep on ice and use immediately. Stock piperidine (10 M) is stored at 4°C. 9. Formamide dyes: bromophenol blue plus xylene cyanole (a small “pinch” of each) in 10 mL of deionized formamide. Store room temperature.
2.4. DNA Sequencing Four dideoxy termination mixes (see Table 1): 18. mMol (Amersham). 1. 2. 3. 4. 5.
35[S]-dATP
at 600 Ci/
0.1 M Dithiothreitol (DTT). Dimethylsulphoxide (DMSO). Chase mix: 0.25 mM of each dNTP in TE/10% DMSO. Sequenase™ (12.5 U/mL) and 5X buffer(USB). Salad spinner: obtainable from most supermarkets or hardware stores, these are easily adapted for hand-spinning microtiter plates (at low g-force!) for mixing solutions into the bottom of the wells. 6. Additional primers for sequencing: 5b1: GATCATGAAAACGCCAAC (6334 to 6351); 3b1: TTCCATACATTCTCTCTC (6435 to 6418); 5h1: GGATCTGGC TATGTAAGTGGTCGG (31028 to 31051); 3h1: CCACTATCTCCTTGA
Hemophilia B Mutational Analysis
163
CATGAATCTC (31218 to 31194). These may be required for sequencing the longer PCR products
3. Methods 3.1. PCR 1. Aliquot 1 µL of each test DNA (approx 30–100 ng) into 0.5-mL microcentrifuge tubes, plus 1 µL of TE as a negative control. 2. Make up a premix for the exon you wish to amplify by multiplying the following volumes by the number of tubes you have plus two for safety: TE 32.5 mL dNTPmix 5 µL PCR buffer 5 µL 5' primer 3 µL 3' primer 3 µL Taq polymerase 0.5 µL Total volume: 49 µL 3. Dispense 49 µL/tube, add a drop of mineral oil and place in PCR machine. Set machine for 94°C for 5 min, followed by 30 cycles of 93°C for 1 min, 61°C for 30 s, 72°C for 2 min, and a final incubation of 72°C for 5 min. 4. Check amplification by running a 5-µL aliquot of the reaction on a 1.5% agarose minigel stained with ethidium bromide. 5. If the products are of the correct size and clean bands, they may proceed directly to the mismatch stage; if not they should be “GeneCleaned” The DNA to be used as probe (usually amplified from a “normal” person) should in any case be “GeneCleaned.”
3.2. “GeneCleaning” (see Note 2) (This is following the manufacturer’s instructions.) 1. Use a scalpel to cut out the band of interest on a UV light box. Care should be taken to keep the UV exposure (both to the DNA and the worker!) to an absolute minimum (see Note 3). 2. Place excised band in a preweighed 1.5-mL microcentrifuge tube. Re-weigh to obtain the weight of gel slice, and add 0.5 volumes of TBE modifier and 4.5 volumes of sodium iodide solution. Heat at 55°C for 5 min or until the gel slice has fully dissolved. 3. Add 5 µL of “Glassmilk” and leave for 5 min at room temperature. 4. “Flick-spin” in a microcentrifuge and remove supernatant. 5. Resuspend in 200 µL of NEW wash solution. 6. Repeat steps 4 and 5 twice more, then “flick-spin” to remove all traces of NEW wash. 7. Resuspend in 5 µL of TE, place in 55°C waterbath, and centrifuge for 2 min. Collect the supernatant in a fresh tube. 8. Repeat step 7, combining the supernatants to give a final eluate of 10 µL.
164
Green
3.3. Chemical Cleavage of Mismatch (see Fig. 2) The protocol described here is the basic radioactive end-labeling method. For other labeling procedures and modifications (see Note 4). 1. Label the probe DNA as follows: Add 1 µL of the normal, GeneCleaned PCR product (approx 50 ng), 1 µL 10X polynucleotide buffer (supplied by manufacturer), 1 µL polynucleotide kinase, 6 µL TE and 0.5 µL γ-32[P]-dATP. 2. Incubate at 37°C for 30 min. 3. To the labeled probe, add 20 µL of 10X hybridization buffer and 170 µL TE. 4. Aliquot 10 “target“ DNA samples into 1.5-mL microcentrifuge tubes: use 5 µL of neat PCR product or 1 µL of “GeneCleaned” product (approx 50 ng). 5. Add 19 µL of the labeled probe mix to each target plus a drop of mineral oil. 6. Incubate at 95°C for 5 min followed by 65°C for 1 h (or overnight if convenient). 7. Add 2 µL of glycogen (as a carrier) to each hybrid plus 0.5 mL of ethanol. Place on dry ice for 5 min and centrifuge for 5 min at 12,000 rpm in a microfuge. 8. Remove and discard supernatant. 9. Resuspend in 14 µL of TE and transfer 7 µL to a fresh 1.5-mL microcentrifuge tube for reaction with osmium tetroxide. 10. Add 20 µL of hydroxylamine solution to one set of tubes and 20 µL of osmium tetroxide solution to the other. 11. Incubate the hydroxylamine tubes at 37°C for 2 h, and the osmium tetroxide tubes at room temperature for 15 min. 12. Stop the reactions by adding 0.5 mL of the ethanol/acetate mixture and placing on ice for 5 min. 13. Centrifuge for 5 min and discard supernatant. 14. Resuspend pellet in 50 mL of piperidine solution and incubate at 90°C for 30 min. 15. Snap-chill on ice and ethanol precipitate again (as in steps 12 and 13). 16. Resuspend the pellets in 5 µL of formamide dyes and load onto a denaturing 6% polyacrylamide gel. 17. When gel has run, remove top plate, cover gel in Saran Wrap™, and expose to pre-flashed X-ray film overnight or longer.
3.4. DNA Sequencing A mismatch band indicates a mutation is present in a particular PCR product (see Note 6). The size of the band indicates the distance in from one end or the other where the sequencing reaction should be targeted. The following volumes are for sequencing eight templates. 1. Make up primer premix: 5 µL primer at 100 ng/mL (either one of the PCR primers or one of the sequencing primers suggested in materials), 18 µL 5X Sequenase buffer, 25 µL TE, and 6 µL DMSO. 2. Add 6 µL of primer premix to 1 µL of GeneCleaned each PCR product in a 0.5mL microcentrifuge tube. 3. Make up the enzyme/label premix: 8 µL 35[S]-dATP, 8 µL 0.1 M DTT, 3 µL DMSO, 15 µL TE, and 1 µL Sequenase (T7 DNA polymerase).
Hemophilia B Mutational Analysis
165
Fig. 2. This autoradiograph of a typical mismatch gel shows the full-length PCR product of exon h (725 nucleotides) at the top of each track. In this experiment, the products were treated with hydroxylamine. Two cleavage bands can be seen of the same size in tracks 2 and 5 (arrowed). m, mol-wt markers; nt, nucleotides. 4. Aliquot 2 µL of each dideoxy mix (‘A mix’, ‘C mix’, etc.) into the wells of a heat resistant microtiter plate. Spin to bottom of well with a salad spinner. 5. Incubate the primer plus templates at 95°C for 5 min, then snap-chill on ice/water bath. 6. Add 4 µL of enzyme/label mix to each annealed template/primer mix; spin to mix. 7. Add 2 µL of this mix to each of four microtiter plate wells containing, respectively, the four dideoxy nucleotide mixes (as prepared in step 4). 8. Spin to mix. Incubate for 5 min at 37°C. 9. Add 2 µL of chase mix to each well. 10. Spin to mix. Incubate at 37°C for 5 min.
166
Green
11. Add 2 µL of formamide dyes to each well 12. Spin to mix. Heat at 95°C for 3 min and snap-chill on an ice/water bath. 13. Load as much of sample as possible onto a denaturing 6% polyacrylamide gel (see Note 7). 14. Run fast blue dye to bottom of gel (roughly equivalent to primer length) and split open glass plates. 15. Fix gel by covering in 10% acetic acid for 15 min. Wash in tap water for 15 min. 16. Place gel on Whatman 3MM paper, cover in Saran Wrap™ and dry on gel dryer for about 30 min. 17. Expose to x-ray film for one day (or up to 14 d for weak signal).
4. Notes 1. The GeneClean™ kit is very easy to use and one of the quickest of the many “band purification” protocols available. Like all kits, however, it is expensive if used on a regular basis. Making your own ‘kit’ is very simple and costs next to nothing (10). 2. Alternative purification methods of gel bands should work just as well. 3. Ultraviolet light will nick the DNA and so increase the background cleavages in the mismatch protocol. Therefore, the DNA should be treated with care—avoid repeated freeze/thawing, store at pH 8.0, and keep UV exposure to an absolute minimum. 4. As an alternative to end-labeling, it is possible to internally label with 32[P]-dCTP during the PCR. However, this generally gives a higher background although has the advantage of allowing both cleavage bands to be seen. A significant throughput of samples is obtained by using internal fluorescent dUTPs (ABI): three products can be labeled with different colors and multiplexed, and run on an ABI 373 or 377 machine. This can be done following the protocol described above, or, for faster manipulations, by using biotinylated primers and streptavidin coated magnetic beads instead of ethanol precipitations (11) (see Chapter 14 for full description of the protocol). 5. The sequencing protocol described here has been used successfully in our laboratory for 10 yr (6,12). Automated fluorescent sequencing is an alternative procedure (described in Chapter 14), although in this context it is slower and considerably more expensive than manual sequencing. 6. It is helpful to run a number of mismatch reactions of the same product (different individuals) alongside the probe alone on one gel to see the background cleavage bands. Anything seen on top of this should be taken as a cleavage band. 7. It is necessary to have a normal control for each sequence–usually this can be other patients products (since they are expected to have different mutations). When loading it is helpful to load all the ‘A’ tracks together (and the same for the ‘C’ and ‘G’ and ‘T’ tracks) so that any pattern variation can be seen immediately. This is particularly useful when sequencing potential carriers for diagnosis.
References 1. Choo, K. H., Gould, K. G., Rees, D. J., and Brownlee, G. G. (1982) Molecular cloning of the gene for human anti-haemophilic factor IX. Nature 299, 178–180.
Hemophilia B Mutational Analysis
167
2. Giannelli, F., Choo, K. H., Rees, D. J., Boyd, Y.. Rizza, C. R., and Brownlee, G. G. (1984) Gene deletions in patients with haemophilia B and anti-factor IX antibodies. Nature 303, 181,182. 3. Siguret, V., Amselem, S., Vidaud, M., Assouline, Z., Kerbiriou-Nabias, D., Pietu, G., et al. ( 1988) Identification of a CpG mutation in the coagulation factor-IX gene by analysis of amplified DNA sequences. Br. J. Haematol. 70, 411–416. 4. Green, P. M., Bentley, D. R,. Mibashan, R. S., and Giannelli, F. (1988) Partial deletion by illegitimate recombination of the factor IX gene in a haemophilia B family with two inhibitor patients. Mol. Biol. Med. 5, 95–106. 5. Saiki, R. K., Gelfand, D. H., Stoffel, S., Scharf, S. J., Higuchi, R., Horn, G. T., Mullis, K. B., and Erlich, H. A.(1988) Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239, 487–491. 6. Green, P. M., Bentley, D. R., Mibashan, R. S., Nilsson, I. M., and Giannelli, F. (1989) Molecular pathology of haemophilia B. EMBO J. 8, 1067–1072. 7. Montandon, A. J., Green, P. M., Giannelli, F., and Bentley, D. R. (1989) Direct detection of point mutations by mismatch analysis: application to haemophilia B. Nucleic Acids Res. 17, 3347–3358. 8. Cotton, R. G., Rodrigues, N. R., and Campbell, R. D. (1988) Reactivity of cytosine and thymine in single-base-pair mismatches with hydroxylamine and osmium tetroxide and its application to the study of mutations. Proc. Natl. Acad. Sci. USA 85, 4397–4401. 9. Crossley, M. and Brownlee, G. G. (1990) Disruption of a C/EBP binding site in the factor IX promoter is associated with haemophilia B. Nature 345, 444–446. 10. Boyle, J. S. and Lew, A. M. (1995) An inexpensive alternative to glassmilk for DNA purification. Trends Genet. 11, 8. 11. Rowley, G., Saad, S., Giannelli, F., and Green, P. M. (1995) Ultrarapid mutation detection by multiplex chemical cleavage Genomics 30, 574–582. 12. Winship, P. R. (1989) An improved method for directly sequencing PCR amplified material using dimethyl sulphoxide. Nucleic Acids Res. 17, 1266.
Screening for Mutations Causing vWD
169
17 Screening for Candidate Mutations Causing von Willebrand’s Disease (vWD) P. Vincent Jenkins 1. Introduction von Willebrand factor (vWF) is a large, complex glycoprotein that exists in plasma and platelets, and is synthesized by megakaryocytes and endothelial cells. vWF plays an essential role in hemostasis in at least two ways. It is involved in platelet adhesion to the damaged vascular endothelium and also stabilizes factor VIII in plasma by acting as its carrier molecule. vWF has a multidomain structure, composed of multiples of four domain types A-D in the arrangement D1-D2-D'-D3-A1-A2-A3-D4-B1-B2-B3-C1-C2 (1). After initial synthesis, the protein is modified by post-translational processing of dimerization and multimerization and cleavage of the D1-D2 domain of the propeptide. The monomeric subunit of 220 kDa forms multimers of a range up to 20mDA. The different functions of vWF are assigned to different domains. The A1 domain is involved in binding of vWF to platelet glycoprotein 1b (GpIb), binding to fibrillar collagen, sulfatides, and heparin. The D3 domain is involved in the binding of factor VIII, while the binding of the platelet GpIIb-IIIa receptor is localized to the carboxy-terminal end of the C2 domain. A collagen binding site important in binding to collagen type III is present in the A3 domain. von Willebrand’s disease (vWD) is the most common inherited bleeding disorder. vWD is the result of either a quantitative deficiency (Type 1), qualitative abnormality (Type 2), or complete absence (Type 3) of vWF (2,3). Mutations giving rise to Type 2 vWD, especially the subtypes 2A and 2B, are well characterized, but far fewer mutations causing quantitative abnormalities have been characterized (4). The inheritance of type 1 vWD, which accounts for 70–80% of cases, is described as autosomal dominant, though very few From: Methods in Molecular Medicine, Vol. 31: Hemostasis and Thrombosis Protocols Edited by: D. J. Perry and K. J. Pasi © Humana Press Inc., Totowa, NJ
169
170
Jenkins
mutations giving rise to dominant type 1 vWD are described. Indeed, cases of compound heterozygous inheritance of type 1 vWD have been described recently (5,6). The variety of bleeding histories and variable family histories even within the same family indicate that type 1 vWD may be a disorder that is caused by a variety of molecular lesions and consequently may not be simply a dominant disorder. The genetic analysis of vWD is complicated not only by the size and complexity of the gene, but also by the presence of a partial pseudogene. The vWF gene is 178kb long, contains 52 exons and is located on chromosome 12p12ter. The mRNA is 8.7 kb long. The pseudogenic sequence is located on chromosome 22 and corresponds to exons 23–34 of the vWF gene. The study of mutations causing vWD has, in general, been by a directed strategy, focusing on sequences coding for particular regions. Most type 2A and 2B mutations are located in exon 28, which codes for the A1 and A2 domains. Study of type 2N disease has focused on the D3 domain, associated with factor VIII binding, coded for by exons 18–22. Studies of the entire coding region have been done as by the amplification of individual exons derived from genomic DNA and sequenced directly. We have devised a screening method for analysis of candidate mutations giving rise to vWD. The strategy for investigation is by chemical cleavage mismatch analysis of segments of the vWF gene obtained by reverse transcription and amplification of lymphocyte derived RNA, except for exon 28, which is amplified directly from genomic DNA (7). The advantage of this method is that coamplification of the pseudogene is avoided and the coding sequences are screened directly, overcoming the problems associated with the large size and complexity of the gene. 2. Materials 2.1. Isolation of Lymphocytes from Peripheral Blood 1. Histopaque–1077: Sigma Diagnostics (Poole, Dorset, UK). 2. Thirty-milliliter round-bottomed polypropylene tubes (e.g., Starsted, UK). 3. Phosphate buffered saline (PBS): phosphate 0.01 M, 0.0027 M potassium chloride, 0.137 M sodium chloride, pH 7.4. Available from many manufacturers, e.g., Sigma.
2.2. Isolation of Total Cellular RNA RNAEasy kit (Qiagen, UK) (see Note 1).
2.3. Reverse Transcription and PCR (see Note 2) 1. 5X RT buffer: 250 mM Tris-HCl, pH 8.3 (20°C), 375 mM KCl, 15 mM MgCl2 (Life Technologies, Paisley, UK).
Screening for Mutations Causing vWD
171
2. 100 mM DTT (Life Technologies). 3. MMLV-Reverse Transcriptase (200 U/µL) (Life Technologies). For the vWF fragment two use SuperScriptase (200 U/µL) (Life Technologies) (see Note 3). 4. Recombinant RNAsin: 10 U/µL. (Promega, Southampton). 5. Dimethylsulfoxide (DMSO). (Sigma) (see Note 4). 6. 5 mM dNTPs. (Promega, Southampton). 7. Total cellular target RNA: 1 µg 50 µL in DEPC H2O. 8. TE buffer, pH 8.0: 10 mM Tris-HCl, pH 8.0, 0.1 mM EDTA. 9. 10X PCR buffer: 670 mM Tris-HCl, pH 8.8, 166 mM (NH4)2SO4, 67 mM MgCl2, and 1.7% BSA. 10. Oligonucleotide primers: Outer sense primer (primer a) 50 pmol (see Table 1) and outer anti-sense primer (primer b) 50 pmol. 11. Taq polymerase: 5 U/µL (Bioline UK. London). 12. 0.5-mL sterile RNAse-free Eppendorfs. 13. 1.5-mL sterile Eppendorfs. 14. Light mineral oil. 15. Thermal cycler.
2.4. Purification of PCR Products 1. 2. 3. 4. 5. 6.
Agarose. 10X Tris-Borate-EDTA (TBE). Ethidium bromide (see Note 5). QIAEX II Gel extraction kit (Qiagen). UV Transilluminator. 6X Loading buffer: 40% sucrose (w/v), 0.25% bromophenol blue (w/v), and 0.25% xylene cyanol (w/v).
2.5. Chemical Cleavage Mismatch Analysis (CCMA) (see Note 6) 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11.
12.
DNA for use as the probe (see Note 7). [γ-32P]dATP: 3000 Ci/mol; 10 Ci/ ml. (Amersham International, Bucks). T4 polynucleotide kinase (10 U/µL) (Promega UK). T4 polynucleotide kinase reaction buffer: 0.5 M Tris-HCl, pH 7.6, 0.1 M DTT, 0.1 M MgCl2. 100 bp molecular weight marker (Pharmacia). 10X hybridization buffer: 3 M NaCl, 1 M Tris-HCl, pH 8.0. Siliconized 1.5-mL Eppendorfs. Mussel glycogen: 20 mg/mL (Boehringer Mannheim, UK). Stop/wash solution: 80% ethanol, 63 mM Sodium acetate, 20 µM EDTA. Osmium tetroxide solution: 1.44 µL 4% osmium tetroxide solution (Sigma, Poole), 6.75 µL pyridine (Aldrich Chemicals, Poole), and 154 µL TE, pH 7.5. Hydroxylamine hydrochloride solution (4 M): hydroxylamine hydrochloride 39 mg (Aldrich Chemicals, Poole), 42 µL diethylamine (Aldrich Chemicals, Poole), and 138 µL deionized H2O. Piperidine 1 M: 90 µL piperidine (Sigma, Poole) and 810 µL deionized H2O.
Segment
Primer
Oligonucleotide sequence
Nucleotide number
PCR product size (bp)
Segment 1
1a 1b 1c 1d 2a 2b 2c 2d 3a 3b 3c 3d 4a 4b 4c 4d 5a 5b 5c 5d 6a 6b 6c 6d
5' gcagctgagagcatggcctag 5' tggatgcggaggtcacctttcagg 5' caccattgtccagcagctgag 5' ggtgcacacagcgtcgcggtc 5' caacacctgcatttgccgaaca 5' cacttccggtcccgacagacacaa 5' atctgcagcaatgaagaatgtcca 5' tgttgcagccaatcttcactgttt 5' gcagcaaaaggagcctatcctg 5' aatcgtgcaacaacggttcc 5' ggtgtgtcccgctgacaacctg 5' gcttcacaggtgaggttgacaac 5' gagctggagaggattggctg 5' ccaggaccttgtggcattca 5' attccaggactttgagacgctc 5' cgctgcacagtccattcctg 5' tgggaacatggaagtcaacg 5' acacactcattgatgaggca 5' ggtgccatcatgcatgaggtc 5' ccgacactcttccaggaagac 5' cctgccttcccgacaaggtg 5' gagcagaacatgcagaggac 5' gtccaccgaagcaccatctac 5' tggcagcactctggcctggc
152 1698 182 1573 1351 2815 1382 2792 2528 4057 2572 3956 5162 6713 5201 6603 6355 7850 6379 7803 7521
Outer Outer Inner Inner Outer Outer Inner Inner Outer Outer Inner Inner Outer Outer Inner Inner Outer Outer Inner Inner Outer 8762 Inner Inner
Segment 2
172
Segment 3
Segment 4
Segment 5
Segment 6
1546 1391 1464 1410 1529 1384 1551 1402 1495 1424 1260 Outer 1217
Jenkins
7544 8761
172 1675 202 1553 1373 2794 1405 2768 2550 4038 2593 3935 5181 6594 5221 6584 6373 7831 6400 7783 7540 8781 7564 8741
172
Table 1 Primer Sequences for the Amplification by Nested RT-PCR of the Coding Sequence of vWF
Screening for Mutations Causing vWD
173
13. Formamide dye: 95% formamide, 20 mM EDTA, 0.05% bromophenol blue, and 0.05% xylene cyanol FF. 14. Acrylamide:bisacrylamide (39:1). 15. 10X TBE. 16. 10% ammonium persulfate. 17. TEMED. 18. Urea. 19. Sequencing apparatus. 20. Whatman 3MM paper. 21. Gel dryer.
3. Methods 3.1. Isolation of Lymphocytes from Peripheral Blood 1. Collect 15 mL of blood using EDTA as an anticoagulant. Pour 10 mL into a 30-mL polypropylene tube and dilute with an equal volume of PBS. 2. Carefully layer the diluted mixture on to 5 mL of Histopaque-1077 sucrose density gradient in a 30-mL polypropylene tube and cap. 3. Spin the sample at 3,000g in a bench-top centrifuge for 20 min at room temperature without brake. 4. Remove the leukocyte monolayer at the interface into a 15-mL polypropylene tube and pellet the cells by centrifugation. Remove the supernatant and discard. 5. Rinse the cells in 10 mL of PBS, pellet the cells by centrifugation and decant the supernatant. 6. The pellet can be stored at –70°C for several months.
3.2. Isolation of Total Cellular RNA 1. Total RNA can be prepared rapidly and easily by using any of a number of commercially available kits such as the Qiagen RNAEasy. 2. For long-term storage total RNA should be precipitated with ethanol and stored in ethanol at –70°C.
3.3. Reverse Transcription and PCR 3.3.1. Reverse Transcription 1. RNA is extremely prone to degradation. All applications should be quick and done on ice. 2. Calculate the volume of the primer required for each reverse transcription reaction performed in duplicate and two additional blanks by using the amounts per reaction given below. For primer sequences and positions, see Table 1. Use 50 ng or 10 pmol of the outer antisense primer (b) in a final volume of 2.5 µL of TE for each reaction. 3. Thaw the primer and RNA on ice and add the primer and TE to each 0.5-mL microcentrifuge tube. 4. Add 5 µL (100 ng) of RNA to the sample tube.
174
Jenkins
5. Add 50 µL of mineral oil and cap the tube. 6. Pulse spin and heat on the thermal cycle at 65°C for 10–15 min. 7. Make a bulk RT mix on ice using the amounts per tube given below: 5X RT buffer 4 µL 5 mM dNTP’s 5 µL 100 mM DTT 2 µL 200U/µ MMLV reverse transcriptase 1 µL (see Note 3) 50 U/µL RNAsin 0.5 µL 8. Remove the samples onto ice and reset the thermal cycler for 42°C. If amplifying Fragment 2 then carry out the reaction at 48°C and use SuperScriptase (200 U/µL). 9. Add 12.5 µL of RT mix to each tube, cap and pulse spin. 10. Incubate at the appropriate temperature for 90 min to 2 h.
3.3.2. First Round Outer PCR 1. This procedure immediately follows the reverse transcription of total RNA detailed above. 2. Whereas the RT reaction is in progress, determine the bulk mix necessary for the PCR. TE X µL (usually 19.5 µL) 1X PCR buffer 5 µL primer a 2.5 µL (250 ng/ 50 pmol) primer b 2.0 µL (200 ng/ 40 pmol) Taq polymerase 0.5 µL (2.5 U). and make the final volume to 30 µL with TE. 3. For amplification of the vWF fragment 2: add 2.5 µL of DMSO to the PCR mix prior to the addition of the Taq polymerase and use 5 U of Taq polymerase (5 U) rather than 0.5 µL. 4. Make up the mix in a sterile 1.5-mL Eppendorf. 5. Place the RT products into a rack and add 30 µL of the mix to each tube, including the blanks. 6. Cap, mix, and pulse spin each tube. Place in the thermal cycler. 7. Inactivate the reverse transcription reaction by heating to 94°C for 5 min. 8. Carry out 30 cycles of PCR consisting of: 94°C for 1 min, 60°C for 1 min, and 72°C for 3 min. On the last cycle the extension time should be increased to 10 min.
3.3.3. Second Round Inner PCR 1. Make up a master mix consisting of (for one reaction): TE X µL 10X PCR buffer 5 µL 5 mM dNTP’s 5 µL primer c 2.5 µL (50pmol) primer d 2.5 µL (50pmol) Taq polymerase 0.5 µL 2. Make up to 50 µL with TE per reaction.
Screening for Mutations Causing vWD
175
3. For amplification of the vWF fragment 2: add 2.5 µL of DMSO to the PCR mix prior to the addition of the Taq polymerase and use 1 µL of Taq polymerase (5 U) rather than 0.5 µL. 4. Make up the bulk mix as according to the number of samples including blanks 5. Aliquot 50 µL of the reaction mix into a clean, sterile 0.5-mL microcentrifuge tube and overlay with oil. 6. Add 2–5 µL of the first round product to the appropriate second round tube, cap, and label. 7. Mix and pulse spin each tube. Place in the thermal cycler. 8. Denature the double-stranded PCR product from the first round amplification reaction by heating to 94°C for 5 min. 9. Carry out 30 cycles of amplification consisting of: 94°C for 1 min, 60°C for 1 min, and 72°C for 3 min. On the last cycle the extension time should be increased to 10 min. 10. Check the efficiency and specificity of the reaction by running 5 µL of second round PCR product on 2% agarose in 1X TBE.
3.4. Purification of PCR Products 1. Prepare a 1% agarose gel in 0.5X TBE containing ethidium bromide 1 µg/mL. Wells should be of sufficient size to contain 50 µL. 2. Allow the gel to set and cover with 0.5X TBE. 3. Load 45 µL of each PCR product plus 5 µL of loading buffer onto the gel and carry out the electrophoresis until the fragment of interest is well separated from any other fragments. 4. Visualize the gel under UV light and excise the band of interest. 5. Isolate the DNA fragments using the QIAEX II Gel extraction kit according to the manufacture’s instructions.
3.5. Chemical Cleavage Mismatch Analysis (CCMA) 3.5.1. Probe Preparation 1. The test PCR product is hybridized to a probe, which is the corresponding PCR product from a normal sample or the vWF cDNA (see Note 7). 2. Mix 25 ng per test sample of probe DNA with 0.5 µL [γ-32P]dATP, 1 µL of 10X kinase buffer, 10 U of T4 polynucleotide kinase and make up to a final volume of 10 µL with deionized H2O. 3. Incubate at 37°C for 30 min.
3.5.2. Hybrid Preparation 1. Place 100 ng of the test PCR product in a 0.5-mL microcentrifuge tube. 2. Add 25 ng of the labeled probe, 2 µL of 10X hybridization buffer and make up to 20 µL with deionized H2O. Overlay with 30 µL of mineral oil. 3. Heat the sample to 100°C in a heating block for 5 min and then cool rapidly to 65°C. Hybridize for between 2–18 h.
176
Jenkins
3.5.3. Chemical Cleavage Analysis 1. Pipet the hybrid into a siliconized 1.5-mL microcentrifuge tube and add 3 µL of 20 mg/mL mussel glycogen. 2. Vortex mix and add 700 µL of the stop solution. 3. Cool at –40°C for 30 min and then spin at maximum speed in a microcentrifuge for 10 min. 4. Rinse the pellet in 70% ethanol and air-dry. 5. Add 14 µL of TE to the pellet, mix, and split the sample into two equal volumes by removing 7 µL into another siliconized Eppendorf. 6. To one tube add 20 µL of the hydroxylamine hydrochloride solution and incubate at 37°C for 2 h. 7. To the other tube, add 18 µL of the osmium tetroxide solution and incubate at room temperature for 30 min. 8. Pipette the hybrid into a siliconized 1.5-mL microcentrifuge tube and add 3 µL of 20 mg/mL mussel glycogen. 9. Vortex mix and add 700 µL of the stop solution. 10. Cool at –40°C for 30 min and then spin at maximum speed in a microcentrifuge for 10 min. 11. Remove the supernatant and to the pellet add 50 µL of the piperidine solution, cap, and mix thoroughly. 12. Incubate at 90°C for thirty mins. 13. Pipette the hybrid into a siliconized 1.5-mL microcentrifuge tube and add 3 µL of 20 mg/mL mussel glycogen. 14. Vortex mix and add 700 µL of the stop solution. 15. Cool at –40°C for 30 min and then spin at maximum speed in a microcentrifuge for 10 min. 16. To the pellets, add 4 µL of deionized H2O and 3 µL of formamide loading buffer. Heat to 80°C for 5 min and then rapidly chill on ice. 17. Run with an approriate labeled DNA molecular weight marker (end-labeled as in Subheading 3.5.1., step 2) in a 4% denaturing polyacrylamide wedge gel. 18. Following electrophoresis, separate the gel plates, carefully transfer the gel to a sheet of Whatman 3MM paper, cover with clingfilm and dry under vacuum at 80°C. Expose to X-ray film at –70°C. 19. Autoradiograph.
3.5.4. Analysis of Results 1. The size of any mismatches identified can be estimated by comparison to the mol-wt marker and the appropriate area of the RT-PCR product sequenced. Any candidate mutations should be confirmed by amplification of the corresponding genomic DNA sequence and direct sequencing. 2. It is convenient to analyze a number of samples simultaneously and include a “normal control,” especially as the vWF gene is highly polymorphic. 3. Most cases of type 2B von Willebrand’s disease, type 2A, and type 2M occur in exon 28, so that this region should be analyzed first in these cases.
Screening for Mutations Causing vWD
177
4. Notes 1. Many kits/methods are available for the isolation of total cellular RNA but this kit is particularly easy to use and provide high quality RNA. 2. All reagents for reverse transcription must be reserved exclusively for this. In addition all reagents must be sterile and made with DEPC-treated water. 3. The vWF fragment 2 is more difficult to reverse transcribe but the use of SuperScriptase solves many of these problems. 4. DMSO is included for the vWF fragment 2 amplification reactions. 5. Ethidium bromide is a potent carcinogen and must be used with care. 6. Materials used in this technique are extremely hazardous, toxic, and possibly mutagenic. Advice from the local safety officer should be sought prior to experimentation. 7. The test PCR product is hybridised to a probe, which is the corresponding PCR product from a normal sample or the vWF cDNA. The vWF cDNA is available from the American Tissue Cell Collection (ATCC 59126, ATCC 59127) and is ideal as a template for amplification for all segments except exon 28. 8. The sequence and sequence numbering is based on the sequence used on the vWD mutation database http://mmg2.im.med.umich.edu/vWF/.
References 1. Sadler, J. E. (1991) von Willebrand factor. J. Biol. Chem. 266, 22777. 2. Sadler, J. E. (1994) A revised classification of von Willebrand disease. Thromb. Haemostasis 71, 520. 3. Sadler, J. E., Matsushita, T., Dong, Z., Tuley, E. A., and Westfield, L. A. (1995) Molecular mechanism and classification of von Willebrand disease. Thromb. Haemostasis 74, 161. 4. Ginsburg, D. and Sadler, J. E. (1993) von Willebrand disease: A database of point mutations, insertions and deletions. Thromb. Haemostasis 69, 177. 5. Eikenbloom, J. C. J., Reitsma, P. H., Peerlinck, K. M. J., and Briât, E. (1993) Recessive inheritance of von Willebrand’s disease type1. Lancet 341, 982. 6. Siguret, V., Lavergne, J-M., Chçrel, G., Boyer-Neumann, C., Ribba, A-S., Bahnak, B. R., Meyer, D., and Piçtu, G. (1994) A novel case of compound heterozygosity with “Normandy”/type 1 Von Willebrand’s disease. Human Genetics 93, 95. 7. Inbal, A., Seligsohn, U., Kornbrot, N., Brenner, B., Harrison, P., Randi, A., Rabinowitz, I., Sadler, J. E. (1992) Characterization of three mutations causing von Willebrand’s disease in five unrelated families. Thromb. Haemostasis 67, 618.
Use of Intron 40
179
18 Use of Intron 40 VNTR I in vWD Gene Tracking Mohammed S. Enayat and Gurcharan K. Surdhar 1. Introduction Common alleles or polymorphisms form the basis of human diversity, and some of these polymorphisms closely linked on the same chromosome with a defective gene have been used for gene tracking in many genetic disorders. The success of any linkage analysis also relies on the nature of the polymorphisms used, and the most useful are those that can have a large numbers of alleles. von Willebrand’s disease (vWD) is an autosomally inherited genetic bleeding disorder caused by quantitative (Type 1 and 3) or qualitative (Type 2) deficiency of von Willebrand Factor (vWF) (1). Types 1 and 2 are dominantly inherited and Type 3 is recessively inherited, with affected individuals being either homozygotes or compound heterozygotes. More than 20 restriction fragment length polymorphisms (RFLP) within vWF have been identified that can be used for gene tracking in vWD families. However, since they are all biallelic polymorphisms, they provide rather limited information (2). In 1990, Peake et al. identified a Variable Number Tandem Repeat (VNTR) within intron 40 of the vWF gene a region of tetranucleotide repeats (ATCT) and used this for gene tracking in carrier detection and antenatal diagnosis (3). Analysis of this VNTR can be carried out by polymerase chain reaction (PCR) amplification followed by acrylamide gel electrophoresis. Initially in this polymorphism, now referred to as VNTR I, eight different length alleles were identified. These were 6 to 14 ATCT repeats with the exception of the 9-repeat. However two additional alleles (9- and 15-repeats) with very low frequencies have subsequently been reported (4). The most common reported genotypes are: 7-7, 6-7, and 7-11, and in general there are no significant differences between the expected and observed genotype frequencies (4). In the 3' part of this VNTR From: Methods in Molecular Medicine, Vol. 31: Hemostasis and Thrombosis Protocols Edited by: D. J. Perry and K. J. Pasi © Humana Press Inc., Totowa, NJ
179
180
Enayat and Surdhar
Fig. 1. This shows a photograph of the vWF VNTR bands for the members of family 1. The PCR samples of the DNA samples from family members are electrophoresed on 7.5% acrylamide gel and, visualized on a UV transilluminator after staining with ethidium bromide. The first six lanes are samples from family members followed by five reference samples. The last lane is molecular marker plasmid pBR322 DNA digested with HaeIII.
region, another VNTR or VNTR II with six further alleles, ranging from 154 to 174bp, has also been reported (5). Mercier et al. showed the usefulness of an AluI restriction pattern obtained from the whole of this VNTR region (6). Intron 40 VNTR is also used in paternity and forensic investigations, but reported VNTR instability as the result of mutation or recombination in this region may also introduce a risk of error in family studies and antenatal diagnosis (7). 2. Materials 2.1. PCR Amplification of Intron 40 1. PCR reaction buffer (10X): 670 mM Tris-HCl, pH 8.0, 166 mM ammonium sulfate and 67 mM Magnesium chloride. To 1 mL of this solution add 4 µL 5% (w/v) bovine serum albumin (BSA) and 7 µL ß-mercaptoethanol (see Note 1). 2. 5 mM dNTPs. 3. 0.1 µg/mL oligonucleotide primers for amplification of intron 40. For the primer sequences, see ref. 3. 4. Thermostable DNA polymerase (5 U/mL). 5. Mineral oil.
2.2. Polyacrylamide Gel Electrophoresis 1. 30% Acrylamide/bisacrylamide (19:1) (see Note 2).
Use of Intron 40
181
Fig. 2. Pedigree of family 1 with types 1 and 3 vWD. vWF:Ag for each member of the family is given below each individual.
2. 3. 4. 5.
1.5 M Tris-HCl, pH 8.8. 25% (w/v) ammonium persulfate (freshly prepared). N,N,N',N'-Tetramethylethylenediamine (TEMED) (see Note 2). Gel loading buffer: 30% glycerol (v/v), 0.25% xylene cyanole (w/v), and 0.25% bromophenol blue (w/v). 6. 5X Electrode buffer, pH 8.3. Comprises 45 g Tris base, 216 g Glycine, 15 g SDS, and distilled water to 3 L. 7. Electrophoresis apparatus, e.g., Bio-Rad PROTEAN II with Multi-Gel Casting Chamber attached to a cooling system (see Note 3). 8. Ethidium bromide (10 mg/mL) (see Note 4).
182
Enayat and Surdhar
Fig. 3. Pedigree of family 2 with type 1 vWD. vWF:Ag for each member of the family is given below each individual.
3. Methods 3.1. PCR Amplification of Intron 40 1. Prepare a master mix according to the number of samples: Distilled water 75 µL, 10 µL 10X PCR Reaction Buffer, 10 µL 5 mM dNTPs, 1 µL of Primer 1 (0.1 µg/µL), 1 µL of Primer 2 (0.1 µg/µL), and 0. 5µL (2.5 U) of Taq DNA polymerase. Multiply the volume by the number of samples to be analysed. 2. Aliquot 98 µL of the master mix to each tube, 2.0 µL of genomic DNA (50 µg/mL). And overlay with 50 µL of mineral oil.
Use of Intron 40
183
Fig. 4. Pedigree of family 3 with types 1 and 3 vWD. vWf:Ag for each member of the family is given below each individual.
3. Carry out the amplification with the following parameters. An initial denaturation at 95°C for 5 min, then 30 cycles of 91°C for 1 min, 52°C for 90 s, 72°C for 3 min, and a final extension of 72°C for 10 min.
184
Enayat and Surdhar
3.2. Polyacrylamide Gel Electrophoresis 1. A 7.5% acrylamide gel is used to analyze the PCR products. For 2 gels (50 mL volumes) mix 25 mL of 30% stock acrylamide/bisacrylamide solution, 48.5 mL distilled water and 25 mL of 1.5 M Tris-HCl, pH 8.8. Add 500 µL of 25% ammonium persulfate and 50 µL of TEMED to initiate polymerization. 2. Cast a gel according to the type of the electrophoresis apparatus in use. With a syringe and needle, pour the acrylamide solution between the two glass plates to fill the space, and place a well-former comb at the top of the gel (see Note 5). 3. Allow the gels to polymerize for 2 h. Assemble the apparatus and fill the buffer reservoirs with 1X electrode buffer. 4. Prepare the PCR samples for loading by mixing 20 µL of the PCR product with 20 µL of PCR product 5 µL of loading buffer and load all of this into the wells of the gel along with a 1-kb ladder molecular size marker in Lane 1. Flush the wells with buffer prior to loading the gel. Samples in which the number of VNTR repeats has been previously established should be run alongside the unknown samples to help with the VNTR number identification. 5. Run the gel at a constant 200 V until the dye reaches the bottom of the glass plates, approx 3 1/2 h. 6. The results are visualized by staining the gels with ethidium bromide: Place the gel in a solution of 100 mL of distilled water containing 5 µL of ethidium bromide (10 mg/mL) for 15 min. 7. Destain the gel by placing it in 100 mL of distilled water for 5 min. 8. VNTR bands are visualized by ultraviolet light from a transilluminator (see Fig. 1 and Note 6).
3.3. Examples of VNTR Investigations 3.3.1. Family 1 (see Fig. 2) The father in this pedigree (I:2) is homozygous for haplotype 7. However, a defect (mutation) must be present on one of his chromosomes leading to type 1 vWD. The mother (I:1) must also carry a null mutation with her haplotype 7, as the combination of these 2 haplotypes in her son (II:1) with haplotype 7/ 7 has given rise to compound heterozygous type 3 vWD. This family’s other affected member (II:3), has the paternal muted haplotype (7) giving rise to type 1 vWD.
3.3.2. Family 2 (see Fig. 3) In this pedigree type 1 vWD is marked with haplotype 11 in the father (1:2) and his 2 sons (II:1 and II:2). However, although both sons have identical haplotypes, they show different phenotype and clinical symptoms. It is possible that the same genetic defect in different individuals present itself in a different way.
Use of Intron 40
185
3.3.3. Family 3 (see Fig. 4) The mother (II:3) of the index member (III:2) is homozygous and therefore it is not possible to verify the haplotype responsible for type 1 vWD in individual III:1. The paternal grandmother (I:1) of the index member could also be carrying a null mutation associated with haplotype 12 leading to type 1 vWD in her son (II:1) and grandson (III:1). However, the index member has a haplotype (12/12), which does not fit with his parents VNTR. This can be as the result of intron 40 VNTR instability seen in other cases (7). But it is also possible that he has a deletion in part of VWF gene (which includes the VNTR sequence), which he has inherited from his unaffected mother (II:3) and demonstrating itself as a homozygous 12/12 haplotype. 4. Notes 1. Be careful when using ß-mercaptoethanol, as it is highly toxic and a powerful irritant. 2. When using acrylamide and TEMED always handle with gloves, and wear apron and safety glasses. 3. The gel electrophoresis tank must be kept cool, in order to prevent a smiling effect of the bands. This is done by running the gel at constant 16°C. 4. Ethidium bromide is a powerful mutagen and should be used with care. 5. It is best to use the 6.5-mm width wells as they provide sufficient width for clear visualization of the bands. 6. The VNTR bands are also present as a higher repeat further up the gel. It is important to distinguish between the VNTR and the repeat or “shadow” bands so as to avoid confusion.
References 1. Ruggeri, Z. M. and Zimmerman, T. S. (1987) von Willebrand factor and von Willebrand disease. Blood 70, 895–904. 2. Gaucher, C. G., Mercier, B., and Mazurier, C. (1992) von Willebrand disease family study: comparison of three methods of analysis of the von Willebrand factor gene polymorphism related to a variable number tandem repeat sequence in intron 40. Brit. J. Haematol. 82, 73–80. 3. Peake, I. R., Bowen, D., Bignell, P., Liddell, M. B., Sadler, J. E., Standen, G., and Bloom, A. L. (1990) Family studies and prenatal diagnosis in severe von Willebrand disease by polymerase chain reaction amplification of a variable number tandem repeat region of the von Willebrand factor gene. Blood 76, 555–561. 4. Haddad, A. P. and Sparrow, R. L. (1997) Two novel alleles of the ATCT variable number tandem repeat locus vWF.VNTR I in intron 40 of the von Willebrand factor gene. Brit. J. Haematol. 96, 298–300. 5. Pools Van Amstel, H. K. and Reitsma, P. H. (1990) Tetranucleotide repeat polymorphism in the vWF gene. Nucleic Acids Res. 18, 4957.
186
Enayat and Surdhar
6. Mercier, B., Gaucher, C. ,and Mazurier, C. (1991) Characterisation of 98 alleles in 105 unrelated individuals in the F8VWF gene. Nucleic Acids Res. 19, 4800. 7. Eikenboom, J. C. J., Reitsma, P. H., van der Velden, P. A., and Briet, E. (1993) Instability of repeats of the von Willebrand factor gene variable number tandem repeat sequence in intron 40. Brit. J. Haematol. 84, 533–535.
Multimeric Analysis of vWF
187
19 Multimeric Analysis of von Willebrand Factor Mohammed S. Enayat 1. Introduction Von Willebrand Factor (vWF) in normal plasma is composed of a series of high molecular multimers, ranging in size from 8 × 105 to over 15 × 106 Daltons (1). The multimeric structure of vWF was first investigated by two-dimensional crossed immunoelectrophoresis (2D-IEP). In 1974, Kernoff et al. (2) used this method, and since then multimer sizing of von Willebrand Factor Antigen (vWF:Ag) in this form and other variations have been used in the diagnosis and classification of von Willebrand’s disease (vWD). Another approach for resolution of vWF multimer has been by nonreducing SDS-gel electrophoresis with two similar methods described by Hoyer and Shainoff (3), and Ruggeri and Zimmerman (4). The original method has since been modified and improved by others (5), but the principle of the method has remain the same. These include variations to the actual method (6), the type of the media in which the protein is separated, semi-automation (7), different types of antibodies (8), and methods of visualization of multimer bands (9,10). Both of these methods are of particular use in identification of qualitatively abnormal vWF, such as those seen in variant or type 2 vWD where there is loss of high and or intermediate molecular weight multimers. But aside from vWF:Ag multimer analysis in von Willebrand disease, this methodology has been used in other disorders such as hemolytic uraemic syndrome (11), thrombotic thrombocytopenic purpura (12), diabetes (13), rheumatic diseases, and vasculitis (14) for monitoring, and assessing endothelial cell damage. Multimeric analysis has also been useful in quality control of Factor VIII (15) and vWF concentrates (16) and in the patient follow ups after administration of one of these products or infusion of DDAVP (17).
From: Methods in Molecular Medicine, Vol. 31: Hemostasis and Thrombosis Protocols Edited by: D. J. Perry and K. J. Pasi © Humana Press Inc., Totowa, NJ
187
188
Enayat
1.1. Two-Dimensional Crossed Immunoelectrophoresis (2D-IEP) Two-dimensional crossed immunoelectrophoresis (2D-IEP) is used to identify and classify those patients with qualitative abnormalities of vWF and are grouped in the type 2 vWD. This rapid and simple method is mainly used for screening of samples prior to a more comprehensive multimeric analysis using SDS-gel electrophoresis. The technique described here is for a method which can simultaneously measure and compare vWF:Ag in 12 plasma samples on a single plate (17).
1.2. SDS Agarose Gel Electrophoresis Of the two methods of multimeric analysis of vWF:Ag used for diagnosis and classification of patients with variant forms of vWD, 2D-CIEP is only useful for an initial screening and can only definitively identify type 2A vWD. For more comprehensive analysis, SDS-gel electrophoresis has to be used. Both plasma and platelet vWF:Ag should be examined for a full diagnosis and classification of type 2 vWD. The described method below is the modification of Enayat and Hill (5) of the originally described method of Ruggeri and Zimmerman (4). This method is a SDS agarose gel electrophoresis using a discontinuous buffer technique. The multimer bands are visualization by autoradiography using a 125I-labeled monoclonal anti-vWF antibody. 2. Materials
2.1. Two-Dimensional Crossed Immunoelectrophoresis (2D-IEP) 1. 3.8% Trisodium citrate. 2. 0.05 M Barbitone buffer, pH 8.6 prepared by mixing: 12.89 g diethyl barbituric acid, 74.32g sodium diethyl barbiturate, 1.75 g sodium, and 7 L of distilled water. 3. Coomassie brilliant blue stain: Prepare by dissolving 1.0 g Coomassie brilliant blue in 200 mL of absolute methanol. Add 300 mL distilled water and 50 mL Glacial Acetic acid. 4. Destain: Prepare by mixing 400 mL absolute methanol, 600 mL distilled water, and 100 mL glacial acetic acid. 5. SeaKem® ME agarose (Flowgen Instruments Ltd. Sittingbourne, UK) (see Note 1). 6. Flatbed chilled electrophoresis apparatus, e.g., Multiphor II Electrophoresis System (Amersham Pharmacia Biotech UK Ltd. UK). 7. 10 cm × 20 cm × 0.2 cm glass plates. 8. Anti-human-vWF:Ag antiserum: DAKO IgG fragment of rabbit antiserum (concentration = 10 g/L) (see Note 2). 9. Normal saline: Prepare by dissolving 0.9 g of NaCl in 100 mL of distilled water. 10. Strong saline: Prepare by dissolving 4.5 g of NaCl in 100 mL of distilled water.
Multimeric Analysis of vWF
189
2.2. SDS Agarose Gel Electrophoresis 2.2.1. Preparation of Washed Platelets 1. Phosphate-buffered saline: 43.83 g NaCl (150 mM), 17.9 g disodium hydrogen phosfate (2H2O) (10 mM), 7.8 g sodium dihydrogen phosphate. (2H2O) (10 mM), 5 L distilled water. Adjust pH to 7.2. 2. Bovine albumin (Fraction V): Prepare a 40% (w/v) solution by layering 40 g bovine albumin (Sigma) onto 100 mL buffered saline in a wide-based flask or beaker. 3. Platelet washing buffer comprises: 0.9 g glucose, 2.4 g potassium EDTA, 100 mL 0. 2M Tris-HCl, pH 8.0. Make up to 1 L with 0.148 M (0.89%) sodium chloride. Adjust to pH 7.4 with 0.1 N HCl or 0.1 N NaOH and store at 4°C. 4. Platelet lysis buffer comprises: 10 mM Tris-HCl, pH 8.0, 1 mM EDTA, 2% SDS, and 1% Triton X-100.
2.2.2. SDS Agarose Gel Electrophoresis 1. Sample dilution buffer: 10 mM Tris-HCl, 1 mM EDTA pH 8.0. To prepare a stock buffer of 10X final working strength combine: 1.211 g of Tris base, 0.372 g Na2 EDTA and distilled water to 100 mL. Adjust pH to 8.0 with concentrated HCl. A working solution is made by mixing: 10 mL of stock, 90 mL of distilled water, 2 g SDS and 48 g urea 2. Stacking gel buffer: 0.125 M Tris-HCl, pH 6.8. Dissolve 1.514 g of Tris in 100 mL distilled water and adjust the pH to 6.8 with concentrated HCl. 3. Running gel buffer: 0.375 M Tris-HCl, pH 8.8. Dissolve 4.54 g Tris in 100 mL distilled water and adjust the pH to 8.8 with concentrated HCl. 4. Electrophoresis tank buffer comprises: 36.0 g Tris (0.0494 M), 172.8 g of glycine (0.384 M), 6 g of SDS (0.1%), and 6 L of distilled water. Adjust pH to 8.35 with NaOH. 5. Phosphate-buffered saline comprises: 43.83 g NaCl (150 mM), 17.9 g disodium hydrogen phosfate (2H2O) (10 mM), 7.8 g sodium dihydrogen phosfate (12H2O) (10 mM), 5 L distilled water. Adjust pH to 7.2. 6. Fixing solution: 250 mL isopropanol, 10 mL acetic, 650 mL distilled water. 7. Antibody: This is a monoclonal antibody ESvWF 10, commercially available from Bioscot Co. An IgG fraction of rabbit antihuman antiserum from DAKO Ltd) can also be used (see Note 3). 8. Agarose (see Note 1): Different types of agarose are used for the stacking and separating gels. SeaKem ® HGT (P) Agarose (Flowgen Instruments Ltd. Sittingbourne, UK) is used for making the stacking gel and Agarose Type VII LGT (Sigma) for preparing the separating gels. The stacking gel’s concentration is 0.8% with 0.1% SDS in its own buffer. Different concentrations of separating agarose is used depending on the type of analysis. The useful range is 1.00, 1.2, 1.3, 1.4, 1.8, and 2.2%. All of these contain 0.1% SDS. 9. Dimethylchlorosilane ,e.g.. BDH.
190
Enayat
Glass plates 130 mm × 200 mm × 2 mm. Gel bond film (Gel Bond PGA Film, Flowgen Instruments Ltd.). Cooled, flat-bed electrophoresis apparatus. Rabbit serum (Sera-Lab Ltd., UK). Supplied neat but must be diluted to 1% before use, with PBS. 14. X-Ray film (3M, Medirad Services Ltd., Chessington, UK). 10. 11. 12. 13.
3. Methods 3.1. Two-Dimensional Crossed Immunoelectrophoresis (2D-IEP)
3.1.1. Collection of Blood Samples and Preparation of Plasma 1. Collect whole blood into anticoagulant in a ratio of one part anticoagulant to nine parts blood. 2. Platelet poor plasma is prepared by centrifugation at 1500g for 15 min at 4°C. Use the plasma immediately or store at –20°C and thaw at 37°C before use.
3.1.2. Gel Preparation and First Dimension Electrophoresis 1. Dissolve 1 g SeaKem® ME agarose in 100 mL of barbitone buffer (1% agarose) and keep at 100°C for 10 min. This is sufficient to prepare two plates. 2. Pour two 20-mL agarose aliquots in universal bottles and keep at 56°C for use in pouring the second dimension gel. Use the remaining 60 mL to prepare two gel plates. 3. Place two 10 cm × 20 cm × 0.2 cm glass plates on a levelled table and warm them using a hair dryer. Then carefully pour 30 mL warm gel on each glass plate, let them set and the place them in a humid chamber. Keep at 4°C for at least 1 h. 4. Punch out twelve wells, 5-mm in diameter and aspirate the cut out wells on the long side of the plate. These wells are cut according to a template (Fig. 1) (see Note 4). Template 1 with the first six 1 cm apart and the other six 2-cm apart in the middle of the glass plate. Place each glass plate on a flat-bed electrophoresis system pre-cooled to 16°C. 5. Connect each gel to electrode buffers via well soaked layers of filter paper. Gel plates are now ready for use in the first dimension of electrophoresis. 6. Apply 20 mL normal control plasma to wells 1 and 12. The rest of the wells are filed with the test samples in duplicate. Each well is filled with 20-mL samples and a “few” crystals of bromophenol blue is added to the normal control plasma in order to follow the progress of plasma proteins in the gel. 7. Electrophoresis is carried out at a 20 V/cm (constant voltage). When the bromophenol blue dye front has migrated for 3 cm (usually after 2 h) the current is turned off. 8. Cut out twelve gel strips, six 1-cm × 3.3-cm and six 2-cm × 3.3-cm, containing the electrophoresed samples, see Fig. 1. 9. Arrange the strips on a fresh glass plate of similar dimension according to the template shown in Fig. 2. 10. Fill the upper and lower troughs so created with 11.5 mL and 8.5 mL molten
Multimeric Analysis of vWF
191
Fig. 1. Template 1 for use in 2DCIEP.
Fig. 2. Template 2 for use in 2DCIEP. agarose which are kept in Universal tubes at 56°C to which 38 mL DAKO IgG fragment of rabbit antihuman-vWF:Ag antiserum has been added immediately before use. 11. Start the second dimension of the electrophoresis and run for 16 h (overnight) at a constant voltage of 7 V/Cm. 12. After completion of electrophoresis, flood the plates with distilled water and covered with three layers of filter paper and press for 15 min. Afterwards dry and then wash first in two changes of strong (×5) saline for 3 h, followed by normal saline and finally in distilled water for further 2 h. 13. Dry the plates as before, they are now ready for staining.
192
Enayat
Fig. 3. 2DCIEP precipitin arcs for 12 serially diluted normal plasma samples (vWF:Ag = 1.00 U/mL). Each sample is diluted with saline and the concentrations are in percent indicated in each well.
14. Stain the glass plates for 10 min in the stain and then destain in three changes of destainer till the back ground is clear. Plates are then dried as before and further cleaned with absolute methanol.
3.1.3 Interpretation of Results The precipitin arc is formed as the result of interaction between VWF:Ag and anti-vWF:Ag antibody. This being a semi-quantitative test, the height and the intensity of the precipitin arc is in proportion to the antigen concentration (see Fig. 3). In normal plasma there should be an asymmetrical arc with steep ascending part, a plateau and then a slow descending tail to the precipitin arc (see Fig. 4). The quality of vWF:Ag is examined by appraisal of the shape of the precipitin arc as well as the Migration Index (MI). This is the ratio of the distance from centre of the well to a line through the peak of arc for the patient’s sample over normal control plasma (Fig. 4). The shape of precipitin arc of vWF:Ag of a type 2A vWD variant is symmetrical and fast moving with migration index of >1.25. Other type two variants of vWD can be identified but not classified exclusively with use of this method, but the loss of the high and intermediate molecular weight multimers (seen in other types of type 2) can be detected.
3.2. SDS Agarose Gel Electrophoresis 3.2.1. Preparation of Washed Platelets 1. Collect whole blood into 3.8% trisodium citrate in a ration of one part anticoagulant to nine parts blood. To prepare platelet rich plasma (PRP), centrifuge at 850 rpm for 10 min at room temperature. Remove the PRP with a pipet into a clean centrifuge tube and carefully layer onto 0.7 mL of 40% albumin using a plastic Pasteur pipet. 2. Centrifuge at 2800 rpm (1300g) at room temperature for 15 min. 3. Discard the supernatant plasma and carefully remove the platelet layer with a plastic pipet and place into a plastic/polyvinyl centrifuge tube. 4. Resuspend the platelets in platelet washing buffer.
Multimeric Analysis of vWF
193
Fig. 4. Precipitin arc for normal control plasma (NC) in (A), plasma from a type 2A patient (P) in (B) and these two superimposed showing the difference in shape and migration of the arcs in (C). 5. Repeat the albumin layering procedure and centrifugation at 2,800 rpm (1300g) for 15 min. 6. Wash the platelet layer once more and finally resuspend in 1 mL of PBS and centrifuge for 3000 rpm (3000g) for 15 min.
194
Enayat
7. Discard the supernatant and resuspend the platelets in 1 mL of PBS. To check the platelet count add 20 mL of the platelet solution to 180 mL of PBS and count the platelets in an automated counter (e.g., Coulter S +IV). Adjust the platelet count to 1–2000 × 109. A minimum of 200 mL of washed platelet concentrate is required for each analysis. Both plasma and platelet samples must be diluted 1:20, and 1:10, respectively in sample dilution buffer.
3.2.2. Platelet Extracts Two types of platelet extracts are prepared for multimer analysis: 1. Platelet extract: prepare by freezing and thawing of the platelet solution six times by alternatively immersing in liquid nitrogen and thawing in a 37°C water bath. Centrifuge in a top bench micro-centrifuge at 13,000 rpm for 5 min. Remove the supernatant and use as Platelet extract and use the precipitate in the Platelet lysate preparation. 2. Platelet lysate: For this preparation, the precipitate from the above is dissolved in 100–300 µL of Platelet lysis buffer.
3.2.2. Gel Preparation 1. Running gel. An appropriate amount of running gel is prepared by melting agarose and SDS in buffer in a microwave oven. Up to 30 mL of agarose solution is required per gel plate. Molten gel is kept at 56°C until use. 2. Stacking gel. An appropriate amount of staking gel is also prepared as above and kept at 56°C until use. 3. Clean two glass plates (130 mm × 200 mm × 2 mm) with detergent and coat the top plate with dimethylchlorosilane. In order to make a uniform gel, assemble a “sandwich set” comprising of two glass plates a piece of Gel Bond on one plate and a 1.5-mm plastic spacer between the edge of the gel bond and the other glass plate. Clam the whole assembly together with bulldog clips. 4. Inject the molten separating agarose using a syringe fitted with a large-gage needle and leave to set at room temperature and then place at 4°C for at least 1 h. 5. To add the stacking gel to the top of the separating gel, open the glass set and making a full length cut parallel to the long axis of the gel at 2.5 cm from what will be the cathode end of the gel using (Fig. 5). Remove a strip of the running gel, reassemble the sandwich set and fill the newly created space with about 5 mL hot stacking gel and allow to set at room temperature and then at 4°C for 1 h. 6. Separate the gel plates and using Template 3 together with a double-bladed cutter, cut 13 sample wells (8 × 2 mm) at 5-mm intervals, 10 mm from the interface between the running and stacking gels. 7. Place the gel is placed on the glass coolant plate of the electrophoresis tank and fill the electrode buffer reservoirs with fresh buffer. Connect the gel to the buffers with soaked layers of filter paper and fill the samples wells with 20 mL of diluted samples. 8. Run the gel initially at 30 mA (about 180 V) in a Pharmacia system) for 15 min until the samples have moved out of the sample wells. At this stage re-fill the
Multimeric Analysis of vWF
195
Fig. 5. Template 3 for use in SDS-gel electrophoresis.
9. 10.
11. 12. 13. 14.
wells with molten stacking gel, reduce the current to 14 mA (80 V) and continue the electrophoresis overnight (see Note 5). The following day, when the dye front has reached the bottom of the gel, remove the gel from the tank and fix in fixing solution for 1 h. Wash the fixed gel in two changes of distilled water for 2 h, press between filter paper for 1 h and immerse in a solution of 0.1% bovine serum albumin in PBS for 30 min and 1% rabbit serum in PBS for further 30 min. Wash the gel in distilled water and place overnight in a diluted solution of 125I-labeled anti-vWF:Ag monoclonal antibody. Wash the gel in two changes of 5× saline solution for 2 h, two changes of 1× saline solution for 3 h, and finally one wash of distilled water for 1 h. Following these washes, press the gel between layers of filter paper and then dry in a current of hot air from a hair dryer. Place the dried gels in an autoradiographic cassette together with a sheet of X-ray film. Place the cassette at –70°C for 2–8 d depending upon the strength of the radioactivity of the labeled antibody or the concentration of the vWF:Ag in the plasma samples (see Note 6).
3.2.3. Interpretation of the Results (see Note 7) Autoradiographs of normal vWF:Ag in plasma shows the full range of the multimer bands of von Willebrand Factor. These are made of high, intermediate and low molecular weight multimers (see Fig. 6). Each multimer band is made up of a triplet band, the main central and two faint but equally stained
196
Enayat
Fig. 6. Autoradiographs of different patterns seen in plasma vWF:Ag multimers from type 2A (lane 1), 2D (lane 2), 2B (lane 3), normal (lane 4), and type 1 vWd (lane 5); electrophoresed in 1.2% (A) and 1.8% (B) agarose gels. The triplet for band 1 is marked by a bracket and the satellite bands “a” and “b” can best be seen in the band 1 of plasma from type 2A vWD (lane 1). Arrow at the top of the gel points to the line between the stacking and separating gels.
satellite bands (a and b). The triplet band structure of vWF:Ag multimer is best seen in medium resolution (1.3–1.5%) agarose gel (see Notes 7 and 8). The loss of high molecular weigh multimers are best investigated in low resolution (1.0–1.2%) agarose gels (Fig. 6A) and the triplet band abnormalities in high resolution (1.8–2.0%) agarose gels (Fig. 6B). Therefore, for a full multimeric analysis 2–3 different gel concentrations should be used (see Note 6). This technique is not easy and even in an international ‘expert’ multicenter comparison of multimer sizing techniques and with similar methods, the results showed different degrees of resolution (19). Normal platelet’s vWF:Ag multimer bands are different to those seen from plasma. Much larger multimers are present in platelet than in plasma and the multimeric organisation is also different (Fig. 7). Smaller multimer bands appear to be made up of a doublet and the central bands migrate less than the corespondent multimers in plasma (20). Aside from visual appraisal of the autoradiographs, they can also be scanned by a gel densitometer (LKB 2202 Ultrascan Laser Densitometer) and the result can be given in form of a printed densitometric trace (Fig. 8). In this way it is
Multimeric Analysis of vWF
197
Fig. 7. Autoradiograph showing different multimer patterns seen in normal plasma (Pls) and platelet (Plt) vWF:Ag , electrophoresed on 1.2 and 1.4% agarose. Arrow at the top of the gel points to the sample application wells. Two small arrows at the bottom point to the doublet band pattern best seen in 1.4% agarose. Note the presence of very high molecular weight multimers in platelet sample best seen in low resolution 1.2% agarose.
also possible to accurately investigate minor variations in each multimer pattern and tabulate the percentage of each of vWF:Ag multimer bands in plasma. 4. Notes 1. For both of these methods, the type and quality of the agarose is of paramount importance. Originally, when different types of agarose were being tried, not only different multimer patterns were obtained from the same samples, but also different electrophoretic conditions were also needed for obtaining acceptable results.
198
Enayat
Fig. 8. Densitometric trace patterns of normal, type 2A, and type 2B von Willebrand disease plasma vWF:Ag multimers electrophoresed on 1.4% agarose gel. 2. Concentration of anti-vWF:Ag antibody used in 2D-IEP is very critical for precipitin arc formation. Different sources and batches of a the antibody make all the difference in the type of arc produced. Production of a perfect result may need an initial optimisation. 3. Monoclonal antibody ESvWF 10 is labeled with 125I by a modification of Chloramine-T gas method of Butt (1972) which allows mild iodination of proteins. In brief, antibodies are diluted to an approximate protein concentration of 10 mg in 10 mL and reacted with 300 mCi (11.1 MBq) Na125I to yield specific activity between 10–15 mCi/mg (0.37–0.55 MBq/mg). The labeled antibody is separated from unlabeled 125I by column chromatography. The concentration of labeled antibody solution is measured in a g counter. This should be about 30–80 × 107 CPM. When a working solution is required, the concentrated solution is diluted to a working solution of 10–15 × 106 CPM by diluting the concentrated
Multimeric Analysis of vWF
199
solution 1:10 in 0.1% BSA and 0.02% sodium azide in PBS. 4. In 2D-IEP test samples are compared in anodal migration and the shape of the arc, it is important to include enough normal control plasma in each plate. For this reason wells number 1, 6, 7, and 12 are always used for normal control. 5. Electrophoretic conditions in SDS-gel electrophoresis are not identical for each gel and run and therefore, special individual attention must be given to allow for minor adjustment needed in each run. The conditions given here may only act as a guide to carry out this type of electrophoresis and should be altered depending on the type of the electrophoretic system being used. 6. Autoradiography has worked well in our hands and is an extremely sensitive method, but this may not be the method of choice in other laboratories, and especially those that are not authorised to handle radioisotopes. When dealing with any radioactivity, certain local and general rules regarding handling, monitoring, and disposal of radioactive material must be observed. Details of the choices available for multimer band visualization are given in the reference section. 7. In SDS-gel electrophoresis, identification of each multimer band complex is important. Particularly in higher gel concentrations when a multimer band may appear in triplet or quintuplet bands, experience is needed to separate bands and identify major bands from minor satellite bands. 8. Acrylamide gels can also be used in as the separating medium in SDS-gel electrophoresis. Details of using this particular separating medium is given elsewhere (5).
References 1. Ruggeri, Z. M. and Ware, J. (1992) The structure and function of von Willebrand factor. Thromb. Haemostasis 67, 594–599. 2. Kernoff, P. B. A. Gruson and R. Rizza, C.R.A. (1974) A variant of factor VIII related antigen. Brit. J. Haematol. 26, 435–440. 3. Hoyer, L. W. and Shainoff, J. R. (1980) Factor VIII-related protein circulates in normal human plasma as high molecular weight multimers. Blood 55, 1056–1059. 4. Ruggeri, Z. M. and Zimmerman, T. S. (1981) The complex multimeric composition of Factor VIII/von Willebrand Factor. Blood 57, 1140–1143. 5. Enayat, M. S. and Hill F. G. H. (1983) Analysis of the multimeric structure of factor VIII related antigen/von Willebrand protein using a modified electrophoresis technique. J. Clin. Pathol. 36, 915–919. 6. Baillod, P., Affolter, B., Kurt, G. H., and Pflugshaupt, R. (1992) Multimeric analysis of von Willebrand factor by vertical sodium dodecyl sulphate agarose gel electrophoresis, vacuum blotting technology and sensitive visualisation by alkaline phosphatase anti-alkaline phosphatase complex. Thromb. Res. 66,745–755. 7. Laerie, A. S., Hoser, M. J., and Savidge, G. F. (1990) Phast assessment of vWF:Ag multimeric distribution. Thromb. Res. 59, 369–373. 8. Enayat, M. S., Hill, F. G. H., Robinson, W., Prowse, C. V., and Hornsey, V. S. (1987) Evaluation of monoclonal antibodies to vWf Antigen for use in autoradiography vWF multimer analysis. Thromb. Haemostasis 57, 217–221.
200
Enayat
9. Tomia, Y., Harrison, J., and Abilgaard, C. F. (1989) von Willebrand factor multimer analysis using a sensitive peroxidase staining method. Thromb. Haemostasis 62, 781–783. 10. Cumming, A. M. and Wensley, R. T. (1993) Analysis of von Willebrand factor multimers using a commercially available enhanced chemiluminescence. J. Clin. Pathol. 46, 470–473. 11. Rose, P. E., Enayat, M. S., Sunderlan, R., Short, P. E., Williams, C. E., and Hill, F. G. H. (1984) Abnormalities of factor VIII related protein multimers in the haemolytic uraemic syndrome. Arch. Disease Childhood 59, 1135–1140. 12. Moake, J. L. and McPherson, P. D. (1989) Abnormalities of von Willebrand Factor multimers in Thrombotic Thrombocytopenic Purpura and the HaemolyticUraemic Syndrome. Am. J. Med. 87, 9–15. 13. Pasi, K. J., Enayat, M. S., Horrocks, P. M., Wright, A. D. and Hill, F. G. H. (1990) Qualitative and Quantitative abnormalities of von willebrand antigen in patients with diabetes mellitus. Thromb. Res. 59, 581–591. 14. Hill, F. G. H., Enayat, M. S., and Scott, D. G. I. (1988) Extreme of vWF:Ag multimer abnormalities in patients with rheumatic diseases accompanied by vasculitis. 2nd International conference on Factor VIII/von Willebrand Factor, Bari, Italy. 15. Hill, F. G. H. and Enayat M. S. (1985) Multimeric analysis of eight lyophilized factor VIII concentrates. Brit. J. Haematol. 60, 201–203. 16. Mazurier, C., Jorieux, S., de Romeuf, C., Samor, B., and Goudemand, M. (1991) In vitro evaluation of a very-high-purity, solvent/detergent-treated, von Willebrand factor concentrate. Vox Sang 61, 1–7. 17. Ruggeri, Z. M., Mannucci, P. M., and Federici, A. B. (1982) Multimeric composition of factor VIII/von Willebrand factor following administration of DDAVP: implications for pathophysiology and therapy of von Willebrand’s disease subtypes. Blood 59, 1272–1278. 18. Enayat, M. S. and Hill, F. G. H. (1982) Qualitative VIIIR:Ag function screening of multiple samples by two-dimensional crossed immunoelectrophoretic technique. Med. Lab. Sci. 39, 357–362. 19. Mannucci, P. M., Abildgard, C. F., Gralnick, H. R., Hill, F. G. H., Hoyer, L. W., Lombardi, R., Nilsson, I. M., Tuddenham, E., and Meyer, D. (1985) Multicentric comparison of von Willebrand factor multimeric sizing techniques. Thromb. Haemostasis 54, 873–876. 20. Lopez-Fernandez, M. F., Lopez-Berges, C., Nieto, J., Martin, R., and Batlle, J. (1986) Platelet and plasma von Willebrand Factor: Structure differences. Thromb. Res. 44, 125–128.
Mutations in Factor VII Gene
201
20 Identification of Mutations in the Human Factor VII Gene Peter M. Baker 1. Introduction It has been recognized from the early 1800s that activation of coagulation can be initiated by the exposure of subendothelial layers (tissue factor), but it was the 1940s before factor VII (FVII) was included in this event (1,2). The discovery of hemophilia A and B supported the hypothesis that the intrinsic pathway incorporating factors VIII and IX was more important in hemostasis (3,4). More recently the extrinsic pathway (incorporating FVII) has been the focus of attention by activating both arms of the coagulation cascade via its action upon factors IX and X (5). FVII is a vitamin K-dependent serine protease associated with the initiation of blood coagulation. Synthesized in the liver, it circulates as a single-chain zymogen of 53 kDa at a concentration of 10 nM (2,3,6). In this form it has no activity, but upon cleavage of the Arg152–Ile153 bond in the presence of activated factors IX and X (FIXa, FXa), and the subendothelial protein tissue factor, the disulphide-linked, two-chain active form is generated (4,5). The FVII gene is 12.8 kb in length and is located at chromosome 13q34, 2.8 kb upstream of the factor X gene (6). A separate gene on chromosome 8 may be involved in the regulation of FVII expression (7,8). FVII has nine exons and eight introns arranged similarly to the other vitamin K-dependent proteins FIX, FX, and protein C (9). The conservation of this homology (protein domains, splice sites, and introns) supports the hypothesis of the evolution from a single gene via duplication and modification (10). Other species proteins show > 75% homology for the equivalent cDNA and catalytic domains (11).
From: Methods in Molecular Medicine, Vol. 31: Hemostasis and Thrombosis Protocols Edited by: D. J. Perry and K. J. Pasi © Humana Press Inc., Totowa, NJ
201
202
Baker
FVII deficiency is a rare disorder affecting approximately 1 in 500,000 of the general population (12). It is inherited as a autosomal recessive disorder, heterozygotes are usually asymptomatic with homozygotes showing variable hemorrhagic symptoms; mucosal bleeding, epistaxsis and menorrhagia (13). Patients with levels of less than 1% experience haemarthroses and arthropathies comparable to patients with severe, classical haemophilia A and B. The 9 exons of the factor VII gene (1a, 1b, 2–8) were first described by O’Hara et al. in 1987 (6). Exons 1a and 1b code for the signal peptide which is removed during processing. In more than 90% of cases alternative splicing produces mRNA lacking exon 1b. The leader sequence produced (either 38 or 60 amino acids) both code for expression of active FVII (14). Exon 2 encodes the γ-carboxyglutamic acid-rich domain (residues 1–37) associated with calcium ion mediated binding of tissue factor, via the negatively charged surfaces of phospholipid (15). Exon 3 codes for the short aromatic stack domain (residues 38–45); exons 4 and 5 (residues 46–83 and 84–130, respectively) code for two tandem epidermal growth factor (EGF) like domains. Together exons 2, 3, 4, and 5 encode the light chain of FVII, which binds to tissue factor (16). Exons 6, 7, and 8 code for the activation and catalytic domains (residues 131–406) similar to other serine protease’s with the active site triad of Ser344, Asp242, and His193. The following methods describe the isolation and identification of mutations within exons 2 to 8 encoding factor VII. Samples are screened using single-stranded conformational polymorphism (SSCP) and ethylene glycol gel electrophoresis (EGGE). Abnormal regions of the factor VII gene are then directly sequenced. Restriction enzyme digest with MspI of exon 8 is also described. This identifies patients with the Arg304 mutation (FVII Padua) and the Arg353 polymorphism, both of which have been reported to alter the levels of circulating FVII (17). 2. Materials All reagents supplied by Sigma (Poole, UK) or BDH Laboratory Supplies (Poole, UK.) unless otherwise stated.
2.1. DNA Extraction 1. Cell lysis buffer: 0.32 M sucrose, 1% Triton X-100 (v/v), 5 mM MgCl2, 10 mM Tris-HCl, pH 7.5. Store at 4°C. 2. Tris-EDTA buffer (TE), pH 8.0: 10 mM Tris-HCl, pH 8.0, 1 mM EDTA. Store at room temperature. 3. Nuclear lysis buffer: 0.32 M lithium acetate, 2% (w/v) lithium dodecyl sulphate, 10 mM Tris-HCl, pH 8.0, 1 mM EDTA. Store at room temperature. 4. Biophenol/chloroform/ISA, stabilized: Biotechnology grade. (Camlab, Cambridge, UK). Store above 4°C.
Mutations in Factor VII Gene 5. 6. 7. 8.
203
3 M sodium acetate, pH 5.5. Store at room temperature. Absolute ethanol. Store at –20°C. 70% Ethanol. Store at room temperature. Sterile distilled water.
2.2. PCR Amplification 1. 10X PCR buffer (Perkin Elmer Corporation, Warrington, UK): 500 mM KCl, 10 mM Tris-HCl, pH 8.3. Store at –20°C. 2. 25 mM MgCl2 (Perkin Elmer Corporation, Warrington UK.). Store at –20°C. 3. 20 mM dNTP working solution: Deoxynucleotide triphosphates (Pharmacia LKB Biotechnology, Milton Keynes, UK) dilute 1+ 4 from 100 mM stock. Store at –20°C. 4. DNA Polymerase. “Amplitaq” 5 U/mL (Perkin Elmer Corporation, Warrington UK.). Store at –20°C. 5. Dimethyl sulphoxide (DMSO): (Fisons Scientific Equipment Loughborough, UK.). Store at room temperature. 6. 10X TBE buffer: Tris 121 g, boric acid 61.8 g, Na2EDTA 7.4 g, distilled H2O to 1 L. Store at room temperature. 7. Ultra-violet-treated H2O (UV-H2O). Store at room temperature 8. Ethidium bromide: 10 mg/mL. Add 2 mL per 100 mL of agarose gel. Store in the dark at 4°C 9. 1.5% Agarose gel in 1X TBE. 10. Gel loading buffer: 0.25% (w/v) bromophenol blue, 0.25% (w/v) xylene cyanol, 20% sucrose. Store at room temperature. 11. Molecular weight markers: ØX174-HaeIII digest (New England Biolabs, Hitchin UK). 12. Oligonucleotide primers (see Table 1). Each of the reverse primers is biotinylated at the 5' end. Make 50 pmol/µL working solutions in UV-treated distilled H2O and store at –20°C. 13. PCR cycler: MJ-Research PTC-200 peltier programable thermal cycler (Genetic Research Instrumentation Ltd, Essex UK).
2.3. Single-Stranded Conformation Polymorphism (SSCP) Analysis 1. 2. 3. 4. 5. 6. 7. 8.
PCR reagents from Subheading 2.2. [α-32P]dCTP (Amersham UK). Store at 4°C 50% Acrylamide. (99:1 Acrylamide:bisacrylamide). Glycerol (AnalaR grade). 0.45-mm syringe filter. (Gelman Scientific Ltd, UK). 2% Dimethyldichlorosilane (Fisons Scientific Instruments, UK). N,N,N’,N’-Tetramethyl-ethylenediamine (TEMED). 25% Ammonium persulfate: Dissolve 0.25 g in 1 mL of distilled H2O. Store at 4°C. Freshly prepared immediately before use. 9. Formamide dye loading buffer: 95% formamide, 10 mM NaOH, 0.25% (w/v) bromophenol blue, and 0.25% (w/v) xylene cyanol. Store at 4°C.
204
Baker
Table 1 Primers for Amplification of the Factor VII Gene Exon
Primer pair (forward/reverse)
2
5'-CAG AGA GGC CAG GCC GGG AAG GAT GG-3' 5'-GCC CAC AGG CCG CAG CCA AAG AGA CG-3' 5'-GGG GCC AAG ATT AGA AGA AAC CTA CC-3' 5'-AAT CAG AAC CTT GGG TCC CTG TCA AA-3' 5'-GTG TGC CAA GCT CAG GCT CTG TCA CC-3' 5'-TGA AGG CCA GTC CCA CCC GTC TTT TG-3' 5'-GGC ACG TTC ATC CCT CAC AAA TCT CT-3' 5'-CTC CTT CCT TGC CCC ACT AAA AGC AT-3' 5'-ATT GTG CAA TGC CAG AGG TTC CTT GG-3' 5'-AGC CAC AGC CCC TGA GAC ACT TGA GA-3' 5'-CCC CAG TTC ACT TGT CCC CAC ACG AG-3' 5'-CTC CCA TGC CCT CCT CTA CCC CAT TA-3'
3+4 5 6 7 8
Fragment size (bp) 472 589 383 343 468 906
10. Sequi-Gen sequencing system with 24-well comb and 0.4-mm spacers. (Bio-Rad Laboratories Ltd., Hemel, Hempstead, UK). 11. Gel fixative: 5% methanol (v/v), 5% acetic acid v/v. Store at room temperature. 12. Chromatography paper 3MM. (Whatman International Ltd, Maidstone, UK). 13. Clingfilm (The Dow Chemical Company, UK). 14. Vacuum dryer. (Bio-Rad Laboratories Ltd, Hemel Hempstead, UK).
2.4. Restriction Enzyme Digestion 1. MspI (New England Biolabs Inc. Hitchin, UK). Store at –20°C. 2. Spermidine: (Calbiochem Corporation La Jolla, CA). Dilute to 10 mM working solution in distilled H2O. Store at room temperature. 3. Bovine serum albumin (BSA): 10 mg/mL. Supplied with restriction enzymes. 4. 2.5% Agarose in 1X TBE buffer containing 0.5 mg/mL ethidium bromide. 5. Loading buffer (see Subheading 2.2., step 10). 6. Molecular weight markers: ØX174-HaeIII digest.
2.5. PCR Product Purification for Direct Sequencing 1. Streptavidin-coated paramagnetic beads, e.g., Dynabeads M-280 (Dynal AS, Oslo, Norway). Store at 4°C. 2. 0.15 N NaOH: freshly prepared immediately before use. 3. 2X Binding and Washing Buffer (BWB): 10 mM Tris-HCl, pH 7.5, 1 mM EDTA, 2 M NaCl. Store at room temperature 4. Tris-EDTA buffer (TE), pH 8.0: 10 mM Tris-HCl, pH 8.0, 1 mM EDTA. Store at room temperature. 5. Vortex agitator (Jencon Scientific Ltd. UK). 6. Magnetic separation unit (Dynal AS).
Mutations in Factor VII Gene
205
Table 2 Forward Sequencing Primers Exon
Primer sequence
Exon 2 Exon 3+4 Exon 5 Exon 6 Exon 7 Exon 8 (1) Exon 8 (2) Exon 8 (3)
5'-GGG AGC ACG GCA GGG AGG AC 5'-CCG TTG GGT GCT CTG GTG AA 5'-GCC ACC TTC CAG GCA GAA CA 5'-CGT TCA TCC CTC ACA AAT CT 5'-GCG AGT CAT CAG AGA AAC AA 5'-AGG TCC CCT TGC CCC AGA AG 5'-CGT GCG CTT CTC ATT GGT CA 5'-GCC CAC ATG CCA CCC ACT AC
2.6. DNA Sequencing 1. 2. 3. 4. 5. 6. 7. 8.
T7 Sequenase v2.0 kit: (Amersham Life Science, Cleveland, Ohio.). Store at –20°C. Forward sequencing primers: see Table 2. [α-35S]dATP: (Amersham, UK). Store at 4°C. Microtiter sequencing trays Urea: Enzyme grade (Gibco BRL, UK). 40% Acrylamide/bisacrylamide (19:1) (Severn Biotech Ltd, UK). 10X TBE buffer. Gel casting and sequencing apparatus.
3. Methods 3.1. DNA Extraction DNA can be extracted from whole blood or buffy coat preparations, anticoagulated with 3.8% trisodium citrate or EDTA. 1. Dilute the sample 1+9 with cold cell lysis buffer in a 17 × 100 mm polypropylene tube and place on ice for 15 min. Centrifuge for 15 min at 1700g at 4°C to pellet the leukocytes, and decant the supernatant into a beaker. Re-suspend the pellet thoroughly in 5 mL TE buffer. 2. Add 10 mL nuclear lysis buffer to the resuspended cells and rotate on an orbital mixer for 20–30 min until a clear viscous solution is obtained. 3. Add 10 mL phenol-chloroform and rotate for 5 min. Centrifuge for 10 min at 1700g at 4°C and remove the upper layer into a clean tube. 4. Add 5 mL of chloroform to the tube and rotate for 5 min. Centrifuge for 10 min at 1700g at 4°C and remove the upper layer to a clean tube. 5. Add 2.5 vol of absolute ethanol and gently mix. 6. Collect precipitate of DNA using a sterile Pasteur pipet. Add to 500 mL of distilled H2O. 7. Place at 4°C for 24–48 h to allow the DNA to go into solution. Store at –20°C.
206
Baker
3.2. DNA Amplification 1. Prepare a 100 mL PCR reaction consisting of: 6 µL 25 mM MgCl2, 10 µL 10X PCR buffer, 1 µL 20 mM dNTP’s, 80 µL UV H2O, 2 µL DNA (500 ng–1 µg), and 1 µL (50 pmol) of each amplification primer (see Notes 1–3). 2. Heat the reactions at 95°C for 5 min on a thermal cycler. 3. Add 0.4 µL (2 U) Taq polymerase to each tube. 4. Carry out 40 cycles of amplification: Denaturation 94°C for 20 s, annealing and extension at 74°C for 20 s. On the last cycle the extension time is increased to 10 min. Primer annealing temperatures/times Exon 2 69°C for 20 s Exon 3+4 61°C for 20 s Exon 5 63°C for 20 s Exon 6 59°C for 20 s Exon 7 64°C for 20 s Exon 8 64°C for 20 s 5. Visualize the PCR products by running 8 µL and 2 µL of loading buffer on a 1.5% agarose gel with ethidium bromide in 1X TBE for 25–30 min at 60 V. 6. For use in SSCP electrophoresis the reaction volumes are scaled down to 20 µL: 1.2 µL 25 mM MgCl2, 2 µL 10X PCR buffer, 0.2 µL 20 mM dNTP’s, 13.4 µL UV H2O, 2 µL DNA (100–200 ng), 1µL (50 pmol) of each amplification primer, and 0.2 µL of [α-32P]dCTP (see Notes 4 and 5).
3.3. Single-Stranded Conformation Polymorphism (SSCP) Analysis SSCP gel electrophoresis differentiates PCR products with differing electrophoretic mobility. These can be labeled with radionucleotides and visualized on X-ray film. 1. Assemble gel plates for SSCP analysis. Wash the gel plates carefully with detergent, rinse in deionized water and dry with lint-free tissues. To remove any grease, wipe each plate with an alcohol-moistened tissue and allow to dry. 2. Apply 1–2 mL of silanizing solution to one of the plates (commonly the “eared” plate) and allow to dry in a fume cupboard. 3. Assemble the plates according to the manufacturer’s instructions and place on one side. 0.4 mm spacers are generally used. 4. Prepare a 100 mL acrylamide gel with 12 mL of 50% acrylamide (99:1 acrylamide:bisacrylamide), 10 mL of 10X TBE, 10 mL of glycerol, and 75 mL of distilled H2O. 5. Add 130 µL of TEMED and 130 µL of 25% ammonium persulfate to initiate polymerization. Insert a 24-well comb with teeth of 0.5 cm and allow to polymerize for at least 60 min. 6. Add 2 µL of the radio-labeled PCR product to 8 µL formamide loading buffer. Incubate in the PCR block at 95°C for 5 min, then place on ice. 7. Assemble the gel apparatus, fill the buffer reservoirs with 1X TBE and pre-run the gel at 45 W for 15 min.
Mutations in Factor VII Gene
207
8. Load 2 µL of the labeled PCR product onto gel. Run at 45 W for approx 1–3 h (see Note 5). 9. Remove gel from apparatus and place in fixative for 15 min. 10. Transfer to 3MM chromatography paper, cover with cling film, and dry under vacuum at 80°C for 2 h. 11. Transfer to X-ray cassette with film and expose overnight (or longer).
3.4. Restriction Enzyme Digestion A single substitution of Arg304 or Arg353 to Gln (CGG->CAG) within exon 8 results in the loss of an MspI restriction enzyme recognition site. When run on 2.5% agarose gels the DNA fragments can be separated to distinguish the relevant genotypes. PCR products from the amplification of exon 8 are used. 1. Add 18 µL of PCR product DNA (exon 8) to 1 µL spermidine, 1 µL BSA, and 1 µL MspI. 2. Incubate for 12–16 h at 37°C. 3. Run the digested products on a 2.5% agarose gel with 2 µL of gel loading buffer at 60 V for 25 min. Include a control of undigested DNA and molecular weight markers. 4. Visualize under UV light. Fragments (bp) generated are: Normal (Arg 304/Arg304, Arg353/Arg353): 274, 242, 203, 80, 47, and 40 bp Gln304/Gln304: 283, 274, 242, 67, and 40 bp 3341, 242, 203, 80, and 40 bp Gln353/Gln353:
3.5. DNA Purification Double-stranded PCR products amplified with biotinylated primers are bound to paramagnetic beads coated with streptavidin. Twenty microliters of streptavidin coated beads used with 50 µL of PCR product provides sufficient template for 3–5 sequencing reactions. 1. Vortex the stock of beads and remove 20 µL into a 1.5-mL Eppendorf tube. 2. Place in the magnetic separation unit for 30 s. 3. Remove the supernatant and add 50 µL of 1X BWB. Vortex briefly to mix (2–3 s) and place in the magnetic separation unit for 30 s. Remove the supernatant and replace with 50 µL of 2X BWB. Vortex to mix. 4. Add 50 µL of the PCR product to the beads. Incubate with continual mixing (to keep the beads in suspension) for 15–20 min at room temperature. 5. Place the Eppendorf in the magnetic separation unit for 30 s and remove the supernatant. Add 10 µL of 0.15 N NaOH and vortex briefly to mix. Incubate at room temperature for 15 min. 6. Place the Eppendorf in the magnetic separation unit for 30 s. Remove the supernatant into a sterile Eppendorf tube and keep (this contains the nonbiotinylated strand of DNA and can be sequenced with a reverse sense primer).
208
Baker
7. Add 100 µL of 0.15 N NaOH to the beads, vortex briefly and place in the separation unit for 30 s. Remove and pool the supernatant with that already collected. 8. Add 100 µL of 1X BWB to the beads, vortex briefly and place in the separation unit for 30 s. Remove the supernatant and discard. 9. Repeat step 8 twice. The second time washing the beads in 100 µL of TE, pH 8.0. 10. Resuspend the beads in 20 µL of distilled H2O. Store at 4°C.
3.6. DNA Sequencing Direct sequencing of the PCR products is performed using the dideoxy chain termination method and T7 DNA polymerase. The method described is based upon the commercially available system Sequenase. 1. Add 5–7 µL of the purified biotinylated PCR product to 1 µL (8–12 pmol) of the appropriate sequencing primer (see Table 2) and 2 µL of 5X sequence reaction buffer. Incubate at 65°C for 5 min, then cool to 30°C at a rate of 2°C per (see Note 6). 2. Dispense 2.5 µL of each termination mix into a microtiter sequencing tray and place at 4°C. Prewarm at 37°C for at least 5 min prior to use. 3. Prepare a master extension mix for the number of templates to be sequenced +1. For example, for six templates combine: 7 µL of 0.1 M dithiothreitol, 3.5 µL [α-35S]dATP, 14 µL of dGTP labeling mix (diluted 1+5 in distilled H2O), 14 µL of Sequenase v2 (T7 DNA polymerase (diluted 1+7 in enzyme dilution buffer). Add diluted Sequenase last ensuring the enzyme dilution buffer is ice-cold before adding the enzyme. 4. Add 6 µL of the master mix to the annealed template primers on ice. Immediately add 3.5 µL to the termination mixes (prewarmed at 37°C) and place at 37°C for 5 min. Add 4 µL of the formamide stop solution to terminate the reaction. 5. Reaction mixes can be used immediately or stored at –20°C. 6. Prepare a 100 mL 6% denaturing polyacrylamide gel by mixing of 42 g of urea, 15 mL of 40% acrylamide/bisacrylamide (19:1 acrylamide:bisacrylamide), 10 mL 10X TBE buffer and distilled water to 100 mL. 7. Assemble the gel sequencing plates (see Subheading 3.3.). 8. Initiate polymerization by adding 130 µL of TEMED and 130 µL of fresh 25% ammonium persulfate. Insert a 20-well comb and allow to polymerise for at least 60 min prior to use. 9. Assemble the gel apparatus, fill the buffer reservoirs with 1X TBE and pre-run the gel at 45 W for 15 min. 10. Denature the samples at 80°C for 10 min and then place onto ice before loading. Load 3–5 µL of each sample. Running time will depend on the exon being sequenced. This will range between 1–3+ h. 11. After electrophoresis is complete, separate the gel plates, and place the gel (adherent to one plate) in fixative for 15 min. 12. Transfer the gel to 3MM chromatography paper, cover with cling film and dry under vacuum at 80°C for 2 h. 13. Transfer to X-ray cassette with film. Develop after 2–3 d.
Mutations in Factor VII Gene
209
4. Notes 1. PCR reactions depend on clean conditions to prevent contamination. This includes the use of aerosol tips, autoclaved glassware, and sterile or UV-treated distilled H2O. 2. Negative controls for PCR amplification should be used, i.e., all reagents except DNA. 3. Where possible, master mixes of reagents should be employed to prevent pipetting errors in small volumes and standardize contents of each tube. 4. Care must be taken in the use of radioisotopes. Recognized guidelines depending on the nature of the isotope being used must be adhered to. This includes perspex shielding, film dosimeters, regular checking of background levels, disposal facilities, log book of usage, and adequate storage facilities. 5. Electrophoresis times will depend on the size of the fragment being loaded. 6. This is conveniently carried out in the PCR block with an adjusted ramp time.
References 1. Thakrah, C. T. (1819) An inquiry into the nature and properties of the blood. Cox, London. 2. Alexander, B., Goldstein, R., Landmehr, G., et al. (1951) Congenital SPCA deficiency: a hitherto unrecognised coagulation defect with haemorrhage rectified by serum and serum fractions. J. Clin. Invest. 30, 596–608. 3. Macfarlane, R. G. (1964) An enzyme cascade in the blood clotting mechanism, and its’ function as a biochemical amplifier. Nature 202, 498–499. 4. Davie, E. W. and Ratnoff, O. D. (1964) Waterfall sequence for intrinsic blood clotting. Science 145, 1310–1312. 5. Broze, G. J. Jr, Girard, T. J., and Novotny, W. F. (1990) Regulation of coagulation by a multivalent Kunitz-type inhibitor. Biochemistry 29, 7539–7546. 6. O’Hara, P. J., Grant, F. J., Halderman, B. A., Gray, C. L., Insley, M. Y., Hagen, F. S., and Murray, M. J. (1987) Nucleotide sequence of the gene coding for human Factor VII, a vitamin-K dependent protein participating in blood coagulation. Proc. Natl. Acad. Sci. USA 84, 5158–5162. 7. de Grouchy, J., Zautzenberg, M.D, Turleau, C., Beguin, S., and Chauin-colin, F. (1984) Regional mapping of clotting factors VII and X to 13q34. Expression of factor VII through chromosome 8. Human Genetics 66, 230–233. 8. Miao, C.H., Leytus, S. P., Chung, D. W., and Davie, E. W. (1992) Liver specific expression of the gene coding for human factor X, a blood coagulation factor. J. Biol. Chem. 267, 7395–7401. 9. Furie, B. and Furie, B. C. (1990) Molecular bases of vitamin-K dependent γ-carboxylation. Blood 75, 1753–1762. 10. Neurath, H. (1984) Evaluation of proteolytic enzymes. Science 224, 350–357. 11. Marakava, M., O’Kamura, T., Kamura, T., Kuroiwa, M., Harada, M., and Niho, Y. (1994) Analysis of the partial nucleotide sequences and deduced primary structures of the protease domains of mammalian blood coagulation factors VII and X. Eur. J. Haematol. 52, 162–168.
210
Baker
12. Regni, M. V., Lewis, J. H., Spero, J. A., and Hasiba, U. (1981) Factor VII deficiency. Am. J. Haematol. 10, 79. 13. Tripplett, D. A., Brandt, J. T., McGann Batard, M.A., Shaeffer Dixon, J. L., and Fair, D. S. (1985) Heterogeneity defined by combined functional and immunochemical analysis. Blood 66, 1284. 14. Berkner, K., Busby, S., Davie, E., et al. (1986) Isolation and expression of cDNA encoding human factor VII. Cold Spring Harb. Symp. Quant. Biol. 51, 531–541. 15. Broze, J. Jr. (1982) Binding of human factor VII and VIIa to moncytes. J. Clin. Invest. 70, 526–535. 16. Kumar, A., Blumenthal, D. K., and Fair, D. S. (1991) Identification of molecular sites on factor VII which mediate its assembly and function in the extrinsic pathway activation complex. J. Biol. Chem. 226, 915–921. 17. Green, F., Kelleher,C., Wilkes, H., Temple, A., Meade, T., and Humpries, S. (1991) A common genetic polymorphism associated with lower coagulation factor VII in healthy individuals. Arterioscler. Thromb. 11, 540–546. 18. Tuddenham, E. G. D, Pemberton, S., and Cooper, D. N. (1995) Inherited factor VII deficiency: genetics and molecular pathology. Thromb. Haemostasis 74(1), 313–321.
Factor XI Deficiency
211
21 Molecular Analysis in Factor XI Deficiency Karen M. Johnson and John H. McVey 1. Introduction Factor XI (FXI) is the zymogen precursor of an active serine protease that participates in the contact phase of coagulation. Synthesized in the liver, it circulates in the plasma in a noncovalent complex with high molecular weight kininogen (1) at a normal concentration of 5 µg/mL. (For clinical purposes, the normal range is defined as 50–150 U/dL) (2). FXI circulates as a homodimeric glycoprotein with a mass of 160 kDa. Each subunit of the FXI molecule consists of a tandem repeat of four “apple” domains, designated A1–A4, which are followed by a typical serine protease catalytic domain (3). Each apple domain has several internal disulphide links: A2 and A3 have an even number of cysteine residues, whereas A1 and A4 have seven cysteine residues. Dimerization of the molecule is mediated through a disulphide bridge between cysteine 321 in the A4 domain of each subunit (4). The Apple 4 domain also contains a binding site for Factor XIIa (FXIIa). Of the other apple domains, A1 contains a site for binding high-mol-wt kininogen, and A2 contains a substrate binding site for Factor IX (FIX) (5–8). FXI is activated by FXIIa by proteolytic cleavage at Arg 379-Ile 380 in each constituent monomer. This cleavage generates two chains, which are held together by three disulphide bonds. The heavy chain comprises the four apple domains, and the light chain contains the catalytic domain. The cleavage of FXI by FXIIa generates two active site serines per dimer. Activated Factor XI (FXIa) recognizes FIX as a substrate, and activates FIX by cleaving it at two sites: Arg145-Ala146 and Arg180-Val181 (2). The gene encoding Factor XI has been localized to the tip of the long arm of chromosome 4 (4q35), and consists of 15 exons spread over 23 kb (9,10). The gene is transcribed to give a mRNA of approx 2 kb, which in turn encodes for a mature protein consisting of 607 amino acids. From: Methods in Molecular Medicine, Vol. 31: Hemostasis and Thrombosis Protocols Edited by: D. J. Perry and K. J. Pasi © Humana Press Inc., Totowa, NJ
211
212
Johnson and McVey
Hereditary Factor XI deficiency is rare. It occurs as an autosomal incompletely recessive disorder with an incidence of 1 in 105-106. Deficiency of FXI was first discovered in a Jewish individual, who presented with a mild bleeding tendency and prolonged partial thromboplastin times (11,12). The majority of cases since described have been among Ashkenazi Jews, in whom three common mutations (designated Types I, II, and III) have been found (13,14). Type I is a splice junction mutation at the start of intron N, in which the invariant 5'-splice donor dinucleotide GT is mutated to AT. Type II is a nonsense mutation in exon 5, in which the GAA encoding Glu177 becomes TAA, a stop codon. Type III is an amino acid substitution in exon 9, in which the TTC encoding Phe283 becomes CTC, coding for Leucine. Type II and Type III mutations account for approx 50 and 40%, respectively of all mutations found in Jewish patients. Increasing numbers of non-Jewish patients have now being identified (15– 17). Among these, the type II and type III mutations account for just 12% of the molecular defects. The majority are patients with low Factor XI antigen levels (18), although more recently some patients with normal antigen levels but reduced activity have been recorded (19,20). A rapid, relatively simple screening method is required to identify the causative mutations in Factor XI deficient patients. As with many genes coding for proteins involved in coagulation, the methods of choice are PCR based. Primary analysis to establish the presence or absence of types I, II, and III mutations is performed by PCR of three specific genomic fragments, followed by restriction enzyme digestion of the PCR products. If these three mutations are absent, subsequent screening of the gene is by means of single strand conformational polymorphism (SSCP) and direct sequencing of individual exons. 2. Materials (see Note 1) 2.1. Isolation of Genomic DNA
2.1.1. Isolation of Genomic DNA from Whole Blood Samples 1. 10 mL EDTA blood samples should be collected into a vessel that can withstand temperatures of –70°C because the sample is frozen before use (preferably not a vacutainer or glass tube!). 2. Lysis buffer: 0.32 M sucrose, 10 mM Tris-HCl, pH 7.5, 1% Triton X-100, 5 mM MgCl2. Prepare with sterile distilled water. Store at 4°C. 3. NaCl/EDTA stock solution: 7.5 mM NaCl and 24 mM EDTA, pH 8.0. Prepare with sterile distilled water. 4. SDS/Proteinase K: 5% SDS and 2 mg/mL Proteinase K. Prepare with sterile distilled water. 5. 3 M NaOAc pH 5.2. Dissolve 123 g of Sodium acetate in approx 200 mL H2O. Adjust pH to 5.2 with glacial acetic acid. Add H2O for final volume of 500 mL. Autoclave to sterilize.
Factor XI Deficiency
213
6. DNA Phenol. 1 kg Ultrapure Phenol (Gibco BRL, #15509-029). Equilibrate overnight with 500 mL of 50 mM Tris-HCl, pH 7.6, 1 mM EDTA, and 0.3 M NaOAc, pH 7.0. Add 50 mL of M-Cresol, 2 mL of 2-mercaptoethanol, and 1 g of β-hydroxyquinolone. Store at 4°C away from light. 7. Phenol/chloroform. Prepare a 50:50 mix of DNA phenol:chloroform 8. Chloroform. 9. 100% Ethanol. 10. Sterile distilled water.
2.1.2. Isolation of Genomic DNA from Tissue Culture cells This method is useful if, for example, patient samples have been obtained as immortalized lymphocytes. 1. Lysing solution: 50 mM Tris-HCl, pH 8.5, 50 mM NaCl, 25 mM EDTA, pH 8.0, 0.5% SDS. Prepare in sterile distilled water and filter-sterilize. Add Proteinase K to 300 µg/mL before use. 2. PBS “A”: 8 g NaCl, 0.2 g KCl, 1.15 g Na2HPO4, 12H2O, 0.2 g KH2PO4. Adjust pH to 7.4 with HCl.
2.2. Polymerase Chain Reaction (PCR) 1. Primer sequences for the detection of Types I-III Factor XI deficiency (see Table 1). 2. Primer sequences for the amplification of exons (see Table 2). 3. DNA polymerase enzyme and 1X PCR buffer. Commercially available polymerase enzymes are supplied with concentrated buffer, with or without magnesium added. This buffer should be diluted with sterile distilled water, and deoxynucleotides and magnesium added as required. For example, to prepare 750 µL of a 10X PCR buffer (with MgCl2) combine: 450 µL of 25 mM MgCl2 (final concentration = 1.5 mM), 15 µL of each dNTP at 100 mM (final concentration = 200 µM) and 6240 µL of sterile water. Filter through 0.2 µm filter. Store as 1 mL aliquots at –20°C. 4. 100 mM dNTPs (e.g., Pharmacia, #27-2035-01). 5. Genomic DNA at a concentration of 150 ng/µL.
2.3. Single Stranded Conformation Polymorphism (SSCP) Analysis 1. 40% Acrylamide: Mix 35.1 g of acrylamide with 0.9 g of N,N’ methylene bisacrylamide and add sterile water to give a final volume of 90 mL. Store at 4°C. 2. 10X TBE pH 8.0: 108 g trizma base (Sigma, #T1503), 55g boric acid, 7.4 g EDTA, and water to 1 L. (These quantities should give the exact pH!) 3. SSCP gel mix: 40% acrylamide (90 mL), 10X TBE (80 mL) and H2O (630 mL). Store at 4°C. Degas just before use. 4. To pour the SSCP gel: Combine the SSCP gel mix (70 mL, degassed) with 10% ammonium persulfate (402 µL) and TEMED (52.5 µL) immediately before pouring the gel. 5. Sample running buffers (see Table 3).
214
Johnson and McVey
Table 1 Primer Sequences for the Detection of the Mutations in Factor XI Deficiency Types I–III Primer
Primer sequence, 5'→3'
I-f I-r II-f II-r III-f III-r
AGT GAC CAA CGA AGA GTG CCA TTG CAT ATA TTC CAT TGG CTA AGA GAA TCT GGA AGG TAC TCA TGT C ATC GAC CAC TCG AAT GTC CTG ACT TTA CTT TCT CTA GGT GCT GT ACA GTC TTG ATT GTG ATG TAT GAA
Product size
Digest with
132 bp
MaeIII
223 bp
BsmI
706 bp
Sau3AI
Table 2 Primer Sequences for the Amplification of the Exons of the FXI Gene Exon 1 2 3 4 5 6 7 8–10 11 12 13 14 15
Primer sequence, 5'→3' F = forward/R = reverse F: AGC AAT TCT CTC AAG G R: GCG GAA CAT CTC TAC AAA GC F: AGC TGT AAG AGT TGA ATG CC R: CAC ATG TGT GGA GAT TGC AG F: ACA TAA CGC ATG CCA TGT AC R: AAA AAT CTG TCT CCT CGA TG F: GCT TTC TGT GTG CTG ACT TT R: CAG CTG GTA TTT GTT GAT TC F: CCC CTA GAA TCT GGA AGG TA R: CGA TTC TGT TTT TCA TCG AC F: CTT AGC AAC ACT GCT GGG AC R: CGT GAG CAT AAG CTG GTA TC F: TCC TGA TAG CTG GTG AAT TG R: GAA GAT AAC AAA TTA TCC TTA CTT G F: CTG ACT TTA CTT TCT CTA GGT GC R: GTT CTC CCT TCT GTG GCT AT F: AAT GCT TCT GTT GCA GAG TG R: TTA TAA ATG TGT GAA GAA GAT GAA C F: GCC ACA CAC TTC ACA ATG TC R: GGT CAG GCC GTA AGT CTA GT F: AAA ATA CAC GAC AAC AAG GC R: TCT AGG ATG GAG CAC ATA TAA C F: ATG GTT ATT CTA CAA ACG AAC C R: CAA CAG AGC GAG ACT CTG TC F: TCT GAG TTG ATC TGT GCA CC R: TAC AAC GAT CAT AGA ACG GG
Product length (bp) 381 333 232 226 253 363 247 752 235 332 270 300 398
Factor XI Deficiency
215
Table 3 Sample Running Buffers Single-stranded buffer
Double-stranded buffer
Stock solution
800 µL 100 µL 100 µL 1 µL
800 µL 100 µL 100 µL —
— 10 mg/mL 10 mg/mL 10 M
80% Formamide 0.1% Bromophenol blue 0.1% Xylene cyanol 10 mM NaOH
6. Redivue [α-33P]dCTP, 10 mCi/ mL; 1000–3000 Ci/mMol (Amersham International). 7. Reagents as for PCR (see Subheading 2.2.).
2.4. Direct Sequencing 1. Microcon 100 columns (Amicon #42413). 2. Automated sequencing kit (e.g., Perkin Elmer ABI Prism Dye Terminator Cycle Sequencing Ready Reaction Kit (#402079 for 100 reactions). 3. Formamide stock: Formamide (10 mL), Amberlite MB-150 (0.75 g) (Sigma, #A5710). Mix for 10 min. Filter. Store at –20°C in 1-mL aliquots. 4. Dextran blue stock: 50 mM EDTA, pH 8.0, dextran blue (30 mg/ mL). 5. Formamide/EDTA/dextran blue: Mix formamide and dextran blue stocks in a ratio of 5:1.
3. Methods (see Note 2) 3.1. Isolation of Genomic DNA
3.1.1. Extraction of DNA from Whole Blood Timing: 3 d minimum. NB: Any blood should be treated as a high-risk sample. The following procedure should be performed in a Class II Containment Cabinet, and the operator should be well protected with laboratory coat, safety glasses, two pairs of gloves, and if possible apron and protective sleeves. Any spills should be cleared immediately; gloves should be changed regularly especially if contaminated. Day 1: 1. The EDTA blood sample should have been stored at –70°C before it is required. Thaw the sample on ice. 2. In a 50-mL tube mix: 10 mL whole blood sample with 40 mL lysis buffer. Leave on ice for 20 min. 3. Spin the sample 1000g at 4°C for 10 min. 4. Remove the supernatant into a fresh tube, cap, and discard. 5. Resuspend the pellet in 5 mL NaCl/EDTA. Use a plastic disposable pipet and as violently as possible resuspend the pellet. The pellet will remain virtually solid.
216
Johnson and McVey
6. In a 13-mL centrifuge tube, add 0.5 mL SDS/Proteinase K. 7. Transfer the blood pellet to the 13 mL tube. 8. Incubate at 37°C overnight.
Day 2: 9. Add: 500 µL 3 M NaOAc, pH 5.2, and 5 mL DNA phenol. Place tube on a rotating mixer and mix at room temperature for 20 min. 10. Spin at 1000g at room temperature for 20 min. 11. Remove and discard the lower layer with a pastette. This will be very thick and a dark brown color. It is easier to remove the interface first followed by the phenol layer, otherwise the aqueous layer containing the DNA tends to be drawn off instead. For the same reason, do not try to remove all of the lower layer. 12. To the remaining aqueous layer, add: 5 mL Phenol/Chloroform and mix at room temperature for 20 min. Spin at 1000g at room temperature for 20 min. 13. Remove and discard the lower layer. This should be a yellow color. 14. To the remaining aqueous layer add: 5 mL chloroform and mix at room temperature for 20 min. Spin at 1000g at room temperature for 20 min. 15. In a sterile 30-mL tube add: 11 mL 100% ethanol, 16. In a sterile microcentrifuge tube, add 200 µL sterile H2O. 17. Carefully transfer 5 mL of the upper aqueous layer from the centrifuge tube to the ethanol-containing tube. The solution tends to turn cloudy then clear as the SDS precipitates slightly. Roll the tube gently. Strands of DNA will slowly begin to appear! 18. Carefully pick up the DNA using a disposable sterile plastic inoculating loop. Dry the pellet slightly by tapping it gently on the side of the tube. 19. Transfer the DNA from the inoculating loop to the tube containing sterile water. 20. Leave the tube at 4°C overnight to several days to allow the DNA to dissolve. The length of time will depend on the amount of DNA extracted from the blood sample. 21. Check the OD260 of a 1:100 dilution of the DNA and determine the concentration (1OD260 = 50 µg/mL). Store the stock DNA at –20°C until required.
3.1.2. Extraction of Genomic DNA from Immortalized Lymphocytes Timing: 3 d minimum. Day 1: 1. Harvest approx 50 mL of media containing the immortalized lymphocytes. Spin the cells at 250g for 5 min at room temperature. Wash the cell pellet twice in PBS “A”; spin cells at 250g for 5 min, removing the supernatant between washes. 2. Resuspend the cell pellet in 5 mL lysing solution, remembering to add the proteinase K. Transfer to a 13-mL sterile centrifuge tube. 3. Incubate at 37°C overnight.
Day 2: 4. Add 500 µL 3 M NaOAc, pH 5.2, and 5 mL phenol chloroform.
Factor XI Deficiency 5. 6. 7. 8. 9. 10. 11. 12. 13. 14.
217
Rotate to mix for 20 min. Centrifuge at 1000g for 20 min at room temperature. To a 30-mL tube add: 11 mL 100% ethanol. To a sterile 1.5-mL microcentrifuge tube add: 200 µL sterile distilled water. Transfer 5 mL of the upper aqueous layer from the sample tube to the ethanol. Roll the tube gently. Strands of DNA should gradually appear. Pick up the DNA using a sterile plastic inoculating loop. Transfer the DNA from the loop to a sterile microfuge tube containing 200 µL H2O. Leave at 4°C for 2 d to allow the DNA to dissolve. Check OD260 to determine the DNA concentration (1OD260 = 50 µg/ mL). Store at –20°C.
3.2. Polymerase Chain Reaction (PCR) This is a very powerful method that can be used to rapidly amplify individual exons from genomic DNA.
3.2.1. PCR to Screen for Type I, II, and III Mutations (17) 1. (See Note 3) In a 500-µL microcentrifuge tube, add the following reagents: 2 µL of genomic DNA (150 ng/µL), 2 µL forward primer (150 ng/µL), 2 µL reverse primer (150 ng/ µL), 95 µl of 1X polymerase buffer, and X U of a thermostable DNA Polymerase enzyme according to the manufacturer’s instructions. 2. Add one or two drops of mineral oil to the top of each tube. Spin briefly before placing the tubes in the thermal cycler. 3. Amplification conditions: Type I FXI deficiency: 94°C for 4 min then 40 cycles of: 94°C for 30 s; 55°C for 15 s, and 72°C for 5 min followed by a final extension at 72°C for 10 min. Type II FXI deficiency: 94°C for 4 min then 40 cycles of: 94°C for 30 s; 60°C for 15 s, and 72°C for 5 min followed by a final extension at 72°C for 10 min. Type III FXI deficiency: 94°C for 4 min then 40 cycles of: 94°C for 30 s; 60°C for 15 s, and 72°C for 5 min followed by a final extension at 72°C for 10 min. 4. Run 10 µL of the PCR product on an agarose gel to check for efficient amplification. 5. Restriction enzyme digest. The appropriate 10X buffers should be provided by the manufacturers of the restriction enzymes. In a sterile microcentrifuge tube add: Type I mutation: 17 µL PCR product, 2 µL of 10X buffer and 1 µL (5–10 U) of MaeIII. Type I mutation I: 17 µL PCR product, 2 µL of 10X buffer and 1 µL (5–10 U) of BsmI 1. Type III mutation: : 17 µL PCR product, 2 µL of 10X buffer and 1 µL (5–10 U) of Sau3A I. In all cases, incubate at 37°C for 2 h. Check the products on a 2.5% agarose gel (see Table 4).
3.2.2. PCR of Exons for Direct Sequencing 1. (See Note 3) In a 500-µL microcentrifuge tube, add: 2 µL of genomic DNA (150 ng/µL), 2 µL of the forward primer (150 ng/µL), 2 µL of the reverse primer (150
218
Johnson and McVey
Table 4 Expected Product Sizes for FXI Mutations Types I–III Mutation PCR product size
Digest with
Digestion product sizes, bp Normal: 99 + 33 Type I: Uncut Normal: 113 + 110 Type II: Uncut Normal: 578 + 128 Type III: 328 + 251 + 128
Type I
132 bp
MaeIII
Type II
223 bp
BsmI
Type III
706 bp
Sau3AI
ng/µL), 95 µL of 1X polymerase buffer, and X units of a thermostable DNA polymerase enzyme according to the manufacturer’s instructions. 2. Add one or two drops of mineral oil to the top of each tube. Spin briefly before placing the tubes in the thermal cycler. 3. Amplification conditions: 94°C for 4 min then 30 cycles of: 94°C for 30 s; 57°C for 60 s, and 72°C for 1 min followed by a final extension at 72°C for 10 min. 4. Run 10 µL of the PCR product on an agarose gel to check for efficient amplification.
3.3. Single-Strand Conformational Polymorphism (SSCP) Analysis (see Note 4) Timing: Day 1: PCR overnight. Day 2: Check PCR, pour SSCP gel and leave to set (2 h), prepare samples (15 min), load and run gel (2–3 h), dry gel (40 min), autoradiograph overnight. 1. Amplify the test DNA as follows: In a 500-µL microcentrifuge tube, add: 1 µL of genomic DNA (150 ng/µL), 1 µL of the forward primer (150 ng/µL), 1 µL of the reverse primer (150 ng/µL), 45 µL of 1X polymerase buffer, 0.25 µL of [α33P]dCTP, and X units of a thermostable DNA Polymerase enzyme according to the manufacturer’s instructions. Add a drop of mineral oil to each tube to prevent evaporation of the samples. (Amplification conditions as described in Subheading 3.2.2.) 2. Run 10 µL of the PCR product on a 1–2% agarose gel to check for efficient amplification. 3. (See Note 5) Take 6 µL of the PCR product and add 6 µL of sample running buffer. Heat to 95°C for 5 min then cool on ice for 5 min. 4. Load 3 µL/lane onto the SSCP gel. 5. Run the gel in a cold room at 4°C at 40 W constant power. Depending on the size of the PCR fragment, it may be necessary to run a second set of samples approx 30 min after the first set. The gel will take 2–3 h to run. It should be stopped just as the bromophenol blue from the shorter runs has reached the bottom of the gel. 6. Dry the gel in a gel dryer (approx 30 min). 7. Autoradiograph the gel overnight, and then for longer if necessary.
Factor XI Deficiency
219
3.4. Direct Sequencing (see Note 6) This method is based on the Perkin Elmer ABI PRISM™ Dye Terminator Cycle Sequencing Ready Reaction Kit. For this method to give good results, both the PCR template and sequencing primer must be of a high quality. 1. PCR the region of interest (see Subheading 3.2.). 2. Run 10 µL of the PCR product on a 1–2% agarose gel to check for efficient amplification. 3. Pool PCR reactions from the same sample as necessary. Make up volume to 500 µL with sterile distilled H2O. 4. Add sample to the top of a Microcon 100 column placed in the microfuge tube supplied with the column. 5. Spin at 500g, for 10–15 min, until all but 10 µL of the fluid has passed through the column. 6. Invert the column into a clean tube. Spin at 1000g for 2 min to collect the sample at the bottom of the tube. 7. Increase the volume to 350 µL with sterile distilled H2O. Check OD260 and determine the DNA concentration. 8. Prepare the sequencing reaction as described in the manual supplied with the kit: In a total volume of 20 µL combine DNA 100 ng, sequencing primer 40 ng and premix 8 µL. 9. (See Note 7.) The sequencing reaction is carried out in a thermal cycler and comprises 25 cycles of: 96°C for 30 s and 50°C for 15 s, followed by a single incubation at 60°C for 4 min. 10. Precipitate the sequenced product: Transfer the 20 µL product to a clean tube and add 3 µL tRNA (10 mg/mL), 80 µL H2O, 10 µL 3 M NaOAc, pH 5.2, and 250 µL EtOH. 11. Leave on ice for no more than 10 min. 12. Spin at 16,000g for 15 min. 13. Remove and discard the supernatant. 14. Add 500 µL 70% EtOH. Spin for 5 min. Remove supernatant. 15. Dry the pellet. 16. Resuspend the pellet in 4 µL formamide/EDTA/dextran blue. 17. Heat sample to 90°C, for 2 min to denature. 18. Place on ice until ready to load.
4. Notes 1. All reagents should be made with sterile distilled water and sterilized by filtration or autoclaving unless otherwise stated. 2. All methods described are those used routinely in the authors laboratory, because they consistently give good results. It should be noted, however, that there are a number of commercially available kits that could alternatively be used. 3. PCR: there are many suppliers of thermal stable polymerases and of thermal cyclers. The conditions described here have been used successfully in the authors’ laboratory using Red Hot DNA polymerase (Advanced Biotechnologies) and a
220
4.
5.
6.
7.
Johnson and McVey Biometral Trio Block thermal cycler. Conditions may vary slightly depending on the source of the polymerase and thermal cycler. Remember to include at least one tube with no added genomic DNA to control for contamination. PCR for SSCP: Where several samples are to be examined, it is easier to make up a “Master Mix” containing buffer, oligonucleotides, enzyme and isotope. Only one pipeting step is then needed, reducing the risk of possible contamination. Remember to include two controls: (a) A “no DNA control”: if an amplified band is obtained in this sample, cross-contamination will have occurred, and these samples should NOT be used in the SSCP. (b) A “Normal control”: The patient samples are compared to this control. SSCP samples: At least one sample of nondenatured normal sample should be prepared, so that the running position of the double stranded PCR fragment can be determined. When the samples are denatured, there will still be some doublestranded material in the sample. Occasionally, a shift can be detected in this, when there is no obvious shift in any of the bands representing the single-stranded material. There are many different polyacrylamide gel apparatus on the market, we have used a 40 cm BRL S2 sequencing gel electrophoresis system. Past experience has shown us that it is better to set up 2 or 3 PCR reactions for the same patient; this will generate sufficient quantities of the DNA required, which can then be purified by the method of choice. The method that we have found to be most successful is the use of Microcon 100 columns. Direct sequencing: The annealing temperature can be altered depending on the Tm of the primer used.
References 1. Thompson, R. E., Mandle, R. Jr., and Kaplan, A. P. (1977) Association of factor XI and high molecular weight kininogen in human plasma. J. Clin. Invest. 60, 1376–1380. 2. Tuddenham, E. G. D. and Cooper, D. N. (1994) The molecular genetics of haemostasis and its inherited disorders. Oxford University Press, Cambridge, UK, pp. 212–220. 3. McMullen, B. A., Fujikawa, K., and Davie, E. W. (1991) Location of the disulphide bonds in human coagulation factor XI: the presence of tandem apple domains. Biochemistry 30, 2056–2060. 4. Meijers, J. C. M., Mulvihill, E. R., Davie, E. W., and Chung, D. W.,(1992) Apple four in human blood coagulation factor XI mediates dimer formation. Biochemistry 31, 4680–4684. 5. Baglia, F. A., Sinha, D., and Walsh, P. N. (1989) Functional domains in the heavy chain region of factor XI: a high molecular weight kininogen-binding site and a substrate-binding site for factor XI. Blood 74, 244–251. 6. Baglia, F. A., Jameson, B. A., and Walsh, P. N. (1990) Localization of the high molecular weight kininogen binding site in the heavy chain of human factor XI to amino acids Phe56 through Ser86. J. Biol. Chem. 265, 4149–4154. 7. Baglia, F. A., Jameson, B. A., and Walsh, P. N. (1992) Fine mapping of the high molecular weight kininogen binding site on blood coagulation factor XI through the use of rationally designed synthetic analogs. J. Biol. Chem. 267, 4247–4252.
Factor XI Deficiency
221
8. Baglia, F. A., Jameson, B. A., and Walsh, P. N. (1991) Identification and chemical synthesis of a substrate binding site for factor IX on coagulation factor XIa. J. Biol. Chem. 266, 24,190–24,197. 9. Asakai, R., Davie, E. W., and Chung, D. W. (1987) Organization of the gene for human factor XI. Biochemistry 26, 7221–7228. 10. Kato, A., Asakai, R., Davie, E. W., and Aoki, N., (1989) Factor XI gene (F11) is located on the distal end of the long arm of human chromosome 4. Cytogenet. Cell Genet. 52, 77–78. 11. Rosenthal, R. L., Dreskin, O. H., and Rosenthal, N. (1953); New haemophilialike disease caused by deficiency of a third plasma thromboplastin factor. Proc. Soc. Exp. Biol. Med. 82, 171–174. 12. Rosenthal, R. L., Dreskin, O. H., and Rosenthal N. (1955) Plasma thromboplastin antecedent (PTA) deficiency; clinical, coagulation, therapeutic and hereditary aspects of a new haemophilia-like disease. Blood 10, 120–131. 13. Asakai, R., Chung, D. W., Davie, E. W., and Seligsohn, U. (1991) Factor XI deficiency in Ashkenazi Jews in Israel. New. Engl. J. Med. 325, 153–158. 14. Asakai, R., Chung, D. W., Ratnoff, O. D., and Davie, E. W. (1989) Factor XI (plasma thromboplastin antecedent) deficiency in Ashkenazi Jews is a bleeding disorder that can result from three types of point mutations. PNAS 86, 7667–7671. 15. Imanaka, Y., Lal, K., Nishimura, T., Bolton-Maggs, P. H. B., Tuddenham, E. G. D., and McVey, J. H. (1995) Identification of two novel mutations in non-Jewish factor XI deficiency. Br. J. Haematol. 90, 916–920. 16. Pugh, R. E., McVey, J. H., Tuddenham, E. G. D., and Hancock, J. F. (1995) Six point mutations that cause factor XI deficiency. Blood 85, 1509–1516. 17. Hancock, J. F., Wieland, K., Pugh, R. E., Martinowitz, U., Schulman, S., Kakkar, V. V., Kernoff, P. B. A., and Cooper, D. N. (1991) A molecular genetic study of factor XI deficiency. Blood 77, 1942–1948. 18. Saito, H., Ratnoff, O., Bouma, B. N., and Seligsohn, U. (1985) Failure to detect variant(CRM)+ plasma thromboplastin antecedent (Factor XI) molecules in hereditary PTA deficiency: A study of 125 patients of several ethnic backgrounds. J. Lab. Clin. Med. 106, 718–721. 19. Ragni, M. V., Sinha, D., Seaman, F., Lewis, J. H., Spero, J. A., and Walsh, P. N. (1985) Comparison of bleeding tendency, factor XI coagulant activity, and factor XI antigen in 25 factor XI-deficient kindreds. Blood 65, 719–725. 20. Mannhalter, C., Hellstern, P., and Deutsch, E., (1987) Identification of a defective factor XI cross-reacting material in a factor XI deficient patient. Blood 70, 31–37.
Antithrombin Deficiency
223
22 Mutational Analysis in Antithrombin Deficiency David J. Perry 1. Introduction Human antithrombin is a single-chain glycoprotein of MW 58 kDa and the most important plasma inhibitor of the coagulation serine proteases. It is a member of the serine protease inhibitor (SERPIN) family of proteins and in common with several other members of this family, its inhibitory activity is increased many thousand-fold in the presence of heparin and other sulphated glycosaminoglycans. Type I antithrombin deficiency, i.e., a 50% reduction in the total amount of plasma antithrombin is estimated to affect approx 1 in 4200 of the general population, whereas Type II deficiency–characterized by the presence of a dysfunctional protein in the plasma of affected individuals, which may be present in normal or reduced amounts–may affect as many as 1 in 600. Approximately 4–6% of individuals with thromboembolic disease will have antithrombin deficiency. A deficiency of antithrombin or a functional abnormality is a recognized cause of recurrent thromboembolic disease, although the risk is dependent upon the precise molecular abnormality. Individuals with Type I antithrombin deficiency or with mutations affecting the reactive site of the molecule or with multiple (pleiotropic) functional abnormalities are at high risk of venous thromboembolic disease, while those with mutations affecting the heparin binding domain are at relatively low risk from thrombosis. The first antithrombin mutations were identified by means of protein sequencing, but as with many areas of mutation analysis, the development of the polymerase chain reaction has revolutionized the characterization of antithrombin mutation. There are several reviews in the literature on antithrombin and its deficiency states that provide a starting point for further reading (1,2). In addition, a database of antithrombin mutations has been published (3). From: Methods in Molecular Medicine, Vol. 31: Hemostasis and Thrombosis Protocols Edited by: D. J. Perry and K. J. Pasi © Humana Press Inc., Totowa, NJ
223
224
Perry
2. Materials 2.1. Enzymatic Amplification of the Antithrombin Gene 1. Oligonucleotide primers (see Table 1) at 50 pmols/µL. Downstream amplification primers are biotinylated at their 5' end to allow rapid purification for solid phase sequencing. 2. Genomic DNA (see Note 1). 100–500 ng of DNA are required for each amplification reaction. 3. 20 mM dNTPs. 100 mM stock solutions of each of the 4 dNTPs (dATP, dCTP, dGTP, and dTTP) are available for many manufacturers, e.g., Pharmacia 4. 10X PCR buffer: PCR buffers ± magnesium are commonly supplied with the thermostable DNA polymerase. The buffer used with “Amplitaq” comprises: 15 mM MgCl2, 500 mM KCl, 100 mM Tris-HCl pH 8.4, and 1% Triton X-100. 5. 25 mM MgCl2. If not included in the PCR buffer. 6. Sterile water. 7. Thermostable DNA polymerase, e.g., Amplitaq at 5 U/µL. 8. 1.5% agarose gel containing ethidium bromide 0.5 µg/mL in 1X Tris-BorateEDTA (TBE).
2.2. Purification of Biotinylated PCR Products and Preparation of Single-Stranded DNA Template 1. Biotinylated PCR product. 2. 1X/2X Binding and washing buffer (BWB): 2X BWB 10 mM Tris-HCl, pH 7.5, 1 mM EDTA, 2 M NaCl. 3. TE pH 8.0: 10 mM Tris-HCl, pH 8.0, 1 mM EDTA. 4. Streptavidin-coated magnetic beads, e.g.,Dynal. 5. Magnetic separation unit, e.g., Dynal MPC® magnet. 6. Sterile water. 7. 0.1 M NaOH: Freshly prepared immediately before use.
2.3. Solid-Phase Sequencing of Single-Stranded DNA Sequencing of PCR products is based on Sequenase v2 (modified T7 DNA polymerase) and the reagents contained within the kit. 1. 2. 3. 4. 5. 6. 7.
Single-stranded DNA (see Subheading 2.2.). 10–20 pmoles of a “nested” sequencing primer (see Table 1). 5X reaction buffer: 200 mM Tris-HCl, pH 7.5, 100 mM MgCl2, 250 mM NaCl. 0.1 M DTT. [α-35S]-dATP 1000–1500 Ci/mmol, e.g., Amersham. Sequenase v2.0 14 U/µL. Store at –20°C (see Note 2). Enzyme dilution buffer: 100 mM Tris-HCl, pH 7.5, 5 mM DTT, 0.5 mg/mL bovine serum albumin. Store at –20°C. Thaw before use and keep on ice. 8. dGTP labeling mix: 5X 7.5 µM dGTP, 7.5 µM dCTP, 7.5 µM dTTP diluted “1 + 5” in distilled water prior to use (see Note 3). 9. ddA, ddC, ddG, and ddT termination mixes (see Note 4).
Antithrombin Deficiency
Table 1 Oligonucleotide and PCR Data for Amplification of the Human Antithrombin Gene
3
Oligonucleotide
Sequence data (5'–3')
Amplification parametersa Fragment size
Exon 1b Upstream amplification primer Downstream amplification primer
GAACCTCTGCGAGATTTAGA GGACTCACAGGAATGACCTCCAA
Annealing: 62°C/1 s Extension: 74°C/30 se Denaturation: 94°C/5 s 35 Cycles
CCAGGTGGGCTGGAATCCTCTGCTTT CTTGGGCCTATGGAAGGCCCAAAGGT GGGTTGCATCCTAGCTTAAC CCATCAGTTGCTGGAGGGTGTCATTAC
Annealing: 62°C/1 s Extension: 74°C/30 s Denaturation: 94°C/5 s 35 Cycles
535 bp
GACTGACCAGCATGTGCTCACCACCC GTAAGCTGAAGAGCAAGAGGAAGTCC TAACTAGGCAGCCCACCAAA TGGGGCTCTCAGGGCCGTTCTGAGTAC
Annealing: 60°C/1 s Extension: 74°C/30 s Denaturation: 94°C/5 s 35 Cycles
1433 bp
GACTGACCAGCATGTGCTCACCACCC CAGTGTGAATTTGGATGCTGTTTCTC TAACTAGGCAGCCCACCAAA CACCTCCTCAATCTCTGAGT
Annealing: 60°C/1 s Extension: 74°C/5 s Denaturation: 94°C/5 s 35 Cycles
385 bp
GCTGCCTGGGAAAATGGAGAAGCCAA GTAAGCTGAAGAGCAAGAGGAAGTCC TTGAATAGCACAGGTGAGTA TGGGGCTCTCAGGGCCGTTCTGAGTAC
Annealing: 60°C/1 s Extension: 74°C/5 s Denaturation: 94°C/5 s 35 Cycles
262 bp
225
Exon 2 Upstream amplification primer Downstream amplification primer Forward sequencing primer Reverse sequencing primer Exon 3c Upstream amplification primer Downstream amplification primer Forward sequencing primer Reverse sequencing primer Exon 3a Upstream amplification primer Downstream amplification primer Forward sequencing primer Reverse sequencing primer Exon 3b Upstream amplification primer Downstream amplification primer Forward sequencing primer Reverse sequencing primer
218 bp
(continued)
226
Table 1 (Continued) Oligonucleotide
4
Exon 4 Upstream amplification primer Downstream amplification primer Forward sequencing primer Reverse sequencing primer Exon 5 Upstream amplification primer Downstream amplification primer Forward sequencing primer Reverse sequencing primer Exon 6 Upstream amplification primer Downstream amplification primer Forward sequencing primer Reverse sequencing primer
Sequence data (5'–3')
Amplification parametersa Fragment size
GGATATGTCTGTGTCAATAACTATCC CTTTTGGTCAGACTACCTTGCGGGTG ATGAATGTTTGTGTTCTTAC GAGAAGGGAGGAAACTCCTT
Annealing: 60°C/1 s Extension: 74°C/35 s Denaturation: 94°C/5 s 35 Cycles
515 bp
GAATTCCCATCTGTGGATTGAAGCCA TGCATGCCTTAACACTGGAAACAGGC TCTCCCATCTCACAAAGACT TGCATGCCTTAACACTGGAAACAGGC
Annealing: 60°C/1 s Extension: 74°C/5 s Denaturation: 94°C/5 s 35 Cycles
230 bp
AAGCATTGAGGAATTGCTGTGTCTGT TTACTTCTGTTCACAAACCAAAAATA CTGCAGGTAAATGAAGAAGGCAGTGA TTACTTCTGTTCACAAACCAAAAATA
Annealing: 60°C/1 s Extension: 74°C/5 s Denaturation: 94°C/5 s 35 Cycles
356 bp
a Times
represent the time for which the samples remain at a particular temperature. primers are used as sequencing primer. c Exon 3 is amplified with the upstream primer of Exon 3a and the downstream primer of Exon 3b. bAmplification
Perry
Antithrombin Deficiency
227
10. Microtiter sequencing trays, e.g., Pharmacia. 11. Stop solution: 95% (v/v) formamide, 20 mM EDTA, pH 8.0, 0.05% (w/v) bromophenol blue, 0.05% (w/v) xylene cyanol. 12. 40% Premixed acrylamide/bisacrylamide in a ratio of 19:1 (available from many manufacturers). 13. Sequencing grade urea. 14. 25% Ammonium persulfate freshly prepared. 15. N,N,N',N'-tetramethylethylenediamine (TEMED). 16. 10X Tris-Borate-EDTA. 17. Sequencing plates (40–50 cm × 20 cm). 18. 0.2–0.4-mm spacers. 19. Silanizing solution, e.g., dimethylchlorosilane. 20. 2 L of 5% methanol (v/v) 5% acetic acid (v/v) in water. 21. Whatman 3MM chromatography paper. 22. SaranWrap™. 23. Autoradiograph film, e.g., Kodak. 24. Power supply unit and sequencing apparatus, e.g., Bio-Rad.
3. Methods 3.1. Enzymatic Amplification of the Antithrombin Gene 1. Amplification reactions are carried out in 100 µL volumes and comprise: 10 µL 10X PCR buffer, 6 µL 25 mM MgCl2 (final concentration of Mg 1.5 mM; see Note 5), 1 µL 20 mM dNTPs (final concentration 200 µM), 100–500 ng DNA, 2 µL amplification primers (100 pmoles of each primer) and water to 100 µL. Add 2 U of Amplitaq to each tube (0.4 µL) and overlay with 100 µL of mineral oil. 2. Place the samples in a programable heating block and denature at 94°C for 5 min and then carry out the amplification reaction using the parameters shown in Table 1. 3. At the end of the amplification reaction, remove the mineral oil and run 5–10 µL of the PCR product in a 1.5% agarose gel containing ethidium bromide 0.5 µg/mL in 1X TBE to check the efficiency and specificity of the reaction.
3.2. Purification of Biotinylated PCR Products and Preparation of Single-Stranded DNA Template 1. Resuspend the magnetic beads by vortexing, remove 20 µL into a 1.5-mL Eppendorf and place in the magnetic separation unit for 30 s. Scale up the volumes depending on how many templates are to be prepared. 2. Carefully remove the supernatant and add 50 µL of 1X BWB to the beads. Vortex for 2–3 s to mix and then place in the magnet for 30 s. Remove the supernatant and add 50 µL of 2X BWB. Vortex briefly to mix. 3. Add the resuspended beads to 50 µL of the PCR reaction and place on an orbital rotator for 15–20 min at room temperature. 4. Place the Eppendorf in the magnet for 30 s and remove the supernatant. 5. Add 10 µL of freshly made 0.1 M NaOH and vortex briefly to mix, then leave on the bench for 15 min without shaking.
228
Perry
6. Place the Eppendorf in the magnet for 30 s, remove the supernatant and transfer to a clean tube. 7. Add 100 µL of 0.1 M NaOH to the beads, vortex briefly, place in the magnetic separation unit for 30 s. 8. Add 100 µL of 1X BWB to the beads. Vortex briefly to mix and then place the Eppendorf in the magnet for 30 s. Carefully remove the supernatant and discard. 9. Repeat the step 8 but using 100 µL of TE, pH 8.0. 10. Finally resuspend the beads in 20 µL of sterile water. Store at 4° C. Do not freeze. Use 4–7µL for each sequencing reaction.
3.3. Solid-Phase Sequencing of Single-Stranded DNA 1. Mix 4–7 µL of the single-stranded DNA template, 2 µL of 5X reaction buffer, 1 µL (5–10 pmoles) of the sequencing primer and distilled water to 10 µL. 2. Heat to 60°C for 5 min and then cool to 30°C at 2°C/min to allow the primer to anneal to the template DNA. Briefly spin in a microcentrifuge to pellet any condensation and place on ice. 3. Aliquot 2.5 µL of each termination-reaction mix into a microtitre sequencing tray and store at 4°C until required. Pre-warm at 37°C for 5 min before use. 4. Prepare a “Master Mix” on ice for the number of templates to be sequenced and store on ice. The master mix comprises for 1 reaction: 1 µL 0.1 M DTT, 0.5 µL [α-35S]-dATP, 2 µL diluted dGTP labeling mix, and 2 µL of Sequenase v2 diluted “1 + 7” in ice-cold dilution buffer. 5. Add 5.5 µL of the master mix to each of the annealed template-primers on ice. Incubate at room temperature for 3–5 min. 6. Add 3.5 µL from step 3 to each of the termination mixes and place at 37°C for 5 min. 7. Add 4 µL of the formamide-dye stop mix to each well. 8. Denature the samples at 95°C for 3–5 min and then place on ice. Load 2–4 µL of each reaction from ice into the wells of a 6% denaturing polyacrylamide gel. Load lanes 1 and 2 with the same reaction to allow subsequent orientation of the gel. Electrophorese at 35 W constant power until the bromophenol dye has reached the end of the gel (or longer to obtain sequence data far from the sequencing primer). 9. Separate the gel plates, fix the gel in 2 L of fixing solution for 30 min and then transfer the gel to 3MM paper, cover with SaranWrap™ and dry under vacuum at 80°C. 10. Autoradiograph overnight.
4. Notes 1. DNA can be isolated from peripheral blood leukocytes using a wide variety of methods. 2. Do not remove Sequenase from the freezer; aliquots should be removed as required directly into the pre-chilled sequencing master mix. 3. The precise dilution varies upon how close to, or how far from the sequencing primer sequence data is required. To read close to the primer increase the dilution, e.g., 1 + 9 or 1 + 14, 1 + 19. To read further from the primer, use the labeling mix undiluted.
Antithrombin Deficiency
229
4. The termination mixes are supplied with kit and contain each deoxynucleotide at a concentration of 80 µM and each dideoxynucleotide (which terminates the extension reaction) at a concentration of 8 µM. There is, therefore a 1 in 10 chance of incorporating a dideoxynucleotide nucleotide and terminating the extension reaction. The termination mixes comprise: ddA: 80 µM dGTP, 80 µM dATP, 80 µM dCTP, 80 µM dTTP, 8 µM ddATP, 50 mM NaCl. ddC: 80 µM dGTP, 80 µM dATP, 80 µM dCTP, 80 µM dTTP, 8 µM ddCTP, 50 mM NaCl. ddG: 80 µM dGTP, 80 µM dATP, 80 µM dCTP, 80 µM dTTP, 8 µM ddGTP, 50 mM NaCl ddT 80 µM dGTP, 80 µM dATP, 80 µM dCTP, 80 µM dTTP, 8 µM ddTTP, 50 mM NaCl. 5. The concentration of Mg in the PCR reaction may vary and titration may be necessary to find the optimal concentration for a particular set of primers and template. In practise a final concentration of 1.5 mM Mg will amplify the majority of templates.
References 1. Perry, D. J. (1994) Antithrombin and its inherited deficiencies. Blood Rev. 8, 37–55. 2. Perry, D. J. and Carrell, R. W. (1996) Molecular genetics of human antithrombin deficiency. Human Mutation 7, 7–22. 3. Lane, D. A., Olds, R. J., Boisclair, V., Chowdhury, V., Thein, S. L., Cooper, D. N., Blajchman, M., Perry, D. J., Emmerich, J., and Aiach, M. (1993) Antithrombin III mutation database: first update. Thromb. Haemostasis 70(2), 361–369.
Ectopic Transcript Analysis
231
23 Ectopic Transcript Analysis in Human Antithrombin Deficiency David J. Perry 1. Introduction A number of reports have demonstrated that it is possible to identify correctly spliced low-level transcripts for tissue-specific genes in a number of non-specific tissues (1–3). The number of transcripts is low (approx 1 copy every 500–1000 cells) (2), but as they are initiated at the normal mRNA start site this suggests that the normal promoters are used. Although ectopic transcript analysis has been used primarily in the study of large and complex genes, e.g., factor VIII, or for the study of splice-site mutations, the relative ease with which the technique can be adapted to the study of a variety of smaller genes and their mutations makes its use attractive for the study of a variety of inherited disorders. A limitation of the described method is that it will not detect mutations in the 3' and 5' untranslated regions of the gene and these areas will require analysis by conventional DNA-based techniques. The methods described in this chapter are used to identify ectopic transcripts of the human antithrombin gene, a gene normally expressed only in the liver. These transcripts can then be screened for mutations by a variety of techniques, cloned, or directly sequenced. The technique is, however, applicable to the study of many other genes, the only changes required are in the sequences of the oligonucleotide primers. To achieve maximum amplification, the technique requires two pairs of nested amplification primers although the primers may overlap. This may be useful when the amount of sequence data that is available is limited. Because the of small amount of the starting template and the two rounds of PCR, the technique is extremely sensitive to any contamination and it is vital to include appropriate negative controls. Similarly, it is wise to avoid clones or libraries that From: Methods in Molecular Medicine, Vol. 31: Hemostasis and Thrombosis Protocols Edited by: D. J. Perry and K. J. Pasi © Humana Press Inc., Totowa, NJ
231
232
Perry
contain the sequence of interest from areas of the laboratory that are be used to make up the amplification reactions, to use only dedicated reagents and pipets and aerosol resistant pipet tips. In addition, in the early parts of the procedure that employ RNA, it is vital to avoid contamination with RNases. 2. Materials 2.1. Isolation of Mononuclear Cells from Peripheral Blood 1. 3.5% Trisodium citrate. 2. Histopaque 1077 (Sigma). 3. PBS: Phosphate-buffered saline.
2.2. Isolation of Total Cellular RNA A number of methods are available for the isolation of total cellular RNA from peripheral blood mononuclear cells. Great success has been achieved using the method of Chomczynski et al. (4), but there are now a number of commercially available kits which considerably simplify the isolation of RNA, e.g., the RNeasy™ kit (Qiagen Ltd. UK). 2.3. Reverse Transcription and Amplification 1. Total cellular RNA: 150–500 ng. 2. 20 mM dNTPs; Prepared from 100 mM stocks and kept exclusively for reverse transcription work. 3. 10X PCR buffer: 100 mM Tris-HCl, pH 8.3 and 500 mM KCl. 4. 25 mM MgCl2. 5. DEPC-treated water (see Note 1). 6. RNAsin: 20 U/µL (Promega Biotechnology, Southampton, UK). 7. AMV reverse transcriptase, e.g., Super RT® HT Biotechnology, Cambridge. 8. Downstream amplification primer at 50 pmoles/µL (see Note 2). 9. Sterile, aerosol resistant pipette tips, e.g., ART® (Molecular Bio-Products Inc., San Diego, CA).
3. Methods 3.1. Isolation of Mononuclear Cells from Peripheral Blood 1. Collect blood into 3.8% trisodium citrate in a ratio of 1 part anticoagulant to nine parts blood. 2. Dilute 10 mL of whole blood with an equal column of PBS and carefully layer onto 10 mL of histopaque 1077 in a 30-mL sterile conical tube. 3. Centrifuge at 2000g for 10 min at 20°C and then carefully remove the tubes from the centrifuge without disturbing the cellular interface. The interface should be clearly visible. 4. Carefully collect the interface, which comprises the mononuclear fraction, using a 5-mL Pasteur pipet. Transfer to a clean 30-mL tube.
Ectopic Transcript Analysis
233
5. Make up to 30 mL with ice-cold PBS. Mix briefly and spin at 2000g for 10 min at 20°C. 6. Carefully pour off the supernatant. Store the pellet on ice if RNA isolation is to be carried out immediately. Alternatively snap freeze and store at –80°C until required.
3.2. Isolation of Total Cellular RNA Depending on which method is used to isolate RNA, the final volume may vary. With the method of Chomczynski et al., the total cellular RNA pellet is resuspended in 200 µL of DEPC-treated water containing 20 U of an RNA inhibitor, RNAsin. For long-term storage, RNA samples are precipitated with ethanol and stored at –70°C. If RNA is isolated using the RNeasy Kit, the RNA is eluted into a final volume of 50 µL.
3.3. Reverse Transcription and Amplification Nested oligonucleotide primers are designed to amplify the whole of the antithrombin cDNA in two overlapping fragments (see Fig. 1, Table 1). For each reverse transcription reaction mix the final volume should be 20 µL. The reaction volumes should, therefore, be calculated before setting up the reactions. 1. Prepare a “Master Mix” comprising appropriate volumes of 20 mM dNTPs, 10X PCR buffer and 25 mM MgCl2 on ice. UV irradiate (254 nm) for 10 min to eliminate any contaminating DNA. For a single reverse transcription reaction the volumes are: 4 µL 25 mM MgCl2, 1 µL 20 mM dNTPs, and 2 µL 10X PCR buffer. 2. Mix 100–500 ng of total cellular with 50 pmoles of the appropriate downstream amplification primer (AT2 or AT4: see Fig. 1, Table 1), 7 µL of the UV-irradiated master mix on ice and DEPC-treated sterile water to 18 µL. 3. Incubate at 65°C for 10 min, place on ice and add 1 µL (20 U) of RNAsin and 20 U of AMV reverse transcriptase. 4. Incubate at 20°C for 10 min, 37°C for 60 min, and then terminate the reaction by heating to 95°C for 10 min. Store sample on ice until required or frozen at –30°C. 5. A positive control should be included in the reverse transcription reaction (see Note 3). 6. To each 20 µL reverse transcription reaction, add an 80 µL reaction mix comprising: 8 µL 10X PCR buffer, 2 µL 25 mM MgCl2, 1 µL 20 mM dNTPs, 100 pmoles of each of the first pair of amplification primers (pairs AT1 + AT2 or AT3 + AT4: Fig. 1, Table 1) and sterile water to 80 µL. 7. Incubate at 100°C for 5 min and then allow to cool to 30°C for 2 min to allow the primers to anneal. 8. Add 2.5 U (0.5 µL) of Thermus aquaticus. DNA polymerase (“Amplitaq”) to each tube and overlay the samples with 100 µL of mineral oil. 9. Incubate the samples at 70°C for 10 min followed by 40 cycles of PCR comprising 94°C for 20 s, 50°C for 20 s, and 72°C for 60 s using a programmable heating block. On the last cycle the extension time should be increased to 10 min.
234
Perry
Fig. 1. Schematic representation of the antithrombin cDNA showing the position and orientation of the amplification primers. 10. After the first PCR is completed, run 10 µL of each amplification on a 1.5% agarose gel in 1X Tris-Borate-EDTA (TBE) containing ethidium bromide (0.5 µg/mL) to check the efficiency and specificity of the reaction. It is probable that only the GAP-DH positive controls will amplify (see Fig. 2). 11. If the amplification reaction is satisfactory, add 1 µL of the PCR reaction to a 98.5 µL mix comprising 10 µL 10X PCR buffer, 6 µL 25 mM MgCl2, 100 pmoles of each of the second set of amplification primers (pairs AT5 + AT6 or AT7 + AT8: Fig. 1, Table 1; see Note 4), 1 µL 20 mM dNTPs and water to 98.5 µL. We do not use a positive control at this step but a negative control, i.e., a water blank must be included in the amplification reaction. 12. Denature the DNA by heating to 100°C for 5 min and then cool to 94°C. Briefly spin to pellet any condensation and return to the PCR block. 13. Add 2.5 U of Amplitaq to each tube, overlay the samples with 100 µL of mineral oil and carry out 40 cycles of amplification using an identical programme to that used for the first round of PCR. 14. Following the second round of amplification run 7–10 µL of each amplification reaction on a 1.5% agarose gel containing ethidium bromide 0.5 µg/mL in 1X TBE to check the efficiency and specificity of the reaction (see Fig. 2).
4. Notes 1. To make DEPC-treated water add 1 mL of DEPC to 1 L of distilled water. Incubate at 37°C overnight and then autoclave. Store at room temperature.
Primers
235
AT cDNA I PCR–1 AT1 AT2c AT cDNA II PCR–1 AT3 AT4c AT cDNA I PCR–2 AT5 AT6 AT cDNA II PCR-2 AT7 AT8 GAP-DH cDNA PCR–1 GAP-1 GAP-2b
Orientation
Primer sequences (5'→3')
Forward primer Reverse primer
TTCAGGCGGATTGCCTCAGATCACAC AAGTAAATGGTGTTAACCAG
Forward primer Reverse primer
ACCGAAGGCCGAATCACCGAT AATGTGAGATGGAAGTAGTT
Forward primer Reverse primer
CAGCCCTGTGGAAGATTAGC Biotin-TGTTAACCAGCACCAGAACA
Forward primer Reverse primer
ACCGATGTCATTCCCTCG Biotin-TTACTTCTGTTCACAAACCAAAAATA
Forward primer Reverse primer
ATGGGGATGGTGAAGGTCGGTGTCAA GGGGCCATCCACAGTCTTCTGGGTGG
Ectopic Transcript Analysis
Table 1 Primer Sequences for Reverse Transcription and Amplification of the Antithrombin/GAP-DH cDNAsa
Sequence positionb Product length
541–566 7078–7097
822 bp
7015–7035 14,016–14,035
804 bp
581–600 7068–7087
772 bp
7030–7047 13,979–1400
758 bp
316–341 3091–3116
540 bp
aThe
antithrombin cDNA is amplified in two overlapping fragments. start site = +1. cAlso used as the reverse transcription primer. bmRNA
235
236
Perry
Fig. 2. 1% agarose gel showing the antithrombin cDNA and glyceraldehyde-3-phosphate dehydrogenase cDNA amplification products. Lanes 1–3 are amplifications of a normal control RNA, lanes 4–6 represent the amplified cDNA derived from a patient with a 6 bp deletion (codons 76/77) of exon 2 of the antithrombin gene and lanes 7–9 the amplified cDNA from a patient with a dysfunctional antithrombin variant (Ile284Asn). Lanes 1, 4, and 7 are positive controls (part of the GAP-DH cDNA); lanes 2, 5, and 8 are amplifications of the antithrombin cDNA I and lanes 3, 6, and 9 are amplifications of the antithrombin cDNA II. PCR-1 represents the amplification products after the first round of PCR and PCR-2, the products after the second round of PCR using a separate set of nested primers. M; 1-kb ladder.
2. Reverse transcription of RNA using the downstream amplification primer used subsequently for the PCR is routinely used and generates excellent results for a wide variety of templates. However, Oligo(dT)15–17 (50 pmoles) can also be used with similar results. 3. A positive control for the RNA isolation, reverse transcription and amplification reactions should be included. The glyceraldehyde-3-phosphate dehydrogenase (GAP-DH) gene, a common housekeeping gene is frequently used. Oligonucleotides are designed to amplify a 540-bp fragment of the GAP-DH cDNA spanning 6 introns and representing approx 2.8-kb of genomic sequence (5). The downstream primer is used to prime the reverse transcription reaction (see Table 1). 4. Primers AT6 and AT8 can biotinylated at their 5' ends to allow the subsequent generation of high-quality single-stranded DNA suitable for sequencing.
References 1. Chelly, J., Concordet, J. P., Kaplan, J. C., and Kahn, A. (1989) Illegitimate transcription: transcription of any gene in any cell type. Proc. Natl. Acad. Sci. USA 86, 2617–21.
Ectopic Transcript Analysis
237
2. Kaplan, J. C., Kahn, A., and Chelly, J. (1992) Illegitimate transcription: its use in the study of inherited disease. Human Mutation 1, 357–360. 3. Sarkar, G. and Sommer, S. S. (1989) Access to a messenger RNA sequence or its protein product is not limited by tissue or species specificity. Science 244, 331–334. 4. Chomczynski, P. and Sacchi, N. (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162, 156–159. 5. Ercolani, L., Florence, B., Denaro, M., and Alexander, M. (1988) Isolation and complete sequence of a functional human glyceraldehyde-3-phosphate dehydrogenase gene. J. Biologic. Chem. 263, 15,335–15,341.
Human Protein C Gene
239
24 Mutational Analysis of the Human Protein C Gene Roger Luddington 1. Introduction The single gene for protein C is located at position q13-q14 on chromosome 2 (1). Two groups have described human genomic clones of protein C isolated from phage l charon libraries using cDNA for human protein C as hybridization probes (2,3). The gene is approximately 11 kb long and is composed of 9 exons and 8 introns. In common with factors VII, IX and X the exons encode specific structural domains of the protein C molecule. Exon 1 encodes the 5' untranslated region, exon 2 encodes the signal peptide and 6 amino acids of the propeptide, exon 3 encodes the remainder of the propeptide and the Gla domain (residues 1–45), exon 4 encodes the connecting segment between the Gla domain and the first EGF-like domain, exons 5 and 6 encode for the EGF-like domains (residues 49–91 and 92–137), exon 7 encodes the activation peptide (residues 157–169), the C-terminus of the light chain and the first 29 amino acids of the heavy chain. Exons 8 and 9 encode the remaining heavy chain sequence. Following the first description of the polymerase chain reaction at the 51st Symposium on Quantitative Biology, Cold Spring Harbor (1986) it has become a fundamental part of molecular biology and has moved from the research field into routine clinical laboratory investigation. PCR amplification allows us to produce a large quantity of a specific region of DNA. Single-stranded DNA templates are produced by heating double-stranded DNA to near boiling (see Note 1). Oligonucleotide primer pairs are designed such that they anneal to areas of the separated strands of DNA flanking the required region (see Note 2). DNA Polymerase will synthesize new complementary strands of DNA starting from From: Methods in Molecular Medicine, Vol. 31: Hemostasis and Thrombosis Protocols Edited by: D. J. Perry and K. J. Pasi © Humana Press Inc., Totowa, NJ
239
240
Luddington
the “primed” region (see Note 3). Each new strand is synthesized such that it extends beyond the position of the primer on the opposite strand, thus generating new primer binding sites. The reaction mixture is again heated and the process repeated. Theoretically following n cycles of PCR 2n copies of the original area of double-stranded DNA will be produced. DNA synthesis like other biochemical processes in nature is not perfect. It is reasonable to assume that up to 1/1000 nucleotides could be mis-incorporated by DNA polymerase. However, with an abundance of template the impact of this upon the final product can be considered negligible. The use of PCR amplification offers an alternative to cloned product as a basis for DNA sequencing. This approach has been applied here to protein C. Oligonucleotide primer pairs were selected to enable the amplification of the coding regions of the PROC gene. This PCR product then being used as the template for DNA sequencing reactions. A database of mutations within the PROC gene is regularly updated (4). 2. Materials 2.1. DNA Extraction 1. Cell lysis buffer: 0.3 2 M sucrose, 1% Triton X100 (w/v), 5 mM magnesium chloride, 10 mM Tris-HCl, pH 8.0. 2. TE buffer: 10 mM Tris-HCl, pH 8.0, 1 mM EDTA. 3. Nuclear lysis buffer: 2% lithium dodecyl sulfate (w/v), 0.32 M lithium acetate, 10 mM Tris-HCl, 1 mM disodium EDTA, pH 8.0. 4. Buffered phenol: store under 0.1 M Tris-HCl, pH 8.0. 5. Chloroform. 6. Absolute alcohol.
2.2. PCR Reactions 1. PCR primers (see Table 1). 2. 10X PCR buffer A: 0.1 M Tris-HCl, pH 8.3, 0.5 M KCl, 1% Triton X100 (w/v), 15 mM MgCl2. Store at –20°C. 3. 10X PCR buffer B: 166 mM (NH4)2SO4, 0.67 M Tris-HCl, pH 8.8, 0.67 mM Na2EDTA, 25 mM MgCl2 (see Note 4). 4. DMSO. 5. β Mercaptoethanol. 6. Bovine serum albumin (BSA). 7. dNTP mix: A mixture containing 200 mmoles of each dNTP. 8. Mineral oil. (If not using thermocycler with heated lid). 9. Thermostable DNA polymerase. 10. Agarose gels: 1% electrophoresis grade agarose in TBE (10X TBE: 121 g Tris, 55 g orthoboric acid, 7.4 g EDTA/L).
Exon
Primer sequences (5'–3')
2
TAGCACTGCCCGGAGCTCAGAAGT GCAGATGCCACCAGGGCCTTGTAG CTCATGGCCCCAGCCCCTCTTAGGCC CTGGTTACCAGCTCGCCCCTGAGCCT CTGGTGCTGGTGCCGCGCCCCCAA TCCGCACACCGGCTGCAGGAGCCTGA CGGCATCGGCAGCTTCAGCTGCGA CTCCCTAGAAACCCTCCTGAGCCC GACCAAGACAGGAGGGCAGTCTCGGG CTGCCAGGATGGACTCAGTGATCCCG AAACCCAGGTGCCCTGGACTGGAGGC AGCCTCTGGCAGCCCCCTTCTGCCTG AAACCCAGGTGCCCTGGACTGGAGGC GCCGGTGTGCTTGTTACATGTCCCTT GGCCTCAGGAAAGTGCCACT (5) GCCGGTGTGCTTGTTACATGTCCCTT
3 4/5
241
6 7 8 8/9 9
Human Protein C Gene
Table 1 Protein C Primer Sequences, DNA Polymerase, and Method of Product Purification DNA polymerase
Reaction buffer
Promega
A
165
Sodium acetate
Promega
A
279
Sodium acetate
Amplitaq
B
358
Sodium acetate
Amplitaq
B
393
Sodium acetate
Promega
A
277
Sodium acetate
Promega
A
229
Sodium acetate
Promega
A
1978
GeneClean®
Promega
A
735
GeneClean®
Product size (bp) Purification method
241
242
Luddington
2.3. Purification of PCR Products The method of purification is dependent upon the size of the exon being studied (see Table 1). 1. 2. 3. 4.
7.5 M sodium acetate. Absolute alcohol. 80% Alcohol. Geneclean II® kit (BIO 101 Inc., CA).
2.4. 32P Sequencing The sequencing protocol is used Sequenase v2 and the various reagents supplied with the sequencing kit. 1. 10X T4 polynucleotide kinase buffer (PNK) buffer: 0.5 M Tris-HCl, pH 7.6, 0.1 M MgCl2, 50 mM dithiothreitol, 1 mM spermidine, 1 mM EDTA. 2. 5X Sequenase buffer: 200 mM Tris-HCl, pH 7.5, 100 mM MgCl2, 250 mM NaCl. 3. BSA: 0.5 mg/mL. 4. Enzyme dilution buffer: 10 mM Tris-HCl, pH 7.5, 5 mM DTT, 0.5 mg/mL BSA. 5. Sequencing primers 6. T4 polynucleotide kinase 7. [γ-32P]dATP 8. Termination mixtures (ddATP, ddCTP, ddGTP, ddTTP) 9. Stop mixture: 95% formamide, 20 mM EDTA, 0.05% bromophenol blue, 0.05% xylene cyanol FF. 10. Urea. 11. 10X TBE. 12. 40% Acrylamide/bisacrylamide (ratio 19:1). 13. TEMED. 14. 25% Ammonium persulfate: prepare immediately before use.
3. Methods 3.1. DNA Extraction 1. To the buffy coat from a 5 mL citrated blood sample add 45 mL of cell lysis buffer and incubate on ice for 20 min. 2. Centrifuge the lysed cells at 4°C for 15 min at 1000g. Carefully remove the supernatant and resuspend the pellet in 5 mL of sterile TE buffer. 3. Add 10 mL of nuclear lysis buffer to each tube and rotate on an orbital mixer for 30 min until no cellular clumps are visible (see Note 5). 4. Add 5 mL of buffered phenol and rotate for 5 min. Add 5 mLof chloroform rotate for a further 5 min. Centrifuge at 1000g for 10 min at 4°C to separate the phases. Remove the upper aqueous layer to a clean tube and add another 5 mL of chloroform. Repeat the rotation and centrifugation steps and remove the aqueous phase again to a clean tube. 5. Precipitate the DNA by adding of 2.5 vol of absolute alcohol and gradually rotate the tubes. As the phases mix the DNA becomes visible. Collect the DNA onto a
Human Protein C Gene
243
sealed sterile Pasteur pipet and gently remove the excess alcohol. Transfer the DNA in to 500 µL of distilled water and leave at 4°C for 48 h to go into solution 6. Calculate the DNA concentration by measuring the optical density of the DNA containing solution at 260 nm (OD260). For double-stranded DNA 1 OD260 = 50 mg DNA. Therefore [DNA]mg in 1 mL = OD260 × dilution × 50. In addition calculate the optical density at 280 nm (OD280) is measured to assess the purity of the sample. OD260/OD280 should be >1.8.
3.2. PCR Amplification 1. All reaction mixtures are made up in a final volume of 100 µL with sterile distilled water. 2. Depending upon the exon being amplified (see Note 6) one of two reaction buffers is used (see Table 2). Reaction buffer A: 1 µg DNA, 10 µL 10X PCR buffer A, 100 pmols of each amplification primer, 200 µmols of each dNTP 2 U of Promega DNA polymerase (added immediately prior to amplification). Reaction buffer B: 1 µg DNA, 10 µL 10X PCR buffer B, 16 µg BSA, 10 mM β-mercaptoethanol, 10% DMSO, 100 pmols of each amplification primer, 200 µmols of each dNTP, 2 U Amplitaq® DNA polymerase (added immediately prior to PCR). 3. Overlay the reaction mixtures with light mineral oil to prevent evaporation. 4. Carry out 35 cycles using the conditions shown in Table 3. A final 10-min incubation at 74°C is incorporated to ensure maximum double-stranded product. 5. 10 µL of each reaction may be run on a submarine minigel containing 1% agarose gel incorporating 0.5 µL/mL ethidium bromide in TBE.
3.3. Purification of PCR Products 3.3.1. Sodium Acetate Precipitation Add 50 µL of 7.5 M sodium acetate to a single 100 µL PCR reaction. Follow this by 150 µL of absolute ethanol and incubate the mixture at 20°C for 5 min. Centrifuge the tube at 10,000g for 10 min and discard the supernatant. Wash the pellet (see Note 7) by adding 500 µL of 80% ethanol followed by a vortex mix and centrifugation at 10,000g for 10 min. 5. Remove the supernatant and allow the pellet to dry at 37°C. The pellet is then resuspended in 20 µL of sterile distilled water. 1. 2. 3. 4.
3.3.2. Geneclean II®(BIO 101 Inc., CA) The Geneclean II® kit is designed for the purification of DNA fragments of 500 bp and above. Thus, the use of this kit is only applicable to the purification of the exon 9 fragment 1. To a single 100 µL PCR reaction, 300 µL of 6 M sodium iodide and 10 µL of “Glassmilk®” (a suspension of silica matrix in water) is added. This is mixed by orbital rotation at 4°C for 20 min followed by centrifugation at 10,000g for 5 s.
244
Luddington
Table 2 Reaction Conditions for the Amplification of the Protein C Gene Exon 2 3 4/5 6 7 8 8/9 9 a5
Annealing temperature
Time
Extension temperature
Time
Denaturation temperature
Time
55°C 57°C 65°C 60°C 50°C 60°C 60°C 55°C
20 s 20 s 20 s 20 s 20 s 20 s 10 s 20 s
74°C 74°C 74°C 74°C 74°C 74°C 74°C 74°C
20 s 30 s 20 s 20 s 30 s 30 s 150 sa 20 s
94°C 94°C 94°C 94°C 94°C 94°C 94°C 94°C
20 s 20 s 20 s 20 s 20 s 20 s 20 s 20 s
s were added per cycle.
Table 3 Conditions Used for Sequencing of the Protein C Exons Exon
Sequencing primer (5'–3')
Gel type
Run time, V/h
2 3 4/5 6
GCTCAGAAGTCCTCCTCAGA CACCAAGGTGAGCTCCCC GACGCTGCCCGCTCTCTCCG CCACCCCGCACCCAGCGTGA (5) TTGGGGGCGCGGCACCAGCA (5) TGCCTGGCAGGCCCCTCACC GCAGCCCTGTGATGTCATCA CCGTGGAAGGAGGCGACCAT CCAGCCCGTCACGAGGGTCT TCCATTGCCATGCAAAAGCC
Standard Wedge Standard Standard Standard Wedge Standard Standard Standard Standard
3400 5100 3600 and 6200 3200 3300 5000 3800 3500 3200 3800
7 8 9
2. Discard the supernatant and wash the pellet twice with “New Wash®” (a Trisbuffered NaCl, ethanol, water solution, pH range 7.0–8.5). Each wash step consists of 750 µL “New Wash®”, a vortex mix and 5 s centrifugation at 10,000g. The supernatant is discarded each time. 3. Following the second wash, add 20 µL of distilled water to the pellet and vortex mix. 4. This is incubated at 55°C for 5 min, followed by centrifugation at 10,000g for 60 s. The supernatant containing the eluted DNA is retained. 5. Repeat the elution step and pool the two aliquots. A 5-µL aliquot of the genecleaned product is then checked for purity on a submarine minigel containing 1% agarose gel incorporating 0.5 µg/mL ethidium bromide in 1X TBE.
Human Protein C Gene
245
3.4. DNA Sequencing 3.4.1. End-Labeling Sequencing Primer 32P 25 pmoles sequencing primer are required for each end-labeling reaction. 1. Combine 1.5 µL 10X T4 PNK buffer, 0.5 µL BSA, 25 pmols of the sequencing primer (see Note 8), 1.0 µL (10 U) T4 polynucleotide kinase, 7.5 µL [γ-32P]dATP (370 MBq/mL), distilled water to 15 µL. Incubate at 37°C for 60 min and then for 15 min at 85°C. The labeled primer is then briefly spun at 10,000g and stored at –20°C or below.
3.4.2. Sequencing Reactions For each set of four sequencing lanes a single annealing and subsequent labeling reaction (the Sequenase reaction mixture) is required. 1. To a 1.5-mL Eppendorf tube add 1 µg of purified amplified DNA in a total volume of 7 µL, 2 µL of 5X Sequenase buffer and 1 µL of 32P-labeled primer. 2. Denature at 100°C for 5 min, followed by a pulse centrifugation at 10,000g to pellet any condensation. Incubate for a further 2 min at 100°C, then immediately transfer to liquid nitrogen. 3. Remove the samples from the liquid nitrogen and allow to thaw at 20°C. Place on ice. 4. Following a pulse centrifugation at 10,000g, to each annealed template-primer, add 1 µL 0.1 M DTT and 2.5 µL distilled water, 2 µL of Sequenase® (diluted 1 + 7 in enzyme dilution buffer on ice. 5. Termination reactions are carried out in microtiter sequencing plates. Add 2.5 µL of each termination mix (ddATP, ddCTP, ddGTP, and ddTTP) to wells labeled “A, C, G, and T”. 6. Add 3.5 µL of template-primer-Sequenase mixture to each of the four lanes and incubate the plate for 5 min at 37°C. 7. Stop the reaction by the adding 4 µL of stop mixture to each well. 8. Heat the plate to 80°C for 5 min to denature the DNA (see Note 9) and then place on ice prior to loading samples onto the sequencing gel.
3.4.3. Denaturing Polyacrylamide Gel Electrophoresis. 1. Clean two 20 × 50 cm glass plates using detergent followed by a rinse in deionised water and an alcohol wipe. 2. Apply a silicone coating to one plate to prevent gel adhesion. 3. Place spacers of 0.2 mm (0.2 mm increasing to 0.5 mm for wedge gels) thickness between the plates and seal the sides and base with Scotch™ electrical tape. 4. Prepare a gel mix using; 42 g of Urea, 10 mL of 10X TBE, 15 mL of 40% acrylamide/bisacrylamide (Ratio 19:1) and make up to 100 mL with sterile distilled water. Microwave on high power for 10 s and then stir at 20°C until the urea is completely dissolved. 5. Filter the mixture through a 0.45-mm syringe-end filter.
246
Luddington
6. Add 135 µL of TEMED and 135 µL of fresh 25% ammonium persulfate. The gel mix is then poured immediately between the assembled plates suing a 50-mL syringe. 7. Clamp a 20-well comb into the open end of the assembly and leave the gel for at least 2 h or overnight to polymerize. 8. Remove the tape from the base of the assembly and fix the gel into the vertical electrophoresis apparatus. Fill the buffer reservoirs with 1X TBE. 9. Pre-run the gel at 35W for 30 min prior to the loading 3 µL of the denatured sequencing reactions. Carry out electrophoresis for the appropriate period of time (see Table 3). 10. Following electrophoresis, separate the gel plates and fix the gel in 5% methanol/ 5% acetic acid. Transfer to a sheet of 3MM paper and dry the gel under vacuum at 80°C for 1–2 h. Expose with X-ray film for 24–48 h.
4. Notes 1. It is important to ensure complete strand separation during the denaturation cycle of PCR. This requires a minimum denaturation temperature of 94°C. As the polymerase activity of the enzyme is lost during prolonged exposure to these temperatures it was important to ensure complete denaturation, but retain sufficient polymerase activity within the reaction mixture. 2. The primers for the PCR reactions were carefully selected. Where possible a random base distribution with a CG content similar to that of the target fragment was selected. Primers pairs that were capable of forming “primer-dimers” were avoided. 3. Polymerase mediated DNA synthesis occurs maximally between 65°C and 75°C. With the activity of Taq polymerase approximately doubling between 65°C and 74°C an extension temperature of 74°C was used. 4. Variations in Mg2+ concentration within a PCR reaction mix will affect the specificity and yield. Excess Mg2+ results in the production of nonspecific amplification whereas insufficient Mg2+ will reduce the product yield. 5. At this stage a successful extraction could be predicted by a marked increase in viscosity 6. Problems were encountered with the amplification of exons 4/5 and 6. These were resolved by the incorporation of β-mercaptoethanol and Dimethylsulfoxide to reduce secondary structure of the target DNA. 7. The term “pellet” should not cause concern when you see only a spec at the base of your Eppendorf tube. Dry and resuspend as described, run a 2-µL aliquot on a minigel to check product. 8. The concentration of the sequencing primer is calculated using the formula. Conc µM = [OD260 × diln. × 40(1 OD260 = 40 µg single-stranded DNA) × 10-3 309 (mean weight of nucleotides) × 20 (mer)] 9. To heat the microtiter plate, use an incubator or place the plate on the head of the PCR thermocycler rather than risk loosing your reaction mixtures in a water bath.
Human Protein C Gene
247
References 1. Patracchini, P., Aiello, V., Palazzi, P., Calzolari, E., and Bernardi, F. (1989) Sublocalization of the human protein C gene on chromosome 2q13-1q14. Human Genetics 81, 191–195. 2. Beckmann, R. J., Schmidt, R. J., Sonterre, R. F., Plutzky, J., Crabtree, G. R., and Long, G. L. (1985) The structure and evolution of a 461 amino acid human protein C precursor and its messenger RNA, based upon the DNA sequence of cloned human liver cDNAs. Nucleic Acids Res. 13, 5233–5247. 3. Foster, D. C., Yoshitake, S., and Davie, E. W. (1984) Characterisation of cDNA coding for human protein C. Proc. Natl. Acad. Sci USA 81, 4766–4770. 4. Reitsma, P. H., Bernardi, F., Doig, R. G., Gandrille, S., Greengard, J. S., Ireland, H., et al. (1995) Protein C deficiency: a database of mutations, 1995 update. On behalf of the Subcommittee on Plasma Coagulation Inhibitors of the Scientific and Standardisation Committee of the ISTH. Thromb. Haemostasis 73, 876–889. 5. Reitsma, P. H., Poort, S. R., Allaart, C. F., Briet, E., and Bertina, R. M. (1991) The spectrum of genetic defects in a panel of 40 Dutch families with the symptomatic protein C deficiency type I: heterogeneity and founder effects. Blood 78, 890–894.
Protein S Gene
249
25 Analysis of the Protein S Gene in Protein S Deficiency Núria Sala and Yolanda Espinosa-Parrilla 1. Introduction Protein S (PS) is a 71-kDa vitamin K-dependent glycoprotein first identified in human plasma by DiScipio and colleagues in 1977 (1), a year after the discovery of the anticoagulant protein C (PC) (2,3). A few years later, Walker demonstrated that PS acts as a cofactor for activated protein C (APC) in the proteolytic inactivation of the procoagulant factors Va and VIIIa (4,5) and in 1984, the first families with hereditary PS deficiency and venous thrombotic disease were identified (6,7). This demonstrated the physiological importance of PS as an antithrombotic protein, which has been further confirmed by the identification of many other families in which the heterozygotes for PS deficiency have an increased risk of developing venous thrombosis in early adulthood (8–10). PS deficient homozygotes with severe thrombotic events and purpura fulminans in the neonatal period have also been described (11,12). Although the molecular mechanism by which PS enhances APC activity has not yet been completely elucidated (2,3), it has been proposed that PS increases the affinity of APC for the phospholipid membranes where the inactivation complex will form and the inactivation reactions take place (13). PS might also have APC independent anticoagulant properties through direct inhibition of prothrombin and factor X activation (14–16). PS is synthesized by the hepatocytes (17), endothelial cells (18,19), megacaryocytes (20), Leydig cells of human testis (21), and brain (22). Two highly homologous PS genes, approx 4 cM apart, have been characterized and mapped near the centromere of chromosome 3, at 3p11.1–3q11.2 (23–28). These are the active gene, PROS1 or PSα and a transcriptionally inactive pseudogene, PROS2 or PSβ (26–28). The PROS1 gene spans about 80 kb of From: Methods in Molecular Medicine, Vol. 31: Hemostasis and Thrombosis Protocols Edited by: D. J. Perry and K. J. Pasi © Humana Press Inc., Totowa, NJ
249
250
Sala and Espinosa-Parrilla
genomic DNA and contains 15 exons that are transcribed in about 3.5 kb of mRNA. PROS2 spans about 50 kb of DNA and shares 96.5% homology with PROS1 in exon sequences and 95.4% in the intronic ones. It lacks exon 1 and contains several detrimental mutations. As deduced from the cDNA sequence (29,30), the precursor PS molecule contains 676 amino acids in 7 structural/ functional domains encoded by the different PROS1 exons (26–28,31). The signal peptide (residues –41 to –18) is encoded by the 3' end of exon 1. The propeptide (residues –17 to –1) is encoded by the 5' end of exon 2 and the amino-terminal γ-carboxyglutamic acid (Gla)-domain of the mature protein is encoded by the 3' end of exon 2. This domain is followed by a short helical stack (residues 38-45), encoded by exon 3, the thrombin sensitive region (residues 46-72), encoded by exon 4 and four epidermal growth factor (EGF)-like domains (residues 76–242), encoded by exons 5 to 8. The carboxy-terminal half of protein S (residues 243-635) is encoded by exons 9 to 14 and the 5'-end of exon 15. This domain is completely different from that of the other vitamin K-dependent proteins, being homologous to the sex hormone binding globulin (SHBG) though it does not bind steroid hormones (21). It contains two small disulphide loops, three potential N-linked glycosylation sites and two potential sites (residues 420-433 and 583-635) for interaction with the C4b-binding protein (C4BP) of human complement (32–34). The plasma concentration of PS is 20–25 mg/mL (260–330 nM) with a half life of 42 h (2). About 40% of PS circulates as free protein, whereas the remaining 60% forms a noncovalent 1:1 stoichiometric complex with the ßchain of the complement C4b-binding protein (C4BPβ+) (2,3). This interaction is of high affinity and abolishes the anticoagulant properties of PS. Therefore, in vivo, all C4BPß+ molecules circulate bound to PS and only the molar excess of PS over C4BPß+ circulates in a free form and is active as a cofactor of APC (35). PS deficiency is inherited as an autosomal dominant disorder present in approx 2–8% of families with hereditary thrombophilia (9,10,36). According to the plasma phenotype, three types of PS deficiency have been described (37). Type I or quantitative PS deficiency is characterized by reduced plasma levels of total and free PS antigen together with reduced anticoagulant activity. Type II PS deficiency, or type IIb according to Comp’s classification (38), is quite uncommon and is characterized by normal concentrations of both, total and free PS antigen, but low cofactor activity. Finally, in type III PS deficiency (or type IIa, according to Comp’s classification) free PS antigen and PS activity levels are reduced whereas total PS antigen levels are normal. The main problem with this classification and with the accurate diagnosis of PS deficiency is that biological variability, environmental factors, and the fairly poor reproducibility of the PS plasma assays (39,40), influence the plasma concen-
Protein S Gene
251
tration of PS causing diagnostic uncertainty due to the overlap existing between low normal PS levels and those present in confirmed heterozygotes for PS deficiency (8). In the last few years, more than 100 PROS1 mutations, most of them point mutations or short deletions or insertions, have been found associated with the PS deficient phenotype and are considered detrimental (31). However, most of these mutations have been published associated to type I or quantitative PS deficient pedigrees and only a few of them have been published to be associated to type III or free PS deficiency (41–43). In at least two families (43), the same mutation cosegregated with type I and type III PS deficient phenotypes coexisting in the same pedigree, which confirms that type I and type III PS deficiency may be phenotypic variants of the same genetic disease (44). On the other hand, Duchemin et al. in a French population (45) and our own group in a Spanish population (46), have found the Proline or PS Heerlen allele of the rare, and apparently neutral, S/P460 polymorphism in exon 13 of PROS1 (47), as the only sequence abnormality detected in several type III deficient probands. Nevertheless, despite this clear linkage disequilibrium between type III PS deficiency and the PS Heerlen allele, our group found absence of linkage between the type III deficient phenotype and the PROS1 and C4BP genes in some families carrying the PS Heerlen allele (46). From all these results it follows that while type I PS deficiency is essentially due to PROS1 allelic heterogeneity, the molecular basis of type III PS deficiency is still unclear. The analysis of the PS gene in patients suffering from inherited PS deficiency is necessary to identify the disease causing mutation. Once the mutation has been identified, it is generally a simple task to screen for its presence in the proband’s relatives in order to offer them an unambiguous diagnosis of their PS status. PROS1 gene analysis is also needed for a better understanding of the relationships between gene and protein structure and function, as well as for a better and more definite classification of the different types of PS deficiencies, based on their molecular basis. The protocols that follow are those we routinely use in our laboratory for the molecular analysis of PS deficiency. Two different approaches, depending on the deficiency type and the size and informativity of the family pedigree, are used. In the case of families with type III PS deficiency we have found it particularly useful to start with the analysis of the segregation patterns of two well known diallelic PROS1 intragenic polymorphisms, in order to confirm or exclude linkage of the deficient phenotype with PROS1 (46,48,49). The polymorphisms analysed are the uncommon serine to proline substitution at codon 460 (S/P460) in exon 13, which results in the PS Heerlen variant (47) and the presence of adenine or guanine at the codon for proline 626 (P626A/G), in exon 15 (50). The main problem with this analysis is that most families are
252
Sala and Espinosa-Parrilla
uninformative for the polymorphisms analysed. The recent description of two new diallelic polymorphisms, one in intron K or 11 and the other in the 3'-end of exon 15 (51), will most likely improve the informativity of this indirect genetic analysis (48,49). The description of multiallelic polymorphic markers of PROS1 would also be very helpful (49). The other approach used in all type I and type II deficient families and in those with type III PS deficiency where the PROS1 gene has not been excluded, is the direct analysis of all coding and intron flanking regions of the gene, by polymerase chain reaction (PCR) amplification of genomic DNA (52), single-strand conformation polymorphism (SSCP) analysis (53–55) and DNA sequencing (56). Other methods for PROS1 analysis, based on similar or different approaches, such us platelet mRNA analysis of the active gene or genomic DNA analysis through denaturing gradient gel electrophoresis, can be found elsewhere (41–43,57–60). 2. Materials Unless otherwise stated, all reagents are prepared in sterile double-distilled water.
2.1. PROS1 Amplification by PCR 1. Genomic DNA. Isolate by any well-standardized method. Dilute to 50 µg/mL in TE buffer 10/0.2 (10 mM Tris-HCl, 0.2 mM Na2EDTA-2H2O, pH 7.5). Store at 4°C. 2. 10 µM oligonucleotide amplification primers. Synthetic oligonucleotides of 20– 24 bases in length are diluted to 10 µM in sterile dH2O.Store frozen at –20°C in aliquots of 0.5-mL for PCR primers and 0.25 mL for sequencing primers (see Note 1; Table 1). Thawed aliquots are kept at 4°C if used in a short time. 3. 2 mM dNTP mix. Prepare a mixed deoxyribonucleoside triphosphate (dNTPs) solution from liquid stocks of 100 mM each dNTP (dATP, dTTP, dCTP, and dGTP, Pharmacia, Uppsala, Sweden). Dilute to 2 mM with sterile dH2O. Keep at –20°C in 0.5-mL aliquots. Thawed aliquots are kept at 4°C if used in a short time (10–15 d). 4. 10X PCR amplification buffer: 100 mM Tris-HCl pH 8.3, 500 mM KCl, 0.1% (w/v) gelatin (Sigma G-2500). Sterilize by autoclaving and store in 1-mL aliquots at –20°C. Thawed aliquots are kept at 4°C if used in a short time. 5. 0.1 M MgCl2. 6. Dimethyl sulfoxide (DMSO, Merck). 7. Taq DNA polymerase at 5 U/µL (we usually use that of Boehringer Mannheim, GmbH, Germany). 8. Mineral oil (Sigma M-3516). 9. Thermal cycler (we usually use Perkin-Elmer Cetus, model 480). 10. Agarose (Seakem Le, FMC BioProducts, Rockland, ME, USA). 11. TBE buffer 5X: 450 mM Tris-HCl, 440 mM boric acid, 9.5 mM Na2EDTA, pH 8.0. Store at room temperature.
Protein S Gene
253
Table 1 Nucleotide Sequences of the Primers used for the Amplification and Sequencing of PROS1 Exons and Intron-Flanking Regions, As Well As the 5' Upstream Region (5'up)a Oligo
Exon
Sequence
Position
Use
PS-Pro1a PS-Pro2a PS-1.1a PS-1.2 PS-2.1 PS-2.2 PS-3.1b PS-3.2a PS-3.2 PS-4.1a PS-4.2a PS-4.2b PS-5/6.1 PS-5/6.2 PS-7.1 PS-7.2 PS-8.1a PS-8.2b PS-8.1b PS-9.1 PS-9.2 PS-10.1 PS-10.2 PS-11.1 PS-11.2 PS-12.1 PS-12.2 PS-13.1a PS-13.2a PS-14.1 PS-14.2a PS-14.2c PS-15.1 PS-15.2
5'up 5'up 1 1 2 2 3 3 3 4 4 4 5 and 6 5 and 6 7 7 8 8 8 9 9 10 10 11 11 12 12 13 13 14 14 14 15 15
CAACTGAAGTCTTTATCGGAGC GCGAGCCTCGGCGGAACAGC TGTTATCACTTCCCCTCTCG TAGGAGCTGCAGCTCTAGAG GTCATACAATTCATAGGCAG CAGAAGGAAGTACAGGCTGG ACATTATAAAATTAAGTTTTAAC TCCCAAGGATAATGAAATTA AGGTGGAGAGTTAGACAGGA TTGGGACAGTTCCTACCATG CTTTACCTACAGAGTTTTTG TCAATTGATGGTAGAAGTGC GGCTTCAGGATTTTTATTATAGTA CTAACTGGGATTATTCTCACAT CACAAATCAAGGGTTCTTTGG GATCAGTAATGATACCACCA GATGTCATAGTATTCTTCCC TCTGTATTTTCCTGACTTAGC CGTGTGTTTTTTTTACCTCAG TAGTAACCAAACAAAAATGC CCCTTATCTGCTTAACCTCT AGCTTTCTGTATTTCTTACTC TACAGACTGCATCAAAGTGGG GTAATACTTGGTTATTTGGTAAT CACACATATTCAAATCTATTAC CCTATACTCATAATCGAGCC TGGGCACACAGTAGATACTC ATCATTGAGAAAGGGAATGG GTAAATACTGCTATGTATAC GCTTATATTGAATCTTTGCTCTG AAATGTCGGTACTAGCCCTAG AAAACTGAAGAAAAAGTAAGC CAAGATGCTAAAAGTCTTGG GATAGCAAGAGAAGTAAGAATTTC
–668 to –647 –131 to –150 –208 to –189 +98 to +79 –108 to –89 +83 to +64 –76 to –54 +115 to +96 +78 to +59 –78 to –59 +54 to +35 +24 to +5 –87 to –64 +58 to +37 –75 to –55 +29 to +10 –134 to –115 +94 to +74 –21 to –1 –97 to –78 +50 to +31 –50 to –30 +49 to +29 –41 to –19 +71 to +50 –69 to –50 +110 to +91 –134 to –115 +74 to +55 –31 to –9 +147 to +127 +27 to +7 –49 to –30 +205 to +182
PCR-Seq PCR-Seq PCR-Seq PCR-Seq PCR-Seq PCR-Seq PCR-Seq PCR Seq PCR-Seq PCR Seq PCR-Seq PCR-Seq PCR-Seq PCR-Seq PCR PCR-Seq Seq PCR-Seq PCR-Seq PCR-Seq PCR-Seq PCR-Seq PCR-Seq PCR-Seq PCR-Seq PCR-Seq PCR-Seq PCR-Seq PCR Seq PCR-Seq PCR-Seq
aNumbering
of the position of the primers in introns is relative to either the 5' (–) or 3' (+) boundaries of the amplified coding sequences. Underlining of oligonucleotides denotes known differences between PROS1 and PROS2.
254
Sala and Espinosa-Parrilla
12. Gel loading buffer 6X: 30% (v/v) glycerol and 0.1% (w/v) bromophenol blue in 1X TBE buffer. Store at 4°C. 13. 10 mg/mL Ethidium bromide solution. 14. DNA molecular size marker: 1 kb DNA ladder at 0.05 µg/mL, 0.04% (w/v) Orange G and 6.8% (w/v) sucrose in TE buffer 10/1 (10 mM Tris-HCl, 1 mM EDTA, pH 8.0). Keep frozen at –20°C in 1-mL aliquots. Thawed aliquots are kept at 4°C. 15. Submarine gel electrophoresis equipment.
2.2. Polymorphism Analysis 1. PCR reaction products containing PROS1 exon 13 and exon 15. 2. RsaI and BstXI restriction enzymes with their corresponding buffer, provided by the manufacturer (Boehringer Mannheim, GmbH, Germany). The enzyme used for each polymorphism to be analyzed is stated in Table 2. 3. Agarose gel electrophoresis materials and equipment (see steps 10–15, above).
2.3. Single-Strand Conformation Polymorphism (SSCP) Analysis 1. 2. 3. 4.
PCR reaction products from the PROS1 amplified fragments. CleanGel 10% and ExcelGel 12.5% DNA Analysis Kits (Pharmacia). Glycerol. Denaturing solution: 95% (v/v) formamide, 20 mM EDTA pH 8.0, 0.05% (w/v) bromophenol blue, 0.05% (w/v) xylene cyanol FF, and 10 mM NaOH. Store at 4°C. 5. DNA Silver Staining Kit, (Pharmacia) or its reagents: glacial acetic acid, 1% (w/v) silver nitrate solution, 37% formaldehyde, sodium carbonate, 2% (w/v) sodium thiosulphate, Na2EDTA-2H2O, and 87% (v/v) glycerol. 6. Multiphor II Electrophoresis Unit with refrigerated bath circulator (MultiTemp Thermostatic Circulator, Pharmacia). 7. Benzin or kerosene (insulating fluid).
2.4. PCR Product Purification 1. PCR reaction products from the PROS1 amplified fragments. 2. QIAquick PCR purification kit (Qiagen, Hilden, Germay). 3. 10 mM Tris-HCl, pH 8.5.
2.5. DNA Sequencing 1. Purified PCR product. 2. Dye Terminator Cycle Sequencing kit, ready reaction (Applied Biosystems, Foster City, CA). 3. DNA sequencing primer 1 µM in sterile dH2O. Keep frozen in 0.25-mL aliquots. Primers used for PROS1 sequencing are shown in Table 1. 4. Dimethyl sulfoxide (DMSO). 5. Mineral oil. 6. Thermal cycler. 7. Sephadex G-50 prepared in TE buffer 10/1 (10 mM Tris-HCl, pH 7.8, 1 mM EDTA). Resuspend 30 g Sephadex G-50 in 250 mL TE 10/1. Stir gently for 30 min
Protein S Gene
255
Table 2 PROS1 Fragments to be Amplified and Restriction Endonucleases Used to Genotype the PROS1 Polymorphisms S/P460 and P626A/G RFLP S/P460 P626A/G
8. 9. 10. 11. 12. 13. 14. 15. 16.
PCR fragment
Enzyme
Allele fragments, bp
Exon 13 Exon 15
RsaI BstXI
S: 360; P: 219, 141 A: 230, 185; G: 415
at 65°C. Remove the excess buffer several times and replace with fresh TE buffer and finally with dH2O. Sterilize by autoclaving. Store at room temperature. 1-mL disposable syringes plugged with cotton wool. Na2EDTA-2H2O 50 mM, pH8.0. Deionised formamide. Sequencing mix (Gibco, BRL Life Technologies): 6% (w/v) acrylamide/ visacrylamide (19:1), 7 M urea, 1X TBE (see Note 2). Keep in the dark at 4°C. 10% (w/v) Ammonium persulfate (APS) in dH2O. TEMED. Alconox detergent (Aldrich Chemical Company, Inc., Milwaukee, WI) 1X TBE buffer Applied biosystems 373 or 373A DNA sequencer.
3. Methods 3.1. Numbering System for Amino Acids and Nucelotides Protein S amino acids and PROS1 nucleotides are numbered according to Schmidel et al. (26). Exons and introns are numbered 1 to 15 and 1 to 14, respectively. Mutations and polymorphisms are designated according to Beaudet and Tsui (61).
3.2. PROS1 Amplifications by PCR All fifteen exons and intron flanking regions of the PROS1 gene, as well as 537 bp of the 5' regulatory sequence, are amplified by the polymerase chain reaction (PCR) in a final volume of 50 or 100 µL depending, respectively, on whether the amplified product is going to be used for restriction or SSCP analysis (VF = 50 µL) or if it will be purified for DNA sequencing (VF = 100 µL). For a final volume of 100 µL, the reaction is prepared as follows. If 50 µL volumes are needed, scale down all reagents. 1. Prepare as many 0.5-mL microcentrifuge tubes as DNA samples to be amplified and to each tube add 10 µL of genomic DNA at 50 ng/µL and one drop of mineral oil. Substitute sterile dH2O for genomic DNA in one of the reaction tubes as a contamination control. 2. In an ice bath, prepare a reaction mix that, per reaction tube, contains: 10 µL of 10X PCR buffer, 0–10 µL DMSO (see Table 3), 1.5–3 µL of 0.1 M MgCl2 (see
256 Table 3 Specific Reaction Conditions Used to Amplify PROS1 Exons with Intron-Flanking Regions (E-1 to E-15) As Well As the 5' Upstream Region (5'up)a
256
Primers
bp
10X PCR buffer, µL
5'up E-1 E-2 E-3 E-4 E-5/6 E-7 E-8 E-9 E-10 E-11 E-12 E-13 E-14 E-15
Pro1a–Pro2a 1.1a–1.2 2.1–2.2 3.1b–3.2a 4.1a–4.2a 5/6.1–5/6.2 7.1–7.2 8.1a–8.2b 9.1–9.2 10.1–10.2 11.1–11.2 12.1–12.2 13.1a–13.2a 14.1–14.2a 15.1–15.2
537 382 349 216 219 505 230 350 261 289 280 348 360 404 415
10 10 10 10 10 10 10 10 10 10 10 10 10 10 10
— 10 — — — — — — — — — — — — —
10 15 10 10 15 10 10 10 10 10 10 10 10 15 10
with dH2O to 90 or to 88 µL if the reaction is to be “hot started.” start” PCR reaction; Taq-polymerase is added after initial denaturation.
aAdjust b“Hot
1 2 1.5 2.5 3 1.5 1.5 3 1.5 1.5 1.5 1.5 1.8 2 1.5
0.2 0.3 0.2 0.2 0.3 0.2 0.2 0.2 0.2 0.2 0.2 0.2 0.2 0.3 0.2
4 5 5 6 4 5 4 5 5 5 5 5 3.5 5 3.5
Primers Taq 5 U/µL µM µL U 0.5 0.5 0.5 0.6 0.4 0.5 0.4 0.5 0.5 0.5 0.5 0.5 0.35 0.5 0.35
0.4b —b 0.4 —b —b 0.4 —b —b 0.4 0.4 —b 0.4 0.4 0.4 0.4
2 2
2
2 2 2 2 2 2
Sala and Espinosa-Parrilla
Exon
Reaction conditions (100-µL final volume)a DMSO, 0.1 M MgCl2 2 mM dNTPs, 10 µM µL µL µL mM µL
Protein S Gene
257
Table 3), 10–15 µL of 2 mM 4dNTP mix (see Table 3), 3–6 µL of 10 µM each primer (forward and reverse, Tables 1 and 3), 0.4 µL of Taq-polymerase at 5 U/ µL (if no hot start is needed, see Table 3) and sterile dH2O to 90 µL. If the reaction is to be “hot started” (see Table 3), do not add the Taq-polymerase in the reaction mix and adjust final volume to 88 µL with dH2O. Mix and microcentrifuge briefly at top speed (13–14,000 rpm). 3. Add 90 µL of the reaction mix (or 88 µL if the reaction is to be “hot started”) to the DNA containing and control tubes and microcentrifuge briefly at top speed. 4. Transfer the tubes to the thermal cycler, denature for 5 min at 95°C and carry out the PCR reaction using the amplification cycles shown in Table 4 (see Note 3). If the reaction is to be “hot started” (see Table 4), denature for 6 min at 98°C, reduce the cycler temperature to 90°C, add 2 µL of Taq-polymerase diluted to 2 U/µL in dH2O just before use and carry out the PCR reaction using the amplification cycles stated in Table 4. Once the reaction is finished, keep the tubes at 4°C until use. 5. Visualize the results by electrophoresing 5 µL of the PCR reaction plus 1 µL of gel loading buffer in a 1% agarose gel and staining with ethidium bromide. Include a lane containing 5 µL of the DNA molecular weight marker.
3.3 Polymorphism Analysis The genotypes for the P626A/G and the S/P460 PROS1 polymorphisms are respectively determined by restriction analysis. 1. 2. 3. 4.
Add 5 U of BstXI to 8 µL of the exon 15 PCR product in a final volume of 30 µL. Add 2.5 U of RsaI to 15 mL of the exon 13 PCR product in a final volume of 50 µL. Incubate as recommended by the enzyme suppliers. Add loading buffer and electrophorese the digestion products (see Table 2) on 2.5% agarose gels in 1X TBE.
3.4. SSCPs Analysis In order to obtain a mutation detection efficiency close to 100%, SSCP analysis of the amplified PROS1 fragments is performed at two different acrylamide concentrations (see Table 5). 1. Rehydrate pre-cast gels exactly as stated in the instructions of the CleanGel DNA analysis kit. 2. Dilute the PCR fragment to be analyzed 1:2 — 1:12 in dH2O, depending on the concentration of the PCR product (see Table 5) (see Note 4). Mix with the same final volume (4–15 µL) of denaturing solution. Keep at room temperature until use (but less than 30 min). 3. Connect the Multiphor II Electrophoresis Unit to the MultiTemp Thermostatic Circulator set to the desired temperature (5–15°C, Table 5). 4. Add 3–4 mL benzin (insulating fluid) to the center of the cooling plate and position the gel onto it, taking care that no air bubbles remain under the gel (see Note 5). 5. Soak the electrode strips with electrode buffer in PaperPool (only for CleanGels) and place them on to the edges of the gel. Be very careful that no air bubbles
258
Table 4 Cycling Parameters Used to Amplify PROS1 Exons With Intron-Flanking Regions (E-1–E-15) As Well As the 5' Upstream Region (5'up)
258
5'up E-1 E-2 E-3 E-4 E-5/6 E-7 E-8 E-9 E-10 E-11 E-12 E-13 E-14 E-15
95 98 95 98 98 95 98 98 95 95 98 95 95 95 95
a“Hot
5a 6a 5 6a 6a 5 6a 6a 5 5 6a 5 5 5 5
Cycling parameters
Hold 90°C
Taq 2 U/µL µL
Cycles n
Denat. °C s
Anneal. °C s
Extens. °C s
extens. °C Min
Yes Yes No Yes Yes No Yes Yes No No Yes No No No No
— 2 — 2 2 — 2 2 — — 2 — — — —
35 35 30 35 35 30 30 35 30 30 30 30 30 35 30
95 95 95 95 95 95 95 95 95 95 95 95 95 95 95
62 56 55 49 56 58 54 56 50 55 53 55 52 62 54
74 74 74 74 74 74 74 74 74 74 74 74 74 74 74
74 74 74 74 74 74 74 74 74 74 74 74 74 74 74
45 60 30 45 45 45 30 45 45 30 60 30 30 45 30
45 60 30 45 45 45 30 45 45 30 60 30 30 45 30
start” PCR reaction; Taq is added at 90°C after initial denaturation.
Final
60 120 60 60 120 60 60 60 60 45 60 45 60 60 60
5 5 5 5 5 5 5 5 5 5 5 5 5 5 5
Sala and Espinosa-Parrilla
Exon
Initial denat. °C Min
Protein S Gene
259
Table 5 Sample Dilutions and Electrophoresis Conditions Used to Analyze PROS1 Fragments by SSCP Electrophoresis Exona
Gel Type
5'up 5'up 1 1 2 2 3 3 4 4 5&6 5&6 7 7 8 8 9 9 10 10 11 11 12 12 13 13 14 14 15 15
12.5% ExcelGel 10% CleanGel 10% CleanGel 12.5% ExcelGel 12.5% ExcelGel 10% CleanGel 12.5% ExcelGel 10% CleanGel 12.5% ExcelGel 10% CleanGel 10% CleanGel 12.5% ExcelGel 12.5% ExcelGel 10% CleanGel 12.5% ExcelGel 10% CleanGel 12.5% ExcelGel 10% CleanGel 12.5% ExcelGel 10% CleanGel 12.5% ExcelGel 10% CleanGel 10% CleanGel 12.5% ExcelGel 12.5% ExcelGel 10% CleanGel 12.5% ExcelGel 10% CleanGel 10% CleanGel 12.5% ExcelGel
Sample dilutionb
Temp. ºC
Prerun V min
V
1/6 1/6 1/2 1/2 1/10 1/10 1/4 1/4 1/4 1/4 1/8 1/8 1/8 1/8 1/4 1/4 1/8 1/8 1/6 1/6 1/6 1/6 1/12 1/12 1/12 1/12 1/8 1/8 1/5 1/5
5 15 5 5 5 15 15 15 5 15 15 5 5 15 5 15 5 15 5 15 5 15 5 5 15 15 5 15 15 15
100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100
600 600 600 600 600 600 600 600 600 600 600 600 600 600 600 600 600 600 600 600 600 600 600 600 600 600 600 600 600 600
20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20 20
Run h 4.5 2.5 2 3.5 3.5 1.5 2 1 2.25 1 2 4.5 2.25 1.5 2.5 1.75 3.5 1.5 3.5 1.5 2.5 1.5 2 3.5 2.25 1.5 3.5 1.5 1.5 2.5
aOf the two electrophoretic conditions stated for all fragments, the ones reported first are those that give best results in our hands. bSample dilution refers to the dilution of the PCR product with dH O, before the 2 addition of the same final volume of stop solution.
remain trapped under the gel and that the strips overlap the gel by a minimum of 3 mm and remain separated from the sample wells by about 5 mm.
260
Sala and Espinosa-Parrilla
6. Denature the diluted samples at 98°C for 2 min and immediately place them on ice. 7. Apply 6.5 µL of each denatured sample to the sample wells. A minimum of two samples from healthy controls are loaded approx 12-wells after the first and before the last well. 8. Connect the electrophoresis unit according to the instruction manual, prerun samples for 20 min at 100 V and then run under the conditions specified in Table 6. 9. Silver stain the gel according to the Silver Staining Protocol for nucleic acids provided by Pharmacia Biotech with the Multhiphor II Unit (see Notes 6 and 7). 10. Allow the gel to dry a little at room temperature and wrap the gel with cling film. 11. Compare single-strand and heteroduplex banding patterns of patients with those of controls.
3.5. PCR Product Purification 1. PCR fragments from 100 bp to 10 kb are separated from oligonucleotide primers, dNTPs and other reaction components by anion-exchange chromatography. 90 µL of the amplified product is purified on QIAquick spin columns following the protocol provided with the QIAquick Purification kit (see Note 8). Elute into 10 mM Tris-HCl, pH 8.5. 2. Visualize 2 µL of the purified product on a 1% agarose gel.
3.6. DNA Sequencing PROS1 purified fragments are directly sequenced using the Applied Biosystems protocol for Taq cycle-sequencing with dye terminators and an Applied Biosystems 373 DNA sequencer. Both the sense and the antisense DNA strands are sequenced using the same primers as those used for amplification with the exception of exons 3, 4, and 14, for which a new antisense primer was synthesised and exon 8, for which a new sense primer was synthesised (see Table 1).
3.6.1. Thermal Cycle Sequencing Reaction 1. In a 0.5-mL microcentrifuge tube add 2–4 µL of the purified DNA fragment, (depending on the concentration of the visualized fragment), 1.5 µL of 1 mM sequencing primer, 0.5 µL DMSO, dH2O up to 6 µL and a drop of mineral oil. Mix and microcentrifuge briefly at top speed. 2. Place tubes in the thermal cycler and incubate for 6 min at 98°C then reduce the temperature to 90°C and maintain it at this temperature. 3. At 90°C add 4 µL of the ready reaction mix (provided with the Dye Terminator Cycle Sequencing kit) and start thermal cycling as follows: 28 cycles of 30 s at 96°C (denaturation), 30 s at 52°C (annealing) and 4 min at 60°C (extension). Immediately after, store tubes at 4°C until use.
3.6.2. Sephadex G-50 Gel Filtration 1. Plug the neck of a 1-mL disposable syringe with cotton wool and fill the syringe up to 1 mL with Sephadex G-50. Keep the liquid level at 1 mL by adding water several times and then let it drip for approx 1 min.
Protein S Gene
261
Table 6 Restriction Endonucleases Used to Distinguish Between PROS1 and PROS2 Amplified Sequences Exon
Enzyme
PROS1 fragments, bp
PROS2 fragments, bp
2 2 4 5 and 6 5 and 6 7 7 8 8 9 10 10 11 11 12 12 13 13 14 14 15 15
MspI Fnu4HI DdeI PstI RsaI FokI MaeI AluI HhaI NsiI RsaI MspI MboI MspI MnlI BstuI SfaNI MspI DdeI BclI SfaNI NlaIV
258-92 350 99-73-47 267-238 295-189-21 79-74-51-26 230 167-161-22 350 246-16 139-101-49 218-71 214-66 131-75-74 273-75 348 278-82 360 325-79 404 208-206-48 462
350 231-119 147-73 505 505 100-78-51 209-20 369a 237-130-2a 211-51 238-49 287 280 280 243-97a 225-115a 360 280-80 404 310-94 414-48 255-257
aPROS2
contains a small insertion or deletion.
2. Centrifuge for 2 min at 1000g at 4°C (see Note 9). 3. Immediately place the bottom of the syringe in a 1.5-mL Eppendorf tube without a cap and pipet 10 µL of the PCR reaction, avoiding oil, onto the top of the Sephadex. 4. Centrifuge for 2 min at 1000g at 4°C. 5. Dry the eluates in a Speedvac evaporator for approx 30 min and keep frozen if the sequencing gel is not to be run the same day.
3.6.3. Preparation of the Sequencing Gel This step is performed essentially as described in the 373 DNA Sequencing System user’s manual: 1. Wash the glass sequencing plates very carefully with Alconox detergent, rinse thoroughly first with tap water, then with dH2O to eliminate any detergent residues and air dry.
262
Sala and Espinosa-Parrilla
2. Assemble gel plates with two 0.4-mm uniform spacers and four large book-binder clamps on each side. Make certain that the outside faces remain outside. 3. To 40 mL of sequencing mix add 300 µL of 10% APS and 28 µL of TEMED. With the help of a syringe, pour this gel solution immediately into the gel plate sandwich, taking care that no air bubbles are formed. Insert the single well gel casting comb and place two large book-binder clamps over it. Leave the gel to polymerise for a minimum of 2 h. 4. Remove the gel casting comb and any extraneous polyacrilamide and rinse the outside faces of the polymerized gel sandwich as well as the gel casting comb well with dH2O to clean any spilled polyacrylamide and urea. 5. Place the gel sandwich into the electrophoresis chamber and without pouring the electrophoresis buffer into its reservoir, scan the plates for dust or dirt by pressing main menu, pre-run, and plate check. Check also the PMT setting. 6. If correct, abort run and pour 1X TBE initially into the upper buffer reservoir and then into the lower one (see Note 10). 7. Set up electrophoresis conditions at 2500 V, 40 mA, 30 W for 10 h at 40°C, and prerun gel for a minimum of 5 min.
3.6.4. Sample Preparation 1. Prepare a mix of 1 µL of 50 mM EDTA, pH 8.0 and 5 µL of deionized formamide per sample to be loaded. 2. Add 4.5 µL of this denaturing mix to each dried sequencing reaction sample (see Subheading 3.6.2.). Vortex and microcentrifuge briefly. 3. Denature samples by incubating at 98°C, 2 min and then placing immediately on ice for a minimum of 2 min.
3.6.5. Sample Loading and Running the Gel 1. Abort sequencer run. 2. With the help of a syringe wash the top of the gel with 1X TBE before inserting the 24-well sharkstooth comb. 3. Load 4.5 µL of each reaction sample per well and start the electrophoresis run. 4. Fill in the sample sheet of the data collection program and start collect, according to the user’s manual.
3.6.6. Sequence Analysis 1. Analyse all sample sequences with help of the data analysis program of the sequencer software and print the sequences. 2. Compare printed sequences of patients with those of controls. Not only the nucleotide sequences, but also the chromatogram shape and the presence of more than a single base peak per position, should be compared (see Note 11).
4. Notes 1. The primers used for each fragment to be amplified are shown in Table 1 and are the same as those described by Reitsma et al. (59) with the exception of the forward
Protein S Gene
263
primers for exons 1 and 13, the reverse primer for exon 14 and the forward and reverse primers for exons 3 (48), 4 and 8. Primers’ concentration is calculated spectrophotometrically by reading at A260 and applying the following formula: (A260) (dilution factor)/(Y × 10-6) = pmols/µL
2.
3.
4. 5. 6. 7.
8.
9. 10. 11.
where Y = (number of A x 15,200) + (number of C x 7050) + (number of G x 12,010) + (number of T x 8400). The denaturing 6% acrylamide solution can be prepared by mixing 30 mL of 40% stock acrylamide solution (19:1), 40 mL water and 100 g of urea. Disolve for 30 min at 65°C. Add 3 g Amberlite (Sigma #MB-1A), protect from light and leave gently stirring (100–400 rpm) for 1 h at 50°C. Vacuum filter. Finally add 40 mL of 5X TBE and dH2O to 200 mL. The reaction conditions stated in Tables 3 and 4 are the ones that gave the best results in our laboratory, allowing for the amplification of only PROS1 gene sequences as confirmed by restriction analysis with endonucleases that specifically cleaved either PROS1 or PROS2 sequences (Table 6). We recommend this confirmation when standardizing the PROS1 amplifications for the first time in the laboratory. Slight modifications of the reaction conditions (i.e., MgCl2 concentration) and cycling parameters (which may vary depending on the thermal cycler used), may be necessary to optimize the reaction in different laboratories. The best results are obtained, with high sample dilutions. According to our experience this is best acomplished by leaving the insulating fluid to spread uniformly over the gel plate by effect of the gel pressure. All solutions are prepared immediately before use and the developing solution has to be vigorously stirred to dissolve the sodium carbonate. Fix the gel by soaking for 30 min in 250 mL of a 10% solution of glacial acetic acid. Wash 3 times by soaking for 2 min in dH2O. Silver stain the gel by soaking for 20 min in 250 mL of 0.1% (w/v) silver nitrate (25 mL of 1% solution) and 0.037% (w/v) formaldehyde (0.25 mL of a 37% solution) in dH2O. Wash the gel for 30 s in dH2O. To develop the gel soak for 2–5 min in 250 mL of 2.5% (w/v) sodium carbonate, 0.037% (w/v) formaldehyde (0.25 mL of a 37% solution), and 0.002% (w/v) sodium thiosulphate (0.25 mL of a 2% solution) in dH2O. When development is complete, stop the reacion by placing the gel in 250 mL of 1.46% (w/v) Na2EDTA-2H2O in dH2O for 10 min. The gels can be preserved by soaking for 20 min in 250 mL of 8.7% glycerol in dH2O. All centrifugations are carried out for 60 s at 13–14000 rpm, in a conventional microcentrifuge. We recommend the use of 10 mM Tris-HCl, pH 8.5 instead of dH2O as elution buffer. The Sephadex level should remain at approx 0.7 mL. Take great care that no buffer is spilled, particularly in the laser reading area. To discard the presence of unspecific errors, confirm that any base change or sequence alteration observed in a patient sample is present in both the sense and the antisense DNA strands and that it is not present in control samples. Further confirmation of the sequence alteration observed should be obtained from a newly
264
Sala and Espinosa-Parrilla synthesised PCR fragment, by either restriction analysis (in the case that it creates or destroys a restriction site) or repeated sequencing. Once the alteration has been confirmed in the patient, screen for its presence in the relatives and confirm that it cosegregates with the deficient phenotype before associating it to the disease causing mutation. Furthermore, and depending very much on the type of mutation identified, the possibility of it being a polymorphism should be excluded by screening for its presence in a minimum group of 50 healthy controls (100 chromosomes).
Acknowledgments We thank Marta Morell for her invaluable technical assistance. Helena Kruyer for her assistance with the manuscript. The project is supported by Dirección General de Investigación Científica y Técnica (DGICYT, PB941233), Fondo de Investigación Sanitaria (FIS-94/0039), and Servei Català de la Salut, Generalitat de Catalunya. Y. Espinosa-Parrilla is supported by a fellowship from the I.R.O Institute. References 1. DiScipio, R. G., Hermondson, M. A., Yates, W. G., and Davie, E. W. (1977) A comparison of human prothrombin, factor IX (Christmas factor), factor X (Stuart factor) and protein S. Biochemistry 16, 698–706. 2. Dahlbäck, B. (1991) Protein S and C4b–binding protein: components involved in the regulation of the protein C anticoagulant system. Thromb. Haemostasis 66, 49–61. 3. Dahlbäck, B. and Stenflo, J. (1994) A natural anticoagulant pathway: proteins C, S, C4b–binding protein and thrombomodulin, in Haemostasis and Thrombosis, 3rd. ed. (Bloom, A. L., Forbes, C. D., Thomas, D. P., and Tuddenham, E. D. G., eds.), Churchill Livingstone, London, pp. 671–698. 4. Walker, F. J. (1981) Regulation of activated protein C by protein S: the role of phospholipid in factor Va inactivation. J. Biol. Chem. 256, 11128–11131. 5. Walker, F. J., Chavin, S. I., and Fay, P. J. (1987) Inactivation of factor VIII by activated protein C and protein S. Arch. Biochem. Biophys. 252, 322–328. 6. Comp, P. C., Nixon, R. R., Cooper, M. R., and Esmon, C. T. (1984) Familial protein S deficiency is associated with recurrent thrombosis. J. Clin. Invest. 74, 2082–2088. 7. Schwarz, H. P., Fischer, M., Hopmeier, P., Batard, M. A., and Griffin, J. H. (1984) Plasma protein S deficiency in familial thrombotic disease. Blood 64, 1297–1300. 8. Engesser, L., Broekmans, A. W., Briët, E., Brommer, E. P., and Bertina, R. M. (1987) Hereditary protein S deficiency: clinical manifestations. Ann. Intern. Med. 106, 677–682. 9. De Stefano, V., Finazzi, G., and Mannucci, P. M. (1996) Inherited thrombophilia: Pathogenesis, clinical syndromes and management. Blood 87, 3531–3544. 10. Lane, D. A., Mannucci, P. M., Bauer, K. A., Bertina, R. M., Bochkov, N. P., Boulyjenkov, V., Chandy ,M., Dahlbäck, B., Ginter, E. K., Miletich, J. P.,
Protein S Gene
11.
12. 13. 14.
15. 16.
17.
18. 19.
20.
21. 22.
23.
24.
25.
265
Rosendaal, F. R., and Seligsohn, U. (1996) Inherited thrombophilia: Part I. Thromb. Haemostasis 76, 651–662. Mahasandana, C., Suvatte, V., Marlar, R. A., Manco–Johnson, M. J., Jacobson, L. J., and Hathaway, W. E. (1990) Neonatal purpura fulminans associated with homozygous protein S deficiency. Lancet 335, 61–62. Pegelow, C. H., Ledford, M., Young, J., and Zilleruelo, G. (1992) Severe protein S deficiency in a newborn. Pediatrics 89, 674–676. Walker, F. J. (1988) Interactions of protein S with membranes. Seminars Thromb. Hemostasis 14, 216–221. Heeb, M. J., Mesters, R. M., Tans, G., Rosing, J., and Griffin, J. H. (1993) Binding of protein S to factor Va associated with inhibition of prothrombinase that is independent of activated protein C. J . Biol. Chem. 268, 2872–2877. Heeb, M. J., Rosing, J., Bakker, H. M., Fernández, J. A., Tans, G., and Griffin, J. H (1994) Protein S binds to and inhibits factor Xa. Proc. Natl. Acad. Sci. USA 91, 2728–2732. Koppelman, S. J., Hackeng, T. M., Sixma, J. J., and Bouma, B. N. (1995) Inhibition of the intrinsic factor X activating complex by protein S: evidence for a specific binding of protein S to factor VIII. Blood 86, 1062–1071. Fair, D. S. and Marlar, R. A. (1986) Biosynthesis and secretion of factor VII, protein C, protein S and the protein C inhibitor from a human hepatoma cell line. Blood 67, 64–70. Fair, D. S., Marlar, R. A., and Levin, E. G. (1986) Human endothelial cells synthesize protein S. Blood 67, 1168–1171. Stern, D. M, Brett, J., Harris, K., and Nawroth, P. P. (1986) Participation of endothelial cells in the protein C–protein S anticoagulant pathway: the synthesis and release of protein S. J. Cell. Biol. 102, 1971–1978. Ogura, M., Tanabe, N., Nishioka, J., Suzuki, K., and Saito, H. (1987) Biosynthesis and secretion of funcional protein S by a human megakaryoblastic cell line (MEG–01). Blood 70, 301–306. Malm, J., He, X., Bjartell, A., Shen, L., Abrahamsson, P. A., and Dahlbäck, B. (1994) Vitamin K–dependent protein S in Leydig cells of human testis. Biochem. J. 302, 845–850. He, X., Shen, L., Bjartell, A., Dahlbäck, B. (1995) The gene encoding vitamin K-dependent anticoagulant protein S is expressed in multiple rabbit organs as demonstrated by Northern blotting, in situ hybridization and immunohistochemistry. J. Histochem. Cytochem. 43, 85–96. Ploos van Amstel, H. K., Reitsma, P. H., Hamulyak, K., de Die Smulders, C. E., Mannucci, P. M., and Bertina, R. M. (1989) A mutation in the protein S pseudogene is linked to protein S deficiency in a thrombophilic family. Thromb. Haemostasis 62, 897–901. Ploos Van Amstel, J. K., van der Zanden, A. L., Bakker, E., Reitsma, P. H., and Bertina, R. M. (1987) Two genes homologous with human protein S cDNA are located on chromosome 3. Thromb. Haemostasis 58, 982–987. Watkins, P. C., Eddy, R., Fukushima, Y., Byers, M. G., Cohen, E. H., Dackowski, W. R., Wydro, R. M., and Shows, T. B. (1988) The gene for protein S maps near the centromere of human chromosome 3. Blood 71, 238–241.
266
Sala and Espinosa-Parrilla
26. Schmidel, D. K., Tatro, A. V., Phelps, L. G., Tomczak, J. A., and Long, G. L. (1990) Organization of the human protein S genes. Biochemistry 29, 7845–7852. 27. Ploos Van Amstel, H. K., Reitsma, P. H., van der Logt, C. P. E., and Bertina, R. M. (1990) Intron–Exon organization of the active human protein S gene PS a and its pseudogene PS b: duplication and silencing during primate evolution. Biochemistry 29, 7853–7861. 28. Edenbrandt, C. M., Lundwall, A., Wydro, R., and Stenflo, J. (1990) Molecular analysis of the gene for vitamin K-dependent protein S and its pseudogene. Cloning and partial gene organization. Biochemistry 29, 7861–7868. 29. Lundwall, A., Dackowski, W. R., Cohen, E. H., Shaffer, M., Mahr, A., Dahlbäck, B., Stenflo, J., and Wydro, R. M. (1986) Isolation and sequence of the cDNA of human protein S, a regulator of blood coagulation. Proc. Natl. Acad. Sci. USA 83, 6716–6720. 30. Hoskins, J., Norman, D. K., Beckmann, R. J., and Long, G. L. (1987) Cloning and characterization of human liver cDNA encoding a protein S precursor. Proc. Natl. Acad. Sci. USA 84, 349–353. 31. Gandrille, S., Borgel, D., Ireland, H., Lane, D. A., Simmonds, R., Reitsma, P. H., Mannhalter, C., Pabinger, I., Saito, H., Suzuki, K., Formstone, C., Cooper, D. N., Espinosa, Y., Sala, N., Bernardi, F., and Aiach, M. (1997) Protein S deficiency: a database of mutations. Thromb. Haemostasis 77, 1201–1214. 32. Nelson, R. M. and Long, G. L. (1992) Binding of protein S to C4b–binding protein. Mutagenesis of protein S. J. Biol. Chem. 267, 8140–8145. 33. Fernández, J. A., Heeb, M. J., and Griffin, J. H. (1993) Identification of residues 413–433 of plasma protein S are essential for binding to C4b–binding protein. J. Biol. Chem. 268, 16,788–16,794. 34. Chang, T. G. T., Maas, B. H. A., Ploos van Amstel, H. K., Reitsma, P. H., Bertina, R. M., and Bouma, B. N. (1994) Studies of the interaction between human protein S and human C4b–binding protein using deletion variants of human protein S. Thromb. Haemostasis 71, 461–467. 35. Griffin, J. H., Gruber, A., Fernández, J. A. (1992) Reevaluation of total, free and bound protein S and C4b–binding protein levels in plasma anticoagulated with citrate or hirudin. Blood 79, 3203–3211. 36. Mateo, J., Oliver, A., Borrell, M., Sala, N., Fontcuberta, J., and the EMET Group. (1997) Laboratory evaluation and clinical characteristics of 2132 consecutive unselected patients with venous thromboembolism. Results of the Spanish multicentric study on thrombophilia (EMET Study). Thromb. Haemost. 77, 444–451. 37. Bertina, R. M. (1990) Nomenclature proposal for protein S deficiency. XXXVI Annual meeting of the Scientific and Standardization Committee of the ISTH, Barcelona (Spain). 38. Comp, P. C. (1990) Laboratory evaluation of protein S status. Seminars Thromb. Haemostasis 16, 177–181. 39. Tripodi, A., Bertina, R. M., Conard, J., Pabinger, I., Sala, N., and Mannucci, P. M. (1992) Multicenter evaluation of three commercial methods for measuring protein S antigen. Thromb. Haemostasis 68, 149–154.
Protein S Gene
267
40. Boyer–Neumann, C., Bertina, R. M., Tripodi, A., D’Angelo, A., Wolf, M., Vigano D’Angelo, S., Mannucci, P. M., Meyer, D., and Larrieu, M. J. (1993) Comparision of functional assays for protein S: European collaborative study of patients with congenital and acquired deficiency. Thromb. Haemostasis 70, 946–950. 41. Gandrille, S., Borgel, D., Eschwege–Gufflet, V., Aillaud, M. F., Dreyfus, M., Matheron, C., Gaussem, P., Abgrall, JF., Jude, B., Sie, P., Toulon, P., and Aiach, M. (1995) Identification of 15 different candidate causal point mutations and three polymorphisms in 19 patients with protein S deficiency using a scanning method for the analysis of the protein S active gene. Blood 85, 130–138. 42. Formstone, C. J., Wacey, A. I., Berg, L. P., Rahman, S., Bevan, D., Rowley, M., Voke, J., Bernardi, F., Legnani, C., Simioni, P., Girolami, A., Tuddenham, E. G. D., Kakkar, V., and Cooper, D. N. (1995) Detection and characterization of seven novel protein S (PROS) gene lesions: evaluation of reverse transcript–polymerase chain reaction as a mutation screening strategy. Blood 86, 2632–2641. 43. Andersen, B. D., Lind, B., Philips, M., Hansen, A. B., Ingerslev, J, and Thorsen, S. (1996) Two mutations in exon XII of the protein S a gene in four thrombophilic families resulting in premature stop codons and depressed levels of mutated mRNA. Thromb. Haemostasis 76, 143–150. 44. Zöller, B., García de Frutos, P., and Dahlbäck, B (1995) Evaluation of the relationship between protein S and C4b–Binding protein isoforms in hereditary protein S deficiency demonstrating type I and type III deficiencies to be phenotypic variants of the same genetic disease. Blood 85, 3524–3531. 45. Duchemin, J., Gandrille, S., Borgel, D., Feugard, P., Alhenc–Gelas, M., Matheron, C., Dreyfus, M., Dupuy, E., Juhan–Vague, I., and Aiach, M. (1995) The Ser 460 to Pro substitution of the Protein Sα (PROS1) gene is a frequent mutation associated with free protein S (type IIa) deficiency. Blood 86, 3436–3443. 46. Espinosa–Parrilla, Y., Morell, M., Souto, J. C., Borrell, M., Heine–Suñer, D., Tirado, I., Volpini, V., Estivill, X., and Sala, N. (1997) Absence of linkage between type III protein S deficiency and the PROS1 and C4BP genes in families carrying the PS Heerlen allele. Blood 89, 2799–2806. 47. Bertina, R. M., Ploos Van Amstel, H. K., van Wijngaarden, A., Coenen, J., Leemhuis, M. P., Deutz Terlouw, P. P., van der Linden, I. K., and Reitsma, P. H. (1990) Heerlen polymorphism of protein S, an immunologic polymorphism due to dimorphism of residue 460. Blood 76, 538–548. 48. Cooper, D. N. and Krawczak, M. (1993) Indirect analysis of human genetic disease. In Human Gene Mutation (Cooper DN and Krawczak M, eds. ), BIOS Scientific Publishers Limited, Oxford, UK, pp 85–108. 49. Pericak–Vance, M. A. (1996) Analysis of genetic linkage data for mendelian traits, in Current Protocols in Human Genetics 1 (Dracopol, N. C. et al., eds. ), Wiley, NY, pp. 1.4.1–1.4.31. 50. Diepstraten, C. M., Ploos van Amstel, J. K., Reitsma, P. H., and Bertina, R. M. (1991) A CCA/CCG neutral dimorphism in the codon for Pro 626 of the human protein S gene PSα (PROS1). Nucleic Acids Res. 19, 5091.
268
Sala and Espinosa-Parrilla
51. Mustafa, S., Pabinger, I., and Mannhalter, C. (1996) Two new frequent dimorphisms in the protein S (PROS1) gene. Thromb. Haemostasis 76, 393–396. 52. Saiki, R. K., Gelfand, D. H., Stoffel, S., Scharf, S. J., Higuchi, R., Horn, G. T., Mullis, K. B., and Erlich, H. A. (1988) Primer–directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239, 487–491. 53. Orita, M., Suzuki, Y., Sekiya, T., and Hayashi, K. (1989) Rapid and sensitive detection of point mutations and DNA polymorphisms using the polymerase chain reaction. Genomics 5, 874–879. 54. Orita, M., Iwahana, H., Kanazawa, H., Hayashi, K., and Sekiya, T. (1989) Detection of polymorphisms of human DNA by gel electrophoresis as single strand conformation polymorphisms. Proc. Natl. Acad. Sci. USA 86, 2766–2770. 55. Hongyo, T., Buzard, G. S., Calvert, R., and Weghorst, C. M. (1993) “Cold SSCP”: a simple rapid and non–radioactive method for opimized single–strand conformation polymorphism analyses. Nucleic Acids Res. 21, 3637–3642. 56. Murray, V. (1989) Improved double–stranded DNA sequencing using the linear polymerase chain reaction. Nucleic Acids Res. 17, 8889. 57. Ploos Van Amstel, H. K., Huisman, M. V., Reitsma, P. H., Wouter ten Cate, J., and Bertina, R. M. (1989) Partial protein S gene deletion in a family with hereditary thrombophilia. Blood 73, 479–483. 58. Schmidel, D. K., Nelson, R. M., Broxson, E. H. Jr, Comp, P. C., Marlar, R. A., and Long, G. L. (1991) A 5. 3-kb deletion including exon XIII of the protein Sα gene occurs in two protein S-deficient families. Blood 77, 551–559. 59. Reitsma, P. H., Ploos Van Amstel, H. K., and Bertina, R. M. (1994) Three novel mutations in five unrelated subjects with hereditary protein S deficiency type I. J. Clin. Invest. 93, 486–492. 60. Mustafa, S., Pabinger, I., and Mannhalter, C. (1995) Protein S deficiency type I: Identification of point mutations in 9 of 10 families. Blood 86, 3444–3451. 61. Beaudet, A. L. and Tsui, L. C. (1993) A suggested nomenclature for designating mutations. Human Mutation 2, 245–248.
Screening for the G to A Transition
269
26 Screening for the G to A Transition at Position 20210 in the 3'-Untranslated Region (UTR) of the Prothrombin Gene Karen P. Brown 1. Introduction The prothrombin gene has recently been investigated as a candidate gene for venous thrombosis risk in selected individuals with a history of venous thrombosis (1). A genetic variation in the 3'-untranslated region (UTR) of the prothrombin gene, a G to A transition at nucleotide position 20210, was found in 18% of selected patients with a personal and family history of venous thrombosis, in 6.2% of unselected consecutive patients with a first episode of deep vein thrombosis, and in 2.3% of healthy control subjects (1). Plasma prothrombin levels have been investigated in individuals with the 20210 A allele and in normal individuals with the 20210 GG genotype and an association was found between the presence of the 20210 A allele and elevated plasma prothrombin levels. Prothrombin activation leads to the generation of the serine protease thrombin which exhibits procoagulant, anticoagulant, and antifibrinolytic activities. Elevation of plasma prothrombin levels in carriers of the 20210 A allele is associated with a 2.8-fold increased risk of venous thrombosis. The prothrombin 20210 A allele is detected by polymerase chain reaction amplification of a 345-bp fragment of the 3'-UTR of the prothrombin gene using a downstream mutagenic primer which introduces a HindIII recognition site in the presence of the A allele. The normal allele lacks the new recognition site and therefore remains at 345-bp after digestion with HindIII, whereas the mutant allele yields two fragments of 322 and 23 bp after enzyme digestion.
From: Methods in Molecular Medicine, Vol. 31: Hemostasis and Thrombosis Protocols Edited by: D. J. Perry and K. J. Pasi © Humana Press Inc., Totowa, NJ
269
270
Brown
2. Materials All reagents must be prepared using sterile distilled water. Unless specified, all chemicals are obtained from either BDH Laboratory Supplies (Poole, UK), or from the Sigma Corporation (Poole, UK) and are AnalaR grade or reagent grade.
2.1. DNA Extraction (see Note 1) 1. Cell lysis buffer: 0.32 M sucrose, 1% triton X-100 (v/v), 5 mM MgCl2, 10 mM Tris-HCl, pH 7.5. Store at 4°C. 2. TE buffer, pH 8.0: 10 mM Tris-HCl, pH 8.0, 1 mM EDTA. Store at room temperature. 3. Nuclear lysis buffer: 0.32 M lithium acetate, 2% (w/v) lithium dodecyl sulphate, 10 mM Tris-HCl, pH 8.0, 1 mM EDTA. Store at room temperature. 4. Biophenol/chloroform/ISA: Stabilized. Biotechnology grade (Camlab, Cambridge, UK). Store above 4°C. 5. 3 M sodium acetate, pH 5.5. Store at room temperature. 6. Absolute ethanol. Store at –20°C. 7. 70% Ethanol. Store at room temperature. 8. Sterile distilled water.
2.2. Polymerase Chain Reaction (PCR) Amplification of the Prothrombin Gene and Product Detection (see Note 3) 1. DNA polymerase: Thermus aquaticus DNA polymerase “Amplitaq” 5 U/mL PerkinElmer Corporation, Roche Molecular Systems, Warrington, UK). Store at –20°C. 2. 10X PCR buffer: 100 mM Tris-HCl, 500 mM KCl This buffer may vary depending upon the precise thermostable DNA polymerase). Store at –20°C. 3. 25 mM MgCl2. MgCl2 is frequently included in the PCR buffer or supplied with the DNA polymerase. Store at –20°C. 4. 20 mM dNTP working solution: 100 mM deoxynucleotide tri-phosphate stock solutions are available from many manufacturers, e.g., Pharmacia LKB Biotechnology (Milton Keynes, UK). A 20 mM working solution of dNTPs is prepared prior to use. Store at –20°C. 5. PCR primers: Oligonucleotide primers can be obtained from a number of molecular biology suppliers. The primers are used at a working solution at 50 pmols/µL. Store at –20°C. The primer sequences for amplifying the prothrombin 3'-UTR polymorphism are: Forward primer 5' -TCT AGA AAC AGT TGC CTG GC (nucleotides 19889–19908) and reverse primer 5'-ATA GCA CTG GGA GCA TTG AA*G C (nucleotides 20233–20212). A* is not present in the normal sequence and is introduced so that the combination of a nucleotide substitution and the genetic abnormality creates a new restriction enzyme cleavage site for HindIII (5'...A/GCTT...3'). 6. Positive DNA control (see Note 4). 7. Programmable thermal cycler, e.g., MJ-Research PTC-200 peltier programmable thermal cycler. Genetic Research Instrumentation Ltd (Essex, UK).
Screening for the G to A Transition
271
8. Electrophoresis equipment. Submarine gel and power pack apparatus, e.g., BioRad Laboratories Ltd (Hemel Hempstead, UK). 9. Loading buffer: 20% sucrose (w/v), 0.25% bromophenol blue (w/v), 0.25% xylene cyanol (w/v). Store at room temperature. 10. Molecular weight markers, e.g., ØX174/HaeIII markers. Store at –20°C. 11. Agarose: Agarose (ultra pure, electrophoresis grade) obtained from Gibco-BRL (Paisley, UK). A 1% agarose gel containing ethidium bromide 0.5 µg/mL is prepapred in 1X TBE buffer (0.09 M Tris-borate, 0.002 M EDTA).
2.3. Restriction Enzyme Digest of PCR Products 1. HindIII: Available from many manufacturers, e.g., New England Biolabs Inc. (Hitchin, UK). Supplied at 20,000 U/mL. Store at –20°C. 2. Spermidine: Obtained from Calbiochem Corporation (La Jolla, CA). A 1 M stock solution should be prepared and then diluted to give a 10 mM working solution. Store at room temperature. 3. Agarose: 2.5% agarose gel containing 0.5 mg/mL ethidium bromide in 1X TBE buffer (0.09 M Tris-borate, 0.002 M EDTA). 4. Loading buffer: 20% sucrose (w/v), 0.25% bromophenol blue (w/v), 0.25% xylene cyanole (w/v). Store at room temperature. 5. Molecular weight markers, e.g., ØX174 RF DNA/HaeIII markers. Store at –20°C.
3. Methods 3.1. DNA Extraction Genomic DNA is extracted from buffy coat preparations from venous samples collected into 3.8% trisodium citrate (1:9 ratio of anticoagulant to blood). The buffy coats may be stored at –20°C in order to batch tests. High molecular weight DNA is extracted from peripheral blood leukocytes using a modified version of a method published by Bell (2) (see Note 1). 1. Defrost frozen buffy coat specimens at 37°C. Transfer defrosted buffy coat to a 17 × 100 mm polypropylene tube and rinse the storage vial with cold cell lysis buffer. Make the total volume up to 10 mL with cold cell lysis buffer and mix gently by inversion. 2. Incubate on ice 15 min. 3. Centrifuge at 1000g for 10 min at 4°C to pellet the leukocytes. 4. Discard the supernatant carefully. Add 200 µL of TE buffer and vortex to resuspend the pellet. 5. Add 400 µL of nuclear lysis buffer and mix gently until the solution goes clear. 6. Add 600 µL of phenol/chloroform and mix gently. 7. Centrifuge at 1000g for 10 min at 4°C. 8. Carefully remove the supernatant in to a clean 1.5-mL tube. 9. Add 20 µL 3 M sodium acetate. 10. Add 1 mL ice cold ethanol and mix vigorously until the DNA can be seen as a white filamentous precipitate.
272
Brown
11. Centrifuge at full speed in a benchtop microfuge for 2 min to pellet the DNA. 12. Gently remove the supernatant and then add 500 µL 70% ethanol and centrifuge again at full speed for 1 min. 13. Remove as much of the ethanol as possible and allow the DNA pellet to dry. 14. Resuspend the DNA pellet in 40 µL of sterile distilled water. The solution should be clear.
3.2. Amplification of the Prothrombin Gene Genomic DNA is amplified using the polymerase chain reaction based on the method of Saiki et al. (3). Optimal PCR amplification of the target sequence may need to be varied when using different thermal cyclers. 1. Each PCR is performed in a total volume of 100 µL, which is set up on ice. (see Note 5). Combine the following: 80.5 µL sterile water, 10 µL 10X PCR buffer, 6 µL 25 mM MgCl2 (final concentration 1.5 mM), 1 µL 20 mM dNTPs (final concentration 200 µmols of each dNTP), 1 µL of amplification primers (containing 50 pmols of each primer), 0.5 µL (2 U) of the DNA polymerase (e.g., Amplitaq), and 2 µL template DNA (0.5–1.0 µg). 2. Vortex the PCR reaction mix and then transfer to a thermal cycler (see Note 6) and heat at 94°C for 5 min to denature the DNA followed immediately by: 52°C for 20 s, 74°C for 20 s, and 94°C for 20 s. A total of 40 cycles of amplification should be performed. On the final cycle the extension time should be increased to 10 min. 3. Check the efficiency and specificity of the PCR reaction by running 8 µL of the product on a 1% agarose gel containing ethidium bromide in 1X TBE buffer, including a DNA size marker in the first lane. 4. Visualize on a UV transilluminator and check the size of the PCR products. The predicted size is 345 bp.
3.3. Restriction Enzyme Digest of the PCR Product The engineered oligonucleotides plus the G to A transition at position 20210 of the prothrombin gene create a recognition site for the restriction enzyme HindIII, which can be detected following an incubation step and visualization of the DNA fragments on agarose gel (see Note 9). 1. Transfer 18 µL the of PCR product in to a clean tube. 2. Add 1 µL of 10 mM spermidine and 1 µL (20 U) of HindIII enzyme. Mix well and incubate overnight at 37°C (see Note 8). 3. Add 4 µL of loading buffer to the digest and load the samples onto a 2.5% agarose gel containing ethidium bromide in 1X TBE buffer including DNA size markers in the first lane. 4. Visualize the DNA fragments on a UV transilluminator.
3.4. Interpretation of Results (see Fig. 1) If G/G is present at position 20210, HindIII digestion will result in a 345-bp (uncut) fragment. This represents a normal genotype. If A/A is present at posi-
Screening for the G to A Transition
273
Fig. 1. HindIII digest of 345-bp fragment of the prothrombin gene. The arrow at 322 bp denotes the fragment produced when the G to A transition at position 20210 results in the creation of a HindIII recognition site. Lane 1, ØX174/HaeIII markers; lane 2, normal genotype; lane 3, heterozygous genotype; lane 4, heterozygous genotype; lane 5, normal genotype; lane 6, normal genotype.
tion 20210, then HindIII digestion will produce fragments of size 23 and 322 bp. This represents a homozygous genotype. If A/G are present at position 20210, HindIII digestion will produce fragments of size 23, 322, and 345 bp. This represents a heterozygous genotype. 4. Notes 1. DNA extraction kits that do not use phenol chloroform are available from a number of molecular biology suppliers. 2. Store all DNA specimens as it is useful to have a comprehensive DNA collection to study as and when new thrombophilia states are identified. 3. It is very important to use working procedures which will minimize the risk of contamination, e.g., designated pre- and post-PCR areas, positive displacement pipets, aerosol resistant tips, sterile water. 4. Positive and negative controls should be included with each set of reactions. A heterozygote is appropriate as a positive control. Negative controls consist of the total PCR reaction mixture, without template DNA, amplified together with the test DNA samples to ensure that no contamination of reagents has occurred. 5. 50 µL (or less) can be used as a PCR reaction volume. Adjust the components volumes accordingly. 6. It may be necessary to overlay PCR reactions with 100 µL of mineral oil depending on the type of thermal cycler used. 7. When a number of patients are being tested it may be appropriate to make a master mix of the PCR reagents and aliquot 98 µL to each test.
274
Brown
8. The overnight incubation step in the enzyme digest technique can be shortened, but times less than 4 h may produce undigested fragments. Only completely digested PCR products should be interpreted. 9. Digest products may be run on 6% nondenaturing polyacrylamide gels for enhanced resolution. 10. The prothrombin 20210 mutation analysis described produces a distinct result with no borderline values. The patient is normal, heterozygous or homozygous for the mutation.
References 1. Poort, S. R., Rosendaal, F. R., Reitsma, P. H., and Bertina, R. M. (1996) A common genetic variation in the 3'-untranslated region of the prothrombin gene is associated with elevated plasma prothrombin levels and an increase in venous thrombosis. Blood 88(10), 3698–3703. 2. Bell, G. I., Karman, J. H., and Rutter, W. J. (1981) Polymorphic DNA region adjacent to the 5' end of the human insulin gene. Proc. Natl. Acad. Sci. USA 78(9), 5759–5763. 3. Saiki, R. K., Scharf, S., Faloona, F., Mullis, K. B., Horn, J. T., Erlich, H. A., and Arnheim, N. (1985) Enzymatic amplification of the b-globin genomic sequences and restriction site analysis for the diagnosis of sickle cell anaemia. Science 230, 1350–1354.
Factor V Leiden Mutation
275
27 Screening for the Factor V Leiden Mutation Karen P. Brown 1. Introduction Familial clustering of thrombosis suggests that genetic risk factors are important in the pathogenesis of venous thromboembolism. However, until recently, well defined genetic defects such as antithrombin, protein C and protein S deficiencies accounted for less than 10% of patients with thrombosis. Resistance to the anticoagulant effect of activated protein C (APC) was first described as a cause of familial thrombophilia by Dahlback et al. (1). Resistance to APC has since emerged as the most common hereditary defect found in patients with venous thrombosis (1), and may account for more than one fifth of all cases of thrombophilia (2). Bertina et al. demonstrated that the APC phenotype was associated with a specific mutation in the factor V gene (3). APC resistance in more than 90% of cases is caused by a single point mutation in the gene for factor V (G to A transition at nucleotide position 1691), which predicts the replacement of Arginine (R) 506 in the APC cleavage site with a Glutamine (Q). The mutation is named Factor V Leiden, and occurs at a CpG dinucleotide, a mutation hotspot in the human genome. Inactivation of membrane bound factor Va by APC occurs through a series of three sequential proteolytic events in the heavy chain of factor V. APC cleavage at Arg 506 is the first event and is required for the subsequent exposure of APC cleavage sites at Arg 306 and Arg 679. The factor V Leiden mutation leads to a loss of positive charge at the APC cleavage site at Arg 506 resulting in an inefficient inactivation of factor Va. Reduced sensitivity to APC degradation, and increased thrombin generation, is the molecular basis for a hypercoagulable, state which constitutes a risk factor for thrombosis (4).
From: Methods in Molecular Medicine, Vol. 31: Hemostasis and Thrombosis Protocols Edited by: D. J. Perry and K. J. Pasi © Humana Press Inc., Totowa, NJ
275
276
Brown
APC resistance has recently become the most prevalent coagulation abnormality associated with venous thrombosis and has been reported to occur in 20–65% of patients with a history of venous thromboembolism (5). However, the abnormality has also been described in the asymptomatic general population at a prevalence of 3–11% (6). The absence of thrombotic disease in normal heterozygote carriers suggests that symptomatic thrombosis requires the simultaneous presence of both factor V Leiden and additional synergistic factors (inherited or acquired). Data suggests a higher risk of thrombosis in patients who have additional thrombophilic genetic defects (7). There is evidence that APC resistance combined with exogenous factors, may play an important role in the early manifestations of thromboembolism during infancy and childhood (8). Allelic frequency has been found to differ around the world. Allele frequency in Europeans has been reported at 4.4% with a high prevalence among Greeks (7%). The factor V Leiden mutation has not been reported in significant numbers in populations from Africa, Southeast Asia, Australasia and the Americas, and may partly explain the rarity of thromboembolic disease in these populations (9). Heterozygosity for the factor V Leiden mutation is associated with a five- to tenfold increased risk of thrombosis, whereas homozygous cases have a 50- to 100-fold increase in the risk of thrombosis (10). Factor V Leiden has also been associated with a four- to fivefold increased risk of recurrent thrombosis. Data suggests that patients with venous thromboembolism affected by factor V Leiden may require more prolonged anticoagulation than those without the mutation (11). However, several homozygotes are reported to remain asymptomatic even in the presence of triggering conditions (12). It is important to attempt to diagnose a thrombophilia state in patients with a thrombotic tendency in order to provide appropriate management, especially during at risk situations, and to prevent secondary episodes both in the patients themselves and in asymptomatic relatives identified through family studies. Heterozygous and homozygous phenotypes for APC resistance can be distinguished on the basis of a normalised APC sensitivity ratio, but the functional assay alone is insufficient for a definitive diagnosis as a range of functional test values in patients with and without the factor V Leiden mutation occasionally overlap. DNA analysis confirms the diagnosis of heterozygosity or homozygosity for the factor V Leiden mutation made by functional coagulation tests. DNA-based testing is not affected by the therapeutic use of anticoagulants, or the presence of coagulation factor abnormalities or inhibitors. A number of methods for detecting the factor V Leiden mutation have been reported (13–16). Direct sequencing is the most accurate method for genotyping, but is complicated and time consuming, and not suitable when large numbers of individuals require testing within a short “turn-round” time.
Factor V Leiden Mutation
277
The G to A transition at nucleotide position 1691 is associated with the loss of a recognition site for the restriction enzyme MnlI. This provides a rapid means of screening individuals for the factor V Leiden mutation. The APC cleavage site is located between Arg 506 and Gly 507 which are encoded by nucleotides 1690–1695 in exon 10 of the factor V gene. In the following method this area of exon 10 is amplified using the polymerase chain reaction (PCR) from genomic DNA using primers derived from a paper by Beauchamp et al. (6). The PCR product is then incubated with MnlI restriction enzyme and the fragments generated separated by agarose gel electrophoresis. The MnlI factor V Leiden detection method is a useful screening method which is ‘robust’ and requires only basic PCR experience to perform. Four base pairs create the MnlI recognition site (GAGG). An alternative code for Arg at this site (CGC or CGG) would also abolish the MnlI recognition site indicating the presence of a factor V Leiden mutation, but the individual would not exhibit APC resistance since the amino acid at position 506 would still be an Arg, preserving the APC cleavage site. An alternative method for detecting the G to A transition is also described using allele-specific primers. This approach is specific for the G to A base mutation. The basis for allele discrimination using allele specific primers is that a primer mismatched at its 3'-end with a DNA template will be less effectively used in the PCR reaction than one which is entirely complementary. Using intron sequence derived from Cripe et al. (19) two downstream oligonucleotide primers were designed (IVS 10 position 8 to position 1691 in exon 10, the 3'-terminal nucleotide of which was either complementary to the mutant sequence (mutation specific primer) or to the wildtype A sequence. Amplification using a common upstream primer and either the normal or mutant specific downstream primer generates a fragment when either the G or A or both are present. The specificity of the allele specific primers is improved by incorporating an additional mismatch at the penultimate position (T to A). As an internal amplification control a β globin fragment is coamplified. Using two reactions per patient, including either the normal or mutant primer in each, allele specific amplification is carried out and the results directly visualised by agarose gel electrophoresis. The specificity is incorporated in to the amplification reaction itself so no additional steps are required. Stringent PCR conditions are critical to the success with which sequence specific reactions discriminate between two different alleles. Variation in cycling protocols may be necessary. 2. Materials All reagents must be prepared using sterile distilled water. Unless specified, all chemicals were obtained from either BDH Laboratory Supplies (Poole, UK), or from the Sigma Corporation (Poole, UK) and were AnalaR or reagent grade.
278
Brown
2.1. DNA Extraction 1. Cell lysis buffer: 0.32 M sucrose, 1% triton X-100 (v/v), 5 mM MgCl2, 10 mM Tris-HCl, pH 7.5. Store at 4°C. 2. TE buffer, pH 8.0: 10 mM Tris-HCl, pH 8.0, 1 mM EDTA. Store at room temperature. 3. Nuclear lysis buffer: 0.32 M lithium acetate, 2% (w/v) lithium dodecyl sulphate, 10 mM Tris-HCl, pH 8.0, 1 mM EDTA. Store at room temperature. 4. Biophenol/Chloroform/ISA: Available from many suppliers (e.g., Camlab, Cambridge, UK). Store above 4°C. 5. 3 M sodium acetate, pH 5.5. Store at room temperature. 6. Absolute ethanol. Store at –20°C. 7. 70% Ethanol. Store at room temperature. 8. Sterile distilled water.
2.2. PCR Amplification of the Factor V Gene and Product Detection 1. DNA polymerase: Thermus aquaticus DNA polymerase, e.g., AmpliTaq 5 U/mL (Perkin-Elmer Corporation, Roche Molecular Systems Warrington, UK). Store at –20°C. 2. 10X PCR buffer: 100 mM Tris-HCl, pH 8.3, 500 mM KCl. Usually supplied with the DNA polymerase. Store at –20°C. 3. 25 mM MgCl2: Frequently included in the PCR buffer or supplied as an additional reagent with the DNA polymerase. Store at –20°C. 4. 20 mM dNTPs: 100 mM stock solutions are available from many manufacturers, e.g., Pharmacia LKB Biotechnology, Milton Keynes, UK. Store at –20°C. 5. PCR primers: Synthetic oligonucleotide primers can be obtained from a number of molecular biology suppliers. The primers are used at a concentration of 50 pmols/µL. Store at –20°C. Primers for the Mnl I-based method are based on the paper of Beauchamp et al. (6). Upstream primer (nucleotides 1623-1642) 5'-CAT GAG AGA CAT CGC CTC TG and downstream primer (Intron 10: nucleotides 45–68) 5'-GAC CTA ACA TGT TCT AGC CAG AAG. 6. Thermal cycler, e.g., MJ-Research PTC-200 peltier programable thermal cycler supplied by Genetic Research Instrumentation Ltd (Essex, UK). 7. Loading buffer: 20% sucrose (w/v), 0.25% bromophenol blue (w/v), 0.25% xylene cyanole (w/v). Store at room temperature. 8. ØX174 RF DNA/HaeIII size markers. Store at –20°C. 9. Agarose gels: 1% agarose containing 0.5 µg/mL ethidium bromide in 1X TBE buffer (0.09 M Tris-borate, 0.002 M EDTA).
2.3. Restriction Enzyme Digestion of PCR Products 1. MnlI: Obtained from New England Biolabs Inc., UK. Supplied at 5000 U/mL. Store at –20°C. 2. Spermidine: Obtained from Calbiochem Corporation (La Jolla, CA). Prepare a 1 M stock solution and dilute this to a 10 mM working solution. Store at room temperature.
Factor V Leiden Mutation
279
3. Agarose: 2% agarose gel containing 0.5 µg/mL ethidium bromide in 1X TBE buffer (0.09 M Tris-borate, 0.002 M EDTA). 4. Loading buffer: 20% sucrose (w/v), 0.25% bromophenol blue (w/v), 0.25% xylene cyanol (w/v). Store at room temperature. 5. ØX174 RF DNA/HaeIII size markers.
2.4. Allele-Specific Amplification of the Factor V Leiden Mutation This approach uses an identical method to the Mnl-I method but different primers. A single common upstream primer is employed: 5'-ACC ATG ATC AGA GCA GTT CA but two different downstream primers one of which is complementary to the wild type factor V sequence: 5'-ACA AAA TAC CTG TAT TCA TC and the other to the factor V Leiden sequence: 5'-ACA AAA TAC CTG TAT TCA TT. Primers for part of the β globin chain are used as amplification control primers: Upstream 5'-GGG CAT AAA AGT CAG GGC AGA GCC ATC and downstream: 5'-TGT GAC TAC GTT AGT AAG CAG ACA AAG. 3. Methods 3.1. DNA Extraction (see Note 1) The part of exon 10, which encodes the APC cleavage site at Arg 506 in the factor V gene is amplified from genomic DNA. Genomic DNA is extracted from buffy coat preparations from venous samples collected in to 3.8% trisodium citrate (1:9 ratio of anticoagulant to blood). The buffy coats may be stored at –20°C in order to batch tests. High molecular weight DNA is extracted from peripheral blood leukocytes using a modified version of a method published by Bell (17). 1. Defrost frozen buffy coat specimens at 37°C. Transfer defrosted buffy coat to a 17 × 100 mm polypropylene tube and rinse the storage vial with cold cell lysis buffer. Make the total volume up to 10 mL with cold cell lysis buffer and mix gently by inversion. 2. Incubate on ice 15 min. 3. Centrifuge at 1000g for 10 min at 4°C to pellet the leukocytes. 4. Discard the supernatant carefully. Add 200 µL of TE buffer and vortex to resuspend the pellet. 5. Add 400 µL of nuclear lysis buffer and mix gently until the solution goes clear. 6. Add 600 µL of phenol/chloroform and mix gently. 7. Centrifuge at 1000g for 10 min at 4°C. 8. Carefully remove the supernatant in to a clean 1.5-mL tube. 9. Add 20 µL 3 M sodium acetate. 10. Add 1 µL ice cold ethanol and mix vigorously until the DNA can be seen as a white filamentous precipitate. 11. Centrifuge at full speed in a benchtop minifuge for 2 min to pellet the DNA.
280
Brown
12. Gently remove the supernatant and then add 500 µL 70% ethanol and centrifuge again at full speed for 1 min. 13. Remove as much of the ethanol as possible and allow the DNA pellet to dry. 14. Resuspend the DNA pellet in 40 µL of sterile distilled water. The solution should be clear.
3.2. Amplification of the Factor V Gene Genomic DNA is amplified using the polymerase chain reaction based on a method by Saiki et al. (18). Optimal PCR amplification of the target sequence may need to be varied when using different thermal cyclers. 1. A 100-µL amplification reaction is set up and comprises: 80.5 µL sterile water, 10 µL of 10X PCR buffer, 6 µL 25 mM MgCl2, 1 µL 20 mM dNTPs, 1 µL containing 50 pmols of each amplification primer, 0.5 µL (2 U) of the thermostable DNA polymerase, e.g., AmpliTaq, and 2 µL of template DNA (0.5–1.0µg) (see Notes 2–5). 2. Vortex the PCR reaction mix briefly and then transfer to a thermal cycler (see Note 4) and heat at 94°C for 5 min immediately followed by a biphasic amplification protocol comprising: 55°C 30 s, 94°C 20 s for 40 cycles. On the last cycle the extension time should be increased to 10 min. 3. Transfer 8 µL of the PCR product into a clean tube and add 2 µL loading buffer. 4. Electrophorese the PCR product in 1% agarose gel containing ethidium bromide in 1X TBE buffer, including a DNA size marker in the first lane. 5. Visualize the digest products on a UV transilluminator and photograph. The predicted fragment size is 147 bp.
3.3. Restriction Enzyme Digest of the PCR Product The G to A transition results in the loss of a recognition site for the restriction enzyme MnlI, which can be detected following an incubation step and visualization of the DNA fragments on agarose gel. 1. Transfer 18 µL of PCR product in to a clean tube. 2. Add 1 µL 10 mM spermidine, 1 µL BSA, and 1 µL (5 U) of the MnlI enzyme. Mix well and incubate overnight at 37°C (see Note 6). 3. Add 4 µL loading buffer to the digested products. 4. Electrophorese the DNA fragments in 2% agarose gel containing ethidium bromide in 1X TBE buffer including DNA size markers in the first lane (see Note 7). 5. Visualize the DNA fragments on a UV transilluminator and photograph (see Fig. 1).
3.4. Allele-Specific Amplification for the Detection of the Factor V Leiden Mutation 1. For each patient sample to be tested two reaction tubes are required. Each PCR is performed in a total volume of 100 µL. 2. For the “normal allele-specific reaction” combine 78.5 µL of sterile water with 10 µL of 10X PCR buffer, 6 µL of 25 mM MgCl2, 1 µL of 20 mM dNTPs, and 1µL
Factor V Leiden Mutation
281
Fig. 1. MnlI digest of 147-bp fragment of factor V gene. The arrow at 122-bp denotes the fragment produced when the G to A transition at position 1691 results in the loss of an Mnl I recognition site. Lane 1, ØX174 DNA/HaeIII markers; lane 2, normal genotype; lane 3, heterozygous genotype; lanes 4–7, normal genotype; lane 8, heterozygous genotype; lane 9, homozygous genotype; lanes 10,11, normal genotype.
3.
4.
5. 6. 7.
(50 pmols) β globin primers. 1 µL (50 pmols) of the common upstream primer and 1µL (50 pmols) of the wildtype (normal) downstream primer. Mix and add 2 µL of template DNA and 0.5 µL (2 U) of a thermostable DNA polymerase, e.g., AmpliTaq. For the “mutant allele-specific reaction” combine 78.5 µL of sterile water with 10 µL of 10X PCR buffer, 6 µL of 25 mM MgCl2, 1 µL of 20 mM dNTPs, and 1µL (50 pmols) β globin primers. 1 µL (50 pmols) of the common upstream primer and 1 µL (50 pmols) of the mutant downstream primer. Mix and add 2 µL of template DNA and 0.5 µL (2 U) of a thermostable DNA polymerase, e.g., AmpliTaq. Vortex the PCR mix then transfer to a thermal cycler and heat at 94°C for 5 min, immediately followed by: 94°C for 20 s, 45°C for 20 s, and 72°C for 20 s. 40 cycles of amplification should be performed and on the last cycle the extension time should be increased to 10 min. Transfer 8 µL of the PCR product in to a clean tube and add 2 µL of loading buffer. Electrophorese the PCR product in a 1% agarose gel containing ethidium bromide in 1X TBE. Include a size marker in the first lane. Visualize the gel on a UV transilluminator and photograph (see Fig. 2).
282
Brown
Fig. 2. Allele-specific PCR for the Factor V Leidien mutation. Amplification patterns for five individuals with the the possible factor V 1691 genotypes are shown. DNA from a normal individual (FV 1691 G/G) only produces a PCR product of 222bp with the normal primer (patients 2–4).
3.5. Interpretation of Results If A/A is present at position 1691, MnlI digestion will produce fragments of sizes 25, 37, and 85 bp (Fig. 1). This represents a normal genotype. If G/G is present at position 1691, MnlI digest will produce fragments of size 25 and 122 bp. This represents a homozygous genotype. If A/G is present at position 1691, MnlI digest will produce fragments of size 25, 37, 85, and 122 bp. This represents a heterozygous genotype. In the case of allele-specific amplification, if an individual is heterozygous for the factor V 1691 G/A mutation, then a PCR product is seen with both the normal and the mutant specific primer reactions (Fig. 2: patient 1). DNA from an individual who is homozygous for this mutation (FV 1691 A/A) produces a PCR product in the reaction with the mutant specific primer only (patient 5). When a 222-bp fragment is absent, the 657-bp β globin product must be present to determine that a successful PCR reaction has taken place. 4. Notes 1. Store all DNA specimens because although the factor V Leiden mutation accounts for a significant proportion of thrombophilia cases, a predisposing cause for
Factor V Leiden Mutation
2.
3.
4. 5. 6.
7.
283
thrombosis remains unidentifiable in a number of patients. It is likely that in the future new thrombophilia states will be identified, and it may be useful to already have a comprehensive DNA collection. One of the APC cleavage sites in factor VIII is encoded by a sequence of nucleotides, which also involves a CpG dinucleotide and so it may be possible that a similar defect in APC mediated inactivation of factor VIIIa may also be associated with a predisposition to thrombosis (20). It is very important to use working procedures which will minimise the risk of contamination, e.g., designated pre- and post-PCR areas, positive displacement pipets, aerosol resistant tips, sterile water. Positive and negative controls should be included with each set of reactions. A factor V Leiden heterozygote is appropriate as a positive control. Negative controls consist of the total PCR reaction mixture without template DNA cycled along with the tests to confirm that no contamination of reagents has occurred. It may be necessary to overlay PCR reactions with 100 µL of mineral oil depending on the type of thermal cycler used. When a number of patients are being tested it may be appropriate to make a master mix of the PCR reagents and aliquot 98 µL to each test. The overnight incubation step in the MnlI enzyme digest technique can be shortened, but times less than 4 hours may produce undigested fragments. It may be useful when electrophoresing the MnlI digest products to run a sample of undigested PCR product in the last lane. This makes it easier to detect undigested fragments in the test digests. Only completely digested PCR products should be interpreted. MnlI digest products may be run on 6% polyacrylamide gels for better resolution. The 25- and 37-bp fragments are not clear on 2% agarose gels but they are not as important as the 85- and 122-bp fragments for genotype interpretation.
References 1. Dahlback, B., Carlsson, M., and Svensson, P. J. (1993) Familial thrombophilia due to a previously unrecognised mechanism characterised by poor anticoagulant response to activated protein C: prediction of a cofactor to activated protein C. Proc. Natl. Acad. Sci. USA 90, 1004–1008. 2. Koster, T., Rosendaal, F.R., de Ronde, H., Briet, F., Vandenbroucke, J.P., and Bertina, R.M. (1993) Venous thrombosis due to poor anticoagulant response to activated protein C:Leiden thrombophilia study. Lancet 342, 1503–1506. 3. Bertina, R. M., Koeleman, B. P. C., Koster, T., Rosendaal, F. R., Dirven, R. J., de Ronde, H., van der Velden, P., A., and Reitsma, P. H. (1994) Mutation in blood coagulation factor V associated with resistance to activated protein C. Nature 369, 64–67. 4. Kalafatis, M., Bertina, R. M., Rand, M. D., and Mann, K. G. (1995) Characterisation of the molecular defect in factor V R506Q. J. Biologic. Chem. 270, 4053–4057. 5. Halbmeyer, W-M., Haushofer, A., Schon, R., and Fischer, M. (1994) The prevalence of poor anticoagulant response to activated protein C resistance (APC resis-
284
6.
7. 8.
9.
10.
11.
12.
13.
14.
15.
16. 17.
18.
Brown
tance) among patients suffering from stroke or venous thrombosis and among healthy subjects. Blood Coagul. Fibrinolysis 5, 51–57. Beauchamp, N. J., Daly, M. E., Hampton, K. K., Cooper, P. C., Preston, F. E., and Peake, I. R. (1994) High prevalence of a mutation in the factor V gene within the UK population: relationship to activated protein C resistance and familial thrombosis. Br. J. Haematol. 88, 219–222. Rees, D. C., Cox, M., and Clegg, J. B. (1995) World distribution of factor V Leiden. Lancet Oct 28;346,(8983), 1133–1134. De-Stefano, V. and Leone, G. (1995) Resistance to activated protein C due to mutated factor V as a novel cause of inherited thrombophilia. Haematologica 80 (4), 344–356. Nowak-Gottl, U., Koch, H.G., Aschka, I., Kohlhase, B., Vielhaber, H., Kurlemann, G., Oleszcuk-Raschke, K., Kehl, H. K., Jurgens, H., and Schneppenheim, R. (1996) Resistance to activated protein C (APCR) in children with venous or arterial thromboembolism. Br. J. Haematol. Mar;92(4), 992–998. Dahlback, B. (1995) New molecular insights in to the genetics of thrombophilia. Resistance to activated protein C caused by Arg 506 to Gln mutation in factor V as a pathogenic risk factor for venous thrombosis. Thromb. Haemostasis Jul;74(1), 139–148. Ridker, P. M., Miletich, J. P., Stampfer, M. J., Goldhaber, S. Z., Lindpaintner, K., and Hennekens, C. H. (1995) Factor V Leiden and risks of recurrent idiopathic venous thromboembolism. Circulation Nov 15;92(10), 2800–2802. Greengard, J. S., Eichinger, S., Griffin, J.H., and Bauer, K. A. (1994) Brief report: variability of thrombosis among homozygous siblings with resistance to activated protein C due to an Arg to Gln mutation in the gene of factor V. N. Engl. J. Med. 331, 1559–1562. Beauchamp, N. J., Daly, M. E., Cooper, P. C., Preston, F. E., and Peake, I. R. (1994) Rapid two-stage PCR for detecting factor V G1691A mutation. Lancet 344, 694–695. Rabes, J. P., Trossaert, M., Conard, J., Samama, M., Giraudet, P., and Boileau, C. (1995) Single point mutation at Arg 506 of factor V associated with APC resistance and venous thromboembolism: improved detection by PCR-mediated sitedirected mutagenesis. Thromb. Haemostasis Nov;74(5), 1379-1380. van-de-Locht, L. T., Kuypers, A. W., Verbruggen, B. W., Linssen, P. C., Novakova, I. R., and Mensink, E. J. (1995) Semi-automated detection of the factor V mutation by allele specific amplification and capillary electrophoresis. Thromb. Haemostasis Nov;74(5), 1276–1279. Gandrille, S., Alhenc-Gelas, M., and Aiach, M. (1995) A rapid screening method for the factor V Arg 506 to Gln mutation. Blood Coagul. Fibrinolysis 6, 245–248. Bell, G. I., Karman, J. H., and Rutter, W. J. (1981) Polymorphic DNA region adjacent to the 5' end of the human insulin gene. Proc. Natl. Acad. Sci. USA 78(9), 5759–5763. Saiki, R. K., Scharf, S., Faloona, F., Mullis, K. B., Horn, J. T., Erlich, H. A., and Arnheim, N. (1985) Enzymatic amplification of the β-globin genomic sequences
Factor V Leiden Mutation
285
and restriction site analysis for the diagnosis of sickle cell anaemia. Science 230, 1350–1354. 19. Cripe, L. D., Moore, K. D., and Kane, W. H. (1992) Structure of the gene for human coagulation factor V. Biochemistry 31, 3777–3785. 20. Gitschier, J., and Wood, W. I. (1992) Sequence of exon-containing regions of the human factor V gene. Human Mol. Genet. 1, 199,200.
Multiple PCR
287
28 Multiplex PCR for Detection of the Prothrombin 3'-UTR (G20210A) Polymorphism and the Factor V Leiden Mutation Gillian Mellars, P. Vincent Jenkins, and David J. Perry 1. Introduction Prothrombotic evaluation of patients with a history—and in particular a family history—of venous thromboembolic disease is becoming increasingly important as our understanding of the molecular abnormalities that underlie this clinical disorder increases. A recently described G→A polymorphism at position 20210 in the 3'-untranslated region of the prothrombin gene (F2 3'UTR) has been found to be associated with an increased risk of venous thrombotic disease. In the Leiden Thrombophilia Study (LETS), the prevalence of carriers of the 20210 A allele in the healthy population was 2.3%, among patients with a single objectively proven DVT 6.2% and in a selected group of patients with a personal and family history of venous thrombosis 18%. In order to simplify detection of the F2 3'-UTR polymorphism and the Factor V Leiden mutation (Arg506Gln), a simplified multiplex method has been developed in our laboratory, using previously described primers (1,2), that, in the presence of either mutation, create a novel HindIII site. While the F2 3'-UTR variant represents a common but relatively low risk factor for venous thrombosis, it may not warrant an introduction of a specific PCR test. The multiplex method allows the detection of the F2 3'-UTR variant alongside factor V genotyping at no significant extra cost in time or resources.
From: Methods in Molecular Medicine, Vol. 31: Hemostasis and Thrombosis Protocols Edited by: D. J. Perry and K. J. Pasi © Humana Press Inc., Totowa, NJ
287
288
Mellars, Jenkins, and Perry
2. Materials 2.1. Amplification of the Factor V Leiden Mutation and the F2 3'-UTR Polymorphism Amplification reactions are carried out in 50-µL reaction volumes comprising: 1. 16 mM (NH4)2SO4, 67 mM Tris-HCl, pH 8.8, 0.01% Tween 20, 0.125 mM dNTPs, 1.5 mM MgCl2, and 1.25 U a thermostable DNA polymerase. 2. 25 pmol of the F2 3'-UTR upstream primer 5'-TCTAGAAACAGTTGCCT-GGC and 25 pmol of the downstream primer 5'-ATACCACTGGGAGCATTGAA*GC (where A* is a foreign nucleotide). 3. 100 pmol of the factor V gene upstream primer 5'-TCAGGCAGGAACAACACCAT primer and 100 pmol of the downstream primer 5'-GGTTACTTCAAGGACAAAATACCTGTA-A*A*G*CT (where A*A*G* are foreign nucleotides). 4. Thermal cycler. 5. Light mineral oil (e.g., Sigma). 6. 0.5-mL sterile PCR tubes (e.g., Advanced Biotechnologies, Epsom, Surrey, UK). 7. Loading buffer: 40% sucrose, 0.05% bromophenol blue, 0.05% xylene cyanole.
2.2. HindIII Digestion of the Amplified PCR Product 1. 2. 3. 4.
Amplified PCR product from Subheading 2.1. Hind III restriction enzyme at 10 U/µL. U-shaped microtiter plates (e.g., Nunc immunoplate). 1% Seakem® LE agarose + 1% NuSieve® GTG® agarose (Flowgen, Lichfield, UK) gel in 1X Tris-Borate-EDTA (TBE). 5. Loading buffer: 40% Sucrose (w/v), 0.05% bromophenol blue (w/v), 0.05% xylene cyanol (w/v).
3. Methods 3.1. Amplification of the Factor V Leiden Mutation and the F2 3'-UTR Polymorphism 1. Prepare a “Master Mix” comprising all the reagents minus the DNA polymerase and the DNA in a “clean area” using aerosol resistant tips. Irradiate the master mix on a UV transilluminator for 10 min. Add the DNA polymerase, vortex briefly, and place on ice until required. 2. Add 49 µL of the master mix to a sterile 0.5-mL sample tube, 1.5 µL of DNA and overlay with 20–30 µL of light mineral oil. A negative control should be included in each batch of amplifications together with a heterozygous control for the factor V Leiden and Prothrombin 3'-UTR Polymorphism. 3. Carry out 40 cycles of amplification consisting of an initial denaturation at 94°C for 4 min then 94°C for 30 s, 56°C for 60 s, and 72°C for 30 s. On the final cycle, the extension time was increased to 10 min. 4. Following amplification mix 5 µL of each PCR product with 2 µL of loading buffer and electrophorese in a 2% agarose gel to check the efficiency and specificity of the amplification reaction.
Multiple PCR
289
3.2. HindIII Digestion of the PCR Product 1. Place a U-well microtiter place on ice and mark the required number of wells. Using a repeating pipet, dispense 2 µL of HindIII into all the wells required. 2. Add 40 µL of the PCR product to each well, mix gently, and seal the plate. 3. Incubate at 37°C overnight (12–16 h). 4. Add 10 µL of loading buffer to each well and load 45 µL onto a 1% agarose/1% Nuseive GTG gel (in 1X TBE). Lane 1 should contain a size marker, e.g., ØX174/ HaeIII. 5. Electrophorese until the xylene cyanol marker is almost at the end of the gel. Visualize under UV light and photograph.
3.3. Amplification Generates: 1. A 345-bp fragment that spans the region of the prothrombin gene encompassing the F2 3'-UTR polymorphism 2. A 241-bp fragment that spans the region of the factor V gene encoding the factor V Leiden mutation.
The use of the mutant primers creates a restriction site for the enzyme HindIII in both cases when either or both of the substituted nucleotides are present. The F2 3'-UTR allele containing the G→A mutation generates two fragments of 322-bp and 23-bp following digestion with HindIII and a factor V allele with the Leiden mutation generates fragments of 209-bp and 32-bp following digestion with HindIII. References 1. Poort, S. W., Rosendaal, F. R., Retisma, P. H., and Bertina, R. M. (1996) A common genetic variation in the 3'-untranslated region of the prothrombin gene is associated with elevated plasma prothrombin levels and an increase in venous thrombosis. Blood 88, 3698–3703. 2. Gandrille, S., Alhenc-Gelas, M., and Aiach, M. (1995) A rapid screening method for the Factor V Leiden Arg 506→Gln mutation. Blood Coag. Fibrinol. 6, 245–248. 3. Brown, K., Luddington, R., Williamson, D., Baker, P., and Baglin, T. (1997) Risk of venous thromboembolism associated with a G to A transition at position 20210 in the 3'-untranslated region of the prothrombin gene. Br. J. Haematol. 98, 907–909.
Isoelectric Focusing
291
29 Isoelectric Focusing and Immunodetection of Plasma Antithrombin Martina Daly 1. Introduction The first studies of plasma protein variation relied predominantly on conventional electrophoretic methods in media such as starch, agar, or cellulose acetate, which separated molecules on the basis of their relative differences in net charge and size. The introduction of isoelectric focusing in polyacrylamide gels (IEF/PA) led to the discovery of additional variability previously undetected by conventional electrophoretic techniques. IEF/PA separates molecules on the basis of their isoelectric points (pI) in a pH gradient generated by the application of an electric field to a mixture of buffer components, known as carrier ampholytes, which are present within a polyacrylamide matrix. Thus, it is possible to discriminate between molecules having a difference in pI as little as 0.01 pH units. The exact composition of isolectric focusing gels may be varied depending on the protein under investigation. In particular, alternative pH gradients may be generated by mixing ampholytes in the appropriate pH range. When used in combination with a simple “native” blotting procedure (1), the basic IEF/PA protocol described below has proven successful in our hands for studying microheterogeneity of plasma antithrombin and, with minor modifications to optimize results, it may be used to analyze any acidic protein of interest, provided a specific antiserum is available. 2. Materials 2.1. Preparation of the Gel/Application of Samples and Electrofocusing The following solutions should be prepared using deionized water. 1. Solution A: 11.64% acrylamide, 0.36% bisacrylamide. Store in a dark bottle at 4°C for up to 2 mo (see Note 1). From: Methods in Molecular Medicine, Vol. 31: Hemostasis and Thrombosis Protocols Edited by: D. J. Perry and K. J. Pasi © Humana Press Inc., Totowa, NJ
291
292
Daly
2. Solution B: 40% sucrose. Prepare fresh when required. 3. Stock acrylamide solution: 100 mL solution A, 50.8 mL solution B, 37.4 mL water. Filter and store in a dark bottle at 4°C for up to 2 mo. 4. pH 4.0–6.0 Ampholines (Pharmacia Biotech, Uppsala, Sweden). The various commercial carrier ampholytes are available in 25-mL bottles that are stored at 4°C. 5. 5% solution of N,N,N´,N´-tetramethylethylenediamine (TEMED). Store at room temperature. 6. 10% Ammonium persulfate, prepare fresh daily. 7. Glass plates: two measuring 125 × 260 × 3 mm and a third measuring 125 × 260 × 1 mm. 8. Ethanol. 9. Electrode strips, e.g., Pharmacia. 10. Sample application strip, e.g., Pharmacia. 11. 1 M H3PO4. Store at room temperature for up to 2 mo. 12. 1 M NaOH. Store at room temperature for up to 2 mo. 13. Electrophoresis unit (e.g., Pharmacia Multiphor II) connected to a thermostatic circulator capable of cooling to 4°C.
2.2. Transfer of Focused Proteins to Nitrocellulose 1. 0.15 M NaCl. Store at room temperature for up to 2 mo. 2. Nitrocellulose membranes, e.g., Schleicher and Schuell (Dassel, West Germany). 3. Whatman 3MM chromatography paper.
2.3. Immunodetection of Antithrombin 1. Blocking buffer: 2% BSA, 0.15 M NaCl, 0.05 M Tris-HCl, pH 7.4. Store at 4°C for up to 1 wk. 2. Wash buffer: 0.15 M NaCl, 0.05 M Tris-HCl, pH 7.4. Store at room temperature for up to 2 mo. 3. Sheep anti-human antithrombin immunoglobulins, e.g., Serotec, Oxford, England. 4. Horseradish peroxidase conjugated rabbit anti-sheep immunoglobulins, e.g., Dako, High Wycombe, England. 5. Peroxidase substrate is prepared fresh as required by dissolving 60 mg 3-amino9-ethylcarbazole (AEC) (Sigma, Dorset, England) in 16 mL dimethyl sulfoxide and diluting to 200 mL using 0.02 M acetate buffer, pH 5.0. 400 µL of 30% H2O2 is then added immediately before use.
3. Methods 3.1. Isoelectric Focusing
3.1.1. Preparation of the Gel 1. Before preparing the gel, thoroughly clean three glass plates, two with dimensions 125 × 260 × 3 mm and a third measuring 125 × 260 × 1 mm, in warm water with detergent, rinse well in deionized water, and swab with ethanol. 2. Allow the plates to dry and arrange them so that the thin plate is separated from one of the thick plates by a 0.8-mm U-shaped polystyrene gasket 5 mm in width
Isoelectric Focusing
3. 4.
5. 6.
293
and shaped so that the open end of the U-frame corresponds with the shorter side of the glass plates (see Note 2). Place the second thick plate behind the thin plate and then clamp the mould on the three sides corresponding to the gasket with bulldog clips. To prepare 25 mL of gel, sufficient for one cassette, add the following to a 250 mL side arm flask: Stock acrylamide solution 23.525 mL, 1.25 mL ampholytes (pH range of 4.0–6.0), and 0.125 mL of 5% TEMED. Degas the solution by connection to a water pump and then add 0.1 mL of 10% ammonium persufate. Immediately pipet the gel solution into the cassette, filling it to capacity and then lie the cassette horizontally on the work surface to allow polymerisation to take place. Gels can be used immediately following polymerisation or they may be sealed in Saran wrap and stored for up to 5 d at 4°C prior to use.
3.1.2. Application of Samples and Electrofocusing 1. When the gel has polymerized, remove the bulldog clips and thick backing plate and lay the cassette on the work surface. Using a thin spatula or blade, carefully prise the second thick plate away from the gel. Remove the gasket and straighten any rough edges using a blade and ruler (see Notes 3 and 4). 2. Trim two electrode strips to slightly shorter than the length of the gel. Soak one strip in 1 M H3PO4 (anode) and lay it lengthwise on the gel approximately 3mm from the edge. Soak the second strip in 1 M NaOH (cathode) and lay it along the opposite edge. Lay a sample application strip approx 10 mm from the cathode (see Note 5). 3. Place the glass plate, supporting the prepared gel, on the cooling plate of an electrophoresis unit connected to a thermostatic circulator set at 4°C. 4. Pipet control and test plasma samples into the wells of the sample application strip, leaving approximately 1 cm of the gel free of sample for analysis of the pH gradient after focusing. Apply 4–10 µL of undiluted citrated or EDTA anticoagulated plasma depending on the capacity of the well (see Note 6). 5. When all the samples have been loaded, connect the electrodes to a high voltage power supply and, maintaining the power at 20 W throughout, focus samples by increasing the voltage at intervals over 2 h as follows: 200 V × 15 min, 400 V × 15 min, 600 V × 15 min, 800 V × 15 min, 1080 V × 30 min, 2000 V × 30 min. The power usually becomes limiting in the final 30 min and samples are usually focused for a total of approx 1850 Vh (see Note 7). 6. The pH gradient may be analysed by elution of ampholytes from 5-mm segments of gel into 4 -mL aliquots of hot distilled water and measurement of pH.
3.2. Transfer of Focused Proteins to Nitrocellulose 1. Remove and discard the electrode pads from the gel. Using a scalpel and ruler, cut and discard the edges of the gel which had been beneath the electrodes. 2. Slowly, immerse the gel, on its supporting glass plate, in 0.15 M NaCl and leave it for 5 min without shaking (see Note 8).
294
Daly
3. Meanwhile, cut a piece of nitrocellulose membrane and two pieces of 3MM chromatography paper to the same size as the trimmed gel. Wear gloves and use a forceps while handling nitrocellulose to avoid protein contamination of the transfer. Equilibrate the nitrocellulose membrane in 0.15 M NaCl for at least 5 min before blotting (see Note 9). 4. Carefully remove the gel, still on its supporting glass plate, from the saline and place it on the work surface. Remove any excess liquid from the edges of the plate and gel by gently dabbing with tissue paper. 5. Lay the presoaked nitrocellulose membrane on top of the gel, taking care to exclude air bubbles. Using a scalpel or pin, make a mark in the nitrocellulose to assist in orientating it with respect to the gel after protein transfer. Place the two pieces of 3MM paper on top of the nitrocellulose and then overlay the gel sandwich with a wad of paper towels. Place a glass plate and weight on top of the towels and leave for 1 h before removing the paper towels and filter paper. The nitrocellulose replica binds strongly to the gel and can be easily separated by wetting the blot with saline or distilled water. 6. Antithrombin may either be detected immediately following blotting or the blot may be stored dry at –20˚C until required (see Note 10).
3.3. Immunodetection of Antithrombin Unless otherwise stated, all of the following steps should be carried out at room temperature with gentle rocking. 1. 2. 3. 4. 5. 6. 7. 8.
Incubate the nitrocellulose blot in blocking buffer for 30 min (see Note 11). Decant the blocking buffer and replace with wash buffer for 10 min (see Note 11). Repeat step 2 giving the blot 3 10-min washes in total. Incubate the blot in sheep anti-human antithrombin immunoglobulins diluted 1/1500 in blocking buffer for 30 min (see Note 12). Repeat steps 2 and 3. Incubate the blot in horseradish peroxidase conjugated rabbit anti-sheep immunoglobulins diluted 1/1500 in blocking buffer for 30 min (see Note 12). Repeat steps 2 and 3. Incubate, without shaking, in freshly prepared peroxidase substrate. A red colored precipitate should develop within 10–30 min. Stop the reaction by washing the membrane in deionised water and then press it dry between sheets of filter paper. The blot should be photographed for record purposes as the substrate color fades with time, particularly when exposed to light (see Note 13).
4. Notes 1. Acrylamide is a neurotoxin with cumulative effects. Wear gloves and a mask when weighing out the acrylamide and bisacrylamide powders and always wear gloves when handling acrylamide solutions. 2. In most flat bed IEF systems, the gel is cast between two glass plates. The plates are usually separated by a gasket which, should leakage be a problem, may be lightly coated with silicone grease.
Isoelectric Focusing
295
3. Ideally, for most efficient cooling during focusing, the gel should be on the thin plate after dismantling the cassette. To facilitate this, the surface of the thick plate that is in contact with the polymerization mixture may be silanized before use. This can be done by pouring a small volume of silanizing solution onto the surface of the plate and wiping with tissues before swabbing with ethanol. Gloves should be worn during the procedure which should be carried out in a fume hood. 4. It is important when separating the thick glass plate from the gel surface not to disturb the gel attached to the lower plate as this may affect electrical conductivity in the gel and cause distortion of the pH gradient during focusing. 5. It is important to lay the electrode strips straight and parallel to one another and in such a way that the platinum wire electrodes of the electrophoresis apparatus lie centred along the strips. This can be ensured by laying a graph paper grid beneath the gel plate when positioning the electrode strips. 6. Samples may be applied using a variety of methods. Perhaps the simplest is to use an application strip made of silicone rubber which contains either slots or circular holes. These strips can be washed afterwards and used repeatedly. Alternatively, samples may be applied on 10 × 5-mm pieces of 3MM chromatography paper. However, due to uncontrolled adsorption of the sample by the paper this is not ideal when the volume of sample available for analysis is limited. 7. Following electrofocusing, it is possible to see focused ampholyte zones on the gel as a series of parallel bands perpendicular to the direction of the electric field. Distorted or wavy bands may be indicative of high salt concentrations in certain samples. Alternatively, inefficient cooling of the gel during electrophoresis may have caused local heating and distortion of the pH gradient. This may be overcome by wetting the cooling block of the electrophoresis apparatus with light paraffin oil before lowering the gel plate onto the block taking care to exclude air bubbles. 8. This step is included in order to remove the carrier ampholytes from the gel before protein transfer. Although not essential, it appears to result in less background staining on the blot after immunodetection. 9. As protein transfer relies only upon the liquid present in the gel to transfer the proteins by capillary action to the nitrocellulose, it is essential that the nitrocellulose and the 3MM paper pieces are cut to the same size as the gel. 10. Nitrocellulose becomes brittle when stored at –20˚C and must therefore be allowed to thaw at room temperature for approx 5 min before incubation in blocking solution. 11. The intensity of nonspecific background staining can be reduced by including this blocking step in which any protein binding sites remaining on the nitrocellulose membrane can be blocked by albumin. The 2% BSA may be replaced by the less expensive alternative of 5% nonfat dried milk if desired. Where the level of nonspecific staining is unacceptable, this may be reduced by the inclusion of 0.02% Tween-20 in the blocking and washing solutions. 12. Appropriate dilutions of alternative antisera should be determined experimentally. 13. Plasma antithrombin is present as a series of eight isoforms varying in isoelectric point from 4.7 to 5.2 (2). This microheterogeneity may be explained entirely by differential sialylation of antithrombin since exhaustive neuraminidase treatment
296
Daly of plasma prior to IEF results in a reduction of heterogeneity to one major antithrombin isoform of pI 6.1, reflecting the removal of sialic acid. Pretreatment of plasma with varying amounts of heparin leads to an anodal shift in the antithrombin isoforms due to the formation of negatively charged complexes having more acidic pI values. These methods may therefore be adapted to investigate antithrombin variants suspected of having altered affinity for heparin (e.g., antithrombin Basel) (3).
References 1. Reinhart, M. P. and Malamud, D. (1982) Protein transfer from isoelectric focusing gels: the native blot. Anal. Biochem. 123, 229–235. 2. Daly, M. and Hallinan, F. (1985) Analysis of antithrombin III microheterogeneity by isoelectric focusing in polyacrylamide gels and immunoblotting. Thromb. Res. 40, 207–214. 3. Daly, M., Ball, R., O’Meara, A., and Hallinan, F. (1989) Identification and characterisation of an antithrombin III mutant (AT Dublin 2) with marginally decreased heparin reactivity. Thromb. Res. 56, 503–513.
Characterization of Heparin Binding Variants
297
30 Characterization of Heparin Binding Variants of Antithrombin by Crossed Immunoelectrophoresis in the Presence of Heparin Martina Daly 1. Introduction The first update of the antithrombin mutation database published in 1993 used a revised classification for antithrombin variants (1). Currently, two deficiency states are recognized: type 1 deficiency is characterized by a parallel reduction in immunological and functional plasma antithrombin levels, whereas type 2 is characterized by the presence of a dysfunctional protein and a discrepancy between normal antigenic and reduced functional activity levels of antithrombin. Type 2 variants are further subtyped into three categories depending on whether the mutation has its effect on the reactive site (RS), the heparin binding site (HBS) or has multiple or pleiotropic effects (PE). Thus, the last update of the antithrombin database listed 11 distinct molecular defects causing heparin binding abnormalities and nine defects having pleiotropic effects interfering with both thrombin inhibitory activity and heparin binding. The majority of PE variants are also associated with reduced immunological concentrations of plasma antithrombin and have mutations affecting amino acid residues belonging to the C-terminal strand 1C (e.g., antithrombin Utah, 407 Pro to Leu) a finding which has led to the suggestion that the integrity of the carboxy-terminal 30 amino acids of antithrombin is essential for maintaining normal circulating antithrombin levels (2). Although type 1 deficiency is readily diagnosed by measuring antigenic and functional activity levels of antithrombin, phenotypic characterization of type 2 subtypes requires some investigation of the heparin binding properties of the abnormal antithrombin. The technique that has been of most value in this respect has been crossed immunoelectrophoresis (CIE) of plasma antithrombin From: Methods in Molecular Medicine, Vol. 31: Hemostasis and Thrombosis Protocols Edited by: D. J. Perry and K. J. Pasi © Humana Press Inc., Totowa, NJ
297
298
Daly
following incorporation of heparin in the first dimension gel. Originally adopted by Sas et al. (3) to study heterogeneity of normal antithrombin in plasma and serum, this method has been widely used for the phenotypic characterisation of physiological variants of antithrombin. Although the method described below is intended for detection of heparin binding variants of antithrombin, with appropriate modifications, it may be adapted to investigate the heparin binding properties of other haemostatic plasma proteins and their variants (e.g., heparin cofactor II). Alternatively, by replacing the heparin in the first dimension gel with other ligands, the binding properties of specific plasma proteins may be examined. 2. Materials 1. Glass plates measuring 100 × 100 × 1 mm. 2. Ethanol. 3. Agarose, type I, low EEO (Sigma, Dorset, England) or Agarose L (Pharmacia Biotech, Uppsala, Sweden) (see Note 1). 4. 0.05 M barbitone buffer, pH 8.6. Dissolve 20.6 g sodium barbitone in 1900 mL water, adjust to pH 8.6 with 0.05 M hydrochloric acid and dilute to a final volume of 2000 mL. 5. 0.15 M NaCl, store at room temperature for up to 2 mo. 6. Heparin. Available as a 5000 U/mL stock solution from CP Pharmaceuticals Ltd. (Wrexham, Clwyd). A 30 U/mL solution is also required and is prepared by dilution of the stock preparation in 0.15 M NaCl (see Note 2). 7. Flat bed electrophoresis apparatus e.g. Multiphor II, Pharmacia Biotech, with thermostatic cooling unit capable of 10°C. 8. Whatman 3MM chromatography paper. 9. Whatman No. 1 filter paper. 10. Saranwrap™. 11. 10% Bromophenol blue (w/v) in 0.15 M NaCl. Store at room temperature. 12. Rabbit anti-human antithrombin immunoglobulins, e.g., Dako, High Wycombe, UK. 13. Destaining solution: 40% methanol (v/v), 10% acetic acid (v/v) in distilled water. 14. Staining solution: Dissolve 2.5 g of Coomassie Brilliant Blue R-250 in 1000 mL of destaining solution. The solution is filtered before use and is stable for at least 2 mo at room temperature.
3. Methods The crossed immunoelectrophoretic pattern of antithrombin is examined in each test plasma sample both in the presence, and absence, of heparin in parallel with a normal or control sample. Thus, for each sample tested two gels must be prepared, one with and one without heparin.
3.1. Preparation of First Dimension Gels 1. Weigh 0.18 g of agarose into each of two glass universal containers, labelled A, and add 18 mL of 0.05 M barbitone buffer, pH 8.6. Similarly, weigh 0.14 g into
Characterization of Heparin Binding Variants
2. 3.
4.
5.
6. 7.
8.
9.
299
each of two containers, labeled B, and add 14 mL 0.05 M barbitone buffer, pH 8.6. Screw the lids loosely on all four containers and heat in a boiling waterbath until the agarose is fully dissolved. Remove to a waterbath preheated to 56°C and allow to cool for at least 30 min. Thoroughly clean two glass plates. Rinse well in deionised water and swab with ethanol. Allow the plates to dry and then place them onto a levelling table, ensuring that it is absolutely level. When the agarose has cooled, pour the contents of one of the containers labeled A onto one of the plates ensuring an even covering of the plate and no overflow of the agarose onto the leveling table (see Notes 3 and 4). Add 54 µL of heparin (5000 U/mL) to the second A container, mix, and pour onto the second plate as described in step 4 (see Note 5). Leave the remaining containers of molten agarose at 56°C for preparation of the second dimension gels. When the agarose has solidified, place both gels in a humid chamber at 4°C before use. Gels should be used on the day of preparation. Carefully, make a circular well, 3 mm in diameter, in the corner of each gel, 10 mm from both edges. Make a second well 10 mm from the edge and 50 mm from the first. This is most easily achieved by placing the gel on a template on which the positions of the wells are already marked (see Note 6). Place both gels, with the wells nearest the negative electrode, on the cooling plate of a flat bed electrophoresis apparatus connected to a thermostatic circulator set at, and precooled to, 10°C (see Note 7). Pour 1L of electrophoresis buffer into each of the electrophoresis tanks. For each of the wicks, soak four pieces of Whatman 3MM chromatography paper (200 × 190 mm) in electrophoresis buffer and place them straight along the gels overlapping the edges by 5 mm at each side. To prevent dehydration during electrophoresis, cover each wick with a piece of SaranWrap™ doubled over at the gel end in order to give a straight edge (see Note 8).
3.2. Application of Samples and Electrophoresis 1. Prepare the test and control citrated plasma samples for electrophoresis as follows: For electrophoresis in the absence of heparin, dilute 100 µL of test/control plasma with 100 µL 0.15 M NaCl. Where heparin is included in the first dimension gel, dilute 100 µL of test/control plasma with 100 µL 0.15 M NaCl containing 30 U/mL heparin. 2. Apply 10 µL of each sample to the appropriate well, ensuring that each gel contains a control and test sample and that heparinised samples are added to the gel containing heparin. 3. Add 1 µL of 10% bromophenol blue in 0.15 M NaCl to each well for use as a tracker dye. 4. Electrophorese samples at 200 V until the bromophenol blue has just reached the opposite wick.
3.3. Preparation and Electrophoresis of Second Dimension Gels 1. When the first dimension separation is complete pipet some molten 1% agarose (at 56°C) into the sample wells and allow it to solidify.
300
Daly
2. Remove the gels one by one from the electrophoresis chamber and place on the template. 3. With the edge of the gel containing the wells nearest you, carefully cut the gel at three positions 15, 50, and 65 mm from the right hand edge, in the direction of the first electrophoresis. Retain the two smaller sections containing the proteins separated by the first dimension electrophoresis and discard the remainder. 4. Place the plate on an absolutely level surface ready for pouring the second dimension gel. 5. Pour 6.3 mL of the 1% agarose (at 56°C) from one of the B containers into a calibrated tube and add 70 µL of rabbit anti-human antithrombin antiserum. Quickly mix, and then pour, the molten agarose into one of the two sections on the plate ensuring that contact is made with the first dimension gel (see Note 9). 6. Repeat step 5 for the second section of the plate. 7. Repeat steps 1–6 for the second gel. Allow the agarose to solidify and then immediately continue with the second dimension electrophoresis. 8. Return the plates to the electrophoresis chamber with the position of both plates rotated through 90°C so that the direction of electrophoresis is from the first dimension gel into the second dimension antiserum-containing gel. 9. Prepare wicks as described in step 9. 10. Electrophorese samples at 200 V for 4 h or overnight at 110 V at 10°C.
3.4. Detection of Immunoprecipitated Antithrombin 1. Wash the gels for 2 h in three changes of 0.15 M NaCl. 2. Overlay the plates with two pieces of Whatman No.1 filter paper followed by a thick stack of paper towels and a glass plate. Place a heavy weight on top and press the gel for 30–60 min or overnight if desired. 3. Carefully, remove the paper towels and filter paper and dry the gel completely with a hair dryer. 4. Stain the gel for 30 min at room temperature in a solution of 0.25% coomassie brilliant blue R-250. 5. Remove excess stain by washing for approx 5 min in 40% methanol, 10% acetic acid (see Note 10).
4. Notes 1. High concentrations of dissociable cations, present in certain preparations of agarose, migrate toward the cathode during electrophoresis. This process, termed electroendosmosis (EEO), results in a movement of liquid in the opposite direction to acidic proteins such as antithrombin reducing discrimination between different protein species by internal convection. For this reason, an agarose with low EEO is recommended. 2. Unfractionated sodium heparin is marketed as a solution known as “Multiparin” by CP Pharmaceuticals Ltd. Where obtained as a dried sodium salt of unfractionated heparin, it can be resuspended in an appropriate volume of water prior to use.
Characterization of Heparin Binding Variants
301
3. At low room temperatures, the agarose may be inclined to solidify before the plate is evenly covered. This may be prevented if, instead of using a leveling table, the plate is placed on the level cooling platform of a flat bed electrophoresis chamber. Warm tap water may then be circulated through the platform to warm the plate before pouring the gel. However, immediately before the gel is poured, the connection to the cooling platform should be changed from the hot to the cold tap to accelerate gel formation. 4. If overflowing of the agarose solution is a problem, prior to pouring the gel put 2–3 drops of molten agarose on the plate. Smear the agarose over the plate and dry with a hair dryer. This helps the gel to bond to the glass. 5. The final concentration of heparin in the gel is 15 U/mL. This is similar to the heparin concentration reported by Sas et al. (3) to be optimal for separation of the heparin binding fraction of normal antithrombin in plasma. 6. Sample wells can be made using a commercially available telescopic gel puncher (Pharmacia Biotech, Uppsala, Sweden) attached to a filter pump. Alternatively, wells can be made using a wide bore Pasteur pipet or a blue pipet tip which has been cut at the narrow end to give an external diameter of approx 3 mm. 7. In some laboratories, it may be possible to achieve sufficient cooling by circulating cold tap water beneath the gel plates during electrophoresis. 8. To ensure an even current during electrophoresis, the paper wicks should be cut to the size of the gels and not allowed to touch the cooling plate beneath the gel at either end. 9. Appropriate concentrations of alternative antisera should be determined experimentally. 10. Plasma antithrombin migrates in agarose predominantly as a single species which can be visualized as a uniform peak following CIE. Binding of negatively charged heparin leads to an overall increase in negative charge and hence greater electrophoretic mobility. Thus, in the presence of heparin, a single antithrombin peak which migrates more rapidly is observed. The can be readily observed by superimposing the two gels electrophoresed in the presence and absence of heparin. Antithrombin mutations which cause a reduction in heparin binding are characterized by the presence of two peaks similar in height: the normal peak and a second peak of reduced mobility. Pleiotropic defects are usually associated with the presence, at low concentrations, of an abnormal antithrombin having reduced affinity for heparin and are characterized by the presence of a normal peak, plus a much smaller second peak of reduced mobility.
Acknowledgments The advice of P. Cooper is gratefully acknowledged. References 1. Lane, D. A., Olds, R. J., Boisclair, M., Chowdhury, V., Thein, S. L., Cooper, D. N., Blajchman, M., Perry, D., Emmerich, J., and Aiach, M. (1993) Antithrombin III mutation database: first update. Thromb. Haemostasis 70, 361–369.
302
Daly
2. Lane, D. A., Olds, R. J., Conard, J., Boisclair, M., Bock, S. C., Hultin, M., Abildgaard, U., Ireland, H., Thompson, E., Sas, G., Horellou, H. H., Tamponi, G., and Thein, S. L. (1992) Pleiotropic effects of antithrombin strand 1C substitution mutations. J. Clin. Invest. 90, 2422–2433. 3. Sas, G., Pepper, D. S., and Cash, J. D. (1975) Investigations on antithrombin III in normal plasma and serum. Brit. J. Haematol. 30, 265–272.
HPLC Peptide Analysis
303
31 The Determination of Amino Acid Sequence Abnormalities in Proteins by HPLC Peptide Analysis David Williamson 1. Introduction Current techniques for DNA amplification and sequencing have greatly simplified the identification of genetic mutations underlying disorders of abnormal protein production. The need, however, for the direct characterization of an amino acid abnormality in a defective protein still arises in particular situations. The normal approach to this problem relies on the specific fragmentation of the protein and subsequent analysis of the resultant mixture of peptides. The techniques currently available for peptide analysis offer very high sensitivity and so require relatively small amounts of protein. Automated peptide sequencing or mass spectrometry can be achieved with subnanomole quantities of peptide. Consequently, sufficient material can be isolated from tryptic digests beginning with as little as a milligram or so of a pure protein. The protein of interest must first be purified from its source, which in most cases will be plasma. As most genetic abnormalities occur in the heterozygous state, only a proportion of the protein is defective, and where possible this should be purified from the normal form of the protein in order to simplify subsequent peptide analyses. For example, if a difference in the overall charge of the protein has been shown by protein electrophoresis, the two components may be purified by ion exchange chromatography. A functional change, such as the affinity for a ligand may be exploited, as with changes in the heparin affinity of some antithrombin variants that enables their separation by affinity chromatography on heparin-sepharose (see Fig. 1). For the production of comparative peptide maps of proteins and the isolation of peptides for further amino acid compositional or sequence analysis, an From: Methods in Molecular Medicine, Vol. 31: Hemostasis and Thrombosis Protocols Edited by: D. J. Perry and K. J. Pasi © Humana Press Inc., Totowa, NJ
303
304
Williamson
Fig. 1. Separation of tryptic peptides of a heparin-affinity variant of antithrombin by reverse-phase HPLC. Two milligrams of human plasma antithrombin, isolated by heparin-affinity chromatography (inset), was modified by reduction and carboxymethylation prior to digestion with TPCK-treated trypsin for 2 h at 37˚C at a protein concentration of 2 mg/mL and a ratio of protease: antithrombin of 1:30 on a weight basis. One hundred microliters of the tryptic digest supernatant was chromatographed on a µBondapak C18 reverse-phase column (3.9 mm × 300 mm, Waters division of Millipore) using a linear gradient of acetonitrile (0–50%) in 0.05% TFA, eluting at 1.0 mL/min. The arrow indicates the abnormal peptide that was not present in the tryptic digest of the normal antithrombin fraction. The collected peak was subjected to automated N-terminal sequence analysis, which yielded the amino acid sequence of residues 40-46 of the antithrombin sequence (I-L-E-A-T-N-R) with the substitution Pro→Leu at position 41 (Antithrombin Basel) originally described by Chang and Tran (5).
HPLC Peptide Analysis
305
enzymatic digest of the protein is most commonly separated by reverse phase high-performance liquid chromatography (HPLC). Cleavage of proteins with proteolytic enzymes is favoured over chemical methods because of the high degree of specificity. The preferred enzyme is usually trypsin, which is highly specific for lysine and arginine, cleaving on the carboxy terminal side of these amino acid residues. With most proteins, it is usually advisable to carry out reduction and modification of sulfhydryl residues prior to digestion with trypsin. Conversion of cysteine residues to more stable derivatives will prevent their oxidation and the random formation of disulphide bonds between cysteine-containing peptides. This procedure also helps with denaturation of the protein to enable more complete proteolytic digestion. A tryptic digest must be prepared under the same conditions from both the normal and abnormal protein species, which can then be analysed and compared. Of the various chromatographic procedures available for the analysis of tryptic digests, reverse phase chromatography is the most widely adopted. The separation in this system is based on the size and relative hydrophobic properties of each peptide, and it is capable of resolving peptides with only slight differences in hydrophobicity. Consequently, peptides differing by a single amino acid may often be resolved (Fig. 1), as well as peptides with modifications to amino acid residues, such as oxidation, glycosylation or acetylation. Described below is a basic approach to sulfhydryl modification by carboxymethylation, tryptic digestion and the reverse phase HPLC separation of tryptic peptides. This will enable the production of peptide chromatograms that can be compared and the isolation of any abnormally behaving peptides. Isolated peptides can be submitted to a specialist facility for amino acid composition analysis, N-terminal amino acid sequencing or further characterisation by mass spectrometry to precisely determine the amino acid abnormality. 2. Materials 2.1. Reduction and Carboxymethylation of Protein Sulfhydryls The method described is for the reduction and modification of sulfhydryls by their conversion to carboxymethylcysteine using the reagent iodoacetic acid. Depending on the reagent used, an acidic, neutral, or basic modifying group can be added, altering the properties of the protein accordingly (see Notes 1 and 2). To minimize undesirable modifications to amino acid residues and other nonspecific reactions, high-purity chemicals and reagents should be used at all stages of protein purification, modification, digestion, and peptide analysis. 1. 8.0 M urea in 0.3 M Tris-HCl, pH 8.3 buffer. Urea solutions should be freshly prepared. Alternatively, 6.0 M guanidine hydrochloride may be used in the same Tris buffer.
306
Williamson
2. Dithiothreitol (DTT, Cleland’s Reagent) 10 mg/mL solution dissolved in deionized water. May be stored in aliquots at –20°C. 3. Iodoacetic acid, 10 mg/mL solution dissolved in deionised water and neutralized with NaOH. The solution should be colorless. Any yellow color is an indication of the presence of iodine that may cause oxidation of thiols and other amino acid modifications.
2.2. Proteolytic Digestion with Trypsin Trypsin is a highly specific protease that cleaves on the carboxy-terminal side of arginine, lysine and S-aminoethylcysteine residues. It is the most preferred enzyme for protein digestion. Cleavage is inhibited at Arg-Pro and LysPro bonds or by the presence of an adjacent acidic amino acid residue. Occasional anomalous cleavages may occur particularly at hydrophobic residues, owing possibly to contaminating chymotryptic activity. These can be minimized by the use of a highly pure trypsin preparation that has been treated with L-(tosylamido-2-phenyl) ethyl chloromethyl ketone (TPCK) to inhibit chymotryptic activity. 1. A suitable trypsin preparation is TPCK-treated bovine pancreatic trypsin, 3x crystallized (Worthington Biochemical Corporation, NJ, USA). Dissolve at 2 mg/mL in deionised water and store frozen in aliquots at –20°C. 2. Stock solution of 0.5 M NH4HCO3. Store at room temperature.
2.3. Separation of Tryptic Peptides by Reverse-Phase HPLC 1. Hardware: The high resolution and reproducibility of HPLC separations requires precise control over flow rates and solvent composition. This depends on the availability of an HPLC system consisting of a gradient controller, a solvent delivery system (dual pump or a single pump with proportioning valves for buffer mixing), sample injector, one or more detectors and a chart recorder output or computer with printer. Most systems are now computer-interfaced combining the functions of gradient control with data collection and analysis. 2. Column: The chromatographic performance of any column is determined by a large number of factors which includes the physical dimensions and construction of the column as well as the nature of the packing material, its particle size, pore size and carbon load (1). For peptide separations, reverse phase columns with C18 or C8 ligands and 5 µm or 10 µm particles are most commonly used. A wide range of suitable columns and radial compression cartridges is available. The column used here is a µBondapak C18 10µm, 3.9 mm i.d. × 300 mm (Waters division of Millipore). 3. Solvents: Two solvent systems are suggested (see Note 7). 4. Trifluoroacetic acid (TFA)/Acetonitrile (CH3CN) Buffers: Prepare a solution of 0.1% TFA in HPLC-grade water. TFA is available in convenient 1-mL ampoules (protein sequencing grade, Sigma).
HPLC Peptide Analysis
307
Buffer A (0.05% TFA): prepare a 1:1 dilution of 0.1% TFA with water. Buffer B (0.05% TFA, 50% acetonitrile): prepare a 1:1 dilution of 0.1% TFA with acetonitrile (BDH, HiperSolv “Far UV” grade for HPLC). Vacuum filter both buffer solutions through a 0.45-µm filter apparatus, which will simultaneously degas the buffers. 5. Ammonium acetate/acetonitrile buffers: Prepare a stock solution of 0.02 M ammonium acetate (CH3COONH4) adjusted to pH 6.0 with a little acetic acid. This stock buffer may be filtered and stored at 4°C for up to 1 wk. Buffer A (0.01 M CH3COONH4, pH 6.0): Prepare a 1:1 dilution of the 0.02 M stock buffer with water. Buffer B (0.01 M CH3COONH4, pH 6.0, 50% acetonitrile): Prepare a 1:1 dilution of the 0.02 M stock buffer with acetonitrile. Vacuum filter and degas the buffer solutions through a 0.45-µm filter apparatus.
3. Methods 3.1. Reduction and Carboxymethylation of Protein Sulfhydryls 1. Dissolve the protein, up to 10 mg, in 1 mL of a solution of 0.3 M Tris-HCl, pH 8.3, 8.0 M deionized urea (or 6.0 M guanidine hydrochloride) to denature the protein. 2. Add a solution of dithiothreitol (DTT) sufficient to give a twofold molar excess over protein thiol groups. Flush the reaction tube with nitrogen, seal and incubate at room temperature for 3–5 h to allow reduction of the sulfhydryls (see Note 3). 3. Add the solution of iodoacetic acid to a final concentration that gives a threefold excess over thiol groups. Flush the solution again with nitrogen, seal the tube, and incubate in the dark at room temperature for a further 1 h. 4. Transfer the protein solution to dialysis tubing and dialyse extensively against 2 × 5 L deionized water over 16 h. Some proteins may precipitate during dialysis in which case a final short dialysis against 0.005 M formic acid may help to resolubilize the protein. 5. The protein may be lyophilized at this stage or proceed directly with proteolytic digestion.
3.2. Proteolytic Digestion with Trypsin 1. Weigh a quantity of the lyophilized protein into a reaction tube and dissolve completely in deionized water at a concentration of up to 10 mg/mL. If the protein solution has not been lyophilized following reduction and carboxymethylation proceed to step 2. 2. Add trypsin to the protein solution at a 1:30 ratio of trypsin:protein based on weight (see Note 4). Mix by vortexing briefly. 3. Add 0.2 mL of 0.5 M NH4HCO3 per ml of protein solution. Mix again by vortexing briefly. Check the pH of the reaction mixture, which should be close to 8.5, by testing a few microliters on a pH indicator strip. If required, adjust the pH further until it is within the range 8.0–9.0 (see Note 5).
308
Williamson
Table 1 Example of a Gradient for the Separation of Tryptic Peptides by Reverse-Phase HPLC Time
Flow rate
%A
%B
Curve type
0 5.0 65.0 75.0 80.0
1.0 1.0 1.0 1.0 1.0
100 100 0 0 100
0 0 100 100 0
— Linear Linear Linear Linear
4. Seal the tube and incubate at 37°C for 2 h (see Note 6). 5. At the end of the incubation period, place the reaction tube in a boiling water bath or heating block at 100°C for 5 min. 6. Centrifuge the sample for 5 min at full speed in a bench top microcentrifuge to remove any precipitate of incompletely digested protein. Remove the supernatant, containing the tryptic peptides, into a clean tube. The tryptic digest supernatant may be lyophilised or stored at –20°C for HPLC analysis.
3.3. Separation of Tryptic Peptides by Reverse-Phase HPLC The optimal gradient conditions will always have to be determined experimentally for each individual protein and for the type of column and buffers being used. The following procedure provides a starting point for peptide separations. 1. The column should be installed on the HPLC instrument, then washed and equilibrated according to the manufacturer’s instructions to remove the shipping solvent and UV absorbing substances (see Note 8). 2. Equilibrate the column ready for analysis by pumping 100% Buffer A at a flow rate of 1.0 mL/min. 3. Set up a gradient program for peptide elution, employing a linear gradient from 100% Buffer A to 100% Buffer B over 60 min with a flow rate of 1.0 mL/min. Allow a short isocratic step before the initiation of the gradient and at the end of the gradient to ensure complete elution of peptides from the column before returning to the initial conditions. Such a gradient table will look as follows (Table 1). 4. Centrifuge the tryptic digest for 5 min at full speed in a bench-top microcentrifuge (13,000 rpm) to ensure a clear supernatant (Note 9). 5. Inject an aliquot of the tryptic digest (for example 20 µL out of 1 mL of a 10 mg/mL tryptic digest) and run the gradient elution program. 6. Depending on the chromatographic separation achieved, changes may be made to the gradient program to improve the separation in particular areas of the chromatogram. 7. Any peptides with altered retention characteristics (see Note 10) by comparison with the normal protein tryptic digest should be manually collected into clean
HPLC Peptide Analysis
309
polypropylene reaction tubes (see Note 11) and stored at –20°C for further characterisation by amino acid analysis, N-terminal peptide sequencing or mass spectrometry. Alternatively, peptides may be dried in a centrifugal vacuum concentrator or by freeze drying.
4. Notes 1. The use of iodoacetic acid will transfer a new negative charge to the protein. If this is undesirable, iodoacetamide may be substituted, which adds an uncharged group (S-carboxamidomethyl cysteine). 2. Cysteines may also be modified to S-aminoethyl cysteine by reacting with the reagent N-iodoethyl-trifluroacetamide (2), adding a basic group that is recognized and cleaved by trypsin. Modification with this reagent therefore increases the number of peptides generated. The reagent previously available for aminoethylation, ethyleneimine, is no longer recommended because of its extreme toxicity. 3. These conditions should be sufficient for reduction of most protein sulfhydryls but some proteins may need longer incubation times, up to 18 h and at 37°C rather than room temperature. 4. The amount of protease and incubation time can be varied depending on the susceptibility of the protein to tryptic digestion. Ratios from 1:25 to 1:100 are commonly used. Sufficient protease is required to give effective digestion whilst keeping to a minimum the peptide products that result from enzyme autodigestion. The use of excessive amounts of protease will therefore interfere with interpretation of the peptide separations. 5. A light protein precipitate may form after the addition of the bicarbonate buffer. With gentle vortexing, this will usually redissolve within several minutes to give a clear solution. If the precipitate does not redissolve completely, check the pH and adjust if necessary. Continue with the incubation at 37°C, mixing periodically by gentle vortexing. 6. Little tryptic activity remains after two hours due to enzyme autolysis and extended incubation periods are therefore of minimal advantage. If longer digestion is required, such as in the case of a particularly resistant protein, it will be necessary to add the enzyme to the reaction in stages. It has also been reported that an autolysis product of trypsin itself is responsible for chymotryptic-like cleavages at hydrophobic residues (3) and these will increase with longer incubation times. 7. The chromatographic separation of peptides varies between buffer systems (4) and in some cases it may therefore be necessary to try more than one system. TFA buffers are commonly used and are convenient because of their high volatility when peptides are dried for subsequent analyses. The TFA/acetonitrile buffers, therefore, are a good first option. Particularly large or very hydrophobic peptides may require a higher concentration of acetonitrile to be used in buffer B. 8. It is recommended that a guard column of the same packing material be used in front of the separation column. When resolution deteriorates or high back-pressure problems occur, the guard column should first be replaced.
310
Williamson
9. The digest may also be filtered through a 0.45-µm microfilter unit. These are available with minimal hold-up volume and low protein binding membranes. This is particularly recommended if no guard column is being used to prolong column life. 10. A single peptide may show a difference in its retention time due to an amino acid substitution or modification. However, more complex differences in the peptide pattern may occur owing to amino acid substitutions that influence the cleavage of the protein by trypsin. For example, an amino acid substitution that results in the removal or introduction of an arginine or lysine, and some substitutions immediately adjacent to arginine or lysine residues that may affect the tryptic fragmentation pattern. 11. Wear gloves when collecting peptides for analysis to avoid contamination. It is also advisable to set aside a supply of tubes for peptide collection that are handled only with gloves. 12. A number of alternative proteases with individual specificities are available if trypsin does not produce the desired pattern of cleavage. These include argininespecific and lysine-specific proteases that may be useful in limiting the number of peptides generated, staphylococcal protease (SAV8) which targets acidic residues, and a number with wider specificities such as α-chymotrypsin, pepsin, and thermolysin (3).
References 1. Wilson, K. J. and Yuan, P. M. (1989) Protein and peptide purification, in Protein Sequencing: A Practical Approach (Findlay, J. B. C. and Geisow, M. J., eds.). IRL, Oxford, pp. 1–41. 2. Schwartz, W. E., Smith, P. K., and Royer, G. P. (1980) N-(ß-Iodoethyl) trifluroacetamide: a new reagent for the aminoethylation of thiol groups in proteins. Anal. Biochem 106, 43–48. 3. Allen, G. (1989) Sequencing of proteins and peptides, in Laboratory Techniques in Biochemistry and Molecular Biology, vol 9, Elsevier Science Publishers, Amsterdam, New York, and Oxford. 4. Wilson, K. J., Honegger, A., and Hughes, G. J. (1981) Comparison of buffers and detection systems for high pressure liquid chromatography of peptide mixtures. Biochem. J. 199, 43–51. 5. Chang, J. and Tran, T. (1986) Antithrombin III Basel. Identification of a Pro-Leu substitution in a hereditary abnormal antithrombin with impaired heparin cofactor activity. J. Biol. Chem. 261, 1174–1176.
Inherited Platelet Receptor Disorder
313
32 Molecular Biological Identification and Characterization of Inherited Platelet Receptor Disorders Ramesh B. Basani, Mark Richberg, and Mortimer Poncz 1. Introduction Platelets are derived from megakaryocytic and have a critical role in thrombus formation. Megakaryocytes are terminally differentiated marrow cells that are derived from the pluripotent hematopoietic stem cell (1). These extremely large, polyploid cells demarcate their cytoplasm, giving rise to circulating platelets. Following vascular injury, platelets adhere to the site of injury through von Willebrand factor (vWF) and the platelet membrane glycoprotein (GP) Ib/IX complex. The platelets become activated, and aggregate with other activated platelets through fibrinogen and the platelet membrane αIIb/β3 (GPIIb/IIIa) integrin complex. In addition, platelets contain unique granules called α-granules that contain important factors involved in normal coagulation. These factors include factor VIII, vWF, factor V, Multimerin, fibrinogen, factor XIII, factor XI, thrombospondin, fibronectin, ß-thromboglobulin (ßTG) and platelet factor 4 (PF4). Some of these factors are actively synthesized in megakaryocytes, some are actively transported through clatherin pits, and some are endocytosed (2,3,9). The biological relevance of platelets, the unusual differentiation pathway of the megakaryocyte and the richness of important proteins related to coagulation found within these cells have made them the target of active scientific pursuit. Unfortunately, platelets are anucleate and were thought to have little residual RNA. Furthermore, megakaryocytes, although being large and polyploid, are rare within the bone marrow. In humans, only 1:10,000 nucleated marrow cells are identifiable megakaryocytes. Because of these limitations, progress towards understanding the molecular biology of the platelet and megaFrom: Methods in Molecular Medicine, Vol. 31: Hemostasis and Thrombosis Protocols Edited by: D. J. Perry and K. J. Pasi © Humana Press Inc., Totowa, NJ
313
314
Basani, Richberg, and Poncz
karyocyte was hindered until the mid-1980s. Since then, three major advances occurred that were critical to the study of the molecular biology of the platelet and megakaryocyte. The first was the discovery that an erythroid cell line HEL actually exhibited a number of megakaryocytic-like features (6). This lead to the rapid establishment of expression cDNA λ libraries from these cells and the isolation of the cDNAs for such platelet-related genes as αIIb, β3, βTG, and PF4 (4,5,7,8,11). The next major advance in the field was the recognition that platelets contain sufficient RNA to allow one to PCR-amplify and analyze the message of a number of platelet-specific genes (12). This allowed the rapid characterization of the message for a number of platelet-specific genes including the determination of the molecular defect in a number of patients with Glanzmann thrombasthenia and Bernard-Soulier syndrome as well as allowing the characterization of the molecular basis of platelet alloantigens. The third advance has yet to fully reach its full potential impact and that is the availability of the megakaryocyte-specific cytokine thrombopoietin (TPO) (13). This cytokine stimulates megakaryocyte development 10- to 100-fold. It has allowed the in vitro stimulation of sufficient numbers of megakaryocytes to permit studies on gene regulation of the developing megakaryocyte as has never been possible before. Below, we discuss how to define and study the molecular basis of an inherited defect in platelet biology. The focus of these studies is on the analysis of patients with Glanzmann thrombasthenia. However, similar such studies have been done for Bernard-Soulier syndrome and other cloned genes that are expressed in megakaryocytes.
1.1. Platelet Reverse Transcription-Polymerase Chain Reaction (RT-PCR) The determination that a patient has an inherited platelet defect depends on clinical suspicion and standard clinical coagulation laboratory studies. The next step often involves protein chemistry studies to demonstrate the level of the suspected protein. These studies will not be discussed here, but it is clear that a careful analysis of such studies is critical prior to launching on the molecular biology techniques described below (see Fig. 1). One of the most important observations in the study of proteins expressed in platelets was the recognition that sufficient residual RNA is present in platelets for RT/PCR amplification of this material, allowing its direct analysis (12). However, the described technique is often difficult to perform since the amount of residual RNA present in platelets is small and activation of platelets in vitro leads to RNA degradation. Easy access to the patient of interest is required. Platelet RT-PCR consists of four steps: isolation of platelet RNA, reverse transcription of mRNA into a single-stranded cDNA transcript, PCR amplifi-
Inherited Platelet Receptor Disorder
315
Fig. 1. Flow chart for molecular biology analysis of an inherited platelet defect beginning either with platelets or white blood cells.
cation of the cDNA transcript, and screening the PCR products for the mutation.
1.2. Genomic DNA Analysis Often obtaining platelet RNA from a patient may be difficult. Therefore, the analysis of the inherited defect would then rely on isolating and characterizing the gene within isolated DNA. We describe below the steps required for the analysis of mutations affecting the αIIb or β3 genes. Both genes have been previously characterized. The αIIb gene contains 30 exons and spans 18 kb (14). Its 5' flanking region contains a transcription start site located 32 bp upstream from the beginning of the αIIb coding region. The β3 gene contains 15 exons and spans at least 46 kb (15,16). The first step in detecting the mutation is to PCR amplify the exons for αIIb and β3, resulting in 32 different PCR products for αIIb and 17 PCR products
316
Basani, Richberg, and Poncz
for β3. These PCR products not only cover all of the exons, but also 500 bp of the 5'-flanking region. The rationale for our genomic PCR strategy is to create PCR fragments of ~300 bp, allowing optimal analysis by single-stranded conformational polymorphism (SSCP) (17–19). While a number of laboratories would prefer to sequence these products directly, we have utilized the sensitive SSCP technique for the screening of our patients. This approach is especially effective if one has a number of patients with the same inherited disease so that one can appreciate a subtle difference in one of the lanes (see Fig. 2). Alternative screening techniques such as denaturing gradient gel electrophoresis (DGGE) (20), have also been successfully used, but we believe that such techniques are often more cumbersome to establish in the laboratory, especially for the analysis of so many different exons. Once a candidate PCR band is defined for a particular patient, the involved mutation needs to be determined. One direct method of doing this is to perform direct PCR sequencing of the purified PCR product. PCR cycle sequencing is a strategy which makes use of thermal cycling to obtain sequence information from very small amounts of template DNA using a thermostable DNA polymerase and dideoxynucleotide triphosphates. Using this method, it is possible to sequence PCR product directly without subcloning. We use the fmol DNA cycle sequencing Kit (Promega, Madison, WI) to sequence the PCR fragments that showed abnormal mobility on SSCP. There are several different ways of using this technique. We use end-labeled primers. Other techniques for automated sequencing or for internal labeling can also be followed. To optimize sequence quality, we recommend using a new set of primers for this sequencing, slightly internal to the original primers used for the PCR amplification.
1.3. Functional Analysis of the Mutation: COS-1 Cells Once a mutation is defined by the above techniques, it is important to show that it is relevant to the patient’s clinical illness. This can be done in a number of ways. One can demonstrate that the particular mutation is not found in the general population and that it is inherited coincidental with the clinical manifestation. The most direct route is to reproduce the defect in an experimental system. We describe the mutagenesis technique and the ex vivo expression systems used in our laboratory to define the biological implication of mutations in the αIIb or β3 cDNAs. Expression studies of the mutation require the introduction of the altered nucleotide into the wild-type cDNA. We utilize a PCR-based site-directed mutagenesis technique involving overlapped PCR products (18,21) (see Fig. 3). In this method, two overlapping complementary oligonucleotide primers are synthesized, incorporating the mutation to be introduced. As shown in Fig. 3, from wild type template cDNA, two overlapping PCR fragments are gener-
Inherited Platelet Receptor Disorder
317
Fig. 2. SSCP analysis results for exon 4 of β3 from a normal control (lane 1) and from a series of Glanzmann thrombasthenic patients (lanes 2-11), demonstrating an abnormal migrating band in lane 6. This patient had an exon splice donor mutation in this exon.
Fig. 3. Overlap PCR strategy for the preparation of a desired mutation. “A” and “B” refer to convenient unique restriction sites. “X” refers to the created mutation in the final cDNA.
317
318
Basani, Richberg, and Poncz
ated using a primer containing the single base pair substitution and a flanking primer. The PCR fragments are then gel purified and analysed on agarose gel to determine the approximate concentration. In the overlap PCR reaction, a combined PCR fragment is generated using the two shorter overlapping PCR fragments along with the flanking primers. The amplified overlap PCR fragment is then gel purified and digested with appropriate restriction enzymes for subcloning into the wild-type cDNA, similarly digested. The constructs are sequenced to confirm the presence of the desired mutation and to ensure that there are no PCR-induced artefacts. Typically, the first- and second-stage PCR amplification is done using Vent DNA polymerase enzyme since this has proofreading capabilities, giving a lower rate of PCR-induced mutations compared to Taq polymerase. To define the biological importance of the introduced overlap PCR mutation described above (which is naturally occurring in the patient), we clone these mutant cDNAs into expression vectors and transiently express the protein product in a selected cell line. For studies of the platelet integrin αIIb/β3 receptor, we have focused on COS-1 cells. COS-1 cells are appropriate for transient expression studies of the high-level expression of αIIb and β3 genes as these cells do not endogenously express these genes (see Fig. 4A).
1.4. Functional Analysis of the Mutation: 1500F B-Lymphocytes Although the analysis of the cDNA constructs in COS-1 cells provides information concerning the intercellular processing and surface expression of αIIb/β3, the inability of the COS-1 cells to activate the receptor and the transient nature of expression prohibits further functional analysis of both the wild type and mutant forms of the receptor. In an attempt to identify alternative cell systems to further investigate the functionality of the αIIb/β3, the 1500F B-lymphocytic cell line was chosen to establish transfected cell lines as it had been shown that phorbol ester (PMA) treatment of these cells result in activation of the related β2 integrin receptors (26). 2. Materials 2.1. Platelet RT-PCR
2.1.1. Isolation of Platelet RNA (see Notes 1 and 2). 1. Acid-citrate-dextrose: 38 mM citric acid, 61 mM Na3citrate, and 136 mM glucose. Adjust pH to 6.5. 2. 50-mL conical tubes. 3. RNA STAT-60™ (a high molar guanidinium thiocyanate solution) (Tel-Test “B” Inc., Friendswood, TX). 4. Chloroform.
Inherited Platelet Receptor Disorder
319
5. Isopropanol. 6. 100% Ethanol.
2.1.2. RT-PCR of Platelet mRNA 1. 2. 3. 4. 5. 6. 7. 8.
RT Buffer: 250 mM Tris-HCl, pH 8.3, 30 mM MgCl2, 375 mM KCl. 10 mM dNTP mix. DEPC-treated water. 80% Ethanol. cDNA synthesis primer at 100 ng/µL (see Note 3). MMLV reverse transcriptase (100 U/L) (Clontech, Palo Alto, CA). Tris-HCl, pH 8.0. Centricon 100 columns (Amicon, Beverly, MA).
2.2. Genomic DNA Analysis 2.2.1. Isolation of Genomic DNA 1. 2. 3. 4. 5. 6.
Anticoagulated whole blood. Isotonic saline: 0.9 g NaCl in 100 mL distilled water. Red cell lysis solution: 0.144 M NH4Cl, 1 mM NH4CO3 (mix together just before use). Chambon buffer A: 10 mM Tris-HCl, pH 8.0, 10 mM EDTA, 10 mM NaCl, 0.5% SDS. 0.75 mL (10 mg/mL) Proteinase K (predigested at 37°C for 1–2 h). Phenol:chloroform:buffer 1:1:1 (v/v/v): Redistilled phenol, chloroform, buffer (500 mM Tris-HCl, pH 8.0, 10 mM EDTA, 10 mM NaCl, 0.5% SDS, 0.1%(w/v) 8-hydroxyquinolone). 7. 100% Ethanol. 8. TE Buffer: 10 mM Tris HCl, pH 7.5, 1 mM EDTA.
2.2.2. Radiolabeled PCR Amplification of Genomic DNA 1. 10X thermophilic buffer (Promega, Madison, WI): 100 mM Tris-HCl, pH 9.0, 500 mM KCl, 1% Triton X-100. 2. DNA oligonucleotides: 200 ng of each primer. 3. 1.25 mM dNTP mix. 4. 25 mM MgCl2. 5. Genomic DNA: 500 ng/µL. 6. [α-32P]dCTP: 10 mCi/mL (Dupont, NEN Research Products, Boston, MA). 7. Taq polymerase (Promega, Madison, WI). 8. Distilled water. 9. 0.25-mL thin-walled PCR tubes.
2.2.3. SSCP Analysis of PCR Products 1. 2. 3. 4.
Siliconizing solution. 95% Ethanol. Ethidium bromide. Agarose.
320
Basani, Richberg, and Poncz
Fig. 4. Transient expression strategy is shown in (A), demonstrating the introduction of a G→C mutation. The mutated DNA in either pMT2ADA or pcDNA3 is transfected into COS-1 cells and after 35S-methionine labeling of the cells, the total cell proteins are immunoprecipitated with an appropriate antibody to the αIIb/β3 receptor. A typical result with wild-type constructs is shown in (B). Lane 1, Cells transfected only with the αIIb cDNA and immunoprecipitated with an anti-αIIb monoclonal antibody B1B5. Lane 2, Cells transfected with β3 alone and immunoprecipitated with an anti-β3 monoclonal antibody SSA6. Lane 3, Cells cotransfected with both vectors and immunoprecipitated with A2A9, a complex dependent monoclonal antibody.
Inherited Platelet Receptor Disorder
321
Fig. 4B 5. 10X TBE: 216 g of Tris base, 110 g boric acid, 80 mL of 0.5 M EDTA, pH 8.0. Make up to 2 L with distilled water. 6. 0.4-mm spacers. 7. Loading buffer: 30% Ficoll 400, 0.25% bromophenol blue, 0.25% xylene cyanol. 8. N,N,N’,N’,-Tetramethyl ethylenediamine (TEMED). 9. Whatman 3MM filter paper. 10. X-OMAT AR autoradiographic film (E. Kodak, Rochester, NY).
2.2.4. Direct PCR Sequencing 1. [γ-32P] ATP (10 mCi/mL) (Dupont, NEN Research Products, Boston, MA). 2. DNA oligonucleotides. 3. 10X T4 PNK buffer (Promega, Madison, WI): 500 mM Tris-HCl, pH 7.5, 100 mM MgCl2, 50 mM DTT, and 1 mM spermidine. 4. T4 polynucleotide kinase (Promega, Madison, WI). 5. PCR sequencing kit. 6. 5X sequencing buffer: 250 mM Tris-HCl, pH 9.0, and 10 mM MgCl2. 7. Sequencing grade Taq polymerase (Promega, Madison, WI). 8. Mineral oil. 9. Sequencing stop buffer: 10 mM NaOH, 95% formamide, 0.05% bromophenol blue and 0.05% xylene cyanol. 10. Acrylamide:bis-acrylamide (19:1). 11. Whatman 3MM filter paper. 12. X-OMAT AR autoradiographic film (E. Kodak, Rochester, NY).
2.2.5. Site-Directed Mutagenesis 1. 2. 3. 4.
250-µL thin walled PCR tubes. Wild-type cDNA. 10 mM dNTPs. DNA oligonucleotides.
322
Basani, Richberg, and Poncz
5. 10X VENT buffer: (200 mM Tris-HCl, pH 8.8, 100 mM KCl, 100 mM (NH4)SO4, 20 mM MgSO4, 1% Triton X-100 (New England Bio labs, Beverly, MA). 6. 100 mM MgSO4. 7. 10X VENT polymerase (New England Bio Labs, Beverly, MA). 8. GENECLEAN kit (Bio 101, Vista, CA). 9. Distilled water.
2.3. Transient Expression 1. COS-1 cells (American Type Culture Collection, Rockville, MD). 2. Dulbeco’s modified Eagle medium (high glucose) (DMEM) (Gibco BRL, Bethesda, MD) supplemented with 10% (V/V) heat-inactivated fetal calf serum (Gibco BRL). 3. 100 U/mL penicillin (Gibco BRL). 4. 100 µg/mL streptomycin (Gibco BRL). 5. 0.3 mg/mL L-glutamine (Gibco BRL). 6. 75 cm2 flasks (Corning Glass Works, Corning, NY). 7. Tris-buffered saline (TBS)-Dextrose: 100 mL of TBS pH 7.4 and 0.5 mL of 20% dextrose). 8. TBS-Dextran: 9.8 mL of Dextran-DEAE (Pharmacia Biotech Inc., Piscataway, NJ), 50 mg/mL of TBS, pH 7.4, 0.2 mL of 20% Dextrose in TBS, pH 7.4. 9. DMEM-chloroquine: 100 mL of DMEM and 100 µL of 100 mM chloroquine. 10. Methionine-free media: ICN Biomedical Inc., Costa Mesa, CA. 11. 35S-methionine 200–400 mCi/mL: Dupont, NEN Research Products, Boston, MA. 12. 0.02 M Tris HCl, pH 7.2, containing 1% Triton X-100, along with the protease inhibitors (all from Sigma Chemicals, St. Louis, MO) 10 µL/mL PMSF (phenyl methylsulfonyl fluoride, 17.4 mg/mL), N-carbobenzoxyl-L-glutamyl-L-tyrosine (44.4 mg/mL in ethanol), 1 µL/mL Aprotinin (2 mg/mL), and 1 µL/mL Leupeptin (2 mg/mL). 13. Fixed Staphylococci: Pansorbin, Calbiochem, San Diego, CA. 14. Antibodies. 15. Affi-Gel A: Bio-Rad Laboratories, Hercules, CA. 16. Resin wash buffer: 50 mM Tris HCl, pH 7.5, containing 0.01 M NaCl, 0.1% (w/ v) SDS, 1% Triton X-100, and 0.5% (w/v) deoxycholic acid. 17. Resin wash buffer + 0.3 M NaCl. 18. Elution buffer: 0.01 M Tris-HCl buffer, pH 6.8, containing 0.3% SDS and 0.2% dithiothreitol (DTT). 19. 0.1% SDS-7.5% polyacrylamide slab gels. 20. Fix solution: 10% (v/v) acetic acid-30% (v/v) methanol. 21. Phosphate-buffered saline (PBS): 140 mM NaCl, 2.7 mM KCl, 8.1 mM Na2HPO4·7H2O, and 1.2 mM KH2PO4; pH 7.1). 22. Lactoperoxidase 0.5 mg/mL (Sigma). 23. 125I: Dupont, NEN Research Products, Boston, MA. 24. H2O2. 25. Autofluor: National Diagnostics, Manville, NJ.
Inherited Platelet Receptor Disorder
323
2.4. Functional Analysis of the Mutation: 1500F B-Lymphocytes 2.4.1. Stable Expression System into Lymphocytes 1. pREP4 and pREP 9. 2. 1500F, EBV immortalized lymphocytes: A gift from Dr. Joel S. Bennett, University of Pennsylvania, Philadelphia, PA. 3. RPMI 1640: GIBCO BRL. 4. 10% (v/v) heat- inactivated fetal calf serum: GIBCO BRL. 5. 100 U/mL penicillin: GIBCO BRL. 6. 100 µg/mL streptomycin: GIBCO BRL. 7. 0.3 mg/mL L-glutamine: GIBCO BRL. 8. Physiological-buffered saline (PBS) (with Ca2+ and Mg2+). 9. Electroporation buffer: 20 mM HEPES, pH 7.05, 137 mM NaCl, 5 mM KCl, 0.7 mM Na2HPO4, and 6 mM dextrose. 10. Geneticin containing 750 µg/mL: GIBCO BRL. 11. Hygromycin B 200 µg/mL: Boehringer Mannheim, Germany.
2.4.2. Flow Cytometric Analysis A2A9 monoclonal antibody (A gift from Dr. Joel S Bennett, University of Pennsylvannia, Philadelphia, PA).
2.4.3. B-Lymphocyte Binding Assay 1. Purified fibrinogen is obtained from Enzyme Research Labs, South Bend, IN. 2. Buffer solution: solution: 50 mM NaHC03 pH 8.0, 150 mM NaCl, and 0.02% sodium azide. 3. 96-well microtiter plate, e.g., VWR, West Chester, PA. 4. Blocking solution: 50 mM NaHCO3, pH 8.0, 150 mM NaCl, 0.02% sodium azide, and 5 mg/mL BSA. 5. Translational grade 35S-methionine. 6. Solution 1: 50 mM Tris-HCl, pH 7.4, 150 mM NaCl, 1% BSA, 0.1% glucose, and 0.5 mM CaCl2. 7. Trypan blue. 8. Solution 2: TBS, pH 7.4, 0.5 mM CaCl2. 9. 10 mM PMA. 10. Ethanol. 11. Distilled water at 4°C. 12. 2% SDS.
3. Methods 3.1. Platelet RT-PCR
3.1.1. Isolation of Platelet RNA 1. Collect 10–50 mL of the patient’s blood directly into a syringe containing 1/6th vol of acid-citrate-dextrose and gently mix.
324
Basani, Richberg, and Poncz
2. Transfer the sample to a 50-mL conical tube and spin at 400g for 20 min at RT. Remove the top two-thirds of the platelet-rich plasma (PRP) phase on top, carefully avoiding the white cell interphase and transfer it to a fresh 50-mL conical tube. 3. Spin the sample at 1000g for 10 min to pellet the platelets. Aspirate off the plasma supernatant, leaving 200–400 µL of plasma on top of the platelet pellet. Gently resuspend the pellet in the remaining plasma by stirring with a pipette tip to create a thick slurry. DO NOT resuspend pellet by pipetting up and down as this activates the platelet and destroys the RNA. 4. Resuspend the platelets in the appropriate amount of RNA STAT-60™ (see Note 2). Vigorously pipet the solution up and down several times to ensure cell lysis. 5. Incubate at room temperature for 5 min to allow dissociation of nucleoprotein complexes, then add 0.2 mL of chloroform per 1 mL of RNA STAT-60. Cover sample and shake vigorously for 15–20 s. 6. Incubate at room temperature for another 5 min and then recentrifuge the sample at 12,000g for 15 min at 4°C. Transfer the aqueous phase to a fresh tube. Add 0.5 mL of isopropanol per 1 mL of RNA STAT-60 used initially. 7. Store the sample at room temperature for 5–10 min and again centrifuge at 12,000g for 10 min at 4°C. The RNA precipitate forms a translucent pellet at the bottom of the tube. 8. Wash pellet with 90% ethanol by vortexing and centrifuge at 7500g for 5 min. Use at least 1 mL of 90% ethanol per 1 mL of RNA STAT-60. Remove the supernatant and resuspend the RNA pellet in 1 mL of 50% ethanol at –70°C. 9. Quantify the yield of RNA by obtaining an OD reading at 260/280nm. Often the yield from platelets can be so low that one cannot quantify the yield. In which case, we recommend that a fourth of the RNA be used for the subsequent RT step.
3.1.2. RT-PCR of Platelet mRNA The next two steps are to convert the template RNA to first-strand cDNA followed by PCR amplification. 1. Spin down 5 µg of total RNA from the ethanol precipitate stock. Wash with 80% ethanol and air dry for 5 min. Dissolve in 4 µL of DEPC-treated H2O. 2. Add 1 µL of the cDNA synthesis primer (100 ng/µL). Heat sample at 70°C for 3 min (to remove secondary folding within the RNA) and allow to cool to room temperature for 10 min. Place sample on ice. 3. Add to the reaction mix: 2 µL RT buffer, 1 µL 10 mM dNTP mix, 1 µL MMLV reverse transcriptase (100 U/L), 2 µL H20. Total volume is 10 µL. 4. Incubate at 42°C for 1 h, and then stop the reaction by heat inactivation at 100°C for 10 min. 5. Dilute the reaction to 1 mL with Tris HCl, pH 8.0, and concentrate in a Centricon 100 to 50 µL. Readjust volume to 1 mL with Tris-HCl, pH 8.0, and concentrate again to 20 µL, using Centricon columns. 6. The sample now represents a stock of single-stranded cDNA template ready for amplification by standard PCR techniques. Each optimal set of PCR conditions
Inherited Platelet Receptor Disorder
325
must be worked out for individual laboratories. The amount of this first strand cDNA stock needed for PCR amplification varies between laboratories, but can often be as little as 1/1,000th of the platelet preparation, assuring a ready resource for the multiple amplifications.
3.2. Genomic DNA Analysis 3.2.1. Isolation of Genomic DNA (see Note 4) 1. Collect 10–50 mL of either citrated or heparinized peripheral blood into a 50-mL conical tube. Centrifuge the sample at 3000 rpm for 20 min and carefully remove the plasma. 2. Wash the cellular pellet twice with isotonic saline and then selectively lyse the red cells with 25 mL of 0.144 M NH4Cl and 2.5 mL of 1 mM NH4CO3. Mix well and leave at room temperature for 30 min. The sample will turn black with complete lysis. Spin down the white cell pellet at 3000 rpm for 10 min. Carefully remove the lysed red cell solution. 3. Wash the white cell pellet twice with isotonic saline. 4. Resuspend the pellet in 1 mL of isotonic saline. Slowly add the suspension dropby-drop to 75 mL of 1X Chambon buffer A and 0.75 mL Proteinase K in a 500– 1000-mL flask. Swirl the buffer gently as you add the cells. Leave the flask at 37°C overnight or longer until the white cells are completely digested. 5. The next day, add 20 mL buffered phenol:chloroform and agitate for several minutes so that the viscous DNA solution mixes with the phenol layer. Centrifuge at 3000 rpm for 10 min. Carefully transfer the aqueous layer into a clean flask and repeat until the phenol layer is clear. 6. Decant the aqueous phase slowly into a clean one liter flask which contains 150 mL of 100% ethanol so that the aqueous phase underlies below the ethanol. Occasional, gentle rocking of the flask back and forth will lead to high molecular DNA strands slowly forming over one day. 7. With a glass pipette, gently remove the DNA by swirling it onto the tip of the pipet and transfer the DNA to an Eppendorf tube. 8. Wash twice with 75% ethanol and lyophilize dry for a few minutes. Resuspend the DNA in 0.5 mL of TE and by gentle inversion, the DNA should go into solution (see Note 3).
3.2.2. Radiolabeled PCR Amplification of Genomic DNA It is very difficult to define a single set of PCR conditions that will ensure optimal specific amplification of the target DNA sequence. We describe the basic protocol that has been successful in our laboratory for most of the exons of both αIIb and β3 genes. 1. All reagents used in the polymerase chain reaction should be prepared with sterile distilled water and stored at –20°C. 2. Using 0.25-mL thin-walled PCR tubes, add 200 ng of the paired sense and antisense primers (~20-mers), 10 µL of 10X thermophilic buffer, 10 µL of 1.25 mM dNTPs,
326
Basani, Richberg, and Poncz
10 µL of 25 mM MgCl2, 500 ng of genomic DNA, 1 µL of [α-32P]dCTP and make up to a final volume of 100 µL adding distilled water (see Note 5). 3. Mix the tubes well and quick spin to make sure that nothing stick to the walls of the tubes. Transfer the tubes to a thermal cycler and heat at 94°C for 5 min. Then add 2 U of Taq polymerase and initiate the following program for 30 cycles: Denaturation at 94°C for 15 s, primer annealing at 55–60°C for 30 s, and primer extension at 72°C for 40 s. After the final cycle, carry out an additional step of 72°C for 5 min to ensure that primer extension is completed, giving a full-length product. 4. After thermal cycling, the samples are analysed on agarose gel to determine the amount of DNA per PCR product. Near identical amounts of PCR products are then subjected to SSCP analysis.
3.2.3. SSCP Analysis of the PCR Products SSCP is a very rapid and sensitive technique in identifying disease causing mutations and also polymorphisms (17,19). The method involves the amplification by PCR of a discreet segment of genomic DNA in the presence of radiolabelled nucleotides, denaturing of the PCR products in formamide, and analysing the single strands on a nondenaturing polyacrylamide gel. Under these conditions single stranded DNAs refold into stable conformations by intrastrand interactions of nucleotides. Because of the intrastrand nucleotide pairing, each single strand DNAs attain a signature conformation that may migrate differently on a nondenaturing polyacrylamide gel electrophoresis (Fig. 2). Based on the intensity of the PCR products on an ethidium bromidestained agarose gel, equal amounts of each PCR samples are added to a final volume of 10 µL, including loading dye. The protocol for SSCP analysis is very similar to manual DNA sequencing except that after the initial denaturation of the sample, the sample is allowed to renature and run in the gel under renaturing conditions, including not having urea in the gel, lower wattage to avoid heating up the sample and running the gel in the cold room. 1. Glass plates must be clean and free of dried gel or soap residue. To remove these residues, wash both plates with 95% ethanol. Set up the plates. One of the two glass plates, preferably the smaller plate, must be siliconized. We use 0.4-mm spacers to make a thin gel. 2. To pour a 0.4-mm gel, combine 9 mL of 10X TBE with 13 mL of 19:1 acrylamide:bisacrylamide and make up the volume up to 90 mL with distilled water. 3. When ready to pour, add 0.1 g of ammonium persulphate, swirl the contents to completely dissolve. Add 30 µL of TEMED, swirl and immediately pour the solution between the glass plates, making sure not to trap any air bubbles. Insert a comb and clamp it. Allow the gel to polymerize for at least 60 min at room temperature.
Inherited Platelet Receptor Disorder
327
4. Run the gel in 1X TBE buffer. Always run the gel at 4°C to avoid artefacts bands (see Note 6). Prerun the gel for 20 min. 5. Denature the samples in formamide at 100°C for 5–10 min and then placed on ice for several minutes. 6. Load the samples on the gel and run for 4–5 h at 16–20 W. 7. Transfer the gel on to Whatman 3MM filter paper, dry, and expose to radiographic film overnight at –70°C. From the autoradiography compare the mobility of the fragments of the patients’ DNAs with a concurrently run normal control (Fig. 2) (see Note 7).
3.2.4. Direct PCR sequencing (see Note 8) 1. The first step is primer labeling. a. In a 0.5-mL Eppendorf tube add 10 pmol of sequencing primer, 3 µL of [γ- 32P] ATP, 1 µL of 10X T4 PNK buffer, 5–10 U of T4 polynucleotide kinase, and make up to a final volume of 10 µL with distilled water. b. Mix the contents, quick spin and incubate at 37°C for 30 min. Then inactivate the enzyme at 90°C for 2 min. 2. The second step in direct sequencing is the extension/termination reaction a. For each set of sequencing reaction, label four 0.5-mL Eppendorf tubes as A, C, G, and T. b. Add 4 µL of appropriate d/ddNTP mix to each tube and leave on ice until use. c. For each set of sequencing reaction, mix 4–40 fmols of template DNA, 10 µL of 5X buffer of 3 µL of [γ-32P]d ATP labeled primer and makeup to a final volume of 32 µL with distilled water in a separate Eppendorf tube. d. Add 10 U of sequencing grade Taq DNA polymerase to the reaction and briefly mix by pipeting. e. Add 8 µL of enzyme/primer/template mix to each of the d/ddNTP (A, C, G, T) mixes and overlay with approx three drops of mineral oil to ~100 µL and briefly spin in a microcentrifuge. f. Place the tubes in a thermal cycler and heat the samples at 95°C for 2 min and initiate the cycling program for 30 cycles (see Note 9). The following conditions for sequencing for a primer <24bp and GC content <50%: Denaturation at 95°C for 30 s, primer annealing at 42°C for 30 s, and primer extension at 70°C for 1 min. g. After completion of the thermal cycling program, add 6 µL of sequencing stop solution to each tube. Briefly centrifuge to terminate the reaction. Analyze the samples on a conventional sequencing gel.
3.3. Functional Analysis of the Mutation: COS-1 cells 3.3.1. Site-Directed Mutagenesis (see Note 10) 1. Using 250-µL thin-walled PCR tubes, add 100–200 ng of template wild-type cDNA, 100 ng of each mutant primer (~30-mer) and flanking primer (~20-mer), 3 µL of 10 mM dNTPs, 10 µL of 10X Vent buffer 1 µL of 100 mM MgSO4 and make up the volume to 100 µL using distilled water.
328
Basani, Richberg, and Poncz
2. Mix the contents and transfer the tubes in to a thermal cycler and heat at 94°C for 5 min. 3. Add 2 U of Vent polymerase to each 100 µL reaction and start the following typical program for 30 cycles; denaturation at 94°C for 15 s, primer annealing at 60°C for 30 s, and primer extension at 72°C for 40 s. After the final cycle, carry out an additional step of 72°C for 5 min to ensure that primer extension is complete, giving full-length double-stranded products. 4. The samples are then analyzed on an agarose and gel purified using a GENECLEAN kit (see Note 11). 5. The two overlapping PCR fragments are used as a template for the second PCR using the flanking primers to generate an overlapped cDNA fragment. The reaction conditions are the same as above except the extension time is lengthened to more than a minute. The amplified fragment is subjected to restriction analysis, subcloned and sequenced to confirm the presence of the desired mutation.
3.3.2. Transient Expression (see Notes 12 and 13) 1. Grow COS-1 cells in COS complete media consisting of Dulbeco’s modified Eagle medium (high glucose) supplemented with 10% (v/v) heat-inactivated fetal calf serum, 100 U/mL pencillin, 100 µg/mL streptomycin, and 0.3 mg/mL L-glutamine. Transfection of plasmid DNA is carried out using the DEAEdextran method (22). 2. Split the cells at 4 × 106 cells per 75 cm2 flask in complete media 24 h before transfection. 3. Aspirate the media and wash the cells once with 5 mL of TBS-Dextrose. 4. Dilute 2 µg of DNA (from Subheading 3.3.1.) in 0.75 mL of TBS-Dextran and overlay the cells. Incubate the flask at 37°C incubator for 1 h with occasional mixing. 5. After 1 h, wash the cells carefully with 5 mL of TBS-dextrose and layer 10 mL of DMEM-chloroquine and incubate for another 3 h. 6. Wash the cells gently three times with serum free DMEM and incubate the cells with complete media at 37°C for 48 h. During each step, observe the cells under a microscope to ensure that the cells are adhering to the bottom of flask. 7. For studies of internal processing of the receptor, the cells are metabolically labelled as follows: 8. After 48 h of transfection, the cells become confluent. Remove the media and replace it with 2 mL of methionine-free media, to starve the cells for 60 min. 9. Replace with 3 mL of the same media supplemented with 35S-methionine and incubate for another 60 min. 10. After incubation, replace the media with 5 mL of complete media and chase for 4 h. 11. Remove the media and harvest the cells using 0.02 M Tris HCl, pH 7.2, containing 1% Triton X-100 + protease inhibitors. It is best to leave the samples on a rotary mixer overnight at 4°C to completely solubilize the cells. 12. The next day, centrifuge the samples at 12,000g for 20 min to remove particulate debris. 13. Immunoprecipitation is done as follows: Incubate 1-mL aliquots of extracts with 4 µL of nonimmune mouse serum for 15 min at 4°C. Add 100 µL of a 10% suspension of fixed staphylococci and incubate at 4°C for 60 min.
Inherited Platelet Receptor Disorder
329
14. Remove the staphylococci by sedimentation and incubate the cleared extracts with 25 mg of the appropriate monoclonal antibody at 4°C for 60 min. Add 100 µL of a 10% suspension of Affi-Gel A and incubate at for 60 min at 4°C to collect the immune complexes. 15. Wash the resin six times: three times with resin wash buffer containing 0.01 M NaCl and three times with the same buffer containing 0.3 M NaCl. 16. Elute the immune complexes bound to the resin by heating to 100°C for 5 min in Elution buffer. 17. Analyse the samples by size-fractionating on a 0.1% SDS-7.5% polyacrylamide slab gel. 18. Fix the gel in 10% (v/v) acetic acid-30% (v/v) methanol, and incubate with Autofluor according to the manufacturer’s instructions. Dry the gel and expose to Kodak X-Omat AR film at -70°C. 19. Figure 4B shows such a blot for wild type constructs in lanes 1 and 2. If one expresses only the αIIb or β3 chain, stability of the protein within the cell can be studied, but its ability to complex with its partner and reach the cell surface requires cotransfection experiments. Lane 3 demonstrates the ability of cotransfected wild-type glycoproteins to complex and to be transported into the Golgi body as the αIIb chain is cleaved to the slightly smaller αIIbα heavy chain. 20. To study surface-expressed αIIb/β3 receptors, cotransfected COS-1 cells are 125Ilabeled using lactoperoxidase/ H2O2. The COS-1 cell transfection is performed at outlined above. 21. After 48 h of transfection, wash the cells once with 5 mL of PBS. 22. Add 2–4 mL of 1X PBS to each flask, 0.5 mg/mL and 1 mCi of 125I to the flask and mix the contents. 23. Add 10 µL of H2O2 (12 µL of 30% H2O2 in 10 mL of H2O) each 15 s by gentle mixing for five times. 24. Aspirate the media and wash cells with 5 mL of PBS. 25. Dissolve the cells in the appropriate buffer along (+ protease inhibitors) and carry out immunoprecipitation of proteins as described above.
3.4. Functional Analysis of the Mutation: 1500F B-Lymphocytes In summary, the approach is to subclone the αIIb and β3 cDNA constructs into pREP9 (neomycin-resistant) and pREP4 (hygromycin-resistant) expression vectors, respectively and to transfect into 1500F (or another Epstein-Barr Virus [EBV]-immortalized) B-lymphocytes using electroporation. Positive selection of cells expressing the recombinant proteins is attained by growing cells in media containing the drug selection markers Geneticin (G418) and Hygromycin B. Surface expression of the αIIb/β3 is then confirmed using flow cytometry. Receptor expressing cells are then metabolically labeled with 35S methionine and allowed to bind to fibrinogen-coated wells in the presence and absence of stimulation with the PMA. The wells are then washed to remove nonspecifically bound cells. Adherent cells are then removed with a 2% SDS solution and the amount of bound cells are then determined by liquid scintillation.
330
Basani, Richberg, and Poncz
3.4.1. Stable Expression System into Lymphocytes (see Note 14) The introduction of specific mutations into the wild type cDNA is performed as described above and the cDNA constructs are shuttled into pREP4 and pREP9 expression vectors. Large-scale cesium chloride-purified DNA is electroporated into cells as follows: 1. Grow 1500F or another EBV-immortalized B-lymphocytic cells in RPMI 1640 media supplemented with 20% heat-inactivated fetal bovine serum, 100 U/mL penicillin, 100 µg/mL streptomycin and 0.3 mg/mL L-glutamine. 2. Spin down 5 × 107 cells at 2000g for 5 min in media. 3. Aspirate the media and wash the cells with 10 mL of PBS (containing Ca2+ and Mg2+). 4. Recentrifuge as above and resuspend the cell pellet in electroporation buffer to a final concentration of 1 × 108/mL. 5. Add 20 µg of each construct to be transfected to a 1.5-mL Eppendorf tube together with 0.5 mL of cells. Mix by gently tapping the tube and transfer to a prechilled electroporation cuvettes and perform the electroporation (see Note 15). 6. After the electroporation, quickly place each sample on ice for 10 min. Transfer the samples to 25 cm2 flask containing 10 mL of 20% FCS and RPMI 1640 without selection markers and grow for 48 h at 37°C in 5% CO2 (see Note 16). 7. At the end of the two day period, spin down the cells at 1000g for 5 mins and resuspend the cells in 12 mL of 20% RPMI media containing 750 µg/mL Geneticin and/or 200 µg/mL Hygromycin B. Plate out the cells in 24-well plates with 0.5 mL/well. 8. At the end of 4–7 d incubation, transfer cells to a 6-well plate with 2–3 mL fresh media per well. Another 1–2 wk are required for expansion before preliminary flow cytometric analysis can be performed (see Note 17).
3.4.2. Flow Cytometric Analysis In order to confirm that the cells that survive in selection media actually express αIIb/β3 receptors on the cell surface, flow cytometry is used to confirm the expression of the receptors. These studies involve routine flow cytometric techniques and will not be detailed here. There are numerous primary monoclonal antibodies, some commercially available, that can be used for flow cytometry studies. We utilise a monoclonal antibody A2A9 which is a complex-dependent antibody that does not recognise the individual subunits of the receptor (23). With this antibody, mean values of 200–300 times untransfected cells indicate cell lines that express the transfected proteins optimally.
3.4.3. B-Lymphocyte Binding Assay Once the level of surface expression for the receptor has been verified by flow cytometry, the cells can then be used for binding to fibrinogen-coated
Inherited Platelet Receptor Disorder
331
plates. This assay system takes advantage of the fact that the 1500F B-lymphocytes have the internal signalling mechanisms required for the activation of the αIIb/β3 receptor into its high affinity state in response to PMA. This results in a 10- to 20-fold increase in binding of transfected cells to fibrinogen-coated plates, when compared to untransfected and non-stimulated cells. The establishment of this in vitro model system allows for the functional mutational analysis of the αIIb/β3 receptor. In this system, effects of mutations on the function of the receptor can be quantitated allowing for the identification of specific amino acids and structural regions that are crucial for the function of this receptor. 3.4.3.1. PREPARATION OF FIBRINOGEN-COATED PLATES 1. Dissolve 4 mg of purified fibrinogen in 100 mL of buffer. 2. Add 100 µL of fibrinogen to each well of a 96-well plate and incubate overnight at 4°C. 3. Remove the fibrinogen solution from the wells by inverting plates and add 300 µL/well of blocking solution. 4. Incubate at 4°C for at least 2 h before running the experiment. 5. Store unused plates in blocking buffer at 4°C.
3.4.3.2. BINDING ASSAY PROTOCOL 1. Add 25 µL of translational grade 35S-methionine to 5 × 106 cells in 25 mL of selection media and incubate overnight to label the cells. 2. The following day, prepare everything before starting the experiment as the cells are fragile once they are removed from the media. Pipet up and down to remove all the cells and place them into a 15-mL conical tube and spin down the cells at 1,000 rpm for 5 min. 3. Aspirate off the media into a radioactive flask and put the samples on ice. Resuspend the sample in 1 mL of Solution 1 on ice and then bring the sample up to 10 mL with Solution 1. 4. Transfer 25 µL of the cells into a 1.5-mL Eppendorf tube containing 25 µL of Trypan Blue and estimate the cell number and viability in a hemocytometer. 5. Spin down the sample, and resuspend the cells in Solution 1 at a concentration of 1.5 × 106/mL and place 500 µL of cells into two tubes pre-chilled to 4°C. 6. Wash the 96-well fibrinogen-coated plate vigorously with Solution 2 to remove excess BSA. 7. Take a 10 mM stock of PMA in ethanol (prechilled) and dilute 10 µL of this stock into 300 µL of prechilled water. Add 10 µL of this diluted PMA stock to one 500 µL sample of cells and mix by gently swirling tube. 8. Plate 100 µL of control (unactivated) and PMA-treated (activated) cells into quadruplicate wells. Cover the plate with parafilm and incubate in 37°C for 30 min. 9. While the plate is incubating, place four 10 µL aliquots of each sample into separate scintillation vials to determine the specific activity of the cells used in the experiment. Add 200 µL of 2% SDS to four scintillation vials for each sample
332
10. 11.
12.
13.
Basani, Richberg, and Poncz and place to the side. The SDS for these samples will simulate the SDS needed to remove the other samples from the wells. At the end of the incubation, remove the buffer from the 96-well plates. Wash vigorously with Solution 2. Visualize the remaining adherent cells under an inverted microscope. You should see a small amount of cells in the wells from non-PMA treated samples. These cells exhibit some background binding, however there should be a dramatic increase in cell density in the wells corresponding to the stimulated samples. Add 50 µL of 2% SDS to each well and vortex slightly, cover with parafilm and incubate for 15 min. Then add an additional 150 µL of 2% SDS and with a pipet tip, stir each well and transfer into a scintillation vial. Add 3 mL of scintillation fluid to each vial, including samples for specific activity measurement. Normalizing for the specific activity of each sample allows one to compare between the PMA stimulated and unstimulated cells and between the wild-type receptor and the mutant receptor under consideration.
4. Notes 1. The isolation of RNA from platelets is complicated because of the small amount of RNA available, the abundance and stability of RNases and the sensitivity of platelets towards activation. The standard precautions for RNA isolation must be applied. Only sterile plasticware should be used and glassware should be avoided if possible. All other glassware and H2O samples and solutions not containing Tris should be diethylpyrocarbonate (DEPC) treated to destroy RNases. All procedures should be done wearing gloves. Throughout the procedure care must be taken not to activate the platelet sample. Contact with glass surfaces, placing the sample on ice and sample agitation all cause platelet activation and should be avoided. 2. We use a commercial RNA preparation kit, which is based on the rapid chaotropic inactivation of RNases by high concentration of guanidinium thiocyanate (27). 3. This primer can be either oligo dT primer for full length cDNA or a primer specific for the mRNA of interest. 4. Techniques for isolating DNA vary greatly among laboratories. We utilise a technique described in the early 1980s that consistently yields several milligrams of high-mol-wt genomic DNA from 10–50 mL of peripheral blood (10). High-molwt DNA is obtained only if the samples are handled with great care. Avoid vigorous vortexing which shears the DNA. The phenol extracted DNA should be gently poured into the 100% ethanol already placed into the flask and the mixing should be allowed to occur over 1–2 d with gentle, occasional mixing. Rapid mixing will degrade the DNA and decrease yields. 5. The PCR is radioactive and must be handled with care. The recommended conditions here include only a 15 s denaturation step. We found that this limitation of heating at 94°C best preserves the Taq polymerase enzyme. 6. Running conditions for SSCP should be optimized in each laboratory. SSCP detection of an abnormal band can be maximized by varying gel conditions so that one analyzes the DNA under more than one set of running conditions.
Inherited Platelet Receptor Disorder
333
7. There are some caveats in the analysis of results: The more samples analyzed concurrently, the more likely that you will appreciate subtle band differences. If there were extraneous band on the analysis of the ethidium bromide agarose gel, these will certainly complicate the SSCP gel. You may have to isolate the PCR bands away from the extraneous bands before doing SSCP. If you analyse a region of DNA and find great variability between your patient samples, it may be that you are dealing with a region of unrecognized high polymorphism. Check the sequence in that region for a short nucleotide repeat. If it is present, see if you can reselect the region to PCR amplify, avoiding what may be a highly polymorphic repeat element. 8. One of the limitations of direct PCR sequencing is that the quality of the sequence is often not as high as sequencing subcloned PCR products, but it does avoid the need to sequence multiple clones to look for a defect. It is recommended that wild-type DNA be sequenced in parallel to the patient’s sample in order to be able to better detect a heterozygous mutation. 9. Cycling programs will be optimized for each primer/template combination. This depends up on the length of the primer or the GC content of the template. 10. Althought there are many kits for site-directed mutagenesis, we have found that the described overlap PCR approach is most consistently effective and cost efficient. Several caveats to obtaining an efficient yield of mutations include the following: The mutation is often a single nucleotide difference from the wildtype. To allow good primer extension with the mutant oligonucleotide, we make sure that there are ~10 nucleotides to either side of the mutant base in each primer. The outer two primers are sufficiently upstream and downstream to incorporate appropriate restriction enzyme sites between them and the mutation site for the subsequent subcloning. Another caveat is that the yield of mutated final product is highest if one is very careful about isolating the two initial overlap bands from the agarose gel to avoid template contamination. Often, we do the second round of PCR with no added primers for 5–10 rounds before adding the outer two primers to improve efficiency of obtaining mutated final product. 11. At this step, it is very important to completely eliminate the wild-type cDNA template or it will greatly decrease the frequency with which you find the mutation in the final PCR product. 12. Suitable expression vectors for the described transient expression studies include the pMT2ADA vector which has the cDNAs driven by the major late promoter of adenovirus and has a built-in 5'-untranslated region intron for increased stability (24), or pcDNA3, which has the cDNAs driven by the CMV promoter. Both vectors drive expression equally well. 13. Although we said that COS-1 cells are advantageous for these expression studies because they do not normally express the αIIb/β3 complex, this also means that there are some limitations with this approach. Intracellular processing of the αIIb and β3 proteins are less efficient than in megakaryocyte and there is often an excess accumulation of intracellular uncleaved αIIb. This suggests that insights gained on the intermediate processing of the receptors have to be qualified in that
334
14.
15. 16.
17.
Basani, Richberg, and Poncz they may not fully reflect what is actually occurring in the developing magakaryocyte. Another major limitation of these and many other cell lineages used for studies of the αIIb/β3 receptor is that, whereas the receptor may reach the cell surface, the receptor is in an inactive conformation and stimulants, such as ADP, collagen, epinephrine, and thrombin that activate platelets do not activate these receptors. One alternative has been to use anti-αIIb/β3 antibodies that alter the conformation of surface αIIb/β3 increasing their affinity for the fibrinogen ligand. Such antibodies, called LIBS antibody (ligand-induced antigenic site) antibodies (25), are one way to study the biology of the receptors. An alternative model being pursued is the use of stable transfection into a cell line that does allow activation of the receptor, as described with the B-lymphocyte system. Although the lymphocyte system is useful for numerous studies on activated receptors, there are a number of caveats that the user must be aware of, including the following: After the B-lymphocytes are electroporated, it is important to allow the cells to recover from the electric shock. Placing the cells directly into selective media immediately after transfection will result in cell death. We use a Gene Pulser (BioRad, Melville, NY) at 0.25 V and 960 Ω. The exact conditions need to be optimized for each particular electroporating device. Particular attention must be paid to the growth of the cells after electroporation. Upon transfer to the 24 well stage in selective media, most of the cells will die over the following 4–7 d. Observation of cell growth should be performed regularly. Dead cells are singular and completely rounded, while live cells grow in aggregate “clumps” or as single non-rounded cells with pseudopods. Care must be taken to try and re-establish the optimal concentration of living cells of 0.5– 1.0 × 106 cells/mL as soon as possible. At the end of 4–7 d incubation, transfer cells to a 6-well plate with 2–3 mL fresh media per well. Another 1–2 wk are required for expansion before preliminary flow cytometric analysis can be performed. An efficient transfection correlates with a faster rate of growth, better flow cytometric values and better fibrinogen binding by the B-lymphocytes. However, these cells maintain high levels of receptor expression for only 2–3 mo. After which, they retain resistance to the selection markers, but fail to express high levels of the receptor. Therefore, positive cell samples should be frozen away at the 6-well stage as soon as possible. Usually, we freeze away aliquots of 1 × 107 cells per vial for future studies. The cells grow in suspension as aggregates and require cell-cell contact for optimal growth. Therefore, special attention should be taken in general maintenance of the cells. The concentration of cells should be maintained at between 0.5–1.0 × 106 cells/mL.
References 1. Hoffman, R. (1989) Regulation of megakaryocytopoiesis. Blood 74, 1196-1212. 2. Handagama, P., Rappolee, D. A., Werb, Z., Levin, J., and Bainton, D. F. (1990) Platelet α-granule fibrinogen, albumin, and immunoglobulin G are not synthesized by rat and mouse megakaryocytes. J. Clin. Invest. 86, 1364–1368.
Inherited Platelet Receptor Disorder
335
3. Louache, F., Debili, N., Cramer, E., Breton-Gorius, J., and Vainchenker, W. (1991) Fibrinogen is not synthesized by human megakaryocytes. Blood 77, 311–316. 4. Poncz, M., Eisman, R., Heidenreich, R., Silver, S. M., Vilaire, G., Surrey, S., Schwartz, E., and Bennett, J. S. (1987) Structure of the platelet membrane glycoprotein IIb: Homology to the alpha subunits of the vitronectin and fibronectin receptors. J. Biol. Chem. 262, 8476–8482. 5. Poncz, M., Surrey, S., LaRocco, P., Weiss, M. J., Rappaport, E. F., Conway, T. M., and Schwartz, E. (1987) Cloning and characterization of platelet factor 4 cDNA derived from a human erythroleukemic cell line. Blood 69, 219–223. 6. Tabilio, A., Rosa, J. -P., Testa, U., Kieffer, N., Nurden, A. T., Del Canizo, M. C., Breton-Gorius, J., and Vainchenker, W. (1984) Expression of platelet membrane glycoproteins and a-granule protein by a human erythroleukemic cell line (HEL). EMBO J. 3, 453–459. 7. Wicki, A. N., Walz, A., Gerber-Huber, S. N., Wenger, R. H., Vornhagen, R., and Clemetson, K. J. (1989) Isolation and characterization of human blood platelet mRNA and construction of a cDNA library in lambda-gt11. Confirmation of the platelet derivation by identification of GPIb coding mRNA and cloning of a GPIb coding cDNA insert. Thromb. Haemostasis 61, 448–453. 8. Butler-Zimrin, A., Eisman, R., Vilaire, G., Schwartz, E., Bennett, J. S., and Poncz, M. (1988) Structure of platelet glycoprotein IIIa: a common subunit for two different membrane receptors. J. Clin. Invest. 81, 1470–1475. 9. Doi, T., Greenberg, S. M., and Rosenberg, R. D. 1987. Structure of the rat platelet factor 4 gene: a marker for megakaryocyte differentiation. Mol. Cell. Biol. 7, 898–904. 10. Poncz, M., Solowiejczyk, D., Harpel, B., Mory, Y., Schwartz, E., and Surrey, S. (1982) Construction of human gene libraries from small amounts of peripheral blood: analysis of β-like globin genes. Hemoglobin 6, 27–36. 11. Wenger, R. H., Wicki, A. N., Walz, A., Kieffer, N., and Clemetson, K. J. (1989) Cloning of cDNA coding for connective tissue activating peptide III from a human platelet-derived lambda expression library. Blood 73(6), 1498–1503. 12. Newman, P. J., Gorski, J., II White, G. C., Gidwitz, S., Cretney, C. J., and Aster, R. H. (1988) Enzymatic amplification of platelet-specific messenger RNA using the polymerase chain reaction. J. Clin. Invest. 82, 739–743. 13. Metcalf, D. (1994) Blood: Thrombopoietin—At last. Nature 369, 519,520. 14. Heidenreich, R., Eisman, R., Surrey, S., Delgrosso, K., Bennett, J. S., Schwartz, E., and Poncz, M. (1990) Organization of the gene for platelet glycoprotein IIb. Biochemistry 29, 1232–1244. 15. Villa-Garcia, M., Li, L., Riely, G., and Bray, P. F. (1994) Isolation and characterization of a TATA-less promoter for the human β3 integrin gene. Blood 83, 668–676. 16. Zimrin, A. B., Gidwitz, S., Lord, S., Schwartz, E., Bennett, J. S., White, II, G. C., and Poncz, M. (1990) The genomic organization of platelet glycoprotein IIIa. J. Biol. Chem. 265, 8590–8595. 17. Ainsworth, P. J., Surh, L. C., and Coulter-Mackie, M. B. (1991) Diagnostic singlestrand conformational polymorphism (SSCP): A simplified non-radioactive method as applied to Tay-Sachs B1 variant. Nucleic Acids Res. 19, 405,406.
336
Basani, Richberg, and Poncz
18. Basani, R. B., Vilaire, G., Shattil, S. J., Kolodziej, M., Bennett, J. S., and Poncz, M. (1996) Glanzmann thrombasthenia due to a two amino acid deletion in the fourth calcium-binding domain of αIIb: Demonstration of the importance of calcium-binding domains in the conformation of αIIbβ3. Blood 88, 167–173. 19. Orita, M., Suzuki, T., Sekiya, T., and Hayashi, K. (1989) Rapid and sensitive detection of point mutations and DNA polymorphisms using the polymerase chain reaction. Genomics 5, 874–879. 20. Losekoot, M., Fodde, R., Harteveld, C. L., Van Heeren, H., Giordano, P. C., and Bernini, L. F. (1990) Denaturing gradient gel electrophoresis and direct sequencing of PCR amplified genomic DNA: A rapid and reliable diagnostic approach to beta thalassaemia. Br. J. Haematol. 76, 269–274. 21. Block, K. L., Ravid, K., Phung, Q. H., and Poncz, M. (1994) Characterization of regulatory elements in the 5'-flanking region of the rat GPIIb gene by studies in a primary rat marrow culture system. Blood 84, 3385–3393. 22. Sambrook, J., Fritsch, E. F., and Maniatis, T. (eds.) (1989) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, Cold Spring Harbor, NY. pp. 16.42–16.44. 23. Bennett, J. S., Hoxie, J. A., Leitman, S. F., Vilaire, G., and Cines, D. B. (1983) Inhibition of fibrinogen binding to stimulated human platelets by a monoclonal antibody. Proc. Natl. Acad. Sci. USA 80, 2417–2421. 24. Bronthon, D. T., Handin, R. I., Kaufman, R. J., Wasley, L. C., Orr, E. C., Mitsock, L. M., et al. (1986) Structure of pre-pro-von Willebrand factor and its expression in heterologous cells. Nature 324, 270–272. 25. Frelinger, A. L., III, Du, X., Plow, E. F., and Ginsberg, M. H. (1991) Monoclonal antibodies to ligand-occupied conformers of integrin αIIbβ3 (glycoprotein IIb-IIIa) alter receptor affinity, specificity, and function. J. Biol. Chem. 266, 17,106–17,111. 26. Loh, E., Beaverson, K., Vilaire, G., Qi, W., Poncz, M., and Bennett, J. S. (1995) Agonist-stimulated ligand binding by the platelet integrin αIIbβ3 in a lymphocyte expression system. J. Biol. Chem. 270, 18,631–18,636. 27. Chirgwin, J. M., Przybyla, A. E., MacDonald, R. J., and Rutter, W. J. (1979) Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry 18, 5294–5299.
In Vitro Expansion of Megakaryocytes
337
33 In Vitro Expansion of Megakaryocytes from Peripheral Blood Hematopoietic Progenitors Michael A. Thornton and Mortimer Poncz 1. Introduction Recently, there have been several reports describing the in vitro proliferation and differentiation of megakaryocytic progenitor cells, isolated from either bone marrow (BM) or peripheral blood (PB), into relatively pure human megakaryocytes (1,2). These culture systems originated from the discovery that Ficoll isolated human mononuclear PB cells, when stimulated with aplastic sera from thrombocytopenic animals, differentiated into megakaryocytes (3), and also from the finding that the megakaryocyte progenitors found in PB or BM typically express the CD34 antigen on their cell surface (4). Collectively, these two discoveries led to a system whereby PB isolated CD34+ cells are cultured with an exogenously derived cytokine soup of growth and differentiation factors. Finally, after a variable expansion period, from 8–14 d, the cells are analyzed for megakaryocytic antigenic markers, such as αIIb/β3 (CD41). The disadvantage of this system is that it is a short-term one, with most of these primary cells being dead 21 d after their initial plating. Other “long-term” systems where the developing CD34+ cells are grown in the presence of cytokine expressing human BM microvascular endothelial cells have demonstrated 200fold expansions over a 2-month growth period (5). Both the short- and longterm culture systems have the potential to generate sufficient numbers of megakaryocytes for doing transient or stable expression studies or for other applications, such as providing sufficient megakaryocyte nuclear extracts for electrophoretic mobility shift assays or nuclei for DNase1 hypersensitivity studies. We describe below the short-term megakaryocyte proliferation and differentiation culture system (Fig. 1). From: Methods in Molecular Medicine, Vol. 31: Hemostasis and Thrombosis Protocols Edited by: D. J. Perry and K. J. Pasi © Humana Press Inc., Totowa, NJ
337
338
Thornton and Poncz
Fig. 1. Flowchart for the isolation of purified megakaryocytes from a sample of PB.
CD34+ megakaryocytic progenitor cells reside in peripheral blood (PB) as a small subpopulation of lymphocytes. In unstimulated peripheral blood (i.e., no exogenous G-CSF treatment), 0.1–0.3% are CD34+. In order to isolate these cells, the first step is to separate lymphocytes from erythrocytes and granulocytes using a Ficoll density solution. Once you have isolated mononuclear cells,
In Vitro Expansion of Megakaryocytes
339
the next step is to select for those cells carrying the CD34 antigen. Usually one uses a negative selection system to begin this process. Soy bean agglutinin binds to and removes such cells as T- and B-lymphocytes, myeloid cells, stromal cells, and fibroblasts. The remaining cells are then subject to a positive selection process, often using an anti-CD34 antibody coated surface to isolate the CD34 cells. These cells are then allowed to grow 8–10 d in the presence of cytokines such as TPO and IL-3. Since there is a range of 30–80% of nonmegakaryocyte cells, at the end of the in vitro culture, it may be preferred to further purify the cells from this heterogeneous mix to homogeneity. This can be achieved through immunological approaches such as fluorescent activated cell sorting (FACS) using FITC labeled CD41 antibodies (6) or double-gated FACS analysis that selects for fluorescent intensity as well as cell size. A more traditional means of purifying megakaryocytes from this mixed population is density/velocity centrifugation. In this approach the cells are separated by a bovine serum albumin (BSA) or Percoll buoyant density centrifugation step (7), which divides the cell population into three fractions. The upper top-layer fraction is removed and layered on a 2–4% Ficoll gradient and centrifuged at 100g for 5 min. The larger sized megakaryocytes are harvested from the pellet, whereas the smaller cells are spread throughout the gradient, primarily according to cell size. 2. Materials 2.1. Preparation of Circulating Monocytic Cells 1. Acid-citrate-dextrose: 38 mM citric acid, 61 mM Na3citrate, and 136 mM glucose. Adjust pH to 6.5. 2. 50-mL sterile conical tubes and 10-mL sterile pipets (Costar Co, Cambridge, MA). 3. Hanks Balanced Salt Solution (HBSS, no Mg2+ or Ca2+) (GibcoBRL, Grand Island, NY). 4. 60-mL syringes (Becton Dickinson, Franklin Lakes, NJ). 5. Ficoll-Paque Research Grade lymphocyte isolation solution (Pharmacia Biotech, Piscataway, NJ). 6. Trypan blue (Sigma Co., St. Louis, MO).
2.2. Isolation of CD34+ Cells 1. Human γ-globulins (Sigma): Heat inactivated at 56°C for 30 min. 2. Soy bean agglutinin (SBA) selection flask (Gencell, Santa Clara, CA). 3. AIS CD34+ MicroCELLector T-25 antibody coated-cell culture flask (Gencell, Santa Clara, CA) (see Note 2). 4. Chymopapain (Sigma). 5. 1X PBS (no Mg2+ or Ca2+) and 1 mM EDTA plus 0.5% heat-inactivated human γ-globulins. Filter sterilize. 6. PBSE: 1X PBS (no Mg2+ or Ca2+) and 1 mM EDTA.
340
Thornton and Poncz
2.3. Growth of Megakaryocytes Ex Vivo (see Note 5) 1. 2. 3. 4. 5. 6. 7.
8. 9.
10. 11. 12. 13.
14.
15. 16. 17. 18. 19.
Iscoves Modified Dulbecco Media (IMDM). 100X Penicillin. 100X Streptomycin. 100X Glutamine. 100X MEM vitamin solution. 100X MEM nonessential amino acids (GibcoBRL, Grand Island, NY). 100X L-asparagine: Add 20 mg of L-asparagine and 4 mg of CaCl2 to 10 mL of IMDM media and then filter sterilize the solution through a 0.2-µm Nalgene filter. Add 500 µL of this preparation to the complete media. CaCl2. α-thioglycerol: Pipet 25 µL of IMDM into a sterile 50-mL conical, and add 2.5 µL of α-thioglycerol and 9 mg of CaCl2 to the IMDM. This will give a 1.0 mM αthioglycerol solution with 0.37 mg/mL CaCl2. Filter sterilize this solution as above and add 500 µL to the IMDM complete media. 0.2-µm Nalgene filter (Nalge Co., Rochester NY). AG501-X8 (D) 20–50 resin mesh (Bio-Rad Laboratories, Richmond, CA). 10X Phosphate-buffered-saline (PBS). Bovine serum albumin (BSA-Fraction V) (Sigma): Add 50 g of BSA- Fraction V to 91 mL of sterile deionized H2O. Dissolve over a 1–2-d period at 4°C. Add 12 g of AG501-X8 (D) 20–50 resin mesh to the dissolved BSA and leave overnight at 4°C with no stirring. Place a 4 × 4 cm sterile gauze pad over a sterile 500-mL graduated cylinder and pour the BSA/resin mixture through to filter out the resin. Add 1.1 mL of 10X PBS for each 15 mL of BSA recovered to the filtered BSA in the graduated cylinder to give a 37% BSA solution. Dilute the 37% BSA to 10% with 1X PBS and filter sterilize the solution through a 0.2-µm filter. Add 500 µL of this 10% deionized BSA solution to the IMDM complete media. Aliquot the remaining deionized BSA in 5 mL units and store at –20°C. IMDM complete media: Transfer 50 mL of IMDM to a sterile glass bottle. Add 500 µl of each of the following: Penicillin/streptomycin(100X), glutamine (100X), MEM nonessential amino acids (100X), MEM vitamin solution (100X), L-asparagine diluted in media with CaCl2, 1 mM α-thioglycerol diluted in media with CaCl2, and 1 mL of 10% deionized BSA (see steps 7, 9, and 13, above). Human AB heparinized, platelet poor plasma: Filter through a 0.45-µm filter prior to use. IL-3 (R&D Systems Inc., Minneapolis, MN): 2 µL of a 10 U/µL stock in 1 mL media: Final concentration 20 U/mL. IL-1α (Peprotech, Rocky Hill, NJ): 2 µL of a 100 pg/µL stock in 1 mL media: Final concentration 200 pg/mL. Kit ligand (Genzyme, Cambridge, MA): 1 µL of 100 ng/µL stock in 1 mL media. Final concentration 100 ng/mL. Thrombopoietin (TPO) (Amgen, Thousand Oaks, CA): 5 µL of 10 ng/µL stock in 1 mL media. Final concentration 50 ng/mL.
In Vitro Expansion of Megakaryocytes
341
2.4. Analysis of the Resulting Cells 1. Methanol (Fisher, Fair Lawn, NJ). 2. Normal goat blocking serum (Sigma). 3. αIIb/β3 (CD41) primary monoclonal antibody (Immunotech, Marseilles, France). Dilute 1:200 prior to use. 4. Anti-mouse IgG, FITC-conjugated (Sigma): Dilute 1:80 prior to use. 5. Glycerol/barbital mounting solution (Sigma). 6. Fluorescent microscope (Olympus, Japan). 7. Cytospin. 8. Distilled water.
3. Methods 3.1. Preparation of Circulating Monocytic Cells 1. Draw 50 mL of PB into a syringe containing 1/5th vol of sterile acid citrate dextrose and mix well. 2. Fill three 50-mL polypropylene sterile conical tubes each with 10 mL of HBSS (no Mg2+ or Ca2+). Directly add from the 60-mL syringe 20 mL of fresh peripheral blood to each of the three 50-mL conical tubes. 3. Fill three additional 50-mL conical tubes with 15 mL each of Ficoll-Paque Research Grade lymphocyte isolation solution. Carefully layer 30 mL of the HBSS diluted peripheral blood cells onto the 15 mL of Ficoll. 4. Centrifuge the Ficoll gradients at 450g for 40 min. 5. Using a 2-mL sterile pipet, carefully remove the buffy coat, middle layer between the upper plasma layer and lower Ficoll layer and place into a sterile 15-mL conical tube. Do not contaminate the sample with excess plasma or Ficoll. 6. Once all white blood cells have been transferred to the conical tubes add HBSS to the sample up to a final volume of 15 mL. You should end up with three 15-mL conical tubes each containing approx 5–6 mL of mononuclear cells and 9–10 mL of HBSS. 7. Pipet the cells to mix them with the HBSS, and then centrifuge the cells at 350g for 10 min. 8. Aspirate off the supernatant and resuspend the cells in 6–8 mL of HBSS using a 10-mL sterile pipet. 9. Centrifuge the cells again at 350g for 10 min. 10. Resuspend the cells once more in HBSS and take a cell count of the number of viable cells using trypan blue (see Note 1). The remaining cells are recentrifuged and then are ready for the selection of CD34+ cells.
3.2. Isolation of CD34+ Cells (see Note 2) We use the AIS CD34+ MicroCELLector T-25 antibody-coated-cell culture flask. There are other commercial kits that are available for the isolation of such cells. The isolated mononuclear cells are initially layered onto a SBAcoated flask for negative selections. This pre-enrichment step is followed by
342
Thornton and Poncz
layering the nonadherent cell pool onto a second flask which is coated with the 8G12 anti-CD 34 antibody. The cells are then released from the flask using a mild protease. 1. Resuspend the cells in 1X PBS [no Mg2+ or Ca2+ containing 1 mM EDTA added and 0.5% heat inactivated human γ-globulins] at a concentration no greater than 3–4 × 107 cells/4 mL. 2. At least one hour prior to the above resuspension step, rinse two SBA- and one CD34+ selection flask(s) with 10 mL of PBS (no Mg2+ or Ca2+) with 1 mM EDTA and then incubate for 60 min with the same buffer. 3. Following incubation, shake the flasks vigorously for 30 s. Repeat this step three times with 10 mL of fresh PBSE each time (see Note 3). 4. Gently layer 4 mL of the mononuclear cell suspension onto the flasks’ binding surface and incubate at room temperature for 60 min. 5. At the end the incubation period carefully rock the flasks from side to side to loosen the nonadherent cells. 6. Carefully remove the cells with a sterile pipet and place into a 15-mL conical tube. Add 4 mL of PBSE to the flask and wash genlty. Carefully remove the PBSE and pool with the other suspended cells and repeat this step one more time. The total volume of SBA minus cell suspension should be 12 mL. 7. Count the cells and check for viability. 8. Centrifuge the cells at 800g at room temperature for 10 min, aspirate the supernatant and resuspend the cells in PBSE containing 0.5% human γ-globulins at a concentration no greater than 3–4 × 107 cells/4 mL. 9. Incubate this suspension for 15 min at room temperature. Layer the SBA minus cell suspension onto the CD34-selection flask’s binding surface and incubate for 1 h. 10. During this 60-min incubation, add 100 U of chymopapain protease to 1 mL of PBSE and divide into five aliquots of 200 µL (20 U). 11. At the end of 60 min, remove the nonadherent cells from the selection flask. Wash the binding surface twice with 4 mL of PBSE and remove the supernatant. 12. Add 4 mL of PBSE containing 200 µL (20 U) of chymopapain onto the binding surface of the selection flask. Incubate 10 min at room temperature. 13. After 10 min, rock the flask from side to side and remove the 4 mL of cells and retain them in a 15-mL conical tube. Add 4 mL of PBSE with 10% fetal bovine serum (FBS) to the flask, rock to wet the entire surface and then aggressively hit the side of the flask several times on each side to loosen the remaining adherent cells. Remove these cells and add them to the 4 mL of cells that you previously placed in the 15-mL conical tube. Repeat this step until no more cells can be seen as determined by microscopic examination of the flask. 14. Count the cells and centrifuge them for 20 min at 1000g.
3.3. Growth of Megakaryocytes Ex Vivo 1. Take 8 mL of the IMDM complete media and add 2 mL of filtered human AB heparinized platelet poor plasma, mix well, and store at 4°C.
In Vitro Expansion of Megakaryocytes
343
2. Resuspend the isolated CD34+ cells described above, at a concentration of 5 × 105 cells/mL in the IMDM complete media plus serum. 3. To the resuspended cells add the following cytokines: IL-3 (R&D Systems): 2 µL of a 10 U/µL stock in 1 mL media: Final concentration 20 U/mL. IL-1α (Peprotech): 2 µL of a 100 pg/µL stock in 1 mL media: Final concentration 200 pg/mL. Kit ligand (Genzyme): 1 µL of 100 ng/µL stock in 1 mL mdia. Final concentration 100 ng/mL. Thrombopoietin (TPO) (Amgen): 5 µL of 10 ng/µL stock in 1 mL media. Final concentration 50 ng/mL. 4. After adding the above cytokines, plate the CD34 cells into a 24-well plate at a density of 2.5 × 105 cells per well or 500 µL of cell suspension/well. Grow the cells at 37°C in 5% CO2 and 98% humidity. 5. On d 3 and 6, after initial plating, the cells must be collected from the wells, counted, centrifuged at 300g for 15 min in 1.5-mL Eppendorf tubes, and then resuspended at a concentration of 5 × 105 cells/mL in the identical media and with the same quantities of cytokines described above (see Note 6). 6. On d 9, 11, and 13, repeat the replating procedure with the exception that the only cytokine to be added being TPO (see Note 6).
3.4. Analysis of the Resulting Cells To characterize the final cultured cells, an immunocytochemical approach for megakaryocytic specific markers is used. 1. Take a small sample of cells from the wells and cytospin at 500 rpm for 10 min onto glass slides. 2. Fix the cells directly on the slides using methanol and then wash in deionized H2O for 10 min. 3. Incubate the slides in normal goat blocking serum for 15 min at room temperature. 4. Remove the blocking agent and add the diluted αIIb/β3 (CD41) primary monoclonal antibody to the cells on the slide. Cover with a small piece of parafilm and incubate at 37°C for 1 h. 5. Wash the the slides 3X in 1X PBS for 5 min/wash. 6. Apply the secondary anti-mouse IgG antibody to the cells on the slides and incubate for 60 min at 37°C. 7. Wash the slides once with 1X PBS, followed by a 5-min wash in deionized H2O. 8. Apply a glycerol/barbital mounting solution and affix cover slips over the cells. 9. After the mounting solution has dried, the cells can be observed using a fluorescent microscope. 10. By using positive control samples, i.e., labeled bone marrow cells, size fractionated to enrich for megakaryocytes, and negative control cells, CD34 cells without cytokine treatment, we can determine the percentage of cells carrying the CD41 antigen on their surface (see Note 7).
344
Thornton and Poncz
4. Notes 1. The yield of mononuclear cells after Ficoll separation of 50 mL of PB is in the range of 0.5–1.0 × 108. 2. We use the AIS CD34+ MicroCELLector T-25 antibody coated cell culture flask. There are other commercial kits that are available for the isolation of such cells. 3. This procedure is designed to remove a special chemical stabilizer, which protects the SBA- and CD34-binding surfaces during shipping. 4. The isolated mononuclear cells are initially layered onto a SBA-coated flask for negative selections. This pre-enrichment step is followed by layering the nonadherent cell pool onto a second flask, which is coated with the 8G12 antiCD 34 antibody. The cells are then released from the flask using a mild protease. Of the mononuclear cells only 3–5 × 107 cells remain after SBA selection. When the SBA cells are selected for CD34 about 2–5 × 105 cells possess this surface antigen. 5. Several culturing systems for the differentiation and proliferation of CD34+ cells into megakaryocytes and platelets have been described (1,8–10). Some have been designed to test the specific effects of individual cytokines on megakaryocyte differentiation and, hence, use serum-free media to avoid the background effects of the endogenous growth factors found in serum. The liquid culture system described here includes 20% human AB serum to supply unspecified cytokines. 6. By d 7 of culture, the cell count is 8–10 × 105 cells. The total yield of cells on d 14 is 3–4 × 106. Typically 20–70% of these cells will be CD41-positive. By leaving out the IL-3 from the growth medium, one can increase the percent megakaryocyte-positive cells, although total cell yield will be decreased. 7. After 12–14 d in culture, one can typically obtain 3–4 × 106 cells, which represents a 15- to 20-fold increase from the time of initial seeding. Morphologically, many of these cells appear to be megakaryocytes, being large, polyploid cells.
References 1. Guerriero, R., Testa, U., Gabbianelli, M., Mattia, G., Montesoro, E., Macioce, G., et al. (1995) Unilineage megakaryocytic proliferation and differentiation of purified hematopoietic progenitors in serum-free liquid culture. Blood 86, 3725–3736. 2. Nichol, J. L., Hornkohl, A. C., Choi, E. S., Hokom, M. M., Ponting, I., Schuening, F. W., and Hunt, P. (1994) Enrichment and characterization of Peripheral blood derived megakaryocyte progenitors that mature in short-term liquid culture. Stem Cells 12, 494–505. 3. Mazur, E. M., Basilico, D., Newton, J. L., Charland, C., Sohl, P. A., and Narendran, A. (1990) Isolation of large numbers of enriched human megakaryocytes from liquid cultures of normal peripheral blood progenitor cells. Blood 76, 117–123. 4. Zauli, G., Valvassori, L., and Capitani, S. (1993) Presence and characteristics of circulating megakaryocyte progenitor cells in human fetal blood. Blood 81, 385–390. 5. Rafii, S., Frey, B., Mohle, R., Moore, M. A. S., and Crystal, R. G. (1996) Constitutive overexpression of thrombopoietin by human bone marrow endothelial cells maintains long-term regeneration of megakaryocytes. Blood 88, 108a.
In Vitro Expansion of Megakaryocytes
345
6. Shattil, S. J., Cunningham, M., and Hoxie, J. A. (1987) Detection of activated platelets in whole blood using activation dependent monoclonal antibodies and flow cytometry. Blood 70, 307–315. 7. Rabellino, E. M., Nachman, R. L., Williams, W., Winchester, R. J., and Ross, G. D. (1979) Human megakaryocytes: characterization of the membrane and cytoplasmic components of isolated marrow megakaryocytes. J. Exp. Med. 49, 1273–1287. 8. Choi, E. S., Nichol, J. L., Hokom, M. M., Hornkohl, A. C., and Hunt, P. (1995) Platelets generated in vitro from proplatelet-displaying human megakaryocytes are functional. Blood 85, 402–413. 9. Alcorn, M. J. and Holyoake, T. L. (1996) Ex vivo expansion of haemopoietic progenitor cells. Blood Rev. 10, 167–176. 10. Kaushansky, K. (1995) Thrombopoietin: The primary regulator of platelet production. Blood 86, 419–431.
Primary Megakaryocytes
347
34 Molecular Biology Studies with Primary Megakaryocytes Yaping Shou and Mortimer Poncz 1. Introduction Megakaryocytes are rare hematopoietic cells comprising only about 0.02– 0.05% of the bone marrow nucleated cell population. Because of the relative infrequency of megakaryocytes in the bone marrow and their fragility in vitro, studies to characterize expression of platelet-specific genes have mostly been carried out in continuous cell lines originating from leukaemic marrow or blood cells that express a range of megakaryocytic phenotypic properties. HEL cells, which are representative of such cell lines, were instrumental in getting the molecular analysis of megakaryocytes and platelets established, and although these cells are still useful for many studies, it has become clear that they have significant limitations. These limitations include the fact that these lines only approximate megakaryocytes. These lines do not contain α-granules, do not demarcate or release platelets, respond appropriately to thrombopoietin (TPO), or express the high levels of such platelet-specific proteins such as the integrin αIIb and platelet factor 4 (PF4). Other proteins such as the platelet-restricted G protein Gzα has not been detected in any of these cell lines. Further, these cell lines often express a mixture of multiple different lineages and can be easily shifted from one lineage to another. In this chapter, we describe one approach that have been useful for allowing molecular biology studies of the megakaryocyte. This approach is the use of primary marrow cells directly for studies of gene regulation (Fig. 1), which has been used for the analysis of the PF4 (1,2) and αIIb (3) genes. The rat primary marrow culture system allows transfection of reporter gene constructs into whole marrow and then analysis of gene expression in the developing megakaryocytes three days later. The introduction of the reporter From: Methods in Molecular Medicine, Vol. 31: Hemostasis and Thrombosis Protocols Edited by: D. J. Perry and K. J. Pasi © Humana Press Inc., Totowa, NJ
347
348
Shou and Poncz
Fig. 1. Strategy for primary megakaryocyte expression system. The expression vector is transfected into primary whole marrow isolated from the tibias and femurs of rats. After 3 d in culture, the reporter gene is examined in either the entire marrow sample or after immunomagnetic depletion of megakaryocytes.
gene by electroporation destroys the mature friable megakaryocytes. During the subsequent in vitro growth in the presence of horse serum, the total number of nucleated cells decreases, but there is an increase in the total number of megakaryocytes and in megakaryocyte ploidy. In addition, the amount of PF4 mRNA and acetylcholinesterase staining of marrow cells increases 10-fold, indicating that normal megakaryocytic differentiation was taking place (4). The transient reporter gene expression studies of both rat αIIb and PF4 5'-flanking region carried out in this short-term culture of marrow cells, in which all nor-
Primary Megakaryocytes
349
mal hematopoietic lineages are represented and differentiating, have revealed important qualitative or quantitative differences in comparison with data primarily based on megakaryocytic cell line studies such as HEL cells. 2. Materials 2.1. Obtaining the Rat Primary Bone Marrow Cell Culture 1. Rats: Charles Rivers Laboratory, Boston, MA. 2. Hank’s balanced salt solution (no Ca2+ or Mg2+). 3. CATCH: Hank’s balanced salt solution, 0.38% trisodium citrate, 1.0 mM adenosine, 2.0 mM theophylline (Sigma Co. St. Louis, MO) and 5% fetal bovine serum, pH 7.4. Sterilized by filtering through a 0.22-µ filter (Nalgene, Rochester, NY). 4. Lysis buffer: Tris Base 2.06 g/L and NH4Cl 7.5 g/L. 5. 100–200-µm mesh nylon filter (Tetko, New York, NY).
2.2. DNA Transfection by Electroporation 1. Cell-Porator; electroporation cuvets (Life Technologies, Gaithersburg, MD). 2. Electroporation buffer: 30.8 mM NaCl, 120.7 mM KCl, 8.1 mM Na2HPO4, 1.46 mM KH2PO4 and 5 mM MgCl2. 3. Iscove’s Modified Dulbecco’s Medium (IMDM); penicillin/streptomycin; L -glutamine (Gibco BRL, Grand Rapids, MI) + 20% horse serum (Hyclone Laboratories, Logan UT). 4. 15-mL sterile conical tubes (CoStar Laboratories, Cambridge, MA). 5. 6-well, 35-mm tissue culture plates (CoStar Laboratories).
2.3. The Human Growth Hormone (hGH) Reporter System (see Note 3) 1. Phosphate-buffered saline (PBS) (Gibco BRL) 2. hGH radioimmunoassay kit (Nichols Institute Diagnostics, San Juan Capistrano, CA). 3. Hirt solution: 0.6% sodium dodecyl sulfate, 0.01 mM EDTA, and 7 mg/mL calf thymus DNA (Sigma), pH 7.5. 4. NaCl. 5. DNase-free RNase: 50 mg/mL. 6. Phenol; chloroform (Fisher Chemicals, Fair Lawn, NJ). 7. 100% Ethanol (Aaper Alcohol and Chemical Co., Shelbyville, KY). 8. Phosphorimager (Molecular Dynamics, Sunnyvale, CA).
2.4. Immunomagnetic Separation (see Note 6) 1. Mouse anti-rat αIIb/β3 monoclonal antibody (0.898 mg/mL) (P34) (A gift from Drs. Takamoto Suzuki and Hiroshi Miyazaki) (5). 2. Iscove’s Modified Dulbecco’s Medium (IMDM). 3. Modified Growth Media (MGM): IMDM, 5% (v/v) horse serum, 1.0 mM adenosine, and 2 mM theophylline. 4. Iron beads coated with rat anti-mouse IgG2α (Dynal, Oslo, Norway).
350
Shou and Poncz
3. Methods 3.1. Obtaining the Rat Primary Bone Marrow Cell Culture 1. Surgically isolate the femurs and tibias from 1–2 CO2-narcotized rats (~400g) and place immediately into cold CATCH medium. 2. After cutting off the distal portions of the bones, flush the marrow cells out of the bones using an 18-gage needle that is connected with a 5-mL or 10-mL syringe filled with CATCH medium (5 mL per femur or tibia) (see Note 1). 3. Disperse cells in CATCH medium with the same syringe and filter through a 100–200-µm mesh nylon filter. 4. Spin down the cells at 400g for 5 min and resuspend them in an equal volume of prewarmed lysis buffer and incubate at 37°C for 10 min to lyse the red cells. 5. The remaining cells are pelleted again as above. If a significant amount of red cells are still seen in the cell pellet then repeat the lysis step. 6. Wash the cells twice with CATCH medium and determine the total yield of nucleated cells using a hematocytometer. About 1 × 109 marrow cells can be obtained from a single rat.
3.2. DNA Transfection by Electroporation 1. Resuspend the cells from Subheading 3.1. in electroporation buffer at a concentration of 2.5 × 107 cells/0.75 mL. Keep on ice. 2. Add 100 µg of circular plasmid DNA, prepared by CsCl2 gradient ultracentrifugation, into 2.5 × 107 rat bone marrow cells in a 0.4-cm cuvets. 3. After a 15-min incubation on ice, the cells are ready for electroporation. 4. Electroporation is carried out using a Cell-Porator at 230 V and 800 µF, surrounded by ice (see Note 2). 5. After electroporation, allow the cells to recover for 10 min on ice and then for 15 min at room temperature. 6. Add 1 mL growth medium to each sample. Then transfer the cells from the electroporation cuvets to 15-mL conical tubes, and spin down the cells at 400g for 5 min. Resuspend each cell pellet in 3 mL of growth medium. 7. Grow the electroporated cells in 6-well, 35-mm plates at 37°C in 5% CO2 for 3 d. Reporter gene expression in marrow cells can then be assayed. For maximal expression, culturing time posttransfection can be determined based on preliminary titration experiments, but usually 3 d is optimal.
3.3. The Human Growth Hormone (hGH) Reporter System Radioimmunoassay has been used in our laboratory to detect hGH expression. 1. Collect nonadherent rat bone marrow cells from the 6-well plates 3 d posttransfection and wash them with PBS. 2. After spinning down cells at 400g for 5 min, resuspend the cell pellet in 0.2 mL deionized H2O and lyse cells by freezing and thawing twice (see Note 4). 3. 100 mL of lysed cells are required for assay for hGH by radioimmunoassay according to the protocol provided by the manufacturer.
Primary Megakaryocytes
4. 5. 6. 7. 8. 9. 10.
351
To standardize expression from one construct to the next, most reporter gene studies utilize a second standard generic strong promoter driving the expression of a different reporter gene. However, such constructs often do not work well in this primary marrow system. We instead use a technique for isolating transfected DNA to standardize the results of our various transfection experiments. This Hirt assay (6) allows one to measure the plasmid DNA in the supernatant after cell lysis and precipitation of cellular DNA with high salt. This method is useful in directly determining the relative transfection efficiencies of the different plasmids being tested in the primary rat marrow transfection studies without the confounding influence of a second reporter gene. Collect one third of electroporated, cultured marrow cells from each sample and lyse them by incubation with 0.7 mL of Hirt solution at 4°C for 2 h. Add 175 ng of control plasmid DNA at this time to ensure that one can account for variability in plasmid isolation among the different samples. After a 2-h incubation, add NaCl to 1 mol/L and incubate the samples overnight at 4°C. Spin the lysates at 7000g for 20 min at 4°C. Collect 0.5 mL of the supernatant from each sample and digest with DNase-free RNase. Isolate by plasmid DNA from the lysates by phenol-chloroform and chloroform extraction followed by ethanol precipitation. Digest the DNA with selected enzyme(s), run digested products in an agarose gel, and blot the gel to a membrane filter for Southern blot analysis (see Note 5).
3.4. Immunomagnetic Separation 1. When using immunomagnetic separation, pool two samples of identically transfected marrow samples and then separate them once again. One of the pooled samples is used as a positive control comparison, and the other is immunomagnetically depleted of its megakaryocytes. 2. Resuspend ~4 × 106 cells from 3 d posttransfection, electroporated, cultured marrow cells in 0.5 mL of modified growth medium (MGM) in 0.5 mL of modified growth medium. 3. Add 40 µL of the primary antibody, a mouse anti-rat αIIb/β3 monoclonal antibody and incubate for 45 min at room temperature on a gyro-rotary platform. 4. After incubation, wash twice with MGM. 5. Prepare the IgG2α-coated Iron beads by washing three times with an equal volume of MGM (10 µL of beads are required for 4 × 106 cells). 6. Add iron beads to each sample and incubate for 45 min at room temperature on the gyro-rotary shaker. 7. Place the samples in a magnetic separator and remove the supernatant (beadnegative cells) after the beads have attached to the magnet. 8. Wash the attached cells twice with MGM saving both washes. 9. Measure reporter gene expression in the bead-negative, megakaryocyte-depleted samples (supernatant and washes) and compare to the analysis of a parallel sample
352
Shou and Poncz that is not incubated with either the primary or secondary antibodies. The tissuespecific activity is the amount of activity that is present in the parallel control minus that seen in the nonadherent cells.
4. Notes 1. Although a small amount of marrow can be isolated from the humerus or other bones of these animals, the amount of additional material is usually insufficient to justify the effort. Stripping of all the muscle from the bones is also not necessary. Often, we simply drill a hole at both ends of the bones with a syringe and straight needle and using pressure on the syringe, to squirt the bone marrow cleanly out with CATCH medium. 2. Conditions for electroporation of marrow cells have to be optimised by each laboratory for their particular apparatus. The variables include: plasmid DNA concentration, cell concentration/volume, voltage, capacitance, and electroporation buffer. The efficiency of electroporation can be a very tight bell-shaped curve. For example, even as little as 25% too much or too little of a reporter gene construct DNA can markedly affect the efficiency of the system. Also, the quality of the DNA must be maintained. All DNA samples should be checked to be sure that there is no RNA contamination and that the DNA is supercoiled. 3. The hGH reporter gene has been used in both the reported PF4 and αIIb promoter studies due to its sensitivity in this primary cell culture system. Unlike many systems in which most of the hGH is released from the cells into the surrounding media, in the primary marrow system, over half of the detectable hGH remains behind in the cells. We have also found that this marrow system does not work with a luciferase reporter system. We advise testing a known promoter for any reporter other than hGH to see if it works well in this primary marrow system. 4. Our studies showed only 1% of the cells were adherent to the plates, and these cells do not express hGH above background levels. 5. The probe that contains a sequence common to all constructs enables one to examine relative efficiency of sample transfection. We quantitate individual band intensity by phosphorimager or densitometric analysis of filters. 6. In order to determine the megakaryocyte specificity of reporter gene expression derived from the whole primary marrow cells, separation of the megakaryocytes can be done using a number of techniques including Botrocetin aggregation of the murine megakaryocytes (1) and immunomagnetic separation of the megakaryocytes (3). We used the magnetic separation technique using an excess of antibodies to ensure that all of the megakaryocytes were removed by the magnetic field (Fig. 2). 7. Using this approach, one cannot measure directly the clumped, removed megakaryocytes as we have found that consistent measurements of the immunomagnetic adherent cells may be difficult to obtain because of variable recovery levels. One needs to measure instead, the total pool minus the nonmagnetic binding pool.
Primary Megakaryocytes
353
Fig. 2. Immunomagnetic-depletion of megakaryocytes of the mature megakaryocytes after the three day primary culture. After incubating with the primary anti-αIIb/β3 antibody, an excess of magnetic bead secondary antibody is added to remove all of the megakaryocytes. Reporter gene activity in the megakaryocytes is done by subtracting the activity in the megakaryocyte-depleted aliquot from that in a total marrow aliquot. 8. One additional caveat is that nonspecific binding of cells to the secondary antibody-coated beads has to be checked in preliminary experiments. Morphological analysis or immunostaining of these cells to confirm their megakaryocyte character is important.
354
Shou and Poncz
References 1. Kuter, D. J., Gminski, D., and Rosenberg, R. D. (1992) Botrocetin agglutination of rat megakaryocytes: a rapid method for megakaryocyte isolation. Exp. Hematol. 20, 1085–1089. 2. Ravid, K., Doi, T., Beeler, D. L., Kuter, D. J., and Rosenberg, R. D. (1991) Transcriptional regulation of the rat platelet factor 4 gene: Interaction between an enhancer/silencer domain and the GATA site. Mol. Cell. Biol. 11, 6116–6127. 3. Block, K. L., Ravid, K., Phung, Q. H., and Poncz, M. (1994) Characterization of regulatory elements in the 5'-flanking region of the rat GPIIb gene by studies in a primary rat marrow culture system. Blood 84, 3385–3393. 4. Kuter, D. J., Greenberg, S. M., and Rosenberg, R. D. (1989) Analysis of megakaryocyte ploidy in rat marrow cultures. Blood 74, 1952–1962. 5. Miyazaki, H., Tamura, S., Sudo, T., and Suzuki, T. (1990) Production and characterization of monoclonal antibodies against rat platelet GPIIb/IIIa. Thromb. Res. 59, 941–953. 6. Hirt, B. (1967) Selective extraction of polyoma DNA from infected mouse cell cultures. J. Mol. Biol. 26, 365–369.