Lymphocytes: A Practical Approach (The Practical Approach Series)

Lymphocytes

The Practical Approach Series SERIES EDITOR B. D. HAMES Department of Biochemistry and Molecular Biology University of Leeds, Leeds LS2 9JT, UK

See also the Practical Approach web site at http://www.oup.co.uk/PAS * indicates new and forthcoming titles Affinity Chromatography Affinity Separations Anaerobic Microbiology Animal Cell Culture (2nd edition) Animal Virus Pathogenesis Antibodies I and II Antibody Engineering Antisense Technology * Apoptosis Applied Microbial Physiology Basic Cell Culture Behavioural Neuroscience Bioenergetics Biological Data Analysis Biomechanics—Materials Biomechanics—Structures and Systems Biosensors * C. elegans Carbohydrate Analysis (2nd edition) Cell-Cell Interactions The Cell Cycle

* Cell Growth, Differentiation and Senescence * Cell Separation Cellular Calcium Cellular Interactions in Development Cellular Neurobiology Chrornatin * Chromosome Structural Analysis Clinical Immunology Complement * Crystallization of Nucleic Acids and Proteins (2nd edition) Cytokines (2nd edition) The Cytoskeleton Diagnostic Molecular Pathology I and II DNA and Protein Sequence Analysis DNA Cloning 1: Core Techniques (2nd edition) DNA Cloning 2: Expression Systems (2nd edition)

if *

*

*

*

*

DNA Cloning 3: Complex Genomes (2nd edition) DNA Cloning 4: Mammalian Systems (2nd edition) DNA Microarrays DNA Viruses Drosophila (2nd edition) Electron Microscopy in Biology Electron Microscopy in Molecular Biology Electrophysiology Enzyme Assays Epithelial Cell Culture Essential Developmental Biology Essential Molecular Biology I and II Eukaryotic DNA Replication Experimental Neuroanatomy Extracellular Matrix Flow Cytometry (2nd edition) Free Radicals Gel Electrophoresis of Nucleic Acids (2nd edition) Gel Electrophoresis of Proteins (3rd edition) Gene Probes 1 and 2 Gene Targeting (2nd edition) Gene Transcription Genome Mapping Glycobiology Growth Factors and Receptors Haemopoiesis High Resolution Chromotography Histocompatibility Testing

if if

* *

*

if

HIV Volumes 1 and 2 HPLC of Macromolecules (2nd edition) Human Cytogenetics I and II (2nd edition) Human Genetic Disease Analysis Image Processing and Analysis Immobilized Biomolecules in Analysis Immunochemistry 1 Immunochemistry 2 Immunocytochemistry Imnundiagnostics In Situ Hybridization (2nd edition) lodinated Density Gradient Media Ion Channels Light Microscopy (2nd edition) Lipid Modification of Proteins Lipoprotein Analysis Liposomes Lymphocytes (2nd edition) Mammalian Cell Biotechnology Medical Parasitology Medical Virology MHC Volumes 1 and 2 Molecular Genetic Analysis of Populations (2nd edition) Molecular Genetics of Yeast Molecular Imaging in Neuroscience Molecular Plant Pathology I and II Molecular Virology

Monitoring Neuronal Activity if Mouse Genetics and Transgenics Mutagenicity Testing Mutation Detection Neural Cell Culture Neural Transplantation Neurochemistry (2nd edition) Neuronal Cell Lines NMR of Biological Macromolecules Non-isotopic Methods in Molecular Biology Nucleic Acid Hybridisation * Nuclear Receptors Oligonucleotides and Analogues Oligonucleotide Synthesis PCR 1 PCR 2 *PCR3:PCR In Situ Hybridization Peptide Antigens Photosynthesis: Energy Transduction Plant Cell Biology Plant Cell Culture (2nd edition Plant Molecular Biology Plasmids (2nd edition) Platelets Postimplantation Mammalian Embryos

* Post-translational Processing Preparative Centrifugation Protein Blotting * Protein Expression Protein Engineering Protein Function (2nd edition) * Protein Localization by Fluorescence Microscopy * Protein Phosphorylation (2nd edition) Protein Purification Applications Protein Purification Methods Protein Sequencing Protein Structure (2nd edition) Protein Structure Prediction Protein Targeting Proteolytic Enzymes Pulsed Field Gel Electrophoresis RNA Processing I and II RNA-Protein Interactions Signalling by Inositides * Signal Transduction (2nd edition) Subcellular Fractionation Signal Transduction if Transcription Factors (2nd edition) Tumour Immunobiology if Virus Culture

Lymphocytes A Practical Approach Second edition Edited by

SARAH L. ROWLAND-JONES Human Immunology Unit Institute of Molecular Medicine John Radcliffe Hospital Oxford OX3 9DS

and ANDREW J. McMICHAEL Human Immunology Unit Institute of Molecular Medicine John Radcliffe Hospital Oxford OX3 9DS

OXPORD UNIVERSITY PRESS

OXPORD UNIVERSITY PRESS

Great Clarendon Street, Oxford OX2 6DP Oxford University Press is a department of the University of Oxford and furthers the University's aim of excellence in research, scholarship, and education by publishing worldwide in Oxford New York Athens Auckland Bangkok Bogotd Buenos Aires Calcutta Cape Town Chennai Dar es Salaam Delhi Florence Hong Kong Istanbul Karachi Kuala Lumpur Madrid Melbourne Mexico City Mumbai Nairobi Paris Sao Paulo Singapore Taipei Tokyo Toronto Warsaw and associated companies in Berlin Ibadan Oxford is a registered trade mark of Oxford University Press Published in the United States by Oxford University Press Inc., New York © Oxford University Press, 2000 All rights reserved. No part of this publication may be reproduced, stored in a retrieval system, or transmitted, in any form or by any means, without the prior permission in writing of Oxford University Press. Within the UK, exceptions are allowed in respect of any fair dealing for the purpose of research or private study, or criticism or review, as permitted under the Copyright, Designs and Patents Act, 1988, or in the case of reprographic reproduction in accordance with the terms of licences issued by the Copyright Licensing Agency. Enquiries concerning reproduction outside those terms and in other countries should be sent to the Rights Department, Oxford University Press, at the address above. This book is sold subject to the condition that it shall not, by way of trade or otherwise, be lent, re-sold, hired out, or otherwise circulated without the publisher's prior consent in any form of binding or cover other than that in which it is published and without a similar condition including this condition being imposed on the subsequent purchaser Users of books in the Practical Approach Series are advised that prudent laboratory safety procedures should be followed at all times. Oxford University Press makes no representation, express or implied, in respect of the accuracy of the material set forth in books in this series and cannot accept any legal responsibility or liability for any errors or omissions that may be made. A catalogue record for this book is available from the British Library Library of Congress Cataloging in Publication Data (Data available) ISBN 0 19 963817 9 (Hbk) 0 19 963816 0 (Pbk) Typeset by Footnote Graphics, Warminster, Wilts Printed in Great Britain by Information Press, Ltd, Eynsham, Oxon.

Preface In the 12 years since the last edition of Lymphocytes: A Practical Approach, the field of cellular immunology has seen many changes. The crystallization of MHC molecules opened up a new understanding of how these cell-surface proteins present antigenic fragments to lymphocyte surveillance. These structural insights were complemented by studies that illuminated how these antigenic peptides were being generated in the infected cell and how they found their way into complexes with newly synthesised MHC molecules. The intricacies of antigen presentation by MHC molecules has shed some light on the basis for the extraordinary polymorphism of these proteins, underscored by improved methods of HLA typing which have demonstrated the true extent of this polymorphism. The process of T-cell recognition has been elucidated by studies of the selection and structure of T-cell receptors, as well as a greater understanding of those activities that are triggered when lymphocytes meet their cognate antigen. This has led to a much more detailed characterization of lymphocyte subsets based on their secretion of soluble factors and other functions. Critical to these studies has been an appreciation of the many other cellsurface molecules expressed by different cells in the immune system involved in their trafficking and cell-to-cell interactions. The processes that regulate the early generation and selection of T-lymphocytes in the thymus are better understood, and their ultimate fate has been illuminated by studies in the field of apoptosis or programmed cell-death. Finally, the role of different lymphocyte subsets in the immune response to different pathogens and tumours has been clarified by better methods of characterizing and quantifying these cell populations. This new edition aims first to provide an update of some of the most wellestablished methods in lymphocyte biology. The volume opens with a lively summary of the key principles of lymphocyte culture, including such invaluable advice as to which parts of the procedures are so critical that they must take priority when your house is on fire! The basic principles of immunohistochemistry and the characterization of lymphocyte surface antigens are outlined in subsequent chapters. The central features of T-cell culture for both human and murine studies are provided in three detailed chapters. These areas were all featured in the first edition of the book (edited by G. G. B. Klaus), but are now covered in new chapters reflecting some of the important recent developments in these areas, such as intracytoplasmic staining to study the production of different cytokines by lymphocyte populations studied by flow cytometry, and the use of the ELISpot assay to enumerate antigenspecific T-cells. Immortalization of B-lymphocytes was described in the first edition: in this volume the use of other transforming viruses to generate Tlymphocyte lines is also described. The generation and use of T- and B-cell

Preface hybridomas is a new area covered in this edition, as is the application of molecular techniques to HLA typing, an advance which has revolutionized the field. Two methods for the quantification of antigen-specific T-cells (in addition to the ELISpot assay) are described in successive chapters: first, the use of limiting dilution analysis is described and updated, and then the new technique of identifying T-cells specific for a particular peptide-MHC combination, by staining them with tetrameric complexes of that MHC molecule assembled with the relevant peptide, is described. This latter technique has proved particularly fruitful for in vivo dynamic studies of T-cell responses to pathogens and tumours over the past 2 years. The potential therapeutic use of expanded antigen-specific T-cells is described, and the final chapters deal with new methodologies for studying apoptosis and the biology of the thymus. Some of the common methodologies (such as cell freezing and lymphocyte separation) are described more than once, but we have included the protocols as supplied by the authors, since minor variations may be important in reflecting the practices of different laboratories. I would like to take this opportunity to thank all the authors for their excellent contributions to this new edition of Lymphocytes: a practical approach (and for their patience with the editor!). Although a volume such as this cannot hope to provide exhaustive cover of every available technique in the area of lymphocyte biology, the experience in our group was that our experimental work undoubtedly benefited from each new chapter that arrived over the past few months: I hope that others will find it similarly useful. Oxford September 1999

SARAH ROWLAND-JONES ANDREW J. McMICHAEL

viii

Contents List of Contributors Abbreviations 1. Preparation of lymphocytes and identification of lymphocyte subpopulations Magdalena Plebanski 1. Introduction 2. Sources of lymphoid and professional antigen-presenting cells 3. Methods of purification Lymphoid organs Body fluids

4. Principles of lymphocyte handling and culture Short- and long-term storage (freezing) Principles of long- and short-term culture 5. Methods of subfractionation for lymphocytes and antigen-presenting cells Physical properties Cell-surface markers Acknowledgement

2. Immunohistochemistry of lymphoid organs Simon C. Biddolph and Kevin C. Gatter 1. Introduction 2. Preparation of lymphoid cells and tissues for immunohistochemistry Slide adhesive Choice of preparation Transport of specimen Cell smear and cytocentrifuge preparations Cell imprints ('dabs' or 'touch preparations') Frozen sections ('cryostat sections') Paraffin sections

3. Immunohistochemical staining Immunohistochemical methods

xvii xix

1

1 1 3 3

10 14 14 16 18 19 20 26 27

27 27 27 28 29 29 31 31 32 39 39

Contents Labels Considerations in the choice of method and label Multiple antibody methods Quality control The distribution of cell types in lymphoid tissue

41 45 49 52 53

Acknowledgements

53

References

53

3. Viral transformation of lymphocytes

55

Edgar Meinl and Helmut Fickenscher 1. Introduction 2. Transformation of T lymphocytes Growth transformation of human T cells by herpesvirus saimiri Immortalization of human T cells by human T-cell leukaemia virus type 1

55 56 56 68

3. B-cell immortalization EBV-transformation of human B cells Transformation of macaque B cells with herpesvirus papio

69 69 70

Acknowledgements

71

References

71

4. B- and T-cell hybridomas

75

Judy M. Bastin 1. Introduction

75

2. Methods for generating B- and T-cell hybridomas and the principles of hybridoma culture Tissue culture Materials Selection procedures Immunizations Fusion partners Fusion protocol Growth of hybridomas Screening assays Cloning hybridomas Cryopreserving and thawing cells Large-scale production of hybridomas Purification Human hybridomas Antibody production by chemical and genetic engineering

75 76 76 77 77 79 79 81 81 82 83 84 84 85 86

x

Contents Disadvantages of nybridomas Conclusions

87 87

3. Applications of hybridoma technology B-cell hybridomas T-cell hybridomas References

5. Murine T-cell culture

88 88 90 91 95

Kingston H. G. Mills 1. Introduction T-cell subtypes and their role in protective immunity Strategies for the induction of distinct T-cell subtypes Techniques for detecting T-cell responses

95 95 96 98

2. Tissue culture conditions, growth factors, and cell viability Culture medium and serum Cytokines and growth factors for culturing T cells Viable cell count 3. Preparation of T cells and APCs Preparation of cells from lymphoid and non-lymphoid organs Purification of mononuclear cells and removal of dead cells Purification of T cells, B cells, and T-cell subpopulations Preparation of macrophages and APCs

99 99 101 102

4. Generation and detection of antigen-specific CD4+ T cells In vivo priming of CD4+ T cells Generation of CD4+ T-cell lines and clones Antigen-specific T-cell proliferation Detection of Thl/ThO/Th2 responses by cytokine production Assay of helper function of T cells for antibody production by B cell 5. Generation and detection of antigen-specific CD8+ CTLs

111 111 112 115 119 124

In vivo priming of CD8+ CTLs Generation of CD8+ T-cell lines and clones Cytotoxic T-cell assay

103 103 106 107 110

127 127 127 128

6. MHC restriction analysis Acknowledgements References

130

6. Human CD4 culture

135

131 132

Anna Vyakarnam, B. Vyas, M. Vukmanovic-Stejic, P. Gorak-Stolinska, D. Wallace, A. Noble, and D. M. Kemeny 1. Introduction xi

135

Contents 2. General apparatus, media, and reagents for human CD4 culture Apparatus Media Reagents

136 136 137 137

3. The isolation and culture of CD4 T-cell subsets from peripheral 137 blood 140 Principle 140 The generation of CD4+ Thl, Th2, and ThO effectors Generation of antigen-specific and random CD4 clones 142 4. Assays for CD4 function Principle of proliferation assay Activation-induced cell death Measuring cytokine production in culture supernatants by ELISA Enumerating cytokine-producing cells by flow cytometry: intracytoplasmic cytokine staining

147 147 149 151

References

158

7. Human cytotoxic T-lymphocyte (CTL) studies

153

161

Sarah L. Rowland-Jones 1. Introduction 2. General principles of CTL culture Tissue culture reagents and conditions What persuades memory CTLs to grow in vitro?

161 162 162 163

3. Generation of antiviral CTL Influenza-specific CTLs HIV-specific CTLs Using peptides to stimulate CTLs Generating virus-specific CTL clones

163 164 165 166 167

4. Measuring CTL activity The CTL lysis assay Measuring the antigen-specific release of cytokines by CTLs How do different methods of quantifying CTLs compare?

169 169 172 175

5. Conclusions

176

References

176

8. Limiting dilution analysis for the quantitation of antigen-specific T cells

179

Andrew Carmichael 1. Theoretical considerations Quantitation at the clonal level using limiting dilution analysis (LDA) The Poisson distribution

xii

179 179 180

Contents Advantages of LDA in addition to quantitation Limitations of LD A 2. Methodology Responder cells Stimulator cells 3. Calculation and interpretation of results Calculation of cytotoxic activity in individual microcultures Classification of positive and negative wells Estimation of precursor frequency Interpretation References

9. HLA-peptide tetrameric complexes

183 183 183 184 187 190 190 190 191 194 194 197

Graham S. Ogg 1. Introduction

197

2. Cloning of modified HLA heavy chain

198

3. Protein expression Principle Comments

199 199 200

4. Inclusion body purification Principle

200 200

5. Refolding by dilution Principle Comments

201 201 202

6. Enzymatic biotinylation Principle Comments

202 202 203

7. Purification of refolded protein Principle 8. ELISA Principle Comments

203 203 204 204 206

9. Formation of tetramers Principle Comments

206 206 206

10. Flow cytometry Principle Comments

207 207 207

11. Conclusions

207

References

208 xiii

Contents

10. Expansion of human cytotoxic T lymphocytes 209 for immunotherapy Rusung Tan 1. Introduction Adoptive transfer of CTLs in humans

209 210

2. Peptide recognition by CTLs Peptide binding motifs

211 211

3. Establishing CTL lines Establishing CTL clones Expansion of CTL clones Ensuring the safety of CTL infusions

213 213 215 217

References

218

11. HLA typing methods

221

Pete Krausa and Michael Browning 1. Introduction

221

2. The HLA system Polymorphism in relation to structure and function Nomenclature HLA in populations

223 224 226 227

3. Methods of HLA typing

230

4. Serological HLA typing Preparation of components The micro-lymphocytotoxicity assay Discussion on serology 5. Molecular biological approaches to tissue typing

230 232 237 238 239

6. The PCR reaction Reagent composition The PCR

240 240 242

7. Detection by oligonucleotide probing (PCR-SSOP) PCR-SSOP protocols PCR-SSOP discussion

243 245 248

8. HLA typing by PCR-SSP Five-locus determination PCR-SSP—phototyping High-resolution PCR-SSP typing PCR-SSP discussion

249 249 256 257

9. Sequence-based typing SBT strategies HLA SBT protocol

258 259 261

xiv

Contents 10. Discussion

264

Key references

267

Commercial suppliers

267

References

268

12. Biochemical characterization of lymphocyte surface antigens

273

Antony Symons and Marion H. Brown 1. Introduction

273

2. Immunoprecipitation Introduction Labelling cellular antigens Solubilization of membrane proteins Immunoprecipitation

274 274 274 280 281

3. SDS-polyacrylamide gel electrophoresis (PAGE) Introduction Detection of proteins

285 285 288

4. Immunoblotting Introduction Preparation of protein samples Blotting proteins Detection of antigen

289 289 290 291 294

5. Strategies for the identification of new molecules Affinity chromatography Ligand hunting

296 296 297

References

297

13. Measurement of cells undergoing apoptosis

299

Y. Furukawa and C. R. M. Bangham 1. Introduction Definition of apoptosis Importance of apoptosis in lymphocyte biology Recognition of apoptotic cells by phagocytes Recent advances in our understanding of apoptosis

299 299 299 300 300

2. Methods available to assay apoptosis DNA laddering Analysis of light scatter by flow cytometry (size and granularity)

303 305 305

xv

Contents Terminal deoxynucleotidyl transferase-mediated dUTP nick end-labelling (TUNEL) Annexin V CMXRos and related dyes

References

305 308 309 313

14. Thymic organ culture John J. T. Owen and Deirdre E. J. McLoughlin 1. Introduction 2. Microdissection and organ culture of the murine feta thymus The production of alymphoid thymus lobes

3. Newborn thymic slice culture 4. Reaggregate thymus organ culture References

315

315 316 321 322 324 329

Appendices Al List of suppliers A2 Commonly used lymphonia lines Edgar Meinl and Helmut Fickenscher

Index

331 337

343

xvi

Contributors CHARLES R. M. BANGHAM

Department of Immunology, Imperial College School of Medicine at St Mary's, Norfolk Place, London W2 1PG, UK. JUDY M. BASTIN

Institute of Molecular Medicine, John Radcliffe Hospital, Headington, Oxford OX3 9DS, UK. SIMON C. BIDDOLPH

Department of Paediatric Pathology, Womens' Centre, John Radcliffe Hospital, Headington, Oxford OX3 9DU, UK. MARION H. BROWN

MRC Cellular Immunology Unit, Sir William Dunn School of Pathology, South Parks Road, Oxford OX1 3RE, UK. MICHAEL BROWNING

Department of Microbiology and Immunology, University of Leicester, Medical Sciences Building, University Road, Leicester LE1 9HN, UK. HELMUT FICKENSCHER

Institut fur Klinische und Molekulare Virologie, Friedrich-AlexanderUniversitat Erlangen-Nuraberg, Schlossgarten 4, D-91054 Erlangen, Germany. Y. FURUKAWA

Department of Immunology, Imperial College School of Medicine at St Mary's, Norfolk Place, London W21PG, UK. KEVIN C. GATTER

University Department of Cellular Sciences, Level 4, John Radcliffe Hospital, Headington, Oxford OX3 9DU, UK. ANDREW CARMICHAEL

Department of Medicine, Level 5, Addenbrooke's Hospital, Hills Road, Cambridge CB2 2QQ, UK. P. GORAK-STOLINSKA

Department of Immunology, GKT School of Medicine and Dentistry, 125 Coldharbour Lane, London SE5 9NU, UK. PETE KRAUSA

Molecular Genetics Division, Forensic Analytical, 3777 Depot Road, Suite 409, Hayward, CA 94545, USA.

Contributors DEIRDRE E. J. MCLOUGHLIN

Department of Anatomy, University of Birmingham Medical School, Edgbaston, Birmingham, B15 2TT, UK. EDGAR MEINL

Max Planck-Institut fur Neurobiologie, Am klopferspitz 18a, D-82152 Martinsried, Germany. KINGSTON H. G. MILLS

Infection and Immunity Group, Department of Biology, National University of Ireland, Maynooth, County Kildare Ireland. GRAHAM S. OGG

Molecular Human Immunology Unit, Institute of Molecular Medicine, John Radcliffe Hospital, Headington, Oxford OX3 9DS, UK. JOHN J. T. OWEN

Department of Anatomy, University of Birmingham Medical School, Edgbaston, Birmingham, B15 2TT, UK. MAGDALENA PLEBANSKI

The Austin Research Institute, Studley Road, Heidelberg, Victoria 3084, Australia. SARAH L. ROWLAND-JONES

Molecular Human Immunology Unit, Institute of Molecular Medicine, John Radcliffe Hospital, Oxford OX3 9DS, UK. ANTONY SYMONS

The R. W. Johnson Pharmaceutical Research Institute, 3210 Merryfield Row, San Diego, CA 92121, USA. RUSUNGTAN

Department of Pathology and Laboratory Medicine, BC's Childrens' Hospital, 4480 Oak Street, Room 2G5, Vancouver, BC V6H 3VA, Canada. M. VUKMANOVIC-STEJIC

Department of Immunology, GKT School of Medicine and Dentistry, 125 Coldharbour Lane, London SE5 9NU, UK. ANNA VYAKARNAM

Department of Immunology, GKT School of Medicine and Dentistry, 125 Coldharbour Lane, London SE5 9NU, UK. B.VYAS

Department of Immunology, GKT School of Medicine and Dentistry, 125 Coldharbour Lane, London SE5 9NU, UK. D. WALLACE

Edward Jenner Institute for Vaccine Studies, Compton, Berkshire RG20 7NN, UK. xviii

Abbreviations AEC AICD AMV-RT AO AP APAAP APC APCN ARMS ATCC AZT B-LCL (LCL) B2m HALT BMT BSA BSE CD CDR CG CFA Ci CITES CJD CMV CMXRos Con A CPE CTL CTLp CTLL DAB DAPI DcR ddNTP DIG DIG-11-UTP DiOC6 DISC DMEM

3-amino-9-ethylcarbazole activation-induced cell death reverse transcriptase from avian myeloblastosis virus Acridine Orange alkaline phosphatase alkaline phosphatase, anti-alkaline phosphatase antigen-presenting cell allo-phycocyanin amplification refractory mutation system American Type Culture Collection 3'-azido-3'-deoxythymidine (aka zidovudine) B-lymphoblastoid cell line beta-2 microglobulin bronchus-associated lymphoid tissue bone-marrow transplant(ation) bovine serum albumin bovine spongiform encephalitis cluster of differentiation complementarity determining regions cell growth medium complete Freund's adjuvant Curie Convention on International Trade in Endangered Species Creutzfeldt-Jakob disease cytomegalovirus Chloromethyl-X-Rosamine Concanavalin A cytopathic effect cytotoxic T-lymphocyte cytotoxic T-lymphocyte precursor cytotoxic T-lymphocyte cell line 3,3' -diaminobenzidine tetrahydrochloride 4,6-diamidino-2-phenylindoledihydrochloride decoy receptor dideoxynucleotide digoxigenin digoxigenin-11-uridine triphosphate 3,3' -dihexyloxacarbocyanine iodide death-inducing signalling complex Dulbecco's Modified Eagle's Medium

Abbreviations DMF DMSO DNA DNase dNTP DR DTH DTT Avm EB EBV ECL™ EDTA ELISA EndoH EPOS ER FACS FADD FASL FcR PCS FITC FLICE fmk FNA GALT GM-CST GVHD Gy H-CMV HAMA HAT HAU HBV H-DNA HGPRT HHV HIV HLA HMAR HRP HS Hsp

N,N' -dimethyl formamide dimethyl sulfoxide deoxyribonucleic acid deoxyribonuclease deoxynucleotide death receptor delayed type hypersensitivity dithiothreitol mitochondrial transmembrane potential ethidium bromide Epstein-Barr virus enhanced chemiluminescent (detection) ethylenediamine tetraacetic acid enzyme-linked immunosorbent assay endo-B-N-acetylglucosaminidase H enhanced polymer one-step endoplasmic reticulum fluorescence activated cell sorter Fas-associated protein with Death Domain Fas-ligand crystallizable fragment receptor fetal calf serurn fluorescein isothiocyanate FADD-like ICE fluoromethylketone fine-needle aspirate gut-associated lymphoid tissue ganulocyte-macrophage colony-stimulating factor graft versus host disease Gray human cytomegalovirus human anti-mouse antibody hypoxanthine, aminopterin, thymidine haemagglutinating units hepatitis B virus heavy DNA (high GC convert) hypoxanthine guanine phosphoribosyl transferase human herpesvirus human immunodeficiency virus human leucocyte antigen heat-mediated antigen retrieval horseradish peroxidase human serum heat-shock protein xx

Abbreviations HSV-TK HSV2 HTLV-1 HVS i.p. IAA ICAM ICE ICFA IEF IFN--Y Ig IL IPTG ISCOM IU kDa LARD LCMV LDA L-DNA LN LPS m.o.i. mAb mClCCP MHC MIP MVA NAA NHS NK NuMA OCT OMK PAP PAPC PBMC PBS PCR PE PEG PFA PHA

herpes simplex virus thymidine kinase herpes simplex virus type 2 human T-cell leukaemia virus herpesvirus saimiri intraperitoneal iodoacetamide intercellular adhesion molecule IL 1-B converting enzyme incomplete Freund's adjuvant isoelectric focusing interferon gamma immunoglobulin interleukin isopropylthio-B-D-galactosidase immunostimulating complex International Units kilodalton lymphocyte-associated receptor of death lymphocytic choriomeningitis virus limiting dilution analysis Light DNA (low GC convert) lymph node lipopolysaccharide multiplicity of infection (units) monoclonal antibody carbonyl cyanide w-chlorophenylhydrazone major histocompatibility complex macrophage inflammatory protein Modified Vaccinia Ankara non-essential ammo acids N-hydroxysuccinimide natural killer (cell) nuclear mitotic apparatus (protein) optimum cutting temperature owl-monkey kidney peroxidase anti-peroxidase professional antigen-presenting cell peripheral blood mononuclear cell phosphate-buffered saline polymerase chain reaction phycoerythrin polyethylene glycol paraformaldehyde phytohaemagglutinin

xxi

Abbreviations

Pi PI PMA PMSF PNGase F PS R/l R/10 RANTES RBCL RIA RPMI RSV RT RT-PCR rW SBT SDS-PAGI SFC SIV s1 SSOP SSP SSPE TAP TBS TCGF TCR TdT TEMED Th TILS TK Tm TMAC TNF-a TNFR Tr TRAIL TRAMP TRITC TUNEL UV

inorganic phosphate propidium iodide phorbol myristic acetate phenylmethylsulfonyl fluoride peptidyl-Af-acetylglucosaminidaseF phosphatidylserine RPMI medium with 1 % FCS RPMI medium with 10% FCS regulated on activation, normal T, expressed and secreted red blood cell lysis radioimmunoassay Rosewell Park Memorial Institute (medium) respiratory syncytial virus room temperature reverse transcriptase PCR recombinant vaccinia virus sequence-based typing sodium dodecyl sulfate polyacrylamide gel electrophoresis spot-forming cell simian immunodeficiency virus specific lysis sequence-specific oligonucleotide probes sequence-specific primers saline-sodium phosphate-EDTA transporter associated with antigen-processing Tris-buffered saline T-cell growth factor T-cell receptor terminal deoxynucleotidyl transferase N, N,N', N' -tetramethylethylenediamine T-helper cell tumour infiltrating lymphocytes thymidine kinase melting temperature tetramethylammonium chloride tumour necrosis factor alpha TNF receptor regulatory T cell TNF-related apoptosis-inducing ligand TNFR-related apoptosis-mediating protein tetramethylrhodamineisothiocyanate terminal deoxynucleotidyl transferase-mediated dUTP nick end-labelling ultraviolet xxii

Abbreviations v-FLIPS zDEVD-fmk zVAD-fmk

viral FLICE inhibitory protein benzyloxycarbonyl-Asp-Glu-Val-Asp(OMe)fluoromethylketone benzyloxycarbonyl-Val-Ala-Asp(OMe)-fluoromethylketone

xxiii

1 Preparation of lymphocytes and identification of lymphocyte subpopulations MAGDALENA PLEBANSKI

1. Introduction This chapter provides the common methods used to isolate lymphocytes and accessory cells from humans and animals (see Section 2), handle them after recovery (see Sections 3 and 4) and, if necessary, subfractionate them (see Sections 5 and 6). It provides general advice as to which methods may be best used for the particular objectives of your experiment, and cross-references to methods throughout the book. It is common when using a new method to follow it precisely. But what if your house is on fire while you are in the middle of purifying a lymphocyte subpopulation? Should you risk leaving your precious cells on the bench? To help avoid some dilemmas, in addition to standard methods, this chapter aims to provide a measure of the adaptability of different experimental procedures.

2. Sources of lymphoid and professional antigenpresenting cells Lymphoid cells (B and T cells) and professional antigen-presenting cells (PAPCs) in mammals are generated mainly in the primary lymphoid organs. During fetal life they are found in the yolk sac. This function is then taken over by the fetal liver and spleen. In adult life their earliest progenitors are found in the bone marrow. These have the potential to generate all the blood cells of the body, including lymphocytes and many PAPCs. Mature granulocytes (neutrophils, eosinophils, and basophils), B lymphocytes, monocytes, and probably natural-killer (NK) cells, leave the bone marrow via the blood. By contrast, the T cells that leave the bone marrow are immature. The immature T cells home for the thymus where they will divide and mature further. The majority of the T cells generated in the thymus die there and only a small

Magdalena Plebanski percentage of mature T cells leave the thymus (10%). Primary lymphoid organs offer a very specialized source of lymphocytes and PAPCs, well suited to the study of early differentiation in the immune system. Chapter 14 details methods to isolate thymic lymphocytes and PAPCs, as well as how to perform cultures where the ultrastructure of the thymus, believed to play a vital role in its function, is left intact. These organs are difficult to process for use as a source of mature lymphocytes and PAPCs, and may, in fact, generate confusing results when attempting to study conventional mature immune responses. Mature lymphocytes can lodge permanently or temporarily in secondary lymphoid organs. These organs are also an abundant source of PAPCs. Secondary lymphoid organs can be encapsulated (spleen and lymph nodes), aggregated (lymphoid follicles such as tonsils, Peyer's patches of the small intestine and the vermiform appendix of the large bowel), or diffuse (lamina propia under the basement membrane of the epithelium of the respiratory and digestive tract). Further expansion and maturation of B cells into plasma cells, naive T cells into memory cells, and resting memory T cells into effector T cells (for example cytotoxic T cells becoming activated to kill) is thought to occur mainly in the secondary lymphoid organs. Many of the gut-associated lymphoid tissue (GALT) and bronchus-associated lymphoid tissue (BALT) lymphocytes recirculate specifically in these tissues, creating a self-contained pattern of reactivity to antigenic stimuli associated with the mucosa. The purification of mucosa-associated lymphocytes and PAPCs is detailed in Sections 3.1.2 and 3.2.2 of this chapter. Peripheral immune responses, arising from infections in non-mucosal tissues, are, in turn, generally reflected in the composition of the spleen and lymph node lymphocytes. In particular, lymph nodes directly draining an area of antigenic stimulation show an early enrichment for antigen-specific lymphocytes. These organs are also a good source of PAPCs, and both the spleen and certain lymph nodes are easy to obtain and process. Section 3.1.1 details how to isolate spleen and lymph node cells. Some of the mature activated cells leave the lymphoid organ to home to other secondary lymphoid organs and to sites of antigenic challenge. Section 3.1.3 discusses how to isolate infiltrating lymphocytes from tissue and tumours. Lymphocytes travel around in lymphatic and blood vessels. Lymphatic vessels are extensively distributed throughout the body. They initially evolved to drain the fluid that seeps out of blood capillaries into tissue. Thus, whereas blood is directly propelled by the action of the heart, lymph moves passively in response to contraction of the body muscles and the seepage of fluid into tissue. All lymphatic vessels begin as thin, blind capillaries with walls consisting of a single layer of flattened endothelial cells. The lymphatics connect to form larger vessels until they either become the right lymphatic duct (draining the upper right part of the body), which empties into the right subclavian vein, or the thoracic duct, which drains everything else and empties into the left subclavian vein. Lymphatics traverse lymph nodes, bringing the 2

1: Preparation of lymphocytes afferent lymph with information about the state of the tissue that it drains and going out in efferent lymph, which, with time, will reflect the response of the lymph node cells to that information. Both afferent and efferent lymph vessels can be cannulated to recover lymphocytes. Unless you are dealing with a species of adequate size this can be technically very demanding (see Section 3.2.1). Most studies of lymphocyte trafficking, where lymphatic cannulation was necessary, have been carried out in sheep. By contrast, blood samples are easy to obtain from a variety of animals and from humans. Section 3.2.1 details how to obtain and process blood samples to maximize the recovery of lymphoid cells and PAPCs.

3. Methods of purification 3.1 Lymphoid organs 3.1.1 Spleen and lymph nodes The spleen is an abundant source of lymphocytes and PAPCs, with 50-100 X 106 cells/mature spleen in mice, and 200-400 X 106 cells/mature spleen in rats. An ongoing in-vivo immune response, due to immunization or infection, can further double the number of cells in the spleen. As well as white cells, mainly lymphocytes (B and T) and PAPCs such as macrophages and dendritic cells, the spleen is plentiful in red cells. Normally, these do not interfere with assays of lymphocyte proliferation (see Chapter 5 and 6) or the in-vitro stimulation of cultures for T-cell cytotoxicity assays (see Chapters 5, 7 and 8). However, they may interfere in assays such as the early IFNfy-release ELISpot assay (see Chapter 7). A protocol is therefore given in this section (see Protocol 3) to lyse red cells and eliminate red-cell contamination of spleen cells. Be certain that your assay really requires this additional step, since it may cause stress to lymphocytes and decrease their viability. Lymph nodes are another abundant source of lymphocytes and these do not have the problem of red-cell contamination. They are, however, quite small and sometimes difficult to find and remove. In some cases you may need to dissect specific lymph nodes, for example if you want to use draining lymphocytes from an area where you have injected an antigen. However, if there are no such restrictions, mesenteric nodes and cervical nodes may be easier to find since they are usually the biggest. The latter are also easily accessible. In addition, axillary, brachial, inguinal, and popliteal nodes may also yield useful numbers of white cells (5-50 X 106 in mice, 20-100 X 106 in rat). Popliteal nodes (behind the knee) are also easily accessible and may be useful to study when antigens have been applied to the lower leg. Thus, an intradermal injection in the footpad leads to a specific expansion of lymphocytes in the popliteal node of that leg. At early time points (before specific cells have migrated to other secondary lymphoid organs in the body) the other popliteal node may be used as a negative control. 3

Magdalena Plebanski t^f

In the United Kingdom work with animals requires valid licences (individual and project licences) from the Home Office, which are obtained after attending a compulsory course where the proper humane methods of working with animals are demonstrated. Do not under any circumstances attempt to work with animals without attending the course and obtaining a licence. Also, think carefully about your experiment, and try to find out if any of your work with animals can be avoided by using a different experimental approach. Protocol 1. Isolation of splenocytes Equipment and reagents • 70% ethanol • 1 pair of non-sterile scissors and forceps • 1 pair of sterile scissors and forceps (bluntended) • R/10 medium: RPMI supplemented with 4 mM L-glutamine, 100 U/ml benzylpenicillin G, 100 ug/ml streptomycin sulfate, 0.05 mM 2-p-mercaptoethanol, and 10% fetal calf serum (PCS)

RPMI 1640 medium Sterile vials Petri dish 10 ml syringe plunger Sterile cell strainer Sterile test tubes Benchtop centrifuge Sterile centrifuge tubes

Method 1. Kill the animal (by cervical dislocation or CO2) and apply 70% alcohol (pour or swab) to the left-hand side of the abdominal fur. 2. Pick up the skin using forceps (can be non-sterile) just below the rib cage on the left side of the abdomen and cut with scissors (these can be non-sterile). Pull the skin back from the incision, both cranially and caudally, exposing the abdominal-wall musculature. 3. Pour 70% alcohol over the exposed musculature and, using sterile (e.g. dipped in 70% alcohol) scissors and forceps, pick up the abdominal wall over the spleen. Locate the spleen (it can be seen through the abdominal wall as a deep red, sausage-shaped organ just under the liver (which is bigger and less brightly coloured) on the lefthand side of the animal). Cut and open the abdomen near the spleen, giving yourself space to grasp it gently in your forceps and draw it out of the abdomen. 4. Holding it gently with the forceps, remove any non-spleen tissue attached to it (connective tissue, vascular stalk, omental connections, gut tissue) with your sterile scissorsa Place each clean spleen into a sterile vial containing sterile RPMI media (or any other physiological buffer), so that it is completely covered.b 5. Transfer the spleen to a Petri dish containing 5 ml of RPMI medium and disaggregate it.c 6. Put a sterile cell strainer on the top of a sterile tube, and pour your cell 4

1: Preparation of lymphocytes suspension through it. Leave any possible cell debris which may not have been strained to settle for 1-3 min, and transfer the debris-free cells to a sterile centrifuge tube.d 7. Centrifuge for 7 minutes at 600 g (1000-2000 r.p.m. in most common tissue-culture laboratory, benchtop centrifuges) at room temperature (RT) (18-22°C). Discard the supernatant. Flick the cell pellet gently and resuspend in 5-10 ml sterile RPMI. Take (sterilely) a 50 ul aliquot of your cell suspension to count cells and assess their viability (see Protocol 2). Centrifuge the cells again. 8. Discard the supernatant, flick the pellet, and resuspend it in the medium appropriate for your experiment at your required cell concentration.e • These tissues are normally easily distinguished from the self-contained, deep-red structure of the spleen. 6 Although it is best to proceed with the rest of the protocol straight away, isolated spleens can be left in media at room temperature for about an hour. If it will take more than an hour, for example if they need to be transported, it is best to put the vial on ice (up to 6 hours) and fill the vial with R/10, "This can be performed in a variety of ways: from crushing with sterile rounded forceps through a sterile metal mesh to careful teasing apart with a pair of sterile needles or forceps. An easy protocol is to use the stop end of a sterile 10 ml syringe plunger and gently push and rub the spleen as it lies in the Petri dish. Small clumps can be further desegregated by taking up the spleen suspension into a syringe through a wide-gauged needle several times (gentlyI). "Use of a strainer is advisable but not essential. Allowing debris to settle out can be done as many times as necessary. " If this is a standard culture medium, e.g. R/10, cells can be left at this stage for 1 hour at room temperature. Leaving cells standing around in a plastic container such as a centrifuge tube for longer, or at 37 °C, may lead to the selective loss of adherent cells, such as macrophages and some dendritic cells and B cells.

The protocol to obtain lymph node cells is virtually identical, except for the initial locating and removal of lymph nodes. When dissecting be careful not to include fatty and connective tissue, which is frequently found in areas surrounding lymph nodes. Lymph nodes are normally rounded, bean-shaped organs with a solid, rubbery consistency and white/yellow in colour. Fatty tissue is white and easily falls apart when pulled by forceps. Connective tissue is white/pink. Lymph nodes are difficult to manage because of their smaller size, so teasing apart with needles may give you better control and thus increased cell recovery than other methods (steel mesh, or the method delineated above). Sterile forceps can be used to hold the lymph node as it is being teased apart. Cell viability can be assessed by counting, under a microscope, cells that take up a dye, most commonly Trypan Blue, after they have lost membrane integrity (see Protocol 2). If more than 25% of the recovered cells are dead, it might be best to remove them from the viable cells. A simple protocol utilizing a one-step density gradient is detailed in Protocol 4. 5

Magdalena Plebanski Protocol 2. Counting cells and assessing cell viability Equipment and reagents • Coulter counting chamber • Microscope (allowing 10-40 x magnification) • 0.5% Trypan Blue in PBS

. PBS: 1.4 M NaCI, 0.3 mM KCI, 7 mM Na2HPO4, 1 mM K2HP04; pH 7.2 for use with murine cells and pH 7.4 for use with human cells

Method 1. Mix 50 ul of the Trypan Blue solution with 50 ul of your cell solution. Dilute further (e.g. make a 3 x dilution by mixing 25 ul of cells with 50 uJ of Trypan Blue) if your cells look very concentrated. 2. Apply to a Coulter counting chamber (normally 10 ul). Make sure the coverslip is firmly attached to the counting chamber by putting moisture (water, not saliva, regardless of what you see other people in the lab. doing!) on the sides of the coverslip and press it firmly on to the counting chamber. Make sure you can see Neubauer rings (coloured diffraction pattern) on the side of the chamber, indicating that the coverslip is properly stuck. 3. Count live lymphocytes and PAPCs (translucent white cells) and dead cells (blue) using 10 X, 20 X, or 40 x magnification. Count at least 50 live cells, and take note of how many areas of the Coulter chamber you need to count to achieve this number. 4. Calculate the viable-cell concentration as follows: (a) if all cells within the triple-line markings on the chamber are counted (in the most commonly employed chambers there are 25 squares marked, each with smaller 16 squares within them to aid counting), your cell concentration is: number of cells counted x dilution X 104 = cells/ml of suspension; (b) if less than 25 squares are counted, simply multiply to compensate, thus: number of cells counted x dilution x multiplier x 104 = cells/ml of suspension. Avoid counting red cells. They can be distinguished as being smaller than lymphocytes, round with dark, well-delineated edges, and slightly reddish in colour. It takes some experience, or a very good microscope, to be confident about counting red cells. It is possible to lyse red cells (see Protocol 3) before counting to avoid this problem. Although this adds an extra step in the procedure, it might be useful while learning to count cells. Alternatively, once viability is assured, cells can be recounted using a crystal violet dye, which will stain purple only nucleated cells. Red cells will remain transparent. Prepare the crystal violet diluent by mixing glacial acetic acid: deionized water: PBS at a 1:12:12 ratio. Add 1-100 mg crystal violet per ml diluent. Mix 10 ul of cell 6

1: Preparation of lymphocytes suspension with 90 ul of the crystal violet solution and count cells under the microscope as described in Protocol 2. Protocol 3. Red blood cell lysis (RBCL) Equipment and reagents . ACK buffer: 0.15 M NH4CI, 1 mM KHCO3, 0.1 mM Na2EDTA pH 7.2 • Benchtop centrifuge

. PCS . RPMI or PBS

Method 1. Centrifuge the cell preparation containing the red cells you want to lyse for 7 min at 600 g. 2. Discard the supernatant and flick the pellet. Add 10 ml of the RBCL solution (ACK buffer) and mix gently. Leave at room temperature for 5 minutes. 3. Dilute with 25 ml of physiological buffer (e.g. RPMI or PBS). 4. Use 2 ml of fetal calf serum (FCS) to underlay the cells in the RBCL solution. 5. Centrifuge at 600 g for 7 min at room temperature.a,b 6. Discard the supernatant, including the FCS. Flick the pellet and resuspend in 5 ml RPMI. Wash once by centrifuging at 600 g for 7 min at room temperature. Discard the supernatant. 7. Look at the pellet: if the cells are sufficiently clean of red cells (the pellet should look white) proceed to flick the pellet and wash the cells again in RPMI. Then resuspend them in the medium you wish to use for your experiment. Otherwise, repeat steps 1-5 to lyse residual red cells. • Red cell membranes generated during red cell lysis should float at the FCS/RBCL interface, whereas lymphocytes just pellet as normal. "This FCS gradient is only necessary if red cell membranes can interfere with your assay. For eliminating red cells before counting under the microscope, this step is unnecessary, and cells can be pelleted straight away from ACK.

Dead cells are also a common contamination problem. In particular, they may be increased when recovering infiltrating lymphocytes from tissue treated with collagenase, or when using thawed cryopreserved cells. The simple method delineated below can eliminate most dead cells (see Protocol 4). It is also useful if you have a precious but yeast-contaminated culture. Normally such a culture should be immediately discarded to avoid contaminating other cultures in your incubator. In critical cases, the Ficoll gradient technique described in Protocol 4 can be applied. This will not eliminate contamination, but it will reduce it, as yeast will pellet to the bottom of the Ficoll gradient and cells will remain floating on top of the Ficoll/medium interface. 7

Magdalena Plebanski Protocol 4.

Elimination of dead cells

Equipment and reagents • Metrizoite-Ficoll solution (1.077 g/ml) • Sterile centrifuge tubes • Sterile pastettes or 1-10 ml plastic pipettes

• Benchtop centrifuge • RPMI medium

Method 1. Add 5 ml of the metrizoite-Ficoll solution at room temperature to a sterile centrifuge tube. Gently layer your cell suspension (1-10 ml) on to the Ficoll. Avoid making swirls in the Ficoll. You can apply the cells with a sterile pipette, allowing the suspension to slide gently down the sides of the tube.3 2. Centrifuge at 600-800 g for 15 min at room temperature. Make sure no brake is applied to stop the centrifuge spin. 3. Collect the cells at the Ficoll/medium interface (they should look like a cloudy white band). Try to aspirate them from the top with a pipette or pastette about 1 mm away, this helps to minimize Ficoll contamination of your cells. Dead cells will have pelleted straight to the bottom. 4. Wash your cells twice in RPMI. Count as described in Protocol 3 during the last spin. Resuspend in the medium of your choice. • If using thawed cells it is best to rest them for at least 1 h in R/10 medium (see Protocol 1) at 37°C to eliminate residual dimethylsulfoxide (DMSO) before layering.

3.1.2 Tonsils and Peyer's patches These organs are tougher to dissociate and need an additional collagenase treatment step. Peyer's patches are an integral component of the gutassociated lymphoid tissue (GALT), and in the mouse approximately 30 of them are embedded along the length of the small intestine. About 1.0 X 106 cells can be recovered from each patch. Maintaining sterility is difficult due to the proximity of the gut contents, even if those are flushed prior to dissection. Plan your experiments accordingly. Protocol 5. Isolation of cells from Peyer's patches Equipment and reagents • As for Protocol 1 • Collagenase • Sterile, wide-bore, 5-10 ml plastic pipette or a 3 ml pastette

• Ice-cold saline • 2 U/ml dispase and 0.1 mg/ml DNase I (if needed)

8

1: Preparation of lymphocytes Method 1. Kill the animal (cervical dislocation or CO2), put on the dissecting board, belly up, and apply 70% alcohol (pour or swab) to the abdominal fur. 2. Pick up the skin just under the jaw and cut towards the pubis with scissors (these can be non-sterile). Pull the skin back from the incision, to both sides, exposing the abdominal wall musculature. 3. Pour 70% alcohol over the exposed musculature and, using sterile (e.g. dipped in 70% alcohol) scissors and forceps, pick up the abdominal wall over the gut and cut to give yourself enough space to remove the whole of the small intestine. Transfer this into a vial containing sterile medium (e.g. RPMI). 4. Transfer into a Petri dish containing sterile medium. Cut the gut into 15 cm lengths and flush the contents with ice-cold saline. Cut around each Peyer's patch (white, round protuberances) using sterile sharp scissors and sterile forceps. 5. Transfer the patch to another dish and rinse with medium. 6. Transfer to a tube containing 1 ml of medium (e.g. RPMI) and collagenase (1-8 ug/ml)a, and incubate for 30 min. During this time take the suspension up and down the wide-bore pipette or pastette about 10 times, every 10 minutes, to help to further dissociate the tissue. Add neutral protease (e.g. 2 U/ml of dispase) and DNase I (0.1 mg/ml) if needed. 7. Transfer the suspension to a sterile tube, allow the debris to settle, and transfer the debris-free cell suspension to a 50 ml sterile centrifuge tube. Top up with cold medium (e.g. RPMI) and centrifuge at 800 g for 10 min at 4°C. 8. Remove the supernatant, flick the pellet, and resuspend it in 10 ml of cold medium. Centrifuge at 600 g for 7 min at 4°C. Repeat this step twice. Count the cells and during the last centrifuge spin assess viability as described in Protocol 2. Resuspend in the right volume of culture medium to give the cell concentration appropriate to your experiment. "Check the collagenase you purchase for details of its specific activity and recommended dose.

For tonsils the protocol is the same, except of course for finding and dissecting the tonsils. For collagenase dissection of any tissue, small fragments of tissue, ideally 2 mm3, will assist efficient digestion. Where significant cell death is expected during the digestion process, it will be necessary to add DNase (50 kU/ml). 9

Magdalena Plebanski 3.1.3 Infiltrating lymphocytes Lymphocytes specifically associated with a local inflammatory, delayed-type hypersensitivity (DTH) or autoimmune response may be enriched in tissue. Their characterization can provide vital information about the local targets of the immune reaction. This approach has been particularly rewarding in the study of solid tumours, where tumour infiltrating lymphocytes (TILs) specific for tumour-associated antigens have been isolated by cloning, thereby providing new targets for the immunotherapy of cancer. However, the numbers of cells isolated can be small, thousands rather than millions, and an early cloning (see Chapter 6), immortalization (see Chapter 4, 5), or optimized culture protocol (see Chapters 6-9) must be in place to use them efficiently. Most tissues can be dissected by adapting Protocol 5 and adding the appropriate density gradients (Percoll (see Protocol 8) or Ficoll (see Protocols 2 and 6) are commonly used) to further isolate lymphocytes away from tissue-derived cells. T cell-specific magnetic beads (see Section 5.2.4) can be also used to positively select for TILs. Isolation of lymphocytes from tumours, rather than tissue, carries the problem of tumour cell proliferation in culture, which can easily outgrow the TILs. Early cloning (see Chapter 6) or limiting-dilution analysis assays (see Chapter 9) may be used to separate TILs from tumour cells.

3.2 Body fluids 3.2.1 Blood and lymph A blood sample is easy to obtain from human volunteers. It can also be taken from animals. In smaller species, such as the mouse, the volume recovered (if all the blood was taken this would be 4 ml, up to 0.4 ml can be taken without causing distress) means that only limited numbers of lymphocytes and PAPCs are available for immunoassays. Registered human blood donors give up to 500 ml of blood, and are allowed to do so every 6 months. It is good practice not to take more than 50 ml at a time from each volunteer for experimental purposes, and not to bleed them again until their blood composition has had time to recover (2 weeks). Volunteers should be fully informed and give written consent to give blood for your particular experimental purpose. If trained and allowed to do so, you can take the blood sample yourself. Hospitals run courses. Otherwise use the assistance of trained staff. Recoveries using standard methods (see Protocol 6) yield an average of 0.5-2 X 106 peripheral blood mononuclear cells (PBMCs) per ml of blood taken. The PBMC composition in a normal healthy adult human averages 60% T cells (CD3+ cells, of which 70% are CD4+ and 30% CD8+), 15% monocytes/macrophages (CD14+), 10% B cells (CD22+), and 15% natural killer (NK) cells (CD56+/CD16+). The frequency of these cells may vary dramatically due to a number of factors including disease, diet, age, genetic predisposition, and pregnancy. 10

1: Preparation of lymphocytes Lymph can be obtained by cannulating the lymphatic ducts. The easiest to cannulate, and also the one containing the most representative lymph sample, since it contains lymph drained from the whole body, is the thoracic duct. The procedure for cannulation is intricate and beyond the practical experience of this author. It is, however, excellently described in the previous edition of Lymphocytes: a practical approach, and in a video made by Dr Simon Hunt (Keble College, Oxford University). Copies of this video may be requested ([email protected]). Protocol 6. Isolation of human peripheral blood mononuclear cells (PMBCs) Equipment and reagents • Standard implements for taking blood: tourniquet, sterile swab (can be 70% alcohol on cotton wool), dry sterile cotton wool, plaster, sterile syringe and needle/ butterfly, and a sterile tube containing anticoagulant" (usually 10 U of preservativefree heparin/ml blood taken)

. • • •

Metrizoite-Ficoll (1.077 g/ml) RPMI medium Sterile centrifuge tubes Benchtop centrifuge

Method 1. Find a clean safe environment in which to take blood from your human volunteer. Have all the necessary implements ready. 2. Take the blood into a sterile plastic syringe (see notes in the introduction to this Section) and transfer to a sterile centrifuge tube of appropriate size containing anticoagulant.a 3. Close the lid of the tube and gently invert to mix the anticoagulant with the blood.b Continue with the next steps if you require a sample of plasma as well as PBMCs from your donor; otherwise go to step 6. 4. Pellet the cells by centrifuging the blood at 800 g (2000-3000 r.p.m. in most benchtop centrifuges found in tissue-culture laboratories) for 20 min at room temperature (18-22°C), with no brake.c Avoid taking all the plasma and try to leave at least 2 cm of it on top of your cells, then top up to the original volume of blood with medium (e.g. RPMI) at room temperature. 5. Mix your cells gently with the remaining plasma and medium by inverting the tube several times.d 6. Layer your cell suspension on to Ficoll using a 1:1 ratio of Ficolkblood, but down to 1:1.5 is still acceptable. Overlay the cell suspension either using a pipette and applying the sample gently to the sides of a sterile centrifuge tube already containing the right amount of Ficoll, or Ficoll can be underplayed by gently eluting the Ficoll at the bottom of the cell suspension. In either case try to avoid

11

Magdalena Plebanski Protocol 6. Continued

7.

8.

9.

10. 11.

swirls. Make sure that the Ficoll and the blood are at room temperature, because (a) the density of Ficoll changes with temperature, and (b) cells clump and are inappropriately separated at 4°C. Keep the Ficoll solution in a dark place or covered with aluminium foil (it is light sensitive) at room temperature at all times, so that it is always ready for use. Don't be surprised if, as you layer, you observe red-cell aggregates falling down through the Ficoll, this is to be expected. Centrifuge at 800 g for 30 min at room temperature without a brake. Make sure the last person to use the centrifuge before you has not changed the temperature setting (!). Look for the milky-white PBMC band at the interface between the Ficoll (transparent) and the remaining plasma (yellow). (Note that the red cells (and neutrophils) will have pelleted through the Ficoll to the bottom.) Collect this PMBC band by aspirating it gently from the top with a sterile pipette or pastette, about 1 mm away from it is best. Start by aspirating the sides as some cells will stick to the sides of the tube. Try to take as little Ficoll as possible with your cells. Do not leave cells uncollected as the PBMC band diffuses with time. Centrifuge the cells that you have collected (800 g, 15 min, room temperature, no brake). Discard the supernatant and flick the pellet before resuspending it in RPMI (normally 10-20 ml are used for the following washing steps). Do not leave cells standing around for more than 10 minutes at this stage, or they will clump. Centrifuge at 600 g for 7 min at room temperature, with full brake. Discard the supernatant, flick the pellet, add RPMI medium. Repeat step 10. Count your cells and assess their viability during this last spin as described in Protocol 2. Resuspend finally in the medium appropriate to your experiment at the cell concentration you require.*

"This is normally heparin (10 U of heparin per ml of blood collected), but other anticoagulants may be used. For example, CDP-adenine is usually employed in blood banks. "At this point blood can be stored for up to 2 hours at room temperature or overnight at 4°C. If it is stored cold then it must be brought back to room temperature before continuing. Failure to do so will provoke clumping and loss of cells during the next protocol steps. "Red cells will pellet first, with an almost invisible layer of white cells on the top, and will normally take up half the volume of your tube. The rest (yellow liquid at the top) is plasma. d Failure to leave some plasma behind may not only cause cell loss by aspirating white blood cells together with the plasma, but will result in clumping of the remaining cells in the next steps. "PBMCs purified in this way can be left in a sterile container in suitable medium (e.g. R/10) overnight at room temperature, or in the 37°C, humid, C02 incubator with the lid of the container slightly loose (to allow C02 exchange, but not contamination) for up to 2 days. However, a proportion of the adherent cells may be lost when they are stored for >1 h, and reactivity may decline, depending on the particular bioassay employed, the longer the cells are left unused. A protocol for the long-term storage of cells by freezing is given in Protocol 8.

12

1: Preparation of lymphocytes 3.2.2 Infiltrates (peritoneum, lungs, synovial fluid) Peritoneal lavage is most commonly performed to obtain macrophages. A peritoneal wash can be taken from an animal by simply rinsing the peritoneal cavity with saline (see Protocol 7). A normal mouse will yield 107 cells, with up to 35% macrophages. The proportion of macrophages may increase up to 65% if thioglycollate is added to the saline and injected intraperitoneally (i.p.) 3-4 days earlier. Even greater numbers of infiltrating macrophages (up to 95%) may be obtained if the animal is immunized i.p. with certain bacterial or parasitic vaccines and cells harvested at day 10 (Propionibacterium acnes (formerly called Corynebacterium parvum) vaccine may be used for this purpose at 0.7 mg vaccine/100 g body weight). Protocol 7. Isolation of peritoneal macrophages Equipment and reagents • 70% ethanol • 22-gauge needle and syringe

• PBS (see Protocol 2) containing 20 U/ml heparin

Method 1. Anaesthetize (ether or CO2) or kill the animal (cervical dislocation) and apply 70% alcohol (pour or swab) to the abdomen. 2. Inject intraperitoneally (i.p.) PBS containing 20 U/ml heparin (5 ml for a mouse, 10 ml for a rat). 3. Massage the abdomen for 1-2 min. 4. Insert a syringe with a 22-gauge needle a short distance (2-4 mm) through the abdominal muscle (peritoneum) at any place where it can avoid touching any organs. Aspirate the fluid while holding the abdominal muscle as high as possible. If the flow stops and the peritoneum is still full, check that your needle is not touching an organ, and readjust if necessary.3 'Animals should recover normally after anaesthesia.

Bronchial lavage will also yield mostly macrophages (up to 90%). The total number recovered is approximately 10s per mouse and 5 X 106 per rat. To do this attach a length of flexible tubing to a syringe and fill the lungs (of anaesthetized animals) with PBS (5-10 ml in mice), flushing the PBS in and out three times. This can be repeated twice more to optimize yields. Synovial fluid cells can be obtained from synovial fluid by treating the fluid with hyaluronidase (50 ug/ml for 30 min at 37 °C, with stirring) to reduce viscosity, and then following Protocol 6, steps 6-12 (described for the separation of blood PBMCs on Ficoll). 13

Magdalena Plebanski

4. Principles of lymphocyte handling and culture 4.1 Short- and long-term storage (freezing) After isolation, lymphocytes and PAPCs can, if necessary, be stored. Human PBMCs can be stored in a constant pH, physiological medium supplemented with nutrients (e.g. R/10) at 37 °C in a humid CO2 incubator for up to 2 days. There is no apparent loss in their ability to secrete lymphokines (such as IL-4 or IFN-y), proliferate, or become activated for lysis by in vitro restimulation. Store them at 106-107/ml, but preferably at 2-5 X 106/ml. Since mouse spleen cells are more sensitive, it is best to use them within 12 h of isolation. Both human and murine cells can normally be left on the bench at room temperature in buffered culture medium containing nutrients (e.g. R/10) for up to 2 h. Inevitably, these steps lead to the loss of adherent cells, particularly if the PBMC or spleen mix is left in a plastic or glass container with a wide surface area. When planning to store cells short term, you should consider whether the lymphocyte or PAPC cell population you are studying may have additional requirements for survival in vitro. Furthermore, some cells may differentiate as soon as they are taken out of their in vivo environment. For example, adherence to plastic quickly leads to monocytes acquiring some of the properties of activated macrophages. For long-term storage (weeks-years) lymphoid and accessory cells can be frozen, and then revived before your experiment. Freezing and defrosting cells, even with an optimized protocol (see Protocols 8 and 9, respectively), may lead to some cell loss. Recoveries after freezing/defrosting differ between cells. Resting cells (>80% PBMCs and spleen cells are normally non-cycling), immortalized T- and B-cell lines (see Chapters 4 and 5) and activated CD4+ T cells are best (see Chapters 6 and 7). Activated cells, particularly those containing lytic granules (neutrophils, cytotoxic T lymphocytes (CTLs), eosinophils, basophils) are worst. It is advisable to freeze between 0.5-5 X 107 cells/vial (in a 1.0 or 0.5 ml volume). In our experience, the smallest number of cells recoverable after freezing is 5 X 104 cells. Storage will also affect recovery. For long-term (>2 weeks), storage in liquid nitrogen (temperature of -120 °C) is advisable. For 1-2 weeks, storage in a -70 °C freezer is normally sufficient. Protocol 8.

Freezing cells

Equipment and reagents • FCS or normal human serum • Dimethylsulfoxide (DMSO) • Cryotubes • Polystyrene rack • Ice and ice-bucket

Centrifuge tubes Benchtop centrifuge Freezer vials (Nunc) -70 °C freezer Liquid-nitrogen storage tank

14

I: Preparation of lymphocytes Method 1. Centrifuge the cells to be frozen at 600 g for 7 min at 4°C. Remove the supernatant and flick the pellet. 2. Remove aggregates from heat-inactivated (30 min at 56°C) FCS or mormal human serum by centrifuging at 800 g for 30 minutes before use. Keep the serum sterile; if in doubt about its sterility, sterilize through a 0.2 (umsterile filter. Resuspend the cells (107-108/ml) in cold (4°C) neat, sterile, heat-inactivated PCS or normal human serum. 3. Incubate on ice for 20 min. While the cells are thus becoming less pinocytically active, make a solution of 20% dimethylsulfoxide (DMSO) in heat-inactivated sterile PCS or normal human serum. Add 0.25 ml of this serum/DMSO solution to each freezer vial (Nunc). Label the vials with a permanent marker pen. 4. Gently resuspend the cells. Add 0.25 ml of the cold cells in serum to each vial containing 0.25 ml of serum and 20% DMSO. 5. Put the vials into a commercially available, gradual freezing chamber, or if you do not have one, push them into a polystyrene rack so that each vial is firmly embedded on three sides and place in a -70°C freezer where the temperature will not be disturbed during storage. 6. For long-term storage (>2 weeks) leave the vials for 24-72 h at -70°C and then transfer them to a liquid nitrogen tank.

Protocol 9. Thawing cryopreserved cells Equipment and reagents • 37 °C water bath • Benchtop centrifuge • Sterile, 15 ml Universal tube • Sterile pastette . RPMI, 10%FCS(R/10 medium, see Protocol 7)

Method 1. Defrost cells from the nitrogen tank by transferring them to -70°C for 24-72 h. 2. Quickly defrost by immersion and gentle shaking in a 37°C water bath. 3. Transfer cells from the vial to a 15 ml sterile Universal tube with a sterile pastette. 4. Immediately add warm (37°C) R/10 medium; initially slowly with gentle shaking, 0.5 ml/min for the first 2 min, followed by 2 ml/min for the next 2 min, and then top up with 5 ml. 5. Centrifuge at 600 g for 7 min at room temperature, with brake. 6. Discard the supernatant, flick the pellet, and add 10 ml of R/10. 15

Magdalena Plebanski Protocol 9. Continued 7. Repeat steps 5 and 6 twice. During the last spin take an aliquot of cells to count and assess viability (see Protocol 2). Follow Protocol 4 if too many dead cells are present (>25%). Otherwise, resuspend the cells at the right concentration in the medium appropriate to your assay.

4.2 Principles of long- and short-term culture Culture media (which determines pH, isotonicity, and nutrients), media supplements (biological factors required for cell survival), the shape and physical properties of the container, and temperature, all affect cell survival and differentiation in culture. A series of conventional culture media have been developed commercially that normally support lymphoid cells and PAPCs in vitro. The most commonly used is RPMI. However, the specialized cell function you may want to study may require a specialized medium, for example the stimulation of naive T cells is normally undetectable in RPMI but is clearly inducible in aMEM media. Most human PBMCs and mouse spleen cell in-vitro cultures and bioassays require supplementation of the media with serum-derived factors. Serum-free media have been developed that provide these factors uniquely, but the simple expedient of adding 10% fetal calf serum (FCS) works for the majority of bioassays. Serum batches are variable in their ability to support assays, and also the level of background responses they induce. Using autologous, or species-specific serum (e.g. normal human serum with human cells) tends to reduce background problems. However, even then, it is advisable to batch-test the serum for your particular culture requirements. The shape of the tissue-culture container and the cell concentration used varies greatly depending on the bioassay and purpose of culturing. Most standard lymphocyte cultures (to assess proliferation, restimulate cells for cytotoxicity assays, or assays of lymphokine production) are carried out in standard tissue-culture plates (Terasaki plates or 96-, 48-, 24-, 12-, or 6-well, flat-bottom plates), with 0.5-5 X 106 cells/ml in the correct volume for the plate being used. Lymphoid cells and PAPCs will change in culture. The longer cells are cultured, the more changes there will be from their initial in-vivo characteristics. This will happen even with clonal cell populations. Although this fact must be kept in mind, many specific questions can only be addressed with long-term cultures. Moreover, in the near future they could be an essential tool not only for the immunologist (see Chapters 4, 5, 6, 7, 8, 9, and 15) but also for the physician (see Chapter 13). 4.2.1 Contamination problems Before deciding on the appropriate level of paranoia it is important to decide whether you are setting up a short-, medium-, or long-term culture. Short 16

1: Preparation of lymphocytes cultures (<24 h) do not require great care for the maintenance of sterility, and can even be performed without it. Media can be supplemented with antibiotics (penicillin and streptomycin or gentamicin, are most commonly used) to minimize possible bacterial contamination. Medium-term cultures (1-7 days) require standard sterility precautions. In other words, all reagents and implements used must be sterile; work in a sterility hood and keep your incubator clean. Fungi and yeasts are particular problems of improperly kept tissue-culture incubators. If you are planning to do long-term cultures (>7 days), fungal or yeast spores may still get into your culture from the air, even if the incubator itself is clean. Contamination usually comes from the air and thus starts in wells at the edges of plates. If using such tissue-culture plates, place your cells in the middle on the plate, and fill the edges with sterile medium. This will not only warn you of contamination in your environment before your cell sample is lost, but will help humidify the immediate area around your cells, decreasing evaporation. Plastic sandwich-boxes, with a small hole left for gas exchange, can also be used to protect plates with cells in long-term culture. Long-term culture always carries the risk of losing your cells. If feasible, consider freezing a sample of your culture as a back-up (see Protocol 8). If, despite your best efforts, contamination has crept in and you have a duplicate clean sample of cells, throw out your contaminated cells. Do it. However, if you have one sample of irretrievably precious cells, you can try rescuing your culture using fungicides or fungostatic agents. Amphotericin B at a 2 (ug/ml final concentration in culture is a common fungostatic, which does not interfere with most lymphocyte functions. It must be maintained in culture (since it prevents growth, but does not kill fungi and yeasts), by adding it every 7 days. The Ficoll gradient delineated in Protocol 4 can be applied to a culture if there is extensive yeast contamination. This will not eliminate contamination, but it will reduce it, as the yeast will pellet to the bottom of the Ficoll gradient and cells will remain floating on top of the Ficoll/medium interface. The recovered cells can be then cultured as normal in the presence of Amphotericin B. Another common contamination problem is mycoplasma. It is not detectable by eye. The first signs of contamination may be a failure of your cells to react normally in functional assays. Specific mycoplasma-detection tests are available commercially. Routine testing (every month) of long-term cultures for mycoplasma contamination is advisable. 4.2.2 Preventing cell proliferation In cases where PAPCs are used to induce the growth and expansion of T cells it may become necessary to stop the former from proliferating. This can be done by irradiating the PAPCs with gamma radiation (normally from a caesium source): 2000 rads prevent the proliferation of human and murine PAPCs and T cells without affecting most of their antigen-presenting cell 17

Magdalena Plebanski functions. If there is no radioactive source available, incubate your PAPCs for 45 min with 50 ug/ml of mitomycin C, followed by extensive washing. However, mitomycin C treatment may lead to a more severe loss in antigenpresenting capacity and should be used with caution.

5. Methods of subfractionation for lymphocytes and antigen-presenting cells The efficient functioning of the immune system depends upon the interaction between different cell types. Table 1 lists the main immune cell types and their characteristics (including cell-surface markers). T cells are central to the Table 1. Main blood-cell types Features

Cell (other names)

Red, small, central indentation

Erythrocyte (red blood Oxygen transport cell or RBC)

Main function

Blood group antigens: ABand rhesus

Very small, irregular shape

Thrombocytes (platelets)

—

Clotting

Surface markers

Medium sized, granular Basophils (similar cell Changes in vessel in tissues is mast cell) permeability

IgE receptor (IgER)

Medium sized, granular Eosinophils

IgG receptor (IgGR), complement receptor (C3bR)

Opsonin targeted killing

Medium sized, granular Natural killer cells (NK) Killing of cells

lgGR(CD16),CD56

Big, granular

Neutrophils

Phagocytosis

IgGR, C3bR, lectins

Big, round in blood, multitude of shapes in tissues

Monocytes (macrophages or histiocytes when in tissue)

Phagocytosis, opsonin targeted killing, fever response, complement production, specific T-cell activation

IgGR, C3bR, lectins (e.g. bacterial lipopolysaccharide receptor or CD1 4)

Veiled cells in blood, long thin arms in tissue

Dendritic cells (Langerhans cells in skin, interdigitating cells in lymph nodes and spleen)

Specific T-cell activation Unusually high levels of MHC molecules, CD38

Medium sized, round in B lymphocyte (terminally blood differentiated B cell is called a plasma cell)

Antibody secretion (as plasma cell), T-cell activation

Medium sized, round in Helper T lymphocyte (Th) blood

Regulates the function CD2, CDS, T-cell of other immune cells receptor (TcR), and CD4

Medium sized, round in Cytotoxic T lymphocyte Killing of cells blood (CTL)

18

Surface immunoglobulin CD19,CD20,CD22

CD2, CDS, TcR, and CDS

3: Preparation of lymphocytes regulation of the specificity, nature, durability, and magnitude of immune responses. The T-cell response is normally activated when PAPCs (B cells, monocytes/macrophages, dendritic cells) partially digest antigen to present its fragments (peptides) to T cells. These are complexed on the PAPC surface with major histocompatibility molecules (MHC). T cells specific for that peptide-MHC complex are then activated. The two main types of T cells, bearing either the CD8 or the CD4 marker, recognize class I- and class II-type MHC complexes, respectively. B-cell activation can occur in the absence or presence of T cells. The latter can regulate B-cell differentiation, and consequently the nature of the antibodies produced to an immune challenge. Markers now exist to distinguish naive and memory T cells, T cells homing to specific tissues, T cells causing suppression or activation of a specific set of immune effector functions. The list grows every day. A similar explosion in cell-surface markers has occurred for PAPCs. Isolating clean PAPC populations and studying their interaction with particular T-cell subsets continues to reveal subtleties in the workings of the immune system.

5.1 Physical properties 5.1.1 Density and size Table 1 provides a comparative idea of the size and granularity of different blood cell types. These apply to cells that are not undergoing an active immune response, since extensive differentiation and changes in shape and size can occur. A density gradient based on Percoll to separate dendritic cells, macrophages, and resting versus activated human T and B cells is described in Protocol 10. Gradients based on the use of albumin have also been described. The most common use of Protocol 10 is the isolation of specific, activated T cells from culture. T-cell blast cells normally appear in a stimulated culture after 48 hours. Cultures can be followed microscopically to allow you to choose the optimal time-point for harvesting blast cells. Several modifications of this method have been proposed to enrich dendritic-cell recovery. In fact, adaptations of this protocol, by modifying the density of the gradient, can be utilized to optimize recoveries of particular cell types in any species. Protocol 10. Isolation of blast T cells on a Percoll gradient Equipment and reagents • Percoll . FCS • 7.5% sodium bicarbonate solution • 10 x RPMI

• Centrifuge tubes • 1-5 ml pastettes, pipettes, or syringes with wide-gauge needle • Benchtop centrifuge

Method

1. Prepare Percoll for cell-use by adding 1.5 M of PBS in a ratio of 1 part PBS to 9 parts of a commercial Percoll solution. Alternatively, dilute 19

Magdalena Plebanski Protocol 10.

2.

3. 4.

5. 6.

7.

Continued

10x RPMI 1640 medium to 1x with dH20 and 7,5% bicarbonate solution. This isotonic Percoll solution is termed 100% Percoll and has a density of 1.1294 g/ml. 10 ul of 10 M Hepes can be added to further maintain physiological pH. Prepare 50%, 40%, and 30% Percoll solutions by diluting the 100% isotonic Percoll with PBS, RPMI, or, for delicate cell types, R/10. Prepare at least 2 ml of each per blast-cell preparation. You will also need a Percoll-free (0%) solution of your chosen medium. Centrifuge the cell preparation containing T-cell blasts at 600 g for 7 min at room temperature, with brake. Discard the supernatant. Flick the pellet and resuspend it in 2 ml of the 100% isotonic Percoll solution. Gently layer on to it 2 ml of each one of the 50%, 40%, 30%, and 0% Percoll solutions. Centrifuge at 600 g for 10 min at room temperature, with no brake. Collect cells at each interface (pipette, pastette, or a syringe with a wide-gauge needle can be used), starting from the 0%-30% interface, 30%-40%, 40%-50% (here are your blast T cells), 50%-100% (here are the resting T cells) and discard the pellet. Wash several times to remove Percoll by centrifuging at 600 g for 7 min at room temperature, with brake. During the last spin assess recovery and viability (see Protocol 2).

5.1.2 Adherence Macrophages, and to a lesser extent dendritic cells and B cells, adhere to glass and plastic. Incubation of human PBMCs in R/10 at 37 °C on a plastic surface, such as a Petri dish, tissue-culture flask, or flat-bottomed tissue-culture wells for more than 1 h is sufficient to cause the adherence of macrophages and dendritic cells, and to some degree, activated B cells. T cells, NK cells, and resting B cells generally do not adhere. If the incubation continues for more than 3 hours, dendritic cells and B cells will detach but macrophages will remain adhered to plastic. Adherence can thus be used to significantly enrich or deplete particular PAPCs. Firmly attached adherent cells can be recovered by gentle rubbing with a cell scraper. Incubation with Ca2+- and Mg2+-free PBS with 0.1-3 mM EDTA (PBS-EDTA) for 20 min at 4°C facilitates detachment.

5.2 Cell-surface markers 5.2.1 Binding of antibodies to specific surface markers Monoclonal antibody (mAb) technology has been coupled with an explosion in the characterization and understanding of different surface molecules on lymphoid cells and PAPCs. Some common markers are listed on Table 1. 20

1: Preparation of lymphocytes Methods have been developed based on the separation of cells that have bound a specific mAb. The main, commonly used protocols are detailed in the following sections. There are two main types of selection: negative, where the cell type which bound the mAb is removed and discarded, and positive where it is recovered. For ease in isolation, select abundantly expressed markers and antibodies with well-characterized binding properties. Remember that the markers we use are also functional molecules for the cell. Thus the interaction of the mAb with the marker could alter subsequent functional activity. When separating cells it is necessary to first consider the scale of preparation. A method suitable for isolating 106 cells may become unwieldy or prohibitively expensive if used to isolate 108 cells. Similarly, methods suitable for large-scale purification may result in excessive cell loss if used with small cell numbers. In general, complement-mediated lysis (see Section 5.2.2) and panning and columns (see Section 5.2.3) are better suited to large-scale preparations (>5 X 107 cells). Magnetic beads (see Section 5.2.4), and particularly cell sorting (see Section 5.2.5), are well suited to smaller preparations (<5 X 107). Perform all steps with sterile reagents if cell subpopulations are required for subsequent culturing. 5.2.2 Complement-mediated lysis This method used to be extensively employed for negative selection. In brief, cells that have bound antibody are killed by the action of complement. It is relatively cheap, and if optimal conditions are followed, gives good depletion. Its limitations are that the mAb employed needs to be able to fix complement, and a good source of complement (batch-testing is advisable) with low non-specific lysis and high specific activity is required. Lysis is time-dependent, and may vary for specific markers and complement batches. Lysis will release the cell contents into the environment which contains your negatively selected cells. Protocol 11. Negative cell selection by complement-mediated cell lysis Equipment and reagents • Monoclonal antibodies of choice (must be of complement-fixing isotype) • Complement source (rabbit or guinea-pig serum) . RPMI

• Centrifuge tubes • Benchtop centrifuge • Equipment and reagents analysis (see Chapter 2)

for FACScan

Method NB: Timing in this protocol is strict. 1. Incubate cells in centrifuge tubes at 2.5 x 106/ml in your medium of choice (e.g. RPMI) with the mAb at a saturating concentration (in most cases 1 ug/ml is sufficient) for 5 min at 37°C.

21

Magdalena Plebanski Protocol 11. Continued 2. Add fresh rabbit or guinea-pig serum as the complement source, 1 volume per 9 volumes of cells (i.e. 1/10 dilution) is usually appropriate. If known, use the optimal dilution titrated for your serum batch. Incubate for 45 min at 37°C. 3. Take an aliquot to assess cell viability (see Protocol 2) and to give a measure of lysis efficiency. 4. Centrifuge the cells at 600 g for 7 min at room temperature, with brake. Remove the supernatant, flick the pellet, and resuspend in RPMI. Repeat. 5. Take an aliquot to assess cell viability (see Protocol 2).a 6. Confirm the efficiency of your depletion by FACScan analysis with the appropriate markers (see Chapter 2). Remember, for the planning and interpretation of your FACScan analysis, that an antibody-binding step has already been performed on your cells. "Some dead cells will have been lost during washing in step 4. However, if too many dead cells for your experimental purpose are still present, eliminate them by Ficoll separation (see Protocol 4).

5.2.3 Panning and columns Adherence to antibody-coated plates or columns is also extensively used, particularly for negative selection. Depletion with optimized protocols is good (up to 90%) and may be enhanced to 100% by additional cycles. Some adherent cells may be non-specifically lost by binding to plastic or glass when following these protocols. The protocol described here assumes the separation of an adherent cell-free population, such as T cells. Protocol 12. Negative selection of human PBMCs by panning Equipment and reagents • Selected murine IgG mAb to a human cellsurface marker • 50 or 90 mm bacteriological-grade Petri dishes » PBS (see Protocol 2)

• Anti-mouse IgG . RPMI • RPMI 10% heat-inactivated FCS (R/10 medium, see Protocol 7) • Benchtop centrifuge and tubes

Method 1. Cover the bottom surface of the Petri dishes with 50 ug/ml anti-mouse antibody in PBS and incubate overnight (4°C or room temperature).3 2. Rinse the plates three times, gently, with medium (e.g. RPMI). 3. Discard the antibody solution and block non-specific binding sites by incubating for 1 h with R/10 medium, or block overnight at 4°C. 22

1: Preparation of lymphocytes 4. Incubate 2-10 x 106 cells/ml) with the specific mAb (normally 1 ug/ml) in R/10 or PBS with 10% heat-inactivated FCS at 4°C for 30 min. 5. Wash three times by centrifuging at 600 g for 7 min at room temperature, with brake. Resuspend in cold R/10 to give a cell concentration of 5-10 x 106/ml. 6. Discard the R/10 from plate and add mAb-coated cells at 5-10 x 106/ml. Add cells in the minimal volume that will still safely cover the surface of the Petri dish (for 90 mm Petri dishes this is 3.5 ml, and for 50 mm it is 2 ml). 7. Incubate at 4°C on a flat surface for 1-2 h. 8. Recover cells which have not bound to the antibody-coated plate. Swirl and gently tip the plate and collect the floating cells with a pastette. Additional cells can be recovered by adding (gently) more R/10 to the plate and repeating this procedure. 9. Wash the negatively selected cells at 600 g for 7 min at room temperature, no brake. Resuspend in the appropriate tissue-culture medium. Viability can be assessed by following Protocol 2 and phenotype confirmed by FACScan analysis (see Chapter 2). "You can leave such prepared plates for up to 7 days in the fridge in a humidified container.

Commercially available columns pre-coated with m Abs of the appropriate specificity, which deplete a variety of common lymphoid and PAPC populations, work on the same principle and are usually simple and reliable. However, they are expensive. Nylon-wool columns for the isolation of T cells may provide a cheaper alternative. This classic empirical method relies on the adherence of B cells, pre-B cells, monocytes/macrophages, and dendritic cells, as well as dead cells to the nylon wool. NK and T cells will not bind, and may thus be enriched compared to other cell types. Minor contaminating cells not removed by the column may be subsequently depleted by magnetic beads (see Section 5.2.4). Protocol 13. T-cell purification by a nylon-wool column Equipment and reagents • Nylon wool • 10 ml plastic syringe

. RPMI with 10%FCS(R/10 medium, see Protocol 7)

Method 1. Wash the nylon wool by boiling it for 5-10 min in four changes of distilled water. 2. Pack it into 10 ml plastic syringe up to the 5 ml mark (0.6 g wool/ syringe). 23

Magdalena Plebanski Protocol 13. Continued 3. Pass 20 ml R/10 medium through the nylon wool. Leave for 15 min at 37°C in R/10. 4. Load the column with 108 cells in 1 ml R/10 (e.g. PBMCs or spleen cells) and incubate at 37°C for 30 min. 5. Elute the T cells and NK cells by flushing through with warm R/10.

5.2.4 Magnetic beads Cell resetting with ferric oxide beads containing maghemite (magnetic beads), which can be attracted by a magnet, allows for the quick and efficient recovery of cell subpopulations. Selective binding of beads occurs if they have a specific mAb coupled to them (direct method). Alternatively, the mAb may be allowed to bind first to the cells, and then beads are applied which bind to the mAb (anti-murine IgG coupled beads are generally used) (indirect method). Positive selection with ferric beads can be performed by following the standard protocol and then eluting the cells from the beads. Purchasing beads for large-scale fractionation can be very expensive. Making your own beads is possible, but laborious. They are thus not a good option for largescale cell depletions (>5 X 107 cells), but they are an excellent choice for the quick recovery or depletion of low numbers of cells. Commercially available beads (Dynabeads M-450 from Dynal) come in a standard size of 4 uM in diameter and thus are individually visible under 10 X magnification. Magnets are also available with holders for Eppendorf tubes, or 5-15 ml laboratory plastic tubes, but any magnet can be used. Choose reagents according to the scale of your purification. Protocol 14 gives the method for indirect negative (steps 1-6) and positive selection (steps 1-9). Steps 3-9 can be used for the direct method. Protocol 14. Positive and negative cell selection using magnetic beads Equipment and reagents • Monoclonal antibody (mAb) to the cellsurface marker of choice (unmodified or biotinylated) • Magnet • Tubes to fit the magnet • Detachabeads (Dynal)"

• Maghemite beads (Dynabeads, Dynal) conjugated with anti-lg (recognizing your mAb of choice) or conjugated to streptavidin if your first mAb is biotinylated . RPMI with 10%FCS(R/10 medium, see Protocol 7)

Method 1. Incubate cells (106-107/ml in R/10) with a saturating concentration of the mAb antibody (1 (ug/ml is usually sufficient) for 30 minutes at 4°C.

24

1: Preparation of lymphocytes 2. Wash unbound antibody off the cells by centrifuging at 600 g for 7 min, at 4°C, with brake. Discard the supernatant (in some cases this mAb solution can be kept to restain cells). Flick the pellet, then resuspend the cells in R/10 and wash again. Finally resuspend at 107-5 x 107/ml in a transparent tube, which will then be easily applied to the magnet. 3. Wash the appropriate number of immunomagnetic beads (5 beads per cell you wish to select or deplete).b To do this transfer the beads to a transparent tube (e.g. Eppendorf or FACScan Falcon tube) and apply to a magnet for 1-2 min. Remove the supernatant with a pastette, taking care not to remove the beads that are being held by the magnet. Top the tube up with R/10, take off the magnet, close the tube, and mix the beads by inversion. Repeat twice. Resuspend in R/10 at 108 beads/ml. 4. Add the beads to the cells. Keep to a small total volume (0.5-1 ml) and, if necessary, use more than one tube. Incubate at 4°C for 45 min with gentle shaking or rotation (enough to prevent the beads and cells from settling to the bottom of the tube by gravity and thus encourage cell-bead interaction, but not strong enough to disrupt this interaction). 5. Apply the bead/cell mixture to the magnet for 2-3 minutes. Beads and bead-bound cells will be held by the magnet on the side of the tube. Transfer the unbound cells to a fresh tube, and apply again to the magnet. Repeat this process a further time with the unbound cells in another fresh tube in order to eliminate beads and bead-bound cells (negatively selected cells). 6. To recover cells bound to beads wash them first from unbound cells by resuspending them in cold R/10 and applying another two times to the magnet. 7. Resuspend the bound cells at a concentration of 107-5 x 107/ml in R/10 at room temperature, either by estimating this concentration or counting an aliquot of your bead/cell mix under the microscope (40 x magnification). 8. Add Detachabeads" at 100 (ul/ml to the cell/bead mix and incubate for 45 min at room temperature with gentle mixing. 9. Apply to the magnet and recover the unbound cells as in step 5. 10. Assess cell numbers and viability (see Protocol 2), and surface phenotype by FACScan analysis (see Chapter 2). " Detachabeads is an antibody to IgG which changes its conformation causing it to release the cells. " If the mAb used with the cells is murine IgG use anti-mouse IgG-coupled beads. If your mAb is biotinylated, you can use streptavidin-coated beads.

25

Magdalena Plebanski 5.2.5 Cell sorting The fluorescence-activated cell sorter (FACS) can be used for the analysis of lymphocyte subpopulations (as outlined in Chapters 6 and 9). This machine electronically detects and quantifies cells with specific fluorescence. The FACS can also be used for the isolation of cell subpopulations bearing a particular surface marker. Thus, cells are stained with a fluorochromelabelled mAb and are then applied to the FACS machine as if for analysis. Currently, up to five different fluorescent markers can be used. Particularly precise selection criteria can thus be employed. Changes in polarity influence the direction of a stream of cells contained in electronically charged droplets. Cells of the required staining characteristics can be selected using appropriate software and are given appropriate charges automatically. Droplets with positively charged cells will be diverted to one tube and those with negatively charged cells into another. Depending on the software, intricate selection criteria can be used on the basis of this simple principle. Isolation of a particular subpopulation may be slow, since cells are selected one by one. It can take 2-8 hours to recover 107 cells. To maintain sterility it is possible, in most sorters, to fit a 0.2 um Millipore filter into the sheath fluidsupply line and then flush through this filter with 10 ml of absolute ethanol (taking care that no alcohol gets into the sheath reservoir by clamping it off beforehand). Then the alcohol is washed off by extensive washing with sterile sheath fluid. Cell sterility during staining is maintained conventionally, using sterile reagents and a tissue-culture hood. Sterile tubes are used for collecting FACS-derived cell fractions. When using FACS to isolate cell subpopulations from culture, note that debris, particularly aggregated dead cells, may block the orifice of the nozzle that takes up the input cells. This will stop the sorting process. Dead-cell aggregates can be allowed to settle to the bottom of a tube and transferred to a fresh tube for sorting. If cell death is extensive consider removing them with a Ficoll gradient (see Protocol 4). When rare cells are being isolated the infrequent droplets collected may dry out. To prevent this, collect the deflected droplets directly into an appropriate fluid (e.g. pH-controlled medium). The presence of 10% serum will help to minimize cell loss through non-specific adherence to the collecting tube. Before attempting to use the FACS machine for cell sorting it is advisable to familiarize yourself with the use of the FACS machine and software for analysis.

Acknowledgement The author wishes to thank Carolyn Hannan for her helpful comments on this chapter. 26

2

Immunohistochemistry of lymphoid organs SIMON C. BIDDOLPH and KEVIN C. GATTER

1. Introduction Immunohistochemistry is a technique for localizing and identifying cellular or tissue components (antigens) by means of an antigen-antibody interaction, the site of the interaction being identified by the application of an appropriate labelling system. This technique plays an important part in diagnostic cellular pathology and biomedical research, and this chapter describes in detail the preparation of lymphoid cells and tissues for immunohistochemistry. It outlines the most frequently used labelling systems, and gives full details of the systems we find most useful in our laboratory. The distribution of different lymphocyte subpopulations in lymphoid tissue is also described.

2. Preparation of lymphoid cells and tissues for immunohistochemistry Immunohistochemical procedures can be applied to cytological preparations (cell smears, cytocentrifuge preparations, and cell imprints), frozen sections, paraffin sections, and resin sections. Procedures used on resin sections using light microscopy are adequately documented elsewhere (1), as are all those used in electron microscopy (2).

2.1 Slide adhesive Whichever type of preparation is made, the cells and tissues will be supported on a glass slide, but the very nature of the immunohistochemical procedure greatly increases the chance of the specimen being lost from the slide. Before one embarks on any of the subsequent preparative techniques, it is essential that there is an available supply of slides treated with adhesive, as described in Protocol 1. Coated slides are available commercially (Speci-Microsystems Ltd., UK).

Simon C. Biddolph and Kevin C. Gatter Protocol 1. Coating slides with adhesivea Equipment and reagents • VECTABOND™ reagent (Vector Laboratories Ltd) in 350 ml acetoneb

• 2% Decon (Decon Ltd) in distilled water

Method 1. Arrange the slides in a slide-rack and wash in 2% Decon for 5 min at room temperature. 2. Wash the slides in running tap water for 5 min. 3. Wash the slides in distilled water for 5 min at room temperature. 4. Place the slides in acetone for 5 min at room temperature. 5. Place the slides in the VECTABOND™ mixture for 5 min at room temperature. 6. Wash the slides in running tap water for 5 min. 7. Wash the slides in distilled water for 5 min at room temperature. 8. Shake the slides dry and incubate at 37°C overnight. When cool, place slides in boxes and store indefinitely at room temperature. ' Modified from the manufacturer's instructions, with permission. "This mixture is sufficient to coat 500 slides.

2.2 Choice of preparation A major consideration concerns the processing of preparations; i.e. to preserve the antigens which are to be demonstrated, whilst simultaneously preserving the cell and tissue morphology to allow an accurate interpretation of the results. From a morphological view, it is better to fix and process tissues through to paraffin sections. However, the range of antigens that can be demonstrated in paraffin sections is restricted when compared to that achieved in frozen sections and cytological preparations. Ultimately, the decision to use a particular preparation rests on which antigen one is hoping to demonstrate, and on which type of preparation the antibody, against that antigen, has been used successfully. Commercial antibody suppliers should ideally give this information. If developing or assessing an antibody, all the different types of preparation must be examined in order to establish what type of preparative technique can be used on a particular specimen type (see Table 1). Fresh tissue is best for demonstrating the broadest spectrum of antigens (see Table 1). After imprints have been taken (see Section 2.5), a portion can be taken for frozen sections (see Section 2.6), and the remainder placed in fixative for processing to produce paraffin sections (see Section 2.7). 28

2: Immunohistochemistry oflymphoid organs Table 1. Permissible preparative techniques

Fresh tissue Fixed tissue Cellular fluid"

FNA"

Cell smear

Cytocentrifuge

Imprint

Frozen section

Paraffin section

No No Yes Yes

No No Yes Yes

Yes No No No

Yes" No

Yesb Yesc Yesf Yesf

Yese Yese

" After subsequent freezing. * After subsequent fixation and processing to paraffin wax. c After subsequent processing to paraffin wax. d This term covers cell-lines in vitro and body fluids. "After subsequent centrifugation and freezing. 'After subsequent centrifugation, fixation, and processing to paraffin wax. 9 Fine-needle aspirate.

Thus, arrangements should be made to receive a specimen in an optimal state (see Section 2.3), so that the appropriate study can be carried out for a particular antigen.

2.3 Transport of specimen Under ideal circumstances, the specimen will arrive in the laboratory without delay. In the event of a delay of a few hours, there is no appreciable deterioration if the specimen is kept refrigerated at 4°C. Any longer than this and autolysis will lead to antigen loss or diffusion, and morphology will be compromised. Various transport media can be used to delay this deterioration: • saline-moistened gauze, Carmichael's medium (3), and Michel's transport medium (4) for fresh tissue; • fixative of choice for fixed tissue; • RPMI-1640 tissue culture medium (Gibco BRL) for cellular fluids and fineneedle aspirates (FNAs).

2.4 Cell smear and cytocentrifuge preparations These preparations can be made from cellular fluids (in vitro cell lines and body fluids) and FNAs. Cytocentrifuge preparations are preferred to cell smears, because a larger number can be made from any one specimen and the concentration of cells into a smaller area makes the subsequent staining more economical and the analysis quicker. If the specimen is rich in cells, it can be advantageous to prepare cell blocks for frozen and paraffin sections (see steps 2 (c) and (d), Protocol 2). 29

Simon C. Biddolph and Kevin C. Gatter Protocol 2. Cell smear and cytocentrifuge preparations from cellular fluids and fine-needle aspirates Equipment and reagents • Centrifuge and plastic centrifuge tubes • Cytocentrifuge and cuvettes (Shandon Scientific Ltd.) • Haemocytometer . VECTABOND-coated slide (see Protocol 1) • 10% (v/v) fetal calf serum (FCS) in RPMI1640 cell culture medium (Gibco BRL)

. DAKO pen (DAKO) • Neutral-buffered formalin: 10% (v/v) formaldehyde, 29 mM NaH2PO4H2O, 46 mM Na2HP04 • 4% agarose • Acetonea

Method 1. Transfer the specimen to a plastic centrifuge tube and centrifuge at 120 g for 10 min. 2. Drain off the supernatant and: (a) For cytocentrifuge preparations, resuspend the pellet in 2 ml 10% PCS in RPMI-1640 medium. Using the haemocytometer, determine the cellularity and adjust the concentration of cells to between 5 x 105 and 106 cells/ml with FCS/RPMI medium. Proceed to step 3. (b) For cell smears, place a pea-sized amount of the specimen on to a coated slide, and with a second slide apply pressure to the specimen to spread it evenly and quickly over both slides. Proceed to step 4. (c) For frozen sections, proceed to Section 2.6. (d) For paraffin sections, fix the cells in neutral-buffered formalin (see Section 2.7.1) for 12 h, centrifuge at 120 g for 10 min, drain off the fixative, and pour molten 4% agarose on to the pellet. Centrifuge at 120 g for 10 min and allow the agarose to set. Remove the agarose pellet and proceed to Section 2.7.3. 3. Place 250 ul of the resuspended cells into each of 12 cytocentrifuge cuvettes and centrifuge at 120 g for 10 min. 4. Air-dry the cell smears and the cytocentrifuge preparations at room temperature for 2 h.b 5. Fix for 10 min in acetonea at room temperature, air-dry for a further 10 min, circle the area of interest with the DAKO pen,c and proceed with immunostainingd(see Section 3). •Acetone is our fixative of choice for the subsequent immunostaining of cytological preparations. Better morphology is seen if preparations are fixed for 2 min in acetone:methanol:40% formaldehyde (19/19/2 by vol.) or acetone:PBS:formalin (5). bLymphoid markers are best shown in cytological preparations that have been air-dried (6). 'This applies a limiting line around the area of interest which prevents the spread of aqueous solutions. d lf immunostaining is not to be performed immediately, wrap the slides in foil after fixation and store at -20°C. Prior to staining, allow the slides to reach room temperature before removing the foil. This prevents condensation forming, which can lead to antigen diffusion.

30

2: Immunohistochemistry of lymphoid organs

2.5 Cell imprints ('dabs' or 'touch preparations') On receipt of a fresh lymphoid specimen, making an imprint is the first preparation that can be carried out. It involves the direct transfer of cells from a freshly cut surface of the tissue on to a slide, and is a quick and simple method involving no specialized equipment. Individual cells or clumps of cells will be seen and the preparation is similar in nature to a cell smear. Immunohistochemistry can be successfully carried out and individual cellular morphology is well preserved, but tissue morphology is better seen in frozen and paraffin sections. The freshly cut surface is lightly blotted with soft and absorbent paper. It is best to grasp the back of the specimen with forceps and lightly, and squarely, touch the specimen on to a coated slide (see Protocol 1). Avoid any sideways movement as this will disrupt the cells. The slides should be dried at room temperature and fixed with acetone prior to immunostaining (see Protocol 2, step 5).

2.6 Frozen sections ('cryostat sections') Freezing tissue provides a hardened specimen for sectioning, excellent preservation of antigens, and moderately good morphological preservation. Ideally, an extremely rapid cooling rate should be used to limit cellular damage caused by ice-crystal formation. The sample size and choice of freezing process are the most important considerations. We freeze specimens no larger than 10 X 10 X 5 mm, using liquid nitrogen at a temperature of -196 °C. Once frozen the specimen can be either sectioned immediately in a cryostat, or stored in a -70 °C freezer (or liquid nitrogen) for sectioning at a later date. To limit the desiccant effects of these cold storage temperatures, we entirely cover the specimen in OCT (Optimum Cutting Temperature compound, Miles Scientific), and wrap it in cold foil or place it in a polyethylene storage tube suited to extreme cold temperatures. OCT should also be used to surround and support the specimen for sectioning in the cryostat. Frozen sections can also be made from highly cellular fluids and FNAs. After centrifugation, the pellet of cells can be carefully frozen and treated in a similar way to tissue (see Protocol 2, step 2 (c) ). 2.6.1 Considerations in the sectioning and fixing of frozen sections To produce high-quality frozen sections safely from lymphoid tissues, several points should be considered: (a) Frozen sections should not be prepared until a risk assessment into the presence of infective agents has been carried out. Betapropriolactone destroys the infectivity of human immunodeficiency virus without compromising the antigenicity (7), but cutting tuberculous specimens may have to be prohibited if suitable containment procedures are unavailable. 31

Simon C. Biddolph and Kevin C. Garter (b) The optimal temperature for cutting different tissues varies; -20 °C is best for bone-marrow because of the need to cool any bone running through the sample, although it is advisable to remove any obvious bone prior to sectioning. Gut-associated lymphoid tissue (GALT), lymph node, thymus, and tonsil are best at -15 °C. Liver and spleen will shatter unless the temperature is raised to -10 °C within the cryostat. (c) Sections should be cut at 6 u.m on to coated slides (see Protocol 1), and air-dried for 6-12 h. Sections should be fixed in acetone for 10 min at room temperature, and circled with a DAKO pen prior to immunostaining or storage (see Protocol 2, step 5).

2.7 Paraffin sections Fixing and processing tissues for paraffin-wax sections gives the best morphological preservation when compared to cytological preparations and frozen sections. Paraffin acts as a support for tissue, thus allowing thin sections to be cut and viewed under the microscope. Unfortunately, the processes used to produce paraffin sections can lead to the masking or destruction of antigens. Nevertheless, a wide range of antigens is still detectable, and commercial antibody suppliers are constantly striving to produce antibodies for use in fixedand paraffin-processed tissue (see Table 2), Numerous techniques have been developed to enable us to 'retrieve' antigens that previously were believed to have been lost entirely in the fixing and processing stages (see Section 2.7.7). 2.7.1 Fixation The primary objective in the fixation of tissue destined for paraffin sections is to stabilize the cell contents and tissues in as near a life-like state as possible through all the processing stages, whereby water is removed and paraffin wax is infiltrated into the specimen. A large variety of fixatives is available, but no single fixative can preserve every single tissue component. Formaldehydebased fixatives are the most widely used and, although the exact mechanism of their fixation effect is not known, it is thought that methylene bridges are formed between amino groups on cellular proteins. This, in effect, creates a gel that holds the cellular constituents in place. We use formol acetic acid for the fixation of bone-marrow trephines—as it has a decalcifying effect that does not compromise antigenicity (see Section 2.7.2)—and neutral-buffered formalin for the fixation of all other lymphoid tissues prior to the production of paraffin sections: • Formol acetic acid—(10% (v/v) formaldehyde, 0.15 M NaCl, 2% (v/v) glacial acetic acid). The bone-marrow trephine should be placed in at least 20 times its own volume of fixative. Large spicules of bone in the specimen should be carefully removed (see Section 2.6.1 (b) ).The solution should be changed three times over 2 days to allow proper fixation and decalcification to occur. 32

2: Immunohistochemistry oflymphoid organs • Neutral-buffered formalin—(10% (v/v) formaldehyde, 29 mM NaH2PO4.H2O, 46 mM Na2HPO4).Tissue should be cut into slices 3 mm thick and placed in at least 20 times its own volume of fixative. Optimal fixation occurs between 12 and 24 h (8), but tissue can be kept in this solution for many years. 2.7.2 Decalcification Areas of calcification in tissue can cause problems when sectioning. Large areas of bone should be excised away, after fixation, from the area of interest. Smaller foci can be decalcified by fixation in formol acetic acid (see Section 2.7.1). 2.7.3 Processing After fixation, the tissue, or cells supported by solid agarose (see Protocol 2, step 2 (d)), must be taken through a graded series of alcohols and an intermediate agent (xylene) to allow infiltration by paraffin wax. This is most conveniently carried out on an automatic tissue processor (e.g. Shandon Scientific Ltd.) using 1.5 h for each of the 12 steps. Increasing the processing temperature from ambient to 45 °C for all stages up to that of wax infiltration benefits immunohistochemical staining (8). The immunoreactivity of tissue in paraffin wax is unaffected by long-term storage, therefore enabling retrospective studies to be carried out. 2.7.4 Sectioning, section drying, and storage Paraffin blocks should be cut at 4-5 |xm on a microtome, by an experienced histologist. The sections must be put on to coated slides (see Protocol 1) and dried overnight at 37 °C. The sections can be heated in a 60 °C oven for 1 h if they need to be stained quickly. The use of a hot-plate is not recommended because of the uneven temperatures across the plate (8). Our experience is that unstained sections can be stored at room temperatures for many years without losing immunoreactivity. 2.7.5 Rehydrating sections The paraffin wax must be completely removed from the section prior to staining. We use three changes of xylene, each of 5 min. The xylene is removed using a graded series of alcohols followed by a thorough wash in cold, running tap water and then transferred to distilled water to await staining. Less toxic alternatives to xylene are available, e.g. Citroclear (HD Supplies). 2.7.6 Blocking endogenous enzymes Enzymes are commonly used as labels, either attached directly or indirectly to the antibody being applied to detect the antigen (see Section 3.2). If enzymes exist in the cells or tissues that are the same or similar to those used as the label in the staining technique, they must be removed—otherwise they will act on the substrate used to locate the enzyme label and a false-positive result will 33

Simon C. Biddolph and Kevin C. Gatter be produced. This is important at this stage because we have found that the best time to remove endogenous peroxidases (pseudoperoxidase, myeloperoxidase, and peroxidase in erythrocytes, granulocytes, and eosinophils, respectively (9)), when using horseradish peroxidase as a label (see Section 3.2.1), is after paraffin section rehydration and before any subsequent stages. We expose the rehydrated sections to 0.5% (2 vol.) hydrogen peroxide in methanol for 20 min at room temperature (see Protocol 3, step 3), or 3% (10 vol.) hydrogen peroxide in distilled water for 20 min at room temperature. This treatment is too harsh for frozen sections and, although alternative treatments are available (9), we either ignore the more granular falsepositivity and carefully compare the test section to a negative control section, or use a different enzyme label such as alkaline phosphatase (see Section 3.1.3). 2.7.7 Antigen retrieval Some antigens were thought to be hidden by, or even destroyed, by formaldehyde-based fixatives and/or paraffin processing. However, methods have been devised to unmask, or retrieve, some antigens using proteolytic enzyme digestion. The use of many antibodies on paraffin sections continued to be limited until the arrival, in the early 1990s, of the heat-mediated antigen retrieval technique (10). Both methods of retrieval are used today, but the latter proves to be the most effective over a broad range of antigens. Some antigens do not need to be retrieved as they are unaffected by fixation or processing, and some, to date, can only be detected in cytological preparations or in frozen sections. Commercial antibody suppliers give information in their catalogues as to whether their products are suitable for different types of preparation. Table 2 shows the antibodies we use in formalin-fixed, paraffin-embedded sections, with our preferred choice of pre-treatment. i. Proteolytic enzyme digestion With formalin fixation, methylene bridges are formed between amino groups. Digestion with proteolytic enzymes can remove this cross-linking, which prevents access to the antigenic sites by the antibody. The time for digestion varies with the nature and time of fixation used, and the antigen being retrieved. The antigen itself can be digested if the times and conditions are not carefully controlled. Unfortunately, there is no one enzyme and time of digestion that can be universally applied. Protocol 3 gives details for using the two most useful proteolytic enzymes. ii. Heat-mediated antigen retrieval (HMAR) This method involves the exposure of paraffin sections to high temperatures in aqueous salt or protein denaturant solutions. Although the exact mechanism of HMAR is unclear, it is believed that the combination of high temperature and exposure to a salt solution may chelate or precipitate 34

2: Immunohistochemistry oflymphoid organs calcium or other divalent metal cations, which otherwise mask antigenic sites by complexing with proteins during formaldehyde fixation (11). Different solutions have been investigated and, although no single solution has been found to be universally optimal, we use either a sodium citrate solution or—most regularly—a Tris-EDTA disodium salt solution (pH 9.0) depending on the antigen we are retrieving or the antibody we are using (see Table 2). Protocol 3. Proteolytic enzyme digestion of formalin-fixed and paraffin-processed sections Equipment and reagents • 0.5% (2 vol.) H2O2 in methanol (for a peroxidase-based labelling system) • Trypsin solution: 0.1% (w/v) trypsin type II, crude from porcine pancreas (ICN Biochemicals) in 0.1% CaCI2 (w/v) pH 7.8, at 37 °C'

• TBS (Tris-buffered saline): 50 mM Trisbase pH 7.6, 0.15 M NaCI • Protease solution: 0.0125% (w/v) protease type XXIV, bacterial (Sigma) in TBSa

Method 1. Cut 4 um paraffin sections on to coated slides (see Protocol 1) and dry overnight at 37°C. De-wax and rehydrate to running tap water and place in distilled water. 2. If using a peroxidase-based labelling system, place sections in 0.5% (2 vol.) H202 in methanol for 20 min at room temperature (see Section 2.7.6). Wash the slides in running tap water and place in distilled water at room temperature. Otherwise omit this step. 3. Pre-warm the slides by immersion in distilled water at 37°C for 30 min. 4. Place the slides in the pre-warmed proteolytic enzyme solution.6 5. Halt the digestion by washing the slides in running tap water for 5 min, and place in distilled water at room temperature. " Pre-warm this solution to 37 °C. "The optimum time for immersion in this solution differs between antigens, antibodies, and the length of fixation Times range from 5 to 30 min and must be determined by trial and error.

HMAR has the following advantages over proteolytic enzyme digestion: • Uniform heating times can be used to retrieve antigens, regardless of the length of time in fixative, whereas enzyme digestion has to be matched to fixation time. • A much greater number of antigens are retrieved. • Some antigens once thought to be completely lost can now be retrieved. 35

Simon C. Biddolph and Kevin C. Garter • The staining of many antigens can be enhanced over and above that obtained post-digestion. • The detection threshold is lowered. This increased sensitivity means that antibodies can be used in a more dilute form. • Non-specific background staining is reduced. However, not all antigens are retrieved optimally using HMAR, so that proteolytic enzyme digestion can still play a part. Also, when using a biotinylated labelling system (see Section 3.1.4), one should bear in mind that the exposure of endogenous biotin is enhanced by HMAR (12). A microwave oven was first used for antigen retrieval (10) and is ideal for a small number of slides (see Protocol 4), but it may give inconsistent results because of its hot and cold spots: for large numbers of slides and more consistent retrieval, we prefer to use a pressure-cooker (13), as shown in Protocol 5, which is also more gentle to the sections. Protocol 4. Heat-mediated antigen retrieval using a microwave oven Equipment and reagents • 850 W domestic microwave oven • Sodium citrate antigen-retrieval solution: 10 mM trisodium citrate dihydrate pH 6.0 • Tris-EDTA antigen-retrieval solution: 50 mM Tris, 2 mM EDTA disodium salt, pH 9.0

• 700 ml microwave-proof container* (Sealtight foodsaver, ADDIS) • Microwave-proof cling-film • Two glass slide-racks, each with 10 slots, enough to hold 20 slides back-to-back

Method 1. Follow Protocol 3, steps 1 and 2. 2. Place the slides back-to-back in the glass slide-racks6 and add enough antigen-retrieval solution of choice to cover the slides. Cover the container with microwave-proof cling-film and pierce the film. 3. Microwave for 5 min at 90% power,3 and check the fluid level. Top up the solution if necessary. 4. Microwave for a further 5 min at 90% power,3 and remove the container from the microwave. Carefully flush out the retrieval solution with cold, running tap water and transfer the slides to distilled water at room temperature. "Different size containers can be used, but the volumes of retrieval solution will then differ. Consequently, the optimal time and power levels should be performance-tested for optima! retrieval. ''The slide-racks should be full of slides at all times. Use blank slides to fill any gaps.

36

2: Immunohistochemistry of lymphoid organs Protocol 5. Heat-mediated antigen retrieval using a pressurecooker Equipment and reagents • Sodium citrate antigen-retrieval solution (see Protocol 4) • Tris-EDTA antigen-retrieval solution (see Protocol 4)

• Stainless-steel pressure-cookera (e.g. Prestige 'Rise n timer' model 6189. Operating pressure of 103 kPa/15 p.s.i.)

Method 1. Follow Protocol 3, steps 1 and 2. 2. Pour 2 litres of the antigen-retrieval solution into the pressure-cooker, place the lid loosely on the body of the pan and heat to boiling point. 3. Place the slidesb into the boiling buffer and seal the cooker. 4. Bring the cooker to pressure.a Heat at full pressure for 90 sec. 5. Remove the cooker from the heat source and place in a sink of cold water. Rinse the exterior of the cooker with cold, running tap water until the pressure has been released. 6. Remove the cooker lid and fill the cooker with cold, running tap water. Remove the slides and place in distilled water. "Follow the manufacturer's instructions for use of the pressure-cooker. b We use four slide racks at one time, 24 slides in each rack. Unlike with microwave retrieval, empty gaps in the rack do not need to be filled.

Table 2. Primary antibodiesa and antigen-retrieval method of choice for formalin-fixed and paraffin-processed specimens Antigen/CD"

No. clone

Supplier

Antigen-retrieval method

CD1a CD2 CD3 CD4 CD5 CD8 CD9 CD15 CD16 CD20 CD21 CD22 CD23 CD30 CD31 CD34

O10 MT910 PCa 1F6 4C7 C8/144B 72F6 C3D1 DJ130C L26 1F8 FPC1 MHM6 BerH2 JC/70A QBend10

Coulter DAKO DAKO NCf NC DAKO NC DAKO DAKO DAKO DAKO NC DAKO DAKO DAKO DAKO

HMAR Citrc HMAR TrEdd HMARTrEd HMAR TrEd HMAR Citr HMARTrEd HMAR TrEd HMAR TrEd HMARTrEd HMAR TrEd HMARTrEd HMARTrEd HMARTrEd HMAR TrEd HMAR TrEd HMAR TrEd

37

Simon C. Biddolph and Kevin C. Gutter Table 2. Continued Antigen/CDb CD35 CD41 CD42b CD43 CD44 CD45 CD45RA CD45RB CD45RO CD50 CD56 CD61 CD66 CD68

No. clone

BerMac-DRC 5B12 MM2/174 DF-T.1 DF1485 2B11 4KB5 PD7/26 UCHL1 KS128 1B6 Y2/51 Kat4c KP1 PGM1 CD71 H68.4 LN-2 CD74 CD75 LN-1 JCB117 CD79a 12E7 CD99 IgA 6E2C1 lgD26 IgD A57H - IgG IgM R1/69 bcl-2/124 bcl-2 Glycophorin A JC159 Glycophorin C Ret40f HLA class II CR3/43 Kappa A8B5 PC Lambda N10/2 PC Ki67 Ki67 PC Lysozyme Myeloperoxidase PC NP57 N'philh Elastase Plasma cell Vs38c S100 PC V. W.ifactor F8/86

Supplier

Antigen-retrieval method

DAKO DAKO DAKO DAKO DAKO DAKO DAKO DAKO DAKO DAKO NC DAKO DAKO DAKO DAKO BioGenex DAKO DAKO DAKO DAKO DAKO DAKO DAKO DAKO DAKO DAKO DAKO DAKO DAKO DAKO DAKO DAKO DAKO DAKO DAKO DAKO DAKO DAKO DAKO

ProtEnz9 ProtEnz HMAR Citr HMAR TrEd HMARTrEd Nil Nil Nil Nil HMARTrEd HMAR Citr HMAR TrEd HMARTrEd HMARTrEd HMARTrEd HMAR Citr HMAR TrEd HMAR TrEd HMAR TrEd HMARTrEd ProtEnz HMAR TrEd ProtEnz HMAR TrEd HMARTrEd Nil HMAR TrEd HMARTrEd HMARTrEd HMARTrEd HMARTrEd HMARTrEd HMAR TrEd HMARTrEd Nil Nil HMAR TrEd HMAR TrEd HMARTrEd

a Concentrated and lyophilized antibodies, once reconstituted, should be stored as 0.1 ml aliquots at -70°C. Pre-diluted antibodies and kits should be stored at 4°C. Avoid repeated thawing and freezing. * Cluster of differentiation. c Heat-mediated antigen retrieval in sodium citrate solution (see Protocol 4). d Heat-mediated antigen retrieval in Tris-EDTA solution (see Protocol 4). "Polyclonal antibody. 'Novocastra Laboratories Ltd. g Proteolytic enzyme (see Protocol 3). 'hNeutrophil. iVon Willebrand.

38

2: Immunohistochemistry of lymphoid organs

3. Immunohistochemical staining The aim of all immunohistochemical staining methods is to visualize accurately a particular antigen. This is achieved by using a specific antibody to the antigen, then visualizing the antibody. Many methods have been developed over the years, each with their own advantages and disadvantages. This section will look at these methods, the commonly used labels and their visualization, and the considerations in choosing a suitable combination of method and label when staining a particular preparation with a single antibody. Staining a preparation with multiple antibodies will also be considered. All the reagents involved in these methods are commercially available.

3.1 Immunohistochemical methods 3.1.1 Direct method This is the simplest and quickest of all the methods. It involves a one-step procedure whereby a label is conjugated directly to the antibody used against a given antigen, and the conjugate is applied to the specimen. However, this is the least sensitive of all the methods available, and the least versatile because the antibody cannot be used in other methods. A more sensitive variant, known as EPOS (enhanced polymer one-step— from DAKO), is available commercially and is gaining in popularity. However, not all antibodies are available in EPOS form, and it also suffers from a lack of versatility. 3.1.2 Indirect method Increased sensitivity and versatility is achieved in this method over the direct method. Unlabelled antibody (primary antibody) against a given antigen is applied to the preparation. A labelled secondary antibody, raised against the species of the primary one, is then applied. If using a large number of primaries of the same species, a single labelled secondary antibody can be used. This is the two-stage indirect method. Sensitivity is enhanced in the threestage method by the further application of a labelled antibody raised against the species in which the labelled secondary was raised. 3.1.3 Unlabelled antibody-enzyme complex method An enzyme label (horseradish peroxidase or alkaline phosphatase—see Section 3.2) and an antibody against the enzyme form a complex (peroxidase anti-peroxidase—PAP, and alkaline phosphatase anti-alkaline phosphatase— APAAP (14)). The antibody in the complex must be raised in the same species as that of the primary. A bridging antibody forms a link between the primary antibody and the complex. Sensitivity is considerably improved by repeating the bridging layer and the enzyme complex, particularly in the 39

Simon C, Biddolph and Kevin C. Gatter APAAP method. It is particularly useful for using on preparations where the endogenous peroxidase content is high, e.g. bone marrow and spleen, and also where the blocking methods (see Section 2.7.6) may destroy the specimen. However, we prefer not to use the APAAP method with primaries directed against nuclear antigens. Results are poor, which we hypothesize relates to poor penetration by the relatively large complexes (unpublished observations). 3.1.4 Avidin-biotin and streptavidin-biotin systems Avidin and streptavidin have a natural affinity for biotin, which is easily conjugated to antibodies and labels. The unlabelled primary is applied, followed by incubation with a biotinylated secondary antibody raised against the species in which the primary antibody was raised. Finally, labelled avidin or streptavidin are allowed to bind with the biotinylated secondary. Alternatively, avidin or streptavidin are allowed to complex with the biotinylated label, and this complex binds to the biotinylated secondary. Both systems are highly sensitive and the most popular methods in use today. The one disadvantage is the problem of endogenous biotin, which is most noticeable in frozen sections and paraffin sections treated with HMAR (see Section 2.7.7 («')). Liver, kidney, breast, and adipose tissue, as well as cells/tissues with high numbers of mitochondria (11), have high levels of endogenous biotin. The biotin can be effectively blocked using commercially available kits (DAKO and Vector Laboratories), which use incubations in 0.1% avidin followed by 0.01% biotin. 3.1.5 Biotinylated tyramine method This method, first used for enhancing ELISA and Western blotting (15) and subsequently adapted for immunohistochemistry (16), produces significantly increased sensitivity when compared to the avidin/streptavidin-biotin systems. The method uses horseradish peroxidase-labelled streptavidin, or the streptavidin-biotin complex, as the third step after the application of primary and biotinylated secondary antibodies (see Section 3.1.4), followed by the application of biotinylated tyramine. The horseradish peroxidase catalyses the deposition of biotinylated tyramine at the sites of immunoreactivity, allowing the increased amounts of biotin to be detected by further addition of labelled avidin or streptavidin. The method allows the detection of some antigens thought to be undetectable in paraffin sections, even after the use of HMAR (17), and also the extensive dilution of primary antibodies. Commercial kits are available— TSA (Du Pont) and CSA (DAKO)—or the biotinylated tyramine can be made in the laboratory (16,17). To date, we have limited experience of this method, but it will certainly be used more in the future unless new primary antibodies and antigen-retrieval solutions are developed. 40

2: Immunohistochemistry oflymphoid organs

3.2 Labels It is essential in all immunohistochemical staining methods to use labels to visualize the antigen-antibody reaction. Enzymes are the most widely used labels because, with the addition of a substrate and a chromogen, different coloured and stable reaction products are visible using light microscopy. Fluorescent labels are also used, but they require more specialized instrumentation to be seen (see Section 3.2.3).

3.2.1 Horseradish peroxidase (HRP) This is the most widely used enzyme label. Hydrogen peroxide acts as the substrate, and different chromogens can be used to produce a variety of different coloured reaction products: • 3,3'-Diaminobenzidine tetrahydrochloride (DAB) yields a dark-brown reaction product, insoluble in organic solvents. See Protocol 6, Method A and Figures 1 A-F, H, and /. The colour can be intensified (see Protocol 6, step 2). • 3-Amino-9-ethylcarbazole (AEC) yields a red reaction product, which is soluble in organic solvents and must be mounted in an aqueous mountant. See Protocol 6, Method B. • Hanker-Yates reagent (18) yields a blue end product, insoluble in organic solvents. Protocol B. Demonstration of horseradish peroxidase Equipment and reagents • TBS (see Protocol 3) . 0.05% DABa (w/v) (3,3'-diaminobenzidine tetrahydrochloride} in TBS • AEC (3-amino 9-ethyl carbazole) • DMF (N,N'-dimethyl formamide) • 0.2 M acetate buffer pH 5.0

« 3% (10 vol.) hydrogen peroxide in distilled water • Mayer's haematoxylin • Xylene-based mountant (e.g. DePeX, BDH) • Aqueous mountant (e.g. Aquamount, BDH)

A. Brown reaction product 1. After immunostaining, wash the sections in two changes of TBS over 5 min. 2. Immediately prior to use, add 160 ul 3% hydrogen peroxide to 50 ml of the DAB solution and incubate the slides in this solution for 4 min at room temperature.b 3. Wash the slides in cold, running tap water for 5 min. 4. Counterstain in Mayer's haematoxylin.c 5. Dehydrate, clear, and mount the slides in a xylene-based mountant. 41

Simon C. Biddolph and Kevin C. Gatter Protocol 6.

Continued

B. Red reaction product 1. After immunostaining, wash the sections in two changes of acetate buffer over 5 min. 2. Immediately prior to use, add 10 mg AEC to 2.5 ml DMF in a glass tube and mix well. 3. In a separate tube, add 0.2 ml 3% (10 vol.) hydrogen peroxide to 50 ml acetate buffer. Mix well and add to the solution made in step 2. Mix well. 4. Filter the mixture on to the sections and incubate at room temperature for 15-20 min.c 5. Wash the slides in cold, running tap water for 5 min. 6. Counterstain in Mayer's haematoxylin.c 7. Wash the slides in distilled water and mount the sections in an aqueous mountant. aWear gloves when handling DAB. To lessen the need to handle the powder, add 0.48 g DAB to 20 ml TBS. Divide into 1 ml aliquots and freeze. To use, thaw out an aliquot, add 49 ml TBS and 160 ul of 3% (10 vol.) hydrogen peroxide. Alternatively, DAB tablets are commercially available (Sigma). bThe strength of the end product can be intensified directly after this stage by incubating the slides in a 0.5% (w/v) copper sulfate in 1% (w/v) sodium chloride solution for 5 min. The end product turns black. Proceed from step 3. c Observe and control the staining microscopically.

3.2.2 Alkaline phosphatase This is the most widely used, alternative enzyme label to HRP. The major advantage is in its use as a label on preparations high in endogenous peroxidase or where blocking methods are harmful to the preparation. Thus, it is our method of choice for cytological specimens, bone-marrow aspirates/ trephines, spleen, and frozen sections. Endogenous alkaline phosphatase in bone, liver, and kidney is easily blocked by the addition of levamisole at the visualization stage. Intestinal and placental alkaline phosphatase are more resistant. Napthol phosphate esters act as substrates for this enzyme. They are hydrolysed to form phosphates, and phenolic compounds that couple with diazonium salts (used as chromogens) to produce coloured azo dyes. Various combinations of substrate and chromogen can be used to yield different coloured reaction products: • Napthol AS-BI phosphate and New Fuchsin yield a red reaction product that is soluble in alcohol, but preparations can be mounted in a xylenebased mountant. See Protocol 7, Method A, and Figure 1G. This is a particularly intense reaction product and is ideal for photography. 42

2: Immunohistochemistry of lymphoid organs • Napthol AS-MX phosphate and Fast-Blue BB yield a blue reaction product that must be mounted in an aqueous mountant. See Protocol 7, Method B. (Substituting Fast-Red TR for Fast-Blue BB yields a soluble, red reaction product.) Protocol 7. Demonstration of alkaline phosphatase Equipment and reagents TBS (see Protocol 3) 5% New Fuchsin in 2 M HCI 4% sodium nitrite in distilled water—freshly prepared Napthol AS-BI phosphate-sodium salt Napthol AS-MX phosphate DMF (see Protocol 6)

Tris buffer: 0.05 M Trisbase pH 8.5 1 M levamisole (in distilled water) Mayer's haematoxylin 1% Neutral Red Xylene-based mountant (e.g. DePeX, BDH) Aqueous mountant (e.g. Aquamount, BDH)

A. Red reaction product 1. After immunostaining, wash the sections in two changes of TBS over 5 min. 2. In a glass tube add 50 mg of Napthol AS-BI phosphate to 0.6 ml of DMF and mix well. 3. In a separate tube, add 0.2 ml of 5% New Fuchsin in 2 M HCI to 0.5 ml of freshly prepared 4% (w/v) sodium nitrite. Mix well for 1 min. 4. Add 100 ul of levamisole to 100 ml Tris buffer pH 8.5. Mix well. 5. Add the mixture in step 3 to that in step 4. Mix well. Add the mixture in step 2, mix well, and filter on to the sections. Incubate for 10-30 mina at room temperature. 6. Wash the slides well in distilled water. 7. Counterstain with Mayer's haematoxylin.a 8. Shake the slides dry and lay the slides on a 60°C hot-plate until the sections are dry. 9. Mount the slides in a xylene-based mountant. B. Blue reaction product 1. After immunostaining, wash the sections in two changes of TBS over 5 min. 2. Add 10 ul levamisole to 9.8 ml of Tris buffer pH 8.5. 3. In a glass tube, add 2 mg of Napthol AS-MX phosphate to 0.2 ml of DMF. Mix well. 4. Add the mixture in step 3 to that in step 2. Mix well. Add 10 mg of FastBlue BB.b Filter on to the sections and incubate for 10-20 mina at room temperature. 43

Simon C. Biddolph and Kevin C. Gatter Protocol 7. Continued 5. Wash the slides well in distilled water. 6. Counterstain with 1% Neutral Red.c 7. Wash the slides in distilled water and mount the sections in an aqueous mountant. "Observe and control the staining microscopically. bTo give a red reaction product, substitute 2 mg of Fast-Red TR for 2 mg of Fast-Blue BB. c lf using Fast-Red TR, counterstain with Mayer's haematoxylin as in step 7, Method A.

3.2.3 Fluorescent labels To be visualized these require more specialized equipment than enzyme labels. The preparations also fade with time and, for these reasons, they are not highly favoured. However, they play an important part in multipleantibody staining, particularly for the simultaneous visualization of more than one antigen in the same cell (see Section 3.4). The fluorescent label, or fluorochrome, absorbs a particular wavelength radiation and emits radiation of a longer wavelength within the visible spectrum as a colour. Each fluorochrome has specific absorption and emission maxima, which allow the choice to be made of a suitable light source for excitation at the absorption maximum, and the most appropriate filter system or sets of filters that allow a simple changeover to be made in order to look for each fluorochrome in turn. The fluorochromes we regularly use are: •fluoresceinisothiocyanate (FITC)—apple-green fluorescence; • Texas Red™ (TR)—red fluorescence • tetramethylrhodamine isothiocyanate (TRITC)—orange-red fluorescence The following points should be noted: (a) The fluorochromes are available commercially, conjugated to species, class, or subclass specific immunoglobulins (ams Biotechnology). This is of particular relevance to multiple-antibody staining (see Section 3.4.1). (b) A problem associated with fluorescent labels was the difficulty in relating staining to morphology. This is overcome in our laboratory by the use of a fluorescent nuclear counterstain (see Protocols). (c) Special mounting media must be used to inhibit fading of sections (see Protocols). Examples of staining with fluorochromes are shown in Section 3.4.

44

2: Immunohistochemistry oflymphoid organs Protocol 8. Counterstaining, mounting, and examining the fluorochrome-labelled preparations Equipment and reagents • Fluorescent microscope equipped with a Ploem-type illuminator containing filter sets for fluorochromes being used in an epiillumination system (e.g. Zeiss Axioskop microscope with Omega Optical filters) • Mercury vapour lamp

. TBS (see Protocol 3) • Nuclear counterstain: DAPI (4',6-diamidino2-phenylindole dihydrochloride, Boehringer Mannheim)8 • Fluorescence mounting medium (Dako)b

Method 1. Proceed from the staining method using fluorochrome-labelled antibodies (see Protocols 10 and 72). 2. Wash over 5 min in two changes of TBS. 3. Incubate in DAPI for 10 min at room temperature in the dark. 4. Wash over 5 min in two changes of TBS. 5. Place the sections in distilled water and mount in a fluorescent mounting medium.b 6. View under fluorescent microscopy using the relevant filter system and photograph the results, or store the images on computer for a permanent record. 'This is available commercially as 10 mg aliquots in 10 ml distilled water. Freeze in 200 ul aliquots and make up to 10 ml with absolute alcohol before use. bStore the sections at 4°C. They should resist fading for several months.

3.3 Considerations in the choice of method and label All the staining methods and labels described in Sections 3.1 and 3.2 can be applied to all the preparations shown in Table 1 from all lymphoid cell and tissue specimens. There is no single optimal combination of staining method and label. The optimum is determined by a number of important factors that should be considered at an early stage: (a) Blocking endogenous peroxidase in cytological preparations and frozen sections can be damaging. In paraffin sections of bone marrow and spleen, the activity can be difficult to block. (b) More sensitive methods will detect levels of antigen that others miss. (c) A method with fewer steps gives fewer opportunities for error, whilst maintaining reliability, reproducibility, and standardization. (d) Long methods can be expensive in terms of time and money. 45

Simon C. Biddolph and Kevin C. Gatter Table 3. Immunohistochemical staining methods of choice Preparation Cell smear. Imprint, Cytocentrifuge, Frozen sections, and Paraffin sections of bone-marrow/spleen . Other paraffin sections

First choice method

Protocol

Alternative method

Protocol

APAAP

9

2/3 stage Indirect

10

Avidin or streptavidin

11

2/3 stage Indirect

10

Assessing and balancing the criteria can be a difficult task. Table 3 shows the method of choice, and an acceptable alternative, for studying different preparations. Protocols 9-11 give the methods in detail. Protocol 9. Alkaline phosphatase, anti-alkaline phosphatase (APAAP) method Equipment and reagents • TBS (see Protocol 3) • Primary mouse monoclonal or polyclonal (e.g. rabbit) antibody, optimally diluted in TBS • APAAP complex—mouse monoclonal (DAKO) antibody, optimally diluted in TBS

• DAKO pen (see Protocol 2i • Unconjugated rabbit anti-mouse immunoglobulin (DAKO), and unconjugated monoclonal mouse anti-rabbit immunoglobulin (clone MR12/53, DAKO), optimally diluted in TBS

Method 1. • Follow Protocol 2 for cell smears and Cytocentrifuge preparations. • Follow Section 2.5 for cell imprints. • Follow Section 2.6 for frozen sections. • Follow only steps 1 and 2 of Protocol 3 for paraffin sections requiring no antigen retrieval. • Follow Protocol 3 for paraffin sections requiring proteolytic enzyme digestion. • Follow Protocol 4 for paraffin sections requiring antigen retrieval in the microwave. • Follow Protocol 5tor paraffin sections requiring antigen retrieval in the pressure-cooker. 2. Wash the sections well in TBS, and circle the area of interest with a DAKO pen if necessary. 3. Apply the primary antibody and incubate for 30-60 min at room temperature. 46

2: Immunohistochemistry oflymphoid organs 4. Wash, over 5 min, in two changes of TBS. 5. If using mouse monoclonal primary, proceed to step 7. If using rabbit polyclonal primary, apply unconjugated monoclonal mouse anti-rabbit immunoglobulin and incubate for 30 min at room temperature. 6. Wash, over 5 min, in two changes of TBS. 7. Apply unconjugated rabbit anti-mouse immunoglobulins and incubate for 30 min at room temperature. 8. Wash, over 5 min, in two changes of TBS. 9. Apply the APAAP complex and incubate for 30 min at room temperature. 10. Wash, over 5 min, in two changes of TBS. 11. Repeat steps 7-10 once or twice more to increase the sensitivity of the method. Use 10 min per incubation. 12. Demonstrate alkaline phosphatase as the enzyme label. See Protocol 7.

Protocol 10. Indirect method (2-stage)a Equipment and reagents • Goat anti-mouse immunoglobulin or goat anti-rabbit immunoglobulin—conjugated to HRP (horseradish peroxidase),b or AP (alkaline phosphatase),b or fluorescent labels'

• TBS (see Protocol 3) • Dako pen (see Protocol 2) • Primary mouse monoclonal or polyclonal (e.g. rabbit) antibody, optimally diluted in TBS

Method 1. Refer to Protocol 9, step 1. 2. Wash the sections well in TBS, and circle the area of interest with a DAKO pen if necessary. 3. Apply the primary antibody and incubate for 30-60 min at room temperature. 4. Wash, over 5 min, in two changes of TBS. 5. If using a primary mouse monoclonal antibody, apply goat anti-mouse immunoglobulin conjugated to the label of choice and incubate for 30 min at room temperature. If using a primary rabbit polyclonal, apply goat anti-rabbit immunoglobulin conjugated to the label of choice and incubate for 30 min at room temperature. 6. Wash, over 5 min, in two changes of TBS. 47

Simon C. Biddolph and Kevin C. Gatter Protocol 10. Continued 7. Depending on the conjugated label used, refer to Protocols 6, 7, or 8 for demonstration of the label. "To use a more sensitive 3-stage indirect method, apply rabbit anti-goat Ig conjugated to the label of choice between steps 6 and 7. Incubate for 30 min at room temperature. b Available from DAKO. cAvailable from ams Biotechnology.

Protocol 11. Avidin/streptavidin-biotin complex method Equipment and reagents • TBS (see Protocol 3) • DAKO pen (see Protocol 2) • Primary mouse monoclonal or polyclonal (e.g. rabbit) antibody, optimally diluted in TBS • Avidin or streptavidin complexed with biotinylated horseradish peroxidase or alkaline phosphatase(ABComplex/StreptABComplex, DAKO; Vectastain ABC kit. Vector Laboratories)a,b

> Biotinylated goat anti-mouse immunoglobulin or biotinylated goat anti-rabbit immunoglobulin (DAKO), optimally diluted in TBS > Avidin/biotin blocking kit (DAKO and Vector Laboratories)b > Substrates and chromogens for the demonstration of enzyme labels (see Protocols 6 and 7)

Method 1. Refer to Protocol 9, step 1. 2. Wash the sections well in TBS, and circle the area of interest with a DAKO pen if necessary. 3. If necessary (see Section 3.1.4), block endogenous biotin using the blocking kit.b 4. Apply the primary antibody and incubate for 30-60 min at room temperature. 5. Wash, over 5 min, in two changes of TBS. 6. Complex the avidin or streptavidin to the biotinylated label of choice.a 7. If using a primary mouse monoclonal antibody, apply biotinylated goat anti-mouse immunoglobulin and incubate for 30 min at room temperature. If using a primary rabbit polyclonal antibody, apply biotinylated goat anti-rabbit immunoglobulin and incubate for 30 min at room temperature. 8. Wash, over 5 min, in two changes of TBS. 9. Apply the avidin/streptavidin biotin complex, made in step 6, and incubate for 30 min at room temperature. 10. Wash, over 5 min, in two changes of TBS. 48

2: Immunohistochemistry oftymphoid organs 11. Depending on the conjugated label used, refer to Protocols 6 or 7 for demonstration of the label. " It is essential that these complexes are made at least 30 min before use. * Follow the manufacturer's instructions for optimal use.

3.4 Multiple antibody methods A logical progression from visualizing a single antigen in a preparation is the combination of single-antibody methods to visualize two or more antigens in the same preparation, be they in the same or different sites. 3.4.1 Considerations in the combination of methods and labels Any primary antibody can be used, but the choice and sequence of methods depends on various factors: (a) There must be sufficient contrast between the labels. Thus, we can use different fluorochromes, different enzymes, or different substrates and chromogens for the same enzymes. (b) Methods using enzyme labels are better suited to detecting different antigens on different cells in the same preparation, because in the same cell a confusing blend of colours can result, or one colour may mask another if antigen expression is dramatically different. Fluorescent labels are ideal for double or multiple labelling of antigens in the same cell. Because, by switching between the relevant filters, each labelled antigen can be seen in turn, even if there is very weak antigen expression and one is totally masking the other. (c) Counterstaining multiple enzyme-labelled preparations is not recommended for all cases. The choice will depend on the colours produced by the chromogens, and the relative solubilities of the labels and counterstains in the mounting media. (d) Multiple-antibody methods are merely combinations of single-antibody methods, and the same considerations as to the type of preparation and the suitability of the technique must be taken as in Section 3.3. (e) Cross-reactivity between the reagents must be minimized. This can be achieved by: (i) the simultaneous use of primary antibodies from different animal species, followed by the simultaneous use of labelled secondary antibodies directed against each of the animal species. Different fluorochromes can be used together, as can different enzyme labels. (ii) the simultaneous use of primary antibodies from the same animal species, but of a different class or subclass, followed by the simultaneous use of class- or subclass-specific, labelled secondary antibodies. 49

Simon C. Biddolph and Kevin C. Gatter (iii) the sequential use of two indirect methods, both involving primary antibodies from the same animal species. Ideally, the antigen showing the weaker expression should be stained by the first indirect sequence. Preferably, different enzyme labels are used for each secondary antibody, i.e. the application and demonstration of an HRP-conjugated secondary for the first sequence, and the application and demonstration of an AP-conjugated secondary antibody for the second sequence. Alternatively, the same enzyme label, but different chromogens, can be used in both indirect sequences. (iv) triple staining, which can be achieved using, sequentially, three indirect sequences for three different antibodies, e.g. HRP demonstrated using DAB, followed by AP demonstrated by Fast-Blue BB and, finally, AP as visualized by New Fuchsin. For detecting antigens in the same cell, our method of choice is simultaneous staining using fluorescent labels (see Protocol 12). This method can also be used for demonstrating antigens in different cells in the same preparation, but we prefer sequential staining using enzyme labels (see Protocol 13). Protocol 12. Simultaneous staining of different antigens, in the same cell, with multiple antibodies Equipment and reagents • TBS (see Protocol 3) • DAKO pen (see Protocol 2\ • Two secondary antibodies, optimally diluted in an aliquot of TBS; each directed against the species, classes, or subclasses of the primary antibodies, and each labelled with a different fluorochrome (ams Biotechnology)

• Two primary antibodies, optimally diluted in an aliquot of TBS, e.g. two mouse monoclonal antibodies of different class or subclass", or a mouse monoclonal antibody, and a rabbit polyclonal antibody' • Fluorescent microscope and appropriate filters, nuclear counterstain, and mounting medium for fluorescent microscopy (see Protocol 8)

Method 1. Refer to Protocol 9, step 1. 2. Wash sections well in TBS and circle the area of interest with a DAKO pen if necessary. 3. Apply the mixture of primary antibodies and incubate for 30-60 min at room temperature. 4. Wash, over 5 min, in two changes of TBS. 5. Apply the mixture of secondary antibodies and incubate for 30 min at room temperature. 6. Wash, over 5 min, in two changes of TBS. 50

2: Immunohistochemistry oflymphoid organs 7. Proceed to Protocol Sfor demonstration of the label. * Unfortunately, not all commercial antibody suppliers give the class or subclass of their primary antibodies in their catalogues, Dako and Biogenex do.

Protocol 13. Sequential staining of different antigens, in different cells, using multiple antibodies Equipment and reagents • TBS (see Protocol 3) • DAKO pen (see Protocol 21 • Substrates and chromogens for the demonstration of enzyme labels (see Protocols 6 and Ti • Two primary antibodies, each optimally diluted in TBS

• Two secondary antibodies, each optimally diluted in TBS; each directed against the species, classes, or subclasses of the primary antibodies, and each conjugated to a different enzyme label—HRP or AP (see Protocol 10) • Aqueous mountant (e.g. Aquamount, BDH)

Method 1. Refer to Protocol 9, step 1. 2. Wash the sections well in TBS, and circle the area of interest with a DAKO pen if necessary. 3. Apply the first primary antibody and incubate for 30-60 min at room temperature. 4. Wash, over 5 min, in two changes of TBS. 5. Apply the HRP-conjugated secondary antibody and incubate for 30 min at room temperature. 6. Wash, over 5 min, in two changes of TBS. 7. Proceed to Protocol 6for demonstration of HRP, but do not counterstain in Mayer's haematoxylin. The reaction product will be brown or red. 8. Wash the slides in cold, running tap water for 5 min. 9. Apply the second primary antibody and incubate for 30-60 min at room temperature. 10. Wash, over 5 min, in two changes of TBS. 11. Apply the AP-conjugated secondary antibody and incubate for 30 min at room temperature. 12. Wash, over 5 min, in two changes of TBS. 13. Proceed to Protocol 7 for demonstration of AP, but do not counterstain in Mayer's haematoxylin. The reaction product will be red or blue and should contrast with the colour of reaction product in step 7. 14. Wash the slides in cold, running tap water for 5 min. 15. Wash the slides in distilled water and mount the sections in an aqueous mountant. 51

Simon C. Biddolph and Kevin C. Gattvr

3.5 Quality control It is essential in any s t a i n i n g method to use controls t h a t allow the results to he validated (9). We use a positive control in the form of a preparation that is known to contain the antigen in question—this shows t h a t the method has worked. We also include a negative control in the form of a preparation in which the primary antibody has been o m i t t e d — t h i s will show any staining by the secondary antibodies and must be considered to be non-sped lie. A fuller discussion of problems, and remedies, associated w i t h immunohistochemical staining is addressed elsewhere (18),

Figure 1. Staining of lymphoid tissue. (A) B cells stained for the pan B-ceN antigen CD79a. (B) T cells stained for the pan T-cell antigen CD3. (C) Proliferating cells are identified by nuclear staining for Ki67 antigen. (D) Cytotoxic T cells are marked by antibodies against CDS. (E) Macrophages may be seen in both B- and T-cell areas with anti-CD68 antibodies. (F) Plasma cells are easily recognized with a variety of antibodies, such as those against immunoglobulin fragments or endoplasmic reticulum antigens such as pS3, This figure shows kappa light-chain staining. (G) Follicular dendritic cells are restricted to the germinal centre and are easily identified with antibodies against CD21. IH) Germinalcentre cells are unstained for bcl-2 protein, whereas virtually all other B- and T-cells are positive. (I) Interdigitating reticulum cells in the T-dependeni areas of the paracortex may be identified with antibodies against S100 protein.

52

2: Immunohistochemistry oflymphoid organs

3.6 The distribution of cell types in lymphoid tissue Figure 1 shows how many of the different cell types are distributed in lymphoid tissue with particular regard to lymph nodes, although similar patterns occur in tonsils, adenoids, and spleen. B cells are concentrated in follicles in both the germinal centre and the mantle zone. In the interfollicular area their number is much lower. T cells are most numerous in the interfollicular area, though many are found in the germinal centre associated with the centroblasts and centrocytes (which are B cells), proliferating in response to antigenic stimulation. Most of the T cells in the germinal centre are CD4+ helper cells, with cytotoxic CD8+ cells largely restricted to the interfollicular zone. Macrophages are distributed throughout all areas of lymph node, but are particularly numerous and large in the germinal centre where they are phagocytosing apoptotic lymphocytes (so-called 'tingible body macrophages'). Plasma cells, the end stage of B-cell differentiation, are produced in the germinal centres from where they migrate out into the tissues via the lymph node sinuses. There are specialized cells forming an antigen-presenting framework in the germinal centres known as follicular dendritic cells. The special nature of the environment in the germinal centre is further illustrated by the fact that virtually all the cells within it are bcl-2 protein-negative, indicative of an area of intense apoptotic activity. T-cell areas have similar specialized antigen-presenting dendritic cells, which have a different antigen profile to the dendritic cells in the germinal centre.

Acknowledgements To Jackie Cordell and Margaret Jones for the invaluable discussions, and to Tricia for her patience and understanding.

References 1. Germain, J. and Stevens, A. (19%). In Theory and practice of histological techniques (4th edn) (ed. J. D. Bancroft and A. Stevens), p. 555. Churchill Livingstone, Edinburgh. 2. Polak, J. M. and Priestley, J. V. (ed.) (1992). Electron microscopy immunocytochemistry. Principles and practice. Oxford University Press, Oxford. 3. Carmichael, A. and Coghill, G. R. (1992). Med. Lab. Sci., 49, 38. 4. Michel, B., Milner, Y., and David, K. (1972). J. Invest. Dermatol.,59,449. 5. Aratake, Y., Tamura, K., Kotani, T., and Ohtaki, S. (1988). Acta Cytol., 32, 117. 6. Krausz, T., Schofield, J. B., Van Noorden, S., Stamp, G. W. H., and MacLennan, K. A. (1993). In Fine needle aspiration cytopathology (ed. J. A. Young), p. 310. Blackwell Scientific, Oxford. 7. Chaplin, A. J., Heryet, A., Holdsworth, L. N., Eglin, R. P., and Millard, P. R. (1989). 7. CM. Pathol., 42,318. 53

Simon C. Biddolph and Kevin C. Gatter 8. Williams, J. H., Mepham, B. L., and Wright, D. H. (1997). J. Clin. Pathol, 50,422. 9. Rainbow, R. D. (1994). In Laboratory histopathology a complete reference (ed. A. E. Woods and R. C. Ellis), p. 8.2-1. Churchill Livingstone, Edinburgh. 10. Shi, S. R., Key, M. E., and Kabra, K. L. (1991). J. Histochem. Cytochem., 39,741. 11. Morgan, J. M., Navabi, H., Schmid, K. W., and Jasani, B. (1994). J. Pathol, 174, 301. 12. Hollinshead, M., Sanderson, J., and Vaux, D. J. (1997). J. Histochem. Cytochem., 45,1053. 13. Norton, A. J., Jordan, S., and Yeomans, P. (1994). J. Pathol, 173,371. 14. Cordell, J. L., Falini, B., Erber, W. E., Ghosh, A. K., Abdulaziz, Z., Macdonald, S., Pulford, K. A. F., Stein, H., and Mason, D. Y. (1984). J. Histochem. Cytochem., 32, 219. 15. Bobrow, M. N., Harris, T. D., Shaughnessy, K. J., and Litt, G. J. (1989). J. Immunol. Methods, 125,279. 16. Merz, H., Malisius, R., Mannweiler, S., Zhou, R., Hartmann, W., Orscheschek, K., Moubayed, P., and Feller, A. C. (1995). Lab. Invest., 73,149. 17. King, G., Payne, S., Walker, F., and Murray, G. (1997). J. Pathol, 183,237. 18. Hanker, J. S., Yates, P. E., Metz, C. B., and Rustini, A. (1977). J. Histochem., 9, 789. 19. Van Noorden, S. (1993). In Immunocytochemistry: a practical approach (ed. J. E. Beesley), p. 207. IRL Press, Oxford.

54

33

Viral transformation of lymphocytes EDGAR MEINL and HELMUT FICKENSCHER

1. Introduction The main limitations of molecular and biochemical studies of human T lymphocytes are twofold. First, the phenotype of T-lymphoblastic tumour cell lines like Jurkat (1) is significantly altered in comparison to primary cells with respect to signal transduction (2) and gene regulation. Second, primary T-cell cultures are inevitably limited in their lifespan. It is often laborious and frequently impossible to grow primary T lymphocytes to large numbers, and it requires considerable effort to amplify antigen-specific T cells (as described in Chapter 10). The use of irradiated feeder cells may cause difficulties in the interpretation of results derived from T cells expanded in this way. Immortalization of human T cells should be the ideal way to solve such problems. T-cell transformation should ideally lead to permanent growth independent of restimulation procedures, whilst conserving the essential features of the primary, parental T cells. Various approaches for immortalizing human T cells have been tried. The technique of T-cell fusion hybridomas is successful for rodent cells, but is much more difficult to achieve with human T cells where it is hampered by the genomic instability of the clones (as discussed in Chapter 4). Viral transformation of human T lymphocytes was first achieved by infection with Human T-cell leukaemia virus type 1 (HTLV-1) (3-8). This type of transformation with HTLV-1 has proved useful in a number of situations, although it is largely confined to CD4+ T cells. Retrovirus-transformed T lymphocytes contain integrated proviral DNA and regularly produce HTLV1 virions. The cells tend to lose their T-cell receptor (TCR) complex, their cytotoxic activity, and their dependence on interleukin (IL)-2 after prolonged cultivation (9,10). Alternatively, herpesvirus saimiri (HVS), an oncogenic virus of New World monkeys, can be used to transform human T cells for stable growth in culture (11). Human T cells transformed by this virus exhibit the phenotype of activated mature T cells, retain a functionally intact T-cell receptor, can be

Edgar Meinl and Helmut Fickenscher triggered to cytotoxicity, and produce Thl-type cytokines (reviewed in refs 12 and 13). These cells contain multiple episomes of herpesvirus saimiri, but release of infectious virus has not been observed. The cultivation of primary human B cells is still more limited than the culture of primary T cells. However, transformation by Epstein-Barr virus (EBV) (14, 15) is now an established method that is routinely used to obtain permanently growing human B cells. EBV-transformed lymphoblastoid B cells are widely used as antigen-presenting and target cells to study T-cell specificity and cytotoxicity. In this chapter, we summarize the procedures for viral transformation of human and monkey B and T lymphocytes. The main emphasis is laid on using cell-free HVS C488 to transform human T lymphocytes to antigenindependent growth.

2. Transformation of T lymphocytes 2.1 Growth transformation of human T cells by herpesvirus saimiri 2.1.1 Herpesvirus saimiri Herpesvirus saimiri (16) is the prototype of the genus -y2-herpesviruses or rhadinoviruses (17, 18). The closest relative of HVS in humans is human herpesvirus type 8 (HHV-8), which is associated with Kaposi's sarcoma and rare types of B-cell lymphoma (19). Herpesvirus saimiri is not pathogenic in its natural host, the squirrel monkey (Saimiri sciureus), and can easily be isolated from the peripheral blood of most animals (20, 21). In other South American monkeys—such as common marmosets (Callithrix jacchus), cottontop tamarins (Saguinus oedipus), and owl monkeys (Aotus trivirgatus), as well as in some breeds of rabbit—HVS infection causes fulminant polyclonal Tcell lymphomas and acute lymphatic leukaemias (22-27). The various strains of herpesvirus saimiri are assigned into subgroups A, B, and C on the basis of DNA sequence divergence in the transformation associated region (28, 29). Strains of subgroup A and C are highly oncogenic in various species of New World monkeys (genus Callithrix, genus Saguinus) (24). Furthermore, marmoset (30-35) T lymphocytes can be transformed in vitro by herpesvirus saimiri. Subgroup C strains are further capable of growthtransforming macaque and human T cells 11, 36-39. HVS is capable of infecting a broad range of cell types, including B cells, epithelial cells, fibroblasts (40), and fetal cell cultures (41), but it is only able to transform T cells for stable growth. 2.1.2 Virus culture Because HVS is associated with tumours in some animals, it has to be considered a potential human pathogen even though no human disease has been reported. Appropriate biosafety containment conditions must be applied con56

3: Viral transformation of lymphocytes tainment level 2 in most countries). Epithelial owl-monkey kidney (OMK) cells, which are typically used for amplifying HVS, are derived from healthy Aotus trivirgatus (owl monkeys). OMK cells are a non-transformed, primary cell line which has unusually stable properties (42). The American Type Culture Collection (ATCC; Manassas, Virginia) offers strain OMK637-69 in the 16th passage under catalogue number ATCC CRL-1556. This cell line was isolated in 1970 and later submitted to the ATCC by Dr M. D. Daniel, New England Regional Primate Research Center, Harvard Medical School, Southborough, MA, USA. OMK-637 has been used intensively in several laboratories over decades with no hint of viral contamination. The cells are maintained as a monolayer in Earle's Minimal Essential Medium (MEM) or Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% heatinactivated fetal calf serum (PCS), glutamine (350 (ug/ml), and antibiotics (100 (ug/ml gentamicin or penicillin/streptomycin at 120 ug/ml each). OMK cell growth does not require CO2 supplementation. The cells are trypsinized and split just once a week on to a doubled area of tissue-culture plasticware. This low ratio maintains the original status of the primary OMK cells and does not enforce selection for fast-growing subtypes, which are no longer fully permissive. The medium is changed on the fourth day after splitting. The cells should not be used for more than 50 passages. OMK cells are the typical propagation system for herpesvirus saimiri, herpesvirus aotus, and herpesvirus ateles. It should be kept in mind that Aotus trivirgatus monkeys are an endangered species. If OMK cells have to pass customs control, appropriate official documentation according to the Convention on International Trade in Endangered Species (CITES) is needed. Traditionally, the tissue-culture medium of freshly confluent, OMK monolayer cultures is removed on days 2-4 after splitting, and an infectious virion suspension is added in a minimal volume (e.g. diluted in 2 ml for a 25 cm2 flask, or in 5 ml for an 80 cm2 flask). Adsorption is allowed to take place at 37 °C for 1-2 h. The monolayer should be covered by the inoculum fluid and should not dry out during this time. Afterwards, medium is added and the incubation is continued. (In our experience this adsorption step may safely be omitted.) After between 1 and 14 days, early cytopathic changes can be observed, typically with focal rounding of cells. Later on, plaques bordered by rounded cells appear, and several days later, the whole cell layer will be lysed by the virus. When high-titre supernatants are to be prepared, it is essential to inoculate at a low multiplicity of infection (0.1-0.5). Ideally, the culture should be maintained for 1-2 weeks, until all the cells have been lysed. Inoculating the cultures at a higher multiplicity of infection (m.o.i.) often results in more dramatic cytopathic effects but yields lower litres of infectious particles, and a high proportion of the virus carry repetitive terminal H-DNA (high GC content) only, without coding L-DNA (low GC content). Once the infected cells have all been lysed, the whole culture (including the OMK cell debris) is used as HVS viral stocks, without any further treatment. The virus 57

Edgar Meinl and Helmut Fickenscher stocks are reasonably stable and can be stored at 4°C for several months without loss of infectivity. Small volumes of supernatant should be frozen in liquid nitrogen or at -80 °C; the titre may decrease by about one order of magnitude upon freezing and thawing. Protocol 1. Preparation of herpesvirus saimiri stocka Equipment and reagents • OMK cells (see above) • Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 10% heatinactivated PCS, 350 ug/ml L-glutamine, and 100 (ug/ml gentamicin (or 120 (ug/ml each of penicillin and streptomycin)

• Virus stock • Equipment and reagents to comply with relevant biosafety containment conditions

Method 1. Grow OMK cells in DMEM supplemented with 10% PCS, glutamine, and gentamicin. Avoid using OMK cells that have been extensively passaged. 2. Trypsinize OMK cells once a week and split them at a ratio of 1:2 per area. Exchange the medium on day 4. 3. One day after a 1:2 split, infect the cells with an appropriate volume of virus stock, e.g. 500 uJ of a routine stock of 105 p.f.u./ml, for inoculation of an OMK monolayer of 175 cm2. 4. Continue the incubation for 1-2 weeks post-infection.b 5. Harvest the tissue culture fluid (including the cell debris) when the cytopathic effect is complete, and store it at 4°C before use.e Alternatively, store aliquots at -80°C, although some loss of efficiency will result from freeze-thawing. "See text for further details "The optimal time-course for the cytopathic effect in the cell culture to reach the point of complete lysis should be between 1 and 2 weeks: longer or shorter time courses will result in poor litres. c

When stored at 4°C, these preparations can be used for T-cell transformation for up to 3 months.

Virus strain C488 (29, 43) was submitted to the ATCC after only a few passages on OMK cells. The virus is available under the catalogue numbers VR-1396 and VR-1414. ATCC also offers virus strain S295C, which belongs to subgroup B, rather than subgroup C as do the other transforming strains. This virus is unable to transform human T cells, but immortalizes marmoset monkey cells with low efficiency (44). 2.1.3 Virus titration The limiting dilution method is the simplest way to estimate virus litres. OMK cells are trypsinized, split into 24-well plates, and incubated at 5% CO2. The 58

3: Viral transformation of lymphocytes cell-free virus suspension is serially diluted in DMEM at KT* to 10-9 and 1 ml of each dilution is added to each well of the 24-well plate the following day. It is important to perform the assay in triplicate at least, and to run control cultures. The plates are observed for a minimum of 14 days and the progress of the cytopathic effect (CPE) should be monitored daily. The more laborious plaque assay is also based on serial dilution. The methyl cellulose solution is prepared as described in Protocol 2, and subconfluent OMK cultures are infected with dilutions of virus stock in 6 cm dishes. After an hour at 37 °C, the supernatant is replaced by the 2% methyl cellulose solution. The medium is poured off carefully after plaque formation has been observed. The plaques are then stained with crystal violet solution and counted. Routine OMK cell cultures should reach litres between 105 and 107 plaque forming units (p.f.u) per ml (42). Protocol 2. Estimation of herpesvirus saimiri titre Equipment and reagents Confluent OMK cells 24-well plates DMEM (see Protocol 7) 15 ml tubes Viral stock PBS 6 cm dishes 1% crystal violet in 20% ethanol/80% water (v/v)

• 2% methyl cellulose syrup: Measure 100 ml H2O into a 500 ml bottle and add 4.4 g methyl cellulose (Methocel MC 4000; Fluka, cat. no. 64630) and autoclave it for 45 min at 121 °C. Add 100 ml 2 x concentrated DMEM, 20 ml PCS, 700 jig/ml L-glutamine, and 200 ug/ml gentamicin. Mix well overnight in the cold room. Add small volumes of PBS in order to achieve a homogeneous sticky syrup.

A. Limiting dilution method 1. Trypsinize confluent OMK cells and split them by 1:5 per area, e.g. into 24-well dishes with 1 ml of the cell suspension in complete DMEM. Let the cells grow overnight. 2. Prepare serial dilutions of the sample in complete DMEM, down to 10~9 as follows. Prepare a panel of 15 ml tubes, each containing 9 ml complete medium, then add 1 ml of viral stock to 9 ml medium and shake vigorously. Take 1 ml of this dilution and transfer it to the next tube, and so on. 3. Aspirate the medium from the well and add 1 ml of the respective dilution of virus. Run the assay with four parallel wells for each dilution. 4. Monitor the development of the cytopathic effect (CPE) for up to 3 weeks, until all the cells have been lysed. Do not feed these cultures during this period. A. Plaque assay 1. Prepare the 2% methyl cellulose syrup. 59

Edgar Meinl and Helmut Fickenscher Protocol 2.

Continued

2. Split confluent OMK cells by 1:5 per area into 6cm dishes. Let the cells grow overnight. 3. Prepare serial dilutions as described above. 4. Aspirate the medium from the well and add 1 ml of the respective dilution. Use three dishes for each dilution. Aspirate the supernatant again after a 1-h incubation at 37°C. 5. Immediately add 5 ml of the methyl cellulose syrup. 6. Observe the CPE for about a week, until the plaques are easily recognized under the microscope. 7. Carefully pour off the medium, wash gently with PBS, and stain with 1% crystal violet in 20% ethanol/80% water (v/v). Remove surplus dye by washing with water and dry the plates. Count the plaques. NB: Vigorous washing may destroy the monolayer and induce artefacts that are indistinguishable from genuine plaques.

2.1.4 Growth-transformation of human T cells Infection of primary human T lymphocytes with HVS subgroup C strains (notably strain C488), but not with strains of subgroups A or B, yields continuously proliferating, mature T-cell lines (11) (reviewed in refs 12 and 13). Permanently growing T-cell lines have been obtained from primary cells of various sources. Polyclonal preparations of mononuclear cells from adult peripheral blood or from cord blood, from thymus or bone marrow, as well as characterized T-cell clones, or flow cytometry-sorted T cells are all suitable for the procedure. The transformation of bulk cultures is polyclonal (25, 45-47), so that a broad variety of V(3 chains are represented. Although TCR 78 cell lines are not usually obtained when large numbers of polyclonal cells are infected, they can be generated using a number of manoeuvres, such as lysis of the ctp T cells, the use of small microtitre cultures, or through the specific differentiation of virus-infected CD34+ thymocytes (49-52). The method requires either freshly isolated quiescent cells or proliferating viable cells with the morphology of activated T lymphocytes. The primary cells may be purified using Ficoll density gradients (1.077 g/ml; Biochrom, Berlin) or the dextran erythrocyte-sedimentation protocol (selective sedimentation of erythrocytes at 37 °C and 1.2% dextran 250000 (w/v)/30 mM Nad for 45 min). Pre-stimulation of fresh primary cells for 24 h with phytohaemagglutinin (PHA) (0.5-10 ug/ml, Murex/Wellcome) or OKT-3 (10-200 ng/ml, Ortho) is only of advantage if the number of available cells is limited. T-cell clones should be restimulated with antigen or mitogen and feeder cells 3-5 days prior to infection. T-cell cultures are kept at a density 60

3: Viral transformation of lymphocytes of about 1 (0.5-1.5) x 106 cells/ml. Most safety committees specifically prohibit the use of the researcher's own cells for transformation experiments, for obvious safety reasons! Different types of cell-culture plasticware can be used. In our experience, the cells best retain viability in 25 cm2 flasks (3-10 ml containing 3-10 x 106 cells), 24-well plates (1-2 ml containing 1-2 X 106 cells) or 96-well, roundbottomed microtitre plates (100-200 ul containing I04-105 cells). The culture flasks should be incubated at a slight angle (of about 15 degrees) to allow close cell-to-cell contacts in the lower edge of the culture flask. Various media formulations have been used. Lines CB-15, PB-W, Lucas (11), and CB-23 (53) were all isolated using a standard medium formulation (80% RPMI-1640, 20% PCS, 50 uM B-mercaptoethanol, L-glutamine (350ug/ml), gentamicin (100ug/ml), without either pre-stimulation or IL-2 supplementation. The quality of fetal calf serum (FCS) batches, even from the same supplier, varies remarkably. In our experience it is very important to compare different serum batches and select a batch with low endotoxin levels. PCS is inactivated at 56 °C for 30 min to avoid problems for both virus and lymphocytes due to complement activation. The addition of IL-2 (at 20-50 U/ml in the culture medium) activates cell proliferation and enhances the transformation frequency. Because usually about one-third of the culture medium is added or replaced twice-weekly, this will result in a final concentration in the culture of less than 20 U/ml IL-2. After studying many different IL-2 batches from different suppliers we found that pre-tested batches of human recombinant IL-2 with low endotoxin levels, purified from E. coli and offered by Roche (cat. nos 1011456 and 1147528) were the most active and provided optimal conditions for transformation efficiency. To save money, the use of this preparation of IL-2 may be limited to the initial transformation procedure and in maintaining small culture volumes. When stable growth is established, or when large cell-culture volumes of transformed lines are required, the lessexpensive and less-active Proleukin™ is recommended (used at 50-100 U/ml in the medium stock). This is human recombinant IL-2 produced for clinical use, which carries 1-des-Ala and 125-Ser amino-acid substitutions and is available from Chiron (Ratingen, Germany). Efforts to enhance transformation efficiencies led to the observation that adding 45% of certain synthetic media was beneficial. Several types of synthetic media were tested as supplements, but only Panserin 401 (PAN, Aidenbach, Germany) and AIM V (Gibco BRL) improved transformation efficiency significantly in our experiments. Panserin 401 medium allows one to judge the metabolic activity of the culture by colour changes, which is not a feature of AIM V medium. Using pre-tested IL-2 (Roche) and medium supplements, about 90% of primary T-cell cultures can be transformed to antigen- and mitogen-independent growth. The failure rate of about 10% can largely be explained on the basis of trivial reasons, such as poor cell viability prior to infection. From our experience, the optimal medium formulation 61

Edgar Meinl and Helmut Fickenscher is: RPMI-1640 45%, CG 45% Panserin 401 or AIM V (45%), PCS 10%, L-glutamine (350 ug/ml), gentamicin (100 rag/ml), and 20-40 U/ml IL-2 (Roche). Protocol 3. Growth-transformation of primary human T cells with herpesvirussaimiri Reagents . 20-40 U/ml IL-2 • Virus supernatant (106 p.f.u./ml)

• Complete medium: RPMI-1640 (45%), Panserin 401 or AIM V (45%), PCS (10%), L-glutamine, and gentamicin

Method 1. Take quiescent primary or rapidly proliferating T-cells in complete medium with IL-2 (2 identical cultures at 5 ml with 5 x 106cells each). 2. Infect one of the cell cultures with virus supernatant (preferably fresh), e.g. 500 uJ of 106 p.f.u./ml) 3. Maintain both infected and uninfected cultures with meticulous care for several months, paying attention to the following points: • keep the cell density high (about 106/ml); • keep flasks at a slight angle (15 degrees) to allow close cell-to-cell contact; • supply fresh medium supplemented with IL-2 twice weekly. • add or change only one-third of the volume. 4. Make sure the following criteria for transformation are fulfilled: • a steady increase in cell numbers; • appropriate T-lymphoblast morphology; • death of control cultures maintained under the same conditions; • persistence of viral episomal DNA; • CD2 hyper-reactivity and non-specific cytotoxicity. 5. Confirm that the transformed T cells do not produce virus particles.

In order to block auto-oxidation of thiol groups and resulting toxicity, the addition of 1 mM sodium pyruvate (Gibco BRL, cat. no. 043-01360, 100 X stock solution at 100 mM), 50 uM a-thioglycerol (Sigma, cat. no. M-6145, 1000 X stock solution at 50 mM), and 20 nM bathocuproine disulfonic acid (Sigma, cat. no. B-1125; 1000 X stock solution at 20 uM) is advantageous, but not essential (M. Falk and G. Bornkamm, personal communication). 62

3: Viral transformation of lymphocytes a-Thioglycerol is a more stable and less odorous alternative to 3-mercaptoethanol. Copper ions, which are relevant for auto-oxidation, are chelated by bathocuproine disulfonic acid. The addition of sodium pyruvate reduces H2O2 concentrations (54). Most experience in T-cell transformation is based on using the HVS strain C488 (11). However, other strains such as C484 (11, 27, 28, 43, 49, 55) and C139 are also able to transform human T cells to some degree. Strain C139 is an isolate from our laboratory and shows several atypical features (49, 50). Overall, HVS strain C488 seems to be the most reliable for transforming human T cells (49), used at 10% (v/v) of infectious OMK supernatant added to a healthy lymphocyte culture, as described in Protocol 3. At least 105 viable cells are necessary for obtaining a transformed culture (49). Good negative controls are uninfected cells and cultures infected with a virus strain of similar titre, such as strain All (subgroup A) or SMHI (subgroup B), which are unable to transform human T cells. During the first weeks of culture, normal T-cell growth is observed in both virus-infected and control cultures, but this normal mitotic phase should not be misinterpreted as transformation. It may take several months before stable growth of virus-infected T cells becomes obvious in comparison with uninfected control cells. Transformation efficiency seems to vary considerably among different donors, but can reach 90% using just a few millions of viable primary cells for infection. Several criteria indicate that transformation has been achieved: • doubling of the cell number constantly once to four times a week over several months, independent of antigen and mitogen; • cell morphology consistent with T lymphoblasts, e.g. enlargement and clumping; • death of identically treated control cultures • persistence of viral non-integrated episomes without virion production (demonstrated by PCR and Gardella gel, as described below, and negative co-cultivation test on OMK cells); • CD2 hyper-reactivity against membrane-bound CD58, or cross-linked CD2 antibodies (see below) (56), and non-specific cytotoxicity against various human or monkey cell lines. Cultures which seem to be growth-transformed can often be subjected to a gradual withdrawal of the medium supplement (Panserin 401 or AIM V). The addition of 10 mM Hepes pH 7.4 (Gibco BRL) helps to avoid cell degeneration caused by low pH. Exogenous IL-2 supplementation can also be gradually reduced, and even suspended altogether for some CD4+ cell cultures. However, CD8+ transformed cell lines are more sensitive to the withdrawal of IL-2. An alternative protocol to obtain HVS-transformed CD4+ and CD8+ Tcell clones from the blood of HIV-1 infected subjects has been described (57). 63

Edgar Meinl and Helmut Fickenscher Peripheral blood mononuclear cells (PBMCs) were obtained by Ficoll gradient, and adherent cells removed by plastic adherence for 2 h. These cells were either infected directly or 2 days following activation with 2 u.g/ml of PHA. The HIV-1 protease inhibitor Ro 31-8959 was added to inhibit spreading of HIV during transformation. At 3-5 days after infection, the cells were seeded at 0.5-1 cells per well in round-bottomed, 96-well plates containing 105, irradiated, allogeneic PBMCs in a final volume of 200 (ul, supplemented with IL-2. The protease inhibitor was maintained for 3 weeks. Growing microcultures were expanded in IL-2 without the addition of feeder cells. 2.1.5 Properties of human growth-transformed T cells Human HVS-transformed T cells carry multiple non-integrated viral episomes (11). Release of infectious virus has not been observed, despite numerous attempts to isolate HVS from human transformed T cells. Most viral genes are not expressed in transformed human T-cells, but the viral oncogene stpC/tip and the superantigen-homologous gene ie14/vsag are strongly and inducibly transcribed (33, 48). Although transformed human T cells usually remain IL-2-dependent, they do not need periodic restimulation with either antigen or mitogen. The transformed cells have the phenotype of mature activated CD4+ or CD8+ T cells, retain a structurally and functionally intact TCR, produce Thl-like cytokines, and can be triggered to cytotoxicity (2, 46, 58-60). They also maintain the early signal-transduction patterns of primary cells (2, 59), express surface activation markers, show inducible cytotoxicity (11, 50, 59), secrete Thl-type cytokines with greater IFN-y production than before transformation (56, 58, 60), and are sensitive to a variety of apoptosisinducing treatments (61, 62). Well-characterized CD4+ T-helper cell clones specific for myelin-basic protein (12, 60), tetanus toxoid (2), bovine 70-kDa heat-shock protein (Hsp70), Lolium perenne group I antigen, Toxocara canis excretory antigen, purified protein-derivative from Mycobacterium tuberculosis (58), have all been successfully transformed, with preservation of their antigen-specificity. Growth transformation of CD8+ EBV-reactive T cells by herpesvirus saimiri has also been reported (45). Although HVS-transformed T cells resemble native T cells in many ways, a striking difference lies in their reactivity to CD2 engagement. Whilst activation of native T cells via the alternative pathway requires particular pairs of antibodies directed to different CD2 epitopes (63), HVS-transformed T cells can be activated by cell-bound CD58 or a single anti-CD2 monoclonal antibody (mAb), provided it recognizes the Tll.l epitope on CD2 and is cross-linked by FcR-bearing cells (33,36,56). Their spontaneous proliferation and cytokine production are reduced by treatment with soluble mAbs to either CD2 or its ligand CD58 (56, 60). CD58 is expressed on a variety of cell types, including lymphocytes, and is the most important cellular ligand for 64

3: Viral transformation of lymphocytes CD2 in humans. Although native T cells are not activated upon binding of CD2 to CD58, this interaction is an important stimulus for the autocrine growth of HVS-transformed T cells (56): this can be inhibited using mAbs to CD2 and its ligand CD58, but not mAbs to other surface molecules like HLADR or B7 (56, 60). The transformed T lymphocytes have further been shown to react on engagement of the CD4 and CD26 receptors (2, 59). When peripheral blood mononuclear cells (PBMCs) are used as antigenpresenting cells (APCs) to study the activation of HVS-transformed T cells, antigen-specific activation may be obscured because the transformed T cells are activated by PBMCs through CD2 without antigen. This problem can be overcome by using mouse L cells (stably-transfected with the appropriate HLA molecule) as APCs, since mouse CD58 binds poorly to human CD2: autocrine activation of the T cells can be simultaneously reduced using antibodies to CD2 or CD58 (60). An alternative is to use EBV-transformed B cells as APCs in the presence of mAbs to CD58 (59). T cell-depleted (2) or unseparated PBMCs (58) have also been used as APCs to elicit an antigenspecific response without blocking mAbs. Withdrawal of IL-2 for a few days before culturing with antigen can enhance the antigen-specific response (2). HVS-transformed T cells from Rhesus monkeys (36) and man (unpublished observations) are both effective APCs. Measuring the production of IFN--y, lymphotoxin, granulocyte-macrophage colony-stimulating factor (GM-CSF), or tumour necrosis factor-a (TNF-a) are all more sensitive indicators of an antigen-specific response than is proliferation (2,13,60, 62). 2.1.6 Test for virus production The concentration of infectious virion particles in the culture supernatant is estimated by the lysis of OMK cells (see Section 2.1.3): this assay is also used to verify that HVS-transformed T cells are not producing virus, which has usually ceased within several weeks of the initial culture (11, 13). Typically, about 106 transformed lymphocytes are added to a 25 cm2 flask of fresh confluent OMK cells (in 5 ml MEM or DMEM with 10% PCS, but without IL-2). Co-cultivation allows the infection of OMK cells with small numbers of lymphocyte-associated virions, as close cell contact is achieved. Transformed human T cells may also be activated by OMK cell contact, presumably by the CD2/CD58 interaction (56), which may stimulate transformed CD8+ lymphocytes to lyse the OMK cells directly: this cytotoxic activity will decrease on further passages with fresh OMK cells. If such problems with cytotoxicity occur, large volumes (around 50 ml) of culture supernatant are harvested to screen for virus particles. Contaminating T cells are removed by low-speed centrifugation (approx. 200 g, 10 min), and the remaining supernatant is subjected to high-speed centrifugation (Sorvall centrifuge approx. 50000 g at 4°C for at least 4 h in an SS34 rotor using 35 ml screw-capped tubes (Nalgene)). Any sediment is resuspended in medium and transferred on to fresh OMK cultures. In the past, three passages were used to exclude virus 65

Edgar MeinI and Helmut Fickenscher growth, taking about 6 weeks. In our experience, the exchange of the culture medium every fourth day over 6 weeks without further passage is sufficient to detect small numbers of infectious particles. Possible or weak cytopathic effects (CPE) can be confirmed by transferring an aliquot of sterile-filtered supernatant to a fresh OMK culture, where typical CPE should be visible in a few days. The sensitivity of this co-cultivation method has been estimated to be one virus-producing cell per 106 cells (21). 2.1.7 Demonstration of viral episomes and virion DNA To demonstrate and distinguish persistent non-integrated episomal (slowly migrating) or lytical linear (higher mobility) viral DNA, in situ lysis gel electrophoresis can be used. The method was originally developed by Gardella (64), and a simplified version is now used (modified after ref. 22). Typical examples for 'Gardella gels' are shown in various reports (11, 22, 36, 64, 65). The electrophoresis is done in a vertical 1% agarose gel in 1 X TBE (89 mM Tris, 89 mM boric acid, 20 mM EDTA) with gel size 20 X 20 cm, 0.5 cm thick, at 4°C. The wells have an area of 0.5 cm X 0.5 cm and are 1 cm deep: they are separated by 0.3-0.5 cm agarose teeth. The thick gel has a tendency to slip out from the gel plates during assembly of the gel apparatus, so the gel and the gel plates are rested on a large 3% agarose block in the lower buffer chamber. The gel system is placed in a refrigerator or cold room with no buffer in the upper chamber. TBE (1 X) for the chambers is precooled. Frozen aliquots of buffers A and B (composition listed below) are prepared in advance, as Ficoll is very sticky, and the enzymes (RNase, Proteinase K) are added just before use. About 2 X 106 transformed lymphocytes are washed in PBS, resuspended in 50 |xl blue sample buffer A (200 mg/ml Ficoll 400,1 X TBE, 0.25 mg/ml Bromophenol Blue, 50 (ug/ml RNase A) and loaded into the bottom of the wells. Conventional X-markers (HindllT) and a small number of virions (obtained by centrifuging 1.0 ml virus suspension at approx. 15 000 g in a cooled benchtop centrifuge) are used as controls, also loaded in buffer A. Green buffer B (120 ul per sample; 50 mg/ml Ficoll 400, 1 X TBE, 1% SDS, 0.25 mg/ml xylene cyanole, 1 mg/ml protease K) is laid over the sample, almost filling the wells. Some 1 X TBE buffer is carefully added to fill the wells completely, and more buffer to fill the upper chamber. Electrophoresis is performed slowly at 4°C. Proteins and RNA are initially degraded enzymatically during a period of at least 3 h at 10 V. Subsequently, the gel run is continued for at least 12 h at 100 V, until xylene cyanole (green) reaches the bottom of the gel. The agarose gel is stained in TBE buffer containing ethidium bromide and photographed, but ethidium bromide staining is usually not sufficient to demonstrate episomal bands. The DNA is transferred on to a nylon membrane (e.g. Hybond™, Amersham) using the alkali transfer protocol. Viral DNA bands will be visualized by stringent hybridization and subsequent autoradiography. There are several alternatives to 66

3: Viral transformation of lymphocytes choosing the hybridization probe. If maximal sensitivity is necessary, a cloned H-DNA fragment should be used (66). H-DNA is highly repetitive in the nonintegrated episomes and amplifies the viral signals. If higher specificity is needed, e.g. to prove that the correct virus strain was used, a fragment from the variable transformation-associated genomic L-DNA end should be used (29). If band intensities have to be compared from cultures infected with different virus strains, it might be advantageous to take a probe from a lessvariable genomic region. An alternative method is to use virus-specific oligonucleotide primers to demonstrate the presence of viral DNA in transformed T cells using PCR (25, 33,49).

2.1.8 Herpesvirus saimiri in T cells of non-human primates The use of herpesvirus saimiri has recently been focused on human T cells, but its potential use in various monkey systems should not be overlooked, as, on the one hand, herpesvirus saimiri is a tumour virus of New World monkeys, and, on the other, Old World monkeys like macaques are widely used as a model for human diseases. For many New World primate species HVS establishes a semi-permissive infection in T cells, with both long-lived productive infection and transformation (summarized in ref. 48). Transcription of IL-2 and activity of IL-4 has been shown from such cultures (30). Transformed New World monkey T cells express the whole spectrum of virus genes, whilst they are producing virus particles (48). T lymphocytes from Old World macaque monkeys can be transformed by HVS in a similar manner to human cells (36-39): the IL-2 dependence of these cultures is variable. In many respects, the transformed macaque T cells resemble their human counterparts. The activated T-cell phenotype is preserved, and virus particles are not usually produced. Antigen-specific Tcell lines against myelin-basic protein or streptolysin O retained their activity after transformation. The MHC class II-expressing transformed cells could present antigen to each other in the absence of additional APCs (36). In contrast to their uninfected progenitor cells, the antigen specificity of the transformants was obscured by using increasing concentrations of irradiated autologous PBMCs as APCs. In contrast to human HVS transformed T cells, transformed T cells from Rhesus monkeys are often double-positive for CD4 and CDS. This does not appear to be an effect of transformation, but rather is a peculiarity of T cells from Rhesus monkeys (36). Most Rhesus monkeys in primate centres are infected with foamy virus, reactivation of which considerably hampers studies of primary T cells and their transformation (37): this is not adequately controlled by the addition of zidovudine (AZT) or other agents which may also be cytotoxic. Transfusion of macaque monkeys with autologous HVS-transformed T cells led to no development of leukaemias or lymphomas, and the animals were also protected from disease after intravenous challenge infection with 67

Edgar Meinl and Helmut Fickenscher high-titre, wild-type virus. HVS strain C488 administered intravenously in high-titre causes an acute disease that is lethal within 2 weeks in naive macaques, thought to be due to a form of polyclonal T-cell leukaemia which has not been seen in humans (39,67).

2.2 Immortalization of human T cells by human T-cell leukaemia virus type 1 Human T-cell leukaemia virus type 1 (HTLV-1) has been used extensively for immortalizing human T cells. The method described here is based on an excellent report by Nutman (68). HTLV-transformed T cells do release virus particles, and as HTLV is a human tumour virus it has to be handled under containment level 3 conditions. Never use your own cells for transformation experiments! Protocol 4. Immortalization of human T-cells by HTLV-1 Equipment and reagents • HTLV-1 producer cells like MT-2 or HUT-102 • T-cells to be transformed, showing rapid growth 2-3 days after activation with PHA . Complete medium: RPMI-1640, PCS (10%), or specific antigen 350 ug/ml L-glutamine, and 100 (ig/ml supplemented with 10-100 U/ml • Irradiation source recombinant IL-2 • Equipment and reagents for PCR and flow cytometry • 24-well tissue-culture plates (e.g. Nunc)

Method 1. Seed rapidly proliferating T cells at 106 cells per well into 24-well plates, in complete medium supplemented with IL-2. 2. Irradiate HTLV-1 producer cells at 106 cells/ml with 6000 rads. 3. Add 106 irradiated producer cells to 106 proliferating T cells. 4. Incubate the cultures for several weeks, feeding the cells twice-weekly with IL-2 medium. 5. Wait for the appearance of rapidly growing cells in the cultures. 6. Confirm transformed status, using: HTLV-1 PCR, flow cytometry for CD25 and HLA-DR. NB: HTLV-1-transformed cells frequently lose IL-2 dependence, cytotoxicity, antigen-reactivity, and TCR expression.

HTLV-1 can be used to transform mononuclear cells from cord blood or adult peripheral blood, or T-cell clones. The cells are first activated with mitogen (PHA, Murex/Wellcome), or with their specific antigen, and incubated in 24-well plates for 2-3 days. The activated cells are then seeded at 106 cells/ml in 24-well plates. The irradiated HTLV-1 producer cells (106 cells/ml; e.g. MT68

3: Viral transformation of lymphocytes 2; or HUT-102, available from ATCC as TIB-162) are added to the wells in a 1:1 ratio, and incubated for 2-6 weeks, being fed with IL-2-containing medium twice weekly. After 6 weeks, rapidly growing cells should be observed, which in many cases are already IL-2-independent. Co-cultivation is more efficient and reliable than infection with cell-free supernatants. HTLV-transformed human T cells express CD25/IL2Ra chain and HLA-DR molecules abundantly on their surface, but after few months of culture, they tend to lose IL-2 dependence, cytotoxicity, antigen-reactivity, and TCR expression (9,10). HTLV-1 provided the first reagent for the immortalization of human T lymphocytes (4, 6-8). In most cases the transformed T cells are CD4+/CD8-, but CD4-/CD8+ human T cells can also be immortalized (3, 5). The principal drawbacks are that transformed cells continue to release virus particles in most cases, and many of the functional characteristics of the primary T cells may be lost. In contrast to HVS-transformed T cells, HTLV-1 immortalized lymphocytes do not produce IL-2.

3. B-cell immortalization 3.1 EBV-transformation of human B cells In contrast to viral transformation of human T lymphocytes, B-cell transformation by EBV is a widely used, reliable, and easy procedure (69), which does not require the same degree of attention to the cultures. This protocol is based on our own experience and on the recommendations by Tosato (15). As for the viruses used in the other protocols, EBV should be treated as a human pathogen and handled at the appropriate level of containment (usually P2). One should keep in mind that EBV is easily reactivated from most EBVtransformed, B-lymphoblastoid cell lines (B-LCL). Never use your own cells in your transformation experiments! To generate EBV stocks, exponentially growing cells of the EBV-transformed, marmoset producer cell line B95-8 (ATCC CRL-1612, DSMZ ACC 100, ECACC 85011419) (70) are seeded at 1 X 106 cells/ml in RPMI-1640 with 10% PCS, glutamine, and antibiotics (complete RPMI). After 3 days of culture, the cells are sedimented at low speed (approx. 200 g, 10 min). The supernatant is filter-sterilized and stored in aliquots at -80 °C. Such supernatants contain up to 1000 transforming units/ml. Protocol 5. Immortalization of human B-cells using EBV Equipment and reagents • Exponentially growing B95-8 cells • RPMI-1640 medium supplemented with 10% PCS, 350 ug/ml l-glutamine, and 100 pg/ml gentamicin • Sterile 0.45 M-m filter

• • • •

69

Freshly purified blood mononuclear cells EBV frozen stock Cyclosporin A 24-well plates

Edgar Meinl and Helmut Fickenscher Protocol 5.

Continued

Method 1. Prepare EBV stock as follows: seed exponentially growing B95-8 cells at 106/ml in the supplemented RMPI-1640 medium. After 3 d, spin down the cells. Pass the supernatant through a sterile filter (0.45 (Jim) and store aliquots at -80 °C. 2. Infect freshly purified blood mononuclear cells (107 cells in 2.5 ml) with 2.5 ml of thawed EBV stock. After 2 h at 37 °C, add 5 ml of complete medium containing cyclosporin A (final concentration 0.5 ug/ml). 3. Cultivate infected cells in flasks or 24-well plates for several weeks with occasional exchange of a third of the medium volume. Keep the cell density high. 4. Amplify the transformed B lymphoblast cells by regular passages.

Freshly gradient-purified PBMCs are infected with an aliquot of supernatant from B95-8 cells (as described in Protocol 5), then maintained in tissue culture until transformation occurs. Transformation may be inhibited by the outgrowth of EBV-specific, cytotoxic T lymphocytes, so cyclosporin A is added to cultures to a final concentration of 0.5 (Ug/ml (Novartis, Basel, Switzerland). Over the next 3 weeks, the cultures do not need much attention: it is important to keep the cell density high, and one third of the medium may be changed once a week if necessary. After 3 weeks, and depending on the metabolic activity, the cells can be expanded in complete medium, which usually leads to rapid proliferation. The resulting lymphoblastoid B-cell lines (14) are latently infected by EBV and can often be induced (e.g. using phorbol esters) to produce virus antigens and particles.

3.2 Transformation of macaque B cells with herpesvirus papio B cells from macaques like Rhesus monkeys (Macaco, mulatd) and cynomolgus monkeys (Macaca fascicularis) can be transformed by herpesvirus papio, an EBV-like virus of baboons (Papio hamadryas) (71-73). The herpesvirus papio-producer cells S594 (71) are seeded at 2 X 105/ml in complete RPMI and cultivated for 10 d at 37 °C. The supernatant is then filter-sterilized and stored in aliquots at -80 °C. Transformation of fresh macaque mononuclear cells is performed in the same way as for the human EBV protocol. The success rate seems to be lower than seen with human B cells and EBV (73). In a similar way, the Rhesus lymphoma cell-line LCL 8664 (ATCC CRL-1805) can be used to produce Rhesus-EBV (74). The cells are seeded at 2 X 105/ml in complete RPMI medium and cultivated for 10 d at 37 °C and thereafter for 10 d at 33 °C, before the virus-containing supernatant is harvested. The use of human AB serum instead of PCS when employing Rhesus-EBV for B-cell 70

5: Viral transformation of lymphocytes transformation has been recommended (73). The generation of macaque Bcell lines is hampered by the contamination of the macaque colonies at most primate centres by simian foamy virus. Cultivation of the B cells in presence of 4 uM AZT may suppress virus reactivation and giant cell formation, but this leads to considerable B-cell toxicity (73).

Acknowledgements Original work underlying this article was supported by the Deutsche Forschungsgemeinschaft (Bonn), the Bayerische Forschungsstiftung (Munchen), the Bundesministerium fur Bildung und Forschung (Bonn), the Johannes and Frieda Marohn-Stiftung, the Wilhelm-Sander-Stiftung (Neustadt/ Donau), and the EU (Shared Cost Action Project on immunoregulatory aspects of T-cell autoimmunity in multiple sclerosis). The authors thank Bernhard Fleckenstein for his continuous support.

References 1. Schneider, U., Schwenk, H. U., and Bornkamm, G. (1977). Int. J. Cancer, 19,621. 2. Broker, B. M., Tsygankov, A. Y., Muller-Fleckenstein, I., Guse, A. H., Chitaev, N. A., Biesinger, B., Fleckenstein, B., and Emmrich, F. (1993). J. Immunol, 151, 1184. 3. Faller, D. V., Crimmins, M. A., and Mentzer, S. J. (1988). J. Virol, 62,2942. 4. Miyoshi, I., Kubonishi, I., Yoshimoto, S., Akagi, T., Ohtsuki, Y., Shiraishi, Y., Nagata, K., and Hinuma, Y. (1981). Nature, 294,770. 5. Persaud, D., Munoz, J. L., Tarsis, S. L., Parks, E. S., and Parks, W. P. (1995). /. V(>0/.,69,6297. 6. Popovic, M., Lange Wantzin, G., Sarin, P. S., Mann, D., and Gallo, R. C. (1983). Proc. NatlAcad. Sci. USA, 80, 5402. 7. Yamamoto, N., Okada, M., Koyanagi, Y., Kannagi, M., and Hinuma, Y. (1982). Science, 217,737. 8. Yoshida, M., Miyoshi, I., and Hinuma, Y. (1982). Proc. Natl Acad. Sci. USA, 79, 2031. 9. Inatsuki, A., Yasukawa, M., and Kobayashi, Y. (1989). /. Immunol., 143,1327. 10. Yssel, H., de Waal Malefyt, R., Due Dodon, M. D., Blanchard, D., Gazzolo, L., de Vries, J. E., and Spits, H. (1989). /. Immunol., 142,2279. 11. Biesinger, B., Muller-Fleckenstein, L, Simmer, B., Lang, G., Wittmann, S., Platzer, E., Desrosiers, R. C., and Fleckenstein, B. (1992). Proc. NatlAcad. Sci. USA, 89, 3116. 12. Meinl, E., Hohlfeld, R., Wekerle, H., and Fleckenstein, B. (1995). Immunol. Today, 16, 55. 13. Fickenscher, H. and Fleckenstein, B. (1998). In Methods in microbiology, Vol. 25, p. 573. Eds. S. H. E. Kaufmann and D. Kabelite. Academic Press, San Diego. 14. Nilsson, K. and Klein, G. (1982). Adv. Cancer Res., 37,319. 15. Tosato, G. (1997). In Current protocols in immunology (ed. J. E. Coligan, A. M. Kruisbeek, D. H. Margulies, E. M. Shevach, and W. Strober), p. 7.22.1. Wiley, NY. 71

Edgar Meinl and Helmut Fickenscher 16. Melendez, L. V., Daniel, M. D., Hunt, R. D., and Garcia, F. G. (1968). Lab. Anim. Care, 18,374. 17. Roizman, B., Desrosiers, R. C., Fleckenstein, B., Lopez, C., Minson, A. C., and Studdert, M. J. (1992). Arch. Virol, 123,425. 18. Albrecht, J. C., Nicholas, J., Biller, D., Cameron, K. R., Biesinger, B., Newman, C., Wittmann, S., Craxton, M. A., Coleman, H., Fleckenstein, B., and Honess, R. W. (1992). /. Virol., 66,5047. 19. Chang, Y., Cesarman, E., Pessin, M. S., Lee, F., Culpepper, J., Knowles, D. M., and Moore, P. S. (1994). Science, 266,1865. 20. Falk, L. A., Wolfe, L. G, and Deinhardt, F. (1972). /. Natl Cancer Inst., 48, 1499. 21. Wright, J., Falk, L. A., Collins, D., and Deinhardt, F. (1976). J. Natl Cancer Inst., 57, 959. 22. Ablashi, D. V., Schirm, S., Fleckenstein, B., Faggioni, A., Dahlberg, J., Rabin, H., Loeb, W., Armstrong, G., Peng, J. W., Aulahk, G., and Torrisi, W. (1985). / Virol, 55, 623. 23. Duboise, S. M., Guo, J., Czajak, S., Desrosiers, R. C., and Jung, J. U. (1998). /. Virol, 72,1308. 24. Fleckenstein, B. and Desrosiers, R. C. (1982). In The herpesviruses (ed. B. Roizman), p. 253. Plenum, NY. 25. Knappe, A., Thurau, M., Niphuis, H., Killer, C., Wittmann, S., Kuhn, E.-M., Rosenwirth, B., Fleckenstein, B., Heeney, J., and Fickenscher, H. (1998). / Virol., 72,3469. 26. Knappe, A., Miller, C., Niphuis, H., Fossiez, F., Thurau, M., Wittmann, S., Kuhn, E.-M., Lebecque, S., Banchereau, J., Rosenwirth, B., Fleckenstein, B., Heeney, J., and Fickenscher, H. (1998). /. Virol. 72,5797. 27. Medveczky, M. M., Szomolanyi, E., Hesselton, R., DeGrand, D., Geek, P., and Medveczky, P. G. (1989). /. Virol., 63,3601. 28. Medveczky, P., Szomolanyi, E., Desrosiers, R. C., and Mulder, C. (1984). /. Virol., 52, 938. 29. Biesinger, B., Trimble, J. J., Desrosiers, R. C., and Fleckenstein, B. (1990). Virology, 176,505. 30. Chou, C. S., Medveczky, M. M., Geek, P., Vercelli, D., and Medveczky, P. G. (1995). Virology, 208,418. 31. Desrosiers, R. C., Silva, D. P., Waldron, L. M., and Letvin, N. L. (1986). J. Virol., 57,701. 32. Kiyotaki, M., Desrosiers, R. C., and Letvin, N. L. (1986). /. Exp. Med., 164,926. 33. Knappe, A., Hiller, C., Thurau, M., Wittmann, S., Hofmann, H., Fleckenstein, B., and Fickenscher, H. (1997). /. Virol., 71,9124. 34. Schirm, S., Miiller, I., Desrosiers, R. C., and Fleckenstein, B. (1984). J. Virol, 49, 938. 35. Szomolanyi, E., Medveczky, P, and Mulder, C. (1987). J. Virol, 61,3485. 36. Meinl, E., Fickenscher, H., Hoch, R. M., de Waal Malefyt, R., 't Hart, B. A., Wekerle, H., Hohlfeld, R., and Fleckenstein, B. (1997). Virology, 229,175. 37. Feldmann, G., Fickenscher, H., Bodemer, W., Spring, M., Nisslein, T., Hunsmann, G., and Dittmer, U. (1997). Virology, 229,106. 38. Akari, H., Mori, K., Terao, K., Otani, I., Fukasawa, M., Mukai, R., and Yoshikawa, Y. (1996). Virology, 218,382. 72

3: Viral transformation of lymphocytes 39. Alexander, L., Du, Z., Rosenzweig, M., Jung, J. U., and Desrosiers, R. C. (1997). J. ViroL, 71,6094. 40. Simmer, B., Alt, M., Buckreus, L, Berthold, S., Fleckenstein, B., Platzer, E., and Grassmann, R. (1991). J. Gen. Virol, 72,1953. 41. Daniel, M. D., Silva, D., Jackman, D., Sehgal, P., Baggs, R. B., Hunt, R. D., King, N. W., and Melendez, L. V. (1975). Bibl. Haematol., 43,392. 42. Daniel, M. D., Melendez, L. V., and Barahona, H. H. (1972). J. Natl Cancer Inst., 49,239. 43. Desrosiers, R. C. and Falk, L. A. (1982). J. Virol., 43, 352. 44. Fleckenstein, B., Muller, L, and Werner, J. (1977). Int. J. Cancer, 19,546. 45. Berend, K. R., Jung, J. U., Boyle, T. J., DiMaio, J. M., Mungal, S. A., Desrosiers, R. C., and Lyerly, H. K. (1993). J. Virol., 67,6317. 46. Fickenscher, H., Meinl, E., Knappe, A., Wittmann, S., and Fleckenstein, B. (1996). Immunologist, 4,41. 47. Saadawi, A. M., L'Faqihi, F., Diab, B. Y., Sol, M. A., Enault, G., Coppin, H., Cantagrel, A., Biesinger, B., Fleckenstein, B., and Thomsen, M., (1997). Tissue Antigens, 49,431. 48. Fickenscher, H., Biesinger, B., Knappe, A., Wittmann, S., and Fleckenstein, B. (1996).J. Virol, 70, 6012. 49. Fickenscher, H., Bokel, C., Knappe, A., Biesinger, B., Meinl, E., Fleischer, B., Fleckenstein, B., and Broker, B. M. (1997). J. Virol, 71,2252. 50. Klein, J. L., Fickenscher, H., Holliday, J. E., Biesinger, B., and Fleckenstein, B. (1996). J. ImmunoL, 156,2754. 51. Pacheco Castro, A., Marquez, C., Toribio, M. L., Ramiro, A. R., Trigueros, C., and Regueiro, J. R. (1996). Int. ImmunoL, 8,1797. 52. Yasukawa, M., Inoue, Y., Kimura, N., and Fujita, S. (1995). /. Virol., 69, 8114. 53. Nick, S., Fickenscher, H., Biesinger, B., Born, G., Jahn, G., and Fleckenstein, B. (1993). Virology, 194,875. 54. O'Donnell Tormey, J., Nathan, C. F., Lanks, K., DeBoer, C. J., and de la Harpe, J. (1987). J. Exp. Med., 165,500. 55. Medveczky, M. M., Geek, P., Sullivan, J. L., Serbousek, D., Djeu, J. Y., and Medveczky, P. G., (1993). Virology, 196,402. 56 Mittriicker, H. W., Muller-Fleckenstein, L, Fleckenstein, B., and Fleischer, B. (1992). J. Exp. Med., 176, 909. 57. Saha, K., Sova, P., Chao, W., Chess, L., and Volsky, D. J. (1996). Nature Med., 2, 1272. 58. De Carli, M., Berthold, S., Fickenscher, H., Muller-Fleckenstein, L, D'Elios, M. M., Gao, Q., Biagiotti, R., Giudizi, M. G., Kalden, J. R., Fleckenstein, B., Romagnani, S., and Del Prete, G. (1993). J. ImmunoL, 151, 5022. 59. Mittriicker, H. W., Muller-Fleckenstein, L, Fleckenstein, B., and Fleischer, B. (1993). Int. ImmunoL, S, 985. 60. Weber, F., Meinl, E., Drexler, K., Czlonkowska, A., Huber, S., Fickenscher, H., Muller-Fleckenstein, L, Fleckenstein, B., Wekerle, H., and Hohlfeld, R. (1993). Proc. NatlAcad. Sci. USA,9Q, 11049. 61. Kraft, M. S., Henning, G., Fickenscher, H., Lengenfelder, D., Tschopp, J., Fleckenstein, B., and Meinl, E. (1998). /. Virol., 72,3138. 62. Broker, B. M., Kraft, M. S., Klauenberg, U., Le Deist, F., de Villartay, J.-P., Fleckenstein, B., Fleischer, B., and Meinl, E. (1997). Eur. J. ImmunoL, 27,2774. 73

Edgar Meinl and Helmut Fickenscher 63. Meuer, S. C., Hussey, R. E., Fabbi, M., Fox, D., Acuto, O., Fitzgerald, K. A., Hodgdon, J. C., Protentis, J. P., Schlossman, S. F., and Reinherz, E. L. (1984). Cell, 36, 897. 64. Gardella, T., Medveczky, P., Sairenji, T., and Mulder, C. (1984). J. Viral, 50, 248. 65. Broker, B. M., Tsygankov, A. Y., Fickenscher, H., Chitaev, N. A., Schulze-Koops, H., Muller-Fleckenstein, L, Fleckenstein, B., Bolen, J. B., and Emmrich, F. (1994). Eur. J. Immunol., 24, 843. 66. Bankier, A. T., Dietrich, W., Baer, R., Barrell, B. G., Colbere Garapin, F., Fleckenstein, B., and Bodemer, W. (1985). J. ViroL, 55,133. 67. Knappe, A., Feldmann, G., Dittmer, U., Meinl, E., Nisslein, T., Wittmann, S., Kirchner, T., Matz-Rensing, K., Bodemer, W., and Fickenscher, H. (1999). (Submitted for publication). 68. Nutman, T. B. (1997). In Current protocols in immunology (ed. J. E. Coligan, A. M. Kruisbeek, D. H. Margulies, E. M. Shevach, and W. Strober), p. 7.20.1. Wiley, NY. 69. Sugden, B. and Mark, W. (1977). J. ViroL, 23, 503. 70. Luka, J, Lindahl, T., and Klein, G. (1978). J. ViroL, 27, 604. 71. Falk, L., Deinhardt, F., Nonoyama, M., Wolfe, L. G., and Bergholz, C. (1976). Int. J. Cancer, 18,798. 72. Rabin, H., Neubauer, R. H., Hopkins, R. F., Dzhikidze, E. K., Shevtsova, Z. V., and Lapin, B. A. (1977). Intervirology, 8, 240. 73. Voss, G., Nick, S., Stahl Hennig, C., Ritter, K., and Hunsmann, G. (1992). J. ViroL Methods, 39,185. 74. Rangan, S. R., Martin, L. N., Bozelka, B. E., Wang, N., and Gormus, B. J. (1986). Int. J. Cancer, 38,425.

74

4

B- and T-cell hybridomas JUDY M. BASTIN

1. Introduction In 1975, Kohler and Milstein (1) described details of a powerful method in which B cells secreting antibody of one specificity could be fused with a continuously growing plasmacytoma. The fusion product is called a hybridoma, and it will express the immunoglobulin genes from both the normal antibodyforming B cell and the plasmacytoma. It will inherit the potential for unlimited growth from the continuously growing plasmacytoma parent and the genetic material determining a given antibody specificity from the antibodysecreting parent. The methods used to generate T-cell hybridomas are essentially the same as for B-cell hybridomas, and in 1978 Kontiainen et al. (2) and Taniguchi and Miller (3) isolated the first T-cell hybrid clones. Antigenspecific normal T cells are fused to a T-cell tumour line. The production of B- and T-cell hybridomas has become routine in many laboratories. Once the need for these reagents has been established those laboratories that are inexperienced in this area may have to decide whether to devote resources to establishing the technology or to approach commercial groups to make the hybridomas for them. The aim of this chapter is to help the reader make the right decision. The chapter does not attempt a complete review of methodology; the intention is to provide the reader with a broad understanding of the techniques and equipment needed to make hybridomas and to give advice on any problems they might encounter.

2. Methods for generating B- and T-cell hybridomas and the principles of hybridoma culture No two laboratories use exactly the same technique and many of these variations are based on empirical observations. This implies that there is much potential for flexibility in the methods. However, at first it is better to follow protocols exactly to avoid difficulties. The first question to ask is whether Bor T-cell hybridomas are appropriate for the problem being addressed. Conventional antisera or continuous cultures of T-cell clones may be equally

JudyM. Bastin good or even preferable to hybridomas. For example, the monoclonal antibodies raised may be of the wrong isotype to fix complement, may recognize an unwanted epitope away from the part of the antigen being studied, or may produce a low-affinity reagent. Also, although T-cell clones can be difficult to maintain, they may be more physiologically relevant than an artificial fusion product.

2.1 Tissue culture Making hybridomas requires experience in cell culture, and a good sterile technique is essential in tissue culture laboratories. The reader is referred to the principles outlined in the first chapter, or a basic cell-culture methods' manual (4). Realistically, the production of hybridomas may require months of tissue culture work. The sequence of events in making hybridomas is shown below and the reader will be taken through each of these step by step. (a) preparation of antigen; (b) development of a screening test; (c) immunization of the animals; (d) screening animal sera; (e) fusion protocol; (f) screening supernatants; (g) cloning and cryopreservation; (h) screening colonies from cloning plates; (i) cryopreserving, recloning, and retesting; (j) final cryopreservation of hybridomas. At each point cryopreservation is emphasized, as it is the only insurance against the loss of useful cultures.

2.2 Materials The equipment needed for the production of hybridomas is listed below and is likely to be available in most laboratories. All the materials can be purchased from commercial suppliers, e.g. Sigma or Gibco BRL. Routine cell-culture media is used, such as RPMI-1640 supplemented with fetal calf serum (PCS). Batches of PCS should be screened for their ability to support hybridoma growth, and pre-screened batches are available commercially. There are a number of calf sera variants available. For example, agamma (Ig-depleted) calf serum has been shown to produce twice as much immunoglobulin as standard PCS, both in human and mouse hybridoma lines (5), and the subsequent purification of a monoclonal antibody is easier if there is no bovine IgG present. Medium containing hypoxanthine, aminopterin, and thymidine (HAT) is 76

4: B- and T-cell Hybridomas used for the selective growth of hybrids after fusion (see Section 2.3): HAT supplement (100 x) is available from Sigma. Polyethylene glycol (PEG) is the fusion-inducing agent. Batches of PEG vary in their toxicity and ability to induce fusions (6), so screening batches for their suitability is worthwhile. A sterile 50% solution of PEG in serum-free RPMI is used. The pH of the solution should be between 7.2 and 8.0. The following equipment is needed for the generation of hybridomas: • • • • • • • • •

carbon-dioxide 37 °C incubator; class-II, tissue culture hood; inverted phase-contrast microscope; liquid-nitrogen storage facilities; centrifuge; access to a good animal facility; sterile tissue culture plasticware and pipettes; 37 °C water bath; relevant fusion-partner for B- or T-cell hybridomas.

2.3 Selection procedures When fusing two different cell types, the frequency of fusion is low (about 1 in 104). The potential of the neoplastic plasmacytoma or T-cell tumour lines for continuous growth means they will rapidly outcompete the minority hybridomas, so a strategy is necessary to eliminate the non-fused cells. The method most commonly in use was developed by Littlefield (7), and relies on the initial generation of mutant plasmacytomas lacking the enzymes responsible for the incorporation of purines and pyrimidines into DNA and RNA. Cells with mutations resulting in the functional absence of the enzymes thymidine kinase (TK) or hypoxanthine guanine phosphoribosyl transferase (HGPRT) will be the only cells to survive when these toxic base analogues are incorporated into the growth medium. Once these mutant lines have been isolated it is possible to select against the growth of the enzyme-deficient lines by forcing them to use the salvage pathway for DNA synthesis. Aminopterin blocks the normal pathway for purine and pyrimidine synthesis, and when it is added to the growth medium the plasmacytoma is forced to use the salvage pathway and cannot survive in HAT medium. Spleen cells fused to the HGPRT- or TK- plasmacytoma cells during hybrid formation enable the hybridomas to survive in the HAT medium. The unfused T or B cells do not proliferate in vitro, and will eventually die.

2.4 Immunizations Once the decision to make hybridomas has been made it is advisable to start the immunization protocol as soon as possible, as the whole procedure will 77

Judy M. Bastin take many weeks. The protocols for the immunization of animals are many and varied. However, in general, spleens are taken from hyperimmunized mice or rats 3 or 4 days after the last injection. Soluble antigen is best delivered with an adjuvant: complete Freund's adjuvant (CFA) is still a popular and efficient choice, but can cause some side-effects for the animals. Other newer adjuvants have been released which are said to be as good as CFA, but with fewer side-effects (8, 9). A secondary booster is given at a variable time after the primary injection, but never in CFA because of the risk of anaphylactic shock to the animal. It may be given in incomplete Freund's adjuvant (ICFA), which lacks the mycobacteria present in the complete form. Live allogeneic and xenogeneic cells are highly immunogenic and are injected intraperitoneally (see Protocol 1 for details of immunization procedures). We have recently used transgenic mice for making a monoclonal antibody to a non-classical HLA class-I protein (10). The aim was to make an antibody capable of distinguishing between classical HLA class-I proteins and the very similar, but less common, non-classical HLA class-I protein HFE. We decided to immunize an HLA B27 class-I transgenic mouse, which should be incapable of making an antibody to that molecule or closely related classical class-I molecules. A specific antibody that recognized HFE protein only and not classical class-I or other non-classical proteins was readily achieved by immunizing with recombinant refolded HFE protein, according to Protocol 1. It is clear that other transgenic animals could be used in this way to make antibodies to proteins that have very similar structures to the transgene product. Protocol 1. Immunization procedures Equipment and reagents • Complete Freund's adjuvant (CFA) • Incomplete Freund's adjuvant (ICFA) . Phosphate-buffered saline (PBS), pH 7.0

A. 1. 2. 3. 4.

• Sterile syringes and needles • Blood collection containers

Soluble antigens Day 1: Inject 50-100 ug of the antigen in CFA subcutaneously. Day 14: Repeat. Day 28: Repeat and test bleed. Inject 50 ug of the antigen in ICFA intravenously 4-5 days before fusion.

B. Cellular antigens 1. Day 1: Inject 5 x 106 washed cells (spin at 300 g for 10 min at room temperature) in PBS intraperitoneally. 2. Day 28: Repeat and test bleed. 3. Repeat with the same number of cells 4—5 days before fusion. 78

4: B- and T-cell Hybridomas

2.5 Fusion partners A number of myeloma or T-cell tumour lines are available for fusion. In the mouse, where there is the greatest choice and experience for antibody production, there is no apparent reason, apart from ready availability, for using a line that retains the ability to code for its own Ig light or heavy chains, since this might complicate the process of monoclonal hybridoma selection. However, both non-secretor and secretor myelomas have been used successfully. Some commonly used mouse myeloma lines used for hybridoma antibody production are: SP2/0-Agl4 (11), P3-X63-Ag8.653 (12), P3-NSl/l-Ag4-l (13), and NSO, a non-secreting clone of P3X63 Ag8 (14). Besides the ability to efficiently yield functional and stable hybridomas, the tumour lines must possess a drug marker that makes it easy to select hybrids. The most common murine T lymphoma is the AKR thymoma BW5147. Other T-cell tumour cell lines are another AKR thymoma, AKR-A, or EL-4 a C57BL/6 lymphoma. The maintenance and health of the fusion partner is of paramount importance in the eventual success of the fusion. Myeloma cells that have been growing for a long time or that have become overgrown are less successful at producing hybridomas than freshly grown cells. It is best to thaw myeloma cells from liquid nitrogen just days prior to the fusion procedure. It is almost impossible to yield successful hybridomas from mycoplasma-infected cells. Mycoplasma infection will reduce the efficiency of fusion and markedly affect the antibody secretion of the few hybridomas formed. Regular mycoplasma screening of all cell lines is therefore an essential part of hybridoma production, and it is better not to start a fusion protocol if cells have not been screened. The HAT sensitivity of the myelomas or thymomas to be used as fusion partners should be checked periodically by attempting to grow a subculture in HAT medium; if growth occurs, a stock culture should be grown in the presence of 10-4 M 8-azaguanine or discarded.

2.6 Fusion protocol There are many variations of the 'standard' fusion protocol. The one described in Protocol 2 has been used in the author's laboratory to produce monoclonal antibodies against a variety of antigens, ranging from cell-surface antigens to soluble proteins. In addition to using PEG as an agent to induce membrane fusion, there are less frequently used alternatives, such as electroporation, that are useful when low numbers of B cells are available for fusion. It is helpful to go through a checklist (see Protocol 2, Equipment and reagents list) and assemble all the reagents before starting the fusion protocol (Protocol 2).

79

Judy M. Bastin Protocol 2.

Fusion

Equipment and reagents Immunized mouse NSI or other fusion-partner cells (107) One sterile Petri dish Eight 24 x 2-ml or ten 96 x 0.2-ml well plates Plastic centrifuge tubes Sterile 1 ml and 10 ml pipettes Sterile Pasteur pipettes Sterile dissecting instruments

. RPMI-1640 at 37 °C . FCS at 37 °C . 37 °C water bath • Humidified 5% CO2-air incubator • 2 x hypoxanthine, aminopterin, thymidine (HAT) . Sterile 50% PEG in RPMI-1640 at 37°C • Timer

Method 1. Kill the mouse in a C02 chamber by cervical dislocation. 2. Soak the mouse in ethanol and open the skin. 3. Use sterile scissors and forceps to open the peritoneum and remove the spleen. 4. Place the spleen in a Petri dish containing 5 ml of serum-free medium (usually RPMI-1640) and cut it in half. Tease the cells out using sterile instruments. 5. Pipette these cells into a sterile plastic tube and allow the clumps to settle over 5 min. 6. Transfer the cells to a second plastic tube and centrifuge at 300 g for 10 min at room temperature. 7. Take 107 fusion-partner cells, wash them free of medium, and pellet by centrifugation (as step 6). 8. Resuspend the two pellets in 5 ml of serum-free medium, mix together, and centrifuge at 300 g for 10 min. Mix the splenic lymphocytes and fusion-partner cells at a ratio of 10:1.a 9. Gently tap the tube to disrupt the pellet and place the tube in a 37°C water bath. 10. Add 1 ml of a 50% PEG and medium mixture at 37°C dropwise to the cell pellet over 1 min. 11. Add 2 ml of pre-warmed serum-free medium, starting immediately, dropwise over 2 min; then add 8 ml over a further 3 min. 12. Spin the cells at 300 g for 10 min. Gentlyb resuspend the cells in the required volume of RPMI-1640 with 20% FCS and plate out.c 13. Place the plates at 37°C in a humidified 5% CO2-air incubator. 14. Add, 24 h later, an equal volume (100 ul for a microtitre plate or 1 ml for a 2-ml well plate) of RPMI-1640/20% FCS supplemented with 2 X HAT to each well. 80

4: B- and T-cell Hybridomas 15. Leave the plates to stand in the incubator until colonies appear (between 7 and 10 days). * For more accuracy you may want to count the spleen cells after lysing the red cells and adjust the number of fusion-partner cells accordingly. bBe very gentle at this stage because the cell-fusion products are susceptible to damage by shear forces. cVarious plating-out procedures are favoured by different workers, e.g. microtitre wells or larger 2 ml wells or a combination of the two. The smaller wells have the advantage that most wells in which cultures grow will contain only one colony (often equivalent to a clone) of hybrid cells, but the disadvantage is that the volume of supernatant available for assay is small.

2.7 Growth of hybridomas Following the plating out of cells in the HAT medium, the cells should be left for at least 7 days. After this time small colonies may appear. As the colonies grow, remove some supernatant and test for antibody or specific T-cell activity in the screening assay. We usually screen only those with single colonies. Obviously, this policy means that some hybridomas will be undetected, so if time allows screening can be extended to wells containing two or three colonies. However, if you do this you will have to separate and clone any positive colonies immediately. This can be a very busy time, and the benefits of a rapid, reliable screening assay cannot be overemphasized! Improved yields of hybridomas are obtained by the addition of feeder cells or various growth factors. The active ingredient of 'hybridoma growth factor' is interleukin-6 (IL-6), the addition of which can increase the yield of monoclonal antibodies. A variant of the Sp2/0 myeloma transfected so that it produces IL-6 is reported to improve hybridoma yields by up to 15-fold (15) In the absence of IL-6 or the Sp2/0 variant, add feeder cells (106/ml): these are usually spleen cells from a non-immunized mouse. It is very easy to lose valuable hybridomas at this vulnerable stage, and great care in cell-culture technique is required.

2.8 Screening assays It is of paramount importance to decide on, and test in good time, a suitable assay to screen hybridoma culture supernatants or T-cell hybridomas: this really cannot be overemphasized. The need to test the animal sera before fusion provides the ideal opportunity to optimize the assay. It is important to include normal mouse sera as a control. The more specific and simple the screening test, the better the chance of quickly and easily obtaining the desired hybridoma, but the procedure for screening for B-cell hybridomas is very different from that for T-cell hybridomas. The nature of the antigen will often dictate the screening assay. For example, hybridomas producing antibodies to cell-surface antigens can be examined quickly and easily by immunofluorescence, while immunoenzyme 81

Judy M. Bastin techniques are more suitable for tissue sections and enzyme-linked immunosorbent assays (ELISAs) for soluble antigens. The screening method chosen should reflect the techniques in which you want to use the antibody. Antibodies that react against fixed tissue will not necessarily react with fresh tissue; some antibodies work very well in one assay but not in another. It is important to have purified antigen for the assay, since antibodies against impurities in the immunizing material will react if the screening material contains the same impurities. It is also quite important to discover the isotype of the monoclonal antibody before the final choice of hybridoma is made. Some isotypes, e.g. IgG1, do not fix complement. IgM antibodies are difficult to store without loss of specificity. IgG3 antibodies are very useful for double-labelling studies as the majority of monoclonal markers are IgG1. The reader is referred to ref. 16 for details of the basic immunological methods mentioned in this section. The screening of T-cell hybridomas will depend on the T-cell phenotype. Thus, antigen-specific suppressor hybridomas are isolated by their ability to bind to antigen-coated plates (a panning procedure) or antigen-coated erythrocytes (a rosetting technique). Antigen-specific helper hybridomas are screened by examining their lymphokine-producing capability in an antigen-specific and MHC-restricted manner. Cytotoxic T-cell hybridomas are selected by a standard CTL assay using an appropriate target (as described in Chapter 7) In essence, the assay chosen must be specific, sensitive, and allow the rapid screening of large numbers of samples.

2.9 Cloning hybridomas Once the screening assay indicates that a well contains a hybridoma of interest, the contents of the well should be cloned as soon as possible. There are several reasons for cloning, the main one being to ensure that a monoclonal reagent is produced. However, it is also important to clone positive wells to prevent them being overgrown by non-specific cells. The most common cloning method is that of limiting dilution, in which wells are plated out from a starting culture into a number of individual wells so that the most likely number of cells in any given well is one. Poisson's distribution then predicts that 37% of wells will end up without cells. However, because the cloning efficiency may be low, it is advisable to clone at predicted frequencies of both one and three cells per well, and to plate out a minimum of 96 wells per concentration. Details of the cloning method used is shown in Protocol 3. Protocol 3. Cloning hybridomas Equipment and reagents • • • •

Non-immunized mouse Non-sterile and sterile scissors and forceps 96-well microtitre plates RPMI-1640 medium

82

• RPMI-1640 supplemented with HAT (see Protocol 2} • Sterile Pasteur pipettes • Liquid nitrogen

4: B- and T-cell Hybridomas Method 1. Kill a non-immunized mouse and remove the spleen aseptically (see Protocol 2). Make a single-cell suspension (see Protocol 2, steps 4-6) to provide the feeder layer for cloning. 2. If there is a single colony present in a well, transfer this to a new well.a 3. After removing cells for cloning, feed the cells remaining in the well with medium and feeder cells (106/ml). Allow the cells to proliferate, then freeze into liquid nitrogen as soon as possible to act as a back-up if the cloned cells do not survive. 4. Count the cells in the well and prepare suspensions at 30 and 10 cells/ ml in 20 ml HAT medium. Add feeder cells to a final concentration of 2 x 105/ml. Plate the mixture into 96-well microtitre plates at 200 ul/well. 5. After 7-21 days test the supernatant from wells containing single colonies and, if positive, expand the cultures and freeze in liquid nitrogen. aUsually, however, a single colony cannot be distinguished. In this case mix the contents of the well by gentle pipetting and transfer the contents to a new well in a microtitre plate).

2.10 Cryopreserving and thawing cells Preserving cells in liquid nitrogen is the only means of ensuring the long-term availability of hybridomas. Cells should be frozen down as soon as possible and their details recorded. The methods used for both freezing and thawing cells are shown in Protocol 4. Protocol 4. Freezing and thawing hybridomas Equipment and reagents « • • • •

• RPMI-1640 supplemented with HAT • RPMI-1640 medium supplemented with HAT, 50% FCS, 20% DMSO (freezing medium) • Polystyrene container with >1-cm thick walls

-80 °C freezer Cryotubes Liquid nitrogen 37 °C water bath Culture flasks or flat-bottomed microtitre plates

?-well

A. Freezinga 1. Take the cells from culture, spin at 300 g for 10 min at room temperature, and resuspend them at about 5 x 106/ml in HAT medium with 50% FCS and 20% dimethyl sulfoxide (DMSO). Gently mix the suspension and dispense into commercially available cryotubes. 2. After sealing and labelling the tubes, place them in the polystyrene container. 83

Judy M. Bastin Protocol 4.

Continued

3. Put this container into a -80°C freezer for 24 h. Then transfer it into liquid nitrogen. B. Thawing 1. Remove a vial from liquid nitrogen and warm it in your hand or in a 37°C water bath. 2. Remove the vial when the ice has just melted and dilute the cell suspension by the dropwise addition of an equal volume of HAT medium. Add another equal volume of medium and leave for 5 min. 3. Centrifuge the cells at 300 g for 5 min. at room temperature. 4. Resuspend the cells in a 5 ml millilitres of freezing medium and add either to a culture flask or a flat-bottomed 96 well plate. Add feeder cells (5 x 105/ml) and IL-6 (10U/ml) if the cells are slow to recover. aWhere possible a controlled-rate freezing system is preferable for very valuable hybridomas.

2.11 Large-scale production of hybridomas Recently, medium- to large-scale in vitro methods of antibody production have become more accessible to most research laboratories; hence, the use and justification for using ascitic fluid has decreased. The generation of peritoneal tumours in mice has been banned in some countries, including the United Kingdom. Monoclonal antibodies can be produced in dialysis tubing, where the antibody yields are up to 1 mg/ml (standard culture supernatant is up to 5 ug/ml). A high concentration of cells (107/ml) in 10 ml of medium supplemented with 10% FCS is placed in a dialysis tube (pore size 12000-14000) and then into an 800-ml tissue culture flask The flask is fed with RPMI-1640 medium containing 2% FCS and 2% primatone (Kraft, Norwich, NY, USA) and placed in a rotator in a CO2 incubator (17). A similar system using dialysis tubing fixed inside a roller bottle was described by Pannell and Milstein in 1992 (18). The yield of 1-2 mg/ml obtained with this method is good. The reader is referred to Andersen and Gruenberg (19) and von Wedel (20) for more information on other largescale production methods.

2.12 Purification There are numerous methods available for purifying monoclonal antibodies, but the method selected should reflect the intended use of the antibody. Sometimes the culture supernatant may be of sufficient purity for use. It is clear from the vast amount of literature on optimized purification procedures 84

4: B- and T-cell Hybridomas that no one procedure is suitable for all monoclonal antibodies, and the reader is referred to ref. 16 for a review of methods. The single, most useful purification procedure for monoclonal antibodies is affinity purification on protein G. It is simple and has the additional advantage of concentrating the antibodies, which can be particularly useful when dealing with large volumes of culture supernatant containing low concentrations of antibody (see Protocol 5 for details). At between pH 6.0 and pH 8.0, the Fc portions of all subclasses of IgG are bound to the protein G matrix. Once all the crude antibody has been applied to the column and washed with a number of column volumes of loading buffer, the purified antibody can be eluted from the column with buffers ranging from pH 4 to pH 2. An important early step is to determine the least acidic pH at which the antibody can be eluted. This will minimize any possible denaturing of the antibody. The protein G can be packed into a 5-ml syringe barrel with a glass-wool plug at the bottom. Protocol 5. Protein G purification Equipment and reagents • Protein G column (e.g. 5 ml syringe barrel with a glass-wool plug at the bottom) • Loading buffer: 0.02 sodium phosphate pH 7.4

• 5 ml collection tubes • Elution buffer: 0.1 M glycine HCI at the previously determined pH (see text above) • Neutralizing agent: 1 M Tris HCI, pH 9.0

Method 1. Wash the column with a 5 column volumes of the loading buffer. 2. Load the sample at a flow rate of less than 1 ml per min. 3. Once all the sample has been loaded, wash through with three column volumes of loading buffer or until the optical density at 280 nm is back to baseline levels. 4. Apply the elution buffer and collect the antibody fraction in a 5 ml tube containing 0.5 ml of the neutralizing agent. 5. Determine the antibody concentration using a spectrophotometer.

2.13 Human hybridomas To produce unaltered human antibodies or to obtain large numbers of human T cells it is necessary to immortalize human B or T lymphocytes. The generation of human antibody-secreting B-cell hybridoma lines was initially very encouraging (21, 22), but subsequently results have been inconsistent. One should remember that the antibodies from immortalized human B cells will not necessarily exactly reflect the human antibody repertoire. The 85

Judy M. Bastin monoclonal antibodies developed may present a biased selection, depending on the source of the B cells and the subsequent manipulations of the cells in vitro. Human B-cell hybridomas are generally stable, but not all B cells fuse equally well. In recent years, research has focused on the source of B cells for fusion, the choice of fusion partners, and the mechanism of fusion. For details of this research refer to ref. 23. There is now a large number of available human antigen-specific B hybridomas. The resultant monoclonal antibodies have made unique contributions to the development of diagnostic and therapeutic reagents. These include analysis of the human B-cell repertoire, which has led to significant insights into the origins of autoimmunity; the search for specific and therapeutic antibodies against human tumours, e.g. melanoma (24), and infectious pathogens continues. The situation for T-cell hybridomas is different. The essential method of production is to fuse PHA-activated human peripheral blood lymphocytes with a fusion partner, e.g. acute lymphatic leukaemia cells (CEM). Several experimental problems have made these cells less useful than continuous cultures of T-cell clones. T-cell hybridomas, particularly human hybrids, show a greater tendency to be functionally unstable during prolonged culture (see Section 2.15). Although human hybridomas were used in the past to study Tcell products such as interferon (25) or lymphokines (26), current literature suggests that T-cell hybridomas have been largely replaced as a research tool by continuous cultures of human T-cell clones.

2.14 Antibody production by chemical and genetic engineering The antigen-binding properties of a particular monoclonal antibody may be ideal in terms of its specificity and affinity, but its usefulness as a reagent may be limited by its isotype—such that certain effector functions cannot be harnessed in vivo, or Fc receptors on the antigen interfere with specific reactions. It may be necessary to alter the antibody by fragmentation and to change or remove the Fc region, or perhaps combine fragments of other antibody specificities to make bispecific reagents. This can be done by chemical means, e.g. proteolytic enzyme digestion to remove the Fc portion, or by genetic manipulation. The essential failure of the hybridoma method to reliably produce human monoclonal antibodies suitable for therapy has coincided with many technological advances in molecular biology. The use of transgenic mice to manipulate the production of a specific B- or T-cell parent has already been mentioned (Section 2.4) but this still yields a rodent hybridoma. The definition of antibody gene sequences led the way, via genetic manipulation, to 'humanize' what started as rodent antibodies so that they would resemble the human equivalent without losing specificity. This approach renders the reagent more 86

4: B- and T-cell Hybridomas clinically useful as there is less danger of rejection. The isolation of antibody genes enables the fine-tuning of the desired characteristics (e.g. specificity or binding affinity), which cannot be achieved by the conventional hybridoma method. The reader is referred to ref. 23 for details of this area of research. One can imagine that in the future the antibody required could be designed by computer and selected from a family of antibody gene libraries.

2.15 Disadvantages of hybridomas The general disadvantages of B-cell hybridomas over conventional antisera have already been mentioned. The specific disadvantage of the IgM isotype is that IgG antibodies are more stable and can be more easily isolated and purified. However, a high number of IgG-producing hybrids are obtained when lymph node cells are used instead of splenocytes for the fusion. The disadvantages of T-cell hybridomas are even greater. Several experimental problems with T-cell hybridomas have made them less useful than continuously growing T-cell clones. T-cell hybridomas, particularly human hybrids, show a greater tendency to functional instability during culture. This may be due to rapid chromosome loss or somatic mutations. In a study of more than 600 mouse and human hybridomas, most of the lymphocytederived chromosomes were lost (27). Therefore, it is best to keep good stocks of cloned hybridomas in frozen storage, and to redone established hybridoma lines when they have been grown continuously for long periods (more than 6 months). Another problem to be aware of is that T-cell hybridomas are not necessarily going to behave like normal antigen-specific T cells. Studies of pairs of cloned T cells and the hybridoma cells derived from them (i.e. fusion products of established T-cell clones and tumour cells) show a number of differences in activation requirements, affinity, use of CD4 molecules, lymphokine secretion, and effector functions. Possible explanations may include the use of different T-cell receptor genes from the tumour fusion partner, different gene regulation in the hybridomas, or differences in the screening methods used in their preparation. As a consequence, great care must be taken in interpreting the experimental data obtained from T-cell hybridomas.

2.16 Conclusions The aim of this section has been to provide a basic understanding of T- and Bcell hybridomas and how they are made. These days, many monoclonal antibodies are commercially available in purified form or can be supplied with a variety of enzyme or fluorescent labels attached, but these are often very expensive. It may be possible to obtain the original hybridoma and purify the antibody in-house. The time and effort involved in generating a monoclonal reagent from scratch should not be underestimated. 87

Judy M. Bastin

3. Applications of hybridoma technology 3.1 B-cell hybridomas The first B-cell hybridomas were produced in an attempt to study immunoglobulin gene expression, and have led to a much greater understanding of the genetic mechanisms of the generation of antibody diversity. The first antibodies with a particular application (those to histocompatibility antigens) were made in 1977 (28). The potential use of monoclonal antibodies as reagents was soon widely appreciated leading to a rapid growth in the field, and a whole area of the biotechnology industry developed around monoclonal antibodies. There are now entire areas of research and diagnosis that would be impossible without monoclonal antibodies, such as the detailed analysis of leucocyte phenotype (29). Many of the major applications of monoclonal antibodies in immunological studies are described elsewhere in this book. 3.1.1 Diagnostic applications of monoclonal antibodies Monoclonal antibodies have been a great success as in vitro and diagnostic reagents. They are used widely in medicine and biology to measure hormones, to identify contaminants in the food industry, to purify proteins, and to identify pathogens in human, veterinary, or plant pathology, where they have largely replaced polyclonal antisera. The reaction between an antibody and its antigen can be directly observed in vitro when an immunoprecipitate is seen at equivalent concentrations: this is the basis of antigen detection. Greater sensitivity can be attained by the use of radioimmunoassay (RIA) techniques, particularly in situations where the antibody itself is labelled with a radioisotope. Even better performance can be obtained when the radioactive label is replaced by a non-radioactive alternative such as a chemiluminescent molecule. This use of monoclonal antibodies is the basis of many diagnostic services in clinical immunology laboratories. 3.1.2 Immunolocalization using monoclonal antibodies Using the technique of immunocytochemistry, antigens can be localized within cells or tissues by the application of antibodies specific for the antigen under investigation, as described in Chapter 2. This permits the precise location of antigens implicated in diseases: one recent example is the human tissue distribution of HFE, a non-classical MUC class I protein, which is associated with hereditary haemochromatosis, a disorder of iron metabolism (10). The antigen-antibody complex can be visualized by applying various labels or markers. The reader is referred to Chapter 2 and ref. 30 for different methods of specimen preparation, both for light and electron microscopy, together with the choices of antibody and label most appropriate. 88

4: B- and T-cell Hybridomas The molecular size of an antigen can be ascertained using immunoblotting techniques (Western blots) on various tissue lysates (16). However, not all antibodies will work for this method and the need for a range of different functional antibodies of the same specificity should be appreciated. 3.1.3 Therapeutic applications of monoclonal antibodies Murine monoclonal antibodies are now the mainstay of virtually all routine diagnostic work in clinical laboratories, where they work well. However, their use in human therapy has been mainly limited by the immune response of the host to the foreign protein, known as the human anti-mouse antibody (HAMA) response, which can be minimized by humanizing the original rodent antibody. Recent developments in human recombinant antibody construction has made available a whole new range of antibody specificities, which may increase their therapeutic applications. An antibody may be used as a specific means of delivering a toxin, radiolabel, or enzymatic prodrug to its target, or to block interactions with receptors and adhesion molecules. However, it is important to remember that a monoclonal reagent may not necessarily be monospecific, since its target epitope may also be present in different antigens or cell types. Unexpected cross-reactions arise fairly frequently and have the potential to reduce clinical efficacy or cause pathological problems (31). Different specific antibodies may have different effects on the target, such as neutralization, lysis, opsonization, or antibody-dependent cytotoxicity. The most useful antibodies for therapy are those that are specific for tumour cellsurface markers, or those that can inactivate infectious agents or manipulate the immune system. The first monoclonal antibody to be approved for therapy was OKT3 in 1986 (32): this recognizes the human T-lymphocyte CD3 complex of the T-cell receptor, causing shedding of their surface T-cell receptor complexes. OKT3 has been a particularly useful immunosuppressive agent against T cell-mediated rejection of solid organ transplants. Similarly, anti CD-4 monoclonal antibody treatment has reduced synovial inflammation in patients with early rheumatoid arthritis (33) and has also been used to treat Crohn's disease (34). Humanized antibodies are made by replacing the constant regions of the rodent antibody with the human equivalent components. This technique has been extended so that just the antigen-binding CDR loops of the rodent antibody are grafted into the human framework. The first example of a fully humanized CDR-grafted antibody of therapeutic potential was CAMPATH1H (35). This was derived from a series of rat monoclonal antibodies specific for the differentiation antigen CD52, which is strongly expressed on virtually all human lymphocytes and monocytes, but not on other blood cells— including haemopoietic stem cells. This antibody has therapeutic potential for the treatment of various lymphoid malignancies, the control of graft versus host disease (GVHD) in bone-marrow transplantation, and the prevention of 89

Judy M. Bastin bone-marrow and organ rejection. Clinical results using this humanized antibody have been very encouraging (36). Monoclonal antibody treatment of lymphoid malignancies has brought some success. There is a humanized antibody against a form of the interleukin-2 receptor (IL-2R alpha) that is absent from resting T cells but present on abnormal T cells in some leukaemias and lymphomas, and on effector T cells involved in GVHD and allograft rejection. In clinical trials, a significant proportion of patients had partial or complete remissions without an antiglobulin response (37). More recently, use of a chimeric antibody directed against the B-cell specific antigen CD20 expressed on non-Hodgkin's lymphomas have been encouraging (38). The treatment of solid tumours has been less successful, although human monoclonal antibodies have been produced against melanomas (24), carcinomas of the colon (39), ovary (40), breast (41), and lung (42). There are few reports of the clinical use of solid tumour-specific antibodies, but recent preliminary data suggests that an antibody specific for an antigen (HER2/neu) expressed in an aggressive form of breast cancer, conjugated with a T-cell costimulatory molecule, B7.1, can improve the outcome for some patients (43).

3.2 T-cell hybridomas The uses of T-cell hybridomas are definitely more limited, particularly now that there are better methods for maintaining continuous T-cell cultures. Nevertheless, T-cell hybridomas can be useful when studies on more physiologically relevant T-cell populations are impossible. 3.2.1 Antigen presentation One of the most useful applications of T-cell hybridomas is in the study of antigen presentation. Antigen-specific CD4+ T-cell hybridomas will produce cytokines after specific stimulation, and this technique has been used in studies of the mechanisms of protection in diabetes (44) and the characterization of immunodominant and protective influenza haemagglutinin epitopes (45). Similarly, acetylcholine receptor-specific T-cell hybridomas have been used to study the autoimmune disorder myasthenia gravis (46, 47). Allergenspecific T-cell hybridomas have been used to study IL-5 production in cells from asthma patients (48), and hybridomas generated from lamina propria lymphocytes have been studied to examine the regulation of interleukin release by prostaglandin E2 in intestinal lymphocyte populations (49, 50). 3.2.2 Apoptosis T-cell hybridomas were used in the initial identification of the cell-surface molecules Fas and Fas-ligand involved in apoptosis (51). The inhibition of Fas-ligand upregulation in HIV-infected individuals (52), and the regulation of Fas and Fas-ligand by cyclosporin (53) were both studied using T-cell hybridomas. 90

4: B- and T-cell Hybridomas 3.2.3 Metastasis and adhesion T-cell hybridomas are highly metastatic, which can be demonstrated by the extent of their invasiveness in fibroblast cultures: this process depends on the activation of LFA-1. Activation of G proteins induces LFA 1-mediated adhesion of T-cell hybridoma cells to the intercellular adhesion molecule ICAM-1 by signal pathways that differ from those involved in phorbol esterinduced adhesion (54). The same author has used T-cell hybridomas to study metastasis reduction (55). In other studies, T-cell hybridomas were used to study the modulation of T-cell endothelial adhesion by astrocyte-conditioned medium (56), thus providing some insights into the physiological properties of the blood-brain barrier. 3.2.4 Other uses of T-cell hybridomas Some interesting applications of T-cell hybridomas include looking at the role of non-anchor residues of Db restricted peptides in class I binding and TCR triggering (57), studies of T-cell tolerance (58), vaccine design (59, 60), T-cell receptors, and superantigens (61). The use of a T-cell hybridoma to study mechanisms of antigen processing and presentation by a murine myoblast cell line (62) led to the increasing use of DNA constructs as a means of vaccination. Thus the original discovery of Kohler and Milstein back in 1975 has led to the distinctive and exciting discipline of hybridoma technology as it is today. These monoclonal reagents will undoubtedly continue to contribute to many areas of medical research.

References 1. Kohler, G. and Milstein, C. (1975). Nature, 256,495. 2. Kontianen, S., Simpson, E., Bohrer, S., Beverley, P. C. L., Herzenberg, L. A., Fitzpatrick, W. C., Vogt, P., Torano, A., McKenzie, I. F. C., and Feldman, M. (1978). Nature, 274,477. 3. Taniguchi, M. and Miller, J. F. A. P. (1978). J. Exp. Med., 148, 373. 4. Freshney, R. I. (1983). Culture of animal cells. A manual of basic technique. Alan R. Liss Inc., New York. 5. Torres, A. R., Healey, M. C., Johnston, A. V., and McKnight, M. E. (1992). Hum. Antibod. Hybridomas, 3, 206. 6. Lane, D., Crissman, R., and Lachman, M. (1984). J. Immunol. Methods, 72,71. 7. Littlefield, J. W. (1964). Science, 145, 709. 8. Bennett, B., Check, I. J., Olsen, M. R., and Hunter, R. L. (1992). J. Immunol. Methods, 153, 31. 9. Kenney, J. S, Hughes, B. W., Masada, M. P., and Allison, A. C. (1984). /. Immunol. Methods, 121, 157. 10. Bastin, J. M., Jones, M., O'Callaghan, C., Schimanski, L., Mason, D., and Townsend, A. (1998). Brit. J. HaemotoL, 103, 931. 91

Judy M. Bastin 11. Shulman, M., Wilde, C. D., and Kohler, G. (1978). Nature, 276, 269. 12. Kearney, J. F., Radbruch, A., Liesegang, B., and Rajewsky, K. (1979). /. Immunol., 123, 1548. 13. Kohler, G., Howe, S. C., and Milstein, C. (1976). Eur. J. Immunol., 6,292. 14. Galfre, G. and Milstein, C. (1981). Methods in enzymology, Vol. 73B, 3. 15. King, L. B. and Ashwell, J. D. (1993). Curr. Opin. Immunol., 5,368. 16. Coligan, J., Kruisbeck, A., Marguiles, D., Shevach, E., and Strober, W. (1994). Current protocols in immunology. National Institutes of Health, USA. John Wiley & Sons Inc. 17. Sjogren-Jansson, E. and Jeansson, S. (1985). J. Immunol. Methods, 84, 359. 18. Pannell, R. and Milstein, C. (1992). J. Immunol. Methods, 146, 43. 19. Andersen, B. G. and Gruenberg, M. L. (1987). In Commercial production of monoclonal antibodies: a guide for scale-up (ed. S. S. Seaver), p. 175. Marcel Dekker, NY. 20. von Wedel, R. J. (1987). In Commercial production of monoclonal antibodies., a guide for scale-up (ed. S. S. Seaver), p. 159. Marcel Decker, NY. 21. Croce, C. M., Linnenbach, A., Hall, W., Steplewski, Z., and Koprowski, H. (1980). Nature, 288, 488. 22. Olsson, L. and Kaplan, H. S. (1980). Proc. Natl Acad. Sci. USA, 77, 5429. 23. Zola, H. (1995). Monoclonal antibodies the second generation. Bios Scientific Publishers Ltd., Oxford. 24. Yielding, N. M., Gerstner, C., and Kirkwood, J. M. (1992). Int. J. Cancer, 52, 967. 25. Le, J., Vilcek, J., Saxinger, C., and Prensky, W. (1982). Proc. Natl. Acad. Sci. USA, 79,7857. 26. Kobayashi, Y., Asada, M., Higuchi, M., and Osawa, T. (1982). J. Immunol., 128, 2714. 27. Gravekamp, C., Santoli, D., Vreudenhil, R., Collard, J. G., and Bolhuis, R. L. (1987). Hybridoma, 6,121. 28. Galfre, G., Howe, S. C., Milstein, C., Butcher, G. W., and Howard, J. C. (1977). Nature, 266, 550. 29. Schlossman, S. F. (1993). Proceedings of Fifth International Workshop on White Cell Differentiation Antigens. 3-7 Nov. 1993. Oxford University Press. Boston, USA. 30. Beesley, J. E. (ed.) (1993). Immunocytochemistry: a practical approach. IRL Press. Oxford. 31. Ghosh, S. and Campbell, A. M. (1986). Immunol. Today, 7, 217. 32. Ortho Multi Centre Study Group (1985). N. Engl. J. Med., 313, 337. 33. Tak, P. P., Van der Lubbe, P. A., Cauli, A., Daha, M. R., Smeets, T. J. M., Kluin, P. M., Meinders, A. E., Yanni, G., Panayi, G. S., and Breedveld, F. C. (1997). Arthritis Rheum., 38, 1457. 34. Stronkhorst, A., Radema, S., Yong, S. L., Bijl, H., Ten Berge, I. J. M., Tytgat, G. N. J., and van Deventer, S. J. H. (1997). Gut, 40, 320. 35. Reichmann, L., Clark, M., and Waldmann, H. (1988). Nature, 332, 323. 36. Lockwood, C. M., Thiru, S., Stewart, S., Hale, G., Isaacs, J., Wraight, P., Elliott, J., and Waldmann, H. (1996). Q. J. Med., 89, 903. 37. Queen, C., Schneider, W. P., and Waldmann, T. A. (1993). In Protein engineering of antibody molecules for prophylactic and therapeutic applications in man (ed. M. Clark), p. 159. Academic Titles, Nottingham. 92

4: B- and T-cell Hybridomas 38. Maloney, D. G., Grillo-Lopez, A. J., White, C. A., Bodkin, D., Schilder, R. J., Neidhart, J. A., Janakiraman, N., Foon, K. A., Liles, T. M., Dallaire, B. K., Wey, K., Royston, I., Davis, T., and Levy, R. (1997). Blood, 90, 2188. 39. Yagyu, T., Monden, T., and Baba, M. (1993). Jpn. J. Cancer Res., 84, 75. 40. Gallagher, G., al-Azzawi, R, Walsh, L. P, and Wilson, G. (1991). Clin. Exp. Immunol., S3, 92. 41. Imam, S. A., Mills, L. A., and Taylor, C. R. (1991). Br. J. Cancer, 64, 1001. 42. Kato, M., Mochezuki, K., Hashizume, S., Tachibana, H., Shirahata, S., and Murakami, H. (1993). Hum. Antibod. Hybridomas, 4, 9. 43. Challlita Eid, P. M., Penichet, M. L., Shin, S. U., Poles, T., Mosammaparast, N., Mahmood, K., Slamon, D. J., Morrison, S., and Rosenblatt, J. D. (1998). /. Immunol, 160, 3419. 44. Ludher, F., Katz, J., Benoist, C., and Mathis, D. (1998). /. Exp. Med., 187, 379. 45. Rajnavolgyi, E., Horvath, A., Gogolak, P., Toth, G. K., Fazekas, G., Fridkin, M., and Pecht, I. (1997). Eur. J. Immunol., 27, 3105, 46. Yang, B., Mclntosh, K. R., and Drachman, D. B. (1998). Clin. Immunol. Immunopathol., 86, 45. 47. Kraig, E., Pierce, J. L., Clarkin, K. Z., Standifer, N. E., Currier, P., Wall, K. A., and Infante, A. J. (1996). /. NeuroimmunoL, 71, 87. 48. Mori, A., Kaminuma, O., Suko, M., Mikami, T., Nishizaki, Y., et al. (1997). J. Allergy Clin. Immunol., 100,56. 49. Barrera, S., Lai, J., Fiocchi, C., and Roche, J. K. (1996). /. Cell. Physiol, 166,130. 50. Kimachi, K., Croft, M., and Grey, H. M. (1997). Eur. J. Immunol, 27, 3310. 51. Suda, T. and Nagata, S. (1994). J. Exp. Med., 179,873. 52. Yang, Y., Liu, Z. H., Ware, C. F., and Ashwell, J. D. (1997). Blood, 89, 550. 53. Brunner, T., Yoo, N. J., Laface, D., Ware, C. F., and Green, D. R. (1996). Int. Immun., 8,1017. 54. Driessens, M. H. E., Van Hulten, P. E. M., Van Rijthoven, E. A. M., Soede, R. D. M. and Roos, E. (1997). Exp. Cell Res., 231, 242. 55. Driessens, M. H. E., Van Rijthoven, E. A. M., La Riviere, G., and Roos, E. (1996). Blood, 88, 3116. 56. Joseph, J., Lublin, F. D., and Knobler, R. L. (1997). Glia, 21, 408. 57. Sigal, L. J. and Wylie, D. E. (1996). Mol. Immunol, 33, 1323. 58. Faure, M., Sanchez, P., Cazenave, P. A., and Rueff-Juy, D. (1997). Cell. Immunol, 180, 84. 59. Lang, T., Prina, E., Sibthorpe, D., and Blackwell, J. M. (1997). Infect. Immun., 65, 380. 60. Sela, M. and Zisman, E. (1997). FASEB J., 11, 449. 61. Fleisher, B., Necker, A., Leget, C., Malissen, B., and Romagne, F. (1996). Infect. Immun., 64, 987. 62. Garlepp, M. J., Chen, W., Tabaris, H., Baines, M., Brooks, A., and McCluskey, J. (1995). Clin. Exp. Immunol., 102, 614.

93

This page intentionally left blank

5 Murine T-cell culture KINGSTON H. G. MILLS

1. Introduction The development of techniques for propagating and cloning T cells has had a dramatic impact on the field of immunology. Indeed, the study of cellular immunology, and many aspects of molecular immunology, are now almost totally dependent on cell-culture techniques. T cells cultured from blood, spleen, lymph nodes, or other lymphoid organs have been successfully used to establish that CD4+ and CD8+ T-cell responses recognize antigen in association with major histocompatibility complex (MHC) class I or class II gene products (1, 2) and that functionally distinct T-cell subtypes can be discriminated on the basis of cytokine secretion (3). The ability to clone antigen-specific T cells has also allowed the definitive identification and functional analysis of distinct T-cell subpopulations, and has provided the ideal tools for studies on the mechanisms of antigen processing, presentation, and T-cell receptor interaction with peptide-MHC complexes. Furthermore, the study of T-cell subtypes in vitro has provided valuable information for manipulating the induction and function of these cells in vivo, and this has important implications for future developments in immunotherapy and vaccines (4).

1.1 T-cell subtypes and their role in protective immunity T cells play a major role in protection against foreign pathogens. CD8+ cytotoxic T lymphocytes (CTLs) kill target cells infected with viruses or bacteria. CD4+ T helper (Th) cells provide help for B cells in antibody production, as well as secreting a range of cytokines that are involved in a variety of immunoregulatory functions or have a direct effect on invading microorganisms (3, 5, 6). CD4+ T cells can also be divided into two subpopulations on the basis of their function and cytokine secretion (3). Th1 cells secrete interleukin (IL)-2, interferon (IFN)--y, and tumour necrosis factor (TNF)-B. They are also involved in delayed-type hypersensitivity and inflammatory responses and display CTL activity in vitro. An important function of the Th1 population in the immunological defence mechanisms in vivo is the activation of macrophages, which are stimulated to take up and kill

Kingston H. G. Mills invading microorganisms. In contrast, Th2 cells, which secrete IL-4, IL-5, IL6, and IL-10, are considered to be the true helper T cells; their secreted cytokines play a crucial role in immunoglobulin (Ig) class switching and B-cell differentiation, in particular for IgE, IgA, and IgGl antibody production (7). Although it was initially considered that cellular and humoral immunity were mediated by Th1 and Th2 subtypes, respectively, it is now clear that TH1 cells can also provide helper function for specific IgG subclasses, especially those involved in opsonization and virus neutralization (8, 9). Furthermore, the Th1 and Th2 subpopulations are reciprocally regulated through a range of cytokines such as IFN-y, IL-4, IL-10, IL-12, and IL-18 secreted by T cells or by cells of the innate immune system (8, 10).

1.2 Strategies for the induction of distinct T-cell subtypes CD4+ and CD8+ T cells respond to antigens that are processed and presented by antigen-presenting cells (APCs) using distinct mechanisms (11-13). CD4+ T cells recognize exogenous antigen in association with MHC class II molecules. Internalized antigens are processed in endosomes into short fragments or peptides which bind to the MHC class II molecules, and Tcell receptors of CD4+ T cells specific for that T-cell epitope interact with the peptide-MHC complex, following expression on the surface of APCs (12, 13). In contrast, CD8+ T cells recognize endogenous antigen in association with MHC class I molecules (1, 13). Therefore CD4+ T cells are readily generated following immunization with killed bacteria, viruses, or purified antigens, whereas the induction of CD8+ T cells normally requires the antigen to be synthesized in the APC, for example a viral antigen in a virus-infected cell. The use of live attenuated microorganisms as vectors, such as the expression of the foreign antigen in a vaccinia virus or attenuated salmonella, provides an alternative means of allowing the induction of CD8+ T-cell responses. The induction of CD8+ class I-restricted T-cell responses is more difficult with non-replicating pathogens or purified recombinant proteins. However, it has been demonstrated that live or killed bacteria or purified antigens, presented in adjuvant formulations based on particles, emulsions, or lipids, can allow exogenous antigen to gain access to the endogenous processing route for presentation to class I-restricted T cells (14, 15). The nature of the antigen, dose, choice of adjuvant, route of immunization, and number of inoculations are all known to affect the strength, duration, and repertoire of T-cell responses (4). The choice of live virulent, live attenuated, or killed whole virus or bacteria, as well as a purified native subunit, live or purified recombinants, or naked DNA as the immunogen considerably influence the induction of T-cell responses in both qualitative and quantitative terms. In general, the longer the immune system is exposed to an antigen, the stronger and more persistent is the T-cell response. Immunization with soluble proteins, including purified native or recombinant antigens, results in 96

5: Murine T-cell culture weak and transient T-cell responses, and when given by a mucosal route (e.g. oral or intranasal) it can result in a state of immunological tolerance. A variety of experimental adjuvants and delivery systems can be used to boost the immune response to the injected antigen. These work by a number of mechanisms, such as: • maintaining the antigen at the site of inoculation for longer; • enhancing antigen uptake through particle formation; • by including components, such as bacterial products, that stimulate innate immune responses. Freund introduced the classical adjuvant for experimental use over 50 years ago. It consists of water in a mineral-oil emulsion containing killed whole mycobacteria. Although this adjuvant is highly effective for inducing antibody and T-cell responses, it is highly toxic and unsuitable for human use. Aluminium salts (aluminium hydroxide and aluminium phosphate) were first used in the 1920s and are still the adjuvants of choice for human immunization. Although used with success in a number of current vaccines (e.g. diphtheria, tetanus, and pertussis; hepatitis B; and killed poliovirus), this adjuvant often induces weak, transient immune responses, especially with soluble, non-particulate protein antigens, thus favouring the induction of Th2 cells in mice (15, 16). The addition of heat-killed Bordetella pertussis has been used experimentally to boost the immune response to alum-adsorbed antigens. This appears to function through the adjuvant effect of lipopolysaccharide (LPS) and pertussis toxin (17, 18). A number of new generation adjuvants and antigen-presenting systems that encompass the properties of Freund's complete adjuvant or alum have recently been developed. Liposomes, immunostimulating complexes (ISCOMs), biocompatible microparticles, or metabolizable oil in water emulsions (4) can replace the particulate nature of the toxic mineral-oil emulsion of Freund's adjuvant. Furthermore, the crude killed bacteria have been replaced by non-toxic bacterial derivatives, such as muramyl dipeptide or monophosphoryl lipid A, or non-toxic mutants of bacterial toxins (16, 18). These molecules enhance acquired immunity by stimulating innate immune responses, such as IL-12 production and B7 expression by APCs (16-18). These approaches can also be used for the selective stimulation of Th1 or Th2 cells, an important consideration in the generation of T-cell clones. Injection of antigen by a systemic route (subcutaneous, intraperitoneal, or intramuscular) is most commonly used and generates the most potent circulating antibody and T-cell responses. We have demonstrated that immunization by the intraperitoneal route favours the induction of Th1 cells, while the subcutaneous route favours Th2 cells (15, 19). However, the majority of infectious pathogens enter the body by a mucosal route, where local immune responses may be an important first line of defence. The role of 97

Kingston H. G. Mills secretory IgA, induced by immunization at any of the common sites of the mucosal system, is well documented against a variety of human pathogen (20). However, the role of local T cells and their induction has been more difficult to evaluate. Nevertheless, there is evidence that immunization at mucosal sites can induce local and systemic T-cell responses (15). It appears that immunization at mucosal surfaces may favour the induction of Th2 cells, and this is consistent with the role of IL-4 and IL-5 in class-switching to IgA.

1.3 Techniques for detecting T-cell responses Once a T-cell response is induced in vivo, the response can be detected in vitro using a variety of laboratory assays. One of the simplest and most routinely used techniques to detect T-cell responses is the proliferation assay. However, this method is relatively crude, and in its simplest form cannot discriminate between T cells of different phenotypes or functions—or even between T cells and B cells, which can also proliferate in response to foreign antigen. More recently, the detection of T-cell responses has encompassed a sophisticated range of assays that can discriminate between the responding population on the basis of their function or cytokine production. Semi-purified mononuclear leucocyte preparations can be used ex vivo for many of the assays used to detect T-cell responses. Since almost all assays involve T-cell recognition of antigen as the first step, a source of APCs as well as T cells is necessary. Unseparated spleen or lymph node cells and densitygradient separated peripheral blood mononuclear cells are rich sources of lymphocytes and also contain sufficient monocytes/macrophages, and other cells, that can function as APCs without further additions. Although contaminated with relatively small numbers of polymorphs and red blood cells, spleen cells can be used for many of the T-cell assays without further separation. Where necessary, the contaminating cells can be removed by density-gradient centrifugation. Although these relatively crude mononuclear cell preparations, which include T cells, B cells, monocytes, dendritic cells, natural killer (NK) cells, and other non-conventional lymphoid cells, can be used for most assays, they do not allow discrimination of the responding T-cell subpopulation. Furthermore, for the assays of T-cell function (e.g. helper or CTL assays) purified T cells, CD4+ or CD8+ T-cell subpopulations, B cells, or APCs are required. A range of methods can be used to purify and separate lymphocyte subpopulations. T cells can be enriched from density-gradient purified mononuclear cells by passage through a nylon-wool column, resetting with ox erythrocytes coupled with anti-mouse IgG (21), or by depletion of B cells on Ig-coated plastic dishes and monocytes by adherence to plastic. B cells can be enriched by depleting T cells using anti-Thy-1 or anti-CD3 antibodies and complement, and monocytes by the recovery of plastic-adherent cells. These techniques do not require sophisticated equipment and are cheap and 98

5: Murine T-cell culture relatively simple to perform. However, they only permit enrichment, rather than a purification, of a particular cell population. The most definitive approach for achieving high levels of purity involves labelling the cell population with a specific monoclonal antibody, followed by separation on a fluorescent activated cell sorter (FACS). Apart from the limited access to FACS machines, this method is relatively slow and is not practical for the separation of large numbers of cells or cells from several samples on the same day, which would often be required for the routine assessment of T-cell responses. An alternative approach, which employs a similar principle, involves the use of antibody-coated magnetic beads (see Chapter 1) or glass beads on affinity columns. Cells are depleted by direct or indirect binding to antibody-coated beads immobilized on a column, or by being placed in a magnetic field. These techniques, if performed carefully, can give high levels of purity and allow the separation of relatively large numbers of cells (up to 109 per column), with several columns run simultaneously. The most definitive technique for analysing the specificity and function of T cells induced by immunization or infection involves the generation of antigenspecific T-cell lines and clones from immune mice (22, 23.) Furthermore, the technique of limiting dilution analysis has been used as a quantitative measure of the frequency of precursor T cells specific for individual antigens in naive or immune animals (see Chapter 8).

2. Tissue culture conditions, growth factors, and cell viability All manipulations with lymphoid tissue and cells prior to culture require rigid adherence to aseptic conditions, as discussed in Chapter 1. Ideally, all work should be carried out in a class-II, or if the work involves certain categories of infectious agents, a class-Ill microbiological safety cabinet. Most laboratories use commercially available disposable plastic pipettes and tissue culture flasks, dishes and plates, pre-sterilized by irradiation. Glassware and instruments should be thoroughly washed to remove any traces of detergent and sterilized by autoclaving at 121 °C for 20 min. Long-term T-cell lines generated from mice or obtained from other laboratories should be screened for mycoplasma contamination.

2.1 Culture medium and serum Although a variety of media are available for cell culture, RPMI-1640 supplemented with a source of serum, is the most commonly used generalpurpose medium for culturing T cells. Culture medium can be purchased as single strength (1 X), 10 X concentrate, or in powder form for reconstitution in distilled water. Reconstituted or diluted medium should be sterilized by filtration through a 0.22 um Millipore filter. Water, saline, PBS, and other 99

Kingston H. G. Mills Table 1. Supplements added to RPMI-1640 for complete medium Supplement

Stock concentrationa

Volume for a 500 ml bottle of mediumb

Final concentration

FCS Streptomycin

Neat 10mg/ml

50ml

10%(v/v) 100 ug/ml

Penicillin L-glutamine 2-mercapthoethanol

10000 units/ml 200 mM 100 mM

Optional supplementsc Gentamicin Fungizone

50 mg/ml 250 ug/ml

| 5.0ml J 5.0ml 250 ul

100 units/ml 2.0 mM 50 uM

50 ul 1.0ml

5 ug/ml 0.5 ug/ml

aMost supplements can be purchased at these concentrations and should be stored at -20°C then thawed and added to the medium prior to use. The complete medium can be stored at 4 °C for at least 2 weeks. bIn order to achieve the exact final concentrations shown here, it is necessary to remove 60 ml of medium from the fresh bottle of RPMI-1640 medium before adding the supplements. However, adding the above volumes of supplements to a full 500 ml bottle of medium, although giving slightly lower final concentrations than that shown above, is simpler and is adequate for good cell growth. "Gentamicin and fungizone are only added if bacterial or fungal contamination is encountered or anticipated, e.g. in the preparation of cell suspensions from tissue ex vivo, where up to 10-fold higher concentrations can be used in the steps prior to culture.

buffers can be sterilized by autoclaving at 121 °C for 20 min. Liquid medium is usually supplied without glutamine, which has a limited shelf life at 4°C. Therefore stock glutamine (200 mM) should be prepared or purchased, stored at -20 °C, and added to a fresh medium at 1/100 dilution prior to use. Penicillin (100 units/ml) and streptomycin (100 ug/ml) are routinely added to inhibit bacterial growth; although, in cases of persistent problems of contamination with bacteria or fungi, gentamicin (5 ug/ml) and Fungizone (Amphotericin-B, 0.25 ug/ml) can also be used. However, the use of these antibiotics and anti-fungal agents should be considered as a last resort, since they can inhibit the growth of lymphoid cells and their extensive use may lead to the emergence of resistant microorganisms. Long-term culture of T cells is enhanced in the presence of the reducing agent 2-mercaptoethanol (50 uM). The composition of complete medium normally used for culture of T cells is shown in Table 1. The survival and replication of T cells in culture is dependent on a source of protein, which is most readily provided by animal serum. Heat-inactivated FCS (5-10%) is most commonly used. However, FCS can result in the nonspecific stimulatory activity of murine lymphoid cells. In addition, it may contain bovine cytokines, which, if they bind to the homologous murine receptor, may complicate experiments with murine cells. Several batches of FCS from different suppliers should be checked for their lack of non-specific stimulatory activity and for their ability to support the growth of the specific 100

5: Murine T-cell culture cell type under study. Furthermore, in view of the possible association between CJD- and BSE-infected bovine products, FCS should be sourced from BSE-free countries. It is also advisable to purchase FCS that has been screened for virus contamination by the suppliers. In the initial rounds of antigen stimulation for the generation of T-cell clones or in T-cell assays, where high background responses are encountered, normal mouse serum (2%) can be substituted for FCS. However, it is more expensive, toxic at higher concentrations, and may contain murine cytokines. RPMI-1640 with 2% FCS (RPMI-2) can be used for routine manipulations and for washing cells prior to culture. Less expensive alternatives, such as Hanks Balanced Salt Solution, supplemented with 1% gelatin or BSA, can also be used.

2.2 Cytokines and growth factors for culturing T cells The survival and long-term culture of T cells is dependent on autocrine or exogenous IL-2 or IL-4. Furthermore, exogenous cytokines or anti-cytokine antibodies can be used for the selective stimulation and expansion of distinct T-cell subtypes (10). Prior to the cloning of the IL-2 gene, crude supernatants of mitogen-activated T cells were used as a source of 'T-cell growth factor' for culturing murine T cells. Alternatively, certain transformed T-cell lines such as Gibbon MLA can constitutively produce IL-2, or in the case of the murine thymoma line EL4, produce IL-4 after stimulation with phorbol myristic acetate (PMA). However, supernatants from polyclonal activated mouse or rat spleen cells contain a heterogeneous range of cytokines in addition to IL2. Nevertheless, supernatants from rat spleen cells stimulated with Concanavalin A (Con A) (see Protocol 1) provide a very useful source of IL-2 for maintaining cultures of established T-cell lines or clones, especially CD4+ Th1 cells and CD8+ CTLs. The induction of Th1 and Th2 cells in vivo is controlled by a variety of factors, including the immunogen and the site of immunization (see Section 1.2). However, the selective generation of Th1 or Th2 clones in vitro can be facilitated by the addition of regulatory cytokines and anti-cytokine antibodies (see Section 4.2). Protocol 1. Preparation of a supernatant containing IL-2 Equipment and reagents • Equipment and reagents for Protocol 3 • Complete medium RPMI-1640 supplemented with 10% FCS • 2.5 ug/ml Can A (Sigma) • 500 ml tissue culture flasks

• • • •

Centrifuge and 50 ml centrifuge tubes 30 ml Universal containers x-Methyl mannoside (Sigma) 0.22 um filter (Millioore)

Method 1. Prepare rat spleen-cell suspensions (see Protocol 3). Expect a yield of 2-3 x 108 viable cells from 101 each spleen.

Kingston H. G. Mills Protocol 1.

Continued

2. Culture at 2 X 106/ml in complete RPMI-1640 medium with Corr A (2.5 ug/ml) in 250 ml volumes in 500 ml tissue culture flasks for 48 h at 37 °C. 3. Transfer the cultures to 50 ml tubes and centrifuge at 400 g for 10 min at4°C. 4. Aliquot 20 ml of the supernatants into 30 ml Universal containers containing 0.4 g of a-methyl mannoside and store at-20°C. 5. Thaw at 37 °C; a-methyl mannoside dissolves. 6. Filter-sterilize and use, or aliquot into smaller volumes and store at -20°C for later use. 7. Screen each batch for IL-2 activity before use (see Section 4.3.2).

2.3 Viable cell count A variety of vital stains can be used for obtaining viable lymphoid cell counts. The combination of Ethidium Bromide and Acridine Orange is one of the simplest and least ambiguous for the discrimination of viable and non-viable cells, especially where cell preparations are contaminated with red cells (e.g. ex-vivo, murine spleen-cell preparations). However, these compounds are carcinogenic and their use requires access to an UV-microscope. Alternatively, viable cells can be counted by Trypan Blue exclusion; this dye only requires a light microscope. Protocol 2. Viable cell count with Ethidium Bromide and Acridine Orange Details of the Tryfan Blue viability test can be found in the Sigma catalogue. Caution: these compounds are carcinogenic and should be handled with care. Equipment and reagents • PBS • Safety equipment for handling ethidium bromide and Acridine Orange • Cell suspension • Fluorescence microscope

• Stock solution of Ethidium Bromide (EB) and Acridine Orange (AO): 100 mg ethidium bromide (Sigma) and 100 mg Acridine Orange (Sigma) in 100 ml PBS. Store at-20 °C.

Method 1. Prepare a working solution by diluting the EB/AO stock solution 1/1000 in PBS. Store at 4°C. 2. Mix a measured volume (20-50 ul) of cell suspension with an appropriate volume (20 ul-1 ml) of the working solution of EB/AO, so

102

5: Murine T-cell culture that the estimated cell concentration is in the range 2 x 105 to 2 x 106/ml. 3. Fill a haemocytometer and count the number of viable (green) and non-viable (orange) cells using a fluorescence microscope with a combination of UV and visible light.

3. Preparation of T cells and APCs 3.1 Preparation of cells from lymphoid and non-lymphoid organs Murine spleens provide the most convenient source of large numbers of T cells and APCs. Lymph nodes (LN), although not giving as high a yield, have a greater proportion of T cells (50%) compared with spleen (30%). Draining LN from the site of immunization (e.g. popliteal LN from the footpad, or inguinal and periaortic LN from the base of the tail) or from the source of infection (e.g. thoracic or tracheobronchial LN from the lungs) provide a rich source of primed T cells. A single cell suspension of spleen and lymph node can be readily prepared by a variety of mechanical disruption techniques. The technique described in Protocol 3 is simple and quick to rapid, and produces a high yield of viable cells (approximately 5 X 107 from one spleen). However, it may not be suitable for the purification of dendritic cells, as these cells may adhere to the wire mesh. Investigations on regional or mucosal T-cell immunity (such as in the lung, gut, or liver), are dependent on specific techniques used for the isolation of lymphoid cells from these tissues. For example, the distinct lymphocyte populations can be purified from the lung airways by bronchoalveolar lavage (see Protocol 4) and from the lung parenchyma or other non-lymphoid organs by tissue disruption and enzyme digestion (see Protocol 5). Protocol 3. Preparation of murine spleen cells Equipment and reagents NB: Use sterile equipment 2 pairs of scissors and forceps 70% alcohol Wire mesh (Fischer Scientific UK) 90 mm petri dish Plunger from a 5 ml syringe

• • • •

Two 15 ml centrifuge tubes Sterile Pasteur pipettes Complete medium of choice Equipment and reagents for cell viability count (see Protocol 2)

Method 1. Kill a mouse by cervical dislocation and immerse it in 70% alcohol. Lay the mouse on its right side and using sterile scissors and forceps lift,

103

Kingston H. G. Mills Protocol 3. Continued

2.

3.

4. 5. 6.

cut, and pull back the skin on the left side of the abdomen. Spray the exposed abdominal musculature with 70% alcohol. Then, using fresh sterile scissors and forceps, make an incision over the spleen and remove it with forceps, carefully cutting away the connective and vascular tissue, and transfer the spleen to sterile medium on icea. Pour the spleen(s) and medium on to sterile wire mesh in a Petri dish and using the plunger of a 5 ml syringe, grind the spleen until a fine suspension is obtained. Transfer the spleen-cell suspension to a 15 ml centrifuge tube and allow the debris/cell clumps to settle for 10 min, or centrifuge at 100 g for 30 sec (alternatively, filter through nylon mesh). Pipette off cells in the supernatant and add to a fresh 15 ml tube. Centrifuge at 300 g for 5 min and resuspend the cell pellet in complete medium. Perform a viable cell count (see Protocol 2).

aSteps 2-5 are performed using cold medium.

Protocol 4. Preparation of bronchoalveolar cells by lavage Equipment and reagents • Warm RPMI-1640 medium supplemented with 2% FCS • RPMI-1640 medium supplemented with 10% FCS • Catheter (made by inserting a 21-gauge needle into either end of a tightly fitting nylon tube (internal diameter approximately 1.0mm). Cut the plastic Luer lock off one of the needles with a small wire cutter to leave a blunt end for inserting into the trachea.)

• Three-way valve with Luer locks, attached to two 5 ml syringe and the catheter • Anaesthetic (any in-house anaesthetic used according to manufacturers instructions) Scissors and forceps Curved forceps Cotton thread 15 ml centrifuge tubes and centrifuge Equipment and reagents for cell viability count (see Protocol 2)

NB: Use sterile equipment and reagents Method 1. Kill the mouse by a lethal anaesthetic injection. 2. Carefully cut and pull back the skin from the thoracic area. Cut the ribcage either side of the sternum and remove the sternum and ribcage. Carefully remove the tissue covering the trachea.a 3. Using a 23-gauge needle, make a small hole in the trachea midway between the lungs and the larynx, take care not to pierce the trachea On both sides or the blood vessels either side of the neck.

104

5: Murine T-cell culture 4. Using curved forceps, thread a cotton ligature under the trachea on the lung side of the hole. 5. Fill a 5 ml syringe filled with warm medium,b attach it to the threeway valve, and fill the catheter with medium, close the valve. 6. Insert the catheter (the end with the blunt needle attached) into the trachea and secure it in position by tying the ligature with sufficient force to prevent the lavage fluid escaping under mild pressure. 7. Open the three-way valve leading to the filled syringe and gently infuse medium into the lungs until they are fully inflated (approximately 0.5 ml). 8. Turn the three-way valve and withdraw the fluid into the empty 5 ml syringe.c 9. Repeat until 5 ml of medium has been infused and withdrawn. 10. Transfer the alveolar lavage fluid to a 15 ml tube and centrifuge at 300 g for 5 min. 11. Resuspend the cells in medium with 10% FCS and perform a viable cell count. aThe mouse can be perfused to limit blood contamination of the lavage fluid by cutting the aorta and vena cava and injecting PBS into the ventricle. bLidocaine (0.28 g/100 ml) can be added to the medium for lavage to improve the cell yield. c If the fluid is difficult to withdraw from the lungs, slightly reposition the catheter, taking care not to withdraw it fully from the trachea.

Protocol 5. Preparation of cells from non-lymphoid organs by enzyme digestion Equipment and reagents NB: Use sterile equipment and reagents • Digestion buffer: complete RPMI-1640 medium with 10% FCS, 1.0 mg/ml collagenase" (Boehringer Mannheim), 30 ug/ml DNase (Sigma) • Dissecting instruments (see Protocol 3)

Petri dish Centrifuge Centrifuge tubes Rotary mixer Nylon mesh (Fischer Scientific UK)

Method 1. Kill a mouse; remove the organ of interest (e.g. lung, liver) with sterile instruments and place in 5-10 ml digestion buffer. 2. Transfer the organ and digestion buffer to a Petri dish and mince/chop the tissue into pieces with scissors (or scalpel) and forceps. 3. Transfer the digestion buffer with tissue fragments and cells to a centrifuge tube, and incubate with constant rotating at 37 °C for 60-90 min.

105

Kingston H. G. Mills Protocol 5. Continued 4. Further dissociate tissue fragments in a Petri dish, and remove debris by filtering through nylon mesh. 5. Pellet the cells by centrifugation at 300 g for 5 min at room temperature and wash twice with RPMI-2 medium. aPronase, dispase, or trypsin at similar concentrations can also be used for tissue digestion.

3.2 Purification of mononuclear cells and removal of dead cells Cell suspensions from disrupted spleen or lymph nodes contain polymorphonuclear leucocytes, red blood cells, and non-viable cells as well as cells of the lymphoid and monocyte lineages. Furthermore, cell suspensions from non-lymphoid organs will include cells that are not derived from the haemopoietic system. Mononuclear leucocytes, including lymphocytes and monocytes, can be separated from other cell types by centrifugation on density gradients. Although commercially available separation media can be used, especially for the preparation of peripheral blood mononuclear cells (PBMCs), metrizamide gradients have proved very successful in my laboratory (see Protocol 6). This technique can also be used to remove dead cells from cultured T cells prior to their use in assays where non-viable cells can affect the readout. Protocol 6. Metrizamide density-gradient centrifugation Equipment and reagents • 35.3 % (w/v) metrizamide stock solution (analytical grade, Nyconed) in distilled water. Filter-sterilize and keep in the dark at 4°C for up to 3 months. . PBS • FCS (refractive index 1.3613) • 18% metrizamide: 1.02 ml of stock metrizamide, 0.94 ml of PBS, 0.04 ml of FCS

15 ml (12 x 75 mm) centrifuge tubes Ex-vivo cells from lymphoid or nonlymphoid organs or cultured cells RPMI-1640 complete medium with 10% FCS RPMI-2 medium (RPMI-1640 with 2% FCS) Benchtop centrifuge with a swing-out rotor Equipment and reagents for cell viability count (see Protocol 2)

Method 1. Dispense 2 ml of 18% metrizamide into 15 ml centrifuge tubes. 2. Carefully overlay with up to 1 x 107 cells in 1 ml of RPMI-1640 complete medium. 3. Centrifuge at 500 g (1500 r.p.m.) for 15 min at room temperature in a benchtop centrifuge fitted with a swing-out rotor. 4. Recover the cells from the interface, wash the cells twice with 8-10 ml of RPMI-2 by centrifugation at 300 g for 5 min at 4°C, and perform a viable cell count. 106

5: Murine T-cell culture

3.3 Purification of T cells, B cells, and T-cell subpopulations A number of methods, including complement-mediated lysis, affinity columns, immunomagnetic beads, resetting, panning, and separation by a fluorescenceactivated cell sorter (FACS), have been used to purify lymphoid cell populations on the basis of monoclonal antibody labelling (21, and Chapter 1). One of the simplest techniques for negative selection involves complementmediated lysis using a complement-fixing antibody against a surface determinant of the cell to be depleted (see Protocol 7). Alternatively, the affinity column technique can employ non-complement-fixing antibodies. Both these techniques, if carefully performed, are very effective and allow the separation of large numbers of cells in a relatively short time. The affinity column technique described below, as well as immunomagnetic beads, can also be used to separate murine T cells and CD4+ and CD8+ subpopulations by negative or positive enrichment. Protocol 7. Purification of B cells by complement-mediated lysis of T cells and plastic adherence of monocytes Equipment and reagents • Complete RPMI-1640 medium • Medium containing the appropriate dilution of anti-CD3 or anti-Thy-1 antibodiesa • Serum-free medium containing complement at the appropriate dilution • Equipment and reagents for EB/AO cell viability count (see Protocol 2)

• Plastic tissue-grade Petri dishes 90 mm diameter) . Sterile Pasteur pipettes • Equipment and reagents for FACScan analysis with anti-CD3 and anti-lg antibodies

Method 1. Resuspend mononuclear cells at 1 x 107/ml in RPMI-1640 with 2% FCS medium containing the appropriate dilution of anti-CD3 or anti-Thy-1 antibody.a 2. Incubate for 30 min at 4°C, shaking the cells periodically. 3. Centrifuge the cell mixture at 300 g for 5 min at room temperature and resuspend at 1 X 107/ml in complement at the appropriate dilution in serum-free medium. 4. Incubate for 30-45 min at 37°C, shaking the cells periodically. Check cells for lysis after 30 min by removing a small aliquot and performing a viable count with EB/AO (see Protocol 2). 5. Centrifuge the cells at 300 g for 5 min at room temperature and wash twice with RPMI-2 medium. 6. Resuspend in complete medium at 5 x 107/ml and add 5 ml per dish to 90 mm plastic tissue-culture grade Petri dishes. Incubate at 37°C for 90-120 min.

107

Kingston H. G. Mills Protocol 7. Continued 7. Remove non-adherent cells with a Pasteur pipette after gently swirling the cell suspension in the dish. 8. Add 5 ml of fresh complete medium pre-warmed to 37°C and add to the non-adherent fraction. 9. Centrifuge at 300 g for 5 min at room temperature and resuspend in complete medium. Perform a viable cell count and check for purity by FACScan analysis with anti-CD3 and anti-lg antibodies. aAntibodies against other T-cell molecules (including xBTCR, ySTCR, CD4, CD8) and against markers expressed on NK cells can also be added for more complete depletion of non B-cell populations.

3.3.1 Purification of murine T cells on anti-lg affinity columns This is a negative selection technique where B cells are removed by the binding through their surface Ig to anti-lg attached to plastic or glass beads on a column. Monocytes also adhere to the beads and are retained on the column. However, the enriched T cells are contaminated with NK cells, but these can be removed by a further step involving antibodies specific for NK cells. The affinity column technique described in Protocol 8 employs columns manufactured by Pierce Laboratories. Other manufactures (e.g. Immulan Columns; Biotex Laboratories, Houston, Texas) use slight variations, which will be described in the manufacturer's instructions. The complete procedure for the separation of T-cell subpopulations involves several steps: the preparation of spleen cells (see Protocol 3), the purification of T cells (see Protocol 8), and the purification of CD4+ or CD8+ T cells (see Protocol 9). The procedure described in Protocol 9 for the purification of CD4+ T cells employs negative selection with an anti-CD8 antibody; the reciprocal antiCD4 antibody is used to prepare CD8+ T cells. Alternatively, if the antimouse Ig on the column used to deplete the B cells cross-reacts with rat Ig, CD4+ or CD8+ T cells can be separated from spleen cells in a single step by incubating the cells with rat anti-CD8 or anti-CD4 antibody, respectively, prior to loading on the anti-lg column. Protocol 8. Purification of murine T cells on anti-lg affinity columns Equipment and reagents • Viable mononuclear cells from murine spleen (see Protocols 2 and 3) • IsoCell™ mouse T cell isolation kit (cat. no. 4493522) Pierce Chemical Co. . PBS

• 15 ml centrifuge tubes on ice • Antibodies to NK cell markers • Equipment and reagents for FACScan analysis with anti-CD3 and anti-lg antibodies

• PBS supplemented with 10% FCS

108

5: Murine T-cell culture Method 1. Clamp the Pierce column containing glass beads and wash with 15 ml PBS. Close the column tap or clamp when the PBS has reached the top of the column, but not below. 2. Add 10 mg polyclonal anti-mouse Ig in 1 ml of PBS and allow it to enter the column. 3. Incubate for 1 h at room temperature. 4. Wash the column with 20 ml of PBS supplemented with 10% FCS. 5. Adjust the flow rate for the particular column size (e.g. 6-8 drops per min for a standard Pierce column). 6. Resuspend viable mononuclear cells from murine spleen at approximately 1 x 108/ml in PBS (or RPMI-1640 medium supplemented with 10% FCS) and load on to the anti-lg column reservoir. 7. Allow the cells to enter the column and collect the eluent into a fresh tube on ice. 8. Continue to top up the reservoir with medium until a total of 20 ml has passed through the column. 9. Retain the eluent and centrifuge at 300 g for 5-10 min at 4°C to recover the non-adherent cells, which include T cells plus null or NK cells. Remove NK cells, if desired, by pre-incubating the cells with antibodies that bind to NK cell markers prior to loading on the column. 10. Determine the purity by FACScan analysis with anti-CD3 and anti-lg antibodies.

Protocol 9. Purification of CD4+ T cells Equipment and reagents • Anti-CD8 rat monoclonal antibody (preferably purified antibody) » Purified T-cell preparation (see Protocol 8). • Pre-prepared anti-rat Ig column (Pierce Laboratories Ltd.)

. RPMI-1640 medium with 2% FCS • Equipment and reagents for FACScan analysis with anti-CD4 and anti-CD8 antibodies

Method 1. Add an anti-CD8 rat monoclonal antibody (preferably purified antibody, but diluted ascites or a high-titre hybridoma supernatant can also be used) to a purified T-cell preparation (see Protocol 8). 2. After 30 min incubation on ice, wash three times by centrifugation at 300 g for 5 min at 4°C and resuspend in RPMI medium with 2% FCS. 3. Count the cells and adjust the concentration to 1 x 108/ml. 4. Load on to a pre-prepared anti-rat Ig column.

109

Kingston H. G. Mills Protocol 9.

Continued

5. Continue as in Protocol 8, steps 1-5. 6. Check the purity by FACScan analysis with anti-CD4 and anti-CD8 antibodies.

3.4 Preparation of macrophages and APCs A variety of cell types can be used as APCs. Normally, B cells, macrophages, or dendritic cells are present in spleen (or PBMC) samples in sufficient proportions to act as APCs for the T cells in these cell preparations without further addition. However, when using purified T cells or T-cell subpopulations, or cultured T-cell lines or clones, it is necessary to add APCs. Murine spleen cells, irradiated to prevent cell proliferation, are the most convenient source of APCs. Although for specialized experiments, purified macrophages, B cells, dendritic cells, L cells, B-cell lymphoma, or fibroblast cell lines can also be used. Murine peritoneal macrophages are used as a source of feeder/accessory cells for the growth of T-cell clones, and they can also be used as APCs or targets for T-cell proliferation and cytotoxicity assays, respectively. Peritoneal cells can be recovered by lavage (see Protocol 10) from naive mice. Injecting the mice with thioglycolate 3-5 days earlier can increase the yield of macrophages. However, the thioglycolate-induced macrophages, although suitable as APCs for established T-cell lines or clones, may not be suitable for certain studies on APC function, especially where macrophage activation is a factor. Total spleen or peritoneal lavage cells can be used as APCs without further purification. But, as these cell populations contain T cells and B cells, they must be irradiated to prevent their proliferation (see Protocol 11). Irradiation with doses ranging from 10 to 50 Gy can be used; however, doses greater than 15 Gy can inhibit the APC function of resting B cells. Protocol 10. Preparation of murine peritoneal macrophages Equipment and reagents • Cold PBS (or serum-free medium) • Sterile scissors and forceps

• 5 ml syringe and a 23-gauge needle

Method 1. Kill a mouse by cervical dislocation. 2. Cut the skin on the abdomen and peel it back. 3. Inject 5 ml cold PBS (or serum-free medium) intraperitoneally using a 5 ml syringe fitted with a 23-gauge needle and withdraw fluid. 4. Repeat once with fresh PBS. 110

5: Murine T-cell culture 5. Centrifuge the cells at 300 g for 5 min at 4°C and perform a cell count. Expect to obtain 5-7 x 106 cells/mouse. 6. Purify macrophages (60-70% of peritoneal lavage cells), if required, by adherence to plastic for 1 h at 37°C.

Protocol 11. Irradiated splenic APCs Equipment and reagents • Spleen cells (see Protocol 3) . PBSa with 10% FCS • Irradiation source (Cobalt-60, Caesium-137, or X-ray)

• 10 ml plastic tube • Complete medium; RPM-1640 supplemented with 10% FCS • RPM 1-2 supplemented with 2% FCS

Method 1. Prepare spleen cells (see Protocol 3) and suspend in PBSa with 10% FCS in a 10 ml plastic tube. 2. Place the tube within the chamber of a cobalt-60, caesium-137, or Xray source and expose to 15-30 Gy irradiation.b 3. Wash the cells with RPM 1-2 and centrifuge at 300 g for 5 min at 4°C and resuspend them in complete medium at a concentration of 4 x 106/ml (to be used at a final concentration of 2 x 106/ml in culture). " Medium with Phenol Red should not be used for this step. b The dose required to prevent cell proliferation should be established for individual irradiation sources.

4. Generation and detection of antigen-specific CD4+T cells 4.1 In vivo priming of CD4+ T cells The induction of CD4+ T cells specific for conserved soluble antigens (e.g. myoglobin, cytochrome C, lysozyme) requires the use of potent adjuvants and the removal of lymphoid cells at a critical period after immunization. The most consistent method used involves immunization with complete Freund's adjuvant (high-dose antigen) and removal of the draining lymph nodes 7-10 days later (24). However, the induction of T-cell responses to foreign antigens are less stringent and a variety of adjuvant formulations can be used (see Section 1.2). Furthermore, in murine models of infectious diseases, infection with a virus, bacterium, or parasite at a variety of sites, including the lung and gut, can induce a systemic CD4+ T-cell response (23, 25). Here, spleen cells are more frequently employed as a source of primed T cells, but draining lymph nodes can also be used. Studies with cloned murine CD4+ T cells have defined subpopulations of 111

Kingston H. G. Mills Table 2. Strategies for the selective stimulation of murine Th1, Th2, or Trl clones Clone

Addition to T cells in vitro Cytokine Antibody

Cytokine secreted by established T-cell clone9

Th1 Th2 Tr1 Th0

IL-2, IL-12 anti-IL-4 IL-4 anti-IL-12 IL-10 IL-2/ crude supernatants

IL-2, IFN-y,TNF-B IL-4, IL-5, IL-6, IL-10, IL-13 IL-5, IL-10, TGF-B,IFN-y IL-2, IFN-y,TNF-B IL-4, IL-5, IL-6, IL-10, IL-13

a

Th1, Th2, and Th0 clones also secrete IL-3, GM-CSF, and TNF-a.

CD4+ T cells that produce either the cytokines IL-2, IFN--y, and TNF-p or IL-4, IL-5, IL-6, IL-10, and IL-13, termed Thl and Th2 cells, respectively, or cells that produce all these cytokines, termed Th0 (3, 8). In addition, a population called regulatory T cells (Trl), that secretes IL-10, TGF-B, IL-5, IFN-y, but not IL-4, can be generated by repeated cultivation in IL-10 (26). As described in Section 1.2, the type of infection or immunogen and the immunization protocol or type of infection, as well as the in-vitro restimulation technique, can determine the generation of Thl, Th2, or Trl clones in vitro. The propagation of Thl cells in vitro is enhanced by the presence of IL-12 and IFN-y, but inhibited by IL-10 and the Th2 cytokine IL-4. In contrast, Th2 cells are stimulated by IL-4 and inhibited by IFN-y and IL-12 (10). IL-18 (interferon-inducing factor) also has a positive effect on the induction and activation of Thl cells (27). Therefore, the choice of purified cytokine versus crude supernatant can influence the phenotype of the clones generated in vitro (see Table 2). Furthermore, the APC may also influence the generation of Thl or Th2 clones. Although it has been suggested that macrophages may preferentially present to Thl cells, whereas B cells may present antigen to Th2 cells (28), dendritic cells (DC) are probably the most potent APCs for either population. Recent evidence suggests that distinct subsets of DC, termed DC1 and DC2, may act as APC for Thl and Th2 cells respectively (29, 30).

4.2 Generation of CD4+ T-cell lines and clones CD4+ T-cell lines specific for soluble proteins can only be initiated with lymphoblasts, previously activated in vivo. Bulk cultures are established by stimulating spleen or lymph node cells with soluble protein antigen. Spleen cells already contain a source of APCs; however, lymph node cells may require additional APCs in the form of irradiated autologous spleen cells. Viable cells, recovered from the bulk cultures, are repeatedly stimulated with antigen and APCs to establish T-cell lines, and cloning is performed after the third round of antigen stimulation. Th cell lines produce autocrine IL-2 or IL4 and do not require an exogenous source to maintain viability. However, the selective induction of Th cell subpopulations is facilitated by the addition of 112

5: Murine T-cell culture cytokines and anti-cytokine antibodies (see Table 2). Furthermore, the cloning and continuous maintenance of antigen-specific T-cell clones is dependent on a source of exogenous cytokines. These cytokines were originally called T-cell growth factor(s) (TCGF), and were usually provided in the form of crude supernatants from in vitro stimulated or transformed T cells. The predominant factor responsible for supporting the growth of T cells in vitro was later identified as IL-2. Indeed, recombinant human IL-2 is now used extensively in place of supernatant TCGF. More recently, other T cell-derived cytokines, in particular IL-4, have also been shown to be capable of stimulating and maintaining the growth of T cells in vitro (10, 19). In the absence of available recombinant cytokines, IL 2-containing supernatants can be conveniently prepared by stimulating rat spleen cells with Con A (see Protocol 1). Protocol 12. Generation and maintenance of murine CD4+ T-cell lines Equipment and reagents • Antigen in desired adjuvant or an appropriate pathogen (see Section 1.2) • Complete medium; RPMI-1640 supplements with 10% FCS • 50 ml culture flasks

• Equipment and reagents for cell viability count (see Protocol 2) • Autologous, irradiated spleen cells (see Protocol 11)

Method 1. Immunize mice with antigen in the desired adjuvant or infect them with the appropriate pathogen. 2. Kill the mice 7-10 days after immunization (or longer in the case of infection), remove the spleens or draining lymph nodes and prepare single cell suspensions as described above. 3. Culture cells at 2 x 106/ml with antigen in 20 ml of complete medium in upright 50 ml culture flasks.a,b 4. Harvest cells after 4-5 days by centrifugation at 300 g for 5 min at room temperature. Resuspend in RPMI-10 and perform a viable cell count (Protocol 2). 5. Reculture lymphoblasts (I x 105/ml) with autologous, irradiated splenic feeder cells (2 x 106/ml irradiated spleen cells) for 5-7 days without antigen. 6. Maintain the T-cell line by a repeated feed (4-5 days with antigen and APCs) and starve (5-7 days, feeders only) cycle. 7. Test antigen specificity by a proliferation assay (see Protocol 15) and freeze cell aliquots at the end of the restimulation cycle. 8. Clone by limiting dilution (Protocol 73). aThe optimum dose of antigen has to be determined for each antigen; ranging from 0.1 to 10 ug/ml for recombinant or native foreign antigen or 100 |xg/ml for conserved globular antigens. b lf lymph node cells are used, add irradiated splenic APCs (2 x 10e/ml) (see Protocol 11).

113

Kingston H. G. Mills 4.2.1 Cloning CD4+ T cells Antigen-specific T-cell clones are normally generated from established T-cell lines. The optimal time is 3-4 days after the third or subsequent antigenic stimulation. Cloning can also be performed on bulk cultures after a single restimulation in vitro; this allows a wider selection of the true repertoire but cloning efficiencies will be very low. Cloning efficiency varies greatly between T-cell lines, therefore it is recommended that a fairly wide range of cell concentrations per well are used (e.g. 100, 10, and 1). To ensure clonality it is essential to redone at 0.3 cells/well. Limiting dilution is the simplest and most commonly used technique for cloning antigen-specific T-cell lines. However, soft agar cloning and micromanipulation can also be used. Conditions for cloning and expanding murine CD4+ Th cells and CD8+ CTL lines are essentially identical. Protocol 13. Cloning antigen-specific T-cell lines by limiting dilution Equipment and reagents • Irradiated (30 Gy) spleen cells • Complete medium supplemented with IL-2 (either recombinant IL-2 (10 ID/ml) or a 10% IL2-containing supernatant (rat Con A supernatant, see Protocol 1)) • Antigen • 96-well, flat-bottomed, tissue culture plates

• Equipment and reagents for cell viability count (see Protocol 2} • 24-well plates (Costar) • Inverted microscope • Liquid nitrogen • Cryostorage container

Method 1. Prepare cloning mixture consisting of irradiated (30 Gy) spleen cells at 2 x 106/ml and antigen at 1-10 ug/ml in complete medium supplemented with IL-2. 2. Perform a viable count on the T-cell line (Protocol 2), and adjust the cell concentration to 1 x 105/ml. 3. Add 10 ul of the cell-line suspension to 22 ml of cloning mixture and make two 10-fold serial dilutions by transferring 2.2 ml to a further 19.8 ml of cloning mixture. 4. Plate out 200 ul per well in 96-well flat-bottomed tissue culture plates. 5. Add 25 ul IL-2 (2 IU) or neat IL 2-containing supernatant to each well on day 7. 6. After 12-14 days, score the plates for wells containing growing cells, using an inverted microscope. 7. Select the plates containing the lowest number of positive wells, in order to have the best assurance of clonality.a

114

5: Murine T-cell culture 8. Prepare fresh cloning mixture as in step 1 and distribute 1.5 ml per well in 24-well plates. 9. Transfer the growing clones to the prepared wells. 10. After 5-6 days add fresh IL-2 to a final concentration of 10 IU/ml, or 200 ul IL 2-containing supernatant. 11. Incubate for a further 8-12 days, when the wells should be confluent. Restimulate with antigen/APCs and transfer the contents of each well either to three wells of a 24-well plate, or as 10 ml cultures to 25 ml flasks (standing upright) using the same cell ratios. 12. Thereafter, expand and feed T-cell clones as determined by their growth rate. 13. When established in flasks, return the Th clones to the 'feed-starvefeed' cycle of the parental Th line, and add IL-2 only at the 'starve' phase. 14. Test all new T-cell clones for antigen specificity in a proliferation assay (see Protocol 15) as soon as possible and freeze stocks in liquid nitrogen cryostorage system, preferably at the end of the starve phase aLess than 12 per plate is acceptable. If using more than one plate per cell dilution, only a manageable number of clones (10-20) should be chosen for expansion. ''T-cell clones should be stimulated with antigen and APCs in the presence of IL-2 after thawing.

4.3 Antigen-specific T-cell proliferation The T-cell proliferation assay is based on the principle that engagement of the T-cell receptor by the MHC-antigen complex on the surface of autologous APCs, together with a second signal generated by CD28-B7 interaction, results in T-cell activation, cytokine secretion, and cell division (31). The level of antigen-induced T-cell proliferation, which is quantified by the incorporation of radiolabelled thymidine, gives a measure of the in vivo priming of T cells specific for that antigen. Since spleen or PBMCs contain professional APCs as well as T cells, these cells can be used in proliferation assays without separation or further addition (see Protocol 15). However, if a definition of the responding population (e.g. CD4+ or CD8+ T cells) is required it is necessary to used purified T-cell subpopulations or cultured Tcell lines/clones with splenic APCs (see Protocol 16). A variety of antigen preparations, including purified soluble proteins, killed viruses or bacteria, or synthetic peptides can be employed. Although, even if it has been established that T cells from a particular MHC background do recognize a peptide epitope, the responses of unpurified cells ex vivo can be very weak with synthetic peptides. In contrast, since the repertoire of epitopes on foreign 115

Kingston H. G. Mills

Figure1. Coupling of antigen to latex microspheres amplifies the proliferative T-cell response. Response of the poliovirus-specific T-cell clone 3N2s5.1 against disrupted poliovirus type 3 (disrupted by boiling in Tris buffer with 0.2% SDS and 0.5% 2mercaptoethanol) coupled to latex microspheres (•), or uncoupled disrupted virus (O), or FCS-coupled microspheres (D) as a control. The nominal antigen concentration represents the estimated final protein concentration of uncoupled disrupted virus protein and latex microsphere-adsorbed virus protein (assuming 100% binding) or the equivalent dilution of FCS-coupled microspheres. (Reproduced, with permission, from reference 30.)

antigens recognized by CD4+ T cells is very diverse, full-length foreign proteins and whole microorganisms can stimulate the potent proliferation of T cells ex vivo. The proliferation assay should be carried out using antigens in a relatively wide dose range, typically 0.1-100 ug/ml for soluble protein antigens. In situations where antigen preparations are limiting or contaminated with agents that are toxic to cells (e.g. urea or detergents), coupling of the antigen to latex microspheres (see Protocol 14) is a convenient method of purifying the antigen and of amplifying the proliferative response (32). The proliferative response curves for a poliovirus-specific T-cell clone shown in Figure 1 demonstrates that an equivalent response can be generated with 50-100-fold less antigen following coupling to latex microspheres. This approach has also been shown to be an effective means of enhancing T-cell responses to bacterial or viral antigens separated by SDS-PAGE (32). 116

5: Murine T-cell culture Protocol 14. Coupling of antigens to latex microspheres Equipment and reagents • Latex microspheres (0.8 um diameter, Sigma) • Glycine buffer: 0.1 M glycine-NaOH buffer pH8.6 • 0.2-10 mg/ml antigen (can be in a variety of buffers)

PBS supplemented with 10% FCS UV light source Petri dish Eppendorf-tube and centrifuge tubes Complete medium

Method 1. Wash the latex microspheres twice with the glycine buffer by centrifuging in a bench microcentrifuge for 5 min. 2. Mix 100 ul of a 10% (w/v) suspension of latex microspheres in glycine buffer with 50-100 ug of antigen (at concentrations ranging from 0.2 to 10 mg/ml) and bring the volume to 1 ml with glycine buffer. 3. Incubate at 4°C for 14-18 h with constant agitation. 4. Wash twice with PBS supplemented with 10% FCS by centrifugation in a bench microcentrifuge for 5 min. 5. Block unbound sites by incubation in PBS supplemented with 10% FCS at 4°C for 2 h. 6. Sterilize by exposure to UV light in a Petri dish. 7. Transfer to an Eppendorf tube centrifuge by centrifugation in a bench microcentrifuge for 5 min and resuspend in 1.0 ml of RPMI-1640 complete medium supplemented with 10% FCS. 8. Store in aliquots at -20°C.

Protocol 15. Proliferation assay with murine spleen or lymph node cells Equipment and reagents • Murine spleen cells or lymph node cellsa « Complete RPMI-1640 medium supplemented with 2% normal mouse serum or 10% FCS • Antigen (Sigma) • 2 |xg/ml Con A (soluble or latex coupled) • Irrelevant antigen (soluble or latex microsphere-coupled) • 96-well, flat-bottomed tissue-culture grade microtitre plates • 37°C incubator with 95% humidity and 5% C02 • Glass-fibre filter paper

• Automatic cell harvester • Methyl-l'Hlthymidine (Amersham), specific activity 2.0 Ci/umol, dilute to 20 uCi/ml in complete RPMI-1640 medium with 10% FCS before use • 60-80°C oven or infra-red lamp • Scintillation bags • Scintillation vials and non-aqueous scintillation fluid • B-Scintillation counter (for vials), or a Betaplate (Wallac), Microbeta (Wallac), or Topcount (Packard) counter

Method 1. Prepare mononuclear cell preparations using murine spleen cells or lymph node cellsa at 4 x 106/ml in the supplemented complete medium.

117

Kingston H. G. Mills Protocol 15.

Continued

2. Prepare a range of antigen dilutions in complete medium (0.1-100 ug/ml for soluble antigens or 10-1000 ng/ml for latex microspherecoupled antigen.b,c 3. Plate out 100 ul of the diluted antigen preparations, Con A ug/ml) or irrelevant antigen (soluble or latex microsphere-coupled), or medium alone (background control) into triplicate wells. 4. Add 100 ul/well of the mononuclear cell preparation and culture for 4-5 days in a 37°C incubator with 95% humidity and 5% C02. 5. Between 4 and 6 hours prior to completion of the culture period add 0.5 uCi of [3H]thymidine (specific activity 2.0 Ci/mmol) in 25 ul of complete medium. 6. Following the 4-6 h pulse, harvest the wells on to glass-fibre filter paper with an automatic cell harvester. 7. Dry the filters in a 60-80°C oven or under an infra-red lamp. 8. Using forceps, place complete filter sheets in bags, or add punchedout discs to scintillation vials, and add non-aqueous scintillation fluid. 9. Place the vials in a conventional B-scintillation counter, or bags in a Betaplate, Microbeta, or Topcount counter and count c.p.m. for each well. 10. Express the results as the arithmetic mean of triplicate cultures in c.p.m., or as stimulation indices, calculated by dividing the counts in cultures with antigen by the counts with medium alone or irrelevant antigen. aLymph node responses can be enhanced by the addition of irradiated splenic APCs (see Protocol 77). bNominal concentration assumes 100% binding to microspheres of antigen from original preparation. c Optimum range to be defined for individual antigens.

Protocol 16. Proliferation assay with purified T cells, T-cell lines, or T-cell clones Equipment and reagents • Complete RPMI-1640 medium supplemented with 10% FCS • Irradiated murine spleen cells (see Protocol 77) • Antigens (see Protocol 75)

• 96-well, flat-bottomed tissue-culture grade microtitre plates • Equipment and reagents for [3H] thymidine incorporation (see Protocol 75)

Method 1. Prepare responding T cells at 4 X 105/ml in complete medium. 2. Prepare APC-irradiated murine spleen cells at 8 X 106/ml, in complete medium (see Protocol 77). 118

5: Murine T-cell culture 3. Prepare antigens as described in Protocol 15 and plate out 100 uI per well in the 96-well microtitre plates. 4. Add 50 ul of T cells and 50 ul APCs per well. 5. Culture for 2-3 days (previously cultured T cells) or 4-5 days (purified fresh T cells). 6. Pulse, harvest and count radioactivity as described in Protocol 15.

4.4 Detection of Thl/ThO/Th2 responses by cytokine production In the absence of phenotypic markers for Thl and Th2 cells, the production of cytokines—characteristic of either subtype—has been used to demonstrate the induction of that T-cell population in vivo. Cytokine production by T cells can detected by a number of techniques including specific bioassays, immunoassays, or ELIspot assays, which all detect cytokine production ex vivo or after specific antigen stimulation of T cells in vitro (33). Alternative approaches include FACScan analysis with anti-cytokine antibodies for the detection of intracellular cytokines (34), or reverse transcriptase-polymerase chain reaction (RT-PCR) for cytokine mRNA (35). Each of these methods has advantages and disadvantages, and the choice of method will be determined by the specific question being addressed. Identification of a cell population secreting a particular cytokine is possible using FACS analysis of cells double-labelled for the intracellular cytokine, and against cell-surface markers specific for that distinct T-cell subtype. RT-PCR is highly sensitive, but although it demonstrates that the cell can produce the cytokine, it does not necessarily mean that it is secreted, and it is difficult to quantify. Immunoassays (on stimulated T-cell supernatants) are highly specific and relatively easy to perform on large number of samples, but they are often at the limit of their sensitivity in detecting the low levels of certain cytokines (e.g. IL-4) from cells stimulated ex vivo. Cytokine bioassays are usually very sensitive, but may not be specific for a single cytokine. Cytokine ELIspot assays are the most quantitative method and can be used to estimate the frequency of memory Thl or Th2 cells, but they are expensive and laborious to carry out. The range of cytokines that have be used for the detection of Thl/ThO/Th2 cells are IFN--y, TNF-(i, IL-2, IL-4, IL-5, IL-6, and IL-10. Although IFN--y is also produced by NK cells, y8 T cells, and CD8+ T cells, the production of IFN--y, without IL-4 or IL-5, is considered to be the most reliable indicator of a Thl response. Conversely, IL-4 or IL-5 production, without IFN--y is indicative of a Th2 response. Although IL-4 is considered to be the most important of these two cytokines for detecting a Th2 response, when compared with IL-5 it is often difficult to detect using ex vivo T cells, but it is readily detected from cultured T-cell lines or clones (9,15,19, 36). 119

Kingston H. G. Mills The detection of cytokine production by an immunoassay or bioassay on antigen-stimulated T cells has proved a convenient and reliable method for the analysis of Thl and Th2 responses in a number of laboratories, including my own (9,15, 19, 25). These assays can be used to detect cytokines secreted into the supernatants of T cells following stimulation with antigens, mitogens, or other polyclonal activators, such as PMA and anti-CD3. Purified total T cells, CD4+ T cells, or long-term antigen-specific T-cell lines or clones are stimulated with antigen and APCs as described for the proliferation assay (see Protocol 16). Unpurified spleen, lymph nodes, or a PBMC preparation can also be used (see Protocol 15), where a more crude discrimination of a type 1 or type 2 response is required without the need to define the cell population involved. However, in this case it is imperative to examine antigen-specific responses, using mitogens only as positive controls. It is important to establish the kinetics of the production of the cytokine of interest for each cell population under study. The levels of certain cytokines, such as IL-2, decline after prolonged culture due to adsorption to cell receptors. As a general rule, supernatants should be removed after 24 h for IL-2 and after 72 h for IL-4, IL5, IL-6, IL-10, or IFM-^. The most convenient approach is to establish the cultures in a 96-well format and to remove the supernatants using a multichannel pipette. The supernatants are added to fresh microtitre plates and can be stored at -20 °C for testing later. A minimum of 50 ul will be required for each cytokine assay. 4.4.1 Cytokine immunoassays Cytokine immunoassays are dependent on two affinity-purified monoclonal antibodies, each specific for different epitopes on the cytokine to be detected: one for cytokine capture and one biotin-labelled for detection. Although often sold in kit form, where the plates are supplied pre-coated with the first antibody, these can be extortionately expensive; it is well worth buying matched pairs of antibodies or looking for an independent source. Protocol 17. Assessment of cytokine levels by immunoassay Equipment and reagents • 1-2 ug/ml anti-cytokine antibody in PBS • 96-well maxisorb ELISA plates (Nunc) • ELISA washing buffer; 0.5 ml Tween-20 to ILPBS • ELISA blocking buffer PBS supplemented with 10% (w/v) milk powder (Marvel Stafford, UK) • Standard in-house cytokine • International standard cytokine or international reference reagent • Complete RPMI-1640 medium supplemented with 10% FCS • Test samples (supernatants)

• Biotin-conjugated, anti-cytokine antibody in PBS supplemented with 0.1% (w/v) BSA • Alkaline phosphatasea-conjugated streptavidin • Phosphatase substrate solution ABTS Substrate Solution: Add 150 mg 2,2'-Azino-bis(3-ethylbenzthiazoline-6-sulfonic acid) (e.g., Sigma, Cat. #A-1888) to 500 ml of 0.1 M anhydrous citric acid (e.g.. Fisher, Cat. #A 940) in ddH20; pH to 4.35 with NaOH. Aliquot 11ml per vial and store at -20 °C. Add 10ul 30% H2O2 prior to use. • ELISA plate reader

120

5: Murine T-cell culture Method 1. Add 100 ul of anti-cytokine antibody (1-2 |xg/ml in PBS) to the wells of 96-well maxisorb ELISA plates and incubate at 4°C overnight. 2. Discard excess antibody and wash the wells three times with ELISA washing buffer. 3. Add 200 ul ELISA blocking buffer and leave at room temp for 2 h. 4. Wash three times with ELISA washing buffer. 5. Prepare serial dilutions of a standard cytokine (typical range 15-5000 pg/ml) in complete medium, having previously checked the concentration of the in-house standard cytokine against the international standard or international reference reagent (31). 6. Add 50 ul of standards and test samples (supernatants) or medium alone to the wells in triplicate and incubate at 4°C overnight or at room temp for 2 h. 7. Wash six times with ELISA washing buffer. 8. Add 100 ul biotin-conjugated, anti-cytokine antibody (1-2 ng/ml) and incubate at room temp for 2 h. 9. Wash six times with ELISA washing buffer. 10. Add 100 (jol alkaline phosphatasea-conjugated streptavidin appropriately diluted (1/1000-1/5000 or as suggested by the suppliers) and incubate at room temp for 1 h. 11. Wash six times with ELISA washing buffer. 12. Add 100 fjd of the phosphatase substrate solution and leave for 20-60 min until the colour has developed. 13. Read the absorbance at 405 nm on an ELISA plate reader. 14. Construct a standard curve of absorbance versus standard cytokine concentration and read off the cytokine concentrations of the samples from their absorbance values. a

Horseradish peroxidase, fluorescent or chemiluminescent conjugates can also be used; however, the latter require access to a fluorimeter or chemiluminometer.

4.4.2 IL-2 bioassay using the CTLL cells This bioassay exploits the IL-2 dependence of the CTLL cells. Since the cell line also proliferates (weakly) in the presence of murine IL-4, it is necessary to include a neutralizing anti-IL-4 antibody when assaying murine IL-2. The CTLL cells can be obtained from the ATCC or another research laboratory. The CTLL cells are cultured in complete medium supplemented with IL-2 (5-10 U/ml recombinant IL-2 or 3% of an IL 2-containing supernatant from Con A-activated spleen cells (see Protocol 1)). Passage the cells after 2-3 days, when the cell density should have reached 1-2 X 105/ml; add 1 ml of the cell culture to a fresh flask containing 9 ml of fresh complete medium supplemented with IL-2 (passage on a Monday, Wednesday, and Friday is convenient). 121

Kingston H. G. Mills Protocol 18.

IL-2 bioassay using CTLL cells

Equipment and reagents • Complete medium; RPM1-1640 supplement with 10% PCS • Standard IL-2 • Test samples . 96-well, flat-bottomed, tissue-culture grade microtitre plates

. CO2 incubator at 37 "C • Anti-murine IL-4 antibody (1.0 M-9/ml °f 11B-11 or other anti-IL-4 neutralizing antibody) • [3H]thymidine (see Protocol 15) • Equipment and reagents for [3H]thymidine uptake and counting (see Protocol 75)

Method 1. Wash the CTLL cells twice in RPMI-1640 medium supplemented with 10% PCS by centrifugation at 300 g for 5 min at room temperature, return to the incubator for about 1 h, and wash twice again. 2. Count the CTLL cells and adjust the concentration to 2 x 10*/ml. 3. Prepare serial dilutions of standard IL-2, ranging from 0.1 to 100 U/ml. 4. Thaw test samples. If they are not already in 50 jxl volumes in 96-well plates, add 50 ul in triplicate to the wells of 96-well microtitre plates. Add 50 n-l of the diluted standards or medium only (negative control) to wells in triplicate. 5. Add 25 ul of anti-murine IL-4 antibody (1.0 ug/ml of 11-B-11 or other anti-IL-4 neutralizing antibody) and incubate at 37°C for 30 min. 6. Add 50 ul of CTLL cells to each of the wells. 7. Incubate for 24 h in a CO2 incubator at 37 °C. 8. Pulse with 0.5 jxCi [3H]thymidine in 25 |xl of complete medium per well and harvest 4-6 h later (see Protocol 75). 9. Count incorporated [3H]thymidine (see Protocol 15), prepare a standard curve of c.p.m. versus IL-2 concentration, and read off the concentration of the unknown samples from the standard curve.

4.4.3 Detection of cytokine mRNA The detection of cytokine production by antigen-stimulated T cells, using immunoassays or bioassays, can be compromised by poor sensitivity and difficulty in discriminating between bound and secreted cytokine on cell preparations ex vivo. An alternative approach to denning type I/type 2 T-cell subpopulations involves the use of RT-PCR, to detect cytokine transcripts in antigen-stimulated T cells. This approach is particularly useful in situations where the cell numbers are limited or the cytokine production is difficult to detect. However, since cytokine mRNA may be detected in cells from nai've mice without stimulation in vitro, it is important to establish the correct amplification cycle for each cytokine and to include unstimulated control cells in each experiment for comparison with the bands observed with stimulated cells. 122

5: Murine T-cell culture Protocol 19. RT-PCR for cytokine mRNA Equipment and reagents • RNA lysis buffer: 4 M guanidinium thiodATP, dCTP, dGTP, dTTP cyanate, 25 mM Na citrate, 0.5% sarcosyl, oligo-dT primer 0.1 M 2-mercaptoethanol RNAsin • Na acetate 2M, pH 4.0 AMV-RT • Phenol:chloroform:isoamyl alcohol (25:24:1 Nuclease-free water (v/v) Specific primers • Isopropanol Taq polymerase • 75% ethanol Thermocycler . 10 x buffer: 0.1 M Tris-HCI pH 8.8, 0.5 M Equipment and reagents for agarose gel KCI, 1% Triton X-100 electrophoresis . MgCI,

A. Isolation of total RNA 1. Add 1 ml of RNA lysis buffer to 5 x 106 cells, and incubate at room temperature for 5 min. 2. Add 0.1 vol. Na acetate and 1.0 vol. alcohol.

phenol:chloroform:isoamyl

3. Cool on ice for 15 min, then centrifuge at 10000 g for 15 min at 4°C. 4. Add an equal volume of isopropanol to the aqueous phase, and incubate for at least 1 h at -70°C. 5. Centrifuge as before for 30 min and wash the resultant pellet in 1 ml of 75% ethanol. 6. Centrifuge at 10000 g for 20 min at 4°C. 7. Air-dry the pellet for 10-15 min and resuspend in 1 ml of water. B. Synthesis of first-strand DNA 1. Add 1 ug of the total cellular RNA to the following reaction mix: • 2 ul 10 x buffer • 5 mM MgCI2 • 1 mM dATP, dCTP, dGTP, dTTP • 0.5 ug oligo-dT primer • 20 U RNAsin • SOU AMV-RT • nuclease-free water to give a final vol. of 20 ul. 2. Incubate the samples at room temperature for 10 min, and 42°C for 60 min. 3. Terminate the reaction by incubating at 96°C for 60 min.

123

Kingston H. G. Mills Protocol 19.

Continued

C. Polymerase chain reaction 1. Add 5 (J of cDNA to the following reaction mix: • 5 ul 10 x reaction buffer • 1.5mMMgCI2 • 0.2 mM dNTP • 1 uM of each specific primer • 2.5 U Taq polymerase • nuclease-free water to give a final vol. of 50 ul. 2. Following an initial denaturing step of 10 min at 92°C, amplify for 35 cycles of 94°C for 1 min, 60°C for 2 min, and 72°C for 2 min. Finally incubate for 10 min at 72°C. 3. Visualize the amplified products by electrophoresis on an 1-2% agarose gel.

4.5 Assay of helper function of T cells for antibody production by B cells The in vitro, helper T-cell assay (see Protocol20) tests the capacity of antigenstimulated T cells to help B cells to produce specific antibody, and is dependent on a source of antigen-primed T and B cells. An alternative in vivo helper assay can be used; this involves the adoptive transfer of primed T and B cells into sublethally irradiated syngeneic recipient mice and the assessment of specific antibody levels in the serum 10-14 days later (9). Antibody production in the supernatants of cultured T and B cells in the in vitro helper assay, or in the serum of recipient mice in the in vivo adoptive transfer method, can be assessed using a variety of assays. The simplest and most reproducible is the assessment of antibody-binding to soluble antigen by ELISA (see Protocol 21). The binding of antigens to ELISA plates varies greatly between different antigen preparations. Many operators recommend using carbonate-bicarbonate buffer at alkaline pH, but PBS at pH 7.2 appears to be adequate for most antigens. Synthetic peptides or short polypeptides often bind poorly, and here drying the antigen preparation on to the plate by placing it in a non-humidified 37 °C incubator or on the bench overnight without the lid has worked well. However, this procedure may denature native proteins and thereby destroy certain conformational antibody epitopes. Binding of certain viruses (e.g. poliovirus) has also been a problem; here an indirect binding procedure has proved successful (9). A purified polyclonal antibody (or monoclonal antibody) against the virus is first bound to the plate and used to capture the virus. This approach is also useful for the specific 124

5: Murine T-cell culture binding of antigen from relative crude preparations. Alternatively, antibody neutralization assays can be employed for antibodies against viral surface antigens or bacterial toxins. Although technically more difficult to perform, these give a more realistic measure of functional antibody production. Protocol 20. Helper T-cell assay Equipment and reagents • Purified T cells (see Protocol 8) from immunized mice or antigen-specific CD4+ T-cell clones • Complete medium; RPMI-1640 supplemented with 10% FCS

• • • •

Primed B cells (see Protocol 7) Irradiated spleen cells (see Protocol 11) 24-well tissue culture plates Humidified CO2 incubator at 37°C

Method 1. Prepare purified T cells (see Protocol 8) from mice immunized with the relevant antigen 10-14 days earlier, or use antigen-specific CD4+ Tcell clones and resuspend at 4 x 106/ml in complete medium. 2. Prepare primed B cells from immunized mice by depleting T cells with anti-Thy-1 or anti-CD3 antibodies and complement (see Protocol 7). Count and resuspend the B cells at 4 x I06/ml. 3. Prepare irradiated spleen cells as APCs (see Protocol 11) and resuspend at 8 x 106/ml in complete medium. 4. Add T cells, B cells, APCs, and antigen in duplicate or triplicate to 2 ml wells of 24-well tissue culture plates, so that the APC and B-cell concentrations are constant at 2 x 106/ml and 1 x 106/ml, respectively, and the concentration of T cells is varied from 1 x 105/mlto 1 x 106/ml, giving ratios of B cells to T cells from 1:1 up to 10:1. Determine the antigen concentrations (0.1-10 |xg/ml) for each antigen. Set up control wells containing B cells or T cells alone with antigen or T and B cells without antigen.3 5. Culture in a humidified CO2 incubator at 37°C. 6. After 7-10 days remove the supernatants and store at -20°C until ready to assay for antibody detection by ELISA (see Protocol 21).b aWhen cultured T-cell lines or clones are used, the numbers of T cells in the helper assay should be reduced by 10-100-fold. The helper function of cultured Thl clones may be undetectable due to their CTL activity against antigen-primed B cells, especially at higher T:Bcell ratios. b Due to interference by residual antigen in the assaying of secreted antibody, in some cases it may be necessary to change the medium during the culture period. Some workers have recommended removing most of the medium after 1-5 days, adding fresh medium, and culturing for a further 5-7 days before removing the supernatants for antibody analysis. Care should be taken not to disturb the cells during this procedure.

125

Kinsston H. G. Mills Protocol 21. Antibody detection by ELISA Equipment and reagents • 96-well, maxisorb ELISA plates (NUNC) • Antigen in PBS pH 7.2 or in carbonatebicarbonate coating buffer 0.05 M pH 9.6 (1.59 g Na2 CO3 + 2.93 g Na HCO3 to 1L H20) • Complete medium; RPMI-1640 medium supplemented with 10% PCS • ELISA washing buffer (see Protocol 77) • ELISA blocking buffer (see Protocol 77) • Multichannel pipette

• Test samples (neat culture supernatants or serum diluted 1/1000) • Alkaline phosphatase-conjugated sheep/ goat/rabbit anti-mouse Ig (or specific antibodies against Ig isotypes or IgG subclasses) • Phosphatase substrate solution (see Protocol 17] • ELISA plate reader

Method 1. Coat the wells of 96-well, maxisorb ELISA plates with antigen by adding 100 ul antigen (concentration 1-5 ng/ml) in PBS or in carbonatebicarbonate coating buffer and incubating at 4°C overnight. 2. Wash three times with ELISA washing buffer. 3. Add ELISA blocking buffer and leave at room temp for 1 h. 4. Wash three times with ELISA washing buffer. 5. Add 100 ul of complete medium to the wells in rows 2-8 of the plate and add 200 |J volumes of test samples (neat culture supernatant or serum diluted 1/100) in triplicate to the first row of wells. Set up triplicate samples of a standard supernatant, or appropriately diluted serum or purified preparation known to contain antibodies against the antigen on the plate (positive control) in this row. Add medium alone to wells for the negative controls. 6. Use a multichannel pipette to make serial dilutions of the test and control samples by transferring 100 ul from row one to row two and so on down the plate, discarding 100 ul from row 8 (alternatively, a wider range of dilutions can be performed by diluting across the plate). 7. Incubate at room temp for 2 h. 8. Wash six times with ELISA washing buffer. 9. Add 100 ul of alkaline phosphatase-conjugated sheep/goat/rabbit anti-mouse IgG (or specific antibodies against Ig isotypes or IgG subclasses). 10. Incubate for 2 h at room temp. 11. Wash six times with ELISA washing buffer. 12. Add 100 ul of the phosphatase substrate solution. 13. Incubate for 20-40 min at room temp and read the absorbance at 405 nm on an ELISA plate reader.

126

5: Murine T-cell culture 14. Express the results as end-point antibody titres by linear regression from the straight part of the curve to 2 standard deviations above the background control values.

5. Generation and detection of antigen-specific CD8+ CTLs 5.1 In vivo priming of CD8+ CTLs CD8+ cytotoxic CTLs recognize peptide antigens, generated by the endogenous route of antigen-processing and presented in association with MHC class I molecules (1, 2, 37). Hence, CD8 + CTLs usually require a replicating immunogen, such as a live virus, for their induction. Recently, however, lipidbased adjuvant systems such as liposomes and ISCOMs have been shown to be capable of stimulating CTLs (14). CTLs can also be generated against alloantigen and tumour cells, but only virus-specific CTLs will be considered here.

5.2 Generation of CD8+ T-cell lines and clones Spleen cell preparations, which contain CTL memory cells from primed mice previously infected with the virus or immunized with viral antigen in an appropriate live vector or adjuvant system, are restimulated in vitro by antigen in bulk cultures. These bulk cultures provide sources of effector cells for establishing virus-specific CTL lines (see Protocol 22) or for the immediate detection of CTL responses (see Protocol 23). The murine spleen cells are restimulated in vitro with target cells (see Protocol 24} infected with the virus, or pulsed with a synthetic peptide known to contain a CTL epitope for the MHC haplotype of the donor. CTL lines can be maintained by restimulation with autologous or MHC-compatible target cells infected with virus or pulsed with synthetic peptides. Unlike CD4+ Th lines, CD8+ CTL lines are dependent on a source of exogenous IL-2 for their survival. Protocol 22. Generation and maintenance of murine virusspecific CD8+ CTL lines Equipment and reagents • Responder spleen cells from virus-primed mice • 50 ml flasks • Complete medium; RPHI-1640 medium supplemented with 10% FCS

. IL-2 • Virus-infected or peptide-pulsed target cells (irradiated syngeneic spleen cells, see Protocol 75)

Method 1. Prepare a suspension of responder spleen cells from virus-primed mice at 2 x 106/ml.

127

Kingston H. G. Mills Protocol 22. Continued 2. Prepare virus-infected or peptide-pulsed target cells (irradiated syngeneic spleen cells) at 2 x 105/ml and add to responder cells in 10 ml volumes in 50 ml flasks. 3. After 5 days of culture add IL-2 (10 lU/ml) and fresh medium (10 ml). 4. After 10-12 days transfer cells to 15 ml centrifuge tube, centrifuge at 300 g for 5 min at room temperature and resuspend at 1 x 106 viable cells/ml. 5. Repeat the restimulation step as described in step 2, except add IL-2 to the medium throughout. 6. The effector (responding T cell) to target ratio can be reduced to 1:1 after four rounds of antigen stimulation. 7. Clone by limiting dilution (see Protocol 13).

5.3 Cytotoxic T-cell assay The MHC-restricted cytotoxic activity of antigen-specific T cells is usually measured in a chromium release assay (see Protocol 25) using peptide-pulsed or virus-infected target cell lines which are MHC-compatible with the responding T cell. Tumour-cell lines expressing a range of murine MHC class I or class II molecules are available from the ATCC (e.g. P815 (H-2d), EL4 (H-2b), or A-20 (H-2k). In general, CTL assays are performed with antigenrestimulated bulk cultures established 5-10 days prior to assay (see Protocol 22). However, assays can also be performed using fresh spleen cells or PBMCs or established T-cell lines. Because of the low frequency of responding Tcells, lysis may not be detectable using fresh cells even at a high K:T ratio (100:1 or 50:1). In contrast, established T-cell lines or clones should kill at K:T ratios as low as 1:1. Although the chromium release assay (see Protocol 25) is described for class-restricted CTLs, it can also be used to test the cytotoxic activity of CD4+ Thl cells (9). In this case, MHC class-II matched APCs incubated with peptides, soluble proteins, killed viruses, or bacteria are used as the target cells. Protocol 23. Preparation of murine CTL effector cells using bulk cultures Equipment and reagents • Spleen cells from virus-infected or immunized mice • Complete medium; RPMI-1640 supplemented with 10% FCS • Live virus, vaccinia virus recombinant, or specific peptide

• 50 ml flasks « CO2 incubator at 37°C . IL-2 • Equipment and reagents for cell viability count (see Protocol 2)

128

5: Murine T-cell culture Method 1. Prepare spleen cells from virus-infected or immunized mice, and suspend at 2 x 106/ml in complete medium. 2. Culture cells with live virus (establish the concentration for each virus), vaccinia virus recombinant (107 p.f.u. per ml), or specific peptide (1-10 ug/ml; previously shown to be recognized by mice of the corresponding haplotype) in 10-20 ml volume in 50 ml flasks (upright) at 37°C in a C02 incubator. 3. Add 5 U/ml of IL-2 after 3-4 days and culture at 37°C in a C02 incubator for a further 4-5 days, or longer if fresh medium and IL-2 is added. 4. At the end of the culture period, centrifuge the cells (200 g for 5 min) and count the number of viable cells (see Protocol 2). 5. Resuspend at 2-4 x 106/ml in complete medium.

Protocol 24. Preparation of 51Cr-labelled target cells Equipment and reagents • Target cells (e.g. tumour cell line) • Serum-free medium . [51Cr] Chromate 37 MBq/ml, 1 mG/ml (Amersham) • RPMI-2: RPMI-1640, 2% FCS

• Complete medium; RPMI-1640 supplemented with 10% FCS • Equipment and reagents for cell viability count (see Protocol 2}

Method 1. Centrifuge 5 x 106 target cells at 300 g for 5 min at room temperature and resuspend in 0.2-0.3 ml of serum-free medium. 2. Add 100 uCi 51Cr per 5 x 106 cells and incubate for 60 min at 37°C. 3. Add 10 ml of RPMI-2 and centrifuge at 300 g for 5 min at room temperature. Discard the supernatant into the radioactive-waste container following local guidelines. Repeat twice. 4. Resuspend in complete medium and count the number of viable cells (see Protocol 2). 5. Resuspend at 2 x 105/ml.

Protocol 25. Chromium release assay Equipment and reagents • Antigen (peptide, live virus, or vaccinia virus recombinant) • 51Cr-labelled target cells • Complete medium RPMI-1640 supplemented with 10% FCS (see Protocol 24)

• • • «

129

96-well microtitre plates LP2 tubes Multichannel pipette Effector cells (see Protocol 23)

Kingston H. G. Mills Protocol 25.

Continued

• Gamma scintillation counter (tubes) or a Microbeta (Wallac) or Topcount (Packard) beta scintillation counter (plates) and the appropriate scintillation fluid

. 1% Triton X-100 (v/v) • Plate carriers for bench top centrifuge

Method 1. Add antigen (determine the optimum concentrations for individual antigens beforehand, or use a range of doses) to aliquots of the target cells.a 2. Prepare twofold dilutions of the effector cells in complete medium in triplicate wells of 96-well plates using a multichannel pipette. 3. Add 100 ul of target cells to each of the wells containing effector cells and into 12 additional wells without effector cells. Add 100 ul of complete medium to six of these wells, to measure the spontaneous 51 Cr release from target cells, and 100 ul of 1% (v/v) Triton X-100 to the other six wells, to measure the maximum 51Cr release from target cells. 4. Using plate carriers, centrifuge the plate(s) at 150 g for 1 min to gently pellet the cells and allow the interaction of CTL effector and target cells. 5. Incubate the plates at 37°C for 4-6 h. 6. Centrifuge the plate(s) at 250 g for 5 min. 7. Harvest 100 ul of the supernatant/well, using a multichannel pipette, and transfer to a fresh plate or LP2 tubes for counting. 8. Count the radioactivity of each sample in a gamma scintillation counter (tubes) or in a Microbeta or Topcount beta scintillation counter (plates) after the addition of the appropriate scintillation fluid. 9. Calculate the percentage cytotoxicity as follows:

10. If spontaneous release is greater than 20% the results may not be reliable. a The number and volume of aliquots will be determined by the number of test and control antigen preparations and the number of effector-cell samples to be tested.

6. MHC restriction analysis T cells recognize antigenic peptides in association with MHC molecules on the surface of APCs (1, 2). The foreign antigen is taken up by macrophages, 130

5: Murine T-cell culture Table 3. MHC restriction analysis of T-cell clones Mouse strain

EB

D

Response of cloriea 1 2 3 4

k k b k d

k k b d d

+ + + _ -

H-2 subregion

K

AB

CBA

k

B10.AQR B10.A(4R) B10.A(5R) BALB/c

q k b d

k k

k b d

EB k k k b d

k

k

+ + _ _ -

_ _ _ _ +

_ _ _ + +

d

a The response of four T-cell clones restricted to l-A , l-E , K , and Dd, respectively. (Reproduced, with permission, from Taylor, P. M., Thomas, D. B., and Mills, K. H. G. (1987). In Lymphocytes: a practical approach (1st edn) (ed. G. B. Klaus), p. 133. IRL Press, Oxford.)

dendritic cells, B cells, or other APCs, either by receptor-mediated endocytosis or by non-specific mechanisms, such as phagocytosis or pinocytosis, where it is then processed into fragments or peptides prior to association with MHC molecules (12, 13, 37). In general, CD4+ Th cells recognize foreign antigen only in association with MHC class II antigens (I-A- or I-E-region gene products in the mouse), whereas CD8+ CTL cells are restricted to class I (K, D, or L region) molecules. Restriction analyses are carried out on Th cells using the proliferation assay (see Protocol 15), and on CTL cells using the killing assay (see Protocol 25), with APCs or targets, respectively, from syngeneic, allogeneic, or recombinant mouse strains (38). Only those APCs or targets with the precise restriction element present will give a positive response. Table 3 describes four clones (1, 2, 3, and 4) which are restricted to I-Ak, I-Ek, Kd, and Dd regions, respectively. Alternatively, restriction analysis can be performed by blocking studies using antibodies specific for individual class I or class II gene products of the MHC haplotype used to generate the T-cell clones. Autologous APCs are pre-incubated with antibody (1-10 ug/ml of purified IgG, azide-free) for 30 min prior to the addition of antigen and T cells, after which the standard proliferation or CTL assay is performed. Inhibition of the T-cell responses indicates that the T-cell recognizes antigen in association with the MHC molecule against which the antibody is directed.

Acknowledgements This work was supported by The Wellcome Trust, The Irish Health Research Board, Enterpriselreland, and the EU Biotechnology and Biomed Programmes. I am grateful to the numerous postdoctoral fellows, postgraduate students, and research assistants as well as former colleagues who helped in the development and refinement of the techniques described in this chapter. 131

Kingston H. G. Mills

References 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 29.

Zinkernagel, R. M. and Doherty, P. C. (1979). Adv. Immunol., 27, 51. Schwartz, R. H. (1985). Annu. Rev. Immunol., 3, 237. Mosmann, T. R. and Coffman, R. L. (1989). Annu. Rev. Immunol, 7, 165. Mahon, B. P., Johnson, P., Moore, A., and Mills, K. H. G. (1998). Crit. Rev. Biotechnol., 18, 251. Schulz, M., Zinkernagel, R. M., and Hengartner, H. (1991). Proc. Natl Acad. Sci. USA, 88, 991. Mills, K. H. G. (1989). Curr. Opin. Inf. Dis., 2, 804. Coffman, R. L., Seymour, B. W., Lehman, D. A., Hiraki, D. D., Christiansen, J. A., Shrader, B., Cherwinski, H. M., Savelkoul, H. M., Finkelman, F. D., Bond, M. W., and Mosmann, T. R. (1988). Immunol. Rev., 102, 5. Abbas, A. K, Murphy, K. M., and Sher, A. (1996). Nature, 383, 787. Mahon, B. P., Katrak, K., Nomoto, A., Macadam A., Minor, P. D., and Mills, K. H. G. (1994). J. Exp. Med., 181, 1285. O'Garra, A. and Murphy, K. (1994). Curr. Opin. Immunol., 6, 458. Morrison, L. A., Lukacher, A. E., Braciale, V. L., Fan, D. P., and Braciale, T. J. (1986). J. Exp. Med., 163, 903. Mills, K. H. G. (1986). Immunol. Today, 7, 260. Germain, R. N. (1986). Nature, 322, 687. Maychaudhuri, S. and Morrow, W. J. W. (1993). Immunol. Today, 14, 344. Moore, A., McGuirk, P., Adams, S., Jones, W. C, McGee, J. P., O'Hagan, D. T., and Mills, K. H. G. (1994). Vaccine, 13, 1741. Moore, A., McCarthy, L., and Mills K. H. G. Vaccine, 17, 2517. Mahon, B. P., Ryan, M. Griffin, F., and Mills, K. H. G. (1996). Infect. Immun., 64, 5295. Ryan, M., McCarthy, L., Mahon, B., Rappuoli, R., and Mills, K. H. G. (1998). Int. Immunol., 10, 101. Barnard, A., Mahon, B. P., Watkins, J., Redhead, K., and Mills, K. H. G. (1996). Immunology, 87, 372. Ogra, P. L. and Garofalo, R. (1990). Progr. Med. Virol., 37, 156. Mills, K. H. G. (1986). In Immunological techniques, methods in enzymology, Vol. 121 (ed. J. J. Langone and H. van Vunakis), p. 726. Academic Press, London. Fathman, G. and Fitch, F. W. (1982). Isolation, characterization and utilization of T-lymphocyte clones. Academic Press, New York. Mills, K. H. G., Skehel, J. J., and Thomas, D. B. (1986). J. Exp. Med., 163, 1477. Corradin, G., Etlinger, H. M., and Chiller, J. M. (1979). /. Immunol, 119, 1048. Mills, K. H. G., Barnard, A. L., Watkins, J., and Redhead, K. (1993). Infect. Immun., 61, 399. Groux, H. O., Garra, A., Bigler, M., Rouleau, M., Svetlana, A., de Vries, J. E., and Roncarolo, M. G. (1997). Nature, 389, 737. Okamura, H., Kashiwamura, S., Tsutsui, H., Yoshimoto, T., and Nakanishi, K. (1998). Curr. Opin. Immunol, 10, 259. Gajewski, T. F., Pinnas, M., Wong, T., and Fitch, F. W. (1991). /. Immunol, 146, 1750. Pulendran, B., Smith, J. L., Gaspary, G., Brasel, K., Pettit, D., Maraskovsky, E., and Maliszewski, C. R. (1999). Proc. Natl. Acad. Sci. USA, 96, 1036. 132

5: Murine T-cell culture 30. Rissoan, M.-C., Soumelis, V., Kadowaki, N., Grouard, G., Briere, F., de Waal Malefyt, R, and Liu, Y.-J. (1999). Science, 283, 1183. 31. Lenschow, D. J., Walunas, T. L., and Bluestone, J. A. (1996). Annu. Rev. Immunol., 14, 233. 32. Katrak, K., Mahon, B. P., Jones, W., Brantigam, S., and Mills, K. H. G. (1992). J. Immunol. Methods, 156, 247. 33. Thorpe, R., Wadhwa, M., Bird, C. R., and Mire-Sluis, A. R. (1992). Blood Rev., 6, 133. 34. Jung, T., Schauer, U., Heusser, C., Neumann, C., and Rieger, C. (1993). J. Immunol. Methods, 159, 197. 35. Melby, P. C., Darnell, B. J., and Tryon, V. V. (1993). J. Immunol. Methods, 159, 235. 36. Swain, S. L., McKenzie, D. T., Weinberg, A. D., and Hancock, W. (1988). J. Immunol., 141, 3445. 37. Townsend, A. R. M., Gotch, F. M., and Davey, J. (1985). Cell, 42, 457. 38. Klein, J., Fiueroa, F., and David, C. S. (1983). Immunogenetics, 17, 553.

133

This page intentionally left blank

6

Human CD4 culture A. VYAKARNAM, B. VYAS, M. VUKMANOVIC-STEJIC, P. GORAK-STOLINSKA, D. WALLACE, A. NOBLE, and D. M. KEMENY

1. Introduction Advances in technologies to isolate, grow, and clone CD4 T cells of chosen specificities have facilitated our understanding of the generation of T-cell receptor diversity and the role of the MHC class I and class II gene products in antigen presentation (1-3). Antigen-specific T-cell lines have been used in the immunotherapy of cancer (4) and in the study of the immunopathology of chronic viral infections (5). Using T-cell clones, the rules governing the T-cell recognition of proteins and synthetic peptides are now being understood, thereby facilitating the production of synthetic vaccines that elicit either class I- or class II-restricted T-cell immunity (6). Recent advances in human CD4 T-cell culture techniques have both confirmed the presence of functionally distinct subsets of CD4 T cells and revealed the complexities of CD4 function. Human CD4 T cells have been classified as either naive cells or memory cells based on their state of activation, responsiveness to IL-2, and on their ability to respond to recall antigens (7). In HIV infection, for example, there is a selective loss of naive CD4 cells, an expansion of memory cells, and a loss of IL-2 production (8). These functional changes within the CD4 compartment were detected with markers that distinguish between naive and memory CD4 cells (8). Within the memory compartment, human CD4 T cells, like their murine counterpart, can be functionally classified into Thl, Th2, and ThO subsets on the basis of the cytokines they produce. Although many cytokines can distinguish these subsets, and despite evidence that the human CD4 compartment is likely to be more heterogeneous than the murine counterpart, there is overwhelming support for the classification of human Thl/Th2 cells to be based on the production of IFN-y and IL-4 (9-11). Thl cells produce IFN-y but not IL-4, and the converse is true for the Th2 subset. The ThO subset produces both IL-4 and IFN-y, and is thought to represent a heterogeneous population of partially differentiated effectors comprising multiple discrete subsets able to secrete both Thl and Th2 cytokines (9-11). The functions of

A. Vyakarnam et al. Thl and Th2 cells correlate with their cytokine profiles. Thl cells are important for the induction of antigen-specific CD8 T-cell responses and are involved in cell-mediated inflammatory reactions, whereas Th2 cells encourage antibody production more efficiently than Thl cells and are particularly important for the induction of IgE (9-11). Many factors govern the induction of Thl/Th2 cells in vivo (10), but two features of Thl and Th2 cells are central to their function. First, each T-cell subset produces cytokines, which serve as autocrine growth factors and promote the differentiation of naive T cells into that subset. Second, the two subsets produce cytokines that cross-regulate each other's development and activity. Thus IFN-Y amplifies Thl development and inhibits Th2 cells, and IL4 produced by Th2 cells has the opposite effect. The net effect of cytokinemediated self-amplification and cross-regulation is that once a T-cell response begins to develop along one pathway, namely Thl or Th2, it becomes increasingly polarized in that direction (9-11). Indeed, many immune disorders are associated with a Thl/Th2 imbalance and understanding the mechanisms of such dysregulation is of importance in developing therapeutic strategies (9-11). In this context, the development of techniques that enable the enumeration of cytokine-producing cells by flow cytometry after intracytoplasmic staining (12) could facilitate our understanding of the pathogenesis of disorders such as AIDS (13), where infection does not lead to a polarized type 1 or type 2 state despite significant changes in the production of both type 1 and type 2 cytokines (14). In this chapter we describe techniques for the isolation of CD4 T cells from peripheral blood and their separation into naive and memory cells. We provide methods by which CD4 cells can be expanded into oliogoclonal Thl and Th2 effector populations, as well as cloning techniques to generate large numbers of cells of chosen specificities. Included are four assays to monitor CD4 T-cell function: (a) a proliferation assay; (b) an assay for activation-induced cell death; (c) cytokine production measured by ELISA; and (d) a method for enumerating cytokine-producing cells by intracytoplasmic staining.

2. General apparatus, media, and reagents for human CD4 culture 2.1 Apparatus You will need the following: • a class II microbiological safety cabinet: all tissue culture should be carried out under strict aseptic conditions; 136

6: Human CD4 culture • disposable, sterile, tissue culture plastics (a range of manufacturers can be used, unless specifically stated) for culturing and manipulating cells; • a refrigerated centrifuge; • a humidified 37°C, 5% CO2 incubator; • a haemocytometer; • a light microscope; and • a caesium source for irradiating feeder cells.

2.2 Media • A range of growth media can be used; the most commonly used is RPMI1640 (Gibco BRL) • Complete culture medium throughout this chapter (unless otherwise stated) consists of RPMI-1640 medium supplemented with 2 mM L-glutamine, 10% human AB serum (heat-inactivated—see below), 50 mM 2B-mercaptoethanol, MEM non-essential amino acids, 1 mM sodium pyruvate, and 20 ug/ml gentamicin. • Serum supplements: either human AB serum (HS) and/or fetal calf serum (FCS) can be used to grow human CD4 T cells. Sera should be batch-tested for their ability to support T-cell growth before use, and all sera should be heat-inactivated. They can be purchased from a variety of sources.

2.3 Reagents • Interleukin-2 (IL-2) (R&D Systems; Eurocetus), this is critical for T-cell growth and survival. • Stimuli: anti-human CD3, anti-human CD28 (Becton Dickinson), phytohaemagglutinin (PHA-L, Sigma). • Purified CD4 cells are critically dependent on the presence of antigenpresenting cells, stimuli (recall antigen or mitogens), and IL-2 for growth. The nature of feeder cells and irradiation dose is indicated in the relevant protocols.

3. The isolation and culture of CD4 T-cell subsets from peripheral blood 3.1 Principle 3.1.1 Techniques to isolate CD4 naive and memory T cells The study of immunological memory in T cells requires reliable markers that can be used to distinguish and separate naive and memory cells. Many molecules including integrins, members of the immunoglobulin supergene family, and other adhesion and homing-related molecules are expressed on both naive 137

A. Vyakarnam et al. and memory cells, but, as they are expressed at different levels (7), they are unsuitable for use in isolating these subsets. The leucocyte common antigen (CD45) is expressed on all nucleated haemopoietic cells, but there is reciprocal expression of high and low molecular weight isoforms on resting and activated CD4 T cells (7, 15, 16). Cells expressing the high molecular weight isoform CD45RA are defined as naive, because of their poor proliferative response to recall antigens and the observation that mitogen or antigen stimulation induces the down-regulation of CD45RA and the induction of the low molecular weight isoform CD45RO. Cells expressing CD45RO are considered to be memory cells, based on the higher frequency of cells responding to recall antigens (17, 18). With the availability of antibodies specific for CD45RA and CD45RO, these markers have become the most reliable method of separating human CD4 cells into naive and memory cells, respectively, despite recent evidence that under certain conditions the expression of these isoforms can revert to their original state (19). Protocol 1. Isolation of CD4 T cells by negative selection Equipment and reagents • Magnetic particle separator, and bidirectional rotator (Dynal) 50 ml conical capped tubes Tissue culture flasks (25 ml, 75 ml) 5 ml and 14 ml polypropylene, roundbottomed capped tubes Cell scraper 25 ml Universal tube Haemocytometer Preservative-free heparin (Pump-Hep 5000 units/5 ml, Leo Laboratories)

• Ficoll-Hypaque (Pharmacia) • Sheep anti-mouse Ig • IgG-coated Dynabeads and DETACHaBEAD (Dynal) • Monoclonal antibody (e.g. BectonDickinson/Pharmingen, Dako, Sigma, Serotec, and Harlan Seralab) . Medium: RPMI-1640 + 5% FCS • Phosphate buffered saline-A (PBSA) • BSA pH 7.4 « Anti-mouse IgG-FITC monoclonal antibody

Method 1. Collect 50 ml of blood into tubes containing preservative-free heparin, and mix gently but thoroughly. 2. Dilute the blood 1:1 with either RPMI-1640 containing 5% FCS (medium) or PBSA containing 0.1% bovine serum albumin (BSA). Layer 35 ml of the diluted blood on to 15 ml Ficoll-Hypaque in a 50 ml tube and centrifuge at 400 g for 30 min at 20°C with the brake off. 3. Harvest the interface-(peripheral blood mononuclear fraction, PBMC) into a fresh tube and dilute 1:3 with medium or PBSA + BSA. Spin at 400 g for 15 min at 20°C. 4. Remove the supernatant. Resuspend the cell pellet in 20 ml of medium and spin at 300 g for 12 min at 20°C. 5. Remove the supernatant. Resuspend the cell pellet in 20 ml of medium and count cells using a haemocytometer.

138

6: Human CD4 culture 6. Remove the majority of macrophages/monocytes (adherent fraction) by adjusting the cell concentration to no more than 5 x 105/ml, then incubate the cells in a plastic tissue culture flask (20 ml per 75 mm3 flask) or Petri dish at 37°C in an incubator for 1 h. 7. Remove the non-adherent fraction by pipetting.a 8. Count the cells and spin down the non-adherent fraction. 9. Resuspend the cells at 2 X 106/ml (no more than 5 ml/tube in a 25 ml Universal) in a cocktail of mouse IgG monoclonal antibodies specific for monocytes/macrophages (CD14), B cells (CD20), NK cells (CD16), CD8T cells. Incubate for 20 min at 4°C with frequent gentle mixing. 10. Wash the cells twice with cold medium or PBSA + BSA, spin at 300 g for 10 min at 4°C. 11. Incubate 3-4 ml of the cells, at 2-5 x 106 cells/ml, in 5 ml roundbottomed tubes with pre-washed, sheep anti-mouse Ig-coated immunomagnetic beads, at a bead-to-cells ratio of 3-4:1. Gently rotate the samples, preferably using bi-directional rotation (Dynal sample mixer), for 30 min at 4°C. 12. Deplete the resetted cells by placing the sample tube with a magnetic particle separator for 2 min. Gently collect the non-rosetted fraction whilst the tube is still attached to the magnet. 13. Spin down the non-rosetted cells at 300 g for 10 min at 4°C and count. 14. Check the purity using immunofluorescence by staining 1 x 105 cells with the recommended amount of anti-mouse IgG-FITC monoclonal antibody. 15. Repeat steps 11-14 about three or four times to ensure a high level of purity. a Adherent cells can be scraped off and used as autologous antigen-presenting cells, if required, after they have been irradiated.

Protocol 2. Isolation of CD4 naive and CD4 memory T cells by negative selection Equipment and reagents • As for Protocol 1

• Anti-CD45RA antibody antibody

or anti-CD45RO

Method 1. Prepare the cells as in Protocol 1, steps 1-8. 2. Add anti-CD45RA antibody to deplete naive cells or add anti-CD45RO

139

A. Vyakarnam et al. Protocol 2.

Continued

antibody to deplete memory cells, in addition to the depleting monoclonal antibodies used in Protocol 1, step 9. 3. Continue as in Protocol 1, steps 8-15.a a Four or five rounds of depletion may be required for optimal separation.

3.1.2 Variations and problems • Positive selection can be used for separating CD4 T cells from PBMCs. In this case, cells are incubated with magnetic beads that have been directly coated with CD4. Following incubation with the magnetic particle separator, the rosetted cells are collected and detached from the magnetic beads (DETACHaBEAD, Dynal). • Negative selection is preferable for separating CD45RA and CD45RO subsets; there is a small population of cells with intermediate levels of staining that are CD45RA+CD45RO+ and difficult to remove by positive selection. Negative selection also avoids problems that might be caused by residual cells with antibody interfering in assays of cell function. • Hybridoma supernatants or purified monoclonal antibodies may be used in separations after pre-titration. • The cell-to-bead ratio used depends on the target population to be enriched. With successive depletion steps the ratio of beads to cells can be decreased. This ratio should be titrated for each system. • Alternative immunomagnetic separation systems are available. For example, the MACS system (Miltenyi Biotec) has the advantage that positively selected cells can be cultured or used for immunofluorescence staining without any interference from the beads, which are much smaller in size. • It is possible to start Protocol 2 (separation of CD45RA and CD45RO cells) after completing Protocol 1 (with purified CD4 T cells).

3.2 The generation of CD4+ Thl, Th2, and ThO effectors 3.2.1 Principle Upon challenge with antigens, CD4 T cells differentiate into effector T cells and produce high levels of many cytokines. In general, the peripheral blood of healthy individuals does not contain high numbers of effector T cells— probably due to their rapid migration into tissues, where they release high levels of cytokines when they re-encounter antigen (20). However, the generation of effector cells from CD4+ PBMCs can be performed in vitro using polyclonal stimuli, and the resulting cells polarized towards Thl or Th2 phenotypes in the presence of exogenously added cytokines (21). IFN-y and IL-12 (a macrophage-derived cytokine with potent IFN-y-inducing 140

6: Human CD4 culture properties) are commonly used to polarize CD4 T cells towards a Thl phenotype, whereas IL-4 in combination with anti-IL-12 or anti-IFN-Y is used to polarize CD4 T cells towards a Th2 state. These blast-like effector cells produce high levels of IL-4, IFN-y, and other cytokines when restimulated, which can be detected by intracellular staining (see Section 4.4). They are thought to be derived mainly from CD4 memory-type cells. This technique provides an ideal model for studying the regulation of the Thl/Th2 balance within the CD4 compartment, and provides a rapid alternative to T-cell cloning for the analysis of polyclonal T-cell responses. It is also ideal for studying T-cell responses to superantigens. Unlike T-cell clones, effector populations generated in this way are heterogeneous and are more likely to resemble those induced in vivo on challenge with complex infectious agents or environmental antigens. Protocol 3. Generating CD4 Th1 and Th2 effectors Equipment and reagents • 14 ml, polypropylene, round-bottomed capped tubes • 24-well, tissue culture plates • Antibodies (anti-human CD3, anti-human CD28 (Becton Dickinson), and anti-human IL-12 (R&D Systems)) • Phosphate-buffered saline (PBS) pH 7.4

• Recombinant IL-12 (R&D Systems) • Complete culture medium: RPMI-1640 medium supplemented with 2 mM L-glutamine, 10% human AB serum (heat-inactivated— see Section 2.2), 50 mM 2B-mercaptoethanol, MEM non-essential amino acids, 1 mM sodium pyruvate, 20 ug/ml gentamicin

Method 1. Prepare CD4 T cells as described in Protocol 1. 2. Wash the cells in complete culture medium at 300 g for 7 min at 4°C in 14 ml polypropylene tubes and adjust the cell concentration to 2 x 106 cells/ml. 3. Prepare a sufficient quantity of PBS containing anti-CD3 (5 ug/ml) and anti-CD28 (2 ug/ml), to coat each well of a 24-well plate. Use 200 ul to coat the surface of one well. Allow the antibodies to bind to the culture surface either for 1 h at room temperature or overnight at 4°C, the antibodies are now 'immobilized'. Remove the PBS from the culture wells and wash with complete culture medium before adding 1 ml of the cell suspension. 4. Generate Th1 effectors by culturing in the presence of rlL-12 as follows. Prepare a solution of rlL-12 at 10 ng/ml in complete culture medium. Add 1 ml of this solution to the 1 ml of CD4 T cells to give a final concentration of rlL-12 of 5 ng/ml and CD4 T cells at 1 x 106 cells/ml. 5. Generate Th2 effectors by culturing CD4 T cells with rlL-4 and anti-IL12 or anti-IFN-y as follows. Prepare a solution of rlL-4 at 200 U/ml and 141

A. Vyakarnam et al. Protocol 3. Continued anti-IL-12 at 10 ug/ml in complete culture medium. Add 1 ml of this solution to 1 ml of the CD4 T cells to give final concentrations of rlL-4 at 100 U/ml, anti-IL-12 at 5 ug/ml, and the T cells at 1 x 106/ml. 6. Refresh the culture medium on day 2 of culture with complete medium containing recombinant cytokines only, followed by an additional change of complete medium on day 4.

3.2.2 Variation and problems • Polarized populations of Thl cells are usually differentiated by day 4 of culture, but Th2 cells are not fully differentiated until day 6. Thl and Th2 cells are usually evaluated by cytokine-production profiles. This can be done by intracellular cytokine staining and analysis by flow cytometry (see Section 4.4) or by cytokine-capture ELISA (see Section 4.3). • Effectors can be generated from cord-blood CD4 T cells using the same protocol. However, anti-IL-4 (5 ug/ml) should be added along with IL-12 to generate Thl cells from cord blood. The degree of polarization of CD4 T cells towards Thl or Th2 varies greatly between donors, and mixtures of Thl and Th2 effectors may be obtained. ThO effectors, which stain positively for both IL-4 and IFN-y, are induced at only a low frequency under these culture conditions. • Choice of stimulus: the use of anti-CD3 and anti-CD28 avoids confounding effects induced by the presence of feeder cells, but autologous feeder cells may be used in conjunction with recall antigens to generate effector populations enriched for the chosen antigen-specific CD4 cells. • In the above protocol, IL-2 is optional and can be used along with the other cytokines at 20 U/ml.

3.3 Generation of antigen-specific and random CD4 clones

3.3.1 Principle The most widely used technique for cloning human CD4 cells is the limiting dilution method, which is comprehensively reviewed elsewhere (22-25, Chapter 8). CD4 cells are plated at low numbers (usually 1 cell/3 wells) to ensure (statistically—Poisson distribution, see ref. 26) that the resulting clones are derived from a single precursor. Cloning at these low cell numbers is critically dependent on the presence of irradiated feeder cells, stimuli (mitogens or recall antigens), and the growth factor IL-2. Detailed below are three protocols for CD4 cloning. Protocols 4 and 5 can be used to generate antigenspecific clones and Protocol 6 describes the generation of random CD4 clones. 142

6: Human CD4 culture Protocol 4. Generation of antigen-specific clones without bulk culture Equipment and reagents • • • • •

60-well Terasaki plates 96-well, flat-bottomed plates Multichannel pipette Eppendorf Multipette Complete culture medium: RPMI-1640, 10% HS, 1% sodium pyruvate, 1% non-essential amino acids (NAA), 50 mM 2-mercaptoethanol, 50 |xg/ml gentamicin

Sterile, glass Pasteur pipettes Vacuum pump with tubing Recombinant IL-2 (Eurocetus) Antigen (e.g. D. pteronyssimus or tuberculin) X-irradiation source PHA Dispenser tips

Method 1. Positively select CD4T cells from PBMCs and resuspend in complete culture medium at a range of concentrations from 105/mlto 101/ml. 2. Prepare autologous PBMCs (feeder cells) at 1 x 106/ml in complete medium and X-irradiate at 4000 rads. 3. Using an Eppendorf multipette fitted with a sterile tip, plate out 10 ul/well of purified CD4 T cells in 60-well Terasaki plates. Add 10 ul of freshly prepared X-irradiated autologous feeders (1 x 106/ml) and antigen at the appropriate final concentration (e.g. D. pteronyssimus at a final concentration of 10 ug/ml, or tuberculin at 10 ug/ml) per well. Prepare 10 plates at the lowest concentration.a Avoid using the corner wells of the Terasaki plate, which tend to dry out rapidly. 4. Ensure that the plate lid is tightly closed and incubate for 5 days at 37°C, 5% C02. 5. On day 5, aspirate 10 ul of the culture medium as follows: attach a sterile, glass Pasteur pipette with a long fine tip to a vacuum pump and aspirate the culture medium carefully. At the end of each row of six wells, flame the tip of the Pasteur pipette to prevent the carry-over of cells. Add back 10 ul of fresh complete culture medium containing 40 U/ml of IL-2 to each well with an Eppendorf multipette and sterile dispenser tip and culture for a further 5 days at 37°C, 5% C02. 6. On day 10 score the wells for cell growth. Score wells positive when proliferation is clearly visible.b Calculate the cloning frequency using weighted-mean statistics as described by Taswell (26). 7. Transfer the cells from the wells deemed positive (at the lowest cell/well concentration) to flat-bottomed, 96-well plates and add 100 ul of the complete culture medium supplemented with IL-2 (20 U/ml). 8. On day 14, restimulate by adding 100 ul of the complete culture medium containing 5 ug/ml final concentration PHA, 105 irradiated feeders/well, and a final concentration of 50 U/ml IL-2.

143

A. Vyakarnam et al. Protocol 4.

Continued

9. Every 3-4 days remove half the complete culture medium and replace with fresh complete medium containing IL-2 (20 U/ml final concentration) using a multichannel pipette and ensuring that a single tip is used per well. 10. Every 14 days restimulate clones using PHA, IL-2, and irradiated feeders as in step 7. 11. Proceed to Protocol 7 when the wells are confluent. a b

Note: No IL-2 is added at this stage to avoid random T-cell activation. It may be helpful to have a plate with just the irradiated feeders as a negative control.

Protocol 5. Generation of antigen-specific clones with bulk culture Equipment and reagents • As Protocol 4

Method 1. Positively select CD4T cells from PBMCs and resuspend in complete culture medium at 1 X 106/ml. 2. Prepare autologous PBMCs (feeder cells) at 1 x 106/ml in complete culture medium and X-irradiate at 4000 rads. 3. Plate out (in 96-well, flat-bottomed plates) 100 ul/well of purified CD4 cells and 100 ml irradiated feeders and antigen at the appropriate concentrations and culture at 37°C, 5% C02. Depending on the cell number, set up 5-12 wells. 4. On day 5, remove half the complete culture medium with a multichannel pipette (ensuring a single tip is used per well) and replace with 100 ul fresh complete culture medium containing IL-2 (20 U/ml final concentration). 5. On day 10, pool the cells from all the wells. Wash and dilute to 3 cells/ ml, and transfer 100 ul to fresh 96-well plates (final concentration .0.3 cells/well), together with 100 ul of freshly prepared X-irradiated autologous feeders (1 x 106/ml) and antigen at the appropriate final concentrations for 10 days at 37°C, 5% CO2. Prepare at least five plates. 6. On days 5 and 10, remove 100 ul of the complete culture medium and replace with 100 ul fresh complete medium containing 20 U/ml of IL-2 with a multichannel pipette (ensure that a single tip is used per well). 144

6: Human CD4 culture 7. On days 13-14 score the wells for cell growth. Score the wells positive when proliferation is clearly visible.a 8. On day 14 restimulate with PHA (5 |xg/ml final concentration) and Xirradiated heterologous feeder cells (at 1 x 106/ml in complete medium) by adding 100 ul of the complete culture medium containing PHA, irradiated feeders, and IL-2 (50 U/ml). 9. Every 3-4 days remove half the culture medium and replace with fresh complete culture medium containing IL-2 (20 U/ml final concentration) using a multichannel pipette and ensuring that a single tip is used per well. 10. Every 14 days restimulate the clones using PHA, IL-2, and irradiated feeders as in step 8. 11. Proceed to Protocol 7 when the wells are confluent. a

It may be helpful to have a plate plated with just the irradiated feeders as a negative control.

3.3.2 Variation and problems • If precursor frequency is very low, the bulk culture can be repeated for two or three rounds before limiting dilution. • Instead of irradiated autologous PBMCs as feeders, autologous EpsteinBarr (EBV)-transformed B-cell lines can be used. The irradiation dose for EBV-lines is generally 10000 rads, but the dose should be checked to ensure that it is sufficient to stop cell division. EBV lines give flexibility to T-cell, antigen-specific cloning and expansion by circumventing the need for repeated bleeding to produce autologous feeders. However, EBV lines are intrinsically immunogenic and can result in the expansion of EBV-specific clones, thereby reducing the frequency of antigen-specific clones. • The method described above of cloning in Terasaki as opposed to 96-well plates is designed to use the minimum number of feeders and purified CD4 T cells necessary for successful cloning. Protocol 6. Generation of random clones Equipment and reagents • As Protocol 4

Method 1. Positively select CD4 T cells from PBMCs and resuspend in complete culture medium at a range of concentrations from 1 x 105/ml to 1 x 101/ml. 2. Prepare autologous PBMCs (feeder cells) at 1 x 106/ml in complete

145

A. Vyakarnam et al. Protocol 6. Continued medium supplemented with PHA at 10 ug/ml and IL-2 at 100 U/ml, and irradiate at 4000 rads. 3. Plate out 10 ul/well of purified CD4 T cells in Terasaki plates, add 10 ul of freshly prepared X-irradiated autologous feeders (1 x 106/ml + stimuli + IL-2) and incubate for 10 days at 37°C, 5% C02 (i.e. final concentration 100, 10, 3, 1, 0.3, and 0.1 cells/well). Prepare at least three plates at the lowest concentration. 4. On day 10 score the wells for cell growth. Score the wells positive when proliferation is clearly visible.a Calculate the cloning using weighted-mean statistics as described by Taswell (26). 5. Transfer the cells from the wells deemed positive (at the lowest cell/well concentration) to flat-bottomed, 96-well plates and add 100 ul complete culture medium supplemented with IL-2 (20 U/ml). 6. On day 14 restimulate with PHA (5 ug/ml final concentration) and irradiated heterologous feeder cells (at 1 x 106/ml in complete medium) by adding 100 ul of complete medium containing PHA, irradiated feeders, and IL-2 (50 U/ml final concentration). 7. Every 3-4 days remove half the culture medium and replace with fresh complete culture medium containing IL-2 (20 U/ml final concentration). 8. Every 14 days restimulate the clones using PHA, IL-2, and irradiated feeders as in step 6. 9. Proceed to Protocol 7 when the wells are confluent. a It may be helpful to have a plate with just the irradiated feeders as a negative control.

Protocol 7. Maintenance of clones Equipment and reagents • • • •

As Protocol 4 24-well plates 6-well plates Culture flasks (75 cm2)

• Liquid nitrogen • Ficoll-Hypaque (Pharmacia) (75 cm2)

Method 1. Repeat 14-day cycles as in steps 6-8 of Protocol 6. 2. After the wells become confluent, transfer cells into 24-well plates, 6well plates, and/or flasks. Increase the feeder-cell number to (approximately) equal the number of cloned cells. Ideally, maintain the CD4 clones at 1 x 106/ml. Freeze aliquots at regular intervals (at the end of the stimulation cycle) in liquid nitrogen.

146

6: Human CD4 culture 3. Separate out the live cells using density-gradient centrifugation if a large number of dead cells and debris accumulate after a period of culture. To do this, layer the cultures into Ficoll-Hypaque and continue as in Protocol 1, steps 2-5.

4. Assays for CD4 function 4.1 Principle of proliferation assay Radiolabelled thymidine, [3H]thymidine, provides an alternative nucleotide which can be incorporated into DNA. As cells grow and divide, DNA is synthesized and the amount of incorporation is directly proportional to the level of cell growth. Optimal lymphocyte growth can be achieved using a variety of different stimuli, notably: anti-CD3 and the protein kinase C (PKC) activator PMA (phorbol myristate acetate); immobilized anti-CD3 and antiCD28; or PMA in conjunction with the calcium ionophore, ionomycin. However, this kind of assay does not measure cell viability, and alternative methods exist that enable both cell proliferation and viability to be assessed. An example of such an assay is WST-1 (Boehringer Mannheim, cat. no. 1644 807). This is a colorimetric assay based on the cleavage of the tetrazolium salt WST-1 by mitochondrial dehydrogenase in viable cells. For details of the protocol, refer to the manufacturer's handbook. Protocol 8. Proliferation assay: activation with anti-CD3 and anti-CD28 Equipment and reagents • 96-well microtitre plates (Nunc, distributed by Gibco BRL) • Glass-fibre filters to match the beta-counter (Pharmacia) • Complete culture medium: RPMI-1640, 10% HS, 1% sodium pyruvate, 1% non-essential amino acids (NAA), 50 mM 2-mercaptoethanol, 20 ng/ml gentamicin

• • • •

Cell harvester (Skatron) Beta-counter (Betaplate™, Pharmacia) Stimuli (mitogens or antibodies of choice) 3 H-labelled methyl thymidine (Amersham) ([3H]thymidine stock at 1 mCi/ml; dilute to give a working stock of 50 uCi/ml in complete medium)

Method 1. Take flat-bottomed, 96-well microtitre plates and coat with 50-100 ul of anti-CD3 (5 ug/ml) and anti-CD28 (5 ug/ml) in PBS for 2-4 h at 37°C. 2. Wash the plates thoroughly with complete culture medium by dispensing 100 ul into each well and then removing it carefully by suction. Repeat this wash step once more and then dispense 100 ul of the complete culture medium into the appropriate wells. 3. Resuspend the CD4 T-cell population under investigation at 1 x 106/ml and plate out 100 uI/well.

147

A. Vyakarnam et al. Protocol 8. Continued 4. Prepare triplicate wells for each stimulus. Set up control wells to contain cells without stimulus. 5. Incubate the cells for 1-4 days at 37°C, 5% CO2 (see variations below). 6. Add 10 ul [3H]thymidine (0.5 uCi/well) for the last 6 h of culture. 7. Measure the incorporated radiolabel by harvesting the cells on to glass-fibre filters using a cell harvester. Allow the filter to dry overnight at room temperature. 8. Once dried, seal the filter in a bag with 10 ml scintillant fluid (Wallac) and read using a beta-counter—the readout will give the counts per min (c.p.m.) of radioactivity in the samples.

4.1.1 Variations and problems • Do not leave cells in the presence of the radiolabel for more than 6 h, as longer incubation times result in extensive thymidine breakdown. • For CD4 T-cell effectors and clones, proliferation can be measured following a 24-h stimulation. Freshly purified CD4 T cells from PBMCs require a 3-4 days' culture. • For anti-CD3 and PMA stimulation, coat plates with anti-CD3 as above and use PMA at a final concentration of 1 ng/ml. • For PMA and ionomycin stimulation, make up a PMA solution as described in Protocol 6, step 2 and add ionomycin at a final concentration of 400 ng/ml. • It is important to optimize the stimuli for optimal proliferation, as high doses of mitogen, e.g. anti-CD3, can induce a state of 'unresponsiveness' or cell death, thus compromising the proliferative response. • For freshly isolated CD4 T cells plate cells at 105/well. For CD4 clones and effectors plate at 1-2 X 104 cells/well. Protocol 9. Antigen-specific proliferation Equipment and reagents • As Protocol 8

Method 1. Use freshly isolated CD4 T cells from PBMCs or CD4-effector cells or clones on day 14 of the stimulation cycle (see Protocols 5 and 6). Wash the cells in complete culture medium (no IL-2) before use. 2. Prepare autologous PBMCs (feeder cells) at 1 x 106/ml in complete medium and irradiate at 4000 rads.

148

6: Human CD4 culture 3. Plate out 100 ul/well of CD4 clones/effectors (2 x 104/well), and 100 ul irradiated autologous PBMCs (feeders). Culture without antigen (control) or with antigen at the appropriate concentration in 96-well plates at 37°C, 5% C02. Prepare at least three wells for each dilution of antigen, and for the controls. 4. Incubate the cells for between 48 h and 4-6 days (see below). Add 10 ul [3H]thymidine (0.5 uCi) for the last 6 h of culture in complete culture medium. 5. Harvest the cells on to glass filters and count in a Matrix beta-counter (see Protocol 8).

4.1.2 Variations and problems • It is useful to employ a wide range of antigen concentrations, at least until the optimum concentration for a particular antigen has been established. • For freshly isolated CD4 T cells, plate cells at 1-2 X 105/well. For CD4 clones and effectors, plate at 2 X 104 cells/well. • For freshly isolated CD4 T cells, optimum antigen-specific proliferation can take between 4-6 days, but this may take only 2-3 days for CD4 effectors and clones.

4.2 Activation-induced cell death 4.2.1 Principle Stimulation of primary CD4 cells in vitro using polyclonal stimuli results in their rapid proliferation and differentiation into effector cells, with few dead or dying cells detectable in the cultures. After several days, however, substantial numbers of cells become apoptotic and the expansion in cell numbers comes to an end. Furthermore, restimulation of effector cells often induces a large proportion of the cells to undergo rapid apoptosis and death. It is not fully understood why some cells die while others proliferate further upon secondary stimulation (27). However, much of the activation-induced cell death (AICD) is due to the expression of Fas-ligand on activated T cells, which interacts with the Fas cell-surface receptor. Fas is expressed constitutively on T cells and when triggered by FasL in susceptible cells induces apoptosis (28). AICD is distinct from T-cell death caused by cytokine deprivation and is dependent on the presence of IL-2 (27, 28). It is mainly restricted to the Thl subset (28) and serves to prevent excessive inflammatory T-cell reactivity. It can be readily induced in both Thl clones and short-term cell lines by the method described in Protocol 10. AICD is generally measured by enumerating apoptosis at the single-cell level. In the early stages of apoptosis the plasma membrane becomes disrupted and loses its asymmetry without the cell membrane becoming 149

A, Vyakamam et al. permeable. Phosphatidylserine (PS), located only on the inner part of the plasma membrane in live cells, becomes translocated on to the external surface during apoptosis. Annexin V has selective affinity to PS under specific salt and calcium concentrations, and this has become a useful method for identifying apoptotic cells (29). The simultaneous staining of cells with a viability stain such as propidium iodide (PI) can distinguish cells with intact membranes from dead cells or cells with damaged membranes. Necrotic cells lose membrane integrity and become permeable, which allows staining of the nucleus with PI and positive staining with Annexin V. Apoptotic cells only stain with Annexin V. Protocol 10. Induction of AICD Equipment and reagents 96-well, tissue culture plates 5 ml, polystyrene, round-bottomed tubes Flow cytometer CD4 T cells PBS pH 7.4 Culture medium FITC-labelled Annexin V (Sigma)

50 mg/ml propidium iodide in PBS (Sigma) Binding buffer: 10 mM Hepes/NaOH pH 7.4, 140 mM NaCI, 2.5 mM CaCI2 Antibodies (anti-CD3, Becton Dickinson) Recombinant IL-2 (Becton Dickinson) Plate holder

Method 1. Incubate 50 ul of anti-CD3 (5 |xg/ml in PBS) in each well of a 96-well plate for 1 h at room temperature or overnight at 4°C, to allow the antiCD3 to be immobilized on the plate. 2. Wash the cultured CD4 effectors (see Section 1.2) at 300 g for 7 min and resuspend in complete culture medium at 2 x 106 cells/ml. 3. Add 100 ul of the cell suspension to the wells with 100 ul of rlL-2 at 200 U/ml to give a final concentration of 100 U/ml and a total of 2 x 105 cells/well. 4. Briefly (30 sec) centrifuge the plate at 200 g to bring the cells on to the well surface and incubate for 8 h at 37°C in 5% CO2.

Protocol 11. Detection of AICD (apoptosis) Equipment and reagents • As Protocol 10

• Micropipettor

Method 1. Remove the cells from the wells with a micropipettor and transfer to 5 ml tubes. Wash once or twice with cold PBS for 5 min at 200 g. 150

6: Human CD4 culture 2. Resuspend the cells in 100 ul of the binding buffer containing FITClabelled Annexin V (according to the manufacturer's instructions) plus 5-10 ul of the propidium iodide solution. Incubate for 15 min at room temperature in the dark. 3. Finally add 400 ul of the binding buffer and analyse on a flow cytometer within 1 h of labelling. 4. Include the following controls: single colour controls for FITC-labelled Annexin V alone, propidium iodide alone, and unstained cells.

4.2.2 Variations and problems • Apoptosis can be detected using a wide variety of techniques in addition to that suggested here. The Annexin V protocol allows cells to be simultaneously stained for cell-surface markers and apoptosis using multicolour flow-cytometric analysis. Dying cells may be present in CD4-effector populations, giving high background staining. These can be removed by density-gradient centrifugation before the induction of AICD.

4.3 Measuring cytokine production in culture supernatants by ELISA 4.3.1 Principle The enzyme-linked immunosorbent assay (ELISA) is a well-established method for measuring cytokine levels in vitro (30, 31). Such assays are based on the availability of cytokine-specific antibodies, and are generally reasonably sensitive, reliable, quick, and easy to perform. The amount of cytokine measured in an immunoassay is related to the extent of antibody binding, and this in turn may be correlated to biological activity (e.g. units/ml) when suitable cytokine standards of known biological potency are used to calibrate the immunoassay. Alternatively, homogeneous cytokines of known protein content can be used for calibration in terms of cytokine concentration (e.g. pg or ng/ml). Protocol 12 describes a sandwich ELISA that uses a pair of commercially available monoclonal anti-cytokine antibodies. The principle is as follows: • The cytokine is bound by an immunosorbent (anti-cytokine monoclonal antibody bound to a solid phase). • The bound cytokine is detected by a biotinylated second monoclonal antibody, which in turn is detected by sequential treatment with a conjugate of streptavidin linked to an appropriate enzyme followed by the relevant substrate. An alternative procedure to that described above is to use a combination consisting of a monoclonal anti-cytokine antibody (as capture) and a poly151

A. Vyakarnam et al. clonal anti-cytokine antibody for detection. Furthermore, a number of different amplification stages can be used before the final substrate development. There are three enzymes commonly used for conjugation: horseradish peroxidase, alkaline phosphatase, and B-galactosidase.

Protocol 12. Measurement of cytokines by ELISA Equipment and reagents • ELISA reader (Molecular Devices from Coulter Electronics) linked to an ordinary line printer • Computer software for data analysis (optional) (SoftMax from Molecular Devices, Coulter Electronics, compatible for PCs) • Plate washer (Wellwash 4, Life Sciences International/Coulter Electronics) • Multichannel pipette • Paired anti-cytokine monoclonal antibodies for coating, and biotinylated second antibodies for detection (AMS Biotechnology; Cambridge BioScience; Medgenix Ltd)

• 96-well ELISA plates with U-shaped wells (Corning Easy Wash, Corning) . PBS pH 7.4 • 2% BSA (Sigma) in PBS . Wash buffer: 0.05% Tween-20 in PBS • Detection system: streptavidin/alkaline phosphatase (AMS Biotechnology; Amersham International) • Recombinant cytokines for standards (R&D Systems; AMS Biotechnology) • Substrate for alkaline phosphatase: p-nitrophenyl-phosphate (pNPP) (Sigma)

A. Coating 1. Dilute the monoclonal anti-cytokine antibody in PBS to 2-10 ug/ml. 2. Add 50 ul of monoclonal antibody per well to a 96-well ELISA plate with U-shaped wellsa and incubate at 4°C overnight or at 37°C for 2 h. 3. Wash twice with the wash buffer. 4. Block overnight with PBS/2% BSA (v/v) at 4°C. B. Detection 1. Wash the plate once with 200 ul of the wash buffer. 2. Add 50 ul of standards in serial twofold dilutions to columns 1 and 2 of a 96-well plate and test samples in duplicate. Incubate for 2 h at 37°C or overnight at 4°C. 3. Wash the plate three times with 200 ml of the wash buffer. 4. Add 50 ul of biotinylated anti-cytokine antibody diluted to 1 ug/ml. Incubate for 1 h at room temperature. 5. Wash the plate four times as before. 6. Add 50 ul of the streptavidin/alkaline phosphatase complex diluted 1:1000 in PBS/2% BSA and incubate for 1 h at room temperature. 7. During this incubation make up the substrate by dissolving pNPP tablets in distilled water. Ensure that the substrate is at room temperature.

152

6: Human CD4 culture 8. Wash the plate four times as before. 9. Add 50 ul of the substrate per well, and leave in the dark for 30 min1 h for the colour to develop. 10. Measure the absorbency at 405 nm. a When using flat-bottomed plates use 100 ul in this and all subsequent steps.

4.3.2 Variations and problems • The use of biotinylated reagents together with multivalent streptavidinenzyme conjugates may enhance the sensitivity of an ELISA considerably, but it may also increase non-specific binding leading to a high background. • It is important to use the same diluent in the ELISA assay that the cells were cultured in. • Correct calibration is vital, and care must be taken to ensure that appropriate references are used.

4.4 Enumerating cytokine-producing cells by flow cytometry: intracytoplasmic cytokine staining 4.4.1 Principle This assay was first described by Jung et al. (12), who demonstrated the feasibility of using intracytoplasmic staining and flow cytometry to assess Tcell cytokine production. This technique enables the frequency of cytokineproducing T cells to be determined on a single-cell basis; and multiparameter flow cytometry allows further correlation to cell phenotype and function (13). The protocol consists of three steps involving the in vitro stimulation of T cells to induce cytokine production in the presence of a protein transport inhibitor. This is followed by cell fixation, permeabilization, and then intracytoplasmic staining of accumulated cytokines. Protocol 13. Activating CD4 cells for intracytoplasmic cytokine staining Equipment and reagents • 24-well, tissue culture plates • 5 ml Falcon tubes • Culture medium: RPMI-1640, 10% FCS, 20 ug/ml gentamicin • CD4 T-cell population

• Protein transport inhibitors: brefeldin or monensin (Sigma) • Stimuli: PHA, PMA, ionomycin (Sigma) . 0.5% BSA in PBS

Method 1. Resuspend CD4 T cells in the culture medium at a density of 1 x 106 cells/ml and plate out 0.5 ml into 24-well tissue culture plates. 153

A. Vyakarnam et al. Protocol 13.

Continued

2. Culturing cells with 10 ng/ml PMA and 400 ng/ml ionomycin in a final volume of 1 ml to ensure maximal cytokine induction. 3. Incubate the cells at 37°C for 4-48 h (see below). 4. In the last 4-6 h of culture, add a protein transport inhibitor (the most commonly used are brefeldin-A and monensin) at a final concentration of 5 ug/ml. 5. Transfer the cells to 5 ml Falcon tubes and wash twice in PBS/0.5% BSA.

4.4.2 Variations and problems • Time of activation: this will need to be assessed for each system. For CD4 T-cell clones 4 h of activation will suffice, whereas freshly isolated CD4 T cells will need to be activated for 12-48 h. • Choice of protein synthesis inhibitor: this may influence both the type and level of cytokine detected. Therefore it is advisable to conduct some preliminary experiments to assess the capacity of these inhibitors to affect intracellular cytokine detection. • If cells are to be surface-stained as well as stained for intracellular cytokines, this should be carried out at this stage (following the normal staining protocols), prior to fixation. Once stained for surface ligand, proceed to fixing the cells. • PMA and ionomycin can down-regulate many cell-surface markers (in particular CD4) and hence may not be a suitable choice for some experiments. Protocol 14. Fixing and permeabilizing cells for intracytoplasmic cytokine staining Equipment and reagents • Stimulated CD4 pellet (see Protocol 13) • 30 ml, capped Universal tubes • 4% formaldehyde (Sigma)

. 0.5% BSA (Sigma) in PBS • 0.5% saponin/1% BSA (both from Sigma) in PBS pH 7.4

Method 1. Add 1 ml of 4% formaldehyde solution to the stimulated CD4 cell pellet in capped, 30 ml Universal containers (Protocol 13). Vortex and leave to stand at room temperature for 20 min in the dark. 2. Wash once in 2 ml PBS/0.5% BSA and centrifuge at 200 g for 10 min at 4°C. 3. Add 2 ml of PBS containing 0.5% saponin/1% BSA for 20 min at room temperature in the dark. Vortex periodically and centrifuge at 200 g for 10 min at 4°C.

154

6: Human CD4 culture 4.4.3 Variations and problems • It is possible to substitute the fixing and permeabilization steps described above by incubating the cells with a commercially available, cellpermeabilization reagent (e.g. OrthoPermeafix™, Ortho Diagnostics (following the manufacturer's protocol)). If OrthoPermeafix is used, follow Protocol 15 using PBS/BSA (no saponin). • Fixing cells with OrthoPermeafix gives the flexibility of staining for surface antigens at the same time as the intracytoplasmic staining. It is important to consider whether staining in one step with a cocktail of antibodies compromises staining of some surface antigens/cytokines: in that case multistep staining can be used. Protocol 15. Intracellular cytokine staining—detection of two cytokines by one-step staining Equipment and reagents • Fixed and permeabilized cells (see Protocol 14) • Antibodies for intracytoplasmic staining: anti IL-4-PE and anti-IFN-y-FITC (PharMingen; other sources can also be used) • FITC conjugated to the isotype control and PE conjugated to the isotype control

• . . •

Microcentrifuge tubes 0.5% saponin/1% BSA in PBS PBS/0.1% BSA pH 7.4 Flow cytometer (e.g. FACscan, Becton Dickinson) and flow-cytometry software for data acquisition and analysis (e.g. CellQuest, Becton Dickinson)

Method NB: Ensure that saponin is included in all steps, since its effects are reversible. 1. Aliquot 2 x 105 fixed and permeabilized cells into microcentrifuge tubes and stain with 50 ul of directly labelled fluorochrome antibodies specific for IL-4 (IL-4-PE) and IFN-y (IFN-y-FITC) using optimized concentrations (1/100 final dilution of the above antibodies are routinely used). 2. Include appropriate controls (this is important). Typically, use three tubes for two-colour immunofluorescence and stain cells with the following combinations—Tube 1: IL-4-PE plus FITC conjugated to the isotype control; Tube 2: IFN-y-FITC plus PE conjugated to the isotype control; and Tube 3: IFN-y-FITC plus IL-4-PE. 3. Leave the cells to incubate for 30 min at room temperature in the dark. 4. Following incubation, wash the cells thoroughly with 2 ml of PBS containing 0.5% saponin/1% BSA and centrifuge at 200 g for 10 min at 4°C.

155

A. Vyakarnam et al. Protocol 15. Continued 5. Resuspend in PBS/0.1% BSA for direct-flow cytometric analysis. Resuspend in 1% paraformaldehyde and store at 4°C if cells are not to be studied immediately. 6. Acquire samples on a flow cytometer and analyse using the appropriate software.

4.4.4 Variations and problems • Acquisition: it is important to set the compensation for FL1 (FITC) and FL2 (PE) channels with the help of samples stained either with FITC or PE in the presence of the isotype controls conjugated with the second fluorochrome (Tubes 1 and 2 in Protocol 15). • Lack of intracellular staining may be attributed to one or more of the following factors: - insufficient antibody: it is necessary to optimize the concentration of each antibody to be used; -incubation time: it may be advisable to extend the incubation time of staining, although this may compromise specificity; - insufficient permeabilization: ensure the samples are thoroughly vortexed following fixation as this will prevent cells from aggregating and will allow saponin to permeabilize the cells efficiently. • Staining in plates versus tubes: in some instances where large numbers of samples need to be processed, staining can be carried out in 96-well Flexiplates as follows: distribute cells at 1-2 X 105 per well in a 96-well Flexiplate and stain exactly as above. For washing, place the Flexi-plate into a 96-well, U-bottom hard plate, cover and centrifuge at 300 g for 5 min at 4°C. To discard the supernatant, hold the Flexi-plate firmly within the hard plate and flick the plate quickly over a sink. Cover the plate and hold firmly on a vortex mixer for a few sec to resuspend the cells before proceeding. Washing volumes in 96-well plates should be 100 ul/well. • Specificity: it is important to show that the antibodies are specific for the cytokines under test. For Thl/Th2 cytokines, this is most effectively done using highly polarized clones as shown in Figure 1. Alternatively, incubate the antibody with recombinant cytokine (in excess) and use this mixture to block staining.

156

6: Human CD4 culture

Figure 1. Detection of IL-4 and IFN-y in CD4 clones by two-colour immunofluorescence. 2 x 106CD4 clones (Th1, ThO,Th2) were activated with PMA and ionomycin for 4 h in the presence of brefeldin as described in Protocol 14. The cells were harvested and fixed with OrthoPermeafix according to the manufacturer's instructions. The cells were washed in PBS/1% BSA twice and 2 x 105 cells distributed in microcentrifuge tubes. Each clone was distributed in three tubes (a total of nine tubes) and the cells washed and stained with IL4-PE, IFN-y-FITC, and the isotype controls as described in Protocol 15. Data in Figure 1 shows the profile of IL-4 (FL2) and IFN-7 (FL1) staining on the single controls and the double staining for each clone.

157

A. Vyakarnam et al.

References 1. Fathman, G. and Fitch, F. W. (1982). Isolation, characterisation and utilisation of T-lymphocyte clones. Academic Press, NY. 2. Fink, P. J., Matis, L. A., McElligot, D. L., Bookman, M., and Hendrik, S. M. (1986). Nature, 321, 319. 3. Schwartz, R. H. (1984). Annu. Rev. Immunol, 3, 237. 4. Rosenberg, S. A. (1996). J. Natl Cancer Inst., 88, 1635. 5. Klenerman, P. and Zinkernagel, R. M. (1997). Immunol. Rev., 159, 5. 6. Townsend, A. R. M., Gotch, F. M., and Davey, J. (1985). Cell, 42, 457. 7. Beverley, P. C. L. (1991). Curr. Opin. Immunol., 3, 355. 8. Connors, M., Kovacs, J. A., Krevat, S., Gea-Banacloche, J. C., Sneller, M. C., Flanagan, M., Metcalf, J. A., Walker, R. E., Falloon, J., Baseler, M., Stevens, R., Feuerstein, I., Masur, H., and Clifford-Lane, H. (1997). Nature Med., 3, 533. 9. Mossman, T. R. and Sad, S. (1996). Immunol. Today, 17, 138. 10. Romangnani, S. (1997). Immunol. Today, 18, 263. 11. Abbas, A. K., Murphy, K. M, and Sher, A. (1996). Nature, 383, 787. 12. Jung, T., Schauer, U., Heusser, C., Neumann, C., and Rieger, C. (1993). J. Immunol. Methods, 15, 197. 13. Ledru, E., Lecouer, H., Garcia, S., Debord, T., and Gougeon, M-L. (1998). J. Immunol, 160, 3194. 14. Fakoya, A., Matear, P. M., Filley, E., Rook, G. A. W., Stanford, J., Gilson, R. J. C., Beecham, N., Weller, I. V. D., and Vyakarnam, A. (1997). AIDS, 11, 1445. 15. Horgan, K. J., Tanaka, Y., and Shaw, S. (1992). Chem. Immunol, 54, 72. 16. Sanders, M. E., Makgoba, M. W., and Shaw, S. (1988). Immunol. Today, 9, 19. 17. Akbar, A. N., Terry, L., Timms, A., Beverley, P. C. L., and Janossy, G. (1988). J. Immunol., 140, 2171. 18. Merkenschlager, M., Terry, L., Edwards, R., and Beverley, P. C. L. (1988). Eur. J. Immunol., 18, 1653. 19. Bell, E. B., Sparshott, S. M., and Bunce, C. (1998). Immunol. Today, 19, 60. 20. Swain, S. L., Bradley, L. M., Croft, M., Tonkonogy, S., Atkins, G., Weinberg, A. D., Duncan, D. D., Hedrick, S. M., Dutton, R. W., and Huston, G. (1991). Immunol. Rev., 123, 115. 21. Gerosa, F., Paganin, C., Peritt, D., Paiola, F., Scupoli, M. T., Aste-Amezaga, M., Frank, I., and Trinchieri, G. (1996). J. Exp. Med., 183, 2559. 22. Feldmann, M., Lamb, J. R., and Woody, J. N. (1985). Human T cell clones: a new approach to immune regulation. Humana Press, Clifton, OH. 23. Fitch, F. W., Fathman, C. G., and Andrew, M. E. (1982). Isolation, characterization, and utilization of T lymphocyte clones. Academic Press, New York. 24. Lanzavecchia, A. (1985). Nature, 314, 537-9. 25. von Boehmar, H. and Haas, W. (1984). T cell clones. Elsevier Science, Amsterdam. 26. Taswell, C. (1981). J. Immunol, 126, 1614. 27. Russell, J. H. (1995). Curr. Opin. Immunol, 7, 382. 28. Ramsdell, F., Seaman, M. S., Miller, R. E., Picha, K. S., Kennedy, M. K., and Lynch, D. H. (1994). Int. Immunol, 6, 1545. 158

6: Human CD4 culture 29. Vermes, I., Haanen, C, Steffens-Nakken, H., and Reutelingsperger, C. (1995). J. Immunol. Methods, 184, 39. 30. Kemeny, D. M. (1981). A practical guide to ELISA. Pergamon Press, Oxford. 31. Meager, A. (1991). In Cytokines: a practical approach (ed. F. R. Balkwill), p. 299. IRL Press, Oxford.

159

This page intentionally left blank

7

Human cytotoxic T-lymphocyte (CTL) studies SARAH L. ROWLAND-JONES

1. Introduction Cytotoxic T-lymphocytes (CTLs) play a major part in the cellular immune response to viruses and other intracellular infections, and in the control of many tumours. They are able to recognize cells expressing foreign antigens through a specific interaction of their T-cell receptors (TCRs) with surface class-I HLA molecules on the target cells which have bound peptides from the pathogen or tumour antigens. This leads to the release of cytokines such as interferon-gamma (IFN-y) and tumour necrosis factor-alpha (TNF-a), chemokines such as RANTES and MIP-la, and ultimately to the lysis of the target cell. The lytic process is caused both by the release of perform and through fas-ligand triggering of programmed cell-death in cells expressing fas (reviewed in ref. 1). On first contact with antigen the CTLs, which initially expand, can persist as memory cells: in most studies of human CTLs, the aim is to detect and expand in vitro this memory-cell population from peripheral blood mononuclear cells (PBMCs). CTLs recognize small peptides (of between 8 and 11 amino acids in length) from foreign proteins that have been broken down in the cytosol of infected or tumour cells by the proteases of the proteasome complex (2). Peptide fragments are translocated to the endoplasmic reticulum (ER) by the transporters associated with antigen-processing (TAPs), where they bind to newly synthesized class I molecules in a groove formed by the alpha helices of the a1 and a-2 domains (reviewed in ref. 3). Human HLA molecules are highly polymorphic and most of the polymorphism occurs in the peptide-binding groove: in consequence, different HLA molecules bind different kinds of peptides (4). Thus a key component of CTL studies is to identify the dominant peptide targets of CTL recognition associated with individual class I HLA molecules for a particular pathogen or tumour. CTLs have been demonstrated in many human virus infections (5). This chapter will present protocols for some of the antiviral CTL responses studied extensively in our group, notably CTLs specific for influenza A and human

Sarah L. Rowland-Jones immunodeficiency virus (HIV-1). In recent years there has been considerable interest in generating CTLs specific for human tumours, in particular for malignant melanoma, for which, although not specifically discussed here, many of the same principles will apply (reviewed in refs 6 and 7).

2. General principles of CTL culture 2.1 Tissue culture reagents and conditions There is a certain mystique attached to CTL culture which has discouraged many laboratories from embarking on this type of work. Some of the newer methods of quantitating antigen-specific CTLs from freshly separated PBMCs, such as the IFN-y ELISpot assay described below, and the use of soluble peptide-HLA tetrameric complexes to stain CTLs described in Chapter 9, obviate the need for CTL culture. However, it will probably remain useful to be able to culture antigen-specific CTL lines and clones, in order to examine in detail the fine specificity of the interaction between the T-cell receptor (TCR) and the HLA-peptide complex, and to determine the functional characteristics of the CTLs. In addition, we are finding it very valuable to have a supply of antigen-specific CTLs with which to test newly synthesized class I peptide-HLA tetrameric complexes, and also to use as a positive control in tetramer studies. Skills in CTL culture will be particularly important if the therapeutic use of CTLs (described in Chapter 10) becomes more widespread. The general principles of lymphocyte culture and sterility have been well described in Chapter 1 (see Section 4.2) and are particularly important for CTL culture. In particular, mycoplasma infection, which may only be a nuisance in the culture of transformed cell lines, increasing their fragility and retarding growth, appears to be uniformly deadly to CTL lines. If stimulator B-lymphoblastoid cell lines (B-LCLs) are being used to maintain the growth of a CTL culture, it is crucial to examine these regularly for mycoplasma contamination, ruthlessly discarding infected cells. Contamination can happen even to the most experienced operator working in the best-kept laboratory, and should not be underestimated. Another important area, which can easily account for a failure to generate successful CTL cultures, is the selection of tissue culture medium, particularly fetal calf serum (FCS). It should not be assumed that the reagents that keep less-fastidious cell lines quite happy in culture will necessarily work for growing CTLs. The practice in our laboratory is to screen several batches of FCS at one time for their ability to maintain the growth of a variety of cell lines and CTL cultures, then to test the better ones for use in establishing virus-specific CTL cultures and setting up CTL clones, which generate the most rigorous requirements. The differences between samples, even from the same supplier, is quite astonishing, and only a minority of batches of FCS will support CTL cloning. 162

7: Human cytotoxic T-lymphocyte (CTL) studies

2.2 What persuades memory CTLs to grow in vitro? Conventional limiting dilution analysis (LDA), as described in Chapter 8, typically generates figures for memory CTLs against pathogens, such as influenza A, in the order of 1 in 10-50000 PBMCs. Although estimates of circulating antigen-specific CTLs made by the ELISpot and tetramer assays are proving to be significantly higher (discussed in detail later in this chapter), it should be remembered that the LDA assay may be more representative of the proportion of CTLs which can actually be grown in vitro successfully. Most methods of antigen-specific CTL expansion employ a carefully chosen dose of antigen and an appropriate cytokine environment to coax these small numbers of memory CTLs to proliferate. In general, when the whole infectious agent is used, there is the need to balance the requirement for generating enough of a stimulus for CTL expansion against the adverse effects on the culture of too much replicating pathogen. When processed antigens or peptides are used, this is less of a problem. Whole virus cultures usually provide a good stimulus to CD4+ T cells, and hence are less demanding of added cytokines such as IL-2 in the early stages; in contrast, the cytokine requirements of peptidestimulated cultures are much more precise (8). Adding too much IL-2 too early can lead to non-specific stimulation rather than selective growth of antigen-specific CTLs. Subsequent maintenance of medium-term CTL lines specific for a particular antigen usually depends on restimulating the culture with a combination of antigen (ideally in the form of the optimized epitope peptide recognized by these CTLs) and antigen-presenting cells that have been irradiated to prevent them overgrowing the CTL culture. Lines can often be maintained in this way for several weeks or months, with preservation of specific cytotoxicity: however, our observations of TCR usage in long-term lines is that they become increasingly oligoclonal, which may distort the interpretation of their specific characteristics.

3. Generation of antiviral CTL The underlying principle used in establishing influenza- and HIV-specific CTLs is to stimulate the donor cells with a small amount of virus (added exogenously in the case of influenza, generated from autologous virus by PHA activation for HIV-infected donors), sufficient to stimulate the expansion of the virus-specific CTL population without overwhelming the culture with uncontrolled virus replication. This technique has also been used to establish CTLs specific for vaccinia virus using PBMCs from vaccinated subjects cultured directly with the virus (9). The generation of CTLs specific for Epstein-Barr virus (EBV) employs small numbers of autologous EBVtransformed cells as stimulators (10). In other cases, an exogenously infected 163

Sarah L. Rowland-Jones stimulator-cell population is used: these cells have been previously infected with virus and are used at a time when there is maximal expression of viral proteins, but before massive shutdown of host protein synthesis or cell death has occurred. Similar principles have been applied for the generation of CTLs specific for: respiratory syncytial virus (RSV), where RSV-infected B-LCLs are used as stimulator cells (11); human cytomegalovirus (H-CMV), where infected fibroblasts constitute the stimulator population (12); and measles virus (infected B-LCLs) (13). The disadvantage of using infected B-LCLs as stimulators is that because these cells express a range of EBV antigens, they also have the potential to elicit an EBV-specific response. An alternative to using whole virus is to stimulate CTLs with purified viral proteins. Although there is a theoretical advantage to using whole virus, in that it will more readily enter the class I processing pathway, purified surface antigen from the hepatitis B virus (HBV) has been successfully used to generate HBV-specific CTL cultures from liver biopsy specimens (14).

3.1 Influenza-specific CTLs One of the first and best-studied human CTL responses is that to influenza A (15). The major strains of influenza differ in their surface glycoprotein antigens, haemagglutinin (H) and neuraminidase (N). The virus isolates most commonly used are A/Puerto Rico/1934 (A/PR8), which is H1N1, and A/X31, which is a hybrid between the H3N2 strain involved in the Hong Kong influenza outbreak of 1968 (A2/HongKong/68) and PR8, and expresses the internal proteins of the latter. An early finding in human CTL studies was that CTL cultures did not discriminate between target cells infected with antigenically distinct viral strains (16): these observations ultimately led to our current understanding of the mechanisms of antigen-processing, whereby viral proteins are broken down in infected cells and recognized on the cell surface as short peptides in the context of HLA class I molecules (17). Protocol 1. Setting up an influenza-specific 'bulk culture' Equipment and reagents • Culture medium: RPMI-1640 supplemented with penicillin (100 U/ml), streptomycin (100 U/ml), L-glutamine (2 mM) (no serum initially) • Incubator at 37°C and 5% CO2

• Freshly separated PBMCs from a healthy donor (see Chapter 1, Protocol 6) • Fetal calf serum (FCS) • Influenza A virus • 75 cm2 tissue culture flask

Method

1. Resuspend PBMCs at 1-2 x 106/ml in 8 ml of the serum-free culture medium in a 75 cm2 tissue culture flask. 2. Add 4-5 haemagglutinating units (HAU) of influenza A virus and incubate at 37°C.

164

7; Human cytotoxic T-lymphocyte (CTL) studies 3. After 1 h, add 1 ml FCS: this will prevent the virus from overwhelming the cultures. 4. Incubate for 5-7 days before testing for specific cytotoxicity against autologous influenza-infected target cells (see Protocol 5). a,b,c a The cultures will survive for up to 10-14 days before dying out. b If the epitope peptide(s) recognized by the CTL culture is/are known, long-term influenzaspecific CTL lines can be generated by restimulating the bulk culture with autologous irradiated (3000 rads) B-lymphoblastoid lines (B-LCLs) which have been pulsed with the peptide at 20-50 uM (sterile solution, passed through a 0.2 urn filter) for an hour before use. IL2 is added at this stage: recombinant IL-2 is used at 10 Cetus units/ml. The cultures are usually maintained in 24-well plates, split as necessary when overcrowded (kept at around 106/well), and restimulated every 7-10 days with peptide-pulsed B-LCLs. c Infect autologous B-cells with 100 HAU for 1 hour in serum-free RPMI medium, wash once with 10 ml R/10 and leave in incubator at 37°C for 3 hours in R/10 before use, to allow time for expression of influenza proteins (the cells can be labelled with chromium during this period).

The method for establishing an influenza-specific CTL 'bulk culture' is described in Protocol 1. If this yields CTLs that are able to recognize influenza-infected target cells, the culture can then be used to map the targets of the response. This is conventionally carried out using reagents such as recombinant vaccinia viruses expressing a single influenza protein, together with overlapping peptides representing the sequence of that protein. More recently, efforts have been made to predict the optimal epitope presented by a given class I HLA molecule, based on information about the nature of peptides binding to that HLA molecule (18) (described in Section 4.1 below).

3.2 HIV-specific CTLs Protocol 2 describes the standard method used in our laboratory to generate an HIV-specific 'bulk culture', which can then be used to map the targets of recognition and to generate antigen-specific CTL lines (19). This method relies on the presence of virus-infected CD4+ cells in the initial PBMC population which, on activation with mitogen, will yield replicating virus to stimulate the CTL population. This method has the advantage of using autologous virus, which may have diversified considerably from the infecting strain in the individual infected patient. However, it is difficult to be precise about the amount of infectious virus generated using this protocol: in our experience, cultures generated from patients at late stages of infection will often die out— presumably being adversely affected by excessive viral replication. Mitogenactivated autologous virus has also been used to stimulate HTLV-1-specific CTL cultures (20). Other investigators have developed methods of stimulating CTLs by incubating PBMCs with a stimulator population expressing selected HIV antigens: this can take the form of autologous B-LCLs infected with recombinant vaccinia viruses which are inactivated with psoralen and ultraviolet irradiation before use (21). We have also found attenuated recombinant vaccinia such as Modified Vaccinia Ankara (MVA) expressing HIV antigens 165

Sarah L. Rowland-Jones to be a useful way of stimulating HIV-specific CTLs (22): there is no need to inactivate this form of vaccinia before use, as it has only very limited replication in human cells. Protocol 2. Generation of HlV-specific CTL 'bulk culture' Equipment and reagents • Freshly separated PBMCs from an HIVinfected donor (see Chapter 1, Protocol 8) • 37°C, 5% C02 incubator • 75 cm2 tissue culture flask • 2-ml well plate or a small tissue culture flask • Universal tube

. R/10 medium: RPMI-1640 supplemented with penicillin, streptomycin, L-glutamine, 10% fetal calf serum (FCS) • Phytohaemagglutinin (PHA) (Wellcome/ Murex) . IL-2 (Lymphocult-T, Biotest)

Method 1. Resuspend PBMCs at 1-2 x 106/ml in a 75 cm2 tissue culture flask in R/10 medium. Take approximately 1/8 of the cells and stimulate for 24-48 h (in a 2-ml well or small tissue culture flask) with PHA at 1/200 dilution. Wash once in a Universal tube with fresh R/10 and add back to the culture.a 2. Grow for one week in R/10, as above, then after 7 days supplement with Lymphocult-T to a final concentration of 10% for a further week. Split the cells and change the medium (R/10 with 10% Lymphocult-T) as necessary. 3. Test CTL activity using fresh PBMCs after 1 week and after 2 weeks in culture.b,c a

PHA should stimulate the replication of autologous HIV, which will be expressed in these blasts: thus the culture is restimulated with autologous virus. b 0nly a minority of donors have CTL activity in unstimulated PBMCs ('fresh CTL response'). C CTL lines can be grown from these 'bulk cultures' using irradiated (3000 rads) autologous Bcell lines pulsed with 20-50 uM of sterile epitope peptide to which the donor has made a response. Repeated weekly restimulations will give increasingly specific long-term CTL lines, from which clones can be grown.

3.3 Using peptides to stimulate CTLs Once the individual peptide epitope (recognized in the context of a particular class I molecule by virus-specific CTLs) is known, this provides a reagent which can be used to stimulate CTLs specific for that epitope directly from PBMCs. We have optimized the conditions for generating CTLs in this way (8), and found this to be a very sensitive method for eliciting a responder population in situations where the CTL frequency is expected to be low, as for example in HIV-exposed uninfected individuals (22, 23). The method works best when the optimal epitope peptide has been determined, but CTLs have also been generated in this way using pools of longer peptides: these can then 166

7: Human cytotoxic T-lymphocyte (CTL) studies be used to test for recognition of a particular peptide in the pool, and ultimately for defining the precise epitope (24, 25). However, the use of longer peptides may also stimulate the growth of specific CD4+ cells, which can obscure identification of the CTL response, so this is a less sensitive method. Protocol 3. Generating CTL by direct stimulation with epitope peptides This method is very sensitive, but requires prior determination of 1 optimal peptide epitope recognized by antigen-specific CTLs in assc ation with a particular class I HLA molecule. Equipment and reagents • Freshly separated PBMCs from an HIVinfected donor (see Chapter 1, Protocol 6) • 37°C, 5% C02 incubator • Sterile peptide solution

• R/10 medium (see Protocol 2) . rlL-7 • rlL-2 or Lymphocult-T (Biotest) • 24-well tissue culture plates

Method 1. Divide freshly separated PBMCs according to the number of peptides to be used, and pellet the cells at 600 g for 5 min at room temperature in separate tubes. Resuspend the pellet in 100 ul concentrated sterile peptide solution, to a final concentration of 20-50 uM. Incubate at 37°C, 5% CO2 for 1-2h. 2. Resuspend the cells to 1-2 x 106/ml in R/10 and plate out in 24-well plates, i.e. 2-4 x 106cells per well. Make sure you use a cell density of at least 1 x 106 cells/ml.a 3. Add IL-2 on day 3—either recombinant IL-2 at 10 Cetus units/ml or as Lymphocult-T (Biotest), added to a final concentration of 10%. 4. After 6-10 days in culture, split the cells if they look overcrowded, and maintain in medium containing IL-2 (replace as necessary).b,c a The addition of rlL-7 (25 ng/ml) to the initial culture significantly improves the generation of specific CTLs (6). b Although some CTL activity can often be detected as early as day 7-10, specific killing is maximal after 12-14 days. The cultures will usually maintain specific CTL activity for up to 3-4 weeks without restimulation. c To grow a long-term CTL line, the culture can be restimulated after 2-3 weeks using autologous irradiated (2000 rads.) B-LCLs pulsed with the appropriate peptide (at 10-50 uM), and then maintained with weekly restimulations. Alternatively, clones can be set up at this stage.

3.4 Generating virus-specific CTL clones The generation of antigen-specific CTL clones was a major goal of cellular immunologists in the past. Individual CTL clones were first used to study the biological properties of antiviral CTLs in vitro and in vivo (26). Later, they 167

Sarah L. Rowland-Jones provided a precise way of studying the interaction between the T-cell receptor of the CTL and its target of recognition, the HLA-peptide complex. Characterizing the T-cell receptor used by virus-specific clones gave insights into how restricted the T-cell receptor usage of particular antiviral CTL responses might be (27, 28) and provided tools for tracking and quantifying specific clones over time, for example in HIV infection (29, 30). More recently, antigen-specific clones have been selectively expanded for therapeutic use (31-34), as described in Chapter 10: under these circumstances, the use of clones reduces the chance of unwanted effects from non-specific cells. The method described below has been in use in our laboratory for several years, and has proved effective for the generation of CTL clones specific for influenza A, EBV, and HIV. The use of mitogen-activated mixed PBMCs was an important addition to previously used protocols (18, 35), and presumably provides additional cytokines that foster the expansion of individual CTL clones. The clones generated in this way are usually maintained using peptidepulsed B-LCLs in the same way as CTL lines, but a 'cloning mix' can be used as a supplement if the clones are not growing well or when thawing out frozen clones. Clones can now be expanded to large numbers if required for therapy: the protocols for doing this are outlined in Chapter 10. Protocol 4. Cloning protocol for the generation of virus-specific CTL clones Equipment and reagents • Mixed allogeneic, freshly separated, PBMCs from at least three different donors, and X-irradiated (3000 rads) • Autologous, X-irradiated (2000 rads) BLCLs, peptide-pulsed (e.g. at 10 uM) for 1 h then washed • Antigen-specific bulk culture or CTL line

37°C, 5% C02 incubator R/10 medium (see Protocol 2) Phytohaemagglutinin (PHA) (Wellcome/ Murex) IL-2 (Lymphocult-T, Biotest) 96-well microtitre plates, preferably flatbottomed

Method 1. Make up the cloning mixture—at 10 ml per 96-well microtitre plate in R/10.

• 106/ml of the X-irradiated, mixed allogeneic PBMCs • 105/ml of the X-irradiated, autologous B-LCLs • PHA at 1/200 dilution. 2. Add CTLs to the mix at 3/ml and 10/ml (i.e. to give 0.3 and 1 cell/well), and plate out in flat-bottomed wells at 100 uI/well. Keep wellhumidified in the incubator. 3. On day 4—add 100 ul of R/10 medium containing 20% Lymphocult-T to each well. 168

7: Human cytotoxic T-lymphocyte (CTL) studies 4. On day 11—screen for positive wells (very obvious on microscopy of flat-bottomed plate) and expand into 1 ml of the cloning mixture as above. 5. On day 14—add 1 ml of R/10 medium containing 20% Lymphocult-T to each well. 6. Test for CTL activity when expanded into two or more wells.a 7. Maintain specific clones by weekly restimulation with autologous, irradiated (2000 rads), peptide-pulsed (10-50 uM) B-LCLs, at a ratio of approx. 1:1 (clone:B-LCL).b a Approximate yield is about 50% of specific clones. b In practice, this usually means 0.5-1 x 106 stimulator cells per well in a 24-well plate. They are kept in medium containing 10% Lymphocult-T throughout. If they stop growing, they can be rejuvenated by adding 'cloning mix' at the time of restimulation. (Frozen aliquots of mixed irradiated PBMCs can be used at this stage—we usually store some for this purpose at the time of cloning either at -80"C or in liquid Nitrogen.)

4. Measuring CTL activity There are a number of different assays of CTL activity, which assess different aspects of their function. The best-known assays look at the killing efficiency of CTLs, by pitting them against appropriate targets and looking for indicators of target-cell death. This can be made more quantitative by carrying out CTL culture and subsequent assays in limiting dilution conditions (as described in Chapter 8). More recently, assays to look at the antigen-specific release of cytokines, such as the IFN-y ELISpot, have been developed, and are discussed later in this section. The use of peptide-HLA tetrameric complexes (described in Chapter 9) has provided a way of enumerating CTLs, based on the expression by CD8+ T cells of a T-cell receptor (TCR) capable of forming a stable interaction with that particular HLA-peptide complex. These assays do not necessarily measure exactly the same populations of cells, and the relationship between them will be discussed in the closing section of this chapter.

4.1 The CTL lysis assay The conventional method of measuring CTL activity is to examine the lysis of appropriate target cells, namely those expressing the correct HLA restriction element and presenting the specific antigen. The chromium release assay has been mainstay of this approach to measuring CTL activity for over two decades. The target cells are labelled with radioactive 51 chromium for 1 h before use, and then incubated with cultured CTLs in vitro. Specific CTL activity is calculated from the excess release of chromium in the presence of a specific antigen compared to that released from the target cells without CTL 169

Sarah L. Rowland-Jones or without antigen. Leakage of chromium from target cells incubated without CTLs is referred to as 'spontaneous release', and is a general indication of the health of the target cells. This can be increased if the target cells were infected with mycoplasma before use in the assay or elevated during the assay if the targets are infected with live virus, e.g. influenza or vaccinia: a very high spontaneous release (>25%) makes the assay results very difficult to interpret. These assays are usually carried out using several dilutions of CTLs (i.e. varying the effector:target (E:T) ratio) or of antigen (e.g. peptide titration) in order to demonstrate that this is a titratable response. The antigen used can be in the form of live whole virus, e.g. influenza A, or presented as a recombinant antigen in a virus vector such as vaccinia. The drawbacks of using live virus are that it can be difficult to quantitate the amount of specific antigen expressed in the target cells, when many other viral proteins are also being processed; also, it may be hard to judge the best timing for the assay, in order to allow antigen processing to take place before the virus interferes with protein synthesis or other aspects of antigen processing. The target cells may also be damaged by the infection process, and therefore more liable to leak chromium spontaneously. However, the use of whole or recombinant viruses provide important tools for mapping the dominant targets of virus-specific CTL responses, prior to more detailed epitope mapping being carried out. When the target of recognition has been mapped to a short stretch of protein, the appropriate synthetic peptide can be used in CTL assays. Target cells are able to present 15-20mer peptides to specific CTLs, although the exact method of processing these longer peptides to the optimal 8-11 amino acid epitope remains obscure. Thus panels of overlapping peptides representing the sequence of the target protein can be used to map the approximate region recognized by a CTL culture. The optimal epitope can then be precisely defined using truncated peptides: the selection of peptides may be guided by knowledge of the peptide-binding 'motif of the restricting class I molecule (23, 24) (as described in Chapter 10) or using more detailed computer algorithms (36). The identification of HLA restriction is usually carried out by looking for CTL recognition of antigen-pulsed targets that are matched with the CTL at a single class I locus. A panel of different B-LCLs or transfectants expressing single class I HLA molecules are useful for this purpose. Protocol 5.

CTL lysis assay

Equipment and reagents • Target-cell line (usually an EBV-transformed lymphoblastoid cell-line, autologous or class I HLA-matched • 37°C, 5% C02 tissue culture incubator • 51Chromium (Amersham) supplied in Na Cl solution at 350-600 uCi/mg (10-35 uCi/ml)

• CTLs (bulk culture, line, or clone) • Source of antigen: whole virus, recombinant vaccinia, protein, or peptide. Determine the optimal conditions for each antigen. • Decon solution (for decontaminating radioactive equipment)

170

7: Human cytotoxic T-lymphocyte (CTL) studies Pasteur pipettes RPMI or R/10 medium (see Protocol 2) 96-well, round-bottomed microtitre plates (Nunc) Cell harvester FCS

. Triton X-100 • Microwave oven • Beta-Plate filter mats, scintillation bags, and scintillation fluid (Pharmacia) • Flat-bed gamma/beta counter (LKB)

Method 1. Pellet healthy target cells at 600 g for 5 min at room temperature (removing the last drop of supernatant with a Pasteur pipette to improve labelling efficiency) and label with 50-80 ul 51Cr. Incubate at 37°C in 5% CO2 for 30-60 min (shorter times for very new/hot chromium). Make sure the hot plastics (tips, etc.) are disposed of according to local radiation safety protocols (e.g. decontaminate with Decon solution). 2. Wash target cells three times with supplemented RPMI (see Protocol 1) or R/10 before use in the assay. Dispose of the first wash especially carefully, since most of the chromium comes off in this first wash (if down the sink, use plenty of running water). If the cells are to be pulsed with peptide, divide them from the pellet after the second wash, then wash after 1 h of incubation with peptide. 3. After the final wash, make up the target cells to 105/ml, and plate out at 5 x 103 (50 ul) or 10* cells/well (100 ul), in duplicate or triplicate, in 96well, round-bottomed microtitre plates. Add peptide, if required, directly to the assay at this stage, e.g. by adding 16 ul of a 10 x solution in different dilutions to duplicate wells, with a no-peptide control. 4. Harvest the CTLs and make up to the volume required in order to be able to add 100 ul to each experimental well in duplicate or triplicate, and to be able to make serial dilutions if required. For bulk CTL cultures, aim to use the highest possible effector-to-target ratio (E:T), around 50-100:1. For established CTL lines and clones, use a lower E:T ratio (down to 1:1 or less). 5. Plate out the control wells for background 51Cr release (target cells plus 100 ul R/10) (see Protocol 1) and total 51Cr release (target cells plus 100 ul detergent, e.g. 5% Triton X-100 in water) for each target in quadruplicate. Add the detergent last of all, and avoid splashing it into any of the other wells. 6. Incubate the plates for 4-6 h at 37°C in 5% CO2. 7. Carefully remove 20 (J of the supernatant of each well (without disturbing the cells) on to Beta-Plate filter mats (Pharmacia). Dry the mats in the microwave (4 min, full power) or oven (5-10 min) and seal in a plastic bag with scintillation fluid (Pharmacia). (Caution: this is carcinogenic—use gloves and wipe up any spills.) Take care not to get scintillation fluid on the outside of the bag, as this can damage the counter. Count the plate in a flat-bed gamma/beta counter (LKB).

171

Sarah L. Rowland-Jones Protocol 5. Continued 8. Calculate lysis from the formula:

a Spontaneous chromium release is a general reflection of the health of the target cells (e.g. mycoplasma infection considerably increases the spontaneous release of chromium): it should be less than 20% in order to be able to interpret the experimental results.

Other methods of measuring CTL antigen-specific lysis have been employed, though none are as widely used as the chromium release assay. These include measuring the release of non-radioactive target-cell labels such as europium (which can then be measured using a time-resolved fluorometer) (37) or of proteases involved in cell-killing such as granzyme A, which acts as a BLT serine esterase (38). Direct visualization of target-cell lysis by microscopy proved to be a useful way of screening for CTL responses to a large panel of antigenic peptides (39): in these assays, no targets were added as the CTLs killed each other in the presence of their cognate antigen.

4.2 Measuring the antigen-specific release of cytokines by CTLs Most CTLs release a variety of cytokines and chemokines on antigen-specific contact (26, 40-44). The most commonly produced are IFN-y (26, 40, 45, 46) and tumour necrosis factor-alpha (TNF-a) (42, 47, 48), but other soluble factors include TNF-B (41), granulocyte-macrophage colony-stimulating factor (GMCSF), IL-2, IL-3, and IL-4 (42), and the CC chemokines macrophageinflammatory protein-1-alpha (MIP-la), MIP-10, and RANTES (43, 44, 49). It is therefore possible to use the antigen-specific release of IFN-y or TNF-a as an indication of CTL recognition. This has also been adapted for use as a screening assay for peptide recognition—PBMCs are incubated with each of a panel of potential epitope peptides and IFN-y production measured by intracytoplasmic staining and flow cytometry (46). The enzyme-linked immunospot (ELISpot) method has been adapted to provide a simple and rapid assay for the identification and enumeration of CTLs, on the basis of their antigen-specific secretion of TNF-a (50) and IFN7 (51-53). The ELISpot assay detects cytokines produced by an individual cell, which are then captured by binding to a specific antibody immobilized on the base of a microtitre well. When the assay is developed using a biotinylated 172

7: Human cytotoxic T-lymphocyte (CTL) studies second-layer antibody, followed by the addition of streptavidin conjugated to alkaline phosphatase, the use of a chromogenic alkaline phosphatase substrate stains the area of cytokine release as a blue 'footprint' for each secreting cell. The spots in wells with and without antigen, and at different input cell numbers, are then counted by eye or using a dissecting microscope, and the results presented as the number of specific spot-forming cells (SFCs) per 106 PBMCs. Assay kits for IFN-y ELISpots are commercially available, but the assay can be adapted to measure other soluble factors for which there are suitable paired antibodies, for example to measure MlP-la secretion (T. Dong, personal communication). The assays originally used a target-cell population to present the antigen, but when using sufficient numbers of PBMCs, the cells will present antigen to one another. This avoids the problems caused by detecting responses specific for the target cell, such as EBV-specific T-cells when B-LCLs are used. This works well as an overnight assay using freshly separated PBMCs, so it is ideal for field studies where facilities for tissue culture and use of radioisotopes may be limited (22). More prolonged incubations (up to 40 h) do not increase the number of SFCs detected (53). It is thought that the use of optimized class I HLA-restricted peptides will selectively stimulate CD8+ cells (54): however, when using longer peptides the responder population can be enriched for CD8+ cells using magnetic beads. The ELISpot assay has most commonly been used to screen for peptide-specific responses and to quantify these from PBMCs (54-56), but it can also be adapted to look at responses to virusinfected stimulator populations, such as HIV-infected PHA blasts (57) or BLCLs infected with recombinant vaccinia viruses. However, not all antigen-specific cells will secrete IFN-y on peptide stimulation: in one of the early descriptions of this method, it was noted that 80-95% of cloned, murine, malaria-specific CTLs were detected by IFN-y ELISpot. Using murine LCMV-specific clones, Butz and Bevan showed that the proportion of IFN-secreting cells varied between 24% and 100%, depending on how recently the cells had been restimulated with antigen (58). Protocol 6. Measuring antigen-specific cytokine release—IFN-y ELISpot assays Kits for this assay are commercially available (Mabtech). However, the assay also can be adapted in-house to measure the antigen-specific release of any cytokine or chemokine for which paired antibodies are available. Equipment and reagents Supplied in Mabtech leit* • First-layer (capture) antibody* • Conjugate antibody* • Detector antibody*

• Sterile peptide solution • 96-well, nitrocellulose plate (Millipore) • RPMI-1640 medium (see Protocol 1)

173

Sarah L. Rowland-Jones Protocol 6.

Continued

• Sterile-filtered PBS • Blocking solution: a serum-containing medium such as R/10 (see Protocol 2} • Virus-specific CTLs or fresh PBMCs (Chapter 1, Protocol 6)a • Incubator at 37°C, 5% C02 . 0.05% Tween-20 in PBS

• Chromogen solution (BioRad): 0.4 ml development buffer (Caution: wear gloves), 9.6 ml sterile deionized water, 0.1 ml colour reagent A, 0.1 ml colour reagent B; added in order to a Universal container. Make up immediately before use.

Method 1. Plan the experiment to work out the number of wells needed (i.e. number of peptides, number of cell dilutions, duplicate or triplicate, etc.), then calculate the amount of first-layer antibody required. 2. Dilute the first-layer (catcher) antibody in PBS, from 1 mg/ml to 15 ug/ml, and apply 50 ul per well in a 96-well nitrocellulose plate to coat the base of the wells, using a tissue culture hood. Leave the plate for 2 h at 37°C, or 3 h at room temperature, or overnight at 4°C. Discard the catcher antibody and wash six times with RPMI (see Protocol 1) or sterile PBS, using 200 ul/well. Apply the blocking solution at 200 ul/well and leave for 45 min-1 h at room temp. 3. Calculate the cell input numbers needed and make up the appropriate dilutions of cells in serum-containing medium (e.g. 5 x 104 down in 2-5-fold dilutions for influenza-specific CTLs from fresh PBMCs).a 4. Throw off the blocking solution, and plate out the cells in 100 ul per well. Add the sterile peptide solution at the required concentration (usually to 20 uM final concentration).b Incubate at 37°C and 5% C02, for 6 h or overnight (16 h). Ensure (this is important) that the plate is not disturbed at this stage of the assay. 5. Discard the cells and medium from the wells, then wash six times with PBS/0.05% Tween-20, 200 ul per well (this can be done with a wash-bottle). 6. Apply the detector antibody, which has been diluted 1:1000 in sterile-filtered PBS, at 50 ul per well. Incubate for 2-4 h at room temperature. 7. Discard excess detector antibody, and wash six times with PBS/0.05% Tween-20, using 200 ul/well. 8. Apply the conjugate antibody, which has been diluted 1:1000 in sterile-filtered PBS, at 50 ul per well. Incubate for 1-2 h at room temperature. 9. Discard excess conjugate antibody, wash six times with PBS/0.05% Tween-20, using 200 uI/well. Leave the last wash solution on until ready to apply the chromogen.

174

7: Human cytotoxic T-lymphocyte (CTL) studies 10. Drain the plate of the last wash, then apply the chromogen (made up immediately before use in a Universal container) at 100 uI/well. Leave at room temperature until a blue colour appears (approx. 1 h). Terminate the reaction by washing the plate under running tap water, then allow it to air-dry (in the hood). Count spots by eye or under a dissection microscope. "The assay is most commonly carried out using freshly separated or frozen PBMCs, but it can also be done with CTL lines or clones, in which case the input cell number should be very much lower. Cells can also be separated into CD8+ subsets using magnetic beads for use in this assay. b Peptide-pulsed target cells can also be used, but are only necessary where the input effector cell number is too low to ensure the presence of antigen-presenting cells.

4.3 How do different methods of quantifying CTLs compare? The principal methods of quantifying CTLs are the ELISpot assay, described in this chapter, the limiting dilution assay, described in the following chapter, and the use of peptide-HLA tetrameric complexes, outlined in Chapter 9. These assays each measure different properties of CTLs. Limiting dilution analysis (LDA) was the 'gold standard' assay for many years: this measures those CTLs that are capable of expanding and growing over 2-3 weeks in culture, which are then assayed for antigen-specific cytotoxicity. It has been suggested that this will significantly underestimate the frequency of circulating effector CTLs, particularly in conditions like HIV infection where the growth potential of CD8+ cells may be seriously impaired (29, 59, 60). The ELISpot assay measures the proportion of cells from the input population which produce IFN-y on contact with their cognate antigen over the 6-16hour assay period. This may depend on how recently cells have encountered antigen, as mentioned earlier. In general, the frequencies obtained with the ELISpot assay are several-fold higher than those derived by LDA (53). The use of peptide-HLA tetramers quantifies those CTLs from an input population which express a TCR able to bind specifically to that peptide-HLA complex: by itself, this does not provide any information about the functional phenotype of the tetramer-staining population. However, the majority of sorted tetramer-positive cells will produce IFN-y in an ELISpot assay (61, 62), and many of them will also expand as clones (61). These different methods have been directly compared in a study of EBVspecific CTLs in 13 people chronically infected with EBV (63). In terms of the hierarchy of epitopes recognized within an individual, each method gave similar results: however, the absolute frequency differed substantially according to the method used. In general, the lowest CTL numbers were obtained using LDA and the highest using tetramers. ELISpot estimates were on average 5.3-fold higher than LDA frequencies, and 4.4-fold lower than tetramer staining. There was good correlation between ELISpot assays and 175

Sarah L. Rowland-Jones both other methods, although the correlation between tetramer staining and LDA frequencies was relatively poor. This suggests that the virus-specific CTL population is functionally heterogeneous, and this needs to be considered when choosing assay methods and interpreting the results.

5. Conclusions The study of human cytotoxic T-lymphocyte responses has advanced considerably in the past few years, and several new methodologies are now available. The choice between them will depend both on practical circumstances and the aspect of CTL function under scrutiny. The CTL lysis assay remains a robust method of examining cytotoxic function, but requires the use of radioisotopes and usually necessitates the expansion of CTLs in culture over several weeks. The limiting dilution assay described in the next chapter has been the 'gold standard' for enumerating antigen-specific CTLs for many years, but is a very time-consuming and exacting procedure, and appears to underestimate significantly the true frequency of circulating antigen-specific CTL effectors. The ELISpot assay is simple and quick, so it is a very useful procedure for screening potential CTL responses and new CTL epitopes: it also uses very few cells, so is valuable when samples are limited. However, once the assay is complete, the cells are lost and cannot be manipulated any further: moreover, only one secreted factor can be examined in each assay, so this provides only limited information about CTL phenotype. The tetramer assay has the advantage of providing phenotypic as well as quantitative information, since co-staining with other antibodies provides the opportunity to look at surface markers of activation, T-cell receptor usage, and cytokine and chemokine production (using intracytoplasmic staining). Moreover, the cells can be sorted directly from the FACS machine and expanded as CTL populations or individual clones (61): we have also found that streptavidincovered magnetic beads can be coated with peptide-HLA monomers and used to select CTLs for cloning (G. S. Ogg and T. Dong, personal communications). However, the use of tetramers currently depends on precise information about the epitope peptide recognized, and the repertoire of available tetramers is relatively limited. As experience of these different assays grows, we will gain valuable tools with which to learn more about the exact role of cytotoxic T-cells generated in response to different infections and malignancies.

References 1. Kagi, D., Ledermann, B., Burki, K., Zinkernagel, R. M., and Hengartner, H. (1995). Immunol. Rev., 146, 95. 2. Goldberg, A. L. and Rock, K. L. (1992). Nature, 357, 375. 176

7: Human cytotoxic T-lymphocyte (CTL) studies 3. Elliott, T. (1997). Adv. Immunol., 65, 47. 4. Rotzschke, O. and Falk, K. (1991). Immunol. Today, 12, 447. 5. Bangham, C. R. M. and McMichael, A. J. (1989). In T cells (ed. M. Feldmann, J. Lamb and M. J. Owen), p. 281. Wiley, New York. 6. Boon, T., Cerottini, J. C., Van den Eynde, B., van der Bruggen, P., and Van Pel, A. (1994). Annu. Rev. Immunol., 12, 337. 7. Coulie, P. G. (1997). Mol. Med. Today, 3, 261. 8. Lalvani, A., Dong, T., Ogg, G., et al. (1997). J. Immunol. Methods, 210, 65. 9. Erickson, A. L. and Walker, C. M. (1993). J. Gen. Virol., 74, 751. 10. Murray, R. J., Kurilla, M. G., Brooks, J. M., et al. (1992). J. Exp. Med., 176, 157. 11. Bangham, C. R. and McMichael, A. J. (1986). Proc. Natl Acad. Sci. USA, 83, 9183. 12. Borysiewicz, L., Morris, S., Page, J., and Sissons, J. G. P. (1983). Eur. J. Immunol., 13, 804. 13. Van Binnendijk, R., Versteeg, Van Oosten, J., et al. (1993). J. Virol., 67, 2276. 14. Barnaba, V., Levrero, M., Franco, A., et al. (1986). Liver, 6, 45. 15. McMichael, A. J., Ting, A., Zweerink, H. J., and Askonas, B. A. (1977). Nature, 270, 524. 16. McMichael, A. J. and Askonas, B. A. (1978). Eur. J. Immunol., 8, 705. 17. Townsend, A. and Bodmer, H. (1989). Annu. Rev. Immunol., 7, 601. 18. Dong, T., Boyd, D., Rosenberg, W., et al. (1996). Eur. J. Immunol., 26, 335. 19. Nixon, D. F., Townsend, A. R. M., Elvin, J. G., Rizza, C. R., Gallwey, J., and McMichael, A. J. (1988). Nature, 336, 484. 20. Parker, C. E., Daenke, S., Nightingale, S., and Bangham, C. R. (1992). Virology, 188, 628. 21. Lubaki, M. N., Egan, M. A., Siliciano, R. F., Weinhold, K. J., and Bollinger, R. C. (1994). AIDS Res. Hum. Retroviruses, 10, 1427. 22. Rowland-Jones, S. L., Dong, T., Fowke, K. R., et al. (1998). J. Clin. Invest., 102, 1758. 23. Rowland-Jones, S. L., Sutton, J., Ariyoshi, K., et al. (1995). Nature Med., 1, 59. 24. Hill, A. V. S., Elvin, J. E., Willis, A. C., et al. (1992). Nature, 360, 434. 25. Missale, G., Redeker, A., Person, J., et al. (1993). J. Exp. Med., 177, 751. 26. Lin, Y. and Askonas, B. A. (1981). J. Exp. Med., 154, 225. 27. Moss, P. A. H., Moots, R. J., Rosenberg, W. M. C., Rowland-Jones, S. J., McMichael, A. J., and Bell, J. I. (1991). Proc. Natl Acad. Sci. USA, 88, 8987. 28. Bowness, P., Moss, P. A. H., Rowland-Jones, S. L., Bell, J. L, and McMichael, A. J. (1993). Eur. J. Immunol., 23, 1417. 29. Moss, P. A. H., Rowland-Jones, S. L., Frodsham, P. M., et al. (1995). Proc. Natl Acad. Sci. USA, 92, 5773. 30. Kalams, S. A., Johnson, R. P., Dynan, M. J., et al. (1996). J. Exp. Med., 183, 1669. 31. Riddell, S. R., Watanabe, K. S., Goodrich, J. M., Li, C. R., Agha, M. E., and Greenberg, P. D. (1992). Science, 257, 238. 32. Koenig, S., Conley, A. J., Brewah, Y. A., et al. (1995). Nature Med., 1, 330. 33. Riddell, S. R., Elliott, M., Lewinsohn, D. A., et al. (1996). Nature Med., 2, 216. 34. Tan, R., Xu, X.-N., Ogg, G. S., et al. (1999). Blood, 93, 1506. 35. Spits, H., Ijssel, H., Cox, T., and De Vries, J. E. (1982). J. Immunol., 128, 95. 36. Roberts, C. G., Meister, G. E., Jesdale, B. M., Lieberman, J., Berzofsky, J. A., and De Groot, A. S. (19%). AIDS Res. Hum. Retroviruses, 12, 593. 37. Granberg, C., Blomberg, K., Hemmila, I., and Lovgren T. (1988). J. Immunol. Methods, 114, 191.

177

Sarah L. Rowland-Jones 38. Suhrbier, A., Fernan, A., Burrows, S. R., Saul, A., and Moss, D. J. (1991). J. Immunol. Methods, 145, 43. 39. Burrows, S. R., Suhrbier, A., Khanna, R., and Moss, D. J. (1992). Immunology, 76, 174. 40. Morris, A. G., Lin, Y.-L., and Askonas, B. A. (1982). Nature, 295, 150. 41. Jassoy, C., Harrer, T., Rosenthal, T., et al. (1993). J. Virol., 67, 2844. 42. Price, P., Johnson, R. P., Scadden, D. T., et al. (1995). Clin. Immunol. Immunopathol., 74, 100. 43. Price, D. A., Sewell, A. K., Dong, T., et al. (1998). Curr. Biol., 8, 355. 44. Wagner, L., Yang, O. O., Garcia-Zepeda, E. A., et al. (1998). Nature, 391, 908. 45. Hamann, D., Baars, P. A., Rep, M. H., et al. (1997). J. Exp. Med., 186, 1407. 46. Lampe, M. F., Wilson, C. B., Bevan, M. J., and Starnbach, M. N. (1998). Infect. Immun., 66, 5457. 47. Ando, K., Hiroishi, K., Kaneko, T., et al (1997). J. Immunol, 158, 5283. 48. Chakraborty, N. G. and Mukherji, B. (1998). Cancer Res., 58, 1363. 49. Biddison, W. E., Taub, D. D., Cruikshank, W. W., Center, D. M., Connor, E. W., and Honma, K. (1997). J. Immunol, 158, 3046. 50. Herr, W., Schneider, J., Lohse, A. W., Meyer zum Buschenfelde, K. H., and Wolfel, T. (1996). J. Immunol Methods, 191, 131. 51. Di Fabio, S., Mbawuike, I. N., Kiyono, H., Fujihashi, K., Couch, R. B., and McGhee, J. R. (1994). Int. Immunol, 6, 11. 52. Miyahira, Y., Murata, K., Rodriguez, D., et al. (1995). J. Immunol. Methods, 181, 45. 53. Lalvani, A., Brookes, R., Hambleton, S., Britton, W. J., Hill, A. V., and McMichael, A. J. (1997). J. Exp. Med., 186, 859. 54. Lalvani, A., Brookes, R., Wilkinson, R. J., et al (1998). Proc. Natl Acad. Sci. USA, 95, 270. 55. Jameson, J., Cruz, J., and Ennis, F. A. (1998). J. Virol., 72, 8682. 56. Hanke, T., Blanchard, T. J., Schneider, J., et al. (1998). J. Gen. Virol., 79, 83. 57. Zhang, C., Cui, Y., Houston, S., and Chang, L. J. (1996). Proc. Natl Acad. Sci. USA, 93, 14720. 58. Butz, E. A. and Bevan, M. J. (1998). Immunity, 8, 167. 59. Gotch, F. M., Nixon, D. F., Alp, N., McMichael, A. J., and Borysiewicz, L. K. (1990). Int. Immunol., 2, 707. 60. Wilson, J. D. K., Ogg, G. S., Allen, R. L., et al. (1998). J Exp. Med., 188, 785. 61. Dunbar, P. R., Ogg, G. S., Chen, J., Rust, N., van der Bruggen, P., and Cerundolo, V. (1998). Curr. Biol., 8, 413. 62. Murali-Krishna, K., Altaian, J. D., Suresh, M., et al. (1998). Immunity, 8, 177. 63. Tan, L. C., Gudgeon, N., Annels, N. K, et al (1999). J. Immunol., 162, 1827.

178

8 Limiting dilution analysis for the quantitation of antigen-specific T cells ANDREW CARMICHAEL

1. Theoretical considerations 1.1 Quantitation at the clonal level using limiting dilution analysis (LDA) To quantify the number of lymphocytes that have a defined functional property (e.g. antigen-specific cytotoxicity) within a mixed population of cells, one needs an assay that is capable of detecting the presence of a single responding cell. Because the cytotoxic activity of an individual T cell is too small to be measured accurately with existing methods, it is necessary to amplify the response by stimulating the single responding cell to undergo clonal proliferation in vitro to generate a sufficiently large population of daughter cells for their combined cytotoxic activity to be detected. Such an assay therefore measures the number of functional precursor cells that are capable of undergoing clonal proliferation and differentiation into effector cells; if for any reason the function of the cells is impaired so that they are incapable of clonal expansion in vitro, the presence of such cells will be underestimated. The principle of limiting dilution analysis is to generate and quantify multiple, independently derived, short-term T-cell clones that have the functional property of interest (see Figure 1). This is done by setting up multiple replicate microcultures in which the initial number of responder cells is progressively reduced over an appropriate range of low dilutions (typically from 104 to 103 cells per microculture), so as to include the dilution at which there is on average one precursor cell of interest per microculture. The optimum culture conditions, including antigen-expressing stimulator cells, for the growth of the precursor cells must be determined empirically in preliminary experiments, so that every available precursor cell is stimulated to grow into a detectable clonal population. It is crucial that all other cells and growth

Andrew Carmichael

Figure 1. An overview of limiting dilution analysis. To generate multiple, antigen-specific T-cell clones, replicate microcultures are set up containing limiting numbers of precursor T cells, with antigen-presenting stimulator cells and growth factors. During a period of in vitro culture single, antigen-specific precursor cells (black circles) proliferate into expanded clones. The function of effector T cells is assayed, for example in a cytotoxicity assay against autologous and MHC-mismatched target cells expressing either test antigen or negative control antigen.

factors needed for a response are adjusted to be present in optimum quantities in every microculture, so that the only factor limiting the generation of a detectable clone is the presence or absence of a single precursor cell. Following the period of clonal expansion in vitro, the cells in each microculture are assayed for effector-cell function (e.g. cytotoxicity, proliferation, cytokine secretion).

1.2 The Poisson distribution When a well-mixed dilute suspension of cells is distributed into multiple replicate microcultures, the distribution of precursor cells is random, not 180

8: Limiting dilution analysis for quantitation of antigen-specific T cells Table 1. The Poisson distribution Probability that a given microculture will receive exactly Average number n= 0 n=1 n= 2 n=3 n =4 of precursor cells No cells 1 cell 2 cells 3 cells 4 cells per microculturea (P0)b (P1) (P2) (P3) (P4)

H=3 u =2 u =1 u = 0.5 u = 0.25

0.05 0.14 0.37 0.61 0.78

0.15 0.27 0.37 0.30 0.20

0.22 0.27 0.18 0.08 0.02

0.22 0.18 0.06 0.01 <0.01

0.17 0.09 0.02 <0.01 <0.01

aWhen the cell suspension is made progressively more dilute (i.e. as u decreases), progressively fewer of the microcultures receive one or more cells, and more of the microcultures receive no cells. b From the zero term of the Poisson distribution (where n = 0): P0 = e-u; in logarithmic form: u = -In P0 Thus the negative logarithm of the proportion of non-responding cultures is linearly related to the average initial number of precursor cells per microculture (see also Figure 2).

uniform. By random distribution some microcultures receive no precursor cells, some receive a single precursor, and the remainder receive two or more precursors. The proportion of microcultures that receive a given number of cells can be predicted on the basis of a theoretical discrete probability distribution called the Poisson distribution (1). If the average initial number of precursor cells per microculture is u, then the probability (Pn) that a given microculture will receive exactly n cells is given as:

The Poisson distribution for different values of U. is shown in Table 1. Note that at the dilution where the average initial number of precursor cells per microculture u = 1, the proportion of the microcultures that will receive no precursor cells (P0) is e-1 namely 0.37 or 37%; the remaining 63% of microcultures receive one or more precursors (see Table 1). From the experimental assay of effector-cell function, one can categorize each LDA microculture as being either positive for effector T cells (these microcultures originally contained one or more precursors) or negative (these originally contained no precursors). For each dilution of responder cells, the proportion of negative microcultures can be calculated and plotted against the initial responder-cell number per microculture on a semi-logarithmic plot (see Figure 2). Provided only a single cell of a given precursor-cell type is required to achieve a positive microculture, the plot is a straight line through the origin, referred to as 'single-hit' kinetics (1). From the regression line through the experimental data, one can determine the dilution at which 37% of the micro181

Andrew Carmichael

Figure 2. Random distribution of precursor cells conforms to the Poisson distribution (see Table 1). Replicate microcultures are set up in which the number of responder cells per well is progressively reduced over a range of dilutions from right to left. The precursor cells are distributed non-uniformly. In this example, at 4000 responder cells per well (top row, middle panel), there is on average one precursor cell per well; 37% of the replicate wells receive no precursor, 37% receive exactly one precursor, and the remaining wells receive two or more precursors. Following the functional assay, at each dilution the proportion of negative wells is calculated and plotted against the initial responder-cell number on a semi-logarithmic plot. From the regression line of the experimental data, the precursor frequency is estimated as the initial responder-cell number at which 37% of the wells are negative (shown by the horizontal dotted line), in this case 1 in 4000 responder cells.

cultures are negative, i.e. the initial responder-cell number per microculture at which there is on average one precursor per microculture. This is an estimate of the frequency of precursor cells within the original responder-cell population. The precursor frequency is expressed, for example, as 1 antigenspecific precursor in 4000 responder cells. 182

8: Limiting dilution analysis for quantitation of antigen-specific T cells

1.3 Advantages of LDA in addition to quantitation (a) By physically segregating the responder cells into very small aliquots, LDA generates multiple, independently derived clones representative of those in the original cell population. It can also minimize unwanted interactions with other cell types (e.g. inhibitory cells) that may interfere with T-cell generation during bulk culture. (b) Using split-well analysis, the cell progeny in each individual microculture can be mixed and divided into multiple replicate aliquots on separate tissue culture plates in order to assay simultaneously for different functional properties (e.g. cytotoxicity against different target-cell types to confirm that cytotoxicity is major histocompatibility complex (MHC)restricted). Thus one can analyse a large population of T-cell clones to determine the relative contributions of cells that recognize different antigens expressed on allogeneic cells (2) or on virus-infected cells (3). (c) After dividing the cells in each microculture into replicate aliquots in split-well analysis, small numbers of cells (102-103) remain in the small residual volume in the original microculture on the master plate. Using the results of the functional assay, one can identify individual microcultures on the master plate that contain clones of interest, and the cells in these selected microcultures can be further expanded and maintained as T-cell lines or re-cloned by formal single-cell cloning (e.g. for the analysis of T-cell receptor usage).

1.4 Limitations of LDA (a) It is difficult to use LDA to quantify accurately very rare precursor cells (less than 1 in 5 X 105 cells), because this requires large numbers of responder cells (5 X104-105)per microculture that may prevent a single precursor cell from interacting efficiently with an antigen-presenting cell. In subjects who have not previously been exposed to a given antigen in vivo, the frequency of naive antigen-specific T cells is usually less than 1 in 105 cells; following in vivo exposure to antigen, as a result of antigendriven clonal expansion the frequency of antigen-specific T cells increases substantially, up to 1 in 2 X 102 (4). Thus LDA can used to estimate the frequency of memory cells but not naive cells. In general, the larger the memory-cell population quantified in LDA, the stronger the corresponding memory immune response in vivo (5). (b) LDA involves large, complex, technically demanding functional assays, typically using between 20 and 40 96-well plates per experiment.

2. Methodology An overview of the experimental design is shown in Figure 1. The culture conditions described below have been developed for the study of human 183

Andrew Carmichael peripheral blood T cells, using antigen-specific cytotoxicity as the functional assay.

2.1 Responder cells Because LDA is a clonogenic assay, it is important that the viability of the responder cells is optimal. We prefer to use freshly obtained responder cells; if cryopreserved cells are used, the conditions of cryopreservation should be carefully optimized to ensure reproducibility between experiments. CD16+ natural killer (NK) cells are depleted from peripheral blood mononuclear cells (PBMCs) prior to LDA culture. NK cells mediate nonMHC restricted cytotoxicity that can interfere with the detection of T cellmediated cytotoxicity. Initial NK-cell depletion is particularly important if the stimulator-cell system is likely to induce NK-cell activation (i.e. if stimulation involves mitogenic lectins, virus-infected cells, or high concentrations of cytokines such as interleukin-2). Protocol 1. Preparation of responder cells Equipment and reagents • Venous blood sample • Sterile 10 ml and 50 ml plastic centrifuge tubes • Sterile phosphate-buffered saline (PBS) pH 7.3 • 100 units/ml preservative-free calcium heparin (Monoparin; CP Pharmaceuticals) in PBS

Ficoll-Hypaque (Lymphoprep; Nycomed) Trypan Blue (see Chapter 1, Protocol 2} Neubauer haemocytometer Anti-CD16 IgM (Leu-11b; Becton Dickinson) Rabbit complement Sterile distilled water

Method 1. Collect a venous blood sample into a sterile 50 ml plastic centrifuge tube containing 3 ml of preservative-free heparin. Dilute the blood sample with an equal volume of PBS. 2. Pipette 12 ml of Ficoll-Hypaque into a second sterile 50 ml tube. Gently pipette the blood on to the Ficoll without disturbing the interface. Centrifuge at 800 g for 15 min at room temperature. 3. Aspirate the PBMC layer from the interface into a sterile 10 ml plastic tube. Centrifuge at 400 g for 10 min at room temperature. 4. Discard the supernatant and resuspend the cell pellet by gentle shaking. Add 10 ml PBS and centrifuge at 400 g for 10 min at room temperature. Repeat this step twice, making three washes in total. Resuspend the cells in 10 ml PBS and count the cells using the Trypan Blue exclusion test with a Neubauer haemocytometer (see Chapter 1, Protocol 2). 5. Place 107 cells in a sterile 10 ml tube and centrifuge at 400 g for 10 min at room temperature. Discard the supernatant and resuspend the cell

184

8: Limiting dilution analysis for quantitation of antigen-specific T cells pellet by gentle shaking. Add 20 ml anti-CD16 IgM and incubate at 37°C for 30 min. 6. Add 10 ml of PBS and centrifuge at 400 g for 10 min at room temperature. Discard the supernatant and resuspend the cell pellet by gentle shaking. 7. Reconstitute freeze-dried rabbit complement by adding 1 ml of sterile distilled water at room temperature.a Add 1 ml complement solution to the cells and incubate at 37°C for 30 min. 8. Add 10 ml of PBS and centrifuge at 400 g for 10 min at room temperature. Discard the supernatant and resuspend the cell pellet by gentle shaking. Resuspend the cells in 10 ml PBS and count the cells using the Trypan Blue exclusion test. aOnce reconstituted, complement has a half-life of 15 min at room temperature.

Protocol 2. Preparation of dilutions of responder cells Equipment and reagents • Sterile PBS pH 7.3 • LDA culture medium: sterile RPMI-1640 supplemented with 2.0 mM L-glutamine, 1.0 x 105 IU of penicillin/I, 100 mg of streptomycin/I (ICN Flow Laboratories), 10% (v/v) Myoclone Plus fetal calf serum (Gibco BRL), 10% (v/v) human AB serum

• Sterile 96-well, 8.5 cm x 12.5 cm Ubottomed, tissue culture plates (Corning) • 37°C, 5% CO2 incubator

Method 1. Reduce evaporation from the LDA microcultures in the centre of the plate by pipetting 250 ul of the sterile PBS into the perimeter wells of two sterile 96-well tissue culture plates. Draw a horizontal line on the lid of each plate to mark the upper and lower halves of each plate. 2. Pipette 50 ul of the LDA culture medium into the six microcultures in the second column at the left side of each plate. 3. Prepare well-mixed suspensions of responder cells in LDA culture medium: • 30 x 104 responder cells in 1.5 ml 10 x 103 cells per well 4 • 15 X 10 responder cells in 1.5 ml 5 X 103 cells per well • 7.5 x 104 responder cells in 1.5 ml 2.5 x 103 cells per well • 3.75 x 10* responder cells in 1.5 ml 1.25 x 103 cells per well. 4. Mix each cell suspension thoroughly and pipette 50 ul into the remaining 27 replicate microcultures on either the upper or lower half of a plate (see Figure 3). Incubate the plates at 37°C in 5% CO2 pending the addition of stimulator cells.

185

Andrew Carmichael

Figure 3. Layout of LDA master plates and cytotoxicity assay plates. (A) Dilutions of responder cells are set up in 27 replicates on the master plates. Stimulator cells are added to all culture wells, including six replicates per plate that have no responder cells. (B) On the day of assay the effector cells in each microculture on the master plates are mixed and divided into replicate aliquots on separate assay plates. Radiolabelled target cells are then added. Maximum 61Cr release is determined by the addition of detergent to six replicates per plate of target cells.

186

8: Limiting dilution analysis for quantitation of antigen-specific T cells

2.2 Stimulator cells These are cells that express the antigen(s) to stimulate the responder T cells of interest. The choice of stimulator cells requires careful consideration, because cells (e.g. fibroblasts) that are not professional antigen-presenting cells (APCs) may process and present antigen differently from professional APCs, and hence may stimulate different populations of T cells. We use fresh stimulator cells because the viability and function of APCs may be impaired by recent cryopreservation. All stimulator cells are irradiated prior to LDA culture to prevent them from proliferating. Protocol 3. Preparation of stimulator cells Equipment and reagents • Sterile LDA culture medium (see Protocol 2) • Gamma irradiation source • Recombinant human interleukin-2 (IL-2) • 37°C, 5% CO2 incubator • RPMI-1640 supplemented with 2.0 mM • 8.5 cm x 12.5 cm sterile 96-well UL-glutamine, 1.0 x 105 iu of penicillin/and bottomed tissue culture plates (Corning) 100 mg of streptomycin/L

Method 1. Choose an appropriate stimulator-cell type: (a) To stimulate alloreactive T cells: • Prepare 2.4 x 106 allogeneic PBMCs from an unrelated subject (see Protocol 1, steps 1-4). This provides 2 x 104 stimulator cells per microculture. (b) To stimulate Epstein-Barr (EBV)-specific T cells: • Prepare 6.0 x 105 autologous EBV-transformed lymphoblastoid cells. This provides 5 x 103 stimulator cells per microculture (6). (c) To stimulate peptide-specific T cells: • Prepare 2.4 x 106 autologous PBMCs (see Protocol 1, steps 1-4) and incubate the cells with synthetic peptide at 40 (ug/ml in RPMI-1640 for 30 min at 37°C. This provides 2 x 104 stimulator cells per microculture (7). (d) To stimulate IL-2-expandable T cells: • Prepare 2.4 x 106 autologous PBMCs. This provides 2 x 104 stimulator cells per microculture (7). 2. Irradiate the stimulator cells (2400 rads) in a gamma irradiator at room temperature. 3. Resuspend the stimulator cells in 6.5 ml of the LDA culture medium plus 10 lU/ml interleukin-2. Add 50 mI of the stimulator-cell suspension to all 60 microcultures in both LDA master plates (see Figure 3). 4. Incubate the LDA plates at 37°C in 5% C02 for 14 days.

187

Andrew Carmichael Protocol 3. Continued 5. On day 6 and day 10, feed each microculture with 50 ul LDA of the culture medium supplemented with 5 ID/ml interleukin-2

During the 14 days of culture, the LDA plates can be incubated within a plastic sandwich box in the incubator to reduce evaporation and to prevent microbial infection. PBS lost by evaporation from the perimeter wells of the LDA plate should be replaced. After 14 days in LDA culture, the assay of effector T-cell function is performed. In a chromium-release cytotoxicity assay, antigen-expressing target cells are labelled with 51Cr and extracellular 51Cr is subsequently washed away; when cytotoxic T cells recognize and kill the radiolabelled target cells, the 51Cr is released into the supernatant and can be quantified in a gamma counter as an indirect measure of target-cell killing. The assay involves simultaneously preparing appropriate target cells (see Protocol 4) and pipetting effector T cells from each microculture on the LDA master plate, in replicate aliquots on to three to five separate assay plates (see Protocol 5). Protocol 4. Preparation of radiolabelled target cells Equipment and reagents • Autologous and MHC-mismatched* lymphoblastoid cell lines (LCL) • Recombinant vaccinia viruses (107 plaque forming units/ml) expressing antigen(s) of interest or control antigen • 5 mCi/ml radioactive chromium, Na251Cr04 (Amersham) • Radioactive-waste container • 10-40 ug/ml synthetic peptide in RPMI-1640

« R/10 medium: sterile RPMI-1640 medium supplemented with 2.0 mM L-glutamine, 1.0 x 105 ID of penicillin/I and 100 mg of streptomycin/I, and 10% (v/v) fetal calf serum . 37°C, 5% CO2 incubator • 10 ml plastic centrifuge tubes « PBS pH 7.3

Method 1. Prepare appropriate antigen-expressing target cells: (a) Vaccinia-infected target cells: • For each recombinant vaccinia virus, add 107 p.f.u. of virus to 2 x 106 LCL in a 10 ml plastic tube and incubate at 37°C in 5% CO 2 for 14h. • Add 10 ml PBS and centrifuge at 400 g for 5 min at room temperature, remove all the supernatant with a pipette tip. Resuspend the cells in 20 ul of Na251CrO4 and incubate at 37°C in 5% CO2 for 1 h. (b) Peptide-pulsed target cells: • Centrifuge 1 x 106 LCL in a 10 ml plastic tube at 400 g for 5 min at room temperature, remove all the supernatant with a pipette

188

8: Limiting dilution analysis for quantitation of antigen-specific T cells tip. Resuspend the cells in 10 ul of Na251CrO4 and incubate at 37°C in 5% CO2 for 1 h. • Add 30 ul of synthetic peptide and incubate at 37°C in 5% CO2 for 1 h.b 2. Add 10 ml warm (37°C) R/10 to the target cells and centrifuge at 400 g for 5 min at room temperature. Discard the supernatant into a radioactive-waste container and resuspend the cell pellet by gentle shaking. Repeat the washing twice, making a total of three washes. 3. Add 1 ml warm R/10 to the target cells, mix thoroughly, and count the cells. Dilute the target cells in warm R/10 to achieve a final cell concentration of 3.3 x 104/ml. a

MHC-mismatched target cells should be included in split-well analysis to verify that antigenspecific cytotoxicity is MHC-restricted and therefore mediated by T cells and not natural killer NK cells (see Figure 3). b Once the target cells have been labelled with 51Cr, it is important to avoid cooling the cells or altering their pH because this may cause excessive spontaneous release of 51Cr.

Protocol 5. Preparation of effector T-cell assay plates (split-well analysis) Equipment and reagents • Sterile 96-well, U-bottomed, tissue culture plates (see Protocol 2) • R/10 (see Protocol 4) • 2% Nonidet NP-40 (v/v) in distilled water • PBS pH 7.3

• Sterile pipette tips . 37°C, 5% C02 incubator • Gamma counter, and associated equipment and reagents

Method 1. Pipette 250 ul PBS into the perimeter wells of each assay plate.a 2. Add 50 ul R/10 to each LDA microculture on the master plates. Each microculture should now contain 250 ul medium. 3. Using sterile pipette tips, thoroughly mix the cells in each LDA microculture. 4. Pipette replicate 45 ul aliquots from each LDA microculture into the corresponding wells of 3-5 replicate assay plates.b Incubate the assay plates at 37°C in 5% CO2 pending the addition of the target cells. 5. Add 50 ul R/10 to each LDA microculture on each master plate to prevent them from drying out, and incubate the master plates at 37°C in 5% C02 pending analysis of the results. 6. Mix each target-cell suspension thoroughly to minimize variation from plate to plate, and quickly pipette 120 ul of the target-cell suspension into each well of the assay plate.

189

Andrew Carmichael Protocol 5. Continued 7. To determine the maximum 51Cr release for each target-cell type, add 45 ul 2% Nonidet NP-40 detergent to six replicates of the target-cell suspension at the right end of each assay plate (see Figure 3). Determine the spontaneous 51Cr release for each target cell from the six replicates at the left end of each plate that originally received no responder cells. 8. Incubate the assay plates at 37°C in 5% CO2 for 4 h. 9. Taking care not to disturb the cell pellet at the bottom of the microculture, aspirate 70 ul of the supernatant from each microculture and measure the radioactivity in a gamma counter.b aThe number of assay plates (usually 3-5 per master plate) depends upon the number of different target-cell types being tested simultaneously. b The precision of pipetting can be improved by the use of automation (8).

3. Calculation and interpretation of results 3.1 Calculation of cytotoxic activity in individual microcultures The large amount of data generated by the cytotoxicity assay is analysed by computer. For each target-cell type, the mean spontaneous 51Cr release and mean maximum 51Cr release are calculated. If there is significant variation from plate-to-plate, mean values of spontaneous and maximum release for individual plates should be used. For each target-cell type, the % specific lysis is calculated for each microculture using the formula: %Specific lysis = test release - mean spontaneous release mean maximum release - mean spontaneous release

100%.

The observed cytotoxicity in a given microculture may include contributions from MHC-restricted T cells, and from non-MHC-restricted NK cells that also mediate cytotoxicity against MHC-mismatched target cells. To identify the MHC-restricted T cell-mediated cytotoxicity, any contribution of non-MHC-restricted cytotoxicity is subtracted; for each microculture, the % specific lysis for the MHC-mismatched control target cell is subtracted from the % specific lysis for each autologous target cell, including the autologous target cell expressing the negative control antigen (see Table 2).

3.2 Classification of positive and negative wells To estimate the precursor frequency, one needs to determine the proportion of negative wells at each dilution of responder cells. Therefore for each micro190

8: Limiting dilution analysis for quantitation of antigen-specific T cells Table 2. Calculation of MHC-restricted % specific lysis (%sl) Target cell typea

Observed %sl

MHC-restricted %sl

Autologous target + test antigen A Autologous target + test antigen B Autologous target + test antigen C Autologous target + control antigen MHC-mismatch target + test antigen

4

24 6 5 5

-1 19 1 0

"Using split-well analysis, cells from an individual microculture are divided into five aliquots and assayed simultaneously against up to five different target-cell types. The observed % specific lysis includes contributions from MHC-restricted and non-MHC-restricted killing. The MHC-restricted killing against each autologous target-cell type is calculated by subtracting the non-MHC-restricted killing (i.e. the % specific lysis against the MHC-mismatched target cell) from the observed %sl against each autologous target-cell type.

culture one needs to categorize the quantitative measurement of % specific lysis as a qualitative variable (either positive or negative) by using an appropriate threshold; if the MHC-restricted % specific lysis against a particular target-cell type exceeds the threshold, it is regarded as positive for cytotoxicity, and if it is below the threshold the well is regarded as negative. To identify the correct magnitude of the threshold, one examines a histogram of the cytotoxicity results. When precursor cells are placed in replicate microcultures at limiting dilution and stimulated to differentiate into clones of cytotoxic effector cells, one would expect a histogram of the % specific lysis against the test antigen from a large number of individual microcultures to be bimodal—with a lower peak comprising microcultures which lacked an antigen-specific precursor (with very little cytotoxicity against target cells expressing the test antigen), and a second higher peak comprising wells having one or more antigen-specific precursors (see Figure 4). Therefore the threshold should be chosen at the nadir of the bimodal experimentally derived histogram, so that it does genuinely distinguish between a positive (presence of a precursor) and a negative microculture (absence of a precursor). The magnitude of the threshold will be affected by the precise experimental conditions used, including the duration of in vitro culture prior to the functional assay, the number of aliquots used for split-well analysis, and the number and type of the target cells used. Using five aliquots and 4 X 103 LCL target cells per well, we find that the nadir of the experimental histogram is consistently 10% specific lysis, which we use as the threshold to classify wells as positive or negative for MHC-restricted cytotoxicity.

3.3 Estimation of precursor frequency The proportion of negative wells at each dilution of responder cells is determined and plotted on a semi-logarithmic plot. To draw the regression line through the data points of an LDA plot we use the maximum likelihood 191

Andrew Carmichael

Figure 4. Identification of positive and negative wells using a threshold for MHCrestricted cytotoxicity. Responder PBMCs from a healthy volunteer were stimulated with a defined peptide from human cytomegalovirus in LDA. The upper panels show the cytotoxicity results for 27 replicate wells at each dilution assayed against peptide-pulsed target cells (open circles) and control target cells (filled circles). The number of wells that show a given level of cytotoxicity are shown as a cumulative histogram of all four dilutions—the cumulative histogram of cytotoxicity against the negative control target is unimodal, whereas the histogram of cytotoxicity against the test antigen target is bimodal. Wells that show 10% specific lysis or more are classified as positive. The frequency of MHC-restricted, peptide-specific CTL precursors was 1 in 9200 responder cells (95% confidence intervals, 1 in 7000 to 1 in 12200; Chi-square statistic, 1.0; 3 degrees of freedom). The precursor frequency against the negative control target cell was too low to quantify.

method (9) using the GLIM 3.77 statistical program (Royal Statistical Society, London, UK). From the regression line, the program calculates the estimate of precursor frequency and 95% confidence intervals (the initial respondercell number at which 37% of the wells are negative). The program also calculates the Chi-square statistic, which indicates how well the regression line of the experimental data conforms to a straight line through the origin; the smaller the Chi-square statistic, the closer the data are to a straight line. If the Chi-square statistic exceeds the critical value (see Table 3), the experimental data do not conform to a straight line and should not be used to estimate the precursor frequency. If the data are non-linear, one can nevertheless derive information from the appearance of the LDA plot (see Figure 5). 192

8: Limiting dilution analysis for quantitation of antigen-specific T cells

Figure 5. The shape of the LDA plot can provide additional information. (A) The linear relationship through the origin (single-hit kinetics) is consistent with a single precursor cell of a given cell type being necessary to generate a response. (B) The curved relationship with impaired response at low initial responder-cell number indicates that the presence of a single precursor cell of a given cell type is not sufficient to generate a response. Possible explanations include: (i) suboptimal growth of single precursors at low initial responder-cell number (e.g. because of insufficient stimulator cells); or (ii) two or more cells of a given cell type being necessary to generate a response (multi-hit kinetics); or (iii) a single cell of more than one type being necessary to generate a response (multitarget kinetics) (see ref. 1). (C) The curved relationship with impaired response at high initial responder-cell number also indicates that the presence of a single precursor cell is not sufficient to generate a response. Possible explanations include: (i) overgrowth of responding cultures leading to cell death due to nutrient deprivation; or (ii) the presence of inhibitory cells whose presence prevents a precursor from giving rise to a detectable clone.

193

Andrew Carmichael Table 3. Critical values of Chi-square statistica Number of dilutions

3 4 5 6

Degrees of freedom

Chi-square statistic

6.0 7.8 9.5

2 3 4 5

11.1

a lf the Chi-square statistic for the experimental regression line exceeds the critical value shown, the experimental data do not conform to a straight line and should not be used to estimate the precursor frequency.

3.4 Interpretation LDA is particularly valuable for making quantitative comparisons within the same culture system. For example, it allows comparisons to be made between different purified subpopulations of responder cells separated prior to stimulation with a given antigen in LDA, or comparison of the relative magnitude of responses directed against different antigens within a complex antigen such as a virus. Absolute estimates of precursor frequency derived from LDA should be interpreted with care. LDA estimates of precursor frequency represent minimum estimates; because the cloning efficiency of LDA is less than 100% efficient, some precursors may fail to grow into detectable clones in vitro. Therefore the true precursor frequency may actually be higher. Results of direct ex vivo cytotoxicity assays (10) and direct quantitation of antigenspecific T cells by flow cytometry using fluorochrome-labelled MHC-peptide tetramers (11) indicate that the number of antigen-specific T cells may be up to 10-fold greater than estimates based upon functional analysis in LDA. This difference may also reflect the fact that many of the highly activated effector T cells responding to antigen in vivo may have reduced clonogenic potential in LDA, possibly because these activated cells are increasingly susceptible to apoptosis.

References 1. Lefkovits, I. and Waldmann, H. (1979). Limiting dilution analysis of cells in the immune system. Cambridge, Cambridge University Press. 2. Taswell, C., MacDonald, H. R., and Cerottini, J-C. (1980). J. Exp. Med., 151, 1372. 3. Borysiewicz, L. K., Hickling, J. K., Graham, S., Sinclair, J., et al. (1988). J. Exp. Med., 168, 919. 4. Lau, L., Jamieson, B. D., Somasundaram, T., and Ahmed, R. (1994). Nature, 369, 648. . 5. Oehen, S., Waldner, H., Kundig, T. M., Hengartner, H., and Zinkernagel, R. M. (1992). J. Exp. Med., 176, 1273. 194

8: Limiting dilution analysis for quantitation of antigen-specific T cells 6. Carmichael, A., Jin, X., Sissons, J. G. P., and Borysiewicz, L. (1993). J. Exp. Med., 177, 249. 7. Carmichael, A., Jin, X., and Sissons, J. G. P. (1996). J. Virol., 70, 8468. 8. Alp, N., Sissons, J. G. P., and Borysiewicz, L. K. (1990). /. Immunol. Methods, 129, 269. 9. Fazekas de St.Groth, S. (1982). /. Immunol. Methods, 49, R11. 10. Gotch, F. M., Nixon, D. F., Alp, N., McMichael, A. J., and Borysiewicz, L. K. (1990). Int. Immunol., 2, 707. 11. Murali-Krishna, K., Altman, J. D., Suresh, M., Sourdive, D. J., et al. (1998). Immunity, 8, 177.

195

This page intentionally left blank

9 HLA-peptide tetrameric complexes GRAHAM S. OGG

1. Introduction HLA-peptide tetrameric complexes allow the direct visualization of antigenspecific T cells by flow cytometry (1-3). Therefore, unlike other techniques used to study antigen-specific T cells, the method is independent of a functional activity such as cytokine production or lysis of target cells. Furthermore, the complexes are sufficiently sensitive (down to 0.02% of CD8+ T cells) to be used directly ex vivo, in contrast to assays of cytolytic function, which usually require a period of expansion in vitro before lysis becomes detectable. HLA-peptide tetrameric complexes are synthesized by the addition of biotin to the inferior aspect of refolded HLA molecules. Streptavidin has four biotin-binding sites and so will induce the formation of tetrameric structures of biotinylated HLA molecules. HLA heavy chain and B2-microglobulin (B2m) are generated in Escherichia coli as inclusion bodies. Only the extracellular portion of the heavy chain is included, and this is modified by the addition of a C-terminal signal sequence containing a site for biotinylation by the bacterial biotin ligase enzyme BirA. The inclusion bodies are solubilized in urea and then added to a refolding reaction along with an epitope peptide. The process of diluting the denaturant urea in the refolding buffer allows a proportion of the HLA heavy chain to refold with B2m and peptide into a conformationally correct form. The complex is then biotinylated at room temperature by the enzyme BirA in the presence of biotin, ATP, and Mg2+. Purification by gel filtration and ion exchange is followed by the addition of fluorescent Streptavidin in a 1:4 molar ratio with the refolded complex to generate the tetramers. A tetrameric structure overcomes the low affinity of T-cell receptors (TCRs) for peptide/HLA, which for single complex interactions has an off-rate half-life of 12-30 sec at 25°C (reviewed in ref. 4). In fact, a trimeric structure may be sufficient—trimers and tetramers of a cytochrome c/I-Ek complex were shown to induce intracellular pH changes in specific T cells, whereas monomers and dimers were inactive (4). Therefore the theoretical problem of using large fluorescent markers such as phycoerythrin (PE; approximately 240 kDa), which may occupy one of the biotinbinding sites on Streptavidin and limit the complexes to three HLA molecules,

Graham S. Ogg is overcome by the benefits of the bright staining obtained with PE. The following sections describe the synthesis of HLA-peptide tetrameric complexes using our current protocols.

2. Cloning of modified HLA heavy chain Figure 1 shows a schematic diagram of the modifications to the heavy chain, e.g. B*3501, required to generate the signal-tagged protein. T7 polymerasedependent, IPTG-inducible expression systems such as the pET (Novagen) vectors work well. An extended 3' primer containing the biotinylation sequence

Figure 1. Schematic diagram showing (a) the cloned domains of the HLA heavy chain required 10 generate class I tetrameric complexes, and (b) the full protein sequence of HLA-B*3501 including leader, transmembrane, and cytosolic regions,

198

9: HLA-peptide tetrameric complexes can be used to add the biotinylation signal to the C terminus of the heavy chain (e.g. GGAGTGGGACTCTACCCTCGGTCCT AGGGACGTAGT ATAAGACCTACG TGTCTTTTACCA CACCTTAGTAGC AATTCGAATAGTGT was used for B*3501). If the heavy chain is being expressed from cDNA then the 5' primer can be modified to change the GC usage of the first few codons of the gene to improve expression efficiency. Variations in the biotinylation sequence are possible and others have been published, including LGGIFEAMKMELRD (5, 6). The first two residues (GS) of the sequence shown in Figure 1 act as a flexible linker between the heavy chain and biotinylation consensus site. This aids the refolding of conformationally correct complexes.

3. Protein expression 3.1 Principle Modified HLA heavy chain and B2-microglobulin are expressed in E. coli, e.g. strain BL21pLysS (Novagen), after induction with isopropylthio-B-Dgalactosidase (IPTG). Protocol 1. Induction of protein expression in E. coli by IPTG Equipment and reagents Agar plates containing 100 ug/ml ampicillin Expression vector (e.g. pET, Novagen) BL21pLysS competent bacteria stock (Novagen) Shaker New Brunswick Scientific 1 litre flasks

• Autoclaved low-salt LB medium: 10 g tryptone, 5 g yeast, 5 g NaCI per litre . 1 M IPTG • 1 litre centrifuge pots • Phosphate-buffered saline (PBS) pH 7.3

Method 1. Transform BL21pLysS with the expression vector by adding 1-2 ul of the plasmid to 20 ul of competent bacteria stock. Incubate on ice for 20 min and then heat-shock at 42°C for 40 sec. Incubate for a further 2 min on ice and streak on to an agar plate containing 100 ug/ml ampicillin. Incubate for 24 hours at 37°C. 2. Inoculate a single colony into a 1 litre flask of low-salt LB medium containing 100 ug/ml ampicillin. 3. Leave for 18 h shaking (r.p.m. 240) at 37°C and then inoculate 30 ml into each of as many 1 litre flasks as required. Check the optical density at 600 nm by comparing against LB without bacteria. When the optical density reaches 0.6-0.9 take a 1 ml pre-induction sample and add 0.5 ml of 1 M IPTG to each 1 litre flask. Leave on the shaker (240 r.p.m.) at 37°C for 4-5 h. Take a 1 ml post-induction sample. 4. Spin down the contents of the flasks in 1 litre centrifuge pots at 2000 g for 30 min. Carefully balance the pots and pre-cool the centrifuge and rotor to 4°C.

199

Graham S. Ogg Protocol 1. Continued 5. Resuspend in a total of 50-75 ml of cold phosphate-buffered saline (PBS).a a The sample can be frozen at -70°C at any stage of the subsequent purification.

3.2 Comments The use of glucose in the LB medium may improve yield. Some expression systems require chloramphenicol (34 (ug/ml) or other selection media in addition to the ampicillin in the agar plates and LB. The overgrowth of nonantibiotic resistant bacteria can be reduced by keeping the optical density of the cultures low so that the pH and antibiotic activity remain relatively stable. Alternatively, this can be achieved through the use of controlled culture systems.

4. Inclusion body purification 4.1 Principle The proteins are synthesized as inclusion bodies, which can be rapidly purified by either chemical/enzymatic or physical lysis methods. Protocol 2. Inclusion body purification by physical lysis Equipment and reagents • Triton wash: 0.5% Triton X-100, 50 mM Tris pH 8, 100 mM NaCI, 0.1% azide, 1 mM EDTA, 1 mM DTT • Resuspension buffer: 50 mM Tris pH 8, 100 mM NaCI, 1 mM EDTA, 1 mM DTT . Urea buffer: 8 M urea, 0.1 M NaH2P04, 0.01 M Tris pH 8, 0.1 mM EDTA, 0.1 mM DTT • Duolite indicator resin (BDH)

• • • • •

Protein concentration assay (Pearce) Sonicator Thick plastic 50 ml centrifuge tubes Hand-held homogenizer Standard reducing gel and appropriate equipment and reagents

Method 1. If necessary thaw the bacterial concentrates. Sonicate in bursts of 30-60 sec; cool on ice (for 2 min) between bursts to diminish degradation associated with heating secondary to the sonication. Continue sonication until the fluid pours like water (usually takes 5-10 bursts).a 2. Centrifuge at 30000 g (4°C) in thick 50 ml centrifuge tubes for 10 min and collect the inclusion body protein layer.b 3. Perform three washes with the Triton wash and one wash with resuspension buffer as follows. Resuspend the inclusion body pellet (make sure it is well resuspended) with an homogenizer and spin at 15000 r.p.m. for 10 min at 4°C.c

200

9: HLA-peptide tetrameric complexes 4. Homogenize the inclusion body pellet in 15-30 ml of urea buffer to which Duolite has been added.d 5. Run a small aliquot (5-10 ml) on a standard reducing gel to check purity, and check an additional aliquot for protein concentration using an assay such as that commercially available as a kit from Pearce. "The subsequent steps are much easier if sonication is complete. b The appearance is likely to be layered, with the lowest layer being inclusion body protein. The consistency of inclusion body is like that of cheese and usually will not resuspend by simple agitation. The upper layers are impurities and unsonicated bacteria. These will resuspend on agitation, so they can be relatively easily distinguished from the underlying protein. If there is a lot of unsonicated bacteria, e.g. 2-3 times the amount of inclusion body, then it will be worth re-sonicating the upper layers. Otherwise just discard the upper layers. cThe inclusion body becomes progressively more pale in appearance as the impurities diminish. d Incubate the 8 M urea at 42°C for 10-20 min to aid dissolution (it is difficult to dissolve in water). Add the indicator Duolite to the urea buffer, in sufficient amount so that some of the Duolite is blue. To aid dissolving the inclusion body it may be necessary to leave the protein rotating in the urea buffer at 4°C for 12-24 h, before spinning out the undissolved material (15000 r.p.m. for 10 min at 4°C).

5. Refolding by dilution 5.1 Principle The denaturant effect of the urea is removed by dilution in a refolding buffer. This allows HLA heavy chain, B2m, and epitope peptide to associate in a conformationally correct form which can be subsequently isolated. Protocol 3. Refolding by dilution Equipment and reagents • Refolding buffer: for HLA*A201 and B*3501 use 100 mM Tris pH 8, 400 mM L-arginine HCI, 5 mM reduced glutathione, 0.5 mM oxidized glutathione, 2 mM EDTA

• • • •

B2-microglobulin (B2m) Dimethyl sulfoxide (DMSO) Epitope peptide Urea buffer (see Protocol 2}

Method 1. Pre-cool 1000 ml of the refolding buffer to 4°C before adding the glutathiones. Then add approximately 30 mg of B2m, which is unlikely to precipitate. 2. Add 8-10 mg peptide—dissolve in DMSO (e.g. 100-200 ul) first to ensure that it will go into solution.a 3. Add 30 mg of heavy chain, which may precipitate depending on the allele.b Stir at 4°C for 24-48 h to allow refolding to take place. a The DMSO at this concentration does not seem to influence refolding. * A*0201 should go into solution easily but others, e.g. B*3501, need to be diluted to <1 mg/ml in urea buffer before adding to the refolding mix.

201

Graham S. Ogg

5.2 Comments Each heavy chain allele may need slight variation in the composition of the refolding buffer. A range of conditions can be tested on a small scale by changing the type, concentration, or pH of the buffer and the concentration of L-arginine. The effects of such variations can be tested either by running the products through gel filtration (see Protocol 5) or by ELISA (see Protocol 6), which permits the rapid screening of large numbers of different conditions. Yield may be improved by the slow addition of the heavy chain over several hours to keep it saturated with peptide and B2m in order to reduce aggregate formation.

6. Enzymatic biotinylation 6.1 Principle The refolded product is first concentrated and then exchanged into a biotinylation buffer. This is followed by biotinylation with the enzyme BirA at the unique site engineered to the C terminus of the HLA heavy chain. Protocol 4. Enzymatic biotinylation of the refolded product Equipment and reagents • 200 ml and 2 litre stir cells (each with a 10kDa membrane cut-off) (Amicon) • 2 disposable PD10 columns (Pharmacia) • 1 mg/ml leupeptin (Sigma) • 1 mg/ml pepstatin (Sigma)

. BirA buffer: 100 mM Tris pH 7.5, 200 mM NaCI, 5 mM MgCI2 • 100 mM D-biotin (Sigma) . 100 mM ATP (Sigma) • 1 mg/ml BirA (Avidity)

Method 1. Centrifuge the refolded product at 2000 g for 30 min at 4°C. Discard the pellet. 2. Use a 2 litre Amicon stir cell to concentrate the supernatant to 100 ml. Then transfer to a 200 ml Amicon stir cell and concentrate to 5 ml. 3. Use two disposable PD10 columns (Pharmacia) to perform a buffer exchange into filtered BirA buffer. Equilibrate the columns with 25 ml of BirA buffer. Add 2.5 ml of the concentrated refolded product to each column. Then add 3.5 ml of BirA buffer to each column and collect the eluent. Remove any precipitate by centrifuging at 15000 r.p.m. for 5 min at 4°C. 4. Add leupeptin and pepstatin to a final concentration of 1 ug/ml. Do not add EDTA as this inhibits BirA. Add 0.5 ml of 100 mM ATP and 40 ul of 100 mM D-biotin. Add 10-15 ul of 50 uM BirA. Leave overnight at room temperature. 5. Remove any precipitate by centrifuging at 15000 r.p.m. for 5 min at 4°C.

202

9: HLA-peptide tetrameric complexes

6.2 Comments The composition of the BirA buffer is variable. A high salt concentration such as 200 mM NaCl may partially inhibit the enzyme and it may be worth trying to reduce this to 100 mM or less.

7. Purification of refolded protein 7.1 Principle Using a two-step procedure the biotinylated protein is purified first by size and then by charge. Protocol 5. Purification of refolded protein Equipment and reagents • Gel filtration column (e.g. Superdex 75, Pharmacia) « Gel filtration buffer: 20 mM Tris pH 8, 150 mM NaCl (filtered) • Ion exchange buffer A: 20 mM Tris pH 8 (filtered) « Ion exchange buffer B: 20 mM Tris pH 8, 1 M NaCl (filtered) • 1 mg/ml leupeptin (Sigma)

1 mg/ml pepstatin (Sigma) EDTA Low protein-binding filter Pharmacia standard markers Amicon 200 ml stir cell cut-off 10 kD Equipment and reagents for ELISA 5 ml sterile glass storage vials 0.45 um filter membrane

Method 1. Equilibrate the gel filtration column with gel filtration buffer (using the wash volume required for the column). 2. Filter the sample using a low protein-binding filter and load on to the column.a 3. Collect the fraction eluting at 42-45 kDa, based on the running times of standard markers. (See Figure 2a for an example of a typical gel filtration trace.) 4. Prior to anion exchange, reduce the salt concentration below 10-15 mM by repeated stir cell concentration and dilution with ion exchange buffer A. 5. Load the sample on to the column using ion exchange buffer A. 6. Start the gradient to run over 20 ml up to 100% of ion exchange buffer B.b

7. Collect all peaks and test in ELISA (see Protocol 6) for the presence of biotinylated refolded complex. (See Figure 2b for an example of a typical ion exchange trace.) 8. Add leupeptin and pepstatin to a final concentration of 1 ug/ml, and EDTA to a final concentration of 1 mM.

203

Graham S. Ogg Protocol 5. Continued 9. Store in autoclaved glass vials at 4°C. a

Depending on the column requirements it may be necessary to further concentrate the sample to a volume that can be loaded effectively. b The fraction will elute shortly after the conductance starts to increase.

8. ELISA 8.1 Principle It is necessary to perform an ELISA using a conformation-dependent antiHLA class I antibody to quantitate the concentration of biotinylated refolded HLA class I molecules. The use of a simple protein-concentration assay kit

Figure 2. Schematic diagram of typical traces from (a) gel filtration and (b) ion exchange purifications. The exact elution volumes will vary from column to column.

204

9: HLA-peptide tetrameric complexes alone will often lead to the overestimation of the amount of true complex, and hence result in inefficient tetramer formation. The following ELISA permits the double development of a single plate to calculate the relative concentration of biotinylated refolded complex. Protocol 6. ELISA to measure relative biotinylation Equipment and reagents ELISA equipment and reagents PBS pH 7.3 5 ug/ml W6/32 (conformation-dependent anti-HLA class I antibody) in PBS 1% bovine serum albumin (BSA) in PBS Rabbit anti-human B2m (Dako) Avidin-horseradish peroxidase (Sigma)

• Alkaline phosphatase-conjugated goat antirabbit Ig (Jackson Immuno Research). • Colorimetric reagent for alkaline phosphatase p-Nitrophenyl phosphate (Sigma) • Colorimetric reagent for horseradish peroxidase 3,3',5,5'-tetramethyl benzidine (Sigma)

Method 1. Coat an ELISA plate with W6/32 at 5 ug/ml in PBS at 37°C for 2-3 h. Block with 1% BSA in PBS overnight at 4°C. Allow a lane of five wells for each sample and include two control lanes of five wells each: one lane with W6/32 and one without. 2. The following morning wash six times with PBS and set up serial dilutions in PBS down each lane of five wells, e.g. serial 1 in 5 dilutions. If available, use a known positive control for the two control lanes containing either W6/32 or no W6/32. Leave at room temperature for 1 h. 3. Wash six times with PBS. Add 100 ul of 1 in 10000 rabbit anti-human B2m in PBS to each well. Leave at room temperature for 20 min. 4. Wash six times with PBS. Add 100 ul of 1 in 10000 alkaline phosphatase-conjugated goat anti-rabbit Ig in PBS to each well. Leave at room temperature for 20 min. 5. Wash six times with PBS. Develop with a Colorimetric reagent for alkaline phosphatase. Read the optical density with an ELISA reader at the wavelength necessary for the reagent used, to give a measurement of the amount of refolded protein compared to a known positive control. 6. Wash six times with PBS. Add 100 ul of 1 in 2000 avidin-HRP in PBS to each well. Leave for 20 min at room temperature. 7. Wash six times with PBS. Develop with a Colorimetric reagent for horseradish peroxidase. Read the optical density with an ELISA reader at the wavelength necessary for the reagent used, to give a measurement of the relative biotinylation of the refolded protein.

205

Graham S. Ogg

8.2 Comments An alternative strategy for deriving the percentage biotinylation is to compare W6/32-dependent protein concentrations before after clearance with streptavidin beads. If no positive control is available then the total protein concentration should also be measured by a protein assay kit such as that available from Pierce. However, it is likely that this will generate a significantly higher concentration than the true amount of biotinylated refolded complex.

9. Formation of tetramers 9.1 Principle Fluorescent streptavidin is added in a 1:4 molar ratio (streptavidin:refolded complex). The use of deglycosylated streptavidin may reduce non-specific binding of the complex to cells. The fluorescent markers we have tested include fluoroscein isothiocyanate (FITC), phycoerythrin (PE), and allophycocyanin (APCN). The bright fluorescence obtained with PE often means that it is the marker of choice. Streptavidin is added slowly to ensure complete saturation of all biotin-binding sites. Protocol 7. Formation of tetramers with streptavidin-PE conjugate Equipment and reagents • 0.2 mg/ml streptavidin-phycoerythrin (PE, e.g. Sigma)

Method 1. Calculate the mass of total streptavidin required to saturate all biotin binding sites at a 1:4 molar ratio (streptavidin:refolded complex) based on a molecular mass of streptavidin of 60 kDa.a 2. Calculate the volume of streptavidin solution to add in total, and divide by 10. 3. At hourly intervals (or longer if possible) add the 1/10 aliquots of streptavidin and rotate at 4°C at 10 r.p.m. in glass storage vials (see Protocol 5). 4. Store the tetramer at 4°C and in the dark. a

The mathematics can be simplified to dividing the total mass of biotinylated refolded complex by 3.16 to generate the total amount of streptavidin required.

9.2 Comments A common source of error is the overestimation of the amount of refolded complex together with an over-rapid addition of streptavidin. These result in 206

9: HLA-peptide tetrameric complexes tetramers being a minor population compared to dimers/monomers and the eventual staining will be poor.

10. Flow cytometry 10.1 Principle The fluorescent tetramers are added to a cell population and the sample is analysed using a fluorescence activated cell sorter (FACS). Protocol 8. Flow cytometry Equipment and reagents • Cell population • Fluorochrome-conjugated anti-CD8 (Caltag) • FACS and tubes (Becton Dickinson)

• Fluorescent tetramer (see Protocol 7) • PBS pH 7.3

Method 1. Centrifuge the cell population(s) in FACS tube(s), e.g. at 500 g for 5 min in 50-100 ul of PBS. 2. Add the titrating amounts fluorescent tetramer to the required tubes.a Incubate for 20 min at 37 °C in the dark. 3. Add the anti-CD8 antibody. Incubate for 20 min at 37°C in the dark. 4. Wash two or three times with PBS. 5. If necessary, fix with a solution of 2% formaldehyde in PBS. " Initially, it is necessary to titrate the tetramer dose.

10.2 Comments Controls include non-stained cells and cells with tetramer alone and anti-CD8 alone. Other controls include CD8+ T cells specific for other epitopes, or peripheral blood mononuclear cells from uninfected individuals or from individuals with irrelevant HLA types. Additional antibodies directed to other cell-surface molecules, e.g. cell-activation or memory markers, can be added at the same time as the anti-CD8 antibody. Figure 3 shows an example of staining with an HLA-A*0201 tetramer refolded around the immunodominant 77-85 peptide from HIV p17 Gag (7).

11. Conclusions Once the protocols have been established it takes approximately 3-4 days to synthesize each tetramer, and the complexes are usually stable, lasting several 207

Graham S. Ogg

Figure 3. Example of staining of the CD8+ T cells from the peripheral blood of an HIVinfected individual. Staining along the x-axis is with anti-CD38 (a marker of T-cell activation) and along the y-axis with the A*0201/Gag tetramer. The percentage of cells within each quadrant is documented.

months at 4°C with no detectable loss of activity. HLA-peptide tetrameric complexes are powerful tools for studying antigen-specific CTLs, allowing quantitation, phenotyping, and functional characterization of the cells. Initial data generated with the HLA-tetramers have extended our understanding of CTL-mediated viral immunity and NK cell function. For the next few years, it is likely that the tetramers will be used predominantly in basic science research, but in due course they may have an additional role in more clinical settings.

References 1. Altman, J., Moss, P. A. H., Goulder, P., Barouch, D., McHeyzer-Williams, M., Bell, J. I., McMichael, A. J., and Davis, M. (1996). Science, 274, 94-6. 2. Ogg, G., Jin, X., Bonhoeffer, S., Dunbar, P., Nowak, M., Monard, S., Segal, J., Cao, Y., Rowland-Jones, S., Cerundolo, V., Hurley, A., Markowitz, M., Ho, D., Nixon D., and McMichael, A. (1998). Science, 279, 2103-6. 3. Gutgemann, I., Fahrer, A. M., Altman, J. D., Davis, M. M., and Chien, Y. H. (1998). Immunity, 8, 667-73. 4. Davis, M. M., Boniface, J. J., Reich, Z., Lyons, D., Hampl, J., Arden B., and Chien, Y. H. (1998). Annu. Rev. Immunol., 16, 523-44. 5. Busch, D. H., Pilip, I., and Pamer, E. G. (1998). J. Exp. Med., 188, 61-70. 6. Schatz, P. J. (1993). Biotechnology., 11, 1138-43. 7. Parker, K. C., Bednarek, M. A., Hull, L. K., Utz, U., Cunningham, B., Zweerink, H. J., Biddison, W. E., and Coligan, J. E. (1992). J. Immunol, 149, 3580-7.

208

10

Expansion of human cytotoxic T lymphocytes for immunotherapy RUSUNG TAN

1. Introduction The adoptive transfer of virus-specific, cytotoxic T-lymphocyte (CTL) lines or clones to humans has proved effective in the prevention and treatment of diseases caused by cytomegalovirus (CMV) and Epstein-Barr virus (EBV) in the first few months after bone-marrow transplantation (1-3). Apart from the benefit to patients, these studies have provided definitive evidence that CTLs are highly efficient at controlling some viral diseases in humans, and raise the possibility that similar therapy may be useful for other infections and tumours which elicit cellular immune responses. However, the generation of antigenspecific CTLs in vitro does not necessarily imply anti-viral efficacy in vivo. Many viruses and some tumours have been shown to evade the cellular immune response by mechanisms as varied as the intricacies of the immune responses themselves. For instance, most members of the Herpesvirus family elaborate proteins that undermine the intracellular class I antigen-processing pathway (4), while other viruses manufacture molecular homologues that interfere with intra- and intercellular signalling (5). In addition, some infected cells and tumours upregulate Fas-ligand thus arming themselves against Fasexpressing lymphocytes (6-8). In patients with depressed CD4+ T-cell function due to therapeutic immunosuppression (for example after bone-marrow transplantation), the efficacy of the infused CTLs appears to correlate with the re-emergence of antigen-specific T-helper cells (2, 9). In diseases where there is no paradigm for protective host immunity, for example HIV infection, the use of CTL adoptive therapy has been less successful (10-13). One obstacle to their therapeutic effectiveness has been the short survival of infused HIVspecific clones (13, 14): however, these studies have provided a clear demonstration that infused HIV-specific CTLs will home towards the sites of active HIV replication in lymphoid tissue (14). Thus, where possible, a thorough understanding of the natural host response to disease should precede adoptive therapy experiments in humans. Successful adoptive immunotherapy depends on a highly organized and meticulous approach to generating, characterizing,

Rusung Tan and culturing virus-specific CTLs. This chapter deals with the methods required for the generation and large-scale expansion of CTLs.

1.1 Adoptive transfer of CTLs in humans Riddell et al. first showed, in uncontrolled trials, that donor-derived, CMVspecific CTL clone infusions protected bone-marrow transplant (BMT) recipients from CMV disease until the reconstitution of their own immune responses (1, 2). These studies demonstrated the relative safety of lymphocyte infusions and the ability of transferred cells to survive up to 12 weeks in most recipients. These studies also suggested that the efficacy of infused CMVspecific CTLs correlated with the re-emergence of antigen-specific T-helper cells from the transplanted marrow. In this situation, the use of polyclonal CD4+ and CD8+ lines may be more useful than individual CTL clones (3, 15). The infusion of donor-derived leucocytes or donor-derived CTL lines, rather than clones, has been used for the treatment of EBV-associated lymphoproliferative disorders in bone-marrow recipients (3, 16), and these experiments confirm both the general safety of infusions and the relatively long-lived nature of infused cells. In both the cases of CMV and EBV, the adoptive transfer of CTLs occurred in the setting of immunosuppressed individuals with regenerating immune systems. It is not currently known whether adoptive CTL therapy will be equally successful in the settings of either (a) a non-immunosuppressed individual (for instance, a patient with colon cancer) and (b) an individual with a mature but suppressed immune system (for instance, a patient with a solid organ transplant). Recently, autologous EBVspecific CTLs were generated prior to transplantation and then transferred to three recipients of solid organ transplants (liver and kidney): a rise in the number of EBV-specific CTLs was demonstrated, using limiting dilution analysis to quantitate CTL precursors, whilst EBV DNA levels showed a corresponding fall (17). It will be important to evaluate the efficacy of CTLs expanded and stored prior to transplantation and infused in this way in the face of active EBV-associated lymphoproliferation. Despite accumulating evidence that HIV-specific CTLs play a key role in containing HIV replication (reviewed in ref. 18), early experiments with the adoptive transfer of lymphocytes in HIV infection were discouraging. Ho et al. attempted to augment CD8+ responses by infusing large numbers of autologous, polyclonally expanded CD8+ cells that had be obtained by leucopheresis (19). The expansion protocol used high doses of IL-2 without antigen-specific T-cell stimulation, thereby failing to enrich for HIV-specific cells. The therapy was well tolerated but no significant anti-HIV effects were observed. In an attempt to maximize lytic efficacy, Koenig et al. twice transferred large numbers (around 1010 cells) of a nef-specific clone to an HIV-infected patient (CD4 count around 400/X1) over a period of 14 months (10). As expected, the number of CD8+ cells was increased post-transfusion, 210

10: Expansion of human cytotoxic T lymphocytes for immunotherapy but surprisingly a corresponding rise in nef-specific CTL activity in peripheral blood was not seen. This may have been because the patient still possessed high baseline activity against the nef epitope, or because the infused cells had been rapidly distributed to the lymphatic system. Unexpectedly, there were transient increases in virus load following both infusions and a concomitant decline in CD4+ cell counts. The first infusion was given with a large dose of IL-2, which probably contributed to virus replication by activating CD4+ T cells in vivo. However, a similar rise in virus load was observed after the second infusion without IL-2. There was one striking effect of the infusion: sequencing of viral isolates from the patient revealed a selection for viruses deleting part or all of the targeted nef epitope. These data strongly imply that the infused CTLs were active against the virus, but that because their specificity was directed at a single epitope they were responsible for driving viral escape. Thus, in the case of a rapidly mutating virus such as HIV, it may be prudent to infuse more than a single clone. Riddell et al. have transferred HIV gag-specific clones to six patients infected with HIV (11). As a safety measure, cells were genetically modified to carry both the hygromycin phosphotransferase gene and the herpes simplex virus thymidine kinase (HSV-TK) gene, which could, if required, efficiently phosphorylate gancyclovir and eliminate the transfused cells. Unfortunately, the infused cells appeared to express HSV-TK and, rather surprisingly (given the immune suppression of the recipients), stimulated a classical HLArestricted CTL response specific for the transfected gene products. Thus subsequent CTL infusions led to the rapid and complete elimination of the foreign cells. This study showed that patients with CD4+ counts of around 200/xl could make primary CTL responses to a novel antigen, and demonstrated that gene marking of cells has the potential to render them susceptible to immune elimination. Other mechanisms of HIV escape may also render CTL infusion therapy ineffective. For example, if a population of CD8+ CD28- cells are primarily selected by ex vivo expansion methods, when these cells are infused they may be particularly susceptible to apoptosis in vivo or fail to function adequately (20). Xu et al. showed that in vitro, wild-type SIV, but not a nef mutant virus, leads to an increase in FasL expression on infected cells (7). Thus the expression of FasL may protect infected cells from CTL attack, killing virusspecific CTLs in the process and providing a route for escaping the immune response. If such a mechanism exists for HIV, simple adoptive transfer of CTLs may simply not work for this disease.

2. Peptide recognition by CTLs CTLs recognize short peptides derived from intracellular proteins, including those expressed by intracellular pathogens, bound to MHC class I (21). Foreign proteins are degraded in the cytosol of infected cells in a proteasome 211

Rusung Tan complex (22), and the peptide fragments are translocated to the endoplasmic reticulum (ER) by a transporter associated with antigen-processing (TAP), where they bind to newly synthesized class I molecules in a groove formed by the polymorphic regions of the a-1 and a-2 heavy-chain domains (23). The consequence of these polymorphisms is that different MHC allotypes bind different peptides. Peptide amino acid side-chains which bind to the groove are known as anchor positions, while those amino acids whose side-chains point out of the groove interact with the TCR. Thus, knowledge of the preferred anchor positions of HLA molecules can aid in the prediction of epitopes (motif prediction).

2.1 Peptide binding motifs A prediction of class I epitopes is based on the peptide binding motif for a given MHC molecule (see Table 1). The peptide binding motif, in turn, is determined by sequencing pooled naturally occurring peptides that have been eluted from a single MHC allotype. The obtained sequences are aligned and a consensus motif developed, which, in some cases, takes into account the crystal structure of the molecule. For all structures derived so far, the anchor binding sites have correlated well with the empirical data gathered beforehand. For instance, in the case of HLA-A*0201, the pooled peptide-sequence motif predicted strong preferences for hydrophobic residues at positions 2 and 9, which are in accord with its crystal structure (24). In addition to anchor binding sites, certain residues may antagonize binding (25, 26) and peptide binding alone is not sufficient to guarantee either in vivo antigen presentation or T-cell recognition. None the less, numerous peptide epitopes have been predicted using these methods (27). Table 1. Peptide-binding motif for HLA-A*1101 (bold denotes primary anchor positions, underlined denotes auxiliary anchor positions (27))

1 Dominant

2

3

V

M

L

I

L

I

F

F

Y

Y

Y

V

I

F

4

5

6

7

8

9

10

11

K

K

K

R

R

A

Subdominant

A

T

N

P

P

I

R

R

D

G

I

V

K

D

M

E

D

F

Q

E

V

E

K

M

Q

212

N

10: Expansion of human cytotoxic T lymphocytes for immunotherapy

3. Establishing CTL lines CTL lines are polyclonal lymphocytes that Iyse target cells bearing antigenic peptides, as described in Chapter 7. In contrast, CTL clones consist of lymphocytes all expressing the same T-cell receptor (TCR), which therefore all recognize the same epitope. In theory, CTL clones should lyse target cells with much greater efficiency than CTL lines. In general, lines are produced by incubating patient-derived peripheral blood mononuclear cells (PBMCs) with cells that can present antigen in an MHC class I-restricted fashion, as described in Chapter 7. The antigen-presenting cells (APCs) may be other autologous PBMCs, autologous B cell lines (B-lymphoblastoid cell lines, BLCLs) infected with either the virus of interest or recombinant vaccinias (rVV) expressing viral gene products, or autologous B-LCLs which have been exogenously coated with antigenic peptides. Engagement of class I-peptide complexes by the clonotypic TCR on CTL precursors (CTLp) results in activation of the lymphocyte and cell division. Because CTLs do not produce interleukin-2 (IL-2) with the efficiency of CD4+ helper cells, the addition of IL-2 or Lymphocult-T to the culture medium is usually necessary.

3.2 Establishing CTL clones CTLs may be cloned directly from PBMCs. However, this procedure is often laborious, requiring the use of numerous microtitre cloning plates in order to select a reasonable number of clones of the desired specificity. This method is usually not as successful as cloning from an established CTL line, in which a higher number of antigen-specific clonotypic CTLs will be present. CTL clones are generated by limiting dilution, that is, single cells are place in single wells and stimulated with antigen or TCR ligand. In the case of antigen stimulation, only those cells whose TCR recognize the class I-antigen complex will be activated and expanded. It is possible to clone using a non-specific T-cell activator such as anti-CD3, but this method may produce more clones with non-specific cytotoxic activity. Cloning with stimulator cells infected with recombinant vaccinia is an alternative strategy and may be an improvement over peptide-coated, antigen-presenting cells because of the physiological expression of class I-peptide complexes on the cell surface. In theory, the presence of a smaller number of antigen-class I complexes should produce additional selection for high-affinity clones. Alternatively, one can lower the concentration of peptide used to coat the stimulator cells to select preferentially for clones with better binding and killing characteristics (28). In our experience, the use of low peptide concentrations in the cloning procedure results in clones that kill better in vitro. Proving the actual 'clonality' of a putative CTL clone is difficult and may not actually be necessary when generating clones for therapeutic purposes. Near-definite proof may be obtained through the sequencing of the variable 213

Rusung Tan regions of the TCR beta chain by anchored PCR (29-31): however, this method is laborious and not always foolproof as small numbers of contaminating cells may still be present (Tan and Rowland-Jones, unpublished data). The specificity, but not the clonotype, of the TCR may be demonstrated using tetrameric MHC-peptide complexes (32, 33), as described in Chapter 9. The use of the appropriate tetramer will establish that a single population of antigen-specific CTLs is present, although this will not necessarily be clonal. Tetramers can also provide the opportunity to select antigen-specific CTLs using a FACS, which can then be cloned and expanded (34): this appears to be a much more efficient method than limiting dilution. The combination of tetramer staining with other antibodies allows a more detailed phenotypic analysis of CTL clones than has previously been possible (13, 34). However, these complexes are not yet widely available for most HLA-peptide combinations. Immunophenotyping the clone with fluoresceinated antibodies directed against CD3 and CD8 provides evidence of a single CTL subset, and is the method most often used to characterize CTL clones for this purpose. The cloning protocol described below was used to isolate HIV-specific CTL clones which were subsequently used in therapy (13). Clones were established from a peptide-specific CTL line by limiting dilution. During the culture process, positive wells may be visualized as early as 8-10 days after initial setup: however, in my experience these cells are often not antigen-specific when tested, possibly because CD4+ cells are present in the original line and grow more quickly than specific CTLs. Thus, it is usually more profitable to screen those wells which become positive for growth between 14 and 21 days. Protocol 1. Cloning from a CTL line Equipment and reagents • Antigen-specific CTL line • 25 ml plastic Universal tubes or 50 ml conical tubes • Haemocytometer • Filter-sterilized 100 uM peptide stock in RPMI-1640 or PBS • Autologous, irradiated (8000 rads) B-LCL • Allogeneic irradiated (3000 rads) PBMCs, mixed from three donors • Phytohaemagglutinin (PHA) (Wellcome)

• 96-well, flat-bottomed, tissue culture plates (Costar) • 24-well flat-bottomed tissue culture plate • Repeating pipette » R/10 medium: RPMI-1640 medium (Gibco) supplemented with L-glutamine (2 mM), penicillin (100 u/ml), streptomycin (100 u/ml), and 10% human or fetal calf serum • Lymphocult-T (Biotest) or other source of IL-2

Method 1. Prepare the cloning mix, comprising: 105 autologous, irradiated BLCLs which have been pulsed with peptide for 1 h at a final concentration of 1-10 uM and then washed; 106 mixed irradiated allogeneic PBMC; and PHA (5 ug/ml) in R/10 medium.

214

10: Expansion of human cytotoxic T lymphocytes for immunotherapy 2. To separate tubes, each containing 10 ml of the cloning mix, add 30 cytotoxic T cells (0.3/well), 100 cells (1/well), and 300 cytotoxic cells (3/well), respectively. 3. Use a repeating pipette, to dispense 100 ul of the cell mixture into each well of a flat-bottomed microtitre plate. 4. Incubate at 37oC and 5% CO2. 5. Four days later, add 100 ul of R/10 and Lymphocult-T (20%) per well. 6. Screen the plates for CTL growth at days 14 and 20 after set-up, and mark the positive wells. 7. Expand cells from positive wells by adding the clone to a further 1 ml of cloning mix and transferring the mixture to a single well of a 24well plate. 8. Add a further 1 ml of R/10 with 20% Lymphocult-T on day 4. 9. Culture the expanded clone for 14 days and test for cytotoxic activity. 10. Examine the phenotype of the clone by CD4/CD8 staining and tetramer staining (see Chapter 9, Protocol 8), where available.

3.3 Expansion of CTL clones Large-scale expansion of CTL clones or oligoclonal lines is technically straightforward, but not always successful. The characteristics of the clone to be expanded are particularly important. We and other investigators have found that clones which have received repeated TCR stimulation over weeks and months in culture do not expand with the efficiency of recently cloned cells (S. Riddell, personal communication). Thus ideally, the CTLs should undergo one large-scale expansion following their initial cloning, and aliquots of these cells may then be cryopreserved for future expansions. In addition, CTLs derived from HIV-infected patients whose CD4 cell counts are below 200/ul do not appear to grow as vigorously as clones from people with less advanced disease. It is possible that CTLs in patients late in HIV infection have already been through several rounds of expansion in vivo and may be end-stage cells (18, 35). In general, cells grow more successfully in smaller flasks (e.g. T25 (50 ml) flasks rather than T200 (600 ml) flasks). However, the use of smaller vessels requires the manipulation of numerous flasks, which increases both the work involved and the chance of bacterial or fungal contamination. Thus, in practice, the use of T75 (200 ml) flasks represents an acceptable balance between optimizing cell growth and reducing excessive manual labour. Large numbers of autologous B-LCLs and PBMCs are required for large-scale expansion and these may be prepared beforehand and frozen. PBMCs are best generated by Ficoll separation of leucopheresis-prepared buffy coats which may be obtained from the local blood-bank. 215

Rusung Tan

Protocol 2.

Large-scale expansion of CTL clones

Equipment and reagents (per 10 x T75 flasks) . CTL clone (2 X 106 cells) • 1 ug/ml stock of anti-CD3 (OKT3, Orthoclone) • Irradiated, 8000 Rads) syngeneic, or allogeneic B-cell line (1.5 x 10s cells) • Irradiated 3000 Rads), allogeneic PBMCs (7.5 x 10s cells) • 1 x T200 tissue culture flask • 10 x T75 tissue culture flasks (Costar)

• 25 ml plastic Universal tubes or 50 ml conical tubes • Haemocytometer • R/10 medium: RPMI-1640 medium supplemented with L-glutamine, penicillin, streptomycin, and 10% human serum • IL-2 approved for human use • Incubator at 37°C, 5% C02 • 100 ml infusion bag of sterile saline

Method 1. In a T200 sterile flask, combine the CTL clone, PBMCs, and B-LCL in 100 ml of R/10 medium. 2. Add 15 ug of anti-CD3 (final concentration = 30 ng/ml) and bring the volume up to 500 ml with R/10. 3. Distribute the cell mixture to 10 x T75 flasks, 50 ml per flask. 4. Incubate the flasks upright at 37°C, 5% CO2 overnight. 5. Add IL-2 (human recombinant IL-2, 25 Cetus units/ml) to flasks the next day. 6. Five days after the initial set-up, harvest cells from all flasks, wash once with RPMI-1640 and resuspend in R/10-IL-2 at 50 ml per flask in 10 flasks. 7. Eight days after set-up, resuspend the cells out of a representative flask and count. If the cell concentration is >2 X 106 per ml, split each flask into two flasks. 8. Test the cells for CTL activity at 12-14 days. 9. Harvest the cells and resuspend in a 100 ml bag of sterile saline for infusion.

Protocol 3. Preparation of human serum Equipment and reagents (per 10 3 T75 flasks) • Volunteers (preferably fasted overnight) who have given informed consent • 18-gauge butterfly needle and catheter (a 20-gauge needle may be used but is slower)

• • • •

4 x 50 ml syringes per volunteer 50 ml sterile conical tubes (Falcon) 58oC water bath An assistant who can handle the syringes is useful

Method 1. Insert the butterfly needle and draw 50 ml of venous blood into a syringe. 216

10: Expansion of human cytotoxic T lymphocytes for immunotherapy 2. While stopping the blood flow by crimping the catheter, disconnect the blood-filled syringe from the catheter and empty the blood into a 50 ml conical tube. 3. Reattach a fresh syringe to the butterfly catheter and withdraw another 50 ml. 4. Repeat the procedure to a total of 200 ml of blood. 5. Allow the tubes to stand at room temperature for 6-8 h. 6. Centrifuge the tubes at 800 x g for 10 min at room temperature. 7. Transfer the serum to fresh 50 ml tubes and centrifuge again. 8. Transfer the serum to fresh 50 ml tubes and heat-inactivate at 58°C for 1 h. 9. Freeze at -20°C in 32 ml aliquots. 10. Save 1 ml of the serum for serological testing (HIV, HBV, HCV).

3.4 Ensuring the safety of CTL infusions If the cells are to be used in therapy, all aspects of the expansion protocol must be carefully scrutinized to reduce the chances of any adverse reaction in the recipient. The tissue culture reagents such as IL-2 and anti-CD3 antibodies must be approved for human use, and can usually be obtained from a hospital pharmacy. The human serum used for culture must be screened for blood-borne viruses (HIV, HBV, and HCV), if not obtained from a blood bank where it will already have been screened. The use of serum from volunteers (described in Protocol 3) allows the selection of serum which optimally supports CTL growth: it is better to collect serum from fasting volunteers in order to reduce the fat content (S. Riddell and K. Watanabe, personal communication). All aspects of the culture should be scrupulously carried out in strictly aseptic conditions, ideally reserving a dedicated tissue culture hood and incubator for the purpose. The two paramount considerations in transferring cultured cells to patients are the sterility of the preparation and the absence of transformed cells. Because patients receiving adoptive cell therapy are usually immunosuppressed, any transferred organisms could lead to serious infections. The cells and growth medium must be periodically assayed for bacterial, viral, and fungal contamination. However, because CTLs may be infected at any time up to the moment of transfer and because the culture of fastidious organisms may require days to weeks of incubation, it is usually necessary to infuse cells prior to complete culture results. Hence, meticulous handling of the cells is an absolute requirement. One way of avoiding this problem is to cryopreserve cells at their peak of lytic activity and thaw them just prior to transfer, when the microbiological results have been finalized. However, there is often a reduction in cytotoxic activity as well as a loss of absolute cell numbers in 217

Rusung Tan lymphocytes which have been frozen. Organisms likely to contaminate cell cultures include mycoplasmas, yeasts, and other fungi. In practice, we screen cells for contamination both 3 days before and on the day of infusion—we test aliquots of cells for mycoplasma and send samples to the clinical microbiology laboratory for cultivation using a blood culture/sterile sites protocol. Although this does not guarantee that samples are absolutely sterile at the time of infusion, it will permit more rapid retrospective diagnosis of any blood-borne infection. Most protocols for lymphocyte expansion utilize EBV-transformed B cells (B-LCLs) as either antigen-presenting cells and/or a source of co-stimulatory molecules. These cells must be thoroughly irradiated (4000-8000 rads) prior to use to prevent the escape of any transformed cells. Aliquots of the feeder cells (B-LCLs and PBMCs) should be cultured separately to demonstrate that the irradiation procedure is adequate to eliminate any chance that the feeder cells could grow out in the recipient. Other investigators have also taken the additional precaution of growing B-LCLs in acyclovir-containing media, thereby preventing the formation of late lytic-cycle infectious EBV particles (17). As cell therapy is currently an experimental procedure, it is absolutely crucial that the use of CTLs in therapy has been reviewed by the local ethical committee and received fully informed consent from the patient and his or her physicians.

References 1. Riddell, S. R., Watanabe, K. S., Goodrich, J. M., Li, C. R., Agha, M. E., and Greenberg, P. D. (1992). Science, 257, 238. 2. Walter, E. A., Greenberg, P. D., Gilbert, M. J., et al. (1995). N. Engl. J. Med., 333, 1038. 3. Rooney, C. M., Smith, C. A., Ng, C. Y. C., et al. (1995). Lancet, 345, 9. 4. Ploegh, H. L. (1998). Science, 280, 248. 5. Smith, G. L., Symons, J. A., Khanna, A., Vanderplasschen, A., and Alcami, A. (1997). Immunol. Rev., 159, 137. 6. Hahne, M., Rimoldi, D., Schroter, M., et al. (1996). Science, 274, 1363. 7. Xu, X.-N., Screaton, G. R., Gotch, F. M., et al. (1997). J. Exp. Med., 186, 7. 8. Strand, S., Hofmann, W. J., Hug, H, et al. (1996). Nature Med., 2, 1361. 9. Heslop, H. E. and Rooney, C. M. (1997). Immunol. Rev., 157, 217. 10. Koenig, S., Conley, A. J., Brewah, Y. A., et al. (1995). Nature Med., 1, 330. 11. Riddell, S. R., Elliott, M., Lewinsohn, D. A., et al. (1996). Nature Med., 2, 216. 12. Lieberman, J., Skolnik, P. R., Parkerson, G. R., et al. (1997). Blood, 90, 2196. 13. Tan, R., Xu, X.-N., Ogg, G. S., et al. (1999). Blood, 93, 1506. 14. Brodie, S. J., Lewinsohn, D. A., Patterson, B. K., et al. (1999). Nature Med., S, 34. 15. Heslop, H. E., Ng, C. Y. C, Li, C, et al. (1996). Nature Med., 2, 551. 16. Papadopoulos, E. B., Ladanyi, M., Emanuel, D., et al. (1994). N. Engl. J. Med., 330, 1185. 17. Haque, T., Amlot, P. L., Helling, N., et al. (1998). J. Immunol., 160, 6204. 18. Rowland-Jones, S. L., Tan, R., McMichael, A. J. (1997). Adv. Immunol., 65, 277. 218

10: Expansion of human cytotoxic T lymphocytes for immunotherapy 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 29. 30. 31. 32. 33. 34. 35.

Ho, M., Armstrong, J., McMahon, D., et al. (1993). Blood, 81, 2093. Levine, B. L., Mosca, J. D, Riley, J. L., et al. (1996). Science, 272, 1939. Townsend, A. and Bodmer, H. (1989). Annu. Rev. Immunol, 7, 601. Goldberg, A. L. and Rock, K. L. (1992). Nature, 357, 375. Townsend, A. and Trowsdale, J. (1993). Semin. Cell. Biol., 4, 53. Bjorkman, P. J., Saper, M. A., Samraoui, B., Bennett, W. S., Strominger, J., and Wiley, D. C. (1987). Nature, 329, 506. Ruppert, J., Sidney, J., Celis, E., Kubo, R. T., Grey, H. M., and Sette, A. (1993). Cell, 74, 929. Kast, W. M., Brandt, R. M., Sidney, J., et al. (1994). J. Immunol, 152, 3904. Rammensee, H. G., Friede, T., and Stevanoviic, S. (1995). Immunogenetics, 41, 178. Alexander-Miller, M. A., Leggatt, G. R., and Berzofsky, J. A. (1996). Proc. Natl Acad. Sci. USA, 93, 4102. Loh, E. Y., Elliott, J. F., Cwirla, S., Lanier, L. L., and Davis, M. M. (1989). Science, 243, 217. Moss, P. A. H., Rowland-Jones, S. L., Frodsham, P. M., et al. (1995). Proc. Natl Acad. Sci. USA, 92, 5773. Kalams, S. A., Johnson, R. P., Dynan, M. J., et al. (1996). J. Exp. Med., 183, 1669. Altman, J., Moss, P. A. H., Goulder, P., et al. (1996). Science, 274, 94. Ogg, G. S., Xin, J., Bonhoeffer, S., et al. (1998). Science, 279, 2103. Dunbar, P. R., Ogg, G. S., Chen, J., Rust, N., van der Bruggen, P., and Cerundolo, V. (1998). Curr. Biol., 8, 413. Pantaleo, G., Koenig, S., Baseler, M., Lane, H. C., and Fauci, A. S. (1990). J. Immunol., 144, 1696.

219

This page intentionally left blank

11 HLA typing methods PETE KRAUSA and MICHAEL BROWNING

1. Introduction The human major histocompatibility complex or HLA system is a set of highly polymorphic genes clustered on chromosome 6. There are three main groups of HLA genes, namely: HLA class I, class II, and class III. HLA class I and class II genes code for molecules that present antigen in the form of peptides at the cell surface. HLA class I molecules are expressed on most nucleated cells and platelets, and present antigen to CD8+ T cells. HLA class II genes are constitutively expressed on professional antigen-presenting cells (B lymphocytes, macrophages, monocytes, and dendritic cells). In addition, HLA class II expression can be induced on a range of other cell types, including activated T cells, activated endothelium, and many epithelial cells. HLA class II molecules present antigen to CD4+ T cells. HLA class III genes code for certain complement components, cytokines (TNF-a and -3), and a variety of non-immunological products, but their identification will not be covered in this chapter. Both class I and class II HLA molecules have a similar structure, comprising two parallel alpha helices sitting over a beta-pleated sheet. The space between the alpha helices forms a groove within which peptide can be bound. The complexes of HLA molecules with bound peptides are presented at the cell surface as markers for immune surveillance by antigen-specific T cells. Cells presenting peptides derived from pathogens can therefore elicit a cellmediated immune response. It should be noted, however, that the great majority of peptides expressed in association with both class I and class II molecules at the cell surface are derived from 'self' proteins, and do not elicit T-cell responses under normal circumstances. Peptides which associate with HLA class I molecules are usually derived from cytosolic proteins, whilst peptides bound to class II molecules are derived from surface glycoproteins or exogenous proteins. There are distinct pathways of antigen processing for the presentation of peptides by MHC class I or class II molecules. The length of peptides bound to class I molecules is limited to around 9-11 amino acids, whilst those bound to class II are usually longer and more variable, ranging from 12 to 25 amino acids in length. This

Pete Krausa and Michael Browning difference is explained by the structural differences between class I and class II molecules (1, 2). Class I molecules have binding grooves with closed ends, which limits the length of peptide bound, whereas class II molecules have open ends to the peptide binding groove, allowing longer peptides to bind. The polymorphism found amongst HLA molecules is found mainly in the region around the peptide binding groove. This polymorphism determines the specificity of peptide binding, as well as how the peptide is orientated within the groove. Additionally, residues of the T-cell receptor interact directly with residues of the HLA molecule. Thus polymorphism in the HLA molecule influences T-cell recognition both directly and indirectly through the specificity of peptide binding (a phenomenon known as MHC restriction). HLA tissue typing involves the identification of HLA polymorphism in HLA genes or their gene products. HLA polymorphism was initially identified serologically, through the discriminatory specificity of antibodies (3-6). These sera, many of which were derived from multiparous women, with specificity against the paternal HLA type, provided the means by which the polymorphic nature of the HLA system was uncovered. Over a number of years, extensive panels of sera were collected, many locally within a particular tissue-typing laboratory. These panels of characterized sera were used to define the HLA type through the patterns of reactivity they produced when tested against HLA-expressing lymphocytes. It soon became apparent through other methods, including the mixedlymphocyte reaction (7-9) and isoelectric focusing (10), that the serological approach failed to identify all HLA polymorphisms. Because of the potential significance of these polymorphisms, alternative approaches offering higher typing resolution were sought. The application of molecular biological methods to tissue typing marked a departure from the characterization of the expressed HLA molecule to the definition of the HLA gene. The majority of molecular techniques currently employed rely on the polymerase chain reaction (PCR) (11, 12). Specific amplification of HLA genes (13) has allowed for the definition of polymorphism at the DNA level, and has had a major impact on HLA typing, resulting in the characterization of a far more polymorphic system than was achievable using serological techniques. The increased resolution offered by PCR-based approaches is complemented by their ease of use compared to the restrictions involved in performing serological typing. However, many professional histocompatibility laboratories continue to use serological typing, since they have collected a highly characterized panel of sera, and have accumulated a great amount of experience in their use and interpretation. But as the resource of sera decreases, and the importance of molecular approaches is further realized, it seems likely that serology will diminish as the method of choice for HLA typing. At a clinical level, the major purpose of tissue typing is to match donor and recipient for solid organ or bone-marrow transplantation. Transplantation 222

11: HLA typing methods laboratories are mainly concerned with matching for HLA-A, HLA-B, and HLA-DR, since these are perceived as the critical loci for donor/recipient matching. However, mismatches at other loci can also have clinical significance. (14) and accurate HLA typing is essential for fully understanding and interpreting cellular interactions within the immune response. It would be impossible to describe in full all methods and protocols currently used for HLA typing. However, a description of certain key methods, currently applied to HLA typing, will he given, together with basic protocols. This chapter will also provide a brief description of the HLA system with regard to the structure of HLA molecules, the nomenclature currently used for HLA type assignment, and the distribution of HLA types in different populations.

2. The HLA system Tissue typing is principally concerned with identifying the allelic variants generated from HLA class I and class II gene loci. These are located on the short arm of chromosome 6 (see Figure 1). HLA class I antigens are coded from three classical loci, HLA-A, -R, -C. There are also several non-classical HLA class I antigens (HLA-E, -F, -G), which also associate with B2microglobulin, and several class 1 pseudogenes. Expression of these nonclassical HLA molecules is variable. For example, HLA-G is predominantly

Figure 1. A map of the 4-Mbp human MHC region on chromosome 6. The MHC is divided into class I, class II, and class II! regions. Class II is at the centromeric end, whilst class I is at the telomeric end of the MHC complex. The class I region contains genes encoding, amongst other things, the classical HLA-A, -B, -C antigens. The class II region contains genes encoding HLA-DP, -DQ, -DR antigens. The class III region contains genes encoding some of the components of the complement system, including CS, C4, and Bf.

223

Pete Krausa and Michael Browning expressed on trophoblasts (15, 16). HLA-E has recently been shown to bind peptides derived from leader sequences of many class I molecules, and that this complex acts as an inhibitory receptor for natural killer (NK)-mediated cell lysis (17). HLA-DR, -DQ, and -DP are the classical HLA class II antigens. The HLADR antigens are composed of a polymorphic beta chain associated with a invariant alpha chain. The HLA-DRB1 locus codes for most of the HLA-DR polymorphism. The HLA-DRA locus codes for an invariant chain, which also combines with beta chains coded for at three other DR loci, namely DRB3, DRB4, and DRB5 to give antigens DR52, DR53, and DR51, respectively. HLA-DQ and DP comprise alpha and beta chains, both of which are polymorphic. As with the HLA class I region, the class II region contains several pseudogenes, together with a number genes encoding molecules involved in the processing of antigens for presentation by HLA class I and class II molecules. The number of known allelic variants at each of the class I and class II loci has risen immensely over recent years, particularly as a consequence of the development and application of molecular biological techniques. There are now more than 90 known HLA-A alleles, 200 HLA-B alleles, and 200 known HLA-DR alleles (18, 19). This contrasts with the serological definition by which approximately 21 well-defined HLA-A serological specificities, 40 HLA-B serological specificities, and 14 HLA-DR specificities were known. The number of possible allelic variants at each locus makes the HLA system the most polymorphic set of genes known in humans.

2.1 Polymorphism in relation to structure and function How HLA molecules function as antigen-presenting molecules became clear once their crystal structure was determined (1). This was initially achieved for the HLA-A2 molecule. The structure revealed that the HLA class I molecule consists of a peptide binding groove (formed by the al and a2 domains) supported by immunoglobulin-like domains comprising the a3 domain and the B2-microglobulin (B2m) light chain (see Figure 2). Unlike the other HLA genes, the B2m chain is encoded on chromosome 15 and is monomorphic. Crystallography revealed a similar structure for class II molecules (2), with the peptide binding groove comprising the al and B1 domains (see Figure 2). The class I heavy chain and both class II a- and B-chains have transmembrane and cytoplasmic regions. The polymorphic differences that define HLA molecules were found to be concentrated in the al and a2 domains of the HLA class I molecule and the al and B1 domains of the HLA class II molecule. Hypervariable regions within these domains were associated with the peptide binding groove itself, reflecting the function of polymorphism for HLA-restricted antigen presentation. The importance of the location of this polymorphism within the peptide 224

11: HLA typing methods

Figure 2. Cartoon depicting the simplified structure of HLA class I and class II molecules. Class ! molecules consist of a heavy alpha transmembrane chain in combination with a B2 microgtobulin light chain. Class II molecules consist of an a- and a B-transmembrane chain. In class I molecules the al and a2 domains form a peptide binding groove, whilst in class molecules this is formed by the u1 and (31 domains. In class ! molecules, the majority of sequence diversity is located mainly within the B1 domain. An estimate of the current number of alleles at each locus is also given.

binding groove determines both the sequence and conformation of peptidc bound within the groove of the HLA molecule (20). The nature of the polymorphisms in HLA genes is not generally one of unique point mutations distinguishing the different alleles. Rather, the range of sequence polymorphism has arisen through recombination or gene conversion events, mostly between alleles at the same locus (21), Therefore, at a given polymorphic position within the gene (or the expressed molecule), a particular sequence motif may be common to a number of different alleles. The combination of these sequence motifs along the length of the gene, or in the expressed molecule, determines the uniqueness of a particular allele. The specificities of reagents used for HLA typing, be they for detecting polymorphism serologically or at the DNA level, reflect the presence or absence of particular polymorphic motifs within the HLA sequence. In HLA, nearly all the polymorphic differences found at the DNA level correspond to sequence differences at an amino acid level. There are comparatively few silent polymorphisms, i.e. polymorphisms in the nucleotide sequence that do not code for a difference in the amino acid sequence. This

225

Pete Krausa and Michael Browning underlines the importance of polymorphism, probably being both evolved and maintained through selective pathogenic pressure (22), and this implies that those alleles which are maintained within a population confer some selective advantage.

2.2 Nomenclature HLA nomenclature has been an area of confusion to the non-specialist for many years. This is because different typing techniques (serological, biochemical, T-cell, and molecular biological methods) have each generated their own nomenclature. Each method presents a different perspective of HLA polymorphism: hence the same HLA specificity could have several different names depending on the method used for typing. However, over recent years, under the auspices of the World Health Organization (WHO), nomenclature for HLA (23) has been formalized on the basis of the DNA sequence of the respective HLA alleles, as described briefly below. Prior to the WHO nomenclature, the assignment of HLA specificities was based primarily upon serological definition. HLA specificities were named numerically, in conjunction with a letter designating the gene locus (e.g. A19; DR3). As an increasing array of sera were used and cells tested, so it became possible to split many of the initial specificities into a number of serologically defined antigens. Hence A19 could be split into A29, A30, A31, A32, A33, and A74, and DR3 could be split into DR17 and DR18. Additionally, the use of isoelectric focusing (IEF) could further split these serologically defined specificities into subtypes, and they were named by their serological specificity followed by a number (e.g. A2 could be subtyped by IEF into subtypes A2.1, A2.2, A2.3, A2.4, A2.5 (24)). Further confusion resulted from the requirement of yet another nomenclature for the definition of specificities determined through the T-cell recognition of allogeneic HLA, with particular reference to class II specificities (e.g. serologically defined DR4 could be subdivided into Dw4, Dw10, Dwl3, Dwl4, and Dwl5 by specific T-cell clones). This complex situation was resolved through the introduction of a nomenclature system based on the allelic definition of HLA specificities through the DNA sequence of their genes. This system requires that HLA alleles are identified by their gene locus in combination with a four-digit number: the first two digits relating to the specificity (mainly on the basis of serology), and the last two digits relating to the subtype number. Hence, A*0205 denotes the fifth HLA-A2 allele. A fifth digit has been introduced to allow a distinction to be made between alleles containing silent polymorphisms. Further digits have also been added where polymorphism has been identified in the non-coding regions of the HLA genes. This nomenclature, sanctioned by the World Health Organization, provides a common system against which HLA specificities can be named, both at the DNA level and for the molecules the HLA genes express. 226

11: HLA typing methods A list of HLA-A, -B, and -DR serological specificities (with their broad serological group specificities shown in brackets), is shown in Table 1. This table also lists the WHO nomenclature allele names corresponding to the serological specificities at these three HLA loci. Alleles that contain silent polymorphisms, named by five or more digits have not been included in this table. The table also lists a number of null alleles (described here as blanks), which contain polymorphisms that abrogate expression (for example, premature stop codons). These alleles have the letter 'N' included in their name,e.g.A*2409Af. It is recommended that the WHO nomenclature be used wherever possible. If the precise HLA subtype is not known, then the type can be described by the first couple of digits, e.g. A*24. If the exact subtype is known, then this should be used e.g. A*2402. The use of the correct nomenclature gives a better definition of the polymorphism found within a given HLA specificity.

2.3 HLA in populations The comparison of HLA types in different population groups has formed a major part of many HLA workshops (25). Such anthropological studies have utilized the extensive polymorphism found within the HLA system to characterize populations, and so highlight both similarities and differences between groups. The application of DNA-based approaches in such studies have further highlighted HLA population differences. Anthropological studies have also established profiles of population groups with regard to the diversity of alleles and their relative frequency. A particular HLA specificity may be present amongst a range of different populations, but may vary significantly in frequency in each population. For instance, A*01 is found in many populations, but it is present in low frequency in a number of Japanese and Thai populations, and in high frequency in Middle Eastern population groups (25). Additionally, certain HLA specificities are restricted within population groups, such as A*4301 being found only within some African populations and A*6901 found within certain Jewish and related population groups. Different populations will also have different levels of HLA diversity. Certain South American tribes contain a very limited number of HLA specificities. In contrast, many African and Asian population groups contain a large number of HLA specificities. Knowing the HLA profile of a population can be useful when interpreting results or searching for particular specificities. For example, HLA-A*02 subtypes found in an English population are different to those found in a Singapore Chinese population (26). The A*02 subtype found in an English individual would almost certainly be A*0201, whilst the Singapore Chinese A*02 would more likely be A*0207. Hence, if you wished to locate an individual who had A*0207, it would be prudent to screen a Chinese population group rather than a group of Western European 227

Table 1. A list of serological specificities for HLA-A, -B, and -DR and their corresponding allele groups as defined by the WHO nomenclature. Serological specificities in brackets ( ) denote the broad group within which a particular serological specificity belongs. Hence serlogical specificities HLA-A23 and -A24 are 'splits' of the broad serological group HLA-A9. HLA-A WHO serology nomenclature

HLA-B WHO serology nomenclature

HLA-DR WHO serology nomenclature

A1 A2 A3 A11 A23 (9) A24(9) A25(10) A26(10) A29(19) A30 A31 (19) A32(19) A33I19) A34(10) A43(10) A66(10) A68(28) A69(28) A74(19) A80 A blank

B7 B*0702-08 B8 B*0801-04 B13 B*1301-03 B15 B*1511 B*1522-236*1528-296*1533-38 B18 B*1801-03 627 B*2701-12 B35 B*3501-21 B37 B*3701-02 B38(16) B*3801-02 B39(16) B*3901-12 B40 B*4003-05684007-086*4011-12 B41 B*4101-02 842 B*4201 B44(12) B*4402-10 B45 (12) B*4501 B46 B*4601 B47 B*4701-02 B48 B*4801-03 B49(21) B*4901 B50(21) B*5001 B51 (5) B*5101-08 B52 (5) 8*5201 653 B*5301-02 B54 (22) B*5401 B55(22) B*5501-06

DR1 DR81*0101-04 DR3 DRB1*0306- 11 DR4 DRB1*0401-27 DR7 DRB1*701DR81*0703 DR8 DRB1*0801-19 DR9 DRB1*0901 DR10 DRB1*1001 DR11(5) DRB1*1101-31 DR12(5) DRB1*1201-05 DR13(6) DRB1*1301-33 DR14(6) DRB1*1401-31 DR-15(2) DRB1*1501-06 DR16(2) DRB1*1601-08 DR17(3) DRB1*0301 DRB1*0304-05 DR18(3) DRB 1*0302-03

A*0101-02 A*0201-26 A*0301-03N A*1 101-04 A*2301 A*2402-14 A*2501-02 A*2601-09 A*2901-03 A*3001-04 A*3101 A*3201-02 A*3301-02 A*3401-02 A* 4301 A*6601-03 A*6801-05 A*6901 A*7401-03 A*8001 A*0215N A*0303N A*2409N A*2411N

DR51

DRB5*0101-09 DRB5*0202-04

DR52

DRB3*0101-03 DRB3*0201-08 DRB3*0301-03

DR53

DRB4*0101-05

B56(22) B*5601-04 DR blank DRB4*0201N DRB4*0301N B57(17) 8*5701-04 B58(17) B85701-02 B59 B*5901 B60 (40) B*4001 B*4010 B61 (40) B*4002 B*4006 B*4009 B62 (15) B*1501 B*1504-08 B*1515 B*1520 B*1524-25 B*15278*1532 B63(15) B*1516-17 B64(14) B*1401 B65(14) B*14028*1403 B67 B*6701 B70 B*1509 B71(70) B*15108*1518 B72(70) B*1503 B73 B*7301 B75(15) B*15028*15028*1530-31 B76(15) B*1512 B*1514B*1519 B77(15) B*1513 B78 B*7801 B81 B*8101 B82 B*8201 B blank B*1526N

Pete Krausa and Michael Browning origin. Knowing the population background of a given individual is an important aspect of transplantation-matching between donor and recipient, particularly if the recipient is from a minority background. It can also be relevant in cellular assays, where matching is required for HLA restriction between effector and target cells.

3. Methods of HLA typing The remainder of this chapter will review some of the main methods currently applied to HLA typing. As already mentioned, it would be impossible to include full and detailed procedures due to the number of methods, and their complexity. However, this chapter describes the relevant aspects of each method discussed with regard to its performance and how it is best applied. References for each of the methods will provide more detailed information as to the performance of each assay. There are a great variety of approaches currently applied to HLA typing. Some of these methods, such as IEF (10), restriction fragment-length polymorphism analysis (RFLP) (27, 28), and heteroduplex analysis (29, 30), will not be discussed here. Although each of these methods has its merit for particular applications, they are normally used for gaining additional information (for example, in subtyping a known specificity) rather than for definitive HLA typing. The methods discussed below are those that are widely used and that provide a stand-alone means of determining HLA specificities. These methods include the serological definition of expressed HLA polymorphism, and the PCR-based analysis of the HLA genes by sequence-specific oligonucleotide probing (PCR-SSOP) (31, 32), sequence-specific primers (PCR-SSP) (33-35), and sequence-based typing (SET) (36-38).

4. Serological HLA typing HLA typing by serology detects polymorphism on HLA molecules expressed on the lymphocyte cell surface. The standard method for serological detection is the micro-lymphocytotoxicity assay (5). This assay involves testing the HLA molecules on lymphocytes against a panel of antisera or monoclonal antibodies, whose specificity for HLA polymorphism has been well characterized. If these antisera or monoclonals bind to the HLA molecules on the cell, they induce lysis in the presence of complement (see Figure 3). This requires the antisera to be of the appropriate class and subclass of immunoglobulin (IgGl, IgG3, IgM) for complement activation. The serological typing of HLA antigens has developed as a unique method used by specialized laboratories. A consequence of the development of this method has been the requirement for dedicated equipment (adapted fluorescence microscopes, Terasaki typing plates, Hamilton syringes), specific 230

11: HLA typing methods

FigureS, The components of the micro-lympnotoxicity assay are shown in this figure. Viable peripheral blood mononuclear cells (class I) or separated B cells (class II) are mixed with antisera of known HLA specificity. If antisera is bound to a cell (a), this mediates the activation of complement, which is added to the assay. Complement in the presence of the appropriate immunoglobulin class of antisera will puncture the cell (b). Dye can then enter the dead cell denoting a positive result (c), and this can be visually detected through an appropriate microscope. The absence of dye within the cell denotes a negative result and indicates that the specificity of the antisera is different to that expressed by the cells tested.

reagents (panels of highly characterized antisera, panels of highly characterized cell lines). Additionally, experienced technicians, knowledgeable in the use, characteristics, and specificity of HLA typing reagents are required to perform the assay successfully. For this reason, HLA typing has, for the main part, remained within the domain of the professional histocompatibility testing laboratory, Serological HLA typing has been the principal method for tissue-typing since the 1960s. It was first developed by Terasaki and McLelland in 1964 (5), and has been modified over the years (39). It remains the method of choice in many laboratories, although its current use is mostly restricted to HLA class I, since serological typing for HLA class II offers poor resolution, and is made more complex through several requirements additional to those for class I typing. These include the isolation of class II-expressing B cells from the peripheral blood mononuciear cell (PBMC) populations, and purging antisera of class I specificities. Class II typing is currently performed by PCR-based methods in most histocompatibility laboratories. A thorough description of all that serological typing entails would be beyond the scope of this chapter. What will be described here are the rudiments of the method, highlighting certain crucial points that must be addressed to successfully typing by serology. 231

Pete Krausa and Michael Browning The assay involves three main steps: (a) the preparation of component reagents, including the separation and storage of PBMCs; (b) the incubation of cells with sera and complement; and (c) the detection of cell lysis and the interpretation of results.

4.1 Preparation of components 4.1.1 Characterization and storage of antisera Panels of well-characterized antisera specific for antigenic polymorphic determinants on the HLA molecule are required to perform the test. The scope of reactivity of this panel of antisera should be sufficient to determine the majority of serologically defined specificities. Testing antisera against panels of well-characterized cell lines allows the antibody specificity to be determined, including cross-reactivity with more than one HLA type. The most useful cells in these characterization panels are those homozygous for specificities at each of the HLA loci, since they allow simpler interpretation of the HLA specificity for each of the antisera tested. Many of these cell lines are described in the proceedings of International HLA Workshops (40). In addition, antisera can be tested at various titres of dilution. Strong antisera may cause excessive cross-reactivity with several related antigenic specificities. Diluting the antisera may reveal a more definitive, and so useful, specificity for use in the antisera panel. Protocol 1. Preparing and storing typing plates Equipment and reagents • Frozen antisera (at -20°C to -40°C) of different known specificities, including a positive-control antiserum (e.g. a panspecific HLA antiserum) and a negativecontrol antiserum (AB serum)

• 60- or 72-well Terasaki typing plates (Robbins Scientific) . Light paraffin oil (0.83-0.86 g/ml at 20 °C, Biotest) . Hamilton syringes (Robbins Scientific)

Method 1. Ensure that the thawed sera are adequately mixed prior to adding them to the typing plates. 2. Add light paraffin oil to each of the wells of 60- or 72-well Terasaki typing plates. 3. Use a Hamilton syringe to shoot 1 ul (usually) of each antisera through the oil into the designated wells. Group sera with similar specificities together so that the layout of the sera on the plate allows the reaction patterns to be easily recognized, and hence the interpretation of the HLA type.

232

11: HLA typing methods 4. Include both a positive control (e.g. a pan-specific HLA antiserum) and a negative control (AB serum) on the typing plate. Additionally, use human AB sera in the wells immediately following a strong antisera, to limit carryover. 5. Record the content of each well. 6. Seal the plates and store frozen, again at -20°C to -40°C.

Plates can also be designed to offer a low level of resolution with a smaller panel of antisera, or a more extensive panel offering better resolution. Hence, a typing may be performed in a single plate, or in as many as 12 plates, depending on the size of the antisera panel. Additionally, the specificities tested for in a particular typing plate should reflect the population for which the typing plate will be used. Different populations will contain different distributions of HLA types, and the typing plate should address this point. It would be inappropriate to include an extensive number of sera specific for an HLA specificity rarely seen in a given population. The availability of good sera is decreasing as fewer laboratories are screening antisera. Prepared HLA typing plates are commercially available from a number of companies, therefore providing a useful resource of tested typing reagents. More recently, HLA-specific monoclonal antibodies have been introduced to serological typing. Whilst providing a renewable and consistent source of antibodies, in general they have not significantly improved the level of resolution that can be achieved by serology. 4.1.2 Complement The detection of antibody bound to the HLA molecules on the cell surface requires the addition of complement to the assay. Antibody bound to the cells will activate complement, causing cell lysis which can be recognized by the uptake of a dye into the cell. Rabbit serum is the usual source of complement for use in the lymphocytotoxicity test. The choice of complement, whether it is strong enough to cause sufficient lysis, or whether it has non-specific activity, is crucial to the assay. The following points should be noted. • Some batches of complement may be toxic to the cell causing non-specific lysis. This is usually due to the presence of unwanted antibodies in the serum containing the complement, which bind to the lymphocytes under test and cause lysis. This appears as a high background of cell death in the assay, making it difficult to interpret the results. • Each new batch of complement therefore needs to be screened at a number of dilutions, with a number of different sera titres, against cells for which the sera should be positive and negative. The complement should also be tested without the presence of specific antisera, to determine potential toxicity. 233

Pete Krausa and Michael Browning • A control screening should also be completed in which the complement is replaced with human AB serum. If a previously tested and good performing complement is available, then this should be included in the screening as a reference point. • A good complement should work well with a range of antisera strengths. The complement should produce a high percentage of cell death when the antiserum is positive for the cell, and minimal cell death when the antiserum is negative. Once a source of complement has been selected, it should be aliquoted into manageable volumes (dependent on the typing throughput) and stored frozen at -40°C to -70°C. Freeze-thawing complement should be avoided, as should leaving it too long at room temperature, since complement is heat labile. 4.1.3 Preparation of PBMCs for typing Lymphocytes separated from blood are the usual source of cells for testing in the lymphocytotoxicity assay. Because the basis of the method is a comparison of living to dead cells, it is important to ensure that the cells are of a high percentage viability prior to starting the assay. Using cells of poor viability will make interpretation in the assay difficult, through a high background of cell death. Additionally, platelets should be removed from the blood. Platelets express HLA class I antigens, and their presence in the assay reduces the amount of antibody available for binding to the HLA antigens expressed on lymphocytes. Platelets can be used for purging class I antibodies prior to screening antisera for class II specificities. Protocol 2. Lymphocyte isolation Note (a) It is usually advisable to perform the isolation under sterile conditions, particularly if the cells will be required for transformation into a cell line, or are required for functional studies. (b)This procedure should yield approximately 106 PMBCs per 10 ml of blood processed. Equipment and reagents Blood collection equipment Venous blood Sodium citrate or preservative free sodium Heparin, 1000 U/ul (0.3 ml per 20 ml blood) Centrifuge tubes For defibrination by sodium citrate (step 2a): 250 ml Erlenmeyer conical flask, 30 glass beads, 1 M CaCI2 • Orbital shaker (Innova 2000 New Brunswick Scientific)

234

Phosphate-buffered saline (PBS) pH 7.4 RPMI-1640 medium (optional) 50 ml Falcon tubes Ficoll density gradient (Lymphoprep, Nycomed) Plastic pastette Haemocytometer Trypan Blue for cell viability counting (see Chapter 1, Protocol 2)

11: HLA typing methods Method 1. Either collect the blood in sodium citrate (final concentration, 0.33% sodium citrate), or in heparin (10 U heparin per ml blood).a Keep the blood at room temperature prior to processing. Do not store the blood in the refrigerator at this point, as this can be deleterious to the cell viability. 2. Remove platelets from the blood by following either (a) or (b): (a) Spin the blood at low speed (150 g for 5 min) and remove the cloudy plasma supernatant, this will contain the majority of the platelets. Take great care not to disturb the buffy coat interface between the red cells and serum, as this is where most of the PBMCs will be found. Dilute the blood to two times the remaining volume. (b) Defibrinateb either citrated or freshly drawn blood by adding 25 ml of blood to a 250 ml Erlenmeyer conical flask containing approximately 30 3 mm glass beads. Mix the blood and beads on a orbital shaker.c If citrated blood is used, add 1 ml of 1 M calcium chloride to the blood immediately before shaking to ensure reversal of the anticoagulation. Make sure that freshly drawn blood is defibrinated immediately the blood is taken. Remove the fibrin clot containing the glass beads and platelets, then dilute the remaining blood to twice its original volume, either in PBS or in RPMI-1640 tissue culture medium. 3. Separate the PBMCs through a density gradient. To a 50 ml Falcon tube containing 15 ml of a Ficoll preparation (Lymphoprep, Nycomed) gently overlayd 30 ml of the diluted blood.e 4. Centrifuge at room temperature for 20 min at 500 g.f Use a plastic pastette to carefully transfer the PBMCs from the interface between the serum and Ficoll to a fresh 50 ml tube. Fill the tube to 50 ml with PBS, to wash out the Ficoll. 5. Centrifuge the 50 ml tube at 250 g for 10 min to pellet the recovered PBMCs. Resuspend the pellet in PBS and repeat the centrifugation. 6. Discard the supernatant and resuspend the cell pellet in an appropriate volume of PBS. Count the cells and check viability (see Chapter 1, Protocol 2), adjust to a viable cell concentration of 106/ml. * Heparin allows separated lymphocytes to be used in functional assays; sodium citrate does not. "Defibrination provides a more complete method of platelet removal than low-speed centrifugation. This causes the fibrin clot to form around the glass beads, drawing in the platelets and removing them from the remaining blood. d Careful overlaying is important as it maintains a good interface between the blood and Ficoll and improves the efficiency of separation. e Diluting the blood gives an easier and more efficient separation of PBMCs from the red cells and granulocytes when spun through the density gradient 'Following this spin, the PBMCs can be seen as a distinct layer at the interface between the diluted serum and Ficoll. The red blood cells can be seen in the bottom layer, below the Ficoll.

235

Pete Krausa and Michael Browning 4.1.4 Cryopreserving and recovering cells Separation of the PBMCs often provides more cells than are required for a single typing. The surplus cells can be stored frozen in liquid nitrogen, in aliquots of 2-3 X 106 cells. This allows a source of cells for any repeat or additional typing, or if the cells are to be used in a panel for screening antisera. Protocol 3.

Freezing and recovering PBMCs

Note: It is important to freeze the cells while they are viable and in good condition. This should therefore be done soon after the separation procedure. Equipment and reagents • PMBCs in PBS (see Protocol 2) • Freezing mix: either 90% heat-inactivated fetal calf serum (HIFCS), 10% DMSOa or RPMI-1640 (tissue culture media), HIFCS, and DMSOa in a ratio of 5:4:1, respectively • Commercial freezing container or a homemade box (pad the interior of a small, stout, cardboard specimen box with paper tissue, and make a polystyrene foam insert with holes suitable for the vials) Nunc/Nalgene

• Isopropanol • Cryopreservation vials suitable for storage in liquid nitrogen • Liquid nitrogen . 37 °C water bath . RPMI-1640 medium • 15 ml Falcon tubes . PBS pH 7.4

Method 1. Centrifuge the cells at 250 g for 5 min at room temperature and pour off the PBS. 2. Gently resuspend the cell pellet, on ice, with cold freezing mix (stored at 4°C) to give a concentration of 4-6 x 106 cells/ml. Transfer 0.5 ml aliquots into Cryopreservation vials and place them into the rack (or the polystyrene foam insert) of the freezing box. 3. Freeze the cells over a steady temperature gradient, approximately 1°C per min, by immersing the rack in isopropanol in the freezing box. Store in a -70°C freezer for 24 h. After this period, transfer the vials to liquid nitrogen storage.b 4. Remove a vial from liquid nitrogen and thaw rapidly by stirring in a 37°C water bath.c 5. When only a small ice crystal is left, immediately but slowly dilute the contents of the vial in about 5 ml of the RPMI-1640 mediumd in a 15 ml Falcon tube. 6. Add PBS to 15 ml and wash the cells to remove the DMSO, which is toxic to the cells. Repeat the wash as step 1 to ensure that all the DMSO is removed. Adjust the volume with PBS to achieve a cell concentration of about 106 cells/ml.

236

11: HLA typing methods 7. Use the recovered cells immediately. aThe DMSO prevents the formation of crystals within the frozen cell, which would cause lysis. 'The manner of cell freezing and subsequent recovery from liquid nitrogen is critical with regard to their viability. cRecovery is simple but needs to be done quickly to ensure viability. d Using medium will help to maximize cell viability.

4.2 The micro-lymphocytotoxicity assay As discussed, this assay detects HLA polymorphism, expressed on lymphocytes, through the specificity of a panel of antisera. Whether a particular antiserum has bound to the HLA antigen on the cell is detected by the addition of complement, which will cause cell lysis in the presence of bound antibody (see Figure 3). Cell lysis can be seen by the uptake of dye into the cell. If antibody is not bound to the HLA antigen, then complement will not be activated and the cell will remain viable. The assay is performed in 60- or 72-well Terasaki plates. Each of the wells contains one of a panel of antisera denning HLA specificities. The antisera are organized on the plate in such a way as to simplify interpretation. Scoring each reaction is simplified by counterstaining the viable cells. Viable cells can be stained with dyes such as Acridine Orange, which can cross the cell membrane. Under a fluorescence microscope, Acridine Orange will stain the viable cells green. Ethidium bromide can be used to stain dead cells; it can not enter the cell unless the membrane has been ruptured. Ethidium bromide will stain the cell red under a fluorescence microscope. Use of a quenching solution such as India ink will help to reduce background fluorescence, making the differentiation between viable and dead cells easier. If a fluorescence microscope is not available, other stains, such as eosin, can be used to estimate cell death. The results are determined from the reaction pattern observed with the panel of antisera of defined HLA specificity. Step-by-step details of the assay are given in the following protocol. Protocol 4. Micro-lymphocytotoxicity assay Equipment and reagents • Frozen Terasaki plates containing antisera (including negative and positive controls) and light mineral oil (see Protocol 7) « Lymphocytes or PMBCs at 106/ml • PBS • 50 (il/ml Acridine Orange in PBS • Hamilton syringes

• • • •

Light box Frozen complement (see Section 4.1.2} 100 ug/ml ethidium bromide in PBS Ink solution: ethidium bromide/black India ink (1:4 (v/v), respectively) • Fluorescence microscope

Method 1. Thaw the stored Terasaki plates containing antisera (see above). 2. Stain the required number of lymphocytes or PBMCs (at a con-

237

Pete Krausa and Michael Browning Protocol 4.

3.

4.

5.

6.

7.

Continued

centration of 106 cells/ml) by adding 5 ul of Acridine Orange to 1 ml of the cell suspension. Incubate for 5 min at room temperature, and wash the cells in PBS. Discard the supernatant and resuspend the cells to a concentration of 2 X 106 cells per ml. Add 1 ul of the stained cells to each of the wells in the Terasaki plates using a Hamilton syringe. Ensure that the cells are mixed with the antisera under the oil in each well. (A light box may be of assistance here.) Incubate at room temperature (21°C) for 30 min. Add 5 ul of thawed complementa to each well. Ensure that the complement combines with the cells and antisera in each well. Incubate for 1 h at room temperature (21°C). Add 1 ul of the ink solution to each well.b If the complement lysis is to be arrested, dilute the ethidium bromide in a 5% EDTA in PBS solution. NB. Ethidium Bromide is a carcinogen. Read the plates using a fluorescence microscope. Note the percentage of cell death above background (as determined with an AB serum, negative control). Also check the positive control, which should attain 100% cell death, to ensure the assay has been successfully completed. Record the results on to a record sheet which shows the specificity of the antisera in each well. Use a scoring systemc to record percentage lysis, e.g. 0 = negative, 1 = 10-20%, 2 = 21-40%, 4 = 41-60%, 6 = 61-80%, 8 = 81-100% and X = not tested or failed.

aComplement should not be kept too long at room temperature prior its use in this assay. b The ink acts to quench any surplus fluorescence making the staining of the cells easier to read. cThe scores placed against the panel specificities provide reactivity patterns, which when interpreted give the HLA type of the cells tested.

4.3 Discussion on serology The serological method outlined above is a well-established technique, and performed appropriately gives excellent results. The method, however, does require various skills and experience, namely in estimating cell death, knowing the performance of each antisera and the likelihood of cross-reactivity, and in the interpretation of reaction patterns. A knowledge of HLA frequencies in different population groups is also essential, since identification of a rare antigen in a given population may alert the serologist to misinterpretation, or the cross-reactivity of certain antisera. The effect of homozygosity upon the pattern of reaction also needs consideration, since having a 'double dose' of a particular antigen may cause cross-reactivity with certain antisera, and so again lead to misinterpretation. Serology also requires dedicated laboratory equipment and reagents. This together with the 238

11: HLA typing methods expertise, skill, and experience has contributed to serology and HLA typing becoming a specialist field. The level of resolution determined through serological typing does not truly reflect the level of polymorphism seen amongst HLA alleles. Serological typing simply cannot differentiate between many subtypes of a given HLA antigen, mainly since these are not in antibody accessible areas of the HLA molecule. Yet these regions of polymorphism, many of which are around the peptide binding groove, are relevant to the functioning of the HLA molecule (41). Successful determination of the HLA type by serology is dependent on the viability of the isolated PBMCs. This is a limitation of the assay, since it reduces the flexibility of performance of the method. Collected blood needs to be processed quickly, and isolated cells need to be stored in liquid nitrogen if they are not to be typed immediately. The use of methods that type HLA polymorphism from genomic DNA, remove many of the restrictions of using viable cells. The application of molecular biological approaches to HLA typing, initially for HLA class II specificities, and more recently for class I specificities, has allowed a greater resolution of HLA polymorphism. It has also meant a more standardized approach to HLA typing, using generic methods performed widely in many laboratories. The next three methods describe techniques which offer a much greater level of resolution than offered through serological typing. This is achieved in all three cases by the power of the polymerase chain reaction (PCR) and looking at polymorphism at the DNA level.

5. Molecular biological approaches to tissue typing PCR has been fundamental to a transition in HLA typing, from looking at polymorphism at the level of the expressed molecule to detecting polymorphism at a DNA level. This has allowed the examination of polymorphism in functionally relevant areas of the HLA molecule that are inaccessible to antibody definition. PCR allows the specific amplification of a region of the DNA, through cycles of DNA strand denaturation, primer annealing to the single-stranded DNA, and extension from the primer to form a new section of doublestranded DNA (11,12). This process of cycles of denaturation, annealing, and extension produces a large number of copies of a specific section of DNA, which provides a template that can be examined through the application of additional techniques. One technique includes probing the PCR amplification product (amplicon) with panels of sequence-specific oligonucleotides probes (PCR-SSOP). The probes detect polymorphic sequence motifs, and determine HLA types through hybridization patterns. Alternatively, the PCR product can be 239

Pete Krausa and Michael Browning analysed by direct sequencing. This sequence-based typing (SET) approach offers the highest level of resolution, since each base position within the PCRamplified polymorphic region of the gene can be considered. In a third technique, the PCR itself is used to define specific allele groups. This PCRSSP (sequence-specific primer) approach depends on the principle of the amplification refractory mutation system (ARMS) (42) for primer design, and relies on assembling a panel of PCR reactions, each specific for a particular allele or allele group. The HLA type is determined from the pattern of positive and negative PCR reactions. Each method has its advantages and disadvantages, especially in terms of speed, throughput, and interpretation. These three methods will be discussed in the remainder of the chapter. Since PCR forms the basis of all three techniques, certain important parameters will be discussed in the design and performance of the PCR reaction. For all molecular approaches to HLA typing, it is important that the specificity of the PCR primers and probes are checked against known HLA gene sequences at regular intervals (18, 19), to ensure that the specificity of the reactions is retained in the light of newly discovered HLA alleles.

6. The PCR reaction No single set of universal conditions can be applied to the PCR. A number of issues, such as the size of the resulting amplicon, the source of enzyme, the available PCR primer sites, and the make of thermocycler all contribute to the profile of the amplification protocol. In this section, certain key components of the PCR reaction will be considered.

6.1 Reagent composition The PCR reaction comprises a PCR buffer, dNTPs, primers, Tag enzyme, and target DNA. Each of these components can be critical to the success of the PCR reaction. Examples of these PCR components are given below. 6.1.1 PCR buffer This is usually made, or provided, at a 10 X concentration. It includes salt, a buffer to maintain pH, and magnesium chloride. Components such as glycerol, albumin, detergent, DMSO, and other additives can be included to help stabilize the reaction. Many of the components of the buffer are dependent on the particular requirements of the enzyme used. The addition of DMSO can help reduce the formation of secondary DNA structures which may affect the efficiency of the PCR reaction. All the reagents used in preparing buffers should be of Molecular Biology grade purity. Magnesium is an important component of the PCR with regard to the performance of the enzyme. The usual magnesium chloride concentration in a 240

11: HLA typing methods PCR reaction will be in the region of 1.0-3.0 mM. Titration of magnesium is recommended to identify the correct magnesium concentration for a particular PCR reaction. A typical 10 X PCR buffer recipe may include: • • • •

500 mM Tris base pH 8.0; 150 mM ammonium sulfate; 15 mM magnesium chloride; Triton X-100.

The 10 X buffer should be formulated in 50-100 ml volumes, filtersterilized through a 0.22 um filter, then dispensed into 1 ml aliquots and stored frozen. 6.1.2 DNA preparation A number of methods have been described for DNA preparation that do not require the use of phenol/chloroform. These methods follow a salting-out procedure (43) to extract DNA from both blood and cultured cells. The extracted DNA must be of sufficient purity and quantity for the PCR to be successful. DNA quality can be assessed on a spectrophotometer, by taking the ratio of optical densities at 260 and 280 nm. An OD260/280 of 1.7-2.1 normally indicates a DNA sample suitable for PCR. Quantity is more an issue for PCR-SSP, which requires more DNA template than either PCR-SSOP or SBT (although even with PCR-SSP, a full HLA typing can be performed with less than 20 ug DNA). There are many commercially available kits based on the salting-out approach. An example of one such kit is the Puregene DNA extraction kits (Gentra Systems). 6.1.3 Primer design The design of forward and reverse primers is based on complementation with DNA sequences of the target genes to yield PCR products of the desired specificity. Reference to HLA-DNA sequence databases are invaluable in the design of primers (18, 19). The level of specificity of the reaction will vary depending on the application to be used. For most PCR-SSOP and PCR-SBT purposes, locus-specific PCRs are used to generate template DNA for further analysis. For PCR-SSP, allele or allele group-specific PCRs are used to define HLA specificity. The design of highly specific PCR primers is discussed in more detail in Section 8.1.2. 6.1.4 PCR reaction mix As a guide, a typical 50 ul PCR reaction may comprise the following ingredients: • 10 X buffer • dNTP mix (mixture of 2.5 mM each dNTP) 241

5.0 ul 3.0 ul

Pete Krausa and Michael Browning • • • • •

Taq enzyme (5 U/ul) Forward primer (4 uM) Reverse primer (4 Genomic DNA (20 ng/ul) H2O

uM)

0.4 ul 5.0 ul 5.0 ul 10.0 u.1 21.6 ul

6.2 The PCR The PCR cycling parameters used for the PCR will vary according to the type of thermocycler used, the length of amplicon, and the requirement for specificity through annealing temperature stringency. 6.2.1 PCR cycling parameters An example of PCR cycling parameters is: • {95 °C for 20 sec, + 62 °C for 45 sec, + 72 °C for 2 minj for 30 cycles. At 95°C, the double-stranded DNA is denatured to single strands. At 62°C, the primers anneal to the single strands, and at 12°C, the enzyme using the dNTPs, extends from the primer to produce a second DNA strand. One approach used for thermal cycling is the 'step-down' or 'touch-down' PCR, in which the first few cycles of amplification are of high annealing stringency. Although the amplification at this point is relatively inefficient, this ensures that the initial amplicons generated are highly specific. In the subsequent rounds, the annealing temperature is lowered, allowing a more efficient, but less specific, PCR. However, because the first few cycles of amplification were so stringent, this enriches the PCR reaction with specific template for the subsequent rounds of PCR and so maintains the specificity of the reaction. The cycling parameters for a step-down PCR may resemble: • {95°C for 20 sec, + 65°C for 1 min, + 72°C for 2 min} 5 cycles; followed by: • {95°C for 20 sec, + 60°C for 1 min, + 72°C for 2 min} 15 cycles; followed by: • {95°C for 20 sec, + 55°C for 1 min, + 72°C for 2 min} 10 cycles. If the amplicon is short (about 200-500 bp), the extension time may be lowered to about 1 min. If the amplicon is in the region of 2 kb, it may be prudent to increase the extension time to 3 min. These are over-simplified guidelines, since the conditions for successful and specific amplifications are multifactorial. 6.2.2 PCR optimization The PCR must be optimized in order to achieve a reliable and robust set of conditions for routine use. An initial attempt at a PCR may provide the 242

11: HLA typing methods rationale for this optimization. Here are some suggestions for achieving a robust and specific amplification: • // the initial PCR is weak or negative, the PCR may be too stringent. This situation may be rectified by increasing any of the following: primer concentration, units of Taq, amount of DNA, or the number of cycles in the PCR. If the DNA concentration is already high, it may contain PCR inhibitors. These may be removed from the DNA by dilution, reprecipitation, or a purification step. The stringency may also be lowered by decreasing the annealing temperature. This should reflect the melting temperature of the primer. To check that all the components of the PCR are functional, a positive control reaction should be included. • If the PCR is non-specific, which can often be seen on an agarose gel as extra bands or smearing across a broad molecular weight range, then stringency may be too low. Lowering the primer concentration, units of Taq, the amount of DNA, or the number of PCR cycles may limit non-specificity. Increasing the annealing temperature will provide additional stringency, allowing greater specificity. The specificity of each primer should also be considered and checked against known sequences, as other related genes (including HLA pseudogenes) may be amplified. Non-specificity may also be caused by DNA contamination. This can be identified by including a negative control in which water is added to the PCR instead of DNA. • Additional optimization can be achieved, by titrating the magnesium concentration (as mentioned above), salt concentration in the buffer, Taq concentration, and DNA concentration. Trying a range of pH in the buffer is another point of optimization. Having generated a PCR template, it now remains to identify the polymorphism. The PCR can be probed using oligonucleotides specific for a known polymorphism; the template can be sequenced using nested sequencing primers; or the PCR itself can be highly specific, defining polymorphism by the presence or absence of an amplification product. These methods of detection will be described below.

7.

Detection by oligonucleotide probing (PCR-SSOP)

Detection of polymorphism by oligonucleotide probing has been a wellestablished method for HLA typing (13). The method was quickly adopted in response to the poor resolution and technical difficulties met in performing HLA class II typing by serology. PCR-SSOP for class II (44-46) marked the first real and popular use of PCR for HLA typing. The strategy for PCR-SSOP is straightforward (see Figure 4A). A specific PCR product (usually based on a gene locus-specific reaction) is blotted on to a membrane support. An oligonucleotide probe, with specificity for a particular sequence motif potentially found within the amplicon, will bind to 243

Pete Krausa and Michael Browning

Figure4. (A) PCR-SSOP describes the probing of specifically PCR-amplified DNA with labelled sequence-specific oligonucleotides. PCR-amplified DNA is fixed to a nylon membrane through UV crosslinking. Labelled probes are then hybridized with the DNA on the membrane. The membranes are then washed to an appropriate stringency, to remove false hybridization. Detection of hybridization is through the labelled probe. Chromogenic detection involves mainly biotin-labelled probes which bind with a streptavidin/horseradish peroxidase ligand, the latter can then react with an appropriate substrate causing a colour change to indicate hybridization on the membrane. With chemiluminescence labelled probes, in which the label can be reacted to emit light, the signal is detected on an autoradiograph. (B). The reverse dot blot is an alternative technique to PCR-SSOP. Instead of DNA being fixed, the SSOP is immobilized on to the membrane. This has the advantage that several different SSOP hybridizations can be performed simultaneously on the same membrane, hence allowing a sample to be typed against all the probes on a single membrane. Detection is through a labelled primer in the initial PCR reaction. The labelled PCR product, bound to the SSOP on the membrane, can then be detected, usually through a chromogenic approach.

the PCR on the membrane if it contains the designated polymorphism. If the polymorphism is not present, then the probe will fail to bind. Whether the probe has hybridized with the PCR product or not will be reported by a label on the probe. The standard PCR-SSOP method sounds simple in theory, but to attain a usable typing requires an extensive number of probing events, due to the sharing of many polymorphic sequence motifs between multiple alleles at a 244

11: HLA typing methods single HLA locus. It is largely the unique pattern of such motifs, rather than unique polymorphic sites, that defines a particular allele or allele group. The interpretation of the reaction pattern generated by the panel of probes often requires computer software, but the software may be unable to distinguish certain allele combinations, leading to possible ambiguities in the typing. However, the method can be scaled up for high throughput. Each membrane can accommodate 96 or more blots of PCR product. Hence, each hybridization event can simultaneously test a large number of samples. Because of the large number of hybridization events required to reach a typing, the process of PCR-SSOP may take several days. However, on completion, typing information on a large number of samples can be simultaneously generated. This method therefore suits the high-throughput laboratory, in which the typing results are not required instantly. An alternative PCR-SSOP approach, which can deliver a rapid typing, is the reverse dot-blot technique (45, 47, 48) (see Figure 4B). Instead of the target DNA being immobilized on to the membrane or support, an array of probes are attached. The target PCR template is hybridized against this panel of immobilized probes. The reporting label is incorporated into the template during the PCR reaction through the primer. Hence, a single sample can be tested against a panel of probes on a single membrane. This approach forms the basis of many commercial kits. The majority of laboratories use non-isotopic methods for detecting hybridization. Biotin-streptavidin labelled probes provided a colour detection system using horseradish peroxidase as the substrate. Light-emitting substrates such as DIG (Boehringer Mannheim) and ECL (Amersham) can also been incorporated, which, similar to a radioactive label, will leave an image on autoradiographic film.

7.1 PCR-SSOP protocols There are numerous protocols described for PCR-SSOP. This section will provide a brief outline of the basic protocol, with some of the pertinent points for performing PCR-SSOP. 7.1.1 DNA preparation and PCR amplification The preparation of the DNA and PCR product have been covered in Section 6.1.2. As ever, it is important to obtain good-quality DNA using a wellestablished and reliable procedure. It is also important to ensure that the DNA is quantified to ensure consistency in the procedure and equivalent amplification within the PCR. The PCR should be checked for successful amplification by running out 5 ul of the amplicon on a 2% agarose gel in 0.5 X TBE buffer, stained with ethidium bromide (1 ul ethidium bromide at 10 mg/ml per 100 ml of agarose gel). The inclusion of a size standard should further confirm the product. The gel should be used as a guide to ensure that 245

Pete Krausa and Michael Browning equivalent quantities of product are blotted on to the membranes. There should be enough amplicon to ensure that the required number of hybridizations can be performed, as determined by the number of defining probes. 7.1.2 Membrane preparation and sample blotting A sufficient number of membranes should be prepared, since PCR-SSOP HLA typing requires hybridizations with an extensive panel of oligonucleotide probes. Some protocols can reuse membranes by stripping off any bound oligonucleotide, and this should be considered in estimating the number of membranes required. Protocol 5.

PCR-SSOP procedure

Equipment and reagents • PCR products • Positively charged membranes (HybondN+, Amersham) . Denaturing solution (e.g. 0.4 M NaOH)

• Neutralizing solution (e.g. 1 x SSPE: 150 mM NaCI, 10 mM NaP04, 10 mM EDTA pH 7.4) . UV crosslinker model A1000, UVP

Method 1. Spot 2-3 ul of each PCR product on to a number of membranes (each membrane can be blotted with multiple samples), and include the appropriate controls.a 2. Allow the membranes to air dry, then place them in the denaturing solution for 10-15 min. 3. Wash the membranes in the neutralizing solution for 1 min. Use a UV crosslinker at the prescribed setting to fix the single-stranded PCR template to the membrane. aThe use of dot-blot or slot-blot apparatus can also aid in applying the PCR product to the membrane. This apparatus draws the PCR amplicon on to a defined area of the membrane by the application of a vacuum to the reverse surface of the membrane.

7.1.3 Hybridization Protocol 6 does not consider the use of radiolabelled probes, since alternative and less hazardous detection methods now exist. Biotinylated oligonucleotide probes offer a number of alternative methods of detection. Oligonucleotides can also be labelled using the DIG-11-ddUTP labelling kit (Boehringer Mannheim). If the oligonucleotide is biotinylated at the 5' end, this still leaves the option for 3' labelling with DIG-11-ddUTP. The oligonucleotide probes should span the polymorphic motif they are to detect, and should be designed to have appropriate hybridization temperatures as determined by their G/C and A/T content. (The melting temperature of an oligonucleotide probe or 246

11: HLA typing methods primer can be roughly calculated by assigning 4°C to each C or G base, and 2°C to each A or T base (49)). Oligonucleotide probes in many of the described methods are in the region of 17-21 nucleotides in length. Many methods describe the use of tetramethylammonium chloride (TMAC) in the hybridization solution (50). This reduces the influence of the G/C content in the oligonucleotide on the hybridization temperature, and instead makes it a function of oligonucleotide length (51). This will potentially reduce the number of different hybridization temperatures, so simplifying the protocol. TMAC is however toxic, and some laboratories avoid its use on this basis. Protocol 6. Hybridization Equipment and reagents • Hybridization buffer: for example, 50 mM Tris-HCI pH 8.0, 2 mM EDTA; 5 x Denhart's solution, 0.1% SDS, and optional 3 M TMAC

• Oligonucleotide probes . Wash solution: 2 x SSPE, 0.1% SDS; optional 3 M TMAC

Method 1. Perform a 30-min, pre-hybridization incubation in hybridization buffer at 42°C-54°C.a 2. Add oligonucleotide probes (2 pM/ul) to the hybridization buffer and membrane (see Protocol 5), and hybridize by incubating for an additional 1-4 h at the appropriate temperature. 3. Wash the membranes one or more times with the wash solution, using gentle agitation, to remove excess probe. aThe temperature varies according to the protocol followed. b Increasing the stringency of washes can be used to enhance the specificity to the hybridization event. Hybridization buffers, and the various washing solutions, have been described in a number of different protocols (52, 53). The hybridizations and washes are often performed in dedicated ovens in which several hybridization bottles can be rotated at the required temperature. The stringent washes must be performed at the correct temperature relative to the probe used. A lack of stringency (i.e. too low a temperature) will introduce falsepositive hybridizations, while being too stringent (i.e. too high a temperature) will lead to falsenegatives.

7.1.4 Detection The detection method is determined by the label used. Many laboratories that use PCR-SSOP for high-throughput screening have moved away from radioactive labelling. The alternative non-radioactive methods are based on either detection by chromogenic development or induction of chemiluminescence. For biotin-labelled probes, the use of a streptavidin conjugated with biotinylated horseradish peroxidase provides the means for both colour detection 247

Pete Krausa and Michael Browning using an appropriate chromogenic substrate (e.g. nitroblue tetrazolium salt in the presence of hydrogen peroxide) or chemiluminescence using the ECL kit available from Amersham. DIG-labelled probes can also be used for both chromogenic and chemiluminescence detection, both of which require the use of an anti-DIG-alkaline phosphatase conjugate (available from Boehringer). For non-radioactive detection methods it is important to block the membrane using the appropriate reagent recommended for the particular detection method. It is also important to stop the chromogenic colour development using the recommended stop solution once the required level of signal is reached. This can take anything from 1 h to overnight (16 h). Chemiluminescence detection offers more flexibility. Detection is similar to radioactive methods since the membrane is exposed on an autoradiograph film, usually in a matter of min. If the film is overexposed, the membrane can simply be exposed again for a shorter time. This is an advantage over the chromogenic approach, for which overdevelopment requires reprobing. 7.1.5 Analysis Once all the probes have been tested for a given sample, the results require scoring to assess positive and negative hybridization events. This is why it is important to include a positive and negative control for each probe, against which the test samples can be compared. Some estimate of the signal strength should be made for assessing the hybridization result. A scoring system which indicates definitely negative, weak but probably negative, indefinite, weak but probably positive, and definitely positive should be implemented. Analysis of the data generated using PCR-SSOP can be a considerable task. Interpretation of the hybridization pattern for each sample, generated from an extensive panel of probes often requires the application of software analysis based on known HLA sequence data. Certain heterozygous combinations will produce ambiguous results, which may require an additional PCR-SSOP assay for resolution. The level of resolution possible will depend on the number and specificity of the oligonucleotide probes used and also the specificity of the initial PCR.

7.2 PCR-SSOP discussion PCR-SSOP has been extensively used for class II typing, but over recent years it has been increasingly applied to class I loci. It is not a procedure suitable for the casual HLA typing of only a small number of samples, but it is a good method for the laboratory with a large sample throughput which is not restricted by time limitations. Such laboratories may be involved in largevolume registry screening for bone-marrow donors or population typing in anthropological studies. An alternative PCR-SSOP strategy, which caters for a small sample volume, 248

11: HLA typing methods is the reverse dot-blot technique. Standard PCR-SSOP has multiple PCR test samples attached to a number of replicate membranes. In comparison, the reverse dot-blot has multiple probes attached to a single membrane (48,54) or attached within the wells of a 96-well plate (45). The membrane is then hybridized with a single PCR sample. A single membrane can therefore be used for typing a given sample. This approach is commercially available as a kit. The two PCR-SSOP approaches facilitate either high throughput or single typings.

8. HLA typing by PCR-SSP HLA typing by PCR-SSOP uses a broadly (usually locus) specific PCR which provides a template for specific oligonucleotide probing. PCR-SSP removes the need for oligonucleotide probing by putting the burden of specificity totally within the PCR amplification. Therefore, PCR-SSP achieves discrimination through a panel of highly specific PCR amplifications. To perform PCR-SSP, several issues require attention. The PCR reactions need to be performed simultaneously under a single set of conditions. The primers used for PCR-SSP are designed using the ARMS principle (42) (see below). Each primer has to be carefully designed to give the required specificity, and subsequently validated in test PCR. Each PCR has also to be controlled to ensure that the PCR amplification has worked. This is achieved through the incorporation of an internal positive control PCR within each reaction. This internal control should amplify with all samples tested (in other words, it should be based on a ubiquitous, monomorphic DNA sequence). PCR-SSP typing was first applied to class II specificities (33, 55-57), but it was quickly used to develop typing methods for HLA-A (35,58), HLA-C (59, 60), and finally HLA-B (34, 61). The use of PCR-SSP provided the first real application of a standard molecular approach across both class I and class II loci. Following development of the technique at each locus, Bunce et al. combined the methods into a single five-locus assay providing medium resolution for HLA-A, -B, -C, DRB, and DQA (62). This section of the chapter will broadly describe this approach. In addition, methods that deliver a higher resolution using nested PCR (26, 35, 63) will also be described.

8.1 Five-locus determination PCR-SSP—phototyping The method, as first described (62), involves simultaneously performing 144 PCR reactions, each PCR reaction having specificity for a given group of alleles. This includes 25 reactions specific for HLA-A, 56 reactions for HLA-B, 23 reactions defining HLA-C, 31 reactions for HLA-DRB, and 9 reactions for HLA-DQA. Ideally, each specificity should be determined by at least two reactions in the panel. This diminishes the chances that a reaction failure will compromise a typing result being reached. Interpretation of the data is simple 249

Pete Krausa and Michael Browning and straightforward. The presence or absence of a particular allele group is determined by the presence or absence of a positive PCR amplification for each specificity tested. This can be assessed by electrophoresis of the PCR amplicons on an agarose gel. Because of the specificity of the primers, the size of PCR product generated by each reaction can be calculated. Gauging the size of the product using an appropriate size standard adds an additional level of confidence to interpretation of the presence and specificity of each PCR amplicon. The panel of PCR reactions used for phototyping produces data which requires interpretation in a similar fashion to that obtained through serological typing. Many of the HLA specificities are identified through their pattern of reactivities with the PCR panel, since many of the reactions identify a group of specificities, similar to the cross-reactive serological specificities of antisera. The nature of HLA polymorphism, and its concentration within exons 2 and 3 for class I and exon 2 for class II, determines both the size of the amplicon and restricts the possible primer sites and combinations. The majority of polymorphisms at a given position within the sequence are shared amongst several alleles, and an allele's uniqueness is determined by the combination of polymorphisms along the length of its sequence. This limits the possible sites for PCR primers and the combinations in which they can be used together. However, it usually means that the same primer can be used in a number of different combinations to define different specificities. Many of the considerations for performing specific PCR amplifications are considered in the previous general PCR section. However, it must be stressed that each primer and reaction needs to be validated, to ensure that all reactions deliver the required specificity under the conditions used in the PCR. The one perceived limiting step in PCR-SSP typing is the requirement for performing a large number of simultaneous PCRs per sample, and then having to visualize the PCR products on an agarose gel. This has been addressed by the use of the 96-well plate format. The 96-well microtitre plates must be suitable for use with the intended thermocycler. By employing multichannel pipettes together with pre-prepared plates containing primer mixes, the PCR reaction can be assembled quickly. At the other end of the reaction, the gel step is again made easier by using dedicated gel tanks, which allow direct loading of samples from the plate into the gel using a multichannel pipette. This means that multiple reactions can be quickly loaded. As an example, three 96-well plates can be loaded on to a gel and run out in under 30 min. Below is a brief description of the protocol, which should be used in conjunction with the published method (62). There are also a number of observations that highlight certain important issues in performing the assay. 8.1.1 DNA preparation As in all the molecular methods described, good DNA quality is an important requirement for this assay. If the DNA extraction step fails to produce a 250

11: HLA typing methods relatively clean preparation, certain of the contaminants (e.g. haemoglobin if the DNA is prepared from blood) can have an adverse effect on any attempted amplification. It is sometimes possible to dilute out this inhibitory effect. As mentioned above, there are currently several good methods available for DNA preparation, which should be considered. Additionally, since PCR-SSP often requires a substantive number of PCR amplifications, it is important to ensure sufficient DNA is available to complete the assay. If 144 reactions are being performed, and 50 ng of DNA is required per amplification, then a minimum of 7.2 u,g is required to perform the typing. It is also important to ensure the DNA is adequately mixed so that equivalent quantities are added to each reaction. If insufficient DNA is available to perform PCR-SSP, it may be possible to generate a locus-specific PCR that can be used as the template for typing (35). This application of nested PCR will be considered in more detail later in this chapter. 8.1.2 Primer design The design of primers is based upon the amplification refractory mutation system (ARMS) principle (42). This principle holds the key to specificity within the PCR-SSP assay. In the PCR amplification, extension takes place from the 3' end of the primer. Hence, if the polymorphism against which the primer holds specificity is located at the 3' end of the primer sequence, under the appropriate levels of stringency, extension will only be permitted when the primer and template are matched at this position. A mismatch at the primer 3'end residue will inhibit extension and so cause the PCR to fail. Only one of the primers in the PCR needs be mismatched for amplification to fail (see Figure 5).

Figures. PCR-SSP requires highly specific PCR reactions to discriminate between different HLA types. This is achieved through ARMS, in which a 3' mismatch with the SSP inhibits amplification. For amplification to occur under the appropriate PCR stringency, both SSPs need to be matched at their 3' residues with their target template. Hence, in the figure, although the SSP binding to the cis DNA strand is matched, and extension is possible, a 3' mismatch on the SSP binding to the trans strand inhibits extension, so causing the PCR reaction to fail.

251

Pete Krausa and Michael Browning The presence or absence of a polymorphism in a given sequence can therefore be determined by the presence or absence of a specific PCR amplification. In addition to primer specificity, the melting temperature of the primers and the annealing temperature in the PCR are critical for successful PCR-SSP. In order to function optimally under a single set of conditions, the primers should all be designed to have similar melting temperatures (Tm). In most of the published systems, the Tm (49) of the primers is between 60 and 62 °C, giving primer lengths in the broad range of 17 to 21 bases. If the primers are correctly designed, and the conditions of the PCR are optimal, PCR-SSP is capable of distinguishing HLA alleles that differ by a single base pair. 8.1.3 Preparation and storage of 96-well PCR-SSP typing plates Plates containing validated primer mixes can be pre-aliquoted prior to use. From a reservoir plate, a substantive number of typing plates can be prepared using a multitrack pipette, or simultaneous 96-well dispensing is possible using equipment like the Robbins Hydra (Robbins Scientific). The primer mix can be stored under oil in each well to prevent drying out. Alternatively, the plates may be purposely dried out and rehydrated by adding the remaining reaction components prior to performing the PCR. Hundreds of such preprepared plates can be stored frozen for several months. It is advisable to label the plates to establish both the orientation of primer mix order, a reference to the plate's content, and its age. 8.1.4 Assembling the PCR Depending upon the number of amplifications in the PCR panel, a mix containing DNA and the remaining components of the PCR can be assembled. For a 13 ul PCR reaction volume, if the primer pre-aliquoted into the plates represents 5 ul of the reaction, then all the other components (consisting of PCR buffer, magnesium chloride, dNTP mix, Taq enzyme, internal control reaction primers, and DNA) can be assembled to provide the remaining 8 ul. Sufficient stock of this 8 ul mixture should be made up to add to all the primer mixes. This can quickly be dispensed across the plate of primer mixes, again using multitrack pipettes. Spinning the plates ensures that the PCR mix is combined with the primers. The composition of the PCR mix is considered earlier in this chapter and also detailed in a number of PCR-SSP papers (33, 35, 62, 64)). A sample protocol is given below as an example (see Protocol 7). 8.1.5 PCR-SSP thermal cycling As mentioned earlier in this chapter, the use of a step-down (also called touch-down) PCR amplification introduces both specificity and efficiency into the PCR amplification. The cycling conditions denoted earlier (see Section 6.2.1) should prove appropriate for use with an extended panel of primers. However, depending on the model of thermocycler used, minor modifications to the protocol may be required. If the reactions are to be performed free of 252

11: HLA typing methods oil, then a thermocycler fitted with a heated lid is required to prevent evaporation of the amplification product. Protocol 7.

Assembling the PCR

The following method describes the assembly of a typing panel of PCR, using 13 ul PCR Equipment and reagents • Forward and reverse primers • 96-well PCR plates (PE-Biosystems Robbins Scientific) • Light mineral oil • Plate holder (PE-Biosystems)

or

• Thermocycler (PE-Biosystems) . PCR mix (per 8 ul): 1 x PCR buffer, 1-3 mM magnesium chloride, 200 uM each of 4 dNTPs, internal control primers, 0.25 U Taq polymerase, 0.01-0.1 ug DNA

Method 1. Dispense 2.5 ul of forward and 2.5 ul of reverse primer into the appropriate wells of a 96-well PCR plate. Overlay with a drop (10 ul) of mineral oil.a 2. Dispense 8 ul of the primer mix per well under the oil phase. Spin the plate (150 g for 15 sec) to ensure adequate mixing of the reagents. 3. Place the plate in the thermocycler. Run the PCR for 30 cycles, consisting of: • 1 min hold at 96°C; • {30 sec at 96°C, 45 sec at 70°C, 45 sec at 72°C} for 5 cycles; • {30 sec at 96°C, 45 sec at 65°C, 45 sec at 72°C} for 20 cycles; • {30 sec at 96°C, 60 sec at 55°C, 60 sec at 72°C} for 5 cycles a

At this stage the plates can be frozen down for later use.

8.1.6 Detection of amplification products Following the PCR, it is necessary to determine which reactions are positive and which are negative. This can be achieved by electrophoresis of the PCR panel products on an agarose gel. The presence of an internal control reaction product in each PCR validates the amplification reaction. In assessing the reaction results, it is necessary to establish which reactions have failed, as determined through the absence of the positive control product. If a lane on a gel is blank, with no product seen in either the specific or control position, then this PCR must be marked as a fail. If the amplicon size differs from that expected, then this must be viewed as a false-positive and the result discounted. If the specific PCR is present, but the positive control band is absent, then this should be marked as a positive. The purpose of the positive 253

Pete Krausa and Michael Browning control is to ensure that the components of the PCR are present sufficient to allow amplification, so ensuring against false-negatives. The presence of a specific product still confirms the competence of the PCR, and suggests that the specific reaction has outcompeted the control, which is, in fact, the preferred situation. Protocol 8.

Electrophoresis of PCR-SSP amplicons

Equipment and reagents • 10 x loading buffer: Bromophenol Blue, • Gel and flatbed electrophoresis apparatus Xylene Cyanol Blue in 50% glycerol in appropriate for running a large number of water (Sigma) PCR amplicons • Multitrack pipette • Plata holder (PE-Biosystems) • 2% agarose gel • Size standard ampusize 50-2000 bp . 10 x TBE buffer (1L 10 x TBE 108 g Tris (Biorad) base 54 g Boric acid 40 ml 0.5 M EDTA . UVtransilluminator water to 1L) • 10 mg/ml ethidium bromide

Method 1. Add 2 ul of the 10 x loading buffer to each reaction well in the plate. Spin the plates at 150 g for 15 sec to ensure the loading buffer and amplification product are combined. 2. Prepare a 2% agarose gel in 0.5 X TBE buffer (diluted from 10 x TBE) containing 1 ul ethidium bromide/100 ml gel. Space the wells in the gel so they are compatible with loading directly from the 96-well plate using a multitrack pipette.a Load half of the PCR/loading buffer volume as this provides the opportunity of a repeat loading should anything go amiss on the first electrophoresis run. 3. Run the electrophoresis in 0.5 x TBE containing ethidium bromide at the same concentration as the agarose gel (step 2). 4. Once loaded, electrophorese the products sufficiently to ensure that a good size determination of positive and control amplicons is possible.b For this reason, make sure you include a size standard, since the size of both the specific and control amplicons is known. View the gel using a UV transilluminator and take a record of the image. 5. Determine the results by the presence or absence of the appropriately sized product on the gel. Record the results on to a sheet detailing the specificity of each reaction, and then resolve the type by interpreting the reactivity pattern obtained with the PCR panel specificity. * Employing a multitrack pipette with the appropriate gel ensures that a large number of products can be quickly loaded, which is essential with this extensive panel of 144 PCR products. b Running the gel at 10 V/cm generally gives good separation, although higher voltages may be used to speed up the electrophoretic separation of the products.

254

11:HLA typing methods

Figure6. An example of an HLA PCR-SSP phototype. 144 PCR-SSP reactions are run simultaneously, encompassing HLA-A, -B, -C, -DRBT, -DRB3, -DRB4, -DRB5, and -DOB1 genes. Interpretation is reached through the presence or absence of the appropriately sized bands for each reaction following agarose gel electrophoresis. The common band present in each lane represents an internal control, which validates the PCR conditions. The sample types as A*03(3), A*2301 (5, 6), Bw4 (26), Bw6(27), B*38(47, 48), B*7518(70, 71, 72), Cw*Q4 (85), Cw*Q704 (92), DRB1*030V4 (109, 110, 126), DRB1*04 (112), DRB3*02Q1 (132, 133), DRB4*07 (134), DOB1*02 (137), DOB1*0302 (143). The figures in brackets denote the reaction number defining the specificity. [Reproduced, with permission, of M. Bunce, Oxford Transplant Centre, Churchill Hospital, Oxford, UK.)

8.1.7 Interpretation of results The HLA type at each locus can be determined from the pattern of reactivity obtained with the panel of PCR reactions. Figure 6 shows a gel upon which the panel of reactions has been run. From this gel, the positive, negative, or failed reactions can be assessed and noted. The results can then be interpreted by knowing the specificity of each reaction. As a simple example, if a sample is positive with a PCR denoting A*23 and A*24, but negative with an A*24specific PCR, the type will be determined as A*23. As with other techniques, it is important that each reaction be reassessed periodically, with reference to newly identified HLA alleles, to ensure its specificity within the known HLA alleles. This includes HLA alleles at other loci and HLA pseudogenes. The results obtained with the panel of 144 reaction described by Bunce et al. (62) offers low- to medium-level resolution. It is important to appreciate that this method represents the first practical approach to typing at multiple class I and II loci, and does not fully reach the level of resolution possible by PCR-SSP. Since the paper was published, additional reactions have been added to improve resolution and to address the increasing number of alleles identified at each HLA locus, 255

Pete Krausa and Michael Browning Higher resolution typing has been demonstrated through the incorporation of additional reactions and the use of nested PCR. This will be described below with particular reference to the HLA-A locus.

8.2 High-resolution PCR-SSP typing Typing resolution at the level of the allele is possible through the discrimination of ARMS PCR. As noted previously, many polymorphic motifs are shared between HLA alleles. This lack of unique polymorphic differences between alleles effectively reduces the number of polymorphic sites that can be used to define an allele group, as a result of potential cross-reactivity with other specificities. Nested PCR can help eliminate this effect, by removing the interference of a group of potentially cross-reactive alleles from a typing. This is achieved by performing an initial PCR which amplifies only those alleles of interest, and which flanks the primer sites required for determining the individual alleles within the amplified group. This has been demonstrated for typing at the HLA-A locus, where allelic discrimination was reached through a combination of one-step PCR with additional PCR reactions using nested primers (35). This method has also been successfully applied to typing HLAA*02 alleles (26), which represent a polymorphic and high-frequency group found in a wide number of population groups, in addition to other HLA specificities, such as HLA-A*30 (63). 8.2.1 Method for nested typing Protocol 9.

Nested PCR-SSP

Equipment and reagents • As Protocol 8

Method 1. Identify the appropriate polymorphic sites and design the primers needed for the first- and second-round PCR. Perform the initial 'group specific' PCR, generating the DNA template for the subtyping reactions, under the same PCR conditions as described above (see Section 6.2.1). Make sure the primer combination will deliver a PCR product that captures sequence polymorphisms, which can be used to define the differences between the alleles amplified in the first-round reaction.a 2. Perform an initial 30-cycle PCR. Then electophorese 5 ul of the amplification product, in the appropriate loading buffer, in a 2% agarose gel in 0.5 x TBE buffer containing ethidium bromide, to verify that the PCR product is of the expected size, and the amplification is sufficiently robust.

256

11: HLA typing methods 3. Dilute the templateb and reduce the number of cycles in the PCR to ensure fidelity within the nested PCR. 4. Use the diluted PCR template with the panel of PCR-SSP reactions defining the subtypes, at 1 ul of this diluted template per 10 ul of the final PCR volume (i.e. 2.5 ul of diluted template in a PCR whose final volume is 25 ul). 5. Store the panel of subtyping PCR mixes frozen under oil in 96-well plates, if desired (see Section 8.1.3). 6. Add the diluted template to each reaction well of the subtyping panel, and spin the plates at 150 g for 15 sec, to ensure the template and reaction mix are combined. 7. Run the PCR through a reduced number of PCR cycles, as made possible through the level of dilution of the initial PCR; typically we have used a 15-cycle PCR, as follows: • {96°C for 20 sec, 60°C for 50 sec, 72°C for 45 sec} for 10 cycles; • {96°C for 20 sec, 55°C for 1 min, 72°C for 45 sec} for 5 cycles; • hold at 4°C. 8. After cycling is complete, visualize the PCR products on an agarose gel (see Protocol 8). Determine the HLA type by comparing the presence or absence of amplicons of expected size against the specificity of the PCR panel.c aFor example, for subtyping HLA-A*02, the initial PCR amplified all A*02 alleles, spanning from the 5' region of exon 2 to the 3' end of exon 3, and covering all the relevant polymorphisms found in those two exons. This PCR product provided the material upon which a panel of second-round PCR reactions, defining these polymorphic differences, was applied. bThe initial PCR generates a large number of copies of the amplified gene fragment. To use this template undiluted in the same number of PCR cycles as in the first-round amplification would generate false-positives, simply through the effect of having such excess of template in the reaction. The PCR product is normally diluted 1 in 100 using dH2O (5 ul of PCR in 495 ul dH2O). If the PCR is weak, then a lower dilution, for instance 1 in 20 or even 1 in 5, can be used, as judged by the intensity of the band on the agarose gel. cIf the PCR was made at a greater dilution, then an increased number of cycles would be required to obtain a detectable amplicon. If too many PCR cycles are applied to the diluted amplicon, PCR stringency would be lost and extra non-specific products would be observed on the agarose gel.

8.3 PCR-SSP discussion The level of resolution by PCR-SSP can be varied, depending on the requirement for the typing. A small panel of PCR reactions can be chosen to provide a low-resolution typing. Higher resolution can be achieved through additional PCR combinations, which identify more pairs of HLA polymorphic motifs. Higher resolution can also be achieved through the use of nested PCR, leading to the removal of potential ambiguity. PCR-SSP therefore 257

Pete Krausa and Michael Browning provides both a simple and flexible approach, easily within the scope of most laboratories with some experience of PCR and basic molecular biology. It is quick to perform and simple to interpret. It is, however, relatively labour intensive (per sample), making it less suitable for the high-throughput laboratory. In establishing this technique, it is important to validate each primer-pair for both positive and negative specificity, to ensure it is functioning correctly. A panel of DNA extracted from HLA-characterized cell lines is an important requirement for any molecular typing technique. Many conditions and primers have been described, which provide the user with a substantial amount of information for both establishing and troubleshooting the method. In addition, commercial kits are available, making the method accessible to those laboratories who do not wish to invest in a large primer synthesis or development time (a list of companies is provided at the end of this chapter).

9. Sequence-based typing Determination of HLA type, by analysing the DNA sequence of polymorphic regions of the HLA gene, has been made possible through the use of oligonucleotide probes and the specificity of PCR primers, as discussed above. These methods only consider a selection of motifs within the polymorphic region, as defined by the probe specificities in PCR-SSOP, or primer specificities in each PCR-SSP reaction. Both these assays define HLA specificities within the context of known HLA alleles. Although these approaches may define new alleles through a novel reactivity pattern (65, 66), there will be instances where new alleles may be missed. This may be due to either a new sequence motif or a new combination of polymorphic motifs within a gene not being visible to the panel of probes or primer combinations used by PCRSSOP and PCR-SSP, respectively. DNA sequencing through the region of interest produces the most complete record of polymorphism found within a given gene. As already discussed, the definition of HLA alleles does not rely on the identification of a given single point mutation, rather a collection of polymorphic motifs, mainly in the regions coding for the peptide binding groove (exons 2 and 3 in HLAA, -B, and -C and exon 2 in HLA-DRB). Hence, extensive panels of probes or PCR primer pairs are required to define this polymorphism. As the required resolution increases, so does the size of the probe panels or the PCR primer pairs. This increase in panel size is an attempt to gain more sequence information on the HLA genes investigated. Even with an extensive panel of probes, the typing approach may not cover all the potential motifs at sites of polymorphism. The alternative to using extensive panels of probes or primer pairs for highresolution typing is to sequence DNA through the region of interest. Sequence-based typing (SET) generates a base-by-base analysis of HLA 258

11: HLA typing methods genes. This provides a powerful approach upon which high-resolution HLA typing is possible, even in the presence of new HLA specificities which may not be detected by other methods. SET is an emerging technology, which is rapidly becoming established within a number of histocompatibility testing laboratories. Initial sequencing protocols, employing radiolabelled dideoxynucleotides were highly manual, labour-intensive, and not feasible for routine HLA typing. Additionally, SBT has been perceived as expensive, difficult to perform and interpret, with low throughput. However, recent advances in both instrumentation and sequencing chemistries have now made SBT a real alternative to the more traditional typing approaches, with the added intrinsic benefit of high resolution and detection of new alleles. The basic premise of DNA sequencing is the generation of sequence ladders from a specific sequencing primer. Much in the same way as PCR, nucleotide bases are added to the 5' end of the sequencing primer as dictated by the single-stranded DNA template to which the primer is bound. The sequence can be terminated at different positions, dependent upon when a dideoxynucleotide (ddNTP) is added to the extending DNA strand instead of a deoxynucleotide (dNTP) (67). Hence, each different ddNTP will produce a ladder of extension products, and the positions at which the reactions are terminated will be determined by the single-stranded DNA template. Having four sequencing reactions, each containing the same primer, but different ddNTP terminators (ddATP, ddGTP, ddCTP, ddTTP) will generate four sequencing ladders. When these four sequencing reactions are electrophoresed together on an acrylamide gel to separate the different sized termination products, it is possible to determine the DNA sequence from the separated bands by their comparative mobility. Having each band tagged with a fluorescent dye, allows automated detection of the sequence ladder, as it passes a laser and sensor in the DNA sequencer. The development of four-colour terminator chemistries have greatly enhanced DNA sequencing. Rather than having to run each particular sequencing reaction ladder in a separate lane, the four-colour chemistries allow all four terminator reactions, each labelled in a different colour, to be run within the same lane. This requires the DNA automated sequencer to be capable of distinguishing the four different fluorochromes. Four-colour sequencing increases the sample throughput and sequence interpretation. The SBT approaches and methods described below will be based upon experiences in using the four-colour BigDye Terminator (PE-Biosystems) chemistry and PE-Biosystems 377 and 310 DNA sequencers.

9.1 SBT strategies As with other molecular strategies, HLA typing by SBT requires an initial PCR to generate a specific template containing the regions of polymorphism 259

Pete Krausa and Michael Browning which define the HLA alleles. This HLA specific template is then sequenced using sequencing primer sites found within the template. These sequencing primer sites can be nested within the PCR template, or introduced as 'tails' incorporated in the PCR primers. There are a number of strategies for generating template by PCR. A single PCR may be designed to amplify all alleles within a particular locus (37), or an HLA locus may be split into a number of group-specific reactions (68, 69). Sequencing a single PCR template for a given HLA locus requires the analysis of heterozygous positions within the sequence in the great majority of samples, due to amplification of both alleles of the gene. This requires that the PCR is even-handed in amplifying both alleles, as are the sequencing primers in generating sequencing ladders from both of the templates. Confident detection of heterozygote positions has been an area of concern in HLA SBT. To introduce greater confidence, many protocols advise that both forward and reverse orientations of a given region be sequenced, since this adds a level of confirmation to the data generated, particularly in detecting heterozygotes at polymorphic positions. In analysing a heterozygote sample, ambiguities may exist in the interpretation of the DNA sequence generated. This is mainly a consequence of polymorphic sequence motifs being shared between alleles. For example, in considering the analysis of exons 2 and 3 of HLA-B, a heterozygous sequence generated by the allele combination of B*2702/B*3501, would be identical to that -generated by B*2708/B*5301. The prevalence of such ambiguities is related to the frequency of each allele in a given population. Although a number of such ambiguous combinations exist amongst the different loci, their impact is limited, since many would rarely be found together in a population group. This aside, the expected number of ambiguous combinations can be reduced by splitting loci into a number of group-specific reactions. Instead of one PCR product containing a mixture of two allele sequences, a panel of group-specific PCRs can be generated which will potentially separate one allele from the other. Sequencing the positive templates will generate two separate homozygous sequences, removing the ambiguity present when they are combined. Another approach to resolving ambiguous combinations is to introduce specificity into additional sequencing primers, which separate the heterozygous sequence into two homozygous sequences. The requirement for introducing more than one PCR per HLA locus to reduce the number of potential ambiguities is determined by the number of alleles present within a locus and their complexity of polymorphism. There is also the practical consideration of the potential frequencies of such ambiguities within a given population. Clearly, the more PCR products that have to be sequenced, the greater the workload, and it is often more practical to generate a single PCR template and sequence the heterozygous combination if the chances of ambiguous combinations are low. 260

11: HLA typing methods A general protocol for sequencing from both a single locus-specific PCR, and a panel of group-specific PCRs is given below, as applied to HLA -A and HLA-DRB typing, respectively. The HLA-A SBT protocol (i.e. Protocol 10) employs nested primer sites for sequencing, whilst the HLA-DRB SBT protocol (see text below) uses sequencing primer sites introduced into the tails of the PCR primers.

9.2 HLA SBT protocol SBT protocols comprise a PCR component followed by a sequencing component. The PCR provides a template upon which specific sequencing primers can be used to generate sequence information. The sequence information generated is then compared to a library of known sequences to determine the type. This comparative step, and sequence data management, can be handled by available software. There are a number of protocols for HLA SBT. Below is a protocol for the SBT of HLA-A using the kit from PE-Applied Biosystems. Other kits employing this sequencing chemistry follow the same protocol. The PCR step in the PE Applied Biosystems HLA-A kit amplifies a 2-kbp region of the HLA gene from exons 1-5. The kit is designed for use with genomic DNA, since the sequencing primers are located in intronic regions flanking each of exons 2, 3, and 4. (Figure 7). Protocol 10. HLA SBT typing assay Equipment and reagents • HLA-A SBT kit (PE-Applied Biosystems) • AmpliTaq Gold enzyme (PE-Applied Biosystems) • 20 ng/ul genomic DNA • Microtitre plates or reaction tubes • Thermocycler (Perkin-Elmer, model no. 2400, 9600, or 9700) • Electrophoresis equipment • Suitable gel loading buffer • 2% agarose gel stained with ethidium bromide • Gel running buffer: 0.5 x TBE buffer • 2-kbp size standard Biorad

• • • • • • •

Microcon-100 column (Amicon) PCR template 100% and 70% ethanol 3 M sodium acetate pH 4.6 Vortex mixer Formamide Sequencing loading buffer: 5:1 formamide/ Dextran Blue • Appropriate acrylamide gel (as recommended by the manufacturer) • ABI-377 automated sequencer • MatchMaker software (PE-Applied Biosystems)

Method 1. For a final 25 ul reaction mix, add 0.4 ul (2 U) of the AmpliTaq Gold enzyme to the 19.6 ul of the HLA-A PCR-kit mix. Make a batch mix of the PCR reagents and AmpliTaq Gold, since preparing single reactions can lead to pipetting errors through adding small volumes of enzyme. Add 20 ul of this PCR mix/AmpliTaq Gold to each reaction tube or well of a microtitre plate.

261

Pete Krausa and Michael Browning Protocol 10. Continued 2. Add 5 ul of genomic DNA to the wells containing the 20 ul of PCR reaction mix. Ensure that all the components are combined at the bottom of the reaction tube or wells. This can be achieved by a brief centrifugation step. 3. Run the PCR through the following thermal cycling parameters validated on Perkin-Elmer 2400, 9600, and 9700 thermocyclers.a • 96°C for 10 min (this activates the AmpliTaq Gold) • {96°C for 20 sec, 65°C for 45 sec, 72°C for 3 min} for 5 cycles; followed by: • {96°C for 20 sec, 60°C for 50 sec, 72°C for 3 min} for 20 cycles; followed by: • {96°C for 20 sec, 55°C for 1 min, 72°C for 3 min} for 10 cycles; followed by a • hold at 4°C. 4. Following the PCR, run out 5 ul of the product on an ethidium-bromide stained 2% agarose gel made in and run in 0.5 X TBE buffer using a suitable loading buffer. Include an appropriate size standard to ensure the product is of the expected 2 kbp size. (See Protocol 8). 5. If the 2 kbp product is present in a robust and specific single band on the gel, purify the remaining 20 ul of product through a Microcon-100 column as per the manufacturer's instructions.b Adjust the volume of the recovered purified PCR template to 30 ul. 6. There are six ready-reaction sequencing mixes in the HLA-A kit, providing both forward and reverse sequences for exons 2, 3, and 4 of HLA-A. The mixes contain all the components of the sequencing reaction, including the ddNTP terminator nucleotides, except for the PCR template. Combine 2 ul of purified PCR template with 8 ul of each of the six sequencing reaction mixes in reaction tubes or the wells of an appropriate microtitre plate. Perform the cycle sequencing reaction on a thermocycler under the following parameters: • 96°C for 10 sec, followed by: • {96°C for 10 sec, 50°C for 10 sec, 60°C for 2 min} for 20 cycles, followed by a • hold at 4°C. 7. Following thermal cycling, ethanol-precipitate the sequence ladder by adding 25 ul of a 24:1 mix of 100% ethanol and 3 M sodium acetate pH 4.6, respectively. Vortex the ethanol and sequencing reactions, then spin hard for 30 min at 1500-3000 g, depending on the centrifuge manufacturer's recommendations. Remove the ethanol by spinning

262

11: HLA typing methods the inverted plate/reaction tubes at 150 g into paper towels for 1 min. Wash the DNA pellet in 70% ethanol then spin hard as above for 5 min. Remove the ethanol as above.c 8. Resuspend the sequencing reaction pellet in 5 ul of the sequencing loading buffer, comprising a 5:1 mix of formamide and Dextran Blue solution. Denature the resuspended pellet at 95°C for 2 min prior to loading between 1,5 and 2.0 ul on to an appropriate acrylamide gel, as recommended for the ABI-377 automated sequencer. If the ABI-310 capillary instrument is used, resuspend and denature the pellet in 15 ul of formamide prior to loading on to the instrument Perform the electrophoresis of the sequence ladder and data collection in accordance with the conditions specified in both the HLA SBT kit and instrument protocols. 9, Following data collection, compare the resulting sequences to libraries of known HLA sequences to determine the HLA type.d a It may be necessary to determine cycling parameters for other models of thermocycler. bThis step removes the interference of unused PCR primers and dNTPs from the subsequent sequencing reactions. cThis protocol ensures the removal of degradation products from the sequencing reaction. If the pellet was simply dried following precipitation, these degradation products would not be removed, and would appear as large non-specific peaks or 'blobs' in the sequencing ladder. dThis procedure is both simplified and enhanced using dedicated software such as MatchMaker (PE-Applied Biosystems).

Figure 7. Strategy for the sequence-based typing of HLA-A locus alleles. PCR primer sites in exons 1 and 5 are used to specifically amplify a 2-kbp HLA-A amplicon. This PCR amplicon is then used as a template for nested cycle sequencing of exons 2, 3, and 4. Each exon is sequenced in both orientations using forward (F) and reverse (R) sequencing primers located in the intron regions flanking each exon,

A similar protocol is described in a kit for the SBT of HLA-DRB. This, however, splits HLA-DRB1 into eight group-specific PCR reactions, plus separate reactions for DRB3, DRB4, and DRB5. The resulting positive reactions can be sequenced in the same manner as outlined in Protocol 10 above. 9.2.1 SBT discussion The SBT approach described above provides informative sequence information for exons 2, 3, and 4 of HLA-A. Because potentially heterozygous

263

Pete Krausa and Michael Browning

Figure8. Electropherogram showing the sequence generated in the 5' region of HLA-A exon 2 using the forward (top panel) and reverse (bottom panel) sequencing primers. Both orientations are necessary to confirm heterozygote positions as depicted here, where R = an A/G heterozygous position and K = a G/T heterozygous position. Analysis of this sample using sequence generated in exons 2, 3, and 4 revealed a type of HLAA*0206, A*68012.

sequences are being generated, it is important to sequence in both forward and reverse orientations, as a means of confirming any heterozygous positions (see Figure 8) and confidently defining regions of polymorphism. The use of a sequencing approach also allows the identification and definition of new HLA variants as they are found in their given populations. The use of DNA sequencing is becoming increasingly popular for HLA typing. This relates to the high resolution offered by SET, and the sequencing data generated, providing both an accurate and more complete definition of the HLA polymorphism found within a particular individual. In addition, as protocols are simplified, and the process of sequencing and subsequent analysis becomes increasingly automated with higher throughput, then SET offers both an efficient and routine typing approach for all the HLA loci.

10. Discussion This chapter considers some of the methods by which HLA typing is performed. It has considered four approaches: one by defining the surface expression of HLA molecules (serology), and three defining HLA polymorphism at the DNA level, (PCR-SSOP, PCR-SSP, and PCR-SBT). Each method has its own positive and negative attributes, and these need to be considered with regard to the typing application. 264

11: HLA typing methods Serology is a well-established procedure, providing definition of expressed HLA polymorphism accessible to detection by antibody. Serology requires dedicated equipment and specialized reagents, together with expertise in interpreting the cross-reactivities of each particular sera in the typing panel. It would therefore be inadvisable for a novice to embark upon establishing a serological assay in-house. However, it would be feasible for commercial trays to be used, since these contain highly characterized sera or monoclonal antibodies. In view of the level of resolution offered by molecular approaches, serology no longer provides the best available method for tissue typing. Molecular biological approaches have greatly enhanced the resolution of HLA typing, and have provided increasing standardization of HLA typing methods. The generic approaches used for HLA DNA analyses are not peculiar to HLA typing, with reagents, equipment, and protocols readily accessible in many laboratories. Until recently, HLA typing usually required a combination of techniques to provide a class I and class II type at the differing levels of resolution required. However, as demonstrated by PCR-SSP (62), it is possible to apply a single molecular biology approach across both class I and class II HLA specificities. This holds true for other methods of DNAbased HLA typing, which therefore promise the economy of a single-method approach to typing. Another advantage of DNA-based methods of HLA typing over serology is the absence of their requirement for viable cells, making sample storage and transport much simpler. Of the three DNA-based methods described, PCR-SSOP is probably the most labour intensive. To achieve a typing requires a large number of hybridization events, which take several days to perform. However, this approach allows a large number of samples to be tested simultaneously, with little extra effort. Hence, each membrane may contain 96 samples, for example, all of which can be hybridized together against the same oligonucleotide. So, after all the oligonucleotide hybridizations have taken place, typings on a large number of samples will be completed. One variant of the PCR-SSOP approach can be used to generate rapid results. This is achieved by a reversal of the basic approach, whereby the panel of oligonucleotide probes is immobilized on the membrane/solid support, and this is then tested against a single sample in a single hybridization event. This technique is described as a reverse dot blot (47, 54). In comparison to the standard PCR-SSOP, the reverse dot blot is more akin to serology or PCRSSP, in which a single sample is tested simultaneously against a panel of specific reagents. Although these methods offer lower throughput, the results per sample are reached more rapidly. PCR-SSP has been instrumental in demonstrating the application of a single approach to simultaneous typing at both the class I and class II loci. The performance and subsequent visualization of such a large number of PCRs on an agarose gel seems daunting. But this is easily addressed through the use of 96-well or 192-well microtitre plates, multichannel pipettes, and dedicated 265

Pete Krausa and Michael Browning flat-bed gel electrophoresis equipment, which allow the loading of large number of PCR products using multichannel pipettes. In the future, this gel step for detecting PCR positives may become obsolete, as PCR products are detected using specific fluorescent probes present within the PCR mix (70). This approach allows the PCR product to be detected as the PCR progresses, and there is no need for agarose gels. The application of this approach to PCR-SSP offers a more automated approach, particularly for data interpretation. The most definitive approach to high-resolution typing is DNA sequencing of the informative regions of the HLA genes. The other described methods only consider specific sites within the HLA genes, as defined by PCR primers or oligonucleotide probes. DNA sequencing provides a much more complete record of HLA polymorphism. The DNA sequence information for a given sample is constant, and remains useful even as more and more novel HLA specificities are identified. The other typing approaches do not have this consistency, and the specificity of sequence-specific primer or probing reactions has to be reassessed as new HLA alleles are identified. Unlike SET, it is often important to know the date of a PCR-SSP or PCR-SSOP typing to determine which alleles have been tested. SBT therefore offers a more comprehensive and informative typing than offered by other methods. SBT has been perceived as both expensive and technically demanding. Automated DNA sequencers are expensive, and therefore many laboratories do not consider their use an option. However, many laboratories will have access to a sequencer, and the simplification of chemistries and protocols puts SBT within the capabilities of an increasing number of tissue typers. Other advances in automated sequencing will, in the future, allow high throughput of samples, particularly through 96-well gel electrophoresis development and rapid electrophoresis through multiple capillary DNA sequencers. These developments are already establishing SBT as a feasible and routine approach to HLA typing. In addition to the methods described, other approaches exist for HLA typing. Many of these involve a PCR step followed by some type of polymorphism detection. This may involve heteroduplex formation between the sample DNA and a number of reference DNA templates, producing unique mobilities when electrophoresed on a gel (71), or the use of restriction enzymes to specifically digest PCR templates in restriction fragment length polymorphism assays (PCR-RFLP) (72-74). Single-stranded conformational polymorphism of PCR templates (PCR-SSCP) relies on the mobility of a single-stranded template on a gel as determined by the conformation reflecting polymorphic content (75). A good way to quickly establish a HLA typing method within a laboratory is to acquire a commercial kit. These kits are generally optimized, which negates the necessity for extensive development as required in establishing a 'homebrew' typing kit. This is particularly useful for those laboratories that have a limited requirement for HLA typing. The four methods described are 266

11: HLA typing methods all available as commercial kits, and a list of suppliers is provided at the end of this chapter. Also included are certain key references from the literature, which provide more detail for each assay, together with the necessary information required if the assay is to be developed in-house, rather than using a commercial kit. The release of HLA typing from serology has brought it within the scope of any good molecular biology laboratory, particularly those with PCR experience. However, an understanding of what the HLA type represents in terms of function, immunogenetics, populations, etc. is not provided with a kit of reagents. A certain level of experience and knowledge of HLA is required for correctly interpreting the typing reached. The last few years have been highly relevant in the area of tissue typing. As resolution increases, and new alleles are found, the ability to perform highly definitive typing will provide a far greater understanding of the relevance and importance of HLA polymorphism in both the functional and clinical settings.

Key references Serology (micro-lymphocytoxicity assay) • McCloskey et al. (76) PCR-SSOP • Kennedy et al. (52) • Bignon et al. (53) PCR-SSP • Krausa et al. (35) • Bunce et al. (62) Sequence-based typing • Scheltingaefa/. (37) • McGinnis et al. (68) • Kotsch et al. (69) • Pera et al. (77)

Commercial suppliers (Full addresses for the following suppliers are given in Appendix 1) Serology (micro-lymphocytoxicity assay) • Biotest Diagnostics Corp. • One-Lambda Inc. • Pel-Freez Clinical Systems 267

Pete Krausa and Michael Browning PCR-SSOP • Biotest Diagnostics Corp. • Dynal PCR-SSP • Dynal • One-Lambda Inc. Sequence-based typing • PE-Applied Biosystems

References 1. Bjorkman, P. J., Saper, M. A., Samraoui, B., Bennett, W. S., Strominger, J. L., and Wiley, D. C. (1987). Nature, 329, 506. 2. Brown, J. H., Jardetzky, T. S., Gorga, J. C., Stern, L. J., Urban, R. G., Strominger, J. L., and Wiley, D. C. (1993). Nature, 364,33. 3. Dausset, J. (1954). Vox Sanguis, 4,190. 4. Dausset, J. (1958). Acta Haemat., 20,156. 5. Terasaki, P. I. and McClelland, J. D. (1964). Nature, 204, 998. 6. van Rood, J. J. and van Leeuwen, A. (1963). J. Clin. Invest., 42,1382. 7. Amos, D. B. and Bach, F. H. (1968). J. Exp. Med., 128, 623. 8. Yunis, E. J. and Amos, D. B. (1971). Proc. NatlAcad. Sci. USA, 68,3031. 9. Mempel, W., Grosse, W. H., Baumann, P., Netzel, B., Steinbauer, R. L, Scholz, S., Bertrams, J., and Albert, E. D. (1973). Transplant. Proc., 5,1529. 10. Yang, S. Y. (1989). In Immunobiology of HLA. Histocompatibility testing 1987, Vol. 1, (ed. B. Dupont), p. 332. Springer-Verlag, New York. 11. Mullis, K. B., Faloona, F. A. (1987). Methods Enzymol, 155, 335. 12. Mullis, K., Faloona, F., Scharf, S., Saiki, R., Horn, G., and Erlich, H. (1986). Cold Spring Harb. Symp. Quant. Biol, 1,263. 13. Saiki, R. K., Bugawan, T. L., Horn, G. T., Mullis, K. B., and Erlich, H. A. (1986). Nature, 324,163. 14. Petersdorf, E. W., Longton, G. M., Anasetti, C., Mickelson, E. M., McKinney, S. K., Smith, A. G., Martin, P. J., and Hansen, J. A. (1997). Blood, 89,1818. 15. Kovats, S., Main, E. K., Librach, C., Stubblebine, M., Fisher, S. J., and DeMars, R. (1990). Science, 248,220. 16. Rinke, d. W. T., Vloemans, S., van den Elsen, P., Haworth, A., and Stern, P. L. (1990). J. Immunol, 144,1080. 17. Braud, V. M., Allan, D. S., O'Callaghan, C. A., et al. (1998). Nature, 391,795. 18. Mason, P. M. and Parham, P. (1998). Tiss. Antigens, 51, 417. 19. Marsh, S. G. (1998). Tiss. Antigens, 51,467. 20. Tussey, L. G., Matsui, M., Rowland-Jones, S., Warburton, R., Frelinger, J. A., and McMichael, A. (1994). J. Immunol., 152,1213. 21. Parham, P., Lomen, C. E., Lawlor, D. A., Ways, J. P., Holmes, N., Coppin, H. L., Salter, R. D., Wan, A. M., and Ennis, P. D. (1988). Proc. NatlAcad. Sci. USA, 85, 4005.

268

11: HLA typing methods 22. Lawlor, D. A., Zemmour, J., Ennis, P. D., and Parham, P. (1990). Annu. Rev. Immunol., 9,23. 23. Bodmer, J. G., Marsh, S. G. E., Albert, E. D., et al. (1997). Hum. Immunol., 53, 98. 24. Guttridge, M. G., Marsh, S. G., and Klouda, P. T. (1992). Tiss. Antigens, 39,32. 25. Clayton, J. and Lonjou, C. (1997). (Section ed. D. Whittle). In Genetic diversity of HLA: functional and medical complication; Proceedings of the 12th International Histocompatibility Workshop and Conference, Vol. 1 (ed. D. Charron), p. 665. EDK, Paris. 26. Krausa, P., Brywka III, M., Savage, D., et al. (1995). Tiss. Antigens, 45,223. 27. Bidwell, J. L., Bidwell, E. A., Savage, D. A., Middleton, D., Klouda, P. T., and Bradley, B. A. (1988). Transplantation, 45,640. 28. Bell, J. I., Denney, D. J., MacMurray, A., Foster, L., Watling, D., and McDevitt, H. O. (1987). J. Immunol., 139,562. 29. Sorrentino, R., Cascino, L, and Tosi, R. (1992). Hum. Immunol., 33,18. 30. Clay, T. M., Culpan, D., Howell, W. M., Sage, D. A., Bradley, B. A., and Bidwell, J. L. (1994). Transplantation, 58,200. 31. Clay, T. M., Howard, M. R., Bidwell, J. L., Bidwell, E. A., Raymond, P. A., Evans, J. E., and Bradley, B. A. (1991). Eur. J. Immunogenet., 18,97. 32. Chen, D. F., Endres, W., Meyer, S. A., and Stangel, W. (1994). Hum. Immunol., 39,25. 33. Olerup, O. and Zetterquist, H. (1992). Tiss. Antigens, 39,225. 34. Bunce, M., Fanning, G. C., and Welsh, K. I. (1995). Tiss. Antigens, 45,81. 35. Krausa, P. and Browning, M. J. (1996). Tiss. Antigens, 47,237. 36. Santamaria, P., Boyce, J. M., Lindstrom, A. L., Barbosa, J. J., Faras, A. J., and Rich, S. S. (1992). Hum. Immunol., 33, 69. 37. Scheltinga, S. A., Johnston-Dow, L. A., White, C. B., van der Zwan, A. W., Bakema, J. E., Rozemuller, E. H., van den Tweel, J. G., Kronick, M. N., and Tilanus, M. G. (1997). Hum. Immunol., 57,120. 38. Kotsch, K., Wehling, J., and Kohler, S. R. B. (1997). Tiss. Antigens, 50,178. 39. Bodmer, W. F. and Bodmer, J. G. (1979). In NIAID manual of tissue typing techniques 1979-1980 (ed. J. G. Ray), p. 46. NIH, Bethesda, MD. 40. Marsh, S. G. E., Packer, R., Heyes, J. M., Bolton, R., Fauchet, R., Charron, D., and Bodmer, J. G. (1997). In Genetic diversity of HLA: functional and medical implication; Proceedings of the 12th International Histocompatibility Workshop and Conference, Vol. 1 (ed. D. Charron), p. 26. EDK, Paris. 41. Madrigal, J. A., Scott, L, Arguello, R., Szydlo, R., Little, A. M., and Goldman, J. M. (1997). Immunologic. Rev., 157,153. 42. Newton, C. R., Graham, A., Heptinstall, L. E., Powell, S. J., Summers, C., Kalsheker, N, Smith, J. C., and Markham, A. F. (1989). Nucleic Acids Res., 17, 2503. 43. Miller, S. A., Dykes, D. D., and Polesky, H. F. (1988). Nucleic Acids Res., 16,1215. 44. Tiercy, J. M., Morel, C., Freidel, A. C., Zwahlen, F., Gebuhrer, L., Betuel, H., Jeannet, M., and Mach, B. (1991). Proc. NatlAcad. Sci. USA, 88,7121. 45. Tiercy, J. M., Roosnek, E., Speiser, D., Cros, P., Allibert, P., Mach, B. and Jeannet, M. (1993). Br. J. Haematol, 85,417. 46. Vaughan, R. W. (1991). Eur. J. Immunogenet., 18, 69. 47. Saiki, R. K., Walsh, P. S., Levenson, C. H., and Erlich, H. A. (1989). Proc. Natl Acad. Sci. USA, 86,6230.

269

Pete Krausa and Michael Browning 48. Bugawan, T. L., Apple, R., and Erlich, H. A. (1994). Tiss. Antigens, 44,137. 49. Thein, S. L. and Wallace, R. B. (1986). In Human genetic disorders: a practical approach (ed. K. E. Davis), p. 33. IRL Press, Herndon, VA. 50. Oh, S. H., Fleischhauer, K., and Yang, S. Y. (1993). Tiss. Antigens, 41,135. 51. Wood, W. I., Gitschier, J., Lasky, L. A., and Lawn, R. M. (1985). Proc. NatlAcad. Sci. USA, 82,1585. 52. Kennedy, L. J. and Poulton, K. V. (1997). In Genetic diversity of HLA: functional and medical implication; Proceedings of the 12th International Histocompatibility Workshop and Conference, Vol. 1 (ed. D. Charron), p. 564. EDK, Paris. 53. Bignon, J. D. and Fernandez-Vina, M. A. (1997). In Genetic diversity of HLA: functional and medical implication; Proceedings of the 12th International Histocompatibility Workshop and Conference, Vol. 1 (ed. D. Charron), p. 584. EDK, Paris. 54. Erlich, H., Bugawan, T., Begovich, A. B., Scharf, S., Griffith, R., Saiki, R., Higuchi, R., and Walsh, P. S. (1991). Eur. J. Immunogenet., 18, 33. 55. Olerup, O. and Zetterquist, H. (1991). Tiss. Antigens, 37,197. 56. Olerup, O., Aldener, A., and Fogdell, A. (1993). Tiss. Antigens, 41,119. 57. Bunce, M., Taylor, C. J., and Welsh, K. I. (1993). Hum. ImmunoL, 37, 201. 58. Krausa, P., Moses, J., Bodmer, W., Bodmer, J., and Browning, M. (1993). Lancet, 341,121. 59. Bunce, M. and Welsh, K. I. (1994). Tiss. Antigens, 43,7. 60. Bunce, M., Barnardo, M. C., and Welsh, K. I. (1994). Tiss. Antigens, 44,200. 61. Sadler, A. M., Petronzelli, R, Krausa, P., Marsh, S. G., Guttridge, M. G., Browning, M. J., and Bodmer, J. G. (1994). Tiss. Antigens, 44,148. 62. Bunce, M., O'Neill, C. M., Barnardo, M. C. N. M., Krausa, P., Browning, M. J., Morris, P. J., and Welsh, K. I. (1995). Tiss. Antigens, 46, 355. 63. Krausa, P., Carcassi, C., Orru, S., Bodmer, J. G., Browning, M. J., and Contu, L. (1995). Hum. ImmunoL, 44, 35. 64. Guttridge, M. G., Burr, C., and Klouda, P. T. (1994). Tiss. Antigens, 44,43. 65. Browning, M. J., Madrigal, J. A., Krausa, P., et al. (1995). Tiss. Antigens, 45, 177. 66. Krausa, P., Young, D. M., Gotch, F. (1996). Immunogenetics, 45, 84. 67. Sanger, F., Nicklen, S., and Coulson, A. R. (1977). Proc. Natl Acad. Sci. USA, 74, 5463. 68. McGinnis, M. D., Conrad, M. P., Bouwens, A. G., Tilanus, M. G., and Kronick, M. N. (1995). Tiss. Antigens, 46,173. 69. Kotsch, K., Wehling, J., Kohler, S., and Blasczyk, R. (1997). Tiss. Antigens, 50, 178. 70. Luedeck, H. and Blasczyk, R. (1997). Tiss. Antigens, 50, 627. 71. Arguello, R., Pay, A. L., McDermott, A., Ross, J., Dunn, P., Avakian, H., Little, A. M., Goldman, J., and Madrigal, J. A. (1997). Nucleic Acids Res., 25,2236. 72. Hviid, T. V., Madsen, H. O., and Morling, N. (1992). Tiss. Antigens, 40,140. 73. Medintz, L, Chiriboga, L., McCurdy, L., and Kobilinsky, L. (1994). J. Forensic Sci., 39,1372. 74. Salazar, M., Yunis, J. J., Delgado, M. B., Bing, D., and Yunis, E. J. (1992). Tiss. Antigens, 40,116. 75. Yoshida, M., Kimura, A., Numano, F., and Sasazuki, T. (1992). Hum. ImmunoL, 34,257. 270

11: HLA typing methods 76. McCloskey, D. J., Brown, J., and Navarrete, C. (1993). In Handbook of HLA typing techniques (ed. K. M. Hui and J. L. Bidwell), p. 175. CRC Press, Boca Raton, FL. 77. Pera, C., Delfino, L., Morabito, A., Longo, A., Johnston-Dow, L., White, C. B., Colonna, M., and Ferrara, G. B. (1997). Tiss. Antigens, 50, 372.

271

This page intentionally left blank

12

Biochemical characterization of lymphocyte surface antigens ANTONY SYMONS and MARION H. BROWN

1. Introduction The approach taken by cellular immunologists to characterize a lymphocyte surface antigen usually begins with the antibody. In many cases the antibody has been raised by immunization with whole cells, that is against the native molecule on the cell surface. If, on the other hand, the characterization of a lymphocyte surface antigen is approached from information about its DNA sequence, the antibody will most probably have been raised against a recombinant protein or a synthetic peptide. The initial biochemical questions asked by a cellular immunologist about an antigen include: • • • • • •

What is its molecular weight? Does it consist of one chain, or several linked by disulfide bonds? Is it glycosylated? Is it synthesized by the cells on which it appears? Is it phosphorylated? Is it different from previously identified antigens?

Two fundamental strategies are used to answer these questions, depending on the properties of the antibody. The first, most often used with antibodies binding to native protein, is to immunoprecipitate the antigen from cells and analyse it electrophoretically (e.g. sodium dodecyl sulfate (SDS) polyacrylamide gel electrophoresis (PAGE)). The other approach employed, particularly if the antibody is against a synthetic peptide, is to use it to identify the unfolded antigen. This can be done using the technique of immunoblotting combined with SDS-PAGE. The aim of this chapter is to present a straightforward approach to the biochemical characterization of lymphocyte surface antigens. The emphasis is on using an antibody with the techniques of immunoprecipitation and immunoblotting, combined with SDS-PAGE, to establish some of the more pertinent

Antony Symons and Marion H. Brown properties of the specific antigen. In the final section, strategies for identifying new molecules based on antibody methods, as well as recombinant protein and DNA technologies, will be briefly described.

2. Immunoprecipitation 2.1 Introduction Immunoprecipitation is a widely used method that, in combination with cell labelling protocols, permits the biochemical characterization of an antigen, without the need to purify large amounts. The principal stages in the immunoprecipitation of a specific antigen are: (a) (b) (c) (d) (e) (f)

cell lysis; binding of an antibody to a specific antigen; precipitation of the antigen-antibody complex; washing the precipitate; dissociation of the antigen from the antibody; and analysis by electrophoresis.

There are different protocols available for each stage of this process: for example, the choice of detergent used for cell lysis, or the method of precipitation. Moreover, there are several different protocols for labelling cellular antigens. The judicious choice of a specific method at each step can provide a great deal of information about the nature and location of an antigen and of any associated molecules. The different methods available, their advantages and specific applications are outlined in this section.

2.2 Labelling cellular antigens Labelling cellular proteins with radioactive isotopes, or by biotinylation, facilitates the sensitive detection of low amounts of precipitated antigen. A specific antibody can then be used to isolate detectable amounts of antigen from relatively few labelled cells. For example, the CD3 antigen, which is expressed on the T-cell surface at a density of approximately 30000 molecules per cell, can be detected by precipitation from 107 cells (see Figure 1). The number of cells can be reduced with more sensitive detection systems such as biotinylation and luminescence. The more antigen present, the fewer cells needed for immunoprecipitation. There are two primary approaches to labelling cellular antigens: biosynthetic labelling, and in situ labelling methods. 2.2.1 Biosynthetic labelling of cellular antigens Biosynthetic labelling techniques are commonly used in the study of the biochemical properties of intracellular, cell surface, and secreted proteins, as well as the synthesis and fate of all cellular proteins (1). Labelling is achieved 274

12: Biochemical characterization of lymphocyte surface antigens

Figure 1. Immunoprecipitation of CD3 from human T blasts labelled for 10 min with [35S]methionine and chased with cold methionine for 0 min (lane 1), 15 min [lane 2), 30 min (lane 3), 60 min (lane 4), and 120 min (lane 5). The arrow indicates the immature form of the CD3-y chain (23 kDa);the mature form is not visible. The bracket shows the position of the CD38 and -e polypeptides and their precursors.

by placing celts in growth medium containing radioactive amino acids, which are then incorporated into newly synthesized proteins. The most commonly used biosynthetic label is [35S]L-methionine,as it has a high specific activity (>800 Ci/mmol) and is incorporated to a detectable amount by most proteins that are synthesized at a reasonable rate and level (~104 molecules/cell). However, not all proteins contain methionine, and even when a protein does contain this amino acid it may not label readily with the isotope. For proteins that cannot be detected by the incorporation of [ 33 S]L-methionine, alternative radiolabelled amino acids are available, such as [35S]L-cysteine. The precursor form of the CD3-y chain (23 kDa) labels well with a combination of [35S]Lmethionine and [35S]L-cysteine,whereas the mature form (26 kDa) is difficult to detect (see Figure I). Most amino acids can also be obtained labelled with 3 H: however, with these radiolabels it is best to use essential amino acids, as the specific activity of non-essentiat residues is reduced by dilution with endogenously synthesized amino acids (2), Cell-surface molecules involved in signalling processes can also be studied by biosynthetic labelling. Many receptors, or receptor-associated molecules, are phosphorylated upon activation, and it is possible to study the effects of activators on these antigens by labelling with the radioisotope 32P. Other properties of antigens—for instance, acylation and glycosylation—can also be investigated, using 3H-labelled fatty acids such as palmitic acid (3) and 3Hlabelled sugars such as mannose, respectively.

2.2.2 [35S]L-methionine labelling Protocol I describes two methods of biosynthetic labelling with [35S]i_methionine. The methods differ in the length of time for labelling and the 275

Antony Symons and Marion H. Brown application, which depends on three main factors: the turnover rate of the protein; the viability of the cells; and the purpose of the experiment. Proteins with a high turnover are optimally labelled for short periods. Longer times result in the increased labelling of other proteins, and hence an increase in the intensity of non-specific proteins in immunoprecipitates. In contrast, proteins with a low turnover rate require longer periods for labelling. The 3-h labelling gives good incorporation of [35S]L-methionine into many proteins: however, those that are synthesized at a slow rate may need an overnight incubation for labelled protein to accumulate. Note that the incubation times in the protocol are merely a guide, and the best results for a particular protein should be determined empirically. The cells used in this method can be either cultured cell lines or cells derived from tissues, such as the spleen or thymus. Labelling adherent cells is essentially the same as described for cells in suspension, except that cells are labelled whilst attached to plastic and later scraped off and processed for analysis. Cultured cells should be growing exponentially for best results. Time-dependent processes, such as post-translational modification and the fate of newly synthesized proteins, can be studied using a modification of the protocol described. In this pulse-chase method, labelling times are short (5-30 min) and are followed by incubation in medium containing an excess of the unlabelled amino acid. Protocol 1. Labelling cells with [35S]L-methionine Equipment and reagents • Methionine-free tissue culture medium (e.g. RPMI-1640) • [36S]L-methionine (Amersham International, 15mCi/ml)

• Fetal calf serum (FCS) dialysed against PBS • Cells • Ice-cold PBS: 10 mM sodium phosphate buffer pH 7.2, 0.17 M NaCI, 3 mM KCI

Method 1. Wash the cells three times with methionine-free medium containing 10% FCS, by centrifugation (300 g, 5 min, room temperature). Count and adjust to 2 x 106 cells/ml in the same medium. 2. Incubate the cells for 30 min at 37°C, to deplete intracellular pools of methionine. 3. Either. (a) After incubation in the methionine-free medium, centrifuge the cells and resuspend at 108/ml in the same medium. Label the cells for 3 h at 37°C with [35S]L-methionine at a concentration of 1 mCi/ml. or.

(b) Add [35S]L-methionine to 20 uCi/ml and label the cells overnight at 37°C. Centrifuge the cells at 300 g for 5 min at 4°C and discard the

276

12: Biochemical characterization of lymphocyte surface antigens supernatant. Resuspend the cells in 10 ml of ice-cold PBS and repeat the centrifugation. The medium and wash are radioactive, so dispose of according to your local radiation safety regulations. 4. Lyse the cells (see Protocol 4Aa), and analyse by immunoprecipitation (see Protocol 4C) and SDS-PAGE (see Protocol 6). a

Lysates can be kept on ice for several hours or at -70°C for a few days before being analysed. However, freezing and thawing lysates after solubilization with detergents can cause dissociation of the multisubunit complexes.

2.2.3 32P labelling The method for radiolabelling phosphorylated receptor molecules with 32P is essentially the same as described above for short-term methionine labelling (4). The main differences are the use of [32P]orthophosphate (Amersham, 10 mCi/ml) as a radiolabel and the use of a phosphate-free medium to deplete intracellular phosphate levels. Most phosphoproteins are sufficiently labelled after 3 h. To increase the incorporation into a particular protein, label for a longer time and/or use a higher concentration of 32P;. Quiescent cells need to be labelled overnight. If the cells are labelled for longer than 6 h the background seen on autoradiographs of immunoprecipitates can be a problem. 2.2.4 In situ labelling methods Whilst the incorporation of radioactive amino acids can be used to label the majority of proteins synthesized by a cell, in situ labelling techniques exist that allow the specific detection of cell-surface molecules. Immunoprecipitation from cells labelled using these methods is a useful way of confirming the location of an antigen. Proteins exposed on the cell surface can be selectively labelled with radioiodine, in a carefully controlled reaction catalysed by lactoperoxidase (5). Radioactive isotopes of iodine are commercially available and 125I is normally used because it has a 60-day half-life. The addition of radioiodine exclusively to the outside of the cell occurs because lactoperoxidase is unable to cross the plasma membrane of a viable cell. Iodine incorporation is dependent on the availability of tyrosine residues. A more widely used alternative method for labelling cell-surface proteins is biotinylation (6). Biotin groups can be coupled to exposed proteins on the cell surface by incubation with sulfo-NHS-biotin. The active NHS (N-hydroxysuccinimide) group allows covalent coupling to the e-amino group of exposed lysine side chains, and the sulfonyl group confers a net negative charge on the molecule preventing it crossing the plasma membrane. Biotinylated proteins are detected using avidin or streptavidin conjugates. Both methods are described in the following sections; however, biotinylation offers many practical advantages over lactoperoxidase-catalysed iodination. First, the need for handling radioactive reagents is eliminated and also, since the streptavidin-biotin binding is the strongest non-covalent interaction known, it allows the detection of picograms 277

Antony Symons and Marion H. Brown of biotinylaled protein with high sensitivity and specificity. In addition, lysine residues are twice as abundant as tyrosines, so that a greater number of residues on each molecule—and, in theory, a broader range of proteins—can be labelled with biotin than with iodine. Finally, biotinylation combined with pulse-chase biosynthetic labelling can be used to follow protein transport, endocytosis, and shedding of a given membrane antigen (7,8).

2.2.5 Cell-surface iodination using lactoperoxidase Lactoperoxidase cannol cross the plasma membrane of viable cells, and under the carefully controlled conditions described below, only proteins exposed on the cell surface are iodinated (5). It is important to use ceils with a high viability (>95%), to avoid labelling the intracellular proteins of dead cells. To maintain viability keep the cells in phosphate-buffered saline (PBS) for as short a time as possible, and check that the viability does not decrease during the experiment. Another important parameter for ensuring vectorial labelling is the iodide concentration. This should always be lower than the lactoperoxidase concentration, so that all iodide is bound to the enzyme and none is free to cross the plasma membrane and label intracellular proteins. Under the conditions described here the lactoperoxidase concentration is about 100fold greater than the iodide concentration. Thus, the amount of iodide used to label the cells can safely be increased if the need arises. For safety reasons it is vital that iodination is performed in a designated, safety-tested fume-hood. An example of an immunoprecipitation experiment performed with I2SIlabelled cells is shown in Figure 2.

Figure 2. Immunoprecipitation and deglycosylation of CD2, Immunoprecipitates were prepared from surface 125l-labelled human T lymphoblasts using CD2-300 Ab (lane 1), rabbit normal IgG (lane 2)r mAb OKTII and digested with PNGase F (lane 3), CD2-300 Ab and digested with PNGase F (lane 4), mAb OKTII (lane 5), and were analysed under reducing conditions on a 10% SDS-polyacrylamide gel.

278

12: Biochemical characterization of lymphocyte surface antigens Protocol 2. Lactoperoxidase-catalysed iodination of cell-surface antigens Equipment and reagents Cells in PBS (see Protocol 7 for PBS) 20 U/ml lactoperoxidase (Sigma) in PBS. Store in aliquots at -70°C. 1 U/ml glucose oxidase (Sigma) in PBS

100 mM glucose in PBS [125Hsodium iodide, carrier-free (Amersham, 100 mCi/ml!

Method 1. Quickly wash the cells to be labelled three times with PBS, by centrifuging at 300 g, 5 min, and 4°C. Count the cells and adjust to 10s cells/ml. 2. To 1 x 107 cells, add 10 ul of lactoperoxidase, 20 ul of glucose oxidase, 10 ul of glucose, and 500 uCi 125I (5 ul). 3. Cap the tube, mix, and incubate for 10 min at 20°C. 4. Wash the cells three times with PBS, as in step 1. Cells are then ready for lysis (see Protocol 4.4/4).

2.2.6 Biotinylation of cell-surface proteins Cell-surface proteins are labelled by incubation with an aqueous solution of sulfo-NHS-biotin. Cells should be in a buffer that contains no primary amine groups (i.e. not Tris or glycine), as these compounds compete with proteins for biotinylation. In addition, sulfo-NHS-biotin undergoes hydrolysis in aqueous solution: however, this is an unavoidable side-reaction but is overcome with excess biotin. The biotinylation reaction appears to be complete within 20-40 min at 0.5 mg/ml (6). The unbound biotin can be quenched with culture medium or with primary amine-containing buffers (e.g. Tris). Cell membranes are solubilized with detergents and specific antigen immunoprecipitated from the lysates. After SDS-PAGE and blotting to nitrocellulose (see Sections 3 and 4), biotinylated proteins are detected with streptavidin-conjugated alkaline phosphatase or horseradish peroxidase. As with iodination, it is important to maintain cell viability to prevent labelling intracellular proteins. In some cases it may be an advantage to label intracellular proteins—for example, to enable the identification of molecules associated with the antigen of interest—in which case, cells can be permeabilized with 0.1% digitonin prior to biotinylation. Protocol 3.

Biotinylation of cell-surface antigens

Equipment and reagents Cells in PBS (see Protocol 1 for PBS) 0.5 mg/ml sulfo-NHS-biotin (Pierce) in dimethyl sulfoxide (DMSO). Make a fresh solution each time.

279

Serum-free culture medium (e.g. RPMI1640) Wash buffer: 1 mM MgCI2, 0.1 mM CaCI2 in ice-cold PBS

Antony Symons and Marion H. Brown Protocol 3.

Continued

Method 1. Wash the cells to be labelled three times with 15 ml of the ice-cold wash buffer, by centrifuging at 300 g, 5 min, and 4°C. Count the cells and adjust to 2 X 107 cells/ml. 2. To 2 X 107 cells, add 2.5 ul of the sulfo-NHS-biotin solution. Incubate the cells at 4°C for 30 min with gentle shaking. 3. After 30 min quench the unreacted sulfo-NHS-biotin by adding 5 ml of the ice-cold serum-free culture medium. Incubate for 10 min at 4°C with gentle shaking and then wash twice with ice-cold PBS. Cells are then ready for lysis (see Protocol 4.4A).

2.3 Solubilization of membrane proteins Immunoprecipitation of cell-surface proteins from labelled cells requires the isolation of these molecules from the lipid component of the membrane. Detergents, organic molecules with both hydrophobic and hydrophilic characteristics, are used to carry out this separation. The cells are lysed and the antigen solubilized in detergent so that it can be selectively precipitated with antibody. The choice of a particular detergent used to lyse the labelled cells is important and can affect the results obtained. Mild (e.g. CHAPS, digitonin) and non-ionic (e.g. Nonidet P-40 (NP-40), Triton X-100) detergents are generally employed to solubilize and disperse antigens in their native state. Lysis with these detergents avoids disruption of the nuclear envelope and release of DNA, which can increase the precipitation of non-specific proteins. Solubilization of membrane proteins with weakly ionic detergents (e.g. sodium deoxycholate) disrupts the nuclear membrane, and thus these detergents are best used after making a membrane preparation. Strongly ionic detergents such as SDS can be used to solubilize cells, but these detergents denature proteins. Strong detergents are commonly used to make whole-cell lysates for immunoblotting (see Section 4) or to expose an epitope that is buried in the tertiary structure of the molecule. In addition, molecules that are associated with an antigen can be identified. Solubilization with mild detergents preserves macromolecular complexes, so that molecules associated with a particular antigen may be co-precipitated (9,10). A simple method for cell lysis, broadly applicable to the precipitation of cell-surface antigens or immunoblotting, is described in Protocol 4. As with each step of an immunoprecipitation, alternative methods are available (11). In the method described, the ratio of cells to lysis buffer is only a guide and significant deviations will not generally affect the results. However, in some cases the lipid-to-detergent ratio may be critical, particularly for maintaining the associations of co-precipitated molecules. The presence of protease inhibitors is crucial at the time of lysis and during subsequent manipulations as 280

12: Biochemical characterization of lymphocyte surface antigens many proteolytic enzymes are released. Phenylmethylsulfonyl fluoride (PMSF) and iodoacetamide (IAA) are most commonly used, but other protease inhibitors can be added to the lysis buffer if degradation is a problem (e.g. leupeptin, soybean trypsin inhibitor). It is also very important to maintain the lysate at 4°C to minimize proteolysis and to help preserve protein-protein interactions. If the cells have been labelled with 32P then phosphatase inhibitors should be added. Vanadate is specific for tyrosine phosphatases (12) and sodium fluoride for threonine/serine phosphatases (13).

2.4 Immunoprecipitation Antibodies are employed to isolate specific antigens from complex cell lysates because of their high specificity and affinity. Both polyclonal antisera and monoclonal antibodies can be used for immunoprecipitation. There are two main steps in this process: antibody binding to antigen; and the precipitation of the antibody-antigen complex. Precipitation of antibody is now commonly carried out using Sepharose conjugated to Protein G or Protein A, which are antibody-binding molecules expressed by Streptococcus spp. and Staphylococcus spp., respectively. Protein G reagents are preferable to Protein A reagents as they bind a broader range of Ig subclasses, and engineered forms are available with increased binding capacity. The use of alternative precipitating reagents, including monoclonal anti-Ig coupled to Sepharose is described elsewhere (14). A detailed protocol for the immunoprecipitation of antigen from cell lysates with Protein G is given below and outlined in Figure 3. In this protocol antibody is isolated on Gammabind Protein G-coupled

Figures. Flow diagram of the immunoprecipitation procedure.

281

Antony Symons and Marion H. Brown Sepharose beads, followed by incubation with the cell lysate, to bind antigen to antibody. This sequence facilitates an increase in the amount of antibody added to the lysate. Alternatively, antibody can be added to the lysate in solution followed by the addition of Protein G-Sepharose; however, this method limits the volume of antibody-containing solution used in the precipitation. Protocol 4. Immunoprecipitation using Gammabind Protein G-Sepharose Equipment and reagents Lysis buffer: 10 mM Tris-HCI pH 7.4, 1% (w/v) NP-40, 150 mM NaCI, 1 mM diethylenediamine tetraacetic acid (EDTA), and the proteolytic inhibitors at the stated concentration (see below) Proteolytic inhibitors: 1 M phenylmethylsulfonyl fluoride (PMSF, Sigma) in isopropanol; 20 mM iodoacetamide (IAA, Sigma) in water; 50 ng/ml soybean trypsin inhibitor in water; 2 ng/ml leupeptin in water Wash buffer 1: lysis buffer plus 0.5 M NaCI Wash buffer 2: lysis buffer plus 0.1% (w/v) SDS

Wash buffer 3:10 mM Tris-HCI pH 7.4,0.1% (w/v) NP-40 Gammabind Protein G-Sepharose (Pharmacia) PBS (see Protocol 7) SDS sample buffer Microlitre syringe (Hamilton), for most efficient washing 1.5 ml microcentrifuge tubes Orbital shaker Vortex mixer Ultracentrifuge

A. Cell lysis 1. Wash the surface- or biosynthetically-labelled cells three times in PBS by centrifugation and then resuspend the cell pellet in 50 ul of PBS per 2 x 107 cells. 2. Add 1 ml of lysis buffer plus fresh 1 ul 1 M PMSF if lysis buffer stored more than 24 h per 2 x 107 cells, and incubate at 4°C for 1 h with constant agitation. 3. Centrifuge the lysate at 3000 g for 5 min 4°C to pellet the nuclei. 4. Remove the supernatant and centrifuge at 100000 g for 60 min at 4°C in an ultracentrifuge.a B. Pre-clearing lysates 1. Wash GammaBind Protein G-Sepharose twice, by centrifugation at 200 g for 1 min in excess lysis buffer, and resuspend as a 20% (v/v) slurry in lysis buffer. 2. Add 50 ul of 20% GammaBind Protein G-Sepharose per 1 ml of lysate, and rotate for 1 h at room temperature or overnight at 4°C on an orbital shaker. 3. Centrifuge at 200 g for 1 min at 4°C to pellet the Sepharose and save the supernatant. This pre-clears the lysate of material that binds nonspecifically to GammaBind Protein G-Sepharose.

282

12: Biochemical characterization of lymphocyte surface antigens C. Immunoprecipitation 1. Wash GammaBind Protein G-Sepharose twice, by centrifugation at 200 g for 1 min in excess lysis buffer, and resuspend as a 20% slurry in lysis buffer. 2. Prepare specific antibody-coupled GammaBind Protein G-Sepharose by aliquoting 50 ul of 20% GammaBind Protein G-Sepharose to 1.5 ml microcentrifuge tubes and adding 1 ml of hybridoma culture supernatant, 10 ug of purified antibody, or 10 ul of ascites fluid or serum. Incubate for 1 h at room temperature or overnight at 4°C on an orbital shaker. 3. Wash the Sepharose twice with 1 ml of lysis buffer using a Hamilton microlitre syringe to aspirate the supernatant. 4. Add 0.5 ml of pre-cleared lysate (107 cells) to each microcentrifuge tube and incubate on an orbital shaker for 1-2 h at 4°C. 5. Pellet the Sepharose by centrifugation at 200 g for 1 min and remove the supernatant. This can be saved for immunoprecipitation with other antibodies. 6. Add 1 ml of wash buffer 1 to the pellet, vortex briefly, and spin at 200 g for 1 min. Aspirate the supernatant with a microlitre syringe. Repeat this washing with wash buffers 2 and 3. This stringent wash protocol will remove proteins not binding directly to a high-affinity antibody.b 7. Resuspend the Sepharose in 50-100 ul of SDS sample buffer and boil for 5 min. Spin at 200 g for 5 min and remove the supernatant.c •If time is short, microcentrifugation for 30 min at 10000 g and 4°C is adequate. The lysate may be stored at -70°C at this stage, although storage time may be limited by the half-life of the labelling radioisotope. For each immunoprecipitation, 0.5 ml (107 cells) of lysate is used. bTo detect associated molecules, a less stringent protocol would be to lyse in mild detergent and use 3-5 washes with 0.2-1 ml lysis buffer. cThe eluted antigen can be stored at -20 °C prior to analysis by SDS-PAGE. In this case reboil the sample after thawing, before applying to the gel.

2.4.1 Immunoprecipitation using antibody directly conjugated to Sepharose beads A further improvement to using Protein G-Sepharose is to covalently bind the antibody directly to CNBr-activated Sepharose beads (Pharmacia). Between 1 and 10 mg of antibody can be bound adequately to 1 ml of beads. Antibody-Sepharose is used in exactly the same way as described in the protocol for Gammabind Protein G-Sepharose (see Protocol 4). The immunoprecipitation shown in Figures 1 and 2 were performed using antibody coupled to beads. The quickest immunoprecipitation method, and that which results in the lowest backgrounds, is to use antibody directly coupled to beads. However, it is only worth the cost and effort of purifying and coupling the antibody if it is to be used regularly. If the quantity of antibody is low or only 283

Antony Symons and Marion H. Brown a few immunoprecipitations are required, then the use of Protein G-coupled Sepharose is recommended. 2.4.2 Biochemical analysis of antigens in conjunction with immunoprecipitation The glycosylation status of antigens, purified by immunoprecipitation, can be analysed with different enzymes that cleave different carbohydrate moieties, prior to SDS-PAGE analysis. For example, peptidyl-N-acetylglucosaminidase F (PNGase F) cleaves most N-linked carbohydrate moieties from the protein (15) and O-glycosidase cleaves mature O-linked carbohydrate moieties from glycoproteins (16). Removal of carbohydrate from the antigen is detected as a reduction in apparent molecular weight (see Figure 2). Both these enzymes can be used to estimate the molecular weight of the protein backbone of a glycoprotein. Endo-B-N-acetylglucosaminidase H (Endo H) cleaves immature high mannose carbohydrates, and can be used to study the glycosylationprocessing of a protein in transit to the plasma membrane. Sialic acid attached to N- and O-linked carbohydrate moieties can be depleted with neuraminidase, thereby reducing the charge heterogeneity of an antigen and facilitating interpretation of spots on two-dimensional gels. The following protocol describes the basic method for treating immunoprecipitates with different glycosidases, and indicates specific conditions for the different enzymes. Oglycosidase can be obtained from Boerhinger, along with the instructions for use. Protocol 5. Glycosidase treatment of immunoprecipitated antigens Equipment and reagents 500 U/ul PNGase F (New England Biolabs) 500 U/ul Endo H (New England Biolabs) 100 U/ul neuraminidase (Sigma) Acetone 25% TCA extraction buffer A: 0.1 M TrisHCI pH 7.4,1% 3-mercaptoethanol, 1% SDS

Enzyme digestion buffer B according to the manufacturer. (An appropriate buffer for neuraminidase digestion is: 0.1 mM sodium acetate pH 5.5, 0.3 M NaCI, 0.2% CaCI2) 1 M PMSF SDS sample buffer

Method 1. Immunoprecipitate the antigen as described in Protocol 4. Centrifuge the precipitate after the final wash and discard the supernatant. 2. Add 10 ul of extraction buffer A to the pellet of Sepharose beads with the antigen bound. Boil for 5 min, centrifuge, and retain the supernatant. 3. Resuspend the pellet in a further 10 ul of extraction buffer A and repeat step 3.

284

12: Biochemical characterization of lymphocyte surface antigens 4. Combine the supernatants and add 80 ul of digestion buffer B. Add 1 ul of the appropriate enzyme, e.g. PNGase F, and 1 ul of 1 M PMSF and incubate for 16 h at 37°C. After 16 h add a further 1 ul PNGase F and 1 ul PMSF.a 5. After a total of 40 h add 100 ul of cold 25% trichloroacetic acid (TCA) and leave on ice for 30 min. Centrifuge at 10000 g for 5 min at 4°C in a microcentrifuge. 6. Carefully remove the supernatant and wash the pellet with 1 ml of cold acetone. Centrifuge at 10 000 g for 10 min at 4°C and repeat the acetone wash of the pelletb. 7. Desiccate the tube. Add SDS sample buffer, boil for 5 min, and analyse by SDS-PAGE. aDigestion with Endo H and neuraminidase is usually complete after 16 h, and may also be sufficient at that time for PNGase F. b After the acetone washes, it is not always possible to see the pellet. Do not worry, it is just very small.

The techniques of immunoprecipitation can be modified to compare an unknown antigen with those previously characterized. This is particularly useful if the antibody in use has an unknown specificity. By 'sequential immunoprecipitation' with two different antibodies, it is possible to determine whether the two antibodies recognize the same molecule. The principle of this technique is that if two antigens are identical, removal of one from a cell lysate will prevent the subsequent precipitation of the other. The procedure depends on the removal of the entire first antigen from the labelled cell lysate, which may take more than one cycle of immunoprecipitation. To ensure that a lysate is thoroughly depleted, wash the immunoprecipitates from each cycle and analyse them by SDS-PAGE. The depleted lysate is then used to attempt to immunoprecipitate the second antigen, which is compared with a parallel immunoprecipitation from an undepleted aliquot of lysate as a control. If the depleted lysate has increased in volume, it is important to adjust the volume of the control lysate accordingly. A simpler process can be carried out to address the same question if one of the antibodies binds to antigen on an immunoblot (see Section 4). Prepare an immunoprecipitate with one antibody, blot it, and use the second antibody to probe the blot.

3. SDS-polyacrylamide gel electrophoresis (PAGE) 3.1 Introduction SDS-PAGE is used extensively in the biochemical characterization of lymphocyte surface antigens. The principle of this technique is that proteins are separated, either on the basis of size or charge, by migration through a 285

Antony Symons and Marion H. Brown polyacrylamide matrix (17). Polyacrylamide gels are formed after polymerization of monomeric acrylamide chains and the cross-linking of these chains by N, W-methylene-bisacrylamide. By passing a current through the gel apparatus, negatively charged molecules such as SDS-coated proteins then migrate towards the anode. There are several variations on the basic electrophoretic technique, such as native or denaturing conditions and gradient gels. One-dimensional SDS-PAGE under denaturing conditions in a homogenous gradient is briefly described below (see Protocol 6). For a more comprehensive guide see Gel electrophoresis of proteins (18) and for descriptions of other electrophoretic techniques, such as two-dimensional electrophoresis and isoelectric focusing (IEF), see references 19, 20, respectively. One-dimensional SDS-PAGE of proteins can provide information about the molecular size and purity of proteins. In addition, the number and molecular size of subunits in a protein can be determined by adding a reducing agent (e.g. dithiothreitol). The molecular weight of the proteins of interest determines the percentage of the acrylamide employed. A 12.5% gel is suitable for proteins of molecular weight between 12 and 45 kDa, but high molecular weight proteins will be difficult to distinguish. Alternatively, a 7.5% gel is ideal for proteins of molecular weight between 50 and 150 kDa, but low molecular weight proteins are not resolved. Apparatus for polyacrylamide gel electrophoresis is available from several different companies (e.g. Bio-Rad, Novex, Pharmacia) and in a variety of formats. Large gels (typically 14 X 14 cm) will provide a better level of resolution, but in practice minigels (6 X 8 cm) are sufficient, use fewer reagents, and separate proteins more rapidly. Pre-cast minigels, which provide good reproducibility, can be obtained from Novex: however, these are expensive and since the method for making gels is straightforward, self-cast minigels are adequate for most applications (see Protocol 6). The PhastSystem™ from Pharmacia is an alternative format that enables fast and reproducible electrophoresis. It consists of a separation unit, control and development units, as well as 3.5 X 4.5 cm pre-formed gels. The small gel size of this system is particularly amenable to the analysis of small amounts of protein. Whilst the PhastSystem™ is more expensive than minigel apparatus, its speed and automation are a great advantage. Protocol 6. SDS-polyacrylamide gel electrophoresis Equipment and reagents Acrylamide solution: 30:0.8 acrylamide:bis acrylamide solution (Bio-Rad) Sample buffer: 2% (w/v) SDS, 10% (v/v) glycerol, 80 mM Tris-HCI pH 6.8, 0.01% (w/v) Bromophenol Blue Running buffer: 0.1% (w/v) SDS, 192 mM glycine, 25 mM Tris-HCI pH 8.3

286

Coomassie stain: 52% (v/v) water, 41% (v/v) methanol, 7% (v/v) acetic acid, 1.25% (w/v) Coomassie Brilliant Blue (Sigma) Gel de-stain: 53% (v/v) water, 40% (v/v) methanol, 7% (v/v) acetic acid Pasteur pipettes and a 23-gauge bore needle

12: Biochemical characterization of lymphocyte surface antigens Mini-Protean II (Bio-Rad) or similar electrophoresis apparatus, including casting stand, glass plates, 0.75 mm spacers, and comb containing 1-20 wells (1.5 mm spacers and combs allow more sample to be loaded but result in loss of resolution) Power supply Vacuum chamber and suction pump

H2O-saturated isobutanol in water 20% and 10% SDS (w/v) N, N, N', N'-tetramethylethylenediamine (TEMED, Sigma) 10% (w/v) ammonium persulfate in water (store as 100 ul aliquots at -20°C) Separating and stacking gels (see Table 1)

Method 1. Assemble the gel apparatus in the casting stand using two clean glass plates and two 0.75 mm spacers. Insert a comb into the glass sandwich and make a mark on the glass plate 0.5 cm below the level of the comb before removing it. 2. Prepare the separating gel solution to the required acrylamide percentage, as in Table 1, and degas in the vacuum chamber. Add 100 u,l 10% (w/v) SDS, 50 ul 10% (w/v) ammonium persulfate, and 10 ul TEMED and mix. 3. Using a Pasteur pipette, immediately apply the separating gel solution to the gel apparatus until the height of the solution reaches the mark on the glass plate. Overlay the gel with H2O-saturated isobutanol and allow to polymerize (~30 min at room temperature).3 4. Tip off the isobutanol and prepare the stacking gel, as in Table 1. Degas. Add 100 uj 20% SDS, 50 ul 10% ammonium persulfate, and 20 ul TEMED. Mix and immediately apply the solution on to the stacking gel. 5. Place the comb into the stacking gel solution, making sure that no air bubbles are trapped in the sample wells, and allow the stacking gel to polymerize (—15 min). 6. Once the gel has set, remove the comb and clean the sample wells using a needle (23-gauge bore) and a suction pump. 7. Attach the gel to the gel apparatus, following the manufacturer's instructions. Fill the upper buffer chamber and monitor for leaks. If necessary, reassemble the unit. Carefully pour running buffer into the bottom buffer chamber (~300 ml) and remove bubbles that are trapped at the bottom of the gel. 8. Load the samples into the wells (5-150 ul depending on the size of the wells). The amount of protein loaded depends on the number of proteins in the sample. If there is only one protein, then load about 5 ug. If a mixture of proteins is used, for example, as in membrane preparations or a cell lysate, then load up to 200 ug of protein. 9. Run the gels (towards the positive electrode) until the dye front reaches the bottom (about 1 h at 200 V). Limit the voltage to prevent overheating, which may cause the glass plates to crack. For optimum

287

Antony Symons and Marion H. Brown Protocol 6. Continued resolution, limit the amperage to 20 mA/gel to allow proteins to stack properly before entering the separation gel. 10. To reveal unlabelled protein bands stain the gel in Coomassie Brilliant Blue (15 min) and de-stain as appropriate. Dry the gel down and locate radiolabelled antigens from immunoprecipitates by autoradiography. 11. Alternatively, transfer the gel to blotting apparatus for Western blot analysis. "The overlay/gel interface will be clearly visible once the gel has set. Failure to polymerize the gel is usually the result of a problem with the ammonium persulfate solution.

Table 1. Recipe for acrylamide gels Percentage acrylamide

Separating gels 30:0.8 acrylamide:bis acrylamide solution (ml) Water (ml) 1.5MTris-HCIpH8.8(ml) Stacking gel 30:0.8 acrylamide:bis acrylamide solution (ml) Water (ml) 1MTris-HCIpH6.8(ml)

7.5%

10%

12%

15%

18%

2.5

3.33

4.0

5.0

6.0

4.85 2.5

4.0 2.5

3.35 2.5

2.35 2.5

1.35 2.5

1.3 7.4 1.25

3.2 Detection of proteins Radiolabelled proteins, immunoprecipitated and separated in a polyacrylamide gel by electrophoresis, can be detected by exposure to photographic film. Unlabelled proteins can be detected by direct staining methods. The most common methods used to stain protein gels are Coomassie Brilliant Blue and silver staining. Coomassie staining is the simplest and most inexpensive method, providing good quantitative visualization of protein bands, but its main limitation is that it is not very sensitive. Detection is limited to micrograms of a specific protein band. In contrast, silver staining is up to 100 times more sensitive than Coomassie, but it is not quantitative. Silver staining is quite protein-selective, with staining intensity depending on the amino acid composition and level of glycosylation. Recently, new stains have become commercially available that combine high sensitivity with ease of use and reusability. SYPRO protein gel stains, from Molecular Probes, provide a level of sensitivity higher than that obtained with Coomassie in a two-step method 288

12: Biochemical characterization of lymphocyte surface antigens

Figure 4. Flow diagram of the immunoblotting procedure.

of staining and rinsing. SYPRO stains also have a high dynamic range allowing visualization of proteins at microgram and nanogram levels on the same gel (21). These fluorescent stains require the use of photographic film or a fluorescent imager (e.g. STORM system from Molecular Dynamics) to visualize the protein bands. As well as non-specific staining of most proteins in a polyacrylamide gel, it is also possible to detect specific proteins. In general, this requires blotting the proteins to a matrix and detection with a specific antibody. This technique, termed immunoblotting, is described in the following section.

4. Immunoblotting 4.1 Introduction Blotting is the term used for transferring molecules to a matrix on which they are immobilized. It was originally described for DNA (22), but subsequently a method for the electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets was devised (23). This method is called Western blotting. Immunoblotting describes the technique of probing a Western blot with polyclonal or monoclonal antibodies to identify specific antigens (24). The principle of immunoblotting is the same as for immunoprecipitation in 289

Antony Symons and Marion H. Brown that a specific antibody can identify its antigen in a crude antigen preparation. However, with immunoblotting the antigen is denatured with SDS, followed by SDS-PAGE and transfer to a membrane, before antibody binding. This approach to characterizing lymphocyte antigens is outlined in Figure 4 and described in the following sections. Immunoblotting avoids some of the problems associated with immunoprecipitation, such as the requirement for cell labelling. Furthermore, the antigen to which the antibody binds is directly identified in immunoblotting, whereas in immunoprecipitation other associated molecules may co-precipitate and make it difficult to identify which one bears the relevant epitope. Immunoblotting also has its limitations, the principle being that it is only applicable in those instances where the antibody recognizes an epitope which survives denaturation.

4.2 Preparation of protein samples Identification of antigen by immunoblotting requires the protein to be immobilized on a membrane, where it is identified with a specific antibody. Crude antigen preparations of whole-cell lysates can be used as a target. Whole cells can be directly solubilized in SDS sample buffer (see Protocol 7). However, the use of solubilized whole cells when the antigen is present in low amounts can cause a loss of resolution and increased non-specific background staining, as more cellular protein is loaded on to the gel. Where a membrane protein is to be identified, making membrane preparations can overcome these limitations. Cells solubilized in lysis buffer, as for immunoprecipitation, can be used (see Protocol 4.4A). In this case, add an equal volume of 4% SDS sample buffer and boil for 10 min. Protocol 7. Preparation of whole-cell lysates in SDS sample buffer Reagents 1 M DTT (optional)

PBS pH 7.4

SDS sample buffer

Method 1. Wash the cells in PBS, pH 7.4, to remove proteins present in the culture medium. 2. For efficient solubilization ensure the cell pellet is well dispersed. If necessary, add a small volume (e.g. 10% of the final volume) of PBS. 3. Add 4% SDS sample buffer to a final concentration of 5-10 x 107 cells/ml and boil for 10 min. Reduce samples, if necessary, by adding a 10% volume of 1 M dithiothreitol (DTT) before SDS-PAGE.

290

12: Biochemical characterization of lymphocyte surface antigens

4.3 Blotting proteins Following solubilization, the protein sample is separated by SDS-PAGE. Negatively charged proteins are then electrophoretically transferred to a nitrocellulose membrane where they are immobilized (25). Blotting is performed in a tank of buffer with the gel completely submerged between two electrode panels. Electroblotting tanks are commercially available. The basic apparatus consists of a tank, which holds the transfer buffer and contains platinum electrodes. The configuration of the platinum wire is designed to ensure a uniform electrical field between electrodes, for example the 'Transblot cell' (Bio-Rad) has an S-shaped electrode. The commonly used buffer for transfer from SDS gels to nitrocellulose is 25 mM Tris base, 192 mM glycine pH 8.3, containing 20% (v/v) methanol. This buffer maintains the negative charge of SDS-bound proteins, and the methanol increases the binding capacity of nitrocellulose. For large (>100 kDa) proteins the addition of 0.05-0.1% SDS improves transfer. For small proteins (<50 kDa) transfer in a carbonate buffer at pH 9.9 may be more efficacious. Variations from this method include transfer from other gel systems, such as two-dimensional gels, agarose gels, and urea gels. Nitrocellulose is the most commonly used membrane for immobilization, but other types of membrane, such as PVDF or nylon, can be used. It is important to note that SDS in the transfer buffer can interfere with protein binding to PVDF and nylon membranes. In addition, methanol should not be used in the transfer buffer for nylon membranes. Protocol 8. Transfer of proteins to membrane Equipment and reagents Electroblotting apparatus (Bio-Rad or Hoefer Scientific Instruments) Power supply Scotch-Brite pads Whatman 540 paper or equivalent Transfer membrane: nitrocellulose, PVDF, or nylon (Hybond series from Amersham)

Transfer buffer: 25 mM Tris base, 192 mM glycine, pH 8.3, 20%
Method (see Figure 5) 1. Separate proteins by SDS-PAGE, include one lane of pre-stained molecular weight markers to indicate the membrane orientation and protein transfer. 2. Wear gloves during the following procedures as oil from hands can block transfer. 3. After electrophoresis remove the stacking gel and place the separating gel in transfer buffer. Allow large gels to soak for 20 min to prevent swelling during transfer. 291

Antony Symons and Marion H. Brown Protocol 8. Continued 4. Assemble the transfer sandwich (see Figure 5) in a tray large enough to hold the transfer cassette. Make sure that the transfer cassette is submerged under the buffer to minimize trapping air bubbles. 5. On one half of the transfer cassette, place a Scotch-Brite pad soaked in buffer, followed by two pieces of pre-wetted Whatman 540 paper cut to the same size as the gel. 6. Place the gel on top of the filter paper. 7. Cut the transfer membrane to the same size as the gel. Place the membrane slowly into transfer buffer, leading with one edge to prevent air being trapped in the membrane. Pre-soak PVDF membranes in 100% methanol for 10 sec. 8. Wet the surface of the gel and place the transfer membrane on top of the gel, making sure there are no bubbles between the gel and the membrane. Remove bubbles by rolling a pipette across the surface.3 9. Complete the sandwich with the other two layers of Whatman paper and Scotch-Brite pad, respectively. Lock the top half of the transfer cassette into place. 10. Ensure the whole sandwich is saturated with buffer and place in the carrier for the blot apparatus. Make sure it is a tight fit, without distorting the gel. Add extra Scotch-Brite pads, if necessary. 11. Submerge the carrier in the blotting tank containing transfer buffer and connect the leads to the power supply. For transfer from SDS gels at pH 8.3 the proteins are negatively charged and will travel towards the positively charged anode. Therefore, ensure the transfer membrane is on the anode side. 12. Transfer proteins to the membrane at 100 V (constant voltage) for 1 h, or overnight at 20 V.b 13. After transfer, dismantle the apparatus. Remove the transfer membrane, noting the orientation of the blot. Cut off one corner of the membrane or label it with a pencil. 14. Stain the gel with Coomassie Brilliant Blue to check the extent of transfer. Alternatively, use Ponceau S, which reversibly stains the membrane, to visualize transferred proteins. • It is important not to trap bubbles at any stage as they block protein transfer. b It is preferable to have the blotting tank in the cold room and to use a water cooling system, particularly for rapid transfer at high voltage. The apparatus can be placed on a magnetic stirrer to circulate the buffer.

4.3.1 Practical tips for protein blotting If the same protein sample is to be probed with multiple antibodies, a large well can be used when setting up the polyacrylamide gel, and the membrane 292

12: Biochemical characterization of lymphocyte surface antigens

Figures. Schematic representation of the blotting sandwich.

cut into strips after transfer (known as a 'Spaghetti Western'). If a number of different antigen preparations are to be used, load the samples to be probed with the same antibody next to each other to minimize the number of times the membrane must be cut. Pre-stained molecular weight standards (e.g. from Amersham or BRL) are the ideal reagents to use for blotting. The transfer of pre-stained markers gives an immediate indication of transfer efficiency. They are also useful when the nitrocellulose has to be cut into several strips, as they can be used to mark the cutting line and to re-align strips. The efficiency of protein transfer to the membrane can be assessed by Coomassie staining the gel after blotting and by reversible staining of the nitrocellulose membrane (26). If no transfer of protein has occurred, check that the power supply is properly connected and that the orientation of the gel and membrane, relative to the cathode and anode, was correct. The membrane should be between the gel and the anode (27). The correct buffer conditions are also important for efficient blotting (see above). In addition, gel composition and thickness affect transfer efficiency (28). Thinner gels transfer much more efficiently than thicker gels (e.g. 0.75-mm thick compared to 1.5 mm), and gels with a higher acrylamide percentage will transfer less efficiently. For example, myosin (200 kDa) is mostly retained in a 12% gel but transfers well from a 5% gel. If the transfer efficiency is low, increase the transfer time or power. Cooling the blotting unit is generally required for transfers longer than 1 h. If clear white areas are apparent on the membrane after transfer, air bubbles were trapped in the blotting sandwich. Take greater care to ensure that all bubbles are excluded. Occasionally, a grid pattern may appear on the membrane after staining. This is caused by having the gel or the membrane too close to the cassette, and can be corrected by adding more layers of filter paper to the sandwich. 293

Antony Symons and Marion H. Brown Protocol 9.

Reversible staining of transfer membrane

Note that nylon membranes are not compatible with this protocol. Equipment and reagents Staining solution: 0.1% (w/v) Ponceau S (Sigma), 5% (v/v) acetic acid

Nitrocellulose or PVDF membrane Molecular weight markers

Method 1. Place the nitrocellulose or PVDF membrane in the staining solution for 30 sec. 2. Destain the membrane for 2 min in water. Mark any molecular weight markers that are not pre-stained with a pencil. 3. Completely destain the membrane by soaking for a further 10 min in PBS or water.

4.4 Detection of antigen After blotting, transferred proteins are immobilized on the surface of the membrane, providing access for reaction with immunodetection reagents. First, the membrane is incubated in a protein and/or detergent blocking solution to saturate non-specific sites remaining on the membrane. The specific antibody is then bound to the antigen on the nitrocellulose membrane and its location visualized. This involves detection of antigen-antibody complexes with a labelled secondary reagent. Generally, an enzyme conjugated to an antibody, which recognizes the constant region of the primary antibody, is used. A variety of agents are currently used to block binding sites on the membrane, including BSA, dried milk powder, Tween-20, casein, and serum. A solution of 0.1% Tween-20, 5% dried milk powder in PBS is a convenient blocking agent for most membranes. However, dried milk contains endogenous alkaline-phosphatase activity that leads to high backgrounds when using alkaline phosphatase-based detection systems (see below). Purified BSA or casein is preferred in this case. Enzyme-based detection systems are now widely used for visualization (29, 30). These detection systems are simple to use, take minutes to develop, and are sensitive enough to detect nanogram quantities of specific antigen, although this does vary between different antibodies. Antigen-antibody complexes are identified with horseradish peroxidase (HRP) or alkaline phosphatase enzymes coupled to a secondary anti-Ig antibody (e.g. rabbit anti-mouse Ig). These enzymes act on the substrate to form an insoluble, luminescent (ECL detection system used with HRP-conjugates, Amersham) or fluorescent (ECF system, alkaline phosphatase-antibodies, Amersham) 294

12: Biochemical characterization of lymphocyte surface antigens

Figure 6. CD48 expression on rat peritoneal exudate cells. Cell lysates were prepared in 1% NP-40 and TO6 cell equivalents per lane analysed under non-reducing conditions on a 10% SDS-polyacrylamide gel followed by blotting to nitrocellulose and detection with mAbs. Rat CD48 was detected as a 43-56 kDa glycoprotein with mAb 0X45 (lane 1), and mAb 0X21, specific for human Factor I, was used as a negative control (lane 2), Two bands at approximately 180 kDa and >250 kDa were observed in both lanes. These bands are probably due to cross-reaction of the anti-mouse secondary antibody with surface IgG and surface IgM present on B cells in the cell lysate.

reaction product that can he detected with photographic film or a fluorescent imager, respectively. Biotinylated proteins analysed by SDS-PAGE and blotted can be delected in a similar fashion using streptavidin-enzyme conjugates rather than a primary antibody. This approach is commonly used in conjunction with cell-surface labelling and immunoprecipitation. In planning a controlled immunoblotting experiment, it is important to consider that non-specific binding of antibodies can occur (see Figure 6), and therefore control antigens and antibodies should always be run in parallel (28). In addition, primary and secondary antibody concentrations should always be optimized for the best signal-to-noise ratio. Spotted blots generally indicate that the antibody concentrations used are too high, or that the blocking and washing steps have not been carried out carefully enough. Protocol 10. Detection of antigen on bfots Equipment and reagents Secondary antibody (e.g. HRP-conjugated anti-lg antibody, Sigma) Detection system reagents (e.g. ECL or ECF, Amarshaml

Wash buffer: 0.1% Tween-20 in PBS Blocking buffer: 6% dried milk po\ 0.1% Tween-20 in PBS Tray or Petri dish Primary antibody

Method 1. Place the transfer membrane in a square Petri dish with 10 ml of the blocking buffer. Incubate at room temperature for 1 h on a rocking platform.

295

Antony Symons and Marion H. Brown Protocol 10.

Continued

2. Briefly wash the membrane with washing buffer and then wash once for 15 min, and twice for 5 min, with fresh changes of washing buffer, at room temperature, on a rocking platform. Use as large a volume as possible of washing buffer each time: 1-2 ml of buffer per cm2 of membrane is suggested. 3. Dilute the primary antibody in blocking buffer.3 4. Incubate the membrane in diluted antibody for 1-2 h at room temperature.6-0 5. Wash the membrane as detailed in step 2. 6. Dilute the labelled secondary antibody in blocking buffer.'' 7. Incubate the membrane in the diluted second antibody for 1 h at room temperature. 8. Wash the membrane as detailed in step 2, and then wash twice more for 5 min each time with fresh buffer. 9. Develop according to the appropriate visualization protocol {see the manufacturer's guide). • Dilution of the primary antibody required to give optimum results will vary and should be determined empirically. Typically, polyclonal antisera can be diluted 1:1000 to 1:5000, hybridoma supernatants 1:10 to 1:100, and ascites fluid >1:10000. These dilutions are given for detection by luminescence (ECL) and may vary with other visualization systems. 'Backgrounds may be improved by incubating at 4°C, and longer incubations may be more effective (overnight at 4"C). "10 ml of diluted antibody in a square Petri dish is ample, and less than half this volume is sufficient for smaller membrane strips if incubations are carried out in a smaller container. d Commercially available enzyme-conjugated antibodies are usually diluted -1:2000 prior to use.

5. Strategies for the identification of new molecules 5.1 Affinity chromatography The principles described in this chapter can be applied to characterize an unknown antigen at the genetic level. Affinity columns of antibody-coupled Sepharose can be made to purify microgram quantities of specific antigen from large volumes of cell lysates (31). Protein sequencing may then lead directly to the identification of the gene by screening protein database resources. Alternatively, if the protein has not previously been described, degenerate oligonucleotides can be synthesized for library screening or PCRbased approaches. The purified antigen may be used to raise a polyclonal antisera if the protein sequence is difficult to obtain, which may be useful for screening a bacterial expression library. 296

12: Biochemical characterization of lymphocyte surface antigens

5.2 Ligand hunting Once a surface antigen has been characterized one of the first questions to be asked is, 'What is its ligand?' If, from the predicted structure, the antigen is thought to be involved in cell-to-cell interactions (32), different techniques from those described in this chapter for a high-affinity antibody are required to characterize the interaction. Interactions between cell-surface molecules are generally of low affinity (33) and therefore a multivalent ligand-binding tool is essential. This can be constructed by expressing the extracellular region of the molecule as a recombinant fusion protein. The divalency of the widely used Ig fusion protein may be sufficiently avid for binding to cell-surface ligands (34). Additional methods to increase valency further have also been developed (35-37). Expression cloning is then often pursued using a cDNA library from the cell type to which the multivalent reagent bound.

References 1. Meisenhelder, J. and Hunter, T. (1988). Nature, 335,120. 2. Coligan, J. E., Gates III, F. T., Kimball, E. S., and Maloy, W. L. (1983). In Methods in enzymology, Vol. 91 (ed. C. H. W. Hirs and S. N. Timosheff), p. 413. Academic Press, London. 3. Omary, M. B. and Trowbridge, I. S. (1981). J. Biol. Chem., 256, 4715. 4. Cantrell, D. A., Davies, A. A., and Crumpton, M. J. (1985). Proc. Natl Acad. Sci. USA, 82, 8158. 5. Hubbard, A. L. and Cohn, Z. A. (1976). In Biochemical analysis of membranes (ed. A. H. Maddy), p. 427. Wiley, London. 6. Sargiacomo, M., Lisanti, M. P., Graeve, L., LeBivic, A., and Rodriguez-Boulan, E. (1989). J. Membr. Biol., 107, 277. 7. Graeve, L., Drickamer, K., and Rodriguez-Boulan, E. (1989). J. Cell. Biol., 109, 2809. 8. Lisanti, M. P., LeBivic, A., Sargiacomo, M., and Rodriguez-Boulan, E. (1989). J. Cell. Biol., 109, 2117. 9. Samelson, L. E., Harford, J., Schwartz, R. H., and Klausner, R. D. (1985). Proc. Natl Acad. Sci. USA, 82, 1969. 10. Oettgen, H. C., Pettey, C. L., Maloy, W. F., and Terhorst, C. (1986). Nature, 320, 272. 11. Weissman, A. M. (1996). In Current protocols in immunology (ed. R. Coico), Unit 8.2. Wiley, London.. 12. Swarup, G., Cohen, S., and Garbers, D. L. (1982). Biochem. Biophys. Res. Commun., 107, 1104. 13. Trumbore, M. W., Wang, R. H., Enkemann, S. A., and Berger, S. L. (1997). J. Biol. Chem., 272, 26394. 14. Springer, T. A. (1996). In Current protocols in immunology (ed. R. Coico), Unit 8.3. Wiley, London. 15. Brown, M. H., Krissansen, G. W., Totty, N. F., Sewell, W. A., and Crumpton, M. J. (1987). Eur. J. Immunol., 17, 15. 297

Antony Symons and Marion H. Brown 16. Katoh, S., McCarthy, J. B., and Kincade, P. W. (1994). J. Immunol., 153, 3440. 17. Laemmli, U. K. (1970). Nature, 227,680. 18. Hames, B. D. and Rickwood, D. (ed.) (1981). Gel electrophoresis of proteins: a practical approach, IRL Press, Oxford. 19. O'Farrell, P. H. (1975). J. Biol. Chem., 250, 4007. 20. O'Farrell, P. Z., Goodman, H. M, and O'Farrell, P. H. (1977). Cell, 12, 1133. 21. Steinberg, T. H., Jones, L. J., Haughard, R. P., and Singer, V. L. (1996). Anal. Biochem.,239, 223. 22. Southern, E. M. (1975). J. Mol. Biol, 98, 503. 23. Towbin, H., Staehelin, T., and Gordon, J. (1979). Proc. Natl Acad. Sci. USA, 76, 4350. 24. Towbin, H. and Gordon, J. (1984). J. Immunol. Meth., 72, 313. 25. Peluso, R. W. and Rosenberg, G. H. (1987). Anal. Biochem., 162, 389. 26. Salinovich, O. and Montelaro, R. C. (1986). Anal. Biochem., 156, 341. 27. Johnstone, A. and Thorpe, R. (1992). Immunochemistry in practice. Blackwell Science, Oxford. 28. Bjerrum, O. J., Larsen, K. P., Heegaard, N. H. H. (1988). In CRC handbook of immunblotting of proteins (ed. O. J. Bjerrum and N. H. H. Heegaard), p. 227. CRC Press, Boca Raton, FL. 29. Gillespie, P. G. and Hudspeth, A. J. (1991). Proc. Natl Acad. Sci. USA, 88, 2563. 30. Schneppenheim, R., Budde, U., Dahlmann, N., and Rautenberg, P. (1991). Electrophoresis, 12, 367. 31. Williams, A. W. and Barclay, A. N. (1982). In Handbook of experimental immunology, Vol. 1 (ed. D. M. Weir), Chapter 22. Blackwell Science, Oxford. 32. Barclay, A. N., Brown, M. H., Law, S. K. A., McKnight, A. J., Tomlinson, M. G., and van der Merwe, P. A. (1997). The leucocyte antigen facts book (2nd edn). Academic Press, London. 33. Van der Merwe, P. A. and Barclay, A. N. (1994). Trends Biochem. Sci., 19, 354. 34. Simmons, D. (1993). In Cellular interactions in development (ed. D. Hartley), p. 93. IRL Press, Oxford. 35. Tomschy, A., Fauser, C., Laudrehr, R., and Engel, J. (1996). EMBO J., 15, 3507. 36. Brown, M. H., Preston, S., and Barclay, A. N. (1995). Eur. J. Immunol, 25, 3222. 37. Altman, J., Moss, P. A. H., Goulder, P., Barouch, D., McHeyzer-Williams, M., Bell, J. L, McMichael, A. J., and Davis, M. M. (1996). Science, 274, 94.

298

13 Measurement of cells undergoing apoptosis Y. FURUKAWA and C. R. M. BANGHAM

1. Introduction 1.1 Definition of apoptosis Apoptosis is a distinct mode of cell death that is responsible for the deletion of cells during development, and the deletion of superfluous cells from normal tissue; sometimes it also occurs in pathological situations. Apoptosis was originally detected because of the distinctive morphology of apoptotic cells, which allows them to be easily distinguished from healthy cells and from those dying by necrosis. Although different cell types do not always display all the hallmarks of apoptosis, cell death by apoptosis does have characteristic features such as shrinkage of the cell, membrane blebbing, chromatin condensation, and nuclear fragmentation (1).

1.2 Importance of apoptosis in lymphocyte biology 1.2.1 Central tolerance (thymic deletion) During T-cell development, there are several stages at which T cells may die by apoptosis (2). Stem cells enter the thymus from the bloodstream and the majority (over 95%) of newly generated thymocytes die within the thymus. In the early stage of T-cell development, those T cells that fail to rearrange Tcell antigen receptor (TCR) p-chain genes will die. After the successful rearrangement of B- and a-chain genes, thymocytes expressing TCRs that cannot interact with self-MHC molecules will die by 'neglect'; and those thymocytes with strong reactivity to self-antigens are purged from the repertoire by negative selection. The only thymocytes that survive are those that are positively selected for their ability to bind complexes of HLA and self-peptide, but which are not activated by the complexes. The precise means by which positively and negatively selected T cells are distinguished is not yet understood, but the affinity of the TCR for the MHC-peptide complex appears to play an important part (3). At each of these stages, the unwanted cells die by apoptosis.

Y. Furukawa and C. R. M. Bangham 1.2.2 Peripheral tolerance (peripheral deletion of autoreactive lymphocytes) Mature lymphocytes that have left the generative organs and encounter selfantigens are controlled by peripheral tolerance. This includes at least three mechanisms. If mature lymphocytes encounter the antigen without costimulation, or actively block the co-stimulation, functional unresponsiveness is induced. In some cases, self-antigen causes activation-induced cell death, in which binding of Fas-ligand (Fas-L) to Fas induces apoptosis. Another mechanism of peripheral tolerance is regulated by cytokines such as IL-2 (4). Selftolerant or bystander B cells also die by apoptosis during cognate B-T-cell interactions, when they present antigen with MHC to the T cell but do not receive a signal from the B-cell antigen receptor (5). 1.2.3 Elimination of superfluous antigen-specific lymphocytes at the termination of an immune response After a transient stimulation of the immune system, such as an acute viral infection, most responding lymphocytes die, but some will survive as memory cells and maintain a state of equilibrium. There are two known mechanisms by which the superfluous lymphocytes are eliminated. The first mechanism is the loss of the antigenic stimulation that provides necessary survival and growth signals to lymphocytes; this loss results in apoptosis. The second mechanism is known as activation-induced cell death. When T cells are exposed to repeated antigenic stimulation such as by self-antigen, activation of the T cell also leads to the co-expression of Fas and Fas-ligand, resulting in the death of the T cell and possibly of neighbouring cells (4).

1.3 Recognition of apoptotic cells by phagocytes Apoptotic cells that have undergone the characteristic morphological and biochemical changes of apoptosis (1) are recognized by the phagocyte or mononuclear phagocytic system (6). Changes in the plasma membrane result in the exposure of phosphatidylserine residues on the outer plasma membrane leaflet (see Section 2.4) and these phosphatidylserine residues lead to a procoagulant state or to inflammatory reactions (7). Removal of apoptotic cells helps to prevent potential inflammatory reactions and may prevent the development of an autoimmune response. In general, apoptotic cells excite little inflammation. However, there is some evidence that antigen from apoptotic cells can be presented to the immune system (8). Those apoptotic cells in the bloodstream are rapidly cleared by the mononuclear phagocytic system, so it is difficult to detect late apoptosis of peripheral blood cells in vivo.

1.4 Recent advances in our understanding of apoptosis The apoptotic process can be divided into at least three functionally distinct phases (9): 300

13: Measurement of cells undergoing apoptosis (a) the initiation phase; (b) the effector phase; and (c) the degradation phase. 1.4.1 New death receptors and ligands identified The initiation phase of apoptosis can be triggered by a variety of stimuli, which include the absence of survival factors, radiation, and steroids. More recently, a family of receptors that transmit death-signals have been characterized, of which the Fas/Fas-ligand and tumour necrosis factor-alpha (TNFa) and TNF receptor (TNFR1) pathways are particularly well known (10). TNF-a and Fas-ligand belong to the TNF family, which possess a homologous extracellular domain. Fas and TNFR1 belong to the TNF receptor family, whose members share a homologous extracellular domain, consisting of two to six cysteine-rich pseudo-repeats. In the TNFR family, Fas and TNFR1 also have a homologous intracellular domain called a death domain which can mediate the signal for apoptosis (see Section 1.4.3). A new member of the TNF family that can mediate apoptosis was recently described and named TRAIL (TNF-related apoptosis-inducing ligand), but the TRAIL receptor has not yet been identified (11). Additional receptors with homology to TNFR and that can mediate apoptosis are currently under investigation—these include a receptor named, by different groups, as: the death receptor (DR3); wsl-1; apo-3; TRAMP (TNFR-related apoptosismediating protein); or LARD (lymphocyte-associated receptor of death) (12-16). DR3 is not the receptor for TRAIL, and its own ligand is still unknown. DR3 is preferentially expressed in tissues enriched with lymphocytes, and has at least 11 alternatively spliced RNA forms: the longest of these, encoding a transmembrane portion, is generated when lymphocytes are activated. An additional apoptosis-inducing receptor, DR4, has recently been identified, which also belongs to the TNFR family and is the receptor for TRAIL (17). DR4 is expressed in most human tissues and has two cysteine-rich pseudo-repeats in the extracellular domain: TNFR and DR3 has four such repeats and Fas has three. The intracellular death domain has 30% aminoacid sequence identity to TNFR1, 28% to DR3, and 19% to Fas. TRAIL can induce rapid apoptosis in many transformed cell lines of diverse origin, so it could be important in tumour-cell lysis. However, TRAIL is also expressed in many normal human tissues; most cells also bear DR4 and yet are not stimulated to apoptosis when they encounter TRAIL, so the physiological role of the TRAIL-DR4 pathway is not yet understood. One possible explanation why TRAIL does not kill DR4-expressing cells in normal tissues was suggested by the identification of other receptors for TRAIL. DR5 (18) (also called Trick 2 (19), TRAIL-R2, or KILLER/DR5) can also transmit a signal for death, but there are two 'decoy' receptors for 301

Y. Furukawa and C. R. M. Bangham TRAIL which bind TRAIL but do not mediate the signal for death. Decoy receptor 1 (DcRl) (18) (also called TRID, LIT, or TRAIL-R3) lacks an intracellular signalling domain and DcR2 (20) bears a truncated death domain. 1.4.2 Central role of mitochondria in apoptosis In the effector phase of apoptosis, disruption of the mitochondrial transmembrane potential (A^m) has been observed in a variety of different systems (21). It is thought that this A^Pm disruption is both necessary and sufficient for cell death: it precedes other manifestations of apoptosis, including plasma membrane alterations, chromatin condensation, and DNA fragmentation. It has been suggested that mitochondrial constituents leak out through the permeability transition channels, and activate the apoptotic machinery in the cytosol. These apoptosis-inducing factors in the mitochondria include cytochrome c (22) and an approximately 50-kDa protein (23). It remains unclear if the loss of A^Pm precedes caspase (cysteine proteinase) activation in all cases of apoptosis. In the case of Fas-mediated apoptosis, the mitochondrial permeability transition is known to be preceded by caspase activation (24). It is also not known whether cytochrome c release is always accompanied by disruption of the A^Pm (25). 1.4.3 Caspase enzymes identified At the effector phase of apoptosis, cysteine proteinases (caspases) are activated and cause the biochemical and morphological change of apoptosis. These caspases are present in non-apoptotic cells as inactive proenzymes, but become active when the precursor is cleaved. The best-known activation site of these pro-caspases is immediately after an aspartic acid residue; since the caspases cleave their substrate after aspartic acid, it is possible that caspases are activated by autocatalysis and form a caspase cascade. Although synthetic peptide inhibitors such as zVAD-fmk (benzyloxycarbonyl-Val-Ala-Asp(OMe)fluoromethylketone) and zDEVD-fmk (benzyloxycarbonyl-Asp-Glu-ValAsp(OMe)-fluoromethylketone) can inhibit caspases and allow Fas-stimulated cells to survive and proliferate, the sequential order of the caspase cascade is not yet established. However, through the use of caspase inhibitors, such as YVAD-CHO for caspase-1 (IL l-(3converting enzyme; ICE), DEVD-CHO for caspase 3, and more specific inhibitors, such as VEID-CHO (acetylVal-Ile-Asp-aldehyde) for caspase-6 and DMQD-CHO (acetyl-Asp-MetGln-Asp-aldehyde) for caspase-3, the cascade is now becoming clearer (26). In Fas-mediated apoptosis, after the trimerization of Fas by Fas ligand, FADD (Fas-associating protein with death domain) is sequestered by the death domain of Fas; the death-effector domain of FADD recruits caspase-8, which forms a death-inducing signalling complex (DISC) and activates caspase-8 (10). Caspase-7 and caspase-3 are activated by caspase-8, and, in turn, caspase-3 activates caspase-6. Both caspase-3 and caspase-6 cleave nuclear mitotic apparatus protein (NuMA) in different sites, and this is thought to 302

13: Measurement of cells undergoing apoptosis mediate the nuclear changes of apoptosis. Caspase-3 is also thought to mediate phosphatidylserine externalization on the cell membrane. Caspase-8 also activates other caspases, and it is thought that the mitochondrial permeability transition is preceded by caspase activation in Fas-induced apoptosis (24). 1.4.4 Interaction between virus proteins and the apoptosis machinery of the cell Some viruses can inhibit apoptosis of infected cells to prolong the time available for their replication. At the induction phase, herpes simplex virus type 2 (HSV2) can reduce FasL expression on the cell surface, and several poxviruses produce soluble TNFR to neutralize TNF and so inhibit apoptosis. At the effector phase, some herpesviruses (e.g. EHV2, HHV8, BHV4, HVS, MC159) produce v-FLIPS (viral FLICE [FADD-like ICE] inhibitory protein), which interacts with the death-effector domain of FADD or pro-caspase-8 and blocks the signal from the death signal-transmitting receptors (27). P35 protein of baculovirus inactivates the activated caspase-8, and CrmA protein of cowpoxvirus inhibits the caspase cascade (28). 1.4.5 Inhibitors and triggers of apoptosis are becoming better defined Through the genetic study of the nematode Caenorhabditis elegans, it is clearly established that two genes, ced3 and ced4, are needed for all programmed cell death that occurs during development, and that another gene, ced9, suppresses the action of ced3 and ced4. Vertebrate homologues have been identified for ced3 (caspase), and for ced9 which is related to bcl-2. A vertebrate homologue for ced4 has recently been identified (29). In the bcl 2-related proteins, some (such as bcl-2, bcl-xL, Mcl-1, and Al) are inhibitors of programmed cell death, whereas others (such as Bax, Bad, Bak, Bik, and Bid) promote programmed cell death. It is known that these bcl-2 family members can dimerize and thereby antagonize or enhance each other's function, but it is not clear how they regulate the activation of caspases. One mechanism by which bcl-2 inhibits apoptosis is by blocking the loss of the mitochondrial membrane potential (30) and the release of cytochrome c (31).

2. Methods available to assay apoptosis We have summarized above how signals from many different molecular pathways are able to induce apoptosis. These signals are brought together in a final common effector phase, which involves the disruption of the mitochondrial transmembrane potential and caspase activation. During the last phase of apoptotic degradation of the cell, the morphology and characteristic biochemistry of apoptosis become apparent (i.e. loss of plasma membrane asymmetry, reactive oxygen generation, cytoplasmic alterations, and finally DNA fragmentation). In this chapter, we describe three 303

Y. Furukawa and C. R. M. Bangham different flow-cytometric methods to detect late apoptotic change as well as early apoptotic change in combination with the phenotype of the cells. Late apoptotic cells with DNA fragmentation can be detected by the TUNEL (terminal deoxynucleotidyl transferase-mediated dUTP nick endlabelling) method (32). However, these late apoptotic cells are rapidly cleared by the mononuclear phagocyte system in vivo, so that apoptosis cannot be detected in freshly isolated peripheral blood using the conventional gel electrophoresis method (DNA laddering: see below) or TUNEL. There are two early and general apoptotic changes before DNA fragmentation: (a) a loss of mitochondrial transmembrane potential (A^Pm) and (b) the aberrant exposure of phosphatidylserine (PS) residues on the outer membrane leaflet. To detect these early apoptotic changes, a mitochondrial dye CMXRos is used to detect the disruption of the transmembrane potential of mitochondria (33), and Annexin V is used to detect PS on the outer membrane leaflet (34). The lymphocyte isolation procedure is presented in Protocol 1. Protocol 1. Isolation of lymphocytes from peripheral blood Equipment and reagents Blood collection equipment, including a heparinized 20 ml syringe (50 U/ml) and heparinized 50 ml tube (50 U heparin/17 ml of blood) PBS

2% FCS in PBS RPMI R/10: 10% FCS in RPMI R/1: 1% FCS in RPMI Histopaque (Sigma)

Method' 1. Collect blood into a heparinized 20 ml syringe, mix well, and transfer to a 50 ml tube. 2. Put the 50 ml tube on ice. 3. Dilute with an equal volume of RPMI (pre-cooled on ice). 4. Mix thoroughly by gentle inversion. 5. Place 15 ml of Histopaque into a fresh 50 ml tube and very gently layer a half to a third of the diluted blood on to the Histopaque. Avoid mixing the blood with the Histopaque. 6. Centrifuge at 400 g for 30 min at 4°C with the centrifuge brake off. 7. Collect PBMCs from the intermediate zone between the Histopaque and plasma and transfer the cells to another 50 ml tube. 8. Resuspend the PBMCs with 50 ml of ice-cold R/1. 9. Centrifuge at 250 g for 10 min at 4°C to decrease the contamination with platelets. 10. Decant the supernatant and resuspend the pellet with 10 ml of icecold R/10. 11. Count the number of cells and keep the sample on ice until the next step. 304

13: Measurement of cells undergoing apoptosis

2.1 DNA laddering In the degradation phase of apoptosis, activation of the apoptosis-associated endonuclease cleaves DNA at linker regions between nucleosomes, resulting in fragments of 180-200 bp and multiples of this unit length (mono- and oligonucleosomes). In a cell population, this type of cleavage can be assessed by the appearance of a ladder of bands on a conventional agarose electrophoresis gel. The advantage of this method is the positive detection of apoptosis, and a DNA ladder is often considered the biochemical hallmark of apoptosis. The disadvantage of this method is that it is insensitive, essentially qualitative, and can only detect the very late stages of apoptosis.

2.2 Analysis of light scatter by flow cytometry (size and granularity) One of the characteristic features of apoptosis is cell shrinkage. The plasma membrane becomes convoluted and acquires a blebbed appearance. In addition to cell shrinkage, the apoptotic cell finally develops chromatin condensation and nuclear fragmentation. Interaction of the cell with the laser beam in the flow cytometer results in light scatter. Light scattered in the forward direction (forward scatter) correlates with the cell size, and light measured at 90° to the laser beam (side scatter) correlates with granularity. During necrosis, both forward scatter and side scatter decrease rapidly. But in the early stages of apoptosis, the decrease of forward scatter precedes the decrease of side scatter, because of cell shrinkage. However, in the late stages of apoptosis, both forward and side scatter decrease. The advantage of this method is its simplicity: however, the light-scatter changes are not very specific to apoptosis or necrosis. Debris and isolated nuclei also have low-light scatter and so the discrimination between necrosis and apoptosis is not always apparent.

2.3 Terminal deoxynucleotidyl transferase-mediated dUTP nick end-labelling (TUNEL) The recent application of in situ end-labelling of DNA at the site of cleavage has also proved a useful tool in quantifying the percentage of apoptosis in a population of cells and in identifying individual apoptotic cells. Terminal deoxynucleotidyl transferase (TdT) incorporates nucleotides to free 3' hydroxy termini, which are exposed by the internucleosomal cleavages in an enzymatic reaction. There are several methods described to detect the incorporated nucleotide. Fluorescein labels incorporated in nucleotide polymers can be detected and quantified by flow cytometry. This TdT-based labelling of the blunt ends of double-stranded DNA breaks, independent of a DNA template, is more specific to apoptotic degradation of the DNA than DNA polymerase I-based in situ nick translation, which detects necrotic cells (35). 305

Y. Furukawa and C. R. M. Bangham A simplified, single-step TUNEL method has been developed using deoxynucleotides directly conjugated to fluorochromes (36) and is presented in Protocol 2. Protocol 2. Quantification of apoptotic cells, based on labelling DNA strand breaks by flow cytometry Equipment and reagents PBS 2% paraformaldehyde (PFA) prepared as follows: Measure 1 g of PFA in a 50-100 ml beaker. Add 23 ml of PBS. Add 0.5 ml of 1 NaOH. Heat on hot plate and mix with a stirrer (pH is about 10.5). After the PFA has dissolved add 1 M HCI and adjust the pH to 7.2-7.4. Filter through a 0.2-p.m pore filter (Sarstedt). Add PBS up to 50 ml. (N.B. this gives best results if prepared on the day of the experiment.) 2% fetal calf serum in PBS

Permeabilization solution: 0.1% Triton X100, 0.1% sodium citrate in PBS TdT and TdT reaction buffer (Boehringer Mannheim cat. no. 1684795) Antibodies to cell-surface markers, conjugated with fluorescein, phycoerythrin (PE), or PE-Cy5 (Immunotech) Falcon tubes (cat. no. 2054) Flow cytometer Horizontal shaker

A. Surface marker staining 1. Wash 106 cells with PBS and centrifuge the cells at 300 g for 5 min. 2. Resuspend the cell pellet in 100 (jul of PBS/2% PCS and add 20 pJ of the appropriate cell-surface marker antibody (Immunotech). 3. Incubate for 30 min on ice. 4. Wash the cells twice at 4°C in PBS (each wash 300 g, 5 min). B. Fixation of the cells 1. Resuspend the pellet in 1 ml of fresh 2% PFA in a 5 mL Falcon tube (cat. no. 2054). 2. Incubate for 30 min at room temperature on a shaker (150 r.p.m.). 3. Centrifuge (300 g, 5 min 4°C) and wash once with PBS, then pellet the cells (3000, 5 min 4°C). C. Permeabilization and labelling 1. Resuspend the cells in 100 |o,l of the permeabilization solution and keep on ice for 2 minutes. 2. Wash the cells twice with PBS (300 g, 5 min 4°C). 3. Resuspend the pellet in 50 jjJ of TdT reaction buffer with TdT in a Falcon tube. 4. Incubate for 60 min at 37°C in the incubator. 5. Wash twice with PBS (300 g, 5 min 4°C). 6. Resuspend the pellet in 250 ^l of PBS. 7. Quantify fluorescein-labelled cells by flow cytometry at a wavelength of 525 nm, PE-conjugated surface marker at 575 nm, and PE-Cy5conjugated surface marker at 635 nm. 306

13: Measurement of cells undergoing apoptosis

Figure 1. Late apoptotic B cells in the mixed peripheral blood mononuclear cell before and after 24 h and 72 h in culture, assessed by the TUNEL method in combination with surface marker (CD19) staining.

Figure 1 demonstrates B-cell apoptosis detected by the TUNEL method before and 24 h and 72 h after culture in mixed PBMCs from a normal person. Apoptotic cells are measured with the FITC colour and B cells are stained with anti-CD19 (surface marker for B cells) conjugated with PE. No apoptotic B cells are detected (see quadrant 2 at 0 hour) in the narrow gate (gate 1) and in the wide gate (gate 2) before culture. Subsequently, apoptotic B cells are detected (see quadrant 2 at 24 h and 72 h) mainly in the wide gate (gate 2): this is because late apoptotic cells shrink and change the scatter as described in Section 2.2. It should also be noted that late apoptotic B cells stain less well with the surface marker CD19 than non-apoptotic B cells. 2.3.1 Advantages and limitations This method appears to be the most specific for the positive identification of apoptotic cells, and is quantitative. One disadvantage is that DNA breaks appear during the late stage of apoptosis and, because these cells are rapidly cleared from peripheral blood by the mononuclear phagocyte system in vivo, they cannot be detected by this method. This method is therefore most useful for cells cultured in vitro or those that are not quickly cleared by the mononuclear phagocyte system, such as thymocytes: this is also an expensive method. 307

Y. Furukawa and C. R. M. Bangham

2.4 AnnexinV Vital cells maintain a degree of plasma membrane asymmetry, and phosphatidylserine (PS) is maintained on the inner plasma-membrane leaflet. Apoptotic lymphocytes expose PS on the outer membrane leaflet early after the onset of apoptosis, even though the integrity of the membrane has not been compromised at this stage. PS exposure seems to last from the early execution phase of apoptosis until the final stage, in which the cell is broken up into apoptotic bodies. Annexin V has been shown to interact strongly and specifically with PS in a Ca2+-dependent manner and can therefore be used to detect apoptosis. Cells are simply incubated in a buffer containing recombinant Annexin V conjugated with fluorescein isothiocyanate (FITC) and analysed by flow cytometry. This simple method for detecting PS on the outer membrane leaflet of the apoptotic cell is presented in Protocol 3, Protocol 3. Quantification of Annexin-V binding to apoptotic cells by flow cytometry

Recombinant Annexin V-FITC (commercially available as Annexin-V-FLUOS from Boehringer Mannheim) PBS Hepes buffer: 10 mM Hepes/NaOH pH 7.4, 150 mM NaCI, 5 mM KCI, 1 mM MgCI2, 1.8 mM CaCI2

50 (ig/ml propidium iodide stock solution Annexin V-Fluos labelling solution: predilute 20 (il of Annexin V in 1 ml of Hepes buffer Cell-surface marker antibodies 1% paraformaldehyde (Protocol 2 gives details for a 2% PFA solution)

A. Annexin V assay without fixation 1. Wash 5 X 105 cells with PBS and centrifuge the cells at 200 fir for 5 min. 2. Resuspend the cell pellet in 100 uJ of the labelling solution containing Annexin V. 3. Also stain the cells simultaneously with propidium iodide dye (1 n.g/ml final concentration), to discriminate necrotic cells from apoptotic cells (although secondary necrotic cell are also double-positive). 4. Add antibodies to bind cell-surface markers. 5. Incubate for 30 min on ice. 6. Add 0.4 ml of Hepes buffer. 7. Quantify Annexin-V binding by flow cytometry. B. Annexin V assay with fixation It is best to analyse samples without fixation to prevent free Annexin V from entering the cell and binding to PS on the inner leaflet of the plasma 308

13: Measurement of cells undergoing apoptosis membrane. However, if necessary (for safety reasons), samples can be fixed after washing in Hepes buffer. 1. 2. 3. 4. 5.

Follow Part A, steps 1-5. Add 3 ml of Hepes buffer. Pellet the cells by centrifugation at 200 g for 5 min. Resuspend the cells in 0.5 ml of 1% paraformaldehyde. Quantify Annexin-V binding by flow cytometry.

NB: It is essential to use Hepes buffer or a buffer containing 1.8 mM calcium for staining and also for washing, since the binding of Annexin V to PS is calcium-dependent.

Figure 2 demonstrates the changes in plasma-membrane phosphatidylserine (PS) distribution during apoptosis induced by Fas ligation in Jurkat cells. PS exposure is detected 1 h after anti-Fas IgM (250 ng/ml) treatment and increases after 2 h. This method can also be combined with surface marker staining. The advantage of this method is that it detects cells early in apoptosis; it is rapid, and permits the quantification of apoptotic cells by flow cytometry (37).

2.5 CMXRos and related dyes Disruption of the mitochondrial transmembrane potential (A<|;m) precedes nuclear signs of apoptosis triggered by different systems (see Section 1.4.2).

Figure2. Time course of phosphatidylserine exposure on the outer plasma-membrane leaflet in Jurkat cells exposed to 250 ng/ml anti-Fas IgM (CH11 from Immunotech) as assessed by the binding of Annexin V-FITC. 309

Y. Furukawa and C. R. M. Bangham Detecting the mitochondrial transmembrane potential can indicate early apoptotic change ex vivo or in vivo. The cytofluorometric Ai]>m quantification is based on the use of cationic lipophilic dyes that are sequestered into the mitochondrial matrix. Unfortunately, most of the potentially sensitive dyes such as 3,3'-dihexyloxacarbocyanine iodide (DiOC6) cannot be fixed and must be measured without fixation (38). This has many disadvantages. The cells must be analysed as soon as they are stained, because the dye rapidly leaks out of the stained cells. Because the dye cannot be fixed, special attention and facilities are required for biologically hazardous samples such as HIV-infected cells. However, Chloromethyl-X-Rosamine (CMXRos) is a paraformaldehydefixable stain for Avjjm quantification, and can overcome these problems. The advantages of CMXRos staining for the quantification of A»]mi are that this can detect the very early stage of apoptosis, and can be combined with surface-marker staining or intracellular staining after fixation. A method for detecting the disruption of Aijjm using CMXRos is presented in Protocol 4. Protocol 4. Chloromethyl-X-Rosamine (CMXRos) staining for detecting mitochondrial transmembrane potential disruption Equipment and reagents 2% fresh paraforrnaldehyde (see Protocol 2} Chloromethyl-X-Rosamine (CMXRos, Molecular Probes) Carbonyl cyanide m-chlorophenylhydrazone (Sigma) PBS (pre-warmed to 37°C and ice cold) RPMI 2% PCS in PBS R/10(RPMI/10%FCS)

DMSO Histopaque (Sigma) Ethanol (Analar grade) Cell-surface marker antibodies (FITC- or PEconjugated) Isotype-matched control antibody Same equipment as Protocol 2 Water bath Falcon centrifuge tubes (cat. no. 2054)

A. CMXRos solution3 1. Before opening the vial, allow it to reach room temperature. 2. Dissolve 1 vial (50 (xg) in DMSO to make a 1 mM stock solution. Store at-20°C in the dark. 3. Make a 200 x intermediate solution from the 1 mM stock solution with DMSO and aliquot 50 uJ to a 15 ml tube. 4. For use, dissolve this aliquot with 10 ml of R/10 to give a final CMXRos concentration of 150 nM. B. Carbonyl cyanide m-chlorophenylhydrazone (rnCICCP) solution 1. Make 50 mM (1000 X) stock solution with 100% ethanol, dissolve at 40 °C.

310

13: Measurement of cells undergoing apoptosis 2. Store at-20 °C. 3. Dilute 1:1000 in R/10 with CMXRos (working concentration for rnCICCP is 50 jjuM). C. Cell staining with CMXRos* 1. Divide 106 cells equally between two Falcon centrifuge tubes.c 2. Centrifuge at 300 g for 5 min at 4°C. 3. In one tube, resuspend the pellet in 1 ml of CMXRos containing R/10 (pre-warmed to 37°C in a water bath) and resuspend the pellet in the other tube in R/10 containing CMXRos and rnCICCP for the negative control. 4. Gently vortex. 5. Incubate for 15 minutes at 37°C. 6. Centrifuge at 300 gfor 5 minutes at room temperature. 7. Wash the cells with 1 ml of PBS (pre-warmed to 37°C). 8. Centrifuge at 300 g for 5 minutes at room temperature. D. Surface marker staining 1. Resuspend the pellet with 100 ul of PBS/2% FCS and keep on ice. 2. For the sample stained with CMXRos, add a surface marker antibody conjugated with FITC or PE. For the negative control stained with CMXRos and rnCICCP, add an isotype-matched control antibody. 3. Gently vortex, keep on ice for 30 min. 4. Add 3 ml of ice-cold PBS and centrifuge at 300 g for 5 minutes at 4°C. 5. Gently vortex. E. Fixation and analysis 1. Add 1 ml of 2% paraformaldehyde (newly made and pre-warmed to 37°C, see Protocol 2). 2. Vortex gently. 3. Keep on a horizontal shaker at room temperature for 15 min, 150 r.p.m. 4. Centrifuge at 300 g for 5 minutes at room temperature. 5. Wash twice with PBS (pre-warmed to 37°C). 6. Centrifuge at 300 g for 5 minutes at room temperature. 7. Resuspend the pellet in 0.5 ml of PBS and vortex.

311

Y. Furukawa and C, R. M. Bangham Protocol 4. 8. Quantify

Continued FITC-conjugated, surface-marker

labelled

cells

by

flow

cytometry at a wavelength of 525 nm, PE-conjugated surface marker at 575 nm, and CMXRos at 635 nm. * In the first experiment, make different concentrations of the dye solution and decide the most appropriate concentration that gives the best discrimination between the positive control and the negative control. 6 To decide the most appropriate concentration of CMXRos, stain a sample at different concentrations (e.g. dissolve the CMXRos aliquot to 120 nM, 130 nM, 140 nM, 150 nM, 160 nM, 170 nM) and compare with the CMXRos and carbonyl cyanide m-chlorophenylhydrazone containing R/10. "Try to use the same cell density in each tube: low cell concentrations may give a decreased discrimination between the positive control and the negative control.

Figures. Time course of disruption of mitochondrial transmembrane potential (A4>m) in Jurkat cells exposed to 250 ng/ml anti-Fas IgM (CH11 from Immunotech) as assessed by the CMXRos incorporation to the mitochondrial membrane in the third colour (635 nm wavelength). Carbonyl cyanide m-chlorophenylhydrazone (rnCICCP) containing CMXRos was used to make a threshold as a negative control.

Table 1. Annexin V positivity and CMXRos negativity after Fas ligation

0 hour 1 hour 2 hours

Annexin V positivity (%)

CMXRos negativity (%)

2.2 10.1 31.3

0.6 14.0 24.5

312

13: Measurement of cells undergoing apoptosis Figure 3 demonstrates the disruption of mitochondrial transmembrane potential (Aum) during apoptosis induced by Fas ligation in Jurkat cells. Disruption of A»|> is measured in the third colour (635 nm wavelength) 1 h after anti-Fas IgM (250 ng/ml) treatment and increases after 2 h. This method can also be combined with surface marker staining. The percentage of apoptotic cells detected by Annexin-V binding and CMXRos staining after Fas ligation in Jurkat cells are summarized in Table 1. The disadvantage of this protocol is that the staining is very sensitive to the staining conditions (e.g. staining time, fixation, cell concentration), so that it is always necessary to use a negative control to determine an appropriate threshold for each staining.

References 1. Kerr, J. R. R, Wyllie, A. H., and Currie, A. R. (1972). Br. J. Cancer, 26,239. 2. Jameson, S. C. and Sevan, M. J. (1998). Curr. Opin. Immunol., 10, 214. 3. Alam, S. M., Travers, P. J., Wung, J. L., Nasholds, W., Redpath, S., Jameson, S. C., and Gascoigne, N. R. J. (1996). Nature, 381, 616. 4. van Parijs, L. and Abbas, A. K. (1998). Science, 280, 243. 5. Rathmell, J. C., Townsend, S. E., Xu, J. C., Flavell, R. A., and Goodnow, C. C. (1996). Cell, 87, 319. 6. Fadock, V. A., Laszlo, D. J., Noble, P. W., Weinstein, L., Riches, D. W. H., and Henson, P. M. (1993). J. Immunol., 151, 4274. 7. Reutelingsperger, C. P. M. and van Heerde, W. L. (1997). Cell. Mol. Life Sci., 53, 527. 8. Silvestris, F., Frassanito, M. A., Cafforio, P., Potenza, D., Di Loreto, M., Tucci, M., Grizzuti, M. A., Nico, B., and Dammacco, F. (1996). Blood, 87,5185 9. Kroemer, G., Zamzami, N., and Susin S. A. (1997). Immunol. Today, 18,44. 10. Nagata S. (1997). Cell, 88, 355. 11. Wiley, S. R, Schooley, K., Smolak, P. J., Din, W. S., Huang, C. P., Nicholl, J. K., Sutherland, G. R., Smith, T. P., Rauch, C., Smith C. A., et al. (1995). Immunity, 3, 673. 12. Chinnaiyan, A. M., O'Rourke, K., Yu, G-L., Lyons, R. H., Garg, M., Duan, D. R., Xing, L., Gentz, R., Ni, J., and Dixit, V. M. (1996). Science, 274, 990. 13. Kitson, J., Raven, T., Jiang, Y. P. Goeddel, D. V., Giles, K. M., Pun, K. T., Grinham, C. J., Brown, R., and Farrow, S. N. (1996). Nature, 384, 372. 14. Marsters, S. A., Sheridan, J. P., Donahue, C. J., Pitti, R. M., Gray, C. L., Goddard, A. D., Bauer, K. D., and Ashkenazi, A. (1996). Curr. Biol., 6, 1669. 15. Bodmer, J. L., Burns, K., Schneider, P., Hofmann, K., Steiner, V., Thome, M., Bornand, T., Hahne, M., Schrter, M., Becker, K., et al. (1997). Immunity, 6, 79. 16. Screaton, G. R., Xu, X. N., Olsen, A. L., Cowper, A. E., Tan, R., McMichael, A. J., et al. (1997). Proc. NatlAcad. Sci. USA, 94, 4615. 17. Pan, G., Ni, J., Wei, Y. F., Yu, G., Gentz, R., Ni, J., and Dixit, V. M. (1997). Science, 276, 111. 18. Sheridan, J. P., Marsters, S. A., Pitti, R. M., Gurney, A., Skubatch, M., Baldwin, D., Ramakrishnan, L., Gray, C. L., Baker, K., Wood, W. L, et al. (1997). Science, 277, 818. 313

Y. Furukawa and C. R. M. Bangham 19. Screaton, G. R., Mongkolsapaya, J., Xu, X. N., Cowper, A. E., McMichael, A. J., and Bell, J. I. (1997). Curr. Biol., 7, 693. 20. Marsters, S. A., Sheridan, J. P., Pitti, R. M., Huang, A., Skubatch, M., Baldwin, D., Yuan, J., Gurney, A., Goddard, A. D., Godowski, P., and Ashkenazi, A. (1997). Curr. Biol., 7, 1003. 21. Kremor, G. (1997). Nature Med., 3, 614. 22. Liu, X., Kim, C. N., Yang, J., Jemmerson, R., and Wang, W. (1996). Cell, 86, 147. 23. Susin, S. A., Zamzami, N., Castedo, M., Hirsch, T., Marchetti, P., Macho, A., Daugas, E., Geuskens, M., and Kroemer, G. (1996). J. Exp. Med., 184, 1331. 24. Boise, L. H. and Thompson, C. B. (1997). Proc. Natl Acad. Sci. USA, 94, 3759. 25. Kluck, R. M., Bossy-Wetzel, E., Green, D. R., and Newmeyer D. D. (1997). Science, 275, 1132. 26. Hirata, H., Tkahashi, A., Kobayashi, S., Yonehara, S., Sawai, H., Okazaki, T., Yamamoto, K., and Sasada, M. (1998). J. Exp. Med., 187, 587. 27. Thome, M., Schneider, P., Hofmann, K., Fickenscher, H., Meinl, E., Neipel, K, Mattmann, C., Burns, K., Bodmer, J. L., Schrter, M., Scaffidi, C., Krammer, P. H., Peter, M. E., and Tscopp, J. (1997). Nature, 386, 517. 28. Ray, C. A., Black, R. A., Kronheim, S. R., Greenstreet, T. A., Sleath, P. R., Salvesen, G. S., and Pickup, D. J. (1992). Cell, 69, 597. 29. Zou, H., Henzel, W. J., Liu, X., Lutschg, A., and Wang, X. (1997). Cell, 90, 405. 30. Shimizu, S., Eguchi, Y., Kamiike, W., Waguri, S., Uchiyama, Y., Matsuda, H., and Tsujimoto, Y. (1996). Oncogene, 13, 21. 31. Yang, J., Liu, X., Bhalla, K., Kim, C. N., Ibrado, A. M., Cai, J., Peng, T. L, Jones, D. P., and Wang, X. (1997). Science, 275,1129. 32. Gorczyca, W., Gong, J., and Darzynkiewicz, Z. (1993). Cancer Res., 53, 1945. 33. Macho, A., Decaudin, D., Castedo, M., Hirsch, T., Susin, S. A., Zamzami, N., and Kroemer, G. (1996). Cytometry, 25, 333. 34. Martin, S. J., Reutelingsperger, C. P. M., McGahon, A. J., Rader, J. A., vn Schie, R. C. A. A., LaFace, D. M., and Green, D. R. (1995). J. Exp. Med., 182, 1545. 35. Gold, R., Schmied, M., Giergerich, G., Breitschopf, H., Hartung, H. P., Toyka, K. V., and Lassmann, H. (1994). Lab. Invest., 71, 219. 36. Li, X., Traganos, F., Melamed, M. R., and Darzynkiewicz, Z. (1995). Cytometry, 20, 172. 37. Koopman, G., Reutelingsperger, C. P. M., Kuijten, G. A. M., Keehnen, R. M. J., Pals, S. T., and Oers, M. H. J. (1994). Blood, 84, 1415. 38. Macho, A., Castedo, M., Marchetti, P., Aguilar, J. J., Decaudin, D., Zamzami, N., Girard, P. M., Uriel, J., and Kroemer, G. (1995). Blood, 86,2481.

314

14

Thymic organ culture JOHN J. T. OWEN and DEIRDRE E. J. McLOUGHLIN

1. Introduction The maturation of T lymphocytes in the thymus is a complex process involving a number of distinct molecular events. Initially, stem cells migrate from the blood into the epithelial thymic primordium (1). These stem cells then undergo a process of T-cell receptor gene rearrangement resulting in the production of separate populations of ct(i and 78 T cells (reviewed in ref. 2). The development of a (3 T cells is preceded by expression of the pre T-cell receptor which controls the maturational process (3). In addition, differentiation of ap T cells is accompanied by expression of CD4 and CD8 antigens. CD4+ CD8+ thymocytes then undergo a rigorous selection process involving the positive selection of cells with 'useful' T-cell receptors capable of recognizing foreign antigens in 'self MHC, but negative selection of cells with 'harmful' receptors capable of autoreactivity (4). These maturational changes are controlled by stromal cells of the thymus in ways that are still not fully understood. Although the initial stromal cell population is of epithelial origin, the thymus is colonized by macrophages and dendritic cells of blood cell origin. The epithelial cells make the cytokine IL-7 which is required for T-cell maturation (5) and, in addition, they present peptide-MHC complexes during positive selection (6). Macrophages play an important role in removing apoptotic thymocytes (7), and dendritic cells are thought to present antigen during negative selection (8). Therefore, it is not surprising that full T-cell maturation has only been achieved inside the whole thymus, whereas cytokines alone are insufficient to support the process. Hence, organ cultures of embryonic thymus have proved to be the only available means of obtaining T-cell differentiation in vitro. Auerbach first tested the developmental potential of 12-day mouse embryo thymus in organ culture and showed the ability of thymic rudiments to generate lymphocytes (9). Owen and Ritter demonstrated lymphopoiesis in thymic primordia of both chick and mouse embryos cultured in diffusion chambers on the chick embryo chorioallantois (10). In a series of experiments, Robinson and Owen (11, 12) showed the emergence of functional T cells in mouse embryo thymus organ cultures and they provided an early demon-

John J. T. Owen and Deirdre E. J. McLoughlin stration of tolerance induction in the thymus in vitro (13). Subsequently, the method was modified so that alymphoid thymic lobes could be produced by treating organ cultures with 2-deoxyguanosine, which is selectively toxic to lymphoid cells (14). These alymphoid rudiments could then be colonized by donor stem cells, in which even a single stem cell was sufficient for lymphopoiesis (15).The production of separate lymphoid and stromal cell components lead to the development of reaggregate organ cultures, in which defined thymocyte subsets can be cultured with particular stromal cell types (16). One of the key factors in successful organ cultures is the provision of adequate oxygenation to whole tissues. This is achieved in embryonic thymus cultures by the permeability of small embryonic lobes to oxygen and by culture of the lobes at an air-liquid interface. However, it was shown that it is possible to culture slices of newborn mouse thymus in the standard organ culture system, allowing studies on the biochemistry of cell signalling during apoptosis (17). The technique of thymic organ culture and its modifications have been used in a wide variety of studies. These range from the study of lymphocytestromal cell interactions already mentioned, through studies on the effects of antibodies, peptides, and inhibitors on thymocyte maturation (reviewed in ref. 18), to the most recent work on gene transfection in organ cultures (19). There seems little doubt that the method will continue to be of value while the nature of the critical cell-cell interactions involved in T-cell development remains uncertain.

2. Microdissection and organ culture of the murine fetal thymus Fetal thymic organ culture is a system that allows the study of T-cell development under defined, in vitro conditions. The optimal developmental stage for mouse embryo thymus culture is 14-16 days' gestation. By 14 days' gestation, the thymus is colonized by CD4- CDS- precursor cells which will differentiate over a 7-9 days' culture period into CD4+ CD8+ thymocytes and some mature CD4+ and CD8+ T cells. During the same culture period, the thymus lobes increase in size so that each lobe yields approximately 0.5 X 106 cells from an initial population of about 0.2 X 105 cells. However, after 16 days' gestation, the thymus has become sufficiently large for central necrosis due to oxygen deprivation to become a problem. To some extent, this problem can be overcome by carefully slicing lobes into small fragments prior to culture (see Protocol 2).

316

14: Thymic organ culture Protocol 1. Organ culture of fetal thymus lobes Equipment and reagents Dissection microscope (Zeiss or equivalent) Fine forceps (TAAB Laboratories) Fine scissors (TAAB Laboratories) Petri dishes (single vent, 90 mm and 50 mm diameter) 70%ethanol Dulbecco's phosphate-buffered saline (PBS, Sigma) 2-Deoxyguanosine (Sigma) R/10: RPMl-1640 medium containing 20 mm Hepes without NaHCO3 (Sigma), 2 mM L-glutamine (Sigma), 100 U/ml penicillin and 0.1 mg/ml streptomycin (Sigma), 10% (v/v) heat-inactivated PCS (from any suitable source) Artiwrap synthetic support sponge (Medipost)" Nucleopore filters (Costar)b

DMEM: Dulbecco's Modified Eagles Medium containing 4,5 g/l glucose, 110 mg/ml sodium pyruvate, 0.004 g/l pyridoxine HCI (Sigma), 3.7 g/l NaHC03 (Sigma), 4 mM L-glutamine (Sigma), 100 U/ml penicillin and 0.1 mg/ml streptomycin (Sigma), 10% (v/v) heat-inactivated FCS (from any suitable source), 0.00035% 2-mercaptoethanol (Sigma), 1% non-essential amino acids (Sigma), 10 mM Hepes buffer pH 7.3 (Sigma) 50% PBS, 50% R/10 Marine fetal material" Sterile 30 ml Universal container Humidified Perspex box that can be gassed (see step 16 and footnote e) PVC tape 2-deoxyguanosine (see section 2.1)

Method Carry out all manipulations using an aseptic technique in an air-flow cabinet. 1. Remove the complete uterus containing embryos aseptically and place in a sterile 30 ml Universal container for transport to the airflow cabinet. 2. Sterilize forceps and scissors in 70% ethanol and leave to air-dry within the air-flow cabinet. 3. Place the uterus containing the embryos into a 90 mm Petri dish. 4. Using the sterilized dissecting scissors and forceps, carefully cut along the wall of the uterus without puncturing the yolk sac of the embryo. 5. Gently, with forceps, grasp the placenta and pull it free from the wall of the uterus. Place the whole embryo, encased in the yolk sac, in a fresh 90 mm Petri dish containing 50% PBS and 50% R/10. 6. To free the embryo, hold the yolk sac by the placenta with one set of forceps and with the other set, gently tear the sac away from the embryo. Place the latter in a fresh 90 mm Petri dish containing 50% PBS and 50% R/10 (see Figure 1). 7. Place the Petri dish on the dissection microscope and position the embryo so that the whole of it can be seen lying on its side. 8. Holding the embryo by the body with one pair of forceps, take the other pair and position the points around the neck so that one of the points is just beneath the chin. Bring the points of the forceps together to decapitate the embryo (see Figure 2).d

317

John J. T. Owen and Deirdre E. J. McLoughlin Protocol 1.

Continued

9. Turn the torso on to its back, limbs uppermost and, still holding it with one pair of forceps, use the other pair to open up the chest cavity. To do this insert the lower point of a pair of forceps just underneath the ribcage from the neck area of the torso, and then bring the forceps together with a scissor action (see Figure 5). Now open the thoracic cavity to clearly expose the heart and lungs. 10. The easiest way to remove the thymus lobes is to remove the whole thoracic tree, i.e. the heart, lungs, etc. To do this place the forceps under the heart and lungs (see Figure 4) and strip out the thoracic contents in an anterior direction. Place this tissue in a 50 mm Petri dish containing RF10 (see Figure 5). 11. Remove the thymus lobes from the surrounding tissue, leaving a minimum of adherent mesenchyme, but take care not to damage the lobes themselves (see Figure 6). 12. The thymus lobes must be placed in organ culture for them to remain viable. Place 4.5 ml DMEM in a 90 mm Petri dish. 13. Put no more than two pieces of Artiwrap in each dish, ensure they are fully saturated from each side with medium. 14. On top of each piece of Artiwrap place 1 nucleopore filter with the shiny side of the filter uppermost. 15. Transfer five thymus lobes to the top of each filter, be careful not to damage them and only put a maximum of 10 lobes in any one Petri dish (see Figure 7). 16. Place the dishes in an environment containing 10% C02 in air mixture, i.e. a C02 incubator or a humidified Perspex box which is then gassed with the above mixture before being sealed with PVC tape." 17. Incubate at 37°C for the required culture period. "The Artiwrap is cut into squares just slightly larger than the nucleopore filters, these are then boiled for 30 min in distilled water. This process is repeated three times and the squares are then removed aseptically and left to dry in a Petri dish, in the air-flow cabinet. Not only will this process sterilize these synthetic foam supports, it also removes any contaminants in the Artiwrap that may affect the fetal thymic organ cultures. 6 The nucleopore filters are a polycarbonate membrane, 13 mm in diameter and have a 0.8 um pore size. These filters are sterilized by boiling once for at least 30 min, removed aseptically, and left to dry in an air-flow cabinet. c Murine fetal material is usually taken at day 14 or 15 of gestation. Day 0 is taken to be the date of vaginal plug detection. "'This method of removing the head of the embryo can only be used up to 16 days after vaginal plug detection: after this time scissors must be used as skeletal structures become more defined. "Fetal thymic organ cultures are particularly sensitive to pH so it is important that they are gassed for at least 15 min before sealing the box. It is necessary to maintain a pH of 7.2-7.4 and constant humidity for successful organ cultures, therefore the Perspex box method is the preferred choice and it also helps to prevent cross-contamination between Petri dishes in the event of infection.

318

i4: Thymic organ culture

Figure 1. Shows the embryonic yolk sac held by the placenta prior to the release of the embryo.

Figure 2. Shows the position of the forceps to decapitate the embryo.

Figures. The thoracic cavity is opened using a pair of forceps with a scissor action (arrowed).

319

John J. T, Owen and Deirdra E. J. McLoughlin

Figure4. The thoracic tree, as viewed through the chest cavity. The fetal thymic lobes can easily be seen.

Figure 5. Shows the excised thoracic tree with thymus lobes, heart, and lungs.

Figure 6. Fetal thymic lobes isolated at day 15 of gestation.

320

14: Thymic organ culture

Figure 7. Shows a 90 mm Petri dish which has been set up for organ culture. The Artiwrap acts as a synthetic support for the nucleopore filter on top of which the fetal thymic lobes will be placed.

2.1 The production of alymphoid thymus lobes In 1982, Jenkinson et al (14) described a method in which alymphoid thymic lobes can be produced by culturing 14-day mouse embryo thymus lobes with 2-deoxyguanosine. The method is based on the selective toxicity of 2deoxyguanosine for lymphoid cells, leaving the epithelial stroma intact. The alymphoid lobes can be colonized by stem cells derived from fetal liver or thymus, and they can also be used as a source of thymic epithelial cells for reaggregate thymic cultures (see Section 4). The procedure for producing alymphoid lobes is the same as Protocol /, except for the addition of 2-deoxyguanosinc to the culture medium at the beginning of the culture period (step 12) to give a final concentration of 1.35 mM. It is advisable to maintain the cultures for at least 5 days to ensure the complete elimination of lymphoid precursors. The resulting lobes (see Figure 8) contain epithelial cells, fibroblasts, and some macrophages.

Figures. A comparison of a freshly isolated, fully lymphoid fetal thymic lobe, removed at day 15 of gestation with an age-matched thymus lobe which has then been cultured for a further 5 days in 2-deoxyguanosine. Note the characteristic vesicles and flattened appearance of this alymphoid thymus (see Section 2.1).

321

John J. T. Owen and Deirdre E. J. McLoughlin

3. Newborn thymic slice culture Although fetal thymus lobes are an optimal size for organ culture, the number of lymphoid cells generated in these lobes can be limiting, particularly when biochemical assays are required (17). One way around this is to use newborn thymus lobes, which provide many more cells: up to 15 X 106 per thymus as opposed to 0.5 X 106 cells from a thymus lobe isolated at day 15 of gestation and organ-cultured for 7 days. Because of the large size of these newborn lobes, the diffusional exchange of oxygen and nutrients is limited, therefore they need to be bisected to prevent the centre of the lobes becoming anoxic and they can only be cultured for short periods of time, i.e. a maximum of 48 h. Protocol 2. Organ culture of the newborn thymus lobe NB Carry out all manipulations using an aseptic technique in an air-flow cabinet. Equipment and reagents Dissection microscope (Zeiss or equivalent) Fine forceps (TAAB Laboratories) Fine scissors (TAAB Laboratories) Fine knives, e.g. cataract knives (Interfocus Ltd) Blunt knife R/10(see Protocol 7) DMEM (see Protocol 7)

Artiwrap (see Protocol 7) Nucleopore filters (see Protocol 7) Petri dishes, 50 mm diameter Newborn mice 70% ethanol for surface sterilization Humidified Perspex box that can be gassed (see Protocol 7, step 16)

Method 1. Sterilize the scissors, forceps, and fine knives with 70% ethanol and leave to dry in the air-flow cabinet. 2. After cervical dislocation, place the newborn mouse on ice for 5 min to restrict blood circulation when the chest cavity is opened. 3. Make a longitudinal cut along the line of the sternum and open the ribcage to expose the heart and lungs. Locate the thymus lobes: these are situated at the top of the thoracic cavity and have a characteristic opalescent appearance (Figure 9). 4. Take the forceps, place the points underneath each thymus lobe and gently remove them into a Petri dish containing R/10 (Figure 70). 5. Clean away any connective tissue attached to the lobes, without damaging them. 6. Using the fine knives, make one clean cut to bisect each lobe longitudinally.

322

14: Thymic organ culture 7. Take a 50 mm Petri dish containing 1.8 ml of DMEM and place a piece of Artiwrap in the medium. Ensure that the Artiwrap is fully saturated with medium, and place a nucleopore filter on top of it (see Protocol 1, steps 13 and 14}. 8. Carefully transfer a maximum of four thymus fragments on to each filter. If possible keep the cut surfaces uppermost.3 9. Place the dishes in an environment containing 10% CO2 in air (see Protocol 7, step 16). 10. Incubate at 37°C for up to 48 h. 'Each fragment of the thymus has now got an open surface and is therefore very delicate, careful handling is needed to avoid forcing the thymocytes out of tha lobe. It is bast to USB a blunt knife to manipulate them from the dish into organ culture as forceps may apply too much pressure to the fragment.

Figure9. The thoracic cavity of a newborn mouse with the front part of the ribcage removed. The thymus lobes are large and easily visible.

Figure 10, Freshly isolated newborn thymus lobes.

323

John J. T. Owen and Deirdre E. J. McLoughlin

4. Reaggregate thymus organ culture The thymus is made up of several heterogeneous populations of cells, thus making it difficult to study the interactions between thymocytes and individual stromal cell types. Reaggregate organ culture is a technique that allows the association of defined stromal and lymphoid populations, while still keeping the three-dimensional thymic microenvironment that is important for thymocyte development (16). Thus in studies on the positive selection of thymocytes, CD4+ CD8+ TCR- thymocytes were reaggregated with purified thymic epithelial cells. During a culture period of 4 days, the emergence of the various stages of positive selection—which culminate in the production of single positive, mature T cells—could be followed (6). In another application of this technique (20) T-cell development was shown to be dependent on the presence of fibroblasts at the CD4- CDS- stage. The method involves the reaggregation of immunomagnetically selected, defined populations of stromal cells and thymocytes to create a chimeric thymus in vitro. The purification of thymic epithelial cells proceeds through a Table 1. Examples of bead-coating procedures Use

Beadxell ratios

Procedure

Depletion of haemopoetic cells from thyrnic strornal cells

10:1

100 uI of stock anti-rat IgG Dynal beads, washed and resuspended in 1 ml of anti-CD45 supernatant (clone M193HL) 300 ul of stock anti-mouse IgG Dynal beads, washed and resuspended in 1.5 ml of 1:50 diluted anti IAd(clone MK-D6) in PBS

Depletion of M HC class II * thymic 10:1 epithelium from the stromal component (class II haplotype in Balb/c mice is IAd) Depletion of medullary epithelium using A2B5

Depletion of CD3+ thymocytes

100 JJL! of stock anti-rat IgG Dynal beads, washed and coated in rat anti-mouse IgM then washed and resuspended in 1 ml of A2B5 supernatant 300 M.| of anti-rat IgG Dynal beads, washed and resuspended in 1 ml of anti-CD3 supernatant

5:1

10:1

Positive selection of MHC class II+ 3:1 thymic epithelium

100 til of anti-mouse IgG Dynal beads, washed and resuspended in 500 y.\ of 1:500 diluted anti-IAd (clone MK-D6) in PBS

Positive selection of CD8+ thymocytes

100 |xl of anti-rat IgG Dynal beads, washed and resuspended in 500 |xl of 1:100 diluted anti-CD8 (clone YTS 169.4) in PBS

3:1

324

14: Thymic organ culture number of stages. First, thymic stromal cells are obtained by enzymatic digestion of 2-deoxyguanosine treated lobes and are depleted of residual macrophages with anti-CD45 coated Dynal beads. These cells can then be further depleted of medullary-type epithelial cells with anti-A2B5 coated Dynal beads. The resulting cell population consists of epithelial cells and fibroblasts. Finally, purified cortical-type epithelial cells are obtained by first selecting on anti-MHC class II-coated Dynal beads and then releasing the cells using pronase. The combination of antibodies and beads used for selection are summarized in Table 1. Association of the selected cell populations is achieved by mixing them together in defined ratios followed by centrifugation. The resulting pellet is transferred, in the form of a slurry, using a mouth-controlled, finely drawn glass pipette, on to the surface of a nucleopore filter set for organ culture, as in Protocols 1 and 2. Protocol 3. The production of a reaggregate thymus NB Carry out all manipulations using an aseptic technique in a tissue culture cabinet. Equipment and reagents Fetal thymus lobes (gestation day 15) depleted of lymphoid cells by culturing for 5-7 days in 2-deoxyguanosine (see Protocol 7) Isolated thymocyte population of interest, i.e. CD4+ CD8+ TCR- newborn thymocytes R/10 (see Protocol 1) Fine knives and forceps (see Protocol 2) 90 mm Petri dishes (see Protocol 7) Dynal beads (pre-coated with anti-species antibodies, i.e. sheep anti-rat IgG or goat anti-mouse IgG, for capture of secondary antibodies, see Table 1; Dynal} Magnetic particle collector (Dynal UK) 0.02% EDTA solution (Sigma) 2.5%trypsin solution (Sigma) Phosphate-buffered saline without Ca2+/ Mg2+ (Sigma) Eppendorf tubes

10 mg/ml pronase E (Sigma) in PBS (Ca2+/ Mg2+-free) Soda-glass tubing for making micropipettes (Fisher Scientific) Aspirator tube assembly for micropipettes (Sigma) Freezing vials (round-bottomed to give maximum interaction between cells and beads) Antibodies for bead-coating: mouse antimouse IAd (Clone MK-D6, Becton Dickenson); rat anti-mouse pan CD45 (Clone M193HL); rat anti-mouse CD8 (Clone YTS 169.4, Harlan Seralab); rat anti-mouse CDS (Clone KT3, Serotec); anti-medullary epithelium (Clone A2B5, a gift from Martin Raff, University College, London) Humidified Perspex box that can be gassed (see Protocol 1, step 16)

A. Bead-coating procedure—to be carried out the day before an experiment 1. Take up the required volume of anti-species coated Dynal beads and place in a sterile Eppendorf tube. 2. Add 1 ml R/10 and mix thoroughly by pipetting up and down. 3. Transfer the Eppendorf tube to the magnetic particle collector—collect the beads and discard the supernatant.

325

John J. T. Owen and Deirdre E. J. McLoughlin Protocol 3.

Continued

4. Repeat steps 2 and 3 twice more to ensure that any azide preservative has been washed from the beads. 5. Resuspend the beads in the appropriate secondary antibody solution (see Table 1) and leave to incubate overnight at 4°C. 6. Prior to use, wash the beads in three 1-ml changes of R/10, as in steps 2 and 3, and resuspend in the original starting volume, i.e. resuspend an initial volume of 100 ^l of beads back into 100 jxl of R/10 just before use. B. Preparation of purified thymic stromal cells from 2-deoxyguanosine treated thymus lobes 1. After 5-7 days' organ culture with 2-deoxyguanosine (see Section 2.1), remove the thymus lobes from their dishes and place into an Eppendorf tube containing 1 ml of Ca2+/Mgz+-free PBS. 2. When the lobes have settled to the bottom of the Eppendorf tube, remove the PBS carefully with a 1 ml Digital micropipette. 3. Repeat this procedure three times and resuspend the lobes in 600 jjil of a 1:10 dilution of the 2.5% trypsin stock to give 0.25% trypsin in 0.02% EDTA. 4. Incubate for 25-30 min at 37°C and complete the disaggregation by gently pipetting up and down with a 1 ml Digital micropipette. 5. Once a cell suspension has been obtained, inactivate the trypsin by adding 400 ^\ of R/10 to the Eppendorf tube. 6. Centrifuge the cells at 150 gfor 10 min at 4°C, count and resuspend in 200 jxl of R/10, and transfer the cells to a round-bottomed freezing vial. 7. Remove residual cells of haemopoietic origin using anti-CD45 coated Dynal beads (see Table 1). Add enough Dynal beads to the cell suspension in the freezing vial to give a ratio of 10 beads to 1 cell. Centrifuge at 150 gior 10 min at 4°C.a 8. Gently pipette to resuspend, transfer to an Eppendorf tube, and place on the magnetic particle collector. Remove the supernatant containing free cells to a fresh freezing vial. 9. To the rosetted cells and free beads left on the magnetic particle collector, add 500 |J of R/10 and resuspend. This procedure will wash free any of the valuable stromal cells that have been trapped in the rosettes, allowing maximum recovery. 10. Replace the Eppendorf tube on the magnetic particle collector and collect the 'washings'. 11. Repeat the above depletion twice more, collecting both the cell suspension and the washings each time.

326

14: Thymic organ culture 12. Combine the final cell suspension and all the washings, centrifuge at 150 0 for 10 min at 4°C, and count the cells. These cells will consist of thymic epithelial cells and fibroblasts. 13. Further purify the epithelial cells as described below. C. Purification of MHC class If" conical thymic epithelial cells from CD45depleted thymic stromal cells 1. Prepare the CD45-depleted thymic stromal cells, as described in the above method. 2. Resuspend these stromal cells in 200 |xl of R/10 and place in a freezing vial. Add anti-A2B5 coated Dynal beads (see Table 1) at a ratio of 5 beads to 1 cell to deplete the stromal population of A2B5 medullary epithelial cells. Centrifuge the beads and cells together at 150 g for 10 min at4°C. 3. Resuspend and transfer to an Eppendorf tube, place on the magnetic particle collector, and transfer the cell suspension into a fresh freezing vial. 4. Repeat the above depletion with another round of A2B5-coated beads. Again collect the supernatant, centrifuge the cells at 150 g for 10 min at 4°C, and count. 5. Positively select MHC class ll+ epithelial cells using anti-MHC class ll+-coated Dynal beads (see Table 1), added at a ratio of 3 beads to 1 cell in 200 p,l of R/10. Centrifuge the beads and cells together at 150 g for 10 min at 4°C. 6. Collect the resetted cells on the magnetic particle collector. 7. Wash the resetted cells with four 1-ml changes of R/10, discarding the supernatants in between, to remove any unbound cells from the beads. Wash once more in PBS and resuspend the cells and beads in 200 (il of 10 mg/ml pronase in PBS (Ca2+/Mg2+-free). 8. Incubate at 37°C for 2 min to remove the beads from the cells. 9. Stop the reaction by adding 800 |xl of ice-cold R/10. 10. Remove the released beads and any remaining rosettes with the magnetic particle collector, leaving the purified MHC class ll+ cells in suspension. 11. Collect the liberated cells by centrifuging at 150 g for 10 min at 4°C, and count. D. Preparation ofCD4+ CD8+ TCR- thymocytes from newborn mouse thymus 1. Remove the thymus from a newborn mouse (see Protocol 2). 2. Prepare a lymphoid cell suspension by gently teasing the lobes apart with fine knives.

327

John J. T. Owen and Deirdre E. J. McLoughlin Protocol 3.

Continued

3. Count the thymocytes and prepare a suspension containing 1.2 x 107 cells in 200 (xl R/10, place these in a freezing vial. 4. Add 100 (xl of anti-CD3 coated Dynal beads (see Table 1) and centrifuge at 150 g for 10 min at 4°C), place on the magnetic particle collector and remove the supernatant to a fresh freezing vial. Discard the rosettes if desired. 5. Repeat the above depletion with another two rounds of anti-CD3 coated beads to ensure maximum depletion. 6. Count the recovered cells, centrifugeb at 150 gfor 10 min at 4°C, and resuspend in 200 p-l R/10. 7. Add the appropriate volume of anti-CD8 coated Dynal beads (see Table 1) to give a final ratio of 3 beads to 1 cell. Centrifuge these together at 150 g for 10 min at 4°C and collect the rosettes. 8. Wash the rosettes three times in Ca2+/Mg2+-free PBS to remove any unbound cells. 9. Resuspend the resetted cells in 600 (J of 0.25% trypsin/0.02% EDTA for 2 min at 37°C. Gently pipette after 1 min to dislodge the cells from the beads. 10. Check that the beads have come off the cells (by microscopic examination of a small sample) and stop the reaction with 1 ml of cold R/10. 11. Remove the beads and any remaining rosettes with the magnetic particle collector, leaving the freed CD4+ CD8+ thymocytes in suspension (most CD8+ newborn thymocytes are also CD4+). 12. Centrifuge at 150 g for 10 min at 4°C. Resuspend the cell pellet in 1 ml of R/10 and count (expect to recover 20-40%, i.e. 2.4-4.8 X 106 cells). E. Preparation of reaggregate thymus lobes The above series of methods will provide purified MHC class ll+ stromal cells and a population of selected thymocytes ready to be formed into a reaggregate thymus lobe. To achieve this, the cells are mixed at a ratio of 1 stromal cell to every 2 thymocytes to produce a successful reaggregate. In some reaggregates, such as the study of the early stages of T-cell development, it will be desirable to have fibroblasts present as well as the stromal and lymphoid cells. If these are required then the ratios should be 2:4:1 for epithelium, lymphocytes, and fibroblasts, respectively. 1. Mix the desired numbers of cells together in 1 ml of R/10 and centrifuge at 150 g for 10 min at 4°C to form a pellet. Ensure there are no more than 3 x 106 cells in any one reaggregate thymus otherwise it

328

14: Thymic organ culture

2. 3.

4.

5.

may not re-form, it is better to create two smaller reaggregates than one large one. Remove as much of the supernatant as possible from the cell pellet, without disrupting it, and vortex the pellet to form a slurry. Using a fine, mouth-controlled, soda-glass micropipette (which can be made by pulling out a micropipette in a flame) draw the cell slurry up and place it as a standing drop on the surface of a nucleopore filterc which has been set up in a 90 mm Petri dish for organ culture (see Protocol 1, steps 12-14). Place the Petri dish in a CO2 incubator or a humidified Perspex box which is then gassed with 10% CO2 in air and sealed (see Protocol 7, step 16). Incubate for the required culture period at 37°C (intact lobes will reform within 12 h).

"The cells and beads are centrifuged together in a round-bottomed freezing vial with a large internal surface area to promote interaction and give the maximum number of rosettes, 'if the volume of cells and beads reaches more than 400 nl then the depletion/selection efficiency is reduced. The cell suspension must be centrifuged before the next volume of beads is added. ° Control the rate of expulsion of the reaggregate slurry so that any excess fluid has time to pass through the filter and the cells do not spread out too far. No more than one reaggregate should be placed on a filter.

References 1. Moore, M. A. S. and Owen, J. J. T. (1967). J. Exp. Med., 126, 715. 2. Anderson, G., Moore, N. C., Owen, J. J. T., and Jenkinson, E. J. (1996). Annu. Rev. Immunol., 14,73. 3. Fehling, H. J., Krotkoua, A., Saint-Ruf, C., and von Boehmer, H. (1995). Nature, 375, 795. 4. von Boehmer, H. (1991). Curr. Opin. Immunol., 3, 210. 5. von Freeden-Jeffy, V., Vierra, P., Lucian, L. A., McNiel, T., Burdach, S. E. G., and Murray, R. (1995). J. Exp. Med., 181,1519. 6. Anderson, G., Owen, J. J. T., Moore, N. C., and Jenkinson, E. J. (1994). J. Exp. Med., 179, 2027. 7. Surh, C. D. and Sprent, J. (1994). Nature, 372,100. 8. Jenkinson, E. J., Anderson, G., and Owen, J. J. T. (1992). J. Exp. Med., 176,845. 9. Auerbach, R. (1961). Dev. Biol., 3,336. 10. Owen, J. J. T. and Ritter, M. A. (1969). J. Exp. Med., 129,431. 11. Robinson, J. H. and Owen, J. J. T. (1976). Clin. Exp. Immunol., 23,347. 12. Robinson, J. H. and Owen, J. J. T. (1977). Clin. Exp. Immunol., 27,322. 13. Robinson J. H. and Owen, J. J. T. (1978). Nature, 271,758. 14. Jenkinson, E. J., Franchi, L. L., Kingston, R., and Owen, J. J. T. (1982). Eur. J. Immunol., 12,583. 15. Kingston, R., Jenkinson, E. J., and Owen, J. J. T. (1985). Nature, 317, 811. 329

John J. T. Owen and Deirdre E. J. McLoughlin 16. Jenkinson, E. J., Anderson, G., and Owen, J. J. T. (1992). /. Exp. Med., 176, 845. 17. Anderson, K. L., Anderson, G., Michell, R. H., Jenkinson, E. J., and Owen, J. J. T. (1996). /. ImmunoL, 156, 4083. 18. Jenkinson, E. J. and Anderson, G. (1994). Curr. Opin. ImmunoL, 6,293. 19. Crompton, T., Gilmour, K. C., and Owen, M. J. (1996). Cell, 86, 243. 20. Anderson, G., Jenkinson, E. J., Moore, N. C., and Owen, J. J. T. (1993). Nature, 362,70.

330

Al List of suppliers American Type Culture Collection (ATCC), Manassas, VA 20108-1549, USA. Amersham Amersham International pic., Lincoln Place, Green End, Aylesbury, Buckinghamshire HP20 2TP, UK. Amersham Corporation, 2636 South Clearbrook Drive, Arlington Heights, IL 60005, USA. Amicon Ltd, Upper Mill, Stonehouse, Gloucestershire GL10 2BJ, UK. AMS Biotechnology, 5 Thorney Leys Park, Witney, Oxon. OX8 7GE, UK. Anderman Anderman and Co. Ltd., 145 London Road, Kingston-Upon-Thames, Surrey KT17 7NH, UK. Appleton Woods Ltd, London House, Heeley Road, Selly Oak, Birmingham B29 6EN, UK. Avidity, 2349 Eudora St, Denver, Colorado 80207, USA. BDH Merck Ltd, Hunter Boulevard, Magna Park, Lutterworth, Leicestershire LE17 4XN, UK. Beckman Instruments Beckman Instruments UK Ltd., Oakley Court, Kingsmead Business Park, London Road, High Wycombe, Bucks HP111J4, UK. Beckman Instruments Inc., PO Box 3100, 2500 Harbor Boulevard, Fullerton, CA 92634, USA. Becton Dickinson and Co., 2 Bridgewater Lane, Lincoln Park, NJ 07035, USA. Becton Dickinson Becton Dickinson and Co., Between Towns Road, Cowley, Oxford OX4 3LY, UK. Bio 101 Bio 101 Inc., c/o Statech Scientific Ltd, 61-63 Dudley Street, Luton, Bedfordshire LU2 OHP, UK. Bio 101 Inc., PO Box 2284, La Jolla, CA 92038-2284, USA. Biochrom Leonorenstr. 2-6,12247 Berlin, Germany. Bio-Rad Laboratories Bio-Rad Laboratories Ltd., Bio-Rad House, Maylands Avenue, Hemel Hempstead HP2 7TD, UK. Biotest Diagnostics Corp., 66 Ford Road, Suite 131, Denville, NJ07834, USA.

List of suppliers Biotest (UK) Ltd., 21A Monkspath Business Park, Knowle, Sollihull, W. Midlands B90 4NZ, United Kingdom. Biotest Diagnostics Corp., 66 Ford Road, Suite 131, Denville, NJ07834, USA. Biotest Ltd., Forensic Analytical Specialties, Inc., Molecular Genetics Division, 3777 Depot Road, Suite 409, Hayward, CA94545, USA. Biotex Labs Inc., Houston, Texas, USA, and Prestwood, Bucks, UK. BRL Life Technologies Ltd., P.O. Box 35, Trident House, Renfrew Road, Paisley, Scotland PA3 4EF. Caltag Laboratories (Products distributed by TCS Biological Ltd) Cambridge Bioscience, 25 Signet Court, Newmarket Rd, Cambridge CB5 8LA, UK. Canberra Packard Ltd., Pangbourne, Berkshire, UK. Chiron, Chiron Corporation Headquarters, 4560 Horton St, Emeryville, CA 94608-2916, USA. Corning Costar (UK) Ltd, 10 The Valley Centre, Gordon Road, High Wycombe, Bucks HP13 6EQ, UK. Coulter Electronics, Northwell Drive, Luton, Beds LU3 3RH, UK. CP Pharmaceuticals Ltd, Ash Road North, Wrexham Industrial Estate, Wrexham LL13 9UF, UK. Dako Ltd., Angel Drive, Ely, Cambs CB7 4ET, UK. Decon (Biddolph list) Denley and Denley (Luckham) are now part of Life Sciences International Deutsche Sanunlnng von Mikroorganismen und ZeUkulturen (DSMZ), Mascheroder Weg Ib, D-38124 Braunschweig, Germany. Dynal Dynal UK Ltd, Thursby Rd, Croft Business Park, Bromborough, Wirral, Merseyside L62 3PW, UK. Dynal UK Ltd, Station House, 28 Grove Street, New Ferry, Wirral, Merseyside L62 5AZ. Dynal Inc., 475 Northern BLVD, Great Neck, NY 11021, USA. Dynal, P.O. Box 158, Sk0yen, N-0212, Oslo, Norway. Eppendorf Scientific Inc., 1 Cantiague Road, P.O. Box 1019, Westbury, NY11590-0207, USA. Eppendorf-Netherler-hinz GmbH, Barkhansenweg 1, D22339 Hamburg, Germany. Eurocetus (ch 6) Falcon (Distributed by Farenheit Lab. Supplies) Farenheit Lab. Supplies, 47 Alston Drive, Bradwell Abbey, Milton Keynes, Bucks MK19 9HB, UK. Flow is now ICN Flow Gentra (ch 11) Gibco (Life Technologies), Fountain Drive, Inchinnan Business Park, Glasgow PA4 9RF, UK. 332

List of suppliers Globephann Ltd, University of Surrey, Guildford, Surrey GU2 5XH, UK. HD Supplies (Biddolph list) Harlan seralab

Harlan Seralab Ltd, Dodge Ford Lane, Belton, Loughborough, Leicestershire LE12 9TE, UK. Harlan Bioproducts for Science Inc., PO Box 29176, Indianapolis, Indiana 46229-0176, USA. Hoefer Scientific Instruments, c/o Amersham Pharmacie Biotech, Amersham Place, Little Chalfont, Bucks HP7 9NA, UK. ICN Flow, Thame Park Business Centre, Wenman Road, Thame, Oxon OX9 3XA, UK. Interfocus Ltd Interfocus Ltd, 14/15 Spring Rise, Falconer Road, Haverhill, Suffolk CB9 7XU, UK. (trades as) Fine science tools (USA) Inc., 373-G Vintage Park Drive, Foster City, CA 94404-1139, USA. Jansenn-Cilag, P.O. Box 79, Saunderton, High Wycombe, Buckinghamshire HP14 4HJ, United Kingdom. Life Sciences International (UK) Ltd, Unit 5, The Ringway Centre, Edison Rd, Basingstoke, Hants RG21 2YH, UK. Mabtech, Vikdalsvagen 50, S-131 40 Nacka, Sweden. Medipost, 100 Shaw Road, Oldham, Lanes OL1 4AY, UK. Miltenyi Biotec Ltd., Almac House, Church Lane, Bisley, Surrey GU24 9DR, UK. Molecular Dynamics, see Brun list. Molecular Probes (Europe), Poort Gebouw, Rijnsburgerweg, 2333, Leiden, The Netherlands. Murex (formerlyWellcome), Murex Diagnostics, Central Rd, Temple Hill, Dartford, Kent, UK. Nalge Nunc International, 75 Panorama Creek Drive, Rochester, NY14625, USA. Nalge Europe Ltd., Foxwood Court, Rotherwas Industrial Estate, Hereford HR2 6JD, United Kingdom. New Brunswick Scientific Co. Inc., P.O. Box 4005, 44 Talmadge Road, Edison, NJ08818-4005, USA. New Brunswick Scientific (UK) Ltd., Edison House, 163 Dixons Hill Road, North Mymms, Hartneld, Herts AL9 7JE, United Kingdom. New England Biolabs New England Biolabs, 67 Knowle Piece, Wilbury Way, Hitchin, Herts SG4 OTY, UK. Nunc Products (Distributed by Gibco (Life Technologies)) Nycomed, Nycomed House, 2111 Coventry Rd, Sheldon, Birmingham, West Midlands B26 3EA, UK. One Lambda Europe, Synergie - Le Millenaire, 770 Rue Alfred Nobel, Montpellier 34000, France. One-Lambda Inc., 21001 Kittridge Street, Canoga Park, CA91303-2801, USA. 333

List of suppliers Ortho-Clinical Diagnostics, PO Box 690, Mandeville House, 62 The Broadway, Amersham, Bucks HP7 OJS, UK. Ortho Pharmaceutical Corp., P.O. Box 300, Raritan NJ 08869 (800)682-6532. PAN Systems, GmbH Bioltechnologische Produckte, Gewerbepark 6, 94501 Aiderbach, Germany. PE-Biosytems PE-Apptied Biosytems, Kelvin Close, Birchwood Science Park, Warrington, Chesh. WA3 7PB, UK. PE-Applied Biosytems, Foster City, CA, USA. Pel-Freez Clinical Systems, Brown Deer, WI, USA. Pharmacia Biosystems Pharmacia Biosystems Ltd. (Biotechnology Division), Davy Avenue, Knowlhill, Milton Keynes MK5 8PH, UK. Pharmacia LKB Biotechnology AB, Bjorngatan 30, S-75182 Uppsala, Sweden. Pharmacia Pharmacia Biotech, 23 Grosvenor Road, St Albans, Herts AL1 3AW, UK. PharMingen, 10975 Torreyana Rd, San Diego, CA 92121, USA. Pierce & Warriner UK Ltd, 44 Upper Northgate St, Chester CHI 4EF, UK. Pi-omega Promega Corporation, 2800 Woods Hollow Road, Madison, WI 53711-5399, USA. Promega Ltd., Delta House, Enterprise Road, Chilworth Research Centre, Southampton, UK. Qiagen Qiagen Inc., do Hybaid, 111-113 Waldegrave Road, Teddington, Middlesex, TW11 8LL, UK. Qiagen Inc., 9259 Eton Avenue, Chatsworth, CA 91311, USA. R & D systems, 4-10 The Quadrant, Barton Lane, Abingdon, Oxon OX14 3YS, UK. Robbins Scientific, Suite B, Greville Court, 1665 High Street, Knowle, Solihull, W. Midlands B93 OLL, United Kingdom. Robbins Scientific, 1250 Elko Drive, Sunnyvale, CA94089-2213, USA. Sarstedt Ltd, 68 Boston Rd, Beaumont Leys, Leicester, Leics LE4 1AW, UK. Schleicher and Schuell Schleicher and Schuell Inc., Keene, NH 03431A, USA. Schleicher and Schuell Inc., D-3354 Dassel, Germany. Schleicher and Schuell Inc., do Andermann and Company Ltd. Serotec Serotec Ltd, 22 Bankside, Station Approach, Kidlington, Oxford OX5 1JE, UK. Serotec Inc., NCSU Centennial Campus, Partners 1, 1017 Main Campus Drive, Suite 2450, Raleigh, NC 27606, USA. Shandon Scientific Ltd., Chadwick Road, Astmoor, Runcorn, Cheshire WA7 1PR, UK. 334

List of suppliers Sigma Chemical Company

Sigma Chemical Company (UK), Fancy Road, Poole, Dorset BH17 7NH, UK. Sigma Chemical Company, 3050 Spruce Street, P.O. Box 14508, St. Louis, MO 63178-9916. Skatron, Unit 11, Studlands Park Avenue, Newmarket, Suffolk CB8 7DB, UK. Sorvall DuPont Company, Biotechnology Division, P.O. Box 80022, Wilmington, DE 19880-0022, USA. Stratagene

Stratagem Ltd., Unit 140, Cambridge Innovation Centre, Milton Road, Cambridge CB4 4FG, UK. Strategene Inc., 11011 North Torrey Pines Road, La Jolla, CA 92037, USA. TAAB Laboratories Ltd, 3 Minerva, Calleva Industrial Park, Aldermarsden, Reading, Berks RG7 4QW, UK. TCS Biological Ltd, Botolph Claydon, Bucks MK18 2LR, UK. United States Biochemical, P.O. Box 22400, Cleveland, OH 44122, USA. UVP Inc., 2066 West 11th Street, Upland, CA91786, USA. UVP Ltd., Unit 1, Trinity Hall Farm Estate, Nuffield Road, Cambridge CB4 1TG, United Kingdom. Wallac (UK) Ltd, Vincent Ave, Crownhill Business Centre, Crownhill, Milton Keynes, Bucks MK8 OAB, UK. Wellcome Reagents, Langley Court, Beckenham, Kent BR3 3BS, UK. Whatman International Ltd, Direct Operations, Liphook Way, 20/20 Maidstone, Kent E16 OLS, UK. Zeiss Carl Zeiss Ltd., PO Box 78, Woodfield Road, Welwyn Garden City, Herts AL7 1LU, UK.

335

This page intentionally left blank

A2 Commonly used human lymphoma lines EDGAR MEINL and HELMUT FICKENSCHER

T-cell lineage Name

Origin, phenotype

Antigen expression Infected with Source

Special comments

Jurkat

ALL, mature

CD2, CD3, CD4

Clone E6-1 Sensitive to FasL and TRAIL

>J.CaM1.6

Jurkat without Lck

CD3

Sup-T1

ALL, mature

CDS, CD4, CDS

Molt- 16 PEER CCRF-CEM

ALL, mature ALL, mature ALL, mature

CD2, CD3, CD4 TCR^e CD3,CD4

ATCC TIB-152 DSMZ ACC-282 ECACC 88042803 ECACC 88052401 ATCC CRL-2063 ECACC 96060401 ATCCCRL-1942 DSMZ ACC-140 ECACC 95013123 DSMZ ACC-29 De Waal Malefyt et al. ATCC CCL-119 ECACC 851 12105 ATCCTIB-195

>CEM-CM3 Molt-4

ALL, mature

CD2, CD3, CD4

Molt-3

ALL, cortical

CD2, CD3CD^ CD8

Molt-15 Karpas-299 HuT78

Pro-ALL ALL Sezary syndrome

CD2-, CD4-, CD8CDS- CD4, CD30 CD3, CD4

>H9

Subclone

MT2 C91PL HUT102

ATL

Mycosis fungoides

CD4

HTLV-1 HTLV-1 HTLV-1

ATCC CRL-1 582 DSMZ ACC-362 ECACC 8501141 3 ATCC CRL-1552 DSMZ ACC-84 ECACC 9002 1901 DSMZ ACC-40 DSMZACC-31 ATCCTIB-161 ECACC 88041901 ATCC HTB-176 ECACC 85050301 ECACC 93121518 Popovic ef a/. ATCCTIB-162

Missing exon 7 of Lck Resistant to aFas mAb CH1

J. Immunol., 142, 3634 Sensitive to FasL and TRAI L Fusion partner for Thybridomas 8-azaguanine resistant p53 mutated

Growth inhibition via CD30 Uses TNF-a as growth factor Secretes IL-2 Sensitive to apoptosis by FasL HTLV-1 producer cell line Sc/ence,219, 856 HTLV-1 producer, secretes IL-15

>Derivate of preceding cell line. Source abbreviations: ATCC, American Type Culture Collection; DSMZ, Deutsche Sammlung von Mikroorganismen und Zellkulturen; ECACC, European Collection of Animal Cell Cultures

B-cell lineage Name

Origin, phenotype

Antigen expression

B-JAB Ramos

Burkitt's lymphoma Burkitt's lymphoma

CD10,lgM CD23, IgM, K

Raji

Burkitt's lymphoma

CD10

EBV

Namalwa

Burkitt's lymphoma

lgM,x

EBV

Daudi

Burkitt's lymphoma

CDIOJgM

EBV

Jiyoye

Burkitt's lymphoma

>P3HR-1

Subclone

Infected with

EBV

EBV

SKW6.4 B-LCL

B-LCL EBV-transformed B-cell lines

IgM

EBV EBV

Source

Special comments

DSMZACC-72 ATCC CRL-1596 ECACC 85030802 ATCC CCL-86 DSMZACC-319 ECACC 8501 1429 ATCCCRL-H32 DSMZACC-24 ECACC 87060801 ATCCCCL-213 DSMZACC-78 ECACC 8501 1437 ECACC 891 20702 ATCC CCL-87 ECACC 88071302

p53 mutated p53 mutated

ATCC HTB-62 ECACC 86010701 ATCCTIB-215 ECACC

Transformation-deficient EBV

p53 mutated

p53 mutated

Stimulate V-y9+ TCR -y6 cells

Sensitive to FasL Set of 250 HLA-typed lines

B-cell lineage Continued Origin, phenotype

Antigen expression

Reh

Pro-B-ALL

CD10

RPMI 8226

Plasmacytoma

IgX

U266B1

Plasmacytoma

lgE,\

ARH-77

Plasmacytoma

lgGl,K

EBV

HS-Sultan

Plasmacytoma

IgG, K

EBV

BC-1 BC-2 BC-3 BCP-1 BCBL-1

Effusion Effusion Effusion Effusion Effusion

Name

lymphoma lymphoma lymphoma lymphoma lymphoma

Infected with

HHV-8 + EBV HHV-8 + EBV HHV-8 HHV-8 HHV-8

Source ATCC CRL-8286 DSMZACC-22 ATCC CCL- 155 ECACC 870 12702 ATCCTIB-196 DSMZACC-9 ECACC 8505 1003 ATCC CRL-1 621 ECACC 88121201 ATCC CRL-1 484 ECACC 87012701 ATCCCRL-2230 ATCCCRL-2231 ATCC CRL-2277 ATCC CRL-2294 Renne etal.

Special comments

Secretes IL-6

Nat. Med., 2, 324; releases HHV-8 after PMA treatment

>Derivate of preceding cell line. Source abbreviations: ATCC, American Type Culture Collection; DSMZ, Deutsche Sammlung von Mikroorganismen und Zellkulturen; ECACC, European Collection of Animal Cell Cultures

Other haemopoietic lineages Name

Origin, phenotype

U-937

Histiocytic

KG-1

AML, monocytic

HLA-DR

>KG-1a

AML, monocytic

HLA-DR negative

MONO-MAC-1 MONO-MAC-6 THP-1

AML, monocytic AML, monocytic AML, monocytic

CD14 CD! 4

HL-60

Promyelocytic

K-562

CML, erythroblastoid

L-428 HDLM-2 174XCEM

Hodgkin Hodgkin T-B hybrid

Antigen expression

Infected with

ig —

CD21,CD30 CD30

Source

Special comments

ATCC CRL-1 593 DSMZ ACC-5 ECACC 850 11440 ATCCCCL-246 DSMZACC-14 ECACC 861 11306 ATCCCCL-246.1 ECACC 91030101 DSMZACC-252 DSMZ ACC- 124 DSMZACC-16 ECACC 88082 1201 ATCC CCL-240 DSMZ ACC-3 ECACC 8501 1431 ATCC CCL-243 DSMZACC-10 ECACC 89121407 DSMZACC-197 DSMZ ACC-17 ATCC CRL-1991

Secretes TIMF-a, differentiates

Differentiates to macrophages

Does not differentiate

Differentiates Secretes TNF-a, differentiates, lacks p53 protein Target for NK-like cytotoxicity

Stimulated by CD30 ligation Fusion of CCRF-CEM with B-LCL

>Derivate of preceding cell line. Source abbreviations: ATCC, American Type Culture Collection; DSMZ, Deutsche Sammlung von Mikroorganismen und Zellkulturen; ECACC, European Collection of Animal Cell Cultures

This page intentionally left blank

Index ABTS substrate solution 120 acetone as fixative 30 acridine orange 102 acrylamide gels, recipes 288 activation-induced cell death (AICD) see apoptosis adhesive coating, slides 27-28 adjuvants, CFE 78,97 adoptive immunotherapy cytomegalovirus infections post BMT 209 Epstein-Barr virus infections post BMT 209 HIV infections 210-11 safety aspects 217-18 see also CTLs, human (adoptive transfer of CTLs 210-11) amnity chromatography, surface antigens 296 AICD see apoptosis AKR thymoraa BW5147 79 alkaline phosphatase 42-4 demonstration 43-4 alkaline phosphatase, anti-alkaline phosphatase (APAAP) label, method 46-7 allophycocyanin (APCN) 206 3-amino-9-ethylcarbazole (AEC) 41 aminopterin, action 77 amphotericin B 17 animal studies, licence 4 annexin V, apoptosis measurement 308,309, 312-13 anti-Ig affinity columns 108 antibiotics, for contamination problems 16-17 antigen retrieval methods, paraffin/formol sections for immunohistochemistry 34-8 heat-mediated antigen retrieval 34-8 proteolytic enzyme digestion 34 antigen-presenting cells (APCs) enrichment/depletion 20 irradiated splenic 111 proliferation prevention 17-18 sources 1-3,98 antigen-specific cytokine release, CTL assay 172-5 antigen-specific response, indicators 65 antigen-specific T cells 99 apoptosis, end of immune response 300 CD4+ 111-27 CD8+ CTLs 127-30,208 clones, human peripheral blood 142-7 lymph nodes 2 proliferation assay for CD4 function 148-9 see also limiting dilution analysis (LD A)

antigens coupling to latex microspheres 117 sequential staining, multiple antibodies 49-51 simultaneous staining, multiple antibodies 51 see also surface antigens antisera, HLA, characterization and storage 232-3 apoptosis antigen-specific lymphocytes, end of immune response 300 caspases 302-3 CD4T cells 149-51 central tolerance (thymic deletion) 299 defined 299 detection 150-1 induction 150 mitochondria, role 302 peripheral tolerance 300 recognition by phagocytes 300 stages 301 T cell hybridomas 90-1 apoptosis measurement 299-314 annexin V 308-9 assay methods 303-4 CMXRos and related dyes 309-13 DNA laddering 305 inhibitors and triggers 303 interaction between virus proteins and apoptosis machinery 303 light scatter analysis by flow cytometry (size and granularity) 305 new death receptors and ligands 301-2 recent advances 300-3 terminal deoxynucleotidyl transferasemediated dUTP nick end-labelling (TUNEL) 305-7 ARMS (amplification refractory mutation system) 251 autoreactive lymphocytes, peripheral deletion, apoptosis 300 avidin-biotin systems 40

B cells CDS stain 52 CD79a stain 52 complement-mediated lysis of T cells, negative selection 107-8 expansion and maturation 2 surface markers 18

Index B-cell hybridomas 75-93 antibody production by chemical and genetic engineering 86-7 cloning hybridomas 82-3 cryopreserving and thawing cells 83-4 disadvantages 75-6,87 equipment required and stages 76-7 fusion partners 79 fusion protocol 79-81 generating methods 75-87 growth of hybridomas 81 human hybridomas 85-6 immunizations of animals 77-8 immunolocalisation using monoclonal antibodies 88-9 large-scale production 84 materials 76-7 monoclonal antibodies 88 purification, protein G 84-5 screening assays 81-2 selection procedures 77 technology applications 88-90 therapeutic applications of monoclonal antibodies 89-90 B-cell immortalization 69-71 EB V-transformation of human B cells 69-70 transformation of macaque B cells with herpes papio 70-1 B-LCLs asAPCs 218 disadvantages as stimulators 164 establishing CTL lines 213 BALT 2 bcl-2-related proteins, and apoptosis 303 bead-coating procedures, reaggregate thymus organ culture 324-5 beta-2-microglobulin, cloning in E. coli 199 beta-propriolactone, destruction of HIV 31 biotinylation cell-surface proteins 277,279-80 enzymatic biotinylation 202-3 HLA-peptide tetrameric complexes 202-3 ELISA 204-5 mAbs 151,153 tyramine, immunohistochemical staining 40 BirA, enzymatic biotinylation 202-3 blood cell types, functions and surface markers 18 purification and preparation of lymphocytes 10-12 blood donation 10 blotting proteins 291-2 BLT serine esterase 172 body fluids, purification and preparation of lymphocytes 10-13

bone marrow transplantation, tissue typing see HLA typing bronchoalveolar lavage 13,104-5 carbonyl cyanide m-chlorophenylhydrazone (mCICCP) 310-11 caspases (cysteine proteinases) 302-3 CD2, immunoprecipitation 278 CD3, immunoprecipitation 274,275 CD4+, murine cloning 114-15 in vivo priming 111-12 lines and clones, generation 112-15 purification 109-10 CD4, human 135-59 apparatus, media, reagents 136-7 assays for CD4 function 147-57 activation-induced cell death (AICD) 149-51 detection 150-1 ELISA of cytokine production in culture supernatants 151-3 proliferation assay activation with anti-CD3 and antiCD28 147-9 antigen-specific proliferation 148-9 cytokine producing cells, enumeration by flow cytometry, activation for intracytoplasmic cytokine staining 153-7 isolation and culture of subsets from peripheral blood 137-7 antigen-specific clones 142-7 with/without bulk culture 142-5 CD4+ Thl/Th2/ThO effectors 140-2 naive and memory T cells 137-40 random CD4 clones 145-7 CD8+ CTLs, murine 127-30 assay 128-30 CD8+ T cells, human HIV specific 208 CD16+ NK cells, for LDA 184-5 CD38, human HIV-infected CD8+ T cells 208

CD45 depletion 327 CD48 expression, enzyme-based detection 295 CD581igand 64-5 CD58 mAbs, EB V-transformation of human B cells 65 CD molecules, heat mediated antigen retrieval (HMAR) 37-8 ced genes, apoptosis 303 cell counting 6 cell fluids, smears, and cytocentrifuge preparations 29-30 cell imprints, dabs or touch preparation 31 cell lysis, membrane proteins 280-1 cell lysis assay, human CTLs 169-72

344

Index cell smears, and cytocentrifuge preparations 29-30 cell sorting, FACS 26 cell viability, elimination of dead cells 5,8 cell-surface iodination, using lactoperoxidase, surface antigens 278-9 central tolerance (thymic deletion) 299 chemiluminescence 248 chloramphenicol 200 chloromethyl-X-Rosamine (CMXRos) 310-11,312 chromium release assay 129 chromogens, tetrazolium nitroblue 248 clones from a CTL line 214-15 hybridomas 82-3 maintenance 146 CMXRos and related dyes, apoptosis measurement 309-13 CNBr-activated Sepharose beads, immunoprecipitation of surface antigens 283^1 collagenase 8-9 columns, mAb-coating 23-4 complement, HLA typing by serology 233-4 complement-mediated lysis of T cells, negatve selection of B cells 21-2 concanavalin A 101 contamination problems, preparation of lymphocytes 16-17 Coomassie staining 288,293 Coulter counting 6 51 Cr-labelled target cells 129,171 preparation for LDA 188-9 see also chromium release assay; CTLs, lysis assay cryopreservation 14-16 HLA typing by serology 236-7 and thawing, B- and T-cell hybridomas 83-4 cryostat sections, sectioning and fixing 31-2 crystal violet 6 CTLs, human 161-78 antiviral CTL generation 163-9 HlV-specific CTLs 165-6 influenza-specific CTLs 164-5 peptide stimulation 166-7 virus-specific CTL clones 167-9 assays 169-76 antigen-specific cytokine release measurement 172-5 ELIspot 173-5 lysis assay 169-72 quantification, comparison of different methods 175-6 see also HLA-peptide tetrameric complexes culture 162-3

persuasion of memory CTLs to grow in vitro 162 reagents and conditions 162 expansion of clones 215-17 expansion for immunotherapy 209-19 adoptive transfer 210-11 CTL infusion safety 217-18 establishing CTL clones 213-15 establishing CTL lines 213-18 expanding CTL clones 215-17 peptide recognition by CTLs 211-12 peptide binding motifs 212 lines vs clones 213-16 safety aspects 217-18 staining 52 see also immunohistochemistry CTLs, murine antigen-specific CD8+ CTLs 127-30 bulk cultures 128-9 cell lines, IL-2 bioassay 121-2 culture media DMEM 57 human CD4 137 human CTLs 162-3 MEM 57 RPMI 16 RPMI-1640 (standard) 61,100 and sera 99-101 for transport 29 culture supernatants, ELISA, cytokine production 151-3 cysteine proteinases (caspases) 302-3 cytocentrifuge preparations 29-30 cytokines and growth factors, murine T-cell culture 101-2 mRNA detection by RT-PCR 122-4 production, human in culture supernatants, ELISA 151-3 flow cytometry and intracytoplasmic cytokine staining 153-7 production, murine ELIspot assays 119 and Thl/ThO/Th2 responses, immunoassays 120-1 see also interferons; interleukins cytomegalovirus, antigen-specific CTLs 164 cytomegalovirus infections post BMT, adoptive immunotherapy 209—10 cytotoxic T lymphocytes (CTLs) human 161-78 murine 127-30 see also CTLs, human; CTLs, murine dead cells elimination 5, 8 see also apoptosis

345

Index death-effector domain (FADD) 26,99,303 death-inducing signalling complex (DISC) 302 delayed-type hypersensitivity (DTK), infiltrating lymphocytes, enrichment 10 dendritic cells anti-CD21 abs 52 as antigen-presenting cells 112 surface markers 18 3,3' -diaminobenzidine tetrahydrochloride (DAB) 41 digoxygenin (DIG) probes 248 DMQD-CHO 302 DNA laddering, apoptosis measurement 305 DNA preparation and PCR amplification, PCR-SSOP for HLA typing 245-6 PCR for HLA typing 241 PCR-SSP for HLA typing 250-1 DNA sequence-based typing (SBT) 258-64 HLA-A 263,264 DRs (death receptors), apoptosis 301-2 Dynabeads, positive/negative cell separation 24-5 EB V see Epstein-Barr virus ELISA antibody detection 126-7 cytokine immunoassays 120-1 cytokine production in culture supernatants 151-3 HLA-peptide tetrameric complexes 204-6 (relative) biotinylation 205-6 ELIspot assays, production of cytokines 119, 173-5 enzymatic biotinylation see biotinylation enzyme-based antigen detection 294-6 enzymes, blocking 33-4 EPOS immunohistochemical preparation 39 Epstein-Barr virus antigen-specific CTLs 163—4 B cell transformation immortalization 69-70 irradiation for antigen-specific CD4 clones 145 mAbs to CD58 65 Epstein-Ban- virus infections, adoptive immunotherapy 209-10 Escherichia coli, cloning of modified heavy chain 198-9 ethidium bromide 102 FACS (fluorescence-activated cell sorter) 26, 99,207 FACScan analysis 22,119

Fas-associated protein with death domain (FADD) 26, 99, 303 Fas/Fas ligand, apoptosis 301 fetal calf serum (FCS) 61, 100 for CTLs 162 sourcing 101 Ficoll density gradient 5, 8 Ficoll/medium interface 11-12 fine-needle aspirates, cell smears, and cytocentrifuge preparations 29-30 fixing cryostat sections 31-2 paraffin sections 32-3 FLICE (viral FADD-like ICE) 303 flow cytometry HLA-peptide tetrameric complexes 207 intracytoplasmic cytokine staining, T cell cytokine production 153-7 light scatter analysis of apoptosis (size and granularity) 305-6 fluorescein isothiocyanate (FITC) 44, 206 fluorescence-activated cell sorter (FACS) 26, 99, 207 fluorescent labels, immunohistochemical staining 44-5 formol-acetic acid 32 freezing and thawing methods 14-16, 83—4 Freund's adjuvant (CFE) 78, 97 fungicides 17 fusion protocol 79-81 GALT 2, 8 see also Peyers' patches gentamicin, in culture media 61-2 germinal centre cells 53 bcl-2 (unstained) 52 glutamine, in culture media 61-2 glycosidase treatment, immunoprecipitation of surface antigens 284-5 granulocytes, surface markers 18 Hanker-Yates reagent 41 heat mediated antigen retrieval (HMAR) 34-8 CD molecules 37-8 helper T cells see Th cells herpesvirus papio, macaque B cells transformation 70-1 herpesvirus saimiri culture and titration 57-60 demonstration of episomes and virion DNA in transformed T cells 66-7 human T cells growth transformation 56-67, 62 criteria 63 strains 63 T cells of non-human primates 67-8

346

Index herpesviruses HSV2, FasL expression 303 interactions with death signal-transmitting receptors 303 HGPRT 77 HIV, destruction with beta-propriolactone 31 HIV gag-specific clones 211 HIV infections adoptive transfer of CTLs 210-11 HVS transformation 63-4 HlV-specific CTLs 165-6 HLA class-I and II 223-30 classical class-II loci 224 classical/non-classical class-I loci 223 heavy chain, cloning 198-9 HLA-A, DNA sequence-based typing (SBT) 263, 264 mAbs to class-I protein 78 nomenclature 225-7 polymorphism 222 in relation to structure and function 224-6 in populations 227-30 serological vs allelic variants, numbers 224 serological specificities, vs WHO nomenclature, lists 228-9 structure 221, 225 HLA molecular approaches to tissue typing 239-40 five-locus determination PCR-SSP 249-56 96-well PCR-SSP typing plates 252 detection of amplification products 253-5 DNA preparation 250-1 interpretation of results 255-6 primer design 251-2 thermal cycling 252-3 high resolution PCR-SSP typing 256-8 method for nested typing 256-7 summary and discussion 257-8 PCR reaction 240-3 DNA preparation 241 ingredients 241-2 PCR buffer 240-1 PCR cycling parameters 242 PCR optimization 242-3 primer design 241 PCR-SBT (sequence-based typing) 258-64 protocol and discussion 261-4 strategies 259-61 PCR-SSOP 243-9, 244 analysis 248 detection methods 247-8 DNA preparation and PCR amplification 245-6 hybridization 246-7

membrane preparation and sample blotting 246 protocols 245-8 summary and discussion 248-9 references 267 reverse dot blot 265 summary and discussion 264-8 suppliers 267-8 HLA typing by serology 230-9 characterization and storage of antisera 232-3 complement addition 233-4 cryopreserving and recovering cells 236-7 micro-lymphocytotoxicity assay 237, 238 PBMC preparation for typing 234—5 preparation of components 232-7 HLA-peptide tetrameric complexes 162, 197-208 cloning of modified heavy chain 198-9 ELISA 204-6 enzymatic biotinylation 202-3 flow cytometry 207 inclusion body purification 200-1 protein expression 199-200 purification of refolded protein 203-4 refolding by dilution 201-2 tetramer formation 206-7 HMAR (heat mediated antigen retrieval) 34-8

horseradish peroxidase (HRP) label 41-2 human growth-transformed T cells properties 64-5 viral episomes and virion DNA demonstration 66-7 virus production test 65-6 human lymphoma, commonly used cell lines 335-9 human serum, preparation 217-18 human T-cell leukemia virus type-1 (HTLV-1) HTLV-1-specific CTLs 165 immortalization of human T cells 68-9

Ig, heat mediated antigen retrieval (HMAR) 37-8 immunoblotting blotting sandwich 293 detection of antigen 294-6 protein samples 290, 293 surface antigens 289, 289-96 immunohistochemical preparation 27-38 cell imprints (dabs or touch preparation) 31 cell smear and cytocentrifuge preparations 29-30 choice of preparation 28-9 frozen (cryostat) sections, sectioning and fixing 31-2 347

Index immunohistochemical preparation (cont.) paraffin sections 32-8 antigen retrieval 34-8 blocking endogenous enzymes 33-4 decalciflcation 33 fixation 32-3 processing and rehydration 33 sectioning, drying and storage 33 slide adhesive 27-28 immunohistochemical staining 39-53 avidin-biotin and streptavidin-biotin systems 40,48-9 biotinylated tyramine method 40 cell type distribution in lymphoid tissue 53 direct and indirect methods 39,47-8 fluorescent labels 44-5 labels 41-5 alkaline phosphatase 42-4 choice 45-7 fluorescent label 44-5 horseradish peroxidase (HRP) 41-2 multiple antibody methods 49-51 label and method combinations 49-51 quality control 52 unlabelled antibody-enzyme complex method 39-40 immunoprecipitation of surface antigens 281-5 CNBr-activated Sepharose beads 283-4 glycosidase treatment 284-5 procedure 281,282-5 •protein G-Sepharose 282-5 immunotherapy see CTLs, human inclusion body purification, HLA-peptide tetrameric complexes 200-1 infiltrating lymphocytes (TIL), purification and preparation 10 influenza-specific CTLs 164-5 bulk culture 164-5 interferons ELIspot assays 119,173-5 IFN, two-colour immunofluorescence 157 interleukins IL-l-3-converting enzyme, ICE) 302 IL-2 in culture media 61-2,101-2 preparation of a supernatant 101-2 IL-2 bioassay using CTLL cells 121-2 IL-4, two-colour immunofluorescence 157 intracytoplasmic cytokine staining detection of two cytokines by one-step staining 155-7 and flow cytometry, production of cytokines 153-7 ionomycin 154,157 isolation see preparation of lymphocytes Jurkat cells 312

Ki67 antigen stain 52 labels, immunohistochemical staining 41-5 lactoperoxidase, cell-surface iodination 278-9 Langerhans cells, surface markers 18 LARD (lymphocyte-associated receptor of death) 301 ligand hunting, surface antigens 297 limiting dilution analysis (LDA) 179-95 advantages/limitations 183 at clonal level 179-80 calculation and interpretation of results 190-4 chi-square critical statistic values 194 classification of positive and negative wells 190-1 cytotoxic activity in individual microcultures 190 estimation of precursor frequency 191-4, 192

interpretation 194 LDA plot shape 193 MHC-restricted specific lysis 191 detection of antigen-specific CD4+ murine T-cells 114-15 methodology 183-90 plate layout 186 persuasion of memory CTLs to grow in vitro 162 Poisson distribution 180-2 preparation of effector T-cell assay plates 189-90 preparation of radiolabelled target cells 188-9 preparation of responder cells 184-6 preparation of stimulator cells 187-90 schema 180 theoretical considerations 179-83 lipopolysaccharide, as adjuvant 97 lung infiltrates, purification and preparation of lymphocytes 13,104 lymph, purification and preparation of lymphocytes 10-12 lymph nodes antigen-specific lymphocytes 2 dissection 3-5 purification and preparation of lymphocytes 53-8 lymphatic vessels 2—3 lymphocyte-associated receptor of death (LARD) 301 lymphocytes see preparation of lymphocytes; purification of lymphocytes; surface antigens lymphoid tissue cell type distribution 53 germinal centre cells 53

348

Index plasma cells 53 purification and preparation of lymphocytes 3-10 as source of lymphocytes 3-10 lymphoma, commonly used human lines 335-9 lysates, proteins for immunoblotting 290 lysis membrane proteins 280-1 see also limiting dilution analysis (LDA) lysis assay, human CTLs 169-72 macaques herpesvirus papio, B cells transformation 70-1 herpesvirus saimiri, T cells transformation 67-8 macrophages anti-CD68 abs, stain 52 murine peritoneal 110-11 purification and preparation 13 surface markers 18 magnetic beads, positive/negative cell separation 24-5 membrane for protein tansfer 291-2 membrane proteins, solubilization 280-1 membranes, nitrocellulose 291-2,294 metastasis, T cell hybridomas 91 metrizamide, density-gradient centrifugation 106 MHC region, chromosome 6 map 223 MHC restriction analysis, murine T-cell clones 130-1 MHC-antigen complex, T cell proliferation assay 115-19 micro-lymphocytotoxicity assay 237-8 mitochondrial transmembrane potential in apoptosis 302 blocking by bcl-2 303 CMXRos detection 310-12 Fasligation 312,313 monoclonal antibodies anti-cytokine antibodies, as capture 151 cell surface markers 20-6 chemical and genetic engineering, B- and Tcell hybridomas 86-7 complement-mediated lysis 21-2 panning and columns 22-4 positive/negative methods of separation 21 monocytes adherence 107-8 surface markers 18 mouse serum, as substitute for PCS 101 mRNA, detection by RT-PCR, cytokines 122-4 multiple antibody methods, immunohistochemical staining 49-51

murine CTLs cytotoxic T-cell assay 128-30 generation and detection of antigen-specific CD8+ CTLs 127-30 CD8+ T-cell lines and clones 127-8 murine T-cell culture 95-133 antigen-specific T-cell proliferation 115-19 assay of helper function of T cells for antibody production by B cells 124-7 bronchoalveolar lavage 13,104-5 cytokines, production, detection of cytokine mRNA 122-4 cytokines and growth factors 101-2 generation and detection of antigen-specific CD4+ T cells 111-27 cloning by limiting dilution 114-15 in vivo priming 111-12 T cells generation of CD4+ lines and clones 112-15 generation and detection of antigen-specific CD8+ CTLs 127-30 CD8+ T-cell lines and clones 127-8 cytotoxic T-cell assay 128-30 in vivo priming, CD8+ CTLs 127 MHC restriction analysis 130-1 preparation of macrophages and APCs 110-11 preparation of T-cells and APCs 103-6 cells from lymphoid and non-lymphoid tissue 103-6 purification anti-Ig affinity columns 108-10 B cells, T- and T-cell subpopulations 107-8 mononuclear cells and dead cell removal 106-10 T-cell responses, detection techniques 96-8 T-cell subtypes induction 96-8 protective immunity role 95-6 Thl/ThO/Th2 clones, selective stimulation 112 Thl/ThO/Th2 responses 119-24 cytokine immunoassays 120-1 cytokine production 119-20 detection of cytokine mRNA 122-4 IL-2 bioassay using CTLL cells 121-2 Th cells, assay of helper function for antibody production by B cells 124-7 tissue culture conditions 99-101 culture medium and serum 99-101 viable cell count 102-3 mycoplasma infections 79 naphthol AS-BI phosphate, substrate for alkaline phosphatase label 42-4

349

Index nitrocellulose protein transfer 291-2 reversible staining 294 nuclear mitotic apparatus protein (NuMA) 302 nylon-wool columns 23-4 oligonucleotide probing (PCR-SSOP) 243-9 see also HLA typing OMK cells (owl monkey kidney) health 57 lysis, test for virions 65-6 one-step (Ficoll) density gradient 5, 8 32

P labelling, surface antigens 277 paraffin sections 32-8 antigen retrieval 34-8 enzyme blocking 34 rehydration 33 sectioning 33 PBS 6 PCR HLA typing 240-3 see also HLA molecular approaches to tissue typing PCR buffer 240-1 PCR-RFLP 266 PCR-SSCP 266 PCR-SSOP, HLA typing 243-9 PCR-SSP, HLA typing 249-58 peptide recognition by CTLs, expansion for immunotherapy 211,212 peptide tetrameric complexes see HLA-peptide tetrameric complexes Percoll gradient 19 peripheral blood mononuclear cells (PBMCs) CD4 cell selection for cloning 145-6 CD T cells, antigen-specific proliferation assay 147-9 human 10 negative selection 22-3 isolation of lymphocytes 304 metrizamide, density-gradient centrifugation 106 preparation 11-12 preparation for HLA typing 234-5 preparation for typing by serology 234-5 study of HVS-transformed cells 65 virus-specific CTL clone generation 168 peritoneal macrophages, purification and preparation 13 Peyers' patches, purification and preparation of lymphocytes 8-10 phagocytes, recognition of apoptotic cells 300 phosphatidylserine (PS), annexin V interactions 308, 309

phycoerythrin (PE) 206 plasma cells 53 anti-p63 stain 52 surface markers 18 plasmacytoma, B- and T-cell hybridomas 75-93 platelets, removal 234 PMA 154, 157 Poisson distribution, limiting dilution analysis (LDA) 180-2 poliovirus-specific T cell clone 3N2s5.1 116 polyacrylamide gel electrophoresis (PAGE) 285-9 acrylamide gels 288 preparation of lymphocytes 1-26 contamination problems 16-17 lymphocyte handling and culture 14-18 cell proliferation prevention 17-18 long and short-term culture 16-18 short and long-term storage (freezing) 14-16 permissible techniques 29 purification methods 3-13 blood and lymph 10-12 body fluids 10-13 infiltrates (peritoneum, lungs, synovial fluid) 13 infiltrating lymphocytes 10 spleen and lymph nodes 3-8 tonsils and Peyers patches 8-10 sources of lymphoid and APCs 1-3 murine T-cells 103-6 subfractionation for lymphocytes and APCs 18-26 see also immunohistochemistry preparation of lymphoid cells and tissues for immunohistochemistry 27-38, 103-6 primary and secondary lymphoid organs 2 professional antigen-presenting cells see antigen-presenting cells (APCs) proliferation assay CD4 T cells, antigen-specific, activation with anti-CD3 and anti-CD28 147-9 T cells 115-19 protein G, purification of B- and T-cell hybridomas 84-5 protein G-Sepharose, immunoprecipitation of surface antigens 282-5 protein samples, for immunoblotting 290, 293

proteins, SDS-PAGE 288-9 proteolytic enzyme digestion antigen retrieval 34-5 cell preparations 105-6 refolded protein, purification 203-4 refolding buffer, dilution effect 201-2 350

Index respiratory syncytial virus, antigen-specific CTLs 164 reticulum cells, anti-SlOO abs, stain 52 reverse dot blot, HLA typing 265 rhadinoviruses see herpesvirus saimiri RPMI-1640 (standard) 61,100 supplements added 100 RT-PCR, mRNA detection in cytokines 122-4 35

S-L-cysteine labelling, surface antigens 275-7 35 S-L-methionine labelling, surface antigens 275-7 safety aspects, CTL infusions 217-18 SDS-PAGE (polyacrylamide gel electrophoresis) 285-9 sectioning and fixing of cryostat sections 31-2 decalcification 33 processing 33-4 paraffin sections 33 Sepharose affinity chromatography, surface antigens 296 Sepharose beads, CNBr-activated 283-4 Sepharose-protein G 282-5 sequence-based typing (SBT), HLA typing 258-64 silver staining, PAGE 288 slide adhesive coating 27-28 spleen, murine dissection 3-5 purification and preparation of lymphocytes 3-8,103-4 storage methods 14-16 streptavidin-biotin systems 40,151,197,277-8 streptavidin-PE conjugate, tetramer formation 206 subfractionation for lymphocytes and APCs adherence 20 binding antibodies to specific surface markers 20-1 cell sorting 26 complement-mediated lysis 21-2 density and size 19-20 magnetic beads 24-5 panning and columns 22-4 physical properties 19-20 surface markers 20-6 suppliers, list 331-4 surface antigens 20-1,273-98 affinity chromatography 296 immunoblotting 289-96 blotting proteins 291-4 practical tips 292-4 detection of antigen 294-6 protein sample preparation 290, 293

immunoprecipitation 274-85 analysis of antigens in conjunction with immunoprecipitation 284-5 biosynthetic labelling of cellular antigens 274-5 biotinylation of cell-surface proteins 277, 279-80 cell-surface iodination using lactoperoxidase 278-9 in situ labelling methods 277-8 32 P labelling 277 procedure 281, 282-5 35 S-L-methionine labelling 275-7 solubilization of membrane proteins 280-1 using ab directly conjugated to Sepharose beads 283-4 ligand hunting 297 new molecule identification 296 SDS-polyacrylamide gel electrophoresis (PAGE) 285-9 detection of proteins 288-9 T cells, MHCI and II recognition 19 synovial fluid, purification and preparation of lymphocytes 13 SYPRO staining 288 T cell(s) naive 16 subtypes induction strategies 96-8 protective immunity role 95-6 surface markers 18-19 see also murine T cell culture; surface antigens T cell adherence 20 T cell anti-Ig affinity columns 108 T cell blast cells, Percoll gradient 19-20 T cell complement-mediated lysis, negative selection of B cells 21-2 T cell density and size 19 T cell expansion and maturation 2 T cell helpers see Th cells T cell HVS transformation, demonstration of episomes and virion DNA 66-7 T cell hybridomas 75-93 antibody production by chemical and genetic engineering 86-7 antigen presentation 90 apoptosis 90-1 cloning 82-3 cryopreserving and thawing cells 83-4 disadvantages 75-6,87 equipment required and stages 76-7 fusion partners 79 fusion protocol 79-81 generating methods 75-87

351

Index T cell hybridomas (cont.) growth 81 human hybridomas 86 immunizations 77-8 large-scale production 84 materials 76-7 metastasis and adhesion 91 other uses 91 purification, protein G 84-5 screening assays 82 selection procedures 77 technology applications 90-1 tissue culture 76 T cell immortalization, human T-cell leukemia virus type-1 (HTLV-1) 68-9 T cell MHCI and II recognition 19 T cell proliferation assay 115-19 T cell receptor, tetrameric MHC-peptide complexes 214 T cell responses see murine T cells T cell viral transformation herpesvirus saimiri human T cells 56-69 non-human primates 67-8 properties of transformed cells 64-5 virus culture and titration 56-60 immortalization of human T-cell leukaemia virus type-1 68-9 terminal deoxynucleotidyl transferasemediated dUTP nick end-labelling (TUNEL), apoptosis measurement 305-7 tetramethylrhodamineisothiocyanate (TRITC) 44 tetrazolium nitroblue chromogen 248 Texas Red fluorescent label 44 Thl/ThO/Th2 responses, detection by cytokine production 120-1 Th cells assay of helper function for antibody production by B cells 124-7 clones, HVS-transformed, properties 64-5 surface markers 18 thoracic duct 11 thymic organ culture 315-30 murine fetal thymus microdissection 316-17,318-21 alymphoid thymus lobe production 321 newborn thymic slice culture 322-3 reaggregate thymus organ culture 324-9

thymidine kinase (TK) 77 thymocytes peripheral deletion 300 thymic (central) deletion 299 thymoma, AKR, BW5147 79 thymus function 1-2,315-16 CD4+ and CD8+ T cells 316 tissue culture, conditions 99-101 tissue typing see HLA typing tonsils, purification and preparation of lymphocytes 8-10 TRAIL (TNF-related apoptosis-inducing ligand) 301 transport media 29 transporters associated with antigenprocessing (TAPs) 161 Trypanblue 6 tumor-infiltrating lymphocytes (TIL), enrichment 10 TUNEL (terminal deoxynucleotidyl transferase-mediated dUTP nick end-labelling) 305-7, 307 two-colour immunofluorescence 157 tyramine, biotinylated 40 unlabelled antibody-enzyme complex method 39-40 v-FLIPS (viral FADD-like ICE, FLICE) 303 vaccinia-infected target cells 188-9 VEID-CHO 302 viable cell count, murine T cells 102-3 viral transformation of lymphocytes 55-74 virus-specific CTL clones 167-9 vital stains 102 Western blotting, with mAbs 289-90 YVAD-CHO, caspase inhibitor 302 zDEVD-fmk 302 zFAD-fmk 302

352