Quality Assurance in the Pathology Laboratory: Forensic, Technical, and Ethical Aspects

Quality Assurance in the

Pathology Laboratory Forensic, Technical, and Ethical Aspects

© 2011 by Taylor and Francis Group, LLC

Quality Assurance in the

Pathology Laboratory Forensic, Technical, and Ethical Aspects Edited by Maciej J. Bogusz

Boca Raton London New York

CRC Press is an imprint of the Taylor & Francis Group, an informa business

© 2011 by Taylor and Francis Group, LLC

CRC Press Taylor & Francis Group 6000 Broken Sound Parkway NW, Suite 300 Boca Raton, FL 33487-2742 © 2011 by Taylor and Francis Group, LLC CRC Press is an imprint of Taylor & Francis Group, an Informa business No claim to original U.S. Government works Printed in the United States of America on acid-free paper 10 9 8 7 6 5 4 3 2 1 International Standard Book Number: 978-1-4398-0234-2 (Hardback) This book contains information obtained from authentic and highly regarded sources. Reasonable efforts have been made to publish reliable data and information, but the author and publisher cannot assume responsibility for the validity of all materials or the consequences of their use. The authors and publishers have attempted to trace the copyright holders of all material reproduced in this publication and apologize to copyright holders if permission to publish in this form has not been obtained. If any copyright material has not been acknowledged please write and let us know so we may rectify in any future reprint. Except as permitted under U.S. Copyright Law, no part of this book may be reprinted, reproduced, transmitted, or utilized in any form by any electronic, mechanical, or other means, now known or hereafter invented, including photocopying, microfilming, and recording, or in any information storage or retrieval system, without written permission from the publishers. For permission to photocopy or use material electronically from this work, please access www.copyright.com (http://www.copyright.com/) or contact the Copyright Clearance Center, Inc. (CCC), 222 Rosewood Drive, Danvers, MA 01923, 978-750-8400. CCC is a not-for-profit organization that provides licenses and registration for a variety of users. For organizations that have been granted a photocopy license by the CCC, a separate system of payment has been arranged. Trademark Notice: Product or corporate names may be trademarks or registered trademarks, and are used only for identification and explanation without intent to infringe. Visit the Taylor & Francis Web site at http://www.taylorandfrancis.com and the CRC Press Web site at http://www.crcpress.com

© 2011 by Taylor and Francis Group, LLC

Table of Contents

Preface Editor Contributors

vii ix xi

Part I Quality Assurance of Chemometric Methods and Pathology: Selected Topics

1

The Preanalytical Phase in Quality Assurance

3

Giuseppe Lippi and Gian Cesare Guidi

2

Quality Assurance of Point-of-Care and On-Site Drug Testing

15

James H. Nichols

3

Quality Assurance of Identification with Chromatographic–Mass Spectrometric Methods

45

Maciej J. Bogusz

4

Quality Assurance of Quantification Using Chromatographic Methods with Linear Relation between Dose and Detector Response Georg Schmitt and Rolf Aderjan

© 2011 by Taylor and Francis Group, LLC

v

77

vi Table of Contents

Part II Quality Assurance Aspects of Newly Emerging Methods in Pathology and Laboratory Medicine

5

Pharmacogenomics, Personalized Medicine, and Personalized Justice Influencing the Quality and Practice of Forensic Science

93

Steven H.Y. Wong

6

Quality Aspects in Autopsy versus Virtopsy

121

Michael J. Thali and Stephan A. Bolliger

Part III Accreditation, Standards, and Education: Their Role in Maintaining Quality

7

Role of Accreditation Procedures in Maintaining Quality

139

Maciej J. Bogusz and Huda Hassan

8

Role of Governmental and Professional Organizations in Setting Quality Standards in Pathology and Laboratory Medicine and Related Areas

205

Maciej J. Bogusz

9

Education and Training in the Changing Environment of Pathology and Laboratory Medicine

289

Gian Cesare Guidi and Giuseppe Lippi

10

Quality Assurance Aspects of Interpretation of Results in Clinical and Forensic Toxicology

345

Katrin M. Kirschbaum and Frank Musshoff

Index © 2011 by Taylor and Francis Group, LLC

363

Preface

The real purpose of the scientific method is to make sure Nature hasn’t misled you into thinking you know something you don’t actually know. If you get careless or go romanticizing scientific information, giving it a flourish here and there, Nature will soon make a complete fool out of you. Pirsig (2000)

It is impossible to define “quality” in one sentence. The term has several definitions, each formulated according to different requirements and perspectives. According to the descriptive approach, quality may be seen as a set of wanted or unwanted features. Following are a few descriptive definitions of quality taken from www.businessdictionary.com and www.thefreedictionary.com: • Measurable and verifiable aspect of a thing or phenomenon, expressed in numbers or quantities, such as lightness or heaviness, thickness or thinness, softness or hardness. • Attribute, characteristic, or property of a thing or phenomenon that can be observed and interpreted, and may be approximated (quantified) but cannot be measured, such as beauty, feel, flavor, taste. • An inherent or distinguishing characteristic: a property or personal trait. According to the subjective and demanding approach, quality is seen as a set of features that should satisfy general expectations or particular requirements. This approach has been expressed in the following definitions: • Measure of excellence or state of being free from defects, deficiencies, and significant variations. • The totality of features and characteristics of a product or service that bears its ability to satisfy stated or implied needs (ISO 8402-1986). • Degree to which a set of inherent characteristics fulfill requirements. The standard defines “requirement” as need or expectation (ISO 9000-2005). From these examples, it may be seen that quality is related to particular human activities and cannot be unequivocally defined and easily measured.

© 2011 by Taylor and Francis Group, LLC

vii

viii Preface

This is in agreement with the findings of some authors, as follows: “Quality refers to the amount of the unpriced attributes contained in each unit of the priced attribute” (Leffler, 1982); “Quality is neither mind nor matter, but a third entity independent of the two, even though Quality cannot be defined, you know what it is” (Pirsig, 2000). Irrespective of all definitions and views, the striving for good quality seems to be an intrinsic feature of the human mind and acting. This was reflected by the formulation of all “good practices,” such as GLP, GMP, GMLP, GCP, GCLP, and others. It is also obvious that achieving a certain quality is a moving target since it is related to requirements and expectations that change constantly. This book is divided into three parts. Part I deals with selected aspects of quality assurance of quantifiable methods that are applied in laboratory medicine and toxicology. Part II discusses the quality aspects of emerging disciplines—personalized therapy and virtopsy. The chapters in this part present regulatory and logistic instrumentation that ensure quality in laboratory methods. Part III reviews the quality of professional education at the graduate and postgraduate levels in pathology and laboratory medicine. The concept of this book is to provide a general insight into the quality assurance aspects of pathology and laboratory medicine. It should be helpful in improving laboratory work and, at the same time, should show the possibilities and limits of all logistic and legal tools related to quality issues. The chapters, written by authors who have long been involved in the theoretical and practical aspects of laboratory activity, cover the most relevant problems of quality assurance. However, they do not provide an encyclopedic view on quality issues. Rather, they should stimulate people involved to monitor their work closely and critically. The quality control of laboratory activities may be organized, but the quality itself cannot be achieved without commitment and constantly high expectations. I would like to express my gratitude to Becky Masterman and Patricia Roberson from Taylor & Francis for their continuous support, patience, and help during the writing and preparation of this book. Maciej J. Bogusz

References Leffler, K.B. Ambiguous changes in product quality, American Economic Review, 72, 956–967, December 1982. Pirsig, R.M. Zen and the Art of Motorcycle Maintenance, Harper Perennial, New York, 2000.

© 2011 by Taylor and Francis Group, LLC

Editor

Maciej J. Bogusz is currently a senior clinical scientist at the Royal Clinic in Riyadh, Saudi Arabia. His scientific interests include the pharmacology and toxicology of illicit drugs and their active metabolites, and the application of modern analytical methods (particularly liquid chromatography-mass spectrometry [LC-MS]) in clinical and forensic toxicology. He is an internationally recognized expert in this area. Dr. Bogusz has additionally performed several studies on the toxicological aspects of herbal remedies. Recently, he developed several methods concerning therapeutic drug monitoring of Â�clinically relevant drugs (i.e., immunosuppressants) using LC-MS. Dr. Bogusz graduated as a physician from Copernicus University School of Medicine in Krakow, Poland, in 1963. In his professional career, he was a research scientist at the Institute of Forensic Research in Krakow and chief toxicologist at the Institute of Forensic Medicine in Krakow. He was board certified in clinical chemistry and forensic medicine in Poland. Since 1986, he has been working in Germany as a Privat-Dozent at the Institute of Legal Medicine at the Ruprecht-Karl University of Heidelberg. He is a diplomate of the German Board of Forensic Toxicologists. From 1990 until 2000, he worked at the Institute of Forensic Medicine at the Aachen University of Technology (RWTH) as a professor of forensic and clinical toxicology. In 2000, he joined the Toxicology Laboratory at the King Faisal Specialist Hospital and Research Centre in Riyadh and later the Royal Toxicology Laboratory. Dr. Bogusz is the author of over 160 original publications in international journals and 8 book chapters and is the editor of 2 books. He is a member of numerous scientific toxicological organizations, such as the International Association of Forensic Toxicologists, the International Association of Therapeutic Drug Monitoring and Clinical Toxicology, the Forensic Science Society, the German Society of Forensic Toxicology and Chemistry, and the Society of Forensic Toxicologists. His name is included in several scientific encyclopedias such as Marquis Who’s Who in the World, 1980–1981, 1993– 1994, 2003; Man of Achievement, St. Ives, U.K.; Who’s Who of Contemporary Achievement, Cambridge, U.K.; and in Who’s Who of German Medicine— Most Frequently Cited German Scientists (Vless Verlag 1995).

© 2011 by Taylor and Francis Group, LLC

ix

Contributors

Rolf Aderjan

Giuseppe Lippi

Maciej J. Bogusz

and

Institute of Legal Medicine and Traffic Medicine Ruprechts-Karl University Heidelberg, Germany

Faculty of Medicine and Surgery Department of Life and Reproduction Sciences University of Verona Verona, Italy

Royal Toxicology Laboratory Royal Clinics Riyadh, Kingdom of Saudi Arabia

Department of Pathology and Laboratory Medicine University Hospital of Parma Parma, Italy

Stephan A. Bolliger

Department of Forensic Medicine Institute of Forensic Medicine University of Bern Bern, Switzerland

Frank Musshoff

Institute of Forensic Medicine Rheinische Friedrich-Wilhelms-University Bonn, Germany

Gian Cesare Guidi

Faculty of Medicine and Surgery Department of Life and Reproduction Sciences University of Verona Verona, Italy

James H. Nichols

Faculty, School of Medicine Tufts University Boston, Massachusetts and

Huda Hassan

Clinical Chemistry Baystate Health Springfield, Massachusetts

Department of Forensic Medicine and Science University of Glasgow Glasgow, Scotland, United Kingdom

Georg Schmitt

Katrin M. Kirschbaum

Institute of Legal Medicine and Traffic Medicine Ruprechts-Karl University Heidelberg, Germany

Institute of Forensic Medicine Rheinische Friedrich-Wilhelms-University Bonn, Germany

© 2011 by Taylor and Francis Group, LLC

xi

xii

Michael J. Thali

Center of Forensic Imaging and Virtopsy Institute of Forensic Medicine University of Bern Bern, Switzerland

Steven H.Y. Wong

Pathology Department Medical College of Wisconsin

© 2011 by Taylor and Francis Group, LLC

Contributors and Toxicology Department and Pharmacogenomics Milwaukee County and Drug Evaluation Laboratory Wisconsin Community Services Milwaukee, Wisconsin

Quality Assurance of Chemometric Methods and Pathology: Selected Topics

© 2011 by Taylor and Francis Group, LLC

I

The Preanalytical Phase in Quality Assurance

1

Giuseppe Lippi and Gian Cesare Guidi

Contents 1.1 Introduction 1.2 Medical and Diagnostic Errors 1.3 Overview on Diagnostic Errors 1.4 The Preanalytical Variability 1.5 Prevention and Management of Preanalytical Errors 1.6 Conclusions References

3 3 5 7 8 11 11

1.1╇Introduction Laboratory diagnostics is an essential part of the clinical decision making because it substantially contributes to the clinical decision making by providing valuable information for the screening, diagnosis, therapeutic monitoring, and follow-up of most—if not all—human disorders. Several changes have occurred in the organization of laboratory diagnostics over the past decades, mainly driven by the widespread introduction of point-of-care testing, centralization of activities in large core laboratories, as well as the increase in number and complexity of diagnostic testing worldwide. As such, laboratory diagnostics, and likewise other medical disciplines, are not as safe as they should be.

1.2╇Medical and Diagnostic Errors Several former studies on patients’ safety published in the 1990s drew attention to the fact that potentially serious medical errors (over half of which are preventable) can occur in the medical care with a relatively high frequency (i.e., up to 7%) and cost the healthcare system a huge amount of money (e.g., between $17 and $29 billion a year in the United States) [1,2]. This striking evidence led the U.S. Institute of Medicine (IOM) to release the foremost report “To Err is Human,” where it was clearly reported that as many as © 2011 by Taylor and Francis Group, LLC

3

4

Quality Assurance in the Pathology Laboratory

98,000 people die each year needlessly due to preventable medical harm [3], the equivalent of three jumbo-jet crashes every 2 days [4]. After the publication of “To Err is Human,” both the IOM and the U.S. government recognized the urgent need to establish firm actions to be proactive for reducing this otherwise concerning estimate of preventable harms to the patients, paving the way to the publication of a second report in 2001, entitled “Crossing the Quality Chasm: A New Health Care System for the 21st Century” [5]. In this document, the IOM reinforced the call for fundamental change to close the quality gap in healthcare, recommending also a radical redesign of the U.S. healthcare system based on a set of 10 new rules to guide patient– clinician relationships, a recommended organizing framework to harmonize the efforts in payment and accountability with improvements in quality. In the same year, the World Health Organization supported the institution of the “World Alliance for Patient Safety,” aimed at facilitating the development of patient-safety policy and practice in all member states. Irrespective of the remarkable attention placed on patient safety in the following years, in 2009, the consumers’ union released a further document entitled “To Err is Human—To Delay Is Deadly,” concluding that “ten years later—the publication of To Err is Human—a million lives lost, billions of dollars wasted” [6]. This expert, independent, nonprofit U.S. organization underlined that it is impossible to establish whether real progresses have been made in the field of patient safety. On the contrary, due to the poor transparency and little to null awareness and public reporting of medical errors, no significant reduction has occurred in the burden of preventable medical errors, which still account for more than 100,000 deaths yearly. Although various descriptions exist for “medical error,” three reasonable and similar definitions have been provided by Reason (failure of a planned sequence of mental or physical activities to achieve its intended outcome when these failures cannot be attributed to chance) [7], Leape (unintended act [either omission or commission] or an act that does not achieve its intended outcome) [4], and the IOM (the failure of a planned action to be completed as intended—that is a error of action—or the use of a wrong plan to achieve an aim—that is an error of intention—) [3]. The area of agreement among all these interpretations is the exclusion of natural history of disease, as well as of the predictable complications of a correctly performed medical procedure, from the adverse outcome. The IOM also classifies medical errors according to four clinical path categories: “diagnostic,” “treatment,” “prevention,” and “others.” As such, while medical errors are traditionally perceived as a wrong therapeutic action (e.g., wrong site surgery, administration of the wrong drug to the right patient or vice versa, blood incompatibility, development of an otherwise preventable medical complication such as venous thromboembolism or hospital-acquired infection), diagnostic errors have instead a great dignity in the daily practice, inasmuch as in © 2011 by Taylor and Francis Group, LLC

The Preanalytical Phase in Quality Assurance

5

vitro diagnostics and imaging studies contribute for up to 70% to the clinical decision making.

1.3╇Overview on Diagnostic Errors The most reliable definition of diagnostic error is that provided by the U.S. Agency for Healthcare Research and Quality, as “… any mistake or failure in the diagnostic process leading to a misdiagnosis, a missed diagnosis, or a delayed diagnosis” [8]. This definition encompasses any failure in timely access to care; elicitation or interpretation of symptoms, signs, or laboratory results; formulation and weighing of differential diagnosis and timely Â�follow-up; and specialty referral or evaluation [9]. As regards laboratory errors, the most suitable definition is that originally endorsed by Bonini et al. as “a diagnosis that is missed, wrong, or delayed, as detected by some subsequent definitive test or finding,” which has been further acknowledged and adopted by the ISO Technical Report 22367, as “a defect occurring at any part of the laboratory cycle, from ordering tests to reporting, interpreting, and reacting to results” [10]. According to these definitions, the unique framework for considering where mistakes can occur in laboratory testing services is obviously the total testing process, so that mistakes can occur in each of its various steps or in any of the places where a handoff can occur, starting from test request and ending with the physician’s reaction to laboratory data, according to the foremost Lundberg’s “brain-to-brain” loop. A recent survey administered at 20 grand rounds presentations across the United States and by mail at two collaborating institutions overviewed diagnostic errors, describing their causes, seriousness, and frequency. After exclusion of cases lacking sufficient details were excluded, 583 errors were identified, 162 (28%) of which were rated as major, 241 (41%) as moderate, and 180 (31%) as minor or insignificant. The most common missed or delayed diagnoses were related to pulmonary embolism (4.5%), drug reactions or overdose (4.5%), lung cancer (3.9%), colorectal cancer (3.3%), acute coronary syndrome (3.1%), breast cancer (3.1%), and stroke (2.6%). More interestingly, most errors occurred in the testing phase (failure to order, report, and follow-up laboratory results) (44%), followed by clinician assessment errors (failure to consider and overweighing competing diagnosis) (32%), history taking (10%), physical examination (10%), and referral or consultation errors and delays (3%). As regards laboratory errors, the most frequent occurrences were failure/delay in ordering needed test/s, erroneous laboratory reading of test, failed or delayed reporting of result/s to clinicians, failed or delayed follow-up of (abnormal) test results, technical errors or poor processing of specimen/test and sample mixup or mislabeled (e.g., wrong patient/test) [9]. © 2011 by Taylor and Francis Group, LLC

6

Quality Assurance in the Pathology Laboratory

Although it is difficult—if not impossible—to provide a real estimation of laboratory errors due to a variety of causes (e.g., underestimation of the problem, underreporting, huge organizational heterogeneity among different countries and facilities, the lack of an universal approach for identification and reporting), mistakes in laboratory diagnostics can occur with an overall frequency of 0.1%–0.3% “events,” 0.1%–0.5% patients, and 0.01%– 0.5% test results [11]. While these numbers appear innocent as compared with the error rate in other medical areas, they become otherwise significant considering the huge amount of tests that each laboratory performs in the daily practice. For example, translating these estimates to the activity of a medium-sized laboratory (e.g., performing 3 millions exams per year), the number of testing errors per day would range between 82 and 247. All these potential problems and errors have a strong influence on patient outcome and healthcare expenditures, so that interventions targeted at reducing uncertainties within the laboratory diagnostics would offer a great potential benefit for improving total quality in laboratory medicine. Although it is reportedly difficult to associate a diagnostic error to an adverse health outcome, within certain areas of testing, especially coagulation testing [12], the consequences of laboratory mistakes might be serious, especially for those considered as “diagnostic.” Patients might hence be diagnosed with a particular condition, when in fact they do not have it (i.e., a “false positive” result), or else a patient with a real pathology might be missed (i.e., a “false negative” result). Some foremost investigations on adverse events related to laboratory errors attest that 9%–15% of laboratory errors might negatively impact on patient care, with the risk of inappropriate care being estimated between 2% and 7%, thereby higher than, or equal to, many other nonmedical activities [11]. Plebani and Carraro also concluded that while most of the laboratory mistakes (74%) might not affect patient outcomes, in 19% of the patients, they might be associated with further inappropriate investigations and unjustifiable increase in costs, whereas in 6.4% of the patients, they might be associated with inappropriate care or inappropriate modification of therapy [13]. Within the healthcare, laboratory medicine has been foremost in achieving awareness of diagnostic errors and pursuing the issue of patient safety by focusing notable efforts on quality control methods and quality assessment programs dealing with analytical aspects of testing over the past century. In the early 1920s, the American Society of Clinical Pathologists, the precursor of the current College of American Pathologist (CAP), had already started a voluntary proficiency testing program focused on analytical quality [14]. In the following years, the CAP promoted several studies and investigations to collect and analyze results on a variety of performance measures, including magnitude and significance of errors, strategies for error reduction, and willingness to implement each of these performance measures [15]. As such, the analytical uncertainty in the total testing process has been drastically © 2011 by Taylor and Francis Group, LLC

The Preanalytical Phase in Quality Assurance

7

reduced during these years, while other extra-analytical activities have been partially or completely ignored, thereby becoming progressively the areas of major uncertainty in laboratory diagnostics. A growing body of evidence accumulated in recent years demonstrates in fact that errors occur more frequently before (preanalytical) and after (postanalytical) the test has been performed. Most errors are due to preanalytical factors (46%–68.2% of total errors), though a high error rate (18.5%–47% of total errors) has also been observed in the postanalytical phase [13]. In particular, the manually intensive activities of the preanalytical phase are those characterized by the highest possible degree of understandardization and vulnerability throughout the total testing process [16–20].

1.4╇ The Preanalytical Variability Until in vivo measurements will translate from theory to practice and thereby become widely available, laboratory diagnostics would only be possible after collecting suitable and representative biological specimens. As such, any single step of the preanalytical phase carries an inherent hazard and may hide the possibility of an error. There is increasing awareness, therefore, that further improvements in the total quality and efficacy of laboratory diagnostics should outstrip the traditional borders of the clinical laboratory, embracing those neglected activities (i.e., sample collection, handling, and storage) that lie outside the walls of the traditional clinical laboratory and in fact add value to the diagnostic performance [16–20]. Regardless of the high impact of preanalytical mistakes on total quality in laboratory diagnostics, there is a considerable difference between in- and outpatients error rates (i.e., from 2 to 10 times higher in the former case), which has been attributed to human factors related to skill in drawing blood, major standardization in procedures of outpatients clinics under the authority of laboratory professional, and the sheer amount of laboratory usage for inpatients. Overall, inappropriate quality and quantity of specimen account for over 60% of the preanalytical errors. Data from the most representative studies on this issue consistently show that problems directly related to the collection of the biological specimens are the leading causes of preanalytical variability, including hemolyzed (54%), insufficient (21%), incorrect (13%), and clotted (5%) samples [21]. In vitro hemolysis, in particular, which mirrors a more generalized process of blood and vascular cell damage occurring during phlebotomy rather than in vivo hemolysis, is the most frequent reason for specimen rejection, five times more frequent than the next one (insufficient specimen quantity) [22]. In hematological and coagulation testing, clotted specimens are also a frequent reason for rejection, whereas a wrong container or an insufficient sample has the highest frequency of rejection in © 2011 by Taylor and Francis Group, LLC

8

Quality Assurance in the Pathology Laboratory

pediatrics [23,24]. Additional problems, such as incorrect sample identification or handling, might occur beyond the blood drawing process, though their prevalence is reportedly much lower, because in most cases, it would go undetected. While misidentification of general laboratory specimens is estimated to represent ∼1% of all diagnostic errors, it can produce the most serious harm to the patient, when not promptly detected. As such, by extrapolation of the adverse event rate to all U.S. hospital-based laboratories, more than 160,000 adverse events per year can be expected from misidentification of patients’ laboratory specimens [25]. A higher prevalence of errors is frequently observed in samples referred from pediatric and emergency departments and, expectedly, the frequency distribution of specific preanalytical problems is different among the hospital wards. Specimens not received prevail from the emergency care units, surgical and clinical departments, whereas clotted and hemolyzed specimens are frequently referred from pediatric and emergency departments, respectively [23,24]. These epidemiological observations have a plausible explanation, because most of the preanalytical activities are still manually intensive, more vulnerable to human errors, and fall outside the control of laboratory professionals.

1.5╇ Prevention and Management of Preanalytical Errors One concept that should be clearly affirmed when dealing with medical errors, laboratory errors, as well as preanalytical errors is that there is no magic bullet to solve all the problems. Actually, a drastic solution might be conjectured, that is, the elimination of all those processes more vulnerable to errors and uncertainty. As mentioned previously, however, this is practically unfeasible because preanalytical activities still are—and will remain for long—almost necessary steps for obtaining suitable samples for testing. As such, the most reliable strategy to reduce uncertainty and contextually errors in this unavoidable step of the total testing process is to establish a multifaceted strategy entailing (1) prediction/prevention of accidental events through exhaustive process analysis, reassessment and rearrangement of quality requirements, dissemination of operative guidelines and best-practice recommendations, reduction of complexity and error-prone activities, introduction of error-tracking systems, and continuous monitoring of performances; (2) increasing and diversifying defensive mechanisms and barriers through application of multiple and heterogeneous systems to identify nonconformities; and (3) decreasing the overall vulnerability of the system through implementation of reliable and objective detection systems and causal relation charts, education, and training [18,20]. First and foremost to succeeding in this process is the introduction of process analysis and root cause analysis (RCA). The lesson learned from © 2011 by Taylor and Francis Group, LLC

The Preanalytical Phase in Quality Assurance

9

improvement methodologies applied to other contexts (i.e., industrial production) such as six sigma and lean management have valuable applications for reducing time and errors required to complete an operation or production and might therefore be suitable options for reorganizing the activities of clinical laboratories as well. Since all human failures, including medical errors, do have a preceding cause, RCA is a valuable aid, since it is based on a retrospective analytical approach, which has found broad applications to investigate major industrial accidents [26]. Basically, RCA focuses on identifying the latent conditions that underlie variation in medical performance and, if applicable, developing recommendations for improvements to decrease the likelihood of a similar incident in the future. The failure mode and effect analysis (FMEA) is increasingly quoted as a reliable tool for risk management, which was originally developed by the U.S. Army and further introduced in aerospace and automobile industry. It is based on a systematic process for identifying potential process failures before they occur, making it possible to recognize potential solutions that will eliminate or minimize the inherent hazards. This model has been modified and simplified by the U.S. Department of Veteran Affairs. National Center for Patient Safety developed a simplified version of FMEA (HFMEA) for implementation in health care [27]. Whatever the solution adopted, this approach encompasses clear problem understanding, feasibility study, requirements engineering, developmental design, and compliance with established laboratory standards issued by certification or accreditation agencies. As such, the use of these tools would entail a greater familiarity and comprehension of how a particular preanalytical activity develops, a comprehensive description of duties and responsibilities, and establishment of safety requirements and performance indicators integrated within the development of the system, aimed at reducing latent and potentially active failures. The second step is the continuous education of the healthcare staff, inside and especially outside the laboratory. Considering that most preanalytical steps take place before the specimens arrive within the laboratory environment [17], dissemination of best practices (e.g., quality manuals) for collection and handling of biological specimens is foremost, along with widespread introduction of certification procedures for the healthcare personnel deputed to collect biological samples [28,29]. The information to be provided to all the operators involved in responsibilities of collection and handling of the specimens includes clear concepts on preanalytical variables such as time of sampling, biological variability, posture, tourniquet application, collection tools, order of draw, procedures for handling, transportation and storage of specimens, indications on the effect of at least commonly encountered influence and interference factors. The third useful step is discontinuation or reduction of those (human) preanalytical activities more vulnerable to errors and uncertainty. Although © 2011 by Taylor and Francis Group, LLC

10

Quality Assurance in the Pathology Laboratory

very little can be done to automate the phase of blood collection thus far, multiple and multifaceted forms of automation are instead emerging in multiple steps of the total testing process, including the preanalytical phase. Automation has the potential to rationalize the workflow, reduce the stress, decrease the burden of manual errors, as well as ensure a greater degree of safety for the operators. Computerized physician order entry, automatic preparation of sample collections tools with pre-labeling of primary tubes, positive patient identification (by traditional barcodes, smart cards, radio-frequency identification, optical character recognition, or voice recognition devices), “active tubes” (e.g., “lab-on-a-chip integrated containers” storing patient data and measuring physiological—temperature/humidity/flow rate—and metabolic data—glucose concentration), automatic transport systems (i.e., pneumatic tubes conveyer, robots), and preanalytical workstations all are valuable options that would limit or replace manually intensive procedures and therefore the chance of human errors throughout these activities [18,20]. The fourth crucial step is the implementation of a comprehensive risk management strategy, focused on what, why, where, and when problems may arise and what can be done to avoid, tolerate, or reduce their adverse outcomes. Preliminarily, this strategy requires identification and implementation of specific, detailed, and reliable error detection systems based on performance indicators that would monitor most—if not all—of the critical steps, reducing risks and preventing undesirable conditions [30,31]. Although we all know that measuring and especially reporting errors is not so simple, nor pleasing and gratifying, a starting point must be established. The recent project “Model of Quality Indicator,” undertaken by the Working Group, “Laboratory Errors and Patient Safety (WG-LEPS)” instituted by the division of Education and Management (EMD) of the International Federation of Clinical Chemistry and Laboratory Medicine (IFCC) must be regarded as a foremost foundation to promote and encourage investigations into errors in laboratory medicine, collect data available on this issue, and recommend strategies and procedures for improving patient safety [32]. The logic consequence is furthermore the selection of those laboratory events arising transversally across the total testing process that are more closely associated with a real (severe) harm for the patient. As such, development and implementation of “sentinel events” besides those traditionally used in general medicine and surgery i.e., is a suitable approach, since it would allow to gain new knowledge about incidents and hold both providers and stakeholders much more accountable for patient safety [33,34]. The final step is the translation of the valuable concepts of internal quality control (IQC) and external quality assessment (EQA) to the preanalytical phase. Although this is not expected to be easy, there are already some valuable examples that an EQA program expressly developed for the preanalytical phase is feasible and useful. Since 1998, the Sociedad Española © 2011 by Taylor and Francis Group, LLC

The Preanalytical Phase in Quality Assurance

11

de Bioquímica Clínica y Patología Molecular (SEQC) has developed an EQA program for the preanalytical phase, focused on the analysis of causes for rejection of samples usually collected in clinical laboratories. The participants are asked to record the number and causes for rejection of routine and/or stat samples encountered in their laboratories. Data gathered throughout 10 blood cycles for the preanalytical phase have also been analyzed already, demonstrating that this approach might provide laboratories with a useful tool for an easier follow-up of their state of the art and, incidentally, allowing them to implement continuous improvement [35]. Most recently, a multicenter evaluation of the hemolysis index (HI) as an indicator of preanalytical quality has been carried out to investigate the feasibility of establishing an EQA for the management of hemolytic specimens across different clinical laboratories in Europe [36]. Reference sera containing varying amounts of spiked hemolyzed blood were shipped to seven separate laboratories and the HI was tested in triplicate. Noticeably, a good agreement of measurements was recorded among the various laboratories, and the discrepancies were further attenuated by normalizing results according to instrument-specific alert values, thus proving the tangible benefits of this program [36,37].

1.6╇ Conclusions Laboratory professionals are familiar with the concept of product security, which is basically concerned with avoiding vulnerabilities intrinsic to a manufactured item, such as a specific analyzer. Unfortunately, this is not enough for ensuring total quality in laboratory diagnostics [38]. While compliance with cost-containment policies worldwide has forced laboratory professionals to reorganize structures and activities, the increasing awareness of the complexity of the total testing process and the availability of technological advances are both paving the way to radically increase accuracy and safety, enabling quality intervention and monitoring in all the multifaceted activities of the preanalytical phase, as well as benchmarking quality of healthcare facilities and professionals with blood collection responsibilities.

References 1. Lazarou J, Pomeranz BH, and Corey PN. Incidence of adverse drug reactions in hospitalized patients: A meta-analysis of prospective studies. JAMA 1998; 279:1200–1205. 2. Berwick DM and Leape LL. Reducing errors in medicine. BMJ 1999; 319:136–137. 3. Kohn KT, Corrigan JM, and Donaldson MS. To Err Is Human: Building a Safer Health System. Washington, DC: National Academy Press, 1999. 4. Leape LL. Error in medicine. JAMA 1994; 272:1851–1857. © 2011 by Taylor and Francis Group, LLC

12

Quality Assurance in the Pathology Laboratory

5. Institute of Medicine. Crossing the Quality Chasm: A New Health Care System for the 21st Century. Washington, DC: National Academy Press, 2001. 6. Consumers Union. To Err is Human—To Delay is Deadly. Available at: http:// www.safepatientproject.org/2009/05/to_err_is_humanto_delay_is_dea.html (last accessed January 12, 2010). 7. Reason J. The nature of error. In: Reason J, ed. Human Error. New York: Cambridge University Press, 1990. pp. 1–18. 8. Schiff GD, Kim S, Abrams R et al. Diagnosing diagnostic errors: Lessons from a multi-institutional collaborative project. In: Advances in Patient Safety: From Research to Implementation, vol. 2. Agency for Healthcare Research and Quality Web site. www.ahrq.gov/qual/advances (accessed January 12, 2010). 9. Schiff GD, Hasan O, Kim S, Abrams R, Cosby K, Lambert BL, Elstein AS et al. Diagnostic error in medicine: Analysis of 583 physician-reported errors. Arch. Intern. Med. 2009; 169:1881–1887. 10. ISO/PDTS 22367. Medical laboratories: Reducing error through risk management and continual improvement: Complementary element. 11. Plebani M. Errors in clinical laboratories or errors in laboratory medicine? Clin. Chem. Lab. Med. 2006; 44:750–759. 12. Favaloro EJ, Lippi G, and Adcock DM. Preanalytical and postanalytical variables: The leading causes of diagnostic error in hemostasis? Semin. Thromb. Hemost. 2008; 34:612–634. 13. Plebani M and Carraro P. Mistakes in a stat laboratory: Types and frequency. Clin. Chem. 1997; 43:1348–1351. 14. Hilborne LH, Lubin IM, and Scheuner MT. The beginning of the second decade of the era of patient safety: Implications and roles for the clinical laboratory and laboratory professionals. Clin. Chim. Acta 2009; 404:24–27. 15. Raab SS. Improving patient safety through quality assurance. Arch. Pathol. Lab. Med. 2006; 130:633–637. 16. Lippi G, Guidi GC, Mattiuzzi C, and Plebani M. Preanalytical variability: The dark side of the moon in laboratory testing. Clin. Chem. Lab. Med. 2006; 44:358–365. 17. Lippi G, Salvagno GL, Montagnana M, Franchini M, and Guidi GC. Phlebotomy issues and quality improvement in results of laboratory testing. Clin. Lab. 2006; 52:217–230. 18. Lippi G and Guidi GC. Risk management in the preanalytical phase of laboratory testing. Clin. Chem. Lab. Med. 2007; 45:720–727. 19. Lippi G, Fostini R, and Guidi GC. Quality improvement in laboratory medicine: Extra-analytical issues. Clin. Lab. Med. 2008; 28:285–294. 20. Lippi G. Governance of preanalytical variability: Travelling the right path to the bright side of the moon? Clin. Chim. Acta 2009; 404:32–36. 21. Lippi G, Bassi A, Brocco G, Montagnana M, Salvagno GL, and Guidi GC. Preanalytic error tracking in a laboratory medicine department: Results of a 1-year experience. Clin. Chem. 2006; 52:1442–1443. 22. Lippi G, Blanckaert N, Bonini P, Green S, Kitchen S, Palicka V, Vassault AJ, and Plebani M. Haemolysis: An overview of the leading cause of unsuitable specimens in clinical laboratories. Clin. Chem. Lab. Med. 2008; 46:764–772.

© 2011 by Taylor and Francis Group, LLC

The Preanalytical Phase in Quality Assurance

13

23. Salvagno GL, Lippi G, Bassi A, Poli G, and Guidi GC. Prevalence and type of pre-analytical problems for inpatients samples in coagulation laboratory. J. Eval. Clin. Pract. 2008; 14:351–353. 24. Lippi G, Bassi A, Solero GP, Salvagno GL, and Guidi GC. Prevalence and type of preanalytical errors on inpatient samples referred for complete blood count. Clin. Lab. 2007; 53:555–556. 25. Lippi G, Blanckaert N, Bonini P, Green S, Kitchen S, Palicka V, Vassault AJ, Mattiuzzi C, and Plebani M. Causes, consequences, detection, and prevention of identification errors in laboratory diagnostics. Clin. Chem. Lab. Med. 2009; 47:143–153. 26. Reason JT. Human Error. New York: Cambridge University Press, 1990. 27. DeRosier J, Stalhandske E, Bagian JP, and Nudell T. Using health care failure mode and effect analysis: The VA national center for patient safety’s prospective risk analysis system. Joint Comm. J. Qual. Improv. 2002; 5:248–267. 28. Lippi G, Salvagno GL, Montagnana M, and Guidi GC. The skilled phlebotomist. Arch. Pathol. Lab. Med. 2006; 130:1260–1261. 29. Lippi G, Mattiuzzi C, and Guidi GC. Laboratory quality improvement by implementation of phlebotomy guidelines. MLO Med. Lab. Obs. 2006; 38:6–7. 30. Simundic AM and Topic E. Quality indicators. Biochem. Med. 2008; 18:311–319. 31. Lippi G and Guidi GC. Preanalytic indicators of laboratory performances and quality improvement of laboratory testing. Clin. Lab. 2006; 52:457–462. 32. Sciacovelli L and Plebani M. The IFCC working group on laboratory errors and patient safety. Clin. Chim. Acta 2009; 404:79–85. 33. Lippi G, Mattiuzzi C, and Plebani M. Event reporting in laboratory medicine. Is there something we are missing? MLO Med. Lab. Obs. 2009; 41:23. 34. Lippi G and Plebani M. The importance of incident reporting in laboratory diagnostics. Scand. J. Clin. Lab. Invest. 2009; 69:811–813. 35. Alsina MJ, Alvarez V, Barba N, Bullich S, Cortés M, Escoda I, and Martínez-Brú C. Preanalytical quality control program—An overview of results (2001–2005 summary). Clin. Chem. Lab. Med. 2008; 46:849–854. 36. Plebani M and Lippi G. Hemolysis index: quality indicator or criterion for sample rejection? Clin. Chem. Lab. Med. 2009; 47:899–902. 37. Lippi G, Luca Salvagno G, Blanckaert N, Giavarina D, Green S, Kitchen S, Palicka V, Vassault AJ, and Plebani M. Multicenter evaluation of the hemolysis index in automated clinical chemistry systems. Clin. Chem. Lab. Med. 2009; 47:934–939. 38. Plebani M and Lippi G. To err is human. To misdiagnose might be deadly. Clin. Biochem. 2010; 43:1–3.

© 2011 by Taylor and Francis Group, LLC

Quality Assurance of Point-of-Care and On-Site Drug Testing

2

James H. Nichols

Contents Abbreviations 2.1 Point-of-Care Testing Definition 2.2 On-Site Drug Testing Methodologies 2.3 Quality Assurance versus Quality Control 2.4 Quality Management System Essentials 2.5 The Role of the Laboratory Director 2.6 Quality Control 2.7 Laboratory Quality Control Based on Risk Management 2.8 Developing a Quality Control Plan for a POC Drug Test 2.9 Summary References

15 15 17 21 22 29 31 33 36 43 43

Abbreviations CAP CLIA 88 CLSI CMS COLA FDA ISO MDMA POC SAMHSA

College of American Pathologists Clinical Laboratory Improvement Amendments of 1988 Clinical and Laboratory Standards Institute Centers for Medicaid and Medicare Services Commission on Office Laboratory Accreditation U.S. Food and Drug Administration International Organization for Standardization 3,4-Methylenedioxymethamphetamine Point-of-care Substance Abuse and Mental Health Services Administration

2.1╇ Point-of-Care Testing Definition Point-of-care (POC) testing is defined as clinical laboratory testing conducted close to the site of patient care, typically by clinical personnel whose © 2011 by Taylor and Francis Group, LLC

15

16

Quality Assurance in the Pathology Laboratory

primary training is not in the clinical laboratory sciences or by patients (self-testing) [1]. POC testing is essentially any laboratory testing conducted outside the central or core laboratory. In the context of drug testing, POC testing can refer to laboratory tests conducted in a satellite laboratory, physician’s office, pain management clinic, pharmacy clinic, rehabilitation center, prison, sports program, or other location where drug testing results are needed to assess patient status. POC testing may be conducted in stationary locations or in mobile transport vehicles, like helicopters, ambulances, cruise ships, and even the space shuttle. This type of testing is sometimes referred to as on-site, near-patient, ancillary, bedside, remote, or satellite laboratory testing. POC testing may involve simple single-use testing devices or may be conducted on more complex laboratory instrumentation. A variety of staff may be involved in performing POC testing. It cannot only be conducted by physicians, nurses, psychiatrists, and other clinical staff but may also be conducted by coaches, police officers, and staff with minimal medical knowledge or formal laboratory experience or training. This raises concern over the reliability of test results conducted by staff with little experience or training. POC drug testing may be performed for forensic (legal) reasons or for clinical management. Drug testing can be conducted in prisons and by police officers to detect the use of prescription and illegal drugs with the intent of prosecuting the person. Businesses may require drug testing after accidents as part of the investigation of on-the-job injuries. Companies also require pre-employment drug screening of job candidates to detect drug use prior to employment. Rehabilitation and pain management clinics may conduct drug testing to ensure that patients are compliant with their program and not selling medications or continuing abuse. Sports programs may conduct testing on athletes to detect banned substances or use of drugs that may enhance performance. In general, forensic drug testing requires confirmation of screening tests by mass spectrometry or another alternate methodology that is legally defensible. A screening test is generally a broad-spectrum immunoassay or other test that can quickly assess a large number of samples for the presence or absence of a number of drugs. Confirmatory testing is more specific and can provide a definitive test result for individual drugs or drug classes. Confirmatory testing is often more labor intensive and takes longer for results than rapid screening methods. For this reason, simple screening tests may be performed on-site to determine initial reactivity, followed by confirmatory testing of reactive samples. Confirmatory testing is generally performed in a central or reference laboratory specializing in drug testing and mass spectrometry. Prosecution of individuals for driving under the influence, expulsion of athletes from a competitive sporting event, and removing a patient from a rehabilitation or pain management program for noncompliance with © 2011 by Taylor and Francis Group, LLC

Quality Assurance of Point-of-Care and On-Site Drug Testing

17

medication contracts all require definitive test results by a confirmatory method. On the other hand, clinical treatment decisions need to be made more rapidly than the availability of confirmation testing and are often made in conjunction with the patient’s symptoms. Such management, based on screening tests alone, is common in hospital and emergency room settings and can be acceptable provided that physicians understand the limitations of screening methods.

2.2╇On-Site Drug Testing Methodologies On-site drug testing is a screening test intended to initially detect the presence or absence of selected drugs and drug classes in the patient’s sample. If the test result is intended for forensic purposes, the specimen will need to be confirmed by a different methodology, most likely gas chromatography mass spectrometry. Clinical utilization of the test results may or may not require confirmation testing, depending on the patient’s symptoms, the clinical history, and the specific case scenario. When confirmatory testing is required, locations that cannot perform confirmatory testing on-site will need to send the specimen to another laboratory where confirmatory testing can be performed. Transport of forensic samples additionally requires chainof-custody paperwork to ensure documentation of specimen handling and control of the specimen before, during, and after analysis. On-site drug testing can be conducted using laboratory instrumentation or simple POC testing kits. Analysis of specimens using laboratory instrumentation requires dedicated space since most laboratory instrumentation is large, heavy, and not intended to be moved. Laboratory instrumentation can conduct urine testing for a variety of drugs of abuse as well as therapeutic drug monitoring levels in serum/plasma for a number of drugs, including antiepileptics, antidepressants, immunosuppressants, antibiotics, and other medications. This chapter will focus on the quality assurance of portable, single-use drug tests that can be conducted in many locations by a number of different individuals for the purposes of rapidly screening patients for drug use. Results of such tests can be utilized for forensic purposes, preemployment checks, or clinical management. A menu of drugs of abuse and drugs with high potential for overdose (tricyclic antidepressants) is available in POC format, including amphetamines, barbiturates, benzodiazepines, cannabinoids, methadone, opiates, phencyclidine, and propoxyphene (Table  2.1). These tests are available to analyze urine specimens and are approved by the U.S. Food and Drug Administration (FDA), and categorized as “waived” or “moderate complexity” testing under the Clinical Laboratory Improvement Amendments of 1988 (CLIA’88) [2]. CLIA’88 laws apply to any laboratory test (including drug testing) used to diagnose, treat, or manage © 2011 by Taylor and Francis Group, LLC

18

Quality Assurance in the Pathology Laboratory Table 2.1â•…List of Available POC Drug Tests for On-Site Rapid Testing Point-of-Care Drug Tests Oral fluid specimens Ethanol Amphetamine Methamphetamine Cannabinoids Cocaine Phencyclidine Opiate Urine specimens Amphetamines Methamphetamine MDMA (3,4-methylenedioxymethamphetamine)—ecstasy Barbiturates Benzodiazepines Cannabinoids Methadone Phencyclidine Propoxyphene Opiates Buprenorphine (suboxone) Oxycodone Tricyclic antidepressants Note: This list is not comprehensive, and only intended to give the reader an idea of the wide menu of laboratory drug tests available for conducting on-site drug testing.

patient care decisions, wherever the test is performed. Forensic testing is outside of CLIA’88, and the quality of forensic laboratories is certified by agencies other than the Centers for Medicaid and Medicare Services (CMS). For instance, federal workplace drug testing is covered under the Substance Abuse and Mental Health Services Administration (SAMHSA) regulations for federal workplace drug testing programs [3]. Ethanol POC tests are FDA approved and available for testing urine specimens, but ethanol is more commonly performed by breathalyzer or in oral fluid samples to avoid the dilutional effects of urine. Drugs of abuse testing can also be conducted on oral fluid samples and are FDA approved for a limited menu of drugs. Oral fluid is collected in an absorbent swab and manually dispensed onto the test kit through a syringe barrel using the pressure of the syringe plunger on the swab. Use of such tests beyond the FDA intended use or on other specimen types (blood, gastric contents, plasma/serum, vitreous humor, etc.) would © 2011 by Taylor and Francis Group, LLC

Quality Assurance of Point-of-Care and On-Site Drug Testing

19

categorize these tests as “high complexity” under CLIA’88 in the United States and would require the laboratory to more extensively evaluate the clinical and technical performance of the kit before use on actual patient samples. POC drug tests employ immunochromatographic methodologies. Most rapid drug tests utilize a one-step process that requires applying a few drops of sample to the test kit and waiting 10–20â•›min before reading results (Figure 2.1). These tests are based on the principle of drug competition for a limited amount of antibody attached to a colored bead, colloidal gold, or other colorimetric compound. Application of the sample solubilizes the labeled antibody and the sample/antibody mixture wicks down an absorbent paper chromatogram where the drug or control compound has been applied in a linear zone across the direction of migration. If no drug is present in the sample, the labeled antibody is free and available to bind the drug on the test kit and form a visible line. A separate antibody–antigen reaction occurs at the control zone of the test kit and forms a visible control line. So, a negative test result will display two lines: a line in the drug zone and a second line in the control zone of the kit. If the drug is present in the sample above the cutoff concentration for the test, all of the labeled antibody will bind to the

Negative 2 lines

Direction of migration

Positive 1 line

Figure 2.1╇ One-step immunochromatography. Drug in the patient’s sample

competes for the labeled antibody with the drug attached to a linear zone on a chromatogram. A few drops of the patient sample solubilize the labeled antibody, and the mixture wicks down a paper, encountering drug and control zones. If no drug is present in the sample, the labeled antibody binds the drug on the chromatogram and forms a visible line. A separate control-antibody reaction forms a line in the control zone. So, a negative test result develops two lines, the drug and control. If drug is present in the sample above the cutoff concentration, the labeled antibody binds to the patient’s sample, and no line is visible in the drug test zone of the chromatogram. A positive test result develops one line, the control.

© 2011 by Taylor and Francis Group, LLC

20

Quality Assurance in the Pathology Laboratory

drug in the sample. As the mixture migrates past the drug zone of the test kit, no labeled antibody sites will be available to bind to the drug zone, so the antibody label continues to migrate to the end of the chromatogram. The separate control antibody will form a single line at the control area. A positive test result is interpreted as the disappearance of a line at the drug area, so one line is visible at the control area. One manufacturer’s POC drug test utilizes a three-step immunochromatography method. This is the only kit that actually forms a line at the drug area with a positive test result. The manufacturer achieves this by first incubating the patient’s sample with both a fluorescent molecule attached to the drug and antibodies directed against the drug or drug classes (Figure 2.2). The fluorescent molecule can be labeled with more than one drug; Figure 2.2 αB

αD

Step 1— incubate sample and reagents

B

A E

C

A

D

E

B

C D

αA

αE

αB

Step 2— load device Step 3— wash Positive 2 lines

A E

B

D C

AA D D C E E B

CB

Negative 1 line (control) αA

αB αD αE Direction of migration

αC (control)

Figure 2.2╇ Three-step immunochromatography. Drugs (A, B, D, and E) and con-

trol (C) are bound to a fluorescent compound. This labeled fluorophore is incubated with the patient sample and antibodies directed against the drugs. After timed incubation, the mixture is applied to a chromatogram and allowed to wick down the paper. In the final step, the chromatogram is washed and interpreted using an electronic reader. Alternatively, a colorimetric compound (colloidal gold or colored beads) can be used to interpret the test visually. If no drug is present in the patient’s sample, antibodies bind to the drug fluorophore, and when the mixture migrates down the chromatogram, no drug-label sites are available to bind to antidrug antibody (αA, αB, αD, and αE) zones on the chromatogram. A separate anti-control antibody (αC) zone binds the fluorophore and creates a fluorescent control line. A negative result develops one line, the control. A drug in the patient’s sample competes for antidrug antibodies (αA, αB, αD, αE), allowing the drug-label sites to remain free and bind to antidrug antibody zones on the chromatogram. A positive test result develops two lines, a line at the drug zone present in the sample and the control line. The test in this figure is positive for drug B. © 2011 by Taylor and Francis Group, LLC

Quality Assurance of Point-of-Care and On-Site Drug Testing

21

displays four different drugs (A, B, D, and E) and a control antigen attached to the label. After a timed incubation, the test mixture is loaded onto the test kit and allowed to migrate down the paper. After a second timed interval, a wash solution is applied to the kit and the test results are interpreted by scanning the chromatogram in an electronic reader. Alternatively, a colored label can be used to allow visual interpretation of test results. If there is no drug in the patient’s sample, the antibody will bind to the specific drugs attached to the fluorescent label. After loading onto the kit, the label will pass several test zones on the chromatogram, which contains antibody directed against various drugs coated onto the chromatographic paper. With no drug in the sample, all of the antibodies block the drug-binding sites on the fluorescent label, and the label migrates past the antibody bound to the chromatogram to the end of the chromatogram. The fluorescent label binds to the control antibody on the chromatogram and forms a line that is interpreted by the test kit reader. A wash step ensures removal of any residual test mixture and minimizes background fluorescence signal. If the sample contains the drug above the cutoff concentration, the drug binds to the antidrug antibody and leaves the fluorescent-labeled drug open and available to bind to the chromatogram, forming a line of fluorescence. So, in the three-step immunochromatography method, a line develops for a positive reaction. A positive test result will thus have two lines: the test drug line and the control line, while a negative test result will produce only one line, the control. Most drug tests are optimized to reproducibly provide the appropriate test response for a sample with a concentration ±20%–25% of the cutoff concentration. However, appropriate timing of the test is important as ghost lines at both the drug and control areas may develop as the kit dries, due to nonspecific binding of the label. Overdevelopment could thus lead to an incorrect interpretation.

2.3╇ Quality Assurance versus Quality Control Quality is defined as a degree of excellence (grade) and a superiority in kind [4]. For laboratory testing, quality is an inherent feature of the laboratory result that characterizes the nature of the laboratory. The laboratory’s—and the laboratory director’s—reputation relies on the quality of the test result. So, for optimum patient care, laboratories necessarily want to generate the best results possible. A defined quality assurance program is required to deliver quality test results. Quality assurance differs from quality control. Quality control is a set of procedures designed to monitor the test method and test results to ensure appropriate test system performance. Quality assurance, on the other © 2011 by Taylor and Francis Group, LLC

22

Quality Assurance in the Pathology Laboratory Table 2.2â•…Definitions of Quality Assurance and Quality Control Quality Assurance versus Quality Control Quality assurance The practice that encompasses all procedures and activities directed toward ensuring that a specified quality of product is achieved and maintained Quality control A set of procedures designed to monitor the test method and test results to ensure appropriate test system performance

hand, is the practice that encompasses all procedures and activities directed toward ensuring that a specified quality of product is achieved and maintained (Table 2.2). One of the first methods for laboratory quality assurance was the Folin and Wu glucose method for the determination of glucose using alkaline copper reduction (copper and phosphomolybdic acid) [5]. This method described the purity of the chemicals required to perform the test, prepared reagents from these chemicals, conducted the test using standard written procedures, measured the reaction in a well-maintained spectrophotometer, and estimated glucose concentration from a standard curve calculated with each batch of samples. This method focused on the need for documented procedures that must be followed with each analysis to ensure quality test results. This is one of the first published procedures to emphasize the quality management system philosophy that forms the basis of later International Organization for Standardization (ISO) 9000 series standards [6–8]. Industry has adopted the ISO 9000 standards, and a variety of manufacturers have certified compliance with ISO 9000 standards and quality management principles. The industrial concept of quality management has been interpreted for the laboratory setting in the Clinical Laboratory Standards Institute (CLSI) HS1 [9] and the ISO 15189 [10] standards, as well as for POC testing in the ISO 22870 [11] standard. Quality management is also very applicable to the forensic laboratory setting, since the quality management system principles are relevant to a variety of different industries and organizations.

2.4╇ Quality Management System Essentials These CLSI and ISO standards apply a core set of 12 quality system essentials basic to any organization across all operations in the health-care path of workflow that defines how a particular product or service is provided (Table  2.3). The laboratory must be part of an organization that has sufficient facilities to operate in a safe manner. Adequate personnel should be trained and competent to perform the procedure, and the equipment must be validated prior to patient testing and have regular ongoing maintenance. © 2011 by Taylor and Francis Group, LLC

Quality Assurance of Point-of-Care and On-Site Drug Testing

23

Table 2.3â•… Quality System Essentials for a Laboratory Quality System Essentials The laboratory Organization Facilities and safety Personnel Equipment Purchasing and inventory The work Process control (preanalytic, analytic, and postanalytic) Documents and records Information management Quality monitoring Assessments—external and internal Occurrence management Customer satisfaction Process improvement

All supplies must be traceable by lot and shipment and performance verified prior to use on samples. The process of analysis must be controlled and documented. Records of patient testing must be maintained and all procedures and policies must be under document control to prevent unexpected changes without supervisory approval. Management of information is thus important, both in protecting confidentiality and for providing traceability of the testing process from sample to reagent to result. Finally, the laboratory must assess the quality of its results, and respond to complaints and occurrences. Customer satisfaction should be monitored and performance improved when issues are noted. Each component of a quality management system is discussed in more detail below. A laboratory, whether a formal dedicated space or a POC facility, must be part of an organization that sets the quality standards. POC drug testing may be conducted in a physician’s office under the direction of a physician in that practice, or the physician’s office may be part of a larger health-care system and adopt that system’s organizational policies. POC drug testing could also be part of an athletic program under an academic organization or conducted on prisoners or suspected intoxicated drivers under the judicial system. Regardless of the location or need for testing, POC drug testing must be conducted under the supervision of a larger organization. That organization sets expectations for quality of POC test results and must provide the necessary resources to provide that level of quality, whether those resources are staff, time, or materials. Moreover, the organization must define levels of authority and responsibility as well as monitor POC drug test quality and overall effectiveness of the quality management system. © 2011 by Taylor and Francis Group, LLC

24

Quality Assurance in the Pathology Laboratory

Facilities and safety are the next quality management system essential. POC drug testing may not be performed in permanent facilities, but that does not negate the need for safety considerations. Staff performing the test will need to use infection precautions, monitor environmental conditions for reagent storage and test analysis, and ensure disposal of used test kits, transfer pipettes, gloves, specimen containers, and other biohazardous materials. Tests will need to be conducted in a safe and ergonomic environment. Staff must be protected from physical hazards and biohazardous materials, and staff should be trained on proper safety techniques and incident follow-up for spills, splashes, or contact with kit reagents (material safety data sheets). Personnel are an important quality management system essential. Staff performing the POC drug tests should have the appropriate education, experience, and qualifications to fulfill the job requirements and skills necessary to perform the testing. Simple CLIA waived drug tests have no specific personnel qualifications or training requirements. Staff only need to follow the manufacturer’s directions. For moderate complexity testing, staff must be properly oriented and trained on the specific device. Such training should ensure that staff can document the necessary skills to perform the test [2] (Table 2.4). The testing personnel are responsible for specimen processing, test performance, and for reporting test results (Table 2.5). Each individual must only perform those tests that are authorized by the laboratory director and that require a degree of skill commensurate with the individual’s Table 2.4â•… CLIA’88 Training Requirements for Moderate Complexity POC Drug Testing Training Requirements for CLIA’88 Moderate Complexity POC Drug Testing Skills required for proper specimen collection (including patient preparation, if applicable), labeling, handling, preservation, processing or preparation, transportation, and storage of specimens Skills required for implementing all standard laboratory procedures Skills required for performing each test method and for proper instrument use Skills required for performing preventive maintenance, troubleshooting, and calibration procedures related to each test performed Working knowledge of reagent stability and storage Skills required to implement the quality control policies and procedures of the laboratory An awareness of the factors that influence test results Skills required to assess and verify the validity of patient test results, through the evaluation of quality control sample values prior to reporting of patient test results Source: Health and Human Services, Health Care Financing Administration Public Health Service, 1992, 42 CFR Part 405 et al., Clinical laboratory improvement amendments of 1988; Final rule, Federal Register 57(40), 7001, Recent revisions available at http:// www.cms.hhs.gov/CLIA (accessed on October 2010). Note: Staff training must ensure that each individual performing test analysis documents these requirements. © 2011 by Taylor and Francis Group, LLC

Quality Assurance of Point-of-Care and On-Site Drug Testing

25

Table 2.5â•… CLIA’88 Testing Personnel Responsibilities Testing Personnel Responsibilities Follow the laboratory’s procedures for specimen handling and processing, test analyses, reporting, and maintaining records of patient test results Maintain records that demonstrate that proficiency testing samples are tested in the same manner as patient samples Adhere to the laboratory’s quality control policies, document all quality control activities, instrument and procedural calibrations, and maintenance performed Follow the laboratory’s established corrective action policies and procedures whenever test systems are not within the laboratory’s established acceptable levels of performance Be capable of identifying problems that may adversely affect test performance or reporting of test results, and either correct the problems or immediately notify (supervisory staff) Document all corrective actions taken when test systems deviate from the laboratory’s established performance specifications Source: Health and Human Services, Health Care Financing Administration Public Health Service. 1992. 42 CFR Part 405 et al., Clinical laboratory improvement amendments of 1988; Final rule. Federal Register 57(40), 7001, Recent revisions available at http:// www.cms.hhs.gov/CLIA (accessed on October 2010). Notes: The testing personnel are responsible for specimen processing, test performance, and reporting test results. These tasks are part of this job function.

education, training or experience, and technical abilities [2]. Periodic competency assessment is necessary to ensure that testing personnel are maintaining skills and performing job functions and conducting testing appropriately. The organization should provide personnel with periodic performance appraisals and opportunities for professional development either through the supervisory staff or in conjunction with human resources. Equipment is another quality management system essential. For POC drug testing, the kits are single-use and disposable, but some manufacturers offer test readers that will need to be validated prior to use to ensure performance within the manufacturer’s specifications. This equipment will need to be maintained and calibrated. Records of service and periodic verification of performance should be documented, especially after major service or recalibration. This documentation should include associated computer hardware, software, and interfaces. As many records are converting from paper documentation to electronic records, federal guidelines, 21 CFR Part 11, define the criteria by which electronic records and electronic signatures are considered reliable and equivalent to paper records [12]. Purchasing and inventory management of equipment, reagents, and supplies is also a quality management system essential. POC drug tests are not only available directly through manufacturer purchase but also may be acquired through laboratory distribution companies. Quality management requires vendor qualification and evaluation to ensure that the distributor can supply the required reagents when needed and that those products © 2011 by Taylor and Francis Group, LLC

26

Quality Assurance in the Pathology Laboratory

are shipped and received in such a way as to document lots and shipments for performance qualification prior to use on patient samples. This requires material tracking of purchase orders, shipments, and receipt of reagents, and evaluation of a subset of kits received with each shipment to ensure appropriate test performance. Such material tracking keeps verified reagents separate from those reagents that have been received but are not yet tested and cleared for use on patient samples. Changes in collection kits may need validation to ensure that a change in manufacturer or product does not alter test performance. This may be applicable with changes in swabs utilized for oral fluid collection, transfer pipettes, and even plastic urine containers, especially for drugs like cannabinoids that could adhere to the plastics in the container. The entire test analysis should be controlled from preanalytic, analytic, to postanalytic processes. Process control involves understanding customer expectations or clinical needs and designing an operational workflow that will meet those needs. The total testing process from test order through patient preparation, sample collection, test performance, and reporting of test results should be mapped and validated to meet clinical expectations. Within the analysis, the testing procedure should be documented in a way that will prevent process changes. Any changes to the testing procedure will necessarily require validation to ensure that the change has not altered technical performance. The use of quality control or analysis of samples with known test results can document stable test performance over time and, together with other control processes like internal instrument checks, play a role in the monitoring of test performance. The selection and frequency for performing control processes depends on a combination of the individual device and manufacturer provided controls, the health-care setting and how the test result will be utilized, as well as the regulatory environment and legal requirements for control frequency. CLSI is currently drafting a document, EP23 Laboratory Quality Control Based on Risk Management, which describes how to develop a quality control plan for individual tests and health-care settings [13]. CLSI EP23 and the strategy for developing a quality control plan for POC drug tests based on risk management will be discussed in further detail later in this chapter. Documents and records are a fundamental part of a quality management system. Policies and procedures should be written in a standard format, for staff to easily find the necessary information. Document control is a key consideration, since the creation, revision, review, and approval processes must be controlled so that only one version of the document is implemented in practice. Laboratories may have one master procedure, with working copies of a procedure at the bench. As revisions are made, every copy must be updated, including the master copy and all working copies. Document control is more easily maintained in a single site, like a physician’s office or hospital laboratory, but for decentralized POC testing, the same procedure may need to be © 2011 by Taylor and Francis Group, LLC

Quality Assurance of Point-of-Care and On-Site Drug Testing

27

copied to dozens of locations. Revision and updating of decentralized procedures becomes complicated as each change must be forwarded to multiple locations and old policies replaced with current versions. CLIA’88 mandates annual management review and signature to ensure that policies and procedures are current [2]. So, policies need to be reviewed and updated regularly. Documents and records of testing need to be stored for some years even after a policy or procedure is discontinued. Document storage requirements vary by regulatory agency and state, but records must minimally be maintained for at least 2 years after discontinuation of a procedure [2]. Federal guidelines, 21CFR Part 11, describe criteria for reliability of electronic records and electronic signatures as equivalents to paper documentation [12]. Information management is thus a critical component of a quality management system. Privacy of test records and results is one aspect of information management. Privacy is a particular concern with drug testing results as positive drug tests can lead to child custody disputes in court, denial of employment, expulsion from rehabilitation programs, health insurance denial, and other forms of discrimination. POC drug tests and other screening tests should always be treated as tentative pending confirmation by a more definitive method, unless the test result is required for emergency management in conjunction with the patient’s symptoms. Only the ordering physician and staff with direct patient care responsibilities should have access to the test result, and electronic medical records should track the time/date and the identity of individuals who access test results. So, data records require different access levels of authority, where some personnel may be restricted from access (because the test results do not belong to their patient), while others can view, report, or even modify a test result. Beyond privacy, accuracy of data is another concern with laboratory information management. Manual entry of test results can lead to typographical errors, so transcription must be proofed before results are accepted. Electronic transmission of results across an instrument interface requires not only verification of the transmission accuracy but also checks on the security of data transmission. Institutional firewalls and other computer privacy barriers or data encryption may be needed in order to safely transmit test results electronically. The effectiveness of the quality management system should be monitored. Occurrence management is one aspect of monitoring that involves identifying and documenting test or instrument failures and physician complaints. Complaints and events should be classified and analyzed for trends that may indicate a systematic problem. The investigation of these events may be an opportunity for root cause analysis into the possible sources of the incident and for performance improvement. Internal and external assessments are another means of monitoring the effectiveness of the quality management system (Table 2.6). Internal © 2011 by Taylor and Francis Group, LLC

28

Quality Assurance in the Pathology Laboratory Table 2.6â•… Examples of Some Internal and External Laboratory Quality Monitors Internal and External Quality Monitors Internal quality monitors Quality control performance Sample correlation Test or equipment failure and other occurrences Delta checks External quality monitors Complaints Laboratory inspections Proficiency testing Customer service surveys

assessments include laboratory monitors of quality and could encompass quality control sample result performance, reagent and equipment failure investigations, sample correlations (with reagent shipments, new lots, etc.), delta checks, and other quality monitors. Sample correlations are the comparison of results between different lots or shipments of reagent and should be conducted on arrival of each shipment and periodically to ensure stable performance during storage. Delta checks are the comparison of a patient’s previous result against their current result and are most relevant for quantitative test results on physiologic parameters that do not change rapidly over time (like creatinine). External assessments include monitors outside of the laboratory and could encompass inspections by accreditation agencies and proficiency testing. Laboratory inspection is required for moderate complexity testing every 2 years under CLIA’88; however, laboratories performing only CLIA’88 waived tests have no specific inspection requirement [2]. Laboratories performing waived tests may only be inspected due to physician or patient complaints filed with the CMS centers that regulate clinical laboratories. Federal workplace urine drug testing laboratories must be inspected initially before certification and twice annually after certification [3]. Proficiency testing is the analysis of samples conducted like patient tests, where the results are reported to an accreditation agency and compared against other laboratories performing the same test methodology. Proficiency surveys grade the laboratory’s performance and assess the laboratory’s overall capacity to produce a test result that is comparable to other laboratories on the same test. Customer service is an additional external quality monitor and a quality management system essential. The laboratory should know physician expectations and patient needs and periodically determine customer satisfaction. This could be assessed by surveying physicians and/or patients regarding the

© 2011 by Taylor and Francis Group, LLC

Quality Assurance of Point-of-Care and On-Site Drug Testing

29

perceived quality of test results, but customer service can also be documented by tracking complaints. Both internal and external quality monitors should be evaluated, and when trends or problems are noted, the monitor should be investigated for sources of variation, changes made to correct the issue, and an action plan developed for ongoing quality improvement. Performance improvement is an expected outcome of monitoring the quality management system and another essential component of a quality management system. Process improvement identifies opportunities for improvement and implements corrective actions and preventive measures to avert incidents and complaints. Once improvements are implemented, internal and external monitors will assess the effectiveness of the changes. In summary, the quality management system has 12 essentials that together define a comprehensive plan to ensure the quality of test results. The essentials address the organization and clinical need of the test, acquisition of reagents and equipment, method validation, personnel qualifications and training, and control over the testing process (preanalytic, analytic, and postanalytic). Internal and external monitors assess the effectiveness of the quality management system, document occurrences, and identify opportunities for performance improvement.

2.5╇ The Role of the Laboratory Director The laboratory director has ultimate responsibility for the quality of laboratory results reported under his or her direction. In this capacity, the laboratory director plays a central leadership role in laboratory management. The laboratory director holds a CLIA’88 certificate that allows the laboratory to perform testing under the director’s supervision. The laboratory director must ensure compliance with all legal and regulatory aspects of CLIA’88 (Table 2.7). Although the laboratory director can delegate some functions within the laboratory, he or she is ultimately responsible for ensuring compliance. When problems are noted through inspection or proficiency testing, it is the laboratory director’s medical license that is restricted through his or her ability to bill Medicare and Medicaid for a period of months to years, depending on the severity of the incident. So, the federal government takes laboratory directorship seriously and wants directors to play an active role in laboratory management rather than just apply their name to licensing paperwork. For this reason, a laboratory director can only hold a maximum of five CLIA’88 certificates. Laboratory inspectors look for documentation of active participation by the laboratory director, through meeting minutes, signatures on policies and procedures, review of control and proficiency test results, and participation in performance improvement or other laboratory committees and activities.

© 2011 by Taylor and Francis Group, LLC

30

Quality Assurance in the Pathology Laboratory

Table 2.7â•…Responsibilities of a Laboratory Director under CLIA’88 Laboratory Director Responsibilities under CLIA’88 If qualified, may perform duties of technical supervisor, clinical consultant, general supervisor, and testing personnel, or delegate these responsibilities to qualified personnel If delegated, the laboratory director remains responsible for ensuring that duties are properly performed Must be accessible to laboratory to provide onsite, telephone, or electronic consultation as needed May direct no more than five laboratories Must ensure quality laboratory services for all aspects of test performance (preanalytic, analytic, and postanalytic) Must ensure laboratory conditions are appropriate for testing performed and provide a safe environment in which employees are protected from hazards Must ensure test methodologies have the capability of providing quality results required for patient care Must ensure verification procedures are adequate to determine performance characteristics Must ensure personnel are performing tests as required for accurate and reliable results Must ensure laboratory is enrolled in an approved proficiency testing program and that proficiency samples are tested as required, results are returned within the expected timeframes, reports are reviewed to evaluate laboratory’s performance, and corrective action plans are followed when proficiency testing is unacceptable Must ensure that quality control and quality assurance programs are established and maintained Must ensure acceptable levels of analytical performance for each test Must ensure that patient test results are reported only when the test system is functioning properly and that remedial actions are taken and documented whenever significant deviations from established performance are identified Must ensure that test result reports include pertinent information required for interpretation Must ensure that consultation is available on the quality of test results and their interpretation Must employ a sufficient number of laboratory personnel with appropriate education, experience, and training; properly supervise and accurately perform tests; and report results Must ensure that prior to patient testing, all personnel have the appropriate education, experience, receive the training appropriate for the type and complexity of services offered, and have demonstrated ability to perform testing operations reliably, and to report accurate results Must ensure that policies and procedures are established for monitoring individuals who conduct any phase of testing (preanalytic, analytic, or postanalytic), to assure they are competent and maintain their competency, and to identify needs for remedial training and continuing education to improve skills Must ensure that an approved procedure manual is available to all personnel Must specify, in writing, the responsibilities and duties of each consultant and supervisor, as well as each person engaged in all phases of testing; identify which examinations each individual is authorized to perform, whether supervision is required, and whether supervisory or director review is required prior to reporting test results Source: Health and Human Services, Health Care Financing Administration Public Health Service, 1992, 42 CFR Part 405 et al., Clinical laboratory improvement amendments of 1988; Final rule, Federal Register 57(40), 7001, Recent revisions available at http:// www.cms.hhs.gov/CLIA (accessed on October 2010). © 2011 by Taylor and Francis Group, LLC

Quality Assurance of Point-of-Care and On-Site Drug Testing

31

The laboratory director must provide for technical and general supervision of the testing process and provide clinical consultation to physicians on the ordering and interpretation of test results. The laboratory director must be a doctor of medicine or a doctor of osteopathy licensed to practice medicine or osteopathy in the state in which the laboratory is located and have laboratory training or experience consisting of at least 1 year directing or supervising non-waived laboratory testing or laboratory training obtained during medical residency (as with physicians certified in hematology). Alternatively, the laboratory director can have at least 20 credit hours of continuing medical education in laboratory practice commensurate with director’ responsibilities. Pathologists accredited by the American Board of Pathology or American Osteopathic Board of Pathology may also be laboratory directors, as well as PhD holders in a chemical, physical, biological, or clinical laboratory science, who are certified by the American Board of Medical Microbiology, the American Board of Clinical Chemistry, the American Board of Bioanalysis, or the American Board of Medical Laboratory Immunology. Those who have earned a master’s or bachelor’s degree in similar disciplines with at least 1 or 2 years of laboratory training experience, respectively, and at least 1 or 2 years of laboratory supervisory experience, respectively, can also qualify as a laboratory director. These qualifications are required because laboratory directors must ensure that they personally meet the qualifications for technical and general supervision of a laboratory, which includes selecting appropriate test methods to meet clinical needs, verification of test procedures and establishing the laboratory’s test performance characteristics, establishing a quality control program, resolving technical problems and ensuring remedial actions are taken, ensuring patient test results are not reported until corrective action is taken, identifying training needs, and ensuring testing personnel are competent. Additionally, the laboratory director must provide clinical consultation to ensure that the tests ordered by physicians meet the clinical expectations, that reports include pertinent information required for interpretation, and that consultation on the quality of test results concerning specific patient conditions is available.

2.6╇ Quality Control Quality control is a set of procedures designed to monitor the test method and test results to ensure appropriate test system performance (Table 2.2). Quality control is only a part of a total quality assurance program for the laboratory. The history of quality control evolved from the manufacturing industry, where a sample of the product was tested for flaws or defects. Whenever the percentage of defective products rose above a critical level, the manufacturing plant would need to implement changes to the © 2011 by Taylor and Francis Group, LLC

32

Quality Assurance in the Pathology Laboratory

manufacturing line to reduce the rate or percentage of defective products to an acceptable level. Quality control concepts entered the clinical laboratory in the mid1900s, where a sample of known concentration was analyzed with each batch of patient specimens. If the control sample generated the expected test result within analytical tolerance, the assay performance was assumed to be acceptable. Control samples are stabilized or frozen so that aliquots of the sample can be analyzed with each day’s patients to verify assay performance over time. The control results detect performance from all parts of the test system, including the reagent, the instrumentation, and the operator. Reagent degradation, instrument malfunction or calibration errors, and operator mistakes will lead to changes in the control results that indicate a problem with the analysis. Patient results can thus be held until the problem is fixed and control results return to the expected values. At that time, patient samples can be reanalyzed and reported. Therefore, controls are useful in verifying the suitability of test systems (sample, reagents, instruments, and/or users), monitoring the precision and trueness of measurement results, preventing false-negative and false-positive results, preventing fault conditions that could lead to inaccurate results, and troubleshooting problems that require corrective action [14]. Because controls are sensitive to the entire system performance, laboratory quality standards have adopted requirements for laboratories to analyze a minimum number of controls with each day’s analytical runs. CLIA’67 was the first quality law for clinical laboratories in the United States that mandated the performance of two levels of quality control, at a normal and abnormal concentration of analyte, each day of patient testing. CLIA’88 reinforced this need for two levels of controls at least every 24â•›h of testing, and private accreditation agencies like the College of American Pathologists (CAP), the Joint Commission, and the Commission on Office Laboratory Accreditation (COLA) followed suit with similar requirements for accredited laboratories. Two levels of controls each day of testing have thus become the de facto historical standard for good laboratory practice. Controls do a good job at detecting analytical problems where the error occurs at one point in time onward in a systematic fashion (Figure 2.3). Take a laboratory analyzer that utilizes bulk liquid reagents. This type of analyzer may produce hundreds of tests from a single bottle of reagent. Regent degradation or an analyzer problem will affect all controls and patient samples run from that bottle of reagent or on that analyzer in the same manner. The problem, however, may not be detected until the next control analysis. For example, a laboratory may analyze controls at 9:00 a.m. each day, but if a line leak occurs at 11:00 a.m., that problem may not be detected until the next control analysis at 9:00 a.m. the next day (Figure 2.3). At that time, the laboratory will need to troubleshoot the problem, fix the line, and then © 2011 by Taylor and Francis Group, LLC

Quality Assurance of Point-of-Care and On-Site Drug Testing Hemolyzed sample Quality control

Quality control 09:00

33

11:00

01:15

09:00

Line leak

Figure 2.3╇ Systematic versus random errors. Consider a laboratory instrument where two levels of quality control samples are analyzed each day at 9:00 a.m. A line leak occurs on the instrument at 11:00 a.m., leading to partial reagent dispensing that decreases test results by 25% from 11:00 a.m. until the error is corrected (systematic error). The line leak would not be detected until the next control samples are analyzed at 9:00 a.m. the next morning. All patients will need to be reanalyzed once the instrument error is fixed. A hemolyzed sample analyzed at 1:15 p.m. increases test results by 50% (random error), but control samples will not detect this error, which affects only one sample.

reanalyze all patient specimens from 11:00 a.m. the previous day. This is a lot of reanalysis, lost productivity, and expense. In addition, if results were autoverified and released before the next control analysis, the test results may need to be corrected and physicians called with the corrected result. This leads to physician concern over the quality of the laboratory results. Controls either need to be analyzed more frequently than once a day or patient results need to be held until successful performance of the next control samples. However, control samples do not detect every type of analytical error. Take a hemolyzed sample or a sample of a patient with an interfering drug or metabolite (Figure 2.3). Controls analyzed once a day will not detect random errors with a single sample. POC drug tests are single-use devices intended to analyze one sample per kit. Analysis of a control sample on one kit uses up the test and will not necessarily detect errors with the very next kit even in the same box of tests. To ensure quality results with single-use POC tests, a different control strategy is required that can better detect random errors with each test.

2.7╇Laboratory Quality Control Based on Risk Management Good laboratory practice to ensure the quality of test results requires a thorough understanding of the total testing process—preanalytic, analytic, and postanalytic. Weak steps in the testing process, where there is the risk of a hazard or error occurring, will require preventive measures or mitigations to reduce the risk of error to a clinically acceptable level. © 2011 by Taylor and Francis Group, LLC

34

Quality Assurance in the Pathology Laboratory

Input information Medical requirements for the test results

Corrective and preventative action and continuous quality improvement

Regulatory and accreditation requirements

Test system information provided by the manufacturer

Information about health care and test-site setting

Process Risk assessment

Output Quality control plan

Process Post implementation monitoring

Figure 2.4╇ Process to develop and continually improve a quality control plan. (Reproduced from Clinical and Laboratory Standards Institute, EP23 Laboratory Quality Control Based on Risk Management, CLSI, Wayne, PA, in press.)

Process control is one of the quality management system essentials defined by the CLSI HS1 and ISO 9000 series standards [6–9]. Developing a quality control plan for a specific test method requires information about risks of failure with the testing device, either provided by the manufacturer in the package insert or other information and publications about the test, knowledge about clinical need, how the test result will be utilized, the laboratory setting and operators, as well as the local quality laws and accreditation standards regulating the test performance (Figure 2.4). CLSI EP23 describes how to develop a quality control plan based on risk management that is customized for a specific test and laboratory setting [13]. CLSI EP23 is based on industrial risk management principles defined in ISO 14971 [15]. CLSI EP23 processes information from the manufacturer, the laboratory setting, and the local quality regulations to develop a quality control plan (Figure 2.4). Once implemented, the effectiveness of the quality control plan is monitored, failures are investigated, and the quality control plan modified to keep the risk of error to a clinically acceptable level in a continuous quality improvement cycle. Sources of laboratory error can come from the environment, the operator, or the analysis (Table 2.8). Environmental sources of error can occur from temperature, including reagent overheating or freezing (during transportation and storage) and instrument performance out of acceptable temperature ranges; humidity (during storage or test analysis particularly with electronic © 2011 by Taylor and Francis Group, LLC

Quality Assurance of Point-of-Care and On-Site Drug Testing

35

Table 2.8â•… Examples of Environmental, Operator-Related, and Analytic Sources of Error for Laboratory Testing Sources of Laboratory Error Environmental Temperature Humidity Airflow Light intensity Altitude Operator Improper specimen preparation and handling Incorrect test interpretation Failure to follow test system instructions Analysis Calibration incorrect Mechanical failure

instruments); poor airflow (around instruments, leading to overheating or too much airflow impeding test development); light exposure (during storage or poor lighting during test interpretation); and even altitude (effects on instruments like blood gas analyzers). Operators can inadvertently make errors in specimen collection, processing, and handling, or fail to follow manufacturer instructions, take analytical shortcuts, and even misinterpret test results, such as interpreting the appearance of a POC drug test line as positive rather than negative, or vice versa. Analytical errors can occur with improper instrument calibration and mechanical failures, or from sample interferences and cross-reacting drugs. Manufacturers incorporate a variety of process controls to minimize the risk of common laboratory errors. Historical performance of two levels of control samples each day of testing can detect some test system problems, but there are other types of controls that are being incorporated into newer tests, particularly single-use POC tests. Many of these tests utilize “on-board” controls that are analyzed with each sample and test kit. The control line on a POC drug test is one example of this type of “on-board” control. This line is developed at the same time that the drug test line is developed, but utilizes a separate antigen–antibody reaction to ensure that the test kit is viable, has not expired, and was stored properly. The control line can also detect that an adequate sample volume was applied to the test kit and that the test development was timed and interpreted appropriately. The control line also can detect sample problems like interfering compounds or adulterants in a urine drug sample and viscosity issues with sample flow, since failure to develop © 2011 by Taylor and Francis Group, LLC

36

Quality Assurance in the Pathology Laboratory

a control line will indicate an invalid test kit or sample. This type of “onboard” quality control is thus sensitive to random errors that can occur with individual samples or test kits. Analyzers also have built-in system checks that can control for instrument function, electrical problems, and even calibration errors. Finally, external control programs, in the form of blind proficiency samples, send the laboratory a set of blind samples a few times a year and grade an individual laboratory’s performance against other laboratories performing the same test methods. EP23 assists laboratories in determining which control processes are most appropriate to an individual test device in their laboratory setting and provides justification for the frequency of performing selected controls. The laboratory director has ultimate responsibility for the quality of test results under his or her direction, so he or she must decide on an appropriate quality control plan for each testing method. Some laboratories may have more tolerance for error because the test results will be confirmed by another method before action is taken while other laboratories will demand more stringent control because the test result is definitive and may result in immediate medical decisions. The control plan is thus customized for a specific testing method and laboratory setting.

2.8╇Developing a Quality Control Plan for a POC Drug Test A quality control plan is usually developed on initial implementation of a new test method, although the quality control plan can be developed on a test already in clinical use, to better define quality processes and improve the quality of test results. The laboratory director should collect information about the test from the package insert and other available information provided by the manufacturer, as well as the local quality regulations and details about the clinical need, who will perform the test, and how the test result will be utilized in making medical decisions (Figure 2.4). This information is processed through a risk assessment to evaluate those risks of highest priority and to determine control processes that will reduce those risks to a clinically acceptable level. While it is never possible to eliminate all probability of risk, the goal of developing a quality control plan is to control risk within acceptable limits in order to meet clinical need. Let us consider a simple POC drug test. This is a single-use test kit that can be utilized in a formal laboratory or taken on-site to deliver drug testing closer to the site of patient care, such as a physician’s office, ambulance, or into the field for use by police in the prison system, and by athletic programs. The test requires a urine sample and is classified as a waived device by CLIA’88. The package insert indicates no need to analyze controls on a © 2011 by Taylor and Francis Group, LLC

Quality Assurance of Point-of-Care and On-Site Drug Testing

37

regular basis, since each kit contains a separate control area that detects test viability, appropriate sample application, and test development and interpretation. Test results are read visibly by the operator at 15â•›min after application of three drops of urine as the appearance of a line in the drug test area (negative) and as the disappearance of a line in the drug test area (positive for drug in the sample above the cutoff concentration). The manufacturer indicates that control samples can be analyzed whenever the laboratory questions the performance of the test kits, but does not make recommendations regarding the frequency or conditions when control samples should be analyzed. Although CLIA’88 waived test regulations only require the laboratory to follow manufacturer’s instructions, there are a number of risks of error with such POC test kits even when manufacturer’s instructions are followed. Some laboratories may find the manufacturer’s risk acceptable, but in other situations, the risk of error from simply following manufacturer’s instructions may not meet clinical expectations. In either case, the laboratory director should assess the risk of performing the test in their laboratory and sign off their acceptance of the quality control plan implemented by the laboratory, whether that is to follow manufacturer’s instructions or to supplement additional control processes. Sources of error can be environmental, operator related, or analytic in nature. Each risk should be considered separately. Risks, and the rationale for controlling each risk, can be documented in a table format that, when completed, will comprise the laboratory’s quality control plan for the POC drug test (Table 2.9). Let us consider the possibility of test kit degradation during shipment. The POC drug test kits should be maintained at room temperature, within a temperature range of 10°C–40°C, and protected from heat and freezing. Since the laboratory director will have no control over shipping conditions, there is a possibility of test kits being exposed to extreme temperatures during shipment. By testing a positive and negative control upon arrival of each shipment of test kits, whether from the same lot or different lots of test kits, the laboratory director can ensure the appropriate performance of the kits before use on patient samples. A positive and negative control should be selected with drug concentrations close to the cutoff concentration (±20%–25% of cutoff), so the control is sensitive to changes in the test kit performance. Controls that are very positive and very negative may not adequately determine minor changes in test kit performance; thus, controls with concentrations close to the cutoff are preferred. This control process is added to the quality control plan (Table 2.9). The residual risk with this mitigation can be assessed by comparing the frequency of the error (hazard) with the consequences for not detecting or preventing the error (hazard). The frequency of this hazard or probability of harm can be estimated from historical data on compromised shipments sent to the laboratory or from the manufacturer regarding the frequency of returned shipments. This © 2011 by Taylor and Francis Group, LLC

38

Quality Assurance in the Pathology Laboratory

Table 2.9â•…Sample Quality Control Plan for a Hypothetical POC Drug Test

Targeted Failure Mode (Hazard)

Automated Control Effective?

Test kit degradation during shipment due to extreme temperature exposure

Partially effective. “On-board” controls detect test kit viability

Test kit degradation during storage, due to temperature exposure

Partially effective. “On-board” controls detect test kit viability

Too much or too little sample

Yes. “On-board” controls detect significant variation in sample volume Partially effective. “On-board” controls will detect significant variations in timing Partially effective. “On-board” controls only detect some adulterants Not effective. “On-board” controls not effective in detecting drug cross-reactivity

Incorrect test development timing

Sample adulteration

Drug cross-reaction

Quality Control Plan Analyze positive and negative control upon arrival of new shipments of test kits prior to use on patient samples Analyze positive and negative control periodically (once a month) to ensure test kit viability Check test kit control zone with each test. Repeat tests with invalid control line Implement a timer with an audible alarm. Validate timer readout at 15â•›min, once per year Implement adulteration tests (or switch to oral fluid drug testing) Confirmatory testing for any questionable test results or whenever drug cross-reactivity is suspected

Is Residual Risk Acceptable? (Yes/No) Yes

Yes

Yes

Yes

Yes

Yes

Notes: The targeted failure mode or risk of error (hazard) is described, the manufacturer’s control is assessed for effectiveness, and the laboratory’s quality control plan is described. The residual risk after implementation of the quality control plan is assessed for clinical effectiveness. If residual risk is still unacceptable, additional control processes will be required to reduce the risk to a clinically acceptable level.

estimate can be subjectively described as follows, as indicated in ISO 14971 [15] and EP23 [13]: • Frequentâ•›=â•›once per week • Probableâ•›=â•›once per month • Occasionalâ•›=â•›once per year © 2011 by Taylor and Francis Group, LLC

Quality Assurance of Point-of-Care and On-Site Drug Testing

39

• Remoteâ•›=â•›once every few years • Improbableâ•›=â•›once in the life of the test system This laboratory estimates that a shipment may be compromised somewhere between occasional (once a year) and remote (once every few years). Since analyzing control samples on each shipment will detect compromised test kits before they are used on patient samples, the frequency of an error with the control process in place is improbable. The severity of harm to patient outcome should the error/hazard not be detected or prevented is also estimated [13,15] as follows: • Negligibleâ•›=â•›inconvenience or temporary discomfort • Minorâ•›=â•›temporary injury or impairment not requiring professional medical intervention • Seriousâ•›=â•›injury or impairment requiring professional medical intervention • Criticalâ•›=â•›permanent impairment or life-threatening injury • Catastrophicâ•›=â•›results in patient death The severity of harm for a POC drug test will depend on how the test result is being utilized. If the POC result is being followed with a confirmation result, there is negligible consequence from a false-positive result, since all positive POC drug tests will be followed with a confirmatory test. However, a temperature-compromised reagent is more likely to give a false-negative result. A false-negative test may miss abuse that could lead to patient harm from continued abuse that is not detected, since negative tests may not be confirmed. This could be serious, or even catastrophic, if the consequence of undetected abuse leads to patient death. In an emergency room, medical management may occur only based on the screening POC drug test, without confirmation, so the severity of harm may be serious if the negative test leads to surgery and there is a drug interference with anesthesia. The frequency of error can be combined with the severity of harm to determine the clinical acceptability of the control process (Table 2.10). An improbable frequency of error or probability of harm combined with a serious to even catastrophic severity of harm is still clinically acceptable, so the clinical acceptability of this control process is documented in the laboratory’s quality control plan (Table 2.9). The risk for each potential error or hazard is assessed in a similar manner. For example, temperature can also affect test kit performance during storage. In a clinical laboratory with controlled temperature conditions, the probability of this hazard is remote (once every few years) and may only occur if the temperature control fails due to power outage. However, if the test kit is transported in a vehicle (e.g., in an ambulance or by visiting nurse), the probability of this hazard is much greater. If the test kits must be refrigerated, © 2011 by Taylor and Francis Group, LLC

40

Quality Assurance in the Pathology Laboratory

Table 2.10â•…Risk Evaluation Table to Determine the Clinical Acceptability of Residual Risk after Implementation of a Control Process Severity of Harm

Probability of harm

Negligible

Minor

Serious

Critical

Catastrophic

Frequent Probable Occasional Remote Improbable

Unacceptable Acceptable Acceptable Acceptable Acceptable

Unacceptable Unacceptable Acceptable Acceptable Acceptable

Unacceptable Unacceptable Acceptable Acceptable Acceptable

Unacceptable Unacceptable Unacceptable Acceptable Acceptable

Unacceptable Unacceptable Unacceptable Unacceptable Acceptable

Source: Reproduced from Clinical and Laboratory Standards Institute, EP23 Laboratory Quality Control Based on Risk Management, CLSI, Wayne, PA, in press. Notes: The probability of harm is a semiquantitative estimate of the probability of harm (frequency of an error occurring) multiplied by the severity of harm and consequence to patient outcome with the control process should the hazard go undetected. Shaded boxes indicate unacceptable clinical risk that requires additional control processes.

there is a higher probability that the refrigerator temperatures may go out of range (particularly when a door is left open), so refrigerated reagents may have a higher probability of temperature degradation than reagents stored at room temperature. In either case, a control strategy can be utilized that periodically analyzes control samples during storage (i.e., once a month). This reduces the probability of reagent degradation during storage to remote (once every few years), since compromised test kits will be detected before use on patient samples. In addition, if the test kits are not stored in a vehicle and removed with other sensitive medications and devices, the frequency of this hazard is also lower. The severity of harm is serious if a compromised test kit is utilized, but the “on-board” control should detect a compromised test kit and, in conjunction with periodic control performance, the risk of using a temperature-compromised test is remote. This control process can be added to the laboratory’s quality control plan (Table 2.9). The potential for operator errors in sample application can also be evaluated by a similar risk assessment process. Operators can apply too much or too little sample, which could lead to inaccurate results. The “on-board” controls should detect over-loading (flooding the test reagents) and underloading (too little reagent to migrate down the chromatogram). With “onboard” controls, the frequency of accepting an inaccurate result due to wrong sample application should be remote (once every few years) and is a factor of the operator properly interpreting the test results. Use of an electronic test reader would reduce the probability of this hazard to improbable, but an instrumented test reader would require calibration, maintenance, and be subject to other mechanical device failures. So, instrumented POC drug tests are a higher (moderate complexity) test under CLIA’88, with additional validation, training, and control requirements. The severity of harm would © 2011 by Taylor and Francis Group, LLC

Quality Assurance of Point-of-Care and On-Site Drug Testing

41

be serious if an inaccurate test result were released, but the combination of remote frequency with serious harm is clinically acceptable. The use of “onboard” controls to detect sample application errors by the operator is added to the laboratory’s quality control plan. There is a risk of operators failing to time the test result appropriately. The manufacturer of this test recommends reading the result visually after 15â•›min. Under-development and over-development could lead to inaccurate results. The test “on-board” controls will detect significant variations in test timing, but the risk of mistiming the development would be significantly less if the laboratory implements a timer to ensure that the test is appropriately developed. However, a timer must be validated periodically (once per year), to ensure that it is appropriately calibrated to read 15â•›min. With the use of a timer, the frequency of timing errors by the operator are probable (once per month), and result from the operator getting pulled away to take care of other tasks and forgetting to return to the test. A timer with an audible alarm that must be turned off reduces this possibility to occasional (once per year). Analysis of control samples periodically, using the timer, will further verify the appropriateness of test timing and timer calibration. The severity of incorrect test timing can be serious, but occasional multiplied by serious severity of harm is clinically acceptable. The use of a timer with an audible alarm is added to the laboratory’s quality control plan. The risk of analytical errors includes sample adulteration and test crossreactivity with other drugs in the patient’s sample. Sample adulterants are compounds that produce false-negative test results when added to the sample. The risk of sample adulteration is greater in patients who are conscious and motivated to fool their drug test. So the frequency of this hazard will vary, depending on the clinical application of the POC drug test. In an emergency room, with obtunded patients, the frequency of sample adulteration will be much less than at a rehabilitation center or in an athletic program. Adulterants like strong acids and bases that destroy antibody binding will affect the reactivity of both drug and control antibodies in the test kit. “On-board” controls will thus be sensitive to a number of common adulterants and invalidate the test result. However, there are some adulterants that may selectively affect drug structure while preserving control reactivity, like Stealth, a peroxide–peroxidase mixture. The laboratory can implement specific adulteration tests to detect the presence of common adulterants like acids, bases, nitrates, dichromate, glutaraldehyde, salts, and dilution. These tests are recommended anytime there is a likely risk of adulteration and adulteration tests are required by the federal workplace drug programs. Alternatively, the laboratory can implement oral fluid drug testing that can be collected in the presence of the patient, without violating personal privacy, which is a concern with urine collections. Use of either adulteration testing or switching from urine to oral fluid POC drug testing can reduce the © 2011 by Taylor and Francis Group, LLC

42

Quality Assurance in the Pathology Laboratory

probability of adulteration risk to occasional (once a year) or remote (once every few years). The consequences, however, of not detecting drug use can be serious or of even greater severity of harm to the patient. Combined, the implementation of adulteration testing or oral fluid testing will reduce this risk to a clinically acceptable level. Drug cross-reactivity is another risk to consider for POC drug testing. The frequency of cross-reactivity depends on the specific drug test and drug class being detected. For instance, amphetamine drug tests are subject to much more cross-reactivity with over-the-counter cold medicines than are cocaine tests. Laboratories can certainly change to another manufacturer if the frequency of false-positive drug tests is significant, but confirmatory testing will provide a more definitive test result than any screening POC drug test. Confirmatory testing is recommended anytime drug-cross reactivity is suspected or the test results do not match the clinical patient history and symptoms. With confirmatory testing, the probability of false-positivity due to drug cross-reactivity is occasional (once per year), and the severity of harm is minor to negligible since clinical action will wait for confirmatory test results. The residual risk of cross-reactivity could occur only from drugs or drug classes that are not readily detected by the confirmatory methods; thus there is still some residual risk, particularly with new and investigational drug protocols. However, the combined probability of drug cross-reactivity (occasional) with the severity of harm when using confirmatory testing (negligible) is clinically acceptable. The need for confirmatory testing with any questionable test results is added to the laboratory’s quality control plan. The laboratory’s quality control plan for this hypothetical POC drug test can be summarized as follows: • Follow manufacturer’s instructions for test performance and interpretation of “on-board” controls. • Analyze two levels of control samples (±20%–25% of cutoff concentration) on arrival of each shipment of test kits and monthly thereafter. • Utilize a timer with an audible alarm to time test development and verify calibration of timer readout annually. • Utilize adulteration testing for POC drug tests performed outside of the emergency room when the frequency of adulteration is significant. • Utilize confirmatory testing whenever there is suspected drug crossreactivity or the screening test results do not match the clinical picture. The laboratory’s quality control plan defines the control processes that will be implemented to minimize the risk of specific hazards or errors with POC © 2011 by Taylor and Francis Group, LLC

Quality Assurance of Point-of-Care and On-Site Drug Testing

43

drug testing. Once implemented, the effectiveness of the quality control plan will be monitored to determine failures, complaints, or occurrence trends that need to be investigated. It is never possible to predict the risk of all potential errors initially when implementing a new testing method, so, over time, the quality control plan will necessarily need to be modified as new risks are uncovered in a continuous quality improvement cycle.

2.9╇Summary POC testing is clinical laboratory testing conducted close to the site of patient care. POC testing is often done with simple single-use test kits that are portable and can be conducted in a range of clinical settings. The quality of POC tests is often questionable, given the number of different personnel and the variety of education levels and laboratory experience. A total quality assurance program is required to ensure the quality of test results. Quality management system essentials that are utilized for central laboratory tests are applicable to POC tests. The laboratory director is ultimately responsible for the quality of test results under his or her direction. Quality control is a set of procedures designed to monitor the test method and test results to ensure appropriate test system performance. Developing a quality control plan requires mapping the testing process (preanalytic, analytic, and postanalytic) and understanding the risks for hazards or errors that may occur at each step of the testing process. Control processes are implemented to mitigate risk and reduce the risk of errors to a clinically acceptable level. A quality control plan is customized to the specific test method, the clinical application of the test result, the clinical setting and testing personnel, and the local quality regulations. Once implemented, the effectiveness of a quality control plan is monitored and modified as new risks are uncovered to continuously improve the quality of test results and reduce risk to a clinically acceptable level. POC drug tests are a specific application of POC testing, which pose their own hazards and risks of error. The quality of POC drug tests can be managed through development of a quality control plan and utilization of a total quality management system in a manner similar to central laboratory tests.

References 1. National Academy of Clinical Biochemistry. 2006. Introduction. In: Laboratory Medicine Practice Guideline: Evidence Based Practice for Point of Care Testing, ed. J.H. Nichols, Washington, DC: AACC Press, pp. vi–viii. 2. Health and Human Services, Health Care Financing Administration Public Health Service. 1992. 42 CFR Part 405 et al., Clinical laboratory improvement amendments of 1988; Final rule. Federal Register 57(40):7001–7243. © 2011 by Taylor and Francis Group, LLC

44







Quality Assurance in the Pathology Laboratory

Recent revisions available at http://www.cms.hhs.gov/CLIA (accessed on October 2010). 3. Substance Abuse and Mental Health Services Administration, April 13, 2004. Mandatory guidelines and proposed revisions to mandatory guidelines for federal workplace drug testing programs; Notices. Federal Register 69(71):19644– 19673. Available at http://www.drugfreeworkplace.gov/federal.html (accessed on October 2010). 4. Merriam-Webster, Inc. 1983. Webster’s Ninth New Collegiate Dictionary, Springfield, MA. 5. Folin O. and Wu H. 1919. A system of blood analysis. J. Biol. Chem. 38:81–110. 6. International Organization for Standardization. 2005. ISO 9000:2005 Quality Management Systems: Fundamentals and Vocabulary. Geneva, Switzerland: ISO. 7. International Organization for Standardization. 2000. ISO 9001:2000 Quality Management Systems: Requirements. Geneva, Switzerland: ISO. 8. International Organization for Standardization. 2000. ISO 9004:2000 Quality Management Systems: Guidelines for Performance Improvement. Geneva, Switzerland: ISO. 9. Clinical and Laboratory Standards Institute. 2004. HS1-A2 A Quality Management System Model for Health Care. Wayne, PA: CLSI. 10. International Organization for Standardization. 2007. ISO 15189:2007 Medical Laboratories: Particular Requirements for Quality and Competence. Geneva, Switzerland: ISO. 11. International Organization for Standardization. 2006. ISO 22870:2006 Point-ofCare Testing: Requirements for Quality and Competence. Geneva, Switzerland: ISO. 12. U.S. Food and Drug Administration, Department of Health and Human Services. Code of Federal Regulations Title 21, Part 11. Electronic records; Electronic signatures. http://www.accessdata.fda.gov/scripts/cdrh/cfdocs/cfCFR/CFRSearch. cfm?CFRPart=11 (accessed on October 2010). 13. Clinical and Laboratory Standards Institute. 2009. EP23 Laboratory Quality Control Based on Risk Management. Wayne, PA: CLSI (in press). 14. International Organization for Standardization. 2004. ISO 15198:2004 Clinical Laboratory Medicine—In vitro Diagnostic Medical Devices—Validation of User Quality Control Procedures by the Manufacturer. Geneva, Switzerland: ISO. 15. International Organization for Standardization. 2005. ISO 14971:2005 Medical Devices—Application of Risk Management to Medical Devices. Geneva, Switzerland: ISO.

© 2011 by Taylor and Francis Group, LLC

Quality Assurance of Identification with Chromatographic–Mass Spectrometric Methods

3

Maciej J. Bogusz

Contents Abbreviations 3.1 Introduction 3.2 Role of Screening Procedures in Identification 3.3 Methodical Considerations 3.3.1 Optimization of Sample Pretreatment 3.3.2 Optimization of Chromatographic Separation 3.3.3 Optimization of MS Detection 3.4 Legal and Regulatory Aspects of Identification 3.4.1 FDA Guidance 3.4.2 U.S. Pesticide Agency Requirements 3.4.3 European Commission Requirements 3.4.4 WADA Criteria 3.4.4.1 Chromatographic Separation Requirements 3.4.4.2 Mass Spectrometric Requirements 3.4.5 AORC Criteria 3.4.5.1 Chromatography 3.4.5.2 Low-Resolution Mass Spectrometry 3.4.6 CAP Criteria 3.5 Closing Remarks References

Abbreviations AAFS AORC CAP CLIA

American Academy of Forensic Sciences Association of Official Racing Chemists College of American Pathologists Clinical Laboratory Improvement Amendments

© 2011 by Taylor and Francis Group, LLC

45

45 46 49 51 51 53 54 60 60 62 63 64 65 65 66 66 67 67 68 70

46

Quality Assurance in the Pathology Laboratory

CMS EI FDA FTICR-MS FWHM GC-MS GTFCh HHS LC-MS mDa MRM NIH RRT RT SIM SOFT SOHT SOP SRM TOF UPLC WADA

Centers for Medicare and Medical Services Electron impact ionization Food and Drug Administration Fourier transform ion cyclotron resonance mass spectrometry Full width at half-maximum height Gas chromatography–mass spectrometry German Society of Toxicological and Forensic Chemistry U.S. Department of Health and Human Services Liquid chromatography–mass spectrometry Millidalton Multiple reaction monitoring National Institutes of Health Relative retention time Retention time Selected ion monitoring Society of Forensic Toxicologists Society of Hair Testing Standard operation procedure Selected reaction monitoring Time-of-flight Ultra-performance liquid chromatography World Anti-Doping Agency

3.1╇Introduction The subject of identification in relation to life sciences can be defined in several ways. The Free Dictionary [1] provides following definitions of identification: Identification—the act of designating or identifying something; evidence of identity; something that identifies a person or thing. Positive identification— evidence proving that you are who you say you are; evidence establishing that you are among the group of people already known to the system; recognition by the system leads to acceptance; a system for positive identification can prevent the use of a single identity by several people. Negative identification—evidence proving that you are not who you say you are not; evidence establishing that you are not among a group of people already known to the system; recognition by the system leads to rejection; a system for negative identification can prevent the use of multiple identities by a single person.

In Wikipedia [2] the following is given: The function of identification is to map a known quantity to an unknown entity so as to make it known. The known quantity is called the identifier (or ID) and the unknown entity is what needs identification. A basic requirement © 2011 by Taylor and Francis Group, LLC

Quality Assurance of Identification with Chromatographic

47

for identification is that the ID be unique. IDs may be scoped, that is, they are unique only within a particular scope. IDs may also be built out of a collection of quantities such that they are unique on the collective. Identification is the capability to find, retrieve, report, change, or delete specific data without ambiguity. This applies especially with information stored in databases. In database normalization it is the central, defining function to the discipline.

The Wordreference dictionary [3] defines recognition, identification as a process of recognizing something or someone by remembering; “a politician whose recall of names was as remarkable as his recognition of faces.” In philosophy, identity (also called sameness) is whatever makes an entity definable and recognizable, in terms of possessing a set of qualities or characteristics that distinguish it from entities of a different type. Or, in layman’s terms, identity is whatever makes something the same or different. This includes operational definition that yields either a yes or a no value for whether a thing is present in a field of observation, or that distinguishes the thing from its background, allowing one to determine what is and what is not included in it. All the above-mentioned definitions may be transferable to analytical chemistry or toxicology. Even the example of a politician, who is able to recognize thousands of faces, is not far from the efficient library search used in various identification procedures. In analytical chemistry, the process of mental recognition is replaced by computer software, comparing registered mass spectra or UV spectra with the library, instead of comparing human faces with the memory. According to de Zeeuw and Franke [4], the process of identification starts with the comparison of an unknown substance with the reference substances, whose properties are stored in the database. When more than one matching compound is selected, the process of identification must continue, using further criteria, until only one substance remains on the list. These authors have formulated the following questions, relevant for chromatographic–mass spectrometric procedures: How can analytical properties be compared (e.g., how to compare mass spectra?)? What should be considered as an “adequate” match? Is there a difference between confirmation and identification? What are the requirements for suitable databases? What are the criteria to reject substances? What is the probability of correctness of the identification? De Zeeuw and Franke distinguished three types of identification: structure elucidation as identification of a pure compound by powerful spectrometric methods, confirmation as a result of successful comparison of the properties © 2011 by Taylor and Francis Group, LLC

48

Quality Assurance in the Pathology Laboratory

of the expected substance with the reference substance, and recognition as a result of positive matching of the properties of the unknown substance with the reference database. In recommendations formulated by Food and Drug Administration (FDA) [5], confirmation is similarly defined as “Unambiguous identification of a compound’s presence by comparison to a reference standard (mass spectrometric).” However, the term “confirmation” may be used in another meaning. In forensic toxicology and doping control, the usual analytical strategy consists of two steps: screening procedure, usually performed with highly sensitive but less specific methods (mainly immunoassays or tandemMS using only one transition), and confirmation of the positive result of screening procedure, which is done with the methods of highest possible specificity, like full-scan GC-MS [6], or LC-MS-MS in MRM mode using three transitions or product spectra [7,8]. Similar definition was given by the U.S. Department of Agriculture [9] for pesticide identification: “Confirmation: Verification of a previous analyte identification that is performed by another analytical system.” De Zeeuw [10] warned against using confirmation procedures as the only proof of identification and postulated the use of various identification procedures, and not only MS. He also criticized the use of different identification criteria in different guidelines, which may lead to contradictory interpretation of the results of mass spectrometric analysis. Nevertheless, instrumental techniques consisting of various chromatographic separation procedures hyphenated with mass spectrometric detection are regarded as sufficient tools for unequivocal identification, if particular requirements are met. These requirements, i.e., the establishing analytical threshold, which is appropriate high for particular task, are formulated by responsible organizations or bodies on national or international level. Lehotay et al. [11] proposed the following definitions of results of various identifying procedures: • Indication as nonquantitative result from a general screening method of lower specificity (e.g., immunoassay) • Determination as a quantitative result from a method that meets the acceptable performance criteria for the quantitative purpose of analysis (e.g., GC with element-specific detector) • Identification as a qualitative result from a method capable of providing structural information (e.g., GC-MS) • Confirmation as a combination of two or more analyses that are in agreement with each other, ideally using methods of independent approaches. Lehotay et al. [11] introduced also the term “limit of identification” (LOI), which is defined as the lowest concentration for which the identification criteria are met © 2011 by Taylor and Francis Group, LLC

Quality Assurance of Identification with Chromatographic

49

Bethem et al. [12] in report of the working group of the ASMS Measurements and Standards Committee went even farther in differentiation of the degree of confidence LOIs. They suggested the following terminology for communication to a client (from lowest to highest confidence step): nonnegative; presumptive; suspected; tentative identification; indicated; identified; identified with confidence; confirmed; identified with utmost certainty. They advised to avoid such terminology as “detected” or “absent.”

3.2╇Role of Screening Procedures in Identification Screening mass spectrometric procedures, often used as a first step of identification, may be divided into two main groups: target, substance-oriented screening and nontarget screening. In the case of nontarget screening, which is often used in clinical and forensic toxicology as “general unknown” analysis, capillary GC-EI-MS is a logical choice. Full-scan mass spectra, obtained with EI-MS, are not very dependent on the instrument and chromatographic conditions applied. Comprehensive libraries of reference EI mass spectra, comprising thousands of substances, are available nowadays [13–15]. This makes possible tentative identification through library search—even without the reference compound. It must be stressed, that the decision concerning preliminary selection and identification based on the statistical analysis of mass spectrum matching with the reference library spectra should be always done by an expert toxicologist. He decides, depending on the case, when the identification level is achieved [10,16,17]. In the case when the reference compound for comparative analysis is not available, the decision concerning the spectrum identity should be taken under utmost consideration, particularly in the case of some “exotic” compounds proposed by the instrument software as candidates for identification. In the full-scan GC-MS-EI, at least four selective ions, including—if possible—molecular ion, should be present in proper abundance ratios. If possible, mass spectra belonging to matrix compounds and affecting the identification should be filtered out. This may greatly enhance the identification power of GC-MS screening [18]. In most identification procedures used in legally sensitive fields, e.g., doping analysis, forensic toxicology, or food quality monitoring, then tentative identification through GC-EI-MS library must be followed by the confirmation step, using the reference compound, run in identical conditions as the analyzed specimen. LC-MS is potentially more amenable for screening purposes than GC-MS since it covers a much broader spectrum of compounds of different polarities. However, this technique suffers several important limitations, both on chromatographic and mass spectrometric side. LC, despite its universality, is a far less selective separation technique than capillary GC. On © 2011 by Taylor and Francis Group, LLC

50

Quality Assurance in the Pathology Laboratory

the other hand, mass spectra of compounds collected with various LC-MS instruments, may vary greatly in regard to relative abundance of fragment ions, even if identical nominal conditions are applied [19]. This makes the direct use of mass spectral data acquired in another laboratory very difficult. For these reasons, LC-MS is an excellent technique for targeted screening or confirmation, but it is not easily applicable for a broad-spectrum search, e.g., in “general unknown” analysis. Nevertheless, in the last years several spectral libraries, comprising hundreds of compounds, were developed using LC-MS [20,21], LC-MS-MS [22,23], or LC-MS-time-of-flight (TOF) [24–26]. The reviews of this topic were recently done by Gergov [27] and by Marquet [28]. Target screening and subsequent confirmation are employed if the particular set of compounds is to be identified. This is the case in the search for scheduled, controlled compounds, e.g., drugs of abuse [29], doping substances [30,31], or food contaminants [32]. In this situation, very specific methods, like GC-MS-MS, LC-MS-MS, both in MRM mode, GC-TOF-MS, or GC-MS-SIM, are applicable. Identification is achieved through the comparison of the chromatographic mobility and the presence of particular fragment ions in intensities corresponding to preset values, observed in reference standards. Limited, task-oriented reference libraries were built for particular groups of compounds. Comprehensive reference data libraries, e.g., for pesticides, based on LC-MS, may comprise several hundred substances. The definition of positive identification or confirmation after LC-MS screening may vary. Some authors mentioned high coincidence of at least two of three spectra generated at three fragmentation energies [33], others a match of at least 60% in reverse-fit library search [34] or similarity of at least five of the most abundant ions [35]. LC-MS-MS (negative ionization ESI, MRM mode) was used by Bogusz et al. [36] for detection of chloramphenicol in food samples (chicken or shrimp meat, honey). Three transitions of deprotonated molecule were monitored. The following criteria of positive identification of chloramphenicol were formulated: retention time (RT) of target within ±1% of internal standard (deuterated analog of target), the presence of three product ions originating from the precursor, and the intensity ratios of product ions in the range of ±2 SD of the mean control values, i.e., ±25%. A different identification strategy was applied by Mottier et al. [37] for determination of chloramphenicol in chicken meat with negative ionization LC-MS-MS. These authors took advantage of the presence of two chlorine atoms in the molecule and used two precursor ions: m/z 321 and m/z 323. The transitions of each isotopic form of deprotonated molecule to product ions m/z 152 and m/z 257 were monitored. The identification criteria were as follows: RT of target within ±1% of internal standard (deuterated analog of target), the variability of the intensity ratios of product ions in the range of 15%–25% of the mean control values. © 2011 by Taylor and Francis Group, LLC

Quality Assurance of Identification with Chromatographic

51

Since the intensity and sometimes pattern of fragmentation in LC-MS is related to the particular technique and conditions used, it was generally postulated that the reference standard should be analyzed in exactly the same conditions as examined sample, at best in the same analytical run. The requirements concerning quality of mass-spectrometric screening procedures were reviewed and discussed by various authors, like Drummer [38], Stimpfl et al. [39,40], and Maurer [41] in relation to clinical and forensic toxicology, and Thevis and Schänzer [30] in relation to doping analysis.

3.3╇Methodical Considerations There are numerous possible factors, which may affect the identification through mass-spectra library, on various steps of identification procedure; the influence of coextracted matrix compounds, incomplete chromatographic separation of compounds, general instrument condition or detector saturation, and peak distortion through excess of the substance. All these factors may change the abundance of ions in a particular mass spectrum and cause mismatching with consequent false interpretation, like false-positive or false-negative identification [42,43]. There are several approaches to optimize the identification process with MS. These approaches may be divided into optimization of sample pretreatment, optimization of chromatographic separation, and optimization of mass spectrometric detection itself. 3.3.1╇Optimization of Sample Pretreatment Optimal, matrix-oriented sample pretreatment is of critical importance in GC-EI-MS identification procedure. It may involve cleavage of conjugates, derivatization, or several cleanup steps. Among isolation procedures used in GC-MS screening and identification, liquid–liquid extraction [13] and solidphase extraction (SPE) [44] were mainly used. In the last years, solid-phase micro-extraction (SPME) is more and more applied, as solvent-free method, particularly useful for screening of volatile compounds of natural or synthetic origin [e.g., 45–48]. For some compounds, particularly large molecules with haptenogenic properties, immunoaffinity extraction procedures were developed. Ho et al. [7] isolated insulin originating from various sources (human, bovine, and porcine) from horse plasma by immunoaffinity precipitation with antibodycoated magnetic beads followed by molecular weight centrifugal extraction. Obtained extracts were analyzed by LC-MS-MS, using nanospray ionization source and QTrap mass spectrometer. For screening purposes, single transition to one common tyrosine immonium ion (m/z 136) was applied (Figure 3.1). The confirmation was done with at least three transition © 2011 by Taylor and Francis Group, LLC

52

Quality Assurance in the Pathology Laboratory

Intensity (cps)

XIC of + MRM (7 pairs): 1162.5/136.3 amu from Sample 9 (plasma spk (0.05 ng/mL... 26.50

2706 2000

25.54

Humalog

25.78

Human insulin 27.24

1000 0

Max. 8984.7 cps.

22.5

23.0

23.5

24.0

24.5

26.0 25.0 25.5 Time (min)

26.5

27.0

27.79 28.24

27.5

28.0

28.5

Intensity (cps)

XIC of + MRM (7 pairs): 1166.0/136.3 amu from Sample 9 (plasma spk (0.05 ng/mL m... Max. 1.7 × 10–4 cps. 25.52

2000

Novolog

1000 0

25.0 25.5 26.0 26.5 27.0 27.5 28.0 28.5 Time (min) XIC of + MRM (7 pairs): 1157.2/136.3 amu from Sample 9 (plasma spk (0.05 ng/mL m... Max. 2.0 × 10–4 cps. Intensity (cps)

22.5

23.0

23.5

24.0

24.5

25.96

1000

Porcine insulin

500 0

22.5

23.0

23.5

24.0

24.5

25.0 25.5 26.0 Time (min)

26.5

27.0

27.5

Intensity (cps)

XIC of + MRM (7 pairs): 1147.7/136.3 amu from Sample 9 (plasma spk (0.05 ng/mL... 25.24

1500

25.64

1000

28.5

Max. 8895.0 cps.

Bovine insulin 27.97

500 0

28.0

22.5

23.0

23.5

24.0

24.5

25.0 25.5 26.0 Time (min)

26.5

27.0

27.5

28.0

28.5

Intensity (cps)

XIC of + MRM (7 pairs): 1150.8/136.3 amu from Sample 9 (plasma spk (0.05 ng/mL m... Max. 1.9 × 10–4 cps. 25.62

1.00e4

Equine insulin (endogenous)

5000.00 0.00

22.5

23.0

23.5

24.0

24.5

25.0 25.5 26.0 Time (min)

26.5

27.0

27.5

28.0

28.5

Figure 3.1╇ Product-ion chromatograms of the targeted insulins obtained from the analysis of a plasma sample spiked with five exogenous insulins at 0.05â•›ng/ mL each. (From Ho, E.N.M. et al., J. Chromatogr. A., 1201, 183–190, 2008. With permission.)

© 2011 by Taylor and Francis Group, LLC

Quality Assurance of Identification with Chromatographic

53

characteristics for the particular insulin, taking also RT into account. The method was applied in doping-control analysis, as a tool of differentiation of equine insulin from the exogenous ones. 3.3.2╇Optimization of Chromatographic Separation Capillary GC is mature technique, in relation to the efficiency of chromatographic separation. Nevertheless, there are recent examples showing that this art of chromatography may be refined, in order to facilitate identification in complex mixtures or matrices. van der Lee et al. [32] presented a targeted screening procedure for 106 scheduled pesticides and contaminants in animal feed matrix. The procedure was based on solvent extraction, gel permeation chromatography (GPC) cleanup, and two-dimensional GC with full-scan TOF-MS. All compounds were automatically detected at the level exceeding 50â•›ng/mL. Twodimensional GC followed by TOF-MS was also applied by Banerjee et al. [49] for multiresidue analysis of pesticides in grapes. A combination of a nonpolar and a polar capillary column connected in series was used. The method resolved the co-elution problems as observed in full scan one-dimensional GC-MS analysis and allowed chromatographic separation of 51 pesticides within 24â•›min run time with library-searchable mass spectrometric confirmation. The limit of detection improved by 2–12 times on GCxGC-TOF-MS against GC-TOF-MS because of sharper and narrower peak shapes. An automated direct sample introduction (DSI) technique coupled to comprehensive two-dimensional GC-TOF MS was applied for the development of a screening method for 17 polychlorinated dibenzo-p-dioxins/dibenzofurans and 4 non-ortho polychlorinated biphenyls (PCBs) in fish oil [50]. Comparison of instrumental performance between DSI-GCxGC/TOF-MS and the traditional gas chromatographic high-resolution mass spectrometry (GC-HRMS) method showed good agreement of results for standard solutions analyzed in blind fashion. Relatively high tolerance of the DSI technique for lipids in the final extracts enabled a streamlined sample preparation procedure that only required GPC and SPE clean-up with graphitized carbon black. This analytical screening method for has the potential to monitor fish oil contaminated with dioxin and dioxin-like PCBs at or above current food safety limits. Kolbrich et al. [51] applied two-dimensional GC-EI-MS (SIM) with cryofocusing for determination of methylenedioxyethylamphetamine (MDMA) and its metabolites, 3,4-methylenedioxyamphetamine (MDA), 4-hydroxy3-methoxymethamphetamine and 4-hydroxy-3-methoxyamphetamine in human plasma. This assay provided low limits of quantification and the chromatographic system should be suitable for application to other analytes and complex matrices.

© 2011 by Taylor and Francis Group, LLC

54

Quality Assurance in the Pathology Laboratory

In contrast to capillary GC, HPLC shows far less effective separation power. The last few years brought distinct progress in this area through introduction of fine-particle columns (particle size below 2â•›μm), requiring much higher working pressure. This technique, known as ultra-performance liquid chromatography (UPLC), enabled much better separation in a shorter time and has been immediately introduced in combination with MS for identification purposes. In the field of doping analysis, UPLC enabled highthroughput analysis, particularly of diuretic compounds. Ventura et al. [52] detected 34 scheduled diuretics and other doping agents in urine extracts, using UPLC-MS-MS in negative and positive ionization mode. Total analysis time was 5â•›min, and the method fulfilled the requirements established by the World Anti-doping Agency (WADA). Thörngren et al. [53] developed UPLC-MS-MS-based screening method of 130 substances (diuretics, central nervous system stimulants, and opiates) for direct injections of urine samples. Samples were injected on a reversed phase column connected to a fast polarity switching and rapid scanning tandem mass spectrometer with an electrospray interface. The software used to evaluate the results produced reports containing a small-sized window for each component and a data table list with flags to indicate any adverse analytical findings in the sample. The report could be processed automatically using application software, which interpret the data and indicate if there is a suspicious sample. One 96-well plate could be analyzed within 16â•›h. Several applications of UPLC-MS concerned pesticide residue analysis. UPLC-TOF-MS was applied for the rapid qualitative and quantitative analysis of 100 pesticides targeted in strawberry [54]. Accurate mass measurement of positive and negative ions allowed their extraction following “full mass range data acquisition” with negligible interference from background or coeluting species observed during UPLC gradient separation (in a cycle time of 6.5â•›min per run). Mass measurement accuracies of ≤5â•›ppm were achieved consistently throughout the separation, mass range, and concentration range of interest thus providing the opportunity to obtain discrete elemental compositions of target ions. In another study [55], 90 pesticides were screened in fruit juices by UPLC-MS-MS (MRM) after simple acetonitrile extraction. The separation was achieved in 11â•›min run. 3.3.3╇Optimization of MS Detection Accurate mass determination emerged as one of the most promising identification tools in contemporary MS. The measured elemental mass allows to calculate the elemental formula of the ion, and therefore to confirm the identity of known compound in the case of library search [24] or to identify of an unknown ion. The mass accuracy may be expressed in absolute values,

© 2011 by Taylor and Francis Group, LLC

Quality Assurance of Identification with Chromatographic

55

usually in millidaltons (mDa), or in relative values, e.g., in parts per million (ppm). These values are calculated as follows:

mDa; ([(m/z )measured − (m/z )calculated ]) × 1000 ppm; 106 ×

([(m/z )measured − (m/z )calculated ]) (m/z )measured

According to FDA guidelines, the mass accuracy required for the identification/confirmation should be within 5â•›ppm (corresponding to around 2.5â•›mDa) for masses below m/z 500 [5]. Mass accuracy depends on the instrument used; for quadrupole or ion-trap instrument, the mass accuracy of 50–100â•›mDa is possible, for TOF or quadrupole-time-of-flight (QTOF) below 10â•›mDa, for Fourier transform ion cyclotron resonance (FTICR)-MS and orbitrap—1â•›mDa and less. Some new constructions of triple–quadrupole instruments show accurate mass capabilities below 1â•›mDa [56]. Mass resolution is very important parameter related to mass accuracy. Mass resolution defines the ability of a mass spectrometer to separate ions of different m/z values and is usually calculated from the formula: M/ΔM, where M is the m/z value of a single-charged ion, and ΔM, is a difference between the M and the next m/z value ion that can be distinguished from M. ΔM is usually expressed as full width at half-maximum height (FWHM) of two adjacent separable mass spectral peaks. For modern instruments, like TOFs, orbitraps, or FTICR-MS, the resolution of 20,000 and higher is possible. Besides toxicological screening [24,27], high-resolution accurate MS has been applied in other screening and identification procedures. Hernandez et al. [47] developed a procedure based on GC coupled to high-resolution TOF-MS (GC/TOF-MS) for targeted and non-targeted screening of organic pollutants in water. SPME was applied for the isolation of 60 organic pollutants, including pesticides, octyl/nonyl phenols, pentachlorobenzene, and polycyclic aromatic hydrocarbons. The identification was carried out by evaluating the presence of up to five representative m/z ions per analyte, measured at high mass accuracy, and the attainment of their Q/q (Q, quantitative ion; q, confirmative ion) intensity ratio. This strategy led to the detection of target compounds in several water samples at low part-per-billion levels. Full-spectrum acquisition data generated by the TOF-MS analyzer also allowed subsequent investigation of the presence of polybrominated diphenyl ethers and several fungicides in samples after MS data acquisition, without the need to reanalyze the water samples. In addition to targeted screening, nontargeted analysis was also tested by application of deconvolution software. Several organic pollutants that did not form a part of the list of contaminants investigated were identified in the water samples, thanks to the

© 2011 by Taylor and Francis Group, LLC

56

Quality Assurance in the Pathology Laboratory

sensitivity of TOF-MS in full-spectrum acquisition mode and the accurate mass information provided by instrument. Several hundreds of crop-protection products were recently banned from use by European and U.S. environmental agencies and therefore became an issue for environment controlling laboratories. Since it was difficult to monitor all these compounds with GC-MS, LC-MS, or LC-MS-MS, Thurman and Ferrer [57] developed a nontargeted screening procedure based on the combination of LC-TOF-MS, LC-IT-MS, and LC-Q-TOF-MS. As reference databases, The Merck Index and ChemIndex, both commercially available, were applied. The identification strategy consisted of four steps: full-scan LC-TOF-MS analysis, library search for empirical formulas and any A+2 isotopes (for halogens or S), LC-ITMS or LC-Q-TOF-MS-MS for structure elucidation, and final comparative standard analysis. Accurate mass determination may be very useful in the analysis of such compounds, which cannot yield characteristic fragment ions in tandem mass spectrometric analysis, particularly in MRM mode. Nielen et al. [58] compared the performance of various high-resolution LC-MS techniques for hormone residue analysis in food samples. The authors used three types of instruments: LC-QTOF-MS, LC-FTIR-MS, and LC-FT-Orbitrap-MS n. The authors stressed the need of optimal sample pretreatment and clean-up for instruments with lower mass accuracy (around 20â•›ppm) since the LC resolution and MS resolution are strongly interrelated and have a major impact on mass accuracy. The instruments with higher mass resolution may accommodate a less completely resolved chromatographic separation. This may be illustrated by the analysis of stanozolol; the inexplicable fragment observed in QTOF-MS (m/z 161.1223 at mass resolution 5000 FWHM) analysis appeared in LC-FTIR-MS as a doublet of ions having minor mass differences (m/z 161.1073 and m/z 161.1324, mass resolution 250,000). The authors postulated resolution of ≥70,000 (FWHM) as sufficient for elucidating of elemental composition of product ions up till m/z 400 (Figure 3.2). Besides high-resolution accurate mass MS, other instrumental solutions were recently applied for identification purposes. Most promising was the application of information dependent acquisition (IDA) in combination with enhanced product ion (EPI) spectrum. This technique has been used by Stanley et al. [8] for the screening of acidic drugs in equine plasma and neutral drugs in equine urine. For plasma, acetonitrile/internal standard precipitation followed by centrifugation was used; urine specimens were only spiked with internal standard and centrifuged. The chromatography consisted of on-line extraction with Oasis HLB column and separation on Chromolith RP-18e column, using isocratic elution. The drugs were detected with QTRAP hybrid tandem MS, equipped with heated nebulizer and TurboIonSpray sources and working in MRM mode. One transition was monitored for each drug. IDA was applied; if the signal was greater than the © 2011 by Taylor and Francis Group, LLC

Quality Assurance of Identification with Chromatographic 100

57

%

161.1223

0

161

(a)

162

m/z

161.1073 C10H13N2

100

161.1324 C12H17

90

Relative abundance

80 70 60 50 40 30 20 10 0 (b)

161.10

161.11

161.12 m/z

161.13

161.14

Figure 3.2╇ Characteristic details of (a) the QTOFMS/MS and (b) LTQMS2/FTIR

product ion mass spectra of stanozolol representing one example of the doublet product ions. (From Nielen, M.W.F. et al., Anal. Chim. Acta, 586: 122–129, 2007. With permission.)

preselected value, the EPI spectrum was recorded. Positive ionization was used for 11 neutral drugs and negative for 32 acidic drugs. Unequivocal identification was achieved for almost all drugs. However, in the case of anabolic steroids, highly similar EPI spectra were observed, and the authors found the method unsuited for this group of compounds. Drees et al. [59] compared the identification ability of MRM ratios and MRM-IDA, using QTrap hybrid triple quadrupole/linear ion trap MS. Fourteen selected drugs of abuse were examined at various concentrations. For MRM-only experiments, two transitions were monitored and ion ratios were calculated. In the case of © 2011 by Taylor and Francis Group, LLC

58

Quality Assurance in the Pathology Laboratory

MRM-IDA, the product mass spectrum (EPI) was recorded when the product ion abundance exceed the defined level. Both methods performed well at low concentrations; at very high concentrations, the MRM-IDA method gave better chance of confirmation. Thermo Scientific introduced recently a new interface—the FAIMS (highfield asymmetric waveform ion mobility spectrometry). The FAIMS interface is located in the atmospheric pressure region between the ion source and the mass spectrometer and allows to selectively isolate target compounds based on a number of physical properties, including charge state and molecular conformation. FAIMS provides an increase in selectivity by utilizing changes that occur in the behavior of an ion when subjected to alternating low and high electric fields. These changes in ion behavior are used by FAIMS to provide ion filtering, resulting in LC-MS chromatograms with reduced chemical background and endogenous interferences. FAIMS is compatible with quadrupole and ion-trap instruments and found applications for identification of compounds in complex matrices, e.g., in doping analysis or in pharmaceutical analysis [60]. A combination of LC-MS-MS and/or GC-MS-nitrogen-phosphorous detector (NPD) was used by Thevis et al. [61] to identify compounds present in confiscated black market drug preparations, containing mainly anabolic steroids or sexual stimulants. The drugs were isolated with simple methanolic extraction and subjected to LC-MS-MS examination on QTrap instrument equipped with ESI source working in MRM mode. Gradient elution was applied in order to separate all compounds. For each drug, three transitions were monitored. For GC-MS-NPD examination, an inlet splitter was applied, and the injected sample was separated on two identical columns; one was connected with EI-MS detector, the other with NPD. The calculation of relative-ion intensities (ion ratios) is usually applied as one of identification features. Bogusz et al. [36] and Mottier et al. [37] used intensity ratios of product ions in LC-MS-MS procedures for identification of chloramphenicol in food samples. Feng et al. [62] developed LC-MS-MS procedure for simultaneous determination of 30 various drugs of abuse in urine. Three transitions were monitored for each drug. The intensity ratios of the two fragment ions to most abundant fragment ion were calculated and used to confirm the identity. These ratios should be in the range of ±3 SD as determined in the validation procedure. Concheiro et al. [63] published an LC-MS-MS study on the simultaneous determination of various drugs of abuse in urine. The procedure was based on SPE in the presence of deuterated analogs, separation on an Atlantis dC18 column and ESI MS-MS (positive ions) in MRM mode. Two transitions were monitored for each drug. Among the usual validation parameters, like linearity, recovery, within-day and between-day precision, and accuracy, limit of detection and quantitation, freeze-and-thaw stability, and matrix effect, also relative ion intensities © 2011 by Taylor and Francis Group, LLC

Quality Assurance of Identification with Chromatographic

59

were tested, in within-day and between-day mode. The ion intensities were calculated at two concentration levels in within-day and between-day regime. It was demonstrated that the variability of results was much higher in between-day experiments than in within-day experiments (Table 3.1). The authors concluded that relative ion intensity should be taken with caution as an identification criterion, and strongly recommended to analyze standard sample with the real sample in the same day, in order to fulfill the established criteria. Stein and Heller (the authors are associated with NIST and FDA, respectively) published a very important study on the factors responsible for falsepositive identification with MS [64]. The following experiments were done: From the reduced NIST/EPA/NIH mass spectral library [15], comprising 96,464 entries, every tenth spectrum (roughly 9600 spectra) was chosen as a search spectrum. These search spectra were eliminated from the library before performing the search, so all library spectra that matched the search spectrum for a given set of constraints were false positives. Search experiments were performed using different number of peaks for matching, the number ranging from one to eight peaks. The abundance window of 0.25 was set, i.e., the search and library spectrum at given m/z was considered a match if the difference in abundance was less than 25%. It was shown that the number of peaks as well as peak abundance clearly reduced the falsepositive probability. The authors concluded that more than three fragment ions (in full scan or SIM mode) should be used for identification and the m/z values of that should be carefully selected. Highly probable peak correlations such as 14â•›amu difference (methyl group loss) or 18â•›amu (water loss) should Table 3.1â•… Variability of Relative Ion Intensities of Various Drugs

Compound

Within-Day Relative Ion Intensities (%)

Between-Day Relative Ion Intensities (%), Low Concentration

Between-Day Relative Ion Intensities (%), High Concentration

EME BEG A MA MDA MDMA Morphine Codeine 6-AM Methadone EDDP LSD

55.6â•›±â•›3.7 58.8â•›±â•›5.8 58.8â•›±â•›9.8 66.7â•›±â•›2.7 21.7â•›±â•›5.8 26.3â•›±â•›2.2 38.5â•›±â•›4.7 37.0â•›±â•›6.8 62.5â•›±â•›6.3 50.0â•›±â•›3.3 50.0â•›±â•›3.3 22.2â•›±â•›5.6

66.7â•›±â•›33.1 32.3â•›±â•›32.0 50.0â•›±â•›22.9 55.6â•›±â•›21.7 29.4â•›±â•›34.0 32.3â•›±â•›37.3 40.0â•›±â•›11.5 40.0â•›±â•›14.8 66.7â•›±â•›17.4 55.6â•›±â•›18.5 55.6â•›±â•›18.5 22.2â•›±â•›14.5

62.5â•›±â•›33.0 32.3â•›±â•›31.3 58.8â•›±â•›23.8 58.8â•›±â•›20.9 27.0â•›±â•›38.9 33.3â•›±â•›37.7 38.5â•›±â•›4.0 38.5â•›±â•›5.4 71.4â•›±â•›17.5 52.6â•›±â•›19.7 52.6â•›±â•›19.7 20.8â•›±â•›10.1

Source: From Concheiro, M. et al., J. Anal. Toxicol., 31, 573–580, 2007. With permission. © 2011 by Taylor and Francis Group, LLC

60

Quality Assurance in the Pathology Laboratory

be avoided. The importance of the use of most appropriate ions (which are usually ions with the highest m/z value and not the ions with the highest intensity) was stressed by Lehotay et al. [11].

3.4╇Legal and Regulatory Aspects of Identification Several professional organizations as well as national and international agencies formulated recommendations and guidelines concerning criteria for identification with mass spectrometric methods. These documents may be divided into two main groups. The first group form strict legal regulations or requirements on national and international level, as issued by U.S. government agencies for clinical laboratories [65], for pesticide testing laboratories [9], and for workplace drug testing [66], by European Union [67], or by WADA for doping control [68]. The second group comprises nonbinding recommendations and guidelines of professional organizations on national and international level, like the guidelines of the FDA [5], Association of Official Racing Chemists (AORC) [69], College of American Pathologists (CAP) [70], Society of Forensic Toxicologists [71], or German Society of Toxicological and Forensic Chemistry [72]. 3.4.1╇FDA Guidance U.S. FDA published final guidance for the development, evaluation, and application of mass spectrometric methods for confirming the identity of animal drug residues [5]. The history of development of this document, which has been published in 2003, was described by Hill [73]. FDA stressed that the guidance contains nonbinding recommendations and does not establish legally enforceable responsibilities. Therefore, throughout the text the word “should” has been used instead of “shall,” e.g., used in the WADA document concerning identification criteria. According to FDA guidelines, the confirmatory mass spectrometric procedures should address each of the following points: Validation package from originating laboratory containing replicate samples, original and spiked, demonstration of zero false-positive rate, demonstration of ≤10% false-negative rate at the tolerance level, demonstration of ruggedness and non-interference of other drugs or matrix components. Method description, containing also structure and full spectrum of target compound, spectral data on at least three structurally specific ions that completely define the parent molecule or more if nonspecific ions are included, proposed fragment ions structures, consistent with fragmentation patterns, justification for specificity of selected ions or scan range, confirmation and operational criteria, as well as quality-control section. © 2011 by Taylor and Francis Group, LLC

Quality Assurance of Identification with Chromatographic

61

Confirmation criteria, in the confirmation procedure, the comparison standard(s) should be analyzed contemporaneously, in the presence of extracted matrix if appropriate. Any of the following MS chromatograms may be used: total ion chromatogram (TIC), reconstructed ion chromatogram (RIC), SIM, or selected reaction monitoring (SRM). Flow injection analysis is discouraged. The chromatographic peak should exceed a signalto-noise threshold of 3:1, and the RT should not differ from the RT of standard more than 2% for GC-MS or 5% for LC-MS. Mass spectral matching criteria vary depending on the MS acquisition mode: In the full-scan and partial-scan MS1, the spectrum should contain at least three structurally specific ions, and the spectrum should visually match the spectrum of the standard. An acceptability range of ±20% on relative abundance of major ions is recommended. Library search algorithms should not be used to confirm identity. All structurally specific ions, mentioned in the method description should be present and their relative abundances should correspond to those of standard. The presence of other unrelated prominent ions should be explained (e.g., from matrix compounds). If background subtraction was used, it should be specified and indicated. In the MS1 SIM, relative abundances of three structurally specific ions should match the standard within ±10% (absolute). In the case of four or more structurally specific ions, the match level is ±15% (absolute). Relative abundances for more than three ions, which include less specific ions like isotopes or due to loss of water, should match the comparison standard within ±10%. In the full-scan and partial-scan MSn, the spectrum should visually match the spectrum of the standard, and there should be general correspondence between relative abundances obtained in sample and standard. All structurally specific ions, mentioned in the method description should be present. If structurally specific precursor ion completely dissociates to product ions, the appearance of at least two structurally specific product ions should be sufficient in MSn+1. The presence of other unrelated prominent ions should be explained (e.g., from matrix compounds). If background subtraction was used, it should be specified and indicated. In MSn SRM, if a precursor ion is completely dissociated, the relative abundance of structurally specific product ions should match the comparison standard within ±10% in the case when two ions were monitored, and within ±20% in the case when three or more ions were monitored. Quality control should include the following points: establishing system suitability, running at least one control and one fortified control sample, control of possible carryover. FDA formulated general recommendations concerning exact mass measurements in confirmatory analysis. Exact mass measurement is defined by © 2011 by Taylor and Francis Group, LLC

62

Quality Assurance in the Pathology Laboratory

FDA as mass assignment to more than one decimal place. The use of this technique will be evaluated on a case-by-case basis, until specific standards applied in residue analysis are generally accepted. It was recommended that the instrument design and operating conditions should be described; the mass resolution and peak purity should be demonstrated to be sufficient to provide only one predominant component per mass peak in the range of the peak of interest. Mass accuracy for reference standards should be expressed in ppm. At lower mass (m/z below 500), 5â•›ppm difference may be sufficient to confirm a unique elemental composition. At masses above m/z 500 is certainly not enough. If multiple candidates occur within the mass measurement, the alternatives should be individually evaluated for their reasonableness. 3.4.2╇U.S. Pesticide Agency Requirements U.S. Pesticide Agency published standard operating procedure (SOP) for identification, confirmation, and quantitation of pesticide residues using GC and LC with mass spectrometric detection [9]. This SOP was written in order to combine the requirements of all MS and MS/MS procedures used in pesticide residue analysis into a single document. It was generally based on FDA recommendations presented above but also showed some differences. The SOP represents the minimum requirements for pesticide analysis, and each laboratory shall have own written procedures, implementing these requirements. In the case of full-scan GC-MS, the spectra should be recorded in the range of 20–500â•›amu. A minimum of three structurally specific ions, preferably including a molecular ion, meeting the signal-to-noise 3:1 ratio are required. Isotopic cluster ions may be used as one of three significant ions. The relative intensity ratios of each ion should be within ±20% of the ratios observed in the reference standard. The use of library search software for EI analysis is mandatory. The use of library search in “soft” ionization techniques, e.g., GC-CI-MS was discouraged. Chromatographic criteria (RT accuracy) for GC-MS were not formulated in this document. In GC-MS-MS analysis, RT of the target compound shall not differ more than ±0.05â•›min from the reference standard or ±0.01 relative retention time (RRT). In MS-MS analysis, two transitions from one precursor ion or from two precursors should be monitored. The relative intensity ratios of each ion should be within ±20% of the ratios observed in the reference standard, and the abundance of each ion should exceed a signal-to-noise ratio of 3:1. For LC-MS analysis, the apparatus should be capable of scanning 50–1200â•›amu in full-scan mode. RT of target compound shall not differ more than ±0.5â•›min from the reference standard or ±0.01 RRT. A minimum of three structurally specific ions, preferably including protonated or deprotonated molecule, meeting the signal-to-noise ratio 3:1 are required. Isotopic cluster ions may be used as one of three significant ions. The relative intensity © 2011 by Taylor and Francis Group, LLC

Quality Assurance of Identification with Chromatographic

63

ratios of each ion should be within ±20% of the ratios observed in the reference standard. In LC-MS/MS analysis, chromatographic requirements (RT or RRT) are the same as for LC-MS, whereas mass spectrometric requirements are identical as for GC-MS-MS. 3.4.3╇ European Commission Requirements The European Commission published in 2002 [67] lists requirements concerning performance of analytical methods and interpretation of results. In this document, performance criteria for mass spectrometric detection were formulated. It was stated that on-line or off-line chromatographic separation is a prerequisite for mass spectrometric confirmation. For both GC-MS and LC-MS, the minimum acceptable RT for the target compound should be at least twice the RT corresponding to the void volume of the column (i.e., the dead time, or Rto). The RRT of the analyte (ratio target:internal standard) should not differ from that of the reference standard more than ±0.5% for GC and ±2.5% for LC. Mass spectrometric detection shall be carried out in full-scan mode, SIM, as well as MS-MSn techniques such as SRM or other techniques in combination with appropriate ionization modes. For full-scan MS, the presence of minimum four diagnostic ions with relative intensity more than 10% in the reference spectrum is obligatory. The molecular ion should be included if its intensity is above 10%. For SIM, the molecular ion should be preferably included. The signal-tonoise ratio for each diagnostic ion shall be ≥3:1. Maximum permitted tolerances for relative ion intensities are as in the Table 3.2. For identification, EC defined identification points (IPs) system. In this system, at least four points are required for the confirmation of identity. The number of points earned by a particular technique is shown in the Table 3.3. According to these criteria, e.g., four characteristic ions are needed if GC-MS or LC-MS is applied, or one precursor and two products for GC-MS-MS or LC-MS-MS. Nielen et al. [58] proposed additional identification criteria to the four-point classification, based on HRMS (Table 3.4). The arbitrary IP system has been generally criticized by Lehotay et al. [11] for lack of appropriate scientific justification. These authors asked: For example, what are the differences in the rates of false positives and false negatives by requiring four IPs for banned substances over three IPs for registered compounds? Why should a high-resolution ion always be worth two points in the IP system, and MS2 ions always be worth 1.5, whereas the (pseudo)molecular ion is only worth 1? What is defined as “high” resolution? © 2011 by Taylor and Francis Group, LLC

64

Quality Assurance in the Pathology Laboratory

Table 3.2â•…Maximal Permitted Tolerances in Abundance Ratios in Comparison with the Standard Relative Intensity (% of Base Peak)

>50% >20%–50% >10%–20% ≤10%

EC [67]

EC [67]

CAP [70]

GC-EI-MS

GC-CI-MS, GC-MSn, LC-MS, LC-MSn ±20% ±25% ±30% ±50%

LC-MS

±10% ±15% ±10% ±50%

±20% ±25% ±30% ±50%

n

WADA [68] GC-EI-MS

±10% Absolute ±20% Relative ±5% Absolute

WADA [68] GC-CI-MS; GC-MSn LC-MS; LC-MSn ±10% Absolute ±25% Relative ±10% Absolute

Notes: FDA [5] used flat rate of permitted tolerances: within ±20% of relative abundance for MS scan and MSn SRM (three transitions) and ±10% for MS-SIM and MSn SRM (three transitions). PDP [9] used flat rate of ±20% of relative abundance (absolute difference) for all MS techniques. AORC [69] used flat rate of ±10% absolute or ±30% relative abundance (whichever is greater) for single-stage MS, and ±20% absolute or ±40% relative (whichever is greater) for MS-MS and related techniques. Table 3.3â•…IPs Earned by Various MS Techniques according to EC MS Technique LR-MS LR-MSn precursor ion LR-MSn product ion HR-MS HR-MSn precursor ion LR-MSn product ion

IPs Earned per Ion 1.0 1.0 1.5 2.0 2.0 2.5

Source: From EU Commission, Off. J. Eur. Comm., L221, 8, 2002. Note: LR-MS, low-resolution mass spectrometry; HR-MS, high-resolution mass spectrometry.

3.4.4╇WADA Criteria The WADA [68] formulated criteria that must be fulfilled in order to identify a prohibited, scheduled substance in urine or blood of an examined athlete with chromatographic–mass spectrometric procedures. These criteria are divided into separation and detection requirements and are as follows. © 2011 by Taylor and Francis Group, LLC

Quality Assurance of Identification with Chromatographic

65

Table 3.4â•… Proposal for Additional LC/MS Criteria to Be Implemented in EC Recommendations [67] Given by Nielen et al. [58] Mass Resolution (FWHM)

Mass Accuracy (mDa)

Screening Confirmation

10,000 ≥10,000

±50 (window) ≤5

HR confirmation

≥20,000

≤5

MS/MS identification of unknowns

≥10,000

≤5

Goal

Remarks Relative retention time ≤2.5% 1.5 identification points/ion or product ion; at least one ion ratio; relative retention time ≤2.5%; N.B.: LC/biogram: 1 additional identification point Two identification points/ion or product ion; at least one ion ratio; relative retention time ≤2.5% Confirm postulated structure by NMR and/or confirm accurate masses at mass resolution ≥70,000 (FWHM)

3.4.4.1  Chromatographic Separation Requirements For capillary GC, the RT of the analyte shall not differ by more than 1% or ±0.2â•›min (whichever is smaller) from that of the same substance in spiked urine sample. For HPLC, the RT of the analyte shall not differ by more than 2% or ±0.4â•›min (whichever is smaller) from that of the same substance in spiked urine sample. These criteria may be relaxed, if the shift in RT may be explained (e.g., by sample overload). 3.4.4.2  Mass Spectrometric Requirements 3.4.4.2.1╇ Full-Scan Modeâ•… Full-scan or partial-scan mode is the preferred approach to identification. A partial scan may begin at an m/z value greater than any abundant ion due to the derivatizing agent or chemical ionization reagent. All diagnostic ions with a relative abundance greater than 10% in the reference spectrum obtained from a reference material must be present in the spectrum of the unknown peak. The relative abundance of three diagnostic ions shall not differ by more than the defined amount (see Table 3.2) from the relative intensities of the same ions observed in the reference spectrum (obtained from spiked urine, reference collection sample, or reference material). It is not permissible to collect additional ions and select those ratios that are within defined tolerance. If the computer-based mass spectral library searching or matching is used, the results should be reviewed by a qualified scientist. If three diagnostic ions with a relative abundance greater than 5% are not available, a second derivative, yielding different diagnostic ions shall be © 2011 by Taylor and Francis Group, LLC

66

Quality Assurance in the Pathology Laboratory

prepared, or a second ionization or fragmentation technique, based on different physical principle shall be used. In any case, a minimum of two diagnostic ions is mandatory for each mass spectrum. 3.4.4.2.2╇ SIM Modeâ•… At least three diagnostic ions must be acquired, with the signal-to-noise ratio >3 for the least intense ion. The relative intensities of ions shall not differ by more than the defined amount (see Table 3.2) from the relative intensities of the same ions observed in the reference spectrum (obtained from spiked urine, reference collection sample, or reference material). For diagnostic ions with a relative abundance of less than 5% in the reference, the ion must be present in the unknown. The concentration of detected compound should be comparable with those in the reference sample. If three diagnostic ions are not available, a second derivative shall be prepared, or a second ionization or fragmentation technique, based on different physical principle shall be used. In any case, a minimum of two diagnostic ions is mandatory for each mass spectrum. 3.4.4.2.3╇ Tandem MS Detectionâ•… The data can be acquired either in fullscan or SRM mode. The precursor ion should be present in both modes. When monitoring more than one product ion, the relative intensities of any of the ions shall not differ by more than the amount given in the table from the relative intensities acquired from a spiked reference sample. The signalto-noise ratio for the least intense ion should be greater than 3. For a diagnostic ion with a relative abundance of less than 5% in the reference, the ion must be present in the unknown. 3.4.5╇AORC Criteria The AORC consists of individuals, not laboratories, and is limited to those concerned with the detection of drugs in racing animals. In 2003, AORC published “Guidelines for the Minimum Criteria for Identification by Chromatography and Mass Spectrometry” [69]. It was stated that gas chromatographic separation coupled to mass spectrometric detection can be sufficiently specific to be used alone as a confirmatory method. The analysis should follow specific injection sequence; negative control, system blank, test sample, system blank, and reference sample (reference material or positive control). The following requirements for chromatography and low-resolution MS were formulated. 3.4.5.1  Chromatography When a suitable internal standard was used, the RRT should not vary from that in the reference sample by more than ±1% for GC and ±2% for LC. The RT value should not vary more than ±1% or 6â•›s for GC and ±2% for LC. These figures concerned “conventional” GC and LC. If high-efficiency separation techniques © 2011 by Taylor and Francis Group, LLC

Quality Assurance of Identification with Chromatographic

67

were used, the laboratories should set appropriate criteria for the technique used. It must be noted, however, that capillary GC received already status of conventional method, whereas packed GC columns are hardly used nowadays. 3.4.5.2  Low-Resolution Mass Spectrometry A minimum of three ions is required for any full-scan technique. The ions selected should be a molecular ion, quasi-molecular ion of fragment ion whose presence and abundance are characteristic of the test substance. The molecular ion or quasi-molecular ion must be included, if it is present at relative abundance ≥5% in the test spectrum. For product-ion scan MS/MS, the selection of the precursor ion should be avoided. However, it may be included in the case of insufficient ions, provided its relative abundance is between 10% and 80% in the test spectrum. Further techniques or derivatizations may be used if a single technique produces less than three ions suitable for matching. The signal-to-noise ratio of any selected ion must be well above 3:1 in the single ion traces. Within the common mass range, all ions with relative abundance >10% that can be ascribed to the analyte and appearing in the reference spectrum must also be present in the test spectrum. The maximum permitted tolerances for the matching ions for single-stage MS was set at 10% absolute or 30% relative, whichever is greater, and for MS-MS at 20% absolute or 40% relative, whichever is greater. The presence of extraneous ions with m/z larger than 100 in the test spectrum should not exceed 20% relative abundance, unless it can be demonstrated to be extraneous using extracted ion chromatograms. In the case when SIM is used instead of full-scan analysis, a minimum of four ions should be selected for matching, and with stricter tolerances on their relative abundances than those required for full-scan techniques. 3.4.6╇ CAP Criteria The CAP in their “Chemistry and Toxicology Checklist” of the Laboratory Accreditation Program formulated requirements, relevant for identification with chromatographic–mass spectrometric methods [70]. In the case of single-stage GC-MS or LC-MS, the identification should be done on the base of ion ratios, using at least two ion ratios, whenever possible. Suggested tolerance limit for GC-MS is ±20% of those of calibrators, for LC-MS the limit is ±30%. If only one ratio of two characteristic ions is available, it may be acceptable if there are other identifying characteristics, e.g., RT. The internal standard should be identified with at least one ion ratio. If full-scan MS is used, the laboratory should set and validate its own threshold of “spectral match” or fit for identification purposes. For tandem MS (GC-MS-MS or LC-MS-MS) in SRM mode, at least one transition and one ion ratio should be monitored, together with RT. However, © 2011 by Taylor and Francis Group, LLC

68

Quality Assurance in the Pathology Laboratory

Table 3.5â•…Summary of Identification Requirements as Formulated by Various Organizations Parameter Method GC-MS/RT tolerance GC-MS/RRT tolerance LC-MS/RT tolerance LC-MS/RRT tolerance MS scan minimal number of ions MS SIM minimal number of ions MSn scan minimal number of ions MSn SRM number of transitions HRMS minimal number of ions Signal-to-noise threshold

FDA [5]

EC [67]

2%

WADA [68]

PD [9]

1% or 0.2′

0.05′

1%

0.01′

1% or 0.01′

0.5′

2%

0.1

2% or 0.02′

0.5% 5%

2% or 0.4′ 2.5%

CAP [70]

AORC [69]

3

4

3

3

3

3

3

4

3

3

3

4

3

4

3

3

2

2

2

2

2

3

3

3

3

2 3

3

3

if enough ions of sufficient abundance exist, two or more ion ratios should be monitored. Ion ratios determined from full-scan analysis are an acceptable identification method and should fulfill the same criteria as for SRM mode. Tolerance limits should be adequate to the method employed and should be supported by references or own data. In another approach, a twofold acceptance criteria of data is applied, for at least three ion ratios and scoring system according to EC requirements [64]. The tolerances of ion ratios differ according to the abundance of ions (see Table 3.2). Table 3.5 shows the summary of requirements as formulated by various organizations.

3.5╇ Closing Remarks The criteria of identification of compounds with chromatography-MS are certainly not chiseled in stone like the Ten Commandments. It is rather a moving target, changing its position in relation to actual knowledge, and continuously setting new requirements, which vary according to particular discipline and final task of the analysis. It is understandable that the strictest © 2011 by Taylor and Francis Group, LLC

Quality Assurance of Identification with Chromatographic

69

requirements are set in these areas, where the results of identification bring legal sanctions. For these reasons, several organizations issued more or less detailed conditions, recommendations, or guidelines, defining minimal attributes necessary for identification. These documents concern both chromatographic and mass spectrometric aspects of the analysis. There is general agreement concerning the kind of parameters to be controlled, e.g., RT, number of ions, or ion intensity ratios. However, the exact numerical criteria, formulated by different bodies or organizations, show distinct variations. This may lead to confusing situation, since the same result may be interpreted in different way. This was already criticized by de Zeeuw [10] who stated: “It cannot be that one and the same test result may lead to positive identification when using Guideline A and a negative identification when using Guideline B.” The same problem has been raised by van Eenoo and Delbeke [74], who compared the regulations concerning mass spectrometric identification in doping and residue analysis and found differences, which may lead to different interpretation of the same result. Moreover, they observed that none of organizations involved have defined a minimum scan range for full-scan MS. According to the authors, it seems illogical that different sets of criteria exist for fields of analysis that are so close related. More recently, Faber [75] discussed the inconsistencies between and within various recommendations concerning residue and doping analysis. Such lack of internal consistency in criteria for acceptable variability of ion abundance ratios (as depicted in Table 3.2) causes paradoxical situation, as shown in the Figure 3.3. Faber [75] proposed a statistics-based interpretation of results, based on characterization of uncertainty in the measurement result.

10 abs

25 rel

15 abs

Tolerance ()

15 12.5 10 6.25

0

25

50

75

100

Relative abundance ()

Figure 3.3╇ WADA tolerance as a function of relative abundance ratio for MS-MS

analysis results. (From Faber, N.M., Accred. Qual. Assur., 14, 111, 2009. With permission.)

© 2011 by Taylor and Francis Group, LLC

70

Quality Assurance in the Pathology Laboratory

All valid recommendations, which are products of common knowledge in given discipline, should be treated as momentary, frozen picture of the present situation on the field of analytical identification. As Hill wrote: “Regulatory guidances are not a substitute for good science, they do however provide a framework that should initiate the questions why and how” [73]. It will be always the final task of the expert involved in identification to answer the question: “Did I identify this compound according to the best available knowledge?” besides the question: “Did I fulfill all formal conditions, necessary for identification?” At this point, professional ethics meets the professional competence.

References 1. http://www.thefreedictionary.com/identification (accessed March 3, 2009). 2. http://en.wikipedia.org/wiki/Identification_(information) (accessed March 3, 2009). 3. http://wordreference.com/definition/identification (accessed March 3, 2009). 4. de Zeeuw R.A. and Franke J.P. 2000. General unknown analysis. In: Forensic Science: Handbook of Analytical Separations, vol. 2. M.J. Bogusz, ed. Amsterdam, the Netherlands: Elsevier Science, pp. 567–599. 5. Guidance for Industry. 2003. Mass spectrometry for confirmation of the identity of animal drug residues. U.S. Department of Health and Human Services. Food and Drug Administration, Center for Veterinary Medicine, Laurel, MD, May 1. Available at: http://www.fda.gov/downloads/AnimalVeterinary/ GuidanceComplianceEnforcement/GuidanceforIndustry/UCM052658.pdf 6. Segura J., Ventura R., Marcos J., and Gallego R.G. 2008. Doping substances in human and animal sport. In: Forensic Science: Handbook of Analytical Separations, 2nd edn., vol. 6. M.J. Bogusz, ed. Amsterdam, the Netherlands: Elsevier Science, pp. 699–744. 7. Ho E.N.M., Wan T.S.M., Wong A.S.Y., Lam K.H.K., and Stewart B.D. 2008. Doping control analysis of insulin and its analogues in equine plasma by liquid chromatography-tandem mass spectrometry. J. Chromatogr. A 1201: 183–190. 8. Stanley S.M.R., Wee W.K., Lim B.H., and Foo H.C. 2007. Direct-injection screening for acidic drugs in plasma and neutral drugs in equine urine by differentialgradient LC–LC coupled MS/MS. J. Chromatogr. B 848: 292–302. 9. U.S. Department of Agriculture. 2007. Agriculture Marketing Service, Science & Technology, Pesticide Data Program, January 1. Available at: http://www.ams. usda.gov/AMSv1.0/getfile?dDocName=STELPRDC5061501 10. de Zeeuw R.A. 2004. Substance identification: The weak link in analytical toxicology. J. Chromatogr. B 811: 3–12. 11. Lehotay S.L., Mastovska K., Amirav A., Fialkov A.B., Alon T., Martos P.A., de Kok A., and Fernandez-Alba A. 2008. Identification and confirmation of chemical residues in food by chromatography-mass spectrometry and other techniques. Trends Anal. Chem. 27: 1070–1090. 12. Bethem R., Boison J., Gale J., Heller D., Lehotay S., Loo J., Musser S., Proce P., and Stein S. 2003. Establishing the fitness for purpose of mass spectrometric methods. J. Am. Soc. Mass Spectrom. 14: 528–541. © 2011 by Taylor and Francis Group, LLC

Quality Assurance of Identification with Chromatographic

71

13. Maurer H.H., Pfleger K., and Weber A. 2007. Mass Spectral Library of Drugs, Poisons, Pesticides, Pollutants, and their Metabolites. Weinheim, Germany: Wiley-VCH. 14. McLafferty F.W. 2001. Registry of Mass Spectral Data, 7th edn. New York: Wiley. 15. US Department of Commerce. 2005. NIST/EPA/NIH Mass Spectral Library. New York: Wiley. 16. Rivier L. 2003. Criteria for the identification of compounds by liquid chromatography-mass spectrometry and liquid chromatography-multiple mass spectrometry in forensic and doping analysis. Anal. Chim. Acta 492: 69–82. 17. Rivier L. 2006. Identification and confirmation criteria for LC-MS. In: Applications of LC-MS in Toxicology, A. Polettini, ed. London, U.K.: Pharmaceutical Press, pp. 97–109. 18. Stimpfl T., Demuth W., Varmuza K., and Vycudilik W. 2003. Systematic toxicological analysis: Computer-assisted Identification of poisons in biological materials. J. Chromatogr. B 789: 3–7. 19. Bogusz M.J., Maier R.D., Kruger K.D., Webb K.S., Romeril J., and Miller M.L. 1999. Poor reproducibility of in-source collisional atmospheric pressure ionization mass spectra of toxicologically relevant drugs. J. Chromatogr. A 844: 409–418. 20. Weinmann W., Wiedemann A., Eppinger B., Renz M., and Svoboda M. 1999. Screening for drugs in serum by electrospray ionization/collision-induced dissociation and library searching. J. Am. Soc. Mass Spectrom. 10: 1028–1037. 21. Saint-Marcoux F., Lachatre G., and Marquet P. 2003. Evaluation of an improved general unknown screening procedure using liquid chromatography-electrospray mass spectrometry and high performance liquid chromatography-diode array detection. J. Am. Soc. Mass Spectrom. 14: 14–22. 22. Weinmann W., Gergov M., and Goerner M. 2000. MS/MS libraries with Â�triple-quadrupole tandem mass spectrometers for drug identification and drug screening. Analysis 28: 934–941. 23. Marquet P., Saint-Marcoux F., Gamble T.N., and Leblanc L.J. 2003. Comparison of a preliminary procedure for the general unknown screening of drugs and toxic compounds using a quadrupole-linear ion-trap mass spectrometry with a liquid chromatography-mass spectrometry reference technique. J. Chromatogr. B 789: 9–18. 24. Gergov M., Boucher G.B., Ojanpera I., and Vuori E. 2001. Toxicological screening of urine for drugs by liquid chromatography/time-of-flight mass spectrometry with automated library search based on elemental formulas. Rapid Commun. Mass Spectrom. 15: 521–526. 25. Decaestecker T.N., Vande Casteele S.R., Wallemacq P.E., van Peteghem C.H., Defore D.L., and van Bocxlaer J.F. 2004. Information-dependent acquisitionmediated LC-MS/MS screening procedure with semiquantitative potential. Anal. Chem. 76: 6365–6373. 26. Nielen M.W., Bovee T.F., van Engelen M.C., Rutgers P., Hamers A.R., van Rhijn J.A., and Hoogenboom L.A. 2006. Urine testing for designer steroids by liquid chromatography with androgen bioassay detection and electrospray quadrupole time-of-flight mass spectrometry identification. Anal. Chem. 78: 424–431. 27. Gergov M. 2008. Forensic screening with liquid chromatography-mass spectrometry. In: Forensic Science: Handbook on Analytical Separations, vol. 6. M.J. Bogusz, ed. Amsterdam, the Netherlands: Elsevier Science, pp. 491–511. © 2011 by Taylor and Francis Group, LLC

72

Quality Assurance in the Pathology Laboratory

28. Marquet P. 2006. Identification and confirmation criteria for LC-MS. In: Applications of LC-MS in Toxicology, A. Polettini, ed. London, U.K.: Pharmaceutical Press, pp. 111–130. 29. van Thuyne W., van Eenoo P., and Delbeke F.T. 2007. Comprehensive screening method for the qualitative detection of narcotics and stimulants using single step derivatization. J. Chromatogr. B 857: 259–265. 30. Thevis M. and Schänzer W. 2005. Examples of doping control analysis by liquid chromatography-tandem mass spectrometry: Ephedrines, beta-receptor blocking agents, diuretics, sympaticomimetics, and cross-linked hemoglobins. J. Chromatogr. Sci. 43: 22–31. 31. Georgakopoulos C.G., Vonaparti A., Stamou M., Kiousi P., Lyris E., Angelis Y.S., Tsoupras G., Wuest B., Nielen M.W., Panderi I., and Koupparis M. 2007. Preventive doping control analysis: Liquid and gas chromatography time-offlight mass spectrometry for detection of designer steroids. Rapid Commun. Mass Spectrom. 21: 2439–2446. 32. van der Lee M.K., van der Weg G., Trang W.A., and Mol H.G. 2008. Qualitative screening and quantitative determination of pesticides and contaminants in animal feed using comprehensive two-dimensional gas chromatography with time-of-flight mass spectrometry. J. Chromatogr. A 1186: 325–339. 33. Hough J.M., Haney C.A., and Voyksner R.D. 2000. Evaluation of electrospray transport CID for the generation of searchable libraries. Anal. Chem. 72: 2265–2270. 34. Venisse N., Marquet P., Duchoslav E., Dupuy J.L., and Lachâtre G. 2003. A general unknown screening procedure for drugs and toxic compounds in serum using liquid chromatography-electrospray-single quadrupole mass spectrometry. J. Anal. Toxicol. 27: 7–14. 35. Bristow A.W., Nichols W.F., Webb K.S., and Conway B. 2002. Evaluation of protocols for reproducible electrospray in-source collisionally induced dissociation on various liquid chromatography/mass spectrometry instruments and the development of spectral libraries. Rapid Commun. Mass Spectrom. 16: 2374–2386. 36. Bogusz M.J., Hassan H., Al-Enazi E., Ibrahim Z., and Al-Tufail M. 2004. Rapid determination of chloramphenicol and its glucuronide in food products by liquid chromatography–electrospray negative ionization tandem mass spectrometry. J. Chromatogr. B 807: 343–356. 37. Mottier P., Parisod V., Gremaud E., Guy P.A., and Stadler R.H. 2003. Determination of the antibiotic chloramphenicol in meat and seafood products by liquid chromatography–electrospray ionization tandem mass spectrometry. J. Chromatogr. B 994: 75–84. 38. Drummer O.H. 2007. Requirements for bioanalytical procedures in postmortem toxicology. Anal. Bioanal. Chem. 188: 1495–1503. 39. Stimpfl T. 2006. General Unknown Screening Using GC-MS. In: The Encyclopedia of Mass Spectrometry: Hyphenated Methods, vol. 8, W.M.A. Niessen, ed. Amsterdam, the Netherlands: Elsevier, pp. 846–852. 40. Stimpfl T. and Vycudilik W. 2004. Automatic screening in postmortem toxicology. Forensic Sci. Int. 142: 115–127. 41. Maurer H.H. 2006. Hyphenated mass spectrometric techniques—Indispensable tools in clinical and forensic toxicology and in doping control. J. Mass Spectrom. 41: 1399–1413. © 2011 by Taylor and Francis Group, LLC

Quality Assurance of Identification with Chromatographic

73

42. Maurer H.H. and Peters F.T. 2006. Analyte identification using library searching in GC-MS and LC-MS. In: The Encyclopedia of Mass Spectrometry: Hyphenated Methods, vol. 8. W.M.A. Niessen, ed. Amsterdam, the Netherlands: Elsevier, pp. 115–121. 43. Maurer H.H. 2008. Forensic screening with GC-MS. In: Forensic Science: Handbook on Analytical Separations, vol. 6. M.J. Bogusz, ed. Amsterdam, the Netherlands: Elsevier, pp. 425–445. 44. Drummer O.H. 1999.Chromatographic screening techniques in systematic toxicological analysis. J. Chromatogr. B 733: 27–45. 45. Pontes M., Marques J.C., and Câmara J.S. 2007. Screening of volatile composition from Portuguese multifloral honeys using headspace solid-phase microextraction-gas chromatography-quadrupole mass spectrometry. Talanta 74: 91–103. 46. Buszewski B., Ulanowska A., Ligor T., Jackowski M., Kłodziñska E., and Szeliga J. 2008. Identification of volatile organic compounds secreted from cancer tissues and bacterial cultures. J. Chromatogr. B 868: 88–94. 47. Hernandez F., Portolés T., Pitarch E., and López F.J. 2007. Target and nontarget screening of organic micropollutants in water by solid-phase microextraction combined with gas chromatography/high-resolution time-of-flight mass spectrometry. Anal. Chem. 79: 9494–9504. 48. Brown S.D., Rhodes D.J., and Pritchard B.J. 2007. A validated SPME-GC-MS method for simultaneous quantification of club drugs in human urine. Forensic Sci. Int. 171: 142–150. 49. Banerjee K., Patil S.H., Dasgupta S., Oulkar D.P., Patil S.B., Savant R., and Adsule P.G. 2008. Optimization of separation and detection conditions for the multiresidue analysis of pesticides in grapes by comprehensive two-dimensional gas chromatography-time-of-flight mass spectrometry. J. Chromatogr. A 1190: 350–357. 50. Hoh E., Lehotay S.J., Mastovska K., and Huwe J.K. 2008. Evaluation of automated direct sample introduction with comprehensive two-dimensional gas chromatography/time-of-flight mass spectrometry for the screening analysis of dioxins in fish oil. J. Chromatogr. A 1201: 69–77. 51. Kolbrich E.A., Lowe R.H., and Huestis M.A. 2008. Two-dimensional gas chromatography/electron-impact mass spectrometry with cryofocusing for simultaneous quantification of MDMA, MDA, HMMA, HMA, and MDEA in human plasma. Clin. Chem. 54: 379–387. 52. Ventura R., Roig M., Montfort N., Sáez P., Bergés R., and Segura J. 2008. Highthroughput and sensitive screening by ultra-performance liquid chromatography tandem mass spectrometry of diuretics and other doping agents. Eur. J. Mass Spectrom. 14: 191–200. 53. Thörngren J.O., Ostervall F., and Garle M. 2008. A high-throughput multicomponent screening method for diuretics, masking agents, central nervous system (CNS) stimulants and opiates in human urine by UPLC-MS/MS. J. Mass Spectrom. 43: 980–992. 54. Taylor M.J., Keenan G.A., Reid K.B., and Fernández D.U. 2008. The utility of ultra-performance liquid chromatography/electrospray ionization time-offlight mass spectrometry for multi-residue determination of pesticides in strawberry. Rapid Commun. Mass Spectrom. 22: 2731–2746. © 2011 by Taylor and Francis Group, LLC

74

Quality Assurance in the Pathology Laboratory

55. Romero-González R., Garrido Frenich A., and Martinez Vidal J.L. 2008. Multiresidue method for fast determination of pesticides in fruit juices by ultra performance liquid chromatography coupled to tandem mass spectrometry. Talanta 76: 211–225. 56. Niessen W.M.A. 2006. High-Resolution Mass Spectrometry and Accurate Mass Determination. In: The Encyclopedia of Mass Spectrometry: Hyphenated Methods, vol. 8. W.M.A. Niessen, ed. Amsterdam, the Netherlands: Elsevier, pp. 27–36. 57. Thurman E.M., and Ferrer I. 2006. Identification of unknown environmental contaminants using multidimensional LC-MS strategies involving TOF-MS, ion-trap MSn, and Q-TOF-MS-MS. In The Encyclopedia of Mass Spectrometry, vol. 8, Hyphenated Methods, ed. W.M.A. Niessen. Amsterdam, the Netherlands: Elsevier, pp. 587–603. 58. Nielen M.W.F., van Engelen M.C., Zuiderent R., and Ramaker R. 2007. Screening and confirmation criteria for hormone residue analysis using liquid chromatography accurate mass time-of-flight, Fourier transform ion cyclotron resonance and orbitrap mass spectrometry techniques. Anal. Chim. Acta 586: 122–129. 59. Drees J.C., Sasaki T.A., Stone J.A., Chen K.H., and Wu A.H. 2007. The advantages and limitations of MRM vs. full scan MS/MS for drug confirmation using LC/MS/MS. Poster K35 on the 55th Conference of American Society of Mass Spectrometry, Indianapolis, IN. 60. http://www.thermoscientific.com/wps/portal/ts/products/detail?productId=119 61722&groupType=PRODUCT&searchType=0 (accessed July 2, 2010). 61. Thevis M., Schrader Y., Thomas A., Sigmund G., Geyer H., and Schänzer W. 2008. Analysis of confiscated black market drugs using chromatographic and mass spectrometric approaches. J. Anal. Toxicol. 32: 232–240. 62. Feng J., Wang L., Dai I., Harmon T., and Bernert J.T. 2007. Simultaneous determination of multiple drugs of abuse and relevant metabolites inn urine by LC-MS-MS. J. Anal. Toxicol. 31: 359–368. 63. Concheiro M., De Castro A., Quintela O., Cruz A., and López-Rivadulla M. 2007. Determination of illicit drugs and their metabolites in human urine by liquid chromatography tandem mass spectrometry including relative ion intensity criterion. J. Anal. Toxicol. 31: 573–580. 64. Stein S.E. and Heller D.N. 2006. On the risk of false positive identification using multiple ion monitoring in qualitative mass spectrometry: Large-scale intercomparisons with a comprehensive mass spectral library. J. Am. Soc. Mass Spectrom. 17: 823–835. 65. Department of Health and Human Services, Health Care Financing Administration, Public Health Service, 42 CFR, Part 405, 1992. Clinical Laboratory Improvement Amendments of 1988; Final Rule. Federal Register 57, No. 40, 967–1087. Available at: http://www.cms.hhs.gov/CLIA 66. Department of Health and Human Services, Substance Abuse and Mental Health Services Administration. 2004. Mandatory Guidelines and Proposed Revisions to Mandatory Guidelines for Federal Workplace Drug Testing Programs. Federal Register 69, No. 71, 19644–19732. Available at: http://workplace.samsha.gov 67. EU Commission. 2002. Commission Decision of 12 August 2002 implementing Council Directive 96/23/EC concerning the performance of analytical methods and the interpretation of results. Off. J. Eur. Comm. L221: 8–34. © 2011 by Taylor and Francis Group, LLC

Quality Assurance of Identification with Chromatographic

75

68. World Anti-Doping Agency (WADA). 2004. Identification criteria for qualitative assays incorporating chromatography and mass spectrometry. WADA Technical Document TD2003IDCR, pp. 1–5. 69. Association of Official Racing Chemists. 2003. AORC guidelines for the minimum criteria for identification by chromatography and mass spectrometry, Storrs Mansfield, CT. Available at: http://cobra.vdl.iastate.edu/aorc-2/ AORC%20MS%20Criteria.pdf 70. College of American Pathologists. Commission on Laboratory Accreditation. Laboratory Accreditation Program. Chemistry and toxicology checklist, 2006, pp. 57–59. 71. Society of Forensic Toxicologists. SOFT/AAFS Forensic Toxicology Laboratory Guidelines, 2006, pp. 1–24. Available at: http://www.soft-tox.org/?pn=publicatio ns&sp=Laboratory_Guidelines 72. German Society of Toxicological and Forensic Chemistry. 1998. Anlage zu den Richtlinien der GTFCh zur Qualitätssicherung bei forensisch-toxikologischen Untersuchungen. Toxichem. Krimtech. 65: 18–24. http://www.gtfch.org/tk/ tk67_1/akqual.pdf GTFCh (71) 73. Hill H.M. 2003. Chromatography in a regulated environment. In: Bioanalytical Separations: Handbook of Analytical Separations, vol. 4. I.D. Wilson, ed. Amsterdam, the Netherlands: Elsevier Science, pp. 373–409. 74. van Eenoo P. and Delbeke F.T. 2004. Criteria in chromatography and mass spectrometry—A comparison between regulations in the field of residue and doping analysis. Chromatographia 59: 39–44. 75. Faber N.M. 2009. Regulations in the field of residue and doping analysis should ensure the risk of false positive declaration is well-defined. Accred. Qual. Assur. 14: 111–115.

© 2011 by Taylor and Francis Group, LLC

Quality Assurance of Quantification Using Chromatographic Methods with Linear Relation between Dose and Detector Response

4

Georg Schmitt and Rolf Aderjan

Contents 4.1 4.2 4.3 4.4

Introduction The PDCA Cycle Calibration Laboratories Method Validation 4.4.1 Selectivity 4.4.2 Calibration Model 4.4.3 Precision 4.4.4 Bias 4.4.5 Limit of Detection 4.4.6 The Lower Limit of Quantification 4.4.7 Statistical Process Control 4.4.8 Measurement Uncertainty 4.4.8.1 Horwitz Equation 4.4.8.2 Reporting of Uncertainty 4.4.8.3 Compliance against Limits 4.5 Practical Examples (Forensic Toxicology) 4.6 Proficiency Testing Schemes References

77 78 79 79 79 80 80 80 81 81 81 82 86 86 87 87 89 89

4.1╇Introduction Quality assurance (QA) is an objective assessment of a laboratory’s capability and commitment to produce repeatable, defendable, and accurate data. QA includes regulation of the quality of raw materials, assemblies, products, and © 2011 by Taylor and Francis Group, LLC

77

78

Quality Assurance in the Pathology Laboratory

components; services related to production; and management, production, and inspection processes. Two key principles characterize QA: “fit for purpose” and “right at the first time.” It is important to realize also that quality is determined by the intended users. However, a considerable part of users of results of quantitative measurements may be unaware of the necessary quality measures behind reported results. This is particularly important in forensic issues, at court and in jurisdiction, where not only forensic medical experts but also analytical laymen rely on reported results, which need to be correct, objective, and reproducible by any other lab working with comparable methods and standards. Therefore, internationally accepted standards must anticipate forensic analytical quality needs. To achieve these objectives, international standards should be used. Reliable analytical methods are required for compliance with national and international regulations in all areas of analysis. According to the “harmonized guidelines for singlelaboratory validation of methods of analysis” (IUPAC technical report), a laboratory must take appropriate measures to ensure that it is capable of providing and does provide data of the required quality [1]. Appropriate measures for QA should be • • • •

Using validated methods of analysis Using internal quality control (QC) procedures Participating in proficiency testing schemes Becoming accredited to an International Standard (ISO/IEC 17025 includes the points above)

4.2╇ The PDCA Cycle The most popular tool used to determine QA is the plan-do-check-adjust cycle, commonly abbreviated as PDCA (Figure 4.1). The four-step model is part of the ISO 27001, which specifies a set of requirements for the establishment, implementation, monitoring and review, maintenance, and improvement of an information security management system (ISMS). Just as a circle has no end, the PDCA cycle should be repeated again and again for continuous improvement [2]: Plan Act

Do Check

Figure 4.1╇ PDCA model. © 2011 by Taylor and Francis Group, LLC

Quality Assurance of Quantification

79

Plan Establish ISMS policy, objectives, processes, and procedures relevant to managing risk and improving information security to deliver results in accordance with an organization’s overall policies and objectives. Do Implement and operate the ISMS policy, controls, processes, and procedures. Check Assess and, where applicable, measure process performance against ISMS policy, objectives, and practical experience, and report the results to management for review. Adjust Take corrective and preventive actions, based on the results of the internal ISMS audit and management review or other relevant information, to achieve continual improvement of the ISMS. The PDCA is part of the QA of calibration laboratories and also used in the statistical process control.

4.3╇ Calibration Laboratories For calibration laboratories, the ISO 17025 is the main standard. This norm provides the structure using the industry standard ISO 9001 approach. It embraces trusted methods and frameworks to help provide a stable quality environment. This includes also the principles of the PDCA and validated methods [3].

4.4╇Method Validation Validation of methods is an integral part of QA to demonstrate the applicability for the intended use. According to IUPAC technical report, typical performance characteristics of analytical methods are applicability, selectivity, calibration, trueness, precision, recovery, operating range, limit of quantification, limit of detection, sensitivity, and ruggedness. Additional parameters may be relevant for particular analytical purpose. Bioanalytical methods in clinical and forensic toxicology are used for identification and determination of drugs and poisons in biological fluids or tissues. For quantitative bioanalytical procedures, at least the following validation parameters should be evaluated [1,4]: selectivity, calibration model, precision, bias, limit of detection, the lower limit of quantification (LLOQ), statistical process control, and measurement uncertainty. These parameters will be discussed in turn. 4.4.1╇Selectivity According to IUPAC technical report, selectivity was defined as “the degree to which a method can quantify the analyte accurately in the presence of © 2011 by Taylor and Francis Group, LLC

80

Quality Assurance in the Pathology Laboratory

interferents. Ideally, selectivity should be evaluated for any important interferent likely to be present.” Method: Analysis of at least six sources of blank matrix. Analysis of one to two zero samples (blank matrix with internal standard). Acceptance criteria: Absence of interfering signals. 4.4.2╇ Calibration Model The choice of an appropriate calibration model is necessary for the quantification process. For the decision, the concentrations of an analyte are plotted against the measured values obtained from an analytical device. Usually, the linear model will be preferred because it can be easily calculated. Analytical devices whose responses are not linear can also be described by nonlinear models. In special cases, standard addition was applied to solve matrix problems. Therefore, the sample was split into aliquots and spiked with analyte [5]. Method: Analysis of at least four to five concentration levels spaced over the concentration range of interest (IUPAC technical report demands six concentration levels). The highest calibration standard defines also the upper limit of quantification (ULOQ). Acceptance criteria: Statistical test of model fit and acceptable accuracy and precision data. 4.4.3╇ Precision Precision can be the “within-laboratory reproducibility, where operator and/ or equipment and/or time and/or calibration can be varied, but in the same laboratory.” It is usually specified as standard deviation (SD). Method: Analysis of five to six replicates per level under repeatability conditions. Control samples at low and high concentrations relative to calibration range. Acceptance criteria: Relative standard deviation (RSD) within ±15% (±20% near LLOQ). 4.4.4╇Bias The bias is usually specified as deviation from the reference value or the “difference between mean measured value from a large series of test results and an accepted reference value (a certified or nominal value).” Method: Analysis of certified reference material (CRM) instead of control samples (can be carried out with the validation of the precision in one experiment, see above). Acceptance criteria: Bias within ±15% of nominal value (±20% near LLOQ). © 2011 by Taylor and Francis Group, LLC

Quality Assurance of Quantification

81

4.4.5╇Limit of Detection The limit of detection (LOD) is the smallest amount or concentration of an analyte that can be reliably distinguished from zero. Depending on the intended use, it must not be part of the validation procedure. For practical use, the LOD can be determined with a simple procedure. The values for this “practical” LOD were greater than the possible “instrumental” LOD. Method: Analysis of the LOD using spiked samples with decreasing concentrations of the analyte. Acceptance criteria: Checking for compliance with identification criteria or a signal-to-noise ratio (SNR) ≥3. Alternative: The statistical approach using data of the calibration function is also possible and part of the ISO 11843 [6,7]. With the assumption of homogeneous variances, the concentration of the prediction interval at zero was calculated. With this approach, the LOD is defined as a 50% probability of the analyte being present or not present and based on an accepted probability for a false-positive decision. The probability of false-positive results declines with higher concentrations. 4.4.6╇ The Lower Limit of Quantification The LLOQ defines the concentration below which the analytical method cannot operate with an acceptable precision. Method: Control samples with an analyte concentration near the LOQ. Alternatively, analysis of spiked samples with decreasing concentrations of the analyte. Acceptance criteria: Compliance with accuracy and precision data of control samples near LLOQ or a SNR ≥ 10. Alternative: The statistical approach using data of the calibration function is also possible (see description for LOD). The LLOQ refers to the minimum quantity, which can be determined with both defined probability level and acceptable relative uncertainty. Using the formulas of the ISO 8466, it is possible to calculate the measurement uncertainty of analytical results (only considering the calibration process) [8,9]. 4.4.7╇Statistical Process Control For the control of precision and accuracy statistical process control charts, also known as Shewhart charting system can be used. A control chart helps to distinguish between statistical and unusual variation in a process. Normally, a control chart is divided into several, at least three, zones (the upper control limit [UCL], the centre line, and the lower control limit [LCL]). Then, data points representing measurements from the process at different times will be inserted [19]. © 2011 by Taylor and Francis Group, LLC

82

Quality Assurance in the Pathology Laboratory Concentration

+3s

99.73 %

95.44 %

+2s X –2s –3s

UCL Centre line

LCL

Time

Figure 4.2╇ Control chart.

Normally, the data points fluctuate within the 3-sigma limits with a level of confidence of greater than 99% (Figure 4.2). 4.4.8╇Measurement Uncertainty The measurement uncertainty (MU) defines the range of the values that could reasonably be attributed to the measured quantity. MU is defined in metrological terminology as “parameter, associated with the result of a measurement, that characterizes the dispersion of the values that could reasonably be attributed to the measurand.” An alternative definition is given in the ISO 3534 as “an estimate attached to a test result, which characterizes the range of values within which the true value is asserted to lie.” This definition seems to be easier to explain but has the disadvantage that the true value itself can never be known and this generally requires further explanations [10]. For the estimation of the MU, the Guide to the Expression of Uncertainty in Measurement (GUM) established the following steps [11]:

1. Define the measurand. 2. Build the model equation. 3. Identify the sources of uncertainty. 4. If necessary, modify the model. 5. Evaluate the input quantities and calculate the value of the result. 6. Estimate the standard uncertainty of input quantities. 7. Calculate the combined standard uncertainty of the result. 8. Present the result (as standard or expanded uncertainty). 9. Analyze the uncertainty contributions.

© 2011 by Taylor and Francis Group, LLC

Quality Assurance of Quantification

Step 1

Step 2

Step 3

83

Specify measurand Convert components to standard deviations

Identify uncertainty sources

Calculate combined standard uncertainty

Simplify by grouping sources covered by existing data

Step 4

Review and if necessary re evaluate large components

Quantify grouped components

Calculate expanded uncertainty

Quantify remaining components

Figure 4.3╇ Summarizing the uncertainty estimation.

This rule was interpreted for analytical chemistry by EURACHEM [12] (Figure 4.3). When all uncertainty components are known, the combined uncertainty can be calculated. Uncertainty components, which are less than one-third of the largest, need not be evaluated in detail. The EURACHEM/CITAC guide is a “Bottom-Up” approach in which the measurand and the input quantities upon which it depends were involved: Step 1: Specify measurand The measurand should be given in the relevant standard operating procedure or other method description. Step 2: Identify uncertainty sources When estimating uncertainty, all relevant uncertainty sources have to be taken into account. The sources can be shown using a “cause and effect” diagram, commonly called fish-bone diagram (Figure 4.4). This kind of diagram identifies many possible causes for an effect. Step 3: Quantify uncertainty components This step includes the estimation or determination of single contributions to uncertainty associated with a number of separate sources. Each individual standard uncertainty component can be expressed as SD using © 2011 by Taylor and Francis Group, LLC

ui = SDi

84

Quality Assurance in the Pathology Laboratory RSD Reproducibility within laboratory Sample

Value

Cref Uncertainty of the nominal/certified value RMSbias Method and lab bias (reference material, interlab comparison, validation)

Figure 4.4╇ Measurement uncertainty model (fish-bone diagram).

The number of observations (n) from which the SD is calculated should be 30 or more. Step 4: Calculate combined uncertainty The combined uncertainty is determined by the Gaussian “error propagation law” using the following formula:

u = u12 + u22 + u32 + 

The information obtained gives a level of confidence of approximately 68%. The expanded uncertainty is calculated from the combined uncertainty using the formula

U = k ⋅u

where U is the expanded uncertainty u is the combined uncertainty k is the coverage factor Using k = 2 or k = 3, the level of confidence is approximately 95% or 99.7%. For small observations (nâ•›<â•›30), the confidence level of the student distribution “t” (two tailed), factor for nâ•›−â•›1 degrees of freedom is recommended as coverage factor. Beside the “bottom-up” approach using a model equation and considering all individual uncertainty contributions, a simple “top-down” method is possible if accuracy and precision have the largest contributions to the combined uncertainty. © 2011 by Taylor and Francis Group, LLC

Quality Assurance of Quantification

85

According to IUPAC technical report [1], “calibration errors are usually (but not always) a minor component of the total uncertainty budget and can usually be safely subsumed into various categories estimated by top-down methods.” The “top-down” concept is used by the Nordtest technical report for bioanalytical methods [13,14]. In this practical approach, a quantified breakdown of the major sources of uncertainty can be done by the combination of precision data of reference material in combination with the deductible contributions of the trueness estimated by proficiency test results. The uncertainty can also be estimated by means of measuring of certified reference material, if no proficiency test results are available (Figure 4.4). The combined uncertainty can be estimated using the following formula:

u = (RMSbias)2 + u(Cref )2 + u(RSDPC )2

with



∑

RMSbias =

 ( bias )   100 ⋅  SW  

2

m

and

u ( Cref ) =

 

∑100 ⋅ SW



SDPT

 m 

p

and

u(RSDPC ) = 100 ⋅

SDPC MV

where Bias is the difference between mean measured value from a large series of test results and an accepted reference value K is the coverage factor M is the number of proficiency tests P is the participation laboratories in the proficiency tests (mean value) MV is the mean value RMSbias is the root mean square of the bias SDPC is the standard deviation determined with a control sample over certain period of time (within-laboratory standard deviation) © 2011 by Taylor and Francis Group, LLC

86

Quality Assurance in the Pathology Laboratory Horwitz equation

50

RSD, 

40 30 20 10

0

100

200

ng/mL

300

400

500

Figure 4.5╇ The Horwitz “trumpet.”

SDPT is the standard deviation determined in the proficiency test TV is the target value determined in the proficiency test U(Cref) is the uncertainty component from the certified or nominal value u(RSDPC) is the uncertainty component of a control sample over a certain period of time U is the combined uncertainty 4.4.8.1  Horwitz Equation The Horwitz equation describes the relationship between the predicted RSD among laboratories and the concentration c, expressed in mass/mass units (e.g., 1â•›μg/g, c = 10−6 g/g) using the following formula (Figure 4.5) [15,16]:

RSD = 2(1−0.5⋅logc )

The Horwitz equation was derived from 150 independent surveys including different analytes, different concentration ranges, and five different analytical methods (chromatography, AAS, spectrometry, polarography, and bioassay). Therefore, the result should be independent of the analyte, the applied method, and the conditions of the sample. Therefore, the result can be used as a fitness-for-purpose criterion in analytical chemistry and to establish limits for proficiency testing schemes. 4.4.8.2  Reporting of Uncertainty Measurement uncertainty is also an important part of the reported result. According to the ISO 17025, the MU must be reported, if this is demanded by a client or is otherwise of importance. The result should be stated together with the expanded uncertainty U. The following form is recommended: © 2011 by Taylor and Francis Group, LLC

Result ± U (units)

Quality Assurance of Quantification

87

Concentration Result minus uncertainty above limit

Result above limit but limit within uncertainty

Control limit

Result below limit but limit within uncertainty Result plus uncertainty below limit

Figure 4.6╇ Uncertainty and compliance limits.

where U is the expanded measurement uncertainty, using a coverage factor kâ•›=â•›2, providing a level of confidence of approximately 95% or kâ•›=â•›3, providing a level of confidence of greater than 99%. 4.4.8.3  Compliance against Limits Assuming that limits were set with no allowance for uncertainty, four situations are apparent for the case of compliance with an upper limit (see Figure 4.6): Case 1. The result ±U (expanded uncertainty) exceeds the control limit. Case 2. The result is above the control limit but the result −U is below the limit. Case 3. The result is below the control limit but the result +U is above the limit. Case 4. The result ±U is below the control limit.

4.5╇ Practical Examples (Forensic Toxicology) A practical estimation of the MU can be done by the combination of precision data of reference material in combination with the deductible contributions of the trueness estimated by proficiency test results. The MU can also be estimated by means of measuring of CRM if no proficiency test results are available. For the estimation of the MU of a single measurement, we included the data of measurements of proficiency test material determined with gas chromatography and mass spectrometry at 30 days in different series according to the guidelines of the GTFCh and the data of control charts. The reference © 2011 by Taylor and Francis Group, LLC

88

Quality Assurance in the Pathology Laboratory

material was well characterized so that it can hardly be distinguished from CRM (target values given as μg/L: BTMF 1/04—Tetrahydrocannabinol (THC): 2.2â•›±â•›0.4; BTMF 3/03—amphetamine 24.8â•›±â•›2.85, benzoylecgonine (BZE) 153.4â•›±â•›17.25, morphine 14.3â•›±â•›2.92, MDMA 26.4â•›±â•›4.47, MDEA 25.4â•›±â•›3.42). For comparison, we included the target values of the proficiency tests BTMF 1-3/02, 1-3/03, 1-3/04, and 1/05 for amphetamine (23.6–279.1), BZE (70.6–352.5), morphine (11.4–125.4), MDMA (26.4–300.5), MDEA (25.4–223), and THC (1.1–5.4) in combination with the within-laboratory precision (n = 10) as mean values. The evaluation was made by means of an Excel program written on the basis of the “GUM.” The estimation of the MU by means of CRM allows combined uncertainties of approximately 2% (amphetamine) to 10% (morphine). The uncertainties were 1.3-fold (morphine) to 4-fold (amphetamine) lower than the results achieved by the combination of proficiency test results and the within-laboratory precision (approximately 8%–13%). Also for THC, the most critical analyte in serum, the MU was considerably lower (approximately 7%) as with the data of proficiency tests (approximately 19%) (Tables 4.1 and 4.2). The estimation of the MU by means of CRM results in lower uncertainties as with the combination of proficiency test results and laboratory precision data. This could be expected, if only results of one laboratory and only the uncertainty of the target value of the control material were included. Table 4.1â•… Contributions to the Combined Uncertainty by Means of Certified Reference Material (CRM, nâ•›=â•›30) Analyte THC Amphetamine MDMA MDEA BZE Morphine

CRM (ng/mL)

RMSbias (%)

U(Cref) (%)

U(RSD) (%)

u (%)

2.2 24.8 26.4 25.4 153.4 14.3

0.5 0.3 5.3 1.5 3.0 3.1

1.2 0.4 1.0 0.8 1.3 1.7

6.8 2.1 5.7 5.8 6.9 9.1

6.9 2.2 7.9 6.1 7.6 9.8

Table 4.2â•… Contributions to the Combined Uncertainty by Means of Proficiency Test Results (BTMF 1-3/02, 1-3/03, 1-3/04, und 1/05) and Laboratory Precision Data (PC, nâ•›=â•›10) Analyte THC Amphetamine MDMA MDEA BZE Morphin

PC (ng/mL)

U(Bias) (%)

U(Cref) (%)

U(Rw) (%)

u (%)

2.2 126 26 133 209 125

17.7 6.0 10.9 13.1 23.1 12.4

3.6 1.7 1.7 1.5 1.6 2.0

7.0 4.9 4.9 9.0 10.3 2.9

19.4 7.9 12.1 16.0 25.3 12.9

© 2011 by Taylor and Francis Group, LLC

Quality Assurance of Quantification

89

The estimation of the MU by CRM is particularly suitable if the estimation refers to the range close to the target value of the reference material. It is also suitable if proficiency tests are no longer available or not offered regularly and CRM is available over years [17,18].

4.6╇ Proficiency Testing Schemes The major aim of an external QA scheme is to examine the comparability of analytical results from different laboratories. It enables every laboratory to monitor, evaluate, and improve their performance in terms of the “PDCA” cycle. Becoming accredited to an international standard, i.e., ISO 17025, includes also participating in proficiency testing schemes. For the calculation of the appraisal criterion, the target SD according to Horwitz [15] as well as the reproducibility according to ISO 5725 [20] can be used. However, the calculation according to ISO 5725 requires at least two independent measured values. In contrast to the empirical evaluation according to Horwitz, the adaptation of the appraisal borders according to ISO 5725 considers the scatter of all participants. For drugs of abuse, therapeutic drugs, and alcohol, the appraisal criterion with addition or subtraction of the target SD to the target value itself was practical proven and sufficient. For some analytes only half of the target SD was applied.

References 1. Thompson M., Ellison S.L.R., and Wood R. (2002) Harmonized guidelines for single-laboratory validation of methods of analysis. Pure and Applied Chemistry 74: 835–855. Available: http://www.iupac.org/publications/pac/2002/ pdf/7405x0835.pdf 2. ISO/IEC 27001 (2005) Information technology—Security techniques— Information security management systems requirements specification, International Organization for Standardization, Geneva, Switzerland. 3. ISO/IEC 17025 (2005) General requirements for the competence of testing and calibration laboratories. 4. Peters F.T., Drummer O.H., and Musshoff F. (2007) Validation of new methods. Forensic Science International 165: 216–224. 5. ISO/IEC 11095 (1997) Linear calibration using reference materials, International Organization for Standardization, Geneva, Switzerland. 6. ISO 11843-2 (2000) Capability of detection—Part 2: Methodology in the linear calibration case, International Organization for Standardization, Geneva, Switzerland. 7. ISO 11843-5 (2008) Capability of detection—Part 5: Methodology in the linear and non-linear calibration cases, International Organization for Standardization, Geneva, Switzerland. © 2011 by Taylor and Francis Group, LLC

90

Quality Assurance in the Pathology Laboratory

8. ISO 8466-1 (1990) Water quality—Calibration and evaluation of analytical methods and estimation of performance characteristics—Part 1: Statistical evaluation of the linear calibration function, International Organization for Standardization, Geneva, Switzerland. 9. ISO 8466-2 (2001) Water quality—Calibration and evaluation of analytical methods and estimation of performance characteristics—Part 2: Calibration strategy for non-linear second-order calibration functions, International Organization for Standardization, Geneva, Switzerland. 10. ISO 3534-1 (1993) Statistics—Vocabulary and symbols, International Organization for Standardization, Geneva, Switzerland. 11. ISO guide to the expression of uncertainty in measurement (GUM) (2nd printing 1995), International Organization for Standardization, Geneva, Switzerland. 12. EURACHEM/CITAC Guide (2000) Quantifying Uncertainty in Analytical Measurement, Williams A., Ellison S.R.L., and Roesslein M. (eds.), 2nd edn. Available from the Eurachem Secretariat (see http://www.eurachem.org/). 13. EURACHEM/EUROLAB/CITAC/NORDTEST Guide (2007) Estimation of Measurement Uncertainty Arising from Sampling. Available from the Eurachem Secretariat (see http://www.eurachem.org/). 14. Nordtest Technical Report 537 (2003) Handbook for Calculation of Measurement Uncertainty in Environmental Laboratories (see http://www.nordtest.org/). 15. Horwitz, W. (1982) Evaluation of analytical methods used for regulation of foods and drugs. Analytical Chemistry 54(1): 67A–76A. 16. Thompson, M. (2004) AMC Technical Brief no. 17. Available: http://www.rsc. org/pdf/amc/brief17.pdf 17. Schmitt G., Herbold M., and Aderjan R. (2008) Estimation of the uncertainty of measurement by means of ‘certified’ reference material. In: GTFCh-Symposium “Aktuelle Beiträge zur Forensischen und Klinischen Toxikologie”, Mosbach, April 18–21, 2007, Verlag: Dr. Dieter Helm, Heppenheim, Germany. 18. Proficiency Testing Scheme GTFCh. Arvecon GmbH (2009), Walldorf, Germany (see http://www.arvecon.de) 19. Thompson M. and Wood R. (1995) Harmonised guidelines for internal quality control in analytical chemistry laboratories. Pure and Applied Chemistry 67: 649–666. 20. ISO 5725-2 (1994) Accuracy (trueness and precision) of measurement methods and results—Part 2: Basic method for the determination of repeatability and reproducibility of a standard measurement method, International Organization for Standardization, Geneva, Switzerland.

© 2011 by Taylor and Francis Group, LLC

Quality Assurance Aspects of Newly Emerging Methods in Pathology and Laboratory Medicine

© 2011 by Taylor and Francis Group, LLC

II

Pharmacogenomics, Personalized Medicine, and Personalized Justice Influencing the Quality and Practice of Forensic Science

5

Steven H.Y. Wong

Contents 5.1 Introduction 5.2 Pharmacogenomics and Other Molecular Diagnostics for Personalized Medicine and Personalized Justice 5.2.1 Drug Therapy and Pharmacogenomics Theranostics 5.2.2 Need for Quality Assurance 5.2.3 Personalized Medicine and Personalized Justice 5.2.4 Pharmacogenomics and Testings 5.2.5 Proposed Personalized Medicine and Personalized Justice Social Balance 5.3 Proactive Quality Assurance by Governmental Agencies 5.4 Quality-Assurance Program Considerations 5.4.1 General Consideration and Education 5.4.2 PGx/Pharmacogenetics Laboratories, Institutional Review, and Informed Consent 5.4.3 College of American Pathologists PGx Survey 5.4.4 CDC, European Medicines Agency, and Australian and South-East Asian Tissue Typing Association 5.4.5 Plasmid-Derived Samples 5.4.6 Commercial Sources 5.5 Molecular Autopsy, PGx Algorithm, and Selected Cases 5.6 Conclusions References Web Sites

© 2011 by Taylor and Francis Group, LLC

93

94 95 95 95 96 96 103 105 108 108 109 109 109 110 111 112 115 115 119

94

Quality Assurance in the Pathology Laboratory

5.1╇Introduction The completion of the human genome project was quickly followed by parallel emergence and rapid advances of transcriptomics, proteomics, metabolomics, epigenetics/imprintomics, and other “omics” sciences, enabled by advances in molecular diagnostics and mass spectrometry. This latter technique, in addition to its roles in therapeutic drug monitoring, clinical and forensic toxicology, has provided “molecular” information for genomics, proteomics, and metabolomics. These “omics” might be readily grouped/ interconnected together as systems biology for understanding the complex interrelationship of various biological and disease processes. These understandings would enhance the practice of personalized medicine (PM), and the “Â�mis-application” might result in legal proceedings in the form of personalized justice (PJ) [1]. PM may be readily defined as the use of molecular biomarkers such as pharmacogenomics (PGx), epigenetics/imprintomics, proteomics and other biomarkers, and molecular imaging for drug discovery and subsequent optimization of therapy. Leading medical schools have already incorporated the practice of PM in revised curriculum [2]. Figure 5.1 shows the basic dogma of molecular biology and the interrelationship of molecular biology/biomarkers for some emerging areas. With these advances, the forensic community is poised to selectively incorporate them for possible explanation of molecular contribution to adverse outcome and possible toxicity and fatality such as the investigation of the role of epigenetics for suicide [3]. The process should include evaluating the robustness/quality of the findings. Thus, this chapter would address quality assurance as follows: (1) access the interrelationship, on a global scale, of PGx and other molecular diagnostics to PM and PJ; (2) illustrate the proactive quality assurance roles of the FDA and other governmental agencies; (3) update PGx quality assurance DNA

RNA

Genomics pharmacogenomics

Transcriptomics

Personalized medicine efficacy

Molecular imaging

Proteins Proteomics

Metabolites Metabolomics

Personalized justice Toxicity, sensitivity Performance? behavior? Environment, “omics” epigenetics/imprintomics

Figure 5.1╇ Proposed interrelationship of molecular biology/biomarkers, PM, and PJ.

© 2011 by Taylor and Francis Group, LLC

Pharmacogenomics, Personalized Medicine, Personalized Justice

95

considerations; and (4) re-state the concept of PGx as adjunct for �molecular autopsy, include a PGx algorithm for forensic pathology/�toxicology, and illustrate the use of PGx in selected cases.

5.2╇Pharmacogenomics and Other Molecular Diagnostics for Personalized Medicine and Personalized Justice 5.2.1╇Drug Therapy and Pharmacogenomics Theranostics Two recent examples are the FDA re-labelings of warfarin and clopidogrel (Plavix)—the number two drug in the world. On January 22, 2010, FDA relabeled warfarin by stating: “The patient’s CYP2C9 and VKORC1 genotype information, when available, can assist in selection of the starting dose.” [4], and on March 12, 2010, FDA issued the boxed warning for clopidogrel “—alerting patients and health care professionals that the drug can be less effective in people who cannot metabolize the drug to convert it to its active form.—by the liver enzyme CYP 2C19—2 percent to 14 percent of the U.S. population are poor metabolizers. Tests are available to assess CYP2C19 genotype” [5]. The re-labeling of these antiplatelet drugs serve to demonstrate an effective quality assurance/regulatory process to ensure patient safety by using adjunct molecular diagnostics such as PGx. These developments would impact the practice of forensic pathology and toxicology as well. For patients and decedents with history of intake of these two antiplatelet drugs and with bleeding complications, genotyping CYP2C9 and CYP2C19 would serve as useful interpretative adjuncts for therapy and forensic pathology/toxicology. 5.2.2╇Need for Quality Assurance In order to ensure the clinical efficacy and forensic validity of these new developments, a basic requirement would be quality assurance. The need for this was evident from the findings of a review. The review of 547 papers published from 2005 to 2007 in two leading journals—Pharmacogenomics, and Pharmacogenetics and Genomics showed that 135 papers utilized genotyping. However, only 9% employed unspecified quality controls; only three studies, 2% included representative samples; and four studies, 3% included previous genotyped samples or a reference panel [6]. Additional review of 20 association studies published in Rheumatism and Arthritis, Cancer, and others also confirmed these previous findings. While it might be premature to apply rigid quality-assurance monitors for the emerging “omics” fields, the need for quality assurance for PGx might be well justified when bench-marked against a well established and accepted forensic field of DNA fingerprinting for identity testing [7]. Further, quality assurance should not be only confined to molecular and analytical © 2011 by Taylor and Francis Group, LLC

96

Quality Assurance in the Pathology Laboratory

procedures, but to more broadly encompass developmental, discovery, and regulatory processes before and after the adoption of new “omics” sciences. 5.2.3╇ Personalized Medicine and Personalized Justice Following a previous presentation and publications [8–11], Wong et al. recently published an editorial on the possible application of translational PGx biomarkers for PM and PJ, with potential implications for the practice of forensic science [1]. PM, as defined previously, holds the promise of offering five “Rights”: Right patient, the Right diagnosis, Right treatment, Right dose, and Right time [12]. For example, a recent study of non-small-cell lung cancer (NSCLC) was initiated due to inadequate staging [13]. From 125 randomly selected patients and using real-time PCR analysis of 185 samples, 5 gene biomarkers were shown to be independent predictors of relapse-free and overall survival. The combination of expression of 5 gene biomarkers (DUSP6, MMD, STAT1, ER BB3, and LCK) would be predictive of outcome. An accompanying editorial proposed further investigations in bringing about personalized therapy (Medicine) for the treatment of lung cancer as shown by Figure 5.2 [14]. In short, these suggested investigations would ensure the quality of the PM by validation of the findings by other centers, expanding the use of other biomarkers including proteomics and molecular imaging, and investigating the use of these biomarkers for predicting metastasis and drug sensitivity. When successfully completed and validated, PM for NSCLC will then be achieved. Taken together, these proposed sequence of studies might be regarded as global quality assurance for the use of PGx and other molecular biomarkers for PM. 5.2.4╇ Pharmacogenomics and Testings As shown by the above example, PGx and gene expression are often used to identify genetic variations and expression which would guide the diagnosis, and choice of drug and dose [15–18]. PGx, often used interchangeably with pharmacogenetics, is a scientific and clinical discipline which attempts to optimize drug therapy based on individual genetic disposition. Genetic variations might impact on drug metabolism, drug binding to transporters and receptors/targets, and signaling pathways. Figure 5.3, according to Evans and McLeod, describes the polygenic determinants of drug response for “active” parent drug [16]. For the individual on the left side of the figure, with normal (WT/WT) homozygous genotype corresponding to an extensive “wild” phenotype, drug metabolism and bioavailability, and receptor binding would be normal. Thus, drug efficacy would be optimal with minimized toxicity. For the homozygous on the right side of the figure with both variant alleles (V/V) corresponding to a “poor or slow” metabolizer, drug metabolism is impaired, © 2011 by Taylor and Francis Group, LLC

Pharmacogenomics, Personalized Medicine, Personalized Justice

97

Phase 1: Genomic signatures Stored specimens plus clinical data Phase 2: Validation Prosective trials Phase 3: Expansion of genomic signatures Preclinical and clinical studies Algorithm Clinical characteristics Molecular imaging Proteomics Genomics

Tumor

Prediction of metastasis Bone

Liver

Brain Lung Prediction of drug sensitivity or resistance Phase 4: Personalized therapy

Figure 5.2╇ Development of personalized drug for lung cancer, from identification of genomics signatures to prospective trials of personalized therapy. (With permission from Herbst, R.S. and Lippman, S.M., NEJM, 356, 76, 2007.)

resulting in increased drug bioavailability and toxicity, and reduced drug efficacy. The individual in the middle possesses one variant allele (WT/V), a heterozygote corresponding to an intermediate metabolizer with decreased efficacy and increased toxicity between the previous two individuals. Another individual, not shown in this figure, possesses multiple copies of the drug-metabolizing gene, resulting in larger amount of enzyme. Classified as an ultra-rapid metabolizer, this individual would experience lower drug bioavailability and therefore decreased efficacy. Figure 5.4 shows the distribution © 2011 by Taylor and Francis Group, LLC

98

Quality Assurance in the Pathology Laboratory WT/WT

Genotype Concentration

10.0 Drug metabolism (degradation)

AUC-100

0

6

% Responding

100

12 18 Time (h)

24

10.0

AUC-200

0.1

0

6

12 18 Time (h)

0

100

200 300 AUC

Metabolism genotype

Polygenic drug response

400

10 0

24

Toxicity

50 Toxicity

AUC-400

1.0

100

Efficacy

50 10 0

10.0

V/V

1.0

1.0

0.1

Drug receptor (efficacy)

WT/V

0.1

100

200 300 AUC

Receptor genotype

6

12 18 Time (h)

100

Efficacy

0

0

400

24

Toxicity

50 10 0

Efficacy 0

100

Response

200 300 AUC

Efficacy

400

Toxicity

+

65%

Low (5%)

+

32%

Low

+

9%

Low

+

79%

Moderate (12%)

+

40%

Moderate

+

10%

Moderate

+

80%

High (80%)

+

40%

High

+

10%

High

Figure 5.3╇ Polygenic determinants of drug response. (With permission from Evans, W.E. and McLeod, H.L., NEJM, 348, 538, 2003.)

No. of subjects

120

80 Extensive metabolism 40

0

Ultrarapid metabolism

0

0.01

0.10

Cutoff

1

Poor metabolism

10

100

Debrisoquin: 4-hydroxydebrisoquin metabolic ratio

Figure 5.4╇ Pharmacogenetics of CYP2D6. Weinshilboum, R., NEJM, 348, 538, 2003.) © 2011 by Taylor and Francis Group, LLC

(With

permission

from

Pharmacogenomics, Personalized Medicine, Personalized Justice

99

Drug in dosage form Patient compliance Drug in solution Absorption Liver

~PG

Drug metabolism

Tissue storage (desired biological effect not elicited) Tissue Free bound drug drug

Plasma compartment Excretion ~PG Protein Free bound drug drug Reabsorption Metabolites

Oral cavity (fluid) hair/others

Kidney drug excretion Parent drug and metabolites

Site of action ~PG Receptor Free bound drug drug Biological effects

Figure 5.5╇ Drug absorption, distribution, metabolism, and elimination,

and PGx.

and metabolic ratios of debrisoquin/4-Â�hydroxydebrisoquin for these four Â�phenotypes [18]. Hydroxylation of debrisoquin is mediated by CYP2D6. The cutoff at about 20 marks the difference between poor and extensive metabolizers. In addition to PGx effect on drug metabolism, Figure 5.5 shows the effect of PGx on drug transporters and receptors. Currently, there is a wealth of information on PGx on drug metabolism [19,20]. Recent PGx investigations in psychiatry have also addressed PGx of targets such as serotonin and dopamine receptors, and serotonin transportors. In the area of drug metabolism, PGx of cytochrome P450 (CYP) enzymes have been well established. Tables 5.1 through 5.3 show the CYP2C9, 2C19, and 2D6 alleles, respectively [18], and Table 5.4 shows the ethnic diversity prevalence of CYP2D6 variations [21]. Other PGx drug-metabolizing genes of interest are listed in Table 5.5 [22], updated and modified from a previous publication. Phase I enzyme genes such as CYP2C9 and 2C19 are indicated as PGx adjuncts for antiplatelet therapy involving warfarin and clopidrogel, respectively. Other important ones include: CYP2B6, CYP4F2, VKORC1 for warfarin [23–27], and UGT1A1 for irinotecan [28]. Another important group includes HLA-Bs histocompatibility genes: HLA-B*5701 for HIV drug such as abacavir [29–33], HLA-B*1502 for Steven Johnson Syndrome hypersensitivity to carbamazepine [34], and HLA-B*5802 for allopurinol therapy [35]. Table 5.6 shows the various PGx methodologies, companies, and FDA © 2011 by Taylor and Francis Group, LLC

100

Quality Assurance in the Pathology Laboratory

Table 5.1â•… Cytochrome P450 2C9 Alleles

Allele

Functional Nucleotide Change

Amino Acid Change

Enzyme Activity

Associated Phenotype

Allele Frequency 0.819 (0.793–0.844) 0.107 (0.086–0.127) 0.074 (0.056–0.091)

CYP2C9*1

None

None

Normal

EM

CYP2C9*2

C430T

Arg144Cys

PM

CYP2C9*3

A1075C

Leul359

CYP2C9*4 CYP2C9*5 CYP2C9*6 CYP2C9*7 CYP2C9*8 CYP2C9*9 CYP2C9*10 CYP2C9*11 CYP2C9*12

T1076C C1080G A818del 55Câ•›>â•›A 449Gâ•›>â•›A 752Aâ•›>â•›G 815Aâ•›>â•›G C1003T

Thrl359 Asp360Glu

12% of wild-type 5% of wild-type ND Decreased None

PM ND PM

Leu191 Arg150His His251Arg Glu272Gly Arg335Trp Pro489Ser

Source: Reproduced from Linder, M.W. et al., Application of pharmacogenetic principles to clinical pharmacology, in Applied Pharmacokinetics & Pharmacodynamcis. Principles of Therapeutic Drug Monitoring, eds. M.E. Burton, J.J. Schentag, L.M. Shaw, and W.E. Evans, Lippincott Williams & Wilkins, Philadelphia, PA, pp. 165–185, 2006. Note: EM, extensive metabolizer; ND, not determined; PM, poor metabolizer.

Table 5.2â•… Cytochrome P450 2C19 Alleles

Allele

Functional Nucleotide Change

CYP2C19*1 CYP2C19*2

None G681A

CYP2C19*3

G636A

CYP2C19*4

A-G initiation codon C1297T G385A

CYP2C19*5 CYP2C19*6

Amino Acid Change

Enzyme Activity

Associated Phenotype

Allele Frequency

None Splicing defect Stop codon

Normal None

EM PM

None

PM

None

None

PM

0.67 0.23 (0.15–0.31) 0.104 (0.05–0.16) 0.00–0.006

Arg433Trp Arg132Gin

None ND

PM PM

0.00–0.009 0.00–0.009

Source: Reproduced from Linder, M.W. et al., Application of pharmacogenetic principles to clinical pharmacology, in Applied Pharmacokinetics & Pharmacodynamcis. Principles of Therapeutic Drug Monitoring, eds. M.E. Burton, J.J. Schentag, L.M. Shaw, and W.E. Evans, Lippincott Williams & Wilkins, Philadelphia, PA, pp. 165–185, 2006. Note: EM, extensive metabolizer; PM, poor metabolizer. © 2011 by Taylor and Francis Group, LLC

Allele CYP2D6*1 CYP2D6*1X2 CYP2D6*2 CYP2D6*2XNa CYP2D6*3 CYP2D6*4 CYP2D6*4X2 CYP2D6*5 CYP2D6*6 CYP2D6*7 CYP2D6*8 CYP2D6*9 CYP2D6*10 CYP2D6*11 CYP2D6*12 CYP2D6*13 CYP2D6*14 CYP2D6*15 CYP2D6*16

Functional Nucleotide Changes None Gene duplication 2850Câ•›>â•›T, G4180C Gene duplication A2549 deletion G1846A G1846A, gene duplication Gene duplication T1707 deletion A2935C G1758T 2613–2615 or delAGA C100T G883C G124A CYP2D6/CYP2D7 hybrid G1758A 138inst CYP2D7P/CYP2D6 hybrid

Structural Effect

Activity

Associated Phenotype

Allele Frequency

None None Arg296Cys,Ser486Thr Arg296Cys,Ser486Thr Frameshift Splicing defect Splicing defect CYP2D6 deleted Frameshift His324Pro Stop codon Lys281 deleted Pro34Ser,Ser486Thr Splicing defect Gly42Arg Frameshift Gly169Arg

Normal Increased Decreased Increased None None None None None None None Decreased Decreased None None None None None None

EM UM EM UM PM PM PM PM PM PM PM EM EM PM PM PM PM PM PM

0.364 (0.337–0.392) 0.0051 (0.0019–0.033) 0.324 (0.298–0.352) 0.0134 (0.008–0.022)b 0.0204 (0.0131–0.0302) 0.207 (0.184–0.231) 0.0008 (0.0000–0.0047) 0.0195 (0.0124–0.0292) 0.0093 (0.0047–0.0166) 0.0008 (0.0000–0.0047) 0.0000 (0.0000–0.0031) 0.0178 (0.0111–0.0271) 0.0153 (0.0091–0.0240) 0.0000 (0.0000–0.0031) 0.0000 (0.0000–0.0031) 0.0000 (0.0000–0.0031) 0.0000 (0.0000–0.0031) 0.0008 (0.0000–0.0047) 0.0008 (0.0000–0.0047)

Frameshift

© 2011 by Taylor and Francis Group, LLC

101

Source: Reproduced from Linder, M.W. et al., Application of pharmacogenetic principles to clinical pharmacology, in Applied Pharmacokinetics & Pharmacodynamcis. Principles of Therapeutic Drug Monitoring, eds. M.E. Burton, J.J. Schentag, L.M. Shaw, and W.E. Evans, Lippincott Williams & Wilkins, Philadelphia, PA, pp. 165–185, 2006. Note: EM, extensive metabolizer; ND, not determined; PM, poor metabolizer. Partial list, for a complete list refer to http://www.imm.ki;se/ CYPaileles/cyp2d6.htm a Nâ•›=â•›2, 3, 4, 5, or 13. b Frequency for Nâ•›=â•›2.

Pharmacogenomics, Personalized Medicine, Personalized Justice

Table 5.3â•… Cytochrome P450 2D6 Alleles

102

Table 5.4â•…Allelic Frequency in Diverse Racial/Ethnic Populations

EU, CA U.S., CA Turkish Chinese Japanese Mex Am Ethiopians AA

F

F

NF

NF

NF

NF

R

R

D

*1

*2

*3

*4

*5

*6

*9

*10

Tot

0.334–0.364 0.37–0.404 0.371 0.23 0.43 0.572

0.285–0.329 0.262–0.337 0.353 0.20 0.123–0.129 0.228

0.1–0.2 0.01 0 0.1

0.189–0.207 0.175–0.199 0.113 <0

0.009–0.014 0.01 0.007

0.018–0.026 0.029 0.006

0.288–0.347

0.175–0.269

0–0.003

0.103 0.012 0.058–0.075

0.014–0.02 0.019–0.08 0.061 0.50 0.381–0.386 0.074 0.086 0.025–0.075

0.016–0.021 0.011–0.014 0.008

<0.1

0.020–0.041 0.021–0.038 0.015 0.057 0.045–0.062 0.023 0.033 0.062–0.067

0–0.005

0–0.003

0.01 0.136 0.014–0.049

Source: Adapted from Bradford, L.D., Pharmacogenomics, 3(2), 229, 2002. Notes: AA, African-American; CA, Caucasians; D, Duplications; EU, European; F, Functional; Mex Am, Mexican American; NF, Non-functional; R, reduced; tot, *1â•›×â•›2, *2â•›×â•›2, and *4â•›×â•›2; U.S., United States.

© 2011 by Taylor and Francis Group, LLC

Quality Assurance in the Pathology Laboratory

Race/ Ethnic

Pharmacogenomics, Personalized Medicine, Personalized Justice

103

Table 5.5â•…Updated Top PGx Tests Abbreviation 1. CYP2D6 2. TPMT 3. CYP2C9 4. CYP2C19 5. VKORC1 6. HLA-B*1502 7. HLA-B*5701 8. HLA-B*5801 9. NAT 10. CYP 3A5 11. UGT1A1 12. MDR1 13. CYP2B6 14. MTHFR 15. CYP4F2

Name and Function Cytochrome P 450 (CYP) 2D6, Phase I drug metabolizing enzyme Thiopurine S-methyltransferase, Phase II drug metabolizing enzyme CYP 2C9, Phase I drug metabolizing enzyme CYP2C19, Phase I drug metabolizing enzyme Vit. K epoxide reductase complex protein 1—mediates vit. K reduction Human leukocyte antigen (HLA) complex class 1, B1502, differentiate the body’s own proteins from proteins made by viruses and bacteria Human leukocyte antigen (HLA) complex class 1, B5701, differentiate the body’s own proteins from proteins made by viruses and bacteria Human leukocyte antigen (HLA) complex class 1, B5801, differentiate the body’s own proteins from proteins made by viruses and bacteria N-acetyltransferase, Phase II drug metabolizing enzyme CYP 3A5, Phase I drug metabolizing enzyme Uridine diphosphate glucuronosyltransferase 1A1, Phase II drug metabolizing enzyme Multidrug resistance (P-glycoprotein), drug protein transporter CYP 2B6, Phase I drug metabolizing enzyme Methylenetetrahydrofolate (CH2THF) reductase, converts CH2 THF to 5-methyltetrahydrofolate CYP 4F2, Phase I drug metabolizing enzyme

Source: Modified from Top ten pharmacogenomics tests, Clinical Laboratory News, American Association for Clinical Chemistry, Washington, DC, May 2005.

approval status [36]. Currently, clinical PGx are limited and reimbursement is pending for further outcome study. However, adverse reactions, which might be avoided by judicious use of PGx prior to drug therapy, have already recognized by the legal community. Thus, the legal community’s involvement in these cases, along with previous use of DNA fingerprinting for identity test [7], could possibly provide the momentum for the emergence of PJ as proposed in recent editorials [1,9]. 5.2.5╇Proposed Personalized Medicine and Personalized Justice Social Balance As an emerging social balance, Figure 5.6 shows the complementary relationship of PM and PJ [11], enabled by the use of molecular biomarkers such as PGx. In this conceptual figure, PM on one side of the balance, as described above, is enabled by applying PGx and other molecular biomarkers as previously shown by Figure 5.1. The desirable outcome is to achieve efficacy. Other biomarkers would include TDM and toxicology. Sirot and Beaumman recently re-emphasized the use of TDM biomarkers to complement PGx in psychiatry [37]. © 2011 by Taylor and Francis Group, LLC

104

Quality Assurance in the Pathology Laboratory Table 5.6â•…Methodologies for PGx Testing Method Sequencing Real-time PCR (RT-PCR) PCR arrays PCR arrays (DMET for 1228 SNPs) Sequencing Pyrosequencing RT-PCR Real-time, allele-specific PCR RT-PCR User developed PCR arrays Nanoparticles PCR electronic arrays RT-PCR PCR arrays Invader assay eQPCR LC PCR bead-based detection dHPLC FISH MALDI-TOF

Companies

FDA Approval

Abbott ABI Autogenomics Affymetrix Bayer Qiagen (Biotage) Celera DxS ParagonDx Nanogen Nanosphere Osmetech Roche Roche Thirdwave TrimGen TM Biosciences Transgenomics Abbott Applied Biosystems

Yes — Yes* — Yes — — — Yes* — Yes* Yes* — Yes Yes Yes* Yes — Yes —

Source: Modified from Payne, D., Methodologies for pharmacogenetic testing, Clin. Chem. News, July 2006. *Approvals after July 2006.

PGx has been used in forensic pathology/toxicology [10–11,38–40]. In the event of an adverse outcome, drug therapy might result in toxicity, drug hypersensitivity, behavioral changes, and impaired performance. These outcomes might be minimized or avoided by possible use of PGx and other biomarkers. Thus, the “misapplication” of these biomarkers testing might Inevitable social balance? check and balance Personalized medicine efficacy

Personalized Justice Toxicity PGx Sensitivity Behavior Performance

Complementary relationship of PM and PJ

Figure 5.6╇ PM, PJ, and PGx and social balance. (Reproduced and modified from Wong, S.H. et al., Clin. Chem. Lab. Med. 46, A118.)

© 2011 by Taylor and Francis Group, LLC

Pharmacogenomics, Personalized Medicine, Personalized Justice

105

constitute the legal basis for PJ. As such, PJ acts a counter-balance to PM and might actually enable the practice of PM in the future. In the emerging practice of PJ, colleagues in the forensic community would be vitally important in the correct application of PGx biomarker testing and the interpretation of the contributing of PGx to drug toxicity and sensitivity. Often, toxicology and other drug-monitoring data are needed to assess the effect of the variations of drug-metabolizing enzyme genes by noting the drug concentration as well as the metabolic ratios if available. These are often regarded as adjuncts to other vital case history including medication for accessing possible drug–drug interactions. Interpretation of PGx and other data call for legal acceptance of the use of molecular biomarkers. Thus, it is important that the legal Â�community be updated on the correct use and to appreciate the limitations of PGx such as the need for bench-marking the correct allelic frequencies with the race/ethnic origin of the subjects. Taken together, the emerging PJ might also be regarded as a global quality-assurance monitor for the practice of PM.

5.3╇Proactive Quality Assurance by Governmental Agencies Governmental regulatory agencies have demonstrated steady and continuous support for the practice of PM to enhance disease diagnosis and treatment. This might be shown by the report of the President’s Advisory Council on Science and Technology, the FDA officials’ opinion expressed in white papers, and regulatory updates in the forms of boxed warning in labeling and re-labeling of newly and previously approved drugs and guidance documents. This series of actions is indicative of the measures that the governmental regulatory agencies are undertaking to ensure the quality and practice of PM, with possible outcome in the emerging practice of PJ as shown by the following scenario. If a patient is treated without adherence to the boxed warning such as clopidrogel in the future and an adverse event such as cardiac arrest occurs, the patient/patient’s family might pursue legal means to recover the cost of the adverse event, indicating the continuum from PM to PJ. PM has been continuously addressed at a high level. On September 28, 2008, the President’s Council of Advisors on Science and Technology issued a report, entitled “Priorities for PM” [41]. The report addressed three main areas: technology and tools, regulation, and reimbursement. In order to hasten research and development related to PM, planning will include both public and private sectors. Regulatory processes would be updated by applying transparent, systematic, and iterative approaches. In using innovative PM products, health care cost should not become obstructive. To achieve © 2011 by Taylor and Francis Group, LLC

106

Quality Assurance in the Pathology Laboratory

these activities, Department of Health Human Services (HHS) might consider establishing an office for coordination. Recent appointment of key FDA Â�officials is an indication that the process is moving forward. In a September 2007 report on Personalized Health Care, Opportunities, Pathways, Resources [42], HHS secretary Leavitt emphasized the advent of PM and the various enabling challenges, pathways, and resources. Among the FDA centers, Center for Device and Radiological Health (CDRH) and Center for Drug Evaluation and Research (CDER) have been strong advocates in supporting the development of new drugs and new testing devices and tests. As described in the introduction of this chapter, FDA-CDER re-labeled approved drugs: warfarin and clopidrogel. In the area of pain management, Woodcock expressed concern about the need to balance in providing patient with efficacious analgesic and the risks to opioid toxicity [43]. In addition, on March 18, 2010, the Drug Information Association (DIA) reported the possible interest of CDER-FDA in fast-tracking a five-drug study for breast cancer [44]. The five drugs included: Abbott’s veliparob. Amgem’s conatumumab and AMG 386, and Pfizer’s figitumumab and neralinib. The 5 year study at the University of Minnesota and Mayo will include matching patient’s DNA as a possible biomarker for response. On another regulatory level, the Office of In vitro Diagnostics of the Center for Device and Radiological Health (CDRH) has advocated the model of total product cycle which incorporated many opportune quality-assurance processes as shown by Figure 5.7, the new CDRH vision for regulating medical devices—Total Product Cycle [45]. According to the model, the same FDA group will review from conception of the product until it is obsolete or replaced by another device. Throughout the product cycle, FDA colleagues and panel members contribute in a stepwise, developmental manner such as meetings, guidance documents, and other processes. The model also shows the inter-linkage of these processes for coordinated quality assurance. On the left side of the model, quality assurance would include post approval— market survey, and in the unfortunate event, warning and product recall to ensure testing efficacy and therefore patient safety. For forensic toxicology and PGx testing, the length of the product cycle varies according to instrumentation. In the using chromatographic procedures for screening and confirmation, the toxicology lab often develops “home-brew” assay. Currently, these are not yet subject to FDA regulation/approval. For the immunoassays using analyzers, most of the assays are approved by FDA. Based on current usage, most of the immunoassays have a long product cycle of more than 10 years! For PGx testing with FDA approved test and/or platforms, it would be accurate to characterize most of them to be on the right side of the model at the beginning or mature stages of the cycle. For PGx, Table 5.6 shows a list of tests, companies, and FDA approval status. Recent approvals have included testing for warfarin sensitivity. In June 2007, FDA-CDRH issued a guidance © 2011 by Taylor and Francis Group, LLC

Pharmacogenomics, Personalized Medicine, Personalized Justice

107

The New CDRH Vision for Regulating Medical Devices—Total Product Life Cycle Request for designation

Device advice

Pro to ty p

M a rk eti n

g

Advisory panels

acturing

MDRs

IDEs

PMAs, 510(k)s

Manuf

Post marketing studies

mercial use Com

Ob so les ce n

ce

Early planning meetings

Cl in ica l

Warning leuers

Recalls

Preclinical

Safety alerts

e

Concept

Agreement and determination meetings

Guidance

Part of the CDRH Strategic Plan, regulation via Total Product Life Cycle, will require that the same work groups within the FDA are involved in regulating a medical device from the time a company conceives the idea until the time the device becomes obsolete and is replaced by a newer device or technology.

Figure 5.7╇ Total product cycle according to CDRH/FDA. (With permission from Auxter, S., Clin. Lab. News, 28(11), 1; 2002.)

for Pharmacogenetic Tests and Genetic Tests for Heritable Markers [46]. The guidance dwelled on pharmacogenetic testing versus genetic testing and offered Â�recommendations including intended use of a device design, analytical studies, software and instrumentation, comparison studies using clinical specimens, clinical evaluation studies comparing device performance to accepted diagnostic procedure(s), effectiveness of the device, and labeling and considerations for planning and evaluating clinical studies. Another article also described design and analytical validation issues. Considerations include: test design, preanalytical issues, calibrators and controls, hardware, software, proficiency testing, and analytical validation of multi-analytes tests [47]. © 2011 by Taylor and Francis Group, LLC

108

Quality Assurance in the Pathology Laboratory

Based on the above, governmental agencies such as the U.S. FDA have been proactively engaged in enhancing the practice of PM. At the same time, FDA’s labeling of newly approved drugs and re-labeling of previously approved drug might encourage clinical colleagues in choosing drugs based on the need to do PGx test or to switch to another medication that does not require PGx testing.

5.4╇ Quality-Assurance Program Considerations 5.4.1╇General Consideration and Education The National Academy of Clinical Biochemistry, the Academy of the American Association for Clinical Chemistry, recently published the Laboratory Medicine Practice Guidelines (LMPG) for Pharmacogenetics. LMPG provides recommendations for quality assurance (Chapter 3) [48] and related laboratory considerations (Chapter 4), respectively [49]. There are six considerations related to methodology and quality assurance [48]. In order to avoid discrepancies, analytical sensitivity and specificity should be established and inconsistent results should be investigated. PGx tests should be validated with samples from independent sources using standard protocol for molecular diagnostics. Sufficient number of whole genomic samples with various variations should be used in order to minimize interference with rare variations. PGx proficiency testing would be similar to other molecular diagnostics. Software programs for data reduction should be checked for analysis integrity. Further, another chapter focused on clinical laboratory service considerations which will affect quality [49]. Laboratory performing PGx in the United States should follow the Clinical Laboratory Improvement Act1988 guidelines for “high-complexity testing.” Whole blood or other verified samples, such as hair or oral fluids would be recommended samples. The report should include gene structure and results. For clinical (and forensic) diagnostics, criteria should be developed for selecting variations, which should be correlated to changes in pharmacokinetics, pharmacodynamics, and toxicity. Cost effectiveness would be desirable. In ensuring quality for PGx, another focus is on education and training. For example, The College of American Pathologists offers a 1 month PGx fellowship at the University of California Irvine [50]. This fellowship will cover four areas of training—basic human genetics, molecular biology, and CYP450 PGx including CYP2D6 and 2C19, methodologies and instrumentation involving Amplichip CYP450 microarrays, diagnostics developments, and participation in research projects. In addition to the above areas, the fellow would also appreciate interpretation, compliance, and reimbursement issues. © 2011 by Taylor and Francis Group, LLC

Pharmacogenomics, Personalized Medicine, Personalized Justice

109

5.4.2╇PGx/Pharmacogenetics Laboratories, Institutional Review, and Informed Consent In 1999, the University of Pittsburgh established a pharmacogenetics Core Laboratory, providing PGx methodologies for clinical research involving drug metabolizing genes [51]. Genotyping is performed with TagMan assay by using Applied Biosystems GeneAmp 7700• Sequence Detection system, the Luminex multiplexed microsphere assay, the Nanogen NanochipT technology, and restriction fragment length polymorphism PCR. Gene expression levels are performed by using real-time quantitative RT-PCR (TaqMan technology). Quality assurance was developed according to the College of American Pathologists/ American College of Medical Genetics’ molecular pathology accreditation program. In performing the assays, positive and negative PCR controls, blinded duplicate sample, and the repeat of an additional 10% of samples. Other procedures include check thermal cycler and cycling time reproducibility, clean the sample block, separate pre- and post-PCR areas, clean biohazard hood with 10% bleach to decontaminate, and other procedures. Caution is taken in reporting patient results in order to ensure privacy and confidentiality. Generally, this was the recommended practice for a molecular laboratory by FerreiraGonzalez [52], and at the Molecular and Pharmacogenetics Laboratory of the Department of Pathology at the Medical College of Wisconsin [53]. Currently, postmortem testing does not require Institutional Review Board (IRB) approval. In considering the implications of PGx findings for the decedent and family members, IRB application is advised. Further, it would be appropriate to seek informed consent from decedent family members if possible. 5.4.3╇ College of American Pathologists PGx Survey The CAP’s proficiency testing programs and interlaboratory sample exchange programs for molecular genetic testing for heritable diseases and conditions includes a pharmacogenetic proficiency testing (PGx) [54]. The survey includes samples containing purified DNA with some of the following genes: CYP2C9, CYP2C19, CYP2D6, UGT1A1 (UDP glucuronosyltransferase), and VKORC1. In addition, case histories are also included and participants are encouraged to interpret the impact of the genotyping results on these cases. 5.4.4╇CDC, European Medicines Agency, and Australian and South-East Asian Tissue Typing Association The CDC’s genetic testing reference materials coordination program (GeT-RM) [55] offers materials for quality control, proficiency testing, test development and validation, and research. One category, genetic inherited disease and pharmacogenetics, offers cell lines, DNA, and other samples that © 2011 by Taylor and Francis Group, LLC

110

Quality Assurance in the Pathology Laboratory Table 5.7â•… Characteristics of Selected CDC’s Coriell DNA Cell Line Coriell DNA/Cell Line Number GM02016 GM07439 GM09301 GM10005 GM12244 GM12273

CYP2D6

Assays Used for CYP2D6 Characterizationa

*2XN/*17 *4XN/*41 Duplication *17/*29 *35/*41 *1/*1

A, B, C, D, E A, B, C, D, E A, B, C, D, E A, B, C, D, E A, B, C, D, E A, B, C, D, E

Sources: From CDC’s Genetic Testing Reference Materials Coordination Program (GeT-RM), http://wwwn.cdc.gov/ dls/genetics/rmmaterials/default.aspx, accessed January 15, 2010; CDC—Characteristics of the cell line for CYP2D6 is in the following table, http://wwwn.cdc.gov/dls/genetics/ rmmaterials/pdf/CYP2D6_GeneConsensus.pdf, accessed January 15, 2010. a Assays used: A, Roche Amplichip; B, AutoGenomics INFINITI; C, Luminex XTag; D, ParagonDx; E, lab developed test, ABI snapshot. See assay used and “alleles tested.”

can be used as reference materials for various inherited diseases, pharmacogenetic loci, and biochemical genetics. For example, the characteristics of some of the cell line for CYP2D6 are listed in Table 5.7 [56]. The European Medicines Agency (EMEA) and its Committee on Human Medicinal Products issued a reflection paper on pharmacogenomic samples, testing and data handling with considerations similar to those offered by FDA-CDRH [57]. Another European agency, EuroGentest, offers a listing of quality-control and reference-material producers on a global basis [58]. In ensuring the quality, Australian and South-East Asian Tissue Typing Association (ASEATTA) developed an international quality-assurance program for HLA-*B 5701 genotyping, subscribed by institutional and commercial laboratories [32]. 5.4.5╇ Plasmid-Derived Samples Since a review showed the low percentage 2%–3% of published studies including quality control samples, van der Straaten et al. demonstrated the use of plasmid-derived samples for pharmacogenetics [6]. The concept is based on a previous publication by Javis et al. [59]. In a proof of principle study, plasmidderived samples were generated for TPMT*2, *3B/C, CYP2D6*3, *4, *6, *9, *41, CYP 2C9*2, *3, and CYP 2C19*2, *3. By using primers, plasmid was generated by “ligation of a specific PCR product into pGEM-Teasy and transformation to competent cells” [6]. Tables 5.8 and 5.9 show the primers and sequences, and the characteristics of the plasmid samples, respectively [6]. Quality assurance © 2011 by Taylor and Francis Group, LLC

Pharmacogenomics, Personalized Medicine, Personalized Justice

111

Table 5.8â•… Primers Names and Sequences Number 0363 0364 0365 3066 0367 0368 0369 0370 0371 0372 0373 0374 0375 0376 0377

0378

Name TPMT*2 (G>C) TPMT*2 TPMT*3B (G>A) TPMT*3B TPMT*3C (A>G) TPMT*3C CYP2C19*2 (A>G) CYP2C19*2 CYP2C19*3 (A>G) CYP2C19*3 CYP2C9*3 (C>T) CYP2C9*2 CYP2C9*3 (A>C) CYP2C9*3 CYP2D6 (*6, *4, *3, *9, *41) CYP2D6

SNP

Sequence 5′ 3′

Size (bp)

Position SNP

Forward TTCACTTTAGTACAGTAGCTAC

1150 525

Reverse TCACCATGCTTCAGGAAGC Forward ATTACACACTCGTCTGCACAC

1150 554

Reverse GGTCTCAAACTCCTGGG Forward ACAATTCAGAGTTCAGGAAATT

1150 570

Reverse ATCACCTGAACCTGGGAGGC Forward AAAAGCTTTGAAATCCCCAACTA 1090 552 Reverse ATTCCTAACCAGCTGTCICATC Forward ACAGAAGTCATTTAACTGCTCTG

1092 558

Reverse TTTGCATTTCTCCAATGACTTC Forward GCCATCTGAGTGGCAAGTAT

1150 610

Reverse AGAAACCCCAGAGAAGTCAG Forward TCCATCCAGGTCAGTAACAG

1150 521

Reverse AAGTTGACAGATTAACATCATC Forward CACCTGCACTAGGGAGGT

2330 *6.519

Reverse

CCCTGCCTATACTCTGGAC

*4:658 *3:1370 *9:1434 *41:1809

Source: Reproduced from van der Straaten, T. et al., Pharmacogenomics, 9, 1261, 2008.

of these plasmid samples were checked by genotyping using Pyrosequencing for TPMT and CYP2D6, RFLP for CYP 2C9 and Taqman assay for CYP2C19, and 100% concordance was obtained. The authors cautioned the limitation of SNP genotyping that exclusion of SNPs do not necessarily confirmed a wild-type (*1) genotype. 5.4.6╇ Commercial Sources Maine Molecular Quality Controls Incorporated (MMQCI) and ParagonDX— Quality control products of MMQCI, such as INTROL•, are manufactured from synthetic DNA suspended in a patented, non-infectious, blood-like matrix, containing two synthetic alleles in mimicking genomic DNA [60]. For example, INTROL PGx 1 Control contains two synthetic alleles of Cytochrome © 2011 by Taylor and Francis Group, LLC

112

Quality Assurance in the Pathology Laboratory

Table 5.9â•… Plasmids SNP

Synonym

rs Number

Plasmid Number

Genotype

1707Tdel G1846A 2549Adel 2613– 2615AGdel G2988A C3608T

*6 *4 *3 *9

rs5030655 rs3892097 rs4986774 rs5030656

40, 41, 42 1 2 3, 4

1707Tdel 1846A 2549Adel 2613–2615AGAdel

*41 *2

rs28371725 rs1799853

A42614C

*3

rs1057910

G19154A

*2

rs4244285

G17948A

*3

rs4986893

2988A 3608C 3608T 42614A 42614C 19154G 19154A 17948G 17948A

TPMT

G238C

*2

rs1800462

TPMT

G460A

*3B

rs1800460

A719G

*3C

rs1142345

5 6 7 9, 10, 11 12, 13 18 20 22, 23, 24 25, 26, 27, 28 29 30, 31, 32 33, 34, 35, 36 43 39 37, 38

Gene CYP2D56

CYP2C9

CYP2C19

a

238G 238C 460G 460A 719A 719G

Source: Reproduced from van der Straaten, T. et al., Pharmacogenomics, 9, 1261, 2008. a As a reference for CYP2D6 SNPs a plasmid control was used with the wild-type nucleotides as designated positions (available on request).

P450 2C9 (CYP2C9), Cytochrome P450 4F2 (CYP4F2), and Vitamin K Epoxide Reductase Complex, Subunit 1 (VKORC1) DNA. ParagonDx offers reference controls: CYP2C9, CYP2C19*2, CYP2C19*3 and CYP2C19*17, CYP2D6, VKORC1, UGT1A1, MTHFR, and NAT2, as shown by Table 5.10 [61].

5.5╇Molecular Autopsy, PGx Algorithm, and Selected Cases PGx is gradually gaining awareness and, hopefully, acceptance by the forensic community. Recent indication is the inclusion of PGx information in a handbook by Molina [62] recent publications [37,38] and a chapter by Jortani, Stauble, and Wong [63]. In order to enhance the use of PGx as an adjunct for forensic pathology/toxicology—molecular autopsy, a PGx algorithm has been proposed to guide the selection of candidate cases, as shown by Figure 5.8. Case selection was initiated by forensic pathology/toxicology review, focusing © 2011 by Taylor and Francis Group, LLC

Pharmacogenomics, Personalized Medicine, Personalized Justice

113

Table 5.10â•… ParagonDx’s Gene Control/Defining Mutations Gene Control CYP2D6 *4A/*2AxN CYP2D6 *2M/*17 CYP2D6 *29/*2AxN CYP2D6 *6B/*41 CYP2D6 *1/*5 CYP2D6 *3A/*4A

Defining Mutations *4 (1846G>; *10 (100C>T); *2AxN (CYP450 gene duplication, 1584C>G, 2850C>T) *2M (−15B4C, 2850C>T); *17 (1023C>T) *29 (1659G>A, 3183G>A); *2AxN (CYP450 gene duplication, 1584C>G, 2850>T) *6 (1707T>del); *41 (2988G>A) *5 (CYP2D6 gene deletion) *3 (2549A>del); *4 (1846G>A); *10 (100C>T)

Not for use in diagnostic procedures. Patent pending CYP2D6 ′35/′41 ′35 (3IG>A); ′41 (2988G>A) CYP2D6 ′1/′9 ′9 (2613.2615delAGA) CYP2D6 ′1/′6B ′6 (1707T>del) CYP2D6 ′5/′41 ′5 (CYP2D6 gene deletion); ′41 (2988G>A) CYP2D6 ′5/′5 ′5 (CYP2D6 gene deletion) None (lacks polymorphic sites) CYP2D6 ′IA/′IA CYP2D6 ′4A/′7 ′4 (1846G>A); ′7 (2935A>C) CYP2D6 ′5/′17 ′5 (CYP2D6 gene deletion), ′17 (1023C> T) CYP2D6 ′4/′4xN ′4 (1846G>A); ′4xN (CYP450′ gene duplication, -1846G>A) CYP2D6 *1/*1xN ′1 XN (CYP450 gene duplication, lacks polymorphic sites) CYP2D6 ′2A/*2A ′2A (−1584C>G,2850C> T) CYP2D6 ′1/′2A ′2A (−1584C>G,2850C> T) CYP2D6 ′10B/′10B ′10 (100C>T) None (lacks polymorphic sites) CYP2C19 ′1/*1 CYP2CI9 1/′′′2 ′2 (+19154G> A) CYP2CI9 ′1/′3 ′3 (+17948 G>A) None (lacks polymorphic sites characteristic CYP2C9 ′I/*1 of CYP2C9 ′2, ′3, ′4, ′5, ′8 and ′11) CYP2C9 *1/*3 ′3 (+42614 A>C) CYP2C9 *2/*3 *2 (+3608 C>T); *3 (+42614 A+C), VKORC + 11173CT VKORC1 (+ 1173C>?T) CYP2C9 *2A/*2A CYP2~9 Control—Homozygous for ′2 CYP2C9 *1/*2 (2 (+3608 C>T) CYP2C9 ′3/′*3 ′3 (+42614 A>C) VKORCI (·1639GG/+1173CC/+3730AA) VKORCI (·1 639G>A; 1173C> T; 3730G>A) VKORCI (−I639GG/+1173CC/+3730AA) VKORCI (−1639G>AL; 1173C> T; 3730G>A) VKORCI (−I639GG/+ 1173CC/+3730GG) VKORCI (−1639G>A; 1173C>T; 3730G>A) VKORCI (−1639GA/+1173CT/+3730GG) VKORCI (·1639G>A; 1173C>T; 3730G>A) VKORCI (*1639AA/+ 1173TT/+3730GG) VKORC1 (−1639G>A; 1173C>T; 3730G>A) VKORCI (·1639GA/+ I173CT/+3730GA) VKORC1 (·1639G>,A; 1173C>T; 3730G>,A) (continued) © 2011 by Taylor and Francis Group, LLC

114

Quality Assurance in the Pathology Laboratory

Table 5.10 (continued)â•… ParagonDx’s Gene Control/Defining Mutations Gene Control

Defining Mutations ′I (6TA repeats) *1 (6TA repeats); ′37(8TA repeats) *28 (7TA repeats) *28 (7TA repeats): ″36(5TA repeats) ′1 (6TA repeats); ″28 (7TA repeats)

UGT1A1 *1/*1 UGT1A1 ′1/′37 UGT1AI ′28/′28 UGTIAI *28/′36 UGT1A1 ′1/28

Source: Reproduced from ParagonDx, http://www.paragondx.com/paragon/70/HumanGenomoic-Quality-Controls/, accessed February 9, 2010).

Forensic pathology review Comprehensive drug screen A. Is there an elevated (toxic) drug level?

Yes

Covariables to consider

Covariables considered A–J J. Was the intent of the decedent suicide? No

Yes

No

A. Toxic drug Level B. High metabolic ratio (acute vs. chronic) C. Drug interactions (micromedex) D. Drug metabolized by P450 (polymorphic) E. Sample site (peripheral, heart, etc.) F. Fallani’s intervals (I, II, III, IV) G. Case Hx/death scene investigation H. Medical Hx-medications/drug of abuse I. Autopsy findings J. Intent (suicide)

Toxicology case review

E. Was peripheral blood used? Yes

No F. Postmortem redistribution may cause elevated level

C/H. Are any other drugs detected?

Perform tissue levels and/or alternative blood sources

Yes

No

C. Drug–drug interaction may cause elevated level D. Is the drug metabolized by a polymorphic ensyzme? Yes

No

Perform genotyping. May show genetic predisposition for toxicity Finalize death certification

Figure 5.8╇ Proposed Milwaukee pharmacogenomic algorithm for forensic pathology/toxicology. (With permission from Jannetto, P.J. et al., J. Anal. Tox., 26, 438, 2002.) © 2011 by Taylor and Francis Group, LLC

Pharmacogenomics, Personalized Medicine, Personalized Justice

115

on medical history, autopsy and toxicology findings such as metabolic ratio(s), if available. In the event of elevated drug concentrations, co-variables A–J are then considered in detail. One of the concerns is the effect of postmortem drug redistribution/metabolism which may be minimized/eliminated by using peripheral blood or other samples such as vitreous humor. Other key considerations would include possible drug–drug interaction and diversion. This latter scenario would render the decedent to be less tolerant to drug toxicity. Once the case is selected, the collected blood samples are then transferred to a PGx/molecular laboratory with chain-of-custody to ensure samples integrity. The origin of using PGx as PJ may be credited to a report of a fluoxetine fatality [64]. The report was about a 9 year old boy, diagnosed with attention deficit hyperactivity disorder, obsessive-compulsive disorder, and Tourette’s syndrome. For these disorders, he was medicated with methylphenidate, clonidine, and fluoxetine. He later developed GI toxicity, incoordination and disorientation, seizures, and cardiac arrest. High fluoxetine and norfluoxetine concentrations were detected in postmortem analysis. PGx showed that he was a poor CYP2D6 metabolizer, with impaired metabolism and therefore accumulation of fluoxetine and norfluoxetine. Other published reports including findings for methadone [37], oxycodone [38], and others [10,11].

5.6╇ Conclusions Rapid advances in genomic medicine, coupled with innovations in molecular diagnostics and instrumentation such as LC/MS/MS, have propelled the frontiers of forensic science. Pivotal to successful adoption, PGx quality assurance would strengthen the scientific foundation, and clinical and forensic efficacy. As PGx is emerging, the support of the scientific and communities along with key governmental agencies would point to successful applications which would result in tangible benefit of patient safety—PM. However, “misapplications” might result in the legal proceedings as in the form of PJ. It would be important for the colleagues in forensic science to embrace these developments and to provide input and interpretation wherever appropriate. In so doing, the forensic community would benefit from avoiding adopting “junk” sciences, and would be a vital part in enabling PM and PJ.

References 1. Wong, S.H., Happy, C., Blinka, D. et al. 2010. From personalized medicine to personalized justice—The promise of pharmacogenomics in the justice system. Pharmacogenomics, 11(6), 731–737. 2. Miller, E.D. 2009. A bold leap into the future—Personalized medicine is key to the new genes to society curriculum. In: Hopkins Medicine, ed. S.E. Pasquale. Johns Hopkins Medicine: Baltimore, MD, p. 48. © 2011 by Taylor and Francis Group, LLC

116

Quality Assurance in the Pathology Laboratory

3. Golgin, E. 2009. Epigenetic suicide note. The Scientist, 23(8), 18–19. 4. FDA updates warfarin labeling with PGx-guided dosing ranges. http://www. genomeweb.com/dxpgx/fda-updates-warfarin-labeling-pgx-guided-dosingranges (accessed March 16, 2010). 5. FDA’s boxed warning for clopidogrel. http://www.fda.gov/NewsEvents/ Newsroom/PressAnnouncements/ucm204253.htm (accessed March 13, 2010) (accessed March 16, 2010). 6. van der Strarten, T., Swen, J., Baak-Pablo, R., Guchelaar, H.J. 2008. Use of plasmid-derived external quality control samples in pharmacogenetic testing. Pharmacogenomics 9, 1261–1266. 7. Jeffreys, A.J., Wilson, V., and Thein, S.L. 1985. Individual-specific fingerprints of human DNA. Nature, 316(6023), 76–79. 8. Wong, S.H. 2007. Pharmacogenomics and personalized medicine for drug addiction and toxicology: Towards personalized justice? In: 11th Asian Pacific Congress of Clinical Biochemistry, Beijing, China. 9. Wong, S.H.Y. and Happy, C. 2009. Personalized justice, translational pharmacogenomics and personalized medicine—Relevant to the forensic sciences? Tox. Talk. 33, 22–23. 10. Wong, S.H., Jentzen, J.M., Shi, R.N., and the Forensic Pathology/Toxicology Methadone Pharmacogenomics Study Group (FPTMPGxSG). 2008. Personalized medicine enabling personalized justice: Methadone pharmacogenomics as an adjunct—For molecular autopsy, and for addiction and driving under the influence of drugs (DUID). Clin. Chem. Lab. Med. 46, A118. 11. Wong, S.H.Y. (in press) Pharmacogenomics as molecular autopsy—An adjunct to forensic pathology/toxicology: From Gregor Mendel to personalized medicine and personalized justice. In: Clarke’s Analysis of Drugs and Poisons, eds. A.C. Moffat, D. Osselton, and B. Widdop, 4th edn. Royal Pharmaceutical Society Publishing: London, U.K. 12. Personalized Medicine Coalition. http://www.personalizedmedicinecoalition. org/ (accessed February 3, 2010). 13. Chen, H.-Y., Yu, S.-L., Chen, C.-H. et al. 2007. A five-gene signature and clinical outcome in non-small-cell lung cancer. NEJM 356, 11–20. 14. Herbst, R.S. and Lippman, S.M. 2007. Molecular signatures of lung cancer— Towards personalized therapy. NEJM 356, 76–78. 15. Linder, M.W., Prough, R.A., and Valdes, R. Jr. 1997. Pharmacogenetics: A laboratory tool for optimizing therapeutic efficiency. Clin. Chem. 43(2), 254–266. 16. Evans, W.E. and McLeod, H.L. 2003. Pharmacogenomics—Drug disposition, drug targets and side effects. NEJM 348, 538–549. 17. Weinshilboum, R. 2003. Inheritance and drug response. NEJM 348(6), 529–537. 18. Linder, M.W., Evans, W.E., and McLeod, H.L. 2006. Application of pharmacogenetic principles to clinical pharmacology. In: Applied Pharmacokinetics and Pharmacodynamcis. Principles of Therapeutic Drug Monitoring, eds. M.E. Burton, J.J. Schentag, L.M. Shaw, and W.E. Evans. Lippincott Williams & Wilkins: Philadelphia, PA, pp. 165–185. 19. Home Page of the Human Cytochrome P450 (CYP) Allele Nomenclature Committee at Karolinska Institute. http://www.imm.ki.se/CYPalleles/(accessed February 2, 2010).

© 2011 by Taylor and Francis Group, LLC

Pharmacogenomics, Personalized Medicine, Personalized Justice

117

20. Cytochrome P450 drug interaction table. 2009. http://medicine.iupui.edu/ flockhart/table.htm 21. Bradford, L.D. 2002. CYP2D6 allele frequency in European Caucasians, Asians, Africans and their descendants. Pharmacogenomics 3(2), 229–243. 22. American Association for Clinical Chemistry. 2005. Top ten pharmacogenomics tests. Clinical Laboratory News. Washington, DC, May. 23. Wadelius, M. and Pirmohamed, M. 2007. Pharmacogenetics of warfarin: Current status and future challenges. Pharmacogen. J. 8(7), 99–111. 24. Stehle, S., Kirchheiner, J., Lazar, A., and Fuhr, U. 2008. PGXs of oral anticoagulants. Clin. Pharmacokin. 47, 565–594. 25. Kangelaris, K.N., Bent, S., Nussbaum, R.L., Garcia, D.A., and Tice, J.A. 2009. Genetic testing before anticoagulation? A systematic review of PGX dosing of warfarin. J. Gen. Intern. Med. 24, 656–664. 26. Caldwell, M.D., Awad, T., Johnson, J.A. et al. 2008. CYP4F2 genetic variant alters required warfarin dose. Blood. 111, 4106–4112. 27. Gage, B.F., Eby, C., Johnson, J.A. et al. 2008. Use of PGX and clinical factors to predict the therapeutic dose of warfarin. Clin. Pharmacol. Ther. 84, 326–331. 28. McLeod, H.L. and Watters, J.B. 2004. Irinotecan pharmacogenetics: Is it time to intervene? J. Cin. Onconl. (Editorial) 22, 1356–1359. 29. Mallal, S., Nolan, D., Witt, C. et al. 2002. Association between presence of HLAB*5701, HLA-DR7, and HLA-DQ3 and hypersensitivity toHIV-1 reverse-transcriptase inhibitor abacavir. Lancet 359, 727–732. 30. Mallal, S., Phillips, E., Carosi, G. et al. 2008. HLA-B*5701 Screening for hypersensitivity to abacavir. NEJM 358, 568–579. 31. Hetherington, S., Hughes, A.R., Mosteller, M. et al. 2002. Genetic variations in HLA-B region and hypersensitivity reactions to abacavir. Lancet 359, 1121–1122. 32. Nolan, D. 2009. HLA-B*5701 screening prior to abacavir prescription: Clinical and laboratory aspects. Crit. Rev. Clin. Lab. Sci. 46(3), 153–165. 33. Panel on Antiretroviral Guidelines for Adult and Adolescents. Guidelines for the use of antiretroviral agents in HIV-1-infected adults and adolescents. Department of Health and Human Services. November 3, 2008, pp. 1–146. Available at http:// www.aidsinfo.nih.gov/ContentFiles/AdultandAdolescentGL.pdf 34. Chung, W.H., Hung, S.I., Hong, H.S. et al. 2004. Medical genetics: A marker for Stevens–Johnson syndrome. Nature 428, 486. 35. Hung, S.I., Chung, W.H., Liou, L.B. et al. 2005. HLA-B*5801 allele as a genetic marker for severe cutaneous adverse reactions caused by allopurinol. Proc. Natl. Acad. Sci. USA 102, 4134–4139. 36. Payne, D. 2006. Methodologies for pharmacogenetic testing. Clin. Chem. News 32(7), 14–16. 37. Sirot, E.J. and Beaumann, P. 2009. Therapeutic drug monitoring and pharmacogenetic tests in pharmacovigilance—When and what? Eur. Psych. 24(S1), S107–S109. 38. Wong, S.H.Y., Wagner, M.A., Jentzen, J.M., Schur, C., Bjerke, J., Gock, S.B., and Chang, C.J. 2003. Pharmacogenomics as an adjunct of molecular autopsy for forensic pathology/toxicology: Does genotyping CYP2D6 serve as an adjunct for certifying methadone toxicity? J. Forensic Sci. 48, 1406–1415.

© 2011 by Taylor and Francis Group, LLC

118

Quality Assurance in the Pathology Laboratory

39. Jannetto, P.J., Wong, S.H.Y., Gock, S, Sahin, E., and Jentzen, J.M. 2002. Pharmacogenomics as an adjunct to forensic toxicology: Genotyping oxycodone cases for cytochrome P450 (CYP) 2D6. J. Anal. Tox. 26, 438–447. 40. Wong, S.H.Y., Gock, S.B., Shi, R.Z. et al. 2006. Pharmacogenomics as an aspect of molecular autopsy for forensic pathology/toxicology. In: Pharmacogenomics and Proteomics: Enabling the Practice of Personalized Medicine, eds. S.H.Y. Wong, M. Linder, and R. Valdes Jr. AACC Press: Washington, DC, pp. 311–320. 41. President’s Council of Advisors on Science and Technology issued a report, entitled Priorities for personalized medicine. 2008. http://www.whitehouse.gov/ administration/eop/ostp (accessed February 24, 2009). 42. Leavitt, M. 2007. September 2007 report on Personalized HEALTH CARE: Opportunities, pathways, resources. http://www.hhs.gov/myhealthcare/news/ phc-report.pdf (accessed February 10, 2010). 43. Woodcock, J. 2009. A difficult balance—Pain management, drug safety and the FDA. NEJM 361, 2105–2107. 44. Drug Information Association. 2010. A report on CDER-FDA is fast-tracking a 5 drugs study for breast cancer. March 18. 45. Auxter, S. 2002. Taking a new approach to in vitro diagnostics regulation—A new FDA office to oversee IVDs from conception on. Clin. Lab. News 28(11), 1. 46. FDA-CDRH’s guidance for pharmacogenetic tests and genetic tests for heritable markers, 2007. http://www.fda.gov/downloads/MedicalDevices/ DeviceRegulationandGuidance/GuidanceDocuments/ucm071075.pdf (accessed February 20, 2010). 47. Mansfield, E., Tezak, X., Altaie, S., Simon, K., and Gutman, S. 2007. Biomarkers for pharmacogenetic and pharmacogenomic studies: Special issues in analytical performance. Drug Discov. Today Technol. Crit. Path 4(1), 21–24. 48. Payne, D.A. and Carr, J. 2010. Methodology and quality assurance considerations in pharmacogenetics testing. In: Guidelines and Recommendations for Laboratory Analysis and Application of Pharmacogenetics to Clinical Practice. Laboratory Medicine Practice Guidelines, eds. R. Valdes, D. Payne, M.W. Linder, G. Burckart, D. Farkas, F. Frueh, H. McLeod, J.-P. Morrello, A. Rahman, G. Ruano, L. Shaw, S. Jortani, W. Steimer, and S. Wong. The National Academy of Clinical Biochemistry. American Association for Clinical Chemistry: Washington, DC, pp. 11–13. 49. Linder, M.W. and Steimer, W. 2010. Clinical laboratory services considerations. In: Guidelines and Recommendations for Laboratory Analysis and Application of Pharmacogenetics to Clinical Practice. Laboratory Medicine Practice Guidelines, eds. R. Valdes, D. Payne, M.W. Linder, G. Burckart, D. Farkas, F. Frueh, H. McLeod, J.-P. Morrello, A. Rahman, G. Ruano, L. Shaw, S. Jortani, W. Steimer, and S. Wong. The National Academy of Clinical Biochemistry. American Association for Clinical Chemistry: Washington, DC, pp. 14–17. 50. College of American Pathologists a one-month PGx fellowship at the University of California Irvine. http://www.cap.org/apps/cap.portal?_ nfpb=true&cntvwrPtlt_actionOverride=%2Fportlets%2FcontentViewer%2Fsh (accessed March 1, 2010). 51. Pharmacogenetics Core Laboratory (PCL) at the University of Pittsburgh. http://www.dept-med.pitt.edu/clinpharm/laboratories.html#pharm (accessed March 2, 2010). © 2011 by Taylor and Francis Group, LLC

Pharmacogenomics, Personalized Medicine, Personalized Justice

119

52. Ferreira-Gonzalez, A. 2009. Lab organization, regulation, and reimbursement in molecular pathology. In: AACC Workshop on Principles and Practices of Molecular Diagnostics and Pharmacogenomics. AACC: Chicago, IL. 53. Schur, B.C., Bjerke, J., Nuwayhid, N., and Wong, S.H. 2001. Genotyping of Â�cytochrome P450 2D6 *3 and *4 mutations using conventional PCR. Clin. Chem. Acta. 308, 25–31. 54. College of American Pathologists (CAP)’s Proficiency testing programs and interlaboratory sample exchange programs for molecular genetic testing for heritable diseases and conditions include pharmacogenetic proficiency testing (PGx). (CAP 2010 survey catalog – http://www.cap.org/apps/docs/laboratory_ accreditation/2008_pt_enrollment_guide.pdf). 55. CDC’s Genetic Testing Reference Materials Coordination Program (GeT-RM). http://wwwn.cdc.gov/dls/genetics/rmmaterials/default.aspx (accessed January 15, 2010). 56. CDC—Characteristics of the cell line for CYP2D6 is in the following table. http://wwwn.cdc.gov/dls/genetics/rmmaterials/pdf/CYP2D6_GeneConsensus. pdf (accessed January 15, 2010). 57. Committee on Human Medicinal Products. 2007. Reflection paper on pharmacogenomic samples, testing and data handling. European Medicines Agency (EMEA) (Doc. Ref. EMEA/CHMP/PGxWP/201914/2006). http://www.emea. europa.eu (accessed February 15, 2010). 58. Listing of quality control and reference material producers on a global basis. http://www.eurogentest.org/laboratories/qau/referencematerials/ and http://www.eurogentest.org/web/info/public/unit1/reference_materials/rm_ databases.xhtml (accessed February 6, 2010). 59. Javis, M., Iyer, R.K, Williams, L.O. et al. 2005. A novel method for creating artificial mutant samples for performance evaluation and quality control in clinical molecular genetics. J. Mol. Diagn. 7, 247–251. 60. Maine Molecular Quality Controls Incorporated. http://www.mmqci.com/qcPGx1.php (accessed February 9, 2010). http://www.paragondx.com/paragon/70/Human-Genomoic 61. ParagonDx. Quality-Controls/(accessed February 9, 2010). 62. Molina, D.K. 2010. Handbook of Forensic Toxicology for Medical Examiners. CRC Press: Boca Raton, FL, pp. 1–370 (Appendix C—PGXs, 343–347). 63. Jortani, S., Stauble, E., and Wong, S.H.Y. (in press). Pharmacogenetics in clinical and forensic toxicology: Opioid overdoses and deaths. In: Handbook of Drug Interaction—A Clinical and Forensic Guide, eds. A. Mozayani and L.P. Raymond. Humana Press: Totowa, NJ. 64. Sallee, F.R., DeVane, C.L., and Ferrell, R.E. 2000. Fluoxetine-related death in a child with cytochrome P-450 2D6 genetic deficiency. J. Child. Adolsec Psychopharmacol. 10, 327–334.

Web Sites http://www.genome.gov/glossary.cfm http://www.geneclinics.org http://www.cdc.gov/genomics/hugenet/reviews.htm © 2011 by Taylor and Francis Group, LLC

120

Quality Assurance in the Pathology Laboratory

http://www.cancer.gov/cancer_information/pdq http://www.ncbi.nlm.nih.gov/omin/ http://www4.od.nih.gov/oba/sacgt.htm http://www.nhlbi.nih.gov/resources/docs/cht-book.htm http://www.nhlbi.nih.gov/about/factpdf.htm http://www.cardiogenomics.med.harvard.edu http://www.nhgri.nih.gov/Policy_and _public_affairs/Legislation/insure.htm http://medicine.iupui.edu/flockhart/table.htm http://www.imm.ki.se/CYPalleles/ http://www.aidsinfonyc.org/tag/science/pgp.html http://www.hhs.gov/news/speech/2006/060630.html

© 2011 by Taylor and Francis Group, LLC

Quality Aspects in Autopsy versus Virtopsy

6

Michael J. Thali and Stephan A. Bolliger

Contents 6.1 Introduction 6.1.1 History 6.1.2 Clinical Autopsy 6.1.3 Forensic Autopsy 6.1.4 Virtopsy 6.2 Techniques 6.2.1 Conventional Clinical and Forensic Autopsy 6.2.2 Virtopsy 6.2.2.1 Photogrammetry-Supported 3D Optical Surface Scanning 6.2.2.2 Computed Tomography 6.2.2.3 Magnetic Resonance Tomography 6.2.2.4 Data Fusion 6.3 Comparison of Quality Aspects in Autopsy and Virtopsy References

121 121 122 122 122 123 123 124 124 125 126 126 127 132

6.1╇Introduction 6.1.1╇History The term “autopsy” comes from the word composition “autos” and “opsomei,” which together mean “seeing (for) oneself.” For this reason, “autopsy” is itself already a quality concept as one sees from the adage: “One only believes what one has seen for oneself.” Autopsies are carried out in various fields and, historically, they have also been popular in various epochs and medical professional disciplines. On the one hand, a few hundred years ago, the anatomic autopsy served especially for understanding the human body with regard to morphology and function. The aim of using cadavers then was to obtain anatomic and physiologic knowledge in order to understand basic somatic functions such as the makeup of the organs, the connections of the circulation system, as

© 2011 by Taylor and Francis Group, LLC

121

122

Quality Assurance in the Pathology Laboratory

well as the nervous system. Today, anatomic sectioning serves primarily in the preclinical training of medical students. 6.1.2╇ Clinical Autopsy The main focus of the pathologic or clinical autopsy is no longer on clarifying how humans are constructed but rather on the quality control (QC) of clinical diagnostics and therapy [1–8]. Only a few decades ago, the rate of autopsies, depending on social and medical understanding, was still 10% or more. In the last years and in many places, though, the proportion of postmortem autopsies, used in hospitals for QC or for clearing up uncertainties, has fallen back, in some cases to less than 10% [9,10]. The task of pathologists has tended to develop away from the cadaver toward biopsy histopathology. In the last decades, there have been numerous publications that plausibly maintain that this reduction is dangerous and that autopsies are still needed in order to reveal diagnostic and therapeutic errors [11–13]. Autopsies, from a clinical, “educational,” and epidemiologic point of view, are therefore very valuable [14]. It is undeniable that the main interest of doctors, who have ascribed to healing patients in accordance with the Hippocratic Oath, has never been the deceased because, in the end, the cadaver ultimately represents a failure of the medical art. 6.1.3╇Forensic Autopsy Forensic medicine has the task of examining the so-called uncommon death as well as determining the aftereffects of violence to living persons. The best definition for an uncommon death was given by the former director of the Institute for Forensic Medicine of the University of Zürich, Prof. Fritz Schwarz: “Uncommon deaths are those that occur suddenly, unexpectedly, with suspicion of the aftereffects of violence, even when it might have occurred earlier.” In Switzerland, uncommon deaths must be reported to the district attorney, who will then commission further examinations, such as an autopsy. In forensic medicine, autopsies serve for clarifying the cause and manner of death. Since forensic medicine is frequently concerned with violent death and bodily harm, it focuses more on reconstruction of the course of events rather than microscopic and/or metabolic findings, as opposed to clinical pathologists. 6.1.4╇ Virtopsy Over hundred years ago, Wilhelm Conrad Röntgen introduced radiology into medicine. To this have now been added ultrasound, computer tomography (CT), magnetic resonance tomography (MRT), as well as all their respective © 2011 by Taylor and Francis Group, LLC

Quality Aspects in Autopsy versus Virtopsy

123

subspecialities and, in the clinic, they now belong to the methodic standards. The situation has been different in forensic medicine where, except classical x-ray, imaging methods were ignored for a long time. In the middle of the 1990s, the Institute for Forensic Medicine in Bern conducted a project dedicated to improve forensic medicine by applying different imaging techniques. The project was eventually called “Virtopsy,” a word derived from “virtual” and “autopsy,” because we wanted to emphasize the objectivity and not the subjectivity and therefore, eliminated the word “autos” (self). The goal of the Virtopsy Project [15–17] was to document findings three dimensionally using the most modern technologies (surface scanning, CT scanning, and magnetic resonance imaging [MRI] scanning), supplemented by postmortem biopsies and angiography. The imaging methods of Virtopsy, described in more detail in the following text, have revolutionized forensic pathology with regard to documentation and reconstruction. The project initially focused on corpses, but now it also serves in assessing living victims of assault.

6.2╇ Techniques 6.2.1╇ Conventional Clinical and Forensic Autopsy As far as we are aware, the standards as to how an anatomic or pathologic autopsy is performed are approximately the same in most countries. By and large, the standards have been anchored within the frameworks of professional or supra-regional societies. In the field of forensic autopsy, there are minimum standards from various societies or guidelines that have been negotiated by local QC organizations. Autopsy quality obviously depends, though, on the school, the training, and the experience of the pathologist. On the European mainland, the forensic autopsy has its roots in Austria/Hungary. Especially, the Germanspeaking countries in Europe orient themselves thereon. In America, a recently published report of the National Research Councils of the National Academies entitled “Strengthening Forensic Science in the United States: A Path Forward” showed that, especially in the area of forensic science, more quality standards are needed. A conventional clinical autopsy typically consists of an external examination of the corpse, an opening of the cranial, the thoracic and abdominal cavities, and an inspection/dissection of the internal organs. Of these organs, samples for histological and/or microbiological examinations are taken. The most relevant findings are photographed and noted on sketches. In addition to these steps, conventional forensic autopsy cases are frequently x-rayed and samples for chemical and toxicological analyses are taken. Besides the photographs and sketches, a written autopsy protocol documents the findings © 2011 by Taylor and Francis Group, LLC

124

Quality Assurance in the Pathology Laboratory

and the conclusions of the examiner are summarized in a written report or expertise. 6.2.2╇ Virtopsy Today, the Institute for Forensic Medicine in Bern uses the following technologies routinely: Photogrammetry-supported three-dimensional (3D) optical surface scanning Computer tomography, supplemented by postmortem angiography and/or postmortem biopsies Magnetic resonance imaging Data fusion 6.2.2.1  Photogrammetry-Supported 3D Optical Surface Scanning Modern 3D surface scanners are mainly utilized in the industry (automobile fabrication, aerospace technology, and product deformation analyses). We have modified these 3D surface scanners in such a way that it is now possible to document the exterior of both the living and the deceased (Figure  6.1). This  occurs in true-to-scale 3D resolution and with color information. Somatic injuries, due in the living to healing and in the deceased, to biological decay, are recorded for all posterity in three dimensions. In this way, patterned injuries to the body, which permit one to make inferences about the object that caused the injury, can be compared years later, if need be, with a possible injurious instrument. The injury shape agreement analysis, thus,

Figure 6.1╇ Surface scanning. The projector at the end of a robot arm casts striped light onto the object to be scanned, thus gaining information as to the surface structure.

© 2011 by Taylor and Francis Group, LLC

Quality Aspects in Autopsy versus Virtopsy

125

is no longer time dependent. Such data, say for obtaining a second opinion, can now be sent around the world via the Internet or other data transmission channels. For example, injuries due to teeth or dentures, shoe imprints, tire profiles, and all other forms of patterned, violent effects to the bodily surface can be documented in three dimensions in this way [18–24] and are then available globally for later analyses and/expertises. 6.2.2.2  Computed Tomography Through the use of CT examinations, one can look into the body interior noninvasively (Figures 6.2 through 6.4). The essential findings from the somatic interior can thus be documented within a few minutes, in the clinic just as in forensic medicine [25–27]. It is undisputed that, when using CT, there are still autopsy findings that cannot be recorded in that way [28–32]. Our experience after more than 10 years shows, though, that using CT somatic findings can be documented and so visualized in three dimensions that these can be understood by lay persons. Due to the resolution of today’s CT instruments, not every bodily finding that one can detect in an autopsy can be documented by this means. For this reason, besides CT, we have developed a method of postmortem angiography (Figure 6.5), similar to what is found in the clinic. With postmortem angiography, the vasculature can be displayed [33–37]. Through this, it is possible to verify the smallest injuries that arise, for example, through gunshots or stabbings as well as in operations. Even leaks in the vascular bed and the coronary valves can be displayed in this way.

Figure 6.2╇ CT, 3D reconstruction of the skull of a suicidal gunshot to the mouth. Note the outward beveling at the vertex, indicating an exit defect.

© 2011 by Taylor and Francis Group, LLC

126

Quality Assurance in the Pathology Laboratory

For the possibility of histological examinations, we extended noninvasive Virtopsy by means of postmortem biopsies [38–39], in order to obtain tissue specimens from the cadaver (Figure 6.6). These tissue specimens are then made accessible for microscopic examinations. Experience has shown that—with the methods just described already—60%–80% of forensically relevant findings could be documented. 6.2.2.3  Magnetic Resonance Tomography For a high soft tissue resolution, not achievable to date with CT, one can perform an MRT scan. An MRT examination is essential, especially when it comes to coronary examinations, say in order to diagnose an infarct [40]. Also, findings in the brain, liver, etc., are better visualized than in CT [41–44] Figure 6.7). Essential is also the much better displayed soft tissue coverings that are of interest to the Figure 6.3╇ CT, 3D bone forensic pathologist, in contrast with the clinician. reconstruction. Note Thus, for example, impact injuries that occur as a the pelvic girdle fractures. Such an image is result of a traffic accident or the effects of violence easily appreciable, even to the neck (manual strangulation) become observ- for medical laypersons, able very readily. Experience in this area has already such as members of the brought us so far that we have sent victims of stran- court. gulations for clinical MRT examining in order to document the injuries [45,46]. Today, it is possible for us to examine the severity of lesions of living victims of strangulation, even if no injuries are seen in the clinical examination. In the early part of 2010, our Total Imaging Matrix TIM-MRI system, which has been in operation since 2009, could be extended with the so-called synthetic MRI software. The advantage of this TIM synthetic MRI system lies in the fact that in one examination step, various MRI sequences (such as T1-T2-PD, etc.) could be performed from tip to toe without any change of the surface traces (Figure 6.8). 6.2.2.4  Data Fusion Thanks to modern software, it is now possible to merge the data from the surface scannings and radiologic data (MRT and CT) into one data set. In addition to the body data set of living persons and of the deceased, we have now begun to include, in cooperation with the accident investigation service of the Bern cantonal police, the injurious objects (which can be an automobile or some other object) in the documentation [19]. This has gone so far © 2011 by Taylor and Francis Group, LLC

Quality Aspects in Autopsy versus Virtopsy

(a)

127

(b)

Figure 6.4 (See color insert following page 180.)╇ Shotgun gunshot to the

back. Semitranslucent skeletal reconstruction: (a) frontal view and (b) lateral view. Objects of a very high radioopacity, such as the pellets (encircled) or the hip prosthesis (arrow) are colored blue by the computer. Such an image makes assessment of the pellet distribution easier than an autopsy.

that we now also document in 3D the scene of the event (say in homicides or complex traffic accidents) with scanning methods. In this way, the situation can be displayed comprehensively. This means that the body and/or the injury that is involved, the causative object, and the 3D event scene are compiled together into one data set. In this way, the accident can be reconstructed virtually.

6.3╇Comparison of Quality Aspects in Autopsy and Virtopsy Autopsy is generally regarded as the “gold standard” in postmortem examination. Indeed, clinics rely on clinical autopsies, for example, to answer questions regarding effectiveness of a certain treatment regimen or the course of a © 2011 by Taylor and Francis Group, LLC

128

Quality Assurance in the Pathology Laboratory

Figure 6.5╇ CT, 3D reconstruction with virtual removal of the left side of the

skull after postmortem whole-body angiography. The cerebral arteries are clearly visible.

Figure 6.6╇ Robot arm performing a biopsy. The biopsy needle can be guided accurately based on the CT images to sample a certain region of interest.

neoplastic disorder. Such an autopsy can deliver a multitude of specimens for further examination or research to an extent obviously not possible to gain in living patients. Alas, the rate of clinical autopsies is declining more or less rapidly due to increasing objections of the next of kin for religious and cultural reasons. © 2011 by Taylor and Francis Group, LLC

Quality Aspects in Autopsy versus Virtopsy

(a)

129

(b)

Figure 6.7 (See color insert following page 180.)╇ (a) Axial CT of the head

showing a region highly suspicious for a cerebral hemorrhage (yellow arrow). Note also the bubbles in the brain (green arrows), which are due to putrefaction, gas production of this decomposing body. (b) MRT of hemorrhage-sensitive sequence showing the CT findings even more clearly.

(a)

(b)

Figure 6.8╇ Traffic accident victim (pedestrian): (a) TIM, T1-weighted sequence showing fluid (blood) in the left thoracic cavity (arrow) and (b) T2 sequence showing a signal increase of the right lung due to blood aspiration (encircled). © 2011 by Taylor and Francis Group, LLC

130

Quality Assurance in the Pathology Laboratory

The forensic autopsy, dedicated to determining the manner of death and reconstructing the course of events, is immensely important in examining a fatality in which involvement of a third party is suspected or cannot be excluded. The forensic autopsy is indeed so important that many countries have laws that prevent the next of kin being able to prevent such examinations and that hardly any judge would try a case without having the autopsy report. However, the autopsy—clinical and forensic—has several drawbacks. Although relevant autopsy findings are often documented by photography, less relevant or normal, inconspicuous findings are—if at all—only documented by the autopsy protocol. Therefore, one has to rely on the examiner’s experience in discriminating relevant from less relevant findings. In clinical autopsies, which rely heavily on histology, this generally does not pose great problems. However, in forensic autopsies, the experience and the integrity of the examiner may be challenged at court. Here, the forensic examiner is forced to prove the findings. According to our experience, the challenging of a forensic examiner’s competence is an increasing phenomenon. Therefore, the forensic examiner is well advised to take photographs of all findings—injured or pathologically altered as well as inconspicuous—in order to prove that, for example, a cardiac disease did or did not influence the victims outcome in, say, a shooting incident. In Switzerland, such a situation, namely a generally nonlethal gunshot injury which, due to a preexisting cardiac disease ultimately became fatal, will influence a judge’s verdict in favor of the defendant. However, even an x-ray or a photograph of a finding may pose problems. These methods reduce a three-dimensional structure to a two-dimensional image. The object in question can therefore only be viewed in one plane and fails to deliver information of the areas not depicted. With forensic imaging as described earlier, several important advantages arise. Certain findings such as gas within the vascular bed indicating a gas embolism may be missed entirely if one does not take (time consuming) appropriate measures at autopsy. Decomposing corpses may also pose difficulties at autopsy. Often, liquefying organs such as the brain are only kept in shape by thin boundaries, which are destroyed at autopsy, thus giving rise to the organ oozing out, eluding further investigation. As forensic imaging does not harm such boundaries, the chances of assessing decomposing organs are greatly enhanced. Furthermore, foreign objects—perhaps case relevant (i.e., bullet fragments, knife tips, etc.) or useful for identification of the corpse (i.e., dental fillings, prosthesis, etc.)—can be identified rapidly.

© 2011 by Taylor and Francis Group, LLC

Quality Aspects in Autopsy versus Virtopsy

131

Acceptance of traditional autopsy has decreased dramatically in the past few years. By scanning corpses, a triage is possible. Many cases that would have been autopsied otherwise would not need further investigation. On the other hand, due to the greater acceptance of noninvasive forensic methods, a broader triage system is possible: when signs of a third-party involvement exist at postmortem imaging, then the arguments for an autopsy are much stronger. One might hypothesize that screening a greater proportion of deceased persons by imaging might help detect a larger number of homicides. MSCT and MRI, combined with postmortem angiography and imageguided biopsy, also have the potential to replace traditional autopsy in many cases, and therefore, to provide a viable examination technique for cultural circles in which autopsy is not welcome. Three-dimensionally reconstructed radiological images are, according to our experience, definitively preferred to by members of the court who do not possess medical knowledge of the typical blood-rich autopsy photographs. However, we believe that forensic imaging has an even greater advantage, namely, the reproducibility of findings. The surface of a corpse (or other object) and internal findings can be documented to scale. The hereby resulting 3D documentation can be stored digitally The data structure of these digital records is ideal for digital storage: by creating 3D images of bodies, instruments, and vehicles suspected of creating injuries and crime scenes, cases can be reexamined decades later, even after burial of the body and liberation of the crime scene. This reexamination can be undertaken by a completely different, unprejudiced group, giving rise to “forensic telemedicine,” a method that would correspond to the routinely performed “telepathology” conferences in clinical pathology. This technique will enhance quality assurance by allowing a neutral second opinion and a benchmark comparison. In daily forensic practice, it has become evident that through applying forensic imaging, an increase in quality and an improvement in forensic diagnostics can be achieved; and the examination results based on the imaging are often quicker and, thanks to a more visual 3D reconstruction, can be displayed in a way that lay persons can understand and comprehend. Momentarily, in terms of workflow and process, this Virtopsy system integration is the only forensic examination track in a forensic institute that has brought together all the modalities and technologies in this form for daily use and research. The method is so promising that we, at the Institute for Forensic Medicine in Bern, have built up an examination sequence of the abovementioned methods. In the last months, we have been able to integrate the various examination methods of the surface scannings, the CT as well as the postmortem angiography and biopsies within one examination room. And

© 2011 by Taylor and Francis Group, LLC

132

Quality Assurance in the Pathology Laboratory

we have optimized all of it with robot support. The resulting product is our “Virtobot.” Further developments in this field will surely follow. Imaging approaches with higher resolutions as well as faster software-based merging of the data are to be aimed for. Our goal is to create additional benefits in forensic clarification of events, entirely in accordance with our institute motto: “In every case—create clarity.”

References 1. Nichols L, Aronica P, and Babe C. 1998. Are autopsies obsolete? Am J Clin Pathol. 110: 210–218. 2. van den Tweel JG. 1999. Autopsies as an important indicator for quality control. Ned Tijdschr Geneeskd. 143: 2351–2354. 3. Dehner LP. 2010. The medical autopsy: Past, present, and dubious future. Mo Med. 107: 94–100. 4. Lundberg GD. 1998. Low-tech autopsies in the era of high-tech medicine: Continued value for quality assurance and patient safety. JAMA 280: 1273–1274. 5. Zarbo RJ, Baker PB, and Howanitz PJ. 1999. The autopsy as a performance measurement tool—Diagnostic discrepancies and unresolved clinical questions: A college of American pathologists Q-probes study of 2479 autopsies from 248 institutions. Arch Pathol Lab Med. 123: 191–198. 6. Smith CJ, Scott SM, and Wagner BM. 1998. The necessary role of the autopsy in cardiovascular epidemiology. Hum Pathol. 29: 1469–1479. 7. Burke MC, Aghababian RV, and Blackbourne B. 1990. Use of autopsy results in the emergency department quality assurance plan. Ann Emerg Med. 19: 363–366. 8. Fernando LBM. 2008. Place of autopsy in quality assurance of curative service. Galle Med J. 13: 51–54. 9. Shojania KG and Burton EC. 2008. The vanishing nonforensic autopsy. N Engl J Med. 358: 873–875. 10. Sinard JH. 2001. Factors affecting autopsy rates, autopsy request rates, and autopsy findings at a large academic medical center. Exp Mol Pathol. 70: 333–343. 11. Aalten CM, Samson MM, and Jansen PA. 2006. Diagnostic errors; the need to have autopsies. Neth J Med. 64: 186–190. 12. Marwick C. 1995. Pathologists request autopsy revival. JAMA. 273: 1889–1891. 13. Xiao J, Krueger GR, Buja LM, and Covinsky M. 2009. The impact of declining clinical autopsy: Need for revised healthcare policy. Am J Med Sci. 337: 41–46. 14. Burton JL and Underwood J. 2007. Clinical, educational, and epidemiological value of autopsy. Lancet 369: 1471–1480. 15. Thali MJ, Yen K, Schweitzer W, Vock P, Boesch C, Ozdoba C, Schroth G et al. 2003. Virtopsy, a new imaging horizon in forensic pathology: Virtual autopsy by postmortem multislice computed tomography (MSCT) and magnetic resonance imaging (MRI)—A feasibility study. J Forensic Sci. 48: 386–403. 16. Bolliger SA, Thali MJ, Ross S, Buck U, Naether S, and Vock P. 2008. Virtual autopsy using imaging: Bridging radiologic and forensic sciences. A review of the Virtopsy and similar projects. Eur Radiol. 18: 273–282.

© 2011 by Taylor and Francis Group, LLC

Quality Aspects in Autopsy versus Virtopsy

133

17. Thali MJ, Dirnhofer R, and Vock PP, eds. 2009. The Virtopsy Approach-3D Optical and Radiological Scanning and Reconstruction in Forensic Medicine, CRC Press, Boca Raton, FL. 18. Buck U, Albertini N, Naether S, and Thali MJ. 2007. 3D documentation of footwear impressions and tyre tracks in snow with high resolution optical surface scanning. Forensic Sci Int. 171: 157–164. 19. Buck U, Naether S, Braun M, Bolliger S, Friederich H, Jackowski C, Aghayev E, Christe A, Vock P, Dirnhofer R, and Thali MJ. 2007. Application of 3D documentation and geometric reconstruction methods in traffic accident analysis: With high resolution surface scanning, radiological MSCT/MRI scanning and real data based animation. Forensic Sci Int. 170: 20–28. 20. Thali MJ, Braun M, and Dirnhofer R. 2003. Optical 3D surface digitizing in forensic medicine: 3D documentation of skin and bone injuries. Forensic Sci Int. 137: 203–208. 21. Thali MJ, Braun M, Markwalder TH, Brueschweiler W, Zollinger U, Malik NJ, Yen K, and Dirnhofer R. 2003. Bite mark documentation and analysis: The forensic 3D/CAD supported photogrammetry approach. Forensic Sci Int. 135: 115–121. 22. Thali MJ, Braun M, Brueschweiler W, and Dirnhofer R. 2003. Morphological imprint: Determination of the injury-causing weapon from the wound morphology using forensic 3D/CAD-supported photogrammetry. Forensic Sci Int. 132: 177–181. 23. Brüschweiler W, Braun M, Dirnhofer R, and Thali MJ. 2003. Analysis of patterned injuries and injury-causing instruments with forensic 3D/CAD supported photogrammetry (FPHG): An instruction manual for the documentation process. Forensic Sci Int. 132: 130–138. 24. Thali MJ, Braun M, Brüschweiler W, and Dirnhofer R. 2000. Matching tire tracks on the head using forensic photogrammetry. Forensic Sci Int. 11: 281–287. 25. Thali MJ, Schweitzer W, Yen K, Vock P, Ozdoba C, Spielvogel E, and Dirnhofer R. 2003. New horizons in forensic radiology: The 60-second digital autopsy-fullbody examination of a gunshot victim by multislice computed tomography. Am J Forensic Med Pathol. 24: 22–27. 26. Leth PM. 2009. Computerized tomography used as a routine procedure at postmortem investigations. Am J Forensic Med Pathol. 30: 219–222. 27. Ljung P, Winskog C, Persson A, Lundström C, and Ynnerman A. 2006. Full body virtual autopsies using a state-of-the-art volume rendering pipeline. IEEE Trans Vis Comput Graph. 12: 869–876. 28. Aghayev E, Christe A, Sonnenschein M, Yen K, Jackowski C, Thali MJ, Dirnhofer R, and Vock P. 2008. Postmortem imaging of blunt chest trauma using CT and MRI: Comparison with autopsy. J Thorac Imaging. 23: 20–27. 29. Christe A, Ross S, Oesterhelweg L, Spendlove D, Bolliger S, Vock P, and Thali MJ. 2009. Abdominal trauma—Sensitivity and specificity of postmortem noncontrast imaging findings compared with autopsy findings. J Trauma. 66: 1302–1307. 30. Jacobsen C and Lynnerup N. 2010. Craniocerebral trauma—Congruence between post-mortem computed tomography diagnoses and autopsy results: A 2-year retrospective study. Forensic Sci Int. 194: 9–14.

© 2011 by Taylor and Francis Group, LLC

134

Quality Assurance in the Pathology Laboratory

31. Jacobsen C, Bech BH, and Lynnerup N. 2009. A comparative study of cranial, blunt trauma fractures as seen at medicolegal autopsy and by computed tomography. BMC Med Imaging. 9: 18. 32. Filograna L, Tartaglione T, Filograna E, Cittadini F, Oliva A, and Pascali VL. 2010. Computed tomography (CT) virtual autopsy and classical autopsy discrepancies: Radiologist’s error or a demonstration of post-mortem multi-detector computed tomography (MDCT) limitation? Forensic Sci Int. 195: e13–e17. 33. Grabherr S, Djonov V, Friess A, Thali MJ, Ranner G, Vock P, and Dirnhofer R. 2006. Postmortem angiography after vascular perfusion with diesel oil and a lipophilic contrast agent. AJR Am J Roentgenol. 187: W515–W523. 34. Jackowski C, Bolliger S, Aghayev E, Christe A, Kilchoer T, Aebi B, Périnat T, Dirnhofer R, and Thali MJ. 2006. Reduction of postmortem angiographyinduced tissue edema by using polyethylene glycol as a contrast agent dissolver. J Forensic Sci. 51: 1134–1137. 35. Grabherr S, Gygax E, Sollberger B, Ross S, Oesterhelweg L, Bolliger S, Christe A, Djonov V, Thali MJ, and Dirnhofer R. 2008. Two-step postmortem angiography with a modified heart-lung machine: Preliminary results. AJR Am J Roentgenol. 190: 345–351. 36. Ross S, Spendlove D, Bolliger S, Christe A, Oesterhelweg L, Grabherr S, Thali MJ, and Gygax E. 2008. Postmortem whole-body CT angiography: Evaluation of two contrast media solutions. AJR Am J Roentgenol. 190: 1380–1389. 37. Flach PM, Ross SG, Bolliger SA, Preiss US, Thali MJ, and Spendlove D. 2010. Postmortem whole-body computed tomography angiography visualizing vascular rupture in a case of fatal car crash. Arch Pathol Lab Med. 134: 115–119. 38. Aghayev E, Ebert LC, Christe A, Jackowski C, Rudolph T, Kowal J, Vock P, and Thali MJ. 2008. CT data-based navigation for post-mortem biopsy—A feasibility study. J Forensic Leg Med. 15: 382–387. 39. Aghayev E, Thali MJ, Sonnenschein M, Jackowski C, Dirnhofer R, and Vock P. 2007. Post-mortem tissue sampling using computed tomography guidance. Forensic Sci Int. 166: 199–203. 40. Jackowski C, Christe A, Sonnenschein M, Aghayev E, and Thali MJ. 2006. Postmortem unenhanced magnetic resonance imaging of myocardial infarction in correlation to histological infarction age characterization. Eur Heart J. 27: 2459–2467. 41. Patriquin L, Kassarjian A, Barish M, Casserley L, O’Brien M, Andry C, and Eustace S. 2001. Postmortem whole-body magnetic resonance imaging as an adjunct to autopsy: Preliminary clinical experience. J Magn Reson Imaging. 13: 277–287. 42. Bisset R. 1998. Magnetic resonance imaging may be alternative to necropsy. BMJ. 317: 1450. 43. Roberts IS, Benbow EW, Bisset R, Jenkins JP, Lee SH, Reid H, and Jackson A. 2003. Accuracy of magnetic resonance imaging in determining cause of sudden death in adults: Comparison with conventional autopsy. Histopathology 42: 424–430. 44. Ros PR, Li KC, Vo P, Baer H, and Staab EV. 1990. Preautopsy magnetic resonance imaging: Initial experience. Magn Reson Imaging. 8: 303–308.

© 2011 by Taylor and Francis Group, LLC

Quality Aspects in Autopsy versus Virtopsy

135

45. Christe A, Thoeny H, Ross S, Spendlove D, Tshering D, Bolliger S, Grabherr S, Thali MJ, Vock P, and Oesterhelweg L. 2009. Life-threatening versus non-lifethreatening manual strangulation: Are there appropriate criteria for MR imaging of the neck? Eur Radiol. 19: 1882–1889. 46. Yen K, Vock P, Christe A, Scheurer E, Plattner T, Schön C, Aghayev E, Jackowski C, Beutler V, Thali MJ, and Dirnhofer R. 2007. Clinical forensic radiology in strangulation victims: Forensic expertise based on magnetic resonance imaging (MRI) findings. Int J Legal Med. 121: 115–123.

© 2011 by Taylor and Francis Group, LLC

Accreditation, Standards, and Education: Their Role in Maintaining Quality

© 2011 by Taylor and Francis Group, LLC

III

Role of Accreditation Procedures in Maintaining Quality

7

Maciej J. Bogusz and Huda Hassan

Contents Abbreviations 7.1 Definitions of Accreditation 7.2 Role and Aims of Accreditation Components in Pathology and Laboratory Medicine 7.2.1 Role of Proficiency Testing 7.2.2 Role of Inspection 7.2.3 Role of Quality Management 7.2.3.1 Quality Management Plan 7.2.3.2 Requirements of CAP, ISO 15189, and ISO/EC 17025 Regarding QM 7.3 Legal Frames, Regulations, and Accreditation Bodies in Pathology, Laboratory Medicine, and Related Areas 7.3.1 International Standards of ISO 7.3.1.1 Development of ISO 17025 and ISO 15189 7.3.1.2 Relationship between ISO 9001, ISO 17025, and ISO 15189 7.3.1.3 Management Requirements of ISO 15189 7.3.1.4 Technical Requirements of the ISO 15189 7.3.1.5 Technical Requirements of the ISO/IEC 17025:2005 7.3.1.6 Accreditation of Testing Laboratories and Medical Laboratories According to ISO 17025 and/or ISO 15189 7.3.2 International Accreditation Organizations 7.3.2.1 International Laboratory Accreditation Cooperation 7.3.2.2 International Accreditation Forum

© 2011 by Taylor and Francis Group, LLC

139

140 141 143 143 147 149 149 150 153 153 156 156 157 162 166 168 172 172 173

140

Quality Assurance in the Pathology Laboratory

175 7.3.3 U.S. Regulations and Accreditation Organizations 7.3.3.1 Centers for Medicare and Medicaid Services Clinical Laboratory Improvement Act (CMS CLIA) 175 7.3.3.2 Commission on Office Laboratory Accreditation 177 178 7.3.3.3 College of American Pathologists (CAP) 187 7.3.3.4 JCIA 7.3.3.5 Other U.S. Nonmedical Accreditation 190 Organizations 191 7.3.4 European Accreditation Organizations 191 7.3.4.1 European Cooperation for Accreditation 192 7.3.4.2 European Standards Organization CEN 7.3.5 Accreditation Organizations and Policies in Selected 194 Countries 194 7.3.5.1 Canada 194 7.3.5.2 United Kingdom 7.3.5.3 Germany 195 196 7.3.5.4 Finland 196 7.3.5.5 Italy 196 7.3.5.6 France 197 7.3.5.7 China 197 7.3.5.8 Developing Countries 199 7.4 Publications and Journals on Accreditation 201 References

Abbreviations A2LA American Association for Lab Accreditation American Association of Blood Banks AABB ANSI-ASQ American National Standards Institute-American Society for Quality American Osteopathic Association AOA ASCLD-LAB American Society of Crime Lab Directors/Laboratory Accreditation Board College of American Pathologists CAP CEN Comité Europeen de Normalisation (European Standards Organization) Comité International des Poids et Mesures CIPM CLIA Clinical Laboratory Improvement Amendments CLSI Clinical and Laboratory Standard Institute CMS Centers for Medicare and Medical Services Commission on Office Laboratory Accreditation COLA Clinical Pathology Accreditation CPA © 2011 by Taylor and Francis Group, LLC

Role of Accreditation Procedures in Maintaining Quality

141

DAP Deutsches Akkreditierungssystem Prüfwesen (German Accreditation System for Testing) European Cooperation for Accreditation EA EC4 The European Communities Confederation of Clinical Chemistry and Laboratory Medicine External quality assessment EQA EQALM European Committee for External Quality Assurance Programmes in Laboratory Medicine Food Analysis Performance Assessment Scheme FAPAS Food and Drug Administration FDA Good clinical laboratory practice GCLP Good laboratory practice GLP U.S. Department of Health and Human Services HHS IAF International Accreditation Forum International Accreditation Service IAS ICSCA Industry cooperation on standards and conformity assessment The International Electrotechnical Commission IEC IFCC International Federation of Clinical Chemistry and Laboratory Medicine IFSTP International Federation of Societies of Toxicologist Pathologists International Laboratory Accreditation Cooperation ILAC International Organization for Standardization ISO Joint Commission JC Joint Commission International Accreditation JCIA Laboratory Accreditation Bureau L-A-B LAP Laboratory Accreditation Program of CAP LIS Laboratory Information System National Voluntary Accreditation Program NVLAP OIML Organisation Internationale de Métrologie Légale PJLABS Perry Johnson Laboratory Accreditation Service PT Proficiency testing QM Quality management Standard operation procedure SOP UKAS United Kingdom Accreditation Service UNIDO United Nations Industrial Development Organisation

7.1╇Definitions of Accreditation Accreditation may be defined on several ways. Various dictionaries provide general definitions of accreditation, as © 2011 by Taylor and Francis Group, LLC

142

Quality Assurance in the Pathology Laboratory

Accreditation—the act of granting credit or recognition (especially with respect to educational institution that maintains suitable standards) [1,2],

or Accreditation: Certification of competence in specified subject or areas of expertise, and of the integrity of an agency, firm, group, or person, awarded by a duly recognized and respected accrediting organization [3].

According to Merriam-Webster online dictionary “to accredit” means to give official authorization or approval of; … to recognize (an educational institution) as maintaining standards that qualify the graduates for admission to higher or more specialized institutions or for professional practice; to consider or recognize as outstanding [4].

International Standard Organization, which is involved in issuing accreditation standards, described accreditation as third party attestation related to a conformity assessment body conveying formal demonstration of its competence to carry out specific conformity measurement tasks. Conformity assessment body was defined as a body that performs conformity assessment services and that can be the object of accreditation, whereas conformity assessment was the demonstration that specified requirements relating to a product, process, system, person or body are fulfilled [5]. International accreditation service coordinators, like International Laboratory Accreditation Cooperation (ILAC) or International Accreditation Forum (IAF), gave the following views on accreditation: Accreditation allows people to make an informed decision when selecting a laboratory, as it demonstrates competence, impartiality and capability. It helps to underpin the credibility and performance of goods and services [6]. Accreditation reduces risk for business and its customers by assuring them that accredited bodies are competent to carry out the work they undertake [7]. For U.K. Accreditation Service (UKAS), accreditation (by UKAS) means that evaluators i.e., testing and calibration laboratories, certification and inspection bodies have been assessed against internationally recognized standards to demonstrate their competence, impartiality and performance capability. It is the ability to distinguish between a proven, competent evaluator that ensures that the selection of a laboratory, certification or inspection body is an informed choice and not a gamble [8].

Accreditation is followed by certification—a procedure by which a third party gives written assurance (certificate) that a product, process, or service conforms to specific requirements. © 2011 by Taylor and Francis Group, LLC

Role of Accreditation Procedures in Maintaining Quality

143

All definitions of accreditation contain two main elements: • The purpose of accreditation, which is to prove, recognize, and certify the competence of the involved institution or organization in defined area. In definitions given by organizers and providers of accreditation service, this is completed with the benefits for prospective client or customer. • The means of how to achieve accreditation, which is done by independent, impartial, and competent assessors against internationally recognized standards. Both elements are relevant in pathology, laboratory medicine, and related areas. The purpose and benefits of accreditation, i.e., the answer to the question “Why accredit?” is well recognized throughout the world. However, the technical requirements, organizational efforts, and high cost of accreditation procedures are still associated with the fact that in many countries the answer to the question “How to achieve accreditation?” is extremely difficult, if not impossible.

7.2╇Role and Aims of Accreditation Components in Pathology and Laboratory Medicine Generally, the certificate of accreditation is a seal of quality of the laboratory service involved in any field. It allows clients to make an informed decision when selecting a laboratory for a particular service, on the basis of proven and documented competence and credibility. These features are particularly important in such sensitive areas, like pathology and laboratory medicine. Incompetent and unreliable laboratory service may, on the one hand, jeopardize the health and even the life of the patient involved, and, on the other hand, not only may it ruin the reputation of the particular laboratory, but it could also affect the entire quality and image of medical service in the covered area. For these reasons, the quality assurance of the medical laboratory activities is a must. It has been recognized more than two decades ago that the best way to achieve and maintain the high level of laboratory work is to certify its work though accreditation process. 7.2.1╇Role of Proficiency Testing Proficiency testing (PT), which is a synonym of the term “external quality assessment” (EQA) used in Europe and South America, is a component of a laboratory’s total quality system that is intended to verify on a periodic basis that laboratory results conform to the expectations for quality set by the organizing body. © 2011 by Taylor and Francis Group, LLC

144

Quality Assurance in the Pathology Laboratory

PT schemes have multiple uses in laboratory medicine. It begins with the PT of diagnosis/identification procedures (e.g., troponins in diagnosis of myocardial infarction or detection of toxic compound in body fluids) on screening and confirmation level up to monitoring the course of illness and the effects of treatment. For the former, the specificity and sensitivity of the methods are of primary importance; for the latter, the robustness and low variability are most relevant. A major limitation of PT is the tendency to maintain the quality at a certain level rather than to stimulate improvement [9]. Technically, PT is an assessment of a laboratory’s analytical performance in comparison to its peers or to an external, accuracy-based reference system. Miller reviewed recently the role of PT in achieving the main task of accreditation, i.e., the standardization and harmonization [10]. “Peer grouping” is the most common procedure used in assigning a target value in PT assessment in pathology and laboratory medicine. This approach is necessary because most control materials used for PT are modified during preparation in such a manner that the matrix is altered relative to native clinical samples and the PT samples are not commutable with native clinical samples. Therefore, it is assumed that “peer groups” that represent similar technology are likely to achieve the same result and the mean value of the peer group may be calculated as the target value. Peer groups are usually formed as instrument/method groupings from the same manufacturer. The second possibility to assign a target value is by measurement of a PT sample using a reference measurement procedure. This approach can be used when the PT material is commutable with native clinical samples. A commutable PT sample is one that has an equivalent mathematical relationship as that observed for native clinical samples between all the different measurement procedures represented in the survey. The topic of commutability has been reviewed recently by Panteghini [11] and is discussed in the Chapter 8.4.2. Since it is uncommon that PT samples are commutable with native clinical samples, target value assignment with a reference measurement procedure is used only in limited cases. Thompson et al. [12] compared the performance of accredited and nonaccredited methods, using the Food Analysis Performance Assessment Scheme (FAPAS•) PT scheme (which is accredited by UKAS). Fifty qualifying examples of analyte-test material combination were selected at random from the reports from the year 2006. The accredited/nonaccredited subsets of results from each example were subjected to a statistical analysis to determine whether any significant differences between the distributions of results could be detected. The proportion of outliers was about twice as high among the nonaccredited group. However, this difference did not reach the level of significance.

© 2011 by Taylor and Francis Group, LLC

Role of Accreditation Procedures in Maintaining Quality

145

Wilson reviewed EQA schemes, applied in toxicology in the United Kingdom [13]. A variety of schemes monitor quantitative performance for analysis of toxic agents such as paracetamol, salicylate, ethanol, and carboxyhemoglobin. Their usefulness for toxicologists depended on the concentration range, which should extend fully into the toxic range, and on the matrix used (synthetic, of animal origin or serum as opposed to whole human blood). A scheme for quantitative determinations of a wider range of toxicological analytes such as opioids, benzodiazepines, and tricyclic antidepressants in human blood has been piloted by the U.K. National External Quality Assessment Scheme (UKNEQAS). Specialist schemes were available for drugs of abuse testing in urine and for hair analysis. While these programs provided much useful information on the performance of analytical techniques, they failed to monitor the integrated processes that are needed in investigation of toxicological cases. In practice, both qualitative and quantitative tests are used in combination with case information to guide the evaluation of the samples and to develop an interpretation of the analytical findings that is used to provide clinical or forensic advice. EQA programs that combine the analytical and interpretative aspects of case studies are available from EQA providers such as UKNEQAS and the Dutch KKGT program (Stichting Kwaliteitsbewaking Klinische Geneesmiddelanalyse en Toxicologie). In an older study, Ferrara et al. [14] reviewed the validity and effectiveness of quality control procedures in light of the principles of analytical toxicology and in awareness of the profound influence which analytical results have in the fields of health and social security. The need of very high degree of reliability of laboratory work was stressed, and factors contributing to the quality of analytical results and methods used to check their reliability were discussed. The technical background and organization of internal and external quality control procedures were presented, with particular reference to educational aspects. Travers presented specific needs of developing countries in relation to EQA, from the view of College of American Pathologists (CAP) [15]. In response to requests from World Health Organization (WHO), CAP organized an EQA program for Latin America. The supply of material for distribution was facilitated, and training in quality management (QM) was promoted. CAP collaborated with the Caribbean Epidemiology Center, responsible for dissemination of all EQA activities through Latin America. Unfortunately, this program did not work and by 1998 practically stopped. According to the author, there are several conditions, which should be met to achieve success in implementation of EQA in developing countries, like laboratory medicine culture, national culture, level of basic services, mode of use of laboratory test and their interpretation, vendor capabilities, and budget allocated for EQA programs.

© 2011 by Taylor and Francis Group, LLC

146

Quality Assurance in the Pathology Laboratory

In a recent study, Thomas [9] performed a survey on EQA schemes in laboratory medicine among 22 EQA organizations representing 407 schemes. The purpose of the study was to determine a frequency of control rounds per year and the number of samples distributed per round. A wide variation was found both within and between disciplines, such as biochemistry, hematology, microbiology, hemostasis, immunology, and histopathology. The median for all disciplines was four rounds per year, for biochemistry six rounds per year, and for hematology three rounds per year. There are several providers of PT programs and schemes. The European Proficiency Testing Information System (EPTIS) [16] helps to find a suitable PT scheme in any region or worldwide. EPTIS database lists almost 1000 schemes, mainly in the fields of chemical and mechanical testing. A comprehensive body of PT schemes available for clinical chemistry, toxicology, and related areas is available on this Web site. Several professional bodies issued guidelines regarding organization of PT programs and evaluation of PT results. European Committee for External Quality Assurance Programmes in Laboratory Medicine (EQALM) is assembling nonprofit organizations for external quality assurance programs in laboratory medicine and established working groups on specific scientific matters (e.g., on hematology, microbiology, nomenclature, among others). Detailed description of the activities of EQALM is done on its homepage [17]. International Federation of Clinical Chemistry (IFCC) formulated detailed guidelines concerning organization of PT programs, which are also published on the homepage of EQALM [18]. This document is divided into three sections. The first general section describes the scope of the guidelines, gives references (mainly International Organization for Standardization [ISO] standards), and definitions of the terms used. The second section is devoted to management system requirements, like quality management system (QMS), document control, use of subcontractors, client feedback, corrective and preventive action, records, internal audits, and management reviews, among others. The third section describes technical requirements, concerning management, staffing, and training, facilities, organization and logistics, choice of methods or procedures, data analysis and interpretation, communication with participants, confidentiality, collusion, and falsification of results. There are two appendices; Appendix A presents commonly used statistical methods for treatment of PT data, whereas Appendix B gives cross-references to ISO 9000, ISO Guide 43-1, and ISO/EC 17025. In the United States, the U.S. Department of Health & Human Services (HHS), acting through Centers of Medicare & Medicaid Services (CMS), published a list of approved PT providers [19]. The list comprises providers offering PT programs in the following disciplines: chemistry (including routine chemistry, endocrinology, and toxicology), cytology, diagnostic immunology, general immunology, hematology, immunohematology, and © 2011 by Taylor and Francis Group, LLC

Role of Accreditation Procedures in Maintaining Quality

147

microbiology. The CMS-approved cytology PT Programs are provided by the CAP, the State of Maryland Cytology PT Program, and the American Society for Clinical Pathology program. The Clinical and Laboratory Standards Institute (CLSI) [20] provided practical guidance for clinical laboratories regarding use and evaluation of PT results. This document, which is addressed principally to U.S. laboratories, includes guidance on selection of a PT program, PT sample handling procedures, evaluation and reporting process, investigation of and response to unsatisfactory scores, and monitoring PT performance over time. The guidance also covers assessment of pre- and post-examination phases of laboratory testing, and using PT as an educational tool [21]. As concerns unacceptable PT results, the CLSI guideline suggests identifying the source of the problem through defined scheme. This scheme classifies possible problem areas such as clerical errors, methodological problems, equipment problems, technical problems caused by personnel errors, and problems with the PT material. Each problem area is divided into detailed possible sources of errors. 7.2.2╇Role of Inspection The internationally recognized standard for the competence of inspection bodies is ISO/IEC 17020:1998 “General criteria for the operation of various types of bodies performing inspection.” This standard is identical to European standard EN 45004. ISO/IEC 17020 should not be confused with the QM standard ISO 9001:2000. The latter is specific to QMSs and does not require evaluation of the technical competence of an inspection body. Therefore, ISO 9001:2000 should not be regarded as an acceptable alternative to ISO 17020. ILAC and IAF issued “Guidance on the Application of ISO/IEC 17020” [22]. This document deals with the following issues of the standard: scope; definitions; administrative requirements; independence, impartiality, and integrity; confidentiality; organization and management; quality system; personnel; facility and equipment; inspection methods and procedures; handling inspection samples and items; records; inspection reports and inspection certificate; subcontracting; complaints and appeals; cooperation; and appendices. According to the guidance, the following elements should be included in inspection reports and certificates: • Designation of the document, i.e., as an inspection report or an inspection certificate, as appropriate (mandatory) • Identification of the document, i.e., date of issue and unique identification (mandatory) • Identification of the issuing body (mandatory) © 2011 by Taylor and Francis Group, LLC

148

• • • •

• • • •

• • • • • • • •

Quality Assurance in the Pathology Laboratory

Identification of the client (mandatory) Description of the inspection work ordered (mandatory) Date(s) of inspection (mandatory) Identification of the object(s) inspected and, where applicable, identification of the specific components that have been inspected and identification of locations where particular methods have been applied (mandatory) Information on what has been omitted from the original scope of work (mandatory) Identification or brief description of the inspection method(s) and procedure(s) used, mentioning the deviations from, additions to or exclusions from the agreed methods and procedures Identification of equipment used for measuring/testing Where applicable, and if not specified in the inspection method or procedure, reference to or description of the sampling method and information on where, when, how, and by whom the samples were taken If any part of the inspection work has been subcontracted, the results of this work shall be clearly identified (mandatory) Information on where the inspection was carried out Information on environmental conditions during the inspection, if relevant The results of the inspection including a declaration of conformity and any defects or other non-compliances found (results can be supported by tables, graphs, sketches, and photographs) (mandatory) A statement that the inspection results relate exclusively to the work ordered or the object(s) or the lot inspected A statement that the inspection report shall not be reproduced except in full without the approval of the inspection body and the client The inspector’s mark or seal Names (or unique identification) of the staff members who have performed the inspection and in cases when secure electronic authentication is not undertaken, their signature (mandatory)

The Belgian company “To the Point Consulting” [23] offers special ISO 17020 implementation package to inspection bodies from around the world. The package contains a quality manual, procedures, and quality records that comply with ISO 17020, and covers all sections and subsections of the ISO 17020 standard in a matching way. It defines a baseline system that satisfies ISO 17020 requirements and provides model of a quality system. The inspection may be announced or unannounced. The advantage of unannounced inspection is that it reflects the quality of laboratory work in real-life situation. It is known and understandable that an announced © 2011 by Taylor and Francis Group, LLC

Role of Accreditation Procedures in Maintaining Quality

149

inspection is preceded by the meticulous preparation of the laboratory staff and facilities. In such situation, the main accent is put on passing the inspection and not on delivering quality results. This may mask various existing drawbacks. The example of the laboratory in a prestigious U.S. hospital, which successfully passed announced inspections for years and was delivering faulty, life-threatening results, was described by Ehrmeyer and Laessig [24]. In any case, the inspection must be associated with permanent internal audit, focused on fault finding, and not on punishment, as formulated by ISO 15189. 7.2.3╇Role of Quality Management 7.2.3.1  Quality Management Plan In clinical laboratories, the QMS is necessary for improvement of services provided by the laboratory in order to improve of patient’s care and safety. Continuous assessment of the laboratory management will effect in constant readiness for inspection. According to Bachner [25], the QMS in pathology and laboratory medicine was defined as a “set of key quality elements that must be in place for an organization’s work operations to function in a manner that meets the organization’s stated quality objectives.” The key quality elements used in the pathology and laboratory medicine are Organization, Personnel resources, Equipment, Supplier and customer issues, Process Control, Documents and Records, Occurrence Management, Assessments, Process Improvement, Facilities and Safety, Information management, and Customer Service and Satisfaction. The elements of the QM plan should be developed by leadership of after careful analysis of these elements. QM plan in clinical laboratory belongs to Clinical Laboratory Improvement Amendments 88 (CLIA’88) and CAP accreditation requirement to ensure that the laboratory participates in monitoring and evaluation of the quality and appropriateness of services provided. It is the responsibility of the laboratory director for implementation of the QM plan. A QM plan is describing the scope of services and organizational chart of the laboratory section, monitoring the pre-analytic, post-analytic phase for testing, quality control system assuring the delivery the accurate and timely results needed in patient care, enhancing employee training and competency assessment, document control requirements, procedures for monitoring of quality control, internal and external quality indicators, customer satisfaction, and reporting of internal quality improvement activities [25]. Plan format which can be in the laboratory format, or according to CLSI (NCCLS) guidelines (GP-22 or GP-26), ISO 9000 series, ISO 15189 accreditation and standards, Joint Commission (JC) Model for Improvement of Organizational Performance or American association of blood banks (AABB) quality program. © 2011 by Taylor and Francis Group, LLC

150

Quality Assurance in the Pathology Laboratory

The QM plan should include all analytic cycles in all sections as well as the mission statement to provide quality and patient safety, risk assessment, monitoring and control activities such as identifying indicators and metrics, identification of problems, information and communication, and continuous improvement. In relation to the QM implementation, the following points are relevant: determination of delegation and responsibility, specification of the frequency of activities, creation of Quality Committee and documentation of its activity, quality improvement report, and documents responding to complaints, problems, and adverse events. During the on-site inspection of the clinical laboratory the inspector will be looking for written QM plan, involvement of the laboratory director in the QMS, monitoring process for improvement, communication within organization, incorporation of proficiency data and corrective action, employee and client’s satisfaction survey results, and utilization of the incident reports for improvement [25]. 7.2.3.2  Requirements of CAP, ISO 15189, and ISO/EC 17025 Regarding QM The CAP recently introduced an educational accreditation program based on the ISO 15189 standard for medical laboratory [26]. The core benefit of using ISO 15189 standards comes from following its comprehensive and highly structured approach for QM. The ISO 15189 standard, designed specifically for the medical laboratories, covers 15 management requirements and 8 technical requirements. As an initial step of QM implementation along the ISO 15189 lines, the “gap analysis” should take place. The laboratory should conduct the internal audit for its processes, to identify the weak areas. Some laboratory may request a pre-assessment from CAP which takes place 9 days before the final accreditation assessment. Once the laboratory passes the final assessment, a 3 year cycle begins; in the first year and second years, two surveillances are scheduled, and during the third year, on-site accreditation is required. Even though many countries adopted the ISO standards as national basis for their accreditation of the medical laboratories, the CMS is not yet ready to make the ISO 15189 a required part of laboratory accreditation under CLIA. The reason is that some requirements in the ISO 15189 are more general and not as stringent or specific as CLIA regulations. For example, the ISO 15189 standard requires having a competent laboratory director, in CLIA this requirements is more specific and indices the training, education, required experience, and responsibilities for this position [26]. Several authors investigated the role and influence of QM on the quality of laboratory work in various disciplines. Bak et al. [27] performed a study to investigate most common used certification and accreditation systems in terms of their efficacy in improving the functional outcome of the rehabilitation © 2011 by Taylor and Francis Group, LLC

Role of Accreditation Procedures in Maintaining Quality

151

from the patient’s perspective. None of the eight identified accreditation and certification systems seemed to be especially appropriate for outcome-based optimizing of rehabilitation process. It was concluded that QMSs in terms of functional health have been provided poor evidence of effectiveness, implementation, and the positive influence on patient’s functional health to deliver an economic benefit. More research is needed to improve evidence in terms of measurable benefit of accreditation and certification of health care providers for patients and other stakeholders. Lehmann [28] evaluated the Â�standards and checklists of CLIA’88 and CAP Laboratory Accreditation Program (LAP) to check the applicability and conformance to ISO 9001 Section 4. Section 4 of ISO 9001 contains 20 aspects of a quality system that must be addressed by an organization in order to receive ISO 9001 certification. This concept was extended to the clinical laboratory when a quality system program establishes for the customer (patient/clinician) that the purchased product (requested information on a submitted specimen-test result) meets established quality norms. Policies and procedures must be available in organization to ensure quality product and be certified. For organization to be certified it must go through the inspection process and demonstrating that it meets defined standards. Grunnet [29] assessed the role and influence of QM on the activity of blood banks in Denmark. The level of implementation of QM in transfusion centers in Denmark is at the accreditation level with reference to the European Union (EU) Blood Directives the Danish Blood Law and is in many aspects equivalent to the ISO 15189 standard. Blood banks are separate hospital departments covering all aspects of the transfusion activity with specially trained medical doctors (separate medical specialty), donor selection, production of blood components, testing for selected infectious markers, blood grouping and compatibility testing, investigation of adverse reactions/complications to transfusions and constructive dialogs with representative users of the services from the blood bank and blood bank personnel in the Hospital Transfusion Committees to secure appropriate use (clinical doctors and nurses) and relevant accessibility of blood components and laboratory testing (the blood bank output). The following tools of QM are in use: a quality manual (overall objectives), master description of procedures (master plans), standard operating procedures (SOPs), and a well-prepared feedback system using quality control measurements of blood components and laboratory tests, through reports of variations (deviation from intended result or SOP), complaints, systematic internal audits, updated educational records of all personnel involved in the activities of the blood bank, assurance that all equipment and utensils are only taken in use after proper validation/qualification and that a maintenance plan or acceptance test is in action. Furthermore, a relevant number of external proficiency tests were carried out to secure the analytical quality of all key parameters in the laboratory. Every second year, the blood bank was inspected by the Danish Medical © 2011 by Taylor and Francis Group, LLC

152

Quality Assurance in the Pathology Laboratory

Agency and identified issues must be addressed in a written response within a time limit. The issues pointed out can deal with the building, personnel, apparatuses, equipment, utensils, processing, data management, corrective actions, and other issues relevant for the fulfillment of the requirements of a European blood bank setting in 2007. In addition, the area of transfusion is surveyed at a national level (blood components/blood donor accidents/clinical practice of transfusion treatments). In conclusion, the author stated that the benefits of QM surpassed the costs by creating high-quality products and services for the benefit of patients, blood donors, hospitals, and personnel in the blood bank. The requirements of ISO 15189 were evaluated by Burnett [30] in terms of organization and a QMS, highlighting the importance of evidence, document control, control of records, and clinical material. Examples were provided from the area of resource management (RSM), pre-analytical, analytical, and post-analytical processes. The importance of evaluation and continual improvement were demonstrated in relation of the internal and external audit assessment, nonconformity, corrective and preventive action, and management review. Garcia et al. [31] conducted a study to calculate various annual QM indicators and implement them as a management tool in laboratories. Twenty annual items over 5 years were collected and calculated in three laboratories under belonging to Public Hospital Network in Catalonia, Spain. The Laboratory Manual Index Program from CAP was used as a reference. The analytical quality indicators versus. productivity were also compared and the annual budget laboratory deviation was calculated. The information obtained from these indicators provided laboratories with a useful benchmarking tool to determine the results of management change and understand the real situation in laboratories. It was concluded that no standardization on the management data exists and different characteristics needs to be unified. Kailner [32] compared the QM requirements in standards ISO 17025 and ISO 15189. ISO 17025/1.1 claims that it “specifies the general requirements a laboratory has to meet if it is to be recognized as competent to carry out tests and/or calibrations, including sampling.” ISO 15189 claims that it is applicable to all types of medical laboratories, but not to reference measurement laboratories. The responsibilities of the laboratories are defined in different way in these two standards. In 17025/4.1.2 “It is the responsibility of the laboratory…to satisfy the needs of the client, the regulatory authorities or organizations providing recognition,” whereas in 15189/4.1.1. “Medical laboratory services, including appropriate consultative services, shall meet the needs of patients, and all clinical personnel responsible for patient care.” Additionally, 15189/4.1.4 requires that medical laboratory services participate in quality improvement activities that deal with improvement of patient care. In other words, the 15189 standard requires that the medical laboratory should be an active part in health care. © 2011 by Taylor and Francis Group, LLC

Role of Accreditation Procedures in Maintaining Quality

153

Theodorou and Anastasakis [33] prepared management review checklist for ISO/EC 17025 and ISO 15189 QMSs. This checklist comprises requirements for both standards as follows: • • • • • • • • • • • • • • •

Follow-up of previous management reviews (for ISO 15189 only) Suitability of policies and procedures (for ISO 17025 only) Reports from managerial and supervisory personnel Outcome of recent internal audits Nonconformities Corrective and preventive actions Assessments by external bodies Results of external quality assessments, interlaboratory comparisons, or proficiency tests Changes in the volume and type of the work Customer feedback Complaints Recommendations for improvement—quality indicators Monitoring of turnaround times (TATs)(for ISO 15189 only) Evaluation of suppliers (for ISO 15189 only) Other relevant factors (QC activities, resource, staff training) (for ISO 17025 only)

Comprehensive checklist was prepared according to these requirements.

7.3╇Legal Frames, Regulations, and Accreditation Bodies in Pathology, Laboratory Medicine, and Related Areas There is a multitude of international and national organizations responsible for creating accreditation standards and for implementation of existing ones. Main players, as well as links between them, are depicted in the Figure 7.1. This subchapter presents most important standards—ISO/EC 17025 and ISO 15189 as well as accreditation bodies, providing international accreditation services for medical and analytical laboratories. 7.3.1╇International Standards of ISO ISO (http://www.iso.org/iso/home.htm) is the world’s largest developer and publisher of international standards. It was founded in 1946 in London by representatives of 25 countries, who decided to create a new international organization, with the object “to facilitate the international coordination and unification of industrial standards.” ISO officially began operations in 1957 in Geneva, Switzerland. Currently, ISO is a network of the national standards institutes of 159 countries (one member per country), with a Central © 2011 by Taylor and Francis Group, LLC

154

Quality Assurance in the Pathology Laboratory

ILAC 82 countries

IAF 52 countries ISO 159 countries

CIPM OIML UNIDO IEC

15189 17025 EU

US Medical labs

Non-medical labs

HHS CLIA

A2LA IAS* NVLAP L-A-B PJLABS ASCLD ANSI

COLA CAP* JCIA* AABB AOA

EA 33 EU countries 18 NON-EU

CEN 30 EU countries

National accreditation services (UKAS*, CPA*, DAP*, DACh* etc.)

Solid line rectangles: Accreditation bodies Broken line rectangle: Cooperating bodies Circles: Standardization bodies * Offering international accreditation service

Figure 7.1╇ Relation between various standardization and accreditation organizations on international level (upper part), European level (right lower part), and in the United States (left lower part). Abbreviations in text.

Secretariat in Geneva that coordinates the system. No matter what the size or strength of that economy, each participating member in ISO has one vote. Every full member of ISO has the right to take part in the development of any standard, which it judges to be important to its country’s economy. Since ISO is a nongovernmental organization, it forms a bridge between the public and private sectors. Many of its member institutes are part of the governmental structure of their countries, or are mandated by their government. Other members have their roots uniquely in the private sector, having been set up by national partnerships of industry associations. As a nongovernmental organization, ISO has no legal authority to enforce the implementation of its standards. ISO does not regulate or legislate. However, countries may decide to adopt ISO standards as regulations or refer to them in legislation, for which they provide the technical basis. In such a way, ISO standards may become a market requirement, mainly those concerned with health, safety, or the environment. ISO standards are technical agreements, which provide the framework for compatible technology worldwide. More than 17,500 International Standards and other types of normative documents are in the current portfolio of ISO. The standards encompass a broad range of activities, such as agriculture © 2011 by Taylor and Francis Group, LLC

Role of Accreditation Procedures in Maintaining Quality

155

and construction mechanical engineering, manufacturing and distribution, transport, medical devices, information and communication technologies, and standards for good management practice and for services. ISO launches the development of new standards in response to the requirement of its national member (acting in the name of national industry or business sector). If accepted, the work item is assigned to 1 of 193 existing technical committees. Proposals may also be made to set up technical committees to cover new scopes of activity. The standards are being developed by experts from the industrial, technical, and business sectors which have asked for the standards, and which subsequently put them to use. At the end of 2006, there were 3041 technical bodies in the ISO system. The experts involved originate from government agencies, testing laboratories, consumer associations, nongovernmental organizations, and academic circles. ISO collaborates with the United Nations Organization and its specialized agencies and commissions, particularly those involved in the harmonization of regulations and public policies, such as CODEX Alimentarius, on food safety measurement, management, and traceability or WHO on health technologies, among others. The basic ISO standard for medical laboratories is ISO 15189:2007 Medical laboratories—Particular requirements for quality and competence. The following ISO standards are also relevant in pathology and laboratory medicine: • ISO 15198:2004: Clinical laboratory medicine—In vitro diagnostic medical devices: Validation of user quality control procedures by the manufacturer • ISO 2287:2006: Point-of-Care Testing: Requirements for Quality and Competence • ISO 15190:2003: Medical laboratories—Requirements for safety • ISO 15195:2003: Laboratory medicine—Requirements for reference measurement laboratories • ISO 22609:2004: Clothing for protection against infectious agents— Medical face masks: Test method for resistance against penetration by synthetic blood • ISO/TS 22367:2008: Medical laboratories—Reduction of error through risk management and continual improvement • ISO 17593:2007: Clinical laboratory testing and in vitro medical devices—Requirements for in vitro monitoring systems for self-testing of oral anticoagulant therapy • ISO/TR 18112:2006: Clinical laboratory testing and in vitro diagnostic test systems—In vitro diagnostic medical devices for professional use: Summary of regulatory requirements for information supplied by the manufacturer © 2011 by Taylor and Francis Group, LLC

156

Quality Assurance in the Pathology Laboratory

In laboratories working in related areas (e.g., forensic toxicology, doping control, workplace drug testing, and food testing) the standard: “ISO/EC 17025:2005— General requirements for the competence of testing and calibration laboratories” is relevant. The standards ISO 15189 and ISO/EC 17025 will be discussed in more detailed way. 7.3.1.1  Development of ISO 17025 and ISO 15189 Historically, international standards for medical and analytical laboratories were formulated in 1990s. ISO 9000 series offered certification, and ISO Guide 25 leaded to accreditation. In Europe, the content of the ISO Guide 25 were accepted as EN 45001. In 1992, both ISO and Comité Europeen de Normalisation (CEN) agreed to accept each other standards and to eliminate the duplication, the ISO Guide 25 was revised, and ISO 17025 was generated instead and by agreement of the CEN the ISO 17025 also become European standard EN 17025 [34]. This standard was written to accommodate all analytical laboratories, as has been applied for medical laboratories as well. There were no specific sector of ISO standards for QM and technical competence in the medical laboratory in the past, which is why in the past the medical laboratory had to follow two separate lines to achieve recognition: one line is relying on the QMS and this was represented by ISO 9000:2000, the second line was technical competence, which was represented in ISO 17025 [34]. However, clinical chemists raised several points, which are relevant for medical laboratories and were not represented in ISO Guide 25/EN 45001, like patient preparation and sample treatment, medical competence of medical laboratory, or safety regulations comprising patient and staff safety. As a consequence, ISO 17025 had become a standard in late 1990s for analytical laboratories, and ISO 15189 for medical laboratories. Although the ISO 15189:2003 is based on both ISO 9000:2000 and ISO/ IEC 17025 standards, it contains in addition to the analytical competence also requirements that are specific for the medical laboratories such as consultative and interpretation activities. The benefits of the accreditation of the medical laboratory are improving the quality of the work, proper documentation of the work flow, total QM, education and competency of laboratory staff, focus in patients outcome and improvement of interdepartmental cooperation, improved efficacy or laboratory services, improved quality of the system, improved patient safety and trust, better comparability of results [34]. 7.3.1.2  Relationship between ISO 9001, ISO 17025, and ISO 15189 The relationship between the ISO 9001, ISO/IEC 17025, and ISO 15189 may be summarized as follows: ISO 9001:2000 is one of the standards family (ISO 9000:2000, ISO 9001:2000, ISO 9004:2000) that are related to the QMS. It includes specific © 2011 by Taylor and Francis Group, LLC

Role of Accreditation Procedures in Maintaining Quality

157

requirement of the QMS for continuous improvement and providing a product that meets user needs but it specifies neither the report product or services nor the technical services. ISO 17025 standard operates in accordance of the ISO 9001:2000 but it includes the general requirements that are needed for accreditation and the competency of testing and calibration laboratory. ISO 17025 can be applied to all testing and calibration laboratories regardless of the number of personnel and scope of its activities. It can be applied for the laboratory that develops its QM and technical systems to improve its operations. ISO 17025 standards does not cover the compliance with regulatory and safety requirement of laboratory’s activities. ISO 17025:1999 does not address the following issues, which are present in ISO 15189: Pre-analytical phase which is important for interpretation of medical laboratory data; analytical phase concerning requirements of internal quality control and external quality assessment; post-analytical requirements for TAT, STAT, and critical results. ISO 15189 is the international standard designed specifically for the accreditation and covering particular quality and competence requirements of the medical laboratory. Table 7.1 shows the comparison of management and technical requirements of two standards. 7.3.1.3  Management Requirements of ISO 15189 ISO/IEC 17025 and ISO 15189 are almost identical in management requirements. There are some differences in the arrangement of some items and rewording some management key titles in the ISO 15189 [35–38]. 7.3.1.3.1╇ Organizationâ•… Medical laboratory shall be legally identifiable and if there is legal liability insurance or a governmental cover, the responsibility of the laboratory personnel who are involved in the sample testing should be given to identify the conflicts of interest. Appropriate communication process in relation to the effectiveness of the QMS should be established within the laboratory. Organizational chart of the laboratory should be established. Laboratory management responsibility such as designing, implementation, maintenance and improvement of the quality system, providing appropriate authority and support to the laboratory personnel to perform their duties, establishing policies and procedures to maintain confidential information. Quality manager and deputies for all key functions should be appointed. 7.3.1.3.2╇ Quality Management Systemâ•… A quality policy statement should include policies and objectives of the QM under the authority of the laboratory director. Management should ensure that policies, processes, programs, procedures, and instructions are documented and understood, implemented and available in a quality manual to all relevant personnel. The quality © 2011 by Taylor and Francis Group, LLC

158

Quality Assurance in the Pathology Laboratory

Table 7.1â•…Management and Technical Requirements for ISO/IEC 17025:2005 and ISO 15189:2003 ISO/IEC 17025:2005 [35,36]

ISO 15189:2007 [37–39]

Designed for Testing and Calibration Laboratories

Designed for Medical Laboratory

4 4.1 4.2 4.3 4.4 4.5 4.6 4.7 4.8 4.9 4.10 4.11 4.12 4.13 4.14

5 5.1 5.2

5.3 5.4 5.5 5.6 5.7 5.8 5.9

Management Requirements Organization Quality management system Document control Review of requests, tenders, and contracts Subcontracting of tests and calibrations Purchasing services and supplies Service to the customers Complaints Control of nonconforming testing and/or calibration work Improvement Corrective action Preventive action Control of records Internal audits

Technical Requirements

4

Management Requirements

4.1 4.2 4.3 4.4

Organization Quality management system Document control Review of contracts

4.5

Examination by referral laboratories

4.6 4.7 4.8 4.9

External services and supplies Advisory services Resolution of complaints Identification and control of non conformities Corrective action Preventive action Continual improvement Quality and technical records Internal audits Management review

4.10 4.11 4.12 4.13 4.14 4.15 5

Resources and Technical Requirements

Personnel Accommodation and environmental conditions and safety audit Test and calibration methods and method validation Equipment Measurement tractability Sampling

5.1 5.2

Personnel Accommodation and environmental conditions

5.3

Laboratory equipment

5.4 5.5 5.6

Handling and transportation of test and calibration items Assuring the quality of test results Reporting the results

5.7

Pre-examination procedures Examination procedure Assuring the quality of examination procedures Post-examination process

5.8 5.9

Reporting results Management of information system

© 2011 by Taylor and Francis Group, LLC

Role of Accreditation Procedures in Maintaining Quality

159

manual should include the scope of services for all services provided by the laboratory, the laboratory management’s statement of the laboratory’s standard of service, QMS’s objectives, knowledge of the all personnel laboratory who involve with examinations activities with the quality documentation and implement the policies and procedures at all times, the laboratory’s good practice commitment to compliance with ISO standards. The description of the QMS and the role of the responsibilities of technical and quality managers should also be included in the quality manual. All laboratory personnel should read and be trained in the use and application of the quality manual. The quality manual should be under the authority and responsibility of the quality manager. 7.3.1.3.3╇ Document Controlâ•… Documents control policies and procedures should be established and maintained in the laboratory including the internal and external records. The policy should describe the type of documents and records, retention, archiving and discarding the obsolete ones, identifying the authorized individual who will sign and approve documents and signatures frequency, also identifying who is responsible for management review. A list of procedures including current revisions and their distribution and maintenance should be described in the document control policy. Controlled record could be such documents like memos, forms, normative documents, or technical records such as work notes, test reports, calibration, observations, and data calculations. Management records include internal audit, management reviews, corrective and preventive action records, and PT reports. All documents relevant to the QMS should be identified by the title, edition or current revision date, source identification, etc. Technical literature should be available to all laboratory individuals. 7.3.1.3.4╇ Review of Contractâ•… In case the laboratory enters into a contract to provide medical laboratory services, a policy to review request, tenders, and contracts should be established. The requirements, including the methods to be used, should be adequately defined and documented. The laboratory should have the capability and resources to meet these requirements. The policy should describe steps to be taken in case of amendments to the contract and who should be informed in case of any deviation from the contract. 7.3.1.3.5╇ Examination by Referral Laboratoriesâ•… Effective policy and procedure should be established by the laboratory for evaluating the selection of referral laboratory or consultants who will provide second opinion for histopathology, cytology, and related disciplines. The policy should indicate who is responsible for selecting and monitoring the © 2011 by Taylor and Francis Group, LLC

160

Quality Assurance in the Pathology Laboratory

quality of referral laboratory and evaluate that the consultant is Â�competent to Â�perform requested Â�examinations. The laboratory should have a list of all referral laboratories that the laboratory uses including location and addresses. If the referring laboratory will prepare the reports, the report shall include all essential elements reported by referral laboratory without alteration that might affect in the clinical interpretation. The laboratory shall advise the customer that the work to be done by subcontractor in writing and, when appropriate, gain the approval of the customer, recommended in writing. 7.3.1.3.6╇ External Services and Suppliesâ•… Laboratory management shall define and document its policies and procedures for the selection and evaluation of the suppliers and the purchased external services that might affect the quality of its services equipment and consumables that may affect the quality of the laboratory services should not be used until they have been tested and verified that they meet the specifications defined in the procedure acceptance criteria. Inventory control system should be available in the laboratory to maintain uninterrupted services. 7.3.1.3.7╇ Advisory Servicesâ•… Professional appropriate laboratory staff shall provide advice on choice of examinations, type of sample, frequency, and interpretation for the results when appropriate. 7.3.1.3.8╇ Service to Customerâ•… The laboratory shall cooperate with customers for clarifying the customer’s request in relation to their tests performed, maintain confidentiality of customer’s laboratory work, provide the customer reasonable access to relevant area for witnessing of testes performed, and getting customer feedback to improve the management system. 7.3.1.3.9╇ Resolution of Complaintsâ•… A policy should be established in the laboratory for resolution complaints received from patients, clinicians, customers, and other parties including investigation of the problems and correction action. All records shall be maintained as required. 7.3.1.3.10╇ Identification and Control of Nonconformitiesâ•… Laboratory should have a policy and procedures to detect the nonconforming work, i.e., activity, which in any aspect does not conform to the laboratory procedures or does not agree or meet the requirements of the QMS or the requesting clinician. The policy and procedures to ensure the actions to be taken are identified and corrective action is taken immediately: the medical significance of the nonconforming work, immediate notification of clinician, identification of the personnel responsible for problem resolving, and the responsibility of authorization of the resumption of examinations. Nonconforming © 2011 by Taylor and Francis Group, LLC

Role of Accreditation Procedures in Maintaining Quality

161

work records should be maintained, and already released nonconforming Â�examinations results should be recalled if necessary. An evaluation of the significance of the nonconforming work shall be done to monitor the trends and initiate preventive actions. 7.3.1.3.11╇ Preventive Actionâ•… Preventive Action Plan can be developed by identifying some potential nonconformities either technical or concerning quality system and monitoring to reduce the recurrence and find an opportunities for improvement. 7.3.1.3.12╇ Continual Improvementâ•… The laboratory shall develop, document, and implement an action plan for improvement. Quality indicators can be chosen by the laboratory management that contribute to patient care by systematically monitoring and evaluating them to find opportunities for improvement. All laboratory personnel and relevant users should have access to suitable educational and training about performance improvement program. Continual improvement of effectiveness of management system can be achieved using quality system, internal audit analysis data, corrective and preventive actions and management review. 7.3.1.3.13╇ Quality and Technical Recordsâ•… A policy and procedure for maintaining QM and technical records should be established in the laboratory, including access collection, storage, safe disposal, retrieval, backup system, and suitable environment to store. The retention time of records should be identified. 7.3.1.3.14╇ Internal Auditsâ•… A policy and procedure for internal audit shall be established and conducted in the laboratory for all management and technical elements, in order to identify areas critically important to patient care and to verify that the laboratory operation continues to comply with quality system and standards. The plan should include the frequencies, type of audit, methodologies, and required documentations. The plan should be organized and carried out by qualified personnel or quality manager. Findings and corrections actions should be recorded. Follow-up procedures should be defined. 7.3.1.3.15╇ Management Reviewâ•… Annual management review of the laboratory’s QMS and medical services, including examination and advisory activities is an international standard requirement to ensure the effectiveness and adequacy of QMS in support patient care and to introduce an opportunity for improvement. Management review shall include but not limited to the following: follow-up of the previous management review; status of correction action and prevention action taken; reports from managerial and © 2011 by Taylor and Francis Group, LLC

162

Quality Assurance in the Pathology Laboratory

supervisory personnel; internal audits outcome; assessment by external body; interlaboratory comparison and PT; any change in the workload and scope of service; complaints and other relevant factors; quality Indicators including monitoring of TAT; nonconformities; evaluation of supplies and suppliers; other relevant factors, such as quality control activities, resources, and staff training; and customer’s feedbacks. All finding and actions of the annual review should be recorded and the laboratory staff should be informed. The management shall ensure that those actions are carried out within an appropriate timescale. 7.3.1.4  Technical Requirements of the ISO 15189 Most of these requirements [36–39] are common with the requirements of ISO 17025 standard [35]. The requirements specific for the ISO 17025 will be presented later. 7.3.1.4.1╇ Personnelâ•… Laboratory management should define the qualifications and duties for all personnel, job descriptions and maintain records of relevant education, professional qualifications, training, and experience. Staff resources shall be adequate to the workload performed in addition to carrying out other functions of QMS. Laboratory personnel should have the qualification and training background and profound theoretical knowledge to be able to discharge the responsibilities. Personnel authorization to perform particular tasks such as sampling, examinations, operation of specific equipment, use of the laboratory information system should be defined by the laboratory management and should be checked at regular interval. All personnel in the laboratory should maintain the confidentiality of the patient results. The laboratory shall use personnel who are employed by, or under contract to, the laboratory. 7.3.1.4.2╇ Accommodation and Environmental Conditionsâ•… The laboratory should have adequate space allocated for the workload without Â�compromising the quality of work, quality control procedure, and safety of personnel or patient care services. The laboratory should be designed for the efficiency of its operation, minimize the risk of injuries and occupational illness. Laboratory facilities for examination should allow correct performance of examinations, including energy sources, ventilation, water, waste disposal, environmental conditions, and housekeeping. Environmental conditions should be monitored and recorded according to specifications. Corrective action should be undertaken when the recorded value of the environmental conditions is outside the acceptable limits. Incompatible activities should be separated to prevent cross-contamination. Access to, and use of, areas potentially affecting the quality of the examinations shall be controlled. Efficient communication system, hygiene plan, safety precaution instructions should © 2011 by Taylor and Francis Group, LLC

Role of Accreditation Procedures in Maintaining Quality

163

be available in the laboratory. Whole staff should be regularly checked up by plant physician. 7.3.1.4.3╇ Laboratory Equipmentâ•… Equipment and its software used for testing, calibration, and sampling shall be capable of achieving the accuracy required and shall comply with specifications relevant to the tests and/ or calibrations concerned. The laboratory shall be furnished with equipments required for the sample collection, sample preparation, examination, and storage. A policy should be available in the laboratory describing the standard requirements of the laboratory equipments. Performance check shall include new equipments, used equipments after repair. Daily performance check shall be performed for routine equipment to ensure its compliance with specifications relevant to examination. The policy should also include the procedure of labeling equipments, storing, transferring, routine maintenance, and safety and electrical check and the frequency of the testing. The laboratory shall provide suitable space for repairs and appropriate personal protective equipment. Backup equipment should be available in case of emergency. Software used in the equipment that was used for collection, processing, recording, and reporting should be updated, documented, and suitably validated. Procedures shall be established and implemented for protecting the integrity of data at all times. Computer programs should be adequately labeled and evaluated. Equipments including hardware, software, reagents, and reference material shall be protected from unauthorized access and alterations or tampering that might invalidate examination results. Instructions on handling (procurement, marking, and storage) of reagents, chemicals, hazardous chemicals, as well as the Safety Data sheets of all chemicals used in the laboratory, should be available in the laboratory and accessible to all employees. All chemicals and reagent reference materials should be labeled according to identity, concentration, and expiry date and should be appropriately stored. The type and quality of reagents and chemicals should be defined in the method, a protocol for use reagents kits should be also defined. 7.3.1.4.4╇ Pre-Examination Proceduresâ•… Pre-examination procedures include specific information and description of the request form. Request form should contain information about patient like name, gender, age, authorized requesting physician’s name, tests ordered, sample types, and some clinical information relevant to patient. Instructions of proper collection and handling of primary samples should be documented and available to the laboratory staff responsible for sample collection. The manual of specimen collection should be in place and should include a list of all available offered examinations, consent form if applicable, procedures for preparation of patient, identification of primary © 2011 by Taylor and Francis Group, LLC

164

Quality Assurance in the Pathology Laboratory

samples, and sample collection procedures. The manual should also include the transportation instruction of the primary samples within time frame and proper conditions appropriate to the specimens and requested examinations, Primary samples should be traceable by recording all specimens in accession book, worksheet, or computer system. Criteria of acceptance or rejection of primary samples should be developed and documented. Periodic review of samples volume required for phlebotomy to ensure collecting suitable volume for appropriate examinations should be done. All requests and samples should be reviewed by authorized personnel to decide which examinations and the methods to be used in performing them. A protocol for collecting, handling, transporting, special requirements, and reporting of urgent samples should be prepared. Retention of samples in case of repletion needed should be documented according to stability of each test offered. 7.3.1.4.5╇ Examination Procedureâ•… Examination procedure describes the adequacy of the procedures to be used for sample examination. Published procedures in established textbooks, journals, or international and national guidelines are preferred after appropriate validation. In-house procedures shall be appropriately validated and fully documented. The procedure selected for use shall be evaluated and validated before being used for medical examination for the following: precision, accuracy, linearity, limit of detection, limit of quantification, and specificity. All procedures and methods should be documented, available to all staff and reviewed at defined intervals (usually annually). Card system can be used as a quick reference at the workbench, provided that a complete manual is available for reference. Any deviation from the procedure shall be reviewed, documented, dated, and authorized. New kits with major change in the reagents shall be checked for performance and adequacy for intended use. Methods or procedures should include purpose of examination, principle of the procedure, validation and performance specifications, type of samples, type of container and additives, required equipment and reagents, calibration procedure, quality control procedures, and procedure steps. Critical value shall be included in procedure where appropriate, laboratory interpretation and safety precautions should be given, as well as potential causes of variability. Reference intervals should be periodically reviewed and when the laboratory changes the examination or pre-examination procedure if required. Any changes in the procedures should be explained to users of the laboratory. 7.3.1.4.6╇ Quality Control Assurance of Examination Proceduresâ•… The laboratory should have a quality control program to verify providing of quality results. Uncertainty of the results should be determined by the laboratory where relevant, the sources that may contribute to uncertainty may © 2011 by Taylor and Francis Group, LLC

Role of Accreditation Procedures in Maintaining Quality

165

include sampling, transport, storage, sample preparation, sample portion selection, calibrators and reference materials, equipment used, environmental conditions, condition of the sample, changes of operator. Calibration of measuring system should be performed to ensure that the results traceable to SI units. Other elements to provide confidence to the results including participation of suitable inter-laboratory program, certified reference material, examination by other procedure, using standard established method, when traceability is provided by supplier, a documentation of statements regarding reagents should be provided for the laboratory. The laboratory should participate with inter-laboratory comparison such as the external quality assessment schemes for each examination performed in the laboratory. The results of external quality assessment should be monitored and correction actions should be initiated when the control criteria are not fulfilled. All inter-laboratory samples should be analyzed under the same condition of routine patient samples. In case the inter-laboratory comparison program is not available, the laboratory should have alternative mechanism for determining the acceptability of the procedures such as exchange sample with other laboratories. In case the examinations performed using different procedures or equipment or at different sites, the laboratory should have a mechanism for verifying the comparability of the results in an appropriate time intervals. Other quality-control-related issues such as the type and frequency for using control materials should be adequate for the internal quality control. Procedure should be established for parameters with no quality requirements to detect tolerable deviations and undertake correction actions of such deviations. In case the internal quality control or calibrators are not available, the laboratory should have alternative procedure to check the validity of the results. 7.3.1.4.7╇ Post-Examination Processâ•… The post-examination process includes revision of the results by authorized personnel before releasing them based on the available clinical information. All results should be checked for writing mistakes and transmission error. A policy shall exist for storage of primary samples, disposal of biological and other wastes (e.g., infectious, causing injuries, radioactive, inflammable, explosive, irritant, etching, and poisonous waste articles). Reporting results policy should be in the laboratory which include the formatting, define the authorized personnel to receive the reports within an agreed and the time interval of receiving the report. Report shall also be legible without mistakes in transcription and should include but not be limited to identification of the procedure, identification and address of the laboratory issued the reports, unique identification of patient, requestor, time and date of samples collection and receiving in the laboratory, time and date of releasing the report, type of samples, principle of procedure used for examination, examination result’s unit (in SI units), © 2011 by Taylor and Francis Group, LLC

166

Quality Assurance in the Pathology Laboratory

biological reference intervals, interpretation of results if required, any comments about adequacy of the primary samples that might compromise the final results, identification of authorized individual who releases the report, and signature of the personnel checking the releasing report. To maintain consistency, the description of examination should follow the vocabulary, syntax recommended by one or more of the organization (IUPAC, CEN, WHO). Policy and procedure of the reports should include the method of retrieval of report, retention time of reported data according to medically relevant. The laboratory should have a policy and procedure for immediate notification of the requesting physicians (or other clinic personnel responsible for patient care about critical values), which includes results sent to referral laboratories for examinations. If results were transmitted as interim reports (by phone or verbally), final written report should be released to the requestor. All records of critical values should be maintained to include the time, date, responsible laboratory employee, person notified, examinations results, and comments for any difficulty encountered. TAT should be established in the laboratory for all examinations according to the clinical needs. A policy should be established in the laboratory in case of not meeting the TAT criteria. In such cases, TAT should be reviewed by the laboratory management when necessary and corrections actions should be in place to identify the problems. Procedures should be in place for verifying the correctness of all transcriptions between referring when releasing examination results to referral laboratory. The laboratory should have written policies and procedures in case of alterations, revision, or amendment of reports and should include time, date, and name of person responsible for the change or revision or amendment. Original results should be included and alteration, revision and amendment should be clearly indicated in the report. 7.3.1.5  Technical Requirements of the ISO/IEC 17025:2005 7.3.1.5.1╇ Test and Calibration Methods and Method Validationâ•… ApproÂ� priate methods should be used for all tests including sampling, handling, transport storage, and preparation for item to be tested and/or calibrated, procedures for operation equipment used. Latest valid edition of published methods shall preferably be used. Methods developed by the laboratory also can be used if they are validated. The customer shall be informed about the methods that have been selected. Nonstandard methods can be developed in the laboratory if all required resources are available and if it is fully validated to confirm that the methods are fit for the intended use, the test method should contain identification, scope, type of tests and/or calibration, apparatus, reference standards and reference materials required, proper environmental conditions, © 2011 by Taylor and Francis Group, LLC

Role of Accreditation Procedures in Maintaining Quality

167

description and steps of procedure, acceptance and rejection criteria, procedure for estimation of uncertainty. If testing laboratory is performing its own calibration, it should apply a procedure to estimate the uncertainty of measurement for all type of calibrations, all uncertainty components should be taken into account using appropriate method of analysis. The laboratory should check calculations and data transfer in regular and systemic manner. When computers and automated equipment are used for testing and/or calibration, the laboratory shall perform evaluation and confirm the adequacy of the used software, maintain confidentiality, proper maintenance of computers and automated equipment to ensure proper function to maintain the integrity of test and calibration data [35,39]. 7.3.1.5.2╇ Measurement Traceabilityâ•… The laboratory shall have an established program and procedure for the calibration of its equipment, participation in an inter-laboratory comparisons program. Calibration and processing reference standard, reference materials shall be traceable to SI units of measurement or to certified reference materials. Intermediate checks need to maintain confidence in the calibration status of reference, transfer or working standards and reference materials shall be performed according to define procedures and schedules. 7.3.1.5.3╇ Samplingâ•… A sampling plan and sampling procedures should be available in the laboratory when it carries out sampling of substances, materials, and products. Sampling processes should identify the factors to be controlled to ensure the validity of the test and calibration results. The laboratory should record in detail with appropriate sampling data any deviations, additions, or exclusions from documented sampling procedure if requested by customer, a procedure of recording data related to sampling should be available in the laboratory and should include the sampling procedure use, identification of the sampler, environmental conditions, diagram of sampling location as necessary. 7.3.1.5.4╇ Handling and Transportation of Test and Calibration Itemsâ•… A procedure should be available in the laboratory for handling, protection storage, retention, transportation, and disposal of test and calibrations items. System for identifying the tests items should be established in the laboratory and this shall be retained throughout the life of the item. 7.3.1.5.5╇ Assuring the Quality of Test Resultsâ•… Quality control procedures should be established in the laboratory for monitoring the validity of tests and/or calibrations performed this includes regular use of certified reference materials and/or internal quality control using secondary reference © 2011 by Taylor and Francis Group, LLC

168

Quality Assurance in the Pathology Laboratory

materials, participation in inter-laboratory comparison or PT schemes, testing calibrations using different methods. The procedure should include detection of trends, statistical techniques for reviewing the results, correction actions shall be taken for the results found outside the predefined criteria. 7.3.1.5.6╇ Reporting the Resultsâ•… Test report should include the information on the standard, a clear interpretation of the test results and more information required by standard. When the test report contains results of tests performed by subcontractors, these results shall be clearly identified. Procedures should be established and implemented for protecting the data and the results in the case of transmission of results by telephone, telex, facsimile, or other electronic or electromagnetic means. Amendments to a test report after releasing the report should be documented as supplement to the original test report and shall meet all the requirements of the international standard. 7.3.1.6  Accreditation of Testing Laboratories and Medical Laboratories According to ISO 17025 and/or ISO 15189 The procedure described below applies to the accreditation of testing and medical laboratories according to DIN EN ISO/IEC 17025 and/or DIN EN ISO 15189 within the framework of the activities of DAP (Deutsches Akkreditierungssystem Prüfwesen) GmbH (German Accreditation System for Testing) [39]. In order for testing laboratory to be accredited by DAP they have to have the following: • Concluded a contract with DAP for conducting an accreditation • Fulfill the criteria for the testing laboratories according to DIN EN ISO/IEC 17025 and/or DIN EN ISO 15189, international guidelines of European Cooperation for Accreditation (EA) and ILAC • Fulfill the technical criteria of the DIN EN ISO/IEC 17025 and/or DIN EN ISO 15189 The preliminary meeting will be conducted between the applicant and DAP assessor to inform the applicant about the process of the accreditation operations and discuss any problems that might influence the process of accreditation. The focus of the meeting will be on the scope of accreditation, information of the content, sequence and costs of accreditation and the obligations of both parties after the accreditation has been granted. Generally, the procedure includes the following steps: check of documents, on-site assessment, accreditation, surveillance, extension of accreditation, and reaccreditation following a reassessment. These steps will be presented in detail. © 2011 by Taylor and Francis Group, LLC

Role of Accreditation Procedures in Maintaining Quality

169

7.3.1.6.1╇ Formal Checking of the Application for Accreditation and the Submitted Documentsâ•… In this stage, the applications for an accreditation are inspected if they are in compliance with the rules of the EU or worldwide accreditation associations (EA, ILAC). Once the requirements are fulfilled, the DAP office will acknowledge the application, nominate the case manager, lead assessor, and select the respective sector committee. The application fee will be invoiced and the contract with the applicant will be prepared. 7.3.1.6.2╇ Pre-Assessmentâ•… The pre-assessment may be conducted to ensure the suitability of accreditation. The laboratory should have all necessary documents for the pre-assessment process. The pre-assessment includes evaluation of laboratory personnel, equipment, and premises and is conducted by the assigned lead assessor or assessor and by case manager in certain cases. The following main aspects are subjected to pre-assessment: • Checking of the prerequisites as regards to personnel, equipment, and premises for accreditation • Evaluation of the management system adequacy • Checking of the documentations • Establishing the scope of accreditation • Exchange of experience and clarification of open questions of the accreditation process 7.3.1.6.3╇ Assessment of the Documentsâ•… The lead assessor checks the required documents for DIN EN ISO/IEC 17025 and/or DIN EN ISO 15189 that were submitted by the laboratory. The laboratory should be informed about any serious nonconformity. If the document review resulted with no serious nonconformities, the lead assessor informs the DAP office and the date of on-site assessment will be scheduled. 7.3.1.6.4╇ Assessment of the Testing Laboratoryâ•… The assessment team consists of the lead assessor and one assessor at least, the time of assessment depends on the scope of accreditation. The assessment of the testing laboratory consists of introductory meeting, assessment of requirements related to organization, management, verification of the technical requirements, and final meeting. The assessors use checklists and forms for conducting the assessment and their focus during the on-site assessment will be on the implementation of the activities for achieving the quality Â�objectives, the organizational structure, the qualification of the personnel, and the technical equipment as well as the cooperation with the customers. The technical competence of laboratory assessed, in relation to selection of test equipments and measuring devices, calibration of measuring equipment, © 2011 by Taylor and Francis Group, LLC

170

Quality Assurance in the Pathology Laboratory

its maintenance and repair, traceability of the measured values to national, standard measures, the verification and validation of test methods will be evaluated. The introductory meeting will be attended by the head of the testing laboratory and quality manager, other responsible laboratory staff and assessors. The participants will be introduced to each others, confirming the application scope and accreditation criteria (specifying the standard and other technical requirements), course of the accreditation, confirming the confidentiality, informing about the classification of non conformities, determining the time of assessment, and other news of the accreditation body. 7.3.1.6.5╇ Technical Interviews╅ The assessor should focus on the following issues: adequacy of management system; cooperation with customers of testing laboratory; competency of the staff members and the head of testing laboratory to manage the operation of the laboratory; and suitability of resources such as equipments, space, and number of staff for the test methods applied. The control of documents should comprise control of documents and records, subcontracting tests, conducting of representative test methods, maintenance and calibration condition of the testing and other equipment, participation in proficiency tests, their evaluation and documentation, availability of reliable sample marking and sample identification systems, availability of test or working instructions, contents and structure of the test reports, internal quality activities for the individual test methods, overall process in the testing laboratory from the inquiry, the tender, receipt of samples, report compliance with additional requirements, e.g., EA requirements, juridical or governmental requirements (if necessary), technical notes of DAP, specific sector committee, or decisions of the committee for accreditation. The testing laboratory has to show to the assessment team documents and records to enable that the appraisal relevant to the items mentioned above is possible. 7.3.1.6.6╇ Final Meeting╅ The final meeting will include overall summary of the assessment and recommendation of the assessment team on the granting of accreditation after the possible corrective action has been implemented or restriction of the scope applied for accreditation, if applicable. Each assessor will provide information of the stated nonconformities and will specify suitable corrective actions. In case of initial accreditations, 5 months at most are given to complete the corrective action, otherwise 2 months after the assessment. Open questions should be clarified. Within the agreed time schedule, the testing laboratory shall provide the documentation on conducting the corrective actions to the assessors.

© 2011 by Taylor and Francis Group, LLC

Role of Accreditation Procedures in Maintaining Quality

171

7.3.1.6.7╇ Assessment Reports: Recommendation for Accreditation╅ Three weeks after the assessment, each assessor needs to submit a report on the area assessed. The lead assessor will prepare the final report and all other documents needed to the case manager who forwards them to the responsible sector committee. A copy of assessment reports will be immediately send by DAP office to testing laboratory. The report will be evaluated by the responsible sector committee/s in addition to other required documents and issue their recommendation on accreditation to the DAP Managing Director. Recommendation for accreditation should be submitted to the sector committee within 6 months from the last day of the assessment. 7.3.1.6.8╇ Granting Accreditation and Issuing the Certificate╅ The DAP Managing Director grants the accreditation on the basis of the recommendation by the sector committee. The accreditation is usually valid for a period of 5 years. The accreditation certificate is signed by the DAP Managing Director then it will be send to customer with information on the conditions resulting from the accreditation, the possible surveillance and next assessment period. 7.3.1.6.9╇ Surveillance╅ The surveillance procedure consists of periodic checking if the prerequisites for accreditation continue to exist. The checking is done by on-site assessments of the accredited bodies. The assessments for surveillance are scheduled by the case manager on the basis of the DAP rules and the recommendations of the sector committees. The surveillance procedure involves obtaining additional information, checking changes of the management documentation, requesting documents, test reports and proofs for the surveillance of the management system, the testing laboratory the accreditation may be extended by new test areas or methods within the assessment of surveillance. During the 5 years validity of accreditation, at least three assessments should be conducted. The first assessment for surveillance to be conducted is within 12 months following the granting of the accreditation. The second and third assessment for surveillance may be extended to 18 months. The surveillance assessment sequence is similar to the initial accreditation with its check of the documents, on-site assessment, checking the corrective action, preparing and checking reports as well as the recommendation of the sector committee. If the on-site surveillance assessment resulted in nonconformities, the testing laboratory shall provide evidence of correction within 2 months following the on-site assessment. If the nonconformities have not been closed out, the accreditation may be suspended or withdrawn. All reports shall be submitted to the case manager or lead assessor within 3 weeks. After receipt at the DAP Office and the following review, a copy of the reports is immediately sent to the testing laboratory.

© 2011 by Taylor and Francis Group, LLC

172

Quality Assurance in the Pathology Laboratory

7.3.1.6.10╇ Reassessment and Reaccreditationâ•… Reassessment is done for the purpose of reaccreditation; the scope of the reassessment corresponds more or less to the scope of an initial accreditation. The purpose is to ensure that the laboratory continues to comply with accreditation criteria by the accredited body and to evaluate the effectiveness of the management system. In case of a reassessment, as a rule, other assessors are to be assigned as compared to the previous accreditation procedure, whereas the lead assessor may be the same as before. The time limit between two reassessments may not exceed 60 months. An application for reaccreditation should be filled and submitted by testing laboratory to DAP office. The reassessment should take place in time before the expiry of the accreditation to have a close connection to the previous accreditation. In many situations, it is more preferable for the testing laboratory to use the third surveillance for the reaccreditation. Eight months before the reaccreditation expires, the DAP Office informs the testing laboratory on the possibility of a reaccreditation. It is possible to extend or reduce the scope of accreditation during reaccreditation procedure. 7.3.2╇International Accreditation Organizations 7.3.2.1  International Laboratory Accreditation Cooperation International Laboratory Accreditation Cooperation (ILAC) [6] is an international cooperation of laboratory and inspection accreditation bodies formed in 1977 with the aim of developing international cooperation for facilitating trade by promotion of the acceptance of accredited test and calibration results. In 1996, ILAC became a formal cooperation with a charter to establish a network of mutual recognition agreements among accreditation bodies that would fulfill this aim. In 2000, 36 laboratory accreditation bodies, full members of ILAC, from 28 economies worldwide signed an “ILAC Arrangement” in Washington, DC to promote the acceptance of technical test and calibration data for exported goods. The arrangement came into effect on January 31, 2001. The “ILAC Arrangement” provided significant technical underpinning to international trade. The key to the Arrangement is the developing global network of accredited testing and calibration laboratories that are assessed and recognized as being competent by ILAC arrangement signatory accreditation bodies. The signatories have, in turn, been peer-reviewed and shown to meet ILAC’s criteria for competence. The ultimate aim was increased use and acceptance by industry as well as government of the results from accredited laboratories, including results from laboratories in other countries. In this way, the free-trade goal of “product tested once and accepted everywhere” could be realized. The ILAC network consists of 125 bodies representing 82 different economies. Worldwide there are almost 29,000 laboratories © 2011 by Taylor and Francis Group, LLC

Role of Accreditation Procedures in Maintaining Quality

173

accredited by an ILAC signatory, and there are over 5000 accredited inspection bodies. ILAC provides a focus for • Developing and harmonizing laboratory and inspection accreditation practices • Promoting laboratory and inspection accreditation to industry, governments, regulators, and consumers. In this field, a number of multilingual brochures on accreditation has been published and is available on the home page of ILAC. As concerns medical laboratories, ILAC applies ISO 15189 standard, for other related testing laboratories (e.g., for forensic laboratories) ISO 17025 is recommended. • Assisting and supporting developing national accreditation systems • Global recognition of laboratories and inspection facilities via the ILAC • Arrangement, thus facilitating acceptance of test, inspection, and calibration data accompanying goods across national borders ILAC developed close links and strategic partnerships with key organizations operating in ILAC’s sphere of work, and has signed Memoranda of Understanding with the following international bodies: Comité International des Poids et Mesures (CIPM), Industry Cooperation on Standards and Conformity Assessment (ICSCA), IAF/ISO, United Nations Industrial Development Organisation (UNIDO), The International Electrotechnical Commission (IEC), and Organisation Internationale de Métrologie Légale (OIML). 7.3.2.2  International Accreditation Forum The International Accreditation Forum, Inc. (IAF) [7] is the world association of Conformity Assessment Accreditation Bodies and other bodies interested in conformity assessment in the fields of management systems, products, services, personnel, and other similar programs of conformity assessment. The IAF was formed from the first meeting of “Organisations that Accredit Quality System Registrars and Certification Programs,” which was held in 1993 in Houston, USA. The meeting was attended by representatives from the United States, Mexico, the Netherlands, the United Kingdom, Australia/New Zealand, Canada, and Japan. The purpose of the IAF was to operate a program for the accreditation of bodies dealing with conformity assessment, in order to ensure that certification of products, processes, or services in one region or country should be accepted in other regions or countries. Also, through the program the IAF aimed to ensure that equivalent conformity assessment procedures used by organizations should be developed. © 2011 by Taylor and Francis Group, LLC

174

Quality Assurance in the Pathology Laboratory

Fifty-two states are members of the IAF. Membership of the IAF is separated into a number of categories. 7.3.2.2.1╇ Accreditation Body Membershipâ•… Open to organizations that conduct and administer programs by which they accredit bodies for certification of quality systems, products, services, personnel, environmental management systems, as well as other programs of conformity assessment. Accreditation body members must declare their intention to join the IAF. 7.3.2.2.2╇ Association Membershipâ•… Open to organizations or associations that represent a similar group of entities, either internationally or within an economy or region. 7.3.2.2.3╇ Partner Membershipâ•… Open to entities representing the interests within an economy, region or internationally, of parts of governments, regulators or of organizations which are nonaccreditation bodies, but which have an interest in conformity assessment, and which support the objectives of IAF. Partner Members may be invited to participate in the technical work of IAF. 7.3.2.2.4╇ Special Recognition Statusâ•… The IAF has the discretion to give special recognition status to organizations that share a common objective with the Corporation. These organizations may be represented and participate at IAF Member meetings but are not eligible to vote. Special recognition status may also be granted to Regional groupings where the implementation of the IAF Multilateral Recognition Arrangements (MLA) is promoted. 7.3.2.2.5╇ Observer Membershipâ•… In cases where the IAF Board of Directors believes it is in the best interests of IAF Members to develop closer relationships with a particular entity, the Board may grant Observer status to such an entity for a period not exceeding 1 year, but subject to annual renewal. An Observer Member may be invited to attend any meeting of IAF and/or participate in its technical work, as determined by the Board from time to time. However, Observer Members are not eligible to vote on any matter. IAF members accredit certification or registration bodies that issue certificates attesting that an organization’s management products or personnel comply with a specified standard (called conformity assessment) and are competent to do the work they undertake and are not subject to conflicts of interest. The second purpose of the IAF is to establish mutual recognition arrangements, known as MLA, between its accreditation body members. The objective of the MLA is that it will cover all accreditation bodies in all countries in the world, thus eliminating the need for suppliers of products © 2011 by Taylor and Francis Group, LLC

Role of Accreditation Procedures in Maintaining Quality

175

or services to be certified in each country where they sell their products or services. IAF has programs to • Develop guidance, rules, and procedures for the operation of accreditation, certification/registration, and mutual recognition programs resulting in “certified once, accepted everywhere” • Ensure that all accreditation body members operate to the highest standards of competence and probity, and only accredit bodies that have demonstrated that they are competent and impartial • Harmonize accreditation procedures and their implementation based on international standards and guides, and IAF guidance on their application • Develop guidance, rules, and procedures for the operation of specific sector conformity assessment schemes to meet the needs of specific industries • Develop guidance, rules, and procedures for the operation of compliance programs to satisfy regulatory or government requirements • Exchange information between accreditation bodies • Cooperate in the training of assessors and other personnel • Contribute to the work of ISO and other relevant international bodies • Liaise with the regional groups of accreditation bodies • Liaise with other relevant bodies such as ILAC, ISO, and industry groups • Assist emerging accreditation bodies in low and medium income economies IAF is publishing communiqués, policy documents, guidance documents, mandatory documents, information documents, newsletters, and others. IAF provides cooperation with national accreditation bodies in pathology, laboratory medicine, and related areas through nominated contact organizations and persons. 7.3.3╇U.S. Regulations and Accreditation Organizations 7.3.3.1  Centers for Medicare and Medicaid Services Clinical Laboratory Improvement Act (CMS CLIA) CLIA is responsible for all activities concerning certification, inspection, and accreditation of medical laboratories in the United States. This is legally based on the Clinical Laboratory Improvement Act, known as “CLIA’88” [40]. This legal rule has been presented and discussed in detail in the Chapter 8 of this book. The CLIA certification program is self-funded through fees paid by its participants. It is administered by the CMS, which is a division of © 2011 by Taylor and Francis Group, LLC

176

Quality Assurance in the Pathology Laboratory

HHS. CMS is charged with the administration and implementation of CLIA and collaborates with the Food and Drug Administration (FDA) and with the Centers for Disease Control and Prevention (CDC). FDA is responsible for the categorization of laboratory tests, whereas CDC provides scientific and technical support. CMS is also responsible for recognizing of private, nonprofit organizations whose requirements are at least equal to those of CLIA. These organizations are entitled to issue certificate of accreditation, which is equal to CLIA compliance. Following organizations have deemed status under CLIA: • COLA—Formerly the Commission on Office Laboratory Accreditation; deemed under CLIA’88 since 1993, the JC since 1997; originally for Physician Office Laboratories (POLs), now provides accreditation service also for community hospitals and some industrial laboratories; inspections by professional staff surveyors focused on education and adopting a quality systems approach to laboratory testing • CAP—the most comprehensive in coverage of all types of clinical laboratories; peer review process; deemed by CLIA’88 and the JC • Joint Commission—Formerly the Joint Commission on Accreditation of Healthcare Organizations (JCAHO), and before that the JC on Accreditation of Hospitals; deemed under CLIA since 1995; laboratory surveys are performed by experienced medical technologists • AABB—accredits organizations collecting, processing, distributing, or transfusing blood and blood components • American Society for Histocompatibility and Immunogenetics— deemed under CLIA’88, JC, and the states of Florida, Oregon, and Washington. Facilities, staff, and procedures are inspected with an emphasis on education and assistance with correction of deficiencies • American Osteopathic Association (AOA)—deemed under CLIA’88 since 1995 for AOA-accredited hospitals According to the CMS CLIA database updated December 2008, [41] 209,499 nonexempt medical laboratories were registered. 129,219 laboratories had waiver certificate, 38,383 performed Provider-Performed Microscopy (PPM), 19,261 were CLIA-compliant, and 16,238 were accredited. In CLIA-exempt states (New York and Washington) together 6398 laboratories were registered. Most laboratories were accredited by COLA (6465), followed by CAP (5386) and JC (2753). The majority of COLA accreditation concerned POLs (6128). As of 2007, the CMS, CAP, and JC inspections are unannounced. This should ensure that the inspection reviews the laboratories during routine, everyday operation. In addition, the inspectors are focusing more on the laboratory © 2011 by Taylor and Francis Group, LLC

Role of Accreditation Procedures in Maintaining Quality

177

work itself instead of reviewing documentation in areas usually separated from the laboratory. The JC uses tracer methodology, following testing through all stages, whereas CAP involves in-depth reviews of sample tests with interviews for bench technologists in order to check their level of understanding. Rauch and Nichols [42] provided an overview of the medical laboratory accreditation and inspection process in the United States. A prevailing concern is the questionable quality of waived testing. There has been an increasing fraction of laboratories that offer only waived testing, usually as POLs. Fifty-three percent POLs are offering only waived tests, 12% are CLIAcompliant, 29% are doing PPM examinations, and only 6% are accredited, all of them by COLA (status of 2007). The facilities offering only waived tests are not subject to routine inspections and only occasionally may be chosen as part of a sample for purposes of auditing. Inspections of POLs in eight states have found issues that raised concern over the quality of test results produced in POLs with certificate of waiver. Among the issues noted during these inspections • Laboratory did not have or follow manufacturer’s instructions • Laboratory did not perform maintenance or function checks as required • Laboratory used expired reagents • Laboratory did not perform quality control as required • Laboratory did not provide training of testing personnel • Laboratory did not evaluate staff for accurate or reliable testing • Laboratory was performing testing beyond its CLIA certificate level According to Rauch and Nichols [42], there is a need to expand regulatory oversight over such laboratories. CMS has set a goal of inspecting at least 2% of POLs with certificates of waiver each year. Repeat inspections noted significant improvement in more than 75% of the POLs that were revisited. 7.3.3.2  Commission on Office Laboratory Accreditation COLA [43] was founded in 1988 as a private alternative to help laboratories stay in compliance with the new CLIA. In 1993, the Health Care Financing Administration (now CMS) granted COLA deeming authority under CLIA, and in 1997, the JCAHO also recognized COLA’s LAP. After 35,000 surveys in which COLA’s practical, educational accreditation methods helped POLs stay in compliance with CLIA, COLA expanded its program offerings to include hospital and independent laboratories. Completing COLA’s accreditation program means that the clinical laboratory is in compliance with CLIA and is recognized by the JCAHO. Following types of laboratories are accredited by COLA: POLs, Community Hospitals, mobile clinics, Veterans Administration facilities, © 2011 by Taylor and Francis Group, LLC

178

Quality Assurance in the Pathology Laboratory

and laboratories of the Department of Defense. COLA is approved by CMS to accredit laboratories in the following specialties: Chemistry, hematology, microbiology, immunology, immunohematology/transfusion services, pathology, including cytology, histopathology, and oral pathology. Additionally to laboratory services, COLA is providing accreditation in management services. QMSs Accreditation Program for Medical Laboratories is a COLA-developed, modern laboratory accreditation process that combines proven QM and business process techniques with traditional laboratory medicine assessment. The QMS process produces higher quality and improved patient safety in laboratory testing, while significantly strengthening process efficiency and lowering cost and risk. 7.3.3.3  College of American Pathologists (CAP) The LAP of the CAP [44] was established in 1961. It received approval as an accrediting organization under the CLIA by the CMS, an agency within the U.S. HHS. The main goal of the LAP is to improve the patient safety by developing the quality of pathology and laboratory services through education and standard setting to ensure that laboratories meet or exceed high-quality standard requirements. CAP is offering accreditation services worldwide. Also, a number of European medical laboratories are accredited according to the standards of the CAP. Accreditation by CAP is based on standards that are translated into checklists and that usually do not refer to EN or ISO standards. However, due to the special relevance of the ISO/EN 15189 standard, CAP is now offering a nonregulated, voluntary accreditation according to this standard. This program does not replace the CLIA-based LAP, but complements CAP accreditation and other quality systems. According to CAP, this program optimizes processes to improve patient care, strengthen quality standards while reducing institutional errors and risks, and controls costs. CAP 15189 is offering a highly disciplined approach to implementing and sustaining change. The accreditation programs examine pre-analytical, analytical, and post-analytical aspects of QM in the laboratory. These include the performance and monitoring of general quality control, test methodologies and specifications, reagents, controls and media, equipment, specimen handling, test reporting and internal performance assessment, and external PT. In addition, personnel requirements, safety, document management, and other administrative practices are included in the inspection process. Laboratories that meet accreditation requirements distinguish themselves as quality laboratories. 7.3.3.3.1╇ General Structure of CAP Accreditation Bodiesâ•… The Council on Accreditation (CoA) sets the strategic direction for the LAP and monitors its overall effectiveness in ensuring that participating laboratories © 2011 by Taylor and Francis Group, LLC

Role of Accreditation Procedures in Maintaining Quality

179

meet regulatory and CAP requirements. The CoA also provides oversight to the Commission on Laboratory Accreditation (CLA), a group of qualified pathologists appointed to advance the LAP to administer the programs through the principles of peer review and education toward the CAP goal to ensure that the programs continue to meet the scientific, service, and regulatory needs of participants; and to enhance the recognition of the pathologist as a physician in clinical decision making and consultation through the role of laboratory director. The CLA oversees and coordinates the activities of the five CLA committees in the development, maintenance, and implementation of accreditation checklists and standards, inspection processes, inter-inspection assessment tools, complaint investigations, and program education, under collaboration with CAP scientific resource committees to keep the programs and their requirements current. The Accreditation Committee is another arm of the CoA responsible for ensuring objectivity and consistency in CAP accreditation decision making by centralizing the decision-making criteria and processes. The Accreditation Committee makes investigation and accreditation decisions in those cases requiring committee action based on approved policy (i.e., more challenging and immediate jeopardy cases that may require a nonroutine inspection, suspension, probation, or conditional accreditation decisions). The Regional Commissioner is responsible for all accreditation activities of a specified group of laboratories. This includes the timely assignment of inspectors, review of inspection findings, and resolution of issues that may arise over accreditation decisions. Following the on-site inspection, the Regional Commissioner, in conjunction with CAP technical staff, reviews the findings and the laboratory’s corrective action. Deputy, State, and Division Commissioners assist the Regional Commissioners. State and Division Commissioners are responsible for identifying and assigning inspectors for their geographic regions. They must make sure that inspections are conducted on a timely basis and in accordance with CLA policy. The inspectors who conduct the on-site laboratory inspections are the main members of the program. The inspection team leader is a boardcertified pathologist who has received training and has participated in several inspections as a team member. Inspection team members are other pathologists, doctoral scientists, supervisory-level medical technologists, pathology residents and fellows, and other individuals who have expertise in the area of the laboratory that they are to inspect. The Laboratory Accreditation staff is composed of technical and administrative personnel who carry out the policies and procedures of the CLA and are responsible for the management and operation of the program. Since the majority of laboratories seek accreditation through CAP, all phases of the accreditation process will be now presented in details. © 2011 by Taylor and Francis Group, LLC

180

Quality Assurance in the Pathology Laboratory

7.3.3.3.2╇ Application and Pre-Inspection Phase: Laboratory Dutiesâ•… A laboratory that would like to become accredited by CAP must submit an application request and once the request has been processed, application materials will be sent to the laboratory in one binder including four sections. The first section will have all the necessary application forms. The other three parts of the binder include “The Standards for Laboratory, Accreditation,” the “CAP Laboratory accreditation Manual” [45], and “Inspection Checklists.” These materials are available for review at the CAP Web site [44] before applying to the program. A new applicant to the accreditation program has up to 6 months to complete and return the application. Laboratories must participate in a CAP-accepted PT program for each patient reportable test. Each laboratory within an institution that operates under a separate CLIA license must submit separate application request forms to be accredited separately by CAP. In pre-inspection phase, application materials (forms and supplemental material) must be prepared and completed by the laboratory. The application form addresses general laboratory information including demographics, personal, contacts, licensure and certification, affiliated laboratories, and conditions of accreditation. All necessary details are given in the forms. For an initial accreditation, a test catalog shall be included. The laboratory must complete a roster for each laboratory section, including any non-laboratory based employees performing point-of-care-testing classified by CMS as moderate or high complexity. All disciplines practiced by the laboratory must be listed in the application, and all disciplines will be inspected. CAP does not accredit portions of laboratories. The accreditation letter lists only those disciplines that are reviewed at the time of the on-site inspection. Laboratories that add disciplines after the inspection must notify the College in writing; in some cases, additional inspections may be required. Laboratories applying for the Forensic Drug Testing (FDT) Accreditation Program must also submit the special “litigation packet” information, including details on QC and chain of custody procedures, analytical data on detection and quantitation of cannabinoids, and samples of documentation. 7.3.3.3.3╇ Preparing for the Inspection: Inspector’s Dutiesâ•… Inspectors and team leaders need to complete a mandatory CAP-prescribed training to promote a consistent understanding of program standards and ensure a uniform application of techniques. The training could be online self-study, live training seminar or live workshop for the team leader and team members. Team leader should be selected according to multiple criteria, including completing training, known conflicts of interest, and qualifications. Generally, one  inspector is needed for the laboratory general inspection, and one for each of the following checklist combinations: hematology and © 2011 by Taylor and Francis Group, LLC

Role of Accreditation Procedures in Maintaining Quality

181

urinalysis; chemistry and toxicology, microbiology and immunology, and anatomic pathology and cytopathology. If the laboratory does not have a donor center, Transfusion Medicine can be combined with another checklist, such as Immunology or Point of Care. Adjustments to the number of inspectors should be made based upon the experience of the inspectors and the extent of testing in the laboratory. All inspectors should be familiar with the safety and test method validation requirements in the Laboratory General Checklist. Inspectors assigned to other checklist may assist the laboratory general inspector for the large full service laboratory. The team leader assembles an inspection team appropriate for the size and scope of the laboratory and check if specific expertise is needed. Also number of inspection days needed to perform the inspection will be recommended. After accepting the assignment for particular laboratory, the inspection team leader should arrange the inspection date. The inspection should occur within the 30 calendar days before laboratory’s accreditation date. A letter should be send to the laboratory director(s) indicating the inspection date, projected schedule, team listing, special requests (e.g., histology slides for review), and preliminary instructions regarding availability of documentation (personnel and training records, procedure manuals, PT results, test validation studies, quality control and maintenance records, and a sampling of completed case records, as applicable). For unannounced inspections, neither the college nor the team leader will communicate to the laboratory the date of the inspection, the name of the team leader, or the composition of the inspection team. 7.3.3.3.4╇ Conducting the Inspectionâ•… Three documents are fundamental to the inspection process: the standards for laboratory accreditation, the checklists, and the inspector’s summation report (ISR). The standards of the laboratory accreditations include • Standard I defines responsibilities and role of the laboratory director. • Standard II concerns the physical facilities and safety of the laboratory, including space, instrumentation, furnishings, communication systems, supplies, ventilation, piped gases and water, public utilities, and security. • Standard III encompasses quality control and performance improvement. This includes discussions of quality control, PT, instrument maintenance, QM, and performance improvement requirements. • Standard IV includes the inspection requirements of the program. On-site inspection by an external team and interim self-inspection are the cornerstones of the inspection requirement. The checklists are used by inspectors to determine if the laboratory meets the requirements set out in © 2011 by Taylor and Francis Group, LLC

182

Quality Assurance in the Pathology Laboratory

the standards. The checklists are revised periodically and include approximately 3000 questions. Similar checklist questions may appear in multiple discipline-specific checklists. According to the activity menu and the scope of service of the laboratory the checklist will be determined and customized for each section by the inspection staff. More than one checklist can be applied for the any laboratory section. Customized checklists reduce the number of non-applicable checklist questions. Supervisors should prepare for inspection using the appropriate specific checklist(s). The laboratory will be inspected with the checklist version that has been sent with the application/reapplication packet even if another version was released between the time of application/reapplication and the actual inspection. The checklists are organized by specific laboratory disciplines and/or important management operations as follows: laboratory feneral, anatomic pathology, chemistry and toxicology, cytogenetics, cytopathology, flow cytometry, hematology and coagulation, histocompatibility, immunology, limited service laboratory, microbiology, molecular pathology, point-of-care testing, team leader assessment of director and quality, transfusion medicine, urinalysis, FDT, reproductive laboratory. Checklists are automatically mailed to accreditation program participants approximately 9 months prior to the inspection anniversary date and again at accreditation mid-cycle during the self-evaluation year. An electronic check list copy can be downloaded from CAP Web site [44]. For the laboratory that they want to anticipate and prepare for upcoming checklist requirements, reviewing the most recent edition of each checklist “checklist with commentary” will be very helpful since the revised checklists not only includes the questions but also the explanation, example, and references to assist understanding and interpretation of the checklist requirements. Each question is uniquely numbered, worded, and designed to produce a “Yes” response, which means that the laboratory is in compliance with the item; a “No” response, which means the laboratory does not comply; or “N/A,” which means that the question does not apply in this situation. Each question on the checklist specified according to how serious affect the patient care by indicating in top of each question either Phase I or Phase II deficiencies. Phase I questions do not seriously affect the quality of patient care or significantly endanger the welfare of a laboratory worker. If a laboratory is cited with a Phase I deficiency, correction and a written response to the CAP are required, but supportive documentation of deficiency correction is not required. Phase II questions may seriously affect the quality of patient care or the health and safety of the hospital or laboratory personnel. All Phase II deficiencies must be corrected before accreditation is granted by the CLA. © 2011 by Taylor and Francis Group, LLC

Role of Accreditation Procedures in Maintaining Quality

183

When a laboratory is in compliance but it can improve its process, a recommendation can be given. Recommendation could be relate to the way the laboratory is doing something or keeping records it might not be related to a checklist item. The laboratory is not obligated to respond to or implement a recommendation. A recommendation that should have been cited as a deficiency will be changed to a deficiency by CAP staff, and a deficiency response will be required from the laboratory. Deficiencies cited by the inspection team may be challenged if the resolution of a disagreement between laboratory personnel and an inspector cannot be achieved before or during the summation conference. The Regional Commissioner will review disputed items and determine if the deficiency can be removed from the record. All inspection findings are confidential. They should not be discussed in any context other than the inspection itself. Moreover, they should not be disclosed to anyone not associated with the accreditation process unless appropriate prior documented consent has been obtained. Accreditation must be carried out in an impartial and objective manner, uninfluenced by any personal, financial, or professional interest of any individual acting on behalf of the CAP LAP. Prior to unannounced inspections, the team leaders are required to sign a statement attesting to the absence of conflict of interest. There are three techniques used by the inspector in order to obtain useful information about the laboratory being inspected. The three techniques are known as “READ–OBSERVE–ASK.” “READ” means review of records and documents; “OBSERVE–ASK” means direct observation of laboratory activities and asking open-ended, probing questions. The use of these techniques eliminates the need to ask every single checklist question, as the dialog between inspector and the laboratory may address 5–10 checklist questions at a time. The list of deficiencies from the previous on-site inspection provided in the inspector’s packet must be reviewed and ensured that they have been appropriately addressed. 7.3.3.3.5╇ Post-Inspection Phaseâ•… The inspection ends with the Summation Conference. During Pre-summation Team Meeting all members of inspection team is checking the consistency of inspection reports and provide a review of cited deficiencies. ISR is then completed with listed deficiencies and description of the reason of the noncompliance. The ISR report must be readable for accurate documentation and appropriate follow up. Recommendations should be recorded in the ISR. A pre-summation conference should be attended by laboratory director, laboratory administration and personnel involve with inspection. The team leader should introduce the inspectors and their assignment and state the goal of the LAP and the main objective to maintain high-quality laboratory work © 2011 by Taylor and Francis Group, LLC

184

Quality Assurance in the Pathology Laboratory

and to be in compliance with CLIA’88 and CAP checklists. The inspection team should identify areas for improvement by citing deficiencies. Another purpose of this meeting is to share information regarding how other laboratories accomplish compliance and make recommendations for the laboratories to achieve better patient care services. All responses for found deficiencies should be submitted with all evidence documentations within 30 calendar days of the inspections. The laboratory should send their deficiency response using the CAP response form and send to CAP and keep the copy in the laboratory. The timeframe for receiving the accreditation decision is 75 days. The decision to accredit a laboratory is made by the Regional Commissioner when the laboratory has provided acceptable documented responses to a Phase I and Phase II deficiencies and correction actions. If the laboratory is in non compliance with accreditation standard and failed to correct cited deficiencies within reasonable period may be presented to CLA for an accreditation decision. For denied laboratory, an official notification by certified mail will be send to all agencies that accepting CAP accreditation [46]. 7.3.3.3.6╇ Accreditation Requirements for Forensic Drug Testing by CAPâ•… CAP checklist contains special chapter devoted to FDT. The requirements specific for FDT are presented below. 7.3.3.3.6.1╇ Personnelâ•… Minimum personnel qualifications for analytical testing in the FDT laboratory should be equivalent to those required under CLIA 1988 guidelines. The laboratory should have an organizational chart, personnel policies, and job descriptions that define qualifications and duties for all positions. Personnel files should contain qualifications and continuing education records for each employee. The director or scientific director should meet at least one of the following qualifications: certified as a Diplomate by the American Board of Forensic Toxicology, certified by the American Board of Clinical Chemistry in Toxicological Chemistry, MD certified in clinical and/or forensic pathology with at least 2 years’ experience in analytical toxicology, and PhD in a chemical and/or biological discipline with at least 2 years’ experience in analytic toxicology. Additionally, the director or scientific director should have appropriate experience in forensic applications of analytical toxicology, such as in-court testimony, attendance at relevant continuing education programs, research, and publications in analytical toxicology. 7.3.3.3.6.2╇ Extent of Services Providedâ•… For the laboratory performing both screening and confirmatory testing of forensic drug samples, the positive results by screening MUST be confirmed before reporting using scientifically acceptable mass spectrometric method. For positive ethanol © 2011 by Taylor and Francis Group, LLC

Role of Accreditation Procedures in Maintaining Quality

185

results, one of separate aliquot of the original specimen should be tested by Â�scientifically acceptable gas chromatographic method. The laboratory should include the cutoff points for screening and confirmation testing for all drug classes. In the case of urine drug testing, the laboratory should screen for at least amphetamines, methamphetamine, benzoylecgonine, codeine, morphine, 6-monoacetylmorphine, phencyclidine, and delta-9-THC-COOH. In the case of oral fluid drug testing, the laboratory should screen for at least amphetamines, methamphetamine, benzoylecgonine, cocaine, norcocaine, codeine, morphine, 6-monoacetylmorphine, phencyclidine, and delta-9-THC-COOH. For hair drug testing, the laboratory should screen for at least amphetamines, methamphetamine, benzoylecgonine, cocaine, codeine, morphine, 6-monoacetylmorphine, phencyclidine, and delta-9-THC-COOH. 7.3.3.3.6.3╇ Proficiency Testingâ•… The laboratory should be enrolled with CAP/ AACC Forensic Urine Drug Testing or CAP—accepted alternative PT program. For the tests where the PT is not available, or if it is available but with different matrix, an alternative assessment should be performed at least semi biannually to validate the performance. A documented procedure must be available for proper handling, analysis, review, and reporting of PT sample. All PT must be integrated within routine laboratory workload together with routine batch and analysis performed by personnel who routinely test patient/client samples using the same documented procedure for testing. An evidence of evaluation, corrective actions for unacceptable PT results must be documented. 7.3.3.3.6.4╇ Quality Managementâ•… The QM should include monitoring the problem of collection client samples, chain of custody problems, or transportation delay. A system must be in place to ensure the improvement of the process. Laboratory must be able to detect any diluted or potentially adulterated sample. 7.3.3.3.6.5╇ Quality Control/Standard Operating Proceduresâ•… The scientific director is responsible for the overall QC Program. QC program must be clearly defined and available to all laboratory staff; it should include delegation of responsibilities, general policies, and analytic details. A documented procedure must be in place to detect the significant clerical and analytical errors before reporting the results. The control used for all commonly screening tests should includes drug free, a controls that are 25% below or above the cutoff for negative and positive control, respectively. The control must comprise 10% of the samples in the batch and at least one control must be in the end of the batch. QC results must be recorded or plotted in a way to allow continuous review and easily detect a failed QC results. Correction actions must be taken immediately in case of QC results failure and results © 2011 by Taylor and Francis Group, LLC

186

Quality Assurance in the Pathology Laboratory

of action must be documented. The QC must be evaluated for acceptability before reporting results and periodic review of QC must be performed by laboratory director or designee. 7.3.3.3.6.6╇ Specimen Handlingâ•… The inspector should inspect the specimen receipt, verification of identity, accessioning, external and internal chain of custody, and labeling. The evaluation of the samples received should include sample volume, any adulteration and dilution check, evaluation of integrity of seals or secured containers, aliquoting, storing, and completion of records. Any observed problem processes that are contradictive with the documentation should be discussed with laboratory director. All specimens must be stored in secure area to which only the authorized individuals can have access. A documented procedure must assure that all positive specimens are retained in their original container for 1 year in freezer. For urine specimens, a documented procedure must be in place to measure the specimen validity (at a minimum testing for creatinine is required). In case of the oral fluid, to check the specimen validity testing the IgG is required. For all hair specimens, the laboratory should have validated procedures to control for potential external contamination. 7.3.3.3.6.7╇ Reporting of Resultsâ•… The laboratory should have a protocol for the reporting of results to clients or their representatives. The protocol should includes the date of specimen collection, date of specimen receipt, donor and client identification information, laboratory unique specimen identification number, specimen matrix tested (for hair specimen the site of collection), drug analyzed as part of the FDT, cutoff values per drug for both screening and confirmation tests, positive and/or negative results, date of report. Only confirmed positives results are reported as positive. Laboratory must have a documented protocol for ensuring the reliability and confidentiality of telephone reports and electronically reported results. 7.3.3.3.6.8╇ Recordsâ•… The laboratory should have a documented procedure that define which records, and for how long records must be maintained to meet client, legal, regulatory, and accreditation requirements. The following records must be maintained for 2 years: laboratory security access logs, accessioning logs, chain-of-custody documents and requisitions, analytical data from screening and confirmation analyses, specimen reports, QC program records, instrument maintenance and calibration records, reagent/standard/ calibrator/control preparation and verification records. Method performance validation records should be kept for at least 2 years after retirement of procedure, as well as personnel files on all laboratory personnel involved with the FDT performed by the laboratory, PT survey results, reports, and corrective © 2011 by Taylor and Francis Group, LLC

Role of Accreditation Procedures in Maintaining Quality

187

actions, previous CAP FDT on-site inspection records and corrective actions, previous CAP FDT self-inspection records and corrective actions, previous CAP general on-site inspection records and corrective actions appropriate to the FDT laboratory. 7.3.3.3.6.9╇ Method Performance Validationâ•… For FDT, CAP formulated criteria for mass spectrometry (GC-MS, LC-MS, GC-MS/MS, and LC-MS/MS). These criteria are presented in details in the Chapter 3.3.4.6 of this book. 7.3.3.4  JCIA Joint commission international accreditation (JCIA) was created in 1998 as a major division of JC’s international subsidiary. The JCIA as a part of JCAHO is an organizational accreditation program that evaluates the operation and management system of the health care organizations to ensure a high-standard patient care, safe, and effective and well-managed organization [46,47]. The WHO partnered with The JC and JC International to establish the world’s first WHO Collaborating Centre dedicated solely to patient safety solutions [48]. New medical staff requirements established by the JC include the development of ongoing professional practice evaluation and focused on professional practice evaluation. Accreditation Council for Graduate Medical Education and the American Board of Medical Specialties jointly developed processes and incorporate the general competencies of patient care, medical knowledge, practice-based learning and improvement, interpersonal and communication skills, professionalism and systems-based practice The CAP mad resources available to assist members and their facilities in implementing the new requirements and improving patient care [49]. 7.3.3.4.1╇ Accreditation Programs and Accreditation Standards of JCIAâ•… The following accreditation programs of JCIA are available through JCIA: • • • • • • •

Ambulatory care Care continuum Clinical laboratory Disease or condition-specific care certification Hospitals Medical transport Primary care

For each of these programs, particular standards were established. Since Clinical LAP is most relevant in this book, it will be presented in more © 2011 by Taylor and Francis Group, LLC

188

Quality Assurance in the Pathology Laboratory

detailed way. JCIA formulated Clinical Laboratory Standards [50], which concern the following fields: • Quality management and improvement (QMI) system, including planning, documenting implementation, and monitoring of QMI program; designing system and processes according to quality improvement principles; identifying key indicators to monitor structures, processes, and outcomes; reference laboratory services; and QMI process documentation requirements. • Management and leadership (MGT) standards, including planning, responsibility, and authority; communication and coordination, QMI documentation, and review. • RSM standards, including provision of resources; human resources; infrastructure and facilities, laboratory equipment, environment, and safety. • Planning, provision, and development of laboratory services. • Monitor, analyze, and improve standards, including general quality control; histopathology and cytopathology; clinical chemistry, hematology and coagulation; microbiology; urinalysis and clinical microscopy; diagnostic immunology and serology; radioisotope testing; blood bank and transfusion service; histocompatibility testing, and cytogenetics. • International patient safety goals: The purpose of the International Patient Safety Goals is to promote specific improvements in patient safety by identifying problematic areas in health care and laboratory services. The following goals apply to accredited laboratories: identify patients correctly, improve effective communication, and reduce the risk of health care-associated infections. It is notable in these standards that the main accent was put on administration part (QMI, MGT) and on quality control. The standards concerning resources and laboratory services, which concern the core functions of laboratory services, are presented in less detailed manner. Dhatt and Sheiban [47] divided 11 JCIA hospital standards into two groups. The first group covered the patient care standards and included access and continuity of care, patient and family rights, assessment of patients (AOP), care of patients (COP), and patient family education. The second group of standards is related to health care organization management standards that includes QMI; prevention and control of infections (PCI); Â�governance, leadership, and direction; facility management, and safety (FMS); staff qualifications and education and management of information (MOI). Some of the hospital standards are also applicable to the laboratory such as AOP, COP, QMI, PCI, and FMS. The most relevant standard to the © 2011 by Taylor and Francis Group, LLC

Role of Accreditation Procedures in Maintaining Quality

189

laboratory is the AOP, which can be applied by the laboratory for better patient services and care and includes availability of laboratory services that meet applicable local and national standards, laws, and regulation; availability of clinical pathology services; availability of Laboratory Safety Program; availability of the results on timely manner by defining the TAT for each tests in the laboratory; availability of the essential reagents and other supplies; availability of procedures for sample collecting, identifying, handling, safe transporting, and disposing; establishing a normal range for results, which must be includes in patient reports; establishing and monitoring of quality control procedures. COP.5.3 standard is applicable to the hospital as well to the laboratory that indicates that the laboratory should have policies and procedures instructions for handling, use, and administration of blood and blood products. FMS.5 can be also as a core standard for organization and the laboratory and this assessing the presence of a plan for the inventory, handling, storage, use control, and disposal of hazardous materials. QMI.1 requires that the hospital and laboratory participate in planning and monitoring a QMI plan. QMI.3.2 and QMI.3.6 are both indicative of the requirements concerning laboratory and radiology safety, quality control programs, and the use of blood and blood products, respectively. Most of the AOP and QMI standards are relevant to ISO 15189 standards such as 4.1—Organization and management is relevant to AOP.5, 4.7—Advisory services vs. (AOP.5.12), 4.12—Continual improvement vs. (QMI.3.2), 5.1—Personnel vs. (AOP.5.3), 5.3—Laboratory equipment vs. (AOP.5.5), 5.4—Reexamination procedure vs. (AOP.5.7), and 5.8—Reporting of results vs. (AOP5.8). 7.3.3.4.2╇ JCIA Accreditation Processâ•… Availability of resources is the first step to get started in the accreditation process and this includes JCIA Standards for Hospitals, Survey Process Guide (available on the Web site of JCIA, web-based training on introduction to the international accreditation process, newsletters and publications, both in printed and electronic form. Twelve to twenty-four months prior to the survey, the organization should obtain JCI Standards manual and begin preparing for JCIA. Six to nine months prior to the survey, the application should be submitted and schedule survey dates should be established within 2 months prior to the survey, JCI survey Team Leader will contact the applied organization to determine survey agenda. Within 2 months after survey, the Accreditation Decision and official Survey Findings Reports from JCI will be submitted to the organization. 7.3.3.4.3╇ Recognition by Accrediting Organizations and Other Government Agenciesâ•… JCAHO accepts CAP accreditation of hospital laboratories. JC laboratory surveyor will not survey CAP-accredited © 2011 by Taylor and Francis Group, LLC

190

Quality Assurance in the Pathology Laboratory

laboratories. During the hospital’s survey, however, an administrative surveyor will Â�examine laboratory safety and a physician surveyor will request and review information on the performance improvement activities of the laboratory and its medical staff. Occasionally the JC validates the CAP inspection process by sending an observer along with a CAP inspection team [51]. 7.3.3.5  Other U.S. Nonmedical Accreditation Organizations There are a number of American governmental and private organizations, involved in accreditation services for laboratories of biological, chemical, or forensic profile. Most of them are members of ILAC or IAF. As a basic standard these organizations are using ISO 17025 standard. American Association for Lab Accreditation (A2LA) [52], is a nonprofit, nongovernmental organization providing comprehensive services in laboratory accreditation and laboratory-related training. Laboratory accreditation is based on ISO/IEC 17025:2005. A2LA also offers programs for accreditation of inspection bodies, PT providers, reference material producers and product certification bodies. Laboratories are accredited in the numerous fields, among them in Biological, Calibration, Chemical, and Environmental. In addition to the broad fields, specifically tailored programs are available for animal drugs, environmental lead (Pb), fertilizers, and food testing, among others. International Accreditation Service, Inc. (IAS), United States [53] offers accreditation programs for testing and calibration laboratories according to ISO 17025 and collaborates with various international organizations, like EA. National Voluntary Laboratory Accreditation Program (NVLAP) [54], is offered by National Institute of Standard and Technology. Among others nonrelated procedures, NVLAP accredits procedure for asbestos fiber analysis. Laboratory Accreditation Bureau (L-A-B) [55] is recognized by ILAC and other organizations to provide ISO/IEC 17025 laboratory accreditation services to testing and calibration labs. L-A-B is recognized to ISO/IEC 17011 for accrediting labs to ISO/IEC 17025. Perry Johnson Laboratory Accreditation, Inc. [56] offers accreditation to ISO/IEC 17025 for laboratories performing testing and/or calibration in a wide range of fields, including, among others, chemical and biological testing. American Society of Crime Lab Directors/Laboratory Accreditation Board (ASCLD/LAB) [57] offers “an ISO-PLUS Program of Crime Laboratory Accreditation ISO/IEC 17025 enhanced by ASCLD/LAB-International Supplemental Requirements.” It means that any laboratory seeking ASCLD/ LAB-International accreditation must demonstrate conformance to the requirements in ISO/IEC 17025:2005, as well as the ASCLD/LAB-International Supplemental requirements for the accreditation of forensic science testing laboratories (2006). The following forensic fields are mentioned: controlled © 2011 by Taylor and Francis Group, LLC

Role of Accreditation Procedures in Maintaining Quality

191

substances, toxicology, trace evidence, biology, firearms/toolmarks, questioned documents, latent prints, crime scene, and digital and multimedia evidence. Additionally, special Breath Alcohol Calibration Accreditation Program is offered. American National Standards Institute—American Society for Quality National Accreditation Board LLC (ANSI-ASQ) provides accreditation services under the ACLASS [58] and ANAB [59] brands. Under the ACLASS brand, the organization accredits ISO/IEC 17025 testing and calibration laboratories, ISO/IEC 17020 inspection bodies, and ISO Guide 34 reference material producers. Under the ANAB brand, the organization is the U.S. accreditation body for management systems and accredits certification bodies for ISO 9001 QMSs, ISO 14001 environmental management systems, ISO 22000 food safety management systems, ANSI/AIHA Z10, CSA Z1000, and BS OHSAS 18001 occupational health and safety management systems, among others. 7.3.4╇ European Accreditation Organizations 7.3.4.1  European Cooperation for Accreditation EA [60] is a nonprofit association which was set up in 1997 and registered as an association in the Netherlands in 2000. EA is the European network of nationally recognized accreditation bodies located in the European geographical area and has 35 full members representing 33 European countries. Additionally, 18 non-European accreditation bodies have signed a contract of cooperation with EA. The EA missions consist of • Defining, harmonizing, and building consistency in accreditation as a service in Europe, by ensuring common interpretation of the standards used by its members • Ensuring transparency of the operations (including assessments) performed and results provided by its members • Maintaining a multilateral agreement on mutual recognition between accreditation schemes and reciprocal acceptance of accredited conformity assessment services and results • Managing a peer evaluation system consistent with international practices—EA as a region is a member of ILAC and IAF • Acting as a technical resource on matters related to the implementation and operation of the European policies on accreditation EA covers accreditation of laboratories (including testing and calibration), inspection bodies, and certification bodies. EA has seven committees: three technical committees (Certification Committee, Inspection Committee, © 2011 by Taylor and Francis Group, LLC

192

Quality Assurance in the Pathology Laboratory

and the Laboratory Committee), which discuss all technical issues related respectively to the accreditation of certification bodies, inspection bodies, and laboratories, with the view of establishing best practice and fostering harmonization. The standards for the work in EA are • • • • •

Laboratories: ISO/IEC 17025, ISO 15189 Inspection: ISO/IEC 17020 Product Certification: EN 45011 (ISO/IEC Guide 65) Personnel Certification: ISO/IEC 17024 Management Systems Certification: ISO/IEC 17021

To other committees belong Multilateral Agreement Council, Harmonization Horizontal Committee, Communication and Publications Committee, and the Financial Oversight Committee. Huisman et al. [61] have collated an inventory of the accreditation procedures for medical laboratories in the EU. The survey was done for the European Communities Confederation of Clinical Chemistry and Laboratory Medicine (EC4). It was found that accreditation of medical laboratories in the countries of the EU is mostly carried out in cooperation with national accreditation bodies. These national accreditation bodies work together in a regional cooperation, the EA. Professionals are trained to become assessors and play a prominent role in the accreditation process. The extent of the training is diverse. The frequency of assessments and surveillance visits differed from country to country and ranges from 1 to 4 years. More harmonization was postulated in this respect, based on a frequency that can be pragmatically handled by laboratory professionals. In the majority of EA bodies, accreditation is carried out on a test-by-test basis. Many professionals would prefer accreditation of the entire service provided within the actual field of testing (hematology, immunology, etc.), with accreditation granted if the majority of tests offered within a service field fulfill the requirements of the ISO 15189 standard. The scope of accreditation is a major point of discussions between the EC4 Working Group on Accreditation and representatives of accreditation bodies in the EA Medical Laboratory Committee. 7.3.4.2  European Standards Organization CEN CEN (= fr. Comité Europeen de Normalisation) [62] is formally appointed by the European Commission to elaborate and present European standards. CEN’s National Members are the National Standards Organizations of 30 European countries. There is only one member per country. They have voting rights in the General Assembly and Administrative Board of CEN and provide delegations to the Technical Board, which defines the work program. It is the responsibility of the CEN National Members to implement European © 2011 by Taylor and Francis Group, LLC

Role of Accreditation Procedures in Maintaining Quality

193

Standards as national standards, to distribute and sell them, and to withdraw any conflicting national standards. CEN is publishing the European Standards (EN), CEN Workshop Agreements, CEN Technical Specifications (CEN/TS), and CEN Technical Reports (CEN/TR). The standards are classified by industrial sector according to the system elaborated by the ISO in order to unify the classification of data about standards throughout the world. Following sectors are relevant to medical, pathological, or related laboratories: “Heath care technology” and “Environment–Health Protection–Safety.” Explosive growth of CEN and of its work program created the suspicion in some areas of the world that the single European market was intended to protect European industry from foreign incursions, what might be termed the “Fortress Europe syndrome.” It was very difficult for non-Europeans to obtain information about European standardization activities and, at the same time, there were obvious defections of western European national standards bodies from the international standardization arena, particularly in some specific areas. The response to this negative development was an agreement on the exchange of technical information between ISO and CEN (called the Lisbon Agreement, approved in 1989), which provided for full and mutual exchange of information between ISO and CEN on their respective activities. This step has been widened in the Vienna Agreement in 1991. The idea behind the agreement was to ensure that, to the largest possible extent, International Standards and European Standards are compatible or, even better, identical. Another major consideration was to make rational use of the resources available for standardization by avoiding duplication of work— this meaning that there had to be agreement on work allocation between ISO and CEN, as there were simply not sufficient expert resources available for ISO and CEN to conduct their standardization activities completely independently. The agreement on technical cooperation between ISO and CEN was approved by ISO Council resolution 18/1990 and CEN General Assembly resolution 3/1990. This agreement (called the Vienna Agreement) was published in June 1991. It is accompanied by common ISO/CEN “Guidelines for the TC/SC Chairmen and Secretariats for implementation,” approved in 1992 and revised in September 1998. The “codified” Vienna Agreement was approved by ISO Council and the CEN Administrative Board in 2001 [63]. Spitzenberger and Edelhauser [64] who reviewed the legal framework of medical laboratories in Europe indicated that although EN ISO/IEC 17025 and EN ISO 15189 provide useful requirements for laboratory testing, these standards are insufficient for giving full presumption of conformity in connection with requirements set by European directives. Additional regulatory documents and standards should be considered. Additionally, laboratory accreditation in usually performed on voluntary basis, whereas compliance with European criteria is mandatory. © 2011 by Taylor and Francis Group, LLC

194

Quality Assurance in the Pathology Laboratory

7.3.5╇Accreditation Organizations and Policies in Selected Countries 7.3.5.1  Canada Li and Adeli [65] reviewed the current status of laboratory quality regulations and accreditation standards in Canada. Laboratory regulations and accreditation standards in Canada are standardized on a provincial but not on national basis. Overseen by the provincial government, each province constructs or subcontracts its own accreditation body. While ISO 15189 has been accepted in all provinces as the standard for accreditation of medical laboratories in Canada, there are variations in extent and pace to implement these standards. Five provinces have their own accreditation bodies, while in the other five provinces medical laboratories are accredited by Canadian Counsel on Health Service Accreditation. Each of these accreditation bodies has developed their own standards, implementing the ISO documents to variable extent. The following ISO standards were incorporated in accreditation standards: ISO 15189 and ISO 17025 (for accreditation requirements), ISO/IEC 17025 (for general requirements for the competence of testing and calibrating laboratories), ISO 17011 (for accreditation processes), ISO 10011 or ISO 19011 (for assessor training), ISO 22870 (for point of care testing), and ISO 15190 (for safety). There is clearly a need for uniform implementation of the accreditation concept using the same standards including ISO standards, ILAC guidelines, and guidelines of professional societies. Collaboration among PT providers to share information technology, and academic and educational resources to manage their PT operations should also be strongly encouraged. 7.3.5.2  United Kingdom The UKAS [8] is the sole national accreditation body recognized by government to assess, against internationally agreed standards, organizations that provide certification, testing, inspection, and calibration services. Special UKAS Web site [66] provides search possibilities for all laboratories involved in testing and calibration and accredited to ISO 17025 standard. Accreditation by UKAS demonstrates the competence, impartiality, and performance capability of these evaluators. UKAS is a non-profit-distributing company, limited by guarantee, and operates under a Memorandum of Understanding with the Government through the Secretary of State for Innovation, Universities, and Skills. UKAS members are the Secretary of State for Innovation, Secretary of State for Environment, Food and Rural Affairs, the Association of British Certification Bodies, British Measurement and Testing Association, Confederation of British Industry, the Safety Assessment Federation, Food Standards Agency, and Health Protection Agency, among others. The UKAS © 2011 by Taylor and Francis Group, LLC

Role of Accreditation Procedures in Maintaining Quality

195

is a signatory to the EA, mutual recognition agreements and has signed a number of international agreements, which help to lower barriers to trade by ensuring international acceptance of certificates issued under the umbrella of UKAS accreditation. As regards medical laboratories, there are two laboratory accreditation bodies within the United Kingdom: UKAS and Clinical Pathology Accreditation (UK) Ltd (CPA) [67]. UKAS and CPA have formed a partnership. The partnership enables the two organizations to cooperate on the development of accreditation policy and facilitates the exchange of best practice. The partnership is aimed at strengthening the authority and reputation of accreditation both in the United Kingdom and internationally by bringing together two organizations with established reputations in their respective fields. It is also a means of reducing the risk of fragmenting accreditation and avoiding proliferation of accreditation standards for laboratories. UKAS and CPA are working together to maximize the international recognition of accreditation. UKAS is recognized by Government as the national accreditation body and is the signatory of international mutual recognition agreements on behalf of the United Kingdom. It is intended that the partnership will in due course be incorporated into these agreements. The partnership introduced international standards for laboratory accreditation (ISO 17025 and ISO 15189) that enables UKAS and CPA to work on common criteria and thereby making a partnership possible. Both partners maintain respective control over professional (technical) decisions and standards. However, UKAS shall retain the Government’s sole recognition status as the National Accreditation Body. CPA is providing External Quality Assurance Schemes for clinical biochemistry, genetics, microbiology, hematology and blood transfusion, histopathology, and immunology. The search engine on the CPA Web site provides detailed information concerning particular medical laboratories, accredited under CPA. 7.3.5.3  Germany German Accreditation Council (DAR) [68] is coordinating all laboratory accreditation services in Germany. The council encompasses several accreditation bodies, like German Accreditation Body Chemistry (DACH) [69], German Accreditation System for Testing (DAP) [70], German Calibration Service (DKD), Association for Accreditation and Certification (GAZ), as well as Federal Ministry of Economics and Technology and German Institute for Standardisation (DIN). Medical laboratories (clinical chemistry, immunology, microbiology, virology, transfusion medicine, human genetics, and pathology) are accredited through DACH and DAP on the base of ISO 15189 standard. For other related laboratories (like forensic testing units, performing forensic autopsies, forensic DNA investigations, blood alcohol determination for forensic purposes, and forensic toxicology analyses), ISO 17025 © 2011 by Taylor and Francis Group, LLC

196

Quality Assurance in the Pathology Laboratory

standard is used. Accreditation and supervision of inspection bodies is done according to ISO/IEC 17020 standard. Two hundred and fifty-eight medical laboratories and 52 forensic laboratories and institutes are currently accredited by DACH and DAP on various methods to ISO 15189, ISO 17025, and ISO 17020 standards (status April 2009). 7.3.5.4  Finland Accreditation is voluntary in Finland, but it has become a part of normal daily routines in main laboratories. Accreditation body in Finland is the Finnish Accreditation Service, FINAS, which is within the parent organization, the Centre for Metrology and Accreditation, and under the Ministry of Employment and the Economy. FINAS uses technical auditors who are clinical biochemists, clinical microbiologists, and specialist physicians. These technical auditors come from the university and central hospital laboratories as well as from big private laboratories. Clinical laboratories have been mainly accredited against ISO/IEC 17025, but ISO 15189 is also used. Five laboratories have been accredited against ISO 15189. All 5 university hospital laboratories are accredited and they have 12 accredited laboratories. Three out of 20 central hospital laboratories have accreditation, as well as 6 private laboratories. Laboratories are accredited against ISO/CEN 17025 or ISO 15189, but both standards are used at the same time in some cases. Accredited laboratories are mainly clinical chemistry/biochemistry and hematology laboratories (16 laboratories), but 11 microbiology, 5 pathology, 5 genetic testing, and 5 clinical physiology laboratories are also accredited [71]. 7.3.5.5  Italy From the recent presentation of Ceriotti [72], it is obvious that in Italy so far there does not exist any nationwide, uniform requirement for quality standards in laboratory medicine. Italy is divided into 20 regions, and each of them has a different organization and different minimal quality requirements for National Health Service. Around 300 out of around 4200 clinical laboratories volunteered to proceed with ISO 9001 certification. Six laboratories are accredited in the United Kingdom by CPA. The ISO 15189 standard is considered to be a reference standard for the accreditation, but up to now, an official accreditation body dedicated to clinical laboratories does not exist. 7.3.5.6  France Gouget [73] reviewed the situation in French medical laboratories. The development of quality assurance started during the 1990s with the publication of guidelines for good practice (GBEA). Accreditation of the hospitals by French National Authority for Health was set up by the French government in order to bring together a number of activities designed to improve the quality of patient care and to guarantee equity within the healthcare system. © 2011 by Taylor and Francis Group, LLC

Role of Accreditation Procedures in Maintaining Quality

197

Recently, the Ministry of Health (MOH) launched a mission, with the aim of initiating a new reform of the French medical biology sector, and of reorganizing laboratory medicine in the public and private sector. One of the common approaches is quality. It requires, as elsewhere in health sector, through the adoption of professional reference and due process, as well as controls by both peers and national authorities. The scope of accreditation is a major point of discussion between the accreditation bodies, the MOH and Professionals. One objective is to implement the standard ISO 15189 today for the accreditation of medical laboratories at the international level with particular requirements for quality and competence specifically designed for medical laboratories, which contains requirements for both quality systems and competence. ISO 15189 should promote harmonization of accreditation programs at an international level. 7.3.5.7  China In 1982, the Chinese MOH set up the National Center for Clinical Laboratory (NCCL), responsible for the quality of clinical laboratories. With the help of WHO and U.K. scholars, NCCL organized training courses on Quality Assurance and began to run the External Quality Assurance Programmes for big hospitals all over China in the 1980s. Then, every province sets up their local Center for Clinical Laboratories and also runs the EQA for local big hospitals. NCCL has been encouraging the clinical laboratories to work on accreditation since the middle of 1990s. So far, there are 5 clinical laboratories which have received CAP accreditation and more than 30 laboratories which have received ISO 15189 accreditation. Since the majority of Chinese clinical laboratories have had difficulty in receiving accreditation of ISO 15189, NCCL began to prepare a regulation for management of clinical laboratories, which was approved by MOH in 2006. The requirements of this regulation are less strict than those in ISO 15189, but it also consists of 56 articles, which are integrated into six sections titled general provision, administration, QM, safety management, supervision, and complementary. Quality and Safety management are the main sections in this regulation. MOH emphasized the investigation and monitoring of the medical service in 2005 and the regulation of management of clinical laboratories became the basic requirements for every clinical laboratory nationwide [74]. 7.3.5.8  Developing Countries Difficult situation of developing countries on the area of accreditation and QM of laboratories in developing countries was depicted in the excellent paper of Ahmad et al. [75] on the example of Pakistan. Qualified pathologists in developing countries are very well aware that a total QMS with mechanism to be part of an internationally recognized accreditation process is the only guarantee of a reasonable and reliable pathology service. However, the © 2011 by Taylor and Francis Group, LLC

198

Quality Assurance in the Pathology Laboratory

ground realities make it virtually impossible to implement such a system. Pathologists in Pakistan, like in other developing countries, suffer from numerous handicaps, like limited number of qualified specialists, and instrumentation. According to an estimate based on membership of Pathology Societies, there were 109 pathologists per million populations in England while in Pakistan there were only 2.6. As a consequence, in Islamabad area, 57% of labs were supervised by non-pathologists, mostly technicians. The situation is similar in neighboring countries. There is no National Lab policy for reagents or regulatory authority in eight out of nine countries in WHO SEAR region. Poor maintenance facilities and frequent power outages make the situation worse. Accreditation under the internationally recognized programs like ISO 15189 is too expensive for most laboratories. In India, only 0.17% of laboratories have achieved accreditation [76]. The situation in Pakistan is similar. It is only recently that an effort has been initiated to start accreditation process under ISO 15189. Some large labs do have accreditation under ISO 9000/17025. According to the current situation, only a few laboratories are likely to meet ISO 15189 standards. Two-tier system has been proposed to improve this situation; it was recommended that accreditation based on ISO 15189 be introduced on a voluntary basis, for large laboratories. An accrediting body like Pakistan National Accreditation Council (PNAC) can be entrusted with the task of inspections and certification of laboratories which fulfill the criteria laid down. The candidate labs should be prepared for accreditation by providing educational material, courses, and workshops. Government should assist this process by providing subsidy to PNAC for carrying out these activities in collaboration with professional bodies like College of Pathologists Pakistan. On the other hand, for the vast majority of laboratories in the country, which are not able to qualify for the ISO standards in their present condition, another option was proposed. The College of Pathologists Pakistan will register laboratories, which meet minimum criteria of requirements. These laboratories will be required to introduce and adhere to internal quality standards. The most important requirement will be to participate in PT program. They will be assessed at periodic intervals to ensure, that they follow the recommended QMS. They will be issued a distinctive College emblem so that they can be distinguished from unregistered quack-run laboratories. This system may be helpful in providing a workable and comprehensive system through which pathology laboratories in the country will be able to offer a reliable service. According to Ahmad et al., this system can be adopted for use in other developing countries. Specific situation in Jordan medical laboratory service was presented by Qutishat [77]. Seventy percent of Jordan’s area is desert, and 45% of a population of approximately 5.6 million is under 15 years of age, and only 2.5% of the total population is above 65 years of age. Health services in © 2011 by Taylor and Francis Group, LLC

Role of Accreditation Procedures in Maintaining Quality

199

Jordan are provided by different sectors: private sector with majority of laboratories, followed by MOH, UNRWA services to Palestinian refugees, Charity Societies, Royal Medical Services, and University Hospitals. All private labs must receive the license by the licensing committee, which is formed by the representatives of the main medical sectors (MOH, military, universities, and private). All laboratories must implement internal quality and participate in a national or international EQAS. There is no regulation in Jordan that obliges laboratories or hospitals to be accredited and only few laboratories have been accredited by international organizations like CAP or JC. Recently, Jordanian Institute of Standards and Metrology (JISM) formed specialized unit on accreditation, mainly involved with nonmedical laboratories. In 2008, JISM started pilot project on accreditation of the medical labs, based on the ISO 15189.

7.4╇ Publications and Journals on Accreditation The journal Accreditation and Quality Assurance, published by Springer Verlag, has been established in 1996 as the information and discussion forum for all aspects relevant to quality, transparency, and reliability of measurement results in chemical and biological sciences. The journal serves the information needs of researchers, practitioners, and decision makers dealing with quality assurance and QM, including the development and application of metrological principles and concepts such as traceability or measurement uncertainty in the following fields: environment, nutrition, consumer protection, geology, metallurgy, pharmacy, forensics, clinical and laboratory medicine, and microbiology. The journal publishes general papers, practitioner’s reports, and reviews and provides a discussion forum for unorthodox ideas, remarkable observations, diverging views, and stimulating questions. In addition, recent developments of legislation and standardization, as well as reports from international bodies or meetings are given. The journal is publishing application papers regarding measurements in such disciplines as environment, nutrition, consumer protection, geology, metallurgy, pharmacy, forensics, clinical and laboratory medicine, microbiology and in all other fields of chemical and biological sciences. The journal is focusing on the following topics: accreditation and certification; quality assurance; tools for quality control; QM; metrology in chemistry, including traceability of measurement results, measurement uncertainty, comparability and equivalence of measurement results; verification and validation, calibration, and statistical simulations; purity assessment and sampling; interlaboratory comparison (PT, EQA), reference materials, reference measurements, dissemination and propagation of reference values; applied statistics for metrology; concepts and terminology; quantities and units. © 2011 by Taylor and Francis Group, LLC

200

Quality Assurance in the Pathology Laboratory

Apart from Accreditation and Quality Assurance, several journals devoted to clinical chemistry are publishing special issues on laboratory accreditation. Clinical Biochemistry, an official organ of the Canadian Society of Clinical Chemists, recently published special issue, presenting the lectures held on the First International Symposium on Quality and Accreditation in Laboratory Medicine in Istanbul, Turkey in 2008. [78]. Clinica Chimica Acta, published in 2001 special issue devoted to European view on accreditation and related areas, like harmonization, EQA, and laboratory inspection [79]. Several books on accreditation and related topics appeared in last years. Springer Verlag published two books, which contain selected articles from the Accreditation and Quality Assurance. The book “Traceability in Chemical Measurement” [80] collects 20 outstanding papers on the topic, mostly published from 1999–2002 in the journal Accreditation and Quality Assurance. They provide the rationale for why it is important to integrate the concepts of validation and traceability and especially to include suitable reference materials into the standard procedures of every analytical laboratory. In addition, this anthology considers the benefits to both the analytical laboratory and the user of the results. The second book “Validation in Chemical Measurement” [81] presents 31 outstanding selected papers on the validation, published in the period 2000–2003 in the journal. David Burnett, a recognized expert on the field on laboratory accreditation, published two books on this topic, dealing mainly with the implementation of the ISO 15189 standard: “Understanding Accreditation in Laboratory Medicine (Management and Technology in Laboratory Medicine)” [82] and “A Practical Guide to Accreditation in Laboratory Medicine” [83]. The author outlined the structure of an “Ideal Standard” for medical laboratories, with an appendix providing cross references to the relevant international standards. The fictional “Pathology Laboratory of St Elsewhere’s Hospital Trust” serves as an example of how to use and implement quality manual, procedures, and forms. A more recent book on the implementation of the ISO 15189 standard was authored by Cooper and Gillions in 2007 [84]. The authors provided the practical details that are needed to implement the ISO 15189 guidelines for medical laboratories, particularly the proper use and application of statistical quality control for assuring quality and competence in a laboratory (Section 5.6 of the requirement: “Assuring the quality of examination procedures”). Practical examples of policies and procedures are provided in the book along with summary checklists that offer constructive advice on meeting the basic needed requirements. JC published in 2009 an “Accreditation Process Guide for Laboratories” [85]. Wenclawiak et al. [86] published a book on quality assurance in analytical chemistry. The book was addressed to laboratory analysts and their © 2011 by Taylor and Francis Group, LLC

Role of Accreditation Procedures in Maintaining Quality

201

trainers or teachers. Topics covered in this book include accreditation—ISO 17025, Â�certification—ISO 9000, PT, basic statistics, measurement uncertainty, Â�glossary/institutions, fit for the purpose (philosophy), quality manual, validation of methods, accreditation vs. certification, good laboratory practice (GLP), calibration—detection limit, reference materials, control charts, metrology/ traceability, TQM, and cost of quality. The accompanying CD contains more than 700 Power Point slides, ready for use as training material. Another book dealing with the accreditation on the base of ISO 17025 standard was written by Wilson and Weir and was dedicated for food and drink laboratories [87].

References 1. http://www.thefreedictionary.com/accreditation (accessed March 12, 2009) 2. http://www.wordreference.com/definition/accreditation (accessed March 12, 2009) 3. http://www.businessdictionary.com/definition/accreditation.html (accessed March 12, 2009) 4. http://www.merriam-webster.com/dictionary/accreditation (accessed March 12, 2009) 5. EN ISO/EC 17011:2004: Conformity assessment—Vocabulary and general principles. 6. http://www.ilac.org/home.html (accessed March 12, 2009) 7. http://www.iaf.nu/ (accessed March 12, 2009) 8. http://www.ukas.com/about-accreditation/What_is_Accreditation/What_is_ Accreditation.asp (accessed March 12, 2009) 9. Thomas A. 2009. External quality assessment in laboratory medicine: Is there a rationale to determine frequency of surveys? Accred. Qual. Assur. 14: 439–444. 10. Miller W.G. 2009. The role of proficiency testing in achieving standardization and harmonization between laboratories. Clin. Biochem. 42: 232–235. 11. Panteghini M. 2009. Traceability as a unique tool to improve standardization in laboratory medicine. Clin. Biochem. 42: 236–240. 12. Thompson M., Mathieson K., Owen L., Damant A.P., and Wood R. 2009. The relationship between accreditation status and performance in a proficiency test. Accred. Qual. Assur. 14: 73–78. 13. Wilson J.F. 2002. External quality assessment schemes for toxicology. Forensic Sci. Int. 128: 98–103. 14. Ferrara D.S., Tedeschi L., Frison G., and Brusini G. 1998. Quality control in toxicological analysis. J. Chromatogr. B 713: 227–243. 15. Travers H. 2002. Quality Assurance programs for countries in need: A global view from the College of American Pathologists. Accred. Qual. Assur. 7: 364–366. 16. http://www.eptis.bam.de/en/index.htm (accessed March 20, 2009) 17. http://www.eqalm.org/ (accessed March 20, 2009) 18. IFCC, C-AQ Guidelines for the Requirements for the Competence of EQAP organizers in medical laboratories, version 3/2002. Available at: http://www. eqalm.org/. (accessed March 12, 2009). 19. http://www.cms.hhs.gov/CLIA/downloads/ptlist.pdf (accessed March 20, 2009) © 2011 by Taylor and Francis Group, LLC

202

Quality Assurance in the Pathology Laboratory

20. http://www.clsi.org/ (accessed March 25, 2009) 21. Clinical and Laboratory Standards Institute (CLSI). 2007. Using Proficiency Testing to Improve the Clinical Laboratory; Approved Guideline, 2nd edn. CLSI document GP27-A2 (ISBN 1-56238-632-8). Clinical and Laboratory Standards Institute, Wayne, PA. 22. http://www.compad.com.au/cms/iaf/workstation/upFiles/600630.IAFILAC-A4_2004_guidance_on_the_application_of_ISO-IEC_17020_2007-04. pdf (accessed April 3, 2009) 23. http://www.iso-17020.com/index.html (accessed April 3, 2009) 24. Ehrmeyer S.S. and Laessig R.H. 2008. Can auditing save us from a quality disaster? Accred. Qual. Assur. 13: 139–144. 25. Bachner, P. College of American Pathologist (CAP). 2009. How to prepare and comply with your quality management plan. 2009 LAP Audioconference Series, February 18, 2009. Department of Pathology and Laboratory Medicine, University of Kentucky College of Medicine, Slides 1–43. 26. Malone B. 2009. AACC—January Clinical Laboratory News: ISO accreditation comes to America—Are labs ready to embrace an international quality management system? Clin. Lab. News 35(1): 1–5. 27. Bak P., Bocker B., Müller W.D., Lohsträter A., and Smolenski U.C. 2004. Certification and accreditation systems as an instrument of quality management in the rehabilitation (Part 2)—Characteristics of most widely used systems. Physikalische Medizin Rehabilitationsmedizin Kurortmedizin 14: 243–248. 28. Lehmann H.P. 1998. Certification standards transfer: From committee to laboratory. Clin. Chim. Acta 278: 121–144. 29. Grunnet N. 2006. The Different Tools in Quality Management. ISBT Science Series, vol. 2, 2007, pp. 150–158. 30. Burnett D. 2006. ISO 15189: 2003—Quality management, evaluation and continual improvement. Clin. Chem. Lab. Med. 44: 733–739. 31. Salas Garcıa A., Vilaplana Perez C., Calderon Ruiz A., Gimeno Bosch C., Perez Jove J., Sevillano Herrada C., Bosch Llobet M.A., and Boquet Miquel X. 2008. Benchmarking and quality management indicators in three medical laboratories. Accred. Qual. Assur. 13: 123–132. 32. Kailner A. 1998. Quality management in the medical laboratory: A comparison of draft standards. Clin. Chim. Acta 278: 111–119. 33. Theodorou D.G. and Anastasakis P.C. 2009. Management review checklist for ISO/IEC 17025 and ISO 15189 quality-management systems. Accred. Qual. Assur. 14: 107–110. 34. Plebani M. 2004. Accreditation of the Medical Laboratory—ISO 15189/ISO 17025. Encyclopedia of Medical Genomics and Proteomics. Editors: Jürgen F., Maurizio P., Informa Healthcare. Available at: http://www.informaworld.com/ smpp/content∼db=all∼content=a713544798 35. DAP-Checklist for the Assessment of Testing Laboratories against DIN EN ISO/IEC 17025:2005 http://www.dap.de/doce.html. CH-PL-17025-e, August 10, 2006, Revision 2.0, pp. 1–19. 36. Burnett D.A. 2002. Companion to ‘A practical Guide to Accreditation in Laboratory Medicine’ for use with ISO 15189:2003 Medical Laboratories— Particular requirements for quality and competence. ISBN 0902429396 (www.acb.org.uk). ACB Venture Publications. © 2011 by Taylor and Francis Group, LLC

Role of Accreditation Procedures in Maintaining Quality

203

37. Burnett D. 2007. ISO 15189:2007—A Practical Tool for the Management of Quality in the Medical Laboratory, Lisbon, Portugal, November 8, 2007. Slides 1–40. 38. DAP I. DAP Checklist for medical laboratories according to DIN EN ISO 15189:2007*—Form CH-ML-15189_e/Rev. 2.1/29.04.08. 39. DAP Rules Accreditation of Testing Laboratories and Medical Laboratories, http://www.dap.de/doce.html. RW II.1_e. Release date September 2006, Revision 6.0, pp. 1–10. 40. 42 CFR Part 493—Laboratory Requirements. 10-1-04 Edition, pp. 967–1087. http://wwwn.cdc.gov/clia/regs/toc.aspx, http://www.access.gpo.gov/nara/cfr/ waisidx_04/42cfr493_04.html 41. http://www.cms.hhs.gov/CLIA (accessed April 15, 2009) 42. Rauch C.A. and Nichols J.H. 2007. Laboratory accreditation and inspection. Clin. Lab. Med. 27: 845–858. 43. www.cola.org (accessed April 17, 2009) 44. http://www.cap.org/apps/cap.portal?_nfpb=true&_pageLabel=accreditation (accessed April 18, 2009) 45. Sharkey E. ed. 2009. Laboratory Accreditation Manual. College of American Pathologists. Available at: http://www.cap.org/apps/docs/laboratory_accreditation/2009_lapmanual.pdf 46. http://www.jointcommissioninternational.org/ (accessed April 22, 2009) 47. Dhatt G.S. and Al Sheiban A. 2008. Joint commission international accreditation: A laboratory perspective. Accred. Qual. Assur. 13: 161–164. 48. JCI Accreditation and Certification. Available at: http://www.jointcommission╉ international.org/common/pdfs/jcia/JCIA_Brochure-new_branding.pdf 49. Catalano E.W., Ruby S.G., Talbert M.L., and Knapman D.G. 2009. College of American Pathologists considerations for the delineation of pathology clinical privileges. Arch. Path. Lab. Med. 133: 613–618. 50. http://www.jointcommissioninternational.org/common/pdfs/jcia/Standards_ Only-Clinical_Lab-1st_edition.pdf (accessed April 22, 2009) 51. Laboratory Accreditation Manual—lnspector Information and Laboratory Information July 2007 Edition, College of American Pathologists, Laboratory Accreditation Manual. 52. http://www.a2la.org/ (accessed May 3, 2009) 53. http://www.iasonline.org/ (accessed May 3, 2009) 54. http://ts.nist.gov/standards/accreditation/index.cfm (accessed May 3, 2009) 55. http://www.l-a-b.com/ (accessed May 3, 2009) 56. http://www.pjlabs.com/default.htm (accessed May 3, 2009) 57. http://www.ascld-lab.org/international/indexinternational.html (accessed May 3, 2009) 58. http://www.aclasscorp.com (accessed May 3, 2009) 59. http://www.anab.org/ (accessed May 3, 2009) (accessed 60. http://www.european-accreditation.org/content/home/home.htm May 10, 2009) 61. Huisman W., Horvath A.R., Burnett D., Blaton V. et al. 2007. Accreditation of medical laboratories in the European Union. Clin. Chem. Lab. Med. 45: 268–275. 62. http://www.cen.eu/cenorm/homepage.htm (accessed May 10, 2009) 63. http://www.iso.org/iso/about/the_iso_story/iso_story_vienna_agreement.htm (accessed May 11, 2009) © 2011 by Taylor and Francis Group, LLC

204

Quality Assurance in the Pathology Laboratory

64. Spitzenberger F. and Edelhauser E. 2006. Accreditation of medical laboratories in Europe: Statutory framework, current situation and perspectives. Transfus. Med. Hemother. 33: 384–392. 65. Li H. and Adeli H. 2009. Laboratory quality regulations and accreditation standards in Canada. Clin. Biochem. 42: 249–255. 66. http://www.ukas.org/ (accessed May 20, 2009) 67. http://www.cpa-uk.co.uk/ (accessed May 20, 2009) 68. http://www.dar.bam.de/index.html (accessed May 20, 2009) 69. http://www.dach-gmbh.de/ (accessed May 20, 2009) 70. http://www.dap.de/ (accessed May 20, 2009) 71. Laitinen P. 2009. Laboratory and quality regulations and accreditation standards in Finland. Clin. Biochem. 42: 312–313. 72. Ferruccio Ceriotti F. 2009. Laboratory quality regulations and accreditation standards in Italy. Clin. Biochem. 42: 317. 73. Gouget B. 2009. Organization and evolution of the regulation and standards in France for the clinical laboratories. Clin. Biochem. 42: 314. 74. Yang Z. 2009. The laboratory accreditation and regulations of clinical laboratory in China. Clin. Biochem. 42: 310. 75. Ahmad M., Khan F.A., and Ahmad S.A. 2009. Standardization of pathology laboratories in Pakistan: Problems and prospects. Clin. Biochem. 42: 259–262. 76. Chakraborty S. 2003. Are Indian clinical laboratories prepared to accept the present accreditation system? Express Healthc Manage News 16–30. 77. Qutishat A.S. 2009. Medical laboratory quality and accreditation in Jordan. Clin. Biochem. 42: 256–258. 78. Uras F. ed. 2009. Highlight section: Quality & accreditation in laboratory medicine. Clin. Biochem. 42: 229–434. 79. Proceedings of the 7th International Conference on Laboratory Medicine “Quality and accreditation of medical laboratories: State-of-the-art, harmonization and projects in the European Union”. Clin. Chim. Acta 2001. 309: 109–215. 80. Paul De Bièvre P. and Günzler H. 2005. Traceability in Chemical Measurement, 1st edn. Springer, Berlin, Germany, pp. 1–281. 81. Paul De Bièvre P. and Günzler H. 2005. Validation in Chemical Measurement, 1st edn. Springer, Berlin, Germany, pp. 1–186. 82. Burnett D. 1997. Understanding Accreditation in Laboratory Medicine (Management & Technology in Laboratory Medicine). American Association for Clinical Chemistry, Washington, DC, pp. 1–310. 83. Burnett D., Poyser K.H., and Sherwood R.A. 2002. A Practical Guide to Accreditation in Laboratory Medicine. ACB Venture Publications, London, U.K., pp. 1–307. 84. Cooper G. and Gillions T. 2007. Producing Reliable Test Results in the Medical Laboratory. Bio-Rad Laboratories, ISBN-10: 0979285704, pp. 1–80. 85. Joint Commission Accreditation Healthcare Organizations. 2009. 2009 Accreditation Process Guide for Laboratories. Joint Commission Resources; Spi edition. ISBN-10: 1599402645. 86. Wenclawiak B.W., Koch M., and Hadjicostas E. 2004. Quality Assurance in Analytical Chemistry: Training and Teaching. Springer Verlag, Heidelberg, Germany, ISBN-10: 354040578X, pp. 1–280. 87. Wilson S. and Weir G. 1995. Food and Drink Laboratory Accreditation: A Practical Approach. Springer Verlag, Heidelberg, Germany, ISBN-10: 0412599201, pp. 1–262. © 2011 by Taylor and Francis Group, LLC

Role of Governmental and Professional Organizations in Setting Quality Standards in Pathology and Laboratory Medicine and Related Areas

8

Maciej J. Bogusz

Contents Abbreviations 8.1 Introduction 8.2 U.S. Government Regulations and Recommendations 8.2.1 Clinical Laboratory Improvement Amendments Issued by U.S. Department of Health and Human Services 8.2.2 Regulations Issued by FDA 8.2.2.1 Identification Issues 8.2.2.2 Quantitation and Method Validation Issues 8.2.2.3 Validation of Electronic Records and Signatures 8.2.2.4 Quality Assurance of Waived Tests and Diagnostic Devices 8.2.3 Regulation Issued by Substance Abuse and Mental Health Administration 8.2.3.1 Specimen Kind and Collection 8.2.3.2 Analytical Aspects of WDT 8.2.3.3 Quality Assurance Aspects of WDT 8.2.4 Guidelines on Good Clinical Laboratory Practice Issued by National Institutes of Health 8.2.4.1 Standards for Organization and Personnel 8.2.4.2 Standards for Laboratory Equipment 8.2.4.3 Standards for Test Facility Operation 8.2.4.4 Quality Control Program 8.2.4.5 Standards for Verification of Performance Specification © 2011 by Taylor and Francis Group, LLC

205

207 208 208 208 216 217 217 227 235 238 239 240 241 243 244 245 245 246 246

206

Quality Assurance in the Pathology Laboratory

8.2.4.6 Standards for Records and Reports 8.2.4.7 Standards for Physical Facilities 8.2.4.8 Standards for Specimen Transport and Management 8.2.4.9 Standards for Personnel Safety 8.2.4.10 Standards for Laboratory Information System 8.2.4.11 Standards for Quality Management 8.2.5 Recommendations of the National Research Council Concerning U.S. Forensic Sciences Community: Creation of the National Institute of Forensic Science 8.3 European Union Regulations and Recommendations 8.3.1 Quality Assurance of Human Resources Coordinated on European Level: The Activity of the European Communities Confederation of Clinical Chemistry and Laboratory Medicine 8.3.1.1 Professional Competence Issues 8.3.1.2 Ethical Issues 8.3.1.3 European Coordination Issues 8.3.2 European Community Activity Concerning Performance of Analytical Methods and Interpretation of Results 8.3.3 European Committee for External Quality Assurance Programmes in Laboratory Medicine 8.4 Professional International and National Organizations 8.4.1 International Conference on Harmonisation 8.4.2 Joint Committee on Traceability in Laboratory Medicine 8.4.3 International Federation of Societies of Toxicologist Pathologists 8.4.4 Recommendations of Organizations of Forensic Toxicologists 8.4.4.1 Forensic Toxicology Laboratory Guidelines Issued by SOFT/AAFS 8.4.4.2 Activity of the College of American Pathologists for Forensic Sciences 8.4.4.3 The International Association of Forensic Toxicologists Guidelines 8.4.4.4 Guidelines of the Society of Hair Testing 8.4.4.5 Guidelines of the German Society of Toxicological and Forensic Chemistry References

© 2011 by Taylor and Francis Group, LLC

247 249 249 250 250 251 252 257

257 258 260 261 262 263 264 264 266 267 269 269 276 276 278 281 284

Role of Governmental and Professional Organizations

207

Abbreviations AAFS American Academy of Forensic Sciences British Association of Research Quality Assurance BARQA Bureau Internationale des Poids et Mesures BIPM College of American Pathologists CAP Clinical Laboratory Improvement Amendments CLIA Clinical and Laboratory Standard Institute CLSI Centers for Medicare and Medical Services CMS Diode Array Detector DAD EC4 The European Communities Confederation of Clinical Chemistry and Laboratory Medicine EFCC European Federation of Clinical Chemistry and Laboratory Medicine External quality assurance EQA EQALM European Committee for External Quality Assurance Programmes in Laboratory Medicine Food and Drug Administration FDA Good Clinical Laboratory Practice GCLP Gas chromatography-mass spectrometry GC-MS GCP Good Clinical Practice Good Laboratory Practice GLP German Society of Toxicological and Forensic Chemistry GTFCh U.S. Department of Health and Human Services HHS ICH International Conference on Harmonisation IFCC International Federation of Clinical Chemistry and Laboratory Medicine IFSTP International Federation of Societies of Toxicologist Pathologists ILAC International Laboratory Accreditation Cooperation ISO International Organization for Standardization Joint Committee on Traceability in Laboratory Medicine JCTLM LC-MS Liquid chromatography-mass spectrometry LIS Laboratory Information System LLOQ Lower limit of quantification LOD Limit of detection Medical review officer MRO NIFS National Institute of Forensic Science NIH National Institutes of Health NIST National Institute of Standards and Technology PT Proficiency testing Quality management QM

© 2011 by Taylor and Francis Group, LLC

208

SAMHSA SOFT SoHT SOP TIAFT TLC ULOQ WDT

Quality Assurance in the Pathology Laboratory

Substance Abuse and Mental Health Administration Society of Forensic Toxicologists Society of Hair Testing Standard operation procedure The International Association of Forensic Toxicologists Thin layer chromatography Upper limit of quantification Workplace drug testing

8.1╇Introduction Examinations, performed in hospital, pathological, or forensic laboratories, are applied in very sensitive areas, like, e.g., preventive cancer screening, workplace drug testing, or in emergency situations. The results of such examinations may have direct impact on the health and well-being of the society, or on the individual fate or professional career of an individual person. Therefore, the government agencies and ministries in many countries, as well as professional organizations, undertook efforts to assure and control the quality of work in the areas in question. Various legal acts, recommendations, or guidelines were directed into improvement of the technical, logistical, and administrative aspects of laboratory activities. Special attention was given to the assurance of appropriate competence level of human resources. It was not possible to review in this chapter the whole multitude of legal acts and recommendations issued in every country in the world. The intention was to present most relevant and most representative regulations.

8.2╇U.S. Government Regulations and Recommendations 8.2.1╇Clinical Laboratory Improvement Amendments Issued by U.S. Department of Health and Human Services The Clinical Laboratory Improvement Amendments, known commonly as CLIA 88 law, was passed in response to press articles, revealing poor laboratory practices, particularly in the field of cancer diagnosis and prevention. CLIA 88 was issued by U.S. Department of Health and Human Services (HHS) [1] and became a general quality assurance standard for all laboratories, testing human specimens for medical purposes. CLIA 88 is divided into several subparts, like General Provisions, Certificate of Waiver, Registration Certificate, Certificate of Accreditation issued by HHS, Accreditation issued by a Private, Nonprofit Organization, General Administration, Participation in Proficiency Testing, Proficiency Testing Programs for Nonwaived Testing, © 2011 by Taylor and Francis Group, LLC

Role of Governmental and Professional Organizations

209

Facility Administration, Quality System for Nonwaived Testing, Personnel for Nonwaived Testing, Inspection, Enforcement Procedures, and Consultations. According to CLIA definitions, laboratory means a facility for the biological, microbiological, serological, chemical, immunohematological, hematological, biophysical, cytological, pathological, or other examination of materials derived from the human body for the purpose of providing information for the diagnosis, prevention, or treatment of any disease or impairment of, or the assessment of the health of human beings. These examinations also include procedures to determine, measure, or otherwise describe the presence or absence of various substances or organisms in the body. Facilities only collecting or preparing specimens (or both) or only serving as a mailing service and not performing testing are not considered laboratories. All laboratories must be certified to perform testing on human specimens under the CLIA rules. There are some exceptions of this condition. The laboratories, performing only simple, waived tests as certified by Food and Drug Administration (FDA) do not need to register, to be accredited, and to participate in proficiency testing programs according to CLIA rules. Additionally, the laboratory is CLIA-exempt if • It only performs testing for forensic purposes. • It is a research laboratory testing human specimens but do not report patient-specific results for the diagnosis, prevention, or treatment of any disease or impairment of, or the assessment of the health of individual patients. • It is a laboratory certified by the Substance Abuse and Mental Health Services Administration (SAMHSA), in which drug testing is performed, which meets SAMHSA guidelines and regulations. However, all other testing conducted by a SAMHSA-certified laboratory is subject to CLIA rules. Laboratory tests are categorized as one of the following: • Waived tests, which are simple laboratory examinations and procedures cleared and approved by FDA for home use, employ methodologies that are so simple and accurate as to render the likelihood of erroneous results negligible, or pose no reasonable risk of harm to the patient if the test is performed incorrectly. • Tests of moderate complexity, including the provider-performed microscopy (PPM) procedures. • Tests of high complexity. The categorization is based on following criteria: required knowledge, training and experience of the analyst, complexity of reagents and material © 2011 by Taylor and Francis Group, LLC

210

Quality Assurance in the Pathology Laboratory

preparation, characteristics of operational steps (pipetting, timing etc.), calibration, stability, complexity, and availability of materials, test system troubleshooting and equipment maintenance, interpretation, and judgment. Each of these criteria is scored in two or three categories, depending on the difficulty and complexity of the test. FDA is the institution responsible for the categorization of each test. A laboratory may perform only waived tests, only tests of moderate complexity, only PPM procedures, only tests of high complexity, or any combination of these tests. The whole system of quality assurance, as formulated by CLIA rules, is divided into the following steps: 1. Certified registration procedure (or certification of waiver for simple laboratories). 2. Certificate of accreditation under CLIA. Most important requirements for a certificate of accreditation, as formulated by CLIA, are summarized as follows: Laboratories issued a certificate of accreditation must (1) treat proficiency testing samples in the same manner as patient samples; (2) notify the approved accreditation program no later than 6 months after any deletions or changes in test methodologies; (3) comply with the requirements of the approved accreditation program; (4) permit random sample validation and complaint inspections; (5) permit HHS to monitor the correction of any deficiencies found through the inspections; (6) authorize the accreditation program to release to HHS the laboratory’s inspection findings whenever HHS conducts random sample or complaint inspections; and (7) authorize its accreditation program to submit to HHS the results of the laboratory’s proficiency testing. A certificate of accreditation is valid for no more than 2 years. 3. Alternative accreditation. Alternatively to CLIA accreditation, accreditation may be done by a private, nonprofit accreditation organization (e.g., CAP—College of American Pathologists), or exemption can be made under an approved state laboratory program. Alternative accreditation or exemption is accepted on equivalency basis, i.e., that an accreditation organization or a state laboratory program are equal to or more stringent than the CLIA requirements taken as a whole. 4. Successful participation in proficiency testing for laboratories performing nonwaived testing. Each laboratory performing nonwaived testing must successfully participate in approved proficiency testing program for each specialty, subspecialty, and analyte or test in which the laboratory is certified under CLIA. If a laboratory fails to participate successfully in proficiency testing for a given specialty, subspecialty, analyte or test, as defined in this section, or fails to © 2011 by Taylor and Francis Group, LLC

Role of Governmental and Professional Organizations



211

take remedial action when an individual fails gynecologic cytology, Centers for Medicare and Medical Services (CMS) impose sanctions. If a laboratory fails to perform successfully in a CMS-approved proficiency testing program, for the initial unsuccessful performance, CMS may direct the laboratory to undertake training of its personnel or to obtain technical assistance, or both, rather than imposing alternative or principle sanctions except when one or more of the following conditions exists: (1) There is immediate jeopardy to patient health and safety. (2) The laboratory fails to provide CMS or a CMS agent with satisfactory evidence that it has taken steps to correct the problem identified by the unsuccessful proficiency testing performance. (3) The laboratory has a poor compliance history. 5. Proper facility administration for nonwaived testing. 6. Quality system for nonwaived testing, including quality assessment (QA) of general laboratory system, preanalytic, analytic, and postanalytic systems. 7. Personnel for laboratories performing nonwaived testing of moderate and high complexity. 8. Inspection system. 9. Enforcement procedures.

As concerns point 4, following assessment criteria of participation in proficiency testing were established for bacteriology, mycobacteriology, mycology, parasitology, virology, syphilis serology, general immunology, routine chemistry, urinalysis, endocrinology, toxicology, and hematology: • Failure to attain an overall testing event score of at least 80% is unsatisfactory performance. • Failure to participate in a testing event is unsatisfactory performance and results in a score of 0 for the testing event. • Failure to return testing results to the proficiency testing program within the time frame specified by the program is unsatisfactory performance and results in a score of 0 for the testing event. • For any unsatisfactory testing event for reasons other than a failure to participate, the laboratory must undertake appropriate training and employ the technical assistance necessary to correct problems associated with a proficiency testing failure. Remedial action must be taken and documented, and the laboratory must maintain the documentation for 2 years from the date of participation in the proficiency testing event. • Failure to achieve an overall testing event score of satisfactory performance for two consecutive testing events or two out of three consecutive testing events is unsuccessful performance. © 2011 by Taylor and Francis Group, LLC

212

Quality Assurance in the Pathology Laboratory

Table 8.1â•… CLIA—Criteria for Acceptable Performance—General Clinical Chemistry Analyte or Test Alanine aminotransferase (ALT/SGP) Albumin Alkaline phosphatase Amylase Aspartate aminotransferase (AST/SGOT) Bilirubin, total Blood gas pO2 pCO2 pH Calcium, total Chloride Cholesterol, total Cholesterol, high-density lipoprotein Creatine kinase Creatine kinase isoenzymes Creatinine Glucose (excluding glucose performed on monitoring devices cleared by FDA for home use Iron, total Lactate dehydrogenase (LDH) LDH isoenzymes Magnesium Potassium Sodium Total protein Triglycerides Urea nitrogen Uric acid

Criteria for Acceptable Performance Target valueâ•›±â•›20% Target valueâ•›±â•›10% Target valueâ•›±â•›30% Target valueâ•›±â•›30% Target valueâ•›±â•›20% Target valueâ•›±â•›0.4â•›mg/dL orâ•›±â•›20% (greater) Target valueâ•›±â•›3 SD Target valueâ•›±â•›5â•›mm Hg orâ•›±â•›8% (greater) Target valueâ•›±â•›0.04 Target valueâ•›±â•›1.0â•›mg/dL Target valueâ•›±â•›5% Target valueâ•›±â•›10% Target valueâ•›±â•›30% Target valueâ•›±â•›30% MB elevated (presence or absence) or Target valueâ•›±â•›3â•›SD Target valueâ•›±â•›0.3â•›mg/dL or ±15% (greater). Target value 6â•›mg/dL or 10% (greater)

Target valueâ•›±â•›20% Target valueâ•›±â•›20% LDH1/LDH2 (+ or −) or Target valueâ•›±â•›30% Target valueâ•›±â•›25% Target valueâ•›±â•›0.5â•›mmol/L Target valueâ•›±â•›4â•›mmol/L Target valueâ•›±â•›10% Target valueâ•›±â•›25% Target valueâ•›±â•›2â•›mg/dL orâ•›±â•›9% (greater) Target valueâ•›±â•›17%

Tables 8.1 through 8.3 show acceptable performance criteria for clinical chemistry, endocrinology, and toxicology, respectively. It is interesting to find that most criteria for quantitative examinations are less restrictive than those recommended by FDA in the “Guidance for Industry” [2]. In this document, the accuracy threshold was set at ±15% of theoretical value. For cytology (pap smears, gynecologic examinations), following criteria were formulated: • The laboratory must ensure that each individual engaged in the examination of gynecologic preparations is enrolled in a CMS-approved © 2011 by Taylor and Francis Group, LLC

Role of Governmental and Professional Organizations

213

Table 8.2â•… CLIA—Criteria for Acceptable Performance—Endocrinology Analyte or Test

Criteria for Acceptable Performance

Cortisol Free thyroxine Human chorionic gonadotropin (excluding urine pregnancy tests done by visual color comparison categorized as waived tests) T3 uptake Triiodothyronine Thyroid-stimulating hormone Thyroxine

Target valueâ•›±â•›25% Target valueâ•›±â•›3 SD Target valueâ•›±â•›3 SD positive or negative

Target valueâ•›±â•›3 SD Target valueâ•›±â•›3 SD Target valueâ•›±â•›3 SD Target valueâ•›±â•›20% or 1.0â•›mcg/dL (greater)

Table 8.3â•… CLIA—Criteria for Acceptable Performance—Toxicology Analyte or Test Alcohol, blood Blood lead Carbamazepine Digoxin Ethosuximide Gentamicin Lithium Phenobarbital Phenytoin Primidone Procainamide (and metabolite) Quinidine Tobramycin Theophylline Valproic acid

Criteria for Acceptable Performance Target valueâ•›±â•›25% Target valueâ•›±â•›10% or 4â•›mcg/dL (greater) Target valueâ•›±â•›25% Target valueâ•›±â•›20% orâ•›±â•›0.2â•›ng/mL (greater) Target valueâ•›±â•›20% Target valueâ•›±â•›25% Target valueâ•›±â•›0.3â•›mmol/L orâ•›±â•›20% (greater) Target valueâ•›±â•›20% Target valueâ•›±â•›25% Target valueâ•›±â•›25% Target valueâ•›±â•›25% Target valueâ•›±â•›25% Target valueâ•›±â•›25% Target valueâ•›±â•›25% Target valueâ•›±â•›25%

proficiency testing program, if available in the state in which he or she is employed. The laboratory must ensure that each individual is tested at least once per year and obtains a passing score. To ensure this annual testing of individuals, an announced or unannounced testing event will be conducted on-site in each laboratory at least once each year. Laboratories will be notified of the time of each announced on-site testing event at least 30 days prior to each event. Additional testing events will be conducted as necessary in each state or region for the purpose of testing individuals who miss the on-site testing event and for retesting individuals. © 2011 by Taylor and Francis Group, LLC

214

Quality Assurance in the Pathology Laboratory

• The laboratory must ensure that each individual participates in an annual testing event that involves the examination of a 10-slide test set. Individuals who fail this testing event are retested with another 10-slide test set. Individuals who fail this second test are subsequently retested with a 20-slide test. Individuals are given not more than 2â•›h to complete a 10-slide test and not more than 4â•›h to complete a 20-slide test. Unexcused failure to appear by an individual for a retest will result in test failure with resulting remediation and limitations on slide examinations. The responses of each proficiency testing are divided into four categories: (a) “Unsatisfactory for diagnosis,” (b) Normal or benign changes,” (c) “Low-grade squamous epithelial lesions,” and (d) “High-grade lesion and carcinoma.” Criteria for scoring system for 10-slide and 20-slide tests are shown in Table 8.4. • If a laboratory fails to ensure that individuals are tested or those who fail a testing event are retested, or fails to take required remedial actions, CMS will initiate intermediate sanctions or limit the laboratory’s certificate to exclude gynecologic cytology testing under CLIA, and, if applicable, suspend the laboratory’s medicare and medicaid payments for gynecologic cytology testing. Table 8.4 shows details of acceptable performance criteria for cytology. It should be noted that the proficiency testing system for cytological examinations, as mandated by CLIA, has been heavily criticized as inefficient and giving misleading results [3–5]. For immunohematology (ABO group and D typing) and hematology compatibility testing, the requirements concerning successful participation are as follows: • Failure to attain a score of at least 100% of acceptable responses for each analyte or test in each testing event is unsatisfactory analyte performance for the testing event. • Failure to attain an overall testing event score of at least 100% is unsatisfactory performance. • Failure to participate in a testing event is unsatisfactory performance and results in a score of 0 for the testing event. • Failure to return proficiency testing results within the time frame specified by the program is unsatisfactory performance and results in a score of 0 for the testing event. • For any unsatisfactory testing event for reasons other than a failure to participate, the laboratory must undertake appropriate training and employ the technical assistance necessary to correct problems associated with a proficiency testing failure. For any unacceptable © 2011 by Taylor and Francis Group, LLC

Role of Governmental and Professional Organizations

215

Table 8.4â•… CLIA—Criteria for Scoring System for Cytology: Gynecologic Examinations Correct Examinee’s Examinee’s Examinee’s Examinee’s Response Response: A Response: B Response: C Response: D Supervisors— 10-slide test

A B C D

10 5 5 0

0 10 0 −5

0 0 10 5

0 0 5 10

Cytotechnologists— 10-slide test

A B C D

10 5 5 0

0 10 0 −5

5 5 10 10

5 5 10 10

Supervisors— 20-slide test

A B C D

2 2.5 2.5 0

0 5 0 −10

0 0 5 2.5

0 0 2.5 5

Cytotechnologists— 20-slide test

A B C D

2 2.5 2.5 0

0 5 0 −10

2.5 2.5 5 5

2.5 2.5 5 5

Notes: A maximum of 10 points for a correct response and a maximum of minus five (−5) points for an incorrect response on a 10-slide test set is provided. For example, if the correct response on a slide is “high-grade squamous intraepithelial lesion” (category “D” on the scoring system chart) and an examinee calls it “normal or negative” (category B), then the examinee’s point value on that slide is calculated as minus five (−5). Each slide is scored individually in the same manner. The individual’s score for the testing event is determined by adding the point value achieved for each slide preparation, dividing by the total points for the testing event and multiplying by 100. On a 20-slide test set, maximums of five points for a correct response and minus ten (−10) points for an incorrect response is provided.

analyte or unsatisfactory testing event score, documented remedial action must be taken, and the documentation must be maintained by the laboratory for 2 years from the date of participation in the proficiency testing event. • Failure to achieve satisfactory performance for the same analyte in two consecutive testing events or two out of three consecutive testing events is unsuccessful performance. • Failure to achieve an overall testing event score of satisfactory for two consecutive testing events or two out of three consecutive testing events is unsuccessful performance. The general concept of QA, based on on-site inspections and meeting generic, external quality standards, as required in CLIA 88, was criticized © 2011 by Taylor and Francis Group, LLC

216

Quality Assurance in the Pathology Laboratory

as inadequate and bringing sometimes unexpected results. It may happen that the laboratory, which passes inspection, does not ensure proper quality. This phenomenon has been raised by Ehrmeyer et al. [6], who gave an example of a failure in the auditing and inspection process: A 243-bed hospital has been a participant on all phases of the CLIA 88 auditing process for over 15 years, and was also “accredited with distinction” by CAP program. Nevertheless, the hospital laboratory was reporting over long period the results of the tests of vital importance (HIV and hepatitis) generated by a faulty system whose internal QA program has been signaling “out of control” status. Four hundred and sixty persons were affected. This status has been consciously ignored by hospital administration, and the analysts were forced by their supervisors to report test results despite of the warnings. The hospital administration failed to take any action despite events that signaled problems in the laboratory including complaints, lost contracts with external customers, occurrence reports, and an employee exposure to blood-borne HIV pathogens. A former laboratory employee, who forwarded a complaint to the state authorities, pinpointing the specific piece of faulty equipment, the specific tests where the problem was occurring, as well as the specific manipulations of the data, revealed all problems. It should be noted that the state inspectors had visited the lab some month before this complaint and sounded no alarms. However, the next inspection, performed afterward, found serious deficiencies and significant problems related to the operation and management of the laboratory. The whole story was reported in detail by the local press [7] and analyzed by the federal authorities [8]. From this example, it is clear that the delivery of quality test results, and not passing inspections, is a priority, which should be ensured in the legal way. According to Ehrmeyer et al., this may be done if auditing is a component of a continuous quality improvement system, promoted by the leadership. This approach is formulated by ISO 15289. However, if auditing is a fault-finding process leading to negative repercussions for all involved, it is unlikely to be effective. 8.2.2╇Regulations Issued by FDA FDA is without doubt the most central agency, responsible for issuance of guidances and recommendations related to quality assurance of various laboratory methods, also on the field of pathology and laboratory medicine. The role of FDA was stressed in the CLIA 88 law. It this document, FDA was named as responsible for qualification of waived and nonwaived methods, and for the complexity categorization of nonwaived tests. Most important FDA documents concern identification with laboratory methods [9], validation of

© 2011 by Taylor and Francis Group, LLC

Role of Governmental and Professional Organizations

217

quantitative methods [2], use of electronic records and signatures [10,11], and requirements for waived tests [12]. 8.2.2.1  Identification Issues Guidelines and requirements concerning identification were discussed in detail in Chapter 3 (QA of identification with chromatographic—mass spectrometric methods). FDA documents concerning other issues will be presented in this section. 8.2.2.2  Quantitation and Method Validation Issues FDA during the last 20 years published series of documents on the validation of bioanalytical methods [13]. In the final stage, these documents were summarized as the official guidance for industry (2). Since the international bodies or organizations, like, e.g., The International Conference on Harmonisation (ICH) of Technical Requirements for Registration of Pharmaceuticals for Human Use did not cover all aspects of the analytical process, the guidelines formulated by FDA were used as the basis of in-house standard operating procedures (SOPs) and guidelines applied in pathology and laboratory medicine not only in the United States, but also in the whole world. The purpose of the guidance was to provide assistance in developing bioanalytical method validation information used in human clinical pharmacology, bioavailability, and bioequivalence studies requiring pharmacokinetic evaluation. This guidance also applies to bioanalytical methods used for nonhuman pharmacology/toxicology studies and preclinical studies as well. The information in the guidance generally applies to bioanalytical separation procedures such as gas chromatography (GC) or liquid chromatography (LC), usually combined with mass spectrometric detection such as LC-MS, LC-MS-MS, GC-MS, and GC-MS-MS performed for the quantitative determination of drugs and/or metabolites in biological matrices such as blood, serum, plasma, or urine. This guidance also applies to other bioanalytical methods, such as immunological and microbiological procedures, and to other biological matrices, such as tissue and skin samples. General recommendations for bioanalytical method validation were given, which can be adjusted or modified depending on the specific type of analytical method used. The fundamental parameters for this validation include accuracy, precision, selectivity, sensitivity, reproducibility, and stability. Validation involves documenting, through the use of specific laboratory investigations, that the performance characteristics of the method are suitable and reliable for the intended analytical applications. The acceptability of analytical data corresponds directly to the criteria used to validate the method.

© 2011 by Taylor and Francis Group, LLC

218

Quality Assurance in the Pathology Laboratory

Published methods of analysis are often modified to suit the requirements of the laboratory performing the assay. These modifications should be validated to ensure suitable performance of the analytical method. When changes are made to a previously validated method, the analyst should exercise judgment as to how much additional validation is needed. During the course of a typical drug development program, a defined bioanalytical method undergoes many modifications. The evolutionary changes to support specific studies and different levels of validation demonstrate the validity of an assay’s performance. Different types and levels of validation are defined and characterized as follows: Full validation is important when developing and implementing a bioanalytical method for the first time, when new drug entity is involved or if metabolites are added to an existing assay for quantification. Partial validations are modifications of already validated bioanalytical methods. Partial validation can range from one intra-assay accuracy and precision determination to a nearly full validation. Typical bioanalytical method changes that fall into this category include bioanalytical method transfers between laboratories or analysts, change in analytical methodology (e.g., change in detection systems, in instruments, and/or software platforms), change in matrix or anticoagulant, change in sample processing procedures, change in species within matrix (e.g., rat plasma to mouse plasma), change in relevant concentration range, or selectivity demonstration of an analyte in the presence of concomitant medications or specific metabolites. Cross-validation is a comparison of validation parameters when two or more bioanalytical methods are used to generate data within the same study or across different studies. An example of cross-validation would be a situation where an original validated bioanalytical method serves as the reference and the revised bioanalytical method is the comparator. The comparisons should be done both ways. Cross-validation should also be considered when data generated using different analytical techniques (e.g., LC-MS-MS vs. ELISA) in different studies are included in a regulatory submission. The analytical laboratory should have a written set of SOPs to ensure a complete system of quality control and assurance. The SOPs should cover all aspects of analysis from the time the sample is collected and reaches the laboratory until the results of the analysis are reported. The SOPs also should include record keeping, security and chain of sample custody, sample preparation, and analytical tools such as methods, reagents, equipment, instrumentation, and procedures for quality control (QC) and verification of results. The process by which a specific bioanalytical method is developed, validated, and used in routine sample analysis can be divided into the following:

© 2011 by Taylor and Francis Group, LLC

Role of Governmental and Professional Organizations

219

• Reference standard preparation. • Bioanalytical method development and establishment of assay procedure. • Application of validated bioanalytical method to routine drug analysis and acceptance criteria for the analytical run and/or batch. These three processes were described in the following sections of the guidance. 8.2.2.2.1╇ Reference Standard Preparationâ•… Analysis of drugs and their metabolites in a biological matrix is carried out using samples spiked with calibration (reference) standards and using QC samples. An authenticated analytical reference standard of known identity and purity should be used to prepare solutions of known concentrations. If possible, the reference standard should be identical to the analyte. When this is not possible, an established chemical form (free base or acid, salt or ester) of known purity can be used. Three types of reference standards are usually used: certified reference standards, commercially supplied reference standards obtained from a reputable commercial source, or other materials of documented purity custom synthesized by an analytical laboratory or other noncommercial establishment. The source and lot number, expiration date, certificates of analyses when available, and/or internally or externally generated evidence of identity and purity should be furnished for each reference standard. 8.2.2.2.2╇ Bioanalytical Method Development: Chemical Assayâ•… The method development and establishment phase defines the chemical assay. Typical method development and establishment for a bioanalytical method include determination of selectivity, accuracy, precision, recovery, calibration curve, and stability of analyte in spiked samples. Selectivity is the ability of an analytical method to differentiate and quantify the analyte in the presence of other components in the sample. For selectivity, analyses of blank samples of the appropriate biological matrix should be obtained from at least six sources. Each blank sample should be tested for interference, and selectivity should be ensured at the lower limit of quantification (LLOQ). If the method is intended to quantify more than one analyte, each analyte should be tested to ensure that there is no interference. Accuracy of an analytical method describes the closeness of mean test results obtained by the method to the true value (concentration) of the analyte. Accuracy is determined by replicate analysis of samples containing known amounts of the analyte at a minimum of three concentrations in the range of expected concentrations using a minimum of five determinations per concentration. The mean value should be within 15% of the actual value

© 2011 by Taylor and Francis Group, LLC

220

Quality Assurance in the Pathology Laboratory

except at LLOQ, where it should not deviate by more than 20%. The deviation of the mean from the true value serves as the measure of accuracy. Precision of an analytical method describes the closeness of individual measures of an analyte when the procedure is applied repeatedly to multiple aliquots of a single homogeneous volume of biological matrix. Precision should be measured using a minimum of five determinations per concentration at a minimum of three concentrations in the range of expected concentrations. The precision determined at each concentration level should not exceed 15% of the coefficient of variation (CV) except for the LLOQ, where it should not exceed 20% of the CV. Precision is further subdivided into within-run and intra-batch precision or repeatability. Recovery of an analyte in an assay is the detector response obtained from an amount of the analyte added to and extracted from the biological matrix, compared to the detector response obtained for the true concentration of the pure authentic standard. Recovery pertains to the extraction efficiency of an analytical method within the limits of variability. The extent of recovery of an analyte and of the internal standard should be consistent, precise, and reproducible. Recovery experiments should be performed by comparing the analytical results for extracted samples at three concentrations (low, medium, and high) with not extracted standards that represent 100% recovery. Calibration (standard) curve is the relationship between instrument response and known concentrations of the analyte. A calibration curve should be prepared in the same biological matrix as the samples in the intended study. Concentrations of standards should be chosen on the basis of the concentration range expected in a particular study. A calibration curve should consist of a blank sample (matrix sample processed without internal standard), a zero sample (matrix sample processed with internal standard), and six to eight nonzero samples covering the expected range, including LLOQ. 8.2.2.2.2.1╇ Lower Limit of Quantificationâ•… The lowest standard on the calibration curve should be accepted as the limit of quantification if the following conditions are met: The analyte response at the LLOQ should be at least five times the response compared to blank response and should be reproducible with a precision of 20% and accuracy of 80%–120%. 8.2.2.2.2.2╇ Calibration Curve/Standard Curve/Concentration-Responseâ•… The following conditions should be met in developing a calibration curve: ±20% deviation of the LLOQ from nominal concentration and ±15% deviation of standards other than LLOQ from nominal concentration. At least four out of six nonzero standards should meet the above criteria, including the LLOQ and the calibration standard at the highest concentration. Stability of an analyte in a particular matrix and container system is relevant only to that matrix and container system and should not be extrapolated © 2011 by Taylor and Francis Group, LLC

Role of Governmental and Professional Organizations

221

to other matrices and container systems. Stability procedures should evaluate the stability of the analytes during sample collection and handling, after longterm (frozen at the intended storage temperature) and short-term (benchtop, room temperature) storage, and after going through freeze and thaw cycles and the analytical process. Conditions used in stability experiments should reflect situations likely to be encountered during actual sample handling and analysis. The procedure should also include an evaluation of analyte stability in stock solution. All stability determinations should use a set of samples prepared from a freshly made stock solution of the analyte in the appropriate analytefree, interference-free biological matrix. Stock solutions of the analyte for stability evaluation should be prepared in an appropriate solvent at known concentrations. 8.2.2.2.2.3╇ Freeze and Thaw Stabilityâ•… Analyte stability should be determined after three freeze and thaw cycles, using, at least, three aliquots at each of the low and high concentrations. The samples should be thawed unassisted at room temperature. When completely thawed, the samples should be refrozen for 12–24â•›h under the same conditions. The freeze– thaw cycle should be repeated two more times and then analyzed on the third cycle. If an analyte is unstable at the intended storage temperature, the stability sample should be frozen at −70°C during the three freeze and thaw cycles. 8.2.2.2.2.4╇ Short-Term Temperature Stabilityâ•… Three aliquots of each of the low and high concentrations should be thawed at room temperature and kept at this temperature from 4 to 24â•›h (based on the expected duration that samples will be maintained at room temperature in the intended study) and analyzed. 8.2.2.2.2.5╇ Long-Term Stabilityâ•… The storage time in a long-term stability evaluation should exceed the time between the date of first sample collection and the date of last sample analysis. Long-term stability should be determined by storing at least three aliquots of each of the low and high concentrations under the same conditions as the study samples. The concentrations of all the stability samples should be compared to the mean of back-calculated values for the standards at the appropriate concentrations from the first day of longterm stability testing. 8.2.2.2.2.6╇ Stock Solution Stabilityâ•… The stability of stock solutions of drug and the internal standard should be evaluated at room temperature for at least 6â•›h. If the stock solutions are refrigerated or frozen for the relevant period, the stability should be documented after completion of the desired storage time, the stability should be tested by comparing the instrument response with that of freshly prepared solutions. © 2011 by Taylor and Francis Group, LLC

222

Quality Assurance in the Pathology Laboratory

8.2.2.2.2.7╇ Post-Preparative Stabilityâ•… The stability of processed samples, including the resident time in the autosampler, should be determined. The stability of the drug and the internal standard should be assessed over the anticipated run time for the batch size in validation samples by determining concentrations on the basis of original calibration standards. 8.2.2.2.3╇ Bioanalytical Method Development: Microbiological and Ligand-Binding Assayâ•… Many of the bioanalytical validation parameters and principles discussed above are also applicable to microbiological and ligand-binding assays (LBAs). However, these assays possess some unique characteristics that should be considered during method validation. 8.2.2.2.3.1╇ Selectivity Issuesâ•… As with chromatographic methods, microbiological and LBAs should be shown to be selective for the analyte. The following recommendations for dealing with two selectivity issues should be considered: 8.2.2.2.3.2╇ Interference from Substances Physicochemically Similar to the Analyteâ•… Cross-reactivity of metabolites, concomitant medications, or endogenous compounds should be evaluated individually and in combination with the analyte of interest. When possible, the immunoassay should be compared with a validated reference method (such as LC-MS) using incurred samples and predetermined criteria for agreement of accuracy of immunoassay and reference method. The dilutional linearity to the reference standard should be assessed using study (incurred) samples. Selectivity may be improved for some analytes by incorporation of separation steps prior to immunoassay. 8.2.2.2.3.3╇ Matrix Effects Unrelated to the Analyteâ•… The standard curve in biological fluids should be compared with standard curve in buffer to detect matrix effects. Parallelism of diluted study samples should be evaluated with diluted standards to detect matrix effects. Nonspecific binding should be determined. 8.2.2.2.3.4╇ Quantification Issuesâ•… Microbiological and immunoassay standard curves are inherently nonlinear and, in general, more concentration points may be recommended to define the fit over the standard curve range than for chemical assays. A minimum of six nonzero calibrator © 2011 by Taylor and Francis Group, LLC

Role of Governmental and Professional Organizations

223

concentrations, run in duplicate, is recommended. The concentration– response relationship is most often fitted to a four- or five-parameter logistic model, although others may be used with suitable validation. The use of anchoring points in the asymptotic high- and low-concentration ends of the standard curve may improve the overall curve fit. Generally, these anchoring points will be at concentrations that are below the established LLOQ and above the established upper limit of quantitation (ULOQ). Whenever possible, calibrators should be prepared in the same matrix as the study samples or in an alternate matrix of equivalent performance. Both ULOQ and LLOQ should be defined by acceptable accuracy, precision, or confidence interval criteria based on the study requirements. For all assays, the key factor is the accuracy of the reported results. This accuracy can be improved by the use of replicate samples. In the case where replicate samples should be measured during the validation to improve accuracy, the same procedure should be followed as for unknown samples. The following recommendations apply to quantification issues: • If separation is used prior to assay for study samples but not for standards, it is important to establish recovery and use it in determining results. • Key reagents, such as antibody, tracer, reference standard, and matrix should be characterized appropriately and stored under defined conditions. • Assessments of analyte stability should be conducted in true study matrix (e.g., should not use a matrix stripped to remove endogenous interferences). • Acceptance criteria: At least 67% (four out of six) of QC samples should be within 15% of their respective nominal value, 33% of the QC samples (not all replicates at the same concentration) may be outside 15% of nominal value. In certain situations, wider acceptance criteria may be justified. Assay reoptimization or validation should be done when there are changes in key reagents, like labeled analyte (tracer), antibody, and matrix. Method development experiments should include a minimum of six runs conducted over several days, with at least four concentrations (LLOQ, low, medium, and high) analyzed in duplicate in each run. 8.2.2.2.4╇ Application of Validated Method to Routine Drug Assaysâ•… Assays of all samples of an analyte in a biological matrix should be completed within the time period for which stability data are available. In general, biological samples can be analyzed with a single determination without duplicate or replicate analysis if the assay method has acceptable © 2011 by Taylor and Francis Group, LLC

224

Quality Assurance in the Pathology Laboratory

variability as defined by validation data. This is true for procedures where precision and accuracy variabilities routinely fall within acceptable tolerance limits. For a difficult procedure with a labile analyte where high precision and accuracy specifications may be difficult to achieve, duplicate or even triplicate analyses can be performed for a better estimate of analyte. A calibration curve should be generated for each analyte to assay samples in each analytical run and should be used to calculate the concentration of the analyte in the unknown samples in the run. The spiked samples can contain more than one analyte. An analytical run can consist of QC samples, calibration standards, and either all the processed samples to be analyzed as one batch or a batch composed of processed unknown samples of one or more volunteers in a study. The calibration (standard) curve should cover the expected unknown sample concentration range in addition to a calibrator sample at LLOQ. Estimation of concentration in unknown samples by extrapolation of standard curves below LLOQ or above the highest standard is not recommended. Instead, the standard curve should be redefined or samples with higher concentration should be diluted and reassayed. It is preferable to analyze all study samples from a subject in a single run. Once the analytical method has been validated for routine use, its accuracy and precision should be monitored regularly to ensure that the method continues to perform satisfactorily. To achieve this objective, a number of QC samples prepared separately and representing lower, middle, and higher concentration range should be analyzed with processed test samples at intervals based on the total number of samples. At least four of every six QC samples should be within ±15% of their respective nominal value. The results of the QC samples provide the basis of accepting or rejecting the run. Based on the analyte and technique, a specific SOP (or sample) should be identified to ensure optimum operation of the system used. It is important to establish an SOP or guideline for repeat analysis and acceptance criteria. This SOP or guideline should explain the reasons for repeating sample analysis. Reasons for repeat analyses could include repeat analysis of clinical or preclinical samples for regulatory purposes, inconsistent replicate analysis, samples outside of the assay range, sample processing errors, equipment failure, poor chromatography, and inconsistent pharmacokinetic data. Reassays should be done in triplicate if sample volume allows. The rationale for the repeat analysis and the reporting of the repeat analysis should be clearly documented. The following acceptance criteria should be considered for accepting the analytical run: • Standards and QC samples can be prepared from the same verified spiking stock solution or verified matrix. • Standard curve samples, blanks, QCs, and study samples can be arranged as considered appropriate within the run. © 2011 by Taylor and Francis Group, LLC

Role of Governmental and Professional Organizations

225

• Matrix-based standard calibration samples should meet the criteria formulated above. • Acceptance criteria for accuracy and precision of QC samples should correspond to those outlined above. • Samples involving multiple analytes should not be rejected based on the data from one analyte failing the acceptance criteria. • The data from rejected runs need not be documented, but the fact that a run was rejected and the reason for failure should be recorded. 8.2.2.2.4.1╇ Documentationâ•… The validity of an analytical method should be established and verified by laboratory studies, and documentation of successful completion of such studies should be provided in the assay validation report. General and specific SOPs and good record keeping are an essential part of a validated analytical method. The data generated for bioanalytical method establishment and the QCs should be documented and available for data audit and inspection. Documentation for submission to the agency should include summary information, method development and establishment, bioanalytical reports of the application of any methods to routine sample analysis, and other information applicable to method development and establishment, and/or to routine sample analysis. Summary information should include • Summary table of validation reports, including analytical method validation, partial revalidation, and cross-validation reports. The table should be in chronological sequence, and include assay method identification code, type of assay, and the reason for the new method or additional validation (e.g., to lower the limit of quantitation). • Summary table with a list, by protocol, of assay methods used. The protocol number, protocol title, assay type, assay method identification code, and report code should be provided. • A summary table allowing cross-referencing of multiple identification codes should be provided (e.g., when an assay has different codes for the assay method, validation reports, and bioanalytical reports, especially when the sponsor and a contract laboratory assign different codes). Documentation for method development and establishment should include • An operational description of the analytical method • Evidence of purity and identity of drug standards, metabolite standards, and internal standards used in validation experiments • A description of stability studies and supporting data © 2011 by Taylor and Francis Group, LLC

226

Quality Assurance in the Pathology Laboratory

• A description of experiments conducted to determine accuracy, precision, recovery, selectivity, limit of quantification, calibration curve (equations and weighting functions used, if any), and relevant data obtained from these studies • Documentation of intra- and inter-assay precision and accuracy • Information about cross-validation study data, if applicable • Legible annotated chromatograms or mass spectrograms, if applicable • Any deviations from SOPs, protocols, or good laboratory practices (GLPs) (if applicable), and justifications for deviations Documentation of the application of validated bioanalytical methods to routine drug analysis should include • Evidence of purity and identity of drug standards, metabolite standards, and internal standards used during routine analyses. • Summary tables containing information on sample processing and storage. Tables should include sample identification, collection dates, storage prior to shipment, information on shipment batch, and storage prior to analysis. Information should include dates, times, sample condition, and any deviation from protocols. • Summary tables of analytical runs of clinical or preclinical samples. Information should include assay run identification, date and time of analysis, assay method, analysts, start and stop times, duration, significant equipment and material changes, and any potential issues or deviation from the established method. • Equations used for back-calculation of results. • Tables of calibration curve data used in analyzing samples and calibration curve summary data. • Summary information on intra- and inter-assay values of QC samples and data on intra- and inter-assay accuracy and precision from calibration curves and QC samples used for accepting the analytical run. QC graphs and trend analyses in addition to raw data and summary statistics are encouraged. • Data tables from analytical runs of clinical or preclinical samples. Tables should include assay run identification, sample identification, raw data and back-calculated results, integration codes, and/or other reporting codes. • Complete serial chromatograms from 5% to 20% of subjects, with standards and QC samples from those analytical runs. For pivotal bioequivalence studies for marketing, chromatograms from 20% of serially selected subjects should be included. In other studies, chromatograms from 5% of randomly selected subjects in each study © 2011 by Taylor and Francis Group, LLC

Role of Governmental and Professional Organizations

• •

•

•

227

should be included. Subjects whose chromatograms are to be submitted should be defined prior to the analysis of any clinical samples. Reasons for missing samples. Documentation for repeat analyses. Documentation should include the initial and repeat analysis results, the reported result, assay run identification, the reason for the repeat analysis, the requestor of the repeat analysis, and the manager authorizing reanalysis. Repeat analysis of a clinical or preclinical sample should be performed only under a predefined SOP. Documentation for reintegrated data. Documentation should include the initial and repeat integration results, the method used for reintegration, the reported result, assay run identification, the reason for the reintegration, the requestor of the reintegration, and the manager authorizing reintegration. Reintegration of a clinical or preclinical sample should be performed only under a predefined SOP. Deviations from the analysis protocol or SOP, with reasons and justifications for the deviations.

Other information applicable to both method development and establishment, and/or to routine sample analysis could include the following: • Lists of abbreviations and any additional codes used, including sample condition codes, integration codes, and reporting codes • Reference lists and legible copies of any references • SOPs or protocols covering the following areas: Calibration standard acceptance or rejection criteria, calibration curve acceptance or rejection criteria, quality control sample and assay run acceptance or rejection criteria, acceptance criteria for reported values when all unknown samples are assayed in duplicate, sample code designations, including clinical or preclinical sample codes and bioassay sample code, assignment of clinical or preclinical samples to assay batches, sample collection, processing, and storage, repeat analyses of samples, and reintegration of samples 8.2.2.3  Validation of Electronic Records and Signatures The standpoint of FDA on the applicability of electronic records and signatures in all FDA-regulated industries (e.g., drug or medical device manufacturers, biotech companies, or biologics developers) was formulated in the Title 21 CFR Part 11 of the Code of Federal Regulations in 1997 (10). The intention of the agency was to permit the widest possible use of electronic technology in all FDA-controlled areas. This rule applies to paper records required by the agency regulations by providing that electronic ones may replace each such paper record, under defined criteria. © 2011 by Taylor and Francis Group, LLC

228

Quality Assurance in the Pathology Laboratory

The entire, original text of the 21 CFR Part 11 Final Rule is as follows: Part 11—Electronic Records; Electronic Signatures Subpart A—General Provisions 11.1 Scope 11.2 Implementation 11.3 Definitions Subpart B—Electronic Records 11.10 Controls for closed systems 11.30 Controls for open systems 11.50 Signature manifestations 11.70 Signature/record linking Subpart C—Electronic Signatures 11.100 General requirements 11.200 Electronic signature components and controls 11.300 Controls for identification codes/passwords Authority: Secs. 201–903 of the Federal Food, Drug, and Cosmetic Act (21 U.S.C. 321–393); sec. 351 of the Public Health Service Act (42 U.S.C. 262). Subpart A—General Provisions § 11.1 Scope (a) The regulations in this part set forth the criteria under which the agency considers electronic records, electronic signatures, and handwritten signatures executed to electronic records to be trustworthy, reliable, and generally equivalent to paper records and handwritten signatures executed on paper. (b) This part applies to records in electronic form that are created, modified, maintained, archived, retrieved, or transmitted, under any records requirements set forth in agency regulations. This part also applies to electronic records submitted to the agency under requirements of the Federal Food, Drug, and Cosmetic Act and the Public Health Service Act, even if such records are not specifically identified in agency regulations. However, this part does not apply to paper records that are, or have been, transmitted by electronic means. (c) Where electronic signatures and their associated electronic records meet the requirements of this part, the agency will consider the electronic signatures to be equivalent to full handwritten signatures, initials, and other general signings as required by agency regulations, unless specifically excepted by regulation(s) effective on or after Federal Register/Vol. 62, No. 54/Thursday, March 20, 1997/Rules and Regulations 13465 August 20, 1997. © 2011 by Taylor and Francis Group, LLC

Role of Governmental and Professional Organizations

229

(d) Electronic records that meet the requirements of this part may be used in lieu of paper records, in accordance with § 11.2, unless paper records are specifically required. (e) Computer systems (including hardware and software), controls, and attendant documentation maintained under this part shall be readily available for, and subject to, FDA inspection. § 11.2 Implementation (a) For records required to be maintained but not submitted to the agency, persons may use electronic records in lieu of paper records or electronic signatures in lieu of traditional signatures, in whole or in part, provided that the requirements of this part are met. (b) For records submitted to the agency, persons may use electronic records in lieu of paper records or electronic signatures in lieu of traditional signatures, in whole or in part, provided that (1) The requirements of this part are met. (2) The document or parts of a document to be submitted have been identified in public docket No. 92S–0251 as being the type of submission the agency accepts in electronic form. This docket will identify specifically what types of documents or parts of documents are acceptable for submission in electronic form without paper records and the agency receiving unit(s) (e.g., specific center, office, division, branch) to which such submissions may be made. Documents to agency receiving unit(s) not specified in the public docket will not be considered as official if they are submitted in electronic form; paper forms of such documents will be considered as official and must accompany any electronic records. Persons are expected to consult with the intended agency receiving unit for details on how (e.g., method of transmission, media, file formats, and technical protocols) and whether to proceed with the electronic submission. § 11.3 Definitions (a) The definitions and interpretations of terms contained in section 201 of the act apply to those terms when used in this part. (b) The following definitions of terms also apply to this part: (1) Act means the Federal Food, Drug, and Cosmetic Act (secs. 201–903 (21 U.S.C. 321–393)). (2) Agency means the Food and Drug Administration. (3) Biometrics means a method of verifying an individual’s identity based on measurement of the individual’s physical feature(s) or © 2011 by Taylor and Francis Group, LLC

230

Quality Assurance in the Pathology Laboratory



(4)



(5)



(6)



(7)



(8)



(9)

repeatable action(s) where those features and/or actions are both unique to that individual and measurable. Closed system means an environment in which system access is controlled by persons who are responsible for the content of electronic records that are on the system. Digital signature means an electronic signature based upon cryptographic methods of originator authentication, computed by using a set of rules and a set of parameters such that the identity of the signer and the integrity of the data can be verified. Electronic record means any combination of text, graphics, data, audio, pictorial, or other information representation in digital form that is created, modified, maintained, archived, retrieved, or distributed by a computer system. Electronic signature means a computer data compilation of any symbol or series of symbols executed, adopted, or authorized by an individual to be the legally binding equivalent of the individual’s handwritten signature. Handwritten signature means the scripted name or legal mark of an individual handwritten by that individual and executed or adopted with the present intention to authenticate a writing in a permanent form. The act of signing with a writing or marking instrument such as a pen or stylus is preserved. The scripted name or legal mark, while conventionally applied to paper, may also be applied to other devices that capture the name or mark. Open system means an environment in which system access is not controlled by persons who are responsible for the content of electronic records that are on the system.

Subpart B—Electronic Records § 11.10 Controls for closed systems Persons who use closed systems to create, modify, maintain, or transmit electronic records shall employ procedures and controls designed to ensure the authenticity, integrity, and, when appropriate, the confidentiality of electronic records, and to ensure that the signer cannot readily repudiate the signed record as not genuine. Such procedures and controls shall include the following: (a) Validation of systems to ensure accuracy, reliability, consistent intended performance, and the ability to discern invalid or altered records. (b) The ability to generate accurate and complete copies of records in both human readable and electronic form suitable for inspection,

© 2011 by Taylor and Francis Group, LLC

Role of Governmental and Professional Organizations

231

review, and copying by the agency. Persons should contact the agency if there are any questions regarding the ability of the agency to perform such review and copying of the electronic records. (c) Protection of records to enable their accurate and ready retrieval throughout the records retention period. (d) Limiting system access to authorized individuals. (e) Use of secure, computer-generated, time-stamped audit trails to independently record the date and time of operator entries and actions that create, modify, or delete electronic records. Record changes shall not obscure previously recorded information. Such audit trail documentation shall be retained for a period at least as long as that required for the subject electronic records and shall be available for agency review and copying. (f) Use of operational system checks to enforce permitted sequencing of steps and events, as appropriate. (g) Use of authority checks to ensure that only authorized individuals can use the system, electronically sign a record, access the operation or computer system input or output device, alter a record, or perform the operation at hand. (h) Use of device (e.g., terminal) checks to determine, as appropriate, the validity of the source of data input or operational instruction. (i) Determination that persons who develop, maintain, or use electronic record/electronic signature systems have the education, training, and experience to perform their assigned tasks. (j) The establishment of, and adherence to, written policies that hold individuals accountable and responsible for actions initiated under their electronic signatures, in order to deter record and signature falsification. (k) Use of appropriate controls over systems documentation, including (1) Adequate controls over the distribution of, access to, and use of documentation for system operation and maintenance. (2) Revision and change control procedures to maintain an audit trail that documents time-sequenced development and modification of systems documentation. § 11.30 Controls for open systems Persons who use open systems to create, modify, maintain, or transmit electronic records shall employ procedures and controls designed to 13466 Federal Register/Vol. 62, No. 54/Thursday, March 20, 1997/Rules and Regulations ensure the authenticity, integrity, and, as appropriate, the confidentiality of electronic records from the point of their creation to the point of their receipt. Such procedures and controls shall include those identified in § 11.10,

© 2011 by Taylor and Francis Group, LLC

232

Quality Assurance in the Pathology Laboratory

as appropriate, and additional measures such as document encryption and use of appropriate digital signature standards to ensure, as necessary under the circumstances, record authenticity, integrity, and confidentiality. § 11.50 Signature manifestations (a) Signed electronic records shall contain information associated with the signing that clearly indicates all of the following: (1) The printed name of the signer (2) The date and time when the signature was executed (3) The meaning (such as review, approval, responsibility, or authorship) associated with the signature (b) The items identified in paragraphs (a)(1), (a)(2), and (a)(3) of this section shall be subject to the same controls as for electronic records and shall be included as part of any human readable form of the electronic record (such as electronic display or printout) § 11.70 Signature/record linking Electronic signatures and handwritten signatures executed to electronic records shall be linked to their respective electronic records to ensure that the signatures cannot be excised, copied, or otherwise transferred to falsify an electronic record by ordinary means. Subpart C—Electronic Signatures § 11.100 General requirements (a) Each electronic signature shall be unique to one individual and shall not be reused by, or reassigned to, anyone else. (b) Before an organization establishes, assigns, certifies, or otherwise sanctions an individual’s electronic signature, or any element of such electronic signature, the organization shall verify the identity of the individual. (c) Persons using electronic signatures shall, prior to or at the time of such use, certify to the agency that the electronic signatures in their system, used on or after August 20, 1997, are intended to be the legally binding equivalent of traditional handwritten signatures. (1) The certification shall be submitted in paper form and signed with a traditional handwritten signature to the Office of Regional Operations (HFC–100), 5600 Fishers Lane, Rockville, MD 20857. (2) Persons using electronic signatures shall, upon agency request, provide additional certification or testimony that a specific electronic signature is the legally binding equivalent of the signer’s handwritten signature. © 2011 by Taylor and Francis Group, LLC

Role of Governmental and Professional Organizations

233

§ 11.200 Electronic signature components and controls (a) Electronic signatures that are not based on biometrics shall (1) Employ at least two distinct identification components such as an identification code and password. (i) When an individual executes a series of signings during a single, continuous period of controlled system access, the first signing shall be executed using all electronic signature components; subsequent signings shall be executed using at least one electronic signature component that is only executable by, and designed to be used only by, the individual. (ii) When an individual executes one or more signings not performed during a single, continuous period of controlled system access, each signing shall be executed using all of the electronic signature components. (2) Be used only by their genuine owners. (3) Be administered and executed to ensure that attempted use of an individual’s electronic signature by anyone other than its genuine owner requires collaboration of two or more individuals. (b) Electronic signatures based upon biometrics shall be designed to ensure that they cannot be used by anyone other than their genuine owners. § 11.300 Controls for identification codes/passwords Persons who use electronic signatures based upon use of identification codes in combination with passwords shall employ controls to ensure their security and integrity. Such controls shall include the following: (a) Maintaining the uniqueness of each combined identification code and password, such that no two individuals have the same combination of identification code and password. (b) Ensuring that identification code and password issuances are periodically checked, recalled, or revised (e.g., to cover such events as password aging). (c) Following loss management procedures to electronically deauthorize lost, stolen, missing, or otherwise potentially compromised tokens, cards, and other devices that bear or generate identification code or password information, and to issue temporary or permanent replacements using suitable, rigorous controls. (d) Use of transaction safeguards to prevent unauthorized use of passwords and/or identification codes, and to detect and report in an immediate and urgent manner any attempts at their unauthorized use to the system security unit, and, as appropriate, to organizational management. © 2011 by Taylor and Francis Group, LLC

234

Quality Assurance in the Pathology Laboratory

(e) Initial and periodic testing of devices, such as tokens or cards, that bear or generate identification code or password information to ensure that they function properly and have not been altered in an unauthorized manner. Dated: March 11, 1997. William B. Schultz, Deputy Commissioner for Policy. [FR Doc. 97–6833 Filed 3–20–97; 8:45 am] Together with the rule itself, in the 21 CFR Part 11 the FDA presents 49 comments on several aspects of the proposed rule, as well as the response of the agency. The response was formulated in 138 points. Some selected comments and agency standpoints are presented as follows: Some comments addressed whether the agency’s policy on electronic records and signatures should be issued as a regulation or recommendation/ guideline. FDA has concluded that regulation (Final Rule) is necessary to establish uniform and enforceable standard in this area. One comment asked whether paper records created by the computer would be subject to Part 11. The comment cited, as an example, the situation in which a computer system collects toxicology data that are printed out as “raw data.” In the response, the agency noted that specific requirements in existing regulations might affect the particular records at issue. Part 11 is not intended to apply to computer systems that are merely incidental to the creation of paper records (i.e., the use of word processing software). In such cases, the computer systems function essentially like manual typewriters or pens, and any signatures would be traditional handwritten signatures. Similar comment raised the question whether a signature that is first handwritten and then captured electronically (e.g., by scanning) is an electronic or handwritten signature. FDA advised that when the act of signing with a pen or stylus is preserved, the result is a handwritten signature. The word “signature” should not be limited to paper technology. The agency disagreed with the comment, suggesting replacing “electronic signature” with “electronic identification” or “electronic authorization.” In the view of the agency, the use of the word “signature” stresses the equivalence and significance of various electronic technologies with the traditional handwritten signature. Several comments objected to the planned inspectional authority of the FDA, regarding it as too broad and potentially detrimental to sensitive information. However, the agency advised that the inspections planned under Part 11 are subject to the same legal limitations as FDA inspections under other regulations. The agency responded that it would not routinely seek to inspect especially sensitive information, such as passwords or private keys, © 2011 by Taylor and Francis Group, LLC

Role of Governmental and Professional Organizations

235

nevertheless reserves the right to conduct the inspections, consistent with statutory limitations. The persons involved may change their passwords and private keys after FDA inspection. One comment argued that the validation of commercially available software is not necessary because such software has already been thoroughly validated. The agency disagreed and indicated that commercial availability is no guarantee of “thorough validation.” The need of validation of such software is not diminished by the fact that it was not written by prospective users. Many comments objected to the requirement that FDA should be provided with electronic copies of electronic records for inspection and proposed to provide FDA with readable paper copies. The agency disagreed and stressed that FDA should be able to conduct audits efficiently and thoroughly using the same technology. In 2003, FDA published nonbinding recommendation presenting the current thinking regarding the scope and application of 21 CFR Part 11 [11]. This document was intended as a guidance, which should be viewed only as recommendation, unless specific regulatory requirements are cited. The reason of the guidance was the concern, raised by a number or users, who saw the 21 CFR Part 11 requirements as unnecessarily restrictive, causing excessive costs, and discouraging innovation and technological advances. As a result of these concerns, the agency decided to review the Part 11 documents in anticipation to revise provisions of that regulation. It was announced that a new, revised Part 11 would be released in 2006. This, however, did not happen until now. The FDA representative stated publicly that the timetable for release is “flexible” [14]. Therefore, Part 11 remains in effect until reexamined. The recommendation of 2003 stressed that Part 11 rule is applicable only if the records in electronic format are used in place of paper format. On the other hand, when persons used computers to generate paper printouts of electronic records, and those paper records meet all requirements of the applicable predicate rules, the use of computer systems in the generation of paper records would not trigger Part 11. FDA defines electronic records as such, which are maintained in electronic format in place of paper format. On the other hand, records or signatures that are not required to be retained electronically, but are nonetheless maintained in electronic format, are not Part 11 records. The decision, whether specific records are Part 11 records, was left to the user, who should document such decision. 8.2.2.4  Quality Assurance of Waived Tests and Diagnostic Devices In the CLIA 88, waived tests were defined as test system, assay, or examination that HHS has determined meets the CLIA criteria as specified for waiver [1]. © 2011 by Taylor and Francis Group, LLC

236

Quality Assurance in the Pathology Laboratory

Waived tests should meet specific criteria as follows: • Should be cleared by FDA for home use • Should employ methodologies so simple and accurate as to render the likelihood of erroneous results negligible • Pose no reasonable risk of harm if the test is performed incorrectly The examples of such tests are dipstick or tablet reagent for urinalysis, urine pregnancy test, blood glucose monitoring devices, among others. Since the secretary of HSS has delegated to FDA the authority to determine whether particular tests are “simple” and have “an insignificant risk of an erroneous result,” FDA issued in 2008 recommendations for manufacturers of in vitro diagnostic devices, which submit waiver applications to this agency [12]. The following components were recommended to include in a CLIA waiver application: • A description of device that demonstrates it is simple to use • The results of risk analysis including the identification of potential sources of error for the device • The results of studies demonstrating insensitivity of the test system to environmental and usage variations under conditions of stress • The results of risk evaluation and control including a description of measures implemented to mitigate the risk of errors, and validation and/or verification studies demonstrating the ability of failure alert, fail-safe mechanisms, and other control measures incorporated into device to mitigate the risk of errors, even under conditions of stress • A description of the design and results of clinical studies conducted to demonstrate that the device has an insignificant risk of erroneous result in the hands of the intended user • Proposed labeling with instructions for use consistent with a device that is “simple” FDA defined following characteristics of a “simple test”: Is a fully automated instrument or a unitized or self-contained test; uses direct unprocessed specimens, such as capillary blood (fingerstick), venous whole blood, nasal swabs, throat swabs, or urine; needs only basic, non-technique-dependent specimen manipulation, including any for decontamination; needs only basic, non-technique-dependent reagent manipulation, such as “mix reagent A and reagent B”; needs no operator intervention during the analysis steps; needs no technical or specialized training with respect to troubleshooting or interpretation of multiple or complex error codes; needs no electronic or mechanical maintenance beyond simple tasks, e.g., changing a battery or © 2011 by Taylor and Francis Group, LLC

Role of Governmental and Professional Organizations

237

power cord; produces results that require no operator calibration, interpretation, or calculation; produces results that are easy to determine, such as “positive” or “negative,” a direct readout of numerical values, the clear presence or absence of a line, or obvious color gradations; provides instructions in the package insert for obtaining and shipping specimens for confirmation testing in cases where such testing is clinically advisable. A “simple test” should not have the following characteristics: • Sample manipulation is required to perform the assay. Sample manipulation includes processes such as centrifugation, complex mixing steps, or evaluation of the sample by the operator for conditions such as hemolysis or lipemia. For this reason, tests that use plasma or serum are not considered simple. • Measurement of an analyte could be affected by conditions such as sample turbidity or cell lysis. • Meets the qualifications to perform moderate- or high-complexity testing. Besides demonstration of simplicity, the waiver application should demonstrate insignificant risk of an erroneous result. Generally, the risk of an erroneous result should be far less for waived tests than nonwaived tests. It should be demonstrated in CLIA waiver application that the test system design is robust, e.g., insensitive to environmental and usage variation, and that all known sources of error are effectively controlled. Most risk control measures should be fail-safe measures or failure alert mechanisms. Whenever feasible, external control materials should be included in the test kit. External control materials for waived tests should be ready to use or employ only very simple preparation steps, e.g., breaking a vial in order to mix liquid and dry components of the control material. Reconstitution steps should not require pipetting by the user. For both quantitative and qualitative tests, the levels of the control materials should correspond to the medical decision level(s) relevant to the indications for use for the test. The waived test should deliver accurate results, i.e., comparable to tests whose results of measurements are traceable to designated references of higher order, usually national or international standards. The clinical studies to support CLIA waiver should compare results obtained with the device proposed for CLIA waiver to results obtained by a comparative method, performed in a laboratory setting by laboratory professionals. According to Rauch and Nichols [15], the use of waived tests creates serious concern from the quality point of view. There is an increasing fraction of laboratories offering only waived tests, usually as physician office laboratories. These facilities are only occasionally subject to random control. Such random inspections performed in eight states have found numerous © 2011 by Taylor and Francis Group, LLC

238

Quality Assurance in the Pathology Laboratory

deficiencies, like laboratory did not have or follow manufacturer’s instructions, the maintenance or function checks were not performed, expired reagents were used, testing personnel were not trained or evaluated, and sometimes the lab performed testing beyond its certificate level. In conclusion, it was stated that the labs performing waived tests should be subject to routine regulatory oversight. 8.2.3╇Regulation Issued by Substance Abuse and Mental Health Administration Workplace drug testing (WDT) is a complex, multifaceted procedure of great social importance. It was established to achieve certain benefits and to fulfill legal obligations as well. The expected benefits of WDT are decreased absenteeism, improved safety, enhanced professional efficiency, lower workplace costs, and increased public trust. Drug testing was also organized in order to comply with national regulations, with contract or insurance carrier requirements, or to establish ground for discipline firing of the employee. However, WDT brings also some intrinsic dangers, like creating an inquisitive and invigilatory atmosphere in the workplace, stigmatization and mobbing in the case of unconfirmed publicized positive test result, or even ruining somebody’s private life and professional career in the case of false positive result. For this reason, all aspects of WDT have to be subjected to very strict QA and QC. The legal history of WDT in United States begun in 1986, when President Reagan issued Executive Order 12564, establishing the goal for a drug-free federal workplace [16]. In this document, it has been stated that The Federal government, as the largest employer in the Nation, can and should show the way towards achieving drug-free workplaces through a program designed to offer drug users a helping hand and, at the same time, demonstrating to drug users and potential drug users that drugs will not be tolerated in the Federal workplace.

The use of illegal drugs, on or off duty, by Federal employees was inconsistent not only with the law-abiding behavior expected of all citizens but also with the special trust placed in such employees as servants of the public: Further, the order stated that drug consumers tend to be less productive, less reliable, and prone to greater absenteeism than their fellow employees who do not use illegal drugs. The use of illegal drugs, on or off duty, by Federal employees also can pose a serious health and safety threat to members of the public and to other employees, and may pose a serious risk to national security, the public safety, and the effective enforcement of the law. The head of each executive agency was obliged to establish a program to mandatory test for the use of illegal drugs by employees in sensitive positions as well as a program for voluntary employee drug testing. In addition, the head of each executive © 2011 by Taylor and Francis Group, LLC

Role of Governmental and Professional Organizations

239

agency was authorized to test an employee for illegal drug use in the case of reasonable suspicion of drug use, or other defined circumstances. In response to the executive order, HHS, acting through responsible agency Substance Abuse and Mental Health Services Administration (SAMSHA), issued in 1988 first mandatory guidelines for federal workplace drug testing programs. These guidelines were revised in 1994, 1997, and in 2004. In the last document, not only the guidelines but also several revisions were proposed, concerning expanding of the specimen list and drug list as well [17]. In November 2008, SAMSHA announced final revisions, taking into account proposals formulated in 2004 guidelines [18]. The whole procedure of WDT, as presented in the guidelines, was divided into several sections: • General: Applicability, definitions, future revisions • Scientific and technical requirements (specimen collection, laboratory personnel, procedures, QA and QC, reporting, protection of records) • Certification of laboratories engaged in urine drug testing for federal agencies • Procedures for review of suspension of proposed revocation of a certified laboratory The most relevant aspects of WDT will be presented below. 8.2.3.1  Specimen Kind and Collection Under the term “specimen” or “sample,” only urine specimens are defined as suitable for drug testing. In the proposed revisions to mandatory guidelines [17], HHS proposed to establish scientific and technical guidelines for the testing of hair, sweat, and oral fluid specimens in addition to urine specimens. Detailed technical procedures concerning sampling, validity, and cutoff levels in all specimens were formulated. However, in the final revision, announced November 24, 2008 [18], HHS took a more cautious approach than the 2004 proposals, regarding the use of alternative specimens. It was stated that further study and analysis is needed before the addition of alternative specimens to the WDT program. The collection procedure is under the responsibility of collector—a trained individual, who instructs and assists a donor and receives the urine specimen. Training documentation of the collector must be maintained for a minimum of 2 years. The collector must not have any personal or direct professional relationship with the donor. The collection site must be secure to prevent unauthorized access to specimens, supplies, and records. The entire WDT collection procedure must be done using chain of custody, which starts at the collection site. This is © 2011 by Taylor and Francis Group, LLC

240

Quality Assurance in the Pathology Laboratory

documented using the custody and control form. This form consists of five pages, designated for the laboratory, medical review officer (MRO), collector, employer, and for the donor, and must be duly filled throughout the whole procedure. The collection procedure begins with the unequivocal verification of donor identity, followed by urine specimen collection to an appropriate container. The specimen volume should be at least 30â•›mL for a single specimen or 45â•›mL for a split specimen, and the temperature, measured within 4â•›min after collection, should be in the range 32°C–38°C/90°F–100°F. Visual inspection of the specimen should not reveal any signs of adulteration (unusual color or odor, excessive foaming). The container should be sealed in the presence of the donor, who has to sign appropriate form together with the collector. The specimen must be submitted to the laboratory not later than 24â•›h after the collection. Any irregularities occurring during the collection procedure should be documented. 8.2.3.2  Analytical Aspects of WDT The President’s Executive Order 12564 [16] defines “illegal drugs” as those included in Schedule I or II of the Controlled Substances Act. Since the schedules cover hundreds of drugs, it is not feasible to test every urine specimen routinely for all of them. The guidelines stated that in applicant testing and random testing at a minimum, urine specimens should be tested for marijuana and cocaine. The test panel may be extended to screening for opiates, amphetamines, and phencyclidine. In the case of reasonable suspicion of drug use, post accident, or unsafe practice testing, the presence of any drug listed in Schedule I or II may be tested. The entire analysis is divided into two steps: Initial drug test and confirmatory drug test. The latter test is applied for specimens identified as positive in the former test. The initial test shall use an immunoassay that meets the requirements of the FDA for commercial distribution. Initial testing shall be performed at permanent location, meet forensic standards, participate in proficiency testing and QA programs, and be subject to site inspection. Confirmatory test must use combined chromatographic separation with mass spectrometric identification, like GC/MS, GC/MS/MS, LC/MS, or LC/MS/MS. The initial testing is divided into two parts: Drug testing and specimen validity testing. The initial cutoff concentrations are shown on Table 8.5. It should be noted that in the entire text of the guidelines the term “Marijuana” or “Marijuana Metabolite” is used. This is hardly correct; marijuana is one of the known preparations of Cannabis sativa plant (together with hashish and hashish oil), cannot metabolize, and cannot be directly detected in urine. More correct term should be “Cannabis-related compounds” (for initial test) and “THC and metabolites” (for confirmatory test). Apart from initial drug testing, the validity testing of urine specimen shall be performed. This © 2011 by Taylor and Francis Group, LLC

Role of Governmental and Professional Organizations

241

Table 8.5â•…SAMSHA—Initial Urine Test Cutoff Levels Drug

Concentration (ng/mL)

Marijuana metabolites Cocaine metabolites Opiate metabolites Phencyclidine Amphetamines MDMA

50 300 2000 25 1000 500

Table 8.6â•…SAMSHA—Criteria of Urine Specimen Validity Adulteration

Substitution

Dilution

pHâ•›>â•›11 orâ•›<â•›3

Creatinineâ•›<â•›20â•›mg/L

NO2â•›≥â•›500â•›mg/L

Spec. gravityâ•›≤â•›1.0010

20â•›mg/Lâ•›≤â•›creatinineâ•›< 200â•›mg/L 1.0010â•›≤â•›spec. gravityâ•›<â•›1.0030

Cr (VI)â•›≥â•›50â•›mg/L Halogenâ•›≥â•›200â•›mg/L of NO2-equivalent Glutaraldehyde Pyridineâ•›≥â•›200â•›mg/L of NO2-equivalent Surfactantâ•›≥â•›100â•›mg/L of DDBS-equivalent

comprises testing for adulteration, substitution, or dilution. Table 8.6 shows criteria for positive results in these tests. In the case of positive result of the initial test, the confirmatory test should be performed, using defined cutoff concentrations (Table 8.7). A specimen that was reported either drug-positive, adulterated, substituted, or as an invalid should be retained and kept in frozen state for a minimum of 1 year. Table 8.8 shows proposed confirmatory cutoff levels for drugs detected in alternative specimens (hair, sweat, oral fluid). These proposals, however, are still pending further experience and study. 8.2.3.3  Quality Assurance Aspects of WDT The guidelines stated that urine drug testing is a critical component of efforts to combat drug abuse in the society. Many laboratories, although familiar with good laboratory practices, may be unfamiliar with the special procedures required when drug test results are used in employment context. For this reason, the minimum standards were defined to certify laboratories © 2011 by Taylor and Francis Group, LLC

242

Quality Assurance in the Pathology Laboratory Table 8.7â•…SAMSHA—Confirmatory Urine Test Cutoff Levels Drug

Concentration (ng/mL)

Marijuana metabolite Cocaine metabolite Morphine Codeine 6-Acetylmorphine Phencyclidine Amphetamine Methamphetamine MDMA MDA MDEA

15 150 2000 2000 10 25 250 250 250 250 250

Table 8.8â•…SAMSHA—Confirmatory Drug Test Cutoff Levels in Proposed Alternative Specimens Drug Marijuana metabolite Cocaine Cocaine metabolite Morphine Codeine 6-Acetylmorphine Phencyclidine Amphetamine Methamphetamine MDMA MDA MDEA

Hair (pg/mg)

Sweat (ng/patch)

Oral Fluid (ng/mL)

0.05 500 50 200 200 200 300 300 300 300 300 300

THC 1 25

THC 2 8 8 40 40 4 10 50 50 50 50 50

25 25 25 20 25 25 25 25 25

engaged in WDT for federal agencies. Each laboratory must be certified by HHS according to the procedure described in the guidelines. This procedure includes initial inspection, three cycles of performance-testing samples, and second inspection within 3 months after certification. Certified laboratories are required to analyze quarterly performance testing samples and are subjected to periodic inspections. The list of HHS-certified laboratories has been regularly published. The recent list contains 41 laboratories and was published in 2008 [19]. Accreditation standards concern various aspects of WDT, like human resources (qualification of MRO and laboratory personnel), QA and QC, logistic and administrative problems (security and chain of custody, storage © 2011 by Taylor and Francis Group, LLC

Role of Governmental and Professional Organizations

243

of positive, adulterated, substituted, or invalid specimens, documentation, and reporting). In the case of human resources, the key persons are laboratory director and MRO. Laboratory director shall have documented qualifications in forensic or clinical analytical toxicology, PhD title, or comparable training and experience in analytical toxicology and its forensic applications (e.g., scientific publications, court testimony, and research concerning drugs of abuse). He is also responsible for ensuring that there are enough personnel with adequate training and experience to supervise and conduct the whole drug testing. MRO shall be a licensed physician, with knowledge and clinical experience in controlled substance-abuse disorders, detailed knowledge of alternative explanations for laboratory positive test results, as well as knowledge about adulteration and substitution of specimens. MRO shall not have any financial interest in the laboratory for which the MRO is reviewing the results of drug testing or shall not be an employee or agent of such laboratory. Any possible conflict of interest must be excluded. Drug testing laboratories shall have QA program that encompasses all aspects of testing, like chain of custody, performance characteristics of initial and confirmatory testing procedures, certification of calibrators and controls, security, and reporting of results. Moreover, the guidelines defined in detail QC requirements for initial drug testing and specimen validity testing. 8.2.4╇Guidelines on Good Clinical Laboratory Practice Issued by National Institutes of Health The good clinical laboratory practices (GCLP), developed by National Institutes of Health (NIH)) embraces both the research and the clinical aspects of GLP. Before development of GCLP, non-clinical, research quality standards were regulated by GLP principles as published in 21 CFR part 58 [20], whereas the quality of clinical laboratory was regulated by 42 CFR part 493 (CLIA 88) [1]. The GCLP standards combined the guidance from regulatory authorities as well as other organizations and accrediting bodies, such as the CAP or ISO 15189. The British Association of Research Quality Assurance (BARQA) took a similar approach by combining good clinical practice (GCP) and GLP in 2003 [21]. The GCLP standards were developed with the objective of providing a single, unified document that encompasses sponsor requirements to guide the conduct of laboratory testing for human clinical trials. It is critical that all of the key GCLP elements are in place and operational. These elements include organization and personnel, testing facilities, appropriately validated assays, relevant positive and negative controls for the assays, a system for recording, reporting and archiving data, a safety program tailored to personnel working in the laboratory, an © 2011 by Taylor and Francis Group, LLC

244

Quality Assurance in the Pathology Laboratory

information management system that encompasses specimen receipt and acceptance, storage, retrieval and shipping, and an overall quality management plan. The compliance with GCLP standards should ensure the generation of consistent, reproducible, and comparable results of clinical trials done at multiple sites. The most appropriate way to ensure compliance with GCLP guidance is to audit laboratories. The principles of GCLP were presented recently by Ezzelle et al. [22]. A comprehensive presentation of GCLP standards and examples of application may be found at the NIH site [23]. Most important aspects of GCLP will be presented below. 8.2.4.1  Standards for Organization and Personnel All personnel must be trained for the performance of all duties and tasks that they perform. After completion of initial training, competency must be assessed and recorded for all components of the employee’s training. An adequate clinical laboratory continuing education program must be documented, and evidence of adherence by all laboratory personnel must be readily available. A testing laboratory must have the following documents stored in the laboratory or readily available for authorized personnel: organizational, departmental, and/or personnel policies that address such topics as orientation, training, continuing education requirements, performance evaluations, benefits, discipline, dress codes, holidays, security, communication, termination, and attendance; job descriptions that define qualifications and delegation of duties for all laboratory positions; personnel files that document each employee’s qualifications, training, and competency assessments as they relate to job performance and the organizational chart(s) that represent the formal reporting and communication relationships that exist among personnel and management and between the main laboratory unit and satellite units. This documentation should be based on standards formulated in CLIA 88. The laboratory director must designate staff that has overall responsibility for the study and serves as the single point-of-contact for document control, staff training, and familiarity with GCLP. All laboratory personnel must receive direct and detailed job-specific training and continuing education to perform all duties so that they understand and competently carry out the necessary functions Additionally, competency assessments must be conducted every 6 months during the first year of employment and annually thereafter. Annual evaluations for the employee’s overall performance of job responsibilities, duties, and tasks as outlined in the job description must be given to all laboratory personnel. The laboratory must employ an adequate number of qualified personnel to perform all of the functions associated with the volume and complexity of tasks and testing performed within the laboratory. All these requirements conform to CLIA 88 standards and/or CAP standards. © 2011 by Taylor and Francis Group, LLC

Role of Governmental and Professional Organizations

245

8.2.4.2  Standards for Laboratory Equipment These standards are also based on CLIA 88 and/or CAP requirements. Laboratory staff must conduct preventive maintenance and service as per manufacturer specifications by following documented daily, weekly, and/or monthly routine maintenance plans for all equipment utilized to ensure that all equipment performs consistently and reproducibly during the conduct of the trial. All scheduled and unscheduled maintenance, service records, and calibrations must be documented for all equipment utilized. This documentation should be readily accessible to operators. As a follow-up step, the laboratory director or designee must consistently review, sign, and date all documentation at least monthly to establish an audit trail. The laboratory must establish tolerance limits for equipment temperatures and other monitored conditions that are consistent with manufacturers’ guidelines and procedural activities because certain reagents and equipment perform optimally under specific conditions. The lab should also maintain daily records of temperatures and other monitored conditions (e.g., humidity). For observations that fall outside of designated tolerance ranges, the laboratory must maintain appropriate documentation of corrective action for these out-of-range temperatures and other conditions. 8.2.4.3  Standards for Test Facility Operation The laboratory must write standard operation SOPs for all laboratory activities to ensure the consistency, quality, and integrity of the generated data. The laboratory must write these SOPs in a manner and language that is appropriate to the laboratory personnel conducting the procedures. SOPs should also be written in a standard format, such as the format recommended GP02-A5 by the Clinical and Laboratory Standards Institute (CLSI) (http://www.clsi. org). Current SOPs must be readily available in the work areas and accessible to testing personnel. All laboratory personnel must document and maintain verification that they have reviewed and understood all relevant SOPs so that there is evidence that all personnel are knowledgeable of appropriate laboratory SOPs. The laboratory must maintain a written current document control plan that addresses and ensures the following vital elements of SOPs: a master list of SOPs currently used in the laboratory; an authorization process that is standard and consistent, limiting SOP approvals to laboratory management; assurance that all SOPs are procedurally accurate and relevant, as well as review of each SOP at appropriate time intervals; removal of retired or obsolete SOPs from circulation and identification of them as retired or obsolete; and an archival system that allows for maintenance of retired or obsolete SOPs for a period defined by the laboratory that meets or exceeds the requirements of applicable regulatory bodies, such as the U.S. FDA, formulated in CLIA 88. © 2011 by Taylor and Francis Group, LLC

246

Quality Assurance in the Pathology Laboratory

8.2.4.4  Quality Control Program The laboratory director or designee should be actively involved in the design, implementation, and oversight of a site-specific, written QC program that defines procedures for monitoring analytic performance and consistent identification, documentation, and resolution of QC issues, according to CLIA 88 requirements. The program should be able to detect immediate errors as well as changes that occur over time and hence assure the accuracy and reliability of test results. The number and frequency of QC tests must be determined, as well as the appropriate QC materials to use. The QC program supports functions in the following areas: test standards and controls, reagents, test specimens, review of QC data, QC logs, labeling of QC materials and reagents, inventory control, parallel testing, and water quality testing. Each of these areas must be carefully monitored and documented. 8.2.4.5  Standards for Verification of Performance Specification The laboratory must verify and document optimal performance of nonwaived CLIA tests used to acquire study-participant results following predefined specifications that are equivalent to the ones provided by the manufacturer. The definition of the normal range must include specifications for the analytical measurement range (AMR) and the clinically reportable range (CRR) of each test used. The laboratory must also include a correction factor for each test to account for systematic errors that occur between tests. The inclusion of correction factors ensures data comparability when multiple tests are conducted to measure the same analyte in support of study-participant results. Before reporting study-participant results, each laboratory that introduces a nonwaived (a CLIA designation) test, must demonstrate performance specifications comparable to those established by the manufacturer to ensure the assay is performing optimally within the proposed testing environment. Documentation of experiment results and approval should be readily accessible. Methods that are defined as waived by CLIA do not require method validation, unless otherwise instructed by the sponsor. Verification and documentation of normal responses for each test system including the AMR and CRR and normal range(s) must be established to determine the usable and reliable range of results produced by that system. For FDA-cleared/approved tests, analytical sensitivity documentation may consist of data from manufacturers or the published literature. If non-FDA approved methods are utilized, the laboratory must define, test, and document the parameters described in the bioanalytical method validation guidelines provided for the industry by the FDA (2) to validate a bioanalytical assay. These include accuracy, precision, analytical sensitivity, analytical specificity, reportable range, reference intervals, and any other parameter required for test performance. If the test system to be validated is an unmodified, FDA-approved method, © 2011 by Taylor and Francis Group, LLC

Role of Governmental and Professional Organizations

247

the manufacturer’s reference range may be verified for the appropriate testing population. If the test is modified, or not FDA-approved, the reference range must be established. The reference range must be established or verified for each analyte and specimen source/type when appropriate. The laboratory may use the manufacturer’s reference range when appropriate specimens are difficult to obtain (e.g., 24â•›h urine specimens, 72â•›h stool specimens, urine toxicology specimens), provided the range is appropriate for the laboratory’s study participant population. In cases where the appropriate specimens are difficult to obtain and the manufacturer has not provided reference ranges appropriate for the laboratory’s study participant population, the laboratory may use published reference range(s). An appropriate number of specimens must be evaluated to verify the manufacturer’s claims for normal values or, as applicable, the published reference ranges. Typically, 20 specimens are required to verify the manufacturer’s or published ranges. These specimens should be appropriately collected from patients that have been predetermined as “normal” by established inclusion /exclusion criteria (e.g., HIV-negative, HBsAg-negative). The specimens should be representative of the population (age, gender, genetics, geographic area, etc.). An appropriate number of specimens must be evaluated to establish reference ranges. Typically, the minimum number of specimens required to establish reference ranges is 120 specimens per demographic group (e.g., if the laboratory wishes to establish gender-specific reference ranges, then the minimum number of specimens would be 240: 120 normal male and 120 normal female). Reference intervals must be evaluated at the following times: upon introduction of a new analyte to the test offerings by a laboratory, with a change of analytic methodology, or with a change in study-participant population. 8.2.4.6  Standards for Records and Reports The laboratory must define and maintain a system to provide and retain all clinical trial data records and reports for a period of time to troubleshoot potential problems, or if it is necessary to reconstruct the study for auditing purposes. These records may include specimen tracking forms, laboratory requisitions, chain-of-custody documents, laboratory reports, equipment service and maintenance records, and instrument printouts. Adequate manual or electronic systems must be in place to ensure assay results and other study participant-specific data (e.g., participant identifier) are accurately and reliably sent from the point of data entry to the final report destination in an accurate and timely manner, or according to specifications detailed within protocols and/or the study/analytical plan. Assay results must be released only to authorized persons. The laboratory director must define alert or critical values in consultation with study-related clinicians. Complete procedures must be in place for immediate notification of key study personnel/responsible clinic staff when assay results fall within established alert or © 2011 by Taylor and Francis Group, LLC

248

Quality Assurance in the Pathology Laboratory

critical ranges. The laboratory must, upon request, make available a list of test assays employed by the laboratory and, as applicable, the performance specifications established or verified. When the laboratory cannot report study-participant test results within the time frames established by the laboratory, the laboratory must notify the appropriate individual(s) of the delays. The laboratory referring study-participant specimens for testing to another laboratory must not revise results or information directly related to the interpretation of results provided by the testing laboratory and must retain the testing laboratory’s report for the period of time defined by the laboratory. Reports generated by the laboratory information system (LIS), and those created by other means, must be concise, readable, standardized in format, and chronological. The laboratory’s test report must indicate the following items: either the study participant’s name and/or a unique identifier; the name and address of the laboratory location where the assay was performed; the date and time of specimen receipt into the laboratory; the assay report date; the name of the test performed; specimen source (e.g., blood, cerebrospinal fluid, and urine); the assay result and, if applicable, the units of measurement or interpretation or both; reference ranges along with age and gender of study participants, if these affect the reference range; any information regarding the condition and disposition of specimens that do not meet the laboratory’s criteria for acceptability; and the records and dates of all assays performed. The laboratory must promptly notify the appropriate clinician and/or clinic staff member if an erroneous result is reported and then corrected as decisions about the clinical trial product and patient/study-participant management depend on these data. It is important to replicate all of the previous information (test results, interpretations, reference intervals) for comparison with the revised information and to clearly indicate that the result has been corrected. Additionally, the laboratory must have a system that identifies the analyst performing and completing the test result modification, along with the date and time. A log or other appropriate record must be kept for result modifications. The laboratory director or designee must review, sign, and date the result modifications/corrective action logs at least monthly. The laboratory must maintain copies of the original report as well as the corrected report. Proper error correction techniques (e.g., single line through error, signature, and date, or electronic equivalent) must be utilized at all times by the laboratory. The laboratory must safely and securely retain all clinical trial data records and reports for a period of time that has been defined by the laboratory to be able to fully reconstruct the study, if necessary. Retention time periods established by the laboratory must meet or exceed the requirements set forth by the product sponsor and/or any applicable regulatory bodies such as the FDA. The laboratory may archive test reports or records either © 2011 by Taylor and Francis Group, LLC

Role of Governmental and Professional Organizations

249

on- or off-site. Stored data and archival information must be easily and readily retrievable within a time frame consistent with study/trial needs (e.g., within 24â•›h). 8.2.4.7  Standards for Physical Facilities The environment in which laboratory testing is performed must not compromise the safety of the staff or the quality of the pre-analytical, analytical, and post-analytical processes. The laboratory design must assure proper equipment placement, ventilation, reagent storage as well as archiving of data in a secure fire-proof, fire-resistant, or fire-protected environment with access to only authorized personnel. Laboratory work areas must have sufficient space so that there is no hindrance to the work or employee safety. Laboratory room temperature and humidity must be controlled so that equipment and testing is maintained within the tolerance limits set forth by the manufacturer. Ambient temperature logs should be utilized to document the acceptable temperature range, record daily actual temperatures, and allow for documentation of corrective action taken should the acceptable temperature ranges be exceeded. All floors, walls, ceilings, and benchtops of the laboratory must be clean and well maintained. Molecular amplification procedures within the laboratory that are not contained in closed systems must have a unidirectional workflow. This must include separate areas for specimen preparation, amplification, detection, and as applicable, reagent preparation to avoid contamination and mix-ups between test and control articles. 8.2.4.8  Standards for Specimen Transport and Management The laboratory must have documented procedures for collection, transportation, and receipt of specimens because the accuracy of all laboratory tests is dependent on specimen quality. A laboratory can only ensure specimen integrity when following appropriate specimen management and transportation procedures. A properly completed request form must accompany each study-participant sample to the laboratory. The request form must document unique study-participant identifiers, specimen collection date and time, study-participant demographics, specimen type, and the collector’s identity. The specimen inspection process must involve verification of the specimen container label information with the request form or log sheet. Any discrepant or missing information must be verified promptly, before specimens are processed or stored by laboratory personnel. The laboratory must have documented specimen acceptance/rejection criteria for evaluation of sample adequacy and integrity. The laboratory must maintain a documented audit trail for every specimen from collection to disposal or storage. A shipping © 2011 by Taylor and Francis Group, LLC

250

Quality Assurance in the Pathology Laboratory

procedure must be documented, which addresses preparing shipments by following all federal and local transportation of dangerous goods regulations by laboratory personnel who are certified in hazardous materials/dangerous goods transportation safety regulations. Twenty-four-hour monitoring of storage conditions (using personnel and/or electronic monitoring with alert systems) and SOPs for response to alerts must be in place to ensure the integrity of samples is maintained. 8.2.4.9  Standards for Personnel Safety Safety policies defined according to regulatory organizations such as the Occupational Safety and Health Administration or the ISO 15189 must be present in the laboratory. The following safety policies must be in place to ensure the safety of laboratory staff and any authorized individuals: standard precautions/universal precautions policy, chemical hygiene/hazard communication plan, waste management policy, safety equipment, and general safety policies (these policies address less specific topics as they relate to laboratory safety, such as fire and back safety). Fire extinguishers, emergency shower, eyewash, and sharp containers must be present in each laboratory, in compliance with general safety/ local laws. Periodic inspection and/or function checks of applicable safety equipment must be documented. The employer must assess the workplace to determine if hazards are likely to be present, which necessitate the use of personal protective equipment (PPE) and provide access to PPE to all laboratory staff at risk. All laboratory employees must use PPE if there is a potential for exposure to blood or other potentially infectious material through any route (e.g., skin, eyes, other mucous membranes). The laboratory must have material safety data sheets or equivalent in the workplace for each hazardous chemical that they use. All laboratory staff must receive safety training. At a minimum, the safety training must include: Blood-borne pathogens, PPE, chemical hygiene/hazard communications, use of safety equipment in the laboratory, use of cryogenic chemicals (e.g., dry ice and liquid nitrogen), transportation of potentially infectious material, waste management/biohazard containment, and general safety/local laws related to safety. Safety training must be documented and maintained. Safety training must be completed before any employee begins working in the laboratory and on a regular basis thereafter. Ongoing safety training must take place each calendar year. Documentation of this training must be signed and dated by the employee. 8.2.4.10  Standards for Laboratory Information System The purpose of an LIS, the way it functions, and its interaction with other devices or programs must be documented with validation data and results including data entry, data transmission, calculations, storage, and retrieval © 2011 by Taylor and Francis Group, LLC

Role of Governmental and Professional Organizations

251

according to 21 CFR Part 11 (10). Since patient management decisions and product advancement decisions are based on laboratory data, appropriate steps must exist to ensure data quality and integrity through documentation. Both abnormal and normal data must be used to test the system. Any changes or modifications to the system must be documented, and the laboratory director or designee must approve all changes before they are released for use. Computer time-stamped audit trails must be used by the LIS. The laboratory’s LIS policies must ensure that LIS access is limited to authorized individuals. The laboratory must maintain a written SOP for the operation of the LIS and should be appropriate and specific to the day-to-day activities of the laboratory staff as well as the daily operations of the information technology (IT) staff. Documentation must be maintained indicating that all users of the computer system receive adequate training both initially and after system modification. Documented procedures and a disaster preparedness plan must exist for the preservation of data and equipment in case of an unexpected destructive event (e.g., fire and flood) or software failure and/or hardware failure, allowing for the timely restoration of service. 8.2.4.11  Standards for Quality Management The laboratory must have a documented quality management (QM) program designed to monitor, assess, and correct problems identified in pre-analytic, analytic, and post-analytic systems, as well as overall laboratory scope. The QM program is a systematic approach to plan the achievement of quality objectives, comply with approved procedures, and assign specific functional responsibilities to laboratory staff. A key component of the QM program is the quality assurance unit (QAU). The QAU must monitor for GCLP compliance, oversee the development of the QM program, resolve quality-related problems, submit status reports to management, and prepare and respond to external audits. The laboratory must provide evidence of implementation and appraisal of the QM program. The QM program documentation must be reviewed at least annually by the laboratory director or designee(s). The laboratory should enroll in external quality assurance (EQA) programs that cover all study protocol analytes. The laboratory’s QM program must include results of ongoing measurement activities of key indicators of quality of laboratory operations compared with internal or external benchmarks and trended over time. The laboratory must be able to use the QM program for guidance when conducting annual appraisals of effectiveness and must provide evidence of its implementation. The laboratory’s monitoring of the QM program must include an internal auditing program. Internal audits involve an individual or a group of laboratory personnel performing a self-assessment comprised of a comparison of the actual practices within the laboratory against the laboratory’s policies and procedures (e.g., personnel files, training documentation, QC © 2011 by Taylor and Francis Group, LLC

252

Quality Assurance in the Pathology Laboratory

performance, review of SOPs). These audits may also compare the laboratory’s practices against a standard set of guidelines or standards. All findings (compliance, noncompliance, or deficiencies) that result from the internal audit should be documented in an organized format to allow for appropriate corrective actions and follow-up through resolutions. The laboratory must have a list of assay turnaround times readily available to all laboratory staff as well as laboratory customers. The QM program should also include an EQA program that is set up to externally evaluate the laboratory’s analytical performance by comparing performance with peer laboratories. EQA programs serve three purposes: (1) to provide an internal measurement tool for ensuring that the information a laboratory generates and provides is accurate, timely, clinically appropriate, and useful; (2) to provide the sponsoring and regulatory agencies with confidence that individual laboratories are generating data with a rigor that will support product licensure; and (3) to ensure that clinical trial volunteer specimens will be analyzed in a system that provides accurate and reliable information to ensure trial volunteer safety. This external evaluation of the laboratory’s analytical performance is vital to ensure a complete QA of laboratory operations. The laboratory director or designee must review all external QA data and evidence of supervisory review of EQA program results must be available. EQA specimens must be analyzed, quality assured, and reported just as study-participant specimens are tested in the laboratory. 8.2.5╇Recommendations of the National Research Council Concerning U.S. Forensic Sciences Community: Creation of the National Institute of Forensic Science In November 2005, the U.S. Congress issued Science, State, Justice, Commerce, and Related Agencies Appropriations Act of 2006, which authorized “the National Academy of Sciences (NAS) to conduct a study on forensic science, as described in the Senate report.” In the fall of 2006, a committee was established by the NAS to implement this congressional charge. Operating under the project title “Identifying the Needs of the Forensic Science Community,” the committee covered numerous issues, like the fundamentals of the scientific method as applied to forensic practice; the assessment of forensic methods and technologies; infrastructure and needs for basic research and technology assessment in forensic science; current training and education in forensic science; the structure and operation of forensic science laboratories; the structure and operation of the coroner and medical examiner systems; budget, future needs, and priorities of the forensic science community and the coroner and medical examiner systems; the accreditation, certification, and licensing of forensic science operations, medical death investigation systems, and scientists, among others. As a result of this scrutiny, the committee identified © 2011 by Taylor and Francis Group, LLC

Role of Governmental and Professional Organizations

253

several alarmingly weak points in the status of forensic disciplines. These findings were summarized in recommendations, which are listed as follows. The committee stated that: The forensic science disciplines currently are an assortment of methods and practices used in both the public and private arenas. Forensic science facilities exhibit wide variability in capacity, oversight, staffing, certification, and accreditation across federal and state jurisdictions. Too often they have inadequate educational programs, and they typically lack mandatory and enforceable standards, founded on rigorous research and testing, certification requirements, and accreditation programs. Additionally, forensic science and forensic pathology research, education, and training lack strong ties to our research universities and national science assets.

Additionally, the human resources were subjected to strong criticism: The forensic science enterprise also is hindered by its extreme disaggregation—marked by multiple types of practitioners with different levels of education and training and different professional cultures and standards for performance and a reliance on apprentice-type training and a guild-like structure of disciplines, which work against the goal of a single forensic science profession. Many forensic scientists are given scant opportunity for professional activities, such as attending conferences or publishing their research, which could help strengthen the professional community and offset some of the disaggregation. The fragmented nature of the enterprise raises the worrisome prospect that the quality of evidence presented in court, and its interpretation, can vary unpredictably according to jurisdiction

The following recommendations were formulated by the NAS committee and published as a book [24]: 1. The committee felt that none of currently existing federal agencies can address all needs of the forensic science communities. Therefore, Congress should establish and appropriate funds for an independent federal entity, the National Institute of Forensic Science (NIFS). NIFS should have a full-time administrator and an advisory board with expertise in research and education, the forensic science disciplines, physical and life sciences, forensic pathology, engineering, IT, measurements and standards, testing and evaluation, law, national security, and public policy. NIFS should focus on (a) establishing and enforcing best practices for forensic science professionals and laboratories; (b) establishing standards for the mandatory accreditation of forensic science laboratories and the mandatory certification of forensic scientists and medical examiners/forensic pathologists— and identifying the entity/entities that will develop and implement accreditation and certification; (c) promoting scholarly, competitive peer-reviewed research and technical development in the forensic © 2011 by Taylor and Francis Group, LLC

254









Quality Assurance in the Pathology Laboratory

science disciplines and forensic medicine; (d) developing a strategy to improve forensic science research and educational programs, including forensic pathology; (e) establishing a strategy based on accurate data on the forensic science community for the efficient allocation of available funds to give strong support to forensic methodologies and practices in addition to DNA analysis; (f) funding state and local forensic science agencies, independent research projects, and educational programs, with conditions that aim to advance the credibility and reliability of the forensic science disciplines; (g) overseeing education standards and the accreditation of forensic science programs in colleges and universities; (h) developing programs to improve understanding of the forensic science disciplines and their limitations within legal systems; (i) assessing the development and introduction of new technologies in forensic investigations, including a comparison of new technologies with former ones. 2. NIFS, after reviewing established standards such as ISO 17025, and in consultation with its advisory board, should establish standard terminology to be used in reporting on and testifying about the results of forensic science investigations. It should establish model laboratory reports for different forensic science disciplines and specify the minimum information that should be included. As part of the accreditation and certification processes, laboratories and forensic scientists should be required to utilize model laboratory reports when summarizing the results of their analyses. 3. NIFS should competitively fund peer-reviewed research in the following areas: (a) Studies establishing the scientific bases demonstrating the validity of forensic methods. (b) The development and establishment of quantifiable measures of the reliability and accuracy of forensic analyses. The research by which measures of reliability and accuracy are determined should be peer reviewed and published in respected scientific journals. (c) The development of quantifiable measures of uncertainty in the conclusions of forensic analyses. (d) Automated techniques capable of enhancing forensic technologies. 4. To improve the scientific bases of forensic science examinations and to maximize independence from or autonomy within the law enforcement community, Congress should authorize and appropriate incentive funds to the NIFS for allocation to state and local jurisdictions for the purpose of removing all public forensic laboratories and facilities from the administrative control of law enforcement agencies or prosecutors’ offices. 5. NIFS should encourage research programs on human observer bias and sources of human error in forensic examinations. In addition, research on sources of human error should be closely linked with

© 2011 by Taylor and Francis Group, LLC

Role of Governmental and Professional Organizations









255

research conducted to quantify and characterize the amount of error. Based on the results of these studies, and in consultation with its advisory board, NIFS should develop standard operating procedures (that will lay the foundation for model protocols) to minimize, to the greatest extent reasonably possible, potential bias and sources of human error in forensic practice. These standard operating procedures should apply to all forensic analyses that may be used in litigation. 6. To facilitate the work of the NIFS, Congress should authorize and appropriate funds to NIFS to work with the National Institute of Standards and Technology (NIST), in conjunction with government laboratories, universities, and private laboratories, and in consultation with scientific working groups (SWGs), to develop tools for advancing measurement, validation, reliability, information sharing, and proficiency testing in forensic science and to establish protocols for forensic examinations, methods, and practices. Standards should reflect best practices and serve as accreditation tools for laboratories and as guides for the education, training, and certification of professionals. Upon completion of its work, NIST and its partners should report findings and recommendations to NIFS for further dissemination and implementation. 7. Laboratory accreditation and individual certification of forensic science professionals should be mandatory, and all forensic science professionals should have access to a certification process. In determining appropriate standards for accreditation and certification, NIFS should take into account established and recognized international standards, such as those published by the ISO. No person (public or private) should be allowed to practice in a forensic science discipline or testify as a forensic science professional without certification. Certification requirements should include, at a minimum, written examinations, supervised practice, proficiency testing, continuing education, recertification procedures, adherence to a code of ethics, and effective disciplinary procedures. All laboratories and facilities (public or private) should be accredited, and all forensic science professionals should be certified, when eligible, within a time period established by NIFS. 8. Forensic laboratories should establish routine QA and QC procedures to ensure the accuracy of forensic analyses and the work of forensic practitioners. QC procedures should be designed to identify mistakes, fraud, and bias; confirm the continued validity and reliability of standard operating procedures and protocols; ensure that best practices are being followed; and correct procedures and protocols that are found to need improvement. 9. NIFS, in consultation with its advisory board, should establish a national code of ethics for all forensic science disciplines and

© 2011 by Taylor and Francis Group, LLC

256

Quality Assurance in the Pathology Laboratory

encourage individual societies to incorporate this national code as part of their professional code of ethics. Additionally, NIFS should explore mechanisms of enforcement for those forensic scientists who commit serious ethical violations. Such a code could be enforced through a certification process for forensic scientists. 10. Congress should authorize appropriate funds to the NIFS to work with appropriate organizations and educational institutions to improve and develop graduate education programs designed to cut across organizational, programmatic, and disciplinary boundaries. The programs must include attractive scholarship and fellowship offerings. Emphasis should be placed on developing and improving research methods and methodologies applicable to forensic science practice and on funding research programs to attract research universities and students in fields relevant to forensic science. NIFS should also support law school administrators and judicial education organizations in establishing continuing legal education programs for law students, practitioners, and judges. 11. To improve medicolegal death investigation: (a) Congress should authorize funds to the NIFS for allocation to states and jurisdictions to establish medical examiner systems, with the goal of replacing and eventually eliminating existing coroner systems. Funds are needed to build regional medical examiner offices, secure necessary equipment, improve administration, and ensure the education, training, and staffing of medical examiner offices. (b) Congress should appropriate resources to the NIH and NIFS, jointly, to support research, education, and training in forensic pathology. In addition, funding, in the form of medical student loan forgiveness and/or fellowship support, should be made available to pathology residents who choose forensic pathology as their specialty. (c) NIFS, in collaboration with NIH, the National Association of Medical Examiners, the American Board of Medicolegal Death Investigators, and other appropriate professional organizations, should establish a SWG for forensic pathology and medicolegal death investigation. The SWG should develop and promote standards for best practices, administration, staffing, education, training, and continuing education for competent death scene investigation and postmortem examinations. Best practices should include the utilization of new technologies such as laboratory testing for the molecular basis of diseases and the implementation of specialized imaging techniques. (d) All medical examiner offices should be accredited pursuant to NIFS-endorsed standards within a timeframe to be established by NIFS. (e) All federal funding should be restricted to accredited offices that meet NIFS-endorsed standards or that demonstrate significant and measurable progress in © 2011 by Taylor and Francis Group, LLC

Role of Governmental and Professional Organizations

257

achieving accreditation within prescribed deadlines. (f) All medicolegal autopsies should be performed or supervised by a board-certified forensic pathologist. This requirement should take effect within a timeframe to be established by NIFS, following consultation with governing state institutions. 12. Congress should authorize and appropriate funds for the NIFS to launch a new broad-based effort to achieve nationwide fingerprint data interoperability. To that end, NIFS should convene a task force comprising relevant experts from the NIST and the major law enforcement agencies (on the local, state, federal, and, perhaps, international levels) and industry, as appropriate, to develop standards for representing and communicating image and minutiae data among automated fingerprint identification systems. 13. Congress should provide funding to the NIFS to prepare, in conjunction with the Centers for Disease Control and Prevention and the FBI, forensic scientists and crime scene investigators for their potential roles in managing and analyzing evidence from events that affect homeland security. This preparation also should include planning and preparedness (to include exercises) for the interoperability of local forensic personnel with federal counterterrorism organizations. The document prepared by the committee [24] is of revolutionary importance for the development of forensic science. On the one side, it enforces the compulsory accreditation and certification of all laboratories and units involved in forensic practice, on the other hand, it paved a way to self-cleaning of the discipline of all individuals or offices, dealing with forensic activity in unscientific and uncontrolled way. It might be expected that in the next years, the overall quality of forensic science in United States will show dramatic improvement.

8.3╇ European Union Regulations and Recommendations 8.3.1╇Quality Assurance of Human Resources Coordinated on European Level: The Activity of the European Communities Confederation of Clinical Chemistry and Laboratory Medicine The European Communities Confederation of Clinical Chemistry and Laboratory Medicine (EC4) was founded in 1993 in order to coordinate the activities of the national societies affiliated to the International Federation of Clinical Chemistry and Laboratory Medicine (IFCC) and to its European branch (the Forum of the European Societies of Clinical Chemistry: FESCC) © 2011 by Taylor and Francis Group, LLC

258

Quality Assurance in the Pathology Laboratory

within the European Union (EU). EC4 has several active working groups, concerning following issues: professional competence (handled in syllabus and other documents), ethical issues (presented in the code of conduct), and international harmonization and unification (as presented in the Guide to the EC4 Register). The activities of EC4 were presented in numerous articles in scientific journals that are listed on the EC4 Web site [25]. 8.3.1.1  Professional Competence Issues The syllabus describes the scientific content of the training and the knowledge that a professional must acquire to be a specialist in clinical chemistry and laboratory medicine (CCLM) and to be eligible for inclusion on the EC4 register. The last version of the syllabus was presented in the publication of Zerah et al. [26]. According to this document, the syllabus • Indicates the level of requirements in postgraduate training to harmonize the postgraduate education in the EU • Indicates the level of content of national training programs to obtain adequate knowledge and experience • Is approved by all EU societies for CCLM The syllabus is not primarily meant to be a training guide, but on the basis of the common minimal program, national societies should formulate programs that indicate where knowledge and experience is needed. To prepare the common European platform planned in this directive, the disciplines are divided into four categories: General chemistry (biochemistry, endocrinology, chemical, immunology, toxicology, and therapeutic drug monitoring) Hematology (cells, transfusion serology, coagulation, and cellular immunology) Microbiology (bacteriology, virology, parasitology, and mycology) Genetics and IVF These categories form core elements, necessary in the training of clinical chemists. The training must involve comprehensive and appropriate university education of at least 5 years, followed by dedicated postgraduate study of at least 4 years. As concerns undergraduate education, it should be usually chemistry/biochemistry or medicine. Postgraduate study should provide an in-depth knowledge of the biology of disease and the procedures and analytical techniques used in a medical laboratory. A commitment to research and development, often in association with clinical colleagues, is of primary importance. The objective is to produce a person competent in laboratory procedures with a sound knowledge of the subject, who is able to interpret © 2011 by Taylor and Francis Group, LLC

Role of Governmental and Professional Organizations

259

and impart laboratory findings and their implications to clinical colleagues. It was stressed that clinical chemists and specialist medical consultants operate at the same professional level and must use their complementary knowledge to the benefit of the patients and institutions they serve. The complexity and scope of currently obtainable laboratory information requires professional interpretation of the data obtained. This interpretation is an essential task of the clinical chemist, for which he should be trained. The postgraduate study and training must meet national requirements, but consideration should be given as to how such requirements might meet those of the EU as a whole so as not to restrict opportunities for their nationals who might wish to practice in other member states. The whole syllabus presents a detailed catalogue of basic and extended knowledge in four main categories of clinical chemistry (general chemistry, hematology, microbiology, and genetics). The list of recommended textbooks and scientific journals is given. This list, however, should be treated as an example, and must be extended according to individual need. Apart from syllabus, the EC4 working group (WG) published a guide defining the competence required of a consultant in CCLM [27]. The consultant is the most senior professional in the discipline. The guide listed a total of 86 competences for the consultant, allocated in six areas: Clinical competences, required to enable to have a detailed understanding of human physiology and pathology of disease (13 competences). Scientific competences, necessary to make effective use of knowledge and data in problem solving, troubleshooting, innovation, and appraisal (15 competences). Technical competences, required to understand analytical techniques and GLP and to advise on technical troubleshooting and innovation (12 competences). Communication competences, enabling to communicate effectively within the discipline, and to participate in relevant professional bodies on multidisciplinary level (12 competences). Management and leadership competences, needed to manage staff, financial and physical resources, and to show leadership in team building and strategic direction (20 competences). Professional autonomy and accountability competences, required to practice professional accountability for self and to demonstrate it for others (14 competences). The list presented in a guide is quite broad and the detailed assessment of competence will vary with the country. The WG recognized that each individual consultant role may have its own particular duties and responsibilities. Therefore, a specific job description is required for each and every consultant © 2011 by Taylor and Francis Group, LLC

260

Quality Assurance in the Pathology Laboratory

in CCLM. It is the responsibility of employing authority to specify the duties of the consultants that they employ. 8.3.1.2  Ethical Issues The EC4 code of conduct represents the ethical values required for correct professional behavior. The compliance with this code is one of the conditions for registration as the specialist in CCLM. The code of conduct was approved in 2003 and published in 2004 [28]. In general principles of the code was stated that specialists in CCLM shall conduct themselves in a manner that does not bring into disrepute the discipline and the profession of CCLM. They shall value integrity, impartiality, and respect for persons and evidence and shall seek to establish the highest ethical standards in their work. Because of their concern for valid evidence, they shall ensure that research is carried out in keeping with the highest standards of scientific integrity. The particular clauses of the code led to following matters: The specialist shall put his knowledge and ability concerning laboratory diagnostics (including the indication for analyses, the reliability of the results, the interpretation of results and scientific research) at the service of diagnosis, therapy, and prevention of human and animal diseases. The specialist shall maintain his competence at the highest level of quality by following all relevant (scientific and practical) developments concerning healthcare in general and his discipline in particular, by participating in relevant training courses; shall accept assignments only within the area of his competence; beyond this limit, he will seek the collaboration of appropriate experts. The professional integrity and intellectual honesty of the specialist shall be the guarantees of his impartiality of analysis, judgment, and consequent decisions. The specialist shall at all times avoid deceit in professional and scientific respect, such as fraud, plagiarism, concealment, improper omission of information, and expressing incorrect or misleading opinions. The specialist will consider himself bound to respect the confidentiality of information obtained by him in his professional work. The specialist will display his commitment to the profession of CCLM by taking part in the activities of its associations, notably those which promote the profession and contribute to continuing training of their members. As head of the laboratory and/or member of the team, the specialist will ensure that all activities in the laboratory are organized and executed as accurately and as quickly as possible; will protect the safety and well-being of his colleagues and be conscious of nature and the © 2011 by Taylor and Francis Group, LLC

Role of Governmental and Professional Organizations

261

environment; will show respect for superiors, colleagues, and subordinates; will strive for a high level of technical achievement, which will also contribute to and promote a healthy and agreeable environment for his colleagues. The specialist will not accept any obligation, which brings him into conflict with his professional independence. In particular, will not solicit for, or accept, gifts, pecuniary advantages, or benefits from the medical product or diagnostic industry. He will not solicit for, or accept, hospitality at sales promotions, symposia, or congresses and the like unless this hospitality is reasonable in level and secondary to the main purpose of the meeting. He will not accept financial support from the industry, directly or indirectly, other than for events for purely professional and scientific purposes. 8.3.1.3  European Coordination Issues This issue is handled in the European register of specialists in CCLM [29]. The guide to the register gives the minimum standards of clinical chemistry education, organizes the operation of the register, and defines the procedures. After expansion of the EU from 15 to 27 member states, EC4 and FESCC merged in 2007, resulting in a new organization, the European Federation of Clinical Chemistry and Laboratory Medicine. EC4 remained as a foundation, responsible for the maintaining of the European register of specialists in CCLM. The actual status of profession of specialist in CCLM in EU countries was recently reviewed [30]. There are several differences in professional status of specialists in EU member states. The medical professionals enjoy automatic recognition in clinical biology and biological chemistry in most countries, except for Cyprus, Greece, and Latvia. The scientist/pharmacist professionals do not enjoy automatic recognition. It must be noted that science/pharmacy-educated professionals comprise about two-thirds of the 30,000 practicing professionals as compared with one-third of medically educated. The level of training of migrating persons often is unclear, which is caused by differences in languages, definition of education, training content and depth, etc. The European register serves as a kind of co-regulation system. Demonstration by the candidate of being registered in the European register has led to acceptance, and non-registration has been an argument for refusal. The inventory of the existing situation in the EU was done both for science/pharmacy-educated specialists and the medically educated professionals. Data were obtained from representatives of the EC4 member societies, which are the IFCC affiliated national societies for CCLM of the EU countries. In all 27 countries, the profession is practiced by medically educated professionals. In 20 countries, the profession is also practiced at senior level by science/pharmacy-educated professionals. Austria, Bulgaria, Estonia, Lithuania, Romania, Sweden, and Malta are allowing only medically © 2011 by Taylor and Francis Group, LLC

262

Quality Assurance in the Pathology Laboratory

educated professionals. In a large majority of countries, the profession is regulated for specialists educated in medicine whereas regulation for specialists educated in pharmacy or science exists in about half of the countries. In the majority of countries, a final examination is included in the training for both medicine and science/pharmacy-educated trainees. In several regulated countries, the registers of medical and scientist/pharmacist professionals are held with the national medical chamber or the Ministry of Health, whereas in other countries, various governmental bodies regulate the profession. Continuous professional development is obligatory in about half of the countries. The inventory revealed obvious differences between the countries. In most countries, the training content and area of activities includes several or all of the four fields (general chemistry, hematology, microbiology, and genetics/IVF), though differing in length and depth. The training content varied in countries, general chemistry and hematology being the most important fields. There were little differences between medical and scientist/ pharmacist training schemes. 8.3.2╇European Community Activity Concerning Performance of Analytical Methods and Interpretation of Results The Commission of the European Communities published in 2002 requirements concerning performance of analytical methods and interpretation of results [31]. This document was primarily issued for laboratories testing live animals and animal products on the presence of residues of toxic and harmful substances. However, analytical and technical requirements presented here were of relevance not only for food products but also in toxicological analysis applied in clinical and forensic laboratories and in doping control, among others. The criteria of identification with mass spectrometric methods published in the commission decision are widely used and quoted in the scientific literature and were implemented in guidelines issued by FDA, as discussed in detail in Chapter 3, Section 3.4.1. In the interpretation of analytical results, following measures were defined: In the search for a substance with cutoff-level characteristics, the decision limit (Coca) was introduced. This is the limit (usually concentration) at and above it can be concluded with an error probability of α that a sample is not compliant. Error α means that the probability that the tested sample is compliant, even though is noncompliant, has been obtained (false noncompliant decision). The procedure for establishing of CCα was described. Detection capability (CCβ) means the smallest content of the substance that may be detected, identified, and/or quantified in a sample with an error probability of β. Beta (β) error means the probability that the tested sample is truly noncompliant, even though a compliant measurement has been © 2011 by Taylor and Francis Group, LLC

Role of Governmental and Professional Organizations

263

obtained (false compliant decision). In the case of substances for which no permitted limit has been established, the detection capability is the lowest concentration at which a method is able to detect truly contaminated samples with a statistical certainty of 1â•›−â•›β. In the case of substances with an established permitted limit, this means that the detection capability is the concentration at which the method is able to detect permitted limit concentrations with a statistical certainty of 1â•›−â•›β. In the search for a substance, which at least has to be detected and confirmed, the minimum required performance limit (MRPL) should be established. The MRPL must be lower than the legal limit of the given substance. In general requirements for the analysis, it was stated that for screening purposes, only those analytical techniques shall be used for which it can be demonstrated in a documented traceable manner that they are validated and have a false compliant rate of <5% (β-error) at the level of interest. In the case of a suspected noncompliant result, this result shall be confirmed by a confirmatory method. Confirmatory methods for organic residues or contaminants shall provide information on the chemical structure of the analyte. Consequently, methods based only on chromatographic analysis without the use of spectrometric detection are not suitable on their own for use as confirmatory methods. However, if a single technique lacks sufficient specificity, the desired specificity shall be achieved by analytical procedures consisting of suitable combinations of clean-up, chromatographic separation(s), and spectrometric detection. The following methods or method combinations were considered suitable for the identification of organic residues or contaminants: LC or GC with MS detection; LC or GC with IR detection; LC with full-scan DAD, LC with fluorescence detection (for molecules or its derivatives with native or specific fluorescence); two-dimensional TLC with full-scan UV-VIS detection; LC-immunogram (in two different LC systems); LC-UV/VIS single wavelength (only if two different LC systems or two detection methods are used). Performance criteria and other specific requirements for particular method were formulated. As concerns validation procedures, it should be based on ISO 5725 [32] and should include following parameters: specificity, trueness, stability, recovery, repeatability, within-laboratory reproducibility, reproducibility, decision limit (CCα), detection capability (CCβ), calibration curves, and ruggedness. The determination of each parameter was described in detail. 8.3.3╇European Committee for External Quality Assurance Programmes in Laboratory Medicine European Committee for External Quality Assurance Programs in Laboratory Medicine (EQALM) was founded in 1996 as a fruit of informal collaboration between European external quality organizers. This is an © 2011 by Taylor and Francis Group, LLC

264

Quality Assurance in the Pathology Laboratory

umbrella organization for European external quality organizers. According to the constitution, adapted in the Barcelona meeting in 2003, EQALM gathers nonprofit organizations for external QA programs in laboratory medicine. These organizations should have national or substantial regional coverage in European countries and should have a strong liaison with the medical laboratory professions. However, organization from outside of Europe may be admitted to membership. EQALM provides a forum for cooperation and exchange of knowledge about quality-related matters especially with regard to external quality assessment/assurance programs. It may establish projects on topics of common interest according to an agreed work program approved by the General Assembly. EQALM operates through the meeting, organized once a year, established working groups on specific scientific matters (e.g., on hematology, microbiology, nomenclature, among others), or issuing books or other scientific publications. Detailed description of the activities of EQALM is done on its homepage [33]. On this page also the presentation from all meetings, organized by EQALM together with the IFCC, are available. These presentations are devoted to various national and international aspects of external QA. Additionally, the guidelines formulated by the IFCC concerning organization of external quality programs are published here.

8.4╇ Professional International and National Organizations 8.4.1╇International Conference on Harmonisation The International Conference on Harmonisation (ICH) of Technical Requirements for Registration of Pharmaceuticals for Human Use [34] is a unique project that brings together the regulatory authorities of Europe, Japan, and the United States and experts from the pharmaceutical industry in the three regions to discuss scientific and technical aspects of product registration. ICH is comprised of representatives from six parties that represent the regulatory bodies and research-based industry in the EU, Japan, and the United States. In Europe, the members are the EU, and the European Federation of Pharmaceutical Industries and Associations. In Japan, the members are the MoH, labor and welfare (MHLW), and the Japan Pharmaceutical Manufacturers Association. In the United States, the members are the FDA and the Pharmaceutical Research and Manufacturers of America. Additional members include observers from the World Health Organization, European Free Trade Association, and Canada. The observers represent non-ICH countries and regions. The goal of ICH is to make recommendations on ways to achieve greater harmonization in the interpretation and application of technical guidelines and requirements for product registration in order to reduce or obviate the need to duplicate the testing carried out during the research and development © 2011 by Taylor and Francis Group, LLC

Role of Governmental and Professional Organizations

265

of new medicines. The objective of such harmonization is a more economical use of human, animal and material resources, and the elimination of unnecessary delay in the global development and availability of new medicines whilst maintaining safeguards on quality, safety and efficacy, and regulatory obligations to protect public health. The focus of ICH has been on the technical requirements for medicinal products containing new drugs. The vast majority of those new drugs and medicines are developed in Western Europe, Japan, and the United States and therefore, when ICH was established, it was agreed that its scope would be confined to registration in those three regions. ICH issued guidelines, divided into four sections: Quality topics, i.e., those relating to chemical and pharmaceutical QA (stability testing, impurity testing, etc.); safety topics, i.e., those relating to in vitro and in vivo preclinical studies (carcinogenicity testing, genotoxicity testing, etc.); efficacy topics, i.e., those relating to clinical studies in human subject (dose response studies, good clinical practices, etc.); and multidisciplinary topics, i.e., cross-cutting topics that do not fit uniquely into one of the above categories. The guidelines were subsequently published on the Web sites of European Commission Enterprise and Industry and European Medicine Agency [35,36]. Additionally, FDA published all guidelines as appropriate guidances [37,38]. From the analytical point of view, most interesting is the guideline “Validation of Analytical Procedures: Text and Methodology” [39]. This document presents a discussion of the characteristics relevant during the validation of the analytical procedures included as a part of registration application submitted within the EU, Japan, and United States. The text was not intended to provide direction on how to accomplish validation; it serves as a collection of terms and their definitions, which should bridge the differences between national regulations. Four most common types of analytical procedures were discussed: identification tests, quantitative tests for impurities, limit tests for impurities, and quantitative tests of the active moiety in drug product. For these tests, following validation parameters were listed: • Accuracy. • Precision, divided into repeatability (intra-assay or within-day precision), intermediate precision (within-laboratory or day-to-day precision), and reproducibility (precision between laboratories in collaborative studies). • Detection limit, defined as signal-to-noise ratio between 3:1 and 2:1, or expressed as 3.3 standard deviation of the response/slope of the calibration curve. • Quantitation limit, defined as signal-to-noise ratio 10:1, or expressed as 10 SD of the response/slope of the calibration curve. • Robustness, defined as a capacity of an analytical procedure to remain unaffected by mall, deliberate variations in method parameters. The © 2011 by Taylor and Francis Group, LLC

266

Quality Assurance in the Pathology Laboratory

evaluation of robustness may be performed by changing such method parameters, like, e.g., extraction time, pH, composition, and flow rate of the mobile phase (for high pressure liquid chromatography [HPLC] procedures), oven temperature, or carrier gas flow (for GC procedures). It should be noted that no specific method or technique has been recommended or even mentioned in this document. 8.4.2╇ Joint Committee on Traceability in Laboratory Medicine Joint Committee on Traceability in Laboratory Medicine (JCTLM) was established under the auspices of the Bureau Internationale des Poids et Mesures (BIPM), the IFCC, and the International Laboratory Accreditation Cooperation. BIPM is an intergovernmental treaty organization for measurement standards. The activity of the JCTLM is presented on the Web site [40]. The goal of the JCTLM is to provide a worldwide platform to promote and give guidance on internationally recognized and accepted equivalence of measurements in laboratory medicine and traceability to appropriate measurement standards. According to BIPM, metrological traceability is defined as a property of a measurement result, whereby the result can be related to a reference through a documented unbroken chain of calibrations, each contributing to the measurement uncertainty [41]. Relevant ISO standards for reference materials and reference measurement procedures are presented in following documents: ISO 17511 (in vitro diagnostic medical devices—measurement of quantities in biological samples—metrological traceability of values assigned to calibrators and control materials), ISO 18153 (metrological traceability of values for catalytic concentration of enzymes assigned to calibrators and control materials), ISO 15193 (presentation of reference measurement procedures), ISO 15194 (description of reference materials), and ISO 15195 (reference measurement laboratories). The traceability of values assigned to calibrators and/or control materials must be assured through available reference measurement procedures and/ or available reference materials of a higher order. Untraceable measurement systems can lead to noncomparable measurement results or incorrect patient diagnosis and treatment. Evidence-based medicine is becoming more and more prominent in the practice of clinical laboratory science. The analytes like, e.g., glucose, cholesterol, or creatinine, have specific cutoffs that are independent of the assay used. To correctly utilize these cutoffs, the assays for the analyte in question must be comparable. False negative results (below the decisive cutoff) may lead to health or even life danger, and false positive to unnecessary and costly treatment. The committee established two WGs: on reference materials and reference methods, responsible for compilation of existing reference methods © 2011 by Taylor and Francis Group, LLC

Role of Governmental and Professional Organizations

267

and materials, and on reference laboratories—networks, preparing lists of laboratory reference measurement services and guidelines for reference laboratories. The Web site of the committee provides the relevant information as database for laboratory medicine and in vitro diagnostics, which allows finding reference materials, measurement services, or reference measurement methods for relevant analytes in various biological matrices. Actually, over 130 reference measurement procedure entries for 75 different health status markers, over 210 certified reference material entries for 128 measurands, and around 100 laboratory reference measurement services were included. The importance of standardization and traceability of diagnostic tests in laboratory medicine was raised recently by Panteghini [42]. He stressed that the commutability is the key requirement for the reliable transfer of results from one lab to another. Commutability is the ability of a reference or calibrator material to show inter-assay properties similar to those of human samples. Commutability is defined as mathematical relationship between the measurement results generated by the measurands (i.e., the quantity measured) in a given calibrator using the reference and the routine procedure. In practical terms, the numerical ratio between the results determined by a given routine and a reference procedure found for the reference material must be the same as the average ratio found for patients’ samples. The commutability of commercially available tests should be controlled. Commutability of manufacturer’s working calibrators is assessed by applying the reference measurement procedure and the routine procedure to the manufacturer’s working calibrator and a set of human samples. Commutability of manufacturer’s product calibrator compares results of measurements by reference procedure and routine procedure on a set of actual samples to which the routine procedure is intended to be applied. 8.4.3╇International Federation of Societies of Toxicologist Pathologists The International Federation of Societies of Toxicologic Pathologists (IFSTP) [43] is a global professional and scientific federation of national and regional international societies of toxicologic pathology. According to its constitution, IFSTP promotes the communication, exchange, and discussion of scientific information among toxicologic pathologists, helps in development and application of appropriate criteria, terms, mechanisms, and requirements for evaluation. The discussion of guidelines with national and international regulatory agencies and the recognition of toxicologic pathologists globally belong to further aims of the federation. IFSTP sponsored several international meetings and symposia. The proceedings are available at the Web site of IFSTP. To the member societies of the federation belong following © 2011 by Taylor and Francis Group, LLC

268

Quality Assurance in the Pathology Laboratory

national organizations: Society of Toxicologic Pathology (North American, www.toxpath.org), British Society of Toxicologic Pathologists (www.bstp. org.uk), Netherlands Society of Toxicology—Section Toxicologic Pathology (www.toxicologie.nl/uk/ToxPath.html), European Society of Toxicologic Pathology (www.eurotoxpath.org), French Society of Toxicologic Pathology (www.toxpathfrance.org), Italian Society of Toxicologic Pathology and Korean Society of Toxicologic Pathology. In the benchmark publication authorized by several societies, Ettlin et al. [44] defined following main challenges of the profession of toxicologic pathology: • Definition of those characteristics that would result in a consensus judgment that a given individual is a qualified toxicologic pathologist. • Development and implementation of criteria based on these characteristics to recognize competency in toxicology pathology on the global level. • Assistance for toxicologic pathology communities in developing nations to establish system of training and accreditation, which will suit their local needs while conforming to global standards in the field. The factors relevant for the development of fully qualified toxicologic pathologist fall into four categories: education, examination, experience, and external evaluation. The best educational basis is best achieved in medical schools, followed by extensive hands-on instruction in anatomic pathology and clinical pathology. Several pathology societies provide continuing education in the field. As concerns examination, various organizations are offering certifying tests to accredit physicians and veterinarians as pathologists. This is a prerequisite for any subsequent demonstration of competence in toxicologic pathology. At present, the Japanese Society of Toxicologic Pathology and the Royal College of Pathologists (United Kingdom) are administering tests designed to examine one’s knowledge of toxicologic pathology. Establishing of a globally acceptable certifying examination in toxicologic pathology seems not feasible for now. Required experience may be gained in practical work under the mentorship of qualified toxicologic pathologists; e.g., in the Netherlands, required training lasts 4 years, and the successful candidate has to reregister at 5 year intervals after suitable reappraisal. The most important means to demonstrate competence in toxicologic pathology is by subjecting an individual’s work to external evaluation by an experienced colleague. In the experience of Ettlin et al. [44], the peer review is most effective when both the original pathologist and the

© 2011 by Taylor and Francis Group, LLC

Role of Governmental and Professional Organizations

269

reviewing pathologist have a common foundation of toxicologic pathology knowledge. 8.4.4╇Recommendations of Organizations of Forensic Toxicologists Forensic toxicology, which is a part of forensic science, underwent rapid analytical progress in the last two decades. This progress was a consequence of development of analytical chemistry, and such techniques, like gas or liquid chromatography hyphenated with mass spectrometry (MS) became routine tools in everyday practice. In parallel to technical progress, the efforts arose to organize the QA on national and international level and several QC programs were established [45,46]. It should be noted that forensic toxicologic analysis fulfills very similar tasks and follows very similar strategy as analysis for food products or crops on residues of toxic or forbidden compounds or doping analysis. In each of these disciplines, the main task is to detect, unequivocally identify, and quantify forbidden or toxic compounds in order to give evidence of the violation of the law. For this reason, the regulations issued by food agencies or doping control agencies are of relevance also for forensic toxicologists [2,9,47–49]. Penders and Verstraete [50] reviewed in 2006 existing guidelines concerning forensic toxicology, clinical toxicology, point-of-care testing, and overlapping areas (determining brain death, drugs of abuse, drug-facilitated sexual assault). They concluded that it is up to the laboratory to choose the best-fitted guidelines, since the different guidelines may apply depending on the specific local and legal situation. Additionally, the need of regular update of guidelines was stressed, due to technological improvement and emerging new drugs. 8.4.4.1  Forensic Toxicology Laboratory Guidelines Issued by SOFT/AAFS These guidelines, copyrighted by the Society of Forensic Toxicologists Inc. and by the American Academy of Forensic Sciences, Toxicology Section, were formulated initially in response to the regulation of forensic urine drug testing and to the Federal Workplace Drug Testing Program, triggered by the Executive Order 12564 (15,16). The first version was published in 1991. After launching of a Forensic Toxicology Accreditation Program, the guidelines were redrafted and changed several times. The final version appeared in 2006 [51]. It was concluded that the guidelines were appropriate for two defined areas: postmortem forensic toxicology and human performance forensic toxicology. It was not appropriate to include forensic urine drug testing, because that area of practice has been covered by the Department of Health

© 2011 by Taylor and Francis Group, LLC

270

Quality Assurance in the Pathology Laboratory

and human services guidelines and by the College of American Pathologists Accreditation program. According to the definition, postmortem forensic toxicology determines the absence or presence of drugs and their metabolites, chemicals such as ethanol and other volatile substances, carbon monoxide and other gases, metals, and other toxic chemicals in human fluids and tissues, and evaluates their role as a determinant or contributory factor in the cause and manner of death. On the other hand, human performance forensic toxicology determines the absence or presence of ethanol and other drugs and chemicals in blood, breath, or other appropriate specimen(s), and evaluates their role in modifying human performance or behavior. The analysis of ethanol in breath was not considered because such tests are not conducted in a laboratory setting. The guidelines deal with following aspects of forensic toxicology issues: Personnel Standard operating procedures Samples and receiving Security and chain-of-custody Analytical procedures Quality assurance and quality control Review of data Reporting of results Interpretation of toxicology results Safety Most relevant aspects of each subchapter will be presented in turn. 8.4.4.1.1╇ Personnelâ•… Laboratory director should be a person with qualifications comparable to the person certified as diplomate by the American Board of Forensic Toxicology. Alternatively, acceptable qualifications include a doctoral degree in one of the natural sciences and at least 3 years of fulltime laboratory experience in forensic toxicology; or a master’s degree in one of the natural sciences and at least 5 years of full-time laboratory experience in forensic toxicology; or a bachelor’s degree in one of the natural sciences and at least 7 years of full-time laboratory experience in forensic toxicology. The director is responsible for the competency of laboratory personnel, for development, validation, and actualization of analytical methodologies, and for maintaining a QA program. As concerns other laboratory staff, it was recommended that each laboratory should have a deputy director, and a supervising technician, besides analysts. 8.4.4.1.2╇ Standard Operating Proceduresâ•… SOPs for all examinations should be kept in an appropriate manual, available to all personnel who are performing tests. The SOP manual should include the following: © 2011 by Taylor and Francis Group, LLC

Role of Governmental and Professional Organizations

271

• Detailed descriptions of procedures for sample receiving, accessioning, chain-of-custody, analysis, QA and QC, review of data, and reporting. • Administrative procedures as well as analytical methods and be reviewed, signed, and dated whenever it is first placed into use or changed. • For each analytical procedure if appropriate: theory and principle of the method, instructions for preparation of reagents, details of the analytical procedure, instructions for preparation of calibrators and controls, information about any special requirements for handling reagents or for ensuring safety, validation parameters (e.g., limit of quantitation [LOQ], linearity), criteria for the acceptance or rejection of qualitative or quantitative results and references. 8.4.4.1.3╇ Samples and Receivingâ•… This part presents detailed instruction concerning samples collection and labeling, specimen handling, specimen receipt, and recommended amounts of specimens. The director should develop and provide detailed guidelines and instructions to all agencies or parties the laboratory serves, stating the types and minimum amounts of specimens needed to accomplish the analyses and subsequent interpretations. Instructions for labeling individual specimen containers, type, and size of specimen containers and, if appropriate, the type and amount of preservative to be added to biological fluids and acceptable conditions for packing and transportation, should also be provided. A chain-of-custody form should be designed, which will accompany specimens from the place of collection to the laboratory. This document may be incorporated in the laboratory-request form and should be properly completed by responsible personnel at the time the specimens are collected. Handling and transportation of a specimen from one individual or place to another should always be properly documented. Every effort should be made to minimize the number of persons handling a specimen. Individual specimens should be transported and stored in such a manner as to minimize the possibility of degradation, contamination, tampering, and/or damage in shipment. The condition of the external package should be documented upon receipt at the laboratory, either on the requisition form that accompanies the specimen(s), in the log book, on the external chain-of-custody form, or on other documents that constitute normal laboratory records. Following amounts of autopsy specimens were suggested: Brain, liver, and kidney; 50â•›g each; heart blood 25â•›mL; peripheral blood 10â•›mL, vitreous humor, bile, urine, gastric contents; all available. As concerns human performance testing, it was recommended that a minimum of 15â•›mL of blood and 30â•›mL urine should be collected for toxicological analysis. However, forensic toxicology laboratories (FTLs) should develop their analytical © 2011 by Taylor and Francis Group, LLC

272

Quality Assurance in the Pathology Laboratory

methods such that a reasonable complete drug screen can be completed on no more than 5â•›mL. 8.4.4.1.4╇ Security and Chain-of-Custodyâ•… Access to the FTL should be limited. Unauthorized personnel should be escorted and may be required to sign a logbook upon entry and departure from the laboratory. The physical layout of the laboratory must be such that unauthorized personnel cannot enter without detection. The receipt of the specimens should be indicated by handwritten or electronic signature; at a minimum, the date of receipt should also be included. Specimens received should be labeled with the name subject, case number, specimen type (e.g., blood) or unique identifier, date specimen taken, and identification of the individual taking the sample. Specimens must be stored in a secure manner. It is recommended that the laboratory have a separate area for receiving, labeling, aliquoting, and/or storing in proper conditions. Any transfer of specimens, or portions thereof, which are removed for analysis, must be documented. It is recommended that the chain-of-custody documentation reflects not only the receipt of the specimen from an outside source but also transfers of the specimen or an aliquot thereof, within the laboratory. If multiple specimens are involved, a batch form may be used. Specimens may be transferred to a secure long-term refrigerator/freezer after analysis. Such transfer and/or subsequent disposal should be documented. The laboratory should develop a SOP for retention and disposal of specimens. 8.4.4.1.5╇ Analytical Proceduresâ•… The analysis of biological fluids should be segregated from other specimens suspected of containing drugs (e.g., syringes). If physical separation of the analytical areas is not practical, separate glassware and pipettes should be used. If use of different analytical instruments is not practical, lack of residual contamination and carry over must be demonstrated after the high-concentration exhibits have been analyzed. Screening tests may be directed toward a specified class of drugs, or a broad-based screen such as GC/MS may be applied. Screening tests must be appropriate and validated for the type of biological specimens being analyzed. Immunoassays used on whole blood must be appropriately validated for that purpose. If the results of preliminary, unconfirmed screening tests were included on the final report, the report must clearly state that the results were unconfirmed. Preliminary results should be confirmed whenever possible by a second technique based on a different chemical principle. The confirmatory test should be more specific than the first test for the target analyte. It is a good practice to confirm the identity of an analyte in a different extract of the same specimen from that used for the first test, or in a second specimen. Use of a second immunoassay system (e.g., RIA) to confirm another immunoassay © 2011 by Taylor and Francis Group, LLC

Role of Governmental and Professional Organizations

273

(e.g., FPIA) is not regarded as acceptable. The rationale for this is that the analytes that cross-react with one assay are also likely to cross-react with the second assay because the antibodies may be raised to the same drug or closely related substance. The use of MS is recommended as the confirmatory technique, where possible and practical. In some circumstances, confirmation using the same system as the first might be acceptable if chemical derivatization is used to change the retention times. The quantitation of an analyte may serve as acceptable confirmation of its identity if it was initially detected by a significantly different method (e.g., GC/MS SIM quantitation of a drug detected by immunoassay). Where MS is used in selected ion-monitoring mode, the use of at least one qualifying ion for each analyte and internal standard, in addition to a primary ion for each, is strongly encouraged. Acceptance criteria for ion ratios is ±20% (for GC-MS) and up to ±30% (for LC-MS) relative to that of the corresponding control or calibrator. Interpretation of GC/MS-EI full scan mass spectra is usually performed by the instrument’s software as a semi-automated search against a commercial or user-compiled library. However, the results of the software search must be used as guides only and cannot be used as the final determinant of identification. Final review of a “library match” must be performed by a toxicologist with considerable experience in interpreting mass spectra. Interpretation should be based on the following principles: For a match to be considered “positive,” all of the major and diagnostic ions present in the known (reference) spectrum must be present in the “unknown.” Occasionally, ions that are in the reference spectra may be missing from the “unknown” due to the low overall abundance of the mass spectrum. If additional major ions are present in the “unknown,” it is good practice to try to determine if the “extra” ions are from a co-eluting substance or “background.” In the case of LC/MS, it is possible to adjust the fragmentation energy (e.g., collision dissociation energy in a single quadrupole LC/MS) in order to produce fragment ions. Running the sample under conditions of both weaker and stronger collision energy is an option. In some circumstances, monitoring a single ion of an analyte may be appropriate, depending on the uniqueness of the ion and whether the analyte has also been characterized by other methods. The use of isotope or adduct ions as qualifier ions for identification is not valid. For all chromatographic assays, the use of a suitable internal standard was recommended, particularly the use of isotope-labeled analogues for GC/MS and LC/MS analyses. Following criteria of acceptability of quantitative chromatographic analysis were recommended: correlation coefficient of calibration curve ≥0.98, range of each calibrator ±20% against the curve, maximum deviation in replicate analysis ±20%, deviation from retention time of reference compound not more than 2% in GC analysis. © 2011 by Taylor and Francis Group, LLC

274

Quality Assurance in the Pathology Laboratory

For ethanol confirmation, using a second analytical system is encouraged. One approach is to confirm detection of ethanol by GC using an enzymatic assay. Alternatively, confirmation using a second GC column is acceptable if the second results in significant changes in retention time and change in elution order of at least some of the common volatiles (e.g., ethanol, isopropanol, acetone). The second analysis should be performed on a separate aliquot of the specimen or an alternate specimen from the same case. 8.4.4.1.6╇ Quality Assurance and Quality Controlâ•… The guidelines made separate recommendation for QA and QC. As concerns QA, all aspects of the analytical process, from specimen collection and reception through analysis, data review, and reporting of results, were mentioned. To assure proper results, FTLs should participate in an external proficiency testing program that includes, at a minimum, samples for alcohol in blood or serum, and for drugs in at least one type of specimen, representative of that typically analyzed by the laboratory (e.g., whole blood or serum for a postmortem toxicology laboratory). The laboratory director should regularly review results of QC and proficiency testing and inform bench personnel. Proficiency test materials should be retained until the summary report is received and any corrective action is completed. False positive errors and false negative results must be thoroughly investigated. The laboratory director should decide whether the analytical procedures involved need revising. All corrective action should be documented. Quantitative proficiency test errors should also be investigated. Depending on the magnitude of the error, corrective action may be as simple as review of the assay results to ensure that the calibration was valid, that the assay was in control, and that any transcriptions were accurate. For more serious errors, corrective action may require repeating the analysis, revalidation of the assay, or even redevelopment of the test. All corrective action should be documented. Monitoring of the performance of assays by periodically calculating the CV was recommended. For chromatographic assays, CVs greater than about 15% indicate relatively poor precision and further investigation of assay performance. The documentation of all routine and nonroutine maintenance of equipment should be included in any QA program. Quality control, according to the guidelines, may be done in form of “open” control and “blind control.” In the first case, the identity of the control specimen and expected result are known to the analyst. Control specimens can be obtained commercially, prepared in the laboratory, distributed by professional organizations, or saved and pooled from former cases. Regardless of the source, the concentration of the analyte in the control must be validated. Blind controls are identical to open controls except their identity is unknown to the analyst. A blind control should test the entire laboratory process including receiving, accessioning, analysis, and reporting. This can © 2011 by Taylor and Francis Group, LLC

Role of Governmental and Professional Organizations

275

be accomplished by setting up a “dummy account” or by cooperation with the submitting agency. Such blind controls are sometimes called “double blinds.” A more practical approach is to have the accessioning section insert blind controls into each batch of specimens. 8.4.4.1.7╇ Review of Dataâ•… Each batch of analytical data should be reviewed before reporting. At a minimum, this review should include chain-of-custody documentation, validity of analytical data (e.g., shape and signal-to-noise ratio of chromatographic peak) and calculations, QC data. Where possible, the results should be reviewed in the context of the case history, autopsy findings, and any relevant clinical data. The review should be documented within the case record. 8.4.4.1.8╇ Reporting of Resultsâ•… It is neither possible nor desirable to suggest a uniform format for reports, since each laboratory must follow the mandates of the particular agency and/or governmental subdivision. However, each report should include all information necessary to identify the case and its source, and should bear test results and the signature of the individual responsible for its contents. The following elements should be included: name and/or identification number; laboratory identification number; name of submitting agency or individual; date submitted; date of report; specimens tested; test results; and signature of approving individual. Records should be retained as long as practical, but for at least 5 years. Records should include a copy of the report, request and custody forms, work sheets, laboratory data, QC, and proficiency testing records. The archiving of backup data files on suitable electronic media, such as CD or DVD disks was strongly encouraged. 8.4.4.1.9╇ Interpretation of Toxicology Resultsâ•… The guideline discouraged forensic toxicologists from including interpretive comments on toxicology reports unless the specific jurisdiction or client requires it and the toxicologist has access to adequate information about the case, such as the circumstances of the case death or incident, and, as appropriate, the medical history and autopsy findings. Interpretation generally requires a “holistic” approach where as much relevant information as practical is considered in formulating an opinion. 8.4.4.1.10╇ Safetyâ•… The laboratory should have a safety manual addressing such issues as handling and disposal of biological specimens, solvents, reagents, and other chemicals in the laboratory, handling and disposal of any radioactive materials used in the laboratory, handling and disposal of laboratory glassware, responses to personal injuries and spillage of biological specimens, chemicals, solvents, reagents, or radioactive materials, regulation © 2011 by Taylor and Francis Group, LLC

276

Quality Assurance in the Pathology Laboratory

governing dress (e.g., laboratory coats and safety glasses), eating, drinking, or smoking in the laboratory. 8.4.4.2  Activity of the College of American Pathologists for Forensic Sciences Under the umbrella of Surveys and Anatomic Pathology Education Program, CAP organized three QA programs for forensic sciences [52]: • DNA database program, designed for DNA analysts performing forensic and mitochondrial DNA testing for the purpose of creating and maintaining databases of convicted offenders and missing persons. • Whole blood forensic pathology program for crime laboratories and hospital laboratories that have forensic toxicology divisions performing qualitative and quantitative analysis of drugs in whole blood. This program was approved by the American Society of Crime Directors. In the program, whole blood and freeze-dried urine specimens containing a mix of drugs are included. The list of drugs comprises 58 various therapeutic and illicit drugs and their metabolites. • Forensic pathology program, consisting of cases presented on CD-ROM. This program was designed for forensic pathologists, residents, fellows, and medical examiners and gives the opportunity to develop and refine forensic-making skills. The spectrum of cases includes anthropology, ballistics, identification, environmental pathology, injury pattern interpretation, medicolegal issues, toxicology, natural death, and trace evidence. In 2003, Pinckard et al. [53] published results of a survey of training program directors performed as a project for the CAP Forensic Identity Committee. The purpose of the survey was to assess the nature and extent of forensic training in the 43 accredited forensic pathology fellowship programs. The results revealed that 41.9% of programs did not meet the minimum requirements of the Accreditation Council for Graduate Medical Education on the field of forensic pathology. Similarly, 44% of programs did not fulfill the requirements of the National Association of Medical Examiners for toxicology training. These shortages may severely affect the communication abilities of forensic pathologists with cooperating scientists, like toxicologists or DNA-based interpretation experts. 8.4.4.3  The International Association of Forensic Toxicologists Guidelines The International Association of Forensic Toxicologists (TIAFT) issued in 1993 laboratory guidelines for toxicological analysis. The supplement to © 2011 by Taylor and Francis Group, LLC

Role of Governmental and Professional Organizations

277

these guidelines was published in 2003 by the Committee on Systematic Toxicological Analysis and Guidelines of TIAFT [54]. The guidelines concerned qualitative analysis of compounds of forensic relevance, and were divided into detection and identification issues. Since the outcomes of these analyses can have substantial legal and/or social consequences, all approaches and procedures should be scientifically undisputable and legally defensible. In all cases, the relevant properties of the analytical procedures used (selectivity, sensitivity, robustness, reproducibility, etc.) have to be adequately ensured and considered and documented in the analytical report. 8.4.4.3.1╇ Detectionâ•… Analytical detection strategy should be adequate to the reason for analysis. If the toxicological analysis is directed a priori to detect a single substance or a group of substances, e.g., in workplace testing, specifically designed analytical procedures can be applied, known as directed or compound-oriented procedures. If the analysis is required to detect or exclude a wide range of (potentially toxic) substances without specific direction (undirected analysis or “general unknown”), the comprehensive strategy of systematic toxicological analysis is required. Its aim is to detect all substances of toxicological relevance. To this end, a number of analytical procedures should be run in parallel or in sequence, representing a multitude of analytical principles. Prior to the systematic analytical approach, thorough consideration should enable to reasonably confine the scope of the detection stage to compounds relevant to the actual problem. Therefore, criteria to define the group of relevant compounds for a given area of interest are desirable. The various areas of interest (such as forensic and clinical toxicology, workplace testing, drugs-of-abuse testing, drugs and driving, doping analysis, environmental analysis, residue analysis) represent analytical challenges of their own, which should be taken into consideration when embarking on the systematic analytical approach. 8.4.4.3.2╇ Identificationâ•… All tentatively relevant detected compounds have to be unambiguously identified. The ultimate aim of the identification process is that for a given unknown detected substance, only one suitable candidate is found (because all measured signals of the unknown and the reference candidate match adequately) and that all other relevant substances can be excluded (because one or more signals do not match). The large number of substances, sometimes widely different, sometimes with very close structural resemblance, makes it hardly possible to really fulfill the exclusion criterion. Experience has learned that a single analytical method, even when it is based on a highly informative principle, is not always sufficient to reach unambiguous identification. Therefore, proper identification requires as a rule two, if not more, analytical methods © 2011 by Taylor and Francis Group, LLC

278

Quality Assurance in the Pathology Laboratory

(their number depending on their information gain) to exclude all possible candidates except one. This can be done by comparing the results of the various tests applied in the detection and/or identification process from the unknown sample with data from authentic reference standards analyzed under the same actual conditions. A less reliable procedure is the comparison of results with data on reference compounds stored in appropriate databases on relevant substances. The latter option is applied in undirected search, when the number of compounds of interest is very large (e.g., in forensic and clinical toxicology, control of drugs, and driving). In such situations, it can become very difficult for single laboratories to set up and maintain adequate supplies of all reference substances (and of their metabolites). In these instances, the use of reliable, interlaboratory databases might be the only feasible solution. The data collection must then contain not only the toxicologically relevant substances but also metabolites, related substances (including isomers, sometimes enantiomers), endogenous substances, and the like. In addition to the data themselves, the interlaboratory reproducibilities of the analytical techniques must be available and have to be included in the evaluation of the compared results and in the conclusions. Many analytical toxicologists have come to use the term “confirmation” of a first analytical “screening” step as a substitute for “identification.” When this relates to cases in which the results from the detection or screening phase lead to the presumption that a certain substance is present, and in the confirmatory stage one or more signals from the unknown are matching those of the presumed candidate, the presumption is considered “confirmed.” However, it should be realized that such an approach does not necessarily provide unambiguous identification; it will always depend on the existence of similar analytical signal patterns of other compounds and on the actually provided information capacity, whether another substance cannot be distinguished from the presumed one. Thus, it has always carefully considered whether the exclusion criterion mentioned above is fulfilled. In order to enable others to estimate the degree of certainty of the result of a qualitative analysis, the methods applied to draw conclusions should be stated in the report, eventually together with their appropriate properties. Special circumstances, such as limited specimen supply, unavailable or improperly functioning detection and/or identification techniques, unexpected interferences, etc., must be mentioned if occurring in the report as well. 8.4.4.4  Guidelines of the Society of Hair Testing Analysis of hair specimens emerged in the 1980s as important extension of detection possibilities of toxicologically relevant organic compounds of natural or synthetic origin. The analysis of hair can widen the detection window of a given compound to several months. Very broad spectrum of therapeutic © 2011 by Taylor and Francis Group, LLC

Role of Governmental and Professional Organizations

279

and illicit drugs, doping agents, and their metabolites may be detected in hair. Some drugs may be detected in hair even after single exposure. For these reasons, hair analysis became very important tool, e.g., in doping control or in evidencing of drug-facilitated sexual assault [55,56]. However, the interpretation of results of hair analysis requires profound knowledge of such factors like the mechanisms of hair incorporation in hair, racial bias, influence of cosmetics and dyes, etc. For these reasons, quantitative analysis and subsequent extrapolation to the amount of drug intake must be done with extreme caution. Forensic toxicologists early recognized the need of particular quality demands in hair analysis and formed the Society of Hair Testing (SoHT), which was founded in 1995, and gathered specialists in this area. The goals of the society are promotion of research in hair testing technologies in forensic, clinical, and occupational sciences; development of international proficiency tests; organization of meetings and workshops; and encouragement to scientific cooperation and exchanges among members. SoHT organizes annual meetings starting 1996. The proceedings from these events, including very informative abstracts, are available on the homepage of the society [57]. From 2001, SoHT started proficiency testing for participating laboratories, both for qualitative and quantitative analyses. In the case of qualitative testing, hair samples taken from drug addicts and drug-free hair samples were sent for testing. The spectrum of drugs covered the following compounds: morphine, 6-monoacetylmorphine, codeine, cocaine, benzoylecgonine, and THC. Over 20 laboratories participated in this proficiency scheme. In 2004, SoHT published Recommendations for Hair Testing in Forensic Cases. The recommendations covered several areas, which are presented below. 8.4.4.4.1╇ Sampling, Shipping, and Storageâ•… The sample should be cut from the posterior vertex region of the head, as close as possible to the scalp, since this is the region of least variation in growth rate. If not, the source of the sampling should be described. The color, length, body site, and any obvious cosmetic treatment of the hair should be recorded. Root (proximal) and tip (distal) sections of the hair should be clearly defined. If segmental analysis is required, a lock of hair must be fixed before cutting. Alternative hair (e.g., pubic, axillary) can be collected if head hair is unavailable. The sample must be handled and stored in a manner so as to minimize degradation, loss of analyte, or contamination from other sources. Dry hair should be stored in the dark at room temperature. A lock of hair, with the thickness of a pencil, or several locks with the thickness of a straw is recommended in order to allow initial testing, confirmatory testing or retesting of the sample if necessary. In postmortem cases, hair should be collected at the beginning of an autopsy. © 2011 by Taylor and Francis Group, LLC

280

Quality Assurance in the Pathology Laboratory

8.4.4.4.2╇ Decontaminationâ•… The issue of external contamination (e.g., external drug exposure or laboratory contamination) must be addressed through multiple methodologies and cannot be solved through the simple application of any single approach. A simple use of cutoff levels is insufficient because external contamination can be at any level. In general, a decontamination strategy must include an initial organic solvent, to remove oils, followed by aqueous washes. In autopsy or exhumation cases, additional pretreatment of the hair in the laboratory may be necessary, depending on the condition of the sample. 8.4.4.4.3╇ Hair Disintegration and Extractionâ•… Each laboratory has the choice of disintegrating the hair matrix before extraction or of extracting the drug directly from the solid hair after suitable preparation. Degradation compounds may be produced during the assay. Since different analytical procedures can produce different quantitative results, the laboratory must include adequate controls in order to assess the degree of conversion. 8.4.4.4.5╇ Screening Testâ•… If a screening test is used, an appropriate method validation including calibrators and controls in a hair matrix must be performed. Analytes of interest must be identified to minimize false negatives. 8.4.4.4.6╇ Criteria for Mass Spectrometric Analysisâ•… The method must be validated according to good laboratory practice. The possible influence of the internal standard at low concentrations must be assessed and documented. As concerns detailed criteria for valid mass spectrometric analysis, the analyst should refer to recommended rules from scientific organizations or national guidelines. 8.4.4.4.7╇ Specific Drug Classes (Opiates, Cocaine, Amphetamines, and Cannabinoids)â•… The recommendations are presented in Table 8.9. 8.4.4.4.8╇ Internal Quality Controlâ•… Internal QC for hair is more difficult than for other homogenous body fluids, since spiked control samples cannot substitute for the actual hair of a drug user. However, spiked controls may be substituted for hair from drug users if properly prepared. One technique is to expose drug-free hair to aqueous solutions of drugs at high concentrations, for several days and then thoroughly wash the hair before drying and analysis. When suitably homogenized, these spiked samples can be used for precision studies, routine QCs, and as internal degradation controls. Various hair types should be employed. For endogenous drugs, controls may be prepared using an alternative medium, e.g., synthetic melanin. © 2011 by Taylor and Francis Group, LLC

Role of Governmental and Professional Organizations

281

Table 8.9â•…Recommendation of SoHT for Hair Analysis on Drugs of Abuse Immunoassay Opiates Cocaine

Amphetamines

Cannabinoids

LOD for Mo or 6-MAMâ•›≤â•›0.2â•›ng/g LODâ•›≤â•›0.5â•›ng/g LODâ•›≤â•›0.2â•›ng/g for A, MA, MDMA, MDEA, MDA LODâ•›≤â•›0.1â•›ng/g

Ethyl alcohol (chronic abuse)

Chromatography LOQâ•›≤â•›0.2â•›ng/g LOQâ•›≤â•›0.5â•›ng/g for cocaine, ≤â•›0.05â•›ng/g for other compounds LOQâ•›≤â•›0.2â•›ng/g for each compound LOQâ•›≤â•›0.1â•›ng/g for THC, ≤â•›0.2 pg/g for THC-COOH Ethyl glucuronideâ•›> 30â•›ng/g FAEEâ•›>â•›500â•›ng/g

Metabolites 6-MAM for heroin identification BE EME, Nor-Co, or Co-Eth Beware of licit drug converting to A or MA THC-COOH required for confirmation

Notes: Mo, morphine; 6-MAM, 6-monoacetylmorphine; A, amphetamine; MA, methamphetamine; MDMA, methylenedioxymethamphetamine, MDEA, methylenedioxyethylamphetamine; MDA, methylenedioxyamphetaminne; THC, tetrahydrocannabinol; THC-COOH, THC-carboxylic acid; FAEE, fatty acid ethyl esters (sum).

8.4.4.4.9╇ External Quality Controlâ•… The laboratory should enroll in a proficiency testing program, where authentic hair specimens are sent for testing. The laboratory must analyze proficiency specimens in the same way as routine samples. In the case of performance failure, corrective actions must be taken. In the external QC organized by the SoHT, reference laboratories will be named, and their results will be used as a reference method and result source. According to the survey organized by Cooper et al. [58], 43 out of 52 laboratories involved in hair testing were following the guidelines of SoHT. However, only nine laboratories were accredited to ISO/IEC 17025 for hair testing. 8.4.4.5  Guidelines of the German Society of Toxicological and Forensic Chemistry In 2005, the Clinical Toxicology Committee of the Society for Toxicological and Forensic Chemistry (GTFCh) published recommendations for minimal requirements on toxicological analysis in the context of determining brain death [59]. These minimal requirements concern selectivity, linearity, and precision and accuracy of analytical method. 8.4.4.5.1╇ Selectivityâ•… The analysis of at least 10 different matrix samples was regarded as a minimum requirement. The need of detection or exclusion of interference arising from the internal standard (particularly, deuterated analogues) was stressed. © 2011 by Taylor and Francis Group, LLC

282

Quality Assurance in the Pathology Laboratory

8.4.4.5.2╇ Linearityâ•… Since toxicological analyses in the context of determining brain death are seldom requested, performing a full calibration for each single sample is not substantiated. Therefore, the method should be developed, which also leads to acceptable results with one-point calibration. The one-point calibration should be supported by linearity experiments where the concentration of the lowest calibrator should be 0.25 × the lower limit of the therapeutic range, and the concentration of the highest calibrator should be at least equal to the upper limit of the therapeutic range. The six replicate analyses of five different calibrators evenly spread across the aforementioned calibration range was regarded as necessary for reliable judgment of the linearity. The matrix used should be as close as possible to the matrix of the samples later to be analyzed. The optimal one-point calibrator can be selected then from the calibrators of full calibration. Of particular importance regarding the later use of a one-point calibration is the inspection of the y-intercept, as a one-point calibration is only reliable if the calibration line passes through the origin. If necessary, a nonlinear calibration model should be applied. 8.4.4.5.3╇ Precision and Accuracyâ•… These parameters should be evaluated at two concentrations corresponding to the lower and upper limit of the therapeutic range. Duplicate measurements on eight different days should be performed. Separate estimation of the repeatability and intralaboratory precision (intermediate precision) from the same set of data should be done. As acceptance criterion, it was set down that the 99% confidence interval of the values measured (average ±3 × laboratory precision) must fit completely within an interval of ±50% of the corresponding target value. In practice, the acceptance criterion means that a concentration in the lowest therapeutic range can be differentiated from a concentration below the measuring range with 99% probability. In October 2009, GTFCh published detailed guidelines and recommendations for QA of forensic–toxicological examinations [60]. This document is valid effective immediately. The guidelines are based on the EN ISO/EC 17025 standard, and comprise following fields: • General undirected screening analysis in cases of suspected influence of pharmaceutical and illicit drugs or poisons, particularly in criminal cases • Directed toxicological analysis, particularly quantitative determination of drugs in various biological matrices • Postmortem toxicological analysis in establishing the cause of death • Toxicological analysis in establishing the fitness to drive a vehicle

© 2011 by Taylor and Francis Group, LLC

Role of Governmental and Professional Organizations

283

The guidelines are divided into several chapters, dealing with particular technical requirements: • General requirements, concerning personnel, laboratory facilities and equipment, and safety precautions • Requirements concerning pre-examination procedures, conditions, and period of sample storage • Requirements concerning immunoassay analyses • Requirements concerning confirmatory analyses, like GCMS, LCMS, and HPLC-UV/DAD • Quality assurance aspects of the analyses (calibration, internal and external QC procedures, documentation, and measurement of uncertainty) • Documentation of final results and expert reporting Together with the guidelines, three new annexes were published; Annex A— Quality requirements for particular analytes (with limits of quantitation in various matrices); Annex B—Requirements concerning validation of analytical methods; Annex C—Requirements for hair analysis. These annexes are effective on April 1, 2011. In Annex A, the recommended limits of quantitation of most common drugs of abuse and their metabolites in serum/plasma, urine, and hair were listed (Table 8.10). Table 8.10â•…Recommendation of GTFCh Concerning Limits of Quantitation of Drugs of Abuse and Their Metabolites Analyzed with Confirmatory Methods in Particular Matrices Compound THC THC-COOH Amphetamine Methamphetamine MDA, MDMA, MDEA Cocaine Benzoylecgonine Morphine Codeine 6-MAM Methadone EDDP

Serum/Plasma (μg/L)

Urine (μg/L)

Hair (ng/mg)

1 10 25 25 25 10 10 10 10 2 50 —

— 10 200 200 200 — 30 25 25 10 200 200

0.02 — 0.1 0.1 0.1 0.1 0.1 0.1 0.1 0.1 0.1 0.1

Note: EDDP, 2-ethylidene-1,5-dimethyl-3,3-diphenylpyrrolidine (methadone metabolite).

© 2011 by Taylor and Francis Group, LLC

284

Quality Assurance in the Pathology Laboratory

References 1. 42 CFR Part 493—Laboratory Requirements. January 10, 2004 edition, pp. 967– 1087. http://wwwn.cdc.gov/clia/regs/toc.aspx, http://www.access.gpo.gov/nara/ cfr/waisidx_04/42cfr493_04.html 2. Guidance for Industry. 2001. Bioanalytical method validation. U.S. Department of Health and Human Services, Food and Drug Administration, Center for Drug Evaluation and Research (CDER), Center for Veterinary Medicine (CVM), Rockville, MD, May 2001. http://www.fda.gov/cder/guidance/4252fnl.pdf 3. Birdsong G.G. 2007. Testing the test. Cancer 111: 461–464. 4. Nagy G.K. and Naryshkin S. 2007. The dysfunctional federally mandated proficiency test in cytopathology. Cancer 111: 467–476. 5. Nagy G.K. 2007. Sir Francis Galton and proficiency testing in cytopathology. Acta Cytol. 51: 530–532. 6. Ehrmeyer S.S. and Laessig R.H. 2008. Can auditing save us from a quality disaster? Accred. Qual. Assur. 13: 139–144. 7. Baltimore Sun. 2004. 10, 13, 21, and 20 April. http://www.baltimoresun.com 8. Testimony. 2004. US Department of Health and Human Services, Washington, DC, May 18, 2004. http://www.hhs.gov/asl/testify/t040518.html (accessed March 15, 2009). 9. Guidance for Industry. 2003. Mass Spectrometry for Confirmation of the Identity of Animal Drug Residues. U.S. Department of Health and Human Services. Food and Drug Administration, Center for Veterinary Medicine, Rockville, MD, May 1, 2003. http://www.fda.gov/cvm/Guidance/guide118.doc 10. 21 CFR Part 11. 1997. Electronic records; electronic signatures; final rule. Federal Register 62(54): 13429–13466, March 20, 1997. http://www.21part11. com/files/library/government/21cfrpart11_final_rule.pdf 11. Guidance for Industry. 2003. Part 11, Electronic records, electronic signatures—scope and application. U.S. Department of Health and Human Services, Food and Drug Administration, Rockville, MD, August 2003. http:// www.fda.gov/cder/guidance/5667fnl.pdf 12. Guidance for Industry and FDA Staff. 2008. Recommendations for Clinical Laboratory Improvement Amendments of 1998 (CLIA) Waiver Applications for Manufacturers of In Vitro Diagnostic Devices. U.S. Department of Health and Human Services, Food and Drug Administration, Rockville, MD, January 2008. http://www.fda.gov/cdrh/oivd/guidance/1171.pdf 13. Hill H.M. 2003. Chromatography in a regulated environment. In: I.D. Wilson. ed. Bioanalytical Separations, Handbook of Analytical Separations, vol. 4, Amsterdam, the Netherlands: Elsevier Science, pp. 373–409. 14. http://en.wikipedia.org/wiki/Title_21_CFR_Part_11 (accessed February 10, 2009). 15. Rauch C.A. and Nichols J.H. 2007. Laboratory accreditation and inspection. Clin. Lab. Med. 27: 845–858. 16. Executive Order 12564 of September 15, 1986. Drug-free workplace. Federal Register vol. 51, September 17, 1986. http://www.da.usda.gov/shmd/drugexec. htm, http://www.csosa.gov/policies/DFWP_AppA_EO12564.pdf 17. Substance Abuse and Mental Health Administration. 2004. Mandatory guidelines and proposed revisions to mandatory guidelines for federal workplace © 2011 by Taylor and Francis Group, LLC

Role of Governmental and Professional Organizations









285

drug testing programs. Federal Register 69(71), 19644–19732, Tuesday, April 13, 2004. 18. SAMHSA News Release 2008. Final federal workplace drug testing guidelines allow broader use of urine specimen testing. http://www.samhsa.gov/ newsroom/advisories/0811213700.aspx 19. Federal Register vol. 73(197): 59640–59641, October 9, 2008. 20. 21 CFR vol. 1, Part 58. Good Laboratory Practice for Nonclinical Laboratory Studies, pp. 303–316. http://edocket.access.gpo.gov/cfr_2001/aprqtr/pdf/21cfr58.1.pdf 21. Stiles T. Grant V., and Mawby N. 2003. Good Clinical Laboratory Practice (GCLP). A Quality System for Laboratories that Undertake the Analyses of Samples from Clinical Trials. Ipswich, U.K.:BARGA. 22. Ezzelle J. Rodriguez-Chavez I.R. Darden J.M et al. 2008. Guidelines on good clinical laboratory practice: Bridging operations between research and clinical research laboratories. J. Pharm. Biomed. Anal. 46: 18–29. 23. http://www3.niaid.nih.gov/research/resources/DAIDSClinRsrch/PDF/GCLP. pdf (accessed February 11, 2009). 24. National Research Council. 2009. Strengthening Forensic Science in the United States: A Path Forward. Committee on Identifying the Needs of the Forensic Sciences Community. ISBN: 978-0-309-13130-8, pp. 1–352. http://www.nap. edu/catalog/12589.html 25. The EC4 Register. http://www.e-c4.org/publications.html 26. Zerah S. McMurray J. Bousquet B. et al. 2006. EC4 European syllabus for post-graduate training in clinical chemistry and laboratory medicine: version 3—2005. Clin. Chem. Lab. Med. 44: 110–120. 27. Beastall G. Kenny D. Laitinen P. et al. 2005. A guide to defining the competence required of a consultant in clinical chemistry and laboratory medicine. Clin. Chem. Lab. Med. 43: 654–659. 28. Sanders G. Opp M. McMurray J. et al. 2004. The European register for specialist in clinical chemistry and laboratory medicine: Code of conduct. Clin. Chem. Lab. Med. 42: 563–565. 29. Pazzagli M. McMurray J., and Zerah S. 2008. The EC4 European register of specialists in clinical chemistry and laboratory medicine. Clin. Chim. Acta 393: 27–30. 30. Jansen R.T.P. 2008. European Communities Confederation of Clinical Chemistry and Laboratory Medicine. Self and co-regulation for science and pharmacy specialists in clinical chemistry and laboratory medicine. Inventory of the existing situation in the EU. www.e-c4.org/publications.html (accessed March 10, 2009). 31. Commission Decision of 12 August 2002 implementing Council Directive 96/23/EC concerning the performance of analytical methods and the interpretation of results. Off. J. Eur. Comm. L 221/8, 18.08.2002. http://eur-lex.europa.eu/ LexUriServ/LexUriServ.do?uri=OJ:L:2002:221:0008:0036:EN:PDF 32. ISO 5725 Part.1–6. 1994: www.iso.org 33. European Committee for External Quality Assurance Programmes in Laboratory Medicine (EQALM). http://www.eqalm.org/ (accessed March 12, 2009). 34. The International Conference on Harmonisation of Technical Requirements for Registration of Pharmaceuticals for Human Use. www.ich.org (accessed February 20, 2009).

© 2011 by Taylor and Francis Group, LLC

286

Quality Assurance in the Pathology Laboratory

35. http://ec.europa.eu/enterprise/pharmaceuticals/eudralex/eudralex_en.htm (accessed February 20, 2009). (accessed 36. http://www.emea.europa.eu/htms/human/ich/background.htm February 20, 2009). 37. http://www.fda.gov/cder/guidance/index.htm (accessed February 21, 2009). 38. http://www.fda.gov/cber/guidelines.htm (accessed February 21, 2009). 39. http://www.ich.org/LOB/media/MEDIA417.pdf (accessed February 21, 2009). 40. http://www.bipm.org/en/committees/jc/jctlm/ (accessed March 1, 2009). 41. Wielgosz R.I. 2008. Joint Committee for Traceability in Laboratory Medicine, Bureau International des Poids et Mesures. A database of higher order reference materials and reference measurement procedures http://www.bipm.org/utils/ en/pdf/Traceability_in_LabMed.pdf (accessed March 1, 2009). 42. Panteghini M. 2009. Traceability as a unique tool to improve standardization in laboratory medicine. Clin. Biochem. 42: 236–240. 43. International Federation of Societies of Toxicologist Pathologists IFSTP. http://ifstp.org (accessed February 21, 2009). 44. Ettlin R.A. Bolon B. Pyrah I. Konishi Y., and Black H.E. 2008. Global recognition of qualified toxicologic pathologists: Where we are now and where we need to go. Exp. Toxicol. Pathol. 60: 1–8. 45. Battista H.J. von Meyer L., and Wehinger G. 1996. Quality assurance in forensic toxicological analysis. Accred. Qual. Assur. 1: 201–206. 46. Levy S. Bergman P., and Frank A. 1999. Quality assurance in forensic science. Accred. Qual. Assur. 4: 253–255. 47. The World Anti-Doping Code. 2004. International standards for laboratories. Version 4.0. August 2004. http://www.wada-ama.org/rtecontent/document/ lab_aug_04.pdf (accessed February 20, 2009). 48. Minimum required performance limits for detection of prohibited substances. WADA Technical Document TD2004MRPL. http://www.wada-ama.org/ rtecontent/document/perf_limits_2.pdf (accessed 20.02.2009). 49. World Anti-Doping Agency (WADA). 2004. Identification criteria for qualitative assays incorporating chromatography and mass spectrometry. WADA Technical Document TD2003IDCR, pp. 1–5. http://www.wada-ama.org/ rtecontent/document/criteria_1_2.pdf (accessed 20.02.2009). 50. Penders J. and Verstraete A. 2006. Laboratory guidelines and standards in clinical and forensic toxicology. Accred. Qual. Assur. 11: 284–290. 51. SOFT/AAFS Forensic Toxicology Laboratory Guidelines. 2006 Version. http:// www.soft-tox.org/docs/Guidelines%202006%20Final.pdf (accessed March 1, 2009). 52. College of American Pathologists. 2008. Surveys & anatomic pathology education program, pp. 199–201. 53. Pinckard J.K. Hunslater D., and Weedn V.W. 2003. A comprehensive analysis of forensic science training in forensic pathology fellowship programs. J. Forensic Sci. 48: ID JFS2002143_482. 54. Committee on Systematic Toxicological Analysis & Guidelines of TIAFT. Laboratory guidelines for toxicological analysis. http://www.tiaft.org/about/ sta_supplement.php (accessed March 2, 2009). 55. Kintz P. ed. 2006. Analytical and Practical Aspects of Drug Testing in Hair. Boca Raton, FL: CRC Press. © 2011 by Taylor and Francis Group, LLC

Role of Governmental and Professional Organizations

287

56. Villain M. Cirimele V., and Kintz P. 2004. Substance abuse in sports: Detection of doping agents in hair by mass spectrometry. In: J. Yinon. ed. Advances in Forensic Applications of Mass Spectrometry, Boca Raton, FL: CRC Press, pp. 129–148. 57. Society of Hair Testing SoHT. http://www.SoHT.org (accessed February 21, 2009). 58. Cooper G. Moeller M., and Kronstrand R. 2008. Current status of accreditation for drug testing in hair. Forensic Sci. Int. 176: 9–12. 59. Peters F.T. Hallbach J., and Maurer H.H. 2005. Recommendations from the Society of Toxicological and Forensic Chemistry (GTFCh) concerning the validation of methods for toxicological analysis in the context of determining brain death. Bull. Int. Ass. Forensic Toxicol. 25: 8–9. 60. Richtlinie der GTFCh zur Qualitätssicherung bei forensisch-toxikologischen Untersuchungen. Available at: https://www.gtfch.org/cms/files/GTFCh_ Richtlinie_For-Tox_Version%201.pdf (accessed October 12, 2009).

© 2011 by Taylor and Francis Group, LLC

Education and Training in the Changing Environment of Pathology and Laboratory Medicine

9

Gian Cesare Guidi and Giuseppe Lippi

Contents Abbreviations 9.1 Introduction 9.2 Laboratory Medicine in Undergraduate Studies 9.3 Implementing a Laboratory Medicine Course into Medical Curricula 9.3.1 Pregraduation Curriculum and Role of Laboratory Medicine 9.3.2 Course of Laboratory Medicine for Undergraduate Students 9.3.2.1 Test Ordering 9.3.2.2 Preanalytical Issues 9.3.2.3 Analytical Issues 9.3.2.4 Test Interpretation 9.4 Laboratory Technicians 9.4.1 The Profession of Laboratory Technologist/Technician in the United States 9.4.2 The Profession of Laboratory Technician in Europe 9.4.3 Main Tasks, Attribution, and Duties of Laboratory Technicians 9.4.4 Training of Laboratory Technicians 9.4.5 End of Training: Validation of the Laboratory Report 9.5 Bioinformatics 9.5.1 Training in Bioinformatics 9.6 Postgraduate Training in Laboratory Medicine 9.6.1 The EC4 Register 9.6.2 Postgraduate Education in the United States 9.6.3 Postgraduate Education in Italy © 2011 by Taylor and Francis Group, LLC

289

290 291 292 293 293 295 295 298 299 300 301 302 303 304 306 311 312 317 322 323 326 329

290

Quality Assurance in the Pathology Laboratory

9.6.4 Postgraduate Education in the United Kingdom 9.6.5 Postgraduate Education in Other European Countries 9.6.6 Postgraduate Education in Other Non-European Countries 9.7 Bioethics in Laboratory Medicine 9.8 Conclusions References

330 332 334 336 339 340

Abbreviations 3DUS Three-dimensional ultrasound Australian Association of Clinical Biochemistry AACB American Board of Pathology ABP ACGME Accreditation Council for Graduate Medical Education Academy of Clinical Laboratory Physicians and Scientists ACLPS American Society for Clinical Pathology ASCP BRCA1 Gene playing critical roles in DNA repair, cell cycle, and genomic stability Canadian Academy of Clinical Biochemistry CACB College of American Pathologists CAP Complete blood cell count CBC Certificate of Completion of Training CCT Capillary electrophoresis CE CLIA Clinical Laboratory Improvement Amendments Clinical pathology CP Cerobrospinal fluid CSF Computed tomography CT D-HPLC Denaturing high-performance liquid chromatography DICOM Digital Imaging and Communications in Medicine EC4 European Communities Confederation of Clinical Chemistry and Laboratory Medicine EFCC European Federation of Clinical Chemistry and Laboratory Medicine EQA External Quality Assessment EU/C European Union/Community HIV Human Immunodeficiency Virus HL-7 Electronic Health Record Functional Model and Standard ICA Independent component analysis ICD-9 International Classification of Diseases and Related Health Problems, 9th rev. Internal Quality Control IQC IEF Isoelectric focalization

© 2011 by Taylor and Francis Group, LLC

Education and Training

291

IFCC International Federation of Clinical Chemistry and Laboratory Medicine Integrating the Healthcare Enterprise IHE Reference interval RI Information technology IT Laboratory information system LIS Medical laboratory technician MLT MRCPath Membership of the Royal College of Pathologists Magnetic Resonance Imaging MRI NAACLS National Accrediting Agency for Clinical Laboratory Sciences National AIDS Control Organization NACO Nuclear Magnetic Resonance NMR Principal component analysis PCA PCR Polymerase chain reaction Positron Emission Tomography PET Postgraduate Medical Education and Training Board PMETB Point-of-care POC Reference change value RCV RFID Radio frequency identification Radiology information system RIS SCP-ECC Standard Communication Protocol for Computerized Electrocardiography SECQ Spanish Society for Clinical Biochemistry and Molecular Biology Single Photo Emission Computed Tomography SPECT Taiwan Society of Clinical Pathologists TSCP

9.1╇Introduction Education is a comprehensive word, meaning a process where both teaching and learning represent dynamic pieces of an action aimed at shaping the individual nature, by developing natural disposition, character, skills, and professional competencies. In all human societies, education has thus represented, and increasingly represents, an element of utmost strategic importance for either the single person’s or the community’s progress. In managing to satisfy the increasing requests, coming from students on one hand and from the community at large on the other, the institutions devoted to education have progressively assumed a highly complex structure, where innovative teaching approaches are flanking the most traditional methods of instruction. In this perspective, education directed at the biomedical sciences and biomedical practices deserves particular attention, for a series of reasons. In the last 10 years, many changes have been introduced in the medical study curricula in the United States as well as European Union countries. Moreover, many

© 2011 by Taylor and Francis Group, LLC

292

Quality Assurance in the Pathology Laboratory

other countries worldwide have proceeded in the same direction, with relevant medical studies reforms. This was due to a series of novel educational subjects mainly related to new professional settings, to the explosion of scientific knowledge and related translational practices and technologies, and to new and improved concepts of medical pedagogy. In this context, education directed at fulfilling the needs of laboratory medicine in terms of graduation, postgraduation, and other professional requirements should be even more regarded as a specific function of teaching and learning. It is frequently claimed that the main principles in education should first consider what to teach, when to teach, how to teach, and who should teach. Taking into account the plurality of possible applicants, education in laboratory medicine should consider another aspect: to whom it should be directed, tailored, and taught. We try to answer these questions in this chapter.

9.2╇Laboratory Medicine in Undergraduate Studies Laboratory medicine is a canonical field of study for degree courses in medicine as well as for other courses directed at healthcare professionals. It is often included as part of integrated lectures in disciplines able to provide students with the fundamental and methodological tools needed to adequately face the subsequent clinical studies. By studying laboratory medicine, the student learns to apply the methods and scientific procedures of investigation to the diagnosis, monitoring, and clinical/therapeutical follow-up of patients. When planning an undergraduate course in laboratory medicine, it is important to consider that the structure at the pre-degree level should be particularly focused on the cultural and professional values of learning achieved by the students, most of whom, after graduation, will use laboratory results in order to complement and support the diagnostic needs for care of their patients. At the undergraduate level and for the purpose of learning, it therefore seems unnecessary or of little utility to address the attention of the students to the technical aspects, which in any case characterize the profession of laboratory doctors and specialists. On the contrary, it seems far more important to stress concepts culturally more useful and practical at this level of studies, such as the interpretation of laboratory data, the appropriateness of a test request, and diagnostic rigor, supported by proper reasoning. We think it is so much more useful to teach students using a series of educative tools, such as diagnostic examples and paradigmatic cases, the methods of learning based on interactive discussion of specific clinical and diagnostic problems, the adoption of criteria that justify the use of prognostic tests, the understanding of the opportunities offered by the tests aimed at monitoring treatment, the knowledge of the rational of screening tests, the correct evaluation of the quality of analytical data and their settlement, © 2011 by Taylor and Francis Group, LLC

Education and Training

293

relative to the “references” and in accordance with quality requisites, and the ability to appreciate the continuing evolution of laboratory medicine, in line with the advances in medical science and technology.

9.3╇Implementing a Laboratory Medicine Course into Medical Curricula In the past several years, as at present, there has been a tremendous upheaval in medical curricula, both in Europe and in other parts of the world [1]. This was (and is) principally due to a series of boosts coming from either the great scientific advancements of the last decades or the new public healthcare organization and management that, particularly in Europe, are directed toward the constitution of systems where the wide diffusion of homogenous levels of care is a qualifying point. This implies that every professional involved in the system should concurrently be adequately qualified in its field of work and able to operate in a complex system, where both interaction and integration of diverse competencies are vital for the optimal functionality of the public healthcare service. The kind of complexity of the healthcare-related procedures itself means that medical students have, after graduation, the knowledge necessary, but not completely adequate, to practice the medical profession, even at the level of general practice. As a consequence, further studies leading to some specialization or postgraduation are generally advisable. Being a pervasive discipline, laboratory medicine represents a relevant field of study of either pre- or postgraduation curricula, with obvious differences. This is due to two distinct but linked phenomena that are peculiar to laboratory medicine, even more than to other diagnostic areas. The former is related to the fact that either instrumental or methodological laboratory technologies have widely exploited the exponential progress of informatics and chemometrics with a huge gain in terms of analytical quality. Laboratory results are presently far more reliable than they were only a few years ago. Consequently, physicians tend to rely more on them, and clinical decisions are increasingly influenced by test results. The latter is related to the incessant translation of relevant research results into clinical advantage to patients, mainly by the increasing availability of predictive tests and diagnostic procedures. Moreover, laboratory tests that are presently offered are able to explore metabolic and organic alterations far earlier than at the time clinical symptoms become manifest and even in latent conditions [2]. 9.3.1╇Pregraduation Curriculum and Role of Laboratory Medicine A complete period of medical training … shall comprise at least a six-year course or 5,500 hours of theoretical and practical instruction given in a University or © 2011 by Taylor and Francis Group, LLC

294

Quality Assurance in the Pathology Laboratory

under the supervision of a University [3]. The medical graduation curriculum in basic, and mainly theoretical, disciplines is generally organized into four to six semester terms during the first 2 or 3 years of studies, depending on the country, being mainly six terms during 3 years in the EU. It includes physics biophysics and biostatistics; biology, chemistry, and biochemistry; anatomy, histology, and embryology; physiology; and general pathology. Teaching is oriented toward a detailed knowledge of the structural and functional relationships of the human body, from the molecular level to that of organs and systems. Although, during the first 3 years of studies, students have less contact with the clinics where first aid and the basis of patient care are practiced, this is not the rule. In fact, mainly in European countries, but, even in other countries worldwide, a progressive contact with patients and emergency clinics is encouraged, to make students aware of the professional issues and problems as early as possible. Starting from the fourth year, the studies are devoted to preclinical disciplines such as pathological anatomy, pathophysiology, and laboratory medicine, including microbiology and pharmacology. The introduction to clinical medicine encompasses internal and surgical propedeutics. Some clinical subjects, such as neurology, psychiatry, dermatovenerology, and radiology, are also taught. In the fifth year, clinical disciplines are exclusively taught. The sixth year is organized mainly as a bedside practice in internal medicine, surgery, gynecology and obstetrics, pediatrics, and in preventive medicine and hygiene, besides general practice. The instruction in these subjects is completed by a state exam, generally taken shortly after graduation. More recent concepts of medical pedagogy discourage the net distinction between preclinical and clinical disciplines as traditionally imparted to students, in two successive blocks. Rather, a more integrated approach is now preferred, where instruction in clinical disciplines starts early and gradually forms the bulk of the basic sciences and then progressively gains importance during the last year, until completion of the course. This approach is believed to be highly effective and is able to optimize the learning abilities of the students. In this context, laboratory medicine plays a crucial role, particularly by virtue of representing the newly aggregated knowledge, where many basic notions, mainly of physics, statistics, informatics, chemistry, biochemistry, and general pathology, are applied to the pathophysiology of metabolic pathways and of organ malfunctions. Moreover, by being placed as a sort of bridge between basic and clinical disciplines, laboratory medicine can encourage progressive merging of the previously segregated disciplines. From an academic point of view, laboratory medicine represents an area of teaching that comprises disciplines such as clinical biochemistry, clinical microbiology, clinical pathology (CP), and, more recently and increasingly, molecular biology, particularly for aspects of pathological and clinical relevance. © 2011 by Taylor and Francis Group, LLC

Education and Training

295

9.3.2╇Course of Laboratory Medicine for Undergraduate Students There are some common misconceptions that students of laboratory medicine should be apprised of, such as the suggestion that ordering, processing, and interpreting tests are straightforward procedures [4], widely controlled by automatic processes, where there is little room for errors or misinterpretation. On the contrary, it is exactly regarding these cardinal aspects of laboratory medicine that students should be made aware that the correct request for and the clinical use of tests are not as straightforward as predicted. Moreover, an increasing concern of healthcare providers is addressed to containing the mounting costs related to diagnostic activities, as they are increasingly regarded by most physicians as relevant aids, not only for improving decision strategies regarding their patients, but also for taking precautions against possible charges in case of adverse patient outcome. For all these reasons, correct and meticulous instructions should be given to students. 9.3.2.1  Test Ordering When students are introduced to the general use of laboratory tests, the first address should be about how test requests should be performed and the reasons in support of that test, depending on clinical conditions and/or health-related needs being presented by either individuals or populations. Diagnosis is a complex, patient-centered process of logical construction, where deductive–inductive steps play a crucial part, and where laboratory tests contribute (to a greater or lesser degree, depending on both the appropriateness and the relevance of the choice) to the final judgment. An important consideration is that no single test, by itself, allows a diagnosis to be made; rather, diagnosing implies the application of clinical judgment to an individual after assembling information coming from various sources. In fact, the diagnostic process regards the individual, not the abstract pathology; it is the interaction of the illness with the living individual that needs to be diagnosed, as the clinical presentation may vary, depending on a series of conditions such as gender, age, general state, concomitant diseases, etc. Moreover, laboratory tests are important in the process of differential diagnosis, particularly when dealing with mutually exclusive but similar clinical conditions, where issuing the right diagnosis is an essential prerequisite for appropriate treatment. A crucial and ever-expanding part played by laboratory medicine regards treatment and therapeutic drug monitoring. Moreover, this field has the potential for great advancement, particularly from a pharmacogenetics perspective, which seems able to provide tailored treatments, depending on the genetic constitution of individuals and on their peculiar ability to absorb, use, and eliminate administered drugs. Students are generally instructed in requesting, using, and interpreting test results © 2011 by Taylor and Francis Group, LLC

296

Quality Assurance in the Pathology Laboratory

that allow either the direct measurement of drugs prescribed in definite clinical conditions, or the evaluation of the effects of particular drugs on some body systems. In the context of direct measurement of drugs prescribed for specific conditions, the most common examples are antiarrhythmic drugs, antiepileptic drugs, and some immunosuppressors. In the context of evaluation of effects of particular drugs, the most common example is oral anticoagulant therapy, which deserves particular attention, for explaining the mechanism of action, for the peculiar aspects of the monitoring strategy, or for the risks connected with suboptimal therapeutic regimens. Particular focus is addressed to tumor biomarkers, by stressing their role as a useful means of monitoring rather than diagnosing cancer. In this context, relevant examples are the use of carcinoembryonic antigen in gut cancer treatment and monitoring, prostate-specific antigen in prostate cancer and relapse premonition, α-fetoprotein in liver cancer, HER2 in breast cancer, etc. However, some recent biomarkers deserve growing attention, as they seem to be able to directly monitor the efficacy of the new molecular drugs, such as those employed or proposed in myeloid leukemia or in colorectal cancer. This is also the case in a series of tests that can be advantageously employed for both prognosis and clinical follow-up. Useful examples are (a) the measurement of reticulocytes in different hematological conditions, not only in terms of percentage of the circulating cells but also by measuring the hemoglobin content of reticulocytes, which can be used to identify the presence of iron-deficient states and to assess response to iron supplementation therapy [5]; (b) the acute phase reactants, in particular Interleukin-6 and C-reactive protein [6], in the follow-up and treatment of infections, and also in conditions of low-grade inflammation, such as those described in atherosclerosis [6]; (c) new markers of severity in cases of acute illness, such as procalcitonin in severe infections [7], or trypsinogen activation peptide in acute pancreatitis [8,9], among others. Finally, mention should be made of screening tests, which are an essential tool for preventive medicine. The basic concepts in support of the use of such tests should be explained by taking into account the three key words underlying the notion of screening, which are: population, risk, and sensitivity. Moreover, screening tests are not exclusively performed within laboratory settings, but they frequently need a reference laboratory for performing specific second-instance tests, in order to rule out false-positive cases. Students should be instructed to perform a correct test request, by, first and foremost, reasoning as to the information they expect to gather from laboratory results, and about the possible panel of further tests able to better clarify an unsettled diagnostic frame. Moreover, the correct instruction should be directed at avoiding improper/excessive requests, particularly when considering that the consequent excess information could possibly bias and delay the entire clinical decision-making process. In this context, © 2011 by Taylor and Francis Group, LLC

Education and Training

297

students should be progressively able to justify each test request according to logical and clinically plausible paths. Furthermore, tests should be requested and/or used according to the contextual clinical setting, the needs being different when dealing with patients in emergency conditions (e.g., myocardial infarction, trauma, acute infections, etc.), or for patients in a programmed environment (e.g., routine surgical intervention). Finally, students should be aware that laboratory tests that are performed in a highly professional and technologically complex health facility are expensive items, and that appropriateness in test ordering is a key for saving the not unlimited resources of the healthcare system. The ultimate learning objectives with reference to test ordering can be condensed into the following two sentences: (a) No lab result can make a diagnosis by itself, it only contributes (to a greater or lesser degree) to an individual’s diagnosis; and (b) Diagnosis implies a clinical judgment to be applied to one (possibly diseased) individual, and not to a single disease. Coming back to the issue of appropriateness of test ordering, it seems important to make some distinctions, as they are relevant for educational purposes. Inappropriate, redundant, or repetitive testing produces considerable organizational and economic problems for both the laboratory and the entire healthcare system. Reliable data suggest that up to 50% of the analyses performed daily in clinical laboratories may be inappropriate [10]. Clinicians order excessive tests for defensive reasons, for ease of access, or simply because of fear of uncertainty [11]. On the other hand, healthcare administrators are urging for appropriateness of tests, a term that is frequently regarded as a synonym for cost reduction. Laboratories are particularly targeted in this process of cost containment, as their outlay can be easily measured in terms of costs per outcome, which is not as much as other, perhaps more expensive, yet less easy to monitor healthcare service providers. Clinical laboratories should focus on the best possible quality and the clinical value of laboratory diagnostics rather than on cost per test result. Laboratory budgets are presently well controlled and, consequently, tightly tailored and, thanks to robust gains in efficiency in the recent past, presently there seems little room left for savings without incurring loss of efficacy, a very critical issue, for clinical reasons. However, appropriateness must be intended as a multifaceted task, and the meaning of the word, should we share the notion that appropriateness of care is “the right treatment, from the right professional, in the right place, at the right time,” [10] would both completely change the perspective and appear more suitable for teaching and learning purposes. Consequently, the right instruction should be that patient needs come first, and appropriateness in test ordering follows. The learning objective should be that although appropriateness in test ordering is very important, it is the patient’s reliance on his or her physician for proper care that matters more, both for ethical and legal reasons. © 2011 by Taylor and Francis Group, LLC

298

Quality Assurance in the Pathology Laboratory

9.3.2.2  Preanalytical Issues There is an increasing need to teach, apply, and monitor quality control procedures to those preanalytical phases that do not directly involve laboratory personnel but are prodromal to main laboratory-based processes. Because of the current consolidation of laboratory procedures and testing, which progressively involve external personnel for specimen collection, transportation, and decentralized phlebotomy, many aspects pertaining to the preanalytical phase are getting out of the direct jurisdiction of the laboratory and, increasingly, involve coordination with other medical professionals who, in many instances, share responsibility for the patient’s care. Thus, it is important for medical students to be aware that the preanalytical phase is among the most critical parts of the total testing process [11,12]. Accordingly, a great deal of attention should be paid to this phase during teaching. The major issues to be considered include the following: 1. Patient identification, as errors in this step are potentially associated with the worst clinical outcome. This is because of the possibility for misdiagnosis and mishandled therapy [13,14]. Identification errors are especially common with in-patient samples [14], preparation, timing of sample collection, particularly checking for fasting, when needed, checking for previous stress or exercise conditions, for proper posture and rest before collection, and for possible concurrent treatments or diets. 2. Collection procedures and materials, possibly by standard techniques and equipment. 3. Suggestions to avoid unsuitable occurrences in sampling, such as hemolysis, under-filling of tubes, wrong tubes, etc. In particular, the most common reasons for unsuitable blood specimens are hemolysis and clotting, which traditionally can be traced to incorrect procedures in sample collection [13–15]. Insufficient volume and clotted specimens are the most common causes for rejection of inpatient samples, whereas the prevalence of inappropriate containers is particularly high for outpatient specimens [14]. The optimal sample volume needed for laboratory tests has been defined as twice the analytic volume of serum or plasma required for laboratory tests, plus the dead volume of sample cup, replicates, and secondary tubes [16]. Under-filled tubes of blood may significantly influence the reliability of the results, especially when the anticoagulant-to-blood ratio is critical, such as in coagulation testing. 4. Suggestions for correct sample handling and storage conditions (warm, cold, at a defined temperature, protected from light, etc.) until measurement, and suggestions for accurate mixing, when needed. © 2011 by Taylor and Francis Group, LLC

Education and Training

299

The considerations driving these teaching items are as follows: • A significant part of the pre-analytical phase is traditionally out of direct control or supervision of the laboratory personnel [17,18], whereas this should be done under medical responsibility or supervision. • Although lack of standardization and errors in this critical phase of the total testing process would falsely suggest minimal harm, cases are reported to be associated with adverse patient outcomes [19]. • The uncertainty of measures consequent to poor pre-analytical standardization takes a small but significant part of the whole healthcare budget. • The learning objective that follows is that by both correctly applying standards and monitoring the processes related to the pre-analytical phase, most unexpected deviations/errors that arise outside the laboratory can be prevented and/or corrected, with significant savings accruing [19]. 9.3.2.3  Analytical Issues Analytical quality specifications play a key role in assuring and continuously improving a high quality of medical care [20–22]. Undergraduate medical students should not need formal involvement in the analytical/methodological phase, but some important exceptions are dictated by the essential basic education each physician should gather and be able to display and practice in his or her profession. Among these, which include the basic principles of laboratory instrumentation and methods, some specific practical skills should be acquired for emergency needs, such as 1. Blood smear preparation, common staining and reading procedures, microscopic observations directed to acquiring the skill to distinguish the more common morphological alterations of either red blood cells or white blood cells 2. Urine sediment preparation and microscopic observation, with the ability to recognize the figurate elements 3. Cerebrospinal fluid (CSF) collection, cell count, and cell classification by microscopy 4. The ability to perform and to interpret rapid tests, such as dip tests for some metabolites, in either blood or urine (e.g., glucose, ketone bodies, lactate, urea, ammonia, etc.) 5. The ability to perform either a skin puncture or a venous puncture for blood collection, taking into account the correct location/vessel © 2011 by Taylor and Francis Group, LLC

300

Quality Assurance in the Pathology Laboratory

and the standard procedures and materials, in order to obtain a correct sample for each ordered test, and to prevent contamination or sample dispersion 9.3.2.4  Test Interpretation Laboratory results are generally interpreted by comparison with appropriate reference intervals (RIs) [23]. To introduce students to RIs, they should be taught the fundamentals of statistical theory regarding populations, identification of representative samples, normal and non-normal distributions, and relative calculations to extract parametric and non-parametric measures. Moreover, the influence of variability, both analytical and biological, on laboratory test results should be described, and the ways to distinctly consider either one should be presented. Then, students will be faced with data interpretation using cross-sectional assessment in respect of traditional RIs or longitudinal assessment in respect of the patient’s own previous results. In the latter situation, the concepts of critical difference and reference change value (RCV) are presented, taking into account some perspectives of the so-called personalized interpretation of data. More arguments to be taught in this context regard the analytical efficiency (sensitivity, sensibility, negative and positive predictive values, likelihood ratios, etc.) and the diagnostic efficacy of laboratory tests, and the methods and techniques for controlling laboratory results, such as the procedures for quality control, for signaling an emergency, and panic values for ascertaining the medium-/long-term method and instrument drift, etc. The considerations driving this teaching step are as follows [23]: • Laboratory results are timely representations of an individual’s status • Cross-sectional comparison with RIs is somehow inadequate and can be misleading • Individual longitudinal comparison with RCV appears more promising, and is already currently employed in some instances (glycosylated hemoglobin, anticonvulsant and therapeutic drug monitoring, a series of well-managed clinical conditions, etc.) The learning objectives are as follows: 1. Analytical quality standards should be regarded as essential basic tools for allowing correct comparison, even more so cross-sectional and longitudinal comparisons; 2. To ascertain early changes, for which the intra-individual variation of data from tests exploring metabolic pathways subjected to strict homeostatic control appears more useful than inter-individual variation; © 2011 by Taylor and Francis Group, LLC

Education and Training

301

3. The perspectives of personalization of healthcare deserve more efforts toward both data transferability and individual data collection and conservation over time for medium- and long-term comparison. At the end of the course, students should be aware that clinical laboratories are highly complex organizations, where activities are performed through strictly controlled and standardized processes, and should be able to amplify the potentiality of the medical process of decision making. When properly used, laboratory results can support and increase clinicians’ abilities in caregiving. Laboratory professionals can provide caregiver physicians with pertinent consultations and advice.

9.4╇Laboratory Technicians The activity performed in a clinical laboratory is directed toward providing suitable results by analytical tests, aimed at supporting physicians in the detection, diagnosis, and treatment of diseased patients. Among the professional personnel working in the clinical laboratory, the laboratory technicians—also known as biomedical technicians or medical laboratory technicians (MLTs)—perform most of these analytical features [24]. The main work of MLTs is directed at examining and analyzing biological samples, i.e., body fluids and materials, and cells. In particular, MLTs analyze the physicochemical composition of organic fluids; test for drug levels in the blood, in order to assess the best therapeutic regimen, and to ascertain how a patient is responding to treatment; match and prepare blood for transfusions; and look for bacteria, parasites, and other microorganisms. Moreover, MLTs prepare specimens for histology examination, perform cell counts, and evaluate possible cell abnormalities in blood and other body fluids. The work of MLTs is mainly performed with automated and computerized instruments, cell counters, and other sophisticated laboratory equipment, including the more recent instruments capable of performing arrays of tests mainly directed at investigating alterations at genetic and molecular levels. With increasing automation and the use of computer technology, most of the activities of MLTs have become less hands-on intensive and more directed at monitoring the instrumentation performance through quality controlrelated procedures. Increasingly, the complexity of tests performed by MLTs, the level of judgment needed, and the amount of responsibility that is attributed MLTs depend largely on the amount of education and training they have and on experience they gain. Starting from the mid 1950s on, when clinical laboratories began their main activity and development in hospitals, the education and training of © 2011 by Taylor and Francis Group, LLC

302

Quality Assurance in the Pathology Laboratory

MLTs has undergone an incessant progression toward increasing qualifications on professional profiles. The need for adequate personnel able to work in an environment where the continuous scientific and technological advancements are imposing rapid adaptations in the internal organization and management was and is met by continuously evolving the universitybased curricula and the requirements for entry-level positions. As regards education and training, the main settings to be considered are represented by those countries where the university and healthcare systems appear more diffused and organized, such as the United States on one hand, and Europe on the other. 9.4.1╇The Profession of Laboratory Technologist/ Technician in the United States In the United States, there are two levels of clinical laboratory personnel with technical qualifications: technologists (higher) and technicians (lower). The former are entitled to perform more complex examinations, such as evaluating test results, developing and modifying procedures, establishing and monitoring programs, and ensuring the accuracy of tests. Technologists can supervise one or more clinical laboratory technicians. In some smaller laboratories, direction can be assumed by a technologist, whereas in larger laboratories technologists generally head specialized sections. The usual requirement for an entry-level position as a clinical laboratory technologist is a bachelor’s degree, with a major in medical technology or one of the life sciences; however, it is possible to qualify for some jobs with a combination of education and on-the-job and specialized training. Universities and hospitals offer medical technology programs. Bachelor’s degree programs in medical technology include courses in chemistry, biological sciences, microbiology, mathematics, and statistics, as well as specialized courses focused on the knowledge and skills used in clinical laboratories. Many programs also offer, or require, courses in management, business, and computer applications. The Clinical Laboratory Improvement Amendments (CLIA) [25] requires technologists who perform highly complex tests to have at least an associate degree. Medical and clinical laboratory technicians generally have either an associate degree from a community or junior college, or a certificate from a hospital, a vocational or technical school, or the armed forces. A few technicians learn their skills and gain experience on the job. The National Accrediting Agency for Clinical Laboratory Sciences (NAACLS) fully accredits about 470 programs for medical and clinical laboratory technologists [26], medical and clinical laboratory technicians [27], histotechnologists [28] and histotechnicians [29], cytogenetic technologists [30], and diagnostic molecular scientists [31]. Moreover, NAACLS approves © 2011 by Taylor and Francis Group, LLC

Education and Training

303

about 60 programs in phlebotomy and clinical assistance [32]. Other nationally recognized agencies that accredit specific areas for clinical laboratory workers include the Commission on Accreditation of Allied Health Education Programs [33] and the Accrediting Bureau of Health Education Schools [34]. Some states require laboratory personnel to be licensed or certified. Licensure of technologists often requires a bachelor’s degree and the passing of an examination, but requirements may vary by state and specialty. Moreover, many employers prefer applicants who are certified by a recognized professional association. Associations offering certification include the Board of Registry of the American Society for Clinical Pathology [35], American Medical Technologists [36], the National Credentialing Agency for Laboratory Personnel [37], and the Board of Registry of the American Association of Bioanalysts [38]. These agencies have different requirements for certification, and different organizational sponsors. In addition to certification, employers seek clinical laboratory personnel with good analytical judgment and the ability to work under pressure. Technologists, in particular, are expected to be good at problem solving. Close attention to details is also essential for laboratory personnel, because small differences or changes in test substances or numerical readouts can be crucial to a diagnosis. Manual dexterity and normal color vision are highly desirable and, with the widespread use of automated laboratory equipment, computer skills are important [39]. Technicians can advance and become technologists through additional education and experience. Technologists may advance to supervisory positions in laboratory activity or may become chief medical technologists or clinical laboratory technologists, or laboratory managers in hospitals. Manufacturers of home diagnostic testing kits and laboratory equipment/ supplies also seek experienced technologists to work in product development, marketing, and sales. Professional certification and a graduate degree in medical technology, one of the biological sciences, chemistry, management, or education usually speeds advancement. A doctorate is usually needed to become a laboratory director. Federal regulation requires directors of moderately complex laboratories to have either a master’s degree or a bachelor’s degree, combined with the appropriate amount of training and experience. Clinical laboratory technologists and technicians held about 319,000 jobs in 2009. More than half such jobs are in hospitals. Most of the remaining jobs are in offices of physicians and in medical and diagnostic laboratories. A small proportion of jobs are in educational services and in ambulatory healthcare services. 9.4.2╇ The Profession of Laboratory Technician in Europe In Europe, there is one main recognized level of clinical laboratory personnel with technical qualifications, i.e., medical/biomedical laboratory © 2011 by Taylor and Francis Group, LLC

304

Quality Assurance in the Pathology Laboratory

technician. In the European Community (EC), as well as in Iceland, Norway, Liechtenstein, and Switzerland, the profession of laboratory technician (medical/biomedical laboratory technician) is listed among the professions covered by Directive 2005/36/EC on the recognition of professional qualifications, which entered into force on October 20, 2007 [40]. The profession of laboratory technician falls under the “general system” of mutual recognition of professional qualifications and is regarded as a regulated profession, meaning that access to and exercise of the profession are subordinate to the possession of a specific professional qualification. The professional qualification should be based on a diploma certifying successful completion of two alternative curricula. One of these is training at the post-secondary level, of a duration of at least 1 year, or of an equivalent duration on a part-time basis, with the condition of the successful completion of the secondary course required to obtain entry to university or higher education or the completion of equivalent school education at the secondary level, as well as professional training with a special structure equivalent to the level of training that provides a comparable professional standard and which prepares the trainee for a comparable level of responsibilities and functions (article 11 (c) of the Directive 2005/36/EC). The alternative is training at higher or university level, of a duration of at least 3 years and not exceeding 4 years, (article 11 (d) of the Directive 2005/36/EC). It has to be outlined that article 11 (c) mainly refers to qualifications obtained with former educational rules and curricula, whereas article 11 (d) considers the curricula presently offered by most EU universities. As regards the free movement of persons and services, which represents a key objective of the EC, the general system is based on the principle of mutual recognition, without prejudice to the application of compensatory measures if there are substantial differences between the training acquired by the person concerned and the training required in the host member state. The compensatory measure may take the form of an adaptation period (of a maximum of 3 years) or an aptitude test. The choice between these measures is up to the person concerned, unless specific derogations exist. Moreover, the Directive allows representative professional associations at both the national and European levels to propose common platforms to compensate for the substantial differences identified between member states’ training requirements. 9.4.3╇Main Tasks, Attribution, and Duties of Laboratory Technicians Laboratory technicians are responsible for laboratory-based activities in hospitals, public and private clinical laboratories, research laboratories, and sometimes in healthcare-related industries. Tasks include sampling, preparing, processing, testing, measuring, recording and analyzing results in © 2011 by Taylor and Francis Group, LLC

Education and Training

305

a series of biological samples, including blood, urine, feces, CSF, etc. They also provide all the required technical support to enable the laboratory to function effectively, with constant observance of the correct procedures and of health and safety guidelines. To do so, technicians will be responsible for actions under their competence, conduct laboratory analysis and research pertaining to biomedical and biotechnology analysis, and, in particular, biochemistry, microbiology and virology, pharmacology/toxicology, immunology, CP, hematology, and cytology and histopathology. They are entitled to practice their professional work autonomously, in direct collaboration with the laboratory’s specialized personnel assigned to various operating responsibilities. Within the laboratory structure, they will be responsible, as part of their functions, for the correct fulfillment of the analytical procedures and of their work, in application of the working protocols defined by the lab director/manager; they will assess that the services supplied correspond to the indicators and standards predefined by the lab director/manager. They will also control and verify the correct operation of the equipment employed and provide for its day-to-day maintenance and the elimination of any small inconveniences; they will participate in programming and organizing the work within the lab where they operate; they will perform their activities in private and public accredited laboratory facilities; and they will contribute to the training of support personnel and to the updating of their professional profiles and to research. Specifically, the activities performed in clinical laboratories by technicians are as follows: • Performing laboratory tests in order to produce reliable and precise data in support of patients, physicians, and scientific investigations; • Carrying out routine tasks accurately, and following strict methodologies to perform analyses, fulfilling the total quality system adopted by the laboratory, in order to meet the regulatory and accreditation requirements; • Preparing specimens and samples for analysis; • Constructing, maintaining, and operating standard laboratory equipment, such as centrifuges, titrators, pipetting machines, and pH meters; • Operating and maintaining automated laboratory equipment, such as blood cell counters, clinical chemistry analyzers, and immunometric analyzers; • Operating and maintaining advanced laboratory instruments, such as gas and liquid chromatography analyzers and mass spectrometers; • Operating and maintaining instruments for molecular biology and cytogenetic studies, such as polymerase chain reaction (PCR) © 2011 by Taylor and Francis Group, LLC

306

• • • • • • •

Quality Assurance in the Pathology Laboratory

thermocyclers, denaturing high-performance liquid chromatography (D-HPLC) analyzers, and microarray equipment; Ensuring the laboratory is well stocked and resourced; Recording, and sometimes interpreting, results to be shown to senior colleagues; Using computers and performing mathematical calculations for the preparation of graphs; Keeping up to date with technical developments, especially those that can save time and improve reliability; Demonstrating practical procedures, if working in education; Conducting searches on identified topics relevant to the research; Following and ensuring strict safety procedures and safety checks.

9.4.4╇ Training of Laboratory Technicians When starting with university-based courses, the student lab technician should learn some preliminary concepts and practices dealing with the preanalytic, analytic, and post-analytic phases of laboratory testing, along with other important aspects of specimen collection, handling, and transportation. However, a very preliminary phase should be dedicated to teaching lab technician students some general requisites for laboratories, the knowledge of which should be preliminary to the other phases, regarding the safety regulations and the adoption of general and specific precautions for the technician himself and/or for other lab personnel. As such, the main instructions should regard the following: • Proper hand washing procedure • Using barrier protection routinely, to prevent skin and mucous membrane contamination with blood or other body fluids • Wearing a mask, eyeglasses or goggles, or a face shield during procedures that are likely to generate droplets of blood or other body fluids, or fluffing from fabric contaminated with biological materials • Wearing an impermeable gown, apron, or other covering when there is a potential for splashing or spraying of blood or body fluids onto the body • Disposing of used needles (which should never be recapped), disposable syringes, skin lancets, scalpel blades, and other sharp items by placing them in a solid, specifically designated biohazard container, which should be located as close as possible to the work area • Putting all specimens of blood and body fluids in appropriate biohazard containers with secure lids to prevent leaking during transport

© 2011 by Taylor and Francis Group, LLC

Education and Training

307

• Decontaminating all laboratory work areas/instruments with appropriate/prescribed detergent procedures after a spill of blood or other body fluids and when work activities are completed • As for the pre-analytic phase, and in particular for all procedures pertaining to phlebotomy, an activity that is performed by lab technicians in some countries, the instruction should take into account some relevant issues regarding the correct patient approach; i.e., correctly taking the patient’s personal history, performing the physical examination for the most evident signs of alterations, reassuring the patient about the maneuvers underway, and performing adequate hemostasis afterwards. As phlebotomy is generally considered a prepreanalytic phase performed outside the laboratory, being an activity mainly performed in clinics or in blood withdrawal centers or even at patient’s home, correct instructions should be imparted to the student in order to comply with the quality processes adopted by the laboratory director, so assuring an uninterrupted “chain” of quality. In fact, lack of understanding about good laboratory practices, and inadequate training, create several opportunities for making errors during phlebotomy, which mainly concern patient misidentification and/or collection of unsuitable specimens for testing, due to unsuitable venous access, venous stasis, and inappropriate collection devices and containers. Improved standardization of phlebotomy techniques, along with dissemination of operative guidelines, continuous education, certification, and training of healthcare professionals involved in blood drawing responsibilities would enhance the chance of obtaining specimens of consistent quality, with favorable revenues for the healthcare system and a favorable outcome for the patient [41]. Correct instructions should also consider that every event incompliant with the quality procedures has to be reported, and then resolved. Moreover, during the first steps of the training, considerable emphasis should be placed on addressing the requirement that all data and results coming from patients deserve confidentiality. In the present day, maintaining the security and privacy of medical data is progressively more challenging. The increase in complexity of information technology (IT) environments, the integration and aggregation of data, and the need/desire of other entities (such as research organizations) to access these data, often on a continuous basis, are flawing both the efforts and the ability to maintain security. These issues encompass all electronic data banks, from patient care records and samples or specimens stored along with data to academic medical research records. Some of these issues are being dealt with using the so-called “honest broker” services, which

© 2011 by Taylor and Francis Group, LLC

308

Quality Assurance in the Pathology Laboratory

are software tools for querying availability of specimens, extracting data, and de-identifying specimens and annotating data for clinical and translational research [42]. • Other aspects of the preanalytic phase outside direct laboratory control regard specimen handling and transportation that, when performed over long distances or in adverse environmental conditions, need protective measures to prevent degradation. Due to the increasing consolidation of analytic processes in large laboratories, appropriate and detailed instructions should be provided to either the phlebotomist or the carrier company, to assure the correct transportation conditions for the samples. This part of the preanalytic phase needs separate directions for different tests and different specimens, such as tissues, cells, urine, CSF, etc.; or microbiology, general versus special clinical chemistry, coagulation, hematology, etc.; or specimens for molecular biology that frequently need immediate stabilization, independent of transportation needs, to prevent degradation [43]. • Sample pre-processing and processing are typically attributed to the competence of the laboratory technician. These activities, being predominantly or exclusively done within laboratories, are largely included in the quality procedures of each laboratory. Specimen preprocessing represents an initial step of some analyses that, particularly in the field of molecular biology and microanalysis, can be manual and is generally followed by automatic processing. Nevertheless, many laboratories are increasingly adopting fully automated procedures, claiming better yields and purity of extracted samples [44]. Laboratories that maintain a primarily manual workflow, in particular CP, pathology, and forensic laboratories involved in nucleic acid analysis, employ instruments that perform only the single function of nucleic acid extraction. In this case, accurate instructions should be given, in order to prevent the risk of contamination [45] and misidentification errors. As such, correct instruction should consider the use of positive identification of samples [46], by either employing well-known systems such as barcodes, or novel identification devices such as radio frequency identification (RFID) [47]. Prior to automated extraction, lab technicians should learn how to perform manual pre-processing of samples, following strict control procedures, to avoid contamination and identification errors. Specimens are then introduced into the instruments by either transferring the sample into a processing cartridge or by placing the pre-processing tube into the instrument. After extraction, nucleic acid samples are removed from the system, and manually advanced through the remaining steps of the workflow, such as amplification procedures, © 2011 by Taylor and Francis Group, LLC

Education and Training

309

capillary electrophoresis (CE), chromatography, spectrometry, etc. It should be recommended that the whole of each process should be entirely traceable. New instruments based on liquid handling procedures have now been introduced, and are able to increase the degree of automation of the processes, overcoming the need of manual preprocessing. As a consequence, an increasing number of laboratories that need large throughput, particularly in the field of molecular biology and nucleic acid investigation, are turning to these instruments. Some new problems can issue from the adoption of automated liquid processors. Adequate instruction should be given, as a steeper learning curve is expected, to become familiar with the instrumentation and its use. Moreover, there are initially more chances for errors, as a result of user setup or the nature of complex automated methods, and difficulties in integration with standard workflow. Even in these circumstances, accurate control of procedures should be applied, in order to assure traceability over the entire process. • The analytical phase, which involves specimen processing, is mainly performed by laboratory technicians, who are responsible for the correct application of the procedures approved by the laboratory director and staff. Lab technicians should also perform the procedures for the assessment of analytical quality control, in order to produce and warrant suitable results for clinical use. To this purpose, lab technicians should be taught the chemical and instrumental basis of the tests employed in the laboratory, and the principles underlying the concept of laboratory quality control assessment, both internal quality control (IQC) and external quality assessment (EQA). Clinical biochemistry is the discipline that mainly provides students with general medical laboratory terms and concepts, and the knowledge and skills needed for testing of blood serum or plasma and other body fluids. The laboratory analysis of urine and body fluids is considered part of the taught discipline that includes physical, chemical, and microscopic examination of these fluids. Correct instruction should be anticipated by a rapid overview of the anatomy and function of the kidney and should consider the presentation of the general disorders affecting urinary function and their relationship with macroscopic and microscopic urine alterations. Parallel with the instruction on the analytical phase, mainly that pertaining to clinical biochemistry, lab technician training should be addressed to the correct understanding and use of RIs [48], at least on an essential basis. RIs are generally obtained by cross-sectional assessment with respect to a range of values opportunely obtained from individuals usually matched for age and gender. The instruction on this topic should © 2011 by Taylor and Francis Group, LLC

310

Quality Assurance in the Pathology Laboratory

consider that the interpretation of patients’ data by using predetermined RIs suffers from some caveats. Instead, both the magnitude of differences in test results across populations and the substantial influence of clinical and demographic variables on RIs increasingly seem to justify a parallel approach, enabling a most intelligible and useful interpretation of data, based on the longitudinal comparison of data [23,49]. At the next stage, regarding the analytical phase that pertains to hematology and coagulation tests, training should be addressed to the use of either the automated instruments for complete blood cell counts (CBCs) or the use of clinical microscopes and photometers, to the manual performance of some tests for obtaining hemostasis or performing coagulation profiles on either plasma or cells (e.g., platelets), and to separation methods such as chromatography and/or electrophoresis, isoelectric focalization (IEF), or CE for hemoglobin fractionation. Therefore, lab technician students should become capable of demonstrating theoretical comprehension of hematology/hemostasis, performing complex diagnostic techniques, and basically correlating laboratory findings with disorders. Immunohematology testing is a constitutive part of the activities done in blood bank institutions. As a consequence, lab technicians should learn and be prepared to perform grouping of, and safety and compatibility testing on, blood samples prior to transfusion testing, to process and store donor blood and test materials, and to perform serological or immunologic testing. Basic microbiology and clinical microbiology and virology are cardinal disciplines in the education and training of lab technicians. Topics should include basic knowledge of the taxonomy of microorganisms; structure, organization, physiology, and genetics of the principal parasites; microbial pathogenicity and resistance; the main infectious diseases due to bacterial and viral causes; the principles of immunology and sero-immunological assays; and related practical applications. Upon completion of the course, students should be able to demonstrate knowledge and skills with respect to procedures, including microscopy, aseptic techniques, staining, culture methods, and identification of microorganisms directly by either culture- or serology- or molecular biology-based methods. Instruction in pathology should start with methods that are mainly related to histopathology and cytopathology; at this point, tissue and cell collection and preparation methods should be taught, together with staining principles and procedures; appropriate microscope use (either optical or fluorescent, or based on other physical principles); general histological and cytological microscopy observation; use of special stains; and correct record keeping and filing of slides, paraffin embedded tissue blocks, and frozen © 2011 by Taylor and Francis Group, LLC

Education and Training

311

tissues and cells. As the use of telepathology is growing, students should be trained to the correct digitalization of the slides [50]. Moreover, the student lab technician can also be trained in anatomic macroscopic pathology as an autopsy assistant. 9.4.5╇ End of Training: Validation of the Laboratory Report Immediately following analysis, laboratory results should be delivered and/ or communicated to the requesting physicians. This implies that the results are considered suitable for clinical use or, in other terms, are validated. The procedure of validation represents a professional operation where the skills, competence, and knowledge of the lab technician (technical/analytical aspects), or the lab director, or delegates (biological/medical aspects) meet and merge to issue the complete report. Thus, validation is a crucial aspect, completing the analytical process, which should be clearly defined in its steps, and needs relevant education. Scarce or defective knowledge could lead to competency issues and discourage liability [51,52]. Validation is addressed to identifying any errors by adopting a reasoning strategy on the entire testing process. It is thus aimed at exploring both the analytical side and the clinical side, which could need in-depth re-examination of the process itself, and/or further tests, and/or thorough discussion with the clinicians. In order to comply with the above issues, results that do not pass the first validation step are slightly delayed in their final transmission to the wards. Subsequent operations may range from a simple re-check of the sample to the complete revision of the entire procedure through clearly defined steps. As for the clinical side, the addition of interpretative comments and discussion with the physician in charge about the relevant aspects are crucial for both caring for patient safety and avoiding adverse consequences due to transmission of incorrect results [52]. Both verification and validation of laboratory results have long been human activities, with positive effects as regards immediacy and relative safety, but certainly also affected by potential negative impacts, mainly due to post-analytical errors [53,54]. In most clinical laboratories, both emergency and routine tests are performed on identical instruments with similar procedures, which inevitably require the presence in the lab of full-time staff capable of running these processes. The manual validation of all results is nevertheless a cumbersome activity that must increasingly face the widespread shortage of personnel currently afflicting the healthcare system in general, and clinical laboratories in particular. Other critical aspects of the human validation process are both some subjectivity in evaluating the outcome, and the overall slowdown of the process, due to the need to check each result before it can be “released.” To become familiar with the process of validation, prior clarification of certain issues is necessary, including the © 2011 by Taylor and Francis Group, LLC

312

Quality Assurance in the Pathology Laboratory

definition of “analytical process,” “reliability,” “biological plausibility,” “validation,” and “expert system” (Table 9.1). Like most of the processes that occur in the laboratory, the validation procedure has taken advantage of informatics, and particularly of the development of suitable systems able to embed the knowledge of human experts into decisional procedures. The final product is a validated report, able to support the clinical decision. In this respect, it is noteworthy that more than two-thirds of all clinical decisions are presently made by caregiving physicians on the basis of laboratory results [55]. In this context, the contribution of the MLT to the validation process is clearly discernible in that (a) the MLT is responsible for completing/ providing all the documents that are prepared in his or her area of autonomy/ responsibility and that are part of the analytical processes which the MLT is primarily responsible for; (b) the MLT cooperates in compliance with the standard indicators and predefined procedures as established by the laboratory director or delegate(s). Fulfillment of and compliance with these procedures and standards contribute to the accuracy of the analytical processes of the laboratory, and provide essential support for the traceability of the processes. Any anomaly/deviation should be reported as “non-compliance,” and the director or delegate(s) must be informed, in order to provide for the relevant adjustments. Moreover, through validation of the reports, the laboratory can display its procedural rigor and the overall professional level of the staff. Ultimately, the validation can be viewed as a global review, encompassing the different phases of the diagnostic process, which includes the collection and management of a biological sample (pre-analytical phase), the analysis of the sample (analytical phase), and the biological plausibility of the results (postanalytical phase). Due to the increasing complexity and specialization of in vitro diagnostics, the validation process is an increasingly critical step in the professional laboratory, because it requires a high level of knowledge and, especially if the validation is carried out manually, time and constant application, browsing the individual reports, one by one. The support of informatics-assisted procedures, such as those presented in Figure 9.1, can greatly improve the speed of report release and the increased reliability of the results.

9.5╇Bioinformatics The compelling tasks that laboratory medicine will face in the coming years need strong support from informatics. Laboratories have always embodied the forefront of medical information, from either a managerial or an interpretive point of view, and new tools are appearing in this regard that can © 2011 by Taylor and Francis Group, LLC

Education and Training

313

Table 9.1â•…Glossary of Terms Employed in the Validation Procedure Accreditation

Reliability

Certification

Electronic signature

LIS Biological plausibility

Process/procedure by which an authorized body shall issue a formal recognition that an organization or person is competent to perform a specific task (UNI CEI EN 45020:1998). The process involves setting standards and external audit processes to assess the adherence of health organizations to specified requirements. It can be achieved in different contexts, as follows: 1. Institutional accreditation, i.e., the inclusion of the accreditation process in the country’s legislation, aimed at configuring the accreditation as a tool to select, on the basis of quality criteria, providers of services within or on behalf of the healthcare system. 2. Training, on a voluntary basis, usually enabled by scientific societies and groups of professionals, is achieved through mutual accreditation visits between equals. 3. Accreditation of excellence, on a voluntary basis. It consists of awards acknowledged by third bodies over the institutional accreditation as described in point 1. Feature provided by a measure directed at assuring that it meets the needs and expectations of the applicants. A prerequisite for the reliability of a result is that the measure has been carried out in accordance with the rules on the quality of the data. Formal recognition by a third party of the proper functioning of the quality system, in compliance with a standard international reference (ISO 9000). Three different types of electronic signatures can be presently described, as follows: • Electronic signature – All data are in electronic form attached to or logically associated with other electronic data, used as a method for identifying computers. • Qualified electronic signature – An electronic signature produced by a computer program that guarantees an exclusive association to the signatory; it is created in such a way that the signatory can maintain individual and linked control to the data that he relates to, in order to detect whether the data have been amended. It is based on a qualified certificate and created by a device able to deliver the signature. • Digital signature – A special type of qualified electronic signature based on a system of cryptographic keys, one public and one private, interlocked, which allows the holder using the private key and the recipient using the public key, respectively, to make manifest and to verify the origin and integrity of a computer or a set of documents. Laboratory information system. A laboratory result is considered biologically plausible/acceptable if the combination of the provided data with the relevant information on the patient is not presenting with inconsistencies. Biological plausibility is in close relationship with the current knowledge regarding the mechanisms of development of a disease, and the understanding of the cellular and molecular mechanisms through which a disease progresses. (continuedâ•›)

© 2011 by Taylor and Francis Group, LLC

314

Quality Assurance in the Pathology Laboratory

Table 9.1 (continued)â•…Glossary of Terms Employed in the Validation Procedure Process Analytical process!

A set of related or interacting activities that transform input elements into output elements. Designation used to define the overall phases and/or activities taking place within the laboratory, pointing to a function used in clinical analytical results. The analytical process largely depends on strict adherence to a wide range of operational procedures taking place in phases, some of them possibly working outside of the physical environment of the laboratory (e.g., collection of biological materials). The analytical process is governed by the meticulous application of standards and criteria established and accepted in accordance with good laboratory practice.

Lab result

Information produced in the laboratory analytical process performed on a biological sample or (sometimes) on the patient himself.

Lab report

A written report that predominantly (but not exclusively) contains results. The purpose of the laboratory report is to present the results in a structured form, to facilitate the correct interpretation, through references to relevant information such as RIs and decision making, quality specifications, etc., and/or calculation of any indices derived from the interpretative comments, and/or any useful communications to the attending physician.

System of quality management

Definitions • Management system to guide and control an organization with regard to quality (UNI EN ISO 9000—the fundamentals and terminology 3.2.3). • Organizational and managerial skills, which, according to the current model, is structured by processes. • Set of interconnected processes that contribute to total quality. The quality system, designed and planned for the assurance of quality of products and services, is geared to meet the needs of the user.

Expert systems

Computer programs developed under so-called artificial intelligence. Medical expert systems are created so as to embed the knowledge of specific domains, such as particular aspects of laboratory diagnostics, and able to solve relevant problems by providing answers like those of a human expert. Expert systems are set up by the relevant experts (medical and informatics), using a database and creating a series of interconnected logical rules. Interactive updating is a positive characteristic of an expert system. Validation through an expert system is carried out by examining the internal consistency of data coming from different areas of the laboratory, by comparing them with other biological and clinical information, thus allowing for automatic validation of most of the results.

© 2011 by Taylor and Francis Group, LLC

Education and Training

315

Table 9.1 (continued)â•…Glossary of Terms Employed in the Validation Procedure Lab validation

Critical value

Proof of validity (synonyms: verification, ratification). 1. Technical and analytical validation (competency of laboratory technician, and of nurse in point-of-care testing) confirms the reliability of the result after the correct application of technical/ analytical procedures has been checked. The checks are based on standards included in the analytical process of the laboratory. 2. Biological validation (competency of lab director or delegate) is a further step in validation, to make the results clinically usable; it is based on checks on the biological plausibility of the data (see separate item). It can be accomplished through expert systems (see separate item). 3. Clinical validation (competency of in-charge physician, with the possible collaboration of the laboratory specialist) is the assessment/ evaluation of the clinical consistency of the results provided, considering the specific condition/disease of the patient. The concept of critical value denotes an unexpected result, largely deviant from that of the reference population, which is associated with an imminent danger to the health of the patient, and therefore requires immediate intervention.

make everyday laboratory tasks easier [56]. However, the scientific advancements and the new perspectives of healthcare need an even wider vision, which should consider the preeminent value of the effective translation of the new knowledge, mechanisms, and techniques generated by basic and applied sciences research into new approaches for the prevention, diagnosis, and treatment of disease [57]. The huge amount of consistent data that laboratory tests provide to the healthcare systems and to the scientific community, besides immediate effectiveness at an individual level, could provide unprecedented advantages on the whole. Positive outcomes have already been observed by employing advanced bioinformatics strategies for the efficient retrieval, analysis, and interpretation of autoimmunity data [58]. Moreover, by using network modeling for combining gene expression profiling with functional genomic and proteomic data, breast cancer susceptibility has been evidenced, due to previously unknown associations between centrosome dysfunction and the BRCA1 gene [59]. Higher accuracy has been obtained in the classification of metastatic versus non-metastatic breast tumors using a network-based system [60]. Prostate cancer detection could be improved by selecting new, promising biomarkers using bioinformatics and the analysis of literature [61]. Thus, bioinformatics represents the tool for the creation and advancement of databases, algorithms, computational and statistical techniques, and theory to solve formal and practical problems arising from the management and analysis of biological data. Over the past few decades, rapid developments in genomic and other molecular research technologies and developments © 2011 by Taylor and Francis Group, LLC

316

Quality Assurance in the Pathology Laboratory

Clinical laboratory reporting system

Analytical phase: Clinical laboratory testing process

Result

Validated report

Yes

Biological plausibility by automatic expert system

No

Re-evaluation of the preanalytical variables and of the analytical performance

Validated report

Yes

Evaluation by the clinical pathologist in charge No

Not plausible Notification to the caring physician

Final trasmission of the laboratory report

Figure 9.1╇ Workflow of the process of remote validation for the release of laboratory reports.

© 2011 by Taylor and Francis Group, LLC

Education and Training

317

in information technologies have coupled to produce a tremendous amount of information related to molecular biology. In order to study how normal whole body organic systems or cellular activities are altered in different disease states, the biological data must be combined to form a comprehensive picture of these activities. Therefore, the field of bioinformatics applied to biological data has evolved such that the most relevant tasks now involve the analysis and interpretation of various types of data, including results from blood and urine analytes, nucleotide and amino acid sequences, protein domains and structures, etc. Moreover, the term “bioinformatics” includes a series of subdisciplines that are directed at specific aspects or fields of biomedicine. From a laboratory medicine perspective, particular importance is assigned to health or medical informatics. This deals with the resources, devices, and methods required for optimizing the acquisition, storage, retrieval, and use of information in health and biomedicine. Health informatics tools not only include computers but also clinical guidelines, formal medical terminologies, and information and communication systems. In these contexts, particular relevance is assumed by the potential for the reduction of medical errors, fraud, and duplication of data. The number of errors that can be avoided through the extensive application of correct informatics procedures appears very high, and the lives saved could exceed many thousands per year [62]. 9.5.1╇ Training in Bioinformatics Interdisciplinarity is a prerequisite for training in bioinformatics. Competencies from fields pertaining to biological, medical, mathematical, and information sciences and technologies should merge to create a professional body capable of both carry out unprecedented operations on data coming from genetics, genomics, proteomics, pharmacogenomics, structural biology, microarrays, etc., and extract from them novel information that is otherwise unattainable. This is increasingly viewed as a crucial task, essential for accelerating innovation and improvement in healthcare, and for fully exploiting the results of biomedical research. The educational areas with relevant disciplines/subjects that should be considered in a bioinformatics degree course are reported in Table 9.2. Nowadays, many colleges and universities in America, Europe, and Asia offer bioinformatics courses at either the undergraduate or postgraduate level [63]. Moreover, accessible web-based bioinformatics tools are widely diffused. The increasing need for bioinformatics and bioinformaticians is increasingly sustained by the continuous growth in the number, size, and complexity of databases. Presently, the research is able to deal with databases as large as those generated by the whole human genome, in a sequencing process that is approaching a period of a few weeks. In the near future, such tasks should be © 2011 by Taylor and Francis Group, LLC

318

Quality Assurance in the Pathology Laboratory

Table 9.2â•…Disciplines and Subjects to Be Considered in a Bioinformatics Course Curriculum Basic Disciplines • Principles of organic and inorganic chemistry • Principles of biochemistry and molecular biology • Principles of anatomy and cytology • Principles of physiology • Principles of genetics • Principles of pharmacology Informatics • Image processing • Programming languages • Advanced algorithms • Advanced databases • Analysis and development of biomedical software Mathematics • Statistics Biomedical subjects • Diagnostic imaging and perceptual imaging • Epidemiological methodology, clinical epidemiology, epidemiology, and public health • Incidence and prevalence of diseases in human populations • Modeling of the natural history of diseases • Measure of the association between a determinant and a disease (relative risk, odds ratio, attributable risk) • Methods of standardization and bias • Causative criteria in empirical research • Main designs of epidemiological studies (cross-sectional, case-control cohort, etc.) • Principal designs in clinical trials (parallel-group, cross-over, etc.) • Principles for the validity of experimental design and elementary methods for evaluating the effectiveness of treatments Clinical Biochemistry • Management of pre-analytical steps • Management of data entering • Security and medicolegal issues in the treatment of sensitive personal data • Methodological aspects in the collection of biological samples • Interaction between the LIS and the decentralized collection points • Laboratory networks • Issues in the management of the analytical phase Analytical and biological variability Precision and accuracy Management and development of RIs Automation in laboratory medicine Potential and limitations of highly automated technologies

© 2011 by Taylor and Francis Group, LLC

Education and Training

319

Table 9.2 (continued)â•…Disciplines and Subjects to Be Considered in a Bioinformatics Course Curriculum Traceability, transferability, and longitudinal assessment of laboratory data Management of patient reports Safety reports Validation and processing of analytical data Quality control and improving the quality assurance system • Management of post-analytical phase Principles of interpretation of laboratory tests Concept of delta checks and other tools for the validation of laboratory data Issues related to and potential of expert systems for the validation of results Control systems in medium- to long-term data management • Interpretation of data from complex biological systems (polygenic diseases, cancer, degenerative diseases, etc.) Elements of Biology, Molecular Genetics, and Medical Genetics • Cellular biology, human genetics, and molecular medical genetics • Methods of analysis of genomes and proteomes • Genome-wide analysis and genome arrays • Functional genomics • Epigenetics • Molecular evolution • Specialized genomic databases • Monogenic diseases and complex diseases • Genotype–phenotype correlations • Quantitative genetics • Methods for the genetic analysis of human disease • Analysis of linkage and association studies in population • Gene frequencies • Predictive genetics • Pharmacogenetics Biometrics and Medical Statistics • Measurements in biomedicine • The assessment of biological variability • Methods for the elementary description of biological characteristics • Definition of reference values (percentiles and cumulative distributions) • Elementary probability theory and its applications in the biomedical field (validity of a diagnostic test—algorithms for classification) • Probabilistic models in medicine (binomial distribution, Gauss, Poisson) • Population and samples: Principles of sampling Use of confidence intervals and test hypotheses in health research Key test used in comparative research Linear regression models (continued)

© 2011 by Taylor and Francis Group, LLC

320

Quality Assurance in the Pathology Laboratory

Table 9.2 (continued)â•…Disciplines and Subjects to Be Considered in a Bioinformatics Course Curriculum Bioinformatics Core • Processing of bioinformatics data Basic image processing (filtering, segmentation, etc.) Methods for classification and recognition of “objects” Bayes theory Classification Clustering Support vector machines Hidden Markov models Mixture models Neural networks Models of learning • Models for natural computing Models and methods of discrete structures and cellular dynamics Biological strings Basic operations and algorithms Symbolic analysis of DNA protocols Multiple-set systems and membranes Modeling of protocellular systems Discrete models of metabolism Algorithms and metabolic determination of metabolic parameters from time series Representations and analysis of biological networks Imaging and Data Processing • Bioimaging Segmentation methods: classical active contours in 2D and 3D, atlas-based methods, mutual information-based methods Generalization to the multidimensional case: 3Dâ•›+â•›time, etc. Hard and elastic recording techniques, 2D and 3D Display and interaction techniques • Physics of bioimaging Physics of devices and operating principles (PET, MRI, SPECT, CT, spiral CT, US, 3DUS) Image formation, backprojection (image reconstruction from projections, Radon transform) Reconstruction from projections (x-ray) Analysis of the characteristics of the images in different cases, according to a perspective of image processing Type of noise, signal-to-noise ratio, stochastic modeling of noise (useful for denoising) • Processing of biomedical signals Stochastic signals Autoregressive models Adaptive prediction Linear identification

© 2011 by Taylor and Francis Group, LLC

Education and Training

321

Table 9.2 (continued)â•…Disciplines and Subjects to Be Considered in a Bioinformatics Course Curriculum Polynomial modeling PC/IC analysis, time–frequency Issues of classification Identification and analysis of concrete cases • Perceptual imaging Advanced mathematical tools for vision modeling Foundations of vision (coding of stimulus, performance, interpretation, fundamental phenomena such as the law of Weber, masking, etc.) Spatial vision (textures: perceptual modeling, analysis algorithms for segmentation and classification) Color, Color vision and colorimetry Medical image perception (assessment methods for automatic image quality for the validation of models and/or algorithms, automatic image interpretation using analysis of scan paths, extraction of semantic features, etc.) Information Systems and Decision Support • Decision support systems in medicine Representation and management guidelines Data warehouse systems for medicine and biology Biomedical data mining Ontologies in medicine and biology • Health information systems Health organization and information systems in healthcare Methods for analyzing health processes Divisional information systems; LIS, RIS Integrated management of multimedia data Standards for health information systems (DICOM, IHE, SCP-ECG, ICD-9, HL7, etc.) • Biomedical databases and bioinformatics Modeling and management of medical records Modeling of complex clinical data Modeling of semi-structured data Structuring and querying of databases of clinical and bioinformatics databases Design of databases in support of medical and biological research Biomedical Robotics • Biomedical modeling The course will address the key issues for the proper functioning of a system of surgical diagnosis and monitoring of surgery. Methods will be presented for the generation of physical models of organs, for their calibration, and for the perceptual response of the forces generated by the contact (virtual and/or real) of a surgical instrument with the body (or its model) during a simulated real intervention. Moreover, the course will describe systems methods for rendering the forces and will cover aspects of human perception that supervise the understanding of the interaction with the organs. (continued)

© 2011 by Taylor and Francis Group, LLC

322

Quality Assurance in the Pathology Laboratory

Table 9.2 (continued)â•…Disciplines and Subjects to Be Considered in a Bioinformatics Course Curriculum • Surgical Robotics The course will cover the main aspects and design of a teleoperation system for surgical robotics. In particular, the architecture will allow the main control of teleoperation, the control algorithms of contact with surfaces, the algorithms to compensate for the delay of transmission, and the software structures that can support a system of robotic surgery and ensure the proper operation.

routinely accomplished within a day, with the generation of enormous datasets that will need intense computational power and interpretive capacities. Other aspects concern various biomarkers and the relevant interplay between genes in different pathological conditions such as tumors and degenerative disorders. In neurology and neurobiology, innovations in electrophysiology and optics allow the coordinated electrical activity of hundreds of neurons in a living animal brain to be followed simultaneously [64]. For example, the Allen Institute for Brain Science in Seattle (Washington, United States) has produced a database of gene expression information in the mouse brain that appears too large for making local copies [65]. All these aspects highlight the need for developing new skills and competencies from the embodiment of biology/medicine and informatics, with a strong commitment toward health research and the health sciences. Some researchers are in favor of educational pathways leading to the computational biologist, where the (bio)informatics moiety represents a technique to be used, rather than an essential part in a graduation or specialty course in bioinformatics [64]. In this vision, bioinformatics should represent only part of the curriculum of study, through a series of courses taught in undergraduate or graduate biology programs. Although the argumentation is serious and valuable, we should consider that the need for bioinformatics is widening beyond research purposes, for which such deliberations seem best suited. Database management and organization of health services, biomedical devices for in vivo diagnostics, computer controlled prostheses, reconstructive imaging, etc., appear more directed at utility purposes, thus necessitating professionals with a strong commitment toward application use. In these cases, graduation/specialization courses in bioinformatics appear more justified.

9.6╇ Postgraduate Training in Laboratory Medicine The issue of postgraduate education in laboratory medicine, and the development of an appropriate and comprehensive curriculum for all professionals working in the field of laboratory medicine have been debated for decades. Clinical laboratory science has developed on a broad front throughout the © 2011 by Taylor and Francis Group, LLC

Education and Training

323

world, resulting in significant differences in the definition of a national clinical laboratory service. Therefore, the foremost questions to be answered before going further in this chapter is what we mean by the terms “laboratory scientist” and “laboratory medicine.” According to Eleftherios Diamandis, a laboratory scientist is not exactly a researcher or a teacher or a manager or a medical consultant or an administrator or a physician, but is supposed to be all these, altogether [66]. Therefore, he or she should be able to demonstrate knowledge and skill regarding the specific scientific, technical, clinical, organizational, and management aspects of this field. Laboratory professionals can also be separated into various categories, according to their degree (MD, PhD), field of work (education, service, or research), facility (academic, public or private hospital) and laboratory (public, private, academic, industrial, or government). The delineation of “laboratory medicine” also varies widely from country to country, but it includes the analysis of body fluids, cells and tissues, and interpretation of the results in relation to health and disease, so that there are often few boundaries among biochemistry, hematology, immunology, microbiology, genetics, and biology. Such a heterogeneity of definitions, backgrounds, and activities explains the huge confusion, across countries and even within the same country, on the best approach for providing education, training, and continuing professional development in laboratory medicine. Although postgraduate training is now mainly the responsibility of universities, over the past decades education and training in laboratory medicine were given to graduates (many of them were already working in the laboratory) through heterogeneous study courses that were somehow equivalent to the current ones. Basically, the vast majority of postgraduate training was done on campus and was largely empirical (hands-on experience at the bench). More recently, a variety of postgraduate courses have been established under names more consistently similar throughout Europe, Australia, and the United States, with the generic definition of laboratory medicine encompassing a plethora of different names: “clinical chemistry,” “clinical biochemistry,” “clinical biology,” “clinical pathology,” “microbiology and virology.” Despite the heterogeneous definitions, the main aim of these courses is to develop a common formative curriculum for all laboratory professionals, regardless of their graduate backgrounds, to allow them to work efficiently and profitably in a clinical laboratory. 9.6.1╇ The EC4 Register The leading mission of the European Federation of Clinical Chemistry and Laboratory Medicine (EFCC) is to support and promote clinical chemistry and laboratory medicine in Europe, to aid communication between the International Federation of Clinical Chemistry and Laboratory Medicine © 2011 by Taylor and Francis Group, LLC

324

Quality Assurance in the Pathology Laboratory

(IFCC) and national scientific societies, to develop education and quality in the discipline, and to encourage young scientists to take an active role in these activities [67]. To try and harmonize (if not homogenize) the conditions for all professionals who have met the agreed education and training requirements to be independent (consultant grade) practitioners in laboratory medicine throughout Europe, the EFCC has developed a sound initiative with the European Communities Confederation of Clinical Chemistry and Laboratory Medicine (EC4) Register. The EC4 Register came under the direction of the EFCC in 2007, when EC4 merged with the Federation of European Societies of Clinical Chemistry and Laboratory Medicine (FESCC) to form the EFCC. The title EC4 now solely relates to the EC4 European Register and the Register Commission, and it only applies to those countries within the EU. The Register Commission’s purpose is the operation of the Register and the promotion of clinical chemistry and laboratory medicine within the EU. The EC4 syllabus for postgraduate training, which is approved by all EU societies for clinical chemistry and laboratory medicine, is the basis for the European Register of Specialists in Clinical Chemistry and Laboratory Medicine, indicating the level of content that EU national training programs (common minimal programs) should contain to impart adequate knowledge and experience in this field [68]. Basically, it is acknowledged that postgraduate education and training should still meet the national requirements, but consideration should be given to how such requirements overlap with those of the EU, so that no opportunities will be missed for nationals who wish to practice in other EU countries. Although the term “clinical chemist” is used throughout the syllabus, the EC4 realizes that different names might exist in different countries to describe the profession according to the definitions of IFCC. Moreover, since different structures of medical laboratories exist in their national environments, the syllabus is focused on the “minimum scientific content” and “core elements” for professional knowledge and training, appreciating the national authority and responsibility of each member state to organize laboratory medicine within in its own national healthcare system. The program is thereby developed under a modular system, enabling the clinical chemist to adjust competency to the demands of national authorities. According to the EC4, training must involve dedicated postgraduate study of at least 4 years, following a comprehensive and appropriate university education of at least 5 years. Postgraduate education should also provide comprehensive knowledge of the biology of diseases and the procedures and analytical techniques used in a medical laboratory. It is important that there should be a commitment to research and development, which will often be undertaken in association with clinical colleagues. The main issues comprising this program include (a) knowledge of biochemistry, hematology, microbiology, parasitology and immunology, © 2011 by Taylor and Francis Group, LLC

Education and Training

325

genetics and the biology of reproductive medicine; (b) pre-analytical conditions; (c) evaluation of results; (d) interpretation (post-analytical phase); (e) laboratory management; and (e) quality insurance management. The specific knowledge, besides a common minimal program, also includes the following [68]: • Indications for clinical chemistry procedures in the early detection of disease, in epidemiology, in disease-related diagnosis, in organrelated diagnosis, in monitoring vital functions and response to therapy, in the field of therapeutic drug monitoring, as well as indications for subsequent specialized examinations and functional tests. • Influence of methods of collection and storage of specimens, including place and time of sample collection; preservation; influence of nutrition, drugs, and posture; choice and correct use of anticoagulants and transport media; care of specimens; identification of specimens; transport and storage of specimens; and influence of temperature, freezing/thawing. • Methodological evaluation of analytical methods, including precision and accuracy, reference methods and statistical comparison of methods, IQC and EQA, analytical specificity and analytical sensitivity, interferences. • Case-related medical evaluation of laboratory tests and methods, with specific skills elated to evaluation (longitudinal comparison of data, patterns of abnormalities, critical difference, critical values, etc.), definition and establishment of reference values, decision thresholds, therapeutic monitoring, differential diagnosis, testing strategies applied to clinical questions, laboratory data reporting, and advice for further investigations. • Clinical training, specifically consisting of participation in ward rounds as a member of the clinical team, and other contact (e.g., seminars and case discussions) with the users of the laboratory service; and studies on organ function, anatomy and physiology, metabolism, biochemical exploration and testing, pathophysiology of disease. • Research and development, with special focus on innovation and improvement in analytical methods and techniques, procedures to test and evaluate methods and technical components, evaluation of laboratory-based and clinical research projects, analysis and documentation of results obtained through basic and applied research, statistical and scientific presentation of results, collaborative planning of clinical research, and publication of papers reporting new or improved laboratory methods and clinical research papers. • Laboratory management and quality assurance, which should include laboratory organization and quality management (analysis © 2011 by Taylor and Francis Group, LLC

326

Quality Assurance in the Pathology Laboratory

of workflows and procedures, selection of equipment and methods, cost-benefit analysis), quality assessment, medical informatics, education of laboratory personnel, basic knowledge of clinical epidemiology, laboratory safety (e.g., hazards from infectious samples, noxious chemicals and isotopes, and mechanical and electrical devices), legal and ethical regulations, and medical laboratory certification and accreditation. 9.6.2╇ Postgraduate Education in the United States Since several different training traditions for postgraduate education of specialists in laboratory medicine have coexisted for decades in the United States, a highly academic venue focused on translating research laboratory technologies into clinical practice (laboratory medicine) has been combined with a community practice-based tradition emphasizing clinical consultation and resource management (clinical pathology), with the aim of producing training programs that integrate all the diverse subdisciplines of CP and that are centered under the broader aegis of pathology. This cohesive training, research, and service environment is however peculiar to the United States, whereas in the great majority of other countries training in the subdisciplines more frequently remains discrete and/or embedded within other medical specialties. As such, training in the United States, and in those other countries that share this approach, must not only convey subdisciplinespecific information, but also enshrine the common approaches, competencies, and world view shared by these pathology subdisciplines. In 1995, four major pathology organizations, the Association of PatholÂ� ogy Chairs, the College of American Pathologists (CAP), the Academy of Clinical Laboratory Physicians and Scientists (ACLPS), and the American Society for Clinical Pathology (ASCP), formed a conjoint committee to examine issues related to optimal CP training, which culminated in the publication of the Graylyn Conference Report [69]. The task force concluded that after completing CP residency training, the resident should have acquired enough skills to direct and manage clinical laboratory services, and be able to (a) serve as a consultant to physicians on cost-effective test strategies and interpretation of results; (b) select, evaluate, and apply laboratory instruments and procedures appropriate to the screening, diagnostic, and monitoring needs of clinical decision making; (c) plan, organize, staff, and direct laboratory resources; (d) use the techniques of medical informatics to acquire and manage data, translate data to clinically useful information, and communicate that information in support of patient care and educational programs; and (e) play an influential role in medical staff and healthcare delivery activities that reach beyond the confines of the laboratory [69]. Since 1995, however, several changes have occurred © 2011 by Taylor and Francis Group, LLC

Education and Training

327

in clinical practice and in the philosophy behind residency education and evaluation. In particular, the Accreditation Council for Graduate Medical Education (ACGME) has mandated the development of a defined curriculum for trainees in all medical specialties, focused on six main areas of competency, which include patient care, medical knowledge, practice-based learning and improvement, interpersonal and communication skills, professionalism, and systems-based practice [70]. A further change was the reduction, by 12 months, of the period required by the American Board of Pathology (ABP) for pathology training, so that the total training was decreased from 5 to 4 years in the case of the combined anatomic pathology (AP)/CP certification qualification and from 4 to 3 years for qualification in AP alone or CP alone. In response to these changes, in 2006 a curriculum in CP was further developed under the auspices of the Academy of Clinical Laboratory Physicians and Scientists (ACLPS, a part of the ASCP), taking into account newly designated and revised areas of residency core competency, the alterations in training requirements promulgated by the ACGME and the ABP [71,72]. Accordingly, the overall goals of a training program in CP were defined, so that a pathologist should develop the following skills: (a) capability of communicating test results as a medical consultant to other clinicians and to patients, as well as being capable of optimally directing the management of the clinical laboratory enterprise (the pathologist understands the science and technology of the clinical laboratory and assures the quality, clinical appropriateness, and usefulness of the data produced by that laboratory. The pathologist is a clinician first and foremost.); (b) knowledge and understanding of methods of diagnostic test development, test utilization in the context of both generally applicable as well as patient-specific clinical settings, and assay interpretation in the acute and chronic clinical management of patients; (c) understanding of methods and implementation of clinical laboratory-based therapeutics, including minimally manipulated and engineered cellular therapy; (d) skills to consult in these areas at the broader systems level, and in the various extant healthcare delivery models; and (e) understanding the role of research, in its broadest definition, in clinical decision making, test development, knowledge generation, and continuing education [71,72]. Since it is recognized that basic residency training in CP, like that in AP, is designed to produce a generalist pathologist, concentrated and protected rotations, structured as subdiscipline specifics, have been generally recommended (for example, a rotation in chemical pathology rather than a joint rotation in chemical pathology and microbiology). Some rotations at higher levels and during the more advanced years of training, when the trainee has acquired basic skills, may be productively cross-disciplinary within the broad field of pathology. The general outline for rotations is conceived as follows: chemical pathology (includes toxicology/xenobiotic management)—level I (3–5 months), level II © 2011 by Taylor and Francis Group, LLC

328

Quality Assurance in the Pathology Laboratory

(1–2 months); hematology (includes flow cytometry, coagulation, and medical microscopy)—level I (3–5 months), level II (1–2 months); microbiology (includes bacteriology, mycology, parasitology, and virology)—level I (3–5 months), level II (1–2 months); transfusion medicine (includes apheresis and cellular therapeutics)—level I (3–5 months), level II (1–2 months); immunopathology (includes tissue typing)—level I (1 month), level II, sometimes combined with other rotations, especially chemical pathology or microbiology; molecular diagnostics (includes cytogenetics)—level I/II (1–2 months); management and informatics—level I/II (1–2 months; both levels may be incorporated as an integral part of other rotations) [71,72]. The specific aspects emphasized in this program of training were reviewed by Smith et al. Among suggestions for competency evaluation methods for CP residency training, Smith et al. also indicated patient care, medical knowledge, practice-based learning/improvement, interpersonal and communication skills, professionalism, and a systems-based practice. More recently, however, the original panel was convened to address further challenges in resident education, and how to overcome them. Current challenges include the heterogeneity of the discipline (which requires analytical, medical, and managerial knowledge), the diverse armamentarium of clinical laboratory testing, and the need to better integrate the resident into the work flow of the laboratory, especially with respect to clinical consultation [73]. Basically, to facilitate teaching by faculty, and learning by residents, most training programs have adopted sequential training in the different CP subdisciplines. However, all the panelists agreed that for CP programs to be successful in imparting useful scientific, clinical, and practical training, residents need to be actively involved in several analytic aspects of laboratory testing and clinical consultation. The proposed model of active learning involves participation in conferences, in-laboratory activity (test performances, data analysis, use of electronic databases), management experience (participation in surrogate “laboratory director” role, in six sigma analysis or LEAN analysis of laboratory processes), formalization of clinical consultation, reinforced interaction between CP residents and test orderers, and regular meetings with attending physicians. Among the various clinical consultation activities in CP, the ACLPS lists selection of appropriate tests; suggestions for proper sequencing and timing of testing; suggestions for alternative tests; recommendations for optimizing collection, handling, and storage of the specimens; interpretation of results and discussion with the ordering physicians; formal consultation; patient interaction; analysis of laboratory test results and their appropriate communication; economical and practical considerations regarding laboratory testing; new test evaluation; and research. Another important point was the need to identify suitable approaches for evaluating competency, and the panelists focused on the two broad areas of data interpretation and clinical consultation. Objective © 2011 by Taylor and Francis Group, LLC

Education and Training

329

evaluation of technical and analytic competency includes microscopy unknowns, oral examinations, problem sets, and written examinations, whereas objective evaluation of clinical consultation was defined as availability, affability, and ability. Most evaluations can be based on encounters at sign-out, rounds, morning reports, and clinical conferences, so that resident presentations provide an opportunity for faculty to assess residents’ abilities to understand literature and apply logical thinking. 9.6.3╇ Postgraduate Education in Italy Postgraduate training in the Italian system has recently been revised, being included in the broad area of “clinical services,” and, in particular, in the subarea called “diagnostic and therapeutic clinical services,” together with microbiology, virology, and pathology. Such training involves dedicated postgraduate study of 5 years, following a university education of 6 years in medicine, and 5 years in life sciences, chemistry, or biotechnology. The educational goals of this course of study are (a) interdisciplinary goals in the subarea of diagnostic and therapeutic clinical services, including knowledge of molecular pathology, physiopathology, general pathology, immunology, and immunopathology; (b) basic goals in clinical biochemistry, including knowledge in analytical chemistry, biochemistry, molecular biology, and medical statistics; and (c) specific goals in clinical biochemistry, including knowledge about the fundamental major organ and system diseases, and their monitoring and prevention [74]. Basically, a postgraduate student is required to acquire skills in analytical instruments utilized as diagnostic tools, as well as in procedures for the collection, storage, and transport of biological samples (preanalytical variability) and the setting up of a biological bank. Moreover, the student should be familiar with the quality specifications in basic clinical biochemistry fields and clinical molecular biology, as well as management/organization issues in the laboratory, including the application of the current legislation, safety, ethics, and deontology rules. At the end of the course, the student should be able to use informatics and media tools to authorize analysis, and to interact with local public health organizations. Further integrative goals are devised, such as knowledge about diagnostics in internal medicine, endocrinology, hematology, gynecology and obstetrics, transplantation, occupational medicine, also considering the role of laboratory medicine as a biotechnological support for therapy. Practically, the educational program includes some mandatory professional activities, such as participation in seminars and meetings; participation in the diagnostic run for at least 1000 patients; attendance at the outpatient clinic (for at least 1 month); attendance at the emergency lab (1 month); attendance at the automation lab (1 month); attendance at the hematology lab, including using a cytofluorimeter, and using an optical microscope for © 2011 by Taylor and Francis Group, LLC

330

Quality Assurance in the Pathology Laboratory

blood and bone marrow smear tests (3 months); attendance at the clinical cytology lab, including performing urine sediment tests, and stool analysis, with parasite detection (2 months); attendance at the protein lab (1 month); attendance at the immunoallergology lab (2 weeks); attendance at the tumor markers lab (2 weeks), attendance at the endocrinology lab (1 month); attendance at the clinical biochemistry separation lab (1 month); attendance at the clinical pharmacology and toxicology lab (2 weeks); attendance at the cell biology lab (1 month, with set up of cell cultures); attendance at the biochemistry, molecular biology, and genetics labs (11 months); attendance at the microbiology and virology labs (2 months); attendance at the analytical chemistry lab, using mass spectrometry, nuclear magnetic resonance, etc. 1 month); presentation of at least one seminar on laboratory medicine each year; and participation in at least three clinical experimental projects or projects comparing inter-laboratory analytical methods or quality assurance programs [73]. 9.6.4╇ Postgraduate Education in the United Kingdom Education and training to become a senior professional in the United Kingdom is coordinated at the national level, and is largely dependent upon completion of the MRCPath examination. Basically, approval of curricula for postgraduate medical training in the United Kingdom is under the authority of an independent regulatory body, known as the Postgraduate Medical Education and Training Board (PMETB). For medical trainees in clinical biochemistry, the PMETB approved the current curriculum for specialty training in chemical pathology in 2007. This curriculum has been revised in line with the policy of the PMETB to ensure that education and training are suitable for the purpose of preparing doctors for the future [75]. This specific curriculum encompasses a 5 year training but entry is competitive and requires a medical degree, plus 2 years of foundation training, or its equivalent. The curriculum is divided into four stages, and progression through those stages is dependent on successful annual assessment and completion of the relevant stage of the MRCPath examination. In stage A (12 months), the trainee gathers a comprehensive understanding of the principles and practice of chemical pathology, under direct supervision. In stage B (12–24 months), the trainee applies knowledge and understanding to most of the day-to-day issues, but still requires consultant input for complex management and clinical aspects. In stage C (12–24 months), the trainee undertakes specialized training, and is largely responsible for his or her practice. Finally, in stage D (12 months), the trainee demonstrates a level of clinical and professional judgment commensurate with independent practice at the consultant level. Completion of specialty training in chemical pathology © 2011 by Taylor and Francis Group, LLC

Education and Training

331

requires clearing the MRCPath examination and successful performance in the in-training assessments. Thereafter, the Certificate of Completion of Training (CCT) enables the trained individual to enter the Specialist Register and so be eligible to seek consultant posts. The leading content of the curriculum comprises two aspects. These aspects are good medical practice and core chemical pathology, and good medical practice, which is developed through demonstration of compliance with several standards of good clinical care, maintenance of good medical practice, teaching and training, appraising and assessing, relationships with patients, working with colleagues, health, and probity. The core curriculum also contains hundreds of standards that describe the scope of practice of the modern profession of clinical biochemistry, encompassing the knowledge required, the skills developed from application of the knowledge, and the attitudes developed as a result. The final scope of this standard presentation is to produce reliable measures of competence [75]. Clinical scientists, however, enter training in clinical biochemistry through a competitive route. The minimum requirement is a BSc Honors degree in a relevant subject, such as chemistry or biochemistry. In practice, however, the competition for entry into the fixed number of training posts means that most trainees have higher qualifications, including many with a research doctorate. A minimum of 4 years’ specialist postgraduate training is required for registration as a clinical scientist with the Health Professions Council. The Department of Health designates and funds training posts, with numbers linked through workforce planning aimed at the future needs of the profession. In clinical biochemistry, supernumerary funding is usually for 3 years, up to the completion of Grade A training, although in some parts of the United Kingdom funding is for 4 years, to the point of registration. Registration as a clinical scientist requires the Certificate of Attainment of the Association of Clinical Scientists. The standards for certification in clinical biochemistry include the requirement to demonstrate the following competencies: scientific knowledge, clinical proficiency, technical training, research and development, communication, problem solving, and management. Trainees maintain a training portfolio, which is used at interviews to assess compliance with the standards. For clinical biochemistry, the detailed content of the discipline-specific curriculum is determined by the Association for Clinical Biochemistry, and is completed by Grade A trainees in a 3 year program. The MRCPath examination is the professional qualification that virtually concludes the training in clinical biochemistry in the United Kingdom. Both medical and clinical scientists sit the identical examination, although they will normally take different training times to be ready for the examination. The examination, which is organized at a national level, may conveniently be divided into two parts. MRCPath part 1, is essentially a test of knowledge, and comprises © 2011 by Taylor and Francis Group, LLC

332

Quality Assurance in the Pathology Laboratory

2–3â•›h written papers, and a four-part practical examination over 3 days. Part 2 is essentially a measure of competence based on a written record of individual work (dissertation to describe an original research project), and a searching 1â•›h oral examination to assess the competence of the individual to function as an autonomous practitioner at the consultant level. Therefore, the MRCPath examination is the end point of the training of clinical scientists in clinical biochemistry. Study for the MRCPath examination takes place during a period of approximately 5 years of higher specialist training, which commences following the completion of Grade A training. Registration as a clinical scientist is normally achieved during the first year of higher specialist training, and this confers the ability to work unsupervised in agreed areas. Therefore, overall, the normal period of training for a clinical scientist to complete their MRCPath is 8 years. 9.6.5╇ Postgraduate Education in Other European Countries In many countries, the new generation of laboratory scientists comes from among graduates of the biological sciences. Their training in the sciences is usually of high quality, but is almost totally lacking in the clinical application of their scientific knowledge. Most often, they obtain this clinical knowledge by on-the-job training and experience. A unique situation for clinical biochemistry exists in the Netherlands, since it is practiced almost exclusively by science-oriented professionals. They are enlisted in the Register of Recognized Clinical Biochemists, supervised by the Netherlands Society of Clinical Chemistry. Training as a clinical biochemist consists of a 4 year period in a hospital laboratory; it is not a specific university education. Strictly specified requirements also exist for trainees, tutors, laboratories, and hospitals to maintain the quality of the profession. The candidate has to become acquainted with a variety of issues, including general clinical biochemistry, hematology, fundamental research, clinical orientation, and management. Passing the yearly examination and publishing two articles in international journals are mandatory. Although continuing education is not yet compulsory, it is formalized within the national society [76]. Like other disciplines of laboratory medicine, clinical biochemistry in France is taught in both the regular medical and pharmacy curricula, but medical teaching is more oriented toward the interpretation of laboratory findings than toward test performance. At present, however, there is no compulsory program of lifelong continuing education, but there are plans to introduce such an obligation in the near future. The practice of laboratory medicine is regulated strictly by the national health administration. Clinical laboratories are multidisciplinary, simultaneously covering clinical biochemistry, microbiology, parasitology, hematology, and immunology. The only officially recognized laboratory profession is that of director of a medical © 2011 by Taylor and Francis Group, LLC

Education and Training

333

analysis laboratory. The practice of this profession is only open to physicians and pharmacists, provided they have graduated in medical biology after 4 years of specialized training through a particular type of residency called the “internat.” The “interns” are selected by competitive examination. After completing their curriculum, specialized physicians or pharmacists can, without further examination or certification, enter a career in a hospital, a university, or both, or direct or codirect a private laboratory. In such a scheme, clinical biochemistry exists as a separate academic discipline, but barely as a distinct profession [77]. Clinical biochemistry in Spain was first established in 1978, as an independent specialty. It is one of several clinical laboratory sciences specialties, together with hematology, microbiology, immunology, and general laboratory science. Graduates in medicine, pharmacy, chemistry, and biological sciences can enter postgraduate training in clinical chemistry after a nationwide examination. Training in an accredited clinical chemistry department is for a duration of 4 years. A national committee for medical and pharmacist specialties advises the government on the number of trainees, the program, and the educational units accreditation criteria. Technical staff includes nurses and specifically trained technologists. A continuous education program is organized by the Spanish Society for Clinical Biochemistry and Molecular Pathology (SECQ) [78]. In Croatia, the specific model of education and practice in clinical chemistry is almost exclusively based on medical biochemists academically educated at the Faculty of Pharmacy and Biochemistry. The model, which has been successfully used for more than 40 years in the Croatian healthcare system, foresees an undergraduate education in clinical chemistry, consisting of 4 years of specific university education, which provides for all requirements to maintain the high quality of the profession. Postgraduate education, leading to more specific scientific and professional expertise, is further regulated by the laws issued by the Ministry of Health and the Ministry of Science and Technology. Besides undergraduate and postgraduate education, there is also a compulsory program of lifelong continuing education, recognized by the Croatian Chamber of Medical Biochemists [79]. In Macedonia, the specialization in medical biochemistry/clinical chemistry is only for physicians and pharmacists, as regulated by law. While in most European countries different professionals (such as physicians, chemists/biochemists, pharmacists, biologists, and others) can specialize in clinical chemistry, the leading issue for the next generation of specialists in Macedonia is whether to accept the present conditions, or to attempt to change the law to include chemists/biochemists and biologists as well. Such change in regulation would also modify the entire national postgraduate educational program in medical biochemistry in accordance with the European EC4 syllabus. However, to obtain sufficient knowledge in clinical chemistry, © 2011 by Taylor and Francis Group, LLC

334

Quality Assurance in the Pathology Laboratory

the duration of vocational training (undergraduate and postgraduate) for all trainees (physicians, pharmacists, chemists/biochemists, and biologists) should be not less than 8 years [80]. In Russia, specialized education of clinical laboratory physicians who work as medical technologists, heads of laboratories, or heads of laboratory divisions is conducted during various forms of postgraduate training, namely, internship, primary specialization courses, advanced study courses, graduate clinical studies, and postgraduate fellowship. Such education is offered at departments for clinical laboratory diagnostics, which are located within the institutes for advanced medical studies or at faculties for advanced medical studies in medical institutes. To date, the primary specialization courses and the advanced study courses have been the most prevalent forms of training clinical laboratory professionals. These two types of courses offer formal lectures and seminars, as well as practical classes, and the course contents are regulated by a uniform curriculum promulgated by the Ministry of Health. Training in these courses is the necessary prerequisite to obtain a degree of advanced qualification as an expert in clinical laboratory diagnostics, which in turn provides access to positions offering better remuneration [81]. 9.6.6╇ Postgraduate Education in Other Non-European Countries The Canadian healthcare system is operated governmentally, at the provincial level. Although most physicians are remunerated on the “charge per service” basis, laboratory physicians (including medical biochemists) are among the few who are remunerated by salary. The training of medical biochemists is basically regulated by the Royal College of Physicians and Surgeons of Canada, by means of a residency program of 4 years duration, following graduation from medical school and completion of the required internship. The training of clinical biochemists, whose functions overlap many of those attributable to medical biochemists, is regulated by the recently created Canadian Academy of Clinical Biochemistry (CACB), through a certification process incorporating written and oral examinations, approximately 1 year apart. Recognized and accredited training programs for clinical biochemists exist in several medical schools; these courses are of 2 or, occasionally, 3 years duration, and entry to these programs requires a PhD and, preferably, some postgraduate research experience. Details of both medical and clinical biochemistry training programs reveal a difference in emphasis and duration rather than in course content, with medical trainees required to spend at least 1 of their 4 years of training in clinical disciplines relevant to the practice of biochemistry [82]. Education of clinical biochemists in Australia occurs primarily after the student has attained a basic degree (in science or applied science), and is employed in a clinical laboratory, either public or private. In the case of © 2011 by Taylor and Francis Group, LLC

Education and Training

335

medical graduates, professional education is carried on under the auspices of the Royal College of Pathologists of Australia, and results in the successful candidate obtaining the status of a “Fellow” of that professional body. While scientists have a number of means of obtaining postgraduate qualifications in clinical biochemistry, formal recognition is conferred by the membership and fellowship examinations of the Australian Association of Clinical Biochemists (AACB). The majority of the programs for the training and continuing education of clinical biochemists are undertaken by the AACB. Currently, there are no formal registration requirements for laboratory scientists within Australia [83]. The Taiwan Society of Clinical Pathologists (TSCP) has developed guidelines for postgraduate education of laboratory medicine and the certification/recertification of clinical pathologists in Taiwan. For certification of clinical pathologists, TSCP has established “Guidelines and Scope of Resident Training” and “Standards for Training Hospitals in Clinical Pathology,” administers board examinations, and issues board certifications/ recertifications. Basically, there are two forms of CP resident training programs, including a straight CP program with 3 years of CP training for a CP certificate, and a combined program with 3 years of AP training and 2 years of CP training for both the CP and AP certificates. The core curriculum for CP training basically includes the following: clinical chemistry (at least 4 months); clinical microscopy, including parasitology (at least 3 months); clinical hematology (at least 4 months); clinical microbiology, including clinical virology (at least 4 months); immunohematology and blood banking, also known as transfusion medicine (at least 3 months); clinical serology and immunology (at least 4 months); and issues on laboratory management (at least 2 months). In recent years, the board examination has also emphasized the subjects of molecular biology and laboratory informatics. The TSCP has also established an accreditation and inspection program for CP residents in training hospitals, so that each hospital accredited for CP training is required to have a detailed teaching protocol. Moreover, the TSCP offers credit hours of education in laboratory medicine by sponsoring scientific and educational programs, which are required for recertification. Recertification requires at least a 100 credit hours of continuing education [84]. A similar program of training is currently being tested in Japan. As an example, the Tenri Hospital resident system was introduced in 1976, and the training program for laboratory medicine began in 1982. The program encompasses emergency tests, blood transfusion, and microbiology (particularly Gram stain and sputum culture) as practical matters. Along with these, it is also required to acquire knowledge on how to reply to consultations from physicians, on laboratory workflow, and on interpretation of laboratory data at reverse clinical pathology conferences [85]. The leading objective of this training is to gain skills for appropriate laboratory utilization and © 2011 by Taylor and Francis Group, LLC

336

Quality Assurance in the Pathology Laboratory

interpretation, and develop communications and consultations with clinical pathologists and medical technologists. Particular emphasis is also being placed on cooperation with medical technologists.

9.7╇Bioethics in Laboratory Medicine Although professional ethics can be considered the indispensable moral background linking a specific profession to the stakeholders, ethical issues have been and still are often overlooked by professionals in laboratory medicine [86]. Nevertheless, a clear understanding of the huge complexities to be taken into account to attain individual welfare and the common good is the cornerstone of full professional involvement in leading healthcare challenges. Allocation and optimization of healthcare resources, collection/management of biological specimens for clinical testing and research, reliability and efficacy of testing, confidentiality, operator’s safety, and the laboratoryclinical interface are among the main ethical issues that challenge laboratory professionals. Scientific discoveries, special knowledge, and more complex technology have paved the way to a new world of laboratory diagnostics. However, due to the huge economic crisis, healthcare systems worldwide are struggling with a dramatic shortage of resources. Therefore, implementation of new tests, selection of the most suitable instrumentation and analytical techniques, laboratory organization (e.g., consolidation, automation) must be considered important ethical issues. Any unfavorable solution associated with unnecessary expenditure for the laboratory and the entire healthcare system is no longer acceptable. There is an enormous danger in this, unless growth and power are accompanied by a strong sense of ethical responsibility. The key to success, in this context, is placing major emphasis on the appropriateness of a test request, establishing a virtuous path of cost-effectiveness analysis that will enable the reduction of unnecessary testing, and/or introducing new, pathbreaking tests that can effectively modify clinical decision making. The potential conflicts of interest with the diagnostic industry are an additional ethical aspect and should be clearly disclosed. The general principle of healthcare ethics is that the patient’s health and welfare are supposed to be of paramount importance. First and foremost, all patients are equal, so the laboratory should treat all patients’ sample fairly and without discrimination. Although adequate information for the proper identification of the patient should always be collected, to enable the requested test and other laboratory procedures to be carried out, unnecessary personal information should not be collected. The patient should also be informed about the aim for which this information is collected. All procedures carried out on a patient, including laboratory testing, require an © 2011 by Taylor and Francis Group, LLC

Education and Training

337

informed consent. Forcing the patient to undergo testing of any kind or not explaining comprehensively the reason for collecting specimens is an invasion of privacy and a clear violation of human rights. Traditionally, consent can be inferred when the patient presents himself or herself at a laboratory with a request form and willingly submits to the usual collecting procedures, but hospitalized patients should be always allowed to refuse a test. Particular tests, especially those requiring invasive procedures (e.g., arterial blood testing, CSF analysis), will require a more detailed explanation, even a written consent. The performance of some special tests, such as the human immunodeficiency virus (HIV) test, might also require particular advice or pre- and posttest counseling. As an example, according to the National AIDS Control Organization (NACO) guidelines, the laboratory should not perform an HIV test unless the individual has been given pretest advice, and posttest counseling is ensured; informed consent is to be obtained before the collection of the specimen, and the result should be kept strictly confidential. It is good laboratory practice to inform the patient (especially when explicitly requested) about the meaning of the tests being performed. As such, the patient should be familiar with the difference between “screening” and “diagnostic” tests. Here, it is useful to mention a paradigmatic example. The prostate-specific antigen is the biomarker of choice for the screening for prostate cancer. Nevertheless, recent data emphasizes that a positive value can be observed in a myriad of other conditions, both physiological (e.g., benign prostate hypertrophy, sexual intercourse) or pathological (e.g., infections, trauma), whereas a negative value, using the traditional cutoff of 4.0â•›ng/mL, does not definitely rule out the presence of a cancer, being associated with only 80%–90% sensitivity. The incessant growth of molecular biology has also contributed to generating new dilemmas, placing clinical laboratories in an uncomfortable position. The ethical boundaries of genetic testing are a matter of debate, in that the equation “genotype to phenotype” has still several drawbacks. Our limited understanding of the complex biological mechanisms underlying genetic expression, especially in multigenic disorders, requires a careful and pondered approach, while considering that laboratory professionals are in the prominent position to provide counseling and knowledgeable information to patients. Finally, when samples are collected for research purposes, a clear approval from the ethics committee and an explicit consent from the patient being tested should always be obtained. In such circumstances, however, the identity of the patients should always be concealed. In emergency situations or when the patients is unresponsive, it might be unfeasible to get an explicit consent, in which case it is acceptable to carry out the necessary procedures, provided they are essential to the patient’s health. Privacy during reception and sampling should also be available and should be appropriate to the type of primary sample being collected and the tests to be performed. Moreover, the laboratory should use preanalytical, analytical, © 2011 by Taylor and Francis Group, LLC

338

Quality Assurance in the Pathology Laboratory

and postanalytical procedures that fulfill quality requirements and meet the needs of the stakeholders. Any manipulation of results (e.g., falsification, arbitrary correction, release despite unsuitable quality controls) must be considered unacceptable. The communication of test results must be always confidential, unless disclosure is authorized. Traditionally, results are reported to the requesting physician and can only be notified to other parties after obtaining the patient’s consent. In addition to the accurate reporting of results, the laboratory personnel have an additional responsibility to ensure that, as far as possible, tests results are correctly interpreted and applied in the patient’s best interest. Accordingly, counseling on test results is a right every patient is entitled to, and it should always be given when requested. The patient’s and the operator’s safety are other sources of concern. The healthcare system is highly complex, as it develops through the interaction of several clinical areas, which involve prevention, diagnosis, and therapy of diseases. In the entire process of delivering healthcare, from screening to therapeutic drug monitoring, the role of laboratory diagnostics is increasingly recognized, providing clinicians with an armamentarium of tests, whose results can guide, modify, and ultimately improve clinical decision making. As such, the patient’s safety only marginally involves the complications of the procedures for collecting biological specimens, but is mainly reflected in the inherent potentiality of errors developing at any point during the total testing process, which can seriously jeopardize the patient’s health, and dissipate economic resources. Laboratory diagnostics is frequently delivered in a pressurized and fast-moving environment, involving a vast array of new and complex technologies, so that things might (and, unfortunately, sometimes do) go wrong, thereby producing unintentional harm for patients. Several articles available in the current scientific literature have assessed the frequency and type of mistakes in a stat laboratory, yielding a relative frequency comprised between 0.1% and 10%, according to the country and the facility. Although most laboratory mistakes do not traditionally affect patients’ care, in up to 20% of cases they might be associated with further inappropriate investigations, resulting in an unjustifiable increase in costs as well as patient inconvenience. Traditionally, the net preponderance of errors is observed in the preanalytical phase (68%) and the postanalytical phase (19%), whereas less than one-fifth of errors are globally attributable to the “true” analytical phase. Given these meaningful numbers, prevention, identification, and correction of errors represent ethical issues of paramount importance, and the laboratory should establish an appropriate procedure for facing this challenging problem. As for any other types of medical errors, the most effective path to improvement is the implementation of a total quality management system, encompassing a multifaceted strategy for process analysis and risk analysis, based on error prevention, detection, and © 2011 by Taylor and Francis Group, LLC

Education and Training

339

management. The operator’s safety should also be ensured throughout the total testing process, including sample collection, handling, processing, and storage. Sample collection should be performed according to regulations and standards that minimize the hazards for both patients and operators (e.g., wearing gloves, and use of disposal procedures that limit the risk of needle stick injury, blood contamination, and transmission of bloodborne pathogens). Samples should be handled and transported safely. Instrumentation should be chosen to minimize the technical and practical hazards and, therefore preferably, equipped with primary tube processors and specimen transport modules that contain no exposed moving parts. Several technological advances have played a crucial role in improving efficiency and safety during the analytical phase of testing. The novel analytical platforms streamline a variety of chemistry and immunotesting and are characterized by menu flexibility, high throughput, uninterrupted workflow, onboard auto-dilution, fast turnaround time, and accurate measurements. Additional innovations include closed tube sampling to minimize the risk of exposure to bloodborne pathogens, and on-board sample and reagent refrigeration to ensure specimen integrity and to reduce reagent waste. To further limit errors due to inappropriate aspiration in samples with insufficient volume, micro-clots, or bubbles, the fluidic systems of modern laboratory instrumentation are now broadly equipped with liquid level sensors, to confirm that correct amounts of sample and reagent have been aspirated, and can be used according to the testing protocols. Electrical noise and accidental contact of the sensor with the tube or cup walls cause level sensor errors, which can be avoided by adding software that processes capacitive signals intelligently, performing real-time error checking and compensation. Limitation of carryover and minimization of the dead volume for both reagents and samples are additional advantages of these liquid level sensors. Apparently, there might not appear to be much scope for ethical brooding among laboratory instrumentation staff and other staff in a clinical laboratory. Yet, a comprehensive analysis of the situation shows that there are several issues that often go overlooked in the profession. Many of the topics discussed border on how most laboratory professionals regard these issues more a matter of professional responsibility than a question of ethics. Nevertheless, in laboratory medicine, as in all the other healthcare areas, professional integrity is all that matters.

9.8╇ Conclusions The field of laboratory diagnostics is undergoing remarkable changes in organization and complexity, providing a variety of new opportunities and risks. The education, skill, and expertise required for laboratory © 2011 by Taylor and Francis Group, LLC

340

Quality Assurance in the Pathology Laboratory

professionals to stay abreast of this continuously evolving scenario now embrace a variety of technical, scientific, and organizational issues. Translating into practice the new insights from basic and innovative sciences, such as those sharing the common suffix “-omics,” requires the construction of a new and complex core curriculum for laboratory professionals, where the integration of different areas of diagnostics within the same laboratory service is ultimately aimed at improving quality, efficiency, efficacy, and safety throughout the entire testing process. Laboratory professionals are expected to include, within their already broad background, several technical and consultative capacities that would fall within rather different diagnostic areas. This can only be achieved with the most appropriate education and training.

References 1. Westbye H. International Federation of Medical Students’ Associations. The Bologna Declaration and medical education: A policy statement from the medical students of Europe. Med Teach 2005;27:83–5. 2. Lippi G, Plebani M, and Guidi GC. The paradox in translational medicine. Clin Chem 2007;53:1553. 3. European Commission. Council Directive 93/16/EEC of 5 April 1993 to facilitate the free movement of doctors and the mutual recognition of their diplomas, certificates and other evidence of formal qualifications. 4. Park YA and Marques MB. Teaching medical students basic principles of laboratory medicine. Clin Lab Med 2007;27:411–24. 5. Brugnara C, Schiller B, and Moran J. Reticulocyte hemoglobin equivalent (Ret He) and assessment of iron-deficient states. Clin Lab Haematol 2006;28:303–308. 6. Pepys MB and Hirschfield GM. C-reactive protein: A critical update. J Clin Invest 2003;111:1805–12. 7. Kofoed K, Andersen O, Kronborg G, Tvede M, Petersen J, Eugen-Olsen J, and Larsen K. Use of plasma C-reactive protein, procalcitonin, neutrophils, macrophage migration inhibitory factor, soluble urokinase-type plasminogen activator receptor, and soluble triggering receptor expressed on myeloid cells-1 in combination to diagnose infections: A prospective study. Crit Care 2007;11:R38. 8. Triester SL and Kowdley KV. Prognostic factors in acute pancreatitis. J Clin Gastroenterol 2002;34:167–176. 9. Smotkin J and Tenner S. Laboratory diagnostic tests in acute pancreatitis. J Clin Gastroenterol 2002;34:459–462. 10. Plebani M, Ceriotti F, Messeri G, Ottomano C, Pansini N, and Bonini P. Laboratory network of excellence: Enhancing patient safety and service effectiveness. Clin Chem Lab Med 2006;44:150–160. 11. Neilson EG, Johnson KB, Rosenbloom ST, Dupont WD, Talbert D, Giuse DA, Kaiser A, and Miller RA; Resource Utilization Committee. The impact of peer management on testordering behaviour. Ann Intern Med 2004;141:196–204. 12. Health Reform in England. Update and Commissioning Framework, July 2006. DH/Demand-Side Reform. Care and Resource utilisation. December 2006.

© 2011 by Taylor and Francis Group, LLC

Education and Training

341

13. Plebani M and Carraro P. Mistakes in a STAT laboratory: Types and frequency. Clin Chem 1997;43:1348–1351. 14. Lippi G, Bassi A, Brocco G, Montagnana M, Salvagno GL, and Guidi GC. Preanalytic error tracking in a laboratory medicine department: Results of a 1-year experience. Clin Chem 2006;52:1442–1443. 15. Howanitz PJ. Errors in laboratory medicine: Practical lessons to improve patient safety. Arch Pathol Lab Med 2005;129:1252–1261. 16. Narayanan S. The preanalytic phasedan important component of laboratory medicine. Am J Clin Pathol 2000;113:429–452. 17. Lippi G and Guidi GC. Risk management in the preanalytical phase of laboratory testing. Clin Chem Lab Med 2007;45:720–7. 18. Lippi G, Guidi GC, Mattiuzzi C, and Plebani M. Preanalytical variability: The dark side of the moon in laboratory testing. Clin Chem Lab Med 2006;44:358–365. 19. Carraro P and Plebani M. Errors in a stat laboratory: Types and frequencies 10 years later. Clin Chem 2007;53:1338–1342. 20. Plebani M. Quality specifications: Self pleasure for clinical laboratories or added value for patient management? Clin Chem Lab Med 2007;45:462–466. 21. Plebani M. Exploring the iceberg of errors in laboratory medicine. Clin Chim Acta 2009;404:16–23. 22. Sciacovelli L, Secchiero S, Zardo L, D’Osualdo A, and Plebani M. Risk management in laboratory medicine: Quality assurance programs and professional competence. Clin Chem Lab Med 2007;45:756–765. 23. Guidi GC, Lippi G, Solero GP, Poli G, and Plebani M. Managing transferability of laboratory data. Clin Chim Acta 2006;374:57–62. 24. Abu-Amero KK. Overview of the laboratory accreditation programme of the College of American Pathologists. East Mediterr Health J 2002;8:654–663. 25. Clinical Laboratory Improvement Amendments. http://www.cms.hhs.gov/ CLIA/16_Certification_Boards_Laboratory_Directors.asp#TopOfPage 26. National Accrediting Agency for Clinical Laboratory Sciences. http://www. naacls.org/accreditation/cls-mt/ 27. National Accrediting Agency for Clinical Laboratory Sciences. http://www. naacls.org/accreditation/clt-mlt/ 28. National Accrediting Agency for Clinical Laboratory Sciences. http://www. naacls.org/accreditation/htl/ 29. National Accrediting Agency for Clinical Laboratory Sciences. http://www. naacls.org/accreditation/ht/ 30. National Accrediting Agency for Clinical Laboratory Sciences. http://www.Â� naacls.org/accreditation/cg/ 31. National Accrediting Agency for Clinical Laboratory Sciences. http://www.Â� naacls.org/accreditation/dms/ 32. National Accrediting Agency for Clinical Laboratory Sciences. http://www.Â� caahep.org/ 33. National Accrediting Agency for Clinical Laboratory Sciences. http://www.Â� naacls.org/search/programs.asp 34. Accrediting Bureau of Health Education Schools. http://www.abhes.org/ Society for Clinical Pathology. http://www.ascp.org/ 35. American FunctionalNavigation/certification.aspx

© 2011 by Taylor and Francis Group, LLC

342

Quality Assurance in the Pathology Laboratory

36. American Medical Technologists. http://www.amt1.com/page.asp?i=157 37. National Credentialing Agency for Laboratory Personnel. http://www.nca-info. org/certification/index.asp 38. Registry of the American Association of Bioanalysts. http://www.aab.org/mt.htm 39. http://www.bls.gov/oco/ocos096.htm 40. European Community. http://ec.europa.eu/internal_market/qualifications/ regprof/index.cfm?fuseaction=home.welcome 41. Lippi G, Salvagno GL, Montagnana M, Franchini M, and Guidi GC. Phlebotomy issues and quality improvement in results of laboratory testing. Clin Lab 2006;52:217–230. 42. Dhir R, Patel AA, Winters S, Bisceglia M, Swanson D, Aamodt R, and Becich MJ. A multidisciplinary approach to honest broker services for tissue banks and clinical data: a pragmatic and practical model. Cancer 2008;113:1705–1715. 43. Asare AL, Kolchinsky SA, Gao Z, Wang R, Raddassi K, Bourcier K, and SeyfertMargolis V. Differential gene expression profiles are dependent upon method of peripheral blood collection and RNA isolation. BMC Genomics 2008;9:474. 44. Huang DJ, Mergenthaler-Gatfield S, Hahn S, Holzgreve W, and Zhong XY. Isolation of cell-free DNA from maternal plasma using manual and automated systems. Methods Mol Biol 2008;444:203–208. 45. von Wurmb-Schwark N, Heinrich A, Freudenberg M, Gebühr M, and Schwark T. The impact of DNA contamination of bone samples in forensic case analysis and anthropological research. Leg Med (Tokyo) 2008;10:125–30. 46. Wagar EA, Tamashiro L, Yasin B, Hilborne L, and Bruckner DA. Patient safety in the clinical laboratory: A longitudinal analysis of specimen identification errors. Arch Pathol Lab Med 2006;130:1662–1668. 47. Francis DL, Prabhakar S, and Sanderson SO. A quality initiative to decrease pathology specimen-labeling errors using radiofrequency identification in a high-volume endoscopy center. Am J Gastroenterol 2009;104:972–975. 48. Gräsbeck R and Saris N-E. Establishment and use of normal values. Scand J Clin Lab Invest 1969;26(110):62–63. 49. Boyd JC. Cautions in the adoption of common reference intervals. Clin Chem 2008;54:238–239. 50. Giansanti D, Castrichella L, and Giovagnoli MR. Telepathology requires specific training for the technician in the biomedical laboratory. Telemed J E Health 2008;14:801–807. 51. Ricós C, García-Victoria M, and de la Fuente B. Quality indicators and specifications for the extra-analytical phases in clinical laboratory management. Clin Chem Lab Med 2004;42:578–582. 52. Plebani M. Interpretative commenting: A tool for improving the laboratoryclinical interface. Clin Chim Acta 2009;404:46–51. 53. Plebani M, and Carraro P. Mistakes in a stat laboratory: Types and frequency. Clin Chem 1997;43:1348–1351. 54. Witte DL, VanNess SA, Angstadt DS, and Pennell BJ. Errors, mistakes, blunders, outliers, or unacceptable results: How many? Clin Chem 1997;43:1352–1356. 55. Plebani M. Charting the course of medical laboratories in a changing environment. Clin Chim Acta 2002;319:87–100. 56. Kricka LJ and Master SR. Validation and quality control of protein microarraybased analytical methods. Mol Biotechnol 2008;38:19–31. © 2011 by Taylor and Francis Group, LLC

Education and Training

343

57. Fontanarosa PB and DeAngelis CD. Basic science and translational research in JAMA. JAMA 2002;287:1728. 58. Petrovsky N and Brusic V. Bioinformatics for study of autoimmunity. Autoimmunity 2006;39:635–643. 59. Pujana MA, Han JD, Starita LM, Stevens KN, Tewari M, Ahn JS, Rennert G et al. Network modeling links breast cancer susceptibility and centrosome dysfunction. Nat Genet 2007;39:1338–1349. 60. Chuang HY, Lee E, Liu YT, Lee D, and Ideker T. Network-based classification of breast cancer metastasis. Mol Syst Biol 2007;3:140. 61. Finlay JA, Klee EW, McDonald C, Attewell JR, Hebrink D, Dyer R, Love B et al. A systematic method for selection of promising serum protein biomarkers to improve prostate cancer (PCa1) detection. Clin Chem 2006;52:2159–2162. 62. Committee on Data Standards for Patient Safety. Patient Safety: Achieving A New Standard for Care. The National Academic Press, Washington, DC, 2004; pp. 1–528. 63. http://www.nslij-genetics.org/bioinfotraining 64. Stein LD. Bioinformatics: Alive and kicking. Genome Biol 2008;9:114. 65. http://www.brain-map.org 66. Diamandis EP. Duties and responsibilities of laboratory scientists. Clin Chim Acta 2002;319:111–115. 67. Blaton V. Accreditation and postgraduate training in European countries: An FESCC survey. Federation of European societies of clinical chemistry. Clin Chim Acta 2001;309:115–20. 68. Zerah S, McMurray J, Bousquet B, Baum H, Beastall GH, Blaton V, Cals MJ et al. European communities of clinical chemistry, EC4 Register Commission. EC4 European Syllabus for Post-Graduate Training in Clinical Chemistry and Laboratory Medicine, Version 3, 2005. Clin Chem Lab Med 2006;44:110–120. 69. Conjoint Task Force of Clinical Pathology Residency Training Writing Committee. Graylyn Conference Report: Recommendations for reform of clinical pathology residency training. Am J Clin Pathol 1995;103:127–129. 70. Folberg R, Antonioli DA, and Alexander CB. Competency-based residency training in pathology: Challenges and opportunities. Hum Pathol 2002;33:3–6. 71. Smith BR, Wells A, Alexander CB, Bovill E, Campbell S, Dasgupta A, Fung M et al. Curriculum content and evaluation of resident competency in clinical pathology (laboratory medicine): A proposal. Am J Clin Pathol 2006;125(Suppl):S3–S37. 72. Smith BR, Wells A, Alexander CB, Bovill E, Campbell S, Dasgupta A, Fung M et al. Curriculum content and evaluation of competency in clinical pathology (laboratory medicine): A proposal. Clin Chem 2006;52:917–949. 73. Luning Prak ET, Young DS, Kamoun M, Nachamkin I, Alexander CB, Spitalnik SL, Peerschke EI, and Smith BR. 2008 ACLPS panel discussion on resident education in clinical pathology. Am J Clin Pathol 2009;131:618–622. 74. Federici G and Bernardini S. The new Italian course of post-graduate education in laboratory medicine. Clin Chim Acta 2008;393:31–32. 75. Beastall GH. Clinical biochemistry education, training and continuing professional development in the United Kingdom. Clin Chim Acta 2008;393:17–21. 76. Sanders GT and Brombacher PJ. Clinical biochemistry training in The Netherlands. Clin Chim Acta 1994;232:133–141. © 2011 by Taylor and Francis Group, LLC

344

Quality Assurance in the Pathology Laboratory

77. Masseyeff RF, Dreux C, and Goussault Y. The impact of clinical biochemistry on university education in France. Clin Chim Acta 1994;232:143–152. 78. Queraltó JM. Clinical biochemistry education in Spain. Clin Chim Acta 1994;232:153–157. 79. Juretić D and Zanić-Grubisić T. Current system of undergraduate and postgraduate education in clinical chemistry in Croatia. Clin Chem Lab Med 1999;37:77–82. 80. Traikovska S and Dzhekova-Stojkova S. Medical biochemistry in Macedonia: A profession for physicians and natural scientists. Clin Chem Lab Med 2001;39:475–477. 81. Morozova VT, Dolgov VV, and Malakhov VN. Training of clinical laboratory professionals in Russia. Clin Chim Acta 1994;232:167–171. 82. Bunting PS and Goldberg DM. Education in clinical biochemistry: The Canadian scene. Clin Chim Acta 1994;232:63–84. 83. O’Leary TD and Guerin MD. Education and clinical biochemistry in Australia. Clin Chim Acta 1994;232:97–107. 84. Sun CF. Postgraduate education in laboratory medicine and certification/re-certification of clinical pathologists in Taiwan. Rinsho Byori 2004;52:307–311. 85. Matsuo S. Postgraduate training program in laboratory medicine at a clinical teaching hospital. Rinsho Byori 2003;51:370–374. 86. McQueen MJ. Ethics and laboratory medicine. Clin Chem 1990;36:1404–1407.

© 2011 by Taylor and Francis Group, LLC

Quality Assurance Aspects of Interpretation of Results in Clinical and Forensic Toxicology

10

Katrin M. Kirschbaum and Frank Musshoff

Contents 10.1 Personal Requirements 10.2 Expert Knowledge 10.2.1 Education and Continuing Education 10.2.1.1 Professional Title “Forensic Toxicologist GTFCh” or “Clinical Toxicologist GTFCh” 10.2.1.2 Professional Title “Forensic Toxicologist SGRM” of the Swiss Society of Forensic Medicine 10.2.1.3 “Diplomate of the American Board of Forensic Toxicology” and “Forensic Toxicology Specialist of the American Board of Forensic Toxicology” 10.2.1.4 “Certified Forensic Toxicologist,” “Certified Forensic Alcohol Toxicologist,” or “Certified Forensic Drug Testing Toxicologist” of the Forensic Toxicologist Certification Board, Inc. 10.2.1.5 “Diplomate of the American Board of Clinical Chemistry” 10.3 Interpretation of Results in Clinical and Forensic Toxicology References

346 346 348 349 355 355

356 357 358 360

Interpreting results in the field of forensic and clinical toxicology requires knowledge of multiple areas, especially natural science, medicine, and jurisprudence. Especially forensic toxicologists have to bear in mind, when they begin an analysis, that their report might be introduced as evidence in court of law. Fundamental knowledge based on education and training in relevant disciplines is therefore the basis for analyzing samples, interpreting results, © 2011 by Taylor and Francis Group, LLC

345

346

Quality Assurance in the Pathology Laboratory

and providing reports. Especially, the provision of reports always has to be done against the background of forensic aspects and possible consequences for a suspect or victim [1–3].

10.1╇ Personal Requirements Forensic and clinical toxicologists must be experts on their field and must be able to understand and conduct a request in all necessary steps. This includes understanding of the problem, selecting and accomplishing appropriate methods, analyzing and interpreting data and, last but not least, providing an objective and understandable report. For this purpose, forensic and clinical toxicologists must be able to explain complex analytical or medical facts in an everyday language, generally understandable. Good speaking skills as well as the ability to write an understandable scientific report are necessary. Reports must be only drawn upon hard facts and a forensic or clinical toxicologist must be able to interpret facts in an objective way. They must be impartial and unbiased and must possess personal integrity. They always have to tell the truth, no matter if their report is of an incriminating or exculpating nature. Forensic or clinical toxicologists should be of good moral character and high ethical and professional standing [1].

10.2╇ Expert Knowledge Expert knowledge in different areas is necessary for handling a case. Giving expert advice for selecting the right material previous to further handling is necessary. Knowledge about the sampling and storage of different types of material is important. Qualitative and quantitative methods have to be developed, validated, and applied. Furthermore, data have to be analyzed and results are interpreted and followed by a written or oral report. The effort requires mainly knowledge of the main areas of chemistry, pharmacology, medicine, and jurisprudence. Forensic and clinical toxicologists mainly deal with blood and urine samples of human origin. Moreover, alternative matrices, like hair, saliva, or tissues are analyzed, besides illicit drugs or other organic or inorganic substances. Knowledge of properties of the different materials, sampling, storage, stability, and sample preparation is necessary. Also, the informative value of each matrix is important and has to be considered when choosing a sample for analysis. For example, concentrations of a substance in blood can provide information about the influence of a drug at a certain point of time but duration of detectability, the “window of detection,” is rather short. © 2011 by Taylor and Francis Group, LLC

Quality Assurance Aspects of Interpretation of Results

347

In urine, detection is possible over a longer period of time but concentrations do not allow drawing a conclusion of the influence of the drug. Urine also mainly contains metabolites that are partly unknown. Hair or nail can provide information about drug intake over several months but questions about the point of time or quantity of consumption can be only answered imprecisely. Handling of a sample requires knowledge of chemistry and physicochemical properties of substances; this enables to choose an appropriate technique for sample preparation. Also, stability, pH-value, solubility, and chemical affinity to solid-phase material, for example, have to be estimated for adequate sample preparation. Furthermore, forensic and clinical toxicologists have to be familiar with analytical chemistry techniques, including instrument methods, for example, gas and liquid chromatographic techniques, mass, ultraviolet, flame emission and absorption spectrophotometric detection techniques, antigen–antibody immunoassay methods, as well as traditional qualitative and quantitative methods of analysis. Analyzing resulting data requires experience with the analytical method. Results, especially of screening methods, have to be surveyed very carefully and several mandatory requirements should exist before declaring a result as “positive.” The operator should always be aware of the limits of the analytical system. Also, results of samples of alternative matrices or postmortem analysis have to be analyzed carefully as, often, methods are not or cannot be validated for these samples. Beside application of analytical procedures, also method development, validation, and quality assurance (QA) play an important role. For the interpretation of the resulting data, knowledge of pharmacology and toxicology is of importance. This includes structure of molecules and structure–response relationships, physical mechanisms, spectrum of efficacy, adverse reactions, interactions, mode of application, xenobiotic metabolism, and organ toxicology of drugs. Also, toxicity tests and other aspects of pharmacodynamics and pharmacokinetics and toxicodynamics and toxicokinetics, respectively, are important knowledge for the interpretation of toxicological and clinical cases. Furthermore, basics of human biology, including knowledge of the function of the human body, especially anatomy, physiology, pathology, and biochemistry, are required. Interpretation of cases in clinical and especially forensic toxicology requires particular knowledge of, for example, conditions of effects of toxins, influence of endogenic and exogenic factors, sampling in suspicion of poisoning, further knowledge of poisons, like metals, nonmetal inorganic poisons, and organic poisons, and last but not least, knowledge of legal aspects and principles of inquest. One important and challenging part in interpretation of forensic toxicology is the postmortem toxicology. Postmortem diagnostic findings in © 2011 by Taylor and Francis Group, LLC

348

Quality Assurance in the Pathology Laboratory

poisoning, thanatochemistry, especially changes in drug distribution, and aspects of exhumation have to be considered [4]. Interpretation of cases against the background of forensic aspects, nevertheless, requires basic knowledge of clinical toxicology. Symptoms of the most frequent types of poisoning, therapeutic methods, antidotes, differential diagnosis, and leading symptoms in poisoning as well as measures taken in acute poisoning, epidemiology of acute poisoning, legal aspects in diagnostics, and treatments of poisoning are of importance for the interpretation. Substances affecting the central nervous system play an important role in the field of forensic toxicology. These are not only illicit drugs, psychotropics, or hypnotics. Also, drugs that have an impact, for example, on blood pressure or blood glucose levels can indirectly affect central nervous functions. Forensic toxicologist should be familiar with the pharmacokinetics of the most important centrally and noncentrally acting intoxicating substances, intoxicating substances in road traffic, aspects of medicine in road traffic, and determination of chronic abuse. Also, the differentiation between intoxications and forensic psychopathology is of importance, as well as retrograde calculation, legal matters, and general pathology. Especially, retrograde calculations of alcohol concentrations, including consideration of alcohol consumption after the critical incident and prior to blood sampling, are a frequently asked question. Finally, the plausibility of results always has to be questioned. Special problems of each case have to be kept in mind and limit values have to be discussed. For example, age, co-medication, addiction, and pharmacogenetics have to be considered in the individual case. Also, scientific publications and current court judgments can help when interpreting own results. Forensic toxicologists should be familiar with relevant laws and regulations for furnishing an opinion. This includes especially narcotics law, road traffic law, and criminal law. Additionally, they should be familiar with experts’ rights and duties [2,5–7]. 10.2.1╇ Education and Continuing Education Several societies in different countries offer the possibility of obtaining a professional or certified title as forensic or clinical toxicologist. Requirements for obtaining the title are an education in natural sciences, mainly chemistry, biology, or pharmacy, or medicine with respective degrees. These degrees are mainly diplomas or state exams in Germany. A PhD or MD is of advantage. Master’s or bachelor’s degree in natural sciences with adequate undergraduate and graduate education in biology, chemistry, and training in pharmacology or toxicology or earned Doctor of Philosophy or Doctor of Science degrees in one of the natural sciences is required in other countries [2,5–10]. © 2011 by Taylor and Francis Group, LLC

Quality Assurance Aspects of Interpretation of Results

349

Some societies require continuing participation in professional activities in the field of forensic toxicology or clinical toxicology of certified forensic toxicologists and clinical toxicologists. Especially, continuing education in order to keep and enhance the present knowledge as well as to improve knowledge and skills according to new developments is expected from professionals. Several societies and their requirements for obtaining a professional title as a forensic or clinical toxicologist are presented in the following sections. 10.2.1.1  P rofessional Title “Forensic Toxicologist GTFCh” or “Clinical Toxicologist GTFCh” 10.2.1.1.1╇ Educationâ•… The Society for Toxicological and Forensic Chemistry (Gesellschaft für toxikologische und forensische Chemie, GTFCh) of the German-speaking countries offers training programs for forensic toxicologists, forensic chemists, and clinical toxicologists. The education of a forensic toxicologist mainly deals with the realization, QA, assessment, interpretation, and expert opinion of qualitative and quantitative analyses of toxicologically relevant substances in biological and nonbiological materials. Practical work in postgraduate professional education institutions, like forensic toxicological institutions of respective university institutions or equivalent institutions, plays an important role. Professional experiences, including the passing on, acquisition, and proof of a thorough knowledge, experience, and skills in forensic toxicology including furnishing of written and oral expert opinion are main parts of the postgraduate period. A detailed list of the postgraduate professional education catalogue of the GTFCh for forensic toxicologists is presented in Table 10.1. Education is supervised by a mentor who is a Forensic Toxicologist GTFCh. The mentor should work in the same institution. Visits in other educational institutions for further practical training are possible. The postgraduate professional education for a clinical toxicologist expands the main knowledge of a forensic toxicologist with a focus on cases of acute or chronic poisonings, pharmaco/toxicokinetic calculations, estimation of prognosis of the course of intoxication, and advising on therapy options. Table 10.2 gives a detailed list of the education modules. Postgraduate professional education should be completed in clinical toxicological institutions of respective university institutes. A Clinical Toxicologist GTFCh has to be chosen as a mentor. He or she will be responsible for supervising the applicant during the time of postgraduate professional education. Visits in other educational institutions are possible for consolidating special practical experiences. Obtaining the title “Forensic Toxicologist GTFCh” or “Clinical Toxicologist GTFCh” requires the membership of the GTFCh and a proof of a university study in natural sciences or medicine and the respective © 2011 by Taylor and Francis Group, LLC

350

Table 10.1â•… Postgraduate Professional Education Modules to Admission as “Forensic Toxicologist GTFCh” Subject

Domain

Toxicodynamics and toxicokinetics/ pharmacodynamics and pharmacokinetics

Forensic toxicology

Postmortem toxicology

Alcohol Other substances affecting the central nervous system

Substances not affecting the central nervous system Basics of forensic genetics Basics of forensic chemistry Quality management

© 2011 by Taylor and Francis Group, LLC

Basic knowledge of the function of the human body (anatomy, physiology, biochemistry) Structure, physical mechanism, spectrum of efficacy, adverse reaction, interaction, mode of application, toxicogenetics/pharmacogenetics Xenobiotic metabolism, organ toxicology, toxicity tests, structure– response relationship Definition of terms, conditions of effect of toxins, influence of endogenic and exogenic factors, postmortem diagnostic findings in poisoning, principles of inquest, sampling in suspicion of poisoning, exhumation, thanatochemistry, metals, nonmetal inorganic poisons, organic poisons, legal aspects Retrograde calculation, law, alcohol consumption after the critical incident and prior to blood sampling Pharmacokinetics of the most important intoxicating substances, intoxicating substances in road traffic, aspects of medicine in road traffic, sampling, determination of chronic abuse, retrograde calculations, legal matters, pathology, intoxication versus forensic psychopathology Analyses and appraisal of samples taken from living humans

Analysis of illicit drugs Analysis of other nonbiological seizures Accreditation Certification

Quality Assurance in the Pathology Laboratory

Basics of human biology Toxicology/ pharmacology

Details

Clinical chemistry Basics of pharmacy Legislation

Analytical toxicology

Epidemiology of acute poisoning Legal aspects in diagnostics and treatment of poisoning Measures taken in acute poisoning Differential diagnosis and cardinal symptoms in poisoning Therapy of acute poisoning Symptoms of the most frequent types of poisoning, therapeutic methods, antidotes Toxicologically relevant parameters Relevant laws and regulations Rights and duties of experts Current court judgments passed Material of investigation Pre-analytical aspects Analytics

Forensic expertise

Method development Postanalytical aspects Bio statistics Plausibility of forensic toxicological results Interpretation of forensic toxicological results

Forensic expertise

Narcotics law, road traffic law, and criminal law (e.g., intoxication effects and criminal responsibility) Standard matrices Alternative matrices (e.g., hair, saliva, tissue samples) Sampling and storage Sample preparation Qualitative and quantitative analysis procedures including validation Quality assurance Sample storage

Quality Assurance Aspects of Interpretation of Results

Clinical toxicology

For example, consideration of problem, limit values Expert opinion on records

351

© 2011 by Taylor and Francis Group, LLC

352

Table 10.2â•… Postgraduate Professional Education Modules to Admission as “Clinical Toxicologist GTFCh” Subject

Domain

Basics of human biology Pharmacology/toxicology

Pharmacology/toxicology

Clinical toxicology

Epidemiology of acute poisonings

Clinical chemistry and laboratory medicine

Analytical toxicology

Samples

© 2011 by Taylor and Francis Group, LLC

Basic knowledge of the function of the human body (anatomy, physiology, biochemistry) Structure of relevant medical substances and toxins, structure–response relationship, physical mechanism, spectrum of efficacy, adverse reaction, interaction, abuse and addiction potential, overdose symptoms, therapeutic measures, antidotes, xenobiotic metabolism, organ toxicology Basics of general toxicology (acute and chronic toxicity, carcinogenicity, mutagenicity, reproduction toxicity) Basics of pharmaceutical technology and biopharmacy Pathophysiology and pathobiochemistry of the most frequent types of poisoning Differential diagnosis and cardinal symptoms of poisoning Basic knowledge of emergency medical measures Therapy of acute and chronic poisoning (primary and secondary toxin removal, antidotes, etc.) Basic knowledge in addiction therapy Estimation of danger potential of hazardous substances and toxicological risk assessment Basics of biochemistry, clinical chemistry, and pathobiochemistry Effects of poisoning on clinical chemical parameters Evaluation of toxicologically relevant clinical chemical parameters Toxicological aspects of microbiology Standard matrices Alternative matrices

Quality Assurance in the Pathology Laboratory

Pharmacodynamics and pharmacokinetics, pharmacogenetics

Details

Postanalytics Basics of biostatistics Quality management

Quality assurance measures Certification Accreditation Plausibility of clinical toxicological analyses results

Clinical toxicological assessment of findings, expert opinion and counseling

Basics of forensic toxicology and forensic chemistry Legislation

Sampling, transportation, and storage Method development and validation Detection techniques (e.g., photometry, mass spectrometry, fluorescence spectrometry, atom absorption spectrometry) Immunochemical procedures Quality assurance measures including internal and external quality control Sample storage

Interpretation of clinical toxicological analyses results

Under consideration of the patient’s clinical state and pharmaco-toxicological properties of the relevant substances Clinical toxicological consultation

Relevant laws and regulations

Medication law, narcotics law, chemical law, medical products law, crop protection law, foodstuffs law, and commodities law Duty to nondisclosure and data protection regulations Legal aspects in diagnostics and treatment in cases of poisoning

Quality Assurance Aspects of Interpretation of Results

Pre-analytical aspects Analytics

Rights and duties of experts

353

© 2011 by Taylor and Francis Group, LLC

354

Quality Assurance in the Pathology Laboratory

degree. The applicant has to obtain at least 5 years of practical experience, or extended time while working part-time, after obtaining the university degree in a postgraduate professional educational institution under the supervision of a mentor. He or she has to demonstrate his in-depth knowledge, experience, and skills in an examination. This has to be oral and individual and is closed to the public. It should take about 1–2â•›h during which knowledge according to the postgraduate professional education catalogue (Tables 10.1 and 10.2) is tested by an examination board. The board consists of four members of the GTFCh. At least three of them must have obtained the title “Forensic Toxicologist GTFCh” or “Clinical Toxicologist GTFCh,” respectively. The chairman has to be qualified as a professor with corresponding experiences in university teaching and examination and at least one member must also be part of the assessment commission. Furthermore, applicants for the title “Forensic Toxicologist GTFCh” have to present at least 10 independent expert reports on varying topics for proving their ability to assess complex facts of a case. They must have participated as an expert in at least 25 court proceedings according to the customs of the respective country. Skills in performing scientific work have to be proven by having submitted at least five independent scientific publications in acknowledged professional journals, predominantly in the field of forensic toxicology. Applicants for the title “Clinical Toxicologist GTFCh” must have planned, processed, and reported on findings or appraised at least 250 clinical toxicological cases, 100 of them must have been performed outside the regular working hours. They must have presented at least 10 independent scientific publications, including case reports in acknowledged professional journals, bulletins, or proceedings of relevant scientific associations as proof of their skills in carrying out scientific work [2,5,6]. 10.2.1.1.2╇ Continuing Educationâ•… Forensic Toxicologists GTFCh and Clinical Toxicologists GTFCh are obliged to continue education in order to enhance the present knowledge, experience, and skills, to acquire new insights and to become acquainted with the latest developments. They must acquire at least 80 continuing education points per year. Thirty points are accepted from private studies; 50 points must be achieved in workshops, seminars, and scientific committees’ meetings approved by the GTFCh, at national and international meetings and conferences in the fields of the postgraduate professional education catalogue, with individual lectures, publications, teaching, contributions to meetings, and visits in other postgraduate professional education institutions or other activities. Activities of different societies and organizations are accepted [2,11,12].

© 2011 by Taylor and Francis Group, LLC

Quality Assurance Aspects of Interpretation of Results

355

10.2.1.2  P rofessional Title “Forensic Toxicologist SGRM” of the Swiss Society of Forensic Medicine 10.2.1.2.1╇ Educationâ•… Laboratory managers working in the field of forensic toxicology in Switzerland are expected to obtain the professional title “Forensic Toxicologist SGRM” of the Swiss Society of Forensic Medicine (Schweizerische Gesellschaft für Rechtsmedizin, SGRM), which is divided into four areas of forensic toxicology. Professionals in laboratories of institutes of forensic medicine should obtain the title in all areas, which are alcohol and driving, driving under the influence of drugs, human-behavior forensic toxicology, and postmortem forensic toxicology. In laboratories, working in the area of drugs and driving, the title should be obtained at least in the areas of alcohol and driving and driving under the influence of drugs. A university degree in natural sciences or medicine and a doctoral degree are required for application of the title. Professional experience of at least 5 years in the field of forensic toxicology and expert knowledge, similar to the postgraduate professional education modules of the GTFCh (Table 10.1), are required. The proof of at least 10 expert reports on varying topics, five scientific publications in acknowledged professional journals, proof of participation in court proceedings, in case practiced, and successful participation in interlaboratory tests has to be provided for application. The oral exam lasts about 1–2â•›h. The examination board consists of three members with experience in different areas of forensic toxicology; at least one must have obtained a professional title in the applied area and at least one has to be a member of the SGRM. Members of the SGRM, who have obtained the title Forensic Toxicologist GTFCh, can also apply for the title Forensic Toxicologists SGRM without additional requirements [7]. 10.2.1.2.2╇ Continuing Educationâ•… Forensic Toxicologists SGRM are also obliged to maintain their expert knowledge and to enhance and expand their skills and experiences according to recent developments in the field of forensic toxicology. They have to acquire at least 80 credit points per year. Thirty points are accepted from private studies; 50 points must be achieved in seminars and workshops, meetings, and conferences of forensic toxicological societies, with individual lectures, publications, teaching, and contributions to meetings [7]. 10.2.1.3  “Diplomate of the American Board of Forensic Toxicology” and “Forensic Toxicology Specialist of the American Board of Forensic Toxicology” The American Board of Forensic Toxicology (ABFT) was formed in 1975 as a joint program between the American Academy of Forensic Sciences, the Society of Forensic Toxicologists, the Californian Association of Toxicologists,

© 2011 by Taylor and Francis Group, LLC

356

Quality Assurance in the Pathology Laboratory

the Canadian Society of Forensic Science, and the Southwestern Association of Toxicologists. It offers the certification of a Forensic Toxicology Diplomate and a Forensic Toxicology Specialist. Applicants of the title “Diplomate of the American Board of Forensic Toxicology” (DABFT) must have completed an earned Doctor of Philosophy or Doctor of Science degree in one of the natural sciences and must have adequate undergraduate and graduate education in biology, chemistry, as well as training in pharmacology or toxicology [13]. Certification as a “Forensic Toxicology Specialist of the American Board of Forensic Toxicology” (FTS-ABFT) requires an earned Bachelor’s Degree in one of the natural sciences and adequate education in chemistry, biology and, maybe, pharmacology and toxicology [14]. At least 3 years of professional experience in forensic toxicology is required for application for one of the titles. Additionally, three professional and character references from persons knowledgeable about the applicant’s forensic toxicology experience are required. After passing a comprehensive written examination, based on the principles and practice of forensic toxicology, applications are reviewed by the Credentials Committee of the Board and considered by the Board of Directors. Certificates are valid for 5 years and are renewable. Requalification requires participation in continued professional activities in forensic toxicology, especially education and training, meetings, workshops, practice, research, teaching, or administration. Continuing education has to be documented and/or evidence of contributions to the science or profession of forensic toxicology [13,14]. 10.2.1.4  “Certified Forensic Toxicologist,” “Certified Forensic Alcohol Toxicologist,” or “Certified Forensic Drug Testing Toxicologist” of the Forensic Toxicologist Certification Board, Inc. The Forensic Toxicologist Certification Board, Inc. (FTCB), which is sponsored by the U.S. societies Southern Association of Forensic Scientists (SAFS) and Midwestern Association of Forensic Scientists (MAFS), offers certification as a Certified Forensic Toxicologist, a Certified Forensic Alcohol Toxicologist, or a Certified Forensic Drug Testing Toxicologist. Applicants must have an education in a relevant physical or biological science with a baccalaureate, masters or doctoral degree, and 32 semester/48 quarter hours of college-level studies in chemistry, which may include biochemistry, pharmacology, and toxicology. Professional experience of 3 years including experience in forensic toxicological analyses, documenting analyses with regard to receipt and reporting, supervising and training others on-thejob, or testifying on the results of such analyses is required for application. Additionally, two letters of professional reference written by practitioners in

© 2011 by Taylor and Francis Group, LLC

Quality Assurance Aspects of Interpretation of Results

357

forensic toxicology and members of professional organizations have to be presented. In written examinations, knowledge of fundamental and practical aspects of ethanol and related volatiles testing, knowledge of fundamental and practical aspects of drug testing and interpretation in forensic toxicology, or both topics, depending on the designated certification, is questioned. Certificates are valid for 5 years and can be renewed in case of continued practice in the field as forensic toxicologist, alcohol toxicologist, or drug testing toxicologist [10]. 10.2.1.5  “Diplomate of the American Board of Clinical Chemistry” 10.2.1.5.1╇ Educationâ•… The American Board of Clinical Chemistry (ABCC) certifies qualified specialists as diplomates in the practice of toxicological chemistry and clinical chemistry. Applicants must possess an earned doctor of philosophy or an equivalent doctoral degree in one of the natural sciences, or a doctor of medicine degree. Education must include a minimum of 30 semester hours in undergraduate and/or graduate level chemistry or biochemistry courses. Professional experience of usually 5 years in toxicological chemistry or clinical chemistry is also required for application. Additionally, three letters of reference have to be submitted to the ABCC office. Examinations of both diplomas are in multiple-choice format and comprised of two parts of approximately 3â•›h each. Analytical techniques, toxicology, therapeutic drug monitoring, basic statistics, interpretation of clinical and forensic findings and laboratory data, and basic pathophysiology are the main topics of the exam in toxicological chemistry. Examination in clinical chemistry focuses on general biochemistry, clinical chemistry calculations, basic statistics, instrumentation, interpretation of clinical findings and laboratory data, basic pathophysiology, quality control, laboratory safety procedures, sample handling and preparation, and interferences [8,15,16]. 10.2.1.5.2╇ Continuing Educationâ•… Diplomates of the American Board of Clinical Chemistry (DABCC) have to document every 2 years 50 contact hours of participation in organized continuing education experiences acceptable to the Board. Continuing education must cover the field of clinical laboratory medicine. Category 1 CME- or ACCENT-approved as well as education activities provided by state laboratory agencies in the United States are accepted. Accepted CE providers include American Society for Clinical Pathology (ASCP), College of American Pathologists (CAP), American Chemical Society (ACS), American Council on Pharmaceutical Education, Society of Forensic Toxicologists (SOFT), American Academy of Forensic Science (AAFS), and the Royal College of Pathologists in the United Kingdom [17].

© 2011 by Taylor and Francis Group, LLC

358

Quality Assurance in the Pathology Laboratory

10.3╇Interpretation of Results in Clinical and Forensic Toxicology Education and resulting expert knowledge as depicted above constitute the basis for the interpretation of results in forensic and clinical toxicological cases. It should enable the professional to critically assess results also in consideration of possible weak points, pitfalls, and plausibility controls. Interpretation of some cases needs particular attention. Examples of several pitfalls are discussed in the following text. Interpretation of results requires a good knowledge of pharmacokinetic data of drugs. For example, after the intake of the antitussive drug codeine, the analgesic and also illegally used drug morphine is build to about 10% by metabolic demethylation. The codeine/morphine concentration ratio of the total drugs following hydrolysis usually is >1.0 in urine for the first 24â•›h. After that time, it often converts to a quotient <1.0, and several hours later, only morphine may be detectable [18]. Other derivates of morphine can also be metabolized to morphine, like the antitussive ethylmorphine, or morphine may be formed artificially during sample preparation, like, for example, the antitussive pholcodine after acid hydrolysis [19]. The parent drug to metabolite ratio in blood can hint at the acute or chronic intake of drugs. High ratios can support the diagnosis of acute poisoning or at least may indicate a recent intake. But it can also provide false clues. A poor metabolizer status of metabolizing enzymes, for example, of the cytochrome P450 family, or enzyme inhibition effects of other substances can influence the parent drug to metabolite ratio and cause intoxications even under therapeutic doses [20,21]. A case report by Koren et al. reports on a breastfed neonate who died on day 13 [22]. His mother had been prescribed a combination of codeine and paracetamol for episiotomy pain. Genotype analysis after the death of the child revealed that the mother was an ultrarapid metabolizer for cytochrome P450 2D6 (CYP2D6), which led to increased formation of morphine from codeine. Blood concentration of morphine of the child was 70â•›ng/mL. Typical serum concentrations of neonates breastfed by mothers receiving codeine are 0–2.2â•›ng/mL [23]. Another example of a fatal intoxication due to a defective genotype is reported by Koski et al. [24]. A doxepin concentration of 2.4â•›mg/L and a nordoxepin concentration of 2.9â•›mg/L were measured in femoral blood of a 43-year-old man with a resulting ratio of 0.83. The doxepin concentration was 16–80 times higher than therapeutic concentrations. The CYP2C19 genotype, which converts doxepin to nordoxepin, was determined as that of an extensive metabolizer but a defective CYP2D6 genotype was detected. CYP2D6 appears to be involved in catalyzing the 2-hydroxylation of (E)-doxepin and (E)-nordoxepin. The high nordoxepin concentration in the reported case was

© 2011 by Taylor and Francis Group, LLC

Quality Assurance Aspects of Interpretation of Results

359

not consistent with an acute intoxication. Furthermore, the defective genotype probably had contributed to the fatal intoxication. Screening techniques for unknown compounds play an important role in forensic and clinical cases. Results obtained by search programs from HPLC- or GC/MS-libraries always have to be critically assessed. Many different compounds have very similar spectra. Somewhat different ion intensities can occur with different mass spectrometers even with standardized ionization techniques. Therefore, libraries containing multiple entries for the same compound can be of great value. Nevertheless, even with the best technical equipment, the decision which spectrum is the most convincing one cannot be made only by the computer but requires a skilled spectroscopist. A report with positive results should clearly state if the finding is just a hint or if it is an evidence that has been proved by confirming analysis with reference material or by an independent second method. Additionally, the plausibility of results should be scrutinized. Availability of substances is often geographically and nationally different. Plausibility of results can also increase when parent compounds or characteristic metabolites can be identified, too [18,25]. A case in the literature reports on a finding of the antidepressant desipramine in the urine of a 3-year-old boy. The result had been achieved with a standardized comparison of mass spectra in a clinical toxicological laboratory and led to accusations against the mother and accommodation of the child in an orphanage. Complex analysis in a forensic toxicological laboratory could not confirm the finding. Searching of the original laboratory documents revealed that a mass spectrum in the shoulder of an unidentified peak, probably matrix, and with a probability of 70.2% had been considered as desipramine and reported as such without further comments on probability [26]. Interpretation of postmortem alcohol concentrations is another example where difficulties can occur. Alcohol may be produced postmortem between death and autopsy or in vitro in specimens collected at autopsy from glucose, or to a lesser extent from lactate, amino or fatty acids, especially by microbial activity [27,28]. Also, distribution from stomach contents may occur when the stomach alcohol concentration is much higher than the blood alcohol concentration [29,30]. In addition to stomach content and blood different specimens, like urine, vitreous humor, synovial, cerebrospinal, chest, or intra-abdominal fluids should be analyzed for alcohol [31–34]. In these fluids, alcohol diffusion or changes due to putrefaction should occur to only a lesser extent, as they are protected and isolated with tissue barriers. Nevertheless, severe damage of a body can increase the exposition of specimens to microorganisms and therefore, alcohol production. As an indicator for putrefaction processes, C3 alcohols, especially n-propanol, that are build

© 2011 by Taylor and Francis Group, LLC

360

Quality Assurance in the Pathology Laboratory

during putrefaction, can be used [28]. Interpreting results of a deceased suffering from diabetes requires also extreme caution, as high glucose levels in blood or even in urine in combination with microorganisms can cause the production of large amounts of alcohol. Therefore, interpretation of postmortem alcohol concentrations must always take into account autopsy findings, the recent history of the deceased and circumstances of death, as well as results of alcohol concentrations of different specimens as far as possible. Addressees of reports, especially in forensic cases, are mostly no experts in a scientific or medical field. Reports should therefore, as stated above, be written in a way understandable to everyone [1]. Methods, results, and especially the statement must be clear and explain complex analytical or medical facts understandable, also to nonexperts. Also, reports of clinical findings that are in most cases addressed to healthcare professionals require, in some cases, further interpretation. Reference ranges and decision limits are not always comparable between laboratories, depend on the method used, and should be specified [35,36]. Also, in cases of, for example, unexpected results, interferences, special questions, etc., interpretative comments can enhance the laboratory result. Studies have shown that especially young or general practitioners and even specialists receiving results outside their specialty appreciate interpretative comments on clinical outcomes [35].

References 1. American Academy of Forensic Sciences (AAFS). 2009. So you want to be a forensic scientist! http://www.aafs.org/default.asp?section_id=resources&page_ id=╉choosing_a_career 2. Gesellschaft für Toxikologische und Forensische Chemie (GTFCh). 2009. Gesellschaft für Toxikologische und Forensische Chemie (GTFCh). http://www. gtfch.org/cms/ 3. Society of Forensic Toxicologists Inc. (SOFT). 2009. An introduction to forensic toxicology. http://www.soft-tox.org/default.aspx?pn=Introduction 4. Drummer, O. H. and J. Gerostamoulos. 2002. Postmortem drug analysis: Analytical and toxicological aspects. Ther. Drug Monit. 24:199–209. 5. Gesellschaft für Toxikologische und Forensische Chemie (GTFCh). 2006. Fortbildungsordnung Klinischer Toxikologe GTFCh/Klinische Toxikologin GTFCh. Toxichem. Krimtech. 73:135–136. 6. Gesellschaft für Toxikologische und Forensische Chemie (GTFCh). 2006. Weiterbildungsordnung Klinischer Toxikologe GTFCh/Klinische Toxikologin GTFCh. Toxichem. Krimtech. 73:128–134. 7. Schweizerische Gesellschaft für Rechtsmedizin (SGRM). 2009. FachtitelReglement der Sektion Forensische Chemie und Toxikologie (FCT). http:// www.sgrm.ch/content.php?setsprache=d&action=sellang&sektion=login&alte rnative=1, no. sgrm_datei_682.pdf 8. American Board of Clinical Chemistry (ABCC). 2009. American Board of Clinical Chemistry (ABCC). http://www.abclinchem.org/Pages/default.aspx © 2011 by Taylor and Francis Group, LLC

Quality Assurance Aspects of Interpretation of Results

361

9. American Board of Forensic Toxicology (ABFT). 2009. Forensic Toxicology Specialist. http://www.abft.org/ 10. Forensic Toxicologist Certification Board, Inc. 2009. Certification Requirements. http://home.usit.net/~robsears/ftcb/index.htm 11. Gesellschaft für Toxikologische und Forensische Chemie (GTFCh). 2006. Fortbildungsordnung Forensischer Toxikologe GTFCh/Forensische Toxikologin GTFCh. Toxichem. Krimtech. 73:126–127. 12. Gesellschaft für Toxikologische und Forensische Chemie (GTFCh). 2006. Weiterbildungsordnung Forensischer Toxikologe GTFCh/Forensische Toxikologin GTFCh. Toxichem. Krimtech. 73:118–125. 13. American Board of Forensic Toxicology (ABFT). 2009. Certification of forensic toxicology diplomates. http://www.abft.org/documents/ABFT-Diplomate%20 Brochure%20(2009).pdf 14. American Board of Forensic Toxicology (ABFT). 2009. Certification of forensic toxicology specialists. http://www.abft.org/documents/ABFT-Forensic%20 Toxicology%20Specialist%20Brochure%20(2009).pdf 15. American Board of Clinical Chemistry (ABCC). 2009. Clinical Chemistry. http://www.abclinchem.org/clin_chem/Pages/default.aspx 16. American Board of Clinical Chemistry (ABCC). 2009. Toxicological Chemistry. http://www.abclinchem.org/tox_chem/Pages/default.aspx 17. American Board of Clinical Chemistry (ABCC). 2009. Continuing education credits. http://www.abclinchem.org/cont_edu/Pages/default.aspx 18. Schutz, H., F. Erdmann, M. A. Verhoff, and G. Weiler. 2003. Pitfalls of toxicological analysis. Leg. Med. (Tokyo). 5(1):S6–S19. 19. Maurer, H. H. and C. F. Fritz. 1990. Toxicological detection of pholcodine and its metabolites in urine and hair using radio immunoassay, fluorescence polarisation immunoassay, enzyme immunoassay, and gas chromatography-mass spectrometry. Int. J. Legal Med. 104: 43–46. 20. Druid, H., P. Holmgren, B. Carlsson, and J. Ahlner. 1999. Cytochrome P450 2D6 (CYP2D6) genotyping on postmortem blood as a supplementary tool for interpretation of forensic toxicological results. Forensic Sci. Int. 99:25–34. 21. Levo, A., A. Koski, I. Ojanpera, E. Vuori, and A. Sajantila. 2003. Post-mortem SNP analysis of CYP2D6 gene reveals correlation between genotype and opioid drug (tramadol) metabolite ratios in blood. Forensic Sci. Int. 135:9–15. 22. Koren, G., J. Cairns, D. Chitayat, A. Gaedigk, and S. J. Leeder. 2006. Pharmacogenetics of morphine poisoning in a breastfed neonate of a codeineprescribed mother. Lancet 368(9536):704. 23. Meny, R. G., E. G. Naumburg, L. S. Alger, J. L. Brill-Miller, and S. Brown. 1993. Codeine and the breastfed neonate. J. Hum. Lact. 9:237–240. 24. Koski, A., I. Ojanpera, J. Sistonen, E. Vuori, and A. Sajantila. 2007. A fatal doxepin poisoning associated with a defective CYP2D6 genotype. Am. J. Forensic Med. Pathol. 28(3):259–261. 25. Aebi, B. and W. Bernhard. 2002. Advances in the use of mass spectral libraries for forensic toxicology. J. Anal. Toxicol. 26:149–156. 26. Musshoff, F., K. M. Kirschbaum, and B. Madea. 2008. Two cases of suspected Munchausen by proxy syndrome: The importance of forensic toxicological analyses in handling suspicions and producing evidence. Arch. Kriminol. 222:162–169. © 2011 by Taylor and Francis Group, LLC

362

Quality Assurance in the Pathology Laboratory

27. Bogusz, M., M. Guminska, and J. Markiewicz. 1970. Studies on the formation of endogenous ethanol in blood putrefying in vitro. J. Forensic Med. 17:156–168. 28. Gilliland, M. G. and R. O. Bost. 1993. Alcohol in decomposed bodies: Postmortem synthesis and distribution. J. Forensic Sci. 38:1266–1274. 29. Athanaselis, S., M. Stefanidou, and A. Koutselinis. 2005. Interpretation of postmortem alcohol concentrations. Forensic Sci. Int. 149:289–291. 30. Iwasaki, Y., M. Yashiki, A. Namera, T. Miyazaki, and T. Kojima. 1998. On the influence of postmortem alcohol diffusion from the stomach contents to the heart blood. Forensic Sci. Int. 94:111–118. 31. Levine, B., M. L. Smith, J. E. Smialek, and Y. H. Caplan. 1993. Interpretation of low postmortem concentrations of ethanol. J. Forensic Sci. 38:663–667. 32. Ohshima, T., T. Kondo, Y. Sato, and Takayasu T. 1997. Postmortem alcohol analysis of the synovial fluid and its availability in medico-legal practices. Forensic Sci. Int. 90:131–138. 33. Trela, F. M. 1989. Ethanol distribution in body fluids in the human from a forensic medicine viewpoint. Prepared as an initial study. Blutalkohol 26:305–318. 34. Winek, C. L., J. Bauer, W. W. Wahba, and W. D. Collom. 1993. Blood versus synovial fluid ethanol concentrations in humans. J. Anal. Toxicol. 17:233–235. 35. Plebani, M. 2009. Interpretative commenting: A tool for improving the laboratory-clinical interface. Clin. Chim. Acta 404:46–51. 36. Wennig, R. 2000. Threshold values in toxicology—Useful or not? Forensic Sci. Int. 113:323–330.

© 2011 by Taylor and Francis Group, LLC

(a)

(b)

Figure 6.4╇ Shotgun gunshot to the back. Semitranslucent skeletal reconstruction: (a) frontal view and (b) lateral view. Objects of a very high radioopacity, such as the pellets (encircled) or the hip prosthesis (arrow) are colored blue by the computer. Such an image makes assessment of the pellet distribution easier than an autopsy.

© 2011 by Taylor and Francis Group, LLC

(a)

(b)

Figure 6.7╇ (a) Axial CT of the head showing a region highly suspicious for a cerebral hemorrhage (yellow arrow). Note also the bubbles in the brain (green arrows), which are due to putrefaction, gas production of this decomposing body. (b) MRT of hemorrhage-sensitive sequence showing the CT findings even more clearly.

© 2011 by Taylor and Francis Group, LLC