Emerging Foodborne Pathogens

240 x 159 /Pantone 2945C & 137C 41.5mm WOODHEAD PUBLISHING IN FOOD SCIENCE, TECHNOLOGY AND NUTRITION After an introdu...

Author: Y. Motarjemi | M. Adams

226 downloads 2967 Views 5MB Size Report

This content was uploaded by our users and we assume good faith they have the permission to share this book. If you own the copyright to this book and it is wrongfully on our website, we offer a simple DMCA procedure to remove your content from our site. Start by pressing the button below!

Report copyright / DMCA form

DOWNLOAD PDF

240 x 159 /Pantone 2945C & 137C

41.5mm

WOODHEAD PUBLISHING IN FOOD SCIENCE, TECHNOLOGY AND NUTRITION

After an introductory chapter, Emerging foodborne pathogens is split into two parts. The first part deals with how pathogens evolve, surveillance methods in the USA and Europe, risk assessment techniques and the use of food safety objectives. The second part of the book looks at individual pathogens, their characteristics, methods of detection and methods of control. These include: Arcobacter; Campylobacter; Trematodes and helminths; emerging strains of E. coli; Hepatitis viruses; Prion diseases; Vibrios; Yersinia; Listeria; Helicobacter pylori; Enterobacteriaceae; Campylobacter; Mycobacterium paratuberculosis; and enterococci.

Yasmine Motarjemi is the Corporate Food Safety Manager in the Quality Department at Nestec Ltd, Switzerland, and Martin Adams is Professor of Food Microbiology at Surrey University, UK

Woodhead Publishing Ltd Abington Hall Abington Cambridge CB1 6AH England www.woodheadpublishing.com ISBN-13: 978-1-85573-963-5 ISBN-10: 1-85573-963-1

CRC Press LLC 6000 Broken Sound Parkway, NW Suite 300 Boca Raton FL 33487 USA CRC order number WP3429 ISBN-10: 0-8493-3429-2

Motarjemi and Adams

Emerging foodborne pathogens will be a standard reference for microbiologists and Quality Assurance staff in the food industry, and food safety scientists working for governments and in the research community.

Emerging foodborne pathogens

Developments such as the increasing globalisation of the food industry, new technologies and products, and changes in the susceptibility of populations to disease, have all highlighted the problem of emerging pathogens. Pathogens may be defined as emerging in a number of ways. They can be newly-discovered, linked for the first time to disease in humans or to a particular food. A pathogen may also be defined as emerging when significant new strains emerge from an existing pathogen, or if the incidence of a pathogen increases dramatically. This important book discusses some of the major emerging pathogens and how they can be identified, tracked and controlled so that they do not pose a risk to consumers.

WOODHEAD PUBLISHING IN FOOD SCIENCE, TECHNOLOGY AND NUTRITION

Emerging foodborne pathogens Edited by Yasmine Motarjemi and Martin Adams

Emerging foodborne pathogens

i

Related titles: Understanding pathogen behaviour; Virulence, stress response and resistance (ISBN-13: 978-1-85573-953-6; ISBN-10: 1-85573-953-4) Pathogens respond dynamically to their environment. Understanding pathogen behaviour is critical both because of evidence of increased pathogen resistance to established sanitation and preservation techniques, and because of the increased use of minimal processing technologies which are potentially more vulnerable to the development of resistance. This collection summarises the wealth of recent research in this area and its implications for microbiologists and QA staff in the food industry. Improving the safety of fresh meat (ISBN-13: 978-1-85573-955-0; ISBN-10: 1-85573-955-0) It is widely recognised that food safety depends on effective intervention at all stages in the food chain, including the production of raw materials. Contaminated raw materials from agricultural production increase the hazards that subsequent processing operations must deal with, together with the risk that such contamination may survive through to the point of consumption. This collection provides an authoritative reference summarising the wealth of research on reducing microbial and other hazards in raw and fresh red meat. Food safety control in the poultry industry (ISBN-13: 978-1-85573-954-3; ISBN-10: 1-85573-954-2) Consumers’ expectations about the safety of products such as poultry meat and eggs have never been higher. The need to improve food safety has led to renewed attention on controlling contamination at all stages of the supply chain from ‘farm to fork’. This collection reviews the latest research and best practice in ensuring the safety of poultry meat and eggs, both on the farm and in subsequent processing operations. Details of these books and a complete list of Woodhead’s titles can be obtained by: ∑ ∑

ii

visiting our web site at www.woodheadpublishing.com contacting Customer Services (e-mail: [email protected]; fax: +44 (0) 1223 893694; tel.: +44 (0) 1223 891358 ext. 30; address: Woodhead Publishing Ltd, Abington Hall, Abington, Cambridge CB1 6AH, England)

Emerging foodborne pathogens Edited by Yasmine Motarjemi and Martin Adams

CRC Press Boca Raton Boston New York Washington, DC

WOODHEAD

PUBLISHING LIMITED

Cambridge England iii

Published by Woodhead Publishing Limited, Abington Hall, Abington Cambridge CB1 6AH, England www.woodheadpublishing.com Published in North America by CRC Press LLC, 6000 Broken Sound Parkway, NW, Suite 300, Boca Raton, FL 33487, USA First published 2006, Woodhead Publishing Limited and CRC Press LLC © 2006, Woodhead Publishing Limited, except Chapter 11 which is © British Crown Copyright 2006 The authors have asserted their moral rights. This book contains information obtained from authentic and highly regarded sources. Reprinted material is quoted with permission, and sources are indicated. Reasonable efforts have been made to publish reliable data and information, but the authors and the publishers cannot assume responsibility for the validity of all materials. Neither the authors nor the publishers, nor anyone else associated with this publication, shall be liable for any loss, damage or liability directly or indirectly caused or alleged to be caused by this book. Neither this book nor any part may be reproduced or transmitted in any form or by any means, electronic or mechanical, including photocopying, microfilming and recording, or by any information storage or retrieval system, without permission in writing from Woodhead Publishing Limited. The consent of Woodhead Publishing Limited does not extend to copying for general distribution, for promotion, for creating new works, or for resale. Specific permission must be obtained in writing from Woodhead Publishing Limited for such copying. Trademark notice: Product or corporate names may be trademarks or registered trademarks, and are used only for identification and explanation, without intent to infringe. British Library Cataloguing in Publication Data A catalogue record for this book is available from the British Library. Library of Congress Cataloging in Publication Data A catalog record for this book is available from the Library of Congress. Woodhead Publishing Limited ISBN-13: Woodhead Publishing Limited ISBN-10: Woodhead Publishing Limited ISBN-13: Woodhead Publishing Limited ISBN-10: CRC Press ISBN-10: 0-8493-3429-2 CRC Press order number: WP3429

978-1-85573-963-5 (book) 1-85573-963-1 (book) 978-1-84569-139-4 (e-book) 1-84569-139-3 (e-book)

The publishers’ policy is to use permanent paper from mills that operate a sustainable forestry policy, and which has been manufactured from pulp which is processed using acid-free and elementary chlorine-free practices. Furthermore, the publishers ensure that the text paper and cover board used have met acceptable environmental accreditation standards. Project managed by Macfarlane Production Services, Dunstable, Bedfordshire, England (e-mail: [email protected]) Typeset by Replika Press Pvt Ltd, India Printed by T J International, Padstow, Cornwall, England

iv

v

Contents

Contributor contact details ..................................................................

xiii

Introduction .........................................................................................

xvii

Part I Identifying emerging pathogens 1

2

3

How bacterial pathogens evolve .............................................. B. Wren, London School of Hygiene and Tropical Medicine, UK 1.1 Introduction ........................................................................ 1.2 Evolution and diversification of bacterial pathogens ...... 1.3 Genetic mechanisms of bacterial evolution ..................... 1.4 Case studies and the evolution of pathogenic Yersinia ... 1.5 Sources of further information ......................................... 1.6 Future studies ..................................................................... 1.7 Conclusion ......................................................................... 1.8 Acknowledgements ........................................................... 1.9 References .......................................................................... Surveillance for emerging pathogens in the United States ... C. R. Braden and R. V. Tauxe, Centers for Disease Control and Prevention, USA 2.1 Introduction ........................................................................ 2.2 Detecting new and emerging pathogens ........................... 2.3 Range of methods used for surveillance in the United States ...................................................................... 2.4 Use of surveillance data .................................................... 2.5 Future trends ...................................................................... 2.6 References .......................................................................... Surveillance of emerging pathogens in Europe ...................... S. J. O’Brien and I. S. T. Fisher, Health Protection Agency Centre for Infections, UK 3.1 Introduction ........................................................................

3 3 3 4 11 17 17 19 19 19 23

23 25 29 35 44 45 50

50

vi

Contents 3.2 3.3 3.4 3.5 3.6 3.7 3.8

4

5

6

The WHO surveillance programme for control of foodborne infections and intoxications in Europe ........... Disease-specific networks funded by the European Commission ...................................................................... Other sources of data on foodborne pathogens in Europe ............................................................................... Challenges for European surveillance of emerging foodborne pathogens ........................................................ Conclusion ........................................................................ Acknowledgements .......................................................... References .........................................................................

Tracking emerging pathogens: the case of noroviruses ........ E. Duizer and M. Koopmans, National Institute for Public Health and the Environment (RIVM), The Netherlands 4.1 Introduction ...................................................................... 4.2 Detection ........................................................................... 4.3 Virus tracking ................................................................... 4.4 Transmission routes .......................................................... 4.5 Prevention and control ..................................................... 4.6 Inactivation of caliciviruses ............................................. 4.7 Thoughts on other viruses ................................................ 4.8 Future trends ..................................................................... 4.9 Additional sources of informatiom .................................. 4.10 References ......................................................................... Industrial food microbiology and emerging foodborne pathogens ................................................................................... L. Smoot, Nestlé USA, USA and J-L. Cordier, Nestlé Nutrition, Switzerland 5.1 Introduction ...................................................................... 5.2 How to approach the issue of emerging pathogens ........ 5.3 How to identify emerging risks – sources of information ....................................................................... 5.4 Control measures during food manufacture .................... 5.5 Conclusions ...................................................................... 5.6 References ......................................................................... Microbiological risk assessment for emerging pathogens .... M. Brown and P. McClure, Unilever, UK 6.1 Introduction ...................................................................... 6.2 The importance of changes on levels of risk .................. 6.3 Interaction with legislation .............................................. 6.4 Users of risk assessments ................................................ 6.5 Risk assessment ................................................................ 6.6 Modelling .......................................................................... 6.7 Risk management .............................................................

51 57 70 72 73 74 74 77

77 83 89 93 96 97 99 100 100 101 111

111 114 115 120 124 125 130 130 133 136 138 138 146 147

Contents 6.8 6.9 6.10 7

Risk communication ......................................................... Conclusions ...................................................................... References and further reading ........................................

Food safety objectives and related concepts: the role of the food industry ....................................................................... L. G. M. Gorris, J. Bassett, J.-M. Membré, Unilever, UK 7.1 Introduction ...................................................................... 7.2 Recent developments in risk analysis ............................. 7.3 Definitions ........................................................................ 7.4 When setting a PO may be more efficient than establishing an FSO ......................................................... 7.5 Designing an FSM system using the new concepts ....... 7.6 Conclusions ...................................................................... 7.7 References ......................................................................... 7.8 Further reading .................................................................

vii 148 148 151 153 153 154 156 168 169 173 175 177

Part II Individual pathogens 8

9

Arcobacter ................................................................................. S. J. Forsythe, Nottingham Trent University, UK 8.1 Introduction ...................................................................... 8.2 The Arcobacter genus ...................................................... 8.3 Arcobacter identification and typing methods ................ 8.4 Methods of detection using growth media ...................... 8.5 Human and animal infections .......................................... 8.6 Prevention and control measures ..................................... 8.7 Future recognition of Arcobacter species as pathogens . 8.8 Acknowledgements .......................................................... 8.9 References ......................................................................... Foodborne trematodes and helminths .................................... K. O. Murrell, Uniformed University of Health Sciences, USA and D. W. T. Crompton, University of Glasgow, Scotland 9.1 Introduction ...................................................................... 9.2 Zoonotic parasite biology and impact on public health 9.3 Detection ........................................................................... 9.4 Economic impact .............................................................. 9.5 Prevention, control and treatment ................................... 9.6 Future trends ..................................................................... 9.7 Acknowledgements .......................................................... 9.8 References .........................................................................

181 181 182 186 197 203 210 211 211 212 222

222 223 241 242 244 244 244 249

10 Emerging pathogenic E. coli ....................................................... 253 G. Duffy, Ashtown Food Research Centre, Teagasc, Ireland 10.1 Introduction ...................................................................... 253 10.2 Detection methods ............................................................ 257

viii

Contents 10.3 10.4 10.5 10.6 10.7 10.8 10.9

11

Sources of VTEC infection in humans ........................... Prevalence of VTEC ........................................................ Survival, persistence and growth in the food chain ....... Control measures ........................................................... Future trends .................................................................. Sources of further information and advice ................... References ......................................................................

260 262 264 265 271 272 272

Hepatitis viruses ....................................................................... N. Cook and A. Rzeżutka, Central Science Laboratory, UK 11.1 Introduction .................................................................... 11.2 Characteristics of hepatitis A and E viruses (morphology, pathogenesis, symptoms of infection) ... 11.3 Epidemiology ................................................................. 11.4 Outbreaks of foodborne hepatitis .................................. 11.5 Detection methods for hepatitis viruses in foods ......... 11.6 Prevalence in the environment and routes of transmission through foodstuffs .................................... 11.7 Prevention and control ................................................... 11.8 Areas for further research .............................................. 11.9 Sources of further information ...................................... 11.10 Acknowledgement .......................................................... 11.11 References ......................................................................

282

12 Prion diseases ............................................................................ C. J. Sigurdson and A. Aguzzi, Universitätsspital Zürich, Switzerland 12.1 Introduction .................................................................... 12.2 Epidemiology ................................................................. 12.3 Detection ........................................................................ 12.4 Transmission................................................................... 12.5 Prevention and control ................................................... 12.6 Future trends .................................................................. 12.7 Prion terminology .......................................................... 12.8 References ...................................................................... 13 Vibrios ........................................................................................ G. B. Nair, S. M. Faruque, D. A. Sack, ICDDR,B – Centre for Health and Population Research, Bangladesh 13.1 Introduction .................................................................... 13.2 Taxonomy and brief historical background .................. 13.3 Clinical signs and symptoms ......................................... 13.4 Virulence factors ............................................................ 13.5 Epidemiology of Vibrio infections ................................ 13.6 Methods of detection ..................................................... 13.7 Subspecies typing ........................................................... 13.8 New pandemic strains of Vibrio parahaemolyticus .....

282 283 286 287 292 294 296 300 301 302 302 309

309 311 317 320 321 323 324 325 332

332 333 334 336 338 347 352 353

Contents 13.9 13.10 13.11 13.12 13.13

ix

Pandemic spread of cholera ........................................... Prevention and control ................................................... Vibrios: the genomic era ................................................ Acknowledgement .......................................................... References ......................................................................

355 356 358 359 359

14 Yersinia enterocolitica ............................................................... T. Nesbakken, Norwegian School of Veterinary Science, Norway 14.1 Introduction .................................................................... 14.2 Taxonomy and characteristics of Yersinia enterocolitica .................................................................. 14.3 Phenotype characterisation ............................................ 14.4 Methods of detection ..................................................... 14.5 Epidemiology ................................................................. 14.6 Risk factors connected to the agent .............................. 14.7 Risk factors in connection with the host ...................... 14.8 Risk factors in connection with survival and growth in foods ........................................................................... 14.9 Risk factors based on epidemiological studies ............. 14.10 Prevention and control at different steps of the food chain ....................................................................... 14.11 Future trends .................................................................. 14.12 Sources of further information and advice ................... 14.13 References ......................................................................

373

15 Listeria ....................................................................................... J. McLauchlin, Health Protection Agency Food Safety Microbiology Laboratory, UK 15.1 Introduction .................................................................... 15.2 Historical summary and emergence of listeriosis as a major foodborne disease ................................................ 15.3 Listeria taxonomy, properties, occurrence and pathogenicity .................................................................. 15.4 The disease listeriosis .................................................... 15.5 Epidemiology, surveillance, typing and routes of transmission .................................................................... 15.6 Growth and isolation of Listeria ................................... 15.7 Prevention and control ................................................... 15.8 Future trends .................................................................. 15.9 Sources of information and advice ............................... 15.10 References ...................................................................... 16 Helicobacter pylori .................................................................... S. F. Park, University of Surrey, UK 16.1 Introduction .................................................................... 16.2 Physiology and growth requirements ............................

373 374 375 376 379 387 388 389 392 392 396 397 397 406

406 407 408 412 415 420 422 423 424 426 429 429 430

x

Contents 16.3 16.4 16.5 16.6 16.7 16.8 16.9

Disease associations and mechanisms of virulence ..... Epidemiology and routes of transmission ..................... Detection methods and culture from clinical samples, food and water ............................................................... Survival in food and water ............................................ Conclusions and future trends ....................................... Sources of further information ...................................... References ......................................................................

17 Enterobacteriaceae .................................................................... J-L. Cordier, Nestlé Nutrition, Switzerland 17.1 Introduction .................................................................... 17.2 Methods of detection ..................................................... 17.3 Epidemiology ................................................................. 17.4 Health risks and underlying factors .............................. 17.5 Prevention and control ................................................... 17.6 References ...................................................................... 18 Campylobacter ........................................................................... R. E. Mandrell and W. G. Miller, US Department of Agriculture, USA 18.1 Introduction .................................................................... 18.2 Seasonal and sporadic disease ....................................... 18.3 Outbreaks ........................................................................ 18.4 Non-diarrhoeal human disease ...................................... 18.5 Reservoirs of ECS in the food and water supply ......... 18.6 Culture and isolation of ECS from human faeces, food and water sources .................................................. 18.7 Detection and differentiation methods .......................... 18.8 Comparative genomics of C. coli, C. lari, C. upsaliensis and C. jejuni ................................................................... 18.9 Putative and potential ECS virulence factors ............... 18.10 Genotyping ..................................................................... 18.11 Prevention and control ................................................... 18.12 Conclusions and future trends ....................................... 18.13 Acknowledgements ........................................................ 18.14 References ...................................................................... 19 Mycobacterium paratuberculosis .............................................. M. W. Griffiths, University of Guelph, Canada 19.1 Introduction .................................................................... 19.2 Johne’s disease ............................................................... 19.3 Crohn’s disease .............................................................. 19.4 Mycobacterium paratuberculosis and Crohn’s disease 19.5 Prevalence of mycobacterium paratuberculosis in foods ........................................................................... 19.6 Survival in food .............................................................

431 434 437 439 440 441 442 450 450 452 454 461 462 464 476

476 483 484 486 488 492 496 498 499 505 506 507 509 509 522 522 522 524 525 531 533

Contents 19.7 19.8 19.9 19.10 19.11

xi

Survival in the environment .......................................... Detection, enumeration and typing ............................... Control ............................................................................ Further sources of information ...................................... References ......................................................................

538 538 542 543 543

20 Enterococci ................................................................................ C. M. A. P. Franz and W. H. Holzapfel, Institute for Hygiene and Toxicology, Germany 20.1 Introduction .................................................................... 20.2 Habitat ............................................................................ 20.3 Use of enterococci as probiotics ................................... 20.4 Infections caused by enterococci and epidemiology .... 20.5 Incidence of virulence factors among food enterococci . 20.6 Incidence of antibiotic resistance among food enterococci ...................................................................... 20.7 Survival of gastrointestinal transit ................................ 20.8 Conclusion ...................................................................... 20.9 References ......................................................................

557

589 589 595 596

Index ....................................................................................................

614

557 560 569 570 586

xii

xiii

Contributor contact details (* = main point of contact)

Editors Dr Yasmine Motarjemi Food Safety Manager Nestlé Quality Management Department 55 Avenue Nestlé CH-1800 Vevey Switzerland E-mail: [email protected] Dr Martin Adams School of Biomedical and Molecular Sciences University of Surrey Guildford GU2 7XH UK E-mail: [email protected]

Chapter 1 Brendan Wren Professor of Microbial Pathogenesis Department of Infectious & Tropical Diseases London School of Hygiene & Tropical Medicine Keppel Street London WC1E 7HT UK Tel office: +44 (0)207 927 2288 Tel lab: +44 (0)207 612 7847 Fax number: +44 (0)207 637 4314 E-mail: [email protected]

Chapter 2 Christopher R. Braden* and Robert V. Tauxe Foodborne and Diarrheal Diseases Branch Division of Bacterial and Mycotic Diseases National Center for Infectious Diseases Centers for Disease Control and Prevention USA Mailstop A-38 Atlanta, GA 30333 E-mail: [email protected] [email protected] v

Chapter 3 Sarah O’Brien University of Manchester School of Medicine Division of Medicine and Neuroscience Clinical Sciences Building Hope Hospital Stott Lane Salford M6 8HD UK E-mail: sarah.o’[email protected]

xiv

Contributor contact details

Chapter 4 Dr Erwin Duizer and Dr Marion Koopmans* Diagnostic Laboratory for Infectious Diseases and Perinatal Screening National Institute for Public Health and the Environment (RIVM) Antonie van Leeuwenhoeklaan 9 3721 MA Bilthoven The Netherlands. E-mail: [email protected] [email protected]

Chapter 5 Jean-Louis Cordier Nestlé Nutrition Avenue Reller 23 CH-1800 Vevey Switzerland E-mail: [email protected] Tel: + 41 21 943 31 04 Les Smoot Nestlé USA 6625 Eiterman Road 43017 Dublin OH USA E-mail: [email protected] Tel: +1 (614) 526 5300

Chapter 6 Martyn Brown and Peter McClure Unilever Colworth House Sharnbrook Beds MK44 1LQ UK E-mail: [email protected] [email protected] Tel: 01234 264788 Fax: 01234 264744

Chapter 7 Leon G. M. Gorris*, John Bassett, Jeanne-Marie Membré Unilever Colworth House Sharnbrook Beds MK44 1LQ UK E-mail: [email protected] [email protected] [email protected]

Chapter 8 Stephen J. Forsythe Applied Microbiology and Environmental Biology School of Biomedical and Natural Sciences Nottingham Trent University Clifton Lane Nottingham NG11 8NS UK Tel: 0115 8483529 Fax: 0115 8486636 E-mail: [email protected]

Chapter 9 D. W. T. Crompton Institute of Biomedical and Life Sciences Graham Kerr Building University of Glasgow Glasgow G12 8QQ Scotland K. D. Murrell* Adjunct Professor Department of Preventative Medicine and Biostatistics School of Medicine Uniformed University of the Health Sciences Bethesda MD 20853 USA E-mail: [email protected]

Contributor contact details

xv

Chapter 10 Geraldine Duffy Ashtown Food Research Centre Teagasc Ashtown Dublin 15 Ireland

Chapter 13 G. Balakrish Nair* and David Sack Laboratory Sciences Division ICDDR,B: Centre for Health and Population Research Mohakhali, Dhaka 1212 Bangladesh

Tel: + 353 1 8059500 Fax: + 353 1 8059550 E-mail: [email protected]

Tel: 880-2-9886464 Fax: 880-2-8812529 or 8823116 E-mail: [email protected] [email protected]

Chapter 11 Nigel Cook Senior Microbiologist/Food Microbiology Central Science Laboratory Sand Hutton York YO41 1LZ UK Tel: +44 (0)1904 462623 Fax: +44 (0)1904 462111 E-mail: [email protected] Dr A. Rzeżutka Zaklad Wirusologi Zywnosci i Srodowiska Panstwowy Instytut Weterynaryjny Al. Partyzantow 57 24-100 Pulawy Poland

Chapter 12 Adriano Aguzzi* and Christina J. Sigurdson Institute of Neuropathology Universitätsspital Zürich Schmelzbergstrasse 12 CH-8091 Zürich Switzerland Tel: +41 1 255 2107 Fax: +41 1 255 4402 E-mail: [email protected]

Chapter 14 Professor Truls Nesbakken Norwegian School of Veterinary Science Dept of Food Safety and Infection Biology P. O. Box 8146 Dep. 0033 Oslo Norway E-mail: [email protected]

Chapter 15 Jim McLauchlin Health Protection Agency Food Safety Microbiology Laboratory Centre for Infections 61 Colindale Ave London NW9 5EQ UK Tel: +44 208 200 4400 Fax: +44 208 358 3112 E-mail: [email protected]

xvi

Contributor contact details

Chapter 16 Simon Park School of Biomedical and Molecular Sciences University of Surrey Guildford GU2 7XH UK E-mail: [email protected] Tel: 01483 689024 Fax: 01483 686401

Chapter 17 Jean-Louis Cordier Nestlé Nutrition Avenue Reller 23 CH-1800 Vevey Switzerland E-mail: [email protected]

Chapter 18 Robert E. Mandrell* and William G. Miller Produce Safety and Microbiology Research Unit Western Regional Research Center Agricultural Research Service US Department of Agriculture 800 Buchanan Street Albany CA 94710-1105 USA Tel: (510) 559-5829 Fax: (510) 559-6165 E-mail: [email protected]

Chapter 19 Dr Mansel W. Griffiths Chair in Dairy Microbiology and Director-Canadian Research Institute for Food Safety Department of Food Science University of Guelph Guelph, ON N1G 2W1 Canada Tel: 519 824 4120 x2269 Fax: 519 763 0952 E-mail: [email protected]

Chapter 20 Professor Dr Wilhelm Holzapfel* and Dr Charles Franz Institut für Hygiene und Toxikologie/ BFEL Haid-und-Neu-Str. 9 D-76131 Karlsruhe Germany Tel.: +49-721-6625-450 Fax: +49-721-6625-453 E-mail: [email protected] [email protected]

Introduction

xvii

Introduction

A good starting point for any discussion on emerging foodborne pathogens is to describe what this term is taken to mean. For our purposes we have adopted a definition which draws on several earlier published versions (Morse, 1995; 2004) and classifies emerging pathogens as: those causing illnesses that have only recently appeared or been recognised in a population, or that are well recognised but are rapidly increasing in incidence or geographic range. One consequence of having a relatively broad definition is that it is not always easy to decide which organisms to exclude and this is a problem we have encountered on several occasions while trying to prevent this book becoming an unmanageable tome. We have not attempted exhaustive coverage of the topic. The specific organisms or groups of organisms addressed in this book are selected for their topical relevance, their impact on public health and their value in portraying important characteristics of emerging pathogens. For some emerging pathogens such as the protozoan, Cyclospora cayetanenis, which are not covered here, or specific focus on the important topic of antimicrobial resistance in foodborne pathogens, the reader is referred to other sources (Strausbaurgh, 2000; Threlfall et al., 2000; Doyle et al., 2001; Miliotis and Bier, 2003; Molbak, 2004; Velge et al., 2005, Wassenaar, 2005, White et al., 2004). Emergence or re-emergence of foodborne pathogens results from a combination of several factors. It depends on our ability to detect, identify and recognise new agents but also reflects the dynamic relationship between: ∑ ∑ ∑

the changing characteristics and distribution of pathogenic microorganisms changes in the people they affect and changes in the production and processing of foods that create new ecological niches for microbial survival and growth.

It is possible to distinguish six major trends that currently influence these factors (WHO, 2000; Käferstein and Abudssalam, 1999; Käferstein et al., 2001;

xviii

Introductiont

Tauxe, 2002; Trevejo et al., 2005) and their impact is illustrated throughout this book.

Mass production and globalisation of the food supply With changes in the socio-economic status of some people leading to increased demand for foods such as meat and meat products, and a growing human population worldwide, food production systems have changed drastically in the last few decades. Intensified animal production has contributed to the spread of zoonotic pathogens and contamination of foods of animal origin as well as the environment. Countries also increasingly source their food supply on a global basis and this poses an increasing problem of control of foodborne hazards. An early illustration of this was the introduction of exotic Salmonella serovars to the UK during World War II as a result of the large scale importation of dried egg. There have been numerous examples since then, a more recent example being the large outbreak of Cyclospora infection in the United States in 1996 associated with imported raspberries from South America. When control measures for a particular hazard are implemented as part of the management strategy in one country, it can be undermined by importation from areas where these are not applied, as evidenced by outbreaks of salmonellosis caused by the importation of Salmonella Enteritidis infected eggs into the UK.

The international movement of people This can take several forms and would include refugees from wars, social conflicts or economic hardship as well as those from more prosperous regions travelling the world for purposes of business or leisure. These have all increased in recent years and offer an alternative route for the acquisition and importation of foodborne (and other) infectious diseases. For instance, Sweden has a good record with regard to the control of indigenous salmonellosis but salmonellosis remains a significant public health problem with 90% of cases estimated to be imported. The potential double impact of international travel on both the acquisition and transmission of foodborne illness is illustrated by the international outbreak of salmonellosis caused by a food service worker returning to her job preparing airline meals following a holiday abroad where she had contracted a salmonella infection.

The changing character of the population Certain groups of people – the very young, the old, the very sick, and the

Introduction

xix

immunocompromised, are more susceptible to foodborne (and other) infections and the proportion of the population in some of these groups is increasing, although such changes are not geographically uniform. A number of opportunistic pathogens are specific threats to these people, for instance Enterobacter sakazakii is a particular concern for premature infants or immunocompromised newborns. The changing demographics of the developed world mean that the proportion of people described as elderly is increasing as life expectancy increases. It is estimated that by the year 2025, 25% of the population will be over the age of 60. In less wealthy countries, the population of children under 5 is particularly at risk of diarrhoeal diseases, further aggravated by the problem of malnutrition and the so-called malnutrition-infection cycle. The number of people with a compromised immune system has also increased. HIV infection which weakens the body’s resistance to infection is one factor in this but other conditions and therapies that suppress the immune system such as cancer chemotherapy also increase susceptibility to foodborne and other infections.

Lifestyle changes The economic and social changes responsible for urbanisation and increased travel and tourism also contribute to an increase in eating food prepared away from the home – in restaurants, from street food vendors and in canteens. Inadequate training in food safety or lack of an appropriate infrastructure to support good hygienic practices means an increased risk of larger scale outbreaks occurring. A change in the diet, as a result of international trade in food and tourism has also influenced the emergence of certain diseases in some countries. For instance, the emergence of salmonellosis in Japan can be attributed to the increased consumption (and possibly import) of meat and meat products.

Transfer of recognised pathogens into new geographic areas This can be a result of the factors already cited which increase global movement and exchange of people and commodities, but it can also be the inadvertent consequence of other actions such as the practice of ships transporting harbour water around the world as ballast and then discharging it in new locations. This was implicated in a major outbreak of Vibrio parahemolyticus infection in Galveston in the United States with oysters harvested from near the site where tankers discharged ballast water and loaded oil destined for Japan. A similar practice is thought likely to have introduced V. cholerae into South America for the first time since the 19th century in 1991.

xx

Introducionts

Microbial evolution Evolutionary processes are more noticeable in microorganisms where marked changes in an organism’s physiology can occur in a relatively short time scale. If such changes affect the virulence of an organism it can result in the emergence of new pathogens and this is illustrated here in particular by the description of Yersinia and E.coli O157. Such changes can occur completely independently of human activity, but the latter can provide the selective pressure for the new strains to thrive. The existence of emerging pathogens reflects the fact that the struggle against foodborne illness is in a constant state of flux as biological evolution introduces new combinations of virulence and resistance factors and social and economic developments change the milieu in which pathogenic microorganisms survive, grow and cause illness. Our ability to picture this situation and respond to new threats is dependent on the accuracy and coverage of information available from sources such as microbiological surveys and epidemiological data. It can never be comprehensive but, surprisingly, it is only relatively recently that serious attempts have been made to determine the degree to which our formal epidemiological picture of foodborne illness reflects the objective situation. Improvements in analytical methods which detect and type microorganisms and the development of tools such as microbiological risk assessment have also helped increase our understanding and ability to manage foodborne risks in recent years. The first part of this book deals with a number of more general issues from the viewpoints of scientists studying emerging foodborne pathogens, regulators and food industry safety specialists. It describes current knowledge of the biology of how new pathogens emerge, the improvements in systems to identify enteric pathogens and recognise outbreaks that might previously have been missed and how concepts developed as part of risk analysis, such as food safety objectives, might be applied to emerging pathogens. In the second part, the ecology, epidemiology, detection and identification, and control measures are described for a selected number of specific emerging pathogens. It is noticeable that limited reference is made to the situation in the developing world. This should not be interpreted as a marginalisation of problems in these areas. On the contrary, due to the poor health and nutritional status of some populations and weaknesses in their sanitary infrastructure, these populations may be more susceptible to emerging diseases. Rather, it reflects the paucity of accurate data on emerging diseases allowing a quantitative assessment of the situation. This lack of information should be treated as a call for equal attention and the need for strengthening the investigation of outbreaks, surveillance and management of foodborne illness in these regions. Although the focus of this book is on emerging food pathogens, it is not intended to detract from the importance of other foodborne pathogens such as Shigella, S. aureus, B. cereus, Clostridium pefringens, or parasitic diseases, as these continue to be an important cause of morbidity in the world and a major

Introduction

xxi

risk for food industry. For instance, S. aureus has been the cause of one of the largest foodborne disease outbreak in the history of food industry, affecting over 13 400 people due to contaminated milk products (Asao et al., 2003). It would be hubristic to assume that the battle against any of these organisms had been finally won and to under-estimate the potential for these to ‘re-emerge’ under the influence of various factors described above. Every so often organisms assume the role of emerging pathogens and go on to become established as major causes of foodborne illness. One need only look at Campylobacter and Norovirus for good examples of these. Some previously well known organisms can assume emerging status in response to changing circumstances. For instance, the development of vacuum packaging caused some concern about a possible increased risk from C. botuliunum, breakdown of public health infrastructure or immigration have led to emergence of brucellosis in the central Asian republics, transmitted mainly through the consumption of unpasteurised goat’s and sheep’s milk, and toxoplasmosis is of increased concern as a consideration for HIV positive individuals. The prospect of bioterrorism has renewed concern about anthrax and changes in worldwide patterns of infectious disease are a likely consequence of global warming. In contrast, the status of many other emerging pathogens, however, never seems to progress beyond the emerging stage. This seems to be the case with Aeromonas hydrophila and may also turn out to be true for Mycobacterium paratuberculosis. False alarms are an inevitable consequence of vigilance. Improved knowledge and understanding will reduce their incidence but it remains important to scrutinise carefully any perceived new hazard. We hope that this book will prove a useful contribution to this process.

References ASAO, T.

et al. 2003. An extensive outbreak of staphylococcal food poisoning due to lowfat milk in Japan: estimation of enterotoxin A in the incriminated milk and powdered skim milk, Epidemiol. Infection, 130 (1): 33–40. DOYLE, M., BEUCHAT, L. and MONTVILLE, T. J. (eds) 2001. Food Microbiology: Fundamentals and Frontiers, 2nd edition. ASM Press, Washington. KÄFERSTEIN, F. and ABUDSSALAM, M. 1999. Food safety in the 21st Century, Bulletin of the World Health Organisation, 77(4): 347–51. KÄFERSTEIN, F.K., MOTARJEMI, Y. and MOY, G. 2001. Food Safety. In R. Lastity (ed.) Food Quality and Standards, Volume of Encylopedia of Life Support Systems (EOLSS), Developed under the auspices of UNESCO, EOLSS publishers), Oxford, UK (www. eolss. net) UNESCO-EOLSS. MILIOTIS, M.D. and BIER, J.W. (eds) 2003. International Handbook of Foodborne Pathogens, Marcel Dekker Inc., New York & Basel. MOLBAK, K. 2004. Spread of resistant bacteria and resistance genes from animals to humans: the public health consequences, J. Vet. Med., B 51: 364–369. MORSE, S. 1995. Factors in the emergence of infectious diseases, Emerg. Infect. Dis., 1 (1): 7–15. MORSE, S.S., 2004. Factors and determinants of disease emergence. Rev. Sci. Tech. Off. Int. Epiz., 23(2): 443–451.

xxii

Introducionts

STRAUSBAURGH, L.

2000. Cyclospora cayetanensis: a review, focusing on the outbreaks of cyclosporiasis in the 1990s. Clinical Infectious Diseases, 31: 1040–1057. TAUXE, R.V. 2002. Emerging foodborne pathogens. Int. J. Food Microbiol., 78(1-2): 31– 41. TREVEJO, R.T., BARR, M.C and ROBINSON, R.A. 2005. Important emerging bacterial zoonotic infections affecting immunocompromised, Vet. Res., 493–506. THRELFALL, E.J. et al. 2000. The emergence and spread of antibiotic resistance in foodborne bacteria. International Journal of Food Microbiology, 62: 1–5. VELGE, PH., CLOECKAERT, A. and BARROW, P. 2005. Emergence of Salmonella epidemics: the problems related to Salmonella enterica serotype Enteritidis and multiple antibiotic resistance in other major serotypes, Vet Res., 36: 267–288. WASSENAAR, T.M. 2005. Use of antimicrobial agents in veterinary medicine and implications for human health, Critical Reviews in Microbiology, 31: 155–169. WHITE, D.G. et al. 2004. Antimicrobial resistance among gram-negative foodborne bacterial pathogens associated with foods of animal origin, Foodborne Pathogens and Disease, 1 (3): 137–152. WHO (2000). Foodborne diseases: a focus on health education. World Health Organization. Geneva.

Part I Identifying emerging pathogens

1

2

Emerging foodborne pathogens

How bacterial pathogens evolve

3

1 How bacterial pathogens evolve B. Wren, London School of Hygiene and Tropical Medicine, UK

1.1

Introduction

Despite advances in hygiene, consumer knowledge, food treatment and food processing, foodborne pathogens still represent a significant threat to human health worldwide. Many foodborne pathogens have never been adequately controlled, while others have re-emerged due to factors related to lifestyle, political, economic, and ecological changes. Bacterial pathogens are particularly adept at continual change due to their short generation time combined with multiple mechanisms to alter their genetic repertoire. Foodborne pathogens have a further level of potential complexity as the evolutionary pressures that shape their existence are compounded by changes in human behaviour and practices such as changes in eating habits, agriculture and food manufacturing processes. The task of keeping pace with the emergence of pathogens seems daunting. However, the recent availability of whole genome sequences of virtually all pathogens, coupled with the development of complementary high-throughput genomics technologies such as DNA microarrays, means that we are now in a position to monitor and determine the underlying genetic mechanisms responsible for the emergence of fitter pathogens. Using case studies and examples from recent post-genome analyses, this chapter will describe the genetic mechanisms by which selected bacterial pathogens have evolved and will describe likely trends that could be used to reduce the emergence of foodborne pathogens.

1.2

Evolution and diversification of bacterial pathogens

Bacteria are the most successful organisms on the planet. Over a billion

4

Emerging foodborne pathogens

years ago they were the first living organisms and inhabited a diverse range of inhospitable niches ranging from boiling hot vents in the oceans to highly acidic springs. Bacterial pathogens, which are the best-understood group of bacteria, have chosen as their niche animals or plants and either deliberately, or inadvertently, cause damage to the host, resulting in disease. This has resulted in a constant ‘arms race’ between the pathogen and host, where the stakes, often death, are high. Thus, it is not surprising that both pathogen and host responses have developed finely tuned genetic mechanisms as part of their survival mechanisms. In contrast to eukaryotes, most bacteria have a rapid generation time; 30 minutes in Escherichia coli, compared with 30 years in humans. This means that bacteria are particularly adept at responding and adapting to different evolutionary pressures allowing the fittest to survive. For example, this may include the need to survive in an inhospitable environment, or for pathogens, in particular, the necessity to increase transmissibility to the next host or to establish themselves in a new host species. When new selection pressures appear, these are the individuals that survive, at the expense of the general population, and forge new populations. Depending on the severity and uniqueness of the selection pressure, this could lead to new speciation. The evolutionary success of bacteria is due to their versatility and diversity, which are largely reflected in their DNA content. Genome sequence data from bacterial pathogens have confirmed the genetic diversity between species, (e.g. the genome sequence of most members of the enterobacteriaceae are 30% different) and even within species (e.g. most strains of E. coli that have been sequenced are at least 10% different). To put this diversity into context, the difference in the genome content between man and mouse is 1%. The diversity of microbial gene content is also exemplified by the observation that approximately half of the predicted genes from bacterial genome sequences are of unknown biological function, and around a half of these appear to be unique to the individual species. For example, over 30% of the genes from E. coli, the best studied of all microorganisms, have no known function. These statistics underscore our limited knowledge of bacteria and microbial pathogens in general. However, it is not just the presence or absence of genes in the genome that contribute to the diversity of micro-organisms. Bacterial pathogens, in particular, have evolved many mechanisms for altering their genetic repertoire that provide a further level of genetic diversification.

1.3

Genetic mechanisms of bacterial evolution

1.3.1 Recombination and gene duplication Most bacteria can undergo DNA recombination at sites of similar nucleotide identity, which often results in an increase in the genetic content of the organism. This allows bacteria to extend or shuffle their genetic repertoire

How bacterial pathogens evolve

5

during reproduction. This can occur at several levels including duplication of open reading frames (formation of paralogous genes), cassettes of genes (genetic islands) or even entire chromosomes. This has advantages for the bacterium because it increases specific gene families that may increase the functional processes of the bacterium in subsequent generations (e.g., enable it to survive in an additional niche). The potential disadvantage of increasing the genetic load is that in terms of energy provision for the additional genetic elements this may be a burden on the efficient functioning of the cell. One example of the use of gene duplication is for generation of diverse surface structures. The genome sequence of the gastric pathogen Helicobacter pylori encodes a family of over 30 paralogous (homologous proteins from the same family that have been expanded by gene duplication) outer membrane proteins that may play a role in generating antigenic variation (Tomb et al., 1997). These are absent in the genome sequence of the foodborne pathogen Campylobacter jejuni and represent one of the few major differences between these closely related species (Parkhill et al., 2000). Similarly, genome analysis of Mycobacterium tuberculosis revealed two novel families of glycine-rich proteins with repetitive structure which constitute 10% of the genome. These gene families may represent a source of antigenic variation for M. tuberculosis (Cole et al., 1998).

1.3.2 Lateral gene transfer – the driving force for diversification Several mechanisms could be responsible for the differences evident amongst bacterial species. Point mutations (single nucleotide changes) leading to the modification, inactivation or differential regulation of existing genes have certainly contributed to the diversification of micro-organisms on an evolutionary timescale. However, it is difficult to account for the ability of bacteria to exploit new environments and become pathogenic based on the accumulation of point mutations alone. In fact, none of the phenotypic traits that are typically used to distinguish E. coli from Salmonella enterica can be attributed to the point mutational evolution of genes common to both species (Lawrence and Ochman, 1998). Instead there is growing evidence that lateral gene transfer (the acquisition of regions of DNA, largely from other microorganisms) in terms of gain of trait functions, has played an integral role in the evolution of bacterial genomes, and in particular the diversification and speciation of the enteric bacteria. Established vehicles for DNA transfer among bacteria include transpositions, conjugative plasmids, phages and natural transformation (innate ability to uptake DNA from other micro-organisms). One characteristic of loci acquired by lateral gene transfer is an atypical G+C content, relative to the rest of the genome (Fleischmann et al., 1995). In contrast to most eukaryotes, bacteria have variable whole G+C contents ranging from 23% to 78%. The availability of a complete genome sequence allows genome-wide screening for ‘spikes’ of G+C variation, offering the opportunity to measure and compare the

6

Emerging foodborne pathogens

cumulative effect of lateral gene transfer among pathogens. Comparison of sequenced genomes confirms that bacteria have undergone frequent gene transfer events, many of which act as markers for possible virulence determinants. Salmonella Typhimurium has over 30 G+C spikes and a number of these contain telltale remnants of portable transposons or insertion sequences (Parkhill et al., 2001a, McClelland et al., 2001). This contrasts with another foodborne pathogen C. jejuni (strain NCTC 11168) in which there is little evidence of lateral gene transfer (Parkhill et al., 2000). It appears that the similarity between these pathogens is mainly restricted to housekeeping genes and that genes required for most functions related to survival, transmission and pathogenesis are remarkably dissimilar. Thus lateral gene transfer is largely responsible for the genotypic and phenotypic differences between these pathogens and it suggests that selective pressures have driven profound evolutionary changes to create two very different foodborne pathogens from a relatively recent common ancestor. Lateral gene transfer often involves linked blocks of genes ranging in size from 5 to 100 kb and, if they contribute to virulence, such cassettes have been termed pathogenicity islands or pathogenicity loci (Hacker et al., 1997). Upon incorporation into a recipient bacterium these DNA regions can convert a benign organism into a pathogen. Examples of the products of pathogenicity islands include many type III and type IV secretion systems from bacterial species including foodborne pathogens such as E. coli and Salmonellae and Yersiniae. Both systems encode specialised organelles that act as molecular syringes to export effector molecules (generally toxins) across the bacterial membrane of Gram-negative bacteria into the host cell to modulate host cellular functions (Cheng and Schneewind, 2000, Galan and Collmer, 1999; Covacci et al., 1999). S. Typhimurium has two well-characterised type III secretion systems (Spi-1 and Spi-2) that play an integral role in their invasion and survival within host cells (Kingsley and Baumler, 2002). Other examples of pathogenicity islands include cluster of genes required for the fitness and survival of an organism such as the iron uptake system in Yersinia species. Many are situated at tRNA loci which thus represent a readily identifiable target to identify putative pathogenicity islands (Hacker et al., 1997). For some bacteria the pathogenicity cassette is not located near tRNA and these are often referred to as pathogenicity loci (PaLocs). Examples include the listeriolysin toxin and phospolipase virulence cassette from the foodborne pathogen Listeria monocytogenes and the cytotoxin and enterotoxin from the enteric pathogen Clostridium difficile (Portnoy et al., 1992; Hundsberger et al., 1997). Several further studies have demonstrated that many virulenceassociated as well as antibiotic resistance genes are located on mobile accessory DNA elements. Phage infection of bacteria has frequently been implicated in the horizontal gene transfer of virulence determinants. Mirold et al. have demonstrated that S. Typhimurium has evolved to a more pathogenic state by bacteriophage lysogenic conversion of SopE, an effector toxic protein transferred by the

How bacterial pathogens evolve

7

Spi-2 type III secretion system (Mirold et al., 1999). Strikingly, most of the isolates harbouring SopE belong to the small group of epidemic strains that have been responsible for a large percentage of human and animal salmonellosis (Mirold et al., 1999). Recent outbreaks of S. Typhimurium have been attributed to a multiply antibiotic resistant phage type, DT104 that appears to have increased virulence in humans and cattle (Wight et al., 1996; Cloeckaert and Schwarz, 2001). This example indicates that differences exist between highly similar salmonellae within animal populations and that more virulent organisms may be selected and expanded. In Vibrio cholerae the VPIf bacteriophage has been shown to encode a pilus that functions as a colonisation factor for the human intestine as well as the receptor for the cholera-toxin encoding CTXf bacteriophage (Karaolis et al., 1999). Another example of the recent emergence of a pathogen with a bacteriophage-encoded toxin is E. coli O157:H7 which is an identified virulence factor (Park et al., 2001; Reid et al., 2000). Additionally for V. cholerae, it has been suggested that the smaller of the two chromosomes can be considered as a mega-plasmid that was captured by the micro-organism in its ancestral past and which provides it with a protective advantage (Heidelberg et al., 2000). This selective advantage may relate to the marine part of the V. cholerae life cycle (the probable natural habitat of V. cholerae) rather than to adaptation to the human host. Lateral gene transfer has and will continue to change the pathogenic character of bacterial species.

1.3.3 Point mutations and slipped-strand mispairing Phase variation, the reversible, high-frequency, gain or loss of a phenotype, resulting from changes of expression of single or multiple genes, is a common survival strategy employed by bacterial pathogens (Henderson et al., 1999). Variation of surface structure by pathogens, frequently referred to as antigenic variation, is often used to avoid detection or to outwit a host’s immune system. In some pathogens, such variation can occur by the slipped-strand mispairing of repeat sequences of DNA during replication. Alteration of the length of these tracts within, or immediately upstream of genes causes the translation of the respective protein to move in and out of the correct frame, affecting the synthesis of the protein. The reversible on/off feature of these genes can be seen as recombinational changes of a binary system resulting in an exponential increase of gene variation. Therefore, the phenotype of an individual bacterium within a growing population can change, leading to a stable sub-population with altered properties. If this sub-population has gained a significant survival advantage then it can persist more readily than the original ‘parent’ strain. But this is a reversible process allowing the subpopulation to switch back should a new environment prove more favourable. Genes with variation in simple repeat sequences have been termed contingency genes and the repeating unit can vary from single nucleotides (homopolymeric tracts) to penta nucleotides (Moxon et al., 1994).

8

Emerging foodborne pathogens

Close scrutiny of whole-genome sequences can identify such repeats. Such analysis simplifies the identification and investigation of potential contingency genes that are often involved in host adaptation and pathogenesis. Prior to sequencing of the H. influenzae genome, only two examples of contingency genes were known in the organism. The search for simple nucleotide repeats in the H. influenzae genome sequence identified at least a further dozen potential contingency genes, four of which are involved in lipopolysaccharide biosynthesis and four more involved in iron uptake (Fleischmann et al., 1995; Hood et al., 1996). Analysis of the H. pylori genome sequence suggested the presence of 27 putative phase variable genes based upon the presence of simple repeats (Tomb et al., 1997; Alm et al., 1999). Two of these repeats were found in independent alpha-3fucosyltransferase genes, which have been shown to be responsible for the variable expression of the Lewis X and Lewis Y antigens on the surface of H. pylori (Wang et al., 1999; Appelmelk et al., 1999; Wang et al., 2000). A striking observation from the C. jejuni genome sequence was the apparently high level of genetic variation affecting translation of over 25 contingency genes (Parkhill et al., 2000). During sequencing of the eightfold redundant shotgun library of clones, regions were identified where the sequences of otherwise identical reads varied at a single point (Parkhill et al., 2000). These were mainly on runs of G and C that varied in length by one or more base pairs. Most of the 25-hypervariable regions group into three clusters in the genome, and these are coincident with loci responsible for lipooligosaccharide (LOS) biosynthesis, capsule biosynthesis and flagellar modification (Parkhill et al., 2000). One of these genes encodes a beta-1,3 galactosyltransferase responsible for expression of a GM1 ganglioside mimic on C. jejuni LOS. An assay to detect the presence of GM1 is its ability to bind cholera toxin (Linton et al., 2000b). This assay has been used to clearly demonstrate the on/off reversible switching of this determinant on the surface of C. jejuni cells (Linton et al., 2000a). Figure 1.1 demonstrates the analysis of six independent colonies with the terminal transferase in frame and out of frame. The ‘in frame’ colonies clearly bind to cholera toxin and when sequenced have the run of 8Gs in the beta-1,3 galactosyl terminal transferase gene. By contrast the ‘out of frame’ colonies barely bind cholera toxin (note that a small sub-population will revert and therefore bind cholera toxin) and when sequenced have a run of 9Gs (Fig. 1.1). This study demonstrates the power of genome sequence data in identifying genes likely to be important in cell surface structures and host-pathogen interactions.

1.3.4 Genome decay and the potential for increased virulence Loss of gene function, or genome decay, occurs as a bacterium adapts to its host. For example, many pseudogenes (DNA sequences that may have once encoded a functional protein), often ignored as sequencing artefacts, may in fact be remnants of functional genes from a pathogen in the process of

How bacterial pathogens evolve

9

6.5 kDa A

B

C

D (b)

GGGTGGGGGGGGTA

E

F

GGGTGGGGGGGGGTA

B

A GGGTGGGGGGGGTA

GGGTGGGGGGGGGTA

D

C GGGTGGGGGGGGTA

GGGTGGGGGGGGGTA

F

E

(a)

(c)

ATG GGT GGG GGG GGT AAA ATT GAT … … … . . . M G G G G K I D Binds cholera toxin

ATG GGT GGG GGG GGG TAA AAT TGA … … … M

G

G

G

G

*

Fails to bind cholera toxin (d)

Fig. 1.1 Demonstration of antigenic variation in C. jejuni b-1,3 galactosyltransferase gene WlaN. (a) Colony immunoblot of a natural population C. jejuni NCTC 11168 cells probed with cholera toxin. The minority of colonies, three of which are boxed, show little binding to cholera toxin, the majority of colonies, three of which are circled, show strong binding to cholera toxin. (b) Analysis of lipooligosaccharide from C. jejuni NCTC 11168 wild type cholera toxin binding variants. SDS-PAGE gel probed with cholera toxin. (c) Sequencing profiles of wlaN intragenic homopolymeric tracts from C. jejuni NCTC 11168 cholera toxin binding variants. Panels A, C and E were obtained from C. jejuni NCTC 11168 colonies circled, whilst panels B, D and F were obtained from C. jejuni NCTC 11168 colonies boxed. (d) Nucleotide and derived amino acid sequence of the region around the homopolymeric tract of the wlaN gene for sequences with eight and nine G residues. Eight G residues allows translational read through and full-length product formation whilst nine G residues leads to translational termination at a now in frame stop codon (TAA) (*) immediately following the homopolymeric tract.

downsizing its genome content as the organism adapts in response to evolutionary pressures. Comparison of the genome sequence of the broad host range foodborne pathogen S. Typhimurium with that of the human host adapted, closely related pathogen S. Typhi has revealed that the latter genome is in the early stages of genome decay with 5% of the predicted genes being non-functional pseudogenes. Most of the pseudogenes appear in genes that formerly encoded for cell surface functions, host interaction or pathogenesis functions, reflecting the evolutionary pressures to streamline the genome in its new human restricted

10

Emerging foodborne pathogens

host. Most pseudogenes are caused by single mutations rather than multiple mutations, again indicative that the observed genome downsizing is a recent event in evolutionary terms. An extreme of genome downsizing can been seen from the genome sequence of the obligate intracellular pathogen Rickettsia prowazekii (Andersson et al., 1998). The 1.11 Mb R. prowazekii genome is packed with pseudogenes, and has the highest proportion of non-coding DNA in any prokaryote – over 24%. The DNA between genes may represent the scattered remnants of genes that are no longer required (or harmful to the existence of the organism) – lost in a step-wise process as the organism acquires an obligate intracellular lifestyle. Analysis of the genome of the leprosy bacillus Mycobacterium leprae paints a similar picture – numerous pseudogenes and extensive genetic downsizing not found in other mycobacterial species that tend to have a more free-living existence (Brosch et al., 2000). Although counterintuitive, it is becoming increasingly evident that some genes actually increase the organism’s virulence when they are inactivated in the process of genome downsizing. When pathogenic Shigella strains arose from a non-pathogenic E. coli ancestor, the loss of ompT and cadA genes may have contributed to their virulence and evolution (so-called ‘black holes’) (Maurelli et al., 1998; Nakata et al., 1993). More recently, this phenomenon has been demonstrated in M. tuberculosis, where several experimentally designed knockout mutants appear more virulent than the wild type strain (Parish et al., 2003). This may also be a contributory factor to the evolution of the highly virulent plague bacillus Yersinia pestis (see below).

1.3.5 Modulation of the frequency of genetic variation and fidelity of proof reading enzymes The genetic diversity of bacteria results not only from horizontal exchange and recombination of DNA sequences from similar and disparate species, but also from errors in DNA replication and repair as well (Radman et al., 2000a, b; Brown et al., 2001). Most bacteria have dedicated genetic systems such as DNA replication and mismatch repair systems that ensure the faithful replication of genetic material in the cell. Occasionally some of these systems may be defective due to genetic mutations altering the fidelity of DNA replication or mismatch repair. This may result in progeny that have a higher mutation rate, so called mutator strains (Radman et al., 2000a, b; Brown et al., 2001). These mutation-prone strains can profoundly affect the evolution rates of bacteria. Potentially a beneficial mutation may allow the rapid emergence of a more fit strain that may have extended its host range as a result of one of the mutational events. A well-characterised system is MutS, which is involved in methyl-directed mismatch repair (Radman et al., 2000a, b). MutS mutants generate a mutator phenotype typified by high mutation rates and promiscuous recombination.

How bacterial pathogens evolve

11

An example of how mutator strains can dominate in selected environments is in the lungs of cystic fibrosis patients who are chronically infected for years by one or a few lineages of Pseudomonas aeruginosa. These bacterial populations adapt to the highly compartmentalised and anatomically deteriorating lung environment of cystic fibrosis patients, as well as to the challenges of the immune defences and antibiotic therapy. In P. aeruginosa a high proportion of isolates (20%) from the lungs of cystic fibrosis patients have an increased mutation frequency (mutators) (Oliver et al., 2000, 2002); In four out of 11 independent P. aeruginosa strains, the high mutation frequency was found to be complemented with the wild-type mutS gene from P. aeruginosa PAO1 (Oliver et al., 2002). Further studies have shown seven out of the 11 mutator strains were found to be defective in the MMR system (four mutS, two mutL and one uvrD) (Oliver et al., 2000). The results show that the putative P. aeruginosa mutS, mutL and uvrD genes are mutator genes and that their alteration results in a mutator phenotype. Mutator strains were not found in 75 non-CF patients acutely infected with P. aeruginosa (Oliver et al., 2000, 2002). These studies also reveal a link between high mutation rates in vivo and the evolution of antibiotic resistance by P. aeruginosa (Blazquez, 2003). For foodborne pathogens such as E. coli and Salmonella mutator strains have been characterised and undoubtedly contribute to the frequency of the mutation rate and evolution of the species. However, inspection of the C. jejuni and H. pylori genomes reveal a lack of mut genes, suggesting that such mechanisms do not apply in these organisms (Tomb et al., 1997; Parkhill et al., 2000).

1.4

Case studies and the evolution of pathogenic Yersinia

1.4.1 Recently emerged pathogens and the Yersinia pestis genome recipe Examples of recently emerged pathogens include V. cholerae non-O1/nonO139 cholera toxin positive strains responsible for the current cholera pandemic (Faruque et al., 1998; Dziejman et al., 2002). E. coli O157 that sporadically appears in the food chain in several parts of the world (Park et al., 2001; Reid et al., 2000) and S. enteritidis phage type 4 replacing a previous niche occupied by pathogenic Salmonella species (Wight et al., 1996; Cloeckaert and Schwarz, 2001). However, the most striking example of the emergence of a highly virulent pathogen is the evolution of the plague bacillus Y. pestis, which evolved from Yersinia pseudotuberculosis, a mild foodborne pathogen in about 2,000 to 20,000 years – an eye blink of evolutionary time (Achtman et al., 1999). By contrast the other Yersinia foodborne pathogen Yersinia enterocolitica, is distantly related to Y. pseudotuberculosis and Y. pestis. This has been referred to as the Yersinia paradox – the two closely related species,

12

Emerging foodborne pathogens

Y. pseudotuberculosis and Y. pestis cause vastly different diseases and are the most closely related (97% at the DNA level), yet the least related, the enteropathogenic yersiniae, are foodborne pathogens causing similar disease. An understanding of how one species evolved from the other can now be gained through genome sequence and microarray analyses. The Y. pestis genome seems to be particularly flexible and in an intermediate stage of genome flux and genome decay. This paradigm of bacterial pathogen evolution can be embodied as the Yersinia genome recipe – add DNA, stir and reduce. Add DNA As the nucleotide sequences of more bacterial genomes become available it is evident that they are mosaics of DNA sequences from different origins, due to the lateral exchange of large mobile genetic elements such as plasmids, phage or transposons. The genetic material acquired often contributes to an organism’s virulence – broadening its host range, for example, or improving its ability to overcome host defences or to cause tissue damage. This lateral gene transfer allows microbial pathogens to evolve extremely rapidly, in ‘quantum leaps’. For Y. pestis, plasmid acquisition certainly seems to be a key element in its evolutionary jump from enteric pathogen to flea-transmitted systemic pathogen. In addition to the virulence plasmid pYV that is also common to the enteropathogenic Yersinia, virtually all Y. pestis strains have two further plasmids – pPla that encodes the plasminogen activator Pla, (Brubaker, 1991) and pMT1 that encodes the putative murine toxin Ymt, as well as the F1 capsule. The precise role of these determinants in host adaptation and virulence is uncertain, but there are several hints that they are involved in transmission. Pla, for example, is important for dissemination of Y. pestis after subcutaneous injection into a mammalian host (Sodeinde et al., 1988) and strains that lack the entire pMT1 plasmid are unable to colonise fleas (Hinnebusch et al., 1998). However, also required for fleaborne transmission is the unstable chromosomally located haemin storage locus (hms), which encodes outer surface proteins. Thus, overall, the acquisition of two plasmid (pPla and pMT1) by horizontal gene transfer, along with the pre-existing chromosomal hms locus, help to explain the rapid evolutionary transition of Y. pestis to fleaborne vector transmitted pathogen (Wren, 2003). The pPla and pMT1 plasmids and the hms locus were known before the Y. pestis strain CO92 genome sequence became available. But what about the rest of the 4.65 Mb chromosome? G+C analysis of the Y. pestis CO92 genome identified at least 21 G+C ‘spike’ regions characteristic of lateral gene transfer, including the 102 kb unstable element that contains hms. (Parkhill et al., 2001b). Among these regions were several genes that appear to have come from other insect pathogens. Sequences related to the parasitism of insects include homologues of insecticidal toxin complexes (Tcs) from Photorhabdus luminescens, Serratia entomophila and Xenorhabdus nematophilus (Waterfield et al., 2001). In addition, a predicted coding sequence

How bacterial pathogens evolve

13

showing similarity to an insect virus-like enhancin protein, a proteolytic enzyme that can damage insect gut membranes was also identified in a region of low G+C content (Parkhill et al., 2001b). The sequence is flanked by transposase fragments, suggesting horizontal acquisition. Other apparent acquisitions include a chromosomally encoded type-III secretion system, similar in gene content and order to the Spi2 type-III system of S. typhimurium (Shea et al., 1996), and several adhesins and iron-scavenging systems. However, subsequent DNA microarray analysis has shown that virtually all these determinants are also present in Y. pseudotuberculosis (Hinchliffe et al., 2003), suggesting that they have been acquired in the Y. pestis genome for some time and that Y. pseudotuberculosis probably has some association with insects, hitherto unknown. Stir A most striking feature of the Y. pestis CO92 genome sequence was the large number of insertion sequence (IS) elements. IS elements consist of perfectly repeated sequences, and are likely sites for homologous recombination events that can rearrange the genome. The total of 140 IS elements in the CO92 genome exceeds that described in most other bacterial genomes and comprises 3.7% of the genome. All bacterial genomes sequenced to date have a small but detectable bias towards G on the leading strand of the bi-directional replication fork (Lobry, 1996). So the G/C skew in different parts of the genome highlights any irregularities in its composition. The G/C skew plot of Y. pestis CO92 shows three anomalies (two inversions and one translocation) (Parkhill et al., 2001b). Each is bounded by IS elements, suggesting that they could be the result of recent recombination. It seems several different chromosomal configurations can exist in the same population, suggesting that genomic rearrangements occur during growth of the organism. This is a particularly unusual feature for a bacterial chromosome and it is unknown how these events affect the biology of the organism. However, because the expression of bacterial genes is influenced by their orientation with respect to the direction of DNA replication, it seems reasonable to conclude that such rearrangements could alter pathogenesis, and be a rapid mechanism to switch on and off virulence. Reduce Close inspection of the CO92 nucleotide sequence identified at least 149 pseudogenes, representing 4% of the genome. Several mechanisms account for the accumulation of pseudogenes in Y. pestis, including IS element expansion, deletion, point mutation and slipped strand mispairing. As Y. pestis has changed its lifestyle from that of the ancestral Y. pseudotuberculosis, it would not be expected to use genes required for enteropathogenicity as the newly evolved Y. pestis would no longer be transmitted by the faecal-oral route. Enteropathogens, particularly those transmitted in the food chain, specifically adhere to surfaces of the gut and

14

Emerging foodborne pathogens

invade cells lining it. Proteins important for this process in Y. pseudotuberculosis include YadA, and Inv, both of which are represented by pseudogenes in Y. pestis (Simonet et al., 1996; Rosqvist et al., 1988). Many of the other pseudogenes reported, for example a putative intimin adhesion protein, may have encoded adhesin molecules that potentially played a role in enteropathogenesis. Additionally many surface exposed features appear to have been lost in the rapid transition from Y. pseudotuberculosis to Y. pestis such as fimbrial-usher systems. This may represent an example of Y. pestis shutting down opportunities for the mammalian host immune system to recognise Y. pestis during systemic disease. Some pseudogenes may be able to regain their function. As outlined above, several pathogens have been shown to switch surface-expressed antigens on or off by slipped-strand mispairing of repeat sequences during replication (Henderson et al., 1999) and a similar process has been demonstrated in Y. pestis in the ureD gene. The organism is characteristically urease negative, but activity can be restored in vitro by the spontaneous deletion of a single base pair in a homopolymeric tract. This type of reversible mutation would free Y. pestis from the metabolic burden of producing proteins that are not required in its new flea/mammal life cycle, yet still allow the potential to express them should a subsequent need arise. But some enteropathogen virulence traits seem to be irreversible in Y. pestis, because the gene pathways encoding them have been inactivated by multiple mutations. Examples here include motility and LPS biosynthesis, where at least five genes in each pathway appear to no longer function in Y. pestis CO92 (Skurnik et al., 2000; Parkhill et al., 2001b). There are also several pseudogenes of unknown function. Given that many of the familiar pseudogenes appear to be associated with a redundant enteric life cycle, identifying these sequences in Y. pestis may reveal potential virulence determinants for investigation in the enteropathogenic yersiniae. Not all of the lost genes relate to putative virulence determinants. In Y. pestis, many pseudogenes relate to physiological functions, particularly with respect to the loss of bioenergetic functions such as dicarboxylic amino acid metabolism. For some time it had already been known that all Y. pestis strains tested lack glucose 6-phosphate dehydrogenase and aspartase among other enzymes that alter the catabolic flow of carbon (Brubaker, 2000; Dreyfus and Brubaker, 1978; Mortlock and Brubaker, 1962). The reduction of unnecessary metabolic load may enable the organism to conserve energy. The newly evolved streamlined organism may then contribute to the development of acute disease. Thus rather like gene acquisition being important in the evolution of highly pathogenic bacteria, genome downsizing may be at least equally important. This loss appears to have been triggered by the extensive expansion of IS elements, which caused major genome rearrangements. Once Y. pseudotuberculosis had acquired certain critical genes, the instability introduced by the IS elements was the major force to release its potential – as Y. pestis.

How bacterial pathogens evolve

15

The question remains why would Y. pestis want to evolve from a common foodborne pathogen to one that kills its host by bacteraemia? The answer may lie in the respective life cycles of the organisms. For the enteropathogenic Yersinia, shedding and spreading by inducing diarrhoea in the host is the most efficient mechanism to transfer to the next host. By contrast Y. pestis is transmitted by a flea vector, which because it is a recent evolutionary event is relatively inefficient, therefore a high bacterial load, i.e., severe bacteraemia in the host, would be required for the organism to be transmitted and ensure an efficient life cycle. Thus there is a very strong selective pressure to cause severe disease. The factors influencing the rise and fall of plague pandemics also remain obscure. Undoubtedly there will be many factors involved, but the genetic make up of Y. pestis is likely to be important. It is possible that during the spread of an epidemic, passage through humans may allow Y. pestis to become more transmissible or more pathogenic, particularly during pneumonic transfer where close human contact may aid transmission. Such a ‘hypervirulent’ strain of V. cholerae was recently demonstrated to have arisen during passage through humans in a cholera epidemic (Merrell et al., 2002). The flexible genome of Y. pestis makes it a likely candidate for such a mechanism. Indeed there is evidence the rapid emergence of the three Yersinia pestis biovars Antiqua, Mediaevalis and Orientalis, arose through parallel micro-evolution as a result of a flexible genome. As Orientalis biovar is glycerol negative and nitrate positive and Mediaevalis is glycerol positive and nitrate negative, it is likely that these biovars arose independently from the glycerol and nitrate positive Antiqua progenitor (Fig. 1.2). Further analysis using subtractive hybridisation and microarray analysis have confirmed that Mediaevalis and Orientalis evolved independently from Antiqua (Radnedge et al., 2002, Hinchliffe et al., 2003). Very recently a fourth biovar, biovar microtus, has been proposed, confirming the process of parallel microevolution in natural plague foci (Zhou et al., 2004).

1.4.2 Evolution of enteropathogenic Yersinia The genome sequences of Y. pseudotuberculosis IP 32953 (serotype I) (Chain et al., 2004) and Y. enterocolitica 8081 (biogroup1B, serotype O8) (http:// www.sanger.ac.uk/Projects/Y_enterocolitica/) have been recently made available. Insights from genome analysis allow us to piece together a picture of how the three pathogenic Yersinia species may have arisen. It seems clear that Y. enterocolitica has evolved independently. It can be separated into three lineages – the mostly avirulent biogroup 1A strains that lack the virulence plasmid, the mouse-virulent Old World strains (biogroups 2 to 5) and mouselethal New World strains (biogroup 1B) (Fig. 1.2). The New World strains appear to have acquired several elements by lateral gene transfer that contribute to their increased virulence compared to Old World strains. In particular, the New World strains contain a ‘high pathogenicity

16

Emerging foodborne pathogens Non-pathogenic environmental Yersinia +pYV Predecessor of pathogenic Yersinia +Yst

Y. enterocolitica

Hms & HPI*

insect toxins

Y. pseudotb non-biofilm

–pYV

Y. enterocolitica IA

HPI & type II secretion

Y. enterocolitica Old-world

Y. enterocolitica New-world

Y. pseudotb biofilm O1b/O3 strains pPla pMT1

Add IS elements, stir and reduce

Y. pestis Antiqua Y. pestis Mediaevalis

Y. pestis Orientalis

Fig. 1.2 Proposed evolution of Yersinia species. The non-pathogenic Yersinia gain the virulence plasmid that contain the prototype type III secretion system to form the predecessor of pathogenic Yersinia. Y. enterocolitica diverges from Y. pseudotuberculosis and forms three lineages. 1A, Old-world and New-world. Y. pseudotuberculosis gains ability to parasitise insects and form biofilms in hosts before evolving into Y. pestis through adding DNA (pPla and pMT1), stirring and reducing. For Y. pestis ensuing microevolution results in three lineages given the biovar designations, Antiqua, Mediaevalis and Orientalis. Note, the high pathogenicity island (HPI) was independently acquired to high pathogenicity island (HPI)*.

island’ (HPI) which encodes the synthesis of the siderophore yersiniabactin, an iron-sequestering low-molecular-weight compound that is invaluable in the iron-limiting environment of the host (Pelludat et al., 1998). The importance of the HPI region to mouse virulence has been demonstrated by transferring it from a New World strain into an Old World strain, whereupon the modified strain was lethal in mice (Pelludat et al., 2002). The HPI has also been found in other enterobacteriaceae, (Schubert et al., 1998) some of which might be candidates for donating the HPI to the Y. enterocolitica New World strains and Y. pseudotuberculosis (Y. pestis). The region is also present in Y. pseudotuberculosis and Y. pestis, but sequence analysis reveals that it is significantly different to the HPI in Y. enterocolitica, suggesting that it may have been acquired independently (Schubert et al., 1998). More recently, another element has been identified that appears to occur exclusively in New World strains – a further type II secretion gene cluster (Iwobi et al., 2003). Genome sequence analysis of the genomes of Y. enterocolitica and Y. pseudotuberculosis have confirmed that they have far fewer IS elements and pseudogenes than Y. pestis CO92 or a more recently sequenced strain of Y. pestis KIM10 (Parkhill and Thompson, 2002; Garcia, 2002; Chain et al., 2004). This suggests that the Y. pseudotuberculosis and Y. enterocolitica genomes are far more stable than Y. pestis. Genome sequence data also

How bacterial pathogens evolve

17

confirms that Y. pestis and Y. pseudotuberculosis are closely related, with gene homology of nearly 97% and largely co-linear gene organisation (Garcia, 2002; Chain et al., 2004). In contrast, Y. enterocolitica is more distantly related, about the same evolutionary distance away from Y. pseudotuberculosis and Y. pestis as Escherichia coli is from Salmonella species. Closer inspection of the disease syndromes of Y. enterocolitica and Y. pseudotuberculosis suggests that although they appear similar, the two species do, in fact, cause different infections. Although both pathogens invade through M cells, Y. enterocolitica colonises the Peyer’s patches, while Y. pseudotuberculosis is more widely disseminated and typically causes acute abdominal pain with mesenteric lymphadenitis of the small intestine. One distinguishing feature of Y. enterocolitica disease compared to Y. pseudotuberculosis is that it causes a more severe diarrhoea (pronounced watery diarrhoea and occasionally bloody diarrhoea with fever in children). The heat stable toxin (Yst) has been identified in all enteropathogenic Y. enterocolitica, but is absent in Y. pseudotuberculosis (Delor and Cornelis, 1992). This could be one of the distinguishing genetic features responsible for this difference in symptoms. Thus, although diarrhoea is a common outcome, the diseases are different. This partly explains the ‘Yersinia paradox’, although it does not shed light on why Y. pestis causes such a different disease.

1.5

Sources of further information

The UK represents a special case in terms of emerging foodborne pathogens because of the heightened awareness of foodborne disease following high profile BSE, E. coli, Listeria and Salmonella outbreaks and the ever increasing reported incidence of campylobacteriosis. Most microbial surveillance in the UK is carried out at the Health Protection Agency (formerly the Central Public Health Laboratories) at Colindale, London. This centralised facility maintains national records of the different species, strains and strain types responsible for foodborne diseases. Through a process of monitoring and reporting the Centre can detect trends, trace the sources and route of transmission of foodborne pathogens, and act to prevent the further spread of disease. In the USA, the Communicable Disease Centre in Atlanta performs a similar role, and most countries have similar disease surveillance centres.

1.6

Future studies

The bedrock of infectious disease prevention and control is high-quality microbiology and surveillance that allows outbreaks to be anticipated and prevented. Traditionally, this has relied on phenotypic markers such as

18

Emerging foodborne pathogens

serotyping and phage typing and limited genotypic methods such as pulsed field gel electrophoresis. More recently, multi locus sequence typing (MLST) has been used effectively for retrospective population genetic studies and for determining clonality of strains of diverse origin. All of these methods suffer from providing limited information. In an ideal world the complete genome sequence of every problem pathogen would be determined as and when outbreaks occurred. Such information would enable us to determine if the genetic information from a given pathogen is changing both in terms of gene acquisition and genome decay. However, even if this were ever possible, we are several years away from being able to do this on a routine basis. In terms of surveillance and prevention of the spread of infectious disease, if a putative virulence determinant(s) from one species were to be identified unexpectedly in another bacterial species (through lateral gene transfer) this would raise concern. If this were identified rapidly, appropriate measures could be taken. There are numerous precedents of virulence determinants being present in different species including several families of toxins (e.g. thiol activating toxins, ADP ribosylating toxins such as cholera toxin and E. coli LT toxins,) type III and IV secretion systems, autotransporters and the Yersinia high-pathogenicity island which is widely distributed among different enterobacteria such as E. coli, Klebsiella and Salmonella (Bach et al., 2000). Specifically designed microarrays may offer a new dimension to microbial surveillance. We are currently developing an active surveillance pathogen (ASP) DNA microarray that contains elements that would not only identify specific foodborne pathogens, but would also contain elements of the known genome flux including pathogenicity islands, pathogenicity loci, antibiotic resistance genes, transposons, plasmids and phages that carry known virulence determinants, many of which have been described in this chapter. The ASP array would be useful for supplying information on tracing the sources and routes of transmission of a given pathogen, active surveillance may allow the identification of the emergence of highly transmissible or virulent strains that could, for example, be traced back to an individual flock or herd, eliminated, thus averting the spread of an emerging virulent strain. The long term potential of the ASP array could be applied to provide information on the ∑ ∑ ∑ ∑ ∑ ∑

emergence of new or more virulent foodborne pathogens spread of antibiotic resistance and associated virulence determinants. (For example, is the practice of adding antibiotics to animal feed contributing to antibiotic resistance in foodborne pathogens?) change in bacterial populations before and after vaccine trials. (For example, does the introduction of new Salmonella poultry vaccine influence the emergence of other foodborne pathogens?) any unusual isolates from patients with traveller’s diarrhoea emergence of nosocomial pathogens whether the genome of a pathogen has been tampered with, either through deliberate or accidental release.

How bacterial pathogens evolve

1.7

19

Conclusion

Common themes to emerge from the genome analysis of over a hundred bacterial pathogens sequenced so far include extensive lateral gene transfer (particularly among enteric pathogens), genome decay (among obligate intracellular pathogens) and extensive antigenic variation by gene shuffling or slipped-strand mispairing. Y. pestis, perhaps the most feared of all recently evolved bacterial pathogens, appears to have all these characteristics, it is an organism in an intermediate stage of genetic flux, where the acquisition of novel sequences by lateral gene transfer appears to be counterbalanced by ongoing genome decay. If we are to continue to outwit pathogens and avoid future outbreaks, there can be no substitute for continuing to undertake basic research against our old adversaries and maintaining active microbial surveillance.

1.8

Acknowledgements

The author wishes to acknowledge Manu Davies for assistance with preparing the manuscript and Val Curtis for useful discussions. The author acknowledges the BBSRC, MRC and The Leverhulme Trust for funding research on foodborne pathogens in his laboratory.

1.9

References

ACHTMAN, M., ZURTH, K., MORELLI, G., TORREA, G., GUIYOULE, A.

and CARNIEL, E. (1999) Proc Natl Acad Sci USA, 96, 14043–8. ALM, R. A., LING, L. S., MOIR, D. T., KING, B. L., BROWN, E. D., DOIG, P. C., SMITH, D. R., NOONAN, B., GUILD, B. C., DEJONGE, B. L., CARMEL, G., TUMMINO, P. J., CARUSO, A., URIA-NICKELSEN, M., MILLS, D. M., IVES, C., GIBSON, R., MERBERG, D., MILLS, S. D., JIANG, Q., TAYLOR, D. E., VOVIS, G. F. and TRUST, T. J. (1999) Nature, 397, 176–80. ANDERSSON, S. G., ZOMORODIPOUR, A., ANDERSSON, J. O., SICHERITZ-PONTEN, T., ALSMARK, U. C., PODOWSKI, R. M., NASLUND, A. K., ERIKSSON, A. S., WINKLER, H. H. and KURLAND, C. G. (1998) Nature, 396, 133–40. APPELMELK, B. J., MARTIN, S. L., MONTEIRO, M. A., CLAYTON, C. A., MCCOLM, A. A., ZHENG, P., VERBOOM, T., MAASKANT, J. J., VAN DEN EIJNDEN, D. H., HOKKE, C. H., PERRY, M. B., VANDENBROUCKE-GRAULS, C. M. and KUSTERS, J. G. (1999) Infect Immun, 67, 5361–6. BACH, S., DE ALMEIDA, A. and CARNIEL, E. (2000) FEMS Microbiol Lett, 183, 289–94. BLAZQUEZ, J. (2003) Clin Infect Dis, 37, 1201–9. BROSCH, R., GORDON, S. V., EIGLMEIER, K., GARNIER, T. and COLE, S. T. (2000) Res Microbiol, 151, 135–42. BROWN, E. W., LECLERC, J. E., KOTEWICZ, M. L. and CEBULA, T. A. (2001) Environ Mol Mutagen, 38, 248–60. BRUBAKER, R. R. (1991) Clin Microbiol Rev, 4, 309–24. BRUBAKER, R. R. (2000) In The prokaryotes, an evolving electronic resource for the microbiological community, (On line: http://et.springer-ny.com:8080/prokPUB/ index.htm) (Eds, Dworkin, M., Falkow, S., Rosenberg, E., Schleifer, K.-H. and Stackelbrandt, E.) Springer Verlag, New York.

20

Emerging foodborne pathogens

CHAIN, P. S., CARNIEL, E., LARIMER, F. W., LAMERDIN, J., STOUTLAND, P.O., REGALA, W. M., GEORGESCU, A. M., VERGEZ, L. M., LAND, M. L., MOTIN, V. L., BRUBAKER, R. R., FOWLER, J., HINNEBUSCH, J., MARCEAU, M., MEDIGUE, C., SIMONET, M., CHENAL-FRANCISQUE, V., SOUZA, B., DACHEUX, D., ELLIOTT, J. M., DERBISE, A., HAUSER, L. J.

and GARCIA, E. (2004) Proc Natl Acad Sci USA, 101, 13826–3. CHENG, L. W. and SCHNEEWIND, O. (2000) Trends Microbiol, 8, 214–20. CLOECKAERT, A. and SCHWARZ, S. (2001) Vet Res, 32, 301–10. COLE, S. T., BROSCH, R., PARKHILL, J., GARNIER, T., CHURCHER, C., HARRIS, D., GORDON, S. V., EIGLMEIER, K., GAS, S., BARRY, C. E., 3rd, TEKAIA, F., BADCOCK, K., BASHAM, D., BROWN, D., CHILLINGWORTH, T., CONNOR, R., DAVIES, R., DEVLIN, K., FELTWELL, T., GENTLES, S., HAMLIN, N., HOLROYD, S., HORNSBY, T., JAGELS, K., BARRELL, B. G. et al. (1998) Nature, 393, 537– 44. COVACCI, A., TELFORD, J. L., DEL GIUDICE, G., PARSONNET, J. and RAPPUOLI, R. (1999) Science, 284, 1328–33. DELOR, I. and CORNELIS, G. R. (1992) Infect Immun, 60, 4269–77. DREYFUS, L. A. and BRUBAKER, R. R. (1978) J Bacteriol, 136, 757–64. DZIEJMAN, M., BALON, E., BOYD, D., FRASER, C. M., HEIDELBERG, J. F. and MEKALANOS, J. J. (2002) Proc Natl Acad Sci USA, 99, 1556–61. FARUQUE, S. M., ALBERT, M. J. and MEKALANOS, J. J. (1998) Microbiol Mol Biol Rev, 62, 1301–14. FLEISCHMANN, R. D., ADAMS, M. D., WHITE, O., CLAYTON, R. A., KIRKNESS, E. F., KERLAVAGE, A. R., BULT, C. J., TOMB, J. F., DOUGHERTY, B. A., MERRICK, J. M. et al. (1995) Science, 269, 496– 512. GALAN, J. E. and COLLMER, A. (1999) Science, 284, 1322–8. GARCIA, E. (2002) In Eighth international symposium on Yersinia, Vol. 16 Turku, Finland. HACKER, J., BLUM-OEHLER, G., MUHLDORFER, I. and TSCHAPE, H. (1997) Mol Microbiol, 23, 1089–97. HEIDELBERG, J. F. et al. (2000) In Genomes 2000: International conference on microbial and model genomes, Vol. 38. HENDERSON, I. R., OWEN, P. and NATARO, J. P. (1999) Mol Microbiol, 33, 919–32. HINCHLIFFE, S. J., ISHERWOOD, K. E., STABLER, R. A., PRENTICE, M. B., RAKIN, A., NICHOLS, R. A., OYSTON, P. C., HINDS, J., TITBALL, R. W. and WREN, B. W. (2003) Genome Res, 13, 2018–29. HINNEBUSCH, B. J., FISCHER, E. R. and SCHWAN, T. G. (1998) J Infect Dis, 178, 1406–15. HOOD, D. W., DEADMAN, M. E., JENNINGS, M. P., BISERCIC, M., FLEISCHMANN, R. D., VENTER, J. C. and MOXON, E. R. (1996) Proc Natl Acad Sci USA, 93, 11121–5. HUNDSBERGER, T., BRAUN, V., WEIDMANN, M., LEUKEL, P., SAUERBORN, M. and VON EICHELSTREIBER, C. (1997) Eur J Biochem, 244, 735–42. IWOBI, A., HEESEMANN, J., GARCIA, E., IGWE, E., NOELTING, C. and RAKIN, A. (2003) Infect Immun, 71, 1872–9. KARAOLIS, D. K., SOMARA, S., MANEVAL, D. R., JR., JOHNSON, J. A. and KAPER, J. B. (1999) Nature, 399, 375–9. KINGSLEY, R. A. and BAUMLER, A. J. (2002) Curr Top Microbiol Immunol, 264, 67–87. LAWRENCE, J. G. and OCHMAN, H. (1998) Proc Natl Acad Sci USA, 95, 9413–7. LINTON, D., GILBERT, M., HITCHEN, P. G., DELL, A., MORRIS, H. R., WAKARCHUK, W. W., GREGSON, N. A. and WREN, B. W. (2000a) Mol Microbiol, 37, 501–14. LINTON, D., KARLYSHEV, A. V., HITCHEN, P. G., MORRIS, H. R., DELL, A., GREGSON, N. A. and WREN, B. W. (2000b) Mol Microbiol, 35, 1120–34. LOBRY, J. R. (1996) Mol Biol Evol, 13, 660–5. MAURELLI, A. T., FERNANDEZ, R. E., BLOCH, C. A., RODE, C. K. and FASANO, A. (1998) Proc Natl Acad Sci USA, 95, 3943–8. MCCLELLAND, M., SANDERSON, K. E., SPIETH, J., CLIFTON, S. W., LATREILLE, P., COURTNEY, L., PORWOLLIK, S., ALI, J., DANTE, M., DU, F., HOU, S., LAYMAN, D., LEONARD, S., NGUYEN, C., SCOTT, K., HOLMES, A., GREWAL, N., MULVANEY, E., RYAN, E., SUN, H., FLOREA, L., MILLER, W., STONEKING, T., NHAN, M., WATERSTON, R. and WILSON, R. K. (2001) Nature, 413, 852–6.

How bacterial pathogens evolve

21

MERRELL, D. S., BUTLER, S. M., QADRI, F., DOLGANOV, N. A., ALAM, A., COHEN, M. B., CALDERWOOD, S. B., SCHOOLNIK, G. K.

and

CAMILLI, A.

(2002) Nature, 417, 642–5.

MIROLD, S., RABSCH, W., ROHDE, M., STENDER, S., TSCHAPE, H., RUSSMANN, H., IGWE, E.

and (1999) Proc Natl Acad Sci USA, 96, 9845–50. MORTLOCK, R. P. and BRUBAKER, R. R. (1962) J. Bacteriol., 84, 1122–3. MOXON, E. R., RAINEY, P. B., NOWAK, M. A. and LENSKI, R. E. (1994) Curr Biol, 4, 24–33. NAKATA, N., TOBE, T., FUKUDA, I., SUZUKI, T., KOMATSU, K., YOSHIKAWA, M. and SASAKAWA, C. (1993) Mol Microbiol, 9, 459–68. OLIVER, A., CANTON, R., CAMPO, P., BAQUERO, F. and BLAZQUEZ, J. (2000) Science, 288, 1251– 4. OLIVER, A., BAQUERO, F. and BLAZQUEZ, J. (2002) Mol Microbiol, 43, 1641–50. PARISH, T., SMITH, D. A., KENDALL, S., CASALI, N., BANCROFT, G. J. and STOKER, N. G. (2003) Infect Immun, 71, 1134–40. PARK, S., WOROBO, R. W. and DURST, R. A. (2001) Crit Rev Biotechnol, 21, 27–48. PARKHILL, J. and THOMPSON, N. R. (2002) In Eighth international symposium on Yersinia, Vol. 15 Turku, Finland. PARKHILL, J., WREN, B. W., MUNGALL, K., KETLEY, J. M., CHURCHER, C., BASHAM, D., CHILLINGWORTH, T., DAVIES, R. M., FELTWELL, T., HOLROYD, S., JAGELS, K., KARLYSHEV, A. V., MOULE, S., PALLEN, M. J., PENN, C. W., QUAIL, M. A., RAJANDREAM, M. A., RUTHERFORD, K. M., VAN VLIET, A. H., WHITEHEAD, S. and BARRELL, B. G. (2000) Nature, 403, 665–8. PARKHILL, J., DOUGAN, G., JAMES, K. D., THOMSON, N. R., PICKARD, D., WAIN, J., CHURCHER, C., MUNGALL, K. L., BENTLEY, S. D., HOLDEN, M. T., SEBAIHIA, M., BAKER, S., BASHAM, D., BROOKS, K., CHILLINGWORTH, T., CONNERTON, P., CRONIN, A., DAVIS, P., DAVIES, R. M., DOWD, L., WHITE, N., FARRAR, J., FELTWELL, T., HAMLIN, N., HAQUE, A., HIEN, T. T., HOLROYD, S., JAGELS, K., KROGH, A., LARSEN, T. S., LEATHER, S., MOULE, S., O’GAORA, P., PARRY, C., QUAIL, M., RUTHERFORD, K., SIMMONDS, M., SKELTON, J., STEVENS, K., WHITEHEAD, S. and BARRELL, B. G. (2001a) Nature, 413, 848–52. PARKHILL, J., WREN, B. W., THOMSON, N. R., TITBALL, R. W., HOLDEN, M. T., PRENTICE, M. B., SEBAIHIA, M., JAMES, K. D., CHURCHER, C., MUNGALL, K. L., BAKER, S., BASHAM, D., BENTLEY, S. D., BROOKS, K., CERDENO-TARRAGA, A. M., CHILLINGWORTH, T., CRONIN, A., DAVIES, R. M., DAVIS, P., DOUGAN, G., FELTWELL, T., HAMLIN, N., HOLROYD, S., JAGELS, K., KARLYSHEV, A. V., LEATHER, S., MOULE, S., OYSTON, P. C., QUAIL, M., RUTHERFORD, K., SIMMONDS, M., SKELTON, J., STEVENS, K., WHITEHEAD, S. and BARRELL, B. G. (2001b) Nature, 413, 523–7. PELLUDAT, C., RAKIN, A., JACOBI, C.A., SCHUBERT, S. and HEESEMANN, J. (1998) J Bacteriol, 180, 538–46. PELLUDAT, C., HOGARDT, M. and HEESEMANN, J. (2002). Infect Immun, 70, 1832–41. PORTNOY, D. A., CHAKRABORTY, T., GOEBEL, W. and COSSART, P. (1992) Infect Immun, 60, 1263– 7. RADMAN, M., TADDEI, F. and MATIC, I. (2000a) Cold Spring Harb Symp Quant Biol, 65, 11–9. RADMAN, M., TADDEI, F. and MATIC, I. (2000b) Res Microbiol, 151, 91–5. RADNEDGE, L., AGRON, P. G., WORSHAM, P. L. and ANDERSEN, G. L. (2002) Microbiology, 148, 1687–98. REID, S. D., HERBELIN, C. J., BUMBAUGH, A. C., SELANDER, R. K. and WHITTAM, T. S. (2000) Nature, 406, 64–7. ROSQVIST, R., SKURNIK, M. and WOLF-WATZ, H. (1988) Nature, 334, 522–4. SCHUBERT, S., RAKIN, A., KARCH, H., CARNIEL, E. and HEESEMANN, J. (1998) Infect Immun, 66, 480–5. SHEA, J. E., HENSEL, M., GLEESON, C. and HOLDEN, D. W. (1996) Proc Natl Acad Sci USA, 93, 2593–7. SIMONET, M., RIOT, B., FORTINEAU, N. and BERCHE, P. (1996) Infect Immun, 64, 375–9. SKURNIK, M., PEIPPO, A. and ERVELA, E. (2000) Mol Microbiol, 37, 316–30. SODEINDE, O. A., SAMPLE, A. K., BRUBAKER, R. R. and GOGUEN, J. D. (1988) Infect Immun, 56, 2749–52. TOMB, J. F., WHITE, O., KERLAVAGE, A. R., CLAYTON, R. A., SUTTON, G. G., FLEISCHMANN, R. D., HARDT, W. D.

22

Emerging foodborne pathogens KETCHUM, K. A., KLENK, H. P., GILL, S., DOUGHERTY, B. A., NELSON, K., QUACKENBUSH, J., ZHOU, L., KIRKNESS, E. F., PETERSON, S., LOFTUS, B., RICHARDSON, D., DODSON, R., KHALAK, H. G.,

GLODEK, A., MCKENNEY, K., FITZEGERALD, L. M., LEE, N., ADAMS, M. D., VENTER, J. C. et al. (1997) Nature, 388, 539–47. WANG, G., RASKO, D. A., SHERBURNE, R. and TAYLOR, D. E. (1999) Mol Microbiol, 31, 1265– 74. WANG, G., GE, Z., RASKO, D. A. and TAYLOR, D. E. (2000) Mol Microbiol, 36, 1187–96. WATERFIELD, N. R., BOWEN, D. J., FETHERSTON, J. D., PERRY, R. D. and FFRENCH-CONSTANT, R. H. (2001) Trends Microbiol, 9, 185–91. WIGHT, J. P., CORNELL, J., RHODES, P., COLLEY, S., WEBSTER, S. and RIDLEY, A. M. (1996) Commun Dis Rep CDR Rev, 6, R112–5. WREN, B. W. (2003) Nature Micro Rev, 1, 55–64. ZHOU, D., TONG, Z., SONG, Y., HAN, Y., PEI, D., PANG, X., ZHAI, J., LI, M., CUI, B., QI, Z., JIN, L., DAI, R., DU, Z., WANG, J., GUO, Z., WANG, J., HUANG, P. and YANG, R. (2004) J Bacteriol., 186, 5147–52.

Surveillance for emerging pathogens in the United States 23

2 Surveillance for emerging pathogens in the United States C. R. Braden and R. V. Tauxe, Centers for Disease Control and Prevention, USA

2.1

Introduction

Public health surveillance is the ongoing systematic collection, analysis, interpretation, and dissemination of health outcome specific data for use in public health action to reduce morbidity and mortality and to improve health (Thacker and Berkelman, 1988). Surveillance of many infections and intoxications, including those that are frequently foodborne, is a fundamental public health activity in many countries. Human foodborne disease surveillance is conducted for three principal reasons: (i) to identify, control and prevent outbreaks of foodborne disease; (ii) to monitor trends and determine the targets for and efficacy of control measures; and (iii) to determine the burden of specific diseases on the public’s health (Potter et al., 2000). The information collected through surveillance systems is essential for conducting microbiological risk assessment studies, making risk management decisions and designing processes used to determine and control potential danger points for microbial contamination in food production, known as hazard analysis and critical control point (HACCP) systems (Borgdorff and Motarjemi, 1997). Surveillance information is used to prioritize and design food safety educational programs and materials for policy makers, public health officials, medical care providers, food industry workers, consumers and others. These activities, based largely on information provided by public health surveillance systems, constitute effective mitigation and prevention programs in food safety. Public health surveillance typically starts with information that already exists for another purpose, and then adds to it. The information useful to clinicians is somewhat different from what is needed for public health surveillance. The clinic makes the diagnosis of salmonellosis, and the clinical

24

Emerging foodborne pathogens

laboratory may determine the antimicrobial resistance of the organism to facilitate treatment. However, neither a detailed food history nor determination of serotype will influence the management of the case, so it is up to public health authorities to interview the patient and to further characterize the infecting organism. In countries without nationalized health systems, the cost of reporting and further public health activities is separate from the cost of patient care, and is borne as one of the core functions of government. Surveillance is a keystone in the effort to define, control and prevent foodborne diseases as depicted in the cycle of surveillance and prevention (Fig. 2.1). Through surveillance activities, emerging pathogens and outbreaks can be identified. Epidemiologic investigation, applied research and interventions may then be applied in prevention efforts. The cycle of surveillance and prevention is exemplified by the description of E. coli O157 in apple cider below. Although the specific targets chosen for surveillance vary from nation to nation, depending on local history, concern and resources, the general goals remain the same. Surveillance is a major source of information for the detection of foodborne outbreaks. Efficient surveillance can detect outbreaks quickly, and subsequent outbreak investigations can lead to rapid interventions such as the removal of contaminated products from the market or temporary closure of a food business. Outbreak investigations are also important opportunities to identify critical gaps in knowledge, leading to applied research and ultimately to better long-term prevention, as unsafe processes are corrected, or new food hazards are identified and controlled. Once prevention measures are in place, continued surveillance will document their success, or indicate the need for further investigation, research, knowledge dissemination and prevention. The information gathered by surveillance and by investigations of sporadic cases or outbreaks can reveal the magnitude and general trends of foodborne disease, helping policy makers target prevention strategies and providing information critical to risk assessment studies.

Surveillance

Epidemiologic investigation

Intervention

Applied research

Fig. 2.1 Cycle of surveillance and prevention. Surveillance serves as the basis for epidemiologic investigation and applied research, each of which determines modes of intervention. As interventions take effect, surveillance changes and the iterative cycle begins again.

Surveillance for emerging pathogens in the United States 25 Foodborne disease surveillance in the United States is conducted primarily by local and state public health agencies. Some form of local surveillance for diseases of public health concern has been conducted for centuries in many countries. In the 19th century, reporting of cholera ushered in the modern concept of the reportable disease in the United States (Rosenberg, 1987). Reporting of typhoid fever cases and deaths drove many improvements in water and food safety at the beginning of the 20th century. More recently, the increase in concern following the large E. coli O157:H7 outbreak in 1993 stimulated enhancements in surveillance for foodborne infections in the United States, as well as other changes in the food safety system (Anon., 1998). The foodborne mode of transmission for many pathogens was discovered in the course of outbreak investigations, as was much of the knowledge we have about specific hazards and how they enter the food supply. As new foodborne disease sources and agents emerge, the strategies used to control them must also evolve. Thus, surveillance for foodborne and other infections is an ever changing arena. The most dramatic recent example of this progress concerns the evolving understanding of the modes of transmission for E. coli O157:H7. In 1982, two outbreaks of severe bloody diarrhea and hemolytic uremic syndrome in the United States were linked to the same fast food restaurant chain (Griffin et al., 2002). The bacterium Escherichia coli was isolated for the stools of ill persons. The specific serotype, O157:H7, had not previously been recognized to cause human illness. Soon thereafter, multiple outbreaks of similar severe illness in the U.S. and Canada were associated with this newly discovered pathogen, E. coli O157:H7. In these outbreaks, the vehicle was determined to be foods of bovine origin, mainly ground beef. Subsequently, national surveillance for E. coli O157:H7 was established, which has been greatly enhanced with the advent of laboratory methods to characterize the pathogen, such as Shiga toxin typing and genotyping. Outbreaks recognized and investigated as a result of national surveillance have led to a much greater understanding of the ecology of E. coli O157:H7 and its modes of transmission. By the late 1990s, multiple foods and water sources were recognized as potential vehicles of transmission, including raw milk, sprouts, juices, lettuce, and contaminated recreational and well water (Griffin et al., 2002). Direct animal to human transmission has also been recognized as an important mode of transmission, responsible for multiple outbreaks at agricultural fairs and petting zoos. Figure 2.2 depicts the evolving understanding of the modes of E. coli O157:H7 transmission. As a result, food and water safety and animal exposure guidelines and regulations have been advanced to control and prevent this important infection.

2.2

Detecting new and emerging pathogens

The identification of new foodborne pathogens may occur outside the purview of public health. This remains a critical aspect of foodborne illness research,

26

Emerging foodborne pathogens

Meat Cow

Cow

Human

Human

Milk (a) Sheep Caribou, other ungulates Cow

Cow

Meat

Water

Contact Milk

Human

Human

Water Manure Fruits and vegetables Deer (b)

Fig. 2.2 Transmission of E. coli O157:H7 (a) 1988 model, (b) 1998 model. Through surveillance and outbreak investigation, the modes of E. coli O157:H7 transmission were discovered. E. coli O157:H7 can be transmitted through multiple food vehicles, from contaminated water, and from direct contact with cattle and other ungulates.

as the vast majority of foodborne illnesses remain unexplained (Mead et al., 1999). Microbiological research into the etiology of previously unexplained human foodborne illness is accomplished by the intensive investigation of individual cases of illness in research settings. Putative pathogens may be first identified in veterinary or plant pathological studies. Identification of new pathogens relies on specialized testing often unavailable in clinical laboratories. The history of the identification and characterization of campylobacteriosis is a prime example. Bacteria of the genus eventually called Campylobacter were first identified in 1909 (Holmberg and Feldman, 1984), but garnered little attention outside the veterinary literature. It was not until 1942 that extraintestinal Campylobacter isolates were recovered from humans. Laboratory methodologies advanced to facilitate the isolation of Campylobacter from faeces, first using filtration techniques in 1972, and finally antibiotic-containing selective media in 1977 (Butzler et al., 1973; Skirrow, 1977). After a span of six decades from its first identification, Campylobacter could be routinely isolated from human faeces in the clinical laboratory. This set the stage for the implementation of public health surveillance and the recognition of campylobacteriosis as the most frequent identified human foodborne bacterial pathogen. With the advent of a greater repertoire of diagnostic methodologies, especially molecular diagnostics, the time from first identification to routine

Surveillance for emerging pathogens in the United States 27 isolation has been much reduced. Over the past decade, diagnosis of foodborne illness due to norovirus has advanced from a purely research endeavour using electron microscopy to the routine application of reverse transcriptase polymerase chain reaction in public health laboratories across the United States. When new or emerging pathogens are discovered, specialized laboratories and investigations may be required to determine the associated clinical manifestations and the potential burden in select populations. These studies aim to collect detailed clinical information, and potential exposures, whether they be foods consumed or other routes of transmission. The inclusion of well persons as controls may allow the statistical association with illness in order to determine the true pathogenic nature of the potential pathogen. These special studies may also be used to evaluate the best detection methods for the new or emerging pathogen. If the burden is determined to be significant, and the methods of detection are transferable to clinical or public health laboratories, then general surveillance may be instituted. The recognition of new and emerging pathogens is not limited to the discovery, characterization and diagnosis of new genera and species of pathogens. Existing methods of characterization may be used to identify emerging strains within pathogen groups. This is especially true for the recognition of antibiotic resistant strains. A multidrug-resistant strain of Salmonella enterica, serotype Newport has recently been identified as an emerging foodborne threat in the United States, for example (see below). In any case, the routine application of methodologies to isolate and identify foodborne pathogens (or their variants) must be implemented in order for public health surveillance to take place in an effective manner. Public health surveillance may then determine the general burden of illness, recognize the emergence or re-emergence of disease, characterize risk factors for illness, and monitor prevention and control policies and practices. One surveillance method may be more appropriate than another, depending on the purpose. Surveillance conducted primarily to detect outbreaks and protect the public should cover the whole population, and should include conditions most likely to appear in outbreak form, for which an agreement has been reached that cases will be routinely reported to public health authorities. While syndromic surveillance for cases of acute dehydrating diarrhoeal illness may provide warning of the advent of a cholera epidemic in the developing world, or of a sudden large local outbreak in the industrialized world, this approach is not specific enough for most surveillance needs, which depend on the report of specific infections. In general, the methods of surveillance are becoming more specific, and more uniform, and are increasingly likely to combine both epidemiological data about the ill person and microbiological information about the infecting organism. Surveillance can be characterized as passive or active, reflecting the level of activity at the public health department. Passive surveillance depends on the clinics and laboratories remembering to report case of specific illness

28

Emerging foodborne pathogens

with more or less reminding. Active surveillance depends on the health department contacting clinics and laboratories, gathering reports directly; this is more expensive and intrusive. The concept of automated surveillance, depending on clinical and laboratory computers to report conditions as soon as they are entered, remains attractive but elusive. When local case surveillance is linked together into regional or national networks, it becomes possible to detect dispersed outbreaks, which would otherwise be missed. Because the modern food supply is itself dispersed, so that persons across a broad geographic area may be exposed to foods from the same source, this geographic linkage is critical. To detect dispersed outbreaks, it can be critical to compare specific markers of the infecting organisms, such as genetic ‘fingerprints’, across many jurisdictions (Swaminathan et al., 2001). Such comparison of subtypes may reveal an unusual clustering of infections with a single strain of a pathogen, which can then be further investigated. Public health laboratories have used a variety of methods to subtype pathogens, and can be linked in regional and national networks to permit rapid comparison of results to provide warning of dispersed outbreaks. Foodborne outbreaks are clusters of the same illness that follow consumption of the same food. Outbreaks can also be the unit of surveillance, which may be an important source of information about the recurrent linkage between specific pathogens and specific foods, as well as drawing attention to the foods that are most frequently associated with illness. However, sporadic individual cases are typically far more common than are recognized outbreaks. Extrapolation from observations made in outbreaks to the entire burden of disease caused by a pathogen should be cautious. For surveillance that is conducted primarily to measure the public health burden of disease or to track long-term trends, collecting detailed data from a representative sample of sites around the country can provide useful information (Angulo and Group, 1997). This so-called ‘sentinel-site’ approach can provide data on important illnesses that are not well represented in national surveillance, because they are not reportable in many jurisdictions, or because they rarely cause outbreaks. Also, in the more controlled sentinel site approach, more active surveillance may be instituted. For the purpose of determining the food source of infections, surveillance based on outbreak investigations provides answers for those illnesses that frequently appear in outbreak form. A sentinel site system can provide a platform for more detailed research efforts to better understand the burden and sources of sporadic infections. Beyond the reports of human disease, systematic collection of data about the prevalence of pathogens in foods or food animals, and about the prevalence of practices and behaviours in the food producers and in the general population may be useful to guide and assess prevention measures. To construct a detailed attribution of the burden of a specific illness such as salmonellosis to specific animal or food sources, systematic monitoring of the pathogen in food and

Surveillance for emerging pathogens in the United States 29 animal reservoirs, with molecular subtyping and comparison of strains with human infections, can be very helpful.

2.3 Range of methods used for surveillance in the United States 2.3.1 Surveillance for nationally notifiable diseases In the United States reports of notifiable diseases have been collected for more than a century, using an ever-expanding list of illnesses. Since 1961, these reports have been voluntarily submitted to the Centers for Disease Control and Prevention, which publishes them weekly and in annual summaries (Thacker, 1994). At an annual meeting, the Council of State and Territorial Epidemiologists decides on which specific illnesses should be nationally notifiable, and agrees on specific case definitions. This general umbrella of reporting covers all parts of the United States, provides information useful to local, state and national authorities, and is relatively inexpensive. Most disease reporting is passive from the standpoint of the public health system, which means that clinicians and laboratories are expected to report cases, but public health agencies do not directly monitor diagnoses. States and local jurisdictions typically institute public health reporting laws for some pathogens to increase the completeness of reporting. Basic case surveillance has been further enhanced for some infections by further characterization of the infecting pathogen in public health laboratories. This began with Salmonella. Following large multistate outbreaks of salmonellosis early in the 1960s, state and large city health department laboratories began to routinely serotype strains of Salmonella isolated from humans; the results of this subtyping were shared with CDC as well, in order to detect outbreaks affecting more than one state (CDC, 1964). Since 1962, national Salmonella surveillance has depended on this serotypebased reporting (Olsen et al., 2001). These data are critical to the detection and investigation of many outbreaks of salmonellosis each year. Since the 1980s, these data have been relayed electronically from states to CDC via the Public Health Laboratory Information System (Bean et al., 1992). Since 1995, these data have been routinely examined using an automated statistical outbreak detection algorithm that compares current reports with the preceding five-year mean number of cases for the same geographic area and week of the year to look for unusual clusters of infection (Hutwagner et al., 1997). The usefulness of this outbreak detection algorithm is limited by timeliness of reporting and high background rates of reporting for common serotypes, such as Salmonella serotypes Typhimurium and Enteritidis. The greatest sensitivity for Salmonella serotyping to detect meaningful clusters is for the rare serotypes; further differentiation is needed for the most common serotypes. The utility of serotyping as an international language for Salmonella subtypes has led to its widespread adoption: in a recent survey, 61 countries reported

30

Emerging foodborne pathogens

that they used Salmonella serotyping for public health surveillance (Herikstad et al., 2002a). A collaborative WHO program called Global SalmSurv promotes the use of Salmonella serotyping internationally, among countries that wish to upgrade their national capacity for foodborne disease surveillance (WHO, 2001). Molecular subtyping is now expanding the power of surveillance to detect outbreaks in the background of sporadic cases and improving the ability to investigate them by distinguishing the molecular ‘fingerprint’, or genotype, of an outbreak strain. These new techniques can define subtypes within a single pathogen and serotype, and provide useful strain differentiation for a growing number of pathogens (Swaminathan et al., 2001). In the United States, state public health laboratories began using a standardized genotyping method, called pulsed-field gel electrophoresis (PFGE), for E. coli O157:H7, after it proved useful in the 1993 West Coast outbreak (Bell et al., 1994), and have now expanded the use of this technique to common serotypes of Salmonella such as Typhimurium and Enteritidis, and Listeria monocytogenes (Swaminathan et al., 2001). Developing this capacity at the state level also enhances rapid detection of multi-county clusters within the state (Bender et al., 1997, 2001). Standardized subtyping protocols have now been developed for seven pathogens, and next-generation, gene-based technologies are under development for the future. PulseNet is the national network formed by linking all state public health laboratories performing PFGE via Internet to the national database of PFGE subtypes maintained by CDC. If clinical isolates are referred to the public health laboratories and rapidly typed, PulseNet can rapidly identify multistate clusters of infections due to specific strains of typed pathogens. Once a cluster of infections is identified, rapid epidemiological investigation can determine whether the cluster is a true outbreak with a common source. Laboratories at the Food and Drug Administration (FDA) and at the U.S. Department of Agriculture (USDA) also participate, so isolates from foods and animals can also be compared in the system. Canada has adopted a compatible system, Coordinated by the National Microbiology Laboratory in Winnipeg. The European network for laboratory based surveillance of foodborne infections, EnterNet, is adopting a compatible system, and discussions are rapidly advancing for PulseNet Asia Pacific, and PulseNet Latin America. As with Salmonella serotyping itself, the global use of standard genotyping will facilitate the detection of multi-continental clusters. Monitoring levels of antimicrobial resistance in foodborne pathogens is another form of subtype-based surveillance. Since 1996 in the United States, the National Antimicrobial Resistance Monitoring System for Enteric Bacteria (NARMS-EB), a collaborative effort of the CDC, USDA and FDA has been monitoring the prevalence of antibiotic resistance in Salmonella, Campylobacter and other foodborne bacterial pathogens isolated from humans, animals and foods (Marano et al., 2000). This provides information about the trends in resistance to specific drugs, identifies the emergence of new resistance threats, and permits the comparison of strains identified in the different locations.

Surveillance for emerging pathogens in the United States 31 Notifiable disease surveillance, amplified by pathogen subtyping, is a powerful and useful tool for public health, but it depends critically on the clinical laboratory infrastructure, and on the capacity and authority of public health institutions. Obviously, if a condition is not diagnosed by clinicians or microbiologists, it will not be possible to conduct surveillance on it by this means. There must be agreement and resources to inform clinicians of reporting requirements, for laboratories to conduct subtyping, and for public authorities to link reports from clinicians with the additional information from the laboratory. One jurisdiction may vary substantially from another in resources, requirements, and interest, making differences in reported incidence difficult to interpret. Limited case information may need to be supplemented by follow-up interviews once a cluster is detected, which can delay identification and control of the food vehicle. As with virtually all surveillance, notifiable disease surveillance captures only a fraction of the actual cases that occur, because many illnesses may not result in a visit to a clinic, a microbiological diagnosis, or a report to a public health authority.

2.3.2 Sentinel site surveillance Separate from the national umbrella of routine notifiable disease surveillance, a sentinel-site surveillance system provides more detailed information about specific illnesses in a representative sample of jurisdictions. With additional resources, that surveillance can be active, and can gather more information about sporadic cases than is usually possible. In the United States this strategy was first developed for monitoring cases of hepatitis, providing detailed laboratory and epidemiological data on cases (Bell et al., 1998). In 1996, the Foodborne Disease Active Surveillance Network (FoodNet), a collaborative program of the CDC, ten sites, the USDA and the FDA, began under the aegis of CDC’s Emerging Infections Program (Angulo and Swerdlow, 1999). FoodNet conducts active case finding for a panel of foodborne infections, as well as epidemiological studies to better understand the trends and sources of foodborne diseases in the United States. FoodNet began with an initial five sites in 1996, and expanded to ten sites by 2004. The surveillance area that year covered 36 million persons, or approximately 13% of the U.S. population (CDC, 2002c). Because case ascertainment is active, reporting is more uniform and complete, and data are better than in passive reporting systems. However, it is also more expensive and limited in geographic scope. FoodNet surveys laboratory, physician, and patient practices that cause an individual case to be diagnosed so that trends in the reported incidence can be interpreted in the light of possible changes in diagnostic practices. In addition, FoodNet has been a platform for conducting case-control studies of sporadic infections to identify general risk factors for infection that distinguish the persons who become ill from those who stay healthy. Similar active surveillance programs have been developed in other countries, including OzFoodNet in Australia, and the Food Safety Authority of Ireland.

32

Emerging foodborne pathogens

2.3.3 Foodborne outbreak reporting A foodborne outbreak is a cluster of two or more similar infections that are shown by investigation to result from ingestion of the same food (Olsen et al., 2000). Most foodborne outbreak investigations are conducted by local and state or provincial health departments. Since 1967, CDC has collected reports of outbreaks of foodborne illnesses investigated by local, state, and national public health authorities (Olsen et al., 2000). Many countries find it useful to conduct similar surveillance. Reports of outbreaks include the nature of the pathogen or toxin, the type of food that caused the outbreak, and limited information about factors that contributed to the outbreak. In the United States, before 1998, these reports were collected on paper and slowly reviewed and compiled. The foodborne outbreak surveillance system has been recently overhauled with an improved form, active solicitation of reports from states, and web-based reporting (CDC, 2002a). The foodborne outbreak surveillance system has provided useful information on long-term trends in many pathogens for which surveillance otherwise does not exist and summaries of the outbreaks caused by a particular pathogen, hazard, or food (Bean and Griffin, 1990). In the future, as the speed of reporting and analysis increases, it may provide more systematic detection of clusters of unusual outbreaks, based both on laboratory testing and epidemiological assessment of the outbreak presentation (Hall et al., 2001). Because outbreak investigations often take some time to reach the final conclusions about sources and contributing factors, the need for speed in reporting must be balanced with the value of complete information. Systematic analysis of reported outbreaks can be used to allocate the burden of many infections and other hazards across broad food categories. Surveillance based on outbreaks has the virtue of covering many pathogens for which there is no individual surveillance, and can even provide helpful information about illnesses for which no pathogen is identified (Hall et al., 2001). However, it will not provide information about pathogens that rarely or never cause recognized outbreaks, such as Campylobacter jejuni or Vibrio vulnificus.

2.3.4 Limitations of surveillance Surveillance of any sort has limitations. One is underreporting. Many cases and even many outbreaks go unrecognized. Individual cases may not be detected because people who are ill do not seek medical care due to the selflimited nature of many foodborne diseases, physicians and laboratories may not make a specific diagnosis, cases may not be reported to authorities, and authorities with stretched resources may not investigate or report them. Thus, the actual number of cases that occur is likely to be substantially greater than the number of cases that are reported. For example, it has been estimated that 38 cases of salmonellosis occur for every one that is reported (Voetsch et al., 2004). A common source outbreak in a restaurant may not be recognized because patrons were exposed in small groups that were unknown to each

Surveillance for emerging pathogens in the United States 33 other. For some foodborne infections, the incubation period may have been long enough to obscure the relationship with the meal, unless persons attending a large gathering, such as a banquet or wedding reception, have some reason to compare their experiences afterwards. As long as it is recognized that underreporting occurs, this limitation does not diminish the utility of the surveillance. A limited amount of systematically collected and well characterized data is far more useful than a larger volume of data from many non-comparable sources. A second limitation is the difficulty in attributing a specific case to a specific source. E. coli O157:H7, Shigella ssp., Salmonella and many other pathogens can be transmitted by a variety of different food and non-food exposures. It is often difficult to determine in the individual case of illness, which of numerous possible exposures in the days preceding illness was the actual source. In the outbreak setting, where careful comparison of food consumption patterns of ill persons with those who remained well can often identify the immediate food vehicle, it is still sometimes difficult to determine among the various inputs which was the potential source: was it the ham, turkey or lettuce on the club sandwiches; did raw meat drip on other food items in the cooler; or did an infected food handler contaminate items on the salad bar? However, many outbreak investigations yield clear answers, and comparison of patterns observed among groups of outbreaks can help define patterns. Finally, case-based surveillance (that is surveillance based on the reports of diagnosed cases of an illness) can count only that which is measurable and known. Because laboratory diagnosis of norovirus infections is not routinely performed in clinical laboratories, this extremely common illness cannot be monitored with the case-based surveillance used for infections caused by Salmonella or Campylobacter. The importance of norovirus infections can be defined in outbreaks where the typical combination of signs, symptoms, incubation period, and duration of illness can be documented and when specimens reach public health laboratories that can make the specific diagnosis. Similarly, enterotoxigenic E. coli (ETEC), the cause of much travellers’ diarrhea, is increasingly recognized as a cause of outbreaks in the United States, and may also be a common cause of sporadic cases, yet the specialized tests to detect it are rarely applied (Dalton et al., 1999). In a recent survey in Minnesota, ETEC was identified in 1.5% of diarrheal stools, more frequently than Salmonella or E. coli O157:H7 (Gahr et al., 2001). It is likely that there are many foodborne agents yet to be discovered (Tauxe, 1997).

2.3.5 Behavioral surveillance and surveys of foods Surveillance efforts also provide systematic data on behavior and exposure of the population to specific risks. Studies conducted through CDC’s Behavioral Risk Factor Surveillance System (BRFSS) documented the high frequency of risky food behavior (Yang et al., 1998). More recently, the FoodNet

34

Emerging foodborne pathogens

population surveys have provided population-based data on the incidence of diarrhoeal illness and the likelihood that someone would seek medical care for a diarrhoeal illness; these surveys were critical to develop a general estimate of the burden of foodborne disease (Herikstad et al., 2002b; Mead et al., 1999). They also provide general population based data on the frequency of exposure to a wide variety of foods and other potential sources of intestinal infection (CDC, 1998). Such surveys depend on what persons can and will report about themselves, and thus may overestimate such desirable behaviors as hand washing and underestimate known risk behaviors such as eating undercooked ground beef. Another potential source of information is the complaint systems maintained by local and state health departments for persons to report illnesses or hazardous conditions they believe may be related to food (Samuel et al., 2001). While such systems are far less specific than systems built on diagnosed cases of illness, they may provide early warning of problems. Public health and regulatory agencies, as well as members of food production industry, have increased the frequency and completeness of microbiological monitoring of foods as food safety programs have become enhanced and strengthened. Microbiological monitoring programs for foods are not intended to test the safety of any particular product, but rather they assess the efficacy of the entire food safety control programs at the farm, production plant, or even national level, as is the case with microbiological testing of imported foods. The pathogens identified in these food surveys can be useful markers for what may be transmitted in the food supply. Some countries (e.g. Denmark) have been able to systematically subtype isolates identified from food surveys at multiple points along the farm to table continuum, and compare these subtypes with pathogens isolated from people, enabling an attribution of a pathogen causing human illness to specific foods. Trends in the emergence of pathogens or pathogen subtypes can be monitored, starting in foods at certain points in production, through illness in humans. In this way, infections in the United States with strains of Campylobacter resistant to the fluoroquinolone class of antibiotics have been shown to be associated with poultry consumption (Kassenborg et al., 2004). Information about pathogen isolates from food and humans exists among several agencies responsible for food safety in the United States, and subtyping and comparison of isolates is now becoming more routine.

2.3.6 Standardizing the methods of surveillance and monitoring A necessary attribute of any successful surveillance system is standardization of information. Comparing information emanating from different tests conducted in different circumstances for different reasons can become so riddled with limitations as to be futile. For example, this is a challenge in the monitoring of antibiotic resistant pathogens. Clinical laboratory data may be biased because susceptibility testing is often done because of some suspicion

Surveillance for emerging pathogens in the United States 35 that a resistant organism is present. The number of different types of susceptibility tests available also makes the data difficult to combine and compare. For these reasons, the systematic collection and testing of isolates has been established in the U.S. called the National Antimicrobial Resistance Monitoring System, Enteric Bacteria (NARMS). In this system, a systematic collection of E. coli O157:H7, Shigella, Salmonella and Campylobacter isolates from across the United States is sent to the CDC for testing to the same panel of 17 antimicrobials in the same laboratory using highly standardized tests. In this way, results are both representative and comparable.

2.4

Use of surveillance data

2.4.1 Assessing the burden of disease Routine public health surveillance records only a fraction of the total number of cases of foodborne diseases which occur in the United States. If that fraction is stable, and the factors that contribute to a case being included are unchanged, then the analyses of associated trends are relevant. However, if a particular pathogen or subtype exhibits a change in pathogenicity or the microbiologic tests used to identify it change, then the representation of that disease by surveillance may be compromised. The emergence of E. coli O157:H7 and other Shiga toxin-producing E. coli in the United States is a prime example of the complexities of surveillance in a changing situation. Trends in laboratory-based surveillance for E. coli O157:H7 showed a marked and rapid increase in cases in the early 1990s, but this increase in cases followed closely the increase in the number of states making this a reportable illness, and the number of laboratories performing stool culture using SorbitolMacConkey agar to identify it (Fig. 2.3). In 2000, surveillance for illness due to Shiga toxin-producing E. coli expanded from just one serotype, O157:H7, to all associated serotypes, though a growing body of evidence indicates that some serotypes of Shiga toxin-producing E. coli are less virulent than others. In addition, methods to test for the Shiga toxin directly were more widely used. For these reasons, the surveillance trends for Shiga toxin-producing E. coli are difficult to interpret. It is thus important to characterize and quantify the various factors involved in the report of an illness, which may be described as a series of events. For any specific illness, a large number of people may be afflicted. Some persons will seek medical care, while others will not, often depending on the severity of illness. Upon visiting a medical care facility, diagnosis and treatment may be empirical, or specimens may be taken for microbiological testing. Within the laboratory, some tests may be applied to the specimen routinely, others not. Even when a reportable pathogen is identified in the clinical laboratory, not all isolates are reported to public health authorities. One can construct a ‘surveillance pyramid’ (Fig. 2.4) of successively smaller layers with the reported illnesses represented by the small tip over a much larger foundation

Emerging foodborne pathogens 50 45

550 States

Isolates

500 450

States reporting

40

400

35

350

30

300 25 250 20

200

15

150

10

100

5

50

0

1993

1994

1995

1996 Year

1997

1998

1999

Isolates reported

36

0

Fig. 2.3 E. coli O157 isolates reported to CDC, 1993–99. National reporting for E. coli O157:H7 started in 1992 in the United States. The number of isolates reported increased steadily over the ensuing years, commensurate with the increase in the number of states submitting reports.

Reported to health dept./CDC Culture-confirmed case Lab tests for organism Specimen obtained Person seeks care Person becomes ill Population exposures

Fig. 2.4 Surveillance pyramid. The number of illnesses reported to public health surveillance systems is a small fraction of the total number of illnesses. Of all persons exposed and ill, only a portion will seek care, and still fewer will have a specimen obtained and tested and finally reported to public health surveillance.

of all illnesses. Public health agencies in several counties have conducted special short-term surveys of their population to determine the number of gastrointestinal illnesses, of physicians to determine the proportion of visits whereby patient samples are obtained for microbiological testing, of laboratories to determine the methods applied to samples to identify various pathogens, and of reporting sources to identify the number of unreported cases. By quantifying each step in the diagnosis and reporting path, an overall multiplier may be determined, as exemplified by the estimate of 38 unrecognized

Surveillance for emerging pathogens in the United States 37 salmonellosis cases for every case reported in the United States (Voetsch et al., 2004). Information from surveillance has recently been integrated into a general estimate of the overall burden of foodborne disease in the United States (Mead et al., 1999). This included the number of cases, hospitalizations, and deaths that were attributed to specific pathogens and to the large number of illnesses that remain unaccounted for. These pathogen-based point estimates provide a benchmark for assessing the economic impact of foodborne diseases, such as the estimate of $6.9 billion dollars for the major bacterial pathogens (Buzby and Roberts, 1996). Some foodborne infections can also cause chronic complications in a small percentage of cases, such as kidney failure related to E. coli O157:H7, reported to occur in 4% to 8% of cases (Griffin et al., 2002), and Guillain Barre Syndrome paralysis, which may complicate 1 in 1000 Campylobacter infections (Nachamkin et al., 2000). Death rates in the months following some infections may be higher than among uninfected but otherwise similar persons (Helms et al., 2002). The full impact of illnesses includes both acute morbidity and mortality, as well as the impact of subsequent complications and of long-term effects such as lifelong impairments from congenital toxoplasmosis or early childhood diarrheal illnesses in impoverished areas (Guerrant et al., 2002). With more information about the frequency, duration, and disability caused by these complications, the burden of foodborne illness could be re-estimated to include Disability Adjusted Life Years (DALYs), a measure used to characterize the burden of many other public health problems (Murray and Lopez, 1997). Surveillance data can subdivide the burden of a specific infection, such as salmonellosis. The contribution of specific Salmonella serotypes to this burden can be derived from their frequency. For example, the three most common serotypes of Salmonella, Typhimurium, Enteritidis, and Newport, together account for over half of all reported cases of salmonellosis in 2002 (Table 2.1).

Table 2.1 Rank of Salmonella serotypes, United States, 2002. Top ten Salmonella serotypes isolated from humans, number of percent of total for 2002 Rank

Serotype

Number

Percent

1 2 3 4 5 6 7 8 9 10

Typhimurium Enteritidis Newport Heidelberg Javiana Montevideo Muenchen Oranienburg Saintpaul Infantis

7062 5116 4204 1957 1188 717 591 585 535 463

21.9 15.8 13.0 6.1 3.7 2.2 1.8 1.8 1.7 1.4

38

Emerging foodborne pathogens

The burden of reported foodborne outbreaks can also be measured. National foodborne outbreak reporting in 1998 through 2000 gave a combined annual incidence of 4.8 outbreaks per 1,000,000 population (CDC). Considering just outbreaks affecting at least ten persons, the rate in the FoodNet coverage area was 3.3 outbreaks per million population per year in 2000 (CDC, 2001a). It is likely that outbreak surveillance undercounts the true frequency of events for the reasons noted above.

2.4.2 Associating human diseases with specific reservoirs For many foodborne pathogens, the association with a specific reservoir, either in a food animal or a human, means that the illnesses they cause are often associated with a characteristic food or group of foods. The data that link a pathogen to a specific food and reservoir often come from outbreak investigations. For many pathogens, a series of investigated outbreaks is the best information available to define the association of the illness with specific foods. For example, the first investigation of E. coli O157:H7 infections identified the pathogen and linked the distinctive illness it caused to eating undercooked hamburgers (Riley et al., 1983). Trace back from an outbreak caused by ground beef, and from sporadic cases caused by drinking raw milk, led to identification of the bovine reservoir for E. coli O157:H7, noteworthy because infected cows are asymptomatic (Wells et al., 1991; Martin et al., 1986). More recently, outbreaks of this infection have been associated with an expanding array of foods such as lettuce, sprouts, and unpasteurized apple cider (Griffin et al., 2002). Early investigations of Campylobacter outbreaks identified raw milk, undercooked poultry, and contaminated water as common sources (Blaser et al., 1979; Vogt et al., 1982; Deming et al., 1987). Pathogens having human reservoirs can also be linked to specific foods, depending on the most characteristic mechanisms of contamination. In 1924, a large epidemic of typhoid fever was linked to raw oysters that were harvested and held near sewage sources (Lumsden et al., 1925). More recently, outbreaks of norovirus infection, which has a human reservoir, have been linked to shellfish (and to direct contamination from ill fishermen), and to foods such as cold salads and sandwiches that are handled extensively in the kitchen, (and to direct contamination from ill food handlers) (Kohn et al., 1995; Parashar and Monroe, 2001). For pathogens that rarely cause outbreaks, studies of sporadic cases and comparison with healthy controls can define associations with particular foods. For example, Vibrio vulnificus was definitively associated with consumption of raw oysters soon after it was first described (Blake et al., 1979). Studies of E. coli O157:H7 infections linked sporadic cases of infection with this pathogen to eating undercooked ground beef, thus supplementing the data from outbreaks (Slutsker et al., 1998; Kassenborg et al., 1998; Mead et al., 1997). Studies of sporadic Campylobacter infection link it to eating poultry and other meats outside the home, as well as to drinking untreated water and to other sources; around the

Surveillance for emerging pathogens in the United States 39 world, poultry remains the dominant reservoir for this pathogen (Friedman et al., 2000; Anon., 2000). Allocating the burden of infections across specific food groups is a complex challenge, which has been approached in several ways. The first depends on epidemiological and public health investigations. Outbreak data on association with foods, supplemented with data from sporadic cases, provides the most readily available public health information for allocating the burden of specific infections across food groups. For example, between 1992 and 1997, 1,153 foodborne outbreaks involving 46,453 illnesses were reported in the United States, for which a food vehicle was determined (Olsen et al., 2000) (CDC, unpublished data). For the 714 outbreaks in which the implicated food could be assigned to a single group, 28% of the illnesses were associated with produce, 21% with meat, 15% with seafood, 11% with poultry and 26% with other foods. This indicates that food safety concerns exist for all major food groups. For those illnesses that rarely appear in outbreak form, data from individual case series or from case-control studies can be used to allocate the burden. Other ways of allocating the burden depend on using systematic sampling data from many foods. For example, the patterns of molecular subtypes in strains of Salmonella isolated from people can be compared to those isolated from a variety of different foods, and those patterns which are unique to one food can be allocated to that food. To be successful, this depends on extensive and systematic sampling of many foods, and use of standardized subtyping methods on a large number of strains. It has been done routinely in Denmark to track the burden of salmonellosis associated with different foods (Anon., 2000) (see below). Finally, if data on pathogen prevalence are available for a large number of foods, a risk allocation can be constructed using the methods of risk analysis, which has been attempted for Listeria monocytogenes (FDA 2003). This approach depends on the assumption that all strains are equally likely to cause disease, and that the distribution of the pathogen in foods can be reliably estimated from studies using a broad range of methods, and conducted over a substantial time span. These assumptions are limitations that significantly impact attribution modeling. Once a food is implicated as a common source of a pathogen, detailed review of its production process may reveal the likely points in the process where the food became contaminated. In an outbreak investigation, this most often happens by tracing back along the production process from the implicated food the ill persons ate. Such a review may identify where the contamination was likely to have originated and where it may have been further amplified or controlled. This information, of particular interest to risk assessors, is only gathered in a minority of foodborne outbreak investigations, and requires a multi-disciplinary approach. Epidemiological investigations of cases can also provide important insight into the precise mechanisms of exposure and the variations in human behaviour that contribute to it. For example, in an outbreak of salmonellosis in Wisconsin

40

Emerging foodborne pathogens

in 1998, illness was associated with eating raw ground beef, a common practice among some ethnic groups (CDC, 1995). In another outbreak, illness was particularly associated with tasting raw ground beef in the process of seasoning and cooking it (Fontaine et al., 1978). In an investigation of Campylobacter infections in Colorado, illness was associated particularly with handling and preparing chicken, not with eating it (Hopkins and Scott, 1983). In an assessment of sporadic ground beef-associated E. coli O157:H7 infections in New Jersey, ill persons were no less likely to have noticed the new meat handling recommendations on the meat wrapper than were those who were well, but were less likely to have washed their hands after handling raw beef (Mead et al., 1997).

2.4.3 Developing control strategies and measuring their effectiveness Preventing foodborne disease is complex, requiring attention and intervention from farm or fishery to table (Anon., 1998). There are no vaccines for the pathogens most commonly transmitted through foods, and while education of the consumer provides an important final safety barrier, it is not by itself sufficient. Making food safer before it reaches the final consumer is critical to maintain confidence in the food supply. The consumer eats many foods without cooking them at all, prepares raw foods of animal origin with the same hands as the uncooked salads, is instructed by tradition and by cookery texts to prepare many meat, poultry, egg and seafood dishes with more concern about overcooking than undercooking, and is told routinely to season them ‘to taste’ during the preparation process before cooking is complete. When new foodborne hazards are identified, the knowledge base for defining such preventions may be quite limited (Holmberg and Feldman, 1984). Public health surveillance, with detailed investigations of outbreaks, can identify new and emerging hazards, define the likely points of control, identify questions in need of further research, and track the effectiveness of control measures. For some hazards, the control measures are obvious and immediate, and do not require extensive risk assessment or other deliberations. For example, requiring toilets with holding tanks on oyster boats makes it less likely that oyster gatherers will contaminate the oyster beds (Kohn et al., 1995). Similarly, restaurant designers who wish to reduce the risk of making their customers ill can install a foot-operated hand washing station near the salad preparation area. For other hazards, the relative merits of potential strategies are not obvious at the outset, and control proceeds by an iterative process. As more is learned, refinements in prevention strategies are progressively refined. Five examples will illustrate how this process can lead to improved prevention. Salmonella and pre-cooked roast beef From 1975 to 1977, Salmonella surveillance detected repeated outbreaks of Salmonella infection associated with pre-cooked deli roast beef (Parham,

Surveillance for emerging pathogens in the United States 41 1984). Evaluation of cooking temperatures revealed that they were sometimes insufficient to kill Salmonella, and an improved approach using specific temperature requirements was applied as an emergency regulation in 1977. In 1981, outbreaks of salmonellosis were again traced to pre-cooked roast beef prepared under these new regulations, showing that these measures were insufficient (CDC, 1981). Re-evaluation clarified that the humidity inside the oven was as critical as the time and temperature of cooking (Parham, 1984). After further regulations were promulgated, outbreaks traced to precooked roast beef have become extremely rare. E. coli O157:H7 and apple cider In 1992, investigation of an outbreak of E. coli O157:H7 infections in Massachusetts linked this pathogen for the first time to apple cider (Besser et al., 1993). This traditional beverage was often pressed from fallen apples, with minimal cleaning, but was long believed to be sufficiently acidic to be safe. Investigators thought that the apples were probably contaminated before they were pressed, possibly in the orchard, which was visited by deer. The first control measures adopted by the industry were simply to wash and brush the apples before pressing them. However, assessment of the survival of the organism in apple cider revealed that E. coli O157:H7 was acid tolerant and could easily survive in cider more acidic than the defined limit of safety of pH 4.5 (Zhao et al., 1993). Recurrent outbreaks of E. coli O157:H7 and Cryptosporidia infections traced to cider mills where apples had been brushed and washed showed that even with cleansing of the apples, cider could be hazardous (Millard et al., 1994; CDC, 1997; Cody et al., 1999). It was also shown that E. coli O157:H7 could, under some circumstances, be internalized into apples, and thus be protected from washing, brushing, or external disinfection (Buchanan et al., 1999; Burnett et al., 2000). Continued outbreaks and research led to the promulgation of juice regulations requiring a pathogen reduction step such as pasteurization (FDA, 2001). To date, no further cider associated outbreaks have occurred in apple cider produced in accordance with this regulation. Salmonella Enteritidis and shell eggs In the 1980s, dramatic outbreaks of Salmonella serotype Enteritidis (SE) infections were traced to Grade A shell eggs (St. Louis et al., 1988). This was surprising, as the egg grading and disinfection process instituted in the 1960s as a result of egg-associated salmonellosis had appeared to be effective. The earlier problem was related to Salmonella on the outside of the shell. It was suggested that the new problem might reflect internal contamination of eggs, possibly as a result of infection of the hen’s reproductive tissues themselves. Sporadic cases of SE infections were also increasing, first in the Northeast, and later over most of the country (Fig. 2.5) (CDC, 1993). These were also shown to be related to eggs, and it was even possible to show a gradient of risk according to the degree of cooking, from hard boiled and hard cooked

Emerging foodborne pathogens 12 10 8 6 4

02

98

00

20

20

96

92

94

90

88

86

84

82

76

78

80

19

72

0

74

2

70

Number /100,000 pop.

42

Year Total

New England

Mid Atlantic

Pacific

Other

Mountain

Fig. 2.5 Salmonella Enteritidis rates, United States, 1970–2002. The rate of reported Salmonella serotype Enteritidis (SE) per 100,000 population varied by region in the United States. The New England region was the first to experience increases in salmonellosis due to SE, followed by Mid Atlantic and then Pacific states. The epidemic has been linked to internally contaminated table eggs. Rates have fallen since 1996 in most regions with the implementation of control measures.

through over easy, to soft boiled and sunny side up (Passaro et al., 1996; Hedberg et al., 1993). Comparison of the strains found in the birds on farms implicated by trace back as the source of contaminated eggs demonstrated the same strains of Salmonella that were found in the affected humans, proving that the source of contamination was the birds themselves (Mishu et al., 1991; Altekruse et al., 1993). Feeding experimental birds SE showed that they did develop silent ovarian infection and then laid normal-looking eggs with contaminated contents (Gast, 1999). A pilot project to develop flock-based screening and control measures was begun, the Pennsylvania Egg Quality Assurance Program (Schlosser et al., 1999). This project was the model for other state egg quality assurance programs (EQAPs). The incidence of SE infections in the mid-Atlantic states, for which Pennsylvania was the main egg source, began decreasing, followed later by the incidence in other states (CDC, 2000). Microbiological screening of farms for SE is an integral part of the EQAPs, with voluntary diversion of the eggs to liquid egg pasteurization if they are found positive. Thus, many potentially tainted eggs are sent for safe processing before they enter the shell egg market. As the epidemic among egg-laying flocks spread from the Northeast to virtually the entire country, outbreak investigations and the attendant trace backs have defined the spread of this problem into new areas, stimulating them to develop their own EQAPs (CDC, 1993; Burr et al., 1999). The slow decline in incidence prompted further measures, such as the refrigeration requirement for eggs in 1999 and the commercialization of a new in-shell pasteurization process. A risk assessment was completed in 1998 (Baker et al., 1998). Current control policies of egg-associated SE appear to be having an impact. By 2002, the incidence of SE had decreased to less than two per 100,000,

Surveillance for emerging pathogens in the United States 43 down from the peak of nearly four per 100,000 in 1995, but it remains above the pre-epidemic incidence of one per 100,000 (Fig. 2.5). Also in 2002, 29 outbreaks of SE infection were reported, a significant decrease from 54 outbreaks in 1995, but still above the Healthy People 2010 objective of 25. The surveillance data clearly show that progress is being made in slowing the Salmonella Enteritidis problems in eggs, but that further efforts are needed to completely control it. Alfalfa sprouts Like SE in eggs, this food safety challenge is not an emerging pathogen, but rather the emergence of well-known pathogens in a new food vehicle. In 1995, shortly after the statistical outbreak detection algorithm was developed for the Salmonella surveillance system, a large 22-state outbreak of infections caused by Salmonella serotype Stanley was detected in the United States (Mahon et al., 1997). This serotype is usually quite rare. Simultaneously, public health officials in Finland identified an outbreak caused by the same organism. Both outbreaks were linked to the consumption of alfalfa sprouts, sprouted from the same batch of seeds (Mahon et al., 1997). Research showed that the sprouting process could greatly amplify the number of Salmonella originally present in the seed, and that the pathogen can be inside the sprout, where it could not be affected by washing or disinfecting (Jaquette et al., 1996; Itoh et al., 1998). The next three years witnessed at least seven outbreaks caused by several serotypes of Salmonella and E. coli O157:H7 in sprouts in the United States, often from contaminated seeds (Taormina et al.). Japan experienced a devastating outbreak that affected 6,000 schoolchildren traced to radish sprouts (Michino et al., 1999; Watanabe et al., 1999). Alfalfa and other seeds for sprouting are produced as raw agricultural commodities and may be easily contaminated in the field or warehouse, where they may be held for years before being sprouted (Breuer et al., 2001). After researchers determined that disinfecting seeds with chlorine could reduce contamination and preserve the ability of seeds to germinate, the FDA promulgated guidelines on seed disinfection and the major seed distributors put these instructions on the package (FDA, 1999). Since then, outbreaks of salmonellosis have been linked to a sprouter that reported disinfecting the seeds following those guidelines (Proctor et al., 2000), as well as to a sprouter using less chlorine than recommended (Winthrop et al., 2002). One recent outbreak involved a single lot of clover seed shipped to two sprouters in Colorado (Brooks et al., 2001). The first did not disinfect the seed before sprouting, and caused 1.13 documented infections per 50 pound bag of seed sprouted, while the second did disinfect, and caused only 0.29 infections per bag of seed. This outbreak showed that the disinfection strategy works partially, but is by itself insufficient to completely protect the public. In addition to disinfection, FDA also recommended lot by lot testing of the irrigation water for Salmonella (FDA, 1999). One outbreak has occurred linked to sprouts that had passed such a test, suggesting that false negative tests may occur (Winthrop et al., 2002).

44

Emerging foodborne pathogens

Thus, continued surveillance and investigation indicate that the challenge of preventing outbreaks of salmonellosis from sprouts has been partially met, but also that a complete solution has still not been implemented. Multi-drug resistant Salmonella Newport and foods of bovine origin One of the latest food hazards to emerge in the United States is a new and highly resistant strain of Salmonella serotype Newport (Gupta et al., 2004). This strain was first identified through the National Antimicrobial Resistance Monitoring System surveillance in 1998, and its detection increased rapidly in 1999 and 2000. The strain is resistant to at least nine antibiotics because it possesses a large plasmid bearing several resistance genes, including an unusual gene, the AmpC cmy2 gene, which confers resistance to most cephalosporins. In 2001, a retrospective study of these strains in Massachusetts identified the same strains in ill and dying dairy cattle, and showed that visiting or working on dairy farms was a risk factor for illness (Zansky et al., 2002). Later in 2001, an outbreak in Connecticut was traced to traditional cheese made from insufficiently pasteurized milk from Massachusetts dairy farms (McCarthy et al., 2002). In 2002, an investigation of a multistate cluster of cases in the Northeast linked the illness to eating ground beef traced to meat from a single slaughter plant (Zansky et al., 2002). Surveillance of human infections indicates a sharp increase in Salmonella Newport infections, which in 2000 represented 9% of human salmonellosis (CDC, 2001b). Many of the Newport strains were multidrug resistant (CDC, 2002b). The same organism has been detected since 1998 among isolates from animals, including bovines (Fedorka-Cray et al., 2002). Among Salmonella Newport isolated from cattle in 2000, 74% had the AmpC multi-drug resistance profile (USDA-ARS, 2002). The evidence to date indicates that this strain has spread in epidemic fashion among cattle herds, that it affects the animals themselves, persons in contact with the animals, and consumers of bovine products, including meat and cheese. Once control measures are identified and implemented, their success can be measured by monitoring animals and meat for this strain, by trends in human illness and by outbreak surveillance. Surveillance activities in animals, meat and poultry can also provide early warning of the spread of this strain or its plasmid to other food animal populations.

2.5

Future trends

In the future, we should expect that new pathogens and new food vehicles will continue to be recognized. New diagnostic strategies will identify some pathogens that currently are often or completely missed. Globalization of the food supply and concentration of its production will create new challenges for detection, investigation, control and prevention. Enhanced public health surveillance for human illness will be vital to identify and investigate these

Surveillance for emerging pathogens in the United States 45 new challenges. In addition, a flexible monitoring system that permits comparison of information from multiple points in the food supply is needed. Just as monitoring cattle at slaughter is an important strategy for documenting the continuing absence of bovine spongiform encephalopathy, so could a system for documenting the frequency of other foodborne hazards at point of slaughter or processing be critical to assessing and controlling other hazards in the future. Minimizing and preventing contamination early in the chain as well as identifying foods at higher risk of being contaminated so that they can be diverted out of the usual food chain to safer processing may become the norm. Increasingly, preventing foodborne disease will mean preventing contamination before food reaches the consumer. Farm management policy, as well as slaughter and processing plant policy, and kitchen practices are all key parts of food safety.

2.6

References

ALTEKRUSE, S., KOEHLER, J., HICKMAN-BRENNER, F., TAUXE, R. and FERRIS, K. (1993) Epidemiology

and Infection, 110, 17–22. and GROUP, F. W. (1997) Emerging Infectious Diseases, 3, 581–583. ANGULO, F. J. and SWERDLOW, D. L. (1999) In Salmonella enterica serovar Enteritidis in humans and animals: epidemiology, pathogenesis, and control (eds, Gast, R. K., Potter, M. E., Wall, P. G. and Saeed, A. M.) Iowa State University Press, Ames, IA, pp. 33–41. ANON. (1998) Ensuring safe food, from production to consumption, National Academy Press, Washington D.C. ANON. (2000) In WHO Consultation of Experts World Health Organization, Copenhagen, Denmark, 21–25 November, 2000. BAKER, A., EBEL, E., HOGUE, A., MCDOWELL, R., MORALES, R., SCHLOSSER, W. and WHITING, R. (1998) Food Safety and Inspection Service, US Department of Agriculture, Washington DC, http://www.fsis.usda.gov/ophs/risk/. BEAN, N. and GRIFFIN, P. (1990) Journal of Food Protection, 53, 804–817. BEAN, N., MARTIN, S. and BRADFORD, H. (1992) American Journal of Public Health, 82, 1273–1276. BELL, B. P., GOLDOFT, M., GRIFFIN, P. M., DAVIS, M. A., GORDON, D. C., TARR, P. I., BARTLESON, C. A., LEWIS, J. H., BARRETT, T. J., WELLS, J. G., BARON, R. and KOBAYASHI, J. (1994) Journal of the American Medical Association, 272, 1349–1353. BELL, B., SHAPIRO, C., ALTER, M., MOYER, L., JUDSON, F., MOTTRAM, K., FLEENOR, M., RYDER, P. and MARGOLIS, H. (1998) Journal of Infectious Diseases, 178, 1579–1584. BENDER, J., HEDBERG, C., BESSER, J., BOXRUD, D., MACDONALD, K. and OSTERHOLM, M. (1997) New England Journal of Medicine, 337, 388–394. BENDER, J., HEDBERG, C., BOXRUD, D., BESSER, J., WICKLUND, J., SMITH, K. and OSTERHOLM, M. (2001) New England Journal of Medicine, 344, 189–195. BESSER, R., LETT, S., WEBER, T., DOYLE, M., BARRETT, T., WELLS, J. and GRIFFIN, P. (1993) JAMA, 269, 2217–2220. BLAKE, P., MERSON, M., WEAVER, R., HOLLIS, D. and HEUBLEIN, P. (1979) New England Journal of Medicine, 300, 1–5. BLASER, M. J., CRAVENS, J., POWERS, B. W., LAFORCE, F. M. and WANG, W. (1979) American Journal of Medicine, 67, 715–718. BORGDORFF, M. and MOTARJEMI, Y. (1997) World Health Statistics Quarterly, 50, 12–23. ANGULO, F.

46

Emerging foodborne pathogens

BREUER, T., BENKEL, D., SHAPIRO, R., HALL, W., WINNETT, M., LINN, M., NEIMANN, J., BARRETT, T., DIETRICH, S., DOWNES, F., TONEY, D., PEARSON, J., ROLKA, H., SLUTSKER, L., GRIFFIN, P.

and (2001) Emerging Infectious Diseases, 7, 977–982. BROOKS, J., ROWE, S., SHILLAM, P., HELTZEL, D., HUNER, S., SLUTSKER, L., HOEKSTRA, R. and LUBY, S. (2001) American Journal of Epidemiology, 154, 1020–1028. BUCHANAN, R., EDELSON, S., MILLER, R. and SAPERS, G. (1999) Journal of Food Protection, 62, 444–450. BURNETT, S., CHEN, J. and BEUCHAT, L. (2000) Applied and Environmental Microbiology, 66, 4679–4687. BURR, R., EFFLER, P., KAHANA, J., KANENAKA, R., BALMER, M., ANGULO, F., BARRETT, T., HAYES, P., NEKOMOTO, T., NAKATA, M., SASAKI, D., HIGA, H., SAWA, T. and CHOY, B. (1999) In 48th Annual Epidemic Intelligence Service Conference, April 19–23, 1999 CDC, Atlanta, GA. BUTZLER, J., DEKEYSER, P., DETRAIN, M. and DEHAEN, F. (1973) Journal of Pediatrics, 82, 493– 495. BUZBY, J. and ROBERTS, T. (1996) Food Review, 19, 20–25. CDC (1964) In National Conference on Salmonellosis (ed. anon.) U.S. Government Printing Office, Atlanta, Georgia, pp. 1–217. CDC (1981) Morbidity and Mortality Weekly Report, 30, 569–570. CDC (1993) Morbidity and Mortality Weekly Report, 42, 793–797. CDC (1995) Morbidity and Mortality Weekly Report, 44, 905–908. CDC (1997) Morbidity and Mortality Weekly Report, 46, 4–8. CDC (1998) FoodNet Population Survey Atllas of Exposures: 1996–1997, Centers for Disease Control and Prevention, Atlanta, GA. CDC (2000) Morbidity and Mortality Weekly Report, 49, 73–79. CDC (2001a), Vol. 2002 http://www.cdc.gov/foodnet/annual/2000/2000final_report.pdf. CDC (2001b) Salmonella Surveillance: Annual Summary, 2000, US Department of Health and Human Services, CDC, Atlanta, Georgia. CDC (2002a) www.cdc.gov/ncidod/dbmd/outbreak/cdc_reported.htm. CDC (2002b) http://www.cdc.gov/narms/. CDC (2002c) Morbidity Mortality Weekly Report, 51, 325–29. CODY, S., GLYNN, K. M., FARRAR, J. A., CAIRNS, K. L., GRIFFIN, P. M., KOBAYASHI, J., FYFE, M., HOFFMAN, R., KING, A. S., LEWIS, J. H., SWAMINATHAN, B., BRYANT, R. G. and VUGIA, D. J. (1999) Annals of Internal Medicine, 130, 202–209. DALTON, C., MINTZ, E., WELLS, J., BOPP, C. and TAUXE, R. (1999) Epidemiology and Infection, 123, 9–16. DEMING, M., TAUXE, R., BLAKE, P. and PATTON, C. (1987) American Journal of Epidemiology, 126, 526–534. FDA (1999) Federal Register, 64, 57893–57902. FDA (2001), http://www.cfsan.fda.gov/~lrd/hhsjuic4.html FDA (2003), http://www.foodsafety.gov/~dms/lmr-2-toc.html. FEDORKA-CRAY, P. W., FM, GRAY, T., HERMOSILLA, J., BALL, T., ANANDARAMAN, M., SALAMONE, B., ROSE, B., DARGATZ, D. and HEADRICK, M. (2002) In 2002 Conference on Antimicrobial Resistance National Foundation for Infectious Disease, Bethesda, Maryland. FONTAINE, R., ARNON, S., MARTIN, W., VERNON, T., GANGAROSA, E., FARMER, J., MORAN, A., SILLIKER, J. and DECKER, D. (1978) American Journal of Epidemiology, 107, 36–45. FRIEDMAN, C., REDDY, S., SAMUEL, M., MARCAUS, R., BENDER, J., DESAI, S., SHIFERAW, B., HELFRICK, D., CARTER, M., ANDERSON, B., HOEKSTRA, M. and GROUP, T. E. F. W. (2000) in International Conference on Emerging Infectious Diseases 2000 CDC Foundation, Atlanta, GA, pp. 149. GAHR, P., SULLIVAN, M., SMITH, K., BESSER, J. and HEDBERG, C. (2001) In 41st Interscience Conference on Antimicrobial Agents and Chemotherapy American Society for Microbiology, Washington, DC, Chicago, Illinois, pp. 443. INVESTIGATION TEAM

Surveillance for emerging pathogens in the United States 47 GAST, R.

(1999) In Salmonella enterica serovar Enteritidis in humans and animals: Epidemiology, pathogenesis, and control (eds, Saeed, A., Gast, R., Potter, M. and Wall, P.) Iowa State University Press, Ames, Iowa, pp. 233–243. GRIFFIN, P., MEAD, P. and SIVAPALASINGAM, S. (2002) In Infections of the Gastrointestinal Tract, 2nd edition (eds, Blaser, M., Smith, P., Greenberg, H., Ravdin, J. and Guerrant, R.) Lippincott Williams and Wilkins, Philadelphia, pp. 627–642. GUERRANT, R., KOSEK, M., LIMA, A., LORNTZ, B. and GUYATT, H. (2002) Trends in Parasitology, 18, 191–193. GUPTA, A., NELSON, J., BARRETT, T., TAUXE, R., ROSSITER, S., FRIEDMAN, C., JOYCE, K., SMITH, K., JONES, T., HAWKINS, M., SHIFERAW, B., BEEBE, J., VUGIA, D., RABATSKY-EHR, T., BENSON, J., ROOT, T., ANGULO, F. and THE NARMS WORKING GROUP (2004) Emerging Infectious Diseases, 10, 1102–1109. HALL, J., GOULDING, J., BEAN, N., TAUXE, R. and HEDBERG, C. (2001) Epidemiology and Infection, 127, 381–387. HEDBERG, C., DAVID, M., WHITE, K., MACDONALD, K. and OSTERHOLM, M. (1993) Journal of Infectious Diseases, 167, 107–111. HELMS, M., VASTRUP, P., GERNER-SMIDT, P. and MOLBAK, K. (2002) Emerging Infectious Diseases, 8, 490–495. HERIKSTAD, H., MOTARJEMI, J. and TAUXE, R. (2002a) Epidemiology and Infection, 129, 1–8. HERIKSTAD, H., YANG, S., VAN GILDER, T., VUGIA, D., HADLER, J., BLAKE, P., DENEEN, V., SHIFERAW, B., ANGULO, F. and GROUP, A. T. F. W. (2002b) Epidemiology and Infection, 129, 9–17. HOLMBERG, S. and FELDMAN, R. (1984) American Journal of Public Health, 74, 205–207. HOPKINS, R. S. and SCOTT, A. B. (1983) Journal of Infectious Diseases, 148, 770. HUTWAGNER, L. C., MALONEY, E. K., BEAN, N. H., SLUTSKER, L. and MARTIN, S. M. (1997) Emerging Infectious Diseases, 3, 395–400. ITOH, Y., SUGITA-KONISHI, Y., KUSUGA, F., IWAKI, M., HARA-KUDO, Y., SAITO, N. NOGUCHI, Y., KONUMA, H. and KUMAGAI, S. (1998) Applied and Environmental Microbiology, 4, 1532– 1535. JAQUETTE, C., BEUCHAT, L. and MAHON, B. (1996) Applied and Environmental Microbiology, 62, 2212–2215. KASSENBORG, H., HEDBERG, C., EVANS, M., CHIN, G., FIORENTINO, T., VUGIA, D., BARDSLEY, M., SLUTSKER, L. and GRIFFIN, P. (1998) In International Conference on Emerging Infectious Diseases Centers for Disease Control and Prevention, Atlanta, GA, Atlanta, GA, pp. 50. KASSENBORG, H., K. E., S., VUGIA, D., RABATSKY-EHR, T., BATES, M., CARTER, M., DUMAS, N., CASSIDY, M., MARANO, N., TAUXE, R., ANGULO, F. and THE EMERGING INFECTIONS PROGRAM FOODNET WORKING GROUP, (2004) Clinical Infectious Diseases, 38, S279–S284. KOHN, M., FARLEY, T., ANDO, T., CURTIS, M., WILSON, S., JIN, Q., MONROE, S., BARON, R., MCFARLAND, L. and GLASS, R. (1995) Journal of the American Medical Association, 273, 466–471. LUMSDEN, L., HASSELTINE, H., LEAKE, J. P. and VELDEE, M. (1925) Public Health Reports, Supplement 50, 1–102. MAHON, B., PONKA, A., HALL, W., KOMATSU, K., DIETRICH, S., SIITONE, A., CAGE, G., HAYES, P., LAMBERT-FAIR, M., BEAN, N., GRIFFIN, P. and SLUTSKER, L. (1997) Journal of Infectious Diseases, 175, 876–882. MARANO, N., ROSSITER, S., STAMEY, K., JOYCE, K., BARRETT, T., TOLLEFSON, L. and ANGULO, F. (2000) Journal of the American Veterinary Medical Assciation, 217, 1829–1830. MARTIN, D. L., SHIPMAN, L. D., WELLS, J. G., POTTER, M. E., HEDBERG, K., WACHSMUTH, I. K., TAUXE, R. V., DAVIS, J. P., ARNOLDI, J. and TILLELI, J. (1986) Lancet, 2, 1043. MCCARTHY, T., PHAN, Q., MSHAR, P., HOWARD, R. and HADLER, J. (2002) In International Conference on Emerging Infectious Diseases CDC, Atlanta, GA, Atlanta, GA. MEAD, P., FINELLI, L., LAMBERT-FAIR, M., CHAMP, D., TOWNES, J., HUTWAGNER, L., BARRETT, T., SPITALNY, K. and MINTZ, E. (1997) Archives of Internal Medicine, 157, 204–207. MEAD, P., SLUTSKER, L., DIETZ, V., MCCAIG, L., BRESEE, J., SHAPIRO, C., GRIFFIN, P. and TAUXE, R. (1999) Emerging Infectious Diseases, 5, 607–625.

48

Emerging foodborne pathogens

MICHINO, H., ARAKI, K., MINAMI, S., TAKAYA, S., SAKAI, N., MIYAZALI, M., ONO, A.

and YANAGAWA, (1999) American Journal of Epidemiology, 150, 797–803. MILLARD, P., GENSHEIMER, K., ADDISS, D., SOSIN, D., BECKETT, G., HOUCK-JANKOWSKI, A. and HUDSON, A. (1994) Journal of the American Medical Association, 272, 1592–1596. MISHU, B., GRIFFIN, P. M., TAUXE, R. V., CAMERON, D. N., HUTCHESON, R. H. and SCHAFFNER, W. (1991) Annals of Internal Medicine, 115, 190–194. MURRAY, C. and LOPEZ, A. (1997) The global burden of disease: A comprehensive assessment of mortality and disability from diseases, injuries, and risk factors in 1900 and projected to 2020, Harvard University Press, Cambridge, MA. NACHAMKIN, I., ALLOS, B. and HO, T. (2000) In Campylobacter, 2nd edition (eds, Nachamkin, I. and Blaser, M.) ASM Press, Washington, DC, pp. 155–175. OLSEN, S., MACKINNON, L., GOULDING, J., BEAN, N. and SLUTSKER, L. (2000) Morbidity and Mortality Weekly Report, Supplemement 01, 1–51. OLSEN, S., BISHOP, R., BRENNER, F., ROELS, T., BEAN, N., TAUXE, R. and SLUTSKER, L. (2001) Journal of Infectious Diseases, 183, 753–761. PARASHAR, U. and MONROE, S. (2001) Reviews in Medical Virology, 11, 243–252. PARHAM, G. (1984) In International Symposium on Salmonella (ed., Snoeyenbos, G.) American Association of Avian Pathologists. University of Pennsylvania. Kennett Square, PA, New Orleans, Louisiana, pp. 275–280. PASSARO, D., REPORTER, R., MASCOLA, L., KILMAN, L., MALCOLM, G., ROLKA, H., WERNER, S. and VUGIA, D. (1996) Western Journal of Medicine, 165, 126–130. POTTER, M., ARCHER, D., BENSON, A., BUSTA, F. and DICKSON, J. (2000) Emerging microbiological food safety issues; Implications for control in the 21st century, Institute of Food Technology, Chicago. PROCTOR, M., HAMACHER, M., TORTORELLO, M., ARCHER, J., BARNETT, M., YING, M., SLUTSKER, L. and DAVIS, J. (2000) In 2nd International Conference on Emerging Infectious Diseases CDC, Atlanta, Atlanta, Georgia, pp. 98. RILEY, L. W., REMIS, R., HELGERSON, S., MCGEE, H. B., WELLS, J. G. DAVIS, B. R., HERBERT, R. J., OLCOTT, E. S., JOHNSON, L. M., HARGRETT, N. T., BLAKE, P. A. and COHEN, M. L. (1983) New England Journal of Medicine, 308, 681–685. ROSENBERG, C. (1987) The Cholera Years: The United States in 1832, 1849, and 1866, University of Chicago Press, Chicago, Illinois. SAMUEL, M., PORTNOY, D., TAUXE, R., ANGULO, F. and VUGIA, D. (2001) Journal of Food Protection, 64, 1261–1264. SCHLOSSER, W., HENZLER, D., MASON, J., KRADEL, D., SHIPMAN, L., TROCK, S., HURD, S., HOGUE, A., SISCHO, W. and EBEL, E. (1999) In Salmonella enterica serovar Enteritidis in humans and animals: Epidemiology, pathogenesis and control (eds, Saeed, A., Gast, R., Potter, M. and Wall, P.) Iowa City University Press, Ames, Iowa, pp. 353–365. SKIRROW, M. (1977) British Medical Journal, 2, 9–11. SLUTSKER, L., RIES, A., MALONEY, K., WELLS, J., GREENE, K. and GRIFFIN, P. (1998) Journal of Infectious Diseases, 177, 962–966. ST. LOUIS, M. E., MORSE, D. L., POTTER, M. E., DEMELFI, T. M., GUZEWICH, J. J., TAUXE, R. V. and BLAKE, P. A. (1988) Journal of the American Medical Association, 259, 2103–2107. SWAMINATHAN, B., BARRETT, T., HUNTER, S., TAUXE, R. and FORCE, C. P. T. (2001) Emerging Infectious Diseases, 7, 382–389. TAORMINA, P., BEUCHAT, L. and SLUTSKER, L. (1999) Emerging Infectious Diseases, 5, 626– 634. TAUXE, R. V. (1997) Emerging Infectious Diseases, 3, 425–434. THACKER, S. (1994) In Principles and practice of public health surveillance (eds, Teutsch, S. and Churchill, R.) Oxford University Press, New York, pp. 3–17. THACKER, S. and BERKELMAN, R. (1988) Epidemiologic Reviews, 10, 164–90. USDA–ARS (2002), http://www.arru.saa.ars.usda.gov. VOETSCH, A., VAN GILDER, T., ANGULO, F., FARLEY, M., SHALLOW, S., MARCUS, R., CIESLAK, P., DENEEN, V., TAUXE, R. and THE EMERGING INFECTIONS PROGRAM FOODNET WORKING GROUP (2004) Clinical Infectious Diseases, 38, S127–S134. H.

Surveillance for emerging pathogens in the United States 49 VOGT, R. L., SOURS, H. E., BARRETT, T., FELDMAN, R. A., DICKINSON, R. J. and WITHERELL, L.

(1982) Annals of Internal Medicine, 96, 292–296. WATANABE, Y., OZASA, K., MERMIN, J., GRIFFIN, P., MASUDA, K., IMASHUKU, S. and SAWADA, T. (1999) Emerging Infectious Diseases, 5, 424–428. WELLS, J. G., SHIPMAN, L. D., GREENE, K. D., SOWERS, E. G., GREEN, J. H., CAMERON, D. N., DOWNES, F. P., MARTIN, M. L., GRIFFIN, P. M., OSTROFF, S. M., POTTER, M. E., TAUXE, R. V. and WACHSMUTH, I. K. (1991) Journal of Clinical Microbiology, 29, 985–989. WHO (2001) http://www.who.int/salmsurv/en/. WINTHROP, K., PALUMBO, M., FARRAR, J., MOHLE-BOETANI, J., ABBOTT, S., INAMI, G. and WERNER, S. (2002) In 89th Annual Meeting of the International Association for Food Protection International Association for Food Protection, San Diego, California June 30–July 3, 2002, pp. 81. YANG, S., LEFF, M. G., MCTAGUE, D., HORVATH, K., JACKSON-THOMPSON, J., MURAYI, T., BOESELAGER, G., MELNIK, T., GILDEMASTER, M., RIDINGS, D., ALTEKRUSE, S. and ANGULO, F. (1998) Morbidity and Mortality Weekly Report: CDC Surveillance Summaries, 47, 33–57. ZANSKY, S., WALLACE, B., SCHOONMAKER-BOPP, D., SMITH, P., RAMSEY, F., PAINTER, J., GUPTA, A., KALLURI, P. and NOVIELLO, S. (2002) Morbidity and Mortality Weekly Report, 51, 545– 548. ZHAO, T., DOYLE, M. and BESSER, R. (1993) Applied and Environmental Microbiology, 59, 2526–2530.

50

Emerging foodborne pathogens

3 Surveillance of emerging pathogens in Europe S. J. O’Brien and I. S. T. Fisher, Health Protection Agency Centre for Infections, UK

3.1

Introduction

3.1.1 The origins of communicable disease control in Europe Communicable disease control in Europe has a long and proud history. In the fifteenth century the Venetians introduced quarantine at their ports in an effort to control the spread of infectious diseases, in particular plague, a tactic that was subsequently adopted throughout Western Europe (MacLehose et al., 2002). By the 19th Century it was clear that quarantine for cholera control, by then the main concern, was inadequate (MacLehose et al., 2002). In 1851, the first International Sanitary Conference was held in Paris leading to the subsequent establishment of a permanent International Committee on Epidemics and the adoption of an International Sanitary Convention (ISC). By 1903, the ISC agreed that states would ‘immediately notify the other governments of the first appearance in its territory of authentic cases of plague or cholera’ (MacLehose et al., 2002). This eventually paved the way for a set of International Health Regulations (IHRs), adopted by the World Health Assembly (WHA) in 1969. In a proposed revision of the IHRs, scheduled for adoption by the WHA in 2005, core requirements for surveillance and response are laid out (World Health Organization (WHO), 2004). 3.1.2 Surveillance for food safety Epidemiological surveillance is essential for any food safety programme. Wisely interpreted surveillance data are used to determine the burden of foodborne illness, the causative organisms and their epidemiology and to detect foodborne disease outbreaks. Surveillance data are thus fundamental for planning, implementing and evaluating food safety programmes (Borgdorff

Surveillance of emerging pathogens in Europe

51

and Motarjemi, 1997). Routine data sources include death registration, hospital discharge data, statutory notifications, laboratory surveillance and outbreak investigation. Borgdorff and Motarjemi (1997) have reviewed comprehensively the strengths and weaknesses of these various data sources. Briefly, death certificates and hospital discharge data include only those with fatal and/or severe disease. Coding errors and a tendency to use ‘catch-all’ diagnostic categories, for example, ‘diarrhoea of unknown aetiology’, are limiting features. Nevertheless, they provide a minimum estimate of the burden of serious disease. Statutory notifications of foodborne disease have the advantage that they are a legal requirement. However, in order to be captured by this system a patient has to feel sufficiently unwell to seek medical advice. Then their medical practitioner not only has to decide that the cause of the patient’s gastroenteritis is foodborne, as opposed to other routes of transmission, but he has to remember his legal obligation to notify the case. Furthermore, the definition of what constitutes food poisoning or food-related illness varies. There is good evidence that notifications are a poor reflection of the burden of foodborne disease (Wall et al., 1996; Atkinson and Maguire, 1998; Simmons et al., 2002). Laboratory report surveillance has the advantage over notifications that a diagnosis is attached to the patient’s symptoms. However, as with notification, the patient must present to medical attention before appropriate investigations can be undertaken. The physician may decide that laboratory investigation is not required to help guide patient management, in which case valuable epidemiological information is lost. Even if investigations are undertaken variations in laboratory protocols and in case definitions influence what is found and reported centrally. For national collation of surveillance data there needs to be a robust system for capturing positive results. Attrition of information at various stages throughout the surveillance process is often expressed as a pyramid (Fig. 3.1). To overcome shortcomings in routinely collected data some countries have embarked on burden of illness studies. These studies have permitted an understanding of the relationship between disease in the community and the data that appear in national statistics (Wheeler et al., 1999; de Wit et al., 2001). Routinely collected surveillance data may be supplemented by the use of sentinel studies and by research to determine the sources and food vehicles for sporadic infection as well as for outbreaks. During the last three decades, foodborne diseases have received increased recognition as an important public health issue. Subsequently, several surveillance programmes for foodborne diseases and pathogens have been established in Europe. These are described in detail below.

3.2 The WHO surveillance programme for control of foodborne infections and intoxications in Europe This is, perhaps, the most comprehensive scheme in terms of its geographical

52

Emerging foodborne pathogens Appears in national statistics Positive result

Specimen submitted

Specimen requested

Presenting to a physician

Disease in the community

Fig. 3.1

Surveillance reporting pyramid showing the stages at which data are lost.

coverage, its longevity and the range of organisms covered under one umbrella. The WHO European region stretches from the Republic of Ireland in the west to the Russian Federation in the east, and as far as Israel to the south (Fig. 3.2). The surveillance programme was launched by WHO/Europe in 1980. Since that time the number of participating countries has grown from just eight at the inception of the programme to 51 by 2000 (Tirado and Schmidt, 2001). The programme is co-ordinated by the Federal Institute for Risk Assessment (BfR) in Berlin, and overall management is from the WHO Centre for Environment and Health in Rome.

Source: http://www.who.int/about/regions/euro/en/index.html

Fig. 3.2 Map showing the countries in the WHO European region that report to the WHO Programme for foodborne infections and intoxications in Europe.

Surveillance of emerging pathogens in Europe

53

Participation in the programme is voluntary and the scheme is based on surveillance activities at national level. Specifically its objectives are to: ∑ ∑ ∑ ∑

evaluate trends in incidence of foodborne diseases and outbreaks identify the causes and epidemiology of foodborne diseases in Europe disseminate relevant information on surveillance collaborate with national authorities to identify approaches to reinforce their surveillance systems (Tirado and Schmidt, 2001).

There is a designated national contact point in each participating country, usually at the health ministry, responsible for collecting and reporting official data on foodborne outbreaks, along with other relevant information. The programme office compiles and reports the data, issuing quarterly newsletters and annual reports both in printed form and published on the worldwide web. Great efforts have been made to standardize data collection and coding, through the use of harmonized definitions and creation of standardized reporting forms and coding systems (Tirado and Schmidt, 2001). One of the prime data sources concerns the epidemiological investigation of outbreaks. The dataset to be reported to WHO comprises the number of people affected, causative agent(s), the implicated food(s), the location at which the food was contaminated or mishandled, the place of purchase or consumption and any contributory factors leading to the outbreak. Figure 3.3 shows the contributory factors leading to foodborne outbreaks in 2000 for six of the countries that report to the WHO Programme. Two general points are illustrated with respect to all countries reporting data to the programme. The first is that the numbers of outbreaks reported vary considerably. Secondly the proportion of outbreaks for which contributory factors cannot be identified is fairly sizeable. In addition to information derived from epidemiological investigation of outbreaks, the WHO also requests statutory notification data, laboratory-report surveillance data and findings from special surveys. Table 3.1 shows campylobacter infection rates from 1993 to 2000. A major strength of the programme is the standardisation which has been brought to bear to improve reporting. Despite this, however, it is still difficult to draw direct comparisons between participating countries. Until recently, surveillance in Europe was primarily seen as a national responsibility and, perhaps not surprisingly, different approaches emerged (MacLehose et al., 2002; Tirado and Schmidt, 2001). The robustness of the data compiled by the WHO is heavily dependent upon that of the national surveillance systems that feed into the system and influenced by timeliness and completeness of reporting. Added to this, diagnostic and reference laboratory methods for detecting pathogens and/or their toxins vary, further complicating inter-country comparisons. The creation in 2000 of WHO Global Salm-surv (GSS) should help to alleviate this latter problem in due course. The foundation for GSS was laid in the late 1990s through a survey conducted by WHO to increase understanding of the worldwide epidemiology of human salmonellosis and the national surveillance systems in place to record disease (Herikstad et al.,

Finland (N = 69)

54

Belgium (N = 74)

Lithuania (N = 8)

Contamination by infected person Inadequate cooking Inadequate refrigeration Other Unknown

Croatia (N = 71)

Sweden (N = 75)

Ireland (N = 64) Contamination by infected equipment Contamination by infected person Inadequate cooking Inadequate refrigeration Other Unknown

Fig. 3.3

Contributory faults reported in outbreaks in selected countries reporting to the WHO programme for foodborne infections and intoxications in Europe.

Emerging foodborne pathogens

Contamination by infected equipment

Table 3.1 Incidence rates of campylobacteriosis in European countries, 1993–2000 1993

Country

No. of cases

Western Europe Belgium 4394 Netherlands N/A U.K. 39477 England & Wales U.K 4011 Scotland Southern Europe Greece N/A Israel 1067 Malta 49 Spain 2387

1995

1996

1997

1998

1999

No. of cases

Incidence rate

No. of cases

Incidence rate

No. of cases

Incidence rate

No. of cases

Incidence rate

No. of cases

Incidence rate

33 31 21 20 21

2 1804 48 1050 5529

41 35 17 24 29

N/A 2197 41 1046 5580

49 42 15 24 29

3 2629 85 1145 5081

56 51 31 26 21

2 2404 93 1178 5306

50 46 4 27 21

N/A 2851 220 1700 6543

44 N/A 74

4879 N/A 45207

48 N/A 84

4779 2871 43449

47 18 83

4991 3741 43978

49 24 82

5417 3646 51360

54 23 95

78

4152

80

4381

86

5107

102

5533

N/A 18 13 6

N/A 1455 16 2943

N/A 25 4 7

N/A 2014 8 3235

N/A 34 2 8

N/A 1314 28 3687

N/A 22 8 9

N/A 1461 21 3755

2000

No. of cases

Incidence rate

No. of cases

Incidence rate

54 46 80 39 29

N/A 3303 435 2032 7137

N/A 64 156 46 81

N/A 3527 245 2331 7646

N/A 68 87 52 86

6610 3398 56852

65 22 110

6514 3160 54987

64 N/A 104

7473 3362 55887

73 N/A 106

108

6381

125

5865

115

6482

127

N/A 25 6 9

136 2446 21 4389

1 41 6 11

306 N/A 11 N/A

3 N/A 3 N/A

261 N/A 30 N/A

3 N/A 8 N/A

Surveillance of emerging pathogens in Europe

Northern Europe Denmark N/A Finland 1600 Iceland 59 Norway 877 Sweden 4485

1994

Incidence rate

55

56

1993

Country

No. of cases

1994

1995

Incidence rate

No. of cases

Incidence rate

South-Eastern Europe Croatia N/A The F.Y.R. N/A of Macedonia

N/A 0

N/A 20

N/A 1

14 37

Eastern Europe Armenia Republic of Moldovia

N/A N/A

N/A N/A

N/A N/A

N/A N/A

N/A N/A

N/A 22

N/A N/A

7 1045 N/A 5058

<0.0 19 N/A 71

33 1141 N/A 4931

Central Europe Austria Czech Republic Hungary Slovakia Slovenia Switzerland

No. of cases

Incidence rate

1996

1997

1998

1999

2000

No. of cases

Incidence rate

No. of cases

Incidence rate

No. of cases

Incidence rate

No. of cases

Incidence rate

No. of cases

Incidence rate

<0.0 2

N/A 41

N/A 2

N/A 47

N/A 2

388 48

N/A 2

N/A 54

N/A 3

N/A 40

N/A 2

13 N/A

<0.0 N/A

7 2

<0.0 <0.0

1 2

<0.0 <0.0

3 N/A

<0.0 N/A

N/A 1

N/A N/A

N/A 8

N/A N/A

N/A 22

N/A N/A

N/A 29

1131 N/A

14 25

1667 N/A

21 37

2454 N/A

30 54

3252 N/A

40 N/A

3471 N/A

43 N/A

<0.0 21 N/A 69

4 794 N/A 544

<0.0 15 N/A 71

N/A 1243 N/A 5656

<0.0 23 N/A 79

N/A 1142 N/A 5955

1 21 N/A 84

N/A 1304 81 5455

2 24 4 77

8968 1177 1324 6709

89 22 66 94

8644 1340 1331 7568

86 25 67 105

N/A = Not available. Source = WHO surveillance programme for control of foodborne infections and intoxications in Europe 7th and 8th Reports (http://www.euro.who.int/foodsafety/surveillance/20031127_1); Health Protection Agency (http://www.hpa.org.uk/infections/topics_az/campy/data_ew.htm); Health Protection Scotland (http://www.show.scot.nhs.uk/scieh/)

Emerging foodborne pathogens

Table 3.1 Continued

Surveillance of emerging pathogens in Europe

57

2002). GSS is a global network of epidemiologists and microbiologists involved in Salmonella surveillance (Petersen et al., 2002). Many countries in the WHO European region are members of GSS. The aim is to enhance the capacity of national and regional reference laboratories to conduct Salmonella serotyping and antimicrobial susceptibility testing through international training courses and an External Quality Assurance System (EQAS). In turn this should improve the reliability and comparability of Salmonella surveillance data obtained from different countries. In the fullness of time it is intended to extend GSS to incorporate other major foodborne pathogens. The dataset amassed by the above WHO programmes is large and covers the whole range of foodborne pathogens. It helped to alert the world to the increasing incidence of foodborne illness, prompting action to revisit the strategies for prevention of illnesses. The data were particularly helpful for designing educational interventions. The most recent report, covering 1999– 2000, highlighted the continued importance of foodborne campylobacteriosis across the region, a high incidence of trichinellosis in the Balkan region and an increasing incidence of brucellosis (Malta fever) in the central Asian republics, transmitted mainly through the consumption of unpasteurized goats’ and sheeps’ milk. Botulism remained frequent in eastern Europe, mostly related to traditional ways of preserving foods at home (WHO Regional Office for Europe, 2003). The richness of the information collected by the WHO surveillance programme makes it suitable for planning and evaluating food safety programmes and interventions such as educational activities. Its usefulness as a tool for detecting emerging pathogens quickly is limited by timeliness. However, planned improvements include real-time reporting, which should help to speed detection.

3.3 Disease-specific networks funded by the European Commission When the European Economic Community was created in 1957 following the Treaty of Rome, public health was not even mentioned. Indeed, it was not until 1992 in the Treaty of Maastricht that specific responsibility for public health was referred to, providing a basis for co-operation in disease prevention between Member States of the European Union (EU) (MacLehose et al., 2002). Six years later, in 1998, the European Parliament and Council adopted a proposal from the European Commission (Decision No 2119/98/ EC) to establish a network for the epidemiological surveillance and control of communicable diseases in the European Community (Ternhag et al., 2004). Even prior to Decision No. 2119/98/EC the heads of the national surveillance centres within the EU had foreseen the need to co-operate at European level on infectious disease surveillance (Bartlett, 1998; Giesecke and Weinberg, 1998). Free movement of goods and people throughout the EU, and migration

58

Emerging foodborne pathogens

and imports from outside the EU, had greatly increased the potential for international outbreaks. A number of disease-specific networks was developed and several of these were directed at potentially foodborne pathogens.

3.3.1 Networks funded by the Directorate General for Health and Consumer Protection Enter-net (formerly known as Salm-net) Enter-net is one of two surveillance networks funded by the European Commission Directorate General for Health and Consumer Protection (DG SANCO). In 1994 routine Europe-wide surveillance of salmonellosis was established through a network named Salm-net, co-ordinated from the Health Protection Agency (formerly the Public Health Laboratory Service) in the United Kingdom. It was funded by the European Commission to prevent human salmonellosis within the EU by strengthening international laboratorybased surveillance and creating a regularly updated European salmonella database open to all participants (Fisher, 1995). It was to be an adjunct to national surveillance schemes, not a substitute for them. As if to reinforce the need for such a collaborative network, several international outbreaks quickly followed – Salmonella Agona, S. Tosamanga and S. Dublin (Killalea et al., 1996; Threlfall et al., 1996; Shohat et al., 1996; Vaillant et al., 1996; Hastings et al., 1996). Rapid information exchange between experts in different EU countries thus led to effective public health action in Europe and beyond (Fisher, 1995). Enter-net was formed in 1997, when surveillance of Vero cytotoxinproducing Escherichia coli (VTEC) was added to European surveillance of human salmonellosis. Antimicrobial resistance surveillance for salmonellas and VTEC was also included. At the outset all 15 Member States of the (then) EU, plus Switzerland and Norway, participated in international surveillance. The network has expanded since then to include Australia, Canada, Japan, Mexico, New Zealand and South Africa, although this latter group does not receive financial support from the European Commission. The Centers for Disease Control and Prevention in Atlanta are also allied to Enter-net. Enter-net comprises a collaboration of national surveillance experts (Fisher, 1999). For each participating country the personnel involved are the microbiologist(s) in charge of the national reference laboratories for Salmonella and STEC and the public health specialist or epidemiologist responsible for national surveillance of those organisms, thus ensuring that high-quality data and information from reliable sources are available to those with the skill to interpret them. The responsibilities of membership are enshrined in principles of collaboration, which cover commitment to rapid data exchange, ownership of, and access to, the international database, confidentiality and data protection requirements, response to outbreaks, liability to product

Surveillance of emerging pathogens in Europe

59

producers and release of information to other national surveillance institutes that are not necessarily members of the Enter-net surveillance network (Fisher and Gill, 2001). This latter point underlines Enter-net’s wider public health obligations. Specific objectives of Enter-net are to: 1. Collect standardised data on the antimicrobial resistance patterns of salmonella isolates. 2. Facilitate the study of resistance mechanisms. 3. Extend the typing of VTEC for surveillance purposes by: (a) extending the availability of phage typing for E. coli O157, (b) using poly- and mono-valent antisera to identify common non-O157 serogroups. 4. Pilot an international quality assessment scheme for laboratory identification/typing of STEC. 5. Establish a core dataset for VTEC isolates. 6. Create an accessible, regularly updated international database of VTEC isolates. Figure 3.4 shows the proportion of VTEC isolates that are confirmed as O157 by reference laboratories in Enter-net participating countries. In France, Denmark, Germany and Italy non-O157 predominate. 7. Detect clusters of VTEC and bring these rapidly to the attention of collaborators. 8. Continue to exchange data on salmonellas regularly and frequently (Fisher, 1999). Figure 3.5 shows the trend in salmonellas in Europe between 1995 and 2002. Of note is the decline in Salmonella Enteritidis. Figure 3.6 shows that whilst PT 4 is declining in importance other phage types are emerging notably PT1, PT8, PT14b and PT21. 100 90 80

Per cent

70 60 50 40 30 20

Average

Germany

Italy

Denmark

France

Sweden

Austria

Belgium

Netherlands

Ireland

New Zealand

E&W

Scotland

Spain

Czech Republic

0

Finland

10

Non-O157 O157

Fig. 3.4 Proportion of Vero cytotoxin-producing Escherichia coli isolates in the Enter-net database that are confirmed as serogroup O157 by country, 2000–02 (Source: Enter-net dataset).

60

Emerging foodborne pathogens 220,000 Enteritidis Typhimurium Other

200,000

Laboratory reports

180,000 160,000 140,000 120,000 100,000 80,000 60,000 40,000 20,000 0 1998

1999

Fig. 3.5

2000

2001

2002

2003

Trends in human salmonellas in Europe, 1995–2003 (Source: Enter-net dataset).

% non PT4

% PT4 70.00

20.00 18.00

60.00

16.00 14.00

50.00

12.00

40.00

10.00 30.00

8.00

20.00

6.00

PT1 PT6 PT6A PT8 PT14B PT21 Other PT4

4.00 10.00 2.00 0.00

0.00 1998

Fig. 3.6

1999

2000

2001

2002

2003

Trends in Salmonella Enteritidis phage types in nine countries reporting to Enter-net, 1998–2003 (Source: Enter-net dataset).

These objectives are achieved through: 1. Harmonisation of phenotypic typing methods. Agreed protocols for typing salmonellas and VTEC are established, in particular a scheme for phage typing S. Enteritidis in all Enter-net laboratories with this capacity. 2. Harmonisation of antimicrobial resistance testing. A multi-centre study for antimicrobial resistance and sensitivity testing of salmonellas has been undertaken successfully in order to ensure comparable results from different laboratories (Threlfall et al., 1999).

Surveillance of emerging pathogens in Europe

61

3. External quality assurance schemes. These have been instituted both for salmonellas and VTEC and are operated regularly. 4. Reporting results to the international databases. Partners collect basic data on each case from which a salmonella or VTEC isolate is submitted for further identification and typing. These include sex, age group, onset date, recent history of foreign travel, date of receipt of specimen in source laboratory, date of receipt of specimen in reference laboratory, region of source laboratory, STEC serogroup, salmonella serotype, phage type, and results of antimicrobial resistance testing. For VTEC isolates detection of toxin production and/or presence of stx genes are also recorded. Data are transmitted electronically to the central databases monthly and quarterly. A routine outbreak detection algorithm is then applied to the pooled data (Farrington et al., 1996). 5. Surveillance outputs. Surveillance reports are produced quarterly and published to the Enter-net website (http://www.hpa.org.uk/hpa/inter/enternet_menu.htm). Annual reports are also compiled. Noteworthy findings are also published in the European bulletin on communicable disease, Eurosurveillance. 6. Circulation and monitoring of urgent requests to the network. Enter-net differs from many surveillance systems in actively encouraging participants to alert the network when they are dealing with national/unusual outbreaks. Urgent requests sent to the Enter-net surveillance hub are distributed to all participants. 7. Annual workshops. These present the participants with opportunities to agree protocols and priorities, review progress, and discuss results. The annual workshops are also crucial in building trust between members of the network. Perhaps the most visible success of the Enter-net network has been prompt outbreak recognition and investigation. International outbreaks are frequently recognised as a result of sharing information on national investigations in participating countries. A good example was an outbreak of multi-resistant S. Typhimurium definitive phage type (DT) 204b involving nearly 400 people in five European countries (Lindsay et al, 2002; Crook et al, 2003) (Fig. 3.7). The organism was resistant to ampicillin (A), chloramphenicol (C), gentamicin (G), neomycin (Ne), kanamycin (K), streptomycin (S), sulphonamides (Su), tetracyclines (T), trimethoprim (Tm), nalidixic acid (Nx) and exhibited low level resistance to ciprofloxacin (Cp) (= R-type ACGNeKSSuTTmNxCpL). Typhimurium 204b is a very unusual type, rarely recorded in the international database, and such an antibiotic resistance pattern had not been observed before. Figure 3.7 also shows the epidemic curve for cases of S. Typhimurium DT204b. England, Wales and Iceland were the countries predominantly affected in the outbreak. All strains tested displayed an identical plasmid profile and strains from five cases in England and Wales and five cases in Iceland possessed an identical pulsed-field profile, strongly suggesting that they

62

England 140

Iceland 181

Netherlands 28

Scotland 24

25 Germany Scotland Netherlands England and Wales Iceland

No. of cases

20 15 10 5 0 03.08.2000

11.08.2000

31.08.2000

11.09.2000 Date

28.09.2000

12.10.2000

Fig. 3.7 Countries affected by an international outbreak of Salmonella Typhimurium DT204b, summer 2000. Source: adapted from Crook et al., 2003

Emerging foodborne pathogens

Germany 19

Surveillance of emerging pathogens in Europe

63

were all part of the same outbreak. Although a common source was suspected, only Iceland implicated imported lettuce as a vehicle with an analytical epidemiological study (Odds Ratio (OR) = 40.8; P = 0.005; 95% Confidence Interval = 2.7 to 3175) (Crook et al., 2003). Finally, international data collation and analysis using the outbreak detection algorithm is instrumental in identifying international outbreaks like that of S. Livingstone (Fisher and Crowcroft, 1998). Nine countries were affected by the outbreak, although at the time that the outbreak was detected through Enter-net, none had accumulated sufficient cases to trigger a national outbreak investigation. Thus it was only by pooling data that the outbreak came to light so early. An international investigation revealed that travel to Tunisia was a common feature amongst the cases. As well as outbreak detection and investigation, the data accumulated through Enter-net are used for describing disease trends. In 2000, results of antimicrobial sensitivity tests for isolates from over 27,000 cases of human salmonellosis were received from ten European countries (Table 3.2). Almost 40% of isolates were resistant to at least one antimicrobial (Table 3.3). Eighteen percent were multi-resistant (Threlfall et al., 2003a). Furthermore a study on strains of S. Typhi and S. Paratyphi A from those same ten countries in 2001 and 2002 showed that strains of both serotypes were demonstrating reduced susceptibility to fluoroquinolone antimicrobials, which has major consequences for treatment (Threlfall et al., 2003b) Basic Surveillance Network The Basic Surveillance Network (BSN) is co-ordinated from the Swedish Institute for Infectious Disease Control in Stockholm. It was created in 2000 to provide easy access to basic descriptive data already contained in national databases, in order to monitor and compare incidence trends for infectious diseases in the 15 original EU Member States, plus Iceland, Norway and Table 3.2 Antimicrobial sensitivity test results for 27,059 salmonella isolates from ten European countries Antimicrobial agent

No. of strains tested

% of strains resistant

Ampicillin (A) Chloramphenicol (C) Gentamicin (G) Kanamycin (K) Streptomycin (S) Sulphonamides (Su) Tetracyclines (T) Trimethoprim (Tm) Nalidixic acid (Nx) Ciprofloxacin (Cp) Cefotaxime (Ct)

25,116 24,545 24,154 23,178 22,324 22,995 24,290 24,937 22,917 25,319 24,413

22 14 2 2 21 30 26 7 14 0.5 0.6

Source: adapted from Threlfall et al., 2003a

64

Emerging foodborne pathogens

Table 3.3 Multiple antimicrobial drug resistance in salmonellas by serotype, Europe (ten countries), 2000 Serotype

Number tested

% resistant to 0

1

2

3

4 or more drugs

Enteritidis Typhimurium Hadar Virchow Infantis Newport Blockley Agona Heidelberg Brandenburg Others (comprising 245 serotypes)

14636 6777 622 449 439 243 229 206 175 160 3123

71 23 21 28 79 79 49 87 57 63 65

24 14 4 27 9 9 10 7 19 26 19

2 8 14 4 4 4 3 3 4 6 4

1 4 24 4 4 4 10 2 6 4 3

2 51 37 36 5 5 25 0.5 14 1 18

Total

27059

57

19

4

3

18

Source: adapted from Threlfall et al., 2003a

Switzerland (Ternhag et al., 2004). The impetus for creating the network arose from Decision No. 2119/98/EC, which set out the legal basis for the network. Following on from that was Decision No. 2000/96/EC, which specified a list of 40 diseases to be covered progressively by the Community network, many of which were not already covered by existing networks. The main objective of the BSN project is the creation of a standard, passive system for sharing basic surveillance data, in order to detect and monitor incidence trends for infectious diseases in Europe (Ternhag et al., 2004). In the longer term the aim is to enable national comparisons, for example through the use of EU case definitions. A major stumbling block when attempting to compare national disease rates is the basis upon which cases are recorded and direct comparisons of rates by country are not yet possible. Some countries record only laboratory-confirmed cases of disease, whilst others might accept a less specific definition, e.g. clinical suspicion. In order to promote comparability of data through the use of standard case definitions the EC has adopted a decision laying down case definitions for reporting communicable diseases to the Community network (Decision No 2002/253/EC). However, many Member States have yet to implement these. Network participants are an epidemiologist and a database manager from each national surveillance institute. The rule for data collection is that the dataset should be as minimal as possible, whilst still fulfilling the network objectives. The data collected through the BSN already exist in national datasets, so data transfer is not burdensome. For each case, the minimum dataset includes age, sex, report date and case classification according to the EU case definitions (possible, probable or confirmed) where available. Additional fields, where appropriate, include mode of transmission, country

Surveillance of emerging pathogens in Europe

65

of infection, country of origin for food, immunisation status and details of the causative organism. Where disaggregated data are not available, aggregated data are captured. Data are uploaded on a monthly basis by means of electronic data transfer and checked before being added to the European database. Aggregated data can be accessed by all network members via a secure website and standardised outputs are published to a publicly accessible website (https: //www2.smittskyddsinstitutet.se/BSN/). Annual workshops for participants are held to agree principles of operation and collaboration. Foodborne diseases covered by the BSN are botulism, campylobacteriosis, entero-haemorrhagic E. coli, hepatitis A, listeriosis, salmonellosis, trichinosis and yersiniosis, although not all countries report all these infections to the BSN yet. In addition the network will include other infectious intestinal diseases, namely cholera, cryptosporidiosis and giardiasis.

3.3.2

Networks funded by the Directorate General for Research

Foodborne Viruses in Europe network Funded through a grant from the European Commission’s Directorate General for Research (DG RESEARCH) the Foodborne Viruses in Europe network (FBVE network) is co-ordinated by the National Institute of Public Health and the Environment in the Netherlands (Koopmans et al., 2003). The FBVE network comprises a collaboration of 12 laboratories in nine European countries (Denmark, Finland, France, Germany, Italy, the Netherlands, Spain, Sweden and the United Kingdom) and participants are virologists and epidemiologists actively researching enteric viruses. Additional participants are from Slovenia and Hungary. The principal research goal is to understand better the mechanisms of emergence of variant norovirus (NV) strains and the main aim is to facilitate the early detection of potentially emerging variant strains (Koopmans et al., 2003). Overall objectives are to: 1. develop novel, standardised, rapid methods for detection and typing of enteric viruses, particularly NV 2. establish a mechanism for rapid, prepublication exchange of epidemiological, virological, and molecular diagnostic data 3. study the importance of enteric viruses as causes of illness across Europe, focusing on international outbreaks of NV and hepatitis A virus infection 4. provide better estimates for the proportion of foodborne NV infections 5. determine high-risk foods and transmission routes of foodborne viral infections in the different countries and between countries 6. describe the pattern of diversity of NV within and between countries and identify potential pandemic strains at the onset 7. investigate the mechanisms of emergence of these strains, including the possibility of spread from animal reservoirs (Koopmans et al., 2003).

66

Emerging foodborne pathogens

These objectives are being met partly through the creation of a European surveillance structure for outbreaks of viral gastroenteritis, including foodor waterborne outbreaks. This has entailed reviewing existing surveillance systems for viral gastroenteritis (Lopman et al., 2002, 2003), designing and agreeing a minimum dataset, reviewing and evaluating methods currently employed for detection and genotyping of NV (Vinjé et al., 2003) so that standardised methods for virus detection in gastroenteritis outbreaks can be developed and building a database for combined epidemiological and virological data open to all participants. In common with other surveillance networks, regular face-to-face meetings are held between participants. Unlike Enter-net and the BSN, where data are collated on individual cases, in the FBVE the unit of data capture is outbreaks. A minimum dataset has been agreed by participants, which includes causative organism, mode of transmission, diagnostic results, number of cases affected and viral typing information. A key achievement was agreement of case definitions for a case and an outbreak of viral gastroenteritis (Koopmans et al., 2003). One of the innovative elements of the FBVE network is data capture by means of webbased Active Server Pages technology (ASP) (Koopmans et al., 2003). This considerably enhances the responsiveness of the surveillance system, as all network participants have password-protected access to a standard webbased questionnaire, and to the outbreak database, and information can be updated as investigations progress. Like Enter-net, the FVBE network has enjoyed early successes. These include detection of a new NV variant (Lopman et al., 2004), and at least three international outbreaks (Koopmans et al., 2003). Ongoing funding for the network has been secured from DG SANCO for a project entitled ‘Prevention of emerging (food-borne) enteric viral infections: diagnosis, viability testing, networking and epidemiology (DIVINE-NET)’. Salm-gene Also funded by a grant from DG RESEARCH, the overall aim of Salm-gene, which commenced in 2001, is to strengthen international Salmonella surveillance through molecular strain typing and differentiation (Peters et al., 2003). The rationale is that prevention and control of salmonellosis relies on the early recognition of outbreaks leading to prompt epidemiological investigation. Although the utility of using phenotypic typing methods as surveillance tools is undisputed, certain salmonella serotypes and phage types predominate, limiting the capacity to detect geographically or temporally clusters of cases involving these strains. Whilst molecular sub-typing has been used very successfully as an adjunct to phenotypic methods in outbreak investigation, the usefulness of applying these methods routinely and rapidly sub-typing salmonella isolates as an integral part of the surveillance of Salmonella in Europe has not been established. Proof of principle has already been established in the United States, where the National Molecular Subtyping Network for foodborne bacterial Disease Surveillance (PulseNetUS) has

Surveillance of emerging pathogens in Europe

67

been illustrating the effectiveness of molecular methods as a surveillance tool since 1996 (Swaminathan et al., 2001). Salm-gene is co-ordinated by the Health Protection Agency in the United Kingdom. Microbiologists from nine national Salmonella reference laboratories in eight European countries are participating (Austria, Denmark, Finland, Germany, Italy, the Netherlands, Spain and the United Kingdom), along with the Enter-net surveillance hub (Peters et al., 2003). The aims of Salm-gene are to: 1. develop standard laboratory operating procedures for PFGE and for computer recognition of the results 2. create a searchable database of PFGE profiles for the major Salmonella serovars currently in circulation within Europe 3. DNA fingerprint a large sample of salmonella strains in each of several countries in real time, using selection criteria that maximise outbreak detection power, and analyse the data continuously in the online database 4. establish an external quality assurance (EQA) scheme for PFGE. (Peters et al., 2003). These are being met by: 1. Standardising laboratory methods. This includes developing a nomenclature for the PFGE sub-types and a protocol for the laboratory procedures. Other methods, such as amplified fragment length polymorphism (AFLP) and fluorescent amplified fragment length polymorphism (fAFLP), are also being evaluated and standardised. Consultation is taking place with other molecular typing schemes, such as PulseNetUS, to ensure comparability of Salm-gene data across continents. A recent international outbreak of S. Stanley and S. Newport involving four people on four continents has reinforced the need for this wider collaboration (Kirk et al., 2004). 2. Developing an external quality assurance scheme. A standard panel of strains is selected and distributed to collaborating countries for subtyping on a six-monthly basis. 3. Developing a central database. Participants send all gene prints and associated epidemiological information to the co-ordinating centre for uploading into a central web-based database, searchable on-line by all participants who have access to descriptive, phenotypic, antibiotic resistance and gene-print information. 4. Holding regular face-to-face meetings. This allows participants to discuss progress, study findings and future developments. Figure 3.8 shows the proportion of S. Enteritidis strains belonging to different PFGE profiles. The majority of isolates belong to one pulsed field profile, in marked contrast to S. Typhimurium (Fig. 3.9) (Gatto et al., 2004).

68

Emerging foodborne pathogens 100%

Proportion (%)

80% 60% 40% 20%

(n

= 35 ) W ale Eng s ( lan Ne n = d& th 33 er 8) lan ds (n Sc = 4) ot lan d (n = 72 ) Sp ain (n = 53 )

4) 15 = Ita

ly

n y( an

Ge

rm

Fin

nm De

Fig. 3.8

lan

ar

d

k(

(n

n

=

=

22

3)

6) 22 = (n ia str Au

)

0%

Other SENTXB.0001

Proportion (%) of Salmonella Enteritidis PT4 PFGE profile types by country (n = 907).

Proportion (%)

100% 80%

Other STYMXB.0006 STYMXB.0013 STYMXB.0061 STYMXB.0001 STYMXB.0067

60% 40% 20%

Fig. 3.9

d( n= 2) an y( n= 126 ) Ita ly (n =2 4) Wa Eng les la (n nd & Sc =1 otl 39) an d( n= 58) Sp ain (n =2 6) rm

Ge

Fin

lan

=2 ) (n

nm De

Au

str

ia

ark

(n

=7 4)

0%

Proportion (%) of Salmonella Typhimurium DT 104 PFGE profile types by country (n = 451).

3.3.3 Feasibility studies In addition to the networks described above, DG SANCO has funded a number of feasibility studies. These have covered: ∑ ∑ ∑ ∑

campylobacteriosis (Takkinen et al., 2003) listeriosis (http://www.europa.eu.int/comm/health/ph_projects/2001/ com_diseases/comdiseases_project_2001_full_en.htm#11) hepatitis A (http://www.europa.eu.int/comm/health/ph_projects/2002/ com_diseases/commdis_2002_16_en.htm) surveillance of outbreaks of foodborne infection in Europe (SOFIE) (http://www.europa.eu.int/comm/health/ph_projects/2002/com_diseases/ commdis_2002_20_en.htm).

Surveillance of emerging pathogens in Europe

69

Apart from the campylobacter project, which has already been reported, the results of the remaining feasibility studies are awaited.

3.3.4 Strengths and weaknesses of the disease-specific networks A feature that the networks share is face-to-face meetings between participants on a regular basis. This has been crucial in building mutual trust. Decisions on developments are arrived at by consensus and, with regard to laboratory methods, the emphasis has usually been on harmonisation rather than requiring that a single system is adopted by all. Enter-net and the FBVE network in particular have both demonstrated that emerging pathogens can be detected quickly, promptly investigated and, consequently, control measures can be implemented speedily. In an outbreak of S. Oranienburg associated with the consumption of chocolate, in which seven European countries reported cases, the implicated product was withdrawn a matter of 12 days after the German Enter-net participants triggered an urgent request to the network (Werber et al., 2002; Fisher et al., 2002; Ethelberg, 2002). This occurred just before Christmas, when failure to have recognised an international outbreak might have had much greater impact and public health consequences. The activities of the networks necessarily extend beyond Europe’s borders. In the outbreak of S. Oranienburg described above, the implicated chocolate product was also found in Canada, Croatia and the Czech Republic. Similarly, in a recent international outbreak of S. Stanley and S. Newport associated with peanuts originating in China and involving countries in four continents, the rapid electronic exchange of epidemiological and molecular data resulted in the swift withdrawal of the contaminated product on a worldwide basis (Kirk et al., 2004). An international outbreak of hepatitis A that originated in Peru was detected through the FBVE (Koopmans et al., 2003). Perhaps the greatest weakness of all the networks is the basis on which they are funded. Those projects funded by DG SANCO are essentially timelimited (up to three years) and there is always the potential for termination or significant reduction of funding after any project round. For those surveillance activities funded on a research basis there are even bigger challenges. Competition for research funding is particularly fierce and a key objective must always be to try to secure a firmer funding base. Fortunately the short-term future looks good for both the FBVE network and Salm-gene. The FBVE network has secured ongoing funding from DG SANCO to continue surveillance, though this will be subject to a time limit. It is anticipated that the strain database from the Salm-gene project will be integrated with the newly-formed Pulse-net Europe network for strains of Salmonella, E. coli O157 and Listeria from both human and veterinary laboratories, which will commence in the near future. A common problem faced by all the European surveillance networks stems from the fact that communicable disease control in Europe has, until recently, been a local affair (MacLehose et al., 2002). Thus interpretation of

70

Emerging foodborne pathogens

data from all the surveillance systems is limited to a greater or lesser extent by the multiplicity of national systems from which they draw their information. Some national surveillance systems are centralised whilst others are federalised. Notifiable or reportable diseases differ from nation to nation. The general consensus is that under-reporting is common, although with few exceptions the extent to which this affects the numerator is not quantified. Another feature which varies by country is the proportion of the population covered by national surveillance systems. National datasets contain varying amounts of information and few employ standard case definitions. These all make it very difficult to draw valid inter-country comparisons. A potential weakness is that the networks are essentially closed, i.e., information is shared freely amongst participants and affiliates but not necessarily more widely. Although public versions of surveillance reports are made available on various websites, these are usually fairly bland and the public profile of these surveillance systems is not, perhaps, as great as it should be. Although the results of outbreak investigations eventually appear in the peer-reviewed literature, this may take many months, during which the rest of the public health community is ignorant of the lessons that have been learned. There is some duplication in that more than one network potentially covers the same diseases. Similarly there are gaps, although some of these might be plugged, depending on the results of various feasibility studies. The BSN provides a minimum dataset on a wide range of conditions, but does not provide a mechanism for the type of public health response that Enter-net or the FBVE network are capable of. Enter-net drills down to provide further detail on the epidemiology of salmonellosis and VTEC. Conversely, without the FBVE network there would be no mechanism for surveillance of the commonest cause of acute gastroenteritis and potentially the commonest cause of foodborne infection in Europe. Finally, the operating efficiency of any surveillance system depends on the timeliness and completeness of reporting. Participants in all the networks continually strive to improve both of these.

3.4 Other sources of data on foodborne pathogens in Europe 3.4.1 EUROCJD and NEUROCJD It is, perhaps, slightly controversial to include the collaborative study of CJD in the European Union in this chapter, although variant Creutzfeldt-Jakob Disease (vCJD) has been linked to exposure, probably through food, to a transmissible spongiform encephalopathy of cattle, namely Bovine Spongiform Encephalopathy (BSE) (Will, 2004). EUROCJD and NEUROCJD are coordinated by the National CJD Surveillance Unit in Edinburgh. The objectives of the EUROCJD network include:

Surveillance of emerging pathogens in Europe ∑ ∑ ∑ ∑

71

documenting the incidence of variant CJD (vCJD) in the EU and analysing potential risk factors for this condition evaluating new diagnostic tests for CJD providing material, including tissue samples, from well documented cases of CJD for other research purposes in the EU developing educational material for relatives of patients and providing information to the general public (See http://www.eurocjd.ed.ac.uk/ EUROINDEX.htm).

The original participants in EUROCJD were from France, Germany, Italy, the Netherlands, Slovakia, Spain and the United Kingdom, followed in 1997 by Austria, Australia, Canada and Switzerland. Subsequently the European Union Council recommended that the epidemiological surveillance of CJD using comparable data should be extended to all Member States. Therefore in 1998 NEUROCJD was funded to include data from Belgium, Denmark, Finland, Greece, Ireland, Norway, Portugal and Sweden. Iceland and Israel also contribute to the scheme. The objectives of NEUROCJD comprise: ∑ ∑ ∑ ∑

establishing agreed clinicopathological criteria for the classification of classical CJD and variant CJD (vCJD) harmonising methods of data collection and analysis and agreeing a minimal data set analysing risk factors for vCJD including past medical history, occupation and diet providing information on the epidemiological characteristics of CJD in the European Union (See http://www.eurocjd.ed.ac.uk/neuroindex.html).

Table 3.4 shows the deaths from vCJD reported to both these projects up to the end of December 2004. Deaths in the United Kingdom far outnumber those elsewhere.

3.4.2 Trends and sources of zoonotic agents in animals, feedingstuffs, food and man in the European Union The European Commission publishes an annual report on trends and sources of zoonotic agents in animals, feedingstuffs, food and man in the European Union. It is compiled in accordance with Article 5 of Council Directive No 92/117/EEC and it is based on annual reports submitted by the Member States and Norway. The report contains a valuable historical overview of the prevalence of zoonoses in the Community. However, like the WHO reports on foodborne infections and intoxications in Europe, data are not published sufficiently frequently to detect emerging pathogens in real time and enable swift public health action to control their spread.

3.4.3 Reports compiled by national surveillance institutes Individual Member States produce routine surveillance outputs derived from

72

Emerging foodborne pathogens

Table 3.4 Variant Creutzfeldt-Jakob Disease – deaths up to 31 December 2004 Country

Number of vCJD cases (deaths)

Australia Austria Belgium* Canada Denmark* Finland France Germany Greece* Iceland* Ireland* Israel* Italy Netherlands Norway* Portugal* Slovakia Spain Sweden* Switzerland UK

0 0 0 1 0 0 8 0 0 0 1 0 1 0 0 0 0 0 0 0 148

Source: EUROCJD (http://www.eurocjd.ed.ac.uk/vCJD.htm) and *NEUROCJD (http:// www.eurocjd.ed.ac.uk/familialneuro.htm)

their national surveillance systems, which are published on their websites and/or in national surveillance bulletins. Countries like Denmark, Norway and the United Kingdom publish an annual zoonoses report in which data from human and animal sources are collated.

3.5 Challenges for European surveillance of emerging foodborne pathogens In May 2004 the European Union grew from 15 Member States to 25. The free movement of goods and people is now over a much wider geographical area. The European surveillance networks are responding by embracing participants from the ten new Member States. These new participants might well need help in making sure that their national surveillance infrastructure can fulfil the information needs of the European surveillance networks. When disease-specific networks were being formed it was envisaged that communicable disease surveillance in Europe would be on a networked basis rather than on a centralised basis (Giesecke and Weinberg, 1998). Initially the former view prevailed and a network for the epidemiological

Surveillance of emerging pathogens in Europe

73

surveillance and control of communicable diseases in the Community was established (Giesecke and Weinberg, 1998). With the passage of time, however, proposals for a European Centre for Disease Prevention and Control (ECDC) have been developed and the ECDC opened in Stockholm in 2005 (Eurosurveillance, 2003, 2004). It is envisaged that the Centre will have a relatively small core staff but it will enable Europe to co-ordinate and mobilise its considerable disease control expertise efficiently and systematically, and improve effective communication to national governments and public health authorities (Eurosurveillance, 2004). A key task will be to harness the expertise and build on the good working relationships in existing Europe-wide dedicated surveillance networks and infrastructure projects without de-stabilising them. Perhaps the creation of the ECDC will afford the possibility to review how the networks are funded, securing ongoing funding for this vital part of the public health armamentarium. The networks also need to build strong scientific and political links with the European Food Safety Authority (EFSA). The EFSA has been operational since 2003. It is now based in Italy and its remit includes: ∑ ∑ ∑ ∑ ∑ ∑ ∑

provision of independent scientific advice to support EU action on food safety, including all stages of food production and supply scientific evaluation of risks to the food chain, and any matter that may have a direct or indirect effect on the safety of the food supply collection, analysis, and exchange of scientific data through networks safety evaluations of dossiers put forward by industry for EU level approval of substances or processes identification of emerging risks scientific support to the Commission, particularly in the case of a food safety crisis direct communication to the public on issues coming within its responsibility (Reid, 2002).

The EFSA will clearly have a keen interest in surveillance data already collected via the disease-specific networks.

3.6

Conclusion

A variety of European surveillance systems exists for capturing information on foodborne pathogens, including emerging pathogens. Many of these systems are passive and tell public health practitioners what has happened. Where Enter-net and the FBVE network have really succeeded is in being able to alert them to what is happening sufficiently quickly to enable timely public health intervention. This is, after all, the whole point!

74

3.7

Emerging foodborne pathogens

Acknowledgements

We should like to thank Cristina Tirado, Marion Koopmans, John Threlfall and Yasmine Motarjemi for helpful comments on the manuscript.

3.8

References

ATKINSON P, MAGUIRE H.

1998. Is food poisoning a clinical or a laboratory diagnosis? A survey of local authority practices in the south Thames region. Commun Dis Public Health 1(3): 161–4. BARTLETT CL. 1998. The challenge of infectious diseases; the European perspective. Surveillance. Neth J Med 52: 267–70. BORGDORFF MW, MOTARJEMI Y. 2003. Surveillance of foodborne diseases: what are the options? World Health Stat Q 50(1–2): 12–23. CROOK PD, AGUILERA JF, THRELFALL EJ, O’BRIEN SJ, SIGMUNDSDOTTIR G, WILSON D et al. 2003. A European outbreak of Salmonella enterica serotype Typhimurium definitive phage type 204b in 2000. Clin Microbiol Infect 9: 839–45. DE WIT MA, KOOPMANS MP, KORTBEEK et al. 2001. Sensor, a population-based cohort study on gastroenteritis in the Netherlands: incidence and etiology. Am J Epidemiol 154(7): 666–74. ETHELBERG S. 2002. International outbreak of Salmonella Oranienburg, October–December 2001, Part 2: Denmark. Eurosurveillance Weekly 6: 020117. EUROSURVEILLANCE. 2003. Commission adopts proposal to create European Centre for Disease Prevention and Control. Eurosurveillance Weekly 7(30): 24/07/2003. (http:// www.eurosurveillance.org/ew/2003/030724.asp) EUROSURVEILLANCE. 2004. European Parliament vote backs European Centre for Disease Prevention and Control (ECDC). Eurosurveillance Weekly 8(7): 12/02/2004. (http:// www.eurosurveillance.org/ew/2004/040212.asp) FARRINGTON CP, ANDREWS NJ, BEALE AD, CATCHPOLE MA. 1996. A statistical algorithm for the early detection of outbreaks of infectious disease. J R Statist Soc A 159: Pt 3: 547–63. FISHER IS. 1995. Salm-Net: a network for human salmonella surveillance in Europe. Euro Surveill; Sep: 7–8. FISHER IS. 1999. The Enter-net international surveillance network – how it works. Euro Surveill; 4: 52–55. FISHER I, CROWCROFT N. 1998. Enter-net/EPIET investigation into the multinational cluster of Salmonella livingstone. Eurosurveillance Weekly 1: 980115. FISHER IS, GILL ON. 2001. International surveillance networks and principles of collaboration. Euro Surveill 6: 17–21. FISHER IST, DE JONG B, VAN PELT W, ARAMINI J, BERGHOLD C, MATTHYS F, et al. 2002. International outbreak of S. Oranienburg, October–December 2001, Part 3: other countries. Eurosurveillance Weekly 6: 020117. GATTO AJ, PETERS T, MAGUIRE C et al. 2004. Distribution of pulsed-field profile sub-types of S. Enteritidis and S. Typhimurium in nine European Countries, 2000–2003. Abstracts of the International Conference on Emerging Infectious Diseases, Atlanta, USA, March 2004, p 60. GIESECKE J, WEINBERG J. 1998. A European Centre for Infectious Disease? Lancet 352: 1308. HASTINGS L, BURNENS A, DE JONG B, WARD L, FISHER I, STUART J et al. 1996. Salm-Net facilitates collaborative investigation of an outbreak of Salmonella tosamanga infection in Europe. Commun Dis Rep CDR Rev 6: R100–2. HERIKSTAD H, MOTARJEMI Y, TAUXE RV. 2002. Salmonella surveillance: a global survey of public health serotyping. Epidemiol Infect. 29(1): 1–8.

Surveillance of emerging pathogens in Europe KILLALEA D, WARD LR, ROBERTS D, DE LOUVOIS J, SUFI F, STUART JM

75

et al. 1996. International epidemiological and microbiological study of outbreak of Salmonella agona infection from a ready to eat savoury snack–I: England and Wales and the United States. BMJ 313: 1105–7. KIRK MD, LITTLE CL, LEM M, FYFE M, GENOBILE D, TAN A et al. 2004. An outbreak due to peanuts in their shell caused by Salmonella enterica serotypes Stanley and Newport– sharing molecular information to solve international outbreaks. Epidemiol Infect 132: 571–7. KOOPMANS M, VENEMA H, HEERSMA H, VAN STRIEN E, VAN DUYNHOVEN Y, BROWN D et al. Early identification of common-source foodborne outbreaks in Europe. 2003. Emerg Infect Dis 9: 1136–42. LINDSAY EA, LAWSON AJ, WALKER RA, WARD LR, SMITH HR, SCOTT FW et al. 2002. Role of electronic data exchange in an international outbreak caused by Salmonella enterica serotype Typhimurium DT204b. Emerg Infect Dis 8: 732–4. LOPMAN B, VAN DUYNHOVEN Y, HANON FX, REACHER M, KOOPMANS M, BROWN D et al. 2002. Laboratory capability in Europe for foodborne viruses. Euro Surveill 7: 61–5. LOPMAN BA, REACHER MH, VAN DUIJNHOVEN Y, HANON FX, BROWN D, KOOPMANS M. 2003. Viral gastroenteritis outbreaks in Europe, 1995–2000. Emerg Infect Dis 9: 90–6. LOPMAN B, VENNEMA H, KOHLI E, POTHIER P, SANCHEZ A, NEGREDO A et al. 2004. Increase in viral gastroenteritis outbreaks in Europe and epidemic spread of new norovirus variant. Lancet 363: 682–8. MACLEHOSE L, MCKEE M, WEINBERG J. 2002. Responding to the Challenge of Communicable Disease in Europe. Science 295; 2047–50. PETERS TM, MAGUIRE C, THRELFALL EJ, FISHER IS, GILL N, GATTO AJ; SALM-GENE PROJECT. 2003. The Salm-gene project – a European collaboration for DNA fingerprinting for foodrelated salmonellosis. Euro Surveill 8: 46–50. PETERSEN A, AARESTRUP FM, ANGULO FJ, WONG S, STOHR K, WEGENER HC. 2002. WHO global salm-surv external quality assurance system (EQAS): an important step toward improving the quality of Salmonella serotyping and antimicrobial susceptibility testing worldwide. Microb Drug Resist 8: 345–53. REID F. 2002. European Food Safety Authority becomes a reality. Eurosurveillance Weekly 6: 020207. SHOHAT T, GREEN MS, MEROM D, GILL ON, REISFELD A, MATAS A et al. 1996. International epidemiological and microbiological study of outbreak of Salmonella agona infection from a ready to eat savoury snack–II: Israel. BMJ 313: 1107–9. SIMMONS G, WHITTAKER R, BOYLE K, MORRIS AJ, UPTON A, CALDER L. 2002. Could laboratorybased notification improve the control of foodborne illness in New Zealand? N Z Med J. 115(1154): 237–40. SWAMINATHAN B, BARRETT TJ, HUNTER SB, TAUXE RV; CDC PULSENET TASK FORCE. 2001. PulseNet: the molecular subtyping network for foodborne bacterial disease surveillance, United States. Emerg Infect Dis 7: 382–9. TAKKINEN J, AMMON A, ROBSTAD O, BREUER T; CAMPYLOBACTER WORKING GROUP. 2003. European survey on Campylobacter surveillance and diagnosis 2001. Euro Surveill 8: 207–13. TERNHAG A, TEGNELL A, LESKO B, SKAERLUND K, PENTTINEN P. 2004. Basic Surveillance Network, a European database for surveillance data on infectious diseases. Euro Surveill 9: 1– 2. THRELFALL EJ, HAMPTON MD, WARD LR, ROWE B. 1996. Application of pulsed-field gel electrophoresis to an international outbreak of Salmonella agona. Emerg Infect Dis 2: 130–132. THRELFALL EJ, FISHER IS, WARD LR, TSCHAPE H, GERNER-SMIDT P. 1999. Harmonization of antibiotic susceptibility testing for Salmonella: results of a study by 18 national reference laboratories within the European Union-funded Enter-net group. Microb Drug Resist 5: 195–200. THRELFALL EJ, FISHER IS, BERGHOLD C, GERNER-SMIDT P, TSCHAPE H, CORMICAN M et al. 2003a.

76

Emerging foodborne pathogens

Antimicrobial drug resistance in isolates of Salmonella enterica from cases of salmonellosis in humans in Europe in 2000: results of international multi-centre surveillance. Euro Surveill 8: 41–5. THRELFALL EJ, FISHER IST, BERGHOLD C, GERNER-SMIDT P, TSCHÄPE H, CORMICAN, M, et al. 2003b. Trends in antimicrobial drug resistance in Salmonella enterica serotypes Typhi and Paratyphi A isolated in Europe, 1999–2001. International Journal of Antimicrobial Agents 22, 487–491. TIRADO C, SCHMIDT K. 2001. WHO surveillance programme for control of foodborne infections and intoxications: preliminary results and trends across greater Europe. J Infect 43: 80–84. VAILLANT V, HAEGHEBAERT S, DESENCLOS JC, BOUVET P, GRIMONT F, GRIMONT PA et al. Outbreak of Salmonella dublin infection in France, November–December 1995. Euro Surveill 1996; 1: 9–10. VINJÉ J, VENNEMA H, MAUNULA L, VON BONSDORFF CH, HOEHNE M, SCHREIER E et al. 2003. International collaborative study to compare reverse transcriptase PCR assays for detection and genotyping of noroviruses. J Clin Microbiol 41: 1423–33. WALL PG, DE LOUVOIS J, GILBERT RJ, ROWE B. 1996. Food poisoning: notifications, laboratory reports, and outbreaks – where do the statistics come from and what do they mean? Commun Dis Rep CDR Rev. 6(7): R93–100. WERBER D, AMMON A, FEIL F, DREESMAN J, VAN TREECK, U, FELL G, et al. 2002. International outbreak of Salmonella Oranienburg, October–December 2001, Part 1: Germany. Eurosurveillance Weekly 6: 020117. WHEELER JG, SETHI D, COWDEN JM et al. 1999. Study of infectious intestinal disease in England: rates in the community, presenting to general practice, and reported to national surveillance. The Infectious Intestinal Disease Study Executive. BMJ 318(7190): 1046– 50. WHO REGIONAL OFFICE FOR EUROPE. 2003. Several foodborne diseases are increasing in Europe: WHO’s ‘five keys to safer food’ for winter holidays. Press release EURO/16/ 03. Available at http://www.euro.who.int/eprise/main/who/mediacentre/PR/2003/ 20031212_2 WILL R. 2004. Variant Creutzfeldt-Jakob disease. Folia Neuropathol 42 Suppl A:77–83. WORLD HEALTH ORGANIZATION. 2004. International Health Regulations: Working paper for regional consultations. Available at http://www.who.int/csr/resources/publications/ IGWG_IHR_WP12_03-en.pdf

Tracking emerging pathogens: the case of noroviruses 77

4 Tracking emerging pathogens: the case of noroviruses E. Duizer and M. Koopmans, National Institute for Public Health and the Environment (RIVM), The Netherlands

4.1

Introduction

Viruses are increasingly recognised as pathogens involved in foodborne infections. One of the reasons for this increased awareness is the improved laboratory capability to detect the groups of viruses causing gastroenteritis, the most common foodborne illness worldwide. Only ten years ago, over 90% of community cases and outbreaks of gastroenteritis went without diagnosis in The Netherlands. Within a decade this proportion of unknowns was reduced to 54% and less than 20% for population or outbreak studies respectively (de Wit et al., 2001a; van Duynhoven et al., 2005). These improvements resulted largely from the recognition of noroviruses (NoVs, formerly known as Norwalk like viruses or small round structured viruses) as the single most important cause of gastroenteritis both in community cases and outbreaks. Data from epidemiological studies, outbreak reports, and (international) surveillance are building the case for the role of foodand waterborne transmission in the epidemiology of these viruses. The increased national and international surveillance activities have shown that viruses are not only more often detected than in the past but have also recognised that several new virus strains have been truly emerging. International outbreaks of gastrointestinal illness have been caused by NoV strains, which have evolved by recombination or genetic drift. While other viruses, such as hepatitis A and hepatitis E viruses, astroviruses, rotaviruses, enteric adenoviruses, and some enteroviruses (Seymour and Appleton, 2001; Koopmans and Duizer, 2004) can be foodborne, this chapter will deal mainly with the NoVs. It should be noted, however, that what we have learned from these nowadays easily recognised pathogens, may be true for several other

78

Emerging foodborne pathogens

structurally similar viruses, some of which cause more serious diseases. Some of these concerns will be discussed in Section 4.7.

4.1.1 The noroviruses Viruses are unique in nature. They are the smallest of all self-replicating organisms, historically characterised by their ability to pass through filters that retain even the smallest bacteria. In their most basic form, viruses consist solely of a small segment of nucleic acid encased in a simple protein shell. They have no metabolism of their own but rather are obliged to invade cells and parasitize subcellular machinery, subverting it to their own purposes. Many have argued that viruses are not even living, although to a seasoned virologist they exhibit a life as robust as any other creature. (Condit, R. C. Principles of Virology, in Fields Virology (2001), with permission.) This definition naturally covers the NoV and is a good starting point for consideration of viruses in matters of food safety. NoV are human enteric caliciviruses. The family Caliciviridae belongs to the picornavirus-like superfamily; small, RNA viruses without an envelope. The calicivirus particles (virions) measure between 27 and 38 nm and consist of a spherical protein shell and a genome of a single strand of approximately 7.6 kb positive sense RNA. The caliciviruses known to infect humans belong to two genera: the genus Norovirus and the genus Sapovirus (SaV, formerly known as Sapporo Like Viruses, or typical caliciviruses). In addition, the family holds two genera of animal viruses, named Vesivirus and Lagovirus (Green et al., 2001). A recently detected bovine calicivirus may be assigned to a fifth genus (Smiley et al., 2003). The genus NoV is further subdivided into an increasing number of poorly defined genogroups (Karst et al., 2003). Each genogroup can be subdivided in several genotypes, defined by >80% amino acid homology across the capsid gene, and over 15 genotypes are characterised at the moment (Koopmans et al., 2003). The NoV are officially denoted by the following cryptogram: host species/genus abbreviation/species abbreviation (i.e. genogroup)/strain designation/year of detection/country of origin. For NoVs the strain designation is the location where the strain was first detected, for example: Hu/NV/GGI/Norwalk Virus/1968/US, Hu/NV/GGI/Southampton virus/1991/UK, Hu/NV/GGII/Hawaii virus/1971/US and Hu/NV/GGII /Bristol/ 1993/UK (Green et al., 2001). Even though in vitro culture systems are not yet available for the NoV (Duizer et al., 2004b), a considerable quantity of data has been obtained on the structure of the genome and the capsid of these viruses. The NoV genome is organised into a 5’untranslated region (UTR), the open reading frames (ORF) 1, 2, and 3, a 3’UTR and a poly A tail. ORF1 encodes the nonstructural proteins necessary for virus replication. The major structural protein (VP1) is coded on ORF2, whereas ORF 3 encodes a minor structural protein (VP2) (Glass et al., 2000; Bertolotti-Ciarlet et al., 2003). Altogether the

Tracking emerging pathogens: the case of noroviruses 79 virion consists of a capsid of 180 copies of VP1 and a small number of VP2, and the single stranded RNA genome which is possibly covalently linked to the capsid by a VPg protein (Green et al., 2001). Being such small and ‘simple’ organisms, with a small genome, viruses rely to a great extent on the enzymes in the host cell they invade to undergo their replicative cycle. Unlike bacteria, viruses are obligate intracellular parasites. Many viruses, including the human enteric caliciviruses, have a narrow species- and tissue tropism, i.e., efficient replication of the human NoVs occurs only in the gastrointestinal tract of humans. Replication in other human tissues has not been detected, and even though NoV genotypes were found in cattle (e.g. bovine Jenavirus, GGI) and pigs (e.g. porcine enteric calicivirus, GGII), none of these animal genotypes have ever been detected in human patients.

4.1.2 Symptoms of a calicivirus infection The NoV are the major causative agents of classical viral gastroenteritis in all age groups (De Wit et al., 2001a). After a short incubation period of 12– 48 hours, the disease is characterised by an acute onset of symptoms as (nonbloody) diarrhoea, vomiting, (low-grade) fever, nausea, chills, weakness, myalgia, headache and abdominal pain. Hence, the illness is referred to as ‘gastric or stomach flu’. The attack rate of NoVs is typically around 45% or higher, but this differs with virus genotype and is also dependent on the host’s genetic susceptibility. Most notable is the usually sudden onset of projectile vomiting, resulting in efficient spreading of viruses. Although patients do, in general, feel acutely ill, and dehydration can be severe, the illness is rarely fatal and subsides on average after two to six days, with the longest duration of illness in children (Rockx et al., 2002). A typical NoV infection is self-limiting and treatment focuses on supportive care and prevention and treatment of dehydration. No antiviral treatment has been found to be effective in treating NoV infection and no vaccine is available yet, although clinical trials with recombinant vaccines based on the capsid protein of NoV are in progress. For the NoV and SaV no long-term sequellae have been reported, but the duration of the infectious period might have been underestimated. Recently it was found that shedding of NoV lasted at least a week, but continued for three weeks in 26% of the patients (Rockx et al., 2002). In immunocompromised persons, chronic infection may develop with persistent diarrhoea and long-term shedding (Nilsson et al., 2003; Gallimore et al., 2004b). Immune response and genetic susceptibility Infected individuals do develop short-term immunity to homologous virus (up to 14 weeks), but the existence or development of long-term immunity to NoV is still elusive (Matsui and Greenberg, 2000). Pre-existing antibodies do not always correlate with protection from infection, and insight into the

80

Emerging foodborne pathogens

correlation between NoV genotypes and serotypes is only just beginning to develop. Serum IgG, IgA and IgM responses are observed after infection with NoV and common epitopes within genogroups and between genogroups have been identified (Erdmann et al., 1989a and b; Gray et al., 1994; Treanor et al., 1993; Hale et al., 2000; Yoda et al., 2000; Harrington et al., 2002; Kitamoto et al., 2002). However, there are contradictory data on the level of cross-reactivity after NoV infections in humans. It has been shown that the specificity of the immune response varies greatly within genogroups but nevertheless, other studies have observed cross reactivity between viruses belonging to different GGs (Farkas et al., 2003; Madore et al., 1990; Treanor et al., 1993). Recent studies show that sensitivity to NoV infection is dependent on ABH-histo-bloodgroup antigens (carbohydrates), Lewis antigens and secretor status (Hutson et al., 2002; Marionneau et al., 2002; Huang et al., 2003; Harrington et al., 2004; Rockx et al., 2005) and that the genetically determined susceptibility is different for different genotypes. For example, bloodgroup B, and non-secretor status confer protection to infection by Norwalk virus, bloodgroup A confers protection to infection by Snow Mountain virus, while none of the bloodgroups offers protection to infection with GGII.4 viruses (reviewed by Hutson et al., 2004). These studies also suggest that the susceptibility to NoV infection is related to specific carbohydration of the host receptor, and that NoV binding can be inhibited by the specific carbohydrates in solution. These findings may lead to the development of (strain specific) antiviral treatments. Research into the genetic susceptibility is booming at the moment and insight may develop and change over time.

4.1.3 Epidemiology of viral gastroenteritis and examples of viral foodborne outbreaks The NoVs are transmitted by the faecal-oral route; they are shed in vomitus and faeces and enter their next victim orally. In persons with clinical illness, viruses typically are detected in stools at levels far exceeding 106 virus particles/ml (the titers for vomit are not known). Since the minimal infectious dose of the NoVs is believed to be very low (between 1–10 particles), and immunity short-lived, introduction of NoV in a population easily leads to an outbreak, affecting many people. Even though the attack rate is rather high, asymptomatic infections are quite common. For example, in a community study in the Netherlands, evidence of virus shedding was found in 5.2% of controls, i.e., persons without gastrointestinal complaints (de Wit et al., 2001a) and in 19% of people without gastrointestinal illness in an outbreak setting (Vinje et al., 1997). The efficient spread of viruses by (projectile) vomiting, the prolonged shedding in faeces after recovery from illness, and the shedding of viruses from asymptomatic carriers are important factors contributing to the impressive numbers of NoV infections.

Tracking emerging pathogens: the case of noroviruses 81 Burden of disease studies Few studies have looked at the incidence and health impact of NoV infection at the community level. The most extensive data are from the UK (Tompkins et al., 1999; Wheeler et al., 1999) and The Netherlands, where a randomised sample of the community participated in cohort studies of infectious intestinal disease (IID). The incidence of community-acquired IID was calculated as 190 per 1000 person years in the UK and 283 per 1000 person years in The Netherlands (Tompkins et al., 1999; de Wit et al., 2001a). Viruses were the most frequently identified causes of community acquired gastroenteritis, with NoV detected in 11% of cases in The Netherlands and 7% in the UK. This difference may partly result from the different methods used for virus detection: de Wit et al. used RT-PCR whereas the study in the UK employed the far less sensitive electron microscopy. In both studies, the referral of patients to a general practitioner was studied as well. Approximately 5% of cases in The Netherlands sought treatment, compared with 4% of cases in Wales and 17% in England. The physicianbased patient group was younger, and had more severe symptoms and longer duration of illness (de Wit et al., 2001b). Some 5% of physician-based cases were NoV positive in The Netherlands, and 6.5% in the UK. The lower proportion of NoV disease in this study population compared with the community cases confirms that on average NoV illness is relatively mild. The financial consequences of this mild disease can, however, be serious; cost estimates related to NoV infections for the Netherlands showed that 13% (i.e. 7 46 million) of costs for gastroenteritis were due to NoV infections alone (van den Brandhof et al., 2004). Smaller studies in selected patient populations have been conducted elsewhere, and show that NoV are known to occur as a prominent cause of illness in countries throughout Europe, the USA, Australia, Hong Kong and Japan (Fankhauser et al., 1998, 2002; Lopman et al., 2002, 2003, 2004; Marshall et al., 2003; Lau et al., 2004; Iritani et al., 2002, 2003). Additionally, evidence is mounting that the disease may be common in countries with different degrees of development across the world, with studies from, for example, Hungary, Argentina, Brazil, Pakistan and India (Farkas et al., 2002; Reuter et al., 2003; Martinez et al., 2002; Parks et al., 1999; Gallimore et al., 2004a; Phan et al., 2004; Girish et al., 2002). NoV infection is common in all age groups but the incidence is highest in young children (<5 yrs). Outbreak studies Probably the best known presentation of NoV is that of large outbreaks of vomiting and diarrhoea that lend the disease the initial description of ‘winter vomiting disease’ (Zahorsky, 1929; Mounts et al., 2000). Since the development of molecular detection methods NoV have emerged as the most important cause of outbreaks of gastroenteritis in institutional settings (i.e. hospitals, nursing homes). The majority of NoV gastroenteritis cases results from direct person-to-person transmission. However, NoV-related outbreaks have been

82

Emerging foodborne pathogens

shown to be food- or waterborne caused by, for example, contaminated shellfish (Doyle et al., 2004; Kingsley et al., 2002a; Le Guyader et al., 2003), raspberries (Ponka et al., 1999) or drinking water (Carrique-Mas et al., 2003; Kukkula et al., 1999; Parshionikar et al., 2003). Additionally, environmental spread of NoV was found, for instance by contaminated carpets in hotels (Cheesbrough et al., 2000), toilet seats and door handles in a rehabilitation centre (Kuusi et al., 2002), and contaminated fomites on hard surfaces, carpets and soft furnishings in a concert hall (Evans et al., 2002). In The Netherlands, approximately 12–15% of community cases of NoV gastroenteritis was attributed to foodborne transmission, based on analysis of questionnaire data. This makes NoV as common a cause of foodborne gastroenteritis as Campylobacter, and more common than Salmonella (de Wit et al., 2003). Outbreaks are quite often a result of a combination of several transmission routes, for example introduction of the virus in a sensitive population by food, water or an asymptomatic shedder, followed by efficient spread of the virus through the susceptible population by direct person-to-person transmission. Large food- or waterborne outbreaks due to a common (point) source introduction are less common than multiple transmission routes outbreaks, but they do occur (see, for example, Cannon et al., 1991; Kohn et al., 1995; Daniels et al., 2000; Girish et al., 2002). Several waterborne outbreaks have been reported as a result of contaminated private wells or communal water systems in Sweden (Carrique-Mas et al., 2003; Nygard et al., 2003), municipal water in Finland (Kukkula et al., 1999), and well water in Wyoming USA (Anderson et al., 2003). Interestingly, no signs of faecal contamination by testing for indicator bacteria were found by Carrique-Mas and co-workers (Carrique-Mas et al., 2003). Foods can be contaminated with NoV anywhere along the food chain from farm to fork. Wherever a NoV carrier comes in contact with food, contamination might occur and due to stability of these pathogens, they are likely to survive many food processes (see Section 4.6; Koopmans and Duizer, 2004). When viral contamination occurs through a person touching food, the contamination will be localised in spots (focally). Infections caused by focally contaminated foodstuffs are most likely to be recognised as foodborne when the contamination has occurred at the end of the food chain. Two reported examples show the characteristics of such outbreaks. One report from Sweden describes the large-scale outbreak detected in 30-day care centres in the Stockholm area in March 1999. All centres obtained their lunch meals from one caterer, and approximately 25% of all customers (n = 1500 customers) fell ill. The early cases had an average incubation time of 34 hours but the outbreak went on for at least 12 days, due to secondary infections. One of the food handlers fell ill in the same time window as the early cases and none of the other food handlers reported symptoms. This implies that the most likely route of food contamination was by a pre- or asymptomatic food handler (Gotz, 2002).

Tracking emerging pathogens: the case of noroviruses 83 Another large point-source foodborne outbreak occurred in the Netherlands in January 2001. A baker who had been sick with vomiting the previous day had prepared the rolls for the buffet lunch at a New Year’s reception. Within 50 hours after the reception, over 200 people had reported ill with gastrointestinal symptoms. Epidemiological and microbiological investigations indicated the rolls as point source of this outbreak with a total of 231 people sick with diarrhoea and vomiting (de Wit et al., in press). It was noted that the baker was still ill during preparation of the rolls and that he vomited in the sink. Cleaning the sink with chlorine did not prevent the outbreak. It is probable that the spread of infectious viruses by vomiting was not restricted to the sink or the cleaning method used was not stringent enough to decontaminate the sink of these resistant viruses. In many outbreaks, however, the seeding event is not recognised. This can be on two levels; (i) the route of introduction of the NoV to the affected population is unknown, or (ii) the vehicle of introduction is known but it is unclear how and when that vehicle (vector) was contaminated. Resolving the transmission routes and vectors involved in such outbreaks is the challenge for viral food safety, now and in the near future.

4.2

Detection

To date, laboratory diagnosis of NoV is based on molecular biological techniques and electron microscopy (EM). Both techniques are based on the detection of the pathogen in stool samples, rather than on measuring an immune response of the host to pathogen. EM is a ‘catch all’ method, which allows detection of many viruses as well as basic typing of viruses. On the basis of immuno-EM, in which samples are treated with specific antisera, NoV antigenic types have been defined which correlate with the genotypes established following later genomic characterisation (Lewis, 1990; Green et al., 1995). EM is, however, quite insensitive (detection limit of 105 to 106 particles per gram stool), and requires specialised equipment and highly skilled personnel. Presently, molecular biological techniques (RT-PCR) are used to detect the viral genome (nucleic acid, RNA in NoVs), and since they can be very sensitive and allow for typing to strain level, this is the method of choice. In addition, some antigen detection based methods (ELISA, EIA) are gaining popularity. These assays have the advantage of simplicity, and many samples can be screened fast. However, the currently available EIAs are less sensitive than RT-PCR methods (Rabenau et al., 2003; Richards et al., 2003; BurtonMacleod et al., 2004). Unfortunately, no culture method is available, significantly hampering studies of the infectivity of the detected viruses. 4.2.1 Viral gastroenteritis: the Kaplan criteria Since the discovery of Norwalk virus (the prototype strain of the NoV) by

84

Emerging foodborne pathogens

Kapikian in 1972 using immune electron microscopy (Kapikian et al., 1972), the role of these viruses in acute gastroenteritis was becoming more clear every year. In a thorough investigation of the role of Norwalk virus in outbreaks of acute nonbacterial gastroenteritis in 1982, Kaplan and co-workers distilled a set of common features of viral gastroenteritis outbreaks. This set of criteria is now known as the Kaplan criteria and may be used as an epidemiological tool to diagnose outbreaks as caused by NoV (Kaplan et al., 1982; Hedberg and Osterholm, 1993; Lopman et al., 2002; Koopmans et al., 2002). The Kaplan criteria used to ascribe gastroenteritis outbreaks to a NoV infection are as follows: ∑ ∑ ∑ ∑ ∑

stools negative for bacterial and parasitic pathogens proportion of cases with vomiting > 50% mean duration of illness 12–60 hours mean incubation period 24–48 hours high attack rate and high number of secondary cases.

It is clear that this method does not allow for virus typing, detailed epidemiological studies or single patient diagnostics. However, for countries without laboratory capacity for NoV diagnosis, the use of Kaplan criteria may give a first indication of the proportion of outbreaks that are likely to be viral.

4.2.2 Detection and typing in patients: RT-PCR and ELISA Even though there is no real treatment for noroviral gastroenteritis, quick laboratory diagnosis can help control the spread of the disease and prevent the ineffective use of antibiotics. Currently the method of choice for the diagnosis of NoV infection is the molecular biological technique called reverse transcription polymerase chain reaction (RT-PCR). This method is based on the detection of viral nucleic acid in faecal samples. The high sensitivity of this method (detection limit of 10–100 viral particles per gram stool) is one of its major advantages. Another advantage is that – theoretically – it can be applied to all kinds of substrates such as faeces, vomitus, serum, foodmatrices and water. A RT-PCR protocol involves, in short, three stages: 1. RNA extraction from the matrix: the viral RNA has to be released from the capsid and the resulting RNA suspension should be cleared from RTPCR inhibitors, (RNases and DNases). The RNA extraction step forms the most crucial difference between methods for virus detection in food, water or environmental samples and clinical specimens. The importance of this step will be discussed in greater detail in section 4.2.3. 2. The RT and PCR steps, in which a fragment of the viral RNA genome is transcribed into DNA and then amplified. 3. Confirmation of the RT-PCR product to rule out false positive results and to type the amplified fragment.

Tracking emerging pathogens: the case of noroviruses 85 The optimisation of stages 2 and 3 of this method have been hampered by the high genetic diversity of the NoV. At present, several protocols are used which have been developed for the detection of a broad range of virus strains but still, no single primer pair can detect all NoV strains (reviewed by Atmar and Estes, 2001). Additionally, generic tests are optimised for the detection of a broad range of viruses, not for the specific and more sensitive detection of one strain (Vennema et al., 2002). While this may be appropriate for patient diagnostics (where high levels of virus are shed in the stool samples), virus detection in environmental samples, food or water requires highly optimised assays with low detection limits. This is not compatible with broad range detection. The most frequently used diagnostic RT-PCR protocols amplify either a part of the gene for the RNA-dependent RNA polymerase (RdRp), located near the 5¢ site of ORF1 of the NoV genome, or a region at the 5¢- end of capsid protein encoding ORF2. Both parts were shown to be conserved enough for the development of primer sets able to detect a range of viruses (generic test), yet variable enough for strain typing (Vennema et al., 2002; Vinje et al., 2004). Others have suggested amplifying other parts of the genome, for example a region at the 3¢- end of ORF1 (Fankhauser et al., 2002) or a region at the 3¢- end of ORF2 (Vinje et al., 2004). However (as will be explained in detail in Section 4.3 of this chapter) for detection, typing and research on transmission routes, harmonisation of methods is urgently needed. Therefore a continuous changing to different genome regions for typing should not be encouraged. The typing of NoV is very important for studies of the transmission routes, and, for example, to establish common source outbreaks (Koopmans et al., 2003). Several typing methods have been described (reviewed by Atmar and Estes, 2001) but the most relevant for virus tracking is the most elaborate; sequencing of the amplified genome fragment. Sequence data and phylogenetic analysis of the RdRp fragment and a fragment of the gene coding for the capsid protein (ORF2) have revealed that recombinant NoV strains have evolved, and thus that analysis of more than one region of the NoV genome may be important (Vinje et al., 2003; Atmar and Estes, 2001). An interesting method for typing of recombinants is described by Kageyama et al. (2003), who suggest amplification of the ORF1-ORF2 junction region, a fragment overlapping the RdRp and capsid gene. In that way, sequencing of just one fragment should suffice to type the strain and to discriminate between recombinants and ‘old’ strains. However, this will apply only when the recombination event has occurred in the junction region. There is at this time not enough information available to assume the junction region is the only recombination site. Recent developments in molecular biology techniques have yielded several new diagnostic tests. One is the development of real-time RT-PCR methods, which are faster than the original RT-PCR protocols, mainly due to the fact that the RT-PCR and confirmation stages are incorporated in one step (Richards

86

Emerging foodborne pathogens

et al., 2004; Kageyama et al., 2003). Another new method is the nucleic acid sequence based amplification (NASBA) technique which, in theory, should be simpler to perform and at least as sensitive as the RT-PCR (Jean et al., 2003; Moore et al., 2004). However, validation of these newer tests is still incomplete, rendering the specificity, sensitivity and broadness largely unknown. Whichever genome detection assay is used for virus detection, one should realise that false negative tests are relatively common, due to the great genetic diversity resulting in primer mismatches (Vinje et al., 2003). Therefore, back-up protocols should be used for unexplained outbreaks that do meet the Kaplan criteria. The NoV are not only genetically but also antigenically very diverse with as much as 30% variation in amino acid sequence of the major capsid proteins within the genogroups and up to 50% between genogroups. This great diversity has hampered the development of broadly reactive diagnostic tests for antigen detection. After it was discovered that expression of the NoV ORF2 by recombinant baculoviruses in insect cells resulted in the self-assembling of the capsid protein into virus like particles (VLPs, Green et al., 1993), many antigen-based detection methods have been developed. The VLPs were first used to detect antibodies to NoV in serum samples (Green et al., 1993; Parker et al., 1993). Later, sera from animals inoculated with VLPs were used to develop enzyme immunoassays (EIAs) for the detection of NoVs in faeces (Jiang et al., 1995; Herrmann et al., 1995). Currently, several EIAs to detect NoV antigens are commercially available (Richards et al., 2003; BurtonMacleod et al., 2004); they are slightly less sensitive than RT-PCR methods, but since the EIAs can be applied by non-specialised laboratories and results can be obtained within 3–4 hours, these assays will be increasingly used to diagnose gastroenteritis outbreaks. The EIAs do not, however, yield information on virus typing, other than possibly the discrimination between GGI and GGII. Therefore, RT-PCR and sequencing of positive outbreaks will still have to be done to gain the information needed for virus tracking and to pinpoint common-source outbreaks.

4.2.3 Detection in foods and water Detection of NoVs in foods and water also relies mostly on RT-PCR methods. Due to the enormous variety in food matrices a considerable challenge for food microbiologists is found in the first stage of the RT-PCR protocol; the extraction of the viral RNA from the matrix. Many studies have focused on method development to extract viral RNA from shellfish, which has resulted in a variety of methods as reviewed by Lees (2000). Common features of these are dissection of the digestive tract and hepatopancreas (Schwab et al., 1998) and subsequent homogenisation, followed by variable (partial) purification and RNA extraction methods. The methods applied are however laborious and specialised and therefore, in general, not available to most routine labs. Other matrices for which virus detection methods have been

Tracking emerging pathogens: the case of noroviruses 87 developed include fresh produce and fruits (Bidawid et al., 2000; Leggitt and Jaykus, 2000; Dubois et al., 2002; Sair et al., 2002; Le Guyader et al., 2004), and hamburgers, ham, turkey and roast beef (Leggitt and Jaykus, 2000; Schwab et al., 2000; Sair et al., 2002). Since foods are often contaminated by an infected food handler, the contamination of food items may be low level and focal. Contamination with irrigation water may result in more diffuse presence of viruses, but primarily at the surface of the produce or product. Therefore most protocols are based on elution of the virus particles from the surface of the product, followed by a concentration step (mostly ultra-centrifugation or -filtration) and RNA extraction from the concentrate (Le Guyader et al., 2004). Recently an immunomagnetic capture method was used to capture (concentrate and purify) NoV from a crude food suspension (Kobayashi et al., 2004). This method at present cannot be generalised because antibodies to NoV are not broadly reactive although some cross-reactivity exists between genotypes within the same genogroup. Further evaluation is needed to see if sufficiently broad reactivity exists. For NoV detection in water a variety of methods is available (Gilgen et al., 1997; Straub et al., 2003; Karim et al., 2004; Haramoto et al., 2004). Here, too, the challenge exists in obtaining concentrates with a detectable level of viral RNA, but a low level of RT-PCR inhibitors. Many protocols are variations on a general method which, in short, entails concentration by adsorption to a filter (e.g. a positively charged membrane, glasswool), subsequent elution from the filter and further concentration using a microconcentrator or precipitation step. But immunoaffinity concentration and purification protocols have been developed for application in water too (Schwab et al., 1996). The difficulties in food safety issues regarding the cumbersome detection of NoVs (or HAV) in shellfish and water is further complicated by the recognition that potential indicators for those viral pathogens, such as bacteria or bacteriophages, may not be as appropriate as was assumed before. For example, the NoV may be present, or persistent, in water or shellfish whereas the indicator organisms are not (Lees, 2000; Formiga-Cruz et al., 2002; Myrmel et al., 2004; Horman et al., 2004). In conclusion, the detection of NoVs in foods is still difficult, due largely to the low level, and focal way of contamination. Therefore, successful (pre-marketing) screening of foods is unlikely to be implemented soon, with the possible exception of shellfish. The generic RT-PCR protocols can, however, be optimised for sensitivedetection of one strain when sequence data for the contaminating strain is already obtained from patient diagnostics (Fig. 4.1). This approach was found to be successful in establishing a contaminated recreational fountain as the source of a gastroenteritis outbreak in schoolchildren by the NoV Birmingham strain (GGI.3) (Hoebe et al., 2004). Thus, for the detection of NoV in suspected foods (foods implicated by epidemiological data), optimised RT-PCR protocols may be used which might help to unambiguously link foods to outbreaks.

88

Emerging foodborne pathogens

Patients: Faeces > 1

RNA isolation >

RT-PCR >

1

Sequencing >

Phylogeny

A T CG M123–M

2

2

Common source?

Optimisation of RT-PCR protocol for virus strain found in patients

1

1

AT CG M123–M

2

2

Foodborne? Food/water > RNA isolation >

RT-PCR >

Sequencing >

Phylogeny

Fig. 4.1 Scheme for foodborne virus tracking. Virus detection in patients and possible vectors such as food or water, to determine common source outbreaks.

While methods have worked reasonably well with artificially contaminated food items, assays applied to suspected food items collected in outbreaks have rarely yielded a positive result. Routine monitoring of foods for bacterial pathogens is itself acknowledged to be an ineffective method of assuring food safety (Motarjemi et al., 1996). The additional practical difficulties in obtaining reliable data for viral contamination mean that routine viral monitoring of foods is very unlikely to become widespread. Next to the problem of obtaining false negative results due to practical difficulties in virus detection in foods and water there is the problem of obtaining false positive results using genome detection by PCR, i.e., the presence of viral RNA does not necessarily indicate the presence of infectious virus (Richards, 1999). Several authors have reported a poor correlation between conventional RT-PCR detection and virus infectivity in a cell culture assay: Slomka and Appleton (1998) and Duizer et al. (2004b) for FeCV after heat treatment or UV irradiation, Lewis et al. (2000) for poliovirus after UV irradiation, and Nuanualsuwan and Cliver (2002) for HAV, poliovirus and FeCV. On the other hand, for hypochlorite inactivation a good correlation was found between RNA detectability and infectivity (Nuanualsuwan and Cliver, 2002; Duizer et al., 2004b) and pretreatment (prior to RT-PCR) of heat or UV inactivated virus suspensions with RNase and proteinase K resulted in an improved correlation between PCR detectability and infectivity

Tracking emerging pathogens: the case of noroviruses 89 (Nuanualsuwan and Cliver, 2002). Recently it was shown that quantification of detectable RNA, by quantification of the RT-PCR signal or by application of quantitative RT-PCR methods, could improve the correlation too (Bhattacharya et al., 2004; Duizer et al., 2004b). However, one must bear in mind that neither PCR, nor EM, nor ELISA are viability or infectivity tests.

4.3

Virus tracking

How should all the information collected so far on the NoVs be combined to get a better understanding of their prevalence, transmission routes, or emergence? It is clear that fundamental knowledge on virus particles, sensitive and specific detection methods for the viruses in patients, foods and environmental samples and epidemiological data are all prerequisites for ‘virus tracking’. Virus tracking is a method aimed to answer questions also posed in standard outbreak investigations such as ‘which virus strain is causing this outbreak, where did it come from and how did it get into the susceptible population?’. Additionally, with virus tracking one strives to answer questions such as ‘how is this strain evolving, and why is it emerging (here and now)?’. Virus tracking is cleverly combining virological and epidemiological data, and adding molecular epidemiology to the formula. Molecular epidemiology has been defined by Janice S. Dorman as ‘a science that focuses on the contribution of potential genetic and environmental risk factors, identified at the molecular level, to the aetiology, distribution and prevention of disease within families and across populations’. Here we will describe how virus tracking of foodborne viruses was done in a European research project conducted by the ‘Foodborne Viruses in Europe (FBVE)’ network (http://www.eufoodborneviruses.net/). When fully operational, this approach will contribute to more rapid and internationally standardised assessment of the spread of foodborne viral pathogens. Mapping these pathways will allow identification of high-risk foods or processing methods, as well as high-risk import/transport routes, which subsequently can be targeted by prevention programmes.

4.3.1 An integrated molecular virological and epidemiological approach to study virus transmission An important aspect of studying diseases internationally is having a platform in place for exchange, collection and sharing of data. Additionally, to understand modes of transmission of viruses, or to recognise a common source outbreak, combining molecular virological data with epidemiological data is essential. Key to this approach is the development of two linked and searchable databases (Fig. 4.2). One database aggregates harmonised epidemiological data, which can be entered in an outbreak investigation form via the Internet. To obtain that goal, a minimum dataset needs to be identified and agreed upon. Relevant

90

Emerging foodborne pathogens Epidemiological data

Virological data

Harmonisation of methods Harmonised clinical definitions Sequencing of consensus PCR fragment – Case of VGE – RNA dependent RNA polymerase – Outbreak of VGE Standard outbreak questionnaire – Etiology – Transmission – Setting – Case information – Diagnostic results – Food vehicles

Development of web-accessible databases

Epidemiological database

Cross reference

www.eufoodbornevirus es.net/asp

Virological sequence database www.RIVM.nl/bnwww

Linked outbreaks Common source Transmission route Food vehicle

Fig. 4.2

Virus tracking: linked and searchable databases.

questions were on the symptoms of the illness, route of transmission, setting of the outbreak, involvement of foods, and the extent of diagnostic evaluation. A web-based questionnaire is an efficient way for collection of information during outbreaks of (viral) gastroenteritis (Koopmans et al., 2003). The other database aggregates virological sequence data, and can be linked with the epidemiological data collection. Sequences can be submitted directly or – ideally – through the web-based outbreak investigation form. It is clear that for matching of sequences all participating labs need to perform RTPCR assays that target the same or at least overlapping parts of the genome. Within the FBVE consortium the partners all used their own favourite PCR protocol for amplification of a part of the RdRp gene. This resulted in several different PCR products. There was, however, a minimal overlap of a 63 nucleotides fragment. In April 2004, the epidemiological and virological

Tracking emerging pathogens: the case of noroviruses 91 database contained 1,969 and 4,173 entries, respectively. Next to the genomic region coding for the RdRp, many sequences of the ORF2, coding for the capsid protein have been collected. Cross reference of these two databases showed that 92% of non-bacterial gastroenteritis outbreaks were associated with NoV. Other enteric viruses detected were astrovirus, hepatitis A virus, rotavirus, and sapovirus. Overall, 10% of outbreaks were reported to be food- or waterborne. These outbreaks were significantly larger than outbreaks attributed to person-to-person transmission. A vehicle was reported in only 37% of outbreaks. In total, 69% of all the NoV outbreaks were associated with just one NoV strain, Grimsby virus. The Grimsby virus belongs to the Genogroup II.4 viruses (GGII.4, reference strain: Hu/NV/GGII/Bristol/1993/UK, other GGII.4 strains are Lordsdale virus and Camberwell virus). The proportion of Grimsby virus was highest in the winter of 2001/2002, when a novel variant Grimsby virus was detected across Europe. The Grimsby viruses were significantly more frequently detected in outbreaks labelled as person-to-person outbreaks than in food- or waterborne outbreaks, and in healthcare settings compared with other settings (FBVE network, unpublished data). In 2002, the emergence of a distinct variant GGII.4 virus made it to the headlines of the public media since this strain caused a tremendous increase in the number of outbreaks in UK hospitals and on international cruises. This event will be described in greater detail in Section 4.3.3.

4.3.2 Molecular epidemiology and virus tracking Molecular epidemiology as it was applied in studies to transmission routes of foodborne viruses is mainly on sequence analysis of (a selected region of) the viral genome. Comparing viral genomes, at the sequence level, from samples that appear epidemiologically linked is the only way to conclusively identify common source outbreaks as such. It is clear that the accuracy of this method is dependent on the length of the fragment, the genome region, and the variation present between the virus strains under investigation. Although NoV are highly variable, and finding identical sequences in food or patient samples from different outbreaks indicates that these may be linked, the data need to be interpreted against a background of population-based data, or – minimally – data from outbreak surveillance. For instance, in the years 1996 and 2002, an epidemic wave of outbreaks occurred over a wide geographic region, in which a single variant NoV belonging to GGII.4 emerged. In these periods, finding identical sequences within the GGII.4 genogroup in different outbreaks meant nothing, other than that it was apparently an outbreak involved in the epidemic. On the other hand, in the same years, having identical sequences belonging to any of the other genotypes provided strong evidence for an epidemiological link. Based on the detailed data from NoV typing one might argue that it is not the NoV in general that are an emerging foodborne pathogen. In fact, the

92

Emerging foodborne pathogens

NoV have been infecting people for quite a long time already. What we notice, however, is that new NoV strains emerge regularly.

4.3.3 Mechanisms of emergence: examples from FBVE When we consider emergence of foodborne viruses, two intriguing observations were made. In the winter of 2000/2001, a novel variant NoV, designated GGIIb was identified. This strain was observed first in August 2000 in association with a large drinking-water related outbreak of gastroenteritis in France, and in the subsequent winter season in six other countries throughout Europe. The initial international outbreak occurred in three countries in association with consumption of imported oysters from France that met all microbiological quality assurance parameters. The GGIIb variant caused between 7 and 71% of all recognised NoV outbreaks detected during that season in different countries. Further characterisation of the new lineage of viruses showed a remarkable finding, namely that the newly recognised ORF1 region was associated with four different capsids. These capsids were similar to previously recognised NoVs. The conclusion was that the detected lineages in these series of outbreaks were in fact new NoV variants, generated through recombination. Not enough is known on the immunity to NoV infections to speculate on how an existing capsid can be advantageous for a virus lineage to allow emergence based on such a recombination event. Note that viruses are obligate intracellular parasites and that recombination can occur only when two virus strains are infecting one cell at the same time. In the oyster-associated outbreaks, multiple variants were detected within the same product. Eating oysters (or other filter-feeding shellfish) contaminated with multiple strains, or ingesting multiple-contaminated products may lead to co-infection of people with related viruses, thereby facilitating the process of virus recombination (Fig. 4.3). This example clearly demonstrates that foodborne and waterborne transmission may have serious impact on the spread – and possibly even the generation – of emerging viral infections across countries. It also illustrates the need for virus-specific quality control criteria for food. The second observation was made in the winter of 2001/2002 when the emergence of a new GGII.4 virus occurred. Throughout Europe an increase in NoV outbreaks was noted. Sequence data of the detected viruses showed that the increase coincided with the emergence of a new GGII.4 strain. The new virus which emerged in January 2002 had a distinct sequence in the gene coding for the RdRp, had not been seen previously and was the dominant cause of NoV outbreaks by mid summer in all but one of the countries participating in the FBVE network (Lopman et al., 2004). Further research is needed to understand if and how the observed changes translate to distinct biological properties such as infectivity, antigenicity or (environmental) stability of the new strain. The example does show that the network approach used is suited to detect and investigate the emergence of a new strain. Interestingly,

Tracking emerging pathogens: the case of noroviruses 93

RNA-1 +

AAA … A

RNA-2 AAA … A Viral protein

RNA

Recombination of RNA genomes

Recombinant

AAA … A

Virion Release of recombinant viruses

Fig. 4.3

Recombination of viruses requires a double infection: two viruses in one cell.

the strain correlated to the increase in NoV outbreaks in 2002 is related to the strains that emerged in the winter of 1995–1996, and again in 2004–2005 In all cases a global epidemic of No V outbreaks was observed. This suggests that viruses of the GGII.4 genotype have properties facilitating transmission or infection, and thereby have the propensity to cause epidemics. Within a relatively short period of three years we have found that emergence of NoV is not just the closing of a diagnostic deficit, but we have found examples of two modes of true emergence. One way was the formation of new strains by recombination of existing strains. The other was the genetic drift of one GGII.4 strain to another new GGII.4 strain. Recombination and genetic drift, are examples of the two ways by which a single stranded RNA virus with an unsegmented genome can evolve. Both mechanisms contribute to the capacity of RNA virus to evolve rapidly and count as explanation for the observation that many of the emerging pathogens are RNA viruses.

4.4

Transmission routes

De Wit et al., (2003) report as risk factors for NoV infection: having a household member with gastroenteritis, contact with a person with GE outside the household (symptomatic shedding) and poor food handling hygiene. Other studies have shown that the eating of raw or undercooked shellfish is a risk factor (Kingsley et al., 2002b; LeGuyader et al., 2003; Doyle et al., 2004; Myrmel et al., 2004; Butt et al., 2004). The efficient, aerosolised spread of infectious viruses by vomiting, worsened by the environmental survival of NoV, contributes to efficient transmission. Another factor in the

94

Emerging foodborne pathogens

spreading of NoV is the shedding of infectious viruses by asymptomatic (and pre- or postsymptomatic) carriers and the employment of NoV shedders in the food chain.

4.4.1 Person to person As mentioned before, NoV are transmitted by the faecal-oral route and the most important way of spreading is from person to person. If the virus is introduced in a sensitive population by a symptomatic shedder, the origin of the virus is clear. However, asymptomatic, pre- or post-symptomatic shedders, and food or water may also introduce the viruses. In addition, prolonged outbreaks may occur following environmental contamination and persistence of NoV. In these cases the origin of the virus is less clear. Since viruses do not replicate in foods, and zoonotic transmission of NoV has not been found so far, all significant transmission routes are presumed to be a variation on person-to-person transmission. This means that NoV can be passed on from a shedder to a food item to the next victim, or water can be contaminated by a shedder and used for direct consumption or used for irrigation or washing of foods. It also implies that all foods handled by a food handler might become contaminated. But even if the source of contamination will always be a person, infections with food or water as vector for NoV transmission are referred to as food- or waterborne infections.

4.4.2 Food- and waterborne transmission The most notorious food with respect to viral infections are the filter feeding shellfish (oysters, mussels, clams). These sea animals actively accumulate viruses from water contaminated with human excrements. The viruses are concentrated in the intestinal tract of the shellfish and may remain infectious for weeks in the natural environment of the shellfish or when stored cooled. Moreover, depuration is not an effective method to reduce the viral load as it is for reducing bacterial contamination (Schwab et al., 1998; MuniainMujika et al., 2002; Kingsley and Richards, 2003) and the composition of the bodymass (proteins, fat, sugars) of shellfish contributes to increased virus stability in heat processing (Croci et al., 1999). Matters are further complicated by the fact that viral contamination of shellfish is reported for batches that meet bacteriological safety standards and the absence of indicator organisms in growing waters or marketed batches is not always a guarantee for the absence of infectious NoV (Chalmers and McMillan, 1995; Schwab et al., 1998; LeGuyader et al., 2003; Nishida et al., 2003). Besides shellfish, many other food items have been implicated in NoV outbreaks: ice (Khan et al., 1994), raspberries (Ponka et al., 1999), salad vegetables, poultry, red meat, fruit, soups, desserts, savoury snacks (Lopman et al., 2003), sandwiches (Parashar et al., 1998; Daniels et al., 2000).

Tracking emerging pathogens: the case of noroviruses 95 As mentioned before, all foods handled by an infectious food handler might be contaminated. Foods can be contaminated anywhere in the food chain, from farm to fork. The items posing the highest risk will be the products that are eaten raw or eaten without any (decontaminating) treatment. This explains why fruits and vegetables have been implicated in outbreaks, especially when harvested under conditions of poor sanitary hygiene or when irrigated with polluted water. The largest outbreak of NoV associated gastroenteritis in Australia involved over 3,000 individuals who had consumed orange juice (Fleet et al., 2000). Although no virus could be detected in the orange juice, the outbreak terminated when the juice was no longer distributed. Several areas where contamination of the juice could have occurred were identified in the production facilities. A high-risk practice is catering. Catered products are by definition products that are manually handled by a food handler at the end of the food chain, and therefore might pose a risk.

4.4.3 Airborne transmission Airborne transmission of NoV was also noted in several outbreaks (Sawyer et al., 1988; Chadwick et al., 1994; Marx et al., 1999). For example, airborne spread of NoV and infection by inhalation with subsequent ingestion of virus particles was described for an outbreak in a hotel restaurant (Marks et al., 2000). An outbreak in a school showed evidence of direct infection by aerosolised viruses after a case of vomiting (Marks et al., 2003). In that same study it was found that cleaning with a quaternary ammonium preparation was ineffective. In all cases, viruses were spread by acts of vomiting.

4.4.4 Zoonotic transmission The NoV that have been found in cattle (e.g. Jena and Newbury agent) and pigs so far are genetically distinct from the currently identified human NoVs (Sugieda et al., 1998; Liu et al., 1999; Dastjerdi et al., 1999; van der Poel et al., 2000, 2003; Sugieda and Nakajima, 2002; Deng et al., 2003; Oliver et al., 2003; Smiley et al., 2003; Wise et al., 2004). Whereas information on the swine enteric caliciviruses is still very scarce, recent studies on the bovine enteric caliciviruses (BEC) suggest that most BECs are best classified into a distinct genogroup (GGIII), and some may even be in a distinct genus (Oliver et al., 2003; Smiley et al., 2003; Wise et al., 2004). Nevertheless, genetic distances between animal NoV and human NoV are within the range found for different lineages of human viruses. Additionally, the animal NoV are enteric caliciviruses and possess a similar tissue tropism in their hosts as do the human NoV (Smiley et al., 2002). This suggests that given the right circumstances, interspecies transmission might occur. A recent study of the seroprevalence in the general population and a cohort of veterinarians specialised in bovines shows IgG reactivity to recombinant bovine NoV capsid protein in 20% of controls and 28% of the

96

Emerging foodborne pathogens

vets. Since cross reactivity could not explain the difference in seroprevalence between these groups, these data indicate that infections of humans by bovine NoV have occurred (Widdowson et al., 2005). However, to date, no bovine NoV strains have been found in human infections, nor have human NoV been found to have caused infection in cattle or pigs. The host range of NoV has been found to be very restricted, as many experimental animals have been inoculated with NoV without developing illness (reviewed by Green et al., 2001). In experimental settings only chimpanzees and macaques were found to seroconvert after inoculation with NoV (Green et al., 2001; Subekti et al., 2002; Rockx et al., 2005a). Recent studies of ‘natural’ infections showed NoV antibody prevalence in mangabey, pigtail and rhesus monkeys and chimpanzees in the USA (Jiang et al., 2004) but not in the Netherlands (Rockx et al., 2005a). These data indicate that interspecies transmission cannot be excluded and thus there might be an animal reservoir for NoV. It is also possible that cattle might play a role as mixing vessel for recombination of NoV strains. While there currently is no proof of such a scenario, the genetic flexibility of RNA viruses is such that it should not be deemed impossible. On the other hand, the existing data do suggest that it is not a frequent event, nor that it has led to the introduction of new NoV strains that spread easily in the human population.

4.5

Prevention and control

Prevention of NoV infection including foodborne transmission will rely on high standards for personal and environmental hygiene. The goal should be to prevent contamination of food items rather than to rely on treatment processes to inactivate the viruses once present in the foods or water. The only way to achieve that will depend on increased awareness of viral food safety throughout the food chain, in particular implementation of Good Agricultural Practice, Good Manufacturing Practice and Good Hygienic Practice during food preparation. Application of HACCP can further enhance preventive measures by identifying and reinforcing the implementation of specific control measures. To reduce the number of viral foodborne outbreaks in the future, governments should include considerations regarding viruses in the microbial food safety guidelines. In agriculture, primary products must be protected from contamination by human, animal, and agricultural wastes. It should be noted that the currently operating sewage treatment systems do not provide effluents safe from viruses (Lodder et al., 1999; Kukavica-Ibrulj et al., 2003; Le Cann et al, 2004). Water used for the cultivation, preparation or packing of food should therefore be of controlled quality to prevent the introduction of virally contaminated water into the foodchain. Also, guidelines specifically aimed at reduction of viral contamination are needed, as it has become clear that

Tracking emerging pathogens: the case of noroviruses 97 the current indicators for, for example, water and shellfish quality are insufficient as predictors of viral contamination. Furthermore, awareness among food-handlers, including seasonal workers, on the transmission of enteric viruses is needed (including the spread of viruses by vomiting), with special emphasis on the risk of transmission by asymptomatically infected persons and those continuing to shed virus following recovery from illness. This implies that food handlers who have increased risk of being NoV shedders have to be excluded from contact with food. Strict personal hygiene will not only reduce the number of virus introductions but also reduce the size of the outbreaks by minimising secondary transmission (Koopmans and Duizer, 2004).

4.6

Inactivation of caliciviruses

The resistance of the NoVs to be cultured (Duizer et al., 2004a) has hampered the development of reliable methods for their detection and viability testing. Therefore, knowledge of efficient inactivation methods and effective intervention in transmission pathways is limited and mostly based on studies using model viruses (reviewed in Koopmans and Duizer, 2004) or quantitative RT-PCR methods to asses RNA disintegration of NoV (Nuanualsuwan and Cliver, 2002; Duizer et al., 2004b). The most commonly used model for NoV in inactivation studies is the feline calicivirus (FeCV) and this virus is proposed as surrogate virus for testing of virucidal activity of disinfectants (Steinmann, 2004). In several tests it was found that FeCV was not efficiently inactivated on environmental surfaces or in suspension by, for example, 1% anionic detergents, quaternary ammonium (1:10), hypochlorite solutions with < 300 ppm free chlorine, or less than 50% or more than 80% alcohol preparations (ethanol or 1- and 2-propanol) (Scott, 1980; Gehrke et al., 2004; Duizer et al., 2004a). Varying efficacies of 65 to 75% alcohol preparations are reported, however, short contact times (< 1 min) rarely resulted in more than 4-log inactivation. Moreover, the presence of faecal or other organic material reduces the virucidal efficacy of many chemicals tested. The efficacy of seven commercial disinfectants for the inactivation of FeCV on strawberries and lettuce was tested by Gulati and co-workers and they found that none of the disinfectants was effective (defined as reducing the virus titer by at least 3-log10) when used at the FDA permitted concentration (Gulati et al., 2001). These data were recently confirmed by Alwood and co-workers for sodium bicarbonate, chlorine bleach, peroxyacetic acid and hydrogen peroxide at FDA approved concentrations (Allwood et al., 2004). Recent studies using FeCV and canine caliciviruses (CaCV) as models for NoV showed that heat inactivation of these two animal caliciviruses was highly comparable. Based on the temperature dependent inactivation profiles it was suggested that a better inactivation of viruses may be expected from regular batch (63 ∞C for 30 min) or classical pasteurisation (70 ∞C for 2 min)

98

Emerging foodborne pathogens

than from high temperature short time (HTST) pasteurisation (72 ∞C for 15 sec). Inactivation at 100 ∞C was, however, complete within seconds (Duizer et al., 2004a). The resistance of FeCV (in suspension) to inactivation by UV 253.7 nm radiation was reported to be highly variable. Doses required to achieve 3log10 reduction in FeCV infectivity ranged from 12 to 26 mJ/cm2 (De Roda Husman et al., 2004; Thurston-Enriquez et al., 2003), while others found only 1-log10 reduction at 48 mJ/cm2 (Nuanualsuwan et al., 2002). These differences may result from differences in composition (turbidity) of the irradiated suspensions although it was shown that at low protein levels (< 4 ug/ml) the effect of suspension composition was negligible. From two studies comparing FeCV and CaCV it may be concluded that UV-B radiation is less effective than UV 253.7 nm in inactivating caliciviruses in suspension (De Roda Husman et al., 2004; Duizer et al., 2004a). The relative resistance of FeCV to UV radiation is intermediate, i.e., comparable to that for the enteroviruses (Gerba et al., 2002), less effective than for vegetative bacteria, but more effective than for phage MS2 (De Roda Husman et al., 2004) and for adenoviruses 2 and 40 (Gerba et al., 2002; ThurstonEnriquez et al., 2003) and B. subtillis spores (Chang et al., 1985). The inactivation of caliciviruses by ionising (gamma) radiation was found to be ineffective, requiring doses of 300–500 Gy to achieve 3 log reduction, i.e., more than twice as much as for phage MS2. Moreover, the low efficacy was even further reduced by increasing the protein content of the suspension to 3–4 ug/ml (De Roda Husman et al., 2004). Other studies reported no apparent effect of ultrasonic energy (26 kHz) on FeCV (Scherba et al., 1991), but complete inactivation by high hydrostatic pressure after 5-min treatments with 275 MPa or more (Kingsley et al., 2002a). Based on comparative PCR data it was concluded that FeCV was a valuable model for NoV in inactivation experiments. However, the enteric NoV was significantly less sensitive to low pH treatments, indicating the need for a truly enteric virus as model for NoV or for an in vitro method for the detection of NoV viability (Duizer et al., 2004b). Due to the high stability of NoV they can survive in the environment, in water or on foods for prolonged periods. This means that the contamination can have occurred a long time ago. Additionally the NoV are quite resistant to refrigeration and freezing, low pH and chemical disinfectants. This combination of high stability and resistance with a low minimal infectious dose has led to several remarkable outbreaks as described above. Awaiting further data on inactivation of NoV by milder disinfectants or treatments it is probably best to apply thorough heating (cooking) for water and food, and high hypochlorite concentrations (> 1%) for disinfection of surfaces when contamination with NoV is suspected.

Tracking emerging pathogens: the case of noroviruses 99

4.7

Thoughts on other viruses

We have learned a great deal on the transmission routes of NoVs due to the fact that infections due to these viruses are relatively easily recognised. The attack rate is high, and the symptoms develop fast, resulting in outbreaks that are easily recognised. The work of the FBVE network has shown that foodborne transmission of viruses contributes significantly to the epidemiology and disease burden of NoV. What does that tell us about food-related risks for other viruses, especially the structurally similar viruses, such as enteroviruses (e.g. poliovirus, coxsackie viruses), hepatitis A virus, and hepatitis E virus? The basic properties that contribute to foodborne transmission, such as asymptomatic carriage and shedding, environmental stability, oral infectivity, and low minimal infectious dose are similar to those of the NoVs. Several examples of food- and water-related outbreaks with these viruses exist. The biggest difference with NoVs is that enteroviruses, hepatitis A and hepatitis E viruses cause illness in a smaller proportion of those exposed, and that these symptoms become noticeable up to ten weeks post infection. As a result, a relation between the illness and a food source will not be made unless it is very obvious, for instance, because a group of cases all participated in the same conference. Otherwise, such outbreaks can be detected only by the use of virus tracking, as described above. The data described also illustrated that current microbiological quality assurance is not adequate for effective prevention of virus infection. This is an important message, because the globalisation of the food chain and international travel are contributing factors to the rapid dissemination of emerging diseases. This is illustrated by the example of SARS, which was considered to be a respiratory pathogen, where control efforts have focused on control of droplet transmission in close person-to-person contacts. Epidemiological and laboratory studies have, however, shown that a major proportion of the SARS cases in Hong Kong has been linked to environmental transmission due to a faulty sewage system (WHO, 2003). Moreover, SARS coronavirus is found to infect intestinal epithelial cells in humans and the majority of SARS patients shed high loads of infectious virus in their stools (Leung et al., 2003), SARS coronavirus is relatively stable in the environment (Duan et al., 2003), coronaviruses in animals are known for their dual tissue tropism (respiratory and enteric), and food animal handlers in Guangdong had increased prevalence of antibodies against the SARS virus (CDC, 2003). Thus, with increasing data becoming available, one can question if the dropletbased respiratory transmission is truly the only mode of transmission. All the factors mentioned suggest that the potential of transmission of SARS coronavirus via human faecal waste is there. During the major outbreak in 2003, foodborne transmission has not been documented, but the latest SARS cases in Guangdong that occurred in December/January 2004 were linked to two restaurants. Without being alarmed, these factors should be used as a warning sign. If SARS is transmitted via food, the NoV data show that we do not have sufficient safeguards in place to prevent human disease.

100

Emerging foodborne pathogens

4.8

Future trends

Given the importance of foodborne viruses and the impact that different factors (globalisation of the market, increased international travel, consumer demands, changes in food-processing, pathogen evolution, etc.), may have on the emergence of disease, it is clear that priority needs to be given to expanding foodborne disease surveillance to cover foodborne viruses. The expansion should include three areas: (i) a more complete coverage of qualified laboratories per country, (ii) inclusion of more countries in international surveillance networks and (iii) development and implementation of detection methods of more classes of viruses in the surveillance programs. Networks comparable to the FBVE network are being developed in other regions of the world and it is important to develop guidelines and rules for data sharing in these early stages. It is also worthwhile paying attention to the impact on viruses of new mild preservation techniques used to inactivate bacteria in foods or, for example, alcohol-based hand-sanitisers used to inactivate bacteria on hands. Most of these methods have been introduced and put into use without proper evaluation of the efficiency against viruses, creating a window of opportunity for foodborne viruses to cause problems. It is also to be expected that the attention given to hepatitis E virus (HEV) will expand significantly since the recent proof of foodborne zoonotic transmission of these viruses (Tei et al., 2003; Yazaki et al., 2003) (HEV will be discussed in detail in Chapter 11). Increased awareness of food as a vector for viruses, combined with increased laboratory capabilities and the implementation of virus tracking methods and molecular epidemiology might result in detection of foodborne transmission of as yet unforeseen viruses. Hopefully the diagnostic gap in gastrointestinal illnesses such as gastroenteritis and hepatitis will be narrowed down. It is not very likely, however, that the problems caused by foodborne virus transmission are going to be resolved quickly. Continued research is needed to assess efficacy of different control measures along food chains to be able to work towards virus-safe food in the future.

4.9

Additional sources of information

Foodborne viruses: An Emerging Problem. Ilsi report and Int J Food Microbiol. 2004 Jan 1; 90(1): 23–41. Review. Foodborne viruses. Koopmans M, von Bonsdorff CH, Vinje J, de Medici D, Monroe S. FEMS Microbiol Rev. 2002 Jun; 26(2): 187–205. Review. Viruses. Koopmans M. (2002) in Foodborne Pathogens: hazards, risk analysis and control, Eds Blackburn and McClure. CRC press. Human Caliciviruses. Kim Y. Green, Robert M. Chanock and Albert Z. Kapikian. In Fields Virology (4th edn, 2001), vol. 1, 841–874.

Tracking emerging pathogens: the case of noroviruses

101

Molecular epidemiology of human enteric caliciviruses in The Netherlands. Koopmans M, Vinje J, Duizer E, de Wit M, van Duijnhoven Y. Novartis Found Symp. 2001; 238: 197–214; discussion 214–8. Review. http://www.eufoodborneviruses.net/

4.10

References

ALLWOOD, P.B., MALIK, Y.S., HEDBERG, C.W.

and GOYAL, S.M. (2004) Effect of temperature and sanitizers on the survival of feline calicivirus, Escherichia coli, and F-specific coliphage MS2 on leafy salad vegetables. J Food Prot 67, 1451–6. ANDERSON, A.D., HERYFORD, A.G., SARISKY, J.P., HIGGINS, C., MONROE, S.S., BEARD, R.S., NEWPORT, C.M., CASHDOLLAR, J.L., FOUT, G.S., ROBBINS, D.E., SEYS, S.A., MUSGRAVE, K.J., MEDUS, C., VINJE, J., BRESEE, J.S., MAINZER, H.M. and GLASS, R.I. (2003) A waterborne outbreak of Norwalk-like virus among snowmobilers – Wyoming, 2001. J Infect Dis 187, 303–6. ATMAR, R.L. and ESTES, M.K. (2001) Diagnosis of noncultivatable gastroenteritis viruses, the human caliciviruses. Clin Microbiol Rev 14, 15–37. BERTOLOTTI-CIARLET, A., CRAWFORD, S.E., HUTSON, A.M. and ESTES, M.K. (2003) The 3’ end of Norwalk virus mRNA contains determinants that regulate the expression and stability of the viral capsid protein VP1: a novel function for the VP2 protein. J Virol 77, 11603–15. BHATTACHARYA, S.S., KULKA, M., LAMPEL, K.A., CEBULA, T.A. and GOSWAMI, B.B. (2004) Use of reverse transcription and PCR to discriminate between infectious and non-infectious hepatitis A virus. J Virol Methods 116, 181–7. BIDAWID, S., FARBER, J.M. and SATTAR, S.A. (2000) Rapid concentration and detection of hepatitis A virus from lettuce and strawberries. J Virol Methods 88, 175–85. BURTON-MACLEOD, J.A., KANE, E.M., BEARD, R.S., HADLEY, L.A., GLASS, R.I. and ANDO, T. (2004) Evaluation and comparison of two commercial enzyme-linked immunosorbent assay kits for detection of antigenically diverse human noroviruses in stool samples. J Clin Microbiol 42, 2587–95. BUTT, A.A., ALDRIDGE, K.E. and SANDERS, C.V. (2004) Infections related to the ingestion of seafood Part I: Viral and bacterial infections. Lancet Infect Dis 4, 201–12. CANNON, R.O., POLINER, J.R., HIRSCHHORN, R.B., RODEHEAVER, D.C., SILVERMAN, P.R., BROWN, E.A., TALBOT, G.H., STINE, S.E., MONROE, S.S., DENNIS, D.T. and OTHERS (1991) A multistate outbreak of Norwalk virus gastroenteritis associated with consumption of commercial ice. J Infect Dis 164, 860–3. CARRIQUE-MAS, J., ANDERSSON, Y., PETERSEN, B., HEDLUND, K.O., SJOGREN, N. and GIESECKE, J. (2003) A Norwalk-like virus waterborne community outbreak in a Swedish village during peak holiday season. Epidemiol Infect 131, 737–44. CDC (2003) (Centers for Disease Control and Prevention) Prevalence of IgG antibody to SARS-associated coronavirus in animal traders – Guangdong Province, China, 2003. MMWR Morb Mortal Wkly Rep 52, 986–7. CHADWICK, P.R., WALKER, M. and REES, A.E. (1994) Airborne transmission of a small round structured virus. Lancet 343, 171. CHALMERS, J.W. and MCMILLAN, J.H. (1995) An outbreak of viral gastroenteritis associated with adequately prepared oysters. Epidemiol Infect 115, 163–7. CHANG, J.C., OSSOFF, S.F., LOBE, D.C., DORFMAN, M.H., DUMAIS, C.M., QUALLS, R.G. and JOHNSON, J.D. (1985) UV inactivation of pathogenic and indicator microorganisms. Appl Environ Microbiol 49, 1361–5. CHEESBROUGH, J.S., GREEN, J., GALLIMORE, C.I., WRIGHT, P.A. and BROWN, D.W. (2000) Widespread environmental contamination with Norwalk-like viruses (NLV) detected in a prolonged hotel outbreak of gastroenteritis. Epidemiol Infect 125, 93–8.

102

Emerging foodborne pathogens

CONDIT, R. C.

(2001) Principles of Virology in Fields Virology, eds Knipe, D.M. et al. pp. 19–52. Philadelphia: Lippincott Williams & Wilkins. CROCI, L., CICCOZZI, M., DE MEDICI, D., DI PASQUALE, S., FIORE, A., MELE, A. and TOTI, L. (1999) Inactivation of hepatitis A virus in heat-treated mussels. J Appl Microbiol 87, 884–8. DANIELS, N.A., BERGMIRE-SWEAT, D.A., SCHWAB, K.J., HENDRICKS, K.A., REDDY, S., ROWE, S.M., FANKHAUSER, R.L., MONROE, S.S., ATMAR, R.L., GLASS, R.I. and MEAD, P. (2000) A foodborne outbreak of gastroenteritis associated with Norwalk-like viruses: first molecular traceback to deli sandwiches contaminated during preparation. J Infect Dis 181, 1467–70. DASTJERDI, A.M., GREEN, J., GALLIMORE, C.I., BROWN, D.W. and BRIDGER, J.C. (1999) The bovine Newbury agent-2 is genetically more closely related to human SRSVs than to animal caliciviruses. Virology 254, 1–5. DE RODA HUSMAN, A.M., BIJKERK, P., LODDER, W., VAN DEN BERG, H., PRIBIL, W., CABAJ, A., GEHRINGER, P., SOMMER, R. and DUIZER, E. (2004) Calicivirus Inactivation by Nonionizing (253.7-Nanometer-Wavelength and Ionizing (Gamma) Radiation. Appl Environ Microbiol 70, 5089–93. DE WIT, M.A.S., WIDDOWSON, M.A., VENNEMA, H., DE BRUIN, E., FERNANDEZ, T., KOOPMANS, M.P.G. Large outbreak of norovirus; use of e-mailed questionnaires to track down the source. Epidemiology and Infection, in press. DE WIT, M.A., KOOPMANS, M.P., KORTBEEK, L.M., WANNET, W.J., VINJE, J., VAN LEUSDEN, F., BARTELDS, A.I. and VAN DUYNHOVEN, Y.T. (2001a) Sensor, a population-based cohort study on gastroenteritis in the Netherlands: incidence and etiology. Am J Epidemiol 154, 666– 74. DE WIT, M.A., KORTBEEK, L.M., KOOPMANS, M.P., DE JAGER, C.J., WANNET, W.J., BARTELDS, A.I. and VAN DUYNHOVEN, Y.T. (2001b) A comparison of gastroenteritis in a general practicebased study and a community-based study. Epidemiol Infect 127, 389–97. DE WIT, M.A., KOOPMANS, M.P. and VAN DUYNHOVEN, Y.T. (2003) Risk factors for norovirus, Sapporo-like virus, and group A rotavirus gastroenteritis. Emerg Infect Dis 9, 1563– 70. DENG, Y., BATTEN, C.A., LIU, B.L., LAMBDEN, P.R., ELSCHNER, M., GUNTHER, H., OTTO, P., SCHNURCH, P., EICHHORN, W., HERBST, W. and CLARKE, I.N. (2003) Studies of epidemiology and seroprevalence of bovine noroviruses in Germany. J Clin Microbiol 41, 2300–5. DOYLE, A., BARATAUD, D., GALLAY, A., THIOLET, J.M., LE GUYAGUER, S., KOHLI, E. and VAILLANT, V. (2004) Norovirus foodborne outbreaks associated with the consumption of oysters from the Etang de Thau, France, December 2002. Euro Surveill 9. DUAN, S.M., ZHAO, X.S., WEN, R.F., HUANG, J.J., PI, G.H., ZHANG, S.X., HAN, J., BI, S.L., RUAN, L. and DONG, X.P. (2003) Stability of SARS coronavirus in human specimens and environment and its sensitivity to heating and UV irradiation. Biomed Environ Sci 16, 246–55. DUBOIS, E., AGIER, C., TRAORE, O., HENNECHART, C., MERLE, G., CRUCIERE, C. and LAVERAN, H. (2002) Modified concentration method for the detection of enteric viruses on fruits and vegetables by reverse transcriptase-polymerase chain reaction or cell culture. J Food Prot 65, 1962–9. DUIZER, E., BIJKERK, P., ROCKX, B., DE GROOT, A., TWISK, F. and KOOPMANS, M. (2004a) Inactivation of caliciviruses. Appl Environ Microbiol 70, 4538–43. DUIZER, E., SCHWAB, K.J., NEILL, F.H., ATMAR, R.L., KOOPMANS, M.P. and ESTES, M.K. (2004b) Laboratory efforts to cultivate noroviruses. J Gen Virol 85, 79–87. ERDMAN, D.D., GARY, G.W. and ANDERSON, L.J. (1989a) Development and evaluation of an IgM capture enzyme immunoassay for diagnosis of recent Norwalk virus infection. J Virol Methods 24, 57–66. ERDMAN, D.D., GARY, G.W. and ANDERSON, L.J. (1989b) Serum immunoglobulin A response to Norwalk virus infection. J Clin Microbiol 27, 1417–8. EVANS , M . R., MELDRUM, R., LANE, W., GARDNER, D ., RIBEIRO , C. D ., GALLIMORE , C . I. and WESTMORELAND, D. (2002) An outbreak of viral gastroenteritis following environmental contamination at a concert hall. Epidemiol Infect 129, 355–60.

Tracking emerging pathogens: the case of noroviruses FANKHAUSER, R.L., NOEL, J.S., MONROE, S.S., ANDO, T.

103

and GLASS, R.I. (1998) Molecular epidemiology of ‘Norwalk-like viruses’ in outbreaks of gastroenteritis in the United States. J Infect Dis 178, 1571–8. FANKHAUSER, R.L., MONROE, S.S., NOEL, J.S., HUMPHREY, C.D., BRESEE, J.S., PARASHAR, U.D., ANDO, T. and GLASS, R.I. (2002) Epidemiologic and molecular trends of ‘Norwalk-like viruses’ associated with outbreaks of gastroenteritis in the United States. J Infect Dis 186, 1– 7. FARKAS, T., BERKE, T., REUTER, G., SZUCS, G., MATSON, D.O. and JIANG, X. (2002) Molecular detection and sequence analysis of human caliciviruses from acute gastroenteritis outbreaks in Hungary. J Med Virol 67, 567–73. FARKAS, T., THORNTON, S.A., WILTON, N., ZHONG, W., ALTAYE, M. and JIANG, X. (2003) Homologous versus heterologous immune responses to Norwalk-like viruses among crew members after acute gastroenteritis outbreaks on 2 US Navy vessels. J Infect Dis 187, 187–93. FLEET, G.H., HEISKANEN, P., REID, I. and BUCKLE, K.A. (2000) Foodborne viral illness – status in Australia. Int J Food Microbiol 59, 127–36. FORMIGA-CRUZ, M., TOFINO-QUESADA, G., BOFILL-MAS, S., LEES, D.N., HENSHILWOOD, K., ALLARD, A.K., CONDEN-HANSSON, A.C., HERNROTH, B.E., VANTARAKIS, A., TSIBOUXI, A., PAPAPETROPOULOU, M., FURONES, M.D. and GIRONES, R. (2002) Distribution of human virus contamination in shellfish from different growing areas in Greece, Spain, Sweden, and the United Kingdom. Appl Environ Microbiol 68, 5990–8. GALLIMORE, C.I., BARREIROS, M.A., BROWN, D.W., NASCIMENTO, J.P. and LEITE, J.P. (2004a) Noroviruses associated with acute gastroenteritis in a children’s day care facility in Rio de Janeiro, Brazil. Braz J Med Biol Res 37, 321–6. GALLIMORE, C.I., LEWIS, D., TAYLOR, C., CANT, A., GENNERY, A. and GRAY, J.J. (2004b) Chronic excretion of a norovirus in a child with cartilage hair hypoplasia (CHH). J Clin Virol 30, 196–204. GEHRKE, C., STEINMANN, J. and GORONCY-BERMES, P. (2004) Inactivation of feline calicivirus, a surrogate of norovirus (formerly Norwalk-like viruses), by different types of alcohol in vitro and in vivo. J Hosp Infect 56, 49–55. GERBA, C.P., GRAMOS, D.M. and NWACHUKU, N. (2002) Comparative inactivation of enteroviruses and adenovirus 2 by UV light. Appl Environ Microbiol 68, 5167–9. GILGEN, M., GERMANN, D., LUTHY, J. and HUBNER, P. (1997) Three-step isolation method for sensitive detection of enterovirus, rotavirus, hepatitis A virus, and small round structured viruses in water samples. Int J Food Microbiol 37, 189–99. GIRISH, R., BROOR, S., DAR, L. and GHOSH, D. (2002) Foodborne outbreak caused by a Norwalklike virus in India. J Med Virol 67, 603–7. GLASS, P.J., WHITE, L.J., BALL, J.M., LEPARC-GOFFART, I., HARDY, M.E. and ESTES, M.K. (2000) Norwalk virus open reading frame 3 encodes a minor structural protein. J Virol 74, 6581–91. GOTZ, H., DE, J.B., LINDBACK, J., PARMENT, P.A., HEDLUND, K.O., TORVEN, M. and EKDAHL, K. (2002) Epidemiological investigation of a food-borne gastroenteritis outbreak caused by Norwalk-like virus in 30 day-care centres. Scand J Infect Dis 34, 115–21. GRAY, J.J., CUNLIFFE, C., BALL, J., GRAHAM, D.Y., DESSELBERGER, U. and ESTES, M.K. (1994) Detection of immunoglobulin M (IgM), IgA, and IgG Norwalk virus-specific antibodies by indirect enzyme-linked immunosorbent assay with baculovirus-expressed Norwalk virus capsid antigen in adult volunteers challenged with Norwalk virus. J Clin Microbiol 32, 3059–63. GREEN, K.Y., LEW, J.F., JIANG, X., KAPIKIAN, A.Z. and ESTES, M.K. (1993) Comparison of the reactivities of baculovirus-expressed recombinant Norwalk virus capsid antigen with those of the native Norwalk virus antigen in serologic assays and some epidemiologic observations. J Clin Microbiol 31, 2185–91. GREEN, S.M., LAMBDEN, P.R., CAUL, E.O., ASHLEY, C.R. and CLARKE, I.N. (1995) Capsid diversity in small round-structured viruses: molecular characterization of an antigenically distinct human enteric calicivirus. Virus Res 37, 271–83.

104

Emerging foodborne pathogens

GREEN, K.Y., CHANOCK, R.M. and KAPIKIAN, A.Z. (2001) Human Caliciviruses. in Fields Virology,

eds Knipe, D.M. pp. 841–74. Philadelphia: Lippincott Williams & Wilkins. and GOYAL, S.M. (2001) Efficacy of commonly used disinfectants for the inactivation of calicivirus on strawberry, lettuce, and a foodcontact surface. J Food Prot 64, 1430–4. HALE, A., MATTICK, K., LEWIS, D., ESTES, M., JIANG, X., GREEN, J., EGLIN, R. and BROWN, D. (2000) Distinct epidemiological patterns of Norwalk-like virus infection. J Med Virol 62, 99– 103. HARAMOTO, E., KATAYAMA, H. and OHGAKI, S. (2004) Detection of noroviruses in tap water in Japan by means of a new method for concentrating enteric viruses in large volumes of freshwater. Appl Environ Microbiol 70, 2154–60. HARRINGTON, P.R., YOUNT, B., JOHNSTON, R.E., DAVIS, N., MOE, C. and BARIC, R.S. (2002) Systemic, mucosal, and heterotypic immune induction in mice inoculated with Venezuelan equine encephalitis replicons expressing Norwalk virus-like particles. J Virol 76, 730–42. HARRINGTON, P.R., VINJE, J., MOE, C.L. and BARIC, R.S. (2004) Norovirus capture with histoblood group antigens reveals novel virus-ligand interactions. J Virol 78, 3035–45. HEDBERG, C.W. and OSTERHOLM, M.T. (1993) Outbreaks of food-borne and waterborne viral gastroenteritis. Clin Microbiol Rev 6, 199–210. HERRMANN, J.E., BLACKLOW, N.R., MATSUI, S.M., LEWIS, T.L., ESTES, M.K., BALL, J.M. and BRINKER, J.P. (1995) Monoclonal antibodies for detection of Norwalk virus antigen in stools. J Clin Microbiol 33, 2511–3. HOEBE, C.J., VENNEMA, H., DE RODA HUSMAN, A.M. and VAN DUYNHOVEN, Y.T. (2004) Norovirus outbreak among primary schoolchildren who had played in a recreational water fountain. J Infect Dis 189, 699–705. HORMAN, A., RIMHANEN-FINNE, R., MAUNULA, L., VON BONSDORFF, C.H., TORVELA, N., HEIKINHEIMO, A. and HANNINEN, M.L. (2004) Campylobacter spp., Giardia spp., Cryptosporidium spp., noroviruses, and indicator organisms in surface water in southwestern Finland, 20002001. Appl Environ Microbiol 70, 87–95. HUANG, P., FARKAS, T., MARIONNEAU, S., ZHONG, W., RUVOEN-CLOUET, N., MORROW, A.L., ALTAYE, M., PICKERING, L.K., NEWBURG, D.S., LEPENDU, J. and JIANG, X. (2003) Noroviruses bind to human ABO, Lewis, and secretor histo-blood group antigens: identification of 4 distinct strain-specific patterns. J Infect Dis 188, 19–31. HUTSON, A.M., ATMAR, R.L., GRAHAM, D.Y. and ESTES, M.K. (2002) Norwalk virus infection and disease is associated with ABO histo-blood group type. J Infect Dis 185, 1335–7. HUTSON, A.M., ATMAR, R.L. and ESTES, M.K. (2004) Norovirus disease: changing epidemiology and host susceptibility factors. Trends Microbiol 12, 279–87. IRITANI, N., SETO, Y., KUBO, H., HARUKI, K., AYATA, M. and OGURA, H. (2002) Prevalence of ‘Norwalk-like virus’ infections in outbreaks of acute nonbacterial gastroenteritis observed during the 1999-2000 season in Osaka City, Japan. J Med Virol 66, 131–8. IRITANI, N., SETO, Y., KUBO, H., MURAKAMI, T., HARUKI, K., AYATA, M. and OGURA, H. (2003) Prevalence of Norwalk-like virus infections in cases of viral gastroenteritis among children in Osaka City, Japan. J Clin Microbiol 41, 1756–9. JEAN, J., D’SOUZA, D. and JAYKUS, L.A. (2003) Transcriptional enhancement of RT-PCR for rapid and sensitive detection of Noroviruses. FEMS Microbiol Lett 226, 339–45. JIANG, B., MCCLURE, H.M., FANKHAUSER, R.L., MONROE, S.S. and GLASS, R.I. (2004) Prevalence of rotavirus and norovirus antibodies in non-human primates. J Med Primatol 33, 30–3. JIANG, X., MATSON, D.O., RUIZ-PALACIOS, G.M., HU, J., TREANOR, J. and PICKERING, L.K. (1995) Expression, self-assembly, and antigenicity of a snow mountain agent-like calicivirus capsid protein. J Clin Microbiol 33, 1452–5. KAGEYAMA, T., KOJIMA, S., SHINOHARA, M., UCHIDA, K., FUKUSHI, S., HOSHINO, F.B., TAKEDA, N. and KATAYAMA, K. (2003) Broadly reactive and highly sensitive assay for Norwalk-like viruses based on real-time quantitative reverse transcription-PCR. J Clin Microbiol 41, 1548–57. GULATI, B.R., ALLWOOD, P.B., HEDBERG, C.W.

Tracking emerging pathogens: the case of noroviruses KAPIKIAN, A.Z., WYATT, R.G., DOLIN, R., THORNHILL, T.S., KALICA, A.R.

105

and CHANOCK, R.M. (1972) Visualization by immune electron microscopy of a 27-nm particle associated with acute infectious nonbacterial gastroenteritis. J Virol 10, 1075–81. KAPLAN, J.E., FELDMAN, R., CAMPBELL, D.S., LOOKABAUGH, C. and GARY, G.W. (1982) The frequency of a Norwalk-like pattern of illness in outbreaks of acute gastroenteritis. Am J Public Health 72, 1329–32. KARIM, M.R., PONTIUS, F.W. and LECHEVALLIER, M.W. (2004) Detection of noroviruses in water – summary of an international workshop. J Infect Dis 189, 21–8. KARST, S.M., WOBUS, C.E., LAY, M., DAVIDSON, J. and VIRGIN, H.W. 4th (2003) STAT1-dependent innate immunity to a Norwalk-like virus. Science 299, 1575–8. KHAN, A.S., MOE, C.L., GLASS, R.I., MONROE, S.S., ESTES, M.K., CHAPMAN, L.E., JIANG, X., HUMPHREY, C., PON, E., ISKANDER, J.K. and OTHERS (1994) Norwalk virus-associated gastroenteritis traced to ice consumption aboard a cruise ship in Hawaii: comparison and application of molecular method-based assays. J Clin Microbiol 32, 318–22. KINGSLEY, D.H. and RICHARDS, G.P. (2003) Persistence of hepatitis A virus in oysters. J Food Prot 66, 331–4. KINGSLEY, D.H., HOOVER, D.G., PAPAFRAGKOU, E. and RICHARDS, G.P. (2002a) Inactivation of hepatitis A virus and a calicivirus by high hydrostatic pressure. J Food Prot 65, 1605– 9. KINGSLEY, D.H., MEADE, G.K. and RICHARDS, G.P. (2002b) Detection of both hepatitis A virus and Norwalk-like virus in imported clams associated with food-borne illness. Appl Environ Microbiol 68, 3914–8. KITAMOTO, N., TANAKA, T., NATORI, K., TAKEDA, N., NAKATA, S., JIANG, X. and ESTES, M.K. (2002) Cross-reactivity among several recombinant calicivirus virus-like particles (VLPs) with monoclonal antibodies obtained from mice immunized orally with one type of VLP. J Clin Microbiol 40, 2459–65. KOBAYASHI, S., NATORI, K., TAKEDA, N. and SAKAE, K. (2004) Immunomagnetic capture rtPCR for detection of norovirus from foods implicated in a foodborne outbreak. Microbiol Immunol 48, 201–4. KOHN, M.A., FARLEY, T.A., ANDO, T., CURTIS, M., WILSON, S.A., JIN, Q., MONROE, S.S., BARON, R.C., MCFARLAND, L.M. and GLASS, R.I. (1995) An outbreak of Norwalk virus gastroenteritis associated with eating raw oysters. Implications for maintaining safe oyster beds. JAMA 273, 466–71. KOOPMANS, M. and DUIZER, E. (2004) Foodborne viruses: an emerging problem. Int J Food Microbiol 90, 23–41. KOOPMANS, M., VON BONSDORFF, C.H., VINJE, J., DE MEDICI, D. and MONROE, S. (2002) Foodborne viruses. FEMS Microbiol Rev 26, 187–205. KOOPMANS, M., VENNEMA, H., HEERSMA, H., VAN STRIEN, E., VAN DUYNHOVEN, Y., BROWN, D., REACHER, M. and LOPMAN, B. (2003) Early identification of common-source foodborne virus outbreaks in Europe. Emerg Infect Dis 9, 1136–42. KUKAVICA-IBRULJ, I., DARVEAU, A. and FLISS, I. (2003) Immunofluorescent detection and quantitation of hepatitis A virus in sewage treatment effluent and on agri-food surfaces using scanning confocal microscopy. J Virol Methods 108, 9–17. KUKKULA, M., MAUNULA, L., SILVENNOINEN, E. and VON BONSDORFF, C.H. (1999) Outbreak of viral gastroenteritis due to drinking water contaminated by Norwalk-like viruses. J Infect Dis 180, 1771–6. KUUSI, M., NUORTI, J.P., MAUNULA, L., MINH, N.N., RATIA, M., KARLSSON, J. and VON BONSDORFF, C.H. (2002) A prolonged outbreak of Norwalk-like calicivirus (NLV) gastroenteritis in a rehabilitation centre due to environmental contamination. Epidemiol Infect 129, 133–8. LAU, C.S., WONG, D.A., TONG, L.K., LO, J.Y., MA, A.M., CHENG, P.K. and LIM, W.W. (2004) High rate and changing molecular epidemiology pattern of norovirus infections in sporadic cases and outbreaks of gastroenteritis in Hong Kong. J Med Virol 73, 113–7. LE CANN, P., RANARIJAONA, S., MONPOEHO, S., LE GUYADER, F. and FERRE, V. (2004) Quantification of human astroviruses in sewage using real-time RT-PCR. Res Microbiol 155, 11–5.

106

Emerging foodborne pathogens

LE GUYADER, F.S., NEILL, F.H., DUBOIS, E., BON, F., LOISY, F., KOHLI, E., POMMEPUY, M.

and ATMAR, (2003) A semiquantitative approach to estimate Norwalk-like virus contamination of oysters implicated in an outbreak. Int J Food Microbiol 87, 107–12. LE GUYADER, F.S., SCHULTZ, A.C., HAUGARREAU, L., CROCI, L., MAUNULA, L., DUIZER, E., LODDERVERSCHOOR, F., VON BONSDORFF, C.H., SUFFREDINI, E., VAN DER POEL, W.M.M., REYMUNDO, R. and KOOPMANS, M. (2004) Round-robin comparison of methods for the detection of human enteric viruses in lettuce. J Food Prot. 67, 2315–2319. LEES, D. (2000) Viruses and bivalve shellfish. Int J Food Microbiol 59, 81–116. LEGGITT, P.R. and JAYKUS, L.A. (2000) Detection methods for human enteric viruses in representative foods. J Food Prot 63, 1738–44. LEUNG, W.K., TO, K.F., CHAN, P.K., CHAN, H.L., WU, A.K., LEE, N., YUEN, K.Y. and SUNG, J.J. (2003) Enteric involvement of severe acute respiratory syndrome-associated coronavirus infection. Gastroenterology 125, 1011–7. LEWIS, D.C. (1990) Three serotypes of Norwalk-like virus demonstrated by solid-phase immune electron microscopy. J Med Virol 30, 77–81. LEWIS, G.D., MOLLOY, S.L., GREENING, G.E. and DAWSON, J. (2000) Influence of environmental factors on virus detection by RT-PCR and cell culture. J Appl Microbiol 88, 633–40. LIU, B.L., LAMBDEN, P.R., GUNTHER, H., OTTO, P., ELSCHNER, M. and CLARKE, I.N. (1999) Molecular characterization of a bovine enteric calicivirus: relationship to the Norwalk-like viruses. J Virol 73, 819–25. LODDER, W.J., VINJE, J., VAN DE HEIDE, R., DE RODA HUSMAN, A.M., LEENEN, E.J. and KOOPMANS, M.P. (1999) Molecular detection of Norwalk-like caliciviruses in sewage. Appl Environ Microbiol 65, 5624–7. LOPMAN, B.A., BROWN, D.W. and KOOPMANS, M. (2002) Human caliciviruses in Europe. J Clin Virol 24, 137–60. LOPMAN, B.A., REACHER, M.H., VAN DUIJNHOVEN, Y., HANON, F.X., BROWN, D. and KOOPMANS, M. (2003) Viral gastroenteritis outbreaks in Europe, 1995–2000. Emerg Infect Dis 9, 90– 6. LOPMAN, B., VENNEMA, H., KOHLI, E., POTHIER, P., SANCHEZ, A., NEGREDO, A., BUESA, J., SCHREIER, E., REACHER, M., BROWN, D., GRAY, J., ITURRIZA, M., GALLIMORE, C., BOTTIGER, B., HEDLUND, K.O., TORVEN, M., VON BONSDORFF, C.H., MAUNULA, L., POLJSAK-PRIJATELJ, M., ZIMSEK, J., REUTER, G., SZUCS, G., MELEGH, B., SVENNSON, L., VAN DUIJNHOVEN, Y. and KOOPMANS, M. (2004) Increase in viral gastroenteritis outbreaks in Europe and epidemic spread of new norovirus variant. Lancet 363, 682–8. MADORE, H.P., TREANOR, J.J., BUJA, R. and DOLIN, R. (1990) Antigenic relatedness among the Norwalk-like agents by serum antibody rises. J Med Virol 32, 96–101. MARIONNEAU, S., RUVOEN, N., LE MOULLAC-VAIDYE, B., CLEMENT, M., CAILLEAU-THOMAS, A., RUIZ-PALACOIS, G., HUANG, P., JIANG, X. and LE PENDU, J. (2002) Norwalk virus binds to histo-blood group antigens present on gastroduodenal epithelial cells of secretor individuals. Gastroenterology 122, 1967–77. MARKS, P.J., VIPOND, I.B., CARLISLE, D., DEAKIN, D., FEY, R.E. and CAUL, E.O. (2000) Evidence for airborne transmission of Norwalk-like virus (NLV) in a hotel restaurant. Epidemiol Infect 124, 481–7. MARKS, P.J., VIPOND, I.B., REGAN, F.M., WEDGWOOD, K., FEY, R.E. and CAUL, E.O. (2003) A school outbreak of Norwalk-like virus: evidence for airborne transmission. Epidemiol Infect 131, 727–36. MARSHALL, J.A., HELLARD, M.E., SINCLAIR, M.I., FAIRLEY, C.K., COX, B.J., CATTON, M.G., KELLY, H. and WRIGHT, P.J. (2003) Incidence and characteristics of endemic Norwalk-like virusassociated gastroenteritis. J Med Virol 69, 568–78. MARTINEZ, N., ESPUL, C., CUELLO, H., ZHONG, W., JIANG, X., MATSON, D.O. and BERKE, T. (2002) Sequence diversity of human caliciviruses recovered from children with diarrhea in Mendoza, Argentina, 1995–1998. J Med Virol 67, 289–98. MARX, A., SHAY, D.K., NOEL, J.S., BRAGE, C., BRESEE, J.S., LIPSKY, S., MONROE, S.S., ANDO, T., HUMPHREY, C.D., ALEXANDER, E.R. and GLASS, R.I. (1999) An outbreak of acute gastroenteritis R. L.

Tracking emerging pathogens: the case of noroviruses

107

in a geriatric long-term-care facility: combined application of epidemiological and molecular diagnostic methods. Infect Control Hosp Epidemiol 20, 306–11. MATSUI, S.M. and GREENBERG, H.B. (2000) Immunity to calicivirus infection. J Infect Dis 181 Suppl 2, S331–5. MOORE, C., CLARK, E.M., GALLIMORE, C.I., CORDEN, S.A., GRAY, J.J. and WESTMORELAND, D. (2004) Evaluation of a broadly reactive nucleic acid sequence based amplification assay for the detection of noroviruses in faecal material. J Clin Virol 29, 290–6. MOTARJEMI, Y., KAFERSTEIN, F., MOY, G., NIYAGAWA, S. and MIYAGISHIMA, K. (1996) Importance of HACCP for public health and development. Food Cont 7, 77–85. MOUNTS, A.W., ANDO, T., KOOPMANS, M., BRESEE, J.S., NOEL, J. and GLASS, R.I. (2000) Cold weather seasonality of gastroenteritis associated with Norwalk-like viruses. J Infect Dis 181 Suppl 2, S284–7. MUNIAIN-MUJIKA, I., GIRONES, R., TOFINO-QUESADA, G., CALVO, M. and LUCENA, F. (2002) Depuration dynamics of viruses in shellfish. Int J Food Microbiol 77, 125–33. MYRMEL, M., BERG, E.M., RIMSTAD, E. and GRINDE, B. (2004) Detection of enteric viruses in shellfish from the Norwegian coast. Appl Environ Microbiol 70, 2678–84. NILSSON, M., HEDLUND, K.O., THORHAGEN, M., LARSON, G., JOHANSEN, K., EKSPONG, A. and SVENSSON, L. (2003) Evolution of human calicivirus RNA in vivo: accumulation of mutations in the protruding P2 domain of the capsid leads to structural changes and possibly a new phenotype. J Virol 77, 13117–24. NISHIDA, T., KIMURA, H., SAITOH, M., SHINOHARA, M., KATO, M., FUKUDA, S., MUNEMURA, T., MIKAMI, T., KAWAMOTO, A., AKIYAMA, M., KATO, Y., NISHI, K., KOZAWA, K. and NISHIO, O. (2003) Detection, quantitation, and phylogenetic analysis of noroviruses in Japanese oysters. Appl Environ Microbiol 69, 5782–6. NUANUALSUWAN, S. and CLIVER, D.O. (2002) Pretreatment to avoid positive RT-PCR results with inactivated viruses. J Virol Methods 104, 217–25. NUANUALSUWAN, S., MARIAM, T., HIMATHONGKHAM, S. and CLIVER, D.O. (2002) Ultraviolet inactivation of feline calicivirus, human enteric viruses and coliphages. Photochem Photobiol 76, 406–10. NYGARD, K., TORVEN, M., ANCKER, C., KNAUTH, S.B., HEDLUND, K.O., GIESECKE, J., ANDERSSON, Y. and SVENSSON, L. (2003) Emerging genotype (GGIIb) of norovirus in drinking water, Sweden. Emerg Infect Dis 9, 1548–52. OLIVER, S.L., DASTJERDI, A.M., WONG, S., EL-ATTAR, L., GALLIMORE, C., BROWN, D.W., GREEN, J. and BRIDGER, J.C. (2003) Molecular characterization of bovine enteric caliciviruses: a distinct third genogroup of noroviruses (Norwalk-like viruses) unlikely to be of risk to humans. J Virol 77, 2789–98. PARASHAR, U.D., DOW, L., FANKHAUSER, R.L., HUMPHREY, C.D., MILLER, J., ANDO, T., WILLIAMS, K.S., EDDY, C.R., NOEL, J.S., INGRAM, T., BRESEE, J.S., MONROE, S.S. and GLASS, R.I. (1998) An outbreak of viral gastroenteritis associated with consumption of sandwiches: implications for the control of transmission by food handlers. Epidemiol Infect 121, 615–21. PARKER, S., CUBITT, D., JIANG, J.X. and ESTES, M. (1993) Efficacy of a recombinant Norwalk virus protein enzyme immunoassay for the diagnosis of infections with Norwalk virus and other human ‘candidate’ caliciviruses. J Med Virol 41, 179–84. PARKS, C.G., MOE, C.L., RHODES, D., LIMA, A., BARRETT, L., TSENG, F., BARIC, R., TALAL, A. and GUERRANT, R. (1999) Genomic diversity of ‘Norwalk like viruses’ (NLVs): pediatric infections in a Brazilian shantytown. J Med Virol 58, 426–34. PARSHIONIKAR, S.U., WILLIAN-TRUE, S., FOUT, G.S., ROBBINS, D.E., SEYS, S.A., CASSADY, J.D. and HARRIS, R. (2003) Waterborne outbreak of gastroenteritis associated with a norovirus. Appl Environ Microbiol 69, 5263–8. PHAN, T.G., OKAME, M., NGUYEN, T.A., MANEEKARN, N., NISHIO, O., OKITSU, S. and USHIJIMA, H. (2004) Human astrovirus, norovirus (GI, GII), and sapovirus infections in Pakistani children with diarrhea. J Med Virol 73, 256–61. PONKA, A., MAUNULA, L., VON BONSDORFF, C.H. and LYYTIKAINEN, O. (1999) An outbreak of calicivirus associated with consumption of frozen raspberries. Epidemiol Infect 123, 469–74.

108

Emerging foodborne pathogens

RABENAU, H.F., STURMER, M., BUXBAUM, S., WALCZOK, A., PREISER, W.

and DOERR, H.W. (2003) Laboratory diagnosis of norovirus: which method is the best? Intervirology 46, 232– 8. REUTER, G., JIANG, X. and SZUCS, G. (2003) Noroviruses are the most common pathogens causing nosocomial gastroenteritis outbreaks in Hungarian hospitals. Orv Hetil 144, 1611–6. RICHARDS, G.P. (1999) Limitations of molecular biological techniques for assessing the virological safety of foods. J Food Prot 62, 691–7. RICHARDS, A.F., LOPMAN, B., GUNN, A., CURRY, A., ELLIS, D., COTTERILL, H., RATCLIFFE, S., JENKINS, M., APPLETON, H., GALLIMORE, C.I., GRAY, J.J. and BROWN, D.W. (2003) Evaluation of a commercial ELISA for detecting Norwalk-like virus antigen in faeces. J Clin Virol 26, 109–15. RICHARDS, G.P., WATSON, M.A. and KINGSLEY, D.H. (2004) A SYBR green, real-time RT-PCR method to detect and quantitate Norwalk virus in stools. J Virol Methods 116, 63–70. ROCKX, B., DE WIT, M., VENNEMA, H., VINJE, J., DE BRUIN, E., VAN DUYNHOVEN, Y. and KOOPMANS, M. (2002) Natural history of human calicivirus infection: a prospective cohort study. Clin Infect Dis 35, 246–53. ROCKX, B., BOGERS, W., HEENEY, J.L., VAN AMERONGEN, G. and KOOPMANS, M. (2005a) Experimental norovirus infection in non-human primates. Journal of Medical Virology 75(2), 313– 20. ROCKX, B.H., VENNEMA, H., HOEBE, C.J., DUIZER, E. and KOOPMANS, M.P. (2005b) Association of histo-blood group antigens and susceptibility to norovirus infections. J Infect Dis. 191(5), 749–54. SAIR, A.I., D’SOUZA, D.H., MOE, C.L. and JAYKUS, L.A. (2002) Improved detection of human enteric viruses in foods by RT-PCR. J Virol Methods 100, 57–69. SAWYER, L.A., MURPHY, J.J., KAPLAN, J.E., PINSKY, P.F., CHACON, D., WALMSLEY, S., SCHONBERGER, L.B., PHILLIPS, A., FORWARD, K., GOLDMAN, C. and OTHERS (1988) 25- to 30-nm virus particle associated with a hospital outbreak of acute gastroenteritis with evidence for airborne transmission. Am J Epidemiol 127, 1261–71. SCHERBA, G., WEIGEL, R.M. and O’BRIEN, W.D. JR (1991) Quantitative assessment of the germicidal efficacy of ultrasonic energy. Appl Environ Microbiol 57, 2079–84. SCHWAB, K.J., DE LEON, R. and SOBSEY, M.D. (1996) Immunoaffinity concentration and purification of waterborne enteric viruses for detection by reverse transcriptase PCR. Appl Environ Microbiol 62, 2086–94. SCHWAB, K.J., NEILL, F.H., ESTES, M.K., METCALF, T.G. and ATMAR, R.L. (1998) Distribution of Norwalk virus within shellfish following bioaccumulation and subsequent depuration by detection using RT-PCR. J Food Prot 61, 1674–80. SCHWAB, K.J., NEILL, F.H., FANKHAUSER, R.L., DANIELS, N.A., MONROE, S.S., BERGMIRE-SWEAT, D.A., ESTES, M.K. and ATMAR, R.L. (2000) Development of methods to detect ‘Norwalklike viruses’ (NLVs) and hepatitis A virus in delicatessen foods: application to a foodborne NLV outbreak. Appl Environ Microbiol 66, 213–8. SCOTT, F.W. (1980) Virucidal disinfectants and feline viruses. Am J Vet Res 41, 410–4. SEYMOUR, I.J. and APPLETON, H. (2001) Foodborne viruses and fresh produce. J Appl Microbiol 91, 759–73. SLOMKA, M.J. and APPLETON, H. (1998) Feline calicivirus as a model system for heat inactivation studies of small round structured viruses in shellfish. Epidemiol Infect 121, 401–7. SMILEY, J.R., CHANG, K.O., HAYES, J., VINJE, J. and SAIF, L.J. (2002) Characterization of an enteropathogenic bovine calicivirus representing a potentially new calicivirus genus. J Virol 76, 10089–98. SMILEY, J.R., HOET, A.E., TRAVEN, M., TSUNEMITSU, H. and SAIF, L.J. (2003) Reverse transcriptionPCR assays for detection of bovine enteric caliciviruses (BEC) and analysis of the genetic relationships among BEC and human caliciviruses. J Clin Microbiol 41, 3089– 99. STEINMANN, J. (2004) Surrogate viruses for testing virucidal efficacy of chemical disinfectants. J Hosp Infect 56 Suppl 2, S49–54.

Tracking emerging pathogens: the case of noroviruses STRAUB, T.M.

109

and CHANDLER, D.P. (2003) Towards a unified system for detecting waterborne pathogens. J Microbiol Methods 53, 185–97. SUBEKTI, D.S., TJANIADI, P., LESMANA, M., MCARDLE, J., ISKANDRIATI, D., BUDIARSA, I.N., WALUJO, P., SUPARTO, I.H., WINOTO, I., CAMPBELL, J.R., PORTER, K.R., SAJUTHI, D., ANSARI, A.A. and OYOFO, B.A. (2002) Experimental infection of Macaca nemestrina with a Toronto Norwalklike virus of epidemic viral gastroenteritis. J Med Virol 66, 400–6. SUGIEDA, M., NAGAOKA, H., KAKISHIMA, Y., OHSHITA, T., NAKAMURA, S. and NAKAJIMA, S. (1998) Detection of Norwalk-like virus genes in the caecum contents of pigs. Arch Virol 143, 1215–21. SUGIEDA, M. and NAKAJIMA, S. (2002) Viruses detected in the caecum contents of healthy pigs representing a new genetic cluster in genogroup II of the genus ‘Norwalk-like viruses’. Virus Res 87, 165–72. TEI, S., KITAJIMA, N., TAKAHASHI, K. and MISHIRO, S. (2003) Zoonotic transmission of hepatitis E virus from deer to human beings. Lancet 362, 371–3. THURSTON-ENRIQUEZ, J.A., HAAS, C.N., JACANGELO, J., RILEY, K. and GERBA, C.P. (2003) Inactivation of feline calicivirus and adenovirus type 40 by UV radiation. Appl Environ Microbiol 69, 577–82. TOMPKINS, D.S., HUDSON, M.J., SMITH, H.R., EGLIN, R.P., WHEELER, J.G., BRETT, M.M., OWEN, R.J., BRAZIER, J.S., CUMBERLAND, P., KING, V. and COOK, P.E. (1999) A study of infectious intestinal disease in England: microbiological findings in cases and controls. Commun Dis Public Health 2, 108–13. TREANOR, J.J., JIANG, X., MADORE, H.P. and ESTES, M.K. (1993) Subclass-specific serum antibody responses to recombinant Norwalk virus capsid antigen (rNV) in adults infected with Norwalk, Snow Mountain, or Hawaii virus. J Clin Microbiol 31, 1630–4. VAN DEN BRANDHOF, W.E., DE WIT, G.A., DE WIT, M.A. and VAN DUYNHOVEN, Y.T. (2004) Costs of gastroenteritis in The Netherlands. Epidemiol Infect 132, 211–21. VAN DER POEL, W.H., VINJE, J., VAN DER HEIDE, R., HERRERA, M.I., VIVO, A. and KOOPMANS, M.P. (2000) Norwalk-like calicivirus genes in farm animals. Emerg Infect Dis 6, 36–41. VAN DER POEL, W.H., VAN DER HEIDE, R., VERSCHOOR, F., GELDERBLOM, H., VINJE, J. and KOOPMANS, M.P. (2003) Epidemiology of Norwalk-like virus infections in cattle in The Netherlands. Vet Microbiol 92, 297–309. VAN DUYNHOVEN, Y.T.H.P, DE JAGER, C.M., KORTBEEK, L.M., VENNEMA, H., KOOPMANS, M.P.G., VAN LEUSDEN, F., VAN DER POEL, W.H.M., VAN DEN BROEK, M.J.M. EXPLORE PROJECT JAM. (2005) A one-year intensified study of outbreaks of gastroenteritis in the Netherlands. Epidemiology and Infection 133(1), 9–21. VENNEMA, H., DE BRUIN, E. and KOOPMANS, M. (2002) Rational optimization of generic primers used for Norwalk-like virus detection by reverse transcriptase polymerase chain reaction. J Clin Virol 25, 233–5. VINJE, J., ALTENA, S.A. and KOOPMANS, M.P. (1997) The incidence and genetic variability of small round-structured viruses in outbreaks of gastroenteritis in The Netherlands. J Infect Dis 176, 1374–8. VINJE, J., VENNEMA, H., MAUNULA, L., VON BONSDORFF, C.H., HOEHNE, M., SCHREIER, E., RICHARDS, A., GREEN, J., BROWN, D., BEARD, S.S., MONROE, S.S., DE BRUIN, E., SVENSSON, L. and KOOPMANS, M.P. (2003) International collaborative study to compare reverse transcriptase PCR assays for detection and genotyping of noroviruses. J Clin Microbiol 41, 1423–33. VINJE, J., HAMIDJAJA, R.A. and SOBSEY, M.D. (2004) Development and application of a capsid VP1 (region D) based reverse transcription PCR assay for genotyping of genogroup I and II noroviruses. J Virol Methods 116, 109–17. WHEELER, J.G., SETHI, D., COWDEN, J.M., WALL, P.G., RODRIGUES, L.C., TOMPKINS, D.S., HUDSON, M.J. and RODERICK, P.J. (1999) Study of infectious intestinal disease in England: rates in the community, presenting to general practice, and reported to national surveillance. The Infectious Intestinal Disease Study Executive. BMJ 318, 1046–50. WHO (2003) Inadequate plumbing systems probably contributed to SARS transmission. Wkly Epidemiol Rec 78, 371–2.

110

Emerging foodborne pathogens

WIDDOWSON, M.A., ROCKX, B., SCHEPP, R., VAN DE POEL, W.H., VAN DUYNHOVEN, Y.T. and KOOPMANS, M.P. (2005) Detection of serum antibodies to bovine norovirus in veterinarians and the general population in the Netherlands 70(1), 119–28. WISE, A.G., MONROE, S.S., HANSON, L.E., GROOMS, D.L., SOCKETT, D. and MAES, R.K. (2004) Molecular characterization of noroviruses detected in diarrheic stools of Michigan and Wisconsin dairy calves: circulation of two distinct subgroups. Virus Res 100, 165–77. YAZAKI, Y., MIZUO, H., TAKAHASHI, M., NISHIZAWA, T., SASAKI, N., GOTANDA, Y. and OKAMOTO, H. (2003) Sporadic acute or fulminant hepatitis E in Hokkaido, Japan, may be foodborne, as suggested by the presence of hepatitis E virus in pig liver as food. J Gen Virol 84, 2351–7. YODA, T., TERANO, Y., SUZUKI, Y., YAMAZAKI, K., OISHI, I., UTAGAWA, E., SHIMADA, A., MATSUURA, S., NAKAJIMA, M. and SHIBATA, T. (2000) Characterization of monoclonal antibodies generated against Norwalk virus GII capsid protein expressed in Escherichia coli. Microbiol Immunol 44, 905–14. ZAHORSKY J. (1929) Hyperemesis hiemis or the winter vomiting disease, Arch Pediatr 46: 391–95.

Industrial food microbiology and emerging foodborne pathogens

111

5 Industrial food microbiology and emerging foodborne pathogens L. Smoot, Nestlé USA, USA and J-L. Cordier, Nestlé Nutrition, Switzerland

5.1

Introduction

Over the last 20–25 years several infectious agents have been newly described or newly associated with foodborne outbreaks. Escherichia coli O157:H7, for example, was first recognised as a human pathogen in 1982 and identified as a cause of bloody diarrhoea. It was associated with the consumption of insufficiently cooked contaminated hamburgers (Riley et al., 1983). It has since then been associated with several other foods such as raw milk, fresh apple juice or salami (Willshaw et al., 2000). Cyclospora cayetanensis emerged as a foodborne pathogen after an outbreak in the United States caused by the consumption of imported Guatemalan raspberries (Herwaldt and Ackers, 1997). For other well-known human pathogens such as Campylobacter jejuni or Listeria monocytogenes the link to food as a vector of transmission was demonstrated only in the early 80s and 90s respectively (Blaser et al., 1983; Jackson and Wenger, 1993). Salmonella spp., a well-established and recognised pathogen, has only over the last 20 years been associated in outbreaks with ‘new’ and unusual foods such as chocolate (Gill et al., 1983), peanut butter (Scheil et al., 1998), breakfast cereals (Anonymous, 1998) or very recently with herbal tea (Rabsch et al., 2005). What are the factors characterising the emergence of a new pathogen? Food and waterborne illnesses occur as a result of the interaction of three factors: the virulence of the pathogen, the susceptibility of the consumers or hosts as well as the foods in which the pathogens are found. Any changes in one or more of these three elements have the potential to cause the emergence of new or the re-emergence of well-known pathogens. Changes in virulence are well illustrated for a number of microorganisms. An example is Escherichia coli, normally a harmless microorganism of the

112

Emerging foodborne pathogens

intestinal tract of humans or warm-blooded animals. Acquisition of mobile genetic elements located on so-called pathogenicity islands has led to strains able to form different types of toxins or showing enhanced invasivity of the host (see also Chapter 1). Details on different groups of pathogenic strains such as entero-pathogenic (EPEC), entero-toxigenic (ETEC), entero-invasive (EIEC), entero-hemorrhagic (EHEC), entero-aggregative (EAEC) E. coli have been reviewed by Willshaw et al. (2000); Robins-Browne and Hartland (2002); Kaper et al. (2004) as well as in Chapter 10 in this book. The presence of genetic elements encoding for different types of toxins has been reported for other, usually harmless, microorganisms belonging to different genera. Examples are Citrobacter freundii (Tschäpe et al., 1995), Klebsiella pneumoniae (Alessio et al., 1993), Bacillus spp. (Rowan et al., 2003) or Clostridium butyricum (Wang et al., 2000) that have been identified as occasional and sporadic causes of foodborne outbreaks. Regarding the hosts, there has been an increase in the number of people in sensitive subpopulations over the last 10–15 years (CAST, 1994; Morris and Potter, 1997; IFT, 2000) and this trend will certainly persist in the future. These subpopulations show a higher susceptibility to foodborne illnesses caused by well-known pathogens but also from microorganisms not usually pathogenic to healthy consumers. These at-risk sub-populations encompass pregnant women, age-related groups such as premature and debilitated infants during the first weeks of their life or elderly persons over about 75 years, immunocompromised groups including AIDS patients, individuals receiving anticarcinogenic or immunosuppressive medications and a group comprising patients suffering from chronic diseases such as diabetes or inflammatory bowel diseases. In developed countries these groups represent up to 20% or more of the population (Morris and Potter, 1997) with a tendency to increase. Although reliable statistical data are not available from all countries, increases in the number of individuals in these groups are also occurring in developing countries. In these developing regions, malnutrition is an additional factor which leads to an increased susceptibility of hosts to food and waterborne pathogens. Changes in the environment are multiple and often complex since numerous parameters are involved. The environment, in its broader sense, includes the world in which we live, processing environments as well as the food itself. Climatic changes and increases in the water temperatures, for example, favour the occurrence of blooms of various planktonic species. These blooms are linked to an increase in the number of outbreaks of neurotoxic, diarrheic and amnesic shellfish poisonings (Hungerford, 2001). The impact of climate changes on waterborne pathogens has been reviewed by Hunter (2003) and also includes discussion of the effects of heavy rainfalls and floods on the occurrence and dissemination of pathogens. Agricultural practices such as the land application of manure and biosolids contribute to the spread of pathogens of human and animal origin such as enteric bacterial pathogens, but also viruses and parasites (Gerba et al.,

Industrial food microbiology and emerging foodborne pathogens

113

2002). Globalisation of the food trade, in particular of unprocessed agricultural products irrigated or washed with contaminated water, further contribute to the spread of these pathogens. Examples are fruits from tropical countries such as berries, cantaloupes or mangoes that have been at the origin of outbreaks involving both unusual pathogens such as protozoan parasites (Ho et al., 2002) and well established ones such as Salmonella. Pathogens such as Salmonella spp., E. coli O157:H7 or C. botulinum have usually been linked to specific foods including dairy, egg and fish or meatbased products. Over recent years however, outbreaks have been linked to new foods and hitherto unknown contamination patterns have been identified. C. botulinum has been associated with unusual food products such as lotus rhizomes (Otofuji et al., 1987), garlic in oil (Lohse et al., 2003) or baked potatoes (Angulo et al., 1998). Internal contamination of eggs with Salmonella enteritidis through the infection of egg-laying flocks has been described by several authors and represents a change when compared to the previously known transmission route through faecal contamination of the shells (GuardPetter, 2001). Outbreaks due to acid apple or orange juice contaminated with E. coli O157:H7 or several serotypes of Salmonella have been reported by Cody et al. (1999) and Krause et al. (2001) respectively. In the case of the apple juice, apples originated from an orchard frequented by deer that were subsequently shown to carry E. coli O157:H7 and one lot contained decayed apples that had been waxed. In the case of the orange juice, the investigation showed the presence of Salmonella in the manufacturing plant and contamination during processing was therefore suggested. Absorption, penetration of washing water contaminated with Salmonella and subsequent colonisation of the fruit pulp has been at the origin of outbreaks with unusual and probably unexpected vehicles such as cantaloupes (Castillo et al., 2004), tomatoes (Iturriaga et al., 2003) and recently mangoes (Sivapalasingam et al., 2003; Penteado et al., 2004). Changes in the traditional preparation and use of foods have also been at the origin of outbreaks. This can be due to changes in the process itself or of the processing conditions, to the use of new ingredients or to the extension of shelf-life to respond to an increased demand and thus to a wider distribution of products. As described by Shaffer et al. (1990) an evolution of the traditional fermentation practices of native foods prepared by Alaskan natives has been at the origin of an increase of botulinum cases, thus a re-emergence of a well-known pathogen. Another typical example is the intoxication affecting 27 patients (one fatality) due to hazelnut yoghurt contaminated with preformed C. botulinum toxin (O’Mahony et al., 1990). The preformed toxin was traced back to the hazelnut conserve used in the manufacture of the yoghurt and had its origin in a modification of the recipe, i.e., the replacement of sugar by aspartame. This led to an increase in the water activity, allowing germination and outgrowth of spores surviving the heat-process followed by the subsequent growth and toxin formation. In this case modifications have very likely been made without reviewing the HACCP plans to assess and take into consideration

114

Emerging foodborne pathogens

the impact of the modifications. Finally in the case of the L. monocytogenes outbreak in Switzerland linked to the soft cheese ‘Vacherin Mont d’Or’ (Bula et al., 1995), subsequent investigation of the causes leading to the outbreak have shown that changes in the manufacturing conditions of the cheese, i.e. a decentralised production followed by a centralised maturation, have greatly contributed to the wide-spread contamination of cheese affecting several manufacturers. The causes outlined in the preceding sections well illustrate the complexity of the concept ‘emerging pathogens’ and the numerous factors that need to be taken into consideration. This represents an important challenge for Public Health Authorities but more so to food manufacturers who need to maintain and review their management tools carefully in case of changes of processing conditions or when new information becomes available on specific pathogens.

5.2

How to approach the issue of emerging pathogens

As discussed in the introductory section, emergence and re-emergence of pathogens is due to interactions of different parameters and is thus a complex process. The parameters and their conditions and interactions leading to such an emergence of new or re-emergence of old pathogens are not always easy to apprehend and to interpret. As an industrial food safety microbiologist or food safety manager it is important to be aware that numerous questions can and need to be raised when considering this issue. It is important to find ways and means to obtain and consolidate the relevant information, to follow scientific, technical and regulatory developments and to analyse and interpret the data, facts, information and opinions and finally to draw conclusions. This should serve as a basis to decide on the needs for specific actions and, if actions are considered necessary, to define the appropriate strategies. During all stages, but in particular when decisions are taken to initiate actions and develop control programs, it is important to consider not only scientific or technical elements but also other elements such as the public perception, the regulatory environment as well as business constraints. While collecting information and data, several questions such as the ones below (not exhaustive) have to be kept in mind. There are necessary to try to focus and streamline efforts and not to chase different issues at the same time. A lack of focus will not allow direction of efforts towards the right target and may lead to wrong decisions as to the required actions. ∑ ∑

Should otherwise harmless microorganisms causing one or few isolated outbreaks over several years or even decades be considered as emerging pathogens? Should such events be considered as exceptional and due to the unfortunate combination of different parameters or conditions and thus unlikely to occur again?

Industrial food microbiology and emerging foodborne pathogens ∑ ∑

∑

115

Should, on the contrary, such events trigger the implementation of specific control measures or should such measures only be investigated in the case of recurring cases over a certain period of time? Should microorganisms such Mycobacterium avium subsp. paratuberculosis, which is viewed as a potential human pathogen by several authors, but where the definitive conclusions are still missing, be considered as hazards and thus be addressed in food safety management systems? How closely should recognised pathogens for which control measures have been developed been followed? While certain pathogens such as Campylobacter jejuni, Listeria monocytogenes or Salmonella spp. are well known pathogens – new knowledge may require new actions. This can be due to outbreaks caused by vehicles not identified so far, changes in their behaviour, etc. It is probably for this reason that they are still considered as ‘emerging pathogens’ in several recent publications (Oldfield, 2001; Bielecki, 2003; Rottman and Gaillard, 2003).

Several of these questions are discussed in the following sections to illustrate the process.

5.3

How to identify emerging risks – sources of information

A first element to consider is the available and published information related to food or waterborne outbreaks. Careful monitoring of information often posted on the World Wide Web will provide information on product recalls and outbreaks. Such information is published regularly, frequently on a daily or weekly basis. While the information provided is often linked with known product/pathogen combinations, information on unexpected cases can be found. For example, the link between Salmonella Agona and herbal tea has been notified in the EU rapid alert system for food and feed in September of 2003. While the occurrence of Salmonella in herbs and plants is not new, the vehicle is, to our knowledge, not common. In addition it is certainly expected that vegetative pathogens, if present in the product, will be inactivated during preparation of the beverage with hot water. Such an outbreak and the information related to it should certainly serve as a trigger for microbiologists and food safety managers involved with this type of products to review essential elements of their HACCP studies. Particular attention should be given to the review of the hazard identification and control measures such as the selection of ingredients would certainly be appropriate. Another element to consider is a review of the way the product is used by consumers. While hot brew is probably the usual way of preparation, a shift to cold or lukewarm water may have occurred. This would warrant a review of instructions and, if necessary, their revision or a change in manufacturing conditions, e.g., the introduction of control measures such as appropriate bactericidal

116

Emerging foodborne pathogens

treatments to ensure the elimination of the pathogens while maintaining desired organoleptical characteristics. Further sources of information are, of course, published case studies on outbreaks that provide extremely valuable information, in particular for outbreaks caused by new or uncommon foods. Such reports and case studies will provide information on unknown sources of pathogens or on unknown or unusual routes of contamination. In the case of chocolate manufacture, for example, the information and details provided in publications describing the first outbreaks have allowed better characterisation of the routes of contamination (Cordier, 2000). Almost every single outbreak had a different cause and issues related with the ingredients, zoning and recontamination, role of water, etc., have become clearer within a few years. This knowledge has allowed reconsideration of, amongst other measures, the design of production facilities, the flow of product and the hygiene zoning within the factories. As a consequence of these outbreaks and the lessons learned, modern chocolate factories are certainly quite different from 20–30 years ago. The situation is more difficult when completely new microorganisms (at least in the field of foods) are implicated or in the case of very sporadic and infrequent outbreaks. In such cases it is very important if not essential to have a well established system and network to access and collect the information. Such cases may otherwise remain unnoticed or the information may only become available late as case reports are published often one or more years later. In this context, surveillance reports of food and waterborne outbreaks as performed by Public Health Authorities also play an important role in the collection of information useful to food manufacturers. Surveillance activities involve the structured and systematic collection of data on outbreaks and their evaluation and dissemination (Swaminathan et al., 2001). The rapid identification of outbreaks and related causes allows governmental regulatory authorities and food manufacturers to trigger the rapid recall of incriminated products and thus to block or minimise the extent of the outbreak. The interconnection or expansion of existing schemes such as SalmNet, EnterNet and PulseNet collecting relevant information results in an increased efficiency. Examples are outbreaks due to infant formulae contaminated with Salmonella strains showing distinct biochemical or molecular characteristics (Usera et al., 1996; Threlfall et al., 1998) or a large multistate outbreak in the United States due to frankfurters contaminated with a particular strain of L. monocytogenes (Anonymous, 2000). The primary aim of such surveillance systems is certainly for authorities to identify outbreaks at an early stage and to take appropriate measures to minimise their extent. The information, if available and accessible, can, however, also be used by food safety managers to assess the potential threats for its own business. For example, it can be determined whether incriminated raw materials or products have been purchased as ingredients or intermediate products, whether the manufacturer of incriminated products is used as supplier

Industrial food microbiology and emerging foodborne pathogens

117

or as contract manufacturer. Such a situation has recently been described in France for two outbreaks of Salmonella Agona linked to contaminated infant formula from two different companies but manufactured both on the same production line by one company (Anonymous, 2005). While the surveillance and typing schemes are devoted to known pathogens, thus covering about 60% of the known foodborne pathogens, in numerous cases the etiological agent is neither isolated nor identified. According to Mead et al. (1999), in the United States more than 80% of the 76 million cases of foodborne illness are of ‘unknown origin’. This will, of course, trigger new research to identify the vector and particular attention has, for example, recently been focused on parasites or viruses as causative agents for foodborne illnesses (Pozio, 2003; Koopmans and Duizer, 2004) With respect to new pathogens such surveillance schemes also provide an increasing chance of detecting strains which are not normally part of the routine analytical activities but which will draw particular attention in case of a sudden and unusual accumulation of cases of illnesses. Such patterns of illness will more than likely trigger specific investigations in order to determine the cause(s). In certain cases this will certainly also allow identification of unusual or new pathogens such as E. coli O111 in Australia (Paton et al., 1996) which has then been identified as important serotype in this region while it is not or is less frequently found in others. A further evolution in preventing foodborne illnesses is better integration of observations from surveillance programs in different fields but that are related to the food chain. Information from the Veterinary Diagnostic Laboratory Reporting System assessing trends in infectious animal diseases is certainly key in understanding, for example, the incidence of E. coli O157:H7 throughout beef and dairy cattle herds and thus in evaluating the risks for the food chain. Emerging infectious pathogens in wildlife may also have an impact at some stage on domestic animals such as cattle and thus gain access into the food chain. Surveys and compilations published in this field may therefore be useful and valuable to detect trends at an early stage and to take appropriate measures already at primary production (Dobson and Foufopoulos, 2001). Another element to consider in the design and implementation of management options is the requirements or recommendations issued by public health authorities at national or international levels. For example, over the last few years, microbiological risk analysis has become more widely applied by authorities in different countries and organisations. In terms of disease, risk is a measure of the probability of occurrence of a particular illness caused by a specific pathogen and the severity of that illness. Microbiological risk analysis is based, as defined by Codex Alimentarius (CAC, 1999), on three components: risk assessment, risk management and risk communication and will become an increasingly essential part of the establishment of sciencebased policies. When used to define regulations and policies, risk assessment reflects the expected impact of a particular pathogen/food combination. It also provides

118

Emerging foodborne pathogens

indications as to which control measures are possible and evaluates their potential efficacy in eliminating or minimising the public health burden. In addition, the systematic and structured assessment provides an idea of the level of urgency and controversy related to the assessed issue. Risk assessment, the scientific and technical part of the risk analysis has four main components which are discussed in more detail in Chapter 6 of this book: (i) the hazard identification, (ii) the exposure assessment, (iii) the hazard characterisation and (iv) the risk characterisation. The outcome of such risk assessments is used to define a policy to protect consumers from illness or injury caused by foods, in particular to establish an appropriate level of protection (ALOP), a concept introduced in the WTO/SPS agreements. An ALOP is expressed as the number of cases or probability of disease of (a certain) illness per year per 100,000 persons in a given population. To be useful for manufacturers as well the ALOP needs to be translated into a level of safety and thus to a level of a hazard in a food. It is then referred to as a food safety objective (FSO) and defined as the maximum frequency and/or concentration of a hazard in a food at the time of consumption (ICMSF 2002 and CAC, 2004). In addition the term performance objective (PO) has recently been defined by Codex Alimentarius (2004) which is defined in the same way but at an earlier point in the food chain. A detailed discussion on FSO and PO is provided in Chapter 7 of this book. What is the relevance of these objectives for food manufacturers? The FSO and PO represent quantifiable elements and serve as an interface between governmental and industrial food safety management systems. Since they express maximal levels or limits which have to be achieved through the implementation of control measures during processing and further handling they need to be considered carefully. FSOs and POs can also be used to derive microbiological criteria which are then used to determine the acceptability of a specific lot with respect to quality and safety requirements (ICMSF, 2002). It is therefore clear that it is extremely important for industrial food safety microbiologists and food safety managers to understand these concepts and to consider them in their management systems. The conceptual formula (eqn 5.1) developed by the ICMSF (2002) provides a possible approach for manufacturers to determine whether an FSO or a PO can be met as well as to understand which factors may contribute in achieving this goal or, alternatively, may jeopardise the safety of a product: H0 – S R + S I £ FSO or PO

5.1

where, H0 represents the initial load of a specific pathogen; S R represents the total reduction achieved during the whole process; S I represents the total increase observed during the whole process and which is composed by growth or recontamination; FSO and PO represent the hazard levels at the moment of consumption and in the food chain respectively.

Industrial food microbiology and emerging foodborne pathogens

119

This conceptual formula describes, in fact, the fate of a pathogen throughout the food chain or in a segment of this chain. It describes the interaction of the different parameters which should allow achievement of the established PO or FSO. The effect of one or more control measures applied to achieve the required FSO is expressed as ‘performance criterion’; the parameters at single processing steps are termed as ‘process criteria’ (e.g. a time/temperature combination at a sterilisation step). As expected, most of the risk assessments performed so far have been focused on those well-established pathogens and foods frequently involved in foodborne outbreaks. Examples are the risk assessments for Listeria monocytogenes in selected ready-to-eat foods (FDA/USDA, CDC, 2003) or for Salmonella enteritidis in eggs (FSIS, 1998). Risk assessments or risk profiles on less common combinations of pathogens and foods such as Listeria monocytogenes and ice cream have been recently published by the Food and Environmental Hygiene Department in Hong Kong (FEHD, 2001) and by the New Zealand Food Safety Authority (NZFSA, 2003) or for Bacillus cereus and rice (NZFSA, 2004). These documents provide good summaries of existing knowledge and detailed information on the current opinions with regard to these issues. This is important to assess whether the measures currently implemented by food manufacturers are appropriate or whether they need to be strengthened. In the case of the ice cream, for example, both authorities agreed to a very low risk related to this category of products. This element can be considered when reviewing current preventive measures applied in processing facilities which seem therefore adequate in achieving the appropriate protection. In the case of Bacillus cereus, the document represents as well a very good basis for discussions on microbiological criteria demonstrating that a certain level of tolerance will most likely not affect public health. The situation concerning emerging or re-emerging pathogens is, of course, much more difficult to handle because detailed knowledge is frequently lacking. It is certainly not possible to perform risk assessments or even risk profiles in the case of individual sporadic cases. However, as the number of cases increases and the information on the causative agents and the food vehicle(s) becomes available, opinions and strategies may be developed. When epidemiological evidence indicates that a hazard is not under control or a new one is emerging, expert panels may identify ways to increase consumer protection. These expert panels, usually composed of participants from different disciplines and horizons, will evaluate the risks based on the available scientific data and propose possible mitigation options if deemed necessary. Such panels may also be involved in addressing possible issues caused by changes in food processing technologies, food packaging or distribution systems. Information is, however, not completely missing and certain newly recognised potential waterborne pathogens such as Cryptosporidium have recently been addressed in a risk assessment (AFSSA, 2002). Government and international bodies have, for example, made extensive use of expert

120

Emerging foodborne pathogens

panels in assessing the situation with respect to Enterobacter sakazakii (FAO/WHO, 2004) and a similar report has been issued by the European Food Safety Agency (EFSA, 2004). The report and recommendations issued by the FAO/WHO following the expert consultation in 2004 will serve as the basis for the revision of the current Codes of Hygiene for the Manufacture of Infant Formulae as well as for the revision of the microbiological criteria established by the Codex Alimentarius (1979). The ones of the EFSA are being used to establish new microbiological criteria for infant formula. Limits for Enterobacteriaceae (absence in 10 ¥ 10g) and, in case of positives, for E. sakazakii (absence in 30 ¥ 10g) have been introduced in Europe in 2006 (EC, 2005). Similar limits ae being discussed by Codex Alimentarius. At different occasions industry expert panels have considered the factors leading to foodborne disease due to, at the time, emerging pathogens and developed recommendations as to appropriate control measures. Examples are guidance documents to control E. coli O157 in dry fermented sausages through an appropriate combination of control measures (Blue Ribbon Task Force, 1996) or to prevent post-process contamination of meat products by L. monocytogenes (Tompkin et al., 1999; Tompkin, 2002). While these documents provide guidance on precise control measures, other reports such as, for example, on M. avium subsp. paratuberculosis issued by the International Dairy Federation (IDF, 2001), only provide a summary of the knowledge related to the organism, its ecology, detection and behaviour. Such reports, however, are useful in identifying gaps in knowledge and thus the need for further research. In this case, for example, gaps have been identified in the precise knowledge on the heat inactivation of this microorganism. Results originating from different laboratories have shown conflicting results and a need was identified to perform future studies under more controlled and realistic conditions, i.e., to take into account parameters relevant to industrial settings and installations. A summary of the current knowledge has been published by Gould (2004).

5.4

Control measures during food manufacture

At the level of the food manufacturers, the basic management tools to ensure the commercialisation of safe products are the well-known Good Manufacturing and Good Hygiene Practices (GMP/GHP) and Hazard Analysis and Critical Control Point (HACCP) principles. These management tools have proven effective to control well-known pathogens. Outbreaks which unfortunately still occur are not due to the inappropriateness of the tools but commonly to a poor understanding of issues, the poor implementation of GMP/GHPs and to some extent of HACCP or due to accidents. The factors contributing to outbreaks summarised by Hobbs and Roberts (1987), i.e., preparation of food too far in advance, storage at ambient temperature, inadequate cooling, inadequate reheating, contaminated processed foods, consumption of raw

Industrial food microbiology and emerging foodborne pathogens

121

foods, etc., are still today at the top of the lists established by different authors and public health organisations. Both GHP/GMP and HACCP are in principle also well adapted to control emerging and re-emerging pathogens. To be effective, however, these tools must be maintained and updated as new information on such hazards becomes available. The occurrence of new pathogens or the identification of new types of foods as vectors for the transmission of known agents requires revision of the control measures according to these new findings and their adaptation where necessary. This is in no way different to the required revisions of HACCP in case of changes in recipes of products or of processing conditions which, in principle, should help in avoiding issues. The question can be raised as to whether certain outbreaks due to such emerging or re-emerging pathogens could have been avoided through a systematic review of existing knowledge and experiences. In the case of the outbreak due to berries contaminated with parasites, for example, the basic hygiene recommendations usually made to travellers, i.e., not to eat this type of fruit in tropical countries has been ‘bypassed’ through the importation into a country with a temperate climate. The outbreaks related to Salmonellacontaminated mangoes have certain analogies with outbreaks caused by contaminated canned foods and where post-process contamination due to penetration of contaminated cooling and cleaning water through micro-leaks has been shown. This raises certainly the question on how well the role of process water is understood and considered and how well control measures related to water treatment are implemented. L. monocytogenes has been recognised for years as the cause of postprocess contamination in soft-cheese manufacturing or in refrigerated meats such as pâté. These cases have allowed to identify causes and routes of contamination and in particular to better understand the role of niches in the processing environment as sources of pathogens. Subsequent outbreaks due to contaminated frankfurter sausages or sweet butter have been traced back to environmental contaminations as well (Anonymous, 2000; Lyytikainen et al., 2000). The role of post-process (heat-treatment) contamination from the processing environment is extremely important but is often not considered with the appropriate care. (Tompkin, 2002; Reij et al., 2004). Why was this knowledge not taken into account when considering GMP/ GHP in the case of sweet butter production, which has been at the origin of an outbreak? Knowledge and interpretation of the details of previous outbreaks related to refrigerated products, of the microbial ecology of L. monocytogenes in dairy processing environments and the principle(s) of post-process contaminations may have allowed producers to anticipate the issue. Could the outbreak due to the consumption of garlic contaminated with C. botulinum mentioned earlier in this chapter not have been prevented? Although unusual, similar cases had already been described almost ten years earlier (Morse et al., 1990; St. Louis et al., 1998) and the information was available and could have been used to design appropriate control measures.

122

Emerging foodborne pathogens

Good Manufacturing and Good Hygiene Practice represent the basic operating and environmental conditions that are necessary for the production of safe, wholesome foods. These general conditions and practices, many of which are described and specified in international or national regulations/ guidelines (e.g. CAC, 1997), are, in general, well known and widely applied. In recognition of specific and particular issues related to individual products or product categories, more specific documents have been issued by international public health organisations or by professional organisations. Examples are the codes for the hygienic manufacture of low acid canned products issued by the Codex Alimentarius (CAC, 1993), the code for milk and dairy products (CAC, 2004), guidelines or codes of hygiene for the manufacture of chilled culinary products (ECFF, 1996), of cocoa, chocolate and confectionery products (IOCCC, 1993) or of dry milk as well as other dairy products (IDF, 1991, 1994). These specific documents highlight particularly important control measures such as the roasting of cocoa beans or the heating conditions of different culinary products as well as requirements for the zoning within a processing facility to prevent post-process contamination, or recommendations on special cleaning procedures. The HACCP system is a management tool which is applied to control specific hazards, i.e., to prevent, eliminate or reduce them to an acceptable level. It was designed to enhance the safety for foods produced for the American space programme in the 1970s (Baumann, 1992). Numerous publications have since been devoted to HACCP and details can be found in different documents (e.g. ICMSF, 1988 Codex Alimentarius, 1997; Mortimer and Wallace, 1998 or ILSI, 2004). Examples of the evolution of control measures as a function of new information and learning experiences is provided below for Salmonella spp., which today are well-known pathogens but which have been considered as emerging or re-emerging pathogens at one stage. The cases described should serve as an example for the necessary steps in the control of new emerging pathogens. Similar examples can be found for other pathogens such as L. monocytogenes. To our knowledge no specific studies have been performed in the past on the occurrence and distribution of Salmonella in dry milk powder or infant formulae factories. The knowledge has, in fact, been gathered following outbreaks such as those reported in the mid 1970s in Australia (Forsyth et al., 2003) or the Farley’s case in late 1985 in the UK (Rowe et al., 1987). These cases have clearly shown the importance of post-process contamination after the drying-step and the need to eradicate Salmonella from these areas in the production facilities. In 1985 a study undertaken by the USDA on milk powder production showed that numerous milk powder plants were still not designed to ensure the containment of unknown contamination and in particular of Salmonella (Mettler, 1989). During this period several codes of practice have been issued by organisations such as the Codex Alimentarius (CAC, 1979) and the

Industrial food microbiology and emerging foodborne pathogens

123

International Dairy Federation (1991). In addition to general requirements on the design of the factory and the layout of processing lines, most of these documents focus on preventing the ingress of Salmonella in the production premises. In particular, areas close to the processing line are critical. In the case of Salmonella presence, practices to avoid its spread throughout the whole plant and to prevent its eventual establishment in a more persistent manner are described. Recommendations also underline the importance of raw material and ingredient processing and handling as well as the prevention of post-process contamination from the line and processing environment. The gradual introduction of preventive measures based on these recommendations has led to an improvement as shown in Table 5.1 (based on Mettler, 1989). Today the incidence of Salmonella in dry milk powders as well as in infant formulae which are manufactured on similar processing lines can be considered as rare. Occasional instances in milk powder and infant formula do occur and presence can be ascribed to errors in the application of the preventive hygiene measures, e.g., use of contaminated dry-mixed ingredients or breakdown of hygiene measures. In the case of chocolate, Salmonella emerged as a pathogen in the 1980s. The occurrence of several outbreaks, which have been summarised by Cordier (2000) triggered the development of specific guidelines to improve the hygienic control measures implemented by manufacturers. Particular emphasis has been put on the roasting and zoning of the subsequent processing steps in order to avoid post-processing recontamination (IOCCC 1991, 1993). For almost 15 years no further outbreaks were registered until 2001/2002 where chocolate contaminated with Salmonella enterica serovar Oranienburg was the origin of a large outbreak (Prager and Tschäpe, 2003) showing that failures of well-known preventive measures are still possible. Table 5.1 Incidence of Salmonella in dry milk powder over a period of 20 years, 1967– 1988 (based on Mettler, 1989) USDA Salmonella surveillance program for skim milk powder Year

No. samples tested

% positive

Year

No. samples tested

% positive

1967 1968 1969 1970 1971 1972 1973 1974 1975 1976 1977

7,843 17,496 12,822 11,254 25,321 28,736 16,652 12,058 10,423 14,418 16,517

0.7 0.2 0.3 0.36 0.27 0.17 0.31 0.52 0.71 1.9 1.08

1978 1979 1980 1981 1982 1983 1984 1985 1986 1987 1988

17,224 13,036 9,720 13,061 16,624 23,622 23,455 26,479 31,912 19,431 14,058

0.6 0.3 0.1 0.06 0.02 0.01 0.11 0.14 0.03 0.03 0.01

124

Emerging foodborne pathogens

Microbiological risk assessment is a tool for authorities developing health protection policies. However, the principles and approach as well as certain elements such as exposure assessment can be used by food manufacturers to review and strengthen their preventive measures. In particular the conceptual equation (5.1) proposed by ICMSF (2002) will contribute to a more systematic and structured assessment of the performance of individual processes. Although no FSOs and POs have been established so far, the equation can nevertheless be of use, for example, in benchmarking different products or newly developed products in comparison to existing categories showing a good (historical) safety record. The fate of pathogens can be described using the different elements (H0, SR and SI) of this conceptual formula. The systematic description of the elements of the product–pathogen–pathway (PPP) should allow description of the outcome of the different steps and identification of elements contributing most to safety and where there may be gaps in knowledge. While the elements H0 and SR are usually well understood, SI represents a combination of increase due to growth and increase due to recontamination. Numerous data are available on the growth behaviour of pathogens as a function of intrinsic and extrinsic parameters (e.g. ICMSF, 1996) and several growth models such the Food Micro Model, the Pathogen Modelling Program or Growth Predictor are available, some directly on the World Wide Web. However, gaps still exist, in particular for specific hurdles and for different new processing technologies. More research will be needed to close these gaps. A major issue, however, is the increase of pathogens, frequently to low or very low levels, due to post-process contamination. For products supporting growth, this represents an additional risk for multiplication to unacceptable levels. Post-process contamination has been identified as a frequent cause of outbreaks as summarised by Reij and Den Aantrekker (2004). Its impact is, however, frequently overlooked and thus appropriate preventive measures are not always implemented or effective. In order to design and implement such control measures it is important to understand the microbial ecology of these microorganisms and their behaviour in different niches in processing facilities, from their presence or ingress into critical areas to their establishment as a permanent population. The importance of these routes of contamination as well as pathogen monitoring to verify the effectiveness of preventive measures has been underlined by the ICMSF (2002).

5.5

Conclusions

A literature review by Taylor et al. (2001) identified 1,415 species of infectious agents known to be pathogenic to humans, 868 or 61% being considered zoonotic, i.e., transmissable between humans and animals. There are 175 pathogenic species associated with diseases considered to be emerging, 75% (132) being zoonotic. The authors estimated that zoonotic pathogens are

Industrial food microbiology and emerging foodborne pathogens

125

twice as likely to be associated with emerging diseases as non-zoonotic pathogens. Although no precise estimation of the role of food and water has been made, it is likely that a number of these ‘emerging’ pathogens will be transmitted through food vectors. While some will behave in a similar way to known pathogens, important differences may exist for others. It will be important to understand these differences in order to adapt the control measures or to develop new ones. In view of such reports and forecasts, it is important to underline the importance of a careful monitoring of the occurrence of outbreaks due to new pathogens or to new food vehicles and of an appropriate interpretation of the situation with respect to prevention. Existing preventive measures (GMP/GHP and HACCP) are in principle effective in preventing outbreaks and controlling pathogens including those recognised as emerging agents for human foodborne illness. It is, however, important to consider the need for modifications of these measures to address specific emerging pathogens. The design and implementation of such modifications require a good knowledge of the organisms, i.e., appropriate analytical and typing methods to understand their occurrence and incidence in raw materials and ingredients, their behaviour during processing and in foods as well as their ecology in food processing environments. This will frequently require investment in terms of research that can last for weeks, even up to years depending on the microorganism and the complexity of the questions addressed. However, these data and knowledge will allow food manufacturers to review and improve the preventive control measures already implemented.

5.6

References

AFFSA (AGENCE FRANÇAISE DE SÉCURITÉ SANITAIRE DES ALIMENTS) (2002) Evaluation quantitative

du risque sanitaire lié à la présence de Cryptosporidium sp. dans l’eau distribuée. http://www.afssa.fr/ftp/afssa/actu/AQRCryptoseptembre02.pdf ALESSIO M, ALBANO F, TARALLO L and GUARINO A. (1993) Interspecific plasmid transfer and modification of heat-stable enterotoxin expression by Klebsiella pneumoniae from infants with diarrhea. Pediatr Res., 33, 205–208. ANGULO F J, GETZ J, TAYLOR J P, HENDRICKS K A, HATHEWAY C L, BARTH S S, SOLOMON H M, LARSON A E, JOHNSON E A, NICKEY L N and RIES A A. (1998) A large outbreak of botulism: the hazardous baked potato. J Infect Dis., 178, 172–177. ANONYMOUS (1998) Multistate outbreak of Salmonella serotype Agona infections linked to toasted oats cereal – United States, April–May, 1998. Morb Mortal Wkly Rep., 47, 462–464. ANONYMOUS (2000) Multistate outbreak of listeriosis – United States, 2000. Morb Mortal Wkly Rep., 49, 1129–1130. Erratum in: Morb Mortal Wkly Rep., (2001), 50, 101. ANONYMOUS (2005) Epidémie de salmonellose à Salmonella enterica serotype Agona chez des nourrissons, France, janvier–avril 2005. Point final de l’investigation au 10 juin 2005. http://www.invs.sante.fr/presse/2005/le_point_sur/salmonella_agona_150605/ BAUMANN H E (1992) Introduction to HACCP. In HACCP Principles and Applications, Eds Pierson M D and Corlett D A, Van Nostrand Reinhold, New York. BIELECKI J (2003) Emerging food pathogens and bacterial toxins. Acta Microbiol Pol., 52 Suppl., 17–22

126

Emerging foodborne pathogens

BLASER M J, TAYLOR D N

and FELDMAN R A (1983) Epidemiology of Campylobacter jejuni infections. Epidemiol Rev., 5, 157–176. BLUE RIBBON TASK FORCE (1996) Dry fermented sausage and E. coli O157:H7. Chicago: National Cattlemen’s Beef Association; 1996. Report no. 11–316. BULA C J, BILLE J and GLAUSER M P (1995) An epidemic of food-borne listeriosis in western Switzerland: description of 57 cases involving adults. Clin Infect Dis., 20, 66–72. CAC (CODEX ALIMENTARIUS COMMISSION) (1979) Recommended International Code of Hygienic Practice for Foods for Infants and Children; CAC/RCP 2-1979, Rome: Food and Agriculture Organization of the United Nations. CAC (CODEX ALIMENTARIUS COMMISSION) (1993) Recommended International Code of Hygienic Practice for Low and Acidified Low Acid Canned Foods. CAC/RCP 23-1979, Rev. 2 (1993); Rome: Food and Agriculture Organization of the United Nations. CAC (CODEX ALIMENTARIUS COMMISSION) (1997) Recommended International Code of Practice – General Principles of Food Hygiene. CAC/RCP1-1969, Rev. 3-1997, Amd (1999), Rome: Food and Agriculture Organization of the United Nations. CAC (CODEX ALIMENTARIUS COMMISSION) (1999) Principles and Guidelines for the Conduct of Microbiological Risk Assessment; CAC/GL-30, Rome: Food and Agriculture Organization of the United Nations. CAC (CODEX ALIMENTARIUS COMMISSION) (2004) Code of Hygienic Practice for Milk and Milk Products. CAC/RCP 57-2004, Rome: Food and Agriculture Organization of the United Nations. CAST (COUNCIL FOR AGRICULTURE SCIENCE AND TECHNOLOGY) (1994) Foodborne pathogens: Risks and consequences. Council of Agricultural Science and Technology, Ames, Ia. CASTILLO A, MERCADO I, LUCIA L M, MARTINEZ-RUIZ Y, PONCE DE LEON J, MURANO E. A. and ACUF G R (2004) Salmonella contamination during production of cantaloupe: a binational study. J Food Prot., 67, 713–720. CODY S H, GLYNN M K, FARRAR J A, CAIRNS K L, GRIFFIN P M, KOBAYASHI J, FYFE M, HOFFMAN R, KING A S, LEWIS J H, SWAMINATHAN B, BRYANT R G and VUGIA D J (1999) An outbreak of Escherichia coli O157:H7 infection from unpasteurised commercial apple juice. Ann Intern Med., 130, 202–209. CORDIER J L (2000) Sugar, honey, cocoa, chocolate and confectionery products. In The Microbiological Safety and Quality of Food, Vol. 1 (Chapter 35), Lund BM, BairdParker T C and Gould G W (eds), Aspen Publications. DOBSON A and FOUFOPOULOS J (2001) Emerging infectious pathogens of wildlife. Phil. Trans. R. Soc. Lond. B, 356, 1001–1012. EC (EUROPEAN COMMISSION) (2005) Commission Regulation (EC) No. 2073/2005 of November 2005 on microbiological criteria for foodstuffs. Official J of European Union, L338, 1–26. ECFF (EUROPEAN CHILLED FOOD FEDERATION) (1996) Guidelines for Good Hygienic Practice in the Manufacture of Chilled Foods. Chilled Food Association, Kettering UK. EFSA (EUROPEAN FOOD SAFETY AGENCY) Opinion of the scientific panel on biological hazards on the request from the commission related to the microbiological risks in infant formulae and follow-on formulae. (Question no EFSA-Q-2003-111). EFSA J., 113, 1–35. FAO/WHO (FOOD AND AGRICULTURE ORGANIZATION/WORLD HEALTH ORGANIZATION) (2004) Report of the meeting on Enterobacter sakazakii and other microorganisms in powdered infant formula. http://www.who.int/foodsafety/publications/micro/enterobacter_ sakazakii/en/ FDA (FOOD AND DRUG ADMINISTRATION) (2003) Quantitative Assessment of Relative Risk to Public Health fro Foodborne Listeria monocytogenes Among Selected Categories of Ready-to Eat Foods. http://www.fodsafety.gov/~dms/lmr2-toc.html. FEHD (FOOD AND ENVIRONMENTAL HYGIENE DEPARTMENT) (2001) Microbiological Risk Assessment of Ice Cream. http://www.fehd.gov.hk/safefood/report/icecream/report.html#con FORSYTH J R, BENNETT N M, HOGBEN S, HUTCHINSON E M, ROUCH G, TAN A and TAPLIN J (2003) The year of the Salmonella seekers – 1977. Aust N Z J Public Health., 27, 385–389.

Industrial food microbiology and emerging foodborne pathogens FSIS (FOOD SAFETY AND INSPECTION SERVICE)

127

(1998) Salmonella Enteritidis Risk Assessment – Shell eggs and egg products. FSIS USDA. http:// www.fsis.usda.gov/OPHS/risk. GERBA C P, PEPPER I L and WHITEHEAD L F (2002) A risk assessment of emerging pathogens of concern in the land application of biosolids. Water Sci Technol., 46, 225–230. GILL O N, SOCKETT P N, BARTLETT C L, VAILE M S, ROWE B, GILBERT R J, DULAKE C, MURRELL H C and SALMASO S (1983) Outbreak of Salmonella napoli infection caused by contaminated chocolate bars. Lancet, 1, 574–577. GOULD, G (2004) Mycobacterium avium subsp. paratuberculosis (MAP) and the food chain. ILSI Europe Report Series, Belgium. GUARD-PETTER J (2001) The chicken, the egg and Salmonella enteritidis. Environ Microbiol., 3, 421–430. HERWALDT B L and ACKERS M L ( 1997) An outbreak in 1996 of cyclosporiasis associated with imported raspberries. The Cyclospora Working Group. N Engl J Med., 336, 1548–1556. HO A Y, LOPEZ A S, EBERHART M G, LEVENSON R, FINKEL B S, DA SILVA A J, ROBERTS J M, ORLANDI P A, JOHNSON C C and HERWALDT B L (2002) Outbreak of cyclosporiasis associated with imported raspberries, Philadelphia, Pennsylvania, 2000. Emerg Infect. Dis., 8, 783– 788. HOBBS B C and ROBERTS D (1987) Food Poisoning and Food Hygiene. 5th edition, Edward Arnold Ltd. London. HUNGERFORD J M (2001) Seafood toxins. In Guide to Foodborne Pathogens, ed. by Labbé R G and Garcia S, pp. 267–283. John Wiley and Sons, New York. HUNTER P R (2003) Climate change and waterborne and vector-borne disease. J Appl Microbiol., 94, Suppl. 37S–46S. ICMSF (INTERNATIONAL COMMISSION ON MICROBIOLOGICAL SPECIFICATIONS FOR FOODS) (1988) HACCP in Microbiological Safety and Quality. Blackwell Scientific Publications. ICMSF (INTERNATIONAL COMMISSION ON MICROBIOLOGICAL SPECIFICATIONS FOR FOODS) (1996) Microorganisms in Foods, Volume 5 – Microbiological Specifications of Food Pathogens. Blackie Academic and Professional. ICMSF (INTERNATIONAL COMMISSION ON MICROBIOLOGICAL SPECIFICATIONS FOR FOODS) (2002) Microorganisms in Foods, Volume 7 – Microbiological Testing in Food Safety Management. Kluwer Academic/Plenum Publishers. IDF (INTERNATIONAL DAIRY FEDERATION) (1991) IDF recommendations for the hygienic manufacture of spray dried milk powders. Bulletin no. 267. Brussels. IDF (INTERNATIONAL DAIRY FEDERATION) (1994) Recommendations for the hygienic manufacture of milk and milk based products. Bulletin no. 292. Brussels. IDF (INTERNATIONAL DAIRY FEDERATION) (2001) Mycobacterium paratuberculosis. IDF Bulletin no. 362. Brussels. IFT (INSTITUTE OF FOOD TECHNOLOGISTS) (2000) IFT Expert Report on Emerging Microbiological Food Safety Issues – Implications for Control in the 21st Century. ILSI EUROPE (INTERNATIONAL LIFE SCIENCES INSTITUTE) (2004) A simple Guide to Understanding and Applying the Hazard Analysis Critical Control Point Concept. (3rd revised edition), Brussels). IOCCC (INTERNATIONAL OFFICE OF COCOA, CHOCOLATE AND CONFECTIONERY) (1991) The IOC Code of Hygienic Practice based on HACCP for the Prevention of Salmonella Contamination in Cocoa, Chocolate and Confectionery Products, 1OCCC, Brussels. IOCCC (INTERNATIONAL OFFICE OF COCOA, CHOCOLATE AND CONFECTIONERY) (1993) The IOCCC Code of Good Manufacturing Practice. Specific GMP for the Cocoa, Chocolate and Confectionery Industry, IOCCC, Brussels. ITURRIAGA M H, ESCARTIN E F, BEUCHAT L R and MARTINEZ-PENICHE R (2003) Effect of inoculum size, relative humidity, storage temperature, and ripening stage on the attachment of Salmonella Montevideo to tomatoes and tomatillos. J Food Prot., 66, 1756–1761. JACKSON L A and WENGER J D (1993) Listeriosis: a foodborne disease. Inf. Med., 10, 61–66. KAPER J B, NATARO J P and MOBLEY H L. (2004) Pathogenic Escherichia coli. Nat Rev Microbiol., 2, 123–140.

128

Emerging foodborne pathogens

and DUIZER E (2004) Foodborne viruses: an emerging problem. Int J Food Microbiol., 90, 23–41. KRAUSE G, TERZAGIAN R and HAMMOND R (2001) Outbreak of Salmonella serotype Anatum infection associated with unpasteurized orange juice. South Med J., 94, 1168–1172. LOHSE N, KRAGHEDE P G and MOLBAK K (2003) Botulism in a 38-year-old man after ingestion of garlic in chilli oil. Ugeskr Laeger., 165, 2962–2963. LYYTIKAINEN O, AUTIO T, MAIJALA R, RUUTU P, HONKANEN-BUZALSKI T, MIETTINEN M, HATAKKA M, MIKKOLA J, ANTTILA V J, JOHANSSON T, RANTALA L, AALTO T, KORKEALA H and SIITONEN A (2000) An outbreak of Listeria monocytogenes serotype 3a infections from butter in Finland. J Infect Dis., 181, 1838–1841. MEAD P S, SLUTSKER L, DIETZ V, MCCAIG L F, BRESEE J S, SHAPIRO C, GRIFFIN P M and TAUXE R V (1999) Food-related illness and death in the United States. Emerg Infect Dis., 5, 607– 625. METTLER A E (1989) Pathogens in milk powders – have we learnt the lessons? J Soc Dairy Technol., 42, 48–55. MORRIS J G and POTTER M (1997) Emergence of new pathogens as a function of changes in host susceptibility. Emerg Infect Dis., 3, 435–441. MORSE D L, PICKARD L K, GUZEWICH J J, DEVINE B D and SHAYEGANI M (1990) Garlic-in-oil associated botulism: episode leads to product modification. Am J Public Health., 80, 1372–1373. MORTIMER S and WALLACE C (1998) HACCP – A Practical Approach. Aspen Publishers Inc. NFZA (2003) Risk profile: Listeria monocytogenes in ice cream. http://www.nzfsa.govt.nz/ science-technology/risk-profiles/lmono-in-ice-cream.pdf NFZSA (2004) Risk profile: Bacillus spp in rice. http://www.nzfsa.govt.nz/science-technology/ risk-profiles/bacillus-in-rice-1.pdf. OLDFIELD E C (2001) Emerging foodborne pathogens: keeping your patients and your families safe. Rev Gastroenterol Disord., 1, 177–186. O’MAHONY M, MITCHELL E, GILBERT R J, HUTCHINSON D N, BEGG N T, RODHOUSE J C and MORRIS J E (1990) An outbreak of foodborne botulism associated with contaminated hazelnut yoghurt. Epidemiol Infect., 104, 389–395. OTOFUJI T, TOKIWA H and TAKAHASHI K (1987) A food-poisoning incident caused by Clostridium botulinum toxin A in Japan. Epidemiol Infect., 99, 167–172. PATON A W, RATCLIFF R M, DOYLE R M, SEYMOUR-MURRAY J, DAVOS D, LANSER J A and PATON J C (1996) Molecular microbiological investigation of an outbreak of hemolytic-uremic syndrome caused by dry fermented sausage contaminated with Shiga-like toxin-producing Escherichia coli. J Clin Microbiol., 34, 1622–1627. PENTEADO A L, EBLEN B S and MILLER A J (2004) Evidence of Salmonella internalization into fresh mangos during simulated postharvest insect disinfection procedures. J. Food Prot., 67, 181–184. POZIO E (2003) Foodborne and waterborne parasites. Acta Microbiol. Pol., 52, Suppl: 83–96. PRAGER R and TSCHÄPE H (2003) Genetic fingerprinting (PFGE) of bacterial isolates for their molecular epidemiology. Berl Munch Tierarztl Wochenschr., 116, 474–481. RABSCH W, TRAGER R, KOCH J, STARK K, ROGGENTIN P, BOCKEMÜHL J, BECKMAN G, STARK R, SIEGL W, AMMON A and TSCHÄPE H (2005) Molecular epidemiology of Salmonella enterica serorar Agone: characterization of a diffuse outbreak caused by aniseed–fennel–caraway in fusion Epidemiol Infect., 133, 837–844. REIJ M W and DEN AANTREKKER E D and ILSI EUROPE RISK ANALYSIS IN MICROBIOLOGY TASK FORCE (2004) Recontamination as a source of pathogens in processed foods. Int J Food Microbiol., 91, 1–11. RILEY L W, REMIS R S, HELGERSON S D, MCGEE H B, WELLS J G, DAVIS B R, HEBERT R J, OLCOTT E S, JOHNSON L M, HARGRETT N T, BLAKE P A and COHEN M L (1983) Hemorrhagic colitis associated with a rare Escherichia coli serotype. N Engl J Med., 308, 681–685. ROBINS-BROWNE R M and HARTLAND E L (2002) Escherichia coli as a cause of diarrhea. J Gastroenterol Hepatol., 17, 467–475. KOOPMANS M

Industrial food microbiology and emerging foodborne pathogens ROTTMAN M

129

and GAILLARD J L (2003) New foodborne infections. Rev Prat., 53, 1055–1062.

ROWAN N J, CALDOW G, GEMMELL C G and HUNTER I S (2003) Production of diarrheal enterotoxins

and other potential virulence factors by veterinary isolates of bacillus species associated with nongastrointestinal infections. Appl Environ Microbiol., 69, 2372–2376. ROWE B, BEGG N T, HUTCHINSON D N, DAWKINS H C, GILBERT R J, JACOB M, HALES B H, RAE F A and JEPSON M (1987) Salmonella ealing infections associated with consumption of infant dried milk. Lancet, 2, 900–903. SCHEIL W, CAMERON S, DALTON C, MURRAY C and WILSON D (1998) A South Australian Salmonella mbandaka outbreak investigation using a database to select controls. Aust N Z J Public Health, 22, 536–539. SHAFFER N, WAINWRIGHT R B, MIDDAUGH J P and TAUXE R V (1990) Botulism among Alaska Natives. The role of changing food preparation and consumption practices. West J. Med., 153, 390–393. SIVAPALASINGAM S, BARRETT E, KIMURA A, VAN DUYNE S, DE WITT W, YING M, FRISCH A, PHAN Q, GOULD E, SHILLAM P, REDDY V, COOPER T, HOEKSTRA M, HIGGINS C, SANDERS J P, TAUXE R V and SLUTSKER L (2003) A multistate outbreak of Salmonella enterica Serotype Newport infection linked to mango consumption: impact of water-dip disinfestation technology. Clin Infect Dis., 37, 1585–1590. ST LOUIS M E, PECK S H, BOWERING D, MORGAN G B, BLATHERWICK J, BANERJEE S, KETTYLS G D, BLACK W A, MILLING M E and HAUSCHILD A H (1988) Botulism from chopped garlic: delayed recognition of a major outbreak. Ann Intern Med., 108, 363–368. SWAMINATHAN B, BARRETT T J, HUNTER S B and TAUXE R V (2001) Pulsenet: the molecular subtyping network for foodborne bacterial disease surveillance, United States. Emerg. Infect Dis., 7: 382–389. TAYLOR L H, LATHAM S M and WOOLHOUSE M E J (2001) Risk factors for human disease emergence. Phil Trans R Soc Lond. B, 356, 983–989. THRELFALL E J, WARD L R, HAMPTON M D, RIDLEY A M, ROWE B, ROBERTS D, GILBERT R J, VAN SOMEREN P, WALL P G and GRIMONT P (1988) Molecular fingerprinting defines a strain of Salmonella enterica serotype Anatum responsible for an international outbreak associated with formula-dried milk. Epidemiol Infect., 121, 289–293. TOMPKIN R B (2002) Control of Listeria monocytogenes in the food-processing environment. J Food Prot., 65, 709–725. TOMPKIN R B, SCOTT V N, BERNARD D T, SVEUM W H, and GOMBAS K S (1999) Guidelines to prevent post-processing contamination from Listeria monocytogenes. Dairy Food Env. Sanit., 19, 551–562. TSCHÄPE H, PRAGER R, STRECKEL W, FRUTH A, TIETZE E and BÖHME G (1995) Verotoxinogenic Citrobacter freundii associated with severe gastroenteritis and cases of haemolytic uraemic syndrome in a nursery school: green butter as the infection source. Epidemiol Infect., 114, 441–450. USERA M A, ECHEITA A, ALADUENA A, BLANCO M C, REYMUNDO R, PRIETO M I, TELLO O, CANO R, HERRERA D and MARTINEZ-NAVARRO F (1996) Interregional foodborne salmonellosis outbreak due to powdered infant formula contaminated with lactose-fermenting Salmonella virchow. Eur J Epidemiol., 12, 377–381. WANG X, MAEGAWA T, KARASAWA T, KOZAKI S, TSUKAMOTO K, GYOBU Y, YAMAKAWA K, OGUMA K, SAKAGUCHI Y and NAKAMURA S (2000) Genetic analysis of type E botulinum toxinproducing Clostridium butyricum strains. Appl Environ Microbiol., 66, 4992–4997. WILLSHAW A G, CHEASTY T and SMITH H R (2000) Escherichia coli in The Microbiological Safety and Quality of Food ed. by Lund B M, Baird-Parker T C and Gould G W Aspen Publishers Inc.

130

Emerging foodborne pathogens

6 Microbiological risk assessment for emerging pathogens M. Brown and P. McClure, Unilever, UK

6.1

Introduction

Global data indicate that the epidemiology of foodborne diseases is changing and that an increased range of microorganisms and foods are causing foodborne illness. A better understanding of the distribution, epidemiology and threat posed by emerging and uncharacterised pathogens is needed because they can have rapid, and poorly controlled, global spread through the food chain and hence the population. The detection, reporting and characterisation of food and waterborne illnesses play an important role in identifying the origins and incidence of disease when links can be made to the causative agents and the foods involved. This information needs to feed back to producers and regulators to ensure that product and process designs cover microbiological hazards that may realistically be expected to be present. Changes in the food industry, including global sourcing of foodstuffs, intensified animal production and changes in the eating habits of consumers may account for the wider range of microorganisms and foods being implicated in foodborne disease. Regional differences in growing, harvesting and processing practices can lead to familiar pathogens being found in a wider range of foods or contamination of specific foods with emerging or uncharacterised pathogens. New pathogens or food vehicles may also become recognised because of changes in consumer sensitivity, especially the development of sub-populations, with increased sensitivity to infection, within the total population of consumers. Lifestyle changes – fast food, eating out-of-home, preference for ‘fresh’ foods (often eaten raw) and reduced awareness of food safety may also increase exposure. It is also the case that some pathogens are seen to ‘emerge’

Microbiological risk assessment for emerging pathogens

131

because of improved surveillance and recovery/detection methods. Nevertheless, improved and more accessible detection methods are needed so that new pathogens can be recognised as the causative agents of disease. Risk assessment can provide the tool for examining the impact of all these changes on the emergence of new hazards and changes in levels of risk. As assessments are only as good as the information input, and cover a changing area, they are likely to need frequent review as the occurrence, distribution or transmission rates of an agent may change with changes in the supply chain. Many emerging pathogens share common features, such as causing typical disease symptoms or existing in an animal reservoir, sometimes without causing disease in the host animals. They sometimes have, or are assumed to have, low infectious doses with the incidence of infection increasing with dose. The occurrence and severity of the illness and the symptoms are often linked to the state of health of the host. Some of these pathogens may also have the ability to change their genetic make-up, so that resistance to processing and virulence may change and antibiotic resistance may develop. Often there is not much knowledge about their ecology, distribution, and point of entry into the food chain, survival and the incidence of resistant-forms or methods for their detection and control. Our inability to recover and enumerate on a routine basis some groups of organisms, such as some viruses (e.g. Noroviruses) and protozoa (e.g. Cyclospora cayetanensis), severely limits our general understanding of these agents. In spite of improvements in analytical methodologies, the causes of many reported foodborne illness outbreaks remain unidentified, and hence the risks to consumers cannot be assessed and appropriate preventive measures taken. Changes in the food vehicle or in the physiology and distribution of pathogens can alter levels of risk for any consumer. These changes can contribute to unexplained changes in the distribution of an illness or the substantial number of illnesses whose cause cannot be identified. The impact of changes on risk level or hazard severity is most usefully examined within a formal risk assessment framework whose completion requires ∑ ∑ ∑

identification of the hazard and its distribution assessment of the effects of the supply chain, especially processing, storage and use of the product on the levels of the pathogen the consumer or host is exposed to characterisation of the effects of the agent on the consumer and any differences for sensitive sub-populations.

Starting a risk assessment will raise questions on the identification and choice of pathogens that may be associated with a particular raw material manufacturing process or product, how and where they enter the food chain to reach consumers and how they can be linked to the symptoms recognised in the population. For most emerging pathogens, this information is at best only partly available. Completion of a risk assessment will provide producers

132

Emerging foodborne pathogens

or regulators with a sound basis for making decisions on preventative measures or the best way of educating consumers to reduce their level of exposure. To achieve this, and then monitor effectiveness, it is essential to have reliable and accessible methods to identify and characterise these agents and monitor exposure through recognition of typical symptoms in the host. This latter requirement is complex, as changes in genetic composition of the pathogen, for example by the exchange of genetic material, may give them characteristics, or virulence, previously unrecognised in the particular species. Host responses to any pathogen may also be variable, depending on the host’s state of health. Therefore the three contributing stages (hazard identification, exposure assessment and hazard characterisation) and the concluding stage of the risk assessment (risk characterisation) must all be completed before output is produced from a study for emerging or uncharacterised pathogens. The output must be accompanied by an assessment of the quality of data used, including data gaps and assumptions, and the influence of variability. Any assessment limited to only one area of the process (e.g. exposure assessment) or a single set of parameters will be incomplete and may be misleading, as the proportionate contribution of any feature or parameter to risk level and hence effective risk management or communication may not be included in the outcome. Data from the United States on the causes of foodborne illness (Mead et al., 1999) indicate that only 30% of cases are caused by bacteria and their toxins, with protozoa and parasites (e.g. Entamoeba histolytica, Giardia lamblia and Cryptosporidium) accounting for a further 3%. Agents implicated in an increase in the number of cases include Campylobacter spp., types of Listeria monocytogenes and Escherichia coli (e.g. enterohaemorrhagic) and less well-known emerging pathogens, such as Parachlamydia (from water systems). The incidence of disease from well-recognised pathogens has also increased (e.g. Salmonella enterica serovar Enteritidis). The largest proportion of food disease cases (67%) is caused by foodborne viruses (e.g. rotaviruses, Noroviruses, astroviruses and adenoviruses) and many in the population carry antibodies to the viruses causing gastrointestinal disease indicating exposure. This distribution of illness between the various causative agents, with only a small fraction attributable to bacteria and their toxins poses particular problems for microbiological risk assessment, where the tools and models have been developed for examining the risks from bacteria and, to a lesser extent, their toxins. Whichever component of the risk assessment process is considered, there is less information and fewer targeted analytical tools for protozoal/parasite and viral diseases than for new or emerging bacterial pathogens. However, the general process of microbiological risk assessment can be used to assess the risks from all these agents. But information on viruses and protozoa, especially for exposure assessment is scarce and may have high variability or be based on assumptions, leading to risk characterisations with high levels of uncertainty. Causal links have not been established between observed disease, epidemiological or surveillance data and particular food vehicles

Microbiological risk assessment for emerging pathogens

133

and the agents likely to be carried by the food, other than bacteria. It is assumed that many viruses are foodborne. In many cases their point, or points, of entry into the food chain and persistence in an infectious form during, or after, processing are not known with certainty. In some cases it has been possible to establish that they were present in material at harvest and persisted during processing, in others they were introduced by carriers during preparation or serving, having been eliminated by processing. In spite of this uncertainty, formal risk assessments provide the only systematic means of assembling and analysing information relevant to new hazards or the impact of changes in sourcing or processing on the range of hazards and levels of risk associated with any food product or market. Risk assessment can provide a structure for scenario analysis to compare difference in exposure between different supply chains, proposed points of entry for pathogens and controls or pathogens with a range of different resistances to existing process, storage and preparation conditions.

6.2

The importance of changes on levels of risk

Risk assessments for these pathogens need to cover changes in three areas: the food chain, characteristics and prevalence of emerging/uncharacterised pathogens and consumers/hosts. Risk assessment methods need to develop to examine and review changes and their significance.

6.2.1 Food chain Familiar materials and products sourced from new regions or made using different technologies or process conditions may contain emerging or uncharacterised pathogens, or familiar pathogens that have not previously been associated with the material. Hence existing risk assessments and HACCP plans will not cover the hazards. Survey work and other investigations that identify the reservoirs of foodborne pathogens are needed to identify realistic hazards and their characteristics against a changing background in trade and processing. Changes or differences in food and agricultural production practices may produce materials with a different range of contaminants, increased prevalence or numbers or geographical distribution. An example of this is the increase in cases of shellfish-associated Vibrio vulnificus illnesses in the US where there is increased harvesting of oysters during the summer months from the Gulf of Mexico (Altekruse et al., 1998). Risk assessments must identify and analyse the effects of changes within the food chain on the occurrence and numbers of pathogens potentially derived from growing areas and raw materials. Therefore better microbiological information is needed from sourcing areas. Hence ‘changes’ to be detailed in the statement of purpose for a risk assessment need to cover a wide range of topics to feed information into the ‘hazard identification’ and ‘exposure

134

Emerging foodborne pathogens

assessment’ stages. This information includes increased or different pathogen inputs from seed, animal feed, raw materials, ingredients and manufacturing operations. Over and above the direct impact of processing on the growth, death and survival of pathogens, changes in processing or formulation may also exert indirect effects on pathogens by altering the microflora of food, so that spoilage contaminants no longer inhibit the growth of pathogens present and they become a realistic hazard. This needs to be considered during the hazard identification. Potential pathogens can be proposed based on information from a number of sources including surveys, analyses of unknown, unfamiliar or new materials and epidemiological data from the source region or country. This can be problematic since different countries have different reporting requirements and surveillance systems in place and in some cases, do not collect information that can be used in hazard identification, particularly if the health effects are not severe. Where there is doubt about whether any pathogen is realistic for any supply chain, exclusion from a HACCP study or from choice of pre-requisites should be only on the basis of information that it is absent. If data are so poor that a risk assessment does not have any value, because of uncertainty or variability in the data available, the hazard should still be considered by the food industry and managed by their food safety assurance systems such as Good Manufacturing Practices and HACCP. Changes in manufacturing operations, including process conditions must also be fully examined by the exposure assessment because they play a critical role in determining pathogen levels in products, as process stages that may remove, or fail to remove, contamination from raw and in-process materials. These stages need to be identified and characterised at the start of any study, so that they can be further analysed during exposure assessment and hazard characterisation. Established processes may alter risk levels themselves when they are done in a different way or under different conditions of hygiene or process control. To allow this analysis to be effective the responses of the pathogens in question to process conditions (e.g. heat or cold) needs to be known. Manufacture of multiple product types, sharing contaminated common ingredients, or cross-contaminated during manufacture may increase the occurrence of contaminated products. Low-level contamination of large volumes of product can lead to diffuse and widespread outbreaks (Tauxe, 2002). With improved surveillance and reporting systems in place in some countries, these outbreaks are now identifiable whereas in the past linked cases may have been recorded as sporadic cases. These may be difficult to quantify within the risk assessment framework, but are likely to be important when risk assessment is used to analyse the reasons for an outbreak, or change in the distribution of disease. This should be done within the exposure assessment stage. A number of factors may change overall levels of risk within a supply chain. For example, better control(s), more severe process conditions and formulations may generally lower risks by reducing the numbers and range

Microbiological risk assessment for emerging pathogens

135

of pathogens present or able to grow to hazardous levels, whilst increases in batch size, etc., may increase risk levels, as any affected product may reach more consumers. New pathogens may not be covered by existing product designs (e.g. verocytotoxigenic E. coli and fermented meats), veterinary inspection, quality assurance/specification and monitoring systems or process specifications built up against a background of materials originating from developed areas with well recognised contaminants and appropriate controls for process hygiene. Where the risk assessment approach is used to analyse the reasons for an incident potentially related to an emerging or uncharacterised pathogen, the likely effectiveness of existing measures against the proposed causative pathogen should be assessed as soon as possible. This may be difficult where knowledge of the characteristics of the pathogen is limited, but under these circumstances, assumptions may prove the only way to propose the origins for the harmful dose and propose one or more process stages that have failed to eliminate the pathogen. If experience suggests that material selection and process conditions are likely to be able to ensure elimination or control of the pathogen, then the exposure assessment stage needs to focus on identifying deviations from the specified practices or specifications. For fresh produce, changes in agronomy, harvesting, distribution, processing, consumption patterns and practices have led to an increase in foodborne illness and the food industry may have no specific intervention steps that can be relied upon for control (e.g. heating) without altering the nature of the product. Then emphasis must be on good agricultural and hygienic practices prior to processing, for example raising of cattle or poultry for fresh meat that are sold in the raw form and may be consumed undercooked or without cooking. All these factors have to be resolved within the hazard identification and exposure assessment stages to derive a realistic characterisation of risk.

6.2.2 Characteristics and prevalence of emerging/uncharacterised pathogens Changes in the origin and history of materials can alter the distribution of pathogens, leading to their unexpected presence or higher numbers in a commodity or foodstuff. Pre-treatment (e.g. stress or injury) may change their characteristics (e.g. increased resistance to preservation factors, transformation to a resistant form or increased virulence causing harm from a lower dose). Genetic changes or physiological adaptation in pathogens may cause them to induce different symptoms in the host, or allow them to grow/survive under different conditions or be carried by different foods. Whilst these general observations are true for bacteria, protozoa and other parasites, it is unknown what effects similar conditions in the supply chain have on viruses and research in this area is essential to improve risk assessments. Certainly viruses change their host range and virulence more rapidly than other pathogens (Cleaveland et al. 2001). Improvements in isolation and

136

Emerging foodborne pathogens

characterisation techniques for any of these pathogens, the wider availability and accessibility of methods for routine screening may show apparent increases in occurrence, or demonstrate a wider distribution.

6.2.3 Consumers/hosts The introduction of an agent into a new host population, for example through a food from a contaminated source, may increase the incidence of disease (e.g. gastro-intestinal disease or fever), or cause previously unrecognised groups of symptoms or diseases (e.g. the illnesses associated with E. coli carrying various virulence genes). Effects will always represent the interaction between the host and the disease-causing agent. Changes in the pattern of diseases, incidence and severity within a population will often be shown by changes in public health statistics. These changes may reflect changes in the type or biology of the pathogen, its ecology or route of transmission or different carrier materials that may provide protection from processing or the body’s defences. If the host is considered, there may be changes in demography (e.g. ageing, malnutrition), sensitivity (e.g. immunological changes) or food-handling behaviour (e.g. prolonged chill storage or consumption of undercooked or raw products) (Gerba et al. 1996).

6.2.4 Environment Changing environmental conditions can also have an impact on the distribution and prevalence of pathogens in different regions. Warmer climates have led to increased coastal blooms of algae resulting in more reports of red tides and other harmful algal blooms (Mudie et al., 2002). Increases in temperatures have also been linked to proliferation of Vibrio cholerae in some regions. In affected areas, the first indication of a change in epidemiology may be an increase in reports of particular types of illness. Such changes are often difficult to predict and may depend on a number of factors interacting with each other to provide the opportunity for pathogens to establish reservoirs, whether these be zoonotic or environmental, and to cause illness. Many of the factors that change environmental conditions are outside the control of individual organisations (e.g. governments, industry and consumers) that are responsible for food safety.

6.3

Interaction with legislation

Authorities responsible for the protection of public health may respond to identification of a new agent or carrier food by implementing additional requirements and controls, often with regional or commodity specificity. Where the agent has not been characterised or the food involved specifically identified, precautionary measures may be imposed until the measures required

Microbiological risk assessment for emerging pathogens

137

to protect public health can be better defined, based on knowledge of the hazard, its origin and response to existing control strategies. To address concerns about non-tariff barriers being put in place and undermining promotion of international trade, the World Trade Organization (WTO) agreement on the Application of Sanitary and Phytosanitary Measures (SPS agreement) was drawn up. For food safety, the SPS agreement recognises standards, guidelines and recommendations established by the Codex Alimentarius Commission. These texts include recommendations to adopt a risk-based approach and article 5 of the SPS agreement states that sanitary measures must be based on risk assessment (see WHO, 1997a). WTO members have to ensure that the measures adopted are non-discriminatory, not more trade restrictive than necessary and are not maintained without sufficient scientific evidence. This is particularly difficult where the tools and information for risk assessment of agents other than bacteria are in the early stages of development. Better tools need to be developed to align precautionary responses with the origin and robustness of pathogens and the severity of effects on consumers. But even the slow adoption of the risk assessment approach incidentally improves understanding of the multiple factors determining product safety and helps producers, retailers and regulators in all parts of the world to achieve more effective consumer protection. For example, on a global basis, few regulatory policies for dealing with Listeria are based on a risk assessment approach. Current risk management strategies range from zero tolerance enforced by random testing and destruction of contaminated product (United States of America) to assessment of compliance with GMP and including establishment of tolerance levels in end products, GMP (Good Manufacturing Practice) and implementation of HACCP plans, with consumer education (focus on pregnant women). The zero tolerance policy may seem to give the lowest risk, but leads to a false sense of security among consumers because it implies that all available materials and products will be free of Listeria. This may lead to complacency in product design, the specification of hygiene levels, transport conditions and times and instructions for preparation and consumption that do not protect the consumer from a potential risk. In some countries (e.g. Canada, Germany, Denmark), there have been recent shifts towards risk-based standards, rather than maintaining zero tolerance policies (Donnelly, 2001). A recent risk assessment study by Chen et al. (2003) has demonstrated that an alternative to the zero tolerance strategy has a greater risk reduction potential and a management strategy focusing on concentration of L. monocytogenes rather than presence alone may have a greater impact on improving public health. The lowest practical risk levels will be achieved by keeping the focus on good manufacturing practices, based on a risk assessment framework, with ongoing monitoring. It is essential to recognise that established surveillance and quality systems and epidemiological data have limited value in predicting the ability of supply chain controls to handle new pathogens or previously recognised pathogens in a new context or material. Any analysis

138

Emerging foodborne pathogens

of surveillance data is prone to biases in reporting, recognition and availability of information and these will also depend on the different taxa and/or geographical regions being considered.

6.4

Users of risk assessments

Microbial risk assessment (MRA) is used to collect and analyse relevant information on emerging or uncharacterised foodborne pathogens and should lead on to risk management and communication with the objective of minimising their adverse impact on human health. Users of the output of a risk assessment will fall into two major groups – regulatory and industrial. Regulatory officials will be interested in identifying the potential for materials either produced or imported into a country to carry these pathogens (Hathaway and Cook, 1997). Their aim will be to identify appropriate measures to control exposure of the population. But, on the other hand, they also need to ensure that a balance is struck between protection, over-cautious application of the precautionary principle when good information does not exist, and freedom of trade and consumer choice. Industrial producers will be interested in the challenge posed by these pathogens to their existing supply chains, product designs, process conditions and consumer markets. Surveillance data and consumer complaints can be used to indicate changes in the incidence of disease or the emergence of new diseases and later indicate the effectiveness of any measures, and interpretation of these data should be improved. Additional indications can be obtained by comparison with levels and symptoms of diseases likely to have a similar origin or an assessment of the likely effects of processing on the proposed causative agent (e.g. based on kinetic studies for surrogates). This approach can also be used to validate or review any risk management or communication decisions (e.g. sourcing of raw material or regulatory measures) taken after a microbial risk assessment. The overriding question, when there is high uncertainty, is what is the optimum means to preserve the balance between consumer protection and consumer choice. The risk analysis technique is the only means of making decisions transparent and understandable. Aspects of industrial use of risk assessments (e.g. setting of critical limits) are covered by Notermans et al. (1995) and the roles of microbiological criteria and assessment of risks during the hazard analysis part of HACCP are described by Buchanan (1995).

6.5

Risk assessment

6.5.1 Terms of reference Microbiological risk assessment (ILSI 1996; Jaykus 1996, WHO 1995) describes the way a microbial hazard may reach its host and cause harm.

Microbiological risk assessment for emerging pathogens

139

Risk is the probability of harm to a consumer or population and hazard is an agent (biological, chemical or physical) with the potential to cause an adverse health effect, which is further characterised to indicate severity. When emerging or uncharacterised pathogens are under scrutiny, the risk assessment process needs to always use all four steps: hazard identification, exposure assessment, hazard characterisation, and risk characterisation to reach an output. The purpose of the assessment has to be clearly stated. The purpose may be preventative, to identify whether a new raw material (e.g. oleo-resins replaced by natural spices), a material from a different origin (e.g. fish sourced from the North Atlantic replaced by fish from tropical waters) or products with different formulations (e.g. milder products with lower levels of acetic acid, relying on refrigeration for stability) or made under different process conditions (e.g. moving a pasteurisation process from one heat exchanger to one with a less accurate control system) are likely to expose consumers to these pathogens. The other purpose is analytical (retrospective), after an outbreak of disease, to try and identify the causative agent, carrier material, and deficiency in processing or combination of factors that led to illness. The input data, information and team composition, including experts, plus procedural or time needs and outputs required by the users should be defined. The questions to be answered will set the scope of the assessment (e.g. how far down the supply chain should the study extend to include the origin of contamination) and the resources, skills and expertise essential for the team. For emerging pathogens it is likely that the extent of the study will play a key role in determining its success. For a preventative study the team must include representatives of the supply chain and technical experts plus product/process developers and buyers of materials, packaging or services, whereas for the analytical study there will also be clinical and epidemiological input. Both types of study will require specialist microbiological input depending on the type of agent being considered. It may be advisable to include a microbiologist familiar with ‘bacterial’ risk assessments in the group alongside a virologist or expert on protozoa/parasites as they will understand the importance of defining parameter values, such as growth/ replication/inactivation limits and their kinetics. Uncertainty and variability need to be clearly defined. Where uncertainty exists, the experimental or survey work needed to reduce uncertainty should be estimated. In some cases (e.g. the effect of process conditions or the effect of storage on viability) a small amount of very focused experimental work may dramatically improve the quality of a risk assessment. Where variability is involved then additional work may only achieve a better description of variability. The purpose of the study and its users will also determine the form of the output, including ∑ ∑ ∑

an assessment of uncertainty the level of variability expected in the characteristics of the pathogen and the disease response of the host a recommendation on what measures can be based on the output.

140

Emerging foodborne pathogens

Databases and software (e.g. as described by Thompson et al., 1992) will form important tools for the risk assessors. There may be a need to use existing data for other (mimic or surrogate) pathogens or closely related types to evaluate hazards by analogy with known, potentially similar hazards. Direct and analogous information and assumptions will have to be combined to form the output of each step and their integration will eventually represent (or simulate) the chain of events from the point of entry of the pathogen into the food chain to exposure. Obviously the quality of the information used will determine the uncertainty in the output. In some cases, the uncertainty may be so high that the assessment has little or no value and preventative measures have to be based on established means. Where an analytical result was sought, a high level of uncertainty may lead to the causes of disease remaining unknown. Valid and helpful risk assessments for emerging or uncharacterised pathogens in food need to account for any unique features of the agent. For example, bacterial risk assessments do not usually take account of microorganisms with a life cycle or any transition to resistant (apart from spore-forming organisms) or more infective forms. This may be triggered by exposure to stress and needs to be covered in the exposure assessment. The linked disease from these different forms may cause different symptoms in hosts of different ages or with different sensitivities. However the overall process needs to remain consistent with existing microbiological and chemical risk assessment processes, whilst taking account of several forms of the agent. Assessments for emerging, or uncharacterised, pathogens need to be based on four general themes. 1. Reliance on recognised detection and analytical methods, including statistical methods for handling limited data, data gaps and uncertainty, and rules for deciding when assumptions are valid. A consistent approach will allow sharing of limited data between multiple risk assessments. This is particularly problematic for some microorganisms where good detection/analytical methods are not available, e.g., noroviruses cannot be grown in cell culture so cannot be tested easily in inactivation/survival studies. 2. Consistent and meaningful descriptions (e.g. qualitative or quantitative) of the impact of points of entry and contamination levels and supply chain activities (e.g. process conditions and times involved) on the risks of human exposure. This must take account of the critical characteristics of the agent (e.g. occurrence, growth and die-off and variability in strain infectivity). Any assessment must integrate the risks of exposure from the initial contamination of the raw materials with any changes in numbers through processing and handling to consumption in order to estimate the level of contamination at consumption. It may be necessary where the point of entry is late in the supply chain to differentiate different types of use (e.g. retail or food service) as they provide different handling and preparation conditions or contact with food handlers.

Microbiological risk assessment for emerging pathogens

141

3. Assessment of the contribution of biological variation (e.g. different kinetics for survival or persistence or growth rates or responses to stress) to strain prevalence and virulence of the agent in specific foods. It is often the case that ‘laboratory’ strains are used to predict the behaviour of more recently discovered pathogenic strains. There can be large differences in the genetic make-up of strains of the same species. The recent genome sequence of E. coli O157:H7 contained 25% more DNA than the non-pathogenic E. coli K12 strain. It is important that strains used behave in a similar manner to the strains of concern. Changes in the physiological characteristics of a pathogen may be recognised only by the occurrence of disease, for example, when established processing or consumer use has been unable to ensure its absence or reduction to nonhazardous numbers in the foodstuff at consumption. A difficulty arises because some or all of these attributes may be variable. 4. Description of sub-populations of consumers who have different susceptibilities to the agent. These differences may lead to either endemic and epidemic levels of disease and can also lead to secondary spread of the disease.

6.5.2 Hazard identification Hazard identification records the association between disease and the presence of a pathogen in a food or a host. Emerging pathogens are usually recognised by finding new symptoms, disease outcome, or increased levels of disease in a population. Relevant data/facts and their basis need to be recorded as soon as possible after detection of disease or as early in the product or sourcing development process as possible. As a first step, relevant pathogens need to be listed for any material source (e.g. raw or packaging material), product (after processing) or outbreak. This may be based on previous association with the food, region or supply chain or on the symptoms noted in a host. If the purpose of the assessment is analytical, then the pathogen should be isolated from the food or host and characterised, if possible. Depending on the type of agent, reliable and rapid methods to do this may, or may not, be available. To contribute to exposure assessment, information used needs to describe the conditions under which the pathogen survives, grows, causes infection, and dies, so that the impact of processing, distribution, preparation, and consumption of the food can be evaluated. For these agents, changes such as adaptation, new virulence traits or ability to survive adverse conditions need to be estimated. Sources of information consulted should be noted and may include epidemiological and surveillance data (on agents and disease), challenge testing, and scientific studies of pathogenicity, but will always be more limited for emerging pathogens. Despite the availability of such information, there have been some notable failures in identifying hazards associated with particular products, e.g., E. coli O157:H7 and fermented meats, where there were probably sufficient data to suggest that this organism

142

Emerging foodborne pathogens

poses a real threat in some of these products. The risk assessment team and its capabilities may also be limited and this must be recognised when the value of the output for decision making is assessed. Established reference, rapid detection and counting methods are available for many bacterial pathogens and indicator bacteria, but such methods are not widely available for the other pathogens (e.g. protozoa and viruses). Therefore their distribution and fate during processing cannot easily be established. If indicators, or surrogates, are suggested for estimating distribution or tracking what happens to these agents during processing, etc., they need to be appropriate in their distribution and/or responses to supply chain conditions (e.g. resistance to heat or freezing). Different indicators may be needed, faecal ones may mimic the distribution of viruses, but the inactivation of likely indicators may well differ from the inactivation kinetics of the viruses of concern. Most foodborne and waterborne viruses are more resistant to heat, disinfection and pH changes than the majority of vegetative bacteria. Hepatitis A virus and human rotavirus appear to be the most stable RNA viruses and are considered good indicator viruses for processes relevant to the food industry (Koopmans and Duizer, 2004). Similarly the availability of unambiguous methods for detection, resuscitation or enumeration of these agents in the food chain is often a bottleneck. These methods are essential to establish the potential for exposure and the dose-response relationships (relative risk) for the pathogen alone and/or in combination with a food or other microorganisms. For ecological or screening work for raw materials, more accessible and cheaper methods are needed, especially for pathogens that are difficult to culture (e.g. viruses and protozoa). Methods with potential include serological and molecular tests that are amenable to automation. In particular, there is a need to develop standardised methods for routine, direct monitoring for pathogens of concern, so that we no longer have to rely on using indicators. Currently indicators are used, generally they are chosen for greater persistence (e.g. faecal streptococci as surrogates or representatives for Gram negative enteric bacteria) to allow the detection of persistent fecal contamination and source tracking. A number of different approaches are being tested for their ability to trace and track sources of contamination. These include DNA-based approaches (e.g. ribotyping, PCR, pulsed field gel electrophoresis (PFGE), and toxin biomarkers), that assume all microbial populations are clonal, therefore those from different sources are likely to be genetically different. Characterising and differentiating their genetic material allows contaminants to be divided into groups of clonal origin and matched to their sources. The use of DNA microarrays represents the latest development in detection technology, where diversity in bacterial populations can be investigated and correlation of specific DNA sequences with phenotypic properties is possible. Once virulence markers have been identified that correlate with infection or different disease outcomes, they could be used for comprehensive surveillance and monitoring of foodborne

Microbiological risk assessment for emerging pathogens

143

pathogens in the food chain (Wells and Bennik, 2003). Use of multiple techniques requires an integrated approach and critical studies of in vivo function require relevant biological assays and convergence of clinical observations, together with an in-depth knowledge of physiology, intermediary metabolism and biochemistry (Moxon and Tang, 2000). Bacteria and possibly other pathogens may also be characterised based on antibiotic resistance. This can be done as they may have different sensitivity/ resistance profiles and different antibiotics are used to treat humans than animals, and often different domestic animal species are treated with different antibiotic combinations. This approach has the potential to distinguish between regional and environmental origins, animal borne or from domesticated animals. These methods are easy to perform, and their results are comparable to those of molecular methods but they require numerous isolates to take account of variability and the use of a wide range of antibiotics at different concentrations. Viruses are believed to cause a large amount of enteric illness, molecular methods, including different primer sets and probes are needed for their detection in food samples and to follow their survival through processing. If cell culture methods are not available, polymerase chain reaction (PCR) techniques can be used to amplify many viruses but these techniques are not routinely available. To aid this process clinical samples need to be screened to test primer effectiveness against new types of virus. Given the detection methods currently available it is unlikely that process effectiveness will be defined on anything other than a presence/absence basis.

6.5.3 Exposure assessment Exposure assessment (EA) describes how a pathogen is distributed in raw materials, introduced into the food chain and then altered in concentrations by the production, distribution, storage and use of the food. An assessment needs to describe a particular supply chain and the process conditions involved and therefore should always include a flow diagram or description of the unit operations. Indicating likely sources of contamination (e.g. from the raw materials and the manufacturing process) processing and storage on the hazard (e.g. growth/survival/death) and the realistic routes for exposure. The extent of any problem will be determined by supply-chain specific parameters and their combined effect will lead to the dose ultimately consumed. This may be further modified by patterns of consumption (e.g. amounts consumed and cooking preference). For emerging or uncharacterised pathogens all modes of transmission leading to exposure or contamination should be considered – food to human, direct pathogen to human or food and human to human and the relative contribution of each pathway should be accounted for in the exposure assessment. Often variability in the system (e.g. different sources of raw material, process control or hygiene) will be important in determining the presence or level of hazard in a portion of food at the point of consumption.

144

Emerging foodborne pathogens

Levels of pathogens endemic in the various components of a food should be established, so that levels beyond control of the process or formulation conditions can be recognised. When exposure assessment is focused on emerging or uncharacterised pathogens, there is likely to be uncertainty or lack of knowledge about this and often assumptions will have to be made. Because of poor knowledge of the agent and its ecology, potential sources outside the main product flow may also need to be considered (e.g. substitution or batching of raw materials from different areas, poor hygiene or microbiological quality of utilities, such as water, cross-contamination or processing errors). Important information indicating critical stages or materials and linking these to exposure may come from a changing pattern of outbreaks, as sourcing or processing changes or new foods are marketed (e.g. fresh produce from new and potentially less hygienic sources). These changes may mean that foods once thought to be ‘safe by design’ may be implicated in outbreaks, because the microbiological challenge is now beyond the scope of the original design. Exposure assessment should allow the extent of any public health problem arising from changes to be estimated, if the scale of material sourcing or supply chain operations (e.g. lot size and raw material mixing) are known. Depending on the scope of the risk assessment, an exposure assessment can begin with pathogen prevalence in pre-harvest or unprocessed raw materials (e.g. ‘farm-to-fork’ risk assessment), or with pathogen input at a particular step (e.g. a processed material or after heat decontamination or from handling and preparation in food service). In every case, the purpose is to determine pathogen prevalence and track the changes in the numbers in the food from start to finish of the process and estimate the levels likely to be ingested by the consumer. Because differences in harvesting and processing methods, handling practices, and climates, geographic regions and seasons are likely to affect levels of all pathogens, these should be identified and if possible linked to prevalence and numbers. Whether presence or activity of a pathogen represents a realistic hazard for any product may be determined by ecological studies and comparison of kinetic values for its growth, death and survival with process (e.g. heating) or product (e.g. pH, water activity or the presence of non-decontaminated ingredients) conditions. Only infrequently will qualitative or quantitative assessments be possible and the use of predictive (kinetic) models for the behaviour of surrogate or similar and well-known, pathogens in the supply chain will provide only rough or directional guidance. There are many limitations on data and models for exposure assessment for all types of hazard, except bacteria. To obtain useful estimates and overcome the need for excessive precautions, it is necessary to understand how product and process conditions affect the agent. For many processed and preserved products (e.g. long life chilled) it is also essential to understand growth and survival under marginal conditions, lag phase duration, the importance of strain to strain variation, the effects of competition with spoilage microorganisms and how these factors lead to differences in virulence or toxigenesis.

Microbiological risk assessment for emerging pathogens

145

Exposure assessments must eventually suggest intervention strategies for safe industrial production of food that can be integrated with pre-requisite and HACCP programmes and specifications, supported by sound product design and operational procedures (e.g. manufacturing controls and QA). Because most food safety management systems (e.g. HACCP) are experiencebased they can control only recognised hazards. Control of new pathogens with unknown characteristics or those with altered characteristics (such as heat resistance) or unexpected occurrence in the food chain is more difficult and depending on the characteristics of the pathogen interventions may not be available at all the stages in the supply chain. Human exposure to pathogens can be assessed by measurement of specific (metabolic) products of the agent in bodily fluids or looking for specific biomarkers such as antibodies in serum or saliva produced in response to exposure to antigens. These methods are not foolproof as they may include non-specific reactions leading to false positive and/or negative results, but such studies can generate information on the number of people exposed and the sources and geographic distribution of exposures to the agent.

6.5.4 Hazard characterisation The hazard characterisation, or dose-response assessment, describes the relationship between the levels of the hazard ingested, and the frequency, different effects and severity of illness. It translates the final exposure to the pathogen into a (likely) health response in a consumer or population of consumers. This step is very difficult because of the shortage of cause/effect data on specific responses to many emerging or uncharacterised pathogens, the effect of the status of the pathogen on virulence or infectivity and because responses in turn depend on the susceptibility of the host (consumer). However, even limited knowledge of the shape and boundaries of a dose-response function can be informative in comparing the risks of different supply chains, processes or the effectiveness of different control measures. Systems used for foodborne disease surveillance include outbreak investigations, laboratorybased reporting of specific foodborne pathogens, physician reported illnesses and active surveillance and each has its own strengths and weaknesses, requiring careful balancing of effort and resources (Altekruse and Swerdlow, 1996). Options for surveillance of foodborne disease are described in WHO (1997b). Epidemiology and disease surveillance studies can provide direct, and often quantitative, data on illness linked to foods. Analysis of those affected may provide estimates of vulnerability or a dose-response where the implicated food is available or exposure assessment allows estimation of the dose level. Reliable tracking of outbreaks based on details of the characteristics of disease, including progression and any secondary symptoms, are needed to trace the fate of pathogens carried in food at the point of consumption. This information needs to extend to sensitive (e.g. the young and elderly) and

146

Emerging foodborne pathogens

super-sensitive (immuno-compromised) populations, as opposed to the general population. The available data are insufficient to support development of models that incorporate variability in all three factors describing the disease triangle (host, pathogen, and environment), or the interactions of these factors. Key issues include susceptible sub-populations and animal-human extrapolation for hosts, strain virulence and prevalence in foods for pathogens, and effects of the food matrix and the intestinal ecosystem for environment. Clinical studies may be used to determine the infective dose for a specific pathogen; or population intervention studies (where consumption or use practices are changed), may be used to estimate the disease risk from certain foods or sources. Even though such studies provide quantitative data, their value is limited by confounding factors (human variation, number of participants, other factors), and they do not always show a clear connection between cause, level and effect.

6.5.5 Risk characterisation Risk characterisation is achieved by integrating the dose-response and exposure assessments to reach a conclusion. This acts as a basis for risk management and communication or highlights gaps in knowledge and provides estimates of the benefits of proposed research. It involves integrating all the information gathered in the previous steps to estimate the risk of illness to a population, or in some cases, to a particular type of consumer. The characterisation should indicate the quality of information used as it affects uncertainty and variability and provides confidence in the output. In this step, the parameters in any assumptions can be modified to show the factors influencing health risk or the impact of any changes or actions on a suspected trend or the potential gains from further research. Scenario-based risk assessments are typically computer-based and can provide rapid responses to ‘what-if’ questions for different situations and materials.

6.6

Modelling

Availability of predictive models that can describe the behaviour of the agent in the environment or food chain and evaluate likely exposure would improve protection of public health. Direct data should be used wherever possible to assess the impact of exposure factors (e.g. processing and consumer handling) and the characteristics/severity and duration of disease. Model development based on the response of known pathogens, can be related to emerging or uncharacterised pathogens as a first step in helping to formulate risks. Risk characterisations from such models would outline exposure to the pathogen and the human (host) health effects. Models or descriptions based on analogies for human susceptibility; dose-response and mechanisms of infection may be used to reduce the level of assumptions. The impact, for example, of an

Microbiological risk assessment for emerging pathogens

147

ageing population or a shift in cooking practices can be simulated by a variety of assumptions that reflect the extent of the change. Suitable methods always need to be found to test the reality of any predictions. Model predictions should be validated using ‘real-world’ data not incorporated in the risk assessment, and comparing model predicted levels with actual survey levels if possible. In order for any model framework to be validated, additional research is obviously needed. Research should include improved identification and validate for pathogens with different origins, characteristics, resistances and carrier materials. Risk assessments can carry large uncertainties, however, due to the limited occurrence and dose-response data available. To aid assessment of E. coli O157:H7, an exposure distribution model and a dose-response envelope have been developed (Cassin et al., 1998) to limit uncertainty in assessing the illness associated with this pathogen. This is necessary because neither distribution data nor human clinical trial data are available for E. coli O157:H7. The predicted exposure distribution of E. coli O157:H7 was modelled using the approximate number of ground beef servings consumed annually in the United States. Dose-response data for two similar or surrogate pathogens, enteropathogenic E. coli (EPEC) and Shigella dysenteriae were used to create a dose-response for E. coli O157:H7. Using both the exposure and dose-response data, an estimated distribution could be proposed for the annual number of cases of E. coli O157:H7 that can be attributed to ground beef. Quantitative risk assessments need models to describe the factors and interactions affecting pathogen prevalence in the supply chain. Improved descriptions of changes in pathogen levels in response to controls in the source, make and deliver functions will be achieved by using systematic investigations (to describe the fate of pathogens at different stages in the supply and consumption chain) and linking these to predictive modelling of responses to key factors, such as heat, etc. In this way microbiological risk assessments will contain knowledge and predictions of disease outcomes and result of control strategies. Initially, models will be crude, but will acquire the available expert knowledge to represent the best available understanding of the interacting features (e.g. control strategies) and their effect on hazards and health risk. Actions to control emerging pathogens cannot wait for scientific certainty, but need to propose realistic decisions on the best available information. Qualitative or quantitative risk assessments prompting the development of models can provide additional insights and data capture, because data are handled and retained in a systematic way.

6.7

Risk management

A multi-barrier approach to risk management is needed for emerging pathogens to improve the chances of successful consumer protection when there is poor

148

Emerging foodborne pathogens

knowledge of exact preventive measures. Management should always cover the protection of food sources from contamination, use of effective methods for the prevention of contamination during processing and the design of process stages to give the best chances of elimination or inhibition, depending on the nature of the pathogen and conditions of food production. The Hazard Analysis and Critical Control Point (HACCP) system should be adapted to use non-quantitative approaches to identify vulnerabilities in product design, sourcing or production systems. Once hazards have been analysed, controls at key points can be reviewed and their effectiveness validated, taking corrective actions to put in as additional controls or by strengthening existing ones, when and where necessary. Validated predictive models (using similar types of microorganisms) can allow comparison of control strategies without experimentation, because experimental work is very difficult in a supply chain environment. Successful hazard prevention and management of emerging pathogens therefore depends on the timely generation of information and its transfer into agriculture, food processing, and preparation practices, backed up by suitable analytical and monitoring techniques.

6.8

Risk communication

Risk assessment studies should be fully and clearly documented as a formal report, with uncertainty and variability clearly explained. To ensure understanding by the potential users, the final report should indicate, in particular, any constraints and assumptions made during the risk assessment process. The report should be made available to risk managers and other interested parties (e.g. farmers, veterinarians, food-processing experts, microbiologists, and consumer experts) to form the interface between them and provide a focus for discussion.

6.9

Conclusions

In considering the wide range of different organisms implicated in emerging foodborne diseases, there are important knowledge gaps that hinder our ability to understand their relative significance, their ecology (including reservoirs) and our ability to control them effectively. The different taxa involved pose different problems (see Table 6.1). It is noteworthy that in a recent review of risk factors for emerging diseases, Taylor et al. (2001) estimated that 75% of the 132 emerging pathogens (all pathogens, not only foodborne) are zoonotic and that zoonotic pathogens are twice as likely to be associated with emerging diseases. In a related study, Cleaveland et al. (2001) reported that the majority of emerging human pathogens comprised of viruses

Knowledge available in risk assessment for different groups of foodborne hazards

Hazards

Technologies for tracking strain changes

Bacterial infections

Y

Microbial Acute Y intoxications Chronic Y

Genetic stability of agent

Technologies Availability Availability Ecology/ Responses Kinetic data for characteri- of informof surrogates distribution to SC events on responses sation ation for RA for RA known known to env. parameter known

Species dependent

Y

Y

Some

✓✓✓

✓✓✓

✓✓✓

✓✓

✓✓✓

✓✓

✓✓✓

Y

Y

Unknown

✓✓✓

✓✓✓

✓✓✓

✓✓✓

✓✓✓

Small

✓

N

N

Unknown

✓✓

✓✓

✓✓

✓✓

✓✓

X

Hazar- Clinical Variability dous symptoms of sensitivity dose known in population known

Viruses

Y

✓

Y

X

Unknown

✓

✓✓

✓✓

X

✓✓✓

X

Protozoa

X

✓

X

X

X

✓✓

✓

✓

X

X

X

Other parasites

X

✓

X

X

X

✓

X

X

X

X

X

✓✓✓ ✓✓ ✓ X

Sufficient knowledge for quantitative risk assessment Poor knowledge Assumptions Unknown

Microbiological risk assessment for emerging pathogens

Table 6.1

149

150

Emerging foodborne pathogens

(44%) or bacteria (30%) and concluded that a significant factor in the predominance of viruses amongst emerging pathogens is the ability to mutate at relatively high rates. RNA viruses are identified as posing the biggest threat because of their higher mutation rates and an underlying ability to transmit across species and orders (e.g. infecting birds as well as mammals). A worrying trend is the ability of some of these pathogens to colonise hosts without causing disease, making the initial identification of reservoirs difficult and the likelihood of eradication impossible. Pathogens infecting wildlife are twice as likely to emerge as pathogens without wildlife hosts. More is known about bacterial pathogens than other groups. Many bacterial populations (e.g. E. coli and salmonellas) are clonal, evolving under competition as distinct genetic types. These arise through horizontal gene transfer, by loss of and ordered gain of genetic information being maintained during adaptation to their niches. The sharing and exchange of mobile genetic elements and presence of common pathogenicity islands in members of the Enterobacteriaceae enables this group of organisms to become successful by continuous evolution. In other groups, e.g., with relatively large genomes, the clonal frame breaks down and genotypes show no adaptation to their habitats but are adept at colonisation of different niches because of their versatility (e.g. Staphylococcus aureus). Whilst many insights have been provided through genome sequencing, large gaps in the understanding and significance of gene function remain. For elucidation of these areas, application of traditional genetic, biochemical, and physiological approaches is necessary in addition to the more recently developed methods, such as proteomics and microarray technologies. Advances in molecular methods have allowed unparalleled progress in our understanding of bacterial genetics and are now being applied to determine expression of genes of pathogens in response to different environments. This will ultimately help in identifying virulence markers in different organisms, help in surveillance and typing of pathogens in the environment, livestock, food and in humans and also aid in identification of effective control measures. This notwithstanding, for those other organisms where methods have not been developed or have not progressed as far as with some bacterial pathogens, the situation is less favourable. Carrying out risk assessments that consider these hazards is fraught with difficulty, when little is known about their ecology, reservoirs and routes of transmission. Key tools for identification of these pathogens include suitable diagnostic methods and well-designed surveillance systems, requiring adequate infrastructure and human resources and effective coordination on regional, national and global scales. It may appear that great advances have been made in recent years in our understanding of emerging pathogens but this should be put in context. Tauxe (2002) estimated an incidence of 79 illness (acute gastrointestinal) episodes per 100 persons per year in the US, with 36% of these being attributed to food. However, only one-fifth of these were explained by the 27 principal foodborne pathogens identified, leaving a substantial gap and

Microbiological risk assessment for emerging pathogens

151

suggesting that many more pathogens have yet to be identified. Carrying out risk assessments for these as yet unidentified/unrecognised pathogens is not possible and our ignorance of these organisms is largely a consequence of our reliance and dependence on traditional methods, e.g., microbial cultivation. Sequence-based molecular methods are likely to impact on this area and should enable reassessment of the concepts of microbial disease causation, for syndromes that are currently poorly understood and characterised. Some of the battles against emerging pathogens are being won. For example there is evidence that control strategies (including risk communication) for L. monocytogenes have been successful in reducing the incidence of foodborne listeriosis in some regions. The same is also true for cases of salmonellosis, where the total number of cases is decreasing in some regions due primarily to reduction in levels of salmonellas in egg-laying flocks (through vaccination of chicks). These successes are undoubtedly a result of the knowledge and understanding embodied in the different elements of risk assessment. For other emerging pathogens, such as Campylobacter, numbers of cases of illness still appear to be increasing in many regions of the world and key pieces of information for the risk assessment process are missing. For these pathogens, it is vital that these key pieces of knowledge and understanding are provided, to enable proper risk assessments to be made, even if these are only qualitative. Lessons can be learnt from recently emerged pathogens and these demonstrate the complex nature and interactions of factors that can contribute to emergence. Nevertheless, they should provide insights that will allow better understanding of changes in practice that could lead to emergence of new pathogens and identification of control measures and strategies that will minimise the risk posed by biological agents transmitted by food.

6.10

References and further reading

ALTEKRUSE SF, SWERDLOW MD

(1996) The changing epidemiology of foodborne diseases. Amer J Med Sci 311 23–29. ALTEKRUSE SF, COHEN ML, SWERDLOW DL (1997) Emerging foodborne diseases. Emerg Infect Dis 3 (3) 285–93. ALTEKRUSE SF, SWERDLOW MD, WELLS SJ (1998) Factors in the emergence of food borne diseases. Vet Clinics North Amer 14 (10) 1–15. BUCHANAN RL (1995) The role of microbiological criteria and risk assessment in HACCP. Food Microbiol 12 421–424. CASSIN MH, LAMMERDING AM, TODD ECD, ROSS W, MCCOLL S (1998) Quantitative risk assessment of Escherichia coli O157:H7 in ground beef hamburgers. Int J Food Microbiol 41 (1) 21–44. CHEN Y, ROSS WH, SCOTT VN, GOMBAS DE (2003) Listeria monocytogenes: low levels equal low risk. J Food Prot 66 570–577. CLEAVELAND S, LAURENSON MK, TAYLOR LH (2001) Diseases of humans and their domestic mammals: pathogen characteristics, host range and the risk of emergence. Phil Trans R Soc Lond B 356 991–999. DONNELLY CW (2001) Listeria monocytogenes: a continuing challenge. Nutr Rev 59 183– 194.

152

Emerging foodborne pathogens

GERBA CP, ROSE JB, HAAS CN

(1996) Sensitive populations: who is at the greatest risk? Int J Food Microbiol 30 (1–2) 113–123. HATHAWAY SC, COOK RL (1997) A regulatory perspective on the potential uses of microbial risk assessment in international trade. Int J Food Microbiol 36 (2-3) 127–133. ILSI RISK SCIENCE INSTITUTE PATHOGEN RISK ASSESSMENT WORKING GROUP (1996) A conceptual framework to assess the risks of human disease following exposure to pathogens. Risk Anal 16 (6) 841–848. JAYKUS L-A (1996) The application of quantitative risk assessment to microbial food safety risks. Crit Rev Microbiol 22 (4): 279–93. KOOPMANS M and DUIZER E (2004) Foodborne viruses: an emerging problem. Int J Food Microbiol 90 (1) 23–41. MEAD PS, SLUTSKER L, DIETZ V, MCCAIG LF, BRESEE JS, SHAPIRO C, GRIFFIN PM, TAUXE RV (1999) Food-related illness and death in the United States. Emerg Infect Dis 5 (5) 607–625. MOXON R, TANG C (2000) Challenge of investigating biologically relevant functions of virulence factors in bacterial pathogens. Phil Trans R Soc Lond B 355 643–656. MUDIE PJ, ROCHON A, LEVAC E (2002) Palynological records of red tide-producing species in Canada: past trends and implications for the future. Palaeogeo. Palaeoclimatol Palaeoecol 180 (1-3) 159–186. NOTERMANS S, GALLHOFF G, ZWIETERING MH, MEAD GC (1995) The HACCP concept: specification of criteria using quantitative risk assessment. Food Microbiol 12 (1) 81–90. ROSE JB, SOBSEY MD (1993) Quantitative risk assessment for viral contamination of shellfish and coastal waters. J Food Prot 56 (12) 1043–50. TAUXE RV (2002) Emerging foodborne pathogens. Int J Food Microbiol 78 (1-2) 31–41. TAYLOR LH, LATHAM SM, WOOLHOUSE MEJ (2001) Risk factors for human disease emergence. Phil Trans R Soc Lond B 356 993–990. THOMPSON KM, BURMASTER DE, CROUCH EAC (1992) Monte Carlo techniques for quantitative uncertainty analysis in public health risk assessments. Risk Anal 12 (1) 53–63. WELLS JM, BENNIK MHJ (2003) Genomics of food-borne bacterial pathogens. Nutr Res Rev, 16 21–35. WHITING RC, BUCHANAN RL (1997) Development of a quantitative risk assessment model for Salmonella enteritidis in pasteurized eggs Int J Food Microbiol 36 (2-3) 111–126. WORLD HEALTH ORGANIZATION (1995) Application of risk analysis to food standards issues. Report of the Joint FAO/WHO Expert Consultation.WHO/FNU/FOS/Report No. 95.3. WORLD HEALTH ORGANIZATION (1997a) Food safety and globalization of trade in food: a challenge to the public health sector. WHO/FSF/FOS97.8 Rev. 1. WORLD HEALTH ORGANIZATION (1997b) Surveillance of foodborne diseases: what are the options ? WHO/FSF/FOS/97.3.

Food safety objectives and related concepts

153

7 Food safety objectives and related concepts: the roll of the food industry L. G. M. Gorris, J. Bassett and J.-M. Membré, Unilever, UK

7.1

Introduction

Diseases caused by foodborne microbial hazards constitute a world-wide public health concern, despite the enormous volume of food produced and consumed safely throughout the world on a daily basis. During the past decades, the incidence of certain foodborne diseases has increased in many parts of the world despite the many improvements made to public health and food safety systems (Schlundt, 2002). Statistics indicate that even in industrialised countries one out of every three people has a foodborne microbial illness event every year (WHO, 2002). It is recognised that food safety is not an absolute but rather a continuum of more or less safety and also that foodborne microbial hazards are likely to remain or (re-)emerge over time for a number of reasons. These include microbial adaptation, changes in the food production systems, changes in human demographics and behaviour, international travel and trade. The globalisation of food markets has increased the challenge to manage these risks. To ensure acute and/or continuous improvement in the health of the population with respect to a particular hazard, governments, or competent national authorities delegated with this task, establish public health goals. These are best based on scientifically sound data, such as epidemiological evidence with food attribution or a detailed assessment of the risk that a foodborne microbiological hazard may pose to the population. To control foodborne hazards in operational practice, Industry1 has developed and 1

Industry here includes all professionals involved in food production throughout the food chain, e.g., from primary production, distribution, processing and manufacture, packaging, storage, retail, catering and food services

154

Emerging foodborne pathogens

implemented generic food safety management systems (i.e. GHP, GMP, GAP) as well as specific food safety management (FSM) systems tailored to the particular food product and food operations (i.e. HACCP). Up to now, public food safety expectations are often based on how well an industry is capable of performing, i.e., the concept of ALARA (as low as reasonably achievable), rather than a stated degree of stringency (Walls and Buchanan, 2005). At a time that food chains are becoming more complex, frequently crossing national borders, governments more and more give direction to the stringency required from these systems in order to achieve a public health goal. By establishing food safety objectives (FSO) for particular hazards associated with certain foods, governments can give clearly articulated guidance to industry on their food safety expectations. Through the FSO and related standards, they provide a link between public health goals and the FSM systems operating within their jurisdiction. The FSO concept helps to move food control away from an ALARA-type management (WHO, 2000) to provide a more transparent and outcome oriented approach to food control, and provide more solid support for equivalent measures to assure food safety. This chapter describes the use of the FSO concept as a risk management tool for governments, the new concepts that have been introduced to relate the FSO set at the end of the food chain to targets at earlier points in the chain, and what the role of industry is regarding the FSO and related concepts.

7.2

Recent developments in risk analysis

At a governmental level, food safety control for public health protection of necessity covers a wide range of different food chains relevant to particular food products or product groups produced locally or imported. The FAO and WHO have called upon countries to apply modern international food safety and quality standards to protect consumer health. Appreciating the need for taking a risk-based approach to food control and public health protection and the complexity of the current food supply within and across countries, these intergovernmental or governmental organisations have adopted risk analysis as the common framework for building food safety control programmes (Buchanan, 2004; CAC, 2004; Cahill and Jouve, 2004; Schlundt, 2002). Through Codex Alimentarius, FAO and WHO are developing guidelines and reports providing detailed advice on the various aspects of risk analysis, namely risk management, risk assessment and risk communication (CAC, 2001; CCFH, 2005; CCGP, 2005). The impact of a foodborne microbial hazard on the health status of a population is evaluated by conducting a microbiological risk assessment (MRA) under the auspices of a competent, governmental authority (CAC, 2001; CCFH, 2005). FAO and WHO have set up a series of expert consultations, referred to as the ‘Joint FAO/WHO Expert meetings on Microbial Risk Assessment’, that have brought together risk assessment experts from across the world who have gained experience

Food safety objectives and related concepts

155

and expertise in MRA through national studies. Over the last few years, they have developed a number of authoritative microbiological risk assessment studies that can be accessed through the JEMRA internet homepage (JEMRA, 2005). An MRA can give a numerical expression of the risk at population level as well as a relative or ranked expression of risks associated with different foods (Buchanan et al., 2000; JEMRA, 2002, 2004; Lammerding and Fazil, 2000). National or international MRA studies have generated risk estimates for pathogen-commodity combinations using data from one or more countries. In light of their public health goals or policies, this information can be used by governments to decide whether current practices provide safe foods or whether food safety improvements are needed. While MRA is an important part of the risk analysis framework, it is the risk management element that is driving the process. Careful integration and coordination of activities associated with risk assessment, risk management, and risk communication is needed. When this can be achieved, the framework is useful to guide regulatory decision-making relating to public health protection as well as trade decisions at the national or international level (Reij and van Schothorst, 2000; Schlundt, 2002; Buchanan et al., 2004; Cahill and Jouve, 2004). By nature, MRA studies carried out under the auspices of governments are very generic because they are developed for a range of food industries and food chains that market a certain type of product. They generally involve typical or representative food chains, processing technologies, and contamination data. However, individual industries must manage the safety of their products at a much more specific level, using suitable food safety management systems (van Gerwen and Gorris, 2004). Importantly, MRA studies for governments can be developed at many levels of detail, depending, for example, on the complexity of the issue, the urgency for obtaining the risk estimate and the data available. Some techniques that have been developed in part or completely in the context of MRA, such as probabilistic approaches to process modelling and risk assessment, may be deployed in an industrial setting as well. However, the purpose and aim of such a use of MRA technologies is very different from governmental MRA (Gorris, 2002). The use of MRA to assess the prevailing public health impact of a pathogen/product combination in the process of microbiological risk management is the sole remit and responsibility of governments. The risk estimate, whether a numerical or a relative expression, can be used by risk managers in governments (i.e. in the competent authority in a country) to decide on an appropriate course of action. In some cases, the estimated risk to the population does not necessitate action, in others specific measures are needed to reduce the burden of disease. In the latter case, risk managers may choose to set health protection goals and use these to formulate targets for all the relevant stakeholders in food chains to meet. Such targets can be defined for the end of the food chain (i.e. at the point of consumption), leaving the industry flexibility as to how it manages the actual chain in order

156

Emerging foodborne pathogens

to meet the target. Such a target is the food safety objective (FSO). Other targets can be defined, possibly additionally, at points earlier in the food chain than the point of consumption, for instance when meeting targets at these points is judged to be important to the success of the industry meeting the end-of-the-chain target (the FSO). Such in-chain or step targets can come in many guises some of which already exist and some of which are new food safety management concepts; a performance objective, a performance criterion, a control measure, a process criterion, a product criterion. According to the Codex guidelines (CCFH, 2005), only competent authorities set FSOs, while mainly (but not exclusively) industry sets ‘in-chain’ targets as part of their FSM systems, which means they are properly embedded in GHP, GMP, and HACCP. Competent authorities on occasion set in-chain targets, for instance as default or safe-harbour guidance to industry that cannot establish such targets by their own means or elect to use the governmental targets. With the use of outcome oriented targets such as the FSO and PO, governments provide guidance on required stringency of food safety management but also provide a benchmark of equivalence. They, in principle, allow different set-ups of FSM systems to operate across a chain or at a step in the chain as long as they deliver in accordance to the end-of-chain target or step target. Figure 7.1 summarises the hierarchy of concepts in food safety management, including new and existing concepts. The use of these concepts by governments in their regulations or guidance to food control will have an impact on the day-to-day food safety management in food operations. Industry needs to be aware of these concepts and how they relate to existing concepts in food safety management, as they may be required to work towards meeting certain of the concepts or use them as management tools in their own FSM systems.

7.3

Definitions

In 2004, the Codex Alimentarius Commission adopted definitions proposed by the Codex Committee for Food Hygiene for three new concepts to be used in the context of the management of microbiological risks (CAC, 2004). ∑ ∑

∑

Food safety objective (FSO): the maximum frequency and/or concentration of a hazard in a food at the time of consumption that provides or contributes to the appropriate level of protection (ALOP). Performance objective (PO): the maximum frequency and/or concentration of a hazard in a food at a specified step in the food chain before the time of consumption that provides or contributes to an FSO or ALOP, as applicable. Performance criterion (PC): the effect in terms of frequency and/or concentration of a hazard in a food that must be achieved by the application of one or more control measures to provide or contribute to a PO or an FSO.

Food safety objectives and related concepts End of food chain target

FSO – food safety objective

157

Set only by competent authority in a country

PO – performance objective In-chain targets

PC – performance criterion MC – microbiological criterion

Set mainly by industry; competent authority can set in particular cases, e.g. as default or safe-harbour or as mandatory standard

CM – control measure

ProcC – process criterion ProdC – product criterion

Fig. 7.1

Set mainly by industry, competent authority can set in particular cases, e.g. as default or safe-harbour or as mandatory standard

The hierarchy of targets proposed in microbiological risk management.

In the above definitions, reference is made to the concept of the appropriate level of protection (ALOP), which is a concept coined in the SPS agreement of the World Trade Organization (WTO-SPS, 1995). The definition given there is ‘the level of protection deemed appropriate by the member (country) establishing a sanitary or phytosanitary measure to protect human, animal or plant life or health within its territory’. As a concept, ALOP is frequently set alongside notions of ‘acceptable level of risk’ or ‘tolerable level of risk’. An ALOP does not have a defined form, but should be a statement of the risk that a society tolerates regarding a certain microbial hazard. It could be a public health goal set by a country’s competent authority such as a maximum frequency of certain illness annually in their population or the aim to reduce the number of certain illnesses to a particular extent. In Sections 7.3 and 7.4, these new concepts and related existing concepts are explained further and the role of industry in managing the performance of their FSM systems accordingly is elaborated on. While it is, in principle, possible to mathematically inter-relate the various concepts, there are some quite practical and conceptual issues that need further attention. Some of these are highlighted in Section 7.5.

7.3.1 Food safety objective (FSO) An FSO specifies the maximum level of a hazard that can be tolerated in the final food product when it is consumed, as this is the moment when no further change can occur in the hazard level and essentially the consumption event is required for an impact on public health (Cole, 2004; Gorris, 2004, 2005; ICMSF, 2002; ILSI, 2004). The concept of this ‘end-of-chain’ target needs to be interpreted and used with an understanding of the etiology and pathogenicity of the foodborne hazard and the food(s). While the FSO represents a hazard level that should not be surpassed in the food, there is discussion on interpretation of the word ‘maximum’ used in the definition. Some interpret this as the absolute arithmetic level to be met with 100% compliance, while

158

Emerging foodborne pathogens

others advocate it to be a statement of an upper limit related to criteria of acceptability (Dahms, 2004; Havelaar et al., 2004). With the FSO set at the time of consumption, it provides a specific link between public health objectives at the governmental level (i.e. the ALOP) and the management of the food production at the operational level. When a competent authority derives an FSO from an ALOP, ideally, this would be done on the basis of a governmental risk assessment because this will normally contain data on the relationship between exposure to a hazard and the impact on health of the normal and/or susceptible populations. This then gives insight into the level of exposure that may meet the public health goal. The level of ‘tolerable’ exposure can than be specified as an FSO. In establishing the hazard level in the FSO format, consideration may be given of an additional margin of safety. Certainly where a risk assessment gives detailed and quantitative insights in relative or absolute risk, factors contributing or mitigating risk and intervention scenarios, relating ALOP to FSO and thus defining the required stringency of the FSM system becomes a more open and transparent exercise. Notably, an FSO may be set without use of risk assessment information, for instance using available epidemiological data relating an observed level of illness in a population to the occurrence of a particular hazard. In this case, attribution of the hazard to specific foods and knowledge of the exposure of the general population to the foodborne hazard are generally less well developed and the FSO level thus less well founded. Another option is to base an FSO on insight in the existing level of the hazard in the food commodity concerned at consumption. An FSO level might then reflect whether the current level is acceptable, which can be a valid option when the public health goal is to maintain status quo, or whether it would be necessary and feasible to reduce this level. It might also be possible to derive an FSO from an existing target for a particular hazard in a food earlier on in the food chain. As an example, it may be possible to relate the level of the hazard at the point in the chain where a microbial criterion is currently defined to the likely level at the end of the chain. Quantitative microbiology techniques (i.e. modelling microbial growth, survival or inactivation) as well as probabilistic risk assessment techniques such as Monte Carlo modelling and Bayesian Belief Networks can be useful in such ‘down-stream’ modelling to project a suitable FSO level. To use the FSO as an overall target at the end of food chains not only articulates a view of the competent national authority on what constitutes a safe food, it also brings the concept of ‘equivalence’ into food control where the FSO specifies a management target but leaves flexibility regarding the way this target is achieved. It clearly acknowledges that food chains can be very different operationally, but nevertheless should comply with a common target. Examples of FSOs in regulation cannot be given yet, although several governments are working towards including such targets. One pathogen/

Food safety objectives and related concepts

159

product combination which has received much attention is Listeria monocytogenes in ready-to-eat food products. This would be a good case in point where setting an FSO could contribute to public health protection. Recent national and international MRA studies have been developed as a basis to explore the establishment of a ‘real’ FSO (FSIS, 2003; JEMRA, 2004). Up to now, as a theoretical example, an FSO of 100 cfu L. monocytogenes/g has been worked with (Gram, 2004; ICMSF, 2002; Szabo et al., 2003; Walls and Buchanan, 2005). The concept of FSO has been established by Codex Alimentarius firstly for microbial hazards, which would include toxic metabolites produced such as mycotoxins. An example of an FSO for aflatoxin in shelled, roasted peanuts (15 mg/kg) has been published (Pitt, 2004). FSOs are not designed to be verifiable by analytical means, although they can be, first because they occur at the time of consumption where testing is not feasible and secondly because any action to follow-up on the result of testing would come too late. In any case, industry working towards meeting an FSO should find ways to validate that their FSM system does comply with the FSO and should monitor key targets at earlier points in the food chain to verify that the system is operating as planned. Such earlier targets can be POs, PCs or CMs. Microbiological criteria can be used as part of verification. Industry has at least two roles to play regarding the FSO concept. When an FSO is stipulated by a competent authority for a particular hazard/food combination, it is likely that it will be a mandatory target and it is industry’s role to ensure the food they produce and market complies with it. However, before an FSO is decided on, industry has a role to play as a key stakeholder in the governmental risk management process leading to the establishment of an FSO. In order to comply with an FSO, industry will need to understand or find ways to assess what the level of the hazard is in the product they are responsible for at the time of consumption, and, in particular, how the level of the hazard in the part of the food chain that they manage contributes to the hazard level at consumption. They may need to collaborate with industries managing other parts of the chain to gain this understanding. In addition to actual data on the hazard levels, industry may need to use quantitative microbiological modelling approaches to project levels at points in the food chain where data on frequency and/or concentration of the hazard are lacking as relevant to the case concerned. When an MRA study has been used by the government in establishing the FSO, this could contain useful information for the industry to consider in investigating the dynamics of the hazard in the chain and evaluating possible mitigation strategies to achieve consistent and robust compliance in the particular situation of the industry. Knowing the dynamics of the hazard level and with a sense for possible mitigation strategies, the industry needs to design and implement appropriate FSM systems governing specific processes, single steps in the chain or particular parts of the food chain encompassing more than a single step.

160

Emerging foodborne pathogens

The second role of industry noted above is that of a key stakeholder in the risk management process of investigating the impact of a foodborne pathogen on public health in their jurisdiction. According to the advice of Codex Alimentarius (CAC, 2004; CCFH, 2005), developing an MRA is the preferred basis for this assessment of prevailing risk, for deciding on the need to mitigate the risk and, when this need is acknowledged, for choosing the appropriate risk management options. One of these is to establish and mandate an FSO. Others relate to related concepts, specific control measures or microbiological criteria. In the development of an MRA, industry can be involved by providing relevant data, when these are available to the industry. This would possibly improve on the correctness and utility of the MRA study. In addition, in the choice of the risk management options, industry could contribute data and expertise that help the governmental risk manager to choose effective and feasible options. After all, the cost-effectiveness of risk management options will influence the total cost to society (which goes well beyond solely monetary costs). It should be noted that industry has to manage all possible risks associated with the foods they put on the market. This responsibility is not confined to products for which an FSO or related concepts are specified by governments. Industry has to manage biological, chemical and physical hazards specific to the food and food operation conditions using appropriate FSM systems. Such systems will involve generic (or prerequisite) tools (i.e. GHP, GMP, GAP) and specific tools (i.e. HACCP) as appropriate to the pathogen/food combination. Specific processing technologies, logistics, and control measures will be deployed by the industry in the production and marketing of the food, the proper functioning of which will be validated before use in practice and verified during actual operation. They need to be validated and verified not only to assure control of the pathogen to which the FSO relates, but for all possible hazards. HACCP has been developed as the semi-quantitative management system that helps industry to discharge this responsibility in a systematic and professional way for hazards across the board. FSO are defined for a small number of microbial hazards and compliance to the FSO can well be fitted in with the HACCP approach. This new approach of government to be more specific in guiding food safety management does not require industry to change significantly the FSM practices they have been putting in place over many years and that have performed well in most respects.

7.3.2 Performance objective (PO) A PO states the maximum level of a hazard in a food at a specified step in the food chain before time of consumption that can be tolerated at that point in the food chain. Use of a PO is a means by which PC and/or particular control measures can be shown to contribute to achieving the FSO and ultimately the ALOP, when defined. In this sense, it is a ‘bridge’ between the measures that determine the food safety performance at a specific step and

Food safety objectives and related concepts

161

the FSO/ALOP. The PO is a target in the food chain that transposes the link to public health goals provided by the FSO further upstream in the food chain. By providing a specific ‘in-chain-target’ for tolerable hazard levels, quantitative guidance is given that can help ensure compliance to end-ofchain targets and public health goals. Whereas FSOs are only established by the competent authority, POs can very well be established by industry and it is expected that this group will start using the concept to improve further the design of the food chains they have responsibility for and ultimately become the group setting the majority of POs. POs established by governments give guidance for the stringency expected in process control. They leave flexibility in how industry complies with regulatory expectations, e.g., use of validated process criteria in HACCP plans. In the case where a government chooses to mandate a PO or POs, it may be their judgement that such guidance relates to a critical step in the overall food chain management for which the way(s) that control is achieved cannot be left flexible to the food chain operators. Governments may also propose PO/POs for voluntary adoption by those industries that would have difficulty establishing such targets for their own operation or that elect to adopt such pre-defined target levels. The latter form of targets are referred to as default or safe-harbour targets (CCFH, 2005). In order to set a PO for a particular food product, insight is required in the dynamics of the hazard throughout the various steps or stages in the chain of production and marketing up to the time of consumption of the product. This allows that, in terms of hazard level, the expected outcome of the food chain up to the point of application of the PO is assessed and a PO level can be decided on. The hazard level prior to consumption can differ substantially from the FSO, depending for instance on the type of food product or the processing applied in its manufacture, i.e., the specific intrinsic and extrinsic factors that apply. However, the following rules may apply in general: ∑ ∑

∑

The PO will have to be more stringent than the FSO for those foods that support the growth of a pathogen between the point that the PO is set at and the time of consumption. The PO may be less stringent than the FSO for foods that, after the point where the PO applies, will receive a lethal treatment that reliably inactivates the pathogen or reduces it to a sufficiently low level to comply with the FSO. The PO and FSO could be set at the same level for foods that do not support growth of a pathogen.

It should be noted that these general rules give a quite simplified view of reality. As ‘level of a hazard’ in the PO and FSO definition relate to both the concentration and (or) the frequency of the hazard, relating ‘levels’ of PO and PSO is not necessarily a straightforward exercise. Additionally, some level of increased stringency can be included in the PO level to account for issues in the product design or operational manufacturing that would benefit from such an extra margin in the target. An MRA can assist in determining

162

Emerging foodborne pathogens

relationships between the FSO and (one or more) PO levels when pertinent data and models for the relevant part of the chain have been included. MRA can then possibly also be used to explore the need for and the extent of a margin of safety required in the PO level. Although, in principle, there would be only one FSO for a specific foodborne pathogen/commodity couple, it is possible that multiple POs are defined in the food chain relevant to the commodity. Obviously, importantly, information about any other POs in the chain should be considered such that the level of the hazard in the end-products of individual steps does comply with the requirements elsewhere in the chain to meet the PO and, ultimately, the FSO. Thus, POs should take into account whether the microbiological hazard(s) will decrease, not change or increase during subsequent steps prior to the food being consumed. For instance, a PO intended for a ready-to-eat food at the point of delivery from the processing establishment is established taking into account knowledge of (i) the probability and extent of growth under specified storage, transport and distribution conditions, (ii) the expected shelf life, and (iii) the expected changes in hazard levels during preparation by the consumer. The wealth of information contained in a detailed and quantitative MRA should be very useful in establishing the appropriate PO or POs, certainly from a government point of view. When a relevant and suitable MRA is not available or does not add particular value, POs could be set according to available scientific and technical information. It is to be expected that industry will often use the latter option, as the information they have available in many cases may be more specific than the information in a governmental MRA. The reason being that such an MRA has likely been compiled for a ‘typical food chain’ and considers more extreme scenarios than apply in the food chain (part) at hand. Although governmental risk assessments often are very large pieces of work and are commonly captured in voluminous reports, they do contain scientific and technical information or tools that are useful to industry. For instance, the industry can use particular information or mathematical techniques to further improve details of their FSM systems (i.e. GHP, GMP, HACCP) or to optimise the design of its operations. Relevant information may include: ∑ ∑ ∑ ∑ ∑

differences in the dynamics of the hazard and the level of control between typical operations information on weak points in food chains such as inadequate processing technologies insight in consumer use and handling or, rather importantly, misuse and mishandling outcome of different intervention strategies possibly simulated the recognition of (new/emerging) hazards that possibly have not been considered in an industry’s FSM systems as yet, the risks they potentially pose and thus the rationale and urgency with which they may need to be considered.

Food safety objectives and related concepts

163

Mathematical modelling techniques or calculations used in governmental MRAs may help industry, for instance, to identify critical points for hazard control or consider appropriate points in their operation for effective hazard control. Although POs are generally not intended to be verified by analytical means, they may be suitable for such verification. In contrast to the situation with FSOs, verification of POs may be very meaningful regarding necessary follow-up. Compliance to the PO needs to be validated as part of the design of the overall FSM system and the measures implemented at the particular step, verified by other means, such as: ∑ ∑ ∑

establishment of a suitable microbiological criterion for the end product, testing and statistical analysis verification (incl. monitoring and record keeping) of a pertinent and validated performance criterion (PC) relating to the PO (see below) or of specific control measures underlying the PC and suitable for verification surveillance or screening programs on the prevalence of a microbial hazard in a food on the marketplace, which may be relevant mainly when a PO is established by a competent authorities.

When POs are set by governments, industry is responsible for compliance to these targets. As with FSOs, industry has to obtain the appropriate knowledge to do this, possibly in collaboration with other food professionals in the food chain, design appropriate FSM systems and manage these during practical operation. Industry may be able to contribute to and be involved in the process by which POs are decided on by competent authorities. Where POs are not mandated but proposed as default or safe-harbour targets, industry is left with a choice to adopt those targets or design alternatives which better fit the particular conditions and make-up of the food chain that they operate. Industry will need to have the appropriate expertise and resource to establish their own POs. Being able to utilise the FSO/PO concepts in the design of FSM systems will help the industries involved achieve more coordinated and better integrated management, which can be tailored to the benefit of the operations and will foster innovative approaches to food production and marketing (e.g. novel processing technologies; new marketing channels) because sufficient flexibility is left in the operations actually deployed.

7.3.3 Performance criterion (PC) A performance criterion (PC) is related to a performance objective (PO) set at a particular step in a food chain and is the effect required of one or more control measure(s) working in concert to meet the PO. A control measure is a concept also used in the framework of HACCP and means ‘any action and activity that can be used to prevent or eliminate a food safety hazard or reduce it to an acceptable level’ (CAC, 2001). In the context of HACCP, the

164

Emerging foodborne pathogens

concept of control measure captures a very broad range of activities and interventions that may go beyond that of specific industrial settings and also can include those that could be instigated both by private and public entities. Some examples to illustrate the range of possible control measures: requiring specific processing technologies to be used, advising use of certain preservatives or physical measures to prevent cross-contamination, defining microbiological specifications, providing guidelines on pathogen control, issuing hygiene codes, microbiological criteria, specific information such as labelling, providing training and education, consumer awareness schemes and others. A PC brings the guidance derived from the public health goals (as included in ALOP/FSO and PO) to the specific conditions of the step involved. In such a step, the different activities will influence the dynamics of a hazard in different ways, but the PC links the overall effect of these various activities to the hazard level stipulated in the PO. Therefore, setting a PC must be based on knowledge of the level of the pathogen in the incoming material and the PO level set for the outgoing material which then relates to the overall FSO/ALOP. In the terminology introduced by the ICMSF (2002), the hazard level in the incoming material is referred to as H0. PCs are generally established by industry, but national governments may also set PCs, for instance to provide mandatory guidance on critical aspect of food safety management or as elective default or safe-harbour targets. Basically, PCs can relate to three effects being aimed at: ∑ ∑ ∑

a reduction of the level (i.e. frequency and/or concentration) of a hazard at the step such as to meet the PO level specified (H0 level is higher than PO level) a tolerable maximum increase in the level of a hazard in a product supporting growth due to pathogen growth and/or additional contamination such that the PO level is not surpassed (PO level higher than H0 level) assurance of no increase in the hazard level in a product (H0 level can be equal to PO level).

In the first case, a PC relates to one or more control measures that together exert a biocidal effect on the microbial hazard in a food. This could be a lethal heat treatment of an infectious pathogen such as Salmonella (for instance, a pasteurisation with a minimum time and temperature specified) alone or, when appropriate, with other control measures that, for instance, avoid recontamination of pasteurised products with the pathogen. A PC aiming for minimal or no-growth can be based on (one or more) control measures with a biostatic effect on microbial hazards. Chilling is a common control measure in this respect that can be used alone or in combination with other control measures that prevent or limit growth, such as the use of preservatives, reduced water activity or modified atmosphere packaging. FSO, PO and PC values all need to be specific to the food product(s) they are set for. In addition, the control measures contributing to or providing a particular PC should be highly tailored to the material coming into a step as

Food safety objectives and related concepts

165

well as to the highly specialised conditions of the plant and processing line utilised or the conditions in the post-manufacturing part of the particular food chain (i.e. storage retail, food service, consumer home). Thus, for a manufacturing operation, the control measures need to be built into the HACCP plan developed for the specific product and the HACCP plan implemented correctly and its performance monitored and reviewed during operation. Before implementation of the designed PC, the PC or rather the underlying control measures need to be validated for their efficacy and reliability to exert the effect aimed at. Validation may be required of the individual control measure, the total PC or the FSM system as a whole in keeping with good guidelines on validation of control measures (CAC, 2001; ILSI, 1999). In establishing a suitable PC, knowledge of the variability of hazard levels is important, but this cannot always be fully accounted for due to lack of supporting data. The H0 for a step, for instance, is likely to be a distribution of values for the frequency and/or concentration of a hazard. In many cases, not enough information is available to describe that distribution accurately. Rather, a deterministic approach is followed and a level is chosen that reflects, for instance, the average of the known prevalence or concentration. In other cases, the ‘highest’ value ever observed may be chosen to reflect the ‘worst case’. Should enough information be available, a distribution of values can be used as such or to relate a numerical upper value for a deterministic calculation. The latter often is the 95th percentile of the distribution, which is then not the absolute worst case but a somewhat ‘more likely’ case. Also, the result of a PC will be a distribution of effects but a choice can be made to use deterministic values in the design of the PC. For a PC to be set to achieve a specific inactivation of a pathogen, the value representing the absolute minimum inactivation required or the most likely inactivation exerted could be used. The choices here determine the outcome of the PC setting exercise. As before, the availability of a relevant and suitable MRA would greatly assist in taking the decisions and establishing a meaningful and valuable PC. When sufficient data and information are available for a quantitative, probabilistic assessment, it may be possible even to take into account the distributions of the various parameters rather than resort to absolute, singlepoint values. When such data are lacking, gaps in the assessment can possibly be overcome by informed assumptions. Industry has a clear role in establishing the PC for steps that they have under their control and they need to choose appropriate processes and control measures to deliver the PC set and decide on the specific settings that indicate their proper functioning or failure. The PC and the underlying control measures needs to be validated by appropriate means before implementation and to be verified after that. For particular control measures, industry will define socalled product or process criteria (ICMSF, 2002). These are existing concepts, commonly used in industry that provide specific details that need to be adhered to for a specific control measure to function as planned. A process

166

Emerging foodborne pathogens

criterion articulates, for instance, the time and temperature of a heat treatment, whereas a product criterion gives intrinsic food parameters such as pH, aw or salt level.

7.3.4 Microbiological criterion (MC) The concept of microbiological criterion (MC) is not a new one and involves a level of microbial testing that can provide useful information on the safety status of a food. It has been used in the context of HACCP since its inception to define and check compliance of a food with the microbiological specifications or requirements established for that food. Early on, the ICMSF put testing for the control of food safety on a sounder statistical basis through the introduction of risk-based sampling plans (ICMSF, 1986, 2002). In this ‘classical’ sense, the MC is useful when a FSM system for a process, step or a chain is designed and validated as well as when a system has been implemented and needs to be verified. An MC defines the acceptability of a product or food lot, based on the presence, absence or number of microorganisms, including parasites, and/or the quantity of their toxins/ metabolites, per unit of mass, volume, area, or lot (CAC, 2001). Currently, the MC approach is particularly useful when there is a need to assess the status of a food lot or consignment for which no information is available on the conditions under which the food was produced that could help in assessing its compliance to an established standard of safety. This could, for instance, apply to port-of-entry testing where MCs are used as a control measure. With the introduction of the new concepts of FSO/PO/PC, it is likely that the utility of the MC concept will expand. For example, when defining and checking compliance of a food to a PO, an MC approach could be useful, at least when the information provided by the MC in terms of representing or assessing the level (= frequency and/or concentration) of a hazard in the food can be transposed to the level as defined in the PO. Likewise, in establishing the appropriateness of a PC and/or the underlying control measure(s), and their proper functioning in operation, the MC approach for design and verification can apply. Because of the limitations of microbiological testing, it has long been recognised that MCs cannot guarantee food safety. However, MC play a role as control measures and as a means to verify the continuing effectiveness of (part of) a food safety control system and may thus help provide insight into whether a PO, PC or FSO is complied with as projected. In specifying an MC for design and/or verification, the specific sampling and statistical design specifications chosen for an MC will depend on many factors, such as the type of hazard, the food concerned, the analytical methodology involved, the variability in the level of the hazard in the food, the level of the hazard being verified, and the confidence required in the verification. In general, an MC will have to be more stringent than the target (i.e. PO or FSO) it is associated to, in order to ensure that the target is being

Food safety objectives and related concepts

167

Probability distribution of hazard in food

met with high confidence and consistently. Where there is a large degree of uncertainty or variability, an appropriate level of stringency should be embedded in the MC (Fig. 7.2). Dahms (2004) demonstrated that translation of an FSO into a microbiological criterion is not a simple exercise. Uncertainties and confidence requirements usually accounted for with statistically based decision rules would easily be neglected. Precise definition of what is meant with an FSO (e.g. how the word ‘maximum’ should be interpreted) and of the desired confidence in compliance to an FSO will need further discussion. Such definitions will have an impact on the suitability of sampling plans and microbiological criteria and, ultimately, on the risk management decisions. Next to the MC, other approaches using microbiological testing in association with statistically sound analysis, may find employment in the design (including validation) and verification of processes (IOM/NRC, 2003; IFT, 2004). In all applications, the extent of analytical testing should depend on the risk posed by the hazard and an objective assessment whether other means of verification would not be quicker and more effective than microbial testing. Ever since the introduction of the concepts of the FSO, MC and PO, there has been confusion about their features and utility. The basis of this confusion is that seemingly, the concepts may all be about levels of a hazard and verification of compliance by microbiological testing. In Table 7.1, a brief overview of differences between these concepts are listed which may help in segregating them. The role of industry regarding MCs is twofold but quite straightforward. Where MCs are mandated by governments, compliance needs to be ensured and where the MC approach is useful for validation or verification purposes, industry can deploy it in designing and operating their FSM systems.

PO or FSO Trace 1

Trace 2

0.0

1.0

2.0

3.0

4.0

5.0 6.0 Log cfu/g

MC trace 2 MC trace 1

Fig. 7.2

Specifying a microbiological criterion depends on insight in hazard distribution.

168

Emerging foodborne pathogens

Table 7.1

Differentiating characteristics of the FSO/PO concept and the MC concept

Food safety objective and performance objective

Microbiological criterion

A target applying at the time of consumption (FSO) or at (an) earlier step(s) in the food chain (PO) that a safe food should comply with.

A statement of conditions that differentiates acceptable from unacceptable lots of food

Considers only the safety of the food, not the quality.

Can be used for both safety and quality of foods

Provides guidance to the industry for the design of the food safety management system of the food chain as a whole (FSO) or for individual steps in the food chain (PO); compliance of foods on the market to the targets needs to be ensured using appropriate verification tools (can be MC).

Applied to individual lots or consignments of food products to validate the appropriateness of the design and for the assessment of the acceptability of products on the market; compliance applies only to the food investigated not to past or future lots or consignments.

Components: hazard to which the target applies; maximum frequency and/or concentration of the hazard; point in the chain where the target applies. It could possibly contain a specification of the level of compliance expected (under discussion).

Components: microorganism (toxin) of concern; sampling plan; analytical unit; analytical method for detection and quantification; point(s) in the chain that the MC applies; microbiological limits; number of analytical complying with limits.

Based on what governmental risk managers believe will ensure the supply of safe foods (FSO; a mandatory or safe-harbour PO) or what industry believes will be a level assuring compliance to an FSO (PO set by industry).

A specification of compliance to established criteria for safety or quality that can relate to a FSO, PO or control measure as well as to a food of which no other information is available regarding compliance to safety/ quality (e.g. port-of-entry)

(Adapted from Cordier, 2004)

7.4 When setting a PO may be more efficient than establishing an FSO As an end-of-chain target, the FSO represent a valuable concept when it can be used to drive improvements in food safety control so that public health goals are (increasingly) better met. When the etiology of a foodborne disease predominately involves the direct consumption of a contaminated ready-toeat food (e.g., Listeria monocytogenes in soft cheeses, Staphylococcus aureus in fermented meats, Salmonella in fresh product) the consumers’ risk is determined mainly by the frequency and extent of contamination in the product at the moment of ingestion. In this instance, there is a clear rationale to establish an FSO that provides guidance to avoid unsafe levels of the hazard occurring. For pathogens such as Salmonella and Enterohaemorhagic E. coli that are infectious and can cause illness in sensitive consumers at very low levels,

Food safety objectives and related concepts

169

the notion of a ‘safe level’ or ‘acceptable level’ that is associated to the FSO concept may not be suitable to drive improvements. In the final product, these pathogens should be virtually absent and setting an FSO might not give sufficiently clear or specific guidance. When pathogens like these are associated with raw foods that need to be cooked prior to consumption, an important point of control is the final food handling and preparation. A PO here may be relevant numerical guidance regarding hazard levels before cooking, while instructions on appropriate cooking (actually representing a PC) would be valuable guidance as well. Additionally, it would be relevant to provide specific descriptive advice for the food handlers alerting them to practices that can cause cross-contamination and should be avoided. That advice could, for instance, be education of consumers on proper hygiene practices in the home, preventing recontamination of cooked foods, or on putting in place physical barriers to prevent prepared foods coming into contact with raw ingredients in a food service setting. Where it is possible to address a problem at the source or at early stages in the food chain, a PO alone or in addition to an FSO might be an effective means to the overall management of the food chain. For instance, having a PO at primary production driving reductions in the prevalence of infectious pathogens such as Salmonella and Campylobacter in materials coming into a manufacturing or food service step would improve the efficacy of the food control considerably.

7.5

Designing an FSM system using the new concepts

To ensure that a food safety management (FSM) system intended for a step in the food chain or for the food chain as a whole performs correctly, delivering a product that complies with safety standards such as the FSO and mandated or voluntary POs, the system has to be designed in terms of the processes and control measures employed in it. The processes and control measures need to be validated, and the correct functioning of the system in operation needs to be verified (van Schothorst, 2004). The new concepts of FSO and PO give concrete guidance for the design of FSM systems applying to a particular step in the food chain. In essence, all one needs to know when designing the FSM system for a step are the input parameter (i.e. the hazard level in the incoming material) and the output parameter (the level of the hazard in the outgoing product, established as a PO or FSO, when the step is the final step in the food chain). Knowing input and output parameter is sufficient to establish the effect required at that step (i.e. the PC). This basic idea led the ICMSF (ICMSF, 2002) to propose a simple equation that brings together the main design parameters for the establishment of the PC for a step that will deliver the PO: H0 – SR + SI £ PO. In which H0 is the initial level of the hazard concerned, SR represents any reduction in the level of the hazard occurring in the step

170

Emerging foodborne pathogens

concerned and SI represents any increase in the level of the hazard occurring in the step. When the step considered is the final step of the food chain, i.e., preparation of the food such that it is ready for consumption, the overall effect will relate to the FSO, rather than a PO. Using the equation in the design of subsequent steps, the PO of one step may constitute the H0 of the following step in the food chain. As proposed by the ICMSF, the appropriate PC can be derived from the need to change the H0 during the course of the step such that it meets the PO specified for the step. The combination of SR and SI thus directly relates to the PC since the PC represents the net, overall effect. The overall effect can be a minimum reduction, no change or maximum increase in hazard concentration. An example of the use of the equation in design is given in Fig. 7.3. In their original publication the ICMSF also developed a number of practical examples illustrating the establishment of FSOs and related concepts using the conceptual equation (ICMSF, 2002). More examples have been published since (Gram, 2004; Szabo et al., 2003; Stewart et al., 2003) and the merits of the approach discussed (Cole, 2004; Reij and van Schothorst, 2000; Stewart et al., 2002). While the equation is simple enough to focus the mind when designing a process step, it may be viewed as a true mathematical equation that can be solved. However, it is not all that straightforward (Havelaar et al., 2004; McMasters and Todd, 2004; Zwietering, 2004) and following are three examples of complicating factors. 1. SR and SI represent the cumulative reduction or cumulative increase respectively, in the level of the hazard. They may involve a multitude of measures and processes that contribute individually to the overall, cumulative effect to very different extents and the individual relative contributions need to be understood in order to design the overall effect, i.e., the PC. H0 10 cfu/g

PO 1 cfu/g

FSO 100 cfu/g PC = 2D

PC - 1D

Lm cfu/g

500 0 – 500

– 1000 Reception

Portioning

CM: heating

Fig. 7.3

Packaging CM: zoning

Consumption

CM: chilling

Graphical representation of the manufacturing and marketing part of a food chain for pâté, a ready-to-eat product.

Food safety objectives and related concepts

171

2. All parameters in the basic equation (H0, SR, SI, PO, FSO) represent distributions of frequency and/or concentration. It would be ideal to consider them as distributions and segregate frequency from concentration as appropriate but this would put a very high demand on supporting data or assumptions. In most instances, therefore, single point values will be used for which support is available and which can be chosen to be more or less conservative. For instance, to be very conservative, the absolute minimum of reduction consistently obtained at the step can be selected for SR in conjunction with the absolute maximum values for H0 and SI occurring. 3. The parameters suggested are all expressed in log10 units. Whereas this may be appropriate for the dynamics in the level of a hazard that follow a logarithmic behaviour (i.e. gradual growth, decimal reduction treatments), it is not for other dynamics. As a case in point, contamination of the food by the hazard in the course of a step, e.g. as a result of cross-contamination after a heat treatment, for instance, will add to the concentration of the hazard in a non-logarithmic fashion. The original conceptual equation does not account for that difference. Despite the various complicating factors that are heavily discussed in scientific and technical literature, the conceptual equation or equations derived from it should be useful to industry to make a start with the design of the FSM system of the step(s) they are responsible for and to communicate with other partners in the food chain responsible for other steps. In this way they can build a properly integrated management system for the food chain overall and, together, ensure compliance to the FSO when defined. Many issues of detail of the new microbiological risk management approach need to be developed further and Table 7.2 lists some examples. Considering Table 7.2

Examples of issues that remain to be addressed (not an exhaustive list)

Issues from a public perspective ∑ When deriving an FSO for a specific food/pathogen combination, an ALOP for a pathogen also occurring in (many) other foods or even water sources will complicate the process enormously. How meaningful will it be? ∑ Epidemiology is an important tool for monitoring the impact of an FSO on public health. Will it truly reflect the impact and will it be specific enough to relate results to the individual actual pathogen/food combinations for which an FSO is established? Correct food attribution is a particular issue. ∑ The FSO may be set using detailed information, incl. distributions, variability and uncertainty of various parameters, compiled in an MRA study. When ‘reverseengineering’ from the FSO to levels earlier in the chain (i.e. to set POs), one cannot mathematically correctly consider the probabilistic calculations (on which variability/ uncertainty have an important impact) as included in the MRA. A solution would be to assume certain values, but the assumptions need to be carefully validated. ∑ How can a bright line in the sand be dictated for a level that can be a combination of concentration and frequency? Are both ‘capped’ to a value then? Why, a certain highfreq./low-conc. situation may have the same theoretic health consequence as a particular

172

Emerging foodborne pathogens

Table 7.2

Continued

low-freq./high-conc. situation for highly infectious pathogens. For less infectious ones, the former case may improve public health outcome, but would not be allowed. ∑ It is assumed that all industries along the chain work together to arrange the chain management such that the FSO is met. Different professionals in the chain, however, may have a very different ‘span of control’. They may be very small players in primary production or retail or food service. Can they discharge their responsibility correctly? Do they have the sufficient capability and skills? How about legal issues when the FSO is not met? ∑ The FSO makes it possible to define equivalence between operations. Would that hold also for the PO? The part of the chain after the point of the PO may not be ‘equivalent’ between food chains. Issues for the industry’s viewpoint ∑ Industry needs support in getting familiar with the concepts introduced by governments and also should be supported in training and skills development. ∑ Industry needs governments to provide (easy-to-use) tools to assess compliance to (mandated) FSOs and POs and to do the necessary calculations in support of their food product or food chain design. ∑ FSOs are agreed on nationally. How can we deal with different FSOs for the same/ similar products in different countries? Should the product be labelled not to be sold in countries for which it does not comply to the FSO? ∑ Where is the burden of proof? With government, to prove that the FSO is not complied to? With industry, to prove compliance? Is it the last player in the chain who needs to provide the evidence? Who decides who it is? ∑ Governments’ intend to monitor compliance to the FSO. Will they be able to separate industries that perform well from those that do not? Those that do well (maybe after heavy investment in upgrading skills) may not be recognised and may even be discouraged because of a few players that do not perform diligently. ∑ FSOs are defined for a food (group). How will the FSO consider the pathogen concerned being present in other (food, water, etc.) sources than the one for which the FSO holds? ∑ When the FSO is a ‘bright line in the sand’ (an absolute upper limit not to surpass in any event), a very large margin of safety will be needed in order to statistically ensure that that in practice no overshoot ever happens. ∑ Since, FSO and PO are ‘design targets’, would it not be better to view them as a limit and set them somewhat conservatively to compensate for a small percentage of overshoot? Specifically when the FSO is set in a generic way, for (a group of) products produced by different chains, there should be allowance made for variability. ∑ The technical know-how in industry may not be sufficient to appreciate the details of an MRA, incl. assumptions, process and modelling parameters, to verify whether the situation in their food chain compares well and the same or similar conditions, technologies and interventions/mitigation scenarios would apply. ∑ When the FSO is a ‘bright-line-in-the-sand’, is this true also for a PO set by government? The PO should be set considering what follows in the chain, which might be different for chains that are differently constructed though producing the same kind of product. PO might not need to be identical for chains that differ as such. ∑ What is the legal situation of a mandatory FSO or PO? Are individual parties responsible or should it be the responsibility of the whole chain, all parties, to be responsible, and thus liable?

Food safety objectives and related concepts

173

the important benefits expected, the effort required to deal with these outstanding issues is very worthwhile. It is important that risk managers in governments obtain and share actual experience in setting FSO and PO levels on the basis of public health goals and MRA studies. Experience is also necessary in the industry regarding assessing whether FSOs and FSO levels are complied with or how food safety systems need to be (re-) designed to deliver compliance. Such experience in all stakeholders is needed to see how the various issues yet to be solved can be tackled in a practical, pragmatic but scientifically robust way. It will be clear that in order for the industry to be a genuine stakeholder in the process of setting FSO/PO levels and professionally able to meet them, there is a clear need to ∑ ∑ ∑ ∑

invest in skills and capability to be able to understand the FSO and related concepts assess (in collaboration with others in the various chains their products go into) whether food safety systems currently used comply to FSOs how measures can be established (and validated) that improve the current systems to meet the FSO, when necessary what the legal status is of the concepts and what their situation is in terms of liability.

This will involve significant upgrading of mathematical and quality-assurance skills which small-scale industry may not be able to support fully. Sector or trade organisations may be able to help, but most probably can provide only guidelines and generic approaches. Support for operational practice in meeting the FSO and related concepts will be given by the prudent government and carefully planned for in the roll-out of the microbiological risk management concepts.

7.6

Conclusions

FSM systems such as HACCP, GHP and GMP have been developed over recent decades to provide the industry with excellent tools for the control of food safety. The framework of risk analysis has been proposed as the common way to evaluate risks and determine appropriate risk management interventions relating to societal public health goals. There is some confusion about terminology and meaning of particular activities, for instance the hazard analysis conducted in HACCP and risk analysis; while a hazard analysis has a number of factors in common with the risk characterisation phase of a risk assessment, they differ in their focus and intent (see Table 7.3 for more details). The concept of a food safety objective and related targets have been proposed to articulate more output oriented targets in an effort by governments to strengthen the link between operational food safety management and the

174

Emerging foodborne pathogens

Table 7.3 Differences and similarities between hazard analysis in HACCP and risk assessment in risk analysis (adapted from CCFH, 2001) Hazard analysis

Risk analysis

∑ As part of a HACCP plan, hazard analysis is normally carried out at a company level and is processing plant/commodity specific. ∑ Hazard analysis involves both hazard identification and hazard evaluation. ∑ Hazard analysis considers all potential hazards (microbiological, chemical and physical). ∑ Hazard analysis considers the nature of the hazard(s), the extent of the hazard(s) and the need to control the hazard(s) in order to assure the safety of the food. ∑ Hazard analysis determines in quantitative terms which potential hazards are significant and the required level of control, when significant. ∑ Hazard analysis is directed to the development of a risk management strategy.

∑ A risk analysis is normally carried out by regulatory authorities, or a unit larger than an individual company, and focuses on understanding the prevailing risk to the consumer population in order to develop appropriate risk reducing interventions. ∑ Often, this concerns the control of an industry-wide public health problem (e.g., listeriosis in ready-to-eat food). ∑ Risk analysis is a complex activity that encompasses risk assessment, risk management and risk communication. ∑ The outcome of risk analysis is normally a determination of the absolute or relative (i.e. benchmarked) level of risk from a foodborne hazard to one or more populations and of one or more options to manage the risk.

Much of the information required for the hazard analysis will also be required for components of risk analysis. For example, determining the source of the hazard, the prevalence and level of the hazard in the food, disease incidence and types and severity of adverse effects, the populations affected and means through which the hazard can be controlled, are all elements that are common to both hazard analysis and risk analysis. The structural framework of hazard analysis also shares several of the components of risk assessment, particularly the hazard identification, hazard characterisation and exposure assessment components.

public health goals. The increased attention for risk-based food control and the advances of mathematical and information technologies have fostered the development of the key quantitative tools that enable the assessment of the impact of foodborne microbial hazards on the health of the population, to evaluate possible interventions to reduce undue risks and to provide clearer guidance for industry. The FSO articulates the joint target of the industry involved in a food chain as it concerns all links in a chain. Performance objectives and performance criteria are two new concepts to transpose the guidance from the public health perspective to operationally relevant parameters such as control measures, product and process criteria that make up operational FSM systems. Conceptually, FSO derives from ALOP, whereas PO and PC derive from FSO. To deliver the PC, one or more control measures are needed and particular control measures are governed by product or process criteria. This hierarchy or cascade of concepts is not necessarily one that cannot be separated. Actually, in principle, flexibility is left in the actual

Food safety objectives and related concepts

175

selection of control measures or in-chain targets for industry to be able to tailor these well to the specifics of their food operation. Food operations do not need to plan for a major change in the way they manage food safety now a number of new concepts have been introduced. At an operational level, many of the concepts, standards and guidelines that are used in FSM systems to date will be needed in the future. However, industry will need to be able to provide evidence that their foods, at the moment they are eaten, comply with an FSO when this is mandated or that the in-chain targets (the PO or POs) have been adequately chosen to, when complied with, contribute to meeting the FSO. This will require industry to become versed in the new concepts, how they are actually established and, where appropriate, used in practice. This requires some level of skills and capacity building by industry, which would be stimulated by appropriate support by the public organisations that advocate and instigate the adoption of the FSO and related concepts.

7.7

References

BUCHANAN, R.L.,

2004. Principles of risk analysis as applied to microbial food safety concerns. Mitteilungen aus Lebensmitteluntersuchung und Hygiene, 95(1), 6–12. BUCHANAN, R.L., J.L. SMITH and W. LONG, 2000. Microbial risk assessment: dose-response relations and risk characterization. International Journal of Food Microbiology, 58, 159–172. BUCHANAN R.L., S. DENNIS and M. MILIOTIS, 2004. Initiating and managing risk assessments within a risk analysis framework: FDA/CFSAN’S practical approach. Journal of Food Protection, 67(9), 2058–2062. CAC (CODEX ALIMENTARIUS COMMISSION), 2001. Food Hygiene – Basic Texts, 2nd edition. Joint FAO/WHO Food Standards Programme, CAC Secretariat, Rome. ISBN 92-5-104619-0 CAC (CODEX ALIMENTARIUS COMMISSION), 2004. Procedural Manual, 14th edition. Joint FAO/ WHO Food Standards Programme, CAC Secretariat. ISBN 92-5-10528-1 CAHILL, S.M. and J.L. JOUVE, 2004. Microbiological risk assessment in developing countries. Journal of Food Protection, 67(9), 2016–2023. CCFH (CODEX COMMITTEE ON FOOD HYGIENE), 2001. Interrelationships Between Hazard Analysis and Risk Analysis. Report of the 34th Session of the Codex Committee on Food Hygiene, Bangkok, Thailand, 8–13 October 2001. ALINORM 03/13, Appendix V, Pages 119–121. CCFH (CODEX COMMITTEE ON FOOD HYGIENE), 2005. Proposed Draft Principles and Guidelines for the Conduct of Microbiological Risk Management. Report of the 37th Session of the Codex Committee on Food Hygiene, Buenos Aires, Argentina, 14–19 March 2005. ALINORM 05/28/13, Appendix III. CCGP (CODEX COMMITTEE ON GENERAL PRINCIPLES), 2005. Proposed draft working principles for risk analysis for food safety. Report of the 21st Session of the Codex Committee on General Principles, Paris, France, 11–15 April 2005, ALINORM 05/28/33A. COLE, M.B., 2004. Food Safety Objectives – Concept and current status. Mitteilungen aus Lebensmitteluntersuchung und Hygiene, 95(1), 13–20. CORDIER, J.L., 2004. Microbiological criteria – Purpose and limitations. Mitteilungen aus Lebensmitteluntersuchung und Hygiene, 95(1), 28–31. DAHMS, S., 2004. Microbiological sampling plans – Statistical aspects. Mitteilungen aus Lebensmitteluntersuchung und Hygiene, 95(1), 32–44.

176

Emerging foodborne pathogens

FSIS (FOOD SAFETY AND INSPECTION SERVICE), 2003. Risk Assessment for Listeria monocytogenes

in Deli Meats. Published May 26, 2003. Available on-line at http://www.fsis.usda.gov/ OPPDE/rdad/FRPubs/97-013F/ListeriaReport.pdf GORRIS, L.G.M., 2002. Use of elements of (quantitative) microbiological risk assessment by industry. In: Principles and guidelines for incorporating microbiological risk assessment in the development of food safety standards, guidelines and related texts. Annex IV of the report of a Joint FAO/WHO Consultation held in Kiel, Germany 18–22 March 2002. FAO and WHO, Rome. ISBN: 92-5-104845-2. GORRIS, L.G.M., 2004. Food Safety Objective: an integral part of food chain management. Mitteilungen aus Lebensmitteluntersuchung und Hygiene, 95(1), 22–27. GORRIS, L.G.M., 2005. Food safety objective: An integral part of food chain management. Food Control, 16(9), 801–809. GRAM, L., 2004. How to meet an FSO – Control of Listeria monocytogenes in the smoked fish industry. Mitteilungen aus Lebensmitteluntersuchung und Hygiene, 95(1), 59–67. HAVELAAR, A.H., M. J. NAUTA and J.T. JANSEN, 2004. Fine-tuning Food Safety Objectives and risk assessment. International Journal of Food Microbiology, 93, 11–29. ICMSF (INTERNATIONAL COMMISSION ON MICROBIOLOGICAL SPECIFICATIONS FOR FOODS), 1986. Microorganisms in Foods 2: Sampling for Microbiological Analysis: Principles and Specific Applications. 2nd edn University of Toronto Press. Toronto. ISBN: 0-802-05693-8. ICMSF (INTERNATIONAL COMMISSION ON MICROBIOLOGICAL SPECIFICATIONS FOR FOODS), 2002. Microorganisms in Foods. Book 7. Microbiological Testing in Food Safety Management. Kluwer Academic/Plenum, NY. ISBN 0-306-47262-7. IFT, 2004. Managing food safety: use of performance standards and other criteria in food inspection systems. IFT Authoritative Report. Available on line at: http://www.ift.org/ pdfs/scitech/managing_food_safety.pdf ILSI (INTERNATIONAL LIFE SCIENCES INSTITUTE), 1999. Validation and verification of HACCP. ILSI Europe Report series. ILSI Europe, Brussels. ISBN 1-57881-060-4. ILSI (INTERNATIONAL LIFE SCIENCES INSTITUTE), 2004. Food Safety Objectives – Role in Microbiological Food Safety Management. ILSI Europe Report series. ILSI Europe, Brussels. ISBN: 1-57881-175-9. IOM/NRC (INSTITUTE OF MEDICINE/NATIONAL RESEARCH COUNCIL), 2003. Scientific Criteria to Ensure Safe Food. Committee on the Review of the Use of Scientific Criteria and Performance Standards for Safe Food. Food and Nutrition Board. Board on Agriculture and Natural Resources. Institute of Medicine/National Research Council. National Academy Press, Washington, D.C. ISBN 0-309-08928-X. JEMRA (JOINT FAO/WHO EXPERT MEETINGS ON MICROBIOLOGICAL RISK ASSESSMENT), 2002. Risk assessments of Salmonella in eggs and broiler chickens. Microbiological Risk Assessment Series 2. FAO/WHO, Rome. ISBN 92-5-104873–8 JEMRA (JOINT FAO/WHO EXPERT MEETINGS ON MICROBIOLOGICAL RISK ASSESSMENT), 2004. Risk assessment of Listeria monocytogenes in ready to eat foods – Technical report. Microbiological Risk Assessment Series 5. FAO/WHO, Rome. ISBN 92-5-105127–5. JEMRA (JOINT FAO/WHO EXPERT MEETINGS ON MICROBIOLOGICAL RISK ASSESSMENT), 2005. Internet homepage. http://www.fao.org/es/esn/jemra/index_en.stm LAMMERDING A.M. and A. FAZIL, 2000. Hazard identification and exposure assessment for microbial food safety risk assessment. International Journal of Food Microbiology. 58, 147–157. MCMASTERS, R.L. and E.C. TODD, 2004. Modeling growth and reduction of microorganisms in foods as functions of temperature and time. Risk Analysis, 24(2), 409–414. PITT, J.I., 2004 Application of the Food Safety Objective concept to the problem of aflatoxins in peanuts. Mitteilungen aus Lebensmitteluntersuchung und Hygiene, 95(1), 52–58. REIJ, M.W., and M. VAN SCHOTHORST, 2000. Critical notes on microbiological risk assessment of food. Brazilian Journal of Microbiology, 31(1), 1–8. SCHLUNDT, J., 2002, New directions in foodborne disease prevention. International Journal of Food Microbiology, 78, 3–17.

Food safety objectives and related concepts

177

STEWART, C.M., R.B. TOMPKIN

and M.B. COLE, 2002. Food safety: new concepts for the new millennium. Innovative Food Science and Emerging Technologies, 3, 105–112. STEWART, C.M., M.B. COLE and D.W. SCHAFFNER, 2003. Managing the risk of staphylococcal food poisoning from cream-filled baked goods to meet a food safety objective. Journal of Food Protection, 66(7), 1310–1325. SZABO, E.A., L., SIMONS, M.J. COVENTRY and M.B. COLE, 2003. Assessment of control measures to achieve a food safety objective of less than 100 CFU of Listeria monocytogenes per gram at the point of consumption for fresh precut iceberg lettuce. Journal of Food Protection, 66(2), 256–264. VAN GERWEN, S.J.C. and L.G.M. GORRIS, 2004. Application of elements of microbiological risk assessment in the food Industry via a tiered approach. Journal of Food Protection, 67 (9), 2033–2040. VAN SCHOTHORST, M., 2004. A simple guide to understanding and applying the Hazard Analysis Critical Control Point concept. ILSI Europe Concise Monograph Series. ILSI-Europe, Brussels. ISBN: 1-57881-179-1. WALLS, I. and R.L BUCHANAN, 2005. Use of food safety objectives as a tool for reducing foodborne listeriosis. Food Control, 16(9), 795–799. WHO (WORLD HEALTH ORGANISATION), 2000. Interaction between Assessors and Managers of Microbiological Hazards in Foods. Report of the WHO Expert consultation held in Kiel, Germany, 21–23 March 2000. WHO, Geneva. Available on-line at ftp://ftp.fao.org/ docrep/nonfao/ae586e/ae586e00.pdf WHO (WORLD HEALTH ORGANISATION), 2002. WHO Global Strategy for Food Safety: safer food for a better health. World Health Organization, Geneva, Switzerland. ISBN: 924154-574-7 WTO (WORLD TRADE ORGANISATION), 1995. The WTO Agreement on the Application of Sanitary and Phytosanitary Measures (SPS Agreement). http://www.wto.org/english/tratop_e/ sps_e/spsagr_e.htm ZWEITERING, M., 2005. Practical considerations on food safety objectives. Food control, 16(a), 817–823.

7.8

Further reading

The following resources may be of interest to readers. They address aspects of microbiological risk assessment and of risk analysis relevant to the topic of this chapter. Microbiological risk assessment in food processing by Stringer, M. and M. Brown (2002). Woodhead Publishers, Cambridge, UK. ISBN 1 85573 585 7 Microbiological risk assessments developed for specific pathogen and commodity combinations developed by JEMRA (Joint FAO/WHO Expert Meetings on Microbiological Risk Assessment). Posted on: http://www.fao.org/es/esn/jemra/ index_en.stm and http://www.who.int/foodsafety/micro/jemra/en/ Guidelines on food safety management and all aspects of risk analysis (risk management, risk assessment general and individual components) are developed by FAO and WHO, partially through Codex Alimentarius. They can be accessed via: http://www.who.int/ foodsafety/micro/jemra/en/ , http://www.fao.org/es/esn/jemra/index_en.stm and http: //www.codexalimentarius.net/web/index_en.jsp Risk Analysis Manual – Food Safety Risk Analysis – an overview and framework manual. FAO and WHO are publishing a document describing the basis principles of risk analysis, describing specific cases relating to microbiological and chemical hazards. Further details through: http://www.fao.org/es/ESN/food/control_riskanalysis_en.stm Risk assessment of foodborne bacterial pathogens: Quantitative methodology relevant for human exposure assessment. Published by DG-SANCO, (European Commission,

178

Emerging foodborne pathogens

Health & Consumer Protection Directorate-General) in 2003. Posted on: http:// europa.eu.int/comm/food/fs/sc/ssc/out308_en.pdf Microbiological risk assessment training package of slides with elaborate notes for education and information. This is being developed by ICD (Industry Council for Development) under the auspices of FAO and WHO. Details available through: http://www.icdonline.org/an/html/actionrisk.html Publications on aspects of microbiological risk analysis and their relationship with food safety management systems. Published by ILSI-Europe (International Life Sciences Institute, Europe Branch) and accessible through: http://europe.ilsi.org/publications/ Interactions of Predictive Microbiology and Risk Assessment. Special section in Risk Analysis, 23(1), 1-238 (2003). 1st International Conference on Microbiological Risk Assessment: Foodborne Hazards. A variety of papers on microbiological risk assessment. Special section in Journal of Food Protection, 67(9), 1965-2074 (2004). The Fourth International Conference on Predictive Modelling in Foods, with contributions on microbiological risk assessment. Special issue of International Journal of Food Microbiology. Volume 100 (1–3), 1–383 (2005). Impact of Food Safety Objectives on Microbiological Food Safety Management. Proceedings of a workshop held on 9–11 April 2003 Marseille, France. Published in a special issue of Food Control, Volume 16 (9), 775-832 (2005).

Part II Individual pathogens

179

180

Emerging foodborne pathogens

Arcobacter

181

8 Arcobacter S. J. Forsythe, Nottingham Trent University, UK

8.1

Introduction

In recent years the Campylobacter genus has come under considerable attention due to the importance of C. jejuni as a major cause of human gastroenteritis. Meanwhile, a number of non-jejuni/coli Campylobacter and related organisms have been recognised as causing animal if not human cases of gastroenteritis. This chapter considers the genus Arcobacter which is beginning to be recognised as a human pathogen, as well as of veterinary importance. There are relatively few reported cases of infection due to Arcobacter, but the data are limited possibly due to the lack of routine use of appropriate isolation media. The most significant study concerning Arcobacter probably started in 1995 in Belgium where the WHO Centre for Campylobacter is specifically looking for non-jejuni/coli Campylobacter-like organisms in faecal samples (see Section 8.5.2 for details). As this study continues, the incidence and symptoms associated with Arcobacter infections will become more apparent. This chapter will review the improvements in isolation and identification techniques for Arcobacter species, occurrence of the organisms in the food chain, as pathogens of farm animals and their possible involvement in human pathogenesis. As will be shown, although there is a growing knowledge of the organism, there is still a need to develop and validate improved selective media for Arcobacter isolation. Basic physiological aspects including impact of extrinsic parameters also need to be investigated and more specifically its role in human, as well as animal, intestinal infections needs to be more fully examined. It is plausible that A. butzleri and A. cryaerophilus, which were first isolated from aborted bovine foetuses and later from porcine foetuses, will in the future be more fully recognised as of significant human importance.

182

Emerging foodborne pathogens

Currently there is increasing awareness of their role as animal pathogens, but only a few isolated human cases. The possible reasons for this low reported incidence are considered in this review. It should be remembered that C. jejuni and L. monocytogenes were also both initially recognised as veterinary pathogens prior to their recognition as human pathogens. A number of reviews on Arcobacter present growing evidence of Arcobacter as a possible cause of human pathogen, and its association with food products (Skirrow 1994; Wesley 1994, 1997; Mansfield and Forsythe 2000; Phillips 2001a, b).

8.1.1 Basic physiological attributes of Arcobacter Arcobacter (Latin for ‘arc-shaped bacterium’) are microaerophilic, Gram negative, helical, non-spore forming rods. Cells are usually helical, curved or S-shaped when viewed by conventional light microscopy. They are generally 1–3 mm by 0.2–0.4 mm, although unusually long cells greater than 20 mm are occasionally observed (Wesley 1994). The Arcobacter cell is motile by means of single unsheathed polar flagellum and exhibits a darting corkscrew movement. Small cryptic plasmids (<5 kp) have been reported in a portion (21/89) of broiler isolates (Harrass et al. 1998). On blood-based agars Arcobacter produce round white, off-white or greyish colonies, 2–4 mm in diameter after three days incubation (Collins et al. 1996a). Colonies are generally small, non-pigmented and convex with entire edges. Colony size may vary and swarming occurs on fresh agar (Wesley 1994). Most aerotolerant strains, except A. butzleri, grow weakly on the common blood agar bases. However, Brain Heart Infusion Agar containing 0.6% yeast extract and 10% blood agar has been used recently for routine culturing (Vandamme et al. 1992b). Most strains are difficult to grow to high cell densities in liquid culture systems (Dickson et al. 1996). The distinctive features of Arcobacter spp., compared with Campylobacter spp., are the aerotolerance and lower growth temperature. Arcobacters can grow between 15 ∞C and 37 ∞C (Hilton et al. 2001) although the upper limit is dependent upon incubation conditions. The Arcobacter can grow in atmospheric oxygen optimally at 30 ∞C and as low as 15 ∞C or below (Vandamme et al. 1992a; On and Holmes 1995, Burnens et al. 1992). Slight growth is observed under anaerobic conditions at 37 ∞C. Whereas C. jejuni, C. coli and C. lari grow optimally at 42 ∞C, few Arcobacter species display such thermotolerance (Lammerding et al. 1996). Arcobacter strains grow between pH 5.5–9.5 with most strains growing between pH 6.8–8.0 (Neill et al. 1978). Control of arcobacter growth and survival using extrinsic parameters is covered in Section 8.6.

8.2

The Arcobacter genus

Ellis et al. (1977) were the first to describe the bacteria later assigned to the

Arcobacter

183

genus ‘Arcobacter’. They found two phenotypically different groups of microaerophilic curved rods in the aborted foetuses of cattle, pigs and sheep (Ellis et al. 1977). These were identified as campylobacters; the so-called ‘Group 1’ strains were identified as Campylobacter fetus and the ‘Group 2’ strains belonged to a previously undescribed Campylobacter taxon. The morphology and mole % GC content of the organisms were similar to those of Campylobacter species but the strains belonging to Group 2 differed in their ability to grow in the presence of atmospheric oxygen at 30 ∞C after primary isolation in a microaerobic environment (Neill et al. 1978). Therefore ‘Group 2’ were referred to as ‘aerotolerant campylobacters’. Later, Neill et al. (1985) suggested that all aerotolerant strains should be considered a new species of the Campylobacter genus and the name Campylobacter cryaerophila sp. nov. was proposed. Kiehlbauch et al. (1991a, 1994) using ribotyping showed that C. cryaerophila was composed of three DNA homology groups; C. cryaerophilia groups A and B and C. butzleri, which has 40% DNA homology with C. cryaerophila. Subsequent partial 16s rRNA sequence analysis showed that C. cryaerophila and C. nitrofigilis exhibited 68% homology with other Campylobacter and an 87% homology with each other and hence Thompson et al. (1988) proposed that they be assigned to a separate genus. Vandamme et al. (1991a) proposed the genus Arcobacter for aerotolerant Campylobacter after extensive immunotyping and SDS-PAGE of cellular proteins, fatty acid analysis and DNA-rRNA and DNA hybridisation studies. Vandamme et al. (1992b) formally transferred C. butzleri to the genus Arcobacter as A. butzleri comb. nov. and also identified five major groups using DNA-DNA hybridisation data. These included A. cryaerophilus (two distinct electrophoretic subgroups), A. butzleri, A. nitrofigilis, and a new species Arcobacter skirrowii. The Arcobacter genus currently has four recognised species; A. butzleri, A. cryaerophilus, A. skirrowii and A. nitrofigilis (Fig. 8.1; Vandamme et al. 1991a, 1992b, Vandamme and Goossens 1992). A. butzleri and A. cryaerophilus are the only species to date that have been associated with human enteric diseases. Three further species have been proposed that are not yet formally recognised; A. cibarius, A. halophilus and Candidatus A. sulfidicus (Wirsen et al. 2002; Houf et al. 2005; Donachie et al. 2005). In addition On et al. (2003) using AFLP and 16S rDNA sequence analysis showed that a novel Arcobacter skirrowii-like species had been isolated from pig abortions and duck cloaca. A number of other arcobacters have been isolated from high temperaturee environments but have not been further identified. The Arcobacter genus is in the rRNA superfamily VI of the Proteobacteria which also includes the genera Campylobacter, Helicobacter, Wolinella and Flexispira. The Campylobacteraceae was created as a new eubacterial family to reflect the close genotypic and phenotypic affiliation between Campylobacter and Arcobacter (Vandamme and De Ley 1991; Vandamme and Goossens, 1992; On 2001; Karenlampi et al. 2004). The phylorelationship based on partial 16S DNA sequence analysis is shown in Fig. 8.1.

0

5

10

15

20

Emerging foodborne pathogens 25

30

184

Campylobacter fetus subsp. fetus

L04314

Sulfurospirillum deleyianum

Y13671

Candidatus Arcobacter sulfidicus

AY035822

Arcobacter sp., Hawaiian hypersaline lake

AF513455

Arcobacter nitrofigilis

L14627

Arcobacter sp., oil-contaminated groundwater

AB030592

Arcobacter butzleri

L14626

Arcobacter cibarius

AJ607391

Arcobacter cryaerophilus, subgroup 1

L14624

Arcobacter cryaerophilus, subgroup 2

AY314755

Arcobacter skirrowii

L14625

Arcobacter skirrowii-like

AY314754

Helicobacter pylori

U01330

Wolinella succinogenes

M88159

Nautilia lithotrophica

AJ404370

Caminibacter hydrogeniphilus

AJ309655

Hydrogenimonas thermophila

AB105049

Fig. 8.1 Phylogenetic relationship of Arcobacter and related organisms. The 16S DNA sequence accession numbers from Genbank are given alongside the strain name. The neighbour joining tree was constructed following DNA sequence alignment using Bionumerics software (Applied Maths, Belgium) by Dr S. On (personnal communication).

8.2.1 A. butzleri A. butzleri cells are 1–3 mm long and 0.2–0.4 mm wide and are weakly catalase positive. All strains grow on VB medium and MacConkey agar and reduce nitrate. Growth occurs in the presence of 8% glucose. Most strains produce DNase, and grow in the presence of 1.5% NaCl and at 42 ∞C. The G+C content is between 28 and 29 mol%. The organism has a 40% DNA homology with A. cryaerophilus but differs in its ability to grow in the presence of 1.5% NaCl and 1% glycine. Plasmids of four sizes (2, 3, 4.8 and 5 kb) were isolated from 24% of A. butzleri isolates. A. butzleri serotypes 1 and 5 are regarded as the primary pathogenic strains of Arcobacter (Lior and Woodward 1991). The majority of A. butzleri isolates have been obtained from humans suffering from diarrhoea, aborted animal fetuses and human blood samples (Vandamme et al. 1992b). Although the association with diarrhoeal illness in humans and animals is striking, the clinical significance of A. butzleri remains to be proven.

8.2.2 A. cryaerophilus A. cryaerophilus is regarded as the most diverse of the Arcobacter species. It is divided into two subgroups corresponding to hybridisation Groups 1A

Arcobacter

185

and 1B (Fig. 8.1). However there are currently no phenotypic tests to differentiate these two groups (Vandamme et al. 1992b).

8.2.3 A. skirrowii A. skirrowii cells are curved rods, 1–3 mm long and 0.2–0.4 mm wide. Most strains produced a-haemolysis on blood agar. Growth occurs on VB medium; no growth occurs on MacConkey agar. Most strains do not grow in the presence of 0.04% TTC and 1.5% NaCl. The G+C content of A. skirrowii is 29–30 mol%. So far A. skirrowii strains have been isolated mainly from preputial fluids of bulls and no human clinical significance has been demonstrated (Vandamme et al. 1992b). A.skirrowii-like organisms from pig abortions and duck cloaca have been described by On et al. (2003). These were shown to be distinct from A. skirrowii using AFLP and 16S rDNA sequence analysis (cf. Fig. 8.1).

8.2.4 A. cibarius A. cibarius is a newly proposed Arcobacter species from poultry. Cells are slightly curved rods, 1–3 mm long. Houf et al. (2005) isolated 20 strains that were positive with the Arcobacter genus-specific test (Harmon and Wesley 1996) but not with the species specific test (Houf et al. 2000). ERIC-PCR analysis showed that the strains formed 16 genotypes. Using numerial analysis of whole-cell proteins all isolates were shown to form a single group that was distinct from other Arcobacter species. DNA-DNA hybridisation with reference strains of the four current Arcobacter species showed only low binding levels. The G+C content of the isolates ranged from 26.8 to 27.3% (within the range of other Arcobacter) and 16S rRNA gene sequence identified A. butzleri as the nearest phylogenetic neighbour (Fig. 8.1). Isolates were distinguishable from other Arcobacter using phenotypic tests; catalase, oxidase, urease, reduction of nitrate, growth at 25 and 37 ∞C under aerobic conditions, growth on 2–4% NaCl media and susceptibility to cephalothin. The proposed type strain is LMG 21996 (Laboratorium voor Microbiologie, Gent, Belgium).

8.2.5 Environmental Arcobacter species The best studied species in this group is the nitrogen-fixing A. nitrofigilis which was defined by Vandamme et al. (1992b). Cells are usually curved or spiral, 1–3 mm long by 0.2–0.9 mm wide. A. nitrofigilis is motile by a single polar unsheathed flagellum. It can be differentiated from the other arcobacters by its nitrogenase activity and by its typical whitish and round colony morphology. This organism is found on the roots of Spartina alterniflora, a salt marsh plant and has no association with human or animal diseases. It exhibits an 89% 16S rRNA sequence homology with other species of Arcobacter (Fig. 8.1; Vandamme et al. 1992b).

186

Emerging foodborne pathogens

The second most studied organism in this group is the coastal marine bacterium provisionally named ‘Candidatus Arcobacter sulfidicus’ (Wirsen et al. 2002). The bacterium is described as a ‘sulphide-oxidising, filamentussulphur-producing vibroid organism’. The name Candidatus is based on the proposal of Murray and Stackebrandt (1995) of a prokaryotic category Candidatus for difficult to grow or presently uncultivatable prokaryotes for which generic information allows formal assignment within established genera. The organism possesses a multilaminar polar membrane morphology similar to that described for other campylobacters but has not been examined in arcobacters. The major difference with the other Arcobacter species is the mode of nutrition. Candidatus A. sulfidicus is chemoautotrophic whereas the others are chemoorganotrophic. Other environmental Arcobacter strains have been detected (though uncultured) from conditions of high hydrostatic pressure (in Suruga Bay and the Japan Trench), and temperature. Although the isolates have not been cultured, their 16S rRNA gene sequence has been analysed and compared with known species (Fig. 8.1) to determine their phylogenetic relationship. These uncultivated isolate have been obtained from salt marsh sediments (McClung et al. 1983), Wadden Sea sediments (Llobet-Brossa et al. 1998), North Sea bacterioplankton (Eilers et al. 2000), in association with vestimentiferan tube worms (Naganuma et al. 1997), a deep-sea hydrothermal chimney, hypersaline cyanobacteral mat from Solar Lakes (Teske et al. 1996) and from the redox interface of the Cariaco Basin (Madrid et al. 2001). Since these strains are not associated with animals or humans they will not be covered in detail in this chapter.

8.3

Arcobacter identification and typing methods

Presumptive Arcobacter species can be identified by their shape (small commashaped or spiral rods) and motility (they exhibit characteristic darting or corkscrew motility) (Nachamkin 1995). Although Arcobacter morphology is similar to Campylobacter, they can be easily distinguished from Campylobacter and related genera by their ability to grow in air at 25 ∞C (Burnens et al. 1992; On 1996; On and Holmes 1995). However, Campylobacter and Arcobacter are relatively inactive phenotypically and definitive strain identification is based on a limited number of tests. Nonetheless, such tests are the most common means of identifying campylobacteria. Phenotypic differences of the four recognised species of Arcobacter and the proposed A. cibarius are summarised in Table 8.1 based on the studies of Kiehlbauch et al. (1991a), Vandamme et al. (1992b), Houf et al. (2005) and On and Holmes (1991a, b, 1992). The main phenotypic traits used for Arcobacter species differentiation are catalase activity, nitrate reduction, cadmium chloride susceptibility, microaerophilic growth at 20 ∞C, growth on MacConkey agar and in the presence of 3.5% NaCl and 1% glycine. Organic acids and amino acids are used as carbon sources. Hydrogen is not required for growth. All

Table 8.1

Differential growth and biochemical tests. Numbers in columns indicate percentage positive (adapted from Mansfield and Forsythe 2000) A. cryaerophilus

A. skirrowii

A. nitrofigilis

A. cibarius

Growth 15 ∞C 25 ∞C, aerobic 37 ∞C, aerobic 37 ∞C, microaerophilic 37 ∞C, anaerobic 42 ∞C, microaerophilic Anaerobic + TMAO Nutrient agar Buffered charcoal yeast medium Campylobacter charcoal-deoxycholate medium Campylobacter minimal medium MacConkey agar Lecithin Growth in presence of glycine 1% NaCl 2% NaCl 3.5% NaCl 4.0% Bile 2% Glucose 8% Pteridine 0/129 vibriostat Cadmium chloride (2.5 mg disc) Oxidase Catalase Alpha haemolysis H2S production (lead acetate paper)

100 100 100 100 100 25–67b 100 100 100 100 100 83–100b 75 58 92 42–67 0 0 0 100 Resistant 100 33–100b 14 0–25

100 100 50 58 16–95 0–18b 11 100 100 95 0 16–58b 16 9–23b 84 0–33b 0 79 45–48 100 Sensitive 100 100 0 0–11

NG 100 100 100 100 11–33b 0 100 100 100 0 0/Positive 11 78 100 61 0 0 50 NG NG 100 100 100 0

100 100 50 0 100 0 100 100 0 0 0 0 0 Not tested 100 100 100 0 NG 100 NG 100 100 0 0

NG 31 0 100 NG 0 Weak NG NG NG NG 100 Varied Varied 0 0 0 NG NG NG NG 100 54 0 0

187

A. butzleri

Arcobacter

Testa

188

Table 8.1

Continued A. butzleri

A. cryaerophilus

A. skirrowii

A. nitrofigilis

A. cibarius

Nitrate reduction Glucose utilisation Hippurate hydrolysis Urea hydrolysis DNase activity Selenite reduction Alkaline phosphatase Tripheyl-tetrazolium chloride reduction Indoxyl acetate Pyrazinamidase activity Resistance to nalidixic acid (30 mg disc) Cephalotin resistance (30 mg disc) Metronidazole resistancec Carbenicillin resistancec Cefoperazone resistancec 5-fluorouracil resistancec Basic fuchsin Crystal violet Janus green G+C content (mol %) Type strain

100 0 0 0 0–92 0 0 100 100 0 14–25b 83–100b 92 100 100 100 100 100 100 29–31 LMG 10828

30–36 0 0 0 0–72 0 0 95 100 0 0–17b 72–100b 100 100 100 100 68 100 100 28–29 LMG 7536 (subgroup 1)

100 NG 0 0 22–100 11 0 77 100 NG 0 100 100 100 100 100 0 33 100 29–30% LMG 6621

100 NG 0 100 100 50 0 0 100 NG 0 0–22b 0 0 0 0 0 0 0 28–29 LMG 7604

0 NG 0 0 0 0 0 0 100 NG Varied 100 NG 100 100 NG Varied Varied Varied 26.8–27.3 LMG 21996

Sources: Vandamme and De Ley 1991; Jacob et al. 1993; On et al. 1996; Schroeder-Tucker et al. 1996; Atabay et al. 1998; Harrass et al. 1998; Wirsen et al. 2002; Houf et al. 2004. It should be noted that numbers of strains tested varied between researchers. Therefore % values are not necessarily comparable. a Tests were at 25 ∞C unless otherwise stated. b variation between sources. c Tested on blood agar medium.

Emerging foodborne pathogens

Testa

Arcobacter

189

Arcobacter isolates hydrolyse indoxyl acetate (Harmon and Wesley 1997; Mansfield and Forsythe 2000). Kazmi et al. (1985) proposed that a simple diagnostic characteristic useful for the presumptive identification of Campylobacter jejuni, C. coli, and Arcobacter spp. is the cadmium chloride test.

8.3.1 Biochemical and other non-molecular methods Numerical taxonomic analysis of a range of biochemical and growth tests has been used to design probablistic identification schemes. On et al. (1996) described a probability identification matrix for campylobacteria, comprising 67 phenotypic characters and 37 taxa. The accuracy and integrity of the matrix was evaluated using established computer-assisted methods. The results indicated that most campylobacteria could be identified accurately and objectively with phenotypic tests when probabilistic methods of data assessment were employed. Nevertheless since Arcobacter spp. do not metabolise a wide range of substrates, identification methods have tended towards the use of molecular methods (Bastyns et al. 1995). These include whole protein profiles, fatty acid profiles, ribotyping techniques, PCR with specific DNA probes and antibiotic resistance patterns. Whole cell protein profiles Campylobacter, Helicobacter and Arcobacter may be distinguished by profiling whole cell proteins using polyacrylamide gel electrophoresis (PAGE)(Vandamme et al. 1991b; Vandamme and Goossens 1992). The separate proteins and peptides are in the molecular weight range of 14,000–116,000 kDa and are easier to extract and separate than outer membrane proteins which can be used to distinguish between certain Campylobacter species, i.e., C. jejuni, C. coli, C. lari and C. fetus (Derclaye et al. 1989). Differences in preparation methods between laboratories have little effect on identifications when numerical analyses are used (Costas et al. 1990). A good correlation between numerical analysis of protein patterns and DNA relatedness (i.e. DNA-DNA hybridisation) has been reported (Costas 1992). Vandamme and his team in 1989 started to collect protein profiles representing all known Campylobacter taxa. By 1992 the database had 600 Campylobacter strains as well as Helicobacter, ‘Flexispira’ and Arcobacter species. These profiles have demonstrated the application of whole cell protein profiles with numerical analysis to differentiate and identify Campylobacter strains. Possible use for epidemiological studies has also been considered. Vandamme et al. (1992b) described the Arcobacter genus using a range of techniques including whole cell protein profiles. Houf et al. (2005) described the new Arcobacter species ‘A. cibarius’ (cf. Fig. 8.1) using such profiling. Fatty acid profiles Fatty acid composition of bacterial cells may significantly differ between

190

Emerging foodborne pathogens

taxa, and its determination and analysis are useful for classifying and identifying many bacteria (Vandamme and Goossens 1992). Lambert et al. (1987) determined the cellular fatty acid compositions of 368 Campylobacter and Campylobacter-like organisms (Lambert et al. 1987). Three hundred and thirty-three strains were placed in one of the three groups (A, B or C), 29 isolates were placed in four additional groups (D, E, F and G). Included in group F was the type strain and one reference strain of A. cryaerophilus (then C. cryaerophila). This group was distinguished by the presence of two isomers of 16:1. Vandamme et al. (1992b) described the fatty acid methyl ester (FAME) analysis of 83 strains of Arcobacter. The two electrophoretic subgroups of A. cryaerophilus could be differentiated easily from each other by the amounts of the two isomers of 16:1. The overall fatty acid compositions of the A. cryaerophilus subgroup 2 strains were very similar to those of the A. butzleri strains. The A. skirrowii strains could be differentiated easily from most other taxa by the presence of an unknown fatty acid with an equivalent chain length of 15.276 Da and by a high percentage of 18:1 cis 11. The A. nitrofigilis strains had an overall fatty acid profile that was very different from the profiles of the other arcobacters. Antimicrobial susceptibilty The first extensive study on antimicrobial susceptibilty of arcobacters was by Kiehlbauch et al. in 1992. They evaluated the activity of 22 antimicrobial agents against 78 A. butzleri and A. cryaerophilus strains and found that the ‘aerotolerant campylobacters’ differed from other campylobacters. Recently Houf et al. (2004) studied the antibiotic profiles of human and poultry isolates. They noted the acquisition of erythromycin and ciprofloxacin resistance, which is of concern since these are frequently used as first-line drugs for human Campylobacteraceae infections. Harrass et al. (1998) used biochemical profiles (API CAMPY®) and resistance patterns to 13 antimicrobial agents to identify and characterise broiler Arcobacter isolates. Thirteen antimicrobial resistance patterns were detected in 89 isolates. A more focused study of antimicrobial agent susceptibility by Atabay and Aydin (2001) characterised the resistance patterns of 39 strains of A. butzleri. Fera et al. (2003) tested seventeen strains of A. butzleri and thirteen of A. cryaerophilus for their antimicrobial susceptibility to 26 antimicrobial agents. As in previous studies, all isolates showed high levels of resistance to penicillins, macrolides, chloramphenicol, trimethoprim and vancomycin. The authors proposed that the carbapenems are a good choice for treating severe Arcobacter infections, along with cefepime (blactam) and the fluoroquinones as a second choice. Serotyping Lior and Woodward (1991) developed a serotyping scheme based on heatlabile antigens. Serogroups 1 and 5 were the most common serotypes among human isolates, followed by 2, 6 and 12 (Squinazi et al. 1995). Serogroup 1

Arcobacter

191

was also most common among poultry, water and sewage isolates. Serogroups 5 and 12 were also common among isolates from water and porcine sources (Marinescu et al. 1996a).

8.3.2 Molecular approaches to Arcobacter species microbial identification Because of the narrow range of biochemical tests available for differentiating Arcobacter, a number of DNA based methods have been developed. DNADNA hybridisation serves as the ‘Gold standard’ for relatedness studies but is not suitable for routine identification purposes and is not commonly used these days. Subsequently other molecular methods based on conserved genes such as the 16S and 23S rDNA genes have been increasingly used to identify Arcobacter (cf. Fig. 8.1). There is only one study using a different conserved gene, glyA (Al Rashid et al. 2000). Ribotyping and restriction fragment length polymorphisms (RFLP) Ribotyping, also known as PCR-restriction fragment length polymorphisms (RFLPs), or DNA fingerprinting of ribosomal DNA (rDNA) is highly discriminatory and can be used for epidemiological subtyping. Most often the technique involves the hybridisation of DNA probes which target the genes encoding the 16S rRNA molecule, to restriction enzyme digested chromosomal DNA. Some workers target both the 16S and 23S rRNA genes. The 23S gene alone does not appear to have enough discriminatory power to be usable for subtyping. Distinctive hybridisation fragments have been identified from the 3-7 genes encoding 16S rRNA in A. butzleri, A. cryaerophilus and A. skirrowii (Kiehlbauch et al. 1991a, 1994; Wesley et al. 1995; Cardarelli-Leite et al. 1996; Schroeder-Tucker et al. 1996) (Table 8.2). Cardarelli-Leite et al. (1996) described a simple rapid method of RFLP analysis which allowed the discrimination of members of the genus Campylobacter from the members of the closely related genera (Arcobacter, Helicobacter, Wolinella). Kiehlbauch et al. (1991c) analysed whole cell chromosomal digests of 84 strains of arcobacters by using Pvu II RFLP of rRNA genes followed by hybridisation with E. coli 16S and 23S rRNA labelled probes. Ribotyping demonstrated that A. cryaerophilus DNA groups 1A and 1B were different from A. butzleri strains. All A. cryaerophilus strains demonstrated a common ribosomal DNA restriction fragment of 3.2kb and the DNA group 1B strains contained an additional common band at 2.6kb. Ninety-four percent of A. butzleri strains contained a 3.0 kb band not found in A. cryaerophilus. Further work by this group evaluated several methods of ribotyping in order to simplify the procedure, so that routine ribotyping was achievable (Kiehlbauch et al. 1994). Two genus specific 16S rRNA-based oligonucelotide DNA probes and an A. butzleri species specific DNA probe have proved effective at identifying field isolates from animals and human sources. It also differentiates between

192

Primer sequences for Arcobacter-specific DNA probes

Organisms 16S rRNA probes A. butzleri A. butzleri

A. butzleri A. skirrowii Arcobacter

Primer

Position

Nucleotide sequence (5’-3’)

Reference

Arco I Arco II Butz Arco III BUTZ SKIR ARC94 ARC1430 CAH1a CAH1b Arc1 Arc2 ARCO

a 224–244 1426–1446 984–1007 269–291 959–983 705–723 94–111 1430–1447 Not given Not given Not given Not given 1357–1338

AGAGATTAGCCTGTATTGTATC TAGCATCCCCGCTTCGAATGA CTTGACATAGTAAGAATGATTTAG AGTTATGTGTCATAGTCTTGGTA CCTGGACTTGACATAGTAAGAATGA GGCGATTTACTGGAACACA TGCGCCACTTAGCTGACA TTAGCATCCCCGCTTCGA AATACATGCAAGTCGAACGA TTAACCCAACATCTCACGAC AGAACGGGTTATAGCTTGCTAT GATACAATACAGGCTAATCTCT CGTATTCACCGTAGCATAGC

Harmon and Wesley 1996 Harmon and Wesley 1996 Harmon and Wesley 1996 Harmon and Wesley 1996 Houf et al. 2000 Houf et al. 2000 Snaidr et al. 1997 Snaidr et al. 1997 Marshall et al. 1999 Marshall et al. 1999 Gonzalez et al. 2000 Gonzalez et al. 2000 Houf et al. 2000

BUTZ N.butz CRYAE N.c.1A N.c.1B CRY1

1222–1241 1174–1199 1375–1395 1135–1162 1713–1736 105–124

CTATTCAGCGTAGAAGATG AGCGTTCTATTCAGCGTAGAAGATGT TAAGTCGAGACTGAAAAGT ACCGAAGCTTTAGATTCGAATTTATTCG GGACTTGCTCCAAAAAGCTGAAG TGCTGGAGCGGATAGAAGTA

Bastyns et al. 1995 Kabeya et al. 2003a Bastyns et al. 1995 Kabeya et al. 2003a Kabeya et al. 2003a Houf et al. 2000

23S rRNA probes A. A. A. A. A. A.

butzleri butzleri cryaerophilus cryaerophilus 1A cryaerophilus 1B cryaerophilus

Emerging foodborne pathogens

Table 8.2

Table 8.2

Continued

Organisms

Primer

Position

Nucleotide sequence (5’-3’)

Reference

A. cryaerophilus A. skirrowii A. skirrowii Arcobacter Arcobacter Arcobacter

CRY2 SKIR N.ski ARCO–U ARCO1 ARCO2

340–359 1466–1483 1424–1443 1865–1846 1580–1599b 1887–1868

AACAACCTACGTCCTTCGAC AGGTCACGGATGGAAGT CGAGGTCACGGATGGAAGTG TTCGCTTGCGCTGACATCAT GTCGTGCCAAGAAAAGCCA TTCGCTTGCGCTGACAT

Houf et al. 2000 Bastyns et al. 1995 Kabeya et al. 2003a Kabeya et al. 2003a Bastyns et al. 1995 Bastyns et al. 1995

R01 R02 R03 R04 R05

318 1249 546 11 1185

GGAACTGAGACACGGTCCAG CGTCACCGTATTGCTGCTCT TAAAGAGCGTGTAGGCGGAT TGATCCTGGCTCAGAGTGAA TGACGTCATCCTCACCTTCC

Suarez Suarez Suarez Suarez Suarez

1R 2 1267

ERICc ERIC Arbitary primer

ATGTAAGCTCCTGGGGATTCAC AAGTAAGTGACTGGGGTGAGCG GAGCGGCCAAAGGGAGCAGAC

Vandamme et al. 1993 Vandamme et al. 1993 Vandamme et al. 1993

Nested PCR probes Arcobacter Arcobacter Arcobacter Arcobacter Arcobacter

et et et et et

al. al. al. al. al.

1997 1997 1997 1997 1997

PCR fingerprinting

c

Nucleotide position based on the A. butzleri 16S rRNA gene. Nucleotide position is based on the E. coli 23S rRNA sequence homologous to the 5’ and 3’-termini of the primers. Enterobacterial repetitive intergenic consensus

Arcobacter

a b

193

194

Emerging foodborne pathogens

the two species associated with human illness and therefore may be useful in clinical studies (Wesley et al. 1995; de Oliveria et al. 1999). Marshall et al. (1999) described a one-day PCR-RFLP procedure for campylobacter related organisms (Table 8.2). The method used one set of primers to cover 26 species. These were designed to amplify a 1004 bp fragment within the 16S rRNA gene. Twenty-seven Arcobacter strains as well as 131 other Campylobacter and Helicobacter isolates were screened. The resultant PCR product after restriction with Taq1 yielded Arcobacter species-specific patterns. Hurtado and Owen (1997) used the Helicobacter primers LS1 and LS2 to amplify an internal region of the 23S rRNA gene of the four Arcobacter species, followed by digestion with HaeIII, CfoI, HpaII and HinfI. A. cryaerophilus and A. skirrowii had identical DNA patterns whereas A. butzleri and A. nitrofigilis had unique species-specific pattern combinations. 16S and 23S rRNA specific gene probes 16S rRNA analysis of Arcobacter has identified target sequences for the construction of cDNA probes for the unequivocal identification of these bacteria. Wesley and co-workers (1995) have designed Arcobacter genus and species-specific 16S and 23S rRNA probes (Table 8.2). Harmon and Wesley (1996) developed a further PCR-16S rRNA assay for the identification of A. butzleri, A. skirrowii and A. cryaerophilius (Table 8.2). Results were obtained in less than 8 h as compared with the several days currently required for phenotypic methods. Bastyns et al. (1995) developed a genus-specific PCR assay for Arcobacter strains using the variable regions of 23S rRNA. The 23S rRNA region was targeted rather than the 16S rRNA because 23S rRNA genes offer potentially greater discrimination than 16S rRNA genes since they are larger and contain more variable residues. After comparison of ten Arcobacter and 26 Campylobacter sequences in the alignment, genus-specific and species-specific probes were designed. Hurtado and Owen (1997) also developed a molecular scheme for the rapid identification of Campylobacter and Arcobacter species based on 23S rRNA gene-based PCR-RFLP restricted using HaeIII, HpaII, CfoI and Hinf I. A. cryaerophilus and A. skirrowii gave identical patterns whereas A. butzleri and A. nitrofigilis had unique species-specific banding profiles. A multiplex PCR assay was used by Harmon and Wesley (1997) to identify Arcobacter isolates, in particular A. butzleri (Table 8.2). The assay used two primer sets, the first to amplify a section of the 16S rRNA gene (Arco I and II), and the second set (ARCO2 and BUTZ) targeted a portion of the 23S rRNA genes that is specific to A. butzleri. Suarez et al. (1997) designed oligonucleotide primers for the rRNA superfamily VI using a nested PCR test (Table 8.2). R01 and R05 were general arcobacter probes whereas the R02, R04 and R03 primers were designed to be more specific. The primers were used in nested PCR reactions;

Arcobacter

195

R02 and R04 in the first step which amplified the region from 11 to 1249, R01 and R05 in the second step. R03 which hybridised with sequences from position 546 to 565 was used to confirm the PCR product of R02 and R04. Under high stringency conditions the probe only hybridised with A. butzleri. Multiplex PCR to detect both C. jejuni and A. butzleri in food products was proposed by Winters and Slavik (2000). A 159 bp product was generated in the presence of C. jejuni, whereas A. butzleri produced a 1223 bp product. Another multiplex PCR assay for the simultaneous detection of A. butzleri, A. cryaerophilus and A. skirrowii used both 16S and 23S primers (Table 8.2). The PCR products were 401 bp, 257 bp, and 641 bp products respectively. An Arcobacter species-specific one-step PCR assay was developed by Kabeya et al. (2003a) (Table 8.2). The primers which amplified a variable region of the 23S rRNA gene were designed for A. butzleri, A. cryaerophilus 1A and 1B and A. skirrowii and were different from those used by Houf et al. (2000). Whereas Houf et al. (2000) applied their multiplex PCR assay to enriched broths, the study by Kabeya was limited to the reference strains for each species and ten isolates; 3 A. butzleri, 3 A. skirrowi, 1 A. cryaerophilus 1A and 3A, A. cryaerophilus 1B. Nevertheless, the differentiation of A. cryaerophilus 1A and 1B had only previously been achievable using DNADNA hybridisation studies (Kiehlbauch et al. 1991b). Enterobacterial repetitive intergenic consensus (ERIC)-PCR and randomly amplified polymorphic DNA (RAPD)-PCR (Lior and Wang 1993) ERIC-PCR 1R and 2 primers designed by Versalovic et al. (1991) were used by Vandamme et al. (1993) as part of the epidemiological study of the A. butzleri strains associate with a nursery and primary school outbreak. DNA fingerprinting is more discriminatory than biotyping or serology and hence more applicable for epidemiological studies. ERIC-PCR is considered simpler for a laboratory to use than ribotyping. Arbitrary developed primers can be used to amplify random DNA products under low-stringency PCR conditions. Typically randomly designed 10-mer primers are used under conditions that allow some mismatches to increase the number of primed sites. PCR products are produced when primer sites are situated within the amplified distance (less than 5 kb) and with the correct opposite orientation. Houf et al. (2002a) optimised both RAPD and ERIC-PCR methods for the characterisation of A. butzleri, A. cryaerophilus and A. skirrowii. The profiles were composed of 2 to 9 fragments (300 to 2072 bp range) of different intensities. Although both methods had good discriminatory power, the profiles generated by ERIC-PCR were more reproducible and complex. Analysis of 228 isolates from broiler carcasses showed that poultry products may have not only more than one Arcobacter species but also multiple genotypes. Houf et al. (2003) extended their study to 1079 isolates from a poultry slaughterhouse. These were delinated into 159 A. butzleri and 139 A. cryaerophilus types. Atabay et al. (2002a) also used RAPD to show that chicken carcasses may be contaminated with different

196

Emerging foodborne pathogens

strains of A. butzleri. Eleven profiles were obtained in total for 35 strains. Pulse field gel electrophoresis (PFGE) PFGE is considered one of the most discriminatory molecular fingerprinting tools. It uses low frequency cutting endonucleases to generate DNA fragments (20–200 kb) that are separated by using pulses of voltage from different directions and durations. This enables larger DNA molecules than normal to be resolved. In order to avoid shearing the chromosomal DNA, the bacterial cells are immobilised in agarose prior to lysis. Isolates with less than three bands different are generally regarded as identical strains. PFGE using SacII, EagI and SmaI restriction endonucleases can be used for genoyping strains of Arcobacter (Rivas et al. 2004). Hume et al. (2001) reported the use of PFGE to show that pigs were colonised by multiple Arcobacter parent genotypes that may have undergone genomic rearrangement. They used the restriction endonucleases EagI and SacII. Similarly SmaI has been extensively used for subtyping and genomic mapping of the phenotypically similar Campylobacter spp. (Chang and Taylor 1990). Using meat isolates, Rivas et al. (2004) reported that EagI produced fewer clusters than SmaI and SacII indicating a lower discriminatory potential. The genotypic diversity of Arcobacter isolates from individual pig farms demonstrates the potential use of PFGE for epidemiological purposes during outbreaks (Hume et al. 2001). It should be noted, however, that PFGE profiles are susceptible to genomic events such as recombination and rearrangement, as well as prophage insertion and deletion. These make the interpretation of PFGE profiles difficult (Hume et al. 2001). Additionally some Arcobacter strains possess nuclease activity and so no PFGE profile is obtained. Amplified fragment length polymorphism (AFLP) AFLP has been proposed as a stable, reproducible, discriminatory and relatively rapid genotyping method that is superior to PFGE (On et al. 2001, 2004). The method involves PCR amplification and selective detection of fragments between neighbouring frequently distributed restriction sites in the target organism (Savelkoul et al. 1999; On and Harrington 2000). A comparison of modified (m)-PCR (Houf et al. 2000) and AFLP-profiling for speciation of Arcobacter spp. by these researchers (Scullion et al. 2001) resulted in a good correlation between the two methods although three A. skirrowii isolates tested gave atypical AFLP profiles, whereas a PCR method (Harmon and Wesley 1996) confirmed them as Arcobacter species. On et al. (2003) applied AFLP analysis to 72 isolates of A. butzleri, A. cryaerophilus, A. skirrowii, A. nitrofigilis and a previously unclassified porcine abortion strain. For strain typing, 62 distinct types were defined, with evidence of clonal linkages within A. butzleri, A. cryaerophilus and A. skirrowii. Cluster analysis revealed five phenons at the 29% similarity level, four of which represented each of the four recognised species. The remaining phenon was further characterised using phenotypic and 16S rDNA sequence analysis and

Arcobacter

197

shown to represent a novel Arcobacter species (Fig 8.1). The two subgroups of A. cryaerophilus were distinguishable at the 39.5% similarity level. The study also showed that A. cryaerophilus subgroup 1 was less common than subgroup 2. Strains of A. skirrowii were distributed across two phenons. One contained the type strain and nine poultry, duck and pig abortion strains. It was proposed that this represented A. skirrowii sensu strictu. The other cluster had one duck isolate and five pig abortion strains. One of these had previously been proposed to be a novel Arcobacter species (On et al. 2002). Further analysis using phenotype and 16S rDNA sequencing confirmed the distinctness of this cluster. A formal description of a new species was deferred until ten isolates had been identified (Ursing et al. 1994).

8.4

Methods of detection using growth media

8.4.1 General principles Standardised methods do not exist for the isolation of Arcobacter species, nevertheless common procedures have developed. Many methods are based on those for the related Campylobacter spp. (Corry et al. 2003). The major difference between arcobacters and campylobacters is the former’s tolerance to oxygen and ability to grow at lower temperatures. Selective media for campylobacters may not be suitable for primary isolation as arcobacters are sensitive to the concentrations of colistin, polymyxin B and rifampin used. Nevertheless, the selective agents are similar to those used for Campylobacter isolation, with the addition of 5-fluorouracil (Table 8.3). In order to avoid the growth of Campylobacter the incubation temperature can be dropped to 30 ∞C or less with aerobic incubation. As with campylobacters, a range of selective and oxygen quenching agents have been used, although the protective agents such as blood, FBP or charcoal may be omitted when using aerobic incubation to reduce the isolation of campylobacters. A range of key Arcobacter media is summarised in Table 8.3 and further details are given below. Another means of selecting the organism is the passive filtration technique whereby the organism swims through a 0.45 or 0.65 mm filter onto the surface of non-selective medium (Steele and McDermott 1984; Lammerding et al. 1996). Some species of Arcobacter grow poorly on blood agar (Vandamme et al. 1992b) and most are difficult to grow in high densities in liquid culture systems. To overcome these limitations Dickson et al. (1996) developed a biphasic culture method.

8.4.2 Arcobacter isolation media Johnson and Murano (1999a, b) developed an enrichment broth and agar medium containing cefoperazone, bile salts and thioglycollate, sheep’s blood and sodium pyruvate (0.05%) and used an aerobic atmosphere to eliminate growth of Campylobacter species. Arcobacter butzleri, A. cryaerophilus and

Table 8.3 Selective agents and oxygen quenching agents used in media for the isolation of Arcobacter spp. (concentrations in mg per litre). Reproduced with permission from Corry et al. (2003)

198

Mediuma(incubation temp. and atmosphere)

Emerging foodborne pathogens

Ellis et al. (1977) EMJH P80 - Broth (30 ∞C A) Lammerding et al. (1996) (30 ∞C MA) Collins et al. (1996a) CVA-Agar (30 ∞C MA) Collins et al. (1996a) mCIN -Agar (30 ∞C MA) De Boer et al. (1996) – ASM agar and broth (24 ∞C A) Atabay and Corry (1997) CAT Broth (30 and 37 ∞C MA) Corry and Atabay (1997) mCCDA (30 and 37 ∞C MA) Atabay and Corry (1998) Oxoid Broth (25 ∞C A) Johnson and Murano (1999a) – Agar (30 ∞C A) Johnson and Murano (1999b) – Broth (30 ∞C A) Marinescu et al. (1996b) broth (25 ∞C A) Marinescu et al. (1996b) Karmali agar (25 ∞C MA) Houf et al. (2001a) Oxoid Arcobacter broth/agar (28 ∞C MA)

Oxygen quenching agents

Cephalosporins

Trimethoprim

Colistin

5-fluorouracil

Other

Vancomycin or Teicoplanin

Antifungals

10 V

5 AM

100 32 czone 10% sheep blood

20 cthin 200

5% horse blood (broth only) haemin 5% laked horse blood charcoal, 0.25% F, 0.25% P

32 czone

20

75 PIP

8 czone

4T

32 czone 1% BS

4T

10 AM

32 czone 32 czone

200

7.5 4% charcoal, haematin

10 AM 10 AM

8 czone 5% sheep blood; 0.5% P; 0.05% TG 0.5% P; 0.05% TG; 3% C

100 CY

5000 iu

0.25%BS

100

1000 AM

32 czone 16 czone

20V 64

100

32N

10AM

czone, cefoperazone; cthin, cephalotin; V, vancomycin; T, teicoplanin; AM, amphotericin B; CY, cycloheximide; PIP, piperacillin; BS, bile salts; N, novobiocin; P, pyruvate; C, charcoal; A aerobic; MA microaerobic.

Arcobacter

199

A. nitrofigilis produce red colonies on the medium, but A. skirrowii was not tested. The authors claimed their medium was better than that of De Boer et al. (1996). Modified charcoal cefoperazone deoxycholate (mCCDA) is commercially available for the isolation of Arcobacter spp. The media can be made specific for A. butzleri by supplementing the basal medium of mCCDA with cefoperazone, amphotericin B and teicoplanin (CAT). The medium suppress the growth of Campylobacter spp. by the absence of the oxygen-scavenging components ferrous sulphate, sodium metabisulfite and pyruvate (FBP). Atabay et al. (1996) tested the suitability of Karmali medium, modified CCD agar, semi-solid blood-free selectivity-motility (SSM) medium and cefoperazone-amphotericin B-teicoplanin (CAT) medium to grow Arcobacter and Campylobacter. Two strains of A. butzleri grew well only on Karmali medium and SSM. A. skirrowi grew poorly on all the selective media, while A. cryaerophilus did not grow on or in any selective medium. Atabay and Corry (1998) described the Arcobacter enrichment broth which incorporated the CAT selective supplement. The broth was better than Preston broth and Bolton enrichment broth (both designed for Campylobacter species) for the recovery of A. butzleri, A. cryaerophilus and A. skirrowii although A. nitrofigilis grows poorly. Houf et al. (2001a) showed that Arcobacter species were all susceptible to colistin (MIC<4 mg/L) and rifampicin. Some A. cryaerophilus and A. skirrowii strains were susceptible to 32 mg/L cefoperazone. Consequently they proposed that media with CAT supplement and EMJH P80 with 5-fluorouracil were sufficient to isolate the three Arcobacter species, although some competitors would also be able to grow. A subsequent paper by Houf et al. (2001b) described a further selective broth and agar medium which used the previous four antibiotics, plus amphotericin B. Liu et al. (1995) showed that Oxyrase encouraged the growth of arcobacters in a nonselective broth aerobically at 37 ∞C, but not at 30 ∞C. The work by Houf and colleagues on A. cibarius highlights the need to recognise that the four currently recognised members of the Arcobacter species may only be the species which are more easily isolated. Corry et al. (2003) stated that it was important to use prolonged incubation periods, up to seven days, to recover A. cryaerophilus and A. skirrowii. Therefore the generally reported low isolation rate may be an artefact. Hence A. cibarius may not be the only new species of Arcobacter to be isolated from the food chain; for example, the ‘A. skirrowi-like’ species of On et al. (2003).

8.4.3 Isolation from animal sources A summary of reports isolating Arcobacter species from animal sources is given in Table 8.4. Initially Arcobacter were isolated from aborted bovine foetuses using protocols originally designed for Leptospira (Ellis et al. 1977; Neill et al. 1985). This approach has been used to isolate Arcobacter from aborted foetuses (Wesley et al. 1995), ground pork (Collins et al. 1996a, b)

200

Emerging foodborne pathogens

Table 8.4 Incidence of Arcobacter in animals and animal products Source

%

n

Site

Reference

Pigs

51 40.4 45.7 43 16–42 59–85 24.3 43 47 23/55 22 0–89.9 0.5 3.7 32 7 1.5 2.2 4.9

86 952 1102 82

Stomach Faeces Faeces Faeces Faeces, porkers Faeces, sows Preputial fluid, boars Aborted fetus Aborted fetus Aborted fetus Slaughterhouse fetus Ground pork Ground pork Ground pork Ground pork Pork Minced beef Beef Minced mixed pork/beef Meat Faeces Faeces Faeces Faeces Faeces Faeces Chicken carcasses Chicken carcasses Chicken carcasses Chicken Chicken neck skin Chicken caeca Chicken cloaca Turkey meat

Suarez et al. 1997 Harmon and Wesley 1996 Harmon and Wesley 1997 Van Driessche et al. 2003 Van Driessche et al. 2004 Van Driessche et al. 2004 De Oliveira et al. 1999 Schroeder-Tucker et al. 1996 Wesley 1997 On et al. 2002 Wesley 1997 Collins et al. 1996a De Boer et al. 1996 Zanetti et al. 1996a Ohlendorf and Murano 2002a Kabeya et al. 2003a, b De Boer et al. 1996 Kabeya et al. 2003a, b De Boer et al. 1996

Cows

Sheep Horses Poultry

Ducks

Monkeys Water

74 30 400 214 299 194 27 200 100 68 90

5 97 10.52 1236 71 31 39.2 51 9.5 200 16.1 62 15.4 13 84 50 96.8 125 100 25 100 23 90 71 0 25 15 407 24.1 220 97 125 77 395 0 57 50 10 52 170 25 4 0 170 14(1) 268 100

10(4)2

Eggs Carcasses Carcasses Caeca Caeca Faeces

Öngör et al. 2004 Harmon and Wesley 1997 Wesley et al. 2000 Van Driessche et al. 2003, 2005 Öngör et al. 2004 Van Driessche et al. 2003 Van Driessche et al. 2003 Johnson and Murano 1999a Lammerding et al. 1994 Atabay and Corry 1998 Kabeya et al. 2003a, b Houf et al. 2001a Atabay and Corry 1998 Wesley and Baetz 1999 De Boer et al. 1996 Lammerding et al. 1996 Manke et al. 1998 Zanetti et al. 1996 Ridsdale et al. 1998, 1999 Harrass et al. 1998 Ridsdale et al. 1998, 1999 Harrass et al. 1998 Anderson et al. 1993, Higgins et al. 1999 Moreno et al. 2003

1 Only tested for A. butzleri 2 All samples were positive using FISH, whereas Arcobacter was only isolated from four samples.

Arcobacter

201

and experimentally infected piglets (Wesley et al. 1996). Suarez et al. (1997) examined the nonglandular region of 71 pig stomachs for Arcobacter. Isolates from nursing sows and developing pigs on three farms of a farrow-to-finish swine operation were identified by PCR and their genotypic fragment patterns examined by PFGE (Hume et al. 2001). The level of genotypic variation revealed that the pigs were colonised by multiple Arcobacter parent genotypes that may have undergone some genomic rearrangement, common to members of Campylobacteraceae, during successive passages through the animals. Additionally, the level of genotypic diversity seen among Arcobacter isolates from individual farms suggested an important tool for source identification and as a monitoring tool during outbreaks.

8.4.4 Isolation from poultry and ducks Table 8.4 summarises the incidence of Arcobacter species from poultry and ducks. Lammerding et al. (1994, 1996) and Marinescu et al. (1996b) have developed methods for the isolation of A. butzleri from poultry carcasses. Gude et al. (2005) have shown that poultry carcasses are contaminated during processing and Arcobacter spp. were not found in poultry searing sheds. Atabay and Corry (1997) compared the Lammerding enrichment broth with CAT broth which is comprised of campylobacter enrichment basal medium, 5% laked horse blood and CAT (cefoperazone, amphotericin B and teicoplanin) selective supplement. After enrichment samples were transferred to the surface of CAT, mCCDA and blood agar plates using both the Steele and McDermott and Lammerding filtration membrane techniques. A. butzleri, A. cryaerophilus and A. skirrowii were isolated, although A. skirrowii was only isolated on blood agar. Corry and Atabay (1997) compared CAT agar and mCCDA for the growth of various Arcobacter strains and found that CAT agar performed better. Further work by Atabay et al. (2001) found that seven A. skirrowii strains from ducks did not grow on either CAT agar or mCCDA. Atabay et al. (2002b) studied the prevalence of Arcobacter species on chicken carcasses sold in retail markets in Turkey. The isolation method involved membrane filtration onto blood agar, an Arcobacter enrichment broth, followed by species identification using a SDS-PAGE profiling of whole-cell proteins and a multiplex-PCR assay (401 bp fragment generated). A. butzleri was the only species isolated, and it was found more frequently (42/44) of fresh chicken samples compared with 7/31 frozen carcasses. A. butzleri and A. cryaerophilus were present at levels of 101 to 104 cfu/g neck skin samples (Table 8.4; Festy et al. 1993; Antolin et al. 2001; Houf et al. 2001a, 2003). Isolation of Arcobacter species from duck carcasses has been described by Ridsdale et al. (1998). Carcass rinsates were enriched in campylobacter enrichment broth basal medium with CAT supplement at 37 ∞C for three days under microaerophilic conditions as well as being directly streaked on CAT agar. Presumptive colonies which tested Gram-negative, oxidase-positive,

202

Emerging foodborne pathogens

curved, rod-shaped bacteria were plated out onto blood agar. Identification of Arcobacter was achieved by API Campy tests, Bolton biotyping scheme and probabilistic identification scheme.

8.4.5 Isolation from various food sources Arcobacter species have been isolated from a range of food sources (Table 8.4) using a range of methods, some of which may favour certain species more than others. Zanetti et al. (1996) used the same technique used for the isolation of Campylobacter to isolate Arcobacter from a range of foods (pork, chicken, turkey, pork sausage and eggs). No substantial difference was seen between the three media although CCDA medium gave better results than Butzler and Preston media. Surprisingly, the variable that had the most influence was the incubation temperature with a greater number of strains being isolated at 42 ∞C rather than 37 ∞C. De Boer et al. (1996) developed the Arcobacter selective enrichment broth (ASB) and a semisolid Arcobacter selective plating medium (ASM) to isolate Arcobacter species from meats under aerobic conditions. These media contain cefoperazone, piperacillin, trimethoprim and cycloheximide as the selective agents. After incubation the plates were examined for the presence of swarming on the semisolid medium. For confirmation, some material from the outer edge of the zone was streaked on a sheep’s blood agar plate to obtain single colonies which were subjected to confirmatory tests (Table 8.1). Only isolated A. butzleri and A. butzleri-like organisms were isolated using these media. A comparative study of the De Boer et al. (1996) and Johnson-Murano methods isolated Arcobacter spp. from 14/50 and 42/50 chicken samples respectively (Table 8.4). The Johnson-Murano method also requires less time to obtain the result; four days with PCR confirmation, compared with six to nine days. Rivas et al. (2004) surveyed the presence of Arcobacter in ground chicken, pork, beef and lamb meats. Samples were enriched in Arcobacter broth (AB) containing the CAT selective supplements, followed by screening for arcobacters using a multiplex PCR method prior to plating onto blood agar with incubation at 30 ∞C aerobically for 24 hours. If the sample had a large amount of non-target flora then enrichments were diluted and spread plated onto Arcobacter agar containing CAT supplement or BA. As per Atabay et al. (2002b), A. butzleri was the only Arcobacter species isolated from samples. The frequency of isolation was poultry 73%, ground meat 35%, pork 22% and lamb 15% (Table 8.4). There was no difference in the isolation rate and sampling site. A number of isolates had indistinguishable PFGE profiles which indicated cross-contamination between different meat species. As shown by many other studies, Rivas et al. (2004) confirmed that A. butzleri is more frequently isolated from poultry than other meats (Table 8.4). However Arcobacter species are infrequently isolated from caecal samples, indicating that poultry carcass contamination is mainly after slaughter. Collins et al. (1996a) showed the effectiveness of using antibiotic selection

Arcobacter

203

for the isolation of Arcobacter from pork using the EMJH P-80 as an enrichment medium along with two selective plating media. Characteristic Arcobacter colonies from CVA, mCIN and BHI agars were streaked onto BHI agar supplemented with 10% defibrinated bovine blood for isolation and identification with DNA probes. Unfortunately, isolates were not identified to the species level. Ohlendorf and Murano (2002a) compared three methods for the isolation of A. butzleri and A. cryaerophilus from spiked samples of raw ground pork. The Johnson-Murano (JM) method was reported to be more sensitive than that of de Boer et al. (1996) and Collins et al. (1996a). The JM method was able to detect A. butzleri at 10 cfu/g in all samples, and A. cryerophilus 1A at the same level in 75% of samples.

8.4.6 Isolation from water Water could be a vector of Arcobacter transmission to animals and humans (Table 8.4). Rice et al. (1999) examined the incidence of Arcobacter in contaminated well water. Plates were examined for typical white or grey round colonies. Target colonies were re-streaked for purification on blood agar and verified using DNA probes (Harmon and Wesley 1996; Zanetti et al. 1996a). A. butzleri and A. cryaerophilus have been isolated from a drinking water reservoir in Germany (Jacob et al. 1998), canal water in Thailand (Dhamabutra et al. 1992), river water in Italy (Musmanno et al. 1997), ground water sources and sewage (Stampi et al. 1993) and mussels (Maugeri et al. 2000). DNA probes based on 16S and 23 rRNA sequences have been used for the detection of Arcobacter in river and wastewater samples using PCR and fluorescent in situ hybridisation (FISH) techniques (Moreno et al. 2003, 2004). The attachment of A. butzleri to pipes in the water distribution system was studied by Assanta et al. (2002). The organism attached to stainless steel, copper and plastic after exposures as short as one hour. This growth could then act as a loci for the organism’s persistence in water.

8.5

Human and animal infections

8.5.1 Animal infections (Logan et al. 1982; Neill et al. 1980) Arcobacter organisms were first isolated from aborted bovine and porcine foetuses as well as from control placentas by Ellis and others in the 1970s (Wesley et al. 1995). Since then Arcobacter spp. have been isolated from uterine and oviduct tissues and from placenta samples of sows with reproductive problems (Van Driessche et al. 2004). Aerotolerant campylobacter-like organisms have been isolated from aborted and normal porcine foetuses, sows with reproductive problems and from clinically healthy specific pathogenfree pigs (Neill et al. 1979; Cardarelli-Leite et al. 1996; De Oliveira et al.

204

Emerging foodborne pathogens

1997; Suarez et al. 1997). In boars, arcobacters have been recovered from preputial swabs, but not from semen (De Oliveira et al. 1999). It has been detected in organs of porcine aborted foetuses and stillborn piglets (On et al. 2002) and in the stomachs of pigs with gastric ulcers (Suarez et al. 1997). Because of the antigenic similarity of Arcobacter isolates from reproductively impaired and normal sows it has been proposed that arcobacters were opportunistic pathogens which colonised the foetus after placental damage (De Oliveira et al. 1997). However, Arcobacter species have also been isolated from faeces of clinically healthy porkers (Kabeya et al. 2003b, c; Van Driessche et al. 2003). A. cryaerophilus is also pathogenic to rainbow trout (Aydin et al. 2002).

8.5.2 Human infections In recent years A. butzleri and A. cryaerophilus have been isolated from the faeces of patients with diarrhoea or recurrent abdominal pain in USA, Canada, Australia, South Africa, Thailand, Italy, France, and Germany (Table 8.5). A. butzleri and A. cryaerophilus have been isolated from patients with severe diarrhoea (Tee et al. 1988; Lerner et al. 1994; Marinescu et al. 1996a; Taylor and Parsonnet 1995) and from blood (Hsueh et al. 1997; On et al. 1995; Yan et al. 2000). However, A. skirrowii, which is more haemolytic than A. butzleri and has been isolated from chicken carcasses, may be overlooked due to its slow growth (Atabay et al. 1998). Little is known on the epidemiology of Arcobacter species other than they are pathogenic to various animals and are found in the food chain. It is probable that A. butzleri and even A. cryaerophilus are human pathogens since they have been cultured from humans with enteritis who were otherwise healthy and from patients suffering from diarrhoea with chronic underlying disease. There is no data on infectious dose. The occurrence of arcobacterrelated diseases may be underestimated due to the lack of surveillance and optimised detection procedures. This is reminiscent of C. jejuni and L. monocytogenes 4b which were initially recognised veterinary pathogens. Examination of human and veterinary clinical specimens for the presence of Arcobacter species is rarely performed, and in most cases suboptimal procedures are used (Houf et al. 2001b). As Marshall et al. (1999) reported, arcobacters may not be detected in humans due to the selective nature of routine campylobacter media. Hence there is a need to validate the method of arcobacter detection to facilitate epidemiological studies and establish the significance of Arcobacter species as human pathogens. In addition, little is known about the risk factors for human infection. The most extensive study to date on this matter is being conducted by Vandenberg et al. (1999, 2003, 2005; Table 8.5). A. butzleri is the Arcobacter species most commonly reported as a human pathogen (Table 8.5; Kiehlbauch et al. 1991a, b). An aerotolerant Campylobacter, possibly A. butzleri, was recovered from 2.4% of Thai children

Table 8.5

Incidence of Arcobacter in humans

Source Faeces Thai children, faeces Faeces

Faeces

Number

Age

Sex

Symptoms

Species

Reference

2.4

1 631 22

35 y 1–2 y <1–74 y

Male NG 10 f :12 m

Ac Ab Ab

Tee et al. 1988 Taylor et al. 1991 Kiehlbauch et al. 1991b

10/65

65

3–7 y

6 f :4 m

Ab

Vandamme et al. 1992a

1 15 2 1 2 21,527

2y

Female

D (4–6 mths) Mild D N (55%) V (27%) D (51%) (>1 mths) B (9%), M (5/22) C (10/10) V (30%) F (10%) D (0%) Dw

Ab

48 y, 52 y <1 d 19 m, 3 y 6 m, 3, 18, 64–69 y

Male:female Male Male:Female 5 f; 3 m

Dw : F, D Bac D D (8/8) C (3/8) V&N (2/8)

Ab Ab Ab Ab

Burnens et al. 1992 Stampi et al. 1993 Lerner et al. 1994 On et al. 1995 Marinescu et al. 1996a Lauwers et al. 1996

100

<0.1

Arcobacter

Faeces Sewage Faeces NG Faeces Faeces

%

205

206

Continued

Source

%

Number

Age

Sex

Symptoms

Species

Reference

Blood Sewage Faeces

1 88 4250

72 y

Female

Bac

Ac1B

22.7 5/4250

57–90 y

Female

D (5/5) C (1/5) N (2/5)

Ab

Hsueh et al. 1997 Stampi et al. 1999 Pers et al. 1999

761 1376 1 53533

NG 60 y NG

NG Male NG

Ab Ab,Ac Ab Ab 44, Ac 7, A 2

Tompkins et al. 1999 Engberg et al. 2000 Yan et al. 2000 Vandenberg et al. 2003, 2005

1 1 1

72 y 7y 69 y

Male Male Female

NG Bac D (41/01) V (17/61) C (18/61) D

As

Wybo et al. 2003, 2004 Woo et al. 2001 Lau et al. 2002

Faeces Faeces Blood Faeces

Faeces Blood Blood

(1/761) 0.15 0.4

Ab = A. butzleri Ac = A. cryaerophilus As = A. skirowii A = Arcobacter unspeciated B = blood in stools Bac = Bacteraemia C = abdominal cramp/pain

Bac

D(w) = diarrhoea (watery) M = mucus in stools N = nausea NG = Not given V = vomiting

Ab

Emerging foodborne pathogens

Table 8.5

Arcobacter

207

during a survey of paediatric gastro-enteritis (Taylor et al. 1991). More than 50% of 22 patients with A. butzleri associated diarrhoea suffered from abdominal pain and nausea; fever, chills and vomiting, and malaise were other frequently reported features (Kiehlbauch et al. 1991b). A. butzleri was isolated from a two-year-old girl with gastro-enteritis (Burnens et al. 1992). In the outbreak of recurrent abdominal cramps (no diarrhoea or fever) at a nursery and primary school in the Rovigo area of Italy, A. butzleri was isolated from faecal samples (Pugina et al. 1991; Vandamme et al. 1992a). PCR-mediated DNA fingerprinting demonstrated that 14 A. butzleri isolates were the same strain and were distinguishable from other A. butzleri strains (Vandamme et al. 1993). A. butzleri was isolated from stool specimens of two hospitalised patients with persistent diarrhoea and severe abdominal cramps (Lerner et al. 1994) and from a neonate with bacteraemia (On et al. 1995). It was sporadically isolated from the faeces of eight patients (Lauwers et al. 1996). Five patients presented diarrhoea, three of whom also had abdominal cramps and two patients were obviously healthy carriers. A. butzleri and A. butzleri-like organisms were isolated from persistent diarrhoea (Marinescu et al. 1996a). A. butzleri has been cultured from human cases of enteritis, in otherwise healthy patients and patients with chronic underlying disease (Dediste et al 1998). A. butzleri was isolated from 22 patients with severe diarrhoea (Wesley 1996). Yan et al. (2000) reported a rare case of invasive A. butzleri infection in a 60-year-old man with liver cirrhosis. The patient had a high fever (39.5 ∞C) and esophageal variceal bleeding. Aerobic blood culture bottles had weak Gram-negative curved rods after two days incubation, and no growth was observed with anaerobic culturing. Subsequently 16S rRNA gene sequencing was applied and the organism was identified as A. butzleri. The fever ceased after parenteral administration of cefuroxime, even though the strain was resistant to cephalosporins on the basis of the MIC determined with the E test. A. cryaerophilus (then C. cryaerophila) was recovered from a single stool specimen of a patient suffering from intermittent diarrhoea for 4–6 months (Wesley 1996). A. cryaerophilus group 1B was also isolated from the blood of a uremic patient with haematogenous pneumonia (Hsueh et al. 1997). A. skirrowii was isolated from a stool sample of a patient with chronic diarrhoea by Wybo et al. (2004). The isolate was identified using phenotyping, multiplex-PCR (Houf et al. 2000) and whole-cell protein profile (Vandamme et al., 1992b). The patient was a 72-year-old man with no association with farm animals or pets and the source was not determined. This was the first isolation of A. skirrowii from a human stool sample. The authors comment that, given their previous experience with this and related organisms, if A. skirrowii is pathogenic then its role in human disease is limited. As well as humans, other primates also suffer from Arcobacter infections. Fifteen A. butzleri isolates were obtained from 14 macaque monkeys, three of which showed mild to moderately severe chronic, active colitis. A. butzleri

208

Emerging foodborne pathogens

was not isolated from normal faeces. Ribotyping of the isolates revealed nine different strains and indicated that A.butzleri was endemic in the primate population (Anderson et al. 1993).

8.5.3 Pathogenicity factors There is very little information on toxin production by arcobacters. Figura et al. (1993) and Musmanno et al. (1997) demonstrated the presence of cytotoxins and cytolethal distending factors in 18 river water isolates. Adherence to Intestine 407, Vero and CHO cell lines was observed, but no invasion. In contrast Fernandez et al. (1995a) using HEp-2 cell culture and rat ileal loop assay proposed that invasion was a pathogenicity mechanism. Wesley et al. (1995, 1996) reported that A. butzleri colonised the neonate piglet intestines and hence suggests an invasive potential. A 20kDa haemaglutinin has been characterised from arcobacters. It was sensitive to proteolytic digestion and 80 ∞C. It is possibly a lectin-like molecule binding to erythrocytes via a glycan receptor containing D-galactose as part of its structure (Tsang et al. 1996). Six out of 17 non-clinical strains of A. butzleri were shown to adhere and induce cytotoxicity in cultured epithelial cells (HEp-2 and HeLa) (Carbone et al. 2003). Of the six adherent strains, five secreted a cytotoxin(s) which caused morphological changes (cell rounding) of a Vero cell line. This limited study confirms previous work by Musmanno et al. (1997) on cytotoxin production by A. butzleri, but does not further characterise the toxin with respect to molecular weight, susceptibility of mammalian cell lines or cellular location of cytotoxin. Johnson and Murano (2002) showed that arcobacter cell extracts showed cytoxicity (cell rounding) towards HeLa and INT407 mammalian cell lines. They were unable to detect a cytolethal distending toxin (as found in C. jejuni) using DNA probes to the cdtA and cdtB subunits of C. jejuni as described by Pickett et al. (1994, 1996).

8.5.4 Sources of infection The route of transmission from animals to humans is unknown as there have been no epidemiological studies to date. The timing of cases in the 1983 nursery-school outbreak of recurrent abdominal cramps supports a person-to-person transmission route of A. butzleri amongst a teacher and the children (Pugina et al. 1991). However, there is circumstantial evidence that it may be a water and meat (pork and poultry products) foodborne pathogen. The association of A. butzleri and A. cryaerophilus with enteritis in humans, and their recovery from chickens, turkeys, ducks and pigs indicated a possible association of Arcobacter spp. with pork and poultry products (Wesley 1996, 1997; de Boer et al. 1996; Houf et al. 2003; Van Driessche et al. 2003). Contamination of meat is assumed to occur from faeces during slaughter

Arcobacter

209

(Ohlendorf and Murano 2002a). There is a high rate of Arcobacter contamination of raw poultry products and the same biotypes and serotype 1 are distribution among human and poultry isolates (Lior and Woodward 1991, 1993, Marin et al. 1995 Marinescu et al. 1996b). Hence the handling of raw poultry, cross-contamination from raw poultry and consumption of undercooked poultry products may be routes of infection. A study by Wesley and Baetz (1999) indicated that natural infections of arcobacter occur in poultry and that the susceptibility of arcobacter to colonisation was dependent on the breed of the bird. Despite its distribution on poultry carcasses, Arcobacter species have been infrequently recovered from the caeca. This suggests that birds were probably not a natural reservoir for Arcobacter spp. and that extensive post-slaughter carcass contamination occurs (Wesley and Baetz 1999). Since Ellis and co-workers first isolated Arcobacter organisms from aborted bovine and porcine foetuses and control placentas in the 1970s, further studies have isolated the organism from other farm animals (bulls, cows and poultry) and humans with enteritis. The incidence of Arcobacter spp. in poultry and meat sources is given in Table 8.4. The incidence ranges from 0% in eggs (n = 57) to 100% in chicken carcasses. A. cryaerophilus and A. skirrowii were isolated from chicken carcasses (in addition to A. butzleri) for the first time by Atabay et al. (1998). Arcobacter, like C. jejuni, exists in the guts of healthy dairy cattle (Wesley et al. 2000). The prevalence and diversity of arcobacters in healthy Belgian porkers and sows on four farms, by faecal analysis has been studied by Van Driessche et al. (2004). The isolates were identified using m-PCR and a modified ERIC-PCR for genetic fingerprinting. In faeces, the prevalence of Arcobacter species ranged from 16 to 85%, with up to 104/g faeces in 55/294 pigs. A. butzleri was the most frequently isolated species with 322/478 positives, compared with 35/478 A. skirrowii and 121/478 A. cryaerophilus. More than one species was sometimes excreted. A large heterogeneity among the species was detected. There were 30 A. skirrowii, 70 A. cryaerophilus and 123 A. butzleri genotypes distinguished. No genotypes were detected on more than one farm. The large heterogeneity may be due to multiple colonisation or genomic rearrangements of parent genotypes. The prevalence of arcobacters ranged from 16–42% in porkers and from 59–85% in sows. This difference could have been either age related since the prevalence of arcobacters increases with the age of the animal, or seasonal since the porkers were sampled during the winter and the sows in June (Hume et al. 2001). Previous reports have shown that arcobacters are more frequently isolated from poultry meat and water during the spring and summer months (Manke et al. 1998; Stampi et al. 1999). As previously stated (Section 8.4.7), Arcobacter species have been isolated from various water sources. Hence drinking water is another possible route of transmission. Consumption or contact with potentially contaminated water was implicated as the probable cause of 63% of A. butzleri-associated illness

210

Emerging foodborne pathogens

(Kiehlbauch et al. 1991a). Arcobacter spp. may be more common in developing nations with inadequate water supplies, since A. butzleri accounted for 16% of the Campylobacter-like isolates made from cases of diarrhoea in Thai children (Taylor et al. 1991; Table 8.5). Of the 1,666 campylobacters received from the 367 canals of the Bangkok metropolitan area, 74 were identified as Arcobacter spp. (then C. cryaerophila) and 42 as C. cryaerophila-like organisms. Dhamabutra et al. (1992) isolated A. cryaerophilus (74/116 isolates) and A. cryaerophilus-like (42/116 isolates) from canal water samples in the Bangkok Metropolitan area. Also A. cryaerophilus and A. butzleri were found in the sewage with average values of 5639 and 188–959/100 ml respectively in incoming raw sewage and 4 and 7–13/100 ml respectively in outgoing disinfected effluent. Campylobacter-like organisms isolated from drinking water were identified by PCR as A. buzleri (Jacob et al. 1996). Arcobacter strains were isolated from river water samples in the area of Bologna, Italy (Musmanno et al. 1997). Jacob et al. (1998) isolated 147 Campylobacterlike strains from six drinking water treatment plants in a two-year investigation period. One hundred were typed as A. butzleri, 17 were A. butzleri-like and 24 were typed as Arcobacter spp. The remaining six were identified as Campylobacter jejuni/coli. Strains of Arcobacter isolated from drinking water treatment plants showed the same serotype as human isolates. Snaidr et al. (1997) found Arcobacter in 4% of activated sludge samples and Stampi et al. (1993) found that A. cryaerophilus was sensitive to pure oxygen treatment but showed some resistance to 2 ppm ClO2. However, Rice et al. (1999) reported that A. butzleri was sensitive to chlorine inactivation. A. butzleri showed a higher sensitivity to BrCl than other microorganisms, but similar resistance to 4 ppm ClO2 (Zanetti et al. 1996). Recently, it has been isolated from water and mussels of two brackish lakes near Messina, Ganzirri and Faro (Maugeri et al. 2000).

8.6

Prevention and control measures

As for pathogens of human or animal origin, avoidance of faecal contamination of the carcass during the slaughtering process will reduce the risk of Arcobacter carriage in the food. Cold temperatures can reduce the viability of some microorganisms, and arcobacter cells are sublethally injured. After 21 days storage at 4 and –20 ∞C, A. butzleri was recovered on non-selective agar only (Hilton et al. 2001). The growth of A. butzleri can be inhibited using EDTA and nisin, and trisodium phosphate (Phillips and Duggan 2001). Treatment with EDTA or with trisodium phosphate at 4 ∞C followed by incubation in the presence of nisin resulted in no viable cells being recovered. The sensitivity of A. butzleri to nisin was less at suboptimal growth temperatures (Long and Phillips 2003; Phillips and Duggan 2002). Storage at 5 ∞C in the presence of 2% sodium lactate, 2% sodium lactate plus 500 IUg–1 nisin or 1.5% sodium lactate plus 1.5% sodium citrate would be more effective in controlling

Arcobacter

211

arcobacter contamination in meat-based food systems compared to low temperature alone. The effect of temperature, initial temperature, initial pH, sodium chloride, sodium nitrite and sodium tripolyphosphate levels of A. butzleri growth were studied by Harrison (2004) and D’sa and Harrison (2005). The growth data were fitted to the modified Gompertz function and the Gompertz parameters calculated. A. butzleri was very sensitive to low levels of sodium tripolyphosphate and did not grow or survive at levels above 0.016% and 0.02% respectively. Sodium tripolyphosphate also extended the lag phase duration. Hence a multiple hurdle approach is an effective method of controlling A. butzleri growth and survival. Since Arcobacter spp. are non-spore formers, standard cooking regimes (i.e. heat treatment to 70 ∞C) will kill the organism and decimal reduction (D-value) times have been determined (Hilton et al. 2001). For A. butzleri the values are D50 18.5 min and D55 1.1–2 min with a Z-value of 7.4 to 8.1 ∞C. These indicate that A. butzleri is about threefold more thermotolerant than Campylobacter species. Some strains of A. butzleri are more resistant to desiccation than Campylobacter (Otth et al. 2001). Nevertheless, the standard recommended temperature for cooking, i.e., core temperature 70 ∞C would be sufficient to kill the organism. A. butzleri is able to survive on stainless steel surfaces for more than four days (Hazeleger et al. 2003). Collins et al. (1996b) and Hazeleger et al. (2003) have determined the sensitivity to irradiation (D 10 0.27-0.3 kGy), which is slightly less than that for Campylobacter spp.

8.7

Future recognition of Arcobacter species as pathogens

It is evident that much work has already been done on developing a large range of isolation procedures. Due to the relative lack of biochemical traits for phenotyping there has been considerable emphasis on the use of DNA probes and related molecular techniques. Indeed, using 16S DNA sequence analysis, new Arcobacter species that have yet to be cultivated and fully characterised have been identified. The Arcobacter are already established as important animal pathogens and it is likely that in the near future the full extent of Arcobacter human gastroenteritis will be recognised. At present it is regarded as rare compared with Campylobacter jejuni and C. coli but human studies using an array of molecular techniques are likely to reveal the true extent of non-C. jejuni/coli infections in the human population.

8.8

Acknowledgements

Thank you to Stephen On and Kurt Houf for their considerable assistance and supplying information prior to their publication. Figure 8.1 was constructed

212

Emerging foodborne pathogens

by Dr Stephen On specifically for this chapter.

8.9

References

AL RASHID, S.T., DAKUNA, I., LOUIE, H., NG, D., VANDAMME, P., JOHNSON, W.

and CHAN, V.L. (2000) Identification of Campylobacter jejuni, C. coli, C. lari, C. upsaliensis, Arcobacter butzleri, and A. butzleri-like species based on the glyA gene. J. Clin. Microbiol. 38, 1488–1494. ANDERSON, K.F., KIEHLBAUCH, J.A., ANDERSON, D.C., MACLURE, H.M. and WACHSMUTH, I.K. (1993) Arcobacter (Campylobacter) butzleri-associated diarrheal illness in a nonhuman primate population. Infection and Immunity 61, 220–223. ANTOLIN, A., GONZALEZ, I., GARCIA, T., HERNANDEZ, P.E. and MARTIN, R. (2001) Arcobacter spp. enumeration in poultry meat using a combined PCR-ELISA assay. Meat Sci. 59, 169– 174. ASSANTA, M.A., ROY, D., LEMAY, M.J. and MONTPETIT, D. (2002) Attachment of Arcobacter butzleri, a new waterborne pathogen, to water distribution pipe surfaces. J. Food Protection 65, 1240–1247. ATABAY, H.I. and AYDIN, F. (2001) Susceptibility of Arcobacter butzleri isolates to 23 antimicrobial agents. Lett. Appl. Microbiol. 33, 430–433. ATABAY, H.I. and CORRY, J.E.L. (1997) The prevalence of campylobacters and arcobacters in broiler chickens. Journal of Applied Microbiology 83, 619–626. ATABAY, H.I. and CORRY, J.E.L. (1998) Evaluation of a new arcobacter enrichment medium and comparison with new media developed for enrichment for Campylobacter spp. International Journal of Food Microbiology 41, 53–58. ATABAY, H.I., CORRY, J.E.L. and PROST, D.E. (1996) Comparison of the productivity of a variety of selective media for Campylobacter and Arcobacter species. Campylobacters, Helicobacters, and related organisms, edited by Newell et al., Plenum Press, New York. ATABAY, H.I., CORRY, J.E.L. and ON, S.L.W. (1998) Diversity and prevalence of Arcobacter spp. in broiler chickens. Journal of Applied Microbiology 84, 1007–1016. ATABAY, H.I., WAINO, M. and MADSEN, M. (2001) Comparison of PCR and conventional isolation mehtods for detection of arcobacters in Danish poultry. Identification of sioaltes using multiplex-PCR and phenotypic tests. 11th International Workshop on Campylobacter, Helicobacter and related organisms. September 1–5, 2001, Freiberg, Germany. ATABAY, H.I., BANG, D.D., AYDIN, F., ERDOGAN, H.M. and MADSEN, M. (2002a) Discrimination of Arcobacter butzleri isolates by polymerase chain reaction-mediated DNA fingerprinting. Lett. Appl. Mcirobiol. 35, 141–145. ATABAY, H.I., AYDIN, F, HOUF, K., SAHIN M. and VANDAMME, P. (2002b). The prevalence of Arcobacter spp. on chicken carcasses sold in retail markets in Turkey, and identification of the isolates using SDS-PAGE. International Journal of Food Microbiology 81, 21–28. AYDIN, S., ENGIN, M. and BIRCAN, R. (2002) A comparative investigation of Arcobacter cryaerophilus infection among albino crosses and high- and low-body-weight rainbow trout. J. Aquatic Animals 14, 39–44. BASTYNS, K., CARTUYVELS, D., CHAPELLE, S., VANDAMME, P., GOOSSENS, H. and DE WACHTER, R. (1995) A variable 23s rDNA region is a useful discriminating target for genus-specific and species-specific PCR amplification in Arcobacter species. System. Appl. Microbiol. 18, 353–356. BURNENS, A.P., SCHAAD, U.B. and NICOLET, J. (1992) Isolation of Arcobacter butzleri from a girl with gastroenteritis on Yersinia selective agar. Medical Microbiology Letters 1, 251–256. CARBONE, M., MAUGERI, T.L., GIANNONE, M., GUGLIANDOLO, C., MIDIRI, A. and FERA, M.T. (2003)

Arcobacter

213

Adherence of environmental Arcobacter butzleri and Vibrio spp. isolates to epithelial cells in vitro. Food Microbiology 20, 611–616. CARDARELLI-LEITE, P., BLOM, K., PATTON, C.M., NICHOLSON, M.A., STEIGERWALT, A.G., HUNTER, S.B., BRENNER, D.J., BARRETT, T.J. and SWAMINATHAN, B. (1996) Rapid identification of Campylobacter species by restriction fragment length polymorphism analysis of a PCR-amplified fragment of the gene coding for 16S rRNA. Journal of Clinical Microbiology 34, 62–67. CHANG, N. and TAYLOR, D.E. (1990) Use of pulse-field agarose gel electrophoresis to size genomes of Campylobacter species and to construct a SalI map of Campylobacter jejuni UA 580. J. Bacteriol. 172, 5211–5217. COLLINS, C.I., WESLEY, I.V. and MURANO, E.A. (1996a) Detection of Arcobacter spp. in ground pork by modified plating methods. Journal of Food Protection 59, 448–452. COLLINS C.I., MURANO, E.A. and WESLEY, I.V. (1996b) Survival of Arcobacter butzleri and Campylobacter jejuni after irradiation treatment in vacuum-packaged ground pork. J. Food Protect 59, 1164–1166. CORRY, J.E.L. and ATABAY, H.I. (1997) Comparison of the productivity of cefoperazone amphotericin teicoplanin (CAT) agar and modified charcoal cefoperazone deoxycholate (mCCD) agar for various strains of Campylobacter, Arcobacter and Helicobacter pullorum. International Journal of Food Microbiology 38, 201–209. CORRY, J.E.L., ATABAY, H.I., FORSYTHE, S.J. and MANSFIELD, L.P. (2003) Culture media for the isolation of campylobacters, helicobacters and arcobacters. In Handbook of Culture Media for Food Microbiology, J.E.L. Corry, G.D.W. Curtis and R.M. Baird (eds). Progress in Industrial Microbiology Volume 37, 271–316. COSTAS, M. (1992) Classification, identification and typing of bacteria by the analysis of their one-dimensional polyacrylamide gel electrophoretic protein patterns. Adv. Electrophor. 5, 351–408. COSTAS, M., POTS, B., VANDAMME, P., KERSTERS, K., OWEN, R.J. and HILL, I.R. (1990) Interlaboratory comparative study of the numerical analysis of one-dimensional sodium dodecyl sulphatepolyacrylamide gel electrophoretic protein patterns of Campylobacter strains. Electrophoresis 11, 467–474. DE BOER, E., TILBURG, J.J.H.C., WOODWARD, D.L., LOIR, H. and JOHNSON, W.M. (1996) A selective medium for the isolation of Arcobacter from meats. Letters in Applied Microbiology 23, 64–66. DE OLIVEIRA, S.J., BAETZ, A.L., WESLEY, I.V. and HARMON, K.M. (1997) Classification of Arcobacter species isolated from aborted pig fetuses and sows with reproductive problems in Brazil. Veterinary Microbiology 57, 347–354. DE OLIVEIRA, S.J., WESLEY, I.V., BAETZ, A.L., HARMON, K.M., KADER, I.I.T.A and DE UZEDA, M. (1999) Arcobacter cryaerophilus and Arcobacter butzleri isolated from perputial fluid of boars and fattening pigs in Brazil. J Vet Diag Invest 11, 462–464. DEDISTE, A., AEBY, A., EBRAERT, A. and VLAES, L. et al. (1998) Arcobacter in stools: clinical features, diagnosis and antibiotic susceptibility. In Lastovica A.J. Newwell, D.G., Lastovia, E.E. (eds) Campylobacter, Helicobacter and related organisms. Cape Town: Institute of Child Health pages 436–439. DERCLAYE, I., DELOR, I., VAN BOUCHAUTE, M., POUEAU, P., WAUTERS, G. and CORNELIS, G.R. (1989) Identification of Campylobacter jejuni and Campylobacter coli by gel electrophoresis of the outer membrane proteins. J. Clin. Microbiol. 27, 1072–1076. DHAMABUTRA , N ., KAMOL -RATHANAKUL , P . and PIENTHAWEECHAI , K . (1992) Isolation of Campylobacter from the canals of Bangkok Metropolitan area. J. Med. Assoc. Thailand 75, 350–363. DICKSON, J.S., MANKE, T.R., WESLEY, I.V. and BAETZ, A.L. (1996) Biphasic culture of Arcobacter species. Letters in Applied Microbiology 22, 195–198. DONACHIE, S.P., BOWMAN, J.P., ON, S.L. and ALAM, M. (2005) Arcobacter halophilus sp. nov., the first obligate halophile in the genus Arcobacter. Int. J. Syst. Evol. Microbiol. 55, 1271–7. D’SA and HARRISON, M.A. (2005) Effect of pH, NaCl content, and temperature on growth

214

Emerging foodborne pathogens

and survival of Arcobacter spp. J. Food Protection 68, 18–25. and AMANN, R. (2000) Culturability and in situ abundance of pelagic bacteria from the North Sea. Appl. Environ. Microbiol. 66, 3044–3051. ELLIS, W.A., NEILL, S.D., O’BRIEN, J.J., FERGUSON, H.W. and HANNA, J. (1977) Isolation of Spirillum/Vibrio-like organisms from bovine fetuses. Vet Record 100, 451–452. ENGBERG, J., ON, S.L.W., HARRINGTON, C.S. and GERNER-SMIDT, P. (2000) Prevalence of Campylobacter, Arcobacter, Helicobacter, and Sutterella spp. in human fecal samples as estimated by a reevaluation of isolation methods or campylobacters. J Clin Microbiol 38, 286–291. FERA, M.T., MAUGERI, T.L., GIANNONE, M., GUGLIANDOLO, C., LA CAMERA, E., BLANDIO, G. and CARBONE, M. (2003) In vitro susceptibility of Arcobacter butzleri and Arcobacter cryaerophilus to different antimicrobial agents. Intl. J. Antimicrobiol Agents 21, 488– 491. FERNANDEZ, H., ELLER, G., PAILLACAR, J., GAJARDO, T. and RIQUELME, A.C. (1995a) Toxigenic and invasive capacities: possible pathogenic mechanisms in Arcobacter cryaerophilus. Mem. Inst. Oswaldo Cruz, Rio de Janeiro. 90, 633–634. FERNANDEZ, H., ROJAS, X. and GAJARDO, T. (1995b) First isolation in Chile of Arcobacter cryaerophilus from a bovine abortion. Archivos de Medicine Veterinaria 27, 111–114. FESTY, B., MARIN, M., DERIMAY, R. and LIOR, H. (1993) Poultry meat and water as the possible sources of Arcobacter butzleri associated human disease in Paris, France. Société Française de Microbiologie, Flashs sur les microorganismes pathogens dans les aliments. Colloque 28–29 April 1993. FIGURA, N., MUSMANNO, R., VAROLI, O., RUSSI, M. and LIOR, H. (1993) Characteristics of arcobacter strains from riverwater samples. Acta Gastro Belgica 56, 26. GONZALEZ, I., GARCIA, T., ANTONLIN, A., HERNANDEZ, P.E. and MARTIN, R. (2000) Development of a combined PCR-culture technique for the rapid detection of Arcobacter spp. in chicken meat. Lett. Appl. Microbiol. 30, 207–212. GUDE, A., HILLMAN, T.J., HELPS, C.R., ALLEN, V.M. and CORRY, J.E. (2005) Ecology of Arcobacter species in chicken rearing and processing. Lett Appl Microbiol. 41, 82–7. HARMON, K.M. and WESLEY, I.V. (1996) Identification of Arcobacter isolates by PCR. Letters in Applied Microbiology 23, 241–244. HARMON, K.M. and WESLEY, I.V. (1997) Multiplex PCR for the identification of Arcobacter butzleri from other arcobacters. Veterinary Microbiology 58, 215–227. HARRASS, B., SCHWARZ, S. and WENZEL, S. (1998) Identification and characterisation of Arcobacter isolated from broilers by biochemical tests, antimicrobial resistance patterns and plasmid analysis. Journal of Veterinary Medicine Series B – Infectious Diseases and Veterinary Public Health 45, 87–94. HARRISON, M.A. (2004) Effects of pH, temperature, sodium chloride, sodium nitrite and sodium tripolyphosphate on the fate of Arcobacter. URL: http://www.porkscience.org/ documents/Research/effectsofphabstract.pdf. Last accessed 19.10.2004. HAZELEGER, W., SONNEMANS, E., DOBBELSTEIN, S. and BEUMER, R. (2003) Survival of Arcobacter butzleri on stainless steel and chicken surfaces and resistance to cleaning. CHRO2003. 12th International workshop of Campylobacter, Helicobacter, & Related Organisms, Aarhus, 6–9 September. HIGGINS, R., MESSIER, S., DAIGNAULT, D. and LORANGE, M. (1999) Arcobacter butzleri isolated from a diarroeic non-human primate. Lab. Anim. 33, 87–90. HILTON, C.L., MACKEY, B.M., HARGREAVES, A.J. and FORSYTHE, S.J. (2001) The recovery of Arcobacter butzleri NCTC 12481 from various temperature treatments. J. Appl. Microbiol. 91, 929–932. HOUF, K., TUTENEL, A., DE ZUTTER, L., VAN HOOF, J. VANDAMME, P. (2000) Development of a multiplex PCR assay for the simultaneous detection and identification of Arcobacter butzleri, Arcobacter cryaerophilus and Arcobacter skirrowii. FEMS Microbiol. Lett. 193, 89–94. HOUF, K., DEVRIESE, L.A., DE ZUTTER, L., VAN HOOF, J. and VANDAMME, P. (2001a) Development EILERS, H., PERNTHALER, J., GLÖCKNER, F.O.

Arcobacter

215

of a new protocol for the isolation and quantification of Arcobacter species from poultry products. Int. J. Food Microbiol. 71, 189–196. HOUF, K., DEVRIESE, L.A., DE ZUTTER, L., VAN HOOF, J. and VANDAMME, P. (2001b) Susceptibility of Arcobacter butzleri, Arcobacter cryaerophilus, and Arcobacter skirrowii to antimicrobial agents used in selective media. J. Clin. Microbiol. 39, 1654–1656. HOUF, K., DE ZUTTER, L., VAN HOOF, J. and VANDAMME, P. (2002a) Assessment of the genetic diversity among arcobacters isolated from poultry products by using two PCR-based typing methods. Appl. Environ. Microbiol. 68, 2172–2178. HOUF, K., DE ZUTTER, L., VAN HOOF, J. and VANDAMME, P. (2002b) Occurrence and distribution of Arcobacter species in poultry processing. J. Food Protection 65, 1233–1239. HOUF, K., DE ZUTTER, L., VERBEKE, B., VAN HOOF, J. and VANDAMME, P. (2003) Molecular characterization of Arcobacter isolates collected in a poultry slaughter house. J. Food Protection. 66, 364–369. HOUF, K., DEVRESE, L.A., HAESEBROUCK, F., VANDENBERG, O., BUTZLER, J.P., VAN HOOF, J. and VANDAMME, P. (2004) Antimicrobial susceptibility patterns of Arcobacter butzleri and Arcobacter cryaerophilus strains isolated from humans and broilers. Microb Drug Resist. 10, 243–247 HOUF, K., ON, S., COENYE, T., VAN HOOF, J. and VANDAMME, P. (2005) Arcobacter cibarius sp. nov., isolated from broiler carcasses. Int. J. Syst. Evol. Microbiol. 55, 713–717. HSUEH, P-R., TENG, L-J., YANG, P-C., WANG, S-K., CHANG, S-C., HO, S-W., HSIIEH, W-C. and LUH, KT. (1997) Bacteremia caused by Arcobacter cryaerophilus 1B. Journal of Clinical Microbiology 35, 489–491. HUME, M.E., HARVEY, R.B., STANKER, L.H., DROLESKEY, R.E., POOLE, T.L. and ZHANG, H-B. (2001) Genotypic variation among Arcobacter isolates from a farrow-to-finish swine facility. J. Food Protect. 64, 645–651. HURTADO, A . and OWEN, R. J. (1997) A molecular scheme based on 23S rRNA gene polymorphisms for rapid identification of Campylobacter and Arcobacter species. Journal of Clinical Microbiology 35, 2401–2404. JACOB, J., LOIR, H. and FEUERPFEIL, I. (1993) Isolation of Arcobacter butzleri from a drinking water reservoir in Eastern Germany. Zbl. Hyg. 193, 557–562. JACOB, J., FEUERPFEIL, I. and SCHULZE, E. (1996) PCR-mediated DNA fingerprinting of atypical Campylobacter strains isolated from surface and drinking water. Zbl. Bakt. 285, 106–112. JACOB, J., WOODWARD, D., FEUERPFEIL, I. and JOHNSON, W.M. (1998) Isolation of Arcobacter butzleri in raw water and drinking water treatment plants in Germany. Zentbl. Hyg. Umweltmed. 201, 189–198. JOHNSON, L.G. and MURANO, E.A. (1999a) Development of a new medium for the isolation of Arcobacter spp.. Journal of Food Protection 61, 1623–1628. JOHNSON, L.G. and MURANO, E.A. (1999b) Comparison of three protocols for the isolation of Arcobacter from poultry. J Food Protect 62, 610–614. JOHNSON, L.G and MURANO, E.A. (2002) Lack of a cytolethal distending toxin among Arcobacter isolates from various sources. J. Food Protection 65, 1789–1795. KABEYA, H., KOBAYASHI, Y., MARUYAMA, S. and MIKAMI, T. (2003a) One-step polymerase chain reaction-based typing of Arcobacter species. Int. J. Food Microbiol. 81, 163–168. KABEYA, H. et al. (2003b) Prevalence of Arcobacter species in retail meats and antimicrobial susceptibility of isolates in Japan. Int. J. Food Microbiol. 90, 303–308 KABEYA, H. et al. (2003c) Distribution of Arcobacter species among livestock in Japan. Vet Microbiol. 93, 153–158. KARENLAMPI, R.I., TOLVANEN, T.P. and HANNINEN, M.L. (2004) Phylogenetic analysis and PCRrestriction fragment length polymorphism identification of Campylobacter species based on partial groEL gene sequences. J. Clin. Microbiol. 42, 5731–5738. KAZMI, S.U., ROBERSON, B.S. and STERN, N.J. (1985) Cadmium chloride susceptibility, a characteristic of Campylobacter spp. Journal of Clinical Microbiology 21, 708–710. KIEHLBAUCH, J.A., BRENNER, D.J., NICHOLSON, M.A., BAKER, C.N., PATTON, C.M., STEIGERWALT, A.G.

216

Emerging foodborne pathogens

and WACHSMUTH, I.K. (1991a) Campylobacter butzleri sp. nov. isolated from humans and animals with diarrheal illness. Journal of Clinical Microbiology 29, 376–385. KIEHLBAUCH, J.A., TAUXE, R.V. and WACHSMUTH, I.K. (1991b) Clinical features of Campylobacter butzleri associated diarrhoeal illness. Microb. Ecol. Health Dis. 4, S92. KIEHLBAUCH, J.A., PLIKAYTIS, B.D., SWAMINATHAN, B., CAMERON, D.N. and WACHSMUTH, I.K. (1991c) Restriction fragment length polymorphisms in the ribosomal genes for the species identification and subtyping of aerotolerant Campylobacter species. Journal of Clinical Microbiology 29, 1670–1676. KIEHLBAUCH, J.A., BAKER, C.N. and WACHSMUTH, I.K. (1992) In vitro susceptibilities of aerotolerant Campylobacter isolates to 22 antimicrobial agents. Antimicrobial Agents and Chemotherapy 36, 717–722. KIEHLBAUCH, J.A., CAMERON, D.N. and WACHSMUTH, I.K. (1994) Evaluation of ribotyping techniques as applied to Arcobacter, Campylobacter and Helicobacter. Molecular and Cellular Probes 8, 109–116. LAMBERT , M. A., PATTON, C. M ., BARRETT, T . J. and MOSS , C . W. (1987) Differentiation of Campylobacter and Campylobacter-like organisms by cellular fatty acid composition. Journal of Clinical Microbiology 25, 703–713. LAMMERDING, A.M., HARRIS, J.E., LOIR, H., MUCKEL, C.A. and IRWIN, R.J. (1994) An isolation method for Arcobacter butzleri from poultry. Dairy, Food and Environmental Sanitation 14, 600. LAMMERDING, A.M., HARRIS, J.E., LOIR, H., WOODWARD, D.E., COLE, L. and MUCKLE, C.A. (1996) Isolation method for recovery of Arcobacter butzleri from fresh poultry and poultry products. Campylobacter, Helicobacters and related organisms, edited Newell et al., Plenum Press, New York. 2–12, 329–333. LAU, S.K.P., WOO., P.C.Y., TENG, J.L., LEUNG, K.W. and YUEN, K.Y. (2002) Identification by 16S ribosomal RNA gene sequencing of Arcobacter bacteraemia in a patient with acute gangrenous appendicitis. J. Clin. Pathol. Mol. Pathol. 55, 182–185. LAUWERS, S., BREYNAERT, J., VAN ETTERIJJCK, R., REVETS, H. and METS, T. (1996) Arcobacter butzleri in the elderly in Belgium. Campylobacter, Helicobacters and related organisms, edited Newell et al., Plenum Press, New York. 3–23, 515–517. LERNER, J., BRUMBERGER, V. and PREAC-MURSIC, V. (1994) Severe diarrhea associated with Arcobacter butzleri. Eur. J. Clin. Microbiol. Infec. Dis. 13, 660–662. LIOR, H. and WANG, G. (1993) Differentiation of Arcobacter butzleri by pulse-field gel electrophoresis (PFGE) and random amplified polymorphic DNA (RAPD). Acta Gastro Enterologica Belgica 6, 29. LIOR, H. and WOODWARD, D. (1991) A serotyping scheme for Campylobacter butzleri. Mico. Ecol. Health Dis. 4, S93. LIOR, H. and WOODWARD, D. (1993) Arcobacter buzleri: A biotyping scheme. Acta Gastro enterologica belgica 6, 28. LIU, X., PHEBUS, R.K., FUNG, D.Y.C. and KASTNER, C.L. (1995) Evaluation of culture protocols and Oxyrase supplementation for Arcobacter spp. J. Rapid Meth. Autom. Microbiol. 4, 115–126. LLOBET-BROSSA, E., ROSSELLÓ-MORA and AMANN, R. (1998) Microbial community composition of Walden Sea sediments as revealed by fluorescence in situ hybridization. Appl. Environ. Microbiol. 64, 2691–2696. LOGAN, E.F., NEILL, S.D. and MACKIE, D.P. (1982) Mastitis in dairy cows associated with an aerotolerant Campylobacter. Vet. Res. 110, 229–230. LONG, C. and PHILLIPS, C.A. (2003) The effect of sodium citrate, sodium lactate and nisin on the survival of Arcobacter butzleri NCTC 12481 on chicken. Food Microbiol. 20, 495–502. MCCLUNG, C. R., PATRIQUIN, D.G. and DAVIS, R.E. (1983) Campylobacter nitrofigilis sp. nov., a nitrogen-fixing bacterium associated with roots of Spartina alterniflora. Int. J. System. Bacteriol. 33, 605–612. MADRID, V.M., TAYLOR, G.T., SCRANTON, M.I. and CHRISTOSERDOV, A.Y. (2001) Phylogenetic

Arcobacter

217

diversity of bacterial and archael communities in the anoxic zone of the Cariaco Basin. Appl. Environ. Microbiol. 67, 1663–1674. MANKE, T.R., WESLEY, I.V., DICKSON, J.S. and HARMON, K.M. (1998) Prevalance and genetic variability of Arcobacter species in mechanically separated turkey. Journal of Food Protection 61, 1623–1628. MANSFIELD, L.P. and FORSYTHE, S.J. (2000) Arcobacter butzleri, A. skirrowii and A. cryaerophilus – potential emerging human pathogens. Rev. Med. Microbiol. 11, 161–170. MARIN, M., SQUINAZI, F., DERIMAY, R., WOODWARD, D.L. and LIOR, H. (1995) Biotypes and serogroups of poultry strains of Arcobacter sp. isolated in France. Eighth International Workshop on Campylobacters, Helicobacters and related organisms, The Guidhall, Winchester, UK, 10–13th July 1995. MARINESCU, M., COLLIGNON, A., SQUINAZI, F., DERIMAY, R., WOODWARD, D. and LIOR, H (1996a) Two cases of persistent diarrhoea associated with Arcobacter sp. Campylobacters, Helicobacters and related organisms, edited by Newell et al., Plenum Press, New York. 3–25, 521–523. MARINESCU, M., COLLIGNON, A., SQUINAZI, F., WOODWARD, D. and LOIR, H. (1996b) Biotypes and serogroups of poultry strains of Arcobacter sp. isolated in France. Campylobacters, Helicobacters and related organisms, edited by Newell et al., Plenum Press, New York. 3–24, 519–520. MARSHALL, S.M., MELITO, P.L., WOODWARD, D.L., JOHNSON, W.M., RODGERS, F.G. and MULVEY, M.R. (1999) Rapid identification of Campylobacter, Arcobacter, and Helicobacter isolates by PCR restriction fragment length polymorphism analysis of the 16S rRNA gene. J Clin Microbiol 37, 4158–4160. MAUGERI, T.L., GUGLIANDOLO, C., CARBONE, M., CACCAMO, D. and FERA, M.T. (2000) Isolation of Arcobacter spp. from a brackish environment. Microbiologica 23, 143–149. MORENO, Y., BOTELLA, S., ALONSO, J. L., FERRÚS, M.A., HERNÁNDEZ, M. and HERNÁNDEZ, J. (2003) Specfic detection of Arcobacter and Campylobacter strains in water and sewage by PCR and fluorescent in situ hybridization. Appl. Environ. Microbiol. 69, 118–1186. MORENO, Y., ALONSO, J.L., BOTELLA, S., FERRUS, M.A. and HERNANDEZ, J. (2004) Survival and injury of arcobacter after artificial inoculation into drinking water. Research in Microbiology 155, 726–730. MURRAY, R.G.E. and STACKEBRANDT, E. (1995) Taxonomic notes: implementation of the provisional status Candidatus for incompletely described prokaryotes. Int. J. System. Bacteriol. 45, 186–187. MUSMANNO, R.A., RUSSI, R.A., LOIR, H. and FIGURA, N. (1997) In vitro virulence factors of Arcobacter butzleri strains isolated from superficial water samples. Microbiologica 20, 63–68. NACHAMKIN, I. (1995) Campylobacter and Arcobacter. In: Manual of Clinical Microbiology, 6th edn. Murray, P.R., Baron, E.J., Pfaller, M.A., Tenover, F.C. and Yolken, R.H. (eds) American Society of Microbiology Washington, pp. 483–491. NAGANUMA, T., KATO, C., HIRAYAMA, H., MORIYAMA, N., HASHIMOTO, J. and HORIKOSHI, K. (1997) Intracellular occurrence of e–proteobacterial 16S rDNA sequences in the vestimentiferan trophosome. J. Oceanogr. 53, 193–197. NEILL , S . D ., ELLIS , W . A . and O ’ BRIEN, J . J . (1978) The biochemical characteristics of Campylobacter-like organisms from cattle and pigs. Res. Vet. Sci. 25, 368–372. NEILL, S.D., ELLIS, W.A. and O’BRIEN, J.J. (1979) Designation of aerotolerant Campylobacterlike organsims from porcine and bovine abortions to the genus Campylobacter. Research in Veterinary Science 27, 180–186. NEILL, S.D., O’BRIEN, J.J. and ELLIS, W.A. (1980) The isolation of aerotolerant campylobacter. The Veterinary Record 106, 152–153. NEILL, S.D., CAMBELL, J.N., O’BRIEN, J.J., WEATHERUP, S.T.C. and ELLIS, W.A. (1985) Taxonomic position of Campylobacter cryaerophila sp. nov. International Journal of Systematic Bacteriology 35, 342–356. OHLENDORF, D.S. and MURANO, E.A. (2002a) Prevalence of Arcobacter spp. in raw ground

218

Emerging foodborne pathogens

pork from several geographical regions according to various isolation methods. J. Food Protection 65, 1700–1705. OHLENDORF, D.S. and MURANO, E.A. (2002b) Sensitivity of three methods used in the isolation of Arcobacter spp. in raw ground pork. J. Food Protection 65, 1784–1788. ON, S.L.W. (1996) Identification methods for campylobacters, helicobacters, and related organisms. Clin. Microbiol. Rev. 9, 405–422. ON, S.L.W. (2001) Taxonomy of Campylobacter, Arcobacter, Helicobacter and related bacteria: current status, future prospects and immediate concerns. J. Appl. Microbiol. 90, 1S–15S. ON, S.L.W. and HARRINGTON, C.S. (2000) Identification of taxonomic and epidemiological relationships among Campylobacter species by numerical analysis of AFLP profiles. FEMS Microbiology Letters 193, 161–169. ON, S.W.L. and HOLMES, B. (1991a) Effect of inoculum size on the phenotypic characterisation of Campylobacter species. Journal of Clinical Microbiology 29, 923–926. ON, S.W.L. and HOLMES, B. (1991b) Reproducibility of tolerance tests that are useful in the identification of Campylobacter. Journal of Clinical Microbiology 29, 1785–1788. ON, S.W.L. and HOLMES, B. (1992) Assessment of enzyme detection tests useful in identification of Campylobacteria. Journal of Clinical Microbiology 30, 746–749. ON, S.W.L. and HOLMES, B. (1995) Classification and identification of Campylobacters, Helicobacters and allied taxa by numerical analysis of phenotypic characters. System. Appl. Microbiol. 18, 374–390. ON, S.L.W., STACEY, A. and SMYTH, J. (1995) Isolation of Arcobacter butzleri from neonate with bacteraemia. Journal of Infection 31, 225–227. ON, S.W.L. AND HOLMES, B. and STACKIN, M.J. (1996) A probability matrix for the identification of Campylobacters, Helicobacters and allied taxa. Journal of Applied Bacteriology 81, 425–432. ON, S.L.W., AMISU, K., OSOKPEHI, R.D., COKER, A.O., OLSSON-ENGVALL, E., AYDIN, F., ATABAY, H.I., and HARRINGTON, C.S. (2001) Genetic diversity of Arcobacter butzleri investigated by AFLP profiling: identification of Nigerian, Turkish and Swedish clonal types. Int. J. Medical Microbiology 291, 139. ON, S.L.W., JENSEN, T.K., BILLE-HANSEN, V., JORSAL, S.E. and VANDAMME, P. (2002) Prevalence and diversity of Arcobacter spp. isolated from the internal organs of spontaneous porcine abortions in Denmark. Vet. Microbiol. 85, 159–167. ON, S.L.W., HARRINGTON, C.S. and ATABAY, H.I. (2003) Differentiation of Arcobacter species by numerical analysis of AFLP profiles and description of a novel Arcobacter from pig abortions and turkey faeces. J. Appl. Microbiol. 95, 1096–1105. ON, S.L.W., ATABAY, H.I., AMISU, K.O., COKER, A.O. and HARRINGTON, C.S. (2004) Genotyping and genetic diversity of Acrobacter butzleri by amplified fragment length polymorphism (AFLP) analysis. Lett. Appl. Microbiol. 39, 347–52. ÖNGÖR, H., ÇETINKAYA, B., AÇIK, M.N. and ATABAY, H.I. (2004) Investigation of arcobacters in meat and faecal samples of clinically healthy cattle in turkey. Lett. Appl. Microbiol. 38, 339–344. OTTH, L., WILSON, M. and FERNÁNDEZ (2001) Desiccation resistance in Arcobacter butzleri. Brazilian J. Microbiol. 32, 311–312. PERS, C., ON, S.L.W., TVEDE, M. and ANDERSEN, L.P. (1999) Arcobacter butzleri in hospitalised patients. Baltimore CHRO. PHILLIPS, C.A. (2001a) Arcobacters as emerging human foodborne pathogens. Food Control 12, 1–6. PHILLIPS, C.A. (2001b) Arcbacter spp. in food: isolation, identification and control. T. Food Sci. Technol. 12, 263–275. PHILLIPS, C.A. and DUGGAN, J. (2001) The effect of EDTA and trisodium phospate, alone and in combination with nisin, on the growth of Arcobacter butzleri in culture. Food Microbiology 18, 547–554. PHILLIPS, C.A. and DUGGAN, J. (2002) The effect of temperature and citric acid, alone, and

Arcobacter

219

in combination with nisin, on the growth of Arcobacter butzleri in culture. Food Control 13, 463–468. PICKETT, C., COTTLE, D., PESCI, E. and BIKAH, G. (1994) Cloning, sequencing and expression of the Escherichia coli cytolethal distending toxin genes. Infect. Immun. 62, 1046– 1051. PICKETT, C., PESCI, E., COTTLE, D.L., RUSSELL, G., ERDEM, A.N. and ZEYTIN, H. (1996) Prevalence of cytolethal distending toxin production in Campylobacter jejuni and relatedness of Campylobacter sp. cdtB genes. Infect. Immun. 64, 2070–2078. PUGINA, P., BENZI, G., LAUWERES, S., VAN ETTERIJCK, R., BUTZLER, J.P., VLAES, L. and VANDAMME, P. (1991) An outbreak of ‘Arcobacter (Campylobacter) butzleri’ in Italy. Micro Ecol Health Dis. 4, S94. RICE, E.W., RODGERS, M.R., WESLEY, I.V., JOHNSON, C.H. and TANNER, S.A. (1999) Isolation of Arcobacter butzleri from ground water. Letters in Applied Microbiology 28, 31–35. RIDSDALE, J.A., ATATABAY, H.I. and CORRY, J.E.L. (1998) Prevelance of campylobacters and arcobacters in ducks at the abattoir. Journal of Applied Microbiology 85, 567–573. RIDSDALE, J.A., ATATABAY, H.I. and CORRY, J.E.L. (1999) Campylobacter and Arcobacter spp. isolated from the carcasses and caeca of commercially reared ducks. Anaerobe 5, 317–320. RIVAS, L., FEGAN, N. and VANDERLINDE, P. (2004) Isolation and characterization of Arcobacter butzleri from meat. Int. J. Food Microbiol. 91, 31–41. SAVELKOUL, P.H., AARTS, H.J., DE HAAS, J., DIJKSHOORN, L., DUIM, B., OTSEN, M., RADEMAKER, J.L., SCHOULS, L. and LENSTRA, J.A. (1999). Amplified-fragment length polymorphism analysis: the state of an art. J Clin Microbiol 37, 3083–3091. SCHROEDER-TUCKER, L., WESLEY, I.V., KIEHLBAUCH, J.A., LARSON, D.J., THOMAS, L-A. and ERICKSON, G.A. (1996) Phenoypic and ribosomal RNA characterisation of Arcobacter species isolated from porcine aborted fetuses. Journal of Veterinary Diagnostic Investigation 8, 186–195. SCUILLION, R., ON, S.L.W., MADDEN, R.H. and HARRINGTON, C.S. (2001) Comparison of a multiplex PCR assay and AFLP profiling for speciation of Arcobacter spp. Poster Presentation at 11th CHRO, Freiburg, September 2001. SKIRROW, M.B. (1994) Diseases due to Campylobacter, Helicobacter and related bacteria. J. Comp. Path. 111, 113–149. SNAIDR, J., AMANN, R., HUBER, I., LUDWIG, W. and SCHLEIFER, K.H. (1997) Phylogenetic analysis and in situ identification of bacteria in activated sludge. Appl Environ Microbiol 63, 2884–2896. SQUINAZI, F., MARIN, M., DERIMAY, R., WOODWARD, D.L. and LIOR, H. (1995) Biotypes and serogroups of poultry strains of Arcobacter sp. isolated in France. La microbiologie dans tous ses états 4éme congrès national de la société française de microbiologie. STAMPI, S., VAROLI, O., ZANNETTI, F. and DE LUCA, G. (1993) Arcobacter cryaerophilus and thermophilic campylobacters in a sewage treatment plant in Italy: two secondary treatments compared. Epidemiol Infect 110, 633–639. STAMPI, S., DE LUCA, G., VAROLI, O. and ZANETTI, F. (1999) Occurrence, removal and seasonal variation of thermophilic campylobacters and Arcobacter in sewage sludge. Zent Hyg Umwelt 202, 19–27. STEELE, T.W. and MCDERMOTT, S.N. (1984) The use of membrane filters applied directly to the surface of agar plates for the isolation of Campylobacter jejuni from feces. Pathol 16, 263–265. SUAREZ, D.L., WESLEY, I.R. and LARSON, D.J. (1997) Detection of Arcobacter species in gastric samples from swine. Veterinary Microbiology 57, 325–336 TAYLOR, D.N. and PARSONNET, J. (1995) Epidemiology and natural history of Helicobacter pylori infection. In Infections of the gastrointestinal tract, pp. 551–563. (eds M.J. Blaser, P.D. Smith, J.I. Ravdin, H.B. Greenberg and R.L. Guerrant) New York, Raven Press. TAYLOR, D.N., KIELHBAUCH, J.A., TEE, W., PITARANGSI, C. and ECHEVERRIA, P. (1991) Isolation of

220

Emerging foodborne pathogens

Group 2 aerotolerant Campylobacter species from Thai children with diarrhea. Journal of Infectious Diseases 163, 1062–1067. TEE, W., BAIRD, R., DYLALL-SMITH, M. and DWYER, B. (1988) Campylobacter cryaerophila isolated from a human. Journal of Clinical Microbiology 26, 2469–2473. TESKE, A., SIGALEVICH, P., COHEN, Y. and MUYZER, G. (1996) Molecular identification of bacteria from a coculture by denaturing gradient gel electrophoresis of 16S ribosomal DNA fragments as a tool for isolation in pure cultures. Appl. Environ. Microbiol. 62, 4210–4215. THOMPSON, L.M.III, SMIBERT, R.M., JOHNSON, J.L. and KRIEG, N.R. (1988) Phylogenetic study of the genus Campylobacter. Int. J. Syst. Bacteriol. 38, 190–200. TOMPKINS, D.S., HUDSON, M.J., SMITH, H.R., et al. (1999) A study of infectious intestinal disease in England: microbiological findings in cases and controls. Comm. Dis. Publ. Hlth. 2, 108–113. TSANG, R.S.W., LUK, J.M.C., WOODWARD, D.L. and JOHNSON, W.M. (1996) Immunochemical characterisation of a haemagglutinating antigen of Arcobacter spp. FEMS Microbiology Letters 136, 209–213. URSING, J.B, LIOR, H. and OWEN, R.J. (1994) Proposal of minimal standards for describing new species of the family Campylobacteraceae. Int. J. System. Bacteriol. 44, 842– 845. VAN DRIESSCHE, E., HOUF, K., VAN HOOF, J., DE ZUTTER, L. and VANDAMME, P. (2003) Isolation of Arcobacter species from animal feces. FEMS Microbiol. Lett. 229, 243–248. VAN DRIESSCHE, E., HOUF, K., VANGROENWEGHE, F., NOLLET, N., DE ZUTTER, L., VANDAMME, P. and VAN HOOF, J. (2004) Occurrence and strain diversity of Arcobacter species in Belgian pigs. Res. Microbiol. 155, 662–6. VAN DRIESSCHE, E., HOUF, K., VANGROENWEGHE, F., DE ZUTTER, L. and VAN HOOF, J. (2005) Prevalence, enumeration and strain variation of Arcobacter species in the faeces of healthy cattle in Belgium. Vet. Microbiol. 105, 149–154. VANDAMME, P. and DE LEY, J. (1991) Proposal for a new family, Campylobacteracae. International Journal of Systematic Bacteriology 41, 451–455. VANDAMME, P. and GOOSSENS, H. (1992) Taxonomy of Campylobacter, Arcobacter, and Helicobacter: A review. Zentralbl. Bakteriol. 276, 447–472. VANDAMME, P., FALSEN, E., ROSSAU, R., HOSTE, B., SEGERS, P., TYTGAT, R. and DE LEY, J. (1991a) Revision of Campylobacter, Helicobacter and Wolinella taxonomy: emendation of generic descriptions and proposal of Arcobacter gen. nov. International Journal of Systematic Bacteriology 41, 88–103. VANDAMME, P., POT, B. and KERSTERS, K. (1991b) Differentiation of campylobacters and campylobacter-like organisms by numerical analysis of one-dimensional electrophoretic protein patterns. System. Appl. Microbiol. 14, 57–66. VANDAMME, P., PUGINA, P., BENZI, G., VAN ETTERIJCK, R., VLAES, L., KERSTERS, K., BUTZLER, J.–P., LIOR, H. and LAUWERS, S. (1992a) Outbreak of recurrent abdominal cramps associated with Arcobacter butzleri in an Italian school. Journal of Clinical Microbiology 30, 2335–2337. VANDAMME, P., VANCANNEYT, M., POT, B., MELS, L., HOSTE, B., DEWETTINCK, D., VLAES, L., VAN DEN BORRE, C., HIGGINS, R., HOMMEZ, J., KERSTERS, K., BUTZLER, J.-P. and GOOSSENS, H. (1992b) Polyphasic taxonomic study of the emended genus Arcobacter with Arcobacter butzleri comb. nov. and Arcobacter skirrowii sp. nov., and aerotolerant bacterium isolated from veterinary specimens. International Journal of Systematic Bacteriology. 42, 344–356. VANDAMME, P., GIESENDORF, B.A.J., VAN BELKUM, A., PIERARD, D., LAUWERS, S., KERSTERS, K., BUTZLER, J-P., GOOSSENS, H. and QUINT, W.G.V. (1993) Discrimination of epidemic and sporadic isolates of Arcobacter butzleri by polymerase chain reaction-mediated DNA fingerprinting. Journal of Clinical Microbiology 31, 3317–3319. VANDENBERG, O., DEDISTE, A., VLAAS, L., AEBY, A., DEDONDER, R., RETORE, P., DOUAT, N., VANDAMME, P., DEVASTER, J-M. and BUTZLER, J-P. (1999) Prevalence, antimicrobial susceptibility

Arcobacter

221

patterns and clinical features of Arcobacter in stool specimens. In Program and abstracts of the 10th International Congress on Campylobacter, Helicobacter and related organisms. Baltimore, USA, 8-10 September Abstract P36.006. VANDENBERG, O., DEDISTE, A., VLAES, L., EBRAERT, A., RETORE, P., DOUAT, N., VANDAMME, P. and BUTZLER, J-P. (2003) Prevalence and clinical features of non-jejuni/coli campylobacter species and related organisms in stool specimens. CHRO Aarhus. VANDENBERG, O., DEDISTE, A., HOUF, K., IBEKWEM, S., SOUAYAH, H., CADRANEL, S., DOUAT, N., ZISSIS, G., BUTZLER, J.P. and VANDAMME, P. (2005) Arcobacter species in humans. Emerging Infectious Diseases 10, 1863–1867. VERSALOVIC, J., KOEUTH, T. and LUPSKI, J.R. (1991) Distribution of repetitive DNA sequences in eubacteria and application to fingerprinting of bacterial genomes. Nucleic Acid Res. 19, 6823–6831. WESLEY, I. (1994) Arcobacter infections pp. 181–190. In Handbook of Zoonoses 2nd edn, Section A: Bacterial, Rickettsial, Chlamydial and Mycotic, Beran, G.W. and Steele. J.H. CRC Press. WESLEY, I.V. (1996) Helicobacter and Arcobacter species: risk for foods and beverages. Journal of Food Protection 59, 1127–1132. WESLEY, I.V. (1997) Helicobacter and Arcobacter: Potential human foodborne pathogens? Trends in Food Science and Technology 8, 293–299. WESLEY, I.V. and BAETZ, A.L. (1999) Natural and experimental infections of Arcobacter in poultry. Poultry Science 78, 536–545. WESLEY, I.V., SCHROEDER-TUCKER, L., BAETZ, A.L., DEWHURST, F.E. and PASTER, B.J. (1995) Arcobacter butzleri-specific 16s rRNA-based probes. Journal of Clinical Microbiology 33, 1691–1698. WESLEY, I.V., BAETZ, A.L. and LARSON, D.J. (1996) Infection of cesarean-derived colostrumdeprived one-day old piglets with Arcobacter butzleri, Arcobacter cryaerophilus, and Arcobacter skirrowii. Infection and Immunity 64, 2295–2299. WESLEY, I.V., WELLS, S.J., HARMON, K.M., FGREEN, A., SCHROEDER-TUCKER, L., GLOVER, M. and SIDDIQUE, I. (2000) Fecal shedding of Campylobacter and Arcobacter spp. in dairy cattle. Applied and Environemental Microbiology 66, 1994–2000. WINTERS, D.K. and SLAVIK, M.F. (2000) Multiplex PCR detection of Campylobacter jejuni and Arcobacter butzleri in food products. Molecular and Cellular Probes 14, 95–99. WIRSEN., C.O., SIEVERT, S.M., CAVNAUGH, C.M., MOLYNEAUX, S.J., AHMA, A., TAYLOR, L.T., DELONG, E.F. and TAYLOR, C. (2002) Characterization of an autotrophic sulphide-oxidizing marine Arcobacter sp. that produces filamentous sulphur. Appl. Environ. Microbiol. 68, 316– 25. WOO, P.C.Y., CHONG, K.T.K., LEUNG, K-W., QUE T-L. and YUEN, K-Y. (2001) Identification of Arcobacter cryaerophilus isolated from a traffic accident victim with bacteremia by 16S ribosomal RNA gene sequencing. Diagn. Microbiol. Infect. Dis. 40, 125–127. WYBO, I., BREYNAERT, J., LINDENBURG, F., HOUF, K. and LAUWERS, S. (2003) Isolation of Arcobacter skirrowii in a patient with chronic diarrhea. Clin. Microbiol. Inf. 9, 394S–395S. WYBO, I., BREYNAERT, J., LAUWERS, S., LINDENBURG, F. and HOUF, K. (2004) Isolation of Arcobacter skirrowii from a patient with chronic diarrhea. J. Clin. Microbiol. 42, 1851–1852. YAN, J-J, KO, W-C, HUANG, A-H, CHEN, H-M., JIN, Y-T. and WU, J-J. (2000) Arcobacter butzleri bacternia in a patient with liver cirrhosis. J. Formos. Med. Assoc. 99, 166–169. ZANETTI, F., STAMPI, S., DE LUCA, G., VAROLI, O. and TONELLI, E. (1996a) Comparative disinfection of secondary-treated sewage with chlorine dioxide and bromine chloride. Zbl. Hyg. 198, 567–579. ZANETTI, F., VAROLI, O, STAMPI, S. and DE LUCA, G. (1996b) Prevalence of thermophilic Campylobacter and Arcobacter butzleri in food of animal origin. International Journal of Food Microbiology 33, 315–321.

222

Emerging foodborne pathogens

9 Foodborne trematodes and helminths K. D. Murrell, Uniformed University of Health Sciences, USA and D. W. T. Crompton, University of Glasgow, Scotland

9.1

Introduction

Humans suffer from a plethora of foodborne diseases including several caused by infection with a variety of species of endoparasitic helminth (WHO, 2000). The helminthiases of concern here are zoonoses, diseases of animals that persist in non-human hosts but have become transmissible to humans. In this article, we focus on a small selection of trematode, cestode and nematode species (Table 9.1) from the many reported from humans (Coombs and Crompton, 1991). The selection includes what we propose to be representative species that illustrate the challenges faced when attempting to implement control measures. For example, in any discussion of Paragonimus westermani we are assuming that the points made refer to the other species of the genus, subspecies and strains infecting humans (see Blair et al., 1999). We also claim that our identification of risk factors and suggestions for prevention, control and treatment have general relevance and application beyond the species listed in Table 9.1. Perhaps as many as 600 million people worldwide, mostly living in lowand middle-income countries, are at risk of infection from the helminths under review in this article (WHO, 2000). The most obvious and theoretically simple measure to prevent infection is to promote education aimed at reducing the consumption of raw, pickled, smoked or undercooked crustaceans, fish, meat and vegetables. Such advice challenges cultural traditions and requires greater fuel consumption, thereby causing more deforestation, soil erosion and atmospheric pollution. More importantly, however, is the need not to jeopardize food security provided by household aquaculture in backyard ponds and family farms. According to estimates made by FAO, the prevalence of undernutrition, which serves as a measure of food insecurity, ranges from

Foodborne trematodes and helminths

223

Table 9.1 Estimates of numbers of human infections with a selection of foodborne helminths1 Helminth species TREMATODA Clonorchis sinensis Fasciola gigantica ¸ ˝ F. hepatica ˛ Fasciolopsis buski Opisthorchis viverrini Paragonimus westermani4 Small intestinal flukes5 CESTODA Taenia saginata T. solium Diphyllobothrium spp6 NEMATODA Anisakis simplex4 Trichinella spiralis7

Numbers (millions)1, 2

References

7

WHO (1995)

2.4

Rim et al. (1994)

0.2 10.53 20 4.4 (Republic of Korea)

WHO (1995) Watanapa and Watanapa (2002) Toscano et al. (1995) Chai and Lee (2002)

77 10 50 9

Keymer (1982) Craig et al. (1996) Eddi et al. (2003) Von Bonsdorff (1977)

0.33 1.5

Ishakura et al. (1998) Dupouy-Camet (2000)

1 Problems encountered in making estimates of numbers of infections are discussed by Crompton (1999). 2 Maps of the distribution of these and other infections have been published by Stürchler (1988). See also Table 9.2. 3 Includes 1.5 million infections with O. felineus. 4 Representative member of a complex of species. 5 A collective title for species of flukes belonging to the Heterophyidae, Echinostomatidae, Neodiplostomidae, Plagiorchiidae and Gymnophallidae (Chai and Lee, 2002; Coombs and Crompton, 1991). Secure identification is extremely difficult. 6 At least four species are zoonotic. 7 At least six species are zoonotic.

38% to 6% of the populations of Asian countries where foodborne trematode infections flourish and where fish contributes 24% of the protein in the people’s diet (SCN, 2004). Foodborne helminth infections also have a significant economic impact on commercial food production not only for home consumption but also for export.

9.2

Zoonotic parasite biology and impact on public health

Problems for humans arising from foodborne helminth infections are caused by the intrusion of human activities into the life histories of the helminths. This conclusion is supported by the information summarized in Table 9.2. Knowledge of the helminths’ distribution, biology and routes of transmission

Features of the distribution, biology, transmission and public health risks of foodborne helminth infections1 Geographic distribution

Biology and transmission

Risk factors

TREMATODA (flukes) Liver flukes2 Fasciola hepatica F. gigantica

F. hepatica: Europe, Africa, North and South America, northern Asia, Oceania.

Adult worms in ruminants (especially cattle, sheep, goats), pigs and in humans.

Consumption of raw aquatic plants (e.g. watercress) and vegetables. Fertilization of fish ponds or crops with water contaminated with human and livestock waste a major risk factor.

Clonorchis sinensis Opisthorchis viverrini O. felineus

F. gigantica: Africa, SE Asia, Japan, China, Korea, Pacific region, Middle East, USA

Intermediate host: aquatic snails, in which asexual reproduction occurs, producing swimming cercaria which attaches to aquatic vegetation and encysts (metacercaria). Transmitted passively to definitive host by ingestion of vegetation, or of water containing detached metacercaria.

C. sinensis: East Asia, SE Asia.

Adult worms in fish-eating mammals, including humans, dogs, cats, pigs and rats.

O. viverrini: Thailand, Laos, Vietnam, Malaysia

First intermediate host: snails, in which parasite multiplies asexually, and emerges as a swimming cercaria, seeking fish. Seriety of fresh-water fish, especially Cyprinidae, which are important in aquaculture. Cercaria invades muscles, gills, fins and scales and encysts (metacercaria).

O. felineus: Southern, central and eastern Europe, Turkey, eastern Siberia. Lung flukes3, 4 Paragonimus spp.

SE Asia, India, China, Japan, central and western Africa, Central and South America.

Adult worms in humans, felids, dogs and pigs. First intermediate host: snails, in which parasite asexual reproduction occurs. Second intermediate host: fresh-water crabs and crayfish (includes many species) eat infected snails, allowing cercariae to encyst (metacercaria) mainly on gills.

Infection of definitive host through ingestion of raw or insufficiently cooked, pickled or smoked fish. Eating pickled or raw fish at parties involving alcohol is especially risky for adults. Use of human and animal waste for pond fertilization is a very important risk for fish. Consumption of infected raw or insufficiently cooked crabs leads to infection with adult worms. Risky preparations include wineor soy-soaked crabs and dishes such as crab juice, crab jam and crab curd.

Emerging foodborne pathogens

Helminth species

224

Table 9.2

Table 9.2

Continued

Helminth species Intestinal flukes Heterophyidae group5

CESTODA (tapeworms) Meatborne Taenia solium (pork) T. saginata (beef)

Risk factors

Zoonotic members of the family are distributed world-wide, especially Korea, Japan, China, Taiwan, SE Asia, North Africa, Bangladesh, India.

Ault worms in fish-eating birds and mammals such as dogs, cats, pigs, rats, various wild animals and humans. First intermediate host: aquatic snails in which asexual reproduction produces swimming cercaria which seek fish. Second intermediate host at least 45 genera of fresh and brackish water fish are susceptible. Cercaria penetrates gills, fins, scales and muscles to encyst (metacercaria).

Consumption of raw, insufficiently cooked, pickled or smoked fish most important route of human infection. Eating special ethnic dishes of raw or pickled fish along with alcohol is a major risk factor in SE Asia. Use of human and animal waste for fish pond fertilization is high risk for fish infection.

SE Asia, China, Taiwan, Bangladesh, India.

Adults in pigs, dogs and humans.

Adult worm infections result when infected plants are eaten, particularly caltrop, water chestnuts, watercress, water hyacinth, water morning glory and lotus. Contamination of water used for growing plants with human and animal (especially pig) waste is especially most important risk factor.

World-wide, especially in Asia, Africa, Latin America.

Adults infect only the human intestine.

First intermediate host: aquatic snails. Asexual reproduction of parasite in snail produces swimming cercaria which seek out aquatic plants on which to encyst (metacercaria). Transmitted when plants are consumed by mammalian host.

Intermediate host: T. solium larvae (cysticercus) normally in pig muscle and viscera. However, if

Consumption of raw or insufficiently cooked pork or beef produces adult worm infection (taeniasis). Indiscriminate human

225

Biology and transmission

Foodborne trematodes and helminths

Fasciolopsis buski

Geographic distribution

226

Table 9.2

Continued

Diphyllobothrium spp.7

Geographic distribution

North America, South America, Eurasia and Japan.

(broad tapeworm)

NEMATODA (roundworms) Trichinella spp7

Biology and transmission

Risk factors

humans accidentally ingest eggs, may also serve as intermediate host with cysticerci in muscle, viscera and brain (neurocysticercosis). T. saginata larvae (cysticercus) in cattle muscle.

defecation, access of pigs to latrines and use of sewage effluent for irrigation of crops and pastures are critical risk factors.

Adult worm in intestines of fish-eating mammals (dogs, cats, mink, pigs, bears, seals and sea lions), including humans.

Consumption of raw or insufficiently cooked, smoked, dried or pickled infected fish most important. Intrusion of humans into aquatic habitats (camping, resorts) has increased risk to humans, although wild animal reservoirs ensure presence of the helminths in endemic areas. Insufficient handling of human waste in wilderness areas is a significant risk factor.

First intermediate host: copepods in which first development stage (procercoid) develops. Second intermediate host: fresh-water fish, in which infective larvae (plerocercoids) develop. Important fish species are pike, salmon, trout, ruff, white fish, and perch.

T. spiralis is most important zoonotic species for humans and pigs, T. spiralis, is cosmopolitan. Other species are primarily sylvatic and have more or less geographical restrictions. 8

Life cycle unusual in that all stages occur in one host. Most species infect only mammals, including humans. Adults in intestines produce larvae that invade the circulatory system and striated muscle where they encapsulate. If muscle larvae (‘trichinae’) are eaten by another mammal, larvae develop in the intestine to adult stage.

Infection acquired by ingestion of raw, insufficiently cooked, smoked or cured meat. Outbreaks in humans are often associated with social events (i.e. Christmas and other celebrations) when special ethnic dishes are prepared such as sausages. Recently, European outbreaks have occurred among

Emerging foodborne pathogens

Helminth species

Table 9.2

Continued

Helminth species

Geographic distribution

Biology and transmission

Risk factors ethnic groups eating raw or lightly cooked infected horse meat. Hunters often at risk from infection with sylvatic species when consuming game, especially wild boar and bear.

1

World-wide but especially important in northern Europe, Japan, Korea, North America, and Pacific Islands.

Complex life cycles involving marine mammals (definitive hosts) such as dolphins, whales, seals and fur seals. First intermediate host: marine crustaceans, in which early parasite larval development occurs. Second intermediate host: fish or squid, in which larvae develop to infective stage for mammals. When ingested, larvae develop to adults in the intestine. Major fish species are, herring, cod, mackerel, salmon, tuna, whiting, haddock, smelt and plaice.

Infection in humans occurs when raw, insufficiently cooked, salted, pickled or smoked fish or squid are consumed. Traditional celebration and wedding dishes such as raw herring, lomi lomi, marinated salmon, sushi, sashimi, ceviche salad, sunomono are important risks.

227

Sources: WHO, 1995; Mas-Coma and Bargues, 1997; Miyazaki, 1991; Murrell, 2002; MacLean et al., 1999; Cross, 2001; Pawlowski and Murrell, 2001. Liver infection sites: bile ducts, gall bladder, pancreatic dust. 3 The systematics of Paragonimus is complex and controversial and has been recently revised (Blair et al., 1999; WHO, 1995; Miyazaki, 1991). 4 Lung: parasite locates usually in lung tissue and pleurocavity, sometimes in extrapulmonary sites such as the central nervous system. 5 Intestinal flukes of the family Heterophyidae, commonly known as ‘minute flukes’, are comprised of many species but the most important zoonotic ones are Heterophyes, Metagonimus and Haplorchis. All have similar life cycles. 6 This genus is comprised of at least thirteen species but the most important as a zoonotic risk are D. latum (Northern Hemisphere), D. dendriticum (sub-Arctic), D. nihonkaiensis (Japan) and D. pacificum (Pacific coast of South America) (Dick et al., 2001). 7 Of the eight described species of Trichinella, only one (T. zimbabwensis) has not been yet reported from humans. From experimental studies domestic pigs are not very susceptible to species other than T. spiralis. 8 See Murrell et al. (2000) for review of taxonomy and geographic distribution. 2

Foodborne trematodes and helminths

Anisakis simplex (herring worm) Pseudoterranova decipiens (cod worm)

228

Emerging foodborne pathogens

and the risks to public health caused by these factors, is fundamental to the design and implementation of control programmes. Because the number of foodborne zoonotic parasites is very large, we have detailed two important examples, one fishborne and one plantborne, to illustrate the complex biology and epidemiology features of these parasites, their economic and public health impacts on resource poor countries, and the difficulties in achieving effective control. For a fuller treatment of these zoonotic diseases, the reader is referred to Chai et al., (2005a) for fishborne parasites and to Mas-Coma et al. (2005) for plantborne parasites.

9.2.1 The fishborne liver flukes, Clonorchis sinensis; Opisthorchis viverrinii and O. felineus Distribution and prevalence Clonorchis sinensis, the Chinese liver fluke, is the most important species of fishborne zoonotic parasite in East Asia (Rim, 1990; Chen et al., 1994; Hong, 2003). It is widely distributed in this region (Table 9.2). In 1947, the estimated number of infected people world-wide was about 19 million (Stoll, 1947), but more recently has been estimated to be about 7–10 million (WHO, 1995; Crompton, 1999). Current endemic areas of clonorchiasis include South Korea, China (except northwestern parts), Taiwan, northern Vietnam, and the far eastern part of Russia (Table 9.1). In the Republic of Korea, national surveys in 1971 and 2004 revealed 1.4–4.6% egg positive rates (Chai et al. 2005a); the number of infected people currently in Korea is estimated at about 1.5 million. In a nationwide survey in China, the prevalence of C. sinensis was 0.4% among almost 1.5 M people examined (Xu et al., 1995). Based on these data, the number of infected people in China may be about 6 million. In Vietnam, clonorchiasis has been endemic mainly in the north, especially along the Red River Delta including Haiphong and Hanoi (Rim, 1982a; De et al., 2003). Opisthorchis viverrini is also highly prevalent in Southeast Asia including Thailand, Laos, Cambodia, and south Vietnam; about 9 million people are estimated to be infected globally (Yossepowitch et al., 2004). In Laos, the Mekong River basin is the most heavily infected area (Chai et al., 2005b). In Vietnam, several southern provinces such as Phu Yen have reported infections, with prevalences above 10% (De et al., 2003). Opisthorchis felineus was first described from a naturally infected cat and subsequently from a man in 1892 and it is now recognized as a natural parasite of dogs, cats, foxes, and pigs in eastern and southeastern Europe and the Asiatic parts of Russia and common also in southern, central, and eastern Europe, Turkey, and Siberia west of the Ob River, including Tomsk and Tyumen.

Foodborne trematodes and helminths

229

Biology and life cycle Clonorchis sinensis and Opisthorchis spp. are members of the trematode Family Opisthorchiidae and are quite similar in morphology, life cycles and modes of transmission. All share a similar epidemiological feature (Fig. 9.1), the transmission to their final host through the latter’s consumption of raw or insufficiently cooked infected fish (sometimes shrimp). This common thread also dictates similar prevention and control strategies. The adult flukes are flat, spindle-shaped, nearly transparent, and although variable they usually range in size from 1.5–4 ¥ 7–15 mm. Although C. sinensis is simlar to O. felineus and O. viverrini, it differs in having branched rather than lobated testes. Typical for the family, they live in the biliary tract of humans and domestic animals and produce eggs which pass out through the common bile duct and intestines. The eggs are ingested by freshwater snails which are the invertebrate host or vector. In the snail, the miracidia

Mature to adults over 4 weeks

5–25 mm adults reside in bile ducts for up to 30 yrs causing:

Metacercariae excyst in small bowel, migrate up common bile duct

~ 15 ¥ 30 m eggs in stool

Encysted metacercariae ingested with fish (carp) Cercariae from snail penetrate under scales of fresh fish

Eggs ingested by hydrobild snails; miracidia hatch, develop sporocysts, rediae, cercarirae over 4–6 wks

Fig. 9.1 Generalised life cycle for fish-borne liver flukes (Clonorchis sinensis, Opisthorchis viverrini and O. felineus). Adapted from MacLean, JD, Cross JH and Mahanty S, 1999 in Tropical Infection Diseases, Guerrant RL, Walker DH and Weller PF, eds. Churchill Livingston, Philadelphia, p.1039.

230

Emerging foodborne pathogens

develop through several asexual stages until finally producing the cercaial stage, which emerges from the snail to search for the fish intermediate host. A cercaria possesses two eye spots, and membranous keels on its ventral and dorsal surfaces of the tail, important diagnostic characters. A free swimming cercaria, probably attracted by movements of the fish, penetrates beneath the fish’s scales, loses its tail, and encysts, chiefly in muscles, less frequently under the scales, fins or gills, and transforms into an encysted metacercaria, which are infective for the definitive mammalian host, including man, pigs, dogs, cats and a variety of rodents. The metacercaria is round or oval, variable in size but measuring on average 0.1 ¥ 0.2 mm. More than a 100 species of freshwater fishes belonging to 13 families, especially the Cyprinidae, and three species of freshwater shrimp, can serve as the second intermediate host (Rim, 1986; Chen et al., 1994; Park et al., 2004). The susceptibility of each species of fish, however, is variable, and the infection rate varies greatly between species of fish. The mode of transmission to the definitive host is through consumption of raw, undercooked, or improperly pickled or smoked infected fish. In the final host, the metacercariae excyst in the duodenum and migrate to the common bile duct and then to the extrahepatic and intrahepatic bile ducts. The metacercariae grow to the adult stage in about 4 weeks after infection (Rim, 1986). Epidemiology Because all the zoonotic liver flukes share a common final transmission feature, i.e., ingestion of infected fish, their overall epidemiological features are very similar, and that of C. sinensis is illustrative. The presence of the snail, fish and mammalian hosts (including man) is essential to transmission, and this combination must be sustainable for the parasite to remain endemic in a region. Because the availability of susceptible snail species is crucial the geographical distribution of liver flukes closely parallels the distribution of appropriate snail host species. Although the prevalence of infection in a snail population can be as low as 0.08% for C. sinensis even in highly endemic areas, this is sufficient to maintain the life cycle because infected snails may release an average of 788 cercariae per snail daily, with a maximum 5,840 cercariae per snail (Rim et al., 1982b). In addition, the shedding interval during the year may be long; in Korea, cercarial shedding has been observed to extend from May to October (Rim, 1982a). This feature is similar also for O. viverrini; although snail infection rates may also be quite low (0.083– 1.6%), this level is sufficient to maintain endemicity (Kaewkes, 2003). In contrast, both the prevalence and intensity of infection of the fish hosts with metacercariae can be very high. Often 94–100% of fish examined can be infected with zoonotic metacercariae (Vichasri et al., 1982; Ooi et al., 1997). The prevalence of liver flukes in endemic areas is, of course, related to the human custom of eating raw fish or shrimps. The morning congee (rice gruel) with slices of raw freshwater fish (southern China and Hong Kong) or

Foodborne trematodes and helminths

231

slices of raw freshwater fish with red pepper sauce (Korea) are examples of major dietary sources of C sinensis infection. In northeastern Thailand and Laos, it is well established that ‘Koi pla’, the most popular raw fish dish, particularly among Thai of Lao descent, is an important food source of infection with O. viverrini. The ‘Koi pla’ dish consists of raw fish flesh chopped with garlic, lemon juice, fish sauce, chili, roasted ground rice, and local vegetables (Rim, 1982b). Other similar dishes include ‘Pla ra’, ‘Pla som’, ‘Pla lap’, ‘Som fak’, and ‘Pla kaw’. Associated with the habit of eating raw fish, characteristic patterns of age and sex prevalence are known among residents of clonorchiasis endemic areas. The rates are generally higher in men than in women, and higher in adults than in children (Rim, 1982a; De et al., 2003). For example, men 25– 55 years old and women over 45 years are the most highly affected groups in Guangxi Province, China (Chen et al., 1994) and Vietnam (De et al., 2003). This probably reflects the behavior pattern of men, who more often gather together for dinners of raw or pickled fish (usually accompanied by alcohol) than to any biochemical or physiological differences between genders. However, in contrast to C. sinensis, no significant differences are generally seen between men and women in the infection rates of O. viverrini. One factor may be that in Thailand, mothers frequently feed raw or partly cooked fish to infants, and this may explain the lack of gender differences, along with the widespread consumption of food dishes such as Koi Pla (Sithithaworn and Haswell-Elkins, 2003). As with C. sinensis, the infection pattern of O. viverrini indicates that initial infections in people occur at a very young age and rise rapidly with age, remaining remain relatively high throughout life (Upatham and Viyanant, 2003). The role of reservoir hosts, especially cats, dogs, and pigs, in maintaining liver fluke endemicity has been investigated (Chen et al., 1994; WHO, 1995; Sithithaworn and Haswell-Elkins, 2003), but, there is no consensus on their importance in transmission risk to humans (Rim, 1986; WHO, 1995; MasComa and Bargues, 1997; De et al. 2003; Sithithaworn and Haswell-Elkins, 2003). In some areas, infection may be high among people and low among domestic animals and vice versa (China), but in other endemic areas these reservoir hosts may also have infection rates comparable to that in humans (WHO, 1995; Mas-Coma and Bargues, 1997; De et al., 2003). This is not a trivial issue because the role of reservoir hosts may have an important bearing on the outcome of control programs. The transmission of O. viverrini cercariae is often seasonal particularly where changes in rainfall and temperature are marked. In Thailand, for example, peak local contamination of local water bodies, and associated snail infections, occurs at the height of the rainy season when surface human and animal fecal contamination and household effluents are washed into ponds, streams and lakes (Sithithaworn and Haswell-Elkins, 2003). Consequently, transmission of O. viverrini to fish, and subsequently humans, may be highest just after the peak of monsoon flooding when intermediate hosts are abundant (Vichasri

232

Emerging foodborne pathogens

et al., 1982). This has prompted strategic control designs that attempt to exploit this seasonal variability by intervening in the transmission cycle when the parasite transmission and abundance is at its lowest and most vulnerable. Seasonal effects on the transmission of C. sinensis are also known; cercarial transmission occurs from May to October in Korea, and between March to October in Taiwan, a more southerly latitude (Mas-Coma and Bargues, 1997). Temperature is the primary determinant and manifests its effect in regulation of snail development (Japan) and/or directly on the parasite’s intra-snail stages (Korea) (Rim 1982a). Overall, the epidemiology of O. felineus is similar to that of the other liver flukes. Man and alternate hosts are infected by consumption of raw or insufficiently cooked or processed fish; in this zoonosis, consumption of even poorly prepared dried fish or fish pickled in garlic juice are potential sources of infection. A recent report described an outbreak of acute opisthorchiasis in a Western European family who ate raw fish exported from Siberia, attesting to the hardiness of the metacercaria and the risk in uninspected fish exports (Yossepowitch et al., 2004). Disease and treatment Diagnosis of liver fluke infections can be made by the recovery of eggs from feces. However, the eggs must be differentiated from those of other trematodes, a task which requires considerable training and experience, and even then the lack of specific diagnostic tools such as molecular probes presents a challenge (Lee et al., 1984; Ditrich et al., 1992). Serological tests such as ELISA using excretory-secretory antigens are helpful in some cases (Choi et al., 2003). There is interest in developing specific molecular or immunological methods to aid this task, but such methods have not yet appeared or gained acceptance (Wongratanacheewin et al., 2003). However, progress in this area is encouraging, for example a PCR-based technique to detect snail and fish infections with O. viverrini has been developed (Maleewong et al., 2003). There are a number of gene sequences now published in Gene Bank, which should spur development of needed diagnostic tools. The hepatic lesions and clinical manifestations in infected people are similar for all the liver fluke infections (Table 9.3) (Rim, 1982b; Beaver and Cupp, 1984). Complications such as pyogenic cholangitis, biliary calculi, cholecystitis, liver cirrhosis, pancreatitis, and cholangiocarcinoma, are often associated with infection (Sripa, 2003). Among these, cholangiocarcinoma is the most serious (Watanapa and Watanapa, 2002; WHO, 2004b). It arises from metaplastic changes of biliary epithelial cells and usually occurs in the secondary intrahepatic bile ducts where the flukes are preferentially situated (Chen et al., 1994). The contributing factors promoting carcinogenesis include ingestion of carcinogens or co-carcinogens, and host endogenous influences such as malnutrition, immunological defects, and genetic factors (Chen et al., 1994; WHO, 1994). However, the exact mechanisms of carcinogenesis are not clearly elucidated.

Table 9.3

Disease: clinical signs, symptoms and pathology, and diagnosis of selected foodborne helminth infections in humans Parasitological diagnosis2

Abdominal pain often localized to right hypochondrium. Anorexia and weight loss. Malaise, mild intermittent fever, mild hapatomegaly, jaundice. Biliary abnormalities, necrotic lesions in hepatic tissue, fibrosis of biliary ducts. Ultrasonography available for monitoring fascioliasis (Richter et al., 1999).

Examination of stool samples for eggs. Difficult to distinguish eggs of F. gigantica from F. hepatica. ELISA (Enzyme-linked immunoabsorbent assay).

Clonorchiasis Clonorchis sinensis3

Anorexia, abdominal pain, weakness and weight loss, diarrhoea. Jaundice, portal hypertension, gallstones. Ascites, gastrointestinal bleeding. Inflammation and hyperplasia of biliary epithelium. Cholengitis, cholecystitis, cholethiasis. Cholangiocarcinoma (Rim, 1986; IARC, 1994).

Detection of eggs in stool samples or biliary drainage. Difficult to distinguish from eggs of Orpisthorchis spp or small intestinal flukes. ELISA technology is useful provided cross reactivity with other species is considered.

Opisthorchiasis Opisthorchis viverrini4

Signs and symptoms similar to chlonorchiasis with chronic heavy infections – enlarged gall-bladder, cholecystitis, cholangitis, liver abscess, gallstone Cholangiocarcinoma (IARC, 1994).

Detection of eggs in stool samples or aspirates. Difficult to distinguish from eggs of C. sinensis or small intestinal flukes. ELISA technology is useful provided cross reactivity with other species is considered.

TREMATODA (flukes) Liver flukes Fascioliasis Fasciola gigantica F. hepatica

Foodborne trematodes and helminths

Clinical signs, symptoms and pathology1

Helminthiasis (genus and species)

233

234

Table 9.3

Continued

Lung flukes Paragonimiasis Paragonimus westermani

Intestinal flukes Fasciolopsiasis Fasciolopsis buski

Metagonimiasis5 Metagonimus yokogawai

CESTODA (tapeworms) Taeniasis due to Taenia saginata

Clinical signs, symptoms and pathology1

Parasitological diagnosis2

Chest pain, rust-coloured sputum (haemoptysis). Fatigue, fever, focal haemorrhagic pneumonia. Granuloma formation and fibrotic encapsulation in lung parenchyma. Migration to ectopic sites. Cerebral paragonimiasis invariably fatal.

Detection of eggs in sputum and/or in stool samples. Haemoptysis may indicate tuberculosis; diagnostic confusion is problematic (Toscano et al. 1995).

Epigastric pain, may simulate peptic ulcer. Facial oedema. Uricarial lesions on body. Nausea, vomiting, diarrhoea.

Detection of eggs in stool samples. Eggs of F. buski may be confused with those of Fasciola spp.

Lethargy. Abdominal pain and diarrhoea. Symptoms related to villous atrophy and crypt hyperplasia.

Detection of eggs in stool samples but these are difficult to distinguish from eggs of C. sinensis, Opisthorchis spp and small intestinal flukes.

Nausea, decreased appetite, abdominal pain, constipation, vomiting. Headache, irritability, dizziness. Symptoms related to disturbance of mucosal architecture.

Detection of eggs in stool samples indicates presence of Taenia but does not identify species. Proglottids (usually present in stools if eggs are found) are

Emerging foodborne pathogens

Helminthiasis (genus and species)

Table 9.3

Continued

Rare complications resulting from proglottid migration to appendix, bile duct, pancreatic duct and peritoneal cavity (Kociecka, 1987a).

obviously morphologically different.

Taeniasis due to Taenia solium

Abdominal symptoms closely resemble those described for T. saginata. Health professionals should be alert to the problem of neurocysticercosis in areas where T. solium infection is endemic (Kociecka, 1987a).

See notes on T. saginata.

Cysticercosis (T. solium)

Neurocysticercosis associated with epilepsy, mental disorders. Ocular infection occurs frequently in children. Subcutaneous infection most common in SE Asia.

Neurocysticercosis requires MRI or CT scans to confirm. Multiple cysticerci infections usually produce antibody readily detected by ELISA or Western Blots.

Diphyllobothrium latum

Gastrointestinal disorders, including nausea, pain and diarrhoea. Infection infrequently induces macrocytic anaemia, caused by competitive utilization of B12 by tapeworm.

Identification of characteristic eggs in stool.

(1) Stomach anisakiasis. Gastric pain, nausea, occasional vomiting. Occult blood in gastric juice and faeces. Chronic infection generates granulomatous lesion. (2) Intestinal anisakiasis. Constant or intermittant obdominal pain, usually in lower right quadrant. Diarrhoea, fever, vomiting.

Parasitological diagnosis is difficult and not practical for public health programmes. Detection of worms by endoscopy or in biopsy samples.

NEMATODA (roundworms) Anisakiasis 6 Anisakis simplex et al.

235

Parasitological diagnosis2

Foodborne trematodes and helminths

Clinical signs, symptoms and pathology1

Helminthiasis (genus and species)

236

Table 9.3

Continued Clinical signs, symptoms and pathology1

Parasitological diagnosis2

Occult blood in faeces. Perforative peritonitis is a serious complication (Bier et al., 1987). Trichinellosis/trichinosis Trichinella spiralis

(1) Intestinal trichinellosis. Abdominal pain, diarrhoea. Prolonged diarrhea leads to weight loss (Kociecka, 1987b). (2) Tissue trichinellosis. Facial edema, especially periobital, muscle pain and swelling, weakness, fever, anorexia. Myocarditis often occurs, sometimes leading to sudden death (Bruschi and Murrell, 2002).

Enteral phase difficult to diagnose, mimics many other conditions (flu, bacterial enteritis, etc.). Hypereosinophilia characteristic, serology with ELISA, IFA and Western Blot very reliable. Muscle biopsy and histological exam, now rarely necessary.

1 Entry into the literature about the clinical signs, symptoms, pathology and diagnosis of foodborne helminth infections is provided by Mas-Coma and Bargues (1997), Pawlowski (1987) and WHO (1995). 2 The preparation and microscopic examination of human stools for the detection and identification of helminth eggs and larvae are described and illustrated by WHO (1994). Similar information about the detection of helminth eggs in the faeces of sheep, cattle, horses, pigs, dogs, cats, poultry and rodents are given by Thienpont et al. (1979). Detection of eggs is not possible until the end of the prepatent period of infection. Examination of more than one sample may be required. Knowledge of prevailing helminth infections should be noted. 3 IARC (1994), concluded that there is limited evidence in humans for the carcinogenicity of infection with C. sinensis. 4 IARC (1994), concluded that there is sufficient evidence in humans for the carcinogenicity of infection with O. viverrini and inadequate evidence in humans for the carcinogenicty of infection with O. felineus. 5 Metagonimiasis produces signs and symptoms characteristic of most disease accompanying infection with species of small intestinal flukes. 6 Anisakiasis produces signs and symptoms characteristic of habitual nematode parasites of fish-eating marine mammals (Bier et al. 1987).

Emerging foodborne pathogens

Helminthiasis (genus and species)

Foodborne trematodes and helminths

237

High incidences of cholangiocarcinoma, based on both necropsy and liver biopsy data, have been reported for O. viverrini. For instance, in Khon Kaen, northeastern Thailand, the incidence of cholangiocarcinoma is estimated to be 129 per 100,000 males and 89 per 100,000 for females, compared to 1–2 per 100,000 in western countries (Vatanasapt et al., 1990). Using hamsters as an experimental animal model, it was shown that chemical carcinogens such as dimethynitrosamine which is present in fermented fish including ‘Pla ra’ play the role of an ‘initiator’, and O. viverrini acts as a ‘promoter’ for the development of cholangiocarcinoma (Thamavit et al., 1994). The severity of the pathology is associated with both intensity and duration of infection and the location of the lesions (Rim, 1982b). In mild infections with less than 100 worms, the infection is usually asymptomatic. Several hundred to thousands of worms, however, can cause significant symptoms causing the patient to seek treatment. Jaundice, indigestion, epigastric discomfort, anorexia, general malaise, diarrhoea, and mild fever are common clinical symptoms (Rim, 1990). A large number of flukes can cause obstruction of the biliary tract. Based on 70 necropsy cases in Thailand, hepatomegaly was remarkable in most chronic and severe cases of opisthorchiasis, with marked dilatation and hypertrophy of the bile ducts (Sripa, 2003). Inflammation of the bile duct and cell infiltrations may be secondary to superimposed bacterial infections; suppurative cholangitis is frequently the end result and the infection may extend into the liver parenchyma causing hepatitis. Prevention and control Prevention and control approaches are more or less similar for all the liver flukes. The traditional human habit of eating raw or improperly cooked freshwater fish is a major reason for sustaining the zoonosis in endemic areas and a seemingly intractable obstacle to control; health education efforts aimed at changing such habits have not been very successful (Guoquing et al., 2001; WHO, 2004b). Currently, the major strategies for community prevention and control include fecal examination and treatment of individual cases with praziquantel (25 mg/kg, 3 times daily, for 2–3 days), health education to instill the need to consume only cooked fish, and environmental sanitation through the building and use of latrines in endemic areas. More recently, WHO (2004) has recommended mass chemotherapy of people at risk in endemic areas as the most practical and immediately effective control strategy. Mass chemotherapy with praziquantel (40 mg/kg in a single dose) is highly efficient and generally feasible to distribute (Lee et al., 1984). Until more such control programs are implemented, however, and followed over time, the long-term effectiveness of this approach may be problematic. Control efforts at interrupting transmission at the intermediate host level apparently have not been extensive to date, judging by the small number of published reports. Several projects have been conducted on pond fish production in China, utilizing snail control and drug treatment of infected members of the household, along with intensive health education of the community on

238

Emerging foodborne pathogens

the risks of eating raw fish. The effect on transmission over two years was mixed, however, with a decline in prevalence in people, but only a modest impact on snail populations, on the use of human feces as pond fertilizer and on the habit of eating raw fish (Guoqing et al., 2001). In Thailand, an FAOled HAACP approach to fish pond management was carried out that focused on water supply, fish fry, fish feed and pond conditions to eliminate contamination of the ponds with O. viverrini eggs and snail infections. A preliminary report indicated some success with this intensive effort, but a full assessment of its sustainability over a period of years is needed (Khamboonruang et al., 1997).

9.2.2

Plantborne liver flukes: Fasciola hepatica and F. gigantica.

Distribution and prevalence Fasciola hepatica and F. gigantica are the important disease-causing species of the trematode family Fasciolidae (Table 9.1). F. hepatica is widely distributed over Europe, southeast Africa, the Americas, Oceania, and Japan and F. gigantica is endemic in Africa, Asia, and Australia although both species coexist in some areas, notably SE Asia (Miyazaki, 1991). Human fascioliasis has been reported from over 60 countries (Table 9.2); WHO (1995) estimates that over 180 million people are at risk, and 2.4 million are infected with one of these species. In addition, livestock infections (ruminants such as cattle and sheep) are common and the cause of serious economic losses (MasComa and Bargues, 1997). Outbreaks are more common in this zoonosis in comparison to many other zoonotic parasitic diseases. For example, recent reports from Vietnam indicate new and expanding epidemic to F. gigantica (De et al., 2003). In an epidemic in Cuba in 1983, more than a 1000 F. hepatica cases were diagnosed (WHO, 1995). Formerly, large outbreaks (F. hepatica) were reported in Europe, especially France (reviewed by MasComa and Bargues, 1997). Several large endemic areas exist in South America, especially the Bolivian Altiplano where F. hepatica prevalences in humans of up to 70% have been reported (reviewed by Mas-Coma and Bargues, 1997). In Peru, there are estimates that as many as 750.000 people are infected (Kumar, 1999). Although human cases attributed to F. gigantica are fewer, infections may be common but unrecognized, either because of a milder form of liver disease, or less availablity of public health services (Mas-Coma and Bargues, 1997). Biology and life cycle The morphology and life cycle for both species of these fasciolids are similar; the similarities in eggs makes differential diagnosis in fecal specimens problematical. The adult worms are large leaf-shaped, broader anteriorly than posteriorly. F. hepatica measures 20–30 mm long and 8–13 mm wide. F. gigantica is larger, measuring 25–75 mm long and 5–12 mm wide. The

Foodborne trematodes and helminths

239

final hosts are mammals, especially ruminants, and occasionally dogs, cats, pigs, rodents, and man (Miyazaki 1991). The intermediate host is a freshwater snail (Fig. 9.2). When the eggs are deposited into water, they develop and release a ciliated miracidium, which swims about until it encounters a suitable snail, where upon it invades the snail’s tissues and develops to the redial stage, which in turn releases the swimming cercarial stage. The cercaria swims through the water and attaches to the underside of water plants, where it secretes a cyst wall, forming a cyst of about 0.25 mm in diameter, now termed the metacercarial stage. When the plant is eaten by a suitable defintive host, the metacercaria excysts in the intestine and penetrates through the intestinal wall, migrates through the abdominal cavity and eventually reaches the bile duct after migration through the liver parenchyma. The worm matures and begins reproduction after 2–3 months. Epidemiology Fascioliasis in humans results from eating raw aquatic plants such as water cress (Nasturtium officinale) and other acquatic plants such as parsley. In Bolivia, a plant referred to as ‘kjosko’ has been incriminated as a major source of infection (Kumar, 1999). There is some evidence that people may acquire the immature worms directly by eating raw intestine and liver of cattle (Miyazaki, 1991). Although the ingestion of watercress is undoubtedly a prime plant source, recent evidence indicates that people may also acquire infection by ingestion of unboiled drinking water (metacercaria can float if dislodged from the plant surface) or from metacercariae on cutting boards and other kitchen utensils (Mas-Coma and Bargues, 1997). Infection often shows familial clustering within communities and although generally there Immature eggs are passed in the host’s faeces

The eggs hatch in water, releasing miracidia parasites which invade an intermediate host (snail)

The parasites reproduce asexually, producing cercariae

The metacercariae excyst in the small intestine. The immature worms migrate through the intestinal wall, the peritoneal cavity and liver and, finally, into the bilary ducts where they reach sexual maturity (over 3–4 months)

The definitive host (e.g. herbivores or humans) is infected by eating vegetation containing metacercariae (e.g. watercress) The cerceriae encyst on aquatic vegetation, resulting in metacercariae

Fig. 9.2

Life cycle of Fasciola hepatica (the sheep liver flute).

240

Emerging foodborne pathogens

is little bias towards sex or age (Chen and Mott, 1990), there are instances in which children exhibit significantly higher prevalences, and may be the major source of egg contamination in the environment (Mas-Coma and Bargues, 1997; Esteban et al., 1997). The main reservoir hosts in the epidemiology of fascioliasis are sheep and goats; cattle are also important, but eventual acquisition of immunity to infection may render them less important in sustaining endemicity (MasComa and Bargues. 1997). The sources of infection for livestock are contaminated fodder, including rice straw and hay; because the snail hosts thrive in rice paddies, cercariae attach to rice plants (Miyazaki, 1991). Grazing in snail infested paddocks or pastures are also a high risk in endemic areas. Disease and treatment The migrating immature fluke may cause sever damage to the liver parenchyma, resulting in bleeding and scar formation (Miyazaki, 1991). When located in the bile duct, its mechanical and toxic effects may cause enlargement of the duct, thickening of the duct wall, and degenerative lesions in the liver tissue. Some worms may migrate into the liver parenchyma and form abcesses. The first symptoms, usually appearing between 4–6 weeks after infection (acute phase), are fever, sweating, abdominal pain, dizziness, cough, bronchial asthma, and urticaria (Table 9.3) (Mas-Coma and Bagrues, 1997; WHO, 1995; Chen and Mott, 1990). Chronic fascioliasis is generally considered asymptomatic, or when symptoms are reported, they are milder in form than that experienced during the acute phase, except in heavy infections; anemia is a prominent characteristic of chronic fascioliasis (WHO, 1995). Bithionol has, until recently been the drug of choice for killing the worms. However, a more effective drug, triclabendazole, is becoming more widely registered and recommended for human use. Albendazole is useful for animal treatment. Prevention and control Prevention ideally should be multi-pronged, aiming at both control of infection in domestic animals and humans. For the former, prevention should include control of snails in fields grazed by cattle or sheep and goats, and drying thoroughly the fodder harvested from fields known to harbour freshwater susceptible snail species. Rotation of pastures, drug treatment of animals, safe-disposal of animal manure (including composting and biological control of snails through introduction of ducks into the rice paddies after harvest to allow them to consume the snails) have been recommended to control transmission to livestock (Boray 1982; Mas-Coma and Bargues, 1997). Control of infection in humans can be achieved rather simply by preventing the consumption of raw watercress and other acquatic plants, especially in endemic zones (Mas-Coma and Bargues, 1997). This requires a health education program that effectively informs members of the community of the dangers of infection and of risky food habits. Commercial watercress production must also be carried out under carefully controlled conditions.

Foodborne trematodes and helminths

9.3

241

Detection

Different approaches to the detection and identification of foodborne helminths are required to cater to the needs of the different groups concerned with prevention, control and treatment. In choosing appropriate technologies, clinicians, public health officials, commercial food producers and researchers are advised to consider the following points. 1. Information about locally prevailing foodborne helminth infections acquired by Ministries of Health at hospitals or recorded in published biomedical literature will be useful. 2. Similar information should be sought by those responsible for the importation of food products from countries where the infections are suspected of being endemic. 3. The long-standing experience of local health professionals is a valuable resource for detection of foodborne helminth infections. 4. Detailed knowledge of the life histories, transmission routes and host ranges of the infections should be reviewed. 5. Familiarity with the accuracy and reliability of diagnostic techniques should be obtained and estimates of their cost-effectiveness in relation to available resources should be made. 6. If practical, application of more than one method of detection, such as comparing the results of stool examinations with the interpretation of clinical signs and symptoms, is desirable. 7. Databases concerning the detection of foodborne helminth infections should be established, maintained and placed in the public domain. Basic information about the detection of a selection of common foodborne helminth infections (Table 9.1) and the human diseases associated with them is given in Table 9.3. In most cases the collection and microscopic examination of stool samples remains the most realistic method of detection, particularly for public health programmes. This procedure, however, is not free from problems and pitfalls. Most importantly, failure to find eggs in a stool sample does not mean that the subject is free from infection and should not be assumed to be a negative result. If the infection is not patent (reproductive development of the helminths is not yet at the point when eggs are released), eggs will not be found. In patent infections consisting of very few worms, the numbers of eggs may be too few to be observed unless concentration methods have been used in the processing of samples before miscroscopic examination. The reliability of any diagnostic technique depends mainly on the skill and dedication of technical staff. Eggs in stool preparations may be missed when tiredness sets in. In large-scale programmes, stool samples may be wrongly identified or even substituted with samples from people outside the programme in an attempt to satisfy those in charge. A helpful critique of problems related to helminth detection is given by Mas-Coma and Bargues (1997).

242

Emerging foodborne pathogens

The WHO-recommended method for the examination of stools is the Kato Katz technique (WHO, 1994; Montresor et al., 2002) This procedure has been tested worldwide and has the advantage of facilitating egg counts (expressed as epg, eggs per gram). Egg counts provide an indirect measure of the intensity of infection; generally the higher the epg, the greater the number of worms present. There is now wide agreement that estimates of intensity provide information about the likelihood and severity of morbidity, the rate of transmission and the regulation of the population of helminth of interest (Anderson and May, 1992). The Kato Katz procedure readily lends itself to quality control whereby an independent observer can examine a selection of randomly chosen slides to see if the results tally with those of the first observer. Three other points should be noted regarding the detection and identification of foodborne helminth infections. First, reliance on clinical signs and symptoms alone may be misleading. Paragonimiasis has often been misdiagnosed as tuberculosis (Toscano et al., 1995). Secondly, finding eggs in stool samples may not allow identification. The assemblage of species of foodborne intestinal trematodes is extremely difficult to differentiate on the basis of egg morphology (Chai and Lee, 2002). Thirdly, detection becomes much more difficult and time consuming when the investigation of intermediate and reservoir hosts is necessary (see De et al., 2003).

9.4

Economic impact

Although scarce, published data indicates that infections with foodborne zoonotic helminths cause illnesses with medical costs and productivity and disability losses totalling millions, perhaps billions, of dollars annually. Until recently, the priorities given to these zoonotic diseases in either research or public health planning has not reflected their actual impact (Roberts et al., 1994). This results from a lack of international effort to assess their impact in terms of medical, productivity and commercial affects. In turn, efforts to do so are hindered by the lack of national assessments of the disease burdens due to generally insufficient surveillance and reporting in most endemic countries (Engels et al., 2003). However, at least partial appreciation for the economic impact (direct and indirect) of these helminthiases can be gained from the economic studies that have been published. Perhaps the most studied is the impact of cysticercosis and taeniasis. In an analysis by Roberts et al., (1994) for Taenia solium cysticercosis, it was estimated that for the USA the annual costs for hospitalization and wage losses, totalled US$8.8 million, the loss in Mexico was US$195 million and for Brazil, US$85 million. Mexico was also reported in the early 1980s to have incurred losses of US$43 million annually from condemned pork (Acevedo-Hernandez, 1982). In western and central Africa, it has been estimated that the losses from pork condemnation due to cysticercosis for ten countries

Foodborne trematodes and helminths

243

is about US$25 million annually (Zoli et al, 2003). In an earlier report by Mann (1983), it was claimed that Africa as a whole suffered losses exceeding US$1.8 billion due to loss of beef with T. saginata cysticercus infections. Infections with adult taeniid tapeworms (taeniasis) may also have some economic burden, although many believe that this stage is generally not clinically important. Fan (1997) reported that from an economic analysis it was apparent that the economic cost due to losses in work productivity, wages and medical care amounted to US$11.4 million in Taiwan, US$13.6 million on Cheju Island in Korea and US$2.4 million for the Indonesian island of Samosir; all three locations highly endemic for T. saginata asiatica. Trichinellosis, even in a developed country such as the USA, can be costly in spite of its very low prevalence (less than 0.01% pigs infected). The fewer than 100 human cases each year cost, in terms of medical care, as much as US$500,000 to US$800,000 each year. However, the most severe economic impact is in the threat of infection in pork, which the US National Pork Producers Council estimated in 1983 cost the industry more than US$400 million annually in decreased consumer demand, export losses, and cost to comply with federal regulations for processing pork (Murrell, 1991). Few attempts have been made to assess the economic impact of foodborne trematode infections. Roberts et al., (1994) estimated that opisthorchiasis (liver fluke disease) cost Thailand, in terms of medical care and wages and productivity losses, about US$100 million annually (1992 prices). Although similar data for human fascioliasis appears to be lacking, there have been a few reports on the economic impact of Fasciola hepatica infections on cattle and sheep (WHO, 1995). In Florida, studies revealed that infected calves had reduced weight gains of 8–28%. Economic losses in Peru to sheep fascioliasis were estimated to be US$11 million annually. Although impact assessments on the effect of fishborne helminths in commercial aquaculture are few, it is not difficult to predict these zoonoses will have serious economic consequences for some regions. It is forecast that future growth in aquaculture will be particularly great in Asia (which is highly endemic for these helminths) (WHO, 1999). It is likely that as the desire to export to meet the growing demand, especially for high-value products such as fresh fish fillets, the region will encounter greater concerns over food safety and quality. Food certification may become essential for economic success. Substantial efforts will be needed in low- and middle-income countries to ensure that their fish products are safe. This is a difficult and complex task, even for a high-income country. For example, in Canada, which has a high standard of food hygiene, its commercial fisheries industry must spend an estimated US$50 million each year to keep the codworm (Pseudoterranova decipiens) out of its fish (Deardorff and Overstreet, 1990).

244

Emerging foodborne pathogens

9.5

Prevention, control and treatment

When resources for health care are limited and priorities must be set as to how health budgets are to be used, decision makers are faced with difficult choices. A range of measures for the prevention, control and treatment of foodborne helminth infections are summarized in Table 9.4. Technical advice and guidance may be sought from staff at the World Health Organization.

9.6

Future trends

Appropriate measures need to be implemented to (i) reduce morbidity due to foodborne helminthiases (ii) reduce the risk of transmission of infection to people living in endemic areas and (iii) ensure that aquaculture products are safe for domestic consumption and export. The following recommendations arising from a joint WHO/FAO Workshop, held in Ha Noi in November 2002, on the theme of foodborne trematode infections provide a practical framework for future action. ∑ Access to essential drugs for the treatment of foodborne helminthiases should be provided in all health systems where the infections are endemic. ∑ Opportunities should be sought to disseminate health messages about the risks of consuming raw, pickled and undercooked foods known to be sources of infection. Health education must be sensitive to cultural norms and must not weaken food security. ∑ The public health significance of foodborne helminthiases should be assessed and placed in the order of priorities for attention. ∑ National control programmes will require thorough planning based on reliable epidemiological data and intersectoral co-operation. ∑ Opportunities should be sought to integrate actions for the control of foodborne helminth infections into existing public health programmes. ∑ Human and animal health professionals should be offered training in (i) diagnosis including the problem of misdiagnosis and (ii) the detection of drug resistance. ∑ Legislation may be needed to ensure best practice in commercial aquaculture regarding the production of food that is free from infection. Food certification will need to be developed, implemented and agreed by exporters and importers of products originating from countries with the potential to enter the global aquaculture market.

9.7

Acknowledgements

We thank Dr E Pozio for advice about the occurrence of Trichinella spiralis and Mrs Patricia Peters for editorial and secretarial skill with our drafts.

Table 9.4

Measures for the prevention, control and treatment of selected foodborne helminth infections1, 2

Helminth infection TREMATODA (flukes) Liver flukes5 Fasciola gigantica

F. hepatica (fascioliasis)

Opisthorchis viverrini6 (opisthorchiasis)

Lung flukes Paragonimus westermani7 (paragonimiasis)

Treatment (WHO, 2004a)4

Safe disposal of contaminated faeces. Best practice of animal husbandry. Snail control if practicable. Freshwater quality management. Preparation of dietary freshwater plants. Boil or purify drinking water.

Triclabendazole 250 mg tablets. By mouth, adult and child over 4 years, 10 mg/kg as a single dose, preferably with a fatty meal (Richter et al., 2002).

Safe disposal of contaminated faeces. Protect fish ponds from faecal contamination. Snail control if practicable. Freshwater management. Avoid eating raw or insufficiently cooked, pickled or smoked freshwater fish. Safe disposal of contaminated faeces. Protect fish ponds from faecal contamination. Snail control if practicable. Freshwater management. Avoid eating raw or insufficiently cooked, pickled or smoked freshwater fish.

Praziquantel 600 mg tablets. By mouth, adult and child over 4 years, 25 mg/kg 3 times daily for 2 consecutive days or 40 mg/kg as a single dose (also see Rim, 1986).

Praziquantel 600 mg tablets. By mouth, adult and child over 4 years, 25 mg/kg 3 times daily for 2 consecutive days or 40 mg/kg as a single dose.8

245

Avoid eating raw, pickled or undercooked crayfish and freshwater crabs. Avoid eating raw or undercooked wild boar meat, pork or chicken (Toscano et al., 1995).

Praziquantel 600 mg tablets. By mouth, adult and child over 4 years, 25 mg/kg 3 times daily for 2 consecutive days or 40 mg/kg as a single dose.

Foodborne trematodes and helminths

Clonorchis sinensis (clonorchiasis)

Prevention and control3

246

Table 9.4

Continued Prevention and control3

Treatment (WHO, 2004a)4

Intestinal flukes Fasciolopsis buski (fasciolopsiasis)

Safe disposal of contaminated faeces. Best practice of animal husbandy. Snail control if practicable.

Praziquantel 600 mg tablets. By mouth, adult and child over 4 years, 26 mg/kg as a single dose.

Freshwater quality management. Preparation of dietary freshwater plants. Boil or purify drinking water (Richter et al., 2002). ¸ Haplorchis taichui Ô Heterophyes heterophyes9 ˝ Metagonimus yokogawai Ô

Avoid eating raw or insufficiently cooked, pickled or smoked freshwater fish. Other preventive measures to control fish infection are those stated for C. sinensis.

Praziquantel 600 mg tablets. By mouth, adult and child over 4 years, 26 mg/kg as a single dose.

¸ Ô ÔÔ ˝ 10 Ô T. solium Ô (taeniasis, cysticercosis) Ô˛

Appropriate sanitation and safe disposal of human faeces; prevent exposure of pigs and cattle to human waste. Meat inspection for presence of cysticerci. Freeze to –25 ∞C for at least 10 days. Avoid eating raw or undercooked (rare) beef and pork (Kociecka, 1987a).

1. Niclosamide 500 mg chewable tablets By mouth, adult and child over 6 years, 2g after light breakfast, followed by a purgative after 2 hours. Child under 2 years 500 mg. 2–6 years 1g. Half dose may be taken before breakfast and half after in cases of T. saginata infections. 2. Praziquantel 600 mg tablets. By mouth, adult and child over 4 years, 5–10 mg/kg as a single dose.

˛

CESTODA (tapeworms) Taenia saginata

Emerging foodborne pathogens

Helminth infection

Table 9.4

Continued

Helminth infection

Prevention and control3

Treatment (WHO, 2004a)4 For cysticercosis, 50 mg/kg daily for 2 weeks. For neurocysticercosis, monitor by CT imaging.

Diphyllobothrium spp.

Praziquantel as a single dose of 5–10 mg/kg.

NEMATODA (roundworms) Anisakis simplex11 (anisakiasis)

Safe preparation of marine fish including prompt evisceration after capture, not smoking (> 60 ∞C), cooking (>70 ∞C), freezing (–25 ∞C for 7 days), marinade in brine (>20% for 10 days).

Extraction of the larval nematodes by endoscopy (Bier et al., 1987). WHO has not recommended anthelminthic treatment for anisakiasis.

Trichinella spiralis12, 13 (trichinellosis, trichinosis)

Best practice in pig husbandry. Meat inspection. Gamble et al., 2000. Cook meat (pork, wild boar, horse, game animals) to 70 ∞C or above. Freeze meat at –23 ∞C for 10 days. Adopt safe techniques for curing meat (Noeckler, 2003).

1. Albendazole 400 mg chewable tablets. By mouth, adult and child over 2 years. 400 mg daily for 3 consecutive days. 2. Mebendazole 100 mg chewable tablets. By mouth, adult and child over 2 years. 200 mg daily for 5 consecutive days.

Foodborne trematodes and helminths

Inspection of fish (candling). Heating to 56 ∞C for 5–10 minutes. Freezing to –23 ∞C for 7 days/–35∞C for 15 hours.

247

248

Table 9.4

Continued Prevention and control3

Treatment (WHO, 2004a)4 3. Pyrantel (embonate) 250 mg chewable tablets. By mouth, adult and child. 10 mg/ kg daily for 5 consecutive days.

1

Prevention and control depend on appropriate health education. Application of prevention and control measures should be related to prevailing climatic, ecological and parasitological conditions where infections are endemic. 3 Readers are advised to consult and apply the WHO golden rules for safe food preparation (see WHO, 1995). 4 In this table, details of the anthelminthic drugs and their use are extracted from the WHO Model Formulary (2004a). Precautions, contraindications and adverse effects are also described in this publication. Drugs must be of proven good quality before use. 5 Mas-Coma and Bargues (1997) summarize methods for the prevention and control of liver fluke infections and provide entry to relevant literature. 6 Opisthorchis felineus, a habitual parasite of fish-eating mammals, frequently infects humans. (Rim et al., 1994) and should be treated in the same manner as O. viverrini. 7 Paragonimus westermani is cited to represent the variety of species and sub-species of this group of lung flukes (Blair et al., 1999). 8 Treatment in hospital may be necessary if the Paragonimus infection involves the central nervous system. 9 These species represent the diversity of small flukes that infect the human small intestine (see Chai and Lee, 2002). 10 If humans swallow infective eggs of T. solium serious neurocysticercosis may develop if the parasite enters the central nervous system. 11 Anisakis simplex is cited to represent the variety of nematodes (‘aquatic ascarids’) including species in the genera Pseudoterranova, Contracaecum and Hysterothylacium (Bier et al., 1987). 12 Trichinella spiralis is cited to represent the variety of species and sub-species known to infect humans (Murrell et al., 2000). 13 During treatment of trichinellosis, prednisolone (40–60 mg daily) may be required to alleviate allergic and inflammatory symptoms (WHO, 2004a). 2

Emerging foodborne pathogens

Helminth infection

Foodborne trematodes and helminths

9.8

249

References

ACEVEDO-HERNANDEZ A

(1982). ‘Economic impact of porcine cysticercosis’, in Flisser, A, Willms, K and Laclette, J P, Cysticercosis: present state of knowledge and perspectives, New York, Academic Press. ANDERSON R M and MAY R M (1992). Infectious Diseases of Humans. Dynamics and Control, Oxford, Oxford University Press. BEAVER P C and CUPP E W (1984). Clinical Parasitology (9th ed.). Lea & Febiger, Philadelphia, pp. 1–825. BIER J W, DEARDORFF T L, JACKSON G J and RAYBOURNE R B (1987). ‘Human anisakiasis’, in Pawlowski Z S, Intestinal Helminthic Infections, Baillière’s Clinical Tropical Medicine and Communicable Diseases, London, Bailliere Tindall, 723–733. BLAIR D, XU ZHI BLAO and AGATSUMA T (1999). ‘Paragonimiasis and the genus Paragonimus’, Adv Parasitol, 42, 113–222. BORAY J.C (1982). ‘Fascioliasis’, in Hillyer, G and Hopia, CE (eds) Handbook Series in Zoonoses. Section C. Parasitic Zoonoses, Vol. III, CRC Press, Boca Raton, Florida, 71–88. BRUSCHI F and MURRELL K D (2002). ’New aspects of human trichinellosis: the impact of new Trichinella species’, Postgrad Med J, 78, 15–22. CHAI J-Y and LEE S-H (2002). ‘Food-borne intestinal trematode infections in the Republic of Korea’, Parasitol Int, 51, 129–154. CHAI J-Y, MURRELL K D and LYMBRY A (2005a). ‘Fishborne parasitic zoonoses: status and issues’. Int. J Parasitol, 35 (Supplement 11–12), 1233–1254. CHAI J-Y, PARK J H, HAN E T, GUK S M, SHIN E H, LIN A, KIM J L, SOHN W M, YONG T S, EOM K S, HWANG E H, PHOMMASACK B, INSISIENGMAI B and RIM H J (2005b). ‘Mixed infections with Opisthorchis viverrini and intestinal flukes in residents of Vientiane Municipality and Saravane Province in Laos’, J Helminthol, 79, 283–289. CHEN M G and MOTT K E (1990). Progress in assessment of morbidity due to Fasciola hepatica infection: a review of recent literature. Trop. Dis. Bull, 87, R1-R38. CHEN M G, LU Y, HUA X, MOTT K E (1994). Progress in assessment of morbidity due to Clonorchis sinensis infection: a review of recent literature. Trop. Dis. Bull, 91, R7R65. CHOI M H, PARK I C, LI S, HONG S T (2003). ‘Excretory-secretory antigen is better than crude antigen for the serodiagnosis of clonorchiasis by ELISA’,. Korean J. Parasitol, 41, 35–39. COOMBS I and CROMPTON D W T (1991). A Guide to Human Helminths, London and Philadelphia, Taylor & Francis Ltd. CRAIG P S, ROGAN M T and ALLAN J C (1996). ‘Detection, screening and community epidemiology of taeniid cestode zoonoses: cystic echinococcosis, alveolar echinococcosis and neurocysticercosis’, Adv Parasitol, 169–250. CROMPTON D W T (1999). ‘How much human helminthiasis is there in the world?’ J Parasitol, 85, 397–403. CROSS J (2001). ‘Fish- and invertebrate-borne helminths’, in Hui Y H, Sattar S A, Murrell K D and Stanfield P S, Foodborne Diseases Handbook, New York, Marcel Dekker Inc. DE N V, MURRELL K D, CONG L D, CAM P D, CHAU L V, TOAN N D and DALSGAARD A (2003). ‘The food-borne trematode zoonoses of Vietnam’, Southeast Asian J Trop Med Public Health, 34 (Supplement), 12–34. DEARDORFF T L and OVERSTREET R M (1990). ‘Seafood-transmitted zoonoses in the United States: the fishes, the dishes, and the worms’, in Ward, D and Hackny, C R, Microbiology of Marine Food Products, New York, Van Nostrand and Reinhold. DICK T A, NELSON P A and CHOUDHURY A (2001). ‘Diphyllobothriasis: update on human cases, foci, patterns, and sources of human infection and future considerations’, Southeast Asian J Trop Med Public Health, 32, Supplement 2, 59–76.

250

Emerging foodborne pathogens

DITRICH O, GIBODA M, SCHOLTZ T, BEER S A

(1992). Comparative morphology of eggs of the Haplorchiinae (Trematoda: Heterophyidae) and some other medically important heterophyid and opisthorchiid flukes. Folia Parasitol, 39, 123–132. DUPOUY-CAMET J (2000). ‘Trichinellsosis: a worldwide zoonosis’, Vet Parasitol, 93, 191– 200. EDDI C, NARI A and AMANFU W (2003). ‘Taenia solium cysticercosi/taenisosis: potential linkage with FAO activities: FAO support possibilities’, Acta Trop, 87, 145–148. ENGELS D, URBANI C, BELOTTO A, MESLIN F and SAVIOLI L (2003). ‘The control of human (neuro)cysticercosis: which way forward?’, Acta Trop, 87, 177–182. ESTEBAN J G, FLORES A, ANGLES R, STRAUSS W, AGUIRRE C and MAS-COMA S (1997). ‘Presence of very high pevlence and intensity of infection with Fasciola hepatica among Aymara children from Northern Bolivian Altiplano’. Acta Trop, 66. 1–14. FAN P C (1997). ‘Annual economic loss by Taenia saginata asiatica taeniasis in three endemic areas of East Asia’, Southeast Asian J Trop Med Public Health, 28, Supplement 1, 217–221. GAMBLE H R, BESSONOV A S, CUPERLOVIC K, GAJADHAR A A, VAN KNAPEN F, NOECKLER K, SCHENONE H and ZHOU X (2000). ‘International Commission on Trichinellosis: Recommendations on methods for the control of trichinella in domestic and wild animals intended for human consumption’, Vet Parasitol, 93, 393–408. GUOQING L, XIAOZHU H, KANU S (2001). ‘Epidemiology and control of clonorchiaisis sinensis in China’, Southeast Asian J. Trop. Med. Public Health, 32(Suppl. 2), 8–11. HONG S T (2003). Clonorchis sinensis, in Miliotis, M D and Bier, J W (ed), International Handbook of Foodborne Pathogens. New York, Basel, Marcel Dekker, Inc., pp. 581– 592. IARC (1994). IARC Monographs on the evaluation of carcinogenic risks to humans, Volume 61, Liver Flukes, Geneva, World Health Organization. ISHAKURA H, TAKAHASHI S, YAGU K, NAKAMURA K, KON S, MATSURA A, KIKUCHI K (1998). ‘Epidemiology: Global aspects of anisakidosis’, in Tadi I, Kojima S and Tsuji M, Proceedings, ICOPA IX, Monduzi Editore Sp A, 379–382. KAEWKES S (2003). ‘Taxonomy and biology of liver flukes’, Acta Trop, 88, 177–186. KEYMER A (1982). ‘Tapeworm infections’, in Anderson R M, Population Dynamics of Infectious Diseases, London, Chapman and Hall, 109–138. KHAMBOONRAUNG C, KEAWVICHIT R, WONGWORAPAT K, SUWANRANGSI S, HONGPROMYART M, SUKAWAT K, TONGUTHAI K, LIMA DOS SANTOS A A M (1997). ‘Application of hazard analysis critical control point (HAACP) as a possible control measure for Opisthorchis viverrini infection in cultured carp (Puntius gonionotus)’. Southeast Asian J. Trop. Med. Public Health 28 (Suppl. 1), 65–72. KOCIECKA W (1987a). ‘Intestinal cestodiases’, in Pawlowski Z S Intestinal Helminthic Infections, Baillière’s Clinical Tropical Medicine and Communicable Diseases, London, Baillière Tindall, 677–694. KOCIECKA W (1987b). ‘Intestinal trichinellosis’, in Pawlowski Z S, Intestinal Helminthic Infections, Baillière’s Clinical Tropical Medicine and Communicable Diseases, London, Baillière Tindall, 755–763. KUMAR V (1999). Trematode Infections and Diseases of Man and Animals. Boston, Kluwer Academic Publishers, 363 pp. LEE S H, HWANG S W, CHAI J Y, SEO B S (1984). ‘Comparative morphology of eggs of heterophyids and Clonorchis sinensis causing human infections in Korea’, Korean J. Parasitol, 22, 171–180. MACLEAN J D, CROSS J and MAHANTY S (1999). ‘Liver, lung and intestinal fluke infections’, in Guerrant R L, Walker D H and Weller P F, Tropical Infectious Diseases, Philadelphia, Churchill Livingstone. MALEEWONG W, INTAPAN P M, WONGKHAM C, WONGSAROJ, T., KOWSUWAN T, PUMIDONMING W, PONGSASKULCHOTI P , KITIKOON V (2003). ‘Detection of Dpisthorchis viverrini in experimentally infected bithynid snails and cyprinoid fishes by a PCR-based method.’, Parasitology, 126, 63–67.

Foodborne trematodes and helminths

251

(1983). ‘Environmental hygiene and sanitation based on the concept of primary health care as a tool for surveillance, prevention and control of taeniasis/cysticercosis’, Curr Pub Hlth Res Topics, 36/83, 127–140. MAS-COMA S and BARGUES M D (1997). ‘Human liver flukes: a review’, Res Revs Parasitol, 57, 145–218. MAS-COMA S BARGUES M D and VALERO M A (2005). ‘Fascioliasis and other plant-borne trematode zoonoses’, Int J Parasitol, 35 (Supplement 11-12), 1255–1278. MIYAZAKI I (1991). Helminthic Zoonoses, Tokyo, International Medical Foundation of Japan. MONTRESOR A, CROMPTON D W T, GYORKOS T W and SAVIOLI L (2002). Helminth Control in School-age Children, Geneva, World Health Organization. MURRELL K D (1991). ‘Economic losses resulting from food-borne parasitic Zoonoses’, Southeast Asian J Trop Med and Public Health, 22, Supplement, 377–381. MURRELL K D (2002). ‘Fishborne zoonotic parasites: epidemiology, detection and elimination’, in Bremner H A, Safety and Quality Issues in Fish Processing, Cambridge, Woodhead Publishing Ltd. MURRELL K D, LICHTENFELS R J, ZARLENGA D S and POZIO E (2000). ‘The systematics of Trichinella with a key to species’, Vet Parasitol, 93, 293–307. NOECKLER K (2003). ‘Trichinella prevalence in the domestic and sylvatic cycle and its importance as a foodborne pathogen’, Helminthologia, 40, 103–108. OOI H K, CHEN C I, LIN S C, TUNG K C, WANG J S, KAMIYA M (1997). ‘Metacercariae in fishes of Sun Moon Lake which is an endemic area for Clonorchis sinensis in Taiwan’, Southeast Asian J Trop Med Public Health 28 (Suppl. 1), 222–223. PARK J H, GUK S M, KIM T Y, SHIN E H, LIN A, PARK J Y, KIM J L, HONG S T, CHAI J Y (2004). ‘Clonorchis sinensis metacercarial infection in the pond smelt Hypomesus olidus and the minnow Zacco platypus collected from the Soyang and Daechung Lakes,’ Korean J. Parasitol., 42, 41–44. PAWLOWSKI Z S (ed.) (1987). ‘Intestinal Helminth Infections’, in Baillière’s Clinical Tropical Medicine and Communicable Diseases, London, Baillière Tindall. PAWLOWSKI Z S and MURRELL K D (2001). ‘Taeniasis and cysticercosis’, in, Hui Y H, Sattar S A, Murrell K D, Nip W-K and Stanfield P S, Foodborne Diseases Handbook, New York, Marcel Dekker Inc. RICHTER J, FREISE S, MULL R K and MILLAN J C (1999). ‘Fascioliasis: sonographic abnormalities of the biliary tract and evolution after treatment with tricalbendazole’, Trop Med Int Health, 4, 774–781. RICHTER J, KNIPPER M, GOBELS K and HAUSSINGER D (2002). ‘Fascioliasis’, Current Treatment Options in Infectious Diseases, 4, 313–317. RIM H J (1982a). ‘Clonorchiasis,’ in Steele, J.H. (ed.), CRC Handbook Series in Zoonoses, Section C: Parasitic Zoonoses, Vol. III (Trematode Zoonoses). CRC Press, Boca Raton, Florida, pp. 17–32. RIM H J (1982b). ‘Opisthorchiasis,’ in Steele, J.H. (ed.), CRC Handbook Series in Zoonoses, Section C: Parasitic Zoonoses, Vol. III (Trematode Zoonoses). CRC Press, Boca Raton, Florida, pp. 109–121. RIM H J (1986). ‘The current pathobiology and chemotherapy of clonorchiasis’, Korean J Parasitol, 24, Supplement, Monograph Series No 3, 1–141. RIM H J (1990). ‘Clonorchiasis in Korea,’ Korean J. Parasitol., 28(Suppl.), 63–78. RIM H J, FARAG H F, SORNMANI S and CROSS J H (1994). ‘Food-borne trematodes: ignored or emerging’, Parasitol Today, 10, 207–209. ROBERTS T, MURRELL K D and MARKS S (1994), ‘Economic losses caused by foodborne parasitic diseases’, Parasitol Today, 10, 419–423. SCN (2004), 5th Report on the World Nutrition Situation, Standing Committee on Nutrition, Geneva, World Health Organization. SITHITHAWORN P and HASWELL-ELKINS M (2003). ‘Epidemiology of opisthorchiasis.’ Acta Trop., 88, 187–194. MANN I

252

Emerging foodborne pathogens

(2003). ‘Pathobiology of opisthorchiasis: an update. Acta Trop., 88, 209–220. (1947). ‘This wormy world’, J Parasitol, 33, 1–18. STÜRCHLER D (1988). Endemic Areas of Tropical Infections, 2nd edition, Toronto, Hans Huber Publishers. THAMAVIT W, PAIROJKUL C, TIWAWECH D, SHIRAI T, ITO N (1994). ‘Strong promoting effect of Opisthorchis viverrini infection on dimethynitrosamine-initiated hamster liver.’ Cancer Lett, 78, 121–125 THIENPONT D, ROCHETTE F and VANPARIJS O F J (1979). Diagnosing Helminthiasis through Coprological Examination, Beerse, Belgium, Janssen Research Foundation. TOSCANO C, YU SEN HAI, NUNN P and MOTT K E (1995). ‘Paragonimiasis and tuberculosis– diagnostic confusion: a review of the literature’, Trop Dis Bull, 92, R1-R26. UPATHAM E S, VIYANANT V (2003). ‘Opisthorchis viverrini and opisthorchiasis: a historical review and future perspective’, Acta Trop, 88, 171–176. VATANASAPT V, TANGVORAPHONKCHAI V, TITAPANT V, PIPITGOOL V, VIRIYAPAP D and SRIAMPORN S, (1990). ‘A high incidence of liver cancer in Khon Kaen Province, Thailand’, Southeast Asian J. Trop. Med. Public Health 21, 489–494. VICHASRI S, VIYANANT V, UPATHAM E S (1982). ‘Opisthorchis viverrini: intensity and rates of infection in cyprinoid fish from an endemic focus in northeast Thailand’. Southeast Asian J. Trop. Med. Public Health, 13, 138–141. VON BONSDORFF B (1977). ‘Diphyllothriasis in man’, Academic Press, London and New York, 1–189. WATANAPA P and WATANAPA W B (2002). ‘Liver-fluke associated cholangiocarcinoma’ Br J Surg, 89, 962–970. WHO (1994), Bench Aids for the Diagnosis of Intestinal Parasites, Geneva, World Health Organization. WHO (1995), Control of foodborne trematode infections, WHO Technical Report Series 849, Geneva, World Health Organization, 122–123. WHO (1999), ‘Food safety issues associated with products from aquaculture’. WHO Technical Report Series No 883, Geneva, World Health Organization. WHO (2000), Foodborne Disease. A Focus for Health Education, (Prepared by Yasmine Motarjemi), Geneva, World Health Organization. WHO (2004a), WHO Model Formulary 2004, Couper M R and Mehta D K, Geneva, World Health Organization. WHO (2004b). Report of Joint WHO/FAO workshop on food-borne trematode infections in Asia, Ha Noi, Vietnam, 26–28 November, 2002. WHO, WPRO, pp. 1–58. WONGRATANACHEEWIN S, SERMSWAN R W, SIRISINHA S (2003). Immunology and molecular biology of Opisthorchis viverrini in fection. Acta Trop. 88, 196–207. XU L Q, JIANG Z, YU S H, XU S, HUANG D, YANG S, ZHAO G, GAN Y, KANG Q and YU D (1995). ‘Nationwide survey of the distribution of human parasites in China’, Chinese J Parasitol Parasit Dis, 13, 1-7 (in Chinese). YOSSEPOWITCH O, GOTESMAN T, ASSOUS M, MARVA E, ZIMLICHMAN R, DAN M (2004). ‘Opisthorchiasis from imported raw fish,’ Emerg. Infec. Dis., 10, 2122–2126. ZOLI A, SHEY-NJILA O, ASSANA E, NGUEKAM J-P, DORNY P, BRANDT J and GEERTS S (2003). ‘Regional status, epidemiology, and impact of Taenia solium cysticercosis in Western and central Africa’, Acta Trop, 87, 35–42. SRIPA B

STOLL N R

Emerging pathogenic E. coli

253

10 Emerging pathogenic E. coli G. Duffy, Ashtown Food Research Centre, Teagasc, Ireland

10.1

Introduction

Escherichia coli are facultatively anaerobic, non spore forming, Gram negative rods within the family Enterobacteriacea. They form part of the natural gastro-intestinal flora of man and warm-blooded animals. Although most E. coli are harmless commensal organisms, there are many pathogenic strains which can cause a variety of illness in man and animals. There are six recognised groups of pathogenic E. coli. Each group has different virulence traits and mechanisms of pathogenicity, many of which are host specific.

10.1.1 Enteropathogenic E. coli (EPEC) EPEC were the first group of E. coli recognised as a causative agent of diarrhoeal illness in humans (Bray, 1945). Symptoms in general appear about 12–36 h after ingestion and include vomiting and diarrhoea. Stools are rarely bloody. In infants the disease can be severe lasting longer than two weeks. The pathogenic mechanisms of this group of organism are linked to their ability to adhere to and invade epithelial cells inducing characteristic attaching and effacing lesions (Donnenberg et al., 1989). The major O groups within this group which are linked to human illness include O55, O86, O111, O119, O126, O127, O128 and O142 (Williams et al., 1997). Through volunteer feeding studies the infectious dose of EPEC in healthy adults has been estimated to be 106 organisms. Food and water have been implicated as vectors of this pathogen and cases are most common in underdeveloped countries where sanitation and water quality may be poor.

254

Emerging foodborne pathogens

10.1.2 Enterotoxigenic E. coli (ETEC) ETEC were first recognised as a causative agent of diarrhoea in the 1960s and 1970s, (Smith and Gyles, 1970). The illness they cause usually occurs between 12 and 36 h after ingestion and symptoms can range from mild diarrhoea to a severe cholera-like illness with diarrhoea characterised by watery stools accompanied by vomiting and severe stomach pains. Symptoms normally persist for two to three days. In humans, ETEC can colonise the small intestine and produce heat stable (ST) and heat labile (LT) toxins (Smith and Gyles, 1970). Serotypes which cause illness in humans include O6, O8, O15, O25, O78, O148, O159 and O167. Fimbrial colonisation factors/ antigens (CFAs) play an important role in pathogenicity and they display a high degree of host specificity, thus strains which are pathogenic in animals generally do not cause illness in humans and vice versa (De Graff and Gasstra, 1997). The infective dose of ETEC for adults has been estimated to be at least 108 cells; but the young, the elderly and the infirm may be susceptible to lower levels. ETEC is thought to be a common cause of traveller’s diarrhoea resulting from consumption of contaminated water or food, and has been linked with gastroenteritis outbreaks on cruise ships. For instance, an investigation of recent outbreaks of ETEC on three cruise ships indicated that all were associated with consuming beverages with ice cubes on board the ship (Daniels et al., 2000).

10.1.3 Enteroinvasive E. coli (EIEC) Infection with EIEC results in an illness with the classical symptoms of invasive bacillary dysentery similar to that caused by Shigella species. Onset of illness occurs about 24 h post ingestion and clinical features include fever, severe abdominal pains and watery diarrhoea followed by the passage of bloody stools. Pathogenicity is related to the ability to invade and multiply within epithelial cells in the colon, a trait which is correlated with the presence of a large (140 MDa) plasmid that is also found in Shigella. The infective dose appears to be substantially higher than for Shigella and this may be related to the greater sensitivity of EIEC to gastric acidity. Volunteer feeding studies showed that at least 106 EIEC organisms are required to cause illness in healthy adults. Serotypes implicated in human illness include O6, O15, O25, O78, O148 and O159. Food and water may be vectors of EIEC and there have been some large outbreaks associated with this group of E. coli. In the USA, 227 became ill, in 96 separate outbreaks from consumption of imported French Camembert or Brie Cheese contaminated with EIEC serogroup 0124 (Tulloch et al., 1973). Another outbreak occurred on a cruise ship from consumption of potato salad contaminated with EIEC (Snyder et al., 1984).

10.1.4 Enteroaggregative E. coli (EAggEC) This group of E. coli was previously categorised as EPEC but differs from

Emerging pathogenic E. coli

255

this group in terms of their ability to produce a pattern of aggregative adherence on Hep 2 cells. They have also been reported to produce a heat stable enterotoxin called EAST 1 (Savarino et al., 1991). While they have been associated with chronic diarrhoea in children there importance as a foodborne pathogen is limited.

10.1.5 Enterohaemorrhagic E. coli (Verocytotoxigenic E. coli) Enterhaemorrhagic group of E. coli (EHEC) cause an illness characterised by severe bloody diarrhoea. They are more commonly referred to as verocytotoxigenic (VTEC) as they produce a toxin which has a cytotoxic effect on vero cell lines. Escherichia coli O157:H7 is the most notorious of this group of pathogenic E. coli and was first implicated in infectious disease in 1982 (Riley et al., 1983). It is now recognised as an important cause of food/waterborne illness in industrialised countries. It is a newly evolved serotype of E. coli which has become pathogenic through the acquisition of a number of virulence factors. Genetic analysis has shown that E. coli O157:H7 is clonally distinct from other verocytotoxin (VT)-producing serotypes but closely related to serotype O55:H7, a non VT-producing clone associated with infantile diarrhoea. Serotype O55:H7 has some pathogenic characteristics, such as the intimin gene, but most strains do not posses the EPEC plasmid. Serotype O55:H7 is reported to have acquired the capability for producing VT and adhesins via horizontal genetic transfer from other pathogens and by recombination. Acquisition of a new serogroup antigen (O157) led to the emergence of a new and highly virulent pathogen (E. coli O157:H7). The symptoms of infection from this group of organisms includes watery diarrhoea which may develop into bloody diarrhoea (haemorrhagic colitis) and severe abdominal pain. Haemolytic uraemic syndrome (HUS), a cause of acute renal failure, may be a complication of the illness, and neurological problems in the form of Thrombotic thrombocytopaenic purpura (TTP) may also occur resulting in a fatality rate of approximately 5% in those patients with acute forms of the illness. Immuno-compromised patients, young children and the elderly are at particular risk of developing HUS (Coia, 1998). The pathogen has an incubation period of 1–14 days with an illness duration of 5–7 days posing epidemiological problems in tracing and controlling sources of infection. The infectious dose for O157:H7 is estimated to be 10–100 cells; but no information is available for other EHEC serotypes (Teunis et al., 2004). Pathogenicity is related to the ability of the organism to adhere to and colonise the human large intestinal epithelial tissue destroying the microvilli by forming attachment and effacing (AE) lesions and the production of verocytotoxins. A large outer membrane protein (94-97 KDa) called intimin mediates the intimate contact between the bacteria and the enterocyte cytoplasmic membrane (attachment) and the destruction of the enterocyte microvilli (effacement). The genetic determinants for AE lesion formation

256

Emerging foodborne pathogens

(eae, tir, esc and sep genes) are grouped together on the chromosome forming a pathogenicity island (Pai III) called LEE, for Locus of Enterocyte Effacement (Kaper et al., 1998). The eae gene encodes for intimin, which is responsible for the intimate attachment and at least five different forms (a, b, g, d, e) have been reported for VTEC strains (Law, 2000). The tir gene codes for a type III-secreted translocated intimin receptor (Tir protein). The esp genes code for type III-secreted translocated Esp proteins. There are however also reports of LEE negative E. coli O157 clones causing illness in humans (Paton et al., 1999) indicating that such strain express alternative adherence factors which allows them to colonise the intestinal tract. Saa an autoagglutinating adhesin produced by LEE negative strains was described by Paton et al., in 2001. A study on VTEC Escherichia coli of human and bovine origins detected more saa-positive strains from bovines than from humans and indicated no significant association between the saa gene and VTEC isolated from patients with HUS or diarrhoea patients compared to isolates from healthy controls (Jenkins et al., 2003a). The E. coli verocytotoxins are closely related to the Shiga toxin of Shigella dysenteriae. Two parallel nomenclature systems exist which are synonymous: the name verocytotoxins (VT) derived from their activity on Vero cells and the name Shiga toxins (Stx) based upon their similarity to the Shiga toxin. Verotoxins are typically bacteriophage encoded, and their production has been shown to be enhanced by prophage-inducing agents such as mitomycin C in a limited number of clinical STEC isolates. Low iron concentrations also reportedly enhances verotoxin production in some clinical isolates (Ritchie et al., 2003). There are two main classes of verotoxin: VT1, a homogeneous group of toxins, virtually identical to the Shiga toxin of Shigella and VT2, a heterogeneous group of toxins, more distantly related to the Shiga toxin. VT1 has been described in association with disease in calves and to a lesser extent in humans. VT2 and a number of VT2 variants have been described which are distinguishable by PCR only, amongst them VT2 and VT2c variants are the most important in HUS in humans. E. coli O157 with eae and VT2 are most often associated with HUS in patients (Beutin et al., 2002; Werber et al., 2003). The role of other VT2 variants in human illness is either less severe or still unclear, they include Vt2d which is associated with VTEC from sheep; VT2e which is primarily responsible for the oedema disease syndrome in piglets (Pierard et al., 1998) and Vt2f which has been isolated from pigeons (Schmidt et al., 2000). Sequence analysis of the large pO157 plasmid has shown a number of gene clusters which have yet to be identified and the full role of plasmids in pathogenesis is still unclear. Non-O157 VTEC, in particular serogroups O26, O111, O103 and O145, are increasingly linked to human illness causing a similar illness to O157:H7. Molecular analysis of a wide range of diseasecausing VTEC serogroups has shown considerable variation among VTEC with respect to their complement of virulence factors. Variations in gene subtypes, e.g., intimin and vt genes, integration sites for the LEE pathogenicity

Emerging pathogenic E. coli

257

island, and in plasmid-encoded virulence factor complement, have all been reported (Schmidt et al., 2001). In some non-O157 VTEC, an additional virulence factor, termed high pathogenicity island (HPI), has been identified. It was surmised that this HPI has also been disseminated in clonal VTEC subgroups by horizontal gene transfer (Karch et al., 1999). Jenkins et al., (2003b) subtyped virulence genes in non-O157 Escherichia coli (VTEC) associated with disease in the United Kingdom and reported that strains that carried gene subtypes vtx(2) and vtx(2c) were most commonly associated with HUS, whereas strains from patients with less severe disease and from the healthy control group were more likely to have vtx(1c) or vtx(2d) genes. The eae gene was detected more frequently in strains isolated from HUS patients than in those associated with cases of diarrhoea and b intimin was the most common intimin subtype in strains isolated from both groups of patients while none of the strains from the healthy control group carried the eae gene. This is a similar pattern to that observed in O157 isolates as described above. Thus VTEC are a heterogeneous group of E. coli strains containing diverse virulence factors and of high public health importance.

10.1.6 Necrotoxigenic E. coli (NTEC) In 1983, Caprioli et al. described a cytotoxin produced by an Escherichia coli strain isolated from infant enteritis which causing multinucleation and enlargement in HeLa cells cultures and necrosis in rabbit skin. The factor was named cytotoxic necrotising factor or CNF and CNF-producing E. coli were later called necrotoxigenic E. coli (NTEC) (Gonzales and Blanco, 1989). Two types of cytotoxic necrotising factors (CNFs) have been described. CNF1 is chromosomally encoded while CNF2 is encoded by a gene located on a transferable F like plasmid called vir. NTEC 1 have been isolated from humans, cattle, piglets, dogs, horses suffering from diarrhoea, septicaemia, urinary tract infections, and internal organs infections (De Rycke et al., 1999). NTEC 2 have been isolated from cattle and sheep with diarrhoea and septicaemia (Blanco et al., 1996). The role of NTEC in causing human illness and the role of food as a vector has yet to be fully elucidated. Overall, in terms of public health importance in the developed world, VTEC are the most important of the pathogenic E. coli and the remainder of this chapter will overview the role of this group of pathogenic E. coli in relation of foodborne illness.

10.2

Detection methods

10.2.1 Cultural Routine cultural techniques for VTEC still focus almost exclusively on the detection of E. coli O157:H7. A standarised cultural method (ISO method no. 16654: 2001) describes an enrichment, isolation and confirmation for

258

Emerging foodborne pathogens

E.coli O157:H7 in foods. This method incorporates the use of immunomagnetic beads coated with antibodies against E. coli O157 and is now regarded as the most sensitive method for the isolation of the pathogen from food. The bead/ E. coli O157 complex is generally plated on Sorbitol McConkey agar (SMAC) which exploits the lack of sorbitol fermentation by E. coli O157:H7. The selectivity of SMAC for samples with a heavy amount of background contamination can be increased by the addition of cefixime and tellurite. Alternative differential media including 4-methylumbelliferyl-ß-D-glucoronide (MUG) agar and 5-bromo-4-chloro-3-indoyl-ß-D-glucoronide (BCIG) agar exploit the lack of ß-glucuronidase (GUD) activity (Restaino et al., 1999) while chromogenic agars including CHROM agar O157 and Rainbow agar can reportedly differentiate between O157 and other VTEC serotypes on a colour basis (Bettelheim, 1998a, b) Non-O157 VTEC strains display a heterogeneous range of genotypic and phenotypic properties and few laboratories routinely screen clinical or food samples for these emergent strains. Progress in the detection and wider surveillance of non-O157 VTEC has been increased by the development and wider availability of non-O157 (O26 and O111) antibody-labelled immunomagnetic beads. In addition, enrichment and plating media optimised for the detection of E. coli O26 and/or O111 from food samples have now been reported (Fukishma and Gomyoda, 1999; Safarikova and Safarik, 2001; Hiramatsu et al., 2002). A recent study by Catarame et al. (2003) compared a number of different enrichment conditions and plating media in combination with immunomagnetic beads for the recovery of E. coli O26 and E. coli O111 from minced beef. The optimum enrichment conditions for E. coli O26 were reported as Tryptone Soya Broth supplemented with cefixime (50mg l–1), vancomycin (40mg l–1) and potassium tellurite (2.5mg l–1) at 41.5∞C. Similar enrichment conditions were optimal for E. coli O111 with the omission of potassium tellurite. The optimum agar for recovery of E. coli O26 was MacConkey Agar (with lactose replaced by rhamnose (20g l–1)) supplemented with cefixime (50 mg ml–1) and potassium tellurite (2.5 mg l–1). Optimum recovery of E. coli O111 was on Chromocult Agar, supplemented with cefixime (50 mg ml–1), cefsulodin (5mg l–1) and vancomycin (8mg l–1). 10.2.2 Immunological methods A number of immunological techniques for VTEC have been developed based on the reaction between an antibody and the O surface antigens on VTEC or the verotoxins produced by these pathogens. These are generally incorporated into enzyme linked immunoassays (ELISA) and a number of commercial kits for serotype O157 are available. These systems generally require an enrichment period to increase pathogen numbers to a detectable level. Other ELISA based kits have been developed for the detection of verotoxin I and 2.

Emerging pathogenic E. coli

259

10.2.3 Molecular methods A number of nucleic acid based methods have been reported for the detection and characterisation of VTEC. The most commonly reported methods are based on the use of the polymerase chain reaction (PCR) to amplify a specific gene target in VTEC. The primers used in the PCR may detect a characteristic virulence factor in VTEC, i.e., vt1, vt2 or eae (intimin) gene sequences or may target a region of the O antigen. Closely related strains of E. coli have rfb genes encoding different O antigens (Stevenson et al., 1994) and this can be exploited to differentiate between different serogroups of VTEC. Genes targeted in recently developed protocols include verotoxin genes (Sharma and Dean-Nystrom, 2003). Species-specific targets include the rfbO157 gene of the O157 antigen (Paton and Paton, 1999) and wzx (O-antigen flippase) and wzy (O-antigen polymerase) for serogroups O26 and O113 (Debroy et al., 2004). Conventional PCR requires amplification of a target gene in a thermocycler, separation of PCR products by gel electrophoresis, followed by visualisation and analysis of the resultant electrophoretic patterns, a process that can take a number of hours. Real-time PCR is an automated PCR assay, which uses fluorescence to detect the presence/absence of a particular gene in real time. It has greatly increased the sensitivity and speed of PCR-based detection methods for the testing and identification of food pathogens from complex matrices. Real-time PCR methods have been developed for the detection of VTEC carrying the major associated virulence genes, i.e., eae, vt1 and vt2 (Sharma 2002; Bono et al., 2004; Fitzmaurice et al., 2004). O’Hanlon et al. (2004) have reported a real-time PCR assay, which targets serotypes specific targets O26 (fliC-fliA gene), O111 (wzy gene) and O157 (per gene) serotypes.

10.2.4 Typing Clinical and public health laboratories employ a range of epidemiological typing systems for VTEC based on phenotypic traits including biochemical and physiological features; and serotyping based on grouping of E. coli isolates by the O and H antigens (Chart and Jenkins, 1999). Bacteriophage typing is the most widely used conventional sub-typing method for E. coli O157 whereby the susceptibility of each isolate to lysis by a panel of bacteriophages is determined and the lytic patterns determine the bacteriophage typing. However, bacteriophage typing may not provide the level of discrimination required for epidemiological investigation and the technique is not applicable to non-O157 VTEC. More recently, the advent of high-resolution molecular methods which allow rapid and effective ‘molecular fingerprinting’ of pathogens has led to the wider application of techniques such as pulse field gel electrophoresis (PFGE). PFGE is the ‘gold standard’ of genetic fingerprinting methods for E. coli O157 and is frequently used in epidemiological investigations of outbreaks, to study relationships between human clinical isolates and isolates

260

Emerging foodborne pathogens

from suspect food sources. This method uses ‘rare-cutter’ restriction enzymes to generate a number of high molecular weight restriction fragments, which can be separated by gel electrophoresis under controlled conditions of direction and duration of the electric field. As the resulting electrophoretic patterns are highly specific for individual strains, and accurately reproducible among different laboratories, PFGE has become a standard technique among public health agencies. Other subtyping reported methods in use for VTEC include amplified fragment length polymorphism (AFLP), ribotyping and REP PCR (Hahm et al., 2003, Avery et al., 2002)

10.3

Sources of VTEC infection in humans

Outbreaks of VTEC infections involving serogroup O157 have now been reported from the United States and Canada (Tarr, 1995), Asia (Michino et al., 1998), Australia (Desmarchelier, 1996), Europe (Tozzi et al., 2001), and Africa (Isaacson et al., 1993, Germani et al., 1997). The cause of infection is wide and varied (Table 10.1). However, many cases of VTEC infection have been related to catered or mass-produced food distributed over a wide area. In 1996, an outbreak of E. coli O157:H7 in the western United States was linked to contaminated hamburgers from a single fast food chain in which over 700 people were affected with 55 cases of HUS and the death of four children (Bell et al., 1994). In 1996, a large outbreak of E. coli O157:H7 occurred in Lanarkshire in Scotland in which there were 496 cases with 20 fatalities. The outbreak was linked to cooked meat supplied by a butcher’s shop to a number of catered events including local parties and a retirement home (Ahmed and Donaghy, 1998). The largest outbreak related to E. coli 0157:H7 occurred in June–August 1996 among Japanese schoolchildren with over 6,000 affected and four fatalities (Michino et al., 1999). The source was white radish sprouts in centrally prepared school lunches. In southern Africa and Swaziland in 1992 an outbreak of E. coli O157:H7 affecting thousands was attributed to contamination of surface water with cattle dung and animal carcasses (Isacson et al., 1993). In all these outbreaks, a chain of events contributed to the outbreak including contaminated raw materials, cross contamination, inadequate cooking, wide distribution of the contaminated food, and consumption of the foods by groups with a higher risk for severe infection (i.e. children and elderly people). Dairy products (milk and cheese), both unpasteurised (McIntyre et al., 2002) and pasteurised (Goh et al., 2002) of bovine and ovine origin have been implicated in VTEC infection. This has included a number of outbreaks among children that have been attributed to the consumption of raw milk and dairy products (Allerberger et al., 2001). Water has been recognised as an important source of infection with a number of large associated outbreaks. In Walkerton, Ontario, Canada in May 2000 an estimated 2,300 people became seriously ill and seven died from exposure to E. coli O157:H7 contamination in the town’s public drinking

Table 10.1

Summary of some outbreaks of E. coli O157 and various sources of infection Reference

Year

Setting

No. of cases

No. of deaths

Likely sources or mode of transmission

USA UK (East Anglia) Scotland Canary Islands Japan (Sakai) USA (Connecticut) UK (Glastonbury) USA Ireland Canada (Ontario) UK (Wales) USA (Washington) Walkerton, Canada Scotland Cumbria, UK

Bell et al., 1994 Morgan et al., 1988 Ahmed and Donaghy, 1998 Pebody et al., 1999 Michino et al., 1999 Hilborn et al., 2000 Crampin et al., 1999 Breuer et al., 2001 O’Donnell et al., 2002 Anon. 1999a Anon 1999b Bruce et al., 2003 Hrudey et al., 2003 Strachan et al., 2001 Goh et al., 2002

1992–3 1985 1996 1997 1996 1996 1997 1997 1998 1999 1999 1999 2000 2000 1999

Regional Community Community International– tourists City Community Music festival Multi-state Childrens day care facility Fair visit Farm centre Community Community Scout camp Community

501 24 496 15 6,000 14 8 85 11 125 17 37 2,300 20 114

3 1 20 0 4 0 0 0 0 0 0 0 7 0 0

Hamburger Handling raw potatoes Cooked meat Well water supply to hotel Radish sprouts Unpasteurised apple cider Faecally contaminated mud Alfa-alfa sprouts Person to person Direct animal contact Direct animal contact Swimming in lake water Public water supply Faecally contaminated mud Pasteurised milk

Emerging pathogenic E. coli

Location

261

262

Emerging foodborne pathogens

water supply (Hrudey et al., 2003). In 1999, well water supplying a number of hotels in the Canary islands contaminated with E. coli O157:H7 resulted in an international outbreak amongst holidaymakers (Pebody et al., 1999). Other recognised transmission routes of infection include consumption and/or handling of fruit/vegetables/salads contaminated with faeces and manure (Hilborn et al., 1999). In the USA, a number of outbreaks have been attributed to consumption of unpasteurised apple cider (Hilborn et al., 2000). A further transmission now recognised as important is direct contact with animals or faecally contaminated mud through work or recreational activities such as swimming (Bruce et al., 2003), camping (Howie et al., 2003), attending country fairs (Crump et al., 2003) and young children visiting petting zoos (Heuvelink et al., 2002). In addition to outbreaks cases there are many sporadic cases on infection which contribute significantly to overall cases of infection. There is considerable variation in infection rates between different countries and regions. In Europe, the highest rates of infection are in the United Kingdom, ranging from around 1.5 cases per hundred thousand in England and Wales to approximately five cases per hundred thousand in Scotland (2001, 2002 data, SCIEH, 2003). In the Republic of Ireland the incidence per 100,000 was 1.7 in 2002 and 2.1 in 2003. (www.ndsc.ie). In northern Europe infection rates are very low ranging from 0.04 per 100,000 in Norway and Finland to 1.1 in Denmark in 2000. Similarly incidence rates are low in southern Mediterranean countries while in central Europe cases average around 1.3 per 100,000 in Germany to about 0.05 in France. In North America and Canada incidence rates of 1.1 in 2003 and three per 10,000 in 2001 were recorded respectively. In Asia, Japan has experienced the most problems related to E. coli O157:H7. Sporadic cases and outbreaks of non-O157 infection (mainly serotypes O111 and O26) have been described in a number of countries over the last ten years. Transmission routes of infection are similar to those reported for serotype O157:H7 including fermented sausage (Henning et al., 1998); water (Hoshina et al., 2001); children’s nurseries/creches (McMaster et al., 2001, Hiruta et al., 2001) and camping (Brooks et al., 2004).

10.4

Prevalence of VTEC

10.4.1 Prevalence of VTEC in cattle and derived beef and dairy products Cattle are regarded as one of main reservoirs of E. coli O157:H7 and the reported prevalence in cattle faeces ranges from 4.2% in England and Wales (Paibia et al., 2003); to 10.2% in the USA (Sargeant et al., 2003). E. coli O157:H7 has also been recovered from the rumen (Van Donkersgoed et al., 1999), hide and carcasses of bovine animals at beef slaughter (Elder et al., 2000; Arthur et al., 2004). A number of studies have also examined beef and beef products at retail for the presence of E. coli O157:H7. A study in the

Emerging pathogenic E. coli

263

Republic of Ireland examined 1500 retail beef samples (minced beef and beef burgers) and found 2.8% (43 samples) positive with counts ranging from <0.52–4.03 log10 cfu g–1 (Cagney et al., 2004). Vernozy-Rozand et al. (2002) reported 0.12% (4/3450) samples positive for E. coli O157:H7 in large-scale processed minced beef in France. Surveys of minced beef from butchers’ shops in a range of countries have reported E. coli O157:H7 contamination at 3.8% (6/160) in Argentina (Chinen et al., 2001); 2.3% (5/ 211) in Switzerland (Fantelli and Stephan, 2001); and 1.1% (36/3216) in the UK (Chapman et al., 2000). Non-O157 VTEC serotypes O26, O103, O111 and O145 have been from faeces of calves (Pearce et al., 2004). Serotypes O26 and O111 have been isolated from retail minced beef (Catarame et al., 2004) A USA study on raw bulk tank milk found E. coli O157:H7 in 1.68% of samples (Murinda et al., 2002) while a study in the Czech Republic also recovered the pathogen from raw milk (Lukasova et al., 2004). While unpasteurised cheese has been implicated in VTEC illness (Anon., 2000) it has generally not been detected in prevalence studies on this commodity (Coia et al., 2001).

10.4.2 Prevalence of VTEC in sheep and derived lamb products Sheep are also now recognised as an important route for transmission of VTEC to humans. A recent outbreak of E. coli O157:H7 in the UK was linked to direct contact with sheep faeces by young boy scouts camping on a field (Ogden et al., 2002). The prevalence reported in sheep faeces is variable ranging from 0.4% (Blanco et al., 1993) in a Spanish study to 1.7% in a UK study (Paiba et al., 2002). Chapman et al. (2001) reported an E. coli O157:H7 prevalence of 0.7% on lamb carcasses at slaughter and on 0.8% of lamb products sampled from butchers’ shops.

10.4.3 Prevalence of VTEC in pigs and derived pork products In pigs, VTEC can cause oedema and post-weaning diarrhoea generally linked to serotypes O138, O139 and O141 which are not implicated in human illness. A low prevalence of E. coli O157:H7 in pigs and pork products has been reported with a Dutch study finding 1.4% of pig faecal samples to be positive for E. coli O157:H7 (Heuvelink et al., 1999a) and a French study finding no VTEC in 1200 pork carcass samples (Bouvet et al., 2001). A similarly low prevalence of E. coli O157:H7 has been reported on raw pork sampled at retail, 1.3% (Heuvelink et al., 1999b).

10.4.4 Prevalence in other animals Non-ruminant animals, both wild (including birds and rodents) and domestic animals (cats and dogs) (Trevena et al., 1996) can carry VTEC and can play

264

Emerging foodborne pathogens

a role in transmission of infection. Wild bird droppings in particular may have a role in environmental transmission with VTEC reported in gulls in the UK (0.9–2.9% – O157:H7) (Wallace et al., 1997) and pigeons in Rome (Dell’Omo et al., 1998) (VTEC but no human pathogenic types)

10.4.5 Prevalence in salads and vegetables Produce (fruits, vegetable and salads) can be contaminated with VTEC from direct contact with faecally contaminated soil or run off water. While these commodities have all been implicated as transmission routes in human illness, snap shot prevalence studies have generally failed to detect the presence of the pathogen (Johannessen et al., 2002; Robertson et al., 2002).

10.4.6 Prevalence of VTEC in water As evidenced by the number of outbreaks of infection attributable to water, as discussed above, this is an important vector in the spread of VTEC. A study on surface water in Alberta found 0.9% of samples positive over a two year period contained E. coli O157:H7 (Johnson et al., 2003). The authors postulated that variations in time, amount, and frequency of manure application onto agricultural lands in the vicinity may have influenced levels of surfacewater contamination with the pathogen.

10.5

Survival, persistence and growth in the food chain

The survival characteristics of the VTEC organisms are generally similar to most other E. coli strains. Storage temperature, pH, water activity and salt content are the most important factors in relation to the survival and or growth of the pathogen in the food environment. Studies on maximum and minimum temperatures for growth of VTEC indicate that the pathogen grew at temperatures between 10 and 45 ºC with optimum growth at 37 ºC (Palumbo et al., 1995). The pathogen survives at food freezing temperatures (–20 ºC). In terms of acid tolerance, VTEC strains show acid tolerance at the extreme range for E. coli organisms and are capable of surviving at a pH of 2.5 (Waterman and Small, 1996) and as such may pose problems in ready to eat low pH foods. E. coli O157:H7 does not display any unusual tolerance to salt concentrations and can only grow in both at NaCl concentrations £ 6.5% (Glass et al., 1992).

10.5.1 Environment Numerous studies have reported on the survival of VTEC in the environment, particularly in cattle faeces, manures and slurries. In bovine faeces, at temperatures of 10 to 18 ∞C survival times are as long as 99 to 130 days

Emerging pathogenic E. coli

265

(Bolton et al., 1999) have been recorded. Studies on slurry have recorded E. coli O157:H7 survival in slurry for up to three months (McGee et al., 2001) Similar persistence has been reported in sheep manure with survival for 100 days at 4 or 10 ∞C reported by Kudva et al. (1998). However, E. coli O157:H7 has been shown to die off quickly (72 h) in cow manure composting at 45 ∞C (Lung et al., 2001).

10.5.2 Food At temperatures typically employed in food industry, including chilled storage, frozen storage and thermal destruction, VTEC display similar survival characteristics to other E. coli strains. The persistence of E. coli O157:H7 in a range of foods at some typical food storage temperatures is presented in Table 10.2. Because of its acid tolerance, E. coli O157:H7 poses a higher risk in traditional low pH ready to eat food products such as fermented meats, than other foodborne pathogens. A study by Riordan et al. (1998) investigated the growth and survival of E. coli O157:H7 during the manufacture of pepperoni. In a standard commercial pepperoni formulation (i.e. 2.5% salt, 100 ppm sodium nitrite, pH 4.8) E. coli O157:H7 numbers declined by only 0.41 log10 CFU/g during fermentation and a further 0.43 log10 CFU/g during subsequent drying (seven days) indicating that an initial control step during processing is needed to ensure the safety of such products.

10.6

Control measures

10.6.1 On farm and environmental controls VTEC survives well in animal faeces as outlined above, and can be recovered for extended periods ranging from several weeks to many months. Because of this persistence, faecal material is a very important potential vehicle for transmission within herds, farms, the retail fresh food chain, and the wider environment. Herd management practices including control of animal stocking, housing and grouping densities and feeding, can reportedly influence the transmission of VTEC among and between cattle herds (Synge et al., 2003; Rugbjerg et al., 2003). Appropriate handling or treatment of faeces is important to control spread of this pathogen and to limit the significant risks of human infection from direct contact with untreated manure or slurry through farming activities, or recreational contact with contaminated soil or water (camping, country fairs, swimming, etc.). In particular, animal waste applied to produce (vegetables, fruit, salads) for human consumption should be actively treated to reduce the risk of pathogen contamination. There are a number of reports in the literature of processes which can expedite the decline of pathogens including E. coli O157:H7 in animal waste including composting (Lung et al., 2001), heat drying and/or gassing with ammonia (Himathongkham and Riemann,1999) and anaerobic digestion (Bujoczek et al., 2001).

266

Survival of E. coli O157:H7 in a range of foods at typical chill and frozen storage temperatures

Food

Temperature (ºC)

Storage time

Initial population (log10cfu/g )

Surviving population (log10cfu/g)

Reference

Ground beef patties Ground beef patties Apple cider Artichokes Apples Strawberries Fermented dried sausage Mineral water Yoghurt

2 –20 4 4 25 –20 4 15 4

4 weeks 1 year 14 days 16 days 28 days 30 days 2 months 63 days 7 days

5.00 5.00 7.00 5.2 7.0 7.0 4.8 3.00 3.49

3.10 3.00 2.00 3.7 5.6 6.3 2.8 0.56 2.73

Ansay et al. (1999) Ansay et al. (1999) Roering et al. (1999) Sanz et al. (2003) Janes et al. (2002) Knudsen et al. (2001) Glass et al. (1992) Kerr et al. (1999) Massa et al. (1997)

Emerging foodborne pathogens

Table 10.2

Emerging pathogenic E. coli

267

Currently, research is addressing the possibility of vaccines for cattle with a view to preventing colonisation and carriage in such major reservoirs. Potter et al. (2004) have reported reduced shedding of Escherichia coli O157:H7 by cattle following vaccination with type III secreted proteins. While Dean-Nystrom (2002) has demonstrated using a pig model that vaccination with intimin may be an ideal candidate to inhibit E. coli O157 colonisation.

10.6.2 Food production The best approach to control VTEC during food production and distribution is the use of food safety management systems based on the principles of Hazard Analysis and Critical Control Points (HACCP) and these do not differ from general control measures used against other food pathogens. General controls Thermal inactivation Several publications have investigated the thermal resistance of E. coli O157:H7 in different matrices. Typical D-values (time at a particular temperature to achieve a 1 log reduction in viable numbers) for E. coli O157:H7 in a range of foods are presented in Table 10.3. Pasteurisation is recommended for all milk and dairy products to control the risk from E. coli O157:H7 in these ready-to-eat products. In addition, pasteurisation is recommended for fresh apple cider which is commonly consumed in the USA. Modified atmosphere packaging Studies on modified atmosphere packaging MAP (40% CO2/60% N2) or vacuum indicate that neither is useful as a control for E. coli O157:H7 on sliced beef (retail cuts) meat compared to packing in air (Uyttendaele, 2001). Table 10.3

D values for E. coli O157:H7 in various food matrices

Food

Heating temperature (ºC)

D value (min)

Reference

Ground beef Beef Pork sausage Salami Pepperoni Chicken Ground turkey Ground lamb Apple cider Apple juice

55 55 55 55 55 55 55 55 50 52

21.13 19.26 11.28 21.9 39.52 11.83 11.51 11.91 65 18

Juneja et al. (1997) Ahmed et al. (1995) Ahmed et al. (1995) Duffy et al. (1999) Riordan et al. (2000) Juneja et al. (1997) Juneja and Marama (1999) Juneja and Marama (1999) Dock et al. (2000) Splittstoesser et al. (1996)

268

Emerging foodborne pathogens

Equally, packaging of shredded lettuce, sliced cucumber, and shredded carrot under an atmosphere containing 3% oxygen and 97% nitrogen had no apparent effect on populations of E. coli O157:H7 (Abdul-Raouf et al., 1993). Chemical disinfectants The sensitivity of isolates of Escherichia coli O157:H7 (which has recently caused waterborne outbreaks) to chlorination has been studied by Rice et al., (1999). Both pathogenic and nonpathogenic levels of the pathogen were significantly reduced within one minute of exposure to free chlorine. Results indicate that chlorine levels typically maintained in water systems are sufficient to inactivate these organisms Aqueous solutions of sodium hypochlorite or hypochlorous acid may be used to sanitise fresh fruits and vegetables. However, pathogenic organisms occasionally survive aqueous sanitisation in sufficient numbers to cause disease outbreaks. Chlorine dioxide (ClO2) gas generated by a dry chemical sachet was tested against E. coli O157:H7 on lettuce leaves. After exposure to ClO2 gas a 3.4, 4.4 or 6.9-log reduction in E. coli O157 was observed while after 30 min, 1 h and 3 h respectively the ClO2, gas sachet was effective at killing pathogens on lettuce without deteriorating visual quality. Apart from chlorine-based compounds, hydrogen peroxide and organic acids may also be used to as anti-microbial agents on fresh fruits (Venkitanarayanan et al., 2002). In the USA, organic acids, in particular acetic acid and lactic acid, are routinely used to wash beef carcasses (Cutter, 1999). Taylor et al. (1999) compared a number of proprietary disinfectant products (18) used in the food industry for their bactericidal efficacy against Escherichia coli O157:H7 at 20 and 10 ∞C according to the BS EN 1276 (1997) quantitative suspension test for the evaluation of bactericidal activity of chemical disinfectants and antiseptics used in food, industrial, domestic and institutional areas. At 20 ∞C, 15 products passed at their in-use concentration (under clean and dirty conditions) against E. coli O157:H7. Fourteen products passed the test at 10 ∞C. The products exhibiting reduced efficacy at the lower temperature were amphoterics and quaternary ammonium compounds although some of these types of products were effective at both temperatures. Taking all the results together, only 11 of the total of 18 products achieved a pass result under all the parameters tested. This work demonstrates the need for final verification of disinfectant efficacy by undertaking field trials in the foodprocessing environment in which the product is intended for use. Irradiation Gamma irradiation can reportedly be used to control against E. coli O157:H7 in alfalfa, radish, and mung bean seeds; brocolli sprouts; apple juice and ground beef. The level of irradiation and pathogen reductions achieved vary with product type. On broccoli sprouts, the D-value, the dose required for a 1-log reduction in Escherichia coli O157:H7 was 1.43 kGy (Rajkowski et al., 2003). In apple cider, a dose of 1.8 kGy was sufficient to achieve a 5D

Emerging pathogenic E. coli

269

inactivation of E. coli O157. (Buchanan et al., 1998). On raw ground beef patties, the D10 values ranged from 0.241 to 0.307 kGy depending on the temperature (–15 to –17 or 3–5 ∞C) and the fat content (8–28%) of the meat (Clavero et al., 1994). Interventions for specific foods For some food commodities particular measures against E. coli O157:H7 have been implemented as outlined below Cattle hide It is now generally accepted that cattle hide is the most important vector of faecal contamination (and therefore VTEC) into the abattoir. Controls aimed at reducing the level of faecal contamination on hides of animals presented for slaughter have been implemented in a number of European countries. These ‘clean cattle policies’ aim to reduce the VTEC contamination of carcasses and derived raw meat products. Animals are judged visually on entry to the abattoir on the basis of the level of faecal material on the hide. Strategies for the processing of dirty animals include rejection of animals with excessively dirty hides, washing of the animals; hide trimming or clipping; slaughter of dirty animals at the end of the kill period or reducing the speed of the slaughter line. Other novel research is directed against specific treatments to reduce VTEC on the hide. These include the possible use of cetylpyridinium chloride (CPC) as an antimicrobial intervention on beef cattle hides (Bosilevac et al., 2004) and chemical dehairing (Nou et al., 2003). Beef carcass Various treatments have been designed to decontaminate carcasses including cold (10–15 ∞C), warm (15–40 ∞C) or hot (75–85 ∞C) water washing (Castillo, et al., 1998), organic acid sprays (acetic, lactic), (Berry and Cutter, 2000) or combinations of these procedures. The most effective of these procedures are hot water washing and organic acid sprays, however, it should be noted that while organic acids are widely used in the USA, they are not currently permitted under EU regulations for beef carcass decontamination. Steam pasteurisation involves the removal of surface water from the carcass after which steam is applied to reduce pathogen numbers (Dorsa et al., 1996). Damage to the carcass surface is limited by immediate chilling with water. This technique is commonly used in the USA, and is now being implemented in Europe. Fermented meats As described above E. coli O157:H7 can survive in traditional dry and semidry fermented meats posing a particular risk in these commodities. This had led to a recommendation that processing protocols achieve a log105.0 cfu g-1 reduction in numbers of E. coli O157:H7. Such reductions maybe achieved

270

Emerging foodborne pathogens

by additional thermal processing and a number of published studies outline heating steps which can be introduced into the manufacturing process after fermentation to achieve the required decline in pathogen numbers (Riordan et al., 2000). In the absence of a thermal processing step, an extended fermentation or maturation period may prove effective in limiting pathogens numbers.

10.6.3 National and international initiatives to control VTEC Because of the severe public health consequences of VTEC infection, a number of national and international initiatives have been undertaken to address the risk posed by this pathogen. In 1997, WHO convened a scientific consultation on the control and prevention of enterohaemorrhagic Escherichia coli (EHEC) (WHO/FSF/FOS/97.6). The report recommended that all outbreaks should be investigated thoroughly to determine the point or process where EHEC contamination occurred so that more effective prevention measures can be introduced. The report emphasised the need for effective lines of communication between different national agencies to be ready to respond to outbreaks and the importance of training staff to conduct epidemiological investigations. The report recommended a range of preventive measures directed at all parts of the food chain. They included ensuring that animal slurry and human faecal waste does not come into contact with crops intended for human consumption or for raising seeds for sprouting, unless such wastes have been treated adequately. Pasteurisation was recommended as a control to ensure safety of milk and raw fruit and vegetable juices and it was also recommend that irradiation be considered for some products, especially readyto-eat and manufactured for highly susceptible people. In the UK, following the large outbreak in Lanarkshire in Scotland in later 1996, a task force study was set up to address the circumstances leading up to this outbreak and, to assess the implications for food safety and the lessons to be learned. This resulted in the Pennington report http://www.scotland.gov.uk/ library/documents-w4/pgr-03.htm. The report proposed measures based on the Hazard Analysis and Critical Control Point system aimed at minimising the potential for contamination/cross contamination with the pathogen at key stages in the food chain from farm to fork with particular focus on the implementation of HACCP in butchers’ shops. Further to this, in the UK an E. coli O157 task force was appointed by the Minister for Health and Community Care in September 2000, under the joint sponsorship of the Food Standards Agency (FSA) Scotland and the Scottish Executive (SE) Health Department. It aimed to review the risk to health of the public in Scotland, and current activities to prevent human infection with E. coli O157; assess the effectiveness of the present arrangements for co-ordination of action at national and local level; and consider what future measures would help protect public health. The report of the task force was published in June 2001.

Emerging pathogenic E. coli

271

In Ireland, a national report on ‘The prevention of E. coli O157, a shared responsibility’ http://www.fsai.ie/publications/reports/ecoli_report.PDF was produced together with a number of industry and consumer focused leaflets on controls to be implemented at each part of the food chain (farm, food factory, abattoir, catering and retail, consumer and vulnerable groups). http:// www.fsai.ie/publications/index.asp#ecoli In 2003, the European Commission Health and Consumer Protection, issued an Opinion of the Scientific Committee on Veterinary Measures relating to public health on verotoxigenic E. coli (VTEC) in foodstuffs. http:// europa.eu.int/comm/food/fs/sc/scv/out58_en.pdf Quantitative risk assessment is now recognised as an important tool in managing risks such as those posed by VTEC and a number of national and international initiatives have been undertaken in this regard. An example is a quantitative risk assessment on E. coli O157:H7 in ground beef conducted by the USDA, Food Safety and Inspection Service (FSIS) in 2002. http:// www.fsis.usda.gov/OPPDE/rdad/FRPubs/00-023NReport.pdf

10.7

Future trends

It is clear that, within the VTEC E. coli, and indeed the wider group of pathogenic E. coli, genetic transfer and evolution is still continuing and new clones continue to emerge. This is exemplified by the emergence of clinically significant non-O157 serotypes and the identification of new virulence/ adhesions mechanisms in these strains. In this regard The European Scientific Committee on Veterinary Measures relating to Public Health on Food-borne Zoonoses has highlighted that research needs for EHEC (VTEC) include the identification of host specific factors involved in VTEC pathogenesis and the improvement of the diagnostic methods for all VTEC-serotypes. Research on emergent pathogenic forms of E. coli in terms of their pathogenicity, prevalence and public health importance needs to be generated in a timely fashion and then translated into practical measures which can be used to reduce the risk posed by this group of pathogenic bacteria. E. coli are a group of organisms which are ubiquitous and persist well in the envrionment. As such it is difficult to limit their contact with fresh foods and to achieve suppression by the application of a control measures at a single Critical Control Point. Thus effective control strategies must consider the multiple points at which VTEC/VT genes can gain access to the human food chain. Control reduction strategies along the entire food chain should be taken into account, including animal feed, management of animal waste, drinking water, water used for food production, and novel processing technologies. Microbiological risk assessment is now recognised as the most effective approach for assessing the safety of a product pathogen pathway (P.P.P.) and in determining where reduction strategies for pathogenic E. coli can best be placed from a practical and economic point of view.

272

10.8

Emerging foodborne pathogens

Sources of further information and advice

While much information on VTEC can be accessed through the considerable scientific literature published on these organisms, there are also a number of websites contain up to date information including the abstracts from the most recent major tri-annual international conference on verocytotoxigenic E. coli. A Report from a WHO Scientific Working Group on Zoonotic Non-O157 Shiga Toxin-producing Escherichia coli (STEC) can be accessed on www.who.int/emc-documents/zoonoses/whocsraph988c.html. A Food Safety and Inspection Service/United States Department of Agriculture website provides current advice on Policy, Procedures, Guidance documents relevant to E. coli O157 in the United States http:// www.fsis.usda.gov/OA/topics/o157.htm

10.9

References

ABDUL-RAOUF UM, BEUCHAT LR

and AMMAR MS (1993). ‘Survival and growth of Escherichia coli O157:H7 on salad vegetables’. Appl Environ Microbiol, 59(7) 1999–2006. AHMED NM, CONNER DE and HUFFMAN DL (1995). ‘Heat-resistance of Escherichia coli O157:H7 in meat and poultry as affected by product composition’, J Food Sci, 60 (3), 606–610. AHMED S and DONAGHY M (1998). ‘An outbreak of Escherichia coli O157:H7 in central Scotland’, 59-65. In Eschericha coli O157:H7 and other shiga toxin producing E. coli strains (editors, Kaper and O’Brien) ASM, Washington. ALLERBERGER F, WAGNER M, SCHWEIGER P, RAMMER HP, RESCH A, DIERICH MP, FRIEDRICH AW and KARCH H (2001). ‘Escherichia coli O157 infections and unpasteurised milk’. Euro Surveill, 6(10):147–51. ANON (1999a). ProMED post, 1999 Oct 16. E. coli, VTEC, cattle, petting zoo – Canada (Ontario) (03) (http://www.promedmail.org). ANON. (1999b). Promed post, 1999 July 9, E. coli, VTEC, open farm – UK (Wales) (02) (http:///www.promedmail.org). ANON. (2000). ‘Waterborne outbreak of gastroenteritis associated with a contaminated municipal water supply, Walkerton, Ontario, May-June 2000’, Canadian Communicable Disease Report 15; 26(20):170–3. ANSAY SE, DARLING KA, and KASPAR CW (1999). ‘Survival of Escherichia coli O157:H7 in ground-beef patties during storage at 2, –2, 15 and then –2 degrees C, and –20 degrees C’, J Food Prot, 62 (11), 1243–7. ARTHUR TM, BOSILEVAC JM, NOU X, SHACKELFORD SD, WHEELER TL, KENT MP, JARONI D, PAULING B, ALLEN DM and KOOHMARAIE M (2004). ‘Escherichia coli O157 prevalence and enumeration of aerobic bacteria, Enterobacteriaceae, and Escherichia coli O157 at various steps in commercial beef processing plants’, J Food Prot 67 (4), 658–65. AVERY SM, LIEBANA E, REID CA, WOODWARD MJ and BUNCIC S (2002). ‘Combined use of two genetic fingerprinting methods, pulse-field gel electrophoresis and ribotyping, for characterization of Escherichia coli O157 isolates from food animals, retail meats, and cases of human disease’, J Clin Microbiol, 40, 2806–12. BELL BP, GOLDOFT M, GRIFFIN PM, DAVIS MA, GORDON DC, TARR PI, BARTLESON CA, LEWIS JH, BARRETT TJ and WELLS JG (1994). ‘A multi-state outbreak of Escherichia coli O157:H7associated bloody diarrhoea and hemolytic uraemic syndrome from hamburgers. The Washington experience’, JAMA, 272 (17):1349–53.

Emerging pathogenic E. coli

273

and CUTTER CN (2000). ‘Effects of acid adaptation of Escherichia coli O157:H7 on efficacy of acetic acid spray washes to decontaminate beef carcass tissue’, Appl Environ Microbiol, 66 (4): 1493–8. BETTELHEIM KA (1998a). ‘Reliability of CHROMagar O157 for the detection of enterohaemorrhagic Escherichia coli(EHEC) O157 but not EHEC belonging to other serogroups’, J Appl Microbiol, 85 (3): 425–8. BETTELHEIM KA (1998b). ‘Studies of Escherichia coli cultured on Rainbow Agar O157 with particular reference to enterohaemorrhagic Escherichia coli (EHEC)’, Microbiol Immunol, 42 (4): 265–9. BEUTIN L, KAULFUSS S, CHEASTY T, BRANDENBURG B, ZIMMERMANN S, GLEIER K, WILLSHAW GA and SMITH HR (2002). ‘Characteristics and association with disease of two major subclones of Shiga toxin (Verocytotoxin)-producing strains of Escherichia coli (STEC) O157 that are present among isolates from patients in Germany’, Diagn Microbiol Infect Dis, 44 (4): 337–46. BLANCO M, BLANCO JE, MORA A, REY J, ALONSO JM, HERMOSO M, HERMOSO J, ALONSO MP, DAHBI G, GONZALEZ EA, BERNARDEZ MI and BLANCO J (1993). ‘Serotypes, virulence genes, and intimin types of Shiga toxin (verotoxin)-producing Escherichia coli isolates from healthy sheep in Spain’, J Clin Microbiol, 41 (4): 1351–6. BLANCO M, BLANCO JE, BLANCO J, ALONSO MP, BALSALOBRE C, MOURINO M, MADRID C and JUAREZ A (1996). ‘Polymerase chain reaction for detection of Escherichia coli strains producing cytotoxic necrotizing factor type 1 and 2 (CNF1 and CNF2)’, J Microbiol Methods, 26, 95–101. BOLTON DJ, BYRNE CM, SHERIDAN JJ, MCDOWELL DA and BLAIR IS (1999). ‘The survival characteristics of a non-toxigenic strain of Escherichia coli O157:H7’, J Appl Microbiol, 86, 407–11. BONO JL, KEEN JE, MILLER LC, FOX JM, CHITKO-MCKOWN CG, HEATON MP and LAEGREID WW (2004). ‘Evaluation of a real-time PCR kit for detecting Escherichia coli O157 in bovine faecal samples’, Appl Environ Microbiol, 70 (3): 1855–57. BOSILEVAC JM, WHEELER TL, RIVERA-BETANCOURT M, NOU X, ARTHUR TM, SHACKELFORD SD, KENT MP, JARONI D, OSBORN MS, ROSSMAN M, REAGAN JO and KOOHMARAIE M (2004). ‘Protocol for evaluating the efficacy of cetylpyridinium chloride as a beef hide intervention’, J Food Prot, 67(2): 303–9. BOUVET J, BAVAI C, ROSSEL R, LE ROUX A, MONTET MP, RAY-GUENIOT S, MAZUY C, ARQUILLIERE C and VERNOZY-ROZAND C (2001). ‘Prevalence of verotoxin-producing Escherichia coli and E. coli O157:H7 in pig carcasses from three French slaughterhouses’, Int J Food Microbiol, 71: 3, 249–55. BRAY J (1945). ‘Isolation of antigenically homogenous strains of Bact coli neapolitanum from summer diarrhoea in infants’, J. Pathol Bacteriol, 57: 239–47. BREUER T, BENKEL DH, SHAPIRO RL, HALL WN, WINNETT MM, LINN MJ, NEIMANN J, BARRETT TJ, DIETRICH S, DOWNES FP, TONEY DM, PEARSON JL, ROLKA H, SLUTSKER L, GRIFFIN PM; INVESTIGATION TEAM (2001). ‘A multistate outbreak of Escherichia coli O157:H7 infections linked to alfalfa sprouts grown from contaminated seeds’, Emerg Infect Dis, 7(6): 977–82. BROOKS JT, BERGMIRE-SWEAT D, KENNEDY M, HENDRICKS K, GARCIA M, MARENGO L, WELLS J, YING M, BIBB W, GRIFFIN PM, HOEKSTRA RM and FRIEDMAN CR (2004). ‘Outbreak of Shiga toxinproducing Escherichia coli O111:H8 infections among attendees of a high school cheerleading camp’, Clin Infect Dis, 38(2): 190–8. BRUCE MG, CURTIS MB, PAYNE MM, GAUTOM RK, THOMPSON EC, BENNETT AL and KOBAYASHI JM (2003). ‘Lake-associated outbreak of Escherichia coli O157:H7 in Clark County, Washington, August 1999’, Arch Pediatr Adolesc Med, 2003 Oct;157 (10): 1016–21. BUCHANAN RL, EDELSON SG, SNIPES K and BOYD G (1998). ‘Inactivation of Escherichia coli O157:H7 in apple juice by irradiation’, Appl Environ Microbiol, 64(11): 4533–5. BUJOCZEK G, REINERS RS and OLASZKIEWICZ JA (2001). ‘Abiotic factors affecting inactivation of pathogens in sludge’, Water Sci & Technol, 44: 10, 79–84. BERRY ED

274

Emerging foodborne pathogens

CAGNEY C, CROWLEY H, DUFFY G, SHERIDAN JJ, O’BRIEN S, CARNEY E, ANDERSON WA MCDOWELL DA

and BLAIR IS (2004). ‘Prevalence and numbers of Escherichia coli O157:H7 in minced beef and beef burgers from butcher shops and supermarkets in the Republic of Ireland’, Food Microbiol, 21: 203–12. CAPRIOLI A, FALBO V, RODA LG, RUGGERI FM and ZONA C (1983). ‘Partial purification and characterization of an Escherichia coli toxic factor that induces morphological cell alterations’, Infect Immun, 39 (3): 1300–6. CASTILLO A, LUCIA LM, GOODSON KJ, SAVELL JW and ACUFF GR (1998). ‘Use of hot water for beef carcass decontamination’, J Food Prot, 61 (1): 19–25. CATARAME TMG, O’HANLON KA, DUFFY G, SHERIDAN JJ, BLAIR IS and MCDOWELL DA (2003). ‘Optimisation of enrichment and plating procedures for the recovery of E. coli O111 and O26 from minced beef’, J. Appl Microbiol, 949–57. CHAPMAN P, SIDDONS CA, CERDAN MALO AT, and HARKIN MA (2000). ‘A one year study of Escherichia coli O157 in raw beef and lamb products’, Epidemiol Infect, 124, 207–13. CHAPMAN PA, CERDAN MALO AT, ELLIN M, ASHTON R, HARKIN (2001). ‘Escherichia coli O157 in cattle and sheep at slaughter, on beef and lamb carcasses and in raw beef and lamb products in South Yorkshire, UK’, Int J Food Microbiol. 64 (1-2): 139–50. CHART H and JENKINS C (1999). ‘The serodiagnosis of infections caused by Verocytotoxinproducing Escherichia coli’, J Appl Microbiol, 86 (5): 731–40. CHINEN I, TANORO JD, MILIWEBSKY E, LOUND LH, CHILLEMI G, LEDRI S, BASCHKIER A, SCARPIN M, MANFREDI E and RIVAS M (2001). ‘Isolation and characterisation of Escherichia coli O157:H7 from retail meats in Argentina’, J. Food Prot, 64, 1346–51. CLAVERO MR, MONK JD, BEUCHAT LR, DOYLE MP and BRACKETT RE (1994). ‘Inactivation of Escherichia coli O157:H7, salmonellae, and Campylobacter jejuni in raw ground beef by gamma irradiation’, Appl Environ Microbiol, 60(6): 2069–75. COIA, J.E. (1998). ‘Clinical, microbiological and epidemiological aspects of Escherichia coli O157 infection’, FEMS Immunology and Medical Microbiology 20: 1–9. COIA JE, JOHNSTON Y, STEERS NJ and HANSON MF (2001). ‘A survey of the prevalence of Escherichia coli O157 in raw meats, raw cow’s milk and raw-milk cheeses in southeast Scotland’, Int J Food Microbiol, 66 (1-2): 63–9. CRAMPIN M, WILLSHAW G, HANCOCK R, DJURETIC T, ELSTOB C, ROUSE A, CHEASTY T and STUART J (1999). ‘Outbreak of Escherichia coli O157 infection associated with a music festival’, Eur J Clin Microbiol Infect Dis, 18(4): 286–8. CRUMP JA, BRADEN CR, DEY ME, HOEKSTRA RM, RICKELMAN-APISA JM, BALDWIN DA, DE FIJTER SJ, NOWICKI SF, KOCH EM, BANNERMAN TL, SMITH FW, SARISKY JP, HOCHBERG N and MEAD (2003). ‘Outbreaks of Escherichia coli O157 infections at multiple county agricultural fairs: a hazard of mixing cattle, concession stands and children’, Epidemiol Infect, 31 (3): 1055–62. CUTTER CN (1999). ‘Combination spray washes of saponin with water or acetic acid to reduce aerobic and pathogenic bacteria on lean beef surfaces’, J Food Prot. 62(3): 280–83. DANIELS NA, NEIMANN J, KARPATI A, PARASHAR UD, GREENE KD, WELLS JG, SRIVASTAVA A, TAUXE RV, MINTZ ED and QUICK R (2000). ‘Travellers’ diarrhoea at sea, three outbreaks of waterborne enterotoxigenic Escherichia coli on cruise ships’, J Infect Diseases, 2000 181, 4: 1491–95. DEAN-NYSTROM EA, GANSHEROFF LJ, MILLS M, MOON HW and O’BRIEN AD (2002). ‘Vaccination of pregnant dams with intimin (O157) protects suckling piglets from Escherichia coli O157:H7 infection’, Infect Immun, 70 (5): 2414–8. DEBROY C, ROBERTS E, KUNDRAT J, DAVIS MA, BRIGGS CE and FRATAMICO PM (2004). ‘Detection of Escherichia coli serogroups O26 and O113 by PCR amplification of the wzx and wzy genes’, Appl Environ Microbiol., 70 (3): 1830–2. DE GRAFF FK and GAASTRA W (1997). ‘Fimbriae of enterotoxigenic Escherichia coli’. In

Emerging pathogenic E. coli

275

Escherichia coli: Mechanisms of virulence, editor: Sussman M. Cambridge University Press. Chp 7, pp. 193–212. DELL’OMO G, MORABITO S, QUONDAM R, AGRIMI U, CIUCHINI F, MACRI A and CAPRIOLI A (1998). ‘Feral pigeons as a source of verocytotoxin-producing Escherichia coli’, Vet Rec. 142: 12, 309–10. DE RYCKE J, MILON A and OSWALD E (1999). ‘Necrotoxic Escherichia coli (NTEC): Two emerging categories of human and animal pathogens’, Vet Rec, 30, 221–23. DESMARCHELIER PM (1996). ‘Foodborne disease: emerging problems and solutions’, Med J Aust, 165 (11–12): 668–71. DOCK LL, FLOROS JD and LINTON RH (2000). ‘Heat inactivation of Escherichia coli O157:H7 in apple cider containing malic acid, sodium benzoate, and potassium sorbate’, J Food Prot, 63 (8): 1026–31. DONNENBERG MS, DONOHUE-ROLFE and KEUSCH GT (1989). ‘Epithelial cell invasion: an overlooked property of enteropathogenic Escherichai coli (EPEC) associated with the EPEC adherence factor’, J Infect Diseases 160: 452–59. DORSA WJ, CUTTER CN and SIRAGUSA GR (1996). ‘Effectiveness of a steam-vacuum sanitizer for reducing Escherichia coli O157:H7 inoculated to beef carcass surface tissue’, Lett Appl Microbiol; 23 (1): 61–3. DUFFY G, RIORDAN DCR, SHERIDAN JJ, WHITING RC, EBLEN BS, MILLER AM, MCDOWELL, DA and BLAIR IS (1999). ‘Differences in thermotolerance of Escherichia coli O157:H7 strains in a salami matrix’, Food Microbiol, 16 (1) 83–91. ELDER RO, KEEN JE, SIRAGUSA GR, BARKOCY-GALLAGHER GA, KOOHMARAIE M and LAEGREID WW (2000). ‘Correlation of enterohaemorrhagic Escherichia coli O157 prevalence in faeces, hides, and carcasses of beef cattle during processing’, Proc Nat Acad Sci USA. 97 (7): 2999–3003. FANTELLI K and STEPHAN R (2001). ‘Prevalence and characteristics of shigatoxin-producing Escherichia coli and Listeria monocytogenes strains isolated from minced meat in Switzerland’, Int J Food Microbiol, 70, 63–9. FITZMAURICE J, GLENNON M, DUFFY G, SHERIDAN JJ, CARROLL C and MAHER M (2004). ‘Real-time qualitative and quantitative assays for the detection and quantification of VT 1 and VT 2 in E. coli O157:H7’, Molecular and cellular probes. 18 (2): 123–32. FUKUSHIMA H and GOMYODA M (1999). ‘An effective, rapid and simple method for isolation of Shiga toxin-producing Escherichia coli O26, O111 and O157 from faeces and food samples’, Zentralbl Bakteriol. 289 (4): 415–28. GERMANI Y, SORO B, VOHITO M, MOREL O and MORVAN J (1997). ‘Enterohaemorrhagic Escherichia coli in Central African Republic’, Lancet, 7: 349 (9066): 1670. GLASS KA, LOEFFELHOLZ JM, FORD JP and DOYLE MP (1992). ‘Fate of Escherichia coli O157:H7 as affected by pH or sodium chloride and in fermented, dry sausage’, Appl Environ Microbiol, 58 (8): 2513–6. GOH S, NEWMAN C, KNOWLES M, BOLTON FJ, HOLLYOAK V, RICHARDS S, DALEY P, COUNTER D, SMITH HR and KEPPIE N (2002). ‘E. coli O157 phage type 21/28 outbreak in North Cumbria associated with pasteurized milk’, Epidemiol Infect, 129 (3): 451–57. GONZALEZ EA and BLANCO J (1989). ‘Serotypes and antibiotic resistance of verotoxigenic (VTEC) and necrotizing (NTEC) Escherichia coli strains isolated from calves with diarrhoea’, FEMS Microbiol Letts, 1: 51 (1): 31–6. HAHM BK, MALDONADO Y, SCHREIBER, E, BHUNIA AK and NAKATSU, CH (2003). ‘Subtyping of foodborne and environmental isolates of Escherichia coli by multiplex-PCR, repPCR, PFGE, ribotyping and AFLP’, J Microbiol. Methods, 53, (3): 387–99. HENNING PH, THAM EB, MARTIN AA, BEARE TH and JUREIDINI KF (1998). ‘Haemolytic-uraemic syndrome outbreak caused by Escherichia coli O111:H11: clinical outcomes’, Med J Aust. 168 (11): 552–5. HEUVELINK AE, ZWARTKRUIS-NAHUIS JT, VAN DEN BIGGELAAR FL, VAN LEEUWEN WJ and DE BOER E (1999a). ‘Isolation and characterization of verocytotoxin-producing Escherichia coli O157 from slaughter pigs and poultry’, Int J Food Microbiol. 52: 67–75.

276

Emerging foodborne pathogens

HEUVELINK AE, ZWARTKRUIS-NAHUIS JT, BEUMER RR

and DE BOER E (1999b). ‘Occurrence and survival of verocytotoxin-producing Escherichia coli O157 in meats obtained from retail outlets in The Netherlands’, J Food Prot. 62 (10): 1115–22. HEUVELINK AE, VAN HEERWAARDEN C, ZWARTKRUIS-NAHUIS JT, VAN OOSTEROM R, EDINK K, VAN DUYNHOVEN YT and DE BOER E (2002). ‘Escherichia coli O157 infection associated with a petting zoo’, Epidemiol Infect, 129 (2): 295–302. HILBORN ED, MERMIN JH, MSHAR PA, HADLER JL, VOETSCH A, WOJTKUNSKI C, SWARTZ M, MSHAR R, LAMBERT-FAIR MA, FARRAR JA, GLYNN MK and SLUTSKER L (1999). ‘A multi-state outbreak of Escherichia coli O157:H7 infections associated with consumption of mesclun lettuce’, Arch Intern Med. 9-23: 159 (15): 1758–64. HILBORN ED, MSHAR PA, FIORENTINO TR, DEMBEK ZF, BARRETT TJ, HOWARD RT and CARTTER ML (2000). ‘An outbreak of Escherichia coli O157:H7 infections and haemolytic uraemic syndrome associated with consumption of unpasteurized apple cider’, Epidemiol Infect. 124(1): 31–6. HIMATHONGKHAM S, and RIEMANN H (1999). ‘Destruction of Salmonella typhimurium, Escherichia coli O157:H7 and Listeria monocytogenes in chicken manure by drying and/or gassing with ammonia’. FEMS Microbiol Letts, 171, 179–82. HIRAMATSU R, MATSUMOTO M, MIWA Y, SUZUKI Y and SAITO M. MIYAZAKI (2002). ‘Characterisation of Shiga toxin-producing Escherichia coli O26 strains and establishment of selective isolation media for these strains’, J Clin Microbiol. 40 (3): 922–5. HIRUTA N, MURASE T, OKAMURA N (2001). ‘An outbreak of diarrhoea due to multiple antimicrobial-resistant Shiga toxin-producing Escherichia coli O26:H11 in a nursery’, Epidemiol Infect, 127 (2): 221–7. HOSHINA K, ITAGAKI A, SEKI R, YAMAMOTO K, MASUDA S, MUKU T and OKADA N. (2001), ‘Enterohaemorrhagic Escherichia coli O26 outbreak caused by contaminated natural water supplied by facility owned by local community’, Jpn J Infect Dis, 54 (6): 247– 8. HOWIE H, MUKERJEE A, COWDEN J, LEITH J and REID T (2003). ‘Investigation of an outbreak of Escherichia coli O157 infection caused by environmental exposure at a scout camp’, Epidemiol Infect, 131 (3): 1063–9. HRUDEY SE, PAYMENT P, HUCK PM, GILLHAM RW and HRUDEY EJ (2003). ‘A fatal waterborne disease epidemic in Walkerton, Ontario: comparison with other waterborne outbreaks in the developed world’, Water Sci Technol. 47 (3): 7–14. INTERNATIONAL ORGANISATION FOR STANDARDISATION (ISO) NO. 16654: 2001 – Microbiology of food and animal feeding stuffs – Horizontal method for the detection of Escherichia coli O157. ISAACSON M, CANTER PH, EFFLER P, ARNTZEN L, BOMANS P and HEENAN R (1993). ‘Haemorrhagic colitis epidemic in Africa’, Lancet. 341, 961. JANES ME, COBBS T, KOOSHESH S and JOHNSON MG (2002). ‘Survival differences of Escherichia coli O157:H7 strains in apples of three varieties stored at various temperatures’, J Food Prot. 65 (7): 1075–80. JENKINS C, PERRY NT, CHEASTY T, SHAW DJ, FRANKEL G, DOUGAN G, GUNN GJ, SMITH HR, PATON AW and PATON JC (2003a). ‘Distribution of the saa gene in strains of Shiga toxin-producing Escherichia coli of human and bovine origins’, J Clin Microbiol, 41 (4): 1775–8. JENKINS C, WILLSHAW GA, EVANS J, CHEASTY T, CHART H, SHAW DJ, DOUGAN G, FRANKEL G and SMITH HR (2003b). ‘Subtyping of virulence genes in verocytotoxin-producing Escherichia coli (VTEC) other than serogroup O157 associated with disease in the United Kingdom’, J Med Microbiol., 52: 11, 941–47. JOHANNSSEN GS, LONCAREVIC S and KRUSE H (2002). ‘Bacteriological analysis of fresh produce in Norway’, Int J Food Microbiol, 77 (3): 199–204. JOHNSON JY, THOMAS JE, GRAHAM TA, TOWNSHEND I, BYRNE J, SELINGER LB, GANNON VP (2003). ‘Prevalence of Escherichia coli O157:H7 and Salmonella spp. in surface waters of southern Alberta and its relation to manure sources’, Can J Microbiol. 49: 5, 326–35.

Emerging pathogenic E. coli

277

and MARMER BS (1999). ‘Lethality of heat to Escherichia coli O157:H7: D- and z-value determinations in turkey, lamb and pork’, Food Res Int, 32, 23–8 JUNEJA VJ, SNYDER OP JR, and MARMER BS (1997). ‘Thermal destruction of Escherichia coli O157:H7 in beef and chicken: determination of D- and Z-values, Int J Food Microbiol, 35 (3): 231–7. KAPER JB, ELLIOT S, SPERANDIO V, PERNA NT, MAYHEW GF and BLATTNER FR (1998). ‘Attaching and effacing intestinal histopathology and the locus of Enterocyte effacement’, In. Escherichia coli O157: H7 and other shiga toxin producing E. coli strains. Editors: Kaper and O’Brien, American Society of Microbiology. KARCH HS, SCHUBERT D, ZHANG W, ZHANG H, SCHMIDT T, OLSCHLAGER and HACKER J (1999). ‘A genomic island, termed high-pathogenicity island, is present in certain nonO157 Shiga toxin-producing Escherichia coliclonal lineages’, Infect Immun. 67: 5994– 6001. KERR M, FITZGERALD M, SHERIDAN JJ, MCDOWELL DA and BLAIR IS (1999). ‘Survival of Escherichia coli O157:H7 in bottled natural mineral water’, J Appl Microbiol, 87 (6): 833–41. KNUDSEN DM, YAMAMOTO SA and HARRIS LJ (2001). ‘Survival of Salmonella spp. and Escherichia coli O157:H7 on fresh and frozen strawberries’, J Food Prot. 64 (10): 1483–8. KUDVA IT, BLANCH K and HOVDE CJ (1998). ‘Analysis of Escherichia coli O157:H7 survival in ovine or bovine manure and manure slurry’, Appl and Env Microbiol, 64: 9, 3166– 74. LAW D (2000). ‘Virulence factors of Escherichia coli O157 and other shiga toxin producing E. coli’, J Clin Mirobiol. 88: 729–45. LUKASOVA J, ABRAHAM B, CUPAKOVA S (2004). ‘Occurrence of Escherichia coli O157 in raw material and food in Czech Republic’, J Vet Med B Infect Dis Vet Public Health. 51 (2): 77–81. LUNG AJ, LIN CM, KIM JM, MARSHALL MR, NORDSTEDT R, THOMPSON NP and WEI CI (2001). ‘Destruction of Escherichia coli O157:H7 and Salmonella enteritidis in cow manure composting’, J Food Prot, 64 (9): 1309–14. MASSA S, ALTIERI C, QUARANTA V AND DE PACE R (1997). ‘Survival of Escherichia coli O157:H7 in yoghurt during preparation and storage at 4 degrees C’, Lett Appl Microbiol, 24 (5): 347–50. MCGEE P, BOLTON DJ, SHERIDAN JJ, EARLEY B, and LEONARD N (2001). ‘The survival of Escherichia coli O157:H7 in slurry from cattle fed different diets’, Letts in Appl Microbiol, 32 (3): 152–5. MCINTYRE L, FUNG J, PACCAGNELLA A, ISAAC-RENTON J, ROCKWELL F, EMERSON B and PRESTON T (2002). ‘Escherichia coli O157 outbreak associated with the ingestion of unpasteurized goat’s milk in British Columbia, 2001’, Can Commun Dis Rep. 28 (1): 6–8. MCMASTER C, ROCH EA, WILLSHAW GA, DOHERTY A , KINNEAR W and CHEASTY T (2001). ‘Verocytotoxin-producing Escherichia coli serotype O26:H11. Outbreak in an Irish Crèche’, Eur J Clin Microbiol Infect Dis, 20 (6), 430–2. MICHINO H, ARAKI K, MINAMI S, NAKAYAMA T, EJIMA Y, HIROE K, TANAKA H, FUJITA N, USAMI S, YONEKAWA M, SADOMOTO K, TAKAYA S and SAKAI N (1998). ‘Recent outbreaks of infections caused by Escherichia coli O157:H7 in Japan’. In Escherichia coli O157:H7 and other shiga toxin producing E. coli strains (eds JB Kaper and AD O’Brien) pp. 73-81. ASM Press, Washington D.C. MICHINO H, ARAKI K, MINAMI S, NAKAYAMA T, EJIMA Y, HIROE K, TANAKA H, FUJITA N, USAMI S, YONEKAWA M, SADOMOTO K, TAKAYA S and SAKAI N (1999). ‘Massive outbreak of Eschericha coli O157:H7 infection in school children in Sakai city, Japan, associated with consumption of white radish sprouts’, Am J. Epidemiol, 150: 787–96. MORGAN, GM, NEWMAN C, PALMER SR, ALLEN JB, SHEPHERD W, RAMPLING A.M., WARREN RE, GROSS RJ, SCOTLAND SM and SMITH HR (1988). ‘First recognized community outbreak of haemorrhagic colitis due to verotoxin-producing Escherichia coli O157.H7 in the UK’, Epidemiology and Infection 101: 1, 83–91. MURINDA SE, NGUYEN LT, IVEY SJ, GILLESPIE BE, ALMEIDA RA, DRAUGHON FA and OLIVER SP JUNEJA VJ

278

Emerging foodborne pathogens

(2003). ‘Prevalence and molecular characterization of Escherichia coli O157:H7 in bulk tank milk and faecal samples from cull cows: a 12-month survey of dairy farms in east Tennessee’, J Food Prot, 65: 5, 752–9. NOU X, RIVERA-BETANCOURT M, BOSILEVAC JM, WHEELER TL, SHACKELFORD SD, GWARTNEY BL, REAGAN JO, KOOHMARAIE M (2003). ‘Effect of chemical dehairing on the prevalence of Escherichia coli O157:H7 and the levels of aerobic bacteria and Enterobacteriaceae on carcasses in a commercial beef processing plant’, J Food Prot. 66 (11): 2005–9. O’DONNELL JM, THORNTON L, MCNAMARA EB, PRENDERGAST T, IGOE D and COSGROVE C (2002). ‘Outbreak of Vero cytotoxin-producing Escherichia coli O157 in a child day care facility’, Commun Dis Public Health 5(1): 54–8. OGDEN ID, HEPBURN NF, MACRAE M, STRACHAN NJ, FENLON DR, RUSBRIDGE SM and PENNINGTON TH (2002). ‘Long-term survival of Escherichia coli O157 on pasture following an outbreak associated with sheep at a scout camp’, Lett Appl Microbiol. 34 (2): 100–4. O’HANLON KA, CATARAME TM, DUFFY G, BLAIR IS and MCDOWELL DA (2004). Rapid detection and quantification of E. coli O157/O26/O111 in minced beef by real-time PCR. Journal of Applied Microbiology. 95(5): 949–57. PAIBA GA, GIBBENS JC, PASCOE SJ, WILESMITH JW, KIDD SA, BYRNE C, RYAN JB, SMITH RP, MCLAREN M, FUTTER RJ, KAY AC, JONES YE, CHAPPELL SA, WILLSHAW GA and CHEASTY T (2002). ‘Faecal carriage of verocytotoxin-producing Escherichia coli O157 in cattle and sheep at slaughter in Great Britain’, Vet Rec. 150 (19): 593–8. PAIBA GA, WILESMITH JW, EVANS SJ, PASCOE SJ, SMITH RP, KIDD SA, RYAN JB, MCLAREN IM, CHAPPELL SA, WILLSHAW GA, CHEASTY T, FRENCH NP, JONES TW, BUCHANAN HF, CHALLONER DJ, COLLOFF AD, CRANWELL MP, DANIEL RG, DAVIES IH, DUFF JP, HOGG RA, KIRBY FD, MILLAR MF, MONIES RJ, NICHOLLS MJ and PAYNE JH (2003). ‘Prevalence of faecal excretion of verocytotoxigenic Escherichia coli O157 in cattle in England and Wales’, Vet Rec. 153 (12): 347–53. PALUMBO SJ, CALL J, SCHULTZ F and WILLIAMS A (1995). ‘Minimum and maximum temperatures for growth and verotoxin production by haemorrhagic strains of Escherichia coli.’ J. Food Prot. 58: 353–6. PATON AW and PATON C (1999). ‘Direct detection of shiga toxigenic Escherichia coli strains belonging to serogroups O111, O157 and O113 by multiplex PCR’, J Clin Microbiol, 37: 3362–5. PATON AW, WOODROW MC, DOYLE RM, LANSER JA and PATON JC (1999). ‘Molecular characterisation of a shiga toxigenic Escherichia coli O113:H21 strain lacking eae responsible for a cluster of cases of haemolytic uraemic syndrome’, J Clin Microbiol. 37: 3357– 61. PATON AW, SRIMANOTE P, WOODROW MC and PATON JC (2001). ‘Characterisation of Saa a novel autogglutinating adhesin produced by locus of enterocyte effacement negative shiga toxigenic Escherichia coli strains that are virulent for humans’, Infect and Immun. 69: 6999–7009. PEARCE MC, JENKINS C, VALI L, SMITH AW, KNIGHT HI, CHEASTY T, SMITH HR, GUNN GJ, WOOLHOUSE ME, AMYES SG and FRANKEL G (2004). ‘Temporal shedding patterns and virulence factors of Escherichia coli serogroups O26, O103, O111, O145, and O157 in a cohort of beef calves and their dams’, Appl Environ Microbiol. 70 (3): 1708–16. PEBODY RG, FURTADO C, ROJAS A, MCCARTHY N, NYLEN G, RUUTU P, LEINO T, CHALMERS R, DE JONG B, DONNELLY M, FISHER I, GILHAM C, GRAVERSON L, CHEASTY T, WILLSHAW G, NAVARRO M, SALMON R, LEINIKKI P, WALL P and BARTLETT C (1999). ‘An international outbreak of Vero cytotoxin-producing Escherichia coli O157 infection amongst tourists; a challenge for the European infectious disease surveillance network’, Epidemiol Infect. 123 (2): 217–23. PIERARD D, MUYLDERMANS G, MORIAU L, STEVENS D and LAUWERS S (1998). ‘Identification of new verocytotoxin type 2 variants B sub-unit genes in human and animal Escherichia coli isolates’, J Clin Microbiol. 36: 3317–22. POTTER AA, KLASHINSKY S, LI Y, FREY E, TOWNSEND H, ROGAN D, ERICKSON G, HINKLEY S, KLOPFENSTEIN

Emerging pathogenic E. coli T, MOXLEY RA, SMITH DR

279

and FINLAY BB (2004). ‘Decreased shedding of Escherichia coli O157:H7 by cattle following vaccination with type III secreted proteins’, Vaccine 22 (3-4): 362–9. RAJKOWSKI KT, BOYD G and THAYER DW (2003). ‘Thayer DW Irradiation D-values for Escherichia coli O157:H7 and Salmonella sp. on inoculated broccoli seeds and effects of irradiation on broccoli sprout keeping quality and seed viability’, J Food Prot, 66(5): 760–6. RESTAINO L, FRAMPTON EW, TURNER KM and ALLISON DR (1999). ‘A chromogenic plating medium for isolating Escherichia coli O157:H7 from beef’, Lett Appl Microbiol. 29: (1): 26–30. RICE EW, CLARK RM and JOHNSON CH (1999). ‘Chlorine inactivation of Escherichia coli O157:H7.’ Emerg Infect Dis, 5(3): 461–3. RILEY LW, REMIS RS, HELGERSON SD, MCGEE HB, WELLS JG, DAVIS BR, HEBERT RJ, OLCOTT ES, JOHNSON LM, HARGRETT NT, BLAKE PA and COHEN ML (1983). ‘Haemorrhagic colitis associated with a rare Escherichia coli serotype’, New Engl J Med, 308, 681–5. RIORDAN DCR, DUFFY G, SHERIDAN JJ, WHITING, RL, EBLEN BS, MCDOWELL DA, BLAIR IS (1998). ‘Survival of E. coli O157:H7 during the manufacture of pepperoni’, J Food Protect. 61: 2, 146–51. RIORDAN DCR, DUFFY G, SHERIDAN JJ, WHITING RC, BLAIR IS and MCDOWELL DA (2000). ‘The effect of acid and heating on the survival of Escherichia coli O157:H7 in pepperoni’, Appl and Environ Microbiol, 60: 4, 1726–9. RITCHIE JM, WAGNER PL, ACHESON DW and WALDOR MK (2003). ‘Comparison of Shiga toxin production by hemolytic-uremic syndrome-associated and bovine-associated Shiga toxin-producing Escherichia coli isolates’, Appl Environ Microbiol, 69 (2): 1059–66. ROBERTSON LJ, JOHANNESSEN GS, GJERDE BK and LONCAREVI S (2002). ‘Microbiological analysis of seed sprouts in Norway’, Int J Food Microbiol, 75 (1-2):119–26. ROERING AM, LUCHANSKY JB, IHNOT AM, ANSAY SE, KASPAR CW and INGHAM SC (1999). ‘Comparative survival of Salmonella typhimurium DT 104, Listeria monocytogenes, and Escherichia coli O157:H7 in preservative-free apple cider and simulated gastric fluid’, Int J Food Microbiol, 46 (3): 263–9. RUGBJERG H, NIELSEN EM, ANDERSEN JS (2003). ‘Risk factors associated with faecal shedding of verocytotoxin-producing Escherichia coli O157 in eight known-infected Danish dairy herds’, Prev Vet Med, 58 (3-4): 101–13. SAFARIKOVA M and SAFARIK I (2001). ‘Immunomagnetic separation of Escherichia coli O26, O111 and O157 from vegetables’, Lett Appl Microbiol, 33 (1): 36–9. SANZ S, GIMENEZ M and OLARTE C (2003). ‘Survival and growth of Listeria monocytogenes and enterohaemorrhagic Escherichia coli O157:H7 in minimally processed artichokes’, J Food Prot, 66: 12, 2203–9. SARGEANT JM, SANDERSON MW, SMITH RA and GRIFFIN DD (2003). ‘Escherichia coli O157 in feedlot cattle faeces and water in four major feeder-cattle states in the USA’, Prev Vet Med, 15: 61 (2):127–35. SAVARINO SJ, FASANO A, ROBERTSON DC and LEVINE MM (1991). ‘Enteroaggregative Escherichia coli elaborate a heat stable enterotoxin demonstrated in an in vitro rabbit intestinal model’, J Clin Invest, 87: 1450–5. SCHMIDT H, SCHEEF J, MORABITO S, CAPRIOLI A, WIELER LH and KARCH H (2000). ‘A new shiga toxin 2 variant (Stx2f) from Escherichia coli isolated from pigeons’, Appl and Env Microbiol, 66: 1205–8. SCOTTISH CENTRE FOR INFECTION AND ENVIRONMENTAL HEALTH (SCIEH) WEEKLY REPORT (2003) ‘VTEC in Scotland 2002’. 37: /49 SHARMA VK (2002). Detection and quantitation of enterohemorrhagic Escherichia coli O157, O111, and O26 in beef and bovine feces by real-time polymerase chain reaction. Journal of Food Protection, 65(9): 1371–80. SHARMA VK and DEAN-NYSTROM EA (2003). ‘Detection of enterohaemorrhagic Escherichia

280

Emerging foodborne pathogens

coli O157:H7 by using a multiplex real-time PCR assay for genes encoding intimin and Shiga toxins’, Vet Microbiol, 29; 93 (3): 247–60. SMITH HW and GYLES CL (1970). ‘The relationship between two apparently different enterotoxins produced by enteropathogenic strains of Escherichia coli of porcine origin’, J Med Microbiol, 3: 87–401. SNYDER JD, WELLS JG, YASHUK J, PUHR N and BLAKE PA (1984). ‘Outbreak of invasive Escherichia coli on a cruise ship’, Am J Trop Med and Hyg. 32: 281–4. SPLITTSTOESSER DF, MCLELLAN MR and CHUREY JJ (1996). ‘Heat resistance of Escherichia coli O157:H7 in apple juice’, J Food Prot, 59 (3): 226–9. STEVENSON G, NEAL B, LIU D, HOBBS M, PACKER NH, BATLEY M, REDMOND JW, LINDQUIST L and REEVES P. (1994). Structure of the O antigen of Escherichia coli K-12 and the sequence of its rfb gene cluster. Journal of Bacteriology 176(13): 4144–56. STRACHAN NJ, FENLON DR and OGDEN I (2001). ‘Modelling the vector pathway and infection of humans in an environmental outbreak of Escherichia coli O157’, FEMS Microbiol Lett, 11; 203(1): 69–73. SYNGE BA, CHASE-TOPPING ME, HOPKINS GF, MCKENDRICK IJ, THOMSON-CARTER F, GRAY D, RUSBRIDGE SM, MUNRO FI, FOSTER G and GUNN GJ (2003). ‘Factors influencing the shedding of verocytotoxin-producing Escherichia coli O157 by beef suckler cows’, Epidemiol Infect. 130, (2): 301–12. TARR PI (1995). Escherichia coli O157:H7: clinical, diagnostic, and epidemiological aspects of human infection. Clin Infect Dis; 20 (1): 1–8. TAYLOR JH, ROGERS SJ and HOLAH JT (1999). ‘A comparison of the bactericidal efficacy of 18 disinfectants used in the food industry against Escherichia coli O157:H7 and Pseudomonas aeruginosa at 10 and 20 degrees C’, J Appl Microbiol. 87(5):718–25. TEUNIS P, TAKUMI K and SHINAGAWA K (2004). ‘Dose response for infection by Escherichia coli O157:H7 from outbreak data’, Risk Anal. 24(2): 401–7. TOZZI AE, GORIETTI S and CAPRIOLI A (2001). ‘Epidemiology of VTEC in humans’ In Verocytotoxigenic E. coli. Editors: Duffy G, Garvey P, McDowell DA. Food Science and Nutrition Press. TREVENA WB, HOOPER RS, WRAY C, WILLSHAW GA, CHEASTY T and DOMINGUE G (1996). ‘Verocytotoxigenic Escherichia coli O157 associated with companion animals’, Vet Rec. 138: 400. TULLOCH EF, RYAN KL, FORMAL SB, and FRANKLIN FA (1973). ‘Invasive enteropathogenic Escherichia coli dysentry: an outbreak of 28 adults’, J Clin Microbiol, 17: 419–21. UYTTENDAELE M, JOZWIK E, TUTENEL A, DE ZUTTER L, URADZINSKI J, PIERARD D and DEBEVERE J (2001). ‘Effect of acid resistance of Escherichia coli O157:H7 on efficacy of buffered lactic acid to decontaminate chilled beef tissue and effect of modified atmosphere packaging on survival of Escherichia coli O157:H7 on red meat’, J Food Prot. 64(11):1661–6. VAN DONKERSGOED J, GRAHAM T and GANNON V (1999). ‘The prevalence of verotoxins, Escherichia coli O157, and Salmonella in the faeces and rumen of cattle at processing’, Can Vet J 40, 332–8. VENKITANARAYANAN KS, LIN CM, BAILEY H, DOYLE MP (2002). ‘Inactivation of Escherichia coli O157:H7, Salmonella enteritidis, and Listeria monocytogenes on apples, oranges, and tomatoes by lactic acid with hydrogen peroxide’, J Food Prot, 65 (1): 100–5. VERNOZY-ROZAND C, RAY-GUENIOT S, RAGOT C, BAVAI C, MAZUY C, MONTET MP, BOUVET J and RICHARD Y (2002), ‘Prevalence of Escherichia coli O157:H7 in industrial mince beef’, Lett Appl Microbiol. 35, 7–11. WALLACE JS, CHEASTY T AND JONES K (1997). ‘Isolation of vero-cytotoxigenic producing Escherichia coli O157 from wild birds’, J Appl Microbiol. 82, 399–404. WATERMAN, S and SMALL P (1996). ‘Characterization of the acid resistance phenotype and rpos alleles of shiga like toxin-producing Eschericha coli.’ Infect. Immun. 64: 280811. WERBER D, FRUTH A, BUCHHOLZ U, PRAGER R, KRAMER MH, AMMON A and TSCHAPE H (2003).

Emerging pathogenic E. coli

281

‘Strong association between shiga toxin-producing Escherichia coli O157 and virulence genes stx2 and eae as possible explanation for predominance of serogroup O157 in patients with haemolytic uraemic syndrome’, Eur J Clin Microbiol Infect Dis, 22 (12): 726–30. WILLIAMS PH, BALDWIN TJ and KNUTTON S (1997). ‘Enteropathogenic Escherichia coli’, In Escherichia coli: Mechanisms of virulence, editor: Sussman M. Cambridge University Press. Ch. 14 p 403-420. WORLD HEALTH ORGANISATION (WHO) (1997). Prevention and control of Enterohaemmorrhagic Escherichia coli (EHEC) infections. Report of A WHO consultation. Document WHO/ FSF/FOS/97.6.

282

Emerging foodborne pathogens

11 Hepatitis viruses N. Cook and A. Rzeżutka, Central Science Laboratory, UK

11.1

Introduction

This chapter will focus on the viral agents of hepatitis, hepatitis A virus (HAV) and hepatitis E virus (HEV) which have a high potential for foodborne transmission. After an outline of the historical background, a brief general description of these viruses will be provided, followed by some details of prevalence of infection, and descriptions of outbreaks of foodborne hepatitis which illustrate how various foods can play a role as a vehicle for transmission of the viral agents. The methodology, which has been applied to the detection of viruses in foods, will be detailed, with discussion of the current state of development, and future requirements. The impact of environmental contamination with hepatitis viruses on food safety will be discussed, with regard to their survival in the environment and their potential contamination of foodstuffs. The new issue of the zoonotic transmission of hepatitis E will be discussed, with regard to recent outbreaks in which contaminated meat was implicated or suspected. An overview of the issue of prevention and control of foodborne hepatitis will be presented, with mention of the effectiveness of disinfection methods, and the role good agricultural/ manufacturing/hygienic practices can play in the prevention of foodborne viral disease. Finally, some significant knowledge gaps will be highlighted, and recommendations to fill them made. 11.1.1 Historical background Next to noroviruses, HAV virus is currently the most significant viral agent of foodborne disease. This is due to the severity of the symptoms, including liver disease, which infection can produce. HEV also has the potential to

Hepatitis viruses

283

become a major foodborne pathogen, although as yet reports of food-related cases are few. Epidemics of jaundice were described in classical times, and the disease was recognised as contagious in the Middle Ages, particularly during wars (Zuckerman and Howard, 1979). During the wars of the early and midtwentieth century, outbreaks, often vast in scale, occurred in the armies of several nations. During the Second Word War and subsequently, human volunteer studies established that viruses were the cause of epidemic hepatitis (Zuckerman and Howard, 1979). In due course, hepatitis A became recognised as an infection which was acquired through ingestion of viruses, in contrast to the bloodborne hepatitis B (Radetsky, 1994). During the 1970s, hepatitis A viruses were isolated from stools of infected patients (O’Connor, 2000; Feinstone et al., 1973). The first reported outbreak of hepatitis E occurred in Delhi, India in 1955 and 1956, although it was not recognised as such until the 1990s, when advances in molecular and immunodiagnostics made it possible to identify the viral agent (Worm et al., 2002).

11.2 Characteristics of hepatitis A and E viruses (morphology, pathogenesis, symptoms of infection) 11.2.1 Hepatitis A virus Hepatitis A virus (HAV) belongs to the genus Hepatovirus, in which it is the only species; the genus itself lies within the family Picornaviridae. This family is comprised of small, non-enveloped single-stranded RNA viruses, and includes human pathogenic agents such as poliovirus, echovirus and rhinovirus. There are seven genotypes of HAV (Robertson, 2001; Hollinger and Emerson, 2001). However, there is only one known serotype of HAV (Hollinger and Emerson, 2001; Banker, 2003). Four genotypes have been isolated from human cases of hepatitis A, and three genotypes are found in Old World monkeys (Robertson, 2001). The strains belonging to each genotype have at least 85% genetic identity, and most human strains belong to either genotype I or III (Cuthbert, 2001, Hollinger and Emerson, 2001). HAV particles are too small, at approximately 28 nm, to be seen by light microscopy, and their morphology may only be visualised under an electron microscope. They possess an icosahedral protein shell or capsid, composed of 32 capsomers or protein subunits, enclosing the RNA genome. The HAV genome is linear, and 7.5 kb in length, covalently linked to a 5’terminal protein and a 3’ poly(A) tail. It contains four structural genes encoding capsid proteins, and seven non-structural genes which become active after entry into a host cell. The number of infectious HAV particles necessary to initiate an infection after ingestion may be very low, perhaps in some cases even single particles (Cliver, 1985). After ingestion, there is an incubation period of around six

284

Emerging foodborne pathogens

weeks before the onset of acute symptoms. However, the greater the dose of virus ingested, the shorter the incubation period (Hollinger and Emerson, 2001). After ingestion, the virus passes through the gastrointestinal tract from where virions are carried to the liver via the hepatic portal vein (O’Connor, 2000). It is not currently known whether the virus replicates in the cells of the gastrointestinal tract prior to passage to the liver (Hollinger and Emerson, 2001). However recent studies suggest that HAV can multiply at a low level in the intestinal epithelial cells (Blank et al., 2000). When virions reach the liver, they attach to receptors on the hepatocytes, and enter these cells and replicate there. Replication of HAV in the hepatocyte cytoplasm is not believed to result in immediate cell damage; this is currently thought to occur subsequent to virion replication and release, via cell-mediated lysis of HAV infected cells. Cells persistently infected in vitro with HAV are not destroyed and their metabolism is relatively unaffected. These findings suggest that virusinduced cytopathology may not be responsible for the pathologic changes seen in HAV infection and that liver disease may result primarily from immune mechanisms (Hollinger and Emerson, 2001). Hepatocyte death may also occur by apoptosis (Koff, 1998). Released virions enter the bile duct, from which they pass into the gastrointestinal tract to be excreted in faeces. During active virus replication infected persons remain generally asymptomatic. The peak virus shedding occurs approximately 4–6 weeks after ingestion of the agent, just before the onset of acute symptoms, although early symptoms of infection can be manifest. This means that, quite often, infected persons can have virus in their stools before becoming aware of any illness. Virus excretion can occur two to three weeks before the onset of jaundice, and generally for up to eight days after this onset (Hollinger and Emerson, 2001; Cliver, 1985). Shedding has in some cases been observed three months after the onset of clinical symptoms, i.e., during the recovery phase (Yotsuyanagi et al., 1996). Virus presence in the blood of infected persons has been demonstrated up to seven days after clinical onset of the disease, and it is not limited to the pre-symptomatic period (Yotsuyanagi et al., 1993). In infants and young children, faecal excretion persists for longer compared to adults’ faecal excretion (Hollinger and Emerson, 2001). Generally, the clinical course of the disease is milder in children than in adults (Hollinger and Emerson, 2001; Banker, 2003), and jaundice is less common and tends to be of short duration (McIntyre, 1990). Chronic disease has not been observed in children (Hollinger and Emerson, 2001). More than 90% of children under the age of five years are asyptomatic, whereas 70 to 80% of adults are symptomatic (Issa and Mourad, 2001). A summary of the symptoms which have been reported among patients with hepatitis A is presented in Table 11.1. In some cases of hepatitis A, serious complications such as fulminant hepatitis leading to acute liver failure are observed. This is age-dependent, with an approximate 2% frequency of fulminant hepatitic failure cases among adolescents and adults with hepatitis A, but among infants and children the

Hepatitis viruses Table 11.1

285

A summary of the symptoms reported among patients with hepatitis A

Period of infection

Duration

Symptoms

Prodromal phase (early symptoms of infection)

Several days to more than a week

General symptoms: fever, fatigue, malaise, myalgia, arthralgia. Gastrointestinal symptoms: anorexia with disorders of taste and smell, sore throat, nausea, vomiting, diarrhoea, constipation, hepatomegaly, splenomegaly, abdominal discomfort. Symptoms from respiratory tract: cough. Skin symptoms: rash, urticaria, exanthematous skin eruptions.

Acute phase

3 weeks

Chronic phase (does not occur in all cases)

Several weeks to 11 months after onset of illness

Gastrointestinal symptoms: anorexia, nausea, vomiting, hepatomegaly, hepatic tenderness, splenomegaly pale stools. Skin symptoms: yellowish discoloration of the mucous membranes(conjunctivae, sclerae), jaundice, pruritus. Other symptoms: dark, golden-brown urine, biochemical and haematological changes. Biochemical and haematological changes.

frequency is less than 0.6% (O’Connor, 2000). The fatality rate is approximately 0.3% (Issa and Mourad, 2001); persons 40 years and older are more likely to have serious complications than younger persons. Complete clinical and biochemical recovery takes place at two months in about 60% of patients, and in almost 100% at six months (Issa and Mourad, 2001). Relapses can occur weeks and months after apparent recovery in up to 10% of patients, and children seem to be more predisposed to relapses. Infection with HAV confers lifelong immunity (Melnick, 1995; Ryder and Beckingham, 2001).

11.2.2 Hepatitis E virus Hepatitis E virus (HEV) was previously classified as a member of the Caliciviridae family, but recent data based on genome organisation and nucleotide sequence analysis has revealed differences, so it is now provisionally classified in a separate genus ‘HEV-like viruses’ (Jameel, 1999; Berke and Matson, 2000). HEV is non-enveloped single-stranded RNA virus. Virion particles are approximately 27 to 34 nm diameter, with an icosahedral protein shell or capsid, enclosing a linear 7.5 kb RNA genome (Worm et al., 2002). All isolated strains of HEV have been classified into four genotypes based on geographical origin – Asian/African, Chinese, Mexican and US/European (Purcell and Emerson, 2001). Despite moderate heterogeneity among all HEV strains there is only a single serotype.

286

Emerging foodborne pathogens

The infectious dose of HEV is currently unknown. After entry by the oral route, the virus is passed through the intestinal tract, where it probably replicates. From the intestinal tract the virus passes to the liver, and after replication there is released into the bile and blood by mechanisms that are not understood (Purcell and Emerson, 2001). HEV replication in the liver results in damage to that organ, but the virus is not directly cytopathic to liver cells (Jameel, 1999; Worm et al., 2002). Some pathological features are characteristic for HEV infection (Jameel, 1999; Worm et al., 2002), but the pathogenesis and mechanisms of liver injury during HEV infection are still not explained. On the basis of the manifestations and course of the disease it can be assumed that immune mechanisms are involved, and responsible for the processes leading to liver damage (Jameel, 1999). The incubation period of hepatitis E ranges from 15–60 days. Virus particles can be found in the bile and faeces of infected persons during the late incubation phase, and subsequently for up to two weeks after the onset of clinical disease (Chauhan et al., 1993). The clinical symptoms of the diseases in most cases are very similar to those reported during hepatitis A. During acute HEV infection, the case fatality rate is 0.5% to 4% (Tahan et al., 2003). The most susceptible for infection are young adults and pregnant women and the case-fatality rate during pregnancy approaches 15 to 25% (Worm et al., 2002).

11.3

Epidemiology

11.3.1 Hepatitis A Each year, approximately 1.4 million persons worldwide become infected with HAV (Issa and Mourad, 2001). The incidence of infection varies between different regions of the world. In developing countries, HAV infection can be highly endemic, with rates of infection in the population reaching 150 cases per 100,000 persons per year (WHO, 2000b). It has been estimated that in the US, approximately 270,000 people become infected annually with hepatitis A, although only a minority of cases are reported (Keeffe, 2004). Data available from the World Health Organization indicate that the annual incidence in Europe is approximately 278,000 cases (WHO, 2000b). In developing countries, most HAV infections occur among children, and adults are generally immune (Cuthbert, 2001; WHO, 2000b). In North America and Western Europe, overall population immunity to HAV is declining (Gust, 1992; Cuthbert, 2001; Banker, 2003), most likely due to increased standards of public health in recent decades. This creates a risk of the occurrence of large outbreaks (ACMSF, 1998), with contaminated foods imported from countries of high endemicity being one of the potential hazards. The most common identifiable route of hepatitis A transmission is personto-person (Cuthbert, 2001; Hadler, 1991). Amongst other risk factors for acquiring hepatitis A are consumption of or exposure to contaminated water

Hepatitis viruses

287

(Leclerc et al., 2002; Nasser, 1994), travel to countries where the disease is highly endemic (Keeffe, 2004), and consumption of contaminated foods. In the US there may be around 4,000 foodborne hepatitis A infections annually, 0.2% of them resulting in death (Mead et al., 1999). In the UK, there have been few reports of foodborne hepatitis A; between 1992 and 1996, 0.5% of reported infections (87 out of 19,147 reports) were possibly foodborne, the vehicle of transmission mainly being shellfish (ACMSF, 1998).

11.3.2 Hepatitis E The most common route of transmission of hepatitis E is consumption of contaminated drinking water, with person-to-person transmission being uncommon (Jameel, 1999). The occurrence of hepatitis E is highest in areas such as Central and South-East Asia, North and West Africa, and Mexico (WHO, 2001), where faecal contamination of water is common, and seroprevalence in populations from endemic regions is around 3–26% (WHO, 2001). Outbreaks involving several thousand cases have been recorded in countries such as India, Myanmar and China (WHO, 2001). In North America and Europe, cases of hepatitis E are uncommon (WHO, 2001), although seroprevalence ranges from 1% to 5%, suggesting circulation of HEV within the populations there (Clemente-Casares et al., 2003). HEV can infect several animals including cats (Okamoto et al., 2004) cattle (Arankalle et al., 2001), pigs (Meng, 2000a,b) and deer (Tei et al., 2003). Judging by antibody prevalence, HEV infection appears common in pigs (Meng et al., 2000a, 2003; Worm et al., 2002; Clemente-Casares et al., 2003), although symptoms may not always be apparent (van der Poel et al., 2001). HEV strains with very similar RNA sequences have been detected in pigs and humans (Banks et al., 2004; van der Poel et al., 2001), which prompts concern over the potential extent of zoonotic transmission of the virus through consumption of contaminated pork products.

11.4

Outbreaks of foodborne hepatitis

Since the first identified outbreak (Roos, 1956) of foodborne hepatitis A (implicated to the consumption of raw oysters), many outbreaks have been reported in detail. Detailed lists of foodborne hepatitis outbreaks can be found in several reviews, e.g., Cliver (1985), and Fiore (2004) who give separate lists of handler-associated, produce-associated and shellfish-associated outbreaks. The types of foodstuff most often implicated in these outbreaks of viral disease were those that are eaten raw or only slightly cooked such as soft fruit, salad vegetables, and shellfish, or handled extensively prior to consumption, such as prepared salad. There are several ways whereby such foods can become contaminated with hepatitis A virus, but ultimately

288

Emerging foodborne pathogens

contamination is due to direct or indirect contact with faeces from an infected person.* The infectious dose of HAV is unknown, but it would appear from the features of many food-associated outbreaks that there are sufficient numbers of virus in tiny amounts of the faeces from an infected person to constitute a hazard (Cliver, 1985).† Foods may acquire viral contamination by direct contact with infected persons during harvesting or preparation, when viruses are transferred or shed onto foodstuffs. Contamination can also occur through contact with sewage – polluted waters, used for growth in the case of shellfish, or irrigation or washing in the case of crops. Contact with contaminated surfaces during preparation can also contaminate foods. Useful illustrations of how contamination of a foodstuff has occurred, and how public health was subsequently affected, may be provided by looking at the features of an outbreak and the findings of its investigation, and this will be done below.

11.4.1 Hepatitis A outbreaks associated with retail outlets, restaurants or social functions Most reported foodborne outbreaks of hepatitis A have been due to an infected food service worker contaminating food which was consumed very soon after, e.g. in a restaurant, delicatessen, or in a social setting such as a banquet (Fiore, 2004). Infected food service workers may contaminate foods directly or contaminate surfaces on which foods are prepared. A major issue with infected food service workers is that they can often be unaware that they are constituting a hazard, since, as described in section 11.2.1, the peak period of HAV shedding from an infected individual occurs before the onset of major symptoms. For example, Massoudi et al. (1999) reported that on 18th October 1994 an employee of a catering company in Kentucky felt too ill to work, and next day was diagnosed with hepatitis A. For the past few weeks he had been preparing cold food items (salad items, fruit, cheese, etc.) for consumption at various events. Between October 27th and November 27th, 91 cases of hepatitis A were reported among people who had attended these events between October 2nd and October 21st. Although the food handler’s hygienic practices were reportedly good (routine hand washing with soap after going to the lavatory and before preparation of food) it appeared that he

*It is unlikely that HAV is shed in vomit, as particle excretion occurs from the liver through the bile duct into the intestine. A recent study has shown that HAV can be present in the saliva of acutely infected patients. (Mackiewicz et al., 2004); a potential for HAV contamination of foods or food-preparation surfaces via saliva may therefore exist (see Levy et al., 1975). †Bidawid et al. (2000a) estimated that the amount of infectious HAV in 1 mg faeces could be as high as 13,000 infectious particles.

Hepatitis viruses

289

was still able to contaminate several food items over at least a three-week period prior to becoming ill.* Secondary cases can occur when food handlers themselves eat contaminated food, become infected then pass the infection to others through contaminating food that they have prepared. In a German city in December 1980, 28 hepatitis A cases occurred which were linked to food served by a restaurant (Zachoval et al., 1981). A woman who worked in a butcher’s ate at this restaurant regularly, but did not develop acute symptoms. However, she did experience mild hepatitis A symptoms (tired, feverish, passing dark urine), through which she continued to work, preparing amongst other items cold meat sandwiches for a Christmas banquet. Subsequently, during January–February 1981, 20 banquet attendees, and 47 customers of the butcher’s shop, became ill with hepatitis A (Zachoval et al., 1981). Although it does not appear that every food-service worker with hepatitis A will pass the infection to others through food contamination (Fiore, 2004), the occurrence of outbreaks such as those described have prompted various recommendations to reduce the risk that infected food-service workers pose to consumers (see Section 11.7).

11.4.2 Hepatitis A transmitted by contaminated shellfish Shellfish such as oysters, mussels, etc., are filter feeders, that is they collect nutrients from the surrounding water by passing it over filters in their body. The filters collect particulate materials, and if the shellfish are grown in water which is contaminated with human faeces they can collect viruses which may also be present. These viruses are concentrated in the gut of the shellfish, and perhaps also the flesh. Depuration, or placing the shellfish in clean waters which can allow them to purge their filters of contaminants, may not be completely effective in removing the viruses, and they remain in the shellfish (Sobsey et al., 1988; Enriquez et al., 1992). There have been several reported outbreaks of hepatitis A in which shellfish have been identified as the vehicle of transmission (Fiore, 2004; Lees, 2000).** An illustrative example is an outbreak of hepatitis A which occurred in New South Wales, Australia in early 1997, where oysters were implicated as the vehicle of infection of several hundred people (Conaty et al., 2000). An epidemiological investigation identified oysters as the likely vehicle of infection, and for many cases it was possible to trace back the oysters from the point of purchase *In another outbreak where the associated food handler had apparently good hygienic practice, investigators considered that she had contaminated foods through frequently putting her hands to her mouth during preparation, and transmitting HAV via saliva or mucus (Levy et al., 1975) **The largest recorded outbreak of foodborne hepatitis was actually implicated to consumption of shellfish. It occurred in Shanghai in 1988, when 300,000 people contracted hepatitis A through eating contaminated clams (Halliday et al., 1991).

290

Emerging foodborne pathogens

to growing beds in Wallis Lake, a major shellfish-producing area in Australia. An environmental investigation revealed several potential sources of pollution of the lake with sewage or human faeces; for instance, an unsewered town upriver of the lake with the septic tanks of several households draining into storm-water channels, some picnic and camping areas in proximity to the lake, which had no toilet facilities, and several vessels sailing on the lake which had inadequate waste disposal systems. In some samples of oysters harvested at the same time as those implicated in the outbreak, several other enteric virus types (enteroviruses, adenoviruses and reoviruses) were detected together with HAV, suggestive of multiple contamination sources. The investigators could not definitively identify any major pollution event, but some weeks prior to the outbreak there had been an exceptionally high rainfall in the area, which may have caused wide dispersal of pollution from its source or sources. HAV could be detected in oyster samples for more than two months after the presumed contamination event, which indicates the scale of persistence of HAV in contaminated oysters, and the limited effectiveness of depuration. The outbreak was controlled by recall of the oysters and a two-month cessation of harvesting.

11.4.3 Hepatitis A transmitted by contaminated fresh produce Fresh produce such as salad vegetables or soft fruit can require extensive handling during harvesting. During harvesting of soft fruit such as strawberries and raspberries, the fruit is often picked by hand. Extensive handling postharvest may also occur; for instance with green onions at least three workers can be required to peel, trim and bundle them (Dentinger et al., 2001). Such practices increase the chances of contamination by infected persons. The production of fresh produce in countries with high endemicity of hepatitis may represent an increasing problem, as produce is often exported from these countries to countries of low endemicity, where much of the population does not have immunity to the viral disease agents. Imported salad vegetables (Dentinger et al., 2001; Nygard et al., 2001; Pebody et al., 1998) and soft fruit (Hutin et al., 1999) have been implicated in several outbreaks of hepatitis A. Contaminated strawberries were the cause of a large outbreak in the United States in 1997 (Hutin et al., 1999). The strawberries had been harvested in four fields in Mexico around March 1996, and shipped to a processor in San Diego, California in April. The processor froze the strawberries and shipped them, in April and May 1996, in 30 lb containers to various schools as part of a US Department of Agriculturesponsored school lunch programme, and also to distributors for commercial use. In February and March 1997, over two hundred cases of hepatitis A were reported from several schools in Michigan and Maine, and the resulting epidemiological investigation identified the frozen strawberries as the vehicle of transmission.

Hepatitis viruses

291

Other cases linked to consumption of these strawberries were identified in other states. HAV was detected by reverse transcription polymerase chain reaction (RTPCR) in serum or stool specimens from many cases, and sequencing analysis revealed that the majority of cases were due to infection by a single strain. Implicated strawberry lots were analysed for the presence of coliform bacteria as indicators of faecal contamination, but each tested negative. This indicated that the outbreak originated from a common source, and this source must have contaminated the strawberries before distribution, since their containers were not opened until just prior to consumption of the contents. It was considered unlikely that contamination occurred in the processing plant, as processing was mainly mechanical with limited handling; furthermore, no hepatitis A had been recorded among the employees during the processing of the fruit. Examining the growing fields in Mexico, FDA officials found that the strawberry plants were drip irrigated, rather than being spray irrigated which could have been the cause of contamination if the water had been contaminated. But it also found that the hygiene facilities on the fields were of poor quality and with extensive hand contact required to pick the fruit, this could have been the cause of the contamination. During the epidemiological investigation, cases suspected of acquiring HAV in Mexico but not linked to consumption of the strawberries were examined; HAV RNA was isolated from 61 of these persons but in no case was the sequence identical to the strain from the outbreak. To date, no HAV has been found in any remaining sample of strawberries from this outbreak. An outbreak of hepatitis A in which HAV was detected in implicated soft fruit was described by Calder et al. (2003). In Auckland, New Zealand, in the first three months of 2002, there was a marked increase in the number of reported hepatitis A cases. HAV was detected, by reverse transcription PCR, in stool specimens from several cases. An epidemiological investigation revealed that a majority of the cases studied had consumed raw blueberries, and there was a significant association of this with the illness. A traceback investigation through retailers and wholesalers implicated a single orchard as the probable source of the outbreak. When frozen blueberries stored at the orchard were analysed, HAV was detected by reverse transcription PCR and confirmed by nucleic acid hybridisation. Sequencing of the PCR products revealed a close identity between the HAV in the blueberries and that in the stool specimens derived from patients. It was not possible to identify exactly how the blueberries had become contaminated with HAV but it was considered that contamination at the orchard by infected food handlers or by polluted ground water were among the likely causes.

11.4.4 Hepatitis E transmitted by contaminated meat There have been very few reports of foodborne outbreaks of hepatitis E. However, recent studies have indicated that consumption of contaminated

292

Emerging foodborne pathogens

and undercooked meats from infected swine species may be a risk factor for acquisition of this disease (see footnote to Section 11.8). An outbreak in which food consumption was definitively implicated occurred recently in Japan (Tei et al., 2003). In April 2003 four people presented to a hospital with hepatitis, and HEV RNA was detected in their serum. It was initially thought that the index patient had acquired the infection through foreign travel, but examination of the patients’ histories revealed that they had all eaten the meat from two Japanese Sika deer caught in the wild. The meat had been eaten raw, sushi-style, several times during the three weeks preceding the onset of the patients’ disease symptoms. Some left-over portions of the deer meat had been kept frozen, and upon analysis HEV RNA was detected in the meat from one deer.* The RNA sequences from the deer isolate were 100% identical to three patients’ HEV isolates and 99.7% identical to the other patient’s isolate (one nucleotide difference over 326 nucleotides sequenced). The patients belonged to two families who shared occasional meals; only those members who ate notable amounts of the contaminated deer meat became infected.

11.5

Detection methods for hepatitis viruses in foods

In most foodborne outbreaks of hepatitis, the food was implicated through epidemiological procedures only, and was not absolutely confirmed as the vehicle for transmission through detection of the virus in samples. This has been primarily due to the lack of efficient methods to detect viruses in foods. There are several basic procedures which can be used to detect viruses, each having advantages and drawbacks when considering application to analysis of foodstuffs. Some procedures are insensitive, in that several thousand virus particles must be present in the sample; others lack the specificity to allow identification of type or strain. Detection of viruses in foods is fraught with difficulties. Viruses do not visibly manifest their presence in foods. They do not spoil the food. They do not, unlike bacteria, grow on artificial media to form visible colonies. Another problem is the extremely small size of viruses. They cannot be seen with an ordinary microscope, and electron microscopy must be employed to visualise them. Electron microscopy is an excellent ‘catch-all’ technique, in that all virus types can be observed thereby, but it requires thousands of viruses to be present in the sample in order to see them readily on a grid. However, because of their low infectious dose, foodstuffs implicated in outbreaks of viral disease may harbour only low numbers of particles. Infection of cultured mammalian cells can be used for detection, but this method is potentially insensitive in that only those virus particles *The titer of the RNA suggests that the HEV was present in numbers as high as 105 particles per g meat.

Hepatitis viruses

293

which remain infectious after the extraction procedure are detected. HAV is difficult to adapt and grow in vitro; some wild-type strains have not been adapted to cell culture despite intensive efforts (Hollinger and Emmerson, 2001). Some adapted strains produce few or no visible effects on the host cell, therefore replication and presence of virus in cells must be confirmed by an indirect method, e.g., immunofluorescence (Hollinger and Emmerson, 2001). The most promising methods for foodborne virus detection are based on the polymerase chain reaction (PCR). These are sensitive, with the potential to detect single virus particles, and, targeting nucleotide sequences, they can be highly specific. As HAV, along with most other enteric viruses, possesses an RNA genome, RTPCR is used for its detection. In some RTPCR-based methods which have been applied to foods, the specificity was enhanced by the use of additional procedures, such as RT-Seminested PCR (Le Guyader et al., 1994), nested RT-PCR (Croci et al., 1999), oligonucleotide probe hybridisation (Calder et al., 2003), and immunocapture-RT-PCR, (Cromeans et al., 1997). Other nucleic acid detection-based procedures have been applied to the detection of HAV in foods. HAV RNA could be detected directly in shellfish tissues sections by an in situ transcription reaction (Romalde et al., 1994). A nucleic acid sequence-based amplification (NASBA) assay for HAV was developed by Jean et al. (2001), targeting the capsid protein gene VP2. The assay was capable of detecting approximately 106 infectious (plaqueforming) units of HAV artificially inoculated onto the surfaces of samples of lettuce and blueberries, after they were extracted from the food surface by washing. A potential limitation of procedures such as RTPCR is that detection of nucleic acid by itself may not indicate whether the virus is infectious (Richards, 1999). Bhattacharya et al. (2004) have, however, reported a correlation between HAV infectivity and RTPCR signal, when using a reverse transcription primer directed against the 3’ poly (A) tail of the viral genome, and PCR primers amplifying a region from the 5’ end; damage to the RNA at any point in the genome will affect reverse transcription and subsequent PCR. Before any detection method can be successfully applied, viruses must be extracted from the food matrix. Viruses may be present in contaminated foods in very low numbers, therefore samples must be substantially concentrated before a detection system such as RTPCR can be effectively employed. The basic features of an extraction/concentration method (Cook and Myint, 1995), are: initial sample treatment to remove virus particles from food solids; removal of the food solids from the extract; virus concentration; and delivery to the detection system. Methods used for extraction of HAV from shellfish involve homogenisation of shellfish meat (Le Guyader et al., 1994; Cromeans et al., 1997; Croci et al., 1999; Kingsley and Richards, 2001; Coelho et al., 2003) or their digestive tissues (Atmar et al., 1995; Kingsley et al., 2002a) followed by centrifugation to remove solids and virus concentration by precipitation. Methods used for virus extraction from fruits and vegetables

294

Emerging foodborne pathogens

have employed homogenisation (Dubois et al., 2002), or washing (Hernández et al., 1997; Bidawid et al., 2000a; Jean et al., 2001) prior to concentration by precipitation via flocculation or acidification followed by centrifugation. Concentration has also been performed by immuno-capture or filtration (Bidawid et al., 2000d). Few of the above methods have actually been used in analysis of foodstuffs, for example during outbreak investigations. Sanchez et al. (2002) used the method of Atmar et al. (1995) to detect HAV in samples of imported clams associated with an outbreak of hepatitis in Spain; Conaty et al. (2000) also used this method along with that of Lees et al. (1995) to examine the oysters from the New South Wales outbreak. Calder et al. (2003) used a method devised for calicivirus and based on washing of fruit followed by virus precipitation by acidification and centrifugation (Gulati et al., 2001) to confirm the presence of HAV in blueberries associated with an outbreak in New Zealand. Tei et al. (2003) used RTPCR to detect HEV sequences in deer meat implicated in an outbreak of hepatitis E, but gave no details of the method used to extract the virus or its nucleic acid from the foodstuff. Cell culture replication of HEV has been reported (Purcell and Emerson, 2001; Smith, 2001), and may prove useful for detection of infectious viruses. There are as yet no standard methods for detection of viruses in foods, but production of such standards is currently under consideration by the European Committee for Standardization (CEN).

11.6 Prevalence in the environment and routes of transmission through foodstuffs As stated above, HEV can infect several animal species, and environmental contamination via the faeces of infected animals might be possible. Apart from some primate hosts, HAV has no animal reservoir and, of course, as a virus it does not propagate in an environment outside of a host. Therefore, when it is detected in an environment it signifies that contamination with human faecal material has occurred. In developed countries, faecal material is disposed of via sewage treatment processes. Several studies have detected HAV in sewage (Kowal, 1985; Jothikumar et al.,1998; Pina et al., 1998), and river and seawater into which sewage was discharged (Kittigul et al., 2000; Pina et al., 1998, 2001). HEV has been detected in urban sewage samples from Europe and North America (Clemente-Casares et al., 2003), areas considered to be non-endemic for this virus. As stated above, if shellfish are grown in waters contaminated with HAV, they may themselves become contaminated, as manifested by the various outbreaks of hepatitis A which have been due to shellfish consumption. Several studies have detected HAV in shellfish such as clams (Kingsley et al., 2002a), oysters (Coelho et al., 2003), cockles (Le Guyader et al., 1994), and mussels (Croci et al., 1999). HAV was detected on lettuce sold in a Costa Rican market (Hernández et al.,

Hepatitis viruses

295

1997); it was considered that it had been contaminated by irrigation or washing with sewage-contaminated water. The potential for a virus to be transmitted through an environment, or through a foodstuff, from host to host is dependent on its potential for survival in the environment or foodstuff. The longer a virus can survive outside a host, the greater are its chances for transmission. Viruses outside a host may be regarded as inert particles and, possessing no intrinsic metabolism, they do not require any nutrients to persist. As they are not in the strict sense ‘alive’ or viable, they do not die or become non-viable; therefore with regard to viruses ‘survival’ means persistence of infectivity. There is currently no information on the survival characteristics of HEV, but HAV has been shown experimentally to be able to survive in several environments, such as water, foods and surfaces (Rzeżutka and Cook, 2004). HAV can remain viable in faeces after drying for at least 30 days under conditions simulating a typical environmental exposure (McCaustland et al., 1982). In other experimental studies, HAV could survive for at least four hours on faecally contaminated surfaces, such as stainless steel, and could be transferred from there to fingertips, and back again (Mbithi et al., 1991, 1992). Transfer was positively influenced by moisture. Abad et al. (1994) found that HAV could survive on various materials for at least 60 days. HAV was generally more resistant to desiccation than other enteric viruses such as adenovirus and poliovirus. The persistence of HAV on environmental surfaces, and its ability to transfer to animate environments may be important factors in the spread of this virus, especially in food preparation settings. For instance, cafeteria trays contaminated by an infected food handler, with which food came in direct contact, were the vehicle in at least one foodborne hepatitis A outbreak (Cliver, 1985). HAV has the ability to survive in seawaters for several weeks (Bosch, 1995; Callahan et al., 1995), with survival being more prolonged in colder temperatures (Bosch, 1995; Crance et al., 1998). This potential promotes their chances of being collected by filter-feeding shellfish. Outbreak investigations have indicated that viruses can persist in shellfish over several weeks following contamination (Conaty et al., 2000; Lees, 2000), and it has been shown (Hewitt and Greening, 2004) that HAV can survive inside mussels even during similar treatment (boiling for 37 sec, steaming for 3 min, then immersion in acid marinade) to that used in commercial preparation of marinaded mussels. In fresh waters, it is possible that HAV could survive for several days with little loss of infectivity. In river waters, little or no decline in infectivity of HAV was observed after 48 days (Springthorpe et al., 1993). In groundwater, HAV could survive longer than 12 weeks, losing only approximately 1% infectivity during that period (Sobsey et al., 1989). In tap water, HAV survived at various temperatures for up to 60 days (Enriquez et al., 1995). This information indicates that HAV could survive long enough in water, between a contamination event and the use of the water for crop irrigation or during food processing, to constitute a risk to health. Irrigation of crops with

296

Emerging foodborne pathogens

contaminated water or organic waste is a potential means of contaminating foodstuffs with enteric viruses, and studies with other enteric virus types, e.g., poliovirus have demonstrated that viruses can be transferred to the surfaces of vegetables and persist there for several days, following the application of sewage sludge or effluent (Rzeżutka and Cook, 2004). Once on foodstuffs such as vegetables, HAV can persist under normal storage conditions over the periods usual between purchase and consumption (Croci et al., 2002). The inference from several outbreaks of hepatitis A which implicated frozen fruit (Ramsay and Upton, 1989; Hutin et al., 1999) is that HAV can survive for several months in frozen foods. Table 11.2 summarises HAV survival in various environments and food, with data from various publications harmonised (values converted to log10 reduction in infectious virus titer) to facilitate comparison.

11.7

Prevention and control

The prevention and control of foodborne viral disease may be attempted by various means, including virus elimination procedures, and good hygienic and agricultural practice. Various methods are commonly employed to eliminate microbial pathogens from foods. These include heat and chemical disinfection, and others such as irradiation or high pressure may become more widely adopted in the future. The effect of such elimination procedures on HAV has been tested (there are no reports of any tests done with HEV). Heating can inactivate viruses (Hollinger and Ticehurst, 1996), but is not appropriate for use with foods such as soft fruit and salad vegetables. The presence of fats or proteins can protect HAV to some degree against heat inactivation (Bidawid et al., 2000b). Chlorination is generally used in the fresh produce industry, but it is not certain that the conditions employed are completely effective against HAV (Koopmans and Duizer, 2004). Gamma irradiation is effective against HAV and other enteric viruses (Bidawid et al., 2000c), but at levels which are higher than those generally permitted for use on foodstuffs. HAV can survive freezing, with little if any loss of infectivity (Hollinger and Ticehurst, 1996); this is manifestly demonstrated in the outbreaks which have occurred from consumption of frozen soft fruit. Modified atmosphere packaging may not provide protection against transmission of HAV (Bidawid et al., 2001). Kingsley et al. (2002b) found that high hydrostatic pressures are effective in eliminating infectivity of HAV. Table 11.3 gives some details about the effect on HAV infectivity of various treatments of foodstuffs, with data from various publications harmonised as in Table 11.2. Koopmans and Duizer (2004) reviewed the various treatments employed during food processing, with regard to information available concerning their effect on foodborne viruses including HAV. They evaluated the likelihood of a risk of infection after consumption of foodstuffs if viruses were present before the treatment process, based on the level of reduction in virus infectivity caused

Table 11.2

HAV survival in various environments and food

Environment/foodstuff

Condition

Reduction in infectivity (log10 /time)

Reference

Stainless steel

5–35 ∞C, 25–95% humidity 35 ∞C, 95% humidity –

< 1/4 h > 1/4 h < 1/20 min < 1/4 h < 3/30 d < 4/30 d < 2.5/60 d < 4/60 d < 1/30 d < 2/30 d 4/28 d 0/92 d 1/24 d; 3.5/92 d; 1/11 d; > 5/65 d < 1/48 h 1.6/55 d 3.5/50 d < 1/56 d < 1/360 d £ 5.2/360 d < 1/2 d; 1/4 d; < 3/9 d 4/12 d < 2/12 d < 1/2 d; > 2/4 d < 1/2 d; < 2/4 d; > 3/7 d

Mbithi et al., 1991

Fingertips Paper Aluminium, china Latex Sea water

River water Drinking water

Carrot Fennel

Bosch, 1995 Callahan et al., 1995 Crance et al., 1998 Springthorpe et al., 1993 Enriquez et al., 1995 Sobsey et al., 1989 Biziagos et al., 1988 Croci et al., 2002 Bidawid et al., 2001 Croci et al., 2002

297

* Lettuce was stored in plastic bags with various mixtures of carbon dioxide and nitrogen gas

Abad et al., 1994

Hepatitis viruses

Groundwater Bottled mineral water Lettuce

4 ∞C, 90% humidity 20 ∞C, 50–85% humidity 4–20 ∞C, 50–90% humidity 4–20 ∞C, 50–90% humidity 5 ∞C 25 ∞C 20 ∞C 4 ∞C 19 ∞C 25 ∞C 2–28 ∞C 4 ∞C 23 ∞C 5 ∞C, 25 ∞C 4 ∞C 23 ∞C 4 ∞C 20–25 ∞C 4–25 ∞C, modified atmosphere packaging* 4 ∞C 4 ∞C

Mbithi et al., 1992

298

Emerging foodborne pathogens

Table 11.3

HAV inactivation by various treatments

Treatment

Liquid/food item

Heat

Milk Skim milk Cream Cockles

Chlorination Gamma irradiation High pressure

Well/tap water Lettuce/ strawberries Clams/oysters Cell culture medium

62.8 ∞Ca 71.6 ∞Ca 65 ∞C 71 ∞C 65 ∞C 71 ∞C 100/101 ∞Cb 95 ∞Cc 1 mg/L FCd 2.7–3.0 kGy 2.0 kGy 450 MPa

Reduction in infectivity (log10/time)

Reference

< < < > < > >

Parry and Mortimer, 1984 Bidawid et al., 2000b

3/30 min 2/15 sec 3/16 min 5/14 min 2/16 min 4/16 min 4/2 min

Millard et al., 1987

< 3/2 h < 1 log10

Abad et al., 1997 Bidawid et al., 2000c

> 6/5 min

Kingsley et al., 2002b

a – pasteurisation conditions, b – steaming (steam temperature), c – immersion (water temperature), d – free chlorine

by the treatment. For some processes, such as boiling of liquid food at 100 ∞C and ultra heat treatment of dairy products, the resulting risk was considered to be negligible (i.e., it was highly unlikely that the product would contain infectious viruses); however, for others such as pasteurisation of liquid and solid foods, and acidification of fruit juices, the risk was deemed medium (the product might contain infectious viruses in numbers that could cause disease). High-risk processes were, e.g., freezing or chilling of frozen desserts, where viruses could survive with little or no loss of infectivity. The evaluation was made on the basis of a study which showed that 1,000 virus particles can be transferred from contaminated fingertips to food surfaces (Bidawid et al., 2000a); this would then require at least a 3 log10 inactivation of infectious viruses by the food treatment process to reduce any risk to negligible proportions. Although somewhat prosaic, the evaluation does provide a good basic overview of the hazard of virus resistance and the consequent risk to consumers, and it should be useful to food manufactures when formulating risk assessments and hazard analysis/critical control points (HACCP) plans. There are various governmental regulations in place which specify sanitary controls for shellfish production, for example European Directive 91/492/ EEC (Anonymous, 1991), and the US Food and Drug Administration National Shellfish Sanitation Program (Anonymous, 1993a). These controls cover several areas, such as the quality of the shellfish-growing waters, processing, and marketing of the food products (Lees, 2000). Waters are classified according to their level of pollution, indicated by the presence of faecal bacteria, and appropriate post-harvest treatment is specified according to the classification.

Hepatitis viruses

299

In Europe, when heating is applied to process shellfish, it should be performed so that the internal temperature of the shellfish is at 90 ∞C for 1.5 minutes (Anonymous, 1993b); this is based on studies on the inactivation of HAV in cockles (Millard et al., 1987). A large amount of shellfish, particularly oysters, are sold live for consumption, and therefore heating cannot be used to process them. Depuration is often used to reduce microbial contamination, and in many countries the process is subject to legal control (Lees, 2000); however it is suspected that it is not entirely effective. Many of these controls have been based upon data obtained with bacterial indicators of contamination, but these may not always be appropriate as indicators of viral contamination of shellfish; new research has been aimed at direct detection of viruses, or detection of bacteriophage as indicators of potential virus presence (Lees, 2000). Bacteriophages may have applications as indicators in other food types (Cliver, 1995); however, they would be useful only to identify foods which may have been contaminated by sewage, but not for foods contaminated by handling (Cliver, 1997b). With regard to agricultural industries, such as those involved in the production of soft fruit and fresh vegetables, Koopmans and Duizer (2004) have pointed out that good agricultural practice must be adhered to, to minimise the risk of transmission of enteric viruses. An important control point is water used for irrigation or washing which must be of good sanitary quality (Richards, 2001). Food handlers should be educated about microbial safety guidelines and hygiene rules (Koopmans and Duizer, 2004), and this should, particularly for HAV, include information about the risk of sick children. This is particularly important in countries where hepatitis A is highly endemic. Many of these countries grow and export fresh produce, and food production on farms is a large source of employment. It is likely that most adult workers are immune to infection with HAV, having been infected as children (Hadler, 1991). However, adults working on farms could bring their children with them, or may not adequately wash their hands after caring for children, most of whom could be asymptomatically infected (WHO, 2000b) and shedding virus. A key measure in the prevention of foodborne transmission of viral disease in any setting, either domestic or industrial, is good hygienic practice. Industrial premises must have adequate sanitary and hand washing facilitates to allow staff to observe good hygienic practice.* Food handlers should be properly trained in food hygiene (WHO, 2000a) and be aware of the risks of low hygienic standards. The World Health Organization has issued a number of educational and training manuals providing guidance on hygienic handling of foods (WHO, 2000a). Amongst other WHO recommendations, individual *Thorough hand washing is very important. The study of Bidawid et al. (2000a) indicated that inadequate hand washing may not be sufficient to remove all HAV particles from contaminated hands, or prevent the transfer of virus from fingers to foods.

300

Emerging foodborne pathogens

food handlers suffering from any disease or infection which may be transmitted by food should report this to their supervisor, who should then use discretion as to whether or not to exclude the person from food-handling duties. Vaccination is available for HAV, and in the US the use of hepatitis A vaccine has resulted in an overall decline in the number of cases being reported annually (Acheson and Fiore, 2004). Vaccination of all food handlers, from primary production through to retail and service, would be an effective means of preventing foodborne hepatitis A (Cliver 1997a), and the WHO has recommended (WHO, 1993) that it should be considered if resources are available.† However, the number of reported handler-associated outbreaks of hepatitis A may not be sufficient to justify the routine vaccination of food handlers (Anonymous, 1996; Jacobs et al. 2000), although it could be worthwhile to keep this issue under consideration (ACMSF, 1998; Keeffe, 2004). During an outbreak, immunisation of at-risk individuals can be used to control the spread of infection (D’Argenio et al., 2003; Sanchez et al., 2002). Immunoprophylaxis for HEV is not yet available. Although it is not certain that pets could harbour or transmit hepatitis E viruses, the presence of antibodies in pet cats found by Okamoto et al. (2004) emphasises the need to always apply good hygienic practices in household settings.

11.8

Areas for further research

There are several general areas where there are knowledge gaps about HAV, for example, what is the infectious dose? With specific regard to the foodborne transmission of hepatitis A, Fiore (2004) has pointed out that it is not clearly known how fresh produce becomes contaminated, and why items such as green onions and strawberries appear to be more susceptible to contamination. In the outbreaks which have occurred where fresh produce was the vehicle of transmission, the extent of the contamination of the foodstuff was not fully ascertained. For example, in the Michigan 1997 hepatitis A outbreak attributed to strawberries, was all the fruit contaminated or only a portion? Was one infected handler responsible or could it have been several? How much handling is required, and how contaminated must the handler’s or handlers’ hands be, to result in several hundred kilos of produce harbouring sufficient HAV to infect several hundred people? Or was the contamination due to washing in contaminated water, and if so, how contaminated must the water have been? etc. There is a need for information on these factors which would facilitate a realistic risk assessment of these issues. Therefore, as well as acquiring more detailed information from outbreak investigations, practical research will be necessary to acquire information on, e.g., how much †

It would be expensive (Jacobs et al., 2000; Meltzer et al., 2001)

Hepatitis viruses

301

contamination (how many strawberries/onions, etc.) results from handling by a person whose hands are contaminated by HAV or, e.g., how much contamination results from washing with water containing, for example, 102 infectious particles per litre? To this end it is important that standard virus detection methods are produced, with comprehensive input from the various groups of researchers who have experience in this area. Such methods will support surveillance programs, epidemiological investigations, and, to some extent, routine monitoring as part of food companies’ food hazard management systems. Considerably more knowledge of HAV and HEV survival in the environment and food, and the factors which influence it, is required for a realistic appraisal of the risks these pathogens pose, and to control their transmission. Specific questions include whether HAV can survive in sewage-amended soils, and whether it can be transferred to crops, and just how long is it able to survive on fresh or frozen produce? The discovery in pigs of HEV strains related to human strains (van der Poel et al., 2001) is potentially significant as regards the possibility of interspecies transfer and zoonotic infection. Pork products are usually thoroughly cooked* at temperatures which should inactivate viruses, but a potential for zoonotic foodborne transfer of HEV may lie in environmental contamination via manure from infected pigs. HEV may be widespread in the general pig population (Banks et al., 2004; Meng, 2000a; van der Poel et al., 2001), and if so, it is possible that much of the pig manure which is stored on farms and subsequently spread onto agricultural land as fertiliser could contain infectious HEV particles. This could result in exposure of the human population (Cook et al., 2004). It may be informative to study prevalence and survival of HEV in the environment and on crops and foods, and also to develop methods to detect interspecies transfer at an early stage (van der Poel et al., 2001).

11.9

Sources of further information

The reader who wishes to learn in greater detail about the historical background of hepatitis infections and the elucidation of their etiology will be well *The studies of Yazaki et al. (2003) and Tamada et al. (2004) suggest that consumption of undercooked pig liver, and undercooked wild boar meat, may have been the cause of some cases of hepatitis E in Japan. Wild boar liver is also often eaten raw in Japan, and this has also been linked to some hepatitis E cases (Matsuda et al., 2003). In Bali, raw pig meat or fresh pig blood can be consumed, and seropositivity to HEV is relatively high in the human population (Wibawa et al., 2004). In a case of hepatitis E in the UK which was caused by an HEV strain very similar to pig strains, the patient had admitted to eating raw pork products, although this was not conclusively the cause of the infection (Banks et al., 2004).

302

Emerging foodborne pathogens

served by consulting an appropriate review such as Zuckerman and Howard (1979), and a good narrative account of how hepatitis viruses were discovered can be found in The Invisible Invaders (Radestky, 1994). The main handbook for information about the general characteristics of hepatitis viruses is Fields Virology, which in its several editions provides comprehensive details regarding virus morphology, replication, pathogenesis, etc. The websites of the Centers for Disease Control (www.cdc.gov), and the World Health Organisation (www.who.int) are up-to-date sources of statistics concerning the prevalence of disease, and other epidemiological information. The WHO book Foodborne Disease: a focus for health education (WHO, 2000a) is an excellent source of information on food hygiene guidelines, which emphasises the importance of training and education of food handlers for the prevention of foodborne disease. The latest research on the prevalence of hepatitis viruses in foods and the environment, the development of methods to mediate their detection, and development of methods to reduce the risk of contamination of foods can be obtained in scientific journals such as the Journal of Food Protection, Applied and Environmental Microbiology, and the International Journal of Food Microbiology. A continuous reporting service providing day-by-day details of disease outbreaks around the world is provided by ProMED-mail (www.promedmail.org), under the International Society for Infectious Diseases (www.isid.org). Currently, there are plans under way to establish formal networks of virologists in both Europe and North America, with the ultimate intention of forming a global network for research and dissemination of information concerning viruses including HAV and HEV in food and the environment.

11.10

Acknowledgement

Artur Rzeżutka was supported by a European Commission Marie Curie Fellowship (QLKI-CT-2002-51453).

11.11 References ABAD F X, PINTO R M, BOSCH A

(1994), ‘Survival of enteric viruses on environmental fomites’, Appl Environ Microbiol, 60 (10), 3704–3710. ABAD F X, PINTO R M, BOSCH A (1997),‘Disinfection of human enteric viruses on fomites’, FEMS Microbiol Lett, 156 (1), 107–111. ACHESON D W, FIORE A E (2004), ‘Preventing foodborne disease – what clinicians can do’, N Engl J Med, 350 (5), 437–440. ACMSF (ADVISORY COMMITTEE ON THE MICROBIOLOGICAL SAFETY OF FOOD) (1998), Report on Foodborne Viral Infections, London, Stationery Office. ANONYMOUS (1991), ‘Council Directive 91/492/EEC of 15th July 1991 laying down the health conditions for the production and the placing on the market of live bivalve molluscs’, Off J Eur Communities, 24 September 1991, L 268, 1–14.

Hepatitis viruses

303

(1993a), National Shellfish Sanitation Program, Manual of Operations, 1993 Revision, USA Department of Health and Human Services, Public Health Service, Food and Drug Administration. ANONYMOUS (1993b), ‘Council decision of 11th December 1992 approving certain heat treatments to inhibit the development of pathogenic micro-organims in bivalve molluscs and marine gastropods’ (93/25/EEC), Off J Eur Communities, 16, 22–23. ANONYMOUS (1996), Department of Health Welsh Office, Scottish Office Department of Health, DHSS (Northern Ireland). Immunisation against Infectious Disease. HMSO 1996. ARANKALLE V A, JOSHI M V, KULKARNI A M, GANDHE S S, CHOBE LP, RAUTMARE S S, MISHRA A C, PADBIDRI V S (2001), ‘Prevalence of anti-hepatitis E virus antibodies in different Indian animal species’, J Viral Hepat, 8 (3), 223–227. ATMAR R L, NEILL F H, ROMALDE J L, LE GUYADER F, WOODLEY C M, METCALF T G, ESTES M K (1995), ‘Detection of Norwalk virus and hepatitis A virus in shellfish tissues with the PCR’, Appl Environ Microbiol, 61 (8), 3014–3018. BANKER D D (2003), ‘Viral hepatitis (Part-I)’, Indian J Med Sci, 57 (8), 363–368. BANKS M, BENDALL R, GRIERSON S, HEATH G, MITCHELL J, DALTON H (2004), ‘Human and porcine hepatitis E virus strains, United Kingdom’, Emerg Infect Dis, 10 (5), 953– 955. BERKE T and MATSON D O (2000), ‘Reclassification of the Caliciviridae into distinct genera and exclusion of hepatitis E virus from the family on the basis of comparative phylogenetic analysis’, Arch Virol, 145 (7), 1421–1436. BHATTACHARYA S S, KULKA M, LAMPEL K A, CEBULA T A, GOSWAMI B B (2004), ‘Use of reverse transcription and PCR to discriminate between infectious and non-infectious hepatitis A virus’, J Virol Methods, 116 (2), 181–187. BIDAWID S, FARBER J M, SATTAR S A (2000a), ‘Contamination of foods by food handlers: experiments on hepatitis A virus transferred to food and its interruption’, Appl Environ Microbiol, 66 (7), 2759–2763. BIDAWID S, FARBER J M, SATTAR S A, HAYWARD S (2000b), ‘Heat inactivation of hepatitis A in dairy foods’, J Food Protect, 63 (4), 522–528. BIDAWID S, FARBER J M, SATTAR S A (2000c), ‘Inactivation of hepatitis A virus (HAV) in fruits and vegetables by gamma irradiation’, Int J Food Microbiol, 57 (1/2), 91–97. BIDAWID S, FARBER J M, SATTAR S A (2000d), ‘Rapid concentration and detection of hepatitis A virus from lettuce and strawberries’, J Virol Methods, 88 (2), 175–185. BIDAWID S, FARBER J M, SATTAR S A (2001), ‘Survival of hepatitis A virus on modified atmosphere-packaged (MAP) lettuce’, Food Microbiol, 18 (1), 95–102. BIZIAGOS E, PASSAGOT J, CRANCE J M, DELOINCE R (1988), ‘Long-term survival of hepatitis A virus and poliovirus type 1 in mineral water’, Appl Environ Microbiol 54 (11), 2705– 2710. BLANK C A, ANDERSON D A, BEARD M, LEMON S M (2000), ‘Infection of polarized cultures of human intestinal epithelial cells with hepatitis A virus: vectorial release of progeny virions through apical cellular membranes’, J Virol, 74 (14), 6476–6648. BOSCH A (1995), ‘The survival of enteric viruses in the water environment’, Microbiologia Sem 11 (3), 393–396. CALDER L, SIMMONS G, THORNLEY C, TAYLOR P, PRITCHARD K, GREENING G, BISHOP J (2003), ‘An outbreak of hepatitis A associated with consumption of raw blueberries’, Epidemiol Infect, 131 (1), 745–751. CALLAHAN K M, TAYLOR D J, SOBSEY M (1995), ‘Comparative survival of hepatitis A virus, poliovirus and indicator viruses in geographically diverse seawaters’, Water Sci Technol, 31 (5/6), 189–193. CHAUHAN A, JAMEEL S, DILAWARI J B, CHAWLA Y K, KAUR U, GANGULY N K (1993), ‘Hepatitis E virus transmission to a volunteer’, Lancet, 341 (8838), 149–150. CLEMENTE-CASARES P, PINA S, BUTI M, JARDI R, MARTÍN M, BOFILL-MAS S, GIRONES R (2003), ‘Hepatitis E virus epidemiology in industrialized countries’, Emerg Infect Dis, 9 (4), 448–454. ANONYMOUS

304

Emerging foodborne pathogens

(1985), ‘Vehicular transmission of hepatitis A’, Public Health Rev, 13 (3/4), 235–292. CLIVER D O (1995), ‘Detection and control of foodborne viruses’, Trends Food Sci Technol, 6 (11), 353–358. CLIVER D O (1997a), ‘Hepatitis A from strawberries: who’s to blame?’, Food Technol, 51 (6), 132. CLIVER D O (1997b), ‘Virus transmission via food’, World Health Stat Quart, 50 (1-2), 90– 101. COELHO C, HEINERT A P, SIMÕES C M O, BARARDI C R M (2003), ‘Hepatitis A virus detection in oysters (Crassostrea gigas) in Santa Catarina state, Brazil, by reverse transcriptionpolymerase chain reaction’, J Food Prot, 66 (3), 507–511. CONATY S, BIRD P, BELL G, KRAA E, GROHMANN G, MCANULTY J M (2000),’ Hepatitis A in New South Wales, Australia from consumption of oysters: the first reported outbreak’, Epidemiol Infect, 124 (1), 121–130. COOK N, MYINT, SH (1995), ‘Modern methods for the detection of viruses in water and shellfish’, Rev Med Microbiol, 6 930, 207–216. COOK N, BRIDGER J, KENDALL K, ITURRIZA-GÓMARA M, EL-ATTAR L, GRAY J (2004), ‘The zoonotic potential of rotavirus’, J Infect, 48 (4), 289–302. CRANCE J M., GANTZER C, SCHWARTZBROD L, DELOINCE R (1998), ‘Effect of temperature on the survival of hepatitis A virus and its capsidal antigen in synthetic seawater’, Env Tox Water Quality, 13 (1), 89–92. CROCI L, DE MEDICI D, MORACE G, FIORE A, SCALFARO C, BENEDUCE F, TOTI L (1999), ‘Detection of hepatitis A virus in shellfish by nested reverse transcription-PCR’, Int J Food Microbiol, 48 (1), 67–71. CROCI L, DE MEDICI D, SCALFARO C, FIORE A, TOTI L (2002), ‘The survival of hepatitis A virus in fresh produce’, Int J Food Microbiol, 73 (1), 29–34. CROMEANS T L, NAINAN O V, MARGOLIS H S (1997), ‘Detection of hepatitis A virus RNA in oyster meat’, Appl Environ Microbiol, 63 (6), 2460–2463. CUTHBERT J A (2001),‘Hepatitis A: old and new’, Clin Microbiol Rev, 14 (1), 38–58. D’ARGENIO P, ADAMO B, CIRRINCIONE R, GALLO G (2003), ‘The role of vaccine in controlling hepatitis A epidemics’, Vaccine, 21 (19/20), 2246–2249. DENTINGER C M, BOWER W A, NAINAN O V, COTTER S M, MYERS G, DUBUSKY L M, FOWLERE S, SALEHI E D P, BELL B (2001), ‘An outbreak of hepatitis A associated with green onions’, J Infect Dis, 183 (8), 1273–1276. DUBOIS E, AGIER C, TRAORE O, HENNECHART C, MERLE G, CRUCIERE C, LAVERAN H (2002), ‘Modified concentration method for the detection of enteric viruses on fruits vegetables by reverse transcriptase-polymerase chain reaction or cell culture’, J Food Prot, 65 (12), 1962–1969. ENRIQUEZ R, FROSNER G G, HOCHSTEIN M V, REIDERMANN S, REINHARDT G (1992), ‘Accumulation and persistence of HAV in mussels’, J Med Virol, 37 (3), 174–179. ENRIQUEZ C E, HURST C J, GERBA C P (1995), ‘Survival of enteric adenoviruses 40 and 41 in tap, sea, and waste water’, Water Res, 29 (11), 2548–2553. FEINSTONE S M, KAPIKIAN A Z, PURCELL R H (1973), ‘Hepatitis A: detection by immune electron microscopy of a viruslike antigen associated with acute illness’, Science, 182 (116), 1026–1028. FIORE A E (2004), ‘Hepatitis A transmitted by food’, Clin Infect Dis, 38 (5), 705–75. GULATI B R, ALLWOOD P B, HEDBERG C W, GOYAL S M (2001), ‘Efficacy of commonly used disinfectants for the inactivation of calicivirus on strawberry, lettuce, and a foodcontact surface’, J Food Prot, 64 (9), 1430–1434. GUST I D (1992), ‘Epidemiological patterns of hepatitis A in different parts of the World’, Vaccine, 10 (S1), 56–58. HADLER S C (1991), ‘Global impact of hepatitis A virus infection: changing patterns’, in: Hollinger F B, Lemon S M, Margolis H S, eds, Viral hepatitis and liver disease, Baltimore, Williams & Wilkins, 14–20. CLIVER D O

Hepatitis viruses HALLIDAY M L, KANG L Y, ZHOU T K, HU M D, PAN Q C, FU T Y, HUANG Y S, HU S L

305

(1991), ‘An epidemic of hepatitis A attributable to the ingestion of raw clams in Shanghai, China’, J Inf Dis, 164 (5), 852–859. HERNÁNDEZ F, MONGE R, JIMÉNEZ C, TAYLOR L (1997), ‘Rotavirus and hepatitis A virus in market lettuce (Latuca sativa) in Costa Rica’, Int J Food Microbiol, 37 (2/3), 221–223. HEWITT J, GREENING G E (2004), ‘Survival and persistence of norovirus, hepatitis A virus, and feline calicivirus in marinated mussels’, J Food Prot, 67, 1743–1750. HOLLINGER F B, EMERSON S U (2001), ‘Hepatitis A virus’, in Fields B N, Howley P M, Griffin D E eds, Fields Virology 4th edn, New York, Lippincott Williams & Wilkins, 799– 840. HOLLINGER F B, TICEHURST J R (1996), ‘Hepatitis A virus’, in Fields B N, Knipe D M, Howley P M eds, Fields Virology 3rd edn, Philiadelphia PA, Lippincot Raven, 735–782. HUTIN Y J F, POOL V, CRAMER E H, NAINAN O V, WETH J, WILLIAMS I T, GOLDSTEIN S T, GENSHEIMER K F, PELL B P, SHAPIRO C N, ALTER M J, MARGOLIS H S (1999), ‘A multistate, foodborne outbreak of hepatitis A’, N Engl J Med, 340 (8), 595–602. ISSA I A, MOURAD F H (2001), ‘Hepatitis A: an updated overview’, J Med Liban, 49 (2), 61– 65. JACOBS, R J, GROVER S F, MEYERHOFF A S, PAIVANAS T A (2000), ‘Cost effectiveness of vaccinating food service workers against hepatitis a infection’, J Food Protect, 63 (6), 768–774. JAMEEL S (1999), ‘Molecular biology and pathogenesis of hepatitis E virus’, Expert Rev Mol Med, 6 (12), 1–16. JEAN J, BLAIS B, DARVEAU A, FLISS I (2001), ‘Detection of hepatitis A virus by the nucleic acid sequence-based amplification technique and comparison with reverse transcriptionPCR’, Appl Environ Microbiol, 67 (12), 5593–5600. JOTHIKUMAR N, CLIVER D O, MARIAM T W (1998), ‘Immunomagnetic capture PCR for rapid concentration and detection of hepatitis A virus from environmental samples, Appl Environ Microbiol, 64 (2), 504–508. KEEFFE E B (2004), ‘Occupational risk for hepatitis A: a literature-based analysis’, J Clin Gastroenterol, 38 (5), 440–408. KINGSLEY D H, RICHARDS G P (2001), ‘A rapid and efficient extraction method for reverse transcription-PCR detection of hepatitis A and Norwalk-like viruses in shellfish’, Appl Environ Microbiol, 67 (9), 4152–4157. KINGSLEY D H, MEADE G K, RICHARDS G P (2002a), ‘Detection of both hepatitis A virus and Norwalk-like virus in imported clams associated with food-borne illness’, Appl Environ Microbiol, 68 (8), 3914–3918. KINGSLEY D H, HOOVER D G, PAPAFRAGKOU E, RICHARDS G P (2002b), ‘Inactivation of hepatitis A virus and a calicivirus by high hydrostatic pressure’, J Food Prot, 65 (10), 1605– 1609. KITTIGUL L, RAENGSAKULRACH B, SIRITANTIKORN S, KANYOK R, UTRARACHKIJ F, DIRAPHAT P, THIRAWUTH V, SIRIPANICHGON K, PUNGCHITTON S, CHITPIROM K, CHAICHANTANAKIT N, VATHANOPHAS K (2000), ‘Detection of poliovirus, hepatitis A virus and rotavirus from sewage and water samples’, Southeast Asian J Trop Med Public Health, 31 (1), 41–46. KOFF R S (1998), ‘Hepatitis A’, Lancet, 351 (9116), 1643–1649. KOOPMANS M, DUIZER E (2004), ‘Foodborne viruses: an emerging problem’, Int J Food Microbiol, 90 (1), 23–41. KOWAL N E (1985), ‘Health effects of land application of municipal sludge, EPA/600/1-85/ 015’, Health Effects Research Laboratory, US Environmental Protection Agency, Research Triangle Park, NC 2771, USA, 78. LECLERC H, SCHWARTZBROD L, DEI-CAS E (2002), ‘Microbial agents associated with waterborne diseases’, Crit Rev Microbiol, 28 (4), 371–409. LEES D (2000), ‘Viruses and bivalve shellfish’, Int J Food Microbiol, 25–59 (1/2), 81–116. LEES D N, HENSHILWOOD K, BUTCHER S (1995), ‘Development of a PCR-based method for the detection of enteroviruses and hepatitis A virus in molluscan shellfish and its application to polluted field samples’, Water Sci Tech, 31 (5/6), 457–464.

306

Emerging foodborne pathogens

LE GUYADER F, DUBOIS E, MENARD D, POMMEPUY M

(1994), ‘Detection of hepatitis A virus, rotavirus and enterovirus in naturally contaminated shellfish and sediment be reverse transcription-seminested PCR’, Appl Environ Microbiol, 60 (10), 3665–3671. LEVY B S, FONTAINE R E, SMITH C A, BRINDA J, HIRMAN G, NELSON D B, JOHNSON P M, LARSON R (1975), ‘A large food-borne outbreak of hepatitis A: possible transmission via oropharyngeal secretions’, JAMA, 234 (3) 289–294. MACKIEWICZ V, DUSSAIX E, LE PETITCORPS M F, ROQUE-AFONSO A M (2004), ‘Detection of hepatitis A virus RNA in saliva’, J Clin Microbiol, 42 (9), 4329–4331. MASSOUDI M S, BELL B P, PAREDES V, INSKO J, EVANS K, SHAPIRO C N (1999), ‘An outbreak of hepatitis A associated with an infected food handler’, Public Health Rep, 114 (2), 157–164. MATSUDA H, OKADA K, TAKAHASHI K, MISHIRO S (2003), ‘Severe hepatitis E virus infection after ingestion of uncooked liver from a wild boar’, J Inf Dis, 188 (6), 944. MBITHI J N, SPRINGTHORPE V S, SATTAR S A (1991), ‘Effect of relative humidity and air temperature on survival of hepatitis A virus on environmental surfaces’, Appl Environ Microbiol, 57 (5), 1349–1399. MBITHI J N, SPRINGTHORPE S, BOULET J R, SATTAR S A (1992), ‘Survival of hepatitis A virus on human hands and its transfer on contact with animate and inanimate surfaces’, J Clin Microbiol, 30 (4), 757–763. MCCAUSTLAND K A, BOND W W, BRADLEY D W, EBERT J W, MAYNARD J E (1982), ‘Survival of hepatitis A virus in faeces after drying and storage for 1 month’, J Clin Microbiol, 16 (5), 957–958. MCINTYRE N (1990), ‘Clinical presentation of acute viral hepatitis’, Br Med Bull, 46 (2), 533–547. MEAD P S, SLUTSKER L, DIETZ V, MCCAIG L F, BRESEE J S, SHAPIRO C, GRIFFIN P M, TAUXE R V (1999), ‘Food-related illness and death in the United States’, Emerg Infect Dis, 5 (5), 607–625. MELNICK J L (1995), ‘History and epidemiology of hepatitis A virus’, J Infect Dis, 171 (Suppl.1), 2–8. MELTZER M I, SHAPIRO C N, MAST E E, ARCARI C (2001), ‘The economics of vaccinating restaurant workers against hepatitis A’, Vaccine, 19 (15/16), 2138–2145. MENG X J (2000a), ‘Novel strains of hepatitis E virus identified from humans and other animal species: is hepatitis E a zoonosis?’, J Hepatol, 33 (5), 842–845. MENG X J (2000b), ‘Zoonotic and xenozoonotic risks of the hepatitis E virus’, Infect Dis Rev, 2 (1), 35–41. MENG XJ (2003), ‘Swine hepatitis E virus: cross-species infection and risk in xenotransplantation’, Curr Top Microbiol Immunol, 278 185–216. MILLARD J, APPLETON, H, PARRY, J V (1987), ‘Studies on heat inactivation of hepatitis A virus with special reference to shellfish’, Epidemiol Infec, 98 (3), 397–414. NASSER A M (1994), ‘Prevalence and fate of hepatitis A virus in water’, Crit Rev Env Sci Tech 24 (4), 281–323. NYGARD K, ANDERSSON Y, LINDKVIST P, ANCKER C, ASTEBERG I, DANNETUN E, EITREM R, HELLSTROM L, INSULANDER M, SKEDEBRANT L, STENQVIST K, GIESECKE J G (2001),‘Imported rocket salad partly responsible for increased incidence of hepatitis A cases in Sweden, 2000– 2001’, Euro Surveill, 6 (10), 151–153. O’CONNOR J A (2000), ‘Acute and chronic viral hepatitis’, Adolesc Med, 11 (2), 279–92. OKAMOTO H, TAKAHASHI M, NISHIZAWA T, USUI R, KOBAYASHI E (2004), ‘Presence of antibodies to hepatitis E virus in Japanese pet cats’, Infection, 32 (1), 57–58. PARRY J V, MORTIMER P P (1984), ‘The heat sensitivity of hepatitis A virus determined by a simple tissue culture method; J Med Virol, 14(3), 277–283. PEBODY R G, LEINO T, RUUTU P, KINNUNEN L, DAVIDKIN I, NOHYNEK H, LEINIKKI P (1998), ‘Foodborne outbreaks of hepatitis A in a low endemic country: an emerging problem?’, Epidemiol Infect, 120 (1), 55–59.

Hepatitis viruses PINA S, PUIG M, LUCENA F, JOFRE J, GIRONES R

307

(1998), ‘Viral pollution in the environment and in shellfish: human adenovirus detected by PCR as an index of human viruses’, Applied Environ Microbiol, 64 (9), 3376–3382. PINA S, BUTI M, JARDI R, CLEMENTE-CASARES P, JOFRE J, GIRONES R (2001), ‘Genetic analysis of hepatitis A virus strains recovered from the environment and from patients with acute hepatitis’, J Gen Virol, 82 (12), 2955–2963. PURCELL R H, EMERSON S U (2001), ‘Hepatitis E virus’, in Fields B N, Howley P M, Griffin D E eds, Fields Virology 4th edn, New York, Lippincott Williams & Wilkins, 3051– 3061. RADETSKY P (1994), The Invisible Invaders, Canada, Little, Brown & Company. RAMSAY C N, UPTON P A (1989), ‘Hepatitis A and frozen raspberries’, Lancet, 1 (8628), 43– 44. RICHARDS G P (1999), ‘Limitations of molecular biological techniques for assessing the virological safety of foods’, J Food Prot, 62 (6), 691–697. RICHARDS G P (2001), ‘Enteric virus contamination of foods through industrial practices: a primer on intervention strategies’, J Ind Microbiol Biotechnol, 27 (2), 117–125. ROBERTSON B H (2001), ‘Viral hepatitis and primates: historical and molecular analysis of human and nonhuman primate hepatitis A, B, and the GB-related viruses’, J Viral Hepat, 8 (4), 233–242. ROMALDE J L, ESTES M K, SZÜCS G, ATMAR R L, WOODLEY C M, METCALF T G (1994), ‘In situ detection of hepatitis A virus in cell cultures and shellfish tissues’, Appl Environ Microbiol, 60 (6), 1921–1926. ROOS B (1956), ‘Hepatitepidemi, spridd genom ostron’, Sven Lakartidn, 53 (16), 989– 1003. RYDER S D, BECKINGHAM I J (2001), ‘ABC of diseases of liver, pancreas, and biliary system: Acute hepatitis’, BMJ, 322 (7279), 251–253. RZEżUTKA A, COOK N (2004), ‘Survival of human enteric viruses in the environment and food’, FEMS Microbiol Rev, 28 (4), 441–453. SANCHEZ G, PINTO R, VANACLOCHA H, BOSCH A (2002), ‘Molecular characterization of hepatitis A isolates from a transcontinental shellfish-borne outbreak’, J Clin Microbiol, 40 (11), 4148–4155. SMITH J L (2001), ‘A review of hepatitis E virus’, J Food Prot, 64 (4), 572–586. SOBSEY M D, SHIELDS P A, HAUCHMAN F S, DAVIS A L, RULLMAN V A, BOSCH A (1988), ‘Survival and persistence of hepatitis A virus in environmental samples’, in Zuckerman A J, Viral Hepatitis and Liver Diseases, New York, Alan R Liss. SOBSEY M D, SHIELDS P A, HAUCHMAN F H, HAZARD R L, CATON L W, III (1989), ‘Survival and transport of hepatitis A virus in soils, groundwater and wastewater’, Water Sci Technol, 18 (10), 97–106. SPRINGTHORPE V S, LOH C L, ROBERTSON W J, SATTAR S A (1993), ‘In situ survival of indicator bacteria, MS-2 phage and human pathogenic viruses in river water’, Water Sci Technol, 27 (3/4), 413–420. TAHAN V, OZDOGAN O, TOZUN N (2003), ‘Epidemiology of viral hepatitis in the Mediterranean basin’, Rocz Akad Med Bialymst, 48, 11–7. TAMADA Y, YANO K, YATSUHASHI H, INOUE O, MAWATARI F, ISHIBASHI H (2004), ‘Consumption of wild boar linked to cases of hepatitis E’, J Hepatol, 40 (5), 869–870. TEI S, KITAJIMA N, TAKAHASHI K, MISHIRO S (2003), ‘Zoonotic transmission of hepatitis E virus from deer to human beings’, Lancet, 362 (2), 371–373. VAN DER POEL W H M, VERSCHOOR F, VAN DER HIEDE R, HERRERA M-I, VIVO A, KOOREMAN M, DE RODA HUSMAN A M (2001), ‘Hepatitis E virus sequences in swine related to sequences in humans, the Netherlands’, Emerg Infect Dis, 7 (6), 959–964. WHO (WORLD HEALTH ORGANIZATION) (1993), ‘Prevention of foodborne hepatitis A’, Weekly Epidemiological Record 68 (22), 157–158. WHO (2000a), Foodborne Disease: a focus for health education, World Health Organization, Geneva.

308

Emerging foodborne pathogens

(2000b), WHO/CDS/CSR/EDC/2000.7, ‘Hepatitis A’, World Health Organization Department of Communicable Disease Surviellance and Response, www.who.int/emc. WHO (2001), WHO/CDS/CSR/EDC/2001.12, ‘Hepatitis E’, World Health Organization Department of Communicable Disease Surveillance and Response, www.who.int/emc. WIBAWA I D, MULJONO D H, MULYANTO, SURYADARMA I G, TSUDA F, TAKAHASHI M, NISHIZAWA T, OKAMOTO H (2004), ‘Prevalence of antibodies to hepatitis E virus among apparently healthy humans and pigs in Bali, Indonesia: Identification of a pig infected with a genotype 4 hepatitis E virus’, J Med Virol, 73 (1), 38–44. WORM H C, VAN DER POEL W H, BRANDSTATTER G (2002), ‘Hepatitis E: an overview’, Microbes Infect, 4 (6), 657–666. YAZAKI Y, MIZUO H, TAKAHASHI M, NISHIWARA T, SASAKI N, GOTANDA Y, OKAMOTO H (2003), ‘Sporadic acute or fulminant hepatitis E in Hokkaido, Japan, may be food-borne, as suggested by the presence of hepatitis E virus in pig liver as food’, J Gen Virol, 84 (Pt 9), 2351–2357. YOTSUYANAGI H, IINO S, KOIKE K, YASUDA K, HINO K, KUROKAWA K (1993), ‘Duration of viremia in human hepatitis A viral infection as determined by polymerase chain reaction’, J Med Virol, 40 (1), 35–38. YOTSUYANAGI H, KOIKE K, YASUDA K, MORIYA K, SHINTANI Y, FUJIE H, KUROKAWA K, IINO S (1996), ‘Prolonged fecal excretion of hepatitis A virus in adult patients with hepatitis A as determined by polymerase chain reaction’, Hepatology, 24 (1), 10–13. ZACHOVAL R, FROSNER G, DEINHARDT F, JOHN I (1981), ‘Hepatitis A transmission by cold meats’, Lancet, 2 (8240), 260. ZUCKERMAN A J, HOWARD C R (1979), The history of viral hepatitis in Hepatitis Viruses of Man, London, Academic Press. WHO

Prion diseases

309

12 Prion diseases C. J. Sigurdson and A. Aguzzi, Universitätsspital Zürich, Switzerland

12.1

Introduction

Prion infections ultimately result in fatal neurodegenerative diseases in humans and a wide variety of animals (Aguzzi, Montrasio et al. 2001). Although prion diseases may present with certain pathophysiological parallels to other progressive encephalopathies, such as Alzheimer’s and Parkinson’s disease (Aguzzi and Raeber 1998), they are unique in being transmissible. Homogenization of brain tissue from affected individuals and intracerebral inoculation into another individual (same species) typically reproduces the disease. This important fact was recognized more than half a century ago in the case of scrapie (Cuille and Chelle 1939), a prototypic prion disease that affects sheep and goats. Inspired by a suggestion of Hadlow that kuru in humans might be an infectious disease similar to scrapie (Hadlow 1959), Gajdusek showed that kuru and Creutzfeldt-Jakob disease (CJD) were transmissible to primates and mice (Gajdusek, Gibbs et al. 1966; Gibbs, Gajdusek et al. 1968), and as later discovered from accidental iatrogenic transmissions, also to other humans (Brown et al. 2000). Therefore, prion diseases are also called transmissible spongiform encephalopathies (TSEs), a term that emphasizes their infectious nature. When Stanley Prusiner started his first attempts at tackling the cause of TSEs (Prusiner, Hadlow et al. 1977), this group of diseases was not in the public limelight. However, bovine spongiform encephalopathy (BSE) was recognized a few years later (Wells, Scott et al. 1987) – an event that would dramatically change the public perception of prion diseases. CJD in humans was, and fortunately continues to be, exceedingly rare; its incidence is typically 1/106 inhabitants/year, but reaches 3/106 inhabitants/year in Switzerland,

310

Emerging foodborne pathogens

which is currently reporting the highest number of cases (Glatzel, Rogivue et al. 2002; Glatzel, Ott et al. 2003). While only less than 1% of all reported cases of Creutzfeldt-Jakob disease (CJD) can be traced to a defined infectious source, the identification of bovine spongiform encephalopathy (BSE) (Wells, Scott et al. 1987) and its subsequent epizootic spread has highlighted prion-contaminated meat-andbone meal as an efficient vector for bovine prion diseases (Weissmann and Aguzzi 1997). Infectious prions do not completely lose their infectious potential even after extensive autoclaving (Taylor 2000).When transmitted to primates, BSE produces a pathology strikingly similar to that of vCJD (Aguzzi and Weissmann 1996b; Lasmezas, Deslys et al. 1996). BSE is most likely transmissible to humans, too, and strong circumstantial evidence (Aguzzi 1996; Aguzzi and Weissmann 1996b; Collinge, Sidle et al. 1996; Bruce, Will et al. 1997; Hill, Desbruslais et al. 1997) suggests that BSE is the cause of variant Creutzfeldt-Jakob disease (vCJD) which has claimed more than 150 lives in the United Kingdom (Will, Ironside et al. 1996; http:// www.cjd.ed.ac.uk) and a much smaller number in some other countries (Chazot, Broussolle et al. 1996). Several aspects of CJD epidemiology continue to be enigmatic. For example, CJD incidence in Switzerland increased twofold in 2001, and appears to be increasing even further in the year 2002 (Glatzel, Pekarik et al. 2002). A screen for recognized or hypothetical risk factors for CJD has, to date, not exposed any causal factors. Several scenarios may account for the increase in incidence, including improved reporting, iatrogenic transmission, and transmission of a prion zoonosis. Prion diseases typically exhibit a very long latency period between the time of infection and the clinical manifestation; this is the reason why these diseases were originally thought to be caused by ‘slow viruses’. From the viewpoint of interventional approaches, this peculiarity may be exploitable, since it opens a possible window of intervention after infection has occurred, but before brain damage is being initiated. Prions spend much of this latency time executing neuroinvasion, which is the process of reaching the central nervous system after entering the body from peripheral sites (Aguzzi 1997; Nicotera 2001). During this process, little or no damage occurs to the brain, and one might hope that its interruption may prevent neurodegeneration. Indeed, the incubation period of prion diseases can be long, ranging from two years to 50 years in some cases of kuru in humans. Once neurodegeneration begins, the disease progresses and is ultimately fatal. Brain lesions are characterized by spongiform degeneration, astrocytic gliosis, occasionally amyloid plaques, and neuronal loss without an inflammatory infiltrate.

12.1.1 What is a prion? Stanley Prusiner’s protein-only hypothesis The most widely accepted hypothesis on the nature of the infectious agent causing TSEs (which was termed prion by Stanley B. Prusiner) (Prusiner

Prion diseases

311

1982) predicates that it consists essentially of PrPSc, an abnormally folded, protease-resistant, beta-sheet rich isoform of a normal cellular protein termed PrPC. According to this theory, the prion does not contain any informational nucleic acids, and its infectivity propagates simply by recruitment and ‘autocatalytic’ conformational conversion of cellular prion protein into diseaseassociated PrPSc (Aguzzi and Weissmann 1997). A large body of experimental and epidemiological evidence is compatible with the protein-only hypothesis, and very stringently designed experiments have failed to disprove it. It would go well beyond the scope of this chapter to review all efforts that have been undertaken in this respect. Perhaps most impressively, knockout mice carrying a homozygous deletion of the Prnp gene that encodes PrPC, fail to develop disease upon inoculation with infectious brain homogenate (Büeler, Aguzzi et al. 1993), nor does their brain carry prion infectivity (Sailer, Büeler et al. 1994). Reintroduction of Prnp by transgenesis – even in a shortened, redacted form – restores infectibility and prion replication in Prnp% mice (Fischer, Rülicke et al. 1996; Shmerling, Hegyi et al. 1998; Supattapone, Bosque et al. 1999; Flechsig, Shmerling et al. 2000). In addition, all familial cases of human TSEs are characterized by Prnp mutations (Aguzzi and Weissmann 1996a; Prusiner, Scott et al. 1998).

12.2

Epidemiology

12.2.1 Natural scrapie in sheep and goats Scrapie is the most common natural prion disease of animals. Even though scrapie was recognized as a distinct disorder of sheep with respect to its clinical manifestations as early as 1738, the disease remained an enigma, even with respect to its pathology, for more than two centuries (Parry 1983). Some veterinarians thought that scrapie was a disease of muscle caused by parasites, whilst others thought that it was a dystrophic process (M’Gowan 1914). An investigation into the etiology of scrapie followed the vaccination of sheep for louping-ill virus with formalin-treated extracts of ovine lymphoid tissue unknowingly contaminated with scrapie prions (Gordon 1946). Two years later, more than 1500 sheep developed scrapie from this vaccine. Scrapie of sheep and goats shares with chronic wasting disease (CWD) of deer and elk a unique property among prion diseases: they seem to be readily communicable within flocks. Although the transmissibility of scrapie seems to be well established, the mechanism of the natural spread of scrapie among sheep is puzzling. The placenta has been implicated as one source of prions accounting for the horizontal spread of scrapie within flocks (via ingestion or environmental contamination) (Pattison and Millson 1961; Pattison 1964; Pattison, Hoare et al. 1972; Onodera, Ikeda et al. 1993), although it is unlikely to be the sole source of infectivity. In Iceland, scrapie-infected flocks of sheep were destroyed and the pastures left vacant for several years; however,

312

Emerging foodborne pathogens

reintroduction of sheep from flocks known to be free of scrapie for many years eventually resulted in scrapie (Palsson 1979). The source of the scrapie prions that attacked the sheep from flocks without a history of scrapie is unknown. Transmission through mites has been advocated (Wisniewski, Sigurdarson et al. 1996), but its significance on the field remains somewhat anecdotal. Tissues that accumulate infectious prions in sheep include, besides the central and peripheral nervous systems, the spleen, lymph nodes (Hadlow, Kennedy et al. 1980) and some non-lymphoid organs. In various experimental animal models, these non-lymphoid organs include the pituitary gland (Pattison and Millson 1962), adrenal gland (Pattison and Millson 1962), pancreas (Pattison and Millson 1960), nasal mucosa (Hadlow, Eklund et al. 1974), intestine (Hadlow, Eklund et al. 1974), muscle (Pattison and Millson 1962), and the eye (retina) (Buyukmihci, Rorvik et al. 1980). How do prions reach these distant sites? Although nerves (Pattison and Millson 1962) and blood (Houston, Foster et al. 2000) may contain infectivity, the precise carrier mechanisms are unclear.

12.2.2 Feline spongiform encephalopathy (FSE) In non-domestic cats, the prion diseases were likely due to ingestion of BSEinfected cattle carcasses. Feline spongiform encephalopathy has been described in a captive cheetah, puma, an ocelot, and a tiger from zoological collections in Great Britain (Kirkwood and Cunningham 1994) (Williams, Kirkwood et al. 2001). In addition to the non-domestic felids, 87 domestic cats in Great Britain and sporadic cases in Norway, Northern Ireland and Liechtenstein have been diagnosed with FSE, all cats were > 2 years old (Ryder, Wells et al. 2001). Clinically affected cats initially demonstrated behavior changes (more timid or aggressive), with subsequent ataxia, hypermetria, and hyperesthesia to sound and touch (Wyatt, Pearson et al. 1991; Bratberg, Ueland et al. 1995). Histopathology revealed spongiform degeneration in the neuropil of the brain and spinal cord with the most severe lesions localized to the medial geniculate nucleus of the thalamus and the basal nuclei (Ryder, Wells et al. 2001). A ban on bovine spleen and CNS tissue in pet foods was initiated in 1990, and all but one of the FSE cases to date occurred in cats born prior to the ban (Nathanson, Wilesmith et al. 1999).

12.2.3 Transmissible mink encephalopathy (TME) Transmissible mink encephalopathy (TME), initially recognized in Wisconsin and Minnesota in 1947, has appeared sporadically in farmed mink in several countries, including the United States, Canada, Finland, Russia, and East Germany (Marsh and Hadlow 1992). Nonetheless, TME outbreaks are rare with the most recent occurrence in the United States in 1985. Epidemiological studies indicate that the disease is causally linked to the ingestion of prion-

Prion diseases

313

contaminated meat, potentially scrapie sheep (Marsh and Bessen 1993). However, in the 1985 TME outbreak in Stetsonville, Wisconsin, the mink rancher stated with certainty that sheep were not fed to mink. Instead, downer (ill) cattle were the primary source of mink food – a discovery which has led to much speculation on a potentially unrecognized BSE-like disease of American cattle (Marsh and Bessen 1993). Despite such speculation, the ultimate origins of TME epidemics remain uncertain. To further investigate potential foodborne sources of TME, mink were intracerebrally (IC) exposed to United Kingdom- and North American-derived sheep scrapie brain homogenates. Mink were highly susceptible to the Suffolk sheep scrapie from the United States, but only after IC inoculation (Hanson, Eckroade et al. 1971). Mink did not develop disease from ingesting scrapie brain (Marsh 1979). These studies suggested, at minimum, that mink are susceptible to scrapie. However, further experiments demonstrated that TME could pass into cattle, and moreover, that brain from these cattle could transmit the TME agent efficiently to mink by either the IC or the oral route, with an incubation period of only four and seven months, respectively. This indicates that TSEs can be transmitted efficiently between cattle and mink (Marsh, Bessen et al. 1991) although the epidemiological significance of these findings are less clear.

12.2.4 Bovine spongiform encephalopathy In 1986, an epidemic of a previously unknown neurological disease appeared in cattle in Great Britain (Wells, Scott et al. 1987): bovine spongiform encephalopathy (BSE) or ‘mad cow’ disease. BSE was shown to be a prion disease by demonstrating protease-resistant PrP in brains of ill cattle (Hope, Reekie et al. 1988; Prusiner, Groth et al. 1993). Based mainly on epidemiological evidence, it has been proposed that BSE represents a massive common source epidemic which has caused more than 180,000 cases to date (Weissmann and Aguzzi 1997). In Britain, cattle, particularly dairy cows, were routinely fed meat and bone meal (MBM) as a nutritional supplement (Wilesmith, Wells et al. 1988; Wilesmith and Wells 1991; Wilesmith, Hoinville et al. 1992; Wilesmith, Ryan et al. 1992). The MBM was prepared by rendering the offal of sheep and cattle using a process that involved steam treatment and hydrocarbon solvent extraction. The extraction process produced protein and fat-rich fractions; the protein or greaves fraction contained about 1% fat from which the MBM was prepared. In the late 1970s, the price of tallow prepared from the fat fraction fell, making it no longer profitable to use hydrocarbons in the rendering process. The resulting MBM contained about 14% fat; maybe the high lipid content protected scrapie prions in the sheep offal from being completely inactivated by steam. Since 1988, the practice of using dietary protein supplements for domestic animals derived from rendered sheep or cattle offal has been forbidden in the UK. Curiously, almost half of the BSE cases have occurred in herds where

314

Emerging foodborne pathogens

only a single affected animal has been found; several cases of BSE in a single herd are infrequent (Wilesmith, Wells et al. 1988; Dealler and Lacey 1990; Wilesmith and Wells 1991; Weissmann and Aguzzi 1997). In 1992, the BSE epidemic reached a peak, with over 35,000 cattle afflicted. In 1993, fewer than 32,000 cattle were diagnosed with BSE and in 1994 the number was approximately 22,000. In 2004, BSE had become a rare disease in British and European cattle, but regrettably (and quite inexplicably) it still had not completely disappeared. Indeed, there are currently concerns over whether BSE could be transmitted to sheep and goats and present a new threat to human health. Experimental studies have shown that sheep are susceptible to oral BSE infections (Jeffrey et al. 2001), and recently, a natural case of BSE in a goat was discovered (Eloit, 2005). Transmission of BSE to experimental animals Brain extracts from BSE cattle have transmitted disease to mice, cattle, sheep and pigs after intracerebral inoculation (Fraser, McConnell et al. 1988; Dawson, Wells et al. 1990a, b; Bruce, Chree et al. 1993). Transmissions to mice and sheep suggest that cattle preferentially propagate a single ‘strain’ of prions; seven BSE brains all produced similar incubation times as measured in each of three strains of inbred mice (Bruce, Chree et al. 1993). However, this notion was recently challenged on the basis of transgenetic studies (Asante, Linehan et al. 2002). Incontrovertible evidence for the existence of several BSE strains, in the opinion of the authors, has yet to be provided. Of particular importance to the BSE epidemic is the transmission of BSE to the non-human primate marmoset after intracerebral inoculation following a prolonged incubation period (Baker, Ridley et al. 1993). The potential parallels with kuru of humans, confined to the Fore region of New Guinea (Gajdusek, Gibbs et al. 1966; Gajdusek 1977), are worthy of consideration. Once the most common cause of death among women and children in that region, kuru has almost disappeared with the cessation of ritualistic cannibalism (Alpers 1987). Although it seems likely that kuru was transmitted orally, as proposed for BSE among cattle, some investigators argue that other routes of transmission were important because oral transmission of kuru to apes and monkeys has been difficult to demonstrate (Gajdusek 1977; Gibbs, Amyx et al. 1980). Oral interspecies prion transmission Besides BSE, four other animal diseases seem to have arisen from ingestion of prions. It has been suggested that an outbreak of transmissible mink encephalopathy in 1985 arose from feeding BSE-contaminated foodstuffs to mink (Marsh, Bessen et al. 1991). The prion-contaminated MBM thought to be the cause of BSE as well as BSE-contaminated pet foods are also most likely the cause of exotic ungulate encephalopathy and feline spongiform encephalopathy (FSE) respectively. FSE has been found in domestic cats throughout Europe, as well as in a puma and a cheetah (Willoughby, Kelly

Prion diseases

315

et al. 1992). Three cases of FSE in domestic cats have been transmitted to laboratory mice and PrPSc has been identified in their brains by immunoblotting (Pearson, Wyatt et al. 1992). Whether FSE may have transmitted to a human (Zanusso, Nardelli et al. 1998) remains anectodal and unproven. Prion disease has been found in the brains of the nyala, greater kudu, eland, gembok and Arabian oryx in British zoos; all of these animals are exotic ungulates. Of eight greater kudu born into a herd maintained in a London zoo since 1987, five have developed prion disease. Except for the first case, none of the other four kudu was exposed to feeds containing ruminant-derived MBM (Kirkwood, Cunningham et al. 1993). Brain extracts prepared from a nyala and a greater kudu have been transmitted to mice (Kirkwood, Wells et al. 1990; Cunningham, Wells et al. 1993). PrP of the greater kudu differs from the bovine protein at four residues; Arabian oryx PrP differs from the sheep PrP at only one residue (Poidinger, Kirkwood et al. 1993).

12.2.5 Chronic wasting disease of deer and elk As the only prion disease of wildlife, chronic wasting disease of deer and elk (CWD) was initially reported in 1980 as a TSE in captive research deer in Colorado and Wyoming, although the disease origin remains obscure (Williams and Young 1980). Since 1980, free-ranging mule deer (Odocoileus hemionus), white-tailed deer (O. virginanus), and Rocky Mountain elk (Cervus elaphus nelsoni) have been detected in the same region of Colorado and Wyoming (Spraker, Miller et al. 1997), but recently increased surveillance efforts across the U.S. and Canada have startlingly revealed CWD not only in adjacent states (Nebraska, New Mexico, and Utah) but also distant (Wisconsin, Illinois, Canada) from this original endemic region. Additionally, game ranched elk have not escaped the disease, with CWD being first detected in 1997. The staggeringly high transmission apparent in captive deer (up to 90% infected in one facility; (Williams and Young 1992)) and in free-ranging deer (up to 15%) (Miller, Williams et al. 2000), occurs by unknown mechanisms, but it is likely by a horizontal route; saliva or feces could potentially harbor infectious prions and contaminate grazing areas. Recently it was shown that environmental transmission can play a role in CWD transmission (Miller,Williams et al. 2004). Clinical signs of CWD are remarkably subtle and nonspecific, characterized by lethargy, weight loss, flaccid hypotonic facial muscles, polydipsia/polyuria, excessive salivation, and behavioral changes, such as loss of fear of humans (Williams and Young 1980). Of the TSEs, histologic brain lesions are most similar to BSE and scrapie, and include large single or septate intraneuronal vacuoles prominent in the parasympathetic vagal nucleus of the medulla oblongata, and also evident in the thalamus, hypothalamus, pons, midbrain, and olfactory cortex (Williams and Young 1993; Spraker, Miller et al. 1997). Similar to scrapie, PrPCWD is abundant in secondary lymphoid tissues, and can be detected in tonsil, Peyer’s patches, and ileocecal lymph node by IHC

316

Emerging foodborne pathogens

as early as 12 weeks after experimental oral CWD inoculation (Sigurdson, Williams et al. 1999). The capacity for CWD transmission to other species is clearly an area of great concern. Unfortunately very little is known about the risk for other wildlife species, domestic ruminants, or humans contracting the disease. Cattle have been inoculated intracerebrally with CWD, and by six years post-inoculation (pi), five of 13 had developed PrPSc in the brain (Hamir, Cutlip et al. 2001; Hamir, et al. 2005). No cattle which have been orally inoculated have showed clinical signs of a TSE at 63 months pi (M.W. Miller and E.S. Williams, unpublished findings). Thus cattle appear to be highly resistant to CWD by a natural route of exposure. The ability of PrPCWD to convert human PrPc in vitro was determined to be inefficient, but similar to the efficiency of PrPBSE to convert human PrPc (Raymond, Bossers et al. 2000).

12.2.6 Human prion diseases The human prion diseases are manifest as infectious, inherited and sporadic disorders, and are often referred to as kuru, sporadic CJD, familial CJD, variant CJD (vCJD), Gerstmann-Sträussler-Scheinker syndrome (GSS) and fatal familial insomnia (FFI), depending upon the clinical, genetic, and neuropathological findings. Familial CJD, GSS, and FFI are inherited prion diseases due to genetic mutations in the PRNP gene. Sporadic CJD (sCJD) occurs worldwide, yet the cause of sCJD remains unknown. Less than 300 iatrogenic CJD cases have occurred from human growth hormones and dura mater transplants.

12.2.7 Variant Creutzfeldt-Jakob disease (vCJD) The most recently recognized form of CJD in humans, variant CJD (vCJD), was first described in 1996 and has been linked to BSE (Will and Zeidler 1996). vCJD represents a distinct clinico-pathological entity that is characterized at onset by psychiatric abnormalities, sensory symptoms and ataxia, and eventually leads to dementia along with other features usually observed in sporadic CJD. vCJD is distinguishable from sporadic cases in that the patients are very young (vCJD: 19–39 yr.; sporadic CJD: 55–70 yr.) and duration of the illness is rather long (vCJD: 7.5–22 months; sporadic CJD: 2.5–6.5 months). Moreover, vCJD displays a distinct pathology within the brain characterized by abundant ‘florid plaques’, decorated by a daisy-like pattern of vacuolation. Most cases of vCJD have been observed in the United Kingdom (Will, Zeidler et al. 2000). For several years, it has been thought that prions are distributed much more broadly within the body of vCJD victims than of sCJD patients (Wadsworth, Joiner et al. 2001). However, this view has recently been challenged by the finding of PrPSc in muscle and spleen of sCJD patients (Glatzel, Abela et al. 2003).

Prion diseases

317

Given that a large fraction of the European population may have been exposed to BSE prions, yet only a minute minority developed vCJD, there can be hardly any doubt that additional genetic modifiers exist, other than PRNP polymorphisms. It was originally claimed that specific allelotypes of the major histocompatibility complex may represent such modifiers (Jackson, Beck et al. 2001), but this was not confirmed by later studies (Pepys, Bybee et al. 2003). So what will the numbers of vCJD victims be in the future? Fortunately, we have not yet seen a large-scale epidemic of this terrible disease. Although many mathematical models have been generated (Ghani, Ferguson et al. 1998; Ghani, Donnelly et al. 2000), the number of cases is still too small to predict future developments with any certainty. Since the year 2001, the incidence of vCJD in the UK appears to be stabilizing and may actually even be falling. One may argue that it is too early to draw any far-reaching conclusions, but each month passing without any dramatic rise in the number of cases increases the hope that perhaps the total number of vCJD victims will be limited (Valleron, Boelle et al. 2001).

12.3

Detection

As in any other disease, early diagnosis would significantly advance the chances of success of an interventional approach. But when compared to other fields of microbiological diagnostics, the tools for prion diagnosis appear to be depressingly unsophisticated. Presymptomatic diagnosis is virtually impossible, and the earliest possible diagnosis is based on clinical signs and symptoms. Hence, prion infection is typically diagnosed after the disease has progressed considerably.

12.3.1 Diagnosis of animal prion diseases Animal TSEs vary considerably in the PrPSc tissue distribution as well as clinical signs. Scrapie and CWD can be diagnosed preclinically by tonsil or conjunctival biopsy and PrP immunohistochemistry, however, even in these diseases not all cases have a lymphoid phase of PrP replication (Spraker, Balachandran et al. 2004). With regard to animals destined for the human food chain, there is the additional crucial need to determine presence of the prion agent in tissues in asymptomatic carriers, well before the appearance of any clinical symptoms. This applies equally to the detection of subclinically prion-infected humans, who may participate in tissue donation programs. To be optimally useful, prion diagnostics should identify ‘suspect’ cases as early during pathogenesis as possible. However, the currently available methods are quite insensitive when compared to those available for other infectious diseases. PrPSc represents the only disease-specific macromolecule identified to date, and all approved commercial testing procedures are based

318

Emerging foodborne pathogens

on the immunological detection of PrPSc. While around fifty companies are reported to be developing prion diagnostic assays, all commercial test kits validated for use by the European Union rely on proteolytic removal of endogenous PrPC prior to detection of PrPSc. Circumvention of the protease digestion step might theoretically yield increased sensitivity of PrPSc-based detection methods and make these methods more amenable to high-throughput technologies. However, it has proved difficult to discriminate between PrPC and PrPSc with antibodies, despite some early reports (Korth, Stierli et al. 1997). Interestingly, tyrosine-tyrosinearginine (YYR) motifs (Paramithiotis, Pinard et al. 2003) were believed to be more solvent-accessible in the pathological isoform of PrP and a monoclonal antibody directed against these motifs was reported to be capable of selectively detecting PrPSc across a variety of platforms. However, YYR motifs are certainly not unique to pathological prion proteins and it remains to be determined whether this reagent can really improve the sensitivity of detection of prion infections. A significant advance in prion diagnostics was achieved in 1997 by the discovery that protease-resistant PrPSc can be detected in tonsillar tissue of vCJD patients (Hill, Zeidler et al. 1997). It was hence proposed that tonsil biopsy may be the method of choice for diagnosis of vCJD (Hill, Butterworth et al. 1999). Furthermore, there have been reports of individual cases showing detection of PrPSc at preclinical stages of the disease in tonsil (Schreuder, Vankeulen et al. 1996) as well as in the appendix (Hilton, Fathers et al. 1998), indicating that lymphoid tissue biopsy may be useful for diagnosing presymptomatic individuals. These observations triggered large screenings of human populations for subclinical vCJD prevalence using appendectomy and tonsillectomy specimens (Glatzel, Ott et al. 2003). PrPSc-positive lymphoid tissue was long considered to be a vCJD-specific feature which would not apply to any other forms of human prion diseases (Hill, Butterworth et al. 1999). However, a recent survey of peripheral tissues of patients with sporadic CJD has identified PrPSc in as many as one-third of skeletal muscle and spleen samples (Glatzel, Abela et al. 2003), as well as the olfactory epithelium of patients suffering from sCJD (Zanusso, Ferrari et al. 2003). These unexpected findings raise the hope that minimally invasive diagnostic procedures may take the place of brain biopsies in intravital CJD diagnostics. The sensitivity of PrPSc detection was significantly improved by the sodium phosphotungstic (NaPTA) precipitation method (Safar, Wille et al. 1998). Concentration of PrPSc prior to Western blot analysis improves the sensitivity of diagnostic assays by as much as four orders of magnitude (Wadsworth, Joiner et al. 2001). Another interesting development was brought about by the conformation-dependent immunoassay (CDI), in which conformational differences of PrP isoforms are mapped by quantitating the relative binding of antibodies to denatured and native protein (Safar, Wille et al. 1998). Rather than relying on protease resistance, the CDI measures a variety of misfolded PrP isoforms, which may increase its sensitivity (Safar, Scott et al. 2002; Bellon, Seyfert-Brandt et al. 2003).

Prion diseases

319

Be that as it may, all techniques described above suffer from the fact that PrPSc continues to represent a surrogate marker for prion infectivity – since (i) PrPSc has not been incontrovertibly shown to be congruent with the prion, and (ii) several manipulations in vitro and in vivo can render PrPC proteaseresistant without bestowing infectivity on it (Jackson, Hosszu et al. 1999). Therefore, determination of prion infectivity by bioassay remains the gold standard. As in Pasteur’s day, the concentration of the infectious agent is determined by inoculating serial dilutions of the test material into experimental animals, and the dilution at which 50% of the animals contract the disease (termed ID 50) is determined. Naturally, this system is riddled with inconveniences; scores of animals need to be sacrificed, and the incubation times are lengthy (transgenetic overexpression of PrPC can help, but only to some extent). Also the method tends to be very inaccurate. The inoculation schemes used in most studies typically suffer from standard errors of ±1 order of magnitude! A radical improvement of this situation is likely to be brought about by the use of prion-susceptible cell lines (Race, Fadness et al. 1987; Bosque and Prusiner 2000). The determination of prion infectivity endpoints in cultures of highly susceptible cells combines the sensitivity and intrinsic biological validity of the bioassay (i.e. direct measurement of the infectivity) with the speed and convenience of an in vitro methodology amenable to mediumthroughput automation (Klohn, Stoltze et al. 2003).

12.3.2 Diagnosis of human prion diseases Human prion disease should be considered in any patient who develops a progressive subacute or chronic decline in cognitive or motor function. Typically adults between 40 and 70 (or more) years of age, patients often exhibit clinical features helpful in providing a premorbid diagnosis of prion disease, particularly sporadic CJD (Roos, Gajdusek et al. 1973; Brown, Cathala et al. 1986). There is as yet no specific diagnostic test for prion disease in the cerebrospinal fluid; the concentration of the proteins 14-3-3 (Hsich, Kinney et al. 1996), S-100 and neuron-specific enolase is often increased, but these represent general markers of neuronal breakdown and do not allow for definite diagnosis of prion encephalopathy. A definitive diagnosis of human prion disease, which is invariably fatal, can often be made from the examination of brain tissue. Since 1992, knowledge of the molecular genetics of prion diseases has made it possible, using peripheral tissues, to diagnose inherited prion disease in living patients by sequencing the prion alleles. A broad spectrum of neuropathological features in human prion diseases precludes a precise neuropathological definition. The classic neuropathological features of human prion disease include spongiform degeneration, gliosis, and neuronal loss in the absence of any significant inflammatory reaction (Budka, Aguzzi et al. 1995). When present, amyloid plaques that stain with a-PrP antibodies are diagnostic.

320

Emerging foodborne pathogens

Horizontal transmission of inherited prion diseases from humans to experimental animals is frequently negative when using rodents, despite the presence of a pathogenic mutation in the PRNP gene (Tateishi, Kitamoto et al. 1992). New lines of transgenic mice with enhanced susceptibility to human or animal prions (Telling, Scott et al. 1994; Weissmann, Fischer et al. 1998) are starting to enable transmission studies that were not practical in apes and monkeys (Brown, Gibbs et al. 1994). In practical terms, however, a definitive diagnosis of human prion disease can be rapidly accomplished if PrPSc can be detected by Western immunoblot analysis of brain homogenates in which samples are subjected to limited proteolysis to remove PrPC before immunostaining (Bockman, Kingsbury et al. 1985; Brown, Coker Vann et al. 1986; Bockman, Prusiner et al. 1987; Serban, Taraboulos et al. 1990). Because of regional variations in PrPSc concentration, methods using homogenates prepared from small brain regions may give false negative results. Alternatively, PrPSc may be detected in situ in cryostat sections bound to nitrocellulose membranes followed by limited proteolysis to remove PrPC, and guanidinium salt treatment to denature PrPSc, and thus enhance its accessibility to a-PrP antibodies (Taraboulos, Jendroska et al. 1992). Denaturation of PrPSc in situ prior to immunostaining has also been accomplished by autoclaving fixed tissue sections (Kitamoto, Shin et al. 1992). In the familial forms of the prion diseases, molecular genetic analyses of PrP can be diagnostic and can be performed on DNA extracted from blood leucocytes ante mortem. Unfortunately, such testing is of little value in the diagnosis of the sporadic or infectious forms of prion disease. In summary, the diagnosis of prion disease may be made in patients on the basis of (i) the presence of PrPSc, (ii) mutant PrP genotype or (iii) appropriate immunohistology, and should not be excluded in patients with atypical neurodegenerative diseases until one, or preferably two, of these examinations have been performed.

12.4

Transmission

There is no example of zoonotic transmission of prions from sheep and goats to humans: many epidemiological studies have failed to implicate scrapie prions from sheep as a cause of CJD (Malmgren, Kurland et al. 1979; Harries Jones, Knight et al. 1988; Cousens, Harries Jones et al. 1990). However, there is uncertainty about whether chonic wasting disease of deer and elk represents a threat to humans who ingest the meat. Actually, even transmissibility of BSE to humans relies on circumstantial evidence. Epidemiology and biochemistry favour the link between BSE and vCJD, but the evidence is not ultimately conclusive. The Koch postulates (which would unambiguously assign an infectious agent to a disease) have never been fulfilled, i.e., experimental inoculation of humans was never performed to

Prion diseases

321

prove this link. Also, accidental oral exposure to BSE infectivity of a sizable group of people at a precisely defined time point has never occurred, or did not result in disease. For these reasons, speculation that vCJD disease may not be due to BSE have never completely subsided. Likewise, we do not know whether scrapie affects only sheep and goats, or whether it can cross species barriers and infect humans. Finally, it is unknown whether BSE, upon transmission to sheep, remains as dangerous for humans as cow-derived BSE, or whether it becomes attenuated and acquires the (allegedly) innocuous properties of bona fide sheep scrapie. Another question relates to the possibility of chronic sub-clinical disease or a permanent ‘carrier’ status in cows as well as in humans. Evidence that such a carrier status may be produced by the passage of the infectious agent across species was first reported by Race and Chesebro (Aguzzi and Weissmann 1998; Race and Chesebro 1998), and has been confirmed by others (Hill, Joiner et al. 2000) – at least for the passage between hamsters and mice. Immune deficiency can also lead to a similar situation in which prions replicate silently in the body, even when there is no species barrier (Frigg, Klein et al. 1999). So the problem of animal transmissible spongiform encephalopathies could be more widespread than is assumed, and may call for drastic prion surveillance measures in farm animals. Moreover, people carrying the infectious agent may transmit it horizontally (Aguzzi 2000), and the risks associated with this possibility can be met only if we know more about how the agent is transmitted and how prions reach the brain from peripheral sites.

12.5

Prevention and control

Several substances may alter prion infection in mammals; a non-exhaustive list includes compounds as diverse as Congo red (Caughey and Race 1992), amphotericin B (Pocchiari, Schmittinger et al. 1987), anthracyclin derivatives (Tagliavini, McArthur et al. 1997), sulfated polyanions (Caughey and Raymond 1993), pentosan polysulphate (Farquhar, Dickinson et al. 1999), soluble lymphotoxin-ß receptors (Montrasio, Frigg et al. 2000), porphyrins (Priola, Raines et al. 2000), branched polyamines (Supattapone, Wille et al. 2001), and beta-sheet breaker peptides (Soto, Kascsak et al. 2000). However, it is sobering that none of the substances have yet made it to any validated clinical use; quinacrine appears to represent the most recent unfulfilled promise (Collins, Lewis et al. 2002). On the other hand, the tremendous interest in this field has attracted researchers from various neighbouring disciplines, including immunology, genetics, and pharmacology, and therefore it is to be hoped that rational and efficient methods for managing prion infections will be developed in the future.

322

Emerging foodborne pathogens

12.5.1 Targeting follicular dendritic cells PrPSc typically accumulates in secondary follicles of the spleen, lymph node, tonsils, and Peyer’s patches on cells known as follicular dendritic cells (FDCs). This phenomenon appears to occur, to a variable extent, in prion diseases including vCJD, scrapie, and CWD, as well as in mouse scrapie and CJD models. Would ablation of FDCs impair formation of PrPSc depots? This question was addressed by inhibiting the LTa/b signalling pathway with soluble LTbR immunoglobulin fusion protein (LTbR-Ig ‘immunoadhesin’), which effectively disbands mature FDC networks. Soluble LTbR-Ig administered before prion inoculation abolished splenic prion replication and delayed neuroinvasion. Moreover, post-prion treatment with soluble LTbR also led to a modest delay in disease development, although splenic prion infectivity was detectable at eight weeks post-inoculation. Therefore, post-exposure treatment of humans with LTbR-Ig could only be considered as a prophylaxis in cases of known prion exposure at well defined early time points. This might include researchers, pathologists, neurologists, neurosurgeons and technicians after accidental CJD injection, or recipients of blood transfusions from patients with CJD. In these instances, we think that a case could be made for experimental use of post-exposure prophylaxis with LTbR-Ig. Prophylaxis should be administered as soon as possible, and it should be clearly kept in mind that LTbR-Ig will not offer any relief to patients with overt CJD, for whom neural entry has already taken place.

12.5.2 Immunization against prion disease Antibodies against PrPSc are not generated during the course of prion infections, but artificial induction of humoral immune responses to PrPC and/or PrPSc might be protective. However, vaccination against the prion protein has proven exceedingly challenging. First, wild-type mice are highly tolerant to PrP as an immunogen. This is not surprising, since PrPC is expressed nearly ubiquitously and is found on the surface of both B and T cells. Second, it was generally believed – with good reason – that antibodies against PrPC, if they can be elicited at all, might lead to severe systemic immune mediated diseases, since PrP is expressed on many cell types. Finally, PrP-specific antibodies would be unlikely to cross the blood brain barrier in therapeutic concentrations. In 2001, it was reported that a transgenic mouse model expressing antiprion m chain antibodies experienced complete protection against prion disease after a peripheral route of exposure (intraperitoneal). In parallel, many other publications addressed prion immunoprophylaxis, both in vitro and in vivo. White et al. (2003) showed that passive anti-PrP immunization delivered after prion exposure delayed disease, and markedly increased the incubation period compared with non-immunized mice. However, active immunization efforts have so far not led to a high anti-PrP titer, owing to the immune tolerance. Moreover, intracranial delivery of PrPC-specific antibodies has

Prion diseases

323

been recently shown to result in neuronal apoptosis in the cerebellum and hippocampus, most likely through clustering of PrPC, which is thought to trigger an abnormal signalling pathway. These results are alarming and certainly reinforce the concept that adequate in vivo safety studies must be carried out before prion immunoprophylaxis trials in humans. On the other hand, it should be noted that neuronal loss occurred only with antibodies targeting a subset of PrP epitopes (within amino acids 95–105 of the PrP sequence), and only at extremely high concentrations of antibody. Hence, we do not believe that Solforosi’s data entirely rules out any prospect for antiprion immunization. In terms of food safety, surveillance of farm animals for BSE and new atypical TSEs will continue to be important. Equally key for human health is the exclusion of specified risk materials (SRM), such as brain and spinal cord of ruminants, from human and animal food.

12.6

Future trends

The extent of exposure of the European population to BSE is unknown. It could well be that millions of people have been exposed to the BSE agent, considering that the prevalence of subclinical BSE in slaughtered cattle may have peaked at about 20% in the UK and was certainly high in other European countries. Fortunately, only approximately 147 cases of vCJD have been recorded so far (as of July 2004) (CJD Surveillance Unit, University of Edinburough; http://www.cjd.ed.ac.uk/figures.htm) Since BSE, in the meantime, has been drastically reduced among cattle, and multiple safety measures have been put into place throughout the human food chain, the danger of contracting a prion infection from cattle is, nowadays, arguably minimal. However, it must be assumed that an unknown proportion of humans are currently subclinically infected with BSE prions. While some of these people may progress to overt disease (vCJD or other, hitherto unrecognized phenotypic manifestations of BSE infection), an unknown proportion of infected individuals may establish a permanent subclinical carrier state. It will be a high public health priority to find out whether – and how – these people may inadvertently pass on the agent to others. For example, the possibility of prion transmission through blood transfusion from preclinical vCJD patients has incited radical measures to prevent this scenario. As a consequence, the United Kingdom and many other countries have introduced universal leukodepletion of blood units. However, it is unknown whether this very costly measure is adequate or necessary, since the partitioning of prion infectivity in blood is unclear. In addition, the United Kingdom is sourcing its entire supply of plasma and plasma-derived products from abroad. Most recently, recipients of blood transfusions have been banned from donating further. By contrast, labile blood products, such as thrombocytes and erythrocytes, are too scarce to be outsourced. Nonetheless, a vCJD case has recently emerged in the UK that might have resulted from

324

Emerging foodborne pathogens

transfusing a blood unit from a preclinical vCJD-infected donor. Unfortunately, records show that 48 people in the UK have received blood transfusions from donors who later developed vCJD. In the long run, one would hope that this accrued knowledge will be put into useful practice. What surrogate markers might be useful to improve sensitivity and specificity of prion disease diagnosis? What prevention strategy could be used in people with known exposure to prions or in animals in high risk environments? What treatment strategy could be attempted to curb prion diseases during the clinical phase? The tremendous interest in the prion field has attracted researchers from various neighboring disciplines, including immunology, genetics, and pharmacology, and therefore it is to be hoped that rational and efficient methods for managing prion infections will be developed in the future. Additionally, with the spread of BSE to goats, potential consequences to food safety should be considered and thus an EU Committee has formed to address this potential risk.

12.7

Prion terminology

Prion: agent of transmissible spongiform encephalopathy (TSE), with unconventional properties. The term does not have structural implications other than that a protein is an essential component. ‘Protein-only’ hypothesis: maintains that the prion is devoid of informational nucleic acid, and that the essential pathogenic component is protein (or glycoprotein). Genetic evidence indicates that the protein is an abnormal form of PrP (perhaps identical with PrPSc). The association with other ‘noninformational’ molecules (such as lipids, glycosamino glycans, or maybe even short nucleic acids) is not excluded. PrPC: the naturally occurring form of the mature Prnp gene product. Its presence in a given cell type is necessary, but not sufficient, for replication of the prion. PrPSc: an ‘abnormal’ form of the mature Prnp gene product found in tissue of TSE sufferers, defined as being partly resistant to digestion by proteinase K under standardized conditions. It is believed to differ from PrPC only (or mainly) conformationally, and is often considered to be the transmissible agent or prion. Encephalopathy: a general term for diseases affecting the brain, including metabolic, toxic, traumatic, infectious, and neoplastic disorders. Although used to describe the lesions of prion diseases, the transmissible spongiform encephalopathies also affect the spinal cord. Follicular dendritic cells (FDCs): cells with a dendritic morphology that are present in the lymphoid germinal centers, where they present intact antigens

Prion diseases

325

held in immune complexes or associated with complement receptors to B cells. FDCs are of non-haematopoietic origin, and are not related to dendritic cells. These definitions (Aguzzi and Weissmann 1997) describe our terminology which is, however, not agreed on by convention and is not necessarily used by others.

12.8

References

AGUZZI, A.

(1996). ‘Between cows and monkeys.’ Nature 381(6585): 734. (1997). ‘Neuro-immune connection in spread of prions in the body?’ The Lancet 349: 742–3. AGUZZI, A. (2000). ‘Prion diseases, blood and the immune system: concerns and reality.’ Haematologica 85(1): 3–10. AGUZZI, A., F. MONTRASIO, et al. (2001). ‘Prions: health scare and biological challenge.’ Nat Rev Mol Cell Biol 2(2): 118–26. AGUZZI, A., A. J. RAEBER (1998). ‘Transgenic models of neurodegeneration. Neurodegeneration: of (transgenic) mice and men.’ Brain Pathol 8(4): 695–7. AGUZZI, A., C. WEISSMANN (1996a). ‘Sleepless in Bologna: transmission of fatal familial insomnia.’ Trends Microbiol 4(4): 129–31. AGUZZI, A., C. WEISSMANN (1996b). ‘Spongiform encephalopathies: a suspicious signature.’ Nature 383(6602): 666–7. AGUZZI, A., C. WEISSMANN (1997). ‘Prion research: the next frontiers.’ Nature 389: 795– 8. AGUZZI, A., C. WEISSMANN (1998). ‘Spongiform encephalopathies. The prion’s perplexing persistence.’ Nature 392(6678): 763–4. ALPERS, M. (1987). Epidemiology and clinical aspects of kuru. Prions – Novel Infectious Pathogens Causing Scrapie and Creutzfeldt-Jakob Disease. S. B. Prusiner and M. M. P. Orlando, Academic Press: 451–65. ASANTE, E. A., J. M. LINEHAN, et al. (2002). ‘BSE prions propagate as either variant CJD-like or sporadic CJD-like prion strains in transgenic mice expressing human prion protein.’ Embo J 21(23): 6358–66. BAKER, H. F., R. M. RIDLEY, et al. (1993). ‘Evidence for the experimental transmission of cerebral beta-amyloidosis to primates.’ Int J Exp Pathol 74(5): 441–54. BELLON , A ., W . SEYFERT - BRANDT , et al. (2003). ‘Improved conformation-dependent immunoassay: suitability for human prion detection with enhanced sensitivity.’ J Gen Virol 84(Pt 7): 1921–5. BOCKMAN, J. M., D. T. KINGSBURY, et al. (1985). ‘Creutzfeldt-Jakob disease prion proteins in human brains.’ N Engl J Med 312(2): 73–8. BOCKMAN, J. M., S. B. PRUSINER, et al. (1987). ‘Immunoblotting of Creutzfeldt-Jakob disease prion proteins: host species-specific epitopes.’ Ann Neurol 21(6): 589–95. BOSQUE, P. J., S. B. PRUSINER (2000). ‘Cultured cell sublines highly susceptible to prion infection.’ J Virol 74(9): 4377–86. BRATBERG, B., K. UELAND, et al. (1995). ‘Feline spongiform encephalopathy in a cat in Norway.’ Vet Rec 136(17): 444. BROWN, P., F. CATHALA, et al. (1986). ‘Creutzfeldt-Jakob disease: clinical analysis of a consecutive series of 230 neuropathologically verified cases.’ Ann Neurol 20(5): 597– 602. BROWN, P., M. COKER VANN, et al. (1986). ‘Diagnosis of Creutzfeldt-Jakob disease by Western blot identification of marker protein in human brain tissue.’ N Engl J Med 314(9): 547–51. AGUZZI, A.

326

Emerging foodborne pathogens

BROWN, P., C. J. GIBBS, JR.,

et al. (1994). ‘Human spongiform encephalopathy: the National Institutes of Health series of 300 cases of experimentally transmitted disease.’ Ann Neurol 35(5): 513–29. BROWN P., J. P. BRANDEL, T. SATO, L. McSHANE, I. KERR, A. FLETCHER, R. G. WILL, M. POCCHIARI, N. R. CASHMAN, J. H. D’AIGNAUX, L. CERVENAKOVA, J. FRADKIN, L. B. SCHONBERGER, S. J. COLLINS (2000). ‘Iatrogenic Creutzfeldt-Jakob disease at the millennium.’ Neurology 55(8): 1075–81. BRUCE, M., A. CHREE, et al. (1993). Transmissions of BSE, scrapie and related diseases to mice. IXth International Congress of Virology, Glasgow. BRUCE, M. E., R. G. WILL, et al. (1997). ‘Transmissions to mice indicate that ‘new variant’ CJD is caused by the BSE agent ’ Nature 389(6650): 498–501. BUDKA, H., A. AGUZZI, et al. (1995). ‘Neuropathological diagnostic criteria for CreutzfeldtJakob disease (CJD) and other human spongiform encephalopathies (prion diseases).’ Brain Pathol 5(4): 459–66. BÜELER, H. R., A. AGUZZI, et al. (1993). ‘Mice devoid of PrP are resistant to scrapie.’ Cell 73(7): 1339–47. BUYUKMIHCI, N., M. RORVIK, et al. (1980). ‘Replication of the scrapie agent in ocular neural tissues.’ Proc Natl Acad Sci USA 77(2): 1169–71. CAUGHEY, B., R. E. RACE (1992). ‘Potent inhibition of scrapie-associated PrP accumulation by congo red.’ J Neurochem 59(2): 768–71. CAUGHEY, B., G. J. RAYMOND (1993). ‘Sulfated polyanion inhibition of scrapie-associated PrP accumulation in cultured cells.’ J Virol 67(2): 643–50. CHAZOT, G., E. BROUSSOLLE, et al. (1996). ‘New variant of Creutzfeldt-Jakob disease in a 26-year-old French man [letter].’ Lancet 347(9009): 1181. COLLINGE, J., K. C. SIDLE, et al. (1996). ‘Molecular analysis of prion strain variation and the aetiology of ‘new variant’ CJD.’ Nature 383(6602): 685–90. COLLINS, S. J., V. LEWIS, et al. (2002). ‘Quinacrine does not prolong survival in a murine Creutzfeldt-Jakob disease model.’ Ann Neurol 52(4): 503–6. COUSENS, S. N., R. HARRIES JONES, et al. (1990). ‘Geographical distribution of cases of Creutzfeldt-Jakob disease in England and Wales 1970–84.’ J Neurol Neurosurg Psychiatry 53(6): 459–65. CUILLE, J., P. L. CHELLE (1939). ‘Experimental transmission of trembling to the goat.’ C R Seances Acad Sci 208: 1058–1160. CUNNINGHAM, A. A., G. A. WELLS, et al. (1993). ‘Transmissible spongiform encephalopathy in greater kudu (Tragelaphus strepsiceros).’ Vet Rec 132(3): 68. DAWSON, M., G. A. WELLS, et al. (1990a). ‘Preliminary evidence of the experimental transmissibility of bovine spongiform encephalopathy to cattle.’ Vet Rec 126(5): 112– 3. DAWSON, M., G. A. WELLS, et al. (1990b). ‘Primary parenteral transmission of bovine spongiform encephalopathy to the pig [letter]’ Vet Rec 127(13): 338. DEALLER, S. F., R. W. LACEY (1990). ‘Transmissible sponigform encephalopathies: the threat of BSE to man.’ Food Microbiol 7: 253–79. ELOIT, M. et al. (2005) ‘BSE agent signatures in a goat.’ Vet Rec 156: 523–4. FARQUHAR, C., A. DICKINSON, et al. (1999). ‘Prophylactic potential of pentosan polysulphate in transmissible spongiform encephalopathies [letter].’ Lancet 353(9147): 117. FISCHER, M., T. RÜLICKE, et al. (1996). ‘Prion protein (PrP) with amino-proximal deletions restoring susceptibility of PrP knockout mice to scrapie.’ EMBO J 15(6): 1255–64. FLECHSIG, E., D. SHMERLING, et al. (2000). ‘Prion protein devoid of the octapeptide repeat region restores susceptibility to scrapie in PrP knockout mice.’ Neuron 27(2): 399– 408. FRASER, H., I. MCCONNELL, et al. (1988). ‘Transmission of bovine spongiform encephalopathy to mice.’ Vet Rec 123(18): 472. FRIGG, R., M. A. KLEIN, et al. (1999). ‘Scrapie pathogenesis in subclinically infected B-celldeficient mice.’ J Virol 73(11): 9584–8.

Prion diseases GAJDUSEK, D. C.

327

(1977). ‘Unconventional viruses and the origin and disappearance of kuru.’ Science 197(4307): 943–60. GAJDUSEK, D. C., C. J. GIBBS, et al. (1966). ‘Experimental transmission of a Kuru-like syndrome to chimpanzees.’ Nature 209: 794–6. GHANI, A. C., C. A. DONNELLY, et al. (2000). ‘Assessment of the prevalence of vCJD through testing tonsils and appendices for abnormal prion protein.’ Proc R Soc Lond B Biol Sci 267(1438): 23–9. GHANI, A. C., N. M. FERGUSON, et al. (1998). ‘Estimation of the number of people incubating variant CJD [letter].’ Lancet 352(9137): 1353–4. GIBBS, C. J. JR., H. L. AMYX, et al. (1980). ‘Oral transmission of kuru, Creutzfeldt-Jakob disease, and scrapie to nonhuman primates.’ J Infect Dis 142(2): 205–8. GIBBS, C. J. JR., D. C. GAJDUSEK, et al. (1968). ‘Creutzfeldt-Jakob disease (spongiform encephalopathy): transmission to the chimpanzee.’ Science 161(839): 388–9. GLATZEL, M., E. ABELA, et al. (2003). ‘Extraneural pathologic prion protein in sporadic Creutzfeldt-Jakob disease.’ N Engl J Med 349(19): 1812–20. GLATZEL, M., P. M. OTT, et al. (2003). ‘Human prion diseases: epidemiology and integrated risk assessment.’ The Lancet Neurology 2(12): 757–63. GLATZEL, M., V. PEKARIK, et al. (2002). ‘Analysis of the prion protein in primates reveals a new polymorphism in codon 226 (Y226F).’ Biol Chem 383((6)): 1021–5. GLATZEL, M., C. ROGIVUE, et al. (2002). ‘Incidence of Creutzfeldt-Jakob disease in Switzerland.’ Lancet 360(9327): 139–41. GORDON, W. S. (1946). ‘Advances in veterinary research.’ Vet Res 58: 516–20. HADLOW, W. J. (1959). ‘Scrapie and kuru.’ Lancet 2: 289–290. HADLOW, W. J., C. M. EKLUND, et al. (1974). ‘Course of experimental scrapie virus infection in the goat.’ J Infect Dis 129(5): 559–67. HADLOW, W. J., R. C. KENNEDY, et al. (1980). ‘Virologic and neurohistologic findings in dairy goats affected with natural scrapie.’ Vet Pathol 17(2): 187–99. HAMIR, A. N., R. C. CUTLIP, et al. (2001). ‘Preliminary findings on the experimental transmission of chronic wasting disease agent of mule deer to cattle.’ J Vet Diagn Invest 13(1): 91– 6. HAMIR, A. N. et al. (2005). ‘Experimental transmission of chronic wasting disease agent from mule deer to cattle by the intracerebral route.’ J Vet Diagn Invest 17: 276–81. HANSON, R. P., R. J. ECKROADE, et al. (1971). ‘Susceptibility of mink to sheep scrapie.’ Science 172(985): 859–61. HARRIES JONES, R., R. KNIGHT, et al. (1988). ‘Creutzfeldt-Jakob disease in England and Wales, 1980–1984: a case-control study of potential risk factors.’ J Neurol Neurosurg Psychiatry 51(9): 1113–9. HILL, A. F., R. J. BUTTERWORTH, et al. (1999). ‘Investigation of variant Creutzfeldt-Jakob disease and other human prion diseases with tonsil biopsy samples.’ Lancet 353(9148): 183–9. HILL, A. F., M. DESBRUSLAIS, et al. (1997). ‘The same prion strain causes vCJD and BSE [letter]’ Nature 389(6650): 448–50. HILL, A. F., S. JOINER, et al. (2000). ‘Species-barrier-independent prion replication in apparently resistant species.’ Proc Natl Acad Sci USA 29(97 (18)): 10248–53. HILL, A. F., M. ZEIDLER, et al. (1997). ‘Diagnosis of new variant Creutzfeldt-Jakob disease by tonsil biopsy.’ Lancet 349: 99. HILTON, D. A., E. FATHERS, et al. (1998). ‘Prion immunoreactivity in appendix before clinical onset of variant Creutzfeldt-Jakob disease [letter].’ Lancet 352(9129): 703–4. HOPE, J., L. J. REEKIE, et al. (1988). ‘Fibrils from brains of cows with new cattle disease contain scrapie-associated protein.’ Nature 336(6197): 390–2. HOUSTON, F., J. D. FOSTER, et al. (2000). ‘Transmission of BSE by blood transfusion in sheep.’ Lancet 356: 999–1000. HSICH, G., K. KINNEY, et al. (1996). ‘The 14-3-3 Brain Protein in Cerebrospinal Fluid As a Marker For Transmissible Spongiform Encephalopathies.’ New England Journal of Medicine 335(13): 924–930.

328

Emerging foodborne pathogens

JACKSON, G. S., J. A. BECK,

et al. (2001). ‘HLA-DQ7 antigen and resistance to variant CJD.’ Nature 414(6861): 269–70. JACKSON, G. S., L. L. HOSSZU, et al. (1999). ‘Reversible conversion of monomeric human prion protein between native and fibrilogenic conformations.’ Science 283(5409): 1935–7. JEFFREY, M. et al. (2001). ‘Oral inoculation of sheep with the agent of bovine spongiform encephalepathy (BSE). 1. Onset and distribution of disease-specific PrP acumulation in brain and viscera.’ J. Comp Pathol 124: 280–9. KIRKWOOD, J. K., A. A. CUNNINGHAM, et al. (1993). ‘Spongiform encephalopathy in a herd of greater kudu (Tragelaphus strepsiceros): epidemiological observations.’ Vet Rec 133(15): 360–4. KIRKWOOD, J. K., A. A. CUNNINGHAM (1994). ‘Epidemiological observations on spongiform encephalopathies in captive wild animals in the British Isles ’ Vet Rec 135(13): 296– 303. KIRKWOOD, J. K., G. A. WELLS, et al. (1990). ‘Spongiform encephalopathy in an arabian oryx (Oryx leucoryx) and a greater kudu (Tragelaphus strepsiceros)’ Vet Rec 127(17): 418– 20. KITAMOTO, T., R. W. SHIN, et al. (1992). ‘Abnormal isoform of prion proteins accumulates in the synaptic structures of the central nervous system in patients with CreutzfeldtJakob disease.’ Am J Pathol 140(6): 1285–94. KLOHN, P. C., L. STOLTZE, et al. (2003). ‘A quantitative, highly sensitive cell-based infectivity assay for mouse scrapie prions.’ Proc Natl Acad Sci U S A 100(20): 11666–71. KORTH, C., B. STIERLI, et al. (1997). ‘Prion (PrPSc)-specific epitope defined by a monoclonal antibody.’ Nature 390(6655): 74–7. LASMEZAS, C. I., J. P. DESLYS, et al. (1996). ‘Bse Transmission to Macaques.’ Nature 381(6585): 743–744. MALMGREN, R., L. KURLAND, et al. (1979). ‘The epidemiology of Creutzfeldt-Jakob disease’. SlowTransmissible Diseases of the Nervous System. S. B. Prusiner and W. J. Hadlow. New York, Academic Press. 1: 93–112. MARSH, R. F., R. A. BESSEN, et al. (1991). ‘Epidemiological and experimental studies on a new incident of transmissible mink encephalopathy.’ J Gen Virol 72(Pt 3): 589–94. MARSH, R. F., R. A. BESSEN (1993). ‘Epidemiologic and experimental studies on transmissible mink encephalopathy.’ Dev Biol Stand 80: 111–8. MARSH, R. F., W. J. HADLOW (1992). ‘Transmissible mink encephalopathy.’ Rev Sci Tech 11(2): 539–50. MARSH, R. F. (1979). In Slow Transmissible Diseases of the Nervous System. (S. B. Prusiner (ed.)), New York, Academic Press: 451–60. M’GOWAN, J. P. (1914). Investigation into the Disease of Sheep Called ‘Scrapie’. Edinburgh, William Blackwood. MILLER, M. W., E. S. WILLIAMS, et al. (2000). ‘Epizootiology of chronic wasting disease in free-ranging cervids in Colorado and Wyoming.’ J Wildl Dis 36(4): 676–90. MILLER, M. W., E. S. WILLIAMS, N. T. HOBBS, L. L. WOLFE (2004). ‘Environmental sources of prion transmission in mule deer.’ Emerg Infect Dis 10: 1003–6. MONTRASIO, F., R. FRIGG, et al. (2000). ‘Impaired prion replication in spleens of mice lacking functional follicular dendritic cells.’ Science 288(5469): 1257–9. NATHANSON, N., J. WILESMITH, et al. (1999). Prion Biology and Diseases. S. B. Prusiner. New York, Cold Spring Harbor Laboratory Press: 431–63. NICOTERA, P. (2001). ‘A route for prion neuroinvasion.’ Neuron 31(3): 345–8. ONODERA, T., T. IKEDA, et al. (1993). ‘Isolation of scrapie agent from the placenta of sheep with natural scrapie in Japan.’ Microbiol Immunol 37(4): 311–6. PALSSON, P. A. (1979). ‘Rida (scrapie) in Iceland and its epidemiology.’ Slow Transmissible Diseases of the Nervous System. S. B. Prusiner and W. J. Hadlow. New York, Academic Press. 1: 357–66. PARAMITHIOTIS, E., M. PINARD, et al. (2003). ‘A prion protein epitope selective for the pathologically misfolded conformation.’ Nat Med 9(7): 893–9.

Prion diseases PARRY, H. B.

329

(1983). Scrapie Disease in Sheep. New York, Academic Press. (1964). ‘The spread of Scrapie by contact between afected and healthy sheep, goats or mice.’ Vet Rec 76: 333–6. PATTISON, I. H., M. N. HOARE, et al. (1972). ‘Spread of scrapie to sheep and goats by oral dosing with foetal membranes from scrapie-affected sheep.’ Vet Rec 90(17): 465–8. PATTISON, I. H., G. C. MILLSON (1960). ‘Further observations on the experimental production of scrapie in goats and sheep.’ J Comp Pathol 70: 182–93. PATTISON, I. H., G. C. MILLSON (1961). ‘Experimental transmission of scrapie to goats and sheep by the oral route.’ J Comp Pathol 71: 171–6. PATTISON, I. H., G. C. MILLSON (1962). ‘Distribution of the scrapie agent in the tissues of experimentally inoculated goats.’ J Comp Pathol 72: 233–44. PEARSON, G. R., J. M. WYATT, et al. (1992). ‘Feline spongiform encephalopathy: fibril and PrP studies.’ Vet Rec 131(14): 307–10. PEPYS, M. B., A. BYBEE, et al. (2003). ‘MHC typing in variant Creutzfeldt-Jakob disease.’ Lancet 361(9356): 487–9. POCCHIARI, M., S. SCHMITTINGER, et al. (1987). ‘Amphotericin B delays the incubation period of scrapie in intracerebrally inoculated hamsters.’ J Gen Virol 68(Pt 1): 219–23. POIDINGER, M., J. KIRKWOOD, et al. (1993). ‘Sequence analysis of the PrP protein from two species of antelope susceptible to transmissible spongiform encephalopathy.’ Arch Virol 131(1-2): 193–9. PRIOLA, S. A., A. RAINES, et al. (2000). ‘Porphyrin and phthalocyanine antiscrapie compounds.’ Science 287(5457): 1503–6. PRUSINER, S. B. (1982). ‘Novel proteinaceous infectious particles cause scrapie.’ Science 216(4542): 136–44. PRUSINER, S. B., D. GROTH, et al. (1993). ‘Ablation of the prion protein (PrP) gene in mice prevents scrapie and facilitates production of anti-PrP antibodies.’ Proc Natl Acad Sci U S A 90(22): 10608–12. PRUSINER, S. B., W. J. HADLOW, et al. (1977). ‘Sedimentation properties of the scrapie agent.’ Proc Natl Acad Sci U S A 74(10): 4656–60. PRUSINER, S. B., M. R. SCOTT, et al. (1998). ‘Prion protein biology.’ Cell 93(3): 337–48. RACE, R. and B. CHESEBRO (1998). ‘Scrapie infectivity found in resistant species [letter] ’ Nature 392(6678): 770. RACE, R. E., L. H. FADNESS, et al., eds (1987). ‘Characterization of scrapie infection in mouse neuroblastoma cells.’ J Gen Virol 1391–9. RAYMOND, G. J., A. BOSSERS, et al. (2000). ‘Evidence of a molecular barrier limiting susceptibility of humans, cattle and sheep to chronic wasting disease.’ Embo J 19(17): 4425–30. ROOS, R., D. C. GAJDUSEK, et al. (1973). ‘The clinical characteristics of transmissible CreutzfeldtJakob disease.’ Brain 96(1): 1–20. RYDER, S. J., G. A. WELLS, et al. (2001). ‘Inconsistent detection of PrP in extraneural tissues of cats with feline spongiform encephalopathy.’ Vet Rec 148(14): 437–41. SAFAR, J. G., M. SCOTT, et al. (2002). ‘Measuring prions causing bovine spongiform encephalopathy or chronic wasting disease by immunoassays and transgenic mice.’ Nat Biotechnol 20(11): 1147–50. SAFAR, J., H. WILLE, et al. (1998). ‘Eight prion strains have PrP(Sc) molecules with different conformations.’ Nat Med 4(10): 1157–65. SAILER, A., H. BÜELER, et al. (1994). ‘No propagation of prions in mice devoid of PrP.’ Cell 77(7): 967–8. SCHREUDER, B. E. C., L. J. M. VANKEULEN, et al. (1996). ‘Preclinical Test For Prion Diseases.’ Nature 381(6583): 563. SERBAN, D., A. TARABOULOS, et al. (1990). ‘Rapid detection of Creutzfeldt-Jakob disease and scrapie prion proteins.’ Neurology 40(1): 110–7. SHMERLING, D., I. HEGYI, et al. (1998). ‘Expression of amino-terminally truncated PrP in the mouse leading to ataxia and specific cerebellar lesions.’ Cell 93(2): 203–14. PATTISON, I. H.

330

Emerging foodborne pathogens

SIGURDSON, C. J., E. S. WILLIAMS,

et al. (1999). ‘Oral transmission and early lymphoid tropism of chronic wasting disease PrPres in mule deer fawns (Odocoileus hemionus).’ J Gen Virol 80(Pt 10): 2757–64. SOTO, C., R. J. KASCSAK, et al. (2000). ‘Reversion of prion protein conformational changes by synthetic beta-sheet breaker peptides.’ Lancet 355(9199): 192–7. SPRAKER, T. R., M. W. MILLER, et al. (1997). ‘Spongiform encephalopathy in free-ranging mule deer (Odocoileus hemionus), white-tailed deer (Odocoileus virginianus) and Rocky Mountain elk (Cervus elaphus nelsoni) in northcentral Colorado.’ J Wildl Dis 33(1): 1–6. SPRAKER T. R., A. BALACHANDRAN, D. ZHUANG, K. I. O’ROURKE (2004). ‘Variable patterns of distribution of PrP(CWD) in the obex and cranial lymphoid tissues of Rocky Mountain elk (Cervus elaphus nelsoni) with subclinical chronic wasting disease.’ Veterinary Records 155(10): 295–302. SUPATTAPONE, S., P. BOSQUE, et al. (1999). ‘Prion protein of 106 residues creates an artifical transmission barrier for prion replication in transgenic mice.’ Cell 96(6): 869–78. SUPATTAPONE , S ., H. WILLE, et al. (2001). ‘Branched polyamines cure prion-infected neuroblastoma cells.’ J Virol 75(7): 3453–61. TAGLIAVINI, F., R. A. MCARTHUR, et al. (1997). ‘Effectiveness of anthracycline against experimental prion disease in Syrian hamsters.’ Science 276(5315): 1119–22. TARABOULOS, A., K. JENDROSKA, et al. (1992). ‘Regional mapping of prion proteins in brain.’ Proc Natl Acad Sci U S A 89(16): 7620–4. TATEISHI, J., T. KITAMOTO, et al. (1992). ‘Creutzfeldt-Jakob disease with amyloid angiopathy: diagnosis by immunological analyses and transmission experiments.’ Acta Neuropathol Berl 83(5): 559–63. TAYLOR, D. M. (2000). ‘Inactivation of transmissible degenerative encephalopathy agents: A review’ Vet J 159(1): 10–17. TELLING, G. C., M. SCOTT, et al. (1994). ‘Transmission of Creutzfeldt-Jakob disease from humans to transgenic mice expressing chimeric human-mouse prion protein.’ Proc Natl Acad Sci USA 91(21): 9936–40. VALLERON, A. J., P. Y. BOELLE, et al. (2001). ‘Estimation of epidemic size and incubation time based on age characteristics of vCJD in the United Kingdom.’ Science 294(5547): 1726–8. WADSWORTH, J. D. F., S. JOINER, et al. (2001). ‘Tissue distribution of protease resistant prion protein in variant CJD using a highly sensitive immuno-blotting assay.’ Lancet 358: 171–80. WEISSMANN, C., A. AGUZZI (1997). ‘Bovine spongiform encephalopathy and early onset variant Creutzfeldt-Jakob disease.’ Curr Opin Neurobiol 7(5): 695–700. WEISSMANN, C., M. FISCHER, et al. (1998). ‘The use of transgenic mice in the investigation of transmissible spongiform encephalopathies.’ Rev Sci Tech 17(1): 278–90. WELLS, G. A., A. C. SCOTT, et al. (1987). ‘A novel progressive spongiform encephalopathy in cattle.’ Vet.Rec. 121: 419–20. WHITE, A. R. et al. (2003). ‘Monoclonal antibodies inhibit prion replication and delay the development of prion disease.’ Nature 422: 80–3. WILESMITH, J. W., L. J. HOINVILLE, et al. (1992). ‘Bovine spongiform encephalopathy: aspects of the clinical picture and analyses of possible changes 1986–1990.’ Vet Rec 130(10): 197–201. WILESMITH, J. W., J. B. RYAN, et al. (1992). ‘Bovine spongiform encephalopathy: epidemiological features 1985 to 1990.’ Vet Rec 130(5): 90–4. WILESMITH , J . W ., G . A . WELLS , et al. (1988). ‘Bovine spongiform encephalopathy: epidemiological studies.’ Vet Rec 123(25): 638–44. WILESMITH, J. W., G. A. WELLS (1991). ‘Bovine spongiform encephalopathy.’ Curr Top Microbiol Immunol 172: 21–38. WILL, R., M. ZEIDLER (1996). ‘Diagnosing Creutzfeldt-Jakob Disease – Case Identification Depends On Neurological and Neuropathological Assessment.’ British Medical Journal 313(7061): 833–4.

Prion diseases WILL, R. G., J. W. IRONSIDE,

331

et al. (1996). ‘A new variant of Creutzfeldt-Jakob disease in the UK.’ Lancet 347(9006): 921–5. WILL, R. G., M. ZEIDLER, et al. (2000). ‘Diagnosis of new variant Creutzfeldt-Jakob disease.’ Ann Neurol 47(5): 575–82. WILLIAMS, E. S., S. YOUNG (1980). ‘Chronic wasting disease of captive mule deer: a spongiform encephalopathy.’ J Wildl Dis 16(1): 89–98. WILLIAMS, E. S., S. YOUNG (1982). ‘Spongiform encephalopathy of Rocky Mountain elk.’ J.Wildl.Dis. 18: 465–71. WILLIAMS, E. S., S. YOUNG (1992). ‘Spongiform encephalopathies in Cervidae.’ Rev Sci Tech 11(2): 551–67. WILLIAMS, E. S., S. YOUNG (1993). ‘Neuropathology of chronic wasting disease of mule deer (Odocoileus hemionus) and elk (Cervus elaphus nelsoni).’ Vet Pathol 30(1): 36–45. WILLIAMS, E. S., J. K., KIRKWOOD, et al. (2001). In Infectious Diseases of Wild Mammals. Ames, Iowa, Iowa State University Press. WILLOUGHBY, K., D. F. KELLY, et al. (1992). ‘Spongiform encephalopathy in a captive puma (Felis concolor).’ Vet Rec 131(19): 431–4. WISNIEWSKI, H. M., S. SIGURDARSON, et al. (1996). ‘Mites as vectors for scrapie [letter].’ Lancet 347(9008): 1114. WYATT, J. M., G. R. PEARSON, et al. (1991). ‘Naturally occurring scrapie-like spongiform encephalopathy in five domestic cats’ Vet Rec 129(11): 233–6. ZANUSSO, G., S. FERRARI, et al. (2003). ‘Detection of pathologic prion protein in the olfactory epithelium in sporadic Creutzfeldt-Jakob disease.’ N Engl J Med 348(8): 711–9. ZANUSSO , G ., E . NARDELLI , et al. (1998). ‘Simultaneous occurrence of spongiform encephalopathy in a man and his cat in Italy [letter].’ Lancet 352(9134): 1116–7.

332

Emerging foodborne pathogens

13 Vibrios G. B. Nair, S. M. Faruque and D. A. Sack, ICDDR,B – Centre for Health and Population Research, Bangladesh

13.1

Introduction

Foodborne diseases are increasing in the industrialized as well as in developing countries. The best approximation of the impact of foodborne diseases is available from the United States where an estimated 76 million illnesses, 325,000 hospitalizations, and 5,000 deaths are attributed to foodborne diseases with known pathogens accounting for an estimated 14 million illnesses, 60,000 hospitalizations, and 1,800 deaths (Mead et al. 1999). Foodborne illness can be caused by a variety of etiologies and these include viruses, bacteria, parasites, and can also be induced by chemical and pesticide pollutants. Listeriosis, salmonellosis, campylobacteriosis, Vibrio infections and haemorrhagic colitis are some of the important foodborne diseases of bacterial origin with salmonellosis being the economically most significant disease (Todd 1989). Vibrio species cause a majority of the illnesses among the various human diseases attributed to the natural bacterial flora of seafoods (Food and Nutrition Board, Institute of Medicine 1991). Recently, the Centers for Disease Control and Prevention (CDC) has estimated a 126% increase in the incidence of Vibrio infections in the US between 1996 and 2002 despite efforts directed at seafood consumers to warn them of the potential hazards of eating raw shellfish (Centres for Disease Control and Prevention 2004b). The foodborne illness statistics in Japan also showed unusual changes with the doubling in the number of food poisoning cases of V. parahaemolyticus in 1998 exceeding the number of Salmonella cases, which was the dominant cause of foodborne illness in Japan the previous two years (World Health Organization 1999). Globally, more than 63.5 million tons of seafood are caught and consumed

Vibrios 333 each year (Lipp and Rose 1997) and there has been an overall increase in seafood consumption and a corresponding increase in seafood-related outbreaks of diseases (Butt et al. 2004). Further, the international food trade, especially trade of warm water shrimps, has shown a quantum leap in recent years. The global production of warm water shrimp was about four million tons, of which 1.3 million tons was traded internationally (Food and Agriculture Organization 1998). With the increase in seafood consumption, expansion in aquaculture practices and rapidly expanding international food trade, medical practitioners can expect to see more infections caused by vibrios. Climatic changes associated with global warming resulting in increased ocean surface temperatures may make conditions conducive for growth of halophilic vibrios and thereby enhance the risk of Vibrio foodborne infections. Among the vibrios, Vibrio cholerae, V. parahaemolyticus and V. vulnificus are responsible for most cases of foodborne illness. To a much lesser extent, other vibrios associated with foodborne illness due to consumption of contaminated seafood include V. alginolyticus (Ji 1989), V. mimicus (Campos et al. 1996), V. damsela (Perez-Tirse et al. 1993; Shin et al. 1996), V. hollisae (Abbot and Janda 1994), V. cholerae non-O1 non-O139 (Morris et al. 1981) and V. fluvialis (Thekdi et al. 1990). The epidemiology of V. cholerae and V. parahaemolyticus/vulnificus are somewhat different in the sense for V. cholerae, the contamination through faecal-oral route is particularly important and seafood may not play the same degree of importance in transmission of cholera as it does for Vibrio parahaemolyticus or V. vulnificus infections. In other words for V. cholerae, when food has been the vehicle, a variety of foods have been implicated including, but not exclusively, seafood; whereas for other vibrios the vehicle is primarily seafood. Of all foodborne infectious diseases in the United States, V. vulnificus has the highest (0.39) case fatality rate (Mead et al. 1999). Several recent events underscore the increasing importance of vibrios as foodborne pathogen of marine origin. Notable among these was the sudden appearance of specific serotypes of V. parahaemolyticus that have lately caused a pandemic of gastroenteritis and the escalation of V. vulnificus infection in the US and Taiwan in recent years.

13.2

Taxonomy and brief historical background

The family Vibrionaceae includes seven genera (Vibrio, Photobacterium, Allomonas, Listonella, Enhydrobacter, Salinivibrio and Enterovibrio) of which the genus Vibrio has the largest number of species. Vibrios are gram-negative g-proteobacteria that are ubiquitous in marine, estuarine and freshwater environments and encompass a diverse group of bacteria including many facultative symbiotic and pathogenic strains. Some of the vibrios have multiple life styles that could include a free-swimming planktonic state, a sessile existence attached to zooplankton or shellfish in a commensal association or

334

Emerging foodborne pathogens

to other surfaces in the ocean and few of them have the capacity to infect humans, causing intestinal or extra intestinal diseases. Of the 48 currently recognized species in the genus Vibrio, ten are recognized as human pathogens as shown in Table 13.1 (http://www.theicsp.org/taxa/vibriolist.htm#vibrio). V. parahaemolyticus, V. cholerae and V. vulnificus are the most important among the vibrios from a foodborne infection standpoint, and will be dealt with in detail in this chapter. V. cholerae O1 and O139 are causative agents of the disease cholera and are associated with devastating epidemics and pandemics. Koch and co-workers discovered what is now known as V. cholerae O1 in Egypt in 1883 (Barua and Burrows 1974) while O139 emerged in the Indian subcontinent in 1992 (Albert et al. 1993; Nair et al. 1994b; Ramamurthy et al. 1993). V. parahaemolyticus is currently recognized as a major, worldwide cause of gastroenteritis, particularly in the Far East where seafood consumption is high (Miwatani and Takeda 1975). The halophile was first identified as a cause of foodborne illness in Japan in 1950 when 272 individuals became ill, and 20 died after consumption of semidried juvenile sardines (Fujino et al. 1953). V. vulnificus, first identified and described by CDC in 1976 (Hollis et al. 1976), is one of the leading causes of seafood-related illness in the United States and is responsible for more than 95% of all seafood related deaths in this country (Oliver and Kaper 1997).

13.3

Clinical signs and symptoms

Infection due to V. cholerae O1 or O139 begins with the ingestion of contaminated food or water containing the organism. After passage through Table 13.1

Vibrio species associated with human infections

Species

V. cholerae O1/O139 V. cholerae non O1 non O139 V. mimicus V. parahaemolyticus V. vulnificus V. alginolyticus V. fluvialis V. furnissii V. hollisae V. metschnikovii

Type strain

Clinical syndrome Diarrhoea

Wound infection

Bacteraemia

ATCC14035/ ATCC51394 N/A

+

–

R

+

+

+

ATCC33653 ATCC17802 ACTC27562 ATC617749 ATC633809 ATC635016 ATC633564 NCT68443

+ + + + + + + R

+ + + + R – R –

+ + + – R – R R

R = rare; N/A = not available; + = prescence of the clinical syndrome; – = absence of the clinical syndrome

Vibrios 335 the acid barrier of the stomach, V. cholerae colonizes the small intestine, and produces cholera toxin (CT) which is mainly responsible for the manifestation of the disease (Kaper et al. 1995). CT acts as a typical A–B type toxin, leading to ADP-ribosylation of a small G protein, and constitutive activation of adenylate cyclase, thus giving rise to increased levels of cyclic AMP within the host cell. This results in the rapid efflux of chloride ions and water from host intestinal cells. The subsequent loss of water and electrolytes leads to the severe diarrhoea and vomiting characteristic of cholera. Massive outpouring of fluid and electrolytes leads to severe dehydration, electrolyte abnormalities, and metabolic acidosis (Rabbani and Greenough 1992). Volunteer challenge studies with V. cholerae have shown that generally a high dose of the organism is required for pathogenesis. Approximately 1011 V. cholerae organisms are required to induce diarrhoea in fasting North American volunteers, unless NaHCO3 was administered to neutralize gastric acid (Cash et al. 1974). When 2.0 g of NaHCO3 is concomitantly administered, 105 or 6 vibrios can induce diarrhoea in 90% of volunteers (Cash et al. 1974; Levine et al. 1981; Sack et al. 1998). Further studies demonstrated that most volunteers who receive as few as 103 to 104 organisms with buffer develop diarrhoea, although lower inocula correlated with a longer incubation period and diminished severity of the disease (Levine et al. 1981). The incubation period generally varies between 25 and 33 hours. In severe disease, death may occur in as high as 50 to 70% of cases if they are not adequately rehydrated (Rabbani and Greenough 1992). V. parahaemolyticus causes three major syndromes of clinical illness that includes gastroenteritis, wound infections, and septicemia. The most common syndrome is gastroenteritis; the symptoms include watery diarrhoea with abdominal cramps, nausea, vomiting, headache and low-grade fever (Honda and Iida 1993). Sometimes the diarrhoea is bloody with stools described as ‘meat washed’ since the stool is a reddish, watery stool (Qadri et al. 2003). The illness is self-limiting and lasts an average of three days in immunocompetent patients. Rarely, sudden cardiac arythmia has been reported (Honda et al. 1976). The mean incubation period for V. parahaemolyticus infection is 15 hours (range 4–96 hours). Under appropriate conditions, this halophile has an extremely short generation time ranging from 8 to 12 minutes and doubling times of 27 minutes have been reported in crabmeat at both 20 and 30 ∞C (Liston 1974). Infection can cause serious illness in persons with underlying disease (Hlady and Klontz, 1996), especially in immunocompromised individuals, e.g. leukemia, liver disease, diabetes and those infected with HIV-AIDS where it can cause serious systemic infections (Hsu et al. 1993; Hally et al. 1995; Ng et al. 1999). Infection with V. parahaemolyticus results in B cell responses and an acute inflammatory response that is self limiting with features similar to those seen in disease caused by Shigella species (Raqib et al. 2000) and is more severe than those seen in disease caused by V. cholerae O1 or O139 (Qadri et al. 2003). Although V. parahaemolyticus and V. cholerae

336

Emerging foodborne pathogens

causes similar diseases, the two vibrios use distinct mechanisms to establish infection (Makino et al. 2003). Diseases associated with V. vulnificus infection present in two patterns that includes localized wound infections acquired through exposure of a wound to salt water or shellfish and primary septicemia acquired through oral ingestion of the organisms with raw oysters as the most common vehicle (Blake et al. 1979). Most patients suffering from V. vulnificus primary septicemia have an underlying chronic disorder such as chronic cirrhosis, haemochromatosis, thalassemia, elevated serum iron level, immune function abnormalities and chronic renal insufficiency and HIV-AIDS (Johnston et al. 1985; Oliver and Kaper 1997; Tacket et al. 1984). Opportunistic infections in susceptible individuals typically cause mortality within 24 to 48 h of the exposure. Wound infection can occur in the absence of predisposing conditions but progresses more frequently to septicemia and has a higher mortality rate in predisposed people (Cerveny et al. 2002). A hallmark of V. vulnificus infection is the fulminant reaction caused by the invading bacteria in connective tissues, displayed as blisters and haemorrhagic necrosis (Chuang et al. 1992). Even in non-fatal cases, V. vulnificus infection evokes intensive tissue damage and occasionally results in amputation and disability (Chen et al. 2003).

13.4

Virulence factors

V. parahaemolyticus strains that are isolated from diarrhoeal patients produce either the thermostable direct haemolysin (TDH) or the TDH-related haemolysin (TRH), or both, while hardly any isolates from the environment have these properties (Honda and Iida 1993; Shirai et al. 1990; Takeda, 1983). A strain producing TDH is referred to as Kanagawa positive (KP) and can be identified by b haemolysis on Wagatsuma blood agar (Takeda 1983; Wagatsuma 1974). TDH has been shown to have haemolytic, enterotoxic, cardiotoxic and cytotoxic activities (Honda and Iida 1993; Nishibuchi et al. 1992; Shirai et al. 1990; Takeda, 1983). Biological, immunological, and physicochemical characteristics of TRH are similar but not identical to those of TDH (Honda et al. 1988). TDH and TRH are each composed of 165-amino acid residues and show approximately 67% identity in the amino acid sequences (Honda and Iida 1993; Park et al. 2000). A strong correlation between urease production (unusual phenotype for V. parahaemolyticus) and trh gene exists (Okuda et al. 1997). Enteroinvasiveness of the bacteria has been reported in a rabbit model, in which the organism invaded, colonized, and produced inflammation in the small intestine (Chatterjee et al. 1984). The overall mechanism of pathogenesis by V. parahaemolyticus, however, remains unclear. Among the 206 currently recognized O serogroups of V. cholerae (Yamai et al. 1997), only O1 and O139 serogroups are associated with the disease cholera. This is related to the observation that more than 95% of the strains belonging to O1 and O139 serogroups produce cholera toxin (CT). In contrast,

Vibrios 337 more than 95% of the strains belonging to non-O1 non-O139 serogroups do not produce CT (Kaper et al. 1995). Another important virulence factor of V. cholerae is the toxin-coregulated pilus (TCP), which is an adhesin that is coordinately regulated with CT production (Taylor et al. 1987). TCP is the only V. cholerae pilus that has been demonstrated to date to have a role in colonization of the gut mucosa of humans (Herrington et al. 1988) and of infant mice (Taylor et al. 1987) the latter being an experimental cholera model. The genes encoding CT form part of the genome of a lysogenic filamentous bacteriophage, designated as CTXf (Waldor and Mekalanos et al. 1996). The pilus colonization factor TCP is also known to act as a receptor for CTXf, which can infect nontoxigenic V. cholerae, leading to the emergence of new toxigenic strains. The tcpA gene is part of a pathogenicity island of about 39.5 kb size known as V. cholerae pathogenicity island (VPI) (Karolis et al. 1998). V. vulnificus is a highly invasive pathogen, being able to reach the bloodstream and cause septicemia via translocation across the intact intestinal wall but little is known about the virulence mechanism of this organism. V. vulnificus is divided into three biotypes based on differences in biochemical and biological properties (Linkous and Oliver 1999). Among the three biotypes, strains belonging to biotype 1 (indole-negative) are most frequently isolated from clinical specimens. Biotype 2 strains have been reported to cause disease mainly among eels and rarely infect humans (Amaro and Biosca, 1996). Biotype 3 was associated with a major outbreak of systemic V. vulnificus infections started among Israeli fish market workers and fish consumers (Bisharat and Raz, 1996; Bisharat et al. 1999). Recent multilocus genotype data and modern molecular evolutionary analysis have shown that biotype 3 is a hybrid organism that evolved by the hybridization of the genomes from two distinct and independent populations of V. vulnificus (Bisharat et al. 2005). Strains of V. vulnificus secrete a variety of products that have been implicated in bacterial virulence and pathogenesis, including capsular polysaccharide (Wright et al. 1990), cytolysin (Gray and Kreger 1985; Kreger and Lockwood, 1981), metalloprotease (protease) (Kothary and Kreger 1985, 1987; Miyoshi et al. 1987), phospholipases (Testa et al. 1984) and siderophores (Okujo and Yamamoto, 1994). Collectively, the cytolysin and the protease are thought to be important for the pathogenesis of V. vulnificus. The primary virulence factor is the polysaccharide capsule, which prevents phagocytosis and activation of complement (Gray and Kreger 1985; Shinoda et al. 1987; Tamplin et al. 1985; Yoshida et al. 1985). The ability to acquire iron from the host via siderophore production is also an essential virulence attribute (Litwin et al. 1996). Biochemical and genetic studies suggest that extracellular proteins released by the invading bacteria mediate the pathogenesis process of penetrating cellular barriers, vascular dissemination, and local destruction of affected tissues (Chen et al. 2003). Multifactor interaction in bacterial virulence is likely to produce the dramatic infection caused by V. vulnificus

338

Emerging foodborne pathogens

(Hsueh et al. 2004). What host aspects are essential to infection are yet to be elucidated.

13.5

Epidemiology of Vibrio infections

13.5.1 Vibrio cholerae Cholera is a water and foodborne disease. The importance of water ecology is suggested by the close association of V. cholerae with surface water and the population interacting with the water (Sack et al. 2004). The faecal-oral transmission of cholera usually occurs by the ingestion of faecally contaminated water by susceptible individuals. Besides drinking water, food has also been recognized as an important vehicle of transmission of cholera (Table 13.2). The disease is endemic in Southern Asia and parts of Africa and Latin America, where outbreaks occur regularly and is particularly associated with poverty and poor sanitation (Fig. 13.1). A distinctive epidemiological feature of cholera is its appearance with seasonal regularity in endemic areas, and in explosive outbreaks often starting simultaneously in several distinct foci (Glass and Black 1992; Kaper et al. 1995) indicating a possible role of environmental factors in triggering the epidemic process. However, the underlying mechanisms are still not well understood. It is possible that an undefined environmental signal triggers a rapid increase in the concentration of V. cholerae in the environment. As human cases start to occur, they, in turn, amplify the number of organisms present, leading to even more cases. Colwell and Spira (1992) have hypothesized that V. cholerae colonize copepods and other zooplankton, and zooplankton blooms play a key role in this process. However, since infection due to V. cholerae occurs exclusively through the oral route, contaminated food and water are the direct sources of human infection, while environmental factors are likely to influence the seasonal prevalence of V. cholerae in the aquatic environment, as well as their survival and epidemic spread. Numbers of culturable V. cholerae isolated from environmental waters are usually far less than the required dose for a severe infection, and the majority of natural infections due to V. cholerae are asymptomatic or lead to mild disease (McCormack et al. 1969). However, it seems likely that a pre-enrichment of the organism in contaminated food may be important in the epidemiology of cholera, particularly the occurrence of the first case of cholera, which subsequently leads to an epidemic, fostered by contaminated water, and poor sanitation. In developing countries, where both poverty and poor sanitation are common, faecal contamination of domestic and commercial food is likely to occur, and in many outbreaks the infection has been traced to consumption of faecally contaminated foods. Persons with acute cholera excrete 107 to 108 V. cholerae organisms per gram of stool (Levine et al. 1988), and total output of V. cholerae by a patient can be in the range of 1011 to 1013 CFU. This large number of organisms can contaminate environmental waters, and people

Table 13.2

Examples of foodborne outbreaks of cholera reported in the literature* Place

Food

No. of cases

Reference

1962 1963 1970 1972 1973 1974 1974 1974–1986 1977 1978 1978 1978 1978 1979 1981 1982 1982 1984 1984 1986 1986 1986 1987 1988

Philippines Hong Kong Israel Australia Italy Portugal Portugal Guam Gilbert Island Singapore USA Bahrain Japan Spain USA Micronesia Singapore India Mali Guinea USA USA Thailand Thailand

Raw shrimp Cold cooked meat Raw vegetables Mixed hors d’oeuvre Raw mussels, clams Bottled mineral water Seafood Raw seafoods Raw & salted fish and clams Steamed prawn, chicken, rice Crabs Bottle-feeding of infants Rock lobster Raw fish Cooked rice Shellfish/leftover rice Cooked squids Ice candies Milted gruel Peanut sauce/cooked rice Crabs/shrimps Raw oysters Raw pork Raw beef

– 5 258 25 278 136 2467 19–46 572 12 11 42 18 267 15 509 22 22 1793 35 18 2 130 52

Felsenfeld (1972) Teng (1965) Fattal et al. (1986) Sutton (1974) Baine et al. (1974) Blake et al. (1977) Blake et al. (1977) Haddock (1987) McIntyre et al. (1979) Khan et al. (1987) Blake (1980) Gunn et al. (1979) Fukumi (1980) World Health Organization (1980) Johnston et al. (1983) Holmberg et al. (1984) Goh et al. (1984) Patnaik et al. (1989) Tauxe et al. (1988) St Louis et al. (1990) Lowry et al. (1989) Klontz et al. (1987) Swaddiwudhipong et al. (1990) Swaddiwudhipong et al. (1992)

Vibrios 339

Year

340

Continued

Year

Place

Food

1989 1991 1991 1991 1992

Philippines USA Ecuador USA South America to Los Angeles, USA Guatemala USA Thailand Hong Kong Lusaka, Zambia

Street food Imported crabs Seafood Imported frozen coconut milk Cold seafood salad (international flight)

1993 1994 1994 1994 2004

Leftover rice Imported food (palm fruit) Yellow rice Seafood Raw vegetables

No. of cases – 4 – 3 75 26 2 6 12 2529

Reference Lim-Quizon et al. (1994) Centers for Disease Control and Prevention (1991) Weber et al. (1994) Lacey et al. (1991) Eberhart-Phillips et al (1997) Koo et al. (1996) Centers for Disease Control and Prevention (1995) Boyce et al. (1995) Kam et al. (1995) Centers for Disease Control and Prevention (2004a)

This table has been taken from the book, Food Borne Disease: A focus for Health Education (World Health Organization 2000). Information for this Table was obtained from Quevedo (1993) and Albert et al. (1997). The table has been updated with some recent foodborne outbreaks caused by Vibrio cholerae O1/O139

Emerging foodborne pathogens

Table 13.2

Vibrios 341 Cholera 2004–2005

Countries with imported cholera cases Countries with reported cholera cases

Fig. 13.1 Global incidence of cholera (this map was provided by the kind courtesy of L. Olsson and PA Parment, SBL Vaccin AB, Stockholm, Sweden). Information from different sources was used to create the updated map and an updated list of cholera in the world. http://www.sblvaccines.se/uploads/Cholera-2004-20052.jpg)

dependent on such water for household purposes are likely to contaminate food. Even after cessation of symptoms, patients who have not been treated with antibiotics may continue to excrete vibrios for one to two weeks (Levine et al. 1988), and a small minority of patients may continue to excrete the organism for even longer periods of time. Asymptomatic carriers are most commonly identified among household members of persons with acute illness. Volunteer studies have shown that when stomach acidity is neutralized with sodium bicarbonate, administration of an inoculum of 106 V. cholerae cells can result in an attack rate of 90% (Levine et al. 1981). Food has a buffering capacity comparable to that seen with sodium bicarbonate. Ingestion of 106 vibrios with food such as fish and rice resulted in the same high attack rate (100%) (Levine et al. 1981). One important epidemiological finding is that an initial infection with V. cholerae provides protection against subsequent disease. In endemic areas such as Bangladesh, cases of cholera are highest in children aged two to nine years (Glass et al. 1982). The decreased rates in children under the age of one year may relate to decreased exposure, and to the protective effect of breast-feeding or breast milk (Clemens et al. 1990). In contrast to the above findings, cholera, when introduced into populations lacking prior exposure to the disease, tends to occur with equal frequency in all age groups (Glass and Black 1992, Holmberg et al. 1984), and this was clearly observed in the South American epidemics (Swerdlow et al. 1992). A similar pattern was seen in the initial epidemics with V. cholerae O139 strains in Bangladesh. In contrast to findings with endemic O1 strains, the majority of O139 cases

342

Emerging foodborne pathogens

occurred in adults (Albert et al. 1993). Susceptibility to cholera depends also on largely unknown host factors. Individuals of blood group O are at increased risk of more severe cholera, which has been shown for natural infection (Clemens et al. 1989; Glass et al. 1985) as well as with experimental infection (Levine et al. 1979). In cholera endemic regions of Asia, including Bangladesh, contamination of food is likely to be an important factor in the transmission of cholera (Spira et al. 1980). Water may serve as a source of secondary contamination of food during its preparation. In endemic areas, transmission of cholera through contaminated foods served by street vendors and restaurants should be considered. In the developed countries, foodborne outbreaks of cholera have on many occasions occurred due to consumption of contaminated seafood. It is clear that CT-producing V. cholerae O1 or O139 can persist in the environment in the absence of known human disease. Periodic introduction of such environmental isolates into the human population through ingestion of uncooked or undercooked shellfish appears to be responsible for isolated foci of endemic disease along the U.S. Gulf Coast and in Australia (Blake et al. 1979, Lowry et al. 1989; Tacket et al. 1984). Environmental isolates contaminating seafood may also have been responsible for the initial case clusters in the South American epidemic. Food has been frequently implicated as a vehicle responsible for introduction of cholera into a new area (Kaper et al. 1995; Glass and Black 1992). In studies in Piura, Peru, drinking unboiled water, eating food from a street vendor, and eating rice after three hours without reheating were all independently associated with illness (Ries et al. 1992). The survival and growth of V. cholerae in foods depend on the physico-chemical properties of the particular foods that have been contaminated. Food characteristics, which enhance the growth of V. cholerae, are low temperature, high-organic content, neutral or alkaline pH, high-moisture content, and absence of other competing microorganisms in the food (Depaola 1981; Pan American Health Organization 1991; Singleton et al. 1982). Of particular concern from a public health perspective is that V. cholerae can survive in water and contaminate foods where it can grow in enough numbers to cause illness in people consuming the food or drink. Food can also provide an ideal culture medium: cooked rice, for example, has been shown to support rapid growth of V. cholerae (Kolvin and Roberts 1982). V. cholerae can survive for more than two weeks in different dairy products, including milk, milk products, soft desserts, and cakes. Addition of sugar and eggs enhances bacterial survival. Although V. cholerae is killed by pasteurization of milk, the organisms can persist in raw milk for as long as four weeks, even if refrigerated. Contamination of meat of animal origin occurs exogenously during processing, cooking, storage, or consumption. It has been shown that V. cholerae can live and grow on cooked chicken; an increase in numbers of V. cholerae from 103 to 106 within 16 hours has been demonstrated (Kolvin and Roberts 1982). There are many other types of

Vibrios 343 food that may be contaminated with V. cholerae, for example V. cholerae can survive on cooked potatoes, eggs, and pasta for up to five days, and can also survive in spices, including pepper and cinnamon, for up to several days. V. cholerae is very sensitive to heat, and is rapidly killed when exposed to a temperature of 100 ∞C. Drying and exposure to sunlight is also an effective means of killing V. cholerae (Kaper et al. 1982; Pan American Health Organization 1991). V. cholerae can survive domestic freezing and can be found after a long period in a frozen state. Leftover rice eaten with tomato sauce, having an acidic pH, unfavourable for V. cholerae, was not associated with cholera cases (St. Louis et al. 1990). The pH of a specific fruit is an important factor that influences contamination by V. cholerae. Sour fruits, such as lemons and oranges, with lower pH (below 4.5) do not support the growth of V. cholerae, and, thus, do not pose risk of cholera transmission. Fruit pulp and concentrate preserved in cans are also less likely to be contaminated if they have an acidic pH. Spices, including raw onions and garlic, can support the survival of V. cholerae for two to three days at ambient temperature (Pan American Health Organization 1991). During the course of the seventh cholera pandemic, contaminated seafoods have been identified as the source of infection in several outbreaks. Seafoods and seafood products most frequently incriminated are shellfish. These foods have been identified as a source of repeated outbreaks in the Unites States and elsewhere (Centers for Disease Control 1991; Gergatz and McFarland 1989; Lowry et al. 1989). Fish becomes infected with V. cholerae either due to sewage contamination of water or by ingestion of aquatic vegetation and zooplankton infested with V. cholerae (Huq et al. 1983). Zooplankton secretes a self-protective coat of chitin that can be dissolved by chitinase, an enzyme produced by V. cholerae O1. Seafoods, including molluscs, crustaceans, crabs, and oysters, feed on plankton and can become infected with V. cholerae (Huq et al. 1983). Once infected, particularly clams and oysters can harbour V. cholerae for weeks, even if refrigerated (DePaola 1981). In crabs, the organisms can rapidly multiply at ambient temperature, and boiling for less than ten minutes or steaming for less than 30 minutes does not completely kill V. cholerae (DePaola 1981). In a food survey in Taiwan, 1,088 vibrios, including V. cholerae and other species, were isolated from seafoods and aquacultured foods (Wong et al. 1992). In many countries, fish is eaten raw or undercooked (Klontz et al. 1987, Wong et al. 1992). Outbreaks of cholera due to consumption of raw fish have been reported from Japan as early as 1886 (Pavia et al. 1987). Fish may serve as an important vehicle of transmission of cholera in the endemic areas of Asia, where it is a major food item and is likely to be contaminated by V. cholerae due to both poor environmental sanitation and poverty. Several other examples of foodborne outbreaks are as follows. In 1978, Singapore experienced a cholera outbreak, which was traced to consumption of prawns and squid that were likely to be contaminated by infected food handlers (Goh 1979). In 1979, an outbreak of cholera occurred in Sardinia;

344

Emerging foodborne pathogens

the source of infection was traced to eating of bivalves from which V. cholerae O1 were isolated (Salmaso et al. 1980). A statistically significant association of cholera with shellfish consumption in Italy in 1973 has shown the importance of shellfish as a vehicle of cholera transmission (Baine et al. 1974; De Lorenzo et al. 1974). In the autumn of 1991, a single cholera case was identified in an oil rig barge in Texas, which was followed by 13 secondary cases of cholera and one asymptomatic infection (Weissman et al. 1974). The source of infection in the index case was traced to consumption of infected seafoods from local water. The secondary cases were infected by consuming rice prepared with water contaminated by the faeces of the index case through cross-connection between a sewer drain and the drinking water supply. Since 1973, a total of 65 cholera cases have been associated with the Gulf Coast reservoir in the United States. In 1971 cholera reappeared in Africa, after an absence of 70 years, and 30 of the 46 countries started reporting cholera. During a cholera outbreak in Mali in 1984, a case-control study showed that eating leftover millet gruel by villagers in an arid region was associated with cholera (St. Louis et al. 1990). In another outbreak in Guinea, consumption of leftover rice with peanut sauce was incriminated as the vehicle of transmission of cholera. Consumption of improperly cooked horsemeat was incriminated in a small outbreak of cholera in Berlin in 1918 (Kolvin and Roberts 1982). An infected butcher who succumbed to cholera the next day had prepared the meat. The importance of contaminated vegetables as a vehicle of cholera transmission is indicated by an outbreak in Jerusalem (Johnston et al. 1983) and some of these cases was shown to be infected by secondary spread of V. cholerae through consumption of vegetables contaminated by faeces. In many countries, the practice of fertilizing gardens with untreated night soil and the habit of consuming uncooked vegetables have often resulted in cholera outbreaks. Vegetables may be contaminated during washing with polluted water. This can also occur when contaminated water is injected into fruits, such as watermelons, to preserve their weight and taste (Feachem 1981).

13.5.2 Vibrio parahaemolyticus V. parahaemolyticus is widely disseminated in estuarine, marine and coastal environments throughout the world (Joseph et al. 1982) and has been detected as far north as in Alaska (Vasconcelos et al. 1975). It has also been reported either as a source of human disease or in the environment along the North American, African, and Mediterranean coasts (Barbieri et al. 1999, Eko et al. 1994, Daniels et al. 2000). The organism accounts for nearly half or more of the bacterial foodborne illness cases in Japan (Zen-Yoji et al. 1965) and in Taiwan (Pan et al. 1996). Surprisingly, V. parahaemolyticus is also an important etiological agent of diarrhoea in inland areas like Calcutta, India.

Vibrios 345 Etiological studies on acute diarrhoeal diseases have shown that gastroenteritis caused by V. parahaemolyticus ranks second to cholera in terms of incidence in Calcutta (Chatterjee et al. 1970; Sakazaki et al. 1971). Epidemiological studies have further revealed the high incidence of human carriers of V. parahaemolyticus in this metropolis (Pal et al. 1984). V. parahaemolyticus was the most commonly isolated Vibrio species isolated during a year-long surveillance along the Gulf Coast of the United States, as well as over a 13-year period in Florida. In a population-based study that relied on passive surveillance in the Khanh Hoa province of Vietnam, a surprising risk factor for V. parahaemolyticus infection was high socioeconomic status (Tuyet et al. 2002). The explanation for this finding was that only the more affluent members of the community could afford seafood thereby attesting the importance of seafood in acquiring infection caused by V. parahaemolyticus. Water temperature, salinity, zooplankton blooms, tidal flushing and dissolved oxygen play an important role in dictating the spatial and temporal distribution of V. parahaemolyticus (Kaneko and Colwell 1978). This pathogen is typically not recovered from estuarine waters during winter months in temperate zones when water temperature is too low for its existence. Water temperatures have been shown to influence the growth of V. parahaemolyticus (Kaneko and Colwell 1975; Kaper et al. 1981; Kelly and Stroh, 1981; Thompson et al. 1976) and the importance of water temperature in the epidemiology of infections is reflected by the fact that most outbreaks occur during the warmer months. Outbreaks of V. parahaemolyticus infections are most common in Japan and Southeast Asia where the consumption of raw or undercooked fish and shellfish is high; they occur occasionally in North and South America and rarely in Europe. Foodborne outbreaks of V. parahaemolyticus have been reported from several countries including Bangladesh, Canada, Guam, India, Thailand, Taiwan Russia, Peru, Senegal and Nigeria. This pathogen is one of the most important foodborne pathogen in Taiwan, Japan and other coastal regions. Most V. parahaemolyticus outbreaks that occurred between 1973 and 1998 in the US occurred during the warmer months were attributed to seafood, particularly shellfish, and had a median attack rate among persons who consumed the implicated seafood of 56% (Abbot and Janda 1994). In tropical countries, in contrast, the seasonality of V. parahaemolyticus is less defined with infection occurring throughout the year. Studies in Calcutta have shown that both marine and freshwater fish provide an ideal substrate for the survival and proliferation of V. parahaemolyticus. They attributed the isolation of V. parahaemolyticus in market samples of freshwater fish to the cross-contamination due to mishandling at the fishmongers’ stalls (Sarkar et al. 1985).

13.5.3 Vibrio vulnificus V. vulnificus is present in tropical and temperate estuarine ecosystems throughout the world. Infection due to this organism has been reported from

346

Emerging foodborne pathogens

USA, Europe, Korea, Taiwan and other countries (Chuang et al. 1992; Dalsgaard et al. 1995; Hlady and Klontz 1996; Park et al. 1991). One factor that influences the incidence of disease caused by V. vulnificus is the prevalence of this organism in the environment. The incidence of V. vulnificus disease parallels its concentration in oyster tissues, with the greatest number of infections occurring during the summer months when seawater temperature ranges between 20 and 30 ∞C (Hlady et al. 1993; Howard et al. 1988). The relationship between environmental factors and V. vulnificus densities in oysters collected monthly in 14 states in the US showed that the levels ranged from none detected to 1,100,000 per gram (Tamplin 1994). The concentration of V. vulnificus in oysters across the northern gulf coast was influenced primarily by water temperature and salinities below 25 parts per thousand (Motes et al. 1998). Variations in surface water temperature above 26 ∞C have little effect on densities, but the densities decline rapidly as temperature declines below 26 ∞C (Motes et al. 1998). The relationship between disease and high infective dose is also supported by data showing that V. vulnificus infections do not occur during cold months when the numbers of organisms are very low, even though greater numbers of oysters are consumed in winter months than in summer months (Tamplin et al. 1996). In Taiwan, V. vulnificus infections are rising and one of the factors associated with this increase is the high prevalence of hepatitis B or C virus infection-related hepatic diseases (liver cirrhosis and hepatoma), the environment, and the popularity of preparing and eating raw or under-cooked seafood (Chuang et al. 1992; Chiang and Chuang 2003). Infection due to V. vulnificus is mainly due to consumption of raw molluscan shellfish particularly filter-feeding oysters. Estimates of the prevalence of V. vulnificus in oysters from the Gulf of Mexico during the summer months have been as high as nearly 100% (Motes et al. 1998). Examination of oysters from three geographically distinct estuaries on the northern Gulf Coast showed that MPN counts were usually 103 to 104 per gram during warm weather months when >85% of the shellfish-associated V. vulnificus cases occur as compared to <10 per gram during the cold-weather months (Motes et al. 1998). Much higher V. vulnificus densities of >105 per gram were observed in oysters during the summer of 1991 in Apalachicola Bay (Jackson et al. 1997). The multiplication of V. vulnificus in summer harvest oyster shell stock held without refrigeration has been shown to be rapid (Cook, 1997). However, the numbers of V. vulnificus organisms do not differ significantly from those at the time of harvest through 30 hours of storage if shell stock are chilled immediately after harvest and stored at temperatures of <13 ∞C (Cook 1994). Prolonged storage of shell stock at 0 to 4 ∞C brings about a significant reduction in numbers of V. vulnificus organisms but storage for up to 48 h at these temperatures bring about no reduction in numbers (Cook and Ruple 1992).

Vibrios 347

13.6

Methods of detection

A critical requirement for a detection method is rapidity and reliability and the ability to preempt a food poisoning event by detecting the pathogen before contaminated foods are consumed. Biochemical and growth tests useful for identifying V. parahaemolyticus, V. cholerae and V. vulnificus are given in Table 13.3. Conventional methods for detecting foodborne vibrios range from growth on selective media, biochemical testing and the most probable number method followed by plating on selective agar (MPN). Selective enrichment with alkaline peptone water or salt polymyxin broth and plating the enrichment culture onto thiosulphate citrate bile salts sucrose (TCBS) agar has been widely used for selective isolation of pathogenic vibrios. Likewise, the MPN method has been extensively used in the past for detection of foodborne vibrios but is limited by the time and labour involved in analyzing a large number of samples. A new effective procedure for detecting V. parahaemolyticus in seafoods using enrichment and plating on to a chromogenic agar medium containing substrates for beta-galactosidase enabled a more sensitive and accurate identification of V. parahaemolyticus than previously used methods (Hara-Kudo et al. 2001). These methods are time consuming, generally requiring at least two to three days, usually more in a developing country setting. This has often led to an underestimation, delayed estimation or the absence of the pathogenic vibrios in seafoods. A number of alternative biochemical, immunological, and molecular methods that shorten the time for detection of pathogens in foods have been developed in the recent past. Molecular methods used for the genetic identification and characterization of foodborne vibrios includes DNA-DNA colony hybridization and PCR-based assays targeting pathogenicity marker genes. Some of the validated primers and PCR conditions for detection of species-specific genes and for precise virulence genes of pathogenic vibrios are shown in Tables 13.4 and 13.5. The structural genes for tdh and/or trh genes for pathogenic V. parahaemolyticus (Nishibuchi et al. 1996; Tada et al. 1992), the ctxAB and tcpA genes for toxigenic V. cholerae O1 and O139 (Hoshino et al. 1998; Koch et al. 1993; DePaola and Huang 1995) and the vvh for V. vulnificus (Brasher et al: 1998; Jones and Bej, 1994) have been extensively targeted to develop PCR methods for detecting pathogenic strains of these vibrios in seafoods and environmental samples. Previously, the Kanagawa test was widely used to identify pathogenic strains of V. parahaemolyticus producing TDH (Miyamoto et al. 1969) but this has been replaced by more efficient PCR methods (Bej et al. 1999; Tada et al. 1992) and DNA probe assays (McCarthy and Blackstone 2000; Wong et al. 2000a, b) that target the tdh gene. However, even PCR requires analysis of the amplified DNA in an agarose gel while DNA-DNA colony hybridization requires at least three days to complete (Panicker et al. 2004b). The presence of inhibitors in seafoods and non-specific DNA products especially in multiplex PCR formats represent further challenges in these PCR based methods (Lees

348

Emerging foodborne pathogens

Table 13.3 Biochemical and growth traits of the three Vibrio species most often implicated in foodborne infections Test

V. cholerae

V. parahaemolyticus

V. vulnificus

Oxidase Indole* Voges-Proskauer* NO3 to NO2 Simmons’ Citrate* ONPG Urea hydrolysis Gelatin hydrolysis Motility Polymyxin B inhibition Arginine dihydrolase* Lysin decarboxylase* Ornithine decarboxylase* Acid production from D-Glucose L-Arabinose D-Arabitol Cellobiose Lactose Maltose D-Mannitol Salicin Sucrose Utilization of L-leucine L-putrescine Ethanol D-glucuronate Growth in NaCl 0% 3% 6% 8% 10% Growth at 42∞C Sensitivity to 10mg of O/129 150 mg of O/129

+ + +/– + + + – + + –/+ – + +

+ + – + – – +/– + + +/– – + +

+ + – + +/– +/– – +/– + – – + +/–

+ – – – – + + – +

+ +/– – – – + + – –

+ – – + +/– + –/+ + –/+

– – – –/+

+ + + +/–

– – – +

+ + +/– – – +

– + + + +/– +

– + +/– – –

S/R S/R

R S

S S

+ >90% positive, +/–, variable; >50% positive, –/+, variable; <50%, –, < 10% positive *Test reaction with 1% NaCl Abbreviations: ONPG; o-nitrophenyl-beta-D-galactopyranoside, R; resistant, S; susceptible,

et al. 1994) and necessitate labour intensive DNA extraction and purification procedures (Bej et al. 1999; McCarthy and Blackstone, 2000). The introduction of real-time PCR amplification has made detection of foodborne pathogens rapid and cost-effective and the analysis of results simple. Real-time PCR eliminates the need for post-PCR processing by

Table 13.4 Primers and PCR conditions for the identification of Vibrio parahaemolyticus, Vibrio cholerae and Vibrio vulnificus using species specific genes Target gene V. parahaemolyticus toxR R27H gyrB tlh V. cholerae rfb O1 rfb O139 ompW ISR V. vulnificus vvh

Sequence

Amplicon size (bp)

Reference

Forward Reverse Forward Reverse Forward Reverse Forward Reverse

5¢-GTCTTCTGACGCAATCGTTG-3¢ 5¢-ATACGAGTGGTTGCTGTCATG-3¢ 5¢-TGCGAATTCGATAGGGTGTTAACC-3¢ 5¢-CGAATCCTTGAACATACGCAGC-3¢ 5¢-CGGCGTGGGTGTTTCGGTAGT-3¢ 5¢-TCCGCTTCGCGCTCATCAATA-3¢ 5¢-AAAGCGGATTATGCAGAAGCACTG-3¢ 5¢-GCTACTTTCTAGCATTTTCTCTGC-3¢

368

Kim et al. 1999

387

Lee et al. 1995

285

Venkateswaran et al. 1998

450

Bej et al. 1999

Forward Reverse Forward Reverse Forward Reverse Forward Reverse

5¢-GTTTCACTGAACAGATGGG-3¢ 5¢-GGTCATCTGTAAGTACAAC-3¢ 5¢-AGCCTCTTTATTACGGGTGG-3¢ 5¢-GTCAAACCCGATCGTAAAGG-3¢ 5¢-CACCAAGAAGGTGACTTTATTGTG-3¢ 5¢-GGTTTGTCGAATTAGCTTCACC-3¢ 5¢-TTAAGCSTTTTCRCTGAGATTG-3¢ 5¢-AGTCACTTAACCATACAACCCG-3¢

192

Hoshino et al. 1999

449

Hoshino et al. 1999

304

Nandi et al. 2000

295

Chun et al. 1999

Forward Reverse

5¢-TTCCAACTTCAAACCGAACTATGA-3¢ 5¢-ATTCCAGTCGATGCGAATA CGTTG-3¢

205

Brasher et al. 1998

toxR, Toxin regulatory gene; R72H, 0.076-kb HindIII DNA fragment of chromosomal DNA of V. parahaemolyticus of unknown function; gyrB, gyrase B gene; tlh, thermolabile haemolysin of V. parahaemolyticus; rfb, encodes enzyme necessary for LPS biosynthesis; ompW, gene encodes outer membrane protein; ISR, 16S-23S rRNA intergenic spacer regions of V. cholerae; vvh, haemolysin gene specific for V. vulnificus.

Vibrios 349

Primer

350

Target gene V. parahaemolyticus tdh trh orf8 V. cholerae ctxA tcpA El Tor tcpA Classical V. vulnificus viuB

Primer

Sequence

Forward Reverse Forward Reverse Forward Reverse

5¢-CCAAATACATTTTACTTGG-3¢ 5¢-GGTACTAAATGGCTGACATC-3¢ 5¢-GGCTCAAAATGGTTAAGCG-3¢ 5¢-CATTTCCGCTCTCATATGC-3¢ 5¢-GCATACAGTTGAGGGGAAAG-3¢ 5¢-AGCGCTCTTTGTTTTCTATATG-3¢

Forward Reverse Forward Reverse Forward Reverse

5¢-CTCAGACGGGATTTGTTAGGCACG-3¢ 5¢-TCTATCTCTGTAGCCCCTATTACG-3¢ 5¢-GAAGAAGTTTGTAAAAGAAGAACAC-3¢ 5¢-GAAAGGACCTTCTTTCACGTTG-3¢ 5¢-CACGATAAGAAAACCGGTCAAGAG-3¢ 5¢-ACCAAATGCAACGCCGAATGGAGC-3¢

Forward Reverse

5¢-GGTTGGGCACTAAAGGCAGATATA-3¢ 5¢-TCGCTTTCTCCGGGGCGG-3¢

Amplicon size (bp)

References

199

Tada et al. 1992

249

Tada et al. 1992

1050

Honda and Iida 1993

301

Keasler and Hall 1993

471

Keasler and Hall 1993

617

Keasler and Hall 1993

504

Panicker et al. 2004a

tdh, thermostable direct haemolysin; trh, thermostable direct haemolysin-related haemolysin; orf8, open reading frame 8; ctxA, cholera toxin A subunit; tcpA, toxin coregulated pilus; viuB, vibriobactin utilization protein

Emerging foodborne pathogens

Table 13.5 Primers and PCR conditions for the detection of important virulence genes of Vibrio parahaemolyticus, Vibrio cholerae and Vibrio vulnificus

Vibrios 351 measuring the accumulation of PCR amplicons during each cycle of PCR in real time, thus decreasing analytical time and labour (Blackstone et al. 2003). In addition, because fluorescence increases in direct proportion to the amount of specific amplicons, real time PCR can be used for quantitation (Fortin et al. 2001; Kimura et al. 2000; Lyon et al. 2000; Nogva et al. 2000). A rapid and reliable real time PCR has been developed for detecting V. parahaemolyticus possessing the tdh gene in pure cultures and in oyster enrichments (Blackstone et al. 2003). In an environmental survey of Alabama oysters, real time PCR detected tdh in 61 samples, whereas the streak plate/ probe method detected tdh in 15 samples and only 24 hrs was required as compared to three days by the streak plate/probe method (Blackstone et al. 2003). The entire detection method, including sample processing, enrichment, and real-time PCR amplification of the vvh of V. vulnificus could be completed within eight hours making it a rapid single-day assay (Panicker et al. 2004a, b). Efforts are currently ongoing to exploit the simplicity and rapidity of the microchip technology widely used for genomic studies for genetic screening and identification of microorganisms. This basically combines the PCR technology with DNA-DNA hybridization and would significantly improve the specificity of target sequence detection in the presence of nonspecific PCR products. Therefore, not only will the technique detect the pathogen but would also furnish information on the pathogenic attributes and also information on the genotypes. Being autochthonous residents of marine and brackish water environments, the presence of these vibrios per se should not be used to reject seafood as unfit for human consumption. Since most of the environmental and seafood isolates of V. cholerae, V. parahaemolyticus and V vulnificus are likely to be non-virulent, it may prove difficult and inaccurate to correlate the presence of these organisms with the development of disease in humans. The exact relationship between strains isolated from estuarine environments, and those isolated from seafood and human clinical isolates is still poorly understood (DePaola et al. 2003). The relatively low population of virulent strains in environmental samples and the similarity in growth kinetics of the virulent and avirulent strains has made it difficult to selectively detect and enumerate virulent strains in the environment (Hara-Kudo et al. 2003). It is therefore important to discriminate the innocuous environmental resident from virulent strains. An important advance made in recent years is the development of molecular methods that have the ability of discriminating potentially virulent strains by targeting multiple genes. A multiplex PCR amplification-based detection targeting the thermolabile haemolysin (tl) gene that has been shown to be present in all strains of V. parahaemolyticus (Taniguchi et al. 1986), and both tdh and trh genes for haemolysin producing pathogenic strains of V. parahaemolyticus has been developed to determine the presence of potentially virulent strains in shellfish (Bej et al. 1999). Likewise, PCR methods for discrimination of total and pathogenic V. vulnificus (Panicker et al. 2004a, b)

352

Emerging foodborne pathogens

and V. cholerae (Nishibuchi et al. 1996, Rivera et al. 2003) have also been developed.

13.7

Subspecies typing

Subspecies typing of vibrios is useful for tracking the organism implicated in outbreaks as well as gaining insights into the ecology of the organism. The serotype, defined by agglutination with appropriate antiserum, is a useful marker for strains and has been one of the most effective conventional methods for subtyping of vibrios. The O antigens of V. cholerae are heat-stable, shows enormous serological diversity and have proven to be valuable markers in both ecological and epidemiological studies. Of approximately 200 currently known O-antigen serogroups (Yamai et al. 1997) just two serogroups, O1 and O139, are associated with cholera. All strains identified as V. cholerae based on biochemical tests but do not agglutinate with O1 or O139 antisera are collectively referred to as the ‘non-O1 non-O139’ (Nair et al. 1994a) or also referred to as non-epidemic serogroups. V. parahaemolyticus synthesizes three major surface antigens; heat-stable somatic O antigen, heat-labile capsular K antigens and H flagellar antigens. The H antigens are serologically identical in all strains. Isolates of V. parahaemolyticus can be differentiated by serotypes and the serotyping scheme of V. parahaemolyticus is constituted by a combination of O and K antigens that are commercially available include 13 O groups and 71 K types (Iguchi et al. 1995). A species-specific flagellar (H) antigen, which groups members of V. vulnificus into a single serotype, has been exploited in the rapid identification of this pathogen (Simonson and Siebeling 1986, 1988; Tassin et al. 1983). Further, Shimada and Sakazaki (1984) have also proposed an ‘O’ serological typing scheme based on direct agglutination of heat killed V. vulnificus cells by polyclonal rabbit sera. V. cholerae O1 strains of the same biotype and serotype can be differentiated by a phage typing scheme for O1 that could separate 1000 V. cholerae strains into 146 phage types using 10 typing phages (Chattopadhyay et al. 1993). Likewise, a phage-typing scheme specific for V. cholerae O139 has been established using a panel of five phages isolated from different regions of India (Chakrabarti et al. 2000). However, in the wake of efficient molecular typing techniques, use of phage typing as a method of subspecies typing of vibrios is on the decline. Several molecular methods have been developed for the typing of Vibrio species and these include restriction fragment length analysis (RFLP) of virulence or virulence associated genes, enterobacterial repetitive intergenic consensus sequence (ERIC) PCR, ribotyping and pulsed-field gel electrophoresis (PFGE). Due to the conservation of nucleotide sequences flanking the tdh and trh genes in V. parahaemolyticus, RFLP analysis of these genes lacks discriminatory power (Nishibuchi et al. 1996). Comparison

Vibrios 353 of different molecular methods for typing showed that ERIC PCR and ribotyping were the most informative typing methods for V. parahaemolyticus, especially when used together while PFGE suffered from a high incidence of DNA degradation and Fla locus RFLP analysis was the least discriminatory (Marshal et al. 1999). Molecular analysis of epidemic isolates of V. cholerae between 1961 and 1996 in Bangladesh revealed clonal diversity among strains isolated during different epidemics (Faruque et al. 1995, 1997). These studies demonstrated the transient appearance and disappearance of more than six ribotypes among classical vibrios, at least five ribotypes of El Tor vibrios and three different ribotypes of V. cholerae O139. A standardized ribotyping scheme for V. cholerae O1(Popovic et al. 1993) and for O139 (Faruque et al. 2000) that can distinguish seven different ribotypes among classical strains, 20 ribotypes and subtypes among El Tor strains and six distinct ribotypes among O139 strains have been effectively used to study the molecular epidemiology of cholera (Gray and Kreger, 1985). V. vulnificus is highly genetically diverse, and single oysters can contain over 100 different strains (Buchrieser et al. 1995). A high degree of heterogeneity has been observed among environmental and clinical isolates of V. vulnificus in Taiwan (Hsueh et al. 2004). However, not all strains possess equal potential for human disease. One study demonstrated that only single strains of V. vulnificus were recovered from the blood of patients who had lethal infections and who had consumed oysters contaminated with numerous strains (Jackson et al. 1997).

13.8

New pandemic strains of Vibrio parahaemolyticus

A variety of serotypes of V. parahaemolyticus normally cause infection, and unlike V. cholerae, there is no association of any particular serotype with disease. In fact, the serotyping scheme for V. parahaemolyticus was developed using strains exclusively of clinical origin. In February 1996, however, a new clone of the O3:K6 serotype emerged in Calcutta, India and quickly spread throughout Asia (Nishibuchi et al. 1996; Matsumoto et al. 2000). The pandemic propensity of this serotype became apparent when reports on the isolation of the O3:K6 serotype from clinical sources appeared in quick succession from Taiwan, Laos, Japan, Thailand and Korea (Matsumoto et al. 2000). The occurrence of foodborne disease outbreaks increased dramatically from 1996 and remained elevated in Taiwan with the O3:K6 serotype accounting for 50.1% in 1996 to 83.8% in 1997 of the total strains of V. parahaemolyticus isolated (Chiou et al. 2000). In the U.S., V. parahaemolyticus O3:K6 was involved in outbreaks from contaminated oysters harvested from Oyster Bay, N.Y. and Galveston Bay, Texas in 1998 (Centers for Disease Control and Prevention 1999). The V. parahaemolyticus outbreak in Galveston Bay was the largest reported in the United States (416 persons), and all

354

Emerging foodborne pathogens

clinical isolates belonged to the O3:K6 serotype (Daniels et al. 2000). Such a widespread occurrence of a single serotype of V. parahaemolyticus was not previously reported and it became evident that the first pandemic in the history of V. parahaemolyticus was ongoing (Fig. 13.2). Genetic analysis showed that the pandemic O3:K6 strains carried the tdh gene but not the trh genes and did not produce urease. Starting with arbitrarily primed PCR (Nishibuchi et al. 1996; Matsumoto et al. 2000), a variety of molecular techniques including ribotyping and pulsed field gel electrophoresis (Bag et al. 1999; Gendel et al. 2001) revealed that the O3:K6 strains associated with outbreaks in widely different geographic areas were genetically closely related group that was distinct from the O3:K6 and non O3:K6 strains isolated before 1996. During the initial period of existence, a certain degree of genomic reassortment among the O3:K6 clones was observed (Bag et al. 1999). At least two different ribotype patterns were observed among the O3:K6 strains from the United States and Asia and most of the strains from the 1998 Galveston Bay outbreak were different from those isolated in New York and other parts of Asia (Gendel et al. 2001). A novel toxRS-targeted PCR method was developed to facilitate rapid diagnosis of the pandemic O3:K6 strains (Matsumoto et al. 2000) which led to the discovery of other serotypes like the O4:K68 and O1:KUT (untypable) that had AP-PCR profiles, toxRS sequences, ribotype and pulsotype identical to that of the pandemic O3:K6 clone (Matsumoto et al. 2000, Chowdhury et al. 2000). These new serotypes appeared to have diverged from the pandemic O3:K6 clone by alteration of the O:K antigens. Multilocus sequence typing provided strong molecular support for the clonal origin of pandemic V. parahaemolyticus O3:K6 and the pandemic strains regardless of serotype were clonal having identical allelic profile and serotype alone did not adequately define a pandemic strain (Chowdhury et al. 2004).

N km Shaded areas represent areas where the pandemic has spread

Fig. 13.2

0

2000 4000

GIS unit, ICDDR,B

The global spread of the pandemic of Vibrio parahaemolyticus.

Vibrios 355 A specific filamentous phage (f237) whose genomic structure is similar to another filamentous phage, CTX (known to carry the gene for cholera enterotoxin) was found to be exclusively associated with all the pandemic strains of V. parahaemolyticus (Nasu et al. 2000; Iida et al. 2001). Instead of ctxAB, f237 possessed a unique open reading frame ORF8, which encodes a protein with similar combination of motifs to a Drosophila adhesive protein encoded by plx (Zhang et al. 1996) leading investigators to believe that the pandemic strains could be more adhesive to host intestinal cells or to the surface of marine plankton. The ORF8 gene was also used as a practical genetic marker for the identification of the pandemic strains of V. parahaemolyticus. In the past eight years, the new pandemic strains of V. parahaemolyticus have caused widespread foodborne outbreaks and the spread of these strains is alarming.

13.9

Pandemic spread of cholera

Outbreaks of cholera cause an estimated 120,000 deaths worldwide and many more cases each year (Faruque et al. 1998). Cholera can spread rapidly and in explosive epidemic form across countries, and at least seven distinct pandemics have been recorded since 1817. Six of these pandemics began from the Ganges delta region of India and Bangladesh, and cholera continues to be an endemic disease in this region (Faruque et al. 1998). The seventh pandemic started in Sulawesi, Indonesia in the early 1960s, and has now spread to most parts of the world. Once endemicity is established in an area, cholera tends to settle into a seasonal pattern. In Bangladesh, for example, epidemic outbreaks usually occur twice during a year, with the highest number of cases just after the monsoon during September to December and a somewhat smaller peak of cholera cases is observed during the spring between March and May (Glass et al. 1982). The beginning of the cholera season coincides with the warmest mean temperature, a fall in the level of river water, and the cessation of rainfall. Seasonal patterns also differ by geographic area, with peak cholera season in Calcutta, India, occurring in April, May, and June. Cholera in South America also developed a periodicity, with more cases in the summer months of January and February. The seventh pandemic is the most extensive of the pandemics in geographic spread and in time, and the causative agent is V. cholerae O1 of the El Tor biotype as opposed to the classical biotype that caused the sixth and presumably earlier pandemics. The seventh pandemic spread to the entire Southeast Asian archipelago by the end of 1962 and during 1963 to 1969, the pandemic spread to the Asian mainland. By 1970, El Tor cholera invaded the Arabian Peninsula, and reached the sub-Saharan West Africa causing explosive outbreaks resulting in more than 400,000 cases with a high case fatality, due mainly to a lack of background immunity in the population, and inadequacies in the health care infrastructure.

356

Emerging foodborne pathogens

The seventh pandemic reached South America in the form of an explosive epidemic that began in Peru in January 1991, and spread to neighboring Ecuador, and then to Colombia, Chile and thence to other countries in South and Central America. The Pan American Health Organization estimates that during 1991–1992 there were 750,000 cases of cholera in the Americas with 6,500 deaths. One of the worst cholera outbreaks occurred in Goma, Eastern Zaire in July 1994, where conflicts between tribes in neighboring Rwanda had displaced nearly a million people who were sheltered in refugee camps. The outbreak of cholera in the refugee camps led to the death of an estimated 12,000 Rwandan refugees during a three-week period (Siddique et al. 1995). The seventh pandemic is ongoing and it continues to cause seasonal outbreaks in many developing countries, especially in Bangladesh and India. However, in 1992, V. cholerae belonging to a non-O1 serogroup (now referred to as O139) caused large epidemics of cholera in India and Bangladesh, and spread to some other countries, perhaps representing the beginning of an eighth pandemic. Recent surveillance has shown that V. cholerae O139 continues to cause cholera outbreaks in India and Bangladesh and coexists with the El Tor vibrios. Recently, there was a marked increase in cholera cases associated with V. cholerae O139 in Bangladesh between March and May, 2002 when an estimated 35,000 cases occurred in and around the capital Dhaka (Faruque et al. 2003).

13.10

Prevention and control

The factor most commonly associated with foodborne Vibrio infections, particularly V. parahaemolyticus and V. vulnificus is consumption of raw or undercooked seafood. Therefore, to prevent gastroenteritis attributable to pathogenic vibrios, consumers should avoid eating raw or undercooked molluscan shellfish. In particular, persons with liver disease should be counselled to avoid raw or undercooked molluscan shellfish, since they are at particularly high risk for V. parahaemolyticus and other severe Vibrio infections (Hlady et al. 1993). Food companies should be encouraged to place warning labels to alert consumers. The wording of the warning labels instituted by the Florida Department of Natural Resources for all wholesale shellfish and shucked product is ‘Consumer information – There is a risk associated with consuming raw oysters or any raw animal protein. If you have chronic illness of the liver, stomach, or blood or have immune disorders, you are at a greater risk of serious illness from raw oysters and should eat oysters fully cooked. If unsure of your risk, consult a physician’ (Centers for Disease Control and Prevention 1993). Public health campaigns should disseminate information that infections by V. parahaemolyticus and V. vulnificus can be easily prevented by adequately cooking all seafood and by not consuming raw molluscan shellfish.

Vibrios 357 Strategies for prevention of outbreaks of Vibrio infections should include (i) monitoring oysters, to identify beds in which Vibrio counts are elevated; (ii) identifying and implementing processing technologies to reduce Vibrio counts in oysters that are sold for raw consumption; (iii) banning harvesting of oysters during the warmer months when seawater temperatures and Vibrio counts are elevated; or (iv) diverting oysters harvested during the warmer months for cooking, irradiation, or pasteurization (Hlady et al. 1993, Centers for Disease Control and Prevention, 1993). Food is an important vehicle for the transmission of V. cholerae especially in an epidemic setting. There, attention to food safety is an essential preventive measure, which should be intensified when there is a threat of cholera. Street vendors and communal food sources will require particular attention, since they pose a special risk (World Health Organization, 1993). For cholera, hand washing, thorough heat treatment of food, chlorination or boiling of water, safe disposal of excreta and sewage water and use of safe water in irrigation are important actions for the control and spread of infection (World Health Organization, 1993). Flies play a relatively small role in spreading cholera but their presence in large numbers indicates poor sanitary conditions, which favour transmission of the disease. During cholera epidemics, in addition to other cholera prevention activities, health officials should inform community leaders about the risk of cholera transmission during funerals, meals should not be served at funerals, and bodies of persons dying of cholera should be disinfected (Gunnlaugsson et al. 1998). Education of food handlers and consumers in safe food handling and prevention of cross-contamination are important preventive measures. Chlorination and other bacteriostatic and bactericidal agents, high pressure, irradiation and mild heating have been used to control V. parahaemolyticus. However, many of these have little practical potential for use in the control of V. parahaemolyticus during the harvesting and post-harvesting steps of fish to be consumed raw (Joint FAO/WHO Activities on Risk Assessment of Microbiological Hazards in Foods 2004). As compared to other Vibrio species, V. vulnificus is most sensitive to most inactivation techniques including mild heat treatment, freezing at –40 ∞C, irradiation, high hydrostatic pressure and low pH (Berlin et al. 1999; Cook and Ruple 1992; Koo et al. 2001). Depuration was shown not to be effective in elimination of V. vulnificus as it resides with various oyster tissues. However, relaying oysters to high salinity (>32 parts per thousand) was shown to reduce V. vulnificus numbers by 3–4 logs (<10 per gram) within two weeks (Motes and DePaola 1996). The Interstate Shellfish Sanitation Conference (ISSC) requires post-harvest-treated oysters to contain less than 30 CFU of V. vulnificus in 1 g of oysters (ISSC 2002). Efficient microbiological monitoring systems at all points from harvest to consumption should be in place to act as check systems. Due to an increased number of disease incidents, the state of California in 2003 released emergency restriction on the sale of all oysters harvested between April and October from the Gulf of Mexico. Effective control measures to reduce the risk of

358

Emerging foodborne pathogens

infection and to ensure the safety of foods, efficient analytical methods for the detection of pathogenic vibrios in foods and the environment, and efficient methods to prevent increase in densities of pathogenic vibrios between harvest and consumption should be established. An important global requirement would be to establish regulatory limits of pathogenic vibrios in seafoods and there is a need to determine safe levels of pathogenic vibrios in seafoods destined for human consumption. Based on quantitative data for V. parahaemolyticus in U.S. shellfish, more than 10,000 total V. parahaemolyticus or >10 tdh- and/or trh-positive V. parahaemolyticus per g in environmental oysters should be considered extraordinary (DePaola et al. 2000). Bacteriological monitoring at harvest sites in the Galveston Bay, however, did not prevent the outbreak in Texas suggesting that current policy and regulations regarding the safety of raw oysters require reevaluation (Daniels et al. 2000). Regulations of the US Food and Drug Administration therefore require additional specific bacteriologic monitoring in shellfish, with a requirement that shellfish have less than 10,000 V. parahaemolyticus organisms per gram of meat. Following the Texas outbreak, Daniels et al. (2000) were of the opinion that V. parahaemolyticus prevention strategies should be based on environmental trigger points, sampling schemes, public education, and the use of new technologies (e.g., pasteurization or radiation) to reduce or eliminate contamination (Daniels et al. 2000).

13.11

Vibrios: the genomic era

The whole genome sequences of V. cholerae, V. parahaemolyticus and V. vulnificus have become available in the past four years reflecting their significance as important human pathogens. A distinctive feature of the genome of the genus Vibrio is that most, if not all, species have two circular chromosomes, a large and a small chromosome. It has been proposed that the genes on the large and small chromosomes of V. cholerae function differently depending on the environments encountered by the organism and the organism adapts to different situation by varying the copy number of the chromosomes (Heidelberg et al. 2000; Trucksis et al. 1998; Yamaichi et al. 1999). Sequencing of the whole genome of a strain each of V. cholerae (Heidelberg et al. 2000), V. parahaemolyticus (Makino et al. 2003) and V. vulnificus (Chen et al. 2003) has shown the presence of super integrons that provide additional sources of genetic variability by their ability to incorporate ORFs and convert exogenous sequences into functional genes (Hall and Collis 1995; RoweMagnus et al. 2001). Based on genome sequence information, it has been postulated that the small chromosome of V. cholerae may have originally been a mega plasmid that was captured by an ancestral Vibrio species (Heidelberg et al. 2000). Comparison of the V. parahaemolyticus genome with that of V. cholerae showed many rearrangements within and between the two chromosomes and

Vibrios 359 the presence of genes for the type III secretion system in V. parahaemolyticus which was not identified in V. cholerae. Genome sequencing has shown that V. parahaemolyticus may have a characteristic common among diarrhoeacausing pathogens such as Shigella, Salmonella and enteropathogenic Escherichia coli, which cause inflammatory diarrhoea by invading or intimately interacting with host intestinal epithelial cells (Makino et al. 2003). The genomic constitution and organization of the three vibrios show how rapid genome evolution has enabled Vibrio species to survive frequently changing conditions in aquatic environments.

13.12

Acknowledgement

We acknowledge with gratitude core donors to the ICDDR,B who support our work. Current donors providing unrestricted support include the aid agencies of the governments of Australia, Bangladesh, Belgium, Canada, Japan, Kingdom of Saudi Arabia, the Netherlands, Sweden, Sri Lanka, Switzerland and the United States of America.

13.13

References

ABBOT, S.L.,

and JANDA, J.M., 1994. Severe gastroenteritis associated with Vibrio hollisae infection: report of two cases and review, Clin Infect Dis, 18 (3), 310–312. ALBERT, M.J., ANSARUZZAMAN, M., BARDHAN, P.K., FARUQUE, A.S.G., FARUQUE, S. M., ISLAM, M.S., MAHALANABISH, D., SACK, R.B., SALAM, M.A., SIDDIQUE, A.K., YUNUS, M.D., and ZAMAN, K., 1993. Large epidemic of cholera like disease in Bangladesh caused by Vibrio cholerae O139 synonym Bengal, Lancet 342 (8868), 387–390. ALBERT, J., NEIRA, M., and MOTARJEMI, Y., 1997. The role of food in the epidemiology of cholera, World Health Statistics Quarterly, 50(1/2), 111–118. AMARO, C. and BIOSCA, E.G., 1996. Vibrio vulnificus biotype 2, pathogenic for eels is also an opportunistic pathogen for humans. Appl Environ Microbiol, 62, 1454–1457. BAG, P.K., NANDI, S., BHADRA, R.K., RAMAMURTHY, T., BHATTACHARYA, S.K., NISHIBUCHI, M., HAMABATA, T., YAMASAKI, S., TAKEDA, Y., and NAIR, G.B., 1999. Clonal diversity among the recently emerged strains of Vibrio parahaemolyticus 03:K6 associated with pandemic spread, J Clin Microbiol, 37, 2354–2357. BAINE, W.B., MAZZOTTI, M., GRECO, D., IZZO, E., ZAMPIERI, A., ANGIONI, G., DI-GIOIA, M., GANGAROSA, E.J., and POCCHIARI, F., 1974. Epidemiology of cholera in Italy in 1973. Lancet, 2 (7893), 1370–1374. BARBIERI, E., FALZANO, L., FIORENTINI, C., PIANETTI, A., BAFFONE, W., FABBRI, A., MATARRESE, P., CASIERE, A., KATOULI, M., KUHN, I., MOLLBY, R., BRUSCOLINI, F., and DONELLI, G., 1999. Occurrence, diversity, and pathogenicity of halophilic Vibrio spp. and non-O1 Vibrio cholerae from estuarine waters along the Italian Adriatic coast, Appl Environ Microbiol, 65 (6), 2448–2753. BARUA, D. and BURROWS, W., 1974. Cholera, Philadelphia: WB Saunders, US. BEJ, A.K., PATTERSON, D.P., BRASHER, C.W., VICKERY, M.C. L., JONES, D.D., and KAYSNER, C.A., 1999. Detection for total and hemolysin-producing Vibrio parahaemolyticus in shellfish using multiplex PCR amplification of tl, tdh and trh, J Microbiol Methods, 36 (3), 215–225.

360

Emerging foodborne pathogens

BERLIN, D.L., HERSON, D.S., HICKS, D.T.,

and HOOVER, D.G., 1999. Response of pathogenic Vibrio species to high hydrostatic pressure, Appl Environ Microbiol, 65 (6), 2776– 2780. BISHARAT, N., and RAZ, R., 1996. Vibrio infection in Israel due to changes in fish marketing. Lancet, 348, 1585–1586. BISHARAT, N., AGMON, V., FINKELSTEIN, R., BEN-DROR, G., LERNER, L., et al. 1999. Clinical, epidemiological, and microbiological features of Vibrio vulnificus biogroup 3 causing outbreaks of wound infection and bacteraemia in Israel, Israel Vibrio Study Group, Lancet 354, 1421–1424. BISHARAT, N., DANIEL, I., COHEN, T., ROSALIND, M., HARDING, FALUSH, D., CROOK, D.W., PETO, T., and MAIDEN, M.C., 2005. Hybrid Vibrio vulnificus, Emerg Infect Dis, 11(1), 30–35. BLACKSTONE, G.M., NORDSTROM, J.L., VICKERY, M.C.L., BOWEN, M.D., MEYER, R. F., and DEPAOLA, A.JR., 2003. Detection of pathogenic Vibrio parahaemolyticus in oyster enrichments by real time PCR, J Microbiol Methods, 53 (2), 149–155. BLAKE, P.A., 1980. Cholera – a possible endemic focus in the United States. N Engl J Med, 302(6), 305–309. BLAKE, P.A., ROSENBERG, M.L., FLORENCIA, J., COSTA, J.B., DO PRADO QUINTINO, L. and GANGAROSA, E.J., 1977. Cholera in Portugal, 1974: II-Transmission by bottled mineral water, Am J Epidemiol, 105(4), 344–348. BLAKE, P.A., MERSON, M.H., WEAVER, R.E., HOLLIS, D.G., and HEUBLEIN, P.C., 1979. Disease caused by a marine Vibrio. Clinical characteristics and epidemiology, N Engl J Med, 300 (1), 1–5. BOYCE, T.G., MINTZ, E.D., GREENE, K.D., WELLS, J.G., HOCKIN, J.C., MORGAN, D. and TAUXE RV., 1995. V. cholerae O139 Bengal infections among tourists to Southeast Asia: an intercontinental foodborne outbreak, J Infect Dis, 172, 1401–1404. BRASHER, C.W., DEPAOLA, A., JONES, D.D., and BEJ, A.K., 1998. Detection of microbial pathogens in shellfish with multiplex PCR, Curr Microbiol, 37 (2), 101–107. BUCHRIESER, C., GANGAR, V.V., MURPHREE, R.L., TAMPLIN, M.L., and KASPAR, C.W., 1995. Multiple Vibrio vulnificus strains in oysters as demonstrated by clamped homogeneous electric field gel electrophoresis, Appl Environ Microbiol, 61 (3), 1163–1168. BUTT, A.A., ALDRIDGE, K.E., and SANDERS, C.V., 2004. Infections related to the ingestion of seafood. Part I: viral and bacterial infections, Lancet Infect Dis, 4 (4), 201–212. CAMPOS, E., BOLANOS, H., ACUNA, M.T., DIAZ, G., MATAMOROS, M.C., RAVENTOS, H., SANCHEZ, L.M., SANCHEZ, O., and BARQUERO, C., 1996. Vibrio mimicus diarrhoea following ingestion of raw turtle eggs, Appl Environ Microbiol, 62 (4), 1141–1144. CASH, R.A., MUSIC, S.I., LIBONATI, J.P., SNYDER, M.J., WENZEL, R.P., and HORNICK, R.B., 1974. Response of man to infection with Vibrio cholerae 1 : Clinical, serologic, and bacteriologic responses to a known inoculum, J Infect Dis, 129 (1), 45–52. CENTERS FOR DISEASE CONTROL, 1991. Cholera outbreak – Peru, Ecuador, and Colombia, Morbid Mortal Weekly Rep, 38, 19–20. CENTERS FOR DISEASE CONTROL AND PREVENTION. 1991. Cholera: New York, Morbid Mortal Weekly Rep, 40(30), 516–518. CENTERS FOR DISEASE CONTROL AND PREVENTION, 1993. Vibrio vulnificus infections associated with raw oyster consumption-Florida, 1981–1992, Morbid Mortal Weekly Rep, 42 (21), 405–407. CENTERS FOR DISEASE CONTROL AND PREVENTION, 1995. Cholera associated with food transported from E1 Salvador-Indiana, 1994. Morbid Mortal Weekly Rep, 44(20), 385–386. CENTERS FOR DISEASE CONTROL AND PREVENTION, 1999. Outbreak of Vibrio parahaemolyticus infection associated with eating raw oysters and clams harvested from Long Island Sound – Connecticut, New Jersey and New York 1998. Morbid Mortal Weekly Rep, 48 (3), 48–51. CENTERS FOR DISEASE CONTROL AND PREVENTION, 2004a. Cholera epidemic associated with raw vegetables – Lusaka, Zambia, 2003–2004, Morbid Mortal Weekly Rep, 53(34), 783–786.

Vibrios 361 CENTERS FOR DISEASE CONTROL AND PREVENTION,

2004b. Preliminary FoodNet data on the incidence of infection with pathogens transmitted commonly through food – selected sites, United States, 2003. Morbid Mortal Weekly Rep, 53(16), 338–343. CERVENY, K.E., DEPAOLA, A., DUCKWORTH, D.H., and GULEG, P.A., 2002. Phage therapy of local and systemic disease caused by Vibrio vulnificus in iron-dextran-treated mice, Infect Immun, 70 (11), 6251–6262. CHAKRABARTI, A.K., GHOSH, A.N., NAIR, G.B., NIYOGI, S.K., BHATTACHARYA, S.K, and SARKAR, B.L., 2000. Development and evaluation of a phage typing scheme for Vibrio cholerae O139 Bengal, J Clin Microbiol, 38 (1), 44–49. CHATTERJEE, B.D., NEOGY, K.N., and GORBACH, S.L., 1970. Study of Vibrio parahaemolyticus from cases of diarrhoea in Calcutta, India, J Med Res, 58 (2), 235–239. CHATTERJEE, B.D., MUKHERJEE, A., and SANYAL, S.N., 1984. Enteroinvasive model of Vibrio parahaemolyticus, Indian J Med Res, 79, 151–158. CHATTOPADHYAY, D.J., SARKAR, B.L., ANSARI, M.O., CHAKRABARTI, B.K., ROY, M.K., GHOSH, A.N., and PAL, S.C., 1993. New phage typing scheme for Vibrio cholerae O1 biotype El Tor strains, J Clin Microbiol, 31(6), 1579–1585. CHEN, C.Y., WU K.M, CHANG, Y.C., CHANG, C.H., TSAI, H.C., LIAO, T.L., LIU, Y. M., DHEN, H.J., SHEN, A.B., LI, J.C., SU, T.L., SHAO, C.P., LEE, C.T., HOR, L.L., and TSAI, S.F., 2003. Comparative genome analysis of Vibrio vulnificus, a marine pathogen, Genome Res, 13 (12), 2577– 2587. CHIANG, S.R., and CHUANG, Y.C., 2003. Vibrio vulnificus infection: clinical manifestations, pathogenesis, and antimicrobial therapy, J Microbiol Immunol Infect, 36 (2), 81–88. CHIOU, C.S., HSU, S.Y., CHIU, S.I., WANG, T.K., and CHAO, C.S., 2000. Vibrio parahaemolyticus serovar O3:K6 as cause of unusually high incidence of food-borne disease outbreaks in Taiwan from 1996 to 1999, J Clin Microbiol, 38 (12), 4621–4625. CHOWDHURY, N.R., CHAKRABORTY, S., RAMAMURTHY, T., NISHIBUCHI, M., YAMASAKI, S., TAKEDA, Y., and NAIR, G.B., 2000. Molecular evidence of clonal Vibrio parahaemolyticus pandemic strains, Emerg Infect Dis, 6 (6), 631–636. CHOWDHURY, N.R., STINE, O.C., MORRIS, J.G., and NAIR, G.B., 2004. Assessment of evolution of pandemic Vibrio parahaemolyticus by multilocus sequence typing, J Clin Microbiol, 42 (3), 1280–1282. CHUANG, Y.C., YUAN, C.Y., LIU, C.Y., LAN, C.K., and HUANG, A.H., 1992. Vibrio vulnificus infection in Taiwan: report of 28 cases and review of clinical manifestations and treatment, Clin Infect Dis, 15 (2), 271–276. CHUN, J., HUQ, A., and COLWELL, R.R., 1999. Analysis of 16S-23S rRNA intergenic spacer regions of Vibrio cholerae and Vibrio mimicus, Appl Environ Microbiol, 65(5): 2202– 2208. CLEMENS, J.D., SACK, D.A., HARRIS, J.R., CHAKRABORTY, J., KHAN, M.R., HUDA, S., AHMED, F., GOES, J., RAO, M.R., SVENNERHOLM, A.M., and HOLMGREN, J., 1989. ABO blood groups and cholera: new observations on specificity of risk and modification of vaccine efficacy, J Infect Dis, 159 (4), 770–773. CLEMENS, J.D., SACK, D.A., HARRIS, J.R., KHAN, M.R., CHAKRABORTY, J., CHOWDHURY, S., RAO, M.R., VAN LOON, F.P.L., STANTON, B.F., YUNUS, M., ALI, M., ANSARUZZAMAN, M., SVENNERHOLM, A.M., and HOLMGREN, J., 1990. Breast feeding and the risk of severe cholera in rural Bangladesh children, Am J Epidemiol, 131 (3), 400–411. COLWELL, R.R., and SPIRA, W.M., 1992. The ecology of Vibrio cholerae In: Cholera, Baura, D. and Greenough III, W.B (eds). Plenum Publishers Co. NY, 107–127. COOK, D.W., 1994. Effect of time and temperature on multiplication of Vibrio vulnificus in postharvest Gulf coast shellstock oyster, Appl Environ Microbiol, 60 (9), 3483–3484. COOK, D.W., 1997. Refrigeration of oyster shellstock: conditions which minimize the outgrowth of Vibrio vulnificus, J Food Prot, 60, 349–352. COOK, D.W., and RUPLE, A.D., 1992. Cold storage and mild heat treatment as processing aids to reduce the numbers of Vibrio Vulnificus in raw oysters, J Food Prot, 525, 985–989.

362

Emerging foodborne pathogens

DALSGAARD, A., HUSS, H.H., H-KITTIKUN, A.,

and LARSEN, J.L., 1995. Prevalence of Vibrio cholerae and Salmonella in a major shrimp production area in Thailand, Int J Food Microbiol, 28 (1), 101–113. DANIELS, N.A., MACKINNON, L.R., BISHOP, ALTEKRUSE, S., RAY, B., HAMMOND, R.M., THOMPSON, S., WILSON, S., BEAN, N.H., GRIFFIN, P.M., and SLUTSKER, L., 2000. Vibrio parahaemolyticus infections in the United States, 1973–1998, J Infect Dis, 181 (5) 1661–1666. DE LORENZO, F., SOSCIA, M., MANZILLO, G., and BALESTRIERI, G.G., 1974. Epidemic of cholera El Tor in Naples, 1973, Lancet 1974; 1 (7859), 669. DEPAOLA, A., 1981. Vibrio cholerae in marine foods and environmental waters: literature review, J Food Sci, 46, 66–70. DEPAOLA, A., and HUANG, G., 1995. Effect of dilution, incubation time, and temperature of enrichment on cultural and PCR detection of Vibrio cholerae obtained from the oyster Crassostrea virginica, Mol Cell Probes, 9 (2), 75–81. DEPAOLA, A., KAYSNER, C.A., BOWERS, J.C., and COOK, D.W., 2000. Environmental investigations of Vibrio parahaemolyticus in oysters following outbreaks in Washington, Texas, and New York (1997 and 1998), Appl Environ Microbiol, 66 (11), 4649–4654. DEPAOLA, A., NORDSTROM, J.L., BOWERS, J.C., WELLS, J.G., and COOK, D.W., 2003. Seasonal abundance of total and pathogenic Vibrio parahaemolyticus in Alabama oysters, Appl Environ Microbiol, 69 (3), 1521–1526. EBERHART-PHILIPS, J., BESSER, R.F., TORMEY, M.P., KOO, D., FEIKIN, D., ARANETA, M.R., WELLS, J., KILMAN, L., RUTHERFORD, G.W., GRIFFIN, P.M., BARON, R., MASCOLA, L., 1996. An outbreak of cholera from food served on an international aircraft, Epidemiol Infect, 116(1), 9– 13. EKO, F.O., UDO, S.M., and ANTIA-OBANG, O.E., 1994. Epidemiology and spectrum of Vibrio diarrhoeas in the lower cross river basin of Nigeria, Cent Eur J Public Health, 2 (1), 37–41. FARUQUE, S.M., ROY, S.K., ALIM, A.R., SIDDIQUE, A.K., and ALBERT, M.J., 1995. Molecular epidemiology of toxigenic Vibrio cholerae in Bangladesh studied by numerical analysis of rRNA gene restriction patterns, J Clin Microbiol, 33 (11), 2833–2838. FARUQUE, S.M., AHMED, K.M., SIDDIQUE, A.K., ZAMAN, K., ALIM, A.R., and ALBERT, M.J., 1997. Molecular analysis of toxigenic Vibrio cholerae O139 Bengal strains isolated in Bangladesh between 1993 and 1996: evidence for emergence of a new clone of the Bengal vibrios, J Clin Microbiol, 35(9), 2299–2306. FARUQUE, S.M., ASADULGHANI, SAHA, M.N., ALIM, A.R., ALBERT, M.J., ISLAM, K.M., and MEKALANOS, J.J., 1998. Analysis of clinical and environmental strains of nontoxigenic Vibrio cholerae for susceptibility to CTXF: molecular basis for origination of new strains with epidemic potential, Infect Immun, 66(12), 5891–5825. FARUQUE, S.M., SAHA, M.N., ASADULGHANI, BAG, P.K., BHADRA, R.K., BHATTACHARYA, S.K., SACK, R.B., TAKEDA, Y., and NAIR, G.B., 2000. Genomic diversity among Vibrio cholerae O139 strains isolated in Bangladesh and India between 1992 and 1998, FEMS Microbiol Lett, 184 (2), 279–284. FARUQUE, S.M., CHOWDHURY, N., KAMRUZZAMAN, M., AHMAD, Q.S., FARUQUE, A.S., SALAM, M.A., RAMAMURTHY, T., NAIR, G.B., WEINTRAUB, A., and SACK, D.A., 2003. Reemergence of epidemic Vibrio cholerae O139, Bangladesh, Emerg Infect Dis, 9 (9), 1116–1122. FATTAL, B., YEKUTIEL, P., and SHUVAL, H.I., 1986. Cholera outbreak in Jerusalem 1970 revisited; the evidence for transmission by wastewater irrigated vegetables. In: Goldsmith, J.R., ed. Environmental epidemiology: epidemiological investigation of community environmental health problems. Boca Raton, F.L., CRC Press. FEACHEM, R.G., 1981. Environmental aspects of cholera epidemiology. I. A review of selected reports of endemic and epidemic situations during 1961–1980, Trop Dis Bull, 78: 675–698. FELSENFELD, O., 1972. Survival of cholera vibrios on food: practical implications and methods of study. Geneva. World Health organization. 1972 (unpublished document BD/cholera/72.1; available on request from Department of Communicable Disease Surveillance and Response, World Health Organization, 1211 Geneva 27, Switzerland).

Vibrios 363 FOOD AND AGRICULTURE ORGANIZATION.

Press release PR98-12E 1998. Import ban on fish products from Africa not the most appropriate answer, Brussels. FOOD AND NUTRITION BOARD, INSTITUTE OF MEDICINE 1991. Seafood Safety/Committee on Evaluation of the Safety of Fishery Products, National Academy Press, Washington, D.C. FORTIN, N.Y., MULCHANDANI, A., and CHEN, W., 2001. Use of real-time polymerase chain reaction and molecular beacons for the detection of Escherichia coli O157:H7, Anal Biochem, 289 (2), 281–288. FUJINO, T., OKUNO, Y., NAKADA, D., AOYAMA, A., FUKAI, K., MUKAI, T., and UEBO, T., 1953. On the bacteriological examination of Shirasu food poisoning, Med J Osaka Univ, 4, 299– 304. FUKUMI, H., 1980. Epidemiological aspects on the cholera outbreak in Japan originating from wedding dinner parties in Ikenohata Bunka Center, Tokyo in 1978. In: Proceeding of the 15th Joint Conference on Cholera. Bethesda, MD, US-Japan Cooperative Medical Science Program, 107–119. GENDEL, S.M., ULASZEK, J., NISHIBUCHI, M., and DEPAOLA, A., 2001. Automated ribotyping differentiates Vibrio parahaemolyticus O3:K6 strains associated with a Texas outbreak from other clinical strains, J Food Prot, 64 (10), 1617–1620. GERGATZ, S.J., and MCFARLAND, L.M., 1989. Cholera on the Louisiana Gulf Coast: historical notes and case report, J La State Med Soc, 141 (10), 29–34. GLASS, R.I., and BLACK, R.E., 1992. The epidemiology of cholera In: Barua D, Greenough WB III, editors Cholera New York: Plenum Medical Book Company, New York, 129– 150. GLASS, R.I., BECKER, S.M., HUQ, I., STOLL, B.J., KHAN, M.U., MERSON, M.H., LEE, J.V., and BLACK, R.E., 1982. Endemic cholera in rural Bangladesh (1966–1980), Am J Epidemiol, 116 (6), 959–970. GLASS, R.I., HOLMGREN, J., HALEY, C.E., KHAN, M.R., SVENNERHOLM, A.M., STOLL, B.J., BELAYET, K. M., BLACK, R.E., YUNUS, M., and BARUA, D., 1985. Predisposition for cholera of individuals with O blood group. Possible evolutionary significance, Am J Epidemiol, 121 (6), 791–796. GOH, K.T., 1979. Epidemiology of diarrhoeal diseases in Singapore, Asian J Infect Dis, 3 (2), 47–56. GOH, K.T., LAM, S., KUMARAPATHY, S. and TAN, J.L., 1984. A common source foodborne outbreak of cholera in Singapore. Int J Epidemiol.,13(2): 210–215. GRAY, L.D., and KREGER, A.S., 1985. Purification and characterization of an extracellular cytolysin produced by Vibrio vulnificus, Infect Immun, 48 (1), 62–72. GUNN, R.A., KIMBALL, A.M., POLLARD, R.A., FEELEY, J.C., FELDMAN, R.A., DUTTA, S.R., MATTHEW, P.P., MAHMOOD, R.A., and LEVINE, M.M., 1979. Bottle feeding as a risk factor for cholera in infants. Lancet, 2 (8145), 730–732. GUNNLAUGSSON, G., FINARSDOTTIR, J., ANGULO, F.J., MENTAMBANAR, S.A., PASSA, A and TAUXE, R.V., 1998. Funerals during the 1994 cholera epidemic in Guinea-Bissau, West Africa: the need for disinfection of bodies of persons dying of cholera, Epidemiol Infect, 120(1), 7–15. HADDOCK, R., 1987. Cholera in a Pacific Island. J Diar Dis Res, 5(3), 181–183. HALL, R.M., and COLLIS, C.M., 1995. Mobile gene cassettes and integrons: Capture and spread of genes by site-specific recombination, Mol Microbiol, 15 (4), 593–600. HALLY, R.J., RUBIN, R.A., FRAIMOW, H .S., and HOFFMAN-TERRY , M.L., 1995. Fatal Vibrio parahaemolyticus septicemia in a patient with cirrhosis: a case report and review of the literature, Dig Dis Sci, 40, 1257–1260. HARA-KUDO, Y., NISHINA, T., NAKAGAWA, H., KONUMA, H., HASEGAWA, J., and KUMAGAI, S., 2001. Improved method for detection of Vibrio parahaemolyticus in seafood, Appl Environ Microbiol, 67 (12), 5819–5823. HARA-KUDO, Y., SUGIYAMA, K., NISHIBUCHI, M., CHOWDHURY, A., YATSUYANAGI, J., OHTOMO, Y., SAITO, A., NAGANO, H., NISHINA, T., NAKAGAWA, H., KONUMA, H., MIYAHARA, M., and KUMAGAI,

364

Emerging foodborne pathogens

S., 2003. Prevalence of thermostable direct hemolysin-producing Vibrio parahaemolyticus

O3:K6 in seafood and coastal environment in Japan, Appl Environ Microbiol, 69 (7), 3883–3891. HEIDELBERG, J.F., EISEN, J.A., NELSON, W.C., CLAYTON, R.A., GWINN, M.L., DODSON, R.J., HAFT, D.H., HICKEY, E.K., PETERSON, J.D., UMAYAM, L., GILL, S.R., NELSON, K.E., READ, T.D., TETTELIN, H., RICHARDSON, D., ERMOLAEVA, M.D., VAMATHEVAN, J., BASS, S., QIN, H., DRAGOI, L., SELLERS, P., MCDONALD, L., UTTERBACK, T., FLEISHMANN, R.D., NIERMAN, W.C., WHITE, O., SALZBERG, S.L., SMITH, H.O., COLWELL, R.R., MAKALANOS, H.J., VENTER, J.C., and FRASER, C.M., 2000. DNA sequence of both chromosomes of the cholera pathogen Vibrio cholerae, Nature, 406 (6795), 477–482. HERRINGTON, D.A., HALL, R.H., LOSONSKY, G., MEKALANOS, J.J., TAYLOR, R.K., and LEVINE, M.M., 1988. Toxin, toxin-coregulated pili, and the toxR regulon are essential for Vibrio cholerae pathogenesis in humans, J Exp Med, 168 (4), 1487–1492. HLADY, W.G., and KLONTZ, K.C., 1996. The epidemiology of Vibrio infections in Florida, (1981–1993), J Infect Dis, 173 (5), 1176–1183. HLADY, W.G., MULLEN, R.C., and HOPKINS, R.S., 1993. Vibrio vulnificus from raw oysters: leading cause of reported deaths from foodborne illness in Florida, J Florida Med Assoc, 80 (8), 536–538. HOLLIS, D.G., WEAVER, R.E., BAKER, C.N., THORNSBERRY, C., and HALOPHILIC, 1976. Vibrio sp. isolated from blood cultures, J Clin Microbiol, 3, 425. HOLMBERG, S.D., HARRIS, J.R., KAY, D.E., HARGRETT, N.T., PARKER, R.D.R., KANSOU, N., RAO, N.U., and BLAKE, P.A., 1984. Foodborne transmission of cholera in Micronesian households, Lancet, 1 (8372), 325–328. HONDA, T., and IIDA, T., 1993. The pathogenicity of Vibrio parahaemolyticus and the role of the thermostable direct haemolysin and related haemolysin, Rev. Med. Microbiol, 4, 106–113. HONDA, T., TAKEDA, Y., MIWATANI, T., KATO, K., and NIMURA, Y., 1976. Clinical features of patients suffering from food poisoning due to Vibrio parahaemolyticus, especially on changes in electrocardiograms, J Jpn Assoc Infect Dis, 50, 216–223. HONDA, T., NI, Y.X., and MIWATANI, T., 1988. Purification and characterization of a hemolysin produced by a clinical isolate of Kanagawa phenomenon-negative Vibrio parahaemolyticus and related to the thermostable direct hemolysin, Infect Immun, 56 (4), 961–965. HOSHINO, K., YAMASAKI, S., MUKHOPADHYAY, A.K., CHAKRABORTY, S., BASU, A., BHATTACHARYA, S.K., NAIR, G.B., SHIMADA, T., and TAKEDA, Y., 1998. Development and evaluation of a multiplex PCR assay for rapid detection of toxigenic Vibrio cholerae O1 and O139, FEMS Immunol Med Microbiol, 20 (3), 201–207. HOWARD, R., BRENNMAN, B., and LIEB, S., 1988. Soft tissue infections in Florida due to marine Vibrio bacteria, J Fla Med Assoc, 73 (1), 29–34. HSU, G.J., YOUNG, T., PENG, M.Y., CHANG, F.Y., and CHOU, M.Y., 1993. Septicemia caused by Vibrio parahaemolyticus: a case report, Zhonghua Yi Xue Za Zhi (Taipei), 52 (5), 351– 354. HSUEH, P.R., LIN, C.Y., TANG, H.J., LEE, H.C., LIU, J.W., LIU, Y.C., and CHUANG, Y.C., 2004. Vibrio vulnificus in Taiwan, Emerg Infect Dis, 10 (9), 1363–1368. HUQ, A., SMALL, E.B., WEST, P.A., HUQ, M.I., RAHMAN, R., and COLWELL, R.R., 1983. Ecological relationships between Vibrio cholerae and planktonic crustacean copepods, Appl Environ Microbiol, 45 (1), 275–283. IGUCHI, T., KONDO, S., and HISATUNE, K., 1995. Vibrio parahaemolyticus O serotypes from O1 to O13 all produce R-type lipopolysaccharide: SDS PAGE and compositional sugar analysis, FEMS Microbiol Lett, 130, 287–292. IIDA, T., HATTORI, A., TAGOMORI, K., NASU, H., NAIM, R., and HONDA, T., 2001. Filamentous phage associated with recent pandemic strains of Vibrio parahaemolyticus, Emerg Infec Dis, 7 (3), 477–478. ISSC, 2002. Issue relating to a Vibrio vulnificus risk management plan for oysters, Interstate Shellfish Sanitation Conference, Columbia, SC.

Vibrios 365 JACKSON, J.K., MURPHREE, R.L.,

and TAMPLIN, M.L., 1997. Evidence that mortality from Vibrio vulnificus infection results from single strains among heterogeneous populations in shellfish, J Clin Microbiol, 35 (8), 2098–2101. JI, S.P., 1989. The first isolation of Vibrio alginolyticus from samples which caused food poisoning, Zhonghua Yu Fang Yi Xue Za Zhi, 23 (2), 71–73 (in Chinese). JOHNSTON, M.J., MARTIN, D.L., PERDUE J, MCFARLAND, L.M., CARAWAY, C.T., LIPPY, E.C., and BLAKE, P.A., 1983. Cholera on a Gulf Coast oil rig, N Engl J Med 309, 523–526. JOHNSTON, J.M., BECKER, S.F., and MCFARLAND, L.M., 1985. Vibrio vulnificus, man and the sea, J Am Med Assoc, 253 (19), 2850–2853. JOINT FAO/WHO ACTIVITIES ON RISK ASSESSMENT OF MICROBIOLOGICAL HAZARDS IN FOODS, 2004. Hazard identification, exposure assessment and hazard characterization of Vibrio spp. in seafood. JONES, D.D., and BEJ, A. K., 1994. Applications of polymerase chain reaction (PCR) in Food Microbiology. In: PCR Technology: Current Innovations, H. Griffin, and Griffin A., (eds), Academic Press, CA, Chapter 33, pp. 341–365. JOSEPH, S.W., COLWELL, R.R., and KAPER, J.B., 1982. Vibrio parahaemolyticus and related halophilic vibrios, CRC Critical Rev Microbiol, 10 (1), 77–124. KAM, K.M, LEUNG, T.H., HO, Y.Y., HO, N.K., and SAW TA., 1995. Outbreak of Vibrio cholerae O1 in Hong Kong related to contaminated fish water tank. Public Health, 109(5), 389– 395. KANEKO, T., and COLWELL, R.R., 1975. Incidence of Vibrio parahaemolyticus in Chesapeake Bay, Appl Microbiol, 30 (2), 251–257. KANEKO, T., and COLWELL, R.R., 1978. The annual cycle of Vibrio parahaemolyticus in Chesapeake bay, Microb Ecology, 4, 135–155. KAPER, J.B., REMMERS, E.F., LOCKMAN, H ., COLWELL, R.R., 1981. Distribution of Vibrio parahaemolyticus in Chesapeake Bay during the summer season, 4, 321–327. KAPER, J.B., BRADFORD, H.B., ROBERTS, N.C., and FALKOW, S., 1982. Molecular epidemiology of Vibrio cholerae in the U.S. Gulf Coast, J Clin Microbiol, 16 (1), 129–134. KAPER, J.B., MORRIS, J.G., and LEVINE, M.M., 1995. Cholera, Clin Microbiol Rev, 8 (1), 48– 86. KAROLIS, D.K.R., JOHNSON, J.A., BAILY, BOEDKER, C.C., KAPER, J.B., and REEVES, P. R., 1998. A Vibrio cholerae pathogenicity island associated with epidemic and pandemic strains, Proc Natl Acad Sci, USA, 95 (6), 3134–3139. KEASLER, S.P. and HALL, R.H.,1993. Detecting and biotyping Vibrio cholerae O1 with multiplex polymerase chain reaction, Lancet. 341(8861): 1661. KELLY, M.T., and STROH, E.M.D., 1981. Occurrence of Vibrionaceae in natural and cultivated oyster populations in the Pacific Northwest, Diagn Microbiol Infect Dis, 9 (1), 1–5. KHAN, M.U., BARUA, D.K., BEGUM, T., and SHAHIDULLAH, M., 1987. Vibriocidal titre in cholera cases and contacts: its value in assessing endemicity of or susceptibility to cholera, Trop Geogr Med, 39(3), 271–275. KIM, Y.B., OKUDA, J., MATSUMOTO, C., TAKAHASHI, N., HASHIMOTO, S., and NISHIBUCHI, M., 1999. Identification of Vibrio parahaemolyticus strains at the species level by PCR targeted to the toxR gene, J Clin Microbiol, 37(4):1173–1177. KIMURA, B., KAWASAKI, S., NAKANO, H., and FUKII, T., 2000. Rapid quantitative PCR monitoring of growth of Clostridium botulinum type E in modified-atmosphere-packaged fish, Appl Environ Microbiol, 67, 206–216. KLONTZ, K.C., TAUXE, R.V., COOK,W.L., RILEY, W.H., and WACHSMUTH, I. K., 1987. Cholera after the consumption of raw oysters, Ann Intern Med, 107 (6), 846–848. KOCH, W.H., PAYNE, W.L., WENTZ, B.A., and CEBULA, T.A., 1993. Rapid polymerase chain reaction method for detection of Vibrio cholerae in foods, Appl Environ Microbiol, 59 (2), 556–560. KOLVIN, J.L., and ROBERTS, D., 1982. Studies on the growth of Vibrio cholerae biotype El Tor and biotype classical in foods, J Hyg Camb, 89 (2), 243–252. KOO, D., ARAGON, A., MOSCOSO, V., GUDIELM, M., BIETTI, L., CARRILLO, N., CHOJOJ, J., GORDILLO, B., CANO, F., CAMERON, D.N., WELLS, J.G., BEAN, N.H. and TAUXE, R.V., 1996. Epidemic

366

Emerging foodborne pathogens

cholera in Guatemala, 1993: transmission of a newly introduced epidemic strain by street vendors. Epidemiol Infect, 116(2), 121–126. KOO, J., MARSHALL, D.L., and DEPAOLA, A., 2001. Antacid increases survival of Vibrio vulnificus and Vibrio vulnificus phage in a gastrointestinal model, Appl Environ Microbiol, 67 (7), 2895–2902. KOTHARY, M.H., and KREGER, A.S., 1985. Production and partial characterization of an elastolytic protease of Vibrio vulnificus. Infect Immun. 50(2): 534–540. KOTHARY, M.H., and KREGER, A.S., 1987. Purification and characterization of an elastolytic protease of Vibrio vulnificus, J Gen Microbiol, 133 (pt 7), 1783–1791. KREGER, A., and LOCKWOOD, D., 1981. Detection of extracellular toxin(s) produced by Vibrio vulnificus, Infect Innun, 33 (2), 583–590. LACEY, C., et al. 1991. Cholera associated with imported frozen coconut milk, Maryland. Morbidity and mortality weekly report, 40(49), 844–845. LEE, C.Y., PAN, S.F. and CHEN, C.H., 1995. Sequence of a cloned pR72H fragment and its use for detection of Vibrio parahaemolyticus in shellfish with the PCR. Appl Environ Microbiol, 61(4): 1311–1317. LEES, D.N., HENSHILWEED, K., and DORE, W.J., 1994. Development of a method for detection of enteroviruses in shellfish by PCR with poliovirus as a model, Appl Environ Microbiol, 60 (8), 2999–3005. LEVINE, M.M., NALIN, D.R., RENNELS, M.B., HORNICK, R.B., SOTMAN, S., VAN-BLERK, G., HUGHES, T. P., O’DONNELL, S., and BARUA, D., 1979. Genetic susceptibility to cholera, Ann Hum Biol, 6 (4), 369–374. LEVINE, M.M., BLACK, R.E., CLEMENTS, M.L., NALIN, D.R., CISNEROS, L., and FINKELSTEIN, R.A., 1981. Volunteer studies in development of vaccines against cholera and enterotoxigenic Escherichia coli, a review, In: T. Holme, J. Holmgren, M.H. Merson, and R. Mollby (ed.). Acute enteric infections in children New prospects for treatment and prevention Amsterdam, Elsevier/North-Holland Biomedical Press. LEVINE, M.M., KAPER, J.B., HERRINGTON, D., LOSONSKY, G., MORRIS, J.G., CLEMENTS, M.L., BLACK, R.E., TELL, B., and HALL, R., 1988. Volunteer studies of deletion mutants of Vibrio cholerae O1 prepared by recombinant techniques, Infect Immun, 56 (1), 161–167. LIM-QUIZON, M.C., et al. 1994. Cholera in metropolitan Manila: foodborne transmission via street vendors. Bulletin of the World Health Organization, 72(5), 745–749. LINKOUS, D.A., and OLIVER, J.D., 1999. Pathogenesis of Vibrio vulnificus, FEMS Microbiol Lett, 174 (2), 207–214. LIPP, K.E., and ROSE, J.B., 1997. The role of seafood in foodborne diseases in the United States of America, Rev Sci Tech, 16, 620–640. LISTON, J., 1974. Influence of U.S. seafood handling procedures on Vibrio parahaemolyticus. In: Fujino, T., Sakaguchi, G. Sakazaki, R, and Takeda Y, (eds). International Symposium on Vibrio parahaemolyticus, Tokyo: Saikon Publishing Co., 123–128. LITWIN, C.M., RAYBACK, T.W., and SKINNER, J., 1996. Role of catechol siderophore synthesis in Vibrio vulnificus virulence, Infect Immun, 64 (7), 283–288. LOWRY, P.W., PAVIA, A.T., MCFARLAND, L.M., PELTIER, B.H., BARRETT, T.J., BRADFORD, H.B., QUAN, J. M., LYNCH, J., MATHISON, J.B., GUNN, R.A., and BLAKE, P.A 1989. Cholera in Louisiana: widening spectrum of seafood vehicles, Arch Intern Med, 149 (9), 2079–2084. LYON, W.J., 2000. TaqMan PCR for detection of Vibrio cholerae O1, O139, non-O1, and non-O139 in pure cultures, raw oysters, and synthetic seawater, Appl Environ Microbiol, 67, 4685–4693. MAKINO, K., OSHIMA, K., KUROKAWA, K., YOKOYAMA, K., UDA, T., TAGOMORI, K., IIJIMA, Y., NAJIMA, M., NAKANO, M., YAMASHITA, A., KUBOTA, Y., KIMURA, Y., YASUNAGA, T., HONDA, T., SHINAGAWA, H., HATTORI, M., and IIDA, T., 2003. Genome sequence of Vibrio parahaemolyticus: a pathogenic mechanism distinct from that of V cholerae, Lancet, 361 (9359), 743–49. MARSHAL, S., CLARK, C.G., WANG, G., MULVEY, W., KELLY, T., and JOHNSON, W.M., 1999. Comparison of molecular methods for typing Vibrio parahaemolyticus, J Clin Microbiol, 37, 2473– 2478.

Vibrios 367 MATSUMOTO, C., OKUDA, J., ISHIBASHI, M., IWANAGA, M., GARG, P., RAMAMURTHY, T., WONG, H., DEPAOLA, A., KIM, Y.B., ALBERT, M.J.,

and NISHIBUCHI, M., 2000. Pandemic spread of an 03:K6 clone of Vibrio parahaemolyticus and emergence of related strains evidenced by arbitrarily primed PCR and toxRS sequence analyses, J Clin Microbiol, 38, 578– 585. MCCARTHY, S.A., and BLACKSTONE, G.M., 2000. DNA isolation methods for detection of pathogenic Vibrio parahaemolyticus by PCR, Lab Inform Bull, 4222 (16), Department of Health and Human Services, Rockville, MD, 1–13. MCCORMACK, W.M., ISLAM, M.S., FAHIMUDDIN, M., and MOSLEY, W.H., 1969. A community study of inapparent cholera infections, Am J Epidemiol, 89 (6), 658–664. MCINTYRE, R.C., et al. 1979. Modes of transmission of cholera in a newly infected population on an atoll: implications for control measures. Lancet, 1(8111), 311–314. MEAD, P.S., SLUTSKER, L., DIETZ, V., MCGAIG, L.F., BRESEE, J.S., SHARPIRO, C., GRIFFIN, P.M., and TAUXE, R.V., 1999. Food-related illness and death in the United States, Emerg Infect Dis, 5 (5), 607–625. MIWATANI, T., and TAKEDA, Y., 1975. Vibrio parahaemolyticus epidemiology ecology and biology, pp. 22–24. In: Miwatani, T. and Takeda, Y. (eds). Vibrio parahaemolyticus a causative bacterium of seafood poisoning, Saiko, Tokyo, Japan. MIYAMOTO, Y., KATO, T., OBRA, S., AKIYAMA, S., TAKIZAWA, K., and YAMAI, S., 1969. In vitro hemolytic characteristic of Vibrio parahaemolyticus: its close correlation with human pathogenicity, J Bacteriol, 100 (2), 1147–1149. MIYOSHI, N., SHIMIZU, C., MIYOSHI, I., and SHINODA, S., 1987. Purification and characterization of Vibrio vulnificus protease, Microbiol Immunol, 31(1), 13–25. MORRIS, J.R., WILSON, R., DAVIS, B.R., WACHSMUTH, I.K., RIDDLE, C.F., WATHEN, H.G., POLLARD, R.A., and BLAKE, P.A., 1981. Non-O group 1 Vibrio cholerae gastroenteritis in the United States: clinical, epidemiologic, and laboratory characteristics of sporadic cases, Ann Intern Med, 94 (5), 656–658. MOTES, M.L., and DEPAOLA, A., 1996. Offshore suspension relaying to reduce levels of Vibrio vulnificus in oysters (Crassostrea virginica), Appl Environ Microbiol, 62 (10), 3875–3877. MOTES, M.L., DEPAOLA, A., COOK, D.W., VEAZEY, J.E., HUNSUCHER, J.C., GARTHRIGHT, W.E., BLODGETT, R.J., and CHIRTEL, S.J., 1998. Influence of water temperature and salinity on Vibrio vulnificus in northern Gulf and Atlantic Coast oysters (Crassostrea virginica), Appl Environ Microbiol, 64 (4), 1459–1465. NAIR, G.B., GARG, S., MUKHOPADHYAY, A.K., SHIMADA, T., and TAKEDA, Y., 1994a, Laboratory diagnosis of Vibrio cholerae O139 Bengal, the new pandemic strain of cholera, LabMedica International, XI, 8–11. NAIR, G.B., RAMAMURTHY, T., BHATTACHARYA, S.K., MUKHOPADHYAY, A.K., GARG, S., BHATTACHARYA, M.K., TAKEDA, T., SHIMADA, T., TAKEDA, Y., and DEB, B.C., 1994b. Spread of Vibrio cholerae O139 Bengal in India, J Infec Dis, 169 (5), 1029–1034. NANDI, B., NANDY, R.K., MUKHOPADHYAY, S., NAIR, G.B., SHIMADA, T., GHOSE, A.C., 2000. Rapid method for species-specific identification of Vibrio cholerae using primers targeted to the gene of outer membrane protein OmpW, J Clin Microbiol., 38(11): 4145–4151. NASU, H., IIDA, T., SUGAHARA, T., YAMAICHI, Y., PARK, K.S., YOKOYAMA, K., MAKINO, K., SHINAGAWA, H., and HONDA, T., 2000. A filamentous phage associated with recent pandemic Vibrio parahaemolyticus O3:K6 strains, J Clin Microbiol, 38 (6), 2156–2161. NG, T.C., CHIANG, P.C., WU, T.L., and LEU, H.S., 1999. Vibrio parahaemolyticus bacteremia: case report, Changgeng Yi Xue Za Zhi, 22 (3), 508–514. NISHIBUCHI, M., FASANO, A., RUSSELL, R.G., and KAPER, J.B., 1992. Enterotoxigenicity of Vibrio parahaemolyticus with and without genes encoding thermostable direct hemolysin, Infect Immun, 60 (9), 3539–3545. NISHIBUCHI, M., JANDA, J.M., and EZAKI, T., 1996. The Thermostable Direct Hemolysin Gene (tdh) of Vibrio hollisae is Dissimilar in Prevalence to and Phylogenetically Distant from the tdh Genes of Other Vibrios: Implications in the Horizontal Transfer of the tdh Gene, Microbiol Immunol, 40 (1), 59–65.

368

Emerging foodborne pathogens

NOGVA, H.K., RUDI, K., NATERSTAD, K., HOLCK, A.,

and LILLEHAUG, D., 2000. Application of 5'nuclease PCR for quantitative detection of Listeria monocytogenes in pure cultures, water, skim milk, and unpasteurized whole milk, Appl Environ Microbiol, 66 (10), 4266–4271. OKUDA, J., ISHIBASHI, M., ABBOTT, S.L., JANDA, J.M., and NISHIBUCHI, M., 1997. Analysis of the thermostable direct hemolysin (tdh) gene and the tdh-related hemolysin (trh) genes in urease-positive strains of Vibrio parahaemolyticus isolated on the West Coast of the United States, J Clin Microbiol, 35 (8), 1965–1971. OKUJO, N., and YAMAMOTO, S., 1994. Identification of the siderophores from Vibrio hollisae and Vibrio mimicus as aerobactin, FEMS Microbiol Lett, 118 (1-2), 187–192. OLIVER, J.D., and KAPER, J.B., Vibrio species, p. 228–264. In: M. Doyle, L.R. Beuchat, and T.J. Montville, eds 1997. Food Microbiology: Fundamentals and Frontiers, ASM Press, Washington, D.C. PAL, S.C., SIRCAR, B.K., NAIR, G.B., and DEB, B.C., 1984. Epidemiology of bacterial diarrhoeal diseases in India with special reference to Vibrio parahaemolyticus infections, In: Bacterial Diarrhoeal Disease, eds, Y. Takeda and T. Miwatani. KTK Scientific Publishers, Tokyo, pp. 65–73. PAN AMERICAN HEALTH ORGANIZATION, 1991. Cholera in the Americas, Bull Pan Am Health Organ, 25, 267–273. PAN, T.M., CHAI, T.J., CHIEN, S.W., and HORNG, C.B., 1996. Foodborne disease outbreaks due to bacteria in Taiwan, 1986 to 1995, J Clin Microbiol, 35 (5), 1260–1262. PANICKER, G., VICKERY, M.C., BEJ, A.K., 2004a. Multiplex PCR detection of clinical and environmental strains of Vibrio vulnificus in shellfish, Can J Microbiol, 50(11), 911– 922. PANICKER, G., MICHAEL, L.M., and BEJ, A.K., 2004b. Rapid Detection of Vibrio vulnificus in Shellfish and Gulf of Mexico Water by Real-Time PCR, Apply Environ Microbiol, 70 (1), 498–507. PARK, S.D., SHON, H.S., and JOH, N.J., 1991. Vibrio vulnificus septicemia in Korea: clinical and epidemiologic findings in seventy patients, J Am Acad Dermatol, 24 (3), 397– 403. PARK, K.S., IIDA, T., YAMAICHI, Y., OYAGI, T., YAMAMOTO, K., and HONDA, T., 2000. Genetic characterization of DNA region containing the trh and ure genes of Vibrio parahaemolyticus, Infect Immun, 68 (10), 5742–5748. PATNAIK, S.K., SHUKLA, P., VERMA, P., DIXIT, G.C., PAL, D., and SHARMA, S.N., 1989. Outbreak of cholera in Berasia Block of Bhopal District in Madhya Pradesh. J Commun Dis, 21(2), 123–128. PAVIA, A.T., CAMPBELL, J.F., BLAKE, P.A., SMITH, J.D., MCKINLEY, T. W., and MARTIN, D.L., 1987. Cholera from raw oysters shipped interstate, J Am Med Assoc, 258 (17), 2374. PEREZ-TIRSE, J., LEVINE, J.F., and MECCA, M., 1993. Vibrio damsela. A cause of fulminant septicemia, Arch Intern Med, 153 (15), 1838–1840. POPOVIC, T., BOPP, C., OLSVIK, O., and WACHSMUTH, K., 1993. Epidemiologic application of a standardized ribotype scheme for Vibrio cholerae O1, J Clin Microbiol, 31(9), 2474– 2482. QADRI, F., ALAM, M.S., NISHIBUCHI, M., RAHMAN, T., ALAM, N.H., CHISTI, J., KONDO, S., SUGIYAMA, J., BHUIYAN, N.A., MATHAN, M., SACK, D.A., and NAIR G.B., 2003. Adaptive and inflammatory immune response in patients infected with strains of Vibrio parahaemolyticus, J Infect Dis, 187, 1085–1096. QUEVEDO, F. 1993. Foods and cholera. In: Pestana DE Castro, A.F., Almeida, W.F., eds, Cholera on the American continents. Washington DC. International Life Science Institute (ILSI) Press. RABBANI, G.H., and GREENOUGH, W.B III., 1992. Pathophysiology and clinical aspects of cholera, In: Barua, D., Greenough, W.B. III., editors, Cholera. New York, Plenum. RAMAMURTHY, T., GARG, S., SHARMA, R., BHATTACHARYA, S.K., NAIR, G.B., SHIMADA, T., TAKEDA, T., KARASAWA, T., KURAZONO, H., PAL, A., and TAKEDA, Y., 1993. Emergence of a novel

Vibrios 369 strain of Vibrio cholerae with epidemic potential in southern and eastern India, Lancet, 341, (8846), 703–704. RAQIB, R., MIA, S.M., QADRI, F., ALAM, T.I., ALAM, N.H., CHOWDHURY, A.K., MATHAN, M.M., and ANDERSSON, J., 2000. Innate immune responses in children and adults with Shigellosis, Infect Immun, 68 (6), 3620–3629. RIES, A.A., VUGIA, D.J., BEINGOLEA, L., PALACIOS, A.M., VASQUEZ, E., WELLS, J.G., BACA, N.G., SWERDLOW, D.L., POLLACK, M., BEAN, N.H., SEMINARIO, L., and TAUXE, R.V., 1992. Cholera in Piura, Peru: a modern urban epidemic, J Infect Dis, 166 (6), 1429–1433. RIVERA, I.N., LIPP, E.K., GIL, A., CHOOPUN, N., HUQ, A., and COLWELL, R.R., 2003. Method of DNA extraction and application of multiplex polymerase chain reaction to detect toxigenic Vibrio cholerae O1 and O139 from aquatic ecosystems, Environ Microbiol, 5 (7), 599–606. ROWE-MAGNUS, DOA, GUETOUT, A.M., PLONCARD, P., DYCHINCO, B., DAVIES, J., and MAZEL, D., 2001. The evolutionary history of chromosomal super-integrons provides an ancestry for multiresistant integrons, Proc Natl Acad Sci USA, 98 (2), 652–657. SACK, D.A., TACKET, C.O., COHEN, M.B., SACK, R.B., LOSONSKY, G.A., SHIMKO, J., NATARO, J.P., EDELMAN, R., LEVINE, M.M., GIANNELLA, R.A., SCHIFF, G., and LANG, D., 1998. Validation of a volunteer model of cholera with frozen bacteria as the challenge, Infect Immun, 66, 1968–1972. SACK, D.A., SACK, R.B., NAIR, G.B., and SIDDIQUE, A. K., 2004. Cholera, Lancet, 363 (9404), 223–233. SAKAZAKI, R., TAMURA, K., PRESCOTT, L.M., BENCIC, Z., SANYALAT, S.C., and SINHA, R., 1971. Bacteriological examination of diarrhoeal stools in Calcutta, Indian J Med Res, 59 (7), 1025–1034. SALMASO, S., GRECO, D., BONFIGLIO, B., CASTELLANI-PASTORIS, M., DE FELIP, G., BRACCIOTTI, A., SITZIA, G., CONGIU, A., PIU, G., ANGIONI, G., BARRA, L., ZAMPIERI, A., and BAINE, W.B., 1980. Recurrence of pelecypod-associated cholera in Sardinia, Lancet, 2 (8204), 1124– 1127. SARKAR, B.L., NAIR, G.B., BANERJEE, A.K., and PAL, S.C., 1985. Seasonal Distribution of Vibrio parahaemolyticus in freshwater environs and in association with fresh water fishes in Calcutta, Appl Environ Microbiol, 49 (1), 132–136. SHIMADA, T., and SAKAZAKI, R., 1984. On the serology of Vibrio vulnificus, Jpn J Med Sci Biol, 37(5/6), 241–246. SHIN, J.H., SHIN, M.G., SUH, S.P., RYANG, D.W., REW, J.S., and NOLTE, F.S., 1996. Primary Vibrio demsela septicemia, Clin Infect Dis, 22, 856–857. SHINODA, S., KOBAYASHI, M., YAMADA, H., YOSHIDA, S., OGAWA, M., and MIZUGUCHI, Y., 1987. Inhibitory effect of capsular antigen of Vibrio vulnificus on bactericidal activity of human serum, Microbiol Immunol, 31 (5), 393–401. SHIRAI, H., ITO, H., HIRAYAMA, T., NAKABAYASHI, Y., KUMAGAI, K., TAKEDA, Y., and NISHIBUCHI, M., 1990. Molecular epidemiologic evidence for association of thermostable direct hemolysin (TDH) and TDH-related hemolysin of Vibrio parahaemolyticus with gastroenteritis, Infect Immun, 58 (11), 3568–3575. SIDDIQUE, A.K., SALAM, A., ISLAM, M.S., AKRAM, K., MAJUMDAR, R.N., ZAMAN, K., FRONCZAK, N., and LASTON, S., 1995. Why treatment centres failed to prevent cholera deaths among Rwandan refugees in Goma, Zaire, Lancet, 345 (8946), 359–361. SIMONSON, J., and SIEBELING, R.J., 1986. Rapid serological identification of Vibrio vulnificus by anti-H coagglutination, Appl Environ Microbiol, 52 (6), 1299–1304. SIMONSON, J., and SIEBELING, R.J., 1988. Coagglutination of Vibrio cholerae, Vibrio mimicus, and Vibrio vulnificus with anti-flagellar monoclonal antibody, J Clin Microbiol, 26 (10), 1962–1966. SINGLETON, F.L., ATTWELL, R., JANGI, S., and COLWELL, R.R., 1982. Effects of temperature and salinity on V. cholerae growth, Appl Environ Microbiol, 44 (5), 1047–1058. SPIRA, W.M., KHAN, M.U., SAEED, Y.A., and SATTAR, M.A., 1980. Microbiological surveillance of intra-neighbourhood E1 Tor cholera transmission in rural Bangladesh, Bull World Health Organ, 58 (5), 731–740.

370

Emerging foodborne pathogens

ST. LOUIS, M.E., PORTER, J.D., HELAL, A., DRAME, K., HARGRETT-BEAN, N., WELLS, J. G.,

and TAUXE, 1990. Epidemic cholera in West Africa: the role of food handling and high-risk foods, Am J Epidemiol, 131 (4), 719–728. SUTTON, R.G.A., 1974. An outbreak of cholera in Australia due to food served in flight on an international aircraft. J Hyg, 72, 441–451. SWADDIWUDHIPONG, W., AKARASEWI, P., CHAYANIYAYODHIN, T., KUNASOL, P., and FOY, H.M., 1990. A cholera outbreak associated with eating uncooked pork in Thailand. J Diarrhoeal Dis Res, 8(3), 94–96. SWADDIWUDHIPONG, W., JIRAKANVISUN, R., and RODKLAI, A., 1992. A common source of foodborne outbreak of El Tor cholera following the consumption of uncooked beef. J Med Assoc Thailand, 75(7), 413–417. SWERDLOW, D.L., MINTZ, E.D., RODRIGUEZ, M., TEJADA, E., OCAMPO, C., ESPEJO, L., GREENE, K.D., SALDANA, W., SEMINARIO, L., TAUXE, R.V., WELLS, J.G., BEAN, N.H., RIES, A.A., POLLACK, M., VERTIZ, B., and BLAKE, P.A., 1992. Waterborne transmission of epidemic cholera in Trujillo, Peru: lessons for a continent at risk, Lancet, 340 (8810), 28–32. TACKET, C.O., BRENNER, F., and BLAKE, P.A., 1984. Clinical features and an epidemiological study of Vibrio vulnificus infections, J Infect Dis, 149 (4), 558–561. TADA, J., OHASHI, T., NISHIMURA, N., SHIRASAKI, Y., OZAKI, H., FUKUSHIMA, S., TAKANO, J., NISHIBUCHI, M., and TAKEDA, Y., 1992. Detection of the thermostable direct hemolysin gene (tdh) and the thermostable direct hemolysin-related hemolysin gene (trh) of Vibrio parahaemolyticus by polymerase chain reaction, Mol Cell Probes, 6 (6), 477–487. TAKEDA, Y., 1983. Thermostable direct hemolysin Vibrio parahaemolyticus, Pharmacol Ther, 19, 123–146. TAMPLIN, M.L, 1994. The ecology of Vibrio vulnificus, In: W. WATKINS and s. MCCARTHY (eds.), Proceedings of the 1994 Vibrio vulnificus Workshop. Office of Seafood, Washington, D.C. TAMPLIN, M.L., SPECTER, S., RODRICK, G.E., and FRIEDMAN, H., 1985. Vibrio vulnificus resists phagocytosis in the absence of serum opsonins, Infect Immun, 49 (3), 715–718. TAMPLIN, M.L., JACKSON, J.K., MUCHRIESER, C., MURPHREE, KENNETH, M., GANGAR, V., MILLER, L.G., and KASPAR, C.W., 1996. Pulsed-Field gel electrophoresis and ribotype profiles of clinical and environmental Vibrio vulnificus isolates, Appl Environ Microbiol, 62 (10), 3572–3580. TANIGUCHI, H., HARANO, R., KUBOMURA, S., HIGASHI, K., and MIZUGUCHI, Y., 1986. Comparison of the nucleotide sequences of the genes for the thermostable direct hemolysin and the thermolabile hemolysin from Vibrio parahaemolyticus, Microb Pathog, 1 (5), 425– 432. TASSIN, M.G., SIEBELING, R.J., ROBERTS, N.C., and LARSON, A.D., 1983. Presumptive identification of Vibrio species with H antiserum, J Clin Microbiol, 18 (2), 400–407. TAUXE, R.V., HOLMBERG, S.D., DODIN, A., WELLS, J.V., and BLAKE, P.A., 1988. Epidemic cholera in Mali: high mortality and multiple routes of transmission in a famine area. Epidemiol Infect, 100 (2), 279–289. TAYLOR, R.K., MILLER, V.L., FURLONG, D.B., and MEKALANOS, J.J., 1987. Use of phoA gene fusions to identify a pilus colonization factor coordinately regulated with cholera toxin, Proc Natl Acad Sci, USA, 84 (9), 2833–2837. TENG, P.H. The role of foods in the transmission of cholera. In: Bushnell Q.A., Brookhyser C.S., eds, Proceeding of Cholera Research Symposium, Honolulu, Hawaii. Washington DC, US Department of Health, Education and Welfare, 1965, 328–331. TESTA, J ., DANIEL, L.W., and KREGER, A.S., 1984. Extracellular phospholipase A2 and lysophospholipase produced by Vibrio vulnificus, Infect Immun, 45 (2), 458–463. THEKDI, R.J., LAKHANI, A.G., RALE, V.B., and PANSE, M.V., 1990. An outbreak of food poisoning suspected to be caused by Vibrio fluvialis, J Diarrhoeal Dis Res, 8 (4), 163–165. THOMPSON, C.A., VANDERZANT, C., and RAY, S.M., 1976. Serological and hemolytic characteristics of Vibrio parahaemolyticus from marine sources, J Food Sci, 41, 204–205. R.V.,

Vibrios 371 TODD, E.C.D.,

1989. Preliminary estimates of costs of foodborne disease in the United States, J Food Protect, 52, 595–601. TRUCKSIS, M., MICHALSKI, J., DENG, Y.K., and KAPER, J.B., 1998. The Vibrio cholerae genome contains two unique circular chromosomes, Proc Natl Acad Sci USA, 95 (24), 14464– 14469. TUYET, D.T., THIEM, V.D., SEIDLEIN, L.V., ASHRAFUZZAMAN, C., PARK, E., CANH, D.G., CHIEN, B.T., GUNG, T.V., NAFICY. A., RAO, M.R., ALI, M., LEE, Y., HUNG, T.S., NICHIBUCHI, M., CLEMENS, J., and TRACH, D.D., 2002. Clinical epidemiological and socioeconomic analysis of an outbreak of Vibrio parahaemolyticus in Khanh Hoa Province, Vietnam, J Infect Dis, 186 (11), 1615–1620. VASCONCELOS, F.J., STANG, W.J., and LAIDLAW, R.H., 1975. Isolation of Vibrio parahaemolyticus and Vibrio alginolyticus from estuarine areas of Southeastern Alaska, Appl Microbiol, 29 (4), 557–559. VENKATESWARAN, K., DOHMOTO, N., and HARAYAMA, S., 1998. Cloning and nucleotide sequence of the gyrB gene of Vibrio parahaemolyticus and its application in detection of this pathogen in shrimp, Appl Environ Microbiol, 1998 64(2), 681–687. WAGATSUMA, S., 1974. Ecological studies on Kanagawa phenomenon positive strains of Vibrio parahaemolyticus, International symposium on Vibrio parahaemolyticus, Saikon Publishing Co, Tokyo, 91–96. WALDOR, M.K., and MEKALANOS, J.J., 1996. Lysogenic conversion by a filamentous phage encoding cholera toxin, Science, 272 (5270), 1910–1914. WEBER, J.T., MINTZ, E.D., CANIZARES, R., SEMIGLIA, A., GOMEZ, I., SEMPERTEGUI, R., DAVILA, A., GREENE, K.D., PUHR, N.D., and CAMERON, D.N., 1994. Epidemic cholera in Ecuador: multidrugresistance and transmission by water and seafood. Epidemiol Infect, 112 (1), 1–11. WEISSMAN, J.B., DEWITT, W.E., THOMPSON, J., MUCHNICK, C.N., PORTNOY, B.L., FEELEY, J.C., and GANGAROSA, E.J., 1974. A case of cholera in Texas, 1973. Am J Epidemiol, 100 (6), 487–98. WONG, H.C., TING, S.H., SHIEH, W.R., 1992. Incidence of toxigenic vibrios in foods available in Taiwan, J Appl Bacteriol, 73 (3), 197–202. WONG, H.C., LIU, S. H., KU, L., W., LEE, I.Y., WANG, T.K., LEE, C.L., KUO, L.P., and SHIH, D.Y., C 2000a. Characterization of Vibrio parahaemolyticus isolates obtained from foodborne illness outbreaks during 1992 through 1995 in Taiwan, J Food Prot, 63, 900–906. WONG, H.C., LIU, S.H., WANG, T.K., LEE, C. L., CHIOU, C.S., LIU, D.P., NISHIBUCHI, M., and LEE, B. K., 2000b. Characteristics of Vibrio parahaemolyticus 03:K6 from Asia, App Environ Microbiol, 66, 3981–3986. WORLD HEALTH ORGANIZATON, 1980. Cholera surveillance. Weekly Epidemiol Rec, 55(13), 93–94. WORLD HEALTH ORGANIZATON, 1993. Guidelines for cholera control. ISBN: 92 415 4449X. WORLD HEALTH ORGANIZATION, 1999. Vibrio parahaemolyticus, Japan, 1996–1998, Weekly Epidemiol Rec, 74 (43), 357–364. WORLD HEALTH ORGANIZATON, 2000. Foodborne disease: a focus for health education. Publication of WHO. WRIGHT, A.C., SIMPSON, L.M., OLIVER, J.D., and MORRIS, J.G. JR., 1990. Phenotypic evaluation of a capsular transposon mutants of Vibrio vulnificus, Infect Immun, 58 (6), 1769– 1773. YAMAI, S., OKITSU, T., SHIMADA, T., and KATSUBE, Y., 1997. Distribution of serogroups of Vibrio cholerae non-O1 non-O139 with specific reference to their ability to produce cholera toxin, and addition of novel serogroups, Kansenshogaku Zasshi, 71 (10), 1037–1045. YAMAICHI, Y., IIDA, T., PARK, K.S., YAMAMOTO, K., and HONDA, T., 1999. Physical and genetic map of the genome of Vibrio parahaemolyticus: presence of two chromosomes in Vibrio species, Mol Microbiol, 31 (5), 1513–1521. YOSHIDA, S., OGAWA, M., and MIZUGUCHI, Y., 1985. Relation of capsular materials and colony opacity to virulence of Vibrio vulnificus, Infect Immun, 47 (2) 446–451.

372

Emerging foodborne pathogens

ZEN-YOJI, H., SAKAI, S., TERAYAMA, T., KUDO, Y., ITO, T., BENOKI, M.,

and NAGASAKI, M., 1965. Epidemiology, enteropathogenicity, and classification of Vibrio parahaemolyticus, J Infect Dis, 115 (5), 436–444. ZHANG, S.D., KASSIS, J., OLDE, B., MELLERICK, D.M., and ODEWALD, W. F., 1996. Pollux, a novel Drosphila adhesion molecule, belongs to a family of proteins expressed in plants, yeasts, nematodes and man, Genes Dev, 10, 1108–1119.

Yersinia enterocolitica 373

14 Yersinia enterocolitica T. Nesbakken, Norwegian School of Veterinary Science, Norway

14.1

Introduction

The chapter starts with a description of the agent, the emergence of yersiniosis and the historical aspects related not only to Yersinia enterocolitica, but also to Yersinia pestis and Yersinia pseudotuberculosis. Characteristics and taxonomy are important since Yersinia enterocolitica is the only foodborne agent, but has close relations to Y. enterocolitica-like bacteria, and correlations between biovars, serovars, ecology and pathogenicity mean that phenotypic characterisation is relevant. In many instances, attempts to isolate Y. enterocolitica from foods implicated in cases of disease in humans have been unsuccessful. Accordingly, efficient isolation and detection methods are described. Under the heading of epidemiology, clinical symptoms of Y. enterocolitica infection, pathogenesis and immunity, sporadic cases, outbreaks and sources of infection like pigs and pork are discussed. Risk factors connected to the agent (plasmid and chromosomal), the host (infection and immunity) and the agent’s ability to survive and grow under different conditions in foods are presented. An important property of the bacterium is its ability to multiply at temperatures near to 0 ∞C, and therefore in many chilled foods. Evidence from large outbreaks of yersiniosis in the USA, Canada and Japan (Cover and Amber, 1989) and from epidemiological studies of sporadic cases (Ostroff et al., 1994; Tauxe et al., 1987) has shown that Y. enterocolitica is a foodborne pathogen, and that in many cases pork is implicated as the source of infection (Hurvell, 1981; Ostroff et al., 1994; Tauxe et al., 1987). Preventive measures and control in the food chain are possible, and some examples of successful control measures in the abattoir are described. Possible interventions at different stages of the food chain are discussed.

374

Emerging foodborne pathogens

14.1.1 Historical aspects The genus Yersinia of the family Enterobacteriaceae includes three wellestablished pathogens (Yersinia pestis, Yersinia pseudotuberculosis and Yersinia enterocolitica) and several non-pathogens (Mollaret et al., 1979). Y. pestis was isolated by Alexandre Yersin in 1894 (Yersin, 1894). The most important Yersinia infection, plague, caused by Y. pestis, is one of the oldest recognised human diseases. Historically, Y. pestis evolved from Y. pseudotuberculosis (Achtman et al., 1999) while Y. enterocolitica is distantly related to Y. pseudotuberculosis and Y. pestis (Chapter 1). Although infections caused by Y. pseudotuberculosis and Y. enterocolitica have been reported regularly only during the last 30 years, it is nevertheless likely that these infections have also occurred for many years. Disease due to Y. pseudotuberculosis (first described in 1884) has been recognised since the beginning of the 20th century, and Y. enterocolitica was first shown to be associated with human disease in 1939 (Mollaret, 1995). The current interest in Y. enterocolitica started in 1958 following a number of epizootics among chinchillas and hares (Hurvell, 1981; Mollaret et al., 1979), and after the establishment of a causal relationship with abscedising lymphadenitis in man. The similarity between the human and animal isolates was established in 1963, and in 1964 the species name Y. enterocolitica was formally proposed by Frederiksen (1964). During the past thirty years, the bacterium has been found with increasing frequency as a cause of human disease, and from animals and inanimate sources.

14.2

Taxonomy and characteristics of Yersinia enterocolitica

A general numerical taxonomic study from 1958 placed Yersinia between Klebsiella and Escherichia coli (Sneath and Cowan 1958). The allocation of Yersinia to the family Enterobacteriaceae was further supported by Frederiksen (1964). Y. enterocolitica is a Gram-negative, oxidase-negative, catalase-positive, nitrate reductase-positive, facultative anaerobic rod (occasionally coccoid), 0.5–0.8 ¥ 1–3 mm in size (Bercovier and Mollaret, 1984). It does not form a capsule or spores. It is non-motile at 35–37 ∞C, but motile at 22–25 ∞C with relatively few, peritrichous flagellae. Some human pathogenic strains of serovar O:3 are, however, non-motile at both temperatures. In addition, the bacterium is urease-positive, H2S-negative, ferments mannitol, and produces acid, but not gas, from glucose (Bercovier and Mollaret, 1984). Aspects of survival and growth are described in Section 14.8 ‘Risk factors in connection with survival and growth in foods’. 14.2.1 Differentiation of Y. enterocolitica from other Yersinia spp. A range of strains of Yersinia variants have been isolated from animals, water and food (Hurvell, 1981; Lee et al., 1981; Mollaret et al., 1979). Many

Yersinia enterocolitica 375 of these bacteria have characteristics that deviate considerably from the typical pattern shown by Y. enterocolitica, but can be classified as belonging to the genus Yersinia (Mollaret et al., 1979). Such Y. enterocolitica-like bacteria have been divided on a genetic basis into seven species (Aleksic et al., 1987; Bercovier et al., 1980a,b, 1984; Brenner, 1981; Brenner et al., 1980a, b, Ursing et al., 1980; Wauters et al., 1988b): Yersinia frederiksenii, Yersinia kristensenii, Yersinia intermedia, Yersinia aldovae, Yersinia rohdei, Yersinia mollaretii and Yersinia bercovieri.

14.3

Phenotypic characterisation

14.3.1 Biotyping The bacteria that are currently classified as Y. enterocolitica do not constitute a homogeneous group. Within the species there is a wide spectrum of biochemical variants. Such variations form the basis for dividing Y. enterocolitica into biovars. Wauters (1991) described a biotyping scheme that differentiates between pathogenic (biovars 1B, 2, 3, 4, 5) and nonpathogenic (only biovar 1A) variants.

14.3.2 Serotyping by using O-antigens Y. enterocolitica can be divided into serovars using O-antigens. So far, 76 different O-factors have been described in both Y. enterocolitica and Y. enterocolitica-like bacteria (Wauters, 1991). A few strains, however, cannot be typed by this system, and the number of described antigen factors is, therefore, likely to increase in the future.

14.3.3 Correlation between biovars, serovars, ecology and pathogenicity Although some antigenic factors are linked to pathogenic strains, for example O:3, O:9, O:8 etc., serotyping alone cannot be used to indicate pathogenicity because these antigenic factors also occur in non-pathogenic species or biovars. For instance, factor O:3 is common in Y. frederiksenii, and may also be encountered in other species and in biovar 1A of Y. enterocolitica. Factor O:8 occurs in biovar 1A and in Y. bercovieri, and factor O:9 in Y. frederiksenii. Hence, antigenic typing of the strains should always be done after appropriate biochemical characterisation. The relationships between the biovars, the Oantigens and the ecology of Y. enterocolitica and related species are presented in the list below (Wauters, 1991). In addition, geographic distributions are presented in Table 14.1. Biovar 1A includes a large number of serovars which are found in the environment, in food and occasionally in the digestive tract of animals and

376

Emerging foodborne pathogens

Table 14.1

Correlation between biovars, serovars, sources and geographic distribution

Serovar

Biovar

Main source(s)

Geographic distribution

O:3 O:3 O:5,27 O:8 O:9 O:13a and O:13b O:21

4 3 2 1B 2 1B 1B

Pig Pig Several Several Pig Several Several

Originally, Europe – now global Japan, East Asia Mainly North America Mainly North America Originally, Europe – also found global Mainly North America Mainly North America

humans. They do not possess virulence properties and are of little or no clinical significance for man. Biovars 1B, 2, 3, 4 and 5 are potential pathogens for man or animals. They exhibit pathogenic properties and, when freshly isolated, usually harbour the virulence plasmid. Strains of biovar 1B belong to a small number of pathogenic serovars, the most frequent being O:8, O:21, O:13a and O:13b, whereas O:4, O:18 and O:20 occur less frequently. They have been isolated mainly in the United States and were therefore called ‘American strains’. Since the beginning of the 1990s, a few strains have been isolated outside North-America; in Europe, Japan, India and Chile (Wauters, 1991). Biovar 2 includes only two serovars, O:9 and O:5,27, which are pathogens for man. O:9 is important in Belgium, Holland and France, while O:5,27 is quite common in the United States (Mollaret et al., 1979; World Health Organization, 1983). Biovar 3 includes serovar O:1,2,3 that has been isolated mainly from chinchilla and rodents and rarely from man (Hurvell, 1981; Mollaret et al., 1979). There are also a few serovars O:5,27 in this biovar (Wauters, 1991). In the beginning of the 1990s, a Voges-Proskauer negative variant of biovar 3, belonging to serovar O:3 was isolated in Japan and East Asia and has become a prominent pathogen for man in these countries (Wauters, 1991). Biovar 4 contains only one serovar, O:3, which is the main pathogenic serovar for man, distributed worldwide. It is also isolated regularly from healthy pigs (Hurvell, 1981; Schiemann, 1989). Biovar 5 is of no importance for humans. It includes serovar O:2,3 that is found in hares and some other animals (Hurvell, 1981; Krogstad, 1974; Lanada, 1990; Mollaret et al., 1979; Slee and Button, 1990; Wauters, 1991).

14.4

Methods of detection

14.4.1 Principles of detection The analytical methods available today for the isolation of pathogenic Y. enterocolitica suffer from limitations such as insufficient selectivity, and, in particular inadequate differentiation between pathogenic and non-pathogenic strains.

Yersinia enterocolitica 377 14.4.2 Specific principles for isolation A three-step method based on a combination of cold enrichment in a nonselective medium with subsequent inoculation onto a highly selective medium, has been developed for the Nordic Committee on Food Analysis (1987). Wauters et al. (1988a) developed a method for isolation of serovar O:3 from meat and meat products. The procedure is based on a two to three-day selective enrichment period in irgasan-ticarcillin-potassium chlorate (ITC) enrichment broth at room temperature, and is therefore very timesaving compared with the method described above. Both Y. enterocolitica and Y. pseudotuberculosis seem to be more tolerant of alkaline conditions than most other Enterobacteriaceae, and treatment of food enrichments with potassium hydroxide (KOH) may be used to selectively reduce the level of background flora (Aulisio et al., 1980). Elements of the methods from the Nordic Committee on Food Analysis (1987), Wauters et al. (1988a), Schiemann (1982), and KOH treatment (Schiemann, 1983) are incorporated into the International Organization for Standardization (ISO) method (ISO 10273) (Figs. 14.1 and 14.2) (International Organization for Standardization, 1994).

14.4.3 Detection by DNA colony hybridization Genetic probes can also be used in DNA colony hybridisation to demonstrate virulent Y. enterocolitica strains (Kapperud et al., 1990a; Tenover, 1988; Wachsmuth, 1985). Isolation plus hybridisation increased the detection rate

Test portion (x g) Dilution 1:100

2 days, 25 ∞C

ITC

SSDC (CIN)

(Some researchers are also using CIN though it is not recommended by ISO)

Fig. 14.1 Method for recovery of Y. enterocolitica from foods according to the International Organization for Standardization (1994): first element. This element of the method is recommended for serovar O:3 in particular (ITC irgasan-ticarcillinpotassium chlorate enrichment; SSDC = Salmonella-Shigella + sodium deoxycholate, CaCl2 agar.

378

Emerging foodborne pathogens

Test portion (x g) Dilution 1 : 10

PSB

Five days (or three days with agitation), 22–25 ∞C 0.5 ml PSB + 4.5 ml KOH for 20 s CIN

CIN

Fig. 14.2 Method for recovery of Y. enterocolitica from foods according to the International Organization for Standardization (1994): second element. This element of the method is recommended for all pathogenic serovars (PSB = phosphate-buffered saline, sorbitol, and bile salts; KOH = KOH and NaCl; CIN (cefsulodin-irgasannovobiocin agar).

from 16% to 38% for the method according to Wauters et al., (1988b) and from 10% to 48% for the Nordic method. The results of this investigation (Nesbakken et al., 1991a) support the supposition that conventional culture methods lead to underestimation of virulent Y. enterocolitica in pork products.

14.4.4 Detection by polymerase chain reaction (PCR) These methods often use primers targeting the virF (Thisted-Lambertz et al., 1996; Weynants et al., 1996a) or the yadA (Kapperud et al., 1993) genes, but also the IcrE (Viitanen et al., 1991) and the yopT genes (Arnold et al., 2001) from the virulence plasmid have been used. Y. enterocolitica may lose the virulence plasmid during culture, subculture or storage (Blais and Philippe, 1995). Accordingly, PCR methods based on chromosomal virulence genes, often the ail gene, have been developed. Often a combination of genes from the virulence plasmid and the chromosome are used. A common gene combination in such a multiplex PCR assay is the virF and ail genes (Kaneko et al., 1995; Nilsson et al., 1998). Rasmussen et al. (1995) detected Y. enterocolitica O:3 in faecal samples and tonsil swabs from pigs using immunomagnetic separation (IMS) and PCR based on the inv gene. O:3 cells were detected after pre-enrichment, but direct detection needed further optimisation of the sample preparation procedures. By combining inv, virF and ail genes in a multiplex-PCR assay, Weynants et al. (1996a) could differentiate between Y. pseudotuberculosis, virulent Y. enterocolitica, and Y. enterocolitica O:3.

Yersinia enterocolitica 379

14.5

Epidemiology

Our understanding of the epidemiology of yersiniosis is still incomplete. Worldwide surveillance data show that great changes have occurred over the last two decades. The importance of Y. enterocolitica as the cause of a number of clinical syndromes is unclear in many areas of the world. Standardised disease surveillance is needed within and across national boundaries so that data from each location are comparable. Improved screening of stools and other specimens for Y. enterocolitica is necessary to further elucidate the epidemiology of the disease. 14.5.1 Clinical symptoms of Y. enterocolitica infection Yersinia enterocolitica is an important cause of gastroenteritis in humans, particularly in temperate countries (Mollaret et al., 1979; World Health Organization, 1983). The consequences of yersiniosis may be severe, and include prolonged acute infections, pseudoappendicitis, and long-term sequelae such as reactive arthritis and erythema nodosum, particularly in northern Europe where the prevalence of the HLA-B27 histocompatibility type is high (Ahvonen, 1972; Cover and Aber, 1989; Winblad, 1975). These consequences make Y. enterocolitica infection a public health and economic problem of greater magnitude than the actual number of recorded cases would suggest (Ostroff et al., 1994). The incubation period is uncertain, but has been estimated as being between two and 11 days (Szita et al., 1973). Gastroenteritis is by far the most common symptom of Y. enterocolitica infection (yersiniosis) in humans (Cover and Aber, 1989; Mollaret et al., 1979). The clinical picture is usually one of a self-limiting diarrhoea associated with mild fever and abdominal pain (Wormser and Keusch, 1981). Nausea and vomiting occur, but less frequently. The portion of the gastrointestinal tract usually involved is the ileocaecal region (Sandler et al., 1982). The colon may also be affected and the infection may simulate Crohn’s disease, which has a different prognosis (Vantrappen et al., 1977). The illness typically lasts from a few days to three weeks, although some patients develop chronic enterocolitis, that may persist for several months (Saebø and Lassen, 1992). Occasionally the infection is limited to the right fossa iliaca in the form of terminal ileitis or mesenteriel lymphadenitis, with symptoms that can be confused with those of acute appendicitis. In several studies of patients with the appendicitis-like syndrome, Y. enterocolitica has been found in up to 9% of patients (Attwood et al., 1987; Niléhn and Sjöström, 1967; Pai et al., 1982; Samadi et al., 1982). Infections with serovars O:3 or O:9 are, in some patients, followed by reactive arthritis (Aho et al., 1981) which is most common in patients possessing the tissue type HLA-B27. Often, although not always, the patient has shown prior gastrointestinal symptoms. Other complications seen with Y. enterocolitica infection are reactive skin complaints, erythema nodosum being the most common. Many such patients have no

380

Emerging foodborne pathogens

history of prior gastrointestinal involvement. Septicaemia due to Y. enterocolitica is seen almost exclusively in individuals with underlying disease (Bottone, 1977), while those with cirrhosis and disorders associated with excess iron are particularly predisposed to infection and increased mortality. Clinical symptoms are influenced by the age of the patient (Bottone, 1977; Wormser and Keusch, 1981). Gastroenteritis dominates in children and young people, while various forms of reactive arthritis are most common in young adults, and most patients with skin manifestations are adult females (Wormser and Keusch, 1981). In Scandinavia, there is a relatively high incidence of both reactive arthritis (10–30% of infections) (Winblad, 1975) and erythema nodosum (30% of infections) (Ahvonen, 1972), caused by serovars O:3 and O:9. These forms of the disease have been almost totally absent in the USA, where O:8, historically, has been the most common cause of yersiniosis. This situation may change, however, as serovar O:3 is on the increase in the USA (Bissett et al., 1990). Transient carriage and excretion of both pathogenic and non-pathogenic Y. enterocolitica may occur following exposure to the bacteria. High rates of asymptomatic carriage have been reported in connection with outbreaks (Tacket et al., 1985), although in surveys unrelated to outbreaks, Y. enterocolitica has been detected in the stools of less than 1% of individuals (Niléhn and Sjöström, 1967). In patients with Y. enterocolitica enteritis, the organism may be excreted in the stools for lengthy periods after symptoms have resolved. In a study of Norwegian patients, convalescent carriage of Y. enterocolitica O:3 was detected in the stools of 47% of 57 patients for a median period of 40 days (range 17–116 days) (Ostroff et al., 1992).

14.5.2 Sporadic cases Y. enterocolitica has been isolated from humans in many countries, but it seems to be found most frequently in cooler climates (North America, the western coast of South America, Europe, northern-, central- and eastern Asia, Australia, New Zealand and South Africa) (Mollaret et al., 1979; Tauxe, 2002; World Health Organization, 1983). The widespread nature of Y. enterocolitica has been well documented; by the mid-1970s, Mollaret et al. (1979) had compiled reports of isolates from 35 countries on six continents. Y. enterocolitica infections are an important cause of gastroenteritis in the developed world, occurring particularly as sporadic cases in northern Europe (Cover and Aber, 1989), where a clustering of cases during autumn and winter has been reported (World Health Organization, 1983). There are appreciable geographic differences in the distribution of the different phenotypes of Y. enterocolitica isolated from man (Mollaret et al., 1979; Wauters, 1991). There is also a strong correlation between the serovars isolated from humans and pigs in the same geographical area (Schiemann, 1989; Tauxe, 2002; Wauters, 1991). Serovar O:3 is widespread in Europe, Japan, Canada, Africa and Latin America. Sometimes, but not always, phage typing makes it possible to distinguish between European, Canadian and

Yersinia enterocolitica 381 Japanese strains (Kapperud et al., 1990b; Mollaret et al., 1979). Serovar O:3 seem to be responsible for more than 90% of the cases in Denmark, Norway, Sweden and New Zealand, and as many as 78.8% of the cases in Belgium (Table 14.2). In general, the data in Table 14.2 originating from different surveillance programs, national statistics and even estimates are not directly comparable. Serovar O:9/ biovar 2 is the second most common in Europe, but its distribution is uneven; while it still accounts for a relatively high percentage of the strains isolated in France, Belgium and the Netherlands, only a few strains have been isolated in Scandinavia (World Health Organization, 1983). However, recent data shows that serovar O:9 is on the decrease in Belgium. In 1979–1981 this serovar was implicated in 23.3% of the cases, while in 1994 it was responsible for only 5.9% of the cases (Ministere Table 14.2 Verified and estimated cases of yersiniosis in some countries. Adapted from Nesbakken T (2005), ‘Yersinia enterocolitica’, in Fratamico P M, Bhunia A K and Smith J L, Foodborne pathogens: Microbiology and Molecular Biology, Norwich, UK, Caister Academic Press, 228–249. With kind permission of Horizon Scientific Press/Caister Academic Press. Country

Total number of cases (year)

Cases per 100,000 inh.

Verified cases Belgium

8291 (1994)

8.5

Denmark

2452 (2003)

4.5

Finland

647 (2003)

12.4

Germany Norway

7113 (2001) 862 (2003)

8.7 1.9

Sweden

7142 (2003)

8.0

Switzerland

51 (1998)

0.7

The European Union

73853 (2000)

Estimated cases New Zealand 3,0002 (1994) United States 87,000 (1997) 1 2 3

84 33.4

Serovar O:3: 78.8%; serovar O:9: 5.9% Serovar O:3: >90% Figures from nine countries in the European Union

References

Ministere des Affaires Sociales, de la Sante Publique et de l’Environnement. Institut d’Hygiene et d’Epidemiologie (1995) Danish Zoonosis Centre, Copenhagen (www.dfvf.dk) National Public Health Institute, Helsinki, Finland (www.ktl.fi) RKI, 2002 National Institute of Public Health, Oslo (www.fhi.no) Swedish Institute for Infectious Disease Control (www.smittskyddsinstitutet.se Swiss National Reference Laboratory for Foodborne Diseases, Berne www.btr.bund.de/ internet/7threport/CRs/swi.pdf European Commission, Health & Consumer Protection DirectorateGeneral www.euro.who.int/nen/ resources/eusanco/20030723 1 Wright et al., 1995 Mead et al., 1999

382

Emerging foodborne pathogens

des Affaires Sociales, de la Sante Publique et de l’Environnement. Institut d’Hygiene et d’Epidemiologie, 1995). A similar reduction has also been seen in France and The Netherlands (L. de Zutter, personal communication, 1996). Worldwide, infection with Y. enterocolitica in humans seems to reflect the serovars in pigs (Nesbakken, 1992). Maybe Y. enterocolitica O:3 has become the dominating serovar in pig herds at the expense of serovar O:9 in this region? Until recently, the most frequently reported serovars in the United States were O:8 followed by O:5,27 (Bisset et al., 1990; Mollaret et al., 1979; World Health Organization, 1995). In recent years, serovar O:3 has been on the increase in the United States; O:3 now accounts for the majority of sporadic Y. enterocolitica isolates in California (Bisset et al., 1990). In 1989, the estimated cost of yersiniosis in the United States was 138 millions of dollars (World Health Organization, 1995). Principal foodborne infections, as estimated for 1997, are ranked by estimated number of cases caused by foodborne transmission each year in the United States. Y. enterocolitica is number ten in the list (among the bacteria in the list, Y. enterocolitica is number seven) (Mead et al., 1999). The appearance of strains of serovars O:3 and O:9 in Europe, Japan in the 1970s, and in North America by the end of the 1980s, is an example of a global pandemic (Tauxe, 2002). The first Japanese case of Y. enterocolitica O:8 infection was linked to consumption of imported raw pork (Ichinohe et al., 1991). The incidence of Y. enterocolitica infection in patients with acute enterocolitis ranges from 0 to 4%, depending on the geographic location, study method, and population: in Australia, Canada, Denmark, Germany, New Zealand, Norway and Sweden (Aleksic and Bockemühl, 1990; Swedish Institute for Infectious Disease Control; Wright et al., 1995; Danish Zoonosis Centre, Copenhagen; National Institute of Public Health, Oslo), Y. enterocolitica has surpassed Shigella, and now rivals Salmonella and Campylobacter as a cause of acute bacterial gastroenteritis. Worldwide surveillance data show great changes over the last two decades. There appears to have been a real and generalised increase in incidence (World Health Organization, 1983, 1995), even though there is still much under-reporting. Nevertheless, improvements in detection and reporting systems may have contributed a great deal to the observed increase.

14.5.3 Outbreaks In the United States, chocolate milk (Black et al., 1978), pasteurised milk (Tacket et al., 1984), soybean curd (tofu) (Tacket et al., 1985), and bean sprouts (Aber et al., 1982) have been implicated as sources in outbreaks of Y. enterocolitica infection. These outbreaks, all of which occurred before 1983, were caused by Y. enterocolitica serovars which have been infrequently associated with human disease (serovars O:13, O:18) or which no longer predominate in the United States (serovar O:8). The milk-borne outbreak in Sweden in 1988 (Alsterlund et al., 1995) was probably caused by

Yersinia enterocolitica 383 recontamination of pasteurised milk because of lack of chlorination of the water supply. In the multistate outbreak in 1982 (Tacket et al. 1984), milk cartons were contaminated with mud from a pig farm (Aulisio et al., 1982). In the case of the outbreak described by Greenwood and Hooper (1990), post-pasteurisation contamination may have occurred from bottles. Previous studies have shown that milk-associated Y. enterocolitica outbreaks have been linked to the addition of ingredients after pasteurisation (Black et al., 1978; Morse et al., 1984). The preparation of raw pork intestines (chitterlings) was associated with an outbreak of Y. enterocolitica O:3 infections among black American infants in Georgia (Lee et al., 1990); the organism was isolated from samples of the pork intestines. Also, in outbreaks in Buffalo, New York, 1994–1996, (Kondracki et al., 1996) chitterlings were the vehicle. In 1981, an outbreak of infection due to Y. enterocolitica O:8 in Washington State occurred in association with the consumption of tofu packed in untreated spring water (Tacket et al., 1985). The outbreak serovar was isolated from the spring water samples. Another outbreak caused by serovar O:8 was traced to ingestion of contaminated water used in manufacturing or preparation of food (Schiemann, 1989). Two other Yersinia outbreaks have been associated with well water. One occurred among members of a Pennsylvania girl scout troop after they ate bean sprouts grown in contaminated well water (Aber et al., 1982); the other was a familial outbreak of yersiniosis in Canada (Thompson and Gravel, 1986). Y. enterocolitica O:3 was isolated from members of a family as well as from the well used as a source of their drinking water. The epidemiology of yersiniosis in the United States seems to have evolved into a pattern similar to the picture in Europe (Bisset et al., 1990; Tauxe, 2002), where foodborne Yersinia outbreaks are rare, and where serovar 3 predominates (Mollaret et al., 1979). Although yersiniosis appears to be more common in Europe than in the United States, only a few foodborne outbreaks have been reported in Europe (Greenwood and Hooper, 1990; Olsovsky et al., 1975; Toivanen et al., 1973; Swedish Institute for Infectious Disease Control). The number of cases in the USA presented in Table 14.2 is only an estimate and should not be directly compared to reported cases in countries in Europe.

14.5.4

Reservoirs for Yersinia

The pig Healthy pigs are often carriers of strains of Y. enterocolitica that are pathogenic to humans, in particular strains of serovar O:3/biovar 4 and serovar O:9/ biovar 2) (Hurvell, 1981; Schiemann, 1989). The organisms are present in the oral cavity, especially the tongue and tonsils, submaxillar lymph nodes, in the intestine and faeces (Nesbakken et al., 2003a,b) (Fig. 14.3). Shiozawa et al. (1991) reported that O:3 strains were isolated from 85% of oral swabs

384

Emerging foodborne pathogens

from 40 freshly slaughtered, healthy pigs and presented evidence that the organism colonized the pigs’ tonsils. In this study 24.3% of 140 pigs were carriers of the organism in the caecum, with counts ranging from fewer than 300 to 110,000 Y. enterocolitica/g of caecal contents. Strains of O:3 have been found frequently on the surface of freshly slaughtered pig carcasses (in frequencies up to 63.3%) (Nesbakken, 1988). This is probably the result of spread of the organism via faeces and intestinal contents during slaughter and dressing operations (Fig. 14.3). The association between yersiniosis in humans and the consumption of raw pork in Belgium (Tauxe et al., 1987) and the apparently rare incidence of the infection in Moslem countries (Samadi et al., 1982), where consumption of pork is restricted, point to pork as a source of infection with Y. enterocolitica. Other pathogenic strains do not appear to be as closely associated with pigs, and may have a different ecology. In western Canada, O:8 and O:5,27 strains have been found most commonly in humans, but only O:5,27 strains were found in the throats of slaughter-age pigs (Schiemann, 1989). In the USA, O:5,27 strains were isolated from the caecal contents and faeces of two out of 50 pigs at slaughter (Kotula and Sharar, 1993). Serovar O:8/ biovar 1B, until recently considered to be the most common human pathogenic strain of Y. enterocolitica in the USA (Tauxe, 2002) and in western Canada (Toma and Lafleur, 1981), has seldom been reported in pigs. Healthy pigs have been found to be infected with Y. enterocolitica O:3 in frequencies up to 85% (Hurvell, 1981; Nesbakken, 1988; Schiemann, 1989; Shiozawa et al., 1991) and in numbers up to 1720/cm2 (Nesbakken, 1988).

24 19 14 9 4

. ln eck dia

reg

Me

m

vis

ney Kid

Pel

Ha

ces Fae

lon Co

m

m

ecu Ca

lleu

Ton sils Su lym b-ma ph xill, no de lym Mes ph ent. no de Sto ma ch

Ser olo gy

–1

Fig. 14.3 Antibodies against Y. enterocolitica O:3 in blood, and Y. enterocolitica O:3 in lymphoid tissues, intestinal contents and on pig carcasses (n = 24). Taken from: Nesbakken et al. (2003b), ‘Occurrence of Yersinia enterocolitica in slaughter pigs and consequences for meat inspection, slaughtering, and dressing procedures’, in Skurnik M, Bengoechea J A and Granfors K, The Genus Yersinia. Entering the Functional Genomic Area. Advances in Experimental Medicine and Biology vol. 529, New York, Kluwer Academic/Plenum Publishers, 303–308. With kind permission of Kluwer Academic Publishers.

Yersinia enterocolitica 385 Cattle Positive tests in serological control programs for brucellosis in cattle, have in some cases proved to be cross-reactions against Y. enterocolitica serovar O:9 (Danish Zoonosis Centre, Copenhagen; Wauters, 1981; Weynants et al., 1996b). The existence of cross-reactions between Y. enterocolitica O:9 and Brucella is described in section 14.7.1 ‘Pathogenesis and immunity’. With a few exceptions (Danish Zoonosis Centre, Copenhagen; Wauters, 1981; Weynants et al., 1996b), cattle are generally not considered to be carriers of human pathogenic Y. enterocolitica. Sheep and goats In Norway, Krogstad (1974) demonstrated outbreaks of Y. enterocolitica infection in goatherds in which serovar O:2/biovar 5 was implicated. He also described a case in which an animal attendant was infected by the same serovar. Biovar 5 has also been isolated from goats in New Zealand (Lanada, 1990). Enteritis in sheep and goats due to infection of Y. enterocolitica O:2,3, biovar 5 is also seen in Australia (Slee and Button, 1990). Serovar O:3 was isolated from the rectal contents in two (3.0%) of 66 lambs in New Zealand (Bullians, 1987). Sheep and goats are generally not considered to be carriers of human pathogenic Y. enterocolitica (Hurvell, 1981). Poultry Stengel (1985) isolated Y. enterocolitica serovars O:3 (n=3), O:9 (n=3), and non-virulent Y. enterocolitica (n=13) from 130 samples of poultry. This is probably the first time these virulent serovars have been isolated from poultry, and there was no obvious opportunity for cross-contamination from pigs or pork. Nevertheless, according to other investigations, poultry has not been proven to be carrier of pathogenic Y. enterocolitica (Nesbakken et al. 1991b). Deer Surveys in New Zealand have found deer to carry both O:5,27/biovar 2 and O:9/biovar 2 (S. Fenwick, personal communication, 1996).

14.5.5

Vehicles for transmission

Pork In contrast to the frequent occurrence of the bacterium in pigs and on freshly slaughtered carcasses, pathogenic Y. enterocolitica have only exceptionally been found from pork products at the retail sale stage (Nesbakken et al., 1991a; Schiemann, 1989; Wauters et al., 1988a), with the exception of fresh tongues. This phenomenon might be explained by the lack of proper selective methodology for the isolation of pathogenic strains. However, Wauters et al. (1988a) described a method which allowed Y. enterocolitica O:3 to be recovered from as many as 12 (24%) of 50 ground pork samples. Genetic probes can

386

Emerging foodborne pathogens

also be used in DNA colony hybridisation to demonstrate virulent Y. enterocolitica strains. The results of one such investigation support the supposition that traditional culture methods lead to underestimation of the presence of virulent Y. enterocolitica in pork products. A significantly higher detection rate (6%) was achieved when two isolation procedures were combined with colony hybridisation, than when the isolation procedures were employed alone (18%) (Nesbakken et al., 1991a). In this study, counts of virulent yersiniae in pork sausage meat varied from 50 to 2,500/g, and in pork cuts from 50 to 300/g. Ostroff et al. (1994) showed in a case-control study that persons with Y. enterocolitica infection reported having eaten significantly more pork or sausages than their matched controls. This phenomenon might be explained by recontamination of sausages after pasteurisation, bacterial multiplication during storage, and insufficient heat treatment in the kitchen. Beef The possibility exists of cross-contamination to beef from pig carcasses and pork in abattoir, cutting plants, meat processing establishments, and butchers’ shops. Beef is sometimes consumed after little or no heat treatment, and some concern has therefore been expressed about Y. enterocolitica contamination in beef. According to the case-control study of Ostroff et al. (1994), persons with yersiniosis were also more likely than controls to report a preference for eating meat prepared raw or rare. Milk and dairy products Worldwide studies indicate that non-pathogenic Y. enterocolitica is fairly common in raw milk (Lee et al., 1981). Non-pathogenic variants of Y. enterocolitica have also been isolated from ice cream (Mollaret et al., 1972) and pasteurised milk (Sarrouy, 1972; Zen-Yoji et al., 1973) as early as 1970. However, it is almost solely in connection with outbreaks caused by contaminated pasteurised milk (Alsterlund et al., 1995; Greenwood and Hooper, 1990; Tacket et al., 1984), reconstituted powdered milk (Morse et al., 1984), and contaminated chocolate milk (Black et al., 1978) that one has been able to find the pathogenic strains. In section 14.5.3, second paragraph, possible pathways of contamination of milk and milk products with Y. enterocolitica are discussed. Water Shallow wells in particular, and also rivers and lakes, are susceptible to contamination with by surface runoff from rain or snowmelt. Such runoff may become contaminated by faeces from wild or domestic animals, or by leakage from septic tanks or open latrines in the surrounding areas. Water is a significant reservoir of Y. enterocolitica (Brennhovd, 1991; Harvey et al., 1976; Kapperud and Jonsson, 1978; Langeland, 1983; Lassen, 1972; Saari and Jansen, 1979). However, most isolates of Y. enterocolitica and Y.

Yersinia enterocolitica 387 enterocolitica-like bacteria obtained from water are variants with no known pathogenic significance to man.

14.6

Risk factors connected to the agent

14.6.1 The virulence plasmid Human pathogenic strains of Y. enterocolitica possess a special plasmid, 40– 50 megadaltons in size (Portnoy and Martinez, 1985). The presence of this plasmid is an essential, though not sufficient, prerequisite for the bacterium to be able to induce disease. Properties associated with the chromosome are also necessary for virulence. Corresponding plasmids are found in Y. pseudotuberculosis and Y. pestis, and there is thus a family of related virulence plasmids within the genus Yersinia (Portnoy and Martinez, 1985). The way in which the plasmid contributes to virulence has not been fully elucidated. The presence of this virulence plasmid has been associated with several properties, most of which are phenotypically expressed only at elevated growth temperatures of 35–37 ∞C (Portnoy and Martinez, 1985). The list of such plasmid-mediated and temperature-regulated properties includes: Ca++dependent growth (Perry and Brubaker, 1983), production of V and W antigens (Perry and Brubaker, 1983), spontaneous autoagglutination (Laird and Cavanaugh, 1980), mannose-resistant haemagglutination (Kapperud et al., 1987), serum resistance (Pai and DeStephano, 1982), binding of Congo red dye (Prpic et al., 1985), hydrophobicity (Lachica et al., 1984), mouse virulence (Nesbakken et al., 1987; Pai and DeStephano, 1982), and production of a number of proteins (Portnoy and Martinez, 1985), of which one is a true outer membrane protein (YadA, previously termed Yop1) (Michiels et al., 1990). This true outer membrane protein forms a fibrillar matrix on the bacterial surface and mediates cellular attachment and entry (Bliska and Falkow, 1994). It also confers resistance to the bactericidal effect of normal human serum and inhibition of the anti-invasive effect of interferon. The mechanism of virulence is known to vary even between different serovars within Yersinia enterocolitica. Plasmid-containing strains of O:8, O:13a, O:13b, and O:21 are lethal to orally infected mice, whereas O:3, O:9 and O:5,27 are not (Nesbakken et al., 1987; Pai and DeStephano, 1982). These latter serovars, however, are capable of maintaining intestinal colonisation for at least one week after orogastric challenge (Nesbakken et al., 1987). 14.6.2 The chromosome Elements encoded by the chromosome are also necessary for maximum virulence. The pathogenic yersiniae share at least two chromosomal loci, inv and ail, that play a role in their entry into eukaryotic cells (Miller et al., 1988). The inv and ail gene products can be classified as adhesins since they

388

Emerging foodborne pathogens

mediate adherence to the eukaryotic surface. Unlike other previously characterised bacterial adhesins, they also mediate entry into a variety of mammalian cells. A high pathogenicity island in pathogenic species of Yersinia encodes genes for three yersiniabactin (Ybt) transport proteins, six Ybt biosynthetic enzymes, one transcriptional regulator (YbtA), and one protein of unknown function (YbtX) (Perry et al., 2001). See also Chapter 1.

14.6.3 Enterotoxin production Many strains of Y. enterocolitica and related species produce a heat-stable enterotoxin (YEST) when the bacteria are cultured at 20–30 ∞C (Pai et al., 1978). Certain strains, especially within the species Y. kristensenii, are also able to produce YEST at 4 and 37 ∞C (Pai et al., 1978). This property is regulated by chromosomal genes and is independent of the virulence plasmid. Although there is no evidence to support the involvement of YEST in the pathogenesis of Y. enterocolitica enteritis, the possibility still remains that enterotoxigenic strains may produce foodborne intoxication by means of preformed enterotoxins. This assumption is based on the fact that YEST is able to resist gastric acidity as well as temperatures used in food processing and storage, without losing activity (Boyce et al., 1979). The ability to produce YEST at room and refrigeration temperature may give the ‘environmental’ yersiniae a new significance in food hygiene as potential agents of foodborne intoxication.

14.7

Risk factors in connection with the host

14.7.1 Pathogenesis and immunity Human infection due to Y. enterocolitica is most often acquired by the oral route. The minimal infectious dose required to cause disease is unknown. In one volunteer, ingestion of 3.5 ¥ 109 organisms was sufficient to produce illness (Szita et al., 1973). Enteric infection leads to proliferation of Y. enterocolitica in the lumen of the bowel and in the lymphoid tissue of the intestine. Adherence to and penetration into the epithelial cells of the intestinal mucosa are essential factors in the pathogenesis of Y. enterocolitica infection (Bliska and Falkow, 1994; Cornelis et al., 1987; Miller et al., 1988; Portnoy and Martinez, 1985). When the bacteria reach the lymphoid tissues in the terminal ileum, a massive multiplication of bacteria and inflammatory response takes place in the Peyer’s patches. Reactive arthritis and erythema nodosum appear to be delayed immunological sequelae of the original intestinal infection. In humans, infection with pathogenic strains of Y. enterocolitica stimulates development of specific antibodies. It is not known whether specific serum antibody protects against reinfection with Y. enterocolitica organisms of the same or different serovars. The immunological response can be measured by a variety of techniques, including tube agglutination, indirect

Yersinia enterocolitica 389 haemagglutination, enzyme-linked immunosorbent assay (ELISA), and solidphase radioimmunoassay (Attwood et al., 1987). An indirect immunofluorescent-antibody assay has also been used (Cafferkey and Buckley, 1987). However, ELISA is probably the most suitable and extensively applied method in the world today. Agglutinating antibodies appear soon after the onset of illness and persist for from two to six months. Some serovars may be associated with illness without eliciting a detectable serological response (Toma and Lafleur, 1981). The serological diagnosis of Y. enterocolitica infection may be complicated by the existence of cross-reactions between Y. enterocolitica, most notably serovar O:9, and such organisms as Y. pseudotuberculosis, Brucella, Vibrio, Salmonella, Proteus and Escherichia coli (Wauters, 1981). The interpretation may also be confounded by high prevalence of seropositive individuals in the healthy population. Of 813 Norwegian military recruits selected at random, 67 (8.2%) had antibodies against Y. enterocolitica O:3 (Nesbakken et al., 1991b). Patients with thyroiditis of an immunological aetiology have an unexplained increased frequency of cross-reacting antibodies to Y. enterocolitica (Shenkman and Bottone, 1976). Detection of antibodies to plasmid-encoded proteins, Yersinia outer membrane proteins (Yops), by immunoblots, has been suggested as a highly specific means of demonstrating previous Y. enterocolitica infection (Ståhlberg et al., 1989). Demonstration of specific circulating IgA to the Yops is indicative of recent or persistent infection and is strongly correlated with the presence of virulent Y. enterocolitica in the intestinal lymphatic tissue of patients with reactive arthritis.

14.8 Risk factors in connection with survival and growth in foods Y. enterocolitica is a facultative organism able to multiply in both aerobic and anaerobic conditions (Bercovier and Mollaret, 1984).

14.8.1 Temperature The ability of Y. enterocolitica to multiply at low temperatures is of considerable concern to food producers. The reported growth range is –2 to 42 ∞C (Bercovier and Mollaret, 1984). Optimum temperature is 28–29 ∞C (Bercovier and Mollaret, 1984). Y. enterocolitica can multiply in foods such as meat and milk at temperatures approaching and even below 0 ∞C (Lee et al., 1981; Stern et al., 1980). It is important to recognise the rate at which Y. enterocolitica can multiply, which is considerably greater than that for L. monocytogenes (Bhaduri et al., 1994). Results show that, in a food with a neutral pH stored at 5 ∞C, Y. enterocolitica counts may increase from, e.g., 10/ml to 2.8 ¥ 107/ ml in five days (Bhaduri et al., 1994).

390

Emerging foodborne pathogens

14.8.2 pH The minimum pH for growth has been reported as being between 4.2 and 4.4 (Kendall and Gilbert, 1980), while in a medium in which the pH had been adjusted with HCl, growth occurred at pH 4.18 and 22 ∞C (Brocklehurst and Lund, 1990). The presence of organic acids will reduce the ability of Y. enterocolitica to multiply at low pH, acetic acid being more inhibitory on a molar basis at a given pH than lactic and citric acids (Brocklehurst and Lund, 1990).

14.8.3 Growth and survival in food The ability to propagate at refrigeration temperature in vacuum-packed foods with a prolonged shelf-life (Bercovier and Mollaret, 1984) is of considerable significance in food hygiene Y. enterocolitica may survive in frozen foods for long periods (Schiemann, 1989). Y. enterocolitica is not able to grow at pH <4.2 or >9.0 (Kendall and Gilbert, 1980; Stern et al., 1980) or at salt concentrations higher than 7% (aw < 0.945) (Stern et al., 1980). The organism does not survive pasteurisation or normal cooking, boiling, baking, and frying temperatures. Heat treatment of raw milk operated at 60 to 72 ∞C for a minimum holding time of 16.2 s rapidly inactivated Yersinia enterocolitica when the bacterium was inoculated at a level of approximately 1.0 ¥ 105 cfu/ml (D’Aoust et al., 1988). Yersinia enterocolitica showed a 4-log reduction in counts at 60 ∞C and absence of viable cells at greater than or equal to 63 ∞C. Heat-treatment of meat products at 60 ∞C for 1–3 minutes effectively inactivates Y. enterocolitica (Lee et al., 1981) indicating that normal pasteurisation treatment or cooking to a core temperature of 70 ∞C would be sufficient for killing the organism. D-values determined in scalding water were 96, 27 and 11 seconds at 58, 60 and 62 ∞C, respectively (Sörqvist and Danielsson-Tham, 1990). The literature is contradictory regarding the multiplication of Y. enterocolitica in meat during conventional cold storage (Bredholt et al., 1999; Fukushima and Gomyoda, 1986; Kleinlein and Untermann, 1990; Lee et al., 1981; Lindberg and Borch, 1994; Schiemann, 1989; Stern et al., 1980). A comparison of published (Hanna et al., 1977) and predicted generation times (GT) (Sutherland and Bayliss, 1994) for Y. enterocolitica in raw pork at 7 ∞C, 0.5% NaCl (w/v) and pH 5.5–6.5 shows GTs of 8.4 – 12.4 hours (published) and 8.15–5.05 hours (predicted). However, according to many reports, the ability of Y. enterocolitica to compete with other psychotrophic organisms normally present in food may be poor (Fukushima and Gomyoda, 1986; Kleinlein and Untermann, 1990; Schiemann, 1989). In contrast, a number of studies have shown that Y. enterocolitica is able to multiply in foods kept under chill storage and might even compete successfully (Bredholt et al., 1999; Gill and Reichel, 1989; Grau, 1981; Lee et al., 1981; Lindberg and Borch, 1994; Stern et al., 1980).

Yersinia enterocolitica 391 Pig carcasses are often held in chilling rooms for two to four days after slaughter prior to cutting. Pre-packaged raw meat products may remain in retail chill cabinets for more than a week, depending on the product, packaging, package atmosphere, and rate of turnover. Pathogenic variants of Y. enterocolitica might propagate considerably during the course of this relatively long storage period.

14.8.4 Fermentation Use of fermentation and starter cultures could prevent growth of Y. enterocolitica. Examples are Leuconostoc spp. or Lactobacillus plantarum in fish (Jeppesen and Huss, 1993). Antagonistic effect of chosen lactic acid bacteria (LAB) strains on Y. enterocolitica species were demonstrated in model set-ups, meat and fermented sausages (Gomolka-Pawlicka and Uradzinski, 2003). The results show that all the LAB strains used within the framework of the model set-ups had antagonistic effect on all the Y. enterocolitica strains. However, this ability was not observed with respect to the tested LAB strains in meat and fermented sausage. This ability was possessed by one of the strains investigated, a L. helveticus strain. There are also examples of survival and growth of Y. enterocolitica in Feta cheese with Streptococcus cremoris (Erkmen, 1996). During fermentation by various lactobacilli, for instance L. bulgarcus and L. acidophilus in skim milk (Ozbas and Aytac, 1996) Y. enterocolitica survived. The study of Bredholt et al. (1999) indicates that 104 cfu/g of Y. enterocolitica is able to grow well at 8 ∞C in vacuum-packaged cooked ham and servelat sausage in the presence of 104–5 cfu/g LAB. These LAB cultures, for instance L. sakei, inhibited growth of Listeria monocytogenes and Escherichia coli O157:H7 in the same experiment. The effect of lactic acid (concentration range of 0.1 to 1.1% v/v within a pH range of 3.9 to 5.8 at 4 ∞C) on growth of Y. enterocolitica O:9 is greater under anaerobic than aerobic conditions, although the bacterium has proved to be more tolerant of low pH conditions under anaerobic atmosphere than under an aerobic atmosphere in the absence of lactic acid (El-Ziney et al., 1995).

14.8.5 Radiation of food Y. enterocolitica is among the most sensitive bacteria needing the lowest radiation doses for elimination (D10~0.20 kGy) (Molins et al., 2001). 14.8.6 Packaging As a facultative organism, the gaseous atmosphere drastically affects the growth of Y. enterocolitica. Under anaerobic conditions, Y. enterocolitica is unable to grow in beef at pH 5.4–5.8, whereas growth occurs at pH 6.0 (Grau, 1981). 100% CO2 is reported to inhibit the growth of Y. enterocolitica

392

Emerging foodborne pathogens

(Gill and Reichel, 1989). In the study of Gill and Reichel (1989), Y. enterocolitica was inoculated into high pH (>6.0) beef DFD (dark firm dry)meat. Samples were packaged under vacuum or in an oxygen-free CO2 atmosphere maintained at atmospheric pressure after the meat had been saturated with the gas and stored at –2, 0, 2, 5 or 10 ∞C. In vacuum packs, Y. enterocolitica grew at all storage temperatures at rates similar or faster than those of the spoilage flora. In CO2 packs, the bacterium grew at both 5 and 10 ∞C, but not at lower temperatures. Growth of Y. enterocolitica was nearly totally inhibited both at 4 and 10 ∞C in a 60% CO2/0.4% CO mixture, while the bacterial numbers in samples packed in high O2 mixture (70% O2/30% CO2) increased from about 5 ¥ 102 bacteria/g at day 0 to about 104 at day 5 at 4 ∞C and to 105 at 10 ∞C. Growth in chub packs (stuffed in plastic casings) was even higher (Nissen et al., 2000).

14.9

Risk factors based on epidemiological studies

Only a few epidemiological studies have been performed to investigate the sources of sporadic human infections. A 1985 study of Y. enterocolitica in Belgium identified consumption of raw pork as a risk factor for disease (Tauxe et al., 1987). The following variables were found to be independently related to an increased risk of yersiniosis in a case-control study conducted in Norway: drinking untreated water, general preference for meat to be prepared raw or rare, and frequency of consumption of pork and sausages (Ostroff et al., 1994). The infrequent occurrence of infections with Y. enterocolitica in some areas of the world may be due in part to avoidance of certain risk factors, such as lack of consumption of pork in Muslim countries (Samadi et al., 1982). A seroepidemiological study has indicated that occupational exposure to pigs may be a risk factor (Nesbakken et al., 1991b), however, confounders could not be excluded.

14.10 Prevention and control at different steps of the food chain Possibility for preventive action and reduction in the food chain is shown in Table 14.3. In addition to the specific prevention measures described in this section, World Health Organization (2000) provides a guide, Foodborne disease: A focus for health education, to the education of food handlers, consumers, food safety managers in public and private sectors as well as policy makers as an effective strategy for reducing the illness and economic losses caused by foodborne disease.

Yersinia enterocolitica 393 Table 14.3 The putative effects of preventive action on occurrence of Y. enterocolitica in the food chain (+++ = great effect, ++ = good effect, + = limited effect, – = probably no effect) Herd level

Slaughter

Meat inspection

Cutting and de-boning

Processing

Preparation and consumption

+++

++

–

–

+++*

+++*

* Reduction/elimination by heat treatment. However, the main problem at these stages is crosscontamination

14.10.1 At the farm level New-born piglets are easily colonised and become long-term healthy carriers of Y. enterocolitica in the oral cavity and intestines (Schiemann, 1989). In a recent study (Skjerve et al., 1998), an enzyme-linked immunosorbent assay (ELISA) was used to detect IgG antibodies against Y. enterocolitica O:3 in sera from 1,605 slaughter pigs from 321 different herds. Positive titres were found in 869 (54.1%) of the samples. In the final epidemiological study 182 (63.4%) of 287 herds were defined as positive. Among the positive herds, there were significantly fewer combined herds of piglets and fatteners than fattening herds. Among the risk factors were using an own-farm vehicle for transport of slaughter pigs to abattoirs, daily observations of a cat with kittens at the farm, and using straw bedding for slaughter pigs. In conclusion, the epidemiological data suggest that it is possible to reduce the herd prevalence of Y. enterocolitica O:3 by minimising contact between infected and noninfected herds. Further, attempts to reduce the prevalence at the top levels of the breeding pyramids may be beneficial for the industry as a whole. The meat industry may use serological tests as a tool to lower the prevalence in the pig population by limiting the contact between seropositive and seronegative herds.

14.10.2 Slaughter Because of the high prevalence of Y. enterocolitica in pig herds, strict slaughter hygiene will remain an important means to reduce carcass contamination with Y. enterocolitica as well as other pathogenic microorganisms (Skjerve et al., 1998). However, it is not possible to sort out pigs contaminated with Y. enterocolitica at post-mortem meat inspection. Pig slaughter is an open process with many opportunities for the contamination of the pork carcass with Y. enterocolitica, and it does not contain any point where hazards are completely eliminated (Borch et al., 1996). Contamination of the carcass with Y. enterocolitica during pig slaughter is most likely to arise from faecal and pharyngeal sources (Nesbakken et al., 2003a). HACCP (Hazard Analysis Critical Control Point) and GMP (Good Manufacturing Practice) in pig slaughter must be focused on limiting this spread. As a guide, attention should be given to the establishment of control measures and identification

394

Emerging foodborne pathogens

of critical control points considering different steps during slaughter and dressing including: lairage, killing, scalding, dehairing, singeing/flaming, scraping, circum-anal incision and removal of the intestines, excision of the tongue, pharynx, and in particular the tonsils, splitting, post-mortem meat inspection procedures, and deboning of the head (Borch et al., 1996). Some of the above-mentioned critical control points will be discussed in more detail below. During transport and lairage, pathogenic Y. enterocolitica may spread from infected to non-infected pigs. If possible, herds should be handled separately, and cleaning and disinfection of the lairage facilities should be performed between herds, since some herds are free from this pathogen (Skjerve et al., 1998). A working procedure that is employed in many abattoirs, and that can be introduced immediately in all abattoirs, is the two-knife method. This can be used to interrupt the path of infection from oral cavity and intestine to other parts of the carcass. The two-knife method involves the installation in the slaughter hall of knife decontaminators, with running water held at a temperature of approximately 82 ∞C. When an unclean working operation has been performed, for example in the region around the rectum or oral cavity, the knife is rinsed before being placed in the decontaminator. The operator should then wash his hands before the other knife is used for clean working operations. The two-knife method should be used both by operators and meat inspection personnel. The possibility of decapitation early on in the carcass dressing procedure has been considered, with the head, including tongue and tonsils, then being removed on a separate line for heat-treatment and cutting. The results presented by Nesbakken et al., (1994) indicate that it is important to modify procedures for removal of the guts, in order to avoid contamination of the carcass from the rectum. Technological solutions have already been found which allow removal of the rectum without soiling of the carcass. This can be done, inter alia, by insertion of a pre-frozen plug into the anus prior to rectum-loosening and gut removal. The sealing off of the rectum with a plastic bag immediately after it has been freed can significantly reduce the spread of Y. enterocolitica to pig carcasses (Nesbakken et al., 1994). According to data from the Norwegian National Institute of Public Health (2005), the occurrence of human yersiniosis has dropped after the introduction of the plastic bag technique in the main abattoirs slaughtering more than 90% of the pigs in Norway (Fig. 14.4).

14.10.3 Meat inspection Meat inspection procedures concerning the head also seem to represent a cross-contamination risk; incision of the sub-maxillary lymph nodes (Fig. 14.3) is a compulsory procedure according to the EU regulations (European Commission, 1995). In a screening of 97 animals, 5.2% of samples from the sub-maxillary lymph nodes were positive and by the sampling of 24 these lymph nodes in a follow-up study, 12.5% of the samples were positive

Yersinia enterocolitica 395 Number of human cases 300

200

1994: Introduction of the plastic bag

100

2

4

200

200

0 200

98

96

94

92

90

88

86

84

82

0

Fig. 14.4 Number of reported human cases of yersiniosis in Norway, 1982–2004. In the middle of 1994, the slaughterhouses in Norway implemented the procedure of sealing off the rectum with a plastic bag (Source: Norwegian National Institute of Public Health (2005), http://www.msis.no, 3/2/2005).

(Fig. 14.3) (Nesbakken et al., 2003a, b). This may, however, result in the bacterium being transported from the medial neck region to other parts of the carcass by the knives and hands of the meat inspection personnel (Nesbakken, 1988; Nesbakken et al., 2003a). In view of the fact that the incidence of tuberculosis in pigs and humans has been reduced to a very low level in many parts of the world, it may be possible to re-consider regulations that require incision of the sub-maxillary lymph nodes by meat inspectors. 14.10.4 Cutting and de-boning Cutting and removal of head-meat in pigs should be carried out on a separate worktable, preferably in a separate room (European Commission, 1995). This room should be considered to be an unclean area. Knives and equipment must not be used for cutting and deboning other parts of the carcass without prior cleaning and disinfection. Current EU regulations that require removal of pig head-meat to be carried out in a separate department are, unfortunately, not complied with in all abattoirs. 14.10.5 Processing of meat products In addition to the slaughter hall, and the cutting and de-boning departments, the sausage-making department must also be considered to be a contaminated area. It must be assumed that raw materials such as pig head-meat and pork cuts, and consequently also sausage meat, are likely to be contaminated with pathogenic Y. enterocolitica. Strict cleaning and disinfecting requirements must therefore also apply here. It is important to maintain an effective separation

396

Emerging foodborne pathogens

between sausage preparation and packing, so as to avoid recontamination after heat-treatment.

14.10.6 Refrigeration Y. enterocolitica is able to propagate at temperatures approaching 0 ∞C. While refrigeration of food does not prevent the multiplication of Y. enterocolitica, the rate at which this takes place will be reduced.

14.10.7 Cross-contamination Raw meats (in particular pork) should be separated from other foods. Crosscontamination from raw meat to heat-treated end products must be avoided in meat-processing establishments, butchers’ shops, meat departments in retail food stores, and in kitchens in institutions, restaurants and homes.

14.10.8 Adequate cooking of meat A case-control study carried out in Norway revealed that inadequate heattreatment of meat is a risk factor for human yersiniosis (Ostroff et al., 1994). Consumption of undercooked pork should be discouraged.

14.10.9 Personal hygiene Precautions aimed at preventing faecal-oral spread of the pathogens should be taken. Hand-washing and proper stool disposal must be employed in household, day-care, and hospital settings.

14.10.10 Cleaning and disinfection Knives, equipment, and machines used to cut or process raw meat products must be cleaned and disinfected before being used for handling other foods. All surfaces that have been in contact with raw meat must be cleaned and disinfected with appropriate and effective agents.

14.11

Future trends

The emergence of yersiniosis may be related to changes that have occurred in livestock farming, food technology and the food industry. Of greatest importance are probably changes in the meat industry, where meat production has shifted from small-scale slaughterhouses with limited distribution patterns, to large facilities that process thousands of pigs each day and distribute their products nationally and internationally. Farm sizes have increased and animal husbandry methods have also become more intensive. Intensive husbandry

Yersinia enterocolitica 397 in the porcine industries creates difficulties in maintaining adequate hygienic conditions in rearing pens, and in limiting cross-contamination between animals. While many modern slaughter techniques reduce the risk of meat contamination, opportunities for animal-to-animal transmission of the organism during transport and lairage, and for cross-contamination of carcasses and meat products, exist on a scale that was unthinkable decades ago. In addition, advances in packaging and refrigeration now allow industry and consumers to store foods for much longer periods, a significant factor with regard to a cold-adapted pathogen such as Y. enterocolitica. However, if a successful reduction of Y. enterocolitica could be accomplished on the top levels of the breeding pyramid, lowering of prevalence of Y. enterocolitica might be obtained in the general pig population. Analysing herds for antibodies might be an easy way to assess if a herd is infected or not. If negative herds only buy animals from certified, negative herds, a closed circle without carriers of Y. enterocolitica could be obtained.

14.12

Sources of further information and advice

Some relevant articles and books: Ostroff S M (1995), ‘Yersinia as an emerging infection: epidemiologic aspects of yersiniosis’, Contrib Microbiol Immunol, 13, 5–10. Mollaret H H (1995), ‘Fifteen centuries of yersiniosis’, Contrib Microbiol Immunol, 13, 1–4. Skurnik M, Bengoechea J A and Granfors K (2003) The Genus Yersinia. Entering the Functional Genomic Area. Advances in Experimental Medicine and Biology vol. 529, New York: Kluwer Academic/Plenum Publishers. Tauxe R V (2002), ‘Emerging foodborne pathogens’, Int J Food Microbiol, 78, 31–42.

14.13

References

ABER R C, MCCARTHY M A, BERMAN R, DEMELFI T

and WITTE E (1982), ‘An outbreak of Yersinia enterocolitica illness among members of a Brownie troop in Centre County, Pennsylvania’ in, Program and Abstracts of the 22nd Interscience Conference on Antimicrobial Agents and Chemotherapy, Miami Beach, American Society for Microbiology, Washington, DC. ACHTMAN M, ZURTH K, MORELLI G, TORREA G, GUIYOULE A and CARNIEL E (1999), ‘Yersinia pestis, the cause of plague, is a recently emerged clone of Yersinia pseudotuberculosis’, Proc Natl Acad Sci USA, 96, 14043–8. AHO K, AHVONEN P, LAITINEN O and LEIRISALO M (1981), ‘Arthritis associated with Yersinia enterocolitica, infection’, in Bottone E J, Yersinia enterocolitica, Boca Raton, Fla, CRC Press, Inc, 113–24. AHVONEN P (1972), ‘Human yersiniosis in Finland. II. Clinical features’, Ann Clin Res, 4, 39–48.

398

Emerging foodborne pathogens

and BOCKEMÜHL J (1990), ‘Mikrobiologie und Epidemiologie der Yersiniosen’, Immun Infekt, 18, 178–85. ALEKSIC S, STEIGERWALT A G, BOCKEMÜHL J, HUNTLEY-CARTER G P and BRENNER D J (1987), ‘Yersinia rohdei sp. nov. isolated from human and dog feces and surface water’, Int J Syst Bact, 37, 327–32. ALSTERLUND R, DANIELSSON-THAM M-L, EDÉN T, DE JONG B, LYXELL G, NILSSON P O and RANSJÖ U (1995), ‘Yersinia enterocolitica-utbrott på Bjärehalvön. Risker med kylda matvaror’, Svensk Vet Tidsskr, 47, 257–60. ARNOLD T, HENSEL A, HAGEN R, ALEKSIC S, NEUBAUER H, and SCHOLZ H C (2001), ‘A highly specific one-step PCR-assay for the rapid discrimination of enteropathogenic Yersinia enterocolitica from pathogenic Yersinia pseudotuberculosis and Yersinia pestis’, Syst Appl Microbiol, 24, 285–89. ATTWOOD S E A, MEALY K, FFERKEY M T, BUCKLEY T F, WEST A B, BOYLE N, HEALY E and KEANE F B CAV (1987), ‘Yersinia infection and acute abdominal pain’, Lancet, I, 529–33. AULISIO C C G, MEHLMAN I J, and SANDERS A C (1980), ‘Alkali method for rapid recovery of Yersinia enterocolitica and Yersinia enterocolitica from foods’, Appl Environ Microbiol, 39, 135–40. AULISIO C C G, LANIER J M and CHAPPEL M A (1982), ‘Yersinia enterocolitica and O:13 associated with outbreaks in three southern states’, J Food Protect 45, 1263. BERCOVIER H and MOLLARET H H (1984), ‘Genus XIV. Yersinia’, in Krieg N R, Bergey’s manual of systematic bacteriology, vol. 1, Baltimore, Md, Williams & Wilkins, 498– 506. BERCOVIER H, BRENNER D J, URSING J, STEIGERWALT A G, FANNING G R, ALONSO J M, CARTER G P and MOLLARET H H (1980a), ‘Characterization of Yersinia enterocolitica sensu stricto’, Curr Microbiol, 4, 201–6. BERCOVIER H, URSING J, BRENNER D J, STEIGERWALT A G, FANNING G R, ALONSO J M, CARTER G P and MOLLARET H H (1980b), ‘Yersinia kristensenii: a new species of Enterobacteriaceae composed of sucrose negative strains (formerly called atypical Yersinia enterocolitica or Yersinia enterocolitica-like)’, Curr Microbiol, 4, 219–24. BERCOVIER H, STEIGERWALT A G, GUIYOULE A, CARTER G P and BRENNER D (1984), ‘Yersinia aldovae (formerly Yersinia enterocolitica-like group X2): a new species of Enterobacteriaceae isolated from aquatic ecosystems’, Int J Syst Bacteriol, 34, 166– 72. BHADURI S, TURNER-JONES C O, BUCHANAN R L and PHILLIPS J G (1994), ‘Response surface model of the effect of pH, sodium chloride and sodium nitrite on growth of Yersinia enterocolitica at low temperatures’, Int J Food Microbiol, 23, 333–43. BISSETT M L, POWERS C, ABBOTT S L and JANDA J M (1990), ‘Epidemiologic investigations of Yersinia enterocolitica and related species: sources, frequency, and serogroup distribution’, J Clin Microbiol, 28, 910–12. BLACK R E, JACKSON R J, TSAI T, MEDVESKY M, SHAYEGANI M, FEELEY J C, MACLEOD K I E and WAKELEE A M (1978), ‘Epidemic Yersinia enterocolitica infection due to contaminated chocolate milk’, New Engl J Med, 298, 76–9. BLAIS B W and PHILIPPE L M (1995), ‘Comparative analysis of yadA and ail polymerase chain reaction methods for virulent Yersinia enterocolitica’, Food Control, 6, 211–14. BLISKA J B and FALKOW S (1994), ‘Interplay between determinants of cellular entry and cellular disruption in the enteropathogenic Yersinia’, Curr Opin Infect Dis, 7, 323–8. BORCH E, NESBAKKEN T, CHRISTENSEN H (1996), ‘Hazard identification in swine slaughter with respect to foodborne bacteria’, Int J Food Microbiol, 30, 9–25. BOTTONE E J (1977), ‘Yersinia enterocolitica: a panoramic view of a charismatic microorganism’, Crit Rev Microbiol, 5, 211–41. BOYCE J M, EVANS D J, EVANS D G and DUPONT H L (1979), ‘Production of heat-stable, methanol-soluble enterotoxin by Yersinia enterocolitica’, Infect Immun, 25, 532–7. BREDHOLT S, NESBAKKEN T and HOLCK A (1999), ‘Protective cultures inhibit growth of Listeria monocytogenes and Escherichia coli O157:H7 in cooked, sliced vacuum- and gas-packaged meat’, Int J Food Microbiol, 53, 43–52. ALEKSIC S

Yersinia enterocolitica 399 (1981), ‘Classification of Yersinia enterocolitica’, in Bottone E J, Yersinia enterocolitica, Boca Raton, Fla, CRC Press, Inc, 1–8. BRENNER D J, BERCOVIER H, URSING J, ALONSO J M, STEIGERWALT A G, FANNING G R, CARTER G P, and MOLLARET H H (1980a), ‘Yersinia intermedia: a new species of Enterobacteriaceae composed of rhamnose-positive, melibiose-positive, raffinose-positive strains (formerly called Yersinia enterocolitica or Yersinia enterocolitica-like)’, Curr Microbiol, 4, 207– 12. BRENNER D J, URSING J, BERCOVIER H, STEIGERWALT A G, FANNING G R, ALONSO J M and MOLLARET H H (1980b), ‘Deoxyribonucleic acid relatedness in Yersinia enterocolitica and Yersinia enterocolitica-like organisms’, Curr Microbiol, 4, 195–200. BRENNHOVD O (1991), ‘Termotolerante Campylobacter spp. og Yersinia spp. i noen norske vannforekomster’, thesis, Norwegian College of Veterinary Medicine, Oslo. BROCKLEHURST T F and LUND B M (1990), ‘The influence of pH, temperature and organic acids on the initiation of growth of Yersinia enterocolitica´, J Appl Bacteriol, 69, 390–7. BULLIANS J A (1987), ‘Yersinia species infection of lambs and cull cows at an abattoir’, New Zealand Vet J, 35, 65–7. CAFFERKEY M T and BUCKLEY T F (1987), ‘Comparison of saline agglutination, antibody to human gammaglobulin, and immunofluorescence tests in the routine serological diagnosis of yersiniosis’, J Infect Dis, 156, 845–8. CORNELIS, G., LAROCHE Y, BALLIGAND G, SORY M-P and WAUTERS G (1987), ‘Yersinia enterocolitica, a primary model for bacterial invasiveness’, Rev Infect Dis, 9, 64–87. COVER T L and ABER R C (1989), ‘Yersinia enterocolitica’, New Engl J Med, 321, 16–24. D’AOUST J Y, PARK C E, SZABO R A, TODD E C, EMMONS D B and MCKELLAR R C (1988), ‘Thermal inactivation of Campylobacter species, Yersinia enterocolitica, and hemorrhagic Escherichia coli O157:H7 in fluid milk’, J Dairy Sci, 71, 3230–6. EL-ZINEY M G, DEMEYER H and DEBEVERE, J M (1995), ‘Kinetics of interactions of lactic acid, pH and atmosphere on the growth and survival of Yersinia enterocolitica IP 383 O:9 at 4∞C’, Int J Food Microbiol, 27, 229–44. ERKMEN, O (1996), ‘Survival of virulent Yersinia enterocolitica during the manufacture and storage of Turkish Feta cheese’, Int J Food Microbiol, 33, 285–92. EUROPEAN COMMISSION (1995), Council directive 64/433/EEC on health condition for the production and marketing of fresh meat, Brussels. FREDERIKSEN W (1964), ‘A study of some Yersinia pseudotuberculosis-like bacteria (“Bacterium enterocoliticum” and “Pasteurella X”)’, in, Proceedings XIV Scand. Congr. of Path. Microbiol., Oslo, Universitetsforlagets Trykningssentral, 103–4. FUKUSHIMA H and GOMYODA M (1986), ‘Inhibition of Yersinia enterocolitica serotype O3 by natural microflora of pork’, Applied and Environmental Microbiology, 51, 990–4. GILL C and REICHEL M (1989), ‘Growth of cold-tolerant pathogens Yersinia enterocolitica, Aeromonas hydrophila and Listeria monocytogenes on high-pH beef packaged under vacuum or carbon dioxide’, Food Microbiol, 6, 223–30. GOMOLKA-PAWLICKA M and URADZINSKI J (2003), ‘Antagonistic effect of chosen lactic acid bacteria strains on Yersinia enterocolitica species in model set-ups, meat and fermented sausages’, Pol J Vet Sci, 6, 99–108. GRAU F H (1981), ‘Role of pH, lactate, and anaerobiosis in controlling the growth of some fermentative gram-negative bacteria on beef’, Appl Environ Microbiol, 42, 1043–50. GREENWOOD M H and HOOPER W L (1990), ‘Excretion of Yersinia spp. associated with consumption of pasteurized milk’, Epidemiol Infect, 104, 345–50. HANNA M O, ZINK D L, CARPENTER Z L and VANDERZANT C (1977), ‘Effect of heating, freezing and pH on Yersinia enterocolitica-like organisms from meat’, J Food Prot, 40, 689– 92. HARVEY S, GREENWOOD M J, PICKETT M J and ROBERT A M (1976),‘Recovery of Yersinia enterocolitica from streams and lakes of California’, Appl Environ Microbiol, 32, 352–4. BRENNER D J

400

Emerging foodborne pathogens

(1981), ‘Zoonotic Yersinia enterocolitica infection: host range, clinical manifestations, and transmission between animals and man’, in Bottone E J, Yersinia enterocolitica, Boca Raton, Fla, CRC Press, Inc, 145–59. ICHINOHE H, YOSHIOKA M, FUKUSHIMA H, KANEKO S and MARUYAMA T (1991), ‘First isolation of Yersinia enterocolitica serotype O:8 in Japan’, J Clin Microbiol, 29, 846–7. INTERNATIONAL ORGANIZATION FOR STANDARDIZATION (1994), Microbiology – General Guidance for the Detection of Presumptive Pathogenic Yersinia enterocolitica (ISO 10273), International Organization for Standardization, Genève, Switzerland. JEPPESEN V F and HUSS H H (1993), ‘Antagonistic activity of two strains of lactic acid bacteria against Listeria monocytogenes and Yersinia enterocolitica in a model fish product at 5 degrees C’, Int J Food Microbiol, 19, 179–86. KANEKO S, ISHIZAKI N and KOKUBO Y (1995), ‘Detection of pathogenic Yersinia enterocolitica and Yersinia pseudotuberculosis from pork using polymerase chain reaction’, Contr Microbiol Immunol 13, 153–5. KAPPERUD G and JOHNSON B (1978), ‘Yersinia enterocolitica et bactéries apparentées isolées à partir d’écosystèmes d’eau douce en Norvège’, Med Mal Infect, 8, 500–6. KAPPERUD G, NAMORK E, SKURNIK M and NESBAKKEN T (1987), ‘Plasmid-mediated surface fibrillae of Yersinia pseudotuberculosis and Yersinia enterocolitica: relationship to the outer membrane protein YOP1 and possible importance for pathogenesis’, Infect Immun, 55, 2247–54. KAPPERUD G, DOMMARSNES K, SKURNIK M and HORNES E (1990a), ‘A synthetic oligonucleotide probe and a cloned polynucleotide probe based on the yopA gene for detection and enumeration of virulent Yersinia enterocolitica’, Appl Environ Microbiol, 56, 17–23. KAPPERUD G, NESBAKKEN T, ALEKSIC S and MOLLARET H H (1990b), ‘Comparison of restriction endonuclease analysis and phenotypic typing methods for differentiation of Yersinia enterocolitica isolates’, J Clin Microbiol, 28, 1125–31. KAPPERUD G, VARDUND T, SKJERVE E, HORNES E, and MICHAELSEN T E (1993), ‘Detection of pathogenic Yersinia enterocolitica in foods and water by immunomagnetic separation, nested polymerase chain reactions, and colorimetric detection of amplified DNA’, Appl Environ Microbiol, 59, 2938–44. KENDALL M and GILBERT R J (1980), ‘Survival and growth of Yersinia enterocolitica in media and in food’, in Gould G W and Corry J E L, Microbial Growth and Survival in Extremes of Environment, Society for Applied Bacteriology Technical Series, No 15, London, Academic Press, pp 215–26. KLEINLEIN N and UNTERMANN F (1990), ‘Growth of pathogenic Yersinia enterocolitica strains in minced meat with and without protective gas with consideration of the competitive background flora’, Int J Food Microbiol, 10, 65–72. KONDRACKI S, BALZANO G, SCHWARTZ J, KIEHLBAUCH J, ACKMAN D and MORSE D (1996), ‘Recurring outbreaks of yersiniosis associated with pork chitterlings’, Abstract 36th Interscience Conference on Antimicrobial agents and Chemotherapy, New Orleans, 259. KOTULA A W and SHARAR A K (1993), ‘Presence of Yersinia enterocolitica serotype O:5,27 in slaughter pigs’, J Food Prot, 56, 215–18. KROGSTAD O (1974), ‘Yersinia enterocolitica infection in goat. A serological and bacteriological investigation’, Acta Vet Scand, 15, 597–608. LACHICA R V, ZINK D L and FERRIS W R (1984), ‘Association of fibril structure formation with cell surface properties of Yersinia enterocolitica’, Infect Immun, 46, 272–5. LAIRD W J and CAVANAUGH D C (1980), ‘Correlation of autoagglutination and virulence of yersiniae’, J Clin Microbiol, 11, 430–2. LANADA E B (1990), ‘The epidemiology of Yersinia infections in goat flocks’, thesis, Massey University, Palmerston North, New Zealand. LANGELAND G (1983) ‘Yersinia enterocolitica and Yersinia enterocolitica-like bacteria in drinking water and sewage sludge’, Acta Pathol Microbiol Immunol Scand Sect B, 91, 179–85. HURVELL B

Yersinia enterocolitica 401 LASSEN J

(1972) ‘Yersinia enterocolitica in drinking-water’, Scand J Infect Dis, 4, 125–7.

LEE L A, GERBER A R, LONSWAY D R, SMITH J D, CARTER G P, POHR N D, PARRISH C M, SIKES R K,

and TAUXE R V (1990), ‘Yersinia enterocolitica O:3 infections in infants and children, associated with the household preparation of chitterlings’, The New Engl J Med, 322, 984–7. LEE W H, VANDERZANT C. and STERN N (1981), ‘The occurrence of Yersinia enterocolitica in foods’, in Bottone E J, Yersinia enterocolitica, Boca Raton, Fla, CRC Press, Inc, 161– 71. LINDBERG C W and BORCH E (1994), ‘Predicting the aerobic growth of Yersinia enterocolitica O:3 at different pH values, temperatures and L-lactate concentrations using conductance measurements’, Int J Food Microbiol, 22, 141–53. MEAD, P S, SLUTSKER L, DIETZ V, MCCAIG L F, BRESEE J S, SHAPIRO C, GRIFFIN, P M and TAUXE R V (1999), ‘Food-related illness and death in the United States’, Emerg Infect Dis, 5, 607–25. MICHIELS T, WATTIAU P, BRASSEUR R, RUYSSCHAERT J M and CORNELIS G (1990), ‘Secretion of Yop proteins by yersiniae’, Infect Immun, 58, 2840–9. MILLER V L, FINLAY B B and FALKOW S (1988), ‘Factors essential for the penetration of mammalian cells by Yersinia’, Curr Top Microbiol Immunol, 138, 15–39. MINISTERE DES AFFAIRES SOCIALES, DE LA SANTE PUBLIQUE ET DE L’ENVIRONNEMENT. INSTITUT D’HYGIENE ET D’EPIDEMIOLOGIE (1995), Surveillance van Infectieuze Aandoeningen door een Netwerk van Laboratoria voor Microbiologie 1994 + Retrospectieve 1983–1993, Brussels. MOLINS R A, MOTARJEMI Y and KAEFERSTEIN F K (2001), ‘Irradiation: A critical control point in ensuring the microbiological safety of raw foods’, in Loaharanu P and Thomlas P, Irradiation for food safety and quality, Pennsylvania, USA, 55–70. MOLLARET H H (1995), ‘Fifteen centuries of yersiniosis’, Contrib Microbiol Immunol, 13, 1–4. MOLLARET H H, NICOLLE P, BRAULT J and NICOLAS R (1972), ‘Importance actuelle des infections a Yersinia enterocolitica’, Bull Acad Nat Med Paris, 156, 704. MOLLARET H H, BERCOVIER H and ALONSO J M (1979), ‘Summary of the data received at the WHO Reference Center for Yersinia enterocolitica’, Contrib Microbiol Immunol, 5, 174–84. MORSE D L, SHAYEGANI M and GALLO R J (1984), ‘Epidemiologic investigation of a Yersinia camp outbreak linked to a food handler’, Am J Public Health, 74, 589–92. NESBAKKEN T (1988), ‘Enumeration of Yersinia enterocolitica O:3 from the porcine oral cavity, and its occurrence on cut surfaces of pig carcasses and the environment in a slaughterhouse’, Int J Food Microbiol, 8, 287–93. NESBAKKEN T (1992), ‘Epidemiological and Food Hygienic Aspects of Yersinia enterocolitica with Special Reference to the Pig as a Suspected Source of Infection’, Thesis, Norwegian College of Veterinary Medicine, Oslo, Norway. NESBAKKEN T (2005), ‘Yersinia enterocolitica’, in Fratamico P M, Bhunia A K and Smith J L, Foodborne pathogens: Microbiology and Molecular Biology, Norwich, UK, Caister Academic Press, 228–249. NESBAKKEN T, KAPPERUD G, SØRUM H and DOMMARSNES K (1987), ‘Structural variability of 40–50 Mdal virulence plasmids from Yersinia enterocolitica. Geographical and ecological distribution of plasmid variants’, Acta Path Microbiol Immunol Scand Sect B, 95, 167–73. NESBAKKEN T, KAPPERUD G, DOMMARSNES K, SKURNIK M and HORNES E (1991a), ‘Comparative study of a DNA hybridization method and two isolation procedures for detection of Yersinia enterocolitica O:3 in naturally contaminated pork products’, Appl Environ Microbiol, 57, 389–94. NESBAKKEN T, KAPPERUD G, LASSEN J and SKJERVE E (1991b), ‘Yersinia enterocolitica antibodies in slaughterhouse employees, veterinarians, and military recruits. Occupational exposure to pigs as a risk factor for yersiniosis’, Contrib Microbiol Immunol, 12, 32–9. FINTON R J

402

Emerging foodborne pathogens

NESBAKKEN T, NERBRINK E, RØTTERUD O-J

and BORCH E. (1994), ‘Reduction of Yersinia enterocolitica and Listeria spp. on pig carcasses by enclosure of the rectum during slaughter’, Int J Food Microbiol, 23, 197–208. NESBAKKEN T, ECKNER K, HØIDAL H K and RØTTERUD O-J (2003a), ‘Occurrence of Yersinia enterocolitica and Campylobacter spp. in slaughter pigs and consequences for meat inspection, slaughtering, and dressing procedures’, Int J Food Microbiol, 80, 231–40. NESBAKKEN T, ECKNER K, HØIDAL, H K and RØTTERUD O-J (2003b), ‘Occurrence of Yersinia enterocolitica in slaughter pigs and consequences for meat inspection, slaughtering, and dressing procedures’, in Skurnik M, Bengoechea J A and Granfors K, The Genus Yersinia. Entering the Functional Genomic Area. Advances in Experimental Medicine and Biology vol. 529, New York, Kluwer Academic/Plenum Publishers, 303–8. NILÉHN B and SJÖSTRÖM B (1967), ‘Studies on Yersinia enterocolitica: occurrence in various groups of acute abdominal disease’, Acta Path Microbiol Immunol Scand, 71, 612–28. NILSSON A, LAMBERTZ S T, STÅLHANDSKE P, NORBERG P, and DANIELSSON-THAM M L (1998), ‘Detection of Yersinia enterocolitica in food by PCR amplification’, Lett Appl Microbiol, 26, 140–1. NISSEN H, ALVSEIKE O, BREDHOLT S and NESBAKKEN T (2000), ‘Comparison between growth of Yersinia enterocolitica, Listeria monocytogenes, Escherichia coli O157:H7 and Salmonella spp. in ground beef packed by three commercially used packaging techniques’, Int J Food Microbiol, 59, 211–20. NORDIC COMMITTEE ON FOOD ANALYSIS (1987), Yersinia enterocolitica. Detection in Food, Method no. 117, 2nd edn, Nordic Committee on Food Analysis, Esbo, Finland, 12. NORWEGIAN NATIONAL INSTITUTE OF PUBLIC HEALTH (2005), http://www.msis.no, 3/2/2005. OLSOVSKY Z, OLSAKOVA V, CHOBOT S and SVIRIDOV V (1975), ‘Mass occurrence of Yersinia enterocolitica in two establishments of collective care of children’, J Hyg Epidemiol Microbiol Immunol, 19, 22–9. OSTROFF S M, KAPPERUD G, LASSEN J, AASEN S and TAUXE R V (1992), ‘Clinical features of sporadic Yersinia enterocolitica infections in Norway’, J Infect Dis, 166, 812–17. OSTROFF S M, KAPPERUD G, HUTWAGNER L C, NESBAKKEN T, BEAN N H, LASSEN J and TAUXE R V (1994), ‘Sources of sporadic Yersinia enterocolitica infections in Norway: a prospective case-control study’, Epidemiol Infect, 112, 133–41. OZBAS Z Y and AYTAC S A (1996), ‘Behaviour of Yersinia enterocolitica and Aeromonas hydrophila in skim milk during fermentation by various lactobacilli’, Z Lebensm Unters Forsch, 1996, 202, 324–8. PAI C H and DESTEPHANO L (1982), ‘Serum resistance associated with virulence in Yersinia enterocolitica’, Infect Immun, 35, 605–11. PAI C H, MORS V and TOMA S (1978), ‘Prevalence of enterotoxigenicity in human and nonhuman isolates of Yersinia enterocolitica’, Infect Immun, 22, 334–8. PAI C H, GILLIS F and MARKS M I (1982), ‘Infection due to Yersinia enterocolitica in children with abdominal pain’, J Infect Dis, 146, 705. + PERRY R D and BRUBAKER R R (1983), ‘Vwa phenotype of Yersinia enterocolitica’, Infect Immun, 40, 166–71. PERRY R D, BEARDEN S W and FETHERSTON J D (2001), ‘Iron and heme acquisition and storage systems of Yersinia pestis’, Recent Res Develop Microbiol, 5, 13–27. PORTNOY D A and MARTINEZ R J (1985), ‘Role of a plasmid in the pathogenicity of Yersinia species’, Curr Top Microbiol Immunol, 118, 29–51. PRPIC J K, ROBINS-BROWNE R M and DAVEY R B (1985), ‘In vitro assessment of virulence in Yersinia enterocolitica and related species’, J Clin Microbiol, 22, 105–10. RASMUSSEN H N, RASMUSSEN O F, CHRISTENSEN H and OLSEN J E (1995), ‘Detection of Yersinia enterocolitica O:3 in faecal samples and tonsil swabs from pigs using IMS and PCR’, J Appl Bacteriol, 78, 563–8. RKI (2002), Epidemiologisches Bulletin No. 29, Robert Koch Institute, Berlin, Germany. SAARI T N, and JANSEN G P (1979), ‘Waterborne Yersinia enterocolitica in the midwest United States’, Contrib Microbiol Immunol, 5, 185–96.

Yersinia enterocolitica 403 and LASSEN J (1992), ‘Acute and chronic gastrointestinal manifestations associated with Yersinia enterocolitica infection. A Norwegian 10-year follow-up study on 458 hospitalized patients’, Ann Surg, 215, 250–5. SAMADI A R, WACHSMUTH K, HUQ M I, MAHBUB M and AGBONLAHOR D E (1982), ‘An attempt to detect Yersinia enterocolitica infection in Dacca, Bangladesh’, Trop Geogr Med, 34, 151–4. SANDLER M, GIRDWOOD A H, KOTTLER R E and MARKS I N (1982), ‘Terminal ileitis due to Yersinia enterocolitica’, S Afr Med J, 62, 573–6. SARROUY J (1972), ‘Isolement d’une Yersinia enterocolitica a partir du lait’, Med Mal Infect, 2, 67. SCHIEMANN D A (1982), ‘Development of a two-step enrichment procedure for recovery of Yersinia enterocolitica from food’, Appl Environ Microbiol, 43, 14–27. SCHIEMANN D A (1983), ‘Alkalotolerance of Yersinia enterocolitica as a basis for selective isolation from food enrichments’, Appl Environ Microbiol, 46, 22–7. SCHIEMANN D A (1989), ‘Yersinia enterocolitica and Yersinia pseudotuberculosis’, in Doyle M P, Foodborne bacterial pathogens, New York, Marcel Dekker, Inc, 601–72. SHENKMAN L and BOTTONE E J (1976), ‘Antibodies to Yersinia enterocolitica in thyroid disease’, Ann Intern Med, 85, 735–9. SHIOZAWA K, NISHINA T, MIWA Y, MORI T, AKAHANE S and ITO K (1991), ‘Colonization in the tonsils of swine by Yersinia enterocolitica’, Contrib Microbiol Immunol, 12, 63–7. SKJERVE E, LIUM B, NIELSEN B and NESBAKKEN T (1998), ‘Control of Yersinia enterocolitica in pigs at herd level’, Int J Food Microbiol, 45, 195–203. SLEE K J and BUTTON C (1990), ‘Enteritis in sheep and goats due to Yersinia enterocolitica infection’, Austr Vet J, 67, 396–8. SNEATH P H A and COWAN S T (1958), ‘An electro-taxonomic survey of bacteria’. J General Microbiol, 19, 551. SÖRQVIST S and DANIELSSON-THAM M L (1990), ‘Survival of Campylobacter, Salmonella and Yersinia spp. in scalding water used at pig slaughter’, Fleischwirtsch, 70, 1460–66. STÅHLBERG T H, HEESEMANN J, GRANFORS K and TOIVONEN P (1989), ‘Immunoblot analysis of IgM, IgG, and IgA responses to plasmid encoded released proteins of Yersinia enterocolitica in patients with or without yersinia triggered reactive arthritis’, Ann Rheum Dis, 48, 577–81. STENGEL G (1985), ‘Yersinia enterocolitica. Vorkommen und Bedeutung in Lebensmitteln’, Fleischwirtschaft, 65, 1490–5. STERN N J, PIERSON M D and KOTULA A W (1980), ‘Effects of pH and sodium chloride on Yersinia enterocolitica growth at room and refrigeration temperature’, J Food Sci, 45, 64–7. SUTHERLAND J P and BAYLISS A J (1994), ‘Predictive modelling of growth of Yersinia enterocolitica: the effects of temperature, pH and sodium chloride’, Int J Food Microbiol, 21, 197–215. SZITA M I, KÁLI M and RÉDEY B (1973), ‘Incidence of Yersinia enterocolitica infection in Hungary’, Contrib Microbiol Immunol, 2, 106–10. TACKET C O, NARAIN J P, SATTIN R, LÖFGREN J P, KÖNIGSBERG C JR, RENDTORFF R C, RAUSA A, DAVIS B R and COHEN M L (1984), ‘A multistate outbreak of infections caused by Yersinia enterocolitica transmitted by pasteurized milk’, J Am Med Assoc, 251: 483–6. TACKET C O, BALLARD J, HARRIS N, ALLARD J, NOLAN C, QUAN T and COHEN M L (1985), ‘An outbreak of Yersinia enterocolitica infections caused by contaminated tofu (soybean curd)’, Am J Epidemiol, 121, 705–11. TAUXE R V (2002), ‘Emerging foodborne pathogens’, Int J Food Microbiol, 78, 31–42. TAUXE R V, WAUTERS G, GOOSSENS V, VANNOYEN, R, VANDEPITTE, J, MARTIN, S M, DE MOL, P and THIERS G (1987), ‘Yersinia enterocolitica infections and pork: the missing link’, Lancet, I, 1129–32. TENOVER F C (1988), ‘Diagnostic deoxyribonucleic acid probes for infectious diseases’, Clin Microbiol Rev, 1, 82–101. SAEBØ A

404

Emerging foodborne pathogens

THISTED LAMBERTZ S, BALLAGI-PORDÁNY A, NILSSON A, NORDBERG P,

and DANIELSSON-THAM M L (1996), ‘A comparison between a PCR method and a conventional culture method for detection of pathogenic Yersinia enterocolitica in foods’, J Appl Bacteriol, 81, 303–8. THOMPSON J S and GRAVEL M J (1986), ‘Family outbreak of gastroenteritis due to Yersinia enterocolitica serotype O:3 from well water’, Can J Microbiol, 32, 700–1. TOIVANEN P, TOIVANEN A, OLKKONEN L and AANTAA S (1973), ‘Hospital outbreak of Yersinia enterocolitica infection’, Lancet, I, 1801–3. TOMA S and LAFLEUR L (1981), ‘Yersinia enterocolitica infections in Canada 1966 to August 1978’, in E J Bottone, Yersinia enterocolitica, Boca Raton, Fla: CRC Press, Inc, 183– 91. URSING J, BRENNER D J, BERCOVIER H, FANNING G R, STEIGERWALT A G, BRAULT J and MOLLARET H H (1980), ‘Yersinia frederiksenii: a new species of Enterobacteriaceae composed of rhamnose-positive strains (formerly called atypical Yersinia enterocolitica or Yersinia enterocolitica-like)’, Curr Microbiol, 4, 213–17. VANTRAPPEN G, AGG H O, PONETTE E, GEBOES K and BERTRAND P (1977), ‘Yersinia enteritis and enterocolitis: Gastroenterological aspects’, Gastroenterology, 72, 220–7. VIITANEN A M, ARSTILA P, LAHESMAA R, GRANFORS K, SKURNIK M, and TOIVONEN, P (1991), ‘Application of the polymerase chain reaction and immunofluorescence techniques to the detection of bacteria in Yersinia-triggered reactive arthritis’, Arthritis Rheum, 34, 89–96. WACHSMUTH K (1985), ‘Genotypic approaches to the diagnosis of bacterial infections: Plasmid analyses and gene probes’, Infect Control, 6, 100–9. WAUTERS G (1981), ‘Antigens of Yersinia enterocolitica’, in Bottone E J, Yersinia enterocolitica, Boca Raton, Fla, CRC Press, Inc, 41–53. WAUTERS G (1991), ‘Taxonomy, identification and epidemiology of Yersinia enterocolitica and related species’, in Grimme H, Landi E and S Dumontet. I Problemi della Moderna Biologia: Ecologia Microbica, Analitica di Laboratorio, Biotecnologia, Vol. 1. Atti del IV Convegno Internazionale, Sorrento, 93–101. WAUTERS G, GOOSSENS V, JANSSENS M and VANDEPITTE J (1988a), ‘New enrichment method for isolation of pathogenic Yersinia enterocolitica O:3 from pork’, Appl Environ Microbiol, 54, 851–4. WAUTERS G, JANSSENS M, STEIGERWALT A G and BRENNER D J (1988b), ‘Yersinia mollaretii sp. nov., formerly called Yersinia enterocolitica biogroups 3A and 3B’, Int J Syst Bacteriol, 38, 424–9. WEYNANTS V, JADOT V, DENOEL P A, TIBOR A and LETESSON J-J (1996a), ‘Detection of Yersinia enterocolitica serogroup O:3 by a PCR method’, Journal of Clinical Microbiology, 34, 1224–7. WEYNANTS V, TIBOR A, DENOEL P A, SAEGERMAN C, GODFROID J, THIANGE P and LETESSON J-J (1996b), ‘Infection of cattle with Yersinia enterocolitica O:9 a cause of the false positive serological reactions in bovine brucellosis diagnostic tests’, Vet Microbiol, 48, 101–112. WINBLAD S. (1975), ‘Arthritis associated with Yersinia enterocolitica infections’, Scand J Infect Dis, 7, 191–5. WORLD HEALTH ORGANIZATION (1983), Yersiniosis: report on a WHO meeting, Paris, 1981, WHO Regional Office for Europe, Euro reports and studies 60, Copenhagen, 31pp. WORLD HEALTH ORGANIZATION (1995), Report of the WHO Consultation on Emerging Foodborne Diseases, Berlin. WORLD HEALTH ORGANIZATION (2000), Foodborne disease: A focus for health education, Geneva, Switzerland WORMSER G P and KEUSCH G T (1981), ‘Yersinia enterocolitica: clinical observations’, in Bottone E J, Yersinia enterocolitica, Boca Raton, Fla, CRC Press, Inc, 83–93. WRIGHT J, FENWICK S and MCCARTHY M (1995), ‘Yersiniosis: an emerging problem in New Zealand’, N Z Public Health Rep, 2, 65–6.

Yersinia enterocolitica 405 (1894), ‘La peste bubonique a Hong Kong’, Ann Inst Pasteur, Paris, 8, 662–7. (1973), ‘An outbreak of enteritis due to Yersinia enterocolitica occurring at a junior high school’, Jpn J Microbiol, 17, 220–2.

YERSIN A

ZEN-YOJI H, MARUYAMA T, SAKAI S, KIMURA S, MIZUNO T, AND MOMOSE T

406

Emerging foodborne pathogens

15 Listeria J. McLauchlin, Health Protection Agency Food Safety Microbiology Laboratory, UK

15.1

Introduction

The bacterium Listeria monocytogenes was first identified as responsible for illness in animals in 1925, and the first suggestion that this was predominantly a foodborne illness was published in 1927. However, it was not until a series of large outbreaks occurred in the 1980s that it was realised that this bacterium is amongst the most important agents responsible for a serious foodborne infection in humans. The properties of the bacterium favour transmission through food and listeriosis most often affects the unborn, newly delivered, neonates, elderly and immuno-compromised individuals. Changes in eating habits to consumption of more ready-to-eat foods with extended refrigerated shelf lives also favours this disease. During the 1980s and 1990s much information was amassed on the distribution, behaviour and susceptibility to environmental challenges of L. monocytogenes. In addition, better recognition of this pathogen and vastly improved diagnostic procedures were developed. The application of control measures throughout the food chain (including the application of HACCP) have now resulted in a dramatic reduction in the levels of contamination of foods on retail sale. Changes in food processing technology together with ever increasing global food sourcing (both of raw materials and distribution of finished products) will present different and changing challenges for the control of this bacterium. Demographic changes will inevitably result in an increased at risk and susceptible population, e.g. the immunocompromised and elderly. Constant attention to food processes and control of L. monocytogenes contamination is an essential on-going responsibility of the food industry.

Listeria

407

15.2 Historical summary and emergence of listeriosis as a major foodborne disease In 1925, Murray, Webb and Swann in Cambridge (UK) described a series of spontaneous severe infections amongst laboratory rabbits and guinea pigs characterised by a marked mononuclear leukocytosis (Murray et al. 1926). The disease was caused by a Gram-positive bacterium, which they named Bacterium monocytogenes. In the following year, Pirie (1927) also isolated a Gram-positive bacterium, in this instance from infected wild gerbils in South Africa; he proposed the generic name Listerella in honour of the surgeon Lord Lister. Murray and Pirie realised that they were dealing with the same bacterium, and combined the names to form Listerella monocytogenes. This was later changed for taxonomic reasons to Listeria monocytogenes (Pirie 1940). In 1929 in Denmark, Nyfeldt isolated L. monocytogenes from the blood cultures of patients with a mononucleosis-like infection (a rare manifestation of the disease), and in 1936, Burn in the USA established listeriosis as a cause of both sepsis amongst newborn infants as well as a cause of meningitis in adults (Gray and Killinger 1966). Prior to 1926 there were published descriptions of disease likely to have been listeriosis; indeed, a ‘diphtheroid’ isolated from the cerebrospinal fluid of a soldier in Paris in 1919 was later identified as L. monocytogenes (Gray and Killinger 1966). The concept that listeriosis is a foodborne disease is not new, indeed Murray and colleagues (1926) commented: ‘The seasonal incidence of the natural disease seems to have been in the early spring and autumn. At these times the fresh food upon which the breeding establishment largely depended either became scarce or rank.’ Pirie (1927) went even further, producing the prophetic, but somewhat forgotten, statements: ‘... infection can be produced by subcutaneous inoculation or by feeding, and it is thought that by feeding that the disease is spread in nature.’ However, human listeriosis remained a relatively obscure disease until the 1980s, attracting limited attention, although large outbreaks of considerable morbidity and mortality but of unknown transmission occurred. For example, 279 and 166 human listeriosis cases respectively occurred in Halle (Germany) during 1966, and in the Anjou region (France) between 1975–76. During the early to mid-1980s, there was a rise in the total numbers of human and animal listeriosis cases in Europe and North America and a series of human foodborne outbreaks (Table 15.1). There was considerable interest in the disease, the causative organism and its interaction and behaviour, together with methods for its detection and isolation, and resulted in the emergence of L. monocytogenes as one of the most important foodborne pathogens. The numbers of reported human listeriosis cases has subsequently declined in most of Europe and North America, although local upsurges in sporadic cases together with large foodborne outbreaks continue to occur. Recent estimates ranked listeriosis as the second and fourth most common cause of death from foodborne infectious diseases in the USA and in England and Wales respectively (Table 15.2).

408

Emerging foodborne pathogens

Table 15.1 Foodborne outbreaks of human listeriosis which led to the emergence of this disease during the 1980s Year

Place

Country

Cases

Deaths

Food vehicle

1981 1983 1985 1983–87 1987–89

Nova Scotia Boston Los Angeles Vaud National

Canada USA USA Switzerland UK

41 49 142 122 337

18 14 30 34 94

Coleslaw Milk Soft cheese Soft cheese Pâté

Table 15.2 Estimation of the five most common causes of death from foodborne pathogens in the USA and England and Wales Annual total of cases of foodborne illness Total numbers of cases

Deaths

USA (data adapted from Mead et al., 1999) All cases 76,000,000 Salmonella 1,412,498 Listeria 2,518 Toxoplasma 225,000 Norovirus 23,000,000 Campylobacter 2,453,926

5,194 843 761 571 190 136

England and Wales* (adapted from Adak et al., 2002) All cases 1,338,772 Salmonella 41,616 Clostridium perfringens 84,081 Campylobacter 358,466 Listeria 194 VTEC O157 995

480 119 89 86 68 22

* Endogenous foodborne disease

15.3 Listeria taxonomy, properties, occurrence and pathogenicity The genus Listeria was originally described as monotypic, containing only L. monocytogenes. However DNA base composition studies by Rocourt and colleagues in the 1982, followed by 16S and 23S rRNA sequence studies a decade later show that six species occur. All species within the genus Listeria form a homogeneous group together with the non-pathogenic species Brochothrix thermospacta and Brochothrix campestris, and justify family status as the Listeriaceae (Collins et al. 1991). 16S rRNA sequence analyses show relationships with other Gram-positive genera of low G + C ratio, including members of the genera Bacillus (Collins et al. 1991). Indeed, the completed genome sequences of L. monocytogenes and Listeria innocua

Listeria

409

which are now available show a close relationship to that from Bacillus subtilis and suggest a common albeit distant origin (Glaser et al. 2001). Listeria are coccobacillary- to bacillus-shaped Gram-positive bacteria. They are non-sporing and motile by peritrichate flagella, aerobic and microaerophilic organisms that grow between <0 ∞C and 45 ∞C. The bacilli are non-motile at 37 ∞C, but exhibit characteristic ‘tumbling’ motility when tested at and below 25 ∞C. The organisms exhibit fermentative activities on carbohydrates. Listeria spp. are catalase-positive and oxidase-negative. The genus Listeria consists of six species: monocytogenes, grayi, innocua, ivanovii, seeligeri and welshimeri. All six species can be readily differentiated by a restricted range of in vitro tests (Table 15.3). The G + C content of DNA is 36–42 mol% and the type species is L. monocytogenes. L. monocytogenes is the major pathogenic species in both animals and humans (McLauchlin 1997). However, in humans, occasional infections due to L. ivanovii (Cummins et al. 1994) and L. seeligeri (Rocourt et al. 1987) have been reported. L. ivanovii infections may account for a significant proportion of cases of listeriosis in domestic animals, especially in sheep (Low and Donachie 1997). Rare infections due to L. innocua in domestic animals have occurred (Walker et al. 1994). L. welshimeri and L. grayi have not been shown to cause disease. Listeria are found ubiquitously in the environment and are distributed worldwide. Listeria have been isolated from fresh water, wastewater, mud Table 15.3

Differential characteristics of Listeria species

In vitro differential character

b haemolysis on blood containing agar Lipase production Amino acid peptidase activity Acid production from: D-mannitol L-rhamnose D-xylose a-methyl D-mannoside CAMP test* with: Staphylococcus aureus Rhodococcus equi

Listeria species monoivanovii innocua welshimeri cytogenes

seeligeri

grayi

+

++

–

–

±

–

+ –

+ +

– +

– +

+ +

– +

– + – +

– – + –

– + – +

– ± + +

– – + ±

+ ± – ±

+

–

–

–

+

–

–

+

–

–

–

–

*Enhancement of haemolysis reaction +Positive reaction: – negative reaction; ± variable or weak reaction.

410

Emerging foodborne pathogens

and soil, especially when decaying vegetable material is present. An extremely wide range of animals (mammals, birds, fish and invertebrates) has been reported to carry Listeria spp. without apparent disease. In humans, carriage rates in faeces of <3% for Listeria spp. and <1% for L. monocytogenes are most commonly reported: carriage in the gut is probably transitory. Because of the occurrence of Listeria in the gut of animals and its survival in the environment, Listeria spp. are commonly found from sites contaminated with human sewage, sewage sludge or animal slurry. This bacterium is highly persistent in the environment, see later discussion on survival in environmental sites within food production environments. The properties of L. monocytogenes favour food as an agent in transmission for listeriosis. It grows in a wide range of foods with relatively high water activities (Aw > 0.95) and over a wide range of temperatures (0–45 ∞C). Growth at refrigeration temperatures is relatively slow with a maximum doubling time of about 1–2 days at 4 ∞C. The bacterium will grow in the presence of 10% NaCl, as well as 200 ppm NaNO2, and will survive in moist and dry environments at specific sites within food manufacturing environments for years. Even when present at high levels in foods, spoilage or taints are not generally produced. Multiplication in food is restricted to the pH range 5–9. L. monocytogenes is not sufficiently heat resistant to survive pasteurisation of milk; i.e., in milk at 62.8 ∞C for 30 minutes a 39D reduction is obtained, and at 71.7 ∞C for 15 seconds a 5.2D reduction is obtained (Mackey and Bratchell 1989). This bacterium survives freezing well. L. monocytogenes is an intracellular parasite, and it is in this environment that the pathogen gains protection and evades some of the host’s defences. However, the host has a number of strategies to deal with such parasites. Non-specific mechanisms of resistance are important as first lines of defence once the mucous membranes are breached. Lysozyme can lyse some strains of L. monocytogenes, and human neutrophils and non-activated macrophages can phagocytose and kill the bacterium. Protective immunity in humans probably depends on T lymphocytes, antibodies playing little or no role. L. monocytogenes is a pathogen of immunologically privileged sites including neurological tissue and the contents of the pregnant uterus. The latter site has a series of potent antimicrobial defences of which L. monocytogenes is resistant together with a small group of other unrelated pathogenic agents. L. monocytogenes enters phagocytic and non-phagocytic cells and a listerial surface protein, internalin (reminiscent of the M protein of Streptococcus pyogenes) is involved with the initial stages of invasion on all cell types. After internalisation, L. monocytogenes becomes encapsulated in a membrane bound compartment. In the phagocyte, most cells in the phagocytic vacuole are probably killed. However, those surviving in the phagocytic vacuole, and those in the membrane bound compartment of non-professional phagocytes, mediate the dissolution of the vacuole membrane by means of a haemolysin (listeriolysin O), and also, possibly, the action of a phospholipase C. Growth occurs in the host cell cytoplasm, and the bacterium becomes surrounded by

Listeria

411

polymerised host cell actin. The ability to polymerise actin by a listerial cell surface protein subverts the host cell’s cytoskeleton and confers intracellular motility to the bacterium. The resulting ‘comet tail’-like structure pushes the bacterium into an adjacent mammalian cell, where it again becomes encapsulated in a vacuole. A listerial lecithinase is involved with dissolution of these membranes; the haemolysin may also contribute in this process. Intracellular growth and movement in the newly invaded cell is then repeated. Similar sets of virulence genes are present in L. ivanovii and L. seeligeri (Vazquez-Boland et al., 2001). Although found in the gut, Listeria spp. show many of the characteristics of bacteria adapted to a saprophytic existence, i.e., growth at low temperature, tolerance of sodium chloride and alkaline conditions, resistance to desiccation, motility at temperatures less than 25 ∞C, presence in soil and decaying vegetable material, and, where pathogenic, a failure to produce host-specific clinical syndromes. However, there are specific adaptations that allow invasion of, and multiplication in, eukaryotic cells by L. monocytogenes. These may have evolved for survival in unicellular and multicellular soil organisms. The ‘true’ habitat for the genus Listeria may be that of decaying plant material with occasional transitory residence in the gastrointestinal tract of animals. Additional properties may allow the utilisation of the intracellular environments of free-living eukaryotic soil organisms by L. monocytogenes. Thus human listeriosis is rarely a zoonotic disease but transmitted via indirect contact with the environment through food. A schematic representation of interaction of Listeria and the environment is shown in Fig. 15.1. Soil or water Listeria most often found in moist sites of neutral pH with decaying organic material

Feed manufacturing environments

Natural home

Food and food manufacturing environments

Sewage or slurry

Growth in feed

Consumption of contaminated feed

Animal disease maternal transmission neonatal cross-infection

Invasion of free living lower eukaryotic organisms

Growth in food

Consumption of contaminated food Milk (mastitis) ?meat and fish

Bovine abortion

Human disease maternal transmission neonatal cross-infection

Fig. 15.1 Inter-relationships of Listeria with the environment. Dark boxes indicate common occurrence, light boxes rare occurrences.

412

15.4

Emerging foodborne pathogens

The disease listeriosis

Listeriosis occurs in a wide variety of animals, including humans, and most often affects the uterus at pregnancy, the central nervous system or the bloodstream. Amongst farm animals, listeriosis is most often recognised in sheep and goats. In humans, serious, and indeed life threatening, infection is most often recognised. Subclinical infections do occur but are rarely identified and considering the widespread distribution of L. monocytogenes, the true spectrum of disease and overall disease burden remains to be defined. In humans, infection is most often recognised in the immunocompromised and elderly patients, pregnant women, and unborn or newly delivered babies. Infection can be treated successfully with antibiotics, but human infection has a case-fatality rate of 20–40% (Farber and Peterkin 1991). In domestic animals (especially in sheep and goats), listeriosis usually presents as encephalitis, abortion or septicaemia, and is a cause of considerable economic loss (Low and Donachie 1997). Consumption of contaminated food or feed is believed to be the principal route of infection, however, in humans, infection can also be transmitted, albeit rarely, by direct contact with the environment or infected animals, or by cross-infection during the neonatal period (see Section 15.5). The incidence of infection increases with age so that the mean age of adult infections is over 55 years. Men are more commonly infected than women over the age of 40 years, and since women are infected in the childbearing years, the overall sex distribution is more or less equal. Immunosuppression is a major risk factor for both the epidemic and sporadic forms of listeriosis and probably accounts for the increasing incidence with age. Human immunodeficiency virus disease is a predisposing factor in some areas. L. monocytogenes infections usually occur in urban populations and in the absence of specific contact with animals. Human listeriosis has a marked seasonality with a peak in cases occurring during the late summer and autumn. In contrast, listeriosis in animals has a marked seasonal peak in the spring. The incubation period in humans between exposure (consumption of contaminated foods) and clinical recognition of the disease varies widely between individuals from 1–90 days, with an average for intra-uterine infection of around 30 days. The infectious dose is likely to vary greatly between individuals within the human population and is likely to be high. 15.4.1 Infection in pregnancy and the neonate Listeriosis in pregnancy is classified by foetal gestation at onset, as this correlates best with the clinical features, microbiology and prognosis. Neonatal infection is divided into early (<2 days old), intermediate (3–5 days old) and late (>5 days old) onset disease. Maternal listeriosis occurs throughout gestation, but before 20 weeks of pregnancy is rarely detected. The mother is usually previously well with a normal pregnancy but with very mild symptoms

Listeria

413

(chills, fever, back pain, sore throat and headache and, sometimes, conjunctivitis, diarrhoea or drowsiness) or be asymptomatic until the delivery of an infected infant. Symptomatic women may have positive blood cultures. Culture from high vaginal swabs (HVSs), stool and midstream urine samples together with pre- or post-natal antibody tests are of little help in diagnosis. With the onset of fever, foetal movements are reduced, and premature labour occurs within about one week. There may be a transient fever during labour, and the amniotic fluid is often discoloured or meconium stained. Culture of the amniotic fluid, placenta or HVS post delivery invariably yields a heavy growth of L. monocytogenes. Fever resolves soon after birth, and the HVS is usually culture-negative after about one month. While the outcome of infection for the mother is usually benign, the outcome for the infant is more variable and can be disastrous. Abortion, stillbirth and early-onset neonatal disease are common, depending on the gestation at infection. However, maternal infection without infection of the offspring can occur and even progress to placental infection without ill effects for the foetus. Early neonatal listeriosis is predominantly a septicaemic illness, contracted in utero. In contrast, late neonatal infection is predominantly meningitic and can be associated with hospital cross-infection. Early onset disease represents a spectrum of mild to severe infection, which can be correlated with the microbiological findings. Those neonates who die of infection usually do so within a few days of birth and have pneumonia, hepatosplenomegaly, petechiae, abscesses in the liver or brain, peritonitis and enterocolitis. Late-onset listeriosis is the third commonest form of meningitis in neonates. The CSF protein content is almost always raised and the glucose level reduced. The total number of white cells is increased but the counts are variable; neutrophils usually predominate, but lymphocytes or monocytes may be the main cell type. In about 50% of Gram films, bacteria, which may resemble rods or cocci, are seen.

15.4.2 Adult and juvenile infection Listeriosis in children older than one month is very rare, except in those with underlying disease. In adults and juveniles the main syndromes are CNS infection, septicaemia and endocarditis. Most cases occur in immunosuppressed patients receiving steroid or cytotoxic therapy or with malignant neoplasms. However, about one-third of patients with meningitis and around 10% with primary bacteraemia are immunocompetent. The clinical presentation of meningitis is the same in all groups, but progression is more rapid in immunocompromised subjects. A peripheral blood leucocytosis occurs, and the CSF white blood cell count is raised. The CSF glucose level is low and the protein level is raised; a very high protein concentration may be a poor prognostic indicator. Gram stains of the CSF are often negative, and the clinical features of infection are such that it is not possible to tell listerial meningitis from meningococcal or pneumococcal infection. However, L. monocytogenes is isolated from blood cultures in most cases.

414

Emerging foodborne pathogens

In the rare cases of encephalitis, cerebritis, or cerebral abscesses the CSF may be normal, but often the white blood cell count is mildly raised and the protein level slightly elevated with a low glucose concentration. The Gram film and culture are usually negative. Blood cultures are the main source of the organism in these patients. Primary bacteraemia is more common in men than in women, and occurs most often in patients with haematological malignancy or renal transplants. A few patients develop CNS infection, which has a poor prognosis. Most patients are predisposed by severe underlying illness.

15.4.3 Other symptoms Foodborne outbreaks of acute gastroenteritis with fever have been described. The foods associated with these outbreaks have been diverse, but heavily contaminated by the bacterium. Symptoms develop in 1–2 days. Large numbers of L. monocytogenes are present in the stool, and a few cases develop serious systemic infection. The ability to cause gastroenteritis may be specific to certain strains of L. monocytogenes and this presentation has not been recognised in all foodborne outbreaks. Rarer manifestations of listeriosis include arthritis, hepatitis, endophthalmitis, cutaneous lesions, and peritonitis in patients on continuous ambulatory peritoneal dialysis and endocarditis. The latter infection is almost always predisposed by illness predisposing by prosthetic or damaged natural valves. Pneumonia occurs in renal transplant recipients and other groups of patients.

15.4.4 Treatment and prognosis L. monocytogenes is almost universally susceptible to a wide range of antibiotics in vitro, including ampicillin, penicillin, vancomycin, chloramphenicol, aminoglycosides and co-trimoxazole. There is little agreement about the best treatment, but many patients have been successfully treated with ampicillin or penicillin with or without an aminoglycoside. Cephalosporins are ineffective. No significant change in the antimicrobial susceptibility of L. monocytogenes has been recognised over the past 30 years, and resistance to any of the agents recommended for therapy is unlikely. Approximately 10% of isolates are resistant to tetracycline. The case-fatality rate in late neonatal disease is about 10%. In contrast, the case fatality rates in early disease are 30–60%, and about 20–40% of survivors develop sequelae such as lung disease, hydrocephalus or other neurological defects. Early use of appropriate antibiotics during pregnancy may improve neonatal survival. The case-fatality rate in adult infection is about 20–50% in CNS infection; 5–20% in primary bacteraemia; and 50% in infective endocarditis. About 25–75% of patients surviving CNS infection suffer sequelae such as hemiplegia and other neurological defects.

Listeria

415

15.5 Epidemiology, surveillance, typing and routes of transmission Listeriosis is predominantly a foodborne disease and although most cases are sporadic, outbreaks also occur. The numbers of cases affected in outbreaks varies from 2 to many hundreds (Table 15.4). Investigation of listeriosis and identification of specific food vehicles is probably more problematic than most other infections transmitted via this route. Disease surveillance systems together with the collection of isolated and application of typing (fingerprinting) techniques for L. monocytogenes are essential tools for analysis of listeriosis cases and these are expensive to maintain requiring national (and ideally international) dedicated resources. Because of the long incubation period (up to 90 days), implicated food items are rarely available for microbiological examination and investigation of food consumption histories (especially in the elderly and infirm) can be difficult. The low attack rate (many individuals can consume a contaminated food but few will develop serious disease) together with the predominantly sporadic nature of this disease means that epidemiological approaches, including case control studies, may not necessarily work well. Even during large outbreaks, case control studies have not always identified food vehicles. Because of the long incubation period, extended periods of colonisation of factory sites and national and international distribution of foods, cases related by common source may be both temporally and geographically very widely spread. Outbreaks have occurred and only been recognised because active surveillance was in operation or because the majority of cases presented to a small number of hospitals. Finally because of the low incidence of the disease, active surveillance systems are essential to capture data on a representative proportion of the cases to recognise trends, clusters and other unusual events. Despite difficulties in investigating listeriosis, success has been made since the mid-1980s with disease surveillance systems, development and application of typing techniques for L. monocytogenes and the recognition of common source foodborne outbreaks. Western European countries report infection rates of <1 to >7 cases per million of the population per year (Table 15.5) and a rate of 9.4 cases per million was reported for the USA (Mead et al., 1999). Although these data reflect considerably different surveillance systems and efforts in collection of data, they are likely to reflect true differences in the incidence of the disease, probably due to very different food consumption and processing practices. A range of subtyping methods is available to distinguish between strains of L. monocytogenes. These methods include the more traditional techniques based on phenotypic characters of serotyping, phage typing, and isoenzyme analysis. Phenotypic methods are being superseded by genotypic methods including ribotyping, pulsed field gel electrophoresis (PFGE), amplified fragment length polymorphism analysis and direct DNA sequencing. Some of these molecular methods allow a greater degree of interlaboratory

416

Table 15.4

Outbreaks of human foodborne listeriosis

Country

Year

Food vehicle

USA New Zealand Canada USA

1976 1980 1981 1983

USA

1985

Switzerland UK USA Australia Australia New Zealand France France USA

1983–87 1987–89 1989 1990 1991 1992 1993 1993 1994

Sweden

1994–95

France Italy Canada USA

1995 1997 1996 1998–99

?raw salad ?Shell or raw fish Coleslaw ?Pasteurised whole milk and 2% milk Mexican-style soft cheese made from unpasteurised milk Soft cheese Pâté ?Shrimps* Pâté Smoked mussels Smoked mussels Pork tongue in aspic Pork rillettes Commercially pasteurised chocolate milk Cold-smoked rainbow trout Soft cheese Sweetcorn salad* Crab meat Hot dogs and delicatessen meats

Total

Pregnant

Non-pregnant

With underlying disease

Deaths

20 22 41 49

0 22 34 7

20 0 7 42

10 0 0 42

5 7 18 14

142

93

49

48

30

122 3552 2 9 4 4 279 38 45

65 185 NK NK 0 2 NK 31 1

57 129 NK NK 4 2 NK 7 44

24 NK NK NK 0 2 NK NK 1

34 94 NK NK 0 1 NK 10 0

9

3

6

17 1566 2 50

11 0 0 NK

9 1566 2 NK

2 5 0 NK

4 0 0 >8

Emerging foodborne pathogens

Numbers of cases 1

Table 15.4

Continued Numbers of cases

Country Finland Finland England France USA France USA USA Canada England England England

Food vehicle

1998–99 1999 1999 1999–2000 2000 1999–2000 2000–2001 2001 2002 2003 2003 2003

Butter Cold smoked trout Cheese and cheese and salad sandwich Pork rillettes Turkey meat Pork tongue in jelly Mexican-style soft cheese made from unpasteurised milk Sliced turkey* Soft cheese Butter Sandwiches Sandwiches

? = food implicated through epidemiological study only. information was not available to classify 41 patients. * infection predominantly presented as gastrointestinal with fever 2

Total

Pregnant

Non-pregnant

With underlying disease

Deaths

25 5 2

0 0 0

25 5 2

24 NK 2

6 NK 1

10 29 32 12

3 8 9 10

7 21 23 2

6 NK 11 1

2 7 10 5

16 17 17 2 4

0 3 15 0 4

16 14 2 2 0

NK NK NK 2 0

NK NK NK 0 0

Listeria

1

Year

1

417

418

Emerging foodborne pathogens

Table 15.5 Reported incidence of listeriosis in Europe 2000 or 2001 (data adapted from de Valk et al., 2003) Cases per 106/population Greece, Iceland, Italy, Portugal Austria, Ireland, Netherlands, Spain England and Wales, Germany, Scotland France, Norway Belgium, Finland Denmark, Sweden, Switzerland

<1 1–2 2–3 3–4 4–6 >7

comparability, and successful networks of laboratories have been established using standardised methods for PFGE with automatic pattern comparison of strain databases over the internet (Swaminathan et al., 2001). Although thirteen serogroups (serovars) are recognised, most cases of human listeriosis are caused by serovars 4b, 1/2a and 1/2b. Most, but not all, of the large outbreaks in humans have been due to serovar 4b, and application of further discriminatory typing, such as PFGE analysis, suggests a high degree of similarity between isolates from unrelated large outbreaks. Human listeriosis is transmitted by direct contact with the environment, infected animals or animal material, but these are very rare. Papular or pustular cutaneous lesions have been described, usually on the upper arms or wrists, in farmers or veterinarians 1–4 days after attending bovine abortions. Infection is invariably mild and usually resolves without antimicrobial therapy, although serious systemic involvement has been described (McLauchlin and Low 1994). Conjunctivitis in poultry workers has also been reported. Hospital cross-infection between newborn infants occurs. Typically, an apparently healthy baby (rarely more than one) develops late-onset listeriosis 5–12 days after delivery in a hospital in which an infant with congenital listeriosis was born shortly before. The same strain of L. monocytogenes is isolated from both infants and the mother of early-onset case, but not from the mother of the late-onset case. The cases are usually delivered or nursed in the same or adjacent rooms, and consequently staff and equipment are common to both. There is little evidence of cross-infection or person-toperson transmission outside the neonatal period. The relationship between the feeding of silage to domestic animals and the development of listeriosis has long been realised (Gray and Killinger 1966). This is of particular importance when the pH is greater than 5.5 and the silage is of poor quality or has had prolonged exposure to aerobic conditions (Low and Donachie 1997). Modern practices of producing silage in large polythene covered bales (‘big bale’) favours the growth of L. monocytogenes in comparison with production in the more traditional clamps, and may, in part, explain the recent apparent increase in the incidence of listeriosis in domestic animals in Britain (Low and Donachie 1997).

Listeria

419

As stated previously, the concept that listeriosis is foodborne dates back to 1926 (Pirie 1927) and observations from veterinary medicine in the 1950s and 60s did not receive much attention in the field of human medicine. However following the association between consumption of contaminated food with both outbreaks and sporadic human cases in the 1980s, (Tables 15.1 and 15.6) there is now a general agreement that the consumption of contaminated foods is the principal route of transmission (Farber and Peterkin 1991). L. monocytogenes has been isolated from a very wide range of foods for human consumption, including raw and processed meat, dairy products, vegetables and seafood products as well as from food production and storage environments (see Section 15.6). The ability to grow at refrigeration temperatures and tolerate preserving agents makes Listeria of particular concern if present in refrigerated foods that are consumed without further cooking. Listeria in final products results from either incomplete eradication during processing, or from contamination from sites within the food production Table 15.6 Changes in the rates of L. monocytogenes contamination of foods examined in England and Wales Year

Soft cheese 1987 <1989 1988–89 1989–90 1991–92 1995 19991 Pâté <1989 1989 1989 1989–90 1990 1991–92 1993 1994 20001 20001 20022

Region

London England and Wales England and Wales Cow Goat and ewe North Yorkshire Bristol England and Wales England and Wales England and Wales South Wales England and Wales North Yorkshire England and Wales Bristol England and Wales England and Wales England and Wales North East England England, Wales, Scotland and Northern Ireland

Total number of samples

% with L. monocytogenes Total

102–103/g

>103/g

222 1130

10% 6%

0.5% NK

5% >1%*

1135 617 131 251 1437 356

6% 4% 0 0.4% 1% 0

<0.1% 0 0 0 0 0

1% 0.2% 0 0 0 0

696 216 1698 161 626 40 29 3065 26 72 1178

17% 35% 10% 10% 4% 0.5% 3% 3% 8% 1% 2%

NK 3% 1% 2% 1% 0 0 0.2% 0 0 0

>2%* 7% 2% 0 0.3% 0 0 0.4% 0 1% 0

NK = not known; * some samples enumeration not performed. Date previously presented in McLauchlin 1996, except 1 (CL Little, Health Protection Agency, Cfl, personal communication) and 2 (Elson et al., 2004).

420

Emerging foodborne pathogens

environment. Contamination of food directly from infected animals is probably rare, although L. monocytogenes can cause mastitis in cows in which large numbers of the bacteria can then be shed in the milk (Bourry et al. 1995). However, it is the ability to survive and persist within factory sites and contaminate foods during processing and handling that has been identified as of prime importance in causing large foodborne outbreaks. Microbiological and epidemiological evidence supports an association with many food types (dairy, meat, vegetable, fish and shellfish) in both sporadic and epidemic listeriosis (Table 15.4). Foods associated with transmission often show common features: of the ability to support the growth of L. monocytogenes (relatively high water activity and near-neutral pH); relatively heavy contamination (>103 organisms per g) with the implicated strain; processed with an extended (refrigerated) shelf life; consumed without further cooking. Outbreaks of human listeriosis involving >100 individuals have occurred, some lasting for several years. This is likely to represent a long-term colonisation of a single site in the food manufacturing environment as well as the long incubation periods shown by some patients. Sites of contamination within food processing facilities involved in human infection have included wooden manufacturing equipment, slicing machinery, wooden and metallic shelving, porous conveyor belts, food residues, cool-room condensates and floor drains; one outbreak of listeriosis was also associated with reconstruction within the food manufacturing environment. L. monocytogenes survives well in moist environments with organic material, and it is from such sites that contamination of food occurs during processing.

15.6

Growth and isolation of Listeria

Listeria spp. grow well on a wide variety of non-selective laboratory media, hence culture from normally sterile sites such as blood or cerebrospinal fluid does not require special media. For specimens such as faeces, vaginal secretions, food and environmental samples, special selective media are necessary. Prior to the mid-1980s, ‘cold enrichment’, utilising the ability of Listeria to outgrow competing organisms at refrigeration temperatures in non-selective broths, was the main method used for selective isolation (Gray and Killinger 1966). When growing on transparent media illuminated by oblique transmitted light and viewed at low magnification (‘Henry’ illumination technique) all Listeria colonies have a characteristic blue colour with a central ‘ground glass’ appearance. However, because of the degree of skill required in recognising characteristic colonies, the lack of specificity and the slowness of these methods (some workers subcultured broths for up to six months), the emergence of listeriosis in 1980s resulted in much improved methodologies. Media have been developed that rely on a number of selective agents, these include: acriflavin, lithium chloride, colistin, ceftazidime, cefotetan, fosfomycin, moxolactam, nalidixic acid, cycloheximide and polymyxin. Such

Listeria

421

media have resulted in the widespread ability of microbiology laboratories (especially those involved with the examination of foods) to selectively isolate Listeria. Numerous enrichment and selective isolation media have now been developed. Those mentioned here (or modifications of these) are used most frequently for the examination of foods. For selective broths: US Food and Drugs Administration (FDA) method (Lovett et al. 1987), the US Department of Agriculture (USDA) method (McClain and Lee 1988), or the Netherlands Government Food Inspection Service (NGFIS) method described by Van Netten et al. (1989) are most often used. Selective agars most frequently used are those of Curtis et al. (1989; ‘Oxford’ formulation) or the PALCAM agar (named after an acronym of the ingredients, polymyxin B, acriflavine, lithium chloride, ceftazidime, aesculin and mannitol) of Van Netten et al. (1989). These media are listed in internationally agreed standard methods (Anon. 1996b), which can also be use for quantification of the levels of Listeria contamination in an individual food (Anon. 1998). All Listeria species are isolated by these methods and are morphologically indistinguishable from each other. To differentiate L. monocytogenes from other Listeria species on selective agars, substrates have been added to selective media to detect phospholipase (Notermans et al.,1991) or b-glucosidase and enhanced haemolysis (Beumer et al. 1997). Selective media, based on lipase and b-glucosidase activity, which successfully differentiates L.monocytogenes from populations of other Listeria species, are now commercially available (Vlaemynck et al. 2000). Non-cultural techniques such as those based upon immunoassays and the polymerase chain reaction are used increasingly for the detection of Listeria in enrichment broths for the examination of foods. L. monocytogenes has been isolated from numerous types of raw, processed, cooked and ready-to-eat foods, usually at levels below 10 organisms per g. As outlined in section 15.3, the properties favour transmission through food and a wide variety of food and food matrices will support the growth of this bacterium, which, especially towards the end of an extended shelf-life can become very heavily contaminated. Such ‘problem’ foods types which support the growth of L. monocytogenes include soft cheese, milk, pâté, frankfurters and other sausages, cooked meat and poultry, smoked fish and shellfish, processed vegetables and some cut fruit including melon. Examples of rates of contamination for two of these ‘problem’ food types examined in the UK are given in Table 15.6, and these are further discussed in Section 15.7. Growth can be localised within specific areas of an individual food, either because of the source of contamination (i.e. within cut or contact surfaces or where raw herbs and spices have been added) or because of the physicochemical properties of the foods such as in the areas of higher pH associated with the rind or with mould growth within a soft cheese. The unusual tolerance of the bacterium to sodium chloride and sodium nitrite, and the ability to multiply (albeit slowly) at refrigeration temperatures makes L. monocytogenes of particular concern as a post-processing contaminant in

422

Emerging foodborne pathogens

long-shelf-life refrigerated foods. The widespread distribution of L. monocytogenes and the ability to survive on dry and moist surfaces favours post-processing contamination of foods from both raw product and factory sites.

15.7

Prevention and control

Control measures for human listeriosis principally rely on the successful exclusion of L. monocytogenes from the food chain. However, since not all foods undergo a Listeria-cidal process this is not practicable, hence all reasonable steps should be implemented to prevent contamination and reduce the multiplication of the organism by adequate temperature and shelf-life control at all stages, hygiene of environmental and factory sites, and quality of raw materials. In addition, a strong education programme should be implemented covering the properties of Listeria and consequences of listeriosis to all those involved with the food production distribution and retailing. During the past two decades, the food industry has been active in investigating Listeria in foods and the factory environment, and implementing control measures (especially HACCP and pathogen monitoring) for this bacterium. The success of these measures is reflected in reductions in the extent of contamination of foods on retail sale in the England and Wales (Table 15.6). In the USA, reductions in the incidence of human listeriosis have also been attributed to industry ‘clean up’ (Tappero et al. 1995). A consideration of food regulation and Listeria contamination is outside the scope of this chapter. However, national regulatory bodies have come to quite different positions (even for different food types within a single country) ranging from an overall zero tolerance, to accommodation of certain levels of contamination together with considerations on shelf-life and the ability of the food to support the growth of the organism. Considerable efforts have been directed towards quantitative risk assessments (Anon. 1999, 2001) and it is envisaged that these will provide a better foundation for identifying the most appropriate interventions, to better inform food regulators, and provide a more rational basis for the formulation of food safety objectives. The final strategy for control of listeriosis is by advice to vulnerable groups. Dietary advice has been given out to vulnerable groups in the UK and USA (Table 15.7). Similar advice has been give in other countries including France, Australia and New Zealand. This advice is certainly prudent, although efforts must be made to continually reinforce it. It is clearly not possible to warn vulnerable groups against all food types associated with infection, and a balance must be made between providing sensible guidance allowing individuals to make informed choices, and scare mongering. Targeting of advice to the general public and attitudes to risk are outside the scope of this chapter, however dietary advice is no substitute for controlling the organism in the food chain. To date there has been limited investigation on the assessment of how effective dietary advice is for controlling listeriosis.

Listeria

423

Table 15.7 Dietary advice for the prevention of listeriosis. (Advice from Anon. 1992, 1994, 1996a) USA

UK

Advice to the general public Cook thoroughly raw food from animal sources such as beef, pork and poultry Wash raw vegetables thoroughly before eating. Keep uncooked meats separate from vegetables and from cooked foods and ready-to-eat foods. Avoid raw (unpasteurised) milk or foods made from raw milk. Wash hands, knives and cutting boards after handling uncooked foods.

Advice for at-risk groups Cook until steaming hot left-over foods or ready-to-eat foods such as hot dogs before eating. Avoid soft cheese such as feta, brie, camembert, blue-veined and Mexican style cheese. Hard cheeses, processed cheese, cottage cheese or yogurt need not be avoided. Raw vegetables should be thoroughly washed before eating. Although the risk of listeriosis associated with foods from deli counters is relatively low, pregnant women and immunosuppressed persons may choose to avoid these foods or thoroughly reheat cold cuts before serving.

15.8

Keep foods for as short a time as possible, follow the storage instructions carefully and observe the ‘best by’ and ‘eat by’ dates on the label. Do not eat undercooked poultry or meat products. Make sure you reheat cookedchilled meals thoroughly and according to the instructions on the label. Wash salad, fruit and vegetables that will be eaten raw. Make sure that your refrigerator is working properly and keep foods stored in it really cold. When reheating food, make sure that it is piping hot all the way through and do not reheat more than once. When using a microwave oven to cook or reheat food, observe the standing times recommended by the oven manufacturer to ensure that food attains an even temperature before it is eaten. Throw away left-over food. Cooked food which is not eaten straight away should be cooled as rapidly as possible and stored in the refrigerator. Pregnant women and anyone with low resistance to infection should not eat soft ripened cheeses of the brie, camembert or blue veined types. Nor should they eat pâté. Any bought cooked-chilled meals or readyto-eat poultry should be reheated until piping hot. Do not eat them cold.

Future trends

The bacterium L. monocytogenes continues to demonstrate its ability to cause considerable morbidity, and is now recognised as one of the major foodborne pathogens. Not only do the properties of the organism favour

424

Emerging foodborne pathogens

transmission through foods, but changes in eating habits to consumption of more ready-to-eat foods which are less well preserved but highly processed with extended refrigerated shelf-lives also favours this disease. Demographic changes will inevitably result in increased at risk and susceptible populations (e.g. the immunocompromised and elderly) and although dietary advice can be given to these groups, this is no substitute for controlling the organism in the food chain. Better recognition of this pathogen and vastly improved diagnostic procedures have allowed a huge body of information to be amassed on the distribution, behaviour and susceptibility to environmental challenges of L. monocytogenes. As has been demonstrated in the UK, application of control measures throughout the food chain (including the application of HACCP) have resulted in a dramatic reduction in the levels of contamination of foods on retail sale, although constant attention to food processes and control of L. monocytogenes contamination is an essential on-going responsibility of the food industry. Changes in food processing technology together with ever increasing food globalisation (both of raw materials and distribution of finished products) will present different and changing challenges for the control of this bacterium. It is likely that improvements in quantitative risk assessments will result in more harmonised food regulation with respect to L. monocytogenes contamination, which will also allow freer international trade. Better awareness of food safety and continued education of all involved with the food chain concerning the properties of L. monocytogenes are essential for the continued and improved control of listeriosis.

15.9

Sources of information and advice

15.9.1 General review articles on Listeria Bille J, Rocourt J (1996) WHO International Multicenter Listeria monocytogenes subtyping study: rationale and set-up of the study. Int J Food Microbiol, 32, 251–262. Buchrieser C, Rusniok C, Kunst F, Cossart P, Glaser P; Listeria Consortium. (2003) Comparison of the genome sequences of Listeria monocytogenes and Listeria innocua: clues for evolution and pathogenicity. FEMS Immunol Med Microbiol, 35, 207–213. Charpentier E, Courvalin P (1999) Antibiotic resistance in Listeria spp. Antimicrobial Agents Chemoth, 43, 2103–2108. Collins MD, Wallbanks S, Lane DJ, Shah J, Nietupski R, Smida J, Dorsch M, Stackebrandt E (1991) Phylogenetic analysis of the genus Listeria based on reverse transcriptase sequencing of 16S rRNA. Int J Syst Bacteriol 41, 240–246. Donnelly CW (2001) Listeria monocytogenes: a continuing challenge. Nutr Rev, 59, 183–194.

Listeria

425

Doyle ME, Mazzotta AS, Wang T, Wiseman DW, Scott VN (2001) Heat resistance of Listeria monocytogenes. J Food Prot 64, 410–429. Farber JM, Peterkin PI (1991) Listeria monocytogenes, a food-borne pathogen. Microbiol Rev 55, 476–511. Gray ML, Killinger AH (1966) Listeria monocytogenes and listeric infections. Bacteriol Rev 30, 309–382. Huss HH, Jorgensen LV, Vogel BF (2000) Control options for Listeria monocytogenes in seafoods. Int J Food Microbiol, 62: 267–274. Kathariou S (2002) Listeria monocytogenes virulence and pathogenicity, a food safety perspective. J Food Prot, 65: 1811–1829. Low JC, Donachie W (1997) A review of Listeria monocytogenes and listeriosis. Vet J 153, 9–29. McLauchlin J (1996) The relationship between Listeria and listeriosis. Food Control 7, 187–193. McLauchlin J (1997) The pathogenicity of Listeria monocytogenes: a public health perspective. Rev Med Microbiol, 8, 1–14. Rocourt J, BenEmbarek P, Toyofuku H, Schlundt J (2003) Quantitative risk assessment of Listeria monocytogenes in ready-to-eat foods: the FAO/ WHO approach. FEMS Immunol Med Microbiol, 35, 263–267. Ryser ET, Marth EH eds (1998) Listeria, Listeriosis, and Food Safety, second edition, Marcel Dekker, New York. Schuchat A, Deaver KA, Wenger JD, Plikaytis BD, Mascola L, Pinner RW, Reingold AL, Broome CV (1992) Role of foods in sporadic listeriosis. I. Case-control study of dietary risk factors. The Listeria Study Group. JAMA, 267: 2041–2045. Schuchat A, Swaminathan B, Broome CV (1991) Epidemiology of human listeriosis. Clin Microbiol Rev, 4, 169–183. Schlech WF. (1991) Listeriosis: epidemiology, virulence and significance of contaminated foodstuffs. J Hosp Infect 19, 211–224. Schlech WF (1997) Listeria gastroenteritis – old syndrome, new pathogen. N Engl J Med, 336: 130–132. Tappero JW, Schuchat A, Deaver KA, Mascola L, Wenger JD (1995) Reduction in the incidence of human listeriosis in the United States. Effectiveness of prevention efforts? J Am Med Assoc 273, 1118–1122. Tompkin RB (2002) Control of Listeria monocytogenes in the food-processing environment. J Food Prot, 65, 709–725. Vazquez-Boland JA, Kuhn M, Berche P, Chakraborty T, Dominguez-Bernal G, Goebel W, Gonzalez-Zorn B, Wehland J, Kreft J (2001) Listeria pathogenesis and molecular virulence determinants. Clin Microbiol Rev, 14, 584–640. WHO. Foodborne disease: a focus for health. 2000, WHO Geneva.

15.9.2 General information and public health data Centres for Disease Control and Prevention, USA

426

Emerging foodborne pathogens

http://www.cdc.gov/ncidod/dbmd/diseaseinfo/listeriosis_g.htm U.S. Food & Drug Administration, Center for Food Safety & Applied Nutrition, USA http://vm.cfsan.fda.gov/~mow/chap6.html Health protection Agency, UK http://www.hpa.org.uk/infections/topics_az/listeria/gen_inf.htm World Health Organisation, risk assessment. http://www.who.int/foodsafety/micro/jemra/assessment/listeria/en/print.html FAO Expert consultation on the trade impact of Listeria in fish products http://www.fao.org/DOCREP/003/X3018E/X3018E00.HTM

15.9.3 Microbiological media, identification and detection systems http://www.chromagar.com/products/listeria.html http://www.laboratorytalk.com/news/oxo/oxo157.html http://www.qualicon.com/pressreleases/pr_baxomalm.html http://service.merck.de/microbiology/ http://industry.biomerieux-usa.com/industry/food/api/apiproducts.htm http://www.800ezmicro.com/productPubs.asp?mb=01&ez=61

15.10

References

ADAK GK, LONG SM, O’BRIEN SJ

(2002) Trends in indigenous foodborne disease and deaths, England and Wales: 1992 to 2000. Gut, 51, 832–841. ANON. (1992) Centers for Disease Control/National Center for Infectious Disease. Preventing foodborne listeriosis. USDHHS PHS May 1992, Atlanta, Georgia, USA. ANON. (1994) Ministry of Agriculture, Fisheries and Foods. Food Sense No 1. Food Safety. PB0551 London. ANON. (1996a) Department of Health. While you are pregnant: how to avoid infection from food and from contact with animals. H15/005 812 1P Sept 96. ANON. (1996b) International standard Microbiology of food and animal feeding stuffs: horizontal method for the detection and enumeration of Listeria monocytogenes, part 1 detection method ISO 11290-1 1996 (E). British Standards Institute, London. ANON. (1998) International Standard Microbiology of food and animal feeding stuffs: horizontal method for the detection and enumeration of Listeria monocytogenes, part 2 enumeration method ISO 11290-2 1998 (E). British Standards Institute, London. ANON. (1999). Codex Alimentarium Commission. Principals and guidelines for the conduct of microbial risk assessment (CAC/GL-30, 1999). http://www.fao.org/docrep/004/y1579e/y1579e05.htm ANON. (2001) Draft Assessment of the Relative Risk to Public Health for Food-borne Listeria monocytogenes among selected categories of ready to eat foods. http://www.foodsafety.gov/~dms/lmrisk.html BEUMER RR, TE GIFFEL MC, COX LJ (1997) Optimization of haemolysis in enhanced haemolysis agar (EHA) – a selective medium for the isolation of Listeria monocytogenes. Lett Appl Microbiol 24, 421–425. BOURRY A, POUTREL B, ROCOURT J (1995) Bovine mastitis caused by Listeria monocytogenes: characteristics of natural and experimental infections. J Med Microbiol 43, 125–132.

Listeria

427

COLLINS MD, WALLBANKS S, LANE DJ, SHAH J, NIETUPSKI R, SMIDA J, DORSCH M, STACKEBRANDT E

(1991) Phylogenetic analysis of the genus Listeria based on reverse transcriptase sequencing of 16S rRNA. Int J Syst Bacteriol 41, 240–246. CUMMINS AJ, FIELDING AK, MCLAUCHLIN J (1994) Listeria ivanovii infection in a patient with AIDS. J Infect, 28, 89–91. CURTIS GDW, MITCHELL RG, KING AF GRIFFIN EJ (1989) A selective differential medium for the isolation of Listeria monocytogenes. Lett Appl Microbiol 8, 95–98. ELSON R, BURGESS F, LITTLE CL, MITCHELL RT (2004) Microbiological examination of readyto-eat cold sliced meats and pâté from catering and retail premises in the United Kingdom. J Appl Microbiol, 96: 499–509. FARBER JM, PETERKIN PI (1991) Listeria monocytogenes, a food-borne pathogen. Microbiol Rev 55, 476–511. GLASER P, FRANGEUL L, BUCHRIESER C, et al. (2001) Comparative genomics of Listeria species. Science 294, 849–852. GRAY ML, KILLINGER AH (1966) Listeria monocytogenes and listeric infections. Bacteriol Rev 30, 309–382. LOVETT J, FRANCIS DW, HUNT JM (1987) Listeria monocytogenes in raw milk: detection, incidence and pathogenicity. J Food Prot, 50, 188–192. LOW JC, DONACHIE W (1997) A review of Listeria monocytogenes and listeriosis. Vet J 153, 9–29. MACKEY BM, BRATCHELL N (1989) The heat resistance of Listeria monocytogenes. Lett Appl Microbiol 9, 89–94. McCLAIN D, LEE WH (1988) Development of the ‘USDA-FSIS’ method for isolation of Listeria monocytogenes from raw meat and poultry. J Assoc Off Anal Chem 71, 660– 664. McLAUCHLIN J (1996) The role of the PHLS in the investigation of listeriosis during the 1980s and 1990s. Food Control 7, 235–239. McLAUCHLIN J (1997) The pathogenicity of Listeria monocytogenes: a public health perspective. Rev Med Microbiol 8, 1–14. McLAUCHLIN J, LOW C (1994) Primary cutaneous listeriosis in adults: An occupational disease of veterinarians and farmers. Vet Rec, 135, 615–617. MEAD PS, SLUTSKER L, DIETZ V, MCCAIG LF, BRESEE JS, SHAPIRO C, GRIFFIN PM, TAUXE RV (1999) Food-related illness and death in the United States. Emerg Infect Dis, 5, 607–625. MURRAY EGD, WEBB RA, SWANN MBR (1926) A disease of rabbits characterised by a large mononuclear leucocytosis, caused by a hitherto undescribed bacillus Bacterium monocytogenes (n.sp.). J Pathol Bacteriol 29, 407–439. NOTERMANS SH, DUFRENNE J, LEIMEISTER-WACHTER M, DOMANN E, CHAKRABORTY T (1991). Phosphatidylinositol-specific phospholipase C activity as a marker to distinguish between pathogenic and nonpathogenic Listeria species. Appl Environ Microbiol 57, 2666– 2670. PIRIE JHH (1927) ‘A new disease of veld rodents, “Tiger River Disease” ’ Publ S Afr Inst Med Res, 3, 163-186. PIRIE JHH (1940) Listeria: change of name for a genus of bacteria. Nature (London) 145, 264. ROCOURT J, SCHRETTENBRUNNER A, HOF H, ESPAZE EP (1987) Une nouvelle espèce du genre Listeria: Listeria seeligeri. Pathol Biol 35, 1075–1080. RYSER ET, MARTH EH eds (1998) Listeria, Listeriosis, and Food Safety, second edition, Marcel Dekker, New York. SWAMINATHAN B, BARRETT TJ, HUNTER SB, TAUXE RV and The CDC PulseNet Task Force (2001) PulseNet: the molecular subtyping network for foodborne bacterial disease surveillance, United States. Emerg Infect Dis, 7, 382–389. TAPPERO JW, SCHUCHAT A, DEAVER KA, MASCOLA L, WENGER JD (1995) Reduction in the incidence of human listeriosis in the United States. Effectiveness of prevention efforts? J Am Med Assoc 273, 1118–1122.

428

Emerging foodborne pathogens

DE VALK H, JACQUET C, GOULET V, et al. (2003) Feasibility study for a collaborative surveillance

of Listeria infections in Europe. Report to the European Commission, DGSANCO, Paris. VAN NETTEN P, PERALES I, VAN DE MOOSDIJK A, CURTIS GD, MOSSEL DA (1989) Liquid and solid selective differential media for the detection and enumeration of L. monocytogenes and other Listeria spp. Int J Food Microbiol, 8, 299–316. VAZQUEZ-BOLAND JA, KUHN M, BERCHE P, CHAKRABORTY T, DOMINGUEZ-BERNAL G, GOEBEL W, GONZALEZ-ZORN B, WEHLAND J, KREFT J (2001) Listeria pathogenesis and molecular virulence determinants. Clin Microbiol Rev, 14, 584–640. VLAEMYNCK G, LAFARGE V, SCOTTER S (2000) Improvement of the detection of Listeria monocytogenes by the application of ALOA, a diagnostic, chromogenic isolation medium. J Appl Microbiol, 88, 430–441. WALKER JK, MORGAN JH, McLAUCHLIN J, GRANT K, SHALLCROSS JA (1994) Listeria innocua isolated from a case of ovine meningoencephalitis. Vet Microbiol 42, 245–253.

Helicobacter pylori

429

16 Helicobacter pylori S. F. Park, University of Surrey, UK

16.1

Introduction

The genus Helicobacter was created in 1989 with Helicobacter pylori as the type species. Since this time, the genus has expanded to include about 18 species (Owen, 1998). An essential diagnostic feature of nearly all helicobacters is the possession of a sheathed flagellum with most also being urease positive and microaerophilic. It seems likely that a majority, if not all, mammals carry Helicobacter species as part of the indigenous biota of their gastric contents (Lecoindre et al., 2000; Fox and Lee, 1997). Whilst helicobacters are traditionally associated with the stomach, increasingly they are also being isolated from extragastric niches within the mammalian body including the intestinal tracts of humans, animals, and birds (On et al., 2002). In addition, certain species have been isolated from diseased livers in mice, and one of these H. hepaticus, has been linked to the formation of liver tumours in these animals (Fox, 1997). H. pylori, however, is primarily associated with the human stomach. Indeed, much evidence suggests that it may actually be part of indigenous microflora of this environment and that this has been the case for at least tens of thousands of years (Blaser, 1998; Ghose et al., 2002; Falush et al., 2003). It is remarkable then, that it was not until 1982, when Marshall and Warren (1984) isolated H. pylori (then designated Campylobacter pyloridis) as a novel Gram negative spiral shaped bacterium from humans with gastric ulcers, that the significance of this species became apparent. Today the pathogenicity of H. pylori disease is well proven and the scope of infection and illness around the world known to be vast, it being the most prevalent bacterial infection among humans. Estimates suggest that as many as 50% of the world’s population may be infected (Goodwin et al., 1997; Lambert et

430

Emerging foodborne pathogens

al., 1995). In countries with low socio-economic status the prevalence of carriage may even be as high as 60% in childhood and 80–90% in elderly people (Brown, 2000). In most infected individuals (~80%), H. pylori does not generate clinical symptoms yet can remain as a persistent infection over a lifetime. However, some 10–20% of infected persons subsequently develop gastric hyperacidity and peptic ulcers. In the United States alone some five million people are diagnosed with ulcers (Sonnenberg and Everhart, 1997). An even smaller, yet significant, proportion of persons (0.1–0.4%) develop distal gastric adenocarcinoma and as a consequence of this H. pylori infection is designated as a class I carcinogen in human gastric cancer (Anon., 1994). The human gastrointestinal tract is thought to be the principal reservoir for infection by H. pylori (Axon, 1996). The mode of transmission, however, has not yet been fully elucidated as epidemiological studies have been impeded by the difficulty of isolating this fastidious organism from food, water and other environmental sources. The finding of helicobacters in nonhuman sources such as livestock (Vaira et al., 1992), vegetables (Hopkins et al., 1993), milk (Fujimura et al., 2002) and water (Hegarty et al., 1999) suggests that food and water may play at least some role in transmission. Consequently, the aim of this chapter is to consider the likelihood that H. pylori is an emerging foodborne pathogen and its main focus, therefore, will be a consideration of actual reports of its isolation from food and its physiology, in terms of its ability to survive in food and water. In addition, because of its association with food and water, the review will also consider the protocols available for the culture of H. pylori from food and water samples, and the use of alternative strategies for its detection in these environments.

16.2

Physiology and growth requirements

H. pylori is a member of the epsilon sub group of the proteobacteria, and as such, is closely related to Campylobacter jejuni a leading cause of foodborne illness (Park, 2002). One characteristic it shares with C. jejuni, and one which hampered its initial isolation, is its fastidious growth requirements. Notably, this species will grow well only in microaerobic environments (5– 10% oxygen) and in carbon dioxide enriched atmospheres (Goodwin and Armstrong, 1990; Xia et al., 1993). Even when provided with these environments, and an optimal growth incubation temperature (35–37 ∞C), growth of the bacterium is very slow and generally from its first isolation 3– 4 days are required before colonies become apparent. Other environmental factors also place restrictions on the growth of the organism and are likely to limit its growth in food. For example, growth of H. pylori can occur only between 33 to 40.5 ∞C (Goodwin and Armstrong, 1990) and at pH4.5 or above (Jiang and Doyle, 1998). The organism is sensitive to sodium chloride,

Helicobacter pylori

431

failing to grow in 2% NaCl, and the minimum aw for growth is between 0.96 and 0.98 (Jiang and Doyle, 1998). H. pylori strains are auxotrophic for several amino acids with some diversity existing in these requirements (Nedenskov, 1994; Reynolds and Penn, 1994). A genome scale metabolic model, which takes into account the genome sequence annotation (Tomb et al., 1997) and physiological data, calculates that of a set 47 metabolites are necessary for growth. Eight of these are amino acids with L-arginine and alanine thought to provide the major sources of carbon (Schilling et al., 2002). However, the requirement for this element can also be met by other compounds including glucose, pyruvate, lactate, malate, fumarate, succinate, a-ketoglutarate and several other amino acids. Notably, of the amino acids that are required for growth, six are also essential amino acids in the human diet. It seems H. pylori may have evolved to selectively utilise these since the host’s nutritional needs, and the subsequent proteolysis of food sources, would generally guarantee their presence in the human gastric environment (Schilling et al., 2002).

16.3

Disease associations and mechanisms of virulence

Whilst many individuals infected with H. pylori remain asymptomatic over a lifetime, in a significant number of cases H. pylori causes gastritis, gastric and duodenal ulcers (Blaser, 1995). Infection is also a significant risk factor for gastric malignancies (Nomura et al., 1991; Uemura et al., 2001). As a consequence of the severe nature of these disease syndromes, and the high incidence of H. pylori infection, this pathogen, its virulence factors and its interaction with the human host have been the focus of intensive research for over two decades. Many recent reviews (Moran et al., 2002; Boquet et al., 2003; Sachs et al., 2003; Prinz et al., 2003; Blaser and Atherton, 2004) have focused in detail on this area, and since a detailed assessment of this is beyond the scope of this review, only the major virulence mechanisms will be considered here. 16.3.1 Mechanisms of acid resistance required for survival in the stomach Because of its specialised niche, one of the major challenges faced by H. pylori is survival and growth in the acidic environment of the human stomach. In the laboratory, however, the pathogen behaves as a neutralophile and accordingly, does not survive well below pH4.0. It is now clear that in order to grow at low pH, H. pylori has evolved, not a general acid resistance mechanism, but one that operates specifically in the unique niche of the human stomach. This mechanism centres on the Ni2+ containing cytoplasmic enzyme urease that converts urea to ammonia and carbon dioxide. H. pylori in fact produces higher activities of urease than any other microbe known

432

Emerging foodborne pathogens

(Mobley et al., 1995) and therefore it is not surprising that this was one the first virulence factors to be identified (Sachs et al., 2003). The role of this cytoplasmic enzyme in acid tolerance is to generate ammonia, which subsequently diffuses into the periplasm, buffering it against the low pH and increasing the membrane potential to allow growth (Scott et al., 1998). This is one of the primary acid tolerance mechanisms of H. pylori and consequently urease activity is essential for survival in the stomach of animal models (Tsuda et al., 1994). However, while this constitutes a highly effective acid tolerance mechanism, it can also be detrimental since urease activity is toxic to H. pylori at neutral pH (Clyne et al., 1995). As a defence against this, H. pylori urease is active only at low pH where its expression is beneficial. Uniquely, control of urease activity occurs at the level of substrate access to the enzyme and urea specific channels in the inner membrane only open at pH values below 6.5 (Weeks et al., 2000). Accordingly, the substrate is only delivered to the enzyme when its activity will not be toxic to the cell. A number of other acid tolerance mechanisms do exist but these are of less importance and are outlined in detail in Sachs et al., (2003).

16.3.2 Toxins and interaction with host epithelial cells The virulence of many pathogens is associated with the production of toxins which interact with host cells to potentiate disease. The observation that H. pylori culture supernatants induce the formation of large vacuoles in eukaryotic cells, led to the discovery of the vacuolating toxin, VacA (Leunk et al., 1988). This high molecular weight pore-forming toxin, which causes massive vacuolation in susceptible cells (Papini et al., 1994), is one of the primary virulence factors for H. pylori. The gene encoding VacA is present in all strains, yet production of the toxin varies significantly (Atherton et al., 1995). This is one of the most fully characterised virulence factors, and while many activities have been proposed for VacA (Papini et al., 2001; Boquet et al., 2003), its role in vivo has not yet been fully elucidated. Recently, however, two independent groups have shown that VacA induces epithelial cell apoptosis (Kuck et al., 2001; Cover et al., 2003) The role of this toxin in virulence may, therefore, be in the destruction of parietal cells, which are the acid producing cells in the stomach. The death of these cells, and the concomitant reduction in stomach HCl production may facilitate enhanced colonisation (Salama et al., 2001; Boquet et al., 2003). Another common paradigm of bacterial pathogenicity is the interaction of bacterium with host cells via the elaboration of specific effector proteins. These generally bring about directed changes in the biology of the host that are of benefit to the pathogen. For H. pylori, the identification of a strain specific gene termed cagA (Cover et al., 1990), which later became recognised as a marker for strains that have increased risk of generating peptic ulcer disease (Nomora et al., 2002) and gastric cancer (Blaser et al., 1995), eventually led to the discovery of such a mechanism. The cagA gene was later found to

Helicobacter pylori

433

be part of a larger pathogenicity island (a 40 kbp DNA insertion into the chromosomal glutamate racemase gene) (Censini et al., 1996) which also encodes a type IV secretion system (Tummuru et al., 1995). It is now known that H. pylori uses the type IV secretion system to inject CagA, and probably other macromolecules, into gastric epithelial cells. Once inside the host cell, the translocated CagA becomes phosphorylated and initiates a number of changes that affect spreading migration and adhesion (Segal et al., 1999).

16.3.3 Adhesion to host tissue Adhesion to host tissue plays an important role in the initial colonisation process for a variety of bacterial pathogens. For H. pylori such contact with host gastric epithelium is beneficial as it prevents removal by mucosal shedding and also gives the bacterium access to nutrients derived from the damaged host epithelium. Not surprisingly, H. pylori possesses a number of proteins that facilitate adhesion. BabA, for example is an adhesion factor that enables this pathogen to bind specifically to Lewis blood group antigens (Ilver et al., 1998). Notably, the target for BabA seems to differ depending on the predominance of blood group in a particular population since South American Indian strains bind blood group O antigens best and this specialisation coincides with the unique predominance of blood group O in these people (AspholmHurtig et al., 2004). Another adhesin, SabA, enables the bacterial cell to bind to inflamed, but not healthy mucosa or Lewis antigens. Since such tissue is normally encountered only during chronic inflammation, and this is often a hallmark of persistent H. pylori infection, this protein might contribute extraordinary chronicity of infection (Mahdavi et al., 2002). One of the emerging aspects of H. pylori virulence, that separates it from other well characterised bacterial pathogens, is the fact that isolates possess an extremely high degree of phenotypic and genotypic diversity. As a consequence of this, different strains induce varying host inflammatory responses, and these in turn, influence the clinical outcome (Lamarque and Peek, 2003; Blaser and Atherton, 2004). In fact, the extent of this variation is so extreme that in effect, each host is colonised by a fluid bacterial gene pool that is, not a single clone, but a mixture of closely related strains (Kuipers et al., 2000). This may be an adaptation to the fact that each individual human host offers distinct and different gastric microenvironments. Since these will be differentially selective and manifold, conventional phenotypic adaptation may be impossible, and in this situation only highly plastic cell populations may be able give rise to individual cell-types suited to some of these environments. This mechanism of extreme genetic variation, in concert with the heterogeneous selection imposed by the host, may enable H. pylori to persist in multiple niches in the stomach of one individual, and to colonise essentially all members of the human race despite its heterogeneous nature (Blaser and Atherton, 2004).

434

16.4

Emerging foodborne pathogens

Epidemiology and routes of transmission

16.4.1 Person to person transmission H. pylori infection is thought to be acquired mainly in childhood and persists throughout life unless specific treatment is applied (Jones and Sherman, 1998; Rowland, 2000). Although definitive routes of transmission have not yet been established, intra-familial infection, with mother to child or sibling to sibling contact, is considered significant (Rothenbacher et al., 2002; RomaGiannikou et al., 2003). Indeed, in experimental systems where Rhesus Macaques have been used to examine natural acquisition, H. pylori infection is most likely acquired from the mother, and since infants from infected dams are more commonly infected, close contact may facilitate infection (Solnick et al., 2003). Outside of the close-knit family situation, however, there is little evidence to suggest that child-child transmission occurs (Tindberg et al., 2001). Numerous studies have suggested that low socio-economic status, including overcrowding and poor sanitation in childhood (Mendall et al., 1992), is a major risk factor for infection. In these environments, H. pylori infection has been correlated with reduced susceptibility to gastro-enteritis. Here the strong negative association between H. pylori infection and this illness is most likely caused by prior exposure to, and thus acquired immunity to other enteric pathogens (Perry et al., 2004). H. pylori has been isolated from faeces (Thomas et al., 1992: Kelly et al., 1994) and also dental plaque (Krajden et al., 1989; Majmudar et al., 1990) though whether faecal-oral or oral-oral transmission occurs has not yet been clearly established. However, there is some evidence that this organism may be transmitted by saliva since a study by Megraud et al., (1995) demonstrated that a risk factor for H. pylori infection is the eating of premasticated foods. Also, if this route is important then the risk of infection may be higher in individuals where occupational exposure to saliva and dental plaque is frequent. In the context, a number of studies have examined the prevalence of H. pylori in dentists but with conflicting outcomes (Honda et al., 2001; Matsuda et al., 2002). H. pylori can be readily cultured from induced vomitus and air contaminated following its emission. The organism can also be isolated from induced stools (Parsonnet et al., 1999). However, since the organism is difficult to isolate from normal stools (Parsonnet et al., 1999), but readily isolated from naturally produced vomitus (Leung et al., 1999), the organism is potentially transmissible during episodes of gastrointestinal tract illness, particularly where vomiting is apparent. Endoscopes are frequently contaminated with H. pylori immediately after gastroduodenal endoscopy and since the pathogen can survive manual cleaning (Nurnberg et al., 2003) the potential for iatrogenic transmission is high. Whilst transmission by contaminated endoscopes or instruments has been reported (Graham et al., 1988; Langenberg et al., 1990) this is preventable

Helicobacter pylori

435

if effective disinfection regimes are followed (Cronmiller et al., 1999). Whilst iatrogenic transmission is the only proven mode of transmission (Fantry et al., 1995), given the high rate of infection in individuals who have not undergone endoscopy and that the rate of infection by this route may approximate to four per one thousand endoscopies (Tytgat, 1995), this pathway is unlikely to constitute a numerically significant mode of transmission.

16.4.2 The potential for zoonotic or vector borne transmission Gastric Helicobacter species, other than H. pylori, are widespread in mammals and have been reported in various wild and domestic mammals of different dietary habits such as cats (Paster et al., 1991; Lecoindre et al., 2000), small mammals (Goto et al.,1998) pigs (De Groote et al., 1999), dogs (Hanninen et al., 1996) and avian hosts (Waldenstrom et al., 2003) including poultry (Atabay et al., 1998). In contrast, members of this genus have not yet been isolated from goats which has led to the suggestion that these animals are naturally resistant to Helicobacter infection (Gueneau et al., 2002). H. pylori is primarily a human-specific inhabitant but there are a number of reports that have associated this bacterium with non-human sources including livestock (Vaira et al.,1992). H. pylori has also been associated with domestic cats (Handt et al., 1994) and since the organism has been cultured from salivary and gastric secretions (Fox et al., 1996), the possibility exists that it could be transmitted from cats to humans. The existence of such a route of infection, however, remains contentious since there is no evidence of H. pylori carriage in stray cats which have little contact with humans. Consequently, it has been suggested that infection in domesticated cats may be an anthroponosis, an animal infection with a human pathogen (El-Zaatari et al., 1997). More recently, the organism has been isolated from sheep tissue and therefore sheep may be another potential zoonotic source for H. pylori (Dore et al., 2001). The close association of certain insects with human habitats has led to the suggestion that insects, infected with H. pylori, are a possible route of transmission. Two factors in particular appear to make house flies an ideal vector. Firstly, the mid-mid gut is acidic, like the human stomach, and could potentially select for H. pylori. Secondly, flies must regurgitate their gastric contents to facilitate feeding. H. pylori DNA has been detected in wild house flies (Grubel et al., 1998), and the organism can be cultured from experimentally infected flies for at least 30 hours after inoculation (Grubel et al., 1997). However, since house flies do not appear to acquire H. pylori readily from fresh human faeces (Osato et al.,1998) their role in transmission of this pathogen is believed to be limited. Similarly, cockroaches are also a common insect within the home and environment and since they also habitually infiltrate food-keeping areas, they have also been implicated in H. pylori transmission. Indeed, whilst transmission by contaminated external body parts does not occur, experimentally infected cockroaches can contaminate the environment

436

Emerging foodborne pathogens

through the spreading of contaminated excreta (Imamura et al., 2003) suggesting that cockroaches are also a potential vector. 16.4.3 The potential for foodborne transmission From the above it can be seen that H. pylori has been associated with various animals, and since these include livestock, there is a possibility that it can enter the food chain via this route. For example, DNA from H. pylori has been detected in cow faeces (Sasaki et al., 1999) and thus contaminated beef could potentially serve as a vector. However, a study which assayed over one hundred beef samples did not isolate H. pylori (Stevenson et al., 2000a), suggesting that transmission from beef and beef products is not likely to be a primary factor for the high prevalence of human infection. Similarly, pigs have the potential to carry the organism since gnotobiotic pigs were the first animals to be experimentally infected with H. pylori (Krakowka et al., 1987). However, H. pylori was not isolated from pigs or pork in an extensive survey (Stevenson and Acuff, 1999) and epidemiological evidence does not support the role of pork as a vehicle. One strict Muslim country, that does not farm pigs, has a very high prevalence of H. pylori infection (Megraud et al., 1989). In contrast, epidemiological evidence does suggest a role for sheep in H. pylori transmission since shepherds in Sardinia have an unusually high carriage rate of 98% (Dore et al., 1999a). Freshly collected non-pasteurised sheep’s milk has been implicated, therefore, as a vehicle particularly since both H. pylori DNA and culturable cells have been detected in this food (Dore et al., 1999b; Dore et al., 2001). Whether sheep or raw sheep’s milk do represent a significant and widespread vector, however, is not yet clear since a similar study, in which 440 raw sheep’s milk samples from the Burdur region of Turkey were assessed, did not isolate the organism (Turutoglu and Mudul, 2002). Raw, but not pasteurised cows’ milk, has also been implicated as a possible vehicle following the culture of H. pylori from this food in a Japanese study (Fujimura et al., 2002). However, since a separate study from the US failed to detect either DNA or viable cells in milk (Jiang and Doyle, 2002) the role of raw milk as a major vehicle is unclear. In countries of low socio-economic status, contamination of irrigation water by raw sewage, and the subsequent contamination of vegetables that are eaten uncooked, is thought to be a key factor in the transmission of enteric pathogens. Since H. pylori has been isolated from faeces (Thomas et al., 1992: Kelly et al.,1994) it may be transmitted by a faecally contaminated foods. However, whilst the consumption of uncooked vegetables has been correlated with an increased risk of infection in Chile (Hopkins et al., 1993), the organism has not yet been cultured from any raw vegetable. 16.4.4 The potential for waterborne transmission The presence of H. pylori DNA in water raises the suspicion that water might be one of the vehicles of infection. It has, for example, been detected in river

Helicobacter pylori

437

water (Fujimura et al., 2004), drinking water (Hulten et al., 1996), surface water (Benson et al., 2004) and seawater (Cellini et al., 2004). In addition, fluorescent in situ hybridisation has been used to detect H. pylori cells in river and wastewater (Moreno et al., 2003) and actively respiring microorganisms binding monoclonal anti-H. pylori antibody appear to be common in surface and shallow groundwater samples (Hegarty et al., 1999). To date, however, there is only one report concerning the culture of H. pylori from water and this followed the specific isolation of the organism from raw sewage using immunomagnetic separation (Lu et al., 2002). Accordingly, the contamination of environmental water by sewage is a possible route of transmission. H. pylori DNA appears to be present in poor quality potable waters (Hulten et al., 1996; Bunn et al., 2002), and well waters (Horiuchi et al., 2001; Mazari-Hiriart et al., 2001). As a consequence, drinking water may be a reservoir for H. pylori in areas of the developing world where water quality is poor but whether or not H. pylori can survive in treated water systems is a matter of debate. An early study suggested that this micro-organism is very sensitive to the chlorine used in water treatment plants and implied that H. pylori can be controlled by disinfection practices normally employed in the treatment of drinking water (Johnson et al., 1997). This finding is supported by the fact that H. pylori does not survive well in tap water (Fan et al., 1998), and by a number of recent studies that have failed to detect H. pylori DNA in treated waters (Horiuchi et al., 2001; Mazari-Hiriart et al., 2001). More recently though, it has been suggested that H. pylori can tolerate chlorinebased disinfectants better than the classical faecal indicator Escherichia coli, a finding that increases the likelihood of waterborne transmission in developed countries (Baker et al., 2002). Indeed one study has detected DNA from Helicobacter species in water associated biofilms in pipes used to carry treated drinking water (Park et al., 2001). However, since the identity of this DNA has not been confirmed by DNA sequencing the species may not be H. pylori.

16.5 Detection methods and culture from clinical samples, food and water Discrete strategies for the detection of H. pylori have been developed for environmental and clinical samples. Since the focus of this chapter is the potential for foodborne transmission, the detection and isolation of H. pylori from food will be considered in detail and its clinical detection will be considered only briefly. 16.5.1 Diagnostic tests and detection in clinical samples At present endoscopy represents the gold standard for the diagnosis of

438

Emerging foodborne pathogens

H. pylori disease in the clinical situation but the invasive nature of this procedure limits its routine use. In response to this, a number of non-invasive methods such as stool antigen tests and DNA detection in saliva samples are increasingly used (Versalovic, 2003; Bonamico et al., 2004). The specific use of PCR for detecting H. pylori in saliva or faeces is reviewed by Kabir (2004). While the culture of H. pylori is desirable for diagnosis in patients with suspected infection, again it is not generally suitable for routine use because samples from gastric biopsies are most commonly used. Consequently, because they are more easily obtainable and less invasive, alternative sampling procedures using stools, vomitus, saliva, and dental plaque are being explored. A timely review of the methods used to culture H. pylori from such clinical samples has been compiled by (Ndip et al., 2003). The natural habitat of H. pylori is the human stomach where the secretion of hydrochloric acid serves to eliminate many bacteria. Since H. pylori has the unique ability to grow here, its isolation from samples from this environment generally only requires media containing minimal selective agents because of the lack of competing bacterial species. Solid plating media commonly used are based on Columbia agar, brain heart infusion agar or charcoal based agar. These are invariably supplemented with various forms of blood or serum to enhance growth (Goodwin et al., 1985; Dent and McNulty, 1988; Henriksen et al., 1995; Jiang and Doyle, 2000). In addition, numerous broths have been used to culture H. pylori but there is no convincing evidence that any particular one provides a superior growth environment (Stevenson et al., 2000b).

16.5.2 Detection in food and water The isolation of H. pylori from food, water and environmental samples is complicated by the presence of mixed microbial populations. Several selective media have been specifically developed for the recovery of H. pylori from such samples (Stevenson et al., 2000c; Degnan et al., 2003). These are based on H. pylori special peptone agar (Stevenson et al., 2000b) in which the inclusion of special peptone and calf serum with iron, promotes growth (Degnan et al., 2003). As a consequence, colony size is increased (Stevenson et al., 2000b) and this in turn, leads to faster visual identification. While H. pylori is able to thrive in the stomach at low pH and in the presence of urea, these conditions do not provide appropriate selection because they allow the growth of other bacteria (Stevenson et al., 2000c). Consequently, antibiotics are commonly used for selection. In this context, a combination consisting of vancomycin amphotericin B, cefsulodin, polymyxin B sulfate, trimethoprim and sulfamethoxazole is highly selective but still allows H. pylori to grow (Stevenson et al., 2000c). A selective media developed for the isolation of H. pylori from water also contains amphotericin B and polymixin B as selective agents, and has the additional benefit of a colour indicator system, which

Helicobacter pylori

439

detects urease activity, and which reduces the time required to detect growth of colonies (Degnan et al., 2003). Whilst H. pylori DNA has been detected frequently in environmental waters (Hulten et al., 1996; Benson et al., 2004; Cellini et al., 2004 Fujimura et al., 2004), recovery of the bacterium from these samples has remained elusive. This might be due to the fact that the bacterium is in fact not able to survive in such environments or because recovery parameters, such as the media composition and the incubation atmosphere, are not adequate for colony formation. Furthermore, because of the fastidious nature of this pathogen, and its sensitivity to stress, it is possible that cells from such environments are sub-lethally damaged, and while still viable, are unable to recover on unspecialised laboratory media. In this context, the finding that half-strength media gives higher recoveries than standard media suggests that nutrient shock is an important factor hampering the isolation of H. pylori from dilute environments (Azevedo et al., 2004).

16.6

Survival in food and water

Whether food acts as a significant vehicle for H. pylori infection is not clear at present. What is more certain is that given its fastidious growth requirements (see Section 16.2), including limits imposed by growth temperature requirements and its microaerophilic nature, H. pylori is unlikely to grow in food (Jiang and Doyle, 1998). Nevertheless, if the organism is introduced into foods, it can survive for extended periods in low acid, high moisture environments under refrigerated storage (Jiang and Doyle, 1998) and is likely therefore, to remain infective. In experimentally contaminated foods including milk and tofu it can be recovered for up to five days at 4 ∞C (Poms and Tatini, 2001). In contrast, it appears to survive less well in raw chicken and lettuce and in these environments it is possible that the lack of protection against oxidation and desiccation, potentiates the death of H. pylori. A similar mechanism may explain the limited survival seen in experimentally contaminated ground beef (Stevenson et al., 2000a). While the organism has been shown to grow in ground beef this occurs only in experimental situations, where a microaerobic atmosphere and enrichment broth are provided (Jiang and Doyle, 2002). An additional factor that may limit the survival of H. pylori in certain types of food, is that the organism does not survive freezing well (Ohkusa et al., 2004).

16.6.1 The role of viable non-culturable states in transmission In aquatic and food environments pathogenic bacteria, which most often grow optimally at the temperature of their host, and which also generally have fastidious requirements for nutrients, often encounter stress in the form of starvation, and osmotic and temperature stresses. As a consequence of

440

Emerging foodborne pathogens

these stresses certain bacteria may enter a viable non-culturable (VNBC) state. This concept, of a bacterium that remains infectious but that can no longer be cultured by conventional means, was first proposed by Colwell following a study on the survival of Salmonella in aquatic systems (Roszak et al., 1984). It has been proposed that in this state, bacteria may retain metabolic activity, yet are unable of undergoing the cellular division under the prevailing environmental conditions. Many bacterial species also alter morphology as they enter this state (Nilsson et al., 1991). Clearly, the presence of a VNBC form of H. pylori would have significant ramifications for the detection and epidemiology of this pathogen and it may explain the difficulty encountered during attempts to isolate the organism from environmental samples. During infection and recovery on laboratory media, the majority of H. pylori cells present are actively dividing spiral shaped cells (Warren and Marshall, 1983). Under certain environmental conditions, however, such as exposure to air (Catrenich and Makin, 1991), prolonged incubation (Shahamat et al., 1993) and oxygen limitation (Donelli et al., 1998), H. pylori cells undergo transition from rods to cocci, similar to the conversion to the VNC form seen in other bacteria. These coccoid forms have also been observed in the human stomach where they are closely associated with damaged gastric mucous cells (Janas et al., 1995). The significance of the these forms, however, remains obscure and whilst various studies indicate viability on the basis of the LIVE/DEAD BacLight viability assay (Adams et al., 2003), the reduction of tetrazolium salts by oxidative metabolism (Gribbon and Barer, 1995; Cellini et al., 1998) and the ability to take up tritium labelled thymidine (Shahamat et al., 1993), others suggest that the coccoids merely represent a morphological manifestation of cellular degeneration and death (Kusters et al., 1997). A recent study has suggested that whilst the coccoid form represents the VBNC state generated as cells age in laboratory media, when the VBNC form is induced by exposure to natural fresh water environments, it occurs as rod-shaped cells (Adams et al., 2003). The existence of a VBNC form may be controversial but cells, which are not recoverable on media, rapidly produce ATP and synthesise mRNA in response to a stimulus provided by lysed human erythrocytes (Nilsson et al., 2002) and thus at least seem capable of responding to external stimuli and inducing gene expression accordingly.

16.7

Conclusions and future trends

H. pylori, being the most common bacterial infection world-wide, has globally profound social and economic consequences. However, even today, over 15 years since its discovery, we are only just beginning to understand this pathogen and its mechanisms of transmission. Our understanding of how H. pylori cause illness is far from complete and consequently, this aspect of their biology will remain an intense area of

Helicobacter pylori

441

future research (the likely direction of this research has been considered by Moran et al., (2002) and Prinz et al., (2003)) since it has the potential to generate improved therapeutic treatments. Emerging research, however, suggests that the decision to use such agents to eradicate this organism in an infected but symptomless individual to prevent progression of the illness may be complicated. In this context, whilst it is well known that the presence of H. pylori can lead to diseases such as peptic ulcers and distal gastric cancer, there is accumulating evidence that its absence is associated with increased risk for cancers of the oesophagus (Chow et al., 1998). These findings pose important questions related to the removal of this pathogen from infected, but otherwise healthy individuals, and the resolution of this question is likely to form the focus of future research. The availability of the complete genome sequence for H. pylori (Tomb et al., 1997), and the availability of microarrays will allow the response of this pathogen to environmental stresses, such as those encountered in food and water to be mapped in intricate detail and this may lead to a better understanding of its ability to survive in these environments. Already, for example, the global responses of H. pylori to acid stress (Ang et al., 2001) and iron limitation (Merrell et al., 2003) have been mapped using this technique. Understanding the route of H. pylori transmission is important if measures are to be implemented to prevent its spread. For the general population the most likely route of transmission seems to be from person to person either through oral to oral or faecal-oral mechanisms. Although there is some debate which of these is significant most researchers agree that infection is acquired by close contact with infected people in early childhood. However, it has been suggested that H. pylori infection is the consequence of a multiple pathway phenomenon and accordingly, the possibility of other transmission routes cannot be excluded. Thus, at present, food and water have to be considered as potential vehicles. As a consequence of its fastidious nature, H. pylori is not likely to grow in foods. Nevertheless, a number of reports have suggested that it does survive in certain foods and if it exists in a VNC state in these environments this might lead to an underestimation of its prevalence in food and water. Given the failure of many studies to detect H. pylori DNA or isolate the organism from common foods such as meats and vegetables, though, it is unlikely that any food type represents a primary vector. Furthermore, given the possible vectors of infection, such as saliva, faeces and insects, the measures which are already used by food establishments and industry to control the spread of other foodborne bacterial pathogens are likely to be highly effective against H. pylori.

16.8

Sources of further information

Two of the most comprehensive and detailed accounts of H. pylori biology are Achtman and Suerbaum (2001) and Mobley et al., (2001). Obviously,

442

Emerging foodborne pathogens

these contain far more information than could reasonably be considered here, and as standard references for this fascinating pathogen, these are an excellent source for further study. Readers will also find many smaller but useful reviews that focus on individual aspects of the biology of H. pylori such as pathogenicity and virulence (Moran et al., 2002; Boquet et al., 2003; Sachs et al., 2003; Prinz et al., 2003; Blaser and Atherton, 2004), and their gastric biology and mechanisms of acid resistance (Sachs et al., 2003). A general collection of protocols for detection, molecular epidemiology and molecular manipulation of H. pylori can be found in Clayton and Mobley (1997). More specifically, non-invasive methods for detection such as stool antigen tests and DNA detection in saliva samples are reviewed in Versalovic (2003), Bonamico et al., (2004), and Kabir (2004). A recent review of the methods used to culture H. pylori from clinical samples has been compiled by Ndip et al., (2003). Finally, Helicobacter (www.blackwellpublishing.com/ journal.asp?ref = 1083-438) is a scientific journal dedicated to these intriguing organisms.

16.9

References

ACHTMAN, M.

and SUERBAUM S. eds (2001) Helicobacter pylori: Molecular and Cellular Biology, Horizon Scientific Press, Norwich, UK. ADAMS, B.L., BATES, T.C. and OLIVER, J.D. (2003) Survival of Helicobacter pylori in a natural freshwater environment. Appl Environ Microbiol 69, 7462–6. ANG, S., LEE, C.Z., PECK, K., SINDICI, M., MATRUBUTHAM, U., GLEESON, M.A. and WANG J.T. (2001) Acid-induced gene expression in Helicobacter pylori: study in genomic scale by microarray. Infect Immun 69, 1679–86. ANON. (1994) International Agency for Research on Cancer (IARC) Working Group on the Evaluation of Carcinogenic Risks to Humans. Helicobacter pylori. In: Schistosomes, liver flukes, and Helicobacter pylori: views and expert opinions of the IARC Working Group on the Evaluation of Carcinogenic Risks to Humans. Lyon, France. ASPHOLM-HURTIG, M., DAILIDE, G., LAHMANN, M., KALIA, A., ILVER, D., ROCHE, N., VIKSTROM, S., SJOSTROM, R., LINDEN, S., BACKSTROM, A., LUNDBERG, C., ARNQVIST, A., MAHDAVI, J., NILSSON, U.J., VELAPATINO, B., GILMAN, R.H., GERHARD, M., ALARCON, T., LOPEZ-BREA, M., NAKAZAWA, T., FOX, J.G., CORREA, P., DOMINGUEZ-BELLO, M.G., PEREZ-PEREZ, G.I., BLASER, M.J., NORMARK, S., CARLSTEDT, I., OSCARSON, S., TENEBERG, S., BERG, D.E. and BOREN, T. (2004) Functional adaptation of BabA, the H. pylori ABO blood group antigen binding adhesin. Science 305, 519–22. ATABAY, H.I., CORRY, J.E. and ON S.L. (1998) Identification of unusual Campylobacter-like isolates from poultry products as Helicobacter pullorum. J Appl Microbiol 84, 1017– 24. ATHERTON, J.C., CAO, P., PEEK JR, R.M., TUMMURU, M.K.R., BLASER, M.J. and COVER, T.L. (1995) Mosaicism in vacuolating cytotoxin alleles of Helicobacter pylori: association of specific vacA types with cytotoxin production and peptic ulceration. J Biol Chem 270, 17771–7. AXON, A.T. (1996) The transmission of Helicobacter pylori: which theory fits the facts? Eur J Gastroenterol Hepatol 8, 1–2. AZEVEDO, N.F., PACHECO, A.P., KEEVIL, C.W. and VIEIRA, M.J. (2004) Nutrient shock and incubation atmosphere influence recovery of culturable Helicobacter pylori from water. Appl Environ Microbiol 70, 490–3.

Helicobacter pylori BAKER, K.H., HEGARTY, J.P., REDMOND, B., REED, N.A.

443

and HERSON D.S. (2002) Effect of oxidising disinfectants (chlorine, monochloramine, and ozone) on Helicobacter pylori. Appl Environ Microbiol 68, 981–4. BENSON, J.A., FODE-VAUGHAN, K.A. and COLLINS, M.L. (2004) Detection of Helicobacter pylori in water by direct PCR. Lett Appl Microbiol 39, 221–5. BLASER, M.J. (1995) The role of Helicobacter pylori in gastritis and its progression to peptic ulcer disease. Aliment Pharmacol Ther 9, Suppl 1, 27–30. BLASER, M.J. (1998) Helicobacters are indigenous to the human stomach: duodenal ulceration is due to changes in gastric microecology in the modern era. Gut 43, 721–7. BLASER, M.J. and ATHERTON, J.C. (2004) Helicobacter pylori persistence: biology and disease. J Clin Invest 113, 321–33. BLASER , M. J., PEREZ-PEREZ , G . I., KLEANTHOUS, H ., COVER , T . L., PEEK, R. M., CHYOU, P. H ., STEMMERMANN, G.N. and NOMURA, A. (1995) Infection with Helicobacter pylori strains possessing cagA is associated with an increased risk of developing adenocarcinoma of the stomach. Cancer Res 55, 2111–5. BONAMICO, M., STRAPPINI, P.M., BONCI, E., FERRI, M., CRISOGIANNI. M., GUIDO, M., THANASI, E., NENNA, R., MACCHIA, S., LUZZI, I., MAGLIOCCA, F.M. and MASTROMARINO, P. (2004) Evaluation of stool antigen test, PCR on ORAL samples and serology for the noninvasive detection of Helicobacter pylori infection in children. Helicobacter 9, 69–76. BOQUET, P., RICCI, V., GALMICHE, A. and GAUTHIER, N.C. (2003) Gastric cell apoptosis and H. pylori: has the main function of VacA finally been identified? Trends Microbiol 11, 410–3. BROWN, L.M. (2000) Helicobacter pylori: epidemiology and routes of transmission. Epidemiol Rev 22, 283–97. BUNN, J.E, MACKAY, W.G., THOMAS, J.E., REID, D.C. and WEAVER, L.T. (2002) Detection of Helicobacter pylori DNA in drinking water biofilms: implications for transmission in early life. Lett Appl Microbiol 34, 450–4. CATRENICH, C.E. and MAKIN, K.M. (1991) Characterisation of the morphologic conversion of Helicobacter pylori from bacillary to coccoid forms. Scand J Gastroenterol Suppl 181, 58–64. CELLINI, L., ROBUFFO, I., DI CAMPLI, E., DI BARTOLOMEO, S., TARABORELLI, T. and DAINELLI, B. (1998) Recovery of Helicobacter pylori ATCC43504 from a viable but not culturable state: regrowth or resuscitation? APMIS 106, 571–9. CELLINI, L., DEL VECCHIO, A., DI CANDIA, M., DI CAMPLI, E., FAVARO, M. and DONELLI, G. (2004) Detection of free and plankton-associated Helicobacter pylori in seawater. J Appl Microbiol 97, 285–92. CENSINI, S., LANGE, C., XIANG, Z., CRABTREE, J.E., GHIARA, P., BORODOVSKY, M., RAPPUOLI, R. and COVACCI, A. (1996) cag, a pathogenicity island of Helicobacter pylori, encodes type Ispecific and disease-associated virulence factors. Proc Natl Acad Sci USA 1996 93, 14648–53. CHOW, W.H., BLASER, M.J., BLOT, W.J., GAMMON, M.D., VAUGHAN, T.L., RISCH, H.A., PEREZ-PEREZ, G.I., SCHOENBERG, J.B., STANFORD, J.L., ROTTERDAM, H., WEST, A.B. and FRAUMENI JR J.F. (1998) An inverse relation between cagA+ strains of Helicobacter pylori infection and risk of oesophageal and gastric cardia adenocarcinoma. Cancer Res 58, 588–90. CLAYTON, C.L. and MOBLEY, H.L.T. eds (1997) Helicobacter pylori Protocols, Methods in Molecular Medicine, 8, Humana Press, Totowa, USA. CLYNE, M., LABIGNE, A. and DRUMM, B. (1995) Helicobacter pylori requires an acidic environment to survive in the presence of urea. Infect Immun 63, 1669–73. COVER, T.L., DOOLEY, C.P. and BLASER, M,J. (1990) Characterization of and human serologic response to proteins in Helicobacter pylori broth culture supernatants with vacuolizing cytotoxin activity. Infect Immun 58, 603–10. COVER, T.L., KRISHNA, U.S., ISRAEL, D.A. and PEEK JR, R.M. (2003) Induction of gastric epithelial cell apoptosis by Helicobacter pylori vacuolating cytotoxin. Cancer Res 63, 951–7. CRONMILLER, J.R., NELSON, D.K., JACKSON, D.K., and KIM, C.H. (1999) Efficacy of conventional

444

Emerging foodborne pathogens

endoscopic disinfection and sterilisation methods against Helicobacter pylori contamination. Helicobacter 4, 198–203. DEGNAN, A.J., SONZOGNI, W.C. and STANDRIDGE, J.H. (2003) Development of a plating medium for selection of Helicobacter pylori from water samples. Appl Environ Microbiol 69, 2914–8. DE GROOTE, D., VAN DOORN, L.J., DUCATELLE, R., VERSCHUUREN, A., HAESEBROUCK, F., QUINT, W.G., JALAVA, K. and VANDAMME P. (1999) ‘Candidatus Helicobacter suis’, a gastric Helicobacter from pigs, and its phylogenetic relatedness to other gastrospirilla. Int J Syst Bacteriol 49, 1769–77. DENT, J.C. and MCNULTY, C.A. (1988) Evaluation of a new selective medium for Campylobacter pylori. Eur J Clin Microbiol Infect Dis 7, 555–8. DONELLI, G., MATARRESE, P., FIORENTINI, C., DAINELLI, B., TARABORELLI, T., DI CAMPLI, E., DI BARTOLOMEO, S. and CELLINI, L. (1998) The effect of oxygen on the growth and cell morphology of Helicobacter pylori. FEMS Microbiol Lett 168, 9–15. DORE, M.P., BILOTTA, M., VAIRA, D., MANCA, A., MASSARELLI, G., LEANDRO, G., ATZEI, A., PISANU, G., GRAHAM, D.Y. and REALDI, G. (1999a) High prevalence of Helicobacter pylori infection in shepherds. Dig Dis Sci 44, 1161–4. DORE, M.P., SEPULVEDA, A.R., OSATO, M.S., REALDI, G. and GRAHAM, D.Y. (1999b) Helicobacter pylori in sheep milk. Lancet 354, 132 DORE, M.P., SEPULVEDA, A.R., EL-ZIMAITY, H., YAMAOKA, Y., OSATO, M.S., MOTOTSUGU, K., NIEDDU, A.M., REALDI, G. and GRAHAM D.Y. (2001) Isolation of Helicobacter pylori from sheep – implications for transmission to humans. Am J Gastroenterol 96, 396–401. EL-ZAATARI, F.A., WOO, J.S., BADR, A., OSATO, M.S., SERNA, H., LICHTENBERGER, L.M., GENTA R.M. and GRAHAM D. Y. (1997) Failure to isolate Helicobacter pylori from stray cats indicates that H. pylori in cats may be an anthroponosis – an animal infection with a human pathogen. J Med Microbiol 46, 372–6. FALUSH, D., WIRTH, T., LINZ, B., PRITCHARD, J.K., STEPHENS, M., KIDD, M., BLASER, M.J., GRAHAM, D.Y., VACHER, S., PEREZ-PEREZ, G.I., YAMAOKA, Y., MEGRAUD, F., OTTO, K., REICHARD, U., KATZOWITSCH, E., WANG, X., ACHTMAN, M. and SUERBAUM, S. (2003) Traces of human migrations in Helicobacter pylori populations. Science 299, 1582–5. FAN, X.G., CHUA, A., LI, T.G. and ZENG, Q.S. (1998) Survival of Helicobacter pylori in milk and tap water. J Gastroenterol Hepatol 13, 1096–8. FANTRY, G.T., ZHENG, Q.X. and JAMES, S.P. (1995) Conventional cleaning and disinfection techniques eliminate the risk of endoscopic transmission of Helicobacter pylori. Am J Gastroenterol 90, 227–32. FOX, J.G. (1997) The expanding genus of Helicobacter: pathogenic and zoonotic potential. Semin Gastrointest Dis 8, 124–41. FOX, J.G. and LEE, A. (1997) The role of Helicobacter species in newly recognised gastrointestinal tract diseases of animals. Lab Anim Sci 47, 222–55. FOX, J.G., PERKINS, S., YAN, L., SHEN, Z., ATTARDO, L. and PAPPO, J. (1996) Local immune response in Helicobacter pylori-infected cats and identification of H. pylori in saliva, gastric fluid and faeces. Immunology 88, 400–6. FUJIMURA, S., KAWAMURA, T., KATO, S., TATENO, H. and WATANABE, A. (2002) Detection of Helicobacter pylori in cow’s milk. Lett Appl Microbiol 35, 504–7. FUJIMURA, S., KATO, S. and KAWAMURA T. (2004) Helicobacter pylori in Japanese river water and its prevalence in Japanese children. Lett Appl Microbiol 38, 517–21. GHOSE, C., PEREZ-PEREZ, G.I., DOMINGUEZ-BELLO, M.G., PRIDE, D.T., BRAVI, C.M. and BLASER, M.J. (2002) East Asian genotypes of Helicobacter pylori strains in Amerindians provide evidence for its ancient human carriage. Proc Natl Acad Sci USA. 99, 15107–11. GOODWIN, C.S. and ARMSTRONG, J.A. (1990) Microbiological aspects of Helicobacter pylori (Campylobacter pylori). Eur J Clin Microbiol Infect Dis 9, 1–13. GOODWIN, C.S., BLINCOW, E.D., WARREN, J.R., WATERS, T.E., SANDERSON, C.R. and EASTON L. (1985) Evaluation of cultural techniques for isolating Campylobacter pyloridis from endoscopic biopsies of gastric mucosa. J Clin Pathol 38, 1127–31.

Helicobacter pylori GOODWIN, C.S., MENDALL, M.M.

445

and NORTHFIELD, T.C. (1997) Helicobacter pylori infection. Lancet 349, 265–9. GOTO, K., OHASHI, H., EBUKURO, S., ITOH, K., TOHMA, Y., TAKAKURA, A., WAKANA, S., ITO, M. and ITOH, T. (1998) Isolation and characterisation of Helicobacter species from the stomach of the house musk shrew (Suncus murinus) with chronic gastritis. Curr Microbiol 37, 44–51. GRAHAM, D.Y., ALPERT, L.C., SMITH, J.L. and YOSHIMURA H.H. (1988) Iatrogenic Campylobacter pylori infection is a cause of epidemic achlorhydria. Am J Gastroenterol 183, 974–80. GRIBBON, L.T. and BARER, M.R. (1995) Oxidative metabolism in nonculturable Helicobacter pylori and Vibrio vulnificus cells studied by substrate-enhanced tetrazolium reduction and digital image processing. Appl Environ Microbiol 61, 3379–84. GRUBEL, P., HOFFMAN, J.S., CHONG, F.K., BURSTEIN, N.A., MEPANI, C. and CAVE D.R. (1997) Vector potential of houseflies (Musca domestica) for Helicobacter pylori. J Clin Microbiol 35, 300–3. GRUBEL, P., HUANG, L., MASUBUCHI, N., STUTZENBERGER, F.J. and CAVE D.R. (1998) Detection of Helicobacter pylori DNA in houseflies (Musca domestica) on three continents. Lancet. 352, 788–9. GUENEAU, P., FUENMAYOR, J., ARISTIMUNO, O.C., CEDENO, S., BAEZ, E., REYES, N., MICHELANGELI, F. and DOMINGUEZ–BELLO, M.G. (2002) Are goats naturally resistant to gastric Helicobacter infection? Vet Microbiol 84, 115–21. HANDT, L.K., FOX, J.G., DEWHIRST, F.E., FRASER, G.J., PASTER, B.J., YAN, L.L., ROZMIAREK, H, RUFO, R. and STALIS I.H. (1994) Helicobacter pylori isolated from the domestic cat: public health implications. Infect Immun 62, 2367–74. HANNINEN, M.L., HAPPONEN, I., SAARI, S. and JALAVA K. (1996) Culture and characteristics of Helicobacter bizzozeronii, a new canine gastric Helicobacter sp. Int J Syst Bacteriol 46, 160–6. HEGARTY, J.P., DOWD, M.T. and BAKER, K.H. (1999) Occurrence of Helicobacter pylori in surface water in the United States. J Appl Microbiol 87, 697–701. HENRIKSEN, T.H., BRORSON, O., SCHOYEN, R., THORESEN, T., SETEGN, D. and MADEBO, T. (1995) Rapid growth of Helicobacter pylori. Eur J Clin Microbiol Infect Dis 14, 1008–11. HONDA, K., OHKUSA, T., TAKASHIMIZU, I., WATANABE, M. and AMAGASA, M. (2001) High risk of Helicobacter pylori infection in young Japanese dentists. J Gastroenterol Hepatol 16, 862–5. HOPKINS, R.J., VIAL, P.A., FERRECCIO, C., OVALLE, J., PRADO, P., SOTOMAYOR, V., RUSSELL, R.G., WASSERMAN, S.S. and MORRIS JR, J.G. (1993) Seroprevalence of Helicobacter pylori in Chile: vegetables may serve as one route of transmission. J Infect Dis 168, 222–6. HORIUCHI, T., OHKUSA, T., WATANABE, M., KOBAYASHI, D., MIWA, H. and EISHI, Y. (2001) Helicobacter pylori DNA in drinking water in Japan. Microbiol Immunol 45, 515–9. HULTEN, K., HAN, S.W., ENROTH, H., KLEIN, P.D., OPEKUN, A.R., GILMAN, R.H., EVANS, D.G., ENGSTRAND, L., GRAHAM, D.Y. and EL-ZAATARI F.A. (1996) Helicobacter pylori in the drinking water in Peru. Gastroenterology 110, 1031–5. ILVER, D., ARNQVIST, A., OGREN, J., FRICK, I.M., KERSULYTE, D., INCECIK, E.T., BERG, D.E., COVACCI, A., ENGSTRAND, L. and BOREN T. (1998) Helicobacter pylori adhesin binding fucosylated histo-blood group antigens revealed by retagging. Science 279, 373–7. IMAMURA, S., KITA, M., YAMAOKA, Y., YAMAMOTO, T., ISHIMARU, A., KONISHI, H., WAKABAYASHI, N., MITSUFUJI, S., OKANOUE, T. and IMANISHI, J. (2003) Vector potential of cockroaches for Helicobacter pylori infection. Am J Gastroenterol 98, 1500–3. JANAS, B., CZKWIANIANC, E., BAK-ROMANISZYN, L., BARTEL, H., TOSIK, D., PLANETA-MALECKA, I. (1995) Electron microscopic study of association between coccoid forms of Helicobacter pylori and gastric epithelial cells. Am J Gastroenterol 90, 1829–33. JIANG, X. and DOYLE, M.P. (1998) Effect of environmental and substrate factors on survival and growth of Helicobacter pylori. J Food Prot 61, 929–33. JIANG, X. and DOYLE M.P. (2000) Growth supplements for Helicobacter pylori. J Clin Microbiol 38, 1984–7.

446

Emerging foodborne pathogens

JIANG, X.

and DOYLE, M.P. (2002) Optimising enrichment culture conditions for detecting Helicobacter pylori in foods. J Food Prot 65, 1949–54. JOHNSON, C.H., RICE, E.W. and REASONER, D.J. (1997) Inactivation of Helicobacter pylori by chlorination. Appl Environ Microbiol 63, 4969–70. JONES, N.L. and SHERMAN, P.M. (1998) Helicobacter pylori infection in children. Curr Opin Pediatr 10, 19–23. KABIR, S. (2004) Detection of Helicobacter pylori DNA in faeces and saliva by polymerase chain reaction: a review. Helicobacter 9, 115–23. KELLY, S.M., PITCHER, M.C., FARMERY, S.M. and GIBSON, G.R. (1994) Isolation of Helicobacter pylori from faeces of patients with dyspepsia in the United Kingdom. Gastroenterology 107, 1671–4. KRAJDEN, S., FUKSA, M. ANDERSON, J., KEMPSTON, J., BOCCIA, A., PETREA, C., BABIDA, C., KARMALI, M., and PENNER, J.L. (1989) Examination of human stomach biopsies, saliva, and dental plaque for Campylobacter pylori. J Clin Microbiol 27, 1397–8. KRAKOWKA, S., MORGAN, D.R., KRAFT, W.G. and LEUNK, R.D. (1987) Establishment of gastric Campylobacter pylori infection in the neonatal gnotobiotic piglet. Infect Immun 55, 2789–96. KUCK, D., KOLMERER, B., IKING-KONERT, C., KRAMMER, P.H., STREMMEL, W. and RUDI, J. (2001) Vacuolating cytotoxin of Helicobacter pylori induces apoptosis in the human gastric epithelial cell line AGS. Infect Immun 69, 5080–7. KUIPERS, E.J., ISRAEL, D.A., KUSTERS, J.G., GERRITS, M.M., WEEL, J., VAN DER ENDE, A., VAN DER HULST, R.W., WIRTH, H.P., HOOK-NIKANNE, J., THOMPSON, S.A. and BLASER M.J. (2000) Quasispecies development of Helicobacter pylori observed in paired isolates obtained years apart from the same host. J Infect Dis 181, 273–82. KUSTERS, J.G., GERRITS, M.M., VAN STRIJP, J.A. and VANDENBROUCKE-GRAULS C. M. (1997) Coccoid forms of Helicobacter pylori are the morphologic manifestation of cell death. Infect Immun 65, 3672–9. LAMARQUE, D. and PEEK JR, R.M. (2003) Pathogenesis of Helicobacter pylori infection. Helicobacter 8, Suppl 1, 21–30 LAMBERT, J .R., LIN , S .K . and ARANDA -MICHEL, J . (1995) Helicobacter pylori. Scand J Gastroenterol 208, suppl. 33–46. LANGENBERG, W., RAUWS, E.A., OUBIER, J.H. and TYTGAT G.N. (1990) Patient-to-patient transmission of Campylobacter pylori infection by fiberoptic gastroduodenoscopy and biopsy. J Infect Dis 161, 507–11. LECOINDRE, P., CHEVALLIER, M., PEYROL, S., BOUDE, M., FERRERO, R.L. and LABIGNE A. (2000) Gastric helicobacters in cats. J Feline Med Surg 2, 19–27. LEUNG, W.K., SIU, K.L., KWOK, C.K., CHAN, S.Y., SUNG, R. and SUNG J.J (1999) Isolation of Helicobacter pylori from vomitus in children and its implication in gastro-oral transmission. Am J Gastroenterol 94, 2881–4. LEUNK, R.D., JOHNSON, P.T., DAVID, B.C., KRAFT, W.G. and MORGAN, D.R. (1988) Cytotoxic activity in broth-culture filtrates of Campylobacter pylori. J Med Microbiol. 26, 93–9. LU, Y., REDLINGER, T.E., AVITIA, R., GALINDO, A. and GOODMAN K. (2002) Isolation and genotyping of Helicobacter pylori from untreated municipal wastewater. Appl Environ Microbiol 68, 1436–9. MAHDAVI, J., SONDEN, B., HURTIG, M., OLFAT, F.O., FORSBERG, L., ROCHE, N., ANGSTROM, J., LARSSON, T., TENEBERG, S., KARLSSON, K.A., ALTRAJA, S., WADSTROM, T., KERSULYTE, D., BERG D.E., DUBOIS, A., PETERSSON, C., MAGNUSSON, K.E., NORBERG, T., LINDH, F., LUNDSKOG, B.B., ARNQVIST, A., HAMMARSTROM, L. and BOREN T. (2002) Helicobacter pylori SabA adhesin in persistent infection and chronic inflammation. Science 297, 573–8. MAJMUDAR, P., SHAH, S.M., DHUNJIBHOY, K.R. and DESAI, H.G. (1990) Isolation of Helicobacter pylori from dental plaques in healthy volunteers. Indian J Gastroenterol 9, 271–2. MARSHALL, B.J. and WARREN, J.R. (1984) Unidentified curved bacilli in the stomach of patients with gastrtis and peptic ulceration. Lancet 16(1), 1311–15. MATSUDA, R., MORIZANE, T., TSUNEMATSU, S., KAWANA, I. and TOMIYAMA, M. (2002) Helicobacter

Helicobacter pylori

447

pylori prevalence in dentists in Japan: a seroepidemiological study. J Gastroenterol 37, 255–9. MAZARI-HIRIART, M., LOPEZ-VIDAL, Y. and CALVA J.J. (2001) Helicobacter pylori in water systems for human use in Mexico City. Water Sci Technol 43, 93–8. MEGRAUD, F. (1995) Transmission of Helicobacter pylori: faecal-oral versus oral-oral route. Aliment Pharmacol Ther 9, Suppl 2, 85–91. MEGRAUD , F ., BRASSENS - RABBE , M . P ., DENIS , F ., BELBOURI , A . and HOA , D . Q . (1989) Seroepidemiology of Campylobacter pylori infection in various populations. J Clin Microbiol 27, 1870–3. MENDALL, M.A., GOGGIN, P.M., MOLINEAUX, N., LEVY, J., TOOSY, T., STRACHAN, D. and NORTHFIELD, T.C. (1992) Childhood living conditions and Helicobacter pylori seropositivity in adult life. Lancet 339, 896–7. MERRELL, D.S., THOMPSON, L.J., KIM, C.C., MITCHELL, H., TOMPKINS, L.S., LEE, A. and FALKOW S. (2003) Growth phase-dependent response of Helicobacter pylori to iron starvation. Infect Immun 71, 6510–25. MOBLEY, H.L., ISLAND, M.D. and HAUSINGER, R.P. (1995) Molecular biology of microbial ureases. Microbiol Rev 59, 451–80. MOBLEY, H.L.T., MENDZ, G.L. and HAZELL, S.L. eds (2001) Helicobacter pylori: Physiology and Genetics, American Society for Microbiology Press, Washington, USA. MORAN, A.P., SVENNERHOLM, A.M. and PENN, C.W. (2002) Pathogenesis and host response of Helicobacter pylori. Trends Microbiol 10, 545–7. MORENO, Y., FERRUS, M.A., ALONSO, J.L., JIMENEZ, A. and HERNANDEZ, J. (2003) Use of fluorescent in situ hybridisation to evidence the presence of Helicobacter pylori in water. Water Res 37, 2251–6. NDIP, R.N., MACKAY, W.G., FARTHING, M.J. and WEAVER L.T. (2003) Culturing Helicobacter pylori from clinical specimens: review of microbiologic methods. J Pediatr Gastroenterol Nutr 36, 616–22. NEDENSKOV, P. (1994) Nutritional requirements for growth of Helicobacter pylori. Appl Environ Microbiol 60, 3450–3. NILSSON, L., OLIVER, J.D. and KJELLEBERG S. (1991) Resuscitation of Vibrio vulnificus from the viable but nonculturable state. J Bacteriol 173, 5054–9. NILSSON, H.O., BLOM, J., ABU-AL-SOUD, W., LJUNGH, A.A., ANDERSEN, L.P. and WADSTROM T. (2002) Effect of cold starvation, acid stress, and nutrients on metabolic activity of Helicobacter pylori. Appl Environ Microbiol 68, 11–9. NOMURA, A., STEMMERMANN, G.N., CHYOU, P-H., KATO, I., PEREZ-PEREZ, G.I. and BLASER M.J. (1991) Helicobacter pylori infection and gastric carcinoma among Japanese Americans in Hawaii. N Engl J Med 325, 1132–6. NOMURA, A.M., PEREZ-PEREZ, G.I., LEE, J., STEMMERMANN, G. and BLASER M.J. (2002) Relation between Helicobacter pylori cagA status and risk of peptic ulcer disease. Am J Epidemiol 155, 1054–9. NURNBERG, M., SCHULZ, H.J., RUDEN, H. and VOGT K. (2003) Do conventional cleaning and disinfection techniques avoid the risk of endoscopic Helicobacter pylori transmission? Endoscopy 35, 295–9. OHKUSA, T., MIWA, H., ENDO, S., OKAYASU, I. and SATO, N. (2004) Helicobacter pylori is a fragile bacteria when stored at low and ultra-low temperatures. J Gastroenterol Hepatol 19, 200–4. ON, S.L., HYNES, S. and WADSTROM, T. (2002) Extragastric Helicobacter species. Helicobacter 7, Suppl 1, 63–7. OSATO, M.S., AYUB, K., LE, H.H., REDDY, R. and GRAHAM D.Y. (1998) Houseflies are an unlikely reservoir or vector for Helicobacter pylori. J Clin Microbiol 36, 2786–8. OWEN, R.J. (1998) Helicobacter-species, classification and identification. Br Med Bull 54, 17–30. PAPINI, E., DE BERNARD M., MILIA, E., BUGNOLI, M., ZERIAL, M., RAPPUOLI, R. and MONTECUCCO C. (1994) Cellular vacuoles induced by Helicobacter pylori originate from late endosomal compartments. Proc Natl Acad Sci USA 91, 9720–4.

448

Emerging foodborne pathogens

PAPINI, E., ZORATTI, M.

and COVER, T.L. (2001) In search of the Helicobacter pylori VacA mechanism of action. Toxicon 39, 757–67. PARK, S.F. (2002) The physiology of Campylobacter species and its relevance to their role as foodborne pathogens. Int J Food Microbiol 74, 177–88. PARK, S.R., MACKAY, W.G. and REID D.C. (2001) Helicobacter sp. recovered from drinking water biofilm sampled from a water distribution system. Water Res 35, 1624–6. PARSONNET, J., SHMUELY, H. and HAGGERTY, T. (1999) Faecal and oral shedding of Helicobacter pylori from healthy infected adults. JAMA 282, 2240–5. PASTER, B.J., LEE, A., FOX, J.G., DEWHIRST, F.E., TORDOFF, L.A., FRASER, G.J., O’ROURKE J.L., TAYLOR, N.S., and FERRERO, R. (1991) Phylogeny of Helicobacter felis sp. nov., Helicobacter mustelae, and related bacteria. Int J Syst Bacteriol 41, 31–8. PERRY, S., SANCHEZ, L., YANG, S., HAGGERTY, T.D., HURST, P. and PARSONNET, J. (2004) Helicobacter pylori and risk of gastroenteritis. J Infect Dis 190, 303–10. POMS, R.E. and TATINI, S.R. (2001) Survival of Helicobacter pylori in ready-to-eat foods at 4 degrees C. Int J Food Microbiol 63, 281–6. PRINZ, C., HAFSI, N. and VOLAND, P. (2003) Helicobacter pylori virulence factors and the host immune response: implications for therapeutic vaccination. Trends Microbiol. 11, 134–8. REYNOLDS, D.J. and PENN, C.W. (1994) Characteristics of Helicobacter pylori growth in a defined medium and determination of its amino acid requirements. Microbiology 140, 2649–56. ROMA-GIANNIKOU, E., KARAMERIS, A., BALATSOS, B., PANAYIOTOU, J., MANIKA, Z., VAN-VLIET, C., ROKKAS, T., SKANDALIS, N. and KATTAMIS, C. (2003) Intrafamilial spread of Helicobacter pylori: a genetic analysis. Helicobacter 8, 15–20. ROSZAK, D.B., GRIMES, D.J. and COLWELL, R.J. (1984) Viable but non recoverable stage of Salmonella enteritidis in aquatic systems. Can J Microbiol 30, 334–338 (1984). ROTHENBACHER, D., WINKLER, M., GONSER, T., ADLER, G. and BRENNER, H. (2002) Role of infected parents in transmission of Helicobacter pylori to their children. Pediatr Infect Dis J 21, 674–9. ROWLAND, M. (2000) Transmission of Helicobacter pylori: is it all child’s play? Lancet 355, 332–3. SACHS, G., WEEKS, D.L., MELCHERS, K. and SCOTT, D.R. (2003) The gastric biology of Helicobacter pylori. Annu Rev Physiol 65, 349–69. SALAMA, N.R., OTTO, G., TOMPKINS, L. and FALKOW, S. (2001) Vacuolating cytotoxin of Helicobacter pylori plays a role during colonisation in a mouse model of infection. Infect Immun 69, 730–6. SASAKI, K., TAJIRI, Y., SATA, M., FUJII, Y., MATSUBARA, F., ZHAO, M., SHIMIZU, S., TOYONAGA, A. and TANIKAWA, K. (1999) Helicobacter pylori in the natural environment. Scand J Infect Dis 31, 275–9. SCHILLING, C.H., COVERT, M.W., FAMILI, I., CHURCH, G.M., EDWARDS, J.S., and PALSSON B.O. (2002) Genome-scale metabolic model of Helicobacter pylori 26695. J Bacteriol 184, 4582– 93. SCOTT, D.R., WEEKS, D., HONG, C., POSTIUS, S., MELCHERS, K. and SACHS, G.(1998) The role of internal urease in acid resistance of Helicobacter pylori. Gastroenterology 114, 58– 70. SEGAL, E.D., CHA, J., LO, J., FALKOW, S. and TOMPKINS L.S. (1999) Altered states: involvement of phosphorylated CagA in the induction of host cellular growth changes by Helicobacter pylori. Proc Natl Acad Sci USA 96, 14559–64. SHAHAMAT, M., MAI, U., PASZKO-KOLVA, C., KESSEL, M. and COLWELL, R.R. (1993) Use of autoradiography to assess viability of Helicobacter pylori in water. Appl Environ Microbiol 59, 1231–5. SOLNICK, J.V., CHANG, K., CANFIELD, D.R. and PARSONNET, J. (2003) Natural acquisition of Helicobacter pylori infection in newborn rhesus macaques. J Clin Microbiol 41, 5511– 6.

Helicobacter pylori SONNENBERG, A.,

449

and EVERHART, J.E. (1997) Health impact of peptic ulcer in the United States. Am J Gastroenterol 92, 614–20. STEVENSON, T.H. and ACUFF, G.R. (1999) Role of helicobacter pylori as an emerging foodborne pathogen in swine. Final report to the Pork Producers Council, (www.porkscience.org/ documents/ Research/roleofhelicobacterpylori.pdf-) STEVENSON, T.H., BAUER, N., LUCIA, L.M. and ACUFF, G.R. (2000a) Attempts to isolate Helicobacter from cattle and survival of Helicobacter pylori in beef products. J Food Prot 63, 174– 8. STEVENSON, T.H., CASTILLO, A., LUCIA, L.M. and ACUFF, G.R. (2000b) Growth of Helicobacter pylori in various liquid and plating media. Lett Appl Microbiol 30, 192–6. STEVENSON, T.H., LUCIA, L.M. and ACUFF, G. R. (2000c) Development of a selective medium for isolation of Helicobacter pylori from cattle and beef samples. Appl Environ Microbiol 66, 723–7. THOMAS, J.E., GIBSON, G.R., DARBOE, M.K., DALE, A. and WEAVER, L.T. (1992) Isolation of Helicobacter pylori from human faeces. Lancet 340, 1194–5. TINDBERG, Y., BENGTSSON, C., GRANATH, F., BLENNOW, M., NYREN, O. and GRANSTROM, M. (2001) Helicobacter pylori infection in Swedish school children: lack of evidence of child-tochild transmission outside the family. Gastroenterology 121, 310–6. TOMB, J.F., WHITE, O., KERLAVAGE, A.R., CLAYTON, R.A., SUTTON, G.G., FLEISCHMANN, R.D., KETCHUM, K.A., KLENK, H.P., GILL, S., DOUGHERTY, B.A., NELSON, K., QUACKENBUSH, J., ZHOU, L., KIRKNESS, E.F., PETERSON, S., LOFTUS, B., RICHARDSON, D., DODSON, R., KHALAK, H.G., GLODEK, A., MCKENNEY, K., FITZEGERALD, L.M., LEE, N., ADAMS, M.D. and VENTER J.C. (1997) The complete genome sequence of the gastric pathogen Helicobacter pylori. Nature 388, 539–47. TSUDA, M., KARITA, M., MORSHED, M.G., OKITA, K. and NAKAZAWA T. (1994) A urease-negative mutant of Helicobacter pylori constructed by allelic exchange mutagenesis lacks the ability to colonise the nude mouse stomach. Infect Immun 62, 3586–9. TUMMURU, M.K., SHARMA, S.A. and BLASER, M.J. (1995) Helicobacter pylori picB, a homologue of the Bordetella pertussis toxin secretion protein, is required for induction of IL-8 in gastric epithelial cells. Mol Microbiol 18, 867–76. TURUTOGLU, H. and MUDUL, S. (2002) Investigation of Helicobacter pylori in raw sheep milk samples. J Vet Med B Infect Dis Vet Public Health. 49, 308–9. TYTGAT, G.N. (1995) Endoscopic transmission of Helicobacter pylori. Aliment Pharmacol Ther 9, Suppl 2, 105–10. UEMURA, N., OKAMOTO, S., YAMAMOTO, S., MATSUMURA, N., YAMAGUCHI, S., YAMAKIDO, M., TANIYAMA, K., SASAKI, N. and SCHLEMPER, R.J. (2001) Helicobacter pylori infection and the development of gastric cancer. N Engl J Med 345, 784–9. VAIRA, D., FERRON, P., NEGRINI, R., CAVAZZINI, L., HOLTON, J., AINLEY, C., LONDEI, M., VERGURA, M., DEI, R. and COLECCHIA, A. (1992) Detection of Helicobacter pylori-like organisms in the stomach of some food-source animals using a monoclonal antibody. Ital J Gastroenterol 24,181–4. VERSALOVIC, J. (2003) Helicobacter pylori. Pathology and diagnostic strategies. Am J Clin Pathol 119, 403–12. WALDENSTROM, J., ON, S.L., OTTVALL, R., HASSELQUIST, D., HARRINGTON, C.S. and OLSEN, B. (2003) Avian reservoirs and zoonotic potential of the emerging human pathogen Helicobacter canadensis. Appl Environ Microbiol 69, 7523–6. WARREN, J.R. and MARSHALL, B.J. (1983) Unidentified curved bacilli on gastric epithelium in active chronic gastritis. Lancet i, 1273–5. WEEKS, D.L., ESKANDARI, S., SCOTT, D.R. and SACHS, G. (2000) A H+-gated urea channel: the link between Helicobacter pylori urease and gastric colonisation. Science 287, 482– 5. XIA, H.X., ENGLISH, L., KEANE, C.T. and O’MORAIN, C.A. (1993) Enhanced cultivation of Helicobacter pylori in liquid media. J Clin Pathol 46, 750–3.

450

Emerging foodborne pathogens

17 Enterobacteriaceae J-L. Cordier, Nestlé Nutrition, Switzerland

17.1

Introduction

The name Enterobacteriaceae was proposed by Rahn (1937) for a phenotypic group comprising the single genus ‘Enterobacter’ and species of several genera which are still recognised such as Erwinia, Escherichia, Klebsiella, Proteus, Salmonella, Serratia and Shigella. The type genus is Escherichia. Enterobacteriaceae are Gram-negative, oxidase-negative, non-spore forming, straight, rod-shaped bacteria, 0.3–1.0 ¥ 1.0–6.0 mm (Brenner, 1984). They are facultatively anaerobic, ferment glucose and produce acid and gas. They contain, with few exceptions (Erwinia chrysanthemi), the enterobacterial common antigen (ECA) (Ramia et al., 1982; Kuhn et al., 1988). Over the last 20–30 years the number of genera and species have been increasing and reorganisations of the taxonomic groups have occurred frequently. The family currently encompasses 41 genera (Garrity, 2001) and an exhaustive review of new members of the family has been performed by Janda (2004). Modern biochemical and molecular identification and typing methods have caused a constant evolution of the nomenclature but in the case of Enterobacteriaceae, the correspondence between the molecular and the original phenotypic classification schemes is rather good. Details on the phylogenetic relation between strains based on the analysis of small subunit (SSU) rRNA have been published by Francino et al. (2004). The name Enterobacteriaceae is derived from the Latin ‘enterobacterium’ meaning intestinal bacterium. The origin of this name and the reference as ‘enteric bacteria’ provides, however, a misleading impression of their ecological niches and occurrence. Although certain members of this family are found in the intestines of humans and animals, in reality they are very widely distributed

Enterobacteriaceae

451

in soil and water as well as in plants. Many species are responsible for diseases of plants thus causing important economic losses. They also play an important role as endosymbionts of insects or of the parasites that feed on insect larvae (Moran and Baumann, 2000). Different Enterobacteriaceae have been implicated or involved in spoilage of food products such as meat and cured meat products (Borch et al., 1996; Garcia et al., 2000) or fish and fish products (Gram and Huss, 1996). K. pneumoniae and K. oxytoca have been identified as the cause of blowing in Mozzarella cheese (Massa et al., 1992) while E. agglomerans caused spoilage of cottage cheese (Brocklehurst and Lund, 1988). K. pneumoniae present in numbers as high as 106 cfu/ml have been the cause of off-odours and offcolours in orange juice concentrate (Fuentes et al., 1985) and different species of Enterobacteriaceae were able to spoil fruit nectars (Vicini et al., 1999). Different species of Serratia and Rahnella aquatilis have been described by Whitfield (2003) as producers of metabolites responsible for off-flavours in different types of foods and Jensen et al. (2001) studied the formation of guaiacol in chocolate milk by a psychrotrophic Rahnella aquatilis. Enterobacteriaceae are also frequently used as hygiene indicators by food processors to demonstrate adherence to Good Hygiene and Good Manufacturing Practices during processing. This is done to detect as early as possible deviations and thus the potential presence of pathogens such as Salmonella (Cox et al., 1988). Considering the widespread occurrence of Enterobacteriaceae in our environment, use of the term ‘faecal indicator’ as done by several authors (e.g. Gauthier and Archibald, 2001) is misleading. It is applicable to some extent only to untreated raw water or foods such as produce or fresh milk but not in processed foods. Up to the 1940s only Salmonella spp. (including S. Arizonae) and Shigella spp. were considered to be food or waterborne pathogens. They were thus divided into pathogens and non-pathogens according to their ability to cause diarrhoeal disease in humans. However, in the years that followed, other members of the family such as certain pathogenic Escherichia coli or Yersinia enterocolitica have been identified as causative agents of gastrointestinal diseases. They are now well-known and well-established pathogens. Numerous Enterobacteriaceae have been associated with extraintestinal infections and are a major cause of nosocomial infections, i.e., hospital acquired infections, in particular in neonatal and paediatric units (Horan et al., 1986; Andresen et al., 1994; Hervas et al., 2001; Parodi et al., 2003). The role and importance of Enterobacteriaceae have been increasing over the last 10–20 years and they are more and more frequently associated with antibiotic resistant strains. In the following sections discussion of nosocomial infections is limited, with few exceptions, to those where exposure occurred through oral or parenteral routes. Several species causing extraintestinal infections such as Enterobacter, Citrobacter, Serratia, Klebsiella, Proteus and others have been involved on occasion with food or waterborne outbreaks and they will be reviewed in the

452

Emerging foodborne pathogens

following sections. Particular attention will be given to Enterobacter sakazakii to acknowledge the increasing importance of this species. The Enterobacteriaceae discussed below can be considered as opportunistic pathogens. Indeed many of the cases reported, including the ones due to E. sakazakii, are the consequence of some parameters and conditions or combinations of them leading to outbreaks. Such parameters are the health status of the patients, the type of food, specific contamination and inappropriate preparation or handling of the foods involved. The symptoms of these diseases range from diarrhoea to severe meningitis, in particular in infants. The mortality rate due to such infections can be high and this is not observed only for E. sakazakii.

17.2

Methods of detection

The reference methods for the detection or enumeration of Enterobacteriaceae have been published by the International Organization for Standardization (ISO, 1991a and 1993). In the case of enumeration, samples or appropriate dilutions are plated on Violet Red Bile Glucose (VRBG) agar, overlaid and incubated at 37 ∞C. VRBG contains selective as well as elective agents such as bile salts, crystal violet and neutral red which suppress competitive organisms and detect the acidification due to the fermentation of glucose. Presumptive typical colonies are then submitted to biochemical tests such as the Gramstain, the oxidase test and the glucose fermentation test. In routine food analysis, frequently only the group of the coliforms (lactose fermenting Enterobacteriaceae) are tested for (ISO 1991b, 1991c). Alternative enumeration methods have been developed which are based on the reference method, an example being the Petrifilm“ (Silbernagel and Lindberg, 2002). Traditional biochemical test strips for the identification of isolated strains have been commercialised by different companies (e.g. Hayek and Willis, 1976; Staneck et al., 1983; Kronvall and Hagelberg, 2002). In the case of very low numbers of Enterobacteriaceae it is necessary to perform an enrichment and therefore either presence/absence tests in predetermined quantities of products or to determine a Most Probable Number (MPN). In such cases a non-selective enrichment in buffered peptone water is done to allow for resuscitation of injured cells followed by a selective enrichment in Enterobacter Enrichment (EE) broth containing brilliant green and bile salts as selective agents. Confirmation of positive tubes is performed on VRBG, followed by biochemical identification as described above. In the case of the analysis of coliforms, Lauryl Sulfate Broth (LST) is used as enrichment broth followed by confirmation on VRBL and using biochemical tests. For most of the Enterobacteriaceae there is no specific method available. In very few cases media have been developed in the clinical field in trying to detect specific Enterobacteriaceae, examples being P. alcalifaciens (Senior,

Enterobacteriaceae

453

1997) or S. marcescens (Giri et al., 2004). An exception is E. sakazakii for which numerous studies have been performed. Up to 1980 E. sakazakii has been classified as yellow pigmented E. cloacae on the basis of its biochemical profile. Following DNA-DNA hybridisation studies it was recognised as a separate species in 1980 (Farmer et al., 1985). Biochemical identification, including with commercial kits, did not always provide satisfactory results. The yellow pigment is, however, not a unique characteristic and it is formed by other members of the Enterobacteriaceae such as strains of E. agglomerans, Escherichia vulneris, Pantoea dispersa or different Erwinia spp. In attempts to find simple discriminatory characteristics several studies have been performed: the occurrence of different morphological types (Farmer et al., 1985; Nazarowec-White and Farber, 1997a), the enzymatic profiles showing the presence of a-glucosidase, of Tween 80 esterase and the absence of phosphoamidase have been studied showing that E. sakazakii is very different from other Enterobacter species (Aldova et al., 1983; Postupa and Aldova, 1984; Farmer et al., 1985; Muytjens et al., 1984). Today a-glucosidase is frequently used in identification schemes as a rapid discriminatory test (Khandai et al., 2004b) and as an elective parameter in several plating media including commercial ones (Iversen and Forsythe, 2004; Iversen et al., 2004a; Leuschner and Bew, 2004; Leuschner et al., 2004; Oh and Kang, 2004). With respect to the detection methods, initially and currently, detection is usually based on methods for Enterobacteriaceae or coliforms with subsequent identification of suspect colonies (FDA/CFSAN, 2002a). Recently a much more specific method using LST supplemented with 0.5 M NaCl and 10 mg/ l vancomycin (mLST) and an incubation temperature of 45 ∞C has been developed (Guillaume-Gentil et al., 2005). This method is being used as the basis for the development of a new international technical standard (ISO, 2005). Epidemiological studies or tracing of environmental isolates require more discriminatory methods such as molecular methods. Several studies have already been dedicated to the typing of E. sakazakii. In a study of several cases Muytjens et al. (1983) used plasmid profiles to compare isolates from patients and from infant formulae. Plasmid profiles were different between the two groups and no clear link could be demonstrated. Clark et al. (1990) on their side investigated two unrelated hospital outbreaks. They compared strains isolated from patients and from infant formulae using antibiograms, plasmid analysis, DNA restriction fragment length polymorphism (DNARFLP), ribotyping and multilocus enzyme electrophoresis. Although the latter technique provided the best discrimination, the other molecular techniques were also effective typing tools, while the antibiograms were not sufficiently reliable. Similar conclusions were drawn by Nazarowec-White and Farber (1999) who found RAPD and PFGE to be the more discriminatory methods followed by ribotyping. Van Acker et al. (2001) used arbitrarily primed PCR to investigate the relationship between isolates from patients and infant formulae. Recent phylogenetic studies using 16S ribosomal DNA and hsp60 sequencing indicated substantial heterogeneity among isolates of E. sakazakii

454

Emerging foodborne pathogens

and similarities with both Citrobacter koseri and E. cloacae (Iversen et al., 2004c; Lehner et al., 2004). PCR methods have been developed in several laboratories both for the specific detection or identification of E. sakazakii (Hamilton et al., 2003; Seo and Brackett, 2004; Lehner et al., 2004). A commercial PCR, the BAX‚ system developed by Dupont Qualicon, has already been included in a methods collection of Health Canada (Anonymous, 2003).

17.3

Epidemiology

17.3.1 Citrobacter spp. Different species of the genus Citrobacter and in particular C. freundii, C. amalonaticus, C. diversus or C. koseri have been associated to human disease (Drelichman and Band, 1985; Gupta et al., 2003c). Enterotoxigenic strains may cause diarrhoea as shown by different authors (Popovici et al., 1964; Guerrant et al., 1976; Farmer et al., 1985; Guarino et al., 1987; Jertborn and Svennerholm, 1991; Doran, 1999). These studies have however focused on the characterisation of the isolates from patients but have often not investigated the type of food involved and the origin of the strains. In the case of a severe outbreak at a nursery school and kindergarten, however, sandwiches prepared with green butter made with parsley were identified as the likely source of infection with a verotoxinogenic strain of C. freundii. Identical strains were isolated from patients suffering from gastroenteritis, from haemolytic uremic syndrome and thrombocytopenic purpura as well as from the parsley which had been grown in an organic garden where pig manure was used as fertiliser (Tschäpe et al., 1995). In another outbreak an antibiotic resistant C. freundii was associated with infant formula as the probable vehicle. This case involved a premature baby fed through a contaminated enteral feeding tube used to deliver the reconstituted infant formula. Overall the plasmid carrying multiple resistance genes persisted in the hospital environment for over seven years and caused other nosocomial outbreaks (Gericke et al., 1993; Thurm and Gericke, 1994). Carneiro et al. (2003) isolated C. freundii as well as other Enterobacteriaceae from reconstituted formulae in a teaching hospital contamination and high counts were attributed to poor hygiene practices and inadequate handling of the reconstituted formula allowing growth to high levels. 17.3.2 Klebsiella spp. K. pneumoniae usually occurs in low numbers in faeces and colonisation to high levels of 108cfu/g and more are considered to be a condition for infections (Selden et al., 1971). Direct transmission from person to person is the most common route of infection (Holzman et al., 1974; Jarvis et al., 1985; FDA/ CFSAN, 2002b) and Klebsiella spp. are common nosocomial pathogens in

Enterobacteriaceae

455

hospitals causing different types of infections (Podschun and Ullmann, 1998; Gupta, 2002). Infants, elderly and immunocompromised individuals are the groups of patients at highest risk (Highsmith and Jarvis, 1985; Sahly et al., 2000). The role of K. pneumoniae as a cause of gastroenteritis was discussed almost 40 years ago (Despres et al., 1969) and has been confirmed recently particularly in infants and children by several authors (Panigrahi et al., 1991; Ananthan-Raju and Alavandi, 1999). Klebsiella spp. have been isolated from different types of produce such as salads, vegetables and fruits or sprouts (Viswanathan and Kaur, 2001; Robertson et al., 2002). Foods, in particular prepared in hospitals, have been implicated on different occasions and related to the intestinal carriage of Klebsiella in patients (Montgomerie et al., 1970; Casewell and Phillip, 1978; Cooke et al., 1980). A foodborne outbreak due to a particular strain of K. pneumoniae has been associated with the consumption of contaminated turkey (Rennie et al., 1990). However, due to the concomitant presence of Clostridium perfringens in the samples this finding was questioned by Hatheway and Farmer (1991). Sabota et al. (1998) reported a case of gastroenteritis followed by multiple organ failure following the consumption of a hamburger contaminated with an enteroinvasive strain of K. pneumoniae. Contamination during food handling seems to have also been the cause of this case. Poor hygienic practices in hospitals have been at the origin of several outbreaks due to contaminated milk-based drink, mothers’ milk or enteral feed. In two cases K. aerogenes has been traced back to a food blender used to prepare the drinks or enteral solutions (Kiddy et al., 1987; Thurn et al., 1990), in other cases poor hygiene during collection and handling of the mothers’ milk, i.e., the use of a contaminated breast pump tubing and safety trap, or of enteral solutions have led to contamination with coliforms and in particular with K. pneumoniae (Donowitz et al., 1981; Novak et al., 2001; Arias et al., 2003). In another case caused by breast milk, the precise source of contamination was not identified (MacRae et al., 1991). Several other similar cases have been reported by different authors and the role of nasogastric feeding tubes in the transmission of antibiotic resistant K. pneumoniae was confirmed by Mayhall et al. (1980). A comparative study on the quality of enteral feeds showed that the frequency in contamination was higher in home-prepared solutions than in those prepared in hospitals, indicating poor hygienic practices at home (Anderton et al., 1993). K. oxytoca has been associated with diarrhoea ranging from mild forms to hemorrhagic colitis (Beaugerie et al., 2003; Beaugerie and Petit, 2004) but no information was provided as to the possible source or vehicle. In another study Berthelot et al. (2001) showed that the nosocomial colonisation of premature babies by K. oxytoca was due to contaminated enteral feeding and readjustment of the hygiene practices of health care workers stopped the outbreak. Different species of Klebsiella, including an enterotoxigenic K. pneumoniae, have been isolated from fish and seafood (Singh and Kulshreshtha, 1992). Although to our knowledge, they have not been implicated in foodborne

456

Emerging foodborne pathogens

outbreaks, K. pneumoniae seems to play a role in cases of scombroid fish poisoning due to histamine production in tuna sashimi (Taylor et al., 1979). Kanki et al., (2002) showed however that the histamine producing bacteria K. pneumoniae and K. oxytoca were misidentified, the correct designations being Raoultella planticola and Raoultella ornithinolytica, both still belonging to the Enterobacteriaceae. Marino et al. (2000) on their side showed that contamination of cheese with Enterobacteriaceae during cheese making and/ or storage led to an increase in biogenic amines.

17.3.3 Enterobacter spp. Enterobacter spp. are normally found as saprophytes in the gastrointestinal tract of humans and animals. They are, however, also very frequently found in water, in sewage and soils, in plants as well as in numerous foods such as dairy products, meat, fish products, spices and vegetables or fruits. Several species of Enterobacter have clinical significance: E. cloacae, E. aerogenes, E. agglomerans, E. gergoviae and E. sakazakii. A significant increase of these infections has been observed over recent years (Gaston, 1988; Shlaes, 1993; Andresen et al., 1994; Gupta et al., 2003a, b) and E. cloacae, along with K. pneumoniae, remains responsible for significant morbidity and mortality, especially in very-low-birth-weight infants (Cordero et al., 2004). Most of these species have also been associated with nosocomial outbreaks, leading either to sepsis due to contaminated parenteral solutions or illnesses of gastrointestinal origin with different levels of severity. These range from diarrhoea to necrotizing enterocolitis and meningitis. In most severe cases, in particular when premature babies are affected, death may ensue. Although parenteral solutions cannot be directly compared to enteral feed, both can be considered nutrients and the mechanisms of contamination compared. Transmission of E. cloacae, and E. agglomerans in one case, through contaminated parenteral solutions has been reported in several occasions. Investigations in Mexico and Brazil traced infections back to such contaminated parenteral solutions, the data indicating contamination during their preparation by hospital personnel (Goncalves et al., 2000; Tresoldi et al., 2000; Macias et al., 2004). In the same year, six premature babies died after having been fed with nutritional drips (vitamins, fats and dextrose) prepared at the hospital contaminated with E. cloacae (Anonymous, 2004a). Several case studies have in fact demonstrated that E. cloacae is frequently found in hospital environments and that poor hygiene practices lead to spread and infection through different routes such as hands, thermometers, saline solutions, dextrose solutions or distilled water (Archibald et al., 1998; Harbarth et al., 1999; Wang et al., 1991; van den Berg et al., 2000; Yu et al., 2000). In a similar nosocomial outbreak involving 11 babies, nine of whom were prematures, E. gergoviae present in a parenteral dextrose saline solution was traced back to the healthcare workers (Ganeswire et al., 2003).

Enterobacteriaceae

457

17.3.4 Enterobacter sakazakii E. sakazakii is an opportunistic pathogen and has been involved in sporadic individual cases or small outbreaks of infections. On a few occasions, the symptoms were limited to septicaemia or diarrhoea only (Monroe and Tift, 1979; El Maadani, 1996). In some outbreaks it has been at the origin of neonatal necrotizing enterocolitis (NEC) the most common gastrointestinal emergency in newborns (Muytjens et al., 1983; Van Acker et al., 2001). In most cases described, however, E. sakazakii overcomes the gastrointestinal barrier gaining access to the bloodstream and finally the cerebrospinal fluid to cause meningitis (e.g. Gallagher and Ball, 1991). It is interesting to note that recently Bar-Oz et al. (2001) have described three cases of prematures with E. sakazakii in the stool samples but showing absolutely no symptoms. Intestinal colonisation without any symptoms as known for other Enterobacteriaceae seems therefore also possible and has been confirmed in a recent outbreak in France (Anonymous, 2004b). Summaries of cases have been published by Nazarowec-White and Farber (1997a), Lai (2001) and Iverson and Forsythe (2003). Since then several other cases have been reported (CDC, 2002; Barreira et al., 2003; Anonymous, 2004b; Stoll et al., 2004; Tuohy and Jacobs, 2005). Mortality rates have been as high as 50% or more but have declined to < 20% in recent years. Even in the case of recovery, long-term neurologic sequelae have been reported in affected babies (Lai, 2001). Outbreaks due to E. sakazakii are very rare and around 30–40 cases involving about 80–100 infants have been described and reported during the last 40–45 years. In the United States, the number of infections due to E. sakazakii in infants has been estimated at 1:100,000 on the basis of a US FoodNet survey in 2002, the figure being based only on statistics of isolates from clinical specimens (IFT, 2004; Lehner and Stephan, 2004). In a threeyear survey performed by Stoll et al. (2004) in neonatal intensive care units (NICUs) in 6,825 blood or cerebrospinal fluid cultures, only one case of E. sakazakii (septicaemia) was found. When compared to E. claoacae (101 cases) and E. aerogenes (20 cases) E. sakazakii was considered by the authors to be a very rare systemic infection. Several cases of bacteremia due to E. sakazakii have been described for older children and adults suffering from different underlying diseases or having been undergoing surgery (Jimenez and Gimenez, 1982; Reina et al., 1989; Hawkins 1991; Tekkok et al., 1996; Lai, 2001; Ongradi, 2002). These cases, however, do not seem to be linked to food intake and a recent preliminary report from New Zealand indicates indeed that no other populations than infants are at risk to become infected when consuming dairy products (Anonymous, 2004c) Powdered infant formulae were identified as source and vehicle of E. sakazakii in a number of these outbreaks (Biering et al., 1989; Simmons et al., 1989; Van Acker et al., 2001; Anonymous, 2002, 2004b; Tuohy and Jacobs, 2005). In other outbreaks, however, the source of the contamination

458

Emerging foodborne pathogens

was not investigated or not detected. In others, E. sakazakii was found in the hospital environment, i.e., in incubators, on blenders and utensils used to prepare the formulae (Urmenyi and Franklin, 1961; Simmons et al. 1989; Jaspar et al., 1990) In the outbreak described by Bar-Oz et al. (2001) E. sakazakii was found only on utensils such as the blender but not in the formula. It is also important to note that in several cases of E. sakazakii infections, infants have not been fed with powdered infant formulae. In one case the infected premature baby received parenteral nutrition consisting of breast milk and ready-to-use, i.e., sterile, premature infant formula (Stoll et al., 2004) and in another case starch was added to a sterile ready-to-feed formula (FAO/WHO, 2004). In another recent case the infected baby was exclusively fed with mother milk (Barreira et al., 2003). The fact that improperly handled mother milk stored in a milk bank may become contaminated with E. sakazakii was shown by Novak et al. (2001). Powdered infant formulae are not sterile and presence of low levels of E. sakazakii due to post-process (heat-treatment) contamination can presently not be excluded. E. sakazakii is readily killed by pasteurisation as demonstrated by several authors (Nazarowec-White and Farber, 1997b; Breeuwer et al., 2003; Edelson-Mammel and Buchanan, 2004). It is however quite resistant to osmotic shock and therefore survives well in dry environments and can be found in processing environments (Breeuwer et al., 2003). As a consequence it may occasionally come to post-process contamination with low levels of E. sakazakii or other Enterobacteriaceae showing similar characteristics. Quantitative determination of E. sakazakii in powdered infant formulae has been performed by several authors and all contaminated products (about 14% of the samples analysed) were found to meet the current specifications of Codex Alimentarius of <0.3 cfu/g (FAO/WHO, 2004) or local legislation (absence in 1 g) (Van Acker et al., 2001). The incidence and concentration of E. sakazakii has been determined in several studies. In a survey conducted in Canada by Nazarowec-White and Farber (1997a) on infant formulae from five different manufacturers, E. sakazakii was detected in about 7% of the cans analysed (8 out of 120). Depending on the brand, incidences of 0% (n = 1), 4% (n = 2), 8% (n = 1) and 12% (n = 1) were established with levels of 0.36 cfu/100g (MPN) in positive samples. This is similar to Muytjens et al. (1988) reporting levels ranging from 0.36 to 66 cfu/100g (MPN) and isolated Enterobacteriaceae from 52% of the 141 cans originating from 35 countries. E. sakazakii was one of the most frequent species isolated. Average levels of 8 cfu/100g have been reported by Simmons et al. (1989) and Heuvelink et al. (2001) using a presence/absence test for samples of 25 g detected E. sakazakii in one sample of infant formula (40 samples analysed) and seven samples of milk powder (170 analysed). In a second survey they isolated E. sakazakii in two different formulae (101 samples) (Heuvelink et al., 2003). The infective dose is not known and the only study on the virulence has been published by Pagotto et al. (2003). As discussed above, poor hygiene

Enterobacteriaceae

459

practices during preparation and handling of the formula have been described in several case studies. Such practices may easily lead to the presence of high levels of E. sakazakii. Indeed Nazarowec-White and Farber (1997a) have shown that E. sakazakii is able to grow very rapidly in reconstituted formula and has as well a short lag phase. This has been confirmed by Iversen et al. (2004b) who have also discussed the potential for biofilm formation in feeding tubes. In an outbreak in France, storage (refrigerated and at room temperature) of a reconstituted formulae for prematures over a prolonged period of time has been reported (El Maadani, 1996) providing ample possibilities for growth. In the risk assessment performed by the FAO/WHO the significant increase in the risk of infection in the case of inappropriate handling (e.g. prolonged storage at room temperature) is clearly highlighted (FAO/WHO, 2004). As clearly shown in the risk assessment on E. sakazakii, it is necessary to implement combinations of management options (FAO/WHO, 2004). One of these options, but which cannot be effective as a stand-alone measure, is the establishment of more stringent microbiological criteria. The Biohazard panel of the EFSA has recommended the development of a Performance Objective and measuring adherence through Enterobacteriaceae (EFSA, 2004). Based on these two reports, the Codex Alimentarius has proposed new riskbased criteria (Enterobacteriaceae: absence in 10 ¥ 10 g and E. sakazakii: absence in 30 ¥ 10 g). The European Commission has recently issued similar criteria, i.e., absence of Enterobacteriaceae in 10 ¥ 10 g and, if a positive is found, absence of E. sakazakii in 30 ¥ 10 g (EC, 2005). The importance of the preparation and handling and the impact of deviations from good practice has, however, also been recognised (FAO/WHO, 2004; EFSA, 2004). Strong recommendations have therefore been made by several public health authorities or professional organisations to develop and promote recommendations and training in hygienic practices along with clear instructions for use (see e.g. Agostoni et al., 2004). For a long time infant formulae were thought to be the only source of E. sakazakii but numerous recent publications have shown the organism to be ubiquitous. Today 50–100 publications have described the occurrence of E. sakazakii and more will certainly follow. Examples (not exhaustive) are raw milk (Jayarao and Wang, 1999), cheese (Morales et al., 2003, 2004), water (Leclerc et al., 2001), fermented beverages (Gassem, 2002), prepared dishes (Soriano et al., 2001), street vended foods (Mensah et al., 2002), mother milk in a milk bank (Novak et al., 2001) and others. Reports on environmental incidence are as well increasing and examples (not exhaustive) are food processing environments and households (Khandai et al., 2004a), coastal waters (Bonadonna et al., 2002), river water and water treatment plants (Alonso et al., 1999; Zamxaka et al., 2004), insects (Kuzina et al., 2001; Hamilton et al., 2003), soil (Babalola et al., 2002), clinical material (Janicka et al., 1999; Oliver et al. 2003), geriatric hospital wards (Masaki et al., 2001), salmon farms (Miranda et al., 2003), ostrich farms (Cabassi et al., 2004), and others.

460

Emerging foodborne pathogens

17.3.5 Serratia The most common representative, S. marcescens, has long been considered as a harmless commensal but it has been now recognised as a frequent cause of nosocomial extraintestinal infections (Hejazi and Falkiner, 1997; O’Connell and Humphreys, 2000). Serratia spp. are widely distributed and have been isolated from numerous habitats such as soil (Giri et al., 2004), dairy products (Morales et al., 2003), meat products (Olsson et al., 2003) or fish products (Gonzalez-Rodriguez et al., 2002). Several nosocomial outbreaks in neonatal intensive care units have been traced to used bottles containing milk (Fleisch et al., 2002) and to breast milk, to a bottle of enteral feed, the same strain being found on equipment used in the ward (Berthelot et al., 1999; Jones et al., 2000). In other cases contaminated parenteral solutions were at the origin of outbreaks due to Serratia spp. or S. odorifera (Frean et al., 1994; Arias et al., 2003). As with other Enterobacteriaceae, presence of Serratia spp. in hospital environments and breaches in hygienic practice have been described by several authors as being the cause of nosocomial outbreaks (van Ogtrop et al., 1997; Villari et al., 2001; Assadian et al., 2002).

17.3.6 Morganella, Proteus and Providencia Organisms of the Morganella-Proteus-Providencia group are ubiquitous in the environment and only a few cases and outbreaks have been reported (O’Hara et al., 2000). Morganella morganii (previously Providencia morganii) has been isolated from infants suffering from diarrhoea (Farmer et al., 1985). The genus Proteus was suspected to be the cause of foodborne illness in the 1940s and several outbreaks have been reported in Germany and Eastern Europe (Babusenko, 1955; Tomasoffova et al., 1965; Gritsenko et al., 1970; Zietze, 1984). Proteus vulgaris has been linked to several foodborne outbreaks due to contaminated foods such as meat (Soncini et al., 1982; Yang et al., 1998). Colonisation of the intestinal tract by P. mirabilis in 14 patients has been identified as the cause of a nosocomial outbreak of infection in a hospital (Chow et al., 1979) and in a study involving more than 1,000 patients suffering from enteric diseases, M. morganii and P. mirabilis have been found more frequently than in faeces from healthy persons (Muller, 1986). Several foodborne outbreaks in different countries have been attributed to Providencia alcalifaciens (Guth and Perrella, 1996; Albert et al. 1998; Murata et al., 2001; Chlibek et al., 2002) which is considered an invasive enteric pathogen. However, no detailed information on the food(s) incriminated is available.

17.3.7 Edwardsiella Edwardsiella tarda is a well-known cause of haemorrhagic septicaemia in fish and has been associated with gastro- and extraintestinal infections in humans (Jaruratanasirikul and Kalnauwakul, 1991; Janda et al., 1991; Janda

Enterobacteriaceae

461

and Abbott, 1993, 1999; Srinivasa-Rao et al., 2004). Edwardsiella is rarely found in faeces of healthy people but has been found in higher numbers in patients suffering from diarrhoea (Gilman et al., 1971) and in this particular case association with amoebic dysentery has been discussed. The role of the pathogen of aquatic species, E. tarda, in human illness related to the consumption of raw fish and shellfish has been discussed by several authors (Vandepitte et al., 1980; Fang et al., 1991; Greenless et al., 1998). Cases of gastroenteritis have also been associated with contact with infected water tortoises or lake water (Sechter et al., 1983), ornamental fish (Vandenpitte et al., 1983) or pet turtles (Nagel et al., 1982). 17.3.8 Other Enterobacteriaceae Certain other members of the Enterobacteriaceae have been associated with isolated sporadic cases of gastrointestinal diseases such as Kluyvera spp (Fainstein et al., 1982) or Hafnia alvei (Albert et al., 1991).

17.4

Health risks and underlying factors

As mentioned in the introduction, most strains of the species discussed here are harmless. The characteristics of strains involved in outbreaks have not been investigated in all instances. Virulence factors have been identified in some instances, for example siderophores in Enterobacter spp. and Citrobacter spp. (Mokracka et al., 2004), haemagglutinin in H. alvei (Podschun et al., 2001), haemolysins in E. cloacae (Simi et al., 2003), enterotoxins in strains of S. marcescens or of E. sakazakii (Singh et al., 1997; Pagotto et al., 2003), and pathogenicity islands or extrachromosomal elements carrying virulence genes in Enterobacter spp. (Mavziutov et al., 2002). The symptoms associated with gastrointestinal diseases caused by the different members of Enterobacteriaceae are diverse and range from mild self-contained diarrhoea to severe haemorrhagic diarrhoea. In a number of cases necrotizing enterocolitis (NEC) has been reported, a severe disease which is frequently associated with premature babies with low birth weight as well as neonates suffering from congenital disorders (Covert et al., 1989; Lee and Polin, 2003; Kafetzis et al., 2003). Septicaemia and/or meningitis, other reported symptoms, are the result of invasion of the intestinal epithelium followed by dissemination into the bloodstream and finally the cerebrospinal fluid by enteric microorganisms (Huang et al., 2000). The mortality rate in cases of meningitis is usually high and babies recovering are often affected by disorders of the central nervous system in particular of the brain. Certain chronic diseases such as ankylosing spondilitis (van Bohemen et al., 1988), arthritis (Priem et al., 1999) or osteomyelitis (Stricker et al., 1998) have been associated with infections caused by different members of the Enterobacteriaceae. A direct link to foodborne outbreaks has, however, to our knowledge, not been established.

462

Emerging foodborne pathogens

For a number of outbreaks described in Section 17.3. little or no information is provided on the patients suffering from gastrointestinal diseases. Most information is available for cases caused by enteral or parenteral solutions, including reconstituted powdered infant formulae showing that preterm or debilitated term infants as well as immuno-compromised patients represent the populations at higher risk. This is similar to any type of food or waterborne disease caused by other types of pathogens.

17.5

Prevention and control

Enterobacteriaceae are usually considered by food manufacturers as hygiene indicators and therefore used to monitor the effectiveness of implemented preventive pre-requisite measures such as Good Manufacturing Practices and Good Hygiene Practices (GMP/GHP) (Cox et al., 1988). This is also reflected in numerous national and international standards or criteria where Enterobacteriaceae or coliforms are included as hygiene indicators with 3class sampling plans, thus with some tolerance values as reflected by the limits m and M of such specifications. Enterobacteriaceae are hardly ever identified as significant hazards in HACCP studies and thus no specific control measures are defined either. However, the specific control measures implemented to control recognised significant hazards such as Salmonella are suitable and effective as well to control members of this family. The characteristics of both the pathogen and the hygiene indicator are indeed very similar in terms, for example, of sensitivity to heat-treatments or other killing steps. The presence of low levels of Enterobacteriaceae in foods is accepted and does not represent a direct safety concern. These levels (m and M of sampling plans) may vary depending on the type of food and consumer. The presence of high levels in foods prepared or handled in kitchens, however, is almost invariably due to an additional contamination during handling, to inappropriate conditions such as prolonged storage at elevated temperature and further handling or a combination of the two factors. This can be addressed through the appropriate information and training of food handlers in Good Hygiene Practices. The establishment of specific control measures for members of the Enterobacteriaceae is thus not very frequent, a significant exception being E. sakazakii in powdered formulae for prematures and infants during the first week of life. As outlined in the FAO/WHO report (2004) E. sakazakii can only be controlled through the implementation of a combination of control measures. Amongst the measures discussed in the above report, some can be applied during production and others during preparation and handling of the prepared bottles. The manufacture of infant formulae can be subdivided in two very distinct parts, a wet and a dry part of the processing. In the wet part, raw materials

Enterobacteriaceae

463

used to manufacture the formulae such as fresh milk, liquid whey or dissolved dry ingredients are heat-treated. The processing conditions at this step may vary depending on the manufacturer, the type of product but they will allow effective control of vegetative microorganisms such as Salmonella or E. sakazakii – usually a reduction in excess of 8–12 log units. The major risks in terms of presence of Salmonella and Enterobacteriaceae, including E. sakazakii, in the finished product are encountered on the dry part of the process. This encompasses the areas with the dryer, the cooling steps, intermediate storage steps, mixing of ingredients up to the filling of the product in its final container. During these steps it is essential to avoid or miminize post-process contamination. These processing steps are therefore located in high hygiene areas which are physically separated from the rest of the processing areas, including the wet one. For years Salmonella has been considered the most significant pathogen for powdered infant formulae and the current hygiene concepts have been introduced and improved since the 1970s following several outbreaks (Forsyth et al., 2003). These concepts are based on the zoning of the different processing areas to achieve the most effective protection of the processing areas and processing lines, i.e. avoiding the ingress of this significant hazard. The zoning is not limited to physical separations but includes as well the flow of personnel, of goods such as ingredients for dry mixing operations, of packaging material as well as of air. An additional key element of the hygiene concept is the maintenance of dry conditions to avoid any multiplication of microorganisms within these high hygiene areas. The effectiveness of these measures is determined through the direct environmental monitoring of Salmonella. This monitoring is usually complemented by the monitoring of Enterobacteriaceae which has been used for decades as hygiene indicator. The determination of this group of microorganisms as hygiene indicator can be performed quite easily and rapidly in a factory set-up and has proven extremely useful to detect hygiene deviations at an early stage. Experience has shown that it is possible to avoid the ingress and establishment of Salmonella and to keep high hygiene areas completely free of the pathogen. Under these circumstances it is also possible to comply with very stringent standards such as absence of the pathogen in 60 ¥ 25g. Breakdown of the preventive measures may however lead to problems as shown in recent outbreaks (Espié et al., 2005 and IVS, 2005). In the case of Enterobacteriaceae (to which E. sakazakii belongs) used as hygiene indicator, experience over several years has shown that it is only possible to minimise their presence but not to eradicate them completely. This requires of course well-established control measures in the processing environment as outlined above. Additional efforts are however needed in maintaining high hygiene levels and it is of particular importance to eliminate completely the presence of water, e.g. condensation or leakages which may lead to multiplication of Enterobacteriaceae already present.

464

Emerging foodborne pathogens

Much more stringent microbiological criteria for Enterobacteriaceae (absence in 10 ¥ 10g) and if a positive is found for E. sakazakii (absence in 30 ¥ 10g) were introduced in Europe in January 2006 and similar criteria are under discussion at the level of Codex Alimentarius. The safety of powdered infant formulae can, however, not been ensured through stringent microbiological criteria alone. As shown in several of the case studies mentioned above, poor hygiene during preparation of the bottles and their storage under inappropriate conditions before consumption, leading to multiplication have contributed to outbreaks. In order to minimise the risks it is important to adhere strictly to the recommendations of manufacturers who provide detailed information as to the preparation and handling and the immediate consumption of reconstituted powders. In addition and to assist the users, in particular in hospitals, recommendations and comments on hygienic practices have been issued by Public Health Authorities such as the FDA/CFSAN (2002), the AFSSA (2005) or organisations such as the one of European Pediatricians (Agostoni et al., 2004).

17.6

References

(AGENCE FRANÇAISE DE SÉCURITÉ SANITAIRE DES ALIMENTS) (2005) Rapport sur les ‘Recommendations d’hygiène pour la préparation et la conservation des biberons’. (17. Octobre 2005). AGOSTONI C, AXELSSON I, GOULET O, KOLETZKO B, MICHAELSEN K F, PUNTIS J W, RIGO J, SHAMIR R, SZAJEWSKA H, TURCK D, VANDENPLAS Y and WEAVER L T (2004) Preparation and Handling of Powdered Infant Formula: A Commentary by the ESPGHAN Committee on Nutrition. J. Pediatr. Gastroenterol. Nutr., 39, 320–322. ALBERT M J, ALAM K, ISLAM M, MONTANARO J, RAHAMAN A S, HAIDER K, HOSSAIN M A, KIBRIYA A K, and TZIPORI S (1991) Hafnia alvei, a probable cause of diarrhea in humans. Infect Immun., 59, 1507–1513. ALBERT M J, FARUQUE A S and MAHALANABIS D (1998) Association of Providencia alcalifaciens with diarrhea in children. J. Clin. Microbiol., 36, 1433–1435. ALDOVA E, HAUSNER O and POSTUPA R (1983) Tween-esterase activity in Enterobacter sakazakii. Zbl. Bakt. Hyg., A256, 103–108. ALONSO J L, SORIANO A, CARBAJO O, AMOROS I and GARELICK H (1999) Comparison and recovery of Escherichia coli and thermotolerant coliforms in water with a chromogenic medium incubated at 41 and 44.5 ∞C. Appl. Env. Microbiol., 65, 3746–3749. ANANTHAN-RAJU S and ALAVANDI S (1999) Enterotoxigenicity of Klebsiella pneumoniae associated with childhood gastroenteritis in Madras, India. Jpn. J. Infect. Dis., 52, 16– 17. ANDERTON A, NWOGUH C E, MCKUNE I, MORRISON L, GREIG M and CLARK B (1993) A comparative study of the numbers of bacteria present in enteral feeds prepared and administered in hospital and the home. J. Hosp. Infect., 23, 43–49. ANDRESEN J, ASMAR B I, DAJANI A S (1994) Increasing Enterobacter bacteremia in pediatric patients. Pediatr. Infect. Dis. J., 13, 787–792. ANONYMOUS (2002) Enterobacter sakazakii infections associated with the use of powdered infant formula – Tennessee, 2001. Morb. Mortal. Wkly. Rep., 51, 297–300. ANONYMOUS (2003) The Dupont Qualicon Bax“ system method for the detection of Enterobacter sakazakii in selected foods. Laboratory Procedure MFLP 27, Health Products and Food Branch, Canada, Ottawa. AFSSA

Enterobacteriaceae

465

(2004a) Devastated mothers mourn their babies. http://www.suntimes.co.za/ 2004/03/14/news/news34.asp ANONYMOUS (2004b) Infections à Enterobacter sakazakii chez des nouveaux-nés ayant consommé du Pregestimil“, préparation pour alimentation pour nourrissons et enfants en bas âge, France, octobre à décembre 2004. Bilan préliminaire de l’investigation nationale et recommandations de signalement. Institut de Veille Sanitaire, 16/12/ 2004. ANONYMOUS (2004c) Hazards associated with Enterobacter sakazakii in the consumption of dairy foods by the general population. Draft Report to the New Zealand Dairy Technical Consultation Committee. ARCHIBALD L K, RAMOS M, ARDUINO M J, AGUERO S M, DESEDA C, BANERJEE S and JARVIS W R (1998) Enterobacter cloacae and Pseudomonas aeruginosa polymicrobial bloodstream infections traced to extrinsic contamination of a dextrose multidose vial. J. Pediatr., 133, 640–644. ARIAS M L, MONGE R and CHAVEZ C (2003) Microbiological contamination of enteral feeding solutions used in Costa Rican hospitals. Arch. Latinoam. Nutr., 53, 277–281. ASSADIAN O, BERGER A, ASPOCK C, MUSTAFA S, KOHLHAUSER C and HIRSCHL A M (2002) Nosocomial outbreak of Serratia marcescens in a neonatal intensive care unit. Infect. Control Hosp. Epidemiol., 23, 457–461. BABALOLA O O, OSIR E O and SANNI A I (2002) Characterization of potential ethyleneproducing rhizosphere bacteria of Striga-infested maize and sorghum. Afr. J. Biotechnol., 1, 67–69. BABUSENKO A M (1955) Investigations on serological properties of Proteus and its relation to etiology of food toxicoinfections. Vopr. Pitan., 14, 26–29. BAR-OZ B, PREMINGER A, PELEG O, BLOCK C and ARAD I (2001) Enterobacter sakazakii infection in the newborn. Acta Paediatr., 90, 356–358. BARREIRA E R, COSTA DE SOUZA D, DE FREITAS GOIS P and FERNANDES J C (2003) Meningite por Enterobacter sakazakii em recem-nascido: relato de caso. Pediatria (Sao Paulo), 25, 65–70. BEAUGERIE L and PETIT J C (2004) Microbial-gut interactions in health and disease. Antibioticassociated diarrhoea. Best Pract. Res. Clin. Gastroenterol., 18, 337–352. BEAUGERIE L, METZ M, BARBUT F, BELLAICHE G, BOUHNIK Y, RASKINE L, NICOLAS J C, CHATELET F P, LEHN N, PETIT J C and Infectious Colitis Study Group (2003) Klebsiella oxytoca as an agent of antibiotic-associated hemorrhagic colitis. Clin. Gastroenterol. Hepatol., 1, 370–376. BERTHELOT P, GRATTARD F, AMERGER C, FRERY M C, LUCHT F, POZZETTO B and FARGIER P (1999) Investigation of a nosocomial outbreak due to Serratia marcescens in a maternity hospital. Infect. Control Hosp. Epidemiol., 20, 233–236. BERTHELOT P, GRATTARD F, PATURAL H, ROS A, JELASSI-SAOUDIN H, POZZETT B, TEYSSIER G and LUCHT F (2001) Nosocomial colonization of premature babies with K. oxytoca: probably role of enteral feeding procedure in transmission and control of the outbreak with the use of gloves. Infect Control Hosp. Epidemiol., 22, 148–151. BIERING G, KARLSSON S, CLARK N C, JONSDOTTIR K E, LUDVIGSSON P and STEINGRIMSSON O (1989) Three cases of neonatal meningitis caused by Enterobacter sakazakii in powdered milk. J. Clin. Microbiol., 27, 2054–2056. BONADONNA L, BRIANCESCO R, COCCIA A M, SEMPRONI M and STEWARDSON D (2002) Occurrence of potential bacterial pathogens in coastal areas of the Adriatic Sea. Env. Monitoring Assessment, 77, 31–49. BORCH E, KANT-MUERMANS M L and BLIXT Y (1996) Bacterial spoilage of meat and cured meat products. Int. J. Food Microbiol., 33, 103–120. BREEUWER P, LARDEAU A, PETERZ M and JOOSTEN H M (2003) Desiccation and heat tolerance of Enterobacter sakazakii. J. Appl. Microbiol., 95, 967–973. BRENNER D J (1984) Family I. Enterobacteriaceae Rahn 1937, nom. fam. cons. Opin. 15, Jud. Comm. 1958, 73; Ewing, Farmer, and Brenner 1980, 674; Judicial Commission ANONYMOUS

466

Emerging foodborne pathogens

1981, 104. In Bergey’s manual of systematic bacteriology, vol. 1.; Krieg N R and Holt J G (eds) Williams and Wilkins Baltimore pp 408–420. BROCKLEHURST T F and LUND B M (1988) The effect of pH on the initiation of growth of cottage cheese spoilage bacteria. Int J Food Microbiol., 6, 43–49. CABASSI C S, TADDEI S, PREDARI G, GALVANI G, GHIDINI, F SCHIANO E. and CAVIRANI S (2003) Bacteriologic findings in ostrich (Struthio camelus) eggs from farms with reproductive failures. Avian Dis., 48, 716–722. CARNEIRO L A, SILVA A P, MERQUIOR V L and QUEIROZ M L (2003) Antimicrobial resistance in Gram-negative bacilli isolated from infant formulas. FEMS Microbiol. Lett., 228, 175–179. CASEWELL M and PHILLIPS I (1978) Food as a source of Klebsiella species for colonisation and infection of intensive care patients. J. Clin. Pathol., 31, 845–849. CDC (2002) Enterobacter sakazakii infections associated with the use of powdered infant formula – Tennessee, 2001. Morb. Mortal Wkly Rep., 51, 298–300. CHLIBEK R, JIROUS J and BERAN J (2002) Diarrhea outbreak among Czech Army Field Hospital personnel caused by Providencia alcalifaciens. J. Travel Med., 9, 151–152. CHOW A W, TAYLOR P R, YOSHIKAWA T T and GUZE L B (1979) A nosocomial outbreak of infections due to multiply resistant Proteus mirabilis: role of intestinal colonization as a major reservoir. J. Infect. Dis., 139, 621–627. CLARK N C, HILL B C, O’HARA C M, STEINGRIMSSON O and COOKSEY R C (1990) Epidemiologic typing of Enterobacter sakazakii in two neonatal nosocomial outbreaks. Diagn. Microbiol. Infect. Dis., 13, 467–472. COOKE E M, SAZEGAR T, EDMONDSON A S, BRAYSON J C and HALL D J (1980) Klebsiella species in hospital food and kitchens: a source of organisms in the bowels of patients. Hyg. (Lond), 84, 97–101. CORDERO L, RAU R, TAYLOR D and AYERS L W (2004) Enteric gram-negative bacilli bloodstream infections: 17 years’ experience in a neonatal intensive care unit. Am. J. Infect. Control, 32, 189–195. COVERT R F, NEU J, ELLIOTT M J, REA J L and GIMOTTY P A (1989) Factors associated with age of onset of necrotizing enterocolitis. Am. J. Perinatol., 6, 455–460. COX L J, KELLER N and VAN SCHOTHORST M (1988) The use and misuse of quantitative determinations of Enterobacteriaceae in food microbiology. Soc. Appl. Bacteriol. Symp. Ser., 17, 237S–249S. DESPRES P, HEROUIN C, PLAINFOSSE B and SERINGE P (1969) Discussion of the role of ‘Klebsiella pneumoniae’ in infantile gastroenteritis. Presse Med., 77, 463–465. DONOWITZ L G, MARSIK F J, FISHER K A and WENZEL R P (1981) Contaminated breast milk: A source of Klebsiella bacteremia in a newborn intensive care unit. Rev. Infect. Dis., 3, 716–720. DORAN T I (1999) The role of Citrobacter in clinical disease of children: review. Clin. Infect. Dis., 28, 384–394. DRELICHMAN V and BAND J D (1985) Bacteremias due to Citrobacter diversus and Citrobacter freundii. Incidence, risk factors, and clinical outcome. Arch. Intern. Med., 145, 1808– 1810. EC (EUROPEAN COMMISSION) (2005) Commission Regulation (EC) No. 2073/2005 of November 2005 on microbiological criteria for foodstuffs. Official J. of European Union, L338, 1–26. EDELSON-MAMMEL S G and BUCHANAN R L (2004) Thermal inactivation of Enterobacter sakazakii in rehydrated infant formula. J. Food Prot., 67, 60–63. EFSA (EUROPEAN FOOD SAFETY AUTHORITY) (2004) Opinion of the Scientific Panel on Biological hazards on the request from the Commission related to the microbiological risks in infant formulae and follow-on formulae. The EFSA J., 113, 1–35. EL MAADANI, M (1996) Génotypage par la réaction de polymérase en chaine avec des amorces arbitraires. Etude d’une épidémie nosocomiae à Enterobacter sakazakii dans une unité de réanimation infantile. PhD Thesis Université de Limoges (F) – Faculté de Pharmacie.

Enterobacteriaceae ESPIÉ, E, WEILL, F X, BROUARD, C, CAPEK, I, DELMAS, G., FORGUES, A M, GRIMONT, F

467

and DE VALK, (2005) Nationwide outbreak of Salmonella enterica serotype Agona infections in infants in France, linked to infant milk formula, investigations ongoing. Eurosurveillance, 10. FAINSTEIN V, HOPFER R L, MILLS K and BODEY G P (1982) Colonization by or diarrhea due to Kluyvera species. J. Infect. Dis., 145, 127. FANG G, ARAUJO V and GUERRANT R L (1991) Enteric infections associated with exposure to animals or animal products Infect. Dis. Clin. North Am., 5, 681–701. FAO/WHO (2004) Report of the meeting on Enterobacter sakazakii and other microorganisms in powdered infant formula, Microbiological Risk Assessment Series No. 6, Geneva (http://www.who.int/foodsafety/publications/micro/enterobacter_ sakazakii/en/) FARMER J J, DAVIS B R, HICKMAN-BRENNER F W, MCWHORTER A, HUNTLEY-CARTER G P, ASBURY M A, RIDDLE C, WATHEN-GRADY H G, ELIAS C, FANNING G R, STEIGERWALT A G, O’HARA C, MORRIS G K, SMITH B and BRENNER D J (1985) Biochemical identification of new species and biogroups of Enterobacteriaceae isolated from clinical specimens. J. Clin. Microbiol., 21, 46–76. FDA/CFSAN (US FOOD AND DRUG ADMINISTRATION/CENTER FOR FOOD SAFETY AND APPLIED NUTRITION) (2002a) Isolation and enumeration of Enterobacter sakazakii from dehydrated powdered infant formula (www. cfsan.fda.gov/~comm/mmesakaz.html) FDA/CFSAN (US FOOD AND DRUG ADMINISTRATION/CENTER FOR FOOD SAFETY AND APPLIED NUTRITION) (2002b) Health professionals letter on Enterobacter sakazakii infections associated with use of powdered (dry) infant formulas in neonatal intensive care units. Office of Nutritional Products, Labelling and Dietary Supplements April 11, 2002; revised October 10, 2002. FLEISCH F, ZIMMERMANN-BAER U, ZBINDEN R, BISCHOFF G, ARLETTAZ R, WALDVOGEL K, NADAL D and RUEF C (2002) Three consecutive outbreaks of Serratia marcescens in a neonatal intensive care unit. Clin Infect Dis., 34, 767–773. FORSYTH, J R, BENNETT, N M, HOGBEN, S, HUTCHINSON, E M, ROUCH, G, TAN, A and TAPLIN, J (2003) The year of the Salmonella seekers – 1977. Aust. N.Z.J. Public Health, 27, 385–389. FRANCINO M P, SANTOS S R and OCHMAN H (2004) Phylogenetic Relationships of Bacteria With Special Reference To Endosymbionts and Enteric Species. In The Prokaryotes (electronic version). FREAN J A, ARNTZEN L, ROSEKILLY I and ISAACSON M. (1994) Investigation of contaminated parenteral nutrition fluids associated with an outbreak of Serratia odorifera septicaemia. J. Hosp. Infect., 27, 263–273. FUENTES F A, HAZEN T C, LOPEZ-TORRES A J and RECHANI P (1985) Klebsiella pneumoniae in orange juice concentrate. Appl. Environ. Microbiol., 49, 1527–1529. GALLAGHER, P G and BALL W S (1991) Cerebral infarctions due to CNS infection with Enterobacter sakazakii. Pediatr. Radiol., 21, 135–136. GANESWIRE R, THONG K L and PUTHUCHEARY S D (2003) Nosocomial outbreak of Enterobacter gergoviae bacteraemia in a neonatal intensive care unit. J. Hosp. Infect., 53, 292–296. GARCIA C, MARTIN A, TIMON M L and CORDOBA J J (2000) Microbial populations and volatile compounds in the ‘bone taint’ spoilage of dry cured ham. Lett Appl Microbiol., 30, 61–66. GARRITY G M (2001) Bergey’s Manual of Systematic Bacteriology, 2nd edn Springer-Verlag New York, NY. GASSEM M A A (2002) A microbiological study of Sobia: a fermented beverage in the Western province of Saudi Arabia. World J. Microbiol.Biotechnol., 18, 173–177. GASTON M A (1988) Enterobacter: an emerging nosocomial pathogen. J. Hosp. Infect., 11, 197–208. GAUTHIER F and ARCHIBALD F (2001) The ecology of ‘fecal indicator’ bacteria commonly found in pulp and paper mill water systems. Water Res., 35, 2207–2218. GERICKE B, DINGER E, HEUCK D, TSCHÄPE H, VOIGT W, CLAUS H and PRESCH C (1993) Clonal spreading of a multidrug resistance Citrobacter freundii strain at a neonatal intensive care unit Zentralbl. Hyg. Umweltmed., 194, 540–552. H

468

Emerging foodborne pathogens

GILMAN R H, MADASAMY M, GAN E, MARIAPPAN M, DAVIS C E

and KYSER K A (1971) Edwardsiella tarda in jungle diarrhoea and a possible association with Entamoeba histolytica. Southeast Asian J. Trop. Med. Public Health, 2, 186–189. GIRI A V, ANANDKUMAR N, MUTHUKUMARAN G and PENNATHUR G (2004) A novel medium for the enhanced cell growth and production of prodigiosin from Serratia marcescens isolated from soil. BMC Microbiol., 4, 11. GONCALVES C R, VAZ T M, LEITE D, PISANI B, SIMOES M, PRANDI M A, ROCHA M M, CESAR P C, TRABASSO P, VON NOWAKONSKI A and IRINO K (2000) Molecular epidemiology of a nosocomial outbreak due to Enterobacter cloacae and Enterobacter agglomerans in Campinas, Sao Paulo, Brazil. Rev. Inst. Med. Trop. Sao Paulo, 42, 1–7. GONZALEZ-RODRIGUEZ M N, SANZ J J, SANTOS J A, OTERO A and GARCIA-LOPEZ M L (2002) Numbers and types of microorganisms in vacuum-packed cold-smoked freshwater fish at the retail level. Int. J. Food Microbiol., 77, 161–168. GRAM L and HUSS H H (1996) Microbiological spoilage of fish and fish products. Int. J. Food Microbiol., 33, 121–137. GREENLEES K J, MACHADO J, BELL T and SUNDLOF S F (1998) Food borne microbial pathogens of cultured aquatic species. Vet. Clin. North Am. Food Anim. Pract., 14, 101–112. GRITSENKO V K, BRYZGALOV F I and SOBOLEV I N (1970) An outbreak of food poisoning caused by Proteus. Gig. Sanit., 35, 90–91. GUARINO A, CAPANO G, MALAMISURA B, ALESSIO M, GUANDALINI S and RUBINO A (1987) Production of Escherichia coli STa-like heat-stable enterotoxin by Citrobacter freundii isolated from humans. J. Clin. Microbiol., 25, 110–114. GUERRANT R L, DICKENS M D, WENZEL R P and KAPIKIAN A Z (1976) Toxigenic bacterial diarrhea: nursery outbreak involving multiple bacterial strains. J. Pediatr., 89, 885– 891. GUILLAUME-GENTIL O, SONNARD V, KANDHAI M C, MARUGG J D and JOOSTEN H (2005) A simple and rapid cultural method for detection of Enterobacter sakazakii in environmental samples. J Food Prot., 68, 64–69. GUPTA A (2002) Hospital-acquired infections in the neonatal intensive care unit – Klebsiella pneumoniae. Semin. Perinatol., 26, 340–345. GUPTA A, AMPOFO K, RUBENSTEIN D and SAIMAN L (2003a) Extended spectrum beta lactamaseproducing Klebsiella pneumoniae infections: a review of the literature. J. Perinatol., 23, 439–443. GUPTA N, CHOUDHARY U, GARG N and ARORA D R (2003b) Enterobacter bacteremia. J. Assoc. Physicians India, 51, 669–672. GUPTA N, YADAV A, CHOUDHARY U and ARORA D R (2003c) Citrobacter bacteremia in a tertiary care hospital. Scand. J. Infect. Dis., 35, 765–768. GUTH B E and PERRELLA E (1996) Prevalence of invasive ability and other virulence-associated characteristics in Providencia alcalifaciens strains isolated in Sao Paulo, Brazil. J Med Microbiol., 45, 459–462. HAMILTON J V, LEHANE M J and BRAIG H R (2003) Isolation of Enterobacter sakazakii from midgut of Stomoxys calcitrans. Emerg. Infect. Dis., 9, 1355–1356. HARBARTH S, SUDRE P, DHARAN S, CADENAS M and PITTET D (1999) Outbreak of Enterobacter cloacae related to understaffing, overcrowding, and poor hygiene practices. Infect. Control Hosp. Epidemiol., 20, 598–603. HATHEWAY C L and FARMER J J (1991) Clostridium perfringens or Klebsiella pneumoniae as the cause of a food-borne outbreak. J. Clin. Microbiol., 29, 415–416. HAWKINS R E, LISSNER C R and SANFORD J P (1991) Enterobacter sakazakii bacteremia in an adult. South Med. J., 84, 793–795. HAYEK L J and WILLIS G W (1976) A comparison of two commercial methods for the identification of the Enterobacteriaceae – API 20E and the Enterotube – with conventional methods. J. Clin. Pathol., 29, 158–161. HEJAZI A and FALKINER F R (1997) Serratia marcescens. J. Med. Microbiol., 46, 903–912. HERVAS J A, BALLESTEROS F, ALOMAR A, GIL J, BENEDI V J and ALBERTI S (2001) Increase of

Enterobacteriaceae

469

Enterobacter in neonatal sepsis: a twenty-two-year study. Pediatr. Infect. Dis. J., 20, 134–140. HEUVELINK A E, KODDE F D, ZWARTKRUIS-NAHUIS J T M and BOER E (2001) Enterobacter sakazakii in melkpoeder. Keuringsdients van Waren Oost. Project Number OT0110. HEUVELINK A E, ZWARTKRUIS-NAHUIS J T M, VAN DER A H, WIR B, VAN OOSTEROM R and DE BOER E (2003) Handhavingsactie Enterobacter sakazakii in zuigelingenvoeding. Keuringsdients van Waren Oost. Project Number OT0210. HIGHSMITH A K and JARVIS W R (1985) Klebsiella pneumoniae: selected virulence factors that contribute to pathogenicity. Infect. Control, 6,75–77. HOLZMAN R S, FLORMAN A L, PODRID P J, SIMBERKOFF M S and TOHARSKY B (1974) Drugassociated diarrhoea as a potential reservoir for hospital infections. Lancet, 1, 1195– 1196. HORAN T C, WHITE J W, JARVIS W R, EMORI T G, CULVER D H, MUNN V P, THORNSBERRY C, OLSON D R and HUGHES J M (1986). Nosocomial infection surveillance, 1984. Morb. Mortality Wkly Rep., 35, 17SS–29SS. HUANG S H, STINS M F and KIM K S (2000) Bacterial penetration across the blood-brain barrier during the development of neonatal meningitis. Microbes Infect., 2, 1237– 1244. IFT (INSTITUE OF FOOD TECHNOLOGISTS) (2004) Bacteria associated with foodborne diseases. August 2004. ISO (INTERNATIONAL ORGANIZATION FOR STANDARDIZATION) (1991a) Microbiology – General guidance for the detection of Enterobacteriaceae with pre-enrichment; Standard 8523:1991. ISO (INTERNATIONAL ORGANIZATION FOR STANDARDIZATION) (1991b) Microbiology – General guidance for the enumeration of coliforms – Most probable number technique. Standard 4831:1991. ISO (INTERNATIONAL ORGANIZATION FOR STANDARDIZATION) (1991c) Microbiology – General guidance for the enumeration of coliforms – colony count technique. Standard 4832:1991 ISO (INTERNATIONAL ORGANIZATION FOR STANDARDIZATION) (1993) Microbiology – General guidance for the enumeration of Enterobacteriaceae without resuscitation – MPN technique and colony-count technique; Standard 7402:1993. ISO (INTERNATIONAL ORGANIZATION FOR STANDARDIZATION) (2005) Milk and milk products – Detection of Enterobacter sakazakii. Technical Standard 22964 (under development). IVERSEN C and FORSYTHE S J (2003) Risk profile of Enterobacter sakazakii, an emergent pathogen associated with infant milk formula. Trends Food Sci. Technol., 11, 443– 454. IVERSEN C and FORSYTHE S J (2004) Isolation of Enterobacter sakazakii and other Enterobacteriaceae from powdered infant formula milk and related products. Food Microbiology, 21, 771–777. IVERSEN C, DRUGGAN P D and FORSYTHE S J (2004a) A selective differential medium for Enterobacter sakazakii. Int. J. Food Microbiology, 96, 133–139. IVERSEN C, LANE M and FORSYTHE S J (2004b) The growth profile, thermotolerance and biofilm formation of Enterobacter sakazakii grown in infant formula milk. Lett. Appl. Microbiol., 38, 378–382. IVERSEN C, WADDINGTON M, ON S L and FORSYTHE S (2004c) Identification and phylogeny of Enterobacter sakazakii relative to Enterobacter and Citrobacter Species. J. Clin. Microbiol., 42, 5368–5370 IVS (INSTITUT DE VEILLE SANITAIRE) (2005) Infection à Salmonella Worthington; Janvier – Juin 2005, France. JANDA J M (2004) New Members of the Family Enterobacteriaceae. In The Prokaryotes (electronic version). JANDA J M and ABBOTT S L (1993) Infections associated with the genus Edwardsiella: the role of Edwardsiella tarda in human disease. Clin. Infect. Dis., 17, 742–748.

470

Emerging foodborne pathogens

and ABBOTT S L (1999) Unusual food-borne pathogens: Listeria monocytogenes, Aeromonas, Plesiomonas, and Edwardsiella species. Clin. Lab. Med., 19, 553–582. JANDA J M, ABBOTT S L, KROSKE-BYSTROM S, CHEUNG W K, POWERS C, KOKKA R P and TAMURA K (1991) Pathogenic properties of Edwardsiella species. J. Clin. Microbiol. 29, 1997– 2001. JANICKA G, KANIA I, ULATOWSKA B, KRUSZYNSKA E, and WOJDA M (1999) The occurrence of the Enterobacter genus rods in the clinical materials and materials taken from hospital environment. Wiad Lek., 52, 554–558. JARURATANASIRIKUL S and KALNAUWAKUL S (1991) Edwardsiella tarda: a causative agent in human infections. Southeast Asian J. Trop. Med. Public Health., 22, 30–34. JARVIS W R, MUNN V P, HIGHSMITH A K, CULVER D H and HUGHES J M (1985) The epidemiology of nosocomial infections caused by Klebsiella pneumoniae. Infect. Control, 6, 68–74. JASPAR A H, MUYTJENS H L and KOLLEE L A (1990) Neonatal meningitis caused by Enterobacter sakazakii: milk powder is not sterile and bacteria like milk too! Tijdschr. Kindergeneeskd., 58, 151–155. JAYARAO B M and WANG L (1999) A study on the prevalence of Gram-negative bacteria in bulk tank milk J. Dairy Sci., 82, 2620–2624. JENSEN N, VARELIS P and WHITFIELD F B (2001) Formation of guaiacol in chocolate milk by the psychrotrophic bacterium Rahnella aquatilis. Lett. Appl. Microbiol., 33, 339–343. JERTBORN M and SVENNERHOLM A M (1991) Enterotoxin-producing bacteria isolated from Swedish travellers with diarrhoea. Scand. J. Infect Dis., 23, 473–479. JIMENEZ E B and GIMENEZ C (1982) Septic shock due to Enterobacter sakazakii. Clin. Microbiol. Newsl., 4, 30. JONES B L, GORMAN L J, SIMPSON J, CURRAN E T, MCNAMEE S, LUCAS C, MICHIE J, PLATT D J and THAKKER B (2000) An outbreak of Serratia marcescens in two neonatal intensive care units. J. Hosp. Infect., 46, 314–319. KAFETZIS D A, SKEVAKI C and COSTALOS C (2003) Neonatal necrotizing enterocolitis: an overview. Curr. Opin. Infect. Dis., 16, 349–355. KHANDAI M C, REIJ M W, GORRIS L G, GUILLAUME-GENTIL O and VAN SCHOTHORST M (2004a) Occurrence of Enterobacter sakazakii in food production environments and households. Lancet, 363, 39–40. KHANDAI M C, REIJ M W, VAN PUYVELDE K, GUILLAUME-GENTIL O, BEUMER R R and VAN SCHOTHORST M (2004b) A new protocol for the detection of Enterobacter sakazakii applied to environmental samples. J. Food Prot., 67, 1267–1270. KANKI M, YODA T, TSUKAMOTO T and SHIBATA T (2002) Klebsiella pneumoniae produces no histamine: Raoultella planticola and Raoultella ornithinolytica strains are histamine producers. Appl. Environ. Microbiol., 68, 3462–3466. KIDDY K, JOSSE E and GRIFFIN N (1987) An outbreak of serious Klebsiella infections related to food blenders. J. Hosp. Infect., 9, 191–193. KRONVALL G and HAGELBERG A (2002) Numerical evaluation of minimal biochemical test combinations for the identification of Enterobacteriaceae species. APMIS, 110, 451– 457. KUHN H M, MEIER-DIETER U and MAYER H (1988) ECA, the enterobacterial common antigen. FEMS Microbiol. Rev., 4, 195–222. KUZINA L V, PELOQUIN J J, VACEK D C and MILLAR T A (2001) Isolation and identification of bacteria associated with adult laboratory Mexican fruit flies, Anastrepha ludens (Diptera: Tephritidae). Current Microbio., 42, 290–294. LAI K K (2001) Enterobacter sakazakii infections among neonates, infants, children, and adults. Case reports and a review of the literature. Medicine (Baltimore), 80, 113–122. LECLERC H, MOSSEL D A A, EDBERG S C and STRUIJK C B (2001) Advances in the bacteriology of the coliform group: Their suitability as markers of microbial water safety. Ann. Rev. Microbiol., 55, 201–234. LEE J S and POLIN R A (2003) Treatment and prevention of necrotizing enterocolitis. Semin. Neonatol., 8, 449–459. JANDA J M

Enterobacteriaceae

471

and STEPHAN R (2004) Microbiological, epidemiological, and food safety aspects of Enterobacter sakazakii. J. Food Prot., 67, 2850–2857. LEHNER A, TASARA T and STEPHAN R (2004) 16S rRNA gene based analysis of Enterobacter sakazakii strains from different sources and development of a PCR assay for identification. BMC Microbiol., 25, 43–49. LEUSCHNER R G and BEW J (2004) A medium for the presumptive detection of Enterobacter sakazakii in infant formula: interlaboratory study. J. AOAC Int., 87, 604–613. LEUSCHNER R G K, BAIRD F, DONALD B and COX L J (2004) A medium for the presumptive detection of Enterobacter sakazakii in infant formula. Food Microbiol., 21, 527–533. MACIAS A E, MUNOZ J M, HERRERA L E, MEDINA H, HERNANDEZ I, ALCANTAR D and PONCE DE LEON S (2004) Nosocomial pediatric bacteremia: the role of intravenous set contamination in developing countries. Infect. Control Hosp. Epidemiol., 25, 226–230. MACRAE M B, SHANNON K P, RAYNER D M, KAISER A M, HOFFMAN P N and FRENCH G L (2001) A simultaneous outbreak on a neonatal unit of two strains of multiply antibiotic resistant Klebsiella pneumoniae controllable only by ward closure. J. Hosp. Infect., 49, 183– 192. MARINO M, MAIFRENI M, MORET S and RONDININI G (2000) The capacity of Enterobacteriaceae species to produce biogenic amines in cheese. Lett. Appl. Microbiol., 31, 168–173. MASAKI H, ASOH N, TAO M, IKEDA H, DEGAWA S, MATSUMOTO K, INOKUCHI K, WATANABE K, WATANABE H and OISHI K (2001) Detection of gram-negative bacteria in patients and hospital environment at a room in geriatric wards under the infection control against MRSA. Kansenshogaku Zasshi, 75, 144–150. MASSA S, GARDINI F, SINIGAGLIA M and GUERZONI M E (1992) Klebsiella pneumoniae as a spoilage organism in mozzarella cheese. J. Dairy Sci., 75, 1411–1414. MAVZIUTOV A R, FIALKINA S V and BONDARENKO V M (2002) Pathogenicity islands in opportunistic Enterobacteria. Zh. Mikrobiol. Epidemiol. Immunobiol., 6, 5–9. MAYHALL C G, LAMB V A, BITAR C M, MILLER K B, FURSE E Y, KIRKPATRICK B V, MARKOWITZ S M, VEAZEY J M and MACRINA F L (1980) Nosocomial Klebsiella infection in a neonatal unit: identification of risk factors for gastrointestinal colonization. Infect. Control, 1, 239– 246. MENSAH P, YEBOAH-MANU D, OWUSU-DARKO K and ABLORDEY A (2002) Street foods in Accra, Ghana: how safe are they? Bull. World Health Organization, 80, 546–554. MIRANDA C D, KEHRENBERG C, ULEP C, SCHWARZS and ROBERTS M C (2003) Diversity of tetracycline resistance genes in bacteria from Chilean salmon farms. Antimicrobial Agents Chemotherapy, 47, 883–888. MOKRACKA J, KOCZURA R and KAZNOWSKI A (2004) Yersiniabactin and other siderophores produced by clinical isolates of Enterobacter spp. and Citrobacter spp. FEMS Immunol. Med. Microbiol., 40, 51–55. MONROE P W and TIFT W L (1979) Bacteremia associated with Enterobacter sakazakii (yellow pigmented Enterobacter cloacae). J. Clin. Microbiol., 10, 850–851. MONTGOMERIE J Z, DOAK P B, TAYLOR D E, NORTH J D and MARTIN W J (1970) Klebsiella in faecal flora of renal-transplant patients. Lancet, 2, 787–792. MORALES P , FERNANDEZ - GARCIA E and NUNEZ M (2003) Caseinolysis in cheese by Enterobacteriaceae strains of dairy origin. Lett. Appl. Microbiol., 37, 410–414. MORALES P, FELIU I, FERNANDEZ-GARCIA E and NUNEZ M (2004) Volatile compounds produced in cheese by Enterobacteriaceae strains of dairy origin. J. Food Prot., 67, 567–573. MORAN N A and BAUMANN P (2000) Bacterial endosymbionts in animals. Curr. Opin. Microbiol., 3, 270–275. MULLER H E (1986) Occurrence and pathogenic role of Morganella-Proteus-Providencia group bacteria in human feces. J. Clin. Microbiol., 23, 404–405. MURATA T, IIDA T, SHIOMI Y, TAGOMORI K, AKEDA Y, YANAGIHARA I, MUSHIAKE S, ISHIGURO F and HONDA T (2001) A large outbreak of foodborne infection attributed to Providencia alcalifaciens. J. Infect. Dis., 184, 1050–1055. MUYTJENS H L, ZANEN H C, SONDERKAMP H J, KOLLÉE L A, WACHSMUTH I K and FARMER J J (1983) LEHNER A

472

Emerging foodborne pathogens

Analysis of eight cases of neonatal meningitis and sepsis due to Enterobacter sakazakii. J. Clin. Microbiol., 18, 115–120. MUYTJENS H L, VAN DER ROS-VAN DE REPE J and VAN DRUTEN H A (1984) Enzymatic profiles of Enterobacter sakazakii and related species with special reference to the alpha-glucosidase reaction and reproducibility of the test system. J. Clin. Microbiol., 20, 684–686. MUYTJENS, H L, ROELOFS-WILLEMSE H and JASPAR G H (1988) Quality of powdered substitutes for breast milk with regard to members of the family Enterobacteriaceae. J. Clin. Microbiol., 26, 743–746. NAGEL P, SERRITELLA A and LAYDEN T J (1982) Edwardsiella tarda gastroenteritis associated with a pet turtle. Gastroenterology., 82, 1436–1437. NAZAROWEC-WHITE M, FARBER J M (1997a) Enterobacter sakazakii: a review. Int. J. Food Microbiol., 34, 103–113. NAZAROWEC-WHITE M and FARBER J M (1997b) Thermal resistance of Enterobacter sakazakii in reconstituted dried-infant formula. Lett. Appl. Microbiol., 24, 9–13. NAZAROWEC-WHITE M and FARBER J M (1999) Phenotypic and genotypic typing of food and clinical isolates of Enterobacter sakazakii. J. Med. Microbiol., 48, 559–567. NOVAK F R, ALMEIDA J A, ASENSI M D, MORAES B A and DOS PRAZERES RODRIGUES D (2001) Antimicrobial resistance of coliform isolates from expressed human milk. Cad. Saude Publica., 17, 713–717. O’CONNELL N H and HUMPHREYS H (2000) Intensive care unit design and environmental factors in the acquisition of infection. J. Hosp. Infect., 45, 255–262. OH S W and KANG D H (2004) Fluorogenic selective and differential medium for isolation of Enterobacter sakazakii. Appl. Environ. Microbiol., 70, 5692–5694. O’HARA C M, BRENNER F W and MILLER J M (2000) Classification, identification, and clinical significance of Proteus, Providencia, and Morganella. Clin. Microbiol. Rev.,13, 534– 546. OLIVER A M, BADDLEY J W and BRIDGES S L (2003) Polymicrobial septic arthritis in a patient with Wilson’s disease. Ann. Rheumatic Dis., 62, 693–694. OLSSON C, OLOFSSON T, AHRNE S and MOLIN G (2003) The Yersinia HPI is present in Serratia liquefaciens isolated from meat. Lett. Appl. Microbiol., 37, 275–280. ONGRADI J (2002) Vaginal infection by Enterobacter sakazakii. Sex Transm. Infect., 78, 467–469. PAGOTTO F J, NAZAROWEC-WHITE M, BIDAWID S and FARBER J M (2003) Enterobacter sakazakii: infectivity and enterotoxin production in vitro and in vivo. J. Food Prot., 66, 370–375. PANIGRAHI D, ROY P and CHAKRABARTI A (1991) Enterotoxigenic Klebsiella pneumoniae in acute childhood diarrhoea. Indian J. Med. Res., 93, 293–296. PARODI S, LECHNER A, OSIH R, VESPA P and PEGUES D (2003) Nosocomial enterobacter meningitis: risk factors, management, and treatment outcomes. Clin Infect. Dis., 37, 159–166. PODSCHUN R and ULLMANN U (1998) Klebsiella spp. as nosocomial pathogens: epidemiology, taxonomy, typing methods, and pathogenicity factors. Clin. Microbiol. Rev., 11, 589– 603. PODSCHUN R, FISCHER A and ULLMANN U (2001) Characterisation of Hafnia alvei isolates from human clinical extra-intestinal specimens: haemagglutinins, serum resistance and siderophore synthesis. J. Med. Microbiol., 50, 208–214. POPOVICI M, SZEGLI L, SOARE L, NEGUT A, DIMITRIU N and STANCIU V (1964) Role of germs of the Citrobacter group in the etiology of alimentary toxinfections. Arch. Roum. Pathol. Exp. Microbiol., 23, 1005–1010. POSTUPA, R and ALDOVA, E (1984) Enterobacter sakazakii: a Tween 80 esterase-positive representative of the genus Enterobacter isolated from powdered milk specimens. J. Hyg. Epidemiol. Microbiol. Rev., 7, 311–327. PRIEM S, FRANZ J and KRAUSE A (1999) Etiology and pathogenesis of bacteria-induced arthritis. Infectious arthritis, reactive arthritis, Lyme arthritis. Internist (Berl), 40, 936–944. RAHN O (1937) New principles for the classification of bacteria. Zentralbl. Bakteriol. Parasitenkd. Infectionskr. Hyg., Abt. II, 96, 273–286.

Enterobacteriaceae RAMIA S, NETER E

473

and BRENNER D J (1982) Production of enterobacterial common antigen as an aid to classification of newly identified species of the families Enterobacteriaceae and Vibrionaceae. Int. J. Syst. Bacteriol., 32, 395–398. REINA, J, PARRAS F, GIL J, SALVA F and ALOMAR P (1989) [Human infections caused by Enterobacter sakazakii. Microbiologic considerations]. Enferm. Infecc. Microbiol. Clin., 7, 147–150. RENNIE R P, ANDERSON C M, WENSLEY B G, ALBRITTON W L and and MAHONY D E (1990) Klebsiella pneumoniae gastroenteritis masked by Clostridium perfringens. J. Clin. Microbiol., 28, 216–219. ROBERTSON L J, JOHANNESSEN G S, GJERDE B K and LONCAREVIC S (2002) Microbiological analysis of seed sprouts in Norway. Int. J. Food Microbiol., 75, 119–126. SABOTA J M, HOPPES W L, ZIEGLER J R, DUPONT H, MATHEWSON J and RUTECKI G W (1998) A new variant of food poisoning: enteroinvasive Klebsiella pneumoniae and Escherichia coli sepsis from a contaminated hamburger. Am. J. Gastroenterol., 93, 118–119. SAHLY H, PODSCHUN R and ULLMANN U (2000) Klebsiella infections in the immunocompromised host. Adv. Exp. Med. Biol., 479, 237–249. SECHTER I, SHMILOVITZ M, ALTMANN G, SELIGMANN R, KRETZER B, BRAUNSTEIN I and GERICHTER C B (1983) Edwardsiella tarda isolated in Israel between 1961 and 1980. J. Clin. Microbiol., 17, 669–671. SELDEN R, LEE S, WANG W L, BENNETT J V and EICKHOFF T C (1971) Nosocomial Klebsiella infections: intestinal colonization as a reservoir. Ann. Intern. Med., 74, 657–664. SENIOR B W (1997) Media for the detection and recognition of the enteropathogen Providencia alcalifaciens in faeces. J. Med. Microbiol., 46, 524–527. SEO K H and BRACKETT R E (2005) Rapid, specific detection of Enterobacter sakazakii in infant formula using a real-time PCR assay. J Food Prot., 68, 59–63. SHLAES D M (1993) The clinical relevance of Enterobacter infections. Clin. Ther.,15 Suppl A, 21–28. SILBERNAGEL K M, LINDBERG K G (2002) Evaluation of the 3M Petrifilm Enterobacteriaceae Count plate method for the enumeration of Enterobacteriaceae in foods. J. Food Prot., 65, 1452–1456. SIMI S, CARBONELL G V, FALCON R M, GATTI M S, JOAZEIRO P P, DARINI A L and YANO T (2003) A low molecular weight enterotoxic hemolysin from clinical Enterobacter cloacae. Can. J. Microbiol., 49, 479–482. SIMMONS B P, GELFAND M S, HAAS M, METTS L and FERGUSON J (1989) Enterobacter sakazakii infections in neonates associated with intrinsic contamination of a powdered infant formula. Infect. Control Hosp. Epidemiol., 10, 398–401. SINGH B R and KULSHRESHTHA S B (1992) Preliminary examinations on the enterotoxigenicity of isolates of Klebsiella pneumoniae from seafoods. Int. J. Food Microbiol., 16, 349– 352. SINGH B R, SINGH Y and TIWARI A K (1997) Characterization of virulence factors of Serratia strains isolated from foods. Int. J. Food Microbiol., 34, 259–266. SONCINI G, D’AUBERT S and CANTONI C (1982) A food poisoning outbreak caused by Proteus vulgaris. Ind. Aliment., 21, 865–867. SORIANO J M, RICO H, MOLTO J C and MAÑES J (2001) Incidence of microbial flora in lettuce, meat and Spanish potato omelette from restaurants. Food Microbiol., 18, 159–163. SRINIVASA-RAO P S, YAMADA Y, TAN Y P and LEUNG K Y (2004) Use of proteomics to identify novel virulence determinants that are required for Edwardsiella tarda pathogenesis. Mol. Microbiol., 53, 573–586. STANECK J L, VINCELETTE J, LAMOTHE F and POLK E A (1983) Evaluation of the Sensititre system for identification of Enterobacteriaceae. J. Clin. Microbiol., 7, 647–654. STOLL B J, HANSEN N, FANAROFF A A and LEMONS J A (2004) Enterobacter sakazakii is a rare cause of neonatal septicemia or meningitis in VLBW infants. J. Pediatr., 144, 821– 823.

474

Emerging foodborne pathogens

STRICKER T, FROHLICH S and NADAL D (1998) Osteomyelitis and septic arthritis due to Citrobacter

freundii and Haemophilus influenzae type b. J. Paediatr. Child Health, 34, 90–91. and LIEBER E R (1979) Histamine production by Klebsiella pneumoniae and an incident of scombroid fish poisoning. Appl. Environ. Microbiol., 37, 274–278. TEKKOK I H, BAEESA S S, HIGGINS M J and VENTUREYRA E C (1996) Abscedation of posterior fossa dermoid cysts. Childs Nerv. Syst., 12, 318–322. THURM V and GERICKE B (1994) Identification of infant food as a vehicle in a nosocomial outbreak of Citrobacter freundii: epidemiological subtyping by allozyme, whole-cell protein and antibiotic resistance. J. Appl. Bacteriol., 76, 553–558. THURN J, CROSSLEY K, GERDTS A, MAKI M and JOHNSON J (1990) Enteral hyperalimentation as a source of nosocomial infection. J. Hosp. Infect., 15, 203–217. TOMASOFFOVA A, BINDAS B and NOVACK A L (1965) Outbreak of toxicoinfective food poisoning due to one serotype of P. hauseri, biotype P. mirabilis. J. Hyg. Epidemiol. Microbiol. Immunol., 69, 54–59. TRESOLDI A T, PADOVEZE M C, TRABASSO P, VEIGA J F, MARBA S T, VON NOWAKONSKI A and BRANCHINI M L (2000) Enterobacter cloacae sepsis outbreak in a newborn unit caused by contaminated total parenteral nutrition solution. Am. J. Infect. Control, 28, 258– 261. TSCHÄPE H, PRAGER R, STRECKEL W, FRUTH A, TIETZE E and BOHME G (1995) Verotoxinogenic Citrobacter freundii associated with severe gastroenteritis and cases of haemolytic uraemic syndrome in a nursery school: green butter as the infection source. Epidemiol. Infect., 114, 441–450. TUOHY P G and JACOBS M (2005) Inquiry into actions of sector agencies in relation to contamination of infant formula with Enterobacter sakazakii. Report Ministry of Health, 133 Molesworth Street, Wellington, New Zealand. URMENYI A M C and FRANKLYN A W (1961) Neonatal death from pigmented coliform infection. Lancet, 1, 313–315. VAN ACKER J, DE SMET F, MUYLDERMANS G, BOUGATEF A, NAESSENS A and LAUWERS S (2001) Outbreak of necrotizing enterocolitis associated with Enterobacter sakazakii in powdered milk formula. J. Clin. Microbiol., 39, 293–297. VAN BOHEMEN C G, WETERINGS E, GOEI THE H S, GRUMET F C and ZANEN H C (1988) Enterobacterial involvement in the pathogenesis of secondary ankylosing spondylitis. Br J Rheumatol., 27 Suppl 2, 61–67. VAN DEN BERG R W, CLAAHSEN H L, NIESSEN M, MUYTJENS H L, LIEM K and VOSS A (2000) Enterobacter cloacae outbreak in the NICU related to disinfected thermometers. J. Hosp. Infect., 45, 29–34. VANDEPITTE J, VAN DAMME L, FOFANA Y and DESMYTER J (1980) Edwardsiella tarda and Plesiomonas shigelloides: Their role as diarrhea agents and their epidemiology. Bull. Soc. Pathol. Exot. Filiales, 73, 139–149. VANDEPITTE J, LEMMENS P and DE SWERT L (1983) Human edwardsiellosis traced to ornamental fish. J. Clin. Microbiol., 17, 165–167. VAN OGTROP M L, VAN ZOEREN-GROBBEN D, VERBAKEL-SALOMONS E M and VAN BOVEN C P (1997) Serratia marcescens infections in neonatal departments: description of an outbreak and review of the literature. J. Hosp. Infect., 36, 95–103. VICINI E, PREVIDI M P and LUSARDI C (1999) Ability of enterobacteria to spoil fruit nectars. Ind. Cons., 74, 3–9. VILLARI P, CRISPINO M, SALVADORI A and SCARCELLA A (2001) Molecular epidemiology of an outbreak of Serratia marcescens in a neonatal intensive care unit. Infect. Control Hosp. Epidemiol., 22, 630–634. VISWANATHAN P and KAUR R (2001) Prevalence and growth of pathogens on salad vegetables, fruits and sprouts. Int. J. Hyg. Environ. Health, 203, 205–213. WANG C C, CHU M L, HO L J, HWANG R C (1991) Analysis of plasmid pattern in paediatric TAYLOR S L, GUTHERTZ L S, LEATHERWOOD M

Enterobacteriaceae

475

intensive care unit outbreaks of nosocomial infection due to Enterobacter cloacae. J Hosp Infect. Sep; 19(1): 33–40. WHITFIELD F (2003) Microbiologically derived off-flavours. In Taints and off-flavours in foods, (ed. B Baigrie); Woodhead Publishing Limited, Cambridge. YANG H Y, LIU Y N (1998) Investigation on a case of toxicosis caused by eating mutton. Meat Hygiene, 9, 7–9. YU W L, CHENG H S, LIN H C, PENG C T and TSAI C H (2000) Outbreak investigation of nosocomial Enterobacter cloacae bacteraemia in a neonatal intensive care unit. Scand. J. Infect. Dis., 32, 293–298. ZAMXAKA M, PIRONCHEVA G and MUYIMA N Y O (2004) Bacterial community patterns of domestic water sources in the Gogogo and Nkonkobe areas of the Eastern Cape Province, South Africa. Water SA, 30, 341–346. ZIETZE H J (1984) Illnesses following consumption of communal provisions caused by mixed infection with Proteus bacteria and their causes. Z. Gesamte Hyg., 30, 224– 225.

476

Emerging foodborne pathogens

18 Campylobacter R. E. Mandrell and W. G. Miller, US Department of Agriculture, USA

18.1

Introduction

Campylobacter cells may have been observed for the first time more than a century ago (Escherich, 1886). However, it is only in the last three decades that the scientific community has become aware that Campylobacter species are biologically diverse; cause a variety of diseases (Skirrow and Blaser, 2000; Nachamkin, 2003), including chronic disease (Table 18.1) (Nachamkin, 2002); colonize a wide range of hosts (Table 18.2) (Skirrow and Blaser, 2000; Miller and Mandrell, 2005); and contaminate a variety of meats and other food items (Table 18.3) (Mandrell and Brandl, 2004; Miller and Mandrell, 2005). The emphasis in Campylobacter research shifted during this time from exclusively veterinary research (‘Vibrio fetus’), to research on culturing and incidence of possible human Campylobacter enetric pathogens (‘vibriorelated’), as well as research primarily on the incidence, epidemiology and pathogenesis of Campylobacter jejuni. The emphasis on studies of C. jejuni has been deserved considering the eventual recognition of C. jejuni’s importance in sporadic and outbreak disease, and occasional serious disease following diarrheoal illness (e.g. Guillain-Barré Syndrome) (Nachamkin et al., 1998). However, recently, it has become apparent that thermophilic species of Campylobacter other than C. jejuni (e.g. C. coli, C. upsaliensis and C. lari) and non-thermophilic Campylobacter species (e.g. C. fetus, C. concisus, C. curvus) are also worthy of attention. This awareness has been stimulated by reports of increased isolation of less common Campylobacter species with less selective culture methods, and the association of some of these species with severe systemic disease (Table 18.1) (Bourke et al., 1998; Bär et al., 1996; Lastovica and Skirrow, 2000; Goossens et al., 1990b; Vandamme, 2000; Abbott et al., 2005).

Campylobacter Table 18.1

477

Diseases associated with Campylobacter Species

Species

Disease

References

C. colia C. concisus

Enteritis Enteritis

(Miller and Mandrell, 2005) (Maher et al., 2003; Engberg et al., 2000; Aabenhus et al., 2002; Lindblom et al., 1995; Vandamme et al., 1989; Musmanno et al., 1998; Matsheka et al., 2002) (Kamma et al., 2000) (Bär et al., 1996) (Maher et al., 2003; Abbott et al., 2005) (Bär et al., 1996)

C. curvus C. fetus subsp. fetusb

Periodontal disease Bacteremia Enteritis Enteritis Bacteremia

Endocarditis Chorioamnionitis Thrombophlebitis Osteomyelitis Pleuropericarditis Meningitis/ brain abcess Cellulitis Prosthetic hip joint infection Aneurism infection C. gracilis

C. helveticus C. hominis C. hyointestinalis

C. jejuni

Enteritis Periodontal disease Head/neck infections None/unknown None/Unknown Enteritis Bacteremia Proctitis Enteritis GBS Miller-Fisher Syndrome

(CDC, 1981; Francioli et al., 1985; Spelman et al., 1986; Noguchi et al., 1989; Morrison et al., 1990; Neuzil et al., 1994; Howe et al., 1995; Watine et al., 1995; Schonheyder et al., 1995; Bär et al., 1996; Ichiyama et al., 1998; Sakran et al., 1999; Briedis et al., 2002; Heng et al., 2002; Teh et al., 2004) (Bär et al., 1996; Peetermans et al., 2000) (Viejo et al., 2001) (Francioli et al., 1985) (Francioli et al., 1985; Allerberger et al., 1991) (Morrison et al., 1990) (La Scola et al., 1998; Dronda et al., 1998) (Francioli et al., 1985; Ichiyama et al., 1998; Briedis et al., 2002) (Bates et al., 1994; Yao et al., 1993) (Rutherford et al., 1989; Kato et al., 1990; Lozano et al., 1999; Mii et al., 1998) (Maher et al., 2003) (Tanner et al., 1998; Kamma et al., 2000; Siqueira and Rocas, 2003) (Johnson et al., 1985) (Minet et al., 1988; Lawson et al., 1999; Lawson et al., 1998; Gorkiewicz et al., 2002) (Bär et al., 1996) (Fennell et al., 1986) (Miller and Mandrell, 2005) (Nachamkin et al., 1998) (Willison and O’Hanlon, 1999)

478

Emerging foodborne pathogens

Table 18.1

Continued

Species

C. lanienae C. lari

C. mucosalis C. rectus

C. showae C. sputorum C. upsaliensis

a b

Disease

References

Polyneuropathies Reactive arthritis Myocarditis

(Yuki et al., 1999) (Ebright and Ryan, 1984) (Florkowski et al., 1984; Westling and Evengard, 2001)

None/unknown Enteritis

(Broczyk et al., 1987; Chiu et al., 1995; Goudswaard et al., 1995; Notario et al., 1996; Lin et al., 1998; Prasad et al., 2001; Otasevic et al., 2004) Septicemia/ (Morris et al., 1998; Skirrow et al., 1993; bacteremia Soderstrom et al., 1991; Krause et al., 2002; Martinot et al., 2001) Septic shock (Werno et al., 2002) Purulent pleurisy (Bruneau et al., 1998) Urinary tract infection (Bezian et al., 1990) Reactive arthritis (Goudswaard et al., 1995) Hemorrhagic colitis (Anderson et al., 1996) Septicemia (Soderstrom et al., 1991) Periodontal disease (Mandell et al., 1992; Rams et al., 1993; Tanner et al., 1998; Kamma et al., 1999; Macuch and Tanner, 2000; Siqueira and Rocas, 2003; Ihara et al., 2003) Hepatolithiasis (Harada et al., 2001) Periodontal disease (Macuch and Tanner, 2000) Hepatolithiasis (Harada et al., 2001) Enteritis (Lindblom et al., 1995) Septicemia (Tee et al., 1998) Axillary abcess (On et al., 1992) Enteritis (Goossens et al., 1990b; Lauwers et al., 1991; Goossens et al., 1995; Lindblom et al., 1995; Carter and Cimolai, 1996; Musmanno et al., 1998; Bourke et al., 1998; Jimenez et al., 1999; Prasad et al., 2001; Boyanova et al., 2004) Bacteremia (Lastovica et al., 1989; Chusid et al., 1990; 1990; Hanna et al., 1994; Bär et al., 1996) Prosthetic knee (Issartel et al., 2002) infection

C. coli and C. jejuni information has been included for purposes of comparison with ECS. Additional details on these species are available in a similar review by Miller and Mandrell (2005). C. fetus subsp. venerealis not known to cause disease in humans.

In this chapter, we review the history, epidemiology, incidence, food sources, disease and culture/detection methods related to emerging Campylobacter species (ECS), and recent genomic sequence data that is relevant to future studies of ECS. We refer the reader to other reviews of Campylobacter that emphasize C. jejuni and C. coli (Nachamkin et al., 1992; Nachamkin and

Campylobacter Table 18.2

479

Host range of Campylobacter species

Organism

Observed host range

References

C. coli C. concisus

Multiplea Humans

C. curvus

Humans

C. fetusb

Cattle

(Miller and Mandrell, 2005) (Lindblom et al., 1995; Macuch and Tanner, 2000; Aabenhus et al., 2002) (Macuch and Tanner, 2000; Koga et al., 1999; Abbott et al., 2005) (Inglis et al., 2004; Manser and Dalziel, 1985; Terzolo, 1988; Atabay and Corry, 1998) (Diker et al., 2000; Varga, 1990) (Logue et al., 2003) (Harvey and Greenwood, 1985) (Rennie et al., 1994; Skirrow et al., 1993; Sauerwein et al., 1993) (Macuch and Tanner, 2000; Johnson et al., 1985; Socransky et al., 1998) (Stanley et al., 1992; Shen et al., 2001) (Stanley et al., 1992; Engvall et al., 2003) (Atabay and Corry, 1998; Busato et al., 1999; Inglis et al., 2004) (Hanninen et al., 2002; Hill et al., 1987) (Gebhart et al., 1985) (Gebhart et al., 1983; Chang et al., 1984; On et al., 1995) (Russell et al., 1992; Misawa et al., 2000) (Fennell et al., 1986; Edmonds et al., 1987; Gorkiewicz et al., 2002) (Lawson et al., 2001) (Miller and Mandrell, 2005) (Inglis et al., 2003; Inglis and Kalischuk, 2004) (Daly et al., 2001) (Sasaki et al., 2003) (Logan et al., 2000) (Benjamin et al., 1983; Giacoboni et al., 1993; Aarestrup et al., 1997) (Waldenstrom et al., 2002; Maruyama et al., 1990)

Sheep Poultry Reptiles Humans C. gracilis

Humans

C. helveticus C. hominis C. hyointestinalisc

Cats Dogs Cattle Deer Hamsters Pigs Primates Humans

C. jejuni C. lanienae

C. lari

Humans Multiplea Cattle Horses Pigs Humans Cattle

Crows/ other birds Dogs (Benjamin et al., 1983; Hald et al., 2004; Engvall et al., 2003) Horses (Duim et al., 2004) Pigs (Moore and Madden, 1998; Lindblom et al., 1990; Harvey et al., 1999) Poultry (Tresierra-Ayala et al., 1994; Moore et al., 2002b; Gorman et al., 2002) Primates (Benjamin et al., 1983) Seagulls (Glunder and Petermann, 1989; Benjamin et al., 1983; Moore et al., 2002a) Seals (Benjamin et al., 1983) Shellfish (Endtz et al., 1997; Van Doorn et al., 1998; Duim et al., 2004)

480

Emerging foodborne pathogens

Table 18.2

Continued

Organism

Observed host range

References

Humans

(Endtz et al., 1997; Van Doorn et al., 1998; Duim et al., 2004; Martinot et al., 2001; Broczyk et al., 1987; Benjamin et al., 1983) (Anderson et al., 1996; Soderstrom et al., 1991)d (Sjogren et al., 1996) (van der Walt et al., 1988; Love et al., 1977; Lawson et al., 1975) (Rams et al., 1993; Macuch and Tanner, 2000; Siqueira and Rocas, 2003) (Etoh et al., 1993; Macuch and Tanner, 2000; Socransky et al., 1998) (Sjogren et al., 1996) (Piazza and Lasta, 1986; Atabay and Corry, 1998; On et al., 1999) (Sjogren et al., 1996) (Terzolo, 1988) (Tee et al., 1998; Lindblom et al., 1995; On et al., 1992) (Baker et al., 1999; Shen et al., 2001) (Olson and Sandstedt, 1987; Modolo and Giuffrida, 2004; Baker et al., 1999; Engvall et al., 2003) (Ridsdale et al., 1998) (Lastovica et al., 1991) (Van Doorn et al., 1998) (Goossens et al., 1995; Skirrow et al., 1993; Goossens et al., 1990a; Lindblom et al., 1995; Lauwers et al., 1991)

C. mucosalis

Humans Dogs Pigs

C. rectus

Humans

C. showae

Humans

C. sputorume

Cats Cattle Dogs Sheep Humans

C. upsaliensis

Cats Dogs Ducks Primates Shellfish Humans

a

Poultry, ducks, game birds, cattle, sheep, pigs, goats, shellfish and fish (summarized in review by Miller and Mandrell, 2005). b Includes subsp. fetus and venerealis. c Includes subsp. hyointestinalis and lawsonii. d Incorrect identification of C. mucosalis strains has been reported (see On, 1994). e Includes biovars sputorum, faecalis, paraureolyticus and ‘bubulus’.

Blaser, 2000; Lastovica and Skirrow, 2000; Nachamkin, 2003), and our recent review of the incidence, outbreaks, and biology of C. coli and C. jejuni related to food and water (Miller and Mandrell, 2005). 18.1.1 History As noted above, the first observation of Campylobacter organisms may have been in 1886 by Theodor Escherich, who described ‘vibrionen’ present in the colonic mucus of 16 of 17 children who had died of ‘cholera infantum’ (Escherich, 1886). Subsequently, bacteria identified by McFadyean and Stockman in 1913 as a probable cause of abortion in sheep were named ‘Vibrio fetus subsp. fetus’ (now Campylobacter fetus) (McFadyean and

Campylobacter Table 18.3

Reported incidence of Campylobacter species in the food supply

Organism

Food sources

References

C. coli

Multiple a

(Mandrell and Brandl, 2004; Miller and Mandrell, 2005)

C. concisus C. curvus C. fetusc

C. hominis C. jejuni

Unknownb Unknownb Porcine liver Ox liver Lamb liver Milk Unknownb Unknownb Shellfish Milk, raw Unknownb Multiplea

C. lanienae C. lari

Unknownb Poultry

C. gracilis C. helveticus C. hyointestinalisd

Pork liver Ox liver Shellfish Produce Water C. C. C. C.

481

mucosalis rectus showae sputorume

C. upsaliensis

Unknownb Unknownb Unknownb Poultry Water Poultry Shellfish

(Kramer et al., 2000) (Kramer et al., 2000) (Kramer et al., 2000) (Klein et al., 1986) (Endtz et al., 1997; Van Doorn et al., 1998) (Salama et al., 1992) (Mandrell and Brandl, 2004; Miller and Mandrell, 2005) (Tresierra-Ayala et al., 1994; Moore et al., 2002a; Gorman et al., 2002) (Kramer et al., 2000) (Kramer et al., 2000) (Endtz et al., 1997; Van Doorn et al., 1998; Duim et al., 2004) (Park and Sanders, 1992) (Obiri-Danso and Jones, 1999; Obiri-Danso et al., 2001; Rosef et al., 2001; Broczyk et al., 1987)

(Atanassova and Ring, 1999) (Daczkowska-Kozon and BrzostekNowakowska, 2001) (Atanassova and Ring, 1999; Gorman et al., 2002; Logue et al., 2003) (Van Doorn et al., 1998)

a

Chicken, turkey, duck, pheasant, other fowl, beef, pork, lamb, mushrooms, salads and vegetables (summarized in reviews by Mandrell and Brandl, 2004; and Miller and Mandrell, 2005). No food source has been identified. c Includes subsp. fetus and venerealis. d Includes subsp. hyointestinalis and lawsonii. e Includes biovars sputorum, faecalis, paraureolyticus and ‘bubulus’. b

Stockman, 1913), and became the type species of Campylobacter. ‘Vibrio’ were isolated from the jejuna of sick calves and pigs and named ‘Vibrio’ jejuni (Jones and Little, 1931) and ‘Vibrio’ coli (Doyle, 1944), respectively. ‘Related vibrio’ species, probably C. jejuni or C. coli, were identified as possible causes of human illness (King, 1957). This increased the focus of attention eventually on these ‘related vibrio’, which were included in the

482

Emerging foodborne pathogens

new genus Campylobacter (Greek for curved rod) in 1963 (Sebald and Véron, 1963). ‘Related vibrio’/Campylobacter could be isolated from human diarrhoeal stool samples (Cooper and Slee, 1971; Dekeyser et al., 1972), but the development of an improved culture method facilitated routine isolation of thermophilic species of Campylobacter (i.e. C. coli and C. jejuni) from human stools and confirmation of these species as human enteric pathogens (Skirrow, 1977). C. jejuni, the major thermophilic Campylobacter species, is recognized as an important source of diarrhoeal illness in the enteric disease research and public health communities. In Europe and North America, it is the number one bacterial cause of GI disease (Friedman et al., 2000). This has focused most of the research and surveillance on C. jejuni and on the other major thermophilic species, C. coli. Therefore, it is not surprising that even extensive reviews of Campylobacter emphasize generally, C. jejuni (Nachamkin et al., 1992; Skirrow and Blaser, 2000). The genus Campylobacter has changed since it was proposed in 1963 (Sebald and Véron, 1963), further defined in 1973 (Véron and Chatelain, 1973), and with the general acceptance of C. jejuni and other species as human pathogens. Many new Campylobacter species have been identified since 1973 including: C. mucosalis (originally C. sputorum subsp. mucosalis) from swine GI tracts (Lawson et al., 1975); C. concisus, C. rectus (originally Wolinella recta), C. curvus (originally Wolinella curva), C. showae and C. gracilis (originally Bacteroides gracilis) isolated from human oral cavities and associated with periodontal disease (Tanner et al., 1981); C. hyointesinalis from swine GI tracts (Gebhart et al., 1983); C. lari (originally C. laridis) from seagulls (Benjamin et al., 1983); C. upsaliensis from dog faeces (Sandstedt et al., 1983); C. jejuni subsp. doylei from humans with enteritis and gastritis (Steele and Owen, 1988); C. helveticus from GI tracts of cats, dogs and humans (Stanley et al., 1992); and C. hominis (Lawson et al., 1998) and C. lanienae, both from faeces of healthy humans (Logan et al., 2000). Other species related to Campylobacter, but reclassified into new genera, or requiring further characterization, are Arcobacter, Lawsonia, Helicobacter, Sulfurospirillum and Sutterella species (On, 2005). Some of these species have been transferred into the Campylobacter genus, and some species have been moved into new genera (Goodwin et al., 1989; Vandamme et al., 1991a; Vandamme and Goossens, 1992; Vandamme, 2000; On, 2005). Arcobacter butzleri, isolated from human faeces, along with A. cryaerophilus and A. skirrowii associated with pig, cow and sheep abortion and reproductive problems, were originally designated ‘aerotolerant Campylobacter’ species (Kiehlbauch et al., 1991; Vandamme et al., 1992b; On et al., 2002). The Campylobacter genus includes currently 16 species and six subspecies. For this review, the ECS listed in Table 18.1 will be emphasized. The reader is referred also to chapters in this book on Helicobacter pylori and Arcobacter species.

Campylobacter

18.2

483

Seasonal and sporadic disease

18.2.1 Incidence Although it took nearly nine decades from Escherich’s observations until Campylobacter species could be isolated routinely from human faeces (Dekeyser et al., 1972; Skirrow, 1977), it is now accepted generally that Campylobacter species, primarily C. jejuni, are the primary cause of bacterial diarrhoeal illness in the industrialized world. It is estimated that two to three million Campylobacter-related illnesses occur in the United States per year (Friedman et al., 2000; Miller and Mandrell, 2005), with probably more than one million per year in the United Kingdom (Pebody et al., 1997), and an estimated 400–500 million illnesses worldwide (Nachamkin, 2003). In 2004, the average incidence of Campylobacter illness in the United Sates, based on surveillance at ten separate sites, was 12.9 per 100,000 (CDC, 2005). This can be compared to the 56 per 100,000 average incidence of Campylobacter reported in 1999 to 2000 by nearly 20 other mostly European countries (WHO, 2004), and 42.3 per 100,000 in Ontario, Canada, for 1997 to 2001 (Lee and Middleton, 2003). Nevertheless, the Campylobacter isolation methods used by most of these countries make it highly probable that only illnesses caused by C. jejuni and possibly C. coli would be identified. 18.2.2 Seasonal illness An intriguing seasonal incidence pattern of Campylobacter illness has been reported consistently in studies in multiple countries (Kapperud and Aasen, 1992; Hudson et al., 1999; Nylen et al., 2002). A study of nine European countries for which weekly data were available indicated yearly peaks of illness between weeks 22 (e.g. Wales) and 33 (e.g. Sweden) (Nylen et al., 2002). A study of the levels of Campylobacter incidence in England and Wales between 1990 and 1999 revealed an average annual rate of 78.4 ± 15 cases and a seasonal occurrence generally between mid-June and mid-July (~weeks 23–27); the increased illness also correlated with an increase in temperature and, possibly, agricultural activities (Louis et al., 2005). The lack of a significant correlation of seasonality of Campylobacter illness with the incidence of Campylobacter on foods suggests contaminated food may not be the primary source of the seasonal illnesses that have been reported (Louis et al., 2005). Although water plays an important role in transmission of Campylobacter species between animals and the environment, the lack of correlation between surface water contamination and incidence of human illness (Jones, 2001) suggests the need for continuing studies of Campylobacter ecology and epidemiology. C. jejuni is by far the major cause of recognized Campylobacter outbreaks and sporadic illness. Nevertheless, other Campylobacter species are beginning to emerge in specific regions of the world as serious causes of human illness (Goossens et al., 1990b; Lastovica and Skirrow, 2000; Miller and Mandrell, 2005). The emergence of non-jejuni/non-coli Campylobacter species as human

484

Emerging foodborne pathogens

pathogens may be due to a combination of factors, including increased surveillance (CDC, 2002), changes or improvements in culture and molecular methods (Le Roux and Lastovica, 1998; Aspinall et al., 1996), and recognition that they cause primarily sporadic rather than outbreak disease (Pebody et al., 1997).

18.3

Outbreaks

It is of historical interest that the first reported outbreak of human illness caused by a Campylobacter species may have been in May, 1938 involving 357 prison inmates sickened by consumption of contaminated milk (Levy, 1946). Levy reported that selected fecal samples from inmates contained mucoid material and ‘vibrio-like micro-organisms almost in pure culture’ (Levy, 1946), suggestive today that the causative agent may have been a Campylobacter species. The development of improved methods for isolation of C. coli and C. jejuni (Skirrow, 1977) were followed closely by the first confirmed identification of Campylobacter as the causative agent of major food- and water-borne outbreaks (Robinson et al., 1979; Vogt et al., 1982), and the incidence of disease caused by thermophilic Campylobacter species has continued to increase up to the present time (Wallace et al., 2000; Pebody et al., 1997). More than 95% of the known outbreaks with a Campylobacter species have been caused by C. jejuni (Miller and Mandrell, 2005). Multiple outbreaks caused by C. jejuni between 1978 and 2003 and associated with meat/beef/ pork (total no. = 24), milk/dairy (N = 96), poultry (N = 46), produce (N = 21), seafood/shellfish (N = 8), water (N = 68), miscellaneous food (N = 49) and unknown sources (N = 600) have been reported, with the largest outbreaks due to contaminated water or raw milk (summarized in Miller and Mandrell (2005)). The first recognized outbreak of a non-jejuni Campylobacter species may have occurred between January 1979 and March 1981 (Table 18.4). It was associated with C. fetus subspecies fetus contaminating a ‘nutritional therapy’ drink consisting of raw fruit, vegetable juices and raw calf’s liver and was administered in Mexican clinics to patients seeking alternative therapies for serious illnesses (CDC, 1981). C. fetus was isolated from the blood of nine patients and peritoneal fluid from one patient. A second C. fetus outbreak occurred in 1981 associated with consumption of raw milk (C. jejuni was isolated also from stool samples for some of the cases) (Table 18.4) (Finch and Riley, 1984). C. fetus, presumably subspecies fetus, has been associated with at least three other reported outbreaks, although a source was confirmed for only one of these outbreaks (dairy/cottage cheese) and suspected in another (raw dairy product) (Table 18.4). It was approximately seven years between these initial C. fetus-associated outbreaks and the next series of reported non-jejuni outbreaks occurring in

Campylobacter Table 18.4

485

Outbreaks caused by ECS in food, water or unknown source Casesa

Species

Source

C. fetus

Possibly raw calf liver Milk, raw

10

USA (CA)b 79–81

(CDC, 1981)

16

USA (WI)c Jun 82

Water, lake water Unknown Dairy, cottage cheese Unknown Unknown

162

Mar 85

(Finch and Blake, 1985; Klein et al., 1986) (Broczyk et al., 1987)

19 13

Belgium 90–91 USA (OH) Dec 92

(Lauwers et al., 1991) (CDC, 2003)

18 4

Canadad Japane

Oct 92 92

C. hyointestinalis C. coli

Milk, raw

5

Canadaf

~92

(Rennie et al., 1994) (Morooka et al., 1996) (Salama et al., 1992)

UK

Sep 93

C. coli

Misc.,g school lunch Misc., ham/feta cheese Unknown Unknown

Multi

Japanh

93–96

24

Belgium

May 95

Multi 23

Japani 93–98 USA (CA)j Mar/Apr 99

C. fetus/ C. jejuni C. lari C. upsaliensis C. fetus C. fetus C. fetus

C. coli C. coli C. curvus

Water

36

Location

Canada

Date

References

(Pebody et al., 1997; Furtado et al., 1998) (IASR, 1999) (Ronveaux et al., 2000) (IASR, 1999) (Abbott et al., 2005)

a

In some outbreaks, more than one microorganism was isolated from patient stool samples. The number of cases listed for some outbreaks represents the number of culture-confirmed cases; not all cases were culture confirmed in some of the large outbreaks. NR, not reported; Multi, multiple outbreaks; ML, multistate. b Nine patients had malignancies; one patient had lupus erythematosus. Patients were from multiple states and one was from Canada, but were all treated in CA hospitals. c Four stool samples yielded C. jejuni and three C. fetus. d Members of this Hutterite colony consumed regularly raw milk and dairy products produced from raw milk. e Isolated from infants with meningitis in neonatal intensive care unit. f Index case was five-month-old female with diarrhoea; two different strains isolated separately from four non-ill family members. g Misc., miscellaneous. h Represents seven total outbreaks: 2 in 1993, 2 in 1994, 1 in 1995 and 2 in 1996. i Represents 130 total outbreaks: 14 in 1993, 25 in 1994, 22 in 1995, 32 in 1996, 39 in 1997 and 37 in 1998. j Brainerd’s diarrhoea; C. curvus was isolated from five stool samples.

1992. At least four C. coli outbreaks have been reported; one associated with water, two with food, and others from unknown or unreported sources (Table 18.4, multiple outbreaks in Japan, 1993–1998). Three outbreaks associated

486

Emerging foodborne pathogens

separately with C. lari (lake water, 1985), C. hyointestinalis (raw milk, ~1992), or C. upsaliensis (unknown source, ~1990) have been the only other non-jejuni Campylobacter outbreaks reported. It is noteworthy, however, that at the time of writing this chapter, sporadic, and possibly outbreak, cases of C. curvus associated with bloody diarrhoea and Brainerd’s diarrhoea were identified using a microfiltration method for isolating spiral/small bacterial cells selectively from stool samples (Abbott et al., 2005). The only reported outbreak in humans due to an Arcobacter species occurred in autumn of 1983 in an Italian nursery and primary school (Vandamme et al., 1992a). The outbreak caused by A. butzleri resulted in ten illnesses in children. The children had abdominal cramps, but no diarrhoea, and the illnesses appeared to be self-limiting. No source of infection was discovered, although person-to-person spread was suspected (Vandamme et al., 1992a). Arcobacter and Campylobacter are related genera, and the reader is referred to the specific chapter on Arcobacter in this book (see Chapter 8). A species designation was not provided for hundreds of additional Campylobacter outbreaks that have been reported (summarized in Miller and Mandrell, 2005), and the culture methods used to isolate Campylobacter species in most of these outbreak investigations involved antibiotic selective media that would minimize and/or preclude isolation of many of the ECS. The long periods between reported Campylobacter outbreaks linked to any species (Miller and Mandrell, 2005), and the predominant use of culture methods that minimize isolation of ECS, suggest that new methods of isolation and detection are needed to obtain an accurate analysis of Campylobacter incidence and epidemiology.

18.4

Non-diarrhoeal human disease

The most common disease associated with C. coli and C. jejuni subsp. jejuni in humans is acute inflammatory enteritis following an incubation period of approximately three days (range = 18 h to 8 days), then cramping and profuse diarrhoea accompanied by fever, headache, dizziness or myalgia (Skirrow and Blaser, 2000). Other outcomes, subsequent mostly to C. jejuni-caused enteritis, are appendicitis, colitis, rashes, arthritis, and rarely, bacteremia and infections of the hepatobiliary system, kidney, heart and spleen (Skirrow and Blaser, 2000). In rare cases, invasive and serious diseases have been reported. For example, approximately 1 in 1000 cases of C. jejuni GI illness is associated with secondary immune-mediated polyneuropathies, such as Guillain-Barré syndrome (GBS) or Miller-Fisher Syndrome (MFS) (Takahashi et al., 2005; Willison and O’Hanlon, 1999). GBS is the most commonly occurring paralytic disease in the United States (Nachamkin et al., 1998). The development of GBS or MFS is due presumably to the cross-reactivity of human antibodies against ganglioside-like lipooligosaccharides expressed by C. jejuni and cellsurface gangliosides on peripheral nerves (Yuki, 1999; Yuki et al., 1999).

Campylobacter

487

Terminal oligosaccharides identical to GM1, GM2, GD1a, GD3 and GT1a gangliosides have been identified chemically as present in C. jejuni lipooligosaccharides (Aspinall et al., 1992, 1993c, 1994; Moran, 1997; St Michael et al., 2002; Gilbert et al., 2005). If studies of C. jejuni are representative for ECS, potentially low concentrations of ECS in foods and water may be sufficient to cause illness. In volunteer studies, 10–60% of 111 adults challenged with 8 ¥ 102 to 2 ¥ 109 C. jejuni cells had diarrhoea or fever (Black et al., 1988). However, differences in incidence of disease were associated with the strains used, the dose, and the suspension in which the inoculum was introduced (milk or 1.3% sodium bicarbonate) (Black et al., 1988). Comparable studies of infectious dose and virulence in humans are not available for ECS. Also, there are few, if any, incidence studies that quantify the approximate number of viable ECS cells present in animals (Table 18.2) or contaminated food sources (Table 18.3). The sporadic pattern of Campylobacter disease and the focus of most clinical laboratories on isolation of common thermophilic Campylobacter species (C. coli and C. jejuni) increases the likelihood that GI cases caused by ECS are undiagnosed (Goossens et al., 1990a,b; Lastovica and Skirrow, 2000; CAMPYCHECK, 2003). ECS probably colonize the GI tract of some humans without causing any illness, whereas in others, enteric illness may go undiagnosed due to inadequate methods as noted above, or colonization may be a prelude to a systemic infection causing serious illness (Table 18.1). Other Campylobacter species are emerging as potential health risks (Goossens et al., 1990b; Bourke et al., 1998; Lastovica and Skirrow, 2000; Matsheka et al., 2001; CAMPYCHECK, 2003). Some of the ECS have been identified as human pathogens as a result of their isolation from non-intestinal infections in a variety of sites (Table 18.1). Of the 16 classified species of Campylobacter, at least 11 species other than C. coli and C. jejuni have been associated with human disease: C. curvus, C. concisus, C. fetus, C. gracilis, C. hyointestinalis, C. lari, C. mucosalis, C. rectus, C. showae, C. sputorum, and C. upsaliensis (Table 18.1).

18.4.1 C. fetus C. fetus deserves special mention since it is the type species of the genus, and because it has been associated with many different types of extraintestinal and invasive disease in humans (Table 18.1). C. fetus subsp. fetus is the major subspecies. It colonizes cattle and sheep intestines, but has been isolated also from their genital tracts, and the placentas and stomachs of aborted fetuses of sheep and cattle (Smibert, 1984). As noted by John Penner in an earlier review of Campylobacter species (Penner, 1988), this tropism is relevant to understanding human disease, because of the reports of infections of human fetuses (Rettig, 1979) and premature labor and neonatal sepsis in humans (CDC, 1984). C. fetus subsp. fetus has been associated with more types of invasive disease than any other ECS, causing septicemias, hip joint

488

Emerging foodborne pathogens

and aneurysm infections, and an impressive list of other inflammatory diseases (Table 18.1). However, in most cases, the invasive diseases occur in the elderly and/or debilitated hosts with serious immunodeficiency or other underlying disease (e.g. cirrhosis, cancer, arthritis, hypogammaglobulinemia). The ‘capsule’ (S-layer) on the outer surface of C. fetus is probably critical during the invasive stage of infections, because it is involved in resistance to humoral and cellular mechanisms of immunity as the bacteria migrate to protected sites (see below). Similar biology of capsular polysaccharide is involved in the invasiveness of Gram-negative mucosal pathogens that invade (Alvarez et al., 2000; Roberts, 1996) and cause meningitis (e.g. Neisseria meningitidis, Haemophilus influenzae) (St Geme and Falkow, 1991; Mandrell et al., 1995; Kahler et al., 1998). The other subspecies of C. fetus, venerealis, is isolated from and adapted to the bovine genital tract, and has not been reported to cause infections in humans (Smibert, 1984).

18.4.2 Other ECS and disease Additional information regarding clinical diseases and sources associated with other ECS will be provided below. Details regarding clinical features, epidemiology and treatment can be obtained in other reviews of Campylobacter species, including reviews specific to non-coli and non-jejuni species (Rettig, 1979; Penner, 1988; Skirrow and Blaser, 2000; Lastovica and Skirrow, 2000; Nachamkin, 2003).

18.5

Reservoirs of ECS in the food and water supply

We have reviewed and summarized recently the many studies identifying reservoirs of C. coli and C. jejuni, and the incidence of these species in animals, on food, in water (Miller and Mandrell, 2005) and on fresh produce (Mandrell and Brandl, 2004). In this review, we will summarize briefly information on C. coli and C. jejuni in food and water, but will emphasize studies of the reservoirs and incidence of non-coli and non-jejuni Campylobacter species (ECS).

18.5.1 C. coli and C. jejuni The incidence of C. coli and C. jejuni in poultry (e.g., chickens, turkeys, ducks, and geese), and other animals produced for food (e.g. cattle, pigs, sheep), on retail meat (especially poultry products), and in raw milk and water, has been reported in numerous studies (for review, see Miller and Mandrell 2005). Although the incidence of thermophilic Campylobacter in poultry is low immediately following hatching, Campylobacter species (usually C. jejuni) can be detected in birds within two to four wks (Berndtson et al., 1996; Evans and Sayers, 2000; Stern et al., 2001). Horizontal transmission

Campylobacter

489

due to contamination of food and water with fecal material, the behaviour of chickens to ingest faeces (coprophagy), and the low infectious dose of Campylobacter for chicks (~35 cells), rapidly disseminates Campylobacter within poultry flocks (Stern et al., 1988). Contamination on the farm results in high contamination at the retail level; 50–90% of retail poultry products can be positive (Miller and Mandrell, 2005). C. jejuni and C. coli have been isolated predominantly in previous studies of the incidence of Campylobacter in animals and food. The average percent incidences calculated from multiple studies were: 33% for live chickens, 53% for chicken meat; 56% for turkey meat; 32% for geese, ducks, pheasant and other fowl; 45% for cattle; 6% for beef, 27% for pigs and pig meat; 31% for sheep and lamb; 16% for seafood; and 1% for produce and producerelated foods (Miller and Mandrell, 2005). Studies of the host range of the ECS and their prevalence in foods have been summarized in Tables 18.2 and 18.3, respectively.

18.5.2 C lari C. lari, like the thermotolerant Campylobacter species C. jejuni and C. coli, is associated primarily with birds (Glunder and Petermann, 1989; Maruyama et al., 1990; Moore et al., 2002a; Waldenstrom et al., 2002), specifically seagulls (Larus sp.) (Table 18.2). It has also been isolated from dogs and swine (Hald et al., 2004; Harvey et al., 1999). C. lari is rarely isolated from animal and processed food sources, relative to C. jejuni and C. coli (Table 18.3), and seldom has been implicated in food- or water-borne outbreaks (Table 18.4). C. lari is a minor contaminant of poultry (Giesendorf et al., 1992; Gorman et al., 2002; Moore et al., 2002b; Scates et al., 2003; Wedderkopp et al., 2000) and has been isolated infrequently from ox and pork livers (Moore and Madden, 1998; Kramer et al., 2000) and produce (Park and Sanders, 1992). In contrast, C. lari has been detected at moderate to high levels in fresh water, seawater and in shellfish. Endtz et al. reported that > 25% of the mussels and oysters collected from the Netherlands in 1993– 1994 were colonized by C. lari (Endtz et al., 1997). They also found a similar incidence of Campylobacter in mussels from Germany, Denmark, and England and oysters from Ireland; none of the strains isolated were speciated. Similarly, two other studies demonstrated C. lari incidence in shellfish of at least 33% (Wilson and Moore, 1996; Van Doorn et al., 1998). C. lari is present at higher levels than C. jejuni in sea water (Obiri-Danso and Jones, 1999; Obiri-Danso et al., 2001; Glunder and Petermann, 1989), whereas C. jejuni is often the most isolated Campylobacter from fresh water (Obiri-Danso and Jones, 1999). The presence of C. lari in sea water and the incidence of this organism in shellfish is presumably a result of the shedding of C. lari by gulls and other shore birds that are colonized by this organism (Glunder and Petermann, 1989). Also, C. lari is more halotolerant than both C. jejuni and C. coli, growing at NaCl concentrations of 1.5% (Smibert,

490

Emerging foodborne pathogens

1984). Although the salt content of seawater is 3.5%, the halotolerance of C. lari may allow it to survive longer in marine environments than other Campylobacter species (Obiri-Danso et al., 2001). C. lari, shed by seagulls, enters the sediment layer at low tide. Obiri-Danso and Jones reported that Campylobacter could be isolated from marine sediments at the highest levels during winter and autumn and at the lowest levels during the summer (ObiriDanso and Jones, 1998). They speculated that higher UV-B levels during the summer kill the Campylobacter cells on the sediments (Obiri-Danso et al., 2001). Similarly, Wilson and Moore (Wilson and Moore, 1996) reported that 81% of the shellfish sampled were positive for Campylobacter during October to January whereas only 6% of the shellfish sampled were positive during May to August. More importantly, these results are consistent with the time of year (October and November) that four Campylobacter outbreaks associated with shellfish occurred.

18.5.3 C. upsaliensis and C. helveticus C. upsaliensis and C. helveticus have been isolated frequently from domestic cats and dogs (Hald and Madsen, 1997; Shen et al., 2001; Moser et al., 2001; Engvall et al., 2003; Sandstedt et al., 1983; Stanley et al., 1992). C. upsaliensis is associated predominantly with dogs and C. helveticus is associated primarily with cats. However, domestic cats can also carry C. upsaliensis; C. helveticus is rarely isolated from dogs. C. upsaliensis has been isolated also from poultry and shellfish (Logue et al., 2003; Van Doorn et al., 1998; Waino et al., 2003). Unlike C. upsaliensis, C. helveticus has not been isolated from humans or food, or implicated in human illness. The source of C. upsaliensis infection is unknown; although it has been found occasionally in food, no known human illness has been associated with consumption of C. upsaliensiscontaminated food. Therefore, it is possible that transmission of these organisms occurs not through the food supply but, as has been reported, from animal to man (Gurgan and Diker, 1994; Goossens et al., 1991) or person-to-person (Walmsley and Karmali, 1989; Goossens et al., 1995). In one study (Labarca et al., 2002), C. upsaliensis strains were isolated from dogs living in the households of campylobacteriosis patients. The C. upsaliensis strains isolated from the patients and the canine isolates were not clonal; however, 3–6 months had elapsed between the collection of the clinical samples and collection of the canine samples. Alternatively, sporadic cases of foodborne illness may be occurring and are unidentified due to inadequate culture methods or lack of traceback in sporadic cases.

18.5.4 C. fetus, C. hyointestinalis, C. sputorum, C. mucosalis, and C. lanienae Several other non-jejuni/coli Campylobacter species have been associated with livestock or other game animals (Table 18.2). These include C. fetus, C.

Campylobacter

491

hyointestinalis, C. sputorum, C. mucosalis, and C. lanienae. C. fetus (incl. subsp. fetus and venerealis) has been isolated from cattle and sheep (Varga, 1990; Atabay and Corry, 1998; Busato et al., 1999; Wesley and Bryner, 1989; Giacoboni et al., 1993). C. hyointestinalis (incl. subsp. hyointestinalis and lawsonii) and C. sputorum (incl. subsp. sputorum, faecalis, and paraureolyticus) are isolated from cattle and swine (Gebhart et al., 1994; Atabay and Corry, 1998; Busato et al., 1999; van der Walt and van der Lugt, 1988; Wilson et al., 1986; Chang et al., 1984; Terzolo, 1988; Piazza and Lasta, 1986). C. mucosalis is predominantly isolated from swine (Lawson et al., 1975; Lomax and Glock, 1982; van der Walt et al., 1988; Wilson et al., 1986). Isolation from humans also has been reported (Soderstrom et al., 1991; Figura et al., 1993; Anderson et al., 1996), however, at least one strain was later identified as a C. concisus (On, 1994). C. lanienae was isolated from the faeces of abattoir workers in Switzerland who routinely handled cattle and pig carcasses (Logan et al., 2000). C. lanienae was also isolated from cattle faeces by Inglis et al (Inglis et al., 2003; Inglis and Kalischuk, 2004; Inglis and Kalischuk, 2003; Inglis et al., 2004); these studies also detected C. hyointestinalis and C. fetus. Detection of these species from food or water sources is infrequent and has not been reported for C. mucosalis or C. lanienae. C. fetus subsp. fetus has been isolated from processed turkey, livestock livers and raw milk (Tauxe et al., 1988; Kramer et al., 2000; Logue et al., 2003), C. sputorum subsp. faecalis from poultry and water (Atanassova and Ring, 1999; DaczkowskaKozon and Brzostek-Nowakowska, 2001), and C. hyointestinalis from shellfish and reindeer meat (Hanninen et al., 2002; Endtz et al., 1997; Van Doorn et al., 1998). As with C. upsaliensis, no human illness has been associated with consumption of C. sputorum- or C. hyointestinalis-contaminated food. The association of C. lanienae with livestock suggests that transmission may be zoonotic since this organism has not been isolated from pork or beef. Similarly, zoonotic transmission of C. hyointestinalis has been documented (Gorkiewicz et al., 2002). Also, transmission of C. upsaliensis may be via domestic dogs or cats. This suggests that a potentially large percentage of human illness caused by non-thermotolerant Campylobacter may be due to proximity or handling of pets, livestock, or livestock carcasses.

18.5.5 ECS restricted to human hosts (C. concisus, C. curvus, C. rectus, C. gracilis, C. showae, and C. hominis) These species are unique in that their isolation from animals other than human has not been reported. Additionally, none of these six species has been isolated, to date, from food or water. Although C. concisus, C. curvus, and C. gracilis have been associated with gastroenteritis (Vandamme et al., 1989; Lindblom et al., 1995; Musmanno et al., 1998; Aabenhus et al., 2002; Matsheka et al., 2002; Maher et al., 2003; Abbott et al., 2005) and C. concisus, C. rectus, C. showae, and C. gracilis have been associated with periodontal

492

Emerging foodborne pathogens

disease (Macuch and Tanner, 2000; Siqueira and Rocas, 2003; Kamma et al., 2000; Tanner et al., 1998; Rams et al., 1993), the source of infection with these species has not been identified. C. hominis is apparently commensal (Lawson et al., 2001); no association with human illness has been reported. The methods for isolating these campylobacters from the oral cavity to determine incidence and association with periodontal disease must be precise. Since they represent a minor proportion of the microflora, their growth will be affected negatively by too high an oxygen concentration during sampling, and up to seven days incubation may be required for adequate growth (Macuch and Tanner, 2000). Also, methods appropriate for oral cavity samples may not be ideal for isolating these species from food, water or stool samples. It is probable that many of these fastidious Campylobacter species are being missed in surveillance or clinical studies due to inadequate culture and identification methods.

18.6 Culture and isolation of ECS from human faeces, food and water sources 18.6.1 Isolation from human faeces Many ECS illnesses are identified as a result of their isolation from nonenteric sites and are associated with serious illnesses in immunocompromised or debilitated hosts, or with periodontal disease (Tanner et al., 1981; Rams et al., 1993; Tanner et al., 1998; Macuch and Tanner, 2000). However, surveys of human diarrhoeal stool samples with culture methods conducive to isolation of ECS (e.g. filtration without antibiotics, 2–10% H2) have reported a higher incidence of ECS than with conventional thermophilic Campylobacter culture methods (Steele and McDermott, 1984; Goossens et al., 1986; 1990b; Medema et al., 1992; Engberg et al., 2000; Le Roux and Lastovica, 1998; Matsheka et al., 2001; McClurg et al., 2002). For example, Dr Albert Lastovica and colleagues at a single hospital in Cape Town, South Africa between October 1990 and April 1999, isolated 2,216 strains of non-jejuni/non-coli Campylobacter species from diarrhetic stools of pediatric patients, by filtration of diluted stool samples onto an antibiotic-free medium and 2–6 days incubation in a H2-enriched microaerophilic atmosphere (‘Cape Town Protocol’) (Lastovica and Skirrow, 2000). Ninety-seven percent of the non-jejuni/noncoli (ECS) isolates were C. concisus (911 isolates), C. upsaliensis (882 isolates) and C. jejuni subsp. doylei (358 isolates), which combined was 62.5% of the total number of Campylobacter strains isolated of any species (3,545 isolates). Fifteen Arcobacter butzleri and almost 300 Helicobacter isolates were recovered also (Lastovica and Skirrow, 2000). The difference in the incidence of ECS in South Africa compared to most other parts of the world could be explained by geographic, genetic or underlying disease factors rather than differences in methodology, however, ECS have been recovered also in European laboratories that employ the appropriate culture methods

Campylobacter

493

(Goossens et al., 1990a; Bourke et al., 1998), and recently in the United States (Abbott et al., 2005).

18.6.2 General isolation methodology for food and water The low levels of detection of the non-thermophilic Campylobacter species in the food supply appear to suggest initially that transmission of these organisms into humans is not through food or water. However, this may be an incorrect assumption. Campylobacter isolation methods used by many laboratories worldwide focus mainly on the isolation of C. jejuni subsp. jejuni since this organism is considered to be the main cause of campylobacteriosis. Isolation of C. jejuni subsp. jejuni and C. coli from food and water sources has been reviewed extensively (Uyttendaele et al., 1995; Corry et al., 1995; Uyttendaele and Debevere, 1996; Mason et al., 1999; Talibart et al., 2000; Jacobs-Reitsma, 2000; Miller and Mandrell, 2005) and will not be discussed in detail here. Essentially, Campylobacter is present on food and in water at much lower levels than in faecal samples (<10–1000 CFU per 10 g (Uyttendaele and Debevere, 1996)), and those present on food may have been injured by exposure to heating, chilling, freezing or other conditions related to processing and storage (Humphrey and Cruikshank, 1985; Humphrey, 1986a,b). Therefore, an enrichment step is required to both detect small numbers of bacteria and resuscitate damaged cells. Enrichment is generally in a rich broth (e.g. Nutrient broth #2) amended with 5–10% sheep or horse blood and one of several different antibiotic supplements (Table 18.5). The media are then incubated for 24–48 h at 42 ∞C in a microaerophilic atmosphere (e.g. 5% O2, 10% CO2, 85% N2) and plated onto selective agar (e.g. modified charcoal-cefoperazone-deoxycholate (mCCD) agar (Hutchinson and Bolton, 1984)) or Campy-Cefex agar (Stern et al., 1992). The selective agar media are incubated for an additional 24–48 h at 42 ∞C. In some cases, a short pre-enrichment step at a reduced temperature (37 ∞C) in antibiotic-free medium is added (Corry et al., 1995; Uyttendaele and Debevere, 1996) in an attempt to improve resuscitation of sub-lethally damaged cells. However, pre-enrichment may increase outgrowth of the normal foodborne microflora, resulting in suppression of the growth of Campylobacter (Uyttendaele and Debevere, 1996). It is not known whether a pre-enrichment would be beneficial to the isolation of non-jejuni/coli Campylobacter, but this is being analyzed currently by multiple laboratories (CAMPYCHECK, 2003).

18.6.3 Antibiotic supplements in enrichment and plating media The goal of enrichment is the selective isolation of desired organisms and suppression of the normal flora on food samples. Unfortunately, several different types of antibiotics are required to maintain optimal suppression: vancomycin, cephalothin, or cefoperazone against Gram-positive organisms

494

Emerging foodborne pathogens

Table 18.5

Selected Campylobacter antibiotic supplements

Supplement

Antibiotics (mg/L)a

Blaser-Wang

Vancomycin (10), polymyxin B (2,500 IU/L), trimethoprim (5), amphotericin B (2), cephalothin (15) Cefoperazone (20), vancomycin (20), cycloheximide (50) Bacitracin (2,500 IU/L), cycloheximide (50), colistin sulfate (10,000 IU/L), cefazolin (15), novobiocin (5) Vancomycin (10), trimethoprim (5), polymyxin B (2,500 IU/L), cephalothin (15), amphotericin B (2) Cefoperazone (8), amphotericin B (10), teicoplanin (4) Cefoperazone (10), colistin sulfate (4), vancomycinb (10), rifampicinb (10), amphotericin B (2) Cefoperazone (32), vancomycin (20), cycloheximide (100) Polymyxin B (2,500 IU/L), rifampicin (10), trimethoprim (10), cycloheximide (100) Vancomycin (10), polymyxin B (2,500 IU/L), trimethoprim (5)

Bolton Butzler Campy-BAP CAT Exeter Karmali Preston Skirrow a

Antibiotic supplements are from Corry et al., (1995). Antibiotic concentrations are in (mg/L) unless otherwise noted. b Vancomycin in broth; rifampicin in agar.

(and some Gram-negative organisms); polymyxin B, colistin, or trimethoprim against Gram-negative organisms; and cycloheximide or amphotericin B as anti-fungals. The use of multiple antibiotics in the enrichment and plating media may decrease overgrowth by non-Campylobacteraceae but may decrease also the number of Campylobacter species that can be isolated. It is worth noting that many of the ‘Campylobacter’ antibiotic supplements listed in Table 18.5 were included for the isolation of C. jejuni and C. coli. However, even some C. jejuni and C. coli strains are sensitive to these antibiotics (Corry et al., 1995). Of particular concern in the isolation of non-jejuni/coli Campylobacter is the antibiotic cephalothin, a common component of many antimicrobial supplements (Table 18.5). Campylobacter species have varying sensitivities to cephalothin (Lastovica and Skirrow, 2000). Most C. jejuni subsp. jejuni, C. coli, C. lari, C. gracilis, and C. lanienae strains are resistant to cephalothin and some strains of C. jejuni subsp. doylei and C. concisus are resistant to the cephalothin concentrations used commonly in isolation protocols. The remaining Campylobacter species (e.g. C. upsaliensis and C. fetus) are sensitive to the concentrations used in media. In addition, some Campylobacter species are inhibited by polymyxin B and colistin (Ng et al., 1988; Goossens et al., 1986). To increase the recovery of thermophilic Campylobacter from faecal samples, especially C. upsaliensis, Aspinall developed the CAT antimicrobial supplement which contains cefoperazone (replacing cephalothin), teicoplanin, and amphotericin B (Aspinall et al., 1993d, 1996) (Table 18.5). The decreased level of cefoperazone (8 mg ml–1) in the Aspinall formulation supports the growth of most Campylobacter and inhibits most Enterobacteriaceae. Since enterococci are not inhibited, teicoplanin was included. Thus, CAT medium

Campylobacter

495

may be effective also in the isolation of some non-thermophilic Campylobacter species. For example, C. sputorum can be isolated from CAT agar, but not from mCCD agar or Karmali agar (Atabay and Corry, 1998). While CAT supplement is sufficient to isolate non-jejuni/coli Campylobacter species, such as C. upsaliensis, from fecal samples, it is probably not sufficient to isolate these organisms from food samples. These studies illustrate the need to identify additional antibiotics effective at suppressing food sample microflora, but not species of interest. As noted previously, alternative methods for the recovery of Campylobacter species involve filtration (Megraud and Elharrif, 1985). The ‘Cape Town Protocol’ (Le Roux and Lastovica, 1998) has no antibiotics in the plating medium, an advantage for isolating non-jejuni/coli Campylobacter species. C. upsaliensis, C. concisus, C. hyointestinalis, C. fetus, C. lari, C. curvus, C. rectus, C. sputorum, C. helveticus, and C. mucosalis, have been isolated in South Africa from human and animal faecal samples (Lastovica and Le Roux, 2001; Le Roux and Lastovica, 1998). In some instances, detection of non-jejuni/coli Campylobacter species is accomplished only through the use of the filtration method (Goossens et al., 1990a; Albert et al., 1992; Abbott et al., 2005). Although some studies have shown that the ‘Cape Town Protocol’ is superior in the isolation of these species, especially C. upsaliensis (Lastovica and Le Roux, 2001; Moreno et al., 1993), other studies have indicated that the filtration method is not as efficient as standard antibiotic media in their isolation (Modolo, 2000; Lopez et al., 1998; Aspinall et al., 1996). However, a novel genogroup of C. upsaliensis was identified recently that potentially contains a locus associated with virulence (Fouts et al., 2005). With one exception, these strains were isolated using a filtration method; the increased sensitivity of several of these strains to cefoperazone suggests that they would not have grown on cefoperazone-containing CAT media. Thus, although use of selective media may increase the overall numbers of campylobacters detected in samples, it may decrease or abolish the detection of certain Campylobacter strains or species, including strains of potential clinical importance (Abbott et al., 2005). Ideally, multiple methods should be used for the isolation of Campylobacter.

18.6.4 Growth temperature Additional factors to consider in isolating non-jejuni/coli Campylobacter from food sources are temperature, atmosphere, and time of incubation. Most C. jejuni (i.e. C. jejuni subsp. jejuni) and C. coli isolation protocols involve incubation of the media at 42 ∞C since growth of these species is fully supported at this temperature. However, some C. jejuni subsp. doylei, C. upsaliensis, C. helveticus, C. fetus, C. concisus and C. mucosalis strains will not grow at 42 ∞C. A recent report of sporadic and outbreak illness caused by C. curvus indicated that they grew at both 37 ∞C and 42 ∞C (Abbott et al., 2005). All 16 Campylobacter species will grow at 37 ∞C

496

Emerging foodborne pathogens

microaerophilically. While most thermotolerant Campylobacter species will grow at 42 ∞C, studies have shown that damaged Campylobacter cells recover better at 37 ∞C (Ray and Johnson, 1984a,b Humphrey, 1986a,b). However, some selective supplements (e.g. Skirrow), devised for use at 42 ∞C are less selective at 37 ∞C (Endtz et al., 1991). 18.6.5 Growth atmosphere The atmospheric requirement of a Campylobacter species is also an important consideration in isolating non-jejuni/coli Campylobacter. Most Campylobacter species will grow microaerophilically (i.e. 3–10% O2) at 37 ∞C. Six Campylobacter species (C. concisus, C. curvus, C. rectus, C. gracilis, C. showae, and C. mucosalis) require hydrogen for growth. C. concisus, C. curvus, and C. mucosalis will grow microaerophilically in the presence of H2, but optimal growth of C. rectus, C. gracilis, and C. showae requires more anaerobic conditions (Vandamme, 2000). In addition, these six species require the addition of formate to the growth media (Lastovica and Skirrow, 2000). C. hominis was isolated after anaerobic growth in the presence of 5% H2 (Lawson et al., 2001), but it is not known if growth of this species is supported in the absence of hydrogen.

18.6.6 Growth incubation time Growth incubation time must also be taken into account when isolating nonjejuni/coli Campylobacter. Most protocols for the isolation of Campylobacter from food and water were designed for the isolation of C. jejuni. These methods involve a 1–2 d enrichment step and a 1–2 d incubation step on selective media. Generally, non-jejuni/coli Campylobacter species grow more slowly than C. jejuni and C. coli, especially during the initial isolation. Incubation times for these organisms range from 2–3 d for C. hyointestinalis (Gorkiewicz et al., 2002; Hanninen et al., 2002; On et al., 1995) and C. lanienae (Sasaki et al., 2003) to over 21 d for C. hominis (Lawson et al., 2001).

18.7

Detection and differentiation methods

18.7.1 Speciation Speciation of isolates often requires lengthy and labour-intensive biochemical assays that are sometimes inaccurate. The primary biochemical test for C. jejuni is hippurate hydrolysis. However, hippurate-negative C. jejuni strains have been observed (Totten et al., 1987; Engvall et al., 2002) and Engvall et al. (2002) reported that 52 of 174 Campylobacter isolates originally identified as thermophilic by phenotypic tests were misidentified: 27 of the 52 were identified as Arcobacter by PCR. The majority of published speciation methods

Campylobacter

497

that do not involve isolation, strain purification, and phenotypic/biochemical characterization are PCR-based. PCR-based methods can be designed to detect genera (Marshall et al., 1999; Linton et al., 1996) or groups of species, such as thermotolerant Campylobacter, (Eyers et al., 1993; Fermer and Engvall, 1999; Sails et al., 1998; Thunberg et al., 2000; Klena et al., 2004), or they can be designed to speciate Campylobacter (Cardarelli-Leite et al., 1996; Marshall et al., 1999; Linton et al., 1996; Burnett et al., 2002; Eyers et al., 1993) present in a sample. Currently, no PCR-based method exists that will identify Campylobacter at the subspecies level. Regardless of the level of identification, the 16S and 23S rDNA regions are obvious targets for amplification since they are the only sequenced regions for many Campylobacter species. The Campylobacter 16S and 23S rDNA regions contain conserved regions that permit the design of ‘Campylobacter’ primer sets. Within these amplicons, species-specific base pair differences are present that can be used either to construct species-specific primers or, when the base pair changes add or subtract restriction sites, to design PCR-RFLP methods. A comprehensive 16S PCR-RFLP method for speciating Campylobacter, Helicobacter and Arcobacter isolates has been reported (Marshall et al., 1999). This method speciated several members of these taxa successfully, but it did not distinguish between C. jejuni and C. coli (a secondary hipO amplification was required), nor could it distinguish between C. hyointestinalis and C. fetus isolates, and subspecies of C. sputorum or C. fetus. Other PCR-RFLP methods have similar problems in that many cannot distinguish C. jejuni and C. coli (CardarelliLeite et al., 1996; Linton et al., 1997). With the accumulation of genomic data, new methods have been described that amplify genes unique to a given species. These include, for example, the hipO gene of C. jejuni (Wang et al., 2002; Englen and Fedorka-Cray, 2002; Steinhauserova et al., 2001; Slater and Owen, 1997; Linton et al., 1997), the ceuE genes of C. jejuni and C. coli (Englen and Fedorka-Cray, 2002; Gonzalez et al., 1997), and the sapB2 gene from C. fetus subsp. fetus (Wang et al., 2002). Additionally, some genes, e.g. glyA (Wang et al., 2002; Al Rashid et al., 2000) or flaA (Waegel and Nachamkin, 1996; Wegmuller et al., 1993; Oyofo et al., 1992), are sufficiently diverse across the taxa that primer sets targeted to specific species can be designed. Multiplex PCR methods based on these genes have demonstrated unequivocal speciation (Wang et al., 2002; Englen and Fedorka-Cray, 2002). A multiplex PCR assay has been reported for identification of C. coli, C. jejuni, C. lari, and C. upsaliensis. Differences in the sequences of the lpxA genes (encodes UDP-N-acetylglucosamine acyltransferase involved in lipidA biosynthesis) for these species were exploited for designing species-specific primers (Klena et al., 2004). The assay was validated with >100 strains of known Campylobacter species, and tested with >100 additional clinical and environmental strains, yielding 100% agreement with biochemical typing methods (Klena et al., 2004). As more sequence data becomes available for the less characterized

498

Emerging foodborne pathogens

Campylobacter species, e.g., C. showae and C. mucosalis, better speciation primer sets can be constructed. Additional details of PCR-based detection of C. coli and C. jejuni in water, milk and poultry samples are provided in previous reviews (Mandrell and Wachtel, 1999; Miller and Mandrell, 2005).

18.8 Comparative genomics of C. coli, C. lari, C. upsaliensis and C. jejuni The first strain of Campylobacter fully sequenced was C. jejuni NCTC 11168 reported in 2000 (Parkhill et al., 2000). Recently, the complete sequence of a second strain of C. jejuni, RM1221, isolated from chicken, and the partial sequences of a strain of each of C. coli (RM2228, isolated from chicken), C. lari (RM2100, isolated from human stool), and C. upsaliensis (RM3195, isolated from human stool) were reported (Fouts et al., 2005). Although closed genomes will provide the most definitive comparisons, preliminary analysis of the initial sequence data has revealed a number of interesting features regarding the ECS. The total chromosome sizes range from 1.52 Mb for the C. lari strain to 1.78 Mb for C. jejuni strain RM1221. The G + C content ranges from 29.64% for C. lari to 34.54% for C. upsaliensis (Fouts et al., 2005).

18.8.1 Integrated elements and phage One of the major differences between the two fully sequenced C. jejuni strains was the presence of four ‘large integrated elements’, one of which resembles a Mu-like phage (CMLP1), containing structural Mu phage head, tail, and transposase homologues (Fouts et al., 2005). Primers designed from the CMLP1 sequence revealed similar genes, and possibly functional CMLP in many ECS strains including C. jejuni subsp. doylei, C. coli, C. lari, C. upsaliensis, C. mucosalis, C. hyointestinalis, C. concisus, and C. curvus (W. Miller, unpublished data). ORFs within additional integrated elements in the C. jejuni, C. lari and C. upsaliensis genomes encode endonucleases, methylases or repressors. Thus, CMLP, and other phage, may be present in many Campylobacter strains, especially those exposed to the food and animal production environment. Regardless, the elements may be important genetic factors in lateral transfer of DNA among compatible ECS. 18.8.2 Plasmids C. coli RM2228, C. lari RM2100 and C. upsaliensis RM3195 have megaplasmids of 180 (pCC178), 46 (pCL46), and 110 kb (pCU110), respectively. pCC178 contains antibiotic resistance genes and putative mobile genetic elements (Fouts et al., 2005). However, the most interesting feature

Campylobacter

499

within these three plasmids is the presence of type IV secretion system (T4SS) genes (Fouts et al., 2005). A putative T4SS locus was first reported for the C. jejuni pVir plasmid (Bacon et al., 2000). T4SS proteins are associated with formation of conjugation pili, mobilization of DNA and secretion of virulence factors for both animal and plant pathogens (Craig et al., 2004). However, the ECS T4SS genes are more similar to those of T4SSs that mobilize DNA, suggesting they serve a similar function for the ECS and may be important in lateral transfer of DNA between species (Fouts et al., 2005).

18.8.3 Polynucleotide tracts A gene-regulation system discovered in the first C. jejuni genome project was based on variable polynucleotide tracts resulting in slipped-strand mispairing during replication (Parkhill et al., 2000). Variable poly G/C tracts were identified also in the C. coli, C. lari and C. upsaliensis sequences, with a high of at least 22 variable poly G/C tracts (range 12–19bp) in C. upsaliensis RM3195 (Fouts et al., 2005). The function of less than half of the C. upsaliensis genes in which the variable tracts occur is unknown; six of the genes have homology with sugar transferases and synthetases.

18.9

Putative and potential ECS virulence factors

Compared to other well-characterized human pathogens (i.e. Salmonella spp. and E. coli), relatively little is known in C. jejuni about the molecular mechanisms of virulence. Similarly, with the exception of C. fetus, even less is known about virulence in the ECS (e.g. C. lari and C. upsaliensis). The recent genome sequencing of C. coli, C. lari, and C. upsaliensis (see above) has enhanced our ability to study the mechanisms of pathogenicity for ECS, although it is worth noting that some virulence determinants might be strainspecific and, therefore, not yet identified. Nevertheless, several genes encoding known or putative virulence determinants in C. jejuni are present in the ECS; these and other virulence determinants are discussed below. 18.9.1 Toxins The toxin of any Campylobacter species that has been best defined genetically and functionally is cytolethal distending toxin (CDT) (Pickett et al., 1996; Lara-Tejero and Galan, 2001). CDT in C. jejuni is encoded by the cdtABC genes. All three proteins are necessary for toxin activity and evidence suggests that the CDT holotoxin is a heterotrimer with a 1:1:1 stoichiometry. CDT causes cell cycle arrest in the G1 or G2 phase, with subsequent cell death (Lara-Tejero and Galan, 2001). CDT genes are present in nearly 100% of C. jejuni strains, and also in some ECS (e.g. C. coli, C. lari, C. upsaliensis,

500

Emerging foodborne pathogens

C. hyointestinalis) and in several related Helicobacter species (Pickett et al., 1996). CDT in extracts of C. upsaliensis reportedly caused cell-cycle arrest of HeLa and human T-lymphocytes (Mooney et al., 2001). Each of the cdtA, B and C genes were identified also in the C. coli, C. lari and C. upsaliensis genomes reported recently (Fouts et al., 2005). Although most strains tested contain the CDT genes, expression of the toxin in Campylobacter is variable, and it is not known if this variability is due to differences in expression or allelic differences in the CDT subunits. Additional enterotoxins, cytotoxins, hemolysins, and even a shigalike toxin, have been reported as present in Campylobacter species (Wassenaar, 1997). These toxins have been identified generally by immunochemical and functional assays, and only in a subset of Campylobacter strains, (C. jejuni predominantly and C. coli infrequently). However, genes encoding toxin synthesis have been elusive. C. coli and C. jejuni strains from different geographic and animal sources were reported to express enterotoxins similar immunochemically to Vibrio cholera toxin and E. coli heat-labile toxin and of variable activity in cell culture assays (Wassenaar, 1997). Enterotoxinlike activity was reported for C. lari (Johnson and Lior, 1986) and C. hyointestinalis (Johnson and Lior, 1988) strains, but genes encoding them have not been identified and the mechanisms of activity remain unclear.

18.9.2 Adhesins and invasins Several putative adhesins described in C. jejuni are also present in C. coli, C. lari, and C. upsaliensis. The PEB proteins of C. jejuni are present in other Campylobacter species; however, not all PEB proteins are present in all campylobacters. PEB1a and PEB1b genes are present in the genome sequences of C. coli RM2228 and C. upsaliensis RM3195, but not C. lari RM2100 (Fouts et al., 2005). PEB1c is present in C. lari RM2100, but the similarities between the C. jejuni and C. lari predicted proteins (53%) are much lower than the C. jejuni and C. coli or C. upsaliensis proteins (91–95%). Also, PEB2 and PEB3 are present in both C. jejuni and C. lari, but not C. coli or C. upsaliensis. All four species contain PEB4. Other Campylobacter adhesins and invasins, such as JlpA CadF, CiaB and fibronectin binding protein (FN), and other putative virulence factors, such as proteins involved in motility and two-component sensors, are present in all four thermophilic Campylobacter species (Fouts et al., 2005). A CiaB homologue has been reported also in C. fetus. Therefore, differences in pathogenesis between C. jejuni and the other thermophilic Campylobacter species may be associated with the function of these known factors and/or hypothetical C. jejuni-specific genes in human hosts. Alternatively, perhaps ECS causing sporadic illness are not being identified.

18.9.3 Campylobacter glycome C. jejuni strains synthesize multiple surface-expressed glycoconjugates that

Campylobacter

501

also are virulence factors. These include capsular polysaccharide, lipooligosaccharide, and glycoproteins with both O- and N-linked sugars (Karlyshev et al., 2005). These molecules compose the C. jejuni glycome (Karlyshev et al., 2005). Although less is known about the glycomes of nonjejuni Campylobacter species, the ECS genomes (i.e. C. coli, C. lari, C. upsaliensis) revealed the potential for equally complex glycomes involved in biology.

18.9.4 Lipooligosaccharides and lipopolysaccharides Lipooligosaccharides are important surface structures in C. jejuni and, presumably, also in ECS. The lipooligosaccharide genetic loci in each of the three sequenced ECS are similar to C. jejuni in organization with heptosyltransferase genes waaC and waaF at opposite ends of the lipooligosaccharide locus surrounding ORFs that are different among the species and probably encode different structures (Fouts et al., 2005; Gilbert et al., 2005). (Presumably, variability exists also among strains as has been described for C. jejuni, by phase variation as a result of variable poly-NT repeats within glycosyltransferase genes (Linton et al., 2000; Gilbert et al., 2005). However, no genes with strong homology to the genes in C. jejuni that synthesize N-acetylneuraminic acid (sialic acid) or the sialyltransferases involved in synthesis of oligosaccharides that mimic ganglioseries glycosphingolipids (e.g. GM1) were evident (Gilbert et al., 2000; Gilbert et al., 2002). C. fetus subsp. fetus (Cff ) and C. fetus subsp. venerealis apparently synthesize smooth-type lipopolysaccharide with high MW repeating units, in contrast to lipooligosaccharide expressed by C. jejuni and C. coli (Perez-Perez et al., 1986; Moran et al., 1994). Lipopolysaccharide is a major serotype antigen of Cff strains and strains susceptible to normal human serum are associated with the serogroup defined by the lipopolysaccharide; serogroup A Cff strains were more resistant than serogroup AB and B strains (Perez-Perez et al., 1986). Lipopolysaccharide and the S-layer protein interactions are critical in the pathogenesis of Cff, since the diseases caused by Cff usually involve invasion into the circulation and involvement of the humoral and cellular immune systems of the host (Table 18.1). Structural analysis of Cff serotype A strain and serotype B strain lipopolysaccharides revealed they are composed of partially O-acetylated D-mannan chains (Senchenkova et al., 1997), or D-rhamnose chains with a terminal O-methyl D-rhamnose (Senchenkova et al., 1996), respectively. In a separate study, sialic acid, fucose, glucose, galactose, D-glucosamine and D-galactosamine were also identified by composition analysis of multiple Cff strains (Moran et al., 1994). It is probable that there are multiple Cff lipopolysaccharide structures that reflect serotype differences and, possibly, the types of disease caused in animal and human hosts (Table 18.1).

502

Emerging foodborne pathogens

The oligosaccharide portion of the lipooligosaccharide of a heat stable (HS) serotype 30 (O:30) strain of C. coli reported by Aspinall et al. was composed of a b-D-Qui3NAc-(1Æ2)-b-D-Qui3NAc disaccharide at the nonreducing end (Aspinall et al., 1993b). Qui3NAc is 3-acylamino-3,6-dideoxyD-glucose, an unusual sugar that in the C. coli lipooligosaccharide is acylated with either 3-hydroxybutanoyl or 3-hydroxy-2,3-dimethyl-5-oxoproly residues (Aspinall et al., 1993b). There appear to be significant differences in the types of sugars and the organization of the lipooligosaccharide and/or lipopolysaccharide related to C. jejuni and ECS. For example, the initial characterizations of C. coli and C. jejuni heat-stable (HS) serotype antigens described enteric-like lipopolysaccharide with varying length O-repeat units resulting in ‘ladder’ patterns of lipopolysaccharide molecules by SDS-PAGE (Preston and Penner, 1987; Penner, 1988). It is now accepted generally, that the endotoxic lipid Acontaining glycolipid is not the HS antigen (Chart et al., 1996) and that the ladder patterns are due to lipid-linked capsular polysaccharide molecules, rather than a lipopolysaccharide (Karlyshev et al., 2000). Similar immunochemical, genetic and structural studies of other ECS will be important to determine whether they have lipooligosaccharide (and mimic mammalian glycosphingolipids) and/or lipopolysaccharide.

18.9.5 Capsular polysaccharide The capsular polysaccharides are important surface structures of many Gramnegative bacteria, and are involved in pathogenesis by protecting organisms from both the cellular and humoral immune systems in animals (Orskov et al., 1977). As noted above, the capsular polysaccharide of C. jejuni are the major molecules responsible for HS (Penner) serotype antigens (Karlyshev et al., 2000) and are important virulence factors (Bacon et al., 2001). Functions of capsular polysaccharides of other bacteria that have been described, in addition to resistance to both non-specific and specific host immunity, are prevention of desiccation, adherence and biofilm formation (Roberts, 1996). The only chemical information reported for capsular polysaccharides of any ECS is for a C. coli serotype O:30 strain (Aspinall et al., 1993a). The capsule was shown to be composed of a repeating 5-ribitol-1-phosphate sugar with side chains at O-2 of O-(6-deoxy-b-D-talo-heptopyranosyl)-(1Æ4)(2-acetylamino-2-deoxy-b-D-glucopyranosyl) units. The 6-deoxy-talo-heptose sugar has not been detected in any other Gram-negative bacteria. kps genes involved in synthesis and export of capsular polysaccharides were identified in recent C. coli (RM2228), C. lari (RM2100) and C. upsaliensis (RM3195) genome sequences (Fouts et al., 2005). The organization of the C. upsaliensis kps genes was different from that of the other two ECS strains and the two C. jejuni strains that have been sequenced (NCTC 11168 and RM1221), with multiple clusters of orthologues located outside the kps locus, and some that are unique to C. upsaliensis (Fouts et al., 2005). A variable

Campylobacter

503

poly-G tract in one of three putative GDP-fucose synthetase genes for C. upsaliensis RM3195 suggests that regulation of the concentration of this or an analogous sugar may occur. Orthologues of C. jejuni kps genes were identified, but many unique genes were present for each of the three ECS, indicating synthesis of different polysaccharide capsule structures.

18.9.6 Phosphorylcholine A putative licABCD locus was identified in C. upsaliensis strain RM3195 (Fouts et al., 2005). The locus had varying, but significant, identity to genes present in Haemophilus influenzae (Weiser et al., 1989), commensal Neisseria species (Serino and Virji, 2002) and Streptococcus pneumoniae (Zhang et al., 1999). licABCD genes in these mucosal and respiratory pathogens putatively encode proteins involved in acquisition of choline (licB), synthesis of phosphorylcholine (licA,C) and transfer of phosphorylcholine (licD) to lipooligosaccharides or teichoic/lipoteichoic acids of Gram-negative or Grampositive bacteria, respectively (Serino and Virji, 2002; Zhang et al., 1999). Preliminary studies indicate that most strains of C. upsaliensis from South Africa, and some from European countries, also have licA (REM, unpublished observations). A variable poly-G tract within the licA gene of C. upsaliensis RM3195 probably regulates synthesis of phosphorylcholine and ultimately affects decoration of lipooligosaccharides.

18.9.7 Protein glycosylation Campylobacter species possess the capability to glycosylate flagellin and other proteins with both O- (Doig et al., 1996; Parkhill et al., 2000) and Nlinked sugars (Szymanski et al., 1999; Young et al., 2002). A genetic locus thought originally to be involved in synthesis of lipooligosaccharides (Fry et al., 1998) was revealed later to be an N-linked protein glycosylation pathway of ~16 kb, designated pgl (Szymanski et al., 1999), and composed of genes putatively encoding a variety of transferases (Szymanski and Wren, 2005). Structural analysis determined the N-linked oligosaccharide to be G a l N A c a1 , 4 G a l N A c a1 , 4 ( G l c b1 , 3 - ) G a l N A c a1 , 4 G a l N A c a1 , 4 GalNAca1,3Bacb1,N-Asn (Bac = trideoxyglucose) (Young et al., 2002). The O-linked glycosylation pathway has been shown to be important in motility (Logan et al., 2002) and the N-linked pathway important in attachment and invasion of eukaryotic cells (Szymanski et al., 2002), and colonization of GI tracts of mice and chickens (Hendrixson and DiRita, 2004). The genome sequences of C. coli RM2228, C. lari RM2100 and C. upsaliensis RM3195 revealed that the pgl genes are conserved and organized similarly among the ECS, except for the absence of one and two pgl genes in the C. coli and C. lari genomes, respectively, and the separation of three pgl genes in the C. upsaliensis genome (Fouts et al., 2005; Szymanski and Wren, 2005). There is no information on how these differences affect O- and N-linked protein

504

Emerging foodborne pathogens

glycosylation for the genome strains of C. coli, C. lari and C. upsaliensis that have homolog genes. However, it seems likely O- and N-linked glycosylation are important factors in ECS biology.

18.9.8 The S (surface) layer of C. fetus and C. rectus. C. fetus cells have been shown to contain a proteinaceous, acidic, and antigenically variable outer layer (Yang et al., 1992). This outer layer, termed surface (S) layer, is responsible for phagocytosis resistance in this species, inhibiting uptake of C. fetus cells by macrophages (Blaser et al., 1988). The S-layer also makes C. fetus cells more resistant to the complement system; it is believed that complement resistance accounts for the large number of systemic C. fetus infections relative to C. jejuni and C. coli (Table 18.1), which are both complement sensitive (Blaser et al., 1988). The S-layer proteins (SLPs) of C. fetus are encoded by alleles of the sapA or sapB genes. SapA alleles are highly conserved at the amino-terminal end; however, very little sequence conservation is present in the carboxy-terminal end of the protein (Tu et al., 2003). SapB alleles show similar organization. Antigenic variation of the SapA SLPs in C. fetus is due to the presence of an invertible segment containing both the sapA promoter and the sapDEF genes that encode a type I SLP transport system (Tu et al., 2004). Recombination at the conserved 5’ end of any two of the clustered sapA alleles results in the juxtaposition of the sapA promoter with one of the sapA alleles and subsequent expression of a new SLP antigen. The periodontal pathogen C. rectus also contains an S-layer (Kaneko, 1992); however, very little similarity exists between the SLPs, although the C. rectus SLPs may also be transported by a type I transport system. The C. rectus SLP is encoded by crsA (Wang et al., 1998). The S-layer in C. rectus is not important for binding to epithelial cells; however, CrsA has been shown to decrease expression of the proinflammatory cytokines IL-6, IL-8 and TNF-a, perhaps thereby permitting persistence of C. rectus in periodontal sites with concomitant inflammation (Wang et al., 2000).

18.9.9 Other virulence factors Additional virulence factors will be revealed as more genetic sequence data are obtained and Campylobacter species are characterized. One area of potential future research involves the characterization of the plasmids and prophage of Campylobacter species. Prophage and plasmids have been demonstrated to be reservoirs of pathogenicity functions in multiple taxa. Although no known virulence genes were present in the prophage regions of the sequenced genomes of C. jejuni and C. lari, other uncharacterized bacteriophage of this genus might contain toxins. Finally, putative virulence genes are present on the megaplasmids of C. lari and C. coli. The 46 kb C. lari RM2100 plasmid contains an S. enterica sinH/sivH adhesin/invasin homolog, and the 180 kb

Campylobacter

505

C. coli RM2228 plasmid contains a block of genes with high similarity to a gene cluster in V. cholerae. However, it is unknown whether either set of genes is important for pathogenicity in these two species. Two-component signal transduction systems (TCSTSs) mediate adaptation of bacteria to changes in their environment through a sensor (histidine kinase) and response regulator system (Albright et al., 1989). Two separate C. jejuni TCSTSs were shown previously to be important in colonization of one-dayold chicks (racR-racS, (Brás et al., 1999)), and colonization and inflammation of normal and immunodeficient mice (dccR-dccS, (Mackichan et al., 2004)). An examination of the C. coli RM2228, C. lari RM2100 and C. upsaliensis RM3195 genomes (Fouts et al., 2005) revealed for each species dccR-dccS homologues, and homologues also for each of the three genes positivelyregulated by dccR-dccS (two putative periplasmic and one integral membrane protein(s)) (Mackichan et al., 2004). Three TCSTSs in addition to the racRracS and dccR-dccS homologues were identified in the C. coli, C. lari and C. upsaliensis genomes (Fouts et al., 2005), indicating similar mechanisms among the ECS for adapting to different environmental stimuli.

18.10

Genotyping

Genotypic typing schemes, reviewed in Wassenaar and Newell (2000) and Newell et al. (2000), rely mainly on bp differences between strains that can be altered by restriction enzymes. Pulsed field gel electrophoresis (PFGE: rare cutting restriction enzymes), ribotyping (polymorphisms in the rDNA loci), PCR-restriction fragment length polymorphisms (PCR-RFLP: polymorphisms at a select locus, e.g. flagellin), and amplified fragment length polymorphisms (AFLP: amplification of digestion products flanked by specific restriction sites), have all been applied to differentiating ECS (Wassenaar and Newell, 2000; Newell et al., 2000; On and Harrington, 2000). However, these restriction-based typing methods have several drawbacks, including lack of standardization, reagent and method differences, variable digestion or fragment sizes due to methylation differences, and labour intensive procedures. AFLP is the most discriminatory of these methods, generally, but the ultimate genotypic marker is the genomic sequence. Although complete genome sequencing of multiple epidemiologically important strains (e.g. outbreak isolates) is not practical, multilocus sequence typing (MLST) (Dingle et al., 2001), which relies on sequencing short (approx. 500 bp) regions from multiple loci, has proven valuable for differentiating C. jejuni strains and assessing their relatedness (Dingle et al., 2002). The availability of three non-jejuni Campylobacter draft genome sequences (Fouts et al., 2005) facilitated the development of an expanded MLST system for genotyping four ECS: C. coli, C. lari, C. upsaliensis and C. helveticus (Miller et al., 2005). One hundred and twenty-eight sequence types were identified for the four species,

506

Emerging foodborne pathogens

indicating that this expanded MLST method is a robust typing system for many ECS. For example, the expanded MLST method was used to type nearly 500 C. coli srains isolated from different geographical locations in the US over a 6 year period from cattle, chickens, swine and turkeys, resulting in 149 MLST sequence types (Miller et al., 2006). The most striking findings, however, were that many of the alleles and resulting sequence types were host-associated, and that cattle isolates diverse both spatially and temporally appeared to be highly clonal (52/63 cattle isolates were a single sequence type). The results of this MLST study indicated that source-tracking of C. coli strains may be possible, and suggested that some C. coli strains may have adapted or been selected in some hosts, i.e. cattle strains (Miller et al., 2006). Also, preliminary MLST analysis of human C. coli strains indicated that attribution of human illnesses to a food source also may be possible (unpublished observations). Other preliminary results suggest that this MLST method can be extended into many of the remaining ECS, including C. concisus, C. fetus, and C. sputorum (unpublished results). Thus, a comprehensive typing method for all the ECS may be feasible. Other potential assays for speciation of ECS include biochemical (Acuff, 1992), genetic (PCR) (Acuff, 1992; Fermer and Engvall, 1999; Wang et al., 2002; Bang et al., 2002; Klena et al., 2004), immunochemical (Kosunen et al., 1984; Lamoureux et al., 1997; Mandrell et al., 2002), chemotaxonomic fatty acid profiling (Brondz and Olsen, 1991), and protein one-dimensional gel electrophoresis methods (Vandamme et al., 1991b). Recently, an oligonucleotide-probe microarray assay was developed for identifying C. coli, C. jejuni, C. lari, and C. upsaliensis strains (Volokhov et al., 2003). MALDI-TOF mass spectrometric analyses of whole Campylobacter cells for intact proteins to identify biomarker ions have been reported previously. Protein biomarker ions in the 10–20 kilodalton (kDa) range were reported to be the most discriminatory ((Winkler et al., 1999), unpublished data). Speciation of C. coli, C. jejuni, C. lari, C. helveticus, C. sputorum subsp. faecalis and C. upsaliensis has been achieved by analyzing a portion of multiple or single colonies isolated from a variety of food and animal samples cultured on agar media (Mandrell et al., 2005). The species- and sub-species specific biomarker ions were in most cases conserved, high copy number, cytosolic proteins (unpublished data) that could be identified by analysis of public (Parkhill et al., 2000; Fouts et al., 2005) and internal (unpublished data) Campylobacter genome databases. MALDI-TOF MS may be especially useful for characterizing ECS strains, because of the minimal genetic and biochemical data available for most ECS.

18.11

Prevention and control

The broad host range and prevalence of Campylobacter species in animals and the food supply (Tables 18.2 and 18.3) reflect the urgent need to develop

Campylobacter

507

better methods for controlling them both in the pre- and post-harvest food production and processing environments. Most of the control and intervention methods that have been developed and tested have targeted C. jejuni and, in some cases, C. coli in animals and food, predominantly chickens and chicken meat (Stern, 1992; White et al., 1997; Stern and Line, 2000; Ransom et al., 2000). As noted above, C. jejuni are prevalent in poultry operations and in retail chicken (Table 18.3 and Ransom et al. (2000) and it is this production system that has had the most attention in development of prevention or control measures. Some pre-harvest control measures for minimizing or eliminating C. jejuni in poultry, but worthy of consideration also for ECS in animals or on food, are sanitation, biosecurity, vaccinations and/or antibiotics to prevent or control debilitating infectious diseases, and the use of nonpathogenic bacteria to competitively exclude Campylobacter colonization (Stern, 1992; White et al., 1997; Ransom et al., 2000; Humphrey, 2004). Post-harvest control measures that have been tested are chemicals (e.g. chlorine, trisodium phosphate, organic acids, herbal extracts) added to processing water, plus water replacements and counter-flow, steam, and irradiation (White et al., 1997; Stern and Line, 2000; Ransom et al., 2000; Humphrey, 2004). Most of these control strategies have not been reported to be highly effective at decreasing Campylobacter significantly or consistently. Decreasing stress during transportation of animals, proper temperature control during food storage, and proper handling of food by food-preparation workers and by consumers, also would probably assist in controlling human illness. Heat treatment or irradiation are logically the most effective post-harvest control methods, but will probably require increased effort, money and public acceptance for success.

18.12

Conclusions and future trends

After nearly three decades of intensive research on Campylobacter species, many questions remain regarding the ecology, biology and epidemiology of ECS, and their incidence in food and role in public health. The risk of getting sick with any Campylobacter species is associated with factors like geographic location (e.g. intensive animal production, farming practices, climate, water, food processing, travel), host-susceptibility (e.g. immunity, host-genetics, underlying disease), ecology (e.g. strain differences and competitive microflora) and habits (e.g. restaurants, cooking techniques, awareness of risks, pets). The major risk factors include consumption of chicken or pork, daily contact with pets (cats and dogs) or chickens, travel abroad, drinking unpasteurized milk, involvement in water sports, and barbecuing meat (Kapperud et al., 1992; Altekruse et al., 1999; Studahl and Andersson, 2000; Rodrigues et al., 2001; Sopwith et al., 2003). However, the sources associated with outbreaks for any Campylobacter species (Miller and Mandrell, 2005), and the limited number of outbreaks documented for ECS (Table 18.4), confirm the increased

508

Emerging foodborne pathogens

risk of consuming raw milk or untreated water. The prevalence of C. coli and C. jejuni in the environment (Miller and Mandrell, 2005), and the incidence of ECS documented in animals and food (Tables 18.2 and 18.3), suggests that humans are exposed frequently to low doses of Campylobacter. Immunocompetent individuals exposed to low doses may develop immunity to subsequent low doses of antigenically similar strains (Blaser et al., 1987; Black et al., 1988). The small genome size of Campylobacter species (~1.6–2.0 Mb) may be compensated by the diversity and hypervariability that occurs through genetic exchange and rearrangements (de Boer et al., 2002; Wassenaar et al., 1998; Miller and Mandrell, 2005), plasmids, and polynucleotide repeats (Fouts et al., 2005; Parkhill et al., 2000). These mechanisms may enhance survival of ECS in animal GI tracts, water, and during food processing (e.g. hot and cold water, oxidative stress, chemical sanitizers). New genotypes and phenotypes of Campylobacter could emerge in animals or food due to increased fitness characteristics that enhance survival under stress conditions (Kelly et al., 2003). Multiple mechanisms of genetic exchange and hypervariability in intensive animal or food production environments probably result in ECS with enhanced fitness for certain animal hosts (e.g. C. fetus and sheep and cattle, C. jejuni and poultry, C. coli and swine, C. upsaliensis and C. helveticus and cats and dogs, C. lari and wild birds). The emergence of strains with increased fitness for a host suggests ECS strains contain clues for determining their source by identifying specific genes and/or mutations crucial for survival. Epidemiologically relevant strains analyzed by novel molecular methods (e.g. MLST and AFLP methods) may help to identify differences between strains for source-tracking, and also clues for developing novel strategies for decreasing the prevalence and virulence of Campylobacter species in food production environments. Isolation procedures used by clinical laboratories focus on the detection of C. jejuni and C. coli since these two species are accepted by most researchers to be the primary pathogenic organisms in the family Campylobacteracae. However, improvements in the detection and isolation of ECS have indicated that these Campylobacter and Arcobacter species cause more human illness than appreciated by the public health community (Vandamme et al., 1992a; Vandenberg et al., 2004). Genetic evidence of Campylobacter species in faeces of patients with GI illness, but with no other cause identified, emphasizes the need for further studies (Maher et al., 2003). The second most isolated Campylobacter species in South Africa is C. concisus, followed closely by C. upsaliensis (Lastovica and Skirrow, 2000). Clinical isolation of ECS in some parts of the world, such as the U.S., is uncommon, although it cannot be ascertained presently whether this is a result of the isolation methods employed or is due to inherent differences in environmental reservoirs. ECS have been isolated from blood and stool samples, but there is minimal data on ECS incidence in food. The most likely explanation for this discrepancy is the difficulty in culturing ECS. Therefore, improved protocols for isolation,

Campylobacter

509

detection and identification of ECS in the food supply are needed (Lastovica and Skirrow, 2000). Because generic Campylobacter isolation methods may not be possible and because foodborne Campylobacter species are present in low levels and possibly in a viable but nonculturable state, molecular methods must be developed to increase detection sensitivity. Extensive genomic data now exist for the four thermotolerant Campylobacter species (Fouts et al., 2005), but PCR-based methods for ECS are hindered by a lack of genomic data for the non-thermotolerant ECS. The only genomic data available are 16S and/ or 23S rDNA sequences; minimal sequence data is available for C. rectus, C. concisus, C. fetus, and Arcobacter species. However, sequencing projects completed or ongoing for some of the ECS will provide genomic data invaluable for development of new and/or improved molecular detection methods (Fouts et al., 2005; Miller et al., 2005; TIGR, 2006). To address some of the issues described above, a Consortium Grant (CAMPYCHECK) was established through the European Commission Fifth Framework Programme (FP5: 1998–2002) (CAMPYCHECK, 2003). The goals of the CAMPYCHECK project are to develop new isolation and detection methods and survey multiple foods for the incidence of ECS. It is anticipated that this research will yield improved assessment of ECS in the food chain and whether new zoonotic reservoirs for these organisms exist. Improved methods will delineate also the clinical importance of ECS and their impact on public health.

18.13

Acknowledgements

This work was supported by the United States Department of Agriculture, Agricultural Research Service CRIS project 5325-42000-041, and it also supports collaboration between the U.S. and the European Commission in the Fifth Framework Project QLK1-CT-2002-0220, ‘CAMPYCHECK’.

18.14

References

AABENHUS, R., PERMIN, H., ON, S. L.

and ANDERSEN, L. P. (2002) Scand J Infect Dis, 34, 248–

52. AARESTRUP, F. M., NIELSEN, E. M., MADSEN, M.

and ENGBERG, J. (1997) Antimicrob Agents Chemother, 41, 2244–50. ABBOTT, S. L., WADDINGTON, M., LINDQUIST, D., WARE, J., CHEUNG, W., ELY, J. and JANDA, J. M. (2005) J Clin Microbiol, 43, 585–8. ACUFF, G. R. (1992) In Compendium of Methods for the Microbiological Examination of Foods (eds, Vanderzant, C. and Splittstoesser, D. F.) American Public Health Assoc., Washington, DC, pp. 1093–1208. AL RASHID, S. T., DAKUNA, I., LOUIE, H., NG, D., VANDAMME, P., JOHNSON, W. and CHAN, V. L. (2000) J Clin Microbiol, 38, 1488–94.

510

Emerging foodborne pathogens

ALBERT, M. J., TEE, W., LEACH, A., ASCHE, V.

and PENNER, J. L. (1992) J Med Microbiol, 37, 176–9. ALBRIGHT, L. M., HUALA, E. and AUSUBEL, F. M. (1989) Annu Rev Genet, 23, 311–36. ALLERBERGER, F., KASTEN, M. J. and ANHALT, J. P. (1991) Klin Wochenschr, 69, 813–6. ALTEKRUSE, S. F., STERN, N. J., FIELDS, P. I. and SWERDLOW, D. L. (1999) Emerg Infect Dis, 5, 28–35. ALVAREZ, D., MERINO, S., TOMAS, J. M., BENEDI, V. J. and ALBERTI, S. (2000) Infect Immun, 68, 953–5. ANDERSON, L. P., ANDERSEN, O., HOLCK, S., BLOM, J. and JUSTESEN, T. (1996) In Campylobacters, Helicobacters, and Related Organisms (eds, Newell, D. G., Ketley, J. M. and Feldman, R. A.) Plenum Press, New York, pp. 503–506. ASPINALL, G. O., MCDONALD, A. G., RAJU, T. S., PANG, H., MILLS, S. D., KURJANCZYK, L. A. and PENNER, J. L. (1992) J Bacteriol, 174, 1324–32. ASPINALL, G. O., MCDONALD, A. G., PANG, H., KURJANCZYK, L. A. and PENNER, J. L. (1993a) J Biol Chem, 268, 18321–9. ASPINALL, G. O., MCDONALD, A. G., PANG, H., KURJANCZYK, L. A. and PENNER, J. L. (1993b) J Biol Chem, 268, 6263–8. ASPINALL, G. O., MCDONALD, A. G., RAJU, T. S., PANG, H., KURJANCZYK, L. A., PENNER, J. L. and MORAN, A. P. (1993c) Eur J Biochem, 213, 1029–37. ASPINALL, S. T., WAREING, D. R., HAYWARD, P. G. and HUTCHINSON, D. N. (1993d) J Clin Pathol, 46, 829–31. ASPINALL, G. O., MCDONALD, A. G. and PANG, H. (1994) Biochemistry, 33, 250–5. ASPINALL, S. T., WAREING, D. R., HAYWARD, P. G. and HUTCHINSON, D. N. (1996) J Appl Bacteriol, 80, 645–50. ATABAY, H. I. and CORRY, J. E. (1998) J Appl Microbiol, 84, 733–40. ATANASSOVA, V. and RING, C. (1999) Int J Food Microbiol, 51, 187–90. BACON, D. J., ALM, R. A., BURR, D. H., HU, L., KOPECKO, D. J., EWING, C. P., TRUST, T. J. and GUERRY, P. (2000) Infect Immun, 68, 4384–90. BACON, D. J., SZYMANSKI, C. M., BURR, D. H., SILVER, R. P., ALM, R. A. and GUERRY, P. (2001) Mol Microbiol, 40, 769–77. BAKER, J., BARTON, M. D. and LANSER, J. (1999) Aust Vet J, 77, 662–6. BANG, D. D., WEDDERKOPP, A., PEDERSEN, K. and MADSEN, M. (2002) Mol Cell Probes, 16, 359– 69. BÄR, W., MÁRQUEZ DE BÄR, G., NITSCHKE, H. M., SCHLIESSLER, A., MAUFF, G., GOLDMANN, A., STEINBRUECKNER, B., HÄRTER, G. and KIST, M. (1996) In Campylobacters, Helicobacters, and Related Organisms (eds, Newell, D. G., Ketley, J. M. and Feldman, R. A.) Plenum Press, New York, pp. 162–165. BATES, C. J., CLARKE, T. C. and SPENCER, R. C. (1994) J Clin Microbiol, 32, 2037. BENJAMIN, J., LEAPER, S., OWEN, R. J. and SKIRROW, M. B. (1983) Current Microbiol, 8, 221– 38. BERNDTSON, E., EMANUELSON, U., ENGVALL, A. and DANIELSSON-THAM, M.-L. (1996) Prevent. Vet Med, 26, 167–85. BEZIAN, M. C., RIBOU, G., BARBERIS-GILETTI, C. and MEGRAUD, F. (1990) Eur J Clin Microbiol Infect Dis, 9, 895–7. BLACK, R. E., LEVINE, M. M., CLEMENTS, M. L., HUGHES, T. P. and BLASER, M. J. (1988) J Infect Dis, 157, 472–9. BLASER, M. J., SAZIE, E. and WILLIAMS, L. P., JR. (1987) Jama, 257, 43–6. BLASER, M. J., SMITH, P. F., REPINE, J. E. and JOINER, K. A. (1988) J Clin Invest, 81, 1434–44. BOURKE, B., CHAN, V. L. and SHERMAN, P. (1998) Clin Microbiol Rev, 11, 440–9. BOYANOVA, L., GERGOVA, G., SPASSOVA, Z., KOUMANOVA, R., YANEVA, P., MITOV, I., DEREJIAN, S. and KRASTEV, Z. (2004) Diagn Microbiol Infect Dis, 49, 71–4. BRÁS, A. M., CHATTERJEE, S., WREN, B. W., NEWELL, D. G. and KETLEY, J. M. (1999) J Bacteriol, 181, 3298–302. BRIEDIS, D. J., KHAMESSAN, A., MCLAUGHLIN, R. W., VALI, H., PANARITOU, M. and CHAN, E. C. (2002) J Clin Microbiol, 40, 4792–6.

Campylobacter BROCZYK, A., THOMPSON, S., SMITH, D.

511

and LIOR, H. (1987) Lancet, 1, 164–5. and OLSEN, I. (1991) J Clin Microbiol, 29, 183–9. BRUNEAU, B., BURC, L., BIZET, C., LAMBERT-ZECHOVSKY, N. and BRANGER, C. (1998) Eur J Clin Microbiol Infect Dis, 17, 185–8. BURNETT, T. A., HORNITSKY, M. A., KUHNERT, P. and DJORDJEVIC, S. P. (2002) FEMS Microbiol Lett, 216, 201–9. BUSATO, A., HOFER, D., LENTZE, T., GAILLARD, C. and BURNENS, A. (1999) Vet Microbiol, 69, 251–63. CAMPYCHECK (2003) Improved physiological, immunological and molecular tools for the recovery and identification of emerging Campylobacteraceae (CAMPYCHECK) : A European Commission Research Project (QLK1 CT 2002 02201), Accessed 2003 http://www.campycheck.org/. CARDARELLI-LEITE, P., BLOM, K., PATTON, C. M., NICHOLSON, M. A., STEIGERWALT, A. G., HUNTER, S. B., BRENNER, D. J., BARRETT, T. J. and SWAMINATHAN, B. (1996) J Clin Microbiol, 34, 62– 7. CARTER, J. E. and CIMOLAI, N. (1996) Nephron, 74, 489. CDC (1981) MMWR Morb Mortal Wkly Rep, 30, 294–5. CDC (1984) MMWR Morb Mortal Wkly Rep, 33, 483–4, 489. CDC (2002) MMWR Morb Mortal Wkly Rep, 51, 325–9. CDC (2003) Centers for Disease Control and Prevention: U.S. Foodborne Disease Outbreaks, Annual Listing, 1990–2000, Accessed 2003 http://www.cdc.gov/foodborneoutbreaks/ us_outb.htm. CDC (2005) MMWR Morb Mortal Wkly Rep, 54, 352–6. CHANG, K., KURTZ, H. J., WARD, G. E. and GEBHART, C. J. (1984) Am J Vet Res, 45, 703–10. CHART, H., FROST, J. A., OZA, A., THWAITES, R., GILLANDERS, S. and ROWE, B. (1996) J Appl Bacteriol, 81, 635–40. CHIU, C. H., KUO, C. Y. and OU, J. T. (1995) Clin Infect Dis, 21, 700–1. CHUSID, M. J., WORTMANN, D. W. and DUNNE, W. M. (1990) Diagn Microbiol Infect Dis, 13, 367–9. COOPER, I. A. and SLEE, K. J. (1971) Med J Aust, 1, 1263–7. CORRY, J. E., POST, D. E., COLIN, P. and LAISNEY, M. J. (1995) Int J Food Microbiol, 26, 43–76. CRAIG, L., PIQUE, M. E. and TAINER, J. A. (2004) Nat Rev Microbiol, 2, 363–78. DACZKOWSKA-KOZON, E. and BRZOSTEK-NOWAKOWSKA, J. (2001) Int J Hyg Environ Health, 203, 435–43. DALY, K., STEWART, C. S., FLINT, H. J. and SHIRAZI-BEECHEY, S. P. (2001) FEMS Microbiology Ecology, 38, 141–51. DE BOER, P., WAGENAAR, J. A., ACHTERBERG, R. P., PUTTEN, J. P., SCHOULS, L. M. and DUIM, B. (2002) Mol Microbiol, 44, 351–9. DEKEYSER, P., GOSSUIN-DETRAIN, M., BUTZLER, J. P. and STERNON, J. (1972) J Infect Dis, 125, 390–2. DIKER, K. S., ESENDAL, O. M. and AKAN, M. (2000) J Vet Med B Infect Dis Vet Public Health, 47, 739–43. DINGLE, K. E., COLLES, F. M., WAREING, D. R. A., URE, R., FOX, A. J., BOLTON, F. E., BOOTSMA, H. J., WILLEMS, R. J. L., URWIN, R. and MAIDEN, M. C. J. (2001) J Clin Microbiol, 39, 14–23. DINGLE, K. E., COLLES, F. M., URE, R., WAGENAAR, J. A., DUIM, B., BOLTON, F. J., FOX, A. J., WAREING, D. R. and MAIDEN, M. C. (2002) Emerg Infect Dis, 8, 949–55. DOIG, P., KINSELLA, N., GUERRY, P. and TRUST, T. J. (1996) Mol Microbiol, 19, 379–87. DOYLE, L. P. (1944) Am J Vet Res, 5, 3–5 DRONDA, F., GARCIA-ARATA, I., NAVAS, E. and DE RAFAEL, L. (1998) Clin Infect Dis, 27, 906–7. DUIM, B., WAGENAAR, J. A., DIJKSTRA, J. R., GORIS, J., ENDTZ, H. P. and VANDAMME, P. A. (2004) Appl Environ Microbiol, 70, 18–24. EBRIGHT, J. R. and RYAN, L. M. (1984) Am J Med, 76, 321–3. EDMONDS, P., PATTON, C. M., GRIFFIN, P. M., BARRETT, T. J., SCHMID, G. P., BAKER, C. N., LAMBERT, M. A. and BRENNER, D. J. (1987) J Clin Microbiol, 25, 685–91. BRONDZ, I.

512

Emerging foodborne pathogens

ENDTZ, H. P., RUIJS, G. J., ZWINDERMAN, A. H., VAN DER REIJDEN, T., BIEVER, M.

and MOUTON, R. (1991) J Clin Microbiol, 29, 1007–10. ENDTZ, H. P., VLIEGENTHART, J. S., VANDAMME, P., WEVERINK, H. W., VAN DEN BRAAK, N. P., VERBRUGH, H. A. and VAN BELKUM, A. (1997) Int J Food Microbiol, 34, 79–88. ENGBERG, J., ON, S. L., HARRINGTON, C. S. and GERNER-SMIDT, P. (2000) J Clin Microbiol, 38, 286–91. ENGLEN, M. D. and FEDORKA-CRAY, P. J. (2002) Lett Appl Microbiol, 35, 353–6. ENGVALL, E. O., BRANDSTROM, B., GUNNARSSON, A., MORNER, T., WAHLSTROM, H. and FERMER, C. (2002) J Appl Microbiol, 92, 47–54. ENGVALL, E. O., BRANDSTROM, B., ANDERSSON, L., BAVERUD, V., TROWALD-WIGH, G. and ENGLUND, L. (2003) Scand J Infect Dis, 35, 713–8. ESCHERICH, T. (1886) Müenchener Medicinische Wochenschrift, 33, 815–35. ETOH, Y., DEWHIRST, F. E., PASTER, B. J., YAMAMOTO, A. and GOTO, N. (1993) Int J Syst Bacteriol, 43, 631–9. EVANS, S. J. and SAYERS, A. R. (2000) Prev Vet Med, 46, 209–23. EYERS, M., CHAPELLE, S., VAN CAMP, G., GOOSSENS, H. and DE WACHTER, R. (1993) J Clin Microbiol, 31, 3340–3. FENNELL, C. L., ROMPALO, A. M., TOTTEN, P. A., BRUCH, K. L., FLORES, B. M. and STAMM, W. E. (1986) J Clin Microbiol, 24, 146–8. FERMER, C. and ENGVALL, E. O. (1999) J Clin Microbiol, 37, 3370–3. FIGURA, N., GUGLIELMETTI, P., ZANCHI, A., PARTINI, N., ARMELLINI, D., BAYELI, P. F., BUGNOLI, M. and VERDIANI, S. (1993) J Clin Microbiol, 31, 727–8. FINCH, M. J. and BLAKE, P. A. (1985) Am J Epidemiol, 122, 262–8. FINCH, M. J. and RILEY, L. W. (1984) Arch Intern Med, 144, 1610–2. FLORKOWSKI, C. M., IKRAM, R. B., CROZIER, I. M., IKRAM, H. and BERRY, M. E. (1984) Clin Cardiol, 7, 558–9. FOUTS, D. E., MONGODIN, E. F., MANDRELL, R. E., MILLER, W. G., RASKO, D. A., RAVEL, J., BRINKAC, L. M., DEBOY, R. T., PARKER, C. T., DAUGHERTY, S. C., DODSON, R. J., DURKIN, A. S., MADUPU, R., SULLIVAN, S. A., SHETTY, J. U., AYODEJI, M. A., SHVARTSBEYN, A., SCHATZ, M. C., BADGER, J. H., FRASER, C. M. and NELSON, K. E. (2005) PLOS Biology, 3, 72–85. FRANCIOLI, P., HERZSTEIN, J., GROB, J. P., VALLOTTON, J. J., MOMBELLI, G. and GLAUSER, M. P. (1985) Arch Intern Med, 145, 289–92. FRIEDMAN, C. R., NEIMANN, J., WEGENER, H. C. and TAUXE, R. V. (2000) In Campylobacter (eds, Nachamkin, I. and Blaser, M. J.) ASM Press, Washington, DC, pp. 121–138. FRY, B. N., KOROLIK, V., TEN BRINKE, J. A., PENNINGS, M. T., ZALM, R., TEUNIS, B. J., COLOE, P. J. and VAN DER ZEIJST, B. A. (1998) Microbiology, 144, 2049–61. FURTADO, C., ADAK, G. K., STUART, J. M., WALL, P. G., EVANS, H. S. and CASEMORE, D. P. (1998) Epidemiol Infect, 121, 109–19. GEBHART, C. J., WARD, G. E., CHANG, K. and KURTZ, H. J. (1983) Am J Vet Res, 44, 361–7. GEBHART, C. J., EDMONDS, P., WARD, G. E., KURTZ, H. J. and BRENNER, D. J. (1985) J Clin Microbiol, 21, 715–20. GEBHART, C. J., MCORIST, S., LAWSON, G. H., COLLINS, J. E. and WARD, G. E. (1994) Vet Pathol, 31, 462–7. GIACOBONI, G. I., ITOH, K., HIRAYAMA, K., TAKAHASHI, E. and MITSUOKA, T. (1993) J Vet Med Sci, 55, 555–9. GIESENDORF, B. A., QUINT, W. G., HENKENS, M. H., STEGEMAN, H., HUF, F. A. and NIESTERS, H. G. (1992) Appl Environ Microbiol, 58, 3804–8. GILBERT, M., BRISSON, J. R., KARWASKI, M. F., MICHNIEWICZ, J., CUNNINGHAM, A. M., WU, Y., YOUNG, N. M. and WAKARCHUK, W. W. (2000) J Biol Chem, 275, 3896–906. GILBERT, M., KARWASKI, M. F., BERNATCHEZ, S., YOUNG, N. M., TABOADA, E., MICHNIEWICZ, J., CUNNINGHAM, A. M. and WAKARCHUK, W. W. (2002) J Biol Chem, 277, 327–37. GILBERT, M., GODSCHALK, P. C. R., PARKER, C. T., ENDTZ, H. P. and WAKARCHUK, W. W. (2005) in Campylobacter jejuni: New Perspectives in Molecular and Cellular Biology, (eds, Ketley, J. and Konkel, M. E.) Horizon Scientific Press, Norfolk, UK pp. 29–48. P.

Campylobacter GLUNDER, G.

and

PETERMANN, S.

513

(1989) Zentralbl Veterinarmed B, 36, 123–30. and COLLINS, M. D. (1997) J Clin

GONZALEZ, I., GRANT, K. A., RICHARDSON, P. T., PARK, S. F.

Microbiol, 35, 759–63. GOODWIN, C. S., ARMSTRONG, J. A., CHILVERS, T., PETERS, M., COLLINS, M. D., SLY, L., MCCONNELL, M.

and

HARPER, W. E. S.

(1989) Int J Syst Bacteriol, 39, 397–40.

GOOSSENS, H., DE BOECK, M., COGNIAU, H., VLAES, L., VAN DEN BORRE, C.

and BUTZLER, J. P. (1986) J Clin Microbiol, 24, 840–43. GOOSSENS, H., POT, B., VLAES, L., VAN DEN BORRE, C., VAN DEN ABBEELE, R., VAN NAELTEN, C., LEVY, J., COGNIAU, H., MARBEHANT, P., VERHOEF, J. and et al. (1990a) J Clin Microbiol, 28, 1039–46. GOOSSENS, H., VLAES, L., DE BOECK, M., POT, B., KERSTERS, K., LEVY, J., DE MOL, P., BUTZLER, J. P. and VANDAMME, P. (1990b) Lancet, 335, 584–6. GOOSSENS, H., VLAES, L., BUTZLER, J. P., ADNET, A., HANICQ, P., N’JUFOM, S., MASSART, D., DE SCHRIJVER, G. and BLOMME, W. (1991) Lancet, 337, 1486–7. GOOSSENS, H., GIESENDORF, B. A., VANDAMME, P., VLAES, L., VAN DEN BORRE, C., KOEKEN, A., QUINT, W. G., BLOMME, W., HANICQ, P., KOSTER, D. S. and et al. (1995) J Infect Dis, 172, 1298–305. GORKIEWICZ, G., FEIERL, G., ZECHNER, R. and ZECHNER, E. L. (2002) J Clin Microbiol, 40, 2601–5. GORMAN, R., BLOOMFIELD, S. and ADLEY, C. C. (2002) Int J Food Microbiol, 76, 143–50. GOUDSWAARD, J., SABBE, L. and TE WINKEL, W. (1995) J Infect, 31, 171. GURGAN, T. and DIKER, K. S. (1994) J Clin Microbiol, 32, 3093–4. HALD, B. and MADSEN, M. (1997) J Clin Microbiol, 35, 3351–2. HALD, B., PEDERSEN, K., WAINO, M., JORGENSEN, J. C. and MADSEN, M. (2004) J Clin Microbiol, 42, 2003–12. HANNA, J. N., ENBOM, R. M. and MURPHY, D. M. (1994) Med J Aust, 160, 655–6. HANNINEN, M. L., SARELLI, L., SUKURA, A., ON, S. L., HARRINGTON, C. S., MATERO, P. and HIRVELAKOSKI, V. (2002) J Appl Microbiol, 92, 717–23. HARADA, K., OZAKI, S., KONO, N., TSUNEYAMA, K., KATAYANAGI, K., HIRAMATSU, K. and NAKANUMA, Y. (2001) J Pathol, 193, 218–23. HARVEY, R. B., YOUNG, C. R., ZIPRIN, R. L., HUME, M. E., GENOVESE, K. J., ANDERSON, R. C., DROLESKEY, R. E., STANKER, L. H. and NISBET, D. J. (1999) J Am Vet Med Assoc, 215, 1601– 4. HARVEY, S. and GREENWOOD, J. R. (1985) J Clin Microbiol, 21, 260–1. HENDRIXSON, D. R. and DIRITA, V. J. (2004) Mol Microbiol, 52, 471–84. HENG, A. E., DE CHAMPS, C., SOUWEINE, B., GUY, L., SIROT, J. and DETEIX, P. (2002) Nephrol Dial Transplant, 17, 689–90. HILL, B. D., THOMAS, R. J. and MACKENZIE, A. R. (1987) J Comp Pathol, 97, 687–94. HOWE, R. A., CLARKE, T., WILCOX, M. H., VANDAMME, P. and SPENCER, R. C. (1995) J Infect, 31, 229–32. HUDSON, J. A., NICOL, C., WRIGHT, J., WHYTE, R. and HASELL, S. K. (1999) J Appl Microbiol, 87, 115–24. HUMPHREY, T. J. (1986a) Lett Appl Microbiol, 3, 81–4. HUMPHREY, T. J. (1986b) J Appl Bacteriol, 61, 125–32. HUMPHREY, T. (2004) Br Poult Sci, 45 Suppl 1, S12. HUMPHREY, T. J. and CRUIKSHANK, J. G. (1985) J Appl Bacteriol, 59, 65–71. HUTCHINSON, D. N. and BOLTON, F. J. (1984) J Clin Pathol, 37, 956–57. IASR (1999), Vol. 20 National Institute of Infectious Disease, Japan, pp. 231. ICHIYAMA, S., HIRAI, S., MINAMI, T., NISHIYAMA, Y., SHIMIZU, S., SHIMOKATA, K. and OHTA, M. (1998) Clin Infect Dis, 27, 252–5. IHARA, H., MIURA, T., KATO, T., ISHIHARA, K., NAKAGAWA, T., YAMADA, S. and OKUDA, K. (2003) J Periodontal Res, 38, 64–72. INGLIS, G. D. and KALISCHUK, L. D. (2003) Appl Environ Microbiol, 69, 3435–47. INGLIS, G. D. and KALISCHUK, L. D. (2004) Appl Environ Microbiol, 70, 2296–306.

514

Emerging foodborne pathogens

INGLIS, G. D., KALISCHUK, L. D.

and BUSZ, H. W. (2003) Can J Microbiol, 49, 655–61. and BUSZ, H. W. (2004) J Appl Microbiol, 97, 410–20. ISSARTEL, B., PARISET, C., ROURE, C., BOIBIEUX, A. and PEYRAMOND, D. (2002) Eur J Clin Microbiol Infect Dis, 21, 234–5. JACOBS-REITSMA, W. (2000) in Campylobacter (eds, Nachamkin, I. and Blaser, M. J.) ASM Press, Washington, DC, pp. 467–482. JIMENEZ, S. G., HEINE, R. G., WARD, P. B. and ROBINS-BROWNE, R. M. (1999) Pediatr Infect Dis J, 18, 988–92. JOHNSON, C. C., REINHARDT, J. F., EDELSTEIN, M. A., MULLIGAN, M. E., GEORGE, W. L. and FINEGOLD, S. M. (1985) J Clin Microbiol, 22, 799–802. JOHNSON, W. M. and LIOR, H. (1986) J Clin Microbiol, 24, 275–81. JOHNSON, W. M. and LIOR, H. (1988) Microb Pathog, 4, 115–26. JONES, F. S. and LITTLE, R. B. (1931) J Exp Med, 53. JONES, K. (2001) Symp Ser Soc Appl Microbiol, 68S–79S. KAHLER, C. M., MARTIN, L. E., SHIH, G. C., RAHMAN, M. M., CARLSON, R. W. and STEPHENS, D. S. (1998) Infect Immun, 66, 5939–47. KAMMA, J. J., NAKOU, M. and BAEHNI, P. C. (1999) J Periodontal Res, 34, 25–33. KAMMA, J. J., DIAMANTI-KIPIOTI, A., NAKOU, M. and MITSIS, F. J. (2000) J Periodontal Res, 35, 33–41. KANEKO, T. (1992) Bull Tokyo Dent Coll, 33, 171–85. KAPPERUD, G. and AASEN, S. (1992) Apmis, 100, 883–90. KAPPERUD, G., SKJERVE, E., BEAN, N. H., OSTROFF, S. M. and LASSEN, J. (1992) J Clin Microbiol, 30, 3117–21. KARLYSHEV, A. V., LINTON, D., GREGSON, N. A., LASTOVICA, A. J. and WREN, B. W. (2000) Mol Microbiol, 35, 529–41. KARLYSHEV, A. V., KETLEY, J. M. and WREN, B. W. (2005) FEMS Microbiol Rev, 29, 377–90. KATO, R., OHTA, T., KAZUI, H., KONDO, M., NAIKI, K. and TSUCHIOKA, H. (1990) J Cardiovasc Surg (Torino), 31, 756–9. KELLY, A. F., MARTINEZ-RODRIGUEZ, A., BOVILL, R. A. and MACKEY, B. M. (2003) Appl Environ Microbiol, 69, 4975–78. KIEHLBAUCH, J. A., BRENNER, D. J., NICHOLSON, M. A., BAKER, C. N., PATTON, C. M., STEIGERWALT, A. G. and WACHSMUTH, I. K. (1991) J Clin Microbiol, 29, 376–85. KING, E. O. (1957) J Infect Dis, 101, 19–28. KLEIN, B. S., VERGERONT, J. M., BLASER, M. J., EDMONDS, P., BRENNER, D. J., JANSSEN, D. and DAVIS, J. P. (1986) Jama, 255, 361–4. KLENA, J. D., PARKER, C. T., KNIBB, K., IBBITT, J. C., DEVANE, P. M., HORN, S. T., MILLER, W. G. and KONKEL, M. E. (2004) J Clin Microbiol, 42, 5549–57. KOGA, M., YUKI, N., TAKAHASHI, M., SAITO, K. and HIRATA, K. (1999) J Neurol Sci, 163, 53–7. KOSUNEN, T. U., BANG, B. E. and HURME, M. (1984) J Clin Microbiol, 19, 129–33. KRAMER, J. M., FROST, J. A., BOLTON, F. J. and WAREING, D. R. (2000) J Food Prot, 63, 1654– 9. KRAUSE, R., RAMSCHAK-SCHWARZER, S., GORKIEWICZ, G., SCHNEDL, W. J., FEIERL, G., WENISCH, C. and REISINGER, E. C. (2002) Infection, 30, 171–4. LA SCOLA, B., CHAMBOURLIER, S. and BOUILLOT, P. (1998) J Infect, 37, 309–10. LABARCA, J. A., STURGEON, J., BORENSTEIN, L., SALEM, N., HARVEY, S. M., LEHNKERING, E., REPORTER, R. and MASCOLA, L. (2002) Clin Infect Dis, 34, E59–60. LAMOUREUX, M., MACKAY, A., MESSIER, S., FLISS, I., BLAIS, B. W., HOLLEY, R. A. and SIMARD, R. E. (1997) J Appl Microbiol, 83, 641–51. LARA-TEJERO, M. and GALAN, J. E. (2001) Infect Immun, 69, 4358–65. LASTOVICA, A. J. and LE ROUX, E. (2001) J Clin Microbiol, 39, 4222–3. LASTOVICA, A. J. and SKIRROW, M. B. (2000) in Campylobacter (eds, Nachamkin, I. and Blaser, M. J.) ASM Press, Washington, DC, pp. 89–120. LASTOVICA, A. J., LE ROUX, E. and PENNER, J. L. (1989) J Clin Microbiol, 27, 657–9. LASTOVICA, A. J., LE ROUX, E. and JOOSTE, M. (1991) Microb Ecol Health Dis, 4 (Suppl.), S87. INGLIS, G. D., KALISCHUK, L. D.

Campylobacter

515

LAUWERS, S., HOFMAN, B., SEGHERS, M., VAN ETTERIJCK, R., VAN ZEEBROECK, A., DE SMET, F.

and (1991) Microb. Ecol. Health. Dis, 4 (Suppl.), S90. LAWSON, A. J., LINTON, D. and STANLEY, J. (1998) Microbiology, 144 (Pt 8), 2063–71. LAWSON, A. J., LOGAN, J. M., O’NEILL G, L., DESAI, M. and STANLEY, J. (1999) J Clin Microbiol, 37, 3860–4. LAWSON, A. J., ON, S. L., LOGAN, J. M. and STANLEY, J. (2001) Int J Syst Evol Microbiol, 51, 651–60. LAWSON, G. H., ROWLAND, A. C. and WOODING, P. (1975) Res Vet Sci, 18, 121–6. LE ROUX, E. and LASTOVICA, A. J. (1998) in Campylobacter, Helicobacter, & Related Organisms (eds, Lastovica, A. J., Newell, D. G. and Lastovica, E. E.) Institute of Child Health, Cape Town, South Africa, pp. 30–33. LEE, M. B. and MIDDLETON, D. (2003) J Food Prot, 66, 953–61. LEVY, A. J. (1946) Yale J Biol Med, 18, 243–58. LIN, C. W., YIN, P. L. and CHENG, K. S. (1998) Zhonghua Yi Xue Za Zhi (Taipei), 61, 339–45. LINDBLOM, G. B., JOHNY, M., KHALIL, K., MAZHAR, K., RUIZ-PALACIOS, G. M. and KAIJSER, B. (1990) FEMS Microbiol Lett, 54, 163–7. LINDBLOM, G. B., SJOGREN, E., HANSSON-WESTERBERG, J. and KAIJSER, B. (1995) Scand J Infect Dis, 27, 187–8. LINTON, D., OWEN, R. J. and STANLEY, J. (1996) Res Microbiol, 147, 707–18. LINTON, D., LAWSON, A. J., OWEN, R. J. and STANLEY, J. (1997) J Clin Microbiol, 35, 2568–72. LINTON, D., GILBERT, M., HITCHEN, P. G., DELL, A., MORRIS, H. R., WAKARCHUK, W. W., GREGSON, N. A. and WREN, B. W. (2000) Mol Microbiol, 37, 501–14. LOGAN, J. M., BURNENS, A., LINTON, D., LAWSON, A. J. and STANLEY, J. (2000) Int J Syst Evol Microbiol, 50 Pt 2, 865–72. LOGAN, S. M., KELLY, J. F., THIBAULT, P., EWING, C. P. and GUERRY, P. (2002) Mol Microbiol, 46, 587–97. LOGUE, C. M., SHERWOOD, J. S., ELIJAH, L. M., OLAH, P. A. and DOCKTER, M. R. (2003) J Appl Microbiol, 95, 234–41. LOMAX, L. G. and GLOCK, R. D. (1982) Am J Vet Res, 43, 1608–14. LOPEZ, L., CASTILLO, F. J., CLAVEL, A. and RUBIO, M. C. (1998) Eur J Clin Microbiol Infect Dis, 17, 489–92. LOUIS, V. R., GILLESPIE, I. A., O’BRIEN, S. J., RUSSEK-COHEN, E., PEARSON, A. D. and COLWELL, R. R. (2005) Appl Environ Microbiol, 71, 85–92. LOVE, R. J., LOVE, D. N. and EDWARDS, M. J. (1977) Vet Rec, 100, 65–8. LOZANO, P., RIMBAU, E. M., MARTINEZ, S., RIBAS, M. A. and GOMEZ, F. T. (1999) Eur J Vasc Endovasc Surg, 18, 86–8. MACKICHAN, J. K., GAYNOR, E. C., CHANG, C., CAWTHRAW, S., NEWELL, D. G., MILLER, J. F. and FALKOW, S. (2004) Mol Microbiol, 54, 1269–86. MACUCH, P. J. and TANNER, A. C. (2000) J Dent Res, 79, 785–92. MAHER, M., FINNEGAN, C., COLLINS, E., WARD, B., CARROLL, C. and CORMICAN, M. (2003) J Clin Microbiol, 41, 2980–6. MANDELL, R. L., DIRIENZO, J., KENT, R., JOSHIPURA, K. and HABER, J. (1992) J Periodontol, 63, 274–9. MANDRELL, R. E. and BRANDL, M. T. (2004) Campylobacter species and fresh produce: outbreaks incidence and biology, in Pre–Harvest and Post-Harvest Food Safety: Contemporary Issues and Future Directions, (eds, Beier, R., Pillai, P. Phillips, T. and Ziprin, R.) IFT Press and Blackwell Publishing, Ames, IA, pp. 59–72. MANDRELL, R. E. and WACHTEL, M. R. (1999) Curr Opin Biotechnol, 10, 273–8. MANDRELL, R. E., AZMI, F. H. and GRANOFF, D. M. (1995) J Infect Dis, 172, 1279–89. MANDRELL, R. E., BATES, A. H. and BRANDON, D. L. (2002) in US Patent Office, Patent no. 6, 395, 819. MANDRELL, R. E., HARDEN, L. A., BATES, A. H., MILLER, W. G., HADDON, W. F. and FAGERQUIST, C. K. (2005) Appl Environ Microbiol, 71, 6292–307. MANSER, P. A. and DALZIEL, R. W. (1985) J Hyg (Lond), 95, 15–21. PIERARD, D.

516

Emerging foodborne pathogens

MARSHALL, S. M., MELITO, P. L., WOODWARD, D. L., JOHNSON, W. M., RODGERS, F. G.

and MULVEY, (1999) J Clin Microbiol, 37, 4158–60. MARTINOT, M., JAULHAC, B., MOOG, R., DE MARTINO, S., KEHRLI, P., MONTEIL, H. and PIEMONT, Y. (2001) Clin Microbiol Infect, 7, 96–7. MARUYAMA, S., TANAKA, T., KATSUBE, Y., NAKANISHI, H. and NUKINA, M. (1990) Nippon Juigaku Zasshi, 52, 1237–44. MASON, M. J., HUMPHREY, T. J. and MARTIN, K. W. (1999) Br J Biomed Sci, 56, 2–5. MATSHEKA, M. I., LASTOVICA, A. J. and ELISHA, B. G. (2001) J Clin Microbiol, 39, 3684–9. MATSHEKA, M. I., ELISHA, B. G., LASTOVICA, A. L. and ON, S. L. (2002) FEMS Microbiol Lett, 211, 17–22. MCCLURG, K. R., MCCLURG, R. B., MOORE, J. E. and DOOLEY, J. S. (2002) J Clin Pathol, 55, 239– 40. MCFADYEAN, J. and STOCKMAN, S. (1913) Report of the Departmental Committee appointed by the Board of Agriculture and Fisheries to inquire into epizootic abortion. Part III Abortion in sheep. pp. 1–29. MEDEMA, G. J., SCHETS, F. M., VAN DE GIESSEN, A. W. and HAVELAAR, A. H. (1992) J Appl Bacteriol, 72, 512–6. MEGRAUD, F. and ELHARRIF, Z. (1985) Eur J Clin Microbiol, 4, 437–8. MII, S., TANAKA, K., FURUGAKI, K., SAKATA, H., KATOH, H. and MORI, A. (1998) Surg Today, 28, 661–4. MILLER, W. G. and MANDRELL, R. E. (2005) in Campylobacter jejuni: New Perspectives in Molecular and Cellular Biology, (eds, Ketley, J. and Konkel, M. E.) Horizon Scientific Press, Norfolk, UK, pp. 101–163. MILLER, W. G., ON, S. L. W., WANG, G., FONTANOZ, S., LASTOVICA, A. J. and MANDRELL, R. E. (2005) J Clin Microbiology, 43, 2315–29 MILLER, W. G., ENGLEN, M. D., KATHARIOU, S., WESLEY, I. V., WANG, G., PITTENGER-ALLEY, L., SILETZ, R. M., MURAOKA, W., FEDORKA-CRAY, P. J. and MANDRELL, R. E. (2006) Microbiology, 152, 245–55. MINET, J., GROSBOIS, B. and MEGRAUD, F. (1988) J Clin Microbiol, 26, 2659–60. MISAWA, N., SHINOHARA, S., SATOH, H., ITOH, H., SHINOHARA, K., SHIMOMURA, K., KONDO, F. and ITOH, K. (2000) Vet Microbiol, 71, 59–68. MODOLO, J. R. (2000) Rev Soc Bras Med Trop, 33, 223–4. MODOLO, J. R. and GIUFFRIDA, R. (2004) Rev Soc Bras Med Trop, 37, 72–3. MOONEY, A., CLYNE, M., CURRAN, T., DOHERTY, D., KILMARTIN, B. and BOURKE, B. (2001) Microbiology, 147, 735–43. MOORE, J. E. and MADDEN, R. H. (1998) J Food Prot, 61, 409–13. MOORE, J. E., GILPIN, D., CROTHERS, E., CANNEY, A., KANEKO, A. and MATSUDA, M. (2002a) Vector Borne Zoonotic Dis, 2, 111–4. MOORE, J. E., WILSON, T. S., WAREING, D. R., HUMPHREY, T. J. and MURPHY, P. G. (2002b) J Food Prot, 65, 1326–8. MORAN, A. P. (1997) J Infect Dis, 176 Suppl 2, S115–21. MORAN, A. P., O’MALLEY, D. T., KOSUNEN, T. U. and HELANDER, I. M. (1994) Infect Immun, 62, 3922–9. MORENO, G. S., GRIFFITHS, P. L., CONNERTON, I. F. and PARK, R. W. (1993) J Appl Bacteriol, 75, 49–54. MOROOKA, T., UMEDA, A., FUJITA, M., MATANO, H., FUJIMOTO, S., YUKITAKE, K., AMAKO, K. and ODA, T. (1996) Scand J Infect Dis, 28, 269–70. MORRIS, C. N., SCULLY, B. and GARVEY, G. J. (1998) Clin Infect Dis, 27, 220–1. MORRISON, V. A., LLOYD, B. K., CHIA, J. K. and TUAZON, C. U. (1990) Rev Infect Dis, 12, 387– 92. MOSER, I., RIEKSNEUWOHNER, B., LENTZSCH, P., SCHWERK, P. and WIELER, L. H. (2001) J Clin Microbiol, 39, 2548–57. MUSMANNO, R. A., RUSSI, M., FIGURA, N., GUGLIELMETTI, P., ZANCHI, A., SIGNORI, R. and ROSSOLINI, A. (1998) New Microbiol, 21, 15–22. M. R .

Campylobacter NACHAMKIN, I.

517

(2002) Microbes Infect, 4, 399–403. (2003) in Manual of Clinical Microbiology, Vol. 1 (ed. Murray, P. R.) ASM Press, Washington, D. C., pp. 902. NACHAMKIN, I. and BLASER, M. J. (eds) (2000) Campylobacter, ASM Press, Washington, DC. NACHAMKIN, I., BLASER, M. J. and TOMPKINS, L. S. (1992) Campylobacter jejuni: Current status and future trends, American Society for Microbiology, Washington, DC. NACHAMKIN, I., ALLOS, B. M. and HO, T. (1998) Clin Microbiol Rev, 11, 555–67. NEUZIL, K. M., WANG, E., HAAS, D. W. and BLASER, M. J. (1994) J Clin Microbiol, 32, 1718–20. NEWELL, D. G., FROST, J. A., DUIM, B., WAGENAAR, J. A., MADDEN, R. H., VAN DER PLAS, J. and ON, S. L. W. (2000) in Campylobacter (eds, Nachamkin, I. and Blaser, M. J.) ASM Press, Washington, DC, pp. 27–44. NG, L.-K., TAYLOR, D. E. and STILES, M. E. (1988) J. Clin. Microbiol., 26, 518–23. NOGUCHI, M., NARUI, K., NAKATANI, T., CHONABAYASHI, N., NAKAMORI, Y., NAKATA, K., SUGI, H. and TANIMOTO, H. (1989) Kansenshogaku Zasshi, 63, 1338–43. NOTARIO, R., BORDA, N., GAMBANDE, T. and SUTICH, E. (1996) Rev Inst Med Trop Sao Paulo, 38, 5–7. NYLEN, G., DUNSTAN, F., PALMER, S. R., ANDERSSON, Y., BAGER, F., COWDEN, J., FEIERL, G., GALLOWAY, Y., KAPPERUD, G., MEGRAUD, F., MOLBAK, K., PETERSEN, L. R. and RUUTU, P. (2002) Epidemiol Infect, 128, 383–90. OBIRI-DANSO, K. and JONES, K. (1998) in Campylobacter, Helicobacter & Related Organisms (eds, Lastovica, A. J., Newell, D. G. and Lastovica, E. E.) Institute of Child Health, Red Cross Children’s Hospital, Cape Town, South Africa, pp. 205. OBIRI-DANSO, K. and JONES, K. (1999) J Appl Microbiol, 87, 822–32. OBIRI-DANSO, K., PAUL, N. and JONES, K. (2001) J Appl Microbiol, 90, 256–67. OLSON, P. and SANDSTEDT, K. (1987) Veterinary Record, 121, 99–101. ON, S. L. (1994) J Clin Microbiol, 32, 2305–6. ON, S. L. W. (2005) in Campylobacter jejuni: New Perspectives in Molecular and Cellular Biology, (eds, Ketley, J. and Konkel, M. E.) Horizon Scientific Press, Norfolk, UK, pp. 101–63. ON, S. L. and HARRINGTON, C. S. (2000) FEMS Microbiol Lett, 193, 161–9. ON, S. L., RIDGWELL, F., CRYAN, B. and AZADIAN, B. S. (1992) J Infect, 24, 175–9. ON, S. L., BLOCH, B., HOLMES, B., HOSTE, B. and VANDAMME, P. (1995) Int J Syst Bacteriol, 45, 767–74. ON, S. L., ATABAY, H. I. and CORRY, J. E. (1999) Epidemiol Infect, 122, 175–82. ON, S. L., JENSEN, T. K., BILLE-HANSEN, V., JORSAL, S. E. and VANDAMME, P. (2002) Vet Microbiol, 85, 159–67. ORSKOV, I., ORSKOV, F., JANN, B. and JANN, K. (1977) Bacteriol Rev, 41, 667–710. OTASEVIC, M., LAZAREVIC-JOVANOVIC, B., TASIC-DIMOV, D., DORDEVIC, N. and MILJKOVIC-SELIMOVIC, B. (2004) Vojnosanit Pregl, 61, 21–7. OYOFO, B. A., THORNTON, S. A., BURR, D. H., TRUST, T. J., PAVLOVSKIS, O. R. and GUERRY, P. (1992) J Clin Microbiol, 30, 2613–9. PARK, C. E. and SANDERS, G. W. (1992) Can J Microbiol, 38, 313–6. PARKHILL, J., WREN, B. W., MUNGALL, K., KETLEY, J. M., CHURCHER, C., BASHAM, D., CHILLINGWORTH, T., DAVIES, R. M., FELTWELL, T., HOLROYD, S., JAGELS, K., KARLYSHEV, A. V., MOULE, S., PALLEN, M. J., PENN, C. W., QUAIL, M. A., RAJANDREAM, M. A., RUTHERFORD, K. M., VAN VLIET, A. H., WHITEHEAD, S. and BARRELL, B. G. (2000) Nature, 403, 665–8. PEBODY, R. G., RYAN, M. J. and WALL, P. G. (1997) Commun Dis Rep CDR Rev, 7, R33–7. PEETERMANS, W. E., DE MAN, F., MOERMAN, P. and VAN DE WERF, F. (2000) J Infect, 41, 180–2. PENNER, J. L. (1988) Clin Microbiol Rev, 1, 157–72. PEREZ-PEREZ, G. I., BLASER, M. J. and BRYNER, J. H. (1986) Infect Immun, 51, 209–12. PIAZZA, D. and LASTA, J. A. (1986) Vet Res Commun, 10, 303–8. PICKETT, C. L., PESCI, E. C., COTTLE, D. L., RUSSELL, G., ERDEM, A. N. and ZEYTIN, H. (1996) Infect Immun, 64, 2070–8. PRASAD, K. N., DIXIT, A. K. and AYYAGARI, A. (2001) Indian J Med Res, 114, 12–7. NACHAMKIN, I.

518

Emerging foodborne pathogens

PRESTON, M. A.

and

(1987) Infect Immun, 55, 1806–12. and SLOTS, J. (1993) Oral Microbiol Immunol, 8, 230–5. RANSOM, G. M., KAPLAN, B., MCNAMARA, A. M. and WACHSMUTH, I. K. (2000) in Campylobacter (eds, Nachamkin, I. and Blaser, M. J.) ASM Press, Washington, DC, pp. 511–528. RAY, B. and JOHNSON, C. (1984a) Food Microbiol., 1, 173–6. RAY, B. and JOHNSON, C. (1984b) J. Food Safety, 6, 183–195. RENNIE, R. P., STRONG, D., TAYLOR, D. E., SALAMA, S. M., DAVIDSON, C. and TABOR, H. (1994) J Clin Microbiol, 32, 721–4. RETTIG, P. J. (1979) J Pediatr, 94, 855–64. RIDSDALE, J. A., ATABAY, H. I. and CORRY, J. E. L. (1998) J Appl Bacteriol, 85, 567–73. ROBERTS, I. S. (1996) Annu Rev Microbiol, 50, 285–315. ROBINSON, D. A., EDGAR, W. J., GIBSON, G. L., MATCHETT, A. A. and ROBERTSON, L. (1979) Br Med J, 1, 1171–3. RODRIGUES, L. C., COWDEN, J. M., WHEELER, J. G., SETHI, D., WALL, P. G., CUMBERLAND, P., TOMPKINS, D. S., HUDSON, M. J., ROBERTS, J. A. and RODERICK, P. J. (2001) Epidemiol Infect, 127, 185–93. RONVEAUX, O., QUOILIN, S., VAN LOOCK, F., LHEUREUX, P., STRUELENS, M. and BUTZLER, J. P. (2000) Acta Clin Belg, 55, 307–11. ROSEF, O., RETTEDAL, G. and LAGEIDE, L. (2001) Int J Environ Health Res, 11, 321–7. RUSSELL, R. G., KIEHLBAUCH, J. A., GEBHART, C. J. and DETOLLA, L. J. (1992) J Clin Microbiol, 30, 3024–7. RUTHERFORD, E. J., EAKINS, J. W., MAXWELL, J. G. and TACKETT, A. D. (1989) J Vasc Surg, 10, 193–7. SAILS, A. D., BOLTON, F. J., FOX, A. J., WAREING, D. R. and GREENWAY, D. L. A. (1998) Mol. Cell. Probes, 12, 317–22. SAKRAN, W., RAZ, R., LEVI, Y., COLODNER, R. and KOREN, A. (1999) Eur J Clin Microbiol Infect Dis, 18, 496–8. SALAMA, S. M., TABOR, H., RICHTER, M. and TAYLOR, D. E. (1992) J Clin Microbiol, 30, 1982– 4. SANDSTEDT, K., URSING, J. and WALDER, M. (1983) Curr Microbiol, 8, 209–13. SASAKI, Y., FUJISAWA, T., OGIKUBO, K., OHZONO, T., ISHIHARA, K. and TAKAHASHI, T. (2003) J Vet Med Sci, 65, 129–31. SAUERWEIN, R. W., BISSELING, J. and HORREVORTS, A. M. (1993) Infection, 21, 331–3. SCATES, P., MORAN, L. and MADDEN, R. H. (2003) Appl Environ Microbiol, 69, 4658–61. SCHONHEYDER, H. C., SOGAARD, P. and FREDERIKSEN, W. (1995) Scand J Infect Dis, 27, 145– 8. SEBALD, M. and VÉRON, M. (1963) Annales de L’institut Pasteur (Paris), 105, 897–910. SENCHENKOVA, S. N., SHASHKOV, A. S., KNIREL, Y. A., MCGOVERN, J. J. and MORAN, A. P. (1996) Eur J Biochem, 239, 434–8. SENCHENKOVA, S. N., SHASHKOV, A. S., KNIREL, Y. A., MCGOVERN, J. J. and MORAN, A. P. (1997) Eur J Biochem, 245, 637–41. SERINO, L. and VIRJI, M. (2002) Mol Microbiol, 43, 437–48. SHEN, Z., FENG, Y., DEWHIRST, F. E. and FOX, J. G. (2001) J Clin Microbiol, 39, 2166–72. SIQUEIRA, J. F., JR. and ROCAS, I. N. (2003) Int Endod J, 36, 174–80. SJOGREN, E ., FALSEN, E., KAIJSER, B. and LINDBLOM, G . B . (1996) in Campylobacters, Helicobacters, and Related Organisms (eds, Newell, D. G., Ketley, J. M. and Feldman, R. A.) Plenum Press, New York, pp. 471–473. SKIRROW, M. B. (1977) Br Med J, 2, 9–11. SKIRROW, M. B. and BLASER, M. J. (2000) in Campylobacter (eds, Nachamkin, I. and Blaser, M. J.) ASM Press, Washington, DC, pp. 69–88. SKIRROW, M. B., JONES, D. M., SUTCLIFFE, E. and BENJAMIN, J. (1993) Epidemiol Infect, 110, 567–73. SLATER, E. R. and OWEN, R. J. (1997) Lett. Appl. Microbiol., 25, 274–8. SMIBERT, R. M. (1984) in Bergey’s Manual of Systematic Bacteriology., Vol. 1 (eds, Krieg, N. R. and Holt, H. G.) The Williams & Wilkins Co., Baltimore, MD, pp. 111–118. RAMS, T. E., FEIK, D.

PENNER, J. L.

Campylobacter SOCRANSKY, S. S., HAFFAJEE, A. D., CUGINI, M. A., SMITH, C.

519

and KENT, R. L., JR. (1998) J Clin Periodontol, 25, 134–44. SODERSTROM, C., SCHALEN, C. and WALDER, M. (1991) Scand J Infect Dis, 23, 369–71. SOPWITH, W., ASHTON, M., FROST, J. A., TOCQUE, K., O’BRIEN, S., REGAN, M. and SYED, Q. (2003) J Infect, 46, 35–45. SPELMAN, D. W., DAVIDSON, N., BUCKMASTER, N. D., SPICER, W. J. and RYAN, P. (1986) Med J Aust, 145, 503–5. ST GEME, J. W., 3RD and FALKOW, S. (1991) Infect Immun, 59, 1325–33. ST MICHAEL, F., SZYMANSKI, C. M., LI, J., CHAN, K. H., KHIEU, N. H., LAROCQUE, S., WAKARCHUK, W. W., BRISSON, J. R. and MONTEIRO, M. A. (2002) Eur J Biochem, 269, 5119–36. STANLEY, J., BURNENS, A. P., LINTON, D., ON, S. L., COSTAS, M. and OWEN, R. J. (1992) J Gen Microbiol, 138 (Pt 11), 2293–303. STEELE, T. W. and MCDERMOTT, S. N. (1984) Pathology, 16, 263–5. STEELE, T. W. and OWEN, R. J. (1988) Int J Syst Bacteriol, 38, 316–18. STEINHAUSEROVA, I., CESKOVA, J., FOJTIKOVA, K. and OBROVSKA, L. (2001) Appl Microbiol, 90, 470–5. STERN, N. J. (1992) in Campylobacter jejuni – Current status and future trends (eds, Nachamkin, I., Blaser, M. J. and Tompkins, L. S.) ASM Press, Washington, D.C., pp. 49–60. STERN, N. J. and LINE, J. E. (2000) in The Microbiological Safety and Quality of Food, Vol. 2 (eds, Lund, B. M., Baird–Parker, A. C. and Gould, G. W.) Aspen Publishers, Gaithersburg, Maryland, pp. 1040–56. STERN, N. J., BAILEY, J. S., BLANKENSHIP, L. C., COX, N. A. and MCHAN, F. (1988) Avian Dis, 32, 330–4. STERN, N. J., WOJTON, B. and KWIATEK, A. (1992) J. Food Protect., 55, 514–17. STERN, N. J., FEDORKA-CRAY, P., BAILEY, J. S., COX, N. A., CRAVEN, S. E., HIETT, K. L., MUSGROVE, M. T., LADLEY, S., COSBY, D. and MEAD, G. C. (2001) J. Food Protect., 64, 1705–10. STUDAHL, A. and ANDERSSON, Y. (2000) Epidemiol Infect, 125, 269–75. SZYMANSKI, C. M. and WREN, B. W. (2005) Nature Rev Microbiol, 3, 225–37. SZYMANSKI, C. M., YAO, R., EWING, C. P., TRUST, T. J. and GUERRY, P. (1999) Mol Microbiol, 32, 1022–30. SZYMANSKI, C. M., BURR, D. H. and GUERRY, P. (2002) Infect Immun, 70, 2242–4. TAKAHASHI, M., KOGA, M., YOKOYAMA, K. and YUKI, N. (2005) J Clin Microbiol, 43, 335–9. TALIBART, R., DENIS, M., CASTILLO, A., CAPPELIER, J. M. and ERMEL, G. (2000) Int J Food Microbiol., 55, 263–7. TANNER, A. C., BADGER, S. and LAI, C. H. (1981) Inter J Sys Bacteriol, 31, 432–45. TANNER, A., MAIDEN, M. F., MACUCH, P. J., MURRAY, L. L. and KENT, R. L., JR. (1998) J Clin Periodontol, 25, 85–98. TAUXE, R. V., HARGRETT-BEAN, N., PATTON, C. M. and WACHSMUTH, I. K. (1988) MMWR CDC Surveill Summ, 37, 1–13. TEE, W., LUPPINO, M. and RAMBALDO, S. (1998) Clin Infect Dis, 27, 1544–5. TEH, H. S., CHIANG, S. H., TAN, A. G., SNG, L. H. and OH, H. M. (2004) Ann Acad Med Singapore, 33, 385–8. TERZOLO, H. R. (1988) Rev Argent Microbiol, 20, 53–68. THUNBERG, R. L., TRAN, T. T. and WALDERHAUG, M. O. (2000) J Food Prot, 63, 299–303. TIGR (THE INSTITUTE FOR GENOMIC RASEARCH) (2006) Campylobacter Genome Projects, http://www.tigr.org/msc/campy/index.shtml TOTTEN, P. A., PATTON, C. M., TENOVER, F. C., BARRETT, T. J., STAMM, W. E., STEIGERWALT, A. G., LIN, J. Y., HOLMES, K. K. and BRENNER, D. J. (1987) J Clin Microbiol, 25, 1747–52. TRESIERRA-AYALA, A., BENDAYAN, M. E., BERNUY, A., PEREYRA, G. and FERNANDEZ, H. (1994) Rev Inst Med Trop Sao Paulo, 36, 497–9. TU, Z. C., WASSENAAR, T. M., THOMPSON, S. A. and BLASER, M. J. (2003) Mol Microbiol, 48, 685–98. TU, Z. C., HUI, J. and BLASER, M. J. (2004) Infect Immun, 72, 1715–24.

520

Emerging foodborne pathogens

UYTTENDAELE, M.

and

DEBEVERE, J.

(1996) Food Microbiology (London), 13, 115–22. and DEBEVERE, J. (1995) Appl Environ

UYTTENDAELE, M., SCHUKKINK, R., VAN GEMEN, B.

Microbiol, 61, 1341–7. and VAN DER LUGT, J. J. (1988) Onderstepoort J Vet Res, 55, 85–7. VAN DER WALT, M. L., SPENCER, B. T. and LOVEDAY, R. K. (1988) Onderstepoort J Vet Res, 55, 165–8. VAN DOORN, L. J., VERSCHUUREN-VAN HAPEREN, A., VAN BELKUM, A., ENDTZ, H. P., VLIEGENTHART, J. S., VANDAMME, P. and QUINT, W. G. (1998) J Appl Microbiol, 84, 545–50. VANDAMME, P. (2000) in Campylobacter (eds, Nachamkin, I. and Blaser, M. J.) ASM Press, Washington, DC, pp. 3–26. VANDAMME, P. and GOOSSENS, H. (1992) Zentralbl Bakteriol, 276, 447–72. VANDAMME, P., FALSEN, E., POT, B., HOSTE, B., KERSTERS, K. and DE LEY, J. (1989) J Clin Microbiol, 27, 1775–81. VANDAMME, P., FALSEN, E., ROSSAU, R., HOSTE, B., SEGERS, P., TYTGAT, R. and DE LEY, J. (1991a) Int J Syst Bacteriol, 41, 88–103. VANDAMME, P., POT, B. and KERSTERS, K. (1991b) System Appl Microbiol, 14, 57–66. VANDAMME, P., PUGINA, P., BENZI, G., VAN ETTERIJCK, R., VLAES, L., KERSTERS, K., BUTZLER, J. P., LIOR, H. and LAUWERS, S. (1992a) J Clin Microbiol, 30, 2335–7. VANDAMME, P., VANCANNEYT, M., POT, B., MELS, L., HOSTE, B., DEWETTINCK, D., VLAES, L., VAN DEN BORRE, C., HIGGINS, R., HOMMEZ, J. and et al. (1992b) Int J Syst Bacteriol, 42, 344– 56. VANDENBERG, O., DEDISTE, A., HOUF, K., IBEKWEM, S., SOUAYAH, H., CADRANEL, S., DOUAT, N., ZISSIS, G., BUTZLER, J. P. and VANDAMME, P. (2004) Emerg Infect Dis, 10, 1863–7. VARGA, J. (1990) Dtsch Tierarztl Wochenschr, 97, 317–21. VÉRON, M. and CHATELAIN, R. (1973) Inter J Sys Bacteriol, 23, 122–34. VIEJO, G., GOMEZ, B., DE MIGUEL, D., DEL VALLE, A., OTERO, L. and DE LA IGLESIA, P. (2001) Scand J Infect Dis, 33, 126–7. VOGT, R. L., SOURS, H. E., BARRETT, T., FELDMAN, R. A., DICKINSON, R. J. and WITHERELL, L. (1982) Ann Intern Med, 96, 292–6. VOLOKHOV, D., CHIZHIKOV, V., CHUMAKOV, K. and RASOOLY, A. (2003) J Clin Microbiol, 41, 4071–80. WAEGEL, A. and NACHAMKIN, I. (1996) Mol Cell Probes, 10, 75–80. WAINO, M., BANG, D. D., LUND, M., NORDENTOFT, S., ANDERSEN, J. S., PEDERSEN, K. and MADSEN, M. (2003) J Appl Microbiol, 95, 649–55. WALDENSTROM, J., BROMAN, T., CARLSSON, I., HASSELQUIST, D., ACHTERBERG, R. P., WAGENAAR, J. A. and OLSEN, B. (2002) Appl Environ Microbiol, 68, 5911–7. WALLACE, D. J., VAN GILDER, T., SHALLOW, S., FIORENTINO, T., SEGLER, S. D., SMITH, K. E., SHIFERAW, B., ETZEL, R., GARTHRIGHT, W. E. and ANGULO, F. J. (2000) J Food Prot, 63, 807– 9. WALMSLEY, S. L. and KARMALI, M. A. (1989) J Clin Microbiol, 27, 668–70. WANG, B., KRAIG, E. and KOLODRUBETZ, D. (1998) Infect Immun, 66, 1521–6. WANG, B., KRAIG, E. and KOLODRUBETZ, D. (2000) Infect Immun, 68, 1465–73. WANG, G., CLARK, C. G., TAYLOR, T. M., PUCKNELL, C., BARTON, C., PRICE, L., WOODWARD, D. L. and RODGERS, F. G. (2002) J Clin Microbiol, 40, 4744–7. WASSENAAR, T. M. (1997) Clin Microbiol Rev, 10, 466–76. WASSENAAR, T. M., GEILHAUSEN, B. and NEWELL, D. G. (1998) Appl Environ Microbiol, 64, 1816–21. WASSENAAR, T. M. and NEWELL, D. G. (2000) Appl Environ Microbiol, 66, 1–9. WATINE, J., MARTORELL, J., BRUNA, T., GINESTON, J. L., POIRIER, J. L. and LAMBLIN, G. (1995) Yonsei Med J, 36, 202–5. WEDDERKOPP, A., RATTENBORG, E. and MADSEN, M. (2000) Avian Dis, 44, 993–9. WEGMULLER, B., LUTHY, J. and CANDRIAN, U. (1993) Appl Environ Microbiol, 59, 2161–5. WEISER, J. N., LINDBERG, A. A., MANNING, E. J., HANSEN, E. J. and MOXON, E. R. (1989) Infect Immun, 57, 3045–52. VAN DER WALT, M. L.

Campylobacter WERNO, A. M., KLENA, J. D., SHAW, G. M.

521

and MURDOCH, D. R. (2002) J Clin Microbiol, 40, 1053–5. WESLEY, I. V. and BRYNER, J. H. (1989) Am J Vet Res, 50, 807–13. WESTLING, K. and EVENGARD, B. (2001) Scand J Infect Dis, 33, 877–8. WHITE, P. L., BAKER, A. R. and JAMES, W. O. (1997) Rev Sci Tech, 16, 525–41. WHO (2004) Surveillance Programme for Control of Foodborne Infections and Intoxications in Europe, 8th Report, Accessed 2005 http://www.bfr.bund.de/internet/8threport/ 8threp_fr.htm. WILLISON, H. J. and O’HANLON, G. M. (1999) J Neuroimmunol, 100, 3–12. WILSON, I. G. and MOORE, J. E. (1996) Epidemiol Infect, 116, 147–53. WILSON, T. M., CHANG, K., GEBHART, C. J., KURTZ, H. J., DRAKE, T. R. and LINTNER, V. (1986) Can J Vet Res, 50, 217–20. WINKLER, M. A., UHER, J. and CEPA, S. (1999) Anal Chem, 71, 3416–9. YANG, L. Y., PEI, Z. H., FUJIMOTO, S. and BLASER, M. J. (1992) J Bacteriol, 174, 1258–67. YAO, J. D., NG, H. M. and CAMPBELL, I. (1993) J Clin Microbiol, 31, 3323–4. YOUNG, N. M., BRISSON, J. R., KELLY, J., WATSON, D. C., TESSIER, L., LANTHIER, P. H., JARRELL, H. C., CADOTTE, N., ST MICHAEL, F., ABERG, E. and SZYMANSKI, C. M. (2002) J Biol Chem, 277, 42530–9. YUKI, N. (1999) Jpn J Infect Dis, 52, 99–105. YUKI, N., HO, T. W., TAGAWA, Y., KOGA, M., LI, C. Y., HIRATA, K. and GRIFFIN, J. W. (1999) J Neurol Sci, 164, 134–8. ZHANG, J. R., IDANPAAN–HEIKKILA, I., FISCHER, W. and TUOMANEN, E. I. (1999) Mol Microbiol, 31, 1477–88.

522

Emerging foodborne pathogens

19 Mycobacterium paratuberculosis M. W. Griffiths, University of Guelph Canada

19.1

Introduction

‘Johne’s bacillus’, which is now known as Mycobacterium avium subsp. paratuberculosis, was first isolated by Johne and Frothingham in 1895 during an investigation of the cause of chronic diarrhoea in cattle. The organism was originally thought to be a strain of Mycobacterium avium but it has also been classified as M. johnei and M. enteritidis. Based on its cell wall composition it has been confirmed to be a member of the M. avium complex and as such Mycobacterium avium subsp. paratuberculosis (MAP) is a member of the family Mycobacteriaceae (Wayne and Kubica 1986). Mycobacteriaceae are Gram-positive, strictly aerobic, non-motile, acid-fast rod-shaped bacteria with fastidious growth requirements, and are characterised by their slow growth rate and resistance to acid and alcohol. This resistance is due to a strong cell wall containing a high lipid concentration. MAP requires the presence of mycobactins, which are iron-binding hydroxamate compounds, for growth. The organism will grow in the temperature range 25 to 45 ∞C with an optimum of 39 ∞C. It will grow at salt concentrations below 5% and at a pH of 5.5 or greater (Collins et al. 2001).

19.2

Johne’s disease

MAP is the causative agent of Johne’s disease, an incurable, chronic, infectious enteritis of ruminants, which results in diarrhoea, weight loss and, ultimately, death; although asymptomatic carriage may occur in cattle (Olsen et al. 2002). Johne’s disease is among the most common bacterial infections in

Mycobacterium paratuberculosis

523

domesticated animals worldwide, but is most common in cattle. It has been estimated that economic losses to the cattle industry in the United States are about $1.5 billion (approximately, Œ 1.2 billion) annually (Harris and Barletta 2001). The organism has also been isolated from deer and wild boar (Alvarez et al. 2005) and rabbits (Raizman et al. 2005); albeit at low frequency. Results of a national survey for Johne’s disease conducted in the US in the 1980s showed that the infection was present in 1.6% of all cattle and 2.9% of cull cows (Merkal et al. 1987). The United States Department of Agriculture reports that between 20% and 40% of US dairy herds are infected with paratuberculosis (Broxmeyer 2005) with herd prevalence being strongly linked to herd size (Manning and Collins 2001). Forty percent of herds consisting of more than 300 head were infected with MAP. The prevalence of MAP in 4,579 purebred beef cattle from 115 ranches in Texas was determined using a commercial ELISA (Roussel et al. 2005). Serum samples were analysed for antibodies and faecal matter from seropositive cattle was submitted for mycobacterial culture. Three percent of cattle were seropositive and 50 of the 115 (43.8%) herds had at least one seropositive animal. Faeces of 73% of the seropositive cattle were culture positive, and these animals were found in 18% of the seropositive herds. A survey of veterinary practices and farms in south west England concluded that 1% of farms had cattle with Johne’s disease and 2% of the animals in these herds were infected (Cetinkaya et al. 1996). Similar prevalence rates have been found in other European countries (Scientific Committee on Animal Health and Animal Welfare 2000) and Canada (VanLeeuwen et al. 2005). However, other studies have shown that the prevalence of MAP in culled dairy cattle in Eastern Canada and Maine was 16.1% based on a systematic random sample of 984 abattoir cattle (McKenna et al. 2004). Herd prevalence in Europe ranges from 7 to 55% and rates in Australia range from 9 to 22% (Manning and Collins 2001). A seasonal pattern of positive cows was also detected, with the highest proportion of cows being positive in June (42.5%). The prevalence rates also vary according to the method of detection. In a study of MAP in cattle in Alberta, Canada, it was determined that the true herd-level prevalence, as determined by ELISA, was 26.8% +/– 9.6%; whereas the rate ranged from 27.6% +/– 6.5% to 57.1% +/– 8.3% when determined by MAP faecal culture, depending on the number of pooled individual faecal samples that were culture positive (Sorensen et al. 2003). There is some evidence that strains are host specific (Motiwala et al. 2004), with strains isolated from sheep and goats being more difficult to culture than the bovine strain (Juste et al. 1991). Johne’s disease usually occurs in young animals as a result of ingestion of feed contaminated with MAP. The ingested bacteria are transported across the epithelium through M-cells overlying the Peyer’s patches and are subsequently released and taken up by macrophages (Tessema et al. 2001). Unlike other intestinal epithelial cells, M-cells express integrins on their luminal faces. Efficient attachment and ingestion of MAP by cultured epithelial

524

Emerging foodborne pathogens

cells requires the expression of a fibronectin (FN) attachment protein homologue (FAP-P) which mediates FN binding by the bacterium. Targeting and invasion of M-cells by MAP in vivo is mediated primarily by the formation of a FN bridge formed between FAP-P and the integrins (Secott et al. 2002, 2004). Inside the macrophage, the mycobacteria are able to resist degradation and grow until the infected macrophage ruptures. The thick, lipid-rich cell envelope of MAP is mainly responsible for their resistance, as well as providing a physical barrier. The mycobacterial cell wall also contains several components that down-regulate the bactericidal function of macrophages. The basic intracellular survival strategy of pathogenic mycobacteria consists of the use of entry pathways that do not trigger oxidative attack, modification of the intracellular trafficking of mycobacteria-containing phagosomes, and modification of the link between the innate and specific immunity. These survival strategies, as well as their implications in the epidemiology, diagnosis, and control of Johne’s disease have been reviewed by Tessema et al. (2001).

19.3

Crohn’s disease

Crohn’s disease is a chronic inflammatory disease of humans that most commonly affects the distal ileum and colon, but it can occur in any part of the gastrointestinal tract (Hendrickson et al. 2002). It is a life-long debilitating illness, the symptoms of which generally first appear in people aged 15 to 24. As yet, there is no known cure for Crohn’s disease. However, management of the disease has become easier with the advent of drugs such as aminosalicylates, budesonide and immunosuppressive drugs (Achkar and Hanauer 2000; Hendrickson, et al. 2002; Hermon-Taylor 2002; Selby 2000). Revolutionary treatments involving genetically engineered anti-TNF a antibody, infliximab, may also provide ways to radically alter the course of severe Crohn’s disease by targeting a specific inflammatory mediator (Bell and Kamm 2000; Sandborn 2005). The illness is often cyclical with patients undergoing intermittent remission followed by recurrence. Surgical intervention is necessary in a large proportion of sufferers. It is primarily a disease of the industrialised world which has led to several hypotheses for this phenomenon. These include the ‘hygiene hypothesis’ which concludes that the lack of enteric parasitic infections, which have all been mainly eradicated in developed countries, causes a weakened systemic immune system, leading to the development of immunomediated diseases such as Crohn’s disease (Wells and Blennerhassett 2005) and the ‘cold chain hypothesis’ which states that cold-chain development has paralleled the outbreak of Crohn’s disease during the 20th century and suggests that psychrotrophic bacteria such as Yersinia spp. and Listeria spp. contribute to the disease as they have been found in Crohn’s disease lesions (Hugot et al. 2003). Several other causes of Crohn’s disease have been

Mycobacterium paratuberculosis

525

postulated such as infectious agents, including bacteria and viruses; allergic and nutritionally related causes; and microparticles, which is part of the concept behind toothpaste as a cause (Korzenik 2005). The underlying theory behind many of these ideas is that the central defect leading to Crohn’s disease is an increased intestinal permeability which may be the result of an innate immune deficiency (Korzenik 2005).

19.4

Mycobacterium paratuberculosis and Crohn’s disease

Because the pathological changes that occur in the small intestines of people with Crohn’s disease are similar to those observed in cattle suffering from Johne’s disease, it has been postulated that MAP is the aetiological agent responsible for Crohn’s disease (Chiodini 1989; Chiodini and Rossiter 1996; Hermon-Taylor 1998, 2001; Hermon-Taylor et al. 2000; Hermon-Taylor and Bull 2002). However, despite the similarities between the two conditions, detailed pathological comparisons reveal important differences, including important extraintestinal manifestations (Van Kruiningen 1999). The clinical features of the two infections are shown in Table 19.1. Evidence linking MAP and Crohn’s disease is far from conclusive. Studies have shown that the organism can be cultured from about 7.5% of patients with Crohn’s disease but from only 1% of healthy individuals (Chiodini and Rossiter 1996). The results of several surveys are summarised in Table 19.2. A two-fold increase in the prevalence of the organism in Crohn’s patients compared with control groups has been reported. However, the biggest differences were noticed when a PCR method based on the IS900 sequence was used to detect the organism (Moss et al. 1992; Scientific Committee on Animal Health and Animal Welfare 2000; Wall et al. 1993). Concerns have been raised because of the difficulty in isolating DNA from mycobacteria (Hermon-Taylor 1998), the inability of PCR to differentiate between viable and dead cells and the fact that some IS900 primers may not be specific for MAP (Cousins et al. 1999; St Amand et al. 2005; Vansnick et al. 2004). The identification of MAP DNA in Crohn’s disease tissue only reveals that MAP infection and Crohn’s disease can exist at the same point in time. MAP infection may occur before or after the development of Crohn’s disease and in either case may have little influence on the natural history of the disease (Cook 2000). Other studies have shown that the prevalence of MAP in Crohn’s disease patients is no different from that in controls (Table 19.2). In a recent population-based case control study of seroprevalence of MAP in patients with Crohn’s disease and ulcerative colitis, the authors could not prove the difference between inflammatory bowel disease patients and healthy volunteers (Bernstein et al. 2004). However, the rate of positive enzymelinked immunosorbent assay results was high (approximately 35%) for all study groups, and there was no difference in rates among Crohn’s disease patients, ulcerative colitis patients, healthy controls, and unaffected siblings.

526

Emerging foodborne pathogens

Table 19.1 Feature

Clinical features of Crohn’s disease and Johne’s disease Crohn’s disease

Preclinical stage Symptoms and signs Not known Incubation period Not known Clinical stage Presenting Chronic diarrhoea, symptoms and abdominal pain, signs weight loss Gastrointestinal symptoms and signs Diarrhoea Chronic (3 weeks+) Blood in stool Rare Vomiting Rare Abdominal pain Yes Obstruction Yes Extraintestinal manifestations Polyarthritis Yes, but rare Uveitis Yes, but rare Skin lesions Yes Amyloidosis Yes, but rare Hepatic Yes, but rare granulomatosis Renal involvement Yes, but rare Clinical course Remission and relapse Yes

Johne’s disease Decreased milk yield Minimum 6 months Chronic diarrhoea, dull hair, weight loss, decrease in lactation Chronica Rare No Unknown No No No No Yesb Yes Yesc Yes

a

Not seen in sheep Goats primarily Goats, deer, primates primarily, also camelids From (Board on Agriculture and Natural Resources 2003) b c

There has also been evidence linking cell-wall deficient forms of MAP with Crohn’s disease (Hulten et al. 2001; Sechi et al. 2001, 2004) but the results produced by this group have been questioned (Roholl et al. 2002). Many other bacteria have been isolated from biopsies taken from Crohn’s patients, including Helicobacter spp., Listeria monocytogenes and Escherichia coli (Tiveljung et al. 1999). Indeed, Crohn’s disease of the terminal ileum, especially if associated with a NOD2 mutation, is characterised by a reduced defensin (antimicrobial peptides) response. This could lead to increased bacterial invasion into the intestinal mucosa. Although it is uncertain that this deficient defensin response leads to a reduced antibacterial activity of the intestinal mucosa, Schmid et al. propose that the most plausible concept of pathogenesis of Crohn’s disease is a defensin deficiency syndrome (Schmid et al. 2004). Further evidence implicating MAP as the aetiological agent in Crohn’s disease was produced by El-Zaatari and colleagues (El-Zaatari et al. 1994, 1997, 1999; Naser et al. 1999). They identified two MAP proteins, p35 and p36 and, when sera of Crohn’s patients were screened for the presence of antibodies to these two proteins, 86% of patients were seropositive for the

Table 19.2

Isolation of MAP from patients with Crohn’s disease

Methodology

Crohn’s

Ulcerative colitis

Control

Reference

Serology Serum Ab by ELISA Serum Ab by ELISA

14/42a (33.3%) 107/283 (37.8%)

ndb 50/144 (34.7%)

(Barta et al. 2004) (Bernstein et al. 2004)

16/28 (57.1%) 15/28 (53.6%) 15/28 (53.6%) 77/89 (86.5%) 40/53 (75.5%) 79/89 (88.8%) 39/53 (73.6%) 9/10 (90%)

? 0/20 (0%) 2/20 (10%) 5/42 (11.9%) 1/10 (10%) 4/27 (14.8%) 1/10 (10%) 0/10 (0%)

3/34 (8.8%) 135/402 (33.6%) 47/138 (34.1%)c ? nd nd 4/40 (10%) 3/35 (8.6%) 5/50 (10%) 0/35 (0%) 0/10 (0%)

(Cohavy et al. 1999)

14/28 (50%) 3/14 (21.4%) 1/30 (3.3%) 4/82 (4.9%) 1/66 (1.5%) 8/24 (33.3%) 1/5 (20%) 0/21 (0%)

2/9 (22.2%) nd nd nd nd 5/22 (22.7%) nd 0/5 (0%)

0/15 (0%) nd nd 1/55 (1.8%) nd 1/40 (2.5%) nd 0/11 (0%)

(Naser et al. 2004) (Chiodini et al. 1984) (Coloe et al. 1986) (Gitnick et al. 1989) (Haagsma et al. 1991) (Del Prete et al. 1998) (Pavlik et al. 1994) (Clarkston et al. 1998)

6/18 (33.3%) 6/17 (35.3%) 10/12 (83.3%) 8/12 (66.7%)

nd nd 2/2 (100%) nd

1/11 (9.1%) 0/13 (0%) 1/6 (16.7%) 0/6 (0%)

(Moss, et al. 1992) (Wall et al. 1993) (Romero et al. 2005)

(Elsaghier et al. 1992) (El-Zaatari et al. 1999) (Naser et al. 1999)

Mycobacterium paratuberculosis 527

38kD Ag 24kD Ag 18kD Ag p36 Ag p36 Ag p35 Ag p35 + p36 Ag Serum IgA binding to mycobacterial HupB protein Culture Culture from blood Culture for 18 months Culture from colonic material Culture from surgical tissue Culture Culture from faeces Culture from surgical tissue Intestinal mucosal biopsies and surgical tissue PCR & related methods PCR of IS900 sequence from culture PCR of IS900 sequence from culture PCR of IS900 sequence from tissue FISH using tissue

528

Table 19.2

Continued Crohn’s

Ulcerative colitis

Control

Reference

PCR of IS900 and IS1311 sequences from tissue PCR in uncultured buffy coats Nested PCR based on IS900 sequence PCR of IS900 sequence from surgical tissue PCR of IS900 sequence from surgical tissue PCR of IS900 sequence from surgical tissue PCR of IS900 sequence from surgical tissue PCR of IS900 sequence from colon biopsy PCR of IS900 sequence PCR of IS900 sequence PCR of IS900 sequence PCR-DEIA of IS900 sequence PCR of IS900 sequence from ileal mucosa PCR PCR of IS900 sequence PCR on intestinal biopsies PCR of colon specimens Multiplex PCR on ileal biopsy PCR on faeces, serum and intestinal tissue Intestinal mucosal biopsies and surgical tissue PCR of IS900 sequence from biopsies and surgical tissue PCR PCR of intestinal tissue

0/18 (0%)

nd

nd

(Baksh et al. 2004)

13/28 (46.4%) 0/13 (0%) 26/40 (65%) 11/24 (45.8%) 13/18 (72.2%) 4/31 (12.9%) 2/9 (22.2%) 10/10 (100%) 10/26 (38.5%) 17/36 (47.2%) 15/17 (88.2%) 8/8 (100%) 3/11 (27.3%) 0/68 (0%) 0/36 (0%) 0/27 (100%) 0/10 (0%) 0/21 (0%)

4/9 (44.4%) 0/14 (0%) nd nd nd nd 2/15 (13.3%) 11/18 (61.1%) nd 2/18 (11.1%) 9/18 (50%) 2/2 (100%) nd 0/49 (0%) 0/13 (0%) nd nd 0/5 (0%)

3/15 (20%) 0/13 (0%) 6/63 (9.5%) 5/38 (13.2%) 10/35 (28.6%) 0/30 (0%) 0/11 (0%) 14/16 (87.5%) 4/35 (11.4%) 3/20 (15%) 1/40 (2.5%) 0/2 (0%) 0/11 (0%) 1/26 (3.8%) 0/23 (0%) 0/11 (0%) 0/27 (0%) 0/11 (0%)

(Naser et al. 2004) (Kanazawa et al. 1999) (Sanderson et al. 1992) (Lisby et al. 1994) (Dell’Isola et al. 1994) (Fidler et al. 1994) (Murray et al. 1995) (Suenaga et al. 1995) (Erasmus et al. 1995) (Gan et al. 1997) (Del Prete et al. 1998) (Mishina et al. 1996) (Tiveljung et al. 1999) (Rowbotham et al. 1995) (Dumonceau et al. 1996) (Frank and Cook 1996) (Al Shamali et al. 1997) (Kallinowski et al. 1998)

1/21 (4.8%)

0/5 (0%)

0/11 (0%)

(Clarkston et al. 1998)

0/34 (0%)

nd

0/17 (0%)

(Chiba et al. 1998)

0/47 (0%) 0/13 (0%)

0/27 (0%) 0/14 (0%)

0/20 (0%) 0/13 (0%)

(Cellier et al. 1998) (Kanazawa et al. 1999)

a b c

No. of positive samples/total no. sampled nd = not determined Unaffected siblings of Crohn’s patients

Emerging foodborne pathogens

Methodology

Mycobacterium paratuberculosis

529

p36 antibody and 74% of patients were seropositive when challenged with both proteins. The corresponding values for sera from controls were 11% and 0%, respectively. However, 100% of BCG vaccinated subjects and 89% of subjects with tuberculosis or leprosy were also seropositive for the p36 antibody. Shafran et al. (2002b) have proposed that detection of p35 and p36 can form the basis of a diagnostic test for Crohn’s disease. Other research has failed to find a link between seroprevalence of MAP antibodies and Crohn’s disease (Kobayashi et al. 1989; Tanaka et al. 1991; Walmsley et al. 1996). The interpretation of data concerning seroprevalence is made difficult because many Crohn’s sufferers take immunosuppressive drugs which can interfere with immunological assays, the assays themselves can be unreliable, and by the fact that Crohn’s disease results in a ‘leaky’ intestine and so patients with the disease readily form antibodies to intestinal and foodborne microorganisms (Blaser et al. 1984). Indeed, Ryan et al. (2004) were able to isolate E. coli DNA more frequently in granulomas from Crohn’s patients than in other non-Crohn’s bowel granulomas. They suggested that the results indicated a tendency for lumenal bacteria to colonise inflamed tissue, or they may have been due to increased uptake of bacterial DNA by gut antigen presenting cells. They concluded that the nonspecific nature of the type of bacterial DNA present in granulomas was evidence against any one bacterium having a significant causative role in Crohn’s disease. Difficulties in identification of MAP in Crohn’s disease have led to the argument that infection with the organism in these patients is paucibacillary (Selby 2004). Our understanding of the pathogenesis of Crohn’s disease has progressed rapidly with the discovery of NOD-2/CARD15 variants associated with ileal involvement, and the significance of various inflammatory mediators. It is now well established that Crohn’s disease is associated with polymorphisms of NOD2 (CARD15) (Girardin, et al. 2003). Previous work has shown that NOD2 acts as an intracellular receptor for bacteria and bacterial breakdown products, and because it appears capable of both activating and inhibiting inflammatory responses, NOD2 plays an important role in the gastrointestinal tract’s response to infectious organisms. NOD2 activation leads to the modification of NEMO. (NF-kB essential modulator), a central component of the NF-kB signalling pathway controlling inflammatory responses. NOD2 mutations responsible for Crohn’s disease cause polymorphisms that prevent the NOD2 protein from properly modifying NEMO (Abbott et al. 2004). More than 30 different genetic variations have been reported so far in Crohn’s disease patients, but three major mutations account for 82% of the total NOD2 (CARD15) mutations (Girardin et al. 2003). Saleh Naser and colleagues (2004) have reported that, although MAP DNA can be detected in the circulation of patients with inflammatory bowel disease and in controls without the disease, the viable organism could only be cultured from blood of patients with Crohn’s disease or ulcerative colitis. Naser and colleagues (2000) have also reported the culture of MAP from intestinal tissue and breast milk in people with Crohn’s disease. The existing

530

Emerging foodborne pathogens

evidence that MAP is one of the causes of Crohn’s disease is inconclusive, despite arguments of protagonists (Bull et al. 2003; Chamberlin et al. 2001; Greenstein 2003; Hermon-Taylor 2001; Quirke 2001). The identification of clusters of Crohn’s disease cases may indicate that it is caused by an aetiological agent, but such clusters are uncommon. In Australia, Johne’s disease is not uniformly distributed yet Crohn’s disease occurs throughout the country. The equal circulation of MAP DNA in patients with and without inflammatory bowel disease suggests that environmental exposure to MAP is widespread, possibly from water, milk, or other sources (Greenstein and Collins 2004). Nevertheless, Naser et al. (2002) were able to culture the bacterium only in patients with inflammatory bowel disease. This may be due to a defect in the mucosal barrier in patients with inflammatory bowel disease that allows passage or persistence of viable organisms taken up by circulating monocytes, or impaired killing of MAP by macrophages in these patients. The presence of MAP in blood could thus be an effect of the disease rather than its cause. Strangely, no correlation was found between the presence of circulating MAP and immunosuppressive therapy as reactivation of tuberculosis is a significant complication of infliximab therapy. However, MAP infection has not been described with this treatment and there is only one report of Crohn’s disease in a patient with AIDS (Richter et al. 2002). There have been reports of the efficacy of antimycobacterial drugs in treatment of Crohn’s patients, but the antibiotics used are active against many other bacteria (Hermon-Taylor 2002; Prantera et al. 1989, 1994, 1996; Shafran et al. 2002a). The remission in symptoms achieved with these drugs is generally short-lived and similar results can be obtained with antibiotics not known to be effective against mycobacteria (Prantera et al. 1996). However, Borody et al. (2002) have described reversal of severe Crohn’s disease in six out of 12 patients using prolonged combination anti-MAP therapy alone. Three patients achieved long-term remission with no detectable Crohn’s disease when all therapy was removed. There is conclusive evidence that hereditary and environmental factors play an important role in the aetiology of Crohn’s disease (Kornbluth et al. 1993). This, together with the conflicting results of studies aimed at confirming a link between MAP and Crohn’s disease, suggest that even if MAP is involved in the development of Crohn’s disease it is not the sole cause. Also, if bacteria are involved in Crohn’s disease then their action may be the result of a dysfunctional immune response and not due to the virulence of the organism per se (Griffiths 2002). Ghadiali et al. (2004) identified two alleles among short sequence repeats of MAP isolated from Crohn’s disease patients, and these clustered with strains derived from animals with Johne’s disease. The authors concluded that the identification of a limited number of genotypes among human strains suggests the existence of human disease-associated genotypes and strain sharing with animals.

Mycobacterium paratuberculosis

19.5

531

Prevalence of Mycobacterium paratuberculosis in foods

Because of the widespread occurrence of Johne’s disease it seems likely that MAP would be present in raw meats from ruminants as well as in raw vegetables and water due to environmental contamination by faeces. However, no data appear to exist in the literature on the prevalence of this organism from these sources, although MAP has been isolated from municipal potable water (Mishina et al. 1996) where it appears to be resistant to chlorination (Greenstein 2003). Possible routes of transmission to humans are milk, undercooked beef, water and animal contact (Greenstein 2003; Greenstein and Collins 2004). Several studies have shown that MAP can be cultured from the milk of cows clinically infected with paratuberculosis (Doyle 1954; Smith 1960; Taylor et al. 1981). MAP has been cultured from the faeces of 28.6% of cows in a single herd with high prevalence of infection. Of the faecal culturepositive cows, MAP was isolated from the colostrum of 22.2% and from the milk of 8.3%. Cows that were heavy faecal shedders were more likely to shed the organism in the colostrum than were light faecal shedders (Sweeney et al. 1992). Levels of the organism in nine culture-positive raw milks from clinically normal, faecal culture-positive cows were between 2–8 CFU/ml (Sweeney et al. 1992). However, other studies have suggested that faecal contamination was the most important contributor to MAP contamination of milk and levels as high as 104 CFU/ml could be attained (Nauta and van der Giessen 1998). Several surveys of pasteurized milk for the presence of MAP have now been carried out and these are summarised in Table 19.3. Millar et al. (1996) examined cream, whey and pellet fractions of centrifuged whole cow milk for MAP by IS900 PCR and found that the PCR assay gave the expected results for spiked milk and for native milk samples obtained directly from MAP-free, sub-clinically and clinically infected cows. These researchers also tested individual cartons and bottles of whole pasteurized cows’ milk obtained from retail outlets throughout Central and Southern England and South Wales from September 1991 to March 1993 by PCR (Millar et al. 1996) and found that 7.1% (22 of 312) tested positive for MAP. After 13–40 months of culture, 50% of the PCR-positive milk samples and 16.7% of the PCR-negative milk samples contained MAP, but the plates were overgrown by other organisms. More positive samples were found in winter and autumn using the PCR assay. During the period March 1999 to July 2000, a survey was undertaken to determine the prevalence of MAP in raw and pasteurized milks in the UK (Grant et al. (2002a). The organism was detected in milk using an initial rapid screening procedure involving immunomagnetic separation coupled to PCR (IMS-PCR). Conventional culture was used to confirm viability of the isolates and the organism was determined to be MAP if it met the following criteria: (i) acid fast, (ii) slow growth and typical colony morphology on Herrold’s egg yolk medium, (iii) presence of IS900 insertion element confirmed

532

Prevalence of MAP in milk

Sample

Method

Commercially pasteurized milk Raw milk Commercially pasteurized milk Raw milk Commercially pasteurized milk Raw milk Raw bulk tank milk Commercially pasteurized milk Raw bulk tank milk Commercially pasteurized milk Commercially pasteurized milk

Culture for 32 weeks

No. of samples tested

No. +ve for MAP (% +ve)

Country

Reference

244

4 (1.6)

Czech Republic

(Ayele et al. 2005)

IMS-PCR of IS900

389 357

50 (12.9) 35 (9.8)

Ireland

(O’Reilly et al. 2004)

Culture

389 357

1 (0.3) 0 (0) Switzerland United Kingdom

(Corti and Stephan 2002) (Grant et al. 2002a)

Canada

(Gao et al. 2002)

PCR of IS900 IMS-PCR of IS900

1384 244 567

273 (19.3) 19 (7.8) 67 (11.8)

Culture

244 567

4 (1.6) 10 (1.8)

Nested PCR of IS900

710

110 (15.5)

Culture on Middlebrook medium

244 (including 44 PCR +ve)

0 (0)

Emerging foodborne pathogens

Table 19.3

Mycobacterium paratuberculosis

533

by PCR, and (iv) dependent on mycobactin J for growth. MAP DNA was detected by IMS-PCR in 7.8% (95% confidence interval, 4.3 to 10.8%) and 11.8% (95% confidence interval, 9.0 to 14.2%) of the raw and pasteurized milk samples, respectively. When culture, following chemical decontamination with 0.75% cetylpyridinium chloride for 5 h, was used to confirm the presence of MAP, 1.6% (95% confidence interval, 0.04 to 3.1%) and 1.8% (95% confidence interval, 0.7 to 2.8%) of the raw and pasteurized milk samples, respectively, tested positive for the organism. The ten culture-positive pasteurized milk samples were from only eight of the 241 milk processing establishments that participated in the survey. Seven of these culture-positive pasteurized milks had been heat treated at 72 to 74 ∞C for 15 s; whereas the remaining three had been treated at 72 to 75 ∞C for an extended holding time of 25 s. Gao et al. (2002) collected 710 retail milks from retail stores and dairy plants in southwest Ontario, and these were tested for the presence of MAP by nested IS900 PCR. The PCR reaction was positive for 110 samples (15.5%); however, no survivors were isolated on Middlebrook 7H9 culture broth nor Middlebrook 7H11 agar slants from 44 PCR positive and 200 PCR negative retail milks. The absence of viable MAP in the retail milks tested may have been a true result or may have been due to the presence of low numbers of viable cells below the detection limit of the culture method (Gao et al. 2002). As well as cows’ milk, MAP DNA has been detected in goats’ milk in Norway (Djonne et al. 2003; Grant et al. 2001) and the UK (Grant et al. 2001) but the UK study failed to detect the organism in a limited number (14) of sheep milk samples.

19.6

Survival in food

Very little work has been published on the ability of MAP to survive in foods. To determine the ability of MAP to survive in cheese, Sung and Collins (2000) investigated the effect of pH, salt and heat treatment on viability of the organism. They showed faster rates of inactivation of MAP at lower pH. It was also concluded that NaCl concentrations between 2 and 6% had little effect on the ability of the organism to survive regardless of pH. However, the inactivation rates were higher in acetate buffer (pH 6, 2% NaCl) than in Queso Fresco cheese (pH 6.06, 2% NaCl). It was concluded that heat treatment of milk together with a 60-day curing period will reduce numbers of MAP in cheese by about 103 CFU/g. Donaghy et al. (2004) studied the survival of MAP over a 27-week ripening period in model Cheddar cheeses prepared from pasteurized milk artificially contaminated with high (104 to 105 CFU/ml) and low (101 to 102 CFU/ml) levels of three different MAP strains. The manufactured Cheddar cheeses were similar in pH, salt, moisture, and fat composition to commercial Cheddar. For all manufactured cheeses, a slow gradual decrease in the count of MAP in cheese was observed

534

Emerging foodborne pathogens

over the ripening period. In all cases where high levels (>104 CFU/g) of MAP were present in one-day-old cheeses, the organism could be recovered after the 27-week ripening period. At low levels of contamination, only one of the three strains of MAP used was recovered from the 27-week-old cheese. Similar research has been carried out in model hard (Swiss Emmentaler) and semi-hard (Swiss Tilsiter) cheese made from raw milk artificially contaminated with declumped cells of two strains of MAP at a concentration of 104 to 105 CFU/ml (Spahr and Schafroth 2001). As seen with the Cheddar cheeses, MAP counts decreased gradually in both the hard and the semi-hard cheeses during ripening. However, viable cells could still be detected in 120day cheese. The temperatures applied during cheese manufacture and the low pH at the early stages of cheese ripening were the greatest contributing factors to the death of MAP in cheese. The authors concluded that counts of MAP in these cheeses would be reduced by 103 to 104 CFU/g during the ripening period which lasts at least 90 to 120 days (Spahr and Schafroth 2001). It is interesting to note that the acid resistance of MAP has been shown to vary with growth conditions (Sung and Collins 2003). Since the revelation that MAP can be isolated from pasteurized milk, there have been numerous studies to ascertain its heat stability in milk. Using a holder method, Chiodini and Hermon-Taylor (1993) observed that heat treatments simulating a batch pasteurization (63 ∞C for 30 min) and a HTST treatment (72 ∞C for 15 s) resulted in over 91% and 95% destruction of MAP, respectively. When MAP was heated in milk in a sealed vial, Dvalues of 229, 48, 22 and 12 s were reported at 62, 65, 68 and 71 ∞C, respectively (Collins et al. 2001; Sung and Collins 1998). When a holder method (63.5 ∞C for up to 40 min) and a laboratory scale pasteurizer (72 ∞C for 15 s) were used, numbers declined rapidly during heating, but approximately 1% of the initial population remained after heating (Grant et al. 1996). This has been attributed to clumping of the bacterial cells rather than due to the presence of a more heat-resistant sub-population of cells (Klijn et al. 2001; Rowe et al. 2000). Other experiments led to the conclusion that laboratory heat treatments simulating pasteurization did not effectively eliminate MAP from the milk unless initial numbers were below 10 CFU/ml (Grant et al. 1998a) or the holding time at 72 ∞C was extended to 25 s (Grant et al. 1999). Using similar methods to heat treat raw milk inoculated with 103 to 107 CFU/ml of MAP, Gao et al. (2002) found no survivors on cultures of seven milks treated by a batch process at 63 ∞C for 30 min, but MAP cells were detected in two of the 11 HTST (72 ∞C for 15 s) treated milks. The positive samples were obtained from raw milks containing 105 CFU/ml and 107 CFU/ml MAP. Lund et al. (2002b) pointed out that the laboratory pasteurizing apparatus used by Grant and her colleagues (Grant et al. 1996, 1998a, 1999) may be liable to error due to condensate and splashed cells which may be able to reach the portions of the inlet and outlet tubes of the apparatus that are above the heating liquid. These cells would receive less than the full heat treatment and may drip back into the heating medium.

Mycobacterium paratuberculosis

535

Also there is a significant heat-up time of about 50 s for the milk to reach approximately 72 ∞C. The importance of clumping of MAP cells on heat resistance was studied by Keswani and Frank (1998). These workers used clumped and de-clumped suspensions of cultures to determine the rate of heat inactivation and survival at pasteurization temperatures in sealed capillary tubes. At 55 ∞C, minimal thermal inactivation was observed for both clumped and declumped cells. At 58 ∞C, thermal inactivation ranging from 0.3 to 0.7 log cycles was observed for both clumped and de-clumped suspensions. D values at 60 ∞C ranged from 8.6 to 11 min and 8.2 to 14.1 min for clumped and declumped cells, respectively, and the respective values at 63 ∞C ranged from 2.7 to 2.9 and 1.6 to 2.5 min. Keswani and Frank (1998) also studied the survival of MAP at initial levels ranging from 44 to 105 CFU/ml at 63 ∞C for 30 min and 72 ∞C for 15 s. No survivors were observed after incubating plates for up to four months on Middlebrook 7H11 agar and up to two months on Herrold’s egg yolk medium. This led to the conclusion that low levels of MAP, as might be found in raw milk, will not survive pasteurization treatments. A laboratory method, in which milk inoculated with MAP was heated in sealed tubes at temperatures ranging from 65 to 72 ∞C for up to 30 min, was compared to results obtained using a small-scale pasteurizer designed to simulate HTST units used in processing plants (Stabel et al. 1997). About 10 CFU/ml of MAP (from an original population of about 1 ¥ 106 CFU/ml) survived heating for 30 min at 72 ∞C in the sealed tubes. However, results obtained using the laboratory scale pasteurizer showed that there were no detectable cells of MAP after heating for 15 s at 65, 70 or 75 ∞C. Thus, results obtained using the holder method could not be extrapolated to a commercial HTST unit, and that continuous flow is essential for effective killing of MAP in milk. Further studies using a continuous flow system were described by Hope et al. (1997). However, because a linear holding tube was used which failed to generate turbulent flow, this study did not simulate exactly the conditions that would exist in a commercial pasteuriser. Seventeen batches of raw milk were inoculated with 102–105 CFU/ml of MAP and pasteurised at temperatures ranging from 72–90 ∞C for 15–35 s. The organism could not be isolated from 96% (275/286) of pasteurised milk samples, representing at least a 4 logcycle reduction in count. Viable mycobacteria were not recovered from the heat-treated milk when raw whole milk was loaded with less than 104 mycobacteria per ml, and were not cultured in any of five batches of milk pasteurized at 72–73 ∞C for 25–35 s, which are the minimum conditions applied when this machine is used commercially to correct for laminar flow in the holding tube. An adequate holding time appeared to be more effective in killing MAP than higher temperatures in the small number of batches treated, and this is similar to results reported by Grant et al. (1999). The effectiveness of the holder and high-temperature short-time pasteurisation standards on the destruction of MAP were conducted using a

536

Emerging foodborne pathogens

slug-flow pasteuriser and a laboratory scale pasteurizer; both of which were used to treat UHT milk inoculated with 105 and 108 CFU/ml of three different strains of MAP (Stabel and Lambertz 2004). Five different time-temperature combinations were evaluated: 62.7 ∞C for 30 min, 65.5 ∞C for 16 s, 71.7 ∞C for 15 s, 71.7 ∞C for 20 s, and 74.4 ∞C for 15 s. Regardless of bacterial strain or method of heating, the heat treatments resulted in an average 5.0 and 7.7 log cycle reduction in MAP count for milk inoculated with the low and high inoculum levels, respectively. The survival of MAP in inoculated batches of milk in a small-scale commercial unit cannot be directly extrapolated to commercial pasteurization of naturally infected milk because of the artificially high mycobacterial loads used in these experiments, possible differences between the thermoresistance of laboratory cultured mycobacteria, features of the smallscale unit (Hope et al. 1997) and the variation in heat resistance of MAP inocula grown under different culture conditions (Sung et al. 2004). However, pasteurization in the continuous flow small-scale unit was more efficient at killing MAP than batch experiments performed in the laboratory. The inaccuracies in heat resistance data produced by laboratory scale experiments were pointed out by Cerf and Griffiths (2000) who also pointed out that it was thermodynamically unfeasible to expect that extending the holding time would have a greater effect on survival of MAP than increasing the heating temperature as proposed by Grant et al. (1999). Several studies have now been completed to determine the effect of commercial pasteurization on the survival of MAP in milk with conflicting results. Pearce et al. (2001) used a pilot-scale pasteurizer operating under validated turbulent flow (Reynolds number, 11,050) to study the heat sensitivity of five strains of MAP (ATCC 19698 type strain, the human isolate designated Linda, and three bovine isolates) in raw whole milk for 15 s at 63, 66, 69, and 72 ∞C. No strains survived at 72 ∞C for 15 s; and only one strain survived at 69 ∞C. Means of pooled D values (decimal reduction times) at 63 and 66 ∞C were 15.0 ± 2.8 s and 5.9 ± 0.7 s, respectively. The mean extrapolated D72∞C was < 2.03 s, which was equivalent to a > 7 log10 kill at 72 ∞C for 15 s. The mean Z value (the temperature increase required for a 1 log10 cycle reduction in D value) was 8.6 ∞C. The five strains behaved similarly when recovery was performed on Herrold’s egg yolk medium containing mycobactin or by a radiometric culture method (BACTEC). In an additional experiment, milk was inoculated with fresh faecal material from a high-level faecal shedder with clinical Johne’s disease and heated at 72 ∞C for 15 s (Pearce et al. 2001). Under these conditions, a minimum inactivation of >4 log10 CFU/ml of MAP kill was achieved, indicating that properly maintained and operated pasteurizers should ensure the absence of viable MAP in retail milk and other pasteurized dairy products. In another study undertaken using a pasteurizer with a validated Reynolds number (62,112) and a flow rate of 3,000 l/h, 20 batches of milk inoculated with 103 to 104 CFU/ml MAP were homogenised and then processed with

Mycobacterium paratuberculosis

537

combinations of three temperatures of 72, 75, and 78 ∞C and three time intervals of 15, 20, and 25 s (McDonald et al. 2005). Surviving cells were assayed using a culture technique capable of detecting one organism per 10 ml of milk. In 17 of the 20 runs, no viable M. paratuberculosis organisms were detected, whereas for 3 of the 20 runs of milk, pasteurized at 72 ∞C for 15 s, 75 ∞C for 25 s and 78 ∞C for 15 s, a small number of viable cells (corresponding to 0.002 to 0.004 CFU/ml) were detected. Pasteurization at all temperatures and holding times was found to be very effective in killing MAP, resulting in a reduction of > 6 log10 in 85% of runs and > 4 log10 in 14% of runs. Both the studies by Pearce et al. (2001) and McDonald et al. (2005) involved milk which had been artificially contaminated with MAP. A similar study was undertaken using raw cows’ milk naturally infected with MAP and pasteurized using an APV HXP commercial-scale pasteurizer (capacity 2,000 l/h) (Grant et al. 2002b). The milk was pasteurized at 73 ∞C for 15 s or 25 s, with and without prior homogenisation (2,500 psi in two stages) in an APV Manton Gaulin KF6 homogeniser. Raw and pasteurized milk samples were tested for MAP by IMS-PCR and culture after decontamination with 0.75% (wt/vol) cetylpyridinium chloride for 5 h. On 10 of the 12 processing occasions, MAP was detectable by IMS-PCR, culture, or both in either raw or pasteurized milk and viable cells were cultured from 4 of 60 (6.7%) raw and 10 of 144 (6.9%) pasteurized milks. Results suggested that survival was related to the initial load of MAP in the raw milk and that homogenisation increased the lethality of subsequent heat treatments. Unlike previous work conducted using a laboratory pasteurizer (Grant et al. 1999), extending the holding time at 73 ∞C to 25 s was no more effective at killing MAP than the 15 s holding time. In contrast to the work of Pearce et al. (2001) and McDonald et al. (2005), this study provides evidence that MAP present in naturally contaminated milk is capable of surviving commercial HTST pasteurization if present in sufficient numbers in the raw milk (Grant et al. 2002b). The reasons for the differences reported in heat resistance studies of MAP have been reviewed by Lund et al. (2002a, b). An alternative processing treatment involving high voltage electric pulses, pulsed electric field (PEF), in combination with heat treatment has been explored to determine its effect on the viability of MAP cells suspended in peptone water and in sterilised cow’s milk (Rowan et al. 2001). PEF treatment at 50 ∞C (2,500 pulses at 30 kV/cm) reduced the level of viable MAP cells by about 5 to 6 log cycles in peptone water and in cows’ milk. Heating at 50 ∞C for 25 min or at 72 ∞C for 25 s (extended HTST pasteurization) resulted in reductions of MAP counts of approximately 0.01 and 2.4 log cycles, respectively. Electron microscopy revealed that exposure to PEF treatment caused substantial damage to MAP cell membranes.

538

19.7

Emerging foodborne pathogens

Survival in the environment

One possible route of transmission of MAP from cattle to humans is through contaminated water. MAP has been isolated from water runoff from cattle farms (Raizman et al. 2004). A study of the River Taff in South Wales, United Kingdom, running from hill pastures grazed by livestock in which MAP is endemic to a populated coastal region showed that the organism could be detected in 31 of 96 daily samples (32.3%) by IS900 PCR, and 12 of the samples by culture (Pickup et al. 2005). Sequencing of the isolates obtained by culture and from river water DNA extracts revealed that 16 of 19 sequences from river water DNA extracts had a single-nucleotide polymorphism at position 214 suggesting the presence of a different, unculturable strain of MAP in the river. The strains that were isolated remained culturable in lake water microcosms for 632 days and persisted to 841 days. Of four reservoirs controlling the catchment area of the Taff, MAP was present in surface sediments from three and in sediment cores from two, consistent with deposition over at least 50 years. Epidemiological studies have indicated a highly significant increase of Crohn’s disease in districts bordering the river. MAP can also survive in faecal material for up to 55 weeks in a dry, fully shaded environment, but for much shorter periods in sunny locations (Whittington et al. 2004). The organism survived for up to 24 weeks on grass that germinated through infected faecal material applied to the soil surface in completely shaded boxes and for up to nine weeks on grass in 70% shade. The results obtained indicated that the cells were able to enter a dormant state and sequences homologous to genes involved in dormancy responses in other mycobacteria were present in the MAP genome sequence. When MAP was present in water at high numbers (106 CFU/ml), chlorine treatment at concentrations of 2 mg/ml for up to 30 min was insufficient to completely eradicate the organism and < 3 log cycle reduction in counts was observed (Whan et al. 2001).

19.8

Detection, enumeration and typing

Diagnostic tests for MAP have been reviewed (Grant and Rowe 2001; Nielsen et al. 2001). Culture methods are laborious and time consuming, taking 8 to 16 weeks to obtain results. Because of this long incubation period, contamination is often a problem and samples have to be treated with selective agents to reduce numbers of non-mycobacterial organisms, although care must be taken in choosing the correct decontaminant to avoid a detrimental effect on the recovery rate in different sample matrices (Donaghy et al. 2003; Dundee et al. 2001; Grant and Rowe 2004). The low numbers present in a sample often necessitate a concentration step, such as centrifugation, filtration, or, more recently, immunomagnetic separation (Djonne, et al. 2003; Grant et al. 1998b 2000). Usually an enrichment step in liquid medium, such

Mycobacterium paratuberculosis

539

as Dubos broth, is used prior to plating onto a solid medium. Of these, one of the most commonly used is Herrold’s egg yolk medium. Confirmation of the identity of the isolate involves meeting the following criteria: (i) it must be acid-fast; (ii) it must exhibit slow growth with a typical colony morphology (i.e. colonies are 1 to 2 mm in diameter, entire and white); (iii) it must be IS900 PCR-positive; (iv) it must require mycobactin J for growth. To decrease the time to obtain results, spiral plating in combination with microscopic colony counting has been investigated (Smith et al. 2003). This technique allowed counts to be obtained in 8 to 14 days. A modification of the culture method has been used successfully in which radioisotope-labelled substrates are incorporated in the growth medium. The assimilation of these substrates can be detected using the BACTEC system. Radiometric culture is faster and more sensitive than traditional culture techniques (Nielsen et al. 2001). The radiometric method has also been combined with PCR to rapidly confirm the MAP status of the sample. Other automated methods are available such as the ESP II Culture System with para-JEM liquid culture reagents that uses pressure sensing instead of radioisotopes to detect growth (Kim et al. 2004), the MB/BacT system in which CO2 produced during growth in a modified Middlebrook 7H9 broth is monitored based on changes in reflection of light from a sensor in the bottom of the culture vessel (Stich et al. 2004) and the Mycobacteria Growth Indicator Tube (MGIT) which has an O2 sensitive fluorescent sensor embedded in its base that fluoresces when O2 becomes depleted in the medium due to growth (Grant et al. 2003). Because of its slow growth there has been considerable interest in the development of more rapid detection tests. These have mainly focused on PCR of the IS900 insertion element which is unique to MAP and is present in multiple copies in the genome of the bacterium. However, recent work has shown that this cross reacts with environmental Mycobacteria sp. in ruminant faeces, which share 71 to 79% (Cousins et al. 1999) and 94% in sequence homology (Englund et al. 2002) to IS900. The limitations of the IS900 PCR assay have been discussed by Nielsen et al. (2001), but the main problem seems to be the high number of false-negative reactions generated by PCR as compared to conventional culture. Because of these limitations work has also been carried out to develop PCR assays based on other genomic loci including 251 (Rajeev et al. 2005); ISMAV2 (Shin et al. 2004); hspX (Ellingson et al. 2000); dnaA (Rodriguez-Lazaro et al. 2004); and f57 (Vansnick et al. 2004). With the availability of the complete genome sequence of MAP identification of unique open reading frames has been facilitated (Paustian et al. 2004, 2005). To improve the sensitivity of PCR assays and to assist in the removal of inhibitors present in the sample that interfere with the polymerase enzyme, methods have also been developed that combine immunomagnetic capture of the organism with PCR (Djonne et al. 2003; Grant et al. 2000). Using this approach it was possible to detect 10 CFU/ml of MAP in water (Whan et al.

540

Emerging foodborne pathogens

2005). Other techniques have been investigated to capture MAP from suspension. For example, Halldorsdottir and colleagues (Halldorsdottir et al. 2002) used buoyant density in a Percoll gradient to remove cells prior to IS900 sequence capture PCR and dot blot assay to detect MAP in faeces; whereas Stratmann et al. (2002) have developed a peptide-mediated magnetic separation technique based on phage display technology to aid selective isolation of MAP from milk. Nine recombinant bacteriophages binding to MAP were isolated from a commercial phage-peptide library encoding random 12-mer peptides. Paramagnetic beads coated with the phage or with a peptide, aMP3, allowed capture of MAP from milk, and when this was combined with an ISMav2-based PCR the bacterium could be detected at levels of 100 CFU/ml in artificially spiked milk. Experiments using milk from naturally infected cows and bulk milk samples from infected herds demonstrated that the peptide-mediated capture PCR was able to detect single strong shedders of MAP in pooled milk samples. Several commercial PCR assays for MAP are now available and the performance of three of these has been evaluated by Taddei et al. (2004). There is also growing interest in the development of real-time PCR methods. Many approaches have been used including primers and fluorescent probes targeting the 251 genomic locus (Rajeev et al. 2005); fluorescence energy transfer probes targeting IS900 (O’Mahony and Hill 2004); SYBR Green in combination with the LightCycler (O’Mahony and Hill 2002); molecular beacons (Fang et al. 2002; Rodriguez-Lazaro et al. 2004); and TaqMan probes (Kim et al. 2002). Studies comparing real-time PCR with molecular beacons to a commercial PCR/Southern blot technique, nested PCR and culture for the detection of MAP have shown that real-time PCR assays are valid alternatives to culture (Christopher-Hennings et al. 2003; Fang et al. 2002). Real-time PCR has also been combined with IMS to produce a method that was capable of detecting £10 cells of MAP in 2 ml of milk or 200 mg of faeces (Khare et al. 2004). PCR methods, when used alone, cannot distinguish between viable and non-viable states of the organism, and to this end PCR has been combined with culture methods including the ESP II system (Ellingson et al. 2004) and an agar culture enrichment step (Secott et al. 1999). To overcome the problem of distinguishing live and dead cells, RT-PCR and an isothermal RNA amplification method, nucleic acid sequence-based amplification (NASBA), have also been investigated (Grant and Rowe 2001; Rodriguez-Lazaro et al. 2004). Another isothermal amplification method, loop-mediated isothermal amplification (LAMP), has been successfully used to detect MAP (Enosawa et al. 2003). LAMP relies on a DNA polymerase with high strand displacement activity to catalyse auto-cycling strand displacement DNA synthesis. A specially designed set of two inner and two outer primers is used, but later during the cycling reaction only the inner primers are used for strand displacement DNA synthesis. The reaction is highly specific because the target sequence is recognised by six independent sequences in the initial stage and by four

Mycobacterium paratuberculosis

541

independent sequences during the later stages of the LAMP reaction. A large amount of DNA is synthesised during the LAMP reaction with the concomitant production of a large concentration of pyrophosphate ion which can be detected as a white precipitate of magnesium pyrophosphate in the reaction mixture. Work on optimisation of DNA extraction protocols has also been carried out (Christopher-Hennings et al. 2003; Stabel et al. 2004). O’Mahony and Hill (2004) found that a milk sample treatment involving a combination of centrifugation, harsh lysis, physical grinding, boiling, nucleic acid purification, and real-time PCR allowed detection of 40 CFU/ml of milk, within 3 h. The method was also able to enumerate the initial titer of MAP in milk by using predetermined standards. Detection of 10 CFU/ml of MAP in milk has been achieved using a bead beater (a device that breaks up bacterial cell wall mechanically by vibrating bacteria with microbeads at high speed) and lysis buffer to lyze MAP cells, followed by boiling and isopropanol precipitation to extract DNA, and inclusion of 0.0037% bovine serum albumin in the PCR reaction mixtures. The improved assay was 10- to 10,000-fold more sensitive than PCR assays that used template DNA prepared by other lysis procedures including boiling alone, freeze-thaw plus boiling, or use of commercial kits for lysis (Odumeru et al. 2001). Because detection is difficult when mycobacteria are intracellularly located or embedded within mammalian tissues, a culture-independent, in situ hybridisation (ISH) assay for the detection of members of the Mycobacterium avium complex in culture, sputum, and tissue has been developed based on a set of rRNA-based oligonucleotides (St Amand et al. 2005). Immunoassays are widely used for screening cattle for Johne’s disease but the use of ELISA assays for the detection of MAP in bulk tank milks has met with little success (Nielsen et al. 2000). However, more recent work using a commercially available ELISA for antibodies against MAP and preserved milk samples in an indirect ELISA assay format may be a convenient tool for the detection of the organism in dairy herds (Hendrick et al. 2005). Other commercial assays have also been adapted for the detection of MAP in milk (Winterhoff et al. 2002). Commercial ELISA and immunodiagnostic kits are available from a number of companies, although concern has been raised about variability between kit lots (Dargatz et al. 2004). To aid in epidemiological investigations molecular typing methods have been studied to allow differentiation of MAP isolates from human and animal reservoirs. Among the methods studied are multilocus variable-number tandemrepeat analysis (MLVA) and IS900 restriction fragment length polymorphism (RFLP) typing. When the techniques were compared, MLVA typing subdivided the most predominant RFLP type, R01, into six subtypes and, thus, showed improved discriminatory ability (Overduin et al. 2004). Good discrimination has also been obtained using a multilocus short sequence repeat sequencing approach (Amonsin et al. 2004), IS900/ ERIC-PCR using primers targeting the enterobacterial intergenic concensus (ERIC) sequence and the IS900

542

Emerging foodborne pathogens

insertion sequence (Englund 2003), a multiplex PCR of IS900 loci (MPIL) (Bull et al. 2000) and randomly amplified polymorphic DNA (RAPD) using the OPE-20 primer (5’-AACGGTGACC-3’) (Pillai et al. 2001).

19.9

Control

Guidelines for minimising transmission of MAP have been published (Green 2002). Arguably the most effective way of controlling MAP is by adopting strategies that will eliminate Johne’s disease from cattle on the farm. However, this is easier said than done because of the organism’s ability to survive in the environment, the long incubation period of the disease and the lack of sensitive diagnostic tests to identify infected animals during this time (Kennedy et al. 2001). It is worth noting that test-and-cull strategies alone may not reduce the prevalence of paratuberculosis in cattle and are costly for producers to pursue but improved calf-hygiene strategies were found to be critically important in every paratuberculosis control program (Groenendaal and Galligan 2003). Risk factors for seropositivity included water source, use of dairy-type nurse cows, previous clinical signs of paratuberculosis, species of cattle and location (Roussel et al. 2005). The risk management strategies used to contain Johne’s disease include prevention of infection of the herd through maintaining a closed herd whenever possible and when new animals have to be introduced they should be from herds free from the disease. Cattle should also be kept from pastures and other environments that may be heavily contaminated due to prior exposure to animals with the disease. It has been demonstrated that MAP can survive in faeces kept outdoors for up to 246 days, depending on the conditions (Collins et al. 2001). Environmental contamination can also be reduced by good management of water and effluent flows from neighbouring high risk farms and by good manure management. The survival of MAP on pasture after destocking of all cattle infected with paratuberculosis was found to be four months during winter. Non-vertebrates, such as cockroaches (Fischer et al. 2003), beetles (Fischer et al. 2004b) and blowflies (Fischer et al. 2004a), as well as wild ruminants or non-ruminant wildlife can be vectors and potentially become a risk factor in the spread of MAP infection. (Machackova et al. 2004). Vaccines have been developed that are effective in reducing the number of clinically affected animals but vaccination does not appear to reduce the total number of infected animals in a herd. Current vaccines are not used in many countries because they interfere with subsequent tests for tuberculosis (Muskens et al. 2002). Work is being carried out on new targets for vaccine development such as a recombinant heat shock protein, rHsp-70 (Langelaar et al. 2002, 2005) and the rMPT 85B antigen (Mullerad et al. 2002). Exposure of individual calves to paratuberculosis should be minimised by rearing in clean environments free from adult cattle, coupled with the adoption of good

Mycobacterium paratuberculosis

543

hygienic practices by farm personnel. The animals should be fed milk and water that are free from contamination, and ideally the calf should be provided with an adequate colostrum intake from a paratuberculosis-negative cow. The most important source of MAP within the herd is the cow with advanced infection, as the rate of excretion of bacteria in the faeces increases as these animals approach clinical disease. Thus, infected animals should be identified as early as possible through testing and applying knowledge of history of the disease in the herd. Control is best achieved by culling calves of infected cows, early culling of suspect cows and test reactors along with animals that have been in contact with these cattle. Recent work has suggested that calves infected during the first weeks of life can be a frequent and important source of infection and in herds where poor control measures were in place MAP was shed in faeces of 7.8 to 80% of calves aged between four to six months (Pavlas 2005). However, early separation of newborn calves from cows and grazing calves under 12 months of age in areas free of adult cattle were not found to be protective against Johne’s disease by other workers (Ridge et al. 2005). Several countries have adopted national programmes to control paratuberculosis in dairy herds and/or to accredit MAP-negative herds as low risk sources of replacement cows. To reduce the level of MAP in milk the UK has recommended increasing the holding time at the minimum pasteurization temperature of 72 ∞C from 15 to 25 s. The control of MAP in animal populations has been reviewed (Kennedy and Benedictus 2001; Whittington and Sergeant 2001).

19.10

Further sources of information

Several recent reviews on the role of MAP in Crohn’s disease have been published (Chacon et al. 2004; Collins 2003, 2004; Grant 2003; Griffiths 2002; Hermon-Taylor and Bull 2002; Manning 2001; Manning and Collins 2001; Stabel 2000).

19.11

References

ABBOTT, D. W., WILKINS, A., ASARA, J. M.

and CANTLEY, L. C. 2004, ‘The Crohn’s disease protein, NOD2, requires RIP2 in order to induce ubiquitinylation of a novel site on NEMO’, Current Biology, vol. 14, no. 24, pp. 2217–2227. ACHKAR, J. P. and HANAUER, S. B. 2000, ‘Medical therapy to reduce postoperative Crohn’s disease recurrence’, American Journal of Gastroenterology, vol. 95, no. 5, pp. 1139–1146. AL SHAMALI, M., KHAN, I., AL NAKIB, B., AL HASSAN, F. and MUSTAFA, A. S. 1997, ‘A multiplex polymerase chain reaction assay for the detection of Mycobacterium paratuberculosis DNA in Crohn’s disease tissue’, Scand. J. Gastroenterol., vol. 32, no. 8, pp. 819–823. ALVAREZ, J., DE JUAN, L., BRIONES, V., ROMERO, B., ARANAZ, A., FERNANDEZ-GARAYZABAL, J. F. and MATEOS, A. 2005, ‘Mycobacterium avium subspecies paratuberculosis in fallow deer and wild boar in Spain’, Veterinary Record, vol. 156, no. 7, pp. 212–213.

544

Emerging foodborne pathogens

AMONSIN, A., LI, L. L., ZHANG, Q., BANNANTINE, J. P., MOTIWALA, A. S., SREEVATSAN, S.

and KAPUR, 2004, ‘Multilocus short sequence repeat sequencing approach for differentiating among Mycobacterium avium subsp. paratuberculosis strains’, J. Clin. Microbiol., vol. 42, no. 4, pp. 1694–1702. AYELE, W. Y., SVASTOVA, P., ROUBAL, P., BARTOS, M. and PAVLIK, I. 2005, ‘Mycobacterium avium subspecies paratuberculosis cultured from locally and commercially pasteurized cow’s milk in the Czech Republic’, Applied and Environmental Microbiology, vol. 71, no. 3, pp. 1210–1214. BAKSH, F. K., FINKELSTEIN, S. D., ARIYANAYAGAM-BAKSH, S. M., SWALSKY, P. A., KLEIN, E. C. and DUNN, J. C. 2004, ‘Absence of Mycobacterium avium subsp. paratuberculosis in the microdissected granulomas of Crohn’s disease’, Mod. Pathol, 1289–1294. BARTA, Z., CSIPO, I., MEKKEL, G., ZEHER, M., MAJOROS, L., BERNSTEIN, C. N. and COLLINS, M. T. 2004, ‘Seroprevalence of Mycobacterium paratuberculosis in patients with Crohn’s Disease’, J. Clin. Microbiol., vol. 42, no. 11, pp. 5432–5433. BELL, S. J. and KAMM, M. A. 2000, ‘Review article: the clinical role of anti-TNFalpha antibody treatment in Crohn’s disease’, Alimentary Pharmacology and Therapeutics, vol. 14, no. 5, pp. 501–514. BERNSTEIN, C. N., BLANCHARD, J. F., RAWSTHORNE, P. and COLLINS, M. T. 2004, ‘Populationbased case control study of seroprevalence of Mycobacterium paratuberculosis in patients with Crohn’s disease and ulcerative colitis’, J. Clin. Microbiol., vol. 42, no. 3, pp. 1129–1135. BLASER, M. J., MILLER, R. A., LACHER, J. and SINGLETON, J. W. 1984, ‘Patients with active Crohn’s disease have elevated serum antibodies to antigens of seven enteric bacteria’, Gastroenterology, vol. 87, no. 4, pp. 888–894. BOARD ON AGRICULTURE and NATURAL RESOURCES 2003, Diagnosis and Control of Johne’s Disease The National Academies Press, Washington, D.C. BORODY, T. J., LEIS, S., WARREN, E. F. and SURACE, R. 2002, ‘Treatment of severe Crohn’s disease using antimycobacterial triple therapy – approaching a cure?’, Dig. Liver Dis., vol. 34, no. 1, pp. 29–38. BROXMEYER, L. 2005, ‘Thinking the unthinkable: Alzheimer’s, Creutzfeldt-Jakob and Mad Cow disease: the age-related reemergence of virulent, foodborne, bovine tuberculosis or losing your mind for the sake of a shake or burger’, Medical Hypotheses, vol. 64, no. 4, pp. 699–705. BULL, T. J., HERMON-TAYLOR, J., PAVLIK, I., EL ZAATARI, F. and TIZARD, M. 2000, Characterization of IS900 loci in Mycobacterium avium subsp. paratuberculosis and development of multiplex PCR typing’, Microbiology, vol. 146 (Pt 9), pp. 2185–2197. BULL, T. J., MCMINN, E. J., SIDI-BOUMEDINE, K., SKULL, A., DURKIN, D., NEILD, P., RHODES, G., PICKUP, R., and HERMON-TAYLOR, J. 2003, ‘Detection and verification of Mycobacterium avium subsp. paratuberculosis in fresh ileocolonic mucosal biopsy specimens from individuals with and without Crohn’s disease’, J. Clin. Microbiol., vol. 41, no. 7, pp. 2915–2923. CELLIER, C., DE BEENHOUWER, H., BERGER, A., PENNA, C., CARBONNEL, F., PARC, R., CUGNENC, P. H., LE QUINTREC, Y., GENDRE, J. P., BARBIER, J. P. and PORTAELS, F. 1998, ‘Mycobacterium paratuberculosis and Mycobacterium avium subsp. silvaticum DNA cannot be detected by PCR in Crohn’s disease tissue’, Gastroenterol. Clin. Biol., vol. 22, no. 8–9, pp. 675–678. CERF, O. and GRIFFITHS, M. W. 2000, ‘Mycobacterium paratuberculosis heat resistance’, Lett. Appl. Microbiol., vol. 30, no. 4, pp. 341–344. CETINKAYA, B., EGAN, K., HARBOUR, D. A. and MORGAN, K. L. 1996, ‘An abattoir-based study of the prevalence of subclinical Johne’s disease in adult cattle in south west England’, Epidemiol. Infect., vol. 116, no. 3, pp. 373–379. CHACON, O., BERMUDEZ, L. E. and BARLETTA, R. G. 2004, ‘Johne’s Disease, Inflammatory Bowel Disease, and Mycobacterium paratuberculosis’, Annu. Rev. Microbiol, 329– 363. V.

Mycobacterium paratuberculosis

545

CHAMBERLIN, W., GRAHAM, D. Y., HULTEN, K., EL ZIMAITY, H. M., SCHWARTZ, M. R., NASER, S., SHAFRAN, I. and EL ZAATARI, F. A. 2001, ‘Review article: Mycobacterium avium subsp. paratuberculosis as one cause of Crohn’s disease’, Aliment. Pharmacol. Ther., vol. 15, no. 3, pp. 337–346. CHIBA, M., FUKUSHIMA, T., HORIE, Y., IIZUKA, M. and MASAMUNE, O. 1998, ‘No Mycobacterium paratuberculosis detected in intestinal tissue, including Peyer’s patches and lymph follicles, of Crohn’s disease’, J. Gastroenterol., vol. 33, no. 4, pp. 482–487. CHIODINI, R. J. 1989, ‘Crohn’s disease and the mycobacterioses: a review and comparison of two disease entities’, Clin. Microbiol. Rev., vol. 2, no. 1, pp. 90–117. CHIODINI, R. J. and HERMON-TAYLOR, J. 1993, ‘The thermal resistance of Mycobacterium paratuberculosis in raw milk under conditions simulating pasteurization’, J. Vet. Diagn. Invest, vol. 5, no. 4, pp. 629–631. CHIODINI, R. J. and ROSSITER, C. A. 1996, ‘Paratuberculosis: a potential zoonosis?’, Vet. Clin. North Am. Food Anim Pract., vol. 12, no. 2, pp. 457–467. CHIODINI, R. J., VAN KRUININGEN, H. J., MERKAL, R. S., THAYER, W. R., JR., and COUTU, J. A. 1984, ‘Characteristics of an unclassified Mycobacterium species isolated from patients with Crohn’s disease’, J. Clin. Microbiol., vol. 20, no. 5, pp. 966–971. CHRISTOPHER-HENNINGS, J., DAMMEN, M. A., WEEKS, S. R., EPPERSON, W. B., SINGH, S. N., STEINLICHT, G. L., FANG, Y., SKAARE, J. L., LARSEN, J. L., PAYEUR, J. B. and NELSON, E. A. 2003, ‘Comparison of two DNA extractions and nested PCR, real-time PCR, a new commercial PCR assay, and bacterial culture for detection of Mycobacterium avium subsp. paratuberculosis in bovine feces’, J. Vet. Diagn. Invest, vol. 15, no. 2, pp. 87–93. CLARKSTON, W. K., PRESTI, M. E., PETERSEN, P. F., ZACHARY, P. E., JR., FAN, W. X., LEONARDI, C. L., VERNAVA, A. M., III, LONGO, W. E. and KREEGER, J. M. 1998, ‘Role of Mycobacterium paratuberculosis in Crohn’s disease: a prospective, controlled study using polymerase chain reaction’, Dis. Colon Rectum, vol. 41, no. 2, pp. 195–199. COHAVY, O., HARTH, G., HORWITZ, M., EGGENA, M., LANDERS, C., SUTTON, C., TARGAN, S. R. and BRAUN, J. 1999, ‘Identification of a novel mycobacterial histone H1 homologue (HupB) as an antigenic target of pANCA monoclonal antibody and serum immunoglobulin A from patients with Crohn’s disease’, Infection and Immunity, vol. 67, pp. 6510–6517. COLLINS, M. T. 2003, ‘Paratuberculosis: Review of present knowledge’, Acta Veterinaria Scandinavica, vol. 44, no. 3–4, pp. 217–221. COLLINS, M. T. 2004, ‘Update on paratuberculosis: 3. Control and zoonotic potential’, Irish Veterinary Journal, vol. 57, no. 1, pp. 49–52. COLLINS, M. T., SPAHR, U. and MURPHY, P. M. 2001, ‘Ecological characteristics of M. paratuberculosis’, Bulletin of the International Dairy Federation. 2001, vol. (362): pp. 32–40. COLOE, P., WILKES, C. R., LIGHTFOOT, D. and TOSOLINI, F. A. 1986, ‘Isolation of Mycobacterium paratuberculosis in Crohn’s disease’, Australian Microbiology, vol. 7, p. 188A. COOK, L. S. 2000, ‘A causal role for Mycobacterium avium subspecies paratuberculosis in Crohn’s disease?’, Can. J. Gastroenterol., vol. 14, no. 6, pp. 479–480. CORTI , S . and STEPHAN , R . 2002, ‘Detection of Mycobacterium avium subspecies paratuberculosis specific IS900 insertion sequences in bulk-tank milk samples obtained from different regions throughout Switzerland’, BMC Microbiol., vol. 2, no. 1, p. 15. COUSINS, D. V., WHITTINGTON, R., MARSH, I., MASTERS, A., EVANS, R. J. and KLUVER, P. 1999, ‘Mycobacteria distinct from Mycobacterium avium subsp. paratuberculosis isolated from the faeces of ruminants possess IS900-like sequences detectable IS900 polymerase chain reaction: implications for diagnosis’, Mol. Cell Probes, vol. 13, no. 6, pp. 431– 442. DARGATZ, D. A., BYRUM, B. A., COLLINS, M. T., GOYAL, S. M., HIETALA, S. K., JACOBSON, R. H., KOPRAL, C. A., MARTIN, B. M., MCCLUSKEY, B. J. and TEWARI, D. 2004, ‘A multilaboratory evaluation of a commercial enzyme-linked immunosorbent assay test for the detection of antibodies against Mycobacterium avium subsp paratuberculosis in cattle’, Journal of Veterinary Diagnostic Investigation, vol. 16, no. 6, pp. 509–514.

546

Emerging foodborne pathogens

DEL PRETE, R., QUARANTA, M., LIPPOLIS, A., GIANNUZZI, V., MOSCA, A., JIRILLO, E. and MIRAGLIOTTA, G. 1998, ‘Detection of Mycobacterium paratuberculosis in stool samples of patients with inflammatory bowel disease by IS900-based PCR and colorimetric detection of amplified DNA’, Journal of Microbiological Methods, vol. 33, pp. 105–114. DELL’ISOLA, B., POYART, C., GOULET, O., MOUGENOT, J. F., SADOUN-JOURNO, E., BROUSSE, N., SCHMITZ, J., RICOUR, C. and BERCHE, P. 1994, ‘Detection of Mycobacterium paratuberculosis by polymerase chain reaction in children with Crohn’s disease’, J. Infect. Dis., vol. 169, no. 2, pp. 449–451. DJONNE, B., JENSEN, M. R., GRANT, I. R. and HOLSTAD, G. 2003, ‘Detection by immunomagnetic PCR of Mycobacterium avium subsp. paratuberculosis in milk from dairy goats in Norway’, Vet. Microbiol., vol. 92, no. 1–2, pp. 135–143. DONAGHY, J. A., TOTTON, N. L. and ROWE, M. T. 2003, ‘Evaluation of culture media for the recovery of Mycobacterium avium subsp. paratuberculosis from Cheddar cheese’, Lett. Appl. Microbiol., vol. 37, no. 4, pp. 285–291. DONAGHY, J. A., TOTTON, N. L. and ROWE, M. T. 2004, ‘Persistence of Mycobacterium paratuberculosis during manufacture and ripening of cheddar cheese’, Appl. Environ. Microbiol., vol. 70, no. 8, pp. 4899–4905. DOYLE, T. M. 1954, ‘Isolation of Johne’s bacilli from the udders of clinically infected cows’, British Veterinary Journal, vol. 110, p. 218. DUMONCEAU, J. M., VAN GOSSUM, A., ADLER, M., FONTEYNE, P. A., VAN VOOREN, J. P., DEVIERE, J. and PORTAELS, F. 1996, ‘No Mycobacterium paratuberculosis found in Crohn’s disease using polymerase chain reaction’, Dig. Dis. Sci., vol. 41, no. 2, pp. 421–426. DUNDEE, L., GRANT, I. R., BALL, H. J. and ROWE, M. T. 2001, ‘Comparative evaluation of four decontamination protocols for the isolation of Mycobacterium avium subsp. paratuberculosis from milk’, Lett. Appl. Microbiol., vol. 33, no. 3, pp. 173–177. EL-ZAATARI, F. A. K., NASER, S. A., ENGSTRAND, L., HACHEM, C. Y. and GRAHAM D.Y. 1994, ‘Identification and characterization of Mycobacterium paratuberculosis recombinant proteins expressed in E. coli’, Current Microbiology, vol. 29, pp. 177–184. EL-ZAATARI, F. A. K., NASER, S. A. and GRAHAM D.Y. 1997, ‘Characterization of specific Mycobacterium paratuberculosis recombinant clone expressing 35,000-molecular weight antigen and reactivity with sera from animals with clinical and subclinical Johne’s disease’, Journal of Clinical Microbiology, vol. 35, pp. 1794–1799. EL-ZAATARI, F. A. K., NASER, S. A., HULTEN, K., BURCH, P. and GRAHAM D.Y. 1999, ‘Characterization of Mycobacterium paratuberculosis p36 antigen and its seroreactivities in Crohn’s disease’, Current Microbiology, vol. 39, pp. 115–119. ELLINGSON, J. L., STABEL, J. R., BISHAI, W. R., FROTHINGHAM, R. and MILLER, J. M. 2000, ‘Evaluation of the accuracy and reproducibility of a practical PCR panel assay for rapid detection and differentiation of Mycobacterium avium subspecies’, Mol. Cell Probes, vol. 14, no. 3, pp. 153–161. ELLINGSON, J. L. E., KOZICZKOWSKI, J. J. and ANDERSON, J. L. 2004, ‘Comparison of PCR prescreening to two cultivation procedures with PCR confirmation for detection of Mycobacterium avium subsp paratuberculosis in US Department of Agriculture fecal check test samples’, Journal of Food Protection, vol. 67, no. 10, pp. 2310–2314. ELSAGHIER, A., PRANTERA, C., MORENO, C. and IVANYI, J. 1992, ‘Antibodies to Mycobacterium paratuberculosis-specific protein antigens in Crohn’s disease’, Clin. Exp. Immunol., vol. 90, no. 3, pp. 503–508. ENGLUND, S. 2003, ‘IS900/ERIC-PCR as a tool to distinguish Mycobacterium avium subsp. paratuberculosis from closely related mycobacteria’, Vet. Microbiol., vol. 96, no. 3, pp. 277–287. ENGLUND, S., BOLSKE G., and JOHANSSON, K. E. 2002, ‘An IS900-like sequence found in a Mycobacterium sp. other than Mycobacterium avium subsp. paratuberculosis’, FEMS Microbiol. Lett., vol. 209, no. 2, pp. 267–271. ENOSAWA, M., KAGEYAMA, S., SAWAI, K., WATANABE, K., NOTOMI, T., ONOE, S., MORI, Y. and YOKOMIZO, Y. 2003, ‘Use of loop-mediated isothermal amplification of the IS900 sequence

Mycobacterium paratuberculosis

547

for rapid detection of cultured Mycobacterium avium subsp. paratuberculosis’, J. Clin. Microbiol., vol. 41, no. 9, pp. 4359–4365. ERASMUS, D. L., VICTOR, T. C., VAN EEDEN, P. J., FALCK, V. and VAN HELDEN, P. 1995, ‘Mycobacterium paratuberculosis and Crohn’s disease’, Gut, vol. 36, no. 6, p. 942. FANG, Y., WU, W. H., PEPPER, J. L., LARSEN, J. L., MARRAS, S. A., NELSON, E. A., EPPERSON, W. B. and CHRISTOPHER-HENNINGS, J. 2002, ‘Comparison of real-time, quantitative PCR with molecular beacons to nested PCR and culture methods for detection of Mycobacterium avium subsp. paratuberculosis in bovine fecal samples’, J. Clin. Microbiol., vol. 40, no. 1, pp. 287–291. FIDLER, H. M., THURRELL, W., JOHNSON, N. M., ROOK, G. A. and MCFADDEN, J. J. 1994, ‘Specific detection of Mycobacterium paratuberculosis DNA associated with granulomatous tissue in Crohn’s disease’, Gut, vol. 35, no. 4, pp. 506–510. FISCHER, O. A., MATLOVA, L., DVORSKA, L., SVASTOVA, P. and PAVLIK, I. 2003, ‘Nymphs of the Oriental cockroach (Blatta orientalis) as passive vectors of causal agents of avian tuberculosis and paratuberculosis’, Med. Vet. Entomol., vol. 17, no. 2, pp. 145–150. FISCHER, O. A., MATLOVA, L., DVORSKA, L., SVASTOVA, P., BARTL, J., WESTON, R. T. and PAVLIK, I. 2004a, ‘Blowflies Calliphora vicina and Lucilia sericata as passive vectors of Mycobacterium avium subsp. avium, M. a. paratuberculosis and M. a. hominissuis’, Med. Vet. Entomol., vol. 18, no. 2, pp. 116–122. FISCHER, O. A., MATLOVA, L., DVORSKA, L., SVASTOVA, P., PERAL, D. L., WESTON, R. T., BARTOS, M. and PAVLIK, I. 2004b, ‘Beetles as possible vectors of infections caused by Mycobacterium avium species’, Veterinary Microbiology, vol. 102, no. 3–4, pp. 247–255. FRANK, T. S. and COOK, S. M. 1996, ‘Analysis of paraffin sections of Crohn’s disease for Mycobacterium paratuberculosis using polymerase chain reaction’, Mod. Pathol., vol. 9, no. 1, pp. 32–35. GAN, H., OUYANG, Q. and BU, H. 1997, ‘Mycobacterium paratuberculosis in the intestine of patients with Crohn’s disease’, Zhonghua Nei Ke. Za Zhi., vol. 36, no. 4, pp. 228–230. GAO, A., MUTHARIA, L., CHEN, S., RAHN, K. and ODUMERU, J. 2002, ‘Effect of pasteurization on survival of Mycobacterium paratuberculosis in milk’, J. Dairy Sci., vol. 85, no. 12, pp. 3198–3205. GHADIALI, A. H., STROTHER, M., NASER, S. A., MANNING, E. J. B. and SREEVATSAN, S. 2004, ‘Mycobacterium avium subsp paratuberculosis strains isolated from Crohn’s disease patients and animal species exhibit similar polymorphic locus patterns’, Journal of Clinical Microbiology, vol. 42, no. 11, pp. 5345–5348. GIRARDIN, S. E., HUGOT, J. P. and SANSONETTI, P. J. 2003, ‘Lessons from Nod2 studies: towards a link between Crohn’s disease and bacterial sensing’, Trends in Immunology, vol. 24, pp. 652–658. GITNICK, G., COLLINS, J., BEAMAN, B., BROOKS, D., ARTHUR, M., IMAEDA, T. and PALIESCHESKY, M. 1989, ‘Preliminary report on isolation of mycobacteria from patients with Crohn’s disease’, Dig. Dis. Sci., vol. 34, no. 6, pp. 925–932. GRANT, I. R. 2003, ‘Mycobacterium paratuberculosis and milk’, Acta Vet. Scand., vol. 44, no. 3–4, pp. 261–266. GRANT, I. R. and ROWE, M. T. 2001, ‘Methods for detection and enumeration of viable Mycobacterium paratuberculosis from milk and milk products’, Bulletin of the International Dairy Federation. 2001, vol. (362): pp. 41–52. GRANT, I. R. and ROWE, M. T. 2004, ‘Effect of chemical decontamination and refrigerated storage on the isolation of Mycobacterium avium subsp. paratuberculosis from heattreated milk’, Lett. Appl. Microbiol., vol. 38, no. 4, pp. 283–288. GRANT, I. R., BALL, H. J., NEILL, S. D. and ROWE, M. T. 1996, ‘Inactivation of Mycobacterium paratuberculosis in cows’ milk at pasteurization temperatures’, Appl. Environ. Microbiol., vol. 62, no. 2, pp. 631–636. GRANT, I. R., BALL, H. J. and ROWE, M. T. 1998a, ‘Effect of high-temperature, short-time (HTST) pasteurization on milk containing low numbers of Mycobacterium paratuberculosis’, Lett. Appl. Microbiol., vol. 26, no. 2, pp. 166–170.

548

Emerging foodborne pathogens

GRANT, I. R., BALL, H. J., and ROWE, M. T. 1998b, ‘Isolation of Mycobacterium paratuberculosis

from milk by immunomagnetic separation”, Appl. Environ. Microbiol., vol. 64, no. 9, pp. 3153–3158. GRANT, I. R., BALL, H. J. and ROWE, M. T. 1999, ‘Effect of higher pasteurization temperatures, and longer holding times at 72 ∞C, on the inactivation of Mycobacterium paratuberculosis in milk’, Lett. Appl. Microbiol., vol. 28, no. 6, pp. 461–465. GRANT, I. R., POPE, C. M., O’RIORDAN, L. M., BALL, H. J. and ROWE, M. T. 2000, ‘Improved detection of Mycobacterium avium subsp. paratuberculosis in milk by immunomagnetic PCR’, Vet. Microbiol., vol. 77, no. 3–4, pp. 369–378. GRANT, I. R., O’RIORDAN, L. M., BALL, H. J. and ROWE, M. T. 2001, ‘Incidence of Mycobacterium paratuberculosis in raw sheep and goats’ milk in England, Wales and Northern Ireland’, Vet. Microbiol., vol. 79, no. 2, pp. 123–131. GRANT, I. R., BALL, H. J. and ROWE, M. T. 2002a, ‘Incidence of Mycobacterium paratuberculosis in bulk raw and commercially pasteurized cows’ milk from approved dairy processing establishments in the United Kingdom’, Appl. Environ. Microbiol., vol. 68, no. 5, pp. 2428–2435. GRANT, I. R., HITCHINGS, E. I., MCCARTNEY, A., FERGUSON, F. and ROWE, M. T. 2002b, ‘Effect of commercial-scale high-temperature, short-time pasteurization on the viability of Mycobacterium paratuberculosis in naturally infected cows’ milk’, Appl. Environ. Microbiol., vol. 68, no. 2, pp. 602–607. GRANT, I. R., KIRK, R. B., HITCHINGS, E. and ROWE, M. T. 2003, ‘Comparative evaluation of the MGIT and BACTEC culture systems for the recovery of Mycobacterium avium subsp. paratuberculosis from milk’, J. Appl. Microbiol., vol. 95, no. 1, pp. 196–201. GREEN, J. P. Draft guidance on control of Johne’s disease in dairy herds. DEFRA UK . 61-2002. 5-3-2005. GREENSTEIN, R. J. 2003, ‘Is Crohn’s disease caused by a mycobacterium? Comparisons with leprosy, tuberculosis, and Johne’s disease’, Lancet Infect. Dis., vol. 3, no. 8, pp. 507–514. GREENSTEIN, R. J. and COLLINS, M. T. 2004, ‘Emerging pathogens: is Mycobacterium avium subspecies paratuberculosis zoonotic?’, Lancet, vol. 364, no. 9432, pp. 396–397. GRIFFITHS, M. W. 2002, ‘Mycobacterium paratuberculosis,’ in Foodborne Pathogens: Hazards, Risk Analysis and Control, C. d. W. Blackburn and P. J. McClure, eds., Woodhead Publishing Ltd., Cambridge, England, pp. 489–500. GROENENDAAL, H . and GALLIGAN , D . T . 2003, ‘Food Animal Economics – Economic consequences of control programs for paratuberculosis in midsize dairy farms in the United States’, Journal of the American Veterinary Medical Association, vol. 223, no. 12, pp. 1757–1763. HAAGSMA , J ., MULDER , C . J . J ., EGER, A . and TYTGAT, G . N . J . 1991, ‘Mycobacterium paratuberculosis isole chez des patients atteints de maladie de Crohn. Resultats preliminaires.’, Acta Endoscopica, vol. 21, pp. 255–260. HALLDORSDOTTIR , S ., ENGLUND , S ., NILSEN , S. F . and OLSAKER , I. 2002, ‘Detection of Mycobacterium avium subsp. paratuberculosis by buoyant density centrifugation, sequence capture PCR and dot blot hybridisation’, Vet. Microbiol., vol. 87, no. 4, pp. 327–340. HARRIS, N. B. and BARLETTA, R. G. 2001, ‘Mycobacterium avium subsp. paratuberculosis in Veterinary Medicine’, Clin. Microbiol. Rev., vol. 14, no. 3, pp. 489–512. HENDRICK, S. H., DUFFIELD, T. F., KELTON, D. F., LESLIE, K. E., LISSEMORE, K. D. and ARCHAMBAULT, M. 2005, ‘Evaluation of enzyme-linked immunosorbent assays performed on milk and serum samples for detection of paratuberculosis in lactating dairy cows’, JavmaJournal of the American Veterinary Medical Association, vol. 226, no. 3, pp. 424–428. HENDRICKSON, B. A., GOKHALE, R. and CHO, J. H. 2002, ‘Clinical aspects and pathophysiology of Inflammatory Bowel Disease’, Clinical Microbiology Reviews, vol. 15, pp. 79–94. HERMON-TAYLOR, J. 1998, ‘The causation of Crohn’s disease and treatment with antimicrobial drugs’, Ital. J. Gastroenterol. Hepatol., vol. 30, no. 6, pp. 607–610.

Mycobacterium paratuberculosis HERMON-TAYLOR, J.

549

2001, ‘Protagonist. Mycobacterium avium subspecies paratuberculosis is a cause of Crohn’s disease’, Gut, vol. 49, no. 6, pp. 755–756. HERMON-TAYLOR, J. 2002, ‘Treatment with drugs active against Mycobacterium avium subspecies paratuberculosis can heal Crohn’s disease: more evidence for a neglected public health tragedy’, Dig. Liver Dis., vol. 34, no. 1, pp. 9–12. HERMON-TAYLOR, J. and BULL, T. 2002, ‘Crohn’s disease caused by Mycobacterium avium subspecies paratuberculosis: a public health tragedy whose resolution is long overdue’, J. Med. Microbiol., vol. 51, no. 1, pp. 3–6. HERMON-TAYLOR, J., BULL, T. J., SHERIDAN, J. M., CHENG, J., STELLAKIS, M. L. and SUMAR, N. 2000, ‘Causation of Crohn’s disease by Mycobacterium avium subspecies paratuberculosis’, Can. J. Gastroenterol., vol. 14, no. 6, pp. 521–539. HOPE, A. F., TULK, P. A. and CONDRON, R. J. 1997, ‘Commercial pasteurization of Mycobacterium paratuberculosis in whole milk’, R. J. Chiodini, M. E. Hines, and M. T. Collins, eds, International Association for Paratuberculosis, Madison, WI., pp. 377–382. HUGOT, J. P., ALBERTI, C., BERREBI, D., BINGEN, E. and CEZARD, J. P. 2003, ‘Crohn’s disease: the cold chain hypothesis’, Lancet, vol. 362, no. 9400, pp. 2012–2015. HULTEN, K., EL ZIMAITY, H. M., KARTTUNEN, T. J., ALMASHHRAWI, A., SCHWARTZ, M. R., GRAHAM, D. Y. and EL ZAATARI, F. A. 2001, ‘Detection of Mycobacterium avium subspecies paratuberculosis in Crohn’s diseased tissues by in situ hybridization’, Am. J. Gastroenterol., vol. 96, no. 5, pp. 1529–1535. JUSTE, R. A., MARCO, J. C., SAEZ, D. O. and ADURIZ, J. J. 1991, ‘Comparison of different media for the isolation of small ruminant strains of Mycobacterium paratuberculosis’, Vet. Microbiol., vol. 28, no. 4, pp. 385–390. KALLINOWSKI, F., WASSMER, A., HOFMANN, M. A., HARMSEN, D., HEESEMANN, J., KARCH, H., HERFARTH, C. and BUHR, H. J. 1998, ‘Prevalence of enteropathogenic bacteria in surgically treated chronic inflammatory bowel disease’, Hepatogastroenterology, vol. 45, no. 23, pp. 1552–1558. KANAZAWA, K., HAGA, Y., FUNAKOSHI, O., NAKAJIMA, H., MUNAKATA, A. and YOSHIDA, Y. 1999, ‘Absence of Mycobacterium paratuberculosis DNA in intestinal tissues from Crohn’s disease by nested polymerase chain reaction’, J. Gastroenterol., vol. 34, no. 2, pp. 200–206. KENNEDY , D . J . and BENEDICTUS , G . 2001, ‘Control of Mycobacterium avium subsp. paratuberculosis infection in agricultural species’, Rev. Sci. Tech., vol. 20, no. 1, pp. 151–179. KENNEDY, D., HOLMSTROM, A., PLYM-FORSHELL, K., VINDEL, E. and SUAREZ-FERNANDEZ, G. 2001, ‘On-farm manangement of paratuberculosis (Johne’s disease) in dairy herds’, Bulletin of the International Dairy Federation. 2001, vol. (362): pp. 18–31. KESWANI, J. and FRANK, J. F. 1998, ‘Thermal inactivation of Mycobacterium paratuberculosis in milk’, J. Food Prot., vol. 61, no. 8, pp. 974–978. KHARE, S., FICHT, T. A., SANTOS, R. L., ROMANO, J., FICHT, A. R., ZHANG, S., GRANT, I. R., LIBAL, M., HUNTER, D. and ADAMS, L. G. 2004, ‘Rapid and sensitive detection of Mycobacterium avium subsp. paratuberculosis in bovine milk and feces by a combination of immunomagnetic bead separation-conventional PCR and real-time PCR’, J. Clin. Microbiol., vol. 42, no. 3, pp. 1075-1081. KIM, S. G., SHIN, S. J., JACOBSON, R. H., MILLER, L. J., HARPENDING, P. R., STEHMAN, S. M., ROSSITER, C. A. and LEIN, D. A. 2002, ‘Development and application of quantitative polymerase chain reaction assay based on the ABI 7700 system (TaqMan) for detection and quantification of Mycobacterium avium subsp. paratuberculosis’, J. Vet. Diagn. Invest, vol. 14, no. 2, pp. 126–131. KIM, S. G., KIM, E. H., LAFFERTY, C. J., MILLER, L. J., KOO, H. J., STEHMAN, S. M. and SHIN, S. J. 2004, ‘Use of conventional and real-time polymerase chain reaction for confirmation of Mycobacterium avium subsp paratuberculosis in a broth-based culture system ESP II’, Journal of Veterinary Diagnostic Investigation, vol. 16, no. 5, pp. 448–453. KLIJN, N., HERREWEGH, A. A. and DE JONG, P. 2001, ‘Heat inactivation data for Mycobacterium

550

Emerging foodborne pathogens

avium subsp. paratuberculosis: implications for interpretation’, J. Appl. Microbiol., vol. 91, no. 4, pp. 697–704. KOBAYASHI, K., BLASER, M. J. and BROWN, W. R. 1989, ‘Immunohistochemical examination for mycobacteria in intestinal tissues from patients with Crohn’s disease’, Gastroenterology, vol. 96, no. 4, pp. 1009–1015. KORNBLUTH, A., SALOMON, P. and SUCHAR, D. B. 1993, ‘Crohn’s disease,’ in Gastroenterological Disease, 5 edn, M. H. Sleisenger and J. S. Fordtran, eds, W.B. Saunders, Philadelphia, PA, pp. 1270–1304. KORZENIK, J. R. 2005, ‘Past and current theories of etiology of IBD – Toothpaste, worms, and refrigerators’, Journal of Clinical Gastroenterology, vol. 39, no. 4, p. S59–S65. LANGELAAR, M., KOETS, A., MULLER, K., VAN EDEN, W., NOORDHUIZEN, J., HOWARD, C., HOPE, J. and RUTTEN, V. 2002, ‘Mycobacterium paratuberculosis heat shock protein 70 as a tool in control of paratuberculosis’, Vet. Immunol. Immunopathol., vol. 87, no. 3–4, pp. 239–244. LANGELAAR, M. F. M., HOPE, J. C., RUTTEN, V. P. M. G., NOORDHUIZEN, J. P. T. M., VAN EDEN, W. and KOETS, A. P. 2005, ‘Mycobacterium avium ssp. paratuberculosis recombinant heat shock protein 70 interaction with different bovine antigen-presenting cells’, Scandinavian Journal of Immunology, vol. 61, no. 3, pp. 242–250. LISBY, G., ANDERSEN, J., ENGBAEK, K. and BINDER, V. 1994, ‘Mycobacterium paratuberculosis in intestinal tissue from patients with Crohn’s disease demonstrated by a nested primer polymerase chain reaction’, Scand. J. Gastroenterol., vol. 29, no. 10, pp. 923–929. LUND, B. M., GOULD, G. W. and RAMPLING, A. M. 2002a, ‘Pasteurization of milk and the heat resistance of Mycobacterium avium subsp. paratuberculosis: a critical review of the data’, Int. J. Food Microbiol., vol. 77, no. 1–2, pp. 135–145. LUND, B. M., GOULD, G. W. and RAMPLING, A. M. 2002b, ‘Pasteurization of milk and the heat resistance of Mycobacterium avium subsp. paratuberculosis: a critical review of the data’, Int. J. Food Microbiol., vol. 77, no. 1–2, pp. 135–145. MACHACKOVA, M., SVASTOVA, P., LAMKA, J., PARMOVA, I., LISKA, V., SMOLIK, J., FISCHER, O. A. and PAVLIK, I. 2004, ‘Paratuberculosis in farmed and free-living wild ruminants in the Czech Republic (1999–2001)’, Veterinary Microbiology, vol. 101, no. 4, pp. 225–234. MANNING, E. J. 2001, ‘Mycobacterium avium subspecies paratuberculosis: a review of current knowledge’, J. Zoo. Wildl. Med., vol. 32, no. 3, pp. 293–304. MANNING, E. J. and COLLINS, M. T. 2001, ‘Mycobacterium avium subsp. paratuberculosis: pathogen, pathogenesis and diagnosis’, Rev. Sci. Tech., vol. 20, no. 1, pp. 133–150. MCDONALD, W. L., O’RILEY, K. J., SCHROEN, C. J. and CONDRON, R. J. 2005, ‘Heat inactivation of Mycobacterium avium subsp. paratuberculosis in milk’, Applied and Environmental Microbiology, vol. 71, no. 4, pp. 1785–1789. MCKENNA, S. L. B., KEEFE, G. P., BARKEMA, H. W., MCCLURE, J., VANLEEUWEN, J. A., HANNA, P. and SOCKETT, D. C. 2004, ‘Cow-level prevalence of paratuberculosis in culled dairy cows in Atlantic Canada and Maine’, Journal of Dairy Science, vol. 87, no. 11, pp. 3770– 3777. MERKAL, R. S., WHIPPLE, D. L., SACKS, J. M. and SNYDER, G. R. 1987, ‘Prevalence of Mycobacterium paratuberculosis in ileocecal lymph nodes of cattle culled in the United States’, J. Am. Vet. Med. Assoc., vol. 190, no. 6, pp. 676–680. MILLAR, D., FORD, J., SANDERSON, J., WITHEY, S., TIZARD, M., DORAN, T. and HERMON-TAYLOR, J. 1996, ‘IS900 PCR to detect Mycobacterium paratuberculosis in retail supplies of whole pasteurized cows’ milk in England and Wales’, Appl. Environ. Microbiol., vol. 62, no. 9, pp. 3446–3452. MISHINA, D., KATSEL, P., BROWN, S. T., GILBERTS, E. C. and GREENSTEIN, R. J. 1996, ‘On the etiology of Crohn disease’, Proc. Natl. Acad. Sci. U.S.A., vol. 93, no. 18, pp. 9816– 9820. MOSS, M. T., SANDERSON, J. D., TIZARD, M. L., HERMON-TAYLOR, J., EL ZAATARI, F. A., MARKESICH, D. C. and GRAHAM, D. Y. 1992, ‘Polymerase chain reaction detection of Mycobacterium paratuberculosis and Mycobacterium avium subsp. silvaticum in long term cultures from Crohn’s disease and control tissues’, Gut, vol. 33, no. 9, pp. 1209–1213.

Mycobacterium paratuberculosis MOTIWALA, A. S., AMONSIN, A., STROTHER, M., MANNING, E. J. B., KAPUR, V.

551

and SREEVATSAN, S. 2004, ‘Molecular epidemiology of Mycobacterium avium subsp. paratuberculosis isolates recovered from wild animal species’, Journal of Clinical Microbiology, vol. 42, no. 4, pp. 1703–1712. MULLERAD, J., MICHAL, I., FISHMAN, Y., HOVAV, A. H., BARLETTA, R. G. and BERCOVIER, H. 2002, ‘The immunogenicity of Mycobacterium paratuberculosis 85B antigen”, Med. Microbiol. Immunol. (Berl), vol. 190, no. 4, pp. 179–187. MURRAY , A ., OLIARO , J ., SCHLUP, M . M ., and CHADWICK , V . S. 1995, ‘Mycobacterium paratuberculosis and inflammatory bowel disease: frequency distribution in serial colonoscopic biopsies using the polymerase chain reaction’, Microbios, vol. 83, no. 337, pp. 217–228. MUSKENS, J., VAN ZIJDERVELD, F., EGER, A., and BAKKER, D. 2002, ‘Evaluation of the long-term immune response in cattle after vaccination against paratuberculosis in two Dutch dairy herds’, Vet. Microbiol., vol. 86, no. 3, pp. 269–278. NASER, S. A., HULTEN, K., SHAFRAN, I., GRAHAM D.Y. and EL-ZAATARI, F. A. K. 1999, ‘Specific seroreactivity of Crohn’s disease patients against p35 and p36 antigens of M. avium subsp. paratuberculosis’, Melbourne, Australia, pp. 525–530. NASER, S. A., SCHWARTZ, D. and SHAFRAN, I. 2000, ‘Isolation of Mycobacterium avium subsp. paratuberculosis from breast milk of Crohn’s disease patients’, Am. J. Gastroenterol., vol. 95, no. 4, pp. 1094–1095. NASER, S. A., GHOBRIAL, G., ROMERO, C. and VALENTINE, J. F. 2004, ‘Culture of Mycobacterium avium subspecies paratuberculosis from the blood of patients with Crohn’s disease’, Lancet, vol. 364, no. 9439, pp. 1039–1044. NAUTA, M. J. and VAN DER GIESSEN, J. W. 1998, ‘Human exposure to Mycobacterium paratuberculosis via pasteurised milk: a modelling approach’, Vet. Rec., vol. 143, no. 11, pp. 293–296. NIELSEN, S. S., THAMSBORG, S. M., HOUE, H. and BITSCH, V. 2000, ‘Bulk-tank milk ELISA antibodies for estimating the prevalence of paratuberculosis in Danish dairy herds’, Prev. Vet. Med., vol. 44, no. 1–2, pp. 1–7. NIELSEN, S. S., NIELSEN, K. K., HUDA, A., CONDRON, R. and COLLINS, M. T. 2001, ‘Diagnostic techniques for paratuberculosis’, Bulletin of the International Dairy Federation. 2001, vol. (362): pp. 5–17. O’MAHONY, J. and HILL, C. 2002, ‘A real time PCR assay for the detection and quantitation of Mycobacterium avium subsp. paratuberculosis using SYBR Green and the Light Cycler’, J. Microbiol. Methods, vol. 51, no. 3, pp. 283–293. O’MAHONY, J. and HILL, C. 2004, ‘Rapid real-time PCR assay for detection and quantitation of Mycobacterium avium subsp. paratuberculosis DNA in artificially contaminated milk’, Appl. Environ. Microbiol., vol. 70, no. 8, pp. 4561–4568. O’REILLY, C. E., O’CONNOR, L., ANDERSON, W., HARVEY, P., GRANT, I. R., DONAGHY, J., ROWE, M. and O’MAHONY, P. 2004, ‘Surveillance of bulk raw and commercially pasteurized cows’ milk from approved Irish liquid-milk pasteurization plants to determine the incidence of Mycobacterium paratuberculosis’, Appl. Environ. Microbiol., vol. 70, no. 9, pp. 5138–5144. ODUMERU, J., GAO, A., CHEN, S., RAYMOND, M. and MUTHARIA, L. 2001, ‘Use of the bead beater for preparation of Mycobacterium paratuberculosis template DNA in milk’, Can. J. Vet. Res., vol. 65, no. 4, pp. 201–205. OLSEN, I., SIGURGARDOTTIR, G. and DJONNE, B. 2002, ‘Paratuberculosis with special reference to cattle. A review’, Vet. Q., vol. 24, no. 1, pp. 12–28. OVERDUIN, P., SCHOULS, L., ROHOLL, P., VAN DER ZANDEN, A., MAHMMOD, N., HERREWEGH, A. and VAN SOOLINGEN, D. 2004, ‘Use of multilocus variable-number tandem-repeat analysis for typing Mycobacterium avium subsp. paratuberculosis’, Journal of Clinical Microbiology, vol. 42, no. 11, pp. 5022–5028. PAUSTIAN, M. L., AMONSIN, A., KAPUR, V. and BANNANTINE, J. P. 2004, ‘Characterization of novel coding sequences specific to Mycobacterium avium subsp. paratuberculosis:

552

Emerging foodborne pathogens

implications for diagnosis of Johne’s Disease’, J. Clin. Microbiol., vol. 42, no. 6, pp. 2675–2681. PAUSTIAN, M. L., KAPUR, V. and BANNANTINE, J. P. 2005, ‘Comparative genomic hybridizations reveal genetic regions within the Mycobacterium avium complex that are divergent from Mycobacterium avium subsp. paratuberculosis isolates’, Journal of Bacteriology, vol. 187, no. 7, pp. 2406–2415. PAVLAS, M. 2005, ‘New findings of pathogenesis, diagnostics and control of paratuberculosis in cattle’, Acta Veterinaria Brno, vol. 74, no. 1, pp. 73–79. PAVLIK, I., BEJCKOVA, L. and FIXA, B. 1994, ‘DNA fingerprinting as a tool for epidemiological studies of paratuberculosis in ruminants and Crohn’s disease’, in Proceedings of the Fourth International Colloquium on Paratuberculosis, Cambridge, U.K. July 17-21, 1994, R. J. Chiodini, M. R. Collins, and E. Bassey, eds., International Association for Paratuberculosis, Inc., Rehoboth, MA, p. 34. PEARCE, L. E., TRUONG, H. T., CRAWFORD, R. A., YATES, G. F., CAVAIGNAC, S. and DE LISLE, G. W. 2001, ‘Effect of turbulent-flow pasteurization on survival of Mycobacterium avium subsp. paratuberculosis added to raw milk’, Appl. Environ. Microbiol., vol. 67, no. 9, pp. 3964–3969. PICKUP, R. W., RHODES, G., ARNOTT, S., SIDI-BOUMEDINE, K., BULL, T. J., WEIGHTMAN, A., HURLEY, M. and HERMON-TAYLOR, J. 2005, ‘Mycobacterium avium subsp. paratuberculosis in the catchment area and water of the river Taff in South Wales, United Kingdom, and its potential relationship to clustering of Crohn’s disease cases in the city of Cardiff’, Applied and Environmental Microbiology, vol. 71, no. 4, pp. 2130–2139. PILLAI, S. R., JAYARAO, B. M., GUMMO, J. D., HUE, E. C., TIWARI, D., STABEL, J. R. and WHITLOCK, R . H . 2001, ‘Identification and sub-typing of Mycobacterium avium subsp. paratuberculosis and Mycobacterium avium subsp. avium by randomly amplified polymorphic DNA’, Vet. Microbiol., vol. 79, no. 3, pp. 275–284. PRANTERA, C., BOTHAMLEY, G., LEVENSTEIN, S., MANGIAROTTI, R. and ARGENTIERI, R. 1989, ‘Crohn’s disease and mycobacteria: two cases of Crohn’s disease with high antimycobacterial antibody levels cured by dapsone therapy’, Biomed. Pharmacother., vol. 43, no. 4, pp. 295–299. PRANTERA, C., KOHN, A., MANGIAROTTI, R., ANDREOLI, A. and LUZI, C. 1994, ‘Antimycobacterial therapy in Crohn’s disease: results of a controlled double blind trial with a multiple antibiotic regimen’, American Journal of Gastroenterology, vol. 89, pp. 513–518. PRANTERA, C., ZANNONI, F., SCRIBANO, M. I., BERTO, E., ANDREOLI, A., KOHN, A. and LUZI, C. 1996, ‘An antibiotic regimen for the treatment of active Crohn’s disease: a randomized, controlled trial of metronidazole and ciprofloxacin’, American Journal of Gastroenterology, vol. 91, pp. 328–332. QUIRKE, P. 2001, ‘Antagonist. Mycobacterium avium subspecies paratuberculosis is a cause of Crohn’s disease’, Gut, vol. 49, no. 6, pp. 757–760. RAIZMAN, E. A., WELLS, S. J., GODDEN, S. M., BEY, R. F., OAKES, M. J., BENTLEY, D. C. and OLSEN, K. E. 2004, ‘The distribution of Mycobacterium avium ssp. paratuberculosis in the environment surrounding Minnesota dairy farms’, J. Dairy Sci., vol. 87, no. 9, pp. 2959–2966. RAIZMAN, E. A., WELLS, S. J., JORDAN, P. A., DELGIUDICE, G. D. and BEY, R. R. 2005, ‘Mycobacterium avium subsp. paratuberculosis from free-ranging deer and rabbits surrounding Minnesota dairy herds’, Canadian Journal of Veterinary Research-Revue Canadienne de Recherche Veterinaire, vol. 69, no. 1, pp. 32–38. RAJEEV, S., ZHANG, Y., SREEVATSAN, S., MOTIWALA, A. S. and BYRUM, B. 2005, ‘Evaluation of multiple genomic targets for identification and confirmation of Mycobacterium avium subsp. paratuberculosis isolates using real-time PCR’, Veterinary Microbiology, vol. 105, no. 3–4, pp. 215–221. RICHTER , E ., WESSLING , J ., LUGERING , N ., DOMSCHKE , W . and RUSCH - GERDES , S . 2002, ‘Mycobacterium avium subsp. paratuberculosis infection in a patient with HIV, Germany’, Emerg. Infect. Dis., vol. 8, no. 7, pp. 729–731.

Mycobacterium paratuberculosis RIDGE, S. E., BAKER, I. M.

553

and HANNAH, M. 2005, ‘Effect of compliance with recommended calf-rearing practices on control of bovine Johne’s disease’, Australian Veterinary Journal, vol. 83, no. 1–2, pp. 85–90. RODRIGUEZ-LAZARO, D., LLOYD, J., HERREWEGH, A., IKONOMOPOULOS, J., D’AGOSTINO, M., PLA, M. and COOK, N. 2004, ‘A molecular beacon-based real-time NASBA assay for detection of Mycobacterium avium subsp. paratuberculosis in water and milk’, Fems Microbiology Letters, vol. 237, no. 1, pp. 119–126. ROHOLL, P. J., HERREWEGH, A. and VAN SOOLINGEN, D. 2002, ‘Positive IS900 in situ hybridization signals as evidence for role of Mycobacterium avium subsp. paratuberculosis in etiology of Crohn’s disease’, J. Clin. Microbiol., vol. 40, no. 8, pp. 3112–3113. ROMERO, C., HAMDI, A., VALENTINE, J. F. and NASER, S. A. 2005, ‘Evaluation of surgical tissue from patients with Crohn’s disease for the presence of Mycobacterium avium subspecies paratuberculosis DNA by in situ hybridization and nested polymerase chain reaction’, Inflammatory Bowel Diseases, vol. 11, no. 2, pp. 116–125. ROUSSEL, A. J., LIBAL, M. C., WHITLOCK, R. L., HAIRGROVE, T. B., BARLING, K. S. and THOMPSON, J. A. 2005, ‘Prevalence of and risk factors for paratuberculosis in purebred beef cattle’, Javma-Journal of the American Veterinary Medical Association, vol. 226, no. 5, pp. 773–778. ROWAN, N. J., MACGREGOR, S. J., ANDERSON, J. G., CAMERON, D. and FARISH, O. 2001, ‘Inactivation of Mycobacterium paratuberculosis by pulsed electric fields’, Appl. Environ. Microbiol., vol. 67, no. 6, pp. 2833–2836. ROWBOTHAM, D. S., MAPSTONE, N. P., TREJDOSIEWICZ, L. K., HOWDLE, P. D. and QUIRKE, P. 1995, ‘Mycobacterium paratuberculosis DNA not detected in Crohn’s disease tissue by fluorescent polymerase chain reaction’, Gut, vol. 37, no. 5, pp. 660–667. ROWE, M. T., GRANT, I. R., DUNDEE, L. and BALL, H. J. 2000, ‘Heat resistance of Mycobacterium avium subsp. paratuberculosis in milk’, Irish Journal of Agricultural and Food Research. 2000, vol. 39(2): pp. 203–208. RYAN, P., KELLY, R. G., LEE, G., COLLINS, J. K., O’SULLIVAN, G. C., O’CONNELL, J. and SHANAHAN, F. 2004, ‘Bacterial DNA within granulomas of patients with Crohn’s disease – Detection by laser capture microdissection and PCR’, American Journal of Gastroenterology, vol. 99, no. 8, pp. 1539–1543. SANDBORN, W. J. 2005, ‘New concepts in anti-tumor necrosis factor therapy for inflammatory bowel disease’, Reviews in Gastroenterological Disorders, vol. 5, no. 1, pp. 10–18. SANDERSON, J. D., MOSS, M. T., TIZARD, M. L. and HERMON-TAYLOR, J. 1992, ‘Mycobacterium paratuberculosis DNA in Crohn’s disease tissue’, Gut, vol. 33, no. 7, pp. 890–896. SCHMID, M., FELLERMANN, K., WEHKAMP, J., HERRLINGER, K. and STANGE, E. F. 2004, ‘The role of defensins in the pathogenesis of inflammatory bowel disease’, Zeitschrift fur Gastroenterologie, vol. 42, no. 4, pp. 333–338. SCIENTIFIC COMMITTEE ON ANIMAL HEALTH and ANIMAL WELFARE 2000, Possible links between Crohn’s disease and Paratuberculosis, European Commission, Brussels, SANCO/B3/ R16/2000. SECHI, L. A., MURA, M., TANDA, F., LISSIA, A., SOLINAS, A., FADDA, G., ZANETTI, S., MANUELA, M., FRANCESCO, T., AMELIA, L., ANTONELLO, S., GIOVANNI, F. and STEFANIA, Z. 2001, ‘Identification of Mycobacterium avium subsp. paratuberculosis in biopsy specimens from patients with Crohn’s disease identified by in situ hybridization’, J.Clin.Microbiol., vol. 39, no. 12, pp. 4514–4517. SECHI, L. A., MURA, M., TANDA, E., LISSIA, A., FADDA, G. and ZANETTI, S. 2004, ‘Mycobacterium avium sub. paratuberculosis in tissue samples of Crohn’s disease patients’, New Microbiol., vol. 27, no. 1, pp. 75–77. SECOTT, T. E., OHME, A. M., BARTON, K. S., WU, C. C. and ROMMEL, F. A. 1999, ‘Mycobacterium paratuberculosis detection in bovine feces is improved by coupling agar culture enrichment to an IS900-specific polymerase chain reaction assay’, J. Vet. Diagn. Invest, vol. 11, no. 5, pp. 441–447. SECOTT, T. E., LIN, T. L. and WU, C. C. 2002, ‘Fibronectin attachment protein is necessary for

554

Emerging foodborne pathogens

efficient attachment and invasion of epithelial cells by Mycobacterium avium subsp. paratuberculosis’, Infect. Immun., vol. 70, no. 5, pp. 2670–2675. SECOTT, T. E., LIN, T. L. and WU, C. C. 2004, ‘Mycobacterium avium subsp. paratuberculosis fibronectin attachment protein facilitates M-cell targeting and invasion through a fibronectin bridge with host integrins’, Infect. Immun., vol. 72, no. 7, pp. 3724–3732. SELBY, W. 2000, ‘Pathogenesis and therapeutic aspects of Crohn’s disease’, Vet. Microbiol., vol. 77, no. 3-4, pp. 505–511. SELBY, W. S. 2004, ‘Mycobacterium avium subspecies paratuberculosis bacteraemia in patients with inflammatory bowel disease’, Lancet, vol. 364, no. 9439, pp. 1013– 1014. SHAFRAN, I., KUGLER, L., EL ZAATARI, F. A., NASER, S. A. and SANDOVAL, J. 2002a, ‘Open clinical trial of rifabutin and clarithromycin therapy in Crohn’s disease’, Dig. Liver Dis., vol. 34, no. 1, pp. 22–28. SHAFRAN, I., PIROMALLI, C., DECKER, J. W., SANDOVAL, J., NASER, S. A. and EL ZAATARI, F. A. 2002b, ‘Seroreactivities against Saccharomyces cerevisiae and Mycobacterium avium subsp. paratuberculosis p35 and p36 antigens in Crohn’s disease patients’, Dig. Dis. Sci., vol. 47, no. 9, pp. 2079–2081. SHIN, S. J., CHANG, Y. F., HUANG, C., ZHU, J., HUANG, L., YOO, H. S., SHIN, K. S., STEHMAN, S., SHIN, S. J. and TORRES, A. 2004, ‘Development of a polymerase chain reaction test to confirm Mycobacterium avium subsp. paratuberculosis in culture’, J. Vet. Diagn. Invest, vol. 16, no. 2, pp. 116–120. SMITH, H. W. 1960, ‘The examination of milk for the presence of Mycobacterium johnei’, Journal of Pathology and Bacteriology, vol. 80, pp. 440–442. SMITH, W. L., MCGARVEY, K. L. and CULLOR, J. S. 2003, ‘The use of spiral plating and microscopic colony counting for the rapid quantitation of Mycobacterium paratuberculosis’, Lett. Appl. Microbiol., vol. 36, no. 5, pp. 293–296. SORENSEN, O., RAWLUK, S., WU, J., MANNINEN, K. and OLLIS, G. 2003, ‘Mycobacterium paratuberculosis in dairy herds in Alberta’, Can.Vet. J., vol. 44, no. 3, pp. 221–226. SPAHR, U. and SCHAFROTH, K. 2001, ‘Fate of Mycobacterium avium subsp. paratuberculosis in Swiss hard and semihard cheese manufactured from raw milk’, Appl. Environ. Microbiol., vol. 67, no. 9, pp. 4199–4205. ST AMAND, A. L., FRANK, D. N., DE GROOTE, M. A. and PACE, N. R. 2005, ‘Use of specific rRNA oligonucleotide probes for microscopic detection of Mycobacterium avium complex organisms in tissue’, Journal of Clinical Microbiology, vol. 43, no. 4, pp. 1505–1514. STABEL, J. R. 2000, ‘Johne’s disease and milk: do consumers need to worry?’, J. Dairy Sci., vol. 83, no. 7, pp. 1659–1663. STABEL, J. R. and LAMBERTZ, A. 2004, ‘Efficacy of pasteurization conditions for the inactivation of Mycobacterium avium subsp. paratuberculosis in milk’, J. Food Prot., vol. 67, no. 12, pp. 2719–2726. STABEL, J. R., STEADHAM, E. M. and BOLIN, C. A. 1997, ‘Heat inactivation of Mycobacterium paratuberculosis in raw milk: are current pasteurization conditions effective?’, Appl. Environ. Microbiol., vol. 63, no. 12, pp. 4975–4977. STABEL, J. R., BOSWORTH, T. L., KIRKBRIDE, T. A., FORDE, R. L. and WHITLOCK, R. H. 2004, ‘A simple, rapid, and effective method for the extraction of Mycobacterium paratuberculosis DNA from fecal samples for polymerase chain reaction’, J. Vet. Diagn. Invest, vol. 16, no. 1, pp. 22–30. STICH, R. W., BYRUM, B., LOVE, B., THEUS, N., BARBER, L. and SHULAW, W. P. 2004, ‘Evaluation of an automated system for non-radiometric detection of Mycobacterium avium paratuberculosis in bovine feces’, J. Microbiol. Methods, vol. 56, no. 2, pp. 267–275. STRATMANN, J., STROMMENGER, B., STEVENSON, K. and GERLACH, G. F. 2002, ‘Development of a peptide-mediated capture PCR for detection of Mycobacterium avium subsp. paratuberculosis in milk’, J. Clin. Microbiol., vol. 40, no. 11, pp. 4244–4250. SUENAGA, K., YOKOYAMA, Y., OKAZAKI, K. and YAMAMOTO, Y. 1995, ‘Mycobacteria in the intestine of Japanese patients with inflammatory bowel disease’, Am. J. Gastroenterol., vol. 90, no. 1, pp. 76–80.

Mycobacterium paratuberculosis SUNG, N.

555

and COLLINS, M. T. 1998, ‘Thermal tolerance of Mycobacterium paratuberculosis’, Appl. Environ. Microbiol., vol. 64, no. 3, pp. 999–1005. SUNG, N. and COLLINS, M. T. 2000, ‘Effect of three factors in cheese production (pH, salt, and heat) on Mycobacterium avium subsp. paratuberculosis viability’, Appl. Environ. Microbiol., vol. 66, no. 4, pp. 1334–1339. SUNG, N. and COLLINS, M. T. 2003, ‘Variation in resistance of Mycobacterium paratuberculosis to acid environments as a function of culture medium’, Appl. Environ. Microbiol., vol. 69, no. 11, pp. 6833–6840. SUNG, N., TAKAYAMA, K. and COLLINS, M. T. 2004, ‘Possible association of GroES and antigen 85 proteins with heat resistance of Mycobacterium paratuberculosis’, Appl. Environ. Microbiol., vol. 70, no. 3, pp. 1688–1697. SWEENEY, R. W., WHITLOCK, R. H. and ROSENBERGER, A. E. 1992, ‘Mycobacterium paratuberculosis cultured from milk and supramammary lymph nodes of infected asymptomatic cows’, J. Clin. Microbiol., vol. 30, no. 1, pp. 166–171. TADDEI, S., ROBBI, C., CESENA, C., ROSSI, I., SCHIANO, E., ARRIGONI, N., VICENZONI, G. and CAVIRANI, S. 2004, ‘Detection of Mycobacterium avium subsp. paratuberculosis in bovine fecal samples: comparison of three polymerase chain reaction-based diagnostic tests with a conventional culture method’, Journal of Veterinary Diagnostic Investigation, vol. 16, no. 6, pp. 503–508. TANAKA, K., WILKS, M., COATES, P. J., FARTHING, M. J., WALKER-SMITH, J. A. and TABAQCHALI, S. 1991, ‘Mycobacterium paratuberculosis and Crohn’s disease’, Gut, vol. 32, no. 1, pp. 43–45. TAYLOR , T . K ., WILKS , C . R . and MCQUEEN , D . S . 1981, ‘Isolation of Mycobacterium paratuberculosis from the milk of a cow with Johne’s disease’, Vet. Rec., vol. 109, no. 24, pp. 532–533. TESSEMA, M. Z., KOETS, A. P., RUTTEN, V. P. and GRUYS, E. 2001, ‘How does Mycobacterium avium subsp. paratuberculosis resist intracellular degradation?’, Vet. Q., vol. 23, no. 4, pp. 153–162. TIVELJUNG, A., SODERHOLM, J. D., OLAISON, G., JONASSON, J. and MONSTEIN, H. J. 1999, ‘Presence of eubacteria in biopsies from Crohn’s disease inflammatory lesions as determined by 16S rRNA gene-based PCR’, J. Med. Microbiol., vol. 48, no. 3, pp. 263–268. VAN KRUININGEN, H. J. 1999, ‘Lack of support for a common etiology in Johne’s disease of animals and Crohn’s disease in humans’, Inflamm. Bowel Dis., vol. 5, no. 3, pp. 183– 191. VANLEEUWEN, J. A., FORSYTHE, L. A., TIWARI, A. and CHARTIER, R. 2005, ‘Seroprevalence of antibodies against bovine leukemia virus, bovine viral diarrhea virus, Mycobacterium avium subspecies paratuberculosis., and Neospora caninum in dairy cattle in Saskatchewan’, Canadian Veterinary Journal – Revue Veterinaire Canadienne, vol. 46, no. 1, pp. 56–58. VANSNICK, E., DE RIJK, P., VERCAMMEN, F., GEYSEN, D., RIGOUTS, L. and PORTAELS, F. 2004, ‘Newly developed primers for the detection of Mycobacterium avium subspecies paratuberculosis’, Vet. Microbiol., vol. 100, no. 3-4, pp. 197–204. WALL, S., KUNZE, Z. M., SABOOR, S., SOUFLERI, I., SEECHURN, P., CHIODINI, R. and MCFADDEN, J. J. 1993, ‘Identification of spheroplast-like agents isolated from tissues of patients with Crohn’s disease and control tissues by polymerase chain reaction’, J. Clin. Microbiol., vol. 31, no. 5, pp. 1241–1245. WALMSLEY, R. S., IBBOTSON, J. P., CHAHAL, H. and ALLAN, R. N. 1996, ‘Antibodies against Mycobacterium paratuberculosis in Crohn’s disease’, QJM, vol. 89, no. 3, pp. 217– 221. WAYNE, L. G. and KUBICA, G. P. 1986, ‘The Mycobacteria,’ in Bergey’s Manual of Systematic Bacteriology, 2nd edn, vol. 2 P. H. A. Sneath et al., eds, Williams and Wilkins, Baltimore, MD, pp. 1435–1457. WELLS, R. W. and BLENNERHASSETT, M. G. 2005, ‘The increasing prevalence of Crohn’s disease in industrialized societies: the price of progress?’, Canadian Journal of Gastroenterology, vol. 19, no. 2, pp. 89–95.

556

Emerging foodborne pathogens

WHAN, L. B., GRANT, I. R., BALL, H. J., SCOTT, R.

and ROWE, M. T. 2001, ‘Bactericidal effect of chlorine on Mycobacterium paratuberculosis in drinking water’, Lett. Appl. Microbiol., vol. 33, no. 3, pp. 227–231. WHAN, L., BALL, H. J., GRANT, I. R., and ROWE, M. T. 2005, ‘Development of an IMS-PCR assay for the detection of Mycobacterium avium ssp. paratuberculosis in water’, Letters in Applied Microbiology, vol. 40, no. 4, pp. 269–273. WHITTINGTON, R. J. and SERGEANT, E. S. 2001, ‘Progress towards understanding the spread, detection and control of Mycobacterium avium subsp. paratuberculosis in animal populations’, Aust. Vet. J., vol. 79, no. 4, pp. 267–278. WHITTINGTON, R. J., MARSHALL, D. J., NICHOLLS, P. J., MARSH, I. B., and REDDACLIFF, L. A. 2004, ‘Survival and dormancy of Mycobacterium avium subsp. paratuberculosis in the environment’, Appl. Environ. Microbiol., vol. 70, no. 5, pp. 2989–3004. WINTERHOFF, C., BEYERBACH, M., HOMUTH, M., STRUTZBERG, K. and GERLACH, G. F. 2002, ‘Establishment and evaluation of an ELISA for the detection of antibodies in milk against Mycobacterium avium subspecies paratuberculosis’, Dtsch. Tierarztl. Wochenschr., vol. 109, no. 5, pp. 230–234.

Enterococci

557

20 Enterococci C. M. A. P. Franz and W. H. Holzapfel, Institute for Hygiene and Toxicology, Germany

20.1

Introduction

Enterococci are typical lactic acid bacteria (LAB) and are of importance in food and clinical microbiology. They are ubiquitous microorganisms, but have a predominant habitat in the gastrointestinal tracts of humans and animals (Giraffa, 2002). Representatives of the genus Streptococcus, formerly grouped as ‘faecal streptococci’ or Lancefield’s group D streptococci, were separated from this genus on the basis of modern classification techniques and serological studies in the 1980s. The large conglomeration of streptococci was thus subdivided into three separate genera: Streptococcus, Lactococcus and Enterococcus (Schleifer and Kilpper-Bälz, 1984; Devriese et al., 1993; Devriese and Pot, 1995). The typical pathogenic species, with the exception of S. thermophilus, remained in the genus Streptococcus, and were separated from the non-pathogenic and technically important species of the new genus Lactococcus (Devriese and Pot, 1995). The ‘faecal streptococci’ associated with the gastrointestinal tract of man and animals, with some fermented foods and a range of other habitats, constituted the new genus Enterococcus. Although c. 30 Enterococcus species are currently recognised, E. faecium and E. faecalis are still the two most prominent representatives and are the species which play the most important roles both in human disease and in fermented foods and in probiotics (Franz et al., 1999). 20.1.1 Taxonomy and identification Since the description of the genus Enterococcus in the 1980s, many taxonomic investigations have resulted in assignment of about 30 species to this genus (for reviews, see Devriese et al., 1993, 2003; Devriese and Pot, 1995; Hardie

558

Emerging foodborne pathogens

and Whiley, 1997; Franz et al., 2003), but the actual number fluctuates from time to time as individual species are re-classified or new taxa are discovered. For example, E. pallens, E. gilvus, E. canis, E. phoeniculicola, E. ratti, E. villorum, E. haemoperoxidus, E. moraviensis, E. hermanniensis, E. phoeniculicola, E. saccharominimus, E. canintestini and E. aquimarinus were only described in 2001 or later (Svec et al., 2001; Teixeira et al., 2001; Vancanneyt et al., 2001, 2004; Tyrrell et al., 2002; Law-Brown and Meyers, 2003; De Graef et al., 2003, Fortina et al., 2004; Koort et al., 2004; Naser et al., 2005; Svec et al., 2005a,b). The species Enterococcus flavescens (Pompei et al., 1992) appears to be identical to E. casseliflavus, which has nomenclatural priority, and Descheemaeker et al. (1997) could not distinguish between the two using either protein analysis or PCR-based typing (Devriese et al., 2003). Enterococcus solitarius (Collins et al., 1989) was shown to be more closely related to the genus Tetragenococcus (Collins et al., 1990; Williams et al., 1991) and was recently reclassified as T. solitarius (Ennahar and Cai, 2005). De Graef et al. (2003) showed that E. porcinus is a junior synonym of E. villorum. The phylogenetic relationship of the different species within the genus Enterococcus has been determined by comparative sequence analysis of their 16S rRNA genes. Based on these data the following species groups can be distinguished: E. faecium-group: E. faecium, E. durans, E. hirae, E. mundtii, E. villorum, E. canis E. avium-group: E. avium, E. malodoratus, E. pseudoavium, E. raffinosus, E. gilvus E. gallinarum-group: E. gallinarum E. casseliflavus, E. flavescens E. dispar-group: E. asini, E. dispar, E. pallens, E. hermanniensis, E. canintestini E. saccharolyticus-group: E. saccharolyticus, E. sulfureus, E. saccharominimus, E. italicus, E. aquimarinus E. cecorum-group: E. cecorum, E. columbae E. faecalis-group: E. faecalis, E. haemoperoxidus, E. moraviensis, E. ratti Members of the genus Enterococcus, like those of the genera Streptococcus and Lactococcus, are catalase-negative, Gram-positive cocci which are arranged in pairs or short chains. Within the chains, the cells are frequently arranged in pairs and are elongated in the direction of the chain. Endospores are absent. E. gallinarum and E. casseliflavus are motile, all others are nonmotile. E. casseliflavus, E. mundtii, E. sulfureus, E. pallens and E. gilvus are yellow-pigmented. All enterococci are facultatively aerobic chemoorganotrophs with a fermentative metabolism. They have a homofermentative lactic acid fermentation with L(+)-lactic acid as the predominant end product of glucose fermentation. Many of the ‘typical’ species of enterococci (E. faecalis, E. durans, E. faecium, E. gallinarum, E. hirae, and E. mundtii) can be easily distinguished from other Gram-positive, catalase-negative,

Enterococci

559

homofermentative cocci such as streptococci and lactococci, in that they are able to grow at 10 and 45 ∞C, in 6.5% NaCl, in the presence of 40% bile and at pH 9.6. However, many of the more recently described Enterococcus species vary in their physiological properties from those of the typical enterococci (Franz et al., 2003). Reliable identification of the genus Enterococcus and its species thus ultimately relies on the use of a combination of phenotypic, genotypic and phylogenetic information in a polyphasic taxonomy approach as described by Vandamme et al. (1996). A variety of genotypic methods have been used successfully to identify enterococci to genus or species level and these are reviewed by Domig et al. (2003). For differentiation between enterococci and lactococci on the genus level, Deasy et al. (2000) described a rapid PCR-based method based on amplification of a region of the 16S rDNA gene. They showed that using this method they could accurately separate enterococci from streptococci, lactococci, pediococci and lactobacilli. Ozawa et al. (2000) were able to accurately identify Enterococcus species by PCR amplification and sequencing of a conserved internal fragment of the Dalanine:D-alanine ligase genes (ddl). Tyrrell et al. (1997) used restriction fragment length polymorphism of the 16S/23S intergenic spacer region to distinguish the Enterococcus species, although with some species e.g., E. avium and E. pseudoavium, such a differentiation was not possible. Baele et al. (2000) used tRNA intergenic spacer PCR for the identification of enterococci species. Williams et al. (1991), Descheemaeker et al. (1997), Quednau et al. (1998), Andrighetto et al. (2001), Gelsomino et al. (2001a) and Vancanneyt et al. (2002) showed that Enterococcus species can be differentiated quite well by RAPD-PCR. Rep-PCR using primer GTG5 also showed excellent identification possibilities (Svec et al., 2005b), while sequencing of the 16S rRNA gene also yields accurate species identification and can aid in the description of new Enterococcus species (see above). Recently, Lehner et al. (2005) reported on the development and use of an oligonucleotide microarray for the identification of Enterococcus spp. This microarray called the ‘ECCPhylochip’ consisted of 41 hierarchically nested 16S or 23S rRNA genetargeted probes and was able to differentiate between 19 tested Enterococcus species originating from pure culture. In addition, the microarray was successfully used in artificially contaminated milk to identify E. faecium and E. faecalis directly in the food sample. The enterococci are important in environmental, food and clinical microbiology. Because of their intestinal habitat in food animals, they can contaminate milk and the dairy environment or meat at the time of slaughter. Nevertheless, enterococci are of technological importance in the production of various European fermented foods such as sausages and cheeses, where they are either purposefully added to the product as starter cultures (Giraffa et al., 1997), or where their presence results from environmental contamination. As a result of their natural association with the gastrointestinal tract, as well as functional and technologically desirable properties, some strains are also used successfully as probiotics (Franz et al., 1999, 2003).

560

Emerging foodborne pathogens

The detrimental activities of enterococci are related to spoilage of foods, especially meats and, more importantly, the fact that certain Enterococcus strains can cause human disease. Enterococci are typical opportunistic pathogens that may cause infections especially in the nosocomial setting in patients which have underlying disease. Over the last two decades, enterococci have emerged as important nosocomial pathogens, and this rise in their association with human disease can in part be explained by their increasing resistance to antibiotics as well as their promiscuity regarding transfer of genetic material (Franz et al., 1999, 2003; Giraffa, 2002). This ‘ambiguous’ nature of enterococci makes them, on the one hand, desirable for use as starter cultures in food production or as probiotics, while, on the other hand, they give rise to concern because of the potential transfer of antibiotic resistances, the possible presence of virulence factors and their role in human disease.

20.2

Habitat

20.2.1 Environment Enterococci occur in a wide variety of environmental niches, including soil, surface waters, waste waters and municipal water treatment plants, on plants, in the gastrointestinal tract of warm blooded animals (including humans) and, as a result of association with plants and animals, in human foods (Franz et al., 1999). On plants, enterococci occur in a truly epiphytic relationship (Mundt et al., 1962) and Enterococcus species typically associated with plants include the yellow-pigmented E. mundtii and E. casseliflavus (Martin and Mundt, 1972). The early studies on enterococci (‘faecal streptococci’) occurring on plants by Mundt et al. (1962) were performed before the genus Enterococcus was re-defined by Schleifer and Kilpper-Bälz (1984). Modern, taxonomic studies based on molecular biological techniques for classification and species identification by Ott et al. (2001) and Müller et al. (2001) validated this epiphytic relationship and enterococci occurring on plants were identified as E. faecium, E. faecalis, E. casseliflavus, E. mundtii and E. sulfureus. The majority of the isolates in the study of Müller et al. (2001), however, possessed a 16S rDNA genotype uncommon to Enterococcus species described at the time of the study. Enterococci also occur on fresh produce and possibly originate from the use of untreated irrigation water or manure slurry for crop production (Johnston and Jaykus, 2004). Interestingly, in this context Johnston and Jaykus (2004) isolated mainly E. faecalis and E. faecium strains, but also other Enterococcus spp. from fresh produce such as celery, cilantro, mustard greens, spinach, collards, parsley, dill, cabbage and cantaluope, and showed that many strains harboured antibiotic resistances. Similarly Ronconi et al. (2002) isolated predominantly E. faecium and E. faecalis strains from lettuce and many strains were also antibiotic resistant. This may

Enterococci

561

have important implications for dissemination of antibiotic resistance genes and thus impact on human health (see below). Enterococci occur in surface waters, sea water as well as municipal and hospital waste waters. Water is the source of a variety of novel Enterococcus spp. that have been described more recently. For example, Svec et al. (2001) described E. haemoperoxidus and E. moraviensis from surface waters and Svec et al. (2005a) described E. aquimarinus which was isolated from seawater. Enterococci are recognised by the U.S. Environmental Protection Agency as indicator organisms for bacteriological water quality in fresh and saline waters (U.S. Environmental Protection Agency, 1986; Anonymous, 1998) and their presence, especially at elevated levels, indicates that faecal pollution from animal or human sources has occurred (Harwood et al., 2004). However, there are many possible sources for enterococci apart from sewage, including animal waste, invertebrates, plants and soils (Harwood et al., 2004). Among the enterococci, particularly E. faecalis, E. faecium, E. durans and E. hirae are considered to be of faecal origin (Godfree et al., 1997) and thus water quality studies were suggested to focus on this subset of enterococcal species that is consistently associated with faecal pollution (Harwood et al., 2004). In both lake and sea water, enterococci were described to either associate with zooplankton, or to occur in the unbound state, depending on the presence or absence of plankton (Maugeri et al., 2004; Signoretto et al., 2004). The binding of E. faecalis in the non-culturable state to plankton was considered as the main mechanism responsible for enterococci to persist in both lake and sea water (Signoretto et al., 2004). Blanch et al. (2003) studied the occurrence of enterococci in raw and treated waste water, surface waters receiving the treated waste water and hospital wastewater in three European countries (Sweden, Spain and United Kingdom). In all three countries, the levels of enterococci in these different waters were quite similar and ranged from ca. log 6 CFU/ml in raw sewage, ca. log 5-6 CFU/ml in hospital wastewater, ca. log. 3-4 CFU/ml in treated sewage to log ca. 1-4 CFU/ml in surface waters (Blanch et al., 2003). Most of the enterococci strains isolated from any and all of the different water sources were identified as E. faecalis and E. faecium, together representing more than 60% of the enterococcal population. Vancomycin and erythromycin resistant enterococci could be isolated from waters of all sources from the three countries, although at differing incidences. Isolation of such antibiotic resistant bacteria from treated waste waters and surface waters showed that the enterococci can pass through different treatments in wastewater plants and can be transferred to surface waters (Blanch et al., 2003). Moreover, Vilanova et al. (2004) followed vancomycin and erythromycin-resistant enterococci during the sewage treatment process and found that although a significant reduction in bacterial populations was observed, the persistence of such antibiotic resistant bacteria in the same proportions in sewage suggested that there was no selective elimination of antibiotic resistant populations during the treatment process. Thus, antibiotic resistant strains survive sewage treatment and this increases

562

Emerging foodborne pathogens

the chance of being transmitted to the food chain especially when water reuse programmes are in place (Blanch et al., 2003; Vilanova et al., 2004).

20.2.2 Gastrointestinal tract Enterococci are well known to occur as part of the natural microflora of the intestinal tract of warm-blooded animals and man and constitute a large proportion of the autochthonous bacteria associated with this ecosystem. E. faecalis is often the predominating Enterococcus sp. in the human bowel, although in some individuals and in some countries, E. faecium outnumbers E. faecalis (Ruoff, 1990; Devriese and Pot, 1995). Numbers of E. faecalis in human faeces range from 105 to 107/g compared with 104 to 105/g for E. faecium (Noble, 1978; Chenoweth and Schaberg, 1990). In livestock such as pigs, cattle and sheep, E. faecalis, E. faecium and E. durans are less frequently isolated when compared to human faeces (Leclerc et al., 1996). E. faecalis, E. faecium, E. hirae and E. cecorum were the enterococci most frequently isolated from pig intestines, while E. faecium predominated in faecal samples (Devriese et al., 1994; Leclerc et al., 1996). The intestinal microflora of young poultry contained principally E. faecalis and E. faecium, but E. cecorum predominated in the intestine of chickens over 12 weeks old (Devriese et al., 1991). E. columbae is an important member of the gut flora of pigeons, while E. hirae frequently occurs in the intestine of pigs, but may also occur in the gut of poultry, cattle, cats and dogs (Devriese et al., 1987). E. durans has been isolated from humans, chickens and calves and E. malodoratus is often found in the tonsils of cats. The habitat of the members of the E. avium species group (E. avium, E. malodoratus, E. raffinosus and E. pseudoavium) otherwise is largely unknown (Devriese et al., 1992; Devriese et al. 2003). Various Enterococcus spp. from intestinal origin have been newly described. These include E. ratti and E. villorum which are associated with enteric disorders in animals (Teixeira et al., 2001; Vancanneyt et al., 2001), and E. canintestini which is associated with the gastrointestinal tract of healthy dogs (Naser et al., 2005).

20.2.3

Foods

Meats The presence of enterococci in the gastrointestinal tract of animals clearly leads to a high potential for contamination of meats at the time of slaughter. In raw meat products, E. faecalis was shown to be the predominant isolate from beef and pork cuts in one study (Stiles et al., 1978), while in another both E. faecium and E. faecalis were the most predominant Enterococcus spp. isolated from pig carcasses (Knudtson and Hartman, 1993). These pig carcasses from three different slaughter plants contained mean counts of 104 to 108 enterococci per 100 cm2 of carcass surface throughout processing

Enterococci

563

(Knudtson and Hartman, 1993). Devriese et al. (1995) showed that E. faecium, E. faecalis and to a lesser extent E. hirae and E. durans occurred in meat and prepared meat products. In a study on poultry, E. faecalis predominated among the Gram-positive cocci isolated from chicken samples collected at abattoirs (Turtura and Lorenzelli, 1994). Capita et al. (2001) found enterococci to occur at a mean count of log 2.72 CFU/g of chicken carcasses from five retail outlets in Spain. In a study on modified-atmosphere-packaged, marinated broiler legs produced in Finland Björkroth et al. (2005) showed that enterococci dominated in the fresh product but were replaced by the spoilage LAB including carnobacteria and Lactobacillus sakei/curvatus (Björkroth et al., 2005). Interestingly, some of the isolates were identified as a novel species E. hermanniensis (Koort et al., 2004). Enterococci were also consistently isolated from beef, poultry or pig carcasses or fresh meat cuts in studies of antibiotic resistance of enterococci (Klein et al., 1998; van den Braak et al., 1998; Davies and Roberts, 1999; Robredo et al., 2000; Borgen et al., 2001; Aarestrup et al., 2002; van den Bogaard et al., 2002; Mac et al., 2002; Hayes et al., 2003; Garnier et al., 2004; Huys et al., 2004; Rizzotti et al., 2005; Wilcks et al., 2005). Enterococci may not only contaminate raw meats, but they can also be associated with processed meats. Cooking of processed meats may confer a selective advantage on enterococci as these bacteria are known to be among the most thermotolerant of the non-sporulating bacteria (Sanz Perez et al., 1982; Magnus et al., 1988). After surviving the heat-processing step, both E. faecalis and E. faecium have been implicated in spoilage of cured meat products such as canned hams and chub-packed luncheon meats (Bell and Gill, 1982; Houben, 1982; Bell and Delacey, 1984; Magnus et al., 1986). Enterococci are also isolated from certain types of fermented sausages, for example sausages known as ‘fuet’, ‘chorizo’ (Casaus et al., 1997; Cintas et al., 1997; Herranz et al., 1999; Martin et al., 2005) and ‘espetec’ (Aymerich et al., 1996) produced in Spain, in Italian sausages (Cocolin et al., 2001) or sausages such as Salami and ‘Landjäger’ produced in many European countries. Salami and Landjäger were shown to contain enterococci at numbers ranging from 102 to 105 CFU/g (Teuber et al., 1996). Because of their tolerance to sodium chloride and nitrite, enterococci can survive and even multiply in the fermenting sausages (Giraffa, 2002; Martin et al., 2005). Some enterococcal strains have the ability to produce enterocins harbouring antimicrobial activity against pathogens and spoilage microorganisms, and may thus be used as bioprotective agents. Such enterocin-producing enterococci, or their purified metabolites, may be applied as extra hurdles for preservation in sausage fermentation and in sliced vacuum-packed cooked meat products, thereby preventing the outgrowth of Listeria monocytogenes and/or slime-producing lactic acid bacteria (Hugas et al., 2003). Cheese Enterococci occur in many traditional European cheeses manufactured in

564

Emerging foodborne pathogens

mostly Mediterranean countries from raw or pasteurised milk (Ordoñez et al., 1978; Coppola et al., 1988; Del Pozo et al., 1988; Litopoulou-Tzanetaki, 1990; Tzanetakis and Litopoulou-Tzanetaki, 1992; Macedo et al., 1995; Tzanetakis et al., 1995; Centeno et al., 1996; Bouton et al., 1998; Menéndez et al., 2001; Prodromou et al., 2001; Caridi et al., 2003; Manolopoulou et al., 2003; Marino et al., 2003; Cosentino et al., 2004). The source of enterococci in milk and in such cheeses is thought to be the faeces of dairy cows, contaminated water or milking equipment and bulk storage tanks (Gelsomino et al., 2001b) as well as natural milk starters (Giraffa, 2002). The isolation of enterococci from natural milk starters can be explained by their heat resistance; natural milk starters are made by pasteurising milk at 42–44 ∞C for 12 to 15 h, thus promoting the thermotolerant bacteria present, which include S. thermophilus strains and Enterococcus spp. (Giraffa, 2002). Strains belonging to the species E. faecalis, E. faecium and E. durans are most often isolated from such cheeses (Table 20.1) and these may contribute to ripening and product flavour (Tzanetakis and Litopoulou-Tzanetaki, 1992; Macedo et al., 1995; Freitas et al., 1995; Centeno et al., 1996; Andrighetto et al., 2001; Menéndez et al., 2001; Delgado et al., 2002; Caridi et al., 2003). Numbers of enterococci in cheese curds range from 104 to 106 CFU/g, and in the fully ripened cheeses from 105 to 107 CFU/g (Table 20.1). Enterococci can grow in the restrictive environment of high salt content and low pH of the cheese (Ordoñez et al., 1978; Litopoulou-Tzanetaki, 1990; Wessels et al., 1990; Freitas et al., 1995) and contribute to the ripening and aroma development of these products due to their proteolytic and esterolytic activities, as well as the production of diacetyl (Jensen et al., 1975; Ordoñez et al., 1978; Trovatelli and Schiesser, 1987; DeFernando et al., 1992; Tsakalidou et al., 1993; Centeno et al., 1996, 1999; Sarantinopoulous et al., 2002). Because of their role in ripening and flavour development in cheeses, enterococci with desirable technological and metabolic traits have been proposed as part of defined starter cultures or as adjunct starter cultures for different European cheeses (Litopoulou-Tzanetaki et al., 1993; Villani and Coppola, 1994; Centeno et al., 1999). Enterococci produce lactic acid as end product of metabolism and this acidifying activity can be considered a technological trait in cheese fermentations. However, the enterococci generally exhibit only low acidifying ability (Aymerich et al., 2000; Andrighetto et al., 2001; Sarantinopoulous et al., 2001; Giraffa, 2003). Proteolytic activity of enterococci for break-down of milk casein is quite important for cheese ripening. However, conflicting reports on proteolytic activity of enterococci suggest a marked strain-to-strain variation of this phenotypic trait (Arizcun et al., 1997; Durlu-Ozkaya et al., 2001; Delgado et al., 2002; Giraffa, 2003). Both esterolytic and lipolytic activity of enterococci are also considered important in the context of cheese ripening and development of flavour and texture. Esterases are arbitrarily defined as enzymes that hydrolyse substrates in solution, while lipases hydrolyse substrates in emulsion (Giraffa, 2003). Esterases have been linked to the flavour development and cheese texture by

Table 20.1

Numbers and predominant isolates of Enterococcus spp. in cheeses from Mediterranean countries

Cheese

Country of origin

Milk source

Enterococci in curd (log CFU/g)

Enterococci at end of ripening (CFU/g)

Predominant bacteria in end product (% of isolates)

Reference

White-brined cheese

Greece

Raw goat milk or mixed goat and ewes’ milk

4.0

6.7

LitopoulouTzanetaki and Tzanetakis (1992)

Kefalotyri cheese

Greece

Ewes’ milk, cow milk or mixed ewes’ and goat milk

4.9

5.8

Teleme cheese

Greece

Pasteurised ewes’ milk

n.r.a

n.r.

Orinotyri cheese La Serena ewes’ milk cheese Manchego cheese Cebreiro

Greece

Raw ewes’ milk

n.r.

6.8

L. plantarum (47%) b E. faecium (12%) L. paracasei subsp. paracasei (10%) E. faecalis (9%) E. faecium (35.6%) L. plantarum (18.4%) L. casei subsp. casei (15.8%) E. durans (9.2%) pediococci (9.2 %) Lactobacilli Leuconostocs Enterococci lactococci, enterococci, leuconostocs

Spain

Raw ewes’ milk

6.2

7.2

Spain

Raw ewes’ milk

n.r.

n.r.

Spain

Raw cow milk

n.r.

6.5

Lactobacilli Leuconostocs Enterococci Enterococci

Tzanetakis and LitopoulouTzanetaki (1992) Prodromou et al. (2001) Del Pozo et al. (1988) Ordoñez et al. (1978) Centeno et al. (1996)

Enterococci 565

E. faecalis (30.1%) E. faecalis (var liquifaciens) (11.9%) Lact. lactis (19.0%) W. (Leuc.) paramesenteroides (7.9%) Leuc. mesenteroides subsp. mesenteroides (6.3%) E. faecium (4.8%)

LitopoulouTzanetaki (1990)

566

Continued

Cheese

Country of origin

Milk source

Enterococci in curd (log CFU/g)

Enterococci at end of ripening (CFU/g)

Predominant bacteria in end product (% of isolates)

Reference

San Símon cheese Tetilla cheese

Spain

Raw cow milk

5–6

6–7

Spain

Raw cow milk

n.r.

7.3

García et al. (2002) Menéndez et al. (2001)

Caprino d’ Aspromonte Montasio

Italy

4–6

5–7

4

ca. 5–7

Serra cheese

Portugal

Raw or heated goat milk Raw or heated cow milk Raw ewes’ milk

n.r.

n.r.

Picante da Beira Baixa cheese

Portugal

n.r.

n.r.

E. faecalis, E. faecium, E. durans, Staph. spp. Micrococcus spp E. faecalis, L. casei subsp. casei, Leuconostoc mesenteroides subsp. mesenteroides enterococci, lactobacilli, mesophilic and thermophilic cocci S. thermophilus, E. durans, E. faecalis, E. faecium Leuc. lactis, Lact. lactis, Leuc. mesenteroides subsp. mesenteroides/ dextranicum E. faecium E. faecium, E. faecalis, E. durans, L. plantarum, L. paracasei

a

Italy

Mixture of raw goat and ewes’ milk

Caridi et al. (2003) Marino et al. (2003) Macedo et al. (1995) Freitas et al. (1995)

n.r. = not reported; b : L. = Lactobacillus; E. = Enterococcus; Lact. = Lactococcus; Leuc. = Leuconostc; W. = Weissella, Staph. = Staphylococcus

Emerging foodborne pathogens

Table 20.1

Enterococci

567

lipolysis of milk fat and subsequent conversion of the free fatty acids produced to methylketones and thioesters, which have importance as cheese flavour compounds. Lipolysis, on the other hand, is not directly involved in cheese rheology but partial glycerides are tensio-active and influence molecular organisation, thus having an effect on cheese texture (Giraffa, 2003). Hydrolysis of triglycerides by enterococci has been reported, with E. faecalis strains appearing to be most active (Macedo and Malcata, 1997; Sarantinopoulos et al., 2001; Durlu-Ozkaya et al., 2001), while the esterolytic system of enterococci appears to be complex and more efficient than their lipolytic system (Giraffa, 2003). Because enterococci are not good acidifiers of milk and meats, and their proteolytic and esterolytic properties may not be high, it would probably be better to use enterococci in food fermentations as adjunct starter cultures in combination with established starter strains rather than using these bacteria as defined starter cultures by themselves. Nevertheless, the effect of the technological properties of the enterococci is not negligible and should not be underestimated. For example, Sarantinopoulos et al. (2002) studied the technological properties of two strains of E. faecium as adjunct starter cultures, either single or combined, on the microbiological, physicochemical and sensory characteristics of Feta cheese in a well-defined study. It was shown that the presence of the enterococcal starter strains positively affected the growth of non-starter LAB, increased the proteolytic index and free amino group concentration, enhanced the water-soluble nitrogen fractions and positively affected taste, aroma, colour, structure, and the overall sensory profile of the cheese (Sarantinopoulos et al., 2002). Clearly, the results of this study supported previous suggestions that enterococci indeed positively influence cheese fermentations. Fermented vegetables Enterococci occur in a variety of fermented vegetables, but it is often not clear whether they originate from the plant material itself or as environmental contaminants. Enterococci have been isolated also from green olive fermentations (Fernández Díez, 1983; Asehraou et al., 1992, van den Berg et al., 1993; Floriano et al., 1998; Lavermicocca et al., 1998; de Castro et al., 2002; Randazzo et al., 2004), in which E. faecalis is a frequent contaminant, and they frequently occur in retail fermented olives. De Castro et al. (2002) suggested that lactic acid bacteria growing at the beginning stages of the olive fermentation are important for improving the hygiene of the product. However, not all of the lactic acid bacteria are suited to grow at the relative high pH conditions resulting from alkaline treatment of the olive grapes to hydrolyse the bitter glucoside oleuropein. Because of their tolerance to the high pH values and salt concentration used in the olive brine, the enterococci appear to be well suited for growth at these conditions (de Castro et al., 2002). It has also been suggested that enterococci can use the antimicrobial compound oleuropein in olive grapes as a growth substrate as a result of

568

Emerging foodborne pathogens

beta-glucosidase activity (Garrido-Fernandez and Vaughn, 1978; Randazzo et al., 2004), thus lowering the toxicity of the fermentation medium for growth of other LAB. In addition, the enterococci, especially E. faecalis and E. faecium strains, have also been associated with Asian and African fermented sorghum foods (Mulyowidarso et al., 1990; Mohammed et al., 1991; Hamad et al., 1997; Moreno et al., 2002; Onda et al., 2002). However, it is not always clear whether they play a constructive or detrimental role in the fermentation of such vegetable products, if they play any role at all. Moreno et al. (2002) isolated two bacteriocinogenic E. faecium strains from spoiled tempeh but did not contribute a major role of these bacteria to the spoilage process. In our own studies on traditional fermented African foods, E. faecium strains were also associated with the fermentation of products such as ‘Hussuwa’ made from sorghum in the Sudan (Yousif et al., 2005). They constituted ca. 10% of bacteria isolated from various stages of the fermentation and thus did not appear to play a significant role in the fermentation. Nevertheless, some of these E. faecium strains displayed some interesting technological properties such as degradation of indigestible sugars raffinose and stachyose, as well as bacteriocin activity, and thus may be interesting for use as adjunct cultures in the fermentation (Yousif et al., 2005). We also isolated enterococci from ‘Okpehe’ made from locust beans in Nigeria. When a selected Enterococcus strain was used together with a B. subtilis starter strain in a model Okpehe fermentation, the resulting product developed an undesirable ‘cheese-like’ aroma, which scored badly in an organoleptic taste panel evaluation. This indicated clearly that the enterococci may not play a role in flavour development in the Okpehe fermentation (Oguntoyinbo et al., in press). In the fermentation of miso-paste, the salt tolerant enterococci (belonging to the E. faeciumgroup) often predominate in the early stages of the fermentation, before they are replaced by the even more salt tolerant Tetragenococcus halophilus strains (Onda et al., 2002). The presence of enterococci to start the fermentation is considered important for two reasons: firstly, these bacteria serve to lower the acidity by production of lactic acid in the beginning stage of the fermentation, and secondly they are believed to be involved in maintaining the bright colour of the miso (the so-called ‘Sae’ effect) (Yoshii, 1995; Onda et al., 2002). From the above examples it is apparent that enterococci occur in a great variety of foods, whether they belong to dairy, meat or plant foods. This means that inevitably, foods containing high numbers of enterococci (e.g., up to 107 CFU/g cheese) are probably consumed daily or at least weekly by the average consumer. The questions which arise from this fact bear direct relevance to the safety discussion which has been going on for the last few years when considering food enterococci: can these strains harbour virulence determinants or antibiotic resistances? What are the routes of transmission? Can enterococci from foods survive gastrointestinal passage and are they able to colonise the gastrointestinal tract? Can food strains which harbour

Enterococci

569

virulence factors or antibiotic resistance determinants cause human infection or can such determinants be transferred to commensal bacteria in the gut? Are enterococci foodborne pathogens and does the presence of enterococci in foods constitute a health risk? These are the question which a tremendous amount of research was devoted to in the last five years, and the results of such investigations will be discussed in the sections below.

20.3

Use of enterococci as probiotics

A few Enterococcus spp. are being used as probiotics. E. faecium SF68 has been used to treat diarrhoea and it is considered as an alternative to antibiotic treatment (Lewenstein et al., 1979; Bellomo et al., 1980). Several placebo controlled, ‘double blind’ clinical studies have shown that treatment of enteritis with E. faecium SF68 was successful for both adults and children. It decreased the duration of diarrheal symptoms and the time for normalisation of patient’s stools (Bellomo et al., 1980; D’Apuzzo and Salzberg, 1982). Another probiotic for human use that contains enterococci is the Causido® culture that consists of two strains of S. thermophilus and one of E. faecium. This probiotic has been claimed to be hypocholesterolaemic in the short-term (Agerholm-Larsen et al., 2000), but long-term reduction of LDL-cholesterol levels was not demonstrated (Richelsen et al., 1996; Sessions et al., 1997); hence, the clinical relevance of this effect is uncertain (Lund et al., 2002). Two probiotic preparations containing enterococci together with other probiotic strains (i.e., either Enterococcus, L. acidophilus and Bifidobacterium or E. faecium and B. subtilis) were used in patients with liver cirrhosis to improve their symptoms of gastrointestinal dysfunction (Zhao et al., 2004). Both types of probiotics increased the Bifidobacterium count and reduced the levels of faecal pH and faecal and blood ammonia significantly, while the preparation containing the enterococci and B. subtilis bacteria also reduced the level of endotoxin in cirrhotic patients with endotoxemia (Zhao et al., 2004). The use of enterococci as probiotics remains a controversial issue, particularly because these Enterococcus probiotics are typically administered as pharmaceutical preparations and thus are ingested in high numbers. While the probiotic benefits of some strains are well established, the emergence of antibiotic-resistant strains of enterococci and the increased association of enterococci with human disease (see below), has raised considerable concern regarding their use as probiotics. The fear that antimicrobial resistance genes or genes encoding virulence factors can be transferred to probiotic strains in the gastrointestinal tract contributes to this controversy. Whether this concern is well founded will be discussed in the sections below.

570

20.4

Emerging foodborne pathogens

Infections caused by enterococci and epidemiology

20.4.1 Enterococcal infections Enterococci are typical opportunistic pathogens and may cause infections in patients that have severe underlying disease, that have received surgery or that are immunocompromised (Morrison et al., 1997). They are commonly associated with hospital-acquired infections and cause bacteraemia, endocarditis, urinary tract and other infections (Murray, 1990; Morrison et al., 1997). Enterococci are amongst the most prevalent organisms associated with nosocomial infections, accounting for approx. 12% of nosocomial infections in the USA (Linden and Miller, 1999). They are the third most common pathogen isolated from bloodstream infections (Jones et al., 1997) and the most frequently reported pathogen in surgical site infections in intensive care units (Richards et al., 2000). In 1999, enterococci were reported as the second most common nosocomial pathogen in the USA (Richards et al., 1999). They contribute significantly to patient mortality as well as to additional hospital stay (Landry et al., 1989; Koch et al., 2004). While E. faecalis was earlier noticed to predominate (more than 80%) among enterococci from human infections and E. faecium was associated with the remainder (Jett et al., 1994), a shift towards E. faecium strains as the causative agent in enterococcal bacteraemia occurred in the last few years, probably because of the emergence of vancomycin-resistant strains (Mundy et al., 2000). Other enterococcal species are rarely associated with human disease, but strains of E. gallinarum, E. hirae, E. casseliflavus, E. durans, E. avium and E. mundtii have been reported in association with infections such as bacteraemia, endocarditis, meningitis, brain abscess and endophthalmitis (Dargere et al., 2002; Choi et al., 2004; Mirzoyev et al., 2004; Pappas et al., 2004; Stephanovic et al., 2004; Villar et al., 2004; Corso et al., 2005; Higashide et al., 2005; Iaria et al., 2005; Mohanty et al., 2005). Bacteraemia is a common form of opportunistic enterococcal infection (Lewis and Zervos, 1990; Jones et al., 1997; Morrison et al., 1997). Compared with a steady reduction in community-acquired cases of enterococcal bacteraemia, nosocomial cases may have increased threefold and reach up to 77% of cases (Shlaes et al., 1981; Maki and Agger, 1988; Morrison et al., 1997; Weinstein et al., 1997). Risk factors associated with enterococcal bacteraemia include underlying disease, presence of urethral or intravascular catheters, surgery, major burns, multiple trauma or prior antibiotic therapy (Lewis and Zervos, 1990). Sources of enterococci causing bacteraemia without endocarditis are most commonly from the urinary tract, but the gastrointestinal and hepatobiliary tracts have also been implicated (Chenoweth and Schaberg, 1990; Lewis and Zervos, 1990; Morrison et al., 1997). Mortality from enterococcal bacteraemia is generally high, most probably because of the underlying complicating factors (Murray, 1990; Kaufhold and Ferrieri, 1993). Enterococci cause an estimated 5 to 15% of cases of bacterial endocarditis with E. faecalis more commonly involved than E. faecium (Murray, 1990; Morrison et al., 1997). The enterococci usually originate from the urinary

Enterococci

571

tract (Chenoweth and Schaberg, 1990; Lewis and Zervos, 1990; Aguirre and Collins, 1993) and underlying heart disease is often present, but it is not a pre-requisite for development of this infection (Chenoweth and Schaberg, 1990; Murray, 1990; Morrison et al., 1997). Endocarditis often occurs in patients that had preceding genitourinary instrumentation or urinary tract infections (UTI), abortion, or urinary tract instrumentation (Chenoweth and Schaberg, 1990; Murray, 1990; Moellering, 1992). Urinary tract infections are commonly caused by enterococci, especially in hospitalised patients. These infections occur especially in persons who had surgery, received antibiotics, had structural abnormalities, or had recurrent enterococcal infections (Chenoweth and Schaberg, 1990; Murray, 1990; Moellering, 1992). Infections of the central nervous system by enterococci are rare and are seen primary in neonates and persons who have undergone complicated neurological procedures (Moellering, 1992; Morrison et al., 1997). Enterococci causing neonatal infection are thought to originate from the vagina, because they are detected in the vaginal microflora in 25% of healthy women (Lewis and Zervos, 1990). E. faecium and E. faecalis have been implicated in outbreaks of neonatal central nervous system infections, although infections of older children and adults have also been reported (Murray, 1990; Tailor et al., 1993). Enterococci may also cause or contribute to abdominal and pelvic abscess formation and sepsis (Murray, 1990). They were reported as a cause of spontaneous peritonitis in cirrhotics and nephrotics, and may be associated with peritonitis in patients on peritoneal dialysis (Murray, 1990; Tyrrell et al., 2002). Dialysis catheters and prior use of antibiotics are predisposing factors for intra-abdominal infections by enterococci (Chenoweth and Schaberg, 1990; Low et al., 1994). 20.4.2 Virulence factors To cause infection, enterococci must have virulence factors which allow the infecting strains to colonise host tissue, invade host tissue and translocate through epithelial cells and evade the hosts immune response. Furthermore, such virulent strains must produce pathological changes either directly by toxin production or indirectly by inflammation (Johnson, 1994). In recent years, considerable progress has been made in determining virulence traits (Table 20.2) from clinical isolates, and each of these may be associated with one or more of the stages of infection mentioned above. Moreover, in the last few years many investigations have focused on the virulence characteristics of enterococci occurring in foods in an attempt to assess the risk of foodborne enterococci for human health. Interestingly, virulence factors which occur in medical Enterococcus isolates could also be found in environmental or food Enterococcus isolates (see below). Colonisation Enterococci are normal commensals occurring in the gastrointestinal tract and thus must be able to colonise this ecological niche. A number of virulence

572

Emerging foodborne pathogens

Table 20.2 Virulence factors which may be present in some Enterococcus strains, and (suggested) association with stage of virulence Virulence determinant

(Suggested) association with stage of virulence

Aggregation substance (AS)

Adhesion to eukaryotic cells (adhesin)/ promotes colonisation Invasion of eukaryotic cells (invasin) Adhesion to extracellular matrix proteins (may promote translocation) Increases survival in immune cells (evasion of host immune response) Eukaryotic cell toxin Lyses immune cells (evasion of host immune response) Can hydrolyse various biological peptides, e.g. collagens and fibrin (role in translocation?) Can hydrolyse antibacterial peptides (evasion of host innate immune response) Adhesin, promotes colonisation Exhibits characteristics of MSCRAMMs – role in evasion of immune response? Adhesion to extracellular matrix proteins (may promote translocation) Exhibits MSCRAMM characteristics: role in evasion of immune response? Adhesin: role in endocarditis

Cytolysin (Cyl) Gelatinase (Gel)

Enterococcal surface protein (Espfs and Espfm) Adhesin to collagen of E. faecalis (Ace) or E. faecium (Acm) Endocarditis antigen from E. faecalis or E. faecium (EfaAfs and EfaAfm) Hyaluronidase Pheromones E. faecium secreted antigen (Sag) Superoxide and hydrogen peroxide Capsule

Degrades hyaluronic acid, a major extracellular matrix constituent: role in translocation? Cause inflammation, induce superoxide production Adhesion to extracellular matrix proteins May cause cell/DNA damage, improves colonisation Evasion of host immune response

factors have been identified which allow the enterococci to adhere to gastrointestinal cells, the extracellular matrix and thus facilitate colonisation or the formation of vegetations. Aggregation substance (AS) Aggregation substance (AS, Table 20.2) is a glycoprotein adhesin that is encoded on pheromone-responsive plasmids. Expression of the AS gene is induced by sex pheromones which are small (7 to 8 amino acids) hydrophobic peptides and which are excreted by plasmidless, recipient E. faecalis strains. Binding of the pheromones by the donor strain leads to expression of AS on the cell surface. AS leads to clumping of donor and recipient cells by binding to a complementary receptor termed ‘binding substance’ on the recipient cell surface. This clumping of cells leads to a highly efficient transfer of the pheromone plasmids on which the AS gene is encoded (Clewell, 1993; Dunny

Enterococci

573

et al., 1995). AS was also shown to be involved in binding to eukaryotic cells. The molecule contains two RGD (Arg-Gly-Asp) amino acid motifs that promote E. faecalis adhesion to eukaryotic cells, such as pig renal tubular cells, via integrin receptors (Kreft et al., 1992). AS was further shown to bind to a variety of cells via such b2-type integrins including human macrophages and intestinal epithelial cells (Sartingen et al., 2000; Süßmuth et al., 2000). In addition, AS can also bind to extracellular matrix (ECM) proteins such as fibronectin, thrombospondin, vitronectin and collagen type I (Rozdzinski et al., 2001). Not only was AS shown to play a role in binding to intestinal cells, it was also found to augment internalisation of enterococci cells and to promote translocation and intracellular survival (Wells et al., 1990; Kreft et al., 1992; Olmsted et al., 1994; Rakita et al., 1999; Vanek et al., 1999; Sartingen et al., 2000; Süßmuth et al., 2000; Wells et al., 2000). AS is therefore considered an important multifunction virulence factor because it acts as an adhesin and invasin; in addition it is involved in translocation as well as evasion of the immune response by intracellular survival in immune cells (Table 20.2). To underline this, AS was associated with an increased mass in valvular vegetations in an animal pathogenicity model and thus enhanced the virulence of these bacteria in these studies (Chow et al., 1993; Schlievert et al., 1998). Enterococcus surface protein from E. faecalis (Espfs) and E. faecium (Espfm) The ‘enterococcal surface protein’ (Esp) produced by E. faecalis (Espfs) or E. faecium (Esp fm) is an adhesin (Table 20.2) which appears to be chromosomally encoded in both species. The incidence of Espfs was shown to be enriched among clinical strains of E. faecalis, indicating a role in pathogenicity (Shankar et al., 1999), although this could not be confirmed by others (Waar et al., 2002). Eaton and Gasson (2002) found Espfm to be highly conserved in infection-derived isolates and environmental isolates, but absent in food and commensal isolates, which led them also to suggest a role in pathogenicity (Eaton and Gasson, 2002). Shankar et al. (2001) used an Esp +fs strain and an isogenic mutant in a mouse model of ascending urinary tract infection to show that Espfs contributed to colonisation and persistence of E. faecalis at this site. However, the Esp +fs strain did not influence histopathological changes in the animal model (Shankar et al., 2001). The presence of Espfs also increased cell hydrophobicity, adherence to abiotic surfaces and biofilm formation in vitro (Toledo-Arana et al., 2001). Espfs was suggested to promote colonisation of host tissue by direct ligandbinding activity to the extracellular matrix in the human host because of the similarity of Esp to microbial surface components recognising adhesive matrix molecules (MSCRAMMs) (Toledo-Arana et al., 2001). However, in an animal model with clindamycin-treated mice, Pultz et al. (2005) showed that Espfs facilitated neither colonisation nor translocation of E. faecalis. Esp was also suggested to have a function in evasion of the host’s immune response (Table 20.2), based on the observation that the overall structure of both Espfs

574

Emerging foodborne pathogens

and Espfm are comparable to that of MSCRAMMs for which such a ECM protein-binding role has been proposed (Rich et al., 1999; Shankar et al., 1999; Eaton and Gasson, 2002). Adhesin to collagen from E. faecalis (Ace) and from E. faecium (Acm) Ace and Acm are adhesins (Table 20.2) that also show structural similarity to MSCRAMMs of other Gram-positive bacteria, particularly to the collagen binding protein Cna of S. aureus (Rich et al., 1999; Nallapareddy et al., 2003). The structural organisation of all Ace, Acm and Cna are similar in that they contain an N-terminal signal sequence followed by the collagen-binding A domain, a B region that consists of repeat units, a cell wall domain with a characteristic LPKTS motif which is a potential target for sortase, a stretch of hydrophobic residues which are thought to stretch the membrane followed by a short cytoplasmic and charged tail (Nallapareddy et al., 2003). Because these proteins also contain repeat units and the number of repeats can be varied, these protein may also be involved in evasion of the immune response (Table 20.2) by mechanisms similar to those suggested by Shankar et al. (1999) for Esp. Ace not only binds to collagen (types I and IV) but also to laminin (Nallapareddy et al., 2000a,b). Nallapareddy et al. (2000b) showed that Ace was expressed by enterococci during human infections. Ninety percent of human sera collected from patients with E. faecalis endocarditis reacted with anti-Ace antibodies. Thus Ace may play an important role in pathogenesis of enterococci particularly during translocation, or when the intestinal epidermal layer is damaged and the underlying extracellular matrix proteins are exposed. As Enterococcus cells would become exposed to immune cells at this site, a mechanism for evading the immune system supplied by the same molecule involved in adherence may be an elegant solution for enterococci to increase their chances of survival. Acm, the collagen binding protein from E. faecium, was shown to bind collagen types I and IV by Nallapareddy et al. (2003) who also showed that particularly the clinical strains of E. faecium exhibited binding to collagen type I, while strains from the faeces of healthy human volunteers did not bind collagen I. The differences between binding capacity of clinical and community isolate strains was statistically significant, indicating that binding to collagen is a virulence factor. Interestingly, all community E. faecium isolates also contained the gene for Acm; however, this gene was in nonfunctional form as a result of nucleotide deletions or insertion of IS6770-like insertion sequence resulting in frame-shift mutations. While Ace and Acm share some (47%) amino acid sequence similarity, Acm has a far greater similarity at the primary sequence level (62%) to the collagen binding protein (Cna) of S. aureus (Nallapareddy et al., 2003). While the similarity of Acm to Ace appears to be confined to the A domain, Acm has similarity to both the A and B domains of Cna (Nallapareddy et al., 2003).

Enterococci

575

Enterococcus endocarditis antigen from E. faecalis (EfaAfs) or E. faecium (EfaAfm) Production of the adhesin-like E. faecalis and E. faecium endocarditis antigens (EfaAfs and EfaAfm, respectively) (Table 20.2) are considered to be potential virulence determinants, and expression of the EfaA was previously shown to be induced by growth of E. faecalis in serum (Lowe et al., 1995). The EfaAfs antigen shows high homology to adhesins such as FimA, SsaB ScaA and PsaA from streptococci. EfaAfs was suggested to play a role in adhesion in endocarditis (Lowe et al., 1995). However, so far only the efaAfs gene was shown to influence pathogenicity in animal models (Singh et al., 1998). The genetic determinant for production of EfaA has been sequenced and the efa operon consists of three genes (efaC, B, A) which have homology to ABCtype metal ion transport systems (Low et al., 2003). The first gene efaC encodes an ATP binding protein, the second (efaB) a hydrophobic transmembrane protein while the third (efaA) probably functions as a solute binding protein receptor for the ABC transporter complex. Low et al. (2003) suggested that EfaCBA is a manganese-regulated operon that functions as a high affinity manganese permease in E. faecalis. It plays a role in the infection of human tissues, where the Mn2+ availability may be as low as 20 nM (Low et al., 2003). Secreted virulence factors Sex pheromones Sex pheromones can be considered as virulence determinants (Table 20.2). They are cleavage products of 21 to 22 amino acid signal peptides that are associated with surface lipoproteins of unknown function (Clewell et al., 2000). These, as well as their surface exclusion proteins, are involved in causing pathological changes such as acute inflammation (Johnson, 1994). They are chemotactic for human and rat PMNs in vitro, and induce superoxide production and secretion of lysosomal enzymes (Ember and Hugli, 1989; Sannomiya et al., 1990; Johnson, 1994). Enterococcus faecium secreted antigen (Sag) The E. faecium secreted Antigen (Sag, Table 20.2) is a 53 kDA protein which is composed of three domains being a putative coiled-coil N-terminal domain, a central domain containing direct repeats and a C-terminal domain with similarity to the P45 and P60 proteins of L. monocytogenes, the latter of which is involved in L. monocytogenes virulence (Teng et al., 2003). This extracellular protein was considered essential for growth and is presumed to play a role in cell wall metabolism. Furthermore, Sag was shown to be capable of broad-spectrum binding to extracellular matrix proteins and was antigenic during infection (Teng et al., 2003). Superoxide and hydrogen peroxide Moy et al. (2004) used E. faecium mediated killing of the nematode worm

576

Emerging foodborne pathogens

Caenorhabditis elegans as an indicator of toxicity and could show that E. faecium produced hydrogen peroxide at levels sufficient to induce cellular damage. Transposon mutagenesis of the E. faecium strain studied showed that insertion mutants with altered C. elegans killing activity were altered in hydrogen peroxide production. Thus, mutation of an NADH oxidase encoding gene eliminated almost all NADH oxidase activity which resulted in reduced hydrogen peroxide production and decreased killing of C. elegans. Therefore, Moy et al. (2004) suggested that H2O2 may serve as a virulence determinant which may damage nearby host cells, although they admitted that the role of hydrogen peroxide in the pathogenesis of human disease is unclear, especially since the levels of H2O2 may be difficult to determine. Nevertheless, Huycke et al. (2002) showed that E. faecalis producing superoxide and hydrogen peroxide could damage eukaryotic cell DNA using both Chinese hamster ovary and HT-29 intestinal epithelial cells in the comet assay. In contrast, a transposon-inactivated mutant with attenuated extracellular superoxide production did not produce the same DNA-damaging effect. H2O2 arising from superoxide was identified as the actual genotoxin (Huycke et al., 2002). Furthermore, these authors showed in a rat model of intestinal colonisation that E. faecalis resulted in a significantly higher stool H2O2 concentration compared with rats colonised with a mutant strain which had decreased superoxide production. Furthermore, using the comet assay they showed that luminal cells from the colon of rats colonised with the superoxide producing E. faecalis showed significantly increased DNA damage compared with control rats colonised with the mutant (Huycke et al., 2002). Cytolysin The b-haemolysin/bacteriocin or cytolysin is a cellular toxin that enhances virulence in animal models (Ike et al., 1984; Jett et al., 1992, 1994; Chow et al., 1993; Gilmore et al., 1994) and is associated with acute mortality in humans (Huycke et al., 1991). The cytolysin gene is encoded either on pheromone-responsive plasmids or within a pathogenicity island. In addition to toxin activity, the extracellular and activated form of cytolysin (CylLS≤) also induces high level expression of the cytolysin structural genes by a quorum-sensing mechanism (Haas et al., 2002; Shankar et al., 2002). In Japan, it has been shown that 60% of clinical strains involved in parenteral infection had a haemolytic phenotype, compared with only 17% of isolates from the faeces of healthy individuals (Ike et al., 1987). Similar trends were observed in a study of E. faecalis bloodstream isolates in the United States (Huycke et al., 1991). However, in a European study, only 16% E. faecalis strains isolated from blood exhibited haemolytic activity (Elsner et al., 2000). Cytolysin production can be considered as a bacterial strategy to evade the host immune response by destroying cells of the immune system, as Miyazaki et al. (1993) showed that haemolytic culture supernatants of E. faecalis lysed mouse PMNs and macrophages. Production of cytolysin appears to be a major risk factor associated with pathogenic enterococci as Huycke et al.

Enterococci

577

(1991) determined a fivefold increased risk of death of patients within three weeks of bacteraemia caused by b-haemolytic enterococci, compared with bacteraemia caused by non-b-haemolytic strains (Huycke et al., 1991). Gelatinase Gelatinase is an extracellular Zn-metalloprotease (EC 3.4.24.30) that acts on a variety of substrates such as insulin-b chain, collagenous material in tissues, the vasoconstrictor edothelin-1, as well as sex-pheromones and their inhibitor peptides (Waters et al., 2003). Production of gelatinase increased pathogenicity in an animal model (Singh et al., 1998). Kühnen et al. (1988) reported that protease-producing E. faecalis were common (63.7%) among enterococci isolated from intensive care units in Germany, and Coque et al. (1995) showed that 54% of clinical enterococci isolates from patients with endocarditis and other nosocomial infections produced protease. The gene for gelatinase (gelE) is located in an operon together with a gene (sprE) encoding a serine protease (Qin et al., 2000). Mutants containing both defective gelE and sprE genes led to delayed time to death in a mouse peritonitis model (Singh et al., 1998; Qin et al. 2000), suggesting that both GelE and SprE are important in the infection in this animal model. However, the authors could not determine whether gelE independently influences the outcome of this enterococcal infection (Qin et al., 2000). Furthermore, while the presence of gelE and fsr (the regulatory genes for gelatinase and serine protease, see below) in entercocci may have an effect on the severity of disease in animal models, Roberts et al. (2004) compared the incidence of these genes among E. faecalis isolates from healthy individuals and from human infections, and found that neither fsr nor gelE was required for E. faecalis to cause infection. GelE was shown to cleave fibrin, which was suggested to have important implications in virulence of E. faecalis as the secreted protease can damage host tissue and thus allow bacterial migration and spread (Table 20.2). Waters et al. (2003) suggested that enterococci in blood infections and vegetations formed during endocarditis were likely to be coated with polymerised fibrin. Expression of GelE would lead to degradation of this fibrin layer surrounding the bacteria and allow further dissemination of the organism. In addition to its role in virulence, GelE was also shown to effect a variety of important housekeeping functions. For example, GelE clears the bacterial cell surface of misfolded proteins and is also responsible for activation of an autolysin. This muramidase-1 autolysin functions to reduce chain length (Waters et al., 2003). GelE also degrades sex-pheromones and their inhibitors. Waters et al. (2003) postulated that overall GelE plays a crucial role for dissemination of the organism in high cell-density environment. Accordingly, not only would degradation of fibrin aid in dissemination, but also reduction of chain length as a result of autolysin activation. Furthermore, once enterococcal growth reaches high densities, the degradation of sex-pheromones decreases aggregation of bacteria, which also increases the potential for dissemination (Waters et al., 2003).

578

Emerging foodborne pathogens

The supernatant from a gelatinase expressing E. faecalis strain was also shown to inactivate the antibacterial peptide LL-37 (Schmidtchen et al., 2002). The peptide LL-37 is part of the innate immune system and has been isolated from epithelial cells, neutrophils and subpopulations of lymphocytes and monocytes. Peptide LL-37 belongs to the family of antimicrobial peptides termed cathelicidins and is activated when cathelicidin hCAP-18 is processed by proteinase 3 (Schmidtchen et al., 2002). Degradation of antimicrobial peptides which are part of the innate immune system thus is a further GelEassociated enterococcal virulence factor (Table 20.2). Hyaluronidase Enterococci may produce hyaluronidase, an enzyme that degrades hyaluronic acid which is a major component of the extracellular matrix (Table 20.2). Because production of this enzyme was linked to pathogenesis of other microorganisms, it was suggested that it may also play a role in enterococcal pathogenesis. However, there is no direct evidence for the role of hyaluronidase in disease caused by enterococci (Jett et al., 1994; Rice et al., 2003). Recently, the gene sequence for the hyaluronidase gene hylEfm from an E. faecium strain was determined (Rice et al., 2003). This gene consisted of 1659 bp which encodes a putative protein of 533 amino acids which exhibits 42% identity and 60% similarity to a hyaluronidase from S. pyogenes (Rice et al., 2003). Rice et al. (2003) screened a large number of E. faecium strains for the incidence of hylEfm and espfm genes. These strains were from stool or non-stool origin isolated from both hospitalised and community based persons. Isolates from animals, waste water and probiotic strains were also investigated. They showed that the presence of espfm was roughly twice that of hylEfm and both genotypes were found primarily in vancomycin-resistant E. faecium isolates from non-stool cultures obtained from patients hospitalised in the United States. Their data suggested that specific E. faecium strains may be enriched in determinants that make them more likely to cause clinical infections (Rice et al., 2003). Capsule Koch et al. (2004) reported that about 57% of the pathogenic enterococci strains investigated possess a capsule. Huebner et al. (1999) purified a capsular polysaccharide and determined that it consisted of a repeat structure of kojibiose linked 1,2 to glycerolphosphate. By raising antibodies to this capsular polysaccharide, they used immunogold labelling to show the presence of the capsule surrounding enterococci in electron microscopic studies (Huebner et al., 1999). Hancock and Gilmore (2002) studied a different capsular polysaccharide from E. faecalis, of which the overall composition of the polymer showed some relation to the carbohydrate purified by Huebner et al. (1999). However, the capsular carbohydrate of Huebner et al. (1999) contained glucose, glycerol and phosphate in a 2:1:2 ratio, and that of Hancock and Gilmore (2002) contained glucose, galactose, glycerol and phosphate in

Enterococci

579

a 4:1:1:2 ratio. The nature of the linkages and the structure of the capsular polysaccharide were not determined by Hancock and Gilmore (2002). Using the capsular polysaccharide producing strain and an isogenic mutant in a murine cutaneous infection model, Hancock and Gilmore (2002) were also able to show that the mutant was more readily cleared from a resulting abscess, as measured by reduction in viable microorganisms from the abdominal lymph nodes that drain this site. This clearly indicated that the production of a capsule does offer some protection to the hosts defence mechanisms (Table 20.2) and that the production of a capsule by some enterococcal strains may play an important role in evasion of the immune response.

20.4.3 Regulation of Enterococcus virulence gene expression Production of aggregation substance (AS) is a tightly regulated phenotype, because autoinduction by a plasmid-bearing donor strain must be prevented. To counteract autoinducing activity, the plasmid-bearing donor cell also excretes a competitive inhibitor, which prevents self induction and which also provides the threshold that allows recipients in the immediate environment to overcome their inhibitory activity with their secreted pheromone (Hirt et al., 2002). For Asc10, the AS of the sex-pheromone plasmid pCF10, the inhibitor iCF10 is secreted at an 80-fold excess to the pheromone cCF10 (Hirt et al., 2002). Induction by cCF10 contained in the cell wall is prevented by cell membrane associated protein PrgY. Induction occurs if neighbouring cells tip the balance in favour of cCF10, which is bound in the cell wall by the pheromonebinding protein PrgZ and consequently imported into the cytoplasm by an Opp (oligopeptide permease) system. The pheromone then interacts with regulatory protein PrgX to allow AS expression. PrgX also controls the transcription of the prgQ promoter which allows production of iCF10 (Hirt et al., 2002). Hirt et al. (2002) showed that the AS of pCF10 is actually induced in vivo, and could increase pathogenicity, as measured by size of aortic valve vegetation in a rabbit endocarditis model. In addition, they showed that the expression of AS conferred a survival advantage to cells harbouring the plasmid and led to a highly efficient transfer of plasmid. The involvement of the pheromonesensing system for in AS expression in plasma was confirmed by the absence of AS induction in a mutant lacking the pheromone-sensing protein prgZ. An interaction of plasma components with the inhibitor peptide iCF10 was proposed as affecting the mating behaviour (Hirt et al., 2002). Production of cytolysin, as mentioned before, is also a regulated phenotype. Regulation is based on autoinduction and a two-component regulatory system that responds to quorum-sensing (Haas et al., 2002). The genes necessary for cytolysin production include cylLL, cylLS (encode structural cytolysin subunits), cylM (encodes protein for intracellular modification of cytolysin), cylB (encodes ABC transporter protein), cylA (encodes protein for extracellular cytolysin activation) and cylI (encodes immunity protein) which are arranged

580

Emerging foodborne pathogens

in a collinear fashion. Upstream of these biosynthesis and immunity genes on the opposite DNA strand are two ORFs (cylR2 and cylR1) which encode regulatory proteins, consisting of a non-globular, a-helical protein with a helix-turn-helix DNA-binding motif (CylR2) and an a-helical protein with three predicted transmembrane domains (CylR1). Together these were shown to repress the cytolysin operon. The inducer for expression of cytolysin was shown to be the smaller, active cytolysin subunit CylLS’’ as mentioned above. Unlike other well-known quorum-sensing systems, this two-component regulatory system did not consist of a protein histidine kinase and a response regulator, rather it depends on a small helix-turn-helix DNA-binding protein and a transmembrane protein of unknown function (Haas et al., 2002). Interestingly, Coburn et al. (2004) showed that E. faecalis can ‘sense’ target cells and in response express cytolysin. Thus, in the absence of target cells the CylLL’’ subunit of the cytolysin toxin forms a complex with the inducer CylLS’’ and blocks it from autoinducing the operon. When target cells are present, however, CylLL’’ binds preferentially to the target, allowing free CylLS’’ to accumulate above the induction threshold. Therefore, enterococci use CylLL’’ to actively probe the environment for target cells, and when these are detected, allows the bacterium to express high levels of cytolysin in response (Coburn et al., 2004). The Enterococcus faecalis endocarditis antigen EfaAfs, as mentioned above, is regulated by Mn2+. The efaCBA operon encodes a putative ABC transporter (Efa permease) of which the EfaA component forms the endocarditis antigen. Transcription of the efaCBA and EfaA production is repressed by Mn2+ by a Mn2+-responsive transcriptional regulator EfaR, which shares 27% identity with the Corynebacterium diphtheria diphtheria toxin repressor DtxR (Low et al., 2003). Low et al. (2003) suggested when Mn2+ is abundant, intracellular levels rise, resulting in EfaR-Mn2+ complexes that bind the efaCBA promoter, inhibiting transcription and hence reducing Mn2+ uptake. However, if bacteria encounter host tissues or human serum where Mn2+ availability is low, the EfaR apoprotein cannot bind the efaC promoter, de-repressing efaCBA expression and hence increasing Efa permease levels and Mn2+ scavenging. This may increase the survival of enterococci in the human environment and thus contribute to virulence. Production of gelatinase is another regulated phenotype. Upstream of the E. faecalis gelE and sprE genes, there are three genes designated fsr (for E. faecalis regulator, see above) that regulate the expression of gelE and sprE. These genes have homology with the Staphylococcus aureus agr genes. In S. aureus, the agr/hld locus contains five genes that encode a quorum-sensing system that regulates the expression of virulence factors (Recsei et al., 1985; Novick et al., 1993; 1995; Qin et al., 2000). The Agr regulatory system upregulates the expression of secreted proteins such as a-toxin, b-toxin, dtoxin, enterotoxin B, toxic shock syndrome toxin 1 and serine protease, and down-regulates surface proteins such as protein A, coagulase, and fibronectinbinding protein (Recsei et al., 1985; Qin et al., 2000). In this system, agrA

Enterococci

581

and agrC encode a response regulator and a sensor transducer, respectively, while agrD encodes a pheromone peptide that acts as an autoinducer (Qin et al., 2000). Qin et al. (2000) demonstrated that for the Fsr system, a cyclic peptide termed gelatinase biosynthesis-activated pheromone (GBAP) is the autoinducer (Nakayama et al., 2001a,b). The amino acid sequence of this peptide corresponds to the C-terminal part of a 242 amino acid protein encoded by fsrB (Nakayama et al., 2001a). The FsrA protein has 38% similarity to the AgrA protein that encodes the response regulator in the S. aureus Agr system, while FsrC has 36% similarity to the ArgC protein that is the sensor transducer of the Agr system (Qin et al., 2000). Homology of the Fsr system of E. faecalis to the Agr system of S. aureus, which plays such an important role in global regulation of S. aureus virulence, leads to the question whether the Fsr system plays a similar role in virulence regulation. So far, the Fsr system is only known to regulate two genes in E. faecalis, the gelatinase gene, gelE, and the serine protease gene, sprE. It was demonstrated that an fsrB deletion mutant attenuated the virulence in Caennorhabditis elegans and a mouse peritonitis model, as well as a rabbit endophthalmitis model, indicating the importance of this gene in virulence (Mylonakis et al., 2002; Sifri et al., 2002). In a rabbit model of endophthalmitis, it was further shown that virulence as result a mutation in the fsr regulator was more attenuated then the attenuation of virulence obtained when either the gelatinase or serine protease genes were inactivated, indicating pleitrophic effects on other traits contributing to pathogenesis of enterococcal infection (Engelbert et al., 2004). There is conflicting evidence on the association of fsr genes with enterococci isolated from infection. In one study (Pillai et al., 2002), the fsr locus was shown to be present in all E. faecalis isolates from cases of endocarditis, whereas only 53% of stool isolates possessed these genes. In contrast, another study found the incidences of neither the fsr genes nor the gelatinase production to be more common in disease associated Enterococcus isolates than in isolates colonising healthy individuals (Roberts et al., 2004). Teng et al. (2002) studied virulence of enterococci by disrupting twocomponent regulatory systems in Enterococcus faecalis. Such two-component regulatory systems, as mentioned above for gelatinase regulation, consist of a protein histidine kinase and a response regulator protein pair. Using the genome sequence information of E. faecalis V583 obtained from The Institute of Genomic Research (TIGR), they identified eleven homologues to the PhoP-PhoS global two-component regulatory system of Bacillus subtilis (Teng et al., 2002). Seven of these pairs were disrupted in E. faecalis strain OG1RF and one mutant, disrupted in the etaR gene of the gene pair designated etaRS, showed a delayed killing and a higher lethal dose in a mouse peritonitis model. In addition, they showed that the mutant was more sensitive to low pH and high temperature than the wild-type strain, indicating that etaRS may regulate different operon(s) involved in virulence and stress response (Teng et al., 2002).

582

Emerging foodborne pathogens

Oxidative stress is encountered by bacteria in many environments, but especially during the infection process as a result of the immune response. Under such conditions, many genes encoding antioxidant enzymes are induced in order to protect the microorganism against reactive oxygen species. Genes involved in the oxidative stress response of E. faecalis include ahpCF (alkyl hydroperoxide reductase), npr (NADH peroxidase), sod (superoxide dismutase and katA (catalase) genes (Verneuil et al., 2004). A mutation in the hypR gene sensitised E. faecalis to H2O2 treatment and greatly affected survival in murine peritoneal macrophages, while transcriptional analysis showed that hypR and ahpCF genes were repressed in the mutant (Verneuil et al., 2004). HypR was shown to directly regulate expression of hypR itself, as well as the ahpCF operon, and thus is a transcriptional regulator of the oxidative stress response and can be considered an E. faecalis virulence factor (Verneuil et al., 2004). Shepard and Gilmore (2002) used real-time PCR to study virulence-gene expression and show that AS, Esp, Ace, EfaA and Gel are induced in serum or urine. However, both environment and growth-phase variations were observed, demonstrating the occurrence of uncharacterised control mechanisms for gene expression that may play an important role in vivo (Shepard and Gilmore, 2002).

20.4.4 Antibiotic resistance A specific cause for concern and a contributing factor to pathogenesis of enterococci is their resistance to a wide variety of antibiotics (Murray, 1990; Landman and Quale, 1997; Leclercq, 1997). Enterococci are either intrinsically resistant and resistance genes are located on the chromosome, or they possess acquired resistance determinants which are located on plasmids or transposons (Clewell, 1990; Murray, 1990). Intrinsic antibiotic resistances include resistance to cephalosporins, b-lactams, sulphonamides and low levels of clindamycin and aminoglycosides, while acquired resistance include resistance to chloramphenicol, erythromycin, high levels of clindamycin and aminoglycosides, tetracycline, high levels of b-lactams, fluoroquinolones and glycopeptides such as vancomycin (Murray, 1990; Leclercq, 1997). Intrinsic resistance to many antibiotics suggests that treatment of infection could be difficult. However, combinations of cell-wall-active antibiotics such as penicillin or ampicillin with aminoglycosides (e.g., streptomycin, kanamycin and gentamicin) act synergistically and have been used successfully in the treatment of enterococcal infection (Moellering, 1990, 1991; Murray, 1990; Simjee and Gill, 1997). Since the early 1970s, a high level of streptomycin and gentamicin resistance was reported, and strains were also found resistant to penicillin-streptomycin or penicillin-gentamicin combinations (Moellering, 1990). In 1983, a strain of E. faecalis producing a b-lactamase identical to that produced by S. aureus was reported (Murray and Mederski-Samoraj, 1983), and it is believed that this strain of Enterococcus received the gene

Enterococci

583

from S. aureus (Murray et al., 1986). The hitherto successful penicillinaminoglycoside treatment was no longer a viable option, resulting in a major therapeutic problem (Moellering, 1991; Morrison et al., 1997). Vancomycin resistance is of special concern because this antibiotic was considered a last resort for treatment of multiple-resistant enterococcal infections. In addition, this antibiotic was given as an alternative to ampicillin or penicillin/aminoglycoside treatment to persons with allergy against penicillin or ampicillin (Morrison et al., 1997). In the mid-1990s in Europe the source of vancomycin-resistant enterococci (VRE) was shown to be most likely from farm animals as a result of ergotropic use of avoparcin, a glycopeptide antibiotic (Klare et al., 1995a,b; Das et al., 1997). In the USA, the situation with respect to nosocomial VRE infections appears to differ considerably from that in Europe, because avoparcin has not been licensed for use (McDonald et al., 1997). A community prevalence survey failed to isolate VRE from healthy volunteers without hospital exposure and from environmental sources or probiotic preparations (Coque et al., 1996). In contrast to Europe, transmission of VRE in the USA does not appear to be from the community to the hospital, and food has not been implicated as a possible vehicle for transmission. This indicates that clinical use of vancomycin is responsible for development of VRE. Currently, six types of glycopeptide resistance (vanA, vanB, vanC, vanD, vanE and vanG) have been described in enterococci and can be distinguished on the basis of the sequence of the structural gene encoding the resistance ligase (Depardieu et al., 2004). VanA type resistance is characterised by high levels of resistance to both vancomycin and teicoplanin, VanB-type resistance is characterised by resistance to variable levels of vancomycin but the strains are susceptible to teicoplanin. VanD-type strains are resistant to moderate levels of vancomycin, while VanC, VanE, and vanG-type strains exhibit low-level resistance to vancomycin only (Depardieu et al., 2004). The emergence of vancomycin-resistant enterococci (VRE) in hospitals has led to infections that cannot be treated with conventional antibiotic therapy and thus such strains pose a serious medical concern. Aware of the vancomycin and multiple resistance problem, the US Food and Drug Administration in 1999 approved the use of the streptogramin B/ A combination quinupristin-dalfopristin for treatment of VRE. Quinupristin/ dalfopristin (Synercid®) was next considered an antibiotic of last resort following the development of VRE (Jones et al., 1998; Werner et al., 2000). However, there was some concern about the use of this antibiotic due to the use of the analogue virginiamycin in agriculture in the USA for over 25 years. Thus, while low frequencies of streptogramin resistance were detected among E. faecium from human origin in the USA and in Europe, streptogramin resistance has been detected frequently among E. faecium strains of animal origin, especially among poultry isolates (Anonymous, 1999; Welton et al., 1998; Jensen et al., 1998, 2000; Werner et al., 2000; Hayes et al., 2001; Simonsen et al., 2004). In addition, clonal spread of streptogramin A resistance from farm animals to farmers has been shown to occur (Jensen et al., 1998;

584

Emerging foodborne pathogens

Werner et al., 2000), indicating that the incidence of Synercid-resistant enterococci from humans will, in all probability, rise. Linezolid is also an antibiotic use to combat VRE and was approved in 2001 by regulatory authorities in Europe and the USA. Linezolid is the first representative of a new class of antibiotics, the oxazolidinones which have a unique mode of action that blocks the assembly of a initiation complex for protein synthesis (Klos et al., 1999). In a surveillance study in Germany from November 2001 to June 2002 susceptibility data of 8,594 Gram-positive clinical isolates indicated a low prevalence of resistance for E. faecalis (2.3%) and E. faecium (1.4%) (Brauers et al., 2004). Nevertheless, first reports of development of linezolid resistance among clinical enterococci strains are emerging (Krawczyk et al., 2004; Raad et al., 2004; Liao et al., 2005) and resistance appears to be based on a single G2576U gene mutation in the 23S rRNA gene (Raad et al., 2004). Daptomycin is a novel, cyclic lipopeptide antibiotic which acts at the cytoplastic membrane of bacteria (Silverman et al., 2003). It has activity against Grampositive pathogens, particularly multiple resistant strains such as vancomycinresistant enterococci (Streit et al., 2004; Alder et al., 2005). In a study of 6,737 clinical Gram-positive organisms, enterococci showed the highest daptomycin MIC values, but almost all (797 of 798 isolates) tested were inhibited at a concentration of less than 4 mg/ml (Streit et al., 2004). Despite this apparent sensitivity of enterococci to daptomycin, recently an Enterococcus faecium strain was shown to become resistant during daptomycin therapy (Sabol et al., 2005). Clearly, although new antibiotics such as linezolid and daptomycin have become available in the post-VRE era, the development of resistance seems to be unstoppable and it will probably be only a question of time until multiple resistant strains will also become resistant to these new antibiotics.

20.4.5 Congruence of epidemiological and strain virulence profile data The involvement of a putative virulence determinant in the pathogenicity of enterococci can be difficult to determine. Undoubtedly, suitable epidemiological data which link the occurrence of a certain virulence factor at high incidence among clinical isolates appears to give a good indication of the relative contribution to virulence. Data derived from relevant cell cultures of animal models can provide valuable information about the role, and possible contribution of a putative virulence factor to virulence of the strain. But how do we know whether a virulence factor really contributes in a human infection and to what degree? Many data pertaining to incidence of virulence determinants in clinical strains, as well as cell culture and animal model data have been discussed in the section on enterococcal virulence factors above. However, together these do not constitute epidemiological data, as comparisons of virulence profile data from clinical isolates with community isolates, or data

Enterococci

585

on virulence determined in cell cultures or animal models do not directly relate to information about their relative contribution to the infection. For many, a direct involvement in pathogenicity has not yet been shown (e.g., hyaluronidase or E. faecium endocarditis antigen) and are thus often termed ‘potential’ virulence determinants. Roberts et al. (2004) studied 215 E. faecalis isolates from human infection and showed that neither the two-component regulatory locus fsr nor gelatinase production was more common in disease-associated isolates, and thus were not probably required for E. faecalis to cause infection. However, these findings obviously did not indicate whether Fsr or gelatinase affect the severity of the disease (Roberts et al., 2004). The data were in contrast to an earlier report which showed that all endocarditis isolates of E. faecalis, vs. 53% of stool isolates carried the fsr locus and thus was suggested to support virulence in the pathogenesis of enterococci (Pillai et al., 2002). In a molecular epidemiological survey, the presence of various virulence genes such as those encoding Ace, EfaA, CylA, GelE, AS, Esp and two novel surface antigens EF0591 and EF3314 among clinical isolates, and isolates from healthy individuals and the environment were determined (Creti et al., 2004). Some genes (e.g., ace, efaA and ef3314) were present in isolates from all sources, while esp and cylA genes were never detected in endocarditis isolates. The aggregation substance gene was shown to be always present in commensal isolates, and an association was noted between the esp gene and isolates from urinary tract infection and bacteraemia (Creti et al., 2004). Vankerckhoven et al. (2004) used multiplex PCR to simultaneously detect five virulence genes (asa1, cylA, gelE, esp and hyl) among clinical and faecal E. faecium isolates from inpatients at European hospitals. These authors showed that overall, the prevalence of esp was significantly higher in clinical vancomycinresistant isolates than in faecal isolates. In addition, these authors used pulsed field gel electrophoresis typing (PFGE) to show that there was a clonal, intrahospital spread of esp-positive vancomycin-resistant E. faecium clones in Italy, and of hyaluronidase-positive, vancomycin-resistant E. faecium clones in the United Kingdom (Vankerckhoven et al., 2004). Thus, while from the above studies Esp in particular appears to be quite important as a virulence determinant, there are other studies which cannot correlate the presence of a certain virulence determinants with increased virulence or pathogenicity based on epidemiological data. Vergis et al. (2002) studied the relationship between the presence of enterococcal virulence factors gelatinase, haemolysin, and Esp and the mortality among patients with bacteraemia due to E. faecalis and could not find a significant association between 14-day mortality and any of the markers studied, either singly or in combination. Baldassari et al. (2004) investigated the presence of genes for virulence determinants among enterococci isolated from endocarditis cases. These authors found only few isolates to harbour genes for Esp and haemolysin, while genes for aggregation substance and gelatinase were more common. Nevertheless, Baldassari et al. (2004) argued that predisposing factors,

586

Emerging foodborne pathogens

particularly hospitalisation and multiple antibiotic therapy, appeared to be more relevant to the development of enterococcal endocarditis. Clearly, therefore, the last word on the relevance of enterococcal virulence factors, either singly or in combination, to enterococcal pathogenesis has not been spoken. Much still needs to be revealed in connection to the relevance and relative contribution of such virulence factors to enterococcal disease. Recently, enterococci bearing so-called ‘pathogenicity islands’ have been described. This raises the question whether the presence of virulence genes clustered together on such a pathogenicity island constitutes a precondition for causing disease. Sequencing large parts of the genome of the clinical E. faecalis strains V583, V586 and MMH594 led to the discovery of a pathogenicity island of about 150 kb with a typical mol% G+C content which was different to the rest of the genome and which was flanked by two terminal repeats (Shankar et al., 2002). This pathogenicity island of E. faecalis MMH594 encoded a cytolysin operon, aggregation substance, Esp, a bile acid hydrolase, transcription regulators, transposases and other genes involved in adaptation and survival in different environments (Shankar et al., 2002). A 150 kb putative E. faecium pathogenicity island was also recently described by Leavis et al. (2004). This pathogenicity island had a lower mol% G+C content when compared to the chromosome and contained the gene for Esp, as well as other putative genes involved in virulence, transcription regulation and antibiotic resistance. Moreover, it appeared to be associated with epidemicity, since 13 of 14 clones analysed from different hospital outbreaks contained this pathogenicity island, but was absent from human surveillance and animal isolates (Leavis et al., 2004). Thus, in all possibility, the presence of virulence factors clustered on pathogenicity islands might more closely correlate with observed enterococcal pathogenicity than the presence of unlinked, single or multiple virulence determinants. However, more research would be required to investigate whether this is the case, but it should not be forgotten that predisposing factors such as multiple antibiotic use and host factors also greatly influence infection by enterococci.

20.5

Incidence of virulence factors among food enterococci

In recent years, an increasing number of studies have been carried out which have investigated the occurrence of virulence traits among food enterococci. Such studies have been primarily done to assess whether enterococci from foods bear the same types of virulence determinants when compared to clinical isolates and thus to evaluate the risk of human infection associated with food enterococcal strains. Furthermore, such studies may also allow the evaluation of the safety of strains which are intended for use as probiotics or possibly as starter cultures in cheese or sausage production. From the above discussion, however, this approach seems a little too simplistic because of the lack of congruence of the virulence determinants with observed

Enterococci

587

pathogenicity, as well as lacking information whether virulence determinants are linked and located on a pathogenicity island. Nevertheless, the importance of such investigations should also not be considered as negligible, as such first assessments of the virulence potential, however crude these may be, do offer some insight as well as an initial assessment of the perceived risk or safety of the strain, and can thus serve as selection criteria for strains which are intended for use in the food industry. In one of the first investigations on this topic, Eaton and Gasson (2001) showed that enterococcal virulence factors were present in food and medical isolates, as well as strains used as starter cultures. However, the incidence of virulence factors was highest among the medical strains, followed by food isolates and then the starter strains. Strains of E. faecalis were noted to harbour multiple virulence determinants, while E. faecium strains were generally clear of virulence determinants (Eaton and Gasson, 2001) (Table 20.3). A similarly low incidence of virulence factors was observed among E. faecium strains isolated from food in our studies, in which only a few strains produced either haemolysin (8.3%) or Esp (2.1%) (Franz et al., 2001). However, E. faecalis strains also harboured multiple virulence determinants, with a much higher incidence than in E. faecium. Further studies (Majhenic et al., 2005; Martin et al., 2005; Yousif et al., 2005) on the virulence of food enterococci strains showed similar trends in that virulence determinants are generally more commonly identified from E. faecalis strains when compared to E. faecium strains (Table 20.3) and that E. faecalis strains more often carry multiple virulence determinants. Some general trends regarding the virulence determinants were also be noted. For example, the gene encoding the E. faecalis and E. faecium endocarditis antigen (efaAfs or efaAfm) and the acm gene from E. faecium can be detected in more than 90% of food strains. Such wide distribution in food isolates may imply that these potential virulence determinants may not play a major role in enterococcal disease. Furthermore, these data (Table 20.3) clearly show that virulence factors such as gelatinase, aggregation substance and Esp generally occur at a very low incidence (<10%) among E. faecium food strains. Semedo et al. (2003) also reported that virulence determinants occurred among food, commensal and clinical isolates of enterococci, but that they were significantly associated with a high virulence potential among clinical isolates, whereas food and commensal strains harboured fewer virulence determinants. The finding that virulence determinants such as cytolysin, Esp, EfaAfs and EfaAfm were also found in other enterococcal species apart from E. faecalis and E. faecium, led these authors to speculate that the occurrence of virulence determinants is a common trait in the genus Enterococcus (Semedo et al., 2003). Because other Enterococcus species which may bear similar virulence traits, however, are not associated with infections to similar degrees as E. faecalis and E. faecium, it may again be argued that the presence of certain virulence factors may not suffice to explain why some enterococci strains cause disease and others do not.

588

Reported incidences of virulence factors among E. faecalis and E. faecium strains from foods % incidence of virulence factor of enterococci from foods Fermented sausages

For E. faecium strains: EfaA GelE ASa Esp Haemolysin or cytolysinb For E. faecalis strains: EfaA GelE AS Esp Haemolysin or cytolysin

(n=55) 100 5.5 5.5 5.5 nd (n=5) 100 100 100 99.3 nd

1

Fermented sorghum2

Cheese/other foods3

Cheese4

Foods5

(n=22) 90.9 0 0 9.1 0 na na na na na na

(n=48) nd 0 0 2.1 8.3 (n=47) nd 48 48.9 36.2 21.3

na na na na na na (n=10)) 100 70 100 50 50

(11) 82 0 0 0 0 (9) 89 78 67 33 44

nd: not determined; na: not applicable as no strains of the indicated species were investigated a: aggregation substance: data pertaining to information on either the clumping phenotype or presence of the asa1 gene b: haemolysin or cytolysin: data pertaining to information on either the presence of cytolysin genes or lysis on blood agar 1 data adapted from Martin et al. (2005) 2 data adapted from Yousif et al. (2005) 3 data adapted from Franz et al. (2001) 4 data adapted from Majhenic et al. (2005) 5 data adapted from Eaton and Gasson (2001)

Emerging foodborne pathogens

Table 20.3

Enterococci

589

20.6 Incidence of antibiotic resistance among food enterococci The incidence of antibiotic resistance among enterococci from food has also been subject to intense investigation (Klein et al., 1998; Davies and Roberts, 1999; Baumgartner et al., 2001; Franz et al., 2001; Mac et al., 2002; Hayes et al., 2003; Johnston and Jaykus, 2004). The result of some of these studies are shown in Table 20.4. These data show that, although many strains were resistant to one or more of the antibiotics, the majority of the isolates were sensitive to the clinically relevant antibiotics such as penicillin, ampicillin, streptomycin, and vancomycin (Klein et al., 1998; Baumgartner et al., 2001; Franz et al., 2001; Hayes et al., 2003; Johnston and Jaykus, 2004). Nevertheless, the occurrence of vancomycin-resistant strains and strains with multiple antibiotic resistances was also demonstrated (Baumgartner et al., 2001; Franz et al., 2001), which gives rise to concern. A further interesting aspect is that the antimicrobial resistance patterns of enterococci isolates from different meat types often differ, and appear to reflect the use of approved antimicrobial agents in the food animal production. For example, resistance to quinupristine/dalfopristine among enterococci isolates can be linked to the use of virginiamycin in poultry production (see also antibiotic resistance section above). Van den Bogaard et al. (2002) showed that the use of antimicrobial growth promoters in production of broilers in the Netherlands clearly led to a higher prevalence of antibioticresistant enterococci isolates (resistant to vancomycin, quinupristin/dalfopristin, high levels of gentamicin), when compared to isolates from laying hens for which the use of antibiotics as growth promoters is not common. The emergence of vancomycin-resistance as a result of ergotropic use serves as a further example which has been intensely investigated. Clearly, evidence is gathering that the therapeutic or growth promoting use of antimicrobials in animal husbandry has dramatic effects on the spread of antimicrobial resistances to human strains. One sad, but on the other hand also useful aspect (from a research point of view) of this is that antibiotic resistance determinants can be used as markers to follow the spread of strains and important routes of foodborne transmission can thus be revealed.

20.7

Survival of gastrointestinal transit

Evidence is gathering that enterococci from the environment or from foods can survive gastrointestinal transit and are able, at least transiently, to establish themselves in the human gastrointestinal tract. In a variety of studies, genetically indistinguishable enterococci have been found in both food animals, food products and humans, suggesting that food animal-derived enterococci may survive stomach passage and colonise the human gut (Bates et al., 1994; van den Bogaard et al., 1997; Descheemaeker et al., 1999; Jensen et al., 1999;

Reported incidences of antibiotic resistances among E. faecium and E. faecalis strains isolated from foods

Resistance to antibiotic

% incidence of resistance of enterococci from foods Fermented sausages1

Fermented sorghum2

Cheese/other foods3

Retail meats (turkey/chicken)4

Retail meats (pork/beef)4

Produce5

Ready to eat foods6

(n=55) 30.9 58.2 56.4 29.1 20 54.5 0 nd 1.8 69.1 (n=5)

(n=22) 0 9.1 31.8 0 0 13.6 0 0 13.6 nd na na na na na na na na na na na

(n=48) 0 45.8 27.1 6.3 10.4 56.3 2.1 4.2 2.1 nd (n=47) 2.1 12.8 63.8 44.7 31.9 27.7 25.5 46.8 0 nd

(n=213/245) 54/23 53/20 87/43 0.9/0.4 41/22 nd nd nd nd nd (n=110/51) nd 0 3 0 3 5 0 0 0 nd

(n=114/245) 4.4/2.8 9.6/8.7 60/39 0.9/0.4 7/19 nd nd nd nd nd (n=161/66) nd 0/0 42/33 94/67 0/0 0/0 nd nd nd nd

(n=97) nd 7 10 29 5 28 0 3 0 nd (n=38) nd 0.6/0 8.1/4.5 89/39 3.1/0 0.6/0 nd nd nd nd

(n=47) 6.4 12.8 29.8 17 2.1 25.5 nd nd 0 19.1 (n=52) 0 0 26.4 41.5 24.5 0 nd nd 0 11.3

93.3 86.7 93.3 46.7 0 nd 0 100

determined; na: not applicable as no E. faecalis strains were investigated adapted from Martin et al. (2005) adapted from Yousif et al. (2005) adapted from Franz et al. (2001) adapted from Hayes et al. (2003) adapted from Johnston and Jaykus (2004) adapted from Baumgartner et al. (2001

Emerging foodborne pathogens

For E. faecium strains: Ampicillin Penicillin Erythromycin Tetracycline Chloramphenicol Ciprofloxacin Gentamicin Streptomycin Vancomycin Rifampin For E. faecalis strains: Ampicillin Penicillin Erythromycin Tetracycline Chloramphenicol Ciprofloxacin Gentamicin Streptomycin Vancomycin Rifampin nd: not 1 data 2 data 3 data 4 data 5 data 6 data

590

Table 20.4

Enterococci

591

Stobberingh et al., 1999; Werner et al., 2000; Ozawa et al., 2002; Donabedian et al., 2003). Thus, it does appear that enterococci can in all probability be naturally transmitted from food animals or foods to the human gastrointestinal tract. One obvious factor is how well these bacteria are able to establish themselves in this environment. Studies done so far suggest that they will be present only transiently. Berchieri (1999) showed that ingestion of a vancomycin-resistant strain isolated from a chicken resulted in colonisation of his own gut for 20 days. Sørensen et al. (2001) showed that glycopeptideresistant E. faecium strains from chicken and a streptogramin-resistant E. faecium strain isolated from a pig could not be recovered from the stools of human volunteers 35 days after ingestion. Nevertheless, the resistant strains could still be isolated on day 14, indicating that they survived gastric passage and were able to multiply, but that there presence was indeed transient. The volunteers ingested 107 CFU of the strains, which was considered to be similar to the level of enterococci present in meat sold at grocery stored (Sørensen et al., 2001). In a study by Gelsomino et al. (2003), human volunteers consumed about 125 grams of Cheddar cheese which contained approx. 104 CFU enterococci/ g, mainly E. casseliflavus and E. faecium, daily for a 12-week period. Clonal relationships were determined by PFGE. In the pre-consumption period, E. faecium was the dominant organism in all subjects, followed by E. faecalis. During cheese consumption, the subjects showed a drastic change in their faecal flora. One particular transient clone of E. faecalis (clone Fs2), which was present in small numbers in the cheese, largely dominated the faeces of the human volunteers. These results indicated that a clone does not need to be present in a food in great numbers to establish itself in the intestine Gelsomino et al. (2003). Lund et al. (2002) showed that a probiotic E. faecium strain could not be recovered from the faeces of human volunteers 31 days after intake ceased. In all these studies, however, the human volunteers were healthy subjects. Speculatively, such colonisation may not be of a transient nature for debilitated persons and/or persons who receive antibiotic treatment. It has been shown, for example that enterococci may show a high colonisation potential in antibiotic treated mice (Dever and Handwerger, 1996; Donskey et al., 1999).

20.7.1 Transmission routes Much evidence has been recently gathered which shows that the food route, particularly the one involving animal foods, appears to be the major transmission route for (antibiotic-resistant) enterococci (or their resistance genes). Gelsomino et al. (2001a) studied the composition of enterococci associated with a small, artisanal-type cheese-making operation in Ireland and noted that E. casseliflavus and E. faecalis were the most frequently isolated species in the milk, curd and cheese samples, as well as in the faeces of the people associated with the cheesemaking. In a further study, Gelsomino

592

Emerging foodborne pathogens

et al. (2001b) used PFGE typing to show that three clones, one of E. faecalis and two of E. casseliflavus, dominated almost all of the milk, cheese and human faecal samples. They suggested that the source of these enterococci was probably the cheese, which was consumed by the farmers running the small-scale cheese production facility (Gelsomino et al. 2002). Other evidence of the food route of transmission comes from various studies which investigated clonal relationships between antibiotic-resistant enterococci from food animals, animal foods and human isolates (clinical of non-clinical stool isolates). Quite a few of these studies have been carried out recently and the majority showed that particular clones of enterococci strains could be isolated from both foods and human sources, indicating a direct route of foodborne transmission (Stobberingh et al., 1999; Werner et al., 2000; Ozawa et al., 2002; van den Bogaard et al., 2002; Donabedian et al., 2003; Garnier et al., 2004). Some of these studies, the antibiotic resistance markers used and the methods employed to determine clonal relatedness of strains are shown in Table 20.5. De Leener et al. (2005) determined relatedness between human, porcine and poultry Enterococcus faecium isolates and their erm(B) genes. The strains were typed using multilocus sequence typing (MLST). Interestingly, these investigations revealed three major clonal complexes which could be described as poultry-specific, pig-specific and human-specific, the last complex contained most of the human clinical isolates. Identical erm(B) sequences, however, were found in genetically linked, but also in genetically unrelated isolates from animals and humans. Furthermore, different erm(B) alleles were also found in genetically indistinguishable isolates. The authors concluded that this can indicate that resistance exchange between animals and humans possibly is due to direct transmission of resistant E. faecium strains, but horizontal exchange of the erm(B) gene between E. faecium isolates from animals and humans or the existence of a common reservoir of erm(B) genes might be more important (De Leener et al., 2005). Similarly, van den Braak et al. (1998) and van den Bogaard et al. (2002) also suggested that while clonal transmission of vancomycin-resistant enterococci from animals may occur, transposon transfer appears to be more common. Thus, not only should the dissemination of antibiotic-resistant bacteria be considered when studying transmission routes, it appears that the spread of antibiotic resistance determinants appears to be just as, if not more, important. While food is obviously a major route of enterococcal transmission, which may be explained by the enteric origin of enterococci in food animals and the high potential for contamination of meats during slaughter, it should not be forgotten that other contamination routes may also be quite important, especially because enterococci are such hardy bacteria. Thus the faecal contamination of waters or plants by food animals or by waste water, especially hospital waste water, may also contribute to the possible transmission of potentially harmful enterococci. Iversen et al. (2004) studied the occurrence of an ampicillin- and ciprofloxacin-resistant, nosocomial E. faecium strain

Table 20.5 Examples of studies where clonal relationships for enterococci from foods or animal sources and from humans (clinical and nonclinical isolates) have been shown, suggested a food route of transmission Food/animal source

Microorganism(s) investigated

Molecular marker

Methods to determine clonal relationships

Reference

Chicken

E. faecium E. faecalis E. faecium

Vancomycin-resistance

PFGE of SmaI digested genomic DNA

Ozawa et al. (2002)

Streptogramin A, macrolide-lincosamidestreptogramin B and chloramphenicol resistance VanA and VanC-types of vancomycin resistance

PCR analysis of linkage of resistance genes

Werner et al. (2000)

PFGE of SmaI digested genomic DNA Molecular characterisation of vanAcontaining transposons including RFLPa and sequence analysis PFGE of SmaI digested genomic DNA Molecular characterisation of vanAcontaining transposons including RFLPa and sequence analysis For VRE: PFGE of SmaI digested genomic DNA Molecular characterisation of vanAcontaining transposons including RFLPa and sequence analysis PFGE of SmaI digested genomic DNA

Garnier et al. (2004)

Poultry meat, poultry manure

Pork or poultry food products

faecium durans gallinarum casseliflavus faecium faecalis

Broiler and laying hen manure

E. E. E. E.

faecium faecalis hirae durans

Antibiotic resistances, vancomycin-resistance

Farm animals, retail foods

E. faecalis

Gentamicin-resistance

Turkey manure

a

Stobberingh et al. (1999) van den Bogaard et al. (2002)

Donabedian et al. (2003)

593

restriction fragment length polymorphism

Vancomycin-resistance

Enterococci

E. E. E. E. E. E.

594

Emerging foodborne pathogens

with a characteristic biochemical phenotype in human and environmental samples. They showed that Enterococcus isolates with the same biochemical phenotype as the nosocomial strain could be commonly isolated from hospital sewage and surface waters and also occurred, but less commonly, in treated sewage and untreated sewage. Using PFGE typing, they could show that the strains from hospital sewage were closely related to the nosocomial strain. Therefore, the study indicated a possible transmission route for nosocomial E. faecium from patients in hospitals to hospital and urban sewage, and further via water treatment plants to surface waters and possibly back to humans (Iversen et al., 2004). As shown above, enterococci appear well equipped to occur in a wide variety of habitats. Thus, when viewing these developments rather pessimistically, the dissemination of potentially dangerous enterococci from the hospital environment, the potential of enterococci to survive under a variety of adverse environmental conditions, increased antibiotic usage in animal husbandry and in hospitals may all in future favour the dissemination of potentially harmful enterococci. The foodborne transmission route may become more and more important as such enterococci are spread from water to vegetable foods and to animal farms. Clearly, prudent use of antibiotics in the food animal industry is a first necessary step to prevent such a disquieting scenario.

20.7.2 Transfer of virulence determinants/antibiotic resistance The transfer of virulence factors or antibiotic resistance genes from strains ingested with food to gastrointestinal strains is a further disturbing possibility. Recent studies have shown that this is a distinct possibility, yet we know nothing about the extent of such a potential problem. Eaton and Gasson (2001) studied the probability of gene transfer to starter culture strains in vitro by showing that virulence genes on a pheromone-response plasmid could be transferred to strains of E. faecalis used as starter cultures in food. However, they were not able to transfer virulence genes into strains of E. faecium starter cultures (Eaton and Gasson, 2001). Lund and Edlund (2001) showed that vancomycin-resistant genes could be transferred to a probiotic E. faecium strain in filter mating experiments. The same could be shown for the transfer to probiotic E. faecium strains used in animal nutrition by Klein and Pack (1997). However, in the study of Klein and Pack (1997) the transfer rate was considerably lower than that of a clinical E. faecium control strain. The possibility of transfer of virulence factors under in vivo conditions was studied by Huycke et al. (1992), using a hamster model of enterococcal intestinal overgrowth. They showed that pheromone-responsive plasmids carrying either antibiotic or cytolysin genes could be effectively transferred in the Hamster gastrointestinal tract, even in the absence of selective pressure with antibiotics (Huycke et al., 1992). Licht et al. (2002) used a new animal model, the streptomycin-treated mini-pig, to show that the pheromone-response plasmid pCF10 could be transferred in the gastrointestinal tract to other E.

Enterococci

595

faecalis strains, again even when there was no selective pressure with antibiotic (Licht et al., 2002). Lester et al. (2004) used streptomycin-treated mice as an animal model to show that conjugal transfer of aminoglycoside and macrolide resistance between E. faecium could occur under gastrointestinal conditions. As mentioned above, the horizontal transfer of antibiotic resistance genes responsible for resistance towards, e.g., macrolides and vancomycin, is also considered to occur and to be more important than clonal spread of the resistant organism (van den Braak et al., 1989; van den Bogaard, et al., 2002; de Leener et al., 2005).

20.8

Conclusion

Although knowledge on aspects of enterococcal taxonomy, their habitats and role in foods and in disease has greatly increased in the last few years, food microbiologists are still quite hard pressed when needing to make decisions whether these bacteria are a risk for consumers or not. While safety investigations have clearly shown that these bacteria occur in large numbers in foods, and that many strains can harbour (multiple) virulence determinants and/or antibiotic resistance genes, epidemiological investigations have shown that some virulence traits appear not to be important or relevant for enterococcal infections, and some enterococci can also cause infections even though they do not harbour known virulence traits. Thus, risk assessments based on such conflicting reports are somewhat difficult. This is especially true in the light of findings that virulence determinants such as aggregation substance, adhesins and cytolysin appear to be common in the genus Enterococcus and are frequently encountered in food strains (Eaton and Gasson, 2001; Franz et al., 2001; Semedo et al., 2003). From a food safety point of view, however, it may be argued that strains which possess multiple virulence determinants associated with various stages of infection (colonisation/adherence, translocation, evasion of the immune response and induction of pathological changes) may pose a higher theoretical risk than strains which possess a single virulence determinant (e.g., adhesion ability). This may also be deduced from the fact that clinical enterococci strains appear to harbour more virulence factors than food or commensal strains (Eaton and Gasson, 2001; Semedo et al., 2003). However, clear data about the relative importance of single or even multiple virulence determinants in food strains (and even clinical strains) are sorely lacking. The question whether food strains possess an intrinsic lower pathogenic potential than clinical isolates has still not been fully answered. In a genotyping study of E. faecium strains from humans, animals and food, Vancanneyt et al. (2002) found that all human clinical isolates of E. faecium fell into a defined subgroup, suggesting that there may be a genetic basis for strains associated with human disease. Thus, virulent sub-populations of strains of a species may exist, as was also suggested by the MLST study of de Leener

596

Emerging foodborne pathogens

et al. (2005), who could group all clinical E. faecium strains in a single clonal complex. Whether such virulent subpopulations are possibly explained by the presence of pathogenicity islands still remains to be determined. Even though data on the presence of virulence factors does not appear to correlate with pathogenic potential, there is a need for safety decisions to be made by food microbiologists. For practical present-day safety investigations therefore, it can be suggested that if an Enterococcus strain is considered for use as a starter culture or as a probiotic, each particular strain should be carefully evaluated for the presence of all known virulence factors in order to assess the potential risk for its use. Ideally, such strains should harbour no virulence determinants and should be sensitive to clinically relevant antibiotics. Because enterococci possess different gene transfer mechanisms (e.g., pheromone-responsive plasmids, conjugative and non-conjugative plasmids and transposons) it is feared that enterococci may readily acquire these determinants from other enterococcal strains. This represents a possible risk related to the use of enterococci as probiotics or starter cultures. Current data on the spread of antibiotic resistance genes, such as genes for vancomycin or macrolide resistance, indicate that this constitutes a threat that should be taken seriously. The above discussion shows that the use of enterococci in foods as starters or as probiotic cultures clearly represents a conundrum in the context of food safety. One should, however, not forget that enterococci are typically associated with the human environment, and in particular with the human gastrointestinal tract. They are also involved in most traditional food fermentations studied thus far, where they appear to play at least some positive role towards the development of product-specific, typical characteristics. Moreover, particular strains may be considered to be opportunistic pathogens, but it is doubtful that they would cause disease in healthy humans. This is supported by the fact that the morbidity of healthy humans resulting from foodborne enterococcal infections appears to be very low. Furthermore, there are probiotic strains on the market with a long history of safe use and large-scale commercial application. Thus in the final analysis, the ‘host factors’ (i.e. physiological condition, underlying disease, immunosuppression) appear to play a key or determining role in the establishment of an infection with enterococci, and contact of those at risk with these bacteria should be minimised.

20.9

References

AARESTRUP, F.M., HASMAN, H., JENSEN, L.B., MORENO, M., HERRERO, I.A., DOMÍNGUEZ, L., FINN, M.

and FRANKLIN, A. (2002). Antimicrobial resistance among enterococci from pigs in three European countries. Appl. Environ. Microbiol. 68, 4127–4129. AGERHOLM-LARSEN, L., BELL, M.L., GRUNWALD, G.K. and ASTRUP, A. (2000). The effect of a probiotic milk product on plasma cholesterol: a meta-analysis of short-term intervention studies. Eur. J. Clin. Nutr. 49, 346–352. AGUIRRE, M. and COLLINS, M.D. (1993). Lactic acid bacteria and human clinical infection. J. Appl. Bacteriol. 75, 95–107.

Enterococci ALDER, J.D.

597

(2005). Daptomycin: a new drug class for the treatment of Gram-positive infections. Drugs Today (Barc.) 41, 81–90. ANDRIGHETTO, C., KNIJFF, E., LOMBARDI, A., TORRIONI, S., VANCANNEYT, M., KERSTERS, K., SWINGS, J. and DELLAGLIO, F. (2001). Phenotypic and genetic diversity of enterococci isolated from Italian cheeses. J. Dairy Res. 68, 303–316. Anonymous (1998). Standard methods for the Examination of Water and Wastewater. Washington DC: American Public Health Association; American Works Association, Water Environment Federation. Anonymous (1999). Danish Integrated Antimicrobial Resistance Monitoring and Research Programme (DANMAP) 1998. Consumption of antimicrobial agents and occurrence of antimicrobial resistance in bacteria from food animals, food and humans in Denmark. Danish Zoonosis Centre, Copenhagen, Denmark. ARIZCUN, C., BARCINA, Y. and TORRE, P. (1997). Identification and characterisation of proteolytic activity of Enterococcus spp. isolated from milk and Roncal and Idiazabal cheese. Int. J. Food Microbiol. 38, 17–24. ASEHRAOU, A., FAID, M. and JANA, M. (1992). Physico-chemical properties and the microflora of Moroccan black table olives. Grasas y Aceites 43, 130–133. AYMERICH, T., HOLO, H., HÅVARSTEIN, L.S., HUGAS, M., GARRIGA, M. and NES, I.F. (1996). Biochemical and genetic characterisation of enterocin A from Enterococcus faecium, a new antilisterial bacteriocin in the pediocin family of bacteriocins. Appl. Environ. Microbiol. 62, 1676– 1682. AYMERICH, T., GARRIGA, M., YLLA, J., VALLIER, J., MONFORT, J.M. and HUGAS. M. (2000). Application of enterocins as biopreservatives against Listeria innocua in meat products. J. Food Prot. 63, 721–726. BAELE, M., BAELE, P., VANEECHOUTTE, M., STORMS, V., BUTAYE, P., DEVRIESE, L.A., VERSCHRAEGEN, G., GIKLIS, M. and HAESEBROUCK, F. (2000). Application of tRNA intergenic spacer PCR for identification of Enterococcus species. J. Clin. Microbiol. 38, 4201–4207. BALDASSARRI, L., CRETI, R., ARCIOLA, C.R., MONTANARO, L., VENDITTI, M. and DI ROSA, R. (2004). Analysis of virulence factors in cases of enterococcal endocarditis. Clin. Microbiol. Infect. 10, 1006–1008. BATES, J., JORDENS, J.Z. and GRIFFITHS, D.T. (1994). Farm animals as a putative reservoir for vancomycin-resistant enterococcal infection in man. J. Antimicrob. Chemother. 34, 507–516. BAUMGARTNER, A., KUEFFER, M. and ROHNER, P. (2001). Occurrence and antibiotic resistance of enterococci in various ready-to-eat foods. Archiv für Lebensmittelhygiene 52, 1–24. BELL, R.G. and GILL, C.O. (1982). Microbial spoilage of luncheon meat prepared in an impermeable plastic casing. J. Appl. Bacteriol. 53, 97–102. BELL, R.G. and DELACEY, K.M. (1984). Heat injury and recovery of Streptococcus faecium associated with the souring of chub-packed luncheon meat. J. Appl. Bacteriol. 57, 229–236. BELLOMO, G., MANGIAGLE, A., NICASTRO, L. and FRIGERIO, G. (1980). A controlled double-blind study of SF68 strain as a new biological preparation for the treatment of diarrhoea in pediatrics. Cur. Ther. Res. 28, 927–934. BERCHIERI A. (1999). Intestinal colonization of a human subject by vancomycin-resistant Enterococcus faecium. Clin. Microbiol. Infect. 5, 97–100. BJÖRKROTH, J., RISTINIEMI, M., VANDAMME, P. and KORKEALA, H. (2005). Enterococcus species dominating in fresh modified-atmosphere-packaged, marinated broiler legs are overgrown by Carnobacterium and Lactobacillus species during storage at 6∞C. Int. J. Food Microbiol. 97, 267–276. BLANCH, A.R., CAPLIN, J.L., IVERSEN, A., KÜHN, I., MANERO, A., TAYLOR, H.D. and VILANOVA, X. (2003). Comparison of enterococcal populations related to urban and hospital wastewater in various climatic and geographic European regions. J. Appl. Microbiol. 94, 994– 1002.

598

Emerging foodborne pathogens

BORGEN, K., SIMONSEN, G.S., SUNDSFJORD, A., WASTESON, Y., OLSVIK,

Ø. and KRUSE, H. (2001). Continuing high prevalence of VanA-type vancomycin-resistant enterococci on Norwegian poultry farms three years after avoparcin was banned. J. Appl. Microbiol. 89, 478–485. BOUTON, Y., GUYOT, P. and GRAPPIN. P. (1998). Preliminary characterization of microflora of Comté cheese. J. Appl. Microbiol. 85, 123–131. BRAUERS, J., KRESKEN, M., HAFNER, D. and SHAH, P.M. (2004). Surveillance of linezolid resistance in Germany, 2001–2002. Clin. Microbiol. Infect. 11, 39–46. CAPITA, R., ALONSO-CALLEJA, C., DEL CAMINO GARCÍA-FERNÁNDEZ, M. and MORENO, B. (2001). Microbiological quality of retail poultry carcasses in Spain. 64, 1961–1966. CARIDI, A., MICARI, P., FOTI, F., RAMONDINO, D. and SARULLO, V. (2003). Ripening and seasonal changes in microbiological and chemical parameters of the artisanal cheese Caprino d’Aspromonte produced from raw or thermized goat’s milk. Food Microbiol. 20, 201– 209. CASAUS, P., NILSEN, T., CINTAS, L.M., NES, I.F., HERNÁNDEZ, P.E. and HOLO, H. (1997). Enterocin B, a new bacteriocin from Enterococcus faecium T136 which can act synergistically with enterocin A. Microbiology 143, 2287–2294. CENTENO, J.A., MENÉNDEZ, S. and RODRÍGUEZ-OTERO, J.L. (1996). Main microbial flora present as natural starters in Cebreiro raw cow’s-milk cheese (Northwest Spain). Int. J. Food Microbiol. 33, 307–313. CENTENO, J.A., MENENDEZ, S., HERMIDA, M.A. and RODRIGUEZ-OTERO, J.L. (1999). Effects of the addition of Enterococcus faecalis in Cebreiro Cheese manufacture. Int. J. Food Microbiol. 48, 97–111. CHENOWETH, C. and SCHABERG, D. (1990). The epidemiology of enterococci. Eur. J. Clin. Microbiol. Infect. Dis. 9, 80–89. CHOI, S.H., LEE, S.-O., KIM, T.H., CHUNG, J.-W., CHOO, E.J., KWAK, Y. G., KIM, M.-N., KIM, Y. S., WOO, J.H., RYU, J. and KIM, N.J. (2004). Clinical features and outcomes of bacteremia caused by Enterococcus casseliflavus and Enterococcus gallinarum: Analysis of 56 cases. Clin. Infect. Dis. 38, 53–61. CHOW, J.W., THAL, L.A., PERRI, M.B., VAZQUEZ, J.A., DONABEDIAN, S.M., CLEWELL, D.B. and ZERVOS, M.J. (1993). Plasmid-associated hemolysin and aggregation substance production contribute to virulence in experimental enterococcal endocarditis. Antimicrob. Agents Chemother. 37, 2474–2477. CINTAS, L.M., CASAUS, P., HÅVARSTEIN, L.S., HERNÁNDEZ, P.E. and NES, I.F. (1997). Biochemical and genetic characterization of enterocin P, a novel sec-dependent bacteriocin from Enterococcus faecium P13 with a broad antimicrobial spectrum. Appl. Environ. Microbiol. 63, 4321–4330. CLEWELL, D.B. (1990). Movable genetic elements and antibiotic resistance in enterococci. Eur. J. Clin. Microbiol. Infect. Dis. 9, 90–102. CLEWELL, D.B. (1993). Bacterial sex pheromone-induced plasmid transfer. Cell 73, 9–12. CLEWELL, D.B., AN, F.Y., FLANNAGAN, S.E., ANTIPORTA, M. and DUNNY, G.M. (2000). Enterococcal sex pheromone precursors are part of signal sequences for surface lipoproteins. Mol. Microbiol. 35, 246–247. COBURN, P.S., PILLAR, C.M., JETT, B.D., HAAS, W. and GILMORE, M.S. (2004). Enterococcus faecalis senses target cells and in response expresses cytolysin. Science 306, 2270– 2273. COCOLIN, L., MANZANO, M., CANTONI, C. and COMI, G. (2001). Denaturing gradient gel electrophoresis analysis of the 16S rRNA gene V1 region to monitor dynamic changes in the bacterial population during fermentation of Italian sausages. Appl. Environ. Microbiol. 67, 5113–5121. COLLINS, M.D., WILLIAMSON, R. and FARROW, J.A.E. (1989). Enterococcus raffinosus sp. nov., Enterococcus solitarius sp. nov. and Enterococcus pseudoavium sp. nov. FEMS Microbiol. Lett. 57, 283–288.

Enterococci COLLINS, M.D., WILLIAMS, A.M.

599

and WALLBANKS, S. (1990). The phylogeny of Aerococcus and Pediococcus as determined by 16S rRNA sequence analysis: description of Tetragenococcus gen. nov. FEMS Microbiol. Lett. 70, 255–262. COPPOLA, S., PARENTE, E., DUMONTET, S. and LA PECCERELLA, A. (1988). The microflora of natural whey cultures utilized as starters in the manufacture of Mozzarella cheese from water-buffalo milk. Lait 68, 295–310. COQUE, T.M., PATTERSON, J.E., STECKELBERG, J.M. and MURRAY, B.E. (1995). Incidence of hemolysin, gelatinase, and aggregation substance among enterococci isolated from patients with endocarditis and other infections and from the feces of hospitalized and communitybased persons. J. Infect. Dis. 171, 1223–1229. COQUE, T.M., TOMAYKO, J.F., RICKE, S.C., OKHYUSEN, P.C. and MURRAY, B.E. (1996). Vancomycinresistant enterococci from nosocomial, community, and animal sources in the United States. Antimicrob. Agents Chemother. 40, 2605–2609. CORSO, A.F., FACCONE, D., GAGETTI, P., TOGNERI, A., LOPARDO, H., MELANO, R., RODRIGUEZ, V., RODRIGUEZ, M. and GALAS, M. (2005). First report of VanA Enterococcus gallinarum dissemination within an intensive care unit in Argentina. Int. J. Antimicrob. Agents. 25, 51–56. COSENTINO, S., PISANO, M.B., CORDA, A., FADDA, M.E. and PIRAS, C. (2004). Genotypic and technological characterization of enterococci isolated from artisanal Fiore Sardo cheese. J. Dairy Res. 71, 444–450. CRETI, R., IMPERI, M., BERTUCCINI, L., FABRETTI, F., OREFICI, G., DIROSA, R. and BALDASSARI, L. (2004). Survey for virulence determinants among Enterococcus faecalis isolated from different sources. J. Med. Microbiol. 53, 13–20. D’APUZZO, V. and SALZBERG, R. (1982). Die Behandlung der akuten Diarrhöe in der Pädiatrie mit Streptococcus faecium: Resultate einer Doppelblindstudie. Therapeutische Umschau 39, 1033–1035. DARGERE, S., VERGNAUD, M., VERDON, R., SALOUX, E., LE PAGE, O., LECLERCQ, R. and BAZIN, C. (2002). Enterococcus gallinarum endocarditis occurring on native heart valves. J. Clin. Microbiol. 40, 2308–2310. DAS, I., FRAISE, A. and WISE, R. (1997). Are glycopeptide–resistant enterococci in animals a threat to human beings? Lancet 349, 997–998. DAVIES, R. and ROBERTS, T.A. (1999). Antimicrobial susceptibility of enterococci recovered from commercial swine carcasses: effect of feed additives. Lett. Appl. Microbiol. 29, 327–333. DEASY, B.M., REA, M.C., FITZGERALD, G.F., COGAN, T.M. and BERESFORD, T.P. (2000). A rapid PCR method to distinguish between Lactococcus and Enterococcus. Syst. Appl. Microbiol. 23, 510–522. DE CASTRO, A., MONTAÑO, A., CASADO, F.-J., SÁNCHEZ, A.-H. and REJANO, L. 2002. Utilization of Enterococcus casseliflavus and Lactobacillus pentosus as starter cultures for Spanishstyle green olive fermentation. Food Microbiol. 19, 637–644. DEFERNANDO, G.D.G., SANZ, B., ASENSIO, M.A. and ORDOÑEZ, J.A. (1992). Effect of extracellular protease of Enterococcus faecalis subsp. liquefaciens on protein breakdown in cheese. Milchwissenschaft. 47, 420–422. DE GRAEF, E.M., DEVRIESE, L.A., VANCANNEYT, M., BAELE, M., COLLINS, M.D., LEFEBVRE, K., SWINGS, J. and HAESEBROUCK, F. (2003). Description of Enterococcus canis sp. nov. from dogs and reclassification of Enterococcus porcinus (Teixeira et al. 2001) as a junior synonym of Enterococcus villorum. Int. J. Syst. Evol. Microbiol. 53, 1069–1074 (published online 13 December 2002). DE LEENER, E., MARTEL, A., DE GRAEF, E.M., TOP, J., BUTAYE, P., HAESEBROUCK, F., WILLEMS, R. and DECOSTERE, A. (2005). Molecular analysis of human, porcine, and poultry Enterococcus faecium isolates and their erm(B) genes. Appl. Environ. Microbiol. 71, 2766–2770. DELGADO, S., DELGADO, T. and MAYO, B. (2002). Technological performance of several Lactococcus and Enterococcus strains of dairy origin in milk. J. Food Prot. 65, 1590– 1596.

600

Emerging foodborne pathogens

DEL POZO, B.F., GAYA, P., MEDINA, M., RODRÍGUEZ-MARÍN, M.A.

and NUÑEZ, M. (1988). Changes in the microflora of La Serena ewes’ milk cheese during ripening. J. Dairy Res. 55, 449–455. DEPARDIEU, F., PERICHON, B. and COURVALIN, P. (2004). Detection of the van alphabet and identification of enterococci and staphylococci at the species level by multiplex PCR (2004). J. Clin. Microbiol. 42, 5857–5860. DESCHEEMAEKER, P.R.M., LAMMENS, C., POT, B., VANDAMME, P. and GOOSSENS, H. (1997). Evaluation of arbitrarily primed PCR analysis and pulsed-field gel electrophoresis of large genomic DNA fragments for identification of enterococci important in human medicine. Int. J. Syst. Bacteriol. 47, 555–561. DESCHEEMAEKER, P.R.M., CHAPELLE, S., DEVRIESE, L.A., BUTAYE, P. VANDAMME, P. and GOOSSENS, H. (1999). Comparison of glycopeptide-resistant Enterococcus faecium isolates and glycopeptide resistance genes of human and animal origins. Antimicrob. Agents, Chemother. 43, 2032–2037. DEVER, L. and HANDWERGER, S. (1996). Persistence of vancomycin-resistant Enterococcus faecium gastrointestinal tract colonization in antibiotic-treated mice. Microb. Drug. Resist. 2, 415–421. DEVRIESE, L.A. and POT, B. (1995). The genus Enterococcus. In: B.J.B. Wood and W.H. Holzapfel (editors), The Lactic Acid Bacteria, The Genera of Lactic Acid Bacteria, Vol. 2. (Blackie Academic: London), pp. 327–367. DEVRIESE, L.A., VAN DE KERCKHOVE, A., KILPPER-BÄLZ, R., SCHLEIFER, K.H. and PHILLIPS, B.A. (1987). Characterization of and identification of Enterococcus species isolated from animals. Int. J. Syst. Bacteriol. 37, 257–259. DEVRIESE, L.A., HOMMEZ, J., WIJFELS, R. and HAESEBROUCK, F. (1991). Composition of the enterococcal and streptococcal intestinal flora of poultry. J. Appl. Bacteriol. 71, 46– 50. DEVRIESE, L.A., CRUZ, C.J., DE-HERDT, P. and HAESEBROUCK, F. (1992). Identification and composition of the tonsillar and anal enterococcal and streptococcal flora of dogs and cats. J. Appl. Bacteriol. 73, 421–425. DEVRIESE, L.A., POT, B. and COLLINS, M.D. (1993). Phenotypic identification of the genus Enterococcus and differentiation of phylogenetically distinct enterococcal species and species groups. J. Appl. Bacteriol. 75, 399–408. DEVRIESE, L.A., HOMMEZ, J., POT, B. and HAESEBROUCK, F. (1994). Identification and composition of the streptococcal and enterococcal flora of tonsils, intestines and faeces of pigs. J. Appl. Bacteriol. 77, 31–36. DEVRIESE, L.A., POT, B., VAN DAMME, L., KERSTERS, K. and HAESEBROUCK, F. (1995). Identification of Enterococcus species isolated from foods of animal origin. Int. J. Food Microbiol. 26, 187–197. DEVRIESE, L., BAELE, M. and BUTAYE, P. (2003). The genus Enterococcus. In: M. Dworkin, S. Falkow, E. Rosenberg, K.-H. Schleifer and E. Stackebrandt (eds). The Prokaryotes, 3rd edition, ISBN 0-387-14254-1. http://www.prokaryotes.com DOMIG, K.J., MAYER, H.K. and KNEIFEL, W. (2003). Methods used for the isolation, enumeration, characterisation and identification of Enterococcus spp.:2. Pheno- and genotypic criteria. Int. J. Food Microbiol. 88, 147–164. DONABEDIAN, S.M., THAL, L.A., HERSHBERGER, E., PERRI, M.B., CHOW, J.W., BARTLETT, P., JONES, R., JOYCE, K., ROSSITER, S., GAY, K., JOHNSON, J., MACKINSON, C., DEBESS, E., MADDEN, J., ANGULO, F. and ZERVOS, M.J. (2003). Molecular characterization of gentamicin-resistant enterococci in the United States: evidence of spread from animals to humans through food. J. Clin. Microbiol. 41, 1109–1113. DONSKEY, C.J., HANRAHAN, J.A., HUTTON, R.A. and RICE, L.B. (1999). Effect of parenteral antibiotic administration on persistence of vancomycin-resistant Enterococcus faecium in the mouse gastrointestinal tract. J. Infect. Dis. 180, 384–390. DUNNY, G.M., LEONARD, B.A. and HEDBERG, P.J. (1995). Pheromone-inducible conjugation in Enterococcus faecalis: Interbacterial and host-parasite chemical communication. J. Bacteriol. 177, 871–876.

Enterococci DURLU-OZKAYA, F., XANTHOPOULOS, V., TUNAIL, N.

601

and LITOPOULOU-TZANETAKI, E. (2001). Technologically important properties of lactic acid bacteria isolates from Beyaz cheese made from raw ewes’ milk. J. Appl. Microbiol. 91, 861–870. EATON, T.J. and GASSON, M.J. (2001). Molecular screening of Enterococcus virulence determinants and potential for genetic exchange between food and medical isolates. Appl. Environ. Microbiol. 67, 1628–1635. EATON, T.J. and GASSON, M.J. (2002). A variant enterococcal surface protein Espfm in Enterococcus faecium; distribution among food, commensal, medical, and environmental isolates. FEMS Microbiol. Lett. 216, 269–275. ELSNER, H.-A., SOBOTTKA, I., MACK, D., CLAUSSEN, M., LAUFS, R., and WIRTH, R. (2000). Virulence factors of Enterococcus faecalis and Enterococcus faecium blood culture isolates. Eur. J. Clin. Microbiol. Infect. Dis. 19, 39–42. EMBER, J.A. and HUGLI, T.E. (1989). Characterization of the human neutrophil response to sex pheromones from Streptococcus faecalis. Am. J. Pathol. 134, 797–805. ENGELBERT, M., MYLONAKIS, E., AUSUBEL, F.M., CALDERWOOD, S.B. and GILMORE, M.S. (2004). Contribution of gelatinase, serine protease, and fsr to the pathogenesis of Enterococcus faecalis endophthalmitis. Infect Imm. 72, 3628–3633. ENNAHAR, S. and CAI, Y. (2005). Biochemical and genetic evidence for the transfer of Enterococcus solitarius to the genus Tetragenococcus as Tetragenococcus solitarius comb. nov. Int. J. Syst. Evol. Microbiol. 55, 589–592. FERNÁNDEZ DÍEZ, M.J. (1983). Olives. In: H.-J Rehm and G. Reed (editors). Biotechnology. Vol. 5. Food and feed production by microorganisms. (Verlag Chemie: Weinheim) pages 379–397. FLORIANO , B., RUIZ-BARBA , J .L . and JIMÉNEZ -DÍAZ, R. (1998). Purification and genetic characterization of enterocin I from Enterococcus faecium 6T1a, a novel antilisterial plasmid-encoded bacteriocin which does not belong to the pediocin family of bacteriocins. Appl. Environ. Microbiol. 64, 4883–4890. FORTINA, M.G., RICCI, G., MORA, D. and MANACHINI, P.L. (2004). Molecular analysis of artisanal Italian cheeses reveals Enterococcus italicus sp. nov. Int. J. Syst. Evol. Microbiol. 54, 1717–1721. FRANZ, C.M.A.P., HOLZAPFEL, W.H. and STILES, M.E. (1999). Enterococci at the crossroads of food safety? Int. J. Food Microbiol. 47, 1–24. FRANZ, C.M.A.P., MUSCHOLL-SILBERHORN, A.B., YOUSIF, N.M.K., VANCANNEYT, M., SWINGS, J. and HOLZAPFEL, W.H. (2001). Incidence of virulence factors and antibiotic resistance among enterococci isolated from food. Appl. Environ. Microbiol. 67, 4385–4389. FRANZ, C.M.A.P., SCHLEIFER, K.H., STILES, M.E. and HOLZAPFEL, W.H. (2003). Enterococci in foods – a conundrum for food safety. Int. J. Food. Microbiol. 88, 105–122. FREITAS, A.C., PAIS, C., MALCATA, F.X. and HOGG, T.A. (1995). Microbiological characterization of Picante de Beira Baixa cheese. J. Food Prot. 59, 155–160. GARCIA, M.C., RODRIGUEZ, M.J., BERNARDO, A., TORNADIJO, M.E. and CARBALLO, J. (2002). Study of enterococci and micrococci Isolated throughout manufacture and ripening of San Simon cheese. Food Microbiol. 19. 23–23. GARNIER, F., GAMBAROTTO, K., DENIS, F. and PLOY, M.-C. (2004). Molecular study of vancomycinresistant enterococci isolated from humans and from food in a cattle-rearing area of France. J. Antimicrob. Chemother. 54, 236–239. GARRIDO-FERNANDEZ, A. and VAUGHN, R.H. (1978). Utilization of oleuropein by microorganisms associated with olive fermentations. Can. J. Microbiol. 24, 680–684. GELSOMINO, R., VANCANNEYT, M., CONDON, S., SWINGS, J. and COGAN, T.M. (2001a). Enterococcal diversity in the environment of an Irish Cheddar-type cheesemaking factory. Int. J. Food Microbiol. 71, 177–188. GELSOMINO, R., VANCANNEYT, M., COGAN, T.M., CONDON, S. and SWINGS, J. (2001b). Source of enterococci in a farmhouse raw-milk cheese. Appl. Environ. Microbiol. 68, 3560– 3565.

602

Emerging foodborne pathogens

GELSOMINO, R., VANCANNEYT, M., COGAN, T.M.

and SWINGS, J. (2003). Effect of raw-milk cheese consumption on the enterococcal flora on human faeces. Appl. Environ. Microbiol. 69, 312–319. GILMORE, M.S., SEGARRA, R.A., BOOTH, M.C., BOGIE, C.P., HALL, L.R. and CLEWELL, D.B. (1994). Genetic structure of the Enterococcus faecalis plasmid pAD1-encoded cytolytic toxin system and ist relationship to lantibiotic determinants. J. Bacteriol. 176, 7335–7344. GIRAFFA, G. (2002). Enterococci from foods. FEMS Microbiol. Rev. 26, 163–171. GIRAFFA, G. (2003). Functionality of enterococci in dairy products. Int. J. Food Microbiol. 88, 215–222 GIRAFFA, G., CARMINATI, D. and NEVIANI, E. (1997). Enterococci isolated from dairy products: a review of risks and potential technological use. J. Food Prot. 60, 732–738. GODFREE, A.F., KAY, D. and WYER, M.D. (1997). Faecal streptococci as indicators of faecal contamination in water. Soc. Appl. Bacteriol. Symp. Ser. 26, 110S–119S. HAAS, W., SHEPARD, B.D. and GILMORE, M.S. (2002). Two-component regulator of Enterococcus faecalis cytolysin responds to quorum-sensing autoinduction. Nature 415, 84–87. HAMAD, S.H., DIENG, M. C., EHRMANN, M. A. and VOGEL, R. F. (1997). Characterisation of the bacterial flora of Sudanese sorghum flour and sorghum sourdough. J. Appl. Microbiol. 83, 764–770. HANCOCK, L.E. and GILMORE, M.S. (2002). The capsular polysaccharide of Enterococcus faecalis and its relationship to other polysaccharides in the cell wall. Proc. Natl. Acad. Sci. USA 99, 1574–1579. HARDIE, J.M. and WHILEY, R.A. (1997). Classification and overview of the genera Streptococcus and Enterococcus. J. Appl. Microbiol. Symp. Suppl. 83, 1S–11S. HARWOOD, V.J., DELAHOYA, N.C., ULRICH, R.N., KRAMER, M.F., WHITLOCK, J.E., GAREY, J.R., and LIM, D.V. (2004) Molecular confirmation of Enterococcus faecalis and Enterococcus faecium from clinical, faecal and environmental sources. Lett. Appl. Microbiol. 38, 476–482. HAYES, J.R., MCINTOSH, A.C., QAIYUMI, S., JOHNSON, J.A., ENGLISH, L.L., CARR, LO.E., WAGNER, D.D. and JOSEPH, S.W. (2001). High-frequency recovery of quinupristin-dalfopristin-resistant Enterococcus faecium isolates from the poultry production environment. J. Clin. Microbiol. 39, 2298–2299. HAYES, J.R., ENGLISH, L.L., CARTER, P.J., PROESCHOLDT, T., LEE, K.Y., WAGNER, D.D. and WHITE, D.G. (2003). Prevalence and antimicrobial resistance of Enterococcus species isolated from retail meats. Appl. Environ. Microbiol. 69, 7153–7160. HERRANZ, C., MUKHOPADHYAY, S., CASAUS, P., MARTÍNEZ, J.M., RODRÍGUEZ, J.M., NES, I.F., CINTAS, L.M. and HERNÁNDEZ, P.E. (1999). Biochemical and genetic evidence of enterocin P production by two Enterococcus faecium-like strains isolated from fermented sausages. Curr. Microbiol. 39, 282–290. HIGASHIDE, T., TAKAHASHI, M., KOBAYASHI, A., OHKUBO, S., SAKURAI, M., SHIRAO, Y., TAMURA, T. and SUGIYAMA, K. (2005). Endophthalmitis caused by Enterococcus mundtii. J. Clin. Microbiol. 43, 1475–1476. HIRT, H., SCHLIEVERT, P.M. and DUNNY, G.M. (2002). In vivo induction of virulence and antibiotic resistance transfer in Enterococcus faecalis mediated by the sex pheromonesensing system of pCF10. Infect. Immun. 70, 716–723. HOUBEN, J .H. (1982). Heat resistance of Streptococcus faecium in pasteurized ham. Fleischwirtschaft 62, 490–493. HUEBNER, J., WANG, Y., KRUEGER, W.A., MADOFF, L.C., MARTIROSIAN, G., BOISOT, S., GOLDMANN, D. A ., KASPER , D .L., TZIANABOS, A. O. and PIER, G. B. (1999). Isolation and chemical characterization of a capsular polysaccharide antigen shared by clinical isolates of Enterococcus faecalis and vancomycin-resistant Enterococcus faecium. Infect. Immun. 67, 1213–1219. HUGAS, M., GARRIGA, M. and AYMERICH, M.T. (2003). Functionalty of enterococci in meat products. Int. J. Food Microbiol. 88, 223–233.

Enterococci HUYCKE, M.M., SPIEGEL, C.A.

603

and GILMORE, M.S. (1991). Bacteremia caused by hemolytic, high-level gentamycin-resistant Enterococcus faecalis. Antimicrob. Agents Chemother. 35, 1626–1634. HUYCKE, M.M., GILMORE, M.S., JETT, B.D. and BOOTH, J.L. (1992). Transfer of pheromoneinducible plasmids between Enterococcus faecalis in the Syrian hamster gastrointestinal tract. J. Infect. Dis. 166, 1188–1191. HUYCKE, M.M., ABRAMS, V. and MOORE, D.R. (2002). Enterococcus faecalis produces extracellular superoxide and hydrogen peroxide that damages colonic epithelial cells DNA. Carcinogenesis 23, 529–536. HUYS, G., D’HAENE, K., COLLARD, J.M., and SWINGS, J. (2004). Prevalence and molecular characterization of tetracycline resistance in Enterococcus isolates from food. Appl. Environ. Microbiol. 70, 1555–1562. IARIA, C., STASSI, G., COSTA, G.B., DI LEO, R., TOSCANO, A. and CASCIO, A. (2005). Enterococcus meningitis caused by Enterococcus casseliflavus. First case report. BMC Infect. Dis. 5, 3. IKE, Y., HASHIMOTO, H. and CLEWELL, D.B. (1984). Hemolysin of Streptococcus faecalis subspecies zymogenes contributes to virulence in mice. Infect. Immun. 45, 528–530. IKE, Y., HASHIMOTO, H. and CLEWELL, D.B. (1987). High incidence of hemolysin production by Enterococcus (Streptococcus) faecalis strains associated with human parenteral infections. J. Clin. Microbiol. 25, 1524–1528. IVERSEN, A., KÜHN, I., RAHMAN, M., FRANKLIN, A., BURMAN, L.G., OLSSON-LILJEQUIST, B., TORELL, E., and MÖLLBY, R. (2004). Evidence for transmission between humans and the environment of a nosocomial strain of Enterococcus faecium. Environ. Microbiol. 6, 55–59. JENSEN, J.P., REINBOLD, G.W., WASHAM, C.J. and VEDAMUTHU, E.R. (1975). Role of enterococci in Cheddar cheese: organoleptic considerations. J. Milk Food Technol. 38, 142–145. JENSEN, L.B., HAMMERUM, A.M., AARESTRUP, F.M., VAN DEN BOGAARD, A.E. and STOBBERINGH, E.E. (1998). Occurrence of satA and vgb genes in streptogramin-resistant Enterococcus faecium isolates from animal and human origins in The Netherlands. Antimicrob. Agents. Chemother. 42, 3330–3331. JENSEN, L.B., HAMMERUM, A.M., POULSEN, R.L. and WESTH, H. (1999). Vancomycin-resistant Enterococcus faecium strains with highly similar pulsed-field gel electrophoresis patterns containing similar Tn1546–like elements isolated from a hospitalized patient and pigs in Denmark. Antimicrob. Agents Chemother. 43, 724–725. JENSEN, L.B., HAMMERUM, A.M. and AARESTRUP, F.M. (2000). Linkage of vat(E) and erm(B) in streptogramin-resistant Enterococcus faecium isolates from Europe. Antimicr. Agents Chemother. 44, 2231–2232. JETT, B.D., JENSEN, H.G., NORDQUIST, R.E. and GILMORE, M.S. (1992). Contribution of the pAD1-encoded cytolysin to the severity of experimental Enterococcus faecalis endophthalmitis. Infect. Immun. 60, 2445–2452. JETT, B.D., HUYCKE, M.M. and GILMORE, M.S. (1994). Virulence of enterococci. Clin. Microbiol. Rev. 7, 462–478. JOHNSON, A.P. (1994). The pathogenicity of enterococci. J. Antimicrob. Chemother. 33, 1083–1089. JOHNSTON, L.M. and JAYKUS, L.-A. (2004). Antimicrobial resistance of Enterococcus species isolated from produce. Appl. Environ. Microbiol. 70, 3133–3137. JONES, R.N., MARSHALL, S.A., PFALLER, M.A., WILKE, W.W., HOLLIS, R.J., ERWIN, M.E., EDMOND, M.B., WENZEL, R.P. and the SCOPE Hospital Study group (1997). Nosocomial enterococcal blood stream infections in the SCOPE program: Antimicrobial resistance, species occurrence, molecular testing results, and laboratory accuracy. Diagn. Microbiol. Infect. Dis. 29, 95–102. JONES, R.N., BELLOW, C. H ., BIEDENBACH, D .J., DEINHART, J .A . and SCHENTAG, J.J . (1998). Antimicrobial activity of quinupristin/dalfopristin (RP 59 500, Synercid) tested against over 28,000 recent clinical isolates from 200 medical centers in the United States and Canada. Diagn. Microbiol. Infect. Dis. 30, 437–451.

604

Emerging foodborne pathogens

KAUFHOLD, A.

and FERRIERI, P. (1993). The microbiological aspects, including diagnosis, of b-hemolytic streptococcal and enterococcal infections. Infect. Dis. Clin. North Am. 7, 235–256. KLARE, I., HEIER, H., CLAUS, H., REISSBRODT, R. and WITTE, W. (1995a). VanA-mediated highlevel glycopeptide resistance in Enterococcus faecium from animal husbandry. FEMS Microbiol. Lett. 125, 165–172. KLARE, I., HEIER, H., CLAUS, H., BÖHME, G., MARIN, S., SELTMANN, G., HAKENBECK, R., ANTANASSOVA, V. and WITTE, W. (1995b). Enterococcus faecium strains with vanA-mediated high-level glycopeptide resistance isolated from animal foodstuffs and fecal samples in the community. Microb. Drug Resist. 1, 265–272. KLEIN, G. and PACK, A. (1997). Antibiotic resistance and transfer of vanA-mediated resistance of enterococci used in animal nutrition. Microecol. ther. 26, 257–268. KLEIN, G., PACK, A. and REUTER, G. (1998). Antibiotic resistance patterns of enterococci and occurrence of vancomycin-resistant enterococci in raw minced beef and pork in Germany. Appl. Environ. Microbiol. 64, 1825–1830. KLOS, P., XIONG, L., SHINABARGER, D. and MANKIN, A. (1999). Resistance mutations in n23S rRNA identify the site of action of the protein synthesis inhibitor linezolid in the ribosomal peptidyl transferase center. J. Mol. Biol. 294, 93–101. KNUDTSON, L.M. and HARTMAN, P.A. (1993). Enterococci in pork processing. J. Food Prot. 56, 6–9. KOCH, S., HUFNAGEL, M., THEILACKER, C. and HUEBNER, J. (2004). Enterococcal infections: host response, therapeutic, and prophylactic possibilities. Vaccine 22, 822–830. KOORT, J., COENYE, T., VANDAMME, P., SUKURA, A. and BJÖRKROTH, J. (2004). Enterococcus hermanniensis sp. nov. from modified-atmosphere-packaged broiler meat and canine tonsils. Int. J. Syst. Evol. Microbiol. 54, 1823–1827. KRAWCZYK, B., SAMET, A., BRONK, M., HELLMANN, A. and KUR, J. (2004). Emerging linezolidresistant, vancomycin-resistant Enterococcus faecium from a patient of a haematological unit in Poland. Pol. J. Microbiol. 53, 193–196. KREFT, B., MARRE, R., SCHRAMM, U. and WIRTH, R. (1992). Aggregation substance of Enterococcus faecalis mediates adhesion to cultured renal tubular cells. Infect. Immun. 60, 25–30. KÜHNEN, E., RICHTER, F., RICHTER, K. and ANDRIES, L. (1988). Establishment of a typing system for group D streptococci. Zentralblatt für Bakteriologie und Hygiene A 267, 322–330. LANDMAN, D. and QUALE, J.M. (1997). Management of infections due to resistant enterococci: A review of therapeutic options. J. Antimicrob. Chemother. 40, 161–170. LANDRY, S.L., KAISER, D.L. and WENZEL, R.P. (1989). Hospital stay and mortality attributed to nosocomial enterococcal bacteremia: a controlled study. Am. J. Infect. Control 17, 323–329. LAVERMICOCCA, P., GOBETTI, M., CORSETTI, A. and CAPUTO, L. (1998). Characterization of lactic acid bacteria isolated from olive phylloplane and table olive brines. Ital. J. Food Sci. 10, 27–39. LAW-BROWN, J. and MEYERS, P.R. (2003). Enterococcus phoeniculicola sp. nov., a new member of the enterococci isolated from the uropygial gland of the Red-billed Woodhoopoe, Phoeniculus purpureus. Int. J. Syst. Evol. Microbiol. 53, 683–685 (published online 4 October 2002). LEAVIS, H., TOP, J., SHANKAR, N., BORGEN, K., BONTEN, M., VAN EMBDEN, J. and WILLEMS, R.J.L. (2004). A novel putative enterococcal pathogenicity island linked to the esp virulence gene of Enterococcus faecium and associated with epidemicity. J. Bacteriol. 186, 672–682. LECLERC, H., DEVRIESE, L.A. and MOSSEL, D.A.A. (1996). Taxonomical changes in intestinal (faecal) enterococci and streptococci: Consequences on their use as indicators of faecal contamination in drinking water. J. Appl. Bacteriol. 81, 459–466. LECLERCQ, R. (1997). Enterococci acquire new kinds of resistance. Clin. Infect. Dis. 24 (Suppl. 1), S80–S84.

Enterococci LEHNER, A., LOY, A., BEHR, T., GAENGE, H., LUDWIG, W., WAGNER, M.

605

and SCHLEIFER, K.-H. (2005). Oligonucleotide microarray for identification of Enterococcus species. FEMS Microbiol. Lett. 246, 133–142. LESTER, C . H., FRIMODT-MOLLER , N . and HAMMERUM, A. M. (2004). Conjugal transfer of aminoglycoside and macrolide resistance between Enterococcus faecium isolates in the intestine of streptomycin-treated mice. FEMS Microbiol. Lett. 235, 385–391. LEWENSTEIN, A., FRIGERIO, G. and MORONI, M. (1979). Biological properties of SF68, a new approach for the treatment of diarrhoeal diseases. Cur. Ther. Res. 26, 967–981. LEWIS, M.C. and ZERVOS, M.J. (1990). Clinical manifestations of enterococcal infection. Eur. J. Clin. Microbiol. Infect. Dis. 9, 111–117. LIAO, C.-H., TSENG, S.-P., FANG, C.-T., TENG, L.-J. HSUCH, P.-R., (2005). First linezolid- and vancomycin-resistant Enterococcus faecium strain in Taiwan. J. Antimicrob. Chemother. 55, 598–599. LICHT, T.R., LAUGESEN, D., JENSEN, L.B. and JACOBSEN, B.L. (2002). Transfer of the pheromoneinducible plasmid pCF10 among Enterococcus faecalis microorganisms colonizing the intestine of mini-pigs. Appl. Environ. Microbiol. 68, 187–193. LINDEN, P.K. and MILLER, C.B. (1999). Vancomycin-resistant enterococci: the clinical effect of a common nosocomial pathogen. Diagn. Micr. Infect. Dis. 33, 113–120. LITOPOULOU-TZANETAKI, E. and TZANETAKIS, N. (1992). Microbiology of white brined cheese made from raw goat milk. Food Microbiol. 9, 13–19. LITOPOULOU-TZANETAKI, E. (1990). Changes in numbers and kinds of lactic acid bacteria during ripening of Kefalotyri cheese. J. Food Sci. 55, 111–113. LITOPOULOU-TZANETAKI, E., TZANETAKIS, N. and VAFOPOULOU-MASTROJIANNAKI, A. (1993). Effect of type of lactic starter on microbiological, chemical and sensory characteristics of Feta cheese. Food Microbiol. 10, 31–41. LOW, D.E., WILLEY, B.M., BETSCHEL, S. and KREISWIRTH, B. (1994). Enterococcis: Pathogens of the 90s. Eur. J. Surg. Suppl. 573, 19–24. LOW, Y.L., JAKUBOVICS, N.S., FLATMAN, J.C., JENKINSON, H.F. and SMITH, A.W. (2003). Manganesedependent regulation of the endocarditis associated virulence factor EfaA of Enterococcus faecalis. J. Med. Microbiol. 52, 113–119. LOWE, A.M., LAMBERT, P.A. and SMITH, A.W., (1995). Cloning of an Enterococcus faecalis endocarditis antigen: Homology with adhesins from some oral streptococci. Infect. Immun. 63, 703–706. LUND, B. and EDLUND, C. (2001). Probiotic Enterococcus faecium strain is a possible recipient of the vanA gene cluster. Clin. Infect. Dis. 32, 1384–1385. LUND, B., ADAMSSON, I. and EDLUND, C. (2002). Gastrointestinal transit survival of an Enterococcus faecium probiotic strain administered with or without vancomycin. Int. J. Food Microbiol. 77, 109–115. MAC, K., WICHMANN-SCHAUER, H., PETERS, J. and ELLERBROEK, L. (2002). Nachweis von Vancomycin-Resistenzgenen bei Enterokokken-Feldstämmen tierischer Herkunft mittels Multiplex-PCR. Arch. für Lebensmittelhyg. 53, 49–72. MACEDO, A.C. and MALCATA, F.X. (1997). Role of adventitious microflora in proteolysis and lipolysis of Serra cheese. Preliminary screening. Zeitschrift für Lebensmitteluntersuchungund Forschung A 205, 25–30. MACEDO, A.C., MALCATA, F.X. and HOGG, T.A. (1995). Microbiological profile in Serra ewe’s cheese during ripening. J. Appl. Bacteriol. 79, 1–11. MAGNUS, C.A., INGLEDEW, W.M. and MCCURDY, A.R. (1986). Thermal resistance of streptococci isolated from pasteurized ham. J. Can. Inst. Food Sci. Technol. 19, 62–67. MAGNUS, C.A., MCCURDY, A.R. and INGLEDEW W.M. (1988). Further studies on the thermal resistance of Streptococcus faecium and Streptococcus faecalis in pasteurized ham. J. Can. Inst. Food Sci. Technol. 21, 209–212. MAJHENIC, A.C., ROGELJ, I., and PERKO, B. (2005). Enterococci from Tolminc cheese: population structure, antibiotic susceptibility and incidene of virulence determinants. Int. J. Food Microbiol. 102, 239–244.

606

Emerging foodborne pathogens

MAKI, D.G.

and AGGER, W.A. (1988). Enterococcal bacteremia: Clinical features, the risk of endocarditis and management. Medicine 67, 248–269. MANOLOPOULOU, E., SARANTINOPOULOUS, P., ZOIDOU, E., AKTYPIS, A., MOSCHOPOULOU, E., KANDARAKIS, I.G. and ANIFANTAKIS, E.M. (2003). Evolution of microbial populations during traditional Feta cheese manufacture and ripening. Int. J. Food Microbiol. 82, 153–161. MARINO, M., MAIFRENI, M. and RONDININI, G. (2003). Microbiological characterization of artisanal Montasio cheese: analysis of its indigenous lactic acid bacteria. FEMS Microbiol. Lett. 229, 133–140. MARTIN, J.D. and MUNDT, J.O. 1972. Enterococci in insects. Appl. Microbiol. 24, 575–580. MARTIN, B., GARRIGA, M. HUGAS, M., and AYMERICH, T. (2005). Genetic diversity and safety aspects of enterococci from slightly fermented sausages. J Appl. Microbiol. 98, 1177– 1190. MAUGERI, T.L., CARBONE, M., FERA, M.T., IRRERA, G.P. and GUGLIANDOLO, C. (2004). Distribution of potentially pathogenic bacteria as free living and plankton associated in a marine coastal zone. J. Appl. Bacteriol. 97, 354–361. MCDONALD, L.C., KUEHNERT, M.J., TENOVER, F.C. and JARVIS, W.R. (1997). Vancomycin-resistant enterococci outside the health-care setting: Prevalence, sources, and public health implications. Emerg. Infect. Dis. 3, 311–317. MENÉNDEZ, S., GODÍNEZ, R., CENTENO, J.A. and RODRÍGUEZ-OTERO, J.L. (2001). Microbiological, chemical and biochemical characteristics of ‘tetilla’ raw cows-milk cheese. Food Microbiol. 18, 151–158. MIRZOYEV, Z., ANAVEKAR, N., WILSON, F., USLAN, D., BADDOUR, L. and MOOKADAM, F. (2004). Enterococcus avium endocarditis. Scand. J. Infect. Dis. 36, 876–878. MIYAZAKI, S., OHNO, A., KOBAYASHI, I., UJI, T., YAMAGUCHI, K. and GOTO, S. (1993). Cytotoxic effect of hemolytic culture supernatant from Enterococcus faecalis on mouse polymorphonuclear neutrophils and macrophages. Microbiol. Immunol. 37, 265–270. MOELLERING, R.C. (1990). The enterococci: An enigma and a continuing therapeutic challenge. Eur. J. Clin. Microbiol. Infect. Dis. 9, 73–74. MOELLERING, R.C. (1991). The Enterococcus: A classic example of the impact of antimicrobial resistance on therapeutic options. J. Antimicrob. Chemother. 28, 1–12. MOELLERING R.C. (1992). Emergence of enterococcus as a significant pathogen. Clin. Infect. Dis. 14, 1173–1178. MOHAMMED, S. I., STEENSON, L. R. and KIRLEIS, A. W (1991). Isolation and characterization of microorganisms associated with the traditional sorghum fermentation for production of Sudanese Kisra. Appl. Environ. Microbiol. 57, 2529–2533. MOHANTY, S., DHAWAN, B., KAPIL, A., DAS, B.K., PANDEY, P., and GUPTA, A. (2005). Brain abscess due to Enterococcus avium. Am. J. Med. Sci. 329, 161–162. MORENO, M.R.F., LEISNER, J.J., TEE, L.K., LEY, C., RADU, S., RUSUL, G., VANCANNEYT, M. and DE VUYST, L. (2002). Microbial analysis of Malaysian tempeh, and characterization of two bacteriocins produced by isolates of Enterococcus faecium. J. Appl. Microbiol. 92, 147–157. MORRISON, D., WOODFORD, N. and COOKSON, B. (1997). Enterococci as emerging pathogens of humans. J. Appl. Microbiol. Symp. Suppl. 83, 89S–99S. MOY, T.I., MYLONAKIS, E., CALDERWOOD, S.B. and AUSUBEL, F.M. (2004). Cytotoxicity of hydrogen peroxide produced by Enterococcus faecium. Infect Immun. 72, 4512–4520. MÜLLER, T., ULRICH, A., OTT, E.M. and MÜLLER, M. (2001). Identification of plant-associated enterococci. J. Appl. Microbiol. 91, 268–278. MULYOWIDARSO, R.K., FLEET, G.H and BUCKLE, K.A. (1990). Association of bacteria with the fungal fermentation of Soybean tempe. J. Appl. Bacteriol. 68, 43–47. MUNDT, J.O., COGGINS, J.A. and JOHNSON, L.F. (1962). Growth of Streptococcus faecalis var. liquifaciens on plants. Appl. Microbiol. 10, 552–555. MUNDY, L.M., SAHM, D.F. and GILMORE, M.S. (2000). Relationships between enterococcal virulence and antimicrobial resistance. Clin. Microbiol. Rev. 13, 513–522.

Enterococci MURRAY, B.E.

607

(1990). The life and times of the Enterococcus. Clin. Microbiol. Rev. 3, 46–

65. MURRAY, B.E., MEDERSKI-SAMORAJ, B.D., FOSTER, S.K., BRUNTON, L.

and HARFORD, P. (1986). In vitro studies of plasmid-mediated penicillinase from Streptococcus faecalis suggest a staphylococcal origin. J. Clin. Invest. 77, 289–293. MYLONAKIS, E., ENGELBERT, M., QIN, X., SIFRI, C.D., MURRAY, B.E., AUSUBEL, F.M., GILMORE, M.S. and CALDERWOOD, S. (2002). The Enterococcus faecalis fsrB gene, a key component of the fsr quorum-sensing system, is associated with virulence in the rabbit endophthalmitis model. Infect. Immun. 70, 4678–4681. NAKAYAMA, J., CAO, Y., HORII, T., SAKUDA, S., AKKERMANS, A.D.L., DE VOS, W.M. and NAGASAWA, H. (2001a). Gelatinase-biosynthesis-activating pheromone: a peptide lactone that mediates a quorum sensing in Enterococcus faecalis. Mol. Microbiol. 41, 145–154. NAKAYAMA, J., CAO, Y., HORII, T., SAKUDA, S. and NAGASAWA, H. (2001b). Chemical synthesis and biological activity of the gelatinase biosynthesis-activating pheromone of Enterococcus faecalis and its analogs. Biosci. Biotechnol. Biochem. 65, 2322–2325. NALLAPAREDDY, S.R., QIN, X., WEINSTOCK, G.M., HÖÖK, M. and MURRAY, B.E. (2000a). Enterococcus faecalis adhesin, ace, mediates attachment to extracellular matrix proteins collagen type IV and laminin as well as collagen type I. Infect. Immun. 68, 5218–5224. NALLAPARREDDY, S.R., SINGH, K.V., DUH, R.W., WEINSTOCK, G.M. and MURRAY, B.E. (2000b). Diversity of ace, a gene encoding a microbial surface component recognizing adhesive matrix molecules, from different strains of Enterococcus faecalis and evidence for production of ace during human infections. Infect. Immun. 68, 5210–5217. NALLAPARREDDY , S. R., WEINSTOCK, G .M . and MURRAY , B.E. (2003). Clinical isolates of Enterococcus faecium exhibit strain-specific collagen binding mediated by Acm, a new member of the MSCRAMM family. Mol. Microbiol. 47, 1733–1747. NASER, S.M., VANCANNEYT, M., DE GRAEF, E., DEVRIESE, L.A., SNAUWART, C., LEFEBVRE, K., HOSTE, B., SVEC, P., DECOSTERE, A., HAESEBROUCK, F. and SWINGS, J. (2005). Enterococcus canintestini sp. nov., from faecal samples of healthy dogs. Int. J. Syst. Evol. Microbiol. Published online 27 May 2005. NOBLE, C.J. (1978). Carriage of group D streptococci in the human bowel. J. Clin. Pathol. 4, 1182–1186. NOVICK, R.P., ROSS, H.F., PROJAN, S.J., KORNBLUM, J., KREISWIRTH, B. and MOGHAZEH, S. (1993). Synthesis of staphylococcal virulence factors is controlled by a regulatory RNA molecule. EMBO J. 12, 3967–3975. NOVICK, R.P., PROJAN, S.J., KORNBLUM, J., ROSS, H.F., JI, G., KREISWIRTH, B., VANDENESH, F. and MOGHAZEH, S. (1995). The agrP2 operon: an autocatalytic sensory transduction system in Staphylococcus aureus. Mol. Gen. Genet. 248, 446–458. OGUNTOYINBO, F.A., SANNI, A.I., FRANZ, C.M.A.P. and HOLZAPFEL, W.H. (2006) Selection and evaluation of Bacillus starter cultures for the production of okpehe, a traditional African fermented condiment. Int. J. Food Microbiology, in press. OLMSTED, S.B., DUNNY, G.M., ERLANDSEN, S.L. and WELLS, C.L. (1994). A plasmid-encoded surface protein on Enterococcus faecalis augments its internalization by cultured intestinal epithelial cells. J. Infect. Dis. 170, 1549–1556. ONDA, T., YANAGIDA, F., UCHIMURA, T., TSUJI, M., OGINO, S., SHINOHARA, T. and YOKOTSUKA, K. (2002). Widespread distribution of the bacteriocin-producing lactic cocci in misopaste products. J. Appl. Microbiol. 92, 695–705. ORDOÑEZ, J.A., BARNETO, R. and RAMOS, M. (1978). Studies on Manchego cheese ripened in olive oil. Milchwissenschaft 33, 609–612. OTT, E.M., MÜLLER, T., MÜLLER, M., FRANZ, C.M.A.P., ULRICH, A., GABEL, M. and SEYFARTH, W. (2001) Population dynamics and antagonistic potential of enterococci colonizing the phyllosphere of grasses. J. Appl. Microbiol. 91, 54–66. OZAWA, Y., COURVALIN, P. and GALIMAND, M. (2000). Identification of enterococci at the species level by sequencing of the genes for D-alanine:D-alanine ligases. Syst. Appl. Microbiol. 23, 230–237.

608

Emerging foodborne pathogens

OZAWA, Y., TANIMOTO, K., NOMURA, T., YOSHINAGA, M., ARAKAWA, Y. and IKE, Y. (2002). Vancomycin-

resistant enterococci in humans and imported chickens in Japan. Appl. Environ. Microbiol. 68, 6457–6461. PAPPAS, G., LIBEROPOULOS, E., TSIANOS, E. and ELISAF, M. (2004). Enterococcus casseliflavus bacteremia. Case report and literature review. J. Infect. 48, 206–208. PILLAI, S.K., SAKOULAS, G., GOLD, H.S., WENNERSTEN, C., ELIOPOULOS, G.M., MOELLERING, R.C. JNR. and INOUYE, R.T. (2002). Prevalence of the fsr locus in Enterococcus faecalis infections. J. Clin. Microbiol. 40, 2651–2652. POMPEI, R., BERLUTTI, F., THALLER, M.C., INGIANNI, A., CORTIS, G. and DAINELLI, B. (1992). Enterococcus flavescens sp. nov., a new species of enterococei of clinical origin. Int. J. Syst. Microbiol. 42, 365–369. PRODROMOU, K., THASITOU, P., HARITONIDOU, E., TZANETAKIS, N. and LITOPOULOU-TZANETAKI, E. (2001). Microbiology of ‘Orinotyri’, a ewe’s milk cheese from the Greek mountains. Food Microbiol. 18, 319–328. PULTZ, N.J., SHANKAR, N., BAGHDAYAN, A.S. and DONSKEY, C.J. (2005). Enterococcal surface protein Esp does not facilitate intestinal colonization or translocation of Enterococcus faecalis in clindamycin-treated mice. FEMS Microbiol. Lett. 242, 217–219. QIN, X., SINGH, K.V., WEINSTOCK, G.M. and MURRAY, B.E. (2000). Effects of Enterococcus faecalis fsr genes on production of gelatinase and a serine protease and virulence. Infect. Immun. 68, 2579–2586. QUEDNAU, M., AHRNE, S., PETERSSON, A.C. and MOLIN, G. (1998). Antibiotic-resistant strains of Enterococcus isolated from Swedish and Danish retailed chicken and pork. J. Appl. Microbiol. 84, 1163–1170. RAAD, I.I., HANNA, H.A., HACHEM, R.Y., DVORAK, T., ARBUCKLE, R.B., CHAIBAN, G. and RICE, L.B. (2004). Clinical-use-associated decrease in susceptibility of vancomycin-resistant Enterococcus faecium to linezolid: a comparison with quinupristin-dalfopristin. Antimicr. Agents Chemother. 48, 3583–3585. RAKITA, R.M., VANEK, N.N., JAQUEZ-PALAS, K., MEE, M., MARISCALCO, M.M., DUNNY, G.M., SNUGGS, M., VAN WINKLE, W.B. and SIMON, S.I. (1999). Enterococcus faecalis bearing aggregation substance is resistant to killing by human neutrophils despite phagocystosis and neutrophil activation. Infect. Immun. 67, 6067–6075. RANDAZZO, C.L., RESTUCCIA, C., ROMANO, A.D. and CAGGIA, C. (2004). Lactobacillus casei, dominant species in naturally fermented Sicilian green olives. Int. J. Food Microbiol. 90, 9–14. RECSEI, P., KREISWIRTH, B., O’REILLY, M., SCHLIEVERT, P., GRUSS, A. and NOVICK, R.P. (1985). Regulation of exoprotein gene expression by agr. Mol. Gen. Genet. 202, 58–61. RICE, L.B., CARIAS, L., RUDIN, S., VAEL, C., GOOSSENS, H., KONSTABEL, C., KLARE, I., NALLAPAREDDY, S.R., HUANG, W. and MURRAY, B.E. (2003). A potential virulence gene, hylEfm, predominates in Enterococcus faecium of clinical origin. J. Infect. Dis. 187, 508–512. RICH, R.L., KREIKEMEYER, B., OWENS, R.T., LABRENZ, S., NARAYANA, S.V.L., WEINSTOCK, G.M., MURRAY , B.E. and HÖÖK, M. (1999). Ace is a collagen-binding MSCRAMM from Enterococcus faecalis. J. Biol. Chem. 274, 26939–26945. RICHARDS, M.J., EDWARDS, J.R., CULVER, D.H. and GAYNES, R.P. (1999). National Nosocomial Surveillance System. Nosocomial infections in medical intensive care units in the United States. Crit. Care Med. 27, 887–892. RICHARDS, M.J., EDWARDS, J.R., CULVER, D.H. and GAYNES, R.P. (2000). Nosocomial infections in combined medical-surgical intensive care units in the United States. Infect. Control Hosp. Epidemiol. 21, 510–515. RICHELSEN, B., KRISTENSEN, K. and PEDERSEN, S.B. (1996). Long-term (6 months) effect of a new fermented milk product on the level of plasma lipoproteins-a placebo-controlled and double blind study. Eur. J. Clin. Nutr. 50, 811–815. RIZZOTTI, L., SIMEONI, D., COCCONCELLI, P.S., GAZZOLA, S., DELLAGLIO, F. and TORRIANI, S. (2005). Contribution of enterococci to the spread of antibiotic resistance in the production chain of swine meat commodities. J. Food prot. 68, 955–965.

Enterococci ROBERTS, J.C., SINGH, K.V., OKHUYSEN, P.C.

609

and MURRAY, B.E. (2004). Molecular epidemiology of the fsr locus and of gelatinase production among different subsets of Enterococcus faecalis isolates. J. Clin. Microbiol. 42, 2317–2320. ROBREDO, B., SINGH, K.V., BAQUERO, F., MURRAY, B.E. and TORRES, C. (2000). Vancomycinresistant enterococci isolated from animals and food. Int. J. Food Microbiol. 54, 197– 204. RONCONI, M.C., MERINO, L.A. and FERNANDEZ, G. (2002). Detection of Enterococcus with high-level aminoglycoside and glycopeptide resistance in Lactuca sativa (lettuce). Enferm. Infecc. Microbiol. Clin. 20, 380–383. ROZDZINSKI, E., MARRE, R., SUSA, M., WIRTH, R. and MUSCHOLL-SILBERHORN, A. (2001). Aggregation substance-mediated adherence of Enterococcus faecalis to immobilized extracellular matrix proteins. Microb. Path. 30, 211–220. RUOFF, K.L. (1990). Recent taxonomic changes in the genus Enterococcus. Eur. J. Clin. Microbiol. Infect. Dis. 9, 75–79. SABOL, K., PATTERSON, J.E., LEWIS, J.S. II, OWENS, A., CADENA, J. and JORGENSEN, J.H. (2005). Emergence of daptomycin resistance in Enterococcus faecium during daptomycin therapy. Antimicrob. Agents Chemother. 49, 1664–1665. SANNOMIYA, P.A., CRAIG, R.A., CLEWELL, D.B., SUZUKI, A., FUJINO, M., TILL, G.O. and MARASCO W.A. (1990). Characterization of a class of nonformylated Enterococcus faecalis-derived neutrophil chemotactic peptides: The sex pheromones. Proc. Nat. Acad. Sci. 87, 66– 70. SANZ PEREZ, B., LOPEZ LORENZO, P., GARCIA, M.L., HERNANDEZ, P.E. and ORDOÑEZ, J.A. (1982). Heat resistance of enterococci. Milchwissenschaft 37, 724–726. SARANTINOPOULOUS, P., ANDRIGHETTO, C., GEORGALAKI, M.D., REA, M.C., LOMBARDI, A., COGAN, T.M., KALANTZOPOULOS, G. and TSAKALIDOU, E. (2001). Biochemical properties of enterococci relevant to their technological performance. Int. Dairy J. 11, 621–647. SARANTINOPOULOUS, P., KALANTZOPOULOUS, G. and TSAKALIDOU, E. (2002). Effect of Enterococcus faecium in microbiological, physicochemical and sensory characteristics of Greek Feta cheese. Int. J. Food Microbiol. 76, 93–105. SARTINGEN, S., ROZDZINSKI, E., MUSCHOLL-SILBERHORN, A. and MARRE, R. (2000). Aggregation substance increases adherance and internalization, but not translocation, of Enterococcus faecalis through different intestinal epithelial cells in vitro. Infect. Immun. 68, 6044– 6047. SCHLEIFER, K .H. and KILPPER-BÄLZ, R. (1984). Transfer of Streptococcus faecalis and Streptococcus faecium to the genus Enterococcus nom. rev. as Enterococcus faecalis comb. nov. and Enterococcus faecium comb. nov. Int. J. Syst. Bacteriol. 34, 31–34. SCHLIEVERT, P.M., GAHR, P.J., ASSIOMACOPOULOS, A.P., STOEHR, M.J., HARMALA, J.W., HIRT, H. and DUNNY, G.M. (1998). Aggregation and binding substances enhance pathogenicity in rabbit models of Enterococcus faecalis endocarditis. Infect. Immun. 66, 218–223. SCHMIDTCHEN, A., FRICK, I.-M., ANDERSSON, E., TAPPER, H. and BJÖRCK, L. (2002). proteinases of common pathogenic bacteria degrade and inactivate the antibacterial peptide LL37. Mol. Microbiol. 46, 157–168. SEMEDO, T., ALMEIDA SANTOS, M., SILVA LOPES, M.F., FIGUEIRDO MARQUES, J.J., BARETTO CRESPO, M.T. and TENREIRO, R. (2003). Virulence factors in food, clinical and reference enterococci: a common trait in the genus? Syst. Appl. Microbiol. 26, 13–22. SESSIONS, V.A., LOVEGROVE, J.A., TAYLOR, G.R.J., DEAN, T.S., WILLIAMS, C.M., SANDERS, T.A.B., MACDONALD, I.A. and SALTER, A.M. (1997). The effect of a new fermented milk product on total plasma cholesterol, LDL-cholesterol, and apolipoprotein B concentrations in middle-aged men and women (abstract 285). In: Sadler, M.J., Saltmarch, M. (eds), Functional Foods: the consumer, the product, and the evidence. The Royal Society of Chemistry, London, pp. 15–19. SHANKAR, V., BAGHDAYAN, A.S., HUYCKE, M.M., LINDAHL, G. and GILMORE, M.S. (1999). Infectionderived Enterococcus faecalis strains are enriched in esp, a gene encoding a novel surface protein. Infect. Immun. 67, 193–200.

610

Emerging foodborne pathogens

SHANKAR, N., LOCKATELL, C.V., BAGHDAYAN, A.S., DRACHENBERG, C., GILMORE, M.S.

and JOHNSON, (2001). Role of Enterococcus faecalis surface protein Esp in the pathogenesis of ascending urinary tract infection. Infect. Immun. 69, 4366–4372. SHANKAR, N., BAGHDAYAN, A.S. and GILMORE, M.S. (2002). Modulation of virulence within a pathogenicity island in vancomycin-resistant Enterococcus faecalis. Nature 417, 746– 750 SHEPARD, B.D. and GILMORE, M.S. (2002). Differential expression of virulence-related genes in Enterococcus faecalis in response to biological cues in serum and urine. Infect. Immun. 70, 4344–4352. SHLAES, D.M., LEVY, J. and WOLINSKY, E. (1981). Enterococcal bacteremia without endocarditis. Arch. Intern. Med. 141, 578–581. SIFRI, C.D., MYLONAKIS, E., SINGH, K.V., QIN, X., GARSIN, D.A., MURRAY, B.E., AUSUBEL, F.M. and CALDERWOOD, S.B. (2002). Virulence effect of Enterococcus faecalis protease genes and the quorum-sensing locus fsr in Caenorhabditis elegans and mice. Infect. Immun. 70, 5647–5650. SIGNORETTO, C., BURLACCHINI, G., DEL MAR LLEO, M., PRUZZO, C., ZAMPINI, M., PANE, L., FRANZINI, G. and CANEPARI, P. (2004). Adhesion of Enterococcus faecalis in the nonculturable state to plankton is the main mechanism responsible for persistence of this bacterium in both lake and seawater. Appl. Environ. Microbiol. 70, 6892–6896. SILVERMAN, J.A., PERLMUTTER, M.G. and SHAPIRO, H.M. (2003). Correlation of daptomycin bactericidal activity and membrane depolarization in Staphylococcus aureus. Antimicr. Agents Chemother. 47, 2538–2544. SIMJEE, S. and GILL, M.J. (1997). Gene transfer, gentamycin resistance and enterococci. J. Hosp. Infect. 36, 249–259. SIMONSEN, G.S., BERGH, K., BEVANGER, L., DIGRANES, A., GAUSTAD, P., MELBY, K.K. and HOIBY, E.A. (2004). Susceptibility to quinupristin-dalfopristin and linezolid in 839 clinical isolates of Gram-positive cocci from Norway. Scand. J. Infect. Dis. 36, 254–258. SINGH, K.V., QIN, X., WEINSTOCK, G.M. and MURRAY, B.E. (1998). Generation and testing of mutants of Enterococcus faecalis in a mouse peritonitis model. J. Infect. Dis. 178, 1416–1420. SØRENSEN, T.L., BLOM, M., MONNET, D.L., FRIMODT-MØLLER, N., POULSEN, R.L. and ESPERSEN, F. (2001). Transient intestinal carriage after ingestion of antibiotic-resistant Enterococcus faecium from chicken and pork. New Engl. J. Med. 345, 1161–1166. STEPHANOVIC, S., JOVANOVIC, M., LAVADINOVIC, L., STOSOVIC, B. and PELEMIS, M. (2004). Enterococcus durans endocarditis in a patient with transposition of the great vessels. J. Med. Microbiol. 53, 259–261. STILES, M.E., RAMJI, N.W., NG, L.-K. and PARADIS, D.C. (1978). Incidence and relationship of group D streptococci with other indicator organisms in meats. Can. J. Microbiol. 24, 1502–1508. STOBBERINGH, E., VAN DEN BOGAARD, A., LONDON, N., DRIESSEN, C., TOP, J. and WILLEMS, R. (1999). Enterococci with glycopeptide resistance in turkeys, turkey farmers, turkey slaughterers, and (sub)urban residents in the south of the Netherlands: evidence for transmission of vancomycin resistance from animals to humans? Antimicrob. Agents Chemother. 43, 2215–2221. STREIT, J.M., JONES, R.N. and SADER, H.S. (2004). Daptomycin activity and spectrum: a worldwide sample of 6737 clinical Gram-positive organisms. J. Antimicrob. Chemother. 53, 669–674. SÜSSMUTH, S.D., MUSCHOLL-SILBERHORN, A., WIRTH, R., SUSA, M., MARRE, R. and ROZDZINSKI, E. (2002). Aggregation substance promotes adherance, phagocytosis, and intracellular survival of Enterococcus faecalis within human macrophages and suppresses respiratory burst. Infect. Immun. 68, 4900–4906. SVEC, P., DEVRIESE, L.A., SEDLACEK, I., BAELE, M., VANCANNEYT, M., HAESEBROUCK, F., SWINGS, J. and DOSKAR, J. (2001). Enterococcus haemoperoxidus sp. nov. and Enterococcus moraviensis sp. nov., isolated from water. Int. J. Syt. Evol. Microbiol. 51, 1567–1574. D . E.

Enterococci SVEC, P., VANCANNEYT, DEVRIESE, L.A., NASER, S., SNAUWAERT, C., LEFEBVRE, K., HOSTE, B.

611

and (2005a). Enterococcus aquimarinus sp. nov. isolated from seawater. Int. J. Syst. Evol. Microbiol. Published online 27 May 2005. SVEC, P., VANCANNEYT, M., SEMAN, M., SNAUWAERT, C., LEFEBVRE, K., SEDLACEK, I. and SWINGS, J. (2005b). Evaluation of GTG5-PCR for identification of Enterococcus spp. FEMS Microbiol. Lett. 247, 59–63. TAILOR, S.A.N., BAILEY, E.M. and RYBAK, M.J. (1993). Enterococcus, an emerging pathogen. Ann. Pharmacother. 27, 1231–1242. TEIXEIRA, L.M., CARVALHO, M.DG.S., ESPINOLA, M.M.B., STEIGERWALT, A.G., DOUGLAS, M.P., BRENNER, D.J., and FACKLAM, R.R. (2001). Enterococcus porcinus sp. nov. and Enterococcus ratti sp. nov. associated with enteric disorders in animals. Int. J. Syst. Evol. Microbiol. 51, 1737–1743. TENG, F., WANG, L., SINGH, K.V., MURRAY, B.E. and WEINSTOCK, G.M. (2002). Involvement of PhoP-PhoS homologs in Enterococcus faecalis virulence. Infect. Immun. 70, 1991– 1996. TENG, F., KAWALEC, M., WEINSTOCK, G.M., HRYNIEWICZ, W. and MURRAY, B.E. (2003). An Enterococcus faecium secreted antigen, SagA, exhibits broad-spectrum binding to extracellular matrix proteins and appears essential for E. faecium growth. Infect. Imm. 71, 5033–5041. TEUBER, M., PERRETEN, V. and WIRSCHING, F. (1996). Antibiotikumresistente Bakterien: Eine neue Dimension in der Lebensmittelmikrobiologie. Lebensmitteltechnologie 29, 182– 199. TOLEDO-ARANA, A., VALLE, J., SOLANO, C., ARRIZUBIETA, M.L., CACARELLA, C., LAMATA, M., AMORENA, B., LEIVA, J., PENADÉS, J.R. and LASA, I. (2001). The enterococcal surface protein, Esp, is involved in Enterococcus faecalis biofilm formation. Appl. Environ. Microbiol. 67, 4538–4545. TROVATELLI, L.D. and SCHIESSER, A. (1987). Identification and significance of enterococci in hard cheese made from raw cow and sheep milk. Milchwissenschaft 42, 717–719. TSAKALIDOU, E., MANOLOPOULOU, E., TSILIBARI, V, GEORGALAKI, M. and KALANTZOPOULOUS, G. 1993. Esterolytic activities of Enterococcus durans and E. faecium strains isolated from greek cheese. Netherl. Milk Dairy J. 47, 145–150. TURTURA, G.C. and LORENZELLI, P. (1994). Gram-positive cocci isolated from slaughtered poultry. Microbiol. Res. 149, 203–213. TYRRELL, G.J., BETHUNE, R.N., WILLEY, B. and LOW, D.E. (1997). Species identification of enterococci via intergenic ribosomal PCR. J. Clin. Microbiol. 35, 1054–1060. TYRRELL, G.J., TURNBULL, L., TEIXEIRA, L.M., LEFEBVRE, J., CARVALHO, M.G., KACKLAM, R.R. and LOVGREN, M. (2002). Enterococcus gilvus sp. nov. and Enterococcus pallens sp. nov. isolated from human clinical specimens. J. Clin. Microbiol. 40, 1140–1145. TZANETAKIS, N. and LITOPOULOU-TZANETAKI, E. (1992). Changes in numbers and kinds of lactic acid bacteria in Feta and Teleme, two greek cheeses from ewes’ milk. J. Dairy Sci. 75, 1389–1393. TZANETAKIS, N., VAFOPOULOU-MASTROJIANNAKI, A. and LITOPOULOU-TZANETAKI, E. (1995). The quality of white-brined cheese from goat’s milk made with different starters. Food Microbiol. 12, 55–63. U.S. Environmental protection Agency (1986). Ambient Water Quality Criteria for Bacteria 1986. Washington DC: US Environmental Protection Agency. VANCANNEYT, M., SNAUWAERT, C., CLEENWERCK, I., BAELE, M., DESCHEEMAEKER, P., GOOSSENS, H., POT, B., VANDAMME, P., SWINGS, J., HAESEBROUCK, F. and DEVRIESE, L.A. (2001). Enterococcus villorum sp. nov., an enteroadherent bacterium associated with diarrhoea in piglets. Int. J. Syst. Evol. Microbiol. 51, 393–400. VANCANNEYT, M., LOMBARDI, A., ANDRIGHETTO, C., KNIJFF, E., TORRIANI, S., BJÖRKROTH, K.J., FRANZ, C.M.A.P., FOULQUIÉ MORENO, M.R., REVETS, H., DE VUYST, L., SWINGS, J., KERSTERS, K., DELLAGLIO, F. and HOLZAPFEL, W.H. (2002). Intraspecies genomic groups in Enterococcus faecium and their correlation with origin and pathogenicity. Appl. Environ. Microbiol. 68, 1381–1391. SWINGS, J.

612

Emerging foodborne pathogens

VANCANNEYT, M., ZAMFIR, M., DEVRIESE, L.A., LEFEBVRE, K., ENGELBEEN, K., VANDERMEULEBROECKE, K., AMAR, M., DE VUYST, L., HAESEBROUCK, F. and SWINGS, J. (2004). Enterococcus saccharominimus sp. nov., from dairy products. Int. J. Syst. Evol. Microbiol. 54, 2175–2179. VANDAMME, P., POT, B., GILLIS, M., DE VOS, P., KERSTERS, K. and SWINGS, J. (1996). Polyphasic taxonomy, a consensus appraoch to bacterial systematics. Microbiol. Rev. 60, 407– 438. VAN DEN BERG, D.J.C., SMITS, A., POT, B., LEDEBOER, A.M., KERSTERS, K., VERBAKEL, J.M.A. and VERRIPS, C.Z. (1993). Isolation, screening and identification of lactic acid bacteria from traditional food fermentation processes and culture collections. Food Biotechnol. 7, 189–205. VAN DEN BOGAARD, A.E., MERTENS, P., LONDON, N.H. and STOBBERINGH, E.E. (1997). High prevalence of colonization with vancomycin- and pristinamycin-resistant enterococci in healthy humans and pigs in the Netherlands: Is the the addition of antibiotics to animal feeds to blame? J. Antimicrob. Chemother. 40, 454–456. VAN DEN BOGAARD, A.E., WILLEMS, R., LONDON, N., TOP, J. and STOBBERINGH, E.E. (2002). Antibiotic resistance of faecal enterococci in poultry, poultry farmers and poultry slaughterers. J. Antimicrob. Chemother. 49, 497–505. VAN DEN BRAAK, N., VAN BELKUM, A., VAN KEULEN, M., VLIEGENTHART, J., VERBRUGH, H.A. and ENDTZ, H.P. (1998). Molecular characterization of vancomycin-resistant enterococci from hospitalised patients and poultry products in the Netherlands. J. Clin. Microbiol. 36, 1927–1932. VANEK, N.N., SIMON, S.I., JACQUES-PALAZ, K., MARISCALCO, M.M., DUNNY, G.M. and RAKITA, R.M. (1999). Enterococcus faecalis aggregation substance promotes opsonin-independent binding to human neutrophils via a complement receptor type 3-mediated mechanism. FEMS Immunol. Med. Microbiol. 26, 49–60. VANKERCKHOVEN, V., VAN AUTGAERDEN, T., VAEL, C., LAMMENS, C., CHAPELLE, S., ROSSI, R., JABES, D. and GOOSSENS, H. (2004). Development of a multiplex PCR for the detection of asa1, gelE, cylA, esp, and hyl genes among European hospital isolates of Enterococcus faecium. J. Clin. Microbiol. 42, 4473–4479. VERGIS, E.N., SHANKAR, N., CHOW, J.W., HAYDEN, M.K., SNYDMAN, M.K., SNYDMAN, D.R., ZERVOS, M.J., LINDEN, P.K., WAGENER, M.M. and MUDER, R.R. (2002). Association between the presence of enterococcal virulence factors gelatinase, hemolysin, and enterococcal surface protein and mortality among patients with bacteremia due to Enterococcus faecalis. Clin. Infect. Dis. 35, 570–575. VERNEUIL, N., SANGUINETTI, M., LE BRETON, Y., POSTERARO, B., FADDA, G., AUFFRAY, Y., HARTKE, A. and GIARD, J.-C. (2004). Effects of the Enterococcus faecalis hypR gene encoding a new transcriptional regulator on oxidative stress response and intracellular survival within macrophages. Infect. Immun. 72, 4424–4431. VILANOVA, X., MANERO, A., CERDA-CELLAR, M. and BLANCH, A.R. (2002). The effect of a sewage treatment plant effluent on the faecal coliforms and enterococci populations of the reception river waters. J. Appl. Microbiol. 92, 210–214. VILLANI, F. and COPPOLA, S. (1994), Selection of enterococcal strains for water-buffalo mozzarella cheese manufacture. Ann. Microbiol. Enzymol. 44, 97–105. VILLAR, M.J., LOPEZ, C. and SANCHEZ CASTANON, J. (2004). Bacteremia due to Enterococcus gallinarum in a patient with varicella and late sarcoidosis. Med. Clin. (Barc.) 123, 435. WAAR, K., MUSCHOLL-SILBERHORN, A.B., WILLEMS, R.J., SLOOFF, M.J., HARMSEN, H.J. and DEGENER, J.E. (2002). Genogrouping and incidence of virulence factors of Enterococcus faecalis in liver transplant patients differ from blood culture and faecal isolates. J. Infect. Dis. 185, 1121–1127. WATERS, C.M., ANTIPORTA, M.H., MURRAY, B.E. and G.M. DUNNY. (2003). Role of the E. faecalis GelE protease in determination of cellular chain length, supernatant pheromone levels, and degradation of fibrin and misfolded surface proteins. J. Bacteriol. 185, 3613–3623.

Enterococci WEINSTEIN, M., TOWNS, M.L., QUARTEY, S.M., MIRRETT, S., REIMER, L.G., PARMIGIANI, G.

613

and (1997). The clinical significance of positive blood cultures in the 1990s: A prospective comprehensive evaluation of the microbiology, epidemiology, and outcome of bacteremia and fungemia in adults. Clin. Infect. Dis. 24, 584–602. WELLS, C.L., JECHOREK, R.P. and ERLANDSEN, S.L. (1990). Evidence for the translocation of Enterococcus faecalis across the mouse intestinal tract. J. Infect. Dis. 162, 82–90. WELLS, C.L., MOORE, E.A., HOAG, J.A., HIRT, H., DUNNY, G.M. and ERLANDSEN, S.L. (2000). Inducible expression of Enterococcus faecalis aggregation substance surface protein facilitates bacterial internalization by cultured enterocytes. Infect. Immun. 68, 7190– 7194. WELTON, L.A., THAL, L.A., PERRI, M.B., DONABEDIAN, S., MCMAHON, J., CHOW, J.W. and ZERVOS, M.J. (1998). Antimicrobial resistance in enterococci isolated from turkey flocks fed virginiamycin. Antimicrob. Agents Chemother. 42, 705–708. WERNER, G., HILDEBRANDT, B., KLARE, I. and WITTE, W. (2000). Linkage of determinants for streptogramin A, macrolide-lincosamide-streptogramin B and chloramphenicol resistance on a conjugative plasmid in Enterococcus faecium and dissemination of this cluster among streptogramin-resistant enterococci. Int. J. Med. Microbiol. 290, 543–548. WESSELS, D., JOOSTE, P.J. and MOSTERT, J.F. (1990). Technologically important characteristics of Enterococcus isolates from milk and dairy products. Int. J. Food Microbiol. 10, 349–352. WILCKS, A., ANDERSEN, S.R. and LICHT, T.R. (2005). Characterization of transferable tetracycline resistance genes in Enterococcus faecalis isolated from raw food. FEMS Microbiol. Lett. 243, 15–19. WILLIAMS, A.M., RODRIGUES, U.M. and COLLINS, M.D. (1991). Intrageneric relationships of enterococci as determined by reverse transcriptase sequencing of small-subunit rRNA. Res. Microbiol. 142, 67–74. YOSHII, H. (1995). Miso-paste. In: Food Microbiology Handbook. H. Yoshii, Y. Kaneko, and K. Yamaguchi (eds), pp. 204–212. Tokyo, Gihodo. YOUSIF, N.M.K., DAWYNDT, P., ABRIOUEL, H., WIJAYA, A., SCHILLINGER, U., VANCANNEYT, M., SWINGS, J., DIRAR H.A., HOLZAPFEL, W.H. and FRANZ, C.M.A.P. (2005). Molecular characterisation, technological properties and safety aspects of enterococci from ‘Hussuwa’, an African fermented sorghum product. J. Appl. Microbiol. 98, 216–228. ZHAO, H.Y., WANG, H.J. and XU, S.Z. (2004). Intestinal microflora in patients with liver cirrhosis. Clin. J. Dig. Dis. 5, 64–67. RELLER, L.B.

614

Index

Index

acceptable level of risk 157 Ace 572, 574 acid resistance/tolerance Helicobacter pylori 431–2 VTEC 264, 265 Acm 572, 574 acquired antibiotic resistance 582 Active Server Pages technology (ASP) 66 active surveillance 27–8 active surveillance pathogen (ASP) DNA microarray 18 adhesins 387–8 adhesin to collagen from Enterococcus faecalis or Enterococcus faecium 572, 574 Cambylobacter 500 adhesion to host tissue 433 adjunct starter cultures 567 aggregation substance (AS) 572–3, 579 Agr regulatory system 580–1 agriculture/farming 112–13 control of VTEC 265–7 controls and hepatitis viruses 299 see also animal husbandry ail adhesin 387–8 airborne transmission 95 alanine 431 ALARA (as low as reasonably achievable) 154 albendazole 240 alfalfa sprouts 43–4

ALOP see appropriate level of protection a-glucosidase 453 amino acids 431 aminoglycosides 414, 582–3 AmpC multi-drug resistance 44 ampicillin 414 amplified fragment length polymorphism (AFLP) 196–7, 260, 505 animal husbandry control of VTEC 265–7, 269 Mycobacterium paratuberculosis 542–3 Yersinia enterocolitica 396–7 prevention and control 393–4 animal prion diseases detection and diagnosis 317–19 epidemiology 311–16 animal waste 264–5 animals Arcobacter infections 203–4 isolation of Arcobacter from animal sources 199–201 Campylobacter in 479–80, 488–92 hepatitis viruses 287 Johne’s disease 522–4, 525, 526, 542 listeriosis in 412, 418 VTEC in 262–4 anisakiasis 235–6 Anisakis simplex (herring worm) 227, 235–6, 247 antibiotic resistance 27, 30

Index Arcobacter 190 Enter-net and surveillance 63, 64 enterococci 560, 561–2, 582–4 incidence among food enterococci 589, 590 transfer 594–5 hazard identification 143 multi-drug resistant Salmonella serotype Newport 44 antibiotics culture of Helicobacter pylori 438–9 Mycobacterium paratuberculosis 530 supplements in enrichment and plating media for Cambylobacter 493–5 antifungals 198 antigen-based detection methods 83, 86, 258, 421 see also enzyme-linked immunosorbent assay (ELISA) antigenic variation 7–8, 9 apoptosis 284 appendectomy screenings 318 apple cider 41 appropriate level of protection (ALOP) 118, 157, 158, 160, 174 aquaculture 237–8, 243, 244 arbitrary primers 193, 195–6 Arcobacter 181–221, 482, 486 animal infections 203–4 basic physiological attributes 182 detection using growth media 197–203 general principles 197, 198 future recognition of Arcobacter species as pathogens 211 genus 182–6, 187–8 human infections 204–8 identification and typing methods 186–97 biochemical and other non-molecular methods 189–91 molecular methods 191–7 pathogenicity factors 208 prevention and control 210–11 sources of infection 208–10 Arcobacter butzleri 181–2, 183, 184, 187–8, 486 human infections 204–7 Arcobacter cibarius 183, 185, 187–8 Arcobacter cryaerophilus 181–2, 183, 184–5, 187–8, 207 Arcobacter isolation media 197–9 Arcobacter nitrofigilis 183, 185, 187–8 Arcobacter skirrowii 183, 185, 187–8, 207

615

L-arginine 431 at-risk groups 112, 141 Listeria 406, 412, 423, 424 attachment and effacing (AE) lesions 255–6 autoinduction 579–80 automated surveillance 28 avoparcin 583 BabA 433 Bacillus cereus 119 Bacillus subtilis 408–9 bacteraemia 457, 570 bacterial pathogen evolution 3–22, 150 evolution and diversification 3–4 evolution of enteropathogenic Yersinia 15–17 future studies 17–18 genetic mechanisms 4–11 genome decay and potential for increased virulence 8–10 lateral gene transfer 5–7, 12 modulation of frequency of genetic variation 10–11 point mutations and slipped-strand mispairing 7–8, 9 recombination and gene duplication 4–5 recently emerged pathogens and Yersinia pestis genome recipe 11–15 bacteriophage typing 18, 259, 352 bacteriophages 5, 6–7, 12, 299, 498 Bangladesh 355 Basic Surveillance Network (BSN) 63–5, 70 BAX system 454 beef and beef products 40–1 VTEC 262–3 control on beef carcasses 269 Yersinina enterocolitica 386 Behavioral Risk Factor Surveillance System (BRFSS) 33 behavioural surveillance 33–4 binding substance 572 biochemical methods Arcobacter 189–91 prion diseases 319 vibrios 347, 348 biochemical test strips 452 biomarker ions 506 biomarkers 145 biovars 375–6 birds VTEC 264 see also poultry

616

Index

bithionol 240 blood transfusions 323–4 blueberries 291 bovine enteric caliciviruses (BECs) 78, 95–6 bovine spongiform encephalopathy (BSE) 70, 309–10, 313–15, 316, 320–1, 323 oral interspecies prion transmission 314–15 transmission to experimental animals 314 Brocothrix campestris 408 Brocothrix thermospacta 408 brucellosis 385 burden of disease 28–9, 51 assessing 35–8 noroviruses 81 cagA gene 432–3 caliciviruses 78 inactivation 97–8 symptoms of infection 79–80 see also noroviruses Campylobacter 181, 182, 186, 197, 476–521 aerotolerant 183 see also Arcobacter comparative genomics 498–9 culture and isolation 492–6 detection and differentiation 496–8, 508–9 diseases associated with 476, 477–8, 483–8 incidence 483 non-diarrhoeal human disease 486–8 outbreaks 484–6 seasonal illness 483–4 future trends 507–9 genotyping 505–6 history 480–2 host range 476, 479–80 prevention and control 506–7 putative and potential virulence factors 499–505 reservoirs in food and water supply 476, 481, 488–92 Campylobacter coli 477, 479, 481–2, 485, 488–9, 498–9, 508 Campylobacter concisus 477, 479, 491–2 Campylobacter curvus 477, 479, 485, 486, 491–2 Campylobacter fetus 183, 477, 479, 480–1, 490–1

disease 487–8 outbreaks 484, 485 S-layer 504 Campylobacter fetus subsp. fetus (Cff) 477, 484, 487–8, 501 Campylobacter gracilis 477, 479, 491–2 Campylobacter helveticus 477, 479, 490 Campylobacter hominis 477, 479, 491–2 Campylobacter hyointestinalis 477, 479, 490–1 Campylobacter jejuni 5, 111, 430, 476, 477–8, 479, 481–2, 498–9, 506, 508 antigenic variation 8, 9 outbreaks 484 reservoirs 488–9 Campylobacter lanienae 478, 479, 490–1 Campylobacter lari 478, 479–80, 489–90, 498–9 Campylobacter mucosalis 478, 480, 490–1 Campylobacter rectus 478, 480, 491–2 S-layer 504 Campylobacter showae 478, 480, 491–2 Campylobacter sputorum 478, 480, 490–1 Campylobacter upsaliensis 478, 480, 490, 498–9 campylobacteriosis identification and characterisation 26 incidence rates in Europe 53, 55–6 Canada 30 Candidatus Arcobacter sulfidicus 183, 186 canine caliciviruses (CaCV) 97–8 ‘Cape Town Protocol’ 492, 495 capsular polysaccharide 337, 488, 502–3, 572, 578–9 carbapenems 190 carriers 321, 341 case-based surveillance 33 case studies on outbreaks 116 CAT antimicrobial supplement (cefoperazone, amphotericin B, teicoplanin) 199, 494–5 catered food 82–3, 260, 288–9 cathelicidins 578 cats 490 cattle 436 control of Mycobacterium paratuberculosis 542–3 Johne’s disease 522–4 multi-drug resistance Salmonella Newport 44 VTEC 262–3 control on cattle hide 269

Index Yersinia enterocolitica 385 Causido culture 569 cefepime (b-lactam) 190 cefoperazone, amphotericin B and teicoplanin (CAT) 199, 494–5 Centers for Disease Control and Prevention (CDC) (USA) 29, 32, 332 cephalosporins 198 cephalothin 494 cercariae 229, 230, 239 cestodes 222, 223, 225–6, 234–5, 242–3, 246–7 see also helminths cetylpyridinium chloride (CPC) 269 cheese enterococci 563–7, 588, 590 Mycobacterium paratuberculosis 533–4 chemical dehairing 269 children 413–14 see also neonates chitin 343 chitinase 343 chitterlings 383 chloramphenicol 414 chlorine-based disinfection 268 HAV 296, 298 Helicobacter pylori 437 chocolate manufacture 116, 123 cholangiocarcinoma 232–7 cholera 50, 334, 338–44 pandemic spread 355–6 prevention and control 357 cholera toxin (CT) 8, 9, 335, 336–7 chromosomal loci 387–8 chronic wasting disease (CWD) 311, 314, 315–16, 317 cider 41 ciprofloxacin resistance 190 Citrobacter 454 Citrobacter freundii 454 clean cattle policies 269 cleaning and disinfection 396 clinical studies 146 clonorchiasis 228, 233 Clonorchis sinensis (Chinese liver fluke) 224, 228–38, 245 Clostridium botulinum 113 food processing and 113–14 clumping of MAP cells 534–5 CMLP1 498 coccoid form of Helicobacter pylori 440 cockroaches 435–6 cod worm 227, 243

617

codes for hygienic manufacture 122–3 Codex Alimentarius Commission 137, 154, 159 codes 122 criteria for Enterobacteriaceae 459 cold chain hypothesis 524 cold enrichment 420 cold storage see refrigeration colistin 197, 198 collagen binding proteins 572, 574 colonisation 571–5 Communicable Disease Centre (USA) 17 complaint systems 34 conceptual formula 118–19, 124, 169–71 conformation-dependent immunoassay (CDI) 318 consumers/hosts see hosts contingency genes 7–8, 9 control measures (CMs) during food manufacture 120–4 FSM system design 170 FSOs and 157, 160, 163–5, 174–5 control strategies see prevention and control co-trimoxazole 414 Council of State and Territorial Epidemiologists (USA) 29 Creutzfeldt-Jakob disease (CJD) 70–1, 309–10, 320 see also variant Creutzfeldt-Jakob disease (vCJD) critical control points 393–5 Crohn’s disease 524–5 clinical features 526 Mycobacterium paratuberculosis and 525–30 cross-contamination 396 cross-infection 418 CTXf 337 culture methods Arcobacter 197–203 Campylobacter 492–6 Enterobacteriaceae 452–3 Helicobacter pylori 437–9 Listeria 420–2 Mycobacterium paratuberculosis 531–3, 538–9 vibrios 347, 348 viruses 292–3 VTEC 257–8 Yersinia enterocolitica 377 curd 564, 565–6 cured meat products 563 cutting 393, 395

618

Index

Cyclospora cayetanensis 111 cysticercosis 235, 242–3 cytolethal distending toxin (CDT) 499–500 cytolysin 337, 572, 576–7, 579–80 cytotoxic necrotising factors (CNFs) 257 cytotoxicity (cell rounding) 208 cytotoxins 500 Arcobacter and production of 208 D-values 267, 390 dairy products 262–3, 386 see also cheese; milk daptomycin 584 death causes of 407, 408 registration data 51 de-boning 393, 395 deer 311, 314, 315–16 Yersinia enterocolitica 385 deer meat 292 default (safe-harbour) targets 161, 163 defensin deficiency syndrome 526 dehairing 269 dental plaque 434 depuration 299 detection methods 140 Arcobacter 186–203 Campylobacter 496–8, 508–9 Enterobacteriaceae 452–4 Helicobacter pylori 437–9 helminths 233–6, 241–2 hepatitis viruses 292–4 Listeria 420–2 Mycobacterium paratuberculosis 538–42 new and emerging pathogens 25–9 noroviruses 83–9 prion diseases 317–20 vibrios 347–52 VTEC 257–60 Yersinia enterocolitica 376–8 diarrhoea 334, 335 dietary advice 422–3 dimethylnitrosamine 237 Diphyllobothrium 226, 235, 247 Diphyllobothrium latum 235 Directorate General for Health and Consumer Protection (DG SANCO) 69 feasibility studies 68–9 surveillance networks 58–65 Directorate General for Research (DG RESEARCH) 65–8

Disability Adjusted Life Years (DALYs) 37 disease-specific networks 57–70, 72–3 diseases and symptoms Arcobacter 204–8 associating with specific reservoirs 38–40 calicivirus infections 79–80 Campylobacter 476, 477–8, 483–8 Enterobacteriaceae 461–2 enterococci 570–1 Helicobacter pylori 431–3 hepatitis viruses 284–6 Listeria 412–14 liver flukes fishborne 232–7 plantborne 240 vibrios 334–6 Yersinia 17, 379–80 disinfectants/disinfection 396 inaction of noroviruses 97, 98 VTEC 268 dispersed outbreaks 28 distal gastric adenocarcinoma 430 diversification 3–4 lateral gene transfer as driving force for 5–7 DNA-DNA colony hybridisation 189, 191, 347, 351, 377–8 DNA extraction protocols 541 DNA methods see molecular methods DNA microarrays 142 DNA recombination 4–5, 92, 93 dogs 490 dose-response assessment (hazard characterisation) 131–2, 133–4, 139, 145–6 dry milk powder 122–3 ducks 200, 201–2 duplication, gene 4–5 E. coli O157 task force 270 E. coli O157:H7 7, 25, 26, 38, 111, 113, 117, 255 alfalfa sprouts 43 apple cider 41 control measures 265–70 culture methods 257–8 predictive modelling 147 prevalence 262–3, 264 sources of infection in humans 260–2 survival and persistence in food 265, 266 US 25, 35, 36, 41, 43

Index see also verocytotoxigenic E. coli (VTEC) EAST 1 255 ECC-Phylochip 559 economic impact 242–3 EDTA 210 education 222, 237, 240, 356, 422–3, 424 Edwardsiella tarda 460–1 EfaAfm 572, 575 EfaAfs 572, 575, 580 egg counts 242 egg quality assurance programmes (EQAPs) 42 eggs, shell 41–3 El Tor cholera 355 elk 311, 314, 315–16 electron microscopy 292 noroviruses 83–4 encephalopathy 324 see also prion diseases end-of-chain targets 155–6, 157 see also food safety objectives endocarditis 570–1 endocarditis antigens 572, 575, 580 endoscopy 434–5, 437–8 enrichment culturing Enterobacteriaceae 452 media for Campylobacter 493–5 media for Listeria 421 Enter-net (formerly SalmNet) 30, 58–63, 64, 69, 70, 116 enteroaggregative E. coli (EaggEC) 254–5 Enterobacter 450, 456 Enterobacter cloacae 456 Enterobacter sakazakii 120, 452, 457–9 control 462, 464 detection 453 epidemiology 457–9 Enterobacteriaceae 150, 450–75 detection methods 452–4 epidemiology 454–61 Citrobacter 454 Edwardsiella 460–1 Enterobacter 456 Klebsiella 454–6 Morganella, Proteus and Providencia 460 Serratia 460 health risks and underlying factors 461–2 prevention and control 462–4 enterobacterial common antigen (ECA) 450 enterobacterial repetitive intergenic

619

consensus sequence (ERIC)-PCR 193, 195–6 vibrio typing 352–3 enterococcal surface proteins (Esp) 572, 573–4, 585–6 enterococci 557–613 antibiotic resistance 560, 561–2, 582–4 incidence among food enterococci 589, 590 congruence of epidemiological and strain virulence profile data 584–6 enterococcal infections 570–1 habitat 560–9 environment 560–2 foods 562–9 gastrointestinal tract 562 regulation of Enterococcus virulence gene expression 579–82 survival of gastrointestinal transit 589–95 transfer of virulence determinants/ antibiotic resistance 594–5 transmission routes 591–4 taxonomy and identification 557–60 use as probiotics 559, 569, 596 virulence factors 571–9, 595–6 colonisation 571–5 incidence among food enterococci 586–8 secreted virulence factors 575–9 Enterococcus 557 taxonomy and identification 557–60 Enterococcus endocarditis antigens 572, 575, 580 Enterococcus faecalis 557, 561, 562 Ace 574 antibiotic resistance among strains isolated from foods 590 EfaAfs 575, 580 Espfs 573–4 pathogenicity island 586 virulence factors among food enterococci strains 587, 588 Enterococcus faecium 557, 561, 562, 568, 570 Acm 574 antibiotic resistance among strains isolated from foods 590 EfaAfm 575 Espfm 573–4 pathogenicity island 586

620

Index

probiotics 569 secreted antigen (Sag) 572, 575 virulence factors among food enterococci strains 587, 588 enterohaemorrhagic E. coli (EHEC) see verocytotoxigenic E. coli enteroinvasive E. coli (EIEC) 254 enteropathogenic E. coli (EPEC) 253 enterotoxigenic E. coli (ETEC) 33, 254 enterocin-producing enterococci 563 enterotoxins 388, 500 enteroviruses 99 environment changes in 112, 136 enterococci 560–2 Listeria 410, 411, 420 prevalence of hepatitis viruses 294–6, 297 survival of Mycobacterium paratuberculosis 538 VTEC environmental controls 265–7 survival and persistence 264–5 environmental Arcobacter species 183, 185–6 environmental stresses 439–40, 441, 582 enzyme immunoassays (EIAs) 83, 86 enzyme-linked immunosorbent assay (ELISA) Mycobacterium paratuberculosis 541 noroviruses 83, 86 VTEC 258 Yersinia enterocolitica 389 epidemiological database 89–90 epidemiology combining epidemiological data with virological data in virus tracking 89–91 congruence of epidemiological data with strain virulence profile data for enterococci 584–6 Enterobacteriaceae 454–61 hazard characterisation 145–6 Helicobacter pylori 434–7 hepatitis viruses 286–7 Listeria 415–20 liver flukes fishborne 230–2 plantborne 239–40 prion diseases 311–17 Vibrio infections 338–46 Yersinia enterocolitica 379–87 risk factors based on epidemiological

studies 392 epithelial cells 432–3 equivalence concept 158 erythromycin resistance 190, 561 Escherichia coli (E. coli) 4, 253–81, 526 changes in virulence 111–12 detection methods 257–60 E. coli O157 11 E. coli O157 task force 270 E. coli O157:H7 see E. coli O157:H7 enteroaggregative (EAggEC) 254–5 enteroinvasive (EIEC) 254 enteropathogenic (EPEC) 253 enterotoxigenic (ETEC) 33, 254 future trends 271 necrotoxigenic (NTEC) 257 prevention and control 265–71 serotype O55:H7 255 survival, persistence and growth in the food chain 264–5, 266 VTEC see verocytotoxigenic E. coli ESP II Culture System 539 esterolysis 564–7 EUROCJD 70–1, 72 Europe 50–76 challenges for surveillance 72–3 origins of communicable disease control 50 WHO surveillance programme 51–7 see also European Union (EU) European Centre for Disease Prevention and Control (ECDC) 73 European Committee for Standardization (CEN) 294 European Food Safety Authority (EFSA) 73, 120, 459 European Scientific Committee on Veterinary Measures relating to Public Health on Food-borne Zoonoses 271 European Union (EU) 30 challenges for surveillance 72–3 control of VTEC 271 criteria for Enterobacteriaceae 459 disease specific networks funded by European Commission 57–70 Basic Surveillance Network 63–5, 70 Enter-net 30, 58–63, 64, 69, 70, 116 FBVE network 65–6, 69, 70, 89–93 feasibility studies 68–9 networks funded by DG RESEARCH 65–8

Index networks funded by DG SANCO 58–65 Salm-gene 66–8, 69 strengths and weaknesses 69–70 EUROCJD and NEUROCJD 70–1, 72 report on trends and sources of zoonotic agents 71 reports compiled by national surveillance institutes 71–2 experimental animals 314 expert panels 119–20 exposure assessment (EA) 131–2, 134, 139, 143–5 external quality assurance schemes (EQAS) 57, 61, 67 extreme genetic variation 433 f237 355 faecal contamination Arcobacter transmission 209 cholera transmission 338 transmission of hepatitis viruses 287–8 VTEC 262–3, 264–5, 269 farming see agriculture/farming Fasciola gigantica 224, 233, 238–40, 245 Fasciola hepatica 224, 233, 238–40, 245 fascioliasis 234, 238, 239–40, 243 Fasciolopsis buski 225, 234, 246 fatty acid methyl ester (FAME) analysis 190 fatty acid profiles 189–90 familial CJD 316 fatal familial insomnia (FFI) 316 feasibility studies 68–9 feline calicivirus (FeCV) 97–8 feline spongiform encephalopathy (FSE) 312, 314–15 fermentation 391 fermented meats 265, 269–70, 391 fermented sausages 391, 563, 588, 590 fermented vegetables 567–9 fibrin 577 fibronectin (FN) attachment protein homologue (FAP-P) 524 filtration 197, 492, 495 fish pond management 237–8 fishborne liver flukes 224, 228–38, 245 biology and life cycle 229–30 disease and treatment 232–7 distribution and prevalence 228 epidemiology 230–2 prevention and control 237–8

621

flies 435 flukes (trematodes) 222, 223, 224–5, 228– 40, 245–6 intestinal flukes 225, 234, 246 liver flukes fishborne 224, 228–38, 245 plantborne 224, 238–40, 245 lung flukes 224, 234, 245 fluoroquinones 190 fluorouracil 197, 198 focally contaminated foodstuffs 82–3, 260, 288–9 follicular dendritic cells (FDCs) 322, 324–5 Food and Agriculture Organization (FAO) 154, 244 food certification 244 food chain control of VTEC 271 prevention and control of Yersinia enterocolitica 392–6 risk assessment and changes in 133–5 survival, persistence and growth of VTEC 264–5, 266 Food and Drug Administration (FDA) (USA) 30, 43 Food and Environmental Hygiene Department (Hong Kong) 119 food handling Enterobacteriaceae 458–9 hepatitis viruses 288–9 prevention and control 299–300 Klebsiella outbreaks 455 and noroviruses 82–3, 97 personal hygiene 97, 396 prevention and control of cholera 357 Food MicroModel 124 food processing changes in 113–14, 134 control measures 120–4 control of VTEC 267–70 general controls 267–9 specific foods 269–70 control of Yersinia enterocolitica 393, 395–6 Listeria monocytogenes 420 use of risk assessment 138 food safety 50–1 food safety management (FSM) systems 154, 173–5, 267 designing 169–73 see also good agricultural practice; good hygienic practice; good manufacturing practice; Hazard

622

Index

Analysis and Critical Control Point (HACCP) system food safety objectives (FSOs) 118–19, 153–78 designing an FSM system 169–73 microbiological criteria 157, 166–8 nature of 157–60 performance criteria 119, 156, 157, 160, 163–6, 174 performance objectives 118–19, 156, 157, 160–3, 168, 174 recent developments in risk analysis 154–6 when setting a PO may be more efficient than establishing an FSO 168–9 Foodborne Disease Active Surveillance Network (FoodNet) 31, 33–4, 38 foodborne transmission Arcobacter 208–9 cholera 338–41, 342–4 enterococci 591–2, 593, 594 Helicobacter pylori 436, 441 Listeria 419–20 noroviruses 82–3, 94–5 Foodborne Viruses in Europe (FBVE) network 65–6, 69, 70, 89–93 foods associating human diseases with specific reservoirs 38–40 attributing illness to specific source 33 Campylobacter 476, 481, 488–92 culture and isolation 493–6 detection of noroviruses in 86–9 Enterobacteriaceae and spoilage 451 enterococci 562–9 incidence of antibiotic resistance 589, 590 incidence of virulence factors 586–8 growth and survival of Yersinia enterocolitica 389–92 Helicobacter pylori detection 438–9 survival 439–40 isolation of Arcobacter from 202–3 links between pathogens and 113 Listeria in 419–20, 421 Mycobacterium paratuberculosis prevalence 531–3 survival 533–7 surveys of 33–4 survival of hepatitis viruses 294–6, 297 survival and persistence of VTEC 265, 266

frequency modulation of genetic variation 10–11 fresh produce 95, 344, 436 enterococci 560–1 hepatitis A virus 290–1 VTEC 264 fruits 95, 290–1 Fsr regulatory system 580–1 fulminant hepatic failure 284–5 G+C spikes 5–6 gamma irradiation 98, 268–9, 296, 298, 391 gaseous atmospheres growth of Campylobacter 496 growth of Yersinia enterocolitica 391–2 gastric cancer 430 gastric hyperacidity 430 gastroenteritis 77 Helicobacter pylori 434 listeriosis 414 viral see viral gastroenteritis Yersinia enterocolitica 379, 380 gastrointestinal tract enterococci 562 survival of enterococci in gastrointestinal transit 589–95 intestinal flukes 225, 234, 246 gelatinase 572, 577–8, 580–1, 585–6 gelatinase biosynthesis–activated pheromone (GBAP) 581 gelE 577, 580–1 Gene Bank 232 gene duplication 4–5 genetic diversity 4 genetic drift 92–3 genetic susceptibility, and noroviruses 79–80 Genogroup II.4 viruses (GGII.4) viruses 91, 92–3 genome decay 8–10, 14 genome sequencing 16–17 Campylobacter 498–9, 505, 508 Helicobacter pylori 441 noroviruses 85, 91–2 vibrios 358–9 genotyping Campylobacter 505–6 enterococci 559 gentamicin 582 Gerstmann-Sträussler–Scheinker syndrome (GSS) 316 GGIIb variant 92

Index Global Salm-Surv (GSS) 30, 53–7 glycome, Campylobacter 500–1 glycosylation, protein 503–4 goats 314 scrapie 311–12 Yersinia enterocolitica 385 good agricultural practice (GAP) 96, 135 good hygienic practice (GHP) 96, 120–2, 125, 135, 451, 462 hepatitis viruses 299–300 Mycobacterium paratuberculosis 542–3 good manufacturing practice (GMP) 96, 120–2, 125, 134, 137, 393, 451, 462 greater kudu 315 Grimsby viruses 91 growth models 124 growth of pathogens requirements for Helicobacter pylori 430–1 vibrios 342–3 VTEC 264–5, 266 Yersinia enterocolitica 389–92 Growth Predictor 124 growth promoters 589 Guillain-Barré syndrome (GBS) 37, 486 Ha Noi workshop recommendations 244 haemic storage locus (hms) 12 haemolysins 500, 585–6 haemolytic uraemic syndrome (HUS) 255, 257 Hafnia alvei 461 Haplorchis taichui 246 Hazard Analysis and Critical Control Point (HACCP) system 23, 96, 120–2, 125, 134, 145, 393 and FSOs 160 HACCP plan 165 hazard analysis compared with risk assessment 173, 174 Listeria 422 risk management 148 VTEC 267, 270 hazard characterisation 131–2, 133–4, 139, 145–6 hazard identification 131–2, 139, 141–3 heads, pigs’ 394–5 health education 222, 237, 240, 356, 422–3, 424 Health Protection Agency (UK) 17

623

heat treatment Arcobacter 211 caliciviruses 97–8 HAV 296, 298 Mycobacterium paratuberculosis in milk 534–7, 543 VTEC 267 Yersinia enterocolitica 390 control 396 Helicobacter 482, 526 Helicobacter hepaticus 429 Helicobacter influenzae 8 Helicobacter pylori 5, 8, 429–49 detection methods and culture 437–9 clinical samples 437–8 food and water 438–9 disease associations and mechanisms of virulence 431–3 epidemiology and transmission routes 434–7 future trends 440–1 physiology and growth requirements 430–1 role of viable nonculturable state 439–40 survival in food and water 439–40 helminths 222–52 detection 233–6, 241–2 economic impact 242–3 future trends 244 prevention, control and treatment 244, 245–8 zoonotic parasite biology and impact on public health 223–40 fishborne liver flukes 228–38 plantborne liver flukes 238–40 ‘Henry’ illumination technique 420 hepatitis A virus (HAV) 99, 142, 282, 283 areas for further research 300–1 characteristics 283–5 detection 293–4 epidemiology 286–7 outbreaks 287–91 prevention and control 296–300 survival 295–6, 297 hepatitis E virus (HEV) 99, 100, 282–3, 301 characteristics 285–6 detection 294 epidemiology 287 outbreaks 291–2 hepatitis viruses 99, 282–308 areas for further research 300–1

624

Index

characteristics 283–6 detection methods 292–4 epidemiology 286–7 historical background 282–3 outbreaks of foodborne hepatitis 287–92 prevalence in the environment and transmission routes through foodstuffs 294–6, 297 prevention and control 296–300 herbal tea 115 herd management see animal husbandry herring worm 227, 235–6, 247 Heterophyes heterophyes 246 Heterophyidae group 225 high pathogenicity islands (HPIs) 6, 15–16, 257, 388, 586 high pressure treatment 98, 296, 298 hippurate hydrolysis 496 hospital discharge data 51 hosts/consumers Campylobacter host range 476, 479–80 Helicobacter pylori adhesion to host tissue 433 risk assessment and 136 toxins and interaction with host cells 432–3 Yersinia enterocolitica and risk factors associated with 388–9 hot water washing 269 HTST pasteurisation 534–7, 543 human prion diseases 316 detection and diagnosis 319–20 see also Creutzfeldt-Jakob disease; kuru ‘Hussuwa’ 568 hyaluronidase 572, 578 hydrochloric acid 438 hydrogen peroxide 572, 575–6 hygiene hypothesis 524 hygiene indicators 451, 462, 463 iatrogenic transmission 434–5 ice cream 119 ICMSF conceptual formula 118–19, 124, 169–71 immunity noroviruses 79–80 Yersinia enterocolitica 388–9 immunological techniques 83, 86, 258, 421 see also enzyme-linked immunosorbent assay (ELISA) immunomagnetic separation (IMS) 87, 258

with PCR (IMS-PCR) 531–3, 539–40 in-chain (step) targets 156, 157, 174–5 see also microbiological criteria; performance criteria; performance objectives in situ hybridisation (ISH) assay 541 incubation period Campylobacter 496 hepatitis viruses 283–4, 286 Listeria 415 prion diseases 310 Yersinia enterocolitica 379 indicator organisms enterococci as 561 hazard identification 142 industrial food microbiology 111–29 approaching the issue of emerging pathogens 114–15 control measures during food manufacture 120–4 identification of emerging risks 115–20 infant formulae 120, 122–3 Enterobacter sakazakii 457–9 manufacture and safety 462–4 inflammatory bowel disease 525, 527–8, 529–30 information sources, and risk identification 115–20 inhibitor peptides 579 insertion sequence (IS) elements 13, 14 integrated elements 498 internalin 410 International Committee on Epidemics 50 International Health Regulations (IHRs) 50 International Organization for Standardization (ISO) 377, 378 International Sanitary Convention (ISC) 50 intestinal flukes 225, 234, 246 intimin 255–6, 267 intra-familial infection 434 intrinsic antibiotic resistance 582 inv adhesin 387–8 invasins 500 ionising radiation 98, 268–9, 296, 298, 391 Ireland 271 irgasan-ticarcillin-potassium chlorate (ITC) 377 irradiation 98, 268–9, 296, 298, 391 IS900 PCR array 525, 532, 533, 539 isolation Campylobacter 492–6, 508–9 Listeria 420–2

Index media for Arcobacter 197–9 Yersinia enterocolitica 377, 378 jaundice 283 Johne’s disease 522–4, 525, 542 clinical features 526 Joint FAO/WHO Expert Meetings on Microbial Risk Assessment (JEMRA) 154–5 Kanagawa test 347 Kaplan criteria 83–4 Kato Katz technique 242 ‘kjosko’ 239 Klebsiella 454–6 Klebsiella oxytoca 455 Klebsiella pneumoniae 454, 455, 456 Kluyvera 461 ‘Koi pla’ 231 kps genes 502–3 kudu, greater 315 kuru 309, 310, 314, 316 laboratory report surveillance 51 ‘laboratory’ strains 141 lactic acid bacteria (LAB) 391, 557 see also enterococci Lactococcus 557, 558 Lagovirus 78 lairage 394 lamb and lamb products 263 lateral gene transfer 5–7, 12 Lawsonia 482 LEE (Locus of Enterocyte Effacement) 256 legislation see regulation leukodepletion of blood units 323 life cycles fishborne liver flukes 229–30 plantborne liver flukes 238–9 linezolid resistance 584 lipolysis 564–7 lipooligosaccharides 501–2 lipopolysaccharides 501–2 Listeria 406–28 epidemiology, surveillance, typing and routes of transmission 415–20 future trends 423–4 growth and isolation 420–2 history 407–8 prevention and control 422–3, 424 regulatory policies and risk assessment 137–8

625

taxonomy, properties, occurrence and pathogenicity 408–11 Listeria grayi 409 Listeria innocua 409 Listeria ivanovii 409 Listeria monocytogenes 111, 114, 121, 406, 407, 410–11, 412, 423–4, 526 differential characteristics 409 infections 412–14 isolation 421 possibility of FSO 158–9 post-processing contamination 421–2 transmission 418–20 treatment 414 Listeria seeligeri 409 Listeria welshimeri 409 listeriolysin O 410 listeriosis 151, 412–14 adult and juvenile infection 413–14 emergence as a major foodborne disease 407–8 infection in pregnancy and the neonate 412–13 outbreaks 407, 408, 415, 416–17 symptoms 412–13, 414 treatment and prognosis 414 liver flukes 224 fishborne 224, 228–38, 245 plantborne 224, 238–40, 245 loop-mediated isothermal amplification (LAMP) 540–1 LTbR immunoglobulin fusion protein (LTbR-Ig ‘immunoadhesin’) 322 lung flukes 224, 234, 245 lysozyme 410 macrophages 410, 523–4 MALDI-TOF mass spectrometry 506 manganese ions 580 mass chemotherapy 237 mass-produced foods 82–3, 260, 288–9 MB/BacT system 539 meat and bone meal (MBM) 313, 314 meat inspection 393, 394–5 meat and meat products Arcobacter isolation 200, 202–3 transmission 208–9 enterococci 562–3 antibiotic resistance 589, 590 fermented meats 265, 269–70, 391 transmission of hepatitis E 291–2 VTEC 262–3

626

Index

Yersinia enterocolitica control 393, 395–6 growth and survival 390–1 see also under individual types of meat meningitis 413, 461 metabolic products 145 metacercariae 229, 230, 239 metagonimiasis 234 Metagonimus yokogawai 234, 246 metalloprotease 337 microbial intoxications 149 microbiological criteria (MC) 157, 166–8 microbiological risk assessment see risk assessment microchip technology 351 mild preservation techniques 100 milk dry milk powder 122–3 Mycobacterium paratuberculosis 531–3 heat treatment 534–7, 543 starters for cheese and enterococci 564, 565–6 Yersinia enterocolitica 382–3, 386 Miller-Fisher syndrome (MFS) 486 mink 312–13 miso-paste 568 modelling 146–7 modified atmosphere packaging (MAP) 267–8 modified charcoal cefoperazone deoxycholate (mCCDA) 199 molecular epidemiology 89, 91–2 molecular methods 320 Arcobacter 191–7 Campylobacter 497–8, 505–6, 508 Listeria 415–18 molecular subtyping 30, 39 noroviruses 83, 84–9 vibrios 347–52 VTEC 259 monitoring 34, 357–8 Listeria 422 standardising 34–5 vibrios 357–8 Morganella morganii 460 most probable number (MPN) method 347 multilocus sequence typing (MLST) 18, 505–6 multilocus variable-number tandem-repeat analysis (MVLA) 541 multiplex PCR methods 194, 195, 351, 378, 497 mutator strains 10–11

MutS 10–11 Mycobacteria Growth Indicator Tube (MGIT) 539 Mycobacterium leprae 10 Mycobacterium paratuberculosis (MAP) (Mycobacterium avium subsp. paratuberculosis) 120, 522–56 control 542–3 and Crohn’s disease 525–30 detection, enumeration and typing 538– 42 Johne’s disease 522–4 prevalence in foods 531–3 survival in the environment 538 in food 533–7 Mycobacterium tuberculosis 5, 10 National Antimicrobial Resistance Monitoring System (NARMS) 30, 35, 44 national surveillance systems and European networks 69–70 reports compiled by national surveillance institutes 71–2 see also United States of America natural transformation 5 necrotising enterocolitis (NEC) 461 necrotoxigenic E. coli (NTEC) 257 nematodes (roundworms) 222, 223, 226–7, 235–6, 243, 247–8 see also helminths NEMO (NF-kB essential modulator) 529 neonates 412–13, 414, 418 nested PCR probes 193, 194–5 NEUROCJD 70–1 neurodegeneration 310 neuroinvasion 310 neutrophils 410 New Zealand Food Safety Authority (NZFSA) 119 nisin 210–11 NOD2 (CARD15) mutations 529 noroviruses (NoVs) 27, 33, 77–110 detection 83–9 in foods and water 86–9 Kaplan criteria 83–4 and typing in patients 84–6 epidemiology of viral gastroenteritis and examples of viral foodborne outbreaks 80–3 FBVE network 65–6, 69, 70, 89–93 future trends 100

Index inactivation of caliciviruses 97–8 nature of 78–9 prevention and control 96–7 symptoms of a calicivirus infection 79–80 transmission routes 81–2, 93–6 virus tracking 89–93 nosocomial infections 570 Enterobacteriaceae 451, 456, 460 notification statutory 51 surveillance in USA and notifiable diseases 29–31 nucleic acid sequence-based amplification (NASBA) technique 86, 293 O-antigens 375–6 oesophageal cancers 441 Okpehe 568 oligonucleotide-probe microarrays 506, 559 olives 567–8 opisthorchiasis 233, 237, 243 Opisthorchis felineus 224, 228–38 Opisthorchis viverrini 224, 228–38, 245 oral interspecies prion transmission 314–15 ORF8 gene 355 organic acid sprays 269 outbreak investigations 24, 25, 39–40, 51 WHO Programme in Europe 53, 54 outbreaks association with foods 39 Campylobacter 484–6 cholera 338, 339–40 Enterobacter sakazakii 457 hepatitis 287–92 information on 115–17 listeriosis 407, 408, 415, 416–17 noroviruses 81–3 surveillance and 24, 25, 28 outbreak reporting 32, 38 VTEC 260–2 Yersinia enterocolitica 382–3 oxazolidinones 584 oxidative stress response 582 oxygen quenching agents 197, 198 oysters hepatitis A virus 289–90 vibrios 346 prevention and control 356–8 p35 and p36 antibodies 526–9 packaging 391–2

627

pandemics pandemic strains of Vibrio parahaemolyticus 353–5 plague 15 spread of cholera 355–6 paragonimiasis 234, 242 Paragonimus 224, 234 Paragonimus westermani 234, 245 parasites 117, 132, 149 see also helminths parenteral solutions 456 parietal cells 432 passive filtration technique 197 passive surveillance 27–8 pasteurisation 269, 534–7, 543 Pathogen Modelling Program 124 pathogenesis 388–9 pathogenicity islands 6, 15–16, 257, 388, 586 PEB proteins 500 penicillin 414, 582–3 Pennington report 270 Pennsylvania Egg Quality Assurance Program 42 peptic ulcers 430 peptide LL-37 578 performance criteria (PC) 119, 156, 157, 160, 163–6, 174 FSM system design 169–70 performance objectives (POs) 118–19, 156, 157, 160–3, 168, 174 FSM system design 169–73 when setting a PO may be more efficient than establishing an FSO 168–9 persistence of pathogens HAV 295–6, 297 VTEC 264–5, 266 person-to-person transmission Arcobacter 208 Helicobacter pylori 434–5, 441 noroviruses 81, 94 personal hygiene 97, 396 Petrifilm 452 pH Helicobacter pylori and 430–2 vibrios 343 Yersinia enterocolitica and 390 phage typing 18, 259, 352 phages 5, 6–7, 12, 299, 498 phase variation 7 phenotyping 17–18, 375–6, 415 pheromones 572, 575, 579

628

Index

phospholipases 337 phosphorylcholine 503 physician-based cases 51, 81 pigs Arcobacter infections 203–4 isolation from 200, 201 Helicobacter pylori 436 hepatitis viruses 301 VTEC 263 Yersinia enterocolitica 382 prevention and control 393–4, 396–7 reservoirs 383–4 slaughter 393–4 plague 50, 374 epidemics 15 plantborne liver flukes 224, 238–40, 245 biology and life cycle 238–9 disease and treatment 240 distribution and prevalence 238 epidemiology 239–40 prevention and control 240 plants 560 plasmid profiles 453 plasmids 5 Campylobacter 498–9, 504–5 Yersinia 12, 378, 387 plastic bag sealing of rectum 394, 395 pMT1 plasmid 12 point mutations 5, 7–8 polyacrylamide gel electrophoresis (PAGE) 189 polymerase chain reaction (PCR) methods 143, 421 Campylobacter 497–8 Enterobacteriaceae 453–4 enterococci 559 hepatitis viruses 293–4 multiplex PCR methods 194, 195, 351, 378, 497 Mycobacterium paratuberculosis 539–41 nested PCR probes 193, 194–5 PCR-RFLP 497, 505 vibrios 347–52 VTEC 259 Yersinia enterocolitica 378 polynucleotide tracts 499 polysaccharide capsule 337, 488, 502–3, 572, 578–9 pork and pork products hepatitis viruses 301 transmission of Arcobacter 208–9

VTEC 263 Yersinia enterocolitica 385–6 post-process contamination 124, 421–2 potassium hydroxide 377, 378 poultry and poultry products Arcobacter isolation 200, 201–2 transmission 208–9 control of Campylobacter 506–7 Yersinia enterocolitica 385 pPla plasmid 12 praziquantel 237 predictive models 146–7 pregnancy 412–13 prevention and control 24, 151 Arcobacter 210–11 Campylobacter 506–7 Enterobacteriaceae 462–4 helminths 244, 245–8 fishborne liver flukes 237–8 plantborne liver flukes 240 hepatitis viruses 296–300 Listeria 422–3, 424 Mycobacterium paratuberculosis 542–3 noroviruses 96–7 prion diseases 321–3 surveillance and 40–4 vibrios 356–8 VTEC 265–71 Yersinia enterocolitica 392–6 primates 207–8 primer sets 497–8 primers, arbitrary 193, 195–6 prion diseases 309–31 detection and diagnosis 317–20 animal prion diseases 317–19 human prion diseases 319–20 epidemiology 311–17 BSE 313–15 CWD 315–16 FSE 312 human prion diseases 316 scrapie in sheep and goats 311–12 TME 312–13 vCJD 316–17 future trends 323–4 prevention and control 321–3 protein-only hypothesis 310–11, 324 terminology 324–5 transmission 320–1 prion-susceptible cell lines 319 Prnp mutations 311

Index probabilistic risk assessment techniques 158 probiotics 559, 569, 596 process criteria 119, 157, 165–6 product criteria 157, 165–6 ProMED-mail 302 prophage 504–5 protease 337 protein glycosylation 503–4 protein-only hypothesis 310–11, 324 protein supplements 313 Proteus mirabilis 460 Proteus vulgaris 460 protozoa 132, 149 Providencia alcalifaciens 460 PrPC 310–11, 320, 322–3, 324 PrPSc 310–11, 315, 316, 322, 324 detection of prion diseases 317–19, 320 Prusiner, Stanley 309, 310–11 pseudogenes 8–10 Yersinia pestis 13–14 Pseudomonas aeruginosa 11 Pseudoterranova decipiens (cod worm) 227, 243 Public Health Laboratory Information System 29 public health surveillance see surveillance pulsed electric field (PEF) treatment 537 pulsed-field gel electrophoresis (PFGE) 18, 30, 505 Arcobacter 196 profiles and Salm–gene 67–8 vibrio typing 352–3 VTEC 259–60 PulseNet 30, 66–7, 116 Pulse-net Europe network 69 quantitative microbiology techniques 158 quantitative risk assessment 147, 271, 422, 424 quarantine 50 quinupristin/dalfopristin (Synercid) resistance 583–4, 589 quorum-sensing 579–80 radiometric culture 539 randomly amplified polymorphic DNA (RAPD)-PCR 195–6 raw fish/seafood 230–1, 343 rDNA primer sets 497–8 reactive arthritis 379, 380 real-time PCR (RTPCR) hepatitis viruses 293–4 Mycobacterium paratuberculosis 540

629

vibrios 348–51 VTEC 259 real-time RT-PCR 85–6 recombination, DNA 4–5, 92, 93 rectum, plastic bag sealing method for 394, 395 refrigeration 164 control of Arcobacter 210–11 Yersinia enterocolitica 396 survival 390–1 regulation 136–8, 244 Listeria 422, 424 use of microbial risk assessment 138 rep PCR 260 reservoirs associating human diseases with specific reservoirs 38–40 Campylobacter in food and water supply 476, 481, 488–92 hosts for liver flukes 231, 240 Yersinia enterocolitica 383–5 restaurant-based outbreaks 288–9 restriction fragment length polymorphism (RFLP) 541 Arcobacter 191–4 Campylobacter 497 PCR-RFLP 497, 505 vibrio typing 352–3 retail outlets 260, 288–9 reverse transcription polymerase chain reaction (RT-PCR) 83, 84–9 ribotyping 260, 505 Arcobacter 191–4 vibrios 352–3 Ricksettia prowazekii 10 risk analysis 39, 117 recent developments 154–6 risk assessment 117–20, 124, 130–52, 154– 5, 160, 173, 174 exposure assessment 131–2, 134, 139, 143–5 hazard characterisation 131–2, 133–4, 139, 145–6 hazard identification 131–2, 139, 141–3 importance of changes in levels of risk 133–6 characteristics and prevalence of emerging pathogens 135–6 consumers/hosts 136 environment 136 food chain 133–5 interaction with legislation 136–8

630

Index

knowledge available for different groups of foodborne hazards 148–50 modelling 146–7 and PCs 165 and POs 162–3 quantitative 147, 271, 422, 424 terms of reference 138–41 users of risk assessments 138 VTEC 271 risk-based sampling plans 166 risk characterisation 132, 139, 146, 173, 174 risk communication 148 risk management 147–8, 155–6, 160 and designing FSM systems 171–3 RNA viruses 150 rotavirus 142 roundworms (nematodes) 222, 223, 226–7, 235–6, 243, 247–8 see also helminths S-layer (surface layer) proteins (SLPs) 504 saa 256 SabA 433 safe-harbour (default) targets 161, 163 Sag 572, 575 salads 264, 290 saliva 434 Salm-gene 66–8, 69 SalmNet 116 see also Enter-net Salmonella 111, 113, 451 alfalfa sprouts 43 control measures during food manufacture 122–3 FSOs and POs 168–9 manufacture of infant formula and 463 pre-cooked roast beef and 40–1 rank of serotypes 37 surveillance Enter-net 30, 58–63, 64, 69, 70, 116 GSS 30, 53–7 Salm-gene 66–8, 69 USA 29–30 Salmonella Agona 115 Salmonella Enteritidis 113 PFGE profiles 67, 68 phage type 4 11 and shell eggs 41–3 trends in Europe 59, 60 Salmonella Livingstone 63 Salmonella Newport 27, 44 Salmonella Oranienburg 69

Salmonella Typhimurium 6–7, 9–10 DT204b 61–3 PFGE profiles 67, 68 trends in Europe 60 salmonellosis 151, 332 Sanitary and Phytosanitary Measures (SPS) agreement 137, 157 Sapovirus (SaV) 78 SARS virus 99 sausages control of Yersinia enterocolitica 395–6 fermented 391, 563, 588, 590 scrapie 309, 311–12, 317, 320, 321 seafood consumption 332–3 raw 230–1, 343 vibrios 345, 346 cholera 342, 343–4 production and control 356–8 see also shellfish seasonality Campylobacter illness 483–4 listeriosis 412 transmission of liver flukes 231–2 vibrios 345, 346 secreted antigen (Sag) 572, 575 secreted virulence factors 572, 575–9 selective media 420–1, 438–9 sensitive subpopulations see at–risk groups sentinel-site surveillance 28, 31 septicaemia 334, 335, 336, 461 serotyping 18 Arcobacter 190–1 surveillance of Salmonella 29–30 Yersinia enterocolitica 375 serovars Listeria 418 Yersinia enterocolitica 375–6 Serratia 460 sewage 294–5 treatment 561 sex pheromones 572, 575, 579 sheep BSE 314 Helicobacter pylori 436 scrapie 311–12 VTEC 263 Yersinia enterocolitica 385 shell eggs 41–3 shellfish Campylobacter 489–90 hepatitis A virus 289–90, 295 production and control 298–9

Index noroviruses 86, 94 vibrios 345, 346 cholera 343–4 production and control 356–8 see also seafood Shiga-like toxins 500 Shiga toxins (Stx) (verocytotoxins) 256 Shigella 10, 254, 451 siderophores 337 silage 418 16S rRNA probes 192, 194–5 skin complaints 379–80 slaughter 393–4, 396–7 slipped-strand mispairing 7–8, 9, 14 snails fishborne liver flukes 229–30 plantborne liver flukes 239, 240 social functions/events 83, 260, 288–9 sodium phosphotungstic (NaPTA) precipitation method 318 sodium tripolyphosphate 211 SopE 6–7 Sorbitol McConkey agar (SMAC) 258 sorghum, fermented 568, 588, 590 speciation 496–8 specified risk materials (SRM) 323 sporadic cases 28, 380–2 sporadic CJD (sCJD) 316, 319 sprE 577, 580–1 standard virus detection methods 294, 301 standardisation of surveillance and monitoring 34–5 Staphylococcus aureus 580–1 starter cultures (for cheese) 564, 565–6, 567, 596 statutory notifications 51 steam pasteurisation 269 step (in-chain) targets 156, 157, 174–5 see also microbiological criteria; performance criteria; performance objectives stomach 429, 438 acid resistance and survival in 431–2 stool samples 241–2 isolation of Campylobacter 492–3 strawberries 290–1 Streptococcus 557, 558 streptogramin resistance 583–4 streptomycin 582 stresses, environmental 439–40, 441, 582 sub-maxillary lymph nodes, incision of 394–5 Sulfurospirillum 482

631

superoxide 572, 575–6 supply chain see food chain surface layer (S–layer) 504 surveillance 17–18, 23–5 cycle of surveillance and prevention 24 detecting new and emerging pathogens 25–9 Europe see Europe; European Union expanding to cover foodborne viruses 100 and food safety 50–1 hazard characterisation 145–6 information from surveillance systems 116–17 Listeria 415–20 UK 17 USA see United States of America surveillance pyramid 35–7, 51, 52 survival enterococci and gastrointestinal transit 589–95 HAV 295–6, 297 Helicobacter pylori in food and water 439–40 Mycobacterium paratuberculosis in the environment 538 in food 533–7 vibrios 342–3 VTEC 264–5, 266 Yersinia enterocolitica 390–1 Sutterella 482 sweet butter production 121 symptoms see diseases and symptoms Synercid (quinupristin/dalfopristin) resistance 583–4, 589 T lymphocytes 410 Taenia saginata 225, 234–5, 246 Taenia solium 225–6, 235, 246–7 taeniasis 234–5, 242–3 tapeworms (cestodes) 222, 223, 225–6, 234–5, 242–3, 246–7 see also helminths TDH-related haemolysin (TRH) 336 teicoplanin 198 temperature growth of Campylobacter 495–6 growth of Yersinia enterocolitica 389 VTEC and survival 264, 266 see also heat treatment; refrigeration test-and-cull strategies 543 thermostable direct haemolysin (TDH) 336 thrombotic thrombocytopaenic purpura (TTP) 255

632

Index

tolerable level of risk 157 tonsil biopsy 318 toxin-coregulated pilus (TCP) 337 toxins Campylobacter 499–500 cholera toxin 8, 9, 335, 336–7 cytotoxins 208, 500 enterotoxins 388, 500 Helicobacter pylori 432–3 production by Arcobacter 208 Shiga-like toxins 500 verocytotoxins 256 toxRS-targeted PCR 354 transmissible mink encephalopathy (TME) 312–13, 314 transmissible spongiform encephalopathies (TSEs) see prion diseases transmission routes Arcobacter 208–10 enterococci 591–4 Helicobacter pylori 434–7, 441 hepatitis viruses 286–7, 294–6 Listeria 415–20 liver flukes fishborne 230–2 plantborne 239–40 noroviruses 81–2, 93–6 prion diseases 320–1 Vibrio infections 338–46 VTEC 260–4 Yersinia enterocolitica 385–7 transposons 5, 12 treatment helminth infections 244, 245–8 fishborne liver flukes 232–7 plantborne liver flukes 240 listeriosis 414 trematodes see flukes Trichinella 226–7, 236 Trichinella spiralis 236, 247–8 trichinellosis/trichinosis 236, 243 triclabendazole 240 trimethoprim 198 trisodium phosphate 210 23S rRNA probes 192–3, 194–5 two-component signal transduction systems (TCSTSs) 505 two-knife method 394 type IV secretion system (T4SS) genes 499 typing Arcobacter 186–97 Enterobacteriaceae 453–4 genotyping 505–6, 559

Listeria 415–20 Mycobacterium paratuberculosis 538–42 noroviruses 84–6 phage typing 18, 259, 352 phenotyping 17–18, 375–6, 415 serotyping 18, 29–30, 190–1, 375 vibrios 352–3 VTEC 259–60 Yersinia enterocolitica 375–6 tyrosine-tyrosine-arginine (YYR) motifs 318 ulcerative colitis 525, 527–8, 529–30 ulcers, peptic 430 undernutrition 222–3 underreporting 32–3 United Kingdom control of VTEC 270 dietary advice and Listeria 423 United States of America (USA) 17, 23–49 detecting new and emerging pathogens 25–9 dietary advice and Listeria 423 foodborne illness statistics 332 future trends 44–5 surveillance methods 29–35 behavioural surveillance and surveys of foods 33–4 foodborne outbreak reporting 32 limitations of surveillance 32–3 nationally notifiable diseases 29–31 sentinel site surveillance 31 standardising surveillance and monitoring 34–5 use of surveillance data 35–44 assessing the burden of disease 35–8 associating diseases with specific reservoirs 38–40 control strategies and their effectiveness 40–4 United States Department of Agriculture (USDA) 30 Food Safety and Inspection Service (FSIS) 271 urease activity 431–2 urinary tract infections (UTI) 571 UV radiation 98 vaccination of food handlers and hepatitis viruses 300

Index Mycobacterium paratuberculosis 542 prion diseases 322–3 VTEC 267 vacuolating toxin (VacA) 432 vancomycin 198, 414 vancomycin-resistant enterococci (VRE) 561, 583, 589 variant Creutzfeldt-Jakob disease (vCJD) 70–1, 72, 310, 316–17, 320–1, 323–4 vector borne transmission 435–6 vegetables 95, 264, 436 cholera 344 enterococci in fermented vegetables 567–9 verification FSOs 159 POs 163 verocytotoxigenic E. coli (VTEC) 168–9, 255–7, 257–72 control measures 265–71 on farm and environmental controls 265–7 food production 267–70 national and international initiatives 270–1 detection methods 257–60 Enter-net 58–63 future trends 271 infection rates 262 prevalence 262–4 sources of infection in humans 260–2 survival, persistence and growth in food chain 264–5 environment 264–5 food 265, 266 see also E. coli O157:H7 verocytotoxins (VT) (Shiga toxins) 256 Vesivirus 78 Veterinary Diagnostic Laboratory Reporting System 117 viable nonculturable state (VNBC) 439–40 Vibrio cholerae 7, 11, 15, 333, 334 clinical signs and symptoms 334–5 detection 347–52 epidemiology 338–44 genome sequencing 358–9 pandemic spread of cholera 355–6 subspecies typing 352 virulence factors 336–7 Vibrio parahaemolyticus 332, 333, 334 clinical signs and symptoms 334, 335–6

633

detection 347–52 epidemiology 344–5 genome sequencing 358–9 new pandemic strains 353–5 prevention and control 357–8 subspecies typing 352–3 virulence factors 336 Vibrio vulnificus 333, 334, 357, 358 clinical signs and symptoms 334, 336 detection 347–52 epidemiology 345–6 subspecies typing 353 virulence factors 337–8 vibrios 332–72 clinical signs and symptoms 334–6 detection methods 347–52 epidemiology 338–46 genomic era 358–9 pandemic spread of cholera 355–6 prevention and control 356–8 subspecies typing 352–3 taxonomy and historical background 333–4 virulence factors 336–8 Violet Red Bile Glucose (VRBG) agar 452 viral gastroenteritis 66, 77 noroviruses epidemiology 80–3 Kaplan criteria 83–4 symptoms of a calicivirus infection 79–80 virginiamycin 583, 589 virions 284 virological sequence database 90–1 virulence changes in E. coli 111–12 genome decay and potential for increased 8–10 regulation of Enterococcus virulence gene expression 579–82 virulence factors 18 Campylobacter 499–505 Enterobacteriaceae 461 enterococci 571–9, 595–6 congruence of epidemiological and strain virulence profile data 584–6 incidence among food enterococci 586–8 transfer 594–5 vibrios 336–8 VTEC 256–7

634

Index

virus like particles (VLPs) 86 virus tracking 89–93 viruses 77–8, 79, 117, 132–3, 148–50 detection 292–4 difficulty of detection 292–3 see also hepatitis viruses; noroviruses warning labels 356 water Campylobacter culture and isolation 493–6 reservoirs of Campylobacter 488–92 enterococci 561–2 Helicobacter pylori detection 438–9 survival 439–40 isolation of Arcobacter 203 Mycobacterium paratuberculosis 538 noroviruses detection in 86–9 prevention and control 96–7 process water 121 survival of HAV 295–6, 297 VTEC 260–2, 264 Yersinia enterocolitica 383, 386–7 waterborne transmission Arcobacter 209–10 cholera 338–41 enterococci 592–4 Helicobacter pylori 436–7, 441 noroviruses 82, 94–5 watercress 239, 240 Western immunoblot analysis 320 whole cell protein profiles 189 World Health Assembly 50 World Health Organization (WHO) 154, 244 food handling 299–300 report on EHEC 270 surveillance programme for control of foodborne infections and intoxications in Europe 51–7 World Trade Organization SPS agreement 137, 157 World Wide Web 115 wound infections 334, 335, 336 Yersinia evolution of enteropathogenic 15–17 paradox 11–12, 17

Yersinia enterocolitica 11–12, 373–405 biotyping 375 correlation between biovars, serovars, ecology and pathogenicity 375–6 detection methods 376–8 differentiation from other Yersinia spp. 374–5 epidemiology 379–87 clinical symptoms of infection 379–80 outbreaks 382–3 reservoirs 383–5 sporadic cases 380–2 vehicles for transmission 385–7 evolution 15–17 future trends 396–7 historical aspects 374 phenotypic characterisation 375–6 prevention and control 392–6 risk factors based on epidemiological studies 392 risk factors connected to the agent 387–8 risk factors in connection with the host 388–9 risk factors in connection with survival and growth in foods 389–92 serotyping 375 taxonomy and characteristics 374–5 Yersinia outer membrane proteins (Yops) 387, 389 Yersinia pestis 10, 374 biovars 15 evolution 15–17 genome recipe 11–15 add DNA 12–13 reduce 13–15 stir 13 Yersinia pseudotuberculosis 11–12, 374 evolution 15–17 yersiniosis 379–83 YEST 388 zero tolerance policy 137 zoning 463 zoonotic agents, annual report on trends and sources 71 zoonotic transmission Helicobacter pylori 435–6 hepatitis viruses 301 noroviruses 95–6