Human Embryogenesis: Methods and Protocols (Methods in Molecular Biology)

Series Editor John M. Walker School of Life Sciences University of Hertfordshire Hatfield, Hertfordshire, AL10 9AB, UK

For other titles published in this series, go to www.springer.com/series/7651

Human Embryogenesis Methods and Protocols

Edited by

Julie Lafond Universit´e du Qu´ebec a` Montr´eal, Montr´eal, QC, Canada

and Cathy Vaillancourt INRS-Institut Armand-Frappier, Laval, QC, Canada

Editors Julie Lafond D´epartement des Sciences Biologiques Laboratoire de Physiologie Materno-Foetale Universit´e du Qu´ebec a` Montr´eal C.P. 8888, Succ. Centre-Ville Montr´eal QC H3C 3P8 Canada [email protected]

Cathy Vaillancourt Institut national de la recherche scientifique Institut Armand-Frappier Universit´e du Qu´ebec 531 boulevard des Prairies Laval QC H7V 1B7 Canada [email protected]

ISSN 1064-3745 e-ISSN 1940-6029 ISBN 978-1-60327-008-3 e-ISBN 978-1-60327-009-0 DOI 10.1007/978-1-60327-009-0 Springer Dordrecht Heidelberg London New York Library of Congress Control Number: 2009927893 c Humana Press, a part of Springer Science+Business Media, LLC 2009  All rights reserved. This work may not be translated or copied in whole or in part without the written permission of the publisher (Humana Press, c/o Springer Science+Business Media, LLC, 233 Spring Street, New York, NY 10013, USA), except for brief excerpts in connection with reviews or scholarly analysis. Use in connection with any form of information storage and retrieval, electronic adaptation, computer software, or by similar or dissimilar methodology now known or hereafter developed is forbidden. The use in this publication of trade names, trademarks, service marks, and similar terms, even if they are not identified as such, is not to be taken as an expression of opinion as to whether or not they are subject to proprietary rights. Printed on acid-free paper Springer is part of Springer Science+Business Media (www.springer.com)

Preface “Now, an embryo may seem like some scientific or laboratory term, but, in fact, the embryo contains the unique information that defines a person.” Todd Akin, American politician The aim of this volume set of Human Embryogenesis: Methods and Protocols is to present the latest developments in human embryogenesis study. In this book, internationally recognized researchers describe in great detail the methods they have perfected to analyze different aspects of the embryogenesis process. A key aspect of this book is that it is written by investigators who have used the techniques extensively. Each protocol includes tips on avoiding pitfalls, notes on the method’s advantages and disadvantages, and a critical survey of the literature. Human embryogenesis encloses a large domain of research, and it would be impossible to describe each aspect in this book. The book does not limit the discussion only to embryos, but it also addresses critical features of fetal and placental development as well as of uterine biology, within which the embryo is housed. Subjects covered include strategies for studying the molecular mechanisms of embryonic development, as well as in vitro fertilization, cloning, and a chapter on the ethics considerations raised by the research on human embryogenesis, a controversial field. The techniques described in this book are also applicable to other species or research in developmental biology and cover a vast range of approaches from animal cloning to fetal programming, from molecular and cellular analysis to bioethics. In developing this volume, we encountered the problem of choosing which subjects should be included and how to organize the contents so as to be reader-friendly. Our decision was to subdivide in large part, so in vitro systems of investigation of implantation and placentation come first, followed by protocols to study the development of the embryo to the fetus and new in vitro fertilization and cloning methods. The book concludes with a review of the laws and ethical considerations, which cannot be dissociated from research on human embryos. Each chapter follows the successful Methods in Molecular BiologyTM series format, each offering step-by-step laboratory instructions, an introduction outlining the principles behind the technique, lists of the necessary equipment and reagents, and notes designed to help the reader perform the experiments without difficulty. Also, illustrations highlight particular techniques as well as expected outcomes. This project would not have been possible without the contributions of many individuals. We wish to express our gratitude to the contributing authors for their time, effort, creativity, and their willingness to share their knowledge and expertise. Our gratefulness goes to Marie-Claude Charest, M.Sc., for her help in the revision and organization of the manuscripts. Our acknowledgment also goes to the publisher who has provided us with helpful guidance and instruction essential for the completion of this book. This book takes a contemporary approach to describing the complex process that transforms an egg into an adult organism. Comprehensive and state-of-the-art, Human

v

vi

Preface

Embryogenesis: Methods and Protocols provides both fundamental and clinical researchers as well as post-docs and graduate students a firm foundation for the successful analysis of the embryogenesis process and a description of the limitations and advantages of the techniques proposed. We hope that it will be useful to all of those who have an interest in unraveling the mysteries of human embryogenesis. We believe you will find in this reference book the most recent and detailed protocol of the experiment that will prove or disprove your wildest hypothesis. Julie Lafond Cathy Vaillancourt

Contents Preface . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

v

Contributors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

ix

SECTION I: INTRODUCTION: WHAT IS HUMAN EMBRYOGENESIS? 1.

Human Embryogenesis: Overview . . . . . . . . . . . . . . . . . . . . . . . Cathy Vaillancourt and Julie Lafond

3

SECTION II: STUDYING EMBRYO IMPLANTATION: FROM TROPHOBLASTS TO EMBRYO 2.

Differential Gene Expression in the Uterus and Blastocyst During the Reactivation of Embryo Development in a Model of Delayed Implantation 11 Pavine L.C. Lef`evre and Bruce D. Murphy

3.

Coculture of Decidua and Trophoblast to Study Proliferation and Invasion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Marie Cohen and Paul Bischof

63

Isolation and Culture of Term Human Cytotrophoblast Cells and In Vitro Methods for Studying Human Cytotrophoblast Cells’ Calcium Uptake Fr´ed´erique Le Bellego, Cathy Vaillancourt, and Julie Lafond

73

Endocrinology and Cell Signaling in Human Villous Trophoblast . . . . . .

89

4.

5.

Catherine Mounier, Benoit Barbeau, Cathy Vaillancourt and Julie Lafond 6.

Gestation-Induced Uterine Vascular Remodeling . . . . . . . . . . . . . . . 103 Pierre-Andr´e Scott, Myl`ene Provencher, Pascale Gu´erin and Jean St-Louis

SECTION III: STERIODOGENESIS AND REPRODUCTIVE SYSTEM 7.

Placental and Fetal Steroidogenesis . . . . . . . . . . . . . . . . . . . . . . . 127 J. Thomas Sanderson

8.

Current Methods in Investigating the Development of the Female Reproductive System . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 137 Patrick J. Devine, Patricia B. Hoyer, and Aileen F. Keating

9.

A Revised and Improved Method for the Isolation of Seminiferous Tubule-Enriched Fractions that Preserves the Phosphorylated and Glycosylated Forms of Proteins . . . . . . . . . . . . . . . . . . . . . . . . . 159 Casimir D. Akpovi and R.-Marc Pelletier

vii

viii

10.

Contents

A Novel Technical Approach for the Measurement of Individual ACAT-1 and ACAT-2 Enzymatic Activity in the Testis . . . . . . . . . . . . . 169 Li Chen, Julie Lafond, and R.-Marc Pelletier

SECTION IV: FROM EMBRYO TO FETAL DEVELOPMENT 11.

Genetic Dissection of Caenorhabditis elegans Embryogenesis Using RNA Interference and Flow Cytometry . . . . . . . . . . . . . . . 181 Elodie L. Boulier and Sarah Jenna

12.

Immune System: Maturation of Myeloid Cells . . . . . . . . . . . . . . . . . 195 Jamila Ennaciri and Denis Girard

13.

Functional Development of Human Fetal Gastrointestinal Tract . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 205 Emile L´evy, Edgard Delvin, Daniel M´enard, and Jean-Franc¸ois Beaulieu

14.

Renal and Cardiac Na+–K+-ATPase and Aconitase in a Rat Model of Fetal Programming . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 225 R´ebecca Gaudet and Mich`ele Brochu

SECTION V: EMBRYOTOXICITY, IN VITRO FERTILIZATION, CLONING, AND E THICS 15.

Assessment of Embryotoxicity Using Mouse Embryo Culture . . . . . . . . . 241 Louise M. Winn and Emily W.Y. Tung

16.

Fertilization In Vitro . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 251 Yinzhong Bing and Rodney J. Ouellette

17.

Animal Cloning by Somatic Cell Nuclear Transfer . . . . . . . . . . . . . . . 267 Lawrence C. Smith and Jae-Gyu Yoo

18.

The Human Embryo: Ethical and Legal Aspects . . . . . . . . . . . . . . . . 281 Bartha Maria Knoppers, Sylvie Bordet, and Rosario Isasi

Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 307

Contributors CASIMIR D. AKPOVI • Department of Pathology and Cell Biology, University of Montreal, Montr´eal, Qu´ebec, Canada BENOIT BARBEAU • BioMed Research Center, Department of Biological Sciences, Universit´e du Qu´ebec a` Montr´eal, Montr´eal, Qu´ebec, Canada JEAN-FRANC¸ OIS BEAULIEU • CIHR Team on Digestive Epithelium, Department of Anatomy and Cell Biology, Universit´e de Sherbrooke, Sherbrooke, Qu´ebec, Canada YINZHONG BING • Conceptia Clinic, Dr Georges L Dumont Hospital, Atlantic Cancer Research Institute, Moncton, New-Brunswick, Canada PAUL BISCHOF • Laboratoire d’Hormonologie, Department of Gynaecology and Obstetrics, Geneva, Switzerland SYLVIE BORDET • Centre for Public Law, Faculty of Law, University of Montreal, Montr´eal, Qu´ebec, Canada ELODIE L. BOULIER • Integrative Genomics and Cell Signaling laboratory, Department of Chemistry and Biological Sciences, Universit´e du Qu´ebec a` Montr´eal, Montr´eal, Qu´ebec, Canada MICH E` LE BROCHU • CHU Sainte-Justine, Mother and Child University Hospital Center, University of Montreal, Montr´eal, Qu´ebec, Canada LI CHEN • Department of Pathology and Cell Biology, University of Montreal, Montr´eal, Qu´ebec, Canada MARIE COHEN • Laboratoire d’Hormonologie, Department of Gynaecology and Obstetrics, Geneva, Switzerland EDGARD DELVIN • CIHR Team on Digestive Epithelium, Departments of Biochemistry, Centre de recherche, CHU Sainte-Justine, Mother and Child University Hospital Center, University of Montreal, Montr´eal, Qu´ebec, Canada PATRICK J. DEVINE • Institut national de la recherche scientifique (INRS) – Institut Armand-Frappier, Universit´e du Qu´ebec, Laval, Qu´ebec, Canada JAMILA ENNACIRI • Laboratoire de recherche en inflammation et physiologie des granulocytes, Institut national de la recherche scientifique (INRS) – Institut Armand-Frappier, Universit´e du Qu´ebec, Laval, Qu´ebec, Canada RE´ BECCA GAUDET • CHU Sainte-Justine, Mother and Child University Hospital Center, University of Montreal, Montr´eal, Qu´ebec, Canada DENIS GIRARD • Laboratoire de recherche en inflammation et physiologie des granulocytes, Institut national de la recherche scientifique (INRS) – Institut Armand-Frappier, Universit´e du Qu´ebec, Laval, Qu´ebec, Canada PASCALE GU E´ RIN • Departments of Obstetrics and Gynecology and of Pharmacology, CHU Sainte-Justine, Mother and Child University Hospital Center, University of Montreal, Montr´eal, Qu´ebec, Canada PATRICIA B. HOYER • Department of Physiology, The University of Arizona, Tucson, Arizona, USA ROSARIO ISASI • Centre for Public Law, Faculty of Law, University of Montreal, Montr´eal, Qu´ebec, Canada

ix

x

Contributors

SARAH JENNA • Integrative Genomics and Cell Signaling Laboratory, Department of Chemistry and Biological Sciences, Universit´e du Qu´ebec a` Montr´eal, Montr´eal, Qu´ebec, Canada AILEEN F. KEATING • Department of Physiology, The University of Arizona, Tucson, Arizona, USA BARTHA MARIA KNOPPERS • CRC in Law and Medicine, Centre for Public Law, Faculty of Law, University of Montreal, Montr´eal, Qu´ebec, Canada JULIE LAFOND • BioMed Research Center, Department of Biological Sciences, Universit´e du Qu´ebec a` Montr´eal, Montr´eal, Qu´ebec, Canada FR E´ D E´ RIQUE LE BELLEGO • BioMed Research Center, Department of Biological Sciences, Universit´e du Qu´ebec a` Montr´eal, Montr´eal, Qu´ebec, Canada PAVINE L.C. LEF E` VRE • Animal Reproduction Research Centre, Faculty of Veterinary Medicine, University of Montreal, University of Montreal, St-Hyacinthe, Qu´ebec, Canada EMILE LE´ VY • CIHR Team on Digestive Epithelium, Departments of Nutrition and Biochemistry, Centre de recherche, CHU Sainte-Justine, University of Montreal, Montr´eal, Qu´ebec, Canada DANIEL ME´ NARD • CIHR Team on Digestive Epithelium, Department of Anatomy and Cell Biology, Universit´e de Sherbrooke, Sherbrooke, Qu´ebec, Canada CATHERINE MOUNIER • BioMed Research Center, Department of Biological Sciences, Universit´e du Qu´ebec a` Montr´eal, Montr´eal, Qu´ebec, Canada BRUCE D. MURPHY • Animal Reproduction Research Centre, Faculty of Veterinary Medicine, University of Montreal, St-Hyacinthe, Qu´ebec, Canada RODNEY J. OUELLETTE • Atlantic Cancer Research Institute, Moncton, New-Brunswick, Canada R.-MARC PELLETIER • Department of Pathology and Cell Biology, University of Montreal, Montr´eal, Qu´ebec, Canada MYL E` NE PROVENCHER • Departments of Obstetrics and Gynecology and of Pharmacology, CHU Sainte-Justine, Mother and Child University Hospital Center, University of Montreal, Montr´eal, Qu´ebec, Canada J. THOMAS SANDERSON • Institut national de la recherche scientifique (INRS) – Institut Armand-Frappier, Universit´e du Qu´ebec, Laval, Qu´ebec, Canada PIERRE-ANDR E´ SCOTT • Departments of Obstetrics and Gynecology and of Pharmacology, CHU Sainte-Justine, Mother and Child University Hospital Center, University of Montreal, Montr´eal, Qu´ebec, Canada LAWRENCE C. SMITH • Animal Reproduction Research Centre, Faculty of Veterinary Medicine, University of Montreal, St-Hyacinthe, Qu´ebec, Canada JEAN ST-LOUIS • Departments of Obstetrics and Gynecology and of Pharmacology, CHU Sainte-Justine, Mother and Child University Hospital Center, University of Montreal, Montr´eal, Montr´eal, Qu´ebec, Canada EMILY W.Y. TUNG • Department of Pharmacology and Toxicology, Queen’s University, Kingston, Ontario, Canada CATHY VAILLANCOURT • Institut national de la recherche scientifique (INRS) – Institut Armand-Frappier, Universit´e du Qu´ebec, Laval, Qu´ebec, Canada LOUISE M. WINN • Department of Pharmacology and Toxicology and School of Environmental Studies, Queen’s University, Kingston, Ontario, Canada JAE-GYU YOO • Animal Reproduction Research Centre, Faculty of Veterinary Medicine, University of Montreal, St-Hyacinthe, Qu´ebec, Canada

Chapter 1 Human Embryogenesis: Overview Cathy Vaillancourt and Julie Lafond Abstract Over the past several decades, embryogenesis knowledge and research have progressed rapidly by taking advantage of the technical advances made in other fields. No field of contemporary biomedical science has been more revolutionized by the techniques of molecular biology than developmental embryology. Despite its inherent controversy, the exploration of the human embryo can unlock many of the answers to our deepest biological questions. The present chapter outlines the methods and protocols written by internationally recognized researchers to analyze different aspects of the embryogenesis process presented in this book. This practical guide covering subjects such as the molecular mechanisms of embryonic development, in vitro fertilization, cloning, and laws and ethical considerations of working with embryos, as well as addressing critical features of fetal and placental development and of uterine biology will aid all those who wish to further unravel the mysteries of human embryogenesis. Key words: Embryo, history, implantation, steroidogenesis, assisted reproductive technology, fetus, law, ethic.

1. Introduction: What Is Human Embryogenesis?

The word “embryogenesis” is a nineteenth-century fusion of two Hellenic stems: enbruein (“to grow in”) and genes (“born”). Human embryogenesis is the process of cell division and cellular differentiation which leads to the development and growth of a human embryo. It spans from the time of implantation to the end of the eighth week after conception, whereafter it is called a fetus [1]. Before widespread use of the microscope and the advent of cellular biology in the nineteenth century, embryology was based on descriptive and comparative studies. The explanation of embryonic development, originally proposed 2,000 years earlier

Julie Lafond and Cathy Vaillancourt (eds.), Human Embryogenesis: Methods and Protocols, vol. 550 © Humana Press, a part of Springer Science+Business Media, LLC 2009 DOI 10.1007/978-1-60327-009-0 1 Springerprotocols.com

3

4

Vaillancourt and Lafond

by Aristotle, was named epigenesis. According to epigenesis, the form of an animal emerges gradually from a relatively formless egg. During the eighteenth century, the prevailing notion in human embryology became preformation: the idea that the egg or sperm contains an embryo, a preformed, miniature infant, or homunculus, which simply becomes larger during development. As microscopy improved during the nineteenth century, biologists could see that embryos took shape in a series of progressive steps, and epigenesis returned and displaced preformation as the favored explanation among embryologists. After the 1950s, with the DNA helical structure being unraveled and the increasing knowledge in the field of molecular biology, embryogenesis emerged as a field of study which attempts to correlate the genes with morphological changes; and so tries to determine which genes are responsible for each phenotype that takes place in an embryo and how these genes are regulated. Thus, over the past several decades, embryogenesis knowledge and research have progressed rapidly by taking advantage of the technical advances made in other fields. No field of contemporary biomedical science has been more revolutionized by the techniques of molecular biology than developmental embryology.

2. Studying Embryo Implantation: From Trophoblast to Embryo

Section II of this volume focuses on protocols for explaining the normal phenomenon of cell proliferation, migration, and invasion into the maternal endometrium which represents fundamental steps of embryo implantation. Between 5 and 8 days after fertilization, the blastocyst attaches to the lining of the uterus, usually near the top. This process, called implantation, is completed by day 9 or 10. Chapter 2 describes an original animal model and technique to analyze the preparation for implantation on both the embryonic and the maternal sides: the delayed implantation in American mink, a reversible arrest in embryo development while the embryo is at the blastocyst stage. Chapter 3 presents a comprehensive protocol of co-culture of decidual and cytotrophoblastic cells, a model to assess trophoblast invasion into maternal endometrium, a biological process essential in human embryo implantation. When we speak about embryogenesis, we cannot pass over in silence the essential role of placenta. Placentation (the formation of placenta) starts once the conceptus begins to implant in the uterine wall, thus the placenta grows from cells of the embryo. The main function of placenta is to transfer nutrients from the maternal tissue to the growing embryo. Chapters 4

Human Embryogenesis: Overview

5

and 5 provide detailed protocols for learning more about placentation and placental functions. Specifically, a detailed protocol for studying the calcium transport by syncytiotrophoblasts in primary culture in vitro is presented in Chapter 4. Human primary trophoblast cell culture is a very useful model to investigate the cellular and the molecular processes implicated in placental function and development and to learn more on mother–embryo relationship. Current methods to study the specific processes involved in placentation, namely, differentiation and cell signaling of villous trophoblasts, are described in Chapter 5. Chapter 6 presents an approach to evaluate the uterine vascular remodeling induced by gestation. During pregnancy the uterine remodeling phenomenon assures the passage of all the nutrients, including O2 , required for fetal growth and gets rid of several fetal waste products. The uterine blood supply is a critical issue for embryo and fetal well-being. Uterine blood flow increases by almost 20 times during that period, which is permitted by highly marked remodeling of the vessel wall.

3. Steriodogenesis and Reproductive System

Section III focuses on steroid hormones as well as on the female and male reproductive systems. The complex communication between the mother, the placenta, and the fetus is guaranteed in part by a balanced supply of the steroid hormones, which are essentials for the embryogenesis. The protocol to analyze the expression and catalytic activity of three key cytochrome P450 (CYP) enzymes involved in the production of progesterone and estrogens, namely, aromatase (CYP19), steroid 17␣-hydroxylase/17,20-lyase (CYP17), and cholesterol side-chain cleavage (CYP11A), is detailed in Chapter 7. The female reproductive system is important for development and fertilization of an oocyte, for implantation, and development of an embryo. Chapter 8 describes a new in vitro organ culture system which allows analyzing changes in follicle formation, follicle development, and ovarian physiology, which can directly be involved in altered embryo development. The male reproduction system also has an important role in adequate fertilization of ovule and embryogenesis. Chapter 9 describes a revised and improved mechanical approach to generate interstitial tissue- and seminiferous tubule-enriched fractions from mouse testis that does not require the use of enzymatic digestion. This approach permits a more precise detection of the phosphorylated and glycosylated forms of the proteins, essential to study the development of male reproductive system in embryo. In parallel,

6

Vaillancourt and Lafond

Chapter 10 presents a new method to measure the individual enzymatic activity of acyl-coenzyme A: cholesterol acyltransferase (ACAT)-1 and -2 in testis.

4. From Embryo to Fetal Development

5. In Vitro Fertilization, Cloning, and Ethic

Section IV of this volume offers detailed protocols to study the genetic, the systemic, and the cellular functions of immune, gastrointestinal, renal, and cardiac systems during and after embryogenesis. The study of Caenorhabditis elegans embryonic development has been useful to dissect the molecular mechanisms controlling cell proliferation, cell polarization, cell differentiation, and morphogenic events involved in embryogenesis in human. Chapter 11 describes a genetic dissection of Caenorhabditis elegans embryogenesis using RNA interference and flow cytometry. This innovative approach enables the analysis of discrete embryonic lethal phenotypes and staging of arrested embryos. Chapter 12 presents a new laboratory tool, the human promyelocytic HL-60 leukemia cell line, for studying the mechanisms involved in cell maturation, essential for the development of the immune system. This cell line can be differentiated toward monocytes, macrophages, or granulocytes and presents an innovative model to study the events which occur in myeloid cells during the embryogenesis. Chapter 13 presents a new organ culture technique in which the morphological and physiological development and regulatory mechanisms of the human gastrointestinal tract are described. This chapter also establishes a new human intestinal epithelial cell line which allows the characterization of the molecular mechanisms in human gastrointestinal development. Chapter 14 presents an animal model to study the fetal programming of adult disease, an area of research that has gained considerable attention in embryology. This chapter describes both an in vitro and an in vivo model to characterize the mechanisms involved in intrauterine programming of renal and cardiac function.

Section V concerns the approaches related vitro fertilization, cloning, and ethical aspects in First, Chapter 15 provides an original method embryotoxicity of exogenous compounds. The

to toxicity, in embryogenesis. to evaluate the mouse embryo

Human Embryogenesis: Overview

7

technique described in this chapter is an innovative tool for assessing the teratogenicity of exogenous compounds as it excludes any confounding maternal and placental effects. This approach also allows the selection of embryos that are at similar stage of development and permits the control of exposure concentrations of the exogenous agents. The continued debate regarding the stage at which the human embryo conceived in the laboratory should be placed in the mother, combined with recent developments in culture media formulations, has brought the role of the human blastocyst in assisted reproductive technology (ART) back into the spotlight. In Chapter 16, the reader will find the frequently employed laboratory procedures and new perspectives on how to take full advantage of success rates using efficient laboratory procedures and technologies. In a subsequent stage, the complex approach of animal cloning is becoming increasingly useful for its applications in biological inquiry. In Chapter 17, authors present detailed protocols that have been most successful in producing laboratory and domestic animal clones. The embryo of a placental mammal is defined as the organism between the first division of the zygote (a fertilized ovum) until it becomes a fetus. In humans, the embryo is defined as the product of conception from implantation in the uterus through the eighth week of development. An embryo is called a fetus at a more advanced stage of development and up until birth or hatching. But, what is its real status? Chapter 18 presents a brief overview of some ethical issues raised by research with embryos, focusing on the moral status of the embryo. The authors also analyze the status of the embryo in Canadian Law and the regulations in the United States, Germany, and the United Kingdom, demonstrating the lack of consensus on this issue in Western countries. Finally, recent development in stem cell research and current alternatives to embryo destruction are also presented. “People forget we come from an embryo and we’re part sperm and part ovary. We have both sides in us.” Michelle Rodriguez, American actress

Reference 1. Definition of embryo according to Webster.

Chapter 2 Differential Gene Expression in the Uterus and Blastocyst During the Reactivation of Embryo Development in a Model of Delayed Implantation ` Pavine L.C. Lefevre and Bruce D. Murphy Abstract Delayed implantation, a reversible arrest in embryo development while the embryo is at the blastocyst stage, provides an interesting window for observation of the preparation for implantation on both the embryonic and maternal sides. The American mink (Mustela vison) is a species in which delayed implantation is a normal aspect of embryo development as it consistently occurs at each breeding season. We used a transcriptome-wide approach to screen global gene expression and to identify new key genes expressed in the uterus and in the endometrium at the resumption of the embryo development, after delayed implantation. By using the suppressive subtractive hybridization (SSH) technique, two libraries of differentially expressed cDNAs, one at the uterine level and a second one at the blastocyst level, were successfully generated. Candidate genes from those two libraries were selected and their differentially expressed pattern of expression between reactivation and delayed implantation was investigated by real-time PCR and immunolocalization. Key words: Blastocyst, uterus, embryo implantation, delayed implantation, embryonic diapause, gene expression, suppressive subtraction hybridization (SSH).

1. Introduction Embryo implantation represents a critical step in the human reproductive process when the blastocyst becomes intimately connected to the maternal endometrium and begins to form the placenta that will provide an interface between the growing fetus and the maternal circulation. Successful implantation requires a receptive endometrium, a normal and functional embryo at Julie Lafond and Cathy Vaillancourt (eds.), Human Embryogenesis: Methods and Protocols, vol. 550 © Humana Press, a part of Springer Science+Business Media, LLC 2009 DOI 10.1007/978-1-60327-009-0 2 Springerprotocols.com

11

12

` Lefevre and Murphy

the blastocyst developmental stage, and a synchronized dialogue between maternal and embryonic tissues. Implantation failure is considered as a major cause of infertility in healthy women (1). Investigations of human embryo implantation are constrained for practical and ethical reasons. Consequently, many animal models of implantation, such as primates, rodents (mice and rats), pigs, and ruminants (sheep and cows) and carnivores (minks and ferrets) have been used to investigate implantation (2). Given the variation in placentation among species, each provides different insight into the nidatory process. Delayed implantation consists in a reversible arrest in embryo development while the embryo is at the blastocyst stage during the preimplantation period. It therefore provides an interesting window for observation of molecular and cellular events associated with the preparation for implantation on both the embryonic and maternal sides. Mechanisms underlying delayed implantation in the mice and rats have been investigated. Ovariectomy on day 4 morning of pregnancy before ovarian estrogen secretion initiates blastocyst dormancy which can last for many days if the animal is treated with progesterone (3). An estrogen injection rapidly activates blastocysts and initiates their implantation. Although many studies adopted a “one by one” candidate approach to investigate gene expression in experimentally induced delayed implantation (4–7), a transcriptome-wide approach is nevertheless a powerful tool to screen global gene expression and to identify new key genes in the process. Hamatani et al. (8) and Reese et al. (9) determined global gene expression by microarray analysis in mice during and after experimentally induced delayed implantation in embryo and uterus, respectively. Even though those studies generated valuable data on gene expression during preimplantation period in the embryo and in the uterus, they are subject to bias due to the experimental manipulation of embryo development. Further, restriction of investigation to a single species may not provide a global picture of the regulation of implantation. To address this issue, we used a carnivore animal model, the American mink (Mustela vison), a species in which delayed implantation, or embryonic diapause, is a normal aspect of embryo development, as it consistently occurs at each breeding season (10). An increased photoperiod at the vernal equinox is the principal environmental signal that reactivates embryos (11). Longer day photoperiod induces the secretion of prolactin, which then activates the ovary, resulting in the secretion of progesterone and other factors that act on the uterus to reactivate the embryo and initiate embryo implantation (12, 13). Embryo reactivation is associated with an increase in the endometrial secretion into the uterine lumen (14). Thus, our working hypothesis is that uterine factor(s) actively secreted by the endometrium into the uterine lumen act on blastocysts in diapause to stimulate the resumption

Gene Expression in Embryonic Diapause

13

of development. The aim of our study was to identify key genes expressed in the uterus and embryo, essential for termination of embryonic diapause. We therefore collected endometria and embryos from mink females during diapause and 3, 5 and 7 days after reactivation. Using the suppressive subtractive hybridization (SSH) technique, we successfully generated two libraries of differentially expressed cDNA between the diapause state and the reactivation of the embryo development: one from the blastocyst and a second from the uterus. The analysis of the two libraries allowed us to generate data on global gene expression analysis, and to identify potential key regulatory genes. Of the different strategies available to study differential gene expression, SSH (15) is an efficient and widely used PCR-based method to obtain subtracted libraries and to isolate differentially expressed genes between two populations of mRNA: the tester, or cDNA that contains specific transcripts of interest and the driver, the reference cDNA. The protocol involves normalization and subtraction in a single procedure. The normalization step (hybridization) equalizes the abundance of cDNAs within the tester population and the subtraction step excludes the common sequences between the target and driver populations (Fig. 2.1). Moreover, the SSH technique enriches rare sequences over 1,000-fold in one round of subtractive hybridization. Because SSH can be initiated using PCR-amplified cDNAs, it seems particularly well-suited to mammal preimplantation stage embryos which contain only a tens of picograms of mRNAs. Furthermore, because SSH does not require previous knowledge of gene sequences, it may also be suitable for species where only a small number of sequences are available in databases. The SSH technique has also the advantage of generating unknown cDNA fragments or previously unknown genes and expressed sequence tags (ESTs). Following the SSH, expressed cDNA fragments are submitted to a differential screening to remove cDNAs common to both the tester and the driver samples from the subtracted sample (16 and Fig. 2.2). The cDNA fragments are then sequenced and the

cDNA Tester cDNA Driver

Hybridization

cDNA Tester

cDNA Driver

Subtractive suppression

cDNA Tester

Fig. 2.1 Flowchart summarizing the two major steps of the SSH technique. First, both mRNA populations are converted into cDNA: Tester and driver cDNAs are hybridized and the hybrid sequences are then removed. Consequently, the remaining unhybridized cDNAs represent sequences that are expressed in the tester yet absent from the driver mRNA population.

14

` Lefevre and Murphy Construction of differentially expressed cDNA library

• Uterine samples and embryo collection (part 3.1) • Total RNA extraction (part 3.2)

RNeasy Micro Kit, QIAGEN, # 74004 ( part 2.1 ) RNeasy Mini Kit, QIAGEN, # 74104 ( part 2.2 )

• Messenger RNA isolation (part 3.2)

Oligotex Kit , QIAGEN, # 70022 ( part 2.2 )

• cDNA synthesis (part 3.2)

SuperSMART PCR cDNA Synthesis, Clontech, # 635000 ( part 2.4 )

• Suppressive Subtraction Hybridization (part 3.3)

PCR-Select cDNA Subtraction Kit, Clontech, # 637401 ( part 2.3 )

• Differential screening (part 3.4)

PCR-Select cDNA Differential Screening kit, Clontech, # 637401 ( part 2.3 )

Description of global gene expression • Sequencing (part 3.5) • Sequence annotation (part 3.6) • Gene ontology (part 3.6.2)

Characterization of spatio-temporal key gene expression pattern • Selection of potential candidate genes (part 3.7) • Quantification of gene expression (part 3.8) • Localisation of gene expression (part 3.8)

Fig. 2.2 Flowchart summarizing the steps of the methodology of global gene expression analysis and characterization of spatio-temporal key gene expression pattern following the use of the SSH technique to construct a differentially expressed cDNA library. The part number of manuscript refers to each mentioned steps, as well as the company and catalog number of the required kits.

sequences are classified according to their degree of homology with sequences listed in gene databases. The cDNA sequences that exhibit a significant degree of homology to known sequences are classified according to their gene ontology, providing a global gene expression perspective. Frequency of copies of the known sequence in the library, its implication in the preimplantation period suggested in the literature for other species and its biological function are taken into account in selecting potential candidate genes. Finally, the spatio-temporal pattern of these gene expression-selected genes is investigated by real-time polymerase chain reaction (qPCR), in situ hybridization, and immunolocalization. The last step allows validation of the SSH by identifying the authentic targets of biological significance. In this chapter, we describe the multiple steps of the method to approach a global gene expression analysis and to identify key regulatory genes (Fig. 2.2). We first list the materials required (see Section 2) followed by a detailed description of the method itself (see Section 3).

Gene Expression in Embryonic Diapause

15

2. Materials 2.1. Embryo and Uterus Sample Collection

2.2. Uterine Samples Total RNA Extraction and mRNA Isolation

2.3. Embryos Total RNA Extraction

2.4. Suppressive Subtraction Hybridization

1. Flushing medium: 500 mL TC-199 medium (Gibco, Burlington, ON, Canada) containing 10% fetal bovine serum (FBS; Gibco) and 2.5 mL penicillin/streptomycin (Gibco). Solution is prepared under a sterile hood, aliquoted, and stored at 4◦ C. Stable at 4◦ C for 1 month. 2. 1× Phosphate buffer saline (PBS) stored at 4◦ C. 3. Paraformaldehyde (PAF) 4% (Sigma). Carcinogenic, corrosive. Safety glasses, gloves, and effective ventilation are required while manipulating the solution. 4. Liquid nitrogen. Store in cryogenic containers and use with adequate ventilation. Use safety glasses and gloves. R 1. RNeasy Mini Kit (cat. no. 74104; Qiagen, Mississauga, ON, Canada). The manufacturer provides all the required reagents except 14.3 M ␤-mercaptoethanol which has to be manipulated under a chemical hood and ethanol (70% and 96–100%). R 2. Oligotex Kit (cat. no. 70022; Qiagen). The manufacturer provides all the required reagents except 14.3 M ␤-mercaptoethanol. R 1. RNeasy Micro Kit (cat. no. 74004; Qiagen). All reagents are supplied in the kit expect 14.3 M ␤-mercaptoethanol and ethanol (70% and 96–100%).

1. PCR-SelectTM cDNA Subtraction Kit (cat. no. 637401; Clontech, Palo Alto, CA, USA). The following reagents are required but not supplied in the kit: a. HaeIII digest of bacteriophage fX174 (cat. nos. N3026S and N3026L; New England Biolabs DNA size markers). b. 80 and 96% ethanol. c. Phenol:chloroform:isoamyl alcohol (25:24:1). d. Chloroform:isoamyl alcohol (24:1). e. AdvantageTM cDNA Polymerase Mix (cat. no. 639105; Clontech). f. dNTP mix for PCR: 10 mM each dATP, dCTP, dGTP, dTTP. g. 50× TAE electrophoresis buffer: 242 g Tris base, 57.1 mL glacial acetic acid, 37.2 g Na2 EDTA•2H2 O, add H2 O to 1 L. For 1× TAE buffer, dilute 50× stock solution 1:49 with H2 O. 2. Super SMARTTM PCR cDNA Synthesis Kit (cat. no. 635000; Clontech). The following reagents are required but not supplied in the kit:

16

` Lefevre and Murphy

a. SMARTTM MMLV Reverse Transcriptase (cat. no. PT4045-2; Clontech). R 2 PCR Kit (cat. nos. 639206 and 639207; b. Advantage Clontech). R c. NucleoSpin RNA II Kit (cat. no. 635990; Clontech). d. ␤-Mercaptoethanol. e. RNase Inhibitor (20 U/␮L) (cat. no. 2696; Ambion’s SUPERase). f. DNA size markers (1 kb DNA ladder). g. 50× TAE electrophoresis buffer (see Section 2.4, Step 1-g). h. CHROMA SPIN + STE-10 Columns (cat. no. 636055; Clontech). i. Microcentrifuge. j. Hot-lid Thermal Cycler. k. TNE buffer 10×: 100 mM Tris; 2.0 M NaCl; 10 mM EDTA; pH 7.4: provide with the Super SMARTTM PCR cDNA Synthesis Kit. l. UV spectrophotometer. 2.5. Differential Screening

1. PCR-Select Differential Screening Kit (cat. no. 637403; Clontech). The following reagents are required but not supplied in the kit: R a. Advantage 2 Polymerase Mix (cat. no. 639201; Clontech). b. dNTP mix for PCR: 10 mM each dATP, dCTP, dGTP, dTTP. c. T/A Cloning Kit Dual Promoter (cat. no. K2060-01; Invitrogen, Carlsbad, CA, USA). d. SOC: Max Efficiency DH5␣ Competent Cells (cat. no. 18258-012; Invitrogen). e. Luria Broth (LB) medium: 10 g Bacto-tryptone, 5 g Bacto-yeast extract, 5 g NaCl, add H2 O to 900 mL. Adjust pH to 7.0 with 5 N NaOH, then bring up to a 1-L volume with H2 O. Autoclave. f. Ampicillin, 50 mg/mL stock solution; store at −20◦ C. g. Isopropyl ␤-D-1-thiogalactopyranoside (IPTG), final concentration 1 mM. h. 5-Bromo-4-chloro-3-indolyl-␤-D-galactopyranoside (X-Gal), final concentration 50 ␮g/mL. i. 0.6 N NaOH. j. 0.5 M Tris–HCl (pH 7.5). k. Denaturing solution: 0.5 M NaOH, 1.5 M NaCl, make fresh each time. l. Neutralizing solution: 0.5 M Tris–HCl pH 7.5, 1.5 M NaCl. m. Nylon membrane. R n. NucleoSpin Extraction Kit (cat. no. 635961; Clontech).

Gene Expression in Embryonic Diapause

17

o. [␣-32P]dCTP or [␣-32P]dATP (3,000 Ci/mmol). p. IllustraTM MicroSpin Columns (cat. no. S-200 27-5120-01; GE Health Care, Buckinghamshire, UK). q. ExpressHybTM Hybridization Solution (cat. nos. 636831 and 636832; Clontech). r. 20× SSC: 175.3 g NaCl, 88.2 g Na3 Citrate•2H2 O. Adjust pH to 7.0 with 1 M HCl, add H2 O to 1 L. Store at room temperature. s. 20% SDS (200 g SDS; add H2 O to 1 L. Heat to 65◦ C to dissolve. Store at room temperature). t. Low-stringency washing solution: 2× SSC, 0.5% SDS. u. High-stringency washing solution: 0.2× SSC, 0.5% SDS. v. Ethanol. w. Sterile, deionized H2 O. x. 50× TAE electrophoresis buffer (see Section 2.4, Step 1-g). y. Thermal Cycler 480 (Roche) and PCR System 2400 or 9600. z. Cyclophilin and G3PDH primers. aa. Milli-Q Water Ultrapure system (Millipore). bb. ImageQuant Software (Applied BioSystem).

3. Methods 3.1. Embryo and Uterine Sample Collection

All procedures involving live animals were approved by the Comit´e de d´eontologie de la Facult´e de M´edecine V´et´erinaire, Universit´e de Montr´eal, which is accredited by the Canadian Council on Animal Care. 1. Remove the uterine horns from the euthanized animal. 2. Rinse the uterus in PBS 1× in a 100-mm Petri dish. 3. Excise as much the adipose tissue as possible. 4. Transfer the uterus to a 50-mm Petri dish. 5. Flush each uterine horn with 2.5 mL flushing medium prewarmed at 37◦ C using a syringe and a 21G1/2 in. needle (Fig. 2.3). 6. Search for embryos under a microscope and collect by aspirating them with a mouth pipette. 7. Rinse the embryos in PBS 1× prewarmed at 37◦ C in a fresh 50-mm Petri dish. Carefully use the mouth pipette to manipulate the embryos under the microscope. 8. Transfer the embryos in 1.5-mL tube into as minimum as possible (a drop or less) of PBS 1×. 9. Snap-freeze the 1.5-mL tube containing embryos in liquid nitrogen and store the samples at −80◦ C until use.

18

` Lefevre and Murphy

Fig. 2.3 Photography of the procedure of the embryo flushing from the uterine lumen. The needle of the syringe is introduced through the cervix into one horn and flushing ` medium is injected to collect the embryos on the oviductal inlet of the horn (Lefevre, 2006, unpublished).

10. Cut on whole uterine horn, place one horn piece in a 1.5mL tube, snap-freeze the tube in liquid nitrogen and store sample at −80◦ C until use. 11. Place the other uterine horn piece in 1.5-mL tube containing PAF 4%. Store the tube at 4◦ C for 24 h. Rinse the tissue in PBS 1×, three times and place the tissue in 70% ethanol at −20◦ C until use (see Note 1). 3.2. Total RNA Extraction and mRNA Isolation 3.2.1. Total RNA Extraction from Uterine Samples (RNeasyR Mini Kit)

1. Thaw uterine sample on dry ice (see Note 2) (Fig. 2.4). R 2. Aliquot 350 ␮L of Buffer RLT (RNeasy Mini Kit) in 14mL polypropylene tube. 3. Place the tissue in the tube with the Buffer RLT. 4. Disrupt and homogenize the tissue using a Rotor-Stator Homogenizer (Polytron): place the tip of the disposable probe into the tube containing the uterine sample. At room temperature, operate the polytron beginning at low speed and increase progressively the speed over 30 s, until the lysate is homogenous (see Note 3). 5. Transfer the lysate to 2-mL tubes. Centrifuge the lysate for 3 min at maximum speed (14,000–18,000g). Carefully

Gene Expression in Embryonic Diapause

The RNeasy procedure represents a well-established technology for RNA purification. This technology combines the selective binding properties of a silica-based membrane with the speed of microspin technology. A specialized high-salt buffer system allows RNA longer than 200 bases to bind to the RNeasy silica membrane. Biological samples are first lysed and homogenized in the presence of a highly denaturing guanidinethiocyanate containing buffer, which immediately inactivates

Rnases to ensure purification of intact RNA (see figure on the left). Ethanol is added to provide appropriate binding conditions, and the sample is then applied to an RNeasy spin column, where the total RNA binds to the membrane and contaminants are efficiently washed away. Highquality RNA is then eluted. The table below summerizes specifications of the RNeasy Mini Kit and the RNeasy Micro kit. The latter allows purifying RNA from small amounts of tissue and is suitable for RNA extraction from embryo at blastocyst stage.

19

Tissue

Lyse and homogenize

Add ethanol

Bind total RNA Total RNA

Wash Specifications

RNeasy Mini Kit

RNeasy Micro Kit

Maximum binding capacity 100 µg

45 µg RNA

Maximum loading volume

700 µl

700 µl

RNA size distribution

RNA > 200 nucleotides RNA > 200 nucleotides

Minimum elution volume

30 µl

Elute Concentrated RNA solution

10 µl

Summerization of specifications of RNeasy Micro column and RNeasy Mini column(Qiagen).

Summerization of total RNA extraction procedure using the RNeasy procedure.

(Adapted from RNeasy Micro Handbook and RNeasy Mini Handbook, Qiagen)

Fig. 2.4 RNeasy principle and procedure for RNA isolation.

6. 7. 8.

9.

10.

11.

transfer the supernatant to a fresh 1.5-mL tube by pipetting. Add 1 volume (350 ␮L) of 70% ethanol to the lysate and mix well by pipetting. Do not centrifuge (see Note 4). R Transfer the sample to an RNeasy MinElute (RNeasy Mini Kit) spin column placed in a 2-mL collection tube. Close the lid gently and centrifuge for 15 s at ≥ 8,000g. Discard the flow-through (see Note 5). R Add 700 ␮L Buffer RW1 (RNeasy Mini Kit) to the RNeasy MinElute spin column. Close the lid gently and centrifuge for 15 s at ≥ 8,000g to wash the spin column membrane. Discard the flow-through and the collection column. Place the RNeasy MinElute spin column in a new 2-mL R collection tube. Add 500 ␮L Buffer RPE (RNeasy Mini Kit) to the spin column. Close the lid gently and centrifuge for 15 s at ≥ 8,000g to wash the spin column membrane. Discard the flow-through. Add 500 ␮L of Buffer RPE to the RNeasy MinElute spin column. Close the lid gently and centrifuge for 2 min at ≥ 8,000g to wash the spin column membrane. Discard the flow-through and collection tube.

20

` Lefevre and Murphy

12. Place the RNeasy MinElute spin column in a new 2-mL collection tube. Close the lid gently and centrifuge at maximum speed (14,000–18,000g) for 1 min. 13. Place the RNeasy MinElute spin column in a new 1.5-mL collection tube. Add 30–50 ␮L RNase-free water directly to the spin column membrane. Close the lid gently and centrifuge for 1 min at ≥ 8,000g to elute the RNA (see Note 6). 14. If the expected RNA yield is >30 ␮g, repeat the elution step using another 30–50 ␮L RNase-free water or using the eluate from the first elution in case high RNA concentration is required. 3.2.2. Messenger RNA Isolation from Uterine Total RNA (OligotexR Kit)

Before starting: R 1. Heat Oligotex Suspension (Oligotex Kit) to 37◦ C in a water bath or heating block. Mix by vortexing and then place at room temperature (Fig. 2.5). 2. Heat a water bath or heating block to 70◦ C and heat Buffer R OEB (Oligotex Kit). Procedure: 1. Determine the amount of starting RNA (see Note 7). Pipet total RNA into an RNase-free 1.5-mL microcentrifuge tube and adjust the volume with RNase-free water (if necessary) to the volume indicated in Table 2.1 (see Note 8).

Oligotex Suspension consists of polystyrene–latex particles of uniform size and a perfect spherical shape (see photography below). dC10T30 oligonucleotides are covalently linked to the surface of the polystyrene– latex particles via a condensation reaction. The particles form a stable suspension that provides a large surface area for rapid and efficient binding of polyadenylic acids. The Oligotex procedure for isolation, purification, and manipulation of poly A + RNA takes advantage of the fact that most eukaryotic mRNA (and some viral RNAs) end in a poly-A tail

of 20–250 adenosine nucleotides. In contrast, rRNAs and tRNAs, which account for over 95% of cellular RNAs, are not polyadenylated. Poly A+ mRNA can be purified by hybridizing the poly-A tail to a dT oligomer coupled to a solid-phase matrix. rRNA and tRNA species, without apoly-A tail, do not bind to the oligo-dT and are easily washed away. Since hybridization requires high-salt conditions, the poly A+ mRNA can then easily be released by lowering the ionic strength and destabilizing the dT: A hybrids (see figure on the left).

Total RNA

Hybridize mRNA to Oligotex

Collect mRNA:Oligotex complexes

Wash mRNA:Oligotex complexes

Elute mRNA from Oligotex

Ready-to-use mRNA

Scanning electron micrograph of Oligotex particles. Magnification 7500x

The Oligotex mRNA procedure (Adapted from Oligotex Handbook, Qiagen)

Fig. 2.5 The Oligotex principle.

Gene Expression in Embryonic Diapause

21

Table 2.1 Buffer amounts for Oligotex mRNA spin-column protocol Total RNA (mg)

Add RNase-free water to (␮L)

Buffer OBB (␮L)

Oligotex suspension (␮L)

≤0.25

250

250

15

0.25–0.50

500

500

30

0.50–0.75

500

500

45

0.75–1.00

500

500

55

2. Add the appropriate volume of Buffer OBB and Oligotex R Suspension (Oligotex Kit) (Table 2.1). Mix the contents thoroughly by pipetting or by flicking the tube. Incubate the sample for 3 min at 70◦ C in a water bath or heating block to disrupt the secondary structure of the RNA. 3. Remove sample from the water bath/heating block and place at 20–30◦ C for 10 min. This step allows hybridization between the oligo dT30 of the Oligotex particle and the poly-A tail of the mRNA. 4. Pellet the Oligotex:mRNA complex by centrifugation for 2 min at maximum speed (14,000–18,000g) and carefully remove the supernatant by pipetting (see Note 9). 5. Resuspend the Oligotex:mRNA pellet in 400 ␮L Buffer R OW2 (Oligotex Kit) by vortexing or pipetting and pipet onto a spin column placed in a 1.5-mL microcentrifuge tube. Centrifuge for 1 min at maximum speed (14,000– 18,000g). 6. Transfer the spin column to a new RNase-free 1.5-mL microcentrifuge tube and apply 400 ␮L Buffer OW2 to the column. Centrifuge for 1 min at maximum speed (14,000– 18,000g) and discard the flow-through. 7. Transfer spin column to a new RNase-free 1.5-mL microcentrifuge tube. R 8. Pipet 20–100 ␮L hot Buffer OEB (Oligotex Kit) (70◦ C) onto the column, pipet up and down three or four times to resuspend the resin, and centrifuge for 1 min at maximum speed (14,000–18,000g) (see Note 10). 9. To ensure maximal yield, pipet another 20–100 ␮L hot Buffer OEB (70◦ C) onto the column. Pipet up and down three or four times to resuspend the resin and centrifuge for 1 min at maximum speed (14,000–18,000g) (see Note 11). 3.2.3. Total RNA Extraction from Embryos (RNeasyR Micro Kit)

1. Carefully thaw embryos on dry ice (Fig. 2.4). R Micro Kit) to dis2. Add 150 ␮L of Buffer RLT (RNeasy rupt the cells. Vortex or pipet to mix. 3. Homogenize by vortexing the tube for 1 min.

22

` Lefevre and Murphy

4. Add 1 volume of 70% ethanol to the lysate and mix well by pipetting (see Note 4). 5. Transfer the sample, including any precipitate that may R Micro have formed, to an RNeasy MinElute (RNeasy Kit) spin column placed in a 2-mL collection tube. Close the lid gently and centrifuge for 15 s at ≥ 8,000g. Discard the flow-through (see Note 5). R 6. Add 150 ␮L Buffer RW1 (RNeasy Micro Kit) to the RNeasy MinElute spin column. Close the lid gently and centrifuge for 15 s at ≥ 8,000g to wash the spin column membrane. Discard the flow-through. 7. Add 700 ␮L Buffer RW1 instead, centrifuge for 15 s at ≥ 8,000g, and discard the flow-through and collection tube. 8. Place the RNeasy MinElute spin column in a new 2-mL collection tube. R 9. Add 500 ␮L Buffer RPE (RNeasy Micro Kit) to the spin column. Close the lid gently and centrifuge for 15 s at ≥ 8,000g to wash the spin column membrane. Discard the flow-through. 10. Add 500 ␮L of 80% ethanol to the RNeasy MinElute spin column. Close the lid gently and centrifuge for 2 min at ≥ 8,000g to wash the spin column membrane. Discard the flow-through and collection tube. 11. Place the RNeasy MinElute spin column in a new 2-mL collection tube. Open the lid of the spin column and centrifuge at full speed for 5 min to insure that the entire ethanol residues are evaporated. Discard the flow-through and collection tube. 12. Place the RNeasy MinElute spin column in a new 1.5-mL collection tube. Add 14 ␮L RNase-free water directly into the center of the spin column membrane. Close the lid gently and centrifuge for 1 min at maximum speed (14,000– 18,000g) to elute the RNA. 13. Quantify the amounts and purity of the extracted total RNA (see Note 7). 3.3. Suppressive Subtraction Hybridization (PCR-SelectTM cDNA Subtraction Kit)

The Subtractive Subtraction Hybridization (SSH) is performed with the PCR-SelectTM cDNA Subtraction Kit for both the uterine samples and the embryos to generate differentially expressed cDNAs between diapause and embryo reactivation. Figure 2.6 details the molecular events that occur during PCR-Select cDNA subtraction. As the amount of total RNA extracted from embryos is too meager, an alternative is to introduce a cDNA preamplification step by means of the Super SMARTTM PCR cDNA Synthesis Kit (see Section 3.3.1) With slight modifications to the standard protocol until the RsaI digestion step, Super SMART cDNA can be used directly for the adaptor ligation step of the PCR-Select cDNA subtraction (see Section 3.3.4).

Gene Expression in Embryonic Diapause

Total RNA SMART cDNA synthesis

ds tester cDNA ds driver cDNA

Poly A +RNA Conventional cDNA synthesis

23

Prepare cDNA by either SMART or conventional synthesis (parts 3.3.1 & 3.3.2). Separately digest tester and driver ds cDNA to obtain shorter, blunt – ended fragments (parts 3.3.1.5 & 3.3.2.3).

RSA I digestion

Tester cDNA with Adaptor 1 Driver cDNA (in excess) Driver cDNA with Adaptor 2R Divide tester cDNA into 2 portions and ligate each to a different adaptor (part 3.3.3). Driver cDNA has no adaptors. First hybridization Hybridization kinetics lead to equalization and enrichment of differentially expressed sequences among tester molecules (part 3.3.4). Second hybridization: mix samples, add fresh denatured driver, and anneal Fill in the ends Generate templates for PCR amplification from differentially expressed sequences (part 3.3.5).

Add primers

Amplify by PCR

Differentially expressed sequences are amplified exponentially (part 3.3.6).

(Clontechniques, April 2004, Clontech)

Fig. 2.6 The PCR-Select cDNA subtraction technique.

Complementary DNA is synthesized from 0.5 to 2 ␮g of poly A+ RNA generated from the uterine samples in diapause and after reactivation (see Section 3.3.3). In the PCR-SelectTM cDNA Subtraction Kit, cDNA that contains specific (differentially expressed) transcripts is referred to as the tester and the reference cDNA as the driver. In the present study, samples collected in diapause are considered as the driver while those collected after reactivation represents the tester. The tester and driver cDNAs are digested with RsaI (see Sections 3.3.2 and 3.3.3), a four-base-cutting restriction enzyme that yields blunt ends. The tester cDNA is then subdivided into two portions and each is ligated with a different cDNA adaptor (see Section 3.3.4). The two adaptors have stretches of identical sequence to allow annealing of the PCR primer once the recessed ends have been filled in (Table 2.2). Two hybridizations are then performed: 1. In the first (see Section 3.3.5), an excess of driver is added to each sample of tester. The samples are then heat denatured and allowed to anneal, generating the type “a,” “b,” “c,” and “d” molecules in each sample. The concentration of high- and low-abundance sequences is equalized among the type “a” molecules because reannealing is faster for the

24

` Lefevre and Murphy

Table 2.2 Sequences of the primers and adaptors used in the PCR-SelectTM cDNA Subtraction Kit and in the Super SMARTTM PCR cDNA Synthesis Kit (Clontech). The sequence of the PCR primer 1 (in bold italic) is complementary to the 5 -end sequence of adaptor 1 (in bold) and adaptor 2R (in bold italic) and Nested Primer 1 (in grey italic) and Nested Primer 2 (in underline) are, respectively, complementary to the 3 -end sequence of adaptor 1 (in grey italic) and adaptor 2R (in underline) Sequence name

Sequences

Length

cDNA synthesis primer

5 -TTTTGTACAAGCTT 30 N1 N-3

45 nt

Adaptor 1

5 -CTAATACGACTCACTATAGGGC TCGAGCGGCCGCCCGGGCAGGT -3 3 -GGGCCCGTCCA-5

44 nt

Nested primer 1

5 -TCGAGCGGCCGCCCGGGCAGGT-3

22 nt



Adaptor 2R

5 -CTAATACGACTCACTATAGGGC AGCGTGGTCGCGGCCGAGGT-3 3 -GCCGGCTCCA-5

Nested primer 2

5 -AGCGTGGTCGCGGCCGAGGT -3 

PCR primer 1

5 -CTAATACGACTCATATAGGGC-3

G3PDH 5 primer

5 -ACCACAGTCCATGCCATCAC-3



G3PDH 3 primer



5 -TCCACCACCCTGTTGCTGTA-3

42 nt

20nt 

22 nt 20 nt





20 nt 

SMART II A

5 -AAGCAGTGGTATCAACGCAGAGTACGCGGG-3

SMART CDS Primer II A

5 -AAGCAGTGGTATCAACGCAGAGTACT(30) N-1N-3 (N = A, C, G, or T; N -1 = A, G, or C)

57 nt

30 nt

5 PCR Primer II A

5 -AAGCAGTGGTATCAACGCAGAGT-3

23 nt

more abundant molecules due to the second-order kinetics of hybridization. At the same time, type “a” molecules are significantly enriched for differentially expressed sequences while cDNAs that are not differentially expressed form type “c” molecules with the driver. 2. During the second hybridization (see Section 3.3.6), the two primary hybridization samples are mixed together without denaturing. Only the remaining equalized and subtracted single-strand (ss) tester cDNAs can reassociate and form new type “e” hybrids. These new hybrids are doublestrand (ds) tester molecules with different ends, which correspond to the sequences of Adaptors 1 and 2R. Fresh denatured driver cDNA is added to further enrich fraction “e” for differentially expressed sequences. After filling in the ends by DNA polymerase, the type “e” molecules – the differentially expressed tester sequences – have different annealing sites for the nested primers on their 5 and 3 ends. The entire population of molecules is then subjected to

Gene Expression in Embryonic Diapause

25

PCR to amplify the desired differentially expressed sequences (see Section 3.3.7). During this PCR, type “a” and “d” molecules are missing primer annealing sites and thus cannot be amplified. Due to the suppression PCR effect, most type “b” molecules form a pan-like structure that prevents their exponential amplification. Type “c” molecules have only one primer annealing site and amplify linearly. Only type “e” molecules – the equalized, differentially expressed sequences with two different adaptors – amplify exponentially. Next, a secondary PCR amplification is performed using nested primers to further reduce any background PCR products and enrich for differentially expressed sequences. 3.3.1. Complementary DNA Synthesis from Total Embryonic RNA and cDNA Preamplification (Super SMARTTM PCR cDNA Synthesis Kit) 3.3.1.1. First-Strand cDNA Synthesis

This protocol has been optimized for total RNA (see Note 12) (Fig. 2.7).

1. For each sample and control human placenta RNA, combine the following reagents in a sterile 0.5-mL reaction tube: 1–50 ␮L RNA sample (2–1,000 ng of total RNA) (see Note 13), 7 ␮L 3 SMART CDS Primer II A (Super SMARTTM PCR cDNA Synthesis Kit) (12 ␮M), 7 ␮L SMART II A

All commonly used cDNA synthesis methods rely on the ability of reverse transcriptase (RT) to transcribe mRNA into single-stranded (ss) DNA in the first-strand reaction. However, because RT cannot always transcribe the entire mRNA sequence, the 5' ends of genes tend to be under represented in cDNA populations. With Clontech’s patented SMART cDNA Technology, high yields of full-length and double-stranded cDNA from small amounts of RNA can be generated. SMART stands for Switching Mechanism At 5' end of RNA Template. The SMART method SMART technology is based on two specific features of Moloney murine leukemia virus reverse transcriptase (MMLVRT):

The SMART Oligonucleotide (patent pending), which has an oligo(G) sequence at its 3‘end, base-pairs with the deoxycytidine stretch, creating an extended template. RT then switches templates and continues replicating to the end of the oligonucleotide (17). The SMART anchor sequence and the poly A sequence serve as universal priming sites for end-to-end cDNA amplification. In contrast, cDNA without these sequences such as prematurely terminated cDNAs, contaminating genomic DNA, or cDNA transcribed from poly A–RNA, will not be exponentially amplified.

1. The addition of non-template nucleotides to the 3' end of the newly synthesized cDNA strand, up on reaching the 5' end of them RNA template (terminal transferase activity). 2. The ability to switch to a second template. First-strand cDNA synthesis is primed by a modified oligo(dT) primer that contains additional sequence at the 3' end (the 3' SMART CDS Primer II A) (see figure on the left). When the MMLVRT reaches the 5' end of the mRNA, the enzyme’s terminal transferase activity attaches several additional nucleotides, primarily deoxycytidine, onto the newly synthesized strand of cDNA.

Overview of the SMART cDNA synthesis method.

(Adapted from the SuperSMARTPCR cDNA synthesis Kit User Manual and the FL772387_SMARTcDNA Brochure, Clontech)

Fig. 2.7 The SMART cDNA synthesis technology.

26

` Lefevre and Murphy

2. 3. 4.

5. 6. 7.

Oligonucleotide (Super SMARTTM PCR cDNA Synthesis Kit) (12 ␮M), x ␮L deionized H2 O (total volume = 64 ␮L). Mix contents and spin for 5 s the tube in a microcentrifuge. Incubate the tube at 65◦ C in a hot-lid thermal cycler for 2 min and then reduce the temperature to 42◦ C. Add the following to each reaction tube (Super SMARTTM PCR cDNA Synthesis Kit): 20 ␮L 5× First-Strand Buffer, 2 ␮L DTT (100 mM), 10 ␮L 50× dNTP (10 mM), 5 ␮L RNase Inhibitor (20 U/␮L), 5 ␮L MMLV Reverse Transcriptase (42 mL total added per reaction). Gently pipet up and down to mix, then spin the tubes briefly in a microcentrifuge. Incubate the tubes at 42◦ C for 90 min in a hot-lid thermal cycler. Add 2 ␮L of 0.5 M EDTA to stop the reaction (see Note 14).

3.3.1.2. Column Chromatography

To purify the SMART cDNA from unincorporated nucleotides and small (<0.1 kb) cDNA fragments, follow this procedure for each reaction tube: 1. Add 212 ␮L of Buffer NT (Super SMARTTM PCR cDNA Synthesis Kit) to each cDNA synthesis reaction; mix well by pipetting. 2. Place a NucleoSpin Extract II Column (Super SMARTTM PCR cDNA Synthesis Kit) into a 2-mL collection tube. Pipet the sample into the column. Centrifuge at 11,200g for 1 min. Discard the flow-through. 3. Add 600 mL of Wash Buffer NT3 (Super SMARTTM PCR cDNA Synthesis Kit) to the column. Centrifuge at 11,200g for 1 min. Discard the flow-through. 4. Place the column back into the collection tube. Centrifuge at 11,200g for 2 min to remove any residual Wash Buffer NT3 (Super SMARTTM PCR cDNA Synthesis Kit). 5. Transfer the NucleoSpin Columns into a fresh 1.5-mL microcentrifuge tube. Add 50 ␮L of sterile Milli-Q H2 O (Super SMARTTM PCR cDNA Synthesis Kit) to the column. Allow the column to stand for 2 min with the caps open. 6. Close the tube and centrifuge at 11,200g for 1 min to elute the sample. 7. Repeat elution with 35 ␮L of sterile Milli-Q H2 O in the same 1.5-mL microcentrifuge tube. The total recovered elution volume should be 80–85 ␮L per sample. If necessary, add sterile Milli-Q H2 O to bring the total volume up to 80 ␮L (see Note 15) (Table 2.3).

3.3.1.3. cDNA Amplification by Long-Distance PCR (LD-PCR)

The complementary DNA amplification includes a step to determine the optimal number of PCR cycles for the amplification (Fig. 2.8). Guidelines for optimizing the PCR, depending on

Gene Expression in Embryonic Diapause

27

Table 2.3 Guidelines for setting-up PCR Total RNA (ng)

Volume of ss cDNA (␮L)

Volume of H2 (␮L)O

Total volume (␮L)

Typical optimal number of PCR cycles

∼2

80

–

80

24–28

∼5

80

–

80

21–24

∼25

80

–

80

17–20

∼50

40

40

80

17–20

∼100

25

55

80

17–20

∼250

10

70

80

17–20

∼500

5

75

80

17–20

∼1,000

2.5

77.5

80

17–20

the amount of total RNA used in the first-strand synthesis, are provided in Table 2.3. 1. Set up three 100 ␮L PCR reactions, labeled “A,” “B,” and “C,” for each tester and driver sample (Fig. 2.8). 2. Preheat the PCR thermal cycler to 95◦ C. 3. For each experimental sample, aliquot 80 ␮L ss cDNA into a labeled 1.5-mL reaction tube. 4. Prepare a Master Mix (Super SMARTTM PCR cDNA Synthesis Kit) for all reaction tubes, plus one additional tube. Combine per reaction (220 ␮L total volume): 172 ␮L Deionized H2 O, 30 ␮L 10× Advantage 2 PCR Buffer, 6 ␮L 50× dNTP (10 mM), 6 ␮L 5 PCR Primer II A (12 ␮M), 6 ␮L 50× Advantage 2 Polymerase Mix. 5. Mix well by vortexing and spin the tube for 5 s in a microcentrifuge. 6. Aliquot 220 ␮L of the PCR Master Mix into each tube containing the 80 ␮L ss cDNA. Mix well. 7. Aliquot 100 ␮L of the resulting PCR reaction mix into three reaction tubes labeled “A,” “B,” and “C”. 8. Cap each tube and place them in the preheated thermal cycler. 9. Commence thermal cycling (with a hot-lid thermal cycler) using 95◦ C 1 min and 15 cycles: 95◦ C 5 s, 65◦ C 5 s, 68◦ C 6 min. 10. Subject each reaction tube to 15 cycles and then pause the program. Transfer 30 ␮L from Tube C to a second reaction tube labeled “Optimization.” Store Tubes A and B and the “Experimental” tube containing the remaining 70 ␮L of Tube C, at 4◦ C.

28

` Lefevre and Murphy

Fig. 2.8. Optimizing PCR parameters for SMART cDNA synthesis (Super SMARTTM PCR cDNA Synthesis Kit User Manual, Clontech).

11. Using the Optimization PCR tube determine the optimal number of PCR cycles (Fig. 2.8): a. Set up six 100 ␮L PCR tubes for each experimental sample, labeled 15, 18, 21, 24, 27, and 30.

Gene Expression in Embryonic Diapause

29

b. Transfer 5 ␮L from the 15 cycles PCR to a clean microcentrifuge tube. c. Return the Optimization tubes to the thermal cycler. Run three additional cycles (for a total of 18) with the remaining 25 ␮L of PCR mixture. Transfer 5 ␮L from the 18 cycles PCR to a clean microcentrifuge tube. d. Run three additional cycles (for a total of 21) with the remaining 20 ␮L of PCR mixture. Transfer 5 ␮L from the 21 cycles PCR to a clean microcentrifuge tube. e. Run three additional cycles (for a total of 24) with the remaining 15 ␮L of PCR mixture. Transfer 5 ␮L from the 24 cycles PCR to a clean microcentrifuge tube. f. Run three additional cycles (for a total of 27) with the remaining 10 ␮L of PCR mixture. Transfer 5 ␮L from the 27 cycles PCR to a clean microcentrifuge tube. g. Run three additional cycles (for a total of 30) with the remaining 5 ␮L of PCR mixture. h. Separate by Electrophoresis each 5 ␮L aliquot of the PCR reaction alongside 0.1 ␮g of 1 kb DNA size markers on a 1.2% agarose/ethidium bromide (EtBr) gel in 1× TAE buffer. i. Determine the optimal number of cycles required for each experimental and control sample (see Note 16 and Fig. 2.9).

Fig. 2.9. Analysis for optimizing PCR parameters. Five or 20 ng of the control human placental total RNA was subjected to the first-strand cDNA synthesis and purification as described in the protocol. Eighty microliters was used for PCR amplification. A range of PCR cycles were performed (18, 21, 24, and 27). Five microliters of each PCR product was electrophoresed on a 1.2% agarose/EtBr gel in 1× TAE buffer following the indicated number of PCR cycles. Lane M: 1 kb DNA ladder size markers. The arrow indicates the strong band at 900 bp typically seen for human placenta total RNA (Super SMARTTM PCR cDNA Synthesis Kit User Manuel, Clontech).

30

` Lefevre and Murphy

12. Retrieve the 15 cycles Experimental PCR tubes from 4◦ C, return them to the thermal cycler, and subject them to additional cycles, if necessary, until the optimal number is reached. 13. When the cycling is completed, analyze a 5-␮L sample of each PCR product alongside 0.1 ␮g of 1 kb DNA size markers on a 1.2% agarose/EtBr gel in 1× TAE buffer (see Note 16 and Fig. 2.9). 14. Add 2 ␮L of 0.5 M EDTA to each tube to terminate the reaction. 3.3.1.4. Column Chromatography

1. For every experimental sample and control, combine the three reaction tubes (A, B, and Experimental) of PCR product into a 1.5-mL microcentrifuge tube. 2. Transfer 7 ␮L of the raw PCR product to a clean microcentrifuge tube and label this tube as “Sample A.” Store at −20◦ C. Sample A will be later used for analysis using column chromatography. 3. To each tube of combined PCR product, add an equal volume of phenol:chloroform:isoamyl alcohol (25:24:1). Vortex thoroughly. 4. Centrifuge the tubes at 11,200g for 10 min to separate the phases. 5. Remove the top (aqueous) layer and place it in a clean 1.5mL tube. 6. Add 700 ␮L of n-butanol and vortex the mix thoroughly (see Note 17). 7. Centrifuge the solution at room temperature at 11,200g for 1 min. 8. Remove and discard the upper (n-butanol organic) phase (see Note 18). 9. Invert a CHROMA SPIN-1000 column several times to completely resuspend the gel matrix. Check for air bubbles in the column matrix. If bubbles are visible, resuspend the matrix in the column buffer by inverting the column again. 10. Remove the top cap from the column and then remove the bottom cap. 11. Place the column into a 1.5-mL centrifuge tube. 12. Discard any column buffer that immediately collects in the tube and add 1.5 mL of 1× TNE buffer. 13. Let the buffer drain through the column by gravity flow until the surface of the gel beads in the column matrix can be seen (see Note 19). 14. Discard the collected buffer and proceed with purification. 15. Carefully and slowly apply the sample to the center of the gel bed’s flat surface. Do not allow any sample to flow along the inner wall of the column. 16. Apply 25 ␮L of 1× TNE buffer and allow the buffer to completely drain out of the column.

Gene Expression in Embryonic Diapause

31

17. Apply 150 ␮L of 1× TNE buffer and allow the buffer to completely drain out of the column. 18. Transfer column to a clean 1.5-mL microcentrifuge tube. 19. Apply 320 ␮L of 1× TNE buffer and collect the eluate as the purified ds cDNA fraction. Transfer 10 ␮L of this fraction to a clean microcentrifuge tube and label this tube as “Sample B.” Store at −20◦ C. Use this aliquot for agarose/EtBr gel analysis. 20. Apply 75 ␮L of 1× TNE buffer and collect the eluate in a clean microcentrifuge tube. Label this tube as “Sample C” and store at −20◦ C. Save this fraction until after agarose/EtBr gel analysis. 21. To confirm that the PCR product is present in the purified ds cDNA fraction, perform the agarose/EtBr gel analysis (see Note 20). 3.3.2. RsaI Digestion (Super SMARTTM PCR cDNA Synthesis Kit)

3.3.2.1. Purification of Digested cDNA (Clontech NucleoTrap Nucleic Acid Purification Kit and Accessories provided in the Super SMARTTM PCR cDNA Synthesis Kit)

This step generates shorter, blunt-ended ds cDNA fragments, which are necessary for both adaptor ligation and subtraction. 1. Before proceeding with RsaI digestion, set aside another 10 ␮L of purified ds cDNA for agarose/EtBr gel analysis to estimate the size range of the ds cDNA products. Label this tube as “Sample D.” 2. Add the following reagents (provided in the Super SMARTTM PCR cDNA Synthesis Kit) to the purified cDNA fraction collected from the CHROMA-SPIN column: a. 36 ␮L 10× RsaI Restriction Buffer b. 1.5 ␮L RsaI (10 U) 3. Mix by vortexing and spin briefly in a microcentrifuge. 4. Incubate at 37◦ C for 3 h. 5. To confirm that RsaI digestion was successful, electrophorese 10 ␮L of uncut ds cDNA (Sample D) and 10 ␮L of RsaI-digested cDNA on a 1.2% agarose/EtBr gel in 1× TAE buffer (see Note 21 and Fig. 2.10). 6. Add 8 ␮L of 0.5 M EDTA to terminate the reaction. 7. Transfer 10 ␮L of the digested cDNA to a clean microcentrifuge tube, label this tube as “Sample E,” and store at −20◦ C. Compare this sample with the PCR product after final purification. 1. Aliquot the RsaI-digested ds cDNA into two clean 1.5mL microcentrifuge tubes (approximately 170 ␮L in each tube). 2. Vortex the NucleoTrap Suspension (NucleoTrap Nucleic Acid Purification Kit) thoroughly until the beads are completely resuspended. 3. Add 680 ␮L of Buffer NT2 and 17 ␮L of NucleoTrap Suspension to each tube of digestion mixture. 4. Incubate the sample at room temperature for 10 min. Mix gently every 2–3 min during the incubation period.

32

` Lefevre and Murphy

Fig. 2.10 Positive control skeletal muscle ds cDNA before (lane 1) and after (lane 2) RsaI digestion. Complementary DNA was synthesized as described in the protocol (see Section 3.3.3) using the human skeletal muscle control poly A+ RNA included in the kit. Lane M: DNA size markers.

5. Centrifuge the sample at 10,000g for 1 min at room temperature. Discard the supernatant. 6. Add 680 ␮L of Buffer NT2 (NucleoTrap Nucleic Acid Purification Kit) to the pellet. Mix gently to resuspend. Centrifuge at 10,000g for 1 min at room temperature. Remove the supernatant completely and discard. 7. Add 680 ␮L of Buffer NT3 (NucleoTrap Nucleic Acid Purification Kit) to the pellet. Mix gently to resuspend. Centrifuge the sample at 10,000g for 1 min at room temperature. Remove the supernatant completely and discard. 8. Repeat the last step. 9. Centrifuge the pellet again at 10,000g for 1 min at room temperature. Air dry the pellet for 15 min at room temperature. Add 50 ␮L of TE buffer (10 mM Tris-Cl, pH 7.5; 1 mM EDTA provided with the NucleoTrap Nucleic Acid Purification Kit) to the pellet. Resuspend the pellet by mixing gently. Combine the resuspended pellets into one tube. Mix gently.

Gene Expression in Embryonic Diapause

33

10. Elute the cDNA by incubating the sample at 50◦ C for 5 min. Gently mix the suspension two to three times during the incubation step. 11. Centrifuge the sample at 10,000g for 30 s at room temperature. Transfer the supernatant to a clean 1.5 mL that has been inserted into a 1.5-mL tube. Centrifuge for 5 min and discard the column. 12. Transfer 6 ␮L of the filtered cDNA solution to a clean 1.5-mL microcentrifuge tube containing 14 ␮L of deionized H2 O. Label this tube as “Sample F” and store at −20◦ C. Use this sample to analyze the SMART cDNA after purification. 13. To precipitate the cDNA, add 50 ␮L of 4 M ammonium acetate and 375 ␮L of 95% ethanol to the remaining sample. 14. Vortex the mix thoroughly and centrifuge the tubes at 11,200g for 20 min at room temperature. Carefully remove and discard the supernatant. 15. Overlay the pellet with 500 ␮L of 80% ethanol. Centrifuge the tube at 11,200g for 10 min. Carefully remove the supernatant and discard. 16. Air dry the pellets for 5–10 min. 17. Dissolve the pellet in 6.7 ␮L of 1× TNE buffer. 18. Transfer 1.2 ␮L to a clean 1.5-mL microcentrifuge tube containing 11 ␮L of deionized H2 O, label this tube as “Sample G,” and store the remaining sample at −20◦ C. 19. Use 10 ␮L of the diluted cDNA to assess the yield of DNA by UV spectrophotometry (see Note 22). If DNA concentration is >300 ng/␮L, dilute cDNA to a final concentration of 300 ng/␮L in 1× TNE buffer and follow the adaptor ligation step in accordance with the PCR-Select cDNA subtraction protocol. 3.3.3. Conventional cDNA Synthesis and RsaI Digestion (PCR-SelectTM cDNA Subtraction Kit) 3.3.3.1. First-Strand cDNA Synthesis

Perform this procedure with each experimental tester and driver poly A+ RNA and with the Control Poly A+ RNA (from human skeletal muscle) provided with the PCR-SelectTM cDNA Subtraction Kit. The skeletal muscle cDNA made in this section serves as control driver cDNA in later steps. 1. For each tester, driver, and the Control Poly A+ RNA (from human skeletal muscle), combine in a sterile 0.5-mL microcentrifuge tube: 2–4 ␮L poly A+ RNA (2 ␮g) (see Note 23), 1 ␮L cDNA Synthesis Primer (10 ␮M) (PCR-SelectTM

34

` Lefevre and Murphy

2. 3. 4.

5. 6.

7. 3.3.3.2. Second-Strand cDNA Synthesis

cDNA Subtraction Kit). Add sterile H2 O to a final volume of 5 ␮L if needed. Mix and spin briefly in a microcentrifuge. Incubate at 70◦ C for 2 min in a thermal cycler. Cool on ice for 2 min and briefly centrifuge. Add to each reaction (final volume 10 ␮L): 2 ␮L 5× FirstStrand Buffer (PCR-SelectTM cDNA Subtraction Kit), 1 ␮L dNTP Mix (10 mM each) (PCR-SelectTM cDNA Subtraction Kit), 1 ␮L sterile H2 O, 1 ␮L AMV Reverse Transcriptase (20 U/␮L) (PCR-SelectTM cDNA Subtraction Kit). Gently vortex and centrifuge the tubes for 5 s. Incubate the tubes at 42◦ C for 1.5 h in an air incubator. Do not use a water bath or thermal cycler. Evaporation can reduce the reaction mixture volume, and therefore, reaction efficiency. Place on ice to terminate first-strand cDNA synthesis.

Perform the following procedure with each first-strand tester, driver, and the control skeletal muscle cDNA: 1. Add to the first-strand synthesis reaction tubes (final volume 80 ␮L): 48.4 ␮L sterile H2 O, 16.0 ␮L 5× SecondStrand Buffer (PCR-SelectTM cDNA Subtraction Kit), 1.6 ␮L dNTP Mix (10 mM) (PCR-SelectTM cDNA Subtraction Kit), 4.0 ␮L 20× Second-Strand Enzyme Cocktail (PCR-SelectTM cDNA Subtraction Kit). 2. Mix contents and spin for 5 s. 3. Incubate at 16◦ C for 2 h in water bath or thermal cycler. 4. Add 2 ␮L (6 U) of T4 DNA Polymerase (PCR-SelectTM cDNA Subtraction Kit). Mix contents well. 5. Incubate at 16◦ C for 30 min in a water bath or thermal cycler. 6. Add 4 ␮L of 20× EDTA/glycogen Mix (PCR-SelectTM cDNA Subtraction Kit) to terminate second-strand synthesis. 7. Add 100 ␮L of phenol:chloroform:isoamyl alcohol (25:24:1). 8. Vortex thoroughly and centrifuge at 11,200g for 10 min at room temperature to separate phases. 9. Carefully collect the top aqueous layer and place in a fresh 0.5-mL microcentrifuge tube. Discard the inter- and lowerphases. 10. Add 100 ␮L of chloroform:isoamyl alcohol (24:1). 11. Vortex thoroughly and centrifuge at 11,200g for 10 min at room temperature to separate phases. 12. Carefully collect the top aqueous layer and place in a fresh 0.5-mL microcentrifuge tube. Discard the inter- and lowerphases. 13. Add 40 ␮L of 4 M NH4 OAc and 300 ␮L of 95% ethanol. 14. Vortex thoroughly and centrifuge at 11,200g for 20 min at room temperature.

Gene Expression in Embryonic Diapause

35

15. Carefully collect the supernatant. 16. Overlay the pellet with 500 ␮L of 80% ethanol. Centrifuge at 11,200g for 10 min. 17. Remove the supernatant. 18. Air dry the pellet for about 10 min to evaporate residual ethanol. 19. Dissolve precipitate in 50 ␮L of sterile H2 O. 20. Transfer 6 ␮L to a fresh microcentrifuge tube. Store this sample at −20◦ C until after RsaI digestion (for agarose gel electrophoresis) to estimate the yield and size range of ds cDNA products synthesized.

3.3.3.3. RsaI Digestion (PCR-SelectTM cDNA Subtraction Kit)

Perform the following procedure with each experimental ds tester and driver cDNA, as well as with the control skeletal muscle cDNA. 1. Add per reaction (final volume 94 ␮L): 43.5 ␮L ds cDNA, 5.0 ␮L 10× RsaI Restriction Buffer, 1.5 ␮L RsaI (10 U/␮L). 2. Mix by vortexing and centrifuge for 5 s. 3. Incubate at 37◦ C for 1.5 h. 4. Set aside 5 ␮L of the digest mixture to analyze the efficiency of RsaI digestion. 5. Add 2.5 ␮L of 20× EDTA/glycogen. 6. Mix to terminate the reaction. 7. Add 50 ␮L of phenol:chloroform:isoamyl alcohol (25:24:1). 8. Vortex thoroughly and centrifuge at 11,200g for 10 min at room temperature to separate phases. 9. Carefully collect the top aqueous layer and place in a fresh 0.5-mL tube. 10. Add 50 ␮L of chloroform:isoamyl alcohol (24:1). 11. Vortex thoroughly and centrifuge at 11,200g for 10 min at room temperature to separate phases. 12. Carefully collect the top aqueous layer and place in a fresh 0.5-mL tube. 13. Add 25 ␮L of 4 M NH4 OAc and 187.5 ␮L of 95% ethanol. 14. Vortex thoroughly and centrifuge at 11,200g for 10 min at room temperature to separate phases. 15. Remove the supernatant. 16. Gently overlay the pellets with 200 ␮L of 80% ethanol. 17. Centrifuge at 11,200g for 5 min. 18. Carefully remove the supernatant. 19. Air dry the pellets for 5–10 min. 20. Dissolve the pellet in 5.5 ␮L of H2 O and store at −20◦ C (see Note 24). 21. Check RsaI-digested cDNA using agarose/EtBr gel electrophoresis (see Note 21).

36

` Lefevre and Murphy

3.3.4. Adaptor Ligation (PCR-SelectTM cDNA Subtraction Kit)

Subtractions should be performed in both directions for each tester/driver cDNA pair (forward and reverse subtraction) (Fig. 2.11), in preparation of the differential screening step. To perform subtractions in both directions, tester cDNA corresponding to each of the poly A+ RNA samples is required. A control subtraction is also performed with the control skeletal muscle cDNA with ␸X174/HaeIII DNA. As illustrated in Fig. 2.12, three separate adaptor ligations must be performed for each experimental tester cDNA and the control skeletal muscle tester cDNA. Each cDNA (cDNA 1, cDNA 2, and cDNA 3 from the control) is aliquoted into two separate tubes: one aliquot is ligated with Adaptor 1 (Testers 1-1, 2-1, and 3-1) and the second is ligated with Adaptor 2R (Testers 1-2, 2-2, and 3-2). After the ligation reactions are set up, portions of each tester tube are combined so that the cDNA is ligated with both adaptors (unsubtracted tester controls 1-c, 2-c, and 3-c). Each unsubtracted tester control cDNA serves as a positive control for ligation and later serves as a negative control for subtraction. 1. Dilute 1 ␮L of each RsaI-digested experimental cDNA (from conventional cDNA synthesis (see Section 3.3.3.3) and from the Super SMART cDNA synthesis (see Section 3.3.2) with 5 ␮L of sterile H2 O. 2. Prepare the control skeletal muscle tester cDNA: dilute the ␸X174/HaeIII Control DNA with sterile H2 O to a final concentration of 150 ng/mL, mix 1 ␮L of control skeletal muscle cDNA (PCR-SelectTM cDNA Subtraction Kit) with 5 ␮L of the diluted ␸X174/HaeIII Control DNA (see Note 25). 3. Prepare the human placenta cDNA from the Super SMARTTM PCR cDNA Synthesis Kit procedure by mixing

Forward Subtraction

cDNA 1 cDNA 1 Sample 1

cDNA 1 specific to sample 1

Hybridizations

cDNA 2 cDNA 2 Sample 2

Reverse Subtraction

cDNA 2 specific to sample 2

Fig. 2.11 Forward and reverse subtraction. The forward subtraction experiment is designed to enrich differentially expressed sequences present in poly A+ RNA sample 1 (cDNA 1, tester) but not poly A+ RNA sample 2 (cDNA 2, driver). However, in the reverse subtraction, cDNA 2 serves as a tester and cDNA 1 serves as a driver. The result is two subtracted cDNA populations: the forward-subtracted cDNA contains sequences that are specific to Sample 1 and the reverse-subtracted cDNA contains sequences that are specific to Sample 2.

Fig. 2.12 Preparing adaptor-ligated tester cDNAs for hybridization and PCR. Each tester cDNA (i.e., each different experimental cDNA and the control skeletal muscle tester cDNA) must be ligated to the appropriate adaptors, as shown above. Panel A. The forward subtraction is the intended experiment. Panel B. A second subtraction in reverse (i.e., tester as driver, driver as tester) is required for differential screening of the subtracted cDNA library. Panel C. Control subtraction with skeletal muscle cDNA. (Adapted from the PCR-Select cDNA Subtraction Kit User Manual, Clontech.)

Gene Expression in Embryonic Diapause 37

38

` Lefevre and Murphy

Table 2.4 Setting up the ligation reactions Component

Tester 1-1 (␮L)

Tester 2-2 (␮L)

Diluted tested cDNA

2

2

Adaptor 1 (10 ␮M)

2

–

Adaptor 2R (10 ␮M)

–

2

Master Mix

6

6

Final volume

10

10

4.

5.

6.

7. 8.

9. 10. 11. 12. 3.3.4.1. Ligation Efficiency Analysis (PCR-SelectTM cDNA Subtraction Kit)

it with ␸X174/HaeIII Control DNA as for the control skeletal muscle tester cDNA (see Note 26). Prepare a ligation Master Mix by combining in a 0.5-mL microcentrifuge tube: 3 ␮L sterile H2 O, 2 ␮L 5× Ligation Buffer (PCR-SelectTM cDNA Subtraction Kit), 1 ␮L T4 DNA Ligase (400 U/␮L) (PCR-SelectTM cDNA Subtraction Kit) (see Note 27). For each experimental tester cDNA and for the control skeletal muscle tester cDNA, combine the reagents in Table 2.4 in the order shown in 0.5-mL microcentrifuge tubes. Pipet mixture up and down to mix thoroughly. In a fresh microcentrifuge tube, mix 2 ␮L of Tester 1-1 and 2 ␮L of Tester 1-2 (PCR-SelectTM cDNA Subtraction Kit). After ligation is complete, this will be the unsubtracted tester control 1-c. Do the same for each additional experimental tester cDNA and the control skeletal muscle tester cDNA. After ligation, approximately 1/3 of the cDNA molecules in each unsubtracted tester control tube will bear two different adaptors. Centrifuge briefly and incubate at 16◦ C overnight. Add 1 ␮L of EDTA/glycogen (provided with the PCRSelectTM cDNA Subtraction Kit). Mix to stop ligation reaction. Heat samples at 72◦ C for 5 min to inactivate the ligase. Centrifuge the tubes for 5 s. Remove 1 ␮L from each unsubtracted tester control (1-c, 2-c, and 3-c) and dilute into 1 mL of H2 O. Store samples at −20◦ C.

The following PCR experiment allows verification that at least 25% of the cDNAs have adaptors on both ends. This experiment is designed to amplify fragments that span the adaptor/cDNA junctions of Testers 1-1 and 1-2, of second experimental tester cDNA (Testers 2-1 and 2-2) from the reverse subtraction, on the adaptor-ligated control skeletal muscle cDNA (Testers 3-1 and

Gene Expression in Embryonic Diapause

39

3-2) and adaptor-ligated control human placenta cDNA (Testers 4-1 and 4-2). 1. Dilute 1 ␮L of each ligated cDNA (e.g., the Testers 1-1 and 1-2) into 200 ␮L of H2 O. 2. Combine the reagents in Table 2.5 in four separate tubes for each experimental cDNA samples and controls. 3. Prepare a Master Mix for all of the reaction tubes. For each reaction planned, combine the reagents in Table 2.6 in the order shown. 4. Mix well by vortexing and centrifuging the tubes for 5 s. 5. Aliquot 22 ␮L of Master Mix into each of the reactions. 6. Mix well by vortexing and centrifuging the tubes for 5 s. 7. Overlay with 50 ␮L of mineral oil. 8. Incubate the reaction mix at 75◦ C for 5 min in a thermal cycler to extend the adaptors thus creating binding sites for the PCR primers. Do not remove the samples from the thermal cycler. 9. Immediately commence thermal cycling: Thermal Cycler 480

PCR Systems 2400 or 9600

20 cycles

1 cycle

◦

94 C, 30 sec

94◦ C, 10 sec

65◦ C, 30 sec

20 cycles

68◦ C, 2.5 min

94◦ C, 10 sec 65◦ C, 30 sec 68◦ C, 2.5 min

10. Analyze 5 ␮L from each reaction on a 2.0% agarose/EtBr gel run in 1× TAE buffer (see Note 28 and Fig. 2.13). 3.3.5. First Hybridization (PCR-SelectTM cDNA Subtraction Kit)

1. Allow the 4× Hybridization Buffer to warm up to room temperature for at least 15–20 min. Verify that there is no

Table 2.5 Setting up the ligation efficiency analysis Tube

1

2

3

4

Tester 1-1 (ligated to Adaptor 1)

1

1

–

–

Tester 1-2 (ligated to Adaptor 2R)

–

–

1

1

G3PDH 3 Primer (10 ␮M)

1

1

1

1

Component (␮L)



G3PDH 5 Primer (10 ␮M)

–

1

–

1

PCR Primer 1 (10 ␮M)

1

–

1

–

Total volume (␮L)

3

3

3

3

40

` Lefevre and Murphy

Table 2.6 Preparation of the ligation efficiency analysis, PCR Master Mix Component

Per reaction

Sterile H2 O

18.5 ␮L

10× PCR reaction buffer

2.5 ␮L

dNTP Mix (10 mM)

0.5 ␮L

50× Advantage cDNA Polymerase Mix

0.5 ␮L

Total volume

22.0 ␮L

PCR Primer 1

G3PDH 5’ Primer

5’

G3PDH 3’ Primer

3’

G3PDH Adaptor 1 or adaptor 2R

Fig. 2.13 Typical results of ligation efficiency analysis. The results shown here are for human samples; lane 1: PCR products using Tester 1-1 (Adaptor 1-ligated) as the template and the G3PDH 3 Primer and PCR Primer 1. Lane 2: PCR products using Tester 1-1 (Adaptor 1-ligated) as the template and the G3PDH 3 and 5 Primers. Lane 3: PCR products using Tester 1-2 (Adaptor 2R-ligated) as the template and the G3PDH 3 Primer and PCR Primer 1. Lane 4: PCR products using Tester 1-2 (Adaptor 2R-ligated) as the template and the G3PDH 3 and 5 Primers, 2% agarose/EtBr gel. Lane M: ␸X174 DNA/HaeIII digest size markers. (Adapted from PCR-SelectTM cDNA Subtraction Kit User Manual, Clontech.)

2.

3. 4. 5.

3.3.6. Second Hybridization (PCR-SelectTM cDNA Subtraction Kit)

visible pellet or precipitate before using the buffer. If necessary, heat the buffer at 37◦ C for ∼10 min to dissolve any precipitate. For each of the experimental and skeletal muscle subtractions, combine the reagents in Table 2.7 in 0.5-mL tubes in the order shown. Overlay samples with one drop of mineral oil and centrifuge briefly. Incubate samples at 98◦ C for 1.5 min in a thermal cycler. Incubate samples at 68◦ C for 8 h. Samples may hybridize for 6–12 h. Do not let the incubation exceed 12 h.

Do not remove the hybridization samples from the thermal cycler for longer than is necessary to add fresh driver. 1. Add into a sterile tube for each experimental tester cDNA and for the control skeletal muscle cDNA (final volume 4

Gene Expression in Embryonic Diapause

41

Table 2.7 Setting up the first hybridization Hybridization samples

1 Tester 1-1

2 Tester 1-2

RsaI-digested Driver cDNA

1.5 ␮L

1.5 ␮L

Adaptor 1-ligated Tester 1-1

1.5 ␮L

–

Component

Adaptor 2R-ligated Tester 1-2

–

1.5 ␮L

4× Hybridization Buffer

1.0 ␮L

1.0 ␮L

Final volume

4.0 ␮L

4.0 ␮L

␮L): 1 ␮L Driver cDNA, 1 ␮L 4× Hybridization Buffer, 2 ␮L sterile H2 O. 2. Place 1 ␮L of this mixture in a 0.5-mL microcentrifuge tube and overlay it with one drop of mineral oil. 3. Incubate at 98◦ C for 1.5 min in a thermal cycler. 4. Remove the tube of freshly denatured driver from the thermal cycler. 5. Use the following procedure to simultaneously mix the driver with hybridization samples 1 and 2 (Table 2.7). This ensures that the two hybridization samples mix together only in the presence of freshly denatured driver: a. Set a micropipettor at 15 ␮L. b. Gently touch the pipette tip to the mineral oil/sample interface of the tube containing hybridization sample 2. c. Carefully draw the entire sample partially into the pipette tip. Do not be concerned if a small amount of mineral oil is transferred with the sample. d. Remove the pipette tip from the tube and draw a small amount of air into the tip, creating a slight air space below the droplet of sample. e. Gently touch the pipette tip to the mineral oil/sample interface of the tube containing the freshly denatured driver sample. f. Carefully draw the entire sample partially into the pipette tip. Do not be concerned if a small amount of mineral oil is transferred with the sample. The pipette tip should now contain both samples (hybridization sample 2 and denatured driver) separated by a small air pocket. g. Transfer the entire mixture to the tube containing hybridization sample 1. h. Mix by pipetting up and down. i. Incubate reaction at 68◦ C overnight. j. Add 200 ␮L of dilution buffer (PCR-SelectTM cDNA Subtraction Kit) and mix by pipetting.

42

` Lefevre and Murphy

k. Heat at 68◦ C for 7 min in a thermal cycler. l. Store at −20◦ C. 3.3.7. PCR Amplification (PCR-SelectTM cDNA Subtraction Kit)

Seven PCR reactions are recommended as described in Fig. 2.12: 1. Forward-subtracted experimental cDNA. 2. Unsubtracted tester control (1-c). 3. Reverse-subtracted experimental cDNA. 4. Unsubtracted tester control for the reverse subtraction (2-c). 5. Subtracted control skeletal muscle cDNA. 6. Unsubtracted tester control for the control subtraction (3-c). 7. PCR control-subtracted cDNA. The PCR controlsubtracted cDNA provides a positive PCR control and contains a successfully subtracted mixture of X174 DNAHaeIII/Digest

3.3.7.1. Primary Amplification

Prepare the PCR templates: 1. Aliquot 1 ␮L of each diluted cDNA from subtracted experimental sample and the corresponding diluted unsubtracted sample into an appropriately labeled tube. 2. Aliquot 1 ␮L of the PCR control subtracted cDNA into an appropriately labeled tube. 3. Prepare a Master Mix for all of the primary PCR tubes. Combine in order (total volume 24 ␮L): 19.5 ␮L sterile H2 O, 2.5 ␮L 10× PCR reaction buffer (PCR-SelectTM cDNA Subtraction Kit), 0.5 ␮L dNTP Mix (10 mM) (PCR-SelectTM cDNA Subtraction Kit), 1.0 ␮L PCR Primer 1 (10 ␮M) (PCR-SelectTM cDNA Subtraction Kit), 0.5 ␮L 50× Advantage cDNA Polymerase Mix. 4. Mix well by vortexing and centrifuge the tube for 5 s. 5. Aliquot 24 ␮L of Master Mix into each of the reaction tubes containing 1 ␮L of the diluted cDNA. 6. Overlay with 50 ␮L of mineral oil. 7. Incubate the reaction mix at 75◦ C for 5 min in a thermal cycler to extend the adaptors thus creating binding sites for the PCR primers. 8. Immediately commence thermal cycling: Thermal Cycler 480

PCR Systems 2400 or 9600

27 cycles

1 cycle:

◦

94◦ C, 25 sec

◦

27 cycles

◦

94◦ C, 10 sec

94 C, 30 sec 66 C, 30 sec 72 C, 1.5 min

66◦ C, 30 sec 72◦ C, 1.5 min

9. Set 8 ␮L aliquots aside from each tube for gel electrophoresis of PCR amplification.

Gene Expression in Embryonic Diapause

3.3.7.2. Secondary Amplification (Nested PCR)

43

1. Dilute 3 ␮L of each primary PCR mixture in 27 ␮L of H2 O. 2. Aliquot 1 ␮L of each diluted primary PCR product mixture into an appropriately labeled tube. 3. Prepare Master Mix for the secondary PCR reactions by combining in order (total volume 24 ␮L): 18.5 ␮L sterile H2 O, 2.5 ␮L 10× PCR reaction buffer (PCR-SelectTM cDNA Subtraction Kit), 1.0 ␮L Nested PCR Primer 1 (10 ␮M) (PCR-SelectTM cDNA Subtraction Kit), 1.0 ␮L Nested PCR Primer 2R (10 ␮M) (PCR-SelectTM cDNA Subtraction Kit), 0.5 ␮L dNTP Mix (10 mM) (PCR-SelectTM cDNA Subtraction Kit), 0.5 ␮L 50× Advantage cDNA Polymerase Mix. 4. Mix well by vortexing and centrifuge the tube for 5 s. 5. Aliquot 24 ␮L of Master Mix into the tubes containing the diluted primary PCR product. 6. Overlay with one drop of mineral oil. 7. Immediately commence thermal cycling: Thermal Cycler 480

PCR Systems 2400 or 9600

10–12 cycles:

10–12 cycles:

94◦ C, 30 sec

94◦ C, 10 sec

◦

68 C, 30 sec

68◦ C, 30 sec

72◦ C, 1.5 min

72◦ C, 1.5 min

8. Analyze 8 ␮L from each reaction on a 2.0% agarose/EtBr gel run in 1× TAE buffer (see Note 29 and Figs. 2.14, 2.15). 9. Store reaction products at −20◦ C. 3.3.8. PCR Analysis of Subtraction Efficiency (PCR-SelectTM cDNA Subtraction Kit)

Amplification by PCR can be used to estimate the efficiency of subtraction by comparing the abundance of known cDNAs before and after subtraction. Ideally this is done with both a nondifferentially expressed gene (e.g., housekeeping gene) and with a gene known to be differentially expressed between the two RNA sources being compared. The test described below uses the G3PDH primers provided with the PCR-SelectTM cDNA Subtraction Kit and cyclophilin primers to confirm the reduced relative abundance of G3PDH and cyclophilin following the PCRSelect procedure (see Note 30 and Figs. 2.11, 2.12). 1. Dilute the subtracted and unsubtracted (unsubtracted tester control 1-c and 2-c) secondary PCR products 10× in H2 O. The concentration of subtracted and unsubtracted product should be roughly equal. 2. Combine in 0.5-mL microcentrifuge tubes in order: a. For the skeletal muscle cDNA control (total volume 30 ␮L): 1 ␮L diluted subtracted cDNA or diluted unsubtracted tester control 1-c, 1.2 ␮L Cyclophilin 3 Primer

44

` Lefevre and Murphy

A. Primary PCR

1000 kb 500 kb

100 kb M

1

2

3

4

5

6

7

B. Secondary PCR

1000 kb 500 kb

100 kb M

1

2

3

4

5

6

7

Fig. 2.14 Amplification of results for reactivated uterus versus uterus in diapause subtraction analysis. Lane M: 100 bp size markers. Panel A: Primary PCR. Panel B: Secondary PCR. Lane 1: PCR products of subtracted skeletal muscle tester cDNA with 0.2% ␸X174/Hae III-digested DNA. Lane 2: PCR products of forward subtraction cDNA. Lane 3: PCR products of reverse subtraction cDNA. Lane 4: PCR products of unsubtracted skeletal muscle tester cDNA with 0.2% ␸X174/Hae III-digested DNA. Lane 5: PCR products of forward unsubtracted cDNA. Lane 6: PCR products of reverse unsubtracted cDNA. Lane 7: PCR control subtracted cDNA. Samples are electrophoresed on a 2% agarose/EtBr gel ` (Lefevre, 2005, unpublished).

3. 4. 5. 6.

7.

(10 ␮M), 1.2 ␮L Cyclophilin 5 Primer (10 ␮M), 3.0 ␮L 10× PCR reaction buffer (PCR-SelectTM cDNA Subtraction Kit), 22.4 ␮L sterile H2 O, 0.6 ␮L dNTP Mix (10 mM) (PCR-SelectTM cDNA Subtraction Kit), 0.6 ␮L 50× Advantage cDNA Polymerase Mix. b. For the experimental cDNA samples (total volume 30 ␮L): 1 ␮L diluted subtracted cDNA or diluted unsubtracted tester control 1-c, 1.2 ␮L G3PDH 3 Primer (10 ␮M), 1.2 ␮L G3PDH 5 Primer (10 ␮M) (PCRSelectTM cDNA Subtraction Kit), 3.0 ␮L 10× PCR reaction buffer, 22.4 ␮L sterile H2 O, 0.6 ␮L dNTP Mix (10 mM), 0.6 ␮L 50× Advantage cDNA Polymerase Mix. Mix by vortexing and briefly centrifuging. Overlay with one drop of mineral oil. Use the following thermal cycling program; 18 cycles: 94◦ C 30 s, 60◦ C 30 s, 68◦ C 2 min. Remove 5 ␮L from each reaction and place it in a clean tube. Put the rest of the reaction mixture back into the thermal cycler for five additional cycles. Repeat the last step twice (i.e., remove 5 ␮L after 28 and 33 cycles).

Gene Expression in Embryonic Diapause

45

Fig. 2.15 Typical results of control skeletal muscle subtraction analysis. The secondary PCR product of the subtracted skeletal muscle sample contains mostly DNA fragments corresponding to the ␸X174/HaeIII digest. The adaptor sequences on both ends of DNA fragments cause the mobility shift of these PCR products in comparison with original, digested ␸X174 DNA. Lane M: ␸X174 DNA/HaeIII digest size markers. Lane 1: Secondary PCR products of subtracted skeletal muscle tester cDNA with 0.2% ␸X174/HaeIII-digested DNA. Lane 2: Secondary PCR products of unsubtracted skeletal muscle tester cDNA ligated with both Adaptors 1 and 2R and containing 0.2% ␸X174/HaeIII-digested DNA. Samples are electrophoresed on a 2% agarose/EtBr gel (from PCR-SelectTM cDNA Subtraction Kit User Manual, Clontech).

8. Examine the 5 ␮L samples (i.e., the aliquots that were removed from each reaction after 18, 23, 28, and 33 cycles) on a 2.0% agarose/EtBr gel (see Note 31 and Fig. 2.16). 3.4. Differential Screening (PCR-Select Differential Screening Kit)

The PCR-Select Differential Screening Kit allows to screen your PCR-Select subtracted library for differentially expressed cDNAs and to eliminate nondifferentially expressed transcripts. The procedure involves a first step of cloning cDNA sequences into a cloning vector to isolate from each other and amplify subtracted cDNA fragments. Clones from the subtracted library are then arrayed on nylon membranes and hybridized with four

46

` Lefevre and Murphy

Subtracted samples Unsubtracted samples 18

23

28

33

18

23

28

33

18

23

28

33

18

23

28

33

18

23

28

33

18

23

28

33

1

2

3

4

5

6

7

8

A. Control human skeletal cDNA (Cyclophilin amplification) 500 bp

B. Forward subtraction cDNA (G3PDH amplification) 500 bp

C. Reverse subtraction cDNA (G3PDH amplification) 500 bp

M

Fig. 2.16 Amplification results for the efficiency of the reactivated uterine cDNA versus cDNA of uterus during diapause subtraction, in the mink. PCR was performed on the subtracted (lanes 1–4) or unsubtracted (lanes 5–8) secondary PCR product using housekeeping gene primers. Lanes 1 and 5: 18 cycles; lanes 2 and 6: 23 cycles; lanes 3 and 7: 28 cycles; lanes 4 and 8: 33 cycles. Lane M: marker, 100 bp. Panel A: Cyclophilin reduction in control human skeletal cDNA subtraction. Panels B and C: G3PDH reduction in the forward subtraction cDNA and in the reverse subtraction cDNA, respectively. Housekeeping gene abundance is significantly reduced by PCR-Select subtraction. The three subtractions ` were successful. (Lefevre, 2005, unpublished).

different probes (Fig. 2.17): a probe made from the subtracted cDNA, another probe made from reverse-subtracted cDNA, and nonsubtracted probes synthesized directly from tester and driver cDNAs. Clones hybridizing to tester but not to driver are differentially expressed; however, nonsubtracted probes are not sensitive enough to detect rare messages. Subtracted probes are greatly enriched for rare differentially expressed sequences and can detect rare transcripts, but they may give false positive results. Thus, using subtracted and nonsubtracted probes together provides the most effective way to identify potentially differentially expressed genes. 3.4.1. Secondary PCR of Subtracted cDNA

1. Label sterile 0.5-mL reaction tubes for PCR. Prepare two secondary PCR tubes for each subtracted and/or unsubtracted probe.

Gene Expression in Embryonic Diapause

47

Fig. 2.17 Experimental set-up for PCR-Select Differential Screening following the PCR-Select cDNA subtraction. This flow chart indicates the procedure for preparing both subtracted and unsubtracted probes. Differential screening with subtracted probes is more sensitive. However, using both subtracted and unsubtracted probes is recommended. Secondary PCR products are cloned to construct the subtracted cDNA library. Complementary DNA clones are hybridized on nylon membranes that are arrayed by four different probes: the forward and reverse subtracted probes and the unsubtracted tester and driver probes.

2. Prepare a PCR Master Mix in a 1.5-mL microcentrifuge tube. Combine in order (total volume 24 ␮L): 18.5 ␮L sterile H2 O, 2.5 ␮L 10× PCR reaction buffer (PCR-Select Differential Screening Kit), 1.0 ␮L Nested PCR Primer 1 (10 ␮M) (PCR-Select Differential Screening Kit), 1.0 ␮L Nested PCR Primer 2R (10 ␮M) (PCR-Select Differential Screening Kit), 0.5 ␮L dNTP Mix (10 mM) (PCR-Select Differential Screening Kit), 0.5 ␮L 50× Advantage cDNA Polymerase Mix. 3. Mix well by vortexing. Spin the tube for 5 s in a microcentrifuge to collect contents at the bottom.

48

` Lefevre and Murphy

4. Aliquot 24 ␮L of Master Mix into each reaction tube labeled. 5. Into each tube, aliquot 1 ␮L of the appropriate template: a. For the forward- and reverse-subtracted probes, use the diluted products of primary PCR amplification from the PCR-Select cDNA subtraction. b. To amplify tester and driver cDNAs to make unsubtracted probes: For the tester probe, use the primary PCR product of the unsubtracted tester control from the forward subtraction as the template. For the driver probe, use the primary PCR product of the unsubtracted tester control from the reverse subtraction as the template. 6. Immediately commence thermal cycling: Thermal Cycler 480

PCR Systems 2400 or 9600

10–12 cycles:

10–12 cycles:

94◦ C, 30 sec

94◦ C, 10 sec

68◦ C, 30 sec

68◦ C, 30 sec

◦

72 C, 1.5 min

72◦ C, 1.5 min

1 cycle:

1 cycle:

72◦ C, 5 min

72◦ C, 5 min

7. Electrophorese 8 ␮L from each reaction on a 2.0% agarose/EtBr gel in 1× TAE buffer (see Note 29). 8. Store reactions at −20◦ C. See Section 3.4.4 for next step. 3.4.2. Subtracted cDNA Library Construction

3.4.2.1. T/A Cloning (Invitrogen T/A Cloning Kit Dual Promoter)

The TA Cloning Kit Dual Promoter with pCRII provides a quick, one-step cloning strategy for the direct insertion of a PCR product into a plasmid vector. Taq polymerase has a nontemplatedependent activity that adds a single deoxyadenosine (A) to the 3 ends of PCR products. The linearized vector supplied in this kit has single 3 -deoxythymidine (T) residues. This allows PCR inserts to ligate efficiently with the vector. 1. Set up the 10 ␮L ligation reaction as follows (final volume 10 ␮L): 3 ␮L fresh secondary PCR product from the forward subtraction (see Note 32), 1 ␮L 10× Ligation Buffer (T/A Cloning Kit Dual Promoter), 2 ␮L pCRII vector (25 ng/␮L) (T/A Cloning Kit Dual Promoter), sterile water to a total volume of 9 ␮L, 1 ␮L T4 DNA Ligase (4.0 Weiss units) (T/A Cloning Kit Dual Promoter). 2. Incubate the ligation reaction at 14◦ C for a minimum of 4 h (preferably overnight).

Gene Expression in Embryonic Diapause

49

3. Ligation reaction may be stored at −20◦ C until cell transformation. 3.4.2.2. Transformation of MAX Efficiency DH5␣ Competent Cells (Invitrogen T/A Cloning Kit Dual Promoter and Invitrogen Max Efficiency DH5␣ Competent Cells)

3.4.2.3. Complementary DNA Amplification from Vector Inserts (PCR-Select Differential Screening Kit)

The ␾80dlacZM15 marker of those competent cells provides ␣-complementation of the ␤-galactosidase gene from the pCRII vector and, therefore, can be used for blue/white screening of colonies on bacterial plates containing X-gal. 1. Thaw competent cells on wet ice. 2. Gently mix cells, then aliquot 100 ␮L of competent cells into chilled polypropylene tubes. Refreeze any unused cells in the dry ice/ethanol bath for 5 min before returning to the −70◦ C freezer. 3. For DNA from ligation reactions, dilute the reactions 5× TE buffer (provide with the Max Efficiency DH5␣ Competent Cells). Add 1 ␮L of the dilution to the cells (1–10 ng DNA), moving the pipette through the cells while dispensing. Gently tap tubes to mix. 4. Incubate cells on ice for 30 min. 5. Incubate the cells for 45 s in a 42◦ C water bath; do not shake. 6. Place on ice for 2 min. 7. Add 0.9 mL of Super Optimal Catabolite repression medium (SOC; Max Efficiency DH5␣ Competent Cells). 8. Shake vigorously at 37◦ C for 1 h. 9. Dilute the experimental reactions 1/1000, 1/100, 1/10 or no dilutions and spread 100–200 ␮L of this dilution on LB medium with 100 ␮g/mL ampicillin (LB-amp) and 40 ␮L 0.1 M IPTG and 40 ␮L X-Gal 20 mg/mL. 10. Incubate overnight at 37◦ C. 11. Analyze the presence, the number, and the color of the colonies grown on the plate for each different dilution. 12. Spread 100 ␮L of the optimal dilution per LB plate with 100 ␮g/mL ampicillin for the remaining experimental reactions. 13. Incubate overnight at 37◦ C. After growth of individual bacterial colonies, the unique presence of the insert is verified by PCR using the Nested Primer 1 and the Nested Primer 2R which have binding site on the adaptors localized at the end of subtracted cDNA inserts. The amplified cDNA is then used to be arrayed on nylon membrane. 1. Randomly pick 1,000 white bacterial colonies on LB plates. 2. Grow each colony in 100 ␮L of LB-amp medium at 37◦ C overnight with vigorous shaking. 3. Prepare a Master Mix for the clones to be amplified. Combine in a clean microcentrifuge tube (total volume 19 ␮L): 2.0 ␮L 10× PCR reaction buffer, 0.6 ␮L Nested Primer 1 (PCR-Select Differential Screening Kit), 0.6 ␮L Nested

50

` Lefevre and Murphy M

1

2

3

4

5

6

7

8

9

10

11

12

13

14

15

1000 pb 500 pb

100 pb

Fig. 2.18 Amplification of 15 embryonic subtracted cDNA inserts of cloning vector after transformation of MAX Efficiency DH5␣ Competent Cells using the Nested Primer 1 and Nester Primer 2R. Clone 6 is excluded from the analysis because no amplification product is detected as well as clone 9 because two different amplification products are detected. In the latter case, the original competent cell may have been transformed by two vectors containing an insert at the same time. ` Electrophoresis in a 2% agarose/EtBr gel, 1× TAE buffer (Lefevre, 2006, unpublished).

4. 5. 6. 7. 8.

3.4.3. Preparation of cDNA Dot Blots of the PCR Products

Primer 2R (PCR-Select Differential Screening Kit), 0.4 ␮L dNTP mix (10 mM), 15.2 ␮L H2 O, 0.2 ␮L 50× PCR enzyme mix. Mix well by vortexing and spin the tube for 5 s in a microcentrifuge. Aliquot 19 ␮L of the Master Mix into each tube. Transfer 1 ␮L of each bacterial culture to each tube. Begin thermal cycling: 94◦ C 30 s and 23 cycles: 95◦ C 10 s, 68◦ C 3 min. Electrophorese 5 ␮L from each reaction on a 2.0% agarose/EtBr gel in 1× TAE buffer. Each PCR product should correspond to the cDNA insert (see Note 33 and Fig. 2.18).

1. For each PCR reaction, combine 5 ␮L of PCR product and 5 ␮L of 0.6 N NaOH (freshly made or at least freshly diluted from concentrated stock) in a 96-well plate. NaOH will denature the DNA for hybridization. 2. Mix by briefly spinning the plate. 3. Using a micropipettor, transfer 1–2 ␮L of each mixture to a nylon membrane. Prepare four identical blots for hybridization with both subtracted and unsubtracted probes. For best results, array each cDNA in duplicate on each membrane. 4. Neutralize the blots for 2–4 min in 0.5 M Tris–HCl (pH 7.5) and wash in H2 O. 5. Cross-link the DNA to the membrane using a UV linking device under 120 mJ. Alternatively, bake the blots for 1–2 h at 70◦ C in an oven (see Note 34).

Gene Expression in Embryonic Diapause

51

3.4.4. Random Primer Labeling of cDNA Probes

3.4.4.1. Purification of Secondary PCR Products (NucleoSpin Extract II Kit Provided with the PCR-Select Differential Screening Kit)

3.4.4.2. Radiolabeling of cDNA Probes (PCR-Select Differential Screening Kit)

1. Add 34 ␮L of Buffer NT to each cDNA synthesis reaction (obtained Section 3.4.1); mix well by pipetting. 2. Place a NucleoSpin Extract II Column (NucleoSpin Extract II Kit) into a 2-mL collection tube. Pipet the sample into the column. Centrifuge at 11,200g for 1 min. 3. Discard the flow-through. 4. Return the column to the collection tube. 5. Add 600 mL of Wash Buffer NT3 (NucleoSpin Extract II Kit) to the column. Centrifuge at 11,200g for 1 min. 6. Discard the flow-through. 7. Place the column back into the collection tube. Centrifuge at 11,200g for 2 min to remove any residual Wash Buffer NT3. 8. Transfer the NucleoSpin Columns into a fresh 1.5-mL microcentrifuge tube. 9. Add 20 ␮L of sterile ultrapure H2 O to the column. Allow the column to stand for 2 min with the caps open. 10. Close the tube and centrifuge at 11,200g for 1 min to elute the sample. (Note 35) 1. In separate 0.5-mL microcentrifuge tubes, mix 3 ␮L (20–90 ng) of each of the purified forward- and reversesubtracted cDNAs and 3 ␮L of each of the unsubtracted tester and driver cDNAs with 6 ␮L of H2 O. 2. Denature by heating for 8 min at 95◦ C and then chill on ice. 3. Add to each tube (final volume 20 ␮L): 3 ␮L Reaction Buffer (–dCTP), 2 ␮L Random Primer Mix, 5 ␮L [␣-32 P] dCTP (50 ␮Ci, 3000 Ci/mmol, aqueous solution), 1 ␮L Klenow Enzyme (exo-) (PCR-Select Differential Screening Kit). 4. Incubate tubes at 37◦ C for 30 min. 5. Terminate each reaction by adding 5 ␮L of Stop Solution (provided with the PCR-Select Differential Screening Kit). 6. Purify probe from unincorporated dNTPs using IllustraTM MicroSpin Columns (GE Health Care). a. Resuspend the resin in the column by vortexing. Use columns immediately after preparation to avoid drying out of the resin. b. Loosen the cap one-quarter turn and snap off the bottom closure. c. Place the column in a collection tube. d. Pre-spin the column for 1 min at 735g. e. Remove the top cap. f. Transfer the column to a new clean microcentrifuge tube.

52

` Lefevre and Murphy

g. Slowly apply the sample to the centre of the resin bed. The resin will appear compacted and angled. Take care not to disturb the resin bed. Do not allow any of the sample to flow around the sides of the bed. h. Spin the column for 2 min at 735g. Purified sample is collected in the bottom of the microcentrifuge tube. i. Remove the spin column from the microcentrifuge tube and discard. 7. Determine the specific activity of each probe. More than 1 × 107 cpm per probe should be obtained.

3.4.5. Hybridization with the Subtracted cDNA

3.4.5.1. Membrane Preparation

3.4.5.2. Preparation of the Hybridization Probes

1. Make hybridization solution for each membrane prepared and arrayed with forward subtracted cDNA: a. Combine 50 ␮L of 20× SSC and 50 ␮L of Blocking Solution. b. Mix well. c. Boil for 5 min and chill on ice. d. Combine with 5 mL of hybridization solution. 2. Place each membrane in a hybridization container and add the hybridization solution. 3. Prehybridize for 40–60 min with continuous agitation at 72◦ C. Continuous agitation of the membranes in a hybridization incubator with rotating bottles is necessary during all prehybridization, hybridization, and washing steps. 1. Mix 50 ␮L of 20× SSC, 50 ␮L of Blocking Solution and your purified probe (at least 1 × 107 cpm per 100 ng of subtracted cDNA). Be sure to add the same number of cpm for each pair of probes. 2. Boil for 5 min and then chill on ice. 3. To each hybridization container, add the probes. Avoid adding the probe directly into the membrane. 4. Hybridize at 72◦ C overnight with continuous agitation. 5. Warm low-stringency (2× SSC/0.5% SDS) and highstringency (0.2× SSC/0.5% SDS) washing solutions to 68◦ C. Keep buffers at 68◦ C during washing. 6. Wash membranes with low-stringency washing solution (4 × 20 min) at 68◦ C. 7. Wash membranes with high-stringency washing solution (2 × 20 min) at 68◦ C. 8. Seal up each membrane in a plastic envelop.

Gene Expression in Embryonic Diapause

A

Clone 1 Clone 2

Probe: Tester unsubtracted

B

Probe: Forward subtracted

53

Clone 1

Probe: Driver unsubtracted Clone 1

Clone 1 Clone 2

Probe: Reverse subtracted

Fig. 2.19 Sample differential screening results. Panel A. Dot blots hybridized with unsubtracted cDNA probes made from tester (mink uterus after reactivation) and driver (mink uterus during diapause) RNAs. Panel B. Dot blots hybridized with cDNA probes made from forward-subtracted cDNA (mink uterus after reactivation as tester, mink uterus in diapause as driver) and reverse-subtracted cDNA (mink uterus in diapause as tester, mink uterus after reactivation as driver). As an example, a radioactive signal is detected for clone 2 only on the dot blots hybridized with unsubtracted cDNA probes made from tester and on dot blots hybridized with cDNA probes made from forward-subtracted cDNA. Consequently, clone 2 is a positive clone and is selected for the sequencing step. On the contrary, clone 1 is detected on the four dot blots hybridized with either both unsubtracted cDNA probes and both subtracted cDNA probes. As a false positive clone, ` clone 1 is removed from the library for the analysis (Lefevre, 2006, unpublished).

9. Scan the membrane using a Phosphoimager-Storm system to detect the radioactive signal and quantify each signal intensity using ImageQuant Software (Applied Biosystem) (Fig. 2.19). 10. Analyze data and remove false positive clones (Fig. 2.20). 11. The membranes can be stored at −20◦ C or be reused: remove the probes by stripping (100◦ C, 7 min in 0.5% SDS). Blots can typically be probed at least five times.

54

` Lefevre and Murphy

Yes Yes

Tunsx/Dunsx ≥ 1 ?

Fx / Rx ≥ 3 ?

No No (Fx / Rx < 3 )

False positive clone

(Tunsx / Dunsx < 1)

Positive clone False positive clone

Fig. 2.20 Analysis of the differential screening dot blots after quantification of the signal’s intensity for each blot by ImageQuant (Applied Biosystem). Fx , Rx , Tunsx , and Dunsx correspond to the radioactive signal’s intensity measured with ImageQuant software (Applied Biosystem) for one clone x hybridized, respectively, with subtracted-forward cDNA probe (Fx ), with subtracted-reverse cDNA probe (Rx ), with unsubtracted tester cDNA probe (Tunsx ), and with unsubtracted driver cDNA probe (Dunsx ). The procedure to determine whether a clone is positive or false positive is represented in the figure above and is the one recommended by the manufacturer (PCR-Select Differential cDNA Kit, Clontech). As the unsubtracted tester/driver cDNA probe do not hybridize with cDNA sequences that are less represented than 0.2% in the whole population of cDNA, the ratio Fx /Rx is analyzed before the ratio Tunsx /Dunsx .

3.5. Differentially Expressed cDNA Sequence Analysis 3.5.1. Sequencing

Bacterial colonies from positive clones must be freshly grown on LB plates before the cDNA insert contained in the vector is extracted and then sent for sequencing. The primer used for the sequencing procedure can be either the Nested Primer 1 and Nested Primer 2R which are localized on the cDNA insert itself (on the adaptors, Table 2.2) or primers like M13, Sp6 which have hybridization sites on the pCR II vector sequence in the cloning site.

3.5.2. Sequences Annotation

3.5.2.1. Sequences Comparison with Sequences Listed in Genbank Database

The differentially expressed cDNA sequences are annotated by comparison with some sequences that are already listed in the Genbank database available on the Internet network. A classification can be established to describe the proportion of sequences that has a high degree of homology with known and characterized or uncharacterized sequences already listed in the Genbank database and the proportion of new sequences that have no significant degree of homology with already listed sequences. To characterize the degree of homology, the percentage of identity between two aligned sequences, the length of homologous sequences, and the E-value which reflects the probability to find a given alignment among all the possible alignments with all the listed sequences of the Genbank are taken into account.

Gene Expression in Embryonic Diapause

55

3.5.2.2. Gene Ontology

Based on sequences that are homologous to known genes, a second classification of the gene ontology may be drawn up. Multiple softwares are available on the Internet network and provide free gene ontology analysis. This software may also identify signaling pathways involving some of the genes contained in the constructed library. That approach provides a global gene expression analysis.

3.5.3. Selection of Candidate Genes

Finally, a “one by one” analysis of each known genes expected to be of significance based on expression patterns from the literature leads to the selection of candidate genes. Clones highly represented in the library, whether known or unknown sequences, may also be selected.

3.5.4. Identification of Candidate Genes

Once a list of candidate genes have been selected, validation of the differentially expression pattern of those genes must be undertaken. Informative techniques can be applied to define the expression pattern of any single gene. Among the most reliable are realtime PCR or semi-quantitative PCR for gene expression quantification and in situ hybridization of mRNA or immunocytochemical localization of protein gene products to establish the spatial gene expression pattern.

4. Notes 1. If embedding samples in paraffin in a few days following the tissue collection, they can be held in PBS 1× at 4◦ C, after the three rinses. 2. It is essential to use the correct amount of starting material in order to obtain optimal RNA yield and purity. A maximum amount of 5 mg fresh or frozen tissue can generally be processed. Weighing tissue is the most accurate way to quantitate the amount of starting material. As a guide, a 1.5-mm cube (3.4 mm3 ) of most animal tissues weighs 3.5–4.5 mg. 3. To avoid damage to the TissueRuptor and disposable probe during operation, make sure the tip of the probe remains submerged in the buffer. Foaming may occur during homogenization. If this happens, let the homogenate stand at room temperature for 2–3 min until the foam subsides before continuing with the procedure. 4. The volume of 70% ethanol to be added may be less if some lysate was lost during homogenization. Precipitates may be visible after the addition of ethanol, but this does not affect the procedure.

56

` Lefevre and Murphy

5. After centrifugation, carefully remove the RNeasy MinElute spin column from the collection tube so that the column does not contact the flow-through. 6. As little as 10 ␮L RNase-free water can be used for elution if a higher RNA concentration is required, but the yield will be reduced by approximately 20%. 7. The concentration of RNA should be determined by measuring the absorbance at 260 nm (A260) in a spectrophotometer. The ratio of the readings at 260 nm and 280 nm (A260/A280) provides an estimate of the purity of RNA with respect to contaminants that absorb in the UV, such as protein. Do not use more than 1 mg total RNA. 8. The initial volume of the RNA solution is not important as long as the volume can be brought up to the indicated amount with RNase-free water. 9. Loss of the Oligotex resin can be avoided if approximately 50 ␮L of the supernatant is left in the microcentrifuge tube. The remaining solution will not affect the procedure. Save the supernatant until certain that satisfactory binding and elution of poly A+ mRNA has occurred. 10. The volume of Buffer OEB used depends on the expected or desired concentration of poly A+ mRNA. Ensure that Buffer OEB does not cool significantly during handling. With multiple samples, it may be necessary to place the entire microcentrifuge tube (with spin column, Oligotex, and sample) into a 70◦ C heating block to maintain the temperature while preparing the next samples. 11. To keep the elution volume low, the first eluate may be used for a second elution. Reheat the eluate to 70◦ C and elute in the same microcentrifuge tube. 12. The minimum amount of starting material for standard cDNA synthesis is 2 ng of total RNA. However, if the RNA sample is not limiting, it is recommended to begin with 20–1,000 ng of total RNA for cDNA synthesis. Please note that if there is >100 ng of total RNA, dilute first-strand cDNA product before proceeding with cDNA amplification. 13. For the control synthesis, add 10 ng of control human placenta total RNA. 14. If necessary, cDNA can be stored at −20◦ C until ready to proceed with column chromatography. 15. Samples can also be stored at −20◦ C for up to 3 months. 16. Choosing the optimal number of PCR cycles ensures that the ds cDNA will remain in the exponential phase of amplification. When the yield of PCR products stops increasing with more cycles, the reaction has reached its plateau. The optimal number of cycles for an experiment is one cycle fewer than is needed to reach the plateau. Figure 2.9 shows a typical gel profile of ds cDNA synthesized using the Con-

Gene Expression in Embryonic Diapause

17.

18.

19.

20.

21.

57

trol Human Placenta Total RNA for SMART cDNA synthesis and amplification (17). The PCR reached its plateau after 24 cycles for the 5-ng experiment and 21 cycles for the 20-ng experiment; that is, the yield of PCR products stopped increasing. After 24 and 21 cycles, a smear appeared in the high molecular weight region of the gel, indicating that the reactions were overcycled. Therefore, the optimal number of cycles would be 23 for the 5-ng experiment and 20 for the 20-ng experiment. Note that the number and position of the bands and the size of the smear observed will be different for each particular total RNA used. Butanol extraction allows concentration of the PCR product to a volume of 40–70 ␮L. Addition of too much n-butanol may remove all the water and precipitate the nucleic acid. If this happens, add water to the tube and vortex until an aqueous phase reappears. If volume is less than 40–70 ␮L, repeat the last three steps: Add 700 ␮L of n-butanol and vortex the mix thoroughly. Centrifuge the solution at room temperature at 11,200g for 1 min and remove and discard the upper (n-butanol organic) phase. If final volume is <40 ␮L after the second butanol concentration step, add H2 O to the aqueous phase to adjust volume to 40–70 ␮L. The top of the column matrix should be at the 0.75 mL mark on the wall of the column. If the column contains much less matrix, discard it and use another column. To analyze the ds cDNA after column chromatography, electrophorese 3 ␮L of the unpurified PCR product (Sample A) alongside 10 ␮L of the PCR product purified by column chromatography (Sample B) and 10 ␮L of the second fraction (Sample C) on a 1.2% agarose/EtBr gel. Compare the intensities of Sample A and Sample B and estimate the percentage of PCR product that remains after column chromatography. The yield of cDNA after column chromatography is typically 50%. If the yield is <30%, check to see if it is present in the second fraction, Sample C. If this second fraction has a higher yield of cDNA than the first, combine the fractions. Otherwise if the cDNA is not present in Sample C, repeat the PCR and column chromatography steps. Electrophorese 2.5 ␮L of undigested ds cDNA and 5 ␮L of RsaI-digested cDNA on a 1% agarose/EtBr gel in 1× TAE buffer side-by-side. Double-strand cDNA appears as a smear from 0.5 to 10 kb. Bright bands correspond to abundant mRNAs or rRNAs. After RsaI digestion, the average cDNA size is smaller (0.1–2 kb compared to 0.5– 10 kb). Typical results are shown in Fig. 2.10.

58

` Lefevre and Murphy

22. For each reaction, 1–3 ␮g of SMART cDNA is obtained after purification. If the yield is lower than this, perform the agarose/EtBr gel analysis: electrophorese 10 ␮L of RsaIdigested cDNA before purification (Sample E) alongside 10 ␮L of purified diluted cDNA before ethanol precipitation (Sample F) and 1.8 ␮L of purified diluted cDNA after ethanol precipitation (Sample G) on a 1.5% agarose/EtBr gel. Compare the intensities of the samples and estimate what percentage of RsaI-digested PCR product remains after purification and ethanol precipitation. The yield of cDNA after purification using the NucleoTrap PCR Kit and ethanol precipitation is typically 70%. 23. For the control synthesis, add 2 ␮L of the skeletal muscle control poly A+ RNA. 24. These 5.5-␮L samples of RsaI-digested cDNA will serve as the experimental driver cDNA and the control skeletal muscle driver cDNA. 25. This is the control skeletal muscle tester cDNA. It contains 0.2% HaeIII-digested ␸X174 DNA; each fragment corresponds to about 0.02% of the total cDNA. After subtraction of the skeletal muscle tester cDNA against the skeletal muscle driver cDNA, the primary bands produced in the final PCR should correspond to these control fragments. 26. For the rest of the PCR-Select protocol, the control human placenta cDNA should be analyzed in parallel with the control skeletal muscle cDNA. 27. The ATP required for ligation is a component of the T4 DNA Ligase mix (3 mM initial, 300 ␮M final). 28. Typical results for the ligation efficiency test are shown in Fig. 2.13. If no products are detected after 20 cycles, perform 5 additional cycles and analyze by gel electrophoresis. The PCR product using one gene-specific primer (G3PDH 3 Primer) and PCR Primer 1 should be about the same intensity as the PCR product amplified using two genespecific primers (G3PDH 3 and 5 Primers). If the band intensity for these PCR products differs by more than 4-fold, the ligation was less than 25% complete and will significantly reduce subtraction efficiency. If working with mouse or rat cDNA, the PCR product amplified using the G3PDH 3 Primer and PCR Primer 1 will be ∼1.2 kb instead of 0.75 kb for human cDNA. 29. Primary PCR: With the PCR control subtracted cDNA, the major bands appearing after 27 cycles should correspond to the ␸ X174 DNA-HaeIII fragments. This result should look similar to the performed skeletal muscle subtraction. The experimental primary PCR subtraction products usually appear as a smear from 0.2 to 2 kb, with or without some distinct bands (Fig. 2.14). Secondary PCR: The

Gene Expression in Embryonic Diapause

59

patterns of secondary PCR products from the PCR Control Subtracted cDNA and from the skeletal muscle subtraction should resemble lanes 1, 4, and 7 in Fig. 2.14 and lane 1 in Fig. 2.15. A few additional bands may appear. The experimental subtracted samples usually appear as smears with or without a number of distinct bands (Fig. 2.14). 30. Not all housekeeping gene transcripts are subtracted evenly. In certain instances a particular housekeeping gene is present at different levels in tester and driver poly A+ RNA. If the concentration of G3PDH message is even 2-fold higher in the tester sample, G3PDH will not be efficiently subtracted out. If subtraction is performed in both directions and there is unsubtracted tester control for both the subtraction and the reverse subtraction, the PCR analysis of subtraction efficiency will indicate if there is any difference in G3PDH abundance in the two cDNA samples being compared. Moreover, G3PDH is not efficiently subtracted in skeletal muscle cDNA, which is the positive control of the subtraction. Therefore, we used cyclophilin as a housekeeping gene to validate the subtraction of the skeletal muscle cDNA. However, in the control skeletal muscle subtraction experiment, the agarose gel banding pattern of the X174 DNA-HaeIII/digest has already indicated whether or not subtraction was successful (Figs. 2.11 and 2.12). 31. Figure 2.16 shows an example of G3PDH and cyclophilin reduction in successfully subtracted mixtures of cDNA from positive control of the subtraction and from reactivated uterus versus uterus in diapause subtraction in the mink. The difference in the number of cycles required for equal amplification of the corresponding PCR product in subtracted and unsubtracted samples indicates the efficiency of the subtraction. For the unsubtracted cDNA, the housekeeping gene product is seen after 18–23 cycles, depending on its abundance in the particular cDNA. With the subtracted samples, a product should be detected at ∼5–15 cycles later. As a positive control for the enrichment of differentially expressed genes, repeat the procedure above using PCR primers for a gene known to be expressed in the tester RNA, but not in the driver RNA. This cDNA should become enriched during subtraction. The difference in the number of cycles required for equal amplification of the corresponding PCR product in subtracted and unsubtracted samples indicates the efficiency of the subtraction. Five cycles correspond roughly to a 20-fold cDNA enrichment. Because of the equalization that occurs during subtraction, the level of enrichment will depend on the

60

` Lefevre and Murphy

32.

33.

34.

35.

initial abundance of each differentially expressed gene, as well as the difference in abundance of each gene in tester and driver. Differentially expressed genes that are present in low abundance in the tester cDNA will be enriched more than differentially expressed genes that are present in high abundance. For optimal ligation efficiencies, using fresh (less than 1day-old) PCR products is recommended. The single 3 A-overhangs on the PCR products will be degraded over time, reducing ligation efficiency. Take care when handling the pCRII vector as loss of the 3 T-overhangs will cause a blunt-end self-ligation of the vector and subsequent decrease in ligation efficiency. Figure 2.18 shows an example of cDNA amplification of insert contained in vectors after MAX Efficiency DH5␣ Competent Cells transformation. While the amplification generates PCR product to be arrayed on membrane for the differential screening, it also provides an elimination step of false positive clones, i.e., bacteria colonies that may have either lost the vector or been transformed by more than one vector. Both techniques can be proceeded to insure an efficient cross-link of the cDNA on the membrane. First cross-link the DNA to the membrane using a UV linking device under 120 mJ and then bake the blots for 1–2 h at 70◦ C in an oven. Yield of larger fragments (>5–10 kb) can be increased by using prewarmed elution buffer (70◦ C): For elution, add prewarmed elution buffer and incubate at room temperature for 1 min before collecting.

Acknowledgments The author would like to acknowledge Dr Marie-France Palin, Dani`ele Beaudry, and Vickie Roussel for their invaluable assistance. This work was supported by a Discovery Grant from the Natural Sciences and Engineering Research Council of Canada to B.D. Murphy.

References 1. Wang, H. and Dey, S.K. (2006) Roadmap to embryo implantation: clues from mouse models. Nature 7, 185–199. 2. Lee, Y.L. and DeMayo, F.J. (2004) Animals models of implantation. Reproduction 128, 679–695. 3. Yoshinaga, K. and Adams, C.E. (1966) Delayed implantation in spayed, progesterone treated adult mouse. J Reprod Fertil 12, 593–595.

4. Gao, F., Lei, W., Diao, H.-L., Hu, S.J., Luan, L.-M. and Yang, Z.-M. (2007) Differential expression and regulation of prostaglandin transporter and metabolic enzymes in mouse uterus during blastocyst implantation. Fertil Steril 88(2), 1256–1265. 5. Jha, R.K., Titus, S., Saxena, D., Kumar, P.G. and Laloraya, M. (2006) Profiling of E-cadherin, ␤-catenin and Ca2+ in

Gene Expression in Embryonic Diapause

6.

7.

8.

9.

10.

11.

embryo-uterine interactions at implantation. FEBS Lett 580, 5653–5660. Xiao, L.-J., Yuan, J.-X., Song, X.-X., Li, Y.C., Hu, Z.-Y. and Liu, Y.-X. (2006) Expression and regulation of stanniocalcin 1 and 2 in rat uterus during embryo implantation and decidualization. Reproduction 131, 1137–1149. Song, H. and Lim, H. (2006) Evidence for heterodimeric association of leukemia inhibitory factor (LIF) receptor and gp130 in the mouse uterus for LIF signaling during blastocyst implantation. Reproduction 131(2), 341–349. Hamatani, T., Ko, MSh., Yamada, M., Kuji, N., Mizusawa, Y., Shoji, M., Hada, T., Asada, H., Maruyama, T. and Yoshimura, Y. (2006) Global gene expression profiling of preimplantation embryos. Hum Cell 19(3), 98–117 Reese, J., Das, S.K., Paria, B.C., Lim, H., Song, H., Matsumoto, H., Knudtson, K.L., DuBois, R.N. and Dey, S.K. (2001) Global gene expression analysis to identify molecular markers of uterine receptivity and embryo implantation. J Biol Chem 276(47), 44137–44145. Hansson, A. (1947) The physiology of reproduction in mink (Mustela vison) with special reference to delayed implantation. Acta Zoologica 28, 1–136. Murphy, B.D. and James, D.A. (1974) The effects of light and sympathetic innervation to the head on nidation in mink. J Exp Zool 187, 267–276.

61

12. Murphy, B.D., Concannon, P.W., Travis, H.F. and Hansel, W. (1981) Prolactin: the hypophyseal factor that terminates embryonic diapause in mink. Biol Reprod 25, 487–491. 13. Lopes, F.L., Demarais, J.A. and Murphy, B.D. (2004) Embryonic diapause and its regulation. Reproduction 128, 669–678. 14. Mead, R.A. (1989) The physiology and evolution of delayed implantation in carnivores. In J.L. Gittleman (Ed.) Carnivore behavior, ecology, and evolution (vol. 1, pp. 437–464). Ithaca, NY: Cornell University Press. 15. Diatchenko, L., Lau, Y.F., Campbell, A.P., Chenchik, A., Moqadam, F., Huang, B., Lukyanov, S., Lukyanov, K., Gurskaya, N., Sverdlov, E.D. and Siebert, P.D. (1996) Suppression subtractive hybridization: a method for generating differentially regulated or tissue-specific cDNA probes and libraries. Proc Natl Acad Sci USA 93, 6025–6030. 16. Chan, J., Kan, Y.W., Diatchenko, L., Vijaychander, S., Chenchik, A. and Siebert, P.D. (1997) Cloning differentially expressed genes from small amounts of total RNA with the Clontech PCR-Select cDNA Subtraction Kit. Clontechniques XII(1), 25–26. 17. Chenchik, A., Zhu, Y.Y., Diatchenko, L., Li, R., Hill, J. and Siebert, P.D. (1998) Generation and use of highquality cDNA from small amounts of total RNA by SMART PCR. In P. Siebert and J. Larrick (Eds.) Gene cloning and analysis by RT-PCR (pp. 305–319). MA: BioTechniques Books.

Chapter 3 Coculture of Decidua and Trophoblast to Study Proliferation and Invasion Marie Cohen and Paul Bischof Abstract Proliferation, migration, and invasion of trophoblastic cells into the maternal endometrium are essential steps of human embryo implantation and placentation. Trophoblast invasion is normally limited in time (first trimester) and space (to the endometrium and to the proximal third of myometrium). Temporal and spatial regulation of trophoblast invasion is mediated in an autocrine way by trophoblastic factors and in a paracrine way by uterine factors. Shallow trophoblast invasion is associated with pathologies including preeclampsia and fetal growth restriction whereas unlimited invasion is associated with hydatidiform moles and choriocarcinomas. In order to understand this important biological process and to characterize some of its regulatory factors, we have developed a model of coculture of decidual and cytotrophoblastic cells in which we can evaluate the effect of each partner on the proliferative and invasive properties of the other. Key words: Placentation, invasion, coculture, cytotrophoblast, decidua.

1. Introduction Proliferation, migration, and invasion of trophoblastic cells into the maternal endometrium are essential steps of human embryo implantation and placentation (1). Cytotrophoblast (CTB) cells proliferate and form columns of invasive CTB. These cells invade the decidualized endometrial stroma, the spiral arteries, the inner third of the myometrium, and thus, anchor the pregnancy inside the uterus. These invasive properties are tightly regulated both in time (during first and early second trimester of pregnancy) and in space. Invasion is mediated by paracrine and autocrine factors such as growth factors, cytokines, hormones, prostaglandins, Julie Lafond and Cathy Vaillancourt (eds.), Human Embryogenesis: Methods and Protocols, vol. 550 © Humana Press, a part of Springer Science+Business Media, LLC 2009 DOI 10.1007/978-1-60327-009-0 3 Springerprotocols.com

63

64

Cohen and Bischof

matrix metalloproteinases (MMPs), and other collagenases (2). Endometrial cells also play a major role during the interaction with the invading trophoblast. They change their morphology and secretion pattern during the secretory phase of the cycle and particularly during the window of implantation in preparation for invasion (3). In abnormalities such as preeclampsia, trophoblast invasion of the uterine spiral arteries does not proceed beyond the decidual portion of the spiral arteries (4) whereas unlimited invasion is associated with hydatidiform moles and choriocarcinomas. The process of embryo implantation and the interaction between maternal decidua and invading CTB cannot be studied in vivo and are difficult to mimic in vitro. After Kliman’s description of matrigel invasion by CTB (5), several in vitro models of coculture were developed to study the different factors that are involved in this process in vitro (6–9). Carver et al. described an in vitro model of embryo implantation using hatched blastocyst cultured on a confluent layer of stromal cells (10). Attachment and implantation of blastocyst into the stromal cell layers were observed by microscopy, and beta-hCG was quantified in supernatant of culture (10). Campbell et al. developed a bilayer coculture of CTB and decidual endothelial cells to study the maternal– fetal cell interaction (11). This model led them to suggest that maternal cells could contribute to the control of endovascular CTB invasion by regulating migration of CTB and matrix metalloproteinase 9 (MMP-9) secretion (12,13). Here, we describe a model of trophoblast invasion using cocultures of decidual cells and CTB.

2. Materials 2.1. Cell Isolation and Culture

1. Hank’s buffered Salt Solution (HBSS) (Gibco) supplemented with 1% (w/v) gentamycin (Gibco). 2. Trypsin cocktail for CTB isolation: 0.25% (w/v) trypsin (Difco, Brunschwig, Basel, Switzerland), 0.25 mg/mL DNase I (Roche, Basel, Switzerland), 0.025 M HEPES, 0.00425 M MgSO4 , 1% (v/v) fungizone (Gibco), 1% (w/v) gentamycin in HBSS (see Note 1). 3. Dulbecco’s Modified Eagle’s Medium (DMEM) (Gibco) supplemented with 10% fetal bovine serum (FBS, Seromed, Oxoid, Switzerland) and 1% gentamycin. 4. Discontinuous Percoll gradient is composed of 14 layers of Percoll (GE Healthcare) (from 70 to 5%) diluted with HBSS and stored at 4◦ C until use. 5. 100 and 40 ␮m filters.

Coculture of Decidua and Trophoblast

65

6. Monoclonal mouse anti-human CD45, Leukocyte Common Antigen (Dako). 7. Dynabeads M-280 sheep anti-mouse IgG (Dynal Biotech, Invitrogen). 8. Collagenase cocktail: collagenase A (Boehringer Ingelheim) is dissolved at 3 mg/mL in HBSS containing 1% gentamycin. 2.2. Immunocytochemistry

1. 2. 3. 4. 5. 6. 7. 8. 9.

2.3. Prolactin and Progesterone Analysis 2.4. Zymography

Cytoslides. Ethanol 70%, 4◦ C to fix cells. HBSS containing 0.1% of Triton X-100 is used for washing. HBSS containing 5% FBS is used for saturation of nonspecific sites. HBSS containing 5% bovine serum albumin (HBSS–BSA) is used to dilute antibody. Monoclonal mouse anti-vimentin, anti-cytokeratin-7 (Dako). Sheep anti-mouse IgG-horse radish peroxidase (Santa Cruz Biotechnology). Hydrogen peroxide (0.3%) in HBSS is conserved at 4◦ C and in the dark (see Note 2). Liquid DAB substrate chromogen system (DakoCytomation).

Culture supernatants are analyzed for progesterone and prolactin using the automated analyzer Kryptor (Brahms, Hennigsdorf, Germany). 1. Gelatin (Calbiochem) (see Note 3). 2. Lower buffer (4×): 1.5 M Tris–HCl, pH 8.7, 0.4% SDS. Store at room temperature. 3. Stacking buffer (4×): 0.5 M Tris–HCl, pH 6.8, 0.4% SDS. Store at room temperature. 4. Thirty percent acrylamide/bis solution (37.5:1), N,N,N,N -tetramethyl-ethylenediamine (TEMED) (Bio-Rad). 5. Ammonium persulfate (APS) is prepared at 10% solution in water and immediately aliquoted (100 ␮L) and stored at −20◦ C. 6. Running buffer: 25 mM Tris, 192 mM Glycine, 0.1% SDS, pH 8.6. 7. Triton X-100 dissolved in water at 2.5% is used to wash gels. 8. Phosphate-buffered saline pH 7.4 containing 140 mM NaCl2 , 2.7 mM KCl, 8 mM Na2 HPO4 , 1.5 mM KH2 PO4 , 0.1% MgCl2 , and 0.1% CaCl2 for washing and incubation of gels.

66

Cohen and Bischof

9. Coomassie blue: 0.1% Coomassie brilliant blue G250 (Fluka, Buchs, Switzerland) in 25% methanol, 10% acetic acid, H2 O. 10. Destain solution: 7.5% acetic acid, 5% methanol in water. 11. Mini-Protean II electrophoresis system (Bio-Rad). 2.5. Proliferation Test

2.6. Invasion Test

CellTiter 96 Aqueous One solution cell proliferation assay (Promega). Absorbance was recorded at 490 nm using a 96-well plate reader. 1. Rat tail collagen I (Sigma) is dissolved at 5 mg/mL in 100% acetic acid (stock solution) and stored at 4◦ C. 2. Coculture was done in 24 wells using transwell permeable polycarbonate membrane with pores of size 8 ␮m (Corning). 3. Cells are colored with a solution of 0.09% of crystal violet (Sigma) dissolved in ethanol. 4. Extraction of crystal violet is realized with distilled H2 O:ethanol:acetic acid (49:50:1) solution. 5. Record absorbance at 540 nm using a 96-well plate reader.

3. Methods 3.1. Isolation and Culture of Cytotrophoblastic (CTB) Cells

CTB cells are isolated from first trimester placentas. Our purification yield is about 10 million cells per mg of tissue. 1. Isolate fresh villous tissue (Fig. 3.1) specimens and wash several times in sterile HBSS pH 7.4. 2. Digest tissue enzymatically four times for 20 min at 37◦ C by trypsin cocktail. 3. Collect single cells at each digestion step, neutralize trypsin cocktail with FBS (10%), centrifuge for 5 min at 800g, and resuspend cells in DMEM. 4. Filter cell suspension using 100-␮m filter (see Note 4), centrifuge for 5 min at 800g, resuspend in DMEM without FBS before loading cell suspension (3 mL per gradient) onto the Percoll gradient, and centrifuge for 25 min at 1,200g without using a brake. 5. Collect the 30–45% bands which contain CTB (Fig. 3.2), wash twice with DMEM, and resuspend in DMEM. 6. Incubate cells with 2 mL of antibody anti-CD45 (dilution 1/20) at 4◦ C during 30 min. 7. Centrifuge cells (800g, 10 min), wash, and resuspend with 5 mL HBSS containing 0.1% of BSA and incubate cell suspension for 20 min at 4◦ C with the dynabeads M-280 particles previously washed twice in HBSS–BSA (100 ␮L of

Coculture of Decidua and Trophoblast

67

Fig. 3.1 Villous tissue of first trimester trophoblast.

Fig. 3.2 Gradient of Percoll after centrifugation of cell suspension for CTB isolation.

dynabeads in 5 mL of buffer) in order to eliminate contaminating leukocytes. After incubation, apply the test tube along the magnet to immobilize the leukocytes bound to the dynabeads and decant the supernatant. After immunopurification the cell suspension represents 90–97% cytotrophoblastic cells, with a 3–7% contamination by fetal stromal cells as verified by immunocytochemistry.

68

Cohen and Bischof

Fig. 3.3 Decidual tissue obtained from legal abortion material.

3.2. Isolation of Decidual Cells

3.3. Immunocytochemistry

1. Isolate decidual tissue (Fig. 3.3) from first trimester legal abortion material and wash it in sterile HBSS, mince it under sterile conditions, and digest tissue twice with collagenase solution during 30 min at 37◦ C. 2. Collect suspension and neutralize it with 10% FBS. 3. Pool supernatants, centrifuge it (1,000g, 10 min), and resuspend cells in DMEM. 4. Filter cell suspension using 40-␮m filter and seed cells into flasks. The obtained cells are cytokeratin negative, vimentin positive, and secrete prolactin in culture medium as verified by immunocytochemistry and culture supernatant analysis. 1. Immunocytochemistry is performed on the cytospin preparations of purified CTB or decidual cells. Centrifuge 100 ␮L of purified cells (1 × 106 cells/mL) onto glass slides in a cytocentrifuge at 80g for 1 min at room temperature. 2. Fix cells and store the slides in ethanol at 4◦ C. 3. Carry out all incubation steps in a humid chamber at room temperature. After fixation, wash the cells and permeabilize them three times for 5 min with HBSS containing 0.1% of Triton. 4. Block non-specific binding site with 5% (v/v) FBS in HBSS for 1 h at room temperature. 5. Remove blocking solution and replace it with antibodies anti-vimentin (1/200) or anti-cytokeratin-7 (1/200) overnight at 4◦ C. 6. Wash the slides three times with HBSS and incubate them with 0.3% hydrogen peroxide for 30 min at room temperature.

Coculture of Decidua and Trophoblast

69

7. Wash again the slides three times and incubate them with the appropriate horse radish peroxidase (HRP)-linked secondary antibody (2 h, room temperature). 8. After washing, stain the cells with DAB chromogen system according to the DakoCytomation’s procedure. 3.4. Invasion Assay

3.5. Proliferation Test

1. Cell invasion assay is performed in an invasion chamber based on the Boyden chamber principle. Each insert is fitted with an 8-␮m pore size polycarbonate membrane. 2. Coat the membrane filter of inserts with rat tail collagen I (5 ␮g/cm2 ). 3. Wash inserts in DMEM and incubate it for 30 min at room temperature. 4. For each well, add 5 × 105 CTB or 2.5 × 105 decidual cells or no cells (control for proliferation assay) in 100 ␮L of serum-free media to the upper compartment of the transwell chambers. Add 5 × 105 decidual cells or 1 × 106 CTB, respectively, or no cells (control for invasion assay) in 400 ␮L of serum-free media to the lower chamber. 5. Incubate cells for 72 h at 37◦ C in a 5% CO2 incubator. 6. After incubation, discard the supernatant and stain the viable cells that invaded collagen with 400 ␮L of crystal violet cell stain during 20 min at room temperature. 7. Rinse cells several times in water and while the insert is still moist, remove non-invading cells from the insert using a cotton-tipped swab (see Note 5). 8. Transfer the stained insert to a clean well containing 200 ␮L of a solution of H2 O:ethanol:acetic acid (49:50:1) for 20 min at room temperature. 9. Transfer 100 ␮L of the dye mixture to a 96-well microtiter plate for colorimetric measurement at 560 nm. Express data as the percentage of invading cells relative to the untreated (control:cultured alone) cells. Realize proliferation assay on the cells present in lower chambers at the end of the coculture (72 h). 1. Remove medium and replace it with 400 ␮L of serum-free medium containing 20% of CellTiter 96 Aqueous One solution reagent. 2. Incubate the plate for 3 h at 37◦ C in a humidified, 5% CO2 atmosphere. 3. Transfer 100 ␮L of the medium of each well in a 96-well plate and record the absorbance at 490 nm using a 96-well plate reader. Subtract the blank (medium containing 20% of CellTiter 96 solution) of the obtained values. Express the data as the percentage of cells relative to the control cells.

70

Cohen and Bischof

3.6. Zymography

1. This protocol assumes the use of a Mini-Protean II electrophoresis system, but it can easily be adapted to other systems. 2. Weigh 5 mg of gelatin into a glass tube and dissolve them in 2.08 mL distilled water at 37◦ C. Then, cool the solution on ice. 3. Prepare a 1-mm thick, 10% gel by mixing gelatin solution, 1.25 mL of lower buffer 4×, 1.67 mL of acrylamide solution, 17.6 ␮L of APS, and 2.5 ␮L of TEMED. Pour the gel, leaving space for the stacking gel, and overlay with water. 4. Prepare the stacking gel by mixing 1.8 mL of distilled water, 0.45 mL of acrylamide solution, 0.75 mL of upper buffer 4×, 12 ␮L APS, and 3 ␮L TEMED. Remove water on the top of the gel, and pour the stack and insert the comb. 5. Prepare samples by diluting 30 ␮L of supernatant with 5 ␮L of sample buffer 7×. 6. When the gel is polymerized, carefully remove the comb and wash the wells with running buffer, using a syringe, of 25 ␮L. 7. Add the running buffer to the upper and lower chambers of the gel unit and load 25 ␮L of each sample in a well.

Fig. 3.4 Gelatinase activities of CTB, decidual cells, or both cells. Influences of coculture on MMP-2 and -9 activities. Cells were cultured alone or cocultured during 48 h and 25 ␮L of culture supernatant was then loaded on zymogram.

Coculture of Decidua and Trophoblast

71

8. Complete the assembly of the gel unit and connect to a power supply in a cold room, 200 V, for about 45 min. 9. When the dye fronts are run off the gel, stop the migration and wash gels on a moving platform six times in 2.5% Triton X-100, 5 min, and three times, 10 min, in PBS at room temperature. 10. Incubate the gels in PBS overnight at 37◦ C (see Note 6). 11. Stain gel in Coomassie blue with shaking for about 45 min and destain. Proteolytic activity appears as clear bands on a blue background (see Note 7, Fig. 3.4).

4. Notes 1. The purification yield can significantly vary if trypsin solution is prepared too early. It is preferable to prepare trypsin the day of purification or alternatively, to keep trypsin at −80◦ C. The pH of solutions (HBSS and trypsin cocktail) is also very important and should be verified each time they are used. 2. Hydrogen peroxide is best stored in the dark at 4◦ C avoiding oxygenation. 3. Gelatin has to be “clean.” Avoid all sources of proteases contamination. 4. CTB can form aggregates, so it is important to resuspend correctly the cells before adding cell suspension on the filter. 5. Take care not to puncture the membrane but be sure to remove most of the cells on the inside perimeter to reduce background staining. 6. Specific inhibitors can be added to the incubation buffer (EDTA, PMSF, Phenanthrolin. . .). 7. Quantification of data can be done by scanning densitometry films. References 1. Red-Horse K, Zhou Y, Genbacev O, Prakobphol A, Foulk R, McMaster M, Fisher SJ. (2004) Trophoblast differentiation during embryo implantation and formation of the maternal-fetal interface. J Clin Invest 114, 744–754. 2. Bischof P, Meisser A, Campana A. (2000) Paracrine and autocrine regulators of trophoblast invasion. Placenta 21(Suppl A) S55–S60. 3. Gellersen B, Brosens IA, Brosens JJ. (2007) Decidualization of the human endometrium: Mechanisms, functions, and clinical perspectives. Semin Reprod Med 25, 445–453.

4. Brosens IA, Robertson WB, Dixon HG. (1972) The role of the spiral arteries in the pathogenesis of preeclampsia. Obstet Gynecol Annu 1, 177–191. 5. Kliman HJ, Feinberg RF. (1990) Human trophoblast-extracellular matrix (ECM) interactions in vitro: ECM thickness modulates morphology and proteolytic activity. PNAS 87(8), 3057–3061. 6. Vi´covac LJ, Genbacev O. (1988) Coincubation – an experimental approach to the study of decidual-trophoblast interaction. Placenta 9, 109–115. 7. Popovici RM, Betzler NK, Krause MS, Luo M, Jauckus J, Germeyer A, Bloethner S,

72

Cohen and Bischof

Schlotterer A, Kumar R, Strowitzki T, von Wolff M. (2006) Gene expression profiling of human endometrial-trophoblast interaction in a coculture model. Endocrinology 147, 5662–5675. 8. Ntrivalas E, Kwak-Kim J, Beaman K, Mantouvalos H, Gilman-Sachs A. (2006) An in vitro coculture model to study cytokine profiles of natural killer cells during maternal immune cell-trophoblast interactions. J Soc Gynecol Investig 13, 196–202. 9. Soghomonians A, Barakat AI, Thirkill TL, Douglas GC. (2005) Trophoblast migration under flow is regulated by endothelial cells. Biol Reprod 73, 14–19. 10. Carver J, Martin K, Spyropoulou I, Barlow D, Sargent I, Mardon H. (2003) An in-vitro model for stromal invasion during implanta-

tion of the human blastocyst. Hum Reprod 8, 283–290. 11. Gallery ED, Campbell S, Ilkovski B, Sinosich MJ, Jackson C. (2001) A novel in vitro co-culture system for the study of maternal decidual endothelial cell-trophoblast interactions in human pregnancy. BJOG 108, 651–653. 12. Campbell S, Rowe J, Jackson CJ, Gallery ED. (2004) Interaction of cocultured decidual endothelial cells and cytotrophoblasts in preeclampsia. Biol Reprod 71, 244–252. 13. Campbell S, Rowe J, Jackson CJ, Gallery ED. (2003) In vitro migration of cytotrophoblasts through a decidual endothelial cell monolayer: the role of matrix metalloproteinases. Placenta 24, 306–315.

Chapter 4 Isolation and Culture of Term Human Cytotrophoblast Cells and In Vitro Methods for Studying Human Cytotrophoblast Cells’ Calcium Uptake ´ erique ´ Fred Le Bellego, Cathy Vaillancourt, and Julie Lafond Abstract Human primary cytotrophoblast cell culture is a very useful model to study the endocrine and immunological functions of syncytiotrophoblasts, as well as the ion exchange between the mother and her fetus, like calcium. In this chapter, we expose the procedure to (1) isolate and purify the cytotrophoblast cells from human term placenta and (2) study syncytiotrophoblast calcium uptake. First, the methodology is based on the enzymatic dissociation of villous placental tissue, followed by Percoll gradient separation. Purity is assessed by flow cytometry using staining against cytokeratin-7, protein specific for trophoblast cells. Cell proliferation is evaluated by a Thiazolyl Blue Tetrazolium Bromide (MTT) assay, hormonal secretion is measured by enzyme-linked immunosorbent assay (ELISA), and fusion is estimated by immunofluorescence using staining against desmosomal proteins. Second, we describe the calcium uptake experiment using the cytotrophoblast cells in culture. Key words: Calcium uptake, cell culture, cytotrophoblast cells, hormonal secretion, human, placenta, proliferation, syncytiotrophoblast.

1. Introduction The placenta is an autonomous and transient organ indispensable for the maintenance of pregnancy and maternal–fetal exchange. Human placenta is not exclusively a barrier; it can also transform stock or distribute various elements that are essential to the fetus. The syncytiotrophoblast represents the most important maternal– fetal barrier (1). It is a multifunctional cell involved in nutrient transport, absorption, exchanges, and specific hormonal secretion such as human chorionic gonadotropin (hCG) and human placental lactogen (hPL). In the context of maternal–fetal exchange, Julie Lafond and Cathy Vaillancourt (eds.), Human Embryogenesis: Methods and Protocols, vol. 550 © Humana Press, a part of Springer Science+Business Media, LLC 2009 DOI 10.1007/978-1-60327-009-0 4 Springerprotocols.com

73

74

Le Bellego, Vaillancourt, and Lafond

calcium is vital for fetal skeletal mineralization and many cellular functions such as cell signaling, enzymatic functions, neurotransmitter/hormone release, and muscular contraction. Thus, an increasing amount of calcium must be transported to the fetus across the human placental trophoblast epithelium to support fetal growth throughout gestation, especially during third trimester where the majority of calcium is deposited in fetal bone. The syncytiotrophoblast is a single continuous polynucleated structure that (2) formed during implantation, characterized by a brush border membrane facing maternal circulation and a basal plasma membrane facing the fetal circulation (3). The villous cytotrophoblast cells are continuously incorporated, by syncytial fusion, into the syncytiotrophoblast. Therefore, the maternal– fetal exchanges are complex mechanisms that could be affected by many intrinsic factors, such as substrate, cell proteins interacting with transporters or by extrinsic factors, such as hormones. The study of the behavior of the cytotrophoblast cells in culture is essential for the understanding of the placental functions. There are a few trophoblastic cell lines that are commercially available such as JEG-3, JAR, or BeWo. They all come from choriocarcinoma, proliferate, and the syncytial fusion needs to be induced (4, 5). These cell lines do not reflect exactly the normal behavior of the cytotrophoblast cells. The other way to study the cytotrophoblastic function is to establish primary cell culture from placenta. This organ presents numerous benefits for cell isolation and culture compared to other human tissues. The placenta represents a large reservoir of materials for isolation of trophoblast cells compared to biopsies, the usual way to obtain human alive tissue. From 30 g of placenta, at least 150 million cells can be obtained per preparation and from one placenta, two preparations can easily be realized. Kliman et al. (6) developed a method in order to isolate and purify cytotrophoblast cells, based on the digestion of villous tissue in a combination of trypsin and DNase I, followed by density Percoll gradient separation to isolate cytotrophoblast cells and discard cellular debris, red blood cells, and multinucleated cells. This procedure was used and adapted by different investigators (7–10). In our laboratory, we adapted the procedure and seeded the cells directly in culture. We evaluated the purity by flow cytometry assay using fluorescein isothiocyanate (FITC)-conjugated monoclonal antibody against cytokeratin-7 (10, 11). It has been reported that anti-cytokeratin-7 antibody was specific for trophoblast cells (12, 13). The rate of purity is usually about 96–98%. Some investigators used a negative selection procedure with antibody-conjugated beads to eliminate noncytotrophoblast cells; antibodies including anti-class I and class II human leukocyte antigen (HLA), tetraspanin family member CD9, or hepatocyte growth factor activator inhibitor (HAI)-1

Villous Cytotrophoblast Cells Culture

75

(7, 9, 14, 15). Once in culture, cytotrophoblast cells rapidly lose the capacity to proliferate (16) and spontaneously differentiate in syncytium and secrete detectable amounts of hCG and hPL (17). Here, we describe the isolation and the culture of cytotrophoblast from term placenta. We describe also the purity evaluation assay, a proliferation assay, the cell differentiation evaluation protocol, and finally, the calcium uptake assay that was carried out on these culture cells.

2. Materials 2.1. Isolation and Culture of Purified Trophoblast Cells 2.1.1. Equipment

1. Sterile field sheets. 2. Sterile Pyrex dish for placental dissection (21 × 30 cm). 3. Sterile Metzenbaum scissors (14 cm, Fisher Scientific, Ottawa, ON, Canada). 4. Sterile pointed scissor (14 cm, Fisher Scientific). 5. Sterile fine-toothed forceps (14 cm, Fisher Scientific). 6. Plastic weight boats for tissue collection, pre-weighted. 7. 1-L plastic beaker. 8. 4-L bottle for liquid waste. 9. Three sterile 100-mL bottles for digestion medium (Corning, Lowell, MA, USA). 10. Sterile 250-mL bottle for culture medium (Corning). 11. Sterile 250-mL trypsinizing flasks for tissue dissociation (Bellco, Vineland, NJ, USA). 12. Sterile 250-mL beaker for the products of digestion. 13. Borosilicate glass Pasteur pipettes 14 and 22.5 cm (Fisher Scientific). 14. 10-mL serological pipettes. 15. 12 × 75 borosilicate disposable culture tubes for Percoll gradients preparation. 16. 15-mL and 50-mL polystyrene centrifuge tubes for cell suspension centrifugation. 17. 50-mL clear polyethylene terephthalate (PET) centrifuge tube for Percoll gradient (Corning). 18. Benchtop shaking water bath at 37◦ C for tissue digestion (for example, Shaking Water Bath, SWB20, Haake, Karlsruhe, Germany). 19. Water bath at 37◦ C for medium warming (Fisher Scientific). 20. Peristaltic pump (for example, Peristaltic Pump P-1, Pharmacia Biotech, Piscataway, NJ, USA) for Percoll gradient. 21. Hemocytometer for cell counting (VWR Scientific, Montreal, QC, Canada). 22. Biohazard bags.

76

Le Bellego, Vaillancourt, and Lafond

2.1.2. Solutions

1. Transport buffer for placenta transport (from hospital to laboratory): 13.34 g Dulbecco’s Modified Eagle’s Medium (DMEM) high glucose without HEPES, 5.95 g HEPES, 3.7 g NaHCO3 , 300,000 U penicillin G (180.94 mg), 50 mg gentamicin sulfate, 5 mg amphotericin B in deionized H2 O to yield 900 mL, pH at 7.0, and complete volume at 1 L. Filter to sterilize (0.2-␮m filter). Freshly made transport buffer could be stored at −20◦ C and kept at +4◦ C until use (7 days maximum). 2. Saline buffer (0.9% NaCl) for wash: 9 g NaCl in deionized H2 O to yield 1 L. Need about 5 L per preparation. 3. Ca/Mg-free Hank’s Buffered Salt Solution (HBSS) (CMFHBSS): 9.52 g HBSS (without Ca2+ and Mg2+ ) and 25 mL 1 M HEPES in 900 mL H2 O, pH at 7.4, and complete volume at 1 L. Filter to sterilize (0.2-␮m filter). Store at +4◦ C until use. 4. Trypsin type I, usually 8,550 U/mg (cat. no. T8003; Sigma, Oakville, ON, Canada) is aliquoted and stored at −20◦ C. It is warmed at room temperature and weighted according to the different amounts of trypsin for the four digestions in individual weight boat. Store at +4◦ C until use: a. b. c. d.

Digestion I: 1,824,000 U, weight 213 mg. Digestion II: 1,200,000 U, weight 140 mg. Digestion III: 960,000 U, weight 112 mg. Digestion IV: 960,000 U, weight 112 mg.

5. DNase type IV, 2,000 U/mg (cat. no. 10104159001; Roche-Applied Sciences, Laval, QC, Canada): 100 mg DNase type IV in 1 mL of CMF-HBSS. Store at 4◦ C until use. For each digestion stage: a. b. c. d.

Digestion I: 75,000 U: 375 ␮L. Digestion II: 50,000 U: 250 ␮L. Digestion III: 38,000 U: 190 ␮L. Digestion IV: 38,000 U: 190 ␮L.

6. Dispase stored at −20◦ C. Thaw 10 mL of dispase aliquot. 7. 100 mM calcium chloride (CaCl2 ): 0.555 g CaCl2 in 50 mL deionized H2 O. 8. 800 mM magnesium sulfate (MgSO4 .7H2 O): 9.852 g MgSO4 in 50 mL deionized H2 O. 9. Enzyme digestion medium: Just prior to each digestion stage, add the appropriate amount of trypsin, DNase, dispase, CaCl2 , and MgSO4 .7H2 O to the pre-warmed CMFHBSS (Table 4.1). 10. Phosphate Buffer Saline (PBS):

Villous Cytotrophoblast Cells Culture

77

Table 4.1 Preparation of enzyme digestion buffer Digestion CMF-HBSS (mL) Trypsin (mg) DNase (␮L) Dispase (mL) CaCl2 (␮L) MgSO4 (␮L) I

150

213

375

2.5

150

150

II

100

140

II

75

112

25

2.5

100

100

19

2.5

75

75

IV

75

112

19

2.5

75

75

a. First prepare the Sodium Phosphate Buffer: i. 0.2 M NaH2 PO4 : 2.4 g NaH2 PO4 in 100 mL H2 O. ii. 0.2 M Na2 HPO4 : 5.68 g Na2 HPO4 in 200 mL H2 O. iii. 160 mL 0.2 M Na2 HPO4 with 0.2 M NaH2 PO4 (about 40 mL). Adjust pH to 7.4. b. PBS (10 mM Sodium Phosphate Buffer, 150 mM NaCl): combine 50 mL Sodium Phosphate Buffer, 8.8 g NaCl, complete volume at 1 L with deionized H2 O. Filter to sterilize (0.2-␮m filter). 11. Fetal Calf Serum (FCS) for cell suspension after digestion centrifugation: FCS density is measured for each new 500mL FCS bottle. To define the density (d1) of the FCS, weigh several times 1 mL FCS with a volumetric pipette. FCS is divided into aliquot and each aliquot is adjusted at a density (d2) of 1.017 g/mL with sterile PBS; 35 mL of FCS mixed with PBS is needed for one placenta preparation. The following formula calculates the volume of PBS to be added to the aliquot of FCS:

d2 =

d1V s + V p Vs + Vp

Vp =

d2V s − d1V s −0.017

Vs = CS initial volume Vp = PBS volume to add 12. Cell suspension medium: 13.37 g DMEM high glucose without HEPES, 5.958 g HEPES, 3.7 g NaHCO3 in 900 mL deionized H2 O. Adjust pH at 7.4 and complete volume at 1 L. Filter to sterilize (0.2-␮m filter). 13. 10× HBSS: 5.36 mM KCl (4 g), 4.4 mM KH2 PO4 (0.6 g), 1.37 M NaCl (80 g), 3.37 mM Na2 HPO4 (0.4788 g), 55.5 mM D-glucose (10 g) in deionized H2 O to yield 1 L solution. Filter to sterilize (0.2-␮m filter). 14. Percoll gradient (cat.no. P1644, Sigma): Percoll gradient is prepared freshly during the first enzymatic digestion.

78

Le Bellego, Vaillancourt, and Lafond

a. Prepare a 90% Percoll stock solution: 18 mL Percoll (stored at 4◦ C, mix well before use) and 2 mL 10× HBSS. b. In 12 × 75 borosilicate disposable culture tubes, prepare the dilution of the Percoll using the 90% stock solution and CMF-HBSS (Table 4.2). c. Mix well each solution. Beginning with the 70% tube, with a slow peristaltic pump (1 mL/min) layer each Percoll solution into a 50-mL PET centrifuge tube using side of the tube to add solutions. Store the gradient at room temperature away from disturbance. 15. Cell culture medium: 174 mL cell suspension medium, 10% fetal bovine serum (FBS) (20 mL), 4 mM glutamine (4 mL), 1× penicillin–streptomycin–neomycin (PSN) (2 mL). Filter to sterilize (0.2-␮m filter). 2.2. Cell Culture Purity Evaluation

1. Cold methanol stored at −20◦ C to fix the cells. 2. 1× HBSS: 10 mL 10× HBSS (see Section 2.1.2, Step 13) and 90 mL deionized H2 O. 3. 1× HBSS containing 50:1 FBS: Combine 2 mL 1× HBSS and 40 ␮L FBS. 4. 1× HBSS–0.2% BSA: 10 mL 1× HBSS and 20 mg BSA. Store and keep at 4◦ C. 5. Antibody anti-cytokeratin-7 FITC-conjugated (Abcam Cambridge, MA, USA).

Table 4.2 Preparation of Percoll gradient solutions Concentration (%)

90% Percoll (mL)

CMF-HBSS (mL)

70

2.33

0.67

65

2.17

0.83

60

2.00

1.00

55

1.83

1.17

50

1.67

1.33

45

1.50

1.50

40

1.33

1.67

35

1.17

1.83

30

1.00

2.00

25

0.83

2.17

20

0.67

2.33

15

0.50

2.50

10

0.33

2.67

5

0.17

2.83

Villous Cytotrophoblast Cells Culture

79

6. 1× HBSS–BSA–anti-cytokeratin-7: 200 ␮L 1× HBSS–0.2% BSA and 6.25 ␮L anti-cytokeratin-7 FITC (1.25 ␮g antibody per million of cells). Prepare fresh and keep in the dark until used. 7. 1.5-mL microtubes. 8. 5-mL polystyrene tubes (Falcon–Becton Dickinson, Oakville, ON, Canada). 9. Flow cytometer (for example, FACScan system using CellQuest software; Becton Dickinson). 2.3. Trophoblast Differentiation Evaluation by Immunofluorescence Staining

1. Eight-well Lab-TekTM chambered coverglass (Nunc Brand, Rochester, NY, USA) or 24-well plate. 2. Serum of the species in which the secondary antibody is raised or FBS to block non-specific sites. In our case, we used mouse serum. 3. Cold methanol stored at −20◦ C to fix the cells. 4. PBS (see Section 2.1.2, Step 10). 5. Wash solution: PBS, 0.2%, Tween-20, 0.1% serum. 6. Mouse monoclonal anti-desmosomal cytokeratin antibody. 7. Alexa Fluor 488 goat anti-mouse IgG (Molecular Probes, Eugene, OR, USA). 8. 300 nM DAPI (4,6-diamidino-2-phenylindole) in PBS or 50 ␮g/mL propidium iodide in PBS. 9. ProLong Gold antifade reagent (cat. no. P36930; Invitrogen, Burlington, ON, Canada) as mounting reagent. R 10. Cold Tissue-Tek OCT (4◦ C). R ). 11. 3 MM paper (Whatman

2.4. Hormonal Secretion Analysis

1. ELISA kit specific for hCG (cat. no. EIA 1911; DRG Diagnostics, Windham, NH, USA). 2. ELISA kit specific for hPL (cat. no. EIA 1283; DRG Diagnostics). 3. Multichannel pipette. 4. Precision pipettes, 50, 100 and 150 ␮L. 5. A microtiter plate reader at 450 nm wavelength (for example, Model 550 microplate reader; BioRad, Mississauga, ON, Canada).

2.5. Proliferation Assay

1. Thiazolyl Blue Tetrazolium Bromide (MTT) (Sigma): stock solution at 5 mg/mL in sterile deionized H2 O. 2. Dimethyl sulfoxide (DMSO). 3. DMEM without red phenol (cat. no. D5030; Sigma). 4. PBS (see Section 2.1.2, Step 10) to wash cells. 5. Microtiter plate reader at 570 nm wavelength (for example, Model 550 microplate reader; BioRad).

80

Le Bellego, Vaillancourt, and Lafond

2.6. Calcium Uptake Assay

1. PBS: 137 mM NaCl (8 g), 8 mM Na2 HPO4 (1,144 g), 0.1 mM CaCl2 (0.1 g), 2.7 mM KCl (0.2 g), 1.5 mM KH2 PO4 (0.2 g), and 0.5 mM MgCl2 •6H2 O (0.1 g) in deionized H2 O to yield 900 mL, adjust pH at 7.4, and complete volume at 1 L. Filter to sterilize (0.2-␮m filter). 2. Cold wash buffer: PBS containing 4 mM EGTA: Dissolve 0.152 g EGTA in 90 mL PBS. Adjust pH at 7.4 and complete volume at 100 mL. Prepare fresh and keep at 4◦ C until use. 3. Uptake buffer: 9.80 g HBSS containing 1.26 mM CaCl2 , 10 mM HEPES (2.383 g), and 1% BSA (1 g) in deionized H2 O to yield 900 mL, adjust pH at 7.4, and complete volume at 1 L. 4. 5 mCi Calcium-45 (Ca45 ) (MP Biomedicals, Irvine, CA, USA). 5. Ca uptake buffer: 5 ␮Ci of Ca45 in 250 ␮L uptake buffer per well. 6. 0.5 M NaOH: Dissolve 2 g NaOH in 100 mL deionized H2 O. 7. Water bath at 37◦ C. 8. Vacuum pump. 9. Bottle for radioactive liquid waste. 10. Biohazard bags for radioactive solid waste. 11. Pipette (10 and 100 ␮L). 12. Beaker. 13. Biodegradable counting scintillant (BCS) (cat. no. NBCS104; Amersham, Piscataway, NJ, USA). 14. Disposable tubes and caps for radioactivity counting. 15. ␤-Scintillation counter (for example, Liquid Scintillation Analyzer Tri-Carb 2800TR, Perkin–Elmer, Waltham, MA, USA). 16. Bicinchoninic acid (BCA) reagent.

3. Methods 3.1. Isolation and Culture of Purified Trophoblast Cells 3.1.1. Initial Steps

1. Warm up trypsin and DNase at room temperature. 2. Thaw PSN 100×, dispase, and FCS aliquots and warm up CMF-HBSS and cell suspension medium in water bath at 37◦ C. 3. Complete the aliquot of FCS with PBS to obtain the desired density. 4. To 100 mL cell suspension medium, add 2 mL PSN 100× and keep it at 37◦ C in water bath.

Villous Cytotrophoblast Cells Culture

81

5. Prepare four bottles with different volumes of CMF-HBSS for each digestion (see Table 4.1) and keep them at 37◦ C. The different products will be added just before each digestion. 3.1.2. Isolation of Trophoblast Cells

1. Begin the preparation of isolation of trophoblast cells less than 4 h after delivery (see Note 1). Keep the placenta on ice in the transport buffer until use. Collect morphological information (weight, size, color, membrane integrity, information on the umbilical cord, and any pathological symptoms such as calcification, hematoma, and lipid steatosis). 2. Place the placenta on Pyrex dish, maternal face side up. Using sterile pointed scissor, cut a thin “piece-shaped edge pie” of tissue, from maternal to fetal surface containing the insertion of umbilical cord and store it in formalin for Hospital Labor Floor staff. 3. Cut away fetal and maternal membranes. Collect histological, RNA, and protein samples (see Note 2). Cut up the placenta into 2.5 cm3 , selecting the softest, thickest portions. Make sure that all pieces go from maternal to fetal surface. Place the pieces in the 1-L plastic beaker. Thoroughly rinse tissue with saline buffer by agitating tissue in solution at room temperature. Do not squeeze tissue. Drain carefully the liquid in the bottle for liquid waste between rinses. To remove blood, wash until the tissue becomes light pink. Keep the pieces of placenta in saline buffer. 4. Place one piece of placental tissue at a time on several paper towels. Using a Metzenbaum scissors, cut small pieces of soft villous tissue from the core of placental chunk, avoiding fibrous tissue and vessels. Collect between 30 and 35 g into a plastic weigh boat. Mince tissue until pieces are about 0.2 cm. Tissue is ready for the enzymatic digestion. Transfer the minced placental tissue into a 250-mL trypsinization flask. 5. First digestion: Prepare the enzyme digestion buffer I (see Table 4.1) and add 1 mL of 100× PSN, mix well, and transfer into the 250-mL trypsinization flask containing the tissue. Mix well and place into shaking water bath. Water in bath should be at least as high as solution in flask to insure uniform warming. Shaking speed is set at no more than 50 cycles/min. Remove trypsinization flask from bath every 5 min and swirl vigorously to resuspend tissue. At the end of 30 min, remove trypsinization flask and place it on the side, allowing tissue fragments to settle for 1 min. With a sterile and clean 10-mL pipette, slowly remove supernatant from just below the surface at a point which is farthest away from tissue fragments. Transfer 81 mL of supernatant to a beaker and discard it in liquid biohazard (see Note 3).

82

Le Bellego, Vaillancourt, and Lafond

6. Second digestion: Prepare the enzyme digestion medium II (see Table 4.1), add it into the 250-mL trypsinization flask containing tissue fragments, and return into shaking water bath for 30 min and swirl suspension every 5 min. Remove trypsinization flask and place it on the side. Allow tissue fragments to settle for 1 min. Collect 81 mL of supernatant in a beaker and dispatch 13.5 mL of supernatant into 6 × 15-mL centrifuge tubes. To stop enzyme digestion, lay down at the bottom of each 15-mL tube, very carefully, about 1.5 mL of CS+PBS with 22.5-cm Pasteur pipette to fill up to 15 mL. Centrifuge the six tubes at 1,250g without using brake for 15 min at 25◦ C. Resultant pellet should reveal a lower red blood cell band and then a white upper band. The white band contains the trophoblast. Remove and discard supernatants from the six tubes, taking care not to aspirate off the white band. Remove all the white fluffy material at the CS interface, this material contains precipitated trypsin and DNase. Resuspend each pellet with 1 mL of warm cell suspension medium which contains PSN. Pool into two sets of three tubes each, lightly capped, and set aside at room temperature. 7. Third digestion: Repeat Step 6. 8. Fourth digestion: Repeat Step 6. Collect the supernatant as much as possible (130–140 mL). Pool the pellet into two sets of five tubes each. Result is six tubes containing pooled pellets. 9. Fill up the six tubes with cell suspension medium with PSN at 15 mL. Centrifuge at 1,250g without using brake for 10 min at 25◦ C. Remove and discard supernatants taking care not to remove any of the white upper bands. Resuspend pellets with 1 mL cell suspension medium with PSN. Pool all cell suspensions, the final volume should not exceed 10 mL. 10. Lay very carefully cell suspension onto Percoll gradient with 14-cm Pasteur pipette. Centrifuge at 509g without using the brake for 25 min at 25◦ C. Handle carefully gradient tube from centrifuge and place into support in completely upright position. 11. Aspirate fluffy white upper band, usually between 25 and 35 mL marks on tube with Pasteur pipette connected to vacuum (Fig. 4.1). The trophoblast are between 25 and 15 mL marks on tube and are separated into three bands: a large one around mark 22.5 mL and two thin ones at 18 and 15 mL marks on tube. Using a Pasteur pipette fitted with a bulb, collect manually the large and the two thin bands into 50-mL polystyrene centrifuge tube (see Note 4).

Villous Cytotrophoblast Cells Culture

83

Fig. 4.1 Schematic representation of locations of diluted Percoll solutions and cell types.

12. Dilute the collected cell fractions fourfold with cell suspension medium with PSN and centrifuge at 1,250g for 10 min at 25◦ C with brake. From this point, work under sterile conditions. Remove and discard supernatant and resuspend pellet with 20 mL of the cell culture medium. 13. Dilute 10 ␮L of cell suspension in 10 ␮L trypan blue. Count cell solution twice with hemocytometer. Dilute suspension to desired concentration with cell culture medium. 14. Seed cells at 0.25 million cells per well for a 96-well plate, 1.5 million cells per well for a 24-well plate, 4.5 million cells per well for a 6-well plate, and incubate cells at 37◦ C in 5% CO2 . 15. Change medium every day. 3.2. Cell Culture Purity Evaluation

1. Before seeding of cells on plates, sample 1×106 cells in two microtubes, one for positive staining and the other for negative control. Complete volume at 1 mL with cell culture medium and centrifuge at 4,500g for 10 min at 4◦ C. Remove carefully and discard the supernatant.

84

Le Bellego, Vaillancourt, and Lafond

2. Add 1 mL of cold methanol to each tube to fix the cells, resuspend the cells, and incubate for 20 min at −20◦ C. 3. Centrifuge at 4,500g for 10 min at 4◦ C. Remove carefully and discard the supernatant. Wash twice the cells with 1 mL 1× HBSS. Between each wash, centrifuge at 4,500g for 10 min at 4◦ C. Remove carefully and discard the supernatant. At this point, you can store the cells for a few days at 4◦ C. 4. Add 1 mL 1× HBSS containing 50:1 FBS per tube to block non-specific antigen sites. Resuspend the cells and incubate for 30 min at room temperature. 5. Repeat Step 3. Wash only one time. 6. Stain the cells of positive tube by adding 200 ␮L 1× HBSS– BSA–anti-cytokeratin-7 and add 200 ␮L 1× HBSS–BSA to the negative tube. Incubate for 45 min at room temperature in dark. 7. Repeat Step 3. 8. Resuspend cells in 500 ␮L 1× HBSS and transfer cell suspension into flow cytometry tube and proceed flow cytometry analysis. 9. A cell preparation is considered to be pure with a minimum of 96% of positive cells staining with the anti-cytokeratin-7 antibody. 3.3. Trophoblast Differentiation Evaluation by Immunofluorescence Staining

1. Cells have been seeded and cultured on 24-well plate or 8-well Lab-TekTM chambered coverglass. 2. Remove supernatant and wash three times with PBS. 3. Fix cells with cold methanol. Incubate for 20 min at −20◦ C. Wash three times with PBS. Cells can be kept at 4◦ C in PBS 0.01% NaN3 . 4. Block with PBS–2% mouse serum to saturate fragmentcrystallizable (Fc) receptor sites in tissue that can bind, nonspecifically, the secondary antibody. FBS can be used instead of serum. Incubate for 1 h at room temperature. Do not wash. 5. Add anti-desmosomal cytokeratin antibody (1:800) in PBS–2% mouse serum. Incubate for 1 h at room temperature or overnight at 4◦ C. Wash three times with wash solution. 6. Add Alexa Fluor 488 goat anti-mouse IgG (1:1000) in PBS–2% mouse serum. Incubate for 1 h at room temperature. Wash three times with wash solution. Wash two times with PBS. 7. Add DAPI (or propidium iodide) to stain the nucleus. Incubate for 5 min at room temperature in DAPI or 30 min at room temperature in propidium iodide. Wash three times with PBS. 8. Mount with the ProLong Gold antifade reagent and store the plate at 4◦ C protected from light until viewing.

Villous Cytotrophoblast Cells Culture

3.4. Hormonal Secretion Analysis

3.5. Proliferation Assay

3.6. Calcium Uptake Assay

85

1. Collect supernatant each day of culture. Centrifuge at 12,000g for 20 min at 4◦ C. Divide the supernatant into different aliquots. 2. Use the ELISA kit for hCG and hPL secretion assays and follow manufacturer’s instructions. 3. For hCG assay, without any treatment during cell culture, supernatant samples from day 1 and day 2 of culture do not need to be diluted. Samples from day 3 and day 4 need to be diluted tenfold with sample diluents (from the ELISA kit). For hPL assay, samples do not need to be diluted. MTT is a yellowish solution and is converted to water-insoluble MTT formazan of dark blue color by mitochondrial dehydrogenases of living cells. 1. Seed cells on 96-well plate. 2. Remove and discard supernatant and wash cells with PBS to remove all traces of culture medium. 3. Add 10 ␮L of MTT (5 mg/mL) and 100 ␮L of D-MEM to each wells, do in duplicate or triplicate. Incubate for 1 h in cell incubator at 37◦ C. Remove the solution and add 100 ␮L of DMSO. Homogenize well the DMSO and the dark blue crystals in each well. 4. Read the intensity of the coloration with an ELISA plate reader at a wavelength of 570 nm. The optical density is proportional to the number of living cells. 1. Cells are seeded in 24-well plate and cultured for 1–4 days. 2. For the experiment, the culture plate is kept at 37◦ C in the water bath. 3. Wash cells twice with 500 ␮L uptake buffer. 4. Incubate the cells with 500 ␮L uptake buffer for 10 min to equilibrate medium. 5. Add 250 ␮L of radioactive 45 Ca uptake buffer (5 ␮Ci/well) for the desired number of times. Remove the Ca uptake buffer using the vacuum pump. 6. Rapidly wash cells three times with 500 ␮L/well of cold wash buffer. Remove the entire buffer between each wash and especially the last one. 7. Add 500 ␮L of 0.5 M NaOH to solubilize the proteins. Incubate for at least 15 min at 37◦ C. 8. About 250 ␮L of this last NaOH–protein solution is used to determine the cell-associated radioactivity (Ca uptake by cells). Add the scintillation liquid and use a ␤-scintillation counter to measure the radioactivity. 9. About 250 ␮L of this last NaOH–protein solution is used to determine the protein amount by a BCA assay with BSA as standard (see Note 5).

86

Le Bellego, Vaillancourt, and Lafond

10. The calcium uptake is presented as nmol of Ca from specific activity per mg of cellular protein.

4. Notes 1. In Canada, term placentas can be obtained and the collection of additional information about the medical background of the patient is subject to ethic politics and investigators must go through the local ethic committees’ rules to obtain the patient’s consent. 2. Tissue collection for histological, RNA, and protein samples is made after the maternal and fetal membranes are removed and before the tissue dissociation. For the histological samples, cut sections of 5 mm3 in different areas of the placenta, set down pieces on absorbent paper and clean up the R blood, embed tissue with a drop of cold Tissue-Tek OCT. R ◦  (4 C) on a strip of Whatman paper, immerse the tissue for 20 s in frozen isopentane (2-methylbutane) (−80◦ C), R until Tissue-Tek is white and store pieces at −80◦ C embedded in aluminium foil. For RNA and protein samples, collect small pieces of tissue from several cotyledons (5–10) to have a good representation of the total placenta (18). For RNA sample, tissues are embedded in RNA later stabilization reagent (Qiagen, Mississauga, ON, Canada) in an RNase-free container, frozen in liquid nitrogen, and stored at −80◦ C. Protein samples are directly frozen in liquid nitrogen and subsequently transferred into sterile tubes for storage at −80◦ C. 3. First digestion is discarded because it contains different types of cells. 4. The ideal way to remove cytotrophoblast bands is as follows: depress bulb completely, place pipette at the top of the solution above band, slowly aspirate while moving pipette around circumference of centrifuge tube, and slowly moving pipette down to stay at top of solution. Do not stop aspiration once started, do not push solution back down once started, and do not place pipette much below the top of the gradient solution. Lift pipette cleanly away from the gradient solution while still applying some vacuum to pull solution into pipette. Make sure to not collect material below this band, this will lead to increase in contamination with other cell types (in order: macrophages, neutrophils, lymphocytes, red blood cells). 5. The BCA protein assay combines the reduction of Cu2+ to Cu1+ by protein in an alkaline medium with the colorimetric detection of Cu1+ by bicinchoninic acid (BCA) (19).

Villous Cytotrophoblast Cells Culture

87

Acknowledgments F. Le Bellego holds a fellowship from Canadian Institute of Health Research (CIHR) funded Strategic Training Initiative in Research in Reproductive Health Sciences (STIRRHS). References 1. J. D. Boyd (1970) The human placenta. Cambridge University Press, Cambridge, MA. 2. A. Malassine and L. Cronier (2002) Hormones and human trophoblast differentiation: a review. Endocrine 19, 3–11. 3. F. Teasdale and G. Jean-Jacques (1985) Morphometric evaluation of the microvillous surface enlargement factor in the human placenta from mid-gestation to term. Placenta 6, 375–81. 4. R. A. Olli, H. J. Rajaniemi, R. Rydbeck and K. Metsikko (1993) Polarity and fusion of JAR choriocarcinoma cells as assessed by enveloped viral glycoproteins. Exp Cell Res 206, 276–82. 5. A. Vargas, J. Moreau, F. Le Bellego, J. Lafond and B. Barbeau (2008) Induction of trophoblast cell fusion by a protein tyrosine phosphatase inhibitor. Placenta 29, 170–74. 6. H. J. Kliman, J. E. Nestler, E. Sermasi, J. M. Sanger and J. F. Strauss, III (1986) Purification, characterization, and in vitro differentiation of cytotrophoblasts from human term placentae. Endocrinology 118, 1567–82. 7. G. C. Douglas and B. F. King (1989) Isolation of pure villous cytotrophoblast from term human placenta using immunomagnetic microspheres. J Immunol Methods 119, 259–68. 8. L. J. Guilbert, B. Winkler-Lowen, R. Sherburne, N. S. Rote, H. Li and D. W. Morrish (2002) Preparation and functional characterization of villous cytotrophoblasts free of syncytial fragments. Placenta 23, 175–83. 9. A. J. Potgens, H. Kataoka, S. Ferstl, H. G. Frank and P. Kaufmann (2003) A positive immunoselection method to isolate villous cytotrophoblast cells from first trimester and term placenta to high purity. Placenta 24, 412–23. 10. R. Moreau, G. Daoud, R. Bernatchez, L. Simoneau, A. Masse and J. Lafond (2002) Calcium uptake and calcium transporter expression by trophoblast cells from human term placenta. Biochim Biophys Acta 1564, 325–32. 11. F. M. Campbell, P. G. Bush, J. H. Veerkamp and A. K. Dutta-Roy (1998) Detection and

12.

13.

14.

15.

16.

17.

18. 19.

cellular localization of plasma membraneassociated and cytoplasmic fatty acid-binding proteins in human placenta. Placenta 19, 409–15. T. Haigh, C. Chen, C. J. Jones and J. D. Aplin (1999) Studies of mesenchymal cells from 1st trimester human placenta: expression of cytokeratin outside the trophoblast lineage. Placenta 20, 615–25. Y. Kato and G. D. Braunstein (1989) Discordant secretion of placental protein hormones in differentiating trophoblasts in vitro. J Clin Endocrinol Metab 68, 814–20. T. Nagamatsu, T. Fujii, T. Ishikawa, T. Kanai, H. Hyodo, T. Yamashita, Y. Osuga, M. Momoeda, S. Kozuma and Y. Taketani (2004) A primary cell culture system for human cytotrophoblasts of proximal cytotrophoblast cell columns enabling in vitro acquisition of the extra-villous phenotype. Placenta 25, 153–65. J. Yui, M. Garcia-Lloret, A. J. Brown, R. C. Berdan, D. W. Morrish, T. G. Wegmann and L. J. Guilbert (1994) Functional, long-term cultures of human term trophoblasts purified by column-elimination of CD9 expressing cells. Placenta 15, 231–46. D. W. Morrish, J. Dakour, H. Li, J. Xiao, R. Miller, R. Sherburne, R. C. Berdan and L. J. Guilbert (1997) In vitro cultured human term cytotrophoblast: a model for normal primary epithelial cells demonstrating a spontaneous differentiation programme that requires EGF for extensive development of syncytium. Placenta 18, 577–85. G. Daoud, M. Amyot, E. Rassart, A. Masse, L. Simoneau and J. Lafond (2005) ERK1/2 and p38 regulate trophoblasts differentiation in human term placenta. J Physiol 566, 409–23. T. M. Mayhew (2008) Taking tissue samples from the placenta: an illustration of principles and strategies. Placenta 29, 1–14. P. K. Smith, R. I. Krohn, G. T. Hermanson, A. K. Mallia, F. H. Gartner, M. D. Provenzano, E. K. Fujimoto, N. M. Goeke, B. J. Olson and D. C. Klenk (1985) Measurement of protein using bicinchoninic acid. Anal Biochem 150, 76–85.

Chapter 5 Endocrinology and Cell Signaling in Human Villous Trophoblast Catherine Mounier, Benoit Barbeau, Cathy Vaillancourt, and Julie Lafond Abstract In humans, the placenta that forms by an implantation process in the maternal uterus allows the development of the embryo and the fetus by exchanging ions, metabolites, and wastes and by producing specific hormones (steroids and proteins) with the levels of secretion often surpassing the levels of other endocrine organs. The process of placental development involves two pathways of differentiation that lead to the formation of two distinct phenotypes: villous trophoblast (fusion phenotype) and extravillous trophoblast (proliferative/invasive phenotype). In this chapter we describe the current methods to study villous trophoblast differentiation and the cell–cell fusion of the cytotrophoblast cells. Key words: Trophoblast, differentiation, syncytiotrophoblast, fusion, endocrine function, human placenta, kinases.

1. Introduction In the villous phenotype differentiation of placental development, the trophoblast differentiates from the fusion of the mononuclear cytotrophoblastic cells into a syncytium, the syncytiotrophoblast (1). The multinucleated syncytiotrophoblast is the functional unit of the human placenta and the direct edge between maternal blood and fetal tissues. This structure is responsible for most of the endocrine functions supported by the placenta. Furthermore, the syncytiotrophoblast plays a fundamental role in permitting the adequate exchange of nutrients and hormones as well as other components between the mother and her fetus. The differentiation and fusion processes occurring during syncytiotrophoblast Julie Lafond and Cathy Vaillancourt (eds.), Human Embryogenesis: Methods and Protocols, vol. 550 © Humana Press, a part of Springer Science+Business Media, LLC 2009 DOI 10.1007/978-1-60327-009-0 5 Springerprotocols.com

89

90

Mounier et al.

formation are highly regulated processes and can be studied in cell lines and/or primary trophoblast freshly isolated from the placenta (2). Differentiation is associated with specific and measurable functions such as human chorionic gonadotropin (hCG) and placental lactogen (hPL) secretion, while cell fusion can be monitored by various assays (3). Cell signaling mediating trophoblast differentiation and fusion is studied in our laboratory through standard protocols and has been focussed on protein tyrosine kinases, p38/ERK1/ERK2 MAPKs, and SFKs. These series of experiments and cell models provide an important basis for the study of the process involved in placental development in relation to endocrine hormones and signal transduction.

2. Materials 2.1. Cell Culture and Activation of BeWo Cells

2.2. Confocal Microscopy on Trophoblast Cells

1. BeWo cells (cat. no. CCL-98; American Type Culture Collection (ATCC)). 2. Ham’s F-12 media supplemented (Invitrogen) with 10% fetal bovine serum (FBS) and L-glutamine (2 mM) (Sigma– Aldrich). 3. Cells are treated with the following activators: the protein tyrosine phosphatase inhibitor bpV[pic] (10 ␮M) (cat. no. ALX-270-205-M005; Alexis Corp, Burlington, Canada) dissolved in demineralized water (stock concentration at 10 mM) and the adenylate cyclase activator forskolin (50 ␮M) (Sigma–Aldrich) dissolved in dimethyl sulfoxide (DMSO) (stock concentration at 12 mM). 4. Trypsin 0.25%/EDTA (4 Na 1×) (Invitrogen). 5. 75-cm2 flasks (Corning). 1. Phosphate-buffered saline (PBS 10×): 80 g NaCl, 2 g KCl, 14.4 g Na2 HPO4 dibasic anhydrous, 2.4 g KH2 PO4 monobasic anhydrous, complete volume at 1 L with demineralized H2 O, pH 7.4. 2. Mouse anti-desmoplakin monoclonal antibody (1:700; cat. no. D-1286; Sigma–Aldrich). 3. Mouse anti-E-cadherin monoclonal antibody (1:400; cat. no. 610181; BD Transduction Laboratories, Mississauga, ON, Canada) overnight at 4◦ C. 4. Mouse anti-connexin 43 monoclonal antibody (1:200; cat. no. 610061; BD Transduction Laboratories). 5. Alexa Fluor 488-conjugated goat anti-mouse IgG (1:1,000; cat. no. A-11001; Invitrogen).

Placental Trophoblast Endocrine

91

6. Fluorescein isothiocyanate (FITC)-conjugated sheep antimouse IgG antibody (1:10) (Chemicon International, Inc., Temecula, CA, USA). 7. Propidium iodide (PI), 50 ␮g/mL (Sigma–Aldrich), dissolved in water (stock concentration at 1 mg/mL). 8. Ethanol 100% and 90%. 9. 24-well plates (Corning). 10. Bovine serum albumin (BSA). 11. Microscope slides (7.5 × 7.5 × 2.5 cm). 12. Microscope cover glasses (22 × 22 × 1.5 mm). 13. Poly-L-lysine (BeWo)/poly-D-lysine (primary trophoblast cells) (cat. no. P8920; Sigma–Aldrich). 14. ProLong gold antifade reagent (Invitrogen). 15. Confocal laser-scanning microscope (Bio-Rad MRC1024, CA, USA) equipped with a Nikon Eclipse TE300 camera (Nikon, Tokyo, Japan). 2.3. siRNA Transfection of BeWo Cells

1. HiPerFect reagent (Qiagen). 2. All siRNAs are chemically synthesized by Sigma–Proligo (The Woodlands, TX, USA). 3. Sequences of sense and nonsense siRNA are generally blasted using the Ensembl blast algorithm to ascertain that no significant homologies with cDNA or genomic sequences are detected.

2.4. Preparation of Cell Lysates

1. Radioimmunoprecipitation assay (RIPA) buffer: 150 mM NaCl, 9.1 mM Na2 HPO4 , 1.7 mM NaH2 PO4 , pH 7.4, 1% Nonidet P-40, 0.5% Na-deoxycholate, 0.1% SDS. 2. Protease and phosphatase inhibitors: 200 ␮M of freshly prepared sodium orthovanadate (Na3 VO4 ), 1 mM phenylmethylsulfonylfluoride (PMSF), and one EDTA-free minitablet (one for 10 mL of RIPA buffer; Roche Diagnostics). 3. Bicinchoninic acid (BCA) assay (Pierce).

2.5. Sodium Dodecyl SulfatePolyacrylamide Gel Electrophoresis (SDS-PAGE)

1. Resolving gel buffer (4×): 1.5 M Tris–HCl, 6.5 mM EDTA, and 0.1% SDS, pH 8.8. Store at room temperature. 2. Stacking gel buffer (4×): 0.5 M Tris–HCl, 6.5 mM EDTA, and 0.4% SDS, pH 6.8. 3. Acrylamide–Bis (30%:0.8%). Mix 100 g of acrylamide and 2.67 g of bis-acrylamide, make-up to 333.3 mL with water, and then filter through Whatman paper No. 1. This extends the stability of the solution upon storage at 4◦ C. This solution is neurotoxic before polymerization. 4. TEMED (N,N,N,N -tetramethyl-ethylenediamine) (see Note 1). 5. 10% Ammonium persulfate (APS) dissolved in water (see Note 2).

92

Mounier et al.

6. Electrode buffer (1×): 25 mM Tris–HCl, pH 8.3, 190 mM glycine, 0.1% SDS. 7. Loading buffer (3×). For 50 mL: 1.5 mL of bromophenol blue (0.1% in 100% methanol), 3.45 g of SDS, 15 mL of 100% glycerol, 18.75 mL of stacking gel buffer (4×), 2.32 g of DTT, and 14.75 mL of water. This solution is stored frozen at −20◦ C in 10-mL aliquots. 8. Bio-Rad Mini-Protean 3 Cell Gel System (Bio-Rad). 2.6. Western Blot Analyses of SFK, MAPKs, and FAK

1. Transfer buffer: 25 mM Tris, 190 mM glycine, and 20% methanol. The pH does not need to be adjusted. 2. Immobilon-P polyvinylidene difluoride transfer membrane (PVDF; Immobilon-P, Millipore). Pore size: 0.45 ␮m. 3. 3 MM Whatman paper (3 MM) (Sigma–Aldrich). 4. Tris-buffer-saline with Tween (TBS–T): 20 mM Tris–HCl, pH 7.6, 137 mM NaCl, and 0.05% Tween-20. 5. Blocking buffer: 5% no fat powdered milk in TBS–T. 6. Primary antibody incubation buffer: 5% (w/v) BSA fraction V in TBS–T. 7. Anti-phospho Erk1/2 (Thr202/Tyr204), anti-Erk1/2, anti-phospho p38 (Thr180/Tyr182), anti-p38, antiphospho Src (Tyr-416/Tyr 527), anti-non-phospho Src (Tyr-416/Tyr 527), goat anti-rabbit IgG, and goat antimouse IgG conjugated with horseradish peroxidase (Cell Signaling, Danvers, MA, USA) (see Note 3). 8. Anti-Src (Santa Cruz Technology), anti-glyceraldehyde3-phosphate dehydrogenase (GAPDH) (Chemicon International, Inc., Temecula, CA, USA) and the FAK antibody sampler kit (BioSource International, Camarillo, CA, USA). 9. BM chemiluminescence Western blotting kit (ECL) (Roche Diagnostics). 10. Kodak X-Omat Blue XB-1 films (PerkinElmer, Waltham, MA, USA). 11. Polyvinylidene chloride films (acetate).

2.7. qPCR Analyses of SFKs

1. RNA kit isolation: NucleoSpin RNA II (Macherey-Nagel, D¨uren, Germany). Omniscript Reverse Transcriptase, Taq PCR core, and QuantiTect SYBR green PCR kit (Qiagen). 2. Primer sequences are generated using the LightCycler Probe design Software 2.0 (Roche Diagnostics) and checked for specificity using BLAST analysis. 3. Specific primers (Operon Technologies, Alameda, CA, USA) (see Note 4). 4. qPCR analyses are performed using the LightCycler 480 (Roche Diagnostics). 5. qPCR are performed using the SYBR green Premix Ex Taq kit (Takara, Madison, WI, USA).

Placental Trophoblast Endocrine

93

6. Quantifications were performed using the relative quantification software, version 1.01 from Roche Diagnostics.

3. Methods 3.1. Differentiation of Trophoblasts

3.1.1. Cell Culture and Activation of BeWo Cells

The syncytiotrophoblast arises by the fusion and differentiation of the relatively undifferentiated, mitotically active cytotrophoblast cells (1). This process is characterized by a morphological and biochemical differentiation. The morphological differentiation is defined by the fusion of mononucleated cytotrophoblast cells with adjacent syncytium (1), while the biochemical differentiation is characterized by the production of hormones such as hCG and hPL (2–4). 1. Twenty-four hours before stimulation, cells in a logarithmic phase of growth are treated with Trypsin/EDTA (1 mL) and 2–3 × 105 cells are then added per well in a 24 well-plate in a final volume of 0.5 mL of growth medium. 2. After 24 h of incubation, medium is removed from the cells and fresh medium is added in the presence of forskolin or bpV[pic] (a protein tyrosine phosphatase inhibitor) or their combination. Cells are incubated for an additional 48 h and then used for further experiments.

3.1.2. Isolation and Fusion of Primary Cytotrophoblast Cells and Measurements of hCG/hPL Levels

See Chapter 4, Le Bellego et al. Isolation and culture of term human cytotrophoblast cells and in vitro methods for studying human cytotrophoblast cells calcium uptake.

3.2. Fusion Assay for Trophoblast Cells

Trophoblast cell differentiation is accompanied by important morphological changes, resulting in cell fusion. For villous cytotrophoblast cells, this final outcome of differentiation results in the formation of what is referred to as the syncytiotrophoblast. This biological process is fundamental for the proper functioning of the placenta. Numerous studies have looked at the mechanism behind trophoblast cell fusion. Some of the latest studies have uncovered a possible role played by vestigial DNA integration events from ancient retroviruses (now known as Human Endogenous Retroviruses (HERVs)) (5, 6). Different additional markers or molecules involved in cell fusion have been outlined (7–13) but further studies are needed to correctly address their involvement in trophoblast syncytialization. The study of trophoblast cell fusion necessitates reliable and accurate assays. Several technical approaches have been explored to permit the most representative and reproducible quantification

94

Mounier et al.

of the extent of cell fusion. Generally, fusion assays rely on confocal microscopy visualization of a concomitant staining of the cytoplasmic membrane and the nucleus. Evaluation of the extent of fusion is based on the calculation of the percentage of nuclei present in syncytia. Some authors use specifically the desmosome marker desmoplakin in addition to propidium iodide (PI) for nucleus staining (14, 15). Similar approaches are undertaken for various trophoblastic cell lines and human primary trophoblast cells. Transfection protocols have also been described for these studies. These experiments are designed in BeWo cells since primary trophoblasts are not easily transfectable. The study of the role and function of various proteins in cell fusion is thus feasible in BeWo cells and can include the use of siRNA duplexes for RNA interference experiments. 3.2.1. Confocal Microscopy on Human Trophoblast Cells

1. Trophoblastic cell lines (2 × 105 cells) are plated (see Section 3.1.1) and are either left untreated or stimulated with 50 ␮M forskolin, 10 ␮M bpV[pic], or their combination for

Fig. 5.1. Cell fusion of human trophoblast cells. BeWo cells were either left untreated (A) or treated with bpV[pic]/forskolin (B) for 48 h. Isolated human primary trophoblast cells were cultured for 1 day (C) or 4 days (D). Cell fusion was revealed by the labeling of desmosomes and the nucleus according to the experimental procedure described in Section 3.2.1.

Placental Trophoblast Endocrine

2.

3.

4.

5.

6.

7.

95

36–48 h. Isolated primary trophoblast cells (1.5 × 106 ) are cultured between day 1 and day 4 before staining. All of these culturing conditions are conducted in 24-well plates (see Note 5 and Fig. 5.1). Medium is then removed and cells are washed three times with PBS 1×. Cells are fixed in 100% methanol for 30 min at −20◦ C, washed, and incubated in PBS 1× containing 2% FBS (v/v) for 30 min for proper blocking of non-specific binding sites (see Note 6). Cells are rinsed three times with PBS 1× and incubated in the presence of mouse monoclonal anti-desmoplakin antibody (1:700) in PBS 1× containing 0.2% BSA for 1.5 h at room temperature. After three washes with PBS 1×, cells are incubated with the Alexa Fluor 488-conjugated goat anti-mouse IgG (1:1,000) for 1.5 h in dark. For nuclear staining, cells are incubated with PI (50 ␮g/mL) for 30 min at room temperature and washed three times with PBS 1×. Cells are then left in a volume of 0.5 mL of PBS 1× and directly visualized with a confocal laser-scanning microscope. All confocal microscopy analyses through this fusion assay can be performed at a 10× or a 40× magnification. A syncytium is defined as an agglomeration of two or more nuclei in the same cytoplasm without intervening surface desmosomal membrane staining. Fusion index is then calculated as follows: a total of 200 nuclei are counted and a percentage is determined for the number of nuclei comprised in syncytia. Several wells can be examined for each experimental condition.

3.2.2. Other Markers of Cell Fusion

1. Cell fusion of villous cytotrophoblasts can be assessed as described under Section 3.2.1. using E-cadherin and connexin 43 as markers. 2. Anti-E-cadherin (1:400) and anti-connexin 43 (1:200) are incubated overnight at 4◦ C. 3. After five washes in PBS 1×, slides are incubated with FITCconjugated sheep anti-mouse IgG antibody (1:10; 1:100, respectively) for 45 min at room temperature. 4. Syncytium formation is quantified by observing the distribution of E-cadherin (or connexin 43) and nuclei in cells and by counting the number of nuclei in syncytia and the total number of nuclei in a random field.

3.2.3. siRNA Transfection of BeWo Cells

1. BeWo cells (1.5 × 105 ) are plated as described under Section 3.1.1 and are either left untreated or stimulated with 50 ␮M forskolin, 10 ␮M bpV[pic], or their combination for 16–24 h.

96

Mounier et al.

2. Using the HiPerFect reagent, cells are next transfected with 37.5 ng of siRNA duplexes (see Note 7) according to the manufacturer’s instructions. 3. After 36 h of transfection (see Note 8), efficiency/specificity of each siRNA is analyzed by qPCR (see Section 3.3.1.4) while the effect on morphological changes is assessed by the fusion assay for trophoblast cells (see Section 3.2). 3.3. Cell Signaling in Trophoblast Cell Differentiation

Phosphorylation mechanisms play a major role in controlling many biological processes in different cell types. Activation of several kinases is necessary to achieve proper placental development. In fact, specific signaling cascade needs to be activated in order to induce cytotrophoblast cell differentiation into syncytiotrophoblasts. In particular, activation of ERK1/2 and p38 MAPK pathways is essential to mediate initiation of trophoblast differentiation (16). Various Src family kinases (SFKs) also play a role in this differentiation process; however, these roles are different, depending on which SFK is activated (17).

3.3.1. Western Blots Analyses of SFK and MAPKs 3.3.1.1. Preparation of Cell Lysates

1. Primary human trophoblasts are prepared as described in Chapter 4. 2. Cells are seeded in 35-mm dishes and cultured in complete culture medium for 4 days at 37◦ C to allow differentiation (see complete protocol in Chapter 4). 3. Every day (day 1 to day 4), medium is removed and the cells are rinsed twice with cold PBS 1× (see Note 9). 4. Cells are lyzed in RIPA buffer containing protease and phosphatase inhibitors. 5. Cell lysates are clarified by centrifugation at 14,000g for 10 min at 4◦ C. 6. Protein concentration of the supernatant is determined with the BCA assay protein reagent and using BSA as a standard. 7. Thirty ␮g of proteins is solubilized in 1× loading buffer and boiled for 5 min at 95◦ C.

3.3.1.2. SDS-PAGE

1. These instructions are adapted to the Mini-Protean 3 Cell Gel System. The glasses are washed properly with a detergent and rinsed extensively with distilled water and subsequently with 95% ethanol to remove all the water. 2. A 1.5-mm thick gel is prepared by mixing 4.1 mL of demineralized H2 O, 4 mL of 30% acrylamide, 5 mL of 4× resolving gel buffer, 0.125 mL of 10% SDS, 0.125 mL of 10% APS, and 5 ␮L of TEMED. The gel is poured rapidly and about 1.5 cm of free space is left for the stacking gel.

Placental Trophoblast Endocrine

3.

4.

5.

6. 7.

3.3.1.3. Western Blot Analyses of Total and Active Kinases

97

The gel is overlaid very slowly with distilled water. The gel should polymerize in less than 30 min. The water is then removed by inverting the gel. The stacking gel is prepared by mixing 1.4 mL of H2 O, 0.33 mL of 30% acrylamide, 0.25 mL of 4× stacking gel buffer, 0.02 mL of 10% SDS, 0.02 mL of 10% APS, and 2 ␮L of TEMED. The gel is poured rapidly and the comb is inserted. The gel should polymerize in less than 30 min. The comb is removed and the wells are rinsed several times with 1× electrode buffer using a 3-mL syringe with a 22gauge needle. The boiled samples are loaded into the wells and are overlaid very carefully with 1× electrode buffer (see Note 10). A prestained standard (10 ␮L) is loaded at the same time. The gel is placed in the running unit and overlaid very carefully with 1× electrode buffer. The gel is run for 2 h at 100 V. The cooling basket is added inside the gel unit and the entire set up is placed in an ice bucket.

1. Proteins are transferred onto a PVDF membrane. These instructions are adapted to the Mini-Protean 3 Cell Transfer System. 2. The PVDF membrane is cut just larger than the size of the separating gel. The membrane is soaked in 100% methanol, rinsed in water, and finally washed in transfer buffer for 5 min before use. 3. At the end of the migration, the gel unit is opened and the stacking gel is removed. The gel is transferred for 30 min in 50 mL of transfer buffer (see Note 11). 4. The transfer cassette is placed and opened in a tray containing 1× transfer buffer with the black side in the buffer. 5. A pad presoaked in transfer buffer is placed first. A piece of 3 MM paper, the same size as the PVDF membrane, is then added and the bubbles are removed by stroking and pressing the 3 MM paper. 6. The gel is subsequently placed on the top and the presoaked PVDF membrane is added. The bubbles are removed again for efficient transfer. 7. A second piece of 3 MM paper is placed on the top followed by a second pad. 8. The cassette is closed and the clamp is placed into position. The cassette is inserted in the transfer apparatus which is already filled with cold transfer buffer. The level of the solution must be just below that of the electrodes. The transfer is run for 90 min at 100 V or overnight at 30 V. The transfer must be performed either in a cold room or in an ice bucket.

98

Mounier et al.

9. At the end of the transfer, the membrane is removed (see Note 12) and placed in 50 mL of blocking solution for 1 h at room temperature. 10. Membranes are then incubated with the appropriate antibody overnight at 4◦ C in primary antibody incubation buffer (1:500 for the anti-phospho p38; 1:1,000 for the anti-Erk1/2, anti-p38, anti-phospho Src (Tyr-416), antiphospho-FAK (Tyr-407, Tyr-576 or Tyr-577), anti-FAK; 1:2,000 for the anti-phospho Erk1/2, anti-phospho Src (Tyr-527), and anti-phospho-FAK (Tyr-397); 1:4,000 for the anti-non-phospho Src, the anti-Src and anti-GAPDH). 11. Membranes are washed three times for 10 min at room temperature in TBS–T and incubated with the horseradish peroxidase-conjugated antibody for 1 h at room temperature in blocking solution (1:1,500 for the anti-rabbit IgG or 1:3,000 for the anti-mouse-IgG) (see Note 13). 12. The membrane is washed three times for 10 min at room temperature in TBS–T and covered with polyvinylidene chloride films (acetate). 13. The membrane is overlaid with 2.5 mL of ECL reagent for 1 min, wrapped in plastic layer, and exposed on an X-Omat Blue XB-1 film. 3.3.1.4. qPCR Analyses of SFK Expressions During Differentiation

1. Total RNA is extracted from cultured trophoblasts (day 1 to day 6) as described in Chapter 5 (see Note 14). 2. Two micrograms of total RNA is reverse transcribed (RT) into cDNA at 37◦ C for 1 h using 10 ␮M Oligo-dT primers and 4 U of Omniscript reverse transcriptase in a 20 ␮L final volume. 3. qPCRs are performed in the presence of 0.5 ␮M of both the sense and the antisense primers (Table 5.1) using the SYBR green Premix Ex Taq kit technology in a LightCycler 1.5 Instrument for 50 cycles (see Note 15). 4. In all PCR reactions, a negative control corresponding to RT reaction performed in the absence of reverse transcriptase is added for each tested gene. 5. Amplification of the D-glucose-6-phosphate dehydrogenase (G6PDH) cDNA is used as an internal control to quantify the expression of a given gene. 6. For quantification studies, dissociation curves are run for all reactions to ensure amplification of a single product with the appropriate melting temperature. These curves are used for quantification.

3.3.1.5. Effect of Kinases Inhibitors on hCG/hPL Secretion and Trophoblast Fusion

1. Following human trophoblast isolation (see Chapter 4), cells are plated in 24-well plates in complete culture medium and left overnight prior treatment.

Placental Trophoblast Endocrine

99

Table 5.1 Sequences of primer sets used in the qPCR analyses Primers

Gene

GeneBank access numbers

Sense (5 –3 )

Anti-sense (5 –3 )

Fgr

M19722

GAGGAGCCCATCTAC ATCGTG

CAGGGGTTGTACTCA TCGTCC

266

Fyn

NM 002037

TGTGACCTCCATCC CCAACT

AACTCAGGTCATCTTCT GTCCGT

179

Hck

NM 002110

CATCATCGTGGTTGC CCTGTA

GCGGGCGACATAG TTGCTT

166

Lck

NM 005356

CACGAAGGTGGCGG TGAAGA

GAAGGGGTCTTGAGAA AATCCA

194

Lyn

M16038

GAGGCTCTACGCTGTG GTCA

GACTCGGAGACCAGAAC ATTAGC

225

Src

NM 005417

CAGTGTCTGACTTCGA CAACGC

CCATCGGCGTGTT TGGAGTA

148

Yes

NM 005433

GCTGCACTGTATGGTCG GTT

AGGGCACGGCATCC TGTATC

156

TACGGCAACAGATACA AGAACG

TCGGCTGCCATAAA TATAGG

192

G-6PDH NM 000402

Product size (bp)

2. Thereafter, cells are preincubated with various kinases inhibitors (Table 5.2) dissolved in DMSO (< 0.1%) or vehicle alone for 1 h in serum free culture medium. 3. Following this treatment, 10% FBS is added. 4. These treatments with kinase inhibitors are repeated for 4 days during the differentiation of cytotrophoblast cells into syncytiotrophoblasts.

Table 5.2 Kinases inhibitors used in the cell signaling studies Inhibitor name

Supplier

Target

Concentration

Reference

PD98059

Sigma

SB203580

Sigma

MEK1/2

50 ␮M

(16)

P38 MAPK

50 ␮M

(16)

PP2

Calbiochem

PP3

Calbiochem

Src family tyrosine kinases

10 ␮M

(17)

Inactive analog of PP2

10 ␮M

(17)

Herbimycin A Genistein

Calbiochem

Tyrosine kinases

1 ␮M

(17)

Calbiochem

Tyrosine kinases

100 ␮M

(17)

100

Mounier et al.

5. Culture media are collected every day for hCG and hPL quantification (see Chapter 4, Section 3.4). 6. After 4 days of culture and treatments trophoblast fusion is evaluated by confocal microscopy (see Section 3.2.1).

4. Notes 1. Buy small bottles of TEMED as its stability is affected once the bottle is opened. Store at room temperature. Work under fume hood. 2. Fresh APS must be prepared each week and stored at 4◦ C. Keeping it longer will alter the polymerization of the gel and therefore the quality of migration. 3. Most of these primary antibodies can be used several times (more than 10 times) when stored at −20◦ C in the antibody incubation buffer. 0.02% Sodium azide may be added to the solution to stabilize the antibody during the time of storage. 4. All primer sequences were generated using the LightCycler Probe Design Software 2.0 (Roche Diagnostics). The specificity of the primers was subsequently verified using a BLAST analysis. 5. This protocol can be used for the detection of any type of proteins in trophoblast cells through the inclusion of specific primary and secondary antibodies. To obtain clearer results, we typically add a cover glass at the bottom of each well. These latter are either pretreated with poly-Llysine for BeWo cells or with poly-D-lysine for primary trophoblast cells (0.01%) for 5 min at room temperature. Cover glasses are then rinsed once with distilled water and dehydrated by subsequently soaking in ethanol 90% and 100% ethanol for 1 min each. Once dried, cover glasses are mounted on a slide using the ProLong gold antifade reagent and left for 24 h at room temperature and for another 24 h at 4◦ C, in dark. 6. Cells can alternatively be fixed in the presence of 4% paraformaldehyde at room temperature for 30 min, in dark, and afterward incubated in 100% methanol during 5 min for permeabilization. 7. The correct amount of added siRNA duplexes needs to be adjusted for optimal RNA interference for each new target. 8. Cells can be transfected between 24 and 72 h with the siRNA depending on the cell type and the nature of the transcript.

Placental Trophoblast Endocrine

101

9. From this step, all the experiments have to be performed at 4◦ C to maintain the level of protein phosphorylation. 10. To separate the proteins efficiently, the same volume of loading buffer should be added in each well. If not, use 1× loading buffer to adjust the volumes. 11. Do not exceed 30 min otherwise the proteins will leak out of the gel. 12. Transfer efficiency can be verified by staining the membrane with Ponceau red (0.2% Ponceau S strain (w/v), 3% TCA, 3% sulfosalicylic acid) for 10 min at room temperature. Rinse the membrane with water until the protein bands become visible. 13. Incubation period of the secondary antibody will increase the presence of non-specific bands on the Western blot. 14. Do not use the TriZol reagent as it will quench the SYBR green signal during qPCR analyses. 15. The specificities of the qPCR reactions are evaluated by running the reaction on a 2% agarose gel stained with ethidium bromide.

Acknowledgments We wish to thank Amandine Vargas, M.Sc. and Dr. Georges Daoud for their experimental contribution to this manuscript. References 1. Midgley, A. R., Pierce, G. B., Jr., Deneau, G. A. and Gosling, J. R. (1963). Morphogenesis of syncytiotrophoblast in vivo: an autoradiographic demonstration. Science 141, 349–350. 2. Kliman, H. J., Nestler, J. E., Sermasi, E., Sanger, J. M. and Strauss, J. F., III (1986). Purification, characterization, and in vitro differentiation of cytotrophoblasts from human term placentae. Endocrinology 118, 1567–1582. 3. Morrish, D. W., Bhardwaj, D., Dabbagh, L. K., Marusyk, H. and Siy, O. (1987). Epidermal growth factor induces differentiation and secretion of human chorionic gonadotropin and placental lactogen in normal human placenta. J Clin Endocrinol Metab 65, 1282–1290. 4. Strauss, J. F., III, Kido, S., Sayegh, R., Sakuragi, N. and Gafvels, M. E. (1992). The cAMP signalling system and human trophoblast function. Placenta 13, 389–403.

5. Mi, S., Lee, X., Li, X., Veldman, G. M., Finnerty, H., Racie, L., LaVallie, E., Tang, X. Y., Edouard, P., Howes, S., Keith, J. C., Jr. and McCoy, J. M. (2000). Syncytin is a captive retroviral envelope protein involved in human placental morphogenesis. Nature 403, 785–789. 6. Blaise, S., de Parseval, N., Benit, L. and Heidmann, T. (2003). Genomewide screening for fusogenic human endogenous retrovirus envelopes identifies syncytin 2, a gene conserved on primate evolution. Proc Natl Acad Sci USA 100, 13013–13018. 7. Adler, R. R., Ng, A. K. and Rote, N. S. (1995). Monoclonal antiphosphatidylserine antibody inhibits intercellular fusion of the choriocarcinoma line, JAR. Biol Reprod 53, 905–910. 8. Frendo, J. L., Cronier, L., Bertin, G., Guibourdenche, J., Vidaud, M., Evain-Brion, D. and Malassine, A. (2003). Involvement of connexin 43 in human trophoblast cell fusion

102

9.

10.

11.

12.

Mounier et al. and differentiation. J Cell Sci 116, 3413– 3421. Cronier, L., Defamie, N., Dupays, L., Theveniau-Ruissy, M., Goffin, F., Pointis, G. and Malassine, A. (2002). Connexin expression and gap junctional intercellular communication in human first trimester trophoblast. Mol Hum Reprod 8, 1005–1013. Getsios, S. and MacCalman, C. D. (2003). Cadherin-11 modulates the terminal differentiation and fusion of human trophoblastic cells in vitro. Dev Biol 257, 41–54. MacCalman, C. D., Furth, E. E., Omigbodun, A., Bronner, M., Coutifaris, C. and Strauss, J. F., III. (1996). Regulated expression of cadherin-11 in human epithelial cells: a role for cadherin-11 in trophoblastendometrium interactions? Dev Dyn 206, 201–211. Kudo, Y. and Boyd, C. A. (2004). RNA interference-induced reduction in CD98 expression suppresses cell fusion during syncytialization of human placental BeWo cells. FEBS Lett 577, 473–477.

13. Huppertz, B., Bartz, C. and Kokozidou, M. (2006). Trophoblast fusion: fusogenic proteins, syncytins and ADAMs, and other prerequisites for syncytial fusion. Micron 37, 509–517. 14. Douglas, G. C. and King, B. F. (1990). Differentiation of human trophoblast cells in vitro as revealed by immunocytochemical staining of desmoplakin and nuclei. J Cell Sci 96(Pt 1), 131–141. 15. Keryer, G., Alsat, E., Tasken, K. and EvainBrion, D. (1998). Cyclic AMP-dependent protein kinases and human trophoblast cell differentiation in vitro. J Cell Sci 111(Pt 7), 995–1004. 16. Daoud, G., Amyot, M., Rassart, E., Masse, A., Simoneau, L. and Lafond, J. (2005). ERK1/2 and p38 regulate trophoblasts differentiation in human term placenta. J Physiol 566, 409–423. 17. Daoud, G., Rassart, E., Masse, A. and Lafond, J. (2006). Src family kinases play multiple roles in differentiation of trophoblasts from human term placenta. J Physiol 571, 537–553.

Chapter 6 Gestation-Induced Uterine Vascular Remodeling ` Provencher, Pierre-Andre´ Scott, Mylene ´ Pascale Guerin, and Jean St-Louis Abstract Uterine blood supply is a critical issue for fetal well-being, since it carries all the nutrients, including O2 , required for fetal growth and gets rid of several fetal waste products. During pregnancy, uterine blood flow increases by almost 20 times and this is permitted by marked remodeling of the vessel wall. In the rat, uterine arterial remodeling takes place in the last 7–8 days of gestation (over 22) and is reversible in the postpartum period upon a similar time frame. It was also described as both hypertrophy and hyperplasia of all the constituents of the vascular wall. Several hypotheses have been proposed to explain such a phenomenon, including the driving role not only of sexual steroid hormones, progesterone and estrogens, but also of trophic factors of fetal origin. We have shown that alterations of the renin–angiotensin– aldosterone system, by manipulating sodium intake in the rats, reduced the pregnancy-induced remodeling of uterine arteries. These maneuvres resulted in the birth of pups that had characteristics of intrauterine growth restriction or in the development in the mother of “experimental” gestational hypertension, depending on, respectively, restriction or increased of sodium intake. Key words: Vascular remodeling, uterine arteries, smooth muscle, myograph, microvessels, western blots, immunohistochemistry, endothelin.

1. Introduction Pregnancy is accompanied by multiple hemodynamic changes including increased uterine perfusion by almost 20 times. This elevation is necessary to satisfy the increasing metabolic needs of the developing fetus. Remodeling of the uterine vasculature, seen in mammals, is critical for an adequate perfusion of the maternal– fetal interface. In the rat, this remodeling is characterized by both hypertrophy and hyperplasia of all constituents of the vessel wall Julie Lafond and Cathy Vaillancourt (eds.), Human Embryogenesis: Methods and Protocols, vol. 550 © Humana Press, a part of Springer Science+Business Media, LLC 2009 DOI 10.1007/978-1-60327-009-0 6 Springerprotocols.com

103

104

Scott et al.

(1). Uterine arteries of different sizes double their internal diameter during pregnancy; this comes back to the initial size during the postpartum period. The remodeling is associated with an increase in arterial stiffness that also returns to prepregnant setting after parturition (2). Uterine veins of different caliber also experience remodeling in size and compliance during that period (3). These morphologic and mechanical changes result in the functional alterations of uterine vasculature, e.g., increased vascular reactivity to vasoconstrictors like angiotensin II (Ang II), phenylephrine (PhE), and potassium chloride (KCl) (4), as well as endothelin (ET) as shown by recent data from our laboratory. It is noteworthy that reactivity of systemic arteries is reduced in gestation (5, 6). However, the physiological mechanisms that are responsible for these changes are still to be identified. In the human and rats, when these changes do not occur as they should, pathologic conditions such as intrauterine growth restriction (IUGR) or preeclampsia develop. This last clinical condition is characterized by hypertension along with proteinuria and/or edema after the 20th week of pregnancy (7). It is also accompanied with increased maternal vascular tone and reduced uteroplacental blood flow (8). It is associated with high rate of maternal and fetal morbidity and mortality, affecting 6–10% of all pregnancies. Unfortunately, etiology and pathogenesis of this disease are still unknown but evidences point toward multifactorial origin of the disease. IUGR, defined as birth weight below the tenth percentile for a given gestational age, is also a multifactorial condition in which several pathogenetic factors (fetal, placental, or maternal) have been documented (9, 10). These pathologies are specific to human beings, but considering the difficulties and ethical considerations regarding pregnant human subjects, it is important to have available some reliable animal models that reproduce the physiological, especially hemodynamic changes of pregnancy as well as of related pathological conditions. 1.1. Animal Models

Several animals are currently used to study pregnancy, such as the rabbit, ewe, monkey, mouse, and rat. To mimic a state resembling preeclampsia, different manipulations were performed: clamping the uterine circulation resulting in ischemia (11–15), inhibition of the nitric oxide (NO) synthesis (16), and perturbations of the renin–angiotensin–aldosterone system by a modification in the sodium intake (17) or by selectively inducing expression of the renin–angiotensin–aldosterone system (RAAS) in murine models (18, 19). Our laboratory has focused on characterization of cardiovascular adaptations to gestation in the rat and their similarities to the ones accompanying human pregnancy (20). Reasons for that choice include short duration of pregnancy (23 days) for sure, but, among others, the localization of uterine vasculature

Uterine Arterial Remodeling

105

outside the uterine wall. This makes access easier to the small uterine arteries. One objective of our work is to characterize the uterine vascular remodeling during pregnancy and to determine by which mechanisms this takes place. This includes studying functional changes of the uterine arteries induced by pregnancy. 1.2. Choice of Experimental Methods

In order to do so, several techniques are available. Reactivity of blood vessels can be assessed isometrically in wire myographs with different pharmacological agents. We have previously reported that uterine arteries denuded of their endothelium and precontracted with PhE exhibited reduced relaxant responses to 17␤-estradiol (17␤-E2 ) in late pregnancy, compared to arteries of non-pregnant rats (21). This difference was abolished when arteries of non-pregnant rats were incubated with L-nitro-arginine methylester (L-NAME), E2 -induced vasorelaxation is partially dependent on muscular NO. Wire myographs were also used to measure reactivity to vasoconstrictors such as endothelin (ET). Indeed, some studies reported increased production of ET during pregnancy (22–24). We have recently observed that uterine arteries from pregnant rats were more reactive to ET than the ones of non-pregnants. Furthermore, the difference in reactivity between ET-1 and ET-3 seen in arteries of non-pregnant rats was abolished in the uterine arteries of the pregnants (Gu´erin, Sicotte, Larivi`ere, St-Louis, unpublished observation). To try explaining these observations we have also performed ex vivo experiments measuring molecular expression of proteins of interest. For instance, we evaluated the expression of the different isoforms of NO synthases (NOS), ET receptors (ET-A/ET-B) and cyclooxygenase (COX) isoforms by western blot. We also used this technique to evaluate the presence in uterine vessels of Bax and Bcl-2 proteins, known markers of apoptosis (25, 26). Finally, to get some knowledge on the mechanisms involved, we used immunofluorescence to determine if the effects seen with the ET agonists were due to increase of its receptors in the endothelial or muscular layers of uterine arterial wall. These three techniques are further described in the present chapter.

2. Materials 2.1. Animals

1. Female (226–250 g, ∼10–11 weeks of age) and male (251–300 g, ∼8–9 weeks of age, for mating) Sprague– Dawley rats (Charles River Canada, St-Constant, QC, Canada) were used.

106

Scott et al.

2.2. Uterine Artery Dissection and Myograph Experiment

1. Krebs bicarbonate solution in mM: 118 NaCl, 4.65 KCl, 25 NaHCO3 , 2.5 CaCl2 , 1.18 MgSO4 , 1.18 KH2 PO4 , and 5.5 dextrose. For more convenience, prepare a 10× stock solution without dextrose and NaHCO3 . On the day of experimentation, prepare enough 1× solution (500 mL–1 L) and add the appropriate amount of dextrose and NaHCO3 . The Krebs bicarbonate solution must be oxygenated with medical gas mixture (95% O2 , 5% CO2 to maintain pH 7.4). All salts needed are of analytical grade (Fisher Scientific and Bio-Rad). 2. Tungsten wire (ø 25 ␮m) (Saturn Industries, Hudson, NY, USA). 3. Phenylephrine hydrochloride (Sigma Chemicals) is dissolved in water to obtain a stock solution of 10–3 M, which is stored at –20◦ C. 4. Carbamylcholine chloride (Carbachol, Sigma Chemicals) is prepared as stock solution of 10−2 M in water and stored at –20◦ C. 5. 17␤-Estradiol (17␤-E2 , Sigma Chemicals) is dissolved at 10−1 , 10−2 , 10−3 M in dimethyl sulfoxide (DMSO) and stored at room temperature or –20◦ C for longer periods. 6. Dumont #5 forceps (Fine Science Tools, Inc., North Vancouver, BC, Canada). 7. Prism (Graphpad Software, San Diego, CA, USA).

2.3. Tissue Homogenization for Western Blot

1. Homogenization buffer #1 (10×): 2.5 M Tris−HCl pH 7.4, 100 mM EDTA, 100 mM EGTA. Store at room temperature. 2. Homogenization buffer #2: 50 mM Tris–HCl pH 7.4, 150 mM NaCl, 1 mM EDTA, 1% NP-40 Alternative, 0.25% sodium deoxycholate, 10% protease inhibitors cocktail (Complete Mini, EDTA-free; Roche Diagnostics). Prepare on the day of the experiment. 3. Laemmli solution (4×): 0.125 M Tris–HCl pH 6.7, 4% (w/v) sodium dodecyl sulfate (SDS), 0.94 mM EDTA, 15% (v/v) glycerol, 0.1 M dithiothreitol (DTT), 0.01% (w/v) bromophenol blue. Just before the experiment, add ␤-mercaptoethanol in a ratio of 500 ␮L:10 mL of stock solution.

2.4. SDSPolyacrylamide Gel Electrophoresis (SDS-PAGE)

1. 30% Acryl-bisacrylamide mix. This solution should be protected from the light and conserved at 4◦ C. This is a neurotoxin when unpolymerized; care should be taken when using the product to avoid exposure. 2. Solutions for separating buffer: 1.5 M Tris–HCl pH 8.8, store at 4◦ C and 10% SDS, store at room temperature.

Uterine Arterial Remodeling

107

3. Solutions for stacking buffer: 1.5 M Tris–HCl pH 6.5, store at 4◦ C and 10% SDS, store at room temperature. 4. N,N,N,N -Tetramethyl-ethylenediamine (TEMED; BioRad), keep at room temperature. 5. Ammonium persulfate (APS): Prepare 10% solution in water on the day of the experiment. 6. Running buffer (10×): 2.5 M Tris-base, 19.2 M glycine, 10% SDS. Store at 4◦ C. When needed, dilute 100 mL in 900 mL water. 7. Recombinant protein molecular weight markers: Full range Rainbow (Amersham Biosciences, Baie d’Urf´e, QC, Canada). 2.5. Western Blotting

1. Transfer buffer (10×): 0.5 M Tris-base, 3.8 M glycine. Store at 4◦ C. On the day of the experiment, 100 mL of the stock solution is mixed with 200 mL of methanol and 700 mL of water. 2. Tris-buffered saline with Tween (TBST) (10×): 500 mM Tris-base, 1.5 M NaCl, 1% Tween-20, pH 7.5. Store at 4◦ C. Dilute 100 mL with 900 mL of water for use. 3. Blocking buffer: 5% (w/v) non-fat dry milk in TBST (NOS, ETR, COX, and Bax); for Bcl-2 use 5% (w/v) bovine serum albumine (BSA). Prepare on the day of the experiment. 4. Enhanced chemiluminescence (ECL) detection system (Amersham Biosciences). 5. Hybond-ECL nitrocellulose membranes (Amersham Biosciences). 6. 3 MM chromatography paper (Whatman). 7. Antibodies: anti-NOS3 mouse IgG1 clone 3 (cat. no. 610297; BD Biosciences Pharmingen, San Diego, CA, USA), anti-NOS2 mouse IgG clone 54 (cat. no. 610432; BD Biosciences Pharmingen), and anti-NOS1 mouse IgG2a clone 16 (cat. no. 610309; BD Biosciences Pharmingen), ETAR rabbit antibodies (cat. no. AN-06; Alomone Labs, Jerusalem, Israel) and ETBR rabbit antibodies (cat. no. AN02; Alomone Labs), COX-1 rabbit polyclonal antibodies (cat. no. 114072-114073; Cayman Chemical, Ann Arbor, MI, USA) and COX-2 rabbit polyclonal antibodies (Cat. No. 115324-115325; Cayman Chemical), Bax rabbit polyclonal antibodies (cat. no. 2772; Cell Signaling Technology, Danvers, MA, USA) and Bcl-2 rabbit polyclonal antibodies (cat. no. 2876; Cell Signaling Technology) and anti-␤-actin mouse monoclonal antibody (cat. no. 045K4831; Novus Biological, Littleton, CO, USA).

2.6. Stripping and Reprobing Blots

1. Stripping buffer: 0.2 M glycine, 0.05% Tween-20, pH 2.5. Store at 4◦ C.

108

Scott et al.

2.7. Tissue Fixation

1. Optimal cutting temperature (OCT) compound (Sakura, Torrance, CA, USA). 2. Precleaned microslides Snowcoat X-tra 1 × 3 × 1.0 mm (Surgipath, MA, USA). 3. Serum International coverslips 24 × 50 mm no. 1 (Serum, QC, Canada).

2.8. Confocal Immunofluorescence

1. Super Pap Pen (Cedarlane laboratories, Inc., Hornby, ON, Canada). 2. Acetone 100%, store at –20◦ C. 3. Phosphate-buffered saline (PBS) (10×): 1.37 M NaCl, 27 mM KCl, 0.1 M Na2 HPO4 , 18 mM KH2 PO4 , pH 7.4. Dilute 100 mL with 900 mL water for use. 4. Phosphate-buffered saline 1× with 0.1% Triton X-100 (PBS–Triton). 5. Blocking buffer: Phosphate-buffered saline 1× with 10% fetal bovine serum (PBS–10% FBS). 6. Antibodies: ETAR rabbit antibodies (cat. no. AN-08; Alomone Labs) and ETBR rabbit antibodies (cat. no. AN04; Alomone Labs), Alexa Fluor 594, red (Invitrogen Molecular Probe, Burlington, ON, Canada), Alexa Fluor 488 conjugated Phalloidin, green (Invitrogen Molecular Probe). 7. Mounting buffer: glycerol and glycine (1:1). 8. Transparent nail polish. 9. Confocal microscope DMRBE epifluorescence photomicroscope with an argon–krypton laser (Leica).

3. Methods Uterine arteries are responsible for blood supply to the uterus. During pregnancy these vessels undergo substantial remodeling to increase blood flow to the maternal–fetal interface in order to satisfy the growing needs of the fetus. As shown in Fig. 6.1, uterine vasculature, in the rat, lies outside the uterine wall, facing the center of the abdomen. The main artery (diameter ≈290 ␮m (21)) gives rise to arcuate arteries (diameter ≈122 ␮m (2)), and then to radial arteries entering the uterine wall. 3.1. Rat Pregnancy and Mating

1. Female Sprague–Dawley rats weighing 226–250 g are mated with fertile males. 2. The next morning, a vaginal smear is obtained. About 1 mL of NaCl 0.9% solution is used in an eye dropper to repeatedly flush vagina of the rat.

Uterine Arterial Remodeling

109

Fig. 6.1 Female urogenital organs of the rat showing (insert) the organization of uterine arterial circulation. For instance, the main uterine artery from which are derived the arcuate arteries that give rise to the radial arteries (not shown) imbedded within the uterine muscle layer.

3. The vaginal washout is spread on a microscope slide and verified under a microscope for the presence of spermatozoa. The day on which spermatozoa are found in vaginal smears is labeled day 1 of pregnancy (parturition on morning of day 23). 4. Rats are sacrificed by decapitation on a precise day of gestation according to protocol. 3.2. Uterine Arteries Dissection and Preparation

Blood vessels are gently dissected under a stereo-microscope. 1. The whole uterine horn with attached vasculature is rapidly bathed in freshly prepared Krebs solution and kept on ice. 2. The uterine horn is placed in a Petri dish with the bottom covered with a silicone cushion and filled with Krebs bicarbonate solution. 3. Gently stretch the vasculature with needles (Fig. 6.2). Do not overstretch to avoid damage to the vessels. 4. To get rid of the surrounding fat, connective tissues and veins, under an optical microscope (∼10 to 50×) use 5mm spring scissor and Dumont #5 forceps. It is better to cut off surrounding tissues rather than tearing it, since the latter may modify the vessel responsiveness. 5. It is important not to squeeze with forceps the vessel segment to be isolated.

110

Scott et al. Ovary Uterus radial arteries

arcuate arteries main artery

Fig. 6.2 Schematic representation of the rat uterine arterial circulation at uterine horn border. Pushpins are shown in the corners of the drawing.

6. Fat tissue surrounding this vasculature is organized in such a way that you can gently peel off one layer over and under the preparation, but some will be left over anyway. 7. On arcuate artery, remove tissues and veins surrounding the artery to be isolated. 8. Cut the main artery at the origin of arcuate artery with small spring scissor (Fig. 6.3). 9. Gently insert one tungsten wire of 3–4 cm long through the incision you have just made. Insert the second wire along the first one. Although this seems easier, be careful not to tear apart the artery. 10. Once the two wires are in place cut the artery, as shown with dashed lines in Fig. 6.3. 11. To isolate the main uterine artery, cut all unwanted tissues (fat, arcuate arteries, and veins). You are left with the main uterine artery and vein attached at both ends with pushpins. Remove the vein and connective tissue left, holding

Tungsten wires

Fig. 6.3 Schematic representation of the insertion of an arcuate artery upon main one. Insertion of the two tungsten wires within the lumen of the arcuate artery is made through an incision in the wall of the main vessel.

Uterine Arterial Remodeling

111

Ovary Uterus radial arteries

arcuate arteries main artery

Main vein Main uterine artery

Fig. 6.4 Isolation of the main uterine artery from the uterine horn along the dashed line. Lower panel, removal of the uterine vein.

the vein with forceps cut between the two vessels all the way through (Fig. 6.4). 12. Once the main uterine artery is cleaned, cut it in segments of ∼2 mm in length. Gently insert two tungsten wires in each segment, holding the vessel with forceps at one end. 3.3. Installation of Arterial Segments in the Myograph

3.4. Nomenclature

1. Once the two tungsten wires are in place, set up the preparation in the myograph. This is used to measure the force generated by contracting muscle. It is equipped with a transducer that converts force into electrical output and a graduated micrometer device to adjust the size of the vascular segment (Fig. 6.5). This can be displayed on a computer monitor or a paper chart recorder. 2. Procedure to fix the arterial segment to the supports of the myograph is described step-by-step (Fig. 6.6). 3. Cut the wire in excess. 4. Measure the axial length of each segment using the microscope graduated eyepiece. 5. Place the whole set up in a tissue bath containing Krebs bicarbonate solution, oxygenated and maintained at 37◦ C. Change the bathing solution every ∼15–20 min when equilibrating. Nomenclature for studies of isolated microvessels is shown in Figs. 6.7 and 6.8 with the following terms. • r : radius of the wire (12.5 ␮m) • L : vessel circumference

112

Scott et al.

• f : distance (␮m) between wires measured with the micrometer • Ax.L. = Axial length (mm) • L0 : vessel circumference when tension recorded is zero • f0 : distance between the wires at L0 • L50 : circumference at an internal pressure equivalent to 50 mmHg • f50 : distance between the wires at an internal pressure equivalent to 50 mmHg

Force transducer Micrometer

Tissue bath Arterial segment

Fig. 6.5 Drawing of the myograph system current used in our laboratory, modified from parts obtained from Kent Scientific (Litchfield, CT, USA). At lower right, the two tissue supports are shown holding an arterial segment by the tungsten wires. The left support is fixed to a strain gage force transducer, the right one being attached to the graduated micrometer displacement device. The supports with the vascular segment are immersed in Krebs solution contained in the jacketed tissue bath that can be moved vertically. Drawing by Benoˆıt Sicotte with many thanks.

Fig. 6.6 Step-by-step procedure to fix the arterial segment to the supports of the myograph.

Uterine Arterial Remodeling

113

Fig. 6.7 Description of the nomenclature for studies of isolated microvessels (see Sections 3.4 and 3.5).

Multiple f50

f0 stretching steps Start

L0

L50

Fig. 6.8 Drawing of an arterial ring (segment) with the two tungsten wires apposed to each other (left). Then, wires are set apart to obtain the circumference “L0 ,” the ring being maximally stretched in the absence of any tension on the wall (middle). Finally, wires are further set apart in small steps (≈25 ␮m) to generate a length–tension curve (Fig. 6.9) to establish the circumference “L50 ” (see Sections 3.4 and 3.5).

3.5. Setting the Degree of Vessel Stretch

Passive stretch on the vessel segment is set up to obtain responses having functional relevance to the physiological behavior of the vessel. Indeed, we should determine the physical stretch to be imposed on the vessel wall to mimic transmural pressure the vessel would have in vivo. For example, the pressure in rat uterine arcuate artery is around 50 mmHg according to in vivo measurements (27) and in vitro studies (28). To determine the optimal level of tension one should apply to arterial wall, passive length– tension relationship is measured (29). 1. First, calculate the vessel circumference. Wire radius being 12.5 ␮m, the equation is as follows: L = 2 f + 4r + 2 πr L = 2 f + 4(12.5␮m) + 6.2832(12.5 ␮m) L = 2 f + 128.54 2. With myograph’s supports touching each other (f = 0 ␮m), pull apart the supports with the micrometer device until some tension is sensed by the transducer. The vessel segment is at its resting circumference (no force applied). The circumference is “L0 ,” distance between the wires being “f0 .” 3. Slightly stretch the arterial segment with measurable, but not excessive, force three times returning to L0 each time. This is done to minimize hysteresis of the vessels.

114

Scott et al.

4. From resting length (L0 ), stretch the arterial segment in steps of 25 ␮m in length (internal circumference) and hold each stretch for 2–3 min before recording wall tension for every stretch. 5. The relationship obtained by plotting tension vs internal circumference can be fitted (we use Prism software) to an exponential curve. This is the length–tension curve for each vessel segment. 6. The vessel is stretched until L50 is reached, that is defined as the internal circumference corresponding to the point on the exponential curve for which the effective transmural pressure is 50 mmHg. This is theoretically depicted by the law of Laplace (T = p × r), defining wall tension (T) in terms of pressure (p) and radius (r). When the straight line of Laplace intercepts the experimental exponential curves, abscissa reading defines the L50 (Fig. 6.9). In different physiological conditions, this curve may change its shape, either through its exponential parameter than is indicative of the stiffness or compliance of the arterial segment or through alteration of its linear component. These may occur, respectively, upon severe modification of sodium intake in the rat (30) and in pregnancy (2). 1. After set up, leave each arterial segment to rest for 30 min at L50 . 2. Challenge the arteries with 1 ␮M phenylephrine to assess responsiveness.

3.6. Concentration– Response Curves

1.20

Bath 1 Ax.L. Conversion

TmN/mm

29/11/2007

Tlaplace 50 mmHg

622

1.00 1.90

0.80

0.074 420.54

Lo Stretch μm

L μm

Transducer

TmN/mm

TIaplace 50 mmHg

25.00 50.00 75.00 100.00 125.00 150.00 175.00

470.54 520.54 570.54 620.54 670.54 720.54 770.54

0.00 0.011 0.02 0.032 0.045 0.07 0.1

0.00 0.08 0.15 0.30 0.45 0.68 0.98

0.50 0.55 0.60 0.66 0.71 0.76 0.82

Tension

Date

0.60

0.40

0.20

L50

740

F50

159.73

0.00 400.00

500.00

600.00

700.00

800.00

L μm

Fig. 6.9 Left, data table on a typical experiment describing (left to right) gradual stretch and resulting circumference, transducer reading and resulting tension, and corresponding tension values for the Laplace equation at intraluminal pressure of 50 mmHg. Right, plot of length–tension curve from these data; downward arrow indicating L50 .

Uterine Arterial Remodeling

115

3. At plateau response, test for functionality of the endothelium, with 10 ␮M carbachol, a known endotheliumdependent vasorelaxant. Whether it is planned to work on the smooth muscle exclusively or under the influence of functional endothelium, this test will help decide if the appropriate preparation is under test. To remove the endothelium several methods are available. In our experiments, these vessels, we inserted a micropipette before insertion of arterial segment into myograph (Step 3.3 above) into the vascular segment that was perfused with a Triton X-100 (0.03%, v/v) solution. 4. Wash the artery from any stimulant by changing Krebs solution three times and let the vessels rest for at least 60 min. Change Krebs solution every ∼15–20 min. 5. Then add cumulative increasing (each addition is three times higher) concentrations of any vasoconstrictor until no further increase in response is reached. Then add a ten times higher concentration of contractile agent to confirm maximum response. For example, phenylephrine concentrations from 10 nM to 10 ␮M are used. 3.7. Concentration– Response Relaxation Curves

To evaluate vasorelaxant properties of any compound or to assess the reactivity in different conditions (pregnancy, Rx treatment, etc.) to a given relaxant, concentration–relaxation curves are performed in precontracted vessels. 1. Proceed as above until Section 3.6, Step 4. 2. Add one concentration of a vasoconstrictor that gives a submaximal response. We usually use phenylephrine at 1 ␮M, but KCl or U-46619 (a thromboxane mimetic) is also used. 3. For example, add cumulative concentration of 17␤-E2 , vasorelaxant substance, and record the value when the plateau response is reached (Fig. 6.10). Some researchers use a concentration of vasoconstrictor that gives 50% of the maximum response. In our laboratory, we use a concentration producing around 80% of maximum (21). Either way, remember that such a procedure is far from being physiological and the higher the concentration of the contractile agent used, the lower the sensitivity to the vasorelaxant (31).

3.8. Preparation of Samples for Western Blotting

1. Whole uterine circulation once cleaned of fat and connective tissue (see Section 3.2) from rats is dissected from uterine horn and snap frozen in liquid nitrogen. 2. Uterine vessels are powdered with a mortar and pestle, using 2–5 uterine horns to obtain enough proteins per sample. 3. Homogenize on ice the powdered tissue in homogenization buffer #1 (1×) for NOS, ET receptors (ETR), and COX and in buffer #2 for Bax/Bcl-2 with a rotor/stator homogenizer

116

Scott et al.

Fig. 6.10 Relaxation to 17␤-estradiol of uterine artery, denuded of their endothelium, from non-pregnant and pregnant rats (21).

(Biospec Products, Inc., Bartlesville, OK, USA) 4.5-mm probe, 2 times 10 s, 35,000 rpm. 4. Centrifuge homogenates at 1,500g for 10 min and measure protein concentration in supernatant with the Bradford assay (Bio-Rad) (32). 5. Prepare aliquots of known concentration. Add Laemmli to the protein sample in a ratio of 1:4. Boil the samples for 5 min. The samples are kept at –80◦ C until use. 3.9. SDS-PAGE

This method was used with the Bio-Rad electrophoresis cell MiniProtean II. 1. Prepare a resolving gel of the appropriate concentration for the protein to be identified: 8% for NOS proteins, 10% for ETR and COX, and 15% for Bax/Bcl-2. The table indicates the mix for each concentration. Resolving gel concentration Components

8%

10%

15%

Water

6.9 mL

5.9 mL

3.4 mL

Acrylamide (30%)

4 mL

5 mL

7.5 mL

Tris (1.5 M pH 8.8)

3.8 mL

3.8 mL

3.8 mL

SDS (10%)

150 ␮L

150 ␮L

150 ␮L

APS (10%)

150 ␮L

150 ␮L

150 ␮L

TEMED

9 ␮L

6 ␮L

6 ␮L

Uterine Arterial Remodeling

117

2. Prepare the stacking gel by mixing 3.4 mL water, 830 ␮L acrylamide (30%), 630 ␮L Tris (1.5 M, pH 6.8), 50 ␮L SDS (10%), 50 ␮L APS (10%), and 5 ␮L TEMED. Pour the mix on top of the resolving gel and insert the comb. Let it polymerize for about 30 min. 3. Prepare the running buffer by diluting 100 mL of the stock solution in 900 mL of water. 4. When the gel is polymerized, assemble the gel unit and add the running buffer. Carefully remove the comb (it is easier to remove the comb when it is covered with running buffer). If necessary, you can wash the wells by gently injecting running buffer with a pipette. 5. Boil the samples for 2 min. Load an equal amount of protein for each sample in the wells including the molecular weight ladder, a positive control, and the negative control (buffer without protein). The positive control is specific to the protein you measure. We have used human endothelial lysate from an aortic cell line for eNOS, macrophage lysate from the RAW 264.7 cell line for iNOS, and rat pituitary lysate from a pituitary tumor of female Wistar-Furth rat for nNOS, all provided by the supplier of antibodies. In the western blots for ETAR, ETBR, COX-1 and COX-2, the positive control was a kidney homogenate and for Bax and Bcl-2 it was thymus homogenate. 6. Assemble electrophoresis unit and connect to a power supply. Let the samples migrate at 120 V, room temperature, until the bromophenol blue runs out of the gel (about 1.5 h). 3.10. Western Blotting

1. To transfer proteins to a nitrocellulose membrane, sponges and four pieces of 3 MM paper, the size of the sponge, are soaked in the transfer buffer. The nitrocellulose membrane, cut to the size of the gel, is put in water to get hydrated and is soaked in the transfer buffer. 2. When the migration is done, glass plates are carefully separated to recuperate the gel. The stacking gel is discarded and a corner is cut in the resolving gel to identify its orientation. The gel is soaked in transfer buffer until the assembling of the transfer “sandwich.” 3. To assemble the transfer “sandwich,” start by the cathode side of the cassette and place a sponge on it. Cover the sponge with two pieces of 3 MM paper and place the gel on top of it. Cover the gel with the nitrocellulose membrane (you can cut the corner of the membrane to identify its orientation now or after the transfer). Put the last pieces of 3 MM paper and the sponge. Make sure there is no air bubble between the layers. To do so, you damp each layer

118

Scott et al.

4.

5. 6.

7.

8. 9.

with some transfer buffer and gently roll a plastic tube to push the air away. Close the cassette and put it in the transfer tank, making sure that the membrane is between the gel and the anode. Cover with transfer buffer, close the tank, and plug in the power supply. Let transfer go on at 4◦ C, at either 75 V for 2 h or at 25 V overnight. Once transfer is complete, carefully disassemble the transfer “sandwich.” You should see the ladder on the membrane. Incubate the membrane in the blocking solution for 1 h at room temperature on a rocking platform (completely cover the membrane when rocking). Discard the blocking buffer and incubate the membrane with the primary antibody. The antibodies are dilute in the blocking buffer. See the table below for the concentration and the time of incubation of each antibody. The incubation is done on a rocking platform. These settings could change with a different batch of antibodies. Remove the antibody and wash the membrane five times for 5 min with TBST buffer. Incubate the membrane for 30 min at room temperature on a rocking platform with the secondary antibody freshly diluted in the blocking buffer. The table below shows which secondary antibody to use for every primary antibody and the dilution factor.

Antibody

Concentration

Incubation time

eNOS

1:1,000

Overnight/4◦ C

iNOS

1:5,000

Overnight/4◦ C

nNOS

1:1,000

Overnight/4◦ C

ETAR

1:500

1 h/room temp.

ETBR

1:500

1 h/room temp.

COX-1

1:200

1 h/room temp.

COX-2

1:200

1 h/room temp.

Bax

1:500

Overnight/4◦ C

Bcl-2

1:500

Overnight/4◦ C

10. Discard the secondary antibody and wash the membrane five times for 5 min with TBST buffer. 11. After washing, 1 mL of each reagent of the ECL detection system is mixed together in a tube protected from light. Pour the mix over the membrane, making sure that every part is covered, and let it react for 1 min. 12. Remove the blot from the ECL mix and gently wipe the excess with a filter paper. Place the membrane between the acetate sheets previously cut to fit in the X-ray cassette.

Uterine Arterial Remodeling

119

Primary antibody

Secondary antibody

eNOS

Sheep anti-mouse IgG horseradish 1:2,000 peroxidase-linked antibody

iNOS nNOS ETAR

” ” Donkey anti-rabbit horseradish peroxidase-linked antibody

Concentration

” ” 1:2,000

ETBR

”

”

COX-1

”

”

COX-2

”

”

Bax

”

1:5,000

Bcl-2

”

”

13. The remaining step is done in a dark room under safe light condition. Place the acetate-containing membrane in the cassette with a film for a suitable exposure time. The bands that you see should be clear but your film should not be burnt. If it is the case, reduce the exposure time. 3.11. Stripping and Reprobing the Blot

1. When satisfactory results are obtained, it is sometimes necessary to strip the membrane when the molecular weight of your internal control is similar to the one of your protein of interest. It is the case for ET receptors and actin. 2. The membrane is incubated (before it dries) in stripping buffer for two periods of 1 h at 70◦ C on a rocking platform. 3. Wash the membrane four times for 5 min in a good volume of TBST buffer on a rocking platform. It is then blocked again with the blocking buffer for 1 h. 4. The membrane is then ready to be reprobed with the antiactin mouse monoclonal antibody. You can follow the steps from 7 of the preceding section.

3.12. Tissue Preparation and Fixation for Confocal Microscopy

1. Each uterine horn is cleaned of unwanted tissues and cut in two. Pieces are mounted on two glass capillaries and put in a hand-made aluminum cup of 2 cm diameter coated with parafilm (Fig. 6.11). 2. Put the preparation on dry ice and fill out the aluminum cup just below the capillaries with OCT. Let the OCT freeze then remove the capillaries and cover the remaining tissue with OCT. 3. When the OCT is perfectly frozen, remove the aluminum cup and the parafilm. Remove exceeding OCT surrounding the tissue to shape a smaller square block (Fig. 6.12).

120

Scott et al.

Fig. 6.11 Drawing showing the mounting of uterine vascular section in a hand-made cup in order to fix it in optimal cutting temperature (OCT) compound. Note the two glass capillaries holding the main uterine artery, while uterine horn lies down in the cup.

Fig. 6.12 Drawing of two uterine horn and their circulation in one cup. Dashed lines indicate the sections of frozen optimal cutting temperature (OCT) compound to be cut to prepare the block for cutting on cryostat.

4. Wrap the block in parafilm covered by aluminum. Make sure to identify the principal artery side of the bloc. Store at – 80◦ C until use. 3.13. Slides Preparation

3.14. Confocal Immunofluorescence for ETAR and ETBR

1. Unwrap the OCT block and fix it on the support of the cryostat. Make sure you fix the uterus side and not the principal artery side of the block on the support. 2. Install the support (with the block) in the cryostat. 3. Cut the excess OCT until principal artery is reached. Then, cut arcuate artery cross-sections of 10 ␮m. 4. Place each section on a preheated slide (37◦ C). 5. Identify each slide with a pencil (pen will wear out) and store at –20◦ C. 1. Unfreeze the slides at room temperature. 2. Circle tissues with the Pap Pen as close as possible to the tissue. 3. Soak the slides in cold (–20◦ C) acetone 100% to fix the tissues (recycle acetone for subsequent use).

Uterine Arterial Remodeling

121

4. Let the slides dry at room temperature while you identify the negative control slide (no 1st Ab) and background control slide (no 2nd Ab). 5. Place the slides in a humid box to prevent drying. 6. Wash slides twice for 5 min at room temperature with PBS. 7. Block the slides with the blocking buffer (PBS with 10% FBS) at room temperature for 30 min. Then remove the blocking buffer. 8. Incubate with the 1st Ab (1/200 for ETA and 1/100 for ETB) overnight at 4◦ C. 9. Wash slides three times for 5 min at room temperature with PBS. 10. Incubate with the 2nd Ab (1/1,000 Alexa Fluor 594) for 1 h at room temperature. 11. Wash slides twice for 5 min with PBS and once for 5 min with H2 O at room temperature. 12. Put one drop of mounting solution on the tissues and place a cover slip. Make sure that there is no air bubble underneath and seal cover slip on the slide with transparent nail polish. 13. Protect from day light and store at 4◦ C. Lecture and analysis should be done as soon as possible, preferably within 1 month. 3.15. Probing for Smooth Muscle Cells (Helps Differentiate from Endothelium)

A

1. Before incubation with the 2nd Ab (Alexa Fluor 594), incubate with conjugated Phalloidin Alexa Fluor 488 (1/2,000) at room temperature for 1 h. 2. Wash slides three times for 5 min at room temperature with PBS. 3. Then repeat the protocol from the 2nd Ab incubation step (see Section 3.14, Step 10).

B

lumen endothelium smooth muscle

Fig. 6.13 Immunofluorescence to quantify receptor expression in smooth muscle in three different representative regions that are averaged (A). For endothelium quantification, use the same technique by circling the endothelium as close as possible and average (B).

122

Scott et al.

3.16. Visualization and Quantification

1. Use a confocal microscope DMRBE epifluorescence photomicroscope with an argon–krypton laser and watch slides at 488 nm (green – Phalloidin) and 522 nm (red – Alexa Fluor 594). 2. Analyze with Confocal Assistant v.4.02 software as shown below. 3. To quantify fluorescence of smooth muscle dose pixels in equal scares in three different representative regions and calculate average intensity (Fig. 6.13A). For endothelium, use the same technique by circling the endothelium as close as possible and average intensity (Fig. 6.13B).

References 1. M. Cipolla and G. Osol (1994) Hypertrophic and hyperplastic effects of pregnancy on the rat uterine arterial wall. Am J Obstet Gynecol 171: 805–11. 2. J. St-Louis, H. Pare, B. Sicotte and M. Brochu (1997) Increased reactivity of rat uterine arcuate artery throughout gestation and postpartum. Am J Physiol 273: H1148–53. 3. K.L. Page, G. Celia, G. Leddy, D.J. Taatjes and G. Osol (2002) Structural remodeling of rat uterine veins in pregnancy. Am J Obstet Gynecol 187: 1647–52. 4. B.M. Sibai (1996) Treatment of hypertension in pregnant women. N Engl J Med 335: 257–65. 5. J.J. Duvekot and L.L. Peeters (1994) Maternal cardiovascular hemodynamic adaptation to pregnancy. Obstet Gynecol Surv 49: S1–14. 6. A.R. Samadi, R.M. Mayberry, A.A. Zaidi, J.C. Pleasant, N. McGhee, Jr. and R.J. Rice (1996) Maternal hypertension and associated pregnancy complications among AfricanAmerican and other women in the United States. Obstet Gynecol 87: 557–63. 7. J.E. Buster and S.A. Carson (2001) Endocrinology and diagnosis of pregnancy. In: Obstetrics: Normal and Problem Pregnancies, Gabbe, S.G., Neibyl J.R. and Simpson, J.L. (eds). New York: Churchill Linvingstone Inc, pp. 3–36. 8. C.J. Lockwood and M.J. Paidas (2000) Preeclampsia and hypertensive disorders. In: Cherry and Merkatz’s Complications of Pregnancy, Cohen, W.R. (ed.). Philadelphia, PA: Lippincott, Williams and Wilkins, pp. 207–14. 9. I. Bernstein, S.G. Gabbe and K.L. Reed (2002) Intrauterine growth restriction. In: Obstetrics: Normal and Problem Pregnan-

10.

11.

12.

13.

14.

15.

16.

17.

cies, Gabbe, S.G., Niebyl, J.R. and Simpson J.L. (eds). New York: Churchill Livingstone, pp. 869–91. E. Roy-Clavel, S. Picard, J. St-Louis and M. Brochu (1999) Induction of uterine growth restriction with low-sodium diet fed to pregnant rats. Am J Obstet Gynecol 180: 608–13. M.M. Abitbol, G.R. Gallo, C.L. Pirani and W.B. Ober (1976) Production of experimental toxemia in the pregnant rabbit. Am J Obstet Gynecol 124: 460–70. M.M. Abitbol, M.B. Ober, G.R. Gallo, S.G. Driscoll and C.L. Pirani (1977) Experimental toxemia of pregnancy in the monkey, with a preliminary report on renin and aldosterone. Am J Pathol 86: 573–90. B.T. Alexander, S.E. Kassab, M.T. Miller, S.R. Abram, J.F. Reckelhoff, W.A. Bennett and J.P. Granger (2001) Reduced uterine perfusion pressure during pregnancy in the rat is associated with increases in arterial pressure and changes in renal nitric oxide. Hypertension 37: 1191–95. K.E. Clark, M. Durnwald and J.E. Austin (1982) A model for studying chronic reduction in uterine blood flow in pregnant sheep. Am J Physiol 242: H297–301. C.A. Combs, M.A. Katz, J.L. Kitzmiller and R.J. Brescia (1993) Experimental preeclampsia produced by chronic constriction of the lower aorta: validation with longitudinal blood pressure measurements in conscious rhesus monkeys. Am J Obstet Gynecol 169: 215–23. C. Yallampalli and R.E. Garfield (1993) Inhibition of nitric oxide synthesis in rats during pregnancy produces signs similar to those of preeclampsia. Am J Obstet Gynecol 169: 1316–20. A. Beausejour, K. Auger, J. St-Louis and M. Brochu (2003) High-sodium intake prevents

Uterine Arterial Remodeling

18.

19.

20. 21.

22.

23.

24.

pregnancy-induced decrease of blood pressure in the rat. Am J Physiol Heart Circ Physiol 285: H375–83. J.U.R.G. Bohlender, D.E.T.L. Ganten and F.C. Luft (2000) Rats transgenic for human renin and human angiotensinogen as a model for gestational hypertension. J Am Soc Nephrol 11: 2056–61. E. Takimoto, J. Ishida, F. Sugiyama, H. Horiguchi, K. Murakami and A. Fukamizu (1996) Hypertension induced in pregnant mice by placental renin and maternal angiotensinogen. Science 274: 995–98. J. St-Louis and M. Brochu (2007) Le paradoxe cardiovasculaire de la grossesse. Med Sci (Paris) 23: 944–49. P.A. Scott, A. Tremblay, M. Brochu and J. St-Louis (2007) Vasorelaxant action of 17 ßestradiol in rat uterine arteries: role of nitric oxide synthases and estrogen receptors. Am J Physiol Heart Circ Physiol Heart Circ Physiol 293, H-3713–19. C. Bourgeois, B. Robert, R. Rebourcet, F. Mondon, T.M. Mignot, P. Duc-Goiran and F. Ferre (1997) Endothelin-1 and ETA receptor expression in vascular smooth muscle cells from human placenta: a new ETA receptor messenger ribonucleic acid is generated by alternative splicing of exon 3. J Clin Endocrinol Metab 82: 3116–23. S.J. Kilpatrick, J.M. Roberts, D.L. Lykins and R.N. Taylor (1993) Characterization and ontogeny of endothelin receptors in human placenta. Am J Physiol 264: E367–72. C. Robaut, F. Mondon, J. Bandet, F. Ferre and I. Cavero (1991) Regional distribution and pharmacological characterization of [125I]endothelin-1 binding sites in human fetal placental vessels. Placenta 12: 55–67.

123

25. I.H. Chae, K.W. Park, H.S. Kim and B.H. Oh (2004) Nitric oxide-induced apoptosis is mediated by Bax/Bcl-2 gene expression, transition of cytochrome c, and activation of caspase-3 in rat vascular smooth muscle cells. Clin Chim Acta 341: 83–91. 26. F. Vega, A. Panizo, J. Pardo-Mindan and J. Diez (1999) Susceptibility to apoptosis measured by MYC, BCL-2, and BAX expression in arterioles and capillaries of adult spontaneously hypertensive rats. Am J Hypertens 12: 815–20. 27. W. Moll and W. Kunzel (1973) The blood pressure in arteries entering the placentae of guinea pig, rabbits and sheep. Pflugers Arch 338: 125–31. 28. G. D’Angelo and G. Osol (1993) Regional variation in resistance artery diameter responses to ␣-adrenergic stimulation during pregnancy. Am J Physiol 264: H78–85. 29. M.J. Mulvany and W. Halpern (1977) Contractile properties of small arterial resistance vessels in spontaneously hypertensive and normotensive rats. Circ Res 41: 19–26. 30. J. St-Louis, B. Sicotte, A. Beaus´ejour and M. Brochu (2006) Remodeling and angiotensin II responses of the uterine arteries of pregnant rats are altered by low and high sodium intake. Reproduction 131: 331–39. 31. M.M. Bradford (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72: 248–54. 32. J. St-Louis and E.L. Schiffrin (1988) Vasorelaxant effects of and receptors for atrial natriuretic peptides in the mesenteric artery and aorta of the rat. Can J Physiol Pharmacol 66: 951–56.

Chapter 7 Placental and Fetal Steroidogenesis J. Thomas Sanderson Abstract Steroid hormones are essential for maintenance of pregnancy and fetal development. The expression and catalytic activity of the key steroidogenic enzymes involved in the production of progesterone and estrogens increase during pregnancy, and there is an intricate communication between the mother, the placenta, and the fetus in order to maintain a balanced supply of the steroid hormones essential for embryogenesis. This chapter describes methods for the measurement of the expression and catalytic activity of three key cytochrome P450 (CYP) enzymes involved in the production of progesterone and estrogens, aromatase (CYP19), steroid 17␣-hydroxylase/17,20-lyase (CYP17), and cholesterol side-chain cleavage (CYP11A). Key words: Aromatase, CYP19, steroid 17␣-hydroxylase, steroid 17,20-lyase, CYP17, cholesterol side-chain cleavage, CYP11A, fetal adrenal, placenta, H295R, JEG-3.

1. Introduction Dramatic changes in steroid hormone production occur during pregnancy and fetal development (1, 2). Preparation of the uterus for implantation and maintenance of pregnancy is regulated by progesterone, a crucial steroid hormone initially produced by the corpus luteum, which is formed immediately after ovulation. The role of progesterone production is gradually taken over by the placenta as it develops during the first trimester. Key enzymes involved in the formation of progesterone from cholesterol are CYP11A (cholesterol side-chain cleavage) and type 1 3␤-hydroxysteroid dehydrogenase (3␤-HSD1) (Fig. 7.1). Luteal and placental progesterone synthesis is dependent on the delivery of (very) low density lipoproteins from the maternal circulation Julie Lafond and Cathy Vaillancourt (eds.), Human Embryogenesis: Methods and Protocols, vol. 550 © Humana Press, a part of Springer Science+Business Media, LLC 2009 DOI 10.1007/978-1-60327-009-0 7 Springerprotocols.com

127

128

Sanderson

from maternal (V)LDL/HDL) HO

Cholesterol CYP11A O

CYP17

O OH

O

CYP17

HO

HO

HO

Dehydroepiandrosterone (DHEA)

17α -Hydroxypregnenolone

Pregnenolone

sulfotransferase

3β -HSD 1

O

O

CYP21 Mineralo- and glucocorticoids

O3SO

DHEA-Sulfate O

Progesterone

fetal adrenal zone

16α-hydroxylase

O

O OH

HO

O3SO

Dehydroepiandrosterone (DHEA)

sulfatase

3β -HSD 1

16α-DHEA-S

fetal liver O

O

OH

O

O

16α-OH-Androstenedione

Androstenedione

via 17β -HSD and 16α -OH-testosterone

CYP19

OH

O

OH

HO

HO

Estrone

Estriol

placental syncytiotrophoblasts

Fig. 7.1 Steroidogenesis in the maternal-placental-fetal unit.

and intracellular hydrolysis of cholesterol esterases to free cholesterol. Another important role for progesterone is as a precursor for the fetal adrenal synthesis of glucocorticoids, mineralocorticoids, and androgens (Fig. 7.1). In addition to fetal roles for androgens, these embryonic steroid hormones, in concert with

Placental and Fetal Steroidogenesis

129

maternal androstenedione, act as precursors for the placental synthesis of estrogens. The placenta lacks the key enzyme CYP17 (steroid 17␣-hydroxylase/17,20-lyase), which converts progesterone to androgens and is thus not capable of de novo synthesis of estrogens. The lack of CYP17 is thought to be the key to the ability of the placenta to be a simultaneous producer of progesterone and estrogens without the loss of progesterone to estrogens or the overexposure of mother and fetus to potent androgens. The delicate interplay between the embryo, the placenta, and the mother allows for the localized presence of sufficient concentrations of the steroid hormones that are required for the maintenance of pregnancy and healthy progression of fetal development, and the preparation of the mother for breast feeding. Researchers are interested in the interplay between maternal, placental, and embryonic steroid hormones and in the effects of disruptions on maternal and embryonic health (3–6). Disruptions may be caused by disease, medication, diet, or exposure to environmental contaminants. Methods for the study of these interferences with steroidogenesis are important for a better understanding of the potential beneficial or deleterious effect of various chemical exposures, be they toxins or dietary constituents, on successful pregnancy and fetal development. This chapter will describe two cell systems and three enzymes important in the study of placental and fetal steroid interactions.

2. Materials 2.1. Cells and Cell Culture

1. H295R human adrenocortical carcinoma cells (cat. no. CRL 2128; American Type Culture Collection (ATCC)) are cultured in 1:1 (v/v) Dulbecco’s modified Eagle medium/Ham’s F-12 nutrient mix (DMEM/F12); 0.365 g/L L-glutamine, 1.2 g/L sodium bicarbonate, and 15 mM HEPES (Sigma–Aldrich) supplemented with 10 mg/L insulin, 5.0 ␮g/L sodium selenite, 5.5 mg/L transferrin, 500 mg/L bovine serum albumin (BSA), and 4.7 mg/L linoleic acid (ITS+1) (Sigma–Aldrich), 100 U/L penicillin/100 ␮g/L streptomycin (Sigma–Aldrich), and either (1) in Europe: 2% steroid-free replacement serum Ultroser SF (Soprachem, France), or (2) in North America: 2.5% Nu-Serum (BD Biosciences, San Diego, CA, USA). 2. JEG-3 human placental choriocarcinoma cells (cat. no. HTB-36; ATCC) are cultured in MEM (Sigma–Aldrich) supplemented (if not already in formulation) with 2 mM L -glutamine (Sigma–Aldrich), 1.5 g/L sodium bicarbonate

130

Sanderson

(Sigma–Aldrich), 1 mM sodium pyruvate (Sigma–Aldrich), 10% fetal bovine serum (FBS) (Sigma–Aldrich), and 100 U/L penicillin/100 ␮g/L streptomycin. 3. Trypsin–EDTA (Sigma–Aldrich). 4. Multi-well culture plates. 2.2. Enzyme Assays

1. 1␤ 3 H-androstenedione (cat. no. NET926; PerkinElmer, Boston, MA, USA) with a lot-dependent specific activity ranging from 15 to 30 Ci/mmol. Store at −80◦ C. 2. Dextran-coated charcoal (DCC): Prepare an aqueous solution of (w/v) 5% charcoal (Sigma–Aldrich) and 0.5% dextran (Sigma–Aldrich). Stir overnight in glass bottle and store at room temperature. 3. Phosphate-buffered saline (1× PBS): Dissolve 8 g NaCl in 800 mL deionized water, 0.2 g KCl, 1.44 g Na2 HPO4 , 0.24 g KH2 PO4 , pH 7.4, volume to 1 L and sterilize in autoclave. 4. Chloroform (reagent grade; J.T. Baker, Phillipsburg, NJ, USA). 5. Dimethyl sulfoxide (DMSO) (Sigma–Aldrich). 6. Pregnenolone (Steraloids, Inc., Newport, RI, USA). 7. Radioimmunoassays (RIAs): Dehydroepiandrosterone (DHEA, final product formed by the two CYP17 activities) RIA kit (IM1138; Immunotech, Marseille, France or DSL-8900, Diagnostic Systems Laboratories, Webster, TX, USA). Pregnenolone RIA kit (ICN Diagnostics, Costa Mesa, CA, USA). 8. Trilostane, 3␤-HSD inhibitor (Stegram Pharmaceuticals, UK). 9. 4-Hydroxyandrostenedione (formestane) (cat. no. F2552; Sigma–Aldrich). 10. SU-10603, CYP17 inhibitor (Novartis, Summit, NJ, USA). 11. 22R-OH-cholesterol (cat. no. H9384, Sigma–Aldrich).

2.3. RNA Isolation and RT-PCR

1. TriReagent (Sigma–Aldrich). 2. Agarose: electrophoresis grade (Sigma–Aldrich). 3. Tris–Borate–EDTA (TBE) 10× buffer (Sigma–Aldrich). Dilute to 1× working strength for agarose gel-electro phoresis. 4. Ethidium bromide 10 mg/mL (Fluka, Sigma–Aldrich). 5. Chloroform reagent grade (J.T. Baker, Phillipsburg, NJ, USA). 6. DMSO (Sigma–Aldrich). 7. Isopropanol molecular biology grade (Sigma–Aldrich). 8. Ethanol anhydrous, reagent grade (J.T. Baker). 9. Access RT-PCR kit (cat. no. A1280; Promega, Madison, WI, USA). 10. Various primers (Table 7.1).

Primer pairs

fw: TTA-TGA-GAG-CAT-GCG-GTA-CC rv: CTT-GCA-ATG-TCT-TCA-CGT-GG

fw: TCTGTCCCTTTGATTTCCACAG rv: GCACGATGCTGGTGATGTTATA

fw: GCT-GCA-ATT-CAA-GCC-AAA-AG rv: GCA-CGA-TGC-TGG-TGA-TGT-TAT-A

fw: GGA-TCT-TCC-AGA-CGT-CGC-GA rv: CAT-GGC-TTC-AGG-CAC-GAT-GC

fw: GGC-ATC-ATA-GAC-AAC-CTG-AGC rv: CAC-TGA-TAG-TTG-GTG-TGC-GG

fw: CCT-GCA-GTG-GCA-CTT-GTA-TG rv: GGT-CAT-CTC-TAG-CTC-AGC-GA

fw: AAA-CTA-CCT-TCA-ACT-CCA-TC rv: ATG-ATC-TTG-ATC-TTC-ATT-GT

Target transcript

CYP19-exon II

CYP19-pII

CYP19-I.3

CYP19-I.1

CYP17

CYP11A

Beta-actin

163 bp

418 bp

425 bp

118 bp

187 bp

112 bp

314 bp

Expected product size

Mg2+ concentration 0.75 mM 1.0 mM 1.0 mM 1.0 mM 0.5 mM 1.0 mM 2.0 mM

Annealing temperature 57◦ C 61◦ C 61◦ C 60◦ C 58◦ C 55◦ C 54◦ C

25

40

40

35

35

35

40

Number of cycles

Table 7.1 Details of the RT-PCR conditions used for the amplification of various transcripts and the household gene beta-actin. All other conditions are as described in the Access RT-PCR kit provided by Promega Corporation

Placental and Fetal Steroidogenesis 131

132

Sanderson

3. Methods Various cell types may be used for the study of human steroidogenesis, including freshly isolated cells obtained from term or first trimester (aborted) placenta, from biopsies (adrenal cortex, prostate, breast), or human cancer cell lines, such as H295R adrenocortical carcinoma, JEG-3, and BeWo choriocarcinoma and LNCaP human prostate cancer cells. Cells are generally adherent and are cultured in multi-well plates. Cells that are useful for the study of human embryonic steroidogenesis are freshly isolated placental cells, human placental cancer cells, such as JEG-3 choriocarcinoma cells, and H295R human adrenocortical cancer cells, which have the functional characteristics of the fetal adrenal gland (7). Key rate limiting steps in the synthesis of progesterone and androgens and estrogens are the cytochrome P450 enzymes CYP11A, CYP17, and CYP19 (8–10). Methods for the determination of the catalytic activity of CYP11A, CYP17, and CYP19 in JEG-3 or H295R cells are described below. 3.1. Cell Culture

1. Thaw cells (stored in liquid nitrogen) rapidly in a 37◦ C water bath and transfer immediately to their appropriate warm culture medium in a 15-mL plastic conical culture tube. 2. Centrifuge cell suspension at 150g for 5 min to remove the freezing medium. Resuspend cell pellets in 15 mL medium and transfer to 25 cm2 culture flasks. 3. Allow 2–3 days for sufficient cells for passage into 75 cm2 flasks. 4. To freeze excess cells of low passage number in liquid nitrogen for future use (see Note 1), transfer cells at a density of 5×106 cells/mL into freezing medium (recommended growth medium plus 10% DMSO). Freeze cells gradually to a temperature of −80◦ C (with the aid of a cryogenic unit or isopropanol-insulated container), then transfer cells to liquid nitrogen. 5. For the study of the effects of test chemicals or other treatments on steroidogenic enzyme activities or expression, cells are usually plated at a density of 1–2 × 105 cells/mL in 12–96 well plates on day 1, exposed to the test compounds in fresh medium on day 2, and harvested for enzymatic studies 24 h later.

3.2. Aromatase Assay

The catalytic activity of aromatase is determined using a modification of the method of Lephart and Simpson (11) as published by Sanderson and coworkers (12, 13).

Placental and Fetal Steroidogenesis

133

1. Prepare a sufficient volume of working solution of 54 nM 3 H-androstenedione in warm (37◦ C) serum-free cell culture medium. 2. Remove cell culture medium from 24-well plates and wash cells once with warm PBS 1×. 3. Add 250 ␮L of working solution to each well and place plates in incubator for 1.5 h (dependent on the activity level) at 37◦ C in an atmosphere of 5% CO2 and 95% air. 4. Add 10 ␮L of remaining working solution, in duplicate, directly to a scintillation vial. This is to verify the concentration of your working solution. 5. Add 200 ␮L of remaining working solution, in duplicate, directly to a 1.5-mL vial containing 500 ␮L chloroform. These are blanks. 6. Prepare two sets of labeled 1.5-mL vials for the chloroform extraction and dextran–charcoal treatment of the samples. 7. After the incubation, place the cells on ice, withdraw exactly 200 ␮L of the medium from each well and transfer to a 1.5-mL vial containing 500 ␮L chloroform. 8. Vortex each vial (including blanks) vigorously for 15 s and spin at 11,000g for 2 min. 9. Transfer carefully 100 ␮L of the aqueous supernatant to the second set of vials containing 100 ␮L dextran-coated charcoal solution. This mixture is vortexed for 15 s and allowed to stand for 5 min. Then spin at 11,000g for 15 min (see Note 2). 10. Transfer 125 ␮L of supernatant to scintillation vials (see Note 2), add 4 mL of scintillation cocktail and count for 10 min in a liquid scintillation counter using quench correction to obtain the number of disintegrations per minute for each sample. Calculation of catalytic activity is described in detail in Section 4 (see Note 3). 3.3. Aromatase mRNA Expression – RNA Isolation and RT-PCR

1. Place 12-well plates containing cells on ice and remove medium. Perform all further steps at 4◦ C (unless stated otherwise) under RNase-free conditions. 2. Wash cells twice with 2 mL PBS 1×. 3. Add 0.5 mL TriReagent reagent, incubate for 5 min, and then scrape cells using tip of pipette and transfer to 1.5-mL vials. Follow the standard protocol supplied with the TriReagent kit to obtain total RNA of the cells in each well. 4. The yield of total RNA is determined spectrophotometrically as follows: A (260 nm) × 0.04 ␮g RNA/␮L × dilution factor = total RNA concentration in ␮g/␮L The purity of RNA is determined by measuring the ratio A260 nm/A280 nm. Pure RNA has a ratio of 2, but extractions generally yield a ratio of 1.8 or higher.

134

Sanderson

5. RNA samples are diluted to an appropriate concentration (usually between 10 and 300 ng/␮L) in nuclease-free water. 6. One-step RT-PCR using an Access RT-PCR kit is performed according to the instructions of the supplier. Amplification conditions require optimization that is dependent on the template and the primers (see Table 7.1). 7. Amplified DNA fragments are separated on 2% agarose gels containing 50 ␮g ethidium bromide/100 mL gel. 3.4. Steroid 17␣-Hydroxylase/17, 20-Lyase (CYP17) Assay

The catalytic activity of CYP17 is determined using a modification of the method described by Canton et al. (14). This assay applies only to H295R cells as JEG-3 cells do not express CYP17. 1. Remove cell culture medium from 24-well plates and wash cells once with warm PBS 1×. 2. Incubate cells at 37◦ C with 1 mL of a 100 nM pregnenolone solution in serum-free medium also containing 1 ␮M of the 3␤-HSD inhibitor trilostane. Incubation times can vary from 30 to 90 min depending on the activity present in the cells. 3. CYP17 activity is measured by DHEA RIA kit according to the manufacturer’s instructions. One should be aware that the DHEA RIA demonstrates cross-reactivity with progesterone at concentrations above the 100 nM chosen for the catalytic assay. 4. As positive control for inhibition of CYP17 activity 1 ␮M SU-10603 is used. 5. The mRNA expression of CYP17 is determined by RT-PCR as described under Section 3.3 using the appropriate primer pair (see Table 7.1).

3.5. Cholesterol Side-Chain Cleavage (CYP11A) Assay

This method is a modification of those reported by Moore et al., Ness and Kasson, and Johansson and coworkers (15–17). 1. Remove cell culture medium from 24-well plates and wash cells once with warm 1× PBS. 2. Incubate cells for 15–30 min (check for linearity) at 37◦ C with 0.5 mL of a 1 ␮M 22R-OH-cholesterol solution in serum-free medium also containing 1 ␮M of the 3␤-HSD inhibitor trilostane and 1 ␮M of the CYP17 inhibitor SU10603. 3. Place plates on ice and transfer 0.4 mL of the reaction medium to plastic vials. Freeze until ready for pregnenolone measurement. 4. Pregnenolone concentrations are determined using a commercial RIA kit according to the manufacturer’s instructions. 5. The mRNA expression of CYP11A is determined by RTPCR as described under Section3.3 using the appropriate primer pair (see Table 7.1).

Placental and Fetal Steroidogenesis

135

4. Notes 1. An important aspect of cell culture to be kept in mind is that with increasing passage number cell characteristics tend to change. In the case of JEG-3 and H295R cells, experiments are ceased after about 40 passages as responses to know that pharmacological inducers of the enzymes under study start to decrease significantly. It is necessary to include positive controls for enzyme induction in each experiment. 2. When performing the aromatase assay, the final step of extraction with dextran-coated charcoal is crucial. It may occur that the dextran-coated charcoal pellet is disrupted during the transfer of the supernatant to liquid scintillation vials. In this case the sample needs to be recentrifuged, either for a longer time period or at greater speed. 3. The activity of aromatase is corrected for the distribution of 3 H-label on the androstenedione molecule, which is 25.7% at the 1␣-position and 74.2% at the 1␤-position (18). The release of tritiated water by the cells should be linear over time. Aromatase activity is expressed in picomoles of androstenedione converted per hour per milligram protein. The specificity of the aromatase assay based on the release of tritiated water should be verified by measuring the production of estrone (the aromatization product of androstenedione), using a 125 I-labeled double-antibody radioimmunoassay kit (cat. no. DSL-8700; Diagnostic Systems, Inc., USA) or by incubating cells in the presence of 4-hydroxyandrostenedione, an irreversible inhibitor of the catalytic activity of aromatase, to block the formation of tritiated water (19). Experiments that involve exposing cells to test chemicals should include negative controls (solvent; preferably DMSO or ethanol at 0.1%), a positive control for aromatase inhibition (e.g., 4-hydroxyandrostenedione) and a positive control for induction, which is highly cell type-dependent (cyclic AMP analogs for gonads and adrenal cortex, phorbol esters for placenta, or glucocorticoids for adipose and breast).

References 1. Braunstein, G. D. (2002) Endocrine Changes in Pregnancy (P. R. Larsen, Eds., 10th ed., pp. 795–810). Saunders, Philadelphia, PA.

2. Fisher, D. A. (2002) Endocrinology of Fetal Development (P. R. Larsen, Ed., 10th ed., pp. 811–841). Saunders, Philadelphia, PA.

136

Sanderson

3. Albrecht, E. D. and Pepe, G. J. (1999) Central integrative role of oestrogen in modulating the communication between the placenta and fetus that results in primate fecal-placental development. Placenta 20, 129–139. 4. Wood, C. E. (2005) Estrogen/hypothalamuspituitary-adrenal axis interactions in the fetus: the interplay between placenta and fetal brain. J Soc Gynecol Investig 12, 67–76. 5. Pepe, G. J. and Albrecht, E. D. (1995) Actions of placental and fetal adrenal steroid hormones in primate pregnancy. Endocr Rev 16, 608–648. 6. Pepe, G. J. and Albrecht, E. D. (1990) Regulation of the primate fetal adrenal cortex. Endocr Rev 11, 151–176. 7. Staels, B., Hum, D. W. and Miller, W. L. (1993) Regulation of steroidogenesis in NCI-H295 cells: a cellular model of the human fetal adrenal. Mol Endocrinol 7, 423–433. 8. Miller, W. L. (1988) Molecular biology of steroid hormone synthesis. Endocrine Rev 9, 295–318. 9. Miller, W. L. (2005) Minireview: regulation of steroidogenesis by electron transfer. Endocrinology 146, 2544–2550. 10. Simpson, E. R., Mahendroo, M. S., Means, G. D., Kilgore, M. W., Hinshelwood, M. M., Graham-Lorence, S., Amarneh, B., Ito, Y., Fisher, C. R., Michael, M. D., et al. (1994) Aromatase cytochrome P450, the enzyme responsible for estrogen biosynthesis. Endocr Rev 15, 342–355. 11. Lephart, E. D. and Simpson, E. R. (1991) Assay of aromatase activity. Methods Enzymol 206, 477–483. 12. Heneweer, M., van den Berg, M. and Sanderson, J. T. (2004) A comparison of human H295R and rat R2C cell lines as in vitro screening tools for effects on aromatase. Toxicol Lett 146, 183–194.

13. Sanderson, J. T., Seinen, W., Giesy, J. P. and van den Berg, M. (2000) 2-Chloro-s-triazine herbicides induce aromatase (CYP19) activity in H295R human adrenocortical carcinoma cells: a novel mechanism for estrogenicity? Toxicol Sci 54, 121–127. 14. Canton, R. F., Sanderson, J. T., Nijmeijer, S., Bergman, A., Letcher, R. J. and van den Berg, M. (2006) In vitro effects of brominated flame retardants and metabolites on CYP17 catalytic activity: a novel mechanism of action? Toxicol Appl Pharmacol 216, 274–281. 15. Moore, R. W., Jefcoate, C. R. and Peterson, R. E. (1991) 2,3,7,8-tetrachlorodibenzo-pdioxin inhibits steroidogenesis in the rat testis by inhibiting the mobilization of cholesterol to cytochrome P450scc. Toxicol Appl Pharmacol 109, 85–97. 16. Ness, J. M. and Kasson, B. G. (1994) Induction of rat granulosa cell steroidogenic enzyme activities and their messenger ribonucleic acids by a splenocyte-derived factor. Mol Cell Endocrinol 106, 163–170. 17. Johansson, M. K., Sanderson, J. T. and Lund, B. O. (2002) Effects of 3-MeSO2DDE and some CYP inhibitors on glucocorticoid steroidogenesis in the H295R human adrenocortical carcinoma cell line. Toxicol In Vitro 16, 113–121. 18. Krekels, M. D. W. G., Wouters, W., DeCoster, R., Van Ginckel, R., Leonaers, A. and Janssen, P. A. J. (1991) Aromatase in the human choriocarcinoma JEG-3, inhibition by R 76 713 in cultured cells and in tumors grown in nude mice. J Steroid Biochem Mol Biol 38, 415–422. 19. Brodie, A. M., Hammond, J. O., Ghosh, M., Meyer, K. and Albrecht, E. D. (1989) Effect of treatment with aromatase inhibitor 4hydroxandrostenedione on the nonhuman primate menstrual cycle. Cancer Res 49, 4780–4784.

Chapter 8 Current Methods in Investigating the Development of the Female Reproductive System Patrick J. Devine, Patricia B. Hoyer, and Aileen F. Keating Abstract The female reproductive system is important as the site for development and fertilization of an oocyte, for implantation and development of an embryo, and for growth and delivery of the fetus. It also produces protein and steroid hormones that help maintain a female’s health. Although the female phenotype is the default pathway for the development of the urogenital system, many processes can become disrupted during and after development which may originate from developmental problems. Improper development can be the underlying cause of structural malformations, sub- or infertility, hormonal abnormalities, endometriosis, carcinogenesis, or other detrimental outcomes. Our research programs examine the normal physiology and function of the female reproductive system and how it can become damaged due to pathologies or environmental/therapeutic exposures, with a focus on the ovary, ovarian follicles, and ovarian hormones. This chapter will describe detailed protocols of an in vitro organ culture system and methods to analyze changes in follicle formation, follicle development, and ovarian physiology. These methods can also be applied to the study of other aspects of female reproduction. Key words: Ovary, in vitro culture, follicle, quantitative RT-PCR, microarray analysis, immunohistochemistry, reproduction, methodology.

1. Introduction Neonatal ovarian cultures are appropriate for examining follicle formation (1, 2), the role of growth factors in follicle growth activation (3–7), and effects of xenobiotic chemicals on ovarian follicle populations (8–11). We have used both rat and mouse ovaries from neonatal (postnatal day 4; PND4) rodents, either from an established breeding colony or from purchased pregnant rodents. Since follicle formation is occurring just before and during this Julie Lafond and Cathy Vaillancourt (eds.), Human Embryogenesis: Methods and Protocols, vol. 550 © Humana Press, a part of Springer Science+Business Media, LLC 2009 DOI 10.1007/978-1-60327-009-0 8 Springerprotocols.com

137

138

Devine, Hoyer, and Keating

period in rodents (12), it is a critical developmental window that requires further characterization. The culture technique relies on diffusion of oxygen from above and nutrients from below the cultured neonatal ovary to penetrate throughout the small tissue. The culture medium used does not include serum, but does contain albumin. The method was developed in Dr. Michael Skinner’s laboratory (13) and was a modification from one described by Dr. Gerald Cunha’s laboratory for the culturing of seminal vesicle and bulbourethral glands (14). We have predominantly used cultures to examine the molecular mechanisms underlying ovarian follicle loss caused by chemical exposures. Effects observed in vitro appear to mimic those that occur in vivo.

2. Materials In all solutions except those used in histological processing, distilled, deionized water (ddi H2 O) is used. 2.1. In vitro Ovarian Culture

1. 48-Well culture plates (or other sized plates). 2. Millicell CM culture plate inserts: sterile, 0.4 ␮m, 30 mm diam., made from polytetrafluoroethylene. 3. Bottle-top filters: 150 mL, cellulose acetate, 0.4 ␮m, 35 mm neck. 4. 100-mL glass bottle or 50 mL centrifuge tubes: sterile, for preparing medium. 5. Microfuge tubes: autoclaved, sterile, for preparing solutions. 6. Surgical instruments (autoclaved, sterile): one large pair of scissors (for decapitation), two small pair of scissors (for collecting ovaries), two small forceps (for collecting ovaries), two fine forceps straight, 11 cm (for trimming ovaries). 7. Incubator: sterile, humidified, 37◦ C, 5% CO2 in air. 8. 70% Ethanol. 9. Ham’s F-12/DMEM (Dulbecco’s modified Eagle’s medium): 1:1 mix, without phenol red or HEPES (see Note 1). 10. Bovine serum albumin (BSA). 11. Albumax II. 12. Ascorbic acid. 13. Transferrin. 14. Penicillin/streptomycin (1,000×) : 5,000 U/mL, 5 ␮g/ mL, respectively. 15. Hank’s buffered saline: without CaCl2 , MgCl2 , MgSO4 , or phenol red.

Methods to Study Ovarian Physiology

139

16. Formaldehyde: 4% in PBS. 17. Bouin’s fixative: 75 mL picric acid, 25 mL 37% formaldehyde, 5 mL glacial acetic acid. 2.1.1. Stock Solutions for Culture Medium Reagents

1. BSA (200×) 200 mg/mL: 1 g in ddi H2 O to 5 mL (final volume), add water only up to 5 mL once solid dissolves. 2. Albumax (100×) 100 mg/mL: 1 g in 10 mL ddi H2 O (final volume). 3. Ascorbic acid (1,000×) 50 mg/mL: 250 mg in 5 mL ddi H2 O. 4. Transferrin (1,000×) 27.5 mg/mL: dissolve 50-mg vial in 1.82 mL H2 O. Prepare as sterile as possible, then aliquot into autoclaved tubes in volumes a little more than what is required for a 50 mL batch of medium (recipe for ovary culture medium, see Section 2.1.2), e.g., 75 ␮L of ascorbic acid. Store at −80◦ C. Good for 1 year or more.

2.1.2. Ovary Culture Medium

1. In 49.1 mL Ham’s F-12/DMEM (50/50), add 250 ␮L BSA (200×), 500 ␮L albumax (100×), 50 ␮L ascorbic acid (1,000×), 50 ␮L transferrin (1,000×), 50 ␮L penicillin/streptomycin (1,000×). 2. Sterilize by filtering through bottle-top filter in sterile flow hood, store in sterile 50-mL tube or 100-mL bottle at 4◦ C. Good for 2 weeks.

2.2. Total RNA Isolation from Cultured Ovaries

All kits are from Qiagen. 1. RNAlater (cat. no. AM7020; Ambion, Austin, TX, USA). 2. Qiashredder kit (cat. no. 79654; Qiagen, Valencia, CA, USA). 3. RNeasy Mini kit (cat. no. 74104; Qiagen). 4. DNAse treatment kit (cat. no. 79254; Qiagen).

2.3. Protein Isolation from Cultured Ovaries

1. Lysis Buffer: pH 7.5, bring to 250 mL with ddi H2 O. Store at 4◦ C. Reagent a. ddi H2 O b. Triton X-100 c. HEPES d. NaCl e. Glycerol f. Sodium fluoride (NaF) g. EDTA h. Sodium dodecyl sulfate (SDS)

Amount 200 mL 2.5 mL 12.5 mL 2.19 g 25 mL 524 mg 186.1 mg 250 mg

Final concentration 1% 50 mM 150 mM 10% 50 mM 2 mM 0.1%

140

Devine, Hoyer, and Keating

2. Just prior to each use, the following should be added to the Lysis Buffer to give the final concentrations listed: 10% proteinase inhibitor cocktail (cat. no. P8340; Sigma–Aldrich, St. Louis, MO, USA) or 1 mM phenylmethanesulfonyl fluoride (PMSF; cat. no. 93482; Sigma–Aldrich), 10 ␮g/mL leupeptin (cat. no. L9783; Sigma–Aldrich), 10 ␮g/mL aprotinin (cat. no. A6279; Sigma–Aldrich), 1 mM sodium orthovanadate (cat. no. S6508; Sigma–Aldrich). 3. Pierce BCA assay kit (cat. no. 23227; Thermo Scientific, Rockford, IL, USA). 2.4. Microarray Hybridization Protocol

1. Nuclease-free H2 O. 2. RNA amplification kits (used prior to hybridizations): a. MessageAmp Amplified RNA (aRNA) kit for cDNA arrays (cat. no. 1750; Ambion). b. MessageAmp aRNA kit for RNA hybridizations (cat. no. 1752; Ambion). c. SenseAmp kit for oligo arrays (cat. no. RAMP110 or RAMP120 SenseAmp; Genisphere, Hatfield, PA, USA). 3. EndoFree RT kit (cat. no. 1740; Ambion). 4. dNTP mix: 10 mM. 5. Amino allyl dUTP’s: 2 mM (cat. no. A-21664; Molecular Probes, through Invitrogen, Carlsbad, CA, USA). 6. Two appropriate amine-reactive fluorescent dyes: we use Alexa Flours 555 and 647 (cat. no. A-32755; Molecular Probes) aliquoted in single-use volumes, protected from light and stored at −80◦ C. 7. Cot-1 DNA: 1 ␮g/␮L. 8. Formamide solution: protect from atmosphere by storing in sealed tubes away from light. 9. ddi H2 O: filtered with a 0.2-␮m bottle-top filter. 10. SSC solution (20×): 1 L (cat. no. 9763; Ambion). 11. PCR product column purification kit (cat. no. 28104; Qiagen). 12. DyeSaver2 anti-fade solution: Protect from light (cat. no. Q500500; Genisphere). 13. Dimethylsulfoxide (DMSO). 14. Printed microarray slide(s). 15. Beakers (150 mL): minimum of four per pair of samples. 16. Atlas glass hybridization chamber: minimum of two per pair of samples (cat. no. 7899-1; BD Biosciences, San Jose, CA, USA). 17. Microcentrifuge elution tubes: 2.0 mL. 18. PCR tubes: 0.2 mL. 19. Bottle-top filters with attached sterile bottle. 20. NaOH: 1 M. 21. HCl: 1 M.

Methods to Study Ovarian Physiology

22. 23. 24. 25. 26. 27. 28.

29. 30.

2.5. Quantitative Real-Time Polymerase Chain Reaction

2.6. Fluorescent Immunohistochemistry

141

SDS 10% solution (see Note 2). EDTA: 0.5 M, pH 8.0. Poly-dA: 1 ␮M, 18-mer, dilute to 10 ␮g/␮L. Random hexamers: for use with amplified RNA samples, dilute to 1 ␮g/␮L. Ethanol 75%. Sodium bicarbonate working solution: 25 mg/mL, prepare fresh each time. Hybridization buffer (2×): 112 ␮L of SSC solution (20×), 168 ␮L of formamide solution, 5.6 ␮L of 10% SDS solution. Mix in SDS last at room temperature. Make ∼285 ␮L or enough for four hybridizations. TX1065 wipes (cat. no. TWTX1065 VWR; West Chester, PS, USA). GeneTac hybridization station (Genomic Solutions, Inc., Ann Arbor, MI, USA).

1. Nuclease-free H2 O. TM R 2. QuantiTect SYBR Green PCR kit (cat. no. 204143; Qiagen). 3. MgCl2 25 mM. R 4. SYBR Green I Dye: Diluted 1 ␮L with 999 ␮L nucleasefree H2 O from original stock solution. 5. Specific primer pairs for gene of interest: 100 pmol/␮L stock solutions in nuclease-free H2 O, make a working solution of equal amounts of both forward and reverse primers. 6. PCR tubes and caps: 0.1 mL. 7. Microcentrifuge tubes: 0.5 and 1.5 mL. 8. Metal PCR tube holder: cooled to 4◦ C (DO NOT cool holder in freezer). 9. Rotor-Gene 3000 (RG 3000) or other thermocycler. 10. Superscript III reverse transcriptase enzyme (cat. no. 18080-044; Invitrogen). 11. House-keeping genes: ␤-actin, L17, and cyclophilin. 1. 2. 3. 4.

Snowcoat slides (Surgipath, Richmond, IL, USA). Citrisolv (can substitute xylene or toluene for this). Ethanol, histology grade. Phosphate-Buffered Saline (PBS): 8.18 g NaCl, 0.2 g KCl, 1.84 g Na2 HPO4 , dissolve in 800 mL ddi H2 O, pH 7.2– 7.4, 1L final volume. 5. Diluant: PBS, pH 7.2–7.4, containing 1% BSA and 0.5% Tween 20. (for 50 mL PBS, add 0.25 mL of 200 mg/mL BSA (in water) and 0.25 mL of Tween 20). 6. Blocking solution (5% BSA/PBS): 1 mL of 200 mg/mL BSA + 3 mL of PBS 1×. 7. Sodium citrate buffer 10 mM: 2.94 g sodium citrate, 800 mL ddi H2 O, pH 6.0, dilute to a final volume of 1 L.

142

Devine, Hoyer, and Keating

8. Primary antibody solution: (test to determine best concentration or based on manufacturers’ suggestions (see Note 3)) dilute with diluant. 9. Secondary antibody solution: (test to determine best concentration or based on manufacturers’ suggestions) dilute with diluant. 10. Streptavidin-conjugate solution: mix with appropriate amount of diluant. Streptavidin-conjugates that can be used include Texas Red-Streptavidin at a dilution of 1:50 (cat. no. SA-1200; Vector Laboratories, Burlingame, CA, USA), Alexa Fluor 568 or Alexa Fluor 488 at a dilution of 1:100 (cat. nos. S11226 or S11222, respectively; Molecular probes), or others that are commercially available. 11. Hoechst 0.1 mg/mL: dilute in 1× PBS to get 0.01 mg/mL (cat. no. B2883; Sigma–Aldrich). 12. Vector blocking kit (cat. no. SP-2002; Vector). 13. Oven capable of reaching 60◦ C. 14. Coplin jars. 15. Disposal low-lint wipers (Kimwipes). 16. Plastic or glass coverslips or Pap pen. 17. Nail polish.

3. Methods 3.1. Whole Early Postnatal Ovary Culture

Although we manipulate and dispense culture medium under a sterile laminar flow hood, other steps are done on the laboratory bench, wiping down all surfaces and utensils with 70% alcohol. In order to optimize the system, pups are sacrificed one litter at a time, working quickly to place ovaries into culture (see Note 4), and culture medium is changed every 2 days and is made fresh every 2 weeks.

3.1.1. Setting Up the Floating Filter Culture System

All steps are done in sterile laminar flow hood before ovaries are isolated. 1. Cut the membrane of Millicell culture plate inserts using a razor or scalpel into ∼14 pieces of about 10–20 mm2 (utensils should be autoclaved and also sterilized by wiping with 70% alcohol). 2. Pipet 250 or 500 ␮L medium or treatment solutions into wells of 48-well culture plates. 3. Lay one piece of Millicell membrane onto the surface of the medium in each well (Fig. 8.1C). The number of wells to be set up can be determined by examining the number of females the day prior to ovary culture, but extra wells should be prepared for mis-sexed pups. Ensure that the top surface

Methods to Study Ovarian Physiology

143

Fig. 8.1 Isolation of neonatal ovaries and establishment of whole ovarian culture system. (A) The location of the ovary lies in a fat pad at the bottom of the kidney. The easiest way to remove the ovary is by grasping the uterus near the ovary, cutting the fat and ovary away from the kidney (cut #1) then cutting the uterus on the other side of the forceps (cut #2). (B) The ovary and attached tissue are then placed in a Petri dish containing buffer. Under a dissecting microscope, the remaining fat, connective tissue, and oviduct are removed with two pairs of fine forceps. (C) The isolated ovary is then placed onto a piece of nitrocellulose membrane floating on medium in the well of a culture plate.

of the membrane is dry otherwise, there is a higher risk that the ovary will fall from the membrane during culture medium replacement. 4. Put the plates in incubator to equilibrate (≤30 min before ovary collection). 3.1.2. Ovary Collection and Culture Set Up

1. Autoclave surgical instruments and wipe down with 70% alcohol before use. 2. Expose one litter of 4-day-old female rats or mice to CO2 inhalation (takes longer than adults, leave in gassed container

144

Devine, Hoyer, and Keating

3.

4.

5.

6.

for about 4 min), then decapitate with scissors. Can also decapitate pups directly without exposing to CO2 . Spray pups with ethanol and dissect out reproductive tract, including part of uterus, fat, oviducts, and ovaries, so that ovaries are not lost (Fig. 8.1A). Ovaries are just below the kidney in a small mass of fat (Fig. 8.1A,B). Place tissues into Petri dishes with Hank’s buffered saline on ice, ten ovaries or less per dish (see Note 4). Under a dissecting microscope, use fine forceps to gently dissect ovaries away from oviduct, fat, and connective tissue (Fig. 8.1B). Gently tear the membrane surrounding the ovary and peel it around to one side. Gathering all of the unwanted tissue to one side, it can be cut off all at once. Cutting off unwanted tissue can be done by squeezing the tissue to be cut between one forceps and running the other forceps along the line formed by the closed forceps tongs of the first pair (see Fig. 8.1B). Some connective tissue can be left on as a way of manipulating the ovary for subsequent steps. Do not use an ovary if it is damaged or torn, because follicle growth will be inhibited around the tear. Using fine forceps, place each ovary onto a piece of membrane (Fig. 8.1C, see Notes 5 and 6). Place a drop of medium from that well onto the membrane so that it covers the entire ovary (drop should be ∼4× the size of the ovary). You can use forceps to transfer a small amount of the medium. Medium can also be placed onto the ovary using a micropipette. Culture in humidified incubator at 37◦ C, 5% CO2 . Every 2 days (see Note 7), in a sterile laminar flow hood, carefully and slowly remove and replace medium (see Note 8). If any ovaries are found at the bottom of the well rather than on the surface of the membrane, they should be discarded.

3.1.3. Fixing and Processing Ovaries

Fix 2 h-overnight in Bouin’s or formaldehyde in wells by replacing medium with fixative or in other plates or tubes. Minimal manipulation of ovaries is advised – they can be manipulated by handling only the membrane if the ovary remains attached or by using a glass pipette. Ovaries should be placed within folded weigh paper before putting them in histocassettes to avoid loss during histological processing. They should be embedded flat so that the largest cross-sections can be obtained (sections are cut parallel to the page in the top image of Fig. 8.2). Bouin’s is the best fixative for Hematoxylin and Eosin staining (H&E), because staining is optimal. Formaldehyde or paraformaldehyde is best for immunohistochemistry.

3.1.4. Evaluation of Follicle Populations

Ovaries are processed histologically by cutting and mounting serial sections at 5 ␮m thickness and staining with H&E.

Methods to Study Ovarian Physiology

145

Fig. 8.2 Morphological characterization of neonatal rat ovaries cultured in vitro. Cultured PND4 rat ovaries were cultured for 15 days in normal culture medium. Ovaries were fixed in Bouin’s fixative, processed for histology, serially sectioned and stained with Hematoxylin and Eosin (H&E). Images of each section were taken using a 40× objective on an upright microscope (Leica), merged into single image per section (C-Imaging Systems, Compix, Inc., Sewickley, PA, USA), and three-dimensional reconstruction was performed using the software Amira (Visage Imaging, Carlsbad, CA, USA), manually identifying various regions. Yellow = primordial and small primary (<10 gc’s) follicles, blue = small (between 10 – 20 gc’s) and large primary, secondary follicles, orange = connective tissue, aqua = ovarian surface.

Alternatively, specific sections can be selected and mounted for counting, while the other sections could be used for other endpoints. Every sixth section is counted for cultured neonatal ovaries, depending upon the sizes and stages of follicles that are present. This is done to allow counts to be a representative sampling of the ovary without counting the same follicle multiple times. Follicles should only be counted if the nucleus is present (see Note 9). Additionally, if a section is folded, the next section should be counted instead. Follicle classification is done as described by Pedersen and Peters (15) and is described in Table 8.1. Follicles can also be found in a transitional state between primordial and primary stages that are identified differently by different groups. We hide the sample identity prior to counting to avoid possible observer bias. Typically, cultured ovaries contain many primordial follicles that remain apparently dormant throughout the culture period and are dispersed throughout the ovary (Fig. 8.2). A relatively constant number of

146

Devine, Hoyer, and Keating

Table 8.1 Physical characteristics of follicles at different stages of development Follicle type

Description for classification

Primordial

A single layer of squamous granulosa cells

Primary

A single layer of cuboidal granulosa cells

Secondary

Two or more layers of granulosa cells without an antral cavity

Antral

Two or more layers of granulosa cells with an antral cavity

Healthy/normal

Condensed chromatin in oocyte nuclei not present, focal contact between oocyte and granulosa cells intact

Atretic/pyknotic

Oocyte pyknotic (dark pink), follicle structure mis-shapen, condensed chromatin appears in oocyte nuclei, and/or focal contact lost between oocyte and granulosa cells or 3 or more pyknotic (eosinophilic) granulosa cells (apoptotic)

primary and a few secondary follicles are also observed between days 2 and 4, usually near the center of the ovary. A lack of such growing follicles could signify either something is wrong with the culture or there is a detrimental effect of treatments. 3.2. Total RNA Isolation from Cultured Ovaries

The amount of tissue required is at least ten pooled mouse ovaries or eight pooled rat ovaries. The planned use of samples determines exactly how many ovaries are needed. Following ovary culture, RNA can be isolated from fresh tissue or ovaries can be put in RNAlater or flash frozen in liquid nitrogen before being stored at −80◦ C. 1. Cultured ovaries are homogenized in 350 ␮L Lysis Buffer using a hand-held homogenizer (Kontes pellet pestle cordless motor), following manufacturer’s instructions in kits to lyse cells (Qiashredder kit) and isolate RNA (RNeasy Mini kit), respectively. 2. Isolate RNA following manufacturer’s instructions using RNeasy Mini kit. 3. If required, remove contaminating DNA using a DNAse treatment kit. One microliter of total RNA is quantified using a spectrophotometer (λ = 260/280 nm). RNA should have a purity of ≥1.7 (ratio A260/A280), otherwise purity could have a negative impact on subsequent use.

3.3. Protein Isolation from Cultured Ovaries

Proteins from cultured ovaries can be isolated for various analyses, including enzyme activity, two-dimensional gel electrophoresis, phosphorylation characterization, and Western blotting. Pools of ten mouse ovaries or six to eight rat ovaries per group should be used to have measurable levels of protein, with at least three pools per measurement to allow statistical analysis.

Methods to Study Ovarian Physiology

147

1. Ovaries should be removed from culture and either flash frozen in liquid nitrogen and stored at −80◦ C or processed for protein isolation immediately. 2. Remove samples from −80◦ C (or fresh) and place on ice. 3. Add a maximum of 500 ␮L Lysis Buffer (with proteinase inhibitors added) directly to the sample vial if you wish to use the entire sample (see Note 10). 4. Place the vial/tube on ice to keep the sample cold during homogenization. 5. Homogenize with hand-held homogenizer for approximately 30 s. 6. Place the homogenate on ice for 30 min. 7. Spin the lysate at 10,000g for 15 min at 4◦ C. 8. Remove the supernatant and spin again at 10,000g for 15 min at 4◦ C. 9. Remove the supernatant and determine protein concentration using Pierce BCA protein assay kit and read absorbance on plate reader. Protein samples can be aliquoted and stored at –80◦ C (see Notes 11 and 12). 3.4. Microarray Hybridization Protocol

A thorough discussion of microarray technology and techniques is not possible here, but we describe the methods which have been used in analyzing cultured ovaries. The method was developed in the laboratory of Dr. Jay Hoying and shorter descriptions have been published previously (16–18). Dr. Skinner’s laboratory has published two articles using similar techniques to those described here (19), using four to eight ovaries per sample (20). We typically use 10–20 ovaries per sample. Techniques may vary somewhat, depending on the available equipment and microarray(s) of choice. The description here involves using GeneTac hybridization station (Genomic Solutions, Inc., Ann Arbor, MI, USA). All solutions for working with RNA should be made with nucleasefree or DEPC-treated water (diethyl pyrocarbonate). RNA samples should be 1–5 ␮g/mL of total amplified RNA per reaction. RNA should be quantified accurately and integrity should be verified carefully before doing microarray analyses. Amplification of RNA is usually necessary for such small samples.

3.4.1. Reverse Transcription Reaction

One reaction is done for each individual sample, and pairs of samples that are to be compared are prepared for each hybridization. The quantities of the reagents shown below are for individual reactions, which can be multiplied by the number of reactions being performed at a single time. They must then be split into the appropriate number of tubes just before use. 1. Tube 1: 7 ␮L total amplified RNA, 1 ␮L random hexamers (for amplified RNA). If necessary, add nuclease-free H2 O to bring volume to 8 ␮L.

148

Devine, Hoyer, and Keating

2. Tube 2: 6 ␮L nuclease-free H2 O (can add more RNA in place of water, if necessary), 2 ␮L 10× RT buffer, 2 ␮L amino allyl dUTP’s, 1 ␮L dNTP mix, 1 ␮L RNase inhibitor, for a final volume of 12 ␮L 3. Incubate Tube 1 at 70◦ C for 5 min. While Tube 1 is incubating, prepare Tube 2. 4. Incubate both Tubes 1 and 2 at 42◦ C for 5 min. 5. Add the contents of Tube 2 to Tube 1. 6. Add 1 ␮L RT enzyme to each sample/tube. 7. Incubate at 42◦ C for 2 h. Product can be stored at −20◦ C or −80◦ C for long term, if necessary. 3.4.2. Base Hydrolysis of RNA

1. Denature samples at 95◦ C for 5 min. 2. Quick chill samples on ice for ∼2 min. 3. To each sample add 8.6 ␮L of 1 M NaOH and 8.6 ␮L of 0.5 M EDTA. 4. Incubate samples for 15 min at 65◦ C. 5. Add equal volume of (8.6 ␮L) 1 M HCl to each tube.

3.4.3. Clean-Up Part I

1. Dilute samples to 100 ␮L with nuclease-free H2 O (add approx. 53 ␮L). 2. Carry out PCR product column purification protocol according to manufacturer’s instructions. 3. Elute with two volumes of 30 ␮L nuclease-free H2 O (total eluted volume should be 60 ␮L). 4. Spin samples at maximum speed (11,000g) for 1 min. 5. Dry sample to 2–3 ␮L in SpeedVac (∼30 min) at 45◦ C (see Note 13).

3.4.4. cDNA Labeling

1. To modified anti-sense cDNA pellet, add 3 ␮L of 25 mg/mL sodium bicarbonate. 2. Prepare aliquots of dye for use by removing from −80◦ C and spinning for 1 min at a maximum speed (11,000g) to get dye to bottom of the tube. Add 6.5 ␮L DMSO to each tube, vortex, and spin for 1 min at maximum speed (11,000g). Green dye – 555 nm (looks pink – 555 nm excitation; 565 nm emission); red dye – 647 nm (looks blue – 650 nm excitation, 670 nm emission). 3. Add 1 ␮L of appropriate dye to each tube. It is important to keep samples separate during this step, i.e., one dye per tube. 4. Wrap tubes in aluminum foil to protect from light, let stand at room temperature for 1 h to incorporate dye into cDNA. 5. While waiting for this step, prepare 2× hybridization buffer.

3.4.5. Clean-Up Part II

1. Bring each tube up to 50 ␮L by adding 42 ␮L of nucleasefree water. Combine both tubes for a final volume of 100 ␮L.

Methods to Study Ovarian Physiology

149

2. Remove poly-dA and Cot-1 DNA aliquots from −20◦ C and thaw on ice; remove formamide from −20◦ C and thaw at room temperature. 3. Sample purification is done as described in Section 3.4.3, except that cDNA is eluted with two volumes of 25 ␮L nuclease-free H2 O (total eluted volume should be 50 ␮L). 4. During the elution step, start appropriate hybridization program on hybridization station (see Section 3.4.7, Step 2). 5. To the labeled sample, add 10 ␮g each of Cot-1 DNA (10 ␮L) and poly-dA (1 ␮L, for cDNA arrays, replace with 1 ␮L H2 O if using oligonucleotide arrays). 6. Add equal volume of 2× hybridization buffer (∼61 ␮L per hybridization). Store samples in aluminum foil until ready to hybridize. 3.4.6. Microarray Slide Preparation

1. In a 150-mL beaker, make 1% SDS solution and heat it to 50–60◦ C. 2. Fill the second beaker with 140 mL of ddi H2 O. 3. Wash microarray slide in 1% SDS solution for ∼2 min, by hand. 4. Rinse in ddi H2 O for ∼1 min by hand. 5. Pull slide slowly out of ddi H2 O so that slide is dry (“dry dip”). 6. Place under hybridization cover and load into a hybridization station or store in dessicator until ready to use.

3.4.7. Hybridization

1. With prepared slide, assemble and position hybridization station cartridge. 2. Select desired hybridization program (usually 47◦ C cDNA program is used) and load samples as required for the apparatus. 3. Inject 124 ␮L of combined samples slowly into hybridization chamber to reduce air bubbles (some small air bubbles on top of the slide are normal). Hybridize for a minimum of 14 h. 4. Dry and protect slides as follows: a. Perform appropriate wash program for the hybridization station. b. Prepare approximately 140 mL of 0.1× SSC using ddi H2 O at room temperature. c. Remove hybridization cover and wipe (with a TX1065 wipe) the backside of the slide, while in hybridization cover. Once clean, remove from hybridization cover and quickly dip in 0.1× SSC. d. Dry dip in 0.1× SSC several times and remove quickly. Use filtered air gun with a quick long, full blast and sweep droplets to one end of the slide, remember to dry both sides of the slide.

150

Devine, Hoyer, and Keating

e. Add about 16 mL DyeSaver2 solution into “dip chamber.” f. Dip slide, with even speed, into DyeSaver2, without wetting the slide label. g. Wipe or blot the wet slides. Then, set in dry dark slide case. Keep in dark for 24 h. 5. After 24 h, slide is ready to scan.

3.5. Quantitative Real-Time Polymerase Chain Reaction

Quantitative real-time PCR is useful for determining relative or exact levels of expression of specific genes (21). It is particularly appropriate for confirming results of microarray analyses. Other reviews have been published on this technique, and we present one particular procedure that we have found to work well with cultured ovaries. In order to ensure the best comparisons, RNA quantification should be accurate, samples should be run in triplicate for each gene of interest, and house-keeping genes should also be measured as internal controls. 1. cDNA synthesis is carried out using 0.25–2 ␮g total RNA with the Superscript III reverse transcriptase enzyme according to manufacturer’s instructions (see Note 14). 2. Dilute cDNA 1:25 from reverse transcription reaction with nuclease-free H2 O in 0.5-mL microcentrifuge tubes (see Note 15). Pipet to mix cDNA. 3. Dilute primers to 5 ␮M with nuclease-free H2 O for the working solution in 1.5-mL microcentrifuge tubes. Pipet to mix primers. 4. Prepare a primer mix with equal parts of forward and reverse primer working solutions for each gene being tested in 0.5-mL microcentrifuge tubes. Pipet to mix primers. 5. Make PCR Master Mix containing each of the following reagents for each reaction (multiply by the total number of reactions to be performed): 2 ␮L diluted cDNA, 0.4 ␮L 25 R mM MgCl2 , 0.35 ␮L nuclease-free H2 O, 0.25 ␮L SYBR Green Dye (if necessary, this dye can be replaced with H2 O for reactions). TM R Green PCR Master Mix. a. 5 ␮L Quantitect SYBR 6. Pipet to mix the cDNA master mixes (see Note 16). 7. Set up PCR tubes in cooled metal PCR tube holder. 8. Aliquot 2 ␮L of primer mix into appropriate PCR tubes. 9. Aliquot 8 ␮L cDNA Master Mixes into appropriate PCR tubes (see Note 17). 10. Analyze samples in the Rotor-Gene 3000 (real-time PCR machine) or other real-time PCR machine. A regular reaction consists of 15 min at 95◦ C, followed by 45 cycles of (i) melt 15 s at 95◦ C, (ii) annealing 15 s at annealing temperature (58◦ C), and (iii) elongation 20 s at 72◦ C,

Methods to Study Ovarian Physiology

151

followed by fluorescence acquisition on SYBR Green wavelength (488 nm excitation, 522 nm emission). 11. Product is tested by determining a melt curve from 72 to 99◦ C, 1◦ C per step, 45 s on first step, then 5 s on each step afterward. 12. Product can also be run on a 2–4% agarose gel to ensure that single bands of the correct size were obtained. Following PCR amplification, a threshold line is set on the amplification graph, done either manually or automatically by the software provided. The software then measures the point or cycle number at which each sample crosses the threshold line, defining the threshold value of detection (the Ct value). The software will identify the Ct values for each sample for both the house-keeping gene and the gene of interest. Results from the gene of interest are normalized to the respective house-keeping gene. The housekeeping gene being used is important, and it must be determined that the house-keeping gene being used does not change with the different experimental conditions under investigation. Some commonly used house-keeping genes for the ovary are ␤-actin, L17, and cyclophilin. 3.6. Fluorescent Immunohistochemistry of Fixed and Sectioned Tissues

3.6.1. Sample Preparation

We have used fluorescent immunohistochemistry to localize proteins of interest, because it provides subcellular localization and can be used for multiple proteins at once (2, 8, 22, 23). This method is critical for researching ovarian physiology because of the ovary’s heterogeneous nature. The best fixation for fluorescent immunohistochemistry is a highly pure paraformaldehyde that does not contain alcohols. An alternative to using ovarian sections described below is used in the laboratory of Dr. Melissa Pepling (University of Syracuse), where they perform fluorescent immunohistochemistry in whole cultured ovaries and capture multiple images by confocal microscopy to perform analyses (2). A more simplified protocol can be used in which the secondary antibody is labeled directly with a fluorescent marker, rather than using a biotinylated secondary antibody and a streptavidinconjugated fluorescent molecule. Elimination of this extra step may reduce sensitivity, but shortens the procedure. 1. Cut 5 ␮m thick sections from paraffin-embedded tissues to be studied. Float sections on the surface of a water bath at 39◦ C for a few minutes and put on Snowcoat slides. Bake sections onto the slides in an oven at 55◦ C for 4 h to overnight (see Note 18). 2. Remove paraffin and rehydrate sections with the following steps in Coplin jars: a. Citrisolv (see Note 19) b. Citrisolv

5 min 5 min

152

Devine, Hoyer, and Keating

c. Citrisolv d. 100% Ethanol e. 95% Ethanol f. 70% Ethanol g. H2 O h. PBS

3.6.2. Microwave Antigen Retrieval

3.6.3. Fluorescent Immunohistochemistry Procedure

5 min 2 min 2 min 1 min 1 min 15 min

1. Put the slides in a Coplin jar filled with ∼250 mL sodium citrate 10 mM. 2. Heat for 3 min at maximum power in microwave oven. 3. Reheat for 10 min at a setting that causes a slow, gentle boil, and then cool on the bench for 30 min at room temperature. 4. Rinse each slide with 500 ␮L PBS. The following incubations should be done in a humidified container (plastic container with wet towel). Be sure not to touch tissue sections when performing manipulations or when pipetting solutions onto slides. 1. Shake liquids off slides and dry the surplus liquid around tissue sections with a kimwipe. Plastic coverslips can be cut to appropriate sizes to cover sections or glass coverslips can be used (or trace around tissue sections with Pap pen instead of using coverslips). 2. Blocking step: cover tissue sections with 20–40 ␮L 5% BSA/PBS for 5–10 min, one slide at a time so that the tissues do not dry. 3. Shake off blocking solution. Add 20–40 ␮L of primary antibody to sections. Cover tissue sections on slide with plastic cover slip. Leave at room temperature for 1 h or 4◦ C overnight (better sensitivity). The concentration of primary antibody must be determined from the literature or by preliminary experiments (see Note 20). 4. Wash three times for 2 min with PBS, shaking off liquid between each step. 5. Shake off liquid and wipe away excess PBS using kimwipes without touching tissue sections. Add two to three drops of streptavidin from Vector Blocking kit and cover sections with coverslips, leave for 15 min. Wash with PBS, 3 × 2 min. 6. Shake off liquid and wipe away excess PBS. Add two to three drops of biotin from Vector blocking kit, cover tissue sections with plastic coverslips, and leave for 15 min. Wash three times for 2 min with PBS. 7. Shake off liquid and wipe away excess PBS. 8. Add biotinylated secondary antibody (that recognizes the species from which the primary antibody came) to sections.

Methods to Study Ovarian Physiology

153

Cover sections with coverslips and leave undisturbed for 1 h at room temperature. Wash three times for 2 min with PBS. 9. Wipe away excess PBS. Add the streptavidin-fluorescent conjugate (we use Alexa Fluor 568 or 488, or Cy5). Cover with coverslip. Leave at room temperature for 1 h. Wash with PBS, 3 × 2 min. 10. Wipe away excess PBS. Add nuclear stain at an appropriate dilution (see Note 21). If using Hoechst to stain nuclei, dilute to 0.01 mg/mL; 50–60 ␮L per slide for a coverslip is sufficient. Leave Hoechst on slide and carefully add coverslip from one side of slide and lower so that there are no bubbles. 11. Label each slide and store in a slide box in a refrigerator overnight. Coverslips can be sealed with nail polish.

4. Notes 1. Phenol red has been reported to have estrogenic properties and so is avoided in our methods, because estradiol appears to be involved in final follicle assembly (1, 2). 2. Store SDS at room temperature, it will form a precipitate if cooled. Precipitate can be redissolved by incubating in a 37◦ C water bath. 3. Antibodies can be tested using multiple slides with sections of tissues that are known to contain the protein. Generally, we test 3–4 concentrations (5-fold dilutions) around the optimal concentration suggested by the company. If the conditions for the secondary antibody are unknown, this should also be tested in the same way, varying both concentrations. Duplicate slides should be done for each condition. Results should be compared by intensity and location of fluorescence, comparing localization with what is expected. 4. The faster the ovaries are placed into the incubator, the healthier they are. Sacrifice each litter separately and process ovaries before starting on the next litter. Isolate ovaries as quickly as possible and minimize the time they are under the dissecting microscope. Tests have shown that the duration that ovaries are under the dissecting microscope is very important, whereas the time on ice has less of an impact. After 1 h under a microscope with its light on, ovaries contained almost no healthy growing follicles after 8 days of culture as compared to ovaries processed rapidly under the microscope (10–15 min, unpublished data, PJ Devine). Initially, however, these ovaries appear normal

154

Devine, Hoyer, and Keating

5.

6.

7.

8.

morphologically. This is why we separate ovaries into multiple Petri dishes, so that each is on the microscope for the least amount of time. It is best if ovaries from individuals are not both in the same condition or treatment, so that variations in follicle numbers, health, size, etc., among individuals has less of an impact upon comparisons that are being made. Two or more ovaries can be placed on each membrane, though they can fuse together if in direct contact. We prefer maintaining a single ovary per well. Although culture medium has traditionally been changed every 2 days of culture, our results did not demonstrate a significant difference in the survival of ovarian tissue or follicle counts whether media were changed every 2 days or were unchanged (Fig. 8.3). When removing medium, tilt the dish slightly and place pipette tip against the bottom edge of the well at the deepest part of the medium. Remove the medium slowly so that the membrane and ovary are not dislodged. The same technique must also be done when replacing medium – with the tip against one edge of the well so that the medium runs down the well’s wall. Otherwise, the ovary or membrane

Fig. 8.3 Differences in ovarian follicle populations of PND4 mouse ovaries between medium that is replenished every 2 days or remained for the duration of cultures. Ovaries were cultured for 8 days in normal culture medium that was either replaced with new medium every 2 days (white bars) or left for the entire culture period (grey bars). Following histological processing, ovaries were serially sectioned (5 ␮m) and stained by H&E, and follicles were categorized and counted in every sixth section. Each follicle category was compared between the two conditions by Student’s T-test; error bars represent standard error of the mean. ∗ Signifies statistical significance with p<0.05. Three experiments were performed with each containing three ovaries per condition (n = 9 each).

Methods to Study Ovarian Physiology

9.

10. 11. 12.

13.

14.

15.

16.

17.

18.

19. 20.

21.

155

may sink to the bottom. If not replaced onto a fresh piece of membrane immediately, the ovary could “drown” or die from lack of air exchange. Counting only oocytes with nuclei present prevents counting the same follicle more than once. This is of particular concern with larger follicles that will occupy a number of sections. If care is not taken to avoid this, counts would overestimate larger follicle number. Best done in 2-mL cryovials, however, 1.5-mL microfuge tubes work fine. Avoid freeze-thawing samples multiple times before use. The amount of protein obtained from cultured ovaries will be relatively small. If Western blots are performed, membranes can be cut into sections after protein transfer to detect different-sized proteins. We cut the membrane at approximately the 50 kDa protein marker, so that different proteins above and below 50 kDa in size may be detected in different antibody incubations. When drying samples in the Speedvac, do not allow them to dry completely. Verify volumes multiple times when volumes are approaching the desired volume. The total quantity of RNA used will depend on the amount isolated from ovaries. Make sure to keep the total starting concentration of RNA used equal in all samples. The cDNA dilution can be changed depending on the abundance of the gene of interest. Usually 2 ␮L of cDNA into 48 ␮L of nuclease-free H2 O is enough. If a gene is known to be present in low abundance, analyses might require using a higher concentration of RNA (e.g., 5 ␮L cDNA in 45 ␮L water). Each sample is analyzed in triplicate for each gene of interest. Include a blank sample (H2 O added instead of cDNA) and calculate for one well in excess of the amount required. If necessary, PCR tubes can be stored at this step at 4◦ C until ready to start reactions. Samples should be analyzed on same day as preparation of reactions. Signal is lost for some antigens, such as Proliferating Cell Nuclear Antigen, if slides are baked and left in the oven at high temperatures. Instead, slides can be allowed to dry overnight at room temperature. Xylene can also be used for these steps, with incubation times of 3 min instead of 5 min. The amount of primary antibody needed for fluorescent immunohistochemistry is generally higher than that required for colorimetric immunohistochemistry. The best nuclear stain is one that fluoresces over a narrow range of wavelengths either in UV or infrared, depending

156

Devine, Hoyer, and Keating

on what wavelengths and filters are available and are being used for the antigen(s) of interest. We use Yoyo-1 (which requires a 30-min RNAse step before adding this dye) or Hoechst, but multiple new dyes are also now available. Confocal microscopy tends to provide sharper images than conventional fluorescent microscopes, but can require higher fluorescent signal.

Acknowledgments Authors would like to thank Patty Christian (University of Arizona) for her work with the immunohistochemistry protocol, Doug Cromey and Marvin Landis (University of Arizona) for their help in developing the three-dimensional model of cultured ovaries, and Xiaoming Hu (USEPA) for establishing the protein isolation method in our laboratories. We thank the laboratory of Dr. Jay Hoying (University of Arizona) for his assistance and support in the microarray technology. This work was supported by the National Sciences and Engineering Research Council Grant 288304-04 and the National Institutes of Health ES09246 and Centre Grant ES06694. References 1. Kezele P. and Skinner M. K. (2003) Regulation of ovarian primordial follicle assembly and development by estrogen and progesterone: endocrine model of follicle assembly. Endocrinology 144, 3329–37. 2. Chen Y., Jefferson W. N., Newbold R. R., Padilla-Banks E. and Pepling M. E. (2007) Estradiol, progesterone, and genistein inhibit oocyte nest breakdown and primordial follicle assembly in the neonatal mouse ovary in vitro and in vivo. Endocrinology 148, 3580–90. 3. Skinner M. K. (2005) Regulation of primordial follicle assembly and development. Hum Reprod Update 11(5), 461–71. 4. Kezele P. R., Nilsson E. E. and Skinner M. K. (2002) Insulin but not insulin-like growth factor-1 promotes the primordial to primary follicle transition. Mol Cell Endocrinol 192, 37–43. 5. Nilsson E. E., Kezele P. and Skinner M. K. (2002) Leukemia inhibitory factor (LIF) promotes the primordial to primary follicle transition in rat ovaries. Mol Cell Endocrinol 188, 65–73. 6. Gigli I., Cushman R. A., Wahl C. M. and Fortune J. E. (2005) Evidence for a role

7. 8.

9.

10.

11.

for anti-Mullerian hormone in the suppression of follicle activation in mouse ovaries and bovine ovarian cortex grafted beneath the chick chorioallantoic membrane. Mol Reprod Dev 71, 480–88. Fortune J. E., Kito S. and Byrd D. D. (1999) Activation of primordial follicles in vitro. J Reprod Fertil Suppl 54, 439–48. Desmeules P. and Devine P. J. (2005) Characterizing the ovotoxicity of cyclophosphamide metabolites on cultured mouse ovaries. Toxicol Sci 90, 500–09. Devine P. J., Sipes I. G. and Hoyer P. B. (2004) Initiation of delayed ovotoxicity by in vitro and in vivo exposures of rat ovaries to 4-vinylcyclohexene diepoxide. Reprod Toxicol 19, 71–77. Rajapaksa K. S., Sipes I. G. and Hoyer P. B. (2007) involvement of microsomal epoxide hydrolase enzyme in ovotoxicity caused by 7,12-dimethylbenz[a]anthracene. Toxicol Sci 96, 327–34. Rajapaksa K. S., Cannady E. A., Sipes I. G. and Hoyer P. B. (2007) Involvement of CYP 2E1 enzyme in ovotoxicity caused by 4vinylcyclohexene and its metabolites. Toxicol Appl Pharmacol 221, 215–21.

Methods to Study Ovarian Physiology 12. Hirshfield A. N. (1991) Development of follicles in the mammalian ovary. Int Rev Cytol 124, 43–101. 13. Parrott J. A. and Skinner M. K. (1999) Kitligand/stem cell factor induces primordial follicle development and initiates folliculogenesis. Endocrinology 140, 4262–71. 14. Cooke P. S., Young P. F. and Cunha G. R. (1987) A new model system for studying androgen-induced growth and morphogenesis in vitro: the bulbourethral gland. Endocrinology 121, 2161–70. 15. Pedersen T. and Peters H. (1968) Proposal for a classification of oocytes and follicles in the mouse ovary. J Reprod Fertil 17, 555–57. 16. Brooks H. L., Ageloff S., Kwon T. H., Brandt W., Terris J. M., Seth A., et al. (2003) cDNA array identification of genes regulated in rat renal medulla in response to vasopressin infusion. Am J Physiol Renal Physiol 284, F218–28. 17. McReynolds M. R., Taylor-Garcia K. M., Greer K. A., Hoying J. B. and Brooks H. L. (2005) Renal medullary gene expression in aquaporin-1 null mice. Am J Physiol Renal Physiol 288, F315–21. 18. Schwartz M. A., Stone A. L., Greer K. A., Hoying J. B. and Williams S. K. (2005) Gene

19.

20.

21.

22.

23.

157

expression in tissue associated with extracellular matrix modified ePTFE. J Biomed Mater Res A 73, 30–38. Kezele P. R., Ague J. M., Nilsson E. and Skinner M. K. (2005) Alterations in the ovarian transcriptome during primordial follicle assembly and development. Biol Reprod 72, 241–55. Nilsson E., Rogers N. and Skinner M. K. (2007) Actions of anti-Mullerian hormone on the ovarian transcriptome to inhibit primordial to primary follicle transition. Reproduction 134, 209–21. Lutfalla G. and Uze G. (2006) Performing quantitative reverse-transcribed polymerase chain reaction experiments. Methods Enzymol 410, 386–400. Hu X. M., Christian P. J., Sipes I. G. and Hoyer P. B. (2001) Expression and redistribution of cellular bad, bax and bcl-xl protein is associated with VCD-induced ovotoxicity in rats. Biol Reprod 65, 1489–95. Devine P. J., Sipes I. G., Skinner M. K. and Hoyer P. B. (2002) Characterization of a rat in vitro ovarian culture system to study the ovarian toxicant 4-vinylcyclohexene diepoxide. Toxicol Appl Pharmacol 184, 107–15.

Chapter 9 A Revised and Improved Method for the Isolation of Seminiferous Tubule-Enriched Fractions that Preserves the Phosphorylated and Glycosylated Forms of Proteins Casimir D. Akpovi and R.-Marc Pelletier Abstract An improved technique to generate high yields of relatively pure seminiferous tubule-enriched fractions from mouse testis by manual isolation is described. Our laboratory had previously developed an isolation method based on mild enzymatic digestion to separate individual constituents of each compartment of the testis, namely, the interstitial tissue and the seminiferous tubules. Although the method had the advantage of allowing the production of seminiferous tubule-enriched fractions in large amounts, we show here that this approach does not allow optimal preservation of the integrity of the proteins in the samples, in particular of the phosphorylated and/or glycosylated forms of the proteins. In an attempt to solve this problem, we developed a novel mechanical approach to generate interstitial tissue- and seminiferous tubule-enriched fractions that does not require the use of enzymatic digestion. This approach has the advantages of providing relatively pure seminiferous tubule-enriched fractions in large quantities and in a short amount of time. In addition, and more significantly, the approach allows a more faithful detection of the phosphorylated and glycosylated forms of the proteins. Key words: Testis, seminiferous tubule, tissue fraction, isolation, protein, phosphorylated forms, glycosylated forms.

1. Introduction The testis is made up of loops of convoluted seminiferous tubules surrounded by interstitial tissue composed of loose connective tissue containing Leydig cells that secrete testosterone into the bloodstream (1). The seminiferous tubules are lined with a stratified epithelium containing germ cells at various stages of Julie Lafond and Cathy Vaillancourt (eds.), Human Embryogenesis: Methods and Protocols, vol. 550 © Humana Press, a part of Springer Science+Business Media, LLC 2009 DOI 10.1007/978-1-60327-009-0 9 Springerprotocols.com

159

160

Akpovi and Pelletier

development (2) and the supporting Sertoli cells (3). Despite fundamental anatomical and functional differences that distinguish the two cellular compartments of the testis (4), most studies use whole testis extracts rather than seminiferous tubule- or interstitial tissue-enriched fractions to conduct their analyses (5–7). Currently available methods to generate tissue-enriched fractions are few in numbers and time-consuming or still based on the use of enzymes. Christensen and collaborators (8) have proposed an elegant method to separate the interstitial tissue from the seminiferous tubules. Although the interstitial tissue-enriched fractions generated were of relatively good purity, their approach was very timeconsuming, requiring more than 3 h to complete and yielded only reduced amounts of tissue fractions from one single testis. Our laboratory has reported an isolation method based on mild enzymatic digestion of the testis (9, 10). The method had the advantage of allowing the isolation of significantly larger amounts of seminiferous tubule-enriched fractions. Here in, we describe an improved method that: (1) provides relatively pure seminiferous tubule-enriched fractions; (2) does not require the use of enzymatic digestion; (3) is rapid in execution; (4) provides large amounts of enriched-tissue fraction in which (5) the integrity of the proteins is preserved.

2. Materials 2.1. Animals

Adult mice, aged more than 60 days, were purchased from Charles River (St-Constant, QC, Canada). They were housed at room temperature with 12 h:12 h light–dark cycle. Food and water were provided ad libitum. Animals were anesthetized by i.p injection of 0.9 mL/kg body weight of sodium phenobarbital (Somnotol; MCI Pharmaceutical, Mississauga, ON, Canada) and 0.15 mL/kg body weight of a solution of 0.3 g/mL chloral hydrate in sterile saline. The protocol was approved by University of Montreal Animal Care Committee.

2.2. Mild Enzymatic Digestion 2.2.1. Reagents

1. Phenylmethylsulfonyl fluoride (PMSF), ethylene glycol-bis(2-aminoethyl ether) – N,N,N  , N-tetraacetic acid (EGTA), sodium chloride (NaCl), sodium fluoride (NaF), sodium orthovanadate (Na3 VO4 ), sodium pyrophosphate dehydrate (Na4 P2 O7 ), potassium chloride (KCl), potassium phosphate

Seminiferous Tubule-Enriched Fraction Isolation Technique

161

(KH2 PO4 ), and soybean trypsin inhibitor (Sigma–Aldrich, Oakville, ON, Canada). 2. Aprotinin, leupeptin, and collagenase D (Boehringer Mannheim). 3. Minimum essential medium (MEM) (Gibco BRL). 2.2.2. Buffers

1. Phosphate-buffered saline (PBS): 137 mM NaCl, 3 mM KCl, 8 mM Na2 HPO4 , 1.5 mM KH2 PO4 , pH 7.4 (see Note 1). Store at room temperature. 2. Buffer A: PBS containing 2 mM PMSF, 1 mM EGTA, 2 ␮g/mL leupeptin, 2 ␮g/mL aprotinin, 4 mM Na3 VO4 , 80 mM NaF, and 20 mM Na4 P2 O7 (see Note 1). Store at 4◦ C.

2.3. Manual Isolation Technique 2.3.1. Reagents

The same reagents as for the mild enzymatic digestion technique are used except for collagenase D and soybean trypsin inhibitor but with the addition of potassium bisperoxol (1,10phenanthroline) oxovanadate (bpV (phen)) (Calbiochem). Protect from light (see Note 2).

2.3.2. Buffers

1. Phosphate-buffered saline (PBS). 2. Buffer B: buffer A plus 10 ␮M bpV (phen). Add bpV (phen) just prior to use, the product is unstable in solution (see Note 2).

2.3.3. Instrument

1. No. 5 Dumont stainless steel forceps.

2.4. Electrophoresis and Western Blotting 2.4.1. Reagents

1. Urea, bovine serum albumin (BSA), Tris (hydroxymethyl)aminomethane, ␤-mercaptoethanol, 3 ,3 ,5 ,5 tetrabromophenol-sulfonaphthalein (bromophenol blue) (Sigma–Aldrich). 2. Sodium dodecyl sulfate (SDS), Bio-Rad Protein Assay, nitrocellulose membrane (Bio-Rad, Mississauga, ON, Canada). 3. Lumi-lightplus chemiluminescence detection kit (Roche Diagnostics Sciences, Laval, QC, Canada). 4. Film-classic Blue (cat. no. EBA 45; Universal X-ray Company of Canada Ltd, Dorval, QC, Canada).

2.4.2. Buffers

1. Tris-buffered saline with Tween (TBST): 140 mM NaCl, 50 mM Tris–HCl, pH 7.4 and 0.05% Tween-20. Store at 4◦ C. 2. Blocking agent and antibody dilution buffer: 3% (w/v) fatfree dry milk in TBST. Can be stored at 4◦ C for not more than 3 days.

162

Akpovi and Pelletier

3. Western blot sample dilution buffer: 8 mM urea, 3% SDS, 5% ␤-mercaptoethanol, 7 mM Tris–HCl, pH 7.6, and 0.005% bromophenol blue. Heat to facilitate dissolution. Store at 4◦ C. 2.4.3. Antibodies

1. A rabbit polyclonal antibody IgG that recognizes all forms (phosphorylated and non-phosphorylated) of Cx43 (cat. no. Pan-Cx43; Sigma–Aldrich). 2. A rabbit polyclonal antibody IgG to Scavenger receptor class B type I (SR-BI) (Novus Biologicals, Littleton, CO, USA). 3. A rabbit anti-mouse myosin light chain (MLC) monoclonal IgM (Sigma–Aldrich). 4. Peroxidase-conjugated goat anti-rabbit IgG and peroxidaseconjugated goat anti-mouse IgM (Jackson ImmunoRes Lab, Mississauga, ON, Canada).

3. Methods 3.1. Testis Collection

1. Clean the anesthetized animals’ fur with 70% ethanol to minimize contamination. 2. Make an incision in the abdomen using curved scissors. 3. Cut the skin from the abdomen to the thorax with scissors. 4. Open the abdominal wall. 5. Remove testes. 6. Place testes in a glass Petri dish containing cold PBS on ice. 7. Remove the fat pad and the epididymis under a dissecting microscope and rinse the testes in cold PBS. 8. The tunica albuginea and the testicular artery are removed.

3.2. Mild Enzymatic Digestion Technique

1. Decapsulated testes are placed in 50-mL Erlenmeyer flask containing 0.25 mg/mL of collagenase D and 0.1 mg/mL of soybean trypsin inhibitor in MEM (10 mL/5 pairs of testis). 2. Place the mixture in a water shaker bath set at 80 cycles/min at 37◦ C for 2 × 20 min. The seminiferous tubules readily disperse. 3. The reaction is stopped by the addition of an equal volume of MEM. 4. Transfer the mixture into 15 mL plastic conical tubes. 5. Allow to deposit 30 min on ice. The seminiferous tubules will settle by gravity, while the interstitial cells will occupy the supernatant. 6. Further separation is achieved by centrifugation at 80g for 15 min at 4◦ C. The two cellular compartments of the testis

Seminiferous Tubule-Enriched Fraction Isolation Technique

163

will show distinct colors, thus rendering identification easy: the tubules are whitish and the interstitial tissue brownish. 7. The resulting seminiferous tubule-enriched fraction in the pellet and the interstitial tissue-enriched fraction in the supernatant are washed three times 10 min in PBS or in buffer A separately and recovered by centrifugation at 250g for 10 min at 4◦ C. 8. Each tissue-enriched fraction is suspended in equal volume of PBS or buffer A. 9. Aliquot and store at −80◦ C. 3.3. Manual Isolation Technique

1. Place the decapsulated testes in cold buffer (PBS, buffer A, or buffer B) (see Note 1) in a glass Petri dish (2 mL/1 pair of testis) on ice. 2. Dice the testis into 2–4 pieces with clean razor blades. 3. Use two pairs of No. 5 Dumont stainless steel forceps to separate and detach the tubules from the interstitium. This isolation usually takes approximately 20 min per testis when mouse is used as animal model. The isolation time will vary with the species used. 4. Check if the seminiferous tubules are completely detached from the interstitial tissue under dissecting microscope with illumination from above (see Note 3).

Fig. 9.1 Schematic representation of the isolation product following 30 min of sedimentation. The seminiferous tubules deposit quickly at the bottom of the tube. The interstitial tissue deposits less rapidly forming the next layer. The supernatant contained isolated germ cells, mainly elongated spermatids that had escaped from the cut ends of the seminiferous tubules.

164

Akpovi and Pelletier

5. Once the isolation is completed, allow the product of isolation to decant in a 1.5-mL eppendorf tube by two testes or in a 15-mL plastic conical tube if more testes are isolated (see Note 4). 6. Allow to deposit an additional 30 min on ice. 7. Separation is followed by a centrifugation at 80g for 15 min at 4◦ C. Three superimposed segments are obtained (Fig. 9.1).

Fig. 9.2 Characterization of the enriched fractions. (A) In contrast, the interstitial tissue-enriched fractions show contamination by round and elongated spermatids (arrow) that had escaped from the broken ends of the tubules. (B) The isolated seminiferous tubules show virtually no residual interstitial tissue on their surfaces. The fractions were viewed and photographed with an inverted microscope Leica DMRIB equipped with Zeiss camera and Northern Eclipse program (A: 120X; B: 240X).

Seminiferous Tubule-Enriched Fraction Isolation Technique

165

8. The supernatant (upper segment in Fig. 9.1) contains few round and elongated spermatids that have escaped from the broken ends of the tubules. The middle segment in Fig. 9.1 contains mainly interstitial tissue (Fig. 9.2A) (see Note 5). The lower segment in Fig. 9.1 contains essentially seminiferous tubules (Fig. 9.2B). Because the upper segment contains only few round and elongated spermatids

Fig. 9.3 The manual isolation technique allows the preservation of the protein’s integrity. Ten ␮g of total proteins was subjected to SDS-PAGE and transferred to a nitrocellulose membrane. The lower part (<35 kDa) of the membrane is cut and incubated with anti-MLC (1:5,000), while the middle part (around 40 kDa) is incubated with antiCx43 (1:20,000) that recognizes all forms (phosphorylated and non-phosphorylated) of Cx43 (Pan-Cx43), and the upper part of the membrane is incubated with anti-SR-BI (1:2,000). (A) In the sample obtained through the manual isolation, all the Cx43 phosphorylated isoforms are preserved. In contrast, in the sample that has been processed using mild enzymatic digestion, the intensity of Cx43 bands is decreased and some of the bands could no longer be detected. (B) The intensity of the band of the glycosylated form of SR-BI is significantly lower in the sample that has been processed with a mild enzymatic digestion than in the sample obtained through manual isolation. MLC, whose band intensity did not change with the different experimental conditions, was used as an internal loading control. The positions of the non-phosphorylated (NP) and phosphorylated (P) forms of connexin 43 (Cx43) are indicated.

166

Akpovi and Pelletier

that segment is added to the lower one before washing (see Notes 5 and 6). 9. Washing: The interstitial tissue- and the seminiferous tubule-enriched fractions are washed three times with the appropriate buffer (PBS, buffer A, or buffer B) and recovered by centrifugation at 250g for 10 min at 4◦ C. 10. Each tissue-enriched fraction is suspended independently in an equal volume of either buffer A or buffer B or PBS (see Notes 1, 5 and 6). 11. Aliquot and store at −80◦ C. 3.4. To Use or Not to Use Mild Enzymatic Digestion

As pointed out in the introduction, testicular tissue fractions can be used with or without the use of mild enzymatic digestion. The use of mild enzymatic digestion (e.g., collagenase) favors a rapid dismantling of the testis parenchyma. However, the use of enzymes does not allow for optimal preservation of the protein’s integrity particularly of the phosphorylated (Fig. 9.3A) and lycosylated (Fig. 9.3B) forms of the proteins that once exposed to enzymes, even to mild enzymatic digestion, are no longer detectable by Western blot analyses.

4. Notes 1. For in vitro proteins dephosphorylation studies, a buffer without anti-phosphatase (Buffer A) or PBS should be used because buffer contains anti-phosphatase could inactivate the phosphatase used for the reaction. 2. Potassium bisperoxol (1,10-phenanthroline) oxovanadate (bpV (phen)) is sold in powder form and must be suspended, aliquoted, and stored at −20◦ C in a container opaque to light. Avoid repeated freezing and thawing. For this reason the aliquots should be made for single use only. 3. To better appreciate the product of the isolation, it is recommended to place a piece of black paper between the ice and the Petri dish. The tissue can also be viewed under a dissecting microscope, with illumination from above. 4. Use the least possible amount of buffer (about 2 mL/1 pair of testis) to facilitate the manual isolation. However, add buffer to the isolated product and suspend before allowing to sediment. 5. The use of buffer containing anti-phosphatase (Buffer B) is indicated for proteins with phosphorylated forms that need to be preserved. 6. The technique described in this study favors the isolation of the seminiferous tubules by allowing to generate relatively

Seminiferous Tubule-Enriched Fraction Isolation Technique

167

pure seminiferous tubule-enriched fractions in large quantities. However, the technique does not favor interstitial tissue-enriched fractions which usually appear contaminated by detached germ cells contained in the supernatant.

Acknowledgments The authors would like to thank Dr. Elo´ısa M. Carbajal for her collaboration to this project. This work was supported in part by NSERC Grant and by Population Council ICMC Grant to RMP. References 1. Ghristensen, A.K. (1975) Leydig cells. In: Handbook of Physiology (Hamilton, D.W. and Greep, R. O., eds.), American Physiological Society, Washington, DC, pp. 57–94. 2. Leblond, C.P. and Clermont, Y. (1952) Definition of the stages of the cycle of the seminiferous epithelium in the rat. Ann NY Acad Sci 55, 548–573. 3. J´egou, B. (1993) The Sertoli-germ cell communication network in mammals. Int Rev Cytol 147, 25–96. 4. Halley, J.B. (1960) Relation of Leydig cells in the human testicle to the tubules and testicular function. Nature 185, 865–866. 5. Benahmed, M., Reventos, J. and Saez, J.M. (1983) Role of plasma lipoproteins in the function of steroidogenic tissues. Ann Endocrinol (Paris) 44, 43–50. 6. Bravo, E., Botham, K.M., Mindham, M.A., Mayes, P.A., Marinelli, T. and Cantafora, A. (1994) Evaluation in vivo of the differential uptake and processing of highdensity lipoprotein unesterified cholesterol

7.

8.

9.

10.

and cholesteryl ester in the rat. Biochim Biophys Acta 1215, 93–102. Xie, C., Richardson, J.A., Turley, S.D. and Dietschy, J.M. (2006) Cholesterol substrate pools and steroid hormone levels are normal in the face of mutational inactivation of NPC1 protein. J Lipid Res 47, 953–963. Christensen, A.K. and Mason, N.R. (1965) Comparative ability of seminiferous tubules and interstitial tissue of rat testes to synthesize androgens from progesterone-4-14c in vitro. Endocrinology 76, 646–656. Pelletier, R., Trifaro, J.M., Carbajal, M.E., Okawara, Y. and Vitale, M.L. (1999) Calcium-dependent actin filament-severing protein scinderin levels and localization in bovine testis, epididymis, and spermatozoa. Biol Reprod 60, 1128–1136. Kabbaj, O., Holm, C., Vitale, M.L. and Pelletier, R.M. (2001) Expression, activity, and subcellular localization of testicular hormone-sensitive lipase during postnatal development in the Guinea pig. Biol Reprod 65, 601–612.

Chapter 10 A Novel Technical Approach for the Measurement of Individual ACAT-1 and ACAT-2 Enzymatic Activity in the Testis Li Chen, Julie Lafond, and R.-Marc Pelletier Abstract Acyl-coenzyme A:cholesterol acyltransferase (ACAT) is implicated in the esterification of cholesterol when the latter is present at concentrations exceeding metabolic demands. Thus, ACAT contributes to the maintenance of cholesterol homeostasis which in testis is essential for the production of fertile gametes. However, the role of individual isoform of the enzyme in the maintenance of cholesterol homeostasis in the gonads has not been addressed yet because approaches to measure the enzymatic activity of each isoform were lacking. Here, we used the selective ACAT-1 inhibitor, K-604, to measure the individual enzymatic activity of ACAT-1 and ACAT-2 in enriched fractions of mouse seminiferous tubules. K-604 inhibited adult mouse ACAT-1 much more than ACAT-2 with IC50 values of 100 and 1,000 ␮M, respectively, in the tubules. Next, the inhibitor concentration (100 ␮M) that inhibits the activity of ACAT-1 but not the activity of ACAT-2 was determined and applied to measure ACAT-1 and ACAT-2 enzymatic activities in mouse seminiferous tubule-enriched fractions. ACAT-2 activity reached 2173 CPMB/200 ␮g protein, while ACAT-1 enzymatic activity was 713 CPMB/200 ␮g proteins in the tubules. We also compared the effect of another inhibitor Manassantin B with K-604. Increasing the concentration (0– 1,000 ␮M) of Manassantin B resulted in the inhibition of the activity of both ACAT-1 and ACAT-2. The results show that only K-604 is a useful tool to determine the individual ACAT-1 and ACAT-2 enzymatic activities in the seminiferous tubules. Key words: Cholesterol, testis, ACAT, enzymatic activity, seminiferous tubules, ACAT-1 inhibitor.

1. Introduction Acyl-CoA:cholesterol acyltransferase (ACAT) is a membranebound enzyme residing in the endoplasmic reticulum (ER) that catalyzes the acylation of cholesterol to cholesteryl esters with Julie Lafond and Cathy Vaillancourt (eds.), Human Embryogenesis: Methods and Protocols, vol. 550 © Humana Press, a part of Springer Science+Business Media, LLC 2009 DOI 10.1007/978-1-60327-009-0 10 Springerprotocols.com

169

170

Chen, Lafond, and Pelletier

long-chain fatty acids (1–3). The enzyme exists in two isoforms, ACAT-1 and ACAT-2 (4), each encoded by different genes (2, 4, 5) and that show distinct tissue distribution (2, 6–8). The ubiquitously expressed ACAT-1 is responsible for the intracellular esterification of cholesterol (7). ACAT-2 protein expression in liver and intestine is consistent with its proposed role in lipoprotein assembly and secretion of cholesteryl esters occurring principally in hepatocytes and enterocytes (5, 8). ACAT-1 was reported in the steroid hormone-producing Leydig cells (9) but ACAT-2 was believed to be absent in the testis (10). ACAT has been studied mainly in gut and liver. The inhibition of ACAT-1 and ACAT-2 has proved to be a useful strategy in the treatment of cholesterol gallstones and atherosclerosis with the development of several of inhibitors targeting individual enzymes (11–13). Although ACAT contributes to the cholesterol homeostasis in the testis (9), the contribution of individual ACAT isoenzymes in this process is yet unclear. Manassantin A and Manassantin B, which have been isolated from the methanol extracts of Saururus chinensis root, exhibited significant human ACAT (hACAT) inhibitory activity (11). Manassantin A was reported to show more inhibitory activity against hACAT-2 than against hACAT-1 while Manassantin B mainly inhibited hACAT-1 but not hACAT-2 (11). Pyripyropene A is another ACAT inhibitor that selectively inhibits ACAT-2 in insect cells transfected with either ACAT-1 or ACAT-2 (14). K-604, a novel ACAT inhibitor highly selective for ACAT-1 (13), was reported to inhibit cholesterol esterification in human macrophages and to suppress the formation of macrophageenriched fatty streak in fat-fed hamsters (13). The study provides a novel technical approach for the measurement of individual ACAT-1 and ACAT-2 enzymatic activity present in the testis based on the use of K-604. This has allowed us to provide the first demonstration in vivo that both ACAT isoforms are active in the testis and that they act in tandem in the seminiferous tubules.

2. Materials 2.1. Mice (Mus musculus)

We used testes obtained from adult Balb/C albino adult mice. All mice were purchased from Charles River (St-Constant, QC, Canada). A total of 30 mice were used. This high number of animals was necessary to generate sufficient microsome fractions that were obtained from seminiferous tubule-enriched fractions but not from whole testis extract as this is done in most studies. Animals were anesthetized by intraperitoneal injection of 0.9 mL/kg

Individual Measurement of ACAT-1 and ACAT-2 Activity

171

body weight of sodium phenobarbital (Somnotol; MCI Pharmaceutical, Mississauga, ON, Canada) and 0.15 mL/kg body weight of a solution of 0.3 g/ml chloral hydrate in sterile saline. After anesthesia, testes were harvested. The protocol was approved by University of Montreal Animal Care Committee. 2.2. Preparation of Seminiferous Tubule-Enriched Fractions (STf) and of Microsomes from STf 2.2.1. Preparation of Seminiferous Tubule-Enriched Fractions

1. PBS buffer (1×): 137 mM NaCl, 3 mM KCl, 8 mM Na2 HPO4 , pH 7.4. Store at 4◦ C. 2. PBS buffer (1×) containing 4 mM Na3 VO4 , 80 mM NaF, 20 mM Na4 P2 O7 , pH 8.5, 2 mM ethylene glycol-bis(2-aminoethyl ether)-N,N,N,N-tetraacetic acid (EGTA), 5 mM leupeptin, 5 mM aprotinin, and 2 mM phenylmethylsulfonyl (PMSF). Store at 4◦ C.

2.2.2. Microsomes Extraction

1. Homogenization solution: 15 mM Tris–HCl, pH 7.4, 300 mM sucrose, 10 mM ␤-mercaptoethanol, and store at 4◦ C. The solution is stable for 6 months. 2. Phosphate buffer: 1 M K2 HPO4 , 1 M KH2 PO4 , pH 7.4, 30 mM EDTA, 5 mM dithiothreitol (DTT), and 250 mM NaCl and store at 4◦ C. The solution is stable for 6 months. 3. Microsomal protein measurement reagents: Microsomal proteins in the tissue-enriched fractions are measured according to the method of Bradford (15) by using a dyebinding assay (Bio-Rad, Mississauga, ON, Canada). Store at 4◦ C.

2.3. Assay for the Measurement of ACAT-1 or ACAT-2 Activity Using K-604 or Manassantin B as the Inhibitor

The assay for the measurement of ACAT-1 or ACAT-2 enzymatic activity using K-604 or Manassantin B follows the same protocol. 1. Assay buffer (5×): 1 M KH2 PO4 , pH 7.4, 10 mM DTT, store at 4◦ C. 2. Cholesterol (ICN Biomedicals, Inc., Irvine, CA, USA) is dissolved to 20 mg/mL in acetone and stored at room temperature (RT). 3. Bovine serum albumin (BSA) (Sigma–Aldrich, Oakville, ON, Canada) is dissolved to 40 mg/mL in water and stored at 4◦ C. 4. [14 C]-oleyl-CoA (56.0 mCi/mmol) (GE Healthcare, Baie d’Urf´e, QC, Canada) is stored in single use aliquots at −20◦ C. It is stable for 6 months. 5. Isopropanol and heptane, store at RT.

172

Chen, Lafond, and Pelletier

6. Stopping solution: isopropanol and heptane (4:1 v/v), is prepared before the experiment. 7. OCS (organic counting scintillant) scintillation cocktail (GE Healthcare), store at RT. 8. Thin layer chromatography (TLC) (Silica gel 60 F254 ) (EMD Chemicals, Inc., Gibbstown, NJ, USA). 9. Extraction mixture: n-hexane–diethyl ether–acetic acid (90:10:1 v/v/v), store at RT, stable for 6 months. 10. Cholesteryl oleate (Sigma–Aldrich) is dissolved to 1 M in acetone and stored in aliquots at RT. Aliquots are sealed with parafilm. 11. Manassantin B (a generous gift from Dr. Tae-Sook Jeong, Korea Research Institute of Bioscience and Biotechnology) is dissolved in 0.1% of dimethylsulfoxide (DMSO) and stored in single use aliquots at −80◦ C. 12. K-604 (a generous gift from Pfizer Global Pharmaceutical, Pfizer Global Research and Development, Pfizer, Inc., Gronton, CT, USA): the powder is stored at RT. Dissolve K-604 in 5 ␮L of DMSO. Always prepare the substrate fresh.

3. Methods 3.1. Preparation of Seminiferous Tubule-Enriched Fractions

Akpovi and Pelletier (16) reported that the use of enzymes such as collagenase and pepsin affects significantly the detection of the phosphorylated and glycosylated forms of the proteins under study. Therefore, in the present study the seminiferous tubuleenriched fractions were obtained mechanically without mild enzymatic digestion using the protocol initially developed by Akpovi et al. (17) and exposed in detail in a chapter of this book (16).

3.2. Extraction of Microsomes from Seminiferous Tubule-Enriched Fractions

It has been advanced that ACAT-1 and ACAT-2 may be located on different sides of the ER membrane, with the active site toward the cytoplasm for ACAT-1 or facing the lumenal side of the membrane for ACAT-2 (18). Therefore, microsomes are used for ACAT activity measurements. Microsomes from mouse seminiferous tubule-enriched fraction are prepared by differential centrifugation as described by Stalhberg et al. (19). Since ACAT is sensitive to proteolysis, protease inhibitors including PMSF, aprotinin, and leupeptin should be used in all solutions for preparation of microsomes. The microsomes are frozen in liquid nitrogen and stored at −80◦ C. 1. The seminiferous tubule-enriched fraction is homogenized in the homogenization solution with a Glass-Col homogenizer on ice (use 5 volumes of homogenization solution per

Individual Measurement of ACAT-1 and ACAT-2 Activity

173

1 volume of tissue). To avoid increasing the temperature of the solution when homogenizing, the samples are homogenized for about 30 s in 10 s intervals. The homogenate is kept on ice 30 min after. 2. The homogenate is centrifuged at 19,600g for 15 min at 4◦ C. The supernatant layer is carefully removed. The pellet is discarded and the microsomes are sedimented by ultracentrifugation at 100,000g for 60 min at 4◦ C. The pellet was resuspended in phosphate buffer and re-ultracentrifugated at 100,000g for 1 h at 4◦ C. 3. The supernatant is removed. The pellet is resuspended in phosphate buffer (use 20–30 ␮L of phosphate buffer per ␮L volume of pellet). The microsomes are stored in 50 ␮L aliquots at −80◦ C. 4. The microsome protein content is evaluated according to the method of Bradford (15) using BSA as a standard. 3.3. Determination of ACAT-1 and ACAT-2 Activity Using K-604 as the Inhibitor

3.3.1. Total ACAT Enzymatic Activity Measurement

K-604 is added to the enzyme assay to selectively inhibit ACAT-1. The level of ACAT-2 activity is the activity remaining after treatment with K-604. The ACAT-1 enzymatic activity in the tubules is determined by subtracting the ACAT-2 enzymatic activity from the total ACAT activity. Total enzymatic activity is measured essentially as described in previous studies (20) with minor modifications. K-604 selectively inhibits ACAT-1 but at high concentrations it also affects ACAT-2 (13). Thus, we proceed to determine the proper concentration of K-604 that inhibits ACAT-1 without affecting ACAT-2 in the seminiferous tubule-enriched fractions. 1. Total ACAT enzymatic activity is determined by assessing the production of cholesteryl[14 C]oleate (20). The microsome preparation (200 ␮g) is added to 100 ␮L assay buffer (1×) (0.2 mM KH2 PO4 , pH 7.4, 2 mM DTT) containing 0.4 mg/mL of cholesterol and 6 mg/mL of BSA. 2. After a 20 min preincubation at 37◦ C, the reaction is triggered by the addition of 10 ␮M [14 C]-oleyl-CoA. 3. The reaction mixture is incubated at 37◦ C for 25 min and the reaction is stopped by the addition of 1 mL isopropanol– heptane (4:1 v/v). 4. The final reaction mixture is vortexed and 0.6 mL heptane and 0.4 mL assay buffer (1×) are added. The upper heptane phase (100 ␮L) is transferred into a vial containing the OCS scintillation cocktail. The radioactivity is measured in a ␤-scintillation counter. The separation of cholesteryl[14 C]oleate from residual substrate, [14 C]oleoylCoA, and side-products is performed by solvent partitioning between an upper heptane phase and a lower isopropanol– water phase (21).

174

Chen, Lafond, and Pelletier

5. Since some of the radioactivity recovered in the upper phase can be due to the enzymatic incorporation of radioactive fatty acid into products other than cholesteryl oleate, to specifically measure ACAT activity, the partitioned heptane phase is separated by TLC using the extraction mixture. An aliquot of the final aqueous reaction mixture evaporated to approximately 50 ␮L is spiked with non-radioactive cholesteryl oleate to visualize the spot, deposited on silica plate and migrated with the extraction mixture. Cholesteryl ester standard (cholesteryl oleate) is used on several lanes across each plate in order to identify the region of cholesteryl ester. The separated free and esterified cholesterol are visualized by staining with iodine vapor and the radioactive content of the excised bands of free and esterified cholesterol is determined by scintillation counting (see Note 1). 3.3.2. Individual ACAT-1 and ACAT-2 Enzymatic Activity Measurements

The initial reaction mixture is the same as in the total ACAT enzymatic activity measurement except for the addition of the ACAT-1 inhibitor K-604. To measure the ACAT-2 enzymatic activity repeat Steps 1–5 of Section 3.3.1. The concentration of K-604 used in the assay is determined according to a dosedependent inhibition curve. Ten different concentrations ranging from 0 to 1,000 ␮M of inhibitor are added to the assay buffer. A concentration–enzymatic activity inhibition curve is established (Fig. 10.1). There is a slight decrease in the total ACAT activity with the addition of 0–50 ␮M K-604. Then, the total ACAT activity is decreased by half with the addition of 100 ␮M K-604. Thereafter, the total ACAT activity reached a constant level despite the addition of increasing amounts of K-604. ACAT is inhibited following addition of 200–1,000 ␮M K-604. K-604 showed a considerably greater inhibition toward ACAT-1 (IC50 = 100 ␮M) than toward ACAT-2 (IC50 = 1,000 ␮M) in the tubules. The inhibitor concentration (100 ␮M) that inhibits almost all ACAT-1 activity but not ACAT-2 activity is selected to measure the individual enzymatic activities. Using this concentration of K-604 we found that ACAT-1 enzymatic activity reached 713 CPMB/200 ␮g protein while ACAT-2 activity reached 2173 CPMB/200 ␮g protein in adult mouse tubules.

3.4. Another Inhibitor, Manassantin B

Manassantin B, another inhibitor for ACAT, was also applied to measure the enzymatic activities of ACAT-1 and ACAT-2 in mouse seminiferous tubule-enriched fractions (see Section 3.3.2). Manassantin B was shown to mainly inhibit hACAT-1 but not hACAT-2 in cells overexpressing hACAT-1 or hACAT2 (10, 11, 22). However, in our hands, an increase of 0–1,000 ␮M of Manassantin B resulted in the simultaneous inhibition of the activity of both ACAT-1 and ACAT-2. The enzymatic activity measured ranged from 2403 CPMB/200 ␮g protein

Individual Measurement of ACAT-1 and ACAT-2 Activity

175

2400 2200

CPMB/200 μg protein

2000 1800 1600 1400 1200 1000 800 600 400 0

1

10

20

50

100

150

175

200 1000 (μM)

Fig. 10.1 Dose-dependent inhibition curve of K-604 in STf (> 60d).

to 446 CPMB/200 ␮g protein. Manassantin B did not show a more potent inhibitory activity against ACAT-1 or ACAT-2 in mouse seminiferous tubule-enriched fractions. Therefore, a concentration–enzymatic activity inhibition curve could not be established for each isoenzyme and the individual ACAT-1 and ACAT-2 activity could not be measured with Manassantin B.

4. Note 1. The extraction mixture including n-hexane–diethyl ether– acetic acid (90:10:1) should be prepared in a glass container. The container with a tight-fitting lid is an advantage. The height of the solution should not exceed 2 cm. ACAT-1 and ACAT-2 activities are evaluated by the quantification of the reaction product (cholesteryl oleate), previously separated from other unspecific products by TLC. The weaker enzymatic activity or extremely different values between groups obtained by TLC could be due to an important loss of products during the necessary TLC manipulation (spotting and recovery), since the analyzed samples used and the method of quantification (evaluation of radioactive reaction product) are the same.

Acknowledgments The authors would like to thank Mrs. Lucie Simoneau (Department of Biological Sciences of Universit´e du Qu´ebec a` Montr´eal)

176

Chen, Lafond, and Pelletier

for valuable experimental assistance. Pfizer Global Pharmaceutical, Pfizer Global Research and Development, Pfizer, Inc. (Groton, CT, USA) are thankfully acknowledged for their generous supply of the inhibitor K-604. The help of Mrs. Lynda Stodola from Pfizer Canada was greatly appreciated. Dr. Tae-Sook Jeong from the Korea Research Institute of Bioscience and Biotechnology is also profusely thanked for her supply of the inhibitor Manassantin B. C.D. Akpovi is profusely thanked for his contribution of mouse seminiferous tubule-enriched fractions to this project. The work was funded by an NSERC Grant to RMP. Li Chen was a recipient of an STIRRHs fellowship. References 1. Chang, T. Y., Chang, C. C. and Cheng, D. (1997) Acyl-coenzyme A:cholesterol acyltransferase. Annu Rev Biochem 66, 613–638. 2. Chang, C. C., Huh, H. Y., Cadigan, K. M. and Chang, T. Y. (1993) Molecular cloning and functional expression of human acylcoenzyme A:cholesterol acyltransferase cDNA in mutant Chinese hamster ovary cells. J Biol Chem 268, 20747–20755. 3. Buhman, K., Accad, K. M., Novak, S., Choi, R. S., Wong, J. S., Hamilton, R. L., Turley, S. and Farese, R. V. Jr. (2000) Resistance to diet-induced hypercholesterolemia and gallstone formation in ACAT2-deficient mice. Nat Med 6, 1341–1347. 4. Oelkers, P., Behari, A., Cromley, D., Billheimer, J. T. and Sturley, S. L. (1998) Characterization of two human genes encoding acyl coenzyme A:cholesterol acyltransferaserelated enzymes. J Biol Chem 273, 26765– 26771. 5. Cases, S., Novak, S.Y., Zheng, W., Myers, H. M., Lear, S. R., Sande, E., Welch, C. B., Lusis, A. J., Spencer, T. A., Krause, B. R., Erickson, S. K. and Farese, R. V. Jr. (1998) ACAT-2, a second mammalian acylCoA:cholesterol acyltransferase. Its cloning, expression, and characterization. J Biol Chem 273, 26755–26764. 6. Anderson, R. A., Joyce, C., Davis, M., Reagan, J. W., Clark, M., Shelness, G. S. and Rudel, L. L. (1998) Identification of a form of acyl-CoA:cholesterol acyltransferase specific to liver and intestine in nonhuman primates. J Biol Chem 273, 26747– 26754. 7. Cases, S., Smith, S. J., Zheng, Y. W., Myers, H. M., Lear, S. R., Sande, E., Novak, S., Collins, C., Welch, C. B., Lusis, A. J., Erickson, S. K. and Farese, R. V. Jr. (1998) Identification of a gene encoding an acyl CoA:diacylglycerol acyltransferase, a key

8.

9.

10.

11.

12.

13.

enzyme in triacylglycerol synthesis. Proc Natl Acad Sci USA 95, 13018–13023. Rudel, L. L., Lee, R. G. and Cockman, T. L. (2001) Acyl coenzyme A:cholesterol acyltransferase types 1 and 2: structure and function in atherosclerosis. Curr Opin Lipidol 12, 121–127. Sakashita, N., Miyazaki, A., Takeya, M., Horiuchi, S., Chang, C. C., Chang, T. Y. and Takahashi, K. (2000) Localization of human acyl-coenzyme A:cholesterol acyltransferase-1 (ACAT-1) in macrophages and in various tissues. Am J Pathol 156, 227–236. Lee, R. G., Willingham, M. C., Davis, M. A., Skinner, K. A. and Rudel, L. L. (2000) Differential expression of ACAT1 and ACAT2 among cells within liver, intestine, kidney, and adrenal of nonhuman primates. J Lipid Res 41, 1991–2001. Lee, W. S., Lee, D. W., Baek, Y. I., An, S. J., Cho, K. H., Choi, Y. K., Kim, H. C., Park, H. Y., Bae, K. H. and Jeong, T. S. (2004) Human ACAT-1 and -2 inhibitory activities of saucerneol B, manassantin A and B isolated from Saururus. chinensis. Bioorg Med Chem Lett 14, 3109–3112. Parini, P., Davis, M., Lada, A. T., Erickson, S. K., Wright, T. L., Gustafsson, U., Sahlin, S., Einarsson, C., Eriksson, M., Angelin, B., Tomoda, H., Omura, S., Willingham, M. C. and Rudel, L. L. (2004) ACAT2 is localized to hepatocytes and is the major cholesterolesterifying enzyme in human liver. Circulation 110, 2017–2023. Ikenoya, M., Yoshinaka, Y., Kobayashi, H., Kawamine, K., Shibuya, K., Sato, F., Sawanobori, K., Watanabe, T. and Miyazaki, A. (2007) A selective ACAT-1 inhibitor, K-604, suppresses fatty streak lesions in fatfed hamsters without affecting plasma cholesterol levels. Atherosclerosis 191, 290–297.

Individual Measurement of ACAT-1 and ACAT-2 Activity 14. Cho, K. H., An, S., Lee, W. S., Paik, Y. K., Kim, Y. K. and Jeong, T. S. (2003) Massproduction of human ACAT-1 and ACAT-2 to screen isoform-specific inhibitor: a different substrate specificity and inhibitory regulation. Biochem Biophys Res Commun 309, 864–872. 15. Bradford, M. M. (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72, 248–254. 16. Akpovi, C. D. and Pelletier, R. M. (2009) A manual method for the isolation of seminiferous tubule-enriched fractions that preserves the phosphorylated and glycosylated forms of proteins. In: Lafond, J. and Vaillancourt, C. (Eds.), Human Embryogenesis: Methods and Protocols. Humana Press, Totowa, NJ 159. 17. Akpovi, C. D., Yoon, S. R., Vitale, M. L. and Pelletier, R. M. (2006) The predominance of one of the SR-BI isoforms is associated with increased esterified cholesterol levels not apoptosis in mink testis. J Lipid Res 47, 2233–2247. 18. Chang, T. Y., Chang, C. C., Lu, X. and Lin, S. (2001) Catalysis of ACAT may be

19.

20.

21.

22.

177

completed within the plane of the membrane: a working hypothesis. J Lipid Res 42, 1933– 1938. Stahlberg, D., Rudling, M., Angelin, B., Bjorkhem, I., Forsell, P., Nilsell, K. and Einarsson, K. (1997) Hepatic cholesterol metabolism in human obesity. Hepatology 25, 1447–1450. Erickson, S. K., Shrewsbury, M. A., Brooks, C. and Meyer, D. J. (1980) Rat liver acylcoenzyme A:cholesterol acyltransferase: its regulation in vivo and some of its properties in vitro. J Lipid Res 21, 930–941. Jeong, T. S., Kim, S. U., Son, K. H., Kwon, B. M., Kim, Y. K., Choi, M. U. and Bok, S. H. (1995) GERI-BP001 compounds, new inhibitors of acyl-CoA:cholesterol acyltransferase from Aspergillus fumigatus F37. I. Production, isolation, and physico-chemical and biological properties. J Antibiot (Tokyo) 48, 751–756. Lee, O., Chang, C. C., Lee, W., and Chang, T. Y. (1998) Immunodepletion experiments suggest that acyl-coenzyme A:cholesterol acyltransferase-1 (ACAT-1) protein plays a major catalytic role in adult human liver, adrenal gland, macrophages, and kidney, but not in intestines. J Lipid Res 39, 1722–1727.

Chapter 11 Genetic Dissection of Caenorhabditis elegans Embryogenesis Using RNA Interference and Flow Cytometry Elodie L. Boulier and Sarah Jenna Abstract Study of Caenorhabditis elegans embryonic development has been useful to dissect the molecular mechanisms controlling cell proliferation, cell polarization, cell differentiation, and morphogenic events also involved in embryogenesis in human (1, 2). The strength of this organism for developmental research consists in its amenability to large-scale genetic screening, its simple morphology, and transparency enabling study of developmental processes at a single cell level. Large-scale genetic screening targeting embryonic development in C. elegans is usually poorly sensitive and non-quantitative (3, 4). In this chapter we detail a novel approach enabling genetic dissection of C. elegans embryogenesis in a quantitative and semi-automated manner. This approach based on RNAi and flow cytometry enables the measurement of discrete embryonic lethal phenotypes and staging of arrested embryos. Key words: Caenorhabditis elegans, RNAi, high-throughput, embryonic development, genetic screening, COPAS Biosort, flow cytometry.

1. Introduction In multicellular organisms, embryonic development involves intense cell proliferation followed by cell differentiation and morphogenic events leading to organ formation (Fig. 11.1). Molecular machines controlling these developmental events appear to be well conserved throughout evolution (1, 2, 5). The soil nematode C. elegans, with its low number of cells (a thousand cells in adults), its simple morphology, and invariable developmental pattern has been used for decades as an animal model to identify the genes controlling the embryonic development (1, 2). The Julie Lafond and Cathy Vaillancourt (eds.), Human Embryogenesis: Methods and Protocols, vol. 550 © Humana Press, a part of Springer Science+Business Media, LLC 2009 DOI 10.1007/978-1-60327-009-0 11 Springerprotocols.com

181

Boulier and Jenna

sequencing of C. elegans genome, the identification of RNA interference (RNAi) as a powerful tool to reduce gene expression in living organisms, and the construction of genome-wide RNAi libraries have significantly accelerated this discovery process. Large-scale RNAi screens using embryonic lethality as a phenotypical readout involve visual inspection of RNAi-treated populations and are usually not quantitative (3, 4, 6, 7). Consequently, these approaches while being powerful to identify essential genes associated with highly penetrant embryonic lethality fail to identify phenotypes with low penetrance and are poorly amenable to the identification of genetic interactions that require quantitative data. The recent development and commercialization of the flow cytometer COPAS Biosort (Complex Object Parametric Analyzer and Sorter) by Union Biometrica provide the necessary technology for the development of high-throughput and quantitative 2-fold stage 3-fold stage

Comma stage

700

number of nucleus per embryo

182

600 500 400 300 200 100 0 0

100

200

300

400

500

600

700

800

Time (min) proliferation

morphogenesis Fig. 11.1 Embryo staging based on fluorescent emission from animals expressing Histone::GFP translational fusion. They are represented by the number of cells per embryo at the different stages of C. elegans embryonic development (1). Pictures of embryos at early and late embryonic stages are recorded using fluorescent microscopy and digital camera.

High-Throughput Study of C. elegans Embryogenesis

183

RNAi screening for embryonic lethality. The COPAS Biosort enables automated quantitative analyses of nematode size and fluorescent emission. It is interfaced with an ReFLx sampler module that enables the analysis of populations incubated in 96-well plates in a semi-automated manner. The procedure detailed in this chapter aims to analyze in a quantitative and semi-automated manner the embryonic lethality associated with nematode populations submitted to RNAi treatment. It also aims to provide a relative staging of arrested embryos and consequently to cluster genes based on their requirement in early or late stages of the embryonic development. To do so, we use a C. elegans transgenic strain expressing a translational fusion of histones with a green fluorescent protein (GFP) throughout embryonic development. Embryos expressing this fusion protein have a GFP emission that is proportional to the number of cells they contain (see Fig. 11.1). GFP emission could then be used to discriminate early embryos (with low GFP emission) from late embryos (with high GFP emission). To identify genes whose functions are required for the embryonic development, transgenic animals are submitted to RNAi using feeding protocol and their progeny analyzed for embryonic lethality. Counting of L1 versus dead embryos using the COPAS Biosort is used to estimate the average embryonic lethality associated with RNAi treatments. The distribution of GFP emission per dead embryos is used to discriminate genes that are involved in early versus late developmental stages. These two quantifications could be used to identify genetic interactions using double genetic perturbations through RNAi (8, 9). This approach could also been used as a first screen to cluster genes based on their involvement in early or late developmental stages.

2. Materials 2.1. Generation and Maintenance of RNAi-Expressing Bacterial Clones

1. The ORFeome-based library Commercially available: open biosystems, http://www.openbiosystems.com. The C. elegans ORFeome–RNAi v1.1 library represents ∼55% of the predicted genes with 11,804 RNAi clones comprising the C. elegans ORF–RNAi feeding library. Highthroughput recombinational cloning protocols were used to transfer the C. elegans ORFeome v1.1 into the pL4440-destRNAi feeding vector using recombinational cloning methods (Gateway cloning, Invitrogen) (4). These constructs are transformed into bacterial strain HT115 as described (3). 2. Genomic DNA-based library Commercially available: Geneservice, http://www.geneservice.co.uk

184

Boulier and Jenna

To generate this library C. elegans genomic fragments were PCR amplified using Research Genetics GenePairs, cloned into the EcoRV site of vector L4440 (10), and transformed into bacterial strain HT115 as described (3). The whole genome library consists of 16,757 bacterial strains, which cover 87% of C. elegans genes. 3. Tetracycline HCl (Bioshop): 5 mg/mL in ethanol 95% and store at −20◦ C. 4. Ampicillin sodium salt (Bioshop): 10 mg/mL in water and store at −20◦ C. 5. LB medium: 10 g/L NaCl, 10 g/L bactopeptone, 5 g/L yeast extract, 2 pearls/L NaOH. Autoclave to sterilize. 2.2. Transformation of HT115 Bacteria with RNAi-Coding Vector

1. Escherichia coli HT115(DE3) strain. Genotype: F-, mcrA, mcrB, IN(rrnD-rrnE)1, lambda-, rnc14::Tn10. Description: This strain is RNAse III deficient and is able to express T7 polymerase upon IPTG induction. T7 polymerase gene expression is driven by the lacUV5 promoter that is IPTG-inducible. Rnc14 encodes RNAse III that is disrupted by Tn10 and consequently unable to degrade the dsRNA expressed in vivo. Tn10 carries a tetracycline resistant gene. 2. SOC medium: 20 g/L bactopeptone, 5 g/L yeast extract, 0.5 g/L NaCl, 10 mL of 250 mM KCl, adjust pH to 7. Autoclave to sterilize. 3. LB agar medium: 10 g/L NaCl, 10 g/L agar, 10 g/L bactopeptone, 5 g/L yeast extract, 2 palette/L NaOH. Autoclave to sterilize. 4. Square bottom 96-well polypropylene blocks (Corning Incorporated). 5. 96-well PCR plates (Corning Incorporated). 6. Breathable films (VWR International). 7. 2-mm Diameter glass beads, sterile (VWR International).

2.3. RNAi Treatment of Histone–GFPExpressing Animals

1. Worm strain RW10006 can be obtained from the Caenorhabditis Genetics Center; University of Minnesota (http://www.cbs.umn.edu/CGC/order.html): Genotype: unc-119(ed3) I; ruls32III[unc-119(+) + pie1::GFP::H2B]; zuls178 V[unc-119(+) + his-72(1 kb)::HIS72::GFP]. Description: These animals express a translational fusion of the histone with the GFP. Expression is ubiquitous in embryo and is also detected in adult germline and several adult somatic cells. 2. NGM agar: 3 g/L NaCl, 16 g/L agar, 2.5 g/L bactopeptone. Autoclave and add 1 mM MgSO4 , 1 mM CaCl2 , 1 mM phosphate buffer, and 5 ␮g/mL cholesterol.

High-Throughput Study of C. elegans Embryogenesis

185

3. NGM liquid: 3 g/L NaCl, 2.5 g/L bactopeptone. Autoclave and add 1 mM MgSO4 , 1 mM CaCl2 , 1 mM phosphate buffer, and 5 ␮g/mL cholesterol. 4. Hypochlorite buffer 1×: 0.4 M hypochlorite, 0.5 M NaOH. 5. TY: 5 g/L bactopeptone, 2.5 g/L yeast extract. Autoclave to sterilize. 6. M9: 12.8 g/L Na2 HPO4 •7H2 O, 3 g/L KH2 PO4 , 5 g/L NaCl, 0.25 g/L MgSO4 •7H2 O. Autoclave to sterilize. 7. Phosphate buffer 1 M: 129.25 g/L KH2 PO4 , 51.75 g/L K2 HPO4 , adjust the pH at 6 and filter to sterilize. 8. IPTG (Bioshop): Prepare 1 M solution and store at −20◦ C. 9. Petri 100-mm diameter plates (Sarstedt). 10. Six-well cell culture flat bottom plate with lid, sterile (Corning Incorporated). 11. Tissue culture 96-well plate flat bottom with lid, sterile (Sarstedt). 2.4. Preparation of Eggs from RNAi-Treated Animals

1. Hypochlorite buffer 2×: 0.8 M hypochlorite, 1 M NaOH. 2. AcroprepTM 96-filter plate, 1.2 ␮m Supor NTRL, 350 ␮L well (Pall Life Science).

2.5. Analysis of HIS2::GFP Animals Progeny Using Flow Cytometry

1. Flat bottom 96-well microtest plates, sterile (Sarstedt). 2. SDS 1%: Dissolve 1 g of SDS in 100 mL of mQ water and store at room temperature. 3. Sheath buffer: This buffer is commercially available (Union Biometrica, Boston, MA, USA). This buffer of unknown composition is an aqueous based reagent containing surfactant. 4. Cleaning reagent: This buffer is commercially available (Union Biometrica). This buffer of unknown composition is an aqueous based reagent containing surfactant. 5. Beads GP control particles: This buffer is commercially available (Union Biometrica). These particles which are used as control are 42-␮m fluorescent latex beads.

3. Methods 3.1. Generation and Maintenance of RNAi-Expressing Bacterial Clones

Double-stranded RNA (dsRNA) inducing RNAi can be introduced into living nematodes using different experimental approaches: (i) through injection in animal gonads, (ii) through soaking of animals in dsRNA solution, or (iii) through feeding the animals with bacteria expressing the dsRNA. The later approach has been adopted by the C. elegans community to develop genome-wide RNAi screenings. Two RNAi-by-feeding libraries

186

Boulier and Jenna

are currently available to the scientific community. They have been generated through PCR-amplification of genomic DNA fragments (3) or through recombination in RNAi-by-feeding vectors of full-length ORFs of the C. elegans ORFeome v1.1 library (4, 11). These two RNAi libraries partially overlap and when combined cover 17,201 genes corresponding to approximately 86% of the predicted worm genome (see Note 1). The C. elegans RNAi-feeding clones are usually provided as E. coli bacterial stocks in LB broth containing 8% glycerol, ampicillin at a concentration of 100 ␮g/mL, and tetracycline at a concentration of 12.5 ␮g/mL. They can be stored at 4◦ C for a week or grown to generate fresh glycerol stocks as detailed in this section. They could also be provided as purified pL4440-RNAi vectors. These construction should then be transformed in HT115 bacteria (12) as detailed here. RNAi-coding vectors are variants of the original pL4440RNAi vector (10) that contain the coding sequence of interest between two T7 promoters. This vector contains a gene of resistance to the ampicillin. The efficiency of RNAi-by-feeding procedure requires that bacteria could express and accumulate a large amount of dsRNA. For this reason RNAi-mediating constructs are transformed in an engineered E. coli HT115(DE3) strain that are deficient for RNAse and engineered to express the T7 RNA polymerase required for dsRNA synthesis (12). 1. Competent cells are prepared using classical calcium chloride procedure and dispensed in 96-well PCR plates, 50 ␮L of bacteria per well, prior to freezing at −80◦ C. 2. Competent cells are thawed on ice and incubated with 100 ng of pL4440 plasmids containing the coding sequence of interest (see Note 2). 3. Bacteria are incubated with DNA in a thermocycler for 30 min at 4◦ C, for 90 s at 42◦ C, and for 10 min at 4◦ C. 4. Bacteria are then transferred to sterile 2 mL 96-well blocks containing 300 ␮L of SOC medium. Blocks are sealed with breathable film and incubated for 30 min at 37◦ C upon agitation (600 rpm in 3-mm orbital microplate shaker). 5. Bacteria are centrifuged at 3,000g for 10 min at room temperature, 260 ␮L of culture medium is removed from the wells. 6. Bacteria are resuspended in remaining medium and plated using sterile glass beads in 6-well plates freshly poured with LB-agar plates containing 100 ␮g/mL of ampicillin and 12.5 ␮g/mL of tetracycline. 7. Seeded plates are incubated at 37◦ C upside-down overnight. 8. A pool of eight colonies for each construct are grown in 500 ␮L of LB medium containing 100 ␮g/mL ampicillin and 12.5 ␮g/mL tetracycline overnight at 37◦ C.

High-Throughput Study of C. elegans Embryogenesis

187

9. About 500 ␮L of 40% glycerol/LB buffer is added to the culture, mixed by vortexing, and stored at −80◦ C for periods up to 2 years. 3.2. RNAi Treatment of Histone–GFPExpressing Animals

As detailed in the introduction transgenic animals expressing a translational fusion of histone with GFP are used to: (i) calculate the embryonic lethality associated with each genetic perturbation; (ii) stage arrested embryos (see Note 3). The procedure detailed in this section is illustrated in Fig. 11.2.

Histone::GFP

RNAi bacterial clones

37°C

8h

synchronisation

Dilution L1 37°C

3h

+ IPTG 1mM 18°C

24h

100 worms/well + NGM + RNAi bacterial clones

37°C

5h

3000 g

L3 18ºC

72h

Adults Embryos synchronisation

L1 Dead embryos

Fig. 11.2 Experimental procedure used to study embryonic development using RNAi and flow cytometry.

188

Boulier and Jenna

Each RNAi is performed in triplicate, and each plate contains the two following controls: (i) worms fed with HT115(DE3) bacteria or (ii) HT115(DE3) bacteria transformed with pL4440eGFP vector. These two conditions correspond to negative and positive RNAi controls, respectively. Using this protocol, RNAi against 30 different genes can be tested per 96-well plate and up to 5 plates can be processed per person and per day. A thousand genes could then be tested using this approach per week. 3.2.1. Synchronization of Nematode Population

In opposition to larvae and adults, embryos are protected against hypochlorite treatment by their egg shelves. This treatment is then used to purify embryos from a non-synchronized population containing a majority of adults. 1. Nematodes are floated from ten 100-mm NGM-agar plates containing a large amount of adult hermaphrodites using 10 mL of M9 buffer (see Note 4). 2. Nematodes are sedimented in 15-mL conical tube at 900g at room temperature. 3. They are then incubated for 4 min in hypochlorite buffer 1×, washed five times, and resuspended in 20 mL of sterile M9 buffer and dispensed in a 100-mL glass Erlenmeyer. 4. Embryos are incubated for 16 h at 22◦ C upon agitation (220 rpm in 3-mm orbital microplate shaker) (see Note 5). During this incubation, eggs will hatch and larvae will arrest at L1 stage due to the lack of food. 5. In order to obtain synchronized L3 larvae, L1 larvae are incubated for 1 day at 18◦ C in about 500 ␮L of NGM liquid per 50 worms containing one fifth (v/v) of a saturated culture of HT115 bacteria. Incubation is carried out in a 100-mL glass Erlenmeyer upon agitation (220 rpm in 3-mm microplate shaker) (see Note 6).

3.2.2. Induction of dsRNA Synthesis by HT115 Bacterial Clones

1. Flat bottom 96-well blocks containing 1 mL of LB medium, 100 ␮g/mL ampicillin, and 12.5 ␮g/mL tetracycline are inoculated with HT115 clones transformed with RNAi constructions, sealed with a breathable film, and grown for 8 h at 37◦ C upon agitation (220 rpm, 3-mm microplate shaker). 2. Bacterial cultures are mixed with a pipette and 20 ␮L is transferred to fresh 96-well blocks containing 750 ␮L of NGM liquid medium containing 100 ␮g/mL ampicillin (see Note 7). 3. Bacterial cultures are incubated at 37◦ C for 3 h upon agitation (220 rpm, 3-mm microplate shaker), and the synthesis of double-stranded RNA was induced for 5 h at 37◦ C after adjunction of 1 mM of IPTG to bacterial culture. 4. Bacteria are centrifuged at 3,000g for 20 min at room temperature. Culture medium is removed from the wells and the bacterial pellet resuspended with 200 ␮L of NGM

High-Throughput Study of C. elegans Embryogenesis

189

liquid medium; 100 ␮L of this culture is transferred to a flatbottom 96-well plate and the remaining culture sealed with a plastic mat and stored at 4◦ C. 3.2.3. Treatment of Synchronized Animals with RNAi

1. Concentration of L3 larvae in synchronized population is estimated in 5 and 10 ␮L of worm suspension using dissecting microscope. 2. Concentration of the worms is adjusted to 4 worms/␮L with M9 buffer. 3. About 25 ␮L of worm suspension (corresponding to 100 L3 larvae) is dispensed per well of plates containing RNAiexpressing bacteria (see Note 8). 4. Animals are submitted to RNAi treatment for 72 h at 18◦ C with agitation (see Note 9).

3.2.4. Preparation of Embryos from RNAi-Treated Animals

1. Nematodes are sedimented at 900g for 3 min and 50 ␮L of supernatant discarded (see Note 10). 2. About 50 ␮L of hypochlorite solution 2× is added to each well and the plate incubated for 2–3 min at room temperature under a dissecting microscope. 3. When adults rupture from the effect of the treatment, suspensions are filtered through support membrane using 96-well filter plates upon vacuum. 4. Embryo preparations are washed four times with 200 ␮L of M9 buffer in the filter plate, resuspended in 150 ␮L of M9, and dispensed in clean and sterile flat-bottom 96-well plates. Each triplicate of experimental condition should be separated by three empty wells that will be used to wash the ReFLx (Fig. 11.2). Embryos are incubated overnight at 22◦ C without agitation. This allows the eggs to hatch.

3.3. Analysis of HIS2::GFP Animals Progeny Using Flow Cytometry

3.3.1. Qualibration of the COPAS Biosort and Reflx Sampler

The COPAS Biosort is operated following Union Biometrica instructions. The standard COPAS Biosort includes a 670-nm red diode laser which is used to measure the axial length (time of flight, TOF) and the optical density of objects. It also contains a multiline argon laser for fluorescent excitation. The standard instruments have an extinction detector and three photomultiplier tube (PMT) fluorescence detectors which can be used to detect fluorescence emissions in the green, yellow, and red regions of the spectrum. To measure GFP emission, select the 488-nm excitation filter for the Multi-Line Argon-Ion Laser and consider the fluorescent emission detected between 498 and 522 nm by the PMT1 (green channel). 1. The flow rate should be adjusted to 9–10 mL/min. To adjust the flow rate to appropriate level, increase or decrease the sample pressure.

190

Boulier and Jenna

Table 11.1

Ext

Signal

Integral

100

100

Green

150

150

Yellow

150

150

Red

150

150

2. To calibrate the COPAS, select “run control particles” in tool menu, put the GP beads in the cup, and click on acquire button to begin sheath and sample flow. We expect to have a mean related to the bead distribution of 21 ± 6 and a coefficient of variation around that mean (C.V.) ≤ 11 (see Note 11). 3. Set up of all parameters for fluorescent and TOF measurement and detection as follows: (a) Scales for TOF, Ext, Green, Yellow, and Red should be set to 256. (b) Gain should be set as shown in Table 11.1 (c) PMT Control should be set at 700 for green and yellow channel and at 900 for the red one. 3.3.2. Analysis of the L1 and Eggs Populations Using the COPAS ReFLx Sampler

Prepare the plate as follows: 1. Fill the three washing wells with either 150 ␮L of SDS 1% (first well) or sheath buffer (second and third wells). The presence of ionic detergent in the first washing well avoids plugging of the COPAS tubes by embryos. 2. Put the plate on the right part of the ReFLx sample module, click “Sample” on the COPAS command interface, and save data file as .txt.

3.3.3. Calculation of the Embryonic Lethality

The COPAS Biosort qualibrates animals and embryos for each condition through measurement of the TOF (Fig. 11.3C). As shown in Fig. 11.3, embryos and L1 Larvae are identified as objects with TOFs ranging from 24 to 36 (Emb, Fig. 11.3A) and from 41 to 100 (L1, Fig. 11.3B), respectively. This measurement allows the calculation of the percentage of embryonic lethality that is expressed as the percentage of dead eggs (Emb) over the total number of objects (Emb + L1). As shown in Fig. 11.3D, control (RNAi) and egfp (RNAi) conditions show an embryonic lethality that may reach 5–20% and that correspond to embryonic lethality resulting from hypochlorite treatment of control animals (see Note 12).

3.3.4. Identification and Representation of the Embryonic Lethality Profiles

Drawing the distribution of eggs (TOF between 25 and 36) for different windows of fluorescence emission ranging from 5 to 50 (arbitrary unit, using parameters set in Section 3.3.1) allows us

High-Throughput Study of C. elegans Embryogenesis

A

B

Emb 25

L1

36

41

40

35

35

30

30

GFP emission

GFP emission

40

25 20 15 10

191

100

25 20 15 10

5

5 0

0 0

20

40

60

80

0

100

20

40

TOF

60

80

100

TOF

Emb

L1

C 40

GFP emission

35 30 25 20 15 10 5 0 0

20

40

60

80

100

TOF

D

E

60

50

control (RNAi)

45

50

35 % embryos

% Emb

40 30 20

20

5 0

)

)

Ai

h ac

on

25

10

0

C

cyk-4(RNAi)

30

15

10

l tro

egfp(RNAi)

40

Ai

N

e bl

N

(R

e

p gf

5

10

15

20

25

30

GFI intensity per egg

(R

4 k-

cy

Fig. 11.3 Flow cytometry analysis of the progeny of RNAi-treated animals. Example of graph plot representing GFP emission versus TOF (time of flight) of freshly prepared embryos (A); of synchronized L1 larvae (B), and of the progeny of animals treated with RNAi against essential genes (C). They are also represented by the percentage of embryonic lethality (D) and by the distribution of embryos based on GFP emission (E) of Histone::GFP-expressing animals fed with HT115 (control (RNAi)), of animals treated with RNAi against egfp (egfp (RNAi)), and of animals treated with an RNAi against cyk-4 (cyk-4 (RNAi)).

192

Boulier and Jenna

to identify RNAi treatments inducing an accumulation of early or late embryos when compared to control (RNAi) (Fig. 11.3E). The shift to low fluorescence of egg distribution for egfp (RNAi) condition shows the efficiency of RNAi treatment for each experiment (see Note 13). As an example of the efficiency of the technique cyk-4 (RNAi) is shown by our technique to induce an arrest of embryos in early embryonic stages (Fig. 11.3E). This confirms published data that show the involvement of cyk-4 in the control of the first division (stages 1–2 cells) (13).

4. Notes 1. For most genes, dsRNA stretches from 200 to 1,000 nucleotides or longer appear to effectively induce interference. However, some specific gene segments are ineffective at inducing interference. Consequently, RNAi treatment should be tried using several segments of a gene. Some additional cloning of cDNA segment into RNAi-byfeeding vectors is consequently required and could complement existing resources. Detail procedure of how to generate these constructs has been described elsewhere (14). 2. HT115 bacteria are extremely fragile and require particular care such as avoiding unnecessary pipetting. 3. Some mutations have been demonstrated to increase sensitivity to dsRNA treatment: eri-1(mg366) IV and rrf3(pk1426) II. RNAi phenotypes in rrf-3(pk1426) II genetic background may be stronger and more closely resemble a null phenotype as compared to wild-type phenotype. However, this mutation was shown to silence transgenes and is therefore not recommended to examine GFP expression in transgenic animals. However, the generation of transgenic animals expressing Histone::GFP fusion proteins in the genetic background of eri-1(mg366) IV mutation could constitute an excellent model to increase the penetrance of RNAi-induced phenotypes. 4. Embryos laid on the NGM-agar plate will stick to the plate and could not be collected by floatation. Eggs could be detached from the plate through gentle scraping of its surface with a finger (with gloves). 5. Embryos need oxygenation for proper development. Lack of oxygenation after hypochlorite treatment will result in major embryonic lethality. 6. Culture could be delayed through incubation at 15◦ C for 1 day and a half.

High-Throughput Study of C. elegans Embryogenesis

193

7. The Tn10 transposon interrupting RNAse III gene in HT115 carries a tetracycline resistance gene. Therefore, bacteria should be subjected to tetracycline selection (12.5 ␮g/mL) to maintain the RNase deficiency. However, the presence of tetracycline in worm culture medium has been reported to reduce RNAi efficiency (15). The transposon being quite stable, we recommend to avoid using tetracycline in NGM culture medium during RNAi treatment of nematodes. 8. Nematodes are dispensed in plates using multichannel pipettes with 200 ␮L tips with extremity cut to avoid damaging the nematodes. 9. Check every day if the worms have enough food. To avoid starvation 50 ␮L of induced bacteria stored at 4◦ C (see Section 3.2.2, Step 4) could be added to the culture. 10. Any food that may have been added to the well during the RNAi treatment have to be considered to estimate the total volume contained per well. The amount of hypochlorite solution 2× has to be then adjusted accordingly to obtain a 1× final concentration in the next experimental step. 11. If the C.V. is >11 and the mean is >27 try to clean the tubules by clicking several times on the clean button. 12. Reducing to a minimum, this level of embryonic lethality will improve the sensitivity of the technique. Consequently, batch of experiment with a baseline embryonic lethality superior to 20% should not be considered for analysis. 13. Experiment should not be considered for analysis if there is no significant difference between distributions corresponding to egfp (RNAi) and control (RNAi) conditions. References 1. Chisholm, A. D. and Hardin, J. (2005) Epidermal Morphogenesis (J. Priess and G. Seydoux, Eds.), wormbook: the online review of C. elegans biology wormbook.org pp. 1–22. 2. Gonczy, P. and Rose, L. S. (2005) Asymmetric Cell Division and Axis Formation in the Embryo (J. Priess and G. Seydoux, Eds.), wormbook: the online review of C. elegans biology wormbook.org pp. 1–20. 3. Kamath, R. S., Fraser, A. G., Dong, Y., Poulin, G., Durbin, R., Gotta, M., Kanapin, A., Le Bot, N., Moreno, S., Sohrmann, M., Welchman, D. P., Zipperlen, P. and Ahringer, J. (2003) Systematic functional analysis of the Caenorhabditis elegans genome using RNAi. Nature 421, 231–237. 4. Rual, J. F., Ceron, J., Koreth, J., Hao, T., Nicot, A. S., Hirozane-Kishikawa, T., Van-

denhaute, J., Orkin, S. H., Hill, D. E., van den Heuvel, S. and Vidal, M. (2004) Toward improving Caenorhabditis elegans phenome mapping with an ORFeome-based RNAi library. Genome Res 14, 2162–2168. 5. Muller, H. A. and Bossinger, O. (2003) Molecular networks controlling epithelial cell polarity in development. Mech Dev 120, 1231–1256. 6. Simmer, F., Moorman, C., van der Linden, A. M., Kuijk, E., van den Berghe, P. V., Kamath, R. S., Fraser, A. G., Ahringer, J. and Plasterk, R. H. (2003) Genome-wide RNAi of C. elegans using the hypersensitive rrf-3 strain reveals novel gene functions. PLoS Biol 1, E12. 7. Maeda, I., Kohara, Y., Yamamoto, M. and Sugimoto, A. (2001) Large-scale analysis of gene function in Caenorhabditis elegans

194

8.

9.

10. 11.

Boulier and Jenna by high-throughput RNAi. Curr Biol 11, 171–176. Lehner, B., Crombie, C., Tischler, J., Fortunato, A. and Fraser, A. G. (2006) Systematic mapping of genetic interactions in Caenorhabditis elegans identifies common modifiers of diverse signaling pathways. Nat Genet 38, 896–903. Lehner, B., Tischler, J. and Fraser, A. G. (2006) RNAi screens in Caenorhabditis elegans in a 96-well liquid format and their application to the systematic identification of genetic interactions. Nat Protoc 1, 1617– 1620. Timmons, L. and Fire, A. (1998) Specific interference by ingested dsRNA. Nature 395, 854. Reboul, J., Vaglio, P., Rual, J. F., Lamesch, P., Martinez, M., Armstrong, C. M., Li, S., Jacotot, L., Bertin, N., Janky, R., Moore, T., Hudson, J. R., Jr., Hartley, J. L., Brasch, M. A., Vandenhaute, J., Boulton, S., Endress, G. A., Jenna, S., Chevet, E., Papasotiropoulos, V., Tolias, P. P., Ptacek, J., Snyder, M., Huang, R., Chance, M. R., Lee, H., Doucette-Stamm, L., Hill, D. E. and Vidal, M. (2003) C. elegans ORFeome version

12.

13.

14.

15.

1.1: experimental verification of the genome annotation and resource for proteome-scale protein expression. Nat Genet 34, 35–41. Timmons, L., Court, D. L. and Fire, A. (2001) Ingestion of bacterially expressed dsRNAs can produce specific and potent genetic interference in Caenorhabditis elegans. Gene 263, 103–112. Jantsch-Plunger, V., Gonczy, P., Romano, A., Schnabel, H., Hamill, D., Schnabel, R., Hyman, A. A. and Glotzer, M. (2000) CYK-4: a Rho family gtpase activating protein (GAP) required for central spindle formation and cytokinesis. J Cell Biol 149, 1391–1404. Jenna, S. and Chevet, E. (2007) HighThroughput RNAi in Caenorhabditis elegans – From Molecular Phenotypes to Pathway Analysis (M. Latterich, Ed.), New York, NY: Taylor & Francis Group, C2008, pp. 65–78. Kamath, R. S., Martinez-Campos, M., Zipperlen, P., Fraser, A. G. and Ahringer, J. (2001) Effectiveness of specific RNAmediated interference through ingested double-stranded RNA in Caenorhabditis elegans. Genome Biol 2.

Chapter 12 Immune System: Maturation of Myeloid Cells Jamila Ennaciri and Denis Girard Abstract Human and animal cell lines are important laboratory tools that can be used for studying a variety of cell functions. Some cell lines are blocked at a certain step of maturation and can be used in order to study the mechanisms involved in cell maturation. Because such cell lines can be differentiated toward a more mature-like phenotype after the addition of agents, they can replace primary cells in large screening experiments preventing daily isolation. The human promyelocytic HL-60 leukemia cell line is an attractive model for studying the events which occur in myeloid cells. Interestingly, these cells can be differentiated toward monocytes, macrophages, or granulocytes as described in the present chapter. Key words: HL-60 cell line, leukemia, immune cells differentiation.

1. Introduction Studies of primary cells are often impeded by the limited amounts of human available cells and tissues and also by the timeconsuming procedures to obtain them, related costs, and the ethical requirements. Fortunately, several lines of human leukemia cells are available, such as HL-60, PLB-985, U937, and THP-1 cells. These cells are blocked at certain steps of their differentiation process but can be prompted to differentiate into different cell phenotypes by various stimuli (1–3). These cell lines permit the investigation of large numbers of homogenous cells, which facilitates functional and biochemical studies. In this chapter we will focus on the promyelocytic HL-60 leukemia cell line initially isolated by S.J. Collins and colleagues in 1977 (4). Peripheral blood leukocytes were obtained by leukopheresis from a 36-yearJulie Lafond and Cathy Vaillancourt (eds.), Human Embryogenesis: Methods and Protocols, vol. 550 © Humana Press, a part of Springer Science+Business Media, LLC 2009 DOI 10.1007/978-1-60327-009-0 12 Springerprotocols.com

195

196

Ennaciri and Girard

old Caucasian female with acute promyelocytic leukemia. Due to their capacity to differentiate in vitro into a variety of different cell types of myelomonocytic lineage, the HL-60 cell line has attracted the interest of many research groups. HL-60 cells differentiate toward neutrophil-like phenotype using dimethyl sulfoxide (DMSO) (5) or into eosinophils when cultured in slightly alkaline media (pH 7.6–7.8) (6), or into monocyte- or macrophage-like cells using 1,25-(OH)2 vitamin D3 (7–10) or phorbol 12-myristate 13-acetate (PMA) (11, 12), respectively. The efficiency of cell differentiation can be evaluated by different methods, including cell morphology, enzymatic reaction, flow cytometry, and the nitroblue tetrazolium (NBT) reduction assay. These methods are detailed in the following sections.

2. Materials 2.1. Cell Culture and HL-60 Differentiation

1. HL-60 cells (American Type Culture Collection (ATCC), Manassas, VA, USA). 2. RPMI medium 1640 (1×) liquid containing 25 mM 4(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) (Invitrogen, Grand-Island, NY, USA) and L-glutamine, or 25 mM 4-(2-hydroxyethyl)-1-piperazinepropanesulfonic acid (HEPPS) (Invitrogen, Grand-Island, NY, USA) supplemented with 10% heat-inactivated fetal bovine serum (FBS) and 50 U/mL penicillin and 50 ␮g/mL streptomycin (Invitrogen). 3. DMSO (Sigma–Aldrich). 4. 1,25-(OH)2 vitamin D3 (Sigma–Aldrich) aliquoted and stored at −80◦ C. 5. Phorbol 12-myristate 13-acetate (PMA) (Sigma–Aldrich). 6. Phosphate-buffered saline (PBS) solution (Invitrogen). 7. Flasks T-75 (Corning Glass Works, Corning, NY, USA).

2.2. Cytology

1. Hema 3 staining kit or Diff-Quick staining kit (Fisher, Kalamazoo, MI, USA). 2. Wright–Giemsa stain set (Sigma–Aldrich). 3. Trypan blue solution (Sigma–Aldrich). 4. Hemacytometer.

2.3. The NBT Assay

1. PMA is dissolved at 10–5 M (stock solution) in Hanks’ Balanced Salt Solution (HBSS) (Invitrogen) and stored at −20◦ C. 2. Nitroblue tetrazolium (NBT) chloride (Sigma−Aldrich) is stored at 4◦ C. 3. RPMI medium 1640 (1×) liquid without serum.

Myeloid Cell Maturation

197

2.4. α -Naphthyl Acetate Esterase Tests

1. ␣-Naphthyl acetate esterase kit (Sigma–Aldrich). 2. Citrate–acetone–methanol fixative: 18 mL citrate dilute solution, 27 mL ACS grade acetone, and 5 mL methanol. Store tightly capped at room temperature. Discard after 8 h. 3. Citrate dilute solution: 1 part citrate concentrate, 9 parts deionized water, pH 5.4 when diluted. 4. TRIZMAL 7.6 dilute buffer solution: 1 part TRIZMAL 7.6 buffer concentrate, 9 parts deionized water, pH 7.6 at 25◦ C. 5. ␣-Naphthyl acetate solution: Dissolve 1 capsule of ␣-naphthyl acetate in 2 mL ethylene glycol monomethyl ether. Remove 1 capsule from freezer as needed. Prepare immediately prior to use. 6. Fast blue RR SALT (cat. no. FBS-25; Sigma–Aldrich). 7. Mayer’s hematoxylin solution (cat. no. MHS-1; Sigma– Aldrich).

2.5. Flow Cytometry

1. Bovine serum albumin (BSA) (Sigma–Aldrich) stored at 4◦ C. 2. PBS 1× (Invitrogen). 3. Staining buffer: PBS with 1% BSA, pH 7.4, filter and store at 4◦ C. 4. FITC-conjugated monoclonal anti-human CD14 clone UCHM-1 (mouse IgG2a) (Sigma–Aldrich), store at 4◦ C. 5. FITC-conjugated monoclonal anti-human CD11b clone 44 (mouse IgG1) (Sigma–Aldrich), store at 4◦ C. 6. 5mL Polystyrene round-bottom tube, sterile (Becton Dickinson; BD Labware, Franklin Lakes, NJ, USA). 7. Flow cytometry (FACScan, BD Biosciences).

3. Methods HL-60 cells can be differentiated toward a neutrophil-like phenotype following treatment with DMSO or toward monocyteor macrophage-like cells using 1,25-(OH)2 vitamin D3 or PMA, respectively (13). In addition, HL-60 cells can be differentiated toward eosinophils when cultured under mildly alkaline conditions (6). Figure 12.1 summarizes the different cell phenotypes that can be generated from commercially available HL-60 cells. Figures 12.2 and 12.3 illustrate HL-60 cells differentiated into neutrophils, monocytes, or macrophages.

198

Ennaciri and Girard Pluripotent stem cell

Myeloid stem cell

CFU-GM

Monoblasts

Myeloblasts HL-60 Promonocytes

Promyelocytes

Granulocytes Monocytes

Macrophages

Eosinophils

Neutrophils

Fig. 12.1 Hematopoietic stem cell differentiation. HL-60 cells are immature myeloid cells that can be differentiated toward different cell phenotypes indicated by the arrows.

3.1. Differentiation Toward Neutrophil-Like Cells

1. An aliquot of 5 × 105 HL-60 cells/mL was cultured in 10 mL of complete RPMI 1640 and incubated in the presence of 1.25% (v/v) DMSO for 6 days at 37◦ C in a 5% CO2 incubator, in T-75 flasks. 2. Every 48 h, the medium was changed and the number of cells adjusted to 5 × 105 /mL. 3. Viable cell counts were performed using a hemacytometer and by observing exclusion of trypan blue. 4. The efficiency of neutrophil-like cell differentiation was then evaluated by cytology from cytocentrifuged preparations stained by the Hema 3 staining kit or Diff-Quick stain set according to the manufacturer’s instructions (see Note 1), followed by cytology (light microscopy). Typically, neutrophil-like cells show a polymorphic nucleus and granules appear purple. The percentage of differentiation was evaluated by the NBT assay and by flow cytometry for monitoring cell surface expression of CD11b.

3.1.1. The NBT Assay

1. A cell suspension of 3 × 105 cells/mL was incubated in an Eppendorf tube for 30 min at 37◦ C in the presence of 150 ␮L of RPMI (serum free) containing 0.1% NBT and 10–7 M PMA (this solution can be stored at 4◦ C for 1 week).

Myeloid Cell Maturation

199

Fig. 12.2 Evaluation of the differentiation induced by DMSO. HL-60 cells (A) were cultivated in RPMI 1640 supplemented with 10% FBS as described under Materials and Methods and were differentiated toward “neutrophil-like” phenotype by addition of 1.25% (v/v) DMSO for 5 days (C). Efficiency of the differentiation was evaluated by NBT dye reduction. Blue–black formazan deposits can be observed in HL-60 + DMSO (D) but not in undifferentiated HL-60 cells (B). E illustrates a mixture of HL-60 (big cells) and HL-60 1 DMSO cells (arrows) to more clearly observed differences between these cells. For comparison, freshly isolated human neutrophils are shown in F. All images are scans from photomicrographs observed by optical microscopy at 400× and those shown in A, C, E, and F are cytospin preparations colored with Diff-Quick staining kit as described (see Section 3.1; from ref. (14), with permission).

2. Differentiated cells were characterized as having acquired NADPH oxidase activity and the capacity to form a deep blue precipitate by reduction of NBT (Fig. 12.2, panels B and D) (14). The percentage of differentiation was evaluated by counting the number of blue-dark positive cells by light microscopy. Experiments performed with efficiency greater than 80% are generally well accepted. 3.2. Differentiation Toward Eosinophils

1. A suspension of HL-60 cells (5 × 105 cells/mL) in 10 mL of fresh medium, buffered with 25 mM 4-(2-hydroxyethyl)-1piperazine propanesulfonic acid (HEPPS), pH 7.8, was incubated in T-75 flasks at 37◦ C for 7 days. 2. Organic buffers were stored as concentrated stock solutions in sterile normal saline. These were added to medium at the specified concentration and adjusted to the desired pH by the addition of 1 M NaOH or HCl solution (6). 3. Cell viability was evaluated by the exclusion of trypan blue as described previously (see Section 3.1). The eosinophil-like cells were evaluated by morphology using the Wright–Giemsa stain and were observed by light

200

Ennaciri and Girard

Fig. 12.3 IL-21 is not a maturation agent for HL-60 cells. HL-60 cells were treated with 100 ng/mL IL-21 or with 1.25% DMSO (v/v) for neutrophil differentiation; 100 nM Vitamin D3 for monocyte differentiation; or 10 nM PMA for macrophage differentiation. Cells were harvested after 6 days for DMSO or vitamin D3 treatment and after 3 days for PMA treatment. (A) Cell cycle analysis was evaluated using propidium iodide. Right panels illustrate corresponding morphological observations monitored by optical microscopy (magnification 200×). (B) HL-60 cell surface expression of CD11b and CD14 (filled curve) was monitored by flow cytometry (see Section 3.3.2). Results are representative of three different experiments. (From ref. (13), with permission.)

microscope. They are characterized by small granules that stain red, a lower nucleo-cytoplasmic ratio, and pale cytoplasm. 3.3. Differentiation Toward Monocytes

1. For differentiation into monocytes, HL-60 cells were cultured in 10 mL of complete RPMI 1640 supplemented with 100 nM 1.25-(OH)2 vitamin D3 and incubated at 37◦ C in a CO2 incubator for 6 days. 2. The efficiency of cell differentiation was first evaluated by cytology (light microscopy). They were easily recognized based on their morphology and their positive staining for the monocyte/macrophage specific enzyme ␣-naphthyl acetate esterase test (non-specific esterase), according to the manufacturer’s instructions. Differentiation can also be evaluated

Myeloid Cell Maturation

201

by flow cytometry (FACScan, BD Biosciences) by monitoring cell surface expression of CD14. 3.3.1. ␣-Naphthyl Acetate Esterase Assay

3.3.2. Flow Cytometry

3.4. Differentiation Toward Macrophages

1. The slides are fixed in citrate–acetone–methanol fixative for 1 min at room temperature. 2. Slides are washed thoroughly in deionized water and air dried for at least 20 min. 3. To 50 mL TRIZMAL 7.6 dilute buffer solution, prewarmed to 37◦ C, add with constant stirring, contents of 1 capsule fast blue RR salt. 4. When salt is completely dissolved in buffer, add 2 mL ␣-naphthyl acetate solution. The solution will be yellow and slightly turbid (staining solution). Continue stirring for 15– 20 s and then add to Coplin jar. Do not filter. 5. Place slides in staining solution and incubate at 37◦ C for 30 min. Protect from light. 6. Remove slides from stain and wash for 3 min in deionized water. Discard staining solution. Counterstain for 5–10 min in Mayer’s hematoxylin solution and rinse in tap water and air dry. Examine by light microscopy, monocytic cells show black granulation (13). We monitored cell surface expression of CD14 or CD11b to confirm the differentiation of HL-60 cells into monocytic or neutrophil-like cells, respectively. 1. Cells were suspended at 1 × 106 /mL, washed twice with cold PBS, and then pre-incubated for 30 min at 4◦ C, in the dark, with an excess of irrelevant purified Ig from the same species and with the same isotype as the antibodies used for immunofluorescent staining (mouse IgG-2a or mouse IgG1), to prevent non-specific binding via FcRs. 2. Cells were washed and incubated with 1 ␮g/mL/tube of the FITC-conjugated mouse anti-human CD14 mAb or with 1 ␮g/mL/tube of the FITC-conjugated mouse anti-human CD11b mAb in the staining buffer for 30 min at 4◦ C, in the dark. 3. Cells were washed twice with the staining buffer before flow cytometry analysis of 10,000 cells per sample. Negative control staining was revealed using 4 ␮L of irrelevant murine IgG (Fig. 12.3B) (13). Cells were protected from light throughout staining and storage. 1. An aliquot of 5 × 105 HL-60 cells/mL was cultured in 10 mL of complete RPMI 1640 and incubated in the presence of 10 nM PMA for 3 days for differentiation toward macrophage-like cells. The cell differentiation was evaluated by cytology (as above, see Section 3.1) since

202

Ennaciri and Girard

macrophage-like cells are easily recognized according to their morphology and by increased size and adherence.

4. Note 1. Hema 3 stain kit according to manufacturer’s instructions. Simply dip the slide in the fixative and then dip in Solution I, followed by Solution II. Rinse with deionized water, dry, and observe under microscope. For neutrophil differentiation, the nucleus appears dark blue, the cytoplasm pale pink, and the granules reddish-lilac.

Acknowledgements This work was supported by grants to D.G. from Natural Sciences and Engineering Research Council of Canada and by the Canadian Institutes of Health Research. JE is a post-doctoral fellow and DG is a Senior Scholar of the Fonds de la Recherche en Sant´e du Qu´ebec. We thank Mary Gregory for reading this manuscript. References 1. Auwerx, J. (1991) The human leukemia cell line, THP-1: a multifacetted model for the study of monocyte-macrophage differentiation. Experientia 47, 22–31. 2. Collins, S. J. (1987) The HL-60 promyelocytic leukemia cell line: proliferation, differentiation, and cellular oncogene expression. Blood 70, 1233–1244. 3. Koeffler, H. P. (1983) Induction of differentiation of human acute myelogenous leukemia cells: therapeutic implications. Blood 62, 709–721. 4. Collins, S. J., R. C. Gallo, and R. E. Gallagher. (1977) Continuous growth and differentiation of human myeloid leukaemic cells in suspension culture. Nature 270, 347–349. 5. Collins, S. J., F. W. Ruscetti, R. E. Gallagher, and R. C. Gallo. (1978) Terminal differentiation of human promyelocytic leukemia cells induced by dimethyl sulfoxide and other polar compounds. Proc Natl Acad Sci USA 75, 2458–2462. 6. Fischkoff, S. A., A. Pollak, G. J. Gleich, J. R. Testa, S. Misawa, and T. J. Reber. (1984)

7.

8.

9.

10.

Eosinophilic differentiation of the human promyelocytic leukemia cell line, HL-60. J Exp Med 160, 179–196. Miyaura, C., E. Abe, T. Kuribayashi, H. Tanaka, K. Konno, Y. Nishii, and T. Suda. (1981) 1 alpha, 25-Dihydroxyvitamin D3 induces differentiation of human myeloid leukemia cells. Biochem Biophys Res Commun 102, 937–943. Tanaka, H., E. Abe, C. Miyaura, T. Kuribayashi, K. Konno, Y. Nishii, and T. Suda. (1982) 1 alpha, 25-Dihydroxycholecalciferol and a human myeloid leukaemia cell line (HL-60). Biochem J 204, 713–719. McCarthy, D. M., J. F. San Miguel, H. C. Freake, P. M. Green, H. Zola, D. Catovsky, and J. M. Goldman. (1983) 1,25dihydroxyvitamin D3 inhibits proliferation of human promyelocytic leukaemia (HL60) cells and induces monocyte-macrophage differentiation in HL60 and normal human bone marrow cells. Leuk Res 7, 51–55. Tanaka, H., E. Abe, C. Miyaura, Y. Shiina, and T. Suda. (1983) 1 alpha,

Myeloid Cell Maturation 25-dihydroxyvitamin D3 induces differentiation of human promyelocytic leukemia cells (HL-60) into monocyte-macrophages, but not into granulocytes. Biochem Biophys Res Commun 117, 86–92. 11. Rovera, G., D. Santoli, and C. Damsky. (1979) Human promyelocytic leukemia cells in culture differentiate into macrophagelike cells when treated with a phorbol diester. Proc Natl Acad Sci USA 76, 2779– 2783. 12. Rovera, G., T. G. O’Brien, and L. Diamond. (1979) Induction of differentiation in human

203

promyelocytic leukemia cells by tumor promoters. Science 204, 868–870. 13. Pelletier, M., A. Bouchard, and D. Girard. (2004) In vivo and in vitro roles of IL-21 in inflammation. J Immunol 173, 7521–7530. 14. Pelletier, M., A. Savoie, and D. Girard. (2000) Activation of human neutrophils by the air pollutant sodium sulfite (Na(2)SO(3)): comparison with immature promyelocytic HL-60 and DMSOdifferentiated HL-60 cells reveals that Na(2)SO(3) is a neutrophil but not a HL60 cell agonist. Clin Immunol 96, 131–139.

Chapter 13 Functional Development of Human Fetal Gastrointestinal Tract ´ Edgard Delvin, Daniel Menard, ´ Emile Levy, and Jean-Franc¸ois Beaulieu Abstract The morphological development of the gastrointestinal tract (GI), in laboratory animals as well as in humans, has been well described since more than 100 years. However, even though its functional development and regulatory mechanisms are pretty well understood, our knowledge of the human GI functions originated primarily from studies on rat and mouse. Because of clear differences in genetic make up, development rates and sequences, as well as physiological differences, extrapolations of animal data to the human must be made with caution. A reliable organ culture technique in which the morphological as well as physiological parameters are well maintained has been set up. This technique allows studies of basic physiological functions such as gene expression, localization of specific cell markers, numerous digestive enzymatic activities, and lipid and lipoprotein processing. Furthermore, it also permits to determine and characterize the biological actions of potential regulators such as growth factors and hormones. Finally, the establishment of human intestinal epithelial cell lines allows the validation and the characterization of the molecular mechanisms involved in the specific regulatory pathways of the human GI development. Key words: Enterocytes, apolipoproteins, EGF, HIEC, organ culture, lipids, lipoproteins, chylomicron, VLDL, LDL, HDL.

1. Introduction The study of the development of the human gastrointestinal tract is not a new science as many important and sophisticated observations date back more than 100 years. Indeed, the structural and ultrastructural development of the different GI segments in utero is well established (1). It is also well known that the development of specific digestive organs in utero and/or after birth occurs at differing rates and involves both morphogenesis Julie Lafond and Cathy Vaillancourt (eds.), Human Embryogenesis: Methods and Protocols, vol. 550 © Humana Press, a part of Springer Science+Business Medis, LLC 2009 DOI 10.1007/978-1-60327-009-0 13 Springerprotocols.com

205

206

´ et al. Levy

and cyto-differentiation. The vast literature concerning GI development in experimental animals reveals many important differences by comparison with the human. In rodents, the functional changes leading to mature or adult functions in the various GI organs (salivary glands, stomach, pancreas, intestine) are characterized by a highly coordinated developmental pattern occurring at weaning time (2, 3). As opposed to rodents, the functional development of the human GI tract is much less coordinated chronologically and occurs during the fetal period (1). While the gastric glandular epithelial structures initiate their development at 12 week of gestation, the initial crypt-villus structures develop in a proximal–distal gradient between 8 and 11 week of gestation and in a distal–proximal gradient in the colon between 11 and 14 week of gestation (4, 5). Henceforth, the regulatory mechanisms behind human GI tract development are seemingly different and undoubtedly more complex than in rodent! The paramount issue for those interested in the maturation of human GI functions has always been: what is, or more likely, what are the regulators or modulators of this functional development? The vast literature on experimental animals well recognized that the final maturation of GI epithelial cells results from integrated interactions including mesenchymal–epithelial interactions and interactions between hormones and growth factors, extra cellular matrix components and cellular integrins, specific intracellular signaling pathways, and selective transcription factors (6). In light of the differing developmental profiles for rodents and humans, the question remains: is it possible to extrapolate regulatory mechanisms characterized in rodents directly to the human GI tract? The extent to which these data can be extrapolated to developing human GI tract remained a debatable issue until the serumfree organ culture technique became available for human fetal GI tissues (7). This technique not only opens the way to establish and delineate the specific modulators involved in the different GI organs maturation, but also allows the study of specific functional activities in developing human gut. We successfully applied this strategy for all GI organs (8–11) and were able to gain insights on cell proliferation (12–15), differential distribution of digestive enzymes in fetal small intestine and colon (16), intestinal lipid processing and lipoprotein synthesis (17–20), on peroxisomal enzymes (21, 22), calcitriol receptors, and calcium binding protein-9 kDa (23–25), on epidermal growth factor (EGF) receptor (26), on differential expression of extracellular matrix components (27–30), and on gastric digestive activities (31–33). We were also able to establish and characterize the specific biological effects of hormones and growth factors in these metabolic activities in developing tissues (19, 20, 33–40). Finally, we were able to establish new human intestinal epithelial cell

Human Fetal Intestine

207

models (41–43) or to use available human colonic carcinoma cells (44–47) in order to validate and establish the molecular mechanisms of the regulatory factors characterized in organ tissue culture. This chapter will focus on how to culture human fetal intestinal explants and appropriate human intestinal epithelial cell types. As exemplified, these culture systems will allow one to study lipid and lipoprotein processing as well as intestinal brush border digestive activities both in basal and epidermal growth factor conditions.

2. Materials 2.1. GI Tissues and Culture Medium

1. Segments from fetuses varying in age from 8 to 20 weeks of gestation [post-fertilization ages estimated according to Streeter (48)] were obtained from normal elective pregnancy termination. No tissue should be collected from cases associated with known fetal abnormality of fetal death. Studies must be approved by an Institutional Human Subject Review Board. The fetal tissues are brought to the culture room as soon as possible, immersed in dissection medium, and prepared into explants within a few minutes at room temperature (RT). 2. Culture medium: Leibovitz L-15 medium containing 40 ␮L/mL garamycin and 40 mg/mL mycostatin. 3. Organ culture distribution and stainless steel grids (Falcon Plastics, Los Angeles, CA, USA). 4. Lens paper (Canadian Laboratories Supplies Ltd., Montreal, QC, Canada).

2.2. Cell Culture, Lysis, and Protein Dosage

1. Caco-2/15 cells cloned from the mother Caco-2 cell line (cat. no. HTB 37; Rockville, MD, USA). 2. Culture medium for Caco-2/15 cells: Dulbecco’s Modified Eagle’s Medium (DMEM) high glucose formula supplemented with 1% glutamax, 1% HEPES (Gibco/Invitrogen, Grand Island, NY, USA) and 10% fetal bovine serum (FBS, Wisent, Inc., St-Jean-Baptiste-de-Rouville, QC, Canada). 3. Culture medium for human intestinal epithelial cells (HIEC): Opti-MEM supplemented with 1% glutamax, 1% HEPES (Gibco), 5 ng epidermal growth factor (EGF, BD Biosciences, Two Oak Park, Bedford, MD, USA), and 5% FBS (CeLLect Gold, MP Biomedical, Inc., Aurora, OH, USA). 4. Trypsin 0.05%/EDTA (Gibco). 5. Cell culture 100 mm dishes (Becton Dickinson Labware, Franklin Lakes, NJ, USA).

208

´ et al. Levy

6. Laemmli solubilization buffer (2×): 1 M Tris–HCl, pH 6.8 (12.50 mL); 10 g sodium dodecyl sulfate (SDS); 20 mL glycerol; 0.02% bromophenol blue solution (2 mL); 55.5 mL H2 O, stored at RT. 10% ␤-Mercaptoethanol (v/v) added at the time of lysis. 7. For protein dosage, 20% trichloroacetic acid (TCA) (w/v), 2% Na2 CO3 solution in NaOH 0.1 N, Folin’s reagent 1 N, 2 mg/mL bovine serum albumin solution, and solution A (1 mL of a 2% Na-tartrate solution and 1 mL of 1% CuSO4 in 98 mL of Na2 CO3 solution). 2.3. SDS-Polyacrylamide Gel Electrophesis (SDS-PAGE)

1. 10% Separating gel: Mix 13.3 mL acryl/bis acrylamide (30:0.15) (BioRad Laboratories, Mississauga, ON, Canada), 20 mL Tris–HCl 1.5 M, pH 8.8, 0.4 mL 10% SDS, 6.1 mL H2 O, 100 ␮L ammonium persulfate 10% (APS) (BioRad), and 20 ␮L TEMED (BioRad). 2. Overlay: Mix 1.25 mL Tris–HCl 1.5 M, pH 8.8, 3.65 mL H2 O, 50 ␮L 10% SDS, and 50 ␮L APS. 3. 4% Stacking gel: Mix 2.66 mL acryl/bis (29:1) (BioRad), 2.5 mL Tris–HCl 1 M, pH 6.8, 0.2 mL 10% SDS, 14.74 mL H2 O, 100 ␮L 10% APS, and 10 ␮L TEMED. 4. Running buffer: Mix 28.8 g glycine, 6.06 g Tris, and 1 g SDS to 1 L H2 O. 5. Prestained molecular weight markers (Amersham/GE Healthcare UK Limited, Little Chalfont, Buckinghamshire, UK). 6. 50-␮L Hamilton glass syringe. 7. Gibco BRL vertical gel electrophoresis apparatus (Model V-16; Invitrogen).

2.4. Western Blotting

1. Trans-Blot cell transfer system (BioRad). 2. Transfer buffer: Add 57.60 g glycine, 12.12 g Tris, and 800 mL methanol to 3,600 mL H2 O and chill to 4◦ C. 3. Nitrocellulose membrane (Hybond, Amersham/GE Healthcare). 4. 3 MM paper (Whatman). 5. 2 g Ponceau S solution (Sigma–Aldrich) dissolved in 152 mL of 20% TCA and completed to 1 L H2 O. 6. Phosphate-buffered saline (PBS): 4 g NaCl, 0.1 g KCl, 7.2 g Na2 HPO4 , 0.12 g KH2 PO4 , 0.5 L H2 O final, pH to 7.4. 7. Tween 20 (BioRad). 8. Blocking buffer: 5% (w/v) nonfat dry milk (Blotto) in 0.1% PBS–Tween. 9. Washing buffer: 0.1% PBS–Tween. 10. Primary antibody: Monoclonal anti-sucrase–isomaltase HSI-14 (see ref. 43) conditioned hybridoma medium diluted in blocking buffer.

Human Fetal Intestine

209

11. Secondary antibody: Anti-mouse IgG conjugated to horseradish peroxidase (Amersham/GE Healthcare). 12. Enhanced chemiluminescent (ECL) reagents (Amersham/GE Healthcare). 2.5. De Novo Apolipoprotein Synthesis Pulse Labeling of Intestinal Explants and Immunoprecipitation Procedure

2.6. Lipid Synthesis and Secretion

1. Preparation of oleic acid (cat. no. 01008; Sigma) in 10% fatty acid-free BSA (Roche, Laval, QC, Canada) [BSA/oleic acid, 1:5 (mol:mol)] for stimulation of apolipoprotein (apo) synthesis. The final oleic acid concentration is 0.7 mM/well. 2. Methionine-free DMEM (Invitrogen) containing 1% glutamine, 1% glutamax, 1% pen-strep, and 1% Na pyruvate (Gibco). 3. 100 ␮Ci/mL [35 S]-methionine (Perkin Elmer Life Sciences, 1,175 Ci/mM). 4. Tris-buffered saline (TBS): 50 mM Tris, pH 7.4, 150 mM NaC1 containing 1% (w/v) Triton X-100, 1 mM methionine, 1 mM phenylmethylsulfonyl fluoride (PMSF), 1 mM pepstatin, trasylol (100 ␮M), 5 mM EDTA, 0.1% SDS, and 0.5% Na deoxycholate. 5. Methionine-free DMEM (Invitrogen) supplemented with 1 mM methionine. 6. 5% TCA. 7. 40 ␮L Protein G Plus/Protein A agarose suspension (Protein A/G; Calbiochem, ON, Canada) for 1–2 mg cell proteins plus 2 ␮g antibodies against apos A-I and B. 8. SDS-sample buffer TBS: containing 0.1% SDS, 0.5% deoxycholate, 5 mM EDTA, 2 mM PMSF, 0.1 mM pepstatin, 100 ␮M trasylol. 9. Rainbow molecular weight standards (Amersham Life Sciences). 10. BTS-450 and liquid scintillation fluid (Ready Organic, Beckman). 1. Radiolabeled [14 C]-oleic acid (sp. Act. 53 mCi/mM, Amersham Life Sciences). 2. Unlabeled oleic acid solubilized in fatty acid-free BSA [BSA/oleic acid 1:5 (mol/mol)]. The final oleic acid concentration was 0.7 mM (0.45 ␮Ci)/well. 3. TBS: 50 mM sodium phosphate, 150 mM NaC1, pH 7.4 (Gibco). 4. Lysis buffer: TBS containing 0.5% deoxycholate, 5 mM EDTA, 2 mM PMSF, 0.1 mM pepstatin, 2 ␮g/mL trasylol. 5. Chloroform:methanol 2:1 (vol/vol). 6. Lipid standard classes’ presence of unlabeled carrier [phospholipids (PL), monoglycerides (MG), diglycerides (DG),

210

´ et al. Levy

7. 8. 9. 10. 11.

free cholesterol (FC), triglycerides (TG), free fatty acids (FFA), and cholesteryl ester (CE)]. Thin-layer chromatography (TLC). Solvent mixture: Hexane–ether–acetic acid (80:20:3, vol/vol/vol). Scintillation vials. Ready safe counting fluid (Beckman, Fullerton, CA, USA). Beckman liquid scintillation spectrometer.

2.7. Lipoprotein Production

1. TL-100 ultracentrifuge (Beckman Instruments, Montreal, QC, Canada). 2. Chylomicrons 1.006 g/mL. 3. Very low density lipoprotein (VLDL) 1.006 g/mL (KBr). 4. Low density lipoprotein (LDL) 1.063 g/mL (KBr). 5. High density lipoprotein (HDL) 1.21 g/mL (KBr). 6. Dialysis solution 0.15 M NaCl, 0.27 mM EDTA (0.01% EDTA), pH 7.4.

2.8. Indirect Immunofluorescence on Tissues

1. Cryostat (CM 3050-S, Leica Instruments, GmbH, Nussloch, Germany). 2. Optimum cutting tissue (OCT) compound (CANEMCO Supplies, Lachine, QC, Canada) embedded fetal small intestinal samples stored at −80◦ C. 3. Silane (Sigma–Aldrich)-coated glass slides. 4. 200 mM Phosphate buffer: 28.04 g Na2 HPO4 anhydride in 1 L H2 O, pH 7.4. 5. 2% Paraformaldehyde (PFA): Heat 50 mL H2 O to 60– 65◦ C, add few drops of NaOH 1 N before to dissolve 2 g PFA (Sigma–Aldrich). Adjust pH to 7.4 and complete volume to 100 mL with phosphate buffer. 6. Quenching solution: 100 mM PBS–glycine pH 7.4 (add 7.5 g glycine in PBS 1×). 7. Primary antibody: Mouse anti-human sucrase–isomaltase HSI-14 antibody (see ref. 43). 8. Secondary antibody: Sheep FITC-conjugated anti-mouse IgG antibody (Chemicon International, Temecula, CA, USA). 9. Blocking solution: 5% Blotto in PBS. 10. Counterstaining with 0.1% Evans blue solution: 1% Stock solution (1 g Evans blue) (Sigma–Aldrich) in 100 mL H2 O. Filter before use. 11. Mounting medium: 0.1% para-Phenylenediamine (0.1 g dissolved in 90 mL glycerol and 10 mL PBS, pH 8.5).

2.9. Gene Arrays

1. RNA extraction with Trizol reagent (Invitrogen). 2. RNA amplification with the TargetAMP 1-Round aRNA amplification kit (Epicentre Biotechnologies, Madison, WI, USA).

Human Fetal Intestine

211

3. Reverse transcription reaction was performed in the presence of 500 ␮M dATP, dCTP, and dGTP, 300 ␮M 5-aminoallyl-dUTP (Sigma), and 200 ␮M dTTP, 1 × firststrand buffer, 10 mM dithiothreitol, and 400 U Superscript II (Invitrogen). 4. Random hexamers (Roche Diagnostics). 5. RNase-free water. 6. Sodium bicarbonate 0.3 M, pH 9. 7. cDNAs were labeled with either Cy3 or Cy5 (GE Healthcare). 8. cDNA microarrays (cat. no. SS-H19k8; University Health Network, Microarray Centre, Toronto, ON, Canada). 9. Sodium acetate, 0.1 M, pH 5.2. 10. QIAquick columns (Qiagen). 11. Deionized water. 12. 2-Propanol once. 13. Prehybridization solution: 0.1% BSA, 5 × SSC, 0.1% SDS. 14. Humidified hybridization chamber (Corning). 15. Hybridization solution: 50% formamide, 5 × SSC, 0.1% SDS. 16. ScanArray Express dual-color confocal laser scanner (Perkin Elmer). 17. TIGR Spotfinder 3.1 software, TIGR MIDAS 4.0 software (Microarray Data Analysis System), and TMEV 3.0 software (TIGR MultiExperiment Viewer: All software is available at The Institute for Genomic Research (TIGR) website, http://www.tigr.org/). 2.10. Addition of Growth Factors

Human recombinant EGF (Becton Dickinson).

3. Methods The methods described below outline the following: (1) preparation of organ explants and culture methodology; (2) the cell culture methodology; (3) SDS-PAGE and Western blot; (4) tissue preparation for immunofluorescence and cell markers; (5) DNA chips approach for gene expression; (6) study of lipids and lipoprotein processing; and (7) the effects of culture supplements, i.e., growth factors and hormones. 3.1. GI Segments and Culture Medium

1. GI segments from fetuses varying from 8 to 20 weeks in age are initially immersed in culture medium with subsequent culture in a culture room starting within 30 min of pregnancy termination (see Note 1).

212

´ et al. Levy

2. When appropriate, the tissues are cleansed of mesentery, split longitudinally, washed in culture medium, and cut into several explants averaging 3 × 7 mm. 3. The explants are then transferred onto lens paper with the mucosal side up. 4. The lens paper covers a stainless steel grid lying over the central well of an organ-culture dish containing sufficient medium to just wet the lens paper. 5. Explants are cultured at 37◦ C in an environment of 5% CO2 , 95% air, and saturated water vapor. Culture medium is renewed after 1 day of culture and every 2 days thereafter. To examine the synthetic and secretory tissue phenomena, appropriate radioactive precursors are added to the culture medium either for continuous exposure of pulse-chase experiments. Materials released by the explants into the culture medium are studied by specific biochemical methods. At the end of the studied culture period, explants are prepared for histological, immunocytochemical, autographic, or electron microscopic studies and/or used for biochemical analyses. 3.2. Cell Culture, Lysis, and Protein Dosage 3.2.1. Caco-2/15 Cells

1. Caco-2/15 cells were cloned from the mother Caco-2 cell line for the greater ability to differentiate spontaneously when maintained at confluence (42, 44, 45). Caco-2/15 cells were therefore passaged before reaching 90% confluence with trypsin/EDTA to provide new maintenance cultures in 100 mm dishes. To do so, a 1:5 split ratio of the trypsinized cells was performed each 4–5 days. To favor minimal adaptation of the cells to the culture conditions, cells were only used between passages 55 and 75. 2. Differentiated Caco-2/15 cells were obtained by keeping the cells at confluence for prolonged times, up to 30 days. 3. The 10 mL of complete medium per dish was renewed each 48 h for both sub- and post-confluent cells. Wide tip pipettes were used to minimize medium flow in order to prevent monolayer damaging.

3.2.2. HIEC Cells

1. HIEC cells are human intestinal epithelial crypt cells that were isolated in our laboratory from fetal ileum (41). These cells were characterized for the expression of several crypt cell markers and their inability to differentiate under standard culture conditions (45). 2. HIEC cells were passaged in a 1:3 split ratio when approaching confluence with trypsin/EDTA to provide new maintenance cultures in 100 mm dishes. Cells were used between passages 4 and 25.

Human Fetal Intestine

213

3. The 10 mL of complete medium per dish was renewed each 48 h. 3.2.3. Cell Lysis

1. Cells are washed twice in 1× PBS before adding 0.5–1.0 mL of 1× Laemmli solubilization buffer containing 5% ␤-mercaptoethanol. Solubilization buffer is evenly distributed in the dish using cell scraper and incubated for 5 min at RT. 2. The mixture is then transferred to a 2 mL microtube, screwcapped, and heated for 5 min at 105◦ C. 3. The samples are then cooled, sonicated (2 × 15 s), and centrifuged at 15,000g in a microfuge for 10 min. The supernatants are transferred to new tubes and frozen at −80◦ C for long-term storage. Avoid freezing–thawing cycles.

3.2.4. Protein Dosage

1. Protein concentration in samples prepared in solubilization buffer is determined with an adaptation of Lowry’s Folin phenol reagent using bovine serum albumin as protein standard. 2. Proteins from 3 to 10 ␮L of sample are precipitated using 100 ␮L TCA 20% on ice for 1 h. Samples are then centrifuged at 15,000g in a microfuge for 10 min. Supernatants are discarded and pellets resuspended in 100 ␮L NaOH 0.1 N. 3. A BSA standard curve is prepared from 0 to 40 ␮L of stock BSA in NaOH 0.1 N solution. 4. Add 100 ␮L sample–NaOH mix to 1 mL solution A, vortex, and incubate for 10 min. 5. Add 100 ␮L Folin 1 N to the mix, vortex quickly, and incubate for 30 min. Read optical density at 578 nm.

3.3. SDS-PAGE and Western Blotting

These instructions are based on the use of a Gibco BRL vertical gel electrophoresis apparatus. They are nevertheless adaptable to other formats including mini-gel systems. The described procedure is the one optimized for the immunodetection of the intestinal cell marker sucrase–isomaltase but has been adapted to several other intestinal cell protein markers. 1. The glass plates and accessories need to be cleaned using a rinsable detergent after use and extensively rinsed with distilled water before storage. Assemble the gel-frame with glass plates, clamps, spacers, and combs so that no leaks occur. 2. Prepare a 1.0-mm thick, 10% separating gel by mixing the acryl/bis (30:0.15), Tris 1.5 M, SDS 10%, and H2 O. Apply vacuum for 5 min to reduce solubilized oxygen. Then add 100 ␮L APS 10% and 20 ␮L TEMED. Mix gently. 3. Pour the solution slowly into the gel-frame without bubbles. Leave space for the stacking gel.

214

´ et al. Levy

4. Pour on the overlay and let the gel polymerize for 45 min. 5. Prepare the 4% stacking gel by mixing the 30% acryl/bis (29:1), 1 M Tris, and 10% H2 O SDS. Apply vacuum for 5 min. 6. Discard the overlay. Add 100 ␮L 10% APS and 10 ␮L TEMED to complete the stacking gel solution. Gently stir the mixture and pour the stacking gel on top of the separating gel. Insert the comb. Polymerization should be complete after 30 min. 7. Remove the clamps from the gel-frame. Assemble the electrophoresis apparatus by attaching the gel-frame to the electrophoresis chamber with clamps. 8. Fill the top chamber with running buffer. Check for absence of leaks. Then, carefully remove the comb and wash the wells with electrophoresis buffer using the 20-mL syringe and a straight needle. 9. Fill the bottom chamber with the remaining running buffer. Be sure to discard the accumulated bubbles from the lower edge of the gel with a flow of running buffer using a curved needle and 20-mL syringe. 10. Thaw the protein samples. Calculate the sample volume to obtain the desired amount of protein for the experiment, ideally between 50 and 100 ␮g protein per well. Volumes should be matched between wells using 1× solubilization buffer. 11. Load the samples and protein marker with a 50-␮L Hamilton glass syringe to the bottom of the well. The syringe is rinsed three times with electrophoresis buffer between each sample and with distilled water once loading is complete. 12. Install the cover and electrodes. Then run the gel for 30–40 min at 70 V to allow the proteins to enter the separating gel. Then, raise the voltage to 100 V for an overnight migration (12 h) or to 170 V for a 3–5 h fast migration. Western blotting instructions are based on the use of a Trans-Blot cell transfer system. Proteins that have been separated by SDS-PAGE are electro-transferred to nitrocellulose membranes. 13. Stop the gel migration, disassemble the cover, discard the electrophoresis buffer, and free the gel-frame when the protein separation is sufficiently advanced. 14. Remove the smaller glass plate of the gel-frame. 15. The sticky stacking gel is detached using a piece of Whatman paper that is spread on its surface and pulled out. One corner of the separating gel is cut to keep track of the orientation and the gel is then removed and immersed in a small amount of chilled transfer buffer for 15 min.

Human Fetal Intestine

215

16. A section of nitrocellulose membrane is cut to fit the gel and is equilibrated in a small amount of chilled transfer buffer. 17. A tray large enough to hold the opened transfer cassette is half-filled with chilled transfer buffer. 18. Infuse the sponges in the transfer buffer and remove air bubbles. Then pack the sandwich frame in the following order: sponge–filter paper–nitrocellulose membrane–gel– filter paper and sponge. Remove all bubbles between the various layers and close the sandwich with the clamp. 19. Fill the transfer chamber two-thirds with cooled transfer buffer and insert the cooling element in the center of the transfer chamber. The sandwich is then inserted in a way that the gel is oriented toward the negative electrode and the nitrocellulose toward the positive electrode. 20. If necessary, add further transfer buffer to fully cover the area of the gel. 21. Run the electro-transfer at 20 V for 30 min and then at 100 V for 1.5 h. 22. Once the transfer is completed, the cassette is taken out of the tank and disassembled. The nitrocellulose membrane is peeled off from the gel, marked for the orientation by cutting the corner corresponding to the one of the gel, and washed in H2 O for 10 min. 23. H2 O is then replaced with Ponceau S solution for 1 min. Recover the Ponceau S solution (it can be used several times) and wash the membrane in water. The protein bands and marker become visible on the membrane. Label the molecular weight bands of the protein marker gently with a pencil. If desired, the membrane can be scanned and later used as loading reference. 24. Cut the nitrocellulose membrane with a razor blade according to the molecular weight marker and the apparent molecular weights of the protein(s) of interest, e.g., between 160 kDa and the top of the membrane since sucrase–isomaltase migrates at ˜ 200 kDa. 25. The membranes are washed twice with PBS for 5 min to remove the Ponceau S staining and incubated with the blocking solution for 60 min. 26. The blocked membrane is placed into plastic bags and the appropriate amount of antibody, diluted in the blocking solution, is poured into the bag, which is then sealed. The dilution for HSI-14 conditioned hybridoma medium is 1:10 and incubation is done overnight at RT. 27. The membrane is then washed thoroughly 3 × 10 min at RT with the washing buffer. 28. It is then incubated for 60 min at RT with the secondary antibody, diluted 1:5,000 in the blocking solution.

216

´ et al. Levy

29. The membrane is washed thoroughly 3 × 10 min at RT with the washing buffer and 3 × 10 min with PBS not containing Tween 20. 30. Aliquots (1 mL) of each portion of the ECL reagent are warmed separately to RT. The membrane is placed between the leaves of a plastic sheet and placed in an X-ray film cassette. The remaining steps are done in a dark room. 31. In the darkroom, the ECL reagents are mixed together and then immediately added to the membrane for 2 min ensuring even coverage. 32. The excess ECL reagents are then removed from the membrane using filter paper. A film is placed over the incubated membrane for a suitable exposure time, typically a few minutes. 3.4. Indirect Immunofluorescence on Tissue Cryosections

The described procedure is the one optimized for the immunodetection of the intestinal cell marker sucrase–isomaltase but is adaptable to several other intestinal cell protein markers. 1. Tissues are prepared by immersion in OCT compound, frozen in liquid nitrogen, and stored long-term at −80◦ C. Blocks and knife are moved 1 h in advance into the cryostat maintained at −22◦ C. 2. The blocks are trimmed by cutting 20–30 ␮m sections until the right orientation is found and the surface is even. Then 2–3 ␮m sections are done and transferred onto silane-coated slides and allowed to dry for 1 h before use or stored at −80◦ C in air-tight boxes. 3. Slides need to be at RT. The tissue is fixed with paraformaldehyde solution for 1 h at 4◦ C. The slides are washed 3 × 10 min in PBS. The tissues are quenched in PBS–glycine solution for 45 min at 4◦ C. Slides are washed for another 3 × 10 min in PBS. 4. Blocking of the reactive sites is achieved with a few drops of 5% blotto solution on sections and incubation in a humidity chamber for 30 min at RT. 5. Remove the blocking solution and add the primary antibody HSI-14 (diluted 1:5 or 1:100 with blocking solution depending on the use of conditioned hybridoma medium or ascitic fluid, respectively) for 1 h at RT. Slides are washed 3 × 10 min in PBS. 6. The secondary antibody is first diluted 1:5 in PBS and this mix centrifuged for 10 min at 15,000g. The supernatant is carefully harvested and further diluted 1:5 in blotto and applied onto the sections for 1 h in a humidity chamber at RT. The slides are washed 3 × 10 min in PBS. 7. The sections are counterstained by 1 min incubation in Evans blue. Slides are then washed 3 × 10 min in PBS, and

Human Fetal Intestine

217

a drop of mounting medium is added before mounting with a coverslip. 8. Sections are viewed under a microscope equipped for epifluorescence. 3.5. Gene Array Analysis

1. RNA is extracted from samples with Trizol and stored at −80◦ C. Quality of RNA is verified on agarose gel and by spectrophotometric assay. RNA is amplified using the manufacturer’s instructions. 2. Reverse transcription is performed as follows: 1 ␮g of amplified RNA is primed with 6 ␮g of random hexamers by heating at 70◦ C for 10 min, snap-cooling on ice for 30 s, and incubating at RT for an additional 5–10 min. Reverse transcription is performed in the presence of 500 ␮M dATP, dCTP, and dGTP, 300 ␮M 5-aminoallyl-dUTP, and 200 ␮M dTTP, 1× first-strand buffer, 10 mM dithiothreitol, and 400 U Superscript II in a volume of 40 ␮L at 42◦ C for 3 h to overnight. cDNA is then lyophilized. 3. For labeling reaction, cDNA is resuspended in 5 ␮L of RNase-free water. Then 3 ␮L of 0.3 M sodium bicarbonate at pH 9 is added. An aliquot of the NHS ester of Cy3 or Cy5 is resuspended in 2 ␮L of DMSO (dye from each tube had been previously dissolved in 72 ␮L DMSO, divided into 4.5 ␮L aliquots, and lyophilized), added to the reactions, and incubated at RT in the dark for 1 h. 4. A reference pool was produced from a mixture of equimolar aliquots of total RNA from human fetal jejunum, ileum, and colon. These tissues were chosen to obtain a more complete representation of the genes spotted on the arrays. 5. For all experiments, the reference pool is labeled with Cy3 dye, while samples to be evaluated are labeled with Cy5 dye (47). Coupling reaction is quenched by the addition of 35 ␮L of 0.1 M sodium acetate, pH 5.2, and unincorporated dye is removed using QIAquick columns. The labeling efficiency is determined by analyzing the whole undiluted sample in a spectrophotometer using a 50 ␮L microcuvette. Fluorescent cDNA probes are lyophilized and stored. 6. cDNA microarrays representing 19,200 human cDNA clones are used. Four independent biological samples of human intestinal explants cultured with or without EGF are analyzed in duplicate. 7. Slides are prehybridized in 0.1% BSA, 5 × SSC, 0.1% SDS for 45 min at 42◦ C, washed by dipping in deionized water twice and 2-propanol once (2:1), and air-dried. 8. Fluorescent cDNA probes are resuspended in 30 ␮L of hybridization solution. To the combined Cy3 and Cy5 samples, 20 ␮g Cot1 DNA and 20 ␮g poly(A)+ DNA are

218

´ et al. Levy

added and the samples are denatured at 95◦ C for 3 min, followed by snap cooling on ice for 1 min. 9. Room-temperature (RT) probes are applied to a prehybridized array, covered with another slide and placed in a humidified hybridization chamber. Hybridization is carried out at 42◦ C for 16 h, followed by 5 min washings in: 1 × SSC, 0.2% SDS at 42◦ C, 0.1 × SSC, 0.2% SDS at RT, and 0.1 × SSC at RT, twice. 10. Arrays are scanned using a ScanArray Express dual-color confocal laser scanner. Data are collected in Cy3 and Cy5 channels and stored as paired TIFF images. 11. For data analysis, spots are identified and local background subtracted using the TIGR Spotfinder 3.1 software (46). A quality control filter is used to remove the questionable array features. Two criteria for spot rejection are a spot shape that deviated from a circle and a low signalto-noise ratio. Hybridization intensity data are normalized using iterative mean-log2(ratio)-centering (data range for mean centering ±3 SD) and Lowess procedures (smoothing parameter sets to 33%) using the native Java function of the TIGR MIDAS 4.0 software (46). Statistical significance is assessed by one-way ANOVA and an adjusted Bonferroni correction is applied for controlling the false-positive rate (P < 0.05 considered significant), and hierarchical clustering analysis is performed using the TMEV 3.0 software (46). 3.6. Study of Lipids and Lipoprotein Processing 3.6.1. De Novo Apo Synthesis: Pulse Labeling of Intestinal Explants and Immunoprecipitation Procedure

1. Incubate jejunal explants with unlabeled oleic acid bound to albumin in serum-free medium for 24 h to induce apo synthesis. 2. During this time, EGF may be added to the medium. 3. Then, rinse the explants twice with PBS. 4. Add methionine-free DMEM containing oleic acid bound to albumin as well as 100 ␮Ci/mL [35 S]-methionine with or without EGF. 5. Incubate for 45 min at 37◦ C. 6. At the end of the labeling, explants are washed three times and homogenized with lysis buffer TBS containing the mixture Triton X-100, antiproteases, and Na deoxycholate. 7. Aliquots of tissue homogenates are precipitated with 5% TCA before radioactivity is determined in a liquid scintillation spectrometer. 8. The lysates are centrifuged for 10 min at 4◦ C in a microcentrifuge and supernatants are collected for immunoprecipitation.

Human Fetal Intestine

219

9. Supernatants are subsequently reacted with apo polyclonal antibodies for 18 h at 4◦ C. 10. Protein A/G is then added, and the mixture is reincubated at 20◦ C for 60 min. 11. The immunoprecipitates are washed extensively with TBS, resuspended in SDS–sample buffer, and analyzed by a polyacrylamide gel preceded by a 4% stacking gel (see Section 3.3). 12. Rainbow molecular weight standards are run in the same conditions. 13. Gels are sectioned into 2-mm slices and counted after an overnight incubation with 1 mL of BTS-450 and 10 mL of liquid scintillation fluid. 14. Results for each apo studied are expressed as percentage apo/total TCA-precipitable protein to assess the specific effect EGF. 3.6.2. Lipid Synthesis and Secretion

1. Explants are cultured in serum-free Leibovitz L-15 medium. 2. After a 3 h stabilization period, the medium is changed with a fresh one containing a final amount of 0.7 mM (0.45 ␮Ci)/well of oleic acid attached to albumin. 3. EGF is added at concentrations of 25, 50, and 100 ng/mL. 4. Intestinal explants are cultured for 42 h at 37◦ C. 5. Aliquots of explant homogenates and their respective incubation media are lipid-extracted with 2:l (v/v) chloroform– methanol. 6. Small amounts (50 ␮g) of lipid standards are added to the samples before separation of individual lipid classes by onedimensional TLC. 7. The nonpolar solvent system is hexane–diethyl ether– glacial acetic acid 80:20:3 (v/v/v). 8. The area corresponding to each lipid is scratched off the TLC plates, and the silica powder is placed in a scintillation vial with Ready Safe counting fluid. 9. Radioactivity was then measured by scintillation counting. 10. An aliquot of the tissue homogenate was used for protein determinations. 11. Results are expressed as dpm/mg protein.

3.6.3. Lipoprotein Production

1. After incubation with labeled oleic acid (see Section 3.6.2). 2. The medium is mixed with the plasma lipid carrier 2:4 (v/v). 3. Lipoproteins are isolated by sequential ultracentrifugation using TL-100 ultracentrifuge. First, 0.97 g/mL chylomicrons are removed by centrifugation at 14,000g for 20 min at 4◦ C. 4. VLDL d<1.006 g/mL and LDL d<1.063 g/mL are separated by spinning at 291,000g for 2.26 h at 5◦ C.

220

´ et al. Levy

5. The HDL fraction is obtained by adjusting the 1.063 g/mL infranatant to density 1.21 g/mL and by centrifuging for 6.30 h at 291,000g at 4◦ C. 6. Each lipoprotein fraction was exhaustively dialyzed against 0.15 M NaCl, 0.001 M EDTA, pH 7.0, at 4◦ C for 24 h. 3.7. Addition of Growth Factors

The organ culture conditions were developed in order to maintain all GI tissues in identical serum-free chemically defined medium. Serum has been intentionally avoided since it is likely to contain all known hormones and growth factors that may prove to be developmentally significant. One has to keep in mind that adult GI tissues require different culture media, but all need the presence of serum which seems to be crucial for optimal results (49). Furthermore, the maintenance of the structural relationship of epithelial cells to each other, to their basal lamina, and to the underlying mesenchymal elements obtained with tissue explants is a great asset based on the importance of the relationships during normal development. In achieving that, we have in hand a powerful tool to study the specific overall biological effects of individual molecule suspected to be involved in the regulatory program of human fetal GI mucosa. As stated in the introduction, so far it has been possible to study the specific effects of a number of growth factors and hormones that are known to influence the developmental program in rodents. Depending on the animal model selected, one specific factor can have either a potent, modest or even no effect on a given function. This phenomenon is well illustrated in the case of EGF (50, 51). Therefore, the principle of supplementation of the culture media with a given growth factor will be illustrated with EGF and the developing human small intestine.

3.7.1. Intestinal Digestive Enzymes

The effects of EGF, added at concentrations of 25, 50 and 100 ng/mL, were studied during 5 days of culture (34). Biochemical studies reveal that lactase activity is significantly increased with the addition of 50 and 100 ng EGF/mL culture medium. On the other hand, the increase in sucrase, trehalase and glucoamylase activities that normally occurs during the culture was repressed in the presence of increasing concentrations of EGF. Interestingly, the addition of the same concentrations of EGF to cultured human fetal colon explants which exhibit the same morphological and digestive enzyme profiles (36) does not affect at all the sucrase or the lactase activities. Therefore, the organ culture system is able to reveal not only the specific actions of EGF on the developing human GI tract, but also to unravel differential effects on different segments.

3.7.2. Apo Synthesis

Human fetal intestine (17–20 weeks) was used to study the synthesis of apo A-I and B and its modulation by epidermal

Human Fetal Intestine

221

growth factor. Cultured jejunal explants were incubated with [35 S]-methionine, homogenized, immunoprecipitated, and subjected to gel analysis. Radioactivity was detected mostly in apo A-I and, to a lesser extent, in both apos B-48 and B-100. However, apo B-48 was always the predominant form. The addition of 100 ng/mL EGF resulted in a simultaneous decrease in apo B-100 synthesis and increase in apo B-48 production without a marked effect on apo A-I. Therefore, EGF is able to modulate levels of both apo B species in fetal explants (17, 37). 3.7.3. Lipid Synthesis

To determine whether fetal intestinal tissue could synthesize and secrete newly formed lipids, jejunal explants were incubated with [14 C]-oleic acid substrate. In all experiments, the total amount of radiolabeled lipids was higher in the medium than in the tissue, which indicates that an active secretion takes place in intestinal organ culture. Although both TG and PL were the major products of [14 C]-oleic acid incorporation, PL accounted for more than 50% in the explants, while TG were consistently predominant (80%) in culture media. Lesser amounts were incorporated into CE (20). While important variations were noted between the lipid composition of tissue and medium in the absence of EGF, the addition of this factor, however, had no substantial effect on total lipid distribution.

3.7.4. Lipoprotein Production

We examined the capacity of fetal explants to synthesize the different lipoprotein fractions (17, 18, 20). Lipoproteins of d = 0.97 g/mL (chylomicrons) were the predominant particles to carry the bulk of [14 C]-oleic acid. Fractions of d = 1.006 g/mL (VLDL) and 1.063 g/mL (LDL) were less enriched with labeled fatty acid than the 0.97 g/mL fraction and even less than the 1.21 g/mL fraction (HDL). The addition of EGF to the culture medium significantly enhanced the d = 0.97 g/mL lipoprotein secretion (25–40%) and decreased the d = 1.006 g/mL and 1.063 g/mL fraction output. The lipid composition of these lipoprotein fractions was never altered by the presence of EGF, suggesting that the number of lipoprotein particles, rather than size, was modified by the growth factor. These findings illustrate the capacity of the human fetal intestine to elaborate lipoprotein fractions for the transport of newly synthesized lipids.

3.8. Conclusions

Taken altogether, the current and future data generated with GI explants as well as with primary culture system of isolated epithelial cells using a nonenzymatic dissociation technique will certainly contribute to a better understanding of the cellular mechanisms by which specific modulators cooperatively and/or directly regulate GI epithelial functions. Furthermore, the use of pertinent human GI cell models will not only validate the cellular

222

´ et al. Levy

mechanism involved but also allow the establishment of the specific molecular pathways implied in unveiling possible therapeutic targets during normal and abnormal fetal development.

4. Note 1. One has to remember that the success of human fetal GI tissues depends upon the fetal age. Indeed, tissues aged between 10 and 14 week of gestation can be successfully maintained in serum-free culture for up to 5 days for the small and large intestine and for up to 7–15 days for the esophagus and stomach. With increasing fetal age (17–20 weeks), it is more and more difficult to maintain the tissues morphologically and physiologically sound: the small and large intestine should not be cultured for more than 2 days and the stomach and esophagus no more than 5 days for reliable and reproductive results.

Acknowledgments ´ The authors thank Inga C. Teller, Eric Tremblay, and Schohraya Spahis for technical assistance in the writing. This original investigation was supported by grants from the Canadian Institutes of Health Research. References 1. Gand, R.J., Watkins, J.B., and Torti, F.M. (1976) Development of the human gastrointestinal tract: a review. Gastroenterology 70, 790–810. 2. Henning, S.J. (1981) Postnatal development: coordination of feeding, digestion and metabolism. Am J Physiol 241, G199–G214. 3. M´enard, D. and Calvert, R. (1991) Fetal and postnatal development of the small and large intestine: patterns and regulation. In: Morissset, J. and Solomon, T. (eds.) Growth of the Gastrointestinal Tract: Gastrointestinal Hormones and Growth Factors. Boca Raton: CRC Press Inc, pp. 147–162. 4. M´enard, D. (2004) Functional development of the human gastrointestinal tract: hormone and growth factor – mediated regulatory mechanisms. Can. J. Gastroenterol. 18, 39–44. 5. M´enard, D. and Beaulieu, J.-F. (1994) Human intestinal brush border membrane hydrolases. In: Bkaily, G. (ed.) Membrane

6.

7.

8. 9.

Physiopathology. Norwell, MA: Kluwer Academic Publishers, pp. 319–341. M´enard, D., Beaulieu, J.-F., Boudreau, F., Perreault, N., Rivard, N. and Vachon, P.-H. (2006) Gastrointestinal tract (GI tract). In: Unsicker, K. and Krieglstein, K. (eds.) Cell Signalling and Growth Factors in Development, from Molecules to Organogenesis. Wiley-VCH, Chapter 20, pp. 755–790. M´enard, D. (1989) Organ culture studies of human gastrointestinal development. In: Smith, M.W. and Sepulveda, F.V. (eds.) Adaptation and Development of Gastrointestinal Function. England: Manchester University Press, pp. 80–91. M´enard, D. and Arsenault, P. (1985) Explant culture of human fetal small intestine. Gastroenterology 88, 691–700. M´enard, D. and Arsenault, P. (1987) Maturation of human fetal esophagus maintained in organ culture. Anat. Rec. 217, 348–354.

Human Fetal Intestine 10. M´enard, D. and Arsenault, P. (1987) Human fetal colon in organ culture. Anat. Embryol. 176, 441–448. 11. M´enard, D., Arsenault, P. and Monfils, S. (1993) Maturation of human fetal stomach in organ culture. Gastroenterology 104, 492–501. 12. Arsenault, P. and M´enard, D. (1987) Cell proliferation in developing human jejunum. Biol. Neonate 51, 297–304. 13. Arsenault, P. and M´enard, D. (1988) Autoradiographic localization of [3 H]-thymidine incorporation in developing human esophagus. Anat. Rec. 220, 313–317. 14. Arsenault, P. and M´enard, D. (1989) Cell proliferation during morphogenesis of human colon. Biol. Neonate 55, 137–142. 15. M´enard, D. and Arsenault, P. (1990) Cell proliferation in developing human stomach. Anat. Embryol. 182, 509–516. 16. M´enard, D. and Pothier, P. (1987) Differential distribution of digestive enzymes in isolated epithelial cells from developing human fetal small intestine and colon. J. Pediatr. Gastroenterol. Nutr. 6, 509–516. 17. Levy, E., Thibault, L. and M´enard, D. (1992) Intestinal lipids and lipoproteins in the human fetus: modulation by epidermal growth factor (EGF). J. Lipid Res. 33, 1607– 1617. 18. Levy, E., Loirdighi, N., Thibault, L., Nguyen, T.D., Labuda, D., Delvin, E.E. and M´enard, D. (1996) Lipid processing and lipoprotein synthesis by the developing human fetal colon. Am. J. Physiol. 33, G813– G820. 19. Loirdighi, N., M´enard, D., Delvin, E.E. and ´ (1997) Ontogeny, location, and horL´evy, E. monal modulation of HMG-CoA reductase, ACAT and monoacylglycerol acyltransferase in the human small intestine. Am. J. Physiol. 273, G62–G67. 20. Levy, E. and M´enard, D. (2000) Developmental aspects of lipid and lipoprotein synthesis and secretion in human gut. In: Bendayan, M. (ed.) Structural and Functional Relationships of the Intestinal Wall. Microscopy Research Technique (Topical Issue) 49, 363–373. 21. Dauc¸a M., Cabl´e, S., Calvert, R., Colin, S., El Bouhtoury-Charnier, F., Schill, J., Leheup, B., Keller, J.M. and M´enard, D. (1996) Peroxisomes and peroxisomal enzymes in the human fetal small intestine. Biol. Neonate 69, 12–21. 22. Huin, C., Corriveau, L., Bianchi, A., Keller, J.-M., Collet, P., Kr´emarik-Bouilland, P., Domenjoud, L., B´ecurve, P., Schohu, H., M´enard, D. and Dauc¸a, M. (2000) Differ-

23.

24.

25.

26. 27.

28. 29.

30.

31.

32.

33.

34.

35.

223

ential expression of peroxisome proliferatoractivated receptors (PPARs) in the developing human fetal digestive tract. J. Histochem. Cytochem. 48, 603–611. Delvin, E.E., Richard, P., Pothier, P. and M´enard, D. (1990) Presence and binding characteristics of calcitriol receptors in human fetal gut. FEBS Lett. 262, 55–57. ´ and Delvin, E.E., Lopez, V., L´evy, E. M´enard, D. (1996) Calcitriol differentially modulates mRNA encoding calcitriol receptors and calcium-binding protein-9 kDa in human fetal jejunum. Biochem. Biophys. Res. Comm. 224, 544–548. ´ and Delvin, E.E., Lopez, V., L´evy, E. M´enard, D. (1996) Developmental expression of calcitriol receptors, calcium binding protein 9 kDa and calcidiol 24-hydroxylase in human intestine. Pediatr. Res. 40, 664–670. Chailler, P. and M´enard, D. (1999) Ontogeny of EGF receptor in the human gut. Front. Biosci. 4, 87–101. ´ and M´enard, D. (1996) DifferTremblay, E. ential expression of extracellular matrix components during the morphogenesis of human gastric mucosa. Anat. Rec. 245, 668–676. Beaulieu, J.-F. (1999) Integrins and human intestinal cell functions. Front. Biosci. 4, D310–D321. Beaulieu, J.-F. (1997) Extracellular matrix components and integrins in relationship to human intestinal epithelial cell differentiation. Prog. Histochem. Cytochem. 31, 1–78. Teller, I.C. and Beaulieu, J.-F. (2001) Interactions between laminin and epithelial cells in intestinal health and disease. Expert Rev. Mol. Med. 3, 1–18. M´enard, D., Monfils, S. and Tremblay, E. (1995) Ontogeny of human gastric lipase and pepsin activities. Gastroenterology 108, 1650–1656. ´ Monfils, S. and M´enard, D. Tremblay, E., (1997) Epidermal growth factor influences cell proliferation, glycoproteins and lipase activity in human fetal stomach. Gastroenterology 112, 1188–1196. ´ Basque, J.-R., Rivard, N. and Tremblay, E., M´enard, D. (1999) Epidermal growth factor and transforming growth factor-␣ downregulate human gastric lipase gene expression. Gastroenterology 116, 831–841. Arsenault, P. and M´enard, D. (1985) Influence of hydrocortisone on human fetal small intestine in organ culture. J. Pediatr. Gastroenterol. Nutr. 4, 893–901. M´enard, D., Arsenault, P. and Pothier, P. (1988) Biological effects of epidermal growth factor in human fetal jejunum. Gastroenterology 94, 656–663.

224

´ et al. Levy

36. M´enard, D., Corriveau, L. and Arsenault, P. (1990) Differential effects of epidermal growth factor and hydrocortisone in human fetal colon. J. Pediatr. Gastroenterol. Nutr. 10, 13–20. 37. Levy, E., Thibault, L., Delvin, E.E. and M´enard, D. (1994) Apolipoprotein synthesis in human fetal intestine: regulation by epidermal growth factor. Biochem. Biophys. Res. Comm. 204, 1340–1345. 38. Levy, E., Sinnett, D., Thibault, L., Nguyen, T.D., Delvin, E.E. and M´enard, D. (1996) Insulin modulation of newly synthesized apolipoprotein B-100 and B-48 in human fetal intestine: gene expression and mRNA editing are not involved. FEBS Lett. 393, 253–258. ´ Monfils, S. and M´enard, D. 39. Tremblay, E., (1997) Epidermal growth factor influences cell proliferation, glycoproteins and lipase activity in human fetal stomach. Gastroenterology 112, 1188–1196. ´ 40. Tremblay, E., Chailler, P. and M´enard, D. (2001) Coordinated control of fetal gastric epithelial functions by insulin-like growth factors and their binding proteins. Endocrinology 142, 1795–1803. 41. Perreault, N. and Beaulieu, J.F. (1996) The use of the dissociating enzyme thermolysin to generate viable human intestinal epithelial cell cultures. Exp. Cell Res. 224, 354–364. 42. Beaulieu, J.F. and Quaroni, A. (1991) Differential expression of sucrase-isomaltase in subpopulations of the human colon tumor cell line Caco-2. Biochem. J. 280, 599–608. 43. Beaulieu, J.F., Nichols, B. and Quaroni, A. (1989) Post-translational regulation of sucrase-isomaltase expression in intestinal crypt and villus cells. J. Biol. Chem. 264, 20000–20011. 44. Vachon, P.H. and Beaulieu, J.F. (1992) Transient mosaic pattern of morphological and functional differentiation in the human

45.

46.

47.

48.

49.

50.

51.

enterocyte-like Caco-2 cell line. Gastroenterology 103, 414–423. Pageot, L.-P., Perreault, N., Basora, N., Francoeur, C., Magny, P. and Beaulieu J.F. (2000) Human cell models to study small intestinal functions: recapitulation of the crypt-villus axis. Microsc. Res. Techn. 49, 394–406. Saeed, A.I., Sharov, V., White, J., Li, J., Liang, W., Bhagabati, N., Braisted, J., Klapa, M., Currier, T., Thiagarajan, M., Sturn, A., Snuffin, M., Rezantsev, A., Popov, D., Ryltsov, A., Kostukovich, E., Borisovsky, I., Liu, Z., Vinsavich, A., Trush, V. and Quackenbush, J. (2003) TM4: a free, open-source system for microarray data management and analysis. Biotechniques 34, 374–378. Tremblay, E., Auclair, J., Delvin, E., Levy, E., M´enard, D., Pshezhetsky, A.V., Rivard, N., Seidman, E., Sinnett, D., Vachon, P.H. and Beaulieu, J.-F. (2006) Gene expression profiles of normal proliferating and differentiating human intestinal epithelial cells: a comparison with the Caco-2 cell model. J. Cell Biochem. 99, 1175–1186. Streeter, G.L. (1920) Weight, sitting head, head size, foot length and mental age of the human embryo. Carnegie Inst. Contrib. Embyol. 11, 143–149. Hugon, J.S., Clavert, R. and M´enard, D. (1982) In vitro methods and their applications. In: Chadwick, V.S. and Phillips, S. (eds.) Small Intestine, Gastroenterology 2. London: Butterworths International Medical Reviews, pp. 58–72. Malo, C. and M´enard, D. (1982) Influence of epidermal growth factor on the development of suckling mouse intestinal mucosa. Gastroenterology 83, 28–35. Pollack, P.A., Goda, T., Colony, P.C., et al. (1987) Effects of internally fed epidermal growth factor on the small and large intestine of the suckling rat. Regul. Pept. 7, 121–132.

Chapter 14 Renal and Cardiac Na+ –K+ -ATPase and Aconitase in a Rat Model of Fetal Programming ´ ` Brochu Rebecca Gaudet and Michele Abstract Fetal programming of adult disease is an area of research that has gained considerable attention. Epidemiological studies suggest that adverse intrauterine environment in fetal life is associated with a higher incidence of hypertension and coronary disease. Several mechanisms could contribute to these diseases and be regulated in a tissue-specific manner. The Na+ –K+ -ATPase, a membrane-bound enzyme, maintains the Na+ and K+ gradients across the plasma membrane of animal cells and therefore provides a mechanism for cell function regulation. Furthermore, in an in vitro model of cardiac hypertrophy, a decrease in the activity of the tricarboxylic acid (TCA) cycle enzyme, aconitase, was observed. We have shown that in our model of fetal programming, these two enzymes were regulated differently in heart and kidney of adult females. Key words: Sodium pump, kidney, heart, tricarboxylic acid cycle enzymes, enzyme activity, intrauterine growth restriction (IUGR), hypertension.

1. Introduction Epidemiological findings and animal studies have led to the fetal programming theory, which holds that the intrauterine environment could be implicated in the etiology of adult diseases (1). The organs are malleable during fetal life, allowing adaptation to surrounding conditions (2). However, adaptations can persist after birth and predispose individuals to adult diseases. Animal models of intrauterine growth restriction (IUGR) are powerful tools to study the underlying mechanisms implicated in the development of pathologic conditions later in life. We developed a model by giving to pregnant rats a low-sodium diet in the last week of Julie Lafond and Cathy Vaillancourt (eds.), Human Embryogenesis: Methods and Protocols, vol. 550 © Humana Press, a part of Springer Science+Business Media, LLC 2009 DOI 10.1007/978-1-60327-009-0 14 Springerprotocols.com

225

226

Gaudet and Brochu

gestation (3). These IUGR animals develop, as adults, higher systolic blood pressure and present renin–angiotensin–aldosterone system alterations, renal dysfunction (4), hypertrophic cardiac remodeling (5), and altered response to salt in adult life, all of which represent risk factors for the onset of cardiovascular diseases. Since the gene expression of Na+ –K+ -ATPase subunits was markedly changed in the IUGR group and because of its implication in sodium reabsorption, the expression and activity of this protein were measured. Reabsorption of solutes and water is a process that requires energy. Renal energetic metabolism was therefore evaluated in IUGR and control rats by measuring the activity of the first two enzymes involved in the tricarboxylic acid (TCA) cycle, citrate synthase and aconitase. In heart, diminished Na+ –K+ -ATPase pump activity would impact resting membrane potential, intracellular Na+ , as well as the activity of the Na+ /Ca2+ exchanger, leading to change in intracellular Ca2+ and perturbations in the contractile response. Therefore, the measurement of these parameters in kidney and heart are important to explain the mechanisms that could lead to adult disease.

2. Materials 2.1. Western Blot for α 1 and β 1 Na+ −K+ -ATPase Subunits 2.1.1. Tissue Lysis and Protein Assay

1. Sucrose buffer: 250 mM Sucrose, 1 mM ethylenediamine tetraacetic acid (EDTA), 20 mM KH2 PO4 , 0.1 mM phenylmethylsulfonyl fluoride (PMSF) pH 7.6. Add PMSF just before use. Store at 4◦ C (see Note 1). 2. Laemmli’s sample buffer (2×): 0.15 M Tris(hydroxymethyl)-aminomethane (Tris), pH 6.8, 1.2% (w/v) sodium dodecyl sulfate (SDS), 30% (v/v) glycerol, 0.002% (w/v) bromophenol blue. Add 15% (v/v) ␤-mercaptoethanol just before use. Store at room temperature. 3. Dye reagent concentrate for protein assay (Bio-Rad Laboratories, Hercules, CA, USA). 4. Bovine serum albumin 0.1 mg/mL (BSA standard) (Sigma– Aldrich, Inc., St. Louis, MO, USA). 5. Bradford protein assay.

Na+ −K+ -ATPase and Aconitase Activities

2.1.2. SDS-Polyacrylamide Gel Electrophoresis (SDS-PAGE)

1. 2. 3. 4.

5. 6. 7.

8.

9. 10.

227

Separating buffer: Tris 1.5 M, pH 8.8. Store at 4◦ C. Stacking buffer: Tris 1.5 M, pH 6.8. Store at 4◦ C. Ten percent (w/v) SDS. Store at room temperature. Thirty percent acrylamide/bis solution (29:1) (acrylamide is neurotoxic when unpolymerized, care should be taken not to receive exposure). Store at 4◦ C. N,N,N,N  -Tetramethyl-ethylenediamine (TEMED) (Invitrogen, Carlsbad, CA, USA). Store at 4◦ C (see Note 2). Ten percent ammonium persulfate (APS), freshly made. Running buffer (10×): 1.92 M glycine, 0.25 M Tris, 1% (w/v) SDS. Store at room temperature or 4◦ C (see Note 3). Full range RainbowTM recombinant protein molecular weight marker (cat. no. RPN800; Amersham/GE Healthcare, Buckinghamshire, UK) (see Note 4). Rat brain microsomal preparation used as positive control (Upstate Biotechnology, Lake Placid, NY, USA). Three mL syringe fitted with a 22-gauge needle.

2.1.3. Western Blotting

1. Transfer buffer (10×): 50 mM Tris, 380 mM glycine. Add 20% (v/v) methanol before use (see Note 5). 2. Phosphate-buffered saline with Tween (PBS–T). Prepare PBS 10× (stock) with 1.37 M NaCl, 27 mM KCl, 0.1 M Na2 HPO4 , 18 mM KH2 PO4 . Dilute with water for use and add 0.1% (v/v) Tween-20. 3. Nitrocellulose membrane (Fisher Scientifique, Nepean, ON, Canada). 4. Ponceau-S solution: 0.1% p/v Ponceau S (Sigma) in 5% acetic acid. 5. Blocking buffer: 5% w/v non-fat dry milk in PBS–T. 6. Primary antibodies (Upstate Biotechnology), ␣1 subunit, 1:20,000; ␤1 subunit, 1:500 both in blocking buffer. 7. Secondary antibody: Horseradish peroxidase-conjugated goat anti-mouse immunoglobulin (Amersham/GE Healthcare Limited), 1:4,000 in blocking buffer. 8. Enhanced chemiluminescence (ECL) detection system (Amersham/GE Healthcare Limited). Store at 4◦ C. 9. High performance chemiluminescence films (Amersham/ GE Healthcare Limited).

2.1.4. Stripping and Reprobing Blots for Internal Control

1. Stripping buffer: 0.2 M Glycine, pH 2.5, 0.05% Tween-20. Store at 4◦ C. 2. Primary antibody: Mouse anti-␤-actin (Abcam, Cambridge, MA, USA), 1:100,000 in blocking buffer for kidney (see Note 6). Mouse anti-GAPDH (Santa Cruz Biotechnology,

228

Gaudet and Brochu

Inc., Santa Cruz, CA, USA) 1:10,000 in blocking buffer for heart. 3. Wash buffer: PBS–T. 2.2. Na+ −K+ -ATPase Activity Assay 2.2.1. Homogenates Preparation

1. Homogenization buffer: 250 mM Sucrose, 5 mM EDTA, 20 mM imidazole, pH 7.4. Store at 4◦ C.

2.2.2. Pump Activity Assay

1. KH2 PO4 1 mM. 2. SDS 2.6 mM. 3. Incubation buffer: 5 mM MgCl2 , 100 mM NaCl, 15 mM KCl, 83.3 mM Tris, 5 mM NaN3 , pH 7.5. For the experiment in presence of ouabain (Sigma–Aldrich Co), add 1 mM ouabain. 4. Ice-cold 3.9% HClO4 . 5. ATP solution: Na2 ATP 30 mM. 6. Coloration solution: 8 mM (NH4 )6 Mo7 O24 •4H2 O (ammonium molybdate), 3% (v/v) sulfuric acid, 144 mM FeSO4 • 7H2 O (iron sulfate). First, dilute molybdate in water, and then, add acid. Add iron sulfate just before use.

2.3. Aconitase and Citrate Synthase Enzyme Assay 2.3.1. Homogenates Preparation

1. Extraction buffer: 0.1 mM Tris–HCl, 15 mM tricarballylic acid, pH 7.8. The buffer needs to be bubbled with nitrogen for 10 min to remove unwanted oxygen.

2.3.2. Enzyme Assay

1. NADP 1.27 mM (stock). 2. Citrate substrate stock: 10 mM Sodium citrate, 160 mM triethanolamine, pH 7.4, 0.5% (v/v) chloroform. 3. MgCl2 •6H2 O 10 mM (stock). 4. Aconitase buffer: 0.5 mM NADP, 5 mM citrate substrate, 0.5 mM MgCl2 •6H2 O. Add 0.8 U of isocitrate dehydrogenase standard (Sigma–Aldrich Co) per mL of prepared buffer. 5. Citrate synthase buffer: 0.1 mM Tris–HCl, 1.25 mM 5,5 dithiobis-2-nitrobenzoic acid (DTNB), pH 8.0. 6. Oxaloactetate (OA)/Acetyl-CoA solution: Prepare 1 mL: 50 mM oxaloacetate, adjust to pH 6.5 with NaOH 1 N (see Note 7). Add 5 mM acetyl-CoA.

2.3.3. Protein Assay

1. Dye reagent concentrate for protein assay (Bio-Rad Laboratories). 2. BSA 0.1 mg/mL (standard) (Sigma–Aldrich Co).

Na+ −K+ -ATPase and Aconitase Activities

229

3. Methods 3.1. Western Blot for α 1 and β 1 Na+ −K+ -ATPase Subunits 3.1.1. Preparation of Rat Renal Cortex and Left Cardiac Ventricle Samples

1. Label, for each sample, one 4-mL ultracentrifuge tube, four 1.7-mL microcentrifuge tubes (see Steps 4, 6, 8) and three 5-mL polypropylene (PP) tubes (see Steps 3, 7). 2. Prepare 2 mL/sample of sucrose buffer. 3. Cut and weigh approximately 200 mg of frozen tissue for each sample. Do not allow tissues to thaw. Transfer sample into a PP tube and add 1.5 mL of sucrose buffer. 4. Crush with polytron homogenizer at maximal speed for about 10–15 s. Transfer the mixture in microcentrifuge tubes. 5. Centrifuge for 15 min, at 2,500g, at 4◦ C. Collect supernatant in ultracentrifuge tubes. 6. Centrifuge tubes for 1 h, at 300,000g, at 4◦ C. Transfer pellets into microcentrifuge tubes and suspend them with 250 ␮L of sucrose buffer using Potter-Helvejem homogenizer. 7. Measure the quantity of protein in duplicate by Bradford assay in polypropylene tubes. 8. Make two different dilutions (2.0 ␮g/␮L for ␣1 subunit and 10.0 ␮g/␮L for ␤1 subunit). 9. Add Laemmli’s buffer 1:1 (see Note 8). 10. Close the tubes and boil for 5 min. Sample preparations can be used immediately or frozen at −20◦ C for further use. 11. Prepare a tube containing only lysis buffer with Laemmli for negative control (see Note 9).

3.1.2. SDS-PAGE

1. These instructions assume the use of a Bio-Rad MiniProtean 3 Electrophoresis module. 2. α 1 subunit: Prepare a 1.5-mm thick, 7% gel by mixing 7.4 mL water with 3.5 mL acrylamide/bis solution, 3.8 mL of Tris buffer 1.5 M pH 8.8, 150 ␮L SDS 10%, 150 ␮L APS 10%, and 10.5 ␮L TEMED (quantities are for two gels). β 1 subunit: Prepare a 1.5-mm thick, 15% gel by mixing 3.4 mL water with 7.5 mL acrylamide/bis solution, 3.8 mL of Tris buffer 1.5 M pH 8.8, 150 ␮L of 10% SDS, 150 ␮L of 10% APS, and 10.5 ␮L TEMED (quantities are for two gels).

230

Gaudet and Brochu

3. Pour the gel leaving space for the stacking gel. Overlay with water until polymerization, for about 15 min. Pour water once polymerized. 4. Prepare stacking gel by mixing 3.4 mL water with 830 ␮L acrylamide/bis solution, 630 ␮L of Tris 1.5 M pH 6.8, 50 ␮L of 10% SDS, 50 ␮L of 10% APS, and 5 ␮L TEMED (quantities are for two gels). 5. Pour the stacking gel over the separation gel and insert the comb. Polymerization should be within 5–10 min. 6. Prepare 800 mL of running buffer 1×. 7. Assemble the gel unit and put it in the chamber. Pour the running buffer between the two gels and in the chamber. The space between the two gels must be full for correct migration. Put off the comb gently. Rinse the wells with running buffer using a 3-mL syringe fitted with a 22-gauge needle. 8. Load wells with 10 ␮L of each sample (10 ␮g/lane for ␣1 subunit and 50 ␮g/lane for ␤1 subunit). Include wells for positive and negative controls and molecular weight marker. 9. Complete the assembly of the gel unit with the top and connect it to a power supply. Run it at 150 V for about 2 h. Blue dye from Laemmli allows following the migration front. The front has to migrate out of the gel. Stop the migration before the 35 kDa marker reaches the bottom of the gel. 3.1.3. Western Blotting for α 1 and β 1 Na+ −K+ -ATPase Subunits

1. The transfer to nitrocellulose membranes of samples separated by SDS-PAGE will be done electrophoretically. These directions assume the use of a Bio-Rad Mini-Protean 3 Mini Trans-Blot module. 2. For each gel, four filter papers and one sheet of nitrocellulose membrane are cut to the size of the separating gel. 3. Drench filter papers and four sponges in 1× transfer buffer (prepare 1 L: 100 mL of transfer buffer 10×, 700 mL water, and 200 mL methanol) (see Note 5). 4. Activate nitrocellulose membranes in water. 5. Prepare the transfer cassettes, the black side down on the bench. 6. Disconnect and disassemble the gel unit. Remove and discard the stacking gel. A little corner of the gel could be cut to remember its orientation. Put the separating gels in transfer buffer. 7. On the black side of the cassette, place a wetted sponge, two wetted filter papers, and the gel. Lay the nitrocellulose membrane on the top of the gel ensuring that no air bubbles are trapped between the gel and the membrane. Put two more filters and the last sponge on top and close the cassette. Repeat the procedure for each gel.

Na+ −K+ -ATPase and Aconitase Activities

231

8. Place the two cassettes in the transfer tank, black sides of the cassettes oriented with black side of the tank (the nitrocellulose membrane will be between the gel and the anode). It is vitally important to orient the apparatus like that or else the proteins will be lost due to its transfer into the buffer. 9. Fill up the chamber of transfer buffer and connect it to a power supply in a 4◦ C room (see Note 5). The transfer can be accomplished at either 80 V for 2 h or 25 V overnight. 10. Once the transfer is completed, take out the cassettes of tank and disassemble it carefully, removing the top sponge and papers. Put nitrocellulose membrane in a jar and pour little Ponceau-S solution, agitating for few minutes to see the protein bands. Discard the gel and the filter papers, rinse sponges. A corner of the membrane could be cut to remember the orientation. The colored molecular weight marker should be clearly visible on the membrane. 11. Incubate the membrane in about 30 mL of blocking buffer for 1 h at room temperature under agitation. During that time, prepare sterile polyethylene (PE) bags larger than membranes (see Note 10). 12. Discard the blocking buffer. Add 4 mL of the primary antibody dilution into the sealed sterile PE bag overnight, 4◦ C with agitation. 13. Discard the primary antibody and wash membranes five times for 5 min each with about 20 mL PBS–T, under agitation. Prepare the secondary antibody during the final wash. 14. Add the secondary antibody dilution to membranes for 45 min at room temperature under agitation. 15. Discard the secondary antibody and wash membranes five times for 5 min each with about 20 mL PBS–T under agitation. Prepare the ECL solution during the final wash; 500 ␮L of each reagent for a total of 1 mL per membrane in a light safe plastic tube. The mix has to be done immediately before use. 16. Once the final wash is completed, shake gently the membranes over a blotting paper to wipe it (be careful while wiping the protein side) and add the ECL on the protein side ensuring complete coverage. Wait for 1 min. 17. Wipe gently again to remove the ECL reagent and place membranes between acetate sheets protector that have been cut to the width of an X-ray film cassette. Place the acetate containing the membrane into the cassette (see Note 11). 18. In a dark room under safe light conditions, place the film on the acetate for a suitable exposure time, typically a few minutes or seconds (Fig. 14.1).

232

Gaudet and Brochu

Fig. 14.1 Representative immunoblot for Western blot analysis of Na+ −K+ -ATPase ␣1 and ␤1 protein from kidney cortex of adult control and IUGR rats.

3.1.4. Stripping and Reprobing Blots for Internal Control (see Note 12)

1. Once a satisfactory result has been obtained, the membrane is then stripped and reprobed with anti-actin-␤ or antiGAPDH to provide a loading control. 2. Pour about 20 mL of stripping buffer into plastic containers and warm to 70◦ C in an agitating bath. Incubate for 2 h, change the buffer after 1 h. 3. Discard the stripping buffer and wash membranes five times for 5 min each with 20 mL PBS–T, under agitation. 4. Incubate the membranes with 30 mL of blocking buffer for 1 h at room temperature under agitation. 5. The blots are then ready to reprobe with primary antibody at 4◦ C overnight under agitation. 6. Then the blots are washed five times, probed with secondary antibody, washed five times again, detected with ECL, and exposed as above.

3.2. Na+ −K+ -ATPase Activity Assay 3.2.1. Preparation of Rat Renal Cortex and Left Cardiac Ventricle Samples

1. Label one 5-mL PP tube for homogenization for each sample. 2. Prepare the homogenization buffer by about 4 mL/sample. Work on ice. 3. Weigh about 150 mg of fresh tissue (see Note 13) and add 1 mL of buffer. Cut tissues into small pieces with scissors. 4. Crush with polytron homogenizer at maximal speed for about 10–15 s. 5. Rinse polytron carefully with water after crushing a sample, rinse with buffer, and wipe the polytron’s stem before next sample (see Note 14). 6. For each sample, add 2.6 mL of homogenization buffer (with the first 1 mL, this corresponds to 24 volumes of buffer: 150 mg × 24 = 3.6 mL).

Na+ −K+ -ATPase and Aconitase Activities

233

7. Leave on ice for 15 min. During that time, prepare 10 mM ouabain solution and a tube containing 200 ␮L SDS for each sample. 3.2.2. Pump Activity Assay

1. For the standard curve, prepare seven tubes in duplicate following this table and put it apart: Final PO4 quantity (nmol) 0 (BLANK)

KH2 PO4 , 1 mM quantity (␮L)

Water quantity (␮L)

0

500

10

10

490

20

20

480

30

30

470

100

100

400

150

150

350

250

250

250

2. Add 200 ␮L of each homogenate into SDS tubes. Vortex. Incubate 15 min at room temperature. Vortex at midtime. During that time, prepare the incubation buffer with and without ouabain. For each sample, prepare three tubes with 212.5 ␮L of incubation buffer with ouabain and three tubes without ouabain (for best results, this experiment is done in triplicate). Set the centrifuge at 2◦ C and the agitating bath at 37◦ C. 3. Add 12.5 ␮L of the samples (+ SDS) to each tube containing incubation buffer (six tubes per sample). Vortex. Incubate at 37◦ C for 10 min. During that time, prepare the ATP solution. 4. After the incubation, steps need to be done always in the same order to ensure the same reaction time between samples. Add 25 ␮L of ATP solution into each tube. Vortex. 5. Incubate at 37◦ C for 5 min. 6. Add 25 ␮L of cold perchloric acid (HClO4 ) in each tube. Vortex. 7. Centrifuge at 1,500g for 15 min, at 2◦ C. During that time, prepare the coloration solution. 8. Prepare one 5-mL PP tube for each reaction. Add 200 ␮L of each triplicate and 200 ␮L water. Add 400 ␮L of coloration solution. Vortex. 9. Add 500 ␮L of coloration solution into each standard curve tube and vortex. 10. Read each tube at spectrophotometer at a wavelength of 750 nm in plastic cuvettes. The dilution factor is 176.

234

Gaudet and Brochu

3.2.3. Calculation of Activity

1. Na+ −K+ -ATPase activity is expressed in ␮mol PO4 /mg tissue/h. The PO4 concentration is found by the absorbance value expressed in ␮mol/L. 2. Exclude the non-specific phosphate production of Na+ −K+ ATPase (the mean result of the triplicate with ouabain) from the value of total production (the mean result of the triplicate without ouabain). 3. The correction factor is thus 2.9 E−4 considering the starting volume of 200 ␮L containing 8.3 mg and the multiplication per 12 to convert 5 min in 1 h.

[dif (␮mol/L) × 0.0002L × 12]/8.3 mg = dif (␮mol/L) × 0.000289 = Activity ␮mol PO4 /mg/h

3.3. Aconitase and Citrate Synthase Enzyme Assay 3.3.1. Preparation of Rat Renal Cortex and Left Cardiac Ventricle Samples

1. Prepare extraction buffer, 1 mL for each sample. 2. Weigh 60 mg of frozen tissue and add 1 mL of extraction buffer. 3. Crush with a polytron homogenizer at a maximal speed for about 10–15 s. Keep the tubes in ice mixed with salt and ethanol to maintain cold for a long time. 4. Transfer homogenized samples into 1.7-mL microcentrifuge tubes. 5. Centrifuge at 9,500g for 10 min, at 4◦ C. 6. Collect the supernatant for the assay.

3.3.2. Enzyme Assay for Aconitase

1. Aconitase activity is determined by the formation of NADPH following ␣-ketoglutarate production from isocitrate. So, the activity is assayed by monitoring the kinetics of optical density of NADPH (at a wavelength of 340 nm) measured on a spectrophotometer. 2. First, set a program in the spectrophotometer to measure until 400 s the optical density (O.D.) at 340 nm. 3. Prepare one cuvette containing 840 ␮L of aconitase buffer for each sample. 4. Blank is done with the first cuvette. 5. Start the program for samples. When the first value of O.D. is stable, add 60 ␮L of the tissue sample (see Section 3.3.1) into the cuvette. Mix with the pipette. 6. Let go for 400 s; an O.D. measure is taken every 15 s and the kinetic curve is drawn. 7. Print the curve and the raw data. 8. Repeat from Steps 5 to 7 for all samples.

Na+ −K+ -ATPase and Aconitase Activities

235

3.3.3. Enzyme Assay for Citrate Synthase

1. Citrate synthase activity is measured by the detection of 5,5 dithiobis-2-nitrobenzoic acid coupled to reactive reduced coenzyme A at 412 nm, upon addition of 5,5 -dithiobis2-nitrobenzoic acid, acetyl-CoA, and oxaloacetate. Use the same supernatants as the ones for aconitase activity assay. 2. Prepare one cuvette containing 50 ␮L of water and 750 ␮L of citrate synthase buffer for each sample. 3. Blank is done with the first cuvette. 4. Add 25 ␮L of the first sample. Samples could need to be diluted by 1:20 to be assayed. 5. Start the program for samples. 6. Add 50 ␮L water and 50 ␮L of OA/acetyl-CoA solution. 7. Let go for 400 s; an O.D. measure is taken every 15 s and the kinetic curve is drawn. 8. Print the curve and the raw data. 9. Repeat from Steps 4 to 8 for all samples.

3.3.4. Protein Assay

1. Measure the quantity of protein by Bradford assay in PP tubes.

3.3.5. Calculation According to Beer–Lambert Law

1. The kinetic formation of 2-␣-ketoglutarate (aconitase enzyme assay) and citrate (citrate synthase enzyme assay) is measured in ␮mol of substrate/min/mg protein. 2. Beer–Lambert law: O.D. = ε•b•c (ε = molar absorption coefficient; b = path length or cuvette width; c = sample protein concentration = aconitase activity). 3. O.D./min is the slope of the kinetic curve between two predetermined points when curve is linear, multiplied by 60 (60 s in 1 min). 4. Path length is 1 cm for standard cuvettes, so b = 1. 5. ε (aconitase) = 6.23 cm2 /␮mol; ε (citrate synthase) = 13.6 cm2 /␮mol. 6. 1 enzymatic unit (U) = 1 ␮mol of substrate/min, so we obtain U/mg. 7. Example: Raw data: Sample concentration is 4.2605 mg/mL; Spectrophotometer measures (table): Time(sec) 0

Wavelength 0.00

60

0.0946

120

0.1079

180

0.1339

240

0.1820

300

0.2455

390

0.3618

236

Gaudet and Brochu O.D. min

=

O.D.t2 −O.D.t1 t2−t1

·

60s min

O.D. min

=

0.3618−0.1820 390s−240s

·

60s min

=

0.07192 min

O.D. = ε · b · c c=

O.D. ε·b

=

0.07192 cm 2 min · 6.23 μmol .1 cm

· 15(dilution)

μmol U = 0.1732 min = 0.1732 ml .ml

 Aconitase activit y

U mg



=

U 0.1732 ml mg 4.2605 ml

=

0.0407U mg

4. Notes 1. Unless stated otherwise, all solutions should be prepared in water that has a resistivity of 17.5 M cm or more (Sybron-Barnstead NANOpure II water deionization system, Dubuque, IO, USA). “Water’’ in this text refers to this standard. 2. TEMED may be stored at room temperature. However, it depends on the company. Thus, follow manufacturer’s instructions. 3. Running buffer 1× could be reused five times. If it appears unclear, do not use it. 4. Protein weight marker could be different. 5. Methanol is essential to maintain the cold temperature, to remove SDS of proteins, and to increase the adhesion of proteins on the membrane. Maintaining the buffer below the room temperature is important to prevent heat-induced damage to the experiment or apparatus. 6. The anti-␤-actin from Abcam is very effective. Because it needs a great dilution, it often leaves large volume. You can keep it at 4◦ C for further use until 3 weeks. If the milk is clotted, throw the solution (blocking solution). 7. Be careful because the attainment of pH 6.5 is rapid. Verify it with pH indicator paper. 8. Laemmli buffer is 2×. Add the volume of Laemmli in consequence of the final volume obtained. The final concentration of the loaded samples takes account of this dilution; 1.0 ␮g/␮L for ␣1 subunit and 5.0 ␮g/␮L for ␤1 subunit. 9. Negative controls could be done with tissues that don t express the wanted protein. If such a tissue is not available, it is possible to use lysis buffer with Laemmli as suggested in this protocol. Positive control (rat brain microsomal preparation) could be bought from companies or done homemade.

Na+ −K+ -ATPase and Aconitase Activities

237

10. The incubation with the primary antibody could be done in plastic container (minimum of 10 mL of solution). However, to use less antibody (less than 5 mL), sterile polyethylene bags (Fisher Scientific) are used with a sealing system. 11. In this protocol, backgrounds are normally very clean so that exact alignment of the film with nitrocellulose membranes could be difficult. We suggest the application of luminescent tape to the edge of the acetate sheet to correctly associate the signals with the lanes. 12. Nitrocellulose membranes could be stripped only once. 13. Na+ −K+ -ATPase activity assay need to be done with fresh tissues; in the morning right after the sacrifice of rats. A loss of activity is noted when using frozen tissues. 14. The volume of the sample is important for further calculation of activity, so it is necessary to wipe the polytron to avoid adding water in the sample.

Acknowledgments We are grateful to Drs. Blandine Comte and James Armitage for their expert advice. This work was supported by grants from Fonds de la Recherche en Sant´e du Qu´ebec and Conseil de Recherches en Sciences Naturelles et G´enie du Canada. References 1. Barker, D.J. (1995) The fetal and infant origins of disease. Eur. J. Clin. Invest. 25, 457– 463. 2. Barker, D.J. (2004) Developmental origins of adult health and disease. J. Epidemiol. Community Health 58,114–115. 3. Roy-Clavel, E., Picard, S., St-Louis, J. and Brochu, M. (1999) Induction of intrauterine growth restriction with low-sodium diet fed to pregnant rats. Am. J. Obstet. Gynecol. 180, 608–613.

4. Battista, M.C., Oligny, L.L., St Louis, J. and Brochu, M. (2002) Intrauterine growth restriction in rats is associated with hypertension and renal dysfunction in adulthood. Am. J. Physiol. Endocrinol. Metab. 283, E124– E131. 5. Battista, M.C., Calvo, E., Chorvatova, A., Comte, B., Corbeil, J. and Brochu, M. (2005) Intrauterine growth restriction and the programming of left ventricular remodelling in female rats. J. Physiol. 565, 197–205.

Chapter 15 Assessment of Embryotoxicity Using Mouse Embryo Culture Louise M. Winn and Emily W.Y. Tung Abstract The mouse embryo culture technique is a valuable tool for assessing embryotoxicity of exogenous compounds as it excludes any confounding maternal and placental effects, allows for the selection of embryos that are at similar stages of development, and permits the control of exposure concentrations of exogenous agents and modifiers of interest. This chapter will use the anticonvulsant drug valproic acid as a model teratogen to describe the mouse embryo culture in detail. Briefly, mice are bred and the presence of a vaginal plug in a female mouse indicates gestational day (GD) 1. On GD 9 embryos are explanted from pregnant dams and embryos that are at similar stages of development (4–6 somite pairs) are cultured in CO2 saturated male rat serum for 24 h at 37◦ C. After 24 h embryonic morphological and developmental parameters, including anterior neuropore closure, are evaluated using a dissecting microscope. Additional biochemical analysis, including molecular approaches to assess embryonic signal transduction, as well as some limitations of the technique will also be discussed. Key words: Mouse embryo culture, embryotoxicity, valproic acid, morphological assessment.

1. Introduction Understanding the mechanisms of how exposure to xenobiotics during pregnancy causes birth defects would have tremendous health and social benefits. While there are several ways to assess the toxicological impact of in utero exposure to drugs and environmental chemicals, murine embryo culture has several advantages. These include the ability to directly control the concentration of xenobiotic exposure, knowledge of the exact developmental stage of the embryo, and the assessment of the embryonic contributions to the observed toxicological outcome. The use of post-implantation embryo culture methods was Julie Lafond and Cathy Vaillancourt (eds.), Human Embryogenesis: Methods and Protocols, vol. 550 © Humana Press, a part of Springer Science+Business Media, LLC 2009 DOI 10.1007/978-1-60327-009-0 15 Springerprotocols.com

241

242

Winn and Tung

greatly developed by the work of the New laboratory. Based on New’s methods (1, 2), we and others have used this approach extensively to help address questions of mechanisms of teratogenic action. In particular, embryo culture studies have provided strong evidence that, following exposure to the anticonvulsant drug phenytoin or valproic acid or the environmental xenobiotic benzo[a]pyrene, embryonic xenobiotic bioactivation results in the substantial formation of reactive oxygen species that can oxidize both DNA and protein (3–5). This damage ultimately leads to embryopathy which, in the case of phenytoin, valproic acid, and benzo[a]pyrene, can be completely abolished by the addition of either superoxide dismutase (SOD) or catalase to the embryo culture media (3–5). Our current studies use the post-implantation embryo culture approach, in combination with in vivo studies, in efforts to elucidate the mechanisms of how the anticonvulsant drug valproic acid initiates developmental toxicity. As will be discussed toward the end of this chapter, in these types of studies a number of molecular biological approaches can be used to assess the effects of teratogen exposures on specific embryonic cell signaling pathways.

2. Materials 2.1. Dissecting and Culture Media

1. 2. 3. 4.

Dulbecco’s Modified Eagle’s Medium (DMEM). Fetal bovine serum (FBS) (Hyclone, Logan, UT, USA). 1 M HEPES buffer, pH 7.4. Heat-inactivated male rat serum (Cocalico Biologicals, Reamstown, PA, USA) (see Note 1). 5. Hanks’ Balanced Salt Solution (HBSS). 6. Gas, 5% CO2 .

2.2. Embryo Explantation

1. CD-1 mice, females, and males (see Note 2). Males should be housed individually. 2. Gross anatomy probe. 3. 70% Ethanol. 4. Forceps and surgical scissors. 5. Watchmaker’s forceps no. 5. 6. Petri dishes. 7. Dissecting microscope with micrometer. 8. Sterile pipettes.

2.3. Culture Apparatus

1. Sterile culture tubes for embryos (see Note 3). 2. Incubator at 37◦ C. 3. Rotating apparatus (see Note 3).

Mouse Embryo Culture

243

3. Methods 3.1. Breeding and Timing of Mice

1. Female CD-1 mice are housed with male CD-1 mice at a 3:1 ratio from 17:00 h until 09:00 h. At 09:00 h, a gross anatomy probe is used to check for the presence of vaginal plugs. If a plug is observed, the time of pregnancy is denoted as GD 1 and pregnant females are separated from the colony.

3.2. Preparation of Dissecting and Culture Media

1. Dissecting medium is required in order to keep the embryos viable during the dissection process. For 1 L of medium, use 875 mL of DMEM, 100 mL of FBS, and 25 mL of 1 M HEPES, pH 7.4. The purpose of the FBS is to prevent the decidual tissues from getting too sticky during dissection. The medium should be warmed to 37◦ C before dissection of the embryos and maintained as close as possible to 37◦ C during dissection. The medium should be made fresh, however, it can be stored at 4◦ C for up to 2 weeks if HEPES is added at the time of use. 2. The culture medium is composed of 80% male rat serum and 20% HBSS. Medium is bubbled with 5% CO2 gas mixture for 30 min in a laminar flow hood or under sterile conditions and then warmed to 37◦ C before use (see Note 4). Culture medium can be stored at 4◦ C for up to 1 week.

3.3. Explantation of Embryos

1. On GD 9.0, sacrifice pregnant dams by cervical dislocation and spray the abdomen with 70% ethanol (Fig. 15.1). Using forceps, pull up skin in the lower abdomen and make an incision using surgical scissors. Then, cut through the peritoneum up toward the kidneys on both sides. Move the intestines and fat pads away to expose the two uterine horns. To remove the uteri, cut just under the oviducts and across the cervix. Remove any fat and place the uteri in warm dissecting medium in a Petri dish. 2. Using two pairs of watchmaker’s forceps, carefully tease uteri away to expose deciduas (Fig. 15.2). Use one pair of forceps to hold one-half of the mesometrial pole while using the other pair to peel away the other half. Carefully remove the parietal endoderm, trophoblast, and Reichert’s membrane. The yolk sac, amnion, and ectoplacental cone are left intact for culture. Embryos with 4–6 somites should be included for culture, while other embryos should be discarded. Dissection medium should be changed frequently during dissection.

3.4. Culture of Embryos

1. Embryos can be pooled and cultured in a large culture tube or individually in smaller tubes. Use 1.3 mL of culture

244

Winn and Tung

Fig. 15.1 Removal of uteri. Dams are sacrificed by cervical dislocation, followed by sterilization with 70% ethanol. Skin is tented and an incision is made in the lower abdomen. The abdomen is exposed and the uteri are found under the fat pads. Cut under the oviducts and across the cervix to free the uteri.

medium per embryo. In the case of valproic acid we add 0–0.6 mM valproic acid (dissolved in HBSS) directly into the embryo culture medium (see Note 5). Tubes should be rotated at 30 cycles/min for 24 h at 37◦ C. For teratological studies, a minimum of ten embryos from at least three different dams should be used in each treatment group. 3.5. Assessment of Embryotoxicity Using Morphological and Developmental Parameters

The embryotoxicity of a compound can be assessed morphologically by using an established developmental scoring system to compare control embryos to embryos that were exposed to the compounds in question. This scoring system has been previously described in detail (6), however, the parameters that we use are outlined in Fig. 15.3. In the case of valproic acid, we have found that embryos exposed to valproic acid have decreased yolk sac diameter, crown rump length, and somite numbers (5). In addition, fewer exposed embryos

Mouse Embryo Culture

245

Fig. 15.2 Dissection, extraction, and culture of embryos.

have turned and more embryos have open anterior neuropores compared to nonexposed controls (5). 3.6. Molecular Techniques for the Examination of Signaling Pathways

There are numerous molecular techniques and tools that can be used in combination with morphological analysis of embryos to help tease out specific signaling pathways that may be affected by xenobiotic exposures. The specific details of each technique are described elsewhere and while not all-inclusive, include 1. Western blotting techniques. We and others have used Westerns to examine the specific changes in embryonic

246

Winn and Tung

Fig. 15.3 Selection of developmental and morphological parameters. After the 24 h culture period, viability is assessed by the presence of a heartbeat, and only embryos that are viable should be included in further assessment. Yolk-sac diameter is measured using a micrometer at the widest point perpendicular to the ectoplacental cone. Crownrump length can also be measured and somite number counted. The culture period starting from GD 9 to GD 10 encompasses a number of developmental hallmarks that can be used to assess the embryotoxicity of a given compound, including embryo turning and anterior neuropore closure.

proteins after exposure to several teratogens using the post-implantation embryo culture model (4, 7, 8). In this approach embryos are typically pooled after various exposure time points (i.e., 4, 12, or 24 h) and homogenized in a lysis buffer containing protease inhibitors. Antibodies to various proteins including those involved with apoptotic signaling are becoming widely available commercially. In addition to changes in protein levels, alterations in protein status can also be measured using the antibody approach. For example, levels of oxidized proteins can be measured (4) and the phosphorylation status of embryonic proteins can be determined either using commercially available antibodies to specific phosphorylated proteins (8) or by purifying phosphorylated embryonic proteins using the Qiagen PhosphoProtein Purification Kit (Qiagen) (9). 2. Immunohistochemical analysis. Similar to Western blot analysis, several groups have used immunohistochemical analysis to assess the embryonic protein changes in specific areas of the embryo (7, 8). In these experiments, after culture and exposure to a given teratogen, embryos are typically fixed and paraffin embedded to allow for embryonic tissue sections to be made. Following tissue mounting onto microscope slides and incubation with antibodies, tissue-specific changes in protein expression can then be observed.

Mouse Embryo Culture

247

3. Antisense oligonucleotides. The short sequences of DNA designed to inhibit the expression of a specific protein has been used by several laboratories to investigate the role of specific proteins in mediating teratogenesis. For example, antisense to E-cadherin in embryo culture led to increased neural tube defects in exposed embryos compared to controls exposed to nonsense oligonucleotides (10), demonstrating the importance of E-cadherin during development. Similarly, Kennedy et al. (11) used antisense to NF-␬B in embryo culture to show the importance of NF-␬B signaling in phenytoin-initiated teratogenesis. In this specific experiment, control sense and nonsense oligonucleotides were dissolved in sterile phosphate-buffered saline and added directly to the embryo culture media. 4. Real-time reverse transcriptase PCR (RT-PCR). Teratogens may act by altering the expression of embryonic mRNA, which can be assessed using RT-PCR. For example, Hosako et al. (8) used RT-PCR analysis to assess the effects of 4-hydroperoxycyclophosphamide on embryonic mRNA expression and Yamada et al. (12) used a similar approach to assess the effects of alcohol exposure on mRNA expression from cultured embryos. 5. Embryo culture using genetically engineered animals. The post-implantation embryo culture method can be used with genetically engineered mice. The background strains for these animals typically come from inbred mouse strains, which tend to have smaller litter sizes and embryos that are generally smaller than outbred embryos. Together this makes culturing these embryos a bit more challenging, however, several laboratories are using this technique including the Wells’ laboratory which has used this approach to assess the importance of the ataxia-telangiectasia gene product, nitric oxide synthase, and NF-␬B activation in ROSmediated embryotoxicity (11, 13, 14). Other molecular approaches include the electrophoretic mobility shift assay to assess DNA binding ability, activation of apoptotic pathways through the use of caspase activation assays, and microarray analysis to assess global gene changes after teratogen exposure. 3.7. Limitations

While murine embryo culture does have several advantages, there are also some limitations to the techniques. One of the biggest limitations is that this technique removes any maternal influences from the effects that may be observed after exposure to a given teratogen. This is generally addressed by combining other in vivo approaches with embryo culture experiments, however, the relationship between embryonic effects seen following exposures in vitro and anomalies of the newborn are not always completely

248

Winn and Tung

clear. Other limitations include the fact that the route of teratogen exposure is not representative of the in vivo situation and that the culture period only represents a relatively brief period of organogenesis. Finally, while the embryo culture technique is not overly difficult, it does require patience and precision and can be quite labor intensive.

4. Notes 1. Male rat serum contains undefined nutrients and factors that enhance the survival and growth of mouse embryos. Male rat serum can be collected from retired CD-1 male rat breeders as previously described (3, 4) or purchased commercially. Serum must be heat inactivated to ensure that complement is inactivated to prevent a complement-immune response. 2. CD-1 mice are used in most of our studies due to their larger size and ease of breeding. Several other laboratories use Swiss-Webster mice. Other strains are A/J, C57B/6N, and others, while smaller can also be cultured. This is particularly relevant in the case of culturing genetically engineered strains and may be necessary based on known strain differences in susceptibility to different agents. 3. Various apparatuses are available for rotation of embryos. In our laboratory, we culture mouse embryos individually in 2-mL microfuge tubes and use a hybridization oven for rotation. Other apparatuses include bench top roller systems that can be placed inside standard incubators, such as the Wheaton W348923-A. 4. To bubble the media we use a sterile glass Pasteur pipette inserted into polyurethane tubing which is attached to a gas tank that is close to a laminar flow hood. It is important to regulate the flow of gas as the media will overflow if the rate of bubbling is too rapid. 5. At this stage of the procedure modulators of bioactivation/detoxification can be added to the embryo culture media. For example, in studies by Miranda et al. (15) varying concentrations of 5,8,11,14-eicosatetraynoic acid (a peroxidase inhibitor) were added to the embryo culture media to evaluate the role of peroxidase-catalyzed bioactivation in phenytoin-initiated embryotoxicity. References 1. New, D.A.T. (1978) Whole embryo culture and the study of mammalian embryos during organogenesis. Biol. Rev. 53, 81–122.

2. New, D.A.T. (1991) The culture of postimplantation embryos. Hum. Repro. 6, 58–63.

Mouse Embryo Culture 3. Winn, L.M. and Wells, P.G. (1995) Phenytoin-initiated DNA oxidation in murine embryo culture, and embryo protection by the antioxidative enzymes superoxide dismutase and catalase: evidence for reactive oxygen species-mediated DNA oxidation in the molecular mechanism of phenytoin teratogenicity. Mol. Pharmacol. 48, 112–120. 4. Winn, L.M. and Wells, P.G. (1997) Evidence for embryonic prostaglandin H synthasecatalysed bioactivation and reactive oxygen species-mediated oxidation of cellular macromolecules in phenytoin and benzo[a]pyrene teratogenesis. Free Rad. Biol. Med. 22, 607–621. 5. Tung, E.W.Y. and Winn, L.M. The antioxidative enzyme catalase protects against neural tube defects induced by valproic acid. Proceedings of the 11th International Congress of Toxicology, Montreal, July 2007. Abstract PM6.256. 6. Brown, N.A. and Fabro S. (1981) Quantitation of rat embryonic development in vitro: a morphological scoring system. Teratology 24, 65–78. 7. Soleman, D., Cornel, L., Little, S.A. and Mirkes, P.E. (2003) Teratogen-induced activation of the mitochondrial apoptotic pathway in the yolk sac of day 9 mouse embryos. Birth Defects Res. A. Clin. Mol. Teratol. 67, 98–107. 8. Hosako, H., Little, S.A., Barrier, M. and Mirkes, P.E. (2007) Teratogen-induced activation of p53 in early postimplantation mouse embryos. Toxicol. Sci. 95, 257–269. 9. Wan, J. and Winn, L.M. (2008) In utero exposure to benzene increases embryonic c-

10.

11.

12.

13.

14.

15.

249

Myb and Pim-1 protein levels in CD-1 mice. Toxicol. Appl. Pharmacol. 228, 326–333. Chen, B. and Hales, B.F. (1995) Antisense oligonucleotide down-regulation of Ecadherin in the yolk sac and cranial neural tube malformations. Biol. Reprod. 53, 1229–1238. Kennedy, J.C., Memet, S. and Wells, P.G. (2004) Antisense evidence for nuclear factor␬B-dependent embryopathies initiated by phenytoin-enhanced oxidative stress. Mol. Pharmacol. 66, 404–412. Yamada, Y., Nagase, T., Nagase, M. and Koshima, I. (2005) Gene expression changes of sonic hedgehog signaling cascade in a mouse embryonic model of fetal alcohol syndrome. J. Craniofac. Surg. 16, 1055–1061. Bhuller, Y. and Wells, P.G. (2006) A developmental role for ataxia-telangiectasia mutated in protecting the embryo from spontaneous and phenytoin-enhanced embryopathies in culture. Toxicol. Sci. 93, 156–163. Kasapinovic, S., McCallum, G.P., Wiley, M.J. and Wells, P.G. (2004) The peroxynitrite pathway in development: phenytoin and benzo[a]pyrene embryopathies in inducible nitric oxide synthase knockout mice. Free Radic. Biol. Med. 37, 1703–1711. Miranda, A.F., Wiley, M.J. and Wells, P.G. (1994) Evidence for peroxidase-catalyzed bioactivation and glutathione-dependent cytoprotection in phenytoin teratogenicity: modulation by eicosatetraynoic acid and buthionine sulfoximine in murine embryo culture. Toxicol. Appl. Pharmacol. 124, 230–241.

Chapter 16 Fertilization In Vitro Yinzhong Bing and Rodney J. Ouellette Abstract In vitro fertilization (IVF) is a technical process in which retrieved oocytes are fertilized outside the body. The developing embryos grow in a laboratory environment and are subsequently transferred into the woman’s uterus. The IVF technique was first introduced as a treatment for infertility in 1978 and success rates have steadily increased in the subsequent decades. Many factors have contributed to the improvement of IVF including the advent of novel techniques and laboratory procedures, such as sperm treatment, intracytoplasmic sperm injection (ICSI), embryo culture, cryopreservation, and pre-implantation genetic diagnosis (PGD). This chapter will review the commonly employed laboratory procedures and include perspectives on how to maximize success rates via efficient laboratory procedures and technology. The purpose is to provide relevant information that will continue to evolve IVF technology as an accessible, effective, and safe treatment for infertility. Key words: In vitro fertilization, intracytoplasmic sperm injection, embryo culture, cryopreservation and transfer, pre-implantation genetic diagnosis.

1. Introduction The first baby to be born using in vitro fertilization (IVF) technique was Louise Brown, in 1978 in UK (1). Since then, an abundance of breakthroughs in both clinical medicine and basic science have allowed countless infertile couples to have their own genetic offspring. An estimated three million children have been born worldwide (2). IVF is a complex process and involves multiple steps resulting in the fertilization of oocytes in the laboratory. The embryos generated in this process are then placed into the uterus for potential implantation. Undoubtedly, the improved and optimized Julie Lafond and Cathy Vaillancourt (eds.), Human Embryogenesis: Methods and Protocols, vol. 550 © Humana Press, a part of Springer Science+Business Media, LLC 2009 DOI 10.1007/978-1-60327-009-0 16 Springerprotocols.com

251

252

Bing and Ouellette

procedures, as well as the significant technological advances have contributed to increasing success with IVF (3). Today although IVF technology is available throughout most of the world, the practice and success rate are largely different from clinic to clinic. Refinements in laboratory technology and clinical practice will continue to enhance the success of this procedure. In addition, many changes can occur during embryo development in vitro which can lead to situations where adjustments in protocols and/or culture conditions may be required. In certain cases, the use of related laboratory techniques, such as intracytoplasmic sperm injection (ICSI), embryo cryopreservation, and preimplantation genetic diagnosis (PGD) may also become necessary. This chapter will review the common IVF laboratory procedures including sperm preparation for IVF and ICSI, oocyte retrieval and insemination, embryo culture and transfer, embryo cryopreservation, and PGD-chromosomal analysis techniques.

2. Materials All media are purchased from Vitrolife, Inc., USA and stored in dark at 2–8◦ C, except specially mentioned. All containers, such as dishes, tubes, pipettes, and catheters, should be pre-rinsed using G-RINSE solution in order to ensure that there is no particulate matter or residual noxious substances. 2.1. Sperm Preparation for IVF and ICSI

1. G-MOPS, a medium for handing gametes outside the incubator, is supplemented with 5% human serum albumin (HSA) and warmed at 37◦ C prior to use for sperm washing. 2. SpermRinse, a bicarbonate and HEPES-buffered medium containing HSA, is pre-equilibrated at 37◦ C for sperm swimup and washing. 3. SpermGradTM , a density-gradient stock solution, is mixed with SpermRinse to obtain 90 and 45% gradient solutions and warmed at 37◦ C prior to use.

2.2. Oocyte Retrieval and Insemination

1. Pre-warmed G-MOPS supplemented with pharmaceutical grade heparin 8.0–10.0 U/mL (Pharmaceutical Partners, ON, Canada) for follicle aspiration. 2. G-MOPS supplemented with 10% HSA is prepared and warmed at 37◦ C for oocyte collection and washing. 3. For an IVF case, place 2.5 mL of G-FERT Plus (fertilization medium) into the two 30-mm pre-rinsed Petri dishes and incubate at 37◦ C and 6% CO2 overnight. For an ICSI case, use G-1 Plus (a medium for the development of cleavage embryos) in place of G-FERT Plus.

Fertilization In Vitro

253

4. Prepare microdrops with 90 ␮L of G-FERT Plus covered by OVOIL (a ultrapure paraffin oil) and pre-equilibrate at 37◦ C and 6% CO2 overnight for insemination (ICSI case, use G-1 Plus in place of G-FERT Plus). 5. Enzymatic solution: Dissolve 100 mg of hyaluronidase 300 U/mg (Hyase, type III; Sigma) with G-MOPS to obtain a concentration of 800 IU/mL stock and store at −20◦ C. 6. ICSITM (PVP: polyvinylpyrrolidone): A solution for immobilization and isolation of sperm prior to ICSI. 7. Falcon dish (no. 1006) is used for ICSI operation. 8. Flexipet denuding pipettes with different diameters, 130, 140, and 170 ␮m (Cook, USA), are used to denude oocytes before ICSI. 2.3. Embryo Culture and Transfer

1. Prepare microdrops with 50 ␮L of G-1 Plus covered by OVOIL and pre-equilibrate at 37◦ C and 6% CO2 overnight for cleavage embryo culture. 2. Prepare EmbryoGlue or G-2 Plus without oil covering and pre-equilibrate at 37◦ C and 6% CO2 overnight for embryo transfer.

2.4. Embryo Cryopreservation 2.4.1. Cleavage Embryo Cryopreservation

G-MOPS supplemented with 10% HSA is used as a base medium for embryo freezing and thawing. 1. Freezing solutions a. Embryo freezing solution 1 (EFS1): 1.5 M 1.2propanediol (PROH) (Sigma). b. Embryo freezing solution 2 (EFS2): 1.5 M PROH, 0.1 M sucrose (Sigma). 2. Thawing solutions a. Embryo thawing solution 1 (ETS1): 1.0 M PROH, 0.2 M sucrose. b. Embryo thawing solution 2 (ETS2): 0.5 M PROH, 0.2 M sucrose. c. Embryo thawing solution 3 (ETS3): 0.2 M sucrose.

2.4.2. Blastocyst Cryopreservation

G-MOPS supplemented with 10% HSA is used as a base medium for blastocyst freezing and thawing. 1. Freezing solutions a. Blastocyst freezing solution 1 (BFS1): 5% glycerol (Sigma). b. Blastocyst freezing solution 2 (BFS2): 10% glycerol, 0.2 M sucrose. 2. Thawing solutions a. Blastocyst thawing solution 1 (BTS1): 10% glycerol, 0.2 M sucrose.

254

Bing and Ouellette

b. Blastocyst thawing solution 2 (BTS2): 5% glycerol, 0.1 M sucrose. c. Blastocyst thawing solution 3 (BTS3): 0.1 M sucrose. 2.5. PGDChromosomal Analysis 2.5.1. Embryo Biopsy and Blastomere Fixation

1. Ca2+ /Mg2+ -free phosphate-buffered saline (PBS), acid Tyrode, sodium citrate, methanol, acetic acid, and pepsin (Sigma). 2. Hypotonic solution: 1% sodium citrate, 0.6% HSA (w/v) in distilled water (dH2 O) and store at 4–5◦ C. 3. Fixation solution: methanol:acetic acid as 3:1, store at −20◦ C and use within 2 h.

2.5.2. Fluorescence In Situ Hybridization (FISH)

1. Antifade II, DAPI (4,6-diamidino-2-phenylindole), NP-40, and DNA probes including Multivysion PB, CEPX (DXZ1), CEPY (DYZ1), and CEP18 (D18Z1) (Vysis, Downer’s Grove, IL, USA). 2. 20 × Saline sodium citrate (SSC): Dissolve 132 g 20 × SSC in 400 mL distilled H2 O (dH2 O) and mix thoroughly. Adjust pH at room temperature to 5.3 and adjust the volume to 500 mL with dH2 O. Filter through a 0.45-␮m filtration unit. Store up to 6 months at room temperature. 3. 2 × SSC/0.1% NP-40: Add 100 mL 20 × SSC, pH 5.3, to 850 mL dH2 O, and then add 1.0 mL NP-40. Adjust pH to 7.0–7.5 and add H2 O to bring final volume of the solution to 1 L. Store up to 6 months at room temperature. 4. 0.4 × SSC/0.3% NP-40 wash solution: Mix thoroughly 20 mL of 20 × SSC with 950 mL of dH2 O. Add 3 mL of NP40 and mix thoroughly until NP-40 is dissolved. Adjust pH to 7.0–7.5 and add H2 O to bring final volume to 1 L. Store up to 6 months at room temperature. Discard them if solutions appear cloudy or contaminated.

3. Methods 3.1. Sperm Preparation for IVF and ICSI

Sperm preparation is a procedure by which potentially fertile sperm are separated from the seminal plasma, immotile sperm, debris, and other cells in the laboratory. Two techniques for sperm separation are widely used: the swim-up (migration) method and density gradient centrifugation method. Usually, the choice of separation method used will depend on the ejaculate quality, previous semen analysis, as well as the choice of fertilization procedure either IVF or ICSI. If the sperm concentration and motility are adequate, the swim-up technique can be performed.

Fertilization In Vitro

255

If semen quality is poor and includes large number of other cells, density gradient centrifugation is preferred. 3.1.1. Swim-Up Procedure

1. After the semen sample liquefies in approximately 30 min at room temperature, perform a sperm assessment to decide the optimal separation method to use. If the sample does not liquefy, it should be passed through a 23 gauge needle. 2. Pipet 1.0 mL of semen into a rinsed tube. Carefully overlay 2.0 mL of pre-equilibrated SpermRinse. Place the swim-up tubes in an angled position in the incubator at 37◦ C and 6% CO2 for 60 min to allow progressively motile sperm to swim into the overlaid medium. 3. Aspirate the top medium (up to 80% of the supernatant) without touching the underlying semen and deposit into a labeled collection tube. Add 5.0 mL of equilibrated SpermRinse and centrifuge at 300–500g for 10 min. 4. Discard the supernatant and resuspend the pellet in 5.0 mL of fresh medium (G-FETR Plus for IVF; G-MOPS + 5% HSA for ICSI) and repeat the centrifugation at 300–500g for 10 min. 5. Remove the supernatant and resuspend the pellet in 0.3–1.0 mL of fresh medium according to sample quality. 6. Calculate the volume, sperm count, motility, and morphology on counting chamber.

3.1.2. Density Gradient Centrifugation

1. Pipet 1.0 mL of 90% gradient solution into the tube first and then slowly pipet 1.0 mL of 45% gradient solution on top of it. 2. Gently add the semen sample on the top of the gradient solution and centrifuge at 300–500g for 20 min. 3. Remove the two top layers and take care not to leave any residues on the tube wall. Transfer the sperm pellet with as little of the 90% solution as possible to another tube with 5 mL of pre-warmed G-MOPS + 5% HSA. 7. Centrifuge at 300–500g for 10 min. 8. Aspirate and discard the supernatants. Wash or resuspend the sperm pellet according to your requirement (G-FERT Plus for IVF; G-MOPS + 5% HSA for ICSI).

3.1.3. Sperm Preparation for IVF and ICSI 3.1.3.1. IVF Case

1. After washing with G-FETR Plus, discard the supernatants and resuspend the pellet in 0.5–2.0 mL of pre-equilibrated G-FETR Plus, depending on sample quality. 2. Determine sperm concentration and motility and equilibrate at 37◦ C and 6% CO2 for at least 2 h.

256

Bing and Ouellette

3. Dilute the equilibrated sperm sample to a concentration of 5 × 106 /mL stock using G-FETR Plus before insemination. 3.1.3.2. ICSI Case

3.2. Oocyte Retrieval and Insemination

3.2.1. Oocyte Retrieval and Culture

1. After washing with G-MOPS + 5% HSA, discard the supernatants and resuspend the pellet in 0.1–1.0 mL of prewarmed G-MOPS + 5% HSA and place it at room temperature until the ICSI procedure. Oocyte retrieval is performed approximately 34–36 h after the injection of human chorionic gonadotropin (hCG). The procedure is performed by transvaginal ultrasound-guided needle aspiration, under conscious sedation. The fluid-filled follicles, each hopefully containing an egg, are punctured and aspirated. The follicular fluids are collected into tubes and quickly transferred to the laboratory where each is examined under the microscope for the presence of oocyte with its accompanying cumulus mass of granulosa cells. The oocytes are then placed in a culture medium and incubated at 37◦ C for 3–6 h. From 2,000 to 5,000 motile sperm are added to the oocyte in a small drop of media (a final concentration of 20,000–50,000 motile sperm/mL) (4) or by direct injection of a single sperm into the oocyte using ICSI technique. Fertilization can be evaluated 16–18 h later by the presence of a male and a female pronucleus in approximately 60–90% of the oocytes. Lower fertilization rates may suggest intrinsic defects in one or both of the gametes. 1. Identify the patient’s name and check the temperature and humidity in the IVF chamber. 2. Ensure that all materials that may come in contact with the oocytes, such as the warm plates and blocks, the collection tubes, and dishes, are pre-warmed. 3. Pre-warmed G-MOPS with heparin (8.0–10.0 U/mL) is used for oocyte collection. 4. After follicular aspiration, move the follicular fluid to laboratory and transfer to an empty dish and examine immediately under microscope. 5. Identify the oocyte and surrounding cumulus/corona radiata complex and immediately place them in the dish containing pre-warmed G-MOPS supplemented with 10% HSA. 6. Rinse the cumulus–oocyte complexes in G-MOPS supplemented with 10% HSA to remove blood cells and debris and then wash in equilibrated G-FERT Plus (G-1 Plus in place of G-FERT Plus in ICSI case). 7. Transfer the oocytes to the culture dishes with equilibrated G-FERT Plus (IVF) or G-1 Plus (ICSI) and return to the incubator immediately. 8. Oocytes are cultured for 3–6 h before insemination.

Fertilization In Vitro

257

3.2.2. Oocyte Insemination

1. After oocytes are cultured for 3–6 h, a 4–10 ␮L of 5 × 106 /mL sperm stock, based on sperm characteristics, is added to a 90 ␮L of insemination drop covered by OVOIL. 2. Leave the dishes in incubator at 37◦ C, 5% O2 , and 6% CO2 for 16–18 h.

3.2.3. Oocyte Preparation for ICSI

1. Place 0.45 mL of G-MOPS + 10% HSA into 4-well dish (37◦ C), and add 50 ␮L of Hyase stock into the first well to obtain a final concentration of 80 IU/mL of Hyase solution. 2. Using a large bore glass pipette, place 3–5 oocytes into the Hyase solution for 30 s (see Note 1). 3. Move the oocytes to the second well (no Hyase) and quickly remove cumulus cells by gently aspirating up and down several times through a diameter of 170-␮m denuding pipette. 4. Remove the majority of corona cells through a diameter of 130–140 ␮m denuding pipette depending on the oocyte size (see Note 2). 5. Rinse the oocytes through the two remaining wells of G-MOPS + 10% HSA and separate mature and immature oocytes according to the presence of the polar body. 6. Place mature (metaphase II, MII) and immature (metaphase I, MI, and germinal vesicle stage, GV) oocytes into culture drops with G-1 Plus, respectively, and return to incubator for 1–2 h of further culture.

3.2.4. ICSI Procedure

1. Place 5 ␮L of ICSI (PVP) solution in the center of Falcon dish and then pipet 0.5–0.8 ␮L of sperm suspension washed with G-MOPS + 5% HSA into the ICSI droplet. 2. Place 5 ␮L droplets of G-MOPS + 10% HSA around the ICSI droplet and quickly cover with OVOIL and warm dishes at 37◦ C. 3. Place one MII oocyte per droplet and start to perform ICSI procedure. 4. Choose a morphologically normal sperm that is swimming at 90◦ to the injection pipette along the bottom of the drop. 5. Immobilize the sperm by striking the top of the tail just behind the midpiece with the injection pipette and gently rubbing the trapped sperm on the bottom of the dish. 6. Aspirate the sperm, tail first, into the injection pipette. Aspirate in and out of the pipette several times to ensure it moves freely and does not get stuck inside the pipette. 7. Lift the injection pipette containing the sperm from the bottom of the dish and move to a droplet containing an oocyte.

258

Bing and Ouellette

8. Immobilize the MII oocyte by applying slight suction to the holding pipette. Position the oocyte so that the polar body is at 12 or 6 o’clock. 9. Move sperm to the end of the injection pipette and puncture the zona pellucida and oolemma at 3–4 o’clock. 10. Aspirate the oolemma membrane into the pipette until it ruptures and then inject the sperm with as little medium as possible. 11. Withdraw the injection pipette gently and release the oocyte from the holding pipette. 12. Rinse the oocytes through G-1 Plus and transfer to the equilibrated post-ICSI dish with 50 ␮L droplets of G-1 Plus (see Note 3). 3.2.5. Fertilization Assessment

3.3. Embryo Culture and Transfer

3.3.1. Cleavage Stage Embryo Culture

1. Following insemination of 16–18 h, transfer the oocytes to a dish with pre-warmed G-MOPS supplemented with 10% HSA and remove cumulus and corona cells using a denudation pipette (in ICSI case, after 16–18 h of ICSI, transfer oocytes to pre-warmed G-MOPS supplemented with 10% HSA for evaluation). 2. Observe and evaluate oocyte fertilization under microscope and record the number of pronuclei, polar bodies, and the other presences, such as MI, GV oocytes. The fertilized oocytes with two pronuclears (2 PN) are assessed as normal fertilization, oocytes with only 1 PN, and with more than 2 PN are considered to be abnormal fertilization and derived from 2 PN oocytes (Fig. 16.1). Embryo culture is the term used to describe the process following oocyte fertilization. Once the fertilized oocyte (known as a zygote) is formed, the culture process will continue in order to encourage the development of the zygote into a cleavage stage of embryo (Days 2–3), or blastocyst stage (Days 5–6), depending on when embryo transfer will be performed. Setting up the optimal in vitro culture conditions based on embryo’s nutrient and environmental requirements and selecting the high quality embryos for transfer are vital to the success of the IVF procedure. 1. After fertilization assessment, rinse the fertilized oocytes thoroughly in several droplets of equilibrated G-1 Plus and then transfer 3–5 fertilized oocytes to a 50 ␮L droplet of equilibrated G-1 Plus (see Note 3). 2. Place the culture dish in the incubator immediately. 3. Observe embryo development and change the culture media in the afternoon of Day 2 (see Note 4). 4. On Day 3, select the best embryos (see Section 3.3.2) and transfer to the uterus in equilibrated EmbryoGlue or in equilibrated G-2 Plus. Alternatively, on Day 3, transfer the

Fertilization In Vitro

259

a

b

c

d

Fig. 16.1 Fertilization assessment. (a) MII oocyte, no fertilization; (b) normal fertilization, 2 PN; (c) abnormal fertilization, 1 PN; (d) abnormal fertilization, 3 PN.

remaining embryos to equilibrated G-2 Plus for further culture to the blastocyst stage or cryopreservation. 3.3.2. Day 3 Embryo Assessment

3.3.3. Blastocyst Culture

Embryos are divided into classes, depending on several morphological parameters which are evaluated in the morning of Day 3 (see Note 5). Grade 4 – the number of blastomeres should be greater than six, with equal size, fragmentation is less than 10%. Grade 3 – the number of blastomeres is greater than six, with unequal size, fragmentation is between 10 and 25%. Grade 2 – the number of blastomeres is between four and five, fragmentation is less than 10% or the number of blastomeres is greater than six, with equal or unequal size, fragmentation between 25 and 40%. Grade 1 – the number of blastomeres is between four and five, fragmentation is more than 10% or the number of blastomeres is greater than six, with unequal size, fragmentation is more than 40%. 1. In the morning of Day 3, the embryos are assessed and washed through the equilibrated G-2 Plus and then 3–5

260

Bing and Ouellette

embryos are transferred into a droplet of 50 ␮L equilibrated G-2 Plus. Return the dish to the incubator immediately. 2. On Day 5, embryos are evaluated and one or two top quality blastocysts are selected and moved to the equilibrated EmbryoGlue or G-2 Plus for transfer. The remaining good quality blastocysts will be cryopreserved. 3. If the blastocysts have not developed by Day 5, the embryos should be moved into a fresh droplet of equilibrated G-2 Plus for further culture and assessed on Day 6. 3.3.4. Blastocyst Assessment

Blastocyst quality is usually measured based on blastocoel expansion, development of inner cell mass (ICM), development of trophectoderm (TE), and state of the zona pellucida (5). A topquality blastocyst is classified as ≥3AA. 1. Blastocyst a. Grade 1 – early blastocyst, blastocoel is less than half embryo volume. b. Grade 2 – blastocyst, blastocoel size is half or more of embryo volume. c. Grade 3 – full blastocyst, blastocoel completely fills embryo volume. d. Grade 4 – expanded blastocyst, blastocoel volume is larger than in early embryo, thining zona. e. Grade 5 – hatching blastocyst, TE cells herniate through zona. f. Grade 6 – hatched blastocyst, blastocyst completely escaped from zona. 2. ICM scoring for blastocysts at grades 3–4 a. Grade A – tightly packed and many cells. b. Grade B – loosely grouped, several cells. c. Grade C – very few cells. 3. TE scoring for blastocysts at grades 3–4 a. Grade A – many cells forming a cohesive epithelium. b. Grade B – few cells forming a loose epithelium. c. Grade C – very few and large cells.

3.3.5. Embryo Transfer

Embryo transfer is the process where the embryos are placed into the uterus. This is usually performed using either equilibrated EmbryoGlue or equilibrated G-2 Plus. Embryos may be transferred on Day 2 (40–48 h post-insemination) or Day 3 (66–74 h post-insemination), or at the blastocyst stage on Days 5–6 (120– 144 h post-insemination). The different stages of embryos for transfer are shown in Fig. 16.2. 1. Add 1 mL of EmbryoGlue to the well, 2 mL of EmbryoGlue to the moat of a rinsed 1-well dish. Pre-equilibrate the dish in 37◦ C and 6% CO2 overnight. 2. Move embryos to the well containing EmbryoGlue for a minimum of 10 min prior to embryo transfer.

Fertilization In Vitro

261

a

b

c

d

Fig. 16.2 Embryo development after IVF; (a) 4-cell stage, Day 2; (b) 8-cell stage, Day 3; (c) blastocyst stage, Day 5; (d) expended blastocyst, Day 6.

3. Rinse the 1 mL non-toxic syringe by drawing up and out media from the moat several times until no air bubbles are observed in the syringe. Draw up approximately 0.5 mL of the media from the moat. 4. Firmly attach the transfer catheter to the syringe. Flush approximately 0.5–1.0 mL of equilibrated transfer medium from the moat through and out of the catheter. 5. After rinsing, draw approximately 0.1 mL of EmbryoGlue from the center well and expel into the moat and leave 20 ␮L of media in syringe. 6. Under microscope, gently load the embryos into the catheter in approximately 5–10 ␮L of additional EmbryoGlue followed by a small amount of air. 7. For the embryo transfer, pass the tip of the catheter into the uterus approximately 1 cm from the top of the cavity and expel the embryos in a total volume of approximately 25–30 ␮L of medium (see Note 6). 8. Slowly withdraw the catheter while maintaining steady pressure on the plunger of the syringe. 9. Check catheter for any remained embryos under microscope.

262

Bing and Ouellette

3.4. Embryo Cryopreservation

Embryo cryopreservation is the process of freezing, storage, and thawing of pre-implantation embryos. It involves an initial exposure to cryoprotectants, cooling to subzero temperature, storage, thawing, and finally, dilution and removal of the cryoprotectants, with a return to a physiological environment that will allow subsequent development. Proper management of the osmotic pressure to avoid damage due to intracellular ice formation is crucial for a successful freezing and thawing procedure. In addition, embryonic membrane permeability to cryoprotectants varies according to the different developmental stages. Usually, PROH is used for freezing of early cleavage embryo (2–8 cell stage at Days 2–3 post-insemination), glycerol is used for blastocyst freezing (Days 5–6 post-insemination).

3.4.1. Cleavage Embryo Freezing

3.4.1.1. Freezing

1. Pre-equilibrate freezing solutions at room temperature. 2. Place cleavage embryos into G-MOPS supplemented with 10% HSA for 2–5 min. 3. Gently move embryos to EFS1 for 10 min. Embryos will shrink and then re-equilibrate. 4. Carefully transfer embryos into EFS2 for a total of 10 min, including loading of embryos into straw. 5. Place sealed straws into the FREEZE CONTROL at room temperature. 6. Cool at rate of −2◦ C/min until −7◦ C. 7. Hold for 1 min, manual seed with cold forceps, and hold for 9 min. 8. Continue cooling at −0.3◦ C/min until −30◦ C. 9. Plunge straws into liquid nitrogen.

3.4.1.2. Thawing

1. Move straw from liquid nitrogen and thaw at room temperature for 30 s. 2. Warm straw in 30◦ C water bath for 30–60 s. Remove and carefully wipe. Do not shake and make air bubbles. 3. Gently expel the embryos into the ETS1 and incubate for 5 min at room temperature. 4. Gently move the embryos to ETS2 for 5 min. 5. Gently move the embryos to ETS3 for 5 min. 6. Place the embryos in G-MOPS supplemented with 10% HSA at room temperature for 5–10 min. 7. Transfer the thawed embryos to G-2 Plus for 2–3 h of culture before embryo transfer.

Fertilization In Vitro

263

3.4.2. Blastocyst Freezing 3.4.2.1. Freezing

1. Place blastocysts into G-MOPS supplemented with 10% HSA for 2–5 min at room temperature. 2. Gently move blastocysts to BFS1 for 10 min. 3. Transfer blastocysts into BFS2 for 7–10 min. 4. Load blastocysts into freezing straws and place sealed straws into the FREEZE CONTROL. 5. Cool at a rate of −2◦ C/min to −7◦ C. 6. Manual seed with cold forceps and hold for 10 min. 7. Further cooling at −0.3◦ C/min to −36◦ C and then hold for 15 min. 8. Plunge straws into liquid nitrogen.

3.4.2.2. Thawing

1. Move straw from liquid nitrogen and thaw at room temperature for 30 s. 2. Warm straw in 30◦ C water bath for 30–60 s. 3. Expel blastocysts into BTS1 for 3 min at room temperature. 4. Gently move blastocysts into BTS2 for 3 min. 5. Gently move blastocysts into BTS3 for 2 min. 6. Move blastocysts into G-MOPS supplemented with 10% HSA for 5 min. 7. Transfer blastocysts to G-2 Plus for 2–3 h of culture before blastocyst transfer.

3.5. PGDChromosomal Analysis

PGD is a process in which embryos obtained from IVF are tested for the specific genetic abnormalities and unaffected embryos are identified for transfer to the uterus. Most of the causes for the repeated unsuccessful IVF cycles and recurrent miscarriage are associated with chromosomal abnormalities in the transferred embryos. Fluorescent in situ hybridization (FISH) can be used for the determination of chromosomal abnormalities and also for the identification of sex to prevent transmission of X-linked diseases. The fluorescent probes labeled with different dyes can bind to the specific chromosomes in the embryo biopsy sample. The number of chromosomes of each type (color) present in the blastomeres is identified under a fluorescent microscope. The geneticist can thus distinguish normal ones from abnormal blastomeres, such as those with aneuploidy. The process includes embryo biopsy, blastomere fixation, and FISH.

3.5.1. Embryo Biopsy and Blastomere Fixation

1. Prepare biopsy dishes: Aliquot four 10–15 ␮L droplets of Ca2+ /Mg2+ -free PBS and a droplet with acid Tyrode solution covered with OVOIL on a Falcon-1006 dish. 2. Set up the micromanipulators with the holding, biopsy, and hatching pipettes. A double pipette holder carrying both the hatching and the biopsy pipettes is used.

264

Bing and Ouellette

3. Load hatching needle with acid Tyrode solution by attaching tubing to a 5 cc syringe – release pressure and let the equilibrium adjust by detaching syringe with tubing. 4. Identify an accessible blastomere containing a nucleus and rotate the embryo so the selected cell is at the 3 o’clock position. 5. Using acid Tyrode, make an artificial opening, 25–30 ␮m, in the zona at the 3 o’clock position. 6. Using a 35–45 ␮m biopsy needle, apply gentle suction to the exposed blastomeres and slowly aspirate the cell into the biopsy needle. Be careful not to rupture or disturb other cells. 7. Expel the blastomere and check that it has a nucleus. If it does not have a nucleus, remove another cell from the embryo. 8. Wash the embryo at least four times through empty droplets of G-2 Plus medium and return to a numbered G-2 Plus droplet until the time of diagnosis and possible replacement. 9. Aspirate blastomere into the pipette and move to another dish with two droplets of hypotonic solution (see Section 2.5.1). 10. Remove oil from the pipette in the first droplet and place blastomere into second droplet of hypotonic solution for 1–2 min. 11. Place a very small volume of hypotonic solution containing the blastomere onto the slide using a fine pooled glass micropipette. 12. Add one drop of the fixative while gently breathing on the slide in order to dry while maintaining humidity. 13. Demarcate cell location with carbide pencil and then add more fixative until the cytoplasm disappears. If excess cytoplasm is still present, the slide can be placed into a Coplin jar containing a solution of 1% pepsin for 5–30 s, depending on the amount of residual cytoplasm. 14. Confirm that the spreading of the nucleus is complete on upright microscope. 15. Dehydrate slide in 70, 85, and 100% methanol for 1 min each. 16. Allow slides to dry completely and then place in a slide box and seal in a zip-lock bag to maintain humidity and store in freezer until FISH. 3.5.2. FISH Procedure

3.5.2.1. Probe Preparation

1. At room temperature, mix hybridization buffer with different DNA probes (CEPX, CEPY, CEP18) and dH2 O. 2. Centrifuge for 1–3 s, vortex, and then recentrifuge.

Fertilization In Vitro

265

3. Premix MultiVysion PB probe in hybridization buffer. 3.5.2.2. Hybridization with Probes for Chromosomes X and Y

3.5.2.3. Hybridization with Probes for Chromosomes 13, 16, 18, 21, and 22

1. Set up program on HYBrite hybridization system, Melt Temp 73◦ C and Melt Time 8 min for the target and DNA probe denaturation, Hyb Temp 37◦ C and Hyb Time 2 h for hybridization process. Allow the HYBrite to warm 37◦ C. 2. Place the specimen slides on the HYBrite surface and apply 3 ␮L of prepared probe solution to the area on the slide where the cells are located. 3. Apply a 12-mm round coverslip over the target area immediately after applying the probe solution. 4. Cut a piece of parafilm and place it over the slide and coverslip. The parafilm keeps the probe solution from drying out during hybridization. 5. Close the lid of the HYBrite and start the melt/ hybridization program. 6. Remove the slides from HYBrite and remove parafilm and coverslip after the 2 h hybridization. 7. Immediately place slides in the jar containing 0.4 × SSC/0.3% NP-40 and incubate for 3 min. 8. Place slides in the jar containing 2 × SSC/0.1% NP-40 at room temperature, incubate for 1 min. 9. Place vertically in a dark area on a paper towel to dry completely. 10. Apply 3 ␮L of DAPI counterstain onto the target area and place a 12-mm coverslip over the counter stain solution with attention to avoid air bubble formation. 11. View slides using a suitable filter set. 1. Set up program on HYBrite, Melt Temp 73◦ C and Melt Time 5 min, Hyb Term 37◦ C and Hyb Time 4 h. 2. Remove the MultiVysion PB probe from −20◦ C and allow warming to room temperature. If the specimen slides were in storage, allow them to equilibrate gradually from −20◦ C to room temperature. 3. Hybridization process is carried out as described above, however, the duration is 4 h in this case. 4. When the HYBrite program is complete, remove the parafilm and coverslip from slides. 5. Place slides immediately in the 0.7 × SSC/0.3% NP-40 in the jar for 7 min. 6. Place slides in the Coplin jar containing 2 × SSC/0.1% NP-40 for 1 min. 7. Place slides vertically in a dark area on a paper towel to dry completely. 8. Apply 3 ␮L of Antifade II onto the target area and place coverslips, avoiding air bubbles (see Note 7). 9. View slides using a suitable filter set.

266

Bing and Ouellette

4. Notes 1. Exposure of oocytes to Hyase solution for longer periods or improper handling may damage them. 2. The diameter of the pipettes should be slightly larger than that of the oocytes to avoid mechanical damage while removing the cumulus and corona cells. 3. Group culture is performed. Five is the maximum number of embryos cultured in each drop based on the embryo nutrient requirements. 4. Culture media must be changed a minimum of every 48 h of embryo culture. 5. The embryo morphology is assessed as close to the time of transfer as possible. 6. A large volume of transfer media and a large air interface may result in expulsion of embryos into the cervix or cause adherence to the exterior surface of the catheter. 7. Do not add DAPI counter stain as this will be indistinguishable from the SpectrumBlue labeled probe signal. References 1. Steptoe, P. C. and Edwards, R. G. (1978) Birth after the reimplantation of a human embryo. Lancet 12, 366. 2. De Mouzon, J. (2006) IVF monitoring worldwide (ICMART). Human Reprod. 21 (suppl 1), i76. 3. Geary, S. and Moon, Y. S. (2006) The human embryo in vitro – recent progress. J. Reprod. Med. 51, 293–302. 4. Baker, G., Liu, D. Y. and Bourne, H. (1999) Assessment of the male and preparation of

sperm for ARTs. In: Trounson, A.O. and Gardner, D.K. (eds.), Handbook of In Vitro Fertilization, 2nd ed. Boca Raton: CRC Press, pp. 99–126. 5. Gardner, D. K. and Schoolcraft, W. B. (1999) Towards reproductive certainty: infertility and genetics beyond. In: Jansen, R. and Mortimer, D. (eds.), In Vitro Culture of Human Blastocysts. Carnforth: Parthenon Press, pp. 378–388.

Chapter 17 Animal Cloning by Somatic Cell Nuclear Transfer Lawrence C. Smith and Jae-Gyu Yoo Abstract Animal cloning is becoming increasingly useful for its applications in biological inquiry and for its potential use in pharmaceutical, medical, and agricultural fields. Due to the complexity of the numerous steps required in reconstructing oocytes by nuclear transfer, detailed protocols are required to minimize the developmental damages inflicted during these manipulations and to standardize procedures across laboratories. Moreover, because oogenesis and early embryogenesis differ widely among mammalian species, it is essential that protocols be adapted according to each species concerned. Our objective here is to detail the protocols that have been most successful in producing laboratory and domestic animal clones. Key words: Cloning, nuclear transfer, micromanipulation, oocyte, embryo.

1. Introduction The methods for animal cloning have changed substantially since Briggs and King (1) who first performed nuclear transplantation studies using amphibian eggs. Due to the reduced size of the oocyte, success with mammals was delayed for numerous years until Illmensee and Hoppe (2) reported the cloning of mice from embryonic cells. Encouraged by this advance, pioneering experiments in sheep by Willadsen (3) opened a door for further research using donor cells from more advanced stages and cultured embryonic cells (4–6). The birth of “Dolly” (7), first animal to be cloned from adult tissues, astonished the scientific community and has provoked continual discussion, mostly due to its wide reaching medical and ethical implications. Julie Lafond and Cathy Vaillancourt (eds.), Human Embryogenesis: Methods and Protocols, vol. 550 © Humana Press, a part of Springer Science+Business Media, LLC 2009 DOI 10.1007/978-1-60327-009-0 17 Springerprotocols.com

267

268

Smith and Yoo

Somatic cell nuclear transfer (SCNT or somatic cell cloning) is a technique in which the nucleus of a somatic cell is transferred into an enucleated matured oocyte for the generation of a new individual, genetically identical to the somatic cell donor. SCNT may be used to generate multiple copies of genetically elite farm animals, to produce transgenic animals for pharmaceutical protein production or xeno-transplantation, or to preserve endangered species. In addition to its practical applications, cloning has become an important tool for studying the gene function, genomic imprinting, chromatin reprogramming, regulation of development, as well as many related scientific areas. Animal cloning is currently feasible in many mammals, ranging from mice to non-human primates. Because of the speciesspecific particularities of oogenesis and embryo development, the materials and protocols employed for animal cloning vary slightly for different mammals. The goal of this report is to describe the materials and methods that are employed to derive cloned mice, cattle, and swine by nuclear transplantation and to highlight some critical differences between the cloning protocols used for different species. Readers are invited to consult a previous volume describing in detail protocols of nuclear transfer and transgenesis in animals (8).

2. Materials 2.1. Instruments and Equipments

1. CO2 incubator (Billups-Rothenberg, Del Mar, CA, USA). 2. Micropipette puller (Model P-97; Sutter Instrument Company, Novato, CA, USA). 3. Hoffman optics inverted microscope (Olympus IX7) equipped with modulation contrast optics, 10, 20, and 40× objectives. 4. Micromanipulator set (Narishige, East Meadow, NY, USA). 5. Microforge (Narishige). 6. Piezo-drill system (Prime Tech, Auburn, MA, USA). 7. Stereomicroscope (Model MZ12.5; Leica Microsystems). 8. Slide warmer (Fisher Scientific). 9. Four-well plate (Nunc). 10. 35-mm and 60-mm culture dishes (Nunc). 11. Cell-tram air (Eppendorf). 12. Cell-tram vario (Eppendorf). 13. Electro cell manipulator 200 (BTX). 14. Micropipettes (Research Instruments Limited, Cornwall, UK) (see Note 1 and Figs. 17.1–17.3). 15. 10–20 mL syringe. 16. 18-G needle.

Animal Cloning

A

269

C

A-1

C-1

Piezo-drill

(a) A-2

(b)

A-3 (c) Piezo-drill A-4

(d)

A-5

(e)

B C-2

Medium Mineral oil 10% PVP

Mercury

Air

Mineral oil or water

C-3

Fig. 17.1 Preparation of micropipettes and nuclear transfer. (A) Procedure to prepare pipettes for nuclear transfer in cattle and pigs. A-1: Positioning of pulled micropipette on the microforge close to a heated glass drop; A-2: Pipette will stick to heated glass and break as the filament cools; A-3: Sharpening of pipette on a beveling wheel; A-4: Positioning of pipette on the microforge; A-5: Pulling of a fine tip on the sharpen pipette. (B) Pipette set-up for piezo micro-driller for nuclear transfer in mice. (C) Procedure of oocyte enucleation and nuclear transfer. C-1: Procedure of cytoplasmic nuclear injection with piezo-drill: (a) Find the hole made during enucleation or penetrate zona pellucida by using several piezo-pulses; (b,c) Advance the tip of injection pipette into the space of the inner side of the holding pipette. While advancing pipette, expel liquid (2–3% PVP) very slowly to bring the nucleus to the tip of injection pipette; (d) When the nucleus is in the tip, stop expelling or gently aspirate the plasma membrane, then use a single piezo-pulse to penetrate the plasma membrane; (e) Place the tip of the pipette close to the inner hole of the holding pipette and expel the nucleus. Withdraw the injection pipette smoothly and quickly. C-2: Aspiration of the cytoplasm surrounding the MII-plate. C-3: Injection of the donor cell into the perivitelline space.

270

Smith and Yoo Oviducts

A

Hyaluronidase in M2 or hepes-CZB

M2 or hepes-CZB

MII stage oocytes

B

10% PVP in M2 or hepes-CZB CB in M2 or hepes-CZB

Enucleated oocytes

C

M2 or hepes-CZB

2–3% PVP

10% PVP

D In vitro culture medium

E

1

2

3

4

1–2: Ca2+-free medium 3–4: SrCl2 in Ca2+-free medium

F In vitro culture medium

Fig. 17.2 Procedures to perform somatic cell nuclear transfer in mice. (A) Oocyte recovery dish with microdrops under mineral oil. Oviducts are placed and opened in the oil to be washed in the hyaluronidase (HY) drops. After removal of cumulus cells in HY, oocytes are thoroughly washed in M2 or HEPES–CZB medium. (B) Oocyte enucleation: Micromanipulation dish with MII oocytes positioned in cytochalasin (CB) drops. MII oocytes are enucleated and separated to avoid mixing. Drops containing polyvinylpyrrolidone (PVP) are used to avoid the sticking of cellular debris and mercury to the pipette. (C) Nuclear injection: Drops containing polyvinylpyrrolidone (PVP) are used for handling donor nuclei for injection. (D) After nuclear injection, oocytes are thoroughly washed in in vitro culture medium. (E) Activation dish: Oocytes are washed in Ca2+ -free medium and activated with SrCl2 . (F) After oocyte activation, oocytes are placed in culture for recovery and development before transfer to synchronized recipients.

Animal Cloning

271

A In vitro maturation

MII stage oocytes

B Enucleation CB in hepes-based medium (HM)

C Nuclear injection in HM Enucleated oocytes

D

Fusion medium

HM + 10% (v/v) FBS

E In vitro culture

F 1

2

3

4

1: IVC medium 2–3: Activation regents 4: IVC medium

G In vitro culture

Fig. 17.3 The process of somatic cell nuclear transfer in cattle and pigs. (A) In vitro maturation dish: Oocytes recovered from slaughterhouse ovaries are cultured to obtain MII-stage oocytes. (B) Enucleation dish: After removal of cumulus cells, oocytes are enucleated in cytochalasin medium (CB) and separated in the micromanipulation drop. (C) Nuclear transfer dish: After oocyte enucleation, donor cells are placed in the perivitelline space of the enucleate oocytes. (D) Electrofusion dish: Couplets (enucleated oocytes with donor cell) are placed in electrofusion medium, positioned in the electrofusion chamber in alignment between the electrodes for fusion. (E) Washing dish: After exposure to the electric pulse, couplets are washed and placed in culture for fusion to occur. (F) Activation dish: Fused couplets are activated in ionomycin and washed. (G) Culture dish: After activation, oocytes are placed in culture and left to develop to the blastocyst stage. Viable blastocysts are transferred to the uterus of synchronized recipients.

272

Smith and Yoo

2.2. Reagents

2.3. Media and Preparation

1. Polyvinylpyrrolidone (PVP) 360 kDa (Sigma). For 10% PVP solution, add 2 g of PVP into 20 mL of HEPESmedium and keep at 4◦ C overnight without shaking or vortexing. Aliquot and keep at −20◦ C. 2. Bisbenzimide (Hoechst 33342; Sigma). 3. Strontium chloride (SrCl2 ; Sigma). 4. 6-Dimethylaminopurine (6-DMAP) (Sigma). 5. Cycloheximide (CHX) (Sigma). 6. Cytochalasin B (CB) (Sigma). For 1,000 × stock, add 1 mg of cytochalasin B into 2 mL of DMSO (dimethyl sulfoxide) and store at −70◦ C. 7. Disposable plastic Petri dishes (60 mm) (Falcon). 8. Dulbecco’s Phosphate-Buffered Saline (D-PBS) (Invitrogen). 9. HEPES (Sigma). 10. Pregnant mare serum gonadotropin (PMSG) (Calbiochem). 11. Human chorionic gonadotropin (hCG) (Calbiochem). 12. Hyaluronidase (Sigma). 13. Mercury (Fisher Scientific) (see Note 2). 14. Bovine serum albumin (BSA) (Calbiochem). 15. Mineral oil (Sigma). 16. PBS Ca2+ and Ca2+ -free (Sigma). 17. Trypsin–EDTA (0.25% trypsin, 1 mM EDTA) (Gibco). 18. Fetal bovine serum (FBS) (Invitrogen). 19. DMSO (Sigma). 20. D-Mannitol (Sigma). 21. TCM-199 with Earle’s salts (TCM-199) (Gibco). 22. Follicle-stimulating hormone (FSH) (Sigma) 23. Luteinizing hormone (LH) (Sigma) As mentioned previously, attention must be given to many factors involved if cloning is to be successful. The composition and characteristics of the culture medium are among the most critical. Culture medium used for long-term culture must be replaced every 2 weeks and the correct pH and osmolarity are essential, since differences in pH and osmolarity can dramatically affect embryo development. As each laboratory has preferable culture medium, we describe the most common and generally used culture medium for the species concerned.

2.3.1. Handling and Micromanipulation Medium 2.3.1.1. Mouse

1. M2 medium (Specialty Media, Phillipsburg, NJ, USA). 2. HEPES–CZB medium: 20 mM HEPES, 81.6 mM NaCl, 4.83 mM KCl, 1.18 mM KH2 PO4 , 1.18 mM

Animal Cloning

273

MgSO4 •7H2 O, 25.12 mM NaHCO3 , 1.70 mM CaCl2 •2H2 O, 31.30 mM sodium lactate, 0.27 mM sodium pyruvate, 0.11 mM EDTA, 1.00 mM glutamine, 100 U/mL sodium penicillin G, 0.70 mg/mL streptomycin, and 5 mg/mL BSA. 2.3.1.2. Bovine and Porcine

1. HEPES-buffered Tyrode’s medium (TL-HEPES) with 114 mM NaCl, 3.2 mM KCl, 2 mM NaHCO3 , 0.4 mM NaH2 PO4 •H2 O, 10 mM sodium lactate, 10 mM HEPES, 100 IU/mL penicillin, 2.0 mM CaCl2 •2H2 O, 0.5 mM MgCl2 6H2 O.

2.3.2. In Vitro Maturation Medium (IVM) 2.3.2.1. Bovine

1. Bicarbonate-buffered M-199 (Sigma) with 10% FBS, 10 ␮L/mL luteinizing hormone (LH) (Ayerst), 10 ␮g/mL follicle-stimulating hormone (FSH) (Sigma), 1 ␮g/mL estradiol-17␤ (Sigma), 2.5 ␮g/mL sodium pyruvate (Sigma), and 50 ␮g/mL gentamicin (Sigma).

2.3.2.2. Porcine

1. TCM-199 supplemented with 25 mM NaHCO3 , 10% (v/v) porcine follicular fluid (pFF), 0.57 mM cysteine, 0.91 mM sodium pyruvate, 0.5 mg/mL p-FSH (Folltropin V; Vetrepharm), 0.5 mg/mL LH, 10 ng/mL epidermal growth factor (EGF), 0.57 mM cysteine, 100 IU/mL penicillin and 100 IU/mL streptomycin.

2.3.3. In Vitro Culture Medium 2.3.3.1. Mouse

1. Potassium Simplex Optimized Medium (KSOM; Specialty Media). 2. CZB medium: 81.6 mM of NaCl, 4.83 mM KCl, 1.18 mM KH2 PO4 , 1.18 mM MgSO4 •7H2 O, 25.12 mM NaHCO3 , 1.70 mM CaCl2 •2H2 O, 31.30 mM sodium lactate, 0.27 mM sodium pyruvate, 0.11 mM EDTA, 1.00 mM glutamine, 100 U/mL sodium penicillin G, 0.70 mg/mL streptomycin, and 5 mg/mL BSA.

2.3.3.2. Bovine

1. SOFaaci medium: 107.63 mM NaCl, 7.16 mM KCl, 1.19 mM KH2 PO4 , 1.51 mM MgSO4 , 1.78 mM CaCl2 •2H2 O, 5.35 mM sodium lactate, 25 mM NaHCO3 , 7.27 mM Napyruvate, 0.20 mM L-glutamine, 45 ␮L/mL BME amino acids solution, 5 ␮l/mL MEM amino acids solution, 0.34 mM tri-sodium-citrate, 2.77 mM myo-inositol, 50.0 ␮g/mL gentamycine, 10.0 ␮g/mL phenol-red. 2. Charles Rosenkrans medium (CR1aa): 114.7 mM NaCl, 3.1 mM KCl, 26.2 mM NaHCO3 , 1 mM L-glutamine, 0.4 mM

274

Smith and Yoo

sodium pyruvate (P-2256), and 5.5 mM hemicalcium lactate (CAT. No. L-4388; Sigma) supplemented with 10 ␮L/mL MEM amino acids solution, 10 ␮L/mL BME amino acids solution, and 3 mg/mL BSA (Fraction V) (9). 2.3.3.3. Porcine

1. North Carolina State University (NCSU)-23 medium: 108.73 mM NaCl, 4.78 mM KCl, 1.7 mM CaCl2 •2H2 O, 1.19 mM KH2 PO4 , 1.19 mM MgSO4 •7H2 O, 25.07 mM NaHCO3 , 5.55 mM D-glucose, 1 mM L-glutamine, 7 mM taurine, 5 mM hypotaurine, 75 ␮g/mL potassium penicillin G, and 50 ␮g/mL streptomycin sulfate (0.4% BSA) (10). 2. Porcine Zygote Medium (PZM5): 108 mM NaCl. 10mM KCl, 0.35 mM KH2 PO4 , 0.4 mM MgSo4 .7H2 O, 25.07 mM NaHCO3 , 0.2 mM sodium pyruvate, 2 mM calcium lactate, 2 mM L-glutamine, 5 mM hypotaurine, 20mL/L BME, 10 mL/L NEAA, 3 mg/mL BSA.

2.3.4. Fusion Medium

1. Bovine: 280 mM Mannitol, 0.1 mM CaCl2 , and 0.05 mM MgCl2 . 2. Porcine: 280 mM Mannitol, 1.0 mM CaCl2 .2H2 O, 0.1 mM MgCl2 .6H2 O

3. Methods 3.1. Preparation of Recipient Oocytes 3.1.1. Mouse

1. Inject 5 IU of PMSG intraperitoneally into female mice (6–12 weeks old). 2. Inject 5 IU of hCG intraperitoneally at 46–48 h of PMSG injection. 3. Dilute the hyaluronidase to 100–150 IU/mL and prepare large droplets of hyaluronidase and M2 or HEPES-CZB medium in a dish with an oil overlay (Fig. 17.2A). 4. 13–14 h post-hCG injection, the mice are killed by cervical dislocation. 5. Isolate the oviducts, place them directly into the oil, and drag them into hyaluronidase drop one at a time until all cumulus oocyte complexes (COCs) are released. 6. After 2–3 min of hyaluronidase treatment, place COCs into hyaluronidase-free drops for washing with several changes of M2 or HEPES–CZB medium. This step should be conducted rapidly but without damaging the oocytes.

3.1.2. Bovine and Porcine

1. Transfer bovine and porcine ovaries from a slaughterhouse to the laboratory in sterile PBS or saline maintained at 35– 38◦ C within 3 h.

Animal Cloning

275

2. Aspirate COCs from follicles (3–6 mm diameter) using a 10–20 mL syringe or a vacuum system fitted with an 18-G needle. 3. For bovine, select compact COCs with several dense layers of cumulus cells and wash three times in HEPES-buffered tissue culture medium (TCM)-199 supplemented with 10% FBS, and culture 25 COCs in 100 ␮L drops of IVM medium (see Section 2.3.2.1) for 18–22 h at 39◦ C in a humidified atmosphere of 5% CO2 in air. 4. For porcine, select COCs three times with TL-HEPES and two times with IVM medium and cultured (50 COCs/500 ␮L drop) in M-199. COCs are cultured for an additional 20 h in the fresh IVM medium (see Section 2.3.2.2) without hormone supplements. 5. After IVM, put all in vitro matured COCs into 1.5-mL Eppendorf tube, then vortex in 0.1% hyaluronidase in TL-HEPES containing 0.01% polyvinyl alcohol (PVA) for 2 min to remove the cumulus cells. Select only oocytes with the first polar body and homogeneous cytoplasm. 3.2. Enucleation

Enucleation refers to removal of spindle–chromosome complex (SCC).

3.2.1. Mouse

1. Prepare enucleation slide and set enucleation and holding pipette (Fig. 17.1B). 2. Place MII stages oocytes into M2 or HEPES–CZB medium supplemented with 2.5–3.0 ␮g/mL CB. It is better not to expose MII-stage oocytes to CB medium for more than 15 min. Therefore, the number of oocytes to handle in each group must be considered according to the experience (speed) of the operator. 3. Penetrate the zona pellucida by using multiple piezo-driver pulses. 4. Remove SCC with a minimal volume of cytoplasm without piezo-pulse. Be careful not to penetrate the cytoplasm membrane during manipulation while removing the SCC. Place enucleated oocytes into M2 or HEPES–CZB medium without CB.

3.2.2. Bovine and Porcine

1. Incubate denuded oocytes for 15 min in HEPES-buffered TCM-199 medium supplemented with 10% (v/v) FBS, 7.5 ␮g/mL CB, and 5 ␮g/mL Hoechst 33342. 2. Place 20–30 oocytes into HEPES-buffered TCM-199 medium supplemented with 10% (v/v) FBS, 7.5 ␮g/mL CB, for each enucleation. 3. Aspirate the first polar body and adjacent cytoplasm (approximately 10–30% of cytoplasm (Fig. 17.1C-2) using a beveled pipette (25-mm internal diameter)) into

276

Smith and Yoo

HEPES-buffered TCM medium supplemented with 10% (v/v) FBS and 7.5 ␮g/mL CB. 4. Confirm enucleation by UV-assisted visualization of fluorescent metaphase plate in the aspirated cytoplasm contained within the enucleation pipette. Be careful not to expose the enucleated oocyte to UV irradiation. 5. After enucleation, put enucleated oocytes into TCM-199 medium before injection. 3.3. Preparation of Donor Nuclei

1. Culture donor cells for as few passages as possible (2–6 passages) in 60-mm Petri dishes in DMEM supplemented with 10% FBS. Prolonged cultures (many passages) tend to accumulate karyotypic defects. 2. Grow donor cells to confluence in order to obtain a quiescent population of cells on the day of SCNT. Some laboratories use serum starvation (0.5% FBS) for between 3 and 5 days before nuclear transfer. 3. Treat 0.05% trypsin/EDTA and resuspend the cells in fresh TCM-199. 4. Approximately half an hour before manipulation, cells are dissociated by incubation in Dulbecco’s phosphate-buffered saline (DPBS) containing 0.05% trypsin for 5 min, pelleted, and resuspended in HEPES-buffered DMEM with 15% FBS.

3.4. Introduction of Donor Nuclei 3.4.1. Mice

In mouse oocytes, a piezo-driven pipette is commonly used to inject nuclei directly into the cytoplasm. The size and shape of the pipette is critical for the efficiency of injection. 1. Prepare dishes for injection using the lids of standard 60mm plastic disposable Petri dishes. 2. Prepare drops of 10% and 2–3% PVP in M2 or HEPES– CZB medium, and M2 or HEPES–CZB medium without PVP (Fig. 17.2C). 3. Set up injection and holding pipettes. The inner diameter of holding pipette should be 25 ␮m to have a small space for injection. 4. Enucleated oocytes for injection are placed in M2 or HEPES–CZB medium drop. 5. Donor cells are mixed in the drop with 2–3% PVP. 6. Set injection pipette as an enucleation pipette and aspirate donor cells in medium with 2–3% PVP and pipette several times to ensure lyses of the membrane and to remove the cytoplasm. Repeat same process to load several nuclei and put the last nucleus at the tip of injection pipette. 7. Find the hole which was made during enucleation or penetrate zona pellucida by using several piezo-pulses.

Animal Cloning

277

8. Advance the tip of injection pipette into the space of inner side of holding pipette (Fig. 17.1-C1-c). During this time, expel liquid (2–3% PVP) very slowly to bring the nucleus to the tip of injection pipette. 9. When the nucleus is in the tip, stop expelling or suck cytoplasm membrane very little, then use a single piezo-pulse to penetrate cytoplasm membrane (Fig. 17.1-C1-d). 10. Place the tip of the pipette at inner side of holding pipette and expel the nucleus. 11. Withdraw the injection pipette smoothly and quickly (Fig. 17.1-C1-e). In some case, aspiration of cytoplasm may be helpful to prevent lyses. 3.4.2. Bovine and Porcine

1. Prepare dishes for injection using the lids of standard 60-mm plastic disposable Petri dishes. 2. Prepare drops of HEPES-buffered TCM-199 supplemented with 5% FBS (Fig. 17.3C). 3. Choose donor cells with smooth-bordered plasma membranes and inject into the perivitelline space of each enucleated oocyte using the same pipette that was used for enucleation. Place a donor cell in close contact with the enucleated oocyte to facilitate fusion. 4. Couplets (enucleated oocytes with a donor cell in the perivitelline space) are placed in TCM-199 medium supplemented with 10% (v/v) FBS for a few minutes to recover before fusion.

3.4.3. Fusion

1. Prepare fusion chamber and equipment and put fusion medium onto the chamber over the two parallel platinum electrodes (Fig. 17.3D). 2. Wash the couplets in a droplet of fusion medium for equilibration and place between electrodes. 3. Align manually with a fine Pasteur pipette to position the fusing membranes perpendicularly to the electrical current (Fig. 17.3D). 4. Induce membrane fusion with a single direct current (DC) pulse of 2.1 kV/cm for 30 ␮s (for porcine cytoplast) or a double DC pulse of 2.5 kV/cm for 30 ␮s (for bovine cytoplast) (see Note 3). 5. After electrical fusion, wash couplets and culture in 50 ␮L droplets of in vitro culture medium and replace in an incubator. Fusion occurs usually within 30 min.

3.5. Artificial Oocyte Activation and In Vitro Culture 3.5.1. Mouse

1. After injection, eggs are incubated in KSOM for 2–3 h before artificial activation.

278

Smith and Yoo

2. Before activation, wash eggs in Ca2+ and Ca2+ -free KSOM several times then incubate in Ca2+ -free KSOM supplemented with 10 mM SrCl2 and 5 ␮g/mL CB (Fig. 17.2E). 3. Incubate eggs in Ca2+ -free KSOM supplemented with 10 mM SrCl2 and 5 ␮g/mL CB for 5–6 h. 4. Wash reconstructed oocytes and place in KSOM culture for as long as required. Embryos can be cultured for 1 day to observe cleavage or for 3 days to allow development to the blastocyst stage. 5. After in vitro culture, embryos are transferred to the oviduct (1- or 2-cell stage) or the uterus (morula and blastocysts) of pseudo-synchronized recipients to enable development to term. 3.5.2. Bovine and Porcine

1. Activate reconstructed cattle eggs with 5 ␮M of ionomycin for 5 min, 2 mM 6-DMAP for 4–5 h, or 10 ␮g/mL cycloheximide and 5 ␮g/mL CB for 5 h in TCM-199 10% FBS (Fig. 17.3F). Porcine oocyte activation is not recommended after reconstruction with donor cell using electrofusion. 2. Activated oocytes are washed three times and placed into 50-␮L droplets of medium under mineral oil in a humidified atmosphere of 5% CO2 , 5% O2 , and 90% N2 . 3. As with mice, in vitro cultures were performed between 1 and 7 days according to the species concerned. 4. In pigs, embryos are often transferred at the 1- to 2-cell stage to the oviduct of synchronized saws. In bovine, embryos are usually cultured for 7 days and transferred non-surgically to the uterus of synchronized cows.

4. Notes 1. Micropipettes are pulled using a pipette puller (Condition: Heat 650, Pull 70, Vel 85, and Time 140). As shown in Figs. 17.1A-1 and 17.2, prepare all types of micropipettes using a microforge. For bovine and porcine nuclear transfer, bend micropipettes at an angle of 15–20 degrees (Fig. 17.3A). For mouse somatic cell nuclear transfer, prepare micropipettes as follows: a. Holding pipette: 80–100 ␮m (outer diameter, OD), 15–20 ␮m (inner diameter, ID). b. Enucleation pipette: 15 ␮m (OD), 12 ␮m (ID). c. Injection pipette: 7 ␮m (OD), 5 ␮m (ID). d. Load a small amount of mercury into the opposite side of the enucleation and injection pipette’s tip (Fig. 17.1B). 2. Use or handling of mercury poses significant health risks. Therefore, we strongly suggest caution and full

Animal Cloning

279

familiarization with the hazards associated with mercury and to follow guidelines for use and handling. Mercury should be handled and stored only under a chemical hood. 3. The condition of fusion may change depending on fusion chamber type and origin of wire. We recommend the use of 2-cell stage embryos for practice and to test fusion chamber and machine fusion parameters. The parameters provided for fusion of porcine and bovine oocytes need to be verified for each new chamber and fusion machine to optimize conditions. References 1. Briggs, R. and King, T.J. (1952) Nuclear transplantation studies on the early gastrula (Rana pipiens). Dev. Biol. 2, 252–270. 2. Illmensee, K. and Hoppe, P.C. (1981) Nuclear transplantation in Mus musculus: developmental potential of nuclei from preimplantation embryos. Cell 23, 9–1. 3. Willadsen, S.M. (1986) Nuclear transplantation in sheep embryos. Nature 320, 63–65. 4. Smith, L.C. and Wilmut, I. (1989) Influence of nuclear and cytoplasmic activity on the development in vivo of sheep embryos after nuclear transplantation. Biol. Reprod. 40, 1027–1035. 5. Sims, M. and First, N.L. (1993) Production of calves by transfer of nuclei from cultured inner cell mass cells. Proc. Natl. Acad. Sci. USA 91, 6143–6147.

6. Campbell, K.H., McWhir, J., Ritchie, W.A. and Wilmut, I. (1996) Sheep cloned by nuclear transfer from a cultured cell line. Nature 380, 64–66. 7. Wilmut, I., Schnieke, A.E., McWhir, J., Kind, A.J. and Campbell, K.H. (1997) Viable offspring derived from fetal and adult mammalian cells. Nature 385, 810–813. 8. Verma, P.J. and Trounson, A.O. (2006) Nuclear Transfer Protocols: Cell Reprogramming and Transgenesis. Humana Press, Boston. 9. Rosenkrans, C.F. and First, N.L. (1994) Effects of free amino acids and vitamins on cleavage and development rate of bovine zygotes in vitro. J. Anim. Sci 72, 434–437. 10. Petters, R.M. and Wells, K. D. (1993) Culture of pig embryos. J. Reprod. Fertil. Suppl. 48, 61–73.

Chapter 18 The Human Embryo: Ethical and Legal Aspects Bartha Maria Knoppers, Sylvie Bordet, and Rosario Isasi Abstract This paper analyses the status of the embryo in Canadian law. First, a brief overview of some ethical issues raised by research with embryos, focusing on the moral status of the embryo, is presented. A survey of the regulatory framework applicable to embryo research in Canada follows, so as to delineate the legal status of the embryo in Canada and its ethical underpinnings. A summary of applicable regulation in Germany, the United Kingdom, and the United States is also undertaken, illustrating the lack of consensus on this issue in Western countries. Finally, recent developments in stem cell research are considered, focusing on current alternatives to embryo destruction. Key words: Embryo research, moral status of the embryo, legal status of the embryo, stem cell research, the human embryo, ethical and legal aspects.

1. Introduction The early human embryo emerged into the light of the laboratory and the clinic during the last century. Created in the pursuit of remedies for infertility, the in vitro embryo has since then continued to be intimately connected with other aspects of the age-old dream of escaping the human condition. Indeed, it is perceived as a gateway to repair the human body through the use of embryonic stem cells, to alter human reproduction through cloning, or even to eliminate genetic disease through gene therapy – all potential techniques that are controversial. In a classic Promethean dilemma, the emergence of the human embryo in our consciousness was initially made possible by research involving embryos, yet much controversy still surrounds the acceptability of carrying out such research. This paper will briefly consider some ethical questions connected with research Julie Lafond and Cathy Vaillancourt (eds.), Human Embryogenesis: Methods and Protocols, vol. 550 © Humana Press, a part of Springer Science+Business Media, LLC 2009 DOI 10.1007/978-1-60327-009-0 18 Springerprotocols.com

281

282

Knoppers, Bordet, and Isasi

on embryos, focusing firstly on the moral status of the embryo and followed by a study of the regulatory framework governing embryo research in Canada. This review will attempt to delineate the legal status of the embryo as well as the ethical underpinnings of Canadian policy on this issue. A brief comparative survey of the applicable regulation in Germany, the United Kingdom, and the United States will also be undertaken to illustrate the lack of consensus on embryo research in Western countries. Finally, stem cell research will be considered, focusing on current alternatives to embryo destruction and illustrating the importance of ethical considerations in science policy. At the outset, it should be noted that there is little agreement concerning appropriate terminology to designate the human embryo. The use of different words for different stages of development is often used to mark a perceived difference in the ethical significance of particular stages (1). For the sake of simplicity, this paper eschews the use of terms such as “zygote,” “pre-embryo,” “fertilized egg,” and others used to describe very early stages of development of the human organism. It uses the word “embryo” as it is defined in the Canadian Assisted Human Reproduction Act (the “Act”) of 2004 (2), to refer to a “human organism during the first 56 days of its development following fertilization or creation” (see Note 1). The variety of applicable regulatory schemes in Western countries illustrates the potential for divergence concerning research with human embryos, which is in large part due to differences in the moral status granted to the embryo. This status influences the ethics of embryo research, and, particularly, the creation of embryos for research. 1.1. The Moral Status of the Human Embryo

Three main positions on the moral status of the embryo can be identified in the current Western literature, with of course some differences of opinion within each: (i) the embryo is ascribed the same moral status as a person from conception, (ii) it acquires moral status at some time after conception and before birth, or (iii) it has no moral status until birth. The view that an embryo has full moral status from conception is generally based on a combination of species membership, human individuality, and potentiality. In contrast, those who believe that the embryo acquires moral status at a later date generally hold that moral status is gradually acquired during development (the “gradualist” view), with full moral status being acquired at varying points, such as implantation into the womb, development of the primitive streak, or viability. In many cases, the embryo is seen as deserving moral respect prior to the acquisition of moral status because of its strong symbolic value. Finally, for others, the embryo is a collection of human cells without moral status other than that accorded to any other type of human

Ethical and Legal Aspects

283

tissue. The only consideration due to it is that which comes from its parents’ intentions or plans for it, and they may dispose of it as they wish. The justifications for ascribing a particular moral status to the embryo are found in considerations of when human life truly begins, the embryo’s potential for development, its interests, and its symbolic value. The beginning of human life, human individuation, and identity. For those who believe that every live human being has moral status, the question of when human life in fact begins becomes important. Some argue that as soon as a diploid cell acquires the potential (by fertilization or somatic cell nuclear transfer, for example) to develop into a human being, a human individual is present and has moral status (3). Others argue that the embryo at this stage is not a true human individual and cannot be granted moral status until that stage is reached. Within this camp, a “genetics-based” view argues that a true individual is formed only when a unique genetic combination is created by fertilization (4), raising the question of whether “embryos” generated by somatic cell nuclear transfer would benefit from the same status as those created by fertilization. Another view of individuation relies not only on the genetic code, but also on reaching a stage of development at which an embryo can no longer divide itself into twins or combine itself with a neighboring embryo to form a new, chimeric organism (5, 6). Only after this stage is the embryo a unique human individual with moral status. This is disputed by those who find it unconvincing to deny status to an embryo at a particular stage because instead of producing one human life, it might produce more (7). Empirical evidence confirms the variety of views on this topic: a poll carried out in Germany reveals that the majority of lay respondents, as well as pediatricians and obstetricians, chose implantation in the womb as the crucial boundary that marks the beginning of human life, whereas the majority of human geneticists, ethicists, and midwives voted for conception as the decisive moment. A significant proportion of lay persons also chose quickening as the moment when life begins (8). Potentiality. Various arguments based on potentiality are invoked to support different views of the moral status of the embryo. Proponents of ascribing full moral status to the embryo from fertilization argue that each fertilized egg is a genetically human, complete cell with the potential to become a human being, which makes it a full member of the human moral community (9, 10). However, embryonic development takes place on a continuum, and this is invoked in various ways by “gradualists”: the embryo initially has a limited probability of complete

284

Knoppers, Bordet, and Isasi

development, which justifies ascribing it with limited moral status. As the embryo develops, the probability of full development increases and its moral status increases correspondingly. Bolstering this argument is the fact that many naturally fertilized embryos do not result in births. Some authors note that this reasoning is based on probability rather than potential (7, 11), and do not consider this a sound basis for determining moral status: in other situations, moral status is not granted to persons based on the probability that they will reach a certain stage in life. In addition, the high attrition rate of embryos in natural procreation is not seen as a good reason to refuse embryos membership in the human moral community, allowing more embryos to be deliberately destroyed by people (7). For some, potential is context-dependent: an in vitro embryo eventually requires implantation in a womb to continue its development, so this is seen as the morally relevant difference between embryos that have status and embryos that do not. Without implantation, the embryo loses its potential to develop into a human life (12–15). Perhaps, this is what underlies the view of those who believe that human life begins at implantation. Context can also be seen as having a social dimension: the parents’ decisions to destroy the embryo or implant it (5, 16, 17) is perceived by some as a determinant element of this context. Opponents of this context-based view argue that there is no ontological difference between embryos regardless of the context they are in. A reductio ad absurdum argument can be constructed against the use of potentiality as a criterion for moral status, stating that with technological progress, all human cells could have reproductive potential, erasing the barrier between reproductive material and other human cells, and weighing in favor of ascribing moral status to all human cells (15, 17–20). This, and the objection that treating the potential being as the being is not justified, is often invoked by proponents of the “interest view” (20, 21) to reject the granting of full moral status to embryos. Interests and moral status. The interest view ascribes moral status to beings based on their having interests. The capacity for sentience is a necessary and sufficient condition for the possession of interests, and therefore moral status, although this status may be different for beings with different capacities. In the case of a developing human being, it is believed that the earliest stage at which embryos could feel pain is around 8 weeks of gestation (22). Nevertheless, the 14-day stage is chosen by many reports and regulatory instruments (2, 23–26) as the upper limit of development allowable for experimentation, as this approximately corresponds to the beginning of formation of the primitive streak, which indicates the initial differentiation of cells that will eventually constitute the nervous system.

Ethical and Legal Aspects

285

Embryos as a symbol of human life. Many who deny full moral status to the human embryo, and therefore a right to life, nevertheless do not think that anything can be done with it. For them, embryos belong to a different category than things or persons, and have moral value without moral status. Rather, as potential persons, embryos are powerful symbols of human life and are worthy of moral consideration as such. This moral consideration is less weighty than the actual interests of born human beings in life and health, but still requires that embryos not be used for frivolous purposes, such as unnecessary experiments or purely commercial gain (20, 21, 27). Is the moral status of the embryo determinative? As both a conceptual and empirical matter, moral status cannot be determined with certainty, and any attempt at balancing the moral worth and needs of embryos and persons must be acknowledged as imprecise (28, 29). In addition, there is a disagreement as to the centrality of this question in the resolution of issues concerning research with embryos (30). Some consider that it is at least as important to consider the meaning of parenting and procreation, the symbolism of creating a human life that may not be intended to come to fruition, or the effects such practices have on us as moral agents, as well as the consequences of allowing or disallowing certain practices on women and children (31, 32). 1.2. Research with Human Embryos 1.2.1. Destruction

Carrying out research with embryos raises questions about the ethics of using an embryo for anything other than procreation and the destruction of the embryo through research (33). In addition, the ethics of creating embryos specifically for research must also be considered. Those who believe that an embryo has full moral status must first consider the acceptability of in vitro fertilization (IVF), which was developed through experimentation that involved the creation and death of embryos. Despite this, the need addressed by IVF is so pressing that it is universally authorized in Western countries. Some countries, however, are not comfortable with dedicating embryos to any but reproductive purposes, and only the number of embryos that can be implanted in a particular cycle may be produced, so that there will not be any spare embryos (see Note 2). When an embryo is granted full moral status, it should be treated like a person. This view would only permit research that is (i) observational in nature, presenting no risk to the embryo before its implantation, or possibly, (ii) innovative therapy for its own benefit. Any research that results in embryo destruction would fail to treat the embryo in accordance with its status as a

286

Knoppers, Bordet, and Isasi

person. Deckers’ objection to the UK law permitting research on embryos is based on this: it unfairly discriminates against embryos by allowing them to be killed for research, something that would not be permitted in the case of other human beings (34). The creation of spare embryos is an IVF-related issue that affects research with embryos. Its goal is to protect women undergoing IVF from the risks associated with undergoing additional ovarian stimulation cycles. Where this is accepted, even those that ascribe full moral status to the embryo tend to accept the “lesser evil” view that embryos slated for destruction in any case might be used for research that is not in their interests. Where moral consideration or respect is felt to be due to an embryo that does not have full moral status, questions are raised as to the proper balancing of this respect against the interests of persons with full moral status. Generally, the interests of born human beings in important values like health and reproductive autonomy are thought to prevail over the symbolic value ascribed to human embryos, provided that embryos are not sacrificed to unnecessary or frivolous research. The existence of benefits that can be achieved or values served that outweigh considerations of the good of the embryo is usually recognized by proponents of this view in cases such as research aimed at improving IVF techniques and our understanding of human reproduction, or at increasing our comprehension of, and possibly remedying serious disease. A criticism often leveled at this position is the ambiguity of “respecting” embryos while destroying them, which makes it seem like a perfunctory justification for questionable conduct (34, 35). 1.2.2. Creation for Research

The creation of embryos specifically for research further divides opinions. Certain types of research require that embryos be created outside of any prospective family plans. Examples of this include additional research on the cryopreservation of oocytes or invasive studies of the early development for the study of genetic conditions or others leading to miscarriage. Those who ascribe the moral status of persons to embryos oppose the creation of embryos for research as well as nontherapeutic research on embryos. Many who accept research on spare embryos nevertheless oppose the creation of embryos for research, because they see it as an unacceptable instrumentalization of the embryo, whereas this is not an issue when the embryo was initially created for reproductive purposes and lost its chance at further development (16). For some, moral value attaches to the reproductive purpose of the parents in creating the embryos, whereas this is not true of the carrying out of research for the health of other human beings (16, 30). Others argue that the hope of beneficial consequences when creating an embryo for

Ethical and Legal Aspects

287

research is longer-term and indirect, and therefore of less weight, when compared to the reproductive goals of parents (36). A “slippery slope” argument has also been formulated, expressing the concern that if the creation of embryos for research is permitted, the criteria applied to the research will soon become less and less stringent, undermining the respect due to embryos. In addition, fears have been expressed that permitting the creation of embryos for research will lead to the commodification of embryos and the gametes used to create them, and the exploitation and coercion of donors, in particular women, for whom the oocyte donation procedure involves health risks (16, 37, 38). Those who favor the creation of embryos for research argue that there is essentially no difference between the ontological or moral status of spare embryos and embryos created for research (18, 21). For them, it is morally acceptable to create embryos for research, within the same parameters that make embryo research acceptable.

2. Legal Status of the In Vitro Embryo in Canada

2.1. Research with Embryos in Canada

Under Canadian law, an unborn human being does not have legal personhood, although its potential to become one is recognized. So far, the case law has focused on the right of a woman to undergo an abortion (39, 40) or liability for prenatal injury or death (41–43). A major consideration in these cases has been the physical unity of the unborn child with the pregnant woman. However, this is not the situation for in vitro embryos, which unlike in the United States, have not been the subject of reported decisions in Canada. An exploration of the relevant provisions of the Act, as well as federal policies applicable to research with embryos, should therefore prove useful to determine the legal status of the in vitro embryo in Canada. The regime applicable to research with embryos in general, including the specific case of stem cell research will be considered before analyzing the legal status of the in vitro embryo. Only federal laws and guidelines are considered here. General principles. In Canada, research with embryos is not prohibited, although it is illegal to create embryos for most types of research, except those aimed at improving assisted reproduction (see Note 3). In other cases, investigators are limited to using embryos initially created for reproductive purposes (“spare embryos”); all forms of cloning are prohibited (see Note 4). The use of embryos for research is a “controlled activity,” which requires that the person carrying out the research be licensed

288

Knoppers, Bordet, and Isasi

(see Note 5), and do so in licensed premises (see Note 6). An Agency is established by the Act (see Note 7) for these licensing purposes; it may issue licenses authorizing the use of an in vitro embryo only where it is satisfied that the use is necessary for the purpose of the proposed research (see Note 8). Currently, the Assisted Human Reproduction Agency of Canada is not fully operational and no licensing regulations have been adopted. Thus, only those persons who were handling embryos during the year preceding April 22, 2004 are presently authorized to do so (see Note 9). Consent of donors. Written consent of the embryo donor must be obtained for any research involving embryos (see Note 10). The embryo donor, in this context, is the single person or couple for whose reproductive use an in vitro embryo was created. Where the donor is a couple, both members must agree for the consent to comply with the regulations. Before making use of an in vitro embryo in research, the researcher must have the embryo donor(s) sign two documents: one in which the donors confirm their understanding of the rules applicable to their consent and its withdrawal, the other being the consent proper, which must identify a specific research project and its goal (see Note 11). If the donor is a couple, the consent may be withdrawn by either member of the couple (see Note 12). In addition, when applicable, the consent of the gamete donors used to create the embryo must also have been obtained (see Note 13). No commercialization of embryos. No embryo used in research may have been obtained in contravention of Section 7(2) of the Act, which prohibits the purchase or sale, the offering to purchase or sell, or any advertising for the purchase or sale, of an in vitro embryo. Prohibited research. Not all types of research are permitted with embryos: they may not be kept in culture outside the womb of a woman for longer than 14 days (see Note 14); and they may not be combined with cells from any other organism (see Note 15). If the research is carried out on an embryo that will be used to create a human being, additional prohibitions apply (see Section 2.3). Federally funded research. In addition to the Act, investigators and institutions receiving funds from certain federal granting agencies (see Note 16) must comply with the Tri-Council Policy Statement (“TCPS”), which sets out certain requirements for research with embryos (44). Most of these are also contained in the Act, but the TCPS specifies that embryos exposed to manipulations not directed specifically to their ongoing normal development may not be transferred for continuing pregnancy (see Note 17). In addition, the TCPS specifically mentions that the formation of animal/human hybrids is unacceptable. The Act seems to permit the creation of hybrids for

Ethical and Legal Aspects

289

non-reproductive purposes, although the creation of chimeras is prohibited. Constitutional note. The government of Quebec is of the opinion that the Act exceeds the federal government’s jurisdiction by legislating in the area of health and civil rights. As a result, the Attorney General of Qu´ebec was mandated by orderin-council (45) to proceed with a reference before the Qu´ebec Court of Appeal, challenging the constitutionality of the sections of the Act dealing with controlled activities and the powers of the Agency. The Qu´ebec Court of Appeal declared these sections of the Act unconstitutional (46); an appeal to the Supreme Court is currently slated to be heard in April 2009. If ultimately successful, Qu´ebec’s constitutional challenge could prevent federal licensing of embryo research by the Agency in Canada, including the control of research purposes and the recently adopted consent requirements. The general framework of prohibitions dealing with embryo research, however, is not challenged and would continue to apply. 2.2. Stem Cell Research

Research involving the derivation of embryonic stem cells from human embryos is permissible in Canada. However, cloning is prohibited, thus banning what was until recently considered one of the most promising avenues for personalized regenerative medicine: the creation of custom-made embryonic stem cell lines from a patient’s cells by somatic cell nuclear transfer (SCNT). The previously mentioned licensing requirements will apply, as do the consent requirements. Research funded by the granting agencies – stem cell guidelines. Additional conditions apply to stem cell research that is carried out in institutions receiving funds from the three major federal funding agencies. These conditions are set out in the Updated Guidelines for Pluripotent Stem Cell Research, June 29, 2007 (the “Stem Cell Guidelines”) (47) and are in part similar to those set forth in the Act, but are more detailed.

2.3. The Legal Status of the In Vitro Embryo in Canada

This brief survey reveals that, although it does not have legal personhood, the embryo in Canada does benefit from moral consideration, which is discernible in the rules concerning its creation and use. For the purposes of this analysis, only the rules contained in the Act are considered. The TCPS, initially adopted in 1998, notes that the Canadian law and ethics of research in human reproduction is broadly consistent with a graduated approach that correlates permitted intervention with the developmental stages of the embryo or fetus, and that a careful, moderate, and controlled approach is preferred to the relatively uncontrolled use of new practices as therapy. Although the TCPS was adopted before the Act, this observation also applies to the regime put in place by the Act.

290

Knoppers, Bordet, and Isasi

The Act was adopted in 2004 after a long process, initiated by the creation of a Royal Commission on New Reproductive Technologies. The 1993 report produced by the Commission (the “Commission Report”) recommended that research with embryos and the creation of embryos for research both be permitted, subject to compulsory licensing by a national reproductive technologies commission (23). These recommendations were generally followed, except as concerns the creation of embryos for research. The use of embryos in research. The restrictions put on the use of embryos in research are revealing. Parental autonomy is paramount, since only embryos specifically donated by the “parents” (i.e., the sources of the embryos) may be used for a particular research project described in the consent. In contrast, the European Society for Human Reproduction and Embryology (ESHRE) recommended only that parents be made aware that embryos slated for destruction might be used in research (48), seemingly granting less importance to parental autonomy once the decision to destroy the embryo has been made. The Agency will operate a licensing regime that controls not only who carries out embryo research and where, but also its purposes. The report of the House Standing Committee on Health (“The Standing Committee Report”), which commented on a draft of a predecessor bill for the Act (49), states that embryo research should be permitted only if research with non-embryonic sources would not achieve the sought after research outcomes, which still leaves open a fairly wide field of inquiry. Although no guidance is currently available on the purposes that will be deemed acceptable, the Commission Report’s recommendations may prove useful here. These included the recommendation that no embryo research be undertaken for commercial gain, that the objectives of such research be achievable only through the use of embryos, and that any research involving the genetic alteration of embryos would not be permissible. The Agency has the power to set the conditions of licenses, inspect premises, and revoke licenses, but as far as policy is concerned it is limited to a consultative role. The Minister of Health can issue policy directives. It is interesting to note that the regulations adopted under the Act, which include those dealing with licensing conditions, designating, and further explaining regulated activities, the rules for clinical trials of a controlled activity, and the exemption of controlled activities from the conditions of the Act under certain conditions, must be laid before both Houses of Parliament for comment before they come into force (see Note 18). This was recommended in the Standing Committee Report to ensure that elected representatives would approve regulation on such controversial subjects.

Ethical and Legal Aspects

291

Embryos for reproduction and embryos for research. Embryos destined to be implanted are protected by additional restrictions, hinting at a different moral status, possibly based on the recognition of their potential to develop into a human being. For example, no selection of the sex of embryos can be carried out except for medical reasons (see Note 19). Society’s interest in protecting itself and the embryo from gender-based discrimination is seen as sufficient to limit parental autonomy in this matter. Modifying the germ line of an embryo so that the mutation is transmissible is also prohibited (see Note 20), reinforcing the statement in Section 2 of the Act that the integrity of the human genome requires protection. These observations support the suggestion that the status of the in vitro embryo intended for implantation is in fact based on its potential for human life. As a future member of the society, it deserves protection in accordance with society’s values, which may outweigh parental autonomy and desires in some respects. However, when the embryo is no longer required for the realization of a parental project, its protection seems more limited, although it benefits from a certain measure of respect. As previously mentioned, a criterion of necessity applies to research that is to be carried out with embryos, but no guidance or decision history is currently available to interpret the word “necessary.” Other prohibitions that limit what can be done to the embryo at this stage also seem to be concerned with preserving embryos’ identity as humans. For example, the mixing of cells from another organism, animal, or human, with a human embryo to create a “chimera” is prohibited in all cases, whereas the mixing of human and animal gametes or nuclei and eggs to create a “hybrid” is prohibited for reproductive purposes only. This may be due to an underlying view of the human embryo as intrinsically deserving more respect than a non-human entity, even if it is slated for destruction. The prohibition on ectogenesis – no embryo may be kept outside a woman’s womb longer than 14 days – may be aimed, at least in part, at protecting research embryos from pain and suffering. This 14-day cut-off is a commonly-used limit because the embryo is known not to have begun differentiation of its future nervous system at this stage. Some also see it as the point where an embryo becomes an individual. However, the main reason invoked to prohibit this type of research in both the Commission Report and the Standing Committee Report was the preservation of the role of women in reproduction and the welfare of children (23, 49). The creation of embryos for research. The creation of embryos for reproductive purposes is acceptable in Canada, as is the creation of embryos for research or instruction in assisted reproduction techniques. This is a pragmatic recognition that IVF came about through research and that research is the only way to improve it, as was recognized in both the Commission Report

292

Knoppers, Bordet, and Isasi

and the Standing Committee Report (23, 49). The Act expressly states that the health and well-being of children born through the application of assisted human reproductive technologies must be given priority in all decisions respecting their use. Thus Canadian law takes it for granted that the health and well-being of those children born from assisted reproduction, and of the adults using these techniques, prevails over any consideration granted to the embryo. It is not permissible to create embryos through cloning or for research other than the improvement of assisted reproduction techniques. Some have argued that although the reasons of the drafters of the Act for a ban on cloning are unclear, Parliamentary debate seemed to focus on the moral status of the embryo (50). It has also been argued that the prohibition against research cloning really aims to protect women from potential coercion and exploitation as oocytes donors (37), since the Act currently appears to permit the creation of hybrids – for research purposes only – by inserting human nuclear DNA into an animal oocyte (see Note 21). It may be that the slope from “hybrid cloning” to reproductive cloning is seen as less slippery, and the moral status of an embryo with human nuclear DNA and animal mitochondrial DNA may be perceived as lesser than that of an embryo with all-human DNA, but the protection of women also seems like a convincing consideration. The protection of presumably “vulnerable” women could also underlie the prohibition on creating embryos for research in general. This was the concern expressed in the Commission Report’s recommendation that such research should be allowed, but that no retrieval cycles be undertaken to produce oocytes for research (23). The woman’s interest may be to use her oocytes for reproductive purposes; by only allowing existing embryos to be used for research, all of a woman’s oocytes are prioritized for her own use (see Note 22), and there is no additional risk to her due to additional procedures. This opinion is controversial: as remarked by the British Human Fertilisation and Embryology Authority, it could also be in a woman’s interest to donate her oocytes to research, and she should be allowed to make this decision (51). A concern with commodification of the embryo underlies Section 7(2) of the Act, which prohibits the advertising, purchase, and sale of embryos and removes them from the commercial realm. Gametes are covered by a similar prohibition (see Note 23), indicating a measure of respect for human reproductive material. The Standing Committee Report supports this interpretation, as it states that human gametes and embryos derive some status from the fact that they are associated with the human species; thus, one source of this respect seems to be gametes’ and embryos’ genetic “humanity” and association with reproduction. Another explicitly referred to is that embryos are seen as a

Ethical and Legal Aspects

293

potential human life, although, as previously discussed, this does not seem to apply in all circumstances.

3. International Perspectives The following is a brief survey of the legal regimes applicable to embryos in other countries, chosen to illustrate some very different views of the status of the embryo. 3.1. Germany

The German Constitution includes a right to life for everyone and respect for the dignity of man, which includes the embryo (see Note 24). The Embryo Protection Law of 1990 was thus adopted to protect the embryo in conformity with the Constitution; in Germany, it is prohibited in most situations to create more embryos than are intended to implant within one treatment cycle, so that spare embryos are not normally generated. Any research on an embryo not aimed at curing it from disease is also prohibited (see Note 25), as is the derivation of new stem cell lines from human embryos. A general ban on the import and use of these cells is implemented by the German Stem Cell Act of 2002 (52), although exceptions can be made for publicly and privately funded research purposes under strict conditions and with approval by a government agency (see Note 26). Much debate took place in Germany concerning the recent amendment of this law, which now permits the use of imported stem cells derived before May 1, 2007. A recent opinion of the German National Ethics Council illustrates the difficulty of resolving this issue, as 14 of the 24 members of the Council were in favor of the amendment, while the remainder, for different reasons, dissented (53). The German regime demonstrates that granting the embryo human dignity and a right to life influences the regulation and practice of IVF and leads to a prohibition of non-therapeutic research on embryos, which in turn raises questions concerning the further development of IVF technology, as well as other types of research. A recently published paper argues that the constitutional protection of the embryo in Germany is undermined by the decision of the German Constitutional Court that effectively legalizes abortion and that as a result of this decision, the Embryo Protection Law could be amended to permit preimplantation genetic diagnosis (PGD) and embryo research. For the moment, however, German couples wishing to undergo PGD and avoid the birth of a child affected by a genetic disease must do so outside their country, although it is possible for them to obtain prenatal diagnosis and undergo an abortion if the embryo or fetus is affected (54).

294

Knoppers, Bordet, and Isasi

3.2. The United Kingdom

In contrast, the United Kingdom has established a regulatory regime that governs all assisted reproduction and related matters, overseen by a non-governmental agency, the Human Fertilization and Embryology Authority (“HFEA”), which was created by the HFE Act in 1990 (see Note 27). The mandate of HFEA includes the regulation of research with embryos through a licensing system. A Code of Practice applies to all licensed activities. With the appropriate license, an investigator may create embryos for research, including through therapeutic cloning (see Note 28), although no research can be carried out on embryos past the earlier of the appearance of the primitive streak or 14 days of development (see Note 29). The HFEA’s mandate is to ensure that such research takes place for authorized purposes (see Note 30). The recent changes to the HFE Act include an increase in the scope of permitted research with embryos to include serious medical conditions (such as injury), an explicit acknowledgement and regulation of the possibility of creating hybrid embryos under license for research (see Note 31), and the removal, for research purposes only, of the prohibition on altering the genetic structure of cells that form part of an embryo (see Note 32). The current and proposed legislative framework in the United Kingdom reflects both a lack of moral status for the human embryo and a degree of respect for it, in that research involving embryos can only take place for specified purposes and is licensed on a project-by-project basis to ensure compliance with the protective provisions of the HFE Act.

3.3. The United States

The United States does not have a federal law regulating research with embryos, but federally funded research involving embryos was banned in 1980. In 1993, this ban was removed by President Clinton, but in 1996 the Dickey-Wicker Amendment was adopted by Congress, and attached to the NIH appropriation bill every year since then. The text of this amendment prohibits government funding for “the creation of a human embryo or embryos for research purposes, or research in which a human embryo or embryos are destroyed, discarded, or knowingly subject to risk of injury or death greater than allowed for research on fetuses in utero (. . .)” (55, see Note 33). This amendment has been interpreted by the Bush administration as prohibiting funding for research not only on embryos, but also on embryonic stem cells themselves, although a limited exception was introduced in 2001, allowing research only on cell lines derived prior to August 9, 2001. The embryo research debate in the United States appears to have been hijacked by the stem cell and cloning debate, due to the promise of so-called therapeutic cloning for stem cell research;

Ethical and Legal Aspects

295

Congress is evenly divided between those who want to prohibit all forms of cloning and those wishing to ban reproductive cloning but permit therapeutic cloning. According to one count, there have been more than 40 attempts since 2001 to pass federal legislation dealing with cloning and stem cell research (56). In 2006, Congress passed the Stem Cell Research Enhancement Act of 2005 (57), which provided federal funding for embryonic stem cell research on spare embryos (see Note 34). This bill was vetoed by President Bush on July 19, 2006. A similar scenario replayed in 2007, with the passage of the Stem Cell Research Enhancement Act of 2007 (58), which allowed federal funding for research on stem cells derived from spare embryos that are slated for destruction, but was vetoed by Bush on June 20, 2007 (59). In neither case were sufficient majorities obtained in Congress to override the presidential veto. An executive order was passed on June 22, 2007, directing federal granting agencies to provide funding for human pluripotent stem cell lines produced in ways that do not create, destroy, or harm human embryos (60). The stem cell debate thus seems to have reproduced the deeply divisive politics of abortion in the United States, based on differing views of moral status of the unborn human being and the appropriate weight to be given to this versus other considerations. In the absence of federal legislation, the private sector is essentially free to carry out such research as it pleases, subject to legislative action by the states. This situation has led to calls for regulation of embryo research and therapeutic cloning.

4. Embryonic Stem Cell Research and Therapeutic Cloning

4.1. The Stem Cell Controversy

The debate surrounding embryonic stem cell research and the efforts made by scientists and ethicists to find alternative sources of stem cells make it an interesting case study when considering research with embryos. Stem cells are cells with the capacity to differentiate into specialized cells of many types and can be isolated from various tissues in the human body (61). Stem cells derived from human embryos, known as embryonic stem cells, have this capacity to a greater degree than many other stem cells, raising hopes that they could be used in regenerative medicine. However, the derivation of stem cell lines from embryos generally requires their destruction, making this technique controversial. Embryonic stem cells could in principle be derived from an embryo created by introducing a patient’s own body cells into an enucleated oocytes, a technique

296

Knoppers, Bordet, and Isasi

known as somatic cell nuclear transfer (SCNT). Such stem cells would be fully compatible with the patient, eliminating tissue rejection on transplantation (see Note 35). Many of the recent discussions of the moral status of the embryo have taken place against this backdrop of great hopes for embryonic stem cells. Embryos are not the only source of stem cells, and stem cells from other sources are already being used as treatments for disease (see Note 36). As a result, many argue that embryo research is not necessary in this area, especially in light of recent promising research involving the “reprogramming” of somatic cells (see Section 4.2). However, knowledge in this field remains preliminary, and many scientists argue for concurrent research on different kinds of stem cells to properly understand the differentiation and control mechanisms that would accelerate their use in therapy (62–64). They also recognize that any such treatments will require much time and effort, and that no short-term benefits should be expected. Embryonic stem cells have been implicated in the cloning controversy, because the SCNT procedure could also eventually be used to produce cloned human beings, although this is disputed (65 and see Section 4.2). Fears of the misuse of this technology for human reproductive cloning were invoked to justify the prohibition of stem cell research involving SCNT, in addition to arguments about the destruction of the embryos. Other ethical issues associated with research in the field of human reproduction came to the fore when one of the leading scientists in the field was found to have falsified his results, and also, allegedly, to have secured oocytes to carry out his experiments from female laboratory personnel in exchange for payment (66–68). 4.2. Alternative Sources of Pluripotent Stem Cells

The creation and destruction of embryos in stem cell research have been the focus of an intense debate, due to ethical concerns and the resulting regulatory restrictions on this research in some countries, such as the United States and Canada. This has spurred efforts to develop alternative ways to make cells with as much potential as embryonic stem cells. Some of the current alternatives are discussed below. Somatic cell reprogramming. Recent progress in the reprogramming of somatic cells into pluripotent cells – induced pluripotent cells or iPS cells – has given rise to the hope that embryo destruction may not be necessary to obtain patientspecific stem cell lines. Animal studies have recently been confirmed with human cells: human fibroblasts were “reprogrammed” by the introduction of four genes into these cells using a viral vector. Additional work seems to indicate that a similar

Ethical and Legal Aspects

297

result can be obtained using fewer or different genes, thus avoiding the use of a known oncogene (69–72). This work is exciting because it could permit the derivation of patient-specific stem cell lines without the need for embryo destruction or human oocytes, making it more likely that, if therapeutic applications are one day developed for these cells, they will be widely available. Embryo biopsy. This procedure involves removal of one cell from the embryo at an early stage of development (8–10 cells) and its use in culture to derive embryonic stem cells. Advanced Cell Technology recently announced the successful use of this technique to derive five embryonic stem cell lines that appear to have all the desired characteristics (73). Apparently, the biopsied embryos continued development normally until the blastocyst stage. Embryo biopsy at this stage is currently carried out for PGD, a diagnostic technique used to select embryos unaffected by genetic disease for implantation. Among the advantages claimed for this method is the fact that the embryo is not destroyed. Detractors argue that the dangers for the biopsied embryo are not currently known and that it would be unconscionable to ask IVF patients who do not require PGD to take this additional risk. A previous suggestion made by Lanza that the technique could be used for embryos already undergoing PGD, and that children resulting from this procedure would have their own customized stem cell lines, has met with skepticism. For embryos already undergoing PGD, the cell removed in biopsy must be cultured until it divides so that one cell is available for genetic diagnosis and the other cell can be used to generate stem cells. If this cell dies in culture, the possibility of diagnosis is lost, leading to an objection that this risk is unacceptable for parents who require the diagnosis (74). Another objection is that embryo cells at this stage are totipotent, which means that the removed cell also has the potential to develop into a human being; those who ascribe full moral status to embryos based on this potential would also see the destruction of this totipotent cell as unacceptable. Parthenogenesis. Parthenogenesis involves the development of an unfertilized oocyte. Although reproduction is not currently possible in mammals with this technique, embryo-like structures called parthenotes can develop for a short time. It has recently been shown that stem cells can be derived from human parthenotes (75). Altered Nuclear Transfer (ANT). This proposal, initially made by Hurlbut, involves the use of genetically altered cells in SCNT to create development-incompetent entities, which could be destroyed to derive embryonic stem cell lines without causing ethical issues. The use of a mutation that can be activated and

298

Knoppers, Bordet, and Isasi

deactivated has been suggested to achieve this, so that the stem cells derived from this entity can be “repaired” after derivation (76). Several arguments have been opposed to this method, including the fact that the genetic modifications or the additional manipulations involved might make any derived stem cells unsafe for therapeutic use and that proof of concept for this technique will itself involve embryo research. Some also argue that willfully interfering with the future development of what might otherwise be a viable embryo involves similar moral considerations as preventing it from development at a later stage, especially if this interference is achieved through a “reversible” genetic defect (13). Somatic cell nuclear transfer. A recently formulated theory holds that ANT may not be required because, in fact, “embryos” obtained from SCNT already are incapable of development into a human being. This is based on evidence that primate eggs have particular characteristics that could effectively make it impossible to reproductively clone primates through SCNT (13). As acknowledged by Hurlbut, science has not currently determined the precise balance of material components essential to create a diploid cell with true developmental potential. It is thus possible that many “embryos” resulting from SCNT lack this potential. However, no reliable empirical evidence is available to indicate whether such cloned embryos are in fact incapable of developing into a human being, and the production of this evidence involves risking the destruction of embryos. Conclusive proof that reproductive cloning is, in fact, impossible in humans may also be difficult to provide: continued failure may imply that the SCNT “embryo” really does not have the potential to develop or simply that this potential is always destroyed in the laboratory. Such a proof would, however, dispel concerns about the “slippery slope” from therapeutic to reproductive cloning. This proposed solution, like parthenogenesis and the ANT proposal, relies on an argument from potential to deny moral status to the created entity: any entity that cannot develop into a human being can be used and destroyed in experiments or for treatment. As noted by some authors, the creation of deliberately damaged “pseudo-embryos,” that may be considered as human life, is unacceptable for those who attach moral status to the embryo (77, 78). These alternatives will not necessarily prove useful outside of stem cell research, and it may remain necessary to create and destroy embryos. However, the intense scientific, ethical, and regulatory discussion surrounding stem cells illustrates the importance of moral considerations, such as the moral status of the embryo, in current science policy.

Ethical and Legal Aspects

299

5. Conclusion This chapter has considered the moral status of the human embryo, an issue central to decision-making on embryo research, before undertaking a survey of the legal status of the human embryo in Canada. The current Canadian legal regime does not grant full legal status to the embryo, but does afford it some protection from commodification and from being used unnecessarily in research. The contours of this protection may emerge more clearly as the regulatory process begun pursuant to the Assisted Human Reproduction Act continues. The Canadian situation contrasts with the German regime, where the embryo has, at least in theory, constitutional protection of its right to life and human dignity. In the United States, a divided Parliament and society have resulted in the prohibition of federally funded research that is destructive of embryos, while the private sector has free rein to carry out embryo-related research in states that do not choose to regulate such research. Canada’s regime seems closer to that of the United Kingdom; in both countries, the embryo has a status broadly consistent with the “gradualist” approach to the moral status of the embryo (29). Unlike in the United Kingdom, in Canada a prohibition applies to the creation of embryos for research (other than research to improve assisted reproduction techniques) and to therapeutic cloning. This may be intended to protect women, as the current source of oocyte for these procedures, from potential coercion and risky egg retrieval procedures. If that is the case, foreseeable developments such as better oocyte preservation and the generation of gametes in vitro may alter the balance of considerations in play: when fewer spare embryos are generated because of better oocyte conservation techniques, and it becomes possible to generate oocytes without exposing women to risk, perhaps these prohibitions will be revisited. On the other hand, if they are based on concerns for commodification of the embryo and the respect due to it, it is unlikely that this will be the case. The identification of less ethically controversial alternatives to embryo research is progressing, especially in the field of stem cells. The process of developing these methods underscores the fact that moral reflection on the status of the embryo does depend on empirical facts, if only to determine what is an embryo and what is not, for example. Moral status is both a conceptual and a value-laden matter. Science continues to challenge our thinking in this regard, with uncertainty remaining the one constant. The creation of “cybrids” by SCNT of human nuclei into animal eggs illustrates this as it stimulates reflection on the question of how human is human. Thus, it would seem that the best that can be done is recognizing “what

300

Knoppers, Bordet, and Isasi

we know and what we do not know, but have an obligation to find out, about what it is to be human and what it is to have moral status” (28).

6. Notes 1. 2. 3. 4. 5. 6. 7.

8. 9. 10. 11. 12. 13. 14. 15. 16.

17.

18. 19. 20. 21. 22.

23.

Section 3 of the Act. Austria and Italy are examples. Section 5(1)(b) of the Act. Sections 5(1)(a) and 5(1)(c) of the Act. Sections 10(2) and 10(3) of the Act. Section 13 of the Act. The Agency has the responsibility to promote the health and safety, and the human dignity and human rights of Canadians, and to foster the application of ethical principles to assisted reproduction and related matters, including research. It also is responsible for administering the licensing and monitoring schemes applicable to controlled activities and for that purpose has enforcement and inspection powers under the Act. Section 40(2) of the Act, not currently in force. Section 71 of the Act. Section 8 of the Act and the related regulations (the “Regulations”) (79). Section 13 of the Regulations. Section 14(3) of the Regulations. Sections 13(2) and 4 of the Regulations. Section 5(1)(d) of the Act. Section 5(1)(i) of the Act. The Canadian Institutes for Health Research (CIHR), Natural Sciences and Engineering Council of Canada (NSERC), and the Social Sciences and Humanities Research Council (SSHRC). The regulatory regime contained in the Act is incomplete, and it is possible that regulations will eventually bridge this gap between federally funded research and other research. Section 66 of the Act. Section 5(1)(e) of the Act. Section 5(1)(f) of the Act. Section 5(1)(g) of the Act. One author has argued that this is not the case when fresh embryos are used for stem cell research and that this practice should therefore be banned. Please refer to McLeod, C. and Baylis, F. (2007) (38). Section 7(1) of the Act.

Ethical and Legal Aspects

301

24. Articles 1(1) and 2(2) of the Basic Law. 25. Embryos that do not show the capacity to develop can be experimented on, but all embryos are presumed to be so capable for the first 24 h after penetration of sperm into the oocyte. 26. This includes a cut-off date: the cells must have been derived before May 1, 2007. The aim of this law is to ensure that no actions in Germany will have instigated the derivation of stem cells from embryos elsewhere. Please refer to Merkel, R. (2007) (54). 27. This Act was recently amended by the Human Fertilisation and Embryology Act 2008 (26), which received royal assent on November 13, 2008. 28. According to the HFEA, only one such license to derive stem cells from human embryos made by cloning, has been granted; in addition, three licenses were recently granted to carry out similar work using “cybrids,” embryos made by the introduction of a human somatic cell nucleus into an animal oocyte. See current projects online at http://www.hfea.gov.uk/en/374.html, accessed November 14, 2008. Reproductive cloning is prohibited by the Human Reproductive Cloning Act 2001 (80). 29. Section 3(4) of the HFE Act. 30. Section 3A(2) of Schedule 2 to the HFE Act. The authorized principal purposes are (a) increasing knowledge about serious disease or other serious medical conditions; (b) developing treatments for serious disease or other serious medical conditions; (c) increasing knowledge about the causes of any congenital disease or congenital medical condition that does not fall within paragraph (a); (d) promoting advances in the treatment of infertility; (e) increasing knowledge about the causes of miscarriage; (f) developing more effective techniques of contraception; (g) developing methods for detecting the presence of gene, chromosome, or mitochondrial abnormalities in embryos before implantation; or (h) increasing knowledge about the development of embryos. 31. This research was already authorized under the previous HFE Act: Two licenses for so-called cybrid research were issued on January 17, 2008 by the HFEA and one was issued on June 18, 2008. Please refer to the HFEA Statement on licensing of applications to carry out research using human-animal cytoplasmic hybrid embryos (81). 32. Section 6 of the amendments to Schedule 2 made to the previous act by the 2008 act.

302

Knoppers, Bordet, and Isasi

33. Section 128 of the statute (55). 34. The Fetus Farming Prohibition Act of 2006, S. 3504 was passed at the same time; it prohibits the use of tissue gestated solely for research purposes. 35. Except for mitochondrial antigens, but preliminary evidence in animals suggests this is not an important concern. Please refer to Drukker, M. (2008) (75). 36. Examples are stem cells from umbilical cord blood and bone marrow, which are used to treat patients suffering from blood malignancies and metabolic diseases. See, online: http://www.marrow.org/PATIENT/Undrstnd˙ Disease˙Treat/Lrn˙about˙Disease/index.html, accessed November 14, 2008.

Acknowledgment The authors thank the Stem Cell Network of Canada for its funding support. References 1. Dhonte-Isnard, E. (2004) L’embryon ´ humain in vitro et le droit, Edition L’Harmattan, Paris, France. 2. Assisted Human Reproduction Act, S.C. 2004, c. 2 (Canada). 3. Deckers, J. (2007) Why Eberl is wrong. Reflections on the beginning of personhood. Bioethics 21, 270–89. 4. Walin, L. (2007) Ambiguity of the embryo protection in the human rights and biomedicine convention: Experiences from the Nordic countries. Eur. J. Health Law. 14, 131–48. 5. Green, R.M. (2001) The Human Embryo Research Debates: Bioethics in the Vortex of Controversy. Oxford University Press, Oxford, New York. 6. DeGrazia, D. (2006) Moral status, human identity and early embryos: a Critique of the President’s approach. J. Law Med. Ethics 34, 49–57. 7. Gomez-Lobo, A. (2007) Individuality and human beginnings: A reply to David DeGrazia. J. Law Med. Ethics 35, 457–62. 8. Krones, T., Schl¨uter, E., Neuwohner, E., El Ansari, S., Wissner, T. and Richter, G. (2006) What is the preimplantation embryo? Soc. Sci. Med. 63, 1–20. 9. Charo, R.A. (2001) Every cell is sacred: Logical consequences of the argument from

10. 11.

12. 13. 14. 15. 16. 17. 18.

potential in the age of cloning. In: Lauritzen, P. (ed.), Cloning and the Future of Human Embryo Research. Oxford University Press, Oxford, New York, pp. 82–89. FitzPatrick, W.J. (2004) Totipotency and the moral status of embryo: new problems for an old argument. J. Soc. Philos. 35, 108–22. Deckers, J. (2007) Why two arguments from probability fail and one argument from Thomson’s analogy of the violinist succeeds in justifying embryo destruction in some situations. J. Med. Ethics 33, 160–64. Agar, N. (2007) Embryonic potential and stem cells. Bioethics 21, 198–207. Hyun, I. and Jung, K.W. (2006) Human research cloning, embryos, and embryo-like artifacts. Hastings Center Rep. 36, 34. Singer, P. and Dawson, K. (1988) IVF technology and the argument from potential. Philos. Public Aff. 17, 87. Camporesi, S. (2007) The context of embryonic development and its ethical relevance. Biotechnol. J. 2, 1147–53. Annas, G. (1996) The politics of humanembryo research: avoiding ethical gridlock. N. Engl. J. Med. 334, 1329–32. Lizza, J.P. (2007) Potentiality and human embryos. Bioethics 21, 379–85. Tauer, C. (2001) Responsibility and regulation: reproductive technologies, cloning

Ethical and Legal Aspects

19. 20.

21. 22. 23.

24.

25.

26.

27. 28. 29. 30. 31.

32.

33.

and embryo research. In: Lauritzen, P. (ed.), Cloning and the Future of the Human Embryo. Oxford University Press, Oxford, New York, pp. 145–61. Elliott, K. (2007) An ironic reductio for a “pro-life” argument: Hurlbut’s proposal for stem cell research. Bioethics 21, 98–110. Steinbock, B. (1992) Life Before Birth – The Moral and Legal Status of Embryos and Fetuses. Oxford University Press, Oxford, New York. Steinbock, B. (2007) The science, policy and ethics of stem cell research. Reprod. BioMed. Online 14, 130. Bortolotti, L. and Harris, J. (2005). Stem cell research, personhood and sentience. Reprod. BioMed. Online 10, 68. Royal Commission on New Reproductive Technologies. (1993) Proceed with Care – Final Report of the Royal Commission on New Reproductive Technologies. Minister of Government Services, Ottawa, Canada. Warnock, M. (1984) Report of the Committee of Inquiry into Human Fertilisation and Embryology. H. M. Stationery Office, London, UK. National Institutes of Health. (1994) Report of the Human Embryo Research Panel. National Institutes of Health, Bethesda, USA. Human Fertilisation and Embryology Act 1990, 1990 c. 37 (U.K.), as amended by the Human Fertilisation and Embryology Act 2008, 2008 c. 22 (U.K.) (the “HFE Act”). Robertson, J.A. (1995) Symbolic issues in embryo research. Hastings Center Rep 25, 37. Gibson, S. (2007) Uses of respect and uses of the human embryo. Bioethics 21, 370–78. Beyleveld, D. (2000) Is embryo research and preimplantation diagnosis ethical? Forensic Sci Int. 113, 461–75. Th´evoz, J.-M. (1990) Entre nos mains l’embryon: recherche bio´ethique. Labor et Fides, Geneva, Switzerland. Ryan, M.A. (2001) Creating embryos for research: on weighing symbolic costs. In: Lauritzen, P. (ed.), Cloning and the Future of Embryo Research. Oxford University Press, Oxford, New York, pp. 50–66. Keenan, J.S.J. (2001) Casuistry, virtue and the slippery slope: major problems with producing human embryonic life for research purposes. In: Lauritzen, P. (ed.), Cloning and the Future of Human Embryo Research. Oxford University Press, Oxford, New York, pp. 67–81. Steering Committee on Bioethics (CDBI). (2003) The Protection of the Human Embryo

34.

35. 36.

37.

38.

39. 40. 41. 42. 43. 44.

45.

46.

47.

48.

303

In Vitro – Report by the Working Party on the Protection of the Human Embryo and Fetus, Council of Europe, Strasbourg, France. Deckers, J. (2005) Why current UK legislation on embryo research is immoral. How the argument from lack of qualities and the argument from potentiality have been applied and why they should be rejected. Bioethics 19, 251–71. Callahan, D. (1995) The puzzle of profound respect. Hastings Center Rep. 23, 39. Campbell, C.S. (2001) Source or resource? Human embryo research as an ethical issue. In: Lauritzen, P. (ed.), Cloning and the Future of Human Embryo Research. Oxford University Press, Oxford, New York, pp. 34–49. Mykitiuk, R., Nisker, J. and Bluhm, R. (2007) The Canadian assisted human reproduction act: protecting women’s health while potentially allowing human somatic cell nuclear transfer into non-human oocytes. Am. J. Bioeth. 7, 71–73. McLeod, C. and Baylis, F. (2007) Donating fresh versus frozen embryos to stem cell research: in whose interests? Bioethics 21, 465–77. R. v. Morgentaler. (1988) 1 S.C.R. 30. Tremblay v. Daigle. (1989) 2 S.C.R. 530. Dobson (Lit. Guardian of) v. Dobson. (1999) 2 S.C.R. 753. Winnipeg Child and Family Services (NW Area) v. DFG (1997) 3 S.C.R. 925. R. v. Sullivan. (1991) 1 S.C.R. 489. NSERC, SSHRC, CIHR. Tri-Council Policy Statement: Conduct of Research Involving Humans, 1998–2005, online: http://www. pre.ethics.gc.ca/english/policystatement/ policystatement.cfm, accessed November 14, 2008. Order in council 1177–2004, December 15, 2004 (G.O.Q. 2005.ii.62), subsequently amended by order in council 73-2006, February 14, 2006 (G.O.Q. 2006.ii.1290). Renvoi fait par le gouvernement du Qu´ebec en vertu de la Loi sur les renvois a` la Cour d’appel, L.R.Q. ch. R-23, relativement a` la constitutionnalit´e des articles 8 a` 19, 40 a` 53, 60, 61 et 68 de la Loi sur la procr´eation assist´ee, L.C. 2004, ch. 2 (Dans l’affaire du), 2008 QCCA 1167. CIHR. (2007) Updated Guidelines for Pluripotent Stem Cell Research, June 29, 2007, online: http://www.cihr-irsc.gc.ca/ e/34460.html, accessed November 14, 2008. ESHRE Task Force on Ethics and Law. (2001) I. The moral status of the

304

49.

50.

51.

52.

53.

54. 55. 56.

57. 58. 59.

Knoppers, Bordet, and Isasi pre-implantation embryo. Human Reprod. 16, 1046. Standing Committee on Health, House of Commons. (2001) Assisted Human Reproduction: Building Families, online: http:// cmte.parl.gc.ca/cmte/Committee Publication.aspx?COM=218&Lang=1& SourceId=213651, accessed November 14, 2008. Caulfield, T. and Bubela, T. (2007) Why a criminal ban? Analyzing the arguments against somatic cell nuclear transfer in the Canadian parliamentary debate. Am. J. Bioeth. 7, 51–61. Human Fertilisation and Embryology Authority. (2007) HFEA Statement on Donating Eggs for Research, 21 February 2007, online: http://www.hfea.gov.uk/en/ 1491.html, accessed November 14, 2008. Act Ensuring the Protection of Embryos in Connection with the Importation and Utilization of Human Embryonic Stem Cells (Stem Cell Act), 28 June 2002, as modified by the Bundestag on April 11, 2008, German Bundestag relaxes Stem Cell Act, online: http://www.bio-pro.de/en/ life/magazin/04713/index.html, accessed November 14, 2008. German National Ethics Council. (2007) Should the Stem Cell Law Be Amended? Opinion, online: http://www.ethikrat.org/˙ english/publications/Opinion˙Should˙the˙ Stem˙Cell˙Law˙be˙ amended.pdf, accessed November 14, 2008. Merkel, R. (2007) The legal status of the human embryo. Reprod. BioMed. Online 14, 54. Public Law 104-99 (The Balanced Budget Downpayment Act, 1), (1996) 104th Congress (U.S.) Fukuyama, F. and Franco, F. (2008) Beyond bioethics. A Proposal for Modernizing the Regulation of Human Biotechnologies.The Paul H. Nitze School of Advanced International Studies, Washington, DC, available online from: http://www.biotechgov.org/, accessed November 14, 2008. Stem Cell Research Enhancement Act of 2005 (H.R. 810), (2006) 109th Congress (U.S.) Stem Cell Research Enhancement Act of 2007 (S. 5), (2007) 110th Congress (U.S.) Office of the Press Secretary. President Bush Discusses Stem Cell Veto and Executive Order, 2007, online: http://www. whitehouse.gov/news/releases/2007/06/ print/20070620-8.html, accessed November 14, 2008.

60. Executive Order No. 13435, 2007 Federal Register, Vol. 72, No. 120, p. 34589. 61. Ratajczak, M.Z., Machalinski, B., Wojakowski, W., Ratajczak, J. and Kucia, M. (2007) A hypothesis for an embryonic origin of pluripotent Oct-4(+) stem cells in adult bone marrow and other tissues. Leukemia 21, 860–67. 62. Zaehres, H. and Scholer, H. (2007) Induction of pluripotency: from mouse to human. Cell 131, 834–35. 63. Pera, M.F. and Hasegawa, K. (2008) Simpler and safer cell reprogramming. Nat. Biotechnol. 26, 59–60. 64. European Molecular Biology Organization. (2006) Stem Cell Research – Status Prospects Prerequisites, online: http://www.embo. org/scisoc/EMBO˙Stem˙Cell˙30˙nov.pdf, accessed November 14, 2008. 65. The President’s Council on Bioethics. (2002) Human Cloning and Human Dignity: An Ethical Inquiry, Washington, DC, online: http://bioethics.gov/reports/cloningreport/ index.html, accessed November 14, 2008. 66. Holden, C. (2006) Stem cell research. Korean cloner admits lying about egg donations. Science 310, 1402–03. 67. Editorial. (2006) Ethics and fraud. Nature 439, 117–18. 68. Cyranoski, D. (2006) Verdict: Hwang’s human stem cells were all fakes. Nature 439, 122–23. 69. Park, I.H., Zhao, R., West, J.A., Yabuuchi, A., Huo, H., Ince, T.A., Lerou, P.H., Lensch, M.W. and Daley, G.Q. (2008) Reprogramming of human somatic cells to pluripotency with defined factors. Nature 451, 141–46. 70. Yu, J., Vodyanik, M.A., Smuga-Otto, K., Antosiewicz-Bourget, J., Frane, J.L., Tian, S., Nie, J., Jonsdottir, G.A., Ruotti, V., Stewart, R., Slukvin, I.I. and Thomson, J.A. (2007) Induced pluripotent stem cell lines derived from human somatic cells. Science 318, 1917–20. 71. Nakagawa, M., Koyanagi, M., Tanabe, K., Takahashi, K., Ichisaka, T., Aoi, T., Okita, K., Mochiduki, Y., Takizawa, N. and Yamanaka, S. (2008) Generation of induced pluripotent stem cells without Myc from mouse and human fibroblasts. Nat. Biotechnol. 26, 101–06. 72. Takahashi, K., Tanabe, K., Ohnuki, M., Narita, M., Ichisaka, T., Tomoda, K. and Yamanaka, S. (2007) Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell 131, 861–72. 73. Chung, Y., Klimanskaya, I., Becker, S., Li, T., Maserati, M., Lu, S.J., Zdravkovic,

Ethical and Legal Aspects T., Ilic, D., Genbacev, O., Fisher, S., Krtolica, A. and Lanza, R. (2008) Human embryonic stem cell lines generated without embryo destruction. Cell Stem Cell. 2, 113–17. 74. Hudson, K. (2006) Embryo biopsy for stem cells: trading old problems for new ones. Hastings Center Rep. 36, 50. 75. Drukker, M. (2008) Recent advancements towards the derivation of immunecompatible patient-specific human embryonic stem cell lines. Semin. Immunol. 20, 123. 76. Hurlbut, W.B., George, R.P. and Grompe, M. (2006) Seeking consensus: a clarification and defense of altered nuclear transfer. Hastings Center Rep. 36, 42.

305

77. Liao, S.M. (2005) Rescuing human embryonic stem cell research: the blastocyst transfer method. Am. J. Bioeth. 5, 8–16. 78. Philpott, S. (2005) Eggs, lies and compromise. Am. J. Bioeth. 5, 1–3. 79. Assisted Human Reproduction (Section 8 Consent) Regulations (the “Regulations”), SOR/2007-137, P.C. 2007-958, Canada Gazette Part. II, Vol. 14, No. 13, p. 1520. 80. Human Reproductive Cloning Act 2001, 2001 c. 23 (UK). 81. HFEA Statement on licensing of applications to carry out research using humananimal cytoplasmic hybrid embryos, online: http://www.hfea.gov.uk/en/1640.html, accessed November 14, 2008.

Index

A

bpV[pic] protein tyrosine phosphatase inhibitor . . . . . . . 90, 93–95 Bradford . . . . . . . . . . . . . . . . . . . 116, 171, 173, 226, 229, 235 Bulbourethral glands . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 138

Abortion . . . . . . . . . . . . . . . . . . . . . . . . . . . xi, 68, 287, 293, 295 Absorption . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 73, 235 ACAT (acyl-coenzyme a cholesterol acyl transferase) . . . . . . . . . . . . . . . . . . viii, 6, 169–175, 223 Aconitase . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . viii, 225–237 Acrylamide . . . . 65, 70, 91, 96, 97, 106, 116, 117, 208, 219, 227, 229, 230 Adenylate cyclase . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 90 Adipose . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 17, 135 Adrenal . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 127, 128, 132, 135 Alexa Fluor . . . 79, 84, 90, 95, 108, 121, 122, 140, 142, 153 American mink (mustela vison) . . . . . . . . . . . . . . . . . . 4, 11, 12 AMV reverse transcriptase . . . . . . . . . . . . . . . . . . . . . . . . . . . 34 Androstenedione . . . . . . . . . . . . 128, 129, 130, 133, 135, 136 Ang (Angiotensin II) . . . . . . . . . . . . . . . . . 103, 104, 123, 226 Animal . . . . . . . . . . . . . . v, viii, x, 4, 6–7, 12, 17, 55, 60, 104, 105, 160, 162, 163, 170–171, 181, 182–185, 187, 190–192, 195, 205–206, 220, 225, 226, 247, 267–279, 288, 291–292, 296, 299, 301–302 model . . . . . . . . . . . . . . . 4, 6, 12, 104, 163, 181, 220, 225 Antibody . . . . . . . . 65–66, 69, 74, 78, 79, 84, 90, 91, 92, 95, 98, 100, 101, 107, 118, 119, 135, 142, 151–153, 155, 161, 162, 208–210, 215, 216, 227, 231, 232, 237, 246 Apo (apolipoprotein) . . . . . . . . . . . . . . . . . . . . . . . . . . 205, 209 Apoptotic . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 146, 246–247 ART (assisted reproductive technology) . . . . . . . . . 3, 7, 287, 291, 292, 294, 299, 300 Atherosclerosis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 170 ATP . . . . . . . . . . . . . . . . . . . . . . 15–17, 58, 211, 217, 228, 233 Autocrin . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 63

C Caco-2 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 207, 212 Calcitriol receptor . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 206 Calcium-45 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 80 Calcium (Ca2+ , Ca) . . . . . . . . . . 73, 74, 76, 80, 86, 186, 274 binding proteins . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 206 transport . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5 uptake . . . . . . . . . . . . . . . . . . . . . . . 7, 73, 75, 80, 85, 86, 93 Carcinogenesis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 137 Cardiac . . . . . . . . . . . . . . . . . . . viii, 6, 225, 226, 229, 232, 234 CD-1 mice . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 242, 243, 248 CD11b . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 197, 198, 200, 201 CD14 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 197, 200, 201 CD45 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 65, 66 C. elegans (Caenorhabditis elegans) . . . . . . . . . viii, 6, 181–187 Cell . . . . . . . . . . . . . . . vii, viii, 3–7, 16, 21, 49, 50, 60, 63–86, 89, 90–100, 107, 116, 121, 129, 132–135, 146, 155, 159, 160, 162, 163, 167, 170, 174, 181–186, 192, 195–202, 205, 207–209, 211–216, 220, 221, 225, 242, 254, 255–258, 260, 261, 262, 264–272, 275–284, 287–289, 291, 293–297, 301 culture . . . . . . . . . . . . . . 5, 73, 74, 78, 83, 85, 90, 93, 129, 132, 133–135, 185, 196, 207, 211, 212 differentiation . . . 6, 75, 93, 96, 181, 196, 198, 200, 201 line . . . . . . . . 6, 74, 90, 94, 117, 132, 195, 196, 205, 207, 212, 289, 293–297 lysate . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 91, 96 maturation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6, 195 polarization . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6, 181 proliferation . . . . . . . . . . . . . . . . . . . . 4, 6, 66, 73, 181, 206 suspension . . . . . . . . . . . . . . xi, 66–68, 71, 75, 77, 78, 80, 82–84, 132, 198 Cellular . . . . . . . . . . iv, 3, 5, 6, 12, 20, 74, 86, 160, 162, 206, 221, 270 CEP18 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 254, 264 CEPX . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 254, 264 CEPY . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 254, 264 Chemiluminescence . . . . . . . . . . . . . . . . . . . . . . . . 92, 107, 161 Cholesterol . . . . . . . . . . . . 5, 6, 127, 128, 130, 134, 169–174, 184, 185, 210 Cholesteryl esters . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 169, 170 Choriocarcinoma . . . . . . . . . . . . . . . . . . . . 63, 64, 74, 129, 132 Chromatin . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 146, 268 Chromatography . . . . . . . . . . . . 26, 30, 56, 57, 107, 172, 210 Chylomicron . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 210, 219, 221 Citrate synthase . . . . . . . . . . . . . . . . . . . . . . 226, 228, 234, 235 Clone . . . . . . . . . . . . . 7, 45–47, 49, 50, 53–55, 60, 107, 183, 185–188, 197, 217, 267, 298

B Bacterial clone . . . . . . . . . . . . . . . . . . . . . . . 183, 185, 187, 188 Bacterial colonies . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 49, 54 Balb/C albino . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 170 Bax . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 105, 107, 115–119 BCA (bicinchoninic acid) . . . . . 80, 85, 86, 91, 96, 140, 147 Bcl-2 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 105, 107, 115–119 Benzo(a)pyrene . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 242 BeWo . . . . . . . . . . . . . . . . . . . . . . . 74, 90, 91, 93–95, 100, 132 Biohazard . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 75, 80, 81 Birth . . . . . . . 7, 103, 104, 205, 225, 241, 267, 282, 284, 293 Blastocyst . . . . . . . . . . . . . . vii, 4, 7, 11–13, 19, 64, 253, 254, 258–263, 271, 278, 297 Blood . . 5, 74, 81, 82, 86, 89, 103–105, 108, 109, 195, 226, 256, 302 Bouin’s fixative . . . . . . . . . . . . . . . . . . . . . . . . . xi, 139, 144, 145 Boyden chamber . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 69 bpV(phen) (Potassium bisperoxol (1, 10-phenanthroline) oxovanadate) . . . . . . . . . . . . . . . . . . . . . . . . . . . 161, 166

307

HUMAN EMBRYOGENESIS

308 Index

Cloning . . . . . . . . . v, viii, 3, 6, 7, 16, 45, 48, 49, 50, 54, 183, 192, 267, 268, 272, 281, 287, 289, 292, 294, 295, 296, 298, 299, 301 Coculture . . . . . . . . . . . . . . . . . . . . . . . . . vii, 63, 64, 66, 69, 70 Collagenase . . . . . . . . . . . . . . . 64, 65, 68, 161, 162, 166, 172 Colonic carcinoma cell . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 207 Colony . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 49, 137, 243 Conceptus . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4 Confocal . . . . . . . . . 90, 91, 94, 95, 100, 108, 119, 120, 122, 151, 156, 211, 218 Connexin-43 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 90, 95, 165 COPAS Biosort . . . . . . . . . . . . . . . . . . . . . . 181–183, 189, 190 Corona cell . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 257, 258, 266 Cotyledon . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 86 COX (cyclooxygenase) . . . . . . . . . . . . . . . . 105, 107, 115–119 Cryopreservation . . . . . . . . . . . . . . . . 251–253, 259, 262, 286 Crypt-villus structures . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 206 Cyclophilin . . . . . . . . . . . . . . . . . . 17, 43, 44, 46, 59, 141, 151 CYP11A (cholesterol side-chain cleavage) . . . . . . . . . 5, 127, 128, 131, 132, 134 CYP17 (steroid 17α-hdroxylase/17, 20-lyase) . . . . . . . . . . 5, 127–132, 134 CYP19 (aromatase) . . . . . . . . . . . . 5, 127, 128, 131–133, 135 Cytocentrifuge . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 68, 198 Cytochalasin . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 270–272 Cytochrome (CYP) P5 . . . . . . . . . . . . . . . . . . . . . . . . . 127, 450 Cytokeratin-7 . . . . . . . . . . . . . . . . . . 65, 68, 73, 74, 78, 79, 84 Cytokine . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 63 Cytoslide . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 65 Cytospin . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 68, 199 Cytotrophoblast/Cytotrophoblastic(CTB). . . . . . . .vii, xi, 4, 63, 64, 66–71, 73–75, 86, 89, 93, 95, 96, 99

D DAB . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 65, 69 DAPI (4, 6-diamidino-2-phenylindole) . . 79, 84, 254, 265, 266 Database . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 13, 14, 54 Decidual . . . . . . . . . . . . . . . . . . . . . . . xi, 4, 63, 64, 68–70, 243 Delayed implantation . . . . . . . . . . . . . . . . . . . . . . . vii, 4, 11, 12 Desmoplakin . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 90, 94, 95 Desmosomal . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 73, 79, 94, 95 Diapause . . . . . . . . . . . . . . . . . . . 11–13, 22, 23, 44, 46, 53, 59 Diploid cell . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 283, 298 Dispase. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .76, 77, 80 Division . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3, 7, 192 DMEM (Dulbecco’s modified Eagle’s medium) . . . . . . . 64, 66, 68, 69, 76, 77, 79, 129, 138, 139, 207, 209, 218, 242, 243, 276 DMSO (dimetyl sulfoxide) . . . . . . . 79, 85, 90, 99, 106, 130, 132, 135, 140, 148, 172, 196–200, 217, 272 DNA . 4, 11, 13–15, 22–60, 91, 93, 98, 134, 140, 146, 148– 150, 155, 183, 186, 192, 211, 217, 242, 247, 254, 264, 265, 292 chips . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 211 polymerase . . . . . . . . . . . . . . . . . . . . . . . . . . . . 15, 24, 42, 43 DNase I . . . . . . . . . . . . . . . . . 64, 74, 76, 77, 80, 82, 139, 146 Dot blot . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 50, 53, 54 dsRNA (Double-stranded RNA) . . . . . . 184–186, 188, 192 Dyebinding assay . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 171 Dynabeads . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 65–67

E E-cadherin . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 90, 95, 247 Ectoplacental . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . xii, 243, 246

EGF (epidermal growth factor) . . . . . . . . . . . . 205–207, 211, 218–221, 273 Egg . . . . . . . . . . v, 4, 185, 188–192, 256, 267, 277, 278, 282, 283, 291, 298, 299 Electrophoresis . . . . . . . . . 15–17, 29, 35, 42, 50, 58, 66, 70, 91, 106, 116, 117, 130, 146, 161, 208, 213, 214, 227, 229 ELISA (enzyme-linked immunosorbent assay) . . . . . . . . 73, 79, 85 Embryo . . . . . . v, vii, viii, xi, xii, 3–7, 10–15, 17–19, 21, 22, 63, 64, 89, 129, 137, 181–184, 187–192, 241–248, 251–254, 258–264, 266–268, 272, 278, 279, 281–301 explantation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 242 implantation . . . . . . . . . . . . . . . . . . . . vii, 4, 11, 12, 63, 64 Embryogenesis . . . . . . . . . . . . . . . . . v–viii, 3–6, 127, 181, 267 Embryology . . . . . . . . . . . . . . . . . . 3, 4, 6, 290, 292, 294, 301 Embryonic development . . . . . . . . v, 3, 6, 181–183, 187, 283 Embryonic lethality . . . . . . . . . . . . . . 181, 183, 187, 190–193 Embryotoxicity . . . . . . . . . . . . . viii, xii, 6, 241, 244, 246–248 Endocrine . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 73, 89, 90 Endometrial . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 12, 63, 64 Endometriosis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 137 Endometrium . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4, 11, 12, 63 Enterocyte . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 170, 205 Enucleation . . . . . . . . . . . . . . . . . . . . . . . . . . 269–271, 275–278 Enzymatic activity . . . . . . . . . . . . . viii, 6, 169–171, 173–175 Enzymatic digestion . . . . 5, 77, 81, 159–162, 165, 166, 172 Enzymatic dissociation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 73 Eosin, xi . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 144, 145 Eosinophil . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 196–199 Epididymis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 162 Epigenesis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4 Epithelial cell . . . . . . . . . . . . . . . . . . . . . . 6, 205–207, 220, 221 ER (endoplasmic reticulum) . . . . . . . . . . . . . . . . . . . . . . . . . 169 ERK . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 90, 92, 96, 98 Escherichia coli HT115 (DE3) strain . . . . . . . . . . . . . . . . . . 184 EST (expressed sequence tag) . . . . . . . . . . . . . . . . . . . . . . . . 13 Estrogen . . . . . . . . . . . . . . . . . . . . . . . 5, 12, 103, 127, 129, 132 ET (Endothelin) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 103–105 Ethic/Ethical . . . . . . . . . v, viii, 3, 6, 7, 12, 86, 104, 195, 267, 281, 282, 285, 289, 293, 296, 298, 300

F FAK . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 92, 98 FBS (fetal bovine serum). . . . . . . . 15, 64–66, 68, 78, 79, 84, 90, 95, 99, 108, 121, 130, 196, 197, 199, 207, 242, 243, 271, 272, 273, 275–278 FCS (fetal calf serum) . . . . . . . . . . . . . . . . . . . . . . . . . . . . 77, 80 Female . . . . . . 5, 13, 105, 108, 109, 117, 137, 142, 143, 196, 225, 241–243, 256, 274, 296 Fertilization . . . . . . v, vii, 3–6, 137, 207, 251, 252, 254, 256, 258, 259, 282, 283, 285, 294 Fetal . . . . . . . v, vii, vii, 3, 5, 6, 15, 63, 64, 67, 73, 74, 77, 78, 81, 86, 89, 90, 103, 104, 108, 127–130, 132, 196, 205–207, 210, 212, 217, 220–222, 225, 242, 272 bone . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 74 growth restriction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 63 ileum . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 212 programming . . . . . . . . . . . . . . . . . . . . . . . . . . v, viii, 6, 225 small intestine . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 206 stromal cell . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 67 Fetus(es) . . . . . . . . . . v, 3, 5, 7, 11, 73, 74, 89, 103, 108, 127, 129, 137, 207, 211, 289, 293, 294, 302 Fgr . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 99

HUMAN EMBRYOGENESIS 309 Index FISH (Fluorescent in situ hybridization) . . . . 254, 263, 264 FITC-conjugated monoclonal antibody . . . . . . . . 74, 78, 79, 91, 95, 197, 201, 210 Flow cytometry . . . . . . . . . . . . . . 6, 73, 74, 84, 181, 185, 187, 189, 191, 196–198, 200, 201 Folin’s reagent . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 208 Follicle . . . . . . . . . . . xi, 5, 137, 138, 144–146, 153–155, 252, 256, 272, 273, 275 Formalin . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 81 Formazan . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 85, 199 Forskolin . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 90, 93–95 Fungizone . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 64 Fusion . . . . . . . . 3, 73, 74, 89, 90, 93–96, 98, 100, 182–184, 187, 192, 271, 274, 277, 279 Fyn . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 99

G G3PDH . . . . . . . . . . . . . . . . 17, 24, 39, 40, 43, 44, 46, 58, 59 G6PDH (D-glucose-6-phosphate dehydrogenase). . . . . .98 β-galactosidase . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 49 Gametes . . . . . . . . . . 168, 252, 256, 287, 288, 291, 292, 299 GAPDH (glyceraldehyde-3-phosphate dehydrogenase) . . . . . . . . . . . . . . . . . . 92, 98, 227, 232 Gastric glandular epithelial structures . . . . . . . . . . . . . . . . 206 Gastrointestinal, viii . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6, 205 Gelatin . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 65, 70, 71 Gelatinase . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 70 Genbank . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 54 Gene . . . 3, 4, 11–14, 25, 43, 46, 49, 55, 57–60, 98, 99, 131, 141, 150, 151, 155, 170, 181–186, 188, 191–193, 205, 210, 211, 217, 226, 247, 281, 296, 301 array analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 217 expression . . . . . . . . . . . . . . 11–14, 55, 182, 184, 205, 211 Genetic screening . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 181 Genistein . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 99 Genomic . . . . . . . . 25, 91, 141, 147, 183, 184, 186, 211, 268 Gentamycin . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 64, 65, 273 Germ cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 159, 163, 167 Gestation . . . . . . . . . . vi, 5, 74, 103, 104, 109, 206, 207, 222, 226, 241, 284 G-FERT plus . . . . . . . . . . . . . . . . . . . . . . . . 252, 253, 255, 256 GI (gastrointestinal tract). . .viii, 6, 205, 206, 211, 220–222 Glucoamylase . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 220 Glutamax . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 207, 209 Glutamine . . . . . . . . . . . . . . . . . . . . 78, 90, 129, 209, 273, 274 Glycogen . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 34, 35, 38 Glycosylated form . . . . . . . . . . . . . . . . . . viii, 5, 159, 165, 172 G-MOPS . . . . . . . . . . . . . . . . . . 252, 253, 255–258, 262, 263 Granulocyte . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6, 195, 198 Granulosa cell . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 146, 256 Growth factor . . . 63, 74, 137, 205–208, 211, 220, 221, 273 Gut . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 170, 206

H H295R (human adrenocortical carcinoma cell) . . . 127, 129, 132, 134, 135 HAI (hepatocyte growth factor activiator inhibitor) . . . . . 76 Ham’s F12 media . . . . . . . . . . . . . . . . . . . . . . 90, 129, 138, 139 HBSS (Hank’s balanced salt solution) . . . . . . 64–66, 68, 71, 76–81, 84, 196, 242–244 hCG (human chorionic gonadotropin) . . . . . . . . . 64, 73, 75, 79, 85, 90, 93, 98, 100, 256, 272, 274 Hck. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .99 HDL (high density lipoprotein) . . . 128, 205, 210, 220, 221 Heart . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 225, 226, 228, 246

Hematoma . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 81 Hematopoietic stem cell . . . . . . . . . . . . . . . . . . . . . . . . . . . . 198 Hepatocytes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 74, 170 HEPES 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid . . . . . . . . . . . . . . . . . . . . . 64, 76, 77, 80, 129, 138, 139, 196, 207, 242, 243, 252, 270–277 Herbimycin A . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 99 HERVs (Human Endogenous Retroviruses) . . . . . . . . . . . 93 HIEC (human intestinal epithelial cells) . . . . 205, 207, 212 High-throughput . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 181, 182 HiPerFect . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 91, 96 Histology/Histological . . . . . . . . . . xi, 81, 86, 138, 141, 144, 145, 154, 212 Histone:GFP (green fluorescent protein) . . . . . . . . 182, 184, 187, 191, 192 HL-60 cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 196–201, 203 HLA (human leucocyte antigen) . . . . . . . . . . . . . . . . . . . . . . 74 Hormone . . . . . . . . . . . . 5, 63, 74, 89, 90, 93, 103, 127–129, 205, 206, 211, 220, 272, 273, 275 Housekeeping gene . . . . . . . . . . . . . . . . . . . . . . 43, 46, 59, 151 hPL (human placental lactogen) . . . . . . . . . . . 73, 75, 79, 85, 90, 93, 98, 100 HRP (horse-radish peroxidase) . . . . . . . . . . . . . . . . . . . . . . . 69 3β-HSD1 (Type 1, 3β-hydroxysteroid dehydrogenase) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 127 Human . . . . . . . . . . . v, vi, vii, 3–7, 12, 25, 29, 32, 33, 36, 39, 40, 46, 56, 58, 63, 65, 73, 74, 87, 89, 90, 93, 94, 96, 97, 104, 117, 129, 132, 170, 181, 195, 197, 199, 201, 205–207, 210–213, 215, 217, 220–222, 252, 256, 268, 272, 281–301 Hybridization . . . . . . . . . . . 11, 13–15, 17, 20–24, 36, 37, 39, 40, 41, 50, 52, 55, 140, 141, 147 Hydatidiform mole . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 63, 64 Hypertension . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 103, 104, 225

I ICSI (Intracytoplasmic sperm injection) . . . . . 251, 252–258 IgG . . . . 65, 79, 84, 90–92, 95, 98, 107, 119, 162, 197, 201, 209, 210 Immune . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . viii, 6, 195, 248 Immunocytochemistry . . . . . . . . . . . . . . . . . . . . . . . . . . . 65, 67 Immunodetection . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 213, 216 Immunofluorescence . . . . . . . . . . . 73, 79, 84, 105, 108, 120, 121, 210, 211, 216 Immunohistochemical analysis . . . . . . . . . . . . . . . . . . . . . . 246 Immunohistochemistry . . . . . . . . . . . . . . . 103, 141, 144, 151, 152, 155, 156 Immunolocalization . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 11, 14 Immunopurification . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 67 Implantation . . . . . . . . . . . . v, vii, 3–7, 11–14, 63, 64, 74, 89, 127, 137, 241, 242, 246, 247, 251, 252, 262, 282–285, 291, 297, 301 Infertility . . . . . . . . . . . . . . . . . . . . . . . . 12, 137, 251, 281, 301 Insert . . . . . . . . . . . . . . . . . . . . . . . . 48–50, 54, 60, 69, 70, 138 In situ hybridization . . . . . . . . . . . . . . . . . . . . . 14, 55, 254, 263 Interstitial tissue . . . . . . . . . . . . . . . . . . . 5, 159, 160, 163–167 Intestinal . . . . viii, 6, 205, 206, 207, 209, 210, 213, 216–221 Intrauterine . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6, 103, 104, 225 Invasion . . . . . . . . . . . . . . . . . . . . . . . . . . . . vii, 4, 63, 64, 66, 69 Inverted microscope . . . . . . . . . . . . . . . . . . . . . . . . . . . 166, 268 In vitro fertilization (IVF) . . . . . . . . . . . v, viii, 3, 6, 251, 252, 254–256, 258, 261, 263, 285, 286, 291, 293, 297 In vitro organ culture system . . . . . . . . . . . . . . . . . . . . . . 5, 137 Ion exchange . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 73 Isoenzymes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 170

HUMAN EMBRYOGENESIS

310 Index

IUGR (intrauterine growth retardation) . . . . . . . . . . . . . 104, 225, 226, 232 IVF (In vitro fertilization) . . . . . . . . . . . v, viii, 3, 6, 251, 252, 254–256, 258, 261, 263, 285, 286, 291, 293, 297

J JAR . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 74 JEG-3 cell line (human placenta choriocarcinoma cell) . . . . . . . . . . . . . . . . . . 74, 127, 129, 132, 134, 135 Jejunal explants . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 218, 221

K K-604 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 169–176 Kidney . . . . . . . . . . . . . . . . 117, 143, 144, 225–227, 232, 243 cortex . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 232 Klenow enzyme . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 51 KSOM (Potassium Simplex Optimized Medium) . . . . . . . . . . . . . . . . . . . . . . . . . . 273, 277, 278

L Larvae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 188–191 Law . . . . . . . . . . . . . . . . v, 3, 7, 114, 235, 281, 286, 287, 289, 292–294, 301 LB-agar . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 186 LB medium . . . . . . . . . . . . . . . . . . . . . . . 16, 49, 184, 186, 188 LB plate . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 49, 54 Lck . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 99 LDL (low density lipoprotein) . . . . . . . . . 205, 210, 219, 221 Leibovitz L-15 medium . . . . . . . . . . . . . . . . . . . . . . . . 207, 219 Leukemia cell line . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6, 195 Leukocyte. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .65, 67, 74, 195 Leukopheresis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 195 Leydig cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 159, 170 Library . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 183, 184, 186 Ligation . . . . . . . . . . . . . 22, 31, 33, 36, 38–40, 48, 49, 58, 60 Lipoproteins . . . . . . . . . . . 127, 170, 205–207, 210, 211, 218, 219–221 Liver . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 128, 170 LNCaP cell line (human prostate cancer cell) . . . . . . . . . 132 Lymphocyte . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 86 Lyn . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 99 Lysate . . . . . . . . . . . . . . . . . . 18, 22, 55, 91, 96, 117, 147, 218

M Macrophage . . . . . . . . . . 6, 86, 117, 170, 195–198, 200–202 -like . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 196–198, 202 Male . . . . . . . . . . . . . . . . . . . . . 5, 105, 108, 241–243, 248, 256 Malformations . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 137 Mammal (mammalian) . . . . . 7, 13, 103, 248, 267, 268, 297 Manassantin (-A, -B) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 170 MAPK . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 90, 92, 96, 99 Maternal . . . . . . . . . . . . . . 4, 7, 11, 12, 63, 64, 73, 74, 81, 89, 103, 104, 108, 127, 128, 129, 241, 247 -fetal exchange . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 73, 74 Matrigel . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 64 Maturation . . . . . . . . . . . . . . . viii, 6, 195, 200, 206, 271, 273 Mayer’s hematoxylin solution . . . . . . . . . . . . . . . . . . . 197, 201 MEM (Minimum essential medium) . . . . . . . 129, 207, 274 β-mercaptoethanol . . . . . . . . . . . . 15, 16, 106, 161, 162, 171, 208, 213, 226 Mice . . . . . . . . . . . . . . . . . . . 12, 143, 160, 170, 241–243, 247, 248, 267–270, 274, 276, 278

Microarray . . . . . . . . . 12, 137, 140, 147, 149, 150, 156, 211, 217, 247 Micromanipulation . . . . . . . . . . . . . . . . . . . . . . . 267, 270–272 Microscopy . . . . . . . . . . . . . . 4, 64, 90, 94, 95, 100, 119, 151, 156, 182, 198–201 Microsome . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 170–173 Microvessels . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 103, 111, 113 Mild enzymatic digestion . . . . . . . . . 159–162, 165, 166, 172 Mineralization . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 74 Mitochondrial. . . . . . . . . . . . . . . . . . . . . . . . .85, 292, 301, 302 MMP-9 (matrix metalloproteinase 9) . . . . . . . . . . . . . . . . . 64 Monoclonal . . . . 65, 74, 79, 90, 95, 107, 119, 162, 197, 208 Monocyte . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6, 195–198, 200 Moral . . . . . . . . . . . . . . . . . 281–287, 289, 291, 292, 294– 300 Morphogenic . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6, 181 Mouse . . . . . . . . . . viii, 5, 6, 58, 65, 79, 84, 90–92, 104, 107, 119, 137, 146, 154, 159, 162, 163, 169, 172, 174–176, 197, 201, 205, 209, 210, 227, 241, 247, 248, 272, 273–279 anti-GAPDH . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 227 embryo culture . . . . . . . . . . . . . . . . . . . . . . . . . . . . . viii, 241 MTT (Thiazolyl Blue Tetrazolium Bromide) . . . 73, 79, 85 Mycostatin . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 207 Myeloid cell . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6, 195, 198 Myelomonocytic . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 196 Myometrium . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 63

N Na+ -K+ -ATPase . . . . . . . . . . . . . . . . viii, 225–231, 234, 237 NAPDH oxydase activity . . . . . . . . . . . . . . . . . . . . . . 199, 234 NBT (nitroblue tetrazolium) . . . . . . . . . . . . . . . 196, 198, 199 Nematode . . . . . . . . . . . . . . . . . . 181, 183, 185, 188, 189, 193 Neonatal ovarian culture . . . . . . . . . . . . . . . . . . . . . . . . . . . . 137 Neuropore . . . . . . . . . . . . . . . . . . . . . . . . . . . . xii, 241, 245, 246 Neurotoxic . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 91, 227 Neurotransmitter . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 74 Neutrophil . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 86, 196–202 -like . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 196–202 NGM-agar plate . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 188, 192 NGM liquid medium . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 188 Nidatory process . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 12 NO (Nitric oxide) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 104, 247 Nuclear transfer . . . . . . . . . . . . 267–271, 276, 278, 279, 283, 289, 296, 297, 298 Nuclei/Nucleus . . . . . . . . . . . . 84, 94, 95, 145, 146, 153, 155, 182, 198, 202, 256, 258, 264, 268, 269, 270, 276, 277, 291, 299, 301 Nutrient . . . . . . . . 4, 5, 73, 89, 103, 129, 138, 248, 258, 266

O 1, 25-(OH)2 vitamin D3 . . . . . . . . . . . . . . . . . . . . . . . . . . . 196 Oleic acid . . . . . . . . . . . . . . . . . . . . . . . 129, 209, 218, 219, 221 Oligonucleotide . . . . . . . . . . . . . . . . . . . . . 20, 25, 26, 149, 247 Oligotex . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 14, 15, 20, 21, 56 Ontology . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 14, 55 Oocytes . . . . . . . . 5, 137, 146, 155, 251–252, 256–259, 266, 267–271, 274–279, 286, 287, 292, 295–297, 299, 301 Opti-MEM . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 207 ORFs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 186 Organ culture . . . . . . . . . . 5, 6, 137, 205–207, 212, 220, 221 Ouabain . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 228, 233, 234 Ovarian . . . . . . . xi, 5, 12, 137, 138, 143, 145, 151, 154, 286 hormones . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 137 Ovariectomy . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 12

HUMAN EMBRYOGENESIS 311 Index Ovary/Ovaries . . . xi, 12, 110, 111, 137–139, 142–147, 150, 151, 153–165, 271, 274 Oviducts . . . . . . . . xi, 18, 143, 144, 243, 244, 270, 274, 278 Ovule . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5

P p38 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 90, 92, 96, 98, 99 Paracrine . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 63 Paraffin . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 55, 151, 246, 253 PBS (phosphate-buffered saline) . . . . . . . . . . . . . . . . . . 15, 17, 18, 55, 71, 76, 77, 79, 80, 82, 84, 85, 90, 95, 96, 108, 121, 130, 133, 134, 139, 141, 142, 152, 153, 161–163, 166, 171, 196, 197, 201, 208, 210, 213, 215, 216, 218, 227, 228, 231, 232, 254, 263, 272, 274 PCR . . . . . . . . . . . 11–17, 22–31, 33–51, 54–60, 92, 98, 130, 131, 133, 134, 137, 140, 141, 148, 150, 151, 155, 184, 186, 247 PCRII vector . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 48, 49, 60 PCR-select cDNA substraction . . . . . . . . . . . . 14, 15, 22–24, 33–45, 47, 48 PD98059 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 99 Penicillin . . . . . . . . 15, 76, 129, 130, 138, 139, 196, 273, 274 Percoll . . . . . . . . . . . . . . . xi, 64, 66, 67, 73–75, 77, 78, 82, 83 Peroxisomal enzyme . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 206 PGD (preimplantation genetic diagnosis) . . . . . . . 251, 252, 254, 263, 293, 297 Phenanthrolin . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 71, 161, 166 Phenotype . . . . . . . . . . 4, 6, 89, 137, 181, 182, 192, 195–199 Phenytoin . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 242, 247, 248 Phosphatase inhibitor . . . . . . . . . . . . . . . . . . . . . 90, 91, 93, 96 PI (propidium iodide). . . . . . . . . . . . . . . . .79, 84, 91, 94, 200 PL4440-RNAi vectors. . . . . . . . . . . . . . . . . . . . . . . . . . . . . .186 Placenta/Placental . . . . . . . . . . . . . v, vii, 3, 4, 5, 7, 11, 25, 29, 36, 39, 56–58, 66, 73–76, 81, 86, 89, 90, 93, 96, 104, 127–129, 132, 135, 241 Placentation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . v, 4, 5, 12, 63 Plasmid . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 48, 186 PMA (phorbol 12-myristate 13-acetate) . . . . . . . . 196–198, 200, 201 PMSF (phenylmethylsulfonyl fluoride) . . . 71, 91, 140, 160, 161, 171, 172, 209, 226 PMT (photomultilplier tube) . . . . . . . . . . . . . . . . . . . 189, 190 PND4 rat ovaries . . . . . . . . . . . . . . . . . . . . . . xi, 137, 145, 154 Poly A+ RNA . . . . . . . . . . . . . . . . . . . . . . . . . 23, 32, 33, 36, 59 Polycarbonate membrane . . . . . . . . . . . . . . . . . . . . . . . . . 66, 69 PP2 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 99 PP3 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 99 Preeclampsia . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 63, 64, 104 Pregnancy 5, 12, 63, 73, 103–105, 108, 109, 114, 115, 127, 129, 207, 211, 241, 243, 288 Preimplantation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 12–14 Primary culture . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5, 221 Progesterone . . . . . . . . . . . 5, 12, 65, 103, 127–129, 132, 134 Prolactin . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 12, 65, 68 Proliferation . . . . . . . . . . . . vi, 4, 6, 63, 66, 69, 73, 75, 79, 85, 181, 182, 206 Proliferative . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 63, 89 ProLong Gold antifade . . . . . . . . . . . . . . . . . . . 79, 84, 91, 100 Promyelocytic . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6, 195, 196 Prostaglandin . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 63 Protease . . . . . . . . . . . . . . . . . . . . . . . 71, 91, 96, 106, 172, 246 PSN (penicillin-streptomycin-neomycin) . . . . . . . . . . . . . . 78 Purification . . . . . . . . . . . . 19, 20, 29–33, 51, 58, 66, 71, 140, 148, 149, 246

R RAAS (Renin-angiotensin-aldosterone system) . . 103, 104, 226 Radioactive . . . . . . . . . . . . . . . . . 53, 54, 80, 85, 174, 175, 212 Rat brain microsomal . . . . . . . . . . . . . . . . . . . . . . . . . . 227, 236 Rat ovaries . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . xi, 145, 146 Rat tail collagen I . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 66, 69 Real-time polymerase chain reaction (real-time PCR; qPCR) . . . . . . . . . . . 11, 14, 92, 96, 98, 99, 101, 141, 150, 247 Remodeling . . . . . . . . . . . . . . . . . . . . vii, 5, 103–105, 108, 226 Renal . . . . . . . . . . . . . . . . viii, 6, 122, 225, 226, 229, 232, 234 Reprogramming . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 268, 296 Retrovirus . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 93 RIPA (radioimmunoprecipitation assay) . . . . . . . . . . . . 91, 96 RNAi (RNA interference) . . . . . . . . . . . 6, 94, 100, 181–193 RNA isolation . . . . . . . . . . 14, 15, 18–20, 130, 133, 139, 146 RNA polymerase . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 186 RNase . . . . . . . . . . . 16, 19, 20–22, 26, 56, 86, 133, 148, 156, 184, 186, 193, 211, 217 RsaI . . . . . . . . . . . . . . . . . . . . 22, 23, 31–33, 35, 36, 41, 57, 58

S SB203580 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 99 SCNT (somatic cell nuclear transfer) . . . . . . . . . . . . viii, 267, 268, 270, 271, 278, 283, 289, 296, 298 Seminiferous . . . . . . . . . . . . . . viii, 5, 159, 160–167, 169–176 Sertoli cell . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 160 SFK (Src family kinase) . . . . . . . . . . . . . . . . . . . 90, 92, 96, 98 Signaling. . . . . . . . . . . .vii, 5, 55, 74, 89, 90, 92, 96, 99, 107, 206, 242, 245–247 siRNA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 91, 94–96, 100 Skeletal muscle . . . . . . . . . . . . . . . . . 32–38, 40, 42–45, 58, 59 SOC (Max Efficiency DH5α Competent Cell) . . . . . 16, 49 medium . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 184, 186 Sodium orthovanadate (Na3 VO4 ) . . . . . . . . . . . 91, 140, 160 Somatic cell . . . . . . . . . . . 184, 267, 268, 270, 271, 278, 283, 289, 296, 298, 301 Somite . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . xii, 241, 243–246 Soybean trypsin inhibitor . . . . . . . . . . . . . . . . . . . . . . . 161, 162 Sperm . . . . . . . . . . . . . . . . . . . . . . . . . . 4, 7, 109, 251–258, 301 Spermatids. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .163–165 Spiral arteries . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 63, 64 SSH (suppressive subtractive hybridization) . . . . . . . . 11, 13, 14, 16, 22 Steatosis. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .81 Stem cell . . . . . . . . . . . . 7, 198, 281, 282, 287, 289, 293–302 Steroid . . . . . . . . . . . . . . . 5, 89, 103, 127–129, 134, 137, 170 Steroidogenesis . . . . . . . . . . . . . . . . . . . . . vii, 3, 127–129, 132 STf (Seminiferous tubule-enriched fractions) . . . . . 171, 175 Streptomycin . . . . 15, 78, 129, 130, 138, 139, 196, 273, 274 SYBR green . . . . . . . . . . . . . . . . . . . . . . . . . . . . 92, 98, 101, 151 Syncytial . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 74 Syncytialization . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 93 Syncytiotrophoblast . . . . . . . . . 5, 73, 74, 89, 93, 96, 99, 128 Syncytium . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 75, 89, 93, 95

T T4 DNA ligase . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 38, 48, 58 Taq polymerase . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 48 TC-199 medium . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 15 TCM-199 medium . . . . . . . . . . . . . . . . . . . . . . . . . . . . 275–277 Teratogenicity . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7 Teratogens . . . . . . . . . . . . . . . . . . . . . . . . . . . 241, 242, 246–248

HUMAN EMBRYOGENESIS

312 Index

Testis . . . . . . . . . viii, 5, 6, 159, 160, 162, 163, 166, 169, 170 TLC (thin layer chromatography) . . . . . . . . . . 172, 174, 175, 210, 219 Tn10 transposon . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 193 Transcript . . . . . . . . . . . . . . . . . . . 13, 23, 45, 46, 59, 100, 131 Transcriptase . . . . . . . . . 16, 25, 26, 34, 92, 98, 141, 150, 247 Transcriptome . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 11, 12 Transfected . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 96, 100, 170 Transfection . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 91, 94–96 Transwell . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 66, 69 Trehalase . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 220 Trophoblast . . . . . vii, xi, 4, 5, 63, 64, 67, 73–75, 80–82, 84, 89–91, 93–96, 98, 100, 243 invasion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4, 63, 64 Trophoblastic . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 63, 74, 94 cell line . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 74, 94 Trypsin . . . . . . . . 64, 66, 71, 74, 76, 77, 80, 82, 90, 93, 130, 161, 162, 207, 212, 272, 276 Trypsinization . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 81, 82 Tunica albuginea . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 162 Tyrosine kinase . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 90, 99

U Umbilical cord . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 81, 302 Urogenital . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 109, 137 Uterine . . . . . . . . . . . v, vii, xi, 3–5, 11, 12, 14, 15, 17, 18, 20, 22, 23, 46, 63, 64, 103–107, 108–111, 113, 115, 116, 119, 120, 243 arteries . . . . . . . . . . . . . . . . . . . . . . . . . . . 103–105, 108, 109 blood flow . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5, 103 blood supply . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5, 103 horn . . . . . . . . . . . . . 17, 18, 109–111, 115, 119, 120, 243 lumen . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . xi, 12, 18

Uterus . . . . . . . . . . . . . vii, 4, 7, 11–13, 15, 17, 44, 46, 53, 59, 63, 89, 108, 110, 111, 120, 127, 143, 144, 251, 258, 260, 261, 263, 271, 278

V Valproic acid . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 241, 242, 244 Vessel . . . . . . . . . . . . . . . . . . . . . . . . . 5, 81, 103, 105, 108–115 Villous . . . . . . . . . . . . . vii, xi, 5, 66, 67, 73, 74, 81, 89, 93, 95 Vimentin . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 65, 68 VLDL (very low density lipoprotein) . . . . . . . . . . . 127, 205, 210, 219, 221

W Worm strain RW10006 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 184 Wright–Giemsa stain . . . . . . . . . . . . . . . . . . . . . . . . . . 196, 199

X φX174/HaeIII . . . . . . . . . . . . . . . . . . 36, 38, 40, 42, 45, 58, 59 Xenobiotics . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 241 X-gal . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 16, 49

Y Yes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 54, 99 Yolk-sac . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . xii, 246

Z Zona pellucida . . . . . . . . . . . . . . . . . . 258, 260, 269, 275, 276 Zygote . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7, 258, 274, 282 Zymogram . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 70 Zymography . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 65, 70