International Review of Cytology, Volume 81

I N T E R N AT I ON A L

REVIEW OF CYTOLOGY VOLUME 81

ADVISORY EDITORS H. W. BEAMS HOWARD A. BERN GARY G. BORISY PIET BORST BHARAT B. CHATTOO STANLEY COHEN RENE COUTEAUX MARIE A. DIBERARDINO CHARLES J. FLICKINGER OLUF GAMBORG M. NELLY GOLARZ DE BOURNE YUKIO HIRAMOTO YUKINORI HIROTA K. KUROSUMI GIUSEPPE MILLONIG ARNOLD MITTELMAN AUDREY MUGGLETON-HARRIS ALEXANDER

DONALD G . MURPHY ROBERT G. E. MURRAY RICHARD NOVICK ANDREAS OKSCHE MURIEL J. ORD VLADIMIR R. PANTIC W. J. PEACOCK DARRYL C. REANNEY LIONEL I. REBHUN JEAN-PAUL REVEL JOAN SMITH-SONNEBORN WILFRED STEIN HEWSON SWIFT K. TANAKA DENNIS L. TAYLOR TADASHI UTAKOJI ROY WIDDUS YUDIN

INTERNATIONAL

Review of Cytology EDITED BY

J. F. DANIELLI

G. H. BOURNE St. George's University School of Medicine St. George's, Grenada West Indies

Danielli Associates Worcester, Massachusetts

ASSISTANT EDITOR K. W. JEON Department of Zoology University of Tennessee Knoxville, Tennessee

VOLUME 81 I983

ACADEMIC PRESS A Subsidiary of Harcortrt Bruce Jovanovich, Publishers New York London Paris San Diego San Francisco SBo Paulo Sydney Tokyo Toronto

COPYRIGHT @ 1983, BY ACADEMIC PRESS,INC. ALL RIGHTS RESERVED. NO PART O F THIS PUBLICATION MAY BE REPRODUCED OR TRANSMITTED IN ANY FORM OR BY ANY MEANS, ELECTRONIC OR MECHANICAL, INCLUDING PHOTOCOPY, RECORDING, OR ANY INFORMATION STORAGE AND RETRIEVAL SYSTEM, WITHOUT PERMISSION IN WRITING FROM THE PUBLISHER.

ACADEMIC PRESS,INC.

111 Fifth Avenue, New York, New York 10003

United Kingdom Edition published by ACADEMIC PRESS, INC. ( L O N D O N ) LTD. 24/28 Oval Road, London NWl7DX

LIBRARY OF CONGRESS CATALOG CARD NUMBER:

I S B N 0-1 2-364481- X PRINTED IN THE UNITED STATES OF AMERICA 83 84 85 86

9 8 1 6 5 4 3 2 1

52 - 5203

Contents CONTRIBUTORS . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

ix

Oxidation of Carbon Monoxide by Bacteria YOUNGM . K I M

AND

GEORGE D . HEGEMAN

I . Introduction . . . . . . . . . I1 . Sources and Sinks for Atmospheric Carbon Monoxide 111 . Carbon Monoxide-Oxidizing Bacteria . . . . . . . . IV. Physiology of Carbon Monoxide Oxidation . . . . . V. Environmental Significance . . . . . . . . . . . . VI . Applications . . . . . . . . . . . . . . . . . . . VII . Conclusions . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . .

. . . . . . . . . . . . . . . . . . . . . . . . . . .

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

. . . . . . . . .

i

2 4 II 24 25 26 28

Sensory Transduction in Bacterial Chemotaxis GERALD L . HAZELBAUER A N D SHIGEAKI HARAVAMA I . Introduction . . . . . . . . . . . . . . . . . . . . I1 . Components and Features of the Sensory System . . . 111. Conventional Receptors . . . . . . . . . . . . . . . I v. Stimuli Not Mediated by Conventional Receptors . . . V. The Excitatory Link . . . . . . . . . . . . . . . . VI . Structure of Transducers . . . . . . . . . . . . . . v11 . Adaptation . . . . . . . . . . . . . . . . . . . . . v111 . Pathways for Unconventional Excitation and Adaptation IX . Concluding Remarks . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . .

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

. . . . . . . . . . . . . . . . . . . . . . . .

. . . . . . . . . . . . . . . .

. . . . . . . .

33 36 40 45 50 52 58 63 64 65

The Functional Significance of Leader and Trailer Sequences in Eukaryotic mRNAs F. E . BARALLE 1. Introduction . . . . . . . . I 1 . The Leader Sequence . . . . I11 . The Trailer Sequence . . . . References . . . . . . . . .

. . . . . . . . . . . . V

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

. . . .

71

72 93 102

vi

CONTENTS

The Fragile X Chromosome GRANT R . SUTHERLAND

I . Introduction . . . . . . . . . . . . I1 . What Is the Fragile X? . . . . . . . 111. Tissue Culture Conditions . . . . . . I v. Cytogenetics . . . . . . . . . . . . V. Genetics . . . . . . . . . . . . . . VI . Clinical Aspects . . . . . . . . . . VII . Karyotype-Phenotype Relationship. . VIII . Conclusions . . . . . . . . . . . . IX . Apologia . . . . . . . . . . . . . . References . . . . . . . . . . . . .

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

. . . . . .

. . . . . .

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

107 108

112 118

124 127 137 138

138 139

Psoriasis versus Cancer: Adaptive versus Iatrogenic Human Proliferative Diseases SEYMOUR GELFANT

I. I1 . Ill . IV. V.

Precis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Cell Cycle Aspects of Psoriasis . . . . . . . . . . . . . . . . . . . . Cell Cycle Aspects of Cancer . . . . . . . . . . . . . . . . . . . . Psoriatic Proliferative Responses to Therapy . . . . . . . . . . . . . . Tumor Proliferative Responses to Therapy . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

145 146 149 154 156 160

Cell Junctions in the Seminiferous Tubule and the Excurrent Duct of the Testes: Freeze-Fracture Studies TOSHIO NAGANOA N D FUMIE SUZUKI I. I1 . III. IV.

Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . Intercellular Junctions between the Sertoli Cells . . . . . . . . . . . . Cell Junctions in the Epithelial Lining in the Exourrent Duct . . . . . . Concluding Remarks . . . . . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

163 165 178 188 188

Geometrical Models for Cells in Tissues HISAOHONDA I . Introduction

. . . . . . . . . . . . . . . . . . . . . . . . . . . .

11. The Cell Aggregate Model: Cells Can Be Represented by Points . . . . .

I11 . The Boundary Shortening Model of Cells in a Tissue IV. Cell States in Tissues: Epithelium-like or Not? . . . V. Fundamental Consideration of Tension and Shape .

. . . . . . . . . . . . . . . . . . . .

. . . . . . . . . .

191 192 216 233 240

vii

CONTENTS VI . Conclusions . . . . . . . . . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

244 246

Growth of Cultured Cells Using Collagen as Substrate JASON YANGAND S . NANDI

I . Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 249 I1 . Early Studies . . . . . . . . . . . . . . . . . . . . . . . . . . . . 250 111. Studies in the 1960s . . . . . . . . . . . . . . . . . . . . . . . . . 251 I v. Studies in the 1970s . . . . . . . . . . . . . . . . . . . . . . . . . 251 V. Three-Dimensional Culture System-Early Studies . . . . . . . . . . . 254 VI . Studies in the 1980s . . . . . . . . . . . . . . . . . . . . . . . . . 255 VII . Studies in.Our Laboratory . . . . . . . . . . . . . . . . . . . . . . 258 VI11 . Conclusion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 277 References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 282 INDEX . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . CONTENTS OF RECENT VOLUMES A N D SUPPLEMENTS . . . . . . . . . . . . . . .

.

287 291

This Page Intentionally Left Blank

Contributors

Numbers in parentheses indicate the pages on which the authors' contributions begin.

F. E . BARALLE (71), Sir William Dunn School of Pathology, University of Oxford, Oxford, England SEYMOUR GELFANT (145), Departments of Dermatology and Cell and Molecular Biology, Medical College of Georgia, Augusta, Georgia 30912 SHIGEAKI HARAYAMA (33), Laboratory of Genetics, Department of Biology, Faculty of Science, University of Tokyo, Hongo, Tohyo, Japan GERALD L. HAZELBAUER (331, BiochemistrylBiophysics Program, Washington State University, Pullman, Washington 99164 GEORGE D. HEGEMAN (I), Microbiology Group, Biology Department, Indiana University, Bloomington, Indiana 47405 HISAOHONDA(191), Kaneho Institute for Cancer Research, Misakicho 19, Kobe 652, Japan YOUNGM. KIM'( I ) , Microbiology Group, Biology Department, Indiana University, Bloomington, Indiana 47405 TOSHIO NAGANO (1631, Department of Anatomy, School of Medicine, Chiha University, Chiba 280, Japan S. NANDI(2491, Cancer Research Laboratory and Department of Zoology, University of California, Berkeley, California 94720

GRANTR. SuTnERLAND (1071, Cytogenetics Unit, Department of Histopathology, Adelaide Children's Hospital, North Adelaide, S.A. 5006, Australia FUMIESUZUKI (1631, Department of Anatomy, School of Medicine, Chiba University, Chiba 280, Japan

JASON YANG(249), Cancer Research Laboratory, University of California, Berkeley, California 94720 'Present address: Department of Biology, Yonsei University, Seoul 120, Korea. ix

This Page Intentionally Left Blank

INTERNATIONAL

REVIEW OF CYTOLOGY VOLUME 81

This Page Intentionally Left Blank

INTERNATIONAL

REVIEW OF CYTOLOGY. VOL. 81

Oxidation of Carbon Monoxide by Bacteria YOUNGM. KIM^

AND

GEORGED. HEGEMAN

MicrobioIogy Group, Department of Biology, Indiana University, Bloomington, Indiana

1. 11.

....................

Introduction Sources and

............... Ill.

IV.

V. VI.

VII.

..................

B. Sinks.. .............................................. Carbon Monoxide-Oxidizing Bacteria ......................... A. Nonutilitarian Carbon Monoxide-Oxidizing Bacteria. ......... B. Utilitarian Carbon Monoxide-Oxidizing Bacteria. . . . . . . . . . . . . Physiology of Carbon Monoxide Oxidation. . . ............ A. Mechanism of Carbon Monoxide Oxidatio B. Carbon Monoxide as Carbon and Energy Source . . . . . . . . . . . . Environmental Significance. .......... Applications .............................................. Conclusions ................ ..................

1

2 2 3 4 5 5 11

11 21 24 25 26 28

I. Introduction Carbon monoxide (CO) has been considered to be one of the most prevalent atmospheric pollutants since the first observation of CO was made by Migeotte (1949) on the basis of a study of solar spectra. Its concentration in the unpolluted troposphere is about 0.1 ppm, less than that of hydrogen or of nitrous oxide (Ehhalt and Volz, 1975), while in urban districts its concentration can be as high as 50- 100 ppm (Robinson and Robbins, 1970). It has been estimated that natural and man-made sources produce about 12-14 X lo8 tons per annum of CO, but repeated measurements have shown a relatively constant CO concentration in the atmosphere (0.03-0.9 ppm) (Robbins et al, 1968, indicating that the rate of destruction of CO must be large and at least equal to the rate of CO production (Warneck, 1975). Indeed, the turnover of CO in the lower atmosphere is quite fast and the mean residence time has been estimated to be 0.1-1 .O year (Junge et al., 1971; Seiler, 1974; Weinstock, 1969; Weinstock and Niki, 1972). The constant level of atmospheric CO suggests that there exist sinks of sufficient magnitude to convert the CO into other compounds (Warneck, 1975), some of 'Present address: Department of Biology, Yonsei University, Seoul 120, Korea. 1

Copyright 0 1983 by Academic Press. Inc. All rights of repmduclion in any form reserved. ISBN 0- 12.36448 I -X

2

YOUNG M. KIM AND GEORGE D. HEGEMAN

which are nonbiological. However, it seems likely that much of the CO generated in soil and in the lower layers of the atmosphere is oxidized to CO, locally by biological agents, principally microbes (Inmann et al., 1971; Warneck, 1975).

11. Sources and Sinks for Atmospheric Carbon Monoxide

A. SOURCES CO is continuously being added to the atmosphere in biologically significant amounts (McConnell et af., 1971) through incomplete combustion of fossil fuels and by atmospheric reactions (Levy, 1971; Weinstock and Niki, 1972). Recently it has been shown that CO is formed by various C-3 plants (Seiler et al., 1978; Seiler and Giehl, 1977), which have been estimated to produce through a lightdependent process 0.5-1 .O X lo8 tons per annum. Isotopic experiments indicate a much higher proportion of CO comes from other natural sources, including the decomposition of porphyrins (Stevens et al., 1972). CO production has also been observed during catabolism of heme and cobalamin compounds by bacteria (Engel et al., 1972, 1973) and of flavonoids by fungi (Westlake et al., 1961), and has also been observed in animal tissue where hemoglobin is converted by microsomal heme oxygenase to equirnolar amounts of biliverdin and CO (Landaw, 1970; White, 1970). In this case, the CO is formed by the oxidation of the a-methine bridge carbon of the porphyrin ring (Tenhunen ef al., 1969). Another report has suggested that CO is a product of the peroxidative degradation of lipids (Wolff and Bidlack, 1976). Some marine invertebrates (siphonophores) also have been reported to produce considerable amounts of CO (Pickwell et al., 1964). Trace amounts of CO are also produced during growth of yeasts and bacteria on glucose (Radler et af., 1974). Furthermore, there are a number of reports of light-dependent CO production by green algae, cyanobacteria, and phototrophic bacteria (Bauer et al., 1980; Loewus and Delwiche, 1963; Troxler, 1972; 'Troxler and Dokos, 1973). Several fungi are also known to produce CO (Simpson et al., 1960; Westlake et af., 1961). On the other hand, Conrad and Seiler (1980a) reported that the CO production by soil was a chemical process rather than a metabolic process of soil microorganisms. It has been estimated that several technological sources create 6.4 X lo8 tons of CO per year (Seiler, 1974) and at any time 7.4 X lo* tons are present in the atmosphere (Robinson and Robbins, 1970). Atmospheric sources include the photochemical oxidation of CH, by .OH radical (Stevens et al., 1972;Weinstock and Niki, 1972; Wofsy er al., 1972), by 0, (Crutzen, 1974) and photolysis of formaldehyde (Calvert et af., 1972), and of CO, (Wolfgang, 1970). CO can also

OXIDATION OF CO BY BACTERIA

3

be produced and stored in the Oceans (Conrad and Seiler, 1980b; Inmann et al., 1971; Junge et al., 1971; Swinnerton et al., 1970; Wilson et al., 1970). Rainwater may transport CO from the upper atmosphere to the earth’s surface (Swinnerton et al., 1971); the solubility of CO in water is similar to that of oxygen. B. SINKS Several mechanisms for removal of CO from the atmosphere have been suggested and demonstrated, but their relative importance is still unclear. It has been suggested that photochemical destruction of CO in the stratosphere (Newell et al., 1974; Pressman and Warneck, 1970), by tropospheric chemical reactions, and in biological processes were the means for removal of CO from the atmosphere (Crutzen, 1974; Kummler et al., 1969; Levy, 1971; Seiler, 1978; Zimmerman et al., 1978). Warneck (1975) estimated that oxidation of CO by OH could remove as much as 6.8 X lo8 tons of CO per year by the reaction: CO + OH + CO, .H. It is known that the biological sink is very significant in removal of CO from the atmosphere. Inmann et al. (1971) estimated that amount of CO potentially removable by this process exceeds current CO production by several fold. Krall and Tolbert (1956) and Bidwell and Fraser (1972) reported evidence of CO metabolism by plant leaves by measuring the incorporation of 14C0 into cellular materials, but concentrations of CO used in both experiments were much higher than the ambient atmospheric level and thus their ecological significance remains unknown. CO also can be oxidized in animal tissue. Breckenridge (1953) reported that purified cytochrome oxidase from pig heart muscle and muscle extracts could oxidize CO to CO,. After a critical examination of a series of reports, Fenn (1970) concluded that humans and other animals play no role as a sink for CO. However, colonic flora in humans does consume CO (Levine et al., 1982). While eukaryotic organisms may play a role in the removal of CO, the major biological sink for CO is probably oxidation of CO by microbes which are present in the soil and surface waters (Conrad and Seiler, 1980a,b; Hegeman, 1980; Heichel, 1973; Inmann et al., 1971; Jones and Scott, 1939; Spratt and Hubbard, 1981). Ingersoll et al. (1974) showed a gradual increase in the binding activity of the soil with an increase in the CO concentration and estimated the global soil uptake of CO to be 1.4 X lo9 tons per year while Seiler (1978) and Bartholomew and Alexander (1981) calculated the average uptake as 5.0 X lo8 and 4.1 X lo8 tons per year, respectively. Tests of individual species of algae (Chappelle, 1962), fungi (Hirsch, 1965; Inmann and Ingersoll, 1971), and both aerobic (Bartholomew and Alexander, 1979; Cypionka et al., 1980; Hirsch, 1965; Kirkconnell, 1978; Kistner, 1953, 1954; Meyer etal., 1980; Meyer and Schlegel, 1977, 1978, 1979; Nozhevnikova

+

4

YOUNG M. KIM AND GEORGE D. HEGEMAN TABLE I MAJOR SOURCES A N D SINKS FOR

CARBON

MONOXIDE"

Amounts Sources and sinks

( x 108 tonslyear)

References

Sources Anthropogenic Oceans Plants Forest fires Methane oxidation Hydrocarbon oxidation Total

6.4 0.2-1.2 0.5-1 .o 0.6 4.0 0.6 12.3-13.8

Seiler (1974) Seiler and Schmidt (1975) Seiler er a/. (1978) Seiler (1974) Seiler (1978) Robinson and Robbins (1969)

Sinks Soil Plants Stratosphere Oxidation by 'OH PhotoIy sis Total

5.0 7.0-70 1.1 7.0 39.0 59.1-122. I

Liebl and Seiler (1975) Bidwell and Fraser (1 972) Seiler (1974) Seiler (1976) Ehhalt (1975)

"Estimates listed here are the most current values among those reported to date.

and Zavarzin, 1974; Ooyama and Shinohara, 1971; Sanzhieva and Zavarzin, 1971; Shinohara and Ooyama, 1972; Zavarzin and Nozhevnikova, 1975, 1977) and anaerobic bacteria (Andress, 1975; Daniels eraf., 1977; Diekert and Thauer, 1978; Fischer er al., 1931, 1932; Fuchs er al., 1974; Kluyver and Schnellen, 1947; Uffen, 1976, 1981; Yagi, 1958; Lynd er al., 1982; Genthner and Bryant, 1982), have shown that these organisms can metabolize and, in some cases, grow with CO in pure culture. A summary of the major sources and sinks for atmospheric CO is given in Table I. 111. Carbon Monoxide-Oxidizing Bacteria

Bacteria that oxidize CO may be subdivided according to whether they are able to use CO as an energy source for growth (utilitarian oxidation) or whether the oxidation process is a gratuitous one (nonutilitarian oxidation) resulting from the acceptance of CO as a pseudosubstrate for an enzyme system evolved to catalyze another process. Among bacteria that can oxidize CO, nonutilitarian representatives have been studied as extensively as utilitarian CO oxidizers, and as much is known of some mechanisms of nonspecific CO oxidation as of the utilitarian process.

OXIDATION OF CO BY BACTERIA

5

A. NONUTILITARIAN CARBON MONOXIDE-OXIDIZING BACTERIA 1. Anaerobic Bacteria Fischer et al. (1931, 1932) reported that sludge from an anaerobic sewage treatment system could effect the anaerobic conversion of CO to methane and CO,. The bacterium thought to be responsible for this reaction was subsequently isolated and studied by Barker (1936) and given the name Methanosarcina barkerii (Schnellen, 1947) after Horace A. Barker who performed much of the early work on the biochemistry and physiology of methanogenic bacteria. After Barker’s work (1936) it was reported that methanogens (Daniels et al., 1977; Kluyver and Schnellen, 1947), a sulfate-reducing bacterium (Postgate, 1970; Yagi, 1958, 1959; Yagi and Tamiya, 1962), clostridia (Diekert et al., 1979a; Diekert and Thauer, 1978, 1980; Drake et al., 1980; Fuchs et al., 1974; Thauer et al., 1974), and a rumen acidogen (Lynd et a f . , 1982; see Section III,B ,2) can oxidize CO gratuitously under anaerobic conditions. Clostridium welchii has been cited in many reports (e.g., Stephenson, 1949) as a CO-oxidizing bacterium, but there is no evidence known to us for CO oxidation by this organism. In 1975, Andress found that cysteine specifically repressed CO-oxidizing activity in growing cultures of Clostridium pasteurianum. As many anaerobic bacteria are grown in the laboratory on cysteine-containing complex media or on media supplemented with reducing agents formulated with cysteine, this finding suggests that the capacity to mediate the oxidation of CO to CO, may be more widespread among anaerobic bacteria than is presently thought (Fuchs et a f . , 1975).

2 . Aerobic Bacteria The aerobic methane oxidizers can also oxidize CO gratuitously. Hubley et a!. (1974) demonstrated that CO induced both respiration and CO, production in washed cell suspensions of the two methane-oxidizing bacteria, Methylomonas albus and Methylosinus trichosporium. Pseudonomonas methanica (Ferenci, 1974, 1975; Ferenci et al., 1975) is also known to be an aerobic nonutilitarian CO-oxidizing bacteria. B . UTILITARIANCARBON MONOXIDE-OXIDIZING BACTERIA 1. Aerobic Bacteria Despite the widespread distribution of and biological consumption of CO, early attempts to isolate microorganisms capable of growth at the expense of CO were not very rewarding. The credit for the discovery of an aerobic bacterium capable of using CO as a source of carbon and energy has generally been given to Beijerinck and van Delden (1903) even though they did not mention the words

6

YOUNG M. KIM AND GEORGE D. HEGEMAN

“carbon monoxide” in their report. They isolated from garden soil a microbe which could be grown on liquid mineral medium to which no source of carbon had been added. Since growth of their organism occurred more readily in laboratory air than in “pure” air of a greenhouse, they held that the organism used a volatile substance present in the laboratory air as carbon and energy source and named it Bacillus oligocarbophilus. The role of CO as substrate was suggested 3 years later by Kaserer (1906) who isolated a hydrogen bacterium, Carboxydomonas oligocurbophila Beij. et van Delden, bearing a close resemblance to the microbe of Beijerinck and van Delden. He proposed CO as an intermediary metabolite in the reactions: H,CO, + H, + CO + 2H,O and 2CO 0, 2H,O --.* 2H,CO,. But Kaserer’s experimental evidence was subjected to a great deal of criticism by many who did not think that he gave convincing proof of CO oxidation. Lantzsch (1922) independently isolated a coccus from a pellicle which developed on distilled water and noted some branched filaments of the same diameter as the coccus, and claimed that this might be the same organism as Beijerinck’s. The morphology was dependent upon the nature of the added carbon source. Although uptake of CO was not demonstrated when grown with 0.02% CO in the gas phase of an enrichment culture, he claimed CO might be the carbon source and renamed the organism Actinomyces oligocarbophilus. Hasernann (1927) also isolated an actinomycete similar to Beijerinck’s which eliminated CO from a bell jar containing CO and air in 12-42 days. The confining liquid rose in the bell jar and gave a positive test for CO,. In 1939, Jones and Scott presented new evidence for the existence and the ubiquity of CO-oxidizing microorganisms by showing the rapid disappearance of CO from sealed mine fire areas and claimed the presence of B. oligocurbophilus in those areas. Later Pandaw et al. ( 1960) stated that a mechanism might exist for the biological oxidation of CO at the surface of the earth and that B. oligocarbophilus which was present in the soil might be a terrestrial ancestor of other biological CO oxidizers. However, a critical analysis of these investigations carried out by Kistner (1953) led him to the conclusion that their results were unsatisfactory. Hirsch (1960) and Zavarzin and Nozhevnikova (1977) confirmed Kistner’s conclusions that the organism known as B. oligocarbophilus did not oxidize CO. The first definitive studies of a CO-oxidizing organism and its action upon CO were, in fact, done by Kistner (1953, 1954). After several unsuccessful attempts at enrichment for the CO oxidizer, he was able to suppress the growth of nonoxidizers by using an atmosphere of 70% CO, 20% 0,, and 10% N,. Based on the ratio of amounts of gases consumed, he concluded that twice as much CO was used as 0, and proposed that the process had the overall stoichiometry: 2CO + 0, + 2C0,. He reported that on the basis of morphological studies and the observation that the organism could oxidize H,, the bacterium should be classi-

+

+

7

OXIDATION OF CO BY BACTERIA

fied in the genus Hydrogenomonas. He subsequently gave it the name Hydrogenomonas carboxydovorans. After Kistner’s work it was generally thought that CO is oxidized by certain hydrogen bacteria. Nevertheless, when several hydrogen bacteria were tested for their ability to use CO it was found that the growth of hydrogen bacteria at the expense of H, is generally very sensitive to CO inhibition (Zavarzin and Nozhevnikova, 1977) and CO is a well known inhibitor of hydrogenase (e.g., Lynd et al., 1982). Hirsch and Conti (1964) isolated species of Hyphomicrobium and Caulobacter using enrichment cultures established in mineral medium and inoculated with water from many sources under a CO/O,/CO,/He (75/10/0.5/14.5 or 30/15/ 0.5/54.5) gas mixture, but they did not give a clear answer regarding whether CO could be used as a source of carbon and energy by their isolates. A year later Hirsch (1965) reported that Hyphomicrobium, Caulobacter, Sarcina, Pseudomonas. corynebacteria, and Nocardia species that were capable of growing autotrophically with CO/O,/CO, were isolated from enrichments with mineral salts solution and lawn soil under CO (30-75%), 0, (10-15%), CO, (0.5-2%), and He (balance). Three strains of coryneform bacteria grew well under strictly autotrophic conditions, i.e., CO was used as the only energy source. The gas uptake observed agreed with the reaction: 2CO 0, + 2C0,. He also noted that H . carboxydovorans and B . oligocarbophilus were distinctly different from the three coryneform strains. In 1967 Davis isolated two flagellated strains of CO-oxidizing hydrogen bacteria (strains 460 and 461) from soil using CO enrichment. Among the many hydrogen bacteria she studied, these were the only strains that could grow autotrophically using either CO or H, as a source of energy. However, no physiological experiments concerning CO metabolism were carried out. Davis et al. (1970) later assigned these bacteria to the genus Pseudomonas. To develop a microbial system utilizing CO as well as N, to cope with a possible future world-wide protein shortage, Ooyama and Shinohara (1971) and Shinohara and Ooyama (1972) isolated two types of N,-fixing CO-utilizing bacteria. The first strain, S17, could use CO as a sole carbon source and H, as an energy source. Growth did not occur when either CO was omitted from the gas mixture or when N, was replaced by Ar. The second strain, A305, could use CO as a sole source of carbon and energy. Using a mineral liquid medium, Sanzhieva and Zavarzin (197 1) isolated from air tanks another organism which grew in an atmosphere of CO. The organism was polymorphic and its cells were often seen combined in stellate aggregations. Because of these traits the authors placed the organism in the genus of free-living rosette-forming bacteria, Sefiberia. Gases were consumed according to the reaction: 2CO + 0, + 2C0,. Because of its ability to oxidize not only H, but also CO, they named it Seliberia carboxydohydrogena. Meyer et a f . (1980) later

+

8

YOUNG M. KIM AND GEORGE D. HEGEMAN TABLE I1 BAC~ERIA WHICH OXIDIZE co TO C O f Mode of oxidationb

Bacteria Aerobic Pseudomonas (Hydrogenomonas) carboxydovorans P . (Seliberia) carboxydohydrogena P . carboxydojlava

U U U

P . gazotropha Comamonas compransoris Achromobacrer carboxydus Pseudomonas spp. Azoiobacrer spp. Azomonas sp. 1, 2, and 3 Hyphomicrobium Caulobacter Sarcina Nocardia Corynebacterium Strain OM2, OM3, and OM4 Strain A305 Strain S17 Actinoplanes Agromyces Microbispora Mycobacrerium Methvlomonas albus

U U U U

U U U U U U U U U

u (3 ? ? ? ? Non-U

References

Kistner (1953, 1954); Meyer and Schlegel (1978) Sanzhieva and Zavarzin (1971) Nozhevnikova and Zavarzin (1974); Kiessling and Meyer (1982) Nozhevnikova and Zavarzin (1974) Nozhevnikova and Zavarzin (1974) Nozhevnikova and Zavarzin (1974) Davis (1967); Davis er a / . (1970) Kirkconnell ( 1978) Kirkconnell (1978) Hirsch and Conti (1964) Hirsch and Conti ( I 964) Hirsch (1965) Hirsch (1965) Hirsch (1965) Cypionka et al. (1980) Shinohara and Ooyama (1972) Ooyama and Shinohara (1971) Bartholomew and Alexander (1979) Bartholomew and Alexander (1979) Bartholomew and Alexander (1979) Bartholomew and Alexander (1979) Hublev e t a / . (1974) . . (continued)

proposed that this bacterium be transferred from the genus Seliberia to the genus Pseudomonas as Pseudomonas carboxydohydrogena on the basis of electron microscopic observations, its strictly aerobic metabolism, and other traits examined. In 1973, Nozhevnikova and Zavarzin isolated several CO-oxdizing bacteria from city soils following enrichment under a gas mixture of 20% 0, and 80% CO. During the isolation of these organisms which could grow with CO as sole source of energy, they found that it was difficult to grow the organisms except as a two-component culture or without the addition of certain vitamins. Pseudomonas gazotropha was vitamin B ,-dependent and Comamonas compransoris, the other component, needed thiamine. Inoculation of each organism into sterile filtrates of cultures of the second organism gave growth at the expense of CO. They concluded from these experiments that, in natural habitats, CO oxidation

,

9

OXIDATION OF CO BY BACTERIA TABLE I1 (Conrinued)

Bacteria Merhylosinus rrichosporium P . methanica Anaerobic Methanobacrerium rhermoaurotrophicum Rhodopseudomonas gelarinosa (in the dark) Rhodospirillum rubrum (in the dark) Rhodopseudomonas spp. (in the light) Eubacterium limosum Desulfovibrio desulfuricans Methanosarcina barkerii Methanobacteriumformicicum Butyribacrerium merhylorrophicum Methanobacrerium ruminanrium Methanobacterium arbophilicum Merhanosarcina UBS Closrridium rhermoacericum Clostridium formicoacericum Clostridium pasreurianum

Mode of oxidationb

References

Non-U Non-U

Hubley er al. (1974) Ferenci er al. (1975)

U

Daniels er al. (1977)

U

Uffen (1976)

U

Uffen (1981)

U

Hirsch (1968)

U Non-U (?) Non-U Non-U Non-U and U (variant) Non-U Non-U Non-U Non-U Non-U Non-U

Genthner and Bryant (1982) Yagi (1958, 1959) Kluyver and Schnellen (1947) Kluyver and Schnellen (1947) Lynd er al. (1982) Daniels el al. (1977) Daniels er al. (1977) Daniels er al. (1977) Diekert and Thauer (1978) Diekert and Thauer (1978) Fuchs er al. (1974); Thauer er al. ( 1974)

OOrganisms for which the evidence seems ambiguous are not included. bU, Utilitarian oxidation; non-U, nonutilitarian oxidation.

could be carried out by both members of this two-component bacterial system, the probable basis for interdependence being reciprocal vitamin feeding. On the basis of microscopic examination of these bacteria they suggested that the microorganisms that oxidize CO belong to different morphological groups and cannot be assigned to a single bacterial genus. Nozhevnikova and Zavarzin (1974) and Zavarzin and Nozhevnikova (1977) carried out a more complete study of CO-utilizing, aerobic Gram-negative bacteria. Designated as sharing the ability to grow at the expense of CO were H. carboxydovorans, P. carboxydohydrogena, Pseudomonas carboxydoflava, P . gazotropha, C . compransoris, and Achromobacter carboxydus. All were regarded as a physiological group of “carboxydobacteria” meaning that bacterial group which can grow aerobically on CO as sole carbon and energy source. All but A . carboxydus were also able to grow under an atmosphere of H,, O,, and

10

YOUNG M. KIM AND GEORGE D. HEGEMAN

CO, as hydrogen autotrophs as well. These authors also placed Kistner’s Hydrogenomonas in the genus Pseudomonas because Davis et al. (1969) rejected the genus Hydrogenomonas on the grounds that the ability to use H, as an energy source was a trait that occurs in an otherwise widely diverse group of bacteria. P . gazotropha was capable both of autotrophy by aerobic growth in the presence of H, or CO as energy sources and of methylotrophic organotrophy by growth in the presence of methanol as sole source of carbon and energy. It was later found that the serine pathway was responsible for assimilation of methanol carbon (Romanova et al., 1978b). This may be the first example of the capacity for growing by means of three types of assimilatory carbon nutrition, i.e., organotrophy, autotrophy, and methylotrophy. Meyer and Schlegel (1 977, 1978) reisolated Kistner’s Pseudomonas carboxydovorans which had been lost for a long time using a mixture of 5% 0,, 5% CO,, and 90% CO. Four different Gram-negative bacteria able to use CO as sole source of carbon and energy and to grow with N, as source of nitrogen were recently obtained by direct isolation from the soil (Kirkconnell, 1978). One of these four bacteria was assigned to the genus Azotobacrer and the other three to Azomonas. These bacteria could not grow as hydrogen bacteria, like A . carboxydus and unlike other CO-oxidizing bacteria previously examined. 2. Anaerobic Bacteria Several anaerobic bacteria also have been reported to grow at the expense of CO as sole energy and carbon sources. Hirsch (1968) reported that Rhodopseudomonas spp. could use CO as a major carbon source and the cleavage of water as a hydrogen source under anaerobic-light conditions. In other reports, Rhodopseudomonas gelutinosa (Dashekvicz and Uffen, 1979; Uffen, 1976) and Rhodospirillum rubrum (Uffen, 1981) were suggested to be able to grow as facultative methylotrophs at the expense of CO as sole source of carbon and energy in the dark, anaerobically. Keppen er al. (1976), however, threw doubt on the general ability of phototrophic bacteria to use CO, since strains of Rhodopseudomonas sulfidophila, Rhodopseudomonas palustris, and Rhodomicrobium vannielii could not use CO under either phototrophic or aerobic dark growth conditions. Although Uffen (1976) reported that M . barkerii and Methanobacterium formicicum were unable to grow on a solid medium with a CO plus H, (20 : 80) gas mixture, Daniels er al. (1977) reported that Methanobacterium thermoautorrophicum grew anaerobically with CO as energy source, but the net growth was slight and the growth rate was only 1% of that observed on HJCO,. Recently a variant of Butyribacterium methylotrophicum was isolated that can grow anaerobically with CO (Lynd et al., 1982), and another recent report describes anaerobic growth of Eubacterium limosum with CO as energy source

OXIDATION OF CO BY BACTERIA

11

(Genthner and Bryant, 1982). Both organisms convert CO to CO, and acetate, and are phenotypically somewhat similar. Table I1 lists the aerobic and anaerobic bacteria that have been reported to oxidize CO to CO,.

IV. Physiology of Carbon Monoxide Oxidation It is well known that CO is inhibitory for virtually all aerobic respiratory organisms. Even in aerobic carboxydobacteria it has been reported that high concentrations of CO reduce the growth rate and cellular yield (Kim, 1981; Nozhevnikova, 1974; Saval’eva and Nozhevnikova, 1972; Zavarzin and Nozhevnikova, 1977), indicating that CO tolerance is a necessary part of the ability to use CO at higher concentrations. It is also known that CO concentrations higher than 30% in the gas phase are inhibitory to the anaerobic growth of M . thermoautotrophicum (Daniels et al., 1977) and that Rhodospirillum rubrum prefers CO concentrations lower than 100%in the gas atmosphere (Uffen, 1981). On the other hand, R. gelatinosa (Uffen, 1976, 1981) is reported to grow even with 100% CO as energy source under anaerobic, dark conditions. A. MECHANISM OF CARBON MONOXIDE OXIDATION

It has generally been considered that CO-oxidizing systems in nonutilitarian bacteria are constitutive whereas those in utilitarian bacteria are inducible, except in P. carboxydoflava (Kiessling and Meyer, 1982), M . thermoautotrophicum (Daniels et al., 1977), a variant of B. methylotrophicum (Lynd et al., 1982). E . limosum (Genthner and Bryant, 1982), and in phototrophic bacteria (Hirsch, 1968). 1. Nonutilitarian Bacteria

The mechanism underlying metabolism of CO by these organisms was clarified first for the methanogenic bacteria by the studies of Kluyver and Schnellen (1947) using whole cells of M . barkerii and M . formicicum. A mixture of CO and H, was converted to CH, according to the following equation: CO + 3H2+ CH, H,O. They proposed that this fermentation process actually proceeds in two steps: CO + H,O + CO, + H, and CO, + 4H2 + CH, + 2H,O. In agreement with this it was established that M . barkerii also acts on CO in the absence of H,. In this case the reaction course could be represented as follows: 4CO + 4 H 2 0 + 4 c 0 , + 4H, and CO, + 4H, + CH, + 2H,O. These two reactions sum to yield: 4CO + 2H,O + 3c0, + CH,. M . barkerii could bring about this conversion even in an atmosphere of 100% CO. M . formicicum be-

+

12

YOUNG M. KIM AND GEORGE D. HEGEMAN

haved like M . barkeru except that a complete conversion of a CO + H, mixture could only be obtained with low concentrations of CO. Yagi (1958, 1959) reported that formate was not an intermediate during CO oxidation in Desulfovibrio desulfuricans and that the reaction might be CO + H,O + CO, H, because of the presence of hydrogenase activity in the cellfree extracts. He suggested that a CO-activating enzyme and an hydrogenase might take part in this reaction together with an electron carrier linking them, but there was no direct evidence for this suggestion. By use of HCO, - and methyl viologen, Yagi and Tamiya (1962) demonstrated that the reaction for oxidation of CO in D . desulfuricans could be reversed in cell suspensions. They also reported that the forward and the backward reactions were inhibited completely by 1 mM KCN, but none of the following reagents at the same concentration inhibited either reaction: oxine, o-phenanthroline, EDTA, NaF, N,H,, NH,OH, As,O,, or HgCl,. Clostridial CO oxidation is in many ways like that of the methanogens, i.e., it involves nonspecific enzyme activity. However, CO dehydrogenase also performs an essential function in pyruvate oxidation. CO may be an electron donor for the reduction of methyltetrahydrofolate to acetate in these cells (Drake er al., 1980; Hu er al., 1981). Fuchs et al. (1974) found that CO was oxidized in growing cultures of C. pasteurianum by the same system in vivo and in vitro since the K, and V,,,, for CO under these conditions were almost the same. Fuchs et al. (1975) suggested that the second oxygen atom in CO, must be derived from H,O in anaerobic CO oxidation by C. pasteurianum and that the enzyme mediating the oxidation of 2H+ 2e-. CO be termed “CO dehydrogenase”: CO H,O + CO, It has been reported that free formate was not a detectable intermediate during CO oxidation in C. pasteurianum (Thauer et al., 1974). The CO-oxidizing activity was acid-labile (pH 4.5) and sensitive to molecular oxygen but was relatively stable to heat. Incubation of the extracts with cyanide (10 pM) or methyl iodide (2.5 mM) resulted in a reversible loss of CO-oxidizing activity. The activity of extracts inactivated by cyanide in the absence of CO was partially restored by incubation of the extracts with CO; the inactivation by methyl iodide was reversed by exposure of treated extracts to the light of a projection lamp. From these results it was proposed that a vitamin B,, compound was probably involved in the catalysis of anaerobic CO oxidation. Other studies on the involvement of a corrinoid enzyme in anaerobic CO oxidation were reported by Diekert and Thauer (1978) and Diekert er al. (1979b). Oxidation of CO to CO, by cell suspensions of Clostridium formicoaceticum and Clostridium thermoaceticum growing on fructose and glucose, respectively, stimulated reduction of CO, to acetate and required pyruvate for conversion of CO to CO,. The catalytic mechanism of CO oxidation in C. formicoaceticum and C . thermoaceticum was “ping-pong,” suggesting that the

+

+

+

+

13

OXIDATION OF CO BY BACTERIA

CO dehydrogenase (CO-DH) could be present in both oxidized and reduced forms. The oxidized form was shown to react reversibly with cyanide, and the reduced form with alkyl halides: cyanide inactivated the enzyme only in the absence of CO while alkyl halides inactivated it only in the presence of CO. The CO-DH inactivated by alkyl halides was reactivated by photolysis. They also reported that clostridia mediating a comnoid-independent total synthesis of acetate from CO, did not possess the CO-oxidizing system. The dependence of the synthesis of CO-DH upon cobalt was then tested because previous reports (Diekert et al., 1979b; Diekert and Thauer, 1978; Thauer et al., 1974) suggested that the CO-DH in clostridia might be a corrinoid enzyme. Such a dependence was not demonstrated, but in the course of these experiments it was found that CO-DH synthesis in C. pasteurianurn, C. therrnoacericum, and C . formicoaceticum required nickel rather than cobalt and that this unusual trace metal could be presumed to be involved in the total synthesis of acetate from CO, (Diekert et al., 1979a; Diekert and Thauer, 1980). Strong evidence that CO-DH is a nickel enzyme in Clostridium came with the observation that the radioactivity of 63Ni supplied in the medium to the cells copurified uniquely with the CO-DH of C. rhermoaceticum (Drake et al., 1980). The molecular weight of,the native enzyme was estimated to be 410,000 by gel filtration. Other properties of this enzyme were almost the same as those previously reported (Diekert and Thauer, 1978), except that the purified enzyme was not appreciably affected by alkyl halides, carbon tetrachloride, and metal chelators. The authors said it was possible that methods used to culture the bacterium and to purify and assay the enzyme might have favored the enzyme’s stability and resistance to alkylation and did not eliminate the possibility that the CO-DH was a corrinoid enzyme. However, it is possible that this nickel enzyme has properties similar to those of comnoid enzymes. Drake et al. (198 1) also reported that part of a multienzyme system which catalyzes the homoacetate-synthesizing pathway of C. thermoaceticum via a transcarboxylation reaction involving pyruvate and methyltetrahydrofolate in the terminal step was able to use CO instead of pyruvate as the C, donor. One of the components in this system contained the metallonickel CO-DH. Both 14C0 and 14CH,-tetrahydrofolate entered the acetate pool (Fig. 2). Aerobic methane-oxidizing bacteria catalyze the oxidation of CO only when metabolizing other substrates.Ferenci (1974, 1975) and Ferenci et al. (1975) have studied the oxidation of CO by the bacteria P . methanica and M . trichosporium. In both P . methanica and M . trichosporium the stoichiometry of CO oxidation was consistent with oxidation catalyzed by a nonspecific mono- or 0, + NADH H + + CO, mixed-function oxygenase complex: CO NAD+ + H,O. This is a gratuitous process that actually drains the cell’s supply of reducing power and this process does not support the growth of either organism. They suggested that alcohol oxidation could provide the necessary reducing

+

+

+

14

YOUNG M. KIM AND GEORGE D. HEGEMAN

power (NADH) to the monooxygenase in vivo, although the metabolism of ethanol by P. rnethanica was found unlikely to result in substrate-levelformation of NADH. They assumed that the failure to do so in vitro could be due to the failure of reversed electron transport to take place or to the disruption, solubilization, or dilution of essential electron transfer components upon preparation of extracts. 2. Utilitarian Bacteria Kistner (1954) first reported oxidation of CO by H . carboxydovorans.Oxidation of CO proceeded independently of lactate oxidation and was not repressed by simultaneous oxidation of lactate. However, cells grown aerobically on lactate for 24 hours almost completely lost the ability to oxidize CO. This ability was not recovered upon reincubation under CO. It is perhaps significant that cells which had been grown on CO already possessed the ability to oxidize H,, although H, was oxidized less rapidly than CO by the same culture. It was also noted that H,-grown cells do not oxidize CO. From all the above results he concluded that the oxidation of CO by H . carboxydovorans depended on the presence in the cells of a catalytic system of an adaptive nature. That system had only been found in cells grown in a mineral medium under a mixture of CO and O,, i.e., the CO-oxidizing system is inducible in H . carboxydovorans. By use of cell-free extracts of P. carboxydovorans Meyer and Schlegel(l979) found that the oxidation of CO could be coupled to the anaerobic reduction of methylene blue, thereby discounting the possibility that CO was oxidized by an oxygenase reaction. The possibility that formate or hydrogen gas is an intermediate was discounted on the basis of the differential sensitivity of the activities of formate dehydrogenase and CO-DH to various physical and chemical treatments as well as the failure to trap free formate or H, in coypled optical assays. These results supported the following equation for CO oxidation in this organism: CO H,O + CO, + 2H+ 2e-. A year later, Cypionka et al. (1980) also concluded that CO oxidation by several carboxydobacteria followed the same mechanism as that for P. carboxydovorans. Kim (198 1) used a completely anaerobic enzyme reaction system for the CODH from P. carboxydohydrogena and suggested that water was the source of the second oxygen atom in CO oxidation by P. carboxydohydrogena. However, experiments employing H2I80did not provide evidence to support this assumption for unknown reason(s), as was true for Kirkconnell and Hegeman (1978). Certain problems in the experimental system including the GUMS analysis are thought to be the reason. Since electrons are not available directly from CO it is possible that CO may form a “formate-equivalent” on the enzyme surface by reacting with water as an intermediate during oxidation to CO, even though free formate is not a true

+

+

OXIDATION OF CO BY BACTERIA

15

intermediate during CO oxidation. This “formate-equivalent’’ could be a “formyl” group formed on the surface of the enzyme and be subsequently converted to CO, and to 2H 2e- which reduces the FAD cofactor on the CO-DH. The CO, so formed can subsequently be used as a carbon source via the reductive pentose cycle. The resulting electrons may be transferred to the electron transport system to produce reducing power and energy for cell growth (Kim, 1981). Figure 1 shows a hypothetical mechanism for CO oxidation in P. carboxydohydrogena. Recent evidence (Meyer, 1982) that the enzyme of P. carboxydovorans contains molybdenum, perhaps other metals, and an iron sulfur center as well as FAD suggests that this scheme is over simplified. Anaerobic M . thermoautotrophicum could utilize CO as an energy source by disproportionating CO to CO, and CH, according to the following equation: 4CO + 2H,O + CH, + 3c0, (Daniels et al., 1977). The Occurrence of growth at the expense of CO agrees with the fact that cell-free extracts of this organism contain both an active factor 420 (F,,,)-dependent hydrogenase and a CO-DH that specifically catalyzes the reduction of F4,, with CO. The enzyme activity was reversibly inactivated by low concentrations of cyanide (2 @) and was very sensitive to inactivation by oxygen. An interesting recent report (Lynd et al., 1982) describes the anaerobic metabolism of CO to acetate by the methylotrophic acidogen, B. methylotrophicum. The parental strain consumes CO during growth on various substrates but does not grow at the expense of CO. A variant was selected, however, that was able to grow on CO alone. This acquired ability was stable, and cells of the parental strain grown on methanol-acetate medium paradoxically had even higher levels of CO dehydrogenase activity than variant cells grown on CO. Four moles of CO were converted to roughly 2 moles of CO, and 1 mole of acetate. The authors put foreward a model (Fig. 2) for anaerobic CO metabolism by B. methylotrophicum similar to that adduced for C. thermouceticum (Drake et al., 1981) and by analogy, other acetogenic clostridia (Diekert and Thauer, 1978) and C. pasteuriunum (Thauer et al., 1974). Acetate may be formed in a corrinoid-dependent transcarboxylation in which pyruvate donates its carboxyl group to methyltetrahydrofolate (Schalman et al., 1973; Welty and Wood, 1977) but in the +

+

CO + H,O

FORMYL-CO-DH(FAD)

2 ~++2eFIG. I . (1981).

Proposed mechanism for CO oxidation in P. carboxydohydrogena. Taken from Kim

16

YOUNG M. KIM AND GEORGE D. HEGEMAN

4co/zjq X-

2

C H,

co,

Fic. 2. Possible mode of formation of acetic acid and COz during anaerobic growth with CO as energy source by E . limosum, B . merhylorrophicum, and oxidation of CO by acetate-forming clostridia. “X” is an unspecified carrier or enzyme. Adapted from Drake e r a / . (1981) and Lynd er a/. (1982). See, e.g., Fig. 2 in Hu era/. (1982) for more detail. The scheme given here is simplified and differs in detail from that presented by other authors.

case of the above systems CO may be used instead of pyruvate as source of the carboxyl group (Drake et a f . , 1981; Hu et a f . , 1982). According to another recent report (Genthner and Bryant, 1982) E. limosum also grows anaerobically with CO but in a rumen fluid-supplemented medium. Here, CO serves as the sole source of energy and the stoichiometry of acetate formation is like that reported for the variant of B. methylotrophicum. Accordingly, it seems reasonable to suppose that the use of CO by E. limosum may also be described by the scheme presented in Fig. 2. There is evidence that R. gefatinosa metabolizes CO to produce equimolar amounts of CO, and H, under anaerobic dark conditions: CO + H,O + CO, + H, (Uffen, 1976, 1981). It has been suggested that Rhodopseudomonassp. grow anaerobically in the light by photodissociation of CO and hemoprotein complex (Hirsch, 1968), but the mechanistic basis for this is obscure. 3. Carbon Monoxide Dehydrogenases of Carboxydobacteria Cypionka et a f . (1980) studied physiological characteristics of various strains of CO-grown carboxydobacteria: P. carboxydohydrogena, P. carboxydojlava, C . compransoris, A. carboxydus, and three other unidentified strains. According to sucrose density gradient centrifugation, the molecular weight of the COoxidizing enzymes of all strains was 230,000, except for A. carboxydus which was 170,000. It turned out that the molecular weights of the CO-oxdizing and H,-oxidizing enzymes were identical, but that the CO-oxidizing enzymes were soluble and the hydrogenases were membrane-bound in all strains examined. Extracts of the four known strains did not show any formate-oxidizing activity. a. Properties. There have been two reports of purified CO-DHs from carboxydobacteria. Meyer and Schlegel (1980) purified CO : methylene blue ox-

OXIDATION OF CO BY BACTERIA

17

idoreductase (CO : MB oxidoreductase) from CO-grown cells of P. carboxydovorans to homogeneity. The enzyme was obtained in 26% yield and was purified 36-fold. Under air the enzyme was stable for at least 6 days at -20°C had a molecular weight of 230,000, gave a single protein and activity band upon polyacrylamide gel electrophoresis, and was homogeneous by the criterion of sedimentation equilibrium. Sodium dodecyl sulfate gel electrophoresis reveded a single band of molecular weight 107,000. The purified CO : MB oxidoreductase was brown colored and had absorption maxima at 405 and 470 nm. From this result the authors suggested that it might be an iron-sulfur protein whose absorption spectrum was not affected by the presence of CO. Neither the absorption spectrum of the native enzyme nor the fluorescence spectrum of the trichloroacetic acid-treated preparation suggested that flavin was a constituent of this enzyme. Because the CO :MB oxidoreductase was free from fonnate dehydrogenase and practically free from hydrogenase activity (2% of that of CO : MB oxidoreductase activity), they concluded that neither hydrogenase nor formate dehydrogenase was functional in catalysis of CO oxidation. Among the metal-chelating agents tested, only cyanide (100 mM) completely inhibited the oxidation of CO. Fonnate and molecular hydrogen had no effect on the enzyme activity, and maximum reaction rates were measured at pH 7.0 and 63°C; temperature dependence followed the Arrhenius equation with an activation energy of 36.8 kJ/mole (8.8 kcalhnole). The apparent K, was 53 p M for CO. Meyer (1982), however, recently reported that the CO-DH from P. carboxydovorans is a new molybdenum-containing iron-sulfur flavoprotein, exhibiting chemical and spectral properties quite similar to those of xanthine oxidase. This enzyme contains 2 moles of noncovalently bound FAD, 4 moles each of acid-labile sulfur and iron, and 8 moles total of iron per mole of enzyme. In addition to these components, molybdenum (1 molehole), zinc (2-3 moleshole), and copper (1-3 moleshole) are present, but nickel is not. The enzyme turned out to be photoreducible in the presence of EDTA and urea and was subject to reoxidation by air. As is true for other molybdenum dehydrogenases, this enzyme was readily inactivated by methanol. The soluble yellow CO-DH of P . carboxydohydrogenawas purified 35-fold to better than 95% homogeneity; the purified enzyme comprised about 3% of the soluble cell protein (Kim and Hegeman, 1981a). The specific activity of this enzyme was almost 100-fold greater than that of P. carboxydovorans (1.94 pmoles of CO oxidized per minute mg-I protein) (Meyer and Schlegel, 1980). The purified enzyme is stable for a long time at -70°C under air, and this stability is greater than the enzyme of P. carboxydovorans which is quite sensitive to storage at -20°C under air. The molecular weight of the purified enzyme was found to be 4 X lo5 by gel filtration. The subunit structure of the native enzyme seems to be an unusual a3P3y3 (a,14K; P, 28K; y, 85K) which

18

YOUNG M. KIM AND GEORGE D. HEGEMAN

suggests a complicated mechanism for CO oxidation. A previous report estimates the molecular weight of CO-DH in P . carboxydohydrogenato be 2.3 X lo5 (Cypionka et al., 1980) in disagreement with that found by Kim and Hegeman (1981a) and in agreement with the value of Meyer and Schlegel(1980) for P . carboxydovoruns. The difference between the two values may be due to the different methods used. Cross-linking experiments with reversible or with nonreversible reagents showed that all three kinds of subunits of the purified CO-DH of P . carboxydohydrogena are involved in the cross-linking reaction, but the cross-linking process could not be successfully reversed (Kim and Hegeman, 1981a). Sulfhydryl groups are apparently not involved in CO oxidation. The K,,,for CO of the purified CO-DH from P . carboxydohydrogenais 63 pM. The isoelectric point of the native enzyme was found to be 4.5-4.7. One mole of native enzyme contains at least 3 moles of noncovalently bound FAD as cofactor, suggesting that one of the three types of subunits binds FAD. The purified enzyme was free from formate dehydrogenase and NAD-specific hydrogenase activities but had particulate hydrogenase-like activity (non-NAD-linked hydrogenase activity) with thionin as electron acceptor. Both soluble CO-DHs purified from aerobic utilitarian CO oxidizers have hydrogenase activity (Kim and Hegeman, 198la; Meyer and Schlegel, 1980). The hydrogenase associated with the purified CO-DHs are of a new type which is soluble but cannot reduce NAD. Association of hydrogenase activity with CO-DH may have two possible explanations: (1) Hydrogenase may be involved in CO utilization through the use of H, that may be formed as an intermediate, but not evolved in free form. (2) Hydrogenase is not involved directly in CO oxidation but H, is a pseudosubstrate for the enzyme. The presence of hydrogenase activity in cell-free extracts of A. curboxydus which cannot grow as a hydrogen bacterium (Cypionka et al., 1980) implies that hydrogen may be a pseudosubstrate for CO dehydrogenase(s), although CO is not commonly regarded to be a close analog of H,. Some hydrogen bacteria require a supply of nickel to form active hydrogenase (Friedrich et al., 1981) and the CO-DH of C. thermoacericum is a metallonickel enzyme (Drake et al., 1980). However, several chelators of divalent metals did not inactivate the purified P. carboxydohydrogena enzyme and exogenously added NiCl,, and other divalent metal salts did not activate, but sometimes inactivated, the two purified CO-DHs from carboxydobacteria(Kim and Hegeman, 1981a; Meyer, 1982). By using immunoprecipitation for purification of the CO-DH from 63Ni-growncells of P . carboxydohydrogenait was found that the enzyme does not contain a significant amount of nickel, therefore is presumably not a nickel enzyme (Kim and Hegeman, 1981a). These results and those of Meyer (1982) indicate that nickel is apparently not a necessary factor for CO oxidation in all biological systems and that there is no necessary relationship between hydrogen bacteria and carboxydobacteria with respect to the involvement of this unusual trace metal.

OXIDATION OF CO BY BACTERIA

19

From the above discussion, one might conclude that oxidation of CO as an energy source by carboxydobacteria is mediated by different enzymes of the dehydrogenase type since there are some apparent structural differences between the CO-DHs of P . carboxydohydrogena and of P . carboxydovorans found in different laboratories. However, by denaturing polyacrylamide gel electrophoresis of immune precipitates, it was found that the CO-DHs from these and other carboxydobacteria are very similar in subunit structure and in antigenicity (Kim et al., 1982; 0 . Meyer, personal communication). The differences are therefore probably not large. b. Evolution. As mentioned in the previous section, the CO-DH of P . carboxydohydrogena has a structure apparently different from that of P . carboxydovorans. Taken together with the fact that CO-utilizing bacteria are assigned to different genera and species (Kirkconnell, 1978; Nozhevnikova and Zavarin, 1974; Zavarzin and Nozhevnikova, 1977), it seems probable that there are significant differences in the mechanism of CO oxidation among aerobic utilitarian CO oxidizers. Studies of several strains of aerobic carboxydobacteria, on the other hand, reveal that these bacteria share several common physiological properties important in CO oxidation during autotrophic growth with CO (Cypionka et al., 1980; Meyer and Schlegel, 1980), indicating that the CO-oxidizing system in these bacteria may indeed be quite similar. Immunological observations made by Kim er al. (1982) indicated clearly that the CO-DHs of P . carboxydohydrogena, P. carboxydovorans, and Azomonas sp. 2 were very similar in structure. These three enzymes all have three nonidentical subunits and the molecular sizes of the corresponding subunits of all three enzymes were almost the same. The CO-DHs of P . carboxydovorans and Azomonas sp. cross-reacted with antibody prepared against the purified CO-DH of P . carboxydohydrogena(Fig. 3 ) . These observations agree with the report that the CO-DHs of all of the carboxydobacteria have a common molecular weight except that of A . carboxydus (Cypionka et al., 1980) and that the CO-DHs from several carboxydobacteria cross-react with the antiserum prepared against the purified CO-DH of P . carboxydovorans (personal communication with 0. Meyer, 1981). These facts imply that the genes for these enzymes may be very similar in the different organisms. From the results presented above, Kim et al. (1982) concluded that the oxidation of CO as an energy source by various Gram-negativebacteria is mediated by similar enzymes. Taken together with the fact that bacteria from many different biological groups oxidize CO, this suggests either that the ability to use CO evolved from a common CO-utilizing ancestor at an early time before divergence occurred with (unlikely) conservation of enzyme structure, or that genetic exchange, perhaps mediated by plasmids or other wide-ranging mechanisms, has recently dispersed genes for a common ancestral CO-DH to bacteria of many different groups. The striking structural similarities among the CO-DHs of P.

20

YOUNG M. KIM AND GEORGE D. HEGEMAN

FIG. 3. Double immunodiffusion patterns for carbon monoxide dehydrogenases from different utilitarian aerobes. Immunodiffusion was performed in 1.2% agarose gel for 24 hours at 30°C followed by staining with Buffalo black. AS, 5 pI antiserum prepared against purified CO dehydrogenase of P. carboxydohydrogena (Kim and Hegeman, 1981a); 1, purified. enzyme used to prepare antibody ( P . carboxydohydrogena. 3.75 pg); 2, crude soluble fraction from CO-grown P . carboxydohydrogena (16.5 Fg); 3 . soluble fraction from P . carboxydovorans OM5; 4, soluble fraction from Azomonas sp. 2 (Kirkconnell, 1978; 27.2 pg). Extracts prepared from cells grown in the absence of CO show no reactions. From Kim (1981).

carboxydohydrogena, P . carboxydovorans, and Azomonas sp. 2 suggest that plasmid(s) may be involved. The observation by Y. Park (unpublished observations) working in the authors’ laboratory that these three organisms all carry a small plasmid (6 kb) of apparently identical size tends to support a role for a plasmid. It is interesting to note that genes conferring the ability to grow with H,

OXIDATION OF CO BY BACTERIA

21

in Nocardia opaca (Reh and Schlegel, 1975), Pseudomonas facilis (Pootjes, 1977), and Alcaligenes eurrophus (Anderson et al., 1981) are located on plasmids. Both carboxydobacteria and hydrogen bacteria share in common the unusual ability to use an inorganic trace gas as energy source for the assimilation of CO, as carbon source, and both are facultative autotrophs. Furthermore, some carboxydobacteria (but not all) can also grow as hydrogen bacteria, even though there are some differences in physiology between the true hydrogen bacteria and the carboxydobacteria during growth with H, and CO,. Davis (1967) and Davis et al. (1970) reported that the strain known as H . carboxydovorans Kistner could not oxidize either CO or H,. Zavarzin and Nozhevnikova (1975, 1977) assumed that the loss of the ability to oxidize CO in this bacterium might come from the loss of a plasmid carrying the gene(s) for CO-qxidizing activity. The data reported by Kim ef al. (1982) strongly support that assumption.

B. CARBON MONOXIDE AS CARBON AND ENERGY SOURCE 1. Carbon Assimilation Nonutilitarian CO-oxidizing bacteria cannot use CO as .carbon and energy source under autotrophic growth conditions. However, a report that Methylococcus cupsulatus contains both ribulose biphosphate carboxylase and phosphoribulokinase (Taylor, 1977) opens the possibility that methylotrophs could grow with CO as a source of carbon following its oxidation to CO, using another compound as source of electrons (reductant). The mechanism for synthesis of cellular material from CO, derived from CO in M . thermoautrophicum (Daniels er al., 1977) is yet unknown; methanogenic bacteria do not seem to possess the reductive pentose phosphate cycle as the chemolithotrophs usually do (see Fig. 2 for a possible pathway). Experiments using I4CO indicated that CO is assimilated in aerobic carboxydobacteria after it is converted to CO, (Romanova et al., 1977; Zavarzin and Nozhevnikova, 1977). Sanzhieva and Zavarzin (1971) first reported that S . carboxydohydrogena grew autotrophically at the expense of CO through the fixation of CO, with ribulose diphosphate. Since that report it has generally been accepted that the carbon dioxide produced from CO is fixed in carboxydobacteria via the reductive pentose phosphate cycle based on the kinetics of 14C0 assimilation into early labeled products and on the presence and activity of the key enzymes of the reductive pentose phosphate cycle, ribulose biphosphate carboxylase and phosphoribulokinase (Kirkconnell, 1978; Meyer and Schlegel, 1978; Nozhevnikova and Saval’eva, 1972; Romanova et al., 1977, 1978a; Romanova and Tsyshnatii, 1978; Zavarzin and Nozhevnikova, 1977). But Romanova et al. (1978a) did not exclude the possibility that there exist other reactions for incor-

22

YOUNG M. KIM AND GEORGE D. HEGEMAN

poration of CO into cell material in P. gazotropha because of the early appearance of 14C from H14C0,- in serine (glycine), especially in the absence of an energy source. Measurement of the actual stoichiometry of uptake and fixation of CO have been made by Kistner (1953, 1954), Zavarzin and Nozhevnikova (1977), Meyer and Schlegel (1978), and Kirkconnell (1978). About 4% of the CO used by several strains of carboxydobacteria, 2% of the CO used by Azomonas sp. and Azotobacter sp., and 16% of the CO used by P. carboxydovorans were incorporated into cellular material. These differences may result from quantitative rather than qualitative differences in electron transport systems among these bacteria since it is known that there are no striking qualitative differences among the electron transport systems of several carboxydobacteria examined (see next section). 2 . Electron Acceptors and Electron Transport Systems Assay of the CO dehydrogenases has usually been done using artificial electron acceptors. Cell-free extracts of D. desulfuricans (Yagi, 1958, 1959) and several methanogens (Daniels et al., 1977) used viologen dyes as electron acceptors during the oxidation of CO. Daniels et al. (1977) reported that M . thermoautotrophicum used F420 as physiological electron acceptor, i.e., CO was used as the electron donor via the F,,,-specific CO dehydrogenase. Clostridia can also use viologen dyes, FAD, FMN, and methylene blue, but cannot use NAD, NADP, or ferredoxin from C. pasteuriunum (Diekert and Thauer, 1978; Fuchs et al., 1974, 1975; Thauer et ul., 1974) as acceptors. From the fact that FAD and FMN were both reduced at equal rates, Thauer et al. (1974) proposed that both flavin nucleotides must be considered to be possible physiological electron acceptors in C. pasteurianum. Fuchs et al. (1979, however, reported that a flavin nucleotide was not likely to be the physiological electron acceptor since the reaction was not found to be specific for one of the two flavin nucleotides and since FAD and FMN usually function as prosthetic groups rather than as dissociable coenzymes (electron acceptors), Drake et al. (1980) reported that ferredoxin purified from C. thermoaceticum and C . pasteurianum and b-type cytochromes of C . thermoaceticum were rapidly reduced by CO in the presence of the CO-DH prepared from C. thermoaceticum, and both were therefore considered to be possible native electron carriers. Since methyl and benzyl viologen were reduced by CO, it was thought that ferredoxin might be a physiological electron acceptor for C. thermoaceticum . FMN and cytochrome c j (Desulfovibrio vulgaris) were also recuced while spinach ferredoxin, FAD, NAD, and NADP were not. The reduction of b-type cytochrome by CO-DH demonstrated the potential for anaerobic oxidative phosphorylation accompanying CO oxidation, i.e., CO-DH might

23

OXIDATION OF CO BY BACTERIA

play a fundamental role in the energy metabolism of the cells, but there was no further investigation of this possibility. Studies of artificial electron acceptors for CO oxidation in carboxydobacteria using purified enzymes (Kim and Hegeman, 1981a; Meyer and Schlegel, 1980) and crude extracts (Cypionka er al., 1980; Kirkconnell, 1978) revealed that methylene blue, thionin, toluylene blue, and phenazine methosulfate, but not viologen dyes, NAD, FAD, nor FMN, could function as electron acceptors. This suggested that ubiquinone might be a physiological acceptor for electrons from CO in this group of bacteria. Restoration of the CO-DH activity in UV-treated cell-free extracts of P. carboxydohydrogena using ubiquinone 10 (UQ,o) revealed that a quinone was a necessary and physiological electron acceptor in CO oxidation (Kim and Hegeman, 1981b). However, Schlegel and Meyer (1981) reported that quinones as well as ferredoxins could not serve as electron acceptors in P. carboxydovorans,which contradicts previous reports (Cypionka et al., 1980; Meyer and Schlegel, 1979, 1980). Several carboxydobacteria possess cytochromes of the b, c, a, and o types, indicating that a typical electron transport system participates in CO oxidation (Kim and Hegeman, 1981b; Kirkconnell, 1978; Lebedinskii et al., 1976; Meyer and Schlegel, 1978; Zavarzin and Nozhevnikova, 1977). Experiments using "Nadi" reagent (to test terminal oxidase function) and electron transport system inhibitors suggested that the existing electron transport system functions during CO oxidation and that electrons from CO are delivered at the level of quinone (Kim and Hegeman, 198Ib). The presence of cytochrome o in carboxydobacteria strongly supports the conclusion that cytochrome o functions as a terminal oxidase (Jurtschuk and Yang, 1980) in cells grown with CO, and that there may be a branched electron transport system in carboxydobacteria. Cytochrome o in Bacillus megarerium has a lower affinity for CO than cytochrome a3 (Broberg and Smith, 1967). A similar system in carboxydobacteria acting together with the CO-DH may be partly responsible for CO tolerance in the carboxydobacteria. Carboxydobacteria cannot obtain reducing power directly through the reduction of NAD(P) to NAD(P)H from CO with the CO-DH. Since'electrons from CO are delivered from the CO-DH at the level of quinone, it seems that reduced pyridine nucleotide must be generated by reverse electron transport, a process which is inefficient when compared with direct reduction of NAD(P)+ by substrate. This inefficiency may explain why carboxydobacteria grow slowly with CO (doubling time = 12-42 hours) (Cypionka et al., 1980; Kim, 1981; Meyer et al., 1980; Meyer and Schlegel, 1978; Sanzhieva and Zavarzin, 1971) and why the efficiency of conversion of CO carbon to cellular material is low (2 16%) (see Section IV,B,l). A possible electron transport system for P. carboxydohydrogena during growth with CO is shown in Fig. 4 (Kim, 1981). +

-

24

YOUNG M. KIM AND GEORGE D. HEGEMAN

co + -CDDH-UQ-CYT.

HL 0

b-m.

C

b r . aa,

FIG. 4. Proposed electron transport system in P. carboxydohydrogena during growth with CO. Branching is presumed to occur at the level of cytochrome c but there is no evidence for this. Adapted from Kim (1981).

V. Environmental Significance It is now clear that the ecological distribution of CO-oxidizing bacteria is quite broad. Carboxydobacteria were thought to be a potentially powerful natural tool for removing CO from the atmosphere (Nozhevnikova, 1974; Nozhevnikova and Zavarzin, 1973; Pandaw er al., 1960; Zavarzin and Nozhevnikova, 1975) and, in nature, may be a part of the microflora utilizing organic intermediates as well as H, and CO produced by anaerobic bacteria (Zavarzin and Nozhevnikova, 1977; Kiessling and Meyer, 1982). But Bartholomew and Alexander (1979) concluded that CO oxidation in soil was not the result of autotrophic metabolism by aerobic carboxydobacteria and that “cometabolic” oxidation of CO to CO, by nonutilitarian CO-oxidizing bacteria might be the major microbial mechanism for the removal of CO in nature. The relatively high K , (53 63 pM) for CO of the purified CO-DHs from carboxydobacteria (Kim and Hegeman, 198la; Meyer and Schlegel, 1980) also casts doubt on whether utilitarian CO oxidizers can use atmospheric CO for growth since the concentration of CO in free air is so low [1.3 39 nmole/liter (0.03 0.9 ppm) depending upon the site of measurement] (Robbins et d . , 1968). Conrad and Seiler (1980a), however, tested P. carboxydovorans to see whether it could utilize the low concentrations (0.7 ppm) of CO present in laboratory air and found that CO was consumed by this organism in sterile soil. From this observation they concluded that this bacterium was a genuine oligocarbophilic microorganism and that its ecological niche in nature might include the utilization of the CO present in the atmosphere. They also reported that CO was consumed by fresh soil under anaerobic as well as aerobic conditions even though the anaerobic consumption rate was lower. Anaerobic preincubation of the soil stimulated the anaerobic CO consumption and reduced the aerobic consumption. Following this examination they suggested that anaerobic microorganisms were also of significance in the consumption of atmospheric CO. Conrad er al. (1981) tested CO consumption rates of several carboxydobacteria at high (50%) and low (0.5 ppm) mixing ratios of CO in air and concluded that carboxydobacteria cannot contribute significantly to the consumption of atmospheric CO since the K , values for CO in cell suspensions of the carboxydobacteria and in cells added to sterile soil (465-1 110 ppm) were much higher than those of the natural soils (5-8 ppm). They assumed that other microorga-

-

-

-

OXIDATION OF CO BY BACTERIA

25

nisms with a high affinity for CO are responsible for the oxidation of the atmospheric CO at the soil surface and that an ecological niche for the carboxydobacteria which have low affinity for CO may be the scavenging of CO at microsites where CO occurs locally at high concentrations during catabolism of organic matter. For instance, it is known that flavonoids and porphyrins are decomposed in the soil with formation of CO (Stevens er al., 1972; Westlake et al., 1961). Rainwater sometimes contains up to 200 times the concentration of CO expected based upon the partial pressure in the atmosphere (Swinnerton et al., 1971). Phototrophic bacteria may remove significant amounts of CO formed during degradation of photosynthetic pigments in decaying vegetative materials in anaerobic sediments (Uffen, 1976). Fuchs et al. (1974) suggested that C. pasteurianum participates in the continuous removal of CO from the environment based on the ability to grow under a low concentration (1 ppm) of CO, but this possibility was rejected by Bartholornew and Alexander (1979) since the ability to oxidize CO anaerobically was abolished by pasteurizing soil (25 minutes at 70°C).

VI. Applications Study of bacterial CO oxidation is, of course, interesting in its own right, but it has recently attracted much attention because CO oxidizers may be used to reduce locally high concentrations of CO in the environment or to produce useful chemicals or single-cell protein from toxic industrial waste gas. A better understanding of the mechanism of biological CO oxidation may also permit the development of large scale nonbiological devices for industrial use involving rational catalytic reactor design based on biological models. Since carboxydobacteria have the ability to grow in gas mixtures containing H, with significant amounts of CO, it has been proposed to cultivate these organisms in unpurified gas from blast-furnaces, synthesis gas made from coal and steam, or the CO + H, mixtures from more modem processes (Hirsch er al., 1982) to produce single-cell protein (Meyer, 1980, 1981; Sanzhieva and Zavarzin, 1971; Saval’eva and Nozhevnikova, 1972). Formyl or other CO-derived intermediates in catalytic conversions are of interest in a number of industrial processes (Haggin, 1982). For instance, it has been reported that methane (“COthane”) can be produced from CO in waste gases through a two-step process using chemical catalysts (Heylin, 1981b). The process uses nickel or cobalt as a catalyst to disproportionate CO to CO, and an active carbon : catalyst complex. The active complex further reacts with water to form equimolar quantities of methane and CO,: 4CO

270-300°C + catalyst -2C02

+ 2C :catalyst

26

YOUNG M . KIM AND GEORGE D . HEGEMAN 2C:catalyst

+ 2H20 (steam)

CH4

+ COz + catalyst

(2)

The net reaction is 4CO + 2H,O + CH, + 3co,, which is the same as that for CO oxidation in M . thermoautotrophicum(Daniels et af., 1977) and M . barkerii (Kluyver and Schnellen, 1947). Interest in practical utilization of CO in waste gases to produce useful gas, together with the assumption that a formyl intermediate may occur during CO oxidation in P . carboxydohydrogena, motivates a search for methods to produce formic acid from CO which is presently flared at industrial locations. There is already one industrial process proposed to produce formic acid from CO using catalytic carboxylation of methanol (Keylin, 198la): CHIOH

+ CO + C H 3 - O - C ( O + H

CHja(O+H

(methyl formate)

+ HzO + CHjOH + HCOOH

(3)

(4)

But this process may need further work to clean the used methanol for recycling, especially if waste gases containing contaminants are used. It is well known that CO can react with several metals such as nickel (Ni), cobalt (Co), and iron (Fe) to make metal carbonyl complexes, e.g., nickel tetracarbonyl [Ni(CO),] and iron pentacarbonyl [Fe(CO),]. The metal carbonyl complex usually reacts with water to yield metal formate [M-O-C(O)-H] and eventually produces metal hydride (M-H) and CO, upon pyrolysis (Deeming and Shaw, 1969). But if one can develop a method efficiently to hydrolyze the metal :formate complex, it would be possible to produce formic acid from

co.

It has been suggested to grow R. gefatinosa with CO to produce CO, and H, and to grow several methanogenic bacteria to produce methane from coal gasification products (CO,, H,, and CO) (Wise et al., 1978). The report that it is possible to replace pyruvate with CO as C, donor during the homoacetate synthesis in C. thermoaceticum opens another possibility that CO may be used to produce acetic acid biologically. Whether any of these suggestions will be commercially competitive is problematic (Pape, 1978).

VII. Conclusions Diverse bacteria that are present in the soil or surface water can remove CO from the biosphere by oxidizing this gas to CO,. Many of these organisms do not profit from this oxidation and oxidize CO gratuitously. It is clear that nonspecific enzymes which have various metabolic functions are involved in this nonutilitarian CO oxidation, though the mechanism of this type of CO oxidation appears not to be uniform. Anaerobic clostridia, carboxydobacteria, meth-

OXIDATION OF CO BY BACTERIA

27

anogens, and sulfate-reducing bacteria oxidize CO via a dehydrogenase, and the second oxygen for CO oxidation to CO, probably comes from water. However, ' aerobic methane-oxidizing bacteria catalyze the reaction via a nonspecific methane monooxygenase, i.e., the oxidation of CO to CO, is not the physiological function of this enzyme which uses 0, as the source of second oxygen atom during CO oxidation. The discovery of nickel in the CO-DH of the homoacetate forming clostridia and of synthesis of acetyl CoA from CO by these and other anaerobic acetogens, is an interesting outcome from studies of the anaerobic COutilizing bacteria. Studies of utilitarian CO oxidation revealed a number of important points. The ability to grow at the expense of CO is not confined to a specific, phenotypically homogeneous group of organisms, but rather is widely distributed, and it may be genetically transmissible by plasmid(s) among a physiologically related group of Gram-negative and, possibly, Gram-positive bacteria. Almost all the carboxydobacteria studied so far share common physiological adaptations for CO oxidation. The CO-dependent reduction of artificial electron acceptors has been demonstrated in most strains tested, and electrons from CO are probably delivered to the electron transport system at the level of quinone; pyridine nucleotides are apparently not involved in CO oxidation. Neither formate nor hydrogen appears to be free intermediates during aerobic CO oxidation, suggesting a direct dehydrogenation of CO by CO dehydrogenase (CO : acceptor oxidoreductase) in which water presumably serves as the source of the second oxygen for CO oxidation even though there is no direct evidence for this hypothesis: CO H,O + CO, 2H + 2e-. CO has to be converted to CO, before it is incorporated into bacterial cellular material, and key enzymes of the reductive pentose phosphate cycle have been identified in all aerobic CO-utilizing bacteria examined. Cytochromes of the b, c, 0, and a types were detected in many strains tested after aerobic growth with CO as the sole source of carbon and energy, i.e., there is no qualitative modification of the general electron transport system to avoid the toxic effects of CO during aerobic oxidation of CO. It is apparent that many carboxydobacteria, but not all, can also grow as hydrogen bacteria with H, and CO,, but bacteria isolated as hydrogen oxidizers do not usually use CO. In both cases that have been examined, the purified CO-DH from aerobic carboxydobacteria has hydrogenase activity, and growth with CO induces hydrogenase synthesis. A CO-DH may also be involved in the anaerobic utilization of CO by photosynthetic bacteria in the dark and by M . thermoautotrophicum; hydrogenase may be responsible for energy generation from H, which results from oxidation of CO with H,O in photosynthetic bacteria. The ability of M . thermoautotrophicum to use CO as energy source, even though marginal, opens the possibility that other methanogens may also use CO under optimal experimental conditions. It has recently been reported that the rumen acidogen, E. limosum, and a stable variant

+

+

+

28

YOUNG M. KIM AND GEORGE D. HEGEMAN

of a very similar methylotrophic acidogen, B. methylotrophicum, grow anaerobically with CO as sole energy source.

ACKNOWLEDGMENTS Work in the author’s laboratory on the oxidation of carbon monoxide by bacteria is supported by a research grant PCM 78-12482 from the U.S.National Science Foundation. We wish to thank Dr. 0. Meyer and many other colleagues for generously sharing unpublished findings with us and for constructive criticism.

REFERENCES Anderson, K., Tait, R. C., and King, W. R. (1981). Arch. Microbiol. 129, 384-390. Andress, G. (1975). Staatsexamensarbeit, University of Bochum. Barker, H. A. (1936). Arch. Mikrobiol. 7, 420-438. Bartholomew, G. W., and Alexander, M. (1979). Appl. Environ. Microbiol. 37, 932-937 Bartholornew, G. W., and Alexander, M. (1981). Science 212, 1389-1391. Bauer, K., Conrad, K., and Seiler, W. (1980). Biochim. Biophys. Acfa 589, 46-55. Beijerinck, M. W., and van Delden, A. (1903). Cenrr. Bakferiol. Parasirenkd. 10, 33-47. Bidwell, R. G. S.,and Fraser, D. E. (1972). Can. J . Bot. 50, 1435-1439. Bowien, B., and Schlegel, H. G. (1981). Annu. Rev. Microbiol. 35, 405-452. Breckenridge, B. (1953). Am. J. Physiol. 173, 61-69. Broberg, P. L., and Smith, L. (1967). Biochim. Biophys. Acra 131, 479-489. Calvert, J. G., Kerr, J. A., Demejian, K. L., and McQuigg, R. D. (1972). Science 175,751-752. Chapelle, E. W. (1962). Biochim. Biophys. Acra 62, 45-62. Conrad, R., and Seiler, W. (1980a). Appl. Environ. Microbiol. 40,437-445. Conrad, R.,and Seiler, W. (1980b). FEMS Microbiol. Lerr. 9, 61-64. Conrad, R., Meyer, 0..and Seiler, W. (1981). Appl. Environ. Microbiol. 42, 211-215. Crutzen, P.J. (1974). Tellus 26, 47-57. Cypionka, H., Meyer, O., and Schlegel, H. G. (1980). Arch. Microbiol. 127, 301-307. Daniels, L., Fuchs, G., Thauer, R. K., and Zeikus, J. G. (1977). J . Bacreriol. 132, 118-126. Dashekvicz, M. P., and Uffen, R. L. (1979). Inr. J . Sysf. Bacreriol. 29, 145-148. Davis, D. H. (1967). Ph.D. thesis. University of California, Berkeley. Davis, D. H., Doudoroff, M.,Stanier, R. Y.,and Mandel, M.(1969). Inr. J . Sysr. Bacteriol. 19, 375-390.

Davis, D. H., Stanier, R. Y.,Doudoroff, M., and Mandel, M. (1970). Arch. Mikrobiol. 70, 1-13. Deeming, A. J.. and Shaw, B. L. (1969). J. Chem. SOC.A , pp. 443-446. Diekert, G. B., and Thauer, R. K. (1978). J . Bacreriol. 136, 597-606. Diekert, G. B., and Thauer, R. K. (1980). FEMS Microbiol. Len. 7, 187-189. Diekert, G. B., Graf, E. G . , and Thauer, R. K. (1979a). Arch. Microbiol. 122, 117-120. Diekert, G. B.. Graf, E. G., and Thauer, R. K. (1979b). I n “Vitamin BI2” (B. Zagalak and W. Friedrich, eds.), pp. 1033-1036. De GNyter, Berlin. Drake, H. L. (1982). J . Bacreriol. 149, 561-566. Drake, H. L., Hu, S.-I., and Wood, H. G. (1980). J. Biol. Chem. 255, 7174-7180. Drake, H. L., Hu, S.-I.,and Wood, H. G. (1981). Annu. ASM Meer., 81sr K42. p. 144 (Abstr.).

OXIDATION OF CO BY BACTERIA

29

Drake, H. L., Hu, S.-I., and Wood, H. G. (1981). J . Biol. Chem. 256, 11137-11144. Ehhalt, D. H. (1975). In “Microbial Production and Utilization of Gases” (H. G. Schlegel e t a / . , eds.), pp. 13-21. Goltz, Gottingen. Ehhalt, D. H., and Volz, A. (1975). In “Microbial Production and Utilization of Gases” (H. G. Schlegel et al.. eds.), pp. 23-33. Goltze, Gottingen. Engel, R. R., Matsen, J. M., Chapman, S. S., and Schwartz, S. (1972). J. Bacteriol. 112. 13 10- 13 15. Engel, R. R., Modler, S.,Matsen. J. M., and Petryka, Z. J. (1973). Biochim. Biophys. Acta 313, 150-155.

Fenn, W. 0. (1970). Ann. N.Y. Acad. Sci. 174, 64-71. Ferenci, T. (1974). FEBS Lett. 41, 94-98. Ferenci, T. (1975).In “Microbial Production and Utilization of Gases” (H. G. Schlegel et a l . , eds.), pp. 371-378. Goltze, Gottingen. Ferenci, T., Strom, T., and Quayle, J. R. (1975). J. Gen. Microbiol. 91, 79-91. Fischer. F., Lieske, R., and Winser, K. (1931). Biochem. Z . 236, 247-267. Fischer, F., Lieske, R., and Winser, K. (1932). Biochem. 2. 245, 2-12. Friedrich, B., Heine, E.. Finck, A., and Friedrich, C. G. (1981). J. Bacteriol. 145, 1144-1149. Fuchs, G., Schnitker, U., and Thauer, R. K. (1974). Eur. J. Biochem. 49, 111-115. Fuchs, G., Andress, G . , and Thauer, R. K . (1975). In “Microbial Production and Utilization of Gases” (H. G. Schlegel et al., eds.), pp. 231-236. Goltze, Gottingen. Genthner, B. R. S., and Bryant, M. P. (1982). Appl. Environ. Microbiol. 43, 70-74. Haggin, J . (1982). Chem. Eng. News 60, 13-21. Hasemann, W. (1927). Biochem. Z. 184, 147-171. Hegeman, G. (1980). Trends Biochem. Sci. 5 , 256-259. Heichel, G. H. (1973). J . Environ. Qual. 2, 419-423. Heylin, M. (1981a). Chem. Eng. News 59, back cover. Heylin, M. (1981b). Chem. Eng. News 59, 21. Hirsch, P. (1960). Arch. Mikrobiol. 35, 391-414. Hirsch, P. (1965). Annu. ASM Meet., 65th P108, pp. 90-91 (Abstr.). Hirsch, P. (1968). Nature (London) 217, 555-556. Hirsch. P., and Conti, S. F. (1964). Arch. Mikrobiol. 48, 339-357. Hirsch, R. L., Gallaghen, J. E., Jr., Lessard, R. E., and Wesselhoft, R. A. (1982). Science 215, 121- 127. Hu, S.-I., Drake, H. L., and Wood, H. G. (1982). J. Bacteriol. 149, 440-448. Hubley, J. H., Mitton, J. R., and Wilkinson, J. F. (1974). Arch. Microbiol. 95, 365-368. Ingersoll, R. B., Inman, R. E., and Fisher, W. R. (1974). Tellus 26, 151-159. Inmann, R . E., and Ingersoll, R. B. (1971). J. Air Pollut. Control 21, 646-647. Inmann, R. E., Ingersoll, R. B., and Levy, E. A. (1971). Science 172, 1229-1231. Jones, G. W., and Scott, G. S. (1939). Ind. Chem. Eng. 31, 775-778. Junge, C., Seiler, W., and Wameck, P. (1971). J. Geophys. Res. 76, 2866-2879. Jurtshuk, P., and Yang, T.-Y. (1980). In “Diversity of Bacterial Respiratory Systems” (C. J. Knowles, ed.), Vol. I, pp. 137-159. CRC Press, Boca Raton, Florida. Kaserer, H . (1906). Centr. Bakteriol. Parasitenkd. 16, 681-696. Keppen, 0. I., Nozhevnikova, A. N., and Gorlenko, V. M. (1976). Microbiology 45, 10-13. Kiessling, M., and Meyer, 0. (1982). FEMS Microbiol. Lett. 13, 333-338. Kim, Y. M. (1981). Doctoral thesis, Indiana University, Bloomington, Indiana. Kim, Y. d.,and Hegeman, G. D. (1981a). J . Bacteriol. 148, 904-91 1. Kim, Y. M., and Hegeman, G. D. (1981b). J. Bacteriol. 148, 991-994. Kim, Y. M., Kirkconnell, S., and Hegeman, G. D. (1982). FEMS Microbiol. Len. 13, 219-223. Kirkconnell, S. (1978). Doctoral thesis, Indiana University, Bloomington, Indiana.

30

YOUNG M. KIM AND GEORGE D. HEGEMAN

Kirkconnell, S., and Hegeman, G. (1978). Biochem. Biophys. Res. Commun. 83, 1584.-1587. Kistner, A. (1953). Proc. K . Ned. Akad. Wet. Ser. C 56, 443-450. Kistner, A. (1954). Proc. K . Ned. Akad. Wet. Ser. C 57, 186-195. Kluyver, A. J., and Schnellen, Ch. G.T.P. (1947). Arch Biochem. 14, 57-70. Krall, A. R., andTolbert, N. E. (1957). PlantPhysiol. 32, 321-326. Kummler, R. H., Grenda, R. N., Bauer, T., Bortner, M. H., Davies, J. H., and MacDowall, 1. (1969). Trans. Am. Geophys. Union 50, 174. Landaw, S. A. (1970). Ann. N.Y. Acad. Sci. 174, I, 32-48. Lantzsch, K. (1922). Cenrr. Bakreriol. Parasirenkd. 57, 309-319. Lebedinskii, A. V., Ivanovskii, R. N., and Nozhevnikova, A. N. (1976). Microbiology 45, 160-161.

Levine, A. S., Bond, M. D., F‘rentiss, B. S., and Levitt, M. D. (1982). Gasrroenrerology (in press). Levy, H. (1971). Science 173, 141-143. Liebl, K. H., and Seiler, W. (1975). In “Microbial Production and Utilization of Gases” (H. G. Schlegel er al., eds.), pp. 215-229. Goltze, Gottingen. Loewus. M. W., and Delwiche, C. C. (1963). Planr Physiol. 38, 371-374. Lynd, L., Kirby, R., and Zeikus, J. G. (1982). J. Bacreriol. 149, 255-263. McConnell, J. C., McElroy, M. B., and Wofsy, S. C. (1971). Narure (London) 233, 187-188. Meyer, 0. (1980). Bioscience 30, 405-407. Meyer, 0. (1981). Studies Environ. Sci. 9, 79-86. Meyer, 0. (1982). J . Biol. Chem. 257, 1333-1341. Meyer, O., and Schlegel, H. G. (1977). In “Microbial Growth on C,-compounds” (G. K. Skryabin er al., eds.), pp. 95-97. USSR Acad. Sci., Puschino. Meyer, 0..and Schlegel, H. G. (1978). Arch. Microbiol. 118, 35-43. Meyer, O., and Schlegel, H. G. (1979). J. Bacreriol. 137, 81 1-817. Meyer. 0..and Schlegel, H. G. (1980). J . Bacteriol. 141, 74-80. Meyer, 0..Lalucat, J., and Schlegel, H. G. (1980). Inr. J. Sysr. Bacreriol. 30, 189-195. Migeotte, M. V. (1949). Phys. Rev. 75, 1108-1 109. Newell, R. E., Boer, G. J., Jr., and Kidson, I. W. (1974). Tellus 26, 103-107. Nozhevnikova, A. N. (1974). Izv. Akad. Nauk SSSR Ser. Biol. 6, 878-884. Nozhevnikova, A. N., and Saval’eva, N. D. (1972). Microbiology 41, 837-843. Nozhevnikova, A. N., and Zavarzin, G. A. (1973). Microbiology 42, 134-135. Nozhevnikova, A. N., and Zavarzin, G. A. (1974). Izv. Akad. Nauk SSSR Ser. Biol. 3,436-440. Ooyama, J., and Shinohara, T. (1971). Rep. Fermenr. Res. Insr. 4, 1-5. Pandaw, M.,Mackay, C., and Wolfgang, R. (1960). J. Inorg. Nucl. Chem. 14, 153-158. Pape, M. (1978). I n “Microbial Energy Conversion” (H. Schlegel and J. Basnea, eds.), pp. 515-530. Goltz, Gottingen. Pickwell, G. V., Barham, E. G., and Wilton, J. W. (1964). Science 144, 860-862. Pootjes, C. F. (1977). Biochem. Biophys. Res. Commun. 76, 1002-1006. Postgate, I. (1970). Narure (London) 226, 978. Pressman, J., and Wameck, P. (1970). J . Amos. Sci. 27, 155-163. Radler, F., Greese, K. D.. Bock, R., and Seiler, W. (1974). Arch. Mikrobiol. 100, 243-252. Reh, M., and Schlegel, H. G. (1975). Nachr. Akud. Wiss. Gdrringen Math. Phys. KI. 11 12, 207-2 16.

Robbins, R. C., Borg, K. M., and Robinson, E. (1968). J. Air Pollur. Conrrol Assoc. 18, 106-1 1 I . Robinson, E., and Robbins, R. C. (1969). SRI-Project PR 6755 (Suppl.). Robinson, E., and Robbins. R. C. (1970). I n “Global Effects of Environmental Pollution” (S.F. Singer, ed.), pp. 50-64. Springer-Verlag, Berlin and New York. Romanova, A. K., and Tsyshnatii, G. V. (1978). Microbiology 47, 6-10.

OXIDATION OF C O BY BACTERIA

31

Romanova, A. K., Nozhevnikova, A. N., Leonthev, I. G., and Alekseeva, S. A. (1977). Microbiology 46, 719-722. Romanova, A. K., Nozhevnikova, A. N., Zykalova, K. A., Alekseeva, S. A., Vedenina, I. Y., Semenova, L. R., and Tsyshnatii, G. V. (1978a). Microbiology 47, 161-165. Romanova, A. K., Vedenina, 1. Y., Zykalova. K. A., Ermolenko, Z. M., and Semenova, L. R. (1978b). Microbiology 47, 492-498. Sanzhieva, E. U.,and Zavmin, G. A. (1971). Dokl. Biol. Sci. Proc. Acad. Sci. USSR 1%,79-81. Saval’eva, N. D., and Nozhevnikova, A. N. (1972). Microbiology 41, 719-723. Schalman, M., Ghambeer, R. K., Ljungdahl, L. G., and Wood, H. G. (1973).J. Biol. Chem. 248, 6255-6261. Schlegel. H. G., and Meyer, 0. (1981).In “Microbial Growth on C,-compounds” (H. Dalton, ed.), pp. 105-1 15. Heyden, London. Schnellen, Ch. G. T. P. (1947). Doctoral thesis, University of Delft. Seiler, W. (1974). Tellus 26, 116-135. Seiler. W. (1976). Proc. KESA Conf. 2, 35/4/1-9. Seiler, W. (1978). I n “Environmental Biogeochemistry and Geomicrobiology” (W. E. Krumbein, ed.), Vol. 3, 773-810. Ann Arbor Scientific Publ., Ann Arbor, Michigan. Seiler, W., and Giehl, H. (1977). Geophys. Res. Lerr. 4, 329-332. Seiler, W., and Schmidt, U. (1974). I n “The Sea” (E. D. Goldberg, ed.), Vol. 5, pp. 219-243. Wiley, New York. Seiler, W.. and Schmidt, U. (1975). In “Microbial Production and Utilization of Gases” (H. G. Schlegel e r a / . . eds.), pp. 35-45. Goltz, Gottingen. Seiler, W., Giehl, H., and Bunse, G. (1978). Pure Appl. Geophys. 116, 439-451. Shinohara, T., and Ooyama, J. (1972). Rep. Ferment. Res. Insr. 42, 81-85. Simpson, F. I., Talbot, G., and Westlaske, D. W. S. (1960). Biochem. Biophys. Res. Commun. 2, 15-18. Spratt, H. G., Jr., and Hubbard, J. S. (1981). Appl. Environ. Microbiol. 41, 1192-1201. Stephenson, M. (1949). “Bacterial Metabolism” (3rd Ed.), p. 96. Longmans, Green, New York. Stevens, C. M., Krout. Z., Walling, D., Venters, A., Engelkemeir, A., and Ross, L. E. (1972). Earth Planer. Sci. Leu. 16, 147-165. Swinnerton, I., Linnenbom, V. I., and Lamontagne, R. A. (1970). Science 167, 984-987. Swinnerton, J . , Lamontagne, R. A., and Linnenbom, V. J. (1971). Science 172, 943-945. Taylor, S. (1977). FEMS Microbiol. Leu. 2, 305-307. Tenhunen, R., Marver, H. S., and Schmid, R. (1969). J. Biol. Chem. 244, 6388-6394. Thauer, R. K., Fuchs, G., Kaufer, B., and Schnitker, U. (1974). Eur. J . Biochem. 45, 343-349. Troxler, R. F. (1972). Eiochemisrry 11, 4235-4242. Troxler, R. F., and Dokos, J. M. (1973). Planr Physiol. 51, 72-75. Uffen, R. L. (1976). Proc. Narl. Acud. Sci. U.S.A. 73, 3298-3302. Uffen, R . L. (1981). Enzyme Microb. Techno/. 3, 197-206. Warneck, P. (1975). In “Microbial Production and Utilization of Gases” (H. G. Schlegel e r a / . , eds.), pp. 53-62. Goltze, Gottingen. Weinstock, B. (1969). Science 156, 224-225. Weinstock, B., and Niki, H. (1972). Science 176, 290-292. Welty, F. K., and Wood, H. G. (1977). J. Biol. Chem. 253, 5832-5838. Westlake, D. W., Roxburgh, H. J., and Talbot, G. (1961). Narure (London) 189, 510-511. White, P. (1970). Ann. N . Y . Acud. Sci. 174, I, 23-31. Wilson, D. F., Swinnerton, J . W., and Lamontagne, R. A. (1970). Science 168, 1577-1579. Wise, D. L., Cooney, C. L., and Augenstein, D. C. (1978). Biorechnol. Bioeng. 20, 1153-1 172. Wofsy, S., McConnell, J. C., and McElroy, M. B. (1972). J. Geophys. Res. 77, 4477-4495.

32

YOUNG M. KIM AND GEORGE D. HEGEMAN

Wolff, D. G., and Bidlack, W. R. (1976). Eiochem. Eiophys. Res. Commun. 73, 850-857. Wolfgang, R. (1970). Nature (London) 225, 876. Yagi, T. (1958). Biochim. Eiophys. Acta 30, 194-195. Yagi. T. (1959). J . Biochem. 46, 949-955. Yagi. T., and Tamiya, N. (1962). Biochim. Biophys. Acta 65, 508-509. Zavarzin, G . A., and Nozhevnikova, A. N. (1975). I n “Microbiai Production and Utilization of Gases” (H. G . Schegel et al., eds.), pp. 207-213. Goltze, Gottingen. Zavarzin, G . A., and Nozhevnikova, A. N. (1977). Microb. Ecol. 3, 305-326. Zmerman, P. R.,Chatfield, R. B., Fishman, J., Crutzen, P. J., and Hanst, P. L. (1978). Geophys. Res. Lett. 5 , 679-682.

INTERNATIONAL REVIEW OF CYTOLOGY. VOL. 81

Sensory Transduction in Bacterial Chemotaxis GERALDL. HAZELBAUER* AND SHIGEAKI HARAYAMAt *BiochemistrylBiophysics Program, Washington State University, Pullman, Washington, and f k b o r a t o t y of Genetics, Department of Biology, Faculty of Science, University of Tokyo. Hongo, Tokyo, Japan I.

......................................

Introduction

A. Excitation . . ..... . . .. . . .. ... .. . . . . . . . . ..........

............... ...................

111. Conventional R

33 33 34 35 36 31 38 39 40

41 42 45 V. The Excitatory Link. VI. Structure of Transduc A. Multiple Methylation and CheB-&pendent Modification.. . . . . B. Homologies and Analogies among Transducer Genes and Their Products . . . . . . . . . . . . ........... VII. Adaptation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A. Control of Methylation ........... B. Adaptation in the Absence of Methylation. . . . . . . . . . . . . . . . . . C. A Functional Role for the CheB-Dependent Modification? . . . . VIII. Pathways for Unconventional Excitation and Adaptation . . . . . . . . . . IX. Concluding Remarks . . . . . . . . . .. . . .. . References .........................................

50 52

52

56 58 58 60 61 63

64 65

I. Introduction A. THESCOPEOF THISREVIEW Just over a dozen years ago, Julius Adler published a seminal paper demonstrating that chemotactic sensitivities of Escherichia cofi were mediated by specific chemoreceptors (Adler, 1969). The importance of this finding was that it identified a receptor-mediated sensory-response system which could be studied using the powerful approaches of molecular genetics and biochemistry. There are now over a dozen laboratories actively involved in the elucidation of the mecha33

Copyright Q 1983 by Academic Ress. Inc. All rights of repmduc:ion in any form reserved. ISBN 0- 12-36448I -X

34

GERALD L. HAZELBAUER AND SHIGEAKI HARAYAMA

nisms of bacterial chemotaxis, primarily in the related enteric species, E. coli and Salmonella typhimurium, and the amount of information being generated makes it difficult to summarize the current understanding of all aspects of the phenomenon. The editors of this series suggested that we focus on “signal transduction in bacterial chemotaxis” and thus we have considered topics related to that subject. We have tried to summarize most of the information available about chemoreceptors and transducers since few molecular components in any receptor system are as well characterized as these proteins. We have also considered in detail the functions of excitation and adaptation which are mediated by receptors and transducers. This emphasis required that we say little about the motility system or about the products of the che genes, which are central to the control of flagellar function and adaptation. At present, most of the information about the che genes derives from genetic studies and that body of information have been recently summarized by J. S. Parkinson (1981). We refer the reader to earlier reviews which consider bacterial flagella and motility in detail (Berg, 1975; Iino, 1977; Silverman and Simon, 1977a; Macnab, 1978, 1980; Silverman, 1980) and recent reviews which provide different emphases and viewpoints (Hazelbauer, 1980; Koshland, 1980, 1981; Ordal, 1980; Taylor and Laszlo, 1981). Chemoreceptors were considered in detail several years ago (Hazelbauer and Parkinson, 1977) while transducers and methylation have been emphasized previously in two excellent reviews (Springer et al., 1979; Boyd and Simon, 1982). B. BACTERIA AS SENSORY CELLS Motile bacteria are sensory cells. Like some other sensory cells, motile Escherichia coli alternates in a random manner between two states, S and T, as diagrammed in Fig. 1. A cell spends 80-90% of the time in the S state. An average duration of residency in an S state is 1-2 seconds and in a T state 0.1-0.2 seconds. A temporal change in the chemical environment of the cell results in a rapid response in the form of an alteration in its behavioral pattern. A favorable change (increase in concentration of an attractant, decrease in a repellent) produces exclusively S state behavior and an unfavorable change results in a greatly increased proportion of time in the T state. The rapid response to a temporal gradient is termed excitation. Like many sensory cells, E. coli adapts to stimuli. Thus the response, a shifted balance between the S and T states, occurs for only a limited period of time even though the altered chemical environment persists. After a time ranging from several seconds to several minutes, depending upon the particular compound and the magnitude of the concentration change, the initial pattern of switching between S and T states is reestablished and the cells have adapted to the original stimulus. The phenomenon of adaptation implies that the sensory cell responds to changes in concentration of a compound rather than to the absolute concentration.

35

BACTERIAL CHEMOTAXIS

T

uu

UI /

excitation

+

IU u uuu u

\ adaptation t adapted state

cw

FIG.1. Schematic representation of chemotactic behavior. (A) Pattern of swims and tumbles. A cell alternates between swims (S)and tumbles (T) which result from counterclockwise (CCW) and clockwise (CW) rotation, respectively, of the flagellar motor. Addition of attractant (+att) results in immediate suppression of tumbles. After adaptation there is a short “overshoot” period during which periods of CW rotation are more frequent than before stimulation. Removal of attractant (-att) causes an increased frequency of tumbles. Adaptation to this negative stimulus occurs about 10-fold more rapidly than adaptation to the equivalent positive stimulus. (B)Changes in methylation during tactic behavior. The level of carboxyl methylation of specific glutamyl residues of the relevant transducer molecules increases during adaptation to positive stimuli and decreases during adaptation to negative stimuli.

C. BACTERIALMOTILITY The concerted functioning of the bacterial motility and sensory systems permits cells to make net progress in spatial gradients of chemicals. An E. coli cell in an isotropic environment swims in a straight line for a few seconds, then undergoes an episode of uncoordination called a tumble, after which swimming is resumed in a new, randomly chosen direction (Berg and Brown, 1972). Swims and tumbles are the S and T states described in the preceding paragraph. Continual alternation of swims and tumbles causes the cell to trace a three-dimensional random walk. The sensory system directs a cell to favorable chemical environments by biasing the random walk with longer path lengths for swims that happen to be in the direction of increasing attractant or decreasing repellent concentration (Berg and Brown, 1972; Macnab and Koshland, 1972; Brown and Berg, 1974). The phenomenon is the same as illustrated in Fig. 1. Temporal increases in attractant concentration experienced by a cell swimming in a gradient generated by diffusion from a source of the attractant are relatively small, so that the period of tumble inhibition creates swim times approximately twice the usual duration (Berg and Brown, 1972). This bias is sufficient to allow extensive accumulation of a population at the source of a diffusion gradient (Adler, 1973).

36

GERALD L. HAZELBAUER AND SHIGEAKI HARAYAMA

The origin of swims and tumbles can be understood in a context of the unusual mechanism of bacterial motility. Bacterial flagella are related to eukaryotic flagella and cilia only in name and a common function as motor organelles. Bacterial flagellar filaments are left-handed helical polymers of protein subunits (often a single type of monomer) approximately the diameter of a tubulin fiber (Iino, 1977). In enteric bacteria, the filaments are 5-10 pm long, attached at randomly distributed points on the surface of cells 1-2 pm in length. The filaments have no enzymatic activity, nor do they contract. Rather, they function in motility as helical propellers, turned by a rotary motor embedded in the cell envelope (Silverman and Simon, 1974; Larsen et al., 1974b; Berg, 1974). The rotary motor consists of a shaft and a series of discs attached to the cytoplasmic membrane and cell wall (DePhamphilis and Adler, 1971a-c). Little is understood about the mechanisms by which the rotary motor functions but it is clear that the energy source is the proton motive force across the cytoplasmic membrane (Larsen et al., 1974a; Manson et al., 1977, 1980; Skulachev, 1977; Matsuura et al., 1977; Shioi el al., 1978; Glagolev and Skulachev, 1978; Khan and Macnab, 1980). Counterclockwise rotation of left-handed hellices exerts a pushing force on the cell. A universal joint, called a hook, attaches each filament to a rotary motor shaft and thus each of the 6-8 flagella on a cell can bend back at the hook to form a bundle of filaments which produces a concerted and coordinated pushing force on the cell, causing it to swim forward (Macnab, 1977). Counterclockwise rotation of closely aligned left-handed helices can occur without tangling because the sense of rotation is the same as the turn of the helix, allowing individual helices to slide past one another. In contrast, clockwise rotation of left-handed helices causes the flagellar bundle to dissociate. The flagella exert pulling forces, which are necessarily uncoordinated since each flagellum is attached to the cell at a separate point on the surface. In addition, clockwise rotation produces a torque of the opposite sense from the helix of the filament, causing deformation of the polymer, even forming localized areas of right-handed helix. The sum of all these effects is a tumble (Macnab and Omston, 1977). Thus the balance between swims and tumbles is the balance between counterclockwiseand clockwise rotation of the flagellar rotary motors. The sensory system biases the random walk by affecting the relative probabilities of the two directions of rotation of the rotary motor. 11. Components and Features of the Sensory System

The power of molecular genetics has made possible the identification of most, if not all, of the molecular components involved in bacterial behavior. In this section, we will outline the present understanding of the conventional pathways

BACTERIAL CHEMOTAXIS

37

of excitation and adaptation and then consider specific aspects and variations in more detail in later sections. A. EXCITATION Excitation is the shift in the normal balance between the two directions of flagellar rotation which occurs in response to a change in concentration of a chemical in the solution surrounding a cell. The concentration of attractants in the environment of a cell is monitored by specific receptor proteins which have recognition sites exposed to the exterior of the cell. Changes in the proportion of occupied receptor sites result in an effect on the rotary motor in approximately 200 msec (Segall et al., 1982). The recognition sites for serine and aspartate, the two most powerful attractants for enteric bacteria, are located on integral cytoplasmic membrane proteins, coded for by the genes rsr and tar, respectively (Hedblom and Adler, 1980; Wang and Koshland, 1980). The recognition sites for galactose and glucose (Hazelbauer and Adler, 197l), maltose (Hazelbauer, 1975), and ribose (Aksamit and Koshland, 1974) are contained on three separate peripheral membrane proteins. It seems likely that occupancy of a serine or aspartate site causes a conformational change in the transmembrane receptor that in turn generates a perturbation which serves as an excitatory signal that in turn affects the “gear shift” of the flagellar rotary motors. Loss of ligand from occupied transducer upon a reduction in ligand concentration (a negative stimulus) results in excitation of the opposite polarity, i.e., increased frequency of tumbles, to that observed upon concentration increases. Thus loss of ligand must induce a conformational change which generates an excitatory signal of the opposite polarity to that generated by a positive stimulus. Ligand-occupied molecules of maltose receptor interact with the Tar protein (Koiwai and Hayashi, 1979; Richarme, 1982), presumably generating an excitatory change similar to that generated by direct binding of aspartate. Excitation by galactose or ribose requires the product of frg (Kondoh et al., 1979; Hazelbauer and Harayama, 1979; Harayama er al., 1979), a cytoplasmic membrane protein analogous in many ways to the Tsr and Tar proteins (Hazelbauer er al., 1981; Harayama et al., 1982). It is likely that the ribose and galactose receptors interact with the Trg protein in the same manner as the maltose receptor interacts with the Tar protein. Because of their role in converting external stimuli in the form of temporal gradients into internal excitatory signals, the Tsr, Tar, and Trg proteins are often referred to as transducers. There is no information available about the character of the excitatory alteration undergone by transducers nor do we understand the nature of the excitatory linkage between transducer and flagellar motor. Analysis of a membrane fraction enriched in areas surrounding the motors revealed no enrichment of transducer proteins, implying that the link is not direct physical interaction of transducer and

38

GERALD L. HAZELBAUER AND SHIGEAKI HARAYAMA

motor (Engstrom and Hpelbauer, 1982). Instead it appears that occupied transducers generate an excitatory signal which travels through the cell from transducer to motor. The most attractive candidates for the signal include small, diffusible molecules or alterations in the permeability properties of the cytoplasmic membrane which could produce fluxes of specific ions across that membrane (see Section V). Whatever the nature of the excitatory signal, excitation can persist for several minutes after a maximal temporal stimulus, implying that the excitatory perturbation must be maintained over that time scale. Thus it is unlikely that the signal would be analogous to the rapid and transient membrane depolarizations which constitute action potentials in eukaryotic nerve cells. There are six cytoplasmic proteins, produced from the six che genes, which are critical for maintaining and controlling the normal balance between the two directions of flagellar rotation (Parkinson, 1978; DeFranco er al., 1979; Parkinson and Houts, 1982). Mutants missing the CheR, CheB, CheY, or CheZ proteins (Parkinson, 1981) can still be excited by several stimuli (although they are abnormal in adaptation) and mutants missing the CheA or Chew proteins can be induced to tumble by a strong acetate stimulus (Parkinson and Houts, 1982). Thus none of those proteins is an absolutely required component of the excitatory pathway. The excitatory signal is ultimately received by the flagellar motor, which responds by a shift to exclusively counterclockwise or predominantly clockwise rotation. A number of motor components are involved in determining the balance between the directions of flagellar rotation as evidenced by the observation that specific mutations in the genes coding for those components can alter the balance, creating tactically defective cells (Parkinson, 198l ; Parkinson and Houts, 1982). Particularly striking is a mutation in theflaAll gene of S. typhirnurium which shifts the rotation balance so extremely to clockwise that the flagellar filament is transformed into a right-handed helix (Khan er al., 1978). In cells containing the mutation, stimuli inducing counterclockwise rotation of the motor cause tumbling and stimuli inducing clockwise rotation cause swimming. Thus responses are inverted and the cells move away from attractants and toward repellents (Rubik and Koshland, 1978).

B. ADAPTATION Adaptation is the reestablishment, after excitation, of the normal balance between the two directions of flagellar rotation even though the altered chemical environment persists. Adaptation is strongly correlated with a covalent modification of the population of transducer molecules through which excitation passed. The simplest model suggests that the excitatory change induced by ligand or ligand-receptor binding to the transducer is effectively cancelled by the covalent modification. Detailed behavioral studies of the course of adaptation indicate that

BACTERIAL CHEMOTAXIS

39

adaptation proceeds slowly at a constant rate over the time period between excitation and reappearance of the original behavioral pattern in the adapted state (Berg and Tedesco, 1975). The time course of the covalent modification corresponds to this pattern (Springer et al., 1979). The modification is carboxyl methylation (Kort et al., 1975) of specific glutamyl residues in the transducer to form carboxyl methyl esters (Kleene et al., 1977; Van der Werf and Koshland, 1977; Stock and Koshland, 1981). A specific methyl transferase, coded for by cheR (Springer and Koshland, 1977), catalyzes the transfer of a methyl group from S-adenosylmethionineto the carboxyl group, and a specific demethylase, coded for by cheB (Stock and Koshland, 1978), catalyzes demethylation, producing methanol (Toews and Adler, 1979) and a regenerated glutamyl residue. Adaptation to positive stimuli (attractant increases, repellent decreases) is linked to increased methylation and adaptation to negative stimuli is linked to demethylation (Springer et a f . , 1977b, 1979; Silverman and Simon, 1977b). There is an asymmetry in the rates of the two types of adaptation. For a given change in receptor occupancy, methylation to the level necessary to establish the fully adapted state requires approximate 10 times as long as the same quantity of demethylation required for adaptation in the opposite direction. Protein carboxyl methylation is not limited to bacteria, but rather is widespread among many higher organisms (for reviews see Gagnon and Heisler, 1979; Paik and Kim, 1980; for recent studies see Usdin et a f . , 1982). All calf tissues examined contained some protein carboxyl methyltransferase activity and some methyl acceptor activity, with certain endocrine organs, some areas of the central nervous system, blood, and testis exhibiting high levels of activity (Kim et al., 1975; Diliberto and Axelrod, 1976). In vitro carboxyl methylation of the acetylcholine receptor (Kloog et a f . , 1980) and calmodulin (Gagnon, 1982) has been observed. There is evidence indicating that carboxyl methylation may be related to leukocyte chemotaxis (Venkatasubramiaianer al., 1979). Considerable evidence links carboxyl methylation of certain membrane protein to adaptation of Paramecium (Thomson et al., 1981). Thus it may well be that protein carboxyl methylation is often part of the mechanisms by which cells respond to chemical stimuli. C. ADAPTATIONAND "BACTERIAL MEMORY" Sensory-response systems are designed to produce the appropriate response to relevant stimuli. This usually requires that the magnitude of a response is graded in proportion to the magnitude of the stimulus. Many types of responses have an all-or-none character, including the response of the bacterial system. The cell either tumbles or not, so that the only way to grade the size of the response is by controlling its duration. This requires the processes of both excitation and adap-

40

GERALD L. HAZELBAUER AND SHIGEAKI HARAYAMA

tation. The larger the stimulus (i.e., the greater the number of occupied transducers), the longer the time required for the methylation system to neutralize the activated transducers and thus the longer the duration of the response. Any sensory-response system with an all-or-none response would be expected to have an adaptation mechanism and so it is not surprising that covalent modification of critical components is an emerging theme in the study of receptor systems. Adaptation creates a system sensitive to changes in concentration of relevant chemicals, rather than to absolute concentrations. After adaptation, a cell with occupied, methylated transducers is poised in the same state as a cell with unoccupied, unmethylated transducers. The adapted cells can respond to further occupancy of the same receptor-transducer pair (within the limits of receptor site saturation) or to occupancy of a different class of receptor sites. Receptor site occupancy is a measure of excitatory stimuli; the total level of methylation is a measure of the extent of adaptation. When these two parameters are balanced, the cell swims and tumbles in its unstimulated pattern, when they are not, the cell exhibits excessive swimming or tumbling. Since methylation is a relatively slow process, the extent of methylation at a given instant is actually a reflection of the chemical environment a short time before. In contrast the extent of receptor occupancy should reflect the instantaneous concentration of ligand. A comparison of these two parameters would allow a swimming cell to determine whether the relevant chemical environment were changing over the time period of a few seconds as the cell swam forward and to determine whether the overall change was favorable (tumble-suppressing) or unfavorable (tumble-inducing). We do not know how the comparison is accomplished, but since both parameters are directly related to the transducers, it is a reasonable hypothesis that those molecules are central to the comparison process. Thus the bacterial sensory system exhibits properties of a rudimentary memory function. The transducer proteins, in a combination of their roles in excitation and adaptation, appear to be intimately involved in the comparison of past and present.

111. Conventional Receptors

E. coli responds chemotactically to a substantial number of different small molecules and early observations indicated that the active compounds could be grouped into at least 20 chemoreceptor classes (Mesibov and Adler, 1972; Adler et al., 1973; Tso and Adler, 1974). Five chemoreceptor proteins, for the attractants galactose-glucose (Hazelbauer and Adler, 197l), maltose (Hazelbauer, 1975), ribose (Aksamit and Koshland, 1974), serine, and aspartate (Hedblom and Adler, 1980; Wang and Koshland, 1980) have been identified. Recent obser-

BACTERIAL CHEMOTAXIS

41

vations show responses to many repellents are mediated in a manner different from the conventional excitatory pathway outlined above (Repaske and Adler, 1981; Kihara and Macnab, 1981), and presently a reasonable hypothesis is that no repellent excitation occurs in the conventional manner. Many different sugars can be transported in E. coli by the phosphotransferasetransport system and each of these sugars is an attractant (Adler et al., 1973). Each of the eight sugarspecific Enzymes I1 appears to serve as a chemoreceptor (Adler and Epstein, 1974). However, recent studies imply that neither transduction of nor adaptation to these stimuli involves conventional transducers which can be carboxyl methylated (Niwano and Taylor, 1982a). Thus it is quite possible that the basic sensory-receptor system of enteric bacteria consists of only five conventional receptors and the three transducers to which those recognition sites are linked. We will discuss the conventional components first and then turn to the unconventional systems. A. AMINOACIDRECEFTORS Serine and aspartate are the two strongest attractants for enteric bacteria (Mesibov and Adler, 1972). The genetic organization of the bacteria indicates clearly that the entire motility-taxis system is integrated as a single unit since all genes are under a common cascade of genetic control (Iino, 1977; Silverman, 1980). The only two receptor protein genes included in this integrated system are tsr and tar (Clarke and Koshland, 1979) which code for the. serine and aspartate receptors, respectively (Hedblom and Adler, 1980; Wang and Koshland, 1980). A strong argument can be made that the motility-taxis system in these species developed (presumably in a common ancestor) in response to selective pressures conferring advantages on cells which could respond to gradients of these two specific amino acids. These two receptor sites are also the only ones to be integrated on the polypeptide chain of transducer proteins. Since the binding sites for ligand or ligand-receptor complex should be on the external face of the cytoplasmic membrane and methylation is controlled by enzymes in the interior of the cell, it is assumed that transducer proteins are transmembrane. The proteins have a molecular weight of about 60,000 and thus are of a sufficient size to have a receptor domain on the outer surface, a transmembrane domain, and interior domains for excitation and methylation. Crosslinking studies indicate that the Tsr and Tar proteins are complexed as tetramers in the membrane (Chelsky and Dahlquist, 1980b). Whether these are exclusively homotetramers of one type of protein, which are in fact found in mutants missing one or the other protein, or can also be heterotetramers is not known. The structure of the serine and aspartate receptors will be considered in more detail in the context of their role as methyl-accepting proteins. There appears to be a high affinity (Kd = 5 pM) and a low affinity (Kd = 300

,

42

GERALD L. HAZELBAUER AND SHIGEAKI HARAYAMA

pM) receptor site for serine which can be distinguished behaviorily (Springer et al., 1977b) and mutationally (Hedblom and Adler, 1980). The high affinity is clearly contained on the Tsr polypeptide (Hedblom and Adler, 1980; Wang and Koshland, 1980) and the available evidence is consistent with that same protein carrying the low-affinity site (Hedblom and Adler, 1980).

B. SUGARRECEPTORS (TABLE1) The recognition sites for galactose and glucose, ribose, and maltose are carried on three peripheral membrane proteins which perform two separate functions in the cell, chemoreception and transport of their respective ligands (Hazelbauer and Parkinson, 1977). These sugar-binding proteins are extreme examples of peripheral membrane proteins since in broken cells or cells with only the outer membrane disrupted, none of the molecules is found in specific association with the cytoplasmic membrane but rather in the soluble fraction (Heppel, 1971). An intact outer membrane, permeable to small molecules but a bamer to the passage of proteins, is necessary to keep the binding proteins in the periplasmic space bounded by the cytoplasmic and outer membranes. Yet characterization of mutants missing the respective binding proteins shows that they are essential for the membrane-associated functions of tactic excitation (Hazelbauer and Adler, 1971; Aksamit and Koshland, 1974; Hazelbauer, 1975) and transport (Boos, 1972; Kellermann and Szmelcman, 1974). Presumably association of binding proteins with membrane components is relatively transient and weak, and thus the dilution of the periplasm, where binding protein concentrations are in the range of 10-100 p M (Hazelbauer, 1979), releases any molecules bound to specific membrane sites. Studies using the maltose-binding protein indicate that ligand-occupied but not ligand-free protein binds to solubilized (Koiwai and Hayashi, 1979) or membrane-integrated (Richarme, 1982) Tar protein, the transducer of maltose stimuli. These observations suggest a simple model for the first step of transduction of excitatory stimuli from the sugar receptors. Binding of ligand to a binding protein has been shown to induce conformational changes (McGowan et al., 1974; Szmelcman et al., 1976; Zukin er al., 1977a,b, 1979; Zukin, 1979). If the transducer recognizes a site present only on occupied receptor, then a ligandreceptor interaction would immediately lead to an occupied receptor-transducer interaction, resulting in excitation as outlined above. Defects in mutant binding proteins define three functionally separable domains on a binding protein, the binding site, a site for interaction with a chemotactic transducer, and a site €or interaction with additional components of the particular transport system. A few mutations affecting the maltose-binding protein eliminate transport of the ligand without serious effect on ligand binding or tactic response (Hazelbauer, 1975). One galactose-binding protein mutation inactivates chemoreceptorfunction without affecting binding or transport (Hazelbauer and Adler, 1971; Ordal and Adler,

TABLE I CONVENTIONAL CHEMORECEPTORS IN ENTERIC BACTERIA Concentration (fl) for half-maximal effect E . coli

S . typhimurium

Receptor Protein la. Tsr protein (highaffiity serine site)

lb. Tsr protein (lowaffinity serine site) 2 . Tar protein

3. Galactose-binding protein

4.

Ribose-binding protein

5. Maltose-binding protein

Gene tsr

tsr

far

mgls

rbsE

mdE

Ligands Serine a-Aminoisobutyric acid Alanine Glycine Serine Aspartate a-Methyl aspartate Glutamate Glucose Galactose Glycerol-P galactoside Fucose Ribose Allose Maltose

Binding in vitro 50

> 2000

Cellular behavior 36 3000d

Binding in witro

5r (*)C

4~ 5000=

(*)<

5000=

(*)P

6OoOc

Excitation transducer

Mechanism of adaptation

Tsr

300b

Y 150dJ 2 w 0.lh

6r 640~ 4OoOc

(80) 0.1'

10h O.lh l00h

6OOog 0.Y 3ooi

1.5'

1.5'

0.29 0.58 (2)

Cellular behavior

Change in level of linked transducer

500c 5000C

0.2h 0.4g

0.3k 100k

Trg

OHedblom and Adler (1980). bSpringer et a f .(1977b). rClarke and Koshland (1979). dBerg and Tedesco (1975). eThese compounds do not compete for the highaffinity serine site in S . typhimurium. fG. L. Hazelbauer (unpublished data). gZukin et al. (l977b). hHazelbauerer al. (1979). iWillis and Furlong (1974). jAksamit and Koshland (1974). "Spudich and Koshland (1974). 'Hazelbauer (1977).

44

GERALD L. HAZELBAUER AND SHIGEAKI HARAYAMA

1974a,b). Of course, mutations affecting the binding site of a protein cause defects in both functions. It appears that there can be extensive “time sharing” of occupied sugarbinding protein between the two separate membrane components with which a binding protein interacts. In a strain carrying a tar hybrid plasmid the number of Tar proteins in the membrane and maltose-binding proteins in the periplasm was approximately equal. Yet initial rates of maltose uptake were normal, indicating that the binding protein was not “sequestered” by interaction with Tar in a manner which affected the functioning of the binding protein in transport (Hazelbauer et al., 1982b). The detailed three-dimensional structures of the sugar receptors, as deduced from X-ray diffraction studies, should soon be available (Quiocho et al., 1979). A 2.4-8, resolution structure of the L-arabinose-binding protein has been determined (Quiocho et al., 1977; Gilliland and Quiocho, 1981), but, unfortunately, this protein serves only as a component in a transport system, not as a chemoreceptor (Hazelbauer, 1970). However, the structure of the galactose-glucosebinding protein at 4.1 8, resolution is strikingly similar to the arabinose protein structure (Quiocho and Pflugrath, 1980). It seems likely that all four periplasmic, sugar-binding proteins will be found to have similar three-dimensional structures, particularly since there are significant degrees of homology at the level of amino acid sequence (Mahoney et al., 1981; Argos et al., 1981). The arabinose protein is ellipsoidal (axial ratio 2: 1) and consists of two distinct globular domains with a deep cleft between them (Quiocho et al., 1977). It is in this cleft that the sugar binds (Newcomer et al., 1979, 1981a). Binding of ligand is linked to a significant conformational change that appears to involve an 18” relative rotation of the two domains, which creates the sugar-binding site between the domains (Newcomer et al., 1981b). In the context of the genetic organization of the E. coli chromosome, the sugar-binding proteins are clearly classed as components of transport systems and not as chemoreceptors. The maltose-binding protein is coded for by malE (Kellerman and Szmelcman, 1974), the first gene in a three gene operon which includes membrane proteins involved maltose transport (Hofnung, 1974; Silhavy et al., 1979). That operon and two others are under the common control of the malT gene product (MbarbouillC et al., 1978) and include genes for all the proteins involved in maltose transport and metabolism. The gene for the galactose-binding protein, mglB (Ordal and Adler, 1974a,b), is followed in the mgl operon by two additional genes, mgM and mglC (Robbins, 1975) which code for membrane-associated transport proteins (Harayama er al., 1982b). The ribosebinding protein gene, recently named rbsB, is in an operon which includes the gene for ribose kinase and at least one additional component necessary for ribose transport (Iida, 1983). A few mutations in mglA and mglC result in drastically reduced response to galactose (Ordal and Adler, 1974b). It seems likely that

BACTERIAL CHEMOTAXIS

45

these taxis-defective phenotypes are the result of a secondary effect of alterations in the transport proteins, perhaps a sequestering of galactose-binding protein, since null mutations created by transposon insertions inactivating mgfA and mgfC do not eliminate galactose taxis (Harayama et a f . , 1982b). Thus neither gene product is absolutely required for response to galactose. Mutations in jlbB, the common positive regulator ofjla and che genes, eliminate expression of motility and taxis genes (Komeda et a f . , 1980) but do not effect expression of sugarbinding protein genes. Instead expression of the binding protein genes is induced by the presence of the respective sugar ligands (Hazelbauer and Parkinson, 1977). These observations suggest the hypothesis that sugar receptors were a secondary addition to the sensory system. Thus a mutation in mafE or far could have produced interaction of the maltose protein and the Tar transducer, creating a tactic sensitivity to maltose. It is a little more difficult to envision the development of the galactose and ribose sensitivities, since the binding proteins for these two sugars are linked to the Trg transducer which handles only those two receptors and contains no direct ligand-binding site. At this time there is no simple explanation for the origin of this transducer-binding protein set, particularly since the Trg transducer seems little related structurally to the amino acid transducers (see Section VI,B,2).

IV. Stimuli Not Mediated by Conventional Receptors Many membrane-active compounds are chemotactic agents for enteric bacteria. Stimulation of cells by a number of these compounds is correlated with changes in intracellular pH (Repaske and Adler, 1981; Kihara and Macnab, 1981). Lipophilic weak acids, decreases in extracellular pH, and nigericin each act as repellents. Lipophilic weak bases, increases in extracellular pH, and valinomycin in the presence of K+ each act as attractants. The Tsr protein is required for these responses (Tso and Adler, 1974) and thus it seems likely that excitation by changes in concentration of those compounds is mediated by Tsr. A simple idea is that there is a critical titratable group in a domain of the Tsr protein which is in contact with the cytoplasm (Repaske and Adler, 1981; Kihara and Macnab, 1981). Protonation of the group would cause a conformational change either identical to or closely mimicking the excitatory change induced in the protein upon loss of bound attractant, causing a bias toward clockwise flagellar rotation and thus toward tumbles. Adaptation appears to occur in the conventional manner, since it is complete before the initial value of internal pH is reestablished and adaptation to excitation by addition of lipophilic weak acids or increasing in external pH is correlated with net demethylation of the Tsr protein (Springer et al., 1979; Slonczewski et a f . , 1982). Thus it would appear that no

46

GERALD L. HAZELBAUER AND SHIGEAKI HARAYAMA

matter how the Tsr protein is induced to an excitatory conformation, that state can be cancelled out by appropriate changes in methylation level. Response to changes in external pH mediated by Tsr is even more complicated, since there appears to be a titratable group on an external domain of Tsr and excitation by pH changes is an algebraic sum of titration of the internal and external groups (Slonczewski et al., 1982). The unconventional nature of pH and weak acid stimuli are illustrated by tactic response of fsr mutants. In the absence of the Tsr protein, the stimuli no longer produce repellent responses but rather attractant responses (Muskavitch el al., 1978). The simplest hypothesis is that increases in internal pH induce a change in the Tar protein which mimics an excitatory change upon positive stimulation. If this induction were relatively inefficient in comparison to the negative excitatory change produced in the Tsr protein, then in a tsr+ tar+ cell, the repellent effect would predominate while in the absence of the Tsr transducer, the attractant effect would be observed (Repaske and Adler, 1981; Kihara and Macnab, 1981). In addition to all these transducer-mediated effects, internal pH appears to affect the swim-tumble balance by a direct alteration of the motility apparatus. A persistent reduction of internal pH results in increased clockwise (tumble mode) rotation and no adaptation is observed (Slonczewski et al., 1982). Wild-type E. coli are thermotactic (Maeda et af., 1976) while tsr mutants are not (Maeda and Imae, 1979). A number of observations imply that temperature changes can induce an excitatory conformation in the Tsr protein analogous to excitation by changes in occupancy of serine in a receptor site, and that the excitation is adapted to by methylation of Tsr. So, like pH or weak acid taxis, thermotaxis is mediated by perturbation of a conventional receptor. Mutants lacking only the high-affinity serine receptor on the Tsr protein are normally thermotactic, while those unable to respond to any concentration of serine, although still responsive to repellent stimuli (Hedblom and Adler, 1980). are insensitive to thermostimuli (Y.Imae, personal communication). It is not known whether the second class of mutants is defective in each of the two receptor sites or in a feature of the protein required for proper functioning of both sites. Complete inhibition of thermotaxis by concentrations of serine which would saturate the high-affinity but not the low-affinity site (Maeda and Imae, 1979) argues that it is not the low-affinity serine site itself which is critical for normal thermotaxis, but rather some other feature of the Tsr protein. The elucidation of the unconventional manner in which many repellent stimuli as well as temperature stimuli are mediated in enteric bacteria provides an instructive example of how “nonspecific” effects can result in a defined behavioral response (Table 11). Particularly in the case of some mammalian chemoreception, the multiplicity of active compounds makes it difficult to envision specific receptor sites for every one. The bacterial example suggests that a sensory system with a limited number of stereospecific recognition sites could

BACTERIAL CHEMOTAXIS

47

provide defined responses to a wide variety of compounds. Those chemicals would induce a response not because of interaction at a stereospecific site but rather because their presence would perturb some component or parameter involved in the conventional sensory pathway. In fact, we will use this notion in consideration of other chemotactic sensitivities of enteric bacteria. There are a number of compounds, in addition to those already considered, which serve as repellents (Tso and Adler, 1974). These include aliphatic alcohols, hydrophobic amino acids, indole, and the heavy metal cations, Co2+ and Ni2+. Sensitivity to the cations requires an active Tar protein while sensitivity to the others except aliphatic alcohols requires tsr activity (Tso and Adler, 1974; Springer et al., 1977b; Reader er al., 1979). Stimuli from each class are adapted to by demethylation of the related transducer (Spdnger et al., 1979). The compounds induce responses only at relatively high concentrations, often a thousandfold higher than concentrations at which attractants are active. The aliphatic alcohols are known to act as uncouplers of E. coli (Eneqvist et al., 1981), indole partially hyperpolarizes E. coli (Snyder et al., 1981) and, at concentrations only 5-fold above the tactically active level, the heavy metal ions make cells immotile. Guided by the model for mediation of pH and weak acid stimuli, it seems reasonable to suggest that the other repellents also act by perturbing the Tsr or Tar proteins in an analogous manner. Although response to one or more repellents may be mediated by recognition at a specific, external receptor site, the possibility seems relatively unlikely. Compounds and treatments which perturb proton motive force or electrical potential across the cytoplasmic membrane are tactically active. Increases act like attractants and decrease like repellents. Tactic response to 0, and other electron acceptors (Taylor et al., 1979; Laszlo and Taylor, 1981), uncouplers and other compounds which perturb ion gradients across the membrane (Ordal and Goldman, 1975, 1976; de Jong and van der Drift, 1978; Hosoi and Oosawa, 1978; Miller and Koshland, 1977, 1980; Taylor et af., 1979), intense blue light (Taylor and Koshland, 1975; Taylor et af., 1979), and normal intensity light in a phototactic organism (Harayama and Iino, 1977) all appear to be mediated by a sensing of changes in the membrane potential or proton motive force, either by an unidentified “receptor” or by a component of the tactic or motility system which is sensitive to these parameters (Glagolev, 1980). However, none of the known transducers appears to be involved in the pathway of excitation (Laszlo and Taylor, 1981; Niwano and Taylor, 1982a). Adaptation to all these stimuli occurs even though the altered level of proton motive force persists, but the conventional system of transducer methylation does not seem to be involved, at least for some of the stimuli (Niwano and Taylor, 1982a). This unconventional adaptation is best considered after a detailed discussion of the methylated proteins. All sugars transported by the phosphotransferase transport system (PTS) act as

48

GERALD L. HAZELBAUER AND SHIGEAKI HARAYAMA TABLE I1 STIMULIMEDIATEDIN UNCONVENTIONAL MANNERS

Class

1. Decrease in ex-

tracellular pH

2. Ionophores

Response

Excitation transducer

Examples

Adaptation

1. Unconventional excitation, conventional adaptation A. Excitation mediated by chan i in intracellular pH Repellent Addition of HCI toshift pH from 7 to 6 Repellent Nigericin Valinomycin (no

-

K+) 3. Lipophilic weak acids

Repellent

4. Increases in extracellular pH

Attractant

5 . Ionophores

Attractant Attractant

6. Lipophilic weak bases

Acetate Benzoate Salicylate DMO (5,5-dimethyl-2-4oxazolidinedione) Addition of NaOH to shift pH from 7 to 8 Valinomycin + K + Ammonia Ethanolamine Methylamine Tris

Change in level of methylation of Tsr

Tsr

I

B. Recognition and excitation mechanism unknown-candidates for unconventional excitation Repellent L-Leucine amino acids L-lsoleucine L-Valine Tsr Change in level of L-Tryptophan methylation of 2. lndole and Repellent lndole Tsr Tsr analogs Skatole 3. Metallic cations Repellent CoS04 Tar Change in level of NiS04 methylation of Tar 1. Hydrophobic

]

(ctmrinued)

weak attractants for E. cofi (Adler et af., 1973). Mutational inactivation of sugarspecific Enzymes I1 results in loss of tactic response to the particular sugars (Adler and Epstein, 1974; Lengler et al., 1981). Mutants defective in the general phosphate-transferring proteins of the PTS,HPr and Enzyme 1, are vastly defective in tactic response to PTS sugars, even though in the strains studied, motility and response to other attractants are essentially normal (Adler and Epstein, 1974;

BACTERIAL CHEMOTAXIS

49

TABLE I1 (Continued)

Class

I . Electron acceptors

2. Intense blue light 3. Uncouplers and inhibitors of electron transport 1. Sugars trans-

ported by phosphotransferase system

2. Aliphatic alcohols

Response

Excitation transducer

Examples

11. Unconventional excitation, unconventional adaptation A. Excitation mediated by changes in proton motive force Attractant Oxygen Nitrate Fumarate Electron transport Repellent Irradiation with 290 changes in Ap to 530 nm light (class 1 requires Repellent Azide cheB activity) Cyanide CCCP

I

B. Excitation and adaptation mechanisms unknown Attractant Glucose \ Mannose Fructose Require respective N-AcetylgluEnzymes 11, Encosamine zyme I, HPr, and Mannitol cheB activity Glucitol Galactitol Aryl-P-glucosides Repellent Ethanol Unknown iso-Propanol

Adaptation

Unknown

Unknown

Unknown

Lengler et al., 1981). Thus, in contrast to chemoreception of other sugars there are indications that sensing of stimuli of PTS sugars is influenced by components inside the cell which are not involved in the general tactic system. Studies (Melton et al., 1978) of glucose taxis in S. typhimurium mutants defective in various PTS components are difficult to interpret since the strains used all contained a normal galactose-bindingprotein, which mediates a response to glucose which is independent of the PTS system. None of the three transducers is required for excitation by PTS sugars (Niwano and Taylor, 1982a) and adaptation does not appear to involve methylation. These issues will be considered further in Section VIII. Finally, it should be noted that observations implying that taxis toward divalent cations is mediated by the Mg2 ,Ca2 -dependent ATPase (Zukin and Koshland, 1976) have been reinvestigated and it now appears unlikely that the ATPase is directly involved in mediating tactic response (Ingolia and Koshland, 1979). +

+

50

GERALD L. HAZELBAUER AND SHIGEAKI HARAYAMA

V. The Excitatory Link The unknown nature of the excitatory link between transducers and the rotary motors constitutes the most critical gap in our current understanding of the tactic system. Recent studies argue against linkage by direct transducer-motor interaction in the membrane (Engstrom and Hazelbauer, 1982). We are left with possibilities involving an intermediate component or process linking the two membrane complexes. All current evidence indicates that diverse stimuli are algebraically summed to produce a common signal and thus a reasonable postulate is that all stimuli impinge on a single component or process which is the ultimate, intracellular excitatory signal. A mutant lacking a functional signal component or process should be incapable of any excitation but none of the known classes of che mutants exhibits this phenotype (Parkinson, 1981; Parkinson and Houts, 1982). If the signal were intimately linked to processes critical to the general functioning or survival of the cell, specific “excitation mutants,” normal in other cell processes might not exist. In any case it is likely the excitatory signal is influenced and perhaps even modulated by other components of the sensory system, products of already identified che genes. In this context it is very interesting that cheZ mutants are defective in excitation by positive stimuli, exhibiting a response after a period (2 seconds) 10-fold greater than the corresponding time (0.2 seconds) for wild-type cells (Segall et al., 1982). Perturbation of Ca2+ levels in Bacillus subtilis was observed to alter swimming behavior in ways which were consistent with a critical role of intracellular Ca2+ concentration in control of tactic behavior (Ordal, 1977). However, a series of E. coli mutants defective in the Ca2+ pump are tactically normal (Brey and Rosen, 1979) and reduction of Ca2+ levels in S. ryphimurium did not affect tactic responses (Snyder et al., 1981). Thus, although Ca2+ remains a possible candidate for a signal component, there is not yet compelling evidence for such a role for that ion. An attractive possibility for the excitatory signal would be a change in the intracellular concentration of an ion as the result of a transmembrane movement of the ion induced by a permeability change. Such an ion flux might be detected as a transient change in the membrane potential. In fact, perturbations in the membrane potential of E. coli, as measured by a membrane-permeant cation, were detected upon tactic stimulation in conditions of low energization (oxygen starvation) (Szmelcman and Adler, 1976). However, studies of El. subrilis (Miller and Koshland, 1977, 1980) and E. coli (Snyder et al., 1981) using perrneant cations and fluorescent dyes to monitor membrane potential of highly energized cells found no consistent correlation between changes in the potential and tactic behavior. The differences between the results observed may be the result of the different physiological states of the cells studied. It could be that changes in membrane potential induced by excitatory fluxes would be masked by the high

BACTERIAL CHEMOTAXIS

51

proton motive force of a highly energized cell; alternatively the hyperpolarizations observed in oxygen-starved cells may reflect effects that are not related directly to tactic mechanisms. In any case, the time resolution of the techniques used is only about 1 second, perhaps too short to detect transient changes caused by excitatory events which have their effect in 200 msec. Of relevance to that consideration are studies of Rhodopseudomonas sphaeroides, a photosynthetic bacterium containing membrane-bound carotenoids. Using the electrochromic absorbance shift of the carotenoids to monitor membrane potential at times < 100 msec after chemical stimulation, a rapid hyperpolarization was observed (Armitage and Evans, 1979, 1980). However, further studies using a potentialsensitive dye to measure membrane potential of spheroplasts of R . sphaeroides and E . cofi led to the conclusion that the apparent hyperpolarization observed by the carotenoid technique was likely to reflect a charge separation in the membrane (conformational change of transducers?) rather than an ion flux (Armitage and Evans, 1981). Studies of chemotaxis in Spirochaeta aurantia may also have relevance to the search for the excitatory signal. The outer membrane of this Gram-negative species is permeable to many membrane-active drugs excluded from E. coli and thus experiments in which the membrane potential is clamped by valinomycin plus K+ can be done on untreated, normally motile cells. The clamping eliminated tactic response but not motility and is correlated with elimination of a transient depolarization induced by attractant stimulation in untreated cells (Goulbourne and Greenberg, 1981). Unfortunately, the lack of taxis-defective mutants in this unusual organism makes it difficult to obtain definitive evidence for the significance of these observations. The cellular level of a compound (approximately 10 nM in an unstimulated cell) which gave a positive response in a radioimmune assay for cyclic GMP exhibited many of the features one would expect of the excitatory signal including alterations in appropriate mutants of E. cofi (Black et a f . , 1980). In vitro, high concentrationsof cGMP inhibited demethylation of transducers and similarly high concentrations applied extracellularly affected tactic behavior and caused increased levels of transducer methylation. However, there are difficulties in reproducing the intracellular measurements originally reported (Black and Adler, 1982) and it appears quite possible that the compound detected by the radioimmune assay is not cGMP itself. A compound that reacted with anti-cGMP antibody might well be related chemically to nucleotides or their derivative. Thus it is particularly interesting that arsenate treatment, which lowers cellular levels of ATP, inhibits tumbles and thus chemotaxis (Larsen et al., 1974a). A significant number of observations can be interpreted to indicate that ATP depletion affects the tactic system not only by reducing the levels of S-adenosyl methionine, the donor for transducer methylation, but also by a second, independent action (Aswad and Koshland,

52

GERALD L. HAZELBAUER AND SHIGEAKI HARAYAMA

1974; Springer et al., 1975; Kondoh, 1980; Galloway and Taylor, 1980; Arai, 1981; Stock et al., 1981; Shioi and Galloway, 1981). The most convincing evidence that arsenate treatment exerts an effect on taxis independently of transducer methylation comes from a recent experiment using a cheR cheB deletion mutant. This strain both swims and tumbles, can respond to tactic stimuli by altering the swim-tumble balance, but lacks any methylation system and is wholely unable to adapt to tactic stimuli (Sherris and Parkinson, 1981; Parkinson and Houts, 1982). Arsenate treatment results in gradual but complete disappearance of tumbles in this mutant and addition of phosphate restores tumbles (J. S. Parkinson, personal communication). A phosphorylated compound, related structurally or metabolically to cGMP, appears the best current candidate for an excitatory signal compound.

VI. Structure of Transducers A. MULTIPLE METHYLATION AND CheB-DEPENDENT MODIFICATION The three conventional transducer proteins, Tsr, Tar, and Trg, are structurally complex to a degree not anticipated by simple models (see Section 11). Each protein is multiply methylated (Boyd and Simon, 1980; Chelsky and Dahlquist, 1980a;DeFranco and Koshland, 1980; Engstrom and Hazelbauer, 1980) and also multiply modified in another way, which alters the electrophoretic behavior of the protein in the same manner as does demethylation (Sherris and Parkinson, 1981; Rollins and Dahlquist, 1981). The nature of the second modification is unknown, but it occurs only in cells with an active cheB gene, which codes for the taxis-specific demethylase, and thus has been called the CheB-dependent modification. The modification occurs in the absence of methylation and, unlike methylation, appears to be irreversible. An attractive hypothesis is that the CheB-dependent modification is a deamidation of glutamine residues by the demethylase [a plausible activity for such an enzyme (Hartman, 197l)] to form a glutamyl residue. Both methylation and CheB-dependent modification alter the charge on the polypeptide chain. Carboxyl methylation eliminates a negative charge and demethylation as well as CheB-dependent modification add a negative charge. In addition, the modifications alter the migration of transducer polypeptides in SDS-polyacrylamide gel electrophoresis. Methylation has been correlated with faster migration and demethylation of CheB-dependent modification with slower migration resulting in a pattern of several bands separated by distances corresponding to differences of 500 to lo00 in apparent molecular weight (Fig. 3a). It may seem surprising that formation or hydrolysis of a single carboxyl methyl ester could have such a drastic effect on electrophoretic migration in the presence of SDS, but there are a growing number of observations in

53

BACTERIAL CHEMOTAXIS

the literature that a single covalent modification (Tung and Knight, 1972; Linnt and Philipson, 1980) or a single amino acid substitution (de Jong er af., 1978; Noel er al., 1979) in a polypeptide can have a profound effect on electrophoresis in SDS. A consistent explanation is that the alterations in the polypeptide result in changes in the number of SDS molecules bound in the particular localized area of the amino acid sequence and thus can significantly affect the net charge on the extended chain (Maley and Guarino, 1977). Recent analysis of tryptic digests of the Tsr and Tar proteins by high performance liquid chromatography have identified peptides containing the modified residues and provides the most detailed information available about the biochemistry of the proteins (Kehry and Dahlquist, 1982a,b) (Table 111). Methylaccepting glutamic acids are located on two peptides, one of which ends in arginine and the other of which ends in lysine and also contains methionine. The two peptides are located on the elution profile at nearby positions which differ only slightly for the Tsr and Tar peptides. Elution is at high concentrations of TABLE 111 FEATURES OF TRANSDUCERS IN E. coli Tryptic peptides containing modifiable sites Total modifiable sites Met-Lys Transducer Tsr Tar Trg

Molecules per cello

Methylaccepting

CheBmodifiable

1600 900 100-200

66

2b 26 2 or 3~

46 2

2c

Me

Arg

CheB

4b 3b

Unknownd

Me

CheB

Ib

2

(I?)b

16

1

(I?)b

Unknown

OThese values are based on an estimate from tracings of gel patterns (Hazelbauer and Engstrom, 1981) that the Tsr and Tar proteins together constitute 1.5% of membrane protein and on the ratio of serine-binding sites to aspartate-binding sites of S. typhimurium (Clarke and Koshland, 1979). Multiplying the values in columns two and three generates a figure of 13,500 methyl-accepting sites in the membrane of an E. coli cell. The number of methyl groups on transducers of E. coli cells adapted to maximal stimuli of serine and aspartate has been determined to be 92 pmole/mg cell protein (Stock and Koshland, 1981). Using the same conversion factor as for the calculation above (120 fg protein/cell), this value is equivalent to 6800 methyl groups per cell, or a little over half the total calculated methyl-accepting sites. This is consistent with observations (Kehry and Dahlquist, 1982a. Fig. 3 and unpublished data) that adaptation to maximal stimuli does not result in saturation of all methyl-accepting sites. The larger, often more motile cells of S. typhimurium exhibit a significantly higher content of methyl-accepting sites (Stock and Koshland, 1981). bData from Kehry and Dahlquist (1982a.b). CHarayama et al. (1982a). dA methionine-containing tryptic peptide of Trg which is CheB-modified is located on an HPLC pattern at a position close to those of the Tsr and Tar Met-Lys peptides (Kehry er al., unpublished resultsl.

54

GERALD L. HAZELBAUER AND SHIGEAKI HARAYAMA

solvent implying that the peptides are likely to be rather hydrophobic. The arginine peptide has twq methyl-accepting sites in the Tsr protein and one site in the Tar protein. The methionine-lysine peptide has four sites in Tsr and three in Tar. Thus the Tsr protein contains a total of six methyl-accepting glutamic acids and the Tar protein contains four. Each protein has two sites for CheB-dependent modification, one of which is clearly on the methionine-lysine peptide containing methyl-accepting sites and the other of which is on an arginine peptide which is closely related to the methyl-accepting arginine peptide but may be a distinct species. A striking observation is that in the absence of CheB-dependent modification, the methionine-lysine peptide can accept only a single methyl group (Kehry and Dahlquist, 1982b). It appears that the CheB-dependent modification exposes glutamyl residues for potential methylation by a structural rearrangement rather than a direct chemical unmasking of reactive groups since one CheBdependent modification opens up two or three sites and the initial methylation site which occurs in the absence of CheB-dependent modification can be any one of the four sites on the Tsr peptide. A number of observations have indicated that the order in which the methylaccepting sites are methylated (Chelsky and Dahlquist, 1980a, 1981; Engstrom and*Hazelbauer, 1980) or demethylated (Springer et al., 1982) is not random and that some sites, once methylated, turn over with very low frequency, in contrast to other sites at which turnover is relatively rapid (Stock and Koshland, 1981; Springer et al., 1982). These results may be explained by the observation (Kehry and Dahlquist, 1982a) that the two methyl-accepting sites on the arginine peptide are occupied in all moderately to extensively methylated electrophoretic forms of the Tsr protein isolated from wild-type cells and are the only methylated sites in species of the protein exhibiting low levels of methylation. Thus the methylated sites on the arginine peptide may represent a “baseline” level of methylation which are not usually exposed to the demethylase. However, examination of turnover of total methyl groups in unstimulated and maximally stimulated and adapted cells (Stock and Koshland, 1981) revealed that only approximately 50% of the methyl groups were exchangeable in either condition although the absolute level of methylation differed by a factor of two. This observation is not easily explained by a “baseline” degree of nonexchanging methyl groups, but could be understood as a reflection of an order in which sites are methylated and demethylated. In fact, double label experiments indicate that exchange of methyl groups is in an order of “last on, first off” (Springer er al., 1982). In a population of transducer molecules which is extensively methylated, sites first methylated during adaptation could be essentially protected from exchange by the addition of several subsequent methyl groups. As cited above, any of the four sites on the methionine-lysine Tsr peptide may be the first methylated (Kehry and Dahlquist, 1982b) so there is not a specific site first methylated during adaptation but if additional methylation and subsequent demethylation are ordered then protection from exchange would still occur. In the case of CheB modification there is a

BACTERIAL CHEMOTAXIS

55

distinct order, first the site on the methionine-lysine, methyl-accepting peptide and then the site on an arginine peptide (Kehry and Dahlquist, 1982b). The hypothesis that faster migration of transducer polypeptides was a function of an increased number of methyl esters suggested that the faster migrating forms should have a less negative PI. Thus on two-dimensional polyacrylamide gels (O’Farrell, 1975) in which the first dimension is isoelectric focusing and the second electrophoresis in the presence of SDS, transducer proteins should be seen as a diagonal line of spots from a position of more negative, higher apparent molecular weight to less negative, lower apparent molecular weight. This is the case for both the Tsr and Tar protein (Engstrom and Hazelbauer, 1980; Hazelbauer and Engstrom, 1981);however, high-resolution gels reveal that the diagonal pattern includes species of more than one apparent molecular weight for a particular PI (Hazelbauer and Engstrom, 1981; Kehry and Dahlquist, 1982a,b). This is seen as a multiplicity of electrophoreticaliy separable forms, at least 9 for Tar and as many as 16 for Tsr distributed in six charge groups for Tsr and four for Tar (Hazelbauer and Engstrom, 1981), values corresponding to the number of methyl-accepting sites on the two proteins (Figs. 2 and 3). The distribution of intense spots is shifted to the upper or lower end of the pattern after adaptation to maximal unfavorable stimulation (demethylation) or to maximal favorable stim-

FIG. 2. Multiple electrophoretic forms of the Tsr transducer protein visualized on two-dimensional gels. Fluorogram of a two-dimensional gel [isoelectric focusing gradient from basic (left) to acidic (right) and SDS-polyacrylamide gel electrophoresis from higher (top) to lower (bottom) apparent molecular weight] of methyl-3H-labeled Tsr protein. Only the region including the Tsr protein is shown. The apparent molecular weight of Tsr forms ranges from 55,000 to 65,000 and the pl from 5.3 to 5.4. The six charge groups of spots focusing at different pls are indicated by arrows. The protein is from unstimulated, wild-type cells and thus the most methylated forms of the protein (least acidic pl) are present in only minor amounts.

56

GERALD L. HAZELBAUER AND SHIGEAKI HARAYAMA

FIG.3. Multiple electrophoretic forms of the Tar transducer protein (a) Pattern of bands on a one-dimensional SDS-polyacrylamide ( I I%, low crosslinking gel) containing methyl-3H-labeled Tar protein. The sample was methyl-labeled cells containing a pBR322 hybrid plasmid carrying the tar gene (Harayama et al., 1982a). (b) Pattern of spots on two-dimensional gels after adaptation to positive or negative stimuli. Fluorograms as in Fig. 2, except that the region shown is the one including the Tar protein. The Tar forms focus at pfs between 5.3 and 5.4. The four charge groups are indicated by arrows. The attractant stimulus was addition of a-methylaspartate at a concentration (10 mM) sufficient to saturate the Tar receptor site. The repellent stimulus was addition of a maximally stimulating concentration ( 5 mM) of NiCI. The fluorogram for the attractant-stimulated condition is a shorter exposure than the other two to allow resolution of individual spots. With equal exposures. the total intensity of spots for the attractant-stimulated condition is approximately 50% greater than for the unstimulated condition. Adapted from Hazelbauer et al. (1982).

ulation (methylation), respectively (Fig. 3b), indicating that all the methyl-labeled forms can lose or gain methyl groups during the course of bulk changes in the level of methylation of the population of transducer molecules. The multiplicity of forms at a single pl implies that not all the sites at which the charge of the polypeptide can be changed by modification (either methylation or CheB modification) produce the same change in electrophoretic migration in the presence of SDS.Although increased methylation is clearly correlated with faster electrophoretic migration in SDS,it is not a necessary conclusion that methylation at each and every site on a transducer affects migration in SDS.In fact, comigration of fully CheB-modified, unmethylated polypeptides with a methyllabeled form of the Trg protein (Harayama er al., 1982a) suggests that addition of a methyl group to at least one site does not affect electrophoretic migration of the polypeptide in SDS.If altered migration reflects a change in SDS binding to a localized area around each individual modified group, then different locations might well be correlated with rather different changes in migration. AND ANALOGIES AMONG TRANSDUCER GENES B. HOMOLOGIES AND THEIR PRODUCTS 1. fsr, far, and rap The fsr and far products are related proteins which exhibit rather similar patterns of cleavage by S. aureus V8 protease (Engstrom and Hazelbauer, 1980;

BACTERIAL CHEMOTAXIS

57

Harayama er al., 1982a) and have a majority of tryptic peptides in common (Chelsky and Dahlquist, 1980a), as well as closely related modified peptides (Kehry and Dahlquist, 1982a,b). Antibody raised to a methylated peptide, of defined molecular weight, derived by proteolytic cleavage from a population of transducer molecules which was primarily Tsr but included a small proportion of Tar, immune precipitated both Tsr and Tar proteins (Wang and Koshland, 1980) Results of DNA-DNA annealing studies using hybrid plasmids carrying transducer genes indicate that tsr, tar, and a newly discovered gene, tap, all exhibit a significant degree of homology with each other (Boyd et al., 1981). Emerging information about nucleotide sequences of these genes reveals specific sequence homologies (A. Boyd, A. Krikos, and M. Simon, personal communication). The region of gene homology appears to be within a single segment of each gene located toward the carboxy-terminal end (Boyd et al., 1981). The region is likely to include sequences coding for the modified peptides of Tsr and Tar (Kehry and Dahlquist, 1982a,b), that is, the cytoplasmic domains of the proteins which interact with the same methyltransferase and demethylase (Boyd et al., 1981). There is no indication of homology between the amino-terminal ends of rsr and tar. These regions could code for external, ligand recognition domains which are dissimilar for the two gene products (Boyd et al.. 1981). It seems likely that tsr and tar evolved from a common ancestral gene or resulted from fusions of a common DNA segment to unrelated segments, and that other transducer genes would contain a region homologous to tsr and tar. A new gene, named rap, found immediately adjacent to tar on the E . coli chromosome, fulfills the expectation of homology (Boyd er al., 1981). tap codes for a methyl-accepting protein, but absence of the gene activity has no striking effect on the tactic phenotype of tap cells (J. S . Parkinson, personal communication). The Tap protein does not seem to be the primary transducer for any presently identified tactic stimuli and the absence of the tap gene in Salmonella (Wang and Koshland, 1982) argues against a critical role for the gene product in the general functioning of the sensory system. However, at high dosages produced in cells containing hybrid plasmids, the rap gene can substitute for missing tar function (Wang and Koshland, 1982). 2. rrg The construction of strains containing increased amounts of Trg protein as a result of the presence of multicopy hybrid plasmids carrying rrg has made possible a detailed characterization of this gene and its transducer product (Harayama et al., 1982a). The Trg protein is analogous to the Tsr and Tar proteins in that it mediates excitation and adaptation to tactic stimuli (Hazelbauer and Harayama, 1979; Kondoh et al., 1979; Koiwai er al., 1980; Hazelbauer et al., 1981). Trg differs from the two other transducers in lacking a site which binds ligand directly (it interacts only with ligand-occupied galactose- or ribose-binding proteins) and a linkage to any repellent stimuli. In addition there are relatively few

58

GERALD L. HAZELBAUER AND SHIGEAKI HARAYAMA

copies of the Trg protein in a normal E. coli cell, a few hundred in contast to approximately 1000 Tar and 2000 Tsr proteins (Hazelbauer and Engstrom, 1981). Recent studies show that Trg is CheB-modified (at least twice, probably more) and multiply methylated (Harayama er al., 1982a) and that the modified peptides appear in the same region of a high performance liquid chromatography pattern as the comparable peptides from Tsr and Tar (M. Kehery, F. W. Dahlquist, P. Engstrom, and G. L. Hazelbauer, unpublished results). However, homologies between trg and the other transducers may be limited to the regions of the modified residues. Patterns of peptides derived from limited proteolysis of Trg protein exhibit little ([3H]methyl labeled) or no ([35S]methioninelabeled) relation to patterns of peptides from Tsr and Tar proteins, although patterns from these two proteins are strikingly similar (Harayama et al., 1982a). Attempts to use a hybrid plasmid carrying rar as a probe in annealing experiments to detect trg in a total chromosomal DNA were unsuccessful (Boyd ef al., 1981) and direct use of a rrg hybrid plasmid revealed no interaction with a tar-containing probe under conditions in which rsr-tar-rap homology is strikingly evident (A. Boyd, A. Krikos, and M. L. Simon, quoted in Harayama er al., 1982a). Yet an antiserum raised to pure Trg interacts with the Tsr and Tar proteins (P.Engstrom, unpublished). Thus trg appears much less related to other transducer genes than they are to each other although the three transducer molecules may all share a very similar structural domain which would include the sites of modification. The common biochemical features of multiple methylation and multiple CheB modifications are likely to be a reflection of common functions. In specific, the Trg protein is not related to any repellent stimuli, yet is CheB-modified at least twice. Whatever the functional significance of the second CheB modification, it is unlikely to be related solely to repellent stimuli (see Section VI1.C).

VII. Adaptation A. CONTROL OF METHYLATION During adaptation to conventional attractant stimuli or repellents, the level of methylation of the appropriate transducer population changes, at what appears to be a constant rate (Springer er al., 1979), to reach a new level maintained in parallel with the adapted state. It appears that the change in methylation level involves alterations in both the enzymes and the substrates (the transducers) involved in the methylation reactions. Methyl groups on transducers turn over in unstimulated cells (Kort ef al., 1975) and more methyl groups turn over in a unit time if the total level of methylation of the transducers is high (Springer er al., 1975). even though not all methyl groups may turn over at the same frequency (see Section VI,A). However, adapted cells starved for methionine maintain

BACTERIAL CHEMOTAXIS

59

their adapted state and the associated new level of methylation (Springer et al., 1977a), indicating that, in the absence of methionine, glutamyl methyl esters which are normally susceptible to demethylation are shielded from the demethylase. Yet unfavorable stimuli result in demethylation even in methioninestarved cells (Springer et al., 1977a), implying that an alteration in the transducer upon loss of ligand exposes methyl esters to the demethylase. Adaptation to favorable and unfavorable stimuli clearly involves inhibition (Toews er al., 1979) and activation (Goy et al., 1977; Toews and Adler, 1979), respectively, of the demethylase. In vitro studies indicate that complementary activation and inhibition of the methyltransferase occurs (Kleene et al., 1979). A general activation or inhibition of the appropriate enzymes is consistent with the observation that upon attractant stimulation, the methylation level of all transducers increases, but only the transducer participating in excitation maintains a new level while methylation level of the other species falls to the original value (M. S. Springer et al., personal communication). Thus the excited transducer must assume a state in which additional methyl groups are stably incorporated at a level which compensates for receptor occupancy. As discussed previously, some sites, once methylated, are slow to be demethylated and there is at least some order in the sequence of sites methylated. A general inhibition of demethylase activity during adaptation to positive stimuli (Toews et al., 1979) provides a basis for explaining the results of early experiments (Berg and Tedesco, 1975) in which the environment of cells adapted to a concentration of one attractant, a-methyl aspartate (recognized by Tar), was rapidly switched from a-methyl aspartate to an equivalent concentration of a second attractant, a-aminoisobutyrate (recognized by Tsr) and, after a few seconds, switched back to the original concentration of the first attractant. During these changes, the cells did not respond, but instead maintained unstimulated behavior. This lack of response is surprising since adaptation (demethylation) to an unfavorable stimulus, a decrease in concentration of one attractant, is rapid, while adaptation (methylation) to a favorable stimulus, an increase in concentration of the other attractant, is slow. If the same asymmetry holds for a cell submitted to the two stimuli simultaneously, then soon after the switch, the cells should have adapted to the negative stimulus by rapid demethylation of one transducer but should still be in the process of adapting to the positive stimulus by the slower methylation of the other transducer. In such a circumstance competing signals inducing counterclockwise and clockwise rotation should be unbalanced and the cell should exhibit a changed behavior. The fact that no response is observed indicates that there is a central integration of stimuli that is not influenced by the drastic difference in rates of adaptation to positive and negative stimuli. The mechanism could be blocking of all demethylation by general inhibition of the demethylase. The conflicting positive and negative excitatory signals from the two different transducers would balance precisely while demethyla-

60

GERALD L. HAZELBAUER AND SHIGEAKI HARAYAMA

tion of one transducer would be slowed to the rate of methylation of the other, as adaptation to receptor occupancy by methylation slowly removed the inhibition of the demethylase caused by the positive excitatory signal. There is little knowledge of the kinds of effects carboxyl methylation could have on the conformation of a polypeptide, particularly one that might be embedded in a membrane. Studies of a hydrophobic polypeptide, alamethicin, provide an interesting example of what could occur. A purified fraction of natural alamethicin is a 20 amino acid, hydrophobic polypeptide, just long enough to span a lipid bilayer as an a-helix, which has modified amino and carboxy termini and a single charged group, a glutamic acid, at position 18 (Balasubramanian et al., 1981). When alamethicin is initially added to one side of a bilayer film, aggregates of monomers form conduction channels only when the applied voltage is positive on the side to which the alamethicin was added (cis side). One interpretation of this observation is that the glutamyl residue, by virtue of its electric charge, fixes the carboxyl terminus of the molecule to the surface of the membrane (Vodyanoy et al., 1982). The electric field then acts on the dipole moment of the molecule to rotate the amino terminus across the membrane to the trans side. Chemical carboxylmethylationof the glutamyl residue creates a peptide which forms conduction aggregates with application of a voltage of either sign, although the magnitude of the necessary voltage is smaller for cis side positive. The ability to respond to voltage of either sign is likely the result of movement of the methylated peptide through the membrane so that channels can form in response to the positive applied voltage on the trans side. (J. E. Hall, personal communication). Thus under the appropriate conditions carboxyl methylation of a glutamyl residue on a transducer might allow the chain to sink into the lipid bilayer, shielding the group from the demethylase. This is particularly tantilizing since the methyl-accepting glutamyl residues are on trypsin-generated peptides likely to be quite hydrophobic (Kehry and Dahlquist, 1982a). B. ADAPTATION IN THE ABSENCE OF METHYLATION Methionine-starved methionine auxotrophs can be excited by unfavorable stimuli and adapt by demethylation of methyl esters which do not otherwise turn over in the absence of methionine (see Section VII,A). Methionine-starved cells can also be excited by favorable stimuli but then do not adapt. Addition of methionine to a suspension of methionine-starved, previously positively stimulated cells results in adaptation after a period which is 80% of the normal adaptation time (Springer et al., 1977a). The 20% difference may represent an alternative mode of adaptation that can function in the absence of methylation. cheR mutants are excited by positive or negative stimuli but are vastly defective in adaptation to either type of stimulus (Goy et al., 1977; Goy and Springer, 1978; Parkinson and Revello, 1978). Some adaptation does occur and is likely to reflect the functioning of an alternative mode of adaptation (Parkinson and Revello, 1978; Stock et al., 1981). There are indications that the CheB protein

BACTERIAL CHEMOTAXIS

61

has a critical role in determining the balance between swims and tumbles, in addition to its demethylase activity (Parkinson and Houts, 1982). It is possible that the other known function of cheB, mediation of CheB-dependent modification of transducer molecules is related to control of the swim-tumble balance and perhaps even to an alternative mode of adaptation mediated by cheB.

c. A FUNCTIONAL ROLEFOR THE CheB-DEPENDENT MODIFICATION? CheB-dependent modification of a Tsr or Tar polypeptide is required for activation of the full complement of methyl-accepting sites on the proteins (Kehry and Dahlquist, 1982b). A number of lines of evidence hint that, under some conditions, CheB-dependent modifications could perform a role in the sensory system in addition to posttranslational maturation of transducer proteins. Tactic stimuli change the rate at which newly synthesized transducer molecules are CheB-modified (Sherris and Parkinson, 1981; Rollins and Dahlquist, 1981). Appropriate unfavorable stimuli increase and appropriate favorable stimuli decrease the rate of the irreversible modification. These observations extend the analogy between CheB-dependent modification and demethylation to include corresponding changes in rates upon tactic stimuli. The effects are observed conveniently only in cheR (methyltransferase) mutants, in which the absence of the multiple methylated forms of the transducer makes possible unambiguous identificationof unmodified and CheB-modified forms of the protein, although it is presumed the same phenomena occur in wild-type cells. The phenotype of cheR mutants is constantly smooth swimming (i.e., exclusively counterclockwise rotation of flagella). Stimulation by repellent addition causes a normal response of clockwise rotation, but adaptation is defective in that its time course is greatly extended (Parkinson and Revello, 1978; Goy et al., 1977; Goy and Springer, 1978). Observation of individual cells after repellent stimuli revealed that at least some adaptation does occur, in the form of gradual reduction of the frequency and duration of episodes of clockwise rotation (Parkinson and Revello, 1978; Stock et al., 1981). The defect of cheR mutants in adaptation to repellent stimuli can be understood as a reflection of the absence of methylated sites on the relevant transducer. Without a methyl ester to demethylate, the system cannot adapt by the conventional mechanism. Partial adaptation in these conditions could be a result of leakiness in the cheR strains studied, but alternatively, CheB-dependent modification, which is accelerated by repellent stimuli, might serve to counteract, at least partially, the clockwise rotation signal generated by repellents. The cellular balance between excitation and adaptation can be viewed as an algebraic sum of “counterclockwise signals” and “clockwise signals. ” Attractant-occupied receptor sites and unmethylated methyl-accepting sites are in the former class and vacant receptor sites and methylated methyl-accepting site are examples of the latter class. If CheB-dependent modifications were to mediate

62

GERALD L. HAZELBAUER AND SHIGEAKI HARAYAMA

the observed cellular adaptation to repellent stimuli in cheR mutants, then the modifications should be “counterclockwise signals.” The phenotypes of null mutations (deletions) missing cheR or both cheR and cheB support this notion (Sherris and Parkinson, 1981; Parkinson and Houts, 1982). Like cheR point mutants, a cheR deletion strain exhibits an extreme counterclockwise bias in flagellar rotation. In striking contrast, a cheR-cheB deletion mutant exhibits a significant clockwise bias. Thus in an isogenic pair of strains, neither of which is capable of any methylation of transducers because of the absence of the methyltransferase gene, the presence of an active cheB gene and the accompanying CheB-dependent modification of transducers is correlated with a strong counterclockwise bias to flagellar rotation. Addition of tactic stimuli to cheR cheB deletion mutants causes appropriate shifts to more or fewer tumbles, but there is no hint that the cells ever adapt by reestablishing the initial swim-tumble balance (J. S. Parkinson, personal communication), indicating that cheB function is required for the partial adaptation observed in cheR strains. An additional striking correlation between cheB activity and a tactic function in the absence of methylation is seen for responses to oxygen or PTS sugars. Using appropriate assay procedures, it can be seen that a cheR deletion mutant exhibits normal responses and only slightly extended adaptation times to those stimuli while cheB or cheR cheB deletion mutants do not respond to PTS sugars and exhibit an inverse response to oxygen (Niwano and Taylor, 1982b). CheB-dependent modifications could perform a physiological role in the functioning of the sensory system only if a proportion of the transducers in the normal cell were less than completely modified by this apparently irreversible reaction. In ultraviolet-irradiated cells infected with appropriate transducing phages, CheB-dependent modification of a population of previously synthesized transducer molecules is less than half complete in 2 hours (Sherris and Parkinson, 1981), but it is not clear how to relate that observation to the situation in normal cells. The best available information addressing the question of extent of CheBdependent modification in unperturbed cells is the patterns of [3H]methyl-labeled spots of transducers observed in two-dimensional gels. The data suggest that within an hour after synthesis, transducer molecules are fully CheB-modified. Tar spots fall into four distinct charge groups and Tsr spots into six charge groups (Hazelbauer and Engstrom, 1981, and Figs. 2 and 3). If a significant proportion of transducer molecules had the first CheB-dependent modification (on the methionine-lysine peptide, which could then be fully methylated) but not the second, then there would be five charge groups of methylated Tar spots and seven of Tsr spots. In contrast a transducer population fully CheB-modified would produce the observed number of charge groups. The limitation of these observations is that the methyl-labeling procedures necessarily involve inhibition of protein synthesis by chloramphenicol during the 1 hour labeling period, so that the indication of complete CheB-dependent modification applies to polypeptides 1 hour posttranslation. However, [35S]methionine-labeled Tsr and Tar proteins

BACTERIAL CHEMOTAXIS

63

synthesized in ultraviolet-irradiated, phage-infected cells harvested 10 minutes after addition of excess unlabeled methionine exhibit two-dimensional patterns almost identical with the [3H]methyl-labeled material (Kehry and Dahlquist, 1982a,b), with the exception of an additional Tar spot corresponding to doubly CheB-modified, unmethylated protein. Thus a reasonable hypothesis is that within 10 minutes of synthesis, transducer molecules are fully CheB-modified and activated for their total methyl-accepting potential. A role for CheB-dependent modification in the dynamic functioning of the sensory system in normal cells would thus be limited to newly synthesized transducer molecules. However, it is quite possible that the CheB protein could have a critical role in an alternative mode of adaptation which would be independent of CheB-dependent modifications (Parkinson and Houts, 1982).

VIII. Pathways for Unconventional Excitation and Adaptation Excitation by repellents appears to be mediated by a perturbation of transducers independent of conventional ligand-recognitionsite (see Section IV). Yet adaptation is by the conventional mechanism of changes in the level of methylation of the relevant transducer. In striking contrast, excitation by oxygen or PTS sugars does not require any known transducer nor does deprivation of methionine, S-adenosylmethionine, or the cheR methyltransferase significantly affect adaptation to those stimuli (Niwano and Taylor, 1982a,b). In fsr rur double mutants, the absence of over 90% of the normal complement of methyl-accepting sites appears to so perturb the methylation system that adaptation to maximal stimuli transduced through trg never occurs, while adaptation times to stimulation by PTS sugars are only moderately extended (Hazelbauer and Engstrom, 1980). A simple hypothesis is that excitation by 0, or PTS sugars is the result of a perturbation in the cells which affects the conventional pathway of excitation at a point after the transducers. Adaptation would then involve a compensatory change in a tactic component or in the parameter initially perturbed. It appears as if the compensatory change does not involve methylation of either a known transducer or any other component: Addition of a PTS sugar to a cell suspension results in a rapid but transient perturbation of intracellular pools of phosphorylated compounds as the sugar is first transported and concurrently phosphorylated. This phenomenon has been evoked in explanations of inducer exclusion by PTS sugars (Lengler and Steinberger, 1978a,b) and changes in the phosphorylation of enzymes I1 have been suggested to be involved in the mechanism of tactic response to PTS sugars (Lengler et al., 1981). It seems possible to us that perturbations in pools of phosphorylated compounds could affect the putative, cGMP-related signal compound (see Section V) and thus produce tactic excitation. Adaptation could be mediated by an alteration in a component of the tactic system or by a metabolic reequilibration of the intracellular pools of phosphorylated compounds. The notion of excitation by perturbation of phosphorylated

64

GERALD L. HAZELBAUER AND SHIGEAKI HARAYAMA

compound pools is consistent with the drastic reduction of response to PTS sugars by mutations in the phosphotransfemng components of the PTS system (Adler and Epstein, 1974). Excitation by oxygen or other electron acceptors may occur by a direct effect of changes in proton motive force on the rotary motor or indirectly by perturbation of the signal compound. In the latter case, the perturbation would have to be mediated independently of oxidative phosphorylation since a mutant defective in the proton-translocating ATPase responds normally to oxygen. Whatever the components mediating tactic sensivitity to oxygen or PTS sugars, the CheB protein is critical for a normal response, since cheB deletion mutants do not respond to PTS sugars at all and exhibit an inverted response to oxygen (Niwano and Taylor, 1982b). The effect of cheB mutations is not limited to responses to transducer-independent stimuli, since response to acetate, mediated by the Tsr protein, is inverted in cheB deletions (Parkinson and Houts, 1982).

IX. Concluding Remarks At present it is possible to organize our understanding of the sensory system of enteric bacteria with the relatively simple and concise generalizations presented in Sections I and 11. The most prominent gap in our knowledge is the nature of the excitatory link between transducers and the rotary motor. We know a great deal about adaptation, and that knowledge promises to have wide relevance in the study of receptor-linked systems with all-or-none responses and in the understanding of the functional significance of covalent modification of proteins in receptor systems. However, we are far from a comprehensive understanding of tactic mechanisms. It is striking that the biochemical information about transducers greatly transcends our rudimentary conceptual scheme of transducer function. The simple model presented in Section I1 neither incorporates nor requires the complexity of multiple methylation and multiple CheB modification of transducer molecules. The existence of multiple methylations makes inadequate models involving transducers with a single recognition site which are excited upon ligand occupancy and simply shut off upon methylation. It is conceivable that transducers have a ligand-binding site linked to each methyl-accepting site, but that seems rather unlikely, particularly since the 60,000 dalton Tsr protein would then contain six serine-binding sites. An alternative notion suggests that transducers can be induced to a range of excited states and that increasing degrees of excitation can be compensated for by increasing numbers of methylations. In this view, the magnitude of excitation would be a function of the proportion of time each individual transducer protein was occupied by ligand or ligand-receptor complex, rather than the proportion of the transducer population occupied at any instant. This would require that the time constant of the transducer excitatory

BACTERIAL CHEMOTAXIS

65

change be larger than the rate constant of ligand dissociation so that the degree of excitatory change could reflect a time integration of occupancy over an appropriate period. Thus the concentration of attractant would be reflected in the time occupancy and a linked excitatory change of each individual transducer molecule. Adaptation would result from an appropriate increase in the level of methylation of each transducer molecule in the cell. This would be consistent with the observations that in a cell adapted to a moderate stimulus or partially adapted to a saturating stimulus, the relevant transducers are a population of molecules all methylated to a similar extent rather than a population including a significant number of minimally methylated and of maximally methylated proteins (Paoni and Koshland, 1979; DeFranco and Koshland, 1980; Engstrom and Hazelbauer, 1980). The quanta1 nature of methylation would mean that individual transducer molecules would not be precisely balanced between counterclockwise signal (ligand occupancy) and clockwise signal (methylation) but the algebraic sum of signals from individual transducers could be balanced to yield an unstimulated state in the cell. In any case, these considerations emphasize the complexity and sophistication of the bacterial sensory system. The present rate of progress in characterizing the molecular components of this system promises an elucidation of many of its basic mechanisms in the near future.

ACKNOWLEDGMENTS We thank all of our colleagues who communicated data to us before publication. Unpublished work from our laboratories was supported in part by grants from the McKnight Foundation and the National Institutes of Health

REFERENCES Adler, J. (1969). Science 166, 1588-1597. Adler, J. (1973). J . Gen. Microbiol. 74, 77-91. Adler, J . , and Epstein, W. (1974). Proc. Narl. Acad. Sci. U.S.A. 71, 2895-2899. Adler, J . , Hazelbauer, G . L., and Dahl, M. M. (1973). J . Eacreriol. 115, 824-847. Aksamit, R. R . , and Koshland, D. E., Jr. (1974). Biochemistry 13, 4473-4478. Arai, T. (1981). J . Eacteriol. 145, 803-807. Argos, P., Mahoney, W. C., Hermodson, M. A,, and Hanei, M. (1981). J . Eiol. Chem. 256, 4357-4361. Armitage, J. P., and Evans, M. C. W. (1979). FEES Lerr. 102, 143-146. Armitage, J. P., and Evans, M. C. W. (1980). FEES Letr. 112, 5-9. Armitage, J. P., and Evans, M. C. W. (1981). FEES Letr. 126, 98-102. Aswad, D., and Koshland, D. E., Jr. (1974). J . Bacreriol. 118, 640-645. Balasubramanian, T. M., Kendrick, N. C. E., Taylor. M., Marshall, G. R., Hall, J . E., Vodyanoy, I., and Reusser, F. (1981). J . Am. Chem. SOC. 103, 6127-6132.

66

GERALD L. HAZELBAUER AND SHIGEAKI HARAYAMA

Berg, H. C. (1974). Nature (London) 249, 77-79. Berg, H. C. (1975). Annu. Rev. Biophys. Bioeng. 4, 119-136. Berg, H. C., and Brown, D. A. (1972). Narure (London) 239, 500-504. Berg, H. C., and Tedesco, P. M. (1975). Proc. Narl. Acad. Sci. U.S.A. 72, 3235-3239. Black, R. A., Hobson, A. C., and Adler, 1. (1980).Proc. Narl. Acad. Sci. U.S.A. 77, 3879-3883. Black, R. A., Hobson, A. C., and Adler, J. (1982). In “Biochemistry of S-Adenosylmethionine and Related Compounds” (E. Usdin, R. T. Borchardt, and C. R. Creveling, eds.), pp. 91-98. Macmillan, New York. Boos, W. (1972). J. Biol. Chem. 247, 5414-5424. Boyd, A., and Simon, M. (1980). J. Bacreriol. 143, 809-815. Boyd, A., and Simon, M. (1982). Annu. Rev. Physiol. 44, 501-518. Boyd, A., Krikos, A., and Simon, M. (1981). Cell 26, 333-343. Brey. R. N., and Rosen, B. P. (1979). J. Bacreriol. 139, 824-834. Brown, D. A., and Berg, H. C. (1974). Proc. Narl. Acad. Sci. U.S.A. 71, 1388-1392. Chelsky, D., and Dahlquist, F. W. (1980a). Proc. Narl. Acad. Sci. U.S.A. 77, 2434-2438. Chelsky, D., and Dahlquist, F. W. (1980b). Biochemistry 19, 4633-4639. Chelsky, D., and Dahlquist, F. W. (1981). Biochemistry 20, 977-982. Clarke, S., and Koshland, D. E., Jr. (1979). J . Biol. Chem. 254, 9695-9702. Debarbouillk, M., Shuman, H. A., Silhavy. T. J., and Schwartz, M . (1978). J . Mol. Biol. 124, 359-37 1. DeFranco, A. L., and Koshland, D. E., Jr. (1980). Proc. Narl. Acad. Sci. U.S.A. 77, 2439-2443. DeFranco, A. L., Parkinson, J. S . , and Koshland, D. E., Jr. (1979). J . Bacreriol. 139, 107114. de Jong, M. H., and van der Drift, C. (1978). Arch. Microbiol. 116, 1-8. de Jong, W. W., Zweers, A., and Cohen, L. H. (1978). Biochem. Biophys. Res. Commun. 82, 532-539. DePhamphilis, M. L., and Adler, J. (1971a). J. Bacreriol. 105, 376-383. DePhamphilis, M. L., and Adler, J . (1971b). J. Bacreriol. 105, 384-395. DePhamphilis, M. L., and Adler, J. (1971~).J. Bacreriol. 105, 396-407. Diliberto, E. J., Jr., and Axelrod, J. (1976). J. Neurochem. 26, 1159-1 165. Engstrom, P., and Hazelbauer, G. L. (1980). Cell 20, 165-171. Engstrom, P., and Hazelbauer, G. L. (1982). Biochim. Biophys. Acra 686, 19-26. Eneqvist, H. G., Hirst, T. R., Harayama, S . , Hardy, S . J. S . , and Randall, L. L. (1981). Eur. J. Biochem. 116, 227-233. Gagnon, C. (1982). I n “Biochemistry of S-Adenosylmethionine and Related Compounds” (E. Usdin, R. T. Borchardt, and C. R. Creveling, eds.), pp. 55-64. Macmillan, New York. Gagnon, C., and Heisler, S. (1979). Life Sci. 25, 993-1000. Galloway, R. J . , and Taylor, B. L. (1980). J. Bacreriol. 144, 1068-1075. Gilliland, G. L., and Quiocho, F. A. (1981). J. Mol. Biol. 146, 341-362. Glagolev, A. N. (1980). J . Theor. Biol. 82, 171-185. Glagolev, A. N., and Skulachev, V. P. (1978). Narure (London) 272, 280-282. Goulbourne, E. A., and Greenberg, E. P. (1981). J . Bacreriol. 148, 837-844. Goy, M. F., and Springer, M. S . (1978). I n “Taxis and Behavior” (G. L. Hazelbauer, ed.), pp. 3-34. Chapman & Hall, London. Goy, M. F., Springer, M. S.. and Adler, J. (1977). Proc. Narl. Acad. Sci. U.S.A. 94,4964-4968. Harayama, S . , and Iino, T. (1977). J . Bacreriol. 131, 34-41. Harayama, S., Palva, E. T., and Hazelbauer, G. L. (1979). Mol. Gen. Genet. 171, 193-203. Harayama, S . , Engstrom, P., Wolf-Watz, H., Iino, T., and Hazelbauer, G. L. (1982). J. Bacleriol. 152, 372-383. Harayama, S., Bollinger, J., Iino, T., and Hazelbauer, G. L. (1983). J . Bacreriol. 153 (in press).

BACTERIAL CHEMOTAXIS

67

Hartman, S. C. (1971). In “The Enzymes.” (P. P. Boyer, ed.), Vol. 4, pp. 79-100. Academic Press, New York. Hazelbauer, G. L. (1970). Ph.D. thesis, University of Wisconsin. Hazelbauer, G. L. (1975). J . Bacteriol. 122, 206-214. Hazelbauer, G. L. (1977). I n “Olfaction and Taste VI” (J. Le Magnen and P. MacLeod, eds.), pp. 47-54. Information Retrieval, London. Hazelbauer, G. L. (1979). In “Bacterial Outer Membranes” (M. Inouye, ed.), pp. 449-473. Wiley, New York. Hazelbauer, G. L. (1980). Endeavor 4, 67-73. Hazelbauer. G. L., and Adler, J. (1971). Narure (London)New Biol. 230, 101-104. Hazelbauer, G. L., and Engstrom, P. (1980). Nature (London) 283, 98-100. Hazelbauer, G. L., and Engstrom, P. (1981). J. Bacteriol. 145, 35-42. Hazelbauer, G. L., and Harayama, S. (1979). Cell 16, 617-625. Hazelbauer, G. L., and Parkinson, I. S. (1977). In “Microbial Interactions” (J. Ressig, ed.), pp. 59-88. Chapman & Hall, London. Hazelbauer, G. L., Engstrom. P., Harayama, S., and Koman, A. (1979). In “Chemoreception and Preference Behavior” (J. H. A. Kroeze, ed.), pp. 9-22. Information Retrieval, London. Hazelbauer, G. L., Engstrom, P., and Harayama, S. (1981). J. Bacreriol. 145, 43-49. Hazelbauer, G. L., Harayama, S . , and E n g s t r h , P. (1982a). Ann. Microbiol. Inst. Pasreur 133A, 19 I - 134. Hazelbauer, G. L., Engstrom, P., and Harayama. S. (1982b). In “Biochemistry of S-Adenosylmethionine and Related Compounds” (E. Usdin, R. T. Borchardt, and C. R. Creveling, eds.), pp. 83-98. Macmillan, New York. Hedblom, M. L., and Adler, J. (1980). J . Bacteriol. 144, 1048-1060. Heppel, L. A. (1971). In “Structure and Function of Biological Membranes” (L. I. Rothfield, ed.), pp. 223-247. Academic Press, New York. Hofnung, M. (1974). Generics 76, 169-184. Hosoi, S . , and Oosawa, F. (1978). J. Bacteriol. 134, 751-756. lida, A., (1983). M. S. Thesis, Univ. of Tokyo. lino, T. (1977). Annu. Rev. Genet. 11, 161-182. Ingolia, T. D., and Koshland, D. E., Jr. (1979). J. Bacteriol. 140, 798-804. Kehry, M. R., and Dahlquist, F. W. (1982a). J . Biol. Chem. 257, 10378-10386. Kehry, M. R., and Dahlquist, F. W. (1982b). Cell. 29, 761-772. Kellermann, 0..and Szmelcman, S. (1974). Eur. J . Biochem. 47, 139-149. Khan, S . , and Macnab, R. M. (1980). J. Mol. Biol. 138, 599-614. Khan, S . , Macnab, R. M.,DeFranco, A. L., and Koshland, D. E., Jr. (1978). P roc. Narl. Acad. Sci. U.S.A. 75, 4150-4154. Kihara. M., and Macnab, R. M. (1981). J . Bacreriol. 145, 1209-1221. Kim, S., Wasserman, L.. Lew, B., and Paik, W. K. (1975). J. Neurochem. 24, 625-629. Kleene, S. J . , Toews, M. L., and Adler, J. (1977). J . Biol. Chem. 252, 3214-3218. Kleene, S. J . , Hobson, A. C., and Adler, J. (1979). Proc. Narl. Acad. Sci. U.S.A. 76,6809-6813. Kloog, Y., Flynn, D., Hoffman, A. R., and Axelrod, J. (1980). Biochem. Biophys. Res. Commun. 97, 1474-1480. Koiwai, 0.. and Hayashi, H. (1979). J. Biochem. 86, 27-34. Koiwai, 0.. Minoshima, S., and Hayashi, H. (1980). J. Biochem. 87, 1365-1370. Komeda, Y., Kutsukake, K., and lino, T. (1980). Genetics 94, 277-290. Kondoh, H. (1980). J. Bacteriol. 142, 527-534. Kondoh, H., Ball, C. B., and Adler, J. (1979). Proc. Narl. Acad. Sci. U.S.A.76, 260-264. Kort, E. N.. Goy, M. F., Larsen, S. H., and Adler, J. (1975). Proc. Narl. Acad. Sci. U.S.A. 72, 3939-3943.

68

GERALD L. HAZELBAUER AND SHIGEAKI HARAYAMA

Koshland, D. E., Jr. (1980). Trends Biochem. Sci. 5 , 297-302. Koshland, D. E., Jr. (1981). Annu. Rev. Biochem. 50, 765-782. Larsen, S. H., Adler, J., Gargus, J. J., and Hogg, R. W. (1974a). Proc. Narl. Acad. Sci. U.S.A. 71, 1239- 1243. Larsen, S. H.,Reader, R. W., Kort, E. N., Tso, W.-W., and Adler, J. (1 974b). Nature (London) 249, 74-77. Laszlo, D. J.. and Taylor, B. L. (1981). J. Bacreriol. 145, 990-1001. Lengler, J., and Steinberger, H. (1978a). Mol. Gen. Gener. 164, 163-169. Lengler, J.. and Steinberger, H. (1978b). Mol. Gen. Gener. 167, 75-82. Lengler, J., Auburger, A. M., Mayer, R., and Pecher, A. (1981). Mol. Gen. Genet. 183, 163-170. Linne, T., and Philipson, L. (1980). Eur. J. Biochem. 103, 259-270. McGowan, E. B., Silhavy, T. J., and Boos, W. (1974). Biochemisrry 13, 993-999. Macnab, R. M. (1977). Proc. Narl. Acad. Sci. U.S.A. 74, 221-225. Macnab, R. M. (1978). Crit. Rev. Biochem. 5 , 291-341. Macnab, R. M. (1980). In “Biological Regulation and Development” (R. F. Goldberger, ed.). Vol. 2, pp. 377-412. Plenum, New York. Macnab, R. M., and Koshland, D. E., Jr. (1972). Proc. Narl. Acad. Sci. U.S.A. 69, 2509-2512. Macnab, R. M., and Ornston, M.K. (1977). J. Mol. B i d . 112, 1-30. Maeda, K., and Imae, Y. (1979). Proc. Natl. Acad. Sci. U.S.A. 76, 91-95. Maeda, K., Imae, Y., Shioi, J . 4 , and Oosawa, F. (1976). J . Bacreriol. 127, 1039-1046. Mahoney, W. C., Hogg, R. W., and Hermodson, M. A. (1981). J . Biol. Chem. 256, 43504356. Maley, F., and Guarino, D. V. (1977). Biochem. Biophys. Res. Commun. 77, 1425-1430. Manson, M. D., Tedesco, P., Berg, H. C., Harold, F. M., and van der Drift, C. (1977). Proc. Narl. Acad. Sci. U.S.A. 74, 3060-3064. Manson, M. D., Tedesco, P. M., and Berg, H. C. (1980). J . Mol. Biol. 138, 541-561. Matsuura, S., Shioi, J.-I., and Imae, Y. (1977). FEBS Lea. 82, 187-190. Melton, T., Hartman, P. E., Stratis, J. P., Lee, T. L., and Davis, A. T. (1978). J. Bacreriol. 133, 708-716. Mesibov, R., and Adler, J. (1972). J. Bacteriol. 112, 315-326. Miller, J. B., and Koshland, D. E., Jr. (1977). Proc. Narl. Acad. Sci. U.S.A. 74, 4752-4756. Miller, J. B., and Koshland, D. E., Jr. (1980). J. Bacreriol. 141, 26-32. Muskavitch, M. A., Kort, E. N., Springer, M. S.,Goy, M. F., and Adler, J. (1978). Science 201, 63-65. Newcomer, M. E., Miller, D. M., III, and Quiocho, F. A. (1979). J . Biol. Chem. 254,7529-7533. Newcomer, M. E., Gilliland, G. L., and Quiocho, F. A. (1981a). J. B i d . Chem. 256, 1321313217. Newcomer, M. E., Lewis, B. A., andQuiocho, F. A. (1981b). J . Biol. Chem. 256, 13218-13222. Niwano, M., and Taylor, B. L. (1982a). Proc. Narl. Acad. Sci. U.S.A. 79, 11-15. Niwano, M., and Taylor, B. L. (1982b). Fed. Proc. Fed. Am. SOC.Exp. Biol. 41, 759. Noel, D., Nikaido, K., and Ames, G. F.-L. (1979). Biochemistry 18, 4159-4165. O’Farrell, P. (1975). J . Biol. Chem. 250, 4007-4021. Ordal, G . W. (1977). Nature (London) 270, 66-67. Ordal, G. W. (1980). Bioscience 30, 408-41 I . Ordal, G. W., and Adler, J. (1974a). J . Bacreriol. 117, 506-516. Ordal, G. W., and Adler, J. (1974b). J . Bacreriol. 117, 517-526. Ordal, G.W., and Goldman, D. J. (1975). Science 189, 802-804. Ordal, G. W., and Goldman, D. J. (1976). J . Mol. Biol. 100, 103-108. Paik, W. K., and Kim, S. (1980). “Protein Methylation.” Wiley, New York. Paoni, N. F., and Koshland, D. E., Jr. (1979). Proc. Narl. Acad. Sci. U S A . 76, 3693-3697. Parkinson, J. S . (1978). J . Bacreriol. 135, 45-53.

BACTERIAL CHEMOTAXIS

69

Parkinson, J. S. (1981). I n “Genetics as a Tool for Microbiology’’ (S. W. Glover and D. A. Hopwood, eds.), pp. 265-290. Cambridge Univ. Press, London & New York. Parkinson, J. S . , and Houts, S . E. (1982). J. Bucreriol., 151, 106-113. Parkinson, J . S . , and Revello, P. T. (1978). Cell 15, 1221-1230. Quiocho, F. A., and Pflugrath, J. W. (1980). J. Biol. Chem. 255, 6559-6561. Quiocho, F. A., Gilliland, G. L., and Phillips, G. N., Jr. (1977). J. Biol. Chem. 252, 5142-5149. Quiocho, F. A,, Meador, W. E., and Pflugrath, J. W. (1979). J . Mol. Biol. 133, 181-184. Reader, R. W., Tso, W. W., Springer, M. S . , Goy, M. F.,and Adler, J. (1 979). J . Gen. Microbiol. 111, 363-374. Repaske, D. R., and Adler, J. (1981). J. Bucreriol. 145, 1196-1208. Richarme, G. (1982). J . Bucreriol. 149, 662-667. Robbins, A. R. (1975). J. Bucreriol. 123, 69-74. Rollins, C., and Dahlquist, F. W. (1981). Cell 25, 333-340. Rubik, B. A., and Koshland, D. E., Jr. (1978). Proc. Nurl. Acud. Sci. U.S.A. 75, 2820-2824. Segall, J. E., Manson, M. D., and Berg, H. C. (1982). Nature (London) 2%, 855-857. Shems, D., and Parkinson, J. S . (1981). Proc. Nurl. Acud. Sci. U.S.A. 78, 6051-6055. Shioi, J . 4 . . and Galloway, R. J. (1981). Fed. Proc. Fed. Am. SOC. Exp. Biol. 40, 1637. Shioi, J . 4 , Imae, Y.,and Oosawa, F. (1978). J. Bucreriol. 133, 1083-1088. Silhavy, T. I., Brickman, E., Bassford, P. J., Casadaban, M. J., Shumman, H.A., Schwartz, V., Guarente, L., Schwartz, M., and Beckwith, J. R. (1979). Mol. Gen. Gener. 174, 249-259. Silverman, M. (1980). Q. Rev. Biol. 55, 395-407. Silverman, M., and Simon, M. (1974). Nurure (London) 249, 73-94. Silverman, M., and Simon, M. (1977a). Annu. Rev. Microbiol. 31, 397-419. Silverman, M., and Simon, M. I. (1977b). Proc. Nurl. Acud. Sci. U.S.A. 74, 3317-3321. Skulachev, V. P. (1977). FEES Len. 74, 1-9. Slonczewski, J. L., Macnab, R. M., Alger, J. R., and Castle, A. (1982). J . Bucreriol. 152, 384-399. Snyder, M. A., Stock, J. B., and Koshland, D. E., Jr. (1981). J. Mol. Biol. 149, 241-257. Springer, M. S . , Kort, E. N., Larsen, S. H.,Ordal, G. W., Reader, R. W., and Adler, J. (1975). Proc. Narl. Acud. Sci. U.S.A. 72, 4640-4644. Springer, M. S . , Goy, M. F., and Adler, J. (1977a). Proc. Nurl. Acud. Sci. U.S.A. 74, 183-187. Springer, M. S . , Goy, M. F., and Adler, J. (1977b). Proc. Nurl. Acud. Sci. U.S.A. 74,3312-3316. Springer, M. S., Goy, M. F., and Adler, J. (1979). Nature (London) 280, 279-284. Springer, M. S . , Zanolari, B., and Pierzchala, P. A. (1982). J. Biol. Chem. 257, 6861-6866. Springer, W. R., and Koshland, D. E., Jr. (1977). Proc. Narl. Acud. Sci. U.S.A. 74, 533-537. Spudich, J. L., and Koshland, D. E., Jr. (1975). Proc. Nurl. Acud. Sci. U.S.A. 72, 710-713. Stock, J. B., and Koshland, D. E., Jr. (1978). Proc. Natl. Acud. Sci. U.S.A. 75, 3659-3663. Stock, J . B., and Koshland, D. E., Jr. (1981). J. Biol. Chem. 256, 10826-10833. Stock, J. B., Maderis, A. M., and Koshland, D. E., Jr. (1981). Cell 27, 37-44. Szmelcman, S., and Adler, J. (1976). Proc. Nurl. Acud. Sci. U.S.A. 73, 4387-4391. Szmelcman, S . , Schwartz, M., Silhavy, T.J., and Boos, W. (1976). Eur. J. Biochem. 65, 13-19. Taylor, B. L., and Koshland, D. E., Jr. (1975). J. Bacreriol. 123, 557-569. Taylor, B. L., and Laszlo, D. J. (1981). I n “Perception of Behavioral Chemicals” (D. M. Norris, ed.), pp. 1-27. Elsevier, Amsterdam. Taylor, B. L., Miller, J. B., Warrick, H. M., and Koshland, D. E., Jr. (1979). J . Bucteriol. 140, 567-573. Thomson, 3. W., Kunugi, K.,and Nelson, D. L. (1981). Fed. Proc. Fed. Am. SOC.Exp. Biol. 40, 1638. Toews, M. L., and Adler, J . (1979). J. Biol. Chem. 254, 1761-1764. Toews, M. L., Goy, M. F.,Springer, M. S., and Adler, J. (1979). Proc. Nurl. Acud. Sci. U.S.A. 76, 5544-5548.

70

GERALD L. HAZELBAUER AND SHIGEAKI HARAYAMA

Tso, W.-W., and Adler, J. (1974). J. Bacteriol. 118, 560-576. Tung, J. S., and Knight, C. A. (1972). Anal. Biochem. 48, 153-163. Usdin, E., Borchardt, R. T., and Creveling, C. R., eds. (1982). “Biochemistry of S-Adenosylmethionine and Related Compounds.’’ Macmillan, New York. Van der Werf, P., and Koshland, D. E., Jr. (1977). J. Biol. Chem. 252, 2793-2795. Venkatasubramanian, K., Hirata, F., Gagnon, C., Corcoran, B. A., O’Dea, R. F., Axelrod, J.. and Schiffrnann, E. (1979). Symp. Mol. Cell Biol. 13, 299-313. Vodyanoy, I., Hall, J. E., Balasubramanian, T. M., and Marshall: G. R. (1982). Biochim. Biophys. A C ~ U684, 53-58.

Wang, E. A,, and Koshland, D. E., Jr. (1980). Proc. Natl. Acad. Sci. U.S.A. 77, 7157-7161. Wang, E. A., Mowry, K. L., Clegg, D. 0.. and Koshland, D. E., Jr. (1982). J. Biol. Chem. 257, 4613-4676.

Willis, R. Zukin, R. Zukin, R. Zukin, R.

C., and Furlong, C. W. (1974). J. B i d . Chem. 249, 6926-6929. S. (1979). Biochemistry 18, 2139-2145. ‘ S., and Koshland, D. E., Jr. (1976). Science 193, 405-408. S., Hartig, P. R., and Koshland, D. E., Jr. (1977a). Proc. Nad. Acad. Sci. U.S.A. 74,

1932- 1936.

Zukin, R. S., Strange, P. G., Heavey, L. R., and Koshland, D. E., Jr. (1977b). Biochemisrrv 16, 38 1-386.

Zukin, R. S., Hartig, P. R., and Koshland, D. E., Jr. (1979). Biochemisrry 18, 5599-5605.

INTERNATIONAL REVIEW OF CYTOLOGY, VOL. 81

The Functional Significance of Leader and Trailer Sequences in Eukaryotic mRNAs F. E. BARALLE Sir William Dunn School of Pathology, University of Oxford, Oxford, England 1. Introduction .............................................. II. The Leader Sequence.. . . . . . . . . A. The “Cap” . . . . . . . . . . . . B. The 5‘ Noncoding Region. . C. Functional Significance ‘of t 111. The Trailer Sequence. . . . . . . . . . A. The 3’ Noncoding Region. B. The Poly(A) Tail . . . . . . . . . C. Synthesis of the Trailer Seq D. Functional Significance o f t References ...............................................

71

102

I. Introduction A functionally active eukaryotic mRNA is the final product of a complex series of steps that includes (1) the transcription of DNA into mRNA precursor, (2) the intranuclear processing of these precursors, and (3) the transport of the mRNAs into the cytoplasm and their association with ribosomes to initiate the process of translation into amino acid sequences. Although interest in the structure of mRNAs dates back to the time when Jacob and Monod (1961) introduced the messenger concept, only recently a combination of better purification techniques and improved sequencing methods made possible the elucidation of the primary structure of several cellular and viral mRNAs. The structural features of a “typical” eukaryotic mRNA molecule as generalized from these studies are shown in Fig. 1. The mRNA molecule can be divided into three domains which are from 5’ to 3’, the leader, coding, and trailer sequences. The leader and trailer regions contain sequences copied from the genomic DNA (the 5’ and 3’ noncoding region) and features added posttranscriptionally [the “cap” at the 5’ terminus and the poly(A) tail at the 3’ terminus]. While there is an obvious function for the middle region of the mRNA molecule which carries the message for the peptide chain, there is more controversy about the functional significance of the leader and trailer sequences. Extreme 71

Copyright Q 1983 by Academic Press. Inc. All right\ of reproduction in any form reserved. ISBN 0-12-364481-X

72

F. E. BARALLE A-U-C

A-A-U-A-A-A

Initiator codon \

/

;

’

f

\

P.C

/

I

\

\

I

i.

-,--I

I

I

15’ non-1 c ~ h s

:

I

I

I

I

I

M2

-

I‘

_I

7 I

I

I

Coding

L

I

I’ non-codlng Poly(A) I

I I

; I

COOH

Proteln

FIG. I . Generalized diagram of a eukaryotic mRNA molecule. Some of the features presented here may be absent or modified in particular messengers.

hypotheses have ranged from considering most of the noncoding regions simply as leftovers from the transcription and processing steps to attributing to them an absolutely essential role in ribosome recognition and initiation of protein synthesis. A considerable amount of experimental work has been carried out to try to solve these questions. It is now clear that some features in the leader and trailer regions are indeed a consequence of their biosynthetic history, like the poly(A) addition signal AAUAAA. However, it is also clear that other features like the “cap” and the poly(A) tail increase the stability of the molecule or more important (in the case of the cap) enhance the ability of the mRNA to bind ribosomes and efficiently initiate protein synthesis. We shall first consider the main aspects of the structure and biosynthesis of the leader and trailer sequence and then we will analyze the experiments that shed some light on the possible functions of these regions.

I. The Leader Sequence A. THE “CAP” Most eukaryotic mRNAs have their 5’ terminal ends blocked by the posttranscriptional addition of a rather unusual structure called the “cap” (for a review on this structure, see Shatkin, 1976; Lewin, 1980; Filipowicz, 1978). The nucleotide at the 5‘ end of the transcript is methylated in the ribose moiety and is linked to a 7 methyl guanosine (m7G) through a triphosphate group (Fig. 2). The linkage involves the 5’ hydroxyls of both the 7 methyl G and the ribose methylated 5’ terminal nucleotide. This 5‘-5‘ linkage is inverted relative to the usual 3’-5’ phosphodiester bonds found in the remainder of the polynucleotide chain. As a result, there is no free 5’ hydroxyl or 5’ phosphate at this so-called 5‘ end. While the caps of all cellular messages possess an m7G, the nature of the residue linked to it varies both in the identity of the base and the extent of methylation in this position. Three types of cap have been recognized according

SEQUENCES IN EUKARYOTIC mRNAs

73

to the positions at which methylation occurs. The simplest variation is a cap with the structure m7GpppX which is called cap 0, where no methylation other than the m7G is found in the structure. Other mRNAs however present an additional methyl group m7GpppXm.In such structures, known as cap 1, the 3'-5' bond between the 2' 0-methylated nucleotide and the next residue in the mRNA chain is stabilized against hydrolysis by alkali or T2 RNase because formation of the 2',3'-cyclic intermediate required for cleavage is blocked. A more extensive methylation of the 5' terminus of mRNAs results in the cap 2 structure: m7GpppXmpXm. A further modification found in mRNA in its 5' terminus and also internally is methylation, not only in the ribose moiety but at position 6 of the base. In fact m6A is found about once every 1500 nucleotides in cellular mRNA (Adams and Cory, 1975). Caps have been detected in almost all eukaryotic cellular and viral mRNAs. Exceptions include picomavirus and satellite tobacco necrosis virus which contain a 5' terminal mono- or diphosphate. The best studied case is poliovirus mRNA. The 5' terminal uridine of the genomic RNA is linked via a phosphodiester bond to a tyrosine residue of the viral protein VPg. However, the 5' terminus of the mRNA found in the polyribosome lacks the protein and instead terminates in 5' monophosphate uridine (Petterson et al., 1977; Nomoto ef al., 1977). Capping occurs after the initiation of transcription and the reactions involved have been studied mostly in vaccinia virus and HeLa cells (for a detailed review,

FIG.2. Structure of the 5' cap of eukaryotic messenger RNA. The linkage of the 7 methyl guanosine to the terminal nucleotide is by a 5' to 5' triphosphate bridge. (From Shatkin, 1976.)

74

F. E. BARALLE

see Shatkin, 1976). The 5’-5’ pyrophosphate bridge is formed by the action of guanylyl transferase and then the terminal guanine is methylated at the N7 position. The subsequent steps complete the methylation pattern characteristic of the specific cap. Recent structural and functional studies have shown that the 5‘ end of cellular mRNA transcripts and thus the capping site is determined by the distance to the “TATA” box. The “TATA” box is a region of strong homology first recognized in the Drosophila histone genes (Goldberg and Hogness, unpublished; Goldberg, 1979) and subsequently identified in many other eukaryotic genes. It consists of an AT-rich sequence flanked by GC-rich segments. Figure 3 shows the common features of the sequences 5‘ of the mRNA capping site in several eukaryotic genes with particular emphasis on the mammalian P-like globin genes. The first A of the TATA tetranucleotide almost universally conserved (I\TA trinucleotide in the case of the P-globin genes) is located approximately 30 nucleotides upstream from the capping site. The conserved location of the TATA box and its similarity to a sequence characteristic of all prokaryotic promoters (Pribnow, 1979) led many investigators to speculate that it might have a role in the initiation of transcription in eukaryotes. However, the absence of the TATA box 5’ to the regions encoding certain viral mRNAs suggests that the TATA box is not essential for transcription in these cases (Baker et al., 1979). The same authors have correlated the absence of the TATA box with microheterogeneity of the capped mRNA 5‘ end. This correlation is consistent with the observation that the deletion of the TATA box from a cloned sea urchin H2A histone gene does not abolish transcription of the gene in Xenopus oocytes, but leads to the production of transcripts with heterogeneous 5’ termini (Grosschedl and Birnstiel, 1980). Furthermore, it has been shown that a point mutation in the TATA box (TATA + TAGA), although it decreases the rate of transcription in vivo, does not change the site of RNA initiation (Grosschedl et al., 1981). An in vivo role of the TATA box in guiding the RNA polymerase into a correct initiation frame has been strongly supported by recent studies on SV40 early promoter regions (Benoist and Chambon, 1981). The situation in vitro appears to be more complicated because deletions or single point mutations involving the TATA box abolish or drastically reduce specific initiation of transcription (Mathis and Chambon, 1981; Corden et al., 1980; Wasylyk et al., 1980). B. THE5‘ NONCODING SEQUENCE 1. Primary Structure of the 5’ Noncoding Regions The 5’ noncoding region extends from the “cap” to the initiator AUG. Studies on the primary structure of this region of eukaryotic mRNA were prompted

SEQUENCES IN EUKARYOTIC mRNAs

Adenovirus Early IA INSULIN Human Rat I OVALBUMIN CONALBUMIN SILK FIBROIN HISTONE Sea urchin H2A Sea urchin H2B Sea urchin H3 Drosophila H2A Drosophila H3 GLOBIN Mouse a Human 0.2 Mouse Mouse gmaj Rabbit g Goat Goat Human ,8 Human 6 Human Human Human E

emin

FA gc

r

75

T~TTTAT (-30)

TATAAAG TATAAAG TATATAT TATTiTAAAA

(-29) (-30) ( - 31 (-30) (-29

TATAAAT TATAAAA TATAAAT

(-34 (-26 (-30

T~TAAAT T~TAAGT

C~TATAA (-29) CLTAAAC (-28) GTATATAAAGCTGAGCAGGGTCAGTTGCTTCTT GCATATAAGGTGAGGTAGGATCAGTTGCTCCTC GCKeGGCAGAGCAGGG-CAGCTGCTGGTT GCATWGGAAGAGCCGGGCCAGCTGCTGCTT GCATAAAA-GGAAGAGCCGGGCCAGCTGCTGGTT GCAT-GTCAGCGCAGAGCCATCTATTGGTT GCE'GGCAGGGCAGAGTCGACTGTTGGTT

--

GAATeGGAAGCACCCTT-CAGCAGTTCGAC

GmLeGGAAGCACCCTT-CAGCAGTTCGAC GAAXWGGCCAGACAGAG-AGGCAGCAGGAC

Fro. 3. Alignment of the 5' flanking sequences of mammalian P-like globin genes. An alignment of the sequences preceding the mRNA capping site of 10 different mammalian P-like globin genes is shown. Dashes indicate gaps introduced to achieve the most consistent alignment. Regions of sequence homology which are common to all P-globin genes sequenced to date are indicated by underlining. Similar sequences found in the 5' flanking regions of other eukaryotic genes are shown above the alignment. Numbers in parentheses give the position of the indicated bases (asterisks) in nucleotides from the mRNA capping site (where known). (Modified from Efstratiadis ef al., 1980.)

Non codinn

I

Messenger Q

globin (rabbit)

Qplob~(hUmul)

globin (mouse) @globin(rabbit) pgIobin(human)

(I

Sequence 31 banes

Initiitor AUG m ' ~ C A ~ c u c c ; u C C A ~ ~ ~ ~ c v G A ~ ~ C C A C C

38 33 54

51

globin (mouse) 50 p globin (mouae) 50 ornlbumin (chicken) 62 insulin (rat) 51 @

reovirua s 54 r e o v t ~845 reovirua 848 reovirua m 52 reovirua m 44 raorirua m 30

32 28

I9 30

VSV N

19 14 14

Vsv Ns

11

VSV L

11

TYMV genome RNA TYMV coat BMV Coat AMV coat

95 m ' G p p p C I I M U C M C U A C C M W C C A ~ c v ~ ~ C M c v ~ C U U A U CA AC ~ - ~ ~ W ~ C A C U U G C M C C ~ C G U M G A C M W G C ~ ~ G A G U M ~

T M genome STNV coat SV40 is9

m'(;pgpMUAGCMUCAGCCCCMC~G

20 10

rn'GpppGUAUUMUM&Q

m

31 68

29 239

*

c

p

p

~

A

~

M

~

~

~

~

U

A

~

C

C

A

U

m ' c p ~ A ~ ~ ~ ~ M C M W A C C M ~ C M C A A A C M c A A A ~ C A ~ A C M U U A ~ A ~ A C M W

..

m Y i p p p A W U C A G G C C ~ 46bp

ppAGUAAAGACAGGMACCVGACWMCA~G

.. C A S . . 50bp.. WGGCMmF .. sobp .. A ~ - ~ I I C U A A A A G C ! U U A ~ G

FIG.4. Nucleotide sequence of the 5' noncoding region of eukaryotic mRNAs. The AUG initiator codon and all the other AUGs are underlined. A dotted l i e denotes the region of complementarity with the 3' end of 18 S RNA proposed by Hagenbiichle er al. (1978) (seeFig. 10). References are as follows: Baralle, 1977a-c; Chang et nl., 1977; Baralle and Brownlee, 1978 (globin mRNAs); McReynolds er al., 1978 (ovalbumin mRNA); Lomedico ef nl., 1979 (rat insulin mRNAI; KO&. 1977; KO& and Shatkin, 1977a,b (reovirus mRNAs); Rose, 1978 (VSV mRNAs); Briand t=r ul., 1978 (TYMV mRNAs); Dasgupta et nl., 1975 (BMV mRNA); Koper Zworthoff er nl., I975 (AMV mRNA); Richards et al., 1978 (TMV mRNA); b u n g ernl., 1979 (STNV mRNA); Ghosh et nl., 1978a.b (SV40 mRNA). (Modified from Baralle and Brownlee, 1978, and Lewin, 1980.)

SEQUENCES IN EUKARYOTIC mRNAs

77

by the hope of finding signals for processing and modification of the mRNA and possible recognition and binding sites for ribosomes and protein factors involved in the initiation of translation. The first complete sequence of the 5' noncoding region of a cellular mRNA was elucidated only 5 years ago (Baralle, 1977a). Since then, scores of 5' noncoding regions have been sequenced either directly from the mRNA or deduced from the sequence of cloned genes. The general picture that emerges comparing cellular and viral 5' noncoding regions is that of a wide variation. The length varies from just a few nucleotides (3 for immunoglobin kappa chain (Hamlyn et al., 1981), 9 for brome mosaic virus (Dasgupta et al., 1975) to 256 for the liver a-amylase mRNA (Hagenbuchle et al., 1981) or more than 200 for the SV40 late mRNAs (Ghosh et al., 1978a,b). The extreme case in eukaryotic cells is the mitochondria1 mRNAs. Most of them have their 5' terminus directly at, or very near to the initiator AUG or AUA triplets (Montoya et al., 1981). No particular sequence appears to be universally conserved in the 5' noncoding region and the only recognizable signal features are the cap, the AUG, and perhaps a limited and somehow scattered complementarity to a region near the 3' terminus of 18 S rRNA (see below). Comparing unrelated viral and cellular mRNAs, we find a very complex picture where divergence is the rule. Figure 4 shows a selected group of such sequences. It can be seen that, although a-and Pglobins, SV40 16 S mRNA, and TYMV genome RNA show stretches of nucleotide sequences surprisingly homologous (note particularly the sequence CUUP,UG), the sequences from ovalbumin, BMV coat, VSV, and reovirus mRNAs fail to show any obvious homology with the globin mRNAs. Note that all the cellular mRNAs in Fig. 4 initiate translation at the AUG codon located nearest to the 5' end (Kozak, 1978). However, some of the viral mRNAs (like SV40 16 S mRNA and TYMV genome RNA) have AUG sequences in the 5' noncoding region. Recently, it has been shown that liver and salivary glands aamylase mRNAs also have an AUG preceding the AUG initiator codon (Hagenbuchle et al., 1981; see Fig. 7 below). If we restrict our comparison to the 5' noncoding region of a family of genes, we should have a better chance of spotting conserved sequences. Figure 5 shows an alignment of the 5' noncoding sequences of the mammalian P-like globin genes. It can be seen that there is a tendency to preserve nucleotides at certain positions and that the distance between the capping site and the initiator AUG is relatively constant (50 to 53 bp). The sequence CTTP, TG is found in 9 out of the 10 genes 7 nucleotides 3' of the capping site. The E gene presents a very similar sequence CTTCCG (Baralle et al., 1980). None of the genes contains an ATG triplet between the capping site and the initiation codon that is consistent with the proposal by Kozak (1978) that translation is initiated with the ATG closest to the 5' end of mRNA (see scanning model for initiation of protein

78 kIOUSt

Pin

nouse

PJ

Rabbit 6

coat

8

Coat 6‘

Human 6

Human b

Human ‘7

Human ‘7

Human c

FIG.5 . Alignment of the 5’ noncoding sequences of mammalian P-like globin genes. An alignment of the sequences between the mRNA capping site and the initiator ATG (underlined) of 10 different mammalian p-like globin genes is shown. Dashes indicate gaps introduced as required for alignment (see footnote to Table I). The sequence CTTPy TG common to the 5’ noncoding regions of several eukaryotic mRNAs (Baralle and Brownlee, 1978) is underlined. Positions of 100% homology are indicated by asterisks. (From Efstratiadis er al., 1980.)

synthesis below). Corrected percentage divergence values for the 5’ noncoding regions are shown in Table I. It can be seen that homologies stand above the rate of random variation.

2 . Secondary Structure of the 5’ Noncoding Regions The mRNAs are single-stranded molecules which may contain many base paired regions. Particularly specific structural features such as hairpin loops are often invoked as signals that are recognized by the appropriate factors as part of the mechanisms of processing mRNA precursors, ribosome binding, initiation of protein synthesis, ribonucleoprotein formation, etc. An extensive structural mapping of a- and P-globin mRNA molecules was carried out by Pavlakis et al. (1980).These authors used end label mRNA molecules for mapping the secondary structure of mRNA as substrates and the nucleases S 1 and T 1 as single-strand

SEQUENCES IN EUKARYOTIC mRNAs

79

probes. The results showed that homologous -As from different species have structural similarities (see Fig. 6). For example, the initiator AUG regions of the mouse and rabbit a mRNAs are not susceptible to S1 and T1 digestion, whereas the AUG regions of the respective p mRNAs are highly exposed. These results may partly explain why initiation of protein synthesis with P-globin mRNA in reticulocytes occurs at a rate 30-40% faster than with a-globin mRNA (Lodish and Jacobsen, 1972). 3 . Synthesis of the 5' Noncoding Regions The synthesis of the 5' noncoding region could be a simple sequential transcription that is continuous from the starting point up to the coding sequence (as in most cellular mRNAs), or it could be extremely complicated involving remote TABLE I CORRECTEDPERCENTAGE DIVERGENCES OF 5' NONCODING SEQUENCES OF MAMMALIAN P-LIKEGLOBINmRNAsa

mRNA pair

Percentage divergence of the 5' noncoding region

I .9 8.5 65 49 57

35 49

Mouse

P maj@min

20

"Sequence divergences for the 5' noncoding region were calculated from the alignments shown in Fig. 5. Direct alignment was carried out as follows. Sequences were first aligned in pairs. Gaps were introduced in one sequence relative to the other where necessary to accommodate length differences and to maintain alignment of homologous segments on either side of the gaps. Alternative alignments of a given sequence segment were examined to identify the most likely homolog of that segment and to minimize the number of gaps introduced. Painvise alignments were then reconciled into a single group alignment by identifying the predominant patterns of homology of the group as a whole. The alignment of each sequence was adjusted where necessary to conform to these patterns. In calculating divergences, gaps (or insertions) in one sequence relative to the other (introduced during alignment; see above) were ignored. Thus the numbers in the table refer to sequence divergence resulting from base substitution. A correction factor for multiple base change events at single sites was applied to the raw divergence values to give the percentage divergences shown in the table. From Efstratiadis er al. (1980).

80

F. E. BARALLE

A

.0C-G

6-C G-C

A

A A-U

C-G Y-G

A-U C-G

G '.

c P

G

C-G G-u ..

G

U--0 U-A-I0

uG

P n s L m C U-A ~ ~ CA

i l b l+4 l lU

U C CG A UG

A G

U

m

d -GLOBIN mRNA

-

U , GLOBIN mRNA

B

2.. d -GLOIIN M N I

FIG.6. Computer-generated secondary structure models of the 5' terminal regions of mouse ctand p-globin mRNAs (A) and rabbit a-and P-globm -As (B)using the data obtained from partial digests with S l and T1 nucleases. (From Pavlakis er al., 1980.)

SEQUENCES IN EUKARYOTIC mRNAs

81

regions in the genome that are brought together by splicing mechanisms. Several eukaryotic viruses (SV40, polyoma, adenoviruses) provide examples of splicing at the 5’ noncoding region of mRNAs. The 5’ noncoding region of adenovims late mRNAs is encoded in three regions. The first is about lo00 base pairs from the second and this one about 2800 bp from the third. The sequences are spliced together to form a noncoding tripartite 5’ leader. This leader is subsequently spliced adjacent to a coding sequence (reviewed by Ziff, 1980). Among cellular mRNAs a very interesting example of possible differences due to splicing is given by a-amylase mRNAs. The mouse liver and salivary gland aamylase mRNAs encode identical proteins but differ in the terminal portion of their 5 ’ noncoding regions. Figure 7 compares the salivary gland a-amylase mRNA sequence with its major liver counterpart. The two mRNAs possess identical coding, 3‘ noncoding regions and a portion of the 5‘ noncoding region. The 204 and 93 nucleotide 5‘ terminal coding regions share the 48 residues immediately adjacent to the coding region. This common segment (nucleotides 159-206, Fig. 7) has the intriguing feature that it begins with an AUG codon which is not used to initiate translation of a-amylase even though it is the one nearest the 5’ terminus. The first AUG is followed by a lysine codon, then the termination triplet UAA. The AUG used to initiate translation (Hagenbuchle et al., 1980) lies 14 codons downstream. We have seen previously that all the cellular mRNAs for which complete sequence information is available initiate translation at the AUG codon located nearest the 5’ end; the salivary gland and liver a-amylase mRNAs are apparent exceptions, together with some of the viral mRNAs. The first AUG in these or-amylase mRNAs may have some regulatory role. Recent analyses of genomic DNA have demonstrated that both liver and salivary gland a-amylase are specified by a single DNA sequence in the mouse haploid genome (Young et al., 1981). Four exons have been found so far which correspond, respectively, from 3’ to 5 ’ , to an internal coding region (called exon 4 here), the 5’ terminal coding region plus the 45 nucleotides of the 5’ untranslated region (exon 3), common to both mRNAs, and two alternative 5’ terminal exons-one of 161 nucleotides (exon 2), which is utilized in liver a-amylase mRNA, and one, about 2.8 kilobases further to the 5’ side in chromosomal DNA, of 50 nucleotides (exon 1) which is used for the salivary gland mRNA. The two alternative mRNAs are probably obtained by differential transcription and/or processing but these points remain to be elucidated. There are promoterlike TATAA boxes at the usual 24 (*1) nucleotides upstream from both exons 1 and 2. It is plausible, therefore (Young et al., 1981), that transcription initiates at exon 1 in the salivary gland and exon 2 in the liver. Equally, transcription could initiate at both sites and only the mRNA containing the appropriate leader might be exported to the cytoplasm in the relevant tissue. Whatever the mechanism, the uncapped liver-type leader sequence (exon 2) must presumably act as an intron in the salivary gland transcript; differential splicing must ultimately generate tissue-

82

F. E. BARALLE

FIG.7. Comparison of the nucleotide sequence of the major liver a-amylase mRNA and its salivary gland counterpart. Numbering begins with nucleotide X (which represents the few initial nucleotides that were not determined) in the liver mRNA. The two mRNAs are assumed to be capped. S and L indicate the tissue-specific salivary gland and major liver a-amylase mRNA leaders.

SEQUENCES IN EUKARYOTIC mRNAs

83

specific mRNAs with exons 1, 3, and 4 being spliced in the salivary gland and 2, 3, and 4 being spliced in the liver. C. FUNCTIONAL SIGNIFICANCE OF THE LEADER SEQUENCE

A very early step in protein synthesis is the selection by the ribosomes of the true initiator region in the mRNA. This process requires that the ribosomes should be able to differentiate the initiator AUG from any internal AUG codons that may be present. The leader sequence of the mRNA is the obvious structure that may contain signals that encode this selectivity. We will now review the many possible interactions that the “cap” and/or the 5’ noncoding region may have with initiation factors, ribosomal proteins, ribosomal RNA, initiator tRNAs, etc. during the initiation of protein synthesis. 1. Functions of the ‘ ‘Cap’’

We have seen that the cap is almost universally present in viral and cellular eukaryotic mRNAs. This wide distribution is consistent with some important functional roles. The more likely roles are (1) to protect the mRNA molecule against the action of phosphatases and nucleases that may degrade the molecule from the 5’ end, and (2) to facilitate the translation of mRNA either by helping in the ribosome binding process or by specific protein binding. It has been speculated that the cap may also have some participation in mRNA processing and transport, and that the methylation pattern of a given mRNA may also be involved in the switching on or off of the protein synthesis in the cell. There is no strong experimental evidence for these functions and we will not discuss them any further. The cap structures at the 5‘ end of mRNA have an important stabilizing effect on mRNA injected into Xenopus luevis oocytes or added to wheat germ or L cell protein-synthesizingextracts (Furuichi et al., 1977; Lockard and Lane, 1978). In all these three systems reovirus mRNAs containing m7GpppGm or GpppG at their 5’ termini are degraded more slowly than molecules bearing pppGm, pppG, or ppG ends. Degradation kinetics of molecules containing m7GpppGmor GpppG termini are identical indicating that the 5’-5‘ pyrophosphate bridge is sufficient for protection of the mRNA against nucleases. Pyrophosphatase treatment of mRNA resulted in rapid degradation of the molecule in wheat germ extracts (Shimothono et al.. 1977). There is a contradictory report that globin mRNA survives well in wheat germ after T4 polynucleotide kinase has been used to split the pyrophosphate bond (Abraham and Pihl, 1977). The presence of a terminal m7G is most likely not the only factor determining mRNA stability. Uncapped The first AUG codon is underlined; while the one actually used to initiate a-amylase synthesis is boxed, as is the terminator triplet. The predicted amino acid sequence of a-amylase is shown below the nucleotide sequence (Hagenbuchle et al., 1981).

84

F. E. BARALLE

natural mRNA molecules such as several viral RNAs are active and stable in vivo and in v i m . 5’ exonuclease protection may be achieved either by a specific conformation at the 5’ termini of the molecule or by a protein covalently bound to the RNA as in the cases of STNV and picornavimses mentioned in the section above. The facilitating role of cap in translation was first demonstrated with reovirus and VSV mRNAs (Both et al., 1975a). The importance of “caps” for translation in vivo was originally suggested by the observation that in VSV-infected BHK cells, all polysome-associated viral RNA was capped, while a portion of viral RNA that was not directing viral protein synthesis contained uncapped triphosphate 5‘ ends (Rose, 1975). In an in v i m situation the ribosomes present in wheat germ extracts showed a strong preference for capped messenger molecules when a mixture of pppGm and m7pppG ended reovirus molecules was used as mRNA (Muthukrishnan et al., 1975a). A different approach to the study of the importance of “caps” was to use m7G analogs. The compound m7GMP (7-methyguanosine 5’-monophosphate) was shown to inhibit the translation in wheatgerm extracts of all capped mRNAs and even to prevent the binding of the messenger to ribosomes (Hickey et al., 1976a,b; Shafritz et al., 1976). However uncapped natural messengers such as STNV RNA (that has 5‘ terminal ppA) or EMC RNA were not inhibited by m7GMP. It follows therefore that the dependence of eukaryotic mRNA translation in caps is neither absolute nor universal (Shatkin, 1976). Furthermore, ribosomes from different cells or species may depend in varying degrees upon the presence of the “cap” structure. In fact, reticulocyte ribosomes will translate uncapped messenger about three times more efficiently than wheatgerm ribosomes, although this may just be the consequence of the in v i m conditions, as many other unrelated parameters such as Kf concentration have different optimums for both systems. It is not clear which features of the cap are required for this process of ribosome binding. The methylation at position 7 of the G and the 5’-5’ pyrophosphate bond is essential (Both et al., 1975b). On the other hand, the methylation of the ribose moieties is not, although it may have an enhancing effect in ribosome binding to analog messengers such as m7GpppG poly(U) as shown by Both et al. (1976) and Muthukrishnan et al. (1976). The same authors have demonstrated that the 40 S ribosomal subunit binds to capped poly(U), poly(U,C), and poly(A,C) which implies that the 40 S subunit does not require very specific sequences adjacent to the cap. However, the formation of the 80 S complex occurs only with capped poly(A,U) or poly(A,U,G) which implies the need for specific sequences in this step. We can further dissect the cap-ribosome interaction looking at other possible participants in it, such as the initiation factors (for a review on initiation factors in protein synthesis, see Anderson et al., 1977; Weissbach and Ochoa, 1976) or

SEQUENCES IN EUKARYOTIC mRNAs

85

particular ribosomal proteins. Shafritz et al. (1976) have shown that a preparation of 80-90% pure reticulocyte initiation factor eW4B binds to capped histone or VSV mRNAs and this binding is specifically inhibited by the addition of the cap analog m7GMP. The same preparation showed binding also to uncapped EMC RNA but this interaction was not prevented by m7GMP. Hence, it is likely that eIF-4B recognizes the 5’ terminus and perhaps another sequence in mRNA (see below). eIF-4B is indeed required for translation of both capped and uncapped mRNA. Sonenberg et al. (1978) have shown that rabbit reticulocytes, mouse L cells, and ascites cells contain a cap binding protein (CBP) of 24,000 molecular weight that specifically recognizes the cap of several mRNAs. The CBP protein was found to be present as an impurity in the preparations of the initiation factors eIF-3 and eIF-4B (Sonenberg ef al., 1978; Bergmann ef al., 1979). The initiation factor and CBP effects apparently are the same phenomena. Sonenberg et al. (1980) have shown that preparations of eIF-3 and eIF-4B, which also contained the CBP, markedly increased translation in HeLa cell extracts of capped mRNAs, but not of naturally uncapped viral messengers. Moreover, further purification of eIF-3 resulting in the removal of the CBP diminished the ability of eIF-3 to stimulate translation of capped mRNA. Purified CBP which had no effect on uncapped STNV RNA but stimulated translation of this RNA after addition of a cap. The CBP has been shown to be the restoring factor that reverses the inhibition of capped mRNA translation in poliovirus-infected cells (Rose et al., 1978; Sonenberg et al., 1979; Trachsel et al., 1980). Poliovirus might inhibit cellular protein synthesis by inactivation of some crucial property of the CBP. The mechanism of action of the CBP was recently studied using a monoclonal antibody directed against the 24,000 CBP and related proteins (Sonenberg et al., 1981). The antibody inhibited the translation of folded, capped eukaryotic mRNAs to a far greater extent than the translation of uncapped mRNAs or native capped mRNAs that do not possess extensive 5’ end secondary structure. It is possible that cap binding proteins might facilitate mRNA ribosomal interactions by unwinding the 5’ terminal secondary structure of eukaryotic mRNAs. Another protein that binds the methylated oligonucleotidem7GpppGpC (a cap analog) was identified in a high salt wash of Arremia salina ribosomes (Filipowicz et al., 1976). As indicated by competition assays, this protein also forms a complex with capped mRNAs. The Arfemia protein apparently does not correspond to one of the known initiation factors from rabbit reticulocytes since these factors do not form a stable complex with m7GpppGpC. However, the binding properties of this protein are not completely specific because it can also interact with GTP. Further studies are necessary to confirm a specific cap binding function. Analogs of the cap also inhibit binding of mRNA and of Met-tRNA, to eIF-2 and addition of eIF-2 relieves the cap analog-induced inhibition of transla-

86

F. E. BARALLE

tion (Kaempfer et al., 1978). However, several lines of evidence indicate that the binding of mRNA to ;IF-2 is primarily to an internal sequence and only secondarily through the cap (see below). An alternative way to study cap-protein interactions is to render the cap chemically reactive by periodate oxidation. This modification does not affect the ability of the mRNA to form the initiation complex while making it possible for the “cap” to react chemically by addition of a reducing agent with neighboring amino acids resulting in cross linking of the cap and the proteins in close contact with it. These experiments permitted us to identify in a wheat germ extract three polypeptides of molecular weight 135,000, 93,000, and 26,000 and in a reticulocyte lysate two polypeptides of molecular weight 160,000 and 35,000 that crosslink to the periodate-oxidized 5’ terminus of reovirus mRNA (Sonenberg and Shatkin, 1977). Crosslinking of all proteins depends on the formation of an initiation complex. The same approach has been used to see whether purified initiation factors can bind to reactive caps. The 24,000 MW CBP protein (see above) present mainly in the eIF-3 factor preparations and to lesser extent in eIF-4B preparations also crosslinks with the cap. It is difficult to define precisely, on the basis of the experiments described, the protein factors involved in cap recognition. Some preparations may contain upto-now undetected contaminants of the CBP type. However, it seems likely that specific cap binding proteins (Sonenberg, 1981) and perhaps one or more of the initiation factors may be needed. The participation of other proteins (i.e., ribosomal proteins) is not strongly established but cannot be ruled out. 2 . Functions of the 5’ Noncoding Region The mRNA sequences that interact during the initiation of translation with the ribosomes and initiation factors not only include the cap but also the 5’ noncoding region and part of the coding region. The ribosome binding site on the mRNA was defined by studying the ribonuclease-resistant fragments of the molecule after formation of the 40 S subunit mRNA complex or with the complete 80 S ribosome. The 80 S ribosome covers a region of about 30-40 nucleotides with the initiator AUG occupying a central position in most cases. The 40 S subunit by itself covers a longer stretch of sequence, the extra bases being mainly toward the 5’ end of the messenger molecule. Given the variable distance between the “cap” and the initiator AUG (see Fig. 4), the former is not always contained in the ribosome-protected fragment. The cap may be involved in an initial recognition of the ribosome but the interaction may not necessarily be preserved at a second stage of the initiation complex formation (Legon, 1976; Kozak and Shatkin, 1977a,b; Rose, 1978). Kozak and Shatkin (1978a), in a series of very elegant experiments, identified the features of the 5‘ terminal fragments from reovirus mRNA which were important for ribosome binding. They first isolated the fragments of messenger

SEQUENCES IN EUKARYOTIC mRNAs

87

protected in the 40 S and 80 S initiation complexes and tested their ability to rebind to the ribosomes. The 80 S-protected fragments showed considerably lower binding ability, implying that the “extra” sequences protected by 40 S initiation complexes contribute to ribosome attachment. Nevertheless, wheat germ ribosomes select the same 5’ terminal initiation site in each reovirus mRNA, irrespective of the presence or absence of m7G on the message. This was demonstrated by comparing fingerprints of the ribosome-protected regions obtained with methylated versus unmethylated RNA. The contribution of m7G to formation of initiation complexes is therefore quantitative rather than qualitative. Limited TI RNase digestion of isolated 5’ terminal fragments from several reovirus messages generated a series of smaller fragments which were analyzed for ability to rebind to ribosomes. Partial digestion products up to 30 nucleotides in length which retained the 5’ cap but not the AUG codon were unable to associate stably with ribosomes, whereas every AUG-containing fragment that was analyzed was able to form initiation complexes. The efficiency of binding of certain AUG-containing fragments, however, was reduced by removal of either the 5’ terminal region, including the cap, or of sequences comprising the beginning of the coding region, on the 3‘ side of the AUG. Complex formation between messenger RNA and ribosomes was inhibited by the trinucleotide AUG, but not by various other oligonucleotides. Although the inhibition was specific, a vast excess of trinucleotide was required for moderate inhibition of 80 S complex formation, and the same concentration of AUG failed to inhibit formation of 40 S initiation complexes. This suggests that the AUG initiator codon and the cap are essential features for the formation of the initiation complex. The 5’ noncoding region, although apparently not essential for the formation of the initiation comlexes, may have a role in enhancing or stabilizing the multiple interactions with the ribosome and initiation factors. We shall now discuss the possible protein RNA and RNA : RNA interactions that may involve the 5’ noncoding region. a. Protein :RNA Interaction. A large number of studies have shown that many initiator factors bind to mRNA. We have already seen that a 24,000 MW polypeptide CBP that was found copurifying with eIF-4B and eIF-3 initiation factor binds specifically to capped mRNAs. There are also examples of protein factors binding specifically to internal segments of the mRNA. It should be clear that the differential requirement for initiation factors is only quantitative. All of them are needed in natural mRNA translation. One of the first initiation factors shown to be preferentially needed for some mRNA was the eIF-4A. Many picornavirus and in particular EMC need larger amounts of eIF-4A than globin mRNA (Blair et a l . , 1977). Furthermore, P-globin mRNA was shown to have higher affinity for eIF-4A than a-globin and increasing the concentration of eIF-4A reduced the difference in translational ability of a and P-globin mRNA. A similar situation is found for eIF-4B (Kabat and Chappell, 1977). Kaempfer et

88

globin cDNA

gglobin cU4A in the presence of eIF-4A

F. E. BARALLE

3‘

5‘

3,

FIG. 8. Synthesis of rabbit f3-globin cDNA in the presence of eIF-4A. Solid underline shows the primer sequence; dashed underline the area where cDNA synthesis stops if eIF-4A is present.

al. (1978) found evidence that the initiation factor eIF-2 which forms a ternary complex with the initiation Met-tRNA, and GTP and promotes binding of Met tRNA, to the 40 S ribosomal subunit also binds to the mRNA. It is proposed that apart from the site for Met-tRNA, binding, eIF-2 has also two mRNA binding sites, one internal and the other involving the m7G “cap.” The internal binding site in the globin mRNA has not been defined at the precise sequence level, although the specificity of binding of eIF-2 to mRNA was shown by the finding that all mRNA species possess a high affinity binding site for eIF-2 including mRNA species lacking the 5’ terminal “cap” of 3’ terminal poly(A) moieties, while RNA species not serving as mRNA, such as negative strand RNA, tRNA, or rRNA, do not possess such a site. Recently eIF-2 was shown to bind specifically to satellite tobacco necrosis virus RNA at the 5’ terminal 44 nucleotide sequence that comprises the ribosome binding site (Kaempfer et al., 1981). In our laboratory (F. E. Baralle, unpublished results), in parallel with the early structural studies on the 5’ noncoding region of a-and P-globin mRNAs, we tried a very simple method of testing initiation factor binding to them. A cDNA of the 5’ noncoding region was synthesized starting with an oligonucleotide primer specific for the region around the AUG initiation codon (Fig. 8). This reaction will produce full length 5’ noncoding region cDNA as can be seen in Fig. 9, lane 3. If the reaction is carried out in the presence of purified initiation factors and any of them binds specifically to mRNA, the cDNA synthesis may be interrupted when the reverse transcriptase finds the template cover by the initiation factor (see diagram Fig. 8). The initiation factors eIF-4B, eIF-4D, eIF-4C, ~~

FIG. 9. Autoradiograph of a 12%acrylamide gel fractionation of globin cDNAs. The cDNA was synthesized in vitro with AMV reverse transcriptase using as template a mixture of a- and f3(predominantly) globin mRNA preparation and the synthetic oligonucleotide primer d(GCACCA) (Baralle, 1977a). Lane 3 shows a normal cDNA synthesis; a and P denote the respective full length cDNA; lane 2 is a cDNA synthesis carried out in the presence of denatured initiation factor eIF-4A and lane 1 is a cDNA synthesis carried out in the presence of eIF-4A. Bands a, b, and c were eluted and depurinated (Ling, 1972). They were shown to be shorter versions of the P-globin cDNA (see Fig. 8) (F. E. Baralle, unpublished results).

SEQUENCES IN EUKARYOTIC mRNAs

89

90

F. E. BARALLE

eIF-2A, eIF-5, eIF-3, eIF-2, and eIF-4A (kindly supplied by Dr. W. Memck, N.I.H.) were tried. Only the initiation factors eIF-4A and eIF-4B altered the pattern of the products synthesized. The eIF-4A. particularly, showed clear evidence of binding. A set of new bands appeared (Fig. 9, lane 1). The bands marked a, b, and c were characterized by depurination (Baralle, 1977a; Ling, 1972) and shown to be shorter versions of the P band. This suggests that the transcription stops 15 k 2 nucleotides before the cap, just before the highly conserved segment CUUCUG in a- and P-globin mRNAs (see Figs. 4 and 5). There is an obvious lack of uniformity in the way protein-mRNA interactions are studied. Many conflicting results may just be the consequence of the use of different assays, reaction conditions, and initiation factors of different purity. There is not as yet a definitive answer to the question of which initiation factor interacts specifically with mRNA in vivo and if this interaction serves to modulate mRNA translation. b. RNA :RNA Interactions. The mechanism of specific ribosome binding to the mRNA in prokaryotes is mediated in part by interaction of the 5’ noncoding region of the messenger with the 3’ terminus of 16 S ribosomal RNA (Shine and Dalgarno, 1975; Steitz and Jakes, 1975). A comparison of the corresponding region of bacterial 16 S rRNA and eukaryotic 18 S rRNA (Hagenbuchle et al., 1978) shows that both sequences are related but, strikingly, the 5 bases that provide most of the interaction in bacteria have been deleted (see Fig. 10). As can be seen in Fig. 4, the polypurine tract of eukaryotic 18 S rRNA shows short stretches of Complementarity with the 5’ noncoding region of a number of eukaryotic mRNAs. In some cases the complementarity is striking, with calculated stabilities for the potential mRNA-rRNA base paired structures in the same range as prokaryotic initiator regions (Ziff and Evans, 1978; Azad and Deacon, 1979; Tsujimoto and Suzuki, 1979). Furthermore, in polyoma virus mRNA the 5’ leader contains multiple copies of such a sequence (Legon, 1979). It should be noticed though that the location of the potential base pairing with respect to both the 5‘ terminal cap and the initiator AUG codon is quite variable. In some mRNAs (e.g., reovirus), it is quite close to the initiation codon, in others (histone, human P-globin), it is so far from it that it is difficult to envisage how 18 S rRNA and initiator tRNA which are at a fixed distance on the ribosome can

Bacterial

5’-

-

Higher 5’- - A Eukaryotes

~

~ CCUGCGGUUGGAUCACCUCCUUA-OH “ 2 3’

M e z Me2

A

CCUGCGGAAGGAUCAWA-OH

3’

FIG. 10. The 3’ terminal sequences of 18 S rRNA in higher eukaryotes and 16 S rRNA in bacteria. The sequences proposed as the complements to the mRNAs initiation regions are underlined. Note that the eukaryotic sequence can be derived from the bacterial by deleting the underlined CCUCC bases and by 2 base substitutions.

SEQUENCES IN EUKARYOTIC mRNAs

91

anneal simultaneously to these sequences. There is the possibility that the leader sequence is folded or forming a loop when the ribosome binding occurred (see above). This would imply a shorter than expected distance between potential base pairing regions and the AUG. However, the CUUCUG base pairing region in globin mRNAs appears to be commonly involved in the stem of a hairpin loop in the secondary structures of the 5' terminal regions (see Fig. 6). In other functional eukaryotic mRNAs, including species of reovirus (Kozak, 1977) and VSV mRNA (Rose, 1978), the potential for stable base pairing between 5' ends and 18 S rRNA 3'-termini is absent (Fig. 4), indicating that this type of base pairing is not obligatory for eukaryotic protein synthesis. The observation that the translation of prokaryotic virus mRNAs which do not possess an adequate complement to eukaryotic 18 S RNA in wheat germ extract is strongly enhanced after enzymatic addition of a 5' cap supports this conclusion (Rosenberg and Peterson, 1979). On the other hand, there is evidence of physical proximity of the 5' region of mRNA and 18 S rRNA in eukaryotic initiation complexes. Nakashima et al. (1980) covalently linked mRNA present in eukaryotic 40 S and 80 S initiation complexes to 18 S rRNA by photoreduction with a 4' substituted psorolen, an RNA crosslinking agent. These experiments showed that the opposite ends of mRNA and 18 S rRNA are proximally located at least in some initiation complexes. It is important to emphasize that although initiation-dependent interactions such as base pairing between mRNA 5' terminal regions and 18 S rRNA are detected by crosslinking, their functional role, if any, in eukaryotic protein synthesis remains to be established.

3. The Scanning Model for Initiation of Protein Synthesis Kozak in 1978 proposed a model for initiation of translation in eukaryotic cells. She describes her hypothesis as follows: The 40 S ribosomal subunit binds first near the 5' end of the mRNA molecule irrespective of the sequence of that region (see Fig. 11). Subsequently the 40 S subunit advances until it encounters the first AUG triplet, at which point the 40 S ribosome halts and the 60 S subunit joins. Recognition of the AUG codon as a stop signal may involve base pairing with the anticodon of Met-tRNA, which is bound to the 40 S complex prior to messenger attachment (Hunter et al., 1977). The model postulates that the ribosomes recognize not the cap but the 5' end of the message. The m7G moiety enhances the efficiency, often dramatically, although even in its absence, the ribosome still binds to the uncapped terminus of mRNA. This critical requirement for a 5' terminus is unambiguously demonstrated by the fact that circularization of the mRNA molecule completely abolishes ribosome binding (Kozak, 1979). The binding of eukaryotic ribosomes to mRNA is apparently at least a two-step process. Ahlquist et al. (1979) observed that when translational elongation is blocked BMV RNA can bind two 80 S ribosomes. One binds at the first

92

F. E. BARALLE

Step 1 :

40s Ribosome binds near 5' end of message

AUG Step 2 :

3'

405 Ribosome advances toward 3' end of message,

stopping when it encounters the first AUG triplet AUG 8

Step 3 :

p4-Gq

3'

60s subunit joins

Fic. 1 I . Diagram of a scanning mechanism by which eukaryotic ribosomes may select the site for initiation of translation. The black dot represents the 5' terminus of the mRNA and IF represents initiation factors associated with the 40 S ribosomal subunit. The same initiation events are postulated to occur in the presence and absence of a methylated cap, but with most messages the efficiency is increased by m7G (Kozak,1978).

AUG codon and the other binds nearer the 5' end at an entry or holding site. This result is in agreement with the scanning model if we accept Kozak's (1980a) suggestion that the observation of 80 S ribosomes instead of 40 S subunits (as predicted by the scanning model) is an artifact that occurred because 60 S subunits are binding to stalled 40 S subunits. After the initial binding, the 40 S subunit must slide along the mRNA chain to the initiator AUG. The ability of the 40 S ribosome to perform this movement has been proved (Kozak and Shatkin, 1978b) and there is strong evidence that this movement is ATP dependent (Kozak, 1980b). If the secondary structure of mRNA is destroyed or weakened by treatment with bisulfite (Kozak, 1980c) or by substituting the guanosine residues (including the m7G cap) by inosine (Morgan and Shatkin, 1980), the 40 S subunits will still bind to the 5' end of mRNA but fail to stop at the 5' proximal initiation site. Instead they extensively migrated beyond the 5' region of the messenger allowing other ribosomes to attach sequentially and scan or to form polysomes even in the presence of sparsomycin. The diminished dependence of denatured RNAs on the m7G cap and on ATP hydrolysis for ribosome attachment suggests that an early step in initiation may be an unfolding of the mRNA 5' terminal region, i.e., the ribosome binding site, possibly mediated by an ATPdependent activity of a cap binding protein (see above, Sonenberg et al., 1981). The failure of the 40 S ribosomal subunit to recognize the proper initiator AUG when the mRNA is denatured strongly suggests that the secondary structure in and around the AUG initiator codon could also be a factor in the selection of mRNA initiation sites by ribosomes. Besides providing an explanation for the modulation of mRNA translational efficiency, such a hypothesis could also explain why some eukaryotic mRNAs such as SV40 16 S mRNA (Ghosh et af., 1978a,b), Sindbis virus mRNA (Hefti et al., 1976), TYMV genomic mRNA

SEQUENCES IN EUKARYOTIC rnRNAs

93

(Briand et af., 1978), liver, and salivary gland a-amylase mRNA (Hagenbuchle et af., 1981) contain more than one AUG codon in the 5' noncoding regions and apparently contradict the scanning model not using the 5' proximal AUG for initiation. Secondary structure may then be responsible for initiation at an internal site without violating the basic idea of the scanning model mechanism. Sherman et af. (1980) provided very elegant genetic evidence for this model. They constructed several mutants of the yeast is0 I-cytochrome c gene varying the initiator AUG position. Their results showed unequivocally that for this gene there was no absolute requirement for a particular sequence 5' to the initiation codon. Translation started always at the AUG closest to the 5' end of the mRNA. An especial case that we should mention here is the mitochondria1 mRNAs. They are, at least in HeLa cells (Grohmann et af., 1978) not capped and the initiator codon is as we have already seen in the 5' terminal or subterminal position. This may eliminate the need for an extensive scanning process, ribosomes may attach to the 5' terminus, and either directly or after a fine adjustment may recognize the initiator codon (Montoya et al., 1981). The 5' noncoding region function is still unclear. There is very good evidence for the involvement of the 5' terminus in initial ribosome binding, and perhaps the 5' noncoding region only has an auxiliary role. Its structure may contain features such as base composition, length, ribosomal RNA complementary sequences, protein binding sequences, etc., that may modulate the messenger function conferring quantitative differences in the relative translativity of different mRNAs [as has been postulated for salivary gland and liver a-amylase mRNAs (Hagenbuchle et af., 198l)]. Furthermore, distinct 5' noncoding region might also specify different lifetimes for diverse messenger molecules.

111. The Trailer Sequence

A. THE3' NONCODINGREGION The 3' noncoding region extends from the termination codon to the poly(A) addition site. While the early studies on the primary structure of the 5' noncoding region centered on the search for signals relevant to the initiation of protein synthesis, there was no obvious function for the 3' noncoding region. Its length varies widely in the eukaryotic cellular mRNAs studied up to now. In chicken ovalbumin a 637-nucleotide-long noncoding region follows the coded messenger (McReynolds et af., 1978), while the 3' noncoding region of mouse a-amylase mRNAs is only 30 nucleotides long-that is, considerably shorter than its 5' counterpart (Hagenbuchle et af., 1981). A similar variation is observed in viral mRNAs. As in the case of the 5' noncoding region of a-amylase mRNAs, there is heterogeneity in the length of the 3' noncoding region of given cellular

FIG. 12. Alignment of the 3' noncoding sequences of mammalian P-like globin genes. An alignment of the sequences between the termination codon and the p l y ( A ) addition site of eight mammalian P-like genes is shown. Due to the high degree of sequence divergence in this region, the alignment should be considered as representative of a number of equally consistent alignments. The sequence AATAAA, which is common to polyadenylated mRNAs (Proudfoot and Brownlee, 1976), is underlined. Dashes indicate gaps introduced as required for alignment. Similarly, nucleotides shown above a given sequence were displaced to achieve the most consistent alignment of the sequences on either side. Termination codons are indicated by a dotted line. (From Efstratiadis et a/.. 1980.)

SEQUENCES IN EUKARYOTIC mRNAs

95

mRNAs. The DHF reductase in mouse cells is coded by at least four distinct mRNAs ranging in size from 750 to 1600 nucleotides. All four are polyadenylated and polysomal, and can be translated in vitro to produce a 21,000 MW protein comigrating with purified dihydrofolate reductase on SDS-polyacrylamide gels. The only apparent difference in these RNAs is the length of 3' untranslated regions, varying from about 80 nucleotides in the smallest mRNA to about 930 nucleotides in the largest (Nunberg et al., 1980; Setzer el al., 1980). The nucleotide sequence of the 3' noncoding regions of different eukaryotic mRNAs shows very little homology with the exception of short segments in the region near the poly(A) addition sites. We shall now compare the 3' noncoding regions of a family of related genes (the mammalian P-like globin) and will discuss their similarities and differences with unrelated mRNAs. Figure 12 shows an alignment of the 3' noncoding regions [termination codon to the poly(A) addition site] of the human P-like globin genes and the rabbit p and mouse Pmuj and pmingenes. The site of poly(A) addition has been determined only for the human P (Proudfoot, 1977) and y (Poon et al., 1978) genes and the rabbit p gene (Proudfoot, 1977). With the exception of the region near the poly(A) addition sites, there is very little homology among the different 3' noncoding sequences (Table 11). Even the very closely related Gy and A~ genes differ by 7% in the 3' noncoding region. The hexanucleotide AAUAAA, thought to play a role in processing and/or polyadenylation of mRNA molecules, was first noted by Proudfoot and Brownlee in 1976. It precedes by 1 1 to 30 bases the poly(A) addition site in most TABLE I1 CORRECTED PERCENTAGE DIVERGENCES OF 3' NONCODINC SEQUENCES OF MAMMALIAN P-LIKEGLOBINmRNAs0

mRNA pair

Percentage divergence of the 3' noncoding region

7.0 59 71

68 86 57 65

Mouse pmajjpmin

36

4equence divergences for the 3' noncoding region were calculated from the alignments shown in Fig. 12. The calculations and alignments were as described in the footnote to Table I.

96

F. E. BARALLE

eukaryotic mRNAs including all the P-like globin genes of Fig. 12. Exceptions to this rule have been found in several viruses (Porter et al., 1978). Variants of this sequence have recently been found. The sequence AAUUAAA precedes the poly(A) addition site in rat amylase and anglerfish somatostatin mRNAs (McDonald et al., 1980; Hobart et al., 1980). The sequence AUUAAA has been reported in some leukocyte interferon mRNAs (Goeddel et al., 1981). Finally, although normal dihydrofolate reductase (DHFR) mRNA contains the sequence AAUAAA near its 3' end, there exists a shorter form of the DHFR mRNA which has the sequence AUAA in the analogous position (Nunberg er al., 1980). The sequences on either side of the AATAAA hexanucleotide are homologous in all the P-like genes of Fig. 12 except that in the y-globin genes, part of this region has been deleted. These homologies are not shared with other eukaryotic genes. In making the alignments of Fig. 12, it is assumed that there is a large deletion near the center of the 3' noncoding regions of the human y genes and a different large deletion in the rabbit P-globin gene. Several smaller deletions (or insertions) are also indicated. The occurrence of sizable deletions or insertions during evolution of these genes suggests that the particular sequences which comprise the 3' noncoding regions are not essential to mRNA function (see below). The sequences immediately adjacent to the poly(A) addition site are relatively conserved among adult P-like genes. This homology is not present in the human y- and eglobin genes, although they do appear in certain other eukaryotic genes

5'

5' 5' 5' 5' 5' 5' 5'

5'

M

T

P

l

l

*

T

G

4

..

P

3'

Adenovirus-2 Earl:< Eg

FIG. 13. Comparison of the 3' noncoding region and its flanking sequences in various genes. Asterisks denote the last nucleotide of the 3' noncoding region. The precise end of the histone HI messenger is unknown. The sequence homologies are boxed. The common sequence AATAAA (AAUAAA in the mRNA) is underlined. (From Benoist era/.. 1980.) The references are as follows: (1) Konkel e t a / . . 1978; (2) Van Ooyen et a / . , 1979; (3) Reddy e? al., 1979; (4) Busslinger er a/.. 1979; (5) Bernard era/., 1977; (6) Pemcaudet et al., 1979; (7) Benoist er al., 1980; (8) Reddy ef al., 1978; and (9) Alestrom et al., 1980.

97

SEQUENCES IN EUKARYOTIC mRNAs

such as SV40 early mRNA, immunoglobulin light chain messengers, etc. (Benoist et d . , 1980). As can be seen in Fig. 13, the homology is particularly striking for SV40 early mRNA and mouse P-globin mRNA where 9 out of the 10 nucleotides preceding the poly(A) tail are identical, but it also extends to rabbit and human P-globin messengers, and an immunoglobulin light chain messenger. This is illustrated in Fig. 13 by boxes, and a consensus sequence is presented from which the boxed sequences may be derived by at most two changes. No consensus sequence is found at the 3' terminal of SV40 late mRNAs, two adenovirus early mRNAs, rabbit or human a-globin mRNA, ovalbumin mRNA, silk fibroin mRNA, or mouse dihydrofolate reductase mRNA. However, a related sequence is found in the immediate 3' flanking region of ovalbumin mRNA and an early adenovirus mRNA. The actual sequences found are very close to those found at the 3' end of the immunoglobulin mRNA: 9 out of 10 nucleotides are the same for the ovalbumin case, 7 out of 10 for the adenovirus case. B. THEPoLY(A) TAIL Most eukaryotic mRNAs contain a sequence of polyadenylic acid attached to their 3' end. In mammalian cells, up to 200 adenosine residues can be found, but shorter poly(A) tails have been found to be typical of other organisms and of mammalian mitochondria1 mRNAs. The length of the poly(A) decreases with the age of its messenger. The reduction in length has been characterized for globin messengers in both mouse and rabbit cells. When newly synthesized globin mRNA is obtained from young erythroid cells, its poly(A) segment is about 150 nucleotides in length. In mature cells, however, shorter poly(A) segments are present on the globin mRNA, corresponding to discrete size classes of roughly 100, 60, and 40 bases (Gorski et al., 1974; Merkel et al., 1975; Nokin et al., 1976). The rate at which poly(A) is shortened is not constant for all messengers; for two adenovirus mRNAs that turn over relatively rapidly in rat cells, the poly(A) is shortened at rates somewhat faster than that of the bulk cellular message population (Wilson et af.,1978). It has been suggested that the shortening may occur in discrete steps. Not all cellular or viral mRNAs are polyadenylated; up to 30% of mRNAs in polysomes lack poly(A). Among these, the most prominent ones are the histone mRNAs. The rest of the poly(A) mRNAs appear to be a subset of the sequences present in the poly(A)+ preparation. Analysis of the in v i m translation products obtained from poly(A) and poly(A)- messenger populations showed that most of the proteins coded by poly(A) - mRNA also are made by poly(A) mRNA. The discovery of poly(A) tails in eukaryotic mRNA made it possible to design several methods for the rapid separation of mRNA from other RNAs by affinity chromatography using poly(U)-sepharose or oligo(dT)-cellulose. +

+

98

F. E. BARALLE

C. SYNTHESIS OF THE TRAILER REGION The mRNAs trailer region is constituted by the 3' noncoding region that is transcribed from the genomic DNA and by the poly(A) tail that is a posttranscriptional modification (Brawerman, 1974). The polyadenylation occurs mainly in the nucleus and is a step-wise process mediated by a poly(A) polymerase activity that adds one adenylic acid residue at a time to nuclear RNA after transcription (for a review see Lewin, 1980). Possibly not all mRNAs are polyadenylated by the same mechanisms. In some cases (like the chicken ovalbumin) transcription does not appear to go beyond the 3' end of the gene (Roop et al., 1980) and it has been suggested that for this mRNA transcription terminates near the poly(A) site. A poly(A) segment could be added directly to the 3' end of this transcript. In contrast to transcription of the ovalbumin gene, there is good evidence that transcription proceeds well beyond the 3' end of the SV40 late mRNAs (Ford and Hsu, 1978; Lai et al., 1978), adenovirus type 2 late mRNAs (Nevins and Darnell, 1978), adenovirus early region 2 and early region 4 mRNAs (Nevins er al., 1980), and the mouse p-major globin mRNA (Hofer and Darnell, 1981). Polyadenylation of these mRNAs presumably involves two steps: cleavage and poly(A) addition. Adenovirus late transcripts are cleaved and polyadenylated soon after the RNA polymerase passes the poly(A) site, before the primary transcript is completed (Nevins and Darnell, 1978). A free 3' end probably would not be available for exonucleolytic attack. It is probable, therefore, that the transcript is cleaved by an endonuclease, and not a 3' exonuclease. The sites for this process must be indicated in the structure of the nucleic acid. As we have seen, the main unifying feature of the 3' terminal regions of eukaryotic mRNAs is the sequence AAUAAA. No secondary structure feature is evident in the 3' end of most eukaryotic mRNAs although some hairpin loop structures could be postulated. Fitzgerald and Shenk (1981) have constructed deletion mutants of SV40 where the region around the AAUAAA site of SV40 late mRNAs was modified. One class of mutants lacking 3 to 14 bases between the AAUAAA and the normal poly(A) addition site produces mRNAs polyadenylated at new sites downstream from the wild-type site (see Fig. 14). The poly(A) site is moved

*

W.t

AATAAACAAGTTAACAACAACAATTGCATTCATTTT

1455

AATAAACA-------------- ATTGCATTCATTTT

*

FIG. 14. Nucleotide sequence at the 3' ends of wild-type and deletion mutants 1452 and 1455 SV40 late mRNAs. The AATAAA sequence (AAUAAA in the mRNA) is on the left-hand side of the figure. The gaps show the size of the deletions and poly(A) addition sites are indicated by an asterisk.

SEQUENCES IN EUKARYOTIC mRNAs

99

farther downstream as the deletions become larger; as a result, polyadenylation always occurs within an 11-19 nucleotide range from the AAUAAA sequence. Another class of mutants lacks segments 12 to 30 nucleotides between the AAUAAA sequence and the coding region of the mRNA. The poly(A) site for only one of these mutants was studied (missing 12 bp). In this case, the spatial relationship between AAUAAA and the poly(A) site is altered, producing a class of mRNAs polyadenylated at the first CA following the AAUAAA sequence, as well as other mRNAs polyadenylated farther downstream. Finally, a 16-bp deletion that includes the AAUAAA sequence prevents poly(A) addition. These experiments strongly point at the sequence AAUAAA as part of the recognition site for polyadenylation. It is also obvious that this sequence may not be all the recognition site or that a different polyadenylation mechanism may exist. The four different length DHF reductase mRNAs mentioned above (Nunberg et a / . , 1980) are all polyadenylated but it is clear that to generate the longer version three poly(A) addition sites have to be ignored. It is known that the shortest mRNA contains the tetranucleotide AAUA located roughly in the same position than the AAUAAA in the longest one. Sequence data on the two intermediate long mRNAs will be available soon, so the structure of the poly(A) addition site can be compared. The tumor viruses SV40, polyoma, and adenovirus present an analogous situation. In adenovirus late genes, there are five 3' acceptor sequences that generate mRNAs differing in their 3' end. All the acceptor sites contain the hexanucleotide AAUAAA and the poly(A) is added to the nascent mRNA before splicing of the intron occurs (for a review, see Ziff, 1980). Although only approximately one-fifth of the RNA mass reachcs the cytoplasm (Nevins and Darnell, 1978; Flint and Sharp, 1976), polyadenylated sequences are transported almost quantitatively. This implies that there are no nonproductive polyadenylation events, and that only one poly(A) tract is added per late transcript although all five potential acceptors are transcribed. Thus polymerases can evidently traverse one poly(A) site nonproductively, utilize a second downstream site, and avoid nonproductive polyadenylation at the remaining positions, although they are transcribed and the acceptor is a nascent RNA. This suggests that the transcription complex actively prevents nonproductive poly(A) addition, possibly through a regulated commitment of the polyadenylation machinery to one of the poly(A) receptors to the exclusion of the other four, at the time of initiation (Nevins and Darnell, 1978). Alternatively, the virus may have evolved a gradient of poly(A) site efficiencies which counterbalances map positions and ensures that each poly(A) site is used with approximately equal efficiency (Ziff, 1980). In this context we shall recall our attention to the variants in the AAUAAA sequence already reported (see above). They may have a differential affinity for the enzymes involved in the poly(A) addition process. In the case of the sequence AUUAAA found in interferon cDNA, it is interesting to note that the more

100

F. E. BARALLE

abundant species have the shortest 3’ noncoding sequences and possess the canonical hexanucleotide at the same position (Goeddel et al., 1981). Finally, we must consider the examples of polyadenylated mRNAs that completely lack the AAUAAA sequences. This is the case of some picomaviruses such as foot and mouth disease virus (FMDV) and poliovirus type I (Porter et al., 1978). This makes it necessary to accept that AAUAAA may not be a universal signal for polyadenylation but alternative mechanisms may also be at work.

D. FUNCTIONAL SIGNIFICANCE OF THE TRAILER SEQUENCE The 3’ noncoding region and the poly(A) tail of eukaryotic mRNA do not appear to have an important role in the biological function of the mRNA. The sequence comparison studies already suggested that the particular sequences which comprise the 3’ noncoding regions are not essential for mRNA function. Consistent with this idea are experimental results showing that the elimination of the 3’ noncoding region of rabbit P-globin mRNA does not abolish in vitro translation (Kronenberg et al., 1979). Furthermore, Setzer et al. (1980) were unable to find any functional difference in the four polysomal DHFR mRNAs already mentioned. They appear to produce identical proteins and their relative proportions are constant at various points in cellular growth and they are of roughly equal stability. It seems likely that redundant polyadenylation and/or transcription termination signals exist at the 3’ end of the DHFR gene as seen in the tumor viruses and may be recognized with varying degrees of efficiency, giving rise to multiple transcription products that are ultimately processed to produce the mRNAs described above. Hence most of the 3’ untranslated region in the longer messengers does not significantly affect the translational function of these RNAs, at least when the length of the 3‘ untranslated region does not exceed certain limits. Another situation that shows the neutrality of the 3’ noncoding region in translation can be seen when the termination codon mutates to a sense codon. For example, the human hemaglobin “Constant Spring” arises by such a mutation UAA + CAA (Clegg ef al., 1971; Proudfoot and Longley, 1976). This produces the ribosome to read 93 nucleotides of the 3‘ noncoding region as coding, producing a 3 1 amino acids longer a-globin chain, illustrating the fact that to the ribosome the length of these regions is irrelevant. It has been suggested that the 3’ noncoding region and the poly(A) tail may have a role in nuclear processing of mRNA precursor and/or transport between the nucleus and the cytoplasm. Certainly a series of proteins is associated with mRNA and its nuclear precursor. Although different mRNAs may be associated with different proteins in almost all the messenger ribonucleoprotein (mRNP) preparations, there are two proteins of about the same size, comparable to the ones found associated with globin mRNAs (molecular weight 52,000 and

SEQUENCES IN EUKARYOTIC mRNAs

101

78,000). There is no good evidence of sequence or region specificity. However, it is generally agreed that the 78,000 MW protein complexed with mRNA in polyribosomes of avian and mammalian cells is associated mainly with the poly(A) tail (Blobel, 1973). This protein is the best characterized of the mRNAassociated proteins but its function is still unclear although there has been a report (Rose et al., 1979) that it is antigenically related to poly(A) polymerase. Recent crosslinking experiments (Setyono and Greenberg, 1981) showed that proteins associated with poly(A) and other regions of mRNA (contrary to what was originally thought) are different in the nucleus and in the cytoplasm suggesting that newly synthesized mRNA molecules when transported to the cytoplasm lose the proteins with which they were associated in the nucleus and become associated with a new set of proteins derived from the cytoplasm, the main one of this being the 78,000 MW protein associated with the poly(A) tail. The poly(A) does have a role in promoting mRNA stability. When globin mRNA is microinjected into living Xenopus oocytes, it is translated into globin. Fully adenylated globin mRNA is very stable in occytes, as shown by the fact that it is translated continuously for up to 2 weeks after injection, a period during which each globin mRNA molecule can produce 100,000 protein molecules (Gurdon et al., 1973). It has been found that if the poly(A) segment is removed from globin mRNA (using the enzyme polynucleotide phosphorylase, which degrades RNA from the 3’ end), the half-life of the mRNA in oocytes is greatly decreased. This effect is reversible, since when poly(A) is added back using an RNA-adenyltransferase from E. coli), the stability of the mRNA is restored (Marbaix et al., 1977). Similarly, nonadenylated histone mRNAs have a short half-life after injection into oocytes, but become stable if poly(A) tails are added to them before the injection (Huez et al., 1978). It seems that a critical length of poly(A) is required for mRNA stability: molecules with less than 10 to 20 adenylate residues are degraded, while those with more than 10 to 20 are not. The poly(A) tails are shortened with the age of the messenger (Sheiness and Damell, 1973). Although this shortening does not appear to reduce the translational ability of the mRNA (Bard et al., 1974; Nevins and Joklik, 1975), it may be that the length of the poly(A) tail is a sort of “age tag” of the messenger read by enzymes involved in the turnover of mRNA. Another process in which the length of the poly(A) tail is varied in response to physiological change is during fertilization of sea urchin eggs, when preexisting cytoplasmic messengers are polyadenylated (Wilt, 1973; Slater and Slater, 1974). The reaction appears to represent both the addition de now of poly(A) to messengers previously lacking it and the extension of poly(A) tails on messengers previously possessing shorter sequences. In mammalian cells almost all polyadenylation occurs in the nucleus; and the shortening of the poly(A) tails occurs in the cytoplasm. However, a small amount of poly(A), less than 10 bases, may be added in the cytoplasm; this

102

F. E. BARALLE

addition is only transient because the newly added terminal bases are rapidly removed in the shorteking reaction (Diez and Brawerman, 1974). The significance of the reaction is not known. The functional significance of the trailer sequence remains obscure. The 3’ noncoding region is not necessary for translation and its most significantly conserved sequence, the hexanucleotide AAUAAA, is certainly a feature whose importance resides in the processing of the mRNA as a signal for the polyadenylation. Hence its presence in the final mRNA is not related to the biological function of the molecule but is rather a vestigial left over from the biosynthesis of it. The poly(A) sequences are present not only in cellular nuclear R N A and cytoplasmic RNA but also in the messenger synthesized by some viruses which reproduce within the cytoplasm and mitochondria1 messenger. This demonstrates that its role cannot be only in processing or transport of mRNA from nucleus to cytoplasm. Recently, Zeevi et al. (1981) have demonstrated that adenovirus nuclear RNA is spliced in the absence of poly(A) addition. Therefore although poly(A) addition usually precedes splicing during mRNA formation, poly(A) is not required for splicing. Its function is not certainly obligatory for successful translation as the existence of poly(A) - mRNAs dramatically demonstrates. There remains to be definitively proved its functions on confemng additional stability to the mRNA and as a sort of age indicator of the mRNA that may modulate its turnover.

REFERENCES Abraham, K. A., and Pihl, A. (1977). Eur. J . Biochem. 77, 589-594. Adams, J. M., and Cory, S. (1975). Nature (London) 255, 28-33. Ahlquist. P., Dasgupta, R., Shih, D. S.. Zimmern, D., and Kaesberg, P. (1979). Nurure (London) 281, 277-282. Akusjirvi, G., and Pettersson, U. (1979). Cell 16, 841-850. Alestrom, P.,Akusjiwi, G..Perricaudet, M., Mathews, M. B., Klessig, D. F., and Pettersson, U. (1980). Cell 19, 671-681. Anderson, W. F., Bosch, L., Cohn, W. E., Lodish, H., Menick. W. C., Weissbach, H., Wittmann, H. G . , and Wool, 1. G. (1977). FEES Leu. 76, 1-10, Azad, A. A., and Deacon, N. J. (1979). Eiochem. Eiophys. Res. Commun. 86, 568-576. Baker, C. C., Herisse, J., Courtois, G., Galibert, F., and Ziff, E. (1979). Cell 18, 569-580. Baralle, F. E. (1977a). Cell 10, 549-558. Baralle, F. E. (1977b). Cell 12, 1085-1095. Baralle, F. E., (1977~).Nurure (London) 267, 279-281. Baralle, F. E., and Brownlee. G. G. (1978). Nurure (London) 274, 84-87. Baralle, F. E., Shoulders, C. C., and Proudfoot, N. J. (1980). Cell 21, 621-626. Bard, E., Efron, D., Marcus, A., and Perry, R. P. (1974). Cell 1, 101-106. Benoist. C., and Chambon, P. (1981). Narure (London) 290, 304-310. Benoist, C., O’Hare, K.,Breathnach, R., and Chambon, P. (1980). NucleicAcidsRes. 8, 127-142.

SEQUENCES IN EUKARYOTIC mRNAs

103

Bergmann, J. E., Trachsel, H., Sonnenberg, N., Shatkin, A. J., and Locksh, H.F. (1979). J. Biol. Chem. 254, 1440-1443. Bernard, 0.. Jackson, J., Cory, C., and Adams, J. (1977). Biochemistry 16, 41 17-4125. Blair, G. E., Dahl, H. H. M., Truelsen, E., and Lelong, J. C. (1977). Nature (London) 265, 65 1-653. Blobel, G. (1973). Proc. Nurl. Acud. Sci. U.S.A. 70, 924-928. Both, G. W., Banejee, A. K., and Shatkin, A. J. (1975a). Proc. Nutl. Acud. Sci. U.S.A. 72, I 189- I 193. Both, G. W., Furuichi, Y., Muthukrishnan, S., and Shatkin, A. J. (1975b). Cell 6, 185-195. Both, G. W., Furuichi, Y., Muthukrishnan, S . , and Shatkin, A. J. (1976). J. Mol. Biol. 104, 637-658. Brawerman, G. (1974). Annu. Rev. Biochem. 43, 621-642. Briand, J.-P., Keith, G., and Guilley, H. (1978). Proc. Nurl. Acud. Sci. U.S.A. 75, 3168-3172. Busslinger, P., Portman, R., and Bimstiel, M. (1979). Nucleic Acids Res. 6, 2997-3008. Chang, J. C., Temple, G. F., Poon, R., Neumann, K. H.,and Kan, Y. W. (1977). Proc. Nurl. Acud. Sci. U.S.A. 74, 5145-5149. Clegg, J. B., Weatherall, D. J., and Milner, P. F. (1971). Nature (London) 234, 337-340. Corden, J., Wasylyk, B., Buchwalder, A., Sassone-Corsi, P., Kedinger, C., and Chambon, P. (1980). Science 209, 1406-1414. Dasgupta, R., Shih, D. S . , Saris, C., and Kaesberg, P. C. (1975). Nature (London) 256, 624-628. Diez, J . , and Brawerman, G. (1974). Proc. N d . Acud. Sci. U.S.A. 71, 409-4095. Efstratiadis, A., Kafatos, F. C., and Maniatis, T. (1977). Cell 10, 571-585. Efstratiadis, A., Posakony, J. W., Maniatis, T., Lawn, R. M., O’Cpnnell, C., Spritz, R. A., DeRiel, J. K., Forget, B. G.,Weissman, S . M., Slightom, J. L., Blechl, A. E., Smithies, 0.. Baralle, F. E., Shoulders, C. C., and Proudfoot, N. J. (1980). Cell 21, 653-668. Filipowicz, W. (1978). FEBS Lett. 96, 1-11. Filipowicz, W., Furuichi, Y., Sierra, J. M., Muthukrishnan, S., Shatkin, A. J.. and Ochoa, S . (1976). Proc. Nutl. Acad. Sci. U.S.A. 73, 1559-1563. Fitzgerald, M.. and Shenk, T. (1981). Cell 24, 251-260. Flint, S . J., and Sharp, P. A. (1976). J . Mol. Biol. 106, 749-771. Ford, J. P., and Hsu, M.-T. (1978). J . Virol. 28, 795-801. Furuichi, Y., La Fiandra, A., and Shatkin, A. J. (1977). Nature (London) 266, 235-238. Ghosh, P. K., Reddy. V. B., Swinscoe, J., Choudary, P. V., Lebowitz, P., and Weissman, S . M. (1978a). J. Biol. Chem. 253, 3643-3647. Ghosh, P. K.. Reddy. V. B., Swinscoe, J., Lebowitz, P., and Weissman, S . (1978b). J . Mol. Biol. 126, 813-846. Goeddel, D. V., Leung, D. W., Dull, T. J., Gross, M., Lawn, R. M., McCandliss, R., Seeburg, P. H.,Ullrich, A., Yelverton, E., and Gray, P. W. (1981). Nature (London) 290, 20-26. Goldberg, M. (1979). Ph.D. thesis, Stanford University, Stanford, California. Gorski, I . , Morrison, M. R., Merkel, C. G., and Lingrel, J. B. (1974). J . Mol. Biol. 86, 363-372. Grohrnann, K., Amalric, F., Crews, S . , and Attardi, G. (1978). Nucleic Acids Res. 5 , 637-651. Grosschedl, R., and Birnstiel, M. L. (1980). Proc. Nurl. Acud. Sci. U.S.A. 77, 1432-1436. Grosschedl, R., Wasylyk, B., Chambon, P., and Bimstiel, M. L. (1981). Nature (London) 294, 178- 180. Gurdon, J. B., Lingrel, J. B., and Marbaix, G. (1973). J . Mol. Biol. 80, 539-551. Hagenbuchle, O., Santer, M., Steitz, J. A., and Mans, R. J. (1978). CeN 13, 551-563. Hagenbuchle, O., Bovey, R., and Young, R. A. (1980). Cell 21, 179-187. Hagenbuchle, 0.. Tosi, M.. Schibler, U., Bovey, R., Wellauer, P. K., and Young, R. A. (1981). Nature (London) 289, 643-646.

104

F. E. BARALLE

Hamlyn, P. H., Gait, M. J., and Milstein, C. (1981). Nucleic Acids Res. 9, 4485-4494. Hefti, E., Bishop, D. H. L., Dubin, D. T., and Stollar, V. (1976). J . Virol. 17, 149-159. Hickey, E. D., Weber, L. A., and Baglioni, C. (1976a). Narure (London) 261, 71-73. Hickey, E. D., Weber, L. A., and Baglioni, C. (1976b). Proc. Narl. Acad. Sci. U.S.A. 73, 19-23. Hobart, P., Crawford, R., Shen, L. P., Pictet, R., and Rutter, W. J. (1980). Nature (London)288, 137-141. Hofer, E., and Damell, J. E. (1981). Cell 23, 585-593. Huez, G . , Marbaix, G., Gallwitz. D., Weinberg, E., Devos, R., Hubert, E., and Clenter, Y. (1978). Narure (London) 271, 572-573. Hunter, A. R., Jackson, R. J., and Hunt, T. (1977). Eur. J. Biochem. 75, 159-170. Jacob, F., and Monod, J. (1961). J. Mol. Biol. 3, 318. Kabat, D., and Chappell, M. R. (1977). J. Biol. Chem. 252, 2684-2690. Kaempfer, R., Rosen, H., and Israeli, R. (1978). Proc. Nafl. Acad. Sci. U.S.A. 75, 650--654. Kaempfer, R., van Emmelo, J., and Fiers, W. (1981). Proc. Narl. Acad. Sci. U.S.A. 78, 1542- 1546. Konkel, D., Tilghman, S., and Leder, P. (1978). Cell 15, 1125-1132. Koper-Zwarthoff, C. E., Lockard, R. E., Alzner de Weerd, B., Raj Bhandary, V. L., and Bol. J. F. (1975). Proc. Narl. Acad. Sci. U.S.A. 75, 3382-3386. Kozak, M. (1977). Narure (London) 269, 390-394. Kozak, M. (1978). Cell 15, 1109-1123. Kozak, M. (1979). Narure (London) 280, 82-85. Kozak, M. (1980a). Cell 22, 7-8. Kozak, M. (1980b). Cell 22, 459-467. Kozak, M. (1980~).Cell 19, 79-90. Kozak, M., and Shakii, A. J. (1977a). J . Mol. Biol. 112, 75-96. Kozak, M., and Shatkin, A. J. (1977b). J. Biol. Chem. 252, 6895-6908. Kozak, M., and Shatkin, A. J. (1978a). Cell 13, 201-212. Kozak, M., and Shatkin, A. J. (1978b). J. Biol. Chem. 253, 6568-6577. Kronenberg, H. M., Roberts, B. E., and Efstratiadis, A. (1979). Nucleic Acids Res. 6, 153-166. Lai, C.-J., Dhar, R., and Khoury, G. (1978). Cell 14, 971-982. Legon, S. (1976). J. Mol. Biol. 106, 37-54. Legon, S. (1979). J . Mol. Biol. 134, 219-240. Leung, D. W., Browning, K. S . , Heckman, J. F., Raj Bhandary, V. i.,and Clark, J. M. (1979). Biochemistry 18, 1361-1365. Lewin, B. (1980). “Gene Expression,” Vol. 2. Wiley, New York. Ling, V. (1972). J. Mol. Biol. 64, 87-102. Lockard, R., and Lane, C. (1978). Nucleic Acids Res. 5 , 3237-3248. Lodish, H. F., and Jacobsen, M. (1972). J . Biol. Chem. 247, 3622-3629. Lomedico, P., Rosenthal, N., Efstratiadis, A., Gilbert, W., Kolodner, R., and Tizard, R. (1979). Cell 18, 545-558. MacDonald, R. J., Crerar, M. M., Swain, W. F., Pictet, R. L., Thomas, G . . and Rutter, W. J. ( 1980). Nature (London) 287, I 17- 122. McReynolds, L., O’Malley, B. W., Nisbet, A. D., Fothergill, J. E., Givol, D., Fields, S., Robertson, M., and Brownlee, G. G. (1978). Narure (London) 273, 723-728. Marbaix, G., Huez, G., and Soreq, H. (1977). Trends Biochem. Sci. 2, N106. Mathis, D. J., and Chambon, P. (1981). Narure (London) 290, 310-315. Merkel, C. G., Kwan, S. P., and Lingrel, J. B. (1975). J. Biol. Chem. 250, 3725-3728. Montoya, J., Ojata, D., and Attardi. G. (1981). Narure (London) 290, 465-470. Morgan, M. A., and Shatkin, A. J. (1980). Biochemistry 19, 5960-5966.

SEQUENCES IN EUKARYOTIC mRNAs

105

Muthukrishnan, S.,Both, G . W., Furuichi, Y.,and Shatkin, A. J. (1975a). Nature (London) 255, 33-37. Muthukrishnan, S . , Filipowicz, W., Sierra, J. M., Both, G. W., Shatkin, A. J., and Ochoa, S. (1975b). J . Biol. Chem. 250, 9336-9341. Muthukrishnan, S., Morgan, M., Banerjee, A. K., and Shatkin, A. J. (1976). Biochemistry 15, 5761-5768. Morgan, M. A., and Shatkin, A. J. (1980). Biochemistry 19, 5960-5966. Nakashima, K., Darzynkiewicz, E., and Shatkin, A. J. (1980). Nature (London) 286, 226-230. Nevins, J. R., and Damell, J. E. (1978). Cell 15, 1477-1493. Nevins, J. R., and Joklik, W. K. (1975). Virology 63, 1-14. Nevins, J. R., Blanchard, J.-M., and Darnell, J. E. (1980). J . Mol. Biol. 144, 377-386. Nokin, P., Bumy, A., Huez, G., and Marbaix, G. (1976). Eur. J . Biochem. 68, 431-436. Nomoto, A., Kitamura, N.. Golini, F., and Wimmer, E. (1977). Proc. Natl. Acad. Sci. U.S.A. 74, 5345-5349. Nunberg, J. H., Kaufman, R. J., Chang, A. C. Y., Cohen, S. N., and Schimke, R. T. (1980). Cell 19, 355-364. Pavlakis, G . N., Lwkard, R. E.. Vamvakopoulos, N., Rieser, L., Raj Bhandary, V. L., and Vournakis, I. N. (1980). Cell 19, 91-102. Perricaudet, M., Akusjlirvi, G . , Virtanen, A., and Pettersson, U. (1979). Nature (London) 281, 694-696. Pettersson, R. F., Flanegan, J. B., Rose, J. K., and Baltimore, D. (1977). Nature (London) 268, 270-272. Poon. R., Kan, Y. W., and Boyer, H. W. (1978). Nucleic Acids Res. 5,4625-4630, Porter, A. G., Fellner, P., Black, D. N., Rowlands, D. J., Harris, T. J. R., and Brown, F. (1978). Nature (London) 276, 298-301. Pribnow, D. (1979).In “Biological Regulation and Development” (R. Goldberger, ed.), Vol. 1, pp. 219-277. Plenum, New York. Proudfoot, N. J. (1977). Cell 10, 559-570. Proudfoot, N. J., and Brownlee, G . G . (1976). Nature (London) 263, 211-214. Proudfoot, N. J . , and Longley, J. 1. (1976). Cell 9, 733-746. Reddy, V., Ghosh, P., Lebowitz, P., and Weissman, S. (1978). Nucleic Acids Res. 5,4195-421 I . Reddy, V . , Ghosh, P., Lebowitz, P.. Piatak, M., and Weissman, S. (1979). J . Virol. 30, 279-296. Richards, K., Guilley, H., Jonard, G., and Hirth, L. (1978). Eur. J . Biochem. 84, 513-519. Roop, D. R., Tsai, M.-J., and O’Malley, B. W. (1980). Cell 19, 63-68. Rose, J . K. (1975). J . Biol. Chem. 250, 8098-8104. Rose, J. K. (1978). CeN 14, 345-353. Rose. J. K., Trachsel, H., Leong, K., and Baltimore, D. (1978). Proc. Natl. Acad. Sci. U.S.A. 75, 2732-2736. Rose, K. M., Jacob, S. T.. and Kumar, A. (1979). Nature (London) 279, 260-262. Rosenberg, M., and Peterson, B. M. (1979). Nature (London) 279, 696-701. Setyono, B., and Greenberg, J. R. (1981). Cell 24, 775-783. Setzer, D. R., McGeogan, M., Nunberg, J. H., and Schimke, R. T. (1980). Cell 22, 361-370. Shafritz, D. A., Weinstein, J. A., Safer, B. Menick, W. C., Weber, L. A., Hickey, E. D., and Baglioni, C. (1976). Nature (London) 261, 291-294. Shatkin, A. J. (1976). Cell 9, 645-653. Sheiness, D., and Damell, J. E. (1973). Nature (London)New B i d . 241, 265-268. Sherman, F., Stewart, S. W., and Schweingruber, A. M. (1980). Cell20, 215-222. Shimothono, K., Kodanne, Y.,Hashimoto. J., and Miure, K. (1977). Proc. Narl. Acad. Sci. U.S.A. 74. 2734-2738.

106

F. E. BARALLE

Shine, J., and Dalgarno, L. (1975). Nature (London) 254, 34-38. Slater, I., and Slater, D. W. (1974). Proc. Nurl. Acad. Sci. U.S.A. 71, 1103- 1107. Sonenberg, N. (1981). Nucleic Acids Res. 9, 1643-1656. Sonenberg, N., and Shatkin, A. J. (1977). Proc. Nurl. Acad. Sci. U.S.A. 76, 4345-4348. Sonenberg, N., Morgan, M. A., Memck, W. C., and Shatkin, A. J. (1978). Proc. Narl. Acad. Sci. U.S.A. 75, 4843-4847. Sonenberg, N., Rupprecht, K.M., Hecht, S . M., and Shatkin, A. J. (1979). Proc. Nurl. Acad. Sci. U.S.A. 76, 4345-4349. Sonenberg, N., Trachsel. H., Hecht, S., and Shatkin, A. J . (1980). Nature (London) 285,331-333. Sonenberg, N., Guertin, D., Cleveland, D., and Trachsel, H. (1981). Cell 27, 563-572. Steitz, 1. A., and Jakes, K. (1975). Proc. Nurl. Acad. Sci. U.S.A. 72, 4734-4738. Trachsel, H., Sonenberg, N., Shatkin, A. J., Rose, J. K.,Leong, K.,Bergmann, J. E., Gordon, J., and Baltimore, D. (1980). Proc. Narl. Acad. Sci. V.S.A. 77, 770-774. Tsujimoto, Y., and Suzuki, Y. (1979). Cell 18 591-600. Van Ooyen, A., Van Den Berg, J . , Mantei, N.. and Weissman, C. (1979). Science 206, 337-344. Wasylyk, B., Derbyshire, R., Guy, A., Molko, D., Roget, A., Teoule, R., and Chambon, P. (1980). Proc. Narl. Acad. Sci. U.S.A. 77, 7024-7028. Weissbach, H.,and Ochoa, S. (1976). Annu. Rev. Biochem. 45, 191-216. Wigle, D. T., and Smith, A. E. (1973). Narure (London) New Eiol. 242, 136-140. Wilson, M.C., Sauki, S. G., White, P. A., and Darnell, J. E. (1978). J. Mol. Biol. 126, 23-36. Wilt, F. H. (1973). Proc. Narl. Acad. Sci. U.S.A. 70, 2345-2349. Young, R. A., Hagenbiichle, O., and Schibler, U. (1981). Cell 23, 451-458. Zeevi, M., Nevins, J. A.,and Darnell, J. E. (1981). Cell 26, 39-46. Zein, S., Sambrook, J., Roberts, R. S., Keller, W.. Fried, M., and DUM, A. R. (1979). Cell 16, 851-861.

Ziff, E. (1980). Nurure (London) 287, 491-499. Ziff, E. B., and Evans, R. M. (1978). Cell 15, 1463-1475.

INTERNATIONAL REVIEW OF CYTOLOGY. VOL. 81

The Fragile X Chromosome GRANTR. SUTHERLAND Cytogenetics Unit, Department of Histopathology , Adelaide Children’s Hospital, North Adelaide, Australia 1. 11. 111.

Introduction

...

........................

IV.

V.

.............................

124

VI.

A. The Phenotype in Males ................................ B. The Phenotype in Females .............................. ................................ C. Treatment.. ...... D. Genetic Counselling and Prenatal Diagnosis ................ VII. Karyotype-Phenotype Relationship ........................... VIII. Conclusions .............................................. IX. Apologia ................... References ...............................................

128 134 135 136 I37 138 138 139

I. Introduction The fragile X chromosome has recently been recognized to be associated with, if not the cause of, a common form of X-linked mental retardation in males and possibly females. While the exact contribution of this chromosome aberration to mental retardation remains to be determined, it is at least of the same magnitude as Down syndrome and possibly more important genetically as it is usually familial (Gerald, 1980). This chromosomal fragile site at Xq27, which has now become known as the fragile X chromosome, was first described by Lubs in 1969 in association with mental retardation. His discovery had become no more than another rare chromosomal curiosity confined to a single family until the independent reports of Giraud et af. (1976) and Harvey et af. (1977) demonstrated the probable association of this fragile site with one common form of X-linked mental retardation. The key to the widespread confirmation of these reports was the discovery that the fragile site was expressed only under highly specific conditions of lymphocyte culture which were not those employed by most cytogenetics laboratories in the late 1970s. I07

Copyrighl 0 1983 by Academic R e s s . Inc. All rights of reproduclion in any form reserved. ISBN 0-12-364481-X

108

GRANT R. SUTHERLAND

The fragile X and its associated syndrome of mental retardation in males have now been found in most countries where this has been sought and in many racial groups. However, there are still problems with the demonstration of the fragile X in some males and many females, and controversy about the clinical syndrome which the fragile X produces in males and the extent of mental handicap it is responsible for in females. Very little is known about the population cytogenetics of the fragile X and the nature of its association with mental retardation remains obscure, especially since some allegedly normal males have been reported to have the fragile X. 11. What Is the Fragile X?

The fragile X is so called because it has a fragile site at the distal end of the long arm.Fragile sites are morphological features of chromosomes which were defined by Sutherland (1979a) as specific points which are liable to show the following features: 1. A nonstaining gap of variable width which usually involves both chromatids. 2. Is always at exactly the same point on the chromosome in an individual or kindred. 3. Is inherited in a Mendelian codominant fashion. 4. Exhibits fragility by the production of acentric fragments, deleted chromosomes, triradial figures, etc. The triradial (or multiradial) figure is the most spectacular cytogenetic manifestation of the fragile site (Fig. 1) and also an essential manifestation for confirmation as a fragile site rather than some other phenomenon causing chromosomal damage. While the triradial was originally considered to be due to selective endoreduplication(Lejeune et al., 1968), it was proposed by FergusonSmith (1973) and subsequently confirmed by Ferguson-Smith (1977) and N d l et al. (1977) that the mechanism for production of triradials was breakage at the fragile site followed by nondisjunction (Fig. 2). While the nature of a fragile site, in terms of chromosome structure, is unknown it presumably represents a segment of chromosome which does not undergo normal compaction for mitosis. Rarely, cells are seen in which all the chromosome material distal to the fragile site is not normally compacted at mitosis (Fraccaro et al., 1972). Fragile sites have not been studied in meiotic cells hence it is unknown whether they are expressed in them. To date 15 fragile sites have been detected and these are shown in the partial ideogram (Fig. 3) and partial karyotype (Fig. 4). These fragile sites fall into three

FIG. I . Multiradial figures produced by fragile sites. (a) Triradial at 2q13; (b) triradial at 6p23; (c) triradial at 9 ~ 2 1(d) ; triradial at 9q23; (e)pentaradial at 10q23; ( f ) triradial at IOq25; (g) triradial at I lq13; (h) triradial at 1 6 ~ 1 2(i) ; triradial at 20pl I .

- -

anaphase

metaphase

11 FIG.2. Mechanism of production of triradial figures and deleted chromosomes by breakage at the fragile site followed by nondisjunction. (After Ferguson-Smith, 1973.).

110

GRANT R . SUTHERLAND

c

l-

c c

6

2

7

8

9

c

10

n

c

c

11

iY 12

c

16

20

X

FIG. 3. The known fragile sites. Group I , small arrows, at 2q13,6p23,7plI,8q22.9p21.9q32, IOq23. I Iq 13, 1 lq23, 12ql3,16p12,20pl1,and Xq27;Group 2,open arrow, 16q22;Group 3,broad arrow, 1Oq25.Reprinted from Sutherland et a l . , American Journal of Human Genetics. May 1983, by permission of the University of Chicago Press.

groups. The first group, the folate-sensitive fragile sites, contains all except two of the known sites which each comes into separate categories. The multibranched chromosomes formed by various combinations of the arms of chromosomes 1,9, and 16 seen in some immunodeficiency states (Tiepolo et al., 1979; Hult.tn, 1978) are not currently considered to be heritable fragile sites since they appear to be products of the diseases involved. Group 1. The folate-sensitive fragile sites are those at 2q13, 6p23, 7pl1, 8q22, 9p21, 9q32, 10q23, llq13, llq23, 12q13, 16~12,2 0 ~ 1 1 ,and Xq27. They are termed folate sensitive because removal of folk acid (and thymidine)

THE FRAGILE X CHROMOSOME

11 1

from culture medium was the first factor found to be essential for their demonstration in lymphocyte culture. Group 2. This group contains only the fragile site at 16q22. This fragile site is not dependent upon conditions of tissue culture (Sutherland, 1979a) but its expression is reportedly enhanced by the addition of distamycin A to lymphocyte

PIC. 4. P'arial karyotype showing the known fragile sites. The left chromosome of each pair is unbanded and the right G-banded. (Pair number 8 courtesy Dr. N. B. Kardon, pair number 7 courtesy Dr. G . C. Webb.)

112

GRANT R. SUTHERLAND

cultures (Schmid et al., 1980). If the variant chromosome 17, sometimes referred to as a satellited 17, is shown to be fragile and is accepted as a fragile site then it might be classified within this group. Group 3. This group contains only the fragile site at 1Oq25. This fragile site was independently discovered by Scheres and Hustinx (1980) and Sutherland et a f . (1980a) and shown to be a polymorphism present in 1 in 40 members of the Australian population sample studied (Sutherland, 1982b). This fragile site is unique in that its expression is dependent upon the presence of BUdR or BCdR in lymphocyte cultures some hours prior to harvest. This is the only common fragile site (Sutherland, 1982b). Hence, while the fragile site on the X chromosome may have a number of features which distinguish it from the other fragile sites, any attempts to elucidate the nature of this fragile site should not ignore the fact that it is one of only a number of folate-sensitive fragile sites. The correct nomenclature for the fragile X remains to be finalized. Lubs (1969) called it a marker X chromosome so this form certainly has priority and is preferred by some (Jacobs et al., 1980; Turner and Opitz, 1980). However, in 1969 it was not known that the marker X was due to a fragile site, now a welldocumented phenomenon, on the distal end of the long arm and the more specific term fragile X is preferable to the nonspecific term, marker X. Every structurally changed X chromosome is a marker X until the structural change is specified. The triplet fra was suggested by Sutherland (1 979a) and has gained fairly wide acceptance. The exact location of the fragile site is yet to be finalized. The rather cumbersome Xq27 or 28 was originally used to indicate this uncertainty, but evidence from Turner et a f . (1978) suggested that Xq27 was correct. Others have opted for Xq28, and it will not be until good prophase banding of this area of chromosome is produced that the matter will be finalized. Most of the prophase banding methods are incompatible with a high level of fragile site expression and Jennings et a f . (1980) found that the position of the fragile site was unresolved using this technology. Until the matter is resolved, fra(X)(q27) will be used to specify the fragile X.

111. Tissue Culture Conditions Fragile sites have mainly been demonstrated in PHA-stimulated lymphocyte cultures and their expression in other cell types is discussed below. To elicit expression of fragile sites, including the fragile X, Sutherland (1977b) showed that it was necessary to culture lymphocytes in medium 199 rather than a range of other culture media examined. The essential feature of medium 199 was subsequently found to be its deficiency in folic acid and thymidine (Sutherland,

THE FRAGILE X CHROMOSOME

113

1979a). Addition of folic acid or thymidine to medium 199 inhibited expression of the fragile sites, as did the biologically related compounds folinic acid and BUdR. Dose-response curves were produced for the effect of folic acid and thymidine on expression of the fragile X (Sutherland, 1979a). These effects of folic acid, thymidine, and BUdR on inhibition of fragile site expression have been fully confirmed by Glover (1981). When folic acid deprivation was found to be important for fragile site expression, methotrexate, an inhibitor of folate metabolism, was found to induce expression of fragile sites in medium which contained folate (Ham’s FIO), although not to the extent that absence of folic acid did (Sutherland, 1979a). Unfortunately this work was carried out in Ham’s F10 which also contains thymidine. Fonatsch (1981b) using skin fibroblasts, has induced the fragile X in a high proportion of cells using methotrexate in Dulbecco’s medium which does not contain thymidine. The time of deprivation of folic acid and thymidine is critical for expression of fragile sites. Deprivation during the last few hours of culture time is necessary for expression (Sutherland, 1979a) indicating that expression of fragile sites is determined either late in S or early in G,. Another factor involved in expression of some fragile sites, including the fragile X, is the pH of the culture medium. A significant positive correlation was found between the pH of medium 199 or MEM-FA at the time of harvest and fragile X expression (Sutherland, 1979a). Others (e.g., Gustavson et al., 1981; Howard-Peebles and Pryor, 1981) have confirmed this pH effect, although using “M” medium, essentially Ham’s F10 without folic acid, thymidine, or hypoxanthine, Jacobs et al. (1980) considered pH to be unimportant. In lymphocyte cultures the duration of the culture before harvesting might be important in maximizing the frequency of expression of the fragile X. Jennings et al. (1980) considered that 96- and 120-hour cultures were better than 72-hour cultures, whereas Gustavson et al. (1981) observed no difference between 72and 94-hour cultures. Howard-Peebles and Pryor (1981) found that increasing the length of culture time enhanced fragile X expression. Jacobs et al. (1980) preferred 96-hour cultures for their studies of the fragile X. Harvey et al. (1977) found only half the frequency of expression in 2-day cultures compared with 3day cultures. In the author’s laboratory 2-day cultures have been found to be unsatisfactory for studying fragile sites because of very low frequencies of expression. The frequency of expression at 4 days is usually greater than at 3 days, but the difference is small, whereas in 5-day or longer cultures the frequency of expression declines along with the quality of the preparation. The reasons for the apparent increase in frequency of expression with time in culture are not clear but depletion of media components which inhibit expression may account for it. Howard-Peebles and Pryor (1979, 1981) have claimed that serum concentration in the culture medium is an important factor in fragile X expression, with

E

Fragile sites and proportion of cells expressing them

Methionhe' concentration (mg/liter)

9~216

0 0.1

0.5 1 3 5

10 15

1Oq23c

1Oq23d

10150 19/50 23/50 22/50 23/50 28/50 25/30 21/30

14/50 17/50 29/50 15/50 21/50

lOq23e

llq1Y

12q13g

Xq27h

1/50

2/50

0142 2/50 10/50 9/50 12/50 -

1/50 211 I

0/50

4/50

Xq27'

1Oq25j

LOq25'

IOq25'

15/40

32/50 17/23 30141 8/13 45/50

~

~

0.05

TABLE I m OF METHIONINE CONCENTRATION ON EXPRESSION OF FRAGILE SITES

9/50 14/50 17/50 11/50

11/33

-

19/50 11/50

8/50

17/50 18/50

14/50 24/50

10/50

2/50

7/50 7/50 8/50 15/50

-

5/50

8/35 7/50 9/50

44/50

10/50

-

21/40

-

2/28 3/33 3/50 1 1/50 12/50 -

10150

5/50

27/50

42/50

17/50

2/50 3/50 9/50 12/50 23/50 20150

0127 1/26 0/10 12/50

15/50 11/50

19/36

-

-

4tudied in MEM-FA (Sutherland, 1979b)without methionine, supplementedwith 5% fetal bovine serum to which the stated concentrations of I-methionine were added when cultures were established. For the fragile site at 1Oq25 MEM-FA-methionine was used to which was added 1 mg/liter folk acid and 10 mglliter BUdR when cultures were established. bManuel et ul. (1981). ceSutherland (1979b) family AY n.2, I , I . and II.3. /Unpublished. 8Sutherland and Hmton (1981)IV.1. hSutherland (1979~) IV,6. 'Unpublished, mildly retarded female. WJnpublished unrelated individuals.

THE FRAGILE X CHROMOSOME

115

higher levels of expression at lower serum concentrations. This effect has not been documented by detailed study. The widespread use of only 5% fetal bovine serum in fragile site work is probably more determined by cost than any proven need for low serum concentrations. Indeed, Webb et af. (1982) found that increasing the fetal calf serum concentration from 5 to 14% gave an improved yield of metaphases without affecting fragile X expression. The next factor in culture medium composition to be regarded as important was the need for methionine. Howard-Peebles et al. (1980) and Howard-Peebles and Pryor (1981) demonstrated that even under conditions of folk acid and thymidine deprivation methionine was essential for fragile X expression, although their results were not clear-cut. One black male expressed the fragile X in the absence of methionine. Attempts to confirm this role of methionine have been inconclusive because lymphocytes grow poorly in the absence of methionine. The limited data produced (Table I) have tended to support the observations of Howard-Peebles and Pryor (1981) although again these results are not unequivocal. Gardner et al. (1982) claimed that high levels of methionine (1 15 mg/liter) added to medium 199 produced a 2- to 4-fold increase in expression of the fragile X in skin fibroblast cultures. Glover and Howard-Peebles (1981) have shown that the need for methionine can be overcome when FUdR is used to induce fragile X expression. Glover (1981) and Tommerup et al. (1981b) showed that FUdR would induce the expression of the fragile X even in the presence of normally inhibiting concentrations of folic acid. FUdR is a powerful inhibitor of thymidylate synthetase and this finding supported and added to the original suggestion of Sutherland (1979a) that the area of metabolism involved is that shown in Fig. 5 , and that fragile site expression is dependent upon a deficiency of thymidine monophosphate which leads to impaired DNA synthesis (Tommerup et al., 1981b). Brookwell et af. (1982), in a major study of FUdR on fragile X expression in lymphocytes and fibroblasts, found that the level of fragile X expression induced in lymphocytes by FUdR was not dependent upon the medium used. This agrees with Glover (198 1) who recommended raising folic acid levels when FUdR is used to help combat its toxicity. Brookwell et af. (1982) also claimed that FUdR induction of the fragile X resulted in an enhancement of expression by about 30%,however, they did not separate their freshly cultured bloods from those in which delays in culture occurred where they claimed enhancement of up to 500%. There is a need to determine whether FUdR will induce a higher level of fragile site expression in freshly cultured lymphocytes than occurs in folic acid and thymidine-free medium and to confirm that any drop in expression with delay in culturing can be overcome by FUdR induction. A variety of other studies on the conditions of lymphocyte culture have been reported. Fonatsch (1981a) reported a marked decrease in the frequency of expression of the fragile X in blood which had been stored for 5 days prior to

116

GRANT R. SUTHERLAND homocysteine

methionine

5-methyl-THF

5.10-methylene THF

-

dUMP

DHF

dTMP

@

0

folic acid

thymidine

dTTP

1

DNA

FIG. 5 . The area of folate metabolism involved in fragile site expression (after Erbe, 1975; Scott and Weir, 1981). The enzymes controlling the various reactions are (1) methionine synthetase, (2) glutamate formiminotransferase, (3) serine hydroxymethyltransferase, (4) methylene-THF reductase, ( 5 ) formimino-THF cyclodeaminase, (6) dihydrofolate reductase, (7) thymidine kinase, (8) thymidylate synthetase. THF, Tetrahydrofolate; DHF, dihydrofolate; dUMP, uridine monophosphate, dTMP, thymidine monophosphate.

culture compared with freshly cultured blood. Jacobs et al. (1980) generally found lower levels of fragile X expression in Hawaii from blood which was in transit for up to 5 days than in Saskatoon where it was studied while fresh, however, to draw any conclusions from a comparison between laboratories is hazardous. Brookwell et al. (1982) found that delay in culturing lymphocytes decreased fragile X expression but that the addition of FUdR to the cultures enhanced expression to the level which might have been expected had the delay not occurred. Gustavson et al. (1981) regarded time between sampling and culture to be unimportant in fragile X expression. Eberle et al. (1981) claimed that cocultivation of male fragile X lymphocytes with female fragile X or normal lymphocytes resulted in a decrease in fragile X expression in the male but did not enhance expression in the female lymphocytes. All available evidence suggests that the folate-sensitive fragile sites will be expressed if there is a relative deficiency of thymidine monophosphate available for DNA synthesis during late S. (The possibility that the fragile site could be repaired during G, cannot be discounted and requires investigation.) The action

THE FRAGILE X CHROMOSOME

117

of methotrexate can be explained by its inhibition of the dihydrofolate reductasecontrolled conversion of DHF to THF, an essential cofactor for thymidylate synthetase to produce thymidine monophosphate. This also accounts for the action of FUdR which specifically inhibits thymidylate synthetase in the presence of folate. It is more difficult to see how the need for methionine and some of the other amino acids (claimed to effect fragile X expression, Lejeune, 1980) involved in one carbon transfers fit into this scheme. It is difficult to see why methionine is apparently essential for fragile site expression. According to Scott and Weir (198 1) methionine deficiency will depress DNA synthesis and cell division and this is seen in lymphocyte cultures which grow very poorly under such conditions. Since methionine deficiency also leads to intracellular folate deficiency it would be expected that methionine deficiency would enhance fragile site expression rather than depress it. Even though it now seems clear that the area of metabolism shown in Fig. 5 is involved it is not clear how it is involved. Why is it that in some cells the fragile site is expressed only on one chromatid? Analogously, in two homozygotes for the fragile site at 10q25 the fragile site was more often expressed on one chromosome than on both (Sutherland, 1981) even though environmental conditions which surrounded the homologous chromosomes during DNA synthesis must be more similar to each other than that in different cells. Two possible explanations for these phenomena can be suggested. First, that in conditions appropriate for expression of fragile sites they are expressed in close to 100% of chromosomes at the completion of S but are gradually repaired during G,. This could account for expression in a single chromatid since presumably the repair events would be independent for each chromatid but expression, if it does occur during S, would not be. Second, fragile sites may be expressed, under appropriate conditions, in virtually 100% of metaphases but that some physical stretching of the chromosome during the process of harvesting may be required to separate the two segments of chromosome across the fragile site (P. B. Jacky, personal communication), thus making it visible. Effects of harvesting techniques on fragile site expression have been found and give some support to the concept that physical forces on the chromosome might be important. Jacky (1980) found that Na citrate used as a hypotonic agent resulted in a higher frequency of expression of the fragile X in fibroblast cultures than if KCI was used; Gardner et al. (1982) supported the use of Na citrate as the preferred hypotonic agent for fibroblast cultures. Buhler et al. (1970) investigated the effects of harvesting on the expression of the fragile site at 2q13 and found a higher level of expression when Na citrate was the hypotonic solution used in harvesting than when KCI or a combination of the two was used. HowardPeebles and Pryor (198 1) reported a higher frequency of fragile X expression if slides were air dried rather than flame dried.

118

GRANT R. SUTHERLAND

IV. Cytogenetics A. LYMPHOCYTES Some of the morphological appearances of the fragile X are shown in Fig. 6. It will be noted that the appearance is more distinctive in the unbanded preparations than in the G-banded ones. When G-banding methods which employ trypsin are used the segment of chromosome distal to the fragile site becomes merely a fuzziness which is not as readily detected as the striking appearance of the fragile X on unbanded chromosomes. Buckton (1981) (in Hecht el af., 1982) reports that if the ASG banding technique of Sumner et af. (197 1) is used then the fragile X is easier to score microscopically than from unbanded preparations. Cytogenetic investigations of the nature of fragile sites have not been very fruitful. In good quality preparations a fine strand of chromosome material can be seen across the gap when the fragile site is expressed as a chromatid or

Fio. 6. The fragile X. (a-c) Expression on chromosomes at different stages of compaction; (d) despiralization of the chromosome material distal to the fragile site; (e.0 double satellited appearance equivalent to triradial; (g) expression in skin fibroblast metaphase (courtesy Dr. P. B. Jacky); (h-j) G-banded appearance; (k) BUdR labeling showing early replicating fragile X (broad arrow) and late replicating normal X (small arrow); (I) similar to k but with fragile X late replicating.

THE FRAGILE X CHROMOSOME

119

chromosome gap. None of the fragile sites stains with Ag-NOR stain (Sutherland and Leonard, 1979; Howard-Peebles and Howell, 1979). Fragile sites have not been examined by electron microscopy due to the technical problem of examining a specific area of a specific chromosome. The nature of the material across the gap in fragile sites remains to be determined. Howard-Peebles and Howell (1981) studied the chromosome core with silver stain and showed that the core ends were fused in the centric portion of the chromosome in a proportion of metaphases from individuals with the fragile X and fra( 16)(q22). These fusions were not visible when the chromosomes were stained with Giemsa. This interesting observation has not been repeated by others and its significance remains unclear. Lubs (1969) reported that X-inactivation was random with respect to the fragile X in females. Similar studies using BUdR labeling rather than tritiated thymidine and autoradiography by Jacobs et al. (1980) and Martin et al. (1980) support Lubs (1969) but there is still a paucity of data in this area. Technical difficulties arise in that both BUdR and thymidine inhibit expression of the fragile X and, when BUdR labeling is used, the fragile site may be more difficult to see on the late labeling X because it is pale staining (Fig. 6). More data in this area are needed in view of its relevance to explaining th‘e clinical findings in females with the fragile X. One problem which arises when examining chromosomes for fragile sites is the occurrence of chromatid gaps and breaks which occur at a higher frequency in all cultures grown under the conditions required for expression of fragile sites than when cells are grown in complete medium. The occurrence of these gaps and breaks appears to be nonrandom and there are a number of “hot spots” where they are seen more frequently than would be expected by chance. These hot spots include bands 3p14, 6q26, and 16q23.1 and gaps or breaks in these regions will be referred to as autosomal lesions. These are differentiated from fragile sites because they rarely occur in more than 3-4% of metaphases from any individual, inheritance has not been demonstrated, and the classical triradial configuration produced by fragile sites has not been reported. The factors involved in expression of autosomai lesions appear to be similar to those involved in fragile site expression (Glover, 1981). The autosomal lesions can cause problems when they mimic the known fragile sites (Leversha et al., 1981). The 6q26 lesion can resemble the fragile X on unbanded preparations; Leversha et al. (1981) have observed this lesion in up to 3.5% of metaphases and Soudek and McGregor (1981) recorded it in 1.2% of metaphases from 31 individuals. In this group they also recorded 0.9% of cells with other C-group chromosomes mimicking the fragile X. If doubt exists as to whether unbanded preparations have a low frequency of the fragile X or the 6q26 lesion then G- or Q-banding of scored slides will allow resolution of this uncertainty. There appears to be a fragile site and an autosomal lesion (Sutherland,

120

GRANT R. SUTHERLAND

1979b; Jennings et al., 1980) at 16q22 and the resolution of confusion between the two could be difficult (Cot6 and Katsantoni, 1980) but might be resolved by culture of cells in a range of medium types, the use of distamycin A (Schmid et al., 1980), and family studies. In view of the many factors which influence the expression of fragile sites it is perhaps pointless to compare frequencies at which they are detected in different laboratories. In general, fragile sites are seen in less than 100% of metaphases, indeed there is only one report of a fragile site (at 2q13) being seen in all cells (Anner6n and Gustavson, 1981). The fragile X has been reported in up to 56% of lymphocyte metaphases (Jacobs et al., 1980; Brookwell et al., 1982; Webb et al., 1982) and 71% of fibroblast metaphases (Fonatsch, 1981b) but is more usually seen in less than 50% of metaphases. In a 3-year-old girl 82% of lymphocyte metaphases were found to express the fragile X (A. Daniel and R. Brookwell, personal communication). Jacobs et al. (1982) have suggested thiit the maximum frequency of expression possible might be 50%. There is sometimes difficulty in inducing expression of fragile sites. In obligate carriers of the autosomal fragile sites they are occasionally not detected or found at such low frequencies that it is difficult to be certain that they are actually present. This problem appears to be greater for the fragile X and the situation in males and females differs. In males the problems associated with expression of the fragile X are only beginning to be appreciated. There is usually no difficulty in detecting the fragile X which is usually present in 10-30% of metaphases if lymphocytes are grown under the currently known optimal conditions. There are, however, reports of individuals who on clinical or family history grounds would appear to be certain to have this chromosome in which it cannot be detected at all or barely detected. For example, only one of a pair of brothers originally-studied by Harvey er al. (1977) showed the fragile X. After repeated study the second brother was found to have this in only 3% of cells (Sutherland, 1979~).Jacobs et al. (1980) have suggested that the fragile X should be detected in 4% or more of metaphases before an individual is considered to have it, although Rhoads et al. (1982) reported a probable obligate carrier female with 3% of her cells expressing a fragile X on one occasion and only 1 in 125 cells on another. This 4% rule would appear to be conservative since an apparent fragile X (as distinct from the 6q26 autosomal lesion) has not been seen in normal individuals in spite of extensive study in the author’s laboratory. Herbst er al. (198 1) suggested 1% might be a better cut off point to use than 4%. Proops and Webb (1981) reported the fragile X in up to 3% of lymphocytes of individuals who probably did not have this chromosome but it is not clear whether they excluded the 6q26 lesion from their data. No fragile X was seen in seven normal males studied in detail by Jennings et al. (1980). Jacobs et al. (1980) recorded a control female with fragile X in 3389 cells. In the author’s experience any individual in whom even one fragile

THE FRAGILE X CHROMOSOME

121

X chromosome is seen should be regarded as probably having the chromosome until this can be disproved by extensive and repeated chromosome studies or an improvement in technology in this area. This holds particularly when there is good family or clinical suspicion. Soudek et al. (1981) have claimed that the proportion of cells showing the fragile X is a familial character and that most members of any one family will have similar frequencies of expression. However, Proops and Webb (1981) remarked upon the inconsistency within the same family. Rhoads et al. (1982) noted individuals to have similar frequencies of expression when sampled over a period of several months. In females, expression of the fragile X appears to be a different problem from that in males. In many females who are obligate carriers of the fragile X it has not been demonstrated. This problem has been encountered and verified by almost all those who have studied females who are obligate or potential carriers of this chromosome. It appears that the proportion of metaphases showing the fragile X decreases with advancing age. Many obligate carriers aged 30 years and above either do not express the fragile X or do so in a very low proportion of metaphases. On the other hand, in females who are potential carriers and aged 20 years or less (these are usually the sisters of young retarded males with the fragile site) the proportion found to have the fragile site is close to 50% (Sutherland, 1979~).Howard-Peebles (1980) has suggested that there may be two types of families with the fragile X, those in which the females are dull and readily express it regardless of age, and those in which they are of normal intelligence and in which expression decreases with age. Jacobs et al. (1980) have claimed that there is a correlation between the frequency of expression of the fragile X in females and their IQ, as well as their age, with the duller females having a higher frequency of expression. They suggest that it is the brighter females (and consequently those with absent or very low frequencies of expression) who are most likely to reproduce and be encountered in family studies as obligate carriers possibly making the apparent age affect either an illusion resulting from ascertainment bias or possibly the result of two different factors affecting expression. Rhoads et al. (1982) found the correlation between IQ and frequency of expression in several carrier females in their Japanese family contrary to the suggestion of Howard-Peebles (1980) that there are two types of family in this regard. Herbst et al. (1981) were also unable to support this suggestion of Howard-Peebles (1980). In those young carrier females reported by Sutherland (1979~)there was only one who was regarded as dull so this does not support the IQ as opposed to age association with expression at least in younger females. Jacobs et al. (1980) put forward two hypotheses to account for problems of expression of the fragile X in females. The first is that there is selection against cells in which the active X is fragile and that if the fragile site is more easily demonstrated when it is on an active X chromosome there will be a decrease in

122

GRANT R. SUTHERLAND

the proportion of X chromosomes expressing the fragile X as age increases. This hypothesis depends upon the easier demonstration of the fragile X on active X chromosomes and there is no evidence to suggest that this is so and some to suggest otherwise. The second hypothesis of Jacobs er al. (1980) is that the chromosome material distal to the fragile site may be lost from some cells and that if it is lost from the active X, the cell dies but if from the inactive X the cell survives. This would lead to selection of cells in which the active X did not have the fragile site, the deleted inactive X not being able to be detected cytologically would appear normal and there would be an apparent decrease in fragile sites with increasing age. Since carriers with lower intelligence are presumably the result of differential X inactivation they would start out with a higher proportion of active X fragile chromosomes than carriers of normal intelligence. Both the above hypotheses are speculative but are the only ones put forward to date to help explain the puzzling and frustrating behavior of the fragile X chromosome in females. Unfortunately FUdR induction of the fragile X does not enhance expression in female carriers where this is low or absent (Rhoads ef al., 1982; Brookwell er al., 1982). Much more data on females who are carriers or potential carriers are required. B. OTHERCELLTYPES

Almost all the above discussion of fragile X chromosomes has pertained to their expression in PHA-stimulated lymphocyte cultures. Most studies on fragile sites have used these cells and only limited studies have been performed on other cell types. 1. Bone Marrow Only two studies of bone marrow chromosomes on individuals with folate sensitive fragile sites have been reported. The late Dr. H. R. McCreanor (personal communication) found the site at 2q13 in 36 out of 168 bone marrow metaphases but the technique used was not recorded. Sutherland (1979b) examined 200 metaphases from a boy with the fragile X but did not detect it in the bone marrow. This study employed an in virro time of only 2 hours. It would have been of interest to culture the bone marrow for longer in folate-free medium or in the presence of FUdR and so determine whether the fragile X could be induced. These very limited data do not indicate whether fragile sites are expressed as fragile sites in vivo, a question of critical importance to the above hypotheses relating to expression of the fragile X in females and possible deleterious effects of other fragile sites (Sutherland, 1982b) in heterozygotes.

THE FRAGILE X CHROMOSOME

123

2. Lymphoblastoid Cell Lines (LCL) LCL from individuals with fra(2)(q13) and the fragile X were examined by Sutherland (1979b) and under conditions of folic acid and thymidine deprivation were not found to express the fragile sites. Subsequently it has been confirmed that the fragile X is not seen in these cells under such conditions but its expression can be induced by FUdR (Jacobs et al., 1982). The use of LCL, with induction of fragile sites by FUdR, may provide a useful system for studying fragile sites, the study of which until now has been hampered by the need to collect fresh blood samples from patients whenever experimental work was done. Furthermore, the expression of the fragile X in these lines derived from female carriers may provide insight into this difficult area and possibly provide a reliable means of carrier detection. 3. Fibroblasts Fibroblasts have been used to prepare chromosomes to be examined for fragile sites without success by Fraccaro et al. (1971) and Magenis et al. (1970). Ferguson-Smith (1973) found the fragile site at 2q13 in fibroblasts. Sutherland ( 1979b) examined fibroblasts cultured under conditions suitable for the demonstration of fragile sites in lymphocytes from carriers of the fragile sites at 2q13, lOq23, 1 lq13, 1 6 ~ 2 22, 0 ~ 1 1 ,and Xq27. Some of the autosomal fragile sites were seen in up to 4% of metaphases but the fragile X was not seen in fibroblasts from three individuals. It was not until Jacky and Dill (1980) demonstrated the fragile X in fibroblasts by severe restriction of folic acid and thymidine that the possibility of using these cells for studies of fragile sites became feasible. Unfortunately the method of Jacky and Dill (1980) has proved difficult to reproduce consistently (Jacobs et al., 1980; Turner et al., 1980a; Mattei et al., 1981). The development of reliable methods for the demonstration of fragile sites in fibroblasts has proceeded slowly. Glover (1981) reported inducing the fragile X in 20 and 25% of fibroblasts using FUdR at concentrationsof 0.05 or 0.1 pM, 24 or 48 hours prior to harvest. Tommerup et al. (1981a) reported generally lower frequencies of expression in two males and one female studied using a range of FUdR concentrations added 24 hours prior to harvest. Fonatsch (1981b), although only having studied one male, reported having induced the fragile X in up to 71% of metaphases in fibroblasts cultured in Dulbecco’s medium with the folate antagonists methotrexate and aminopterine. Mattei et al. (198 1) reported inducing the fragile X reliably in fibroblasts using medium 199 and methotrexate. Several groups (Tommerup et al., 1981a; A. Daniel, R. Brookwell, G. Turner, and J. Fishburn, 1981, in Hecht et al., 1982; Jenkins et al., 1981) have reported demonstration of the fragile X in the fibroblasts of female carriers who did not express it in their lymphocytes. If this finding can be confirmed and

124

GRANT R. SUTHERLAND

extended then a reliable method of carrier detection may become possible. Jenkins et al. (1981) have used FUdR to induce expression of the fragile X in cultured amniotic fluid cells thus making prenatal diagnosis of the fragile X possible. However, in view of the difficulties involved in this area Sutherland and Jacky (1982) have suggested that this be approached with great caution. 4. Somatic Cell Hybrids

The only report of the fragile X in somatic cell hybrids is that of Bryant et al. (1981) who attempted to determine whether the normal genome could suppress fragile site expression by complementation. Expression of the fragile X was not suppressed by the normal genome.

V. Genetics All the known fragile sites appear to behave in a Mendelian codominant fashion. Only one has been subjected to segregation analysis and no distortion of expected segregation ratios was observed (Sutherland, 1982b). There has been the suggestion that the fragile X may not follow expected ratios and be preferentially transmitted (Harvey et al., 1977). The same possibility has been raised for X-linked mental retardation without the fragile X (Renpenning et al., 1962). There is great difficulty in trying to establish preferential transmission of either form of retardation because of problems of ascertainment. Families in which there are multiple affected individuals are much more likely to be ascertained than those with small numbers of or single affected individuals. Indeed, many of the families which have been studied to date were ascertained because of mental retardation which followed an X-linked pattern of inheritance. Such families are likely to include more affected males and more carrier females than families identified via a single individual. Howard-Peebles et al. (1979) found 5 1% of the males in their families to have the fragile X but this was without any correction for ascertainment bias. If preferential transmission of the fragile X does occur this needs to be confirmed because it has major implications for genetic counselling. Perhaps the best way of studying this problem would be prospectively. There should be no bias in a recording of all the offspring born (or prenatally diagnosed when this becomes routine) to known carrier females. Such data should finally determine the segregation pattern shown by the fragile X. The racial origin of most fragile X males has been European (Herbst, 1980) but they have been identified in American blacks (Howard-Peebles and Stoddard, 1980a), Japanese and Filipino (Rhoads et al., 1982), several of the racial groups in South Africa (Venter et al., 1981), and Australian aboriginals (Turner, 1981). Hence it would appear that the fragile X will be found to be present in most racial groups where it is sought.

THE FRAGILE X CHROMOSOME

125

There have been anecdotal reports of a possible association between fragile sites and two separate phenomena, the first being an increased incidence of the fragile X in individuals with other major chromosome abnormalities such as XXY (Wilmot et al., 1980), XYY (McCarthy, 1981), Down syndrome (Jacobs et al., 1980; J. Lafourcade, personal communication to H. Riveira et a l . , 1981), and Trisomy 8 (de Grouchy, 1981;Turleau et a l . , 1979). In the Dunn etal. (1963) family a Down syndrome child was produced by a carrier female. Kaiser-McCaw and Hecht (1980) reported a female with a deleted fragile X, del(X)(q22q26),the presence of the fragile site proving that the deletion was interstitial. Shabtai et al. (1980) recorded an XXY male and his mother with the fragile site at 16q22. Second, there might be an increased incidence of other chromosome abnormalities in families in which chromosomes with fragile sites are segregating (Cot6 etal., 1978;Scirensen eral., 1979). This latter phenomenon is most likely the result of ascertainment bias but the former one is difficult to assess since it is also undoubtedly influenced by selective case reporting. Only further data will determine whether female carriers of the fragile X are more liable to produce aneuploid gametes, with or without the fragile X, than are noncarriers. In an X-linked disease where the reproductive fitness of affected males is zero and the mutation rates in the two sexes equal, one-third of affected males should be new mutants. The reproductive fitness of males with the fragile X is certainly not zero (G. C. Webb et al., 1981; Nielsen et al., 1981b) but probably closely approaches it. Because of the difficulty in excluding the fragile X from mothers of sporadic fragile X males it is difficult to be certain that any sporadic males are new mutants. Several have been found where this is the most probable explanation of their origin. On the other hand, there is no convincing example of a new mutant for other fragile sites and such claims are most probably due to failure to detect the fragile site in one parent (Sutherland, 1982a). There has been only one reported demonstration of linkage between a fragile site and another genetic marker; this was the fragile site at 16q22 and HPA (Magenis et a l . , 1970). The fragile site at 6p23 has been formally shown to be linked to HLA (Mulley and Sutherland, unpublished). Fried and Sanger (1973) found possible linkage between a form of X-linked mental regardation and XG but with the localization of XG to the opposite end of the X chromosome from the fragile site there can be no linkage between these markers. The fragile X status of Fried’s (1972) family is unknown. Linkage has been formally demonstrated between the two fragile sites on 1Oq and a map distance of 11 female cM between them calculated (Sutherland et a l . , 1982). Since fragile sites are manifested as defects in chromosome compaction for mitosis it is possible that if such defects were present during meiosis they could affect crossing-over and distort the genetic length of the chromosome near them. Only accurate gene localization near fragile sites, by means other than segregation with fragile sites, together with information from segregation analysis will determine this.

126

GRANT R. SUTHERLAND

The genes HPRT and G6PD have been mapped closely to the fragile site at Xq27 although no linkage studies with the G6PD locus have been reported. Carroll and Howard-Peebles (1981) found normal levels and electrophoretic mobilities of G6PD in erythrocytes and fibroblasts of fragile X males. Similar findings for G6PD were made by Mareni and Migeon (1981) who also measured mutation rate at the HPRT locus and found no difference between fragile X males and controls. This work of Mareni and Migeon (1981) suggests that the difficulty in obtaining expression of the fragile X in some cells is not because the chromosomal material distal to the fragile site has been lost. There is very little information on the population cytogenetics of any of the fragile sites except for the one at 10q25 which is polymorphic in the Australian population (Sutherland, 1982b). There is a suggestion, based on inadequate numbers, that the autosomal folic acid-sensitive fragile sites may be more common among the mentally retarded than unselected neonates (Sutherland, 1982a), but this work needs to be extended before this suggestion can be confirmed or refuted. The available data on the population cytogenetics of the fragile X are shown in Table 11. This shows that the fragile X is not common, is not usually found in other than retarded males and their female relatives, and that apparently normal males with the fragile X must be rare. TABLE I1 POPULATrON CYToGENETIC DATAON THE FRAGILE x ______

Series Sutherland (1982b)

Turner et al. (1980b)

Soudek and Gorzny (1980)

Group Male neonates Female neonates Patients referred for diagnostic chromosome studies All males in Minda Home (institutionalized retardates) Strathmont (institutionalized retardates) Males with 36 < IQ < 70 Other males Females Totally dependent profoundly mentally retarded residents of Ru Rua Males Females Girls with 55 < IQ < 75 Normal phenotype Abnormal phenotype Normal adult males

~

Number studied

Number fra(X)

522 497 2231

0 0 7

298

6

98 6 35

2 0 0

42 45

0 0

12 56 57

5

0 0

THE FRAGILE X CHROMOSOME

127

The incidence of the fragile X and its contribution to mental handicap in males and females are not known. Turner and Turner (1974) estimated that the prevalence of all forms of X-linked mental retardation resulting in an IQ in the range 30-55 (moderate mental retardation) was 0.53/1000 males (Turner and Opitz, 1980). In a more recent examination of the same population Fishburn et al. (1982) estimated this prevalence as 0.5511000 males. If approximately one-half of X-linked mental retardation is due to the fragile X (Herbst, 1980; Brookwell et af., 1982) and if two-thirds of affected males come into the IQ range 35-55, then the incidence of the fragile X would be approximately 0.40/1000 males. Fishbum et al. (1982) estimated the prevalence of fragile X males with moderate mental retardation to be 0.19/1000 males. Herbst and Miller (1980) have estimated that 0.92/1000 live born males in British Columbia would have the fragile X. This latter estimate is probably an overestimate since, after the increased infant mortality in Down syndrome this would make the fragile X a more common cause of mental retardation than Down syndrome in males. Enough work has been done to know that this is not so. Sutherland (1982a) has shown that in an institution in which 10-15% of the inmates have Down syndrome only 1.6% had the fragile X. This would indicate that mental retardation due to the fragile X is less common than Down syndrome but since Turner (1981) and Fishburn et af. ( 1982) claim that fragile X males are less liable to institutiohalization because of their relatively normal appearance and amicable nature than other males with the same degree of retardation the fragile X males may be underrepresented in the institutional sample. All estimates of the incidence of the fragile X are unreliable to a greater or lesser extent because the standard assumptions used when making estimates involving X-linked conditions, that the condition is lethal (reproductively) in the male and fully recessive in the female, just do not apply to the fragile X. The contribution of the fragile X to mental handicap in females remains uncertain. Turner et al. (1980b) and Fishburn er al. (1982) have suggested that as many as 30% of carriers are borderline or mildly retarded and their studies remain the only ones which have examined a population of retarded girls. Again this aspect of fragile X work is bedevilled by the problem of ascertainment and this question is in urgent need of an answer for genetic counselling.

VI. Clinical Aspects The autosomal fragile sites have usually been considered to be without phenotypic effect (Sutherland, 1979b). Homozygotes for the folate-sensitiveautosoma1 fragile sites have not been identified but Sutherland (1979b) has speculated that such homozygosity could be deleterious. Homozygotes for the BUdR requiring fragile site at lOq25 are phenotypically normal (Sutherland, 1981) as are

128

GRANT R. SUTHERLAND

probable homozygotes for fra( 16)(q22) (Schmid et a f . , 1980). Sutherland (1982a) found the autosomal fragile sites to be 10 times more common among institutionalized retardates than unselected newborns; this difference was statistically significant although the groups studied were small and this work needs repeating on other groups. If this finding is confirmed then heterozygotes for the autosomal fragile sites may be at some increased risk of being mentally retarded although the majority will not be. The only fragile site which is unequivocally associated with a mental retardation syndrome is the one on the X chromosome. X-linked mental retardation has been recognized for many years and achieved respectability as a result of the publications of Lerke (1972, 1974). The main publications prior to this were those of Martin and Bell (1943), Dunn et al., (1963), and Renpenning et a f . (1962). The name of the senior author of this last paper had come into eponymous use to describe “nonspecific” X-linked mental retardation. However, since the family described by Renpenning et al. (1962) does not have the fragile X chromosome (Fox et al., 1980) the term Renpenning syndrome should be restricted to one of those forms of X-linked mental retardation which does not have the fragile X chromosome. Indeed there would appear to be at least four categories of X-linked mental retardation which have now been recognized clinically (Turner and Opitz, 1980; Fishburn et al., 1982) and Herbst and Miller (1980) have estimated that there could be between 7 and 19 X-linked genes responsible for X-linked mental retardation. Good reviews of the development of X-linked mental retardation as a clinical concept have been published (Turner and Opitz, 1980; Herbst, 1980) and only the form associated with the fragile X will be considered further. The form of X-linked mental retardation associated with the fragile site has no generally accepted succinct name. Turner and Opitz (1980) suggested MOMX syndrome for macroorchidism-marker X but this is inappropriate since macroorchidism is not a constant or the only clinical feature of the condition and is certainly inappropriate to apply to those females who are retarded as a consequence of carrying the fragile X. Fragile X-linked mental retardation was suggested by Kaiser-McCaw et al. (1980) and modified to fragile (X)-linked mental retardation by Brookwell et al. (1982) and this is preferred since it can be applied to either sex. A. THEPHENOTYPE IN MALES Before the fragile X had been recognized as a common entity there were a number of reports of a syndrome of mental retardation associated with macroorchidism (Cant6 et al., 1976, 1978; Turner et af., 1975; Ruvalcaba et al., 1977) which was thought to be X-linked. After the discovery of the conditions necessary to demonstrate the fragile X it was shown by Sutherland and Ashforth (1979) Turner et al. (1978), and Rivera er al. (1981) that the form of X-linked

THE FRAGILE X CHROMOSOME

129

mental retardation with macroorchidism and that with the fragile X were the same entity. It now appears that X-linked mental retardation with macroorchidism and other features of fragile (X)-linked mental retardation can exist without the fragile X (Herbst er al., 1981; Fishburn et al., 1982). Apart from widespread interest in the association of macroorchidism with the fragile X there have been few detailed clinical studies of a series of males with this chromosome. The first such study was that of Turner et al. (1980a) who examined 25 males from 7 families. They proposed a clinical syndrome in males with the fragile X composed of the following features: 1. Mental retardation which was usually moderate but varied from severe to mild. 2. Speech delay greater than motor development delay. The speech tended to be narrative and compulsive and was referred to as litany speech. 3. Behavior problems in some cases which had been labeled as autistic and hyperactive. 4. Macroorchidism, generally present in adults and possibly in prepubertal males. 5 . Birth weight greater than that of siblings, the mean of 22 males was on the seventieth percentile. 6. Increased head circumference before puberty returning to normal in adulthood. 7. Normal but characteristic facial appearance due to (a) large forehead with supraorbital fullness, (b) prominent chin, (c) large ears, and (d) pale irides (in 22 of 25 males examined). This concept of a syndrome comprising any more than mental retardation and possibly macroorchidism associated with the fragile X has been challenged (Kaiser-McCaw and Hecht, 1980; Kaiser-McCaw et al., 1980). Each of the components of this syndrome will be examined. Mental retardation is almost always present. Proops and Webb (1981) recorded IQs ranging from 20 to 65 in 11 males who unequivocally had the fragile X. In the original family of Lubs (1969) one male had a measured IQ of 70 but others in the family were more severely retarded. The males described by Jennings et al. (1980) were all severely retarded. Martin et al. (1980) reported brothers with IQs of 57 and 67. Gustavson et al. (1981) reported males with IQs from severely retarded to 70. There are numerous other reports which taken together indicate that most of the males are moderately retarded, however, it would appear that there is a broad range of IQs shown by fragile X males with a small proportion coming into the normal range. Some of the mildly retarded males have reproduced (Jacobs et al., 1980), as have some of the normally intelligent ones (G. C. Webb et af., 1981; Nielsen et al., 1981b).

130

GRANT R. SUTHERLAND

The spectrum of intellectual development in fragile X males raises the possibility of this chromosome being present in normal males. Daker et al. (1981) reported brothers of normal intelligence who appear to have the fragile X but full family studies were not carried out and folk acid sensitivity of the fragile X was not demonstrated. Rhoads et al. (1982) recorded a probable hemizygote of normal intelligence who on pedigree data has transmitted the fragile X to a retarded grandson; strangely, the fragile X could not be demonstrated in this normal man. Nielsen et al. (1981b) described a family in which three nonretarded males apparently transmitted the fragile X to retarded grandchildren. G . C. Webb et al. (1981) were the first to document the fragile X in a normal male, his daughter and retarded grandson. At present it is reasonable to conclude that the great majority of fragile X males will be retarded although in some instances only mildly, with a small number having normal intellectual function. A practical consequence of this is that the fragile X can be transmitted from normal males to their retarded grandsons (G. C. Webb et al., 1981) and this pattern of segregation should always be considered when carrying out family studies. Furthermore, nonretarded male siblings of fragile X males should have their chromosomes studied. The question of a specific developmental problem in regard to speech has been considered by Herbst (1980) and Herbst et al. (1981) who concluded that there was no association between language abilities and the fragile X. This conclusion is in the face of many reports summarized by Herbst (1980) in which a verbal problem has been either noted clinically or documented by a difference between verbal and performance IQ scores. Unfortunately most of this work was done before the fragile X was recognized to be present in a proportion of cases of Xlinked mental retardation and is based on a heterogeneous group with this diagnosis. Jacobs et al. (1980) reported speech patterns similar to the litany speech of Turner et af. (1980a) and suggested it was characteristic enough to suspect the fragile X on this basis alone. Rhoads et al. (1982) found a relative verbal disability among the affected males in their Japanese family and the only one fully assessable had litany speech. Howard-Peebles et al. (1979) and HowardPeebles and Stoddard (1979) examined the verbal abilities of individuals with Xlinked mental retardation with and without the fragile X and found no distinctive pattern. The verbal disabilities of the two groups were not different from each other or from other retarded groups studied, however, the numbers studied were small and the authors indicated that further studies of males with X-linked mental retardation were required. Further documentation of the verbal abilities of males with the fragile X is required before a deficit in this area can be regarded as proven. Turner et al. (1980a) reported behavior problems in only three of the males they studied. Rhoads et af. (1982) recorded a Japanese male with autistic behavior and hyperactivity. Herbst (1980) considered behavior problems in her series,

THE FRAGILE X CHROMOSOME

131

and although they had been recorded in more than half the males concluded that they may be no more a feature of X-linked mental retardation (the heterogeneous group) than of other forms of mental retardation. Brown et al. (1982) recorded four fragile X males with autism. Most authors have studied adults with the fragile X and there is little doubt that these rarely have behavior problems and are not difficult to manage either in institutions or in the community (Turner er al., 1980a). Giraud et al. (1976) noted behavior problems in two of five fragile X boys. Lejeune (1982) noted severe behavior problems, including psychotic complication of mental retardation and autism, in 8 out of 16 fragile X males. The author’s impression from dealing with a number of children with the fragile X is that apart from mental retardation, behavior problems are the main feature of the condition which causes parental complaint. The problems have mostly been related to hyperactivity but some of the children had been labeled as autistic prior to diagnosis and others have psychotic features to their behavior. In general, these problems appear to have improved with age. Again, more data are required to document a possible association between the fragile X and childhood behavior problems. There still appears to be confusion about the relationship between macroorchidism and the fragile X. Turner et al. (1978), Sutherland and Ashforth (1979), Sutherland et al. (1980a), and Rivera et al. (1981) concluded that the form of X-linked mental retardation associated with macroorchidism and that associated with the fragile X were the same entity. Jacobs et al. (1979) claimed that there was no correspondence between the two forms of mental retardation and that either could exist separately but later (Jacobs et al., 1980) withdrew this claim emphasizing the point made by Howard-Peebles and Stoddard (1980b) that clinical impressions of macroorchidism were useless and that actual measurement of testicular volume was required. It would now seem that X-linked mental retardation with macroorchidism [and the other features of fragile (X)-linked mental retardation] can exist without the fragile X being present (Herbst et al., 1981; Fishburn et al., 1982). Such a family was described by Ruvalcaba et al. (1977) where Jennings et al. (1980) were unable to demonstrate the fragile X. This condition will be considered later in Section VII. Testicular volume is a difficult parameter to measure in the living male and can be approached using the Prader orchidometer which has limitations in that the largest bead on the standard model is 25 ml. For testes larger than this (and for smaller ones) length and width can be measured and the volume calculated from the formula IIl,lw2 where 1 is the length and w the width of the testis cant^ er al., 1976). Normal data have been provided for Caucasian males by Prader (1974), Farkas (1972), and Zachmann et al. (1974) and it has been suggested (Rhoads et al., 1982) that different criteria of normality may be required for other racial groups. Benign macroorchidism has been described by Padron et al. ( 1979) who found 15 out of 202 normal Cuban males to have testes greater than

132

GRANT R. SUTHERLAND

25 ml in volume. Of these, six had volumes calculated from measurement to be greater than 2 SD above the mean and ranged from 58 to 74 ml. Semen analysis was normal but the volume of ejaculate and sperm counts were much greater than in males with normal testicular volumes. An analysis of the published and unpublished testicular volumes of retarded adult males of Caucasian origin with the fragile X, ascertained via mental retardation rather than macroorchidism, shows that the mean testicular volumes of 83 such males is 48 ml. The range is from 15 to 127 ml (Jacobs et al., 1980). The distribution (Fig. 7) is skewed such that the modal volume is in the range 35-40 ml. Hence it would appear that the fragile X chromosome has the effect of increasing the mean testicular volume in males from about 19 ml (Zachmann et al., 1974) in normal males to 48 ml and about 80% of fragile X males will have a mean testicular volume of greater than 30 ml. There can be little doubt that macroorchidism is a feature of most males with the fragile X, and in all families with the fragile X at least some of the males with this chromosome have macroorchidism. Histological studies of enlarged testes from fragile X males have been carried out by cant^ et al. (1976, 1978), Ruvalcaba et al. (1977), Bowen et al. (1978),

2 20J

f

B

a

w m

5 = 10-

0

MEAN TESTICULAR VOLUME (ml)

Fic. 7. Distribution of mean testicular volume of 83 adult Caucasian fragile X males in whom macroorchidism was not a factor in ascertainment. Mean volume is the average of the right and left testicular volume.

THE FRAGILE X CHROMOSOME

133

and Turner et al. (1975) and the only consistent finding seems to be a relatively normal testis with interstitial edema. Ruvalcaba et al. (1977) concluded that macroorchidism was due to an increase of water content in the testis. Normal semen analysis was reported by Cantu et al. (1976). The use of macroorchidism as a means of screening males to identify those with the fragile X has produced conflicting results. Brown et al. (1981) screened 15 males with nonspecific mental retardation and found five with one or both testicles having a volume of greater than 25 ml; four were shown to have the fragile X. Nielsen et al. (198 la) screened 178 retarded males and, using the same criteria as Brown et al. (1981), identified 10 with macroorchidism of whom only one had the fragile X. On the other hand, Pozsonyi et al. (1981) screened 818 retarded males, again using the same criteria as Brown et al. (1981), and found 190 with macroorchidism of whom only nine had the fragile X. This latter finding would suggest that macroorchidism is either very common among the retarded group studied or that the criteria for determining it were wrong. Some of the males identified in this way presumably had X-linked mental retardation with macroorchidism but without the fragile X. In the survey of Fishburn et al. (1982), of 18 families with X-linked mental retardation and macroorchidism, 12 had the fragile X and 6 did not. There are only limited data available on birth weight of fragile X males. Those studied by Turner et al. (1980a) had an average birth weight on the seventieth percentile and in 12 of 16 their birth weight was on average greater than that of their unaffected siblings. In the two families of Ruvalcaba er al. (1977) birth weights were noted to be above the nintieth percentile for gestational age. Herbst et al. (1 98 1) recorded birth weights of nine fragile X males and only one had a birth weight greater than all his siblings. Hence the information on birth weights is equivocal and more data are needed on this aspect of development. There is not much data on head circumference in children with the fragile X other than that presented by Turner et al. (1980a). Jennings et al. (1980) reported the head circumference on a 5-year-old boy to be greater than the nintieth percentile. Jacobs et al. (1980) recorded head circumferences on three children and two of these are at the nintieth percentile. Herbst et al. (198 1) recorded head circumferences of two boys and seven adult fragile X males and all were normal. The limited data available indicate probable increased head circumference in children but not adults (Turner et al., 1980a), although Rhoads et af. (1982) recorded an increased head circumference in adult Japanese males with the fragile X. The characteristic facial appearance described by Turner et al. (1980a) has been confirmed by others but challenged by some. Jacobs et al. (1980) referring to this remarked they appear “to be cast in the same mould.” Jennings et al. (1980) state that facial appearance is unique and describe it as mid-facial hypoplasia with large prominent ears and prognathism. Fox et al. (1980) found the

134

GRANT R. SUTHERLAND

characteristic fragile X syndrome in members of the original Dunn et al. (1962) family which has the fragile X but not in that described by Renpenning et al. (1962) which does not have the fragile X. Herbst et al. (1981) noted normal faces in many of their fragile X males but suggested a tendency toward long narrow faces, prominent jaws, and large or lop ears. Kaiser-McCaw and Hecht (1980) have challenged the existence or at least the constancy of the phenotype after study of a number of retarded males in a large Spanish kindred. One feature of the fragile X syndrome not mentioned by Turner er al. (1980a) is the hypogonadal appearance of some of the adult fragile X males. This can include sparse body hair with a female pubic hair distribution and gynecomastia. In their original description of the syndrome Turner et al. (1975) reported one male to have minimal beard growth, female pubic hair distribution, gynecomastia, and striae on the buttocks, abdomen, and axillae; this man’s brother was similarly affected in this way. Ruvalcaba er al. 1977) commented upon a male having lack of secondary sexual development at the age of 16.7 years. Bowen et al. (1978) recorded gynecomastia in one male, as did Webb et al. (1982). Although the endocrinological investigations of fragile X males have been normal (CantLi et al., 1976; Bowen et al., 1978; Ruvalcaba et al., 1977) this is an area which may reward further study. Numerous other clinical findings have occasionally been mentioned by various authors but the only others to occur frequently are clumsiness with poor fine motor control, large hands and feet, and an increased incidence of seizures. Rishburn et al. (1982) report exaggerated reflexes without clinical spasticity to be common in fragile X males. It would seem that from the literature and the author’s experience that there is indeed a syndrome associated with the fragile X in males (Fig. 8) but that it is variable although the variation is probably no greater than that seen in other dysmorphic syndromes, especially those associated with chromosome abnormalities. Not every fragile X male will be diagnosed clinically but as a retarded male will be worthy of chromosome study.

B. THEPHENOTYPE IN FEMALES No female homozygous for the fragile X has been described so that all clinical data on the fragile X in females are derived from heterozygotes. The main study of heterozygotes is that of Turner et al. (1980b) who karyotyped 128 mentally retarded girls of whom 72 were regarded as being physically phenotypically normal; among the 72 there were five who had the fragile X chromosome. This study suggested that 7% of girls with an IQ in the range 55 to 75 and who have no physical abnormality may be retarded because they carry the fragile X. In the families of these girls 18 heterozygotes were identified (excluding the index cases) of whom six were at least educationally retarded. This would suggest that one-third of fragile X carriers may be mildly retarded or worse. Fishburn et al.

THE FRAGILE X CHROMOSOME

135

FIG. 8. Facial appearances of five retarded fragile X males (a) aged 3 years, (b) aged 5 years, (c) aged 1 I years, (d) aged 16 years, (e) aged 62 years. Macroorchidism shown by a fragile X male, note size of testes in relation to 25 ml orchidometer bead (0.

(1982), from a more extensive study of 40 families, c o n f m that one-third of female heterozygotes are borderline or mildly mentally retarded but have no physical abnormality. Physical examination of the index cases identified by Turner et al. (1980b) showed no abnormality other than obesity in four of the five, and pale irides in two. Webb el al. ( 1 982) reported a severely retarded heterozygote (IQless than 30) with a moderately retarded niece; neither had dysmorphic features although both were mildly obese, one had bright blue irides and the other hazel irides. Many authors have recorded retarded heterozygotes but have not commented upon their physical phenotype and there is a need for further study in this area. C. TREATMENT Lejeune (1982) has claimed that treatment of fragile X males with oral or intramuscular folate derivatives has resulted in an improvement in the behavior

136

GRANT R. SUTHERLAND

of seven out of eight who had psychotic behavior. The basis of this treatment is entirely empirical since no abnormality of folate metabolism has been demonstrated in fragile X males (Jennings et al., 1980; Popovich et al., 1980). No other treatment trials have been reported and there is need for a blind trial of folate treatment to determine whether the claim of Lejeune (1982) can be substantiated. A vitamin treatment study of the mentally retarded was reported by Harrell er al. (1981) in which small increases in IQ were recorded for most of those studied except for one boy whose IQ at age 7 years was 25 to 30, but after treatment at the age of 9 years was about 90. Did this child have the fragile X?

D. GENETICCOUNSELLING AND PRENATAL DIAGNOSIS Genetic counselling in fragile X families is very difficult for a number of reasons. The inability to detect the fragile X in many obligate carriers makes carrier detection uncertain, even when females are studied at an early age. It is not possible to be absolutely certain that males with the fragile X will be retarded although the degree of uncertainty here is so small that for practical purposes this problem can be ignored. Another problem is the possibility that normal males in these families could have the fragile X and not manifest it (Rhoads et al., 1982) although again the probability of this is very low. The risks to a carrier female of having a child who has the fragile X are still uncertain and could be greater than 50% (see Section V). If this is so then some carrier females may be reluctant to embark upon prenatal diagnosis if their aim is to have a child (male or female) who does not have the fragile X. If prenatal diagnosis is offered to carrier females then there is a problem when a female fetus is found with the fragile X. Her probabilities of being a bit dull, mildly or moderately retarded, or worse are not known although Turner et al. (1980b) and Fishhurn et al. (1982) have estimated that one-third of such females are retarded to some degree. Most couples undertaking prenatal diagnosis would not wish to continue with a female pregnancy if there was a one in three chance that the child was going to be retarded and for this reason the usual practice of fetal sexing in X-linked conditions, with abortion of male fetuses, will be of limited use in fragile (X)-linked mental retardation. The concept of prenatal diagnosis has been mooted for a long time and was suggested by Lubs (1969) in his original description of the fragile X. Harvey et al. (1977) also proposed this as an option for carrier females. These suggestions were made before the difficulties in obtaining fragile X expression in fibroblasts were appreciated (Sutherland, 1977a). Jenkins et al. (1981) were the first to demonstrate the fragile X in cultured amniotic fluid cells by induction with FUdR and Shapiro et al. (1982) achieved a prospective prenatal diagnosis using the same approach. T. Webb er al. (1981) used lymphocyte culture from fetal blood sampling via fetoscopy to show that a male fetus had the fragile X. Either of these approaches should be successful in prenatally diagnosing the fragile X if

THE FRAGILE X CHROMOSOME

137

they are only utilized by those with considerable laboratory experience in demonstrating this chromosome in a variety of cell types (Sutherland and Jacky, 1982).

VII. Karyotype-Phenotype Relationship There is little doubt that the fragile X chromosome is associated with a mental retardation syndrome in most males who have it. It is also clear that a proportion of females who carry the fragile X are mildly retarded or worse. Furthermore, the mental retardation syndrome seen in males with the fragile X can exist in males in whom the fragile X cannot be demonstrated (Fishburn et al., 1982). The nature of the association between the fragile X and its associated syndrome is unclear. The possibility of a locus for the mental retardation syndrome being so closely linked to the fragile site that recombination will not usually be seen within any family could explain some of the observed facts. It could certainly account for the finding of the syndrome associated with the fragile site in some families and not in others and with the finding of normal males with the fragile X (Daker et al., 1981). It cannot however readily account for normal males transmitting the fragile X and mental retardation to their grandsons (Rhoads er al., 1982; G . C. Webb et al., 1981; Nielsen et al., 1981a). This would, on a linkage hypothesis, require such males to have married females who were carriers of the locus and for recombination to have occurred in their daughters before the recombinant chromosome was transmitted-a series of events so improbable that it can be discounted. The most likely explanation for apparently normal fragile X males is that either the genetic effect of the fragile X is nonpenetrant or only very mildly expressed. There is a suggestion in the family described by Nielsen er al. (1981b) that the normal fragile X males were less intelligent than their brothers without the fragile X who were of superior intelligence. Presumably the deleterious effect of the fragile X is imposed upon the genetic component of intellectual endowment and where this is very high even substantial impairment of it could result in normal intelligence. No fragile X male of superior intelligence has been reported. Until any further evidence to the contrary is presented it is probably safe to conclude that the fragile site at Xq27 is a cytological manifestation of the gene responsible for the mental retardation syndrome seen in association with it. The gene may not be 100% penetrant and its expression can certainly. vary both clinically and cytologically. Mental retardation seen in female carriers of the fragile X is presumably the result of differential X-inactivation. There is still the problem of those males without the fragile X but with the clinically indistinguishable syndrome of X-linked mental retardation with its associated physical findings including macroorchidism. There are several possible explanations for this phenomenon and it is not possible to choose between them at this time. There is still a paucity of clinical information about these males

138

GRANT R. SUTHERLAND

and it might be that they will be found eventually to be a separate clinical entity. If this is not so then two main possibilities arise. First, all such males have the fragile X but under conditions of culture it is not expressed. Soudek er al. (1981) suggested that fragile X families had a characteristic frequency of expression of the fragile site in lymphocyte culture and that on average males in some families had a very low frequency of expression. If Soudek’s suggestion is true, then in some families expression may be so difficult to elicit using current technology that males in these families may appear not to have the fragile X. Attempts to demonstrate a fragile X in fibroblast or lymphoblastoid cultures in these males may help resolve this matter, or further technical advances in the demonstration of fragile sites may be needed before it can be finally resolved. Second, there may be an allelic mutation which will not result in expression as a fragile site but which results in an abnormal gene product with the same phenotypic consequences as the mutation which is expressed as a fragile site, such mutation could be in the form of a small deletion. Genetic heterogeneity is commonly found in well-studied genetic diseases and there is no reason to think fragile (X)-linked mental retardation will be any different.

VIII. Conclusions The fragile X chromosome is a common cause of mental retardation in males and females. Much more information is required on the nature and effects of the fragile X in virtually every area where it has been examined from chromosome structure, the biochemistry involved in expression in different cell types, the incidence in various populations and its contribution to mental retardation, the nature of its association with abnormal phenotypes in most males and some females, its possible role in chromosome segregation of both the X chromosome carrying it and other chromosomes, and its linkage relationships with other genes on the X chromosome to its relationship to the autosomal fragile sites. Perhaps some of these questions will not be answered until recombinant DNA technology has been applied to fragile sites (Gerald, 1980); nevertheless even at this present state of rudimentary knowledge study of the fragile X chromosome is an essential part of clinical cytogenetics where its contribution to diagnosis, prevention, and possibly treatment of mental handicap is just beginning.

IX. Apologia Gerald (1981) has expressed the hope that the circumstances surrounding my finding that fragile sites depend upon conditions of tissue culture for expression (Sutherland, 1977b) would be documented. In 1975 shortly after 1 had taken up my present appointment in Adelaide I attempted to restudy some of the autoso-

THE FRAGILE X CHROMOSOME

139

ma1 fragile sites which had been found in the mid-1960s in patients studied in the Unit. This was only intended to be a short project to occupy my time until I settled into my new job and decided upon some more worthwhile activity. Between the time these patients were ascertained and my arrival the laboratory (along with many others around the world) had switched from using TC199 for lymphocyte culture and was using RPMI 1640 which I soon changed to Ham’s F10, which I had been using in Edinburgh, so that we could use a single medium for culture of lymphocytes, fibroblasts, and amniotic fluid cells. My early attempts to study fragile sites used Ham’s F10, and, needless to say, were quite unsuccessful. In late 1975 I visited my old laboratory in Melbourne and Jill Harvey, who was my successor there, showed me her work on the fragile X which was subsequently published (Harvey et af., 1977). I guessed that this marker X chromosome (as it then was) probably had a fragile site similar to the autosomal ones I was attempting to restudy (mainly because of the double satellited appearance occasionally seen) and guessed that I would not be able to demonstrate it. On returning to Adelaide I briefly tried a few changes to my culturing technique attempting to induce the vanished autosomal sites by reproducing the Melbourne conditions. Initially I tried steptomycin in my Ham’s F10 because this was in use in Melbourne, whereas 1 was using only penicillin. Eventually I decided to try and duplicate the Melbourne conditions as faithfully as I could and purchased some TC199. Under these conditions my vanished autosomal fragile sites miraculously reappeared and study of a few families suspected of having X-linked mental retardation soon allowed me to confirm the common occurrence of the fragile X and provided material for further studies. To my chagrin, one of the fragile X males had been studied and pronounced to have a normal karyotype by me during my period in the Melbourne laboratory. Jill Harvey assured me that checking of the preparation I had examined showed it to be of fairly poor quality but this was probably just Jill being nice to me. Had I been observant enough at the time, Lubs’ initial discovery would well have been confirmed shortly after it had been made.

ACKNOWLEDCMENTS

I thank Dr. P. B. Jacky for helpful discussion during the preparation of this article and many authors who sent me preprints of work in press. This work has been supported by grants from the National Health and Medical Resource Council of Australia, The Channel 10 Children’s Medical Research Foundation, and The Adelaide Children’s Hospital Research Trust.

REFERENCES Annekn, G . , and Gustavson, K. H. (1981). Hereditas 95, 63-67. Bowen, P., Biederman, B., and Swallow, K. A. (1978). Am. J . Med. Genet. 2, 409-414.

140

GRANT R. SUTHERLAND

Brookwell, R., Daniel, A., Turner, G.,and Fishburn, J. (1982). Am. J. Med. Genet. 13, 139-148. Brown, W. T., Mezzacappa, P. M., and Jenkins, E. C. (1981). Lancet 2, 1055. Brown, W. T., Friedman, E.,Jenkins, E. C., Brooks, J., Wisniewski, K., Raguthu, S . , and French, J. H. (1982).-Lancet 1, 100. Bryant, E. M., Hoehn, H., and Martin, G.M. (1981). Am. J. Hum. Genet. 33, 99A. Buhler, E. M., Luchsinger, U., Bilhler, U. K., Mehes, K., and Stalder, G.R. (1970). Hum.Genet. 9,97-104. Cantd, J. M., Scaglia, H. E., Medina, M., GonAez-Diddi, M., Morato, T.,Moreno, M. E., and Perez-Palacios, G. (1976). Hum. Genet. 33, 23-33. Canhi, J. M., Scaglia, H. E., Gonzhlez-Diddi, M., Hernhdez-Jhuregui, P., Morato, T., Moreno, M. E., Giner, J., Alchtar, A., Herrera, D., and P&ez-Palacios, G.(1978). Hum. Genet. 41, 33 1-339. Carroll, A. J., and Howard-Peebles, P. N. (1981). Am. J. Hum. Genet. 33, 826-828. CBt6, G.B., and Katsantoni, A. (1980). Ann. Gdndt. 23, 241-243. CBt6, G.B., Papadakou-Lagoyanni, S., and Pantelakis, S. (1978). Ann. Gdndt. 21, 209-214. Daker, M. G.,Chidiac, P., Fear, C. N., and Beny, A. C. (1981). Lancet 1, 780. de Grouchy, I. (1981). Inr. Congr. Hum. Genet.. 6rh, Israel. Dunn, H. G.,Renpenning, H., Gerrard, J. W., Miller, J. R., Tabata, T., and Federoff, S. (1963). Am. J . Menr. Defc. 67, 827-848. Eberle, G.,Zankl, H., and Zankl, M. (1981). Lancet 1, 557. Erbe, R. W. (1975). N. Engl. J. Med. 293, 753-757. Farkas, L. G. (1972). Am. J. Phys. Anthropol. 34, 325-328. Ferguson-Smith, M. A. (1973). Ann. Gdnnh. 16, 29-34. Ferguson-Smith, M. A. (1977). Rec. Adelaide Child. Hosp. 1, 278-286. Fishburn, J., Turner, G.,Daniel, A., and Brookwell, R. (1983). Am. J . Med. Genet. (in press). Fonatsch, C. (1981a). Lancer 1, 494. Fonatsch, C. (1981b). Hum. Genet. 59, 186. Fox, P., Fox, D., and Gerrard, J. W. (1980). Am. J. Med. Genet. 7, 491-495. Fraccaro, M., Lindsten, J., Tiepolo, L., and Ricci, N. (1972). Chromosomes Today 3, 138-146. Fried, K. (1972). Clin. Genet. 3, 258-263. Fried, K., and Sanger, R. (1973). J. Med. Genet. 10, 17-18. Gardner, A. P., Howell, R. T., and McDermott, A. (1982). Lancet 1, 101. Gerald, P. S. (1980). New Engl. J. Med. 303, 696-697. Gerald, P. S. (1981). Pediatrics 68, 594-595. Giraud, F., Ayme, S., Mattei, J. F., and Mattei, M. G. (1976). Hum. Genet. 34, 125-136. Glover, T. W. (1981). Am. J. Hum. Genet. 33, 234-242. Glover, T. W., and Howard-Peebles, P. N. (1981). Am. J . Hum.Genet. 33, 104A. Gustavson, K.-H., Holmgren, G.,Blomquist, H. G . , and Mikkelsen, M. (1981). Clin. Genet. 19, 101-1 10. Harrell, R. F., Capp, R. H., Davis, D. R., Peerless, J., and Ravitz, L. R. (1981). Proc. Natl. Acad. Sci. U.S.A. 78, 574-578. Harvey, J., Judge, C., and Wiener, S. (1977). J . Med. Genet. 14, 46-50. Hecht, F., Jacky, P. B.,and Sutherland, G . R. (1982). Am. J. Med. Genet. 11, 489-495. Herbst, D. S. (1980). Am. J. Med. Genet. 7, 443-460. Herbst, D. S., and Miller, J. R. (1980). Am. J. Med. Genet. 7, 461-469. Herbst, D. S., Dunn, H. G..Dill, F. J., Kalousek, D. K., and Krywaniuk, L. W. (1981). Hum. Genet. 58, 366-372. Howard-Peebles, P. N. (1980). Am. J. Med. Genet. 7, 497-501. Howard-Peebles, P. N., and Howell, W. M. (1979). Cyrogener. Cell Genet. 23, 277-278. Howard-Peebles, P. N., and Howell, W. M. (1981). Cyrogener. Cell Genet. 31, 115-119.

THE FRAGILE X CHROMOSOME

141

Howard-Peebles, P. N., and Pryor, J. C. (1979). New Engl. J . Med. 301, 166. Howard-Peebles, P. N., and Pryor, J. C. (1981). Clin. Gener. 19, 228-232. Howard-Peebles, P. N., and Stoddard, G. R. (1979). Hum. Genet. 50, 247-251. Howard-Peebles, P. N., and Stoddard, G. R. (1980a). Am. J. Hum. Genet. 32, 629-630. Howard-Peebles, P. N., and Stoddard, G. R. (1980b). Clin. Genet. 17, 125-128. Howard-Peebles, P. N., Stoddard, G. R., and Mims, M. G. (1979). Am. J . Hum. Genet. 31, 2 14-222. Howard-Peebles, P. N., Pryor, J. C., and Stoddard, G. R. (1980). Am. J . Hum. Genet. 32, 73A. Hulttn, M. (1978). Clin. Gener. 14, 294. Jacky, P. B. (1980). Ph.D. thesis, University of British Columbia. Jacky, P. B., and Dill, F. J. (1980). Hum. Gener. 53, 267-269. Jacobs, P. A,, Mayer, M., Rudak, E., Gerrard, J., Ives, E. J., Shokeir, M. H. K., Hall, J.. Jennings, M., and Hoehn, H. (1979). New Engl. J . Med. 300, 737-738. Jacobs, P. A., Glover, T. W., Mayer, M., Fox, P., Gerrard, J. W., Dunn, H. G., and Herbst, D. S. (1980). Am. J . Med. Genet. 7 , 471-489. Jacobs, P. A,, Hunt, P. A., Mayer, M., Wang, J-C., Boss, G., and Erbe, R. W. (1982). Am. 1. Hum. Genet. 34, 552-551. Jenkins, E. C., Brown, W. T., Duncan, C. J., Brooks, J., Yishay, M. B., Giordano, F. M., and Nitowsky, H. M. (1981). Lancer, 2, 1292. Jennings, M., Hall, J. G., and Hoehn, H. (1980). Am. J. Med. Gener. 7 , 417-432. Kaiser-McCaw, B., and Hecht, F. (1980). Am. J . Hum. Genet. 32, 114A. Kaiser-McCaw, B., Hecht, F., Cadien, J. D.. and Moore, B. C. (1980). Am. J. Med. Gener. 7 , 503-505. Lehrke. R. (1972). Am. J. Menr. Defic, 76, 611-619. Lehrke, R. G. (1974). Birrh Defects Orig. A n Ser. 12, 1-100. Lejeune, J. (1980). C.R. Acad. Sci. Paris Ser. D . 290, 1075-1077. Lejeune, J. (1982). Lancer 1, 273-274. Lejeune, J., Dutrillaux, B., Lafourcade, J., Berger, R., Abonyi, D., and Rethod, M. 0. (1968). C . R . Acad. Sci. Paris Ser. D . 266, 24-26. Leversha, M. A., Webb, G. C., and Pavey, S. M. (1981). Lancer 1, 49. Lubs, H. A. (1969). Am. J. Hum. Genet. 21, 231-244. McCarthy, C. M. T. (1981). Annu. Sci. Meer. 5th, Hum. Genet. SOC.Ausr., Canberra. Magenis, R. E.,Hecht, F., and Lovrien, E. W. (1970). Science 170, 85-87. Manuel, A., Sutherland, G. R., and Molesworth, J. (1981). Annu. Sci. Meet. 5rh. Hum. Genet. SOC. Aust.. Canberra. Mareni, C., and Migeon, B. R. (1981). Am. J . Hum. Genet. 33, 752-761. Martin, J. P., and Bell, J. (1943). J . Neurol. Psychiatr. 6, 154-157. Martin, R. H., Lin, C. C., Mathies, B. I., and Lowry, R. B. (1980). Am. J. Med. Gener. 7 , 433-441. Mattei, M. G., Mattei, J. F., Vidal, I., and Giraud, F. (1981). Hum. Genet. 59, 166-169. Nielsen. K. B., Tommerup, N., Dyggve, H.,and Schou, C. (1981a). N . Engl. J . Med. 305, 1348. Nielsen, K. B.. Tommerup, N., Poulsen, H., and Mikkelsen, M. (1981b). Hum. Gener. 59, 2325. N d l , B., Quack, B., Mottet, J., Natois, Y., and Dutrillaux, B. (1977). Exp. Cell Res. 104, 423-426. Padron, R. S., Hung, S., Licea, M.. Pkrez-Plaza, M., and Arce, B. (1979). Inr. J . Androl. 2, 1-5. Popovich, B. W.. Rosenblatt, D. S., Vekemans, M., andcooper, B. A. (1980). Am. J . Hum. Gener. 32, 84A. Pozsonyi, J., Sergovich, F., Kirkilionis, A., and Sheridan, G. (1981). Inr. Congr. Hum. Genet., 6rh, Israel.

142

GRANT R. SUTHERLAND

Prader, A. (1974). I n “Clinical Endocrinology. Theory and Practice” (A. Labhart, ed.), p. 1036. Springer-Vedag, Berlin and New York. Proops, R., and Webb, T. (1981). J . Med. Genet. 18, 366-373. Renpenning, H., Gerrard, J. W., Zaleski, W. A,, and Tabata, T. (1962). Can. Med. Assoc. J. 87, 954-956. Rhoads, F. A., Oglesby. A. C., Mayer, M., and Jacobs, P. A. (1982). Am. J . Med. Genet. 12, 205-21 7. Rivera, H., Hernandez, A., Plascencia, L., Sanchez-Corona, J., Garcia-Cruz, D., and Cantu, J. M. (1981). Ann. G6nPr. 24, 220-222. Ruvalcaba, R. H. A., Myhre, S. A., Roosen-Runge, C., and Beckwith, J. 9. (1977). J. Am. Med. ASSOC.238, 1646-1650. Scheres, J. M. J. C., and Hustinx, T. W. J. (1980). Am. J . Hum. Genet. 32, 628-629. Schmid, M., Klett, C., and Niederhofer, A. (1980). Cyrogenet. Cell Genet. 28, 87-94. Scott, J. M., and Weir, D. G. (1981). Lancet 2, 337-340. Shabtai, F.,Bichacho, S., and Halbrecht, I. (1980). Hum. Genet. 55, 19-22. Shapiro, L. R., Wilrnot, P. L.. Brenholz, P., Leff, A., Martino, M., Harris, G.,Mahoney, M. J., and Hobbins, J. C. (1982). Lancer 1, 99-100. Stirensen, K., Nielsen, J., Holm, V.. and Haahr, J. (1979). Hum. Genet. 48, 131-134. Soudek, D., and Gorzny, N. (1980). Clin. Genet. 19, 140-141. Soudek, D., and McGregor, T. (1981). Lancer 1, 556-557. Soudek. D., Partington, M. W., and McGregor, T. (1981). Inr. Congr. Hum. Genet., 6rh, Israel Abstr P.17.15, p. 251. Sumner. A. T., Evans, H. J., and Buckland, R. A. (1971). Nature (London)NewEiol. 232,31-32. Sutherland, G.R. (1977a). New Engl. J. Med. 2%, 1415. Sutherland, G.R. (1977b). Science 197, 265-266. Sutherland, G. R. (1979a). Am. J. Hum. Genet. 31, 125-135. Sutherland, G.R. (1979b). Am. J . Hum. Genet. 31, 136-148. Sutherland, G. R. (1979~).Hum. Genet. 53, 23-27. Sutherland, G.R. (1981). Am. J. Hum. Genet. 33, 946-949. Sutherland. G. R. (1982a). Am. J. Hum. Genet. 34, 452-458. Sutherland. G. R. (1982b). Am. J . Hum. Genet. 34, 753-756. Sutherland, G. R., and Ashforth, P. L. C. (1979). Hum. Genet. 48, 117-120. Sutherland, G.R., and Hinton, L. (1981). Hum. Genet. 57, 217-219. Sutherland, G. R., and Jacky, P. B. (1982). Lancet 1, 100. Sutherland, G.R., and Leonard, P. (1979). Hum. Genet. 53, 29. Sutherland. G. R., Baker, E., and Seshadri. R. S. (1980a). Am. J . Hum. Genet. 32, 542-548. Sutherland, G.R., Judge, C. G.,and Wiener, S . (1980b). J . Med. Genet. 17, 73. Sutherland. G.R., Baker, E., and Mulley, J. C. (1982). Science 217, 373-374. Tiepolo, L., Maraschio, P., Girnelli, G.,Cuoco, C., Gargani. G. F., and Romano, C. (1979). Hum. Genet. 51, 127-137. Tommerup, N., Nielsen, K. B., and Mikkelsen, M. (1981a). Am. J. Med. Genet. 9, 263-264. Tommerup, N., Poulsen, H., and Bmndum-Nielsen, K. (1981b). J . Med. Genet. 18, 374-376. Turleau, C., Czernichow, R., Royer, P., and de Grouchy, J. (1979). Ann. G b i t . 22, 205-209. Turner, G. (1981). Inr. Congr. Hum. Genet., 6th. Israel. Turner, G.,and Opitz, J. M. (1980). Am. J. Med. Genet. 7, 407-415. Turner, G.,and Turner, 9. (1974). J . Med. Genet. 11, 109-1 13. Turner, G.,Eastman, C.. Casey, J., McLeay, A., Procopis, P., and Turner B. (1975). J. Med. Genet. 12, 367-371. Turner, G.,Gill, R., and Daniel, A. (1978). N. Engl. J . Med. 299, 1472. Turner, G.,Daniel, A., and Frost, M. (1980a). J. Pediatr. %, 837-841.

THE FRAGILE X CHROMOSOME

143

Turner, G., Brookwell, R., Daniel, A., Selikowitz, M., and Zilibowitz, M. (1980b). N. Engl. J . Med. 303, 662-664. Venter, P. A., Gericke, G. S., Dawson, B., and Op’t Hof, J. (1981). S. Afr. Med. J . 60,807-811. Webb, G. C., Rogers, J. G., Pitt, D. B., Halliday, J., and Theobald, T. (1981). Lancer 2, 1231- 1232.

Webb, G . C., Halliday, J. L., Pitt, D. B., Judge, C. G., and Leversha, M. (1982). J. Med. Genet. 19, 44-48.

Webb, T., Butler, D., Insley, J.. Weaver, J. B., Green, S., and Rodeck, C. (1981). Lancer 2,1423. Wilmot, P. L., Shapiro, L. R., and Duncan, P. A. (1980). Am. J. Hum. Genet. 32, 94A. Zachmann, M., Prader, A., Kind, H. P., Hafliger, H.,and Budliger, H. (1974). Helv. Puediarr. Act0 29, 61-72.

This Page Intentionally Left Blank

INTERNATIONAL REVIEW OF CYTOLOGY. VOL. 81

Psoriasis versus Cancer: Adaptive versus Iatrogenic Human Cell Proliferative Diseases SEYMOUR GELFANT Departments of Dermatology and Cell and Molecular Biology, Medical College of Georgia, Augusta, Georgia I. M c i s ................................................... Cell Cycle Aspects of Psoriasis

145

111. Cell Cycle Aspects of Cancer.. ..............................

149 149 150 154 154 154 156 156

11.

A. Introduction .............. B. Comments a .............. IV. Psoriatic Proliferative Responses to Therapy .................... A. Introduction .......................................... B. Comments and Support (Fig. 3 ) . ......................... V. Tumor Proliferative Responses to Therapy ..................... A. Introduction ......................... B . Comments and Support (Fig. 4) .......................... References ....................

157 160

I. Pr6cis The ideas in this article are presented in the form of annotated diagrams in four figures which depict, describe, compare, and contrast the cycling*noncycling cell proliferative transitions as they apply to the problems of psoriasis and cancer in man. The ideas presented in the figures are elaborated on by text commentary, and they are all supported by references or by direct quotations from published literature. Figure 1 deals with the cell cycle aspects of psoriasis and depicts the cycling* noncycling germinative epidermal cell transitions involved in the original manifestation, remission, and relapse of psoriasis. Evidence is presented that the germinative layer of epidermis is composed of four major categories of cycling, noncycling Go-, G,-, and G,-blocked epidermal cells which behave as a “proliferative ecosystem” to service the proliferative needs and the proliferative responses of the tissue. The major clinical aspects of psoriasis, i.e., the original manifestation, remission, and relapse of active psoriasis, are explained in terms of recruitment and return of germinative epidermal cells to the cycling and noncycI45

Copyright 0 1983 by Academic Press, Inc. All rights of reproduction in any form reserved.

ISBN 012-364481-X

146

SEYMOUR GELFANT

ling states (also in terms of net changes in the overall histological numbers of germinative cells). Figure 2 deals with cell cycle aspects of cancer and depicts the establishment of primary and secondary tumors in terms of transformation of normal cycling cells, development of the early primary tumor mass, establishment of a primary tumor proliferative ecosystem-composed of the four major categories of cycling and noncycling tumor cells and their systems of subpopulations, and the establishment of secondary tumor proliferative ecosystems. Figure 3 deals with psoriatic proliferative responses to therapy in terms of epidermal cyclingenoncycling tissue growth fraction responses and in terms of psoriatic tissue survival-adaptive responses to therapy. Figure 4 compares and contrasts tumor cell growth fraction responses to therapy, with psoriatic tissue epidermal growth fraction responses, specifically in relation to chemo- and radiation-induced decrease in cycling cell growth fraction and in relation to continuous therapy. From a cell kinetic point of view, tumor cell growth fraction responses to therapy, i.e., recruitment of noncycling tumor cells to the cycling state, are the opposite of psoriatic epidermal cell growth fraction responses, where, in response to therapy, cycling germinative epidermal cells move into the noncycling state (an adaptive response). From the point of view of patient responses to therapy, psoriasis is an adaptive disease-in which therapy does not destroy the skin and does not produce skin cancer-even though the therapeutic agents are known carcinogens. In contrast, cancer is a “potential’ ’ iatrogenic disease; continuous chemo- and radiation therapy of established tumors may result in tumor metastasis, in additional neoplastic transformation (of normal cells), and in “terminal” disseminated malignant tumor growth.

II. Cell Cycle Aspects of Psoriasis A. INTRODUCTION

Psoriasis is a disease of epidermal hyperplasia resulting in faster epidermal cell transit to the stratum comeum and to excessive scaling-which is the main clinical disturbance in psoriasis. From a cell kinetic point of view, it had been generally assumed that all epidermal cells in the germinative compartment of human epidermis were actively proliferating (moving through the cell cycle) and that epidermal hyperplasia associated with active psoriasis was due to a dramatic speeding up of the proliferative cell cycle time (Weinstein et al., 1971). These assumptions were challenged several years ago on the basis of a critical analysis of the supporting experimental data and on a basis of other reports in the literature (Gelfant, 1976). It was suggested then that not all germinative epidermal cells are in the cycling state and that increased epidermal cell proliferation in

147

PSORIASIS VERSUS CANCER

active lesions of psoriasis is not brought about by a drastic shortening in the cell cycle time-but rather, is brought about by a proliferative recruitment of noncycling uninvolved psoriatic germinative epidermal cells. It was subsequently proposed (Gelfant, 1977, 1981) that the germinative layer of epidermis, like all other tissues, is composed of four major categories of cycling, noncycling Go-, G,-, and G,-blocked cells which behave as a "proliferative ecosystem" to service the proliferative needs of the proliferative responses of the tissue. These ideas have resulted in the scheme shown in Fig. 1 which depicts the "cyclingenoncycling germinative epidermal cell transitions in the original manifestation, remission, and relapse of psoriasis."

B. COMMENTS AND SUPPORT(FIG. 1) 1. Latent Psoriasis For support of the statement that latent psoriasis is genetically transmitted, i.e., that there is a familial pattern and a familial concentration of this disease, see "The Genetics of Psoriasis" (Watson er a f . , 1972) and "The Inheritance of Psoriasis" (Dobson, 1980). is divida. Explanation Cycling State. The cycling state, G,+S+G,-M, ed into three interphase periods plus the period of mitosis. It consists of a long 1.LATENT PSORIAID CYCLING CELLS (-50%)

IwnelUlq tr.nunlllW

-'

NONCYCLINQ CELLS ( - 5 0 % )

CYCLING STATE one u ~ . g o r y

NONCVCLINQ STATES (lnd.llnll*Ilma)

lhrraaawlr

CYCLING STATE Aller mitwia dmghler cell1 conllnue movlnQ ihrough next cell cycle

NONCYCLING STATES Three dlllerenl winla 01 arrml In lhe cell cycle MOII cello arfeC.1 In lhe noncyciing ~ ~ 8 1 o c k .atate d and serve as Ihe main H)urMI 01 reCIYI1men1 I" aclive pwriaala

(cellcycle lime)

CVCLINQ CELLS ( - 5 0 % ) one Ul.pory

3

\\

NONCVCLINQ CELLS ( - 5 0 % ) lhraul.pcflr Icwnblnad dlwram)

[-m'"aI'"* *,UM

1 /

''Oripinal Manifestation"

CVCLINQ STATE

(tooxi

-=haw

1

UII mmpsrlmsnl I0 IMtllayer

noncycling germinative epidermal cell transitions in the original manifestaFIG. I . Cycling tion, remission, and relapse of psoriasis.

148

SEYMOUR GELFANT

pre-DNA synthesis gap period (GI) lasting 10 to 20 hours (or days), followed by a limited, discrete period of DNA synthesis (S) generally from 6 to 8 hours (sometimes as long as 20 hours), followed in turn by a short post-DNA synthesis interval (G,) of about 1 to 4 hours, and finally, by a rather rapid period of mitosis (M) which lasts about 1 or 2 hours. b. Explanation Noncycling States (Indefinite Time). The upper series of diagrams of cycling and noncycling cells [a scheme which has been applied to all proliferative tissues and tumors (Gelfant, 1977, 1981)] is based upon the idea of three inherent arrest points in the cell cycle: a Go barrier (dashed line) arrest mechanism located early in the GI period of the cell cycle; a GI block located at the G,/S border; and a G, block located at the G,/M transition point. In relation to these inherent cell cycle arrest points, there are four major categories: cycling cells (no arrest points) and noncycling Go-, GI-, and G,-blocked germinative epidermal cells-existing within a single layer of basal epidermis. Figure 1 provides an estimate of the relative proportions and fluctuations of the four categories of cycling and noncycling cells. Only about 50% of the germinative epidermal cells in latent unstimulated psoriatic skin are in the cycling state; the other 50% of the germinative cells reside in the noncycling states. And of the three categories of noncycling cells, most (80-95%) reside in the Go-blocked state; the germinative layer of epidermis also contains small proportions of noncycling GI- and G,-blocked cells (2- 10%). c. Evidence: Cycling and Noncycling Germinative Epidermal Cells. Autoradiographic and histological mitotic evidence for cycling germinative epidermal cells moving through S or M has been recorded in the epidermis of laboratory animals (Potten, 1981) and in man (Gelfant, 1976). The indication that the cell cycle time (T,)of cycling germinative epidermal cells in latent psoriasis is around 100 hours can be supported by a number of in virro and in vivo cell kinetic studies in man on both normal and on uninvolved psoriatic skin (Gelfant, 1982a; Heenen et al., 1979; Wright, 1977). All three categories of noncycling Go-, G,-, and G,-blocked cells have been demonstrated in the germinative layer of the epidermis in laboratory animals (Gelfant, 1977), and there is evidence that they can remain in the noncycling states indefinitely-for months or years (Gelfant, 1981). Using skin biopsy samples from patients who have been continuously infused with [3H]thymidine, we have recently presented experimental evidence for the existence of noncycling cells in human epidermis in vivo. Approximately 50% of the germinative epidermal cells in human epidermis can reside in the noncycling state (Gelfant et al., 1982). This conclusion is also supported by a recent report by Briggaman and Kelly (1982) in a paper entitled “Continuous Thymidine Labeling Studies of Normal Human Skin Growth on Nude Mice: Measurement of Cycling Basal Cells.” Their results indicate that basal cells of normal human skin constitute a heterogeneous population of cycling and noncycling cells and that about 50% are in the noncycling state. We are in the process of obtaining additional evidence for the existence of noncycling Go- and G,-block-

PSORIASIS VERSUS CANCER

149

ed germinative epidermal cells in normal and in psoriatic human epidermis in vivo using tape stripping and flow cytometry procedures (Gelfant, 1982b; Gelfant et al., 1982). 2 . Active Psoriasis The original manifestation of active psoriasis may involve (1) a relative shortening in the cell cycle time of cycling germinative cells, from around 200 hours (Goodwin and Fry, 1977; Heenen et al., 1979) to around 100 hours (Gelfant, 1976; Heenen et al., 1979; Wright, 1977); (2) a more important major recruitment of noncycling cells to the cycling state (since most noncycling germinative cells reside in the Go-blocked state, they serve as the main source of recruitment in the transition to active psoriasis); and (3) a histological increase in the overall germinative cell compartment (Van Scott and Ekel, 1963). In several recent publications (Gelfant, 1982b; Gelfant et al., 1982) we provide direct experimental evidence for the specific recruitment of noncycling Goblocked germinative epidermal cells in clinically uninvolved psoriatic skin. We also demonstrate (in one patient) that this proliferative recruitment resulted in the clinical manifestation of active psoriasis. Although there is experimental evidence indicating that approximately 100% of the germinative cells in active psoriasis can be in the cycling state (Weinstein, 1971), a more generalized assessment of the growth fraction in active psoriasis is around 75% (Chopra and Flaxman, 1974; Harper et al., 1978). 3. Resolved Psoriasis All three categories of noncycling G,-, G,-, and G,-blocked cells have been combined into a single diagram in the lower panel depicting noncycling cells in Fig. 1. Clinical remission of active psoriasis due to therapy, or spontaneous, involves transitions to the three noncycling states and a return to the more “normal” germinative epidermal cell growth fraction status (i.e., 50% cycling, 50% noncycling). Relapse as depicted in Fig. 1 would be similar to the original manifestation and recruitment of noncycling cells to the cycling state. The ideas on the cell cycle aspects of psoriasis depicted in Fig. 1 and discussed above can be further supported by the following quotation from Goodwin and Fry (1977): “It is suggested that the increase in dividing cells and expansion of the epidermal compartment so characteristic of psoriasis may reflect alterations in growth fraction and not rapid cell replication.” 111. Cell Cycle Aspects of Cancer

A. INTRODUCTION Cancer is a disease of transformation of normal cells in a heritable manner, and the establishment of invasive primary, secondary, and disseminated tumor

150

SEYMOUR GELFANT

growths. From a cell kinetic point of view, primary tumors are similar to normal tissues in a number of ways. (1) They exist as independent proliferative ecosystems-their growth patterns being independent of the normal tissues in which they reside. (2) The relative percentages of noncycling Go-, G,-, and G,-blocked tumor cells are similar to normal tissues. (3) Most primary tumor cells (70-90%) are in the noncycling state. (4) And in general, most primary tumors maintain a balanced tumor growth by a balance between tumor cell loss and tumor cell birth. Specialized noncycling (cancerous) primary tumor cells metastasize and establish secondary tumors-which in themselves behave as independent proliferative ecosystems. The proliferative states of secondary tumors, at any point in time, i.e., the relative proportions of cycling and noncycling tumor cells, may differ from the tissue in which they reside, they may differ from the primary tumor of origin, and they also may differ from secondary tumors at other metastatic sites (Steel, 1977; Bellamy and Hinsull, 1978; Silvestrini et al., 1974), thus making the situation difficult from the point of view of generalized chemotherapy. These ideas are included in Fig. 2 which depicts cell cycle aspects involved in the establishment of primary and secondary tumors.

B. COMMENTS AND SUPPORT(FIG. 2) 1. Transformation [Adapted from Gelfant (1 981)I Environmentally induced direct transformation or reprogramming of DNA in a heritable manner can occur in a number of ways. For example, environmental carcinogenic factors, chemicals, viruses, irradiation (Higginson, 1969; Heidelberger, 1975; Ames, 1979), may transform DNA directly (Barrett et al., 1978; Milo and DiPaolo, 1978), by electrophilic attack (Arehart-Treichel, 1979), parametric energy transfer excitation (Barrett, 1979), binding or bonding DNA strands (Neidle, 1980), insertion of viruses (Green, 1978), evolution of oncogenes (Temin, 1971, 1972, 1974), activation of transforming genes (Comings, 1973), or these environmental factors may cause the synthesis of unusual gene regulatory molecules during the cell cycle of a normal parent cell (Stein et al., 1978). Chromosomal regulatory molecules, nuclear proteins, and small nuclear RNAs interact with and bind to DNA during replication in the S period or during release and reacquisition of chromosomal molecules-which occurs in the process of chromosome condensation and decondensation during mitosis-and in this way reprogram or “transform” genetic expression of daughter cells (Goldstein and KO,1978; Pederson and Bhorjee, 1979; Goldstein, 1978). Other methods by which transformed daughter cells can arise include errors in immortal stem cell division, i.e., errors in segregation of DNA strands during alignment and separation of sister chromatids (Lajtha, 1979; Cairns, 1975; Potten et al., 1978), alterations in gene expression related to cellular differentiation

151

PSORIASIS VERSUS CANCER

I. Tranrlormatlon dlrnl tranalormatlon of normal cycllnp ~ l l a chromwomu reprogrammeddurlnp S or M

Envlronmentaliy transformed “lnitlatd” daughter cells may daveio% into a primary tumor dlrectlv or they may requlro addltlonai carclnogenlc “promotlon:’

m.

Ertabllrhucondary tumor#.

Noncycllnp 0 , and 02 blockad primary tumor ceth and thelr ayatem of aubpopulatlona metaataaire to Mcondary altos; dwalop mlcromela8lawa (plnl 01 opllmum nymu 10 Humpy). Ealabllah Mcondary tumor prliferalive UOIatema dlrnlly or after a p r l o d

G,

01dormancy

(JII~w~towdl0rt01.

bldch

m.

E8tabllsh primary prollferatlve ecosystem (dilfkult to uadkrtr).

/-

@Q!J ?+c 2-10%

’

.bb& NONCYCLING CELLS VO -80%) CYCLING CELLS (lo-=%) t h m catqorler one catagory PRIMARY AND SECONDARY TUMORS

FIG. 2. Establishment of primary and secondary tumors (independent proliferative ecosystems).

(Cairns, 1979), or related to epigenetic changes in gene activity (Holliday, 1979). Environmentally transformed “initiated” daughter cells may develop into a primary tumor mass directly or they may require additional carcinogenic “promotion. ” It is generally accepted that carcinogenic transformation is a two-stage process: i.e., initiation, the initial mutational event, and promotion, which in-

152

SEYMOUR GELFANT

volves subsequent and additional exposure to environmental carcinogens (Chouroulinkov and Lasne, 1978). The second event may occur soon after the first or not until a long time later. Initiation is irreversible. Promotion is reversible and may be experimentally manipulated-thus offering therapeutic possibilities (Marx, 1978). 2. Early Primary Tumor Mass The ideas inserted in Fig. 2 that the “early primary tumor mass” is different from the established primary tumor and that the early primary tumor mass is more susceptible to therapy can be supported by the following observations from the literature: Cell kinetic studies show that early primary tumors are mostly composed of cycling cells, i.e., primary tumor labeling indexes may be as high as 60% (Schenken, 1976) and growth fractions may reach 1.0 (Schenken, 1976; Sheehy et al., 1975; Frei, 1977). And there is evidence that cell cycle specific chemotherapy has maximum effects on the early primary tumor mass (Schenken, 1976; Frei, 1977). Indeed, early tumor diagnosis (as publicized by the American Cancer Society) is one of the major approaches in controlling cancer (Berlin, 1979; Carter and Wasserman, 1975). 3. Establishment of a Primary Tumor Proliferative Ecosystem With time, cycling, transformed early primary tumor mass cells move into the noncycling states-an inevitable process we have termed tissue and tumor cellular “aging” transitions (Gelfant and Smith, 1972; Gelfant, 1977, 1981). And at this stage, the primary tumor becomes difficult to eradicate. Supporting quotations: from Schenken (1976), “As the tumor grows, successively smaller proportions of cells are in the proliferative compartment and the proportion of nonproliferative (Go) cells increases. Thus, as a tumor grows, there are changes in cell proportions susceptible to various categories of cytotoxic agents.” And “Accumulation of Non-cycling Cells with a G,-DNA Content in Aging Solid Tumours” (title of report by Conix et al., 1983). For additional publications that make the same points, in support of the ideas stated in Fig. 2, see Feilux de Lacroix et al. (1979), Frei (1977), Kopper et al. (1978), and Carter and Wasserman (1975). The potential proliferative pool of the primary tumor is now composed of the four major categories of cycling and noncycling cells depicted in Fig. 2. All three categories of noncycling G,-, Go-, and G,-blocked cells have been demonstrated and documented in primary tumors (Gelfant, 1977; Post and Hoffman, 1969; Post er al., 1973; Dombemowsky et al., 1974; Bichel and Dombemowsky, 1975; Dombemowsky and Bichel, 1976; Alsabti, 1979; Terz et al., 1977). There is also tumor growth fraction data which support the estimate in Fig. 2 of 70% noncycling and 30% cycling tumor cells (Wright, 1977; Bresciani et a f . , 1974; Schiffer et al., 1979; Shirakawa et al., 1970). In addition to the four major

PSORIASIS VERSUS CANCER

153

categories of cycling and noncycling cells, there are subpopulations of cells within the noncycling categories which may be selectively and independently activated by different stimuli (Gelfant, 1977, 198 1) and there are subpopulations of tumor cells which we speculate have specific metastatic capabilities (a point we will allude to in the next section). The primary tumor-composed of the four major categories of cycling and noncycling cells and their subpopulations-has become an independent proliferative ecosystem, a system which confers adaptive value to the tumor and a system which proliferates independently of the tissue in which it resides (Steel, 1977).

4. Establishment of Secondary Tumor Proliferative Ecysystems In other reports (Gelfant, 1977, 1981) we suggest that the cancerous properties of metastasis and repopulation of primary tumors reside in a minority system of primary tumor cells-compatible with our description of noncycling G, - and G,blocked cells and their subpopulations. These subpopulationsare depicted in Fig. 2 as triangles, circles, and hexagonal cells moving (metastasizing) in the noncycling G I - and G,-blocked states. Unshaded circles within the cells represent nuclei in the noncycling G, period with nuclear DNA contents of 2C (pre-DNA synthesis); shaded circles represent nuclei in the noncycling G , period with nuclear DNA contents 4C (post-DNA syntheis). The above ideas can be supported by the following quotations from the literature: “neoplasms are also heterogeneous with regard to invasion and metastasis, i.e., that they contain a variety of subpopulations of cells with differing metastatic potentials” (Fidler, 1978); and “cancer metastases originate from subpopulations of cells with high metastatic potential that preexist within the parent tumor” (Kripke et al., 1978); also, “only certain . . . malignant cells possess characteristics that enable them to travel through the body and establish new tumors” (Nicolson, 1979). In general, “It is suggested that the necrotic regions of tumors, and products derived from them, facilitate the detachment of tumor cells . . . thereby potentially promoting metastasis and invasion” (Weiss, 1977). Newly invaded malignant (subpopulations of noncycling G ,- and G,-blocked) primary tumor cells may remain dormant, retaining the capacity to be released at a later date [see “On the Latency of Tumor Cells” (Stein-Werblowsky, 1978)], or they may immediately begin to proliferate and repopulate. As indicated in Fig. 2, “proliferating early micrometastases” are similar to the “early primary tumor mass” in the sense that micrometastases are also mostly composed of cycling tumor cells (Schabel, 1975; Plesnicar et al., 1979) and also that this is the stage of optimum response to therapy (Schabel, 1975; Fugmann et al., 1977). Finally, as depicted by the dashed arrows in Fig. 2, some repopulatingcycling tumor cells return to the Go-blocked state, and some also return to the noncycling G I- and G,-blocked states-thus establishing independent secondary tumor proliferative ecosystems composed of the four major categories of cycling and noncycling tumor cells (and their systems of subpopulations).

154

SEYMOUR GELFANT

IV. Psoriatic Proliferative Responses to Therapy A. INTRODUCTION In Fig. 3 the following questions are addressed: (1) How do therapeutically useful drugs and radiation, known specifically to kill all cycling cells engaged in DNA synthesis or in mitosis, arrest and reverse psoriatic hyperproliferation in involved epidermis-without major destruction of germinative cells and without denuding the skin? (2) How do these drugs keep uninvolved psoriatic epidermis in a state of abated cell proliferation and clinically clear during prolonged remission? The question is also raised of why psoriatic patients continuously exposed to carcinogenic coal tars and ultraviolet radiation apparently do not develop skin cancers. These questions are answered in terms of epidermal cyclingenonc ycling tissue growth fraction responses and in terms of psoriatic tissue survival-adaptive responses.

B. COMMENTS AND SUPPORT (FIG. 3) 1. Original Manifestation of Psoriasis In Fig. 1 we depicted and provided evidence for the contention that in latent (uninvolved) psoriatic skin, only about 50% of the germinative epidermal cells are actively moving through the cell cycle; most of the germinative cells are in the quiescent, noncycling states. In Fig. 3 (I) we propose that in terms of intrinsic tissue growth fraction response-an increase in the cycling cell growth fraction, usually associated with superficial cutaneous trauma (Farber and Van Scott, 1979) recruits noncycling germinative cells to the cycling state (Gelfant, 1982b). This recruitment of noncycling cells results in epidermal hyperproliferation, in histological enlargement of the germinative cell compartment (Van Scott and Ekel, 1963), and in the clinical manifestation of active psoriasis (Gelfant, 1978). 2. Remission In answer to question I above+f how therapy arrests and reverses psoriatic hyperproliferation without major destruction of epidermal germinative cells, Fig. 3 (11) proposes that a decrease in the growth fraction in active psoriasis by killing cycling cells in S or in M (Farber et al., 1976; Weinstein et al., 1977) moves other cycling germinative cells to the noncycling state where they become refractory to therapy killing (an adaptive response). This would come about, once again, by an inherent tissue growth fraction control response-which restores the more “normal” germinative cell growth fraction status, 50% cycling, 50% noncycling (see Fig. I), and results in clinical remission (Gelfant, 1978).

155

PSORIASIS VERSUS CANCER

Origlnrl Mrnlfostrtlon increase in cycling cell growth fraction in latent prorimis-trauma induced or spontaneous, recruits noncyciing germinative cells to thecycling state; also, histologically enlarges germinative cell compartment

trauma

Latent

1. Psoriaris

Romirrlon (adaptive response) Decrease in growth fraction in active psoriasis by killing cycling cells in S or in M with cancer therapy drugs, ultraviolet radiation, airo UV + coal tars or paoralens, movesother cycling germinativeceiis to the noncyciing state where they become refractory to therapy killing (an rdrptivr rOSpOnr). therapy

a- Psoriasis

Rwlved Psoriasis

D

ROl8pO

Increase in cycling cell growth fraction in reaoived psoriasis due to withdrawal of therapy, or trauma induced-recruit8 noncycling germinative c ~ i i to s the cycling state.

-

therapy withdrawal

a.

Reaoived Psoriasis

Psoriasis

I R.rolvrd Plorlarlr (adaptive responses) Continuous-intermittent killing of small numbera of cycling germinatlve cells with cancer therapy drugs and irradiation keeps other noncycilng germinative cell8 in the noncyciing state and prevents denuding of the akin (on rdrptlvr r a p o n r ) .Also, continuour expoaure to carcinogenic coal tars and ultraviolet radiation doe8 not resuit in skin Cancar (mrdrptlvr nrponr).

I Ip.

yry,

growth fraction maintained

'

I I I

noncyciing state maintained

8

m FIG.3. Psoriatic epidermal-cell growth fraction and skin cancer responses to cancer therapy drugs and irradiation : adaptive responses. 3. Relapse

The tissue growth fraction responses of resolved psoriasis depicted in Fig. 3 (111) are the same as those depicted for the original manifestation of latent psoriasis in Fig. 3 (I). Figure 3 (111) implies that relapse from therapeutic remission (as also the original manifestation of latent psoriasis) occurs if the genninative cell population growth fraction increases beyond a critical point in unin-

156

SEYMOUR GELFANT

volved epidermis. Beyond this (tissue control) point, psoriatic germinative cells become transformed-in the sense that there would be a continuous release of noncycling germinative cells into the cycling state, and there would be no return to the noncycling resting state, i.e., from Baltimore (1975), “Transformation is thus an abrogation of the resting state. ” Withdrawal of chemotherapy during therapeutic remission or the Koebner phenomenon (Monacelli, 1971) are two examples of conditions which would activate psoriatic lesions according to the scheme depicted in Fig. 3 (111). 4. Resolved Psoriasis

In answer to question 2 above of how therapy keeps psoriatic epidermis in a state of proliferative and clinical remission, Fig. 3 (IV) states that continuousintermittent killing of small numbers of cycling germinative cells with cancer therapy drugs and irradiation keeps other noncycling germinative cells in the noncycling state. In terms of tissue growth fraction control, maintaining a low growth fraction maintains the noncycling state. This prevents denuding of the skin (an adaptive response) and also results in clinical remission. Figure 3 (IV) also raises the question of why psoriatic patients-continuously exposed to carcinogenic coal tars and ultraviolet r a d i a t i o d o not develop skin cancers, and implies that this is an additional tissue adaptive response. The following quotations offer direct support and an explanation for this statement: from Shuster et al. (1979), “The incidence of skin cancer in patients with psoriasis seems to be low, despite repeated use of known carcinogens in treating the disorder. This may be due to a reduced capacity of psoriatic skin to metabolise precarcinogens because of impaired arylhydrocarbon hydroxylase (AHH) activity . . . since the disease is probably genetically transmitted as a dominant trait, it may have persisted because it confers genetic advantage.” And from Jacobs et al. (1977), “Psoriasis patients would be expected to have a higher than normal occurrence of skin cancer since they are frequently subjected to physical and chemical agents which may be either carcinogenic or cytotoxic . . . based on clinical observation, psoriatics actually had fewer carcinomas of the skin than the nonpsoriatics.” It should be pointed out, however, that these ideas have recently been contradicted in articles entitled “Psoriasis and the Risk of Cancer” (Stem, 1982) and “Cancer in Patients with Psoriasis” (Halprin et al., 1982).

V. Tumor Proliferative Responses to Therapy A. INTRODUCTION Figure 4 was designed to contrast tumor cell growth fraction responses to therapy-with psoriatic tissue epidermal cell growth fraction responsesde-

PSORIASIS VERSUS CANCER

157

scribed in Fig. 3. The comparisons between tumor and psoriatic tissue responses specifically relate to therapy-induced decrease in growth fraction [Fig. 3 (11); Fig. 4 (I)], and to continuous therapy [Fig. 3 (IV); Fig. 4 (II,III,IV)]. From a cell kinetic point of view, tumor cell growth fraction responses to therapy, i.e., recruitment of noncycling tumor cells to the cycling state, are the opposite of psoriatic epidermal cell growth fraction responses, where, in response to therapy, cycling germinative epidermal cells move into the noncycling state. From the point of view of patient responses to continuous therapy, psoriasis is an adaptive disease-in which therapy does not destroy the skin and may not produce skin cancer-ven though the therapeutic agents are known carcinogens. In contrast, cancer is a “potential” iatrogenic disease; continuous chemo- and radiation therapy of established tumors may result in tumor metastasis, in additional neoplastic transformation (of normal cells), and in “terminal” disseminated malignant tumor growth.

B. COMMENTS AND SUPPORT (FIG.4) 1. Initial Primary Tumor Therapy

In contrast to psoriatic tissue growth fraction responses illustrated in Fig. 3 (II), Fig. 4 (I) indicates that a decrease in the growth fraction of primary tumors-by killing cycling tumor cells in S or in M by cancer therapy drugs (Dorr and Fritz, 1980; Lampkin et al., 1972; Klein and Lennartz, 1974), or in general by ionizing radiation (Tubiana and Malaise, 1976), recruits noncycling tumor cells to the cycling state (as a tumor-tissue compensatory reaction), and that this tumor cell recruitment response is used as a chemotherapeutic scheduling strategy. The statements and the ideas depicted in Fig. 4 (I) can be supported by the following quotations: “Recruitment of resting tumor cell populations into the cycle is a commonly used therapeutic procedure applied as part of a treatment schedule and is followed by the administration of a second agent which specifically elminates these cells” (Epifanova, 1977). “Recruitment is a term used to designate the induction of a resting cell into the mitotic cycle or the induction of a slowly proliferating cell population to increase its rate of cell replication. Recruiting of resting tumor cell populations into the cycle is desirable since we know that rapidly growing tumors in man are easier to cure. Resting tumour cells will enter the division cycle after a fraction of the cells is killed either by radiation or chemotherapy” (Van Putten, 1974). And from Mauer et al. (1977), ‘‘Most chemotherapeutic agents in current use for the treatment of leukemia and other malignancies are maximally effective during some phase of the cell cycle. Therefore, there should be a chemotherapeutic advantage to increasing the num-

158

SEYMOUR GELFANT

lnltkl Primary Tumor Thoropy Decreaee In growth fraction by killing cycling calls In S or in M with u n m r therapy drugs, or in general by ionizing radlation, recruits noncyciing tumor cells to the cycling state (tumor recruitment-chemotherapeutic scheduling strategy).

Conllnuour Therapy (potential iatrogenic responses) COntinuous-intermittent killing of cycling tumor cells with cancer therapy drugs or irradiation. also surgery or even biopsy trauma, may facilitate metastasis and establishment of secondary tumors. Anticancer drugs also may cause additional neoplastic transformation. This may eventually resuit in disseminated malignant tumor growth (latrogmkumrr).

..:

.*’.

continuous therapy primary tumor

.. *’”a

continuous therapy

primary B. secondary tumors additional

-

non cycling

I-$

disseminated tumor growth “iatrogenic cancer“

FIG. 4. Primary and secondary tumor cell growth fraction responses to cancer therapy drugs and irradiation :potential iatrogenic responses.

ber of cells in the specific, sensitive phase of the cell cycle for subsequent administration of the active drug . . . the size of the growth fraction is increased by perturbing the cell population to induce recruitment of resting cells back into the cell cycle.” Figure 4 (I) implies recruitment of all three categories of noncycling tumor cells. The following quotations provide evidence for the specific recruitment of

PSORIASIS VERSUS CANCER

159

noncycling Go-, GI-, and G,-blocked tumor cells: “The effect of a large reduction in tumor cell mass acts as a simulus for shifting Goc*GI to the right (recruitment)” (Dorr and Fritz, 1980). “These results indicate recycling of resting cells first with G, and later with G, DNA content, which contribute to the regrowth of the tumours” (Dombernowsky and Bichel, 1976). “Greater reductions in the labeling indices than in the number of mitoses, most of which were unlabeled, may be accounted for by the contribution of unlabeled mitoses from the G, pool. This population could have been the major source of new tumor cells” (Post et al., 1974).

2 . Continuous Therapy (Potential Iatrogenic Responses) One of the main purposes of this article is to point out, explain, and contrast the differences between psoriatic tissue and malignant tumor tissue, cytokinetic responses and tissue (patient) survival responses to chemo- and radiation therapy. In contrast to the adaptive responses to psoriatic skin, continuous therapy of malignant primary tumors may result in iatrogenic disseminated terminal tumor growth. As stated in Fig. 4:the effects of “Continuous-intermittent killing of cycling tumor cells with cancer therapy drugs may eventually result in disseminated malignant tumor growth” [“many chemotherapeutic drugs, in particular cyclophosphamide (CY), exert strong tumor metastasis-promoting effects” (Milas et al., 1979)l; or irradiation [“Mode of Spreading and Terminal of Disease in Malignant Lymphoma after Radiation Therapy” (Kiyono et al., 1978), “In patients with advanced lesions receiving postoperative radiation therapy, the incidence of distant metastases is significantly higher” (Merino et al., 1977)l; also surgery [“The Dissemination of Cancer Cells during Operative Procedures” (Griffiths, 1960), “Experimental Increase of Lung Metastases after Operative Trauma (Amputation of Limb with Tumor)” (Lewis and Cole, 1958)]; or even biopsy trauma [“Needle Tract Seeding Following Aspiration of Renal Cell Carcinoma” (Gibbons et al., 1977)] may facilitate metastasis and establishment of secondary tumors. Anticancer drugs also may cause additional neoplastic transformation [ ‘‘A Delayed Complication of Cancer Therapyxancer” (Harris, 1979), “Toxicity of Antineoplastic Agents in Man . . . Carcinogenic Potential” (Sieber and Adamson, 1975), “The Carcinogenic Properties of Some of the Principal Drugs Used in Clinical Cancer Chemotherapy” (Weisburger et al., 1975)]. This may eventually result in disseminated malignant tumor growth (iatrogenic c a n c e r h a s depicted in Fig. 4. In terms of iatrogenic responses, Fig. 4 (11) implies that continuous therapy of the primary tumor results in recruitment of noncycling cells-and specifically of noncycling G,- and G,-blocked tumor cells (depicted as triangular, circular, and hexagonal cells with open and shaded nuclei)-which have the specialized capacity to metastasize to secondary sites. “It is suggested that the necrotic regions

160

SEYMOUR GELFANT

of tumors, and products derived from them, facilitate the detachment of tumor cells . . . thereby potentially promoting metastasis and invasion” (Weiss, 1977). For additional evidence for specific recruitment of noncycling G,- and G,-blocked tumor cells, see comments made above in relation to Fig. 4 (I) and also comments made in relation to establishing secondary tumors (Fig. 2). Figure 4 (111) implies that further continuous therapy of both primary and secondary tumors results in additional recruitment, in additional metastasis, and in additional neoplastic transformation of normal cells not only by anticancer drugs discussed above, but also, by radiation therapy [“Neoplastic transfonnation following split doses of X rays” (Borek, 1977)]. All of this, finally [depicted in Fig. 4 (IV)], results in disseminated tumor growth, “iatrogenic cancer.”

ACKNOWLEDGMENTS To Mrs. Juanita Jones for the highest level-professionally intimate-helpful and preparing this manuscript. Supported by NIH Grant AM 19735.

assistance in writing

REFERENCES Alsabti, E. A. K. (1979). J. Cancer Res. Clin. Oncol. 95, 209-220. Ames, B. N. (1979). Science 204, 587-593. Arehart-Treichel, J. (1979). Sci. News 115, 41 1-414. Baltimore, D. (1975). Cold Springs Harbor Symp. Quanr. Eiol. 39, 1187-1200. Barrett, 1. C., Tsutsui, T., and Ts’o, P. 0. P. (1978). Nature (London) 274, 229-232. Barrett, T. W. (1979). Cancer Eiochem. Eiophys. 3, 189-192. Bellamy, D., and Hinsull, S. M. (1978). Er. 1. Cancer 37, 81-85. Berlin, N. I. (1979) Perspec?. Eiol. Med. 22, 500-518. Bichel, P., and Dombernowsky, P. (1975). Eur. J. Cancer 11, 425-431. Borek, C. (1977). Er. J . Radiol. 50, 845-846. Bresciani, F., Paoluzi, R., Benassi, M., Nervi, C., Casale, C., and Ziparo, E. (1974). Cancer Res.

34, 2405-2415. Briggaman, R. A., and Kelly, T. (1982). J . Invest. Dermurol. 78, 359. Cairns, J. (1975). Nature (London) 255, 197-200. Cairns, J. (1979). DiTerenriarion 13, 67. Carter, S. K., and Wasserman, T. H. (1975). Cancer Chemorher. Rep. 5 (Pt. 2). 235-241. Chopra, D. P., and Flaxman, B. A. (1974). Cell Tissue Kine?. 7, 69-76. Chouroulinkov, I., and Lasne, C. (1978). Bull. Cancer 65, 255-264. Comings, D. E. (1973). Proc. Narl. Acud. Sci. U.S.A.70, 3324-3328. Conix, P., Liautaud-Roger, F., Boisseau, A., Loirette, M., and Cattan, A. (1983). Cell Tissue Kine?. (in press). Dobson, R. L. (1980). Arch. Dermurol. 116, 657. Dombernowsky, P., and Bichel, P. (1976). Cell Tissue Kiner. 9, 9-18. Dombernowsky, P., Bichel, P., and Hartmann. N. R. (1974). Cell Tissue Kiner. 7, 47-60. Dorr. R. T..and Fritz, W. L. (1980). In “Cancer Chemotherapy Handbook,” pp. 3-25. Elsevier, Amsterdam.

-PSORIASIS VERSUS CANCER

161

Epifanova, 0. I. (1977). In?. Rev. Cyrol. Suppl. 5, 303-335. Farber, E. M., and Van Scott, E. J. (1979). I n “Dermatology in General Medicine” (T. B. Fitzpatrick, A. 2. Eisen, K. Wolff, 1. M. Freedberg, and K. F. Austen, eds.), pp. 233-247. McGraw-Hill, New York. Farber, E. M., Pearlman, D., and Abel, E. A. (1976). Arch. Dermurol. 112, 1679-1688. Fehux de Lacroix, W., Weyer. M., Schutt, A., and Lennartz, K. J. (1979). J. Cancer Res. Clin. Oncol. 94, 29-37. Fidler, 1. J. (1978). Cancer Res. 38, 2651-2660. Frei, E., I11 (1977). Cancer 40, 569-573. Fugmann, R. A., Anderson, J. C., Stolti, R. L., and Martin, D. S. (1977). Cancer Res. 37, 496-500. Gelfant, S. (1976). Er. J . Dermurol. 95, 577-590. Gelfant, S . (1977). Cancer Res. 37, 3845-3862. Gelfant, S. (1978). Cell Tissue Kinet. 11, 577-579. Gelfant, S. (1981). Inr. Rev. Cyrol. 70, 1-25. Gelfant, S. (1982a). Proc. Inr. Psoriasis Symp., 3rd. pp. 53-59. Gelfant, S. (1982b). Cell Tissue Kiner. 15, 393-397. Gelfant, S., and Smith, J. G.,Jr. (1972). Science 178, 357-361. Gelfant, S., Drewinko, B., Darzynkiewicz, 2.. Eisinger, M., and Camplejohn, R. S. (1983). I n “Cell Proliferation in Psoriasis” (N. A. Wright and R. S. Camplejohn, eds.). Churchell Livingston, London. (In press). Gibbons, R. P., Bush, W. H., Jr., and Burnett, L. L. (1977). J . Urol. 118, 865-866. Goldstein, L. (1978). I n “Cell Reproduction” (E. R. Dirksen. D. Prescott, and C. F. Fox, eds.), pp. 155-171. Academic Press, New York. Goldstein, L., and KO, C. (1978). Chromosoma (Berlin) 68, 319-325. Goodwin, P., and Fry, L. (1977). Clin. Exp. Dermafol. 2, 259-264. Green, M. (1978). Perspecr. Eiol. Med. 21, 373-397. Griftiths, J. D. (1960). Ann. R. Coll. Surg. Engl. 27, 14-44. Halprin, K. M., Comerford. M; and Taylor, J. R. (1982). J . Am. Acad. Dermarol. 7, 633-638. Harper, R. A., Rispler, J., and Urbanek, R. W. (1978). J. Invesr. Dermufol. 70, 254-256. Hams, C. C. (1979). J. Narl. Cancer Insr. 63, 275-277. Heenen, M., Achten, G.,and Galand, P. (1979). Ann. Dermurol. Venereol. (Paris) 106, 131-139. Heidelberger, C. (1975). Annu. Rev. Eiochem. 44,79-113. Higginson, J. (1969). Proc. Can. Cancer Res. Conf. 8th. Honey Harbour, Ontario, pp. 40-75. Holliday, R. (1979). Er. J. Cancer 40, 513-522. Jacobs, P. H., Farber, E. M., and Nall, M. L. (1977). Proc. Inr. Psoriasis Symp., 2nd. pp. 350-352. Kiyono, K., Wako, T., Ohata, T., Watanabe, T., and Kobayashi, T. (1978). Nippon Acra Radiol. 38, 539-546. Klein, H. 0.. and Lennartz, K. J. (1974). Semin. Hemarol. 11, 203-227. Kopper, L., Jeney, A., Takacs, J., Benedeczky, I., Dzurillay, E., and Lapis, K. (1978). Eur. 1. Cancer 14, 59-73. Kripke, M. L., Gruys, E., and Fidler, I. J. (1978). Cancer Res. 38, 2962-2967. Lajtha, L. G.(1979). Dtyerentiarion 14, 23-34. Lampkin, B. C., McWilliams, N. B., and Mauer, A. M. (1972). Semin. Hemarol. 9, 21 1-223. Lewis, M. R., and Cole, W. H. (1958). Am. Med. Assoc. Arch. Surg. 77, 621-626. Marx, J. L. (1978). Science 201, 515-518. Mauer, A. M., Murphy, S . B., Hayes, F. A., and Dahl, G.V. (1977). I n “Growth Kinetics and Biochemical Regulation of Normal and Malignant Cells” (B. Drewinko and R. M. Humphrey, eds.), pp. 855-864. Williams & Wilkins, Baltimore, Maryland. Merino, 0. R., Lindberg, R. D., and Fletcher, G.H. (1977). Cancer 40, 145-151.

162

SEYMOUR GELFANT

Milas, L., Malenica, B., and Allegretti, N. (1979). Cancer Immunol. Immunofher. 6, 191-196. Milo, G. E., Jr., and DiPaolo, J. A. (1978). Narure (London) 275, 130-132. Monacelli, M. (1971). Proc. In!. Psoriasis Symp., Isr. Stanford Univ.. pp. 99-104. Neidle, S. (1980). Nature (London) 283, 135. Nicolson, G. L. (1979). Sci. Am. 240, 66-76. Pederson, T., and Bhojee, J. S. (1979). J . Mol. Biol. 128, 451-480. Plesnicar, S., Klanjscek, G., Modic, S . , and Rustia, M. (1979). Cancer Res. 39, 4575-4578. Post, J., and Hoffman, J. (1969). Exp. Cell Res. 57, 111-113. Post, J., Sklarew, R. I., and Hoffman, J. (1973). J . Narl. Cancer Insr. 50, 403-414. Post, J., Sklarew, R. J., and Hoffman, J. (1974). J. Narl. Cancer Insr. 52, 1897-1903. Potten, C. S. (1981). Inr. Rev. Cyrol. 69, 271-318. Potten, C. S . , Hume, W. J., Reid, P., and Cairns, J. (1978). Cell 15, 899-906. Schabel, F. M., Jr. (1975). Cancer 35, 15-24. Schenken, L. L. (1976). Cancer Trear. Rep. 60, 1761-1776. Schiffer, L. M., Braunschweiger, P. G., Stragand, J. J., and Poulakos, L. (1979). Cancer 43, 1707- 17 19.

Sheehy, P. F., Fried, J., Dowling, M. D., Jr., and Clarkson, B. D. (1975). Cancer 36, 203-210. Shirakawa, S.,Luce, J. K., Tannock, I . , and Frei, E.,111 (1970). J . Clin. Invest. 49, 1188-1 199. Shuster, S., Chapman, P. H., and Rawlins, M. D. (1979). Br. Med. J . 1, 941-942. Sieber, S. M., and Adamson, R. H. (1975). Adv. Cancer Res. 22, 57-155. Silvestrini, R., Sanfilippo, O., and Tedesco, G. (1974). Cancer 34, 1252-1258. Steel, G. G. (1977). In “Growth Kinetics of Tumours.” Clarendon, Oxford. Stein, G. S., Stein, J. L., and Thomson, J. A. (1978). Cancer Res. 38, 1181-1201. Stein-Werblowsky, R. (1978). Br. J . Exp. Patho/. 59, 386-389. Stern, R., Zierler, S., and Parish, J. A. (1982). J . Invest. Dermutol. 78, 147-149. Temin, H. M. (1971). Proc. Leperit Coll. 2nd, Paris. pp. 176-187. Temin, H. M. (1972). Proc. Narl. Acad. Sci. U.S.A. 69, 1016-1020. Temin, H. M. (1974). Cancer Res. 34, 2835-2841. Ten, J. J., Lawrence, W., Jr., and Cox, B. (1977). Cancer 40, 1462-1470. Tubiana, M., and Malaise, E. (1976). Cancer Trear. Rep. 60, 1887-1895. Van Putten, L. M. (1974). Cell Tissue Kiner. 7,493-504. Van Scott, E. J., and Ekel, T. M. (1963). Arch. Dermarol. 88, 373-381. Watson, W., Cann, H. M., Farber, E. M., and Nall, M. L. (1972). Arch. Dermafol. 105, 197-207. Weinstein, G. D. (1971). Ann. N . Y . Acad. Sci. 186, 452-466. Weinstein, G. D., Velasco, J., and Frost, P. (1971). Proc. Inr. Psoriasis Symp.. Isr, Srunford, Univ., pp. 393-407. Weinstein, G. D., Golub, A. L., and McCullough, J. L. (1977). Proc. Inr. PsoriasisSymp., 2nd. pp. 210-218.

Weisburger, J. H., Griswold, D. P., Prejean, J. D., Casey, A. E., Wood, H. B., and Weisburger, E. K. (1975). I n “The Ambivalence Cytostatic Therapy” (E. Grundmann and R. Gross, eds.), pp. 1-17. Springer-Verlag, Berlin and New York. Weiss, L. (1977). Inr. J. Cancer 20, 87-92. Wright, N. (1977). Inr. J. Dermarol. 16, 449-463.

INTERNATIONAL REVIEW OF CYTOLOGY. VOL. 81

Cell Junctions in the Seminiferous Tubule and the Excurrent Duct of the Testis: Freeze-Fracture Studies TOSHIONAGANO AND FUMIESUZUKI Department of Anatomy, School of Medicine, Chiba University, Chiba, Japan I . Introduction ... ... Intercellular Junctions between the Sertoli Cells ................. A. Structure of the Sertoli Cell Junctions B. Development ......................................... C. Specialization between the Sertoli Cell and the Spermatogenic Cell ................................................. D. Blood-Testis Barrier in Nonmammalian and Invertebrate Testes ..................................... E. Experimental and Histopathological Aspects . . . . . . . . 111. Cell Junctions in the Epithelial Lining in the Excurrent Duct . . . . . . A. Tubuli Recti.. ..................... B. Rete Testis ........................................... C. Ductuli Efferentes . . . . . . . . . . . . . . . . . . D. Epididymis ........................................... E. Ductus Deferens.. ..................................... IV. Concluding Remarks ................................. References ............................................... 11.

I63 I65 165 172 I75 176 176 178 I79 I79 179 I83 186 I88 188

I. Introduction This article will describe morphological observations of intercellularjunctions in the seminiferous tubule and the excurrent duct system of some mammalian testes as revealed mainly by freeze-fracturing. The junctions in the nonmammalian testes will also be described briefly. The seminiferous epithelium resting on the seminiferous tubule consists of two cellular populations: spermatogenic cells and Sertoli cells. These two originate from different germinal layers during histogenesis. The former migrates from the endodermal vitellogastric epithelium and the latter originates from the mesodermal coelomic epithelium. In the active state, the spermatogenic cells continue to divide and differentiate into the mature spermatids. It has been postulated that the cytoplasmic connections exist as cytoplasmic bridges in each generation of the spermatogenic cells (Dym and Fawcett, 1971). In other words, all generations of the clonal spermatogenic cells appear to be connected with each other by the cytoplasmic bridges to form syncytia until spermiation (release from Sertoli cells), though this feature would I63

Copyright 0 1983 by Academic Press. Inc. All rights of reproduction in any form reserved. ISBN 0-12-364481-X

164

TOSHIO NAGANO AND FUMIE SUZUKI

FIG. 1. (A,B) Scanning electron micrograph of the rat seminiferous epithelium viewed from the basal side. The basal lamina, myoid cells, and others were digested by collagenase. The arrangement of the Sertoli cells (S) and spennatogonia is observed. The cytoplasmic connections between the spennatogonia are indicated by the arrows. X650 (A); X 1300 (B).(Courtesy of Dr.M. Hamazaki, Kurume University.)

CELL JUNCTIONS

165

be difficult to prove practically. The Sertoli cells or supporting cells, on the other hand, never divide in the adult testis and are separated by their cell membranes as individual cells. Although such phenomena had been described in the early literature, the evidence was not accepted until electron microscopic studies were available (Fig. 1) (see, Dym and Fawcett, 1971). It is partially true that the seminiferous tubule is classified into a holocrine type of gland. However, while the spermatogenic cells do not show an epithelial feature, the Sertoli cells do show unique epithelial characteristics to support the spermatogenic cells by formation of the microenvironment, blood-testis banier and to secrete androgen binding protein. Extensive morphological studies have yet to be made for the latter. Syncytial connections of the spermatogenic cells are not considered in this article. Beside the seminiferous epithelium, the wall of the seminiferous tubule consists of the basal lamina, myoid cells, and connective tissue cells with more or less collagen and elastic fibers. In the interstitium, there are Leydig cells, blood vessels, and lymphatics. The Leydig cells, myoid cells, and endothelial cells of the vessels attached to each other by the junctional complexes will not be considered in this article. The testicular excurrent duct system including rete testis, ductuli efferentes, epididymis, and ductus deferens is not only the transport and storage site for the sperm cells but is also responsible for sperm maturation; the spermatozoa gain fertilizing ability during the passage through the duct system. The epithelial cells of the system show cytological variations in the different parts and provide the proper microenvironments for the passing spermatozoa. From micropuncture studies, it is known that the fluid composition in various segments of the duct system is different from that present in blood plasma or lymph, modifying it along the duct (see review paper by Hinton, 1980). Moreover, the spermatozoa, the haploid cells, are heterogeneous for individuals concerned and work as a trigger for autoantibody production if they leak from the pathway. To maintain the fluid composition and to isolate the spermatozoa within the lumen, the epithelial tight junctions of the excurrent duct system are significant as a partition between the intra- and extraluminal spaces. The regional differentiation of the cell junctions will be described in relation to the epithelial characteristics. 11. Intercellular Junctions between the Sertoli Cells A. STRUCTURE OF THE SERTOLI CELLJUNCTIONS Intercellularjunctions between the epithelial lining cells other than the Sertoli cells were recognized as the terminal bar by light microscopy many years ago. ‘The term “Sertoli (cell) junctions” emphasizes not only the uniqueness of the intramembrane specializations but also includes the associated filaments and cisterns which are important as defining characteristics of the complex as was described by Gilula et al. (1976).

166

TOSHIO NAGANO AND FUMIE SUZUKI

The fine structure and the functional importance of the lining cell junctions were established by Farquhar and Palade (1963). They have defined a junctional complex consisting of three components, the zonulu occludens, tight (occluding) junction, the zonulu adherens, intermediate junction, and the muculu adherens, desmosome. In addition to the three components, the nexus or gap junction was found not only between the lining cells but also in the nonlining cells. Although early reports described the surface specializations of the Sertoli cells (Brokelmann, 1963; Nicander, 1967; Flickinger and Fawcett, 1967), the Sertoli cell junctions were not recognized as the site of the blood-testis barrier until the 1970s (Dym and Fawcett, 1970; Fawcett et al., 1970; see review articles, Neaves, 1977; Setchell, 1978). It is well known that fine particulate tracers, ferritin, peroxidase, or lanthanum nitrate, which had been administrated intravascularly, peritubularly, or in the lumen, were blocked by the tight junction. In the seminiferoustubule, the Sertoli tight junction is located near the base where the tracers are blocked. By this junction, the seminiferous epithelium is divided into two compartments: a basal compartment containing the premeiotic cells (spermatogonia, preleptotene spermatocytes) and an adluminal compartment containing the more advanced spermatocytes and spermatids (Dym and Fawcett, 1970). The fine structure of the junctional complex between adjacent Sertoli cells by thin sectioning consists of fused areas of the two Sertoli membranes, bundles of fine filaments of 50 8, diameter, and a series of cisterns of the endoplasmic reticulum. The cisterns are arranged nearly parallel to the Sertoli cell membranes in the junctional domain. A small number of ribosomes are attached in the endoplasmic side of the cisternal membrane. Other areas of the cisternal membrane are devoid of the ribosomes. The filaments are located between the cistern and the Sertoli cell membrane. They are actin-like in nature as concluded by decoration of heavy meromyosin forming the arrowheads (Toyama, 1976). The actin bundles run nearly parallel to the fused lines of the tight junction. Therefore, when the actin filaments are cut longitudinally, fused points of the cell membrane are not obviously seen. Although the functional significance of the arrangement of the cisterns in this region is not known, the cisterns may serve as a control mechanism for the contraction of the actin filaments. Freeze-fractured replicas provide an en face view of the Sertoli junctions which are quite unique and characteristic among the junctional complexes of other cells (Figs. 2 and 3). Tight junctions, the fused areas of adjacent Sertoli cell membranes, appear as discrete rows of the intramembranous particles. The rows Fic. 2. Freeze-fracture electron micrograph showing the basal part of the seminiferous epithelium of the guinea pig. The basal lamina, nuclei of the spermatogonia. and cytoplasm of the Sertoli cells are sectioned. The enface view of the Sertoli cell membranes is seen in the area bordered by the line. Inset is higher magnification of this area. Fused lines of the adjacent Sertoli membranes are the tight junctions. Perfused fixation with glutaraldehyde. P, P face. X 12,000. X 17,000 (inset).

CELL JUNCTIONS

167

168

TOSHIO NAGANO AND FUMIE SUZUKI

Rc. 3. Tight junctions of rat Sertoli cells on both fractured faces (P, E). The many parallel discrete rows of particles in the grooves on the E face and on the ridges on the P face represent the tight junctional particles or strands. Note more numerous particles or strands of the tight junctions on the E face than on the P face while there are many less particles of the nonjunctionalmembrane on the E face than on the P face. Perfused glutaraldehyde fixation. X72.000.

are approximately parallel to each other, about 0.05-pm apart, with less anastomoses and perpendicular to the cell axis. There are 30 or more in number on one junctional domain. The rows of the particles are found more numerously on the E face than on the P face. This particle localization on the fractured faces differs from that of other epithelia (see Staehelin, 1974) and resembles that in the vascular endothelial cells (Simionescu er af., 1975, 1976). Continuous strands of the tight junctional particles are sometimes found. Paired rows or strands of the junctions are also found. These features of the Sertoli cell junctions are not observed in other kinds of cells of vertebrates. Published papers on the Sertoli cell junctions revealed by freeze-fracture are fundamentally consistent for various mammals: in man (Nagano and Suzuki, 1976a), rat (Fawcett, 1975; Gilula er af., 1976; Bigliardi and Vegni Talluri, 1976; McGinley et af., 1977; Meyer er af., 1977; Nagano, 1980), mouse (Nagano and Suzuki, 1976b), and guinea pig (1976~).On the contrary, Connell (1978) has stated that in dog Sertoli cells, the junctions are similar to the septate junctions in invertebrate cells. However, it is

CELL JUNCTIONS

169

difficult to compare the Sertoli cell junctions of mammals with the septate junctions in the invertebrate cells (see Staehelin, 1974). In fact, in follicular cells in the silkworm testis, the tight junctions are distinguished from the septate junctions (Toshimori et al., 1979, see Section 11,D). Gap junctions between the Sertoli cells of the adult testis are situated between the parallel tight junctions. They consist of an aggregation of the gap junctional particles and are rectangular in contour. The particles on the P face and corresponding pits on the E face are regularly arranged. The large size, more than 0.5 km in diameter, gap junctions that are of round contour, and that appear in other cells, are not found in the adult Sertoli cells. The gap junctions in the developing Sertoli cells are described in the next section. Gilula et al. (1976) have postulated that the gap junctions between the tight junctional rows may provide the structural basis for coordination of the cytological events of the spermatogeniccycles. According to the experimental results of Gilula et af. (1976), the Sertoli cell junctions were resistant to exposure to hypertonic solutions, which were perfused vascularly, followed in a few minutes by fixation. The adluminal compartment of the seminiferous epithelium appeared to be intact while the basal compartment was condensed and shrunken. This provides evidence to support the concept that the Sertoli cell tight junctions constitute the morphological site of the bloodtestis barrier. The barrier is extremely firm. Since the study by Claude and Goodenough (1973), there is disagreement as to whether the number of the tight junctional strands reflects physiological tightness of the barrier. Martinez-Palomo and Erlij (1975) concluded that some hitherto unknown properties of the junctional strands themselves might be responsible for the permeability properties of the tight junctions but not the number. The discrete rows of the Sertoli tight junctions appearing preferentially on the E face were explained as the lack of glutaraldehyde-reactivesite on these particles, since the tight junctional particles of other cells become continuous strands on the P face by the reaction of glutaraldehyde (van Deurs and Luft, 1979). Measurements of the transepithelial resistance for the seminiferous epithelium have yet to be made. Development of freeze-fracture techniques makes it possible to observe the intramembranous particles and cellular junctions without use of chemical fixations and cryoprotectants. The Sertoli cell junctions revealed by metal contact freezing are quite similar in structure to those fixed in glutaraldehyde followed by glycerol treatment (Nagano, 1980) (Figs. 4-7). The discrete rows of the tight junctional particles are more numerous in number on the E face than on the P face. Continuous strands consisting of the particles are sometimes found. Narrow furrows in which the tight junctional particles appear to be located before fracturing the membrane are found on the P face (Figs. 4 and 7). The particles of the gap junctions are closely gathered in quasi-hexagonal fashion. The particle-free regions called the “aisles” can be found in the gap junctions in the juvenile Sertoli cells. The particles of the nonjunctional areas are more numerous on the P

170

TOSHIO NAGANO A N D FUMIE SUZUKI

Fio. 4. Rat Sertoli junctions frozen by the metal contact method without chemical fixation. On the P face (P),narrow furrows without particles are noted (arrowheads). On the E face (E), discrete rows of particles and strands (S) are seen. X95,ooO (Nagano, 1980).

face than on the E face. Therefore, the proper use of glutaraldehydeand glycerol does not produce such drastic artifacts as previously expected as far as the Sertoli cells are concerned. It has been reported that in quickly frozen tissues of various kinds, the organization of the gap junctions shows pleiomorphism; some of the particles have a crystalline configuration while the others show a random distribution (Raviola et al., 1980). Probably, proteins of the Sertoli tight and gap junctions appear not to be changed extensively during chemical fixation. In contrast to the Sertoli cells, tight junctions of the liver, small intestine, and epididymis show different configurations with and without chemical treatment (Nagano et al., 1982). The tight junctions of these tissues, other than the Sertoli cell, are to be found in discrete rows appearing more preferentially on the E face than on the P face, without use of glutaraldehyde and glycerol, as already suggested by van Deurs and Luft (1979). By conventional methods, these tight junctions can be found as continuous strands on the P face. Quantitative differences between the unfixed and chemically fixed materials remain to be studied. Desmosomes between adjacent Sertoli cells of the adult mammalian testis

CELL JUNCTIONS

171

have not been observed. However, in the rooster, the desmosomal structure has been reported by thin sectioning (Cooksey and Rothwell, 1973). The terminal segment of the seminiferous tubule is lined with Sertoli cells without spermatogenic cells. The intercellularjunctions in this segment are quite similar to those in the seminiferous tubule with spermatogenic cells (Suzuki and Nagano, 1978a). The number of the tight junctional rows are numerous, more than 30. The discrete rows of the tight junctional particles are more numerous on the E face grooves than on the P face ridges, as similarly observed in the seminiferous tubule. The junctional domain in this segment appears to be broader, and the distance between adjacent tight junctions is shorter than those in the seminiferous epithelium. Anastomoses of the tight junctions are less in number and the tight junctions run almost parallel to each other.

FIG. 5. Rat Sertoli junctions treated as in Fig. 4. Discrete rows of particles with some strands (S) are almost parallel to each other. The pits of the gap junctions (arrow) are closely arranged on the E face (entire field). X 100,OOO (Nagano, 1980).

172

TOSHIO NAGANO A N D FUMIE SUZUKI

FIG.6. Five-day-old mouse Sertoli junctions frozen by metal contact showing tight junctional strands and particles running in random directions. The junctional rows are discontinuous at many places. Pits of the gap junctions can be seen on the E face (almost entire field) with patches of a hexagonal arrangement (arrows). X80,OOO.

B. DEVELOPMENT The blood-testis barrier develops prior to manifestation of the testicular function. In the mouse and rat, the barrier appears to be completed by 3 to 4 weeks of age (Wale et af., 1973). In man, it has been reported that lanthanum tracer penetrates freely through the interstices between the Sertoli cells reaching the central portion of the tubule in the prepubertal testes (3-8 years of age), and that the tracer is blocked by the Sertoli junctions at the age of puberty (1 1-13 years) (Furuya et af., 1980a). These investigators suggested that the human bloodtestis barrier is formed shortly before and after the spermatogonia proliferate to give rise to the primary spermatocytes. The time of the barrier formation approximately coincides with the formation of the lumen of the seminiferous tubule (Flickinger, 1967).

CELL JUNCTIONS

173

FIG.7. Higher magnification of the gap junctions and some tight junctions of the 5-day-old mouse Sertoli cell frozen by the metal contact. In the gap junction, particle-free regions, called aisles, are evident. The narrow furrows (F)without or with the tight junctional particles are noted. Some furrows (arrow) are found in the aisles of the gap junction. x 100,OOO.

During pre- and postnatal development, gap junctions between the Sertoli cells are round or polygonal in outline. The major diameter of the patch of the gap junction is more than 0.5 pm. Particle-free regions in the gap junction are also found and short segments of the tight junctions with random directions can be seen (Figs. 6 and 7). As development proceeds, the patches of the gap junctions are reduced in size and the linear arrangement of the tight junctions elongates. Finally, the tight junctions become parallel to each other to form circumferential belts along the Sertoli cells. The gap junctions are situated between the parallel tight junctions with a rectangular outline (Nagano and Suzuki, 1976b, 1978; Gilula et al., 1976; Meyer et al., 1977). It has been pointed out that there are gentle ridges on the P face and shallow grooves on the E face of the Sertoli tight junctions devoid of the particles during early stages of development (Fig. 8) (Nagano and Suzuki, 1978). This type of junction, free of the junctional parti-

174

TOSHIO NAGANO AND FUMIE SUZUKI

Fki. 8. Tight junctions of 14-day embryo mouse Sertoli cells. On the P face (P), linear ridges (R) without particles and with particles (Pt)are found. On the E face (E), grooves with particles (Pt) and without particles (W) are also seen. The continuation from the ridge (Pface) to the groove (E face) is indicated by the arrows. X60,oOO (Nagano and Suzuki, 1978).

cles, can be recognized as linear elevations on the P face and shallow grooves on the E face in the juxtaluminal region of the coelomic mesothelium. of the mouse embryo (Suzuki and Nagano, 1979). This feature is believed to represent the initial formation of the tight junctions. In the developing Sertoli cells, the small size gap junctions are in contact with the linear arrangement of the particles, suggesting reduction of the gap junctions during development. Developmental events of the Sertoli junctions also proceed in the germ cellfree testis of the congenic mouse whose primordial germinal cells are completely absent in the seminiferous tubule (Nagano et al., 1977). The formation of the Sertoli junctions in this animal is basically similar to that of normal development. Thus the Sertoli junctions develop independently regardless to the presence or absence of the germ cells.

175

CELL JUNCHONS BETWEEN THE SERTOLI CELLAND C. SPECIALIZATION SPERMATOGENIC CELL

THE

The surface regions of the Sertoli cell facing differentiating spermatids have a specialized structure which resembles to some extent a moiety of the Sertoli junction. The structure consists of both bundles of actin filaments running around the acrosomal region of the spermatid and a series of cisterps of the endoplasmic reticulum. However, it is not known whether the structure is “junction,” “junctional derivative,” or not. By thin sectioning, the structure has been extensively described in various mammals (Brokelmann, 1963; Nicander, 1967; Flickinger and Fawcett, 1967; Nagano, 1968; Fawcett, 1975). Furthermore, Russell (1977b,c) has reported the cyclic reutilization of the structure during spermatogenesis. He has proposed the discontinuation of the use of the term “junctional specialization” (Russell, 1977~).This may not be the “junction” but may serve as a grasping device for the head of the spermatid in the Sertoli cell. As this structure resembles the moiety of the Sertoli junction, it would be interesting to speculate that the Sertoli junction itself divides into two, moves upward, and becomes a grasping device of the Sertoli cell for the spermatid during spermatogenesis. The recycling hypothesis of the structure including the actin filaments has also been proposed (Toyama, 1975; Toyama et al.: 1979; Ross, 1976; Russell, 1977b, 1979~). Another kind of device to retain the head of the spermatids has been reported in the rat (Russell and Clermont, 1976; Russell, 1979a-c). The cell membrane of the late spermatid invaginates into the Sertoli cell forming the tubulobulbar complexes. Freeze-fracture observations on the area between the Sertoli cell and the late spermatid have not been reported. In the rat, symmetrical densities on the cell membranes between the Sertoli cell and the spermatogenic cells except the late spermatid have been described as the desmosome-like structure (Kaya and Harisson, 1976; Russell, 1977a). In this region, both cell membranes come into close contact with a 3 to 5 nm distance between them. McGinley et af. (1977, 1979) have reported the existence, in the rat testis, of a peculiar arrangement-ofthe particles on the germ cell membrane. They considered this arrangement as a gap junction-like structure which appeared in both basal and adluminal compartments. However, the structure observed by them is so atypical that one cannot see the gap junctional particles on the P face and corresponding pits on the E face. It seems that no clear evidence for the intercellular junctions (tight or gap) between the spermatogenic cell and the Sertoli cell has been provided, at least for adult mammalian testes, except for the desmosome-like structure. As mentioned above, the spermatogenic cells are syncytial in the seminiferous tubule, so that any intercellular junctions between them may not exist. However, if some of them originate from different sper-

176

TOSHIO NAGANO AND FLJMIE SUZUKI

matogonial clone cells, the gap junctions may exist. This assumption is too theoretical to prove. Symmetrical densities of the plasma membranes between the Sertoli cell and the developing spermatid have been reported in the rooster (Nagano, 1959; Cooksey and Rothwell, 1973). However, no freeze-fracture observations of this area have been reported as yet. In the embryonic mouse testis, membrane densities with symmetry between the Sertoli cell and the germ cell have been observed (Nagano and Suzuki, 1978). They interpreted the gathered particles on the P face as the desmosome. Asymmetrical fuzzy lining of either Sertoli cell or gem1 cell membrane is also found in the mouse embryo. This lining may not be the cell junction but is explained as the site of endocytosis or exocytosis of the cell membrane.

D. BLOOD-TESTISBARRIER IN NONMAMMALIAN AND INVERTEBRATE TESTES

According to studies by Marcailou and Szollosi (1980) in nematodes and fish and by Jones (1978) in the locust, electron microscopic tracers such as peroxidase or lanthanum appear to be blocked by the sustentacular cells where the postmeiotic cells are situated. In contrast, the tracers penetrate into the level of the premeiotic cells. Nevertheless, the anatomical arrangement of the spermatogenic cells in the testis in these animals is very different from that of mammals. Whatever differences exist in histological organization of the testis from that of mammals, it can be generalized that, in the animal kingdom, the microenvironment for the haploid germ cell differentiation is provided in the testis by the somatic cells as described by Marcailou and Szollosi (1980). Freeze-fracture studies of the junctional complexes between the sustentacular cells in the silkworm testis have been reported by Toshimri er al. (1979). Three kinds of junctions, septate, gap, and tight junctions, are detected between the sustentacularcells which envelop the spermatids. The tight junctions are characterized by branching zigzag ridges on the P face. The particles of the gap junctions appear to be more prominent on the E face than on the P face. The particle localization of the gap junctions is frequently found in other somatic cells of invertebrates (see Flower, 1977). The septate junctions of the cells are seen as many mutually parallel wavy rows of the particles, not serially arranged but intermittently spaced, on the P face.

E. EXPERIMENTAL AND HISTOPATHOLOGICAL ASPECTS In the human testicular feminization syndrome that is characterized by congenital lack of androgen receptors, the tubule consists of Sertoli cells, spermatogonia, and early sperrnatocytes without any further differentiating cells. In

CELL JUNCTIONS

177

this case, many parallel tight junctions similar to those in normal men can be seen (Nagano and Suzuki, 1976a). If gonadotropin release is suppressed, the development of the blood-testis barrier is delayed in the rat but the junctions appear at such time as the blood-testis barrier has been constituted (Vitale et af., 1973). Further, after administration of busulfan to the pregnant rat, the junctions in the offspring’s testis develop in the tubule which contains only Sertoli cells (Gilula et al., 1976), as reported in the germ cell-free testis of the congenic mouse (see Section 11,B). Clinical and pathological aspects on the blood-testis barrier have been reported in limited number. In the testis from idiopathic hypogonadotropic eunuchoidism, it has been reported that the Sertoli junctions have not been detected but after treatment with human chorionic gonadotropin, lanthanum tracer is blocked by newly formed junctions (Furuya et al., 1980b). Morphological changes of the blood-testis barrier have not been found clearly in varicocele of men (Cameron et af., 1980) nor in immune-induced aspermatogenesis and vasectomy in the guinea pig (Castro and Seiguer, 1974). On the other hand, the penetration of lanthanum tracer from the tubule wall to the adluminal compartment has been found in ligation of efferent ductules (Neaves, 1973; Ross, 1977). After vasectomy of a particular strain (Lewis rats) lanthanum tracer penetrates into the adluminal compartment associated with the decrease of testicular weight and sperm concentration due to the production of autoantibodies(Neaves, 1978). Passive transfer of anti-testis antibody 24 to 48 hours after injection in the guinea pig produced deformation of the spermatid nucleus and acrosome, indicating that the antibody penetrated into the adluminal compartment (Nagano and Okumura, 1973). By isoimmunization of the testicular tissue as antigens in the guinea pig, histological changes appeared as exfoliation of the differentiated germ cells from the Sertoli cells and distortion of the spermatid nucleus and acrosome (Nagano and Okumura, 1973). It is also reported in autoimmune orchitis that the tracers penetrate into the tubule suggesting a breakdown of the barrier (Johnson, 1970a; Wilson et af., 1973). Possible mechanisms for initiation of experimental allergic orchitis by which the antibodies reach the adluminal compartment are described by Tung (1980). Soluble antigens leak at the weakest barrier (the rete or efferent duct, see below) and they flow either in an anteretrogradeor retrograde direction, or both. Another possibility is that there is an unknown factor which weakens the barrier and permits the antibody to pass through the barrier. Fawcett (1979) has indicated that an almost identical set of changes is observed after application of heat, administration of antifertility drugs, and vasectomy. The feature common to premature release of germ cells, whether drug-induced or the immune response, would seem to be a reaction of the Sertoli cells to injury which involves a withdrawal of their processes that normally hold the germinal cells in the epithelium. The mechanism for the antibody penetration to the adluminal compartment has not been analyzed at a fine structural level. Sporadic breakage of the

178

TOSHIO NAGANO A N D FUMIE SUZUKl

FIG.9. Sertoli cell junctions of allergic orchitis in the guinea pig 17 days after immunization with testicular homogenate and complete adjuvant. The tight junctions are fragmented into many pieces. P, P face; E, E face. ~35,000(Nagano and Suzuki, 1976~).

tight junctions of the Sertoli cells occurred in allergic aspermatogenesis in the guinea pig induced by autoantigens (Fig. 9) (Nagano and Suzuki, 1976~).More freeze-fracture observations of the Sertoli cell junctions in clinicopathological aspects will be needed to correlate the morphological changes and the leakage of the blood-testis barrier.

111. Cellular Junctions in the Epithelial Lining in the Excurrent Duct The junctional complexes of the epithelial cells lining the excurrent duct system are situated in. the juxtaluminal area of the cell. When they are observed by freeze-fracture using glutaraldehyde and glycerol, the tight junctional elements are preferentially located on the P face and the grooves are found on the E face. On the P face, they consist of continuous strands with some discontinuities. On the E face, the particles in the grooves are not many in number. The geometric organization of the tight junctions in different regions of the duct as observed by conventional freeze-fracture will be described.

CELL JUNCTIONS

179

A. TUBULIRECTI The tubuli recti connect the terminal segment of the seminiferous tubule to the rete testis and are lined with a simple epithelium that varies in height. They also vary in length among the mammals (Osman and Pliien, 1978). In the rat, they are very short or completely absent. In the guinea pig, the epithelial cells contain a tremendous amount of glycogen throughout the cytoplasm (Fawcett and Dym, 1974). It is also reported that the epithelial cells of the tubuli recti of the boar is capable of phagocytosis of spermatozoa (Sinowatz el a f . , 1979). No freezefracture observations on the junctional complexes of the tubuli recti have been published. According to the thin section study (Osman and Ploen, 1978), fused areas of the tight junctions are relatively large in number.

B. RETETESTIS The lumen of the rete testis has many anastomoses forming a three-dimensional meshwork in the mediastinum. In the rat, the rete expands to the outside of the testis, and this portion is called exfrafesticufurrefe (Roosen-Runge, 1961; Dym, 1976). The rete is lined with cuboidal or low columnar cells. The epithelial cells are the lowest in height among the seminiferous tubule and the duct system. A long single flagellum and many small microvilli are found in the apical part of the cells (Dym, 1976; Roosen-Runge and Holstein, 1978). Degenerating spermatozoa are found in the cytoplasm indicating phagocytotic activity to remove the unnecessary spermatozoa (Dyrn, 1976; Sinowatz ef a f . , 1979). By freeze-fracture observations on the epithelial cells of the rat rete testis, the tight junctions show anastomosing branches, and consist of smooth-surfaced strands with some discontinuities on the P face. The particles in the grooves on the E face are few in number. Some free endings of the strands toward the basal direction can be seen. The number of the strands traced in the apical-basal direction varies from 3 to 25, and the mean number is 8.8 in the rat (Suzuki and Nagano, 1978a). It is likely that the meshwork of the junctions in the extratesticular rete is more extensive than that in the intratesticular rete (Fig. 10). By thin sectioning, Dym (1976) has reported that the intercellular tracer compounds are blocked from entering the lumen of the rete testis by the juxtaluminal tight junctions, and suggested that the barrier exists at the level of the rete testis.

C. DUCTULI EFFERENTES The ductuli efferentes are several or more in number in one testis and extend from the rete to the initial segment of the epididymis. The lumen of the ductuli is stellate in cross section because the lumen is lined by alternating groups of tall and low cells forming several ridges along the length of the ductuli. The epi-

180

TOSHlO NAGANO AND FUMIE SUZUKI

FIG. 10 The tight junctional meshwork of the extratesticular rete testis of the rat. Most of the tight junctions can be observed as strands with some discontinuities on the P face (P). Many branchings and anastomoses of the strands are noted. E, E face; L, luminal side. X60,oOO (Suzuki and Nagano, 1978a).

thelium comprises the nonciliated (principal) and ciliated cells. The nonciliated cells are subdivided into several types in morphology depending on the species (Morita, 1966; Holstein, 1969). Many pinocytotic vacuoles and coated vesicles are found in the apical cytoplasm of the nonciliated cells. In the ductuli efferentes, as the epithelial lining cells consist of two or more kinds of cells, the tight junctional strands are different in number between different combinations of the cells. Between the two nonciliated cells, the tight junctional strands are minimal in number along the excurrent duct as far as examined in the rat (Fig. 11). The mean number is 1.6, which is much smaller than that of

181

CELL JUNCTIONS

the rete testis. It is interesting to note that the number of the tight junctional strands and the width of the domain are the same regardless of the cell size and shape along the duct. In association with the poorly developed tight junctions of the nonciliated cells, aggregations of the gap junctional particles extend circumferentially in the juxtaluminal region. This type of gap junction termed “belt-like gap junction” was first described in the rat ductuli efferentes (Suzuki and Nagano, 1978a), and later in the human, guinea pig, and mouse (Nagano and Suzuki, 1980) (Fig. 12). Frequently, the tight junctional domain is almost completely replaced by the belt-like gap junction. The particle-free regions are sometimes found nearly vertical to the belt. Therefore, no junctional elements can be seen in this region. The lanthanum tracer reaches near the luminal surface between the nonciliated cells. Macula type of gap junctions is also seen beneath the tight junctional domain. The gap junctions between the nonciliated cells may indicate a functional syncytium in the broad sense. Between the ciliated and the nonciliated cells, a few strands of the tight junctions are found. Between two ciliated cells, the tight junctional strands appeared to be well developed, though the observations of such combinations are 20

T 15

0” e

5

10

0

0

2

5

Rete testis

C.-Non C.

N o n C.-Non C.

v

ductuli efferentes

Initial L

Caput

.

Corpus

Cauda I

Epididymis

FIG. 1 I . Histogram of the mean number and standard deviation of the strands of the tight junctions in various parts of the duct system. C-Non C, tight junctions between ciliated and nonciliated cells; Non C-Non C, between two nonciliated cells (Suzuki and Nagano, 1978a).

182

TOSHIO NAGANO AND FUMIE SUZUKI

FIG. 12. A large belt-like gap junction in the adluminal area between the nonciliated cells in the mouse ductuli efferentes. Aggregation of the particles on the P face (P) and corresponding pits on the E face (E) can be observed. L, Luminal side. X90,oOO (Nagano and Suzuki, 1980).

limited in number. In general, epithelial cells which are subjected to mechanical stress appear to have many tight junctions. Many more tight junctional strands are found between the tectorial cells of the inner ear than those between other cells in the same endolymphatic canal (Hirokawa, 1980). The tight junctions between the ciliated cells in the oviduct (Komatsu et al., 1978) and in the efferent ductule may be another example. In these cases, the tight junctions may function as a device for mechanical support against the stress or ciliary movement in addition to the diffusion barrier. The rete was believed to be the weakest barrier along the duct. Waksman (1959) and Johnson (1970b) suggested that the rete was the primary site of antibody invasion. It seems, however, that our results may indicate the ductuli

CELL JUNCTIONS

183

efferentes appear to be most permeable in the excurrent duct, since the tight junctions in the rete are more developed than in the efferent ductules. Although it is stated that the number itself of the tight junctional strands may not be related to the tightness of the barrier (Martinez-Palomoand Erlij, 1975), the free regions of the junctional elements between the nonciliated cells suggest the absent parts of the barrier. It is evident that the majority of the fluid secreted by the seminiferous epithelium is reabsorbed at the proximal part of the excurrent duct (Crabo, 1965) and that particulated tracers injected into the rete are taken up in the cytoplasmic vesicles of the nonciliated cells of the ductuli efferentes (Montorzi and Burgos, 1967). As an effective way of fluid transport through the epithelial layer, solute may be actively pumped out by the cells into the intercellular space resulting in a passive influx of water. Diamond (1974) has speculated that if the junctions were leaky, more salt could cross the junction into the intercellular spaces. As in the case of the proximal convoluted tubules in the kidney (Claude and Goodenough, 1973), the weak intercellular barrier of the ductuli efferentes may facilitate the fluid movement. D. EPIDIDYMIS The epididymis is customarily subdivided into three regions, the caput, corpus, and cauda in gross anatomy, and is formed with a convoluted duct. The pseudostratified epithelium of the epididymis consists of principal cells, basal cells, and halo cells. In addition, clear and apical cells are seen in rodent species. The principal, clear, and apical cells reach the lumen, and the cells of the latter two types are situated sporadically among the principal cells (Hamilton, 1975). The principal cells are the most dominant cells in the epithelium, and show regional variations along the epididymal duct. In the initial segment, the principal cell type is tall columnar, which tends to reduce its height toward the distal part, and in the cauda epididymidis, the cell is low columnar or cuboidal in shape. Several substances, such as glycoproteins, glycerylphosphorylcholine, carnitine, sialic acid, and steroids are known to be produced by the epididymal epithelium (see Hamilton, 1975). Although morphological information for the synthetic pathway of these substances is limited, active participation of the principal cells, particularly in the initial segment, in glycoprotein and protein synthesis has been established by autoradiographic studies (Kopehg and Pech, 1977; Flickinger, 1979). The principal cells are also known to take up the particulate substances (Hamilton, 1975). The functions of the other types of cells are still in debate. Freeze-fracture images of the epididymal tight junctions have been studied in rats (Friend and Gilula, 1972; Suzuki and Nagano, 1978a), in mice (Suzuki and Nagano, 1978b), and in monkeys (Cavicchia, 1979). All of these images seem to represent the tight junctions between the adjacent principal cells. Extensive

184

TOSHIO NAGANO AND FUMIE SUZUKI

networks of the tight junctions are evident at the apical region. Basal strands of the tight junctional networks often terminate as free endings. Small gap junctions are sometimes seen in the tight junctional networks, and the macula type of gap junctions appears basal to the tight junctional domain. Desrnosomes are recognized as characteristic particle aggregations in the basal part of the tight junctions (Fig. 13). Suzuki and Nagano (1978b) compared the tight junctional organization of the epithelium in the various regions in the rat epididymis. The width of the tight junctional domain is at its largest at the initial segment of the epididymis (Fig. 13) and becomes narrower from the proximal to the distal part of the epididymis. The mean number of the strands in the apical-basal direction is 12.7 in the initial segment, 15.6 in the caput, 8.3 in the corpus, and 9.9 in the cauda (Fig. 11). The strands on the P face are more discontinuous in the more proximal portion of the epididyrnis and have a smoother appearance in the more distal portion. In the

FIG.13. The initial segment of the rat epididymis. The tight junctional belt is wide. On the P face (P),the strands are discrete rows of particles blending smoothly outlined strands (arrows) and form a frequently anastomosing meshwork. No particular orientation of the strand to the cell axis is recognizable. Desmosomes (asterisks) can be identified in the basal compartments of the tight junctional meshworks. L, Lumen. X45.000 (Suzuki and Nagano, 1978a).

CELL JUNCTIONS

185

FIG. 14. The tight junction of the cauda epididymidis in the rat. On the P face (P),the majority of strands are smoothly outlined with some discontinuities, and orient parallel to the luminal surface. L, Lumen. X60,OOO (Suzuki and Nagano, 1978a).

initial segment, the meshworks are composed of branching and anastomosing strands (Fig. 13). The orientation of the strands to the cell axis is ambiguous in this segment. In the more distal part of the epididymis, the meshworks show a stretched appearance around the circumference of the cells, and parallel orientation of the strands to the luminal surface is prominent. The branching and anastomozing of the strands are less in number than those in the initial segment. The extremities of this tendency are seen in the cauda, where the majority of the strands are arranged in parallel to the luminal surface (Fig. 14). The geometrical variation may reflect the different stresses which distend the lumen around the circumference as suggested by Hull and Staehelin (1976), since the distal part of the epididymis is differentiated for sperm storage (Glover and Nicander, 197I ) and receives a large stress from the accumulation of the luminal contents. The tracer experiments show some species variation in the permeability of the epididymal epithelium. Friend and Gilula (1972) showed that in the rat the occludens portion of the junctional complex excludes pyroantimonate from the intercellular space when the tracer is introduced via the lumen. Cavicchia (1979) showed that in the monkey intravascularly injected lanthanum penetrated close to the apical plasma membrane. He attributed the permeability to the nonparallel orientation of the strands to the luminal surface and to the discontinuities of the strands. Considering the regional variations of the tight junctions observed by freeze-fracture, the permeability may vary from region to region. The tight junctions of the clear cell and apical cell in the rodent should not be neglected. Development of the tight junctional organization has been studied in the caput epididymidis of the mouse (Suzuki and Nagano, 1978b). The rudiment of the epididymis appears as a Wolffian duct on the tenth day of gestation. The lumen can be found on the twelfth day and the tight junctional meshworks surround the entire circumference of the cells. The depth of the tight junctional belt and the

186

TOSHIO NAGANO AND FUMIE SUZUKI 1

2

FIG. 15. Developmental processes of the tight junction in the caput epididymidis of the mouse. The figures were prepared by tracing the strands in micrographs of freeze-fracture replicas tSuzuki and Nagano, 1978b). 1-4 represent 12-day-old embryo, 10-day-old, 16-day-old, and adult, respectively. Note the marked increase of the strands from I to 3, and the geographical change between 3 and 4.

number of strands increase until 20 days of postnatal age. The geometrical organization of the meshworks changes during development (Fig. 15). The remarkable development of the tight junctions can be found in the three-cell joining part before puberty. Up to 20 days, the strands anastomose frequently with no particular orientation to the cell axis. After 20 days, the major direction of the strands becomes parallel to the luminal surface decreasing the anastomoses in number. The configuration changes of the meshworks seem to be correlated with increased stress to the cell apex by the widening of the lumen and the thickening of the cells themselves. In the basal side of the tight junctional belt, free endings of the strands appear irrespective of the developmental stages and loop terminations of the strands are found frequently in the prepubertal stages. The gap junctions associated with the tight junctional meshworks are also found frequently before puberty. After puberty, this type of gap junction decreases in number and size and isolated gap junctions of large size appear below the tight junctional domain. E. DUCTUSDEFERENS The ductus deferens is lined with pseudostratified epithelium consisting of columnar cells and basal cells. The columnar cells are subdivided into principal,

CELL JUNCTIONS

187

pencil, and mitochondrion-rich cells in the scrota1 segment of the human ductus (Hoffer, 1976). The regional variations of the epithelium have been noted in the rat (Hamilton and Cooper, 1978) and in the monkey (Ramos, 1979). Freeze-fracture observations on the junctional complex of the epithelial lining cells are reported in the proximal part of the duct in the rat (Suzuki and Nagano, 1978a). The adluminal tight junctions are similar to those of the cauda epididymidis. The width of the tight junctions is about 0.6 p n . In addition, many strands appear ubiquitously running almost at random directions on the lateral surface of the cell. Some strands run parallel to each other (Fig. 16). The adluminal strands have morphological features for a sealing device, but the additional strands on the lateral surface may not work for sealing. The functional significance of these strands cannot be explained. Nevertheless, one should note that the epithelial cells of the duct are obliged to change form by the pressure of

Fic. 16. Lateral surface of the epithelial cells of the rat ductus deferens. The tight junctional strands are scattered throughout the field. E, E face; P, P face. X53.000 (Suzuki and Nagano, 1978a).

188

TOSHIO NAGANO AND FLJMIESUZUKI

the luminal contents and by muscular contraction. They may work as an attachment device to prevent separation of the lateral surface of the adjacent cells. Freeze-fracture observations of the tight junctions in the various segments of the duct and in different species are left for future works.

IV. Concluding Remarks We have discussed cell to cell junctions revealed by freeze-fracture i n the seminiferous tubules and the lining cells of the excurrent duct. Sealing elements of these lining cells have a significant function in maintaining the specific niicroenvironments playing an important role in spermatogenesis, transportation, maturation, and storage of the spermatozoa. Unique features of the Sertoli cell junctions are emphasized. Instead of the conventional method of freeze-fracture, the techniques of rapid freezing and deep etching without use of aldehyde fixatives and cryoprotectants will be a powerful tool to reveal the “new” fine structure of membrane and cytoplasm. Plausible explanations of the unique particle distribution in the Sertoli cell junctions both in fixed and “unfixed” conditions are expected in further studies. Concomitantly, it remains to be understood how the different configurations of the tight junctions along the excurrent duct reflect the results obtained by micropuncture analysis of the fluid components in different segments of the duct system. More comparative, experimental, and clinicopathologicalstudies on the junctional complexes would be necessary to understand the blood-testis barrier and the environments of the excurrent duct system.

ACKNOWLEDGMENTS We thank Dr. W. J. O’Sullivan for his assistance in the preparation of the manuscript and Dr. M. Hamazaki for the contribution of his electron micrograph. This work was supported by a grant from the Japanese Ministry of Education, Culture and Science.

REFERENCES Bigliardi, E., and Vegni Talluri, M. (1976). Cell Tissue Res. 172, 29-38. Briikelmann, J. (1963). Z . Zellforsch. 59, 820-850. Cameron, D. F.,Snydle, F. E., Ross, M. E., and Drylie, D. M. (1980). Ferril. Sreril. 33,526-533. Castro, A. E., and Seiguer, A. C. (1974). Virchow Arch. Abr. E Zellparhol. 16, 297-309. Cavicchia, J. C. (1979). Cell Tissue Res. 201, 451-458. Claude, P., and Goodenough, D. A. (1973). J . Cell Eiol. 58, 390-400. Connell, C. J. (1978). J . Cell Eiol. 76, 57-75.

CELL JUNCTIONS

189

Cooksey, E. J., and Rothwell, B. (1973). J. Anar. 114, 329-345. Crabo, B. (1965). Acru Vet. Scand. 6 (Suppl. 5 ) , 1-94. Diamond, J . M. (1974). Fed. Proc. Fed. Am. Sor. Exp. Biol. 33, 2220-2224. Dym, M. (1976). Anut. Rec. 186, 493-524. Dym, M., and Fawcett, D. W. (1970). Biol. Reprod. 3, 308-326. Dym, M., and Fawcett, D. W. (1971). Biol. Reprod. 4, 195-215. Farquhar, M. G., and Palade, G . E. (1963). J. Cell Biol. 17, 375-412. Fawcett, D. W. (1975). Hundb. Physiol. 5, 21-55. Fawcett, D. W. (1979). In “Vasectomy” (I. H. Lepow and R. Crozier, eds.), pp. 3-23. Academic Press, New York. Fawcett, D. W., and Dym, M. (1974). J . Reprod. Fertil. 38,401-409. Fawcett, D. W . , Leak, L. V., and Heidger. P. M. (1970). J. Reprod. Fertil. Suppl. 10, 105-122. Flickinger, C. J. (1967). Z. Zellforsch. 78, 92-1 13. Flickinger, C. J. (1979). Biol. Reprod. 20, 1015-1030. Flickinger, C. J., and Fawcett, D. W. (1967). Anat. Rec. 158, 207-222. Flower, N. E. (1977). J. CellSci. 25, 163-171. Friend, D. S., and Gilula, N. B. (1972). J. Cell Biol. 53, 758-776. Furuya, S., Kumamoto, Y.,Mori, M., and Sugiyama, S. (1980a). In “Normal and Cryptorchid Testis” (E. S. E. Hafez, ed.), pp. 73-93. Nijhoff, The Hague. Furuya, S., Kumamoto, Y.,and Ikegaki, S. (1980b). Arch. Androl. 5, 361-367. Gilula, N. B., Fawcett, D. W., and Aoki, A. (1976). Dev. Biol. 50, 142-168. Glover, T. D., and Nicander, L. (1971). J. Reprod. Ferril. Suppl. 13, 39-50. Hamilton, D. W. (1975). Hundb. Physiol. 5, 259-301. Hamilton, D. W . , and Cooper, T. G . (1978). Anur. Rec. 190, 795-810. Hinton, B. T. (1980). Invest. Urol. 18, 1-10, Hirokawa, N. (1980). Anat. Rec. 196, 129-143. Hoffer, A. P. (1976). Biol. Reprod. 14, 425-443. Holstein, A. F. (1969). Zwunglose Abhundl. Gebier Norm. Parhol. Anar. 20, 1-91. Hull, B. E., and Staehelin, L. A. (1976). J . Cell Biol. 68, 688-704. Johnson, M. H. (1970a). J. Reprod. Ferril. 22, 119-127. Johnson, M. H. (1970b). J . Purhol. 101, 129-139. Jones, R. T. (1978). J. CellSci. 31, 145-163. Kaya, M., and Hanison, R. G. (1976). J . Anal. 121, 279-290. Komatsu, M., Ishimura, K., and Fujita, H. (1978). Arch. Hisrol. Jpn. 41, 453-458. Kopefny, V., and Pech, V. (1977). Hisrochemistry 50, 229-238. McGinley, D., Posalaky, Z., and Porvaznik, M. (1977). Anar. Rec. 189, 211-232. McGinley, D. M., Posalaky, Z., Porvaznik, M., and Russell, L. (1979). Tissue Cell 11, 741-754. Marcailou, C., and Szollosi, A. (1980). J. Ulrrusrrucr. Res. 70, 128-136. Martinez-Palomo, A,, and Erlij, D. (1975). Proc. Nurl. Acud. Sci. U.S.A. 72, 4487-4491. Meyer, R., Posalaky, Z.. and McGinley, D. (1977). 1. Ulrrusrrucr. Res. 61, 271-283. Montorzi, N. M., and Burgos, M. H. (1967). Z . Zellforsch. 83, 58-69. Morita, I. (1966). Arch. Hisrol. Jpn. 26, 341-365. Nagano, T. (1959). Arch. Hisr. Jpn. 16, 311-345. Nagano, T. (1968). Z . Zellforsch. 89, 39-43. Nagano, T. (1980). J. Elecrron Microsc. 29, 250-255. Nagano, T., and Okumura, K. (1973). Virchow Arch. Abr. B Zellparhol. 14, 223-236. Nagano, T., and Suzuki, F. (1976a). Cell Tissue Res. 166, 37-48. Nagano, T., and Suzuki, F. (1976b). Anar. Rec. 185, 403-418. Nagano, T., and Suzuki, F. (1976~).Gummu Symp. Endocrinol. 13, 61-67. Nagano, T., and Suzuki, F. (1978). Cell Tissue Res. 189, 389-401.

190

TOSHIO NAGANO AND FUMIE SUZUKI

Nagano, T., and Suzuki, F. (1980). Arch. Hisrol. Jpn. 43, 185-189. Nagano, T., Suzuki, F., Kitamura, Y., and Matsumoto, K. (1977). Lab. Invesr. 36, 8-17. Nagano, T., Toyama, Y., and Suzuki, F. (1982). Am. J . Anar. 162,47-58. Neaves, W. B. (1973). J. Cell Eiol. 59, 559-572. Neaves, W. B. (1977). I n “The Testis” (A. D. Johnson and W. R. Comes, eds.), Vol. 4, pp. 125-162. Academic Press, New York. Neaves, W. B. (1978). J. Reprod. Ferril. 54, 405-411. Nicander, L. (1967). 2.Zellforsch. 83, 375-397. Osman. D. I., and Plijen, L. (1978). Anar. Rec. 192, 1-18. Ramos, A. S., Ir. (1979). Arch. Androl. 3, 187-196. Raviola, E.,Goodenough, D. A., and Raviola, G. (1980). J . Cell Eiol. 87, 273-279. Roosen-Runge, E. C. (1961). Acra Anar. 45, 1-30. Roosen-Runge, E. C., and Holstein, A. F. (1978). Cell Tissue Res. 189, 409-433. Ross, M. H. (1976). Anar. Rec. 186, 79-104. Ross, M. H. (1977). Am. J . Anar. 148, 49-56. Russell, L. (1977a). Am. J. Anar. 148, 301-312. Russell, L. (1977b). Am. J . Anar. 148, 313-328. Russell, L. (1977~).Tissue Cell 9, 475-4923, Russell, L. D. (1979a). Anar. Rec. 194, 213-232. Russell, L. D. (1979b). Anar. Rec. 194, 233-246. Russell, L. D. (1979~).Am. J . Anar. 155, 259-280. Russell, L., and Clermot, Y. (1976). Anar. Rec. 185, 259-278. Setchell, B. P. (1978). “The Mammalian Testis.” Cornell Univ. Pkss, Ithaca, New York. Simionescu, M., Simionescu, N.,and Palade, G. E. (1975). J . Cell Biol. 67, 863-885. Simionescu, M., Simionescu, N.,and Palade, G. E. (1976). J . CeNBiol. 68, 705-723. Sinowatz, F., Wrobel, K. H., Sinowatz, S.. and Kugler, P. (1979). J. Reprod. Ferril. 57, 1-4. Staehelin, L. A. (1974). Inr. Rev. Cyrol. 39, 191-283. Suzuki, F., and Nagano, T. (1978a). Anat. Rec. 191, 503-520. Suzuki, F., and Nagano, T. (1978b). Dev. Eiol. 63, 321-334. Suzuki, F., and Nagano, T. (1979). Cell Tissue Res. 198, 247-260. Toyama, Y. (1975). Cell Tissue Res. 158, 205-213. Toyama, Y.(1976). Anar. Rec. 186, 447-492. Toyama, Y.,Obinata, T., and Holtzer, H. (1979). Anar. Rec. 195, 47-62. Toshimori, K., Iwashita, T., and Oura, C. (1979). Cell Tissue Res. 202, 63-73. Tung, K. S. K. (1980). In “Immunological Aspects of Infertility and Fertility Regulation” (D. S. Dhindsal and F. B. Schumacher, eds.). pp. 33-91. Elsevier, Amsterdam. van Dews, B., and Lufi, J. H. (1979). J. Llltrastruc?. Res. 68, 160-172. Vitale, R., Fawcett, D. W., and Dym, M.(1973). Anar. Rec. 176, 333-344. Waksman, B. H. (1959). J. Exp. Med. 109, 311-324. Wilson, J. T., Jones, N. A., Katsh. S., and Smith, S. W. (1973). Anal. Rec. 176, 85-100.

INTERNATIONAL REVIEW OF CYTOLOGY. VOL. 81

Geometrical Models for Cells in Tissues HISAO HONDA Kanebo Institute for Cancer Research, Kobe, Japan

.........................

1. Int 11. Th

111.

IV.

V. V1.

Be Represented by Points . . .

A. ......................... B. ......................... C. Approximation of Actual Cellular Patterns by the Cell Aggregate Model ...................................... D. Application of the Cell Aggregate Model of Cell Patterns ....................... The Boundary Shortening Model of Cells in a A. lntracellular Contractile Systems. ....... B. The Boundary Shortening Model of Cells C. Application of the Boundary Shortening Model to Dynamic Changes of Cellular Patterns.. ........................... Cell States in Tissues: Epithelium-like or Not A. Discrimination of Cellular Patterns. ....................... B. Formation of an Epithelium-like Cell Sheet C. The Epithelium-like State of Cells ........................ Fundamental Consideration of Tension and Shape A. Tension for Maintaining a Constant Shape . . . . . . . . . . . . . . . . . B. On the Polygonal Pattern with the Minimum Boundary Length. Conclusions .............................................. References .................... ....

191 I92 I92 194 200 204 216 216 217 227 233 233 236 238 240 240 242 244 246

I. Introduction A tissue can be explained in terms of individual cell properties, since it consists of cells and acellular material which is derived from cells. Some tissue properties can be simply understood as being more like a collection of independent cells, whereas others can only be understood as being under the influence of some supervising mechanism of the entire system. Such a supervising mechanism is mysterious and vague at present, but one that demands investigation. One possible way is to study the system, as far as possible, as a simple collection of cells. Continuing such an investigation will clarify its limits and define remaining problems clearly. Therefore, powerful models are needed which will bridge the gap between a tissue and its component cells. Living organisms often show cellular structures whose surface pattern is poly191

Copyright 0 1983 by Academic Press. Inc. All rights of reproduction in any form reserved. ISBN 0-12-364481-X

192

HISAO HONDA

gonal. The geometry of such structures has long been investigated (e.g., Lewis, 1923, 1943; Thompson, 1942; Matzke and Duffy, 1956; Wheeler, 1962a,b; Korn and Spalding, 1973; Korn, 1976, 1980; Dormer, 1980; Pyshnov, 1980; Abbott and Lindenmayer, 1981). On the other hand, recently increasing knowledge about intracellular filamentous structures has improved our understanding of the mechanism for generating the forces responsible for cell shape maintenance and its change. On the basis of such knowledge we have initiated reconstruction of cell models which may contribute to advances of the study of tissue morphogenesis. We will describe two geometrical cell models, the cell aggregate model (Section 11) and the boundary shortening model of cells in a tissue (Section 111). These will be shown to be useful in describing cellular patterns and simulating dynamic changes during morphogenesis, developmental processes, and wound healing. These will eventually be used to analyze cellular patterns geometrically and to inspect states or functions of a tissue (Section IV). The models will be discussed with respects to mechanics and geometry (Section V). For the moment, we will deal with two-dimensional cellular patterns only. In addition to the technical simplicity of obtaining actual data and calculating and displaying with the use an electronic computer, most morphogenesis in developmental processes is essentially two-dimensional. For instance, a presumptive fate-map of an embryo is considered to be on a spherical surface. A number of epithelial organs undergo either invagination or evagination during early organogenesis, i.e., a relatively flat sheet of cells is converted into a curved structure, forming either a tube, vesicle, or branched tree. Models for twodimensional patterns, though simple, may be useful in many situations.

11. The Cell Aggregate Model: Cells Can Be Represented by Points

It is almost impossible to construct a cell model which fits all kinds of cells because of the nearly infinite vNety of cells. Therefore, we will note relatively general properties of some cells and, based on such properties, construct a plausible model. This model can be considered as the first-order approximation, and could be improved later for higher order approximations. The model should have the ability to indicate quantitatively how close it is to actual cellular patterns. A. PROPERTIES OF SOME CELLS An isolated cell which is suspended in a medium is spherical in shape. It is true of animal cells, and also of plant cells (e.g., protoplast, cells removed their cell

GEOMETRICAL MODELS FOR CELLS IN TISSUES

193

walls by pectinase and cellulase; Nagata and Takebe, 1970). When it attaches to substratum, its thin cytoplasm (filopodia with webbing, or lamellipodia) often spreads radially like “fried-egg” shape. Figure 1 shows a spreading process of a rat hepatocyte attached to a serum-pretreated glass surface (Seglen and Gjessing, 1978). Similar processes were observed in other cells, e.g., a human cell line (normal human diploid WI-38 cells, Rajaraman et al., 1974), mouse embryo fibroblasts (Figs. 1-4 in Ivanova et al., 1976), sea urchin coelomocytes (Fig. l a in Edds, 1980), and pig kidney epithelial cells (PK15,Connolly et al., 1981). When spreading cells collide with each other, they fail to move over one another’s upper surfaces due to the lack of adhesion of the upper surface (DiPasquale and Bell, 1974), and eventually arrange themselves as a confluent monolayer (cells contacted by neighbors on all sides). In a culture of dissociated hepatocytes, spherical cells attach to and spread on the bottom surface as in Fig. 1, and form a monolayered cell sheet showing a remarkable polygonal pattern (Fig. 9a-d in Rubin et al., 1978). In a culture of dissociated epithelial cells from embryonic chick pigmented retina, a monolayered sheet shows a polygonal pattern, and stable contacts with junctional complexes between cells were found (Crawford et al., 1972; Crawford, 1975; Newsome et al., 1974; Middleton and Pegrum, 1976). Radial spreading and collision of cells were observed also in vivo. The spreading of epithelial cells was studied during wound closure in the transparent fin of Xenopus laevis tadpoles (Radice, 1980). The marginal cells around the wound extended broad lamellipodia radially as shown in Fig. 2. When the lamellipodia met near the center of the wound, they adhered to each other and stopped advancing. On the basis of these observations, we will initially consider cells with properties such as spreading and making boundaries between them. a I

‘

.

-

.

b

C

FIG. I . Attaching and spreading hepatocytes which have been isolated by collagenase from rat livers. Cells were allowed to attach to the bottom surface of the culture dish for 30 minutes (a), 2.5 hours (b), and 5 hours (c). Drawn from photographs of scanning electron microscopy of Fig. 2A, C, and E in Seglen and Gjessing (1978) with permission of the authors and The Company of Biologists Limited.

194

HlSAO HONDA

FIG. 2. The spreading of epithelial cells at the wound margin during wound closure in the fin of Xenopus laevis tadpoles. Extending border was drawn in superposition from the photographs of 0.5, I , 1.5,2,2.25, and 2.5 minutes after wounding. Dotted lines indicate approximated figures because of displacement of wound margins. Bar, 25 pm. Drawn from Fig. 4A-F in Radice (1980).

B. THE CELLAGGREGATE MODEL 1. Dirichlet Domains When circles are fixed on a plane and their radii are increasing, the circles contact and then overlap each other. Boundaries are defined as intersecting lines between neighboring pairs of circles as shown in Fig. 3a. When the radii become so large that the circles cover the plane without leaving any gaps, we can divide the plane into domains (Fig. 3b). The domains are convex polygons (i.e., having all interior angles less than 180") and cover the plane without leaving any gaps or overlaps. These polygonal domains correspond one-to-one to centers of the circles. Such a domain is mathematically defined as a polygon whose interior consists of all the points in the plane which are nearer to a particular point than to any other point. This is called a Dirichlet domain (Dirichlet, 1850; Coxeter, 1969; Loeb, 1976), which is the same concept as the two-dimensional case of a Voronoi polyhedron (Voronoi, 1908; Rogers, 1964). We intend to use Dirichlet domains as a cell aggregate model.

GEOMETRICAL MODELS FOR CELLS IN TISSUES

195

/------

a

FIG.3. Dirichlet domains. Their centers are indicated by dots. (a) Circles are fixed at their centers on a plane and their radii are increasing. Boundaries are defined as intersecting lines between neighboring pairs of circles. (b) Dirichlet domains covering the plane without gaps.

2 . Dirichlet Approximation We will develop a method to make approximate Dirichlet domains from an actual cellular pattern. Centers of the circles (Dirichlet centers) in a plane correspond one-to-one to Dirichlet polygonal domains. Therefore, Dirichlet domains determine Dirichlet centers uniquely as follows: There is a method to determine the direction to a Dirichlet center from the vertex of a domain, at which three sides meet (Chapter 13 in Loeb, 1976). The line A,Pi in Fig. 4 is the direction to the Dirichlet center where L A i + , A,Pi = 180" - LB&4- ,. When the directions to the Dirichlet center from every vertex of the particular domain are determined, they all intersect at a single point P which is the Dirichlet center. However, when the domain is of an actual cellular pattern, i.e., a general polygon which is not necessarily a Dirichlet one, the lines of the direction do not intersect at a single point. Therefore, the reasonably approximated center P is defined so that the value of El: becomes minimum, where li is the distance from P perpendicular to line AiPi, Z is the summation from i = 1 to i = n, and n is the number of vertices in the domain. Dirichlet centers, P , are determined successively in every polygonal domain in a pattern. On the basis of such Dirichlet centers, we can make a new pattern of Dirichlet domains, which should be close to the original cellular pattern and is called the Dirichlet approximation to the original pattern. 3 . Deviation from Dirichlet Domains In order to know quantitatively how closely a polygonal pattern is approximated by Dirichlet domains, a deviation value (the A value) is defined as an

196

HlSAO HONDA

FIG. 4. The method for closely approximating the Dirichlet center. P A i , The direction of the P , The approximated Dirichlet center of the Dirichlet center. LP&4i+l = 180" - LB&4idomain.

,.

average value of (Z&,in/nj over all domains in a pattern, where nj is the number of vertices of the jth domain, and the scale of a pattern is determined so that the averaged area of the polygons becomes a unity. For practical calculation.

where N is the number of all domains in a pattern, Sj is area of thejth domain, and

A is zero when the pattern consists of exact Dirichlet domains, while it becomes larger as the pattern diverges away from the Dirichlet domains.

GEOMETRICAL MODELS FOR CELLS IN TISSUES

197

4. Examples of Dirichlet Domains

The mathematical definition of Dirichlet domains as mentioned previously can be shown in an example: Consider all elementary schools in a city. It might be useful to subdivide the city into school districts in such a way that everyone living in a given district lives closer to the school in his own district than to any other school. The district so defined is called a Dirichlet domain; the school is called its center (Loeb, 1976). Therefore, Dirichlet patterns can be expected in animal and plant ecology, cell gathering, and periodic relay transfer of signals, convection, and diffusion; for examples, territories of male mouthbreeder fishes where Dirichlet centers are fishes’ nests (Hasegawa, et al., 1976; Fig. 2b in Honda, 1978); crown projection diagram of trees, Japanese cedars in a forest (Hasegawa et al., 198 1); aggregation domains and centers of amoebae of the cellular slime mold (Fig. 2 in Cone and Bonner, 1980); concentric circular wave patterns of cyclic AMP distribution which centered on the foci (Dirichlet centers) of the aggregations of the cellular slime mold (Tomchik and Devreotes, 1981); spiral waves using the Belousov-Zhabotinsky reagents (Winfree, 1972); BCnard cells as a convection pattern in a dish of liquid heated uniformly from beneath (e.g., Velarde and Normand, 1980); diffusion pattern in gelatin of drops of potassium ferrocyanide solution (Leduc’s experiment, Thompson, 1942; Honda, 1978); and patterns of Ouchterlony’s test (two-dimensionaldouble diffusion test) in immunology. On the other hand, Dirichlet domains resemble the phenomena that a cell in an aggregate displays its shape because of contiguous cells. That is, independent spherical cells, because of an increase of cell size or cell number, or a reduction in the space to which cells are confined, become so crowded and packed tightly as to become deformed into polygons. In fact, when many uniform spheres of a deformable plastic substance (e.g., fat clay or plasticine) are randomly distributed in a plane and pressed uniformly, they are deformed into a polygonal pattern which is close to Dirichlet domains as shown in Fig. 5a-d. Figure 6 (solid line) shows a polygonal pattern of the flat clay sphere (traced from Fig. 5d), from which approximated Dirichlet centers were determined by the method mentioned in Section II,B,2, and plotted by solid circles. The deviation value from Dirichlet domains was obtained as A = 0.324 X On the basis of such Dirichlet centers, new Dirichlet domains were made which are shown by a FIG.5. (a-d) The arrangement of fat clay spheres (a, b), and its depressed pattern (c, d). The regular arrangement (a, c) and the random arrangement (b, d). (e-g) The monolayer of cultured cells from chick embryos. (e) Retinal pigment epithelial cells. Bar, 50 pm. (0 Lung epithelial cells. Bar, 50 pm. (e and f, by courtesy of Dr.Kunio Yasuda; Honda, 1978.) (g) Chondrocytes (Courtesy of Dr. Kazuo Watanabe.) Bar, 50 pm. (h and i) Actual cellular patterns of the blastular wall of a starfish embryo before (h) and after (i) cell division. Two cells indicated by white dots in (h) divided into four daughter cells (white dots) in (i). (i) is a photograph taken 60 minutes after (h). Bar, 20 pm.

I98

I99

200

HISAO HONDA

FIG.6. Dirichlet approximation of a polygonal pattern of depressed spheres of fat clay. Solid line, the actual pattern traced from the photograph of Fig. 5d. Solid circles, Dirichlet centers. Broken line, Dirichlet domains approximated the actual pattern. A = 0.324 X 10-2. Dotted line, a pattern after the BS procedure (s = 1.033; see Section 111).

broken line and are close to the actual pattern (solid line). The pattern is similar to a natural polygonal cellular pattern. Therefore, we kill use Dirichlet domains as the cell aggregate model and investigate how close the actual cellular patterns are to Dirichlet domains.

c. APPROXIMATION OF ACTUALCELLULAR PA'ITERNS

BY THE CELL

AGGREGATE MODEL Using the cell aggregate model, we will make Dirichlet domains similar to several actual cellular patterns. Figure 7 (solid line) shows a cellular pattern of the coenobial green alga, Pediustrum buryunum. The colony is formed by spherical zoospores aggregating into a plane one zoospore thick and growing into polygonal cells (e.g., Honda, 1973). Therefore, the pattern is expected to be one of Dirichlet domains. From the actual pattern of the solid line in Fig. 7, approximated Dirichlet centers were determined and plotted by solid circles. The deviation value from Dirichlet domains obtained was A = 0.347 X lo-*. Based upon

GEOMETRICAL MODELS FOR CELLS IN TISSUES

20 1

such Dirichlet centers, new Dirichlet domains were made which are shown by a broken line. The broken line is the Dirichlet approximation of the actual pattern of the alga (solid line) (Honda, 1978). Monolayered epithelial cells sometimes show polygonal patterns on culture dishes. Retinal pigment cells and lung epithelial cells from chick embryos were dissociated, and cultured as confluent monolayers which show the patterns seen in Fig. 5e and f, and were drawn by solid lines as shown in Figs. 8 and 9. The patterns were approximated by Dirichlet domains (broken lines in Figs. 8 and 9) with A = 1.62 x and A = 2.79 X l o w 2 ,respectively (Honda, 1978). Chondrocytes (cartilage cells) from chick embryos were dispersed and cultured. They form cell aggregates which are not usually monolayered (Eguchi and Okada, 1971). The photograph in Fig. 5g was taken after searching for a monolayered region. The traced pattern of Fig. 5g is shown by a solid line in Fig. 10. It was approximated by Dirichlet domains (broken line) with A = 2.18 X

FIG. 7. Dirichlet approximation of a cellular pattern of a coenobial green alga (Pediostrum boryunum). The actual pattern (solid line) was approximated by Dirichlet domains (broken line) with Solid circles, Dirichlet centers (Honda, 1973). A = 0.347 X

FIG.8. The pattern of retinal pigment cells traced from Fig. 5e (solid line) was approximated by Solid circles, Dirichlet centers (Honda, Dirichlet domains (broken line) with A = 1.62 X 1978).

FIG. 9. The pattern of lung epithelial cells traced from Fig. 5f (solid line) was approximated by Dirichlet domains (broken line) with A = 2.79 x 10-2. Solid circles, Dirichlet centers (Honda, 1978).

GEOMETRICAL MODELS FOR CELLS IN TISSUES

203

FIG. 10. The pattern of chondrocytes traced from Fig. 5g (solid line) was approximated by Dirichlet domains (broken line) with A = 2.18 X lo-*. Solid circles, Dirichlet centers (Honda and Watanabe, unpublished).

lop2(Honda and Eguchi, 1980). The pattern of chondrocytes shows a deviation value similar to epithelial cells. The Dirichlet approximation is not generally useful for three-dimensional cellular patterns because it has been developed for two-dimensional patterns. However, it may be applicable to tissues which consist of long cylindrical cells such as muscle fibers (syncytia). The Dirichlet approximation of a transverse sectional pattern of rabbit muscle fibers is shown in Fig. I 1 with A = 2.62 X 1 0 - 2 (Honda, 1978). The muscle can be considered to be a bundle of packed cylindrical cells (muscle fibers) and its transverse section is essentially twodimensional. These examples show that usual cellular patterns can be approximated by Dirichlet domains with the deviation value less than 2-3 X l o p 2 . The Dirichlet approximation is quite useful in the cases in which we can neglect the discrepancy between the solid and broken lines in Figs. 7- 11. On the contrary there are polygonal patterns which are not suitably approximated by Dirichlet domains: FL cells compose a cell sheet in which cells are irregular and moving whose A value is 8.4 x l o p 2 (Honda and Watanabe, unpublished); the cracked pattern of glaze on pottery shows polygons whose interior angles are sometimes almost right (Fig. 2f in Honda, 1978). angle and whose A value is 16.7 X

204

HISAO HONDA

FIG. 1 1 . The pattern of a transverse section of muscle fibers (solid line) from a rabbit longissimus muscle (Fig. 11-16A, Bloom and Fawcett, 1975) was approximated by Dirichlet domains (broken line) with A = 2.62 x 10-2. Solid circles, Dirichlet centers (Honda, 1978).

D. APPLICATION OF THE CELLAGGREGATE MODELTO DYNAMIC CHANGES OF CELLPAITERNS Since patterns can be approximated by Dirichlet domains which correspond one-to-one to Dirichlet centers, dynamic changes of cellular patterns, e.g., cell loss, division, locomotion, and arrangement, can be simply investigated with using point removal, addition, displacement, and stabilization, respectively. The method to represent cells as points has also been used for simulation of cell self-sorting where individual cells are represented as vertices and the adjacent areas of these cells as edges in the topological exchange model (Matela and Fletterick, 1979, 1980). 1. Cell Loss

There is an experiment to remove a single cell from an epithelium and observe the healing process (Hudspeth, 1975). When a single cell is experimentally removed from the mudpuppy gallbladder epithelum, contiguous cells deform to

GEOMETRICAL MODELS FOR CELLS IN TISSUES

205

fill the defect. The actual cellular patterns before and after the cell removal are shown in Fig. 12a and b. A cell to be removed is indicated by the arrow. Dirichlet centers corresponding to these polygonal cells were obtained and plotted by solid circles in Fig. 12c, where approximated Dirichlet domains are also shown. The Dirichlet center which corresponds to the cell to be removed is indicated by the arrow (Fig. 12c), and it was removed (Fig. 12d) in order to simulate the cell removal experiment. The Dirichlet domains after the removal of the particular Dirichlet center is shown in Fig. 12d which should be compared with the actual pattern of Fig. 12b. They closely resemble each other (Honda, 1978). The similar observation was performed in a rabbit corneal endothelium (Sherrard, 1976). The corneal endothelium shows a polygonal, almost hexagonal

.

I

FIG. 12. The experimental removal of a cell and its simulation by the cell aggregate model. (a) An actual cellular pattern of gallbladder epithelium from mudpuppy (Necrurus muculosus). The arrow indicates a cell to be removed. (b) An actual pattern after healing (traced from Figs. 4 and 6 in Hudspeth, 1975). (c) Dirichlet domains based on Dirichlet centers (solid circles) which were determined from patterns (a) and (b). The arrow indicates a center to be removed. (d) Dirichlet domains based on the remaining Dirichlet centers (solid circles), after removal of the center. (c) and (d) are simulations of the actual patterns of (a) and (b) using the cell aggregate model (Honda, 1978).

206

HISAO HONDA

cellular pattern. In a damage experiment by glycerin drops, a single cell which fell away was replaced by the spreading of neighboring cells during the healing process, and a rosette pattern formed eventually. The pattern was interpreted by the Dirichlet cell model (Hasegawa and Tanemura, unpublished) as in the gallbladder epithelium.

2. Cell Division It has been proposed theoretically that a cell division can be described by replacing a single center by two, based on the Dirichlet cell model (Fig. 13 in Honda, 1978). Recently, we found a real example of cell division which can be described by the model (Honda, Yamanaka, and Dan-Sohkawa, unpublished). The process of cell division in a starfish embryo (Asferina pectinifera) at stages from 2IL cells to the beginning of rotation was recorded by a series of photographs. The blastula is a hollow sphere consisting of a single layer of columnar cells. When seen from the surface, the apical shape of a cell of the blastular wall shows a polygon (Fig. 5h). After cell divisions a polygonal cell sheet contains additional polygons (Fig. 5i). The change of a polygonal pattern by cell divisions was simulated on an electronic computer making use of the cell aggregate model. Figure 13a traced from Fig. 5h shows a polygonal pattern in which two cells about to divide are indicated by light and heavy stipples. The approximate Dirichlet centers were determined in all polygons in the pattern, and are indicated by solid circles. The center corresponding to the dividing cell is replaced by two centers. The direction of cell division (i.e., the direction of the array of two daughter cells just divided) is not known. However, it was confirmed by us in a

a

b

C

d

'

FIG. 13. Simulation of cell division by the cell aggregate model. (a) The actual cellular pattern of the blastular wall of a starfish embryo traced from Fig. 5h. Two cells just about to divide are indicated by light and heavy stipples, and their long axes by doubly headed arrows. Solid circles, Dirichlet center. (b) Simulation of cell division by repeating the Dirichlet center-gravity center method. (c) The pattern after the boundary shortening procedure (see Section 111) of pattern (b). (d) The actual pattern after cell division traced from Fig. 5i. Compare (c) and (d) (Honda, Yamanaka, and Dan-Sohkawa, unpublished).

GEOMETRICAL MODELS FOR CELLS IN TISSUES

207

blastular wall of a starfish embryo that a cell divides perpendicular to its long axis, which was formerly described by Hofmeister (1 863). Therefore, the Dirichlet center corresponding to the cell just about to divide was split into two centers along the long axis of the cell. Dirichlet domains were made on the basis of the centers including the two replacements for the original one. The resultant pattern contains one extra polygon due to the cell division. Next, the areal centers of gravity (i.e., the centers of gravity of polygonal plates. whose thickness and density are considered to be uniform) were obtained from respective Dirichlet domains which were further used to make the next Dirichlet domains (Fig. 14). The procedure was repeated until a final polygonal pattern was reached asymptotically (Fig. 14c). The procedure, the Dirichlet center-gravity center method was formerly used in the field of ecology by Tanemura and Hasegawa (1980), and applied here to simulating cells moving into a stable position. The final polygonal pattern by the Dirichlet center-gravity center method (Fig. 13b) was modified a little by the boundary shortening procedure (which will be explained in detail in Section III), and shown in Fig. 13c. This pattern should be compared with the pattern in Fig. 13d which is traced from the actual cellular pattern after cell division (Fig. 5).They closely resemble each other, that is, we can predict a pattern after cell division based pn a pattern before division using the cell aggregate model, although the question remains as to how to quantify the closeness of a resemblance. There have been some studies dealing with cell division in polygonal cellular patterns (e.g., Lewis, 1943; Korn and Spalding, 1973; Korn, 1980; Pyshnov, 1980; Abbott and Lindenmayer, 1981). However, their purpose does not seem to be as close correspondence to actual patterns as the present investigation does.

Fic. 14. The Dirichlet center-gravity center method for obtaining a stable cell position. Based on centers (dots), Dirichlet domains (solid lines) are made. Their areal centers of gravity are indicated by open circles. Based on the open circles, next Dirichlet domains (broken line) are made. (a), (b). and (c) show repetition of such a procedure. Open circles and broken line in (a) correspond to dots and solid line in (b). respectively. Those in (b) correspond to those in (c) in a similar fashion. Note that polygons cease to vary asymptotically (Honda, Yamanaka, and Dan-Sohkawa, unpublished).

208

HlSAO HONDA

3 . Cell Locomotion Corneal endothelium which is a monolayered cell sheet shows a remarkable regular polygonal pattern (Fig. 2%). Cat corneal endothelium was wounded by removing a small number of cells, and the healing process was recorded in the living state by serial photographs with a specular microscope (Maurice, 1968; Kani et al., 1980). Every individual cell was indentified, and its change in shape and position was investigated (Ogita et af., 1981). Figure 15a shows that polygonal cells locomote toward the wound, and become flattened and elongated to

FIG. 15. Cell locomotion after woundng in cat corneal endothelium. (a) Polygonal endothelial cells underwent flattening, became elongated toward the wound, and locomoted to cover the wound surface (left side). Solid, full-lined, and dotted-lined polygons, cells just after wounding, 1 day, and 4 days later, respectively. Bar, 100 pm. Reproduced from Ogita et al. (1981) with permission of the Japanese Journal of Ophthalmology. (b) Locomotion of all cells in the region during I day just after wounding is presented by line segments, where circles indicate starting points. Bar, 100 pm.

GEOMETRICAL MODELS FOR CELLS IN TISSUES

209

cover the acellular region of the wound. The locomotion and the shape change were more remarkable in cells closer to the wound. When cells are represented by points at the centers of respective polygons, the cell behavior is illustrated in Fig. 15b, which is a record of cell locomotion during the first day after wounding. Such figures enable us to analyze cell behavior quantitatively and to apply the method of fluid dynamics when considering cell locomotion lines as streamlines. The cell close to the wound locomotes more than 60 km a day just after wounding, and such an extreme movement halts within 5 or 6 days, but a very small movement or micromovement still occurs. Fluid dynamic analyses showed that cells close to the wound and just after wounding behave like a compressible (or expandable) fluid, whereas long after wounding cells behave like fluid in steady flow (Honda et al., 1982). 4. Cell Arrangements Epidermal cells of mammalian skin are organized into remarkably ordered structures, neat columns of vertical cells as shown in Fig. 16. In a surface view, hexagonally shaped squamous cells predominantly cover the skin surface. In

Ftc. 16. Ordered structure in guinea pig ear epidermis. Note vertical columns consisting of stacking cells. Outer surface is indicated by asterisks. Drawn from the photograph of Fig. I in Christophers (1972) with permission of the author and Springer-Verlag.

210

HlSAO HONDA

such an epidermis there is a constant turnover of stacked cells with a renewal of cells from a basal layer, a differentiationduring shifting to the surface, and a loss of surface cells. On the other hand, in the early stages of development cell arrangement in the epidermis of a mouse is irregular. At such stages there are no defined columns of epidermal cells. Cell boundaries overlap irregularly through every focus level in a transparent specimen. During ontogeny the neat vertical cell columns in epidermis become established from irregular cell aggregates. The developmental process forming an ordered structure of skin can be regarded as the process of point arrangement from random to regular, if cells are considered as points (Honda et al., 1979). The two-dimensional case will be considered first. Points are randomly distributed on the uppermost line as shown by solid circles in Fig. 17. Next, points on the lower line are positioned by the upper ones so that a point is determined to be midway between the two nearest upper points. All points on the lines are similarly positioned. When the procedure is sequentially performed from the upper line to the lower one, the distribution of the points become uniform as shown by open circles in Fig. 17. The points on every other layer are stacked approximately along a vertical line as shown by arrows in Fig. 17. A similar process can be considered in a three-dimensional space. Epidermis is considered as a pile of many layers on which cells settle. A point from a basal layer shifts upward and is positioned by the upper three points which form a triangle on a layer approximately parallel to the skin surface. The point is positioned just below the central part (e.g., the inner center or the center of gravity) of the triangle. This process is repeated using an electronic computer.

*-.* *---* _____* *. --*--* * 4 ---__ *-- --*---* ---_*_ _ _ _ _ *---* ---- * *____

.--_._

------

----

_.___

----

t

t

FIG. 17. Cell column formation in the two-dimensional space. Points on the uppermost line are randomly distributed. A point on the lower line is positioned midway between the nearest upper two points. (Periodic boundary condition is used for the points next to the terminals.) Point distribution becomes more regular toward the lower lines. Note the points on every other layer are approximately arranged along a vertical line (arrows) (Honda er af., 1979).

GEOMETRICAL MODELS FOR CELLS iN TISSUES

0

21 1

t-2

FIG. 18. Positioning of points in a computer simulation in three-dimensional space. The drawing is a view from below. Points are represented by spheres which belong to the layer t - 2, t - 1, or t . The position of the points on layer f is defined not only by the points on layer t - 1, but is also affected by the points on layer t - 2 (Honda e r a / . , 1979).

For initiation of the computer simulation, the points are irregularly distributed on the zeroth (uppermost) layer, but each of them has six neighbors, respectively. By connecting neighboring pairs with lines, we get a network consisting of triangles which cover a layer. The points on the first layer (which underlies the zeroth layer) are placed just below the central part of the alternate triangles on the zeroth layer. Thus, every other triangle on the zeroth layer has a point below it. Such point arrangement is reasonable since it only describes a cell aggregate which is approximately closely packed, but not in the closest packing. Once the simulation starts, in order to determine a new point on the layer t, a triangle is successively selected at random among the triangle network on the former layer (t- 1). Figure 18, which is a view from below (from a basal layer), may be helpful in understanding how a new point is positioned. If the triangle (on layer t- 1) does not have any point on layer t-2 (solid arrow), the triangle is used to determine a point on the layer t . (A point is placed just below the central part of the triangle on layer t- 1.) If the triangle has a point just above it (open arrow), no point is placed, and the next triangle is selected at random. This assumption seems reasonable, since a new cell may be jostled and settle easier to the region indicated by the solid arrow, because of little hindrance from cells on layer r-2, than the region indicated by the open arrow. When all triangles of the former layer (t- 1) were tried, the process advances to the next lower layer. By repetition of such a process a pile of layers on which the points are distributed is obtained. The points on every three of the lower layers become stacked approximately along a vertical line which reminds us of an epidermal cell column. Figure 19 shows the result of a simulation where all stacked points

212

HISAO HONDA

FIG. 19. A surface view of the result of a computer simulation of point arrangement in threedimensional space. Smaller circles indicate point-positionson lower layers, and they are presented in 2) indicated superposition. Periodic boundary condition was used at the rectangular boundary by broken line (Honda et al., 1979).

(v3:

during simulation are represented, in superposition, by circles with decreasing radii. Small circles indicating points on lower layers are regularly arranged. This asymptotic process in which an initial irregular arrangement of points becomes regular can also be explained analytically, i.e., without computer simulation (Saito, 1982). For presenting cell boundaries by a two-dimensional display an approximation is used: Since neighboring cell points do not exist on the same layer (Fig. 20), we need to consider three sequential layers as one group. All points on the layers immediately above and below it (layers r-1 and t + l ) are projected on the concerned layer in question, t. Dirichlet domains are obtained from all points existing and projected on layer t. Three-dimensionally interdigitating cells are approximated by the Dirichlet domains as shown in Fig. 20. This pattern approximation will be identified by a notation, the layer [t- 1 , t, t+ 11. Patterns [0, 1 , 21-[3, 4, 51 and [ l l , 12, 131-[14, 15, 161 are shown in Fig. 21a and b. As shown in Fig. 21b, the patterns of lower layers are quite regular. Epidermis has been considered to consist of flattened tetrakaidecahedra, 14sided bodies (see Fig. 22) by Menton (1976) and Allen and Potten (1976). (This polyhedron has formerly been found in vegetable parenchymal cells; Lewis, 1923.) The regular arrangement of cell points in our simulation is compatible

GEOMETRICAL MODELS FOR CELLS IN TISSUES

I I

I

I I

213

I I I

0 I

FIG. 20. Vertical section of a stack of layers (top) and its surface view (bottom). As shown in the top figure, neighboring cells are not on the same level, but show a trilevel arrangement. Cells are interdigitating and stacked in a neat column perpendicular to the surface. A cell which is a flattened tetrakaidecahedron is shown in the center of the bottom figure. This can be approximately represented by a hexagon (thick solid line) which is a two-dimensional Dirichlet domain determined after neighboring points on the layers t ? 1 were projected onto the layer t . SS, Line indicating position of plane of section for top figure (Honda er al., 1979).

FIG. 21. Surface views of cell column formation in the computer simulation of Fig. 19. Approximated cell boundaries are obtained using Dirichlet domains as described in Fig. 20. They are displayed in superposition of the layers [O, I , 21-13. 4, 51 (a), and the layer [I 1, 12, 131-[14, 15, 16) (b) (Honda et a/.. 1979).

.

214

HISAOHONDA

FIG.22. Flattened tetrakaidecahedra neighboring each other, which have eight hexagonal faces (two of them, top and bottom, are large and the remaining six are small) and six square faces, respectively. Note they are not on the same layer, but show trilevel arrangement (Honda et al.. 1979).

with these polyhedra. To demonstrate this, we will consider a space-filling polyhedron of the three-dimensional Dirichlet domain. As the distance between the two adjacent layers is small (Figs. 20 and 23), a point on layer t has the two first nearest neighboring points on layer r+3, the six second nearest on layers t? 1 (these points correspond to the two large regular hexagonal faces and the six small hexagonal ones of the flattened tetrakaidecahedron as shown in Fig. 22), and the six third nearest on the layer f+2 (these six correspond to the six square faces) as described in Honda et af. (1979).

t-2

t+l

t- 2 t*l *

t-1

t +2

1 2

Fio. 23. Neighbors of a point in the regular arrangement by computer simulation. A point (solid sphere) on the layer has the first and second nearest neighbors (dotted) on the layers t f 3 and t & I , and the third nearest (open) on the layers t & 2 (Honda et al., 1979).

GEOMETRICAL MODELS FOR CELLS IN TISSUES

215

The assumption that cells can be represented by points and rearranged to an optimum packing, enabled us to perform the above-mentioned computer simulation, which explained the cell arrangement of neat vertical cell columns and of a hexagonal pattern covering a skin surface. Next, we will show that the same assumption is useful to explain the constancy of skin thickness or depth (Honda and Oshibe, unpublished). The tetrakaidecahedral model of skin is compatible with the dynamic process of the constant loss of surface cells and the supplying with cells shifting upward from a basal layer (Menton, 1976; Allen and Potten, 1976). When considering a cluster of closely packed flattened tetrakaidecahedra (see Fig. 22), top and bottom surfaces of the cluster show the trilevel arrangement of the polyhedra, that is, neighboring polyhedra are not on the same layer. When a cell shifts upward from the basal layer, it is plausible that the tell fills the uppermost vacant position (solid arrow in Fig. 20) rather than the lower position of the bottom level of the cluster (open arrows in Fig. 20). One may consider the system upside down: Points (cells) are falling on a surface which is covered by many hexagonal domains. When a point falls on a hexagonal domain, we consider two cases. (1) The case in which one cell stacks on the domain where the point falls and its level increases by one. (2) The case in which the point settles at the domain of the lowest level among a group of the seven domains, consisting of the domain where the point falls and its neighboring six domains. If there are more than one domain whose level is the lowest, the point settles at the nearest domain to the falling position among the lowest level domains. The level of the domain at which the point settles increases by one. The computer simulations according to the above-mentioned schemes were performed, and the results are shown in Fig. 24. We get the remarkably constant

FIG.24. Results of computer simulation on the skin thickness. (a) The first case in which cells are randomly determined by their positions. (b) The second case in which cells look for appropriate positions among their neighbors after random positioning. Both figures are upside down. Periodic boundary condition was used for cells next to the borders (Honda and Oshibe, unpublished).

216

HISAO HONDA

thickness of cell stacks in the second case as shown in Fig. 24b, and considerable roughness in the first case. The first case results in a Poisson distribution as is well known. This computer simulation implies that no supervising mechanism is required to understand the constancy of skin thickness, but it is enough that a cell is assumed to have an ability to find the appropriate position inside a quite local area among its neighbors.

111. The Boundary Shortening Model of Cells in a Tissue A. INTRACELLULAR CONTRACTILE SYSTEMS

Cells in an aggregate are cohesive owing to intercellularjunctional complexes such as tight junctions, septate desmosomes (Green and Bergquist, 1982), gap junctions, desmosomes, and so on. Moreover, in some types of cells, specific structures lie close to cell boundaries at a certain level of a cell in a tissue as in Fig. 25a and b (dense material along boundaries). In cultures of dissociated pigmented retinal epithelial cells from chick embryos, stable cell contacts were developed between the colliding cells, tight junctions, gap junctions, and belt desmosomes (Zonula adherens) with associated microfilaments forming a band running completely around the periphery of each cell (Middleton and Pegrum, 1976). The microfilament is considered the same as the thin filaments whose bundles show a polygonal pattern along cell boundaries in parallel section to the plane of the cell monolayer (Crawford et al., 1972; Crawford, 1979). The method of immunofluorescencestaining with heavy meromyosin or actin antibody showed such bundles containing actin (Eguchi, 1977; Owaribe et al., 1979). Such actin-like filaments were also found in other tissues in vivo. The filaments were arranged in a polygonal ring around the circumference of the cell at the level of the apical junctions, which connected adjacent cells together at the external surface of the early amphibian embryos (Trirurus alpestris and Xenopus laevis, Perry, 1975), the early mouse embryo (Lehtonen and Badley, 1980), the corneal endothelium of chick embryos (Kodama et al., 1981), and the oviduct epithelium of the Japanese quail (Yamanaka, Tanaka, and Honda, unpublished). In lens fiber cells which are the differentiated cells from the epithelium, microfilaments were in close contact with plasma membranes and show a regular hexagonal pattern in a section parallel to the hexagonal structure of the fiber cell (calf, rat, and pigeon lens, Kibbelaar et al., 1980). Microfilaments containing actin in nonmuscle cells, when considering homologies to a muscle contraction, were expected to have a function of contractility. When continuous observations were made of microfilaments in a cultured cell after addition of an ATP solution, the contraction of the microfilaments was

GEOMETRICAL MODELS FOR CELLS IN TISSUES

217

found to correspond to the cell deformation (Isenberg et al., 1976; Kreis and Birchmeier, 1980). Circumferential bundles of microfilaments in pigment epithelial cells show a polygonal pattern at their apical level. When the epithelium was treated with a glycerol solution and transferred to the ATP solution, each cell constituting the epithelium itself contracted (Owaribe et al., 1981). When the stress fibers which are considered to consist of microfilaments were severed by laser microirradiation, the severing of the target fiber was immediately followed by the separation of cut ends in some (almost half) of the fibers (Strahs and Berns, 1979). This indicates that some of the fibers are in a tensile state. These investigations show that the microfilament in nonmuscle cells has, explicitly or latently, an ability to act as an intracellular contractile system. B. THE BOUNDARY SHORTENING MODELOF CELLSIN A TISSUE 1. The Triple Junction of Three Lines It is a geometrical fact that, when there are three fixed vertices A, B, C and one movable vertex P in a plane, the total side length AP + BP + CP becomes minimum when P is fixed so that the three lines meet at 120", i.e., LAPB = LBPC = LCPA = 120" if such an arrangement is possible, as shown in Fig. 26a; when the triangle ABC has a vertex with an angle of 120" or more, the triple junction degenerates and joins the vertex for the minimum length as shown in Fig. 26b. These arrangements are realized by a rubber string with an elaborated connection as shown in Fig. 26c, where the string is homogeneously stretched since there is no friction at contact points. Soap films also realize the triple junction with 120" because surface tension constitutes the main force to determine a pattern as shown in Fig. 26d: When a sandwich of glass in which three thumbtacks sitting points upward between two sheets of glass is dipped into a soap solution and then withdrawn, we sometimes get the triple junction (Stevens, 1974). By using the geometrical fact of the minimum length arrangement, we can transform a given polygonal pattern into the pattern whose total side length is minimum. Then we could obtain information about whether the given cellular sheet is operating under a contractile system or not. However, as shown in Fig.

FIG.25. (a and b) Polygonal boundaries (a) and their triple junction (b) of epithelial cells of the oviduct (Japanese quail). The sectional patterns are parallel to the surface of an epithelium at the apical level. Bars, I pm in (a) and (b). (Electron microscopic photograph by Miss Yoshiko Tanaka.) (c-e) Artificial polygonal patterns. (c) A network of rubber strings. (d) Soap bubbles arranged on a plane. (e) An enlarged photograph of (c). The circumference of a polygon is a closed string of the stretched rubber. Vertices of a polygon are small metal rings through which strings thread. (0 Cat corneal endothelial cells photographed live in siru by a specular microscope; corresponds to the lower part of Fig. 34a. Bar, 50 pm. (Courtesy of Drs. Yoji Ogita and Shoichi Higuchi.)

218

219

220

HISAO HONDA

a

b

d

C

FIG. 26. The triple junction of three lines, A, B, C, fixed vertices; P, a movable vertex. (a) Length AP' BP' + CP' is minimum when LAP'B = LBP'C = LCP'A = 120" if this arrangement is possible. (b) If the triangle ABC has a vertex with angle of 120" or more (LABC), P degenerates and joins B for the minimum length. (c) The triple junction of a stretched rubber string. (d) That of cross-sectioned soap films.

+

27, it was impossible to apply such a transformation for this purpose, since the size of certain polygons continued either to be expanded (stippled polygon) or to be reduced, even to nothing (shaded polygon), as the process is repeated (Honda, unpublished).

2 . The Boundary Shortening Procedure In order to overcome the above-mentioned disadvantage, two arbitrarily vertices (P and Q in Fig. 28) linked with each other by a side were chosen and moved so as to maintain a constant area for each polygon as shown in Fig. 28. The length of the five edges, AP' BP' + P'Q' + Q'C Q'D can be calculated from the position of P' (which moves along the line containing P and is parallel with AB). P' is sequentially moved away from P by small distances (positive or negative) and fixed at a point where the length of the five edges is found to be in local minimum. This is the elemental step of boundary shortening. All information on the given pattern (x-, y-coordinatesof vertices, fixed terminal points, and their connection relations) was stored in a disc memory. A side was selected by using (pseudo-)randomnumbers in a digital electronic computer, to which the elemental step of boundary shortening was performed as mentioned above. The procedure was repeated on a series of several thousands of random numbers and stopped when the total boundary length ceased to decrease. The whole procedure is called the boundary shortening procedure (the BS procedure). We can obtain two lines of information from the procedure. One concerns the theoretically predicted cellular pattern (the final pattern of the BS procedure) of

+

+

GEOMETRICAL MODELS FOR CELLS IN TISSUES

22 1

FIG. 27. Computer simulation of the boundary shortening under the assumption of the triple junction with 120" as shown in Fig. 26. In order to transform a polygonal pattern into another pattern whose total side length is shorter than that of the original, a vertex was selected as P at random in a pattern. Three vertices which are directly connected with P were determined as A, B, C, and fixed. P was moved to make the triple junction whose internal angles are all 120". The same procedure was repeated using a series of random numbers. It was expected that a pattern would be gradually transformed into one whose total side length is shorter than that of the original. However, heptagons, octagons, . . . expand their size (e.g., dotted area), and pentagons, quadrangles, . . . reduce their size and eventually become nothing (e.g., shaded area) during the repetition. (a), (b), (c), and (d) are patterns after 0, 121, 240, and 267 steps.

an actual pattern under a hypothetical condition of complete shortening. The other is the value of boundary shortening (the s value) which is the ratio in percentage of the decrease of total boundary length to the initial total one, i.e., (the final total boundary length) (the initial total boundary length) where s indicates the degree of lack of boundary shortening of the given pattern. A small s value suggests that a contractile system is under operation and that the cell sheet is likely to be in tension.

222

HISAO HONDA

FIG.28. Displacement of two vertices (P and Q) linked with a side while maintaining the area of each domain constant. When P moves to P‘ (PP’ is parallel with AB. since the area of APB equals that of AP’B), Q is constrained to move to Q‘: Q’ is determined so that it is on the line which contains Q and is parallel with CD, and the area of APQC equals that of AP‘Q’C (Honda and Eguchi, 1980).

An example is shown in Figs. 29 and 30. Solid circles in Fig. 29 were fixed, and sides were selected by using a series of random numbers until the 2500th step. The decrease of the boundary length at every step is shown in the top figure in Fig. 30. These were only small decreases after around the 2000th step. The s

FIG. 29. Monolayered cell sheet of cultured lung epithelial cells from chick embryo (solid line) traced from the photograph of Fig. 5f and the pattern after the BS procedure (dotted line). Solid circles represent fixed points. Open ellipses and triangles, see the legend to Fig. 30. s = 0.598 (Honda and Eguchi, 1980).

GEOMETRICAL MODELS FOR CELLS IN TISSUES

223

FIG. 30. Process of the BS procedure of the pattern of cultured lung epithelial cells in Fig. 29. Abscissa, steps for boundary shortening. Ordinate of top figure, difference t f the boundary length between sequential steps. Ordinate of bottom figure, s value. s means percentage of decrease of the total boundary length to the initial one. The results of the bottom figure are represented in a graph obtained by using three different series of random numbers. Arrows with an open ellipse and triangle show the levels at which s values converged when the points with an open ellipse or triangle in Fig. 29 were fixed in addition to the solid circles during the BS procedure (Honda and Eguchi, 1980).

value which is a relative value of integration of the decreases of the boundary length during the BS procedure is shown in the bottom of Fig. 30. To inspect the affect of selecting sides of a different sequence, the patterns obtained by using another two different series of random numbers are superimposed on the bottom of Fig. 30. The s values at the 2500th step were 0.601, 0.602, and 0.608, respectively. These three patterns after the BS procedure are almost the same (dotted lines in Fig. 29). The fixed points which are located at the periphery of the pattern may also cause the s value to vary. When the vertices with open ellipses or triangles in Fig. 29 were fixed in addition to those presented by the solid circles, the s values observed at the 2500th step are shown by the arrows in Fig. 30 (s = 0.606 and 0.570). The patterns after the BS procedure in the cases are not presented. The central parts were quite similar to the dotted lines in Fig. 29. 3 . A Few Comments on the BS Procedure Before applying the BS procedure to an actual polygonal pattern, we will discuss the validity of the procedure in detail. This section could be read later, since it is rather complicated.

224

HISAO HONDA

If a contractile system is operating, it follows that the s value is small. Conversely, if the s value is small, it does not follow necessarily that a contractile system is in operation. A small s value is logically not a sufficient condition, although necessary, for the operating contractile system. A small s value only suggests such a system. For instance, the s value of an exactly regular hexagonal pattern, such as that resulting from uniformly pressing spheres of an equal size which are made of a deformable plastic substance (e.g., fat clay as described in Section II,B,4) and are regularily arranged in the closest packing on a plane, is small although the plastic substance is certainly not in a tensile state (s = 0.18, Fig. 5a and c). If the regular arrangement of the spheres of fat clay are disturbed, the s value of the pattern of the pressed spheres becomes large, because there is no contractile system (s = 1.03, Fig. 5b and d). Therefore, the implication of the small s value should be supported by other information such as experimental results, comprehensive considerations, and so on. On the other hand, a large s value logically means that there is no functioning contractile system, since a large (not small) s value is a sufficient condition for not operating the contractile system. Although the BS procedure was originally developed for analyzing cellular patterns whose boundaries are actively shortening (Honda and Eguchi, 1980), it is also applicable to patterns whose source of tension comes from an expansion of the cellular area. For, the tension of a cellular pattern is caused either (1) by a contraction of the boundary length due to a contractile system while the area of each polygon remains constant or (2) by an expansion of the area while the total length of the boundaries remains constant due to an inelastic (nonstretching) structure. When we apply the BS procedure to cellular patterns, we should distinguish between two cases, which depend on how closely actual cell sheets are similar to the model. In case one, actual patterns need not resemble the model so completely. When we have many polygonal cellular patterns at hand, and we do not have any other powerful method to distinguish and group them, the s values by the BS procedure is useful in discriminating the patterns with respect to their mechanical properties as will be shown later (Section IV,A). It is essential in this case to apply the same procedure to many patterns. Variation of the s value obtained by the procedure is a good clue to discriminate patterns. It is less important if the pattern transformation is actually realized just in the same manner as the BS procedure has hypothetically been carried out in a computer simulation. In case two, actual transformation of a pattern has to be similar to the BS procedure. In this case, not only the s value but also the final transformed pattern by the BS procedure are meaningful. The final pattern can be used as the predictive pattern because the actual process of transformation of the pattern is closely simulated by the BS procedure. This case will be realized in a state change of a polygonal cellular sheet where no cell division takes place.

GEOMETRICAL MODELS FOR CELLS IN TISSUES

225

4. Examples of the Boundary Shortening Model We will first apply the BS procedure to several polygonal patterns which are known to have certain typical, well-defined characteristics. Figure 2% is an artificial network consisting of many polygons whose circumference is a closed string of the stretched rubber and whose vertices are small rings of metal through which strings thread as shown in Fig. 25e. The s value of this network is expected to be small because the rubber strings are working as a contractile system, and the network is in a tensile state. The BS procedure was applied to the pattern of the network (solid line in Fig. 31 which was drawn from the photograph of Fig. 25c), and the result is shown by dotted line in Fig. 31. The difference between both patterns is difficult to discern and the s value is quite small (s = 0.072). The next example is soap bubbles which are known to be formed on the principle of minimum surface (e.g., Thompson, 1942; Stevens, 1974). When they were arranged on a plane and photographed (Fig. 25d), we obtain a polygonal pattern which is approximated by a cross-section of the vertical films between the bubbles, where minimum surface of films corresponds to minimum length in

FIG. 31. The pattern of the network of rubber strings traced from Fig. 25c (solid line). Dotted line, the pattern after the BS procedure. Solid circles at periphery, fixed points. s = 0.072. Broken line, approximated Dirichlet domains. Solid circles, Dirichlet centers. A = 1.06 X 10-2.

226

HISAO HONDA

FIG.32. A pattern of soap bubbles traced from Fig. 25d (solid line), and that after the BS procedure (dotted line). Solid circles at periphery indicate fixed points during the BS procedure. s = 0.065 (Honda and Eguchi, 1980).

a plane of cross-section. The BS procedure was applied to the pattern traced from the photograph (solid line in Fig. 32). The resultant pattern (dotted line) was scarcely changed and the s value is as small’as that of the rubber network ( s = 0.065). On the contrary, we will now investigate a pattern with a large s value. The solid line in Fig. 33 shows a transverse sectional pattern of a bundle of small blood vessels in the swimbladder of the deep-sea eel. The bundle consists of arteries and veins, all mixed together, with the counterflowing arteries and veins lying next to each other. There is a transfer of heat and oxygen between artery and vein. In the sectional pattern, the long boundary length between arteries and veins is considered to be suitable for the countercurrent exchange of oxygen and heat, and the pattern gives rise to a checkerboard whose s value is expected to be large (Scholander, 1969). The BS procedure was applied to the checkerboardlike pattern (solid line in Fig. 33) and the resultant pattern is obtained (dotted line). They differ considerably, and the s value is large (s = 1.47) as expected. These examples suggest that the BS procedure and the s value are meaningful with respect to the function of the systems, and are useful for investigating

GEOMETRICAL MODELS FOR CELLS IN TISSUES

221

FIG. 33. A transverse sectional pattern of a bundle of small blood vessels (veins and arteries) in the wall of the swimbladder of the deep-sea eel (solid line). Stippled and nonstippled vessels show vessels which counterflow each other. Dotted line, a pattern after the BS procedure. Solid circles, fixed points. s = 1.47.

cellular patterns. Now, we will apply the BS procedure to actual cellular patterns. C. APPLICATIONOF THE BOUNDARY SHORTENING MODELTO DYNAMIC OF CELLULAR PA-ITERNS CHANGES 1. The s Values of a Corneal Endothelium during Wound Healing Corneal endothelium shows a remarkably regular polygonal pattern as mentioned previously (Section II,D,3). A pattern of normal endothelium of a cat cornea is shown in Figs. 25f and 34a (solid line). The BS procedure transformed the pattern as shown by the dotted line with an s = 0.483. When the endothelium was wounded, cells around the wound became flattened and elongated to cover the acellular region of the wound as already mentioned (Section II,D,3). Indeed, the pattern 1 day after wounding included many flattened and elongated cells as shown in Fig. 34b (solid line). The s value had increased remarkably (s = 1.049). Later the cells returned to their original, nonelongated shape, but still

228

HISAO HONDA

C FIG.34. Cellular patterns of cat corneal endothelia close to a wound (left side). Solid line, traced pattern from a photograph. Dotted line, the pattern after the BS procedure. Solid circle, fixed point. Bar, 100 pm. (a) Immediately after wounding, s = 0.483; (b) I day, s = 1.049; (c) 7 days, s = 0.551; (d) 63 days, s = 0.456 (Honda, Ogita, and Higuchi, unpublished).

retained the area of the flattened shape, as shown in the pattern on the seventh day after wounding (solid line, Fig. 34c). This is caused by rearrangements of cells and will be investigated in detail in the next section. Here, this pattern (solid

GEOMETRICAL MODELS FOR CELLS IN TISSUES

229

line) was transformed by the BS procedure (dotted line), and the s value obtained was again small (s = 0.551). Then, areas of the flattened cells also decreased gradually to the normal size. This decrease in area was accompanied by the movement of other peripheral cells toward the wound because the cells maintain their attachment to each other. The cells were still moving a little even on the sixty-third day after wounding. Owing to this steady micromovement the cells deformed becoming elongated as shown in Fig. 34d (solid line). The BS procedure made little change in the pattern as shown by the dotted line, and the s value is small (s = 0.456). The elongated cells on the first and the sixty-third days can be distinguished from each other by the s values. These results can be understood when considering the time scale of the operation of the boundary shortening. Normal, stable endothelial cells had enough time to shorten their boundaries, so the s value was small (around 0.5). On the first day after wounding, shifting, expansion, and elongation of the cell sheet was so fast that the cell boundaries had not completed shortening, i.e., the boundary was still long, and the s value was large. On the other hand, cell shifting was almost stopped on the seventh day (Honda et al., 1982), or so slow on the sixty-third day that the cell boundaries had shortened completely. That is, the cell shifting could be considered to be almost stopped during the boundary shortening. This may be the same concept as a quasistatic process in physics. Especially on the sixty-third day, the micromovement caused the cells to be elongated as shown in Fig. 34d (solid line) and the boundaries can be shortened during such micromovement (the small s value). These can be realized in an elongated hexagon whose interior angles are all 120" as shown schematically in Fig. 46. In this example, the s values obtained by the BS procedure have elucidated the successive changes of the cell state and suggested the mechanism of cell shape change during wound healing of the corneal endothelium.

2 . Cell Rearrangements We will again examine the healing process of a wound in a cat corneal endothelium. After wounding, the endothelial cells shifted toward the wound, and a pattern of the shifting traces showed continuous flows like streamlines of a fluid as shown in Fig. 15b. However, as shown in Fig. 35, cell shifting during the fourth to twelfth days was not continuous. Some of the cells showed large shifting and others showed little movement or a reversed direction, even though these cells were contiguous to each other. Cell shifting is not along a smooth continuous gradient. Figure 36 shows the change of an actual pattern of individually identified cells. The stippled cells which were normal polygons in Fig. 36a were flattened and elongated 1 day after wounding as shown in Fig. 36b. On the eleventh day, the elongated cells became nonelongated but still flattened, i.e., the area of the

230

HISAO HONDA

P n

P

0

4

a

0 0

0

4

B

P

0

0

-0

P

o

0

9

Q 4

4

* Q

A

b

-

o

-

o

a

o 0

b

?

Q

0

0

0

Q

0

P Q

'0

b

O

Q

O

D o

0

?

1)

O

O

0

p

0

b

-0 0

O 0

FIG. 35. Shifting of endothelial cells during the fourth to twelfth days after wounding. The shifting was not smoothly continuous. Some cells shift greatly and others little (or sometimes in a different direction), even though these cells are contiguous to each other. Line segment, cell shifting during the fourth to twelfth days. Open circle, position of cells on the fourth day. Arrow, direction to the wound. Bar, 100 pm.

polygonal cells did not decrease where cell rearrangements had taken place as shown in Fig. 36c. Such curious behaviors of cells, nonelongated polygons without the area decrease, are expected to be the result of frequent rearrangements of cells taking place probably during the fourth to seventh days. We will investigate these using the boundary shortening model of cells. For this purpose we will first consider an elemental step of cell rearrangements. Figure 37 shows successive patterns of actual cells in which the neighboring cells have changed. The boundary of the group of four cells against outer contiguous cells shows a concave polygon, and the edge-number of its total outline does not change. All outer contiguous cells can be identified and remain unchanged. However, the arrangement of the four cells within the group changed. The two stippled cells which are initially in contact become separate from each other, and the two open cells come into surface contact. During such a movement of cells the edge-number of stippled cells decreases by one, and that of the open ones increases by one. This neighbor change is an elemental step of cell rearrangements and can be simulated using the BS procedure under a new rule of changes of the vertex connections as follows: When the BS procedure is performed in the pattern as in Fig. 38a, sometimes a side-length become extremely short as shown in Fig. 38b. In such a case we change the connections between vertices as shown in Fig. 38c where the area of the polygons is almost un-

GEOMETRlCAL MODELS FOR CELLS IN TISSUES

23 1

a

b

a ......*.... . .. .. .. .. ..... . ......... ...... .. ........ ................... . .

FIG. 36. Actual successive patterns with identified cells near the wound in the corneal endothelium. (a) Immediately after wounding; (b) after I day; (c) after I 1 days. Arrow, the direction to the wound. Bar. 50 Fm.

changed. When the BS procedure is again continued, we obtain the pattern of Fig. 38d. This is a successful computer simulation of the neighbor change of actual cells in Fig. 37. This neighbor change is considered as a fundamental movement of cells in a polygonal cellular pattern where cells are tessellated in a tissue. Now, we will try to understand the curious cell behaviors as shown in Figs. 35

a

FIG. 37. A neighbor change of actual endothelial cells. (a) One day after wounding; (b) after 1 1 days. Arrow. the direction to the wound. Bar, 50 km.

232

HISAO HONDA

a

FIG. 38. A neighbor change in a computer simulation using the BS procedure including the rule of changes of vertex connections. When the BS procedure was applied to (a), a side became extremely short (b). After changing the vertex connections as (c), (c) became (d) by the ordinary BS procedure.

and 36 (noncontinuous cell shifting and the formation of nonelongated polygonal cells without the area decrease) during wound healing of a corneal endothelium using the BS procedure including changes of vertex connections. Upon wounding, the cells suddenly have a localized empty space near by and elongate. In Fig. 39a the x-coordinates of the vertices were enlarged three times while the ycoordinates remained unchanged. The cellular pattern- immediately begins to contract its boundary length. Figure 39b and c is the pattern during the BS procedure. Some of the sides are very short or almost null in length. To such sides, the rule of changes of vertex connections (Fig. 38) is applied, and the BS procedure is again performed. After repetition of the BS procedure including vertex connection changes we get the pattern in Fig. 39d. This is a simulation of frequent rearrangements of cells. A stippled cell shifted to the right whereas a shaded cell shifted to the left. The directions of shifting were different, corresponding to noncontinuous cell shifting in the actual observation (Fig. 35). The cell shapes became nonelongated as shown in Fig. 39d, maintaining the area unchanged. The short or almost null sides of polygons such as in Figs. 38b and c and 39b and c were not only theoretical or hypothetical features, but also occur in the cellular patterns 1 day after wounding (Honda 'el al., 1982). These examples proved that the BS procedure and the estimation of the s value are useful in understanding dynamic changes of certain cellular patterns and, by

GEOMETRICAL MODELS FOR CELLS IN TISSUES

233

FIG. 39. Cell rearrangements in a computer simulation. Elongated cells (a), after three changes of the vertex connections under the BS procedure as shown by circles in (b) and (c). became nonelongated ones (d), maintaining areas unchanged. Two cells (stippled and shaded) migrated to different directions from each other, relatively.

addition of the rule of changes of vertex connection, can be applied more widely (Honda et al., 1982). Therefore, an assumption of cell boundary shortening is essential for the computer simulation of cell rearrangements. The cause of the boundary shortening may be attributed to intracellular microfilaments because cornea endothelial cells are known to contain microfilaments (Hay and Revel, 1969; Kaye et al., 1974; Van Horn and Hyndiuk, 1975; Van Horn et al., 1977), which are especially restricted to a circumferential region along polygonal boundaries (Kodama et al., 1981). Cell elongation and rearrangement may be universal phenomena where the surface is expanding or contracting in one direction, since such behaviors have also been reported in the superficial cellular pattern of an amphibian embryo during and prior to gastrulation (Keller, 1978). Another example is a threedimensional aggregate of chick liver cells (Phillips et al., 1977). Cells in an aggregate are initially pressed into flattened polyhedra by centrifugation, but during prolonged centrifugation they regain their original undisturbed shape by cell rearrangements (or “cell slippage” as used by Phillips et a l . , 1977).

IV. Cell State in Tissues: Epithelium-like or Not? A. DISCRIMINATION OF CELLULAR PATTERNS We will apply the BS procedure to the cellular patterns which were used for the cell aggregate model in Section II,C.

234

HISAO HONDA

FIG. 40. The pattern of retinal pigment cells traced from Fig. 5e (solid line) was transforrned by the BS procedure (dotted line). s = 0.687. Solid circles. fixed points (Honda and Eguchi. 1980).

The pigment epithelial cell sheet in culture (Fig. 5e) was traced and the pattern (solid line in Fig. 40) was transformed by the BS procedure as shown by dotted line in Fig. 40. The resulting s value was 0.687. The lung epithelial cell sheet in culture (Fig. 50 has been already treated by the BS procedure in Fig. 29, where the method of the BS procedure was explained (s = 0.598). The monolayered cell sheet of chondrocytes (Fig. 5g) was treated by the BS procedure as shown in Fig. 41 (s = 1.84). Chondrocytes (cartilage cells), which are not epithelial in origin but mesenchyrnal, form cell aggregates that are not usually monolayered (Eguchi and Okada, 1971). The photograph of Fig. 5g was taken by looking for a region where the aggregate was monolayered in a culture dish. The transverse sectional pattern of a muscle fiber bundle, which was used for the investigation with the cell aggregate model (Fig. 1 I ) , was also transformed by the BS procedure as shown in Fig. 42 (s = I .71). Although muscle fibers are known to contract longitudinally, they are not expected to contract transversely because of their close parallel packing. In comparing these values (Table I), we find s values of epithelial sheets fall in

FIG. 41. The pattern of chondrocytes traced from Fig. 59 (solid line) was transformed by the BS procedure (dotted line). s = 1.84. Solid circles, fixed points (Honda and Watanabe, unpublished).

FIG.42. The pattern of a transverse section of muscle fibers (solid line) was transformed by the BS procedure (dotted line). s = 1.71. Solid circles. fixed points (Honda and Eguchi, 1980).

236

HISAO HONDA TABLE 10

A

Cellular pattern Cultured lung epithelial cells Cultured retinal pigmented epithelial cells Cultured chondrocytes Transverse section of a bundle of muscle fibers

X

102

2.79

s(%)

1.83h

0.598 0.61 16

2.18 2.62

1.84 1.71

aFrom Honda and Eguchi (1980). hAverage values from two samples.

a range (50.6) distinct from those of nonepithelial cell sheets, whereas the A values of these sheets are all almost similar (Honda and Eguchi, 1980).

B. FORMATION OF

AN

EPITHELIUM-LIKE CELLSHEET

The blastular wall of the starfish is an example of a cell sheet whose A and s values vary during a developmental process. These values are good clues that the nature of the tissue changes. The embryo of the starfish (Asterinapectinifera)develops into a hollow sphere consisting of a single layer of cells which eventually becomes closely packed. Such a polygonal cellular pattern was analyzed with the cell aggregate model and the boundary shortening model. The result is shown schematically in Fig. 43. During the stages between the seventh cleavage and the rotating blastula, the A value rose from 0.16 X l o p 2 to 1.1 X whereas the s value decreased from 1.0 to 0.4 (Honda et al., 1983). It is probable that the pattern on the seventh cleavage stage closely approximated Dirichlet domains (a small A value) because the state of cells up to this stage resembles that of independent spherical cells compressed within a confined space. The situation up to this stage is similar to the pattern formation in Pediastrurn as previously described (Section 11,C). The rise in the A value implies that formerly independent cells have developed an interaction between one another. This is in good accord with the results of morphological studies in which cells were shown to begin to adhere closely to each other at the eighth cleavage stage as a result of the initiation of septate desmosome formation. The septate desmosome is known to form bands and bind the opposing cell membranes along the circumference of the apical cell surfaces, a position corresponding to the polygonal boundaries (Dan-Sohkawa, 1976; Dan-Sohkawa and Fujisawa, 1980). A decreasing s value indicates that the boundaries are shortening, and implies that the cells are being organized into a tensile cell sheet. The s value approached

GEOMETRICAL MODELS FOR CELLS IN TISSUES

237

those (0.4) of epithelial sheets as described in the Section IV,A. Indeed, the blastular wall at that stage had been interpreted as an epithelium by morphological criteria: cells in a monolayer, closely bound to each other on the outer surface by septate desmosomes, and the inner surface lined by a basement membrane (Dan-Sohkawa and Fujisawa, 1980). There are the two causes for a small s value as previously described (Section III,B,3): ( I ) contraction of the boundary length while maintaining the polygonal area constant, and (2) expansion of the area while maintaining the boundary length constant. We consider the pattern of early starfish blastula belongs to case (2), since we were unable to find either bundles of microfilaments or other specific structures that might give support to a contractile system (Dan-Sohkawa and Fujisawa, 1980; Kadokawa, Dan-Sohkawa, and Eguchi, unpublished). Therefore, we suppose that the small s value is caused by a factor such as the rigidity or nonstretchiness of the septate desmosomal band acting against the cytoplasmic pressure generated by the change in cell shape from spherical to polyhedral as the cells become more adhesive to each other. Any conclusion, however, must wait until more is learned about the actual mechanism. There may be a similar process in the differentiation of cultured teratocarcinoma stem cells (PCC4aza1, Lo and Gilula, 1980). Stem cells which show a packed polygonal cellular pattern differentiate into endoderm-like cells in which microfilaments and their bundles are frequently aligned in parallel and in close association with the cell borders. Tight junctions form continuous belts which surrounded the entire apical borders of each cell. Their cellular pattern seems to show that the cell sheet is entering a tensile state during differentiation. (The endoderm-like cells differentiate eventually into giant cells, thus differing from the early development of starfish embryos.)

FIG. 43. Schematic presentation of spherical independent cells (a), being packed into polygonal shapes (b). and eventually organized into a tensile sheet (c). (a) Spherical cells crowded in one plane. (b) Dirichlet domains made based on the original sphere (dotted line) distribution of (a). A = 0; s is large. (c) The pattern after the BS procedure (solid line) starting from a pattern (dotted line) which is the same as the solid line in (b). A is large; s is small.

238

HlSAO HONDA

c . THE EPITHELIUM-LIKE STATE OF CELLS As has been shown above, the s value and the A value are valid for determining whether a sheet belongs to the epithelial type or not. The small s value (i.e., a short boundary length) of an epithelial cell sheet is reasonable when considering that an epithelium is generally a smooth sheet which is not wrinkled and relatively constant in thickness and functions as a tight surface barrier at the interface between a fluid and the tissue. It should be noted that we could establish the two kinds of cell monolayers by using the s value. Abercrombie and Heaysman (1954) distinguished a cell monolayer from a three-dimensional cell aggregate. A cell monolayer was defined as a two-dimensional distribution of cells attached to a culture substratum. Monolayer formation is attributed to cell nature such as contact inhibition of movement or overlapping (DiPasquale and Bell, 1974; Garrod and Steinberg, 1975; Timpe et al., 1978). We propose here that cell monolayers should be divided further into two groups: a nontensile cell sheet which has a large s value, and a tensile one which has a small s value. In a three-dimensional aggregate (Fig. 44a), cells overlap each other. KB cells, other tumor cells, and some transformed cells form this aggregate. In a nontensile cell sheet (Fig. 44b), cells are not connected with each other or are connected at several spots. The apical surfaces of cells are convex outward in general, cell sheets are loose clusters, and the s value is large. Chick embryonic liver parenchyma cells (Garrod and Steinberg, 1975), 3T3 mouse fibrohlastic cells (Timple er al., 1978), and chick chondrocytes (Fig. 5g; Eguchi and Okada, 1971) form this kind of monolayer. In a tensile cell sheet (Fig. 44c), cells are connected with each other by junctions which form continuous belts such as tight junctions or septate desmosomes which surround the entire apical border of each cell. The boundaries of such cells are stable in the normal state, their apical surfaces are flat, and the s value is small. Retinal epithelial pigment cells (Fig. 5e), lung epithelial cells (Fig. 5f), and corneal endothelial cells in a normal state (Fig. 250 form such a stable monolayer. a

b

C

FIG. 44. Schematic presentation of the three kinds of cell clusters. (a) A three-dimensional irregular mass of cells. (b) A nontensile cell sheet attributed to contact inhibition of overlapping. (c) A tensile cell sheet. Cells are immobilized in contact on all sides with neighboring cells by junctional complexes (stippled structures) forming belts surrounding the entire apical border of each cell such as tight junctions or septate desmosomes. Note that the apical cell surface is flat (c) whereas it is convex outward in (b).

GEOMETRICAL MODELS FOR CELLS IN TISSUES

239

We have already described several processes corresponding to the change from a nontensile state to a tensile one: formation of a tensile cell sheet in the blastular wall of starfish embryos (Section IV,B), differentiation of the teratocarcinoma stem cell in culture (Section IV,B), change of the corneal endothelial cells close to a wound during the wound healing process (Fig. 34), and differentiation of the gathering, packed mesenchymal cells on a stroma differentiating into corneal endothelium (Kodama et al., 1981). The s value is particularly useful for investigating such processes because it allows us to trace the change of tissue nature without disturbing the cell sheet, but simply by observing it externally. It should be stressed here that the s value and the A value are mutually independent and that they represent completely uhrelated aspects of a pattern. Some examples will be discussed using a schematic figure (Fig. 45): We made, using fat clay, artificial polygonal patterns which had small A values and both small and large s values. When the spheres of fat clay were regularly arranged as stated in Section III,B,3 (Fig. 5a), the polygonal pattern had a small s value (s = 0.180, A = 0.164 X lo-*, Fig. 5c). However, when the spheres were irregularly arranged as shown in Fig. 5b, the pattern had a large s value (s = 1.03, A = 0.324 X lo-?, Fig. 5d). Similar patterns (A = 0) with both’small and large s

A

value

x 10’

FIG.45. Plot of s values of several patterns against their A values. (A) The region including Dirichlet domains (A = 0 ) with various s values, and the patterns of depressed spheres of flat clay (small A values; Fig. 5c and d). (B)The region including the patterns of rubber strings and soap bubbles (small s values. both: Figs. 31 and 32). (C) The region including the FL cell pattern with the large .Y and large A values. (D)The region including the surface patterns of developing starfish embryos (Section 1V.B). Arrow, the direction of advancing stages of development. Open circles, actual data. Dots, regions A-D.

240

HlSAO HONDA

values were made by a computer through the systematic construction of random Dirichlet domains (Honda and Eguchi, 1980). These Dirichlet domains or these like Dirichlet domains fall in region A in Fig. 45. If some polygonal patterns are made of substances such as rubber strings or soap bubbles (Fig. 25c or d), the s values are all small (s = 0.07 and 0.06). However, the A values are expected to be small or large, respectively, when size and arrangement of domains are regular or irregular. These patterns of tensile sheets fall in region B in Fig. 45. FL cells which are in an irregular mass and are moving in a sheet show large A and large s values (A = 8.4 X s = 3.9) which fall in the region C in Fig. 45 (Honda and Watanabe, unpublished). The cellular patterns of blastular walls of starfish embryos (Section .[V,B) happen to provide us with an interesting example in which the relation between A and s values is inverted during the course of development. Spherical, independent cells become crowded and packed tightly in which the pattern is close to Dirichlet domains (small A value) and the boundary does not contract (large s value). Then, cells become organized adhesively into a sheet and have contractile systems (small s value) in which the pattern deviates from the Dirichlet one (large A value). This example falls in the region D in Fig. 45. Transformation of a pattern into a tensile sheet during the development is represented by a line with an arrow. It may also be possible to find a tissue morphogenesis as follows: At the beginning, nonspherical cells gather and are packed to form a sheet which show a polygonal pattern whose A value and s value are both expected to be large because it started with nonspherical cells. This would mean that it is far from Dirichlet domains and has no contractile system. When a contractile system has been developed, the sheet becomes tensile and the s value decreases while the A value remains constant or decreases a little because of regularization of the cell pattern by boundary shortening.

V. Fundamental Consideration of Tension and Shape A. TENSION FOR MAINTAINING A CONSTANT SHAPE Although the basic idea relating surface tension and cell shape has recurred sporadically (e.g., Thompson, 1942), it has not been so productive of results as expected. However, the recent increase in knowledge on intra- and intercellular structures which are considered to exert a tensile force of cells has encouraged us to reevaluate this fundamental concept. Our construction of geometrical cell models is one attempt to better understand tissues consisting of cells and cellular substances.

GEOMETRICAL MODELS FOR CELLS IN TISSUES

24 1

We will consider the relationship between states of tension and deformation under a contractile system. If the system undergoes an actual process of contraction, the contractile apparatus ceases to operate, leaving behind a deformation. If the system still has the ability to shorten successively, it continues to undergo a contraction process, resulting in a drastic morphological change. On the other hand, if the system undergoes little contraction because of geometrical hindrances such as constancy of polygonal area, adhesion to neighbors, or others, it produces tension. That is, a contraction system will exert a state of tension when the shape is scarcely deformed. Our intention in constructing geometrical cell models is to investigate fine changes of tissues into a tensile state, instead of drastic morphological changes, while maintaining their shape almost constant. One of the simplest methods of such investigation is to detect tension of a tissue by dissecting it and following the process of its deformation (e.g., curling). Systematic investigations by this method in amphibian embryos have been performed (Beloussov et al., 1975). In contrast to the dissection methods, the present analysis with the geometrical models allows us possibly to trace the change of a tensile state without teasing the cell sheet. The tension which our geometrical models deal with is exerted in tissues such as alveoli of the lung under inflation or deflation (Schiirch et a / . , 1976, 1978), endothelia of a blood vessel under blood pressure, corneal endothelia under intraocular pressure, epithelia of the urinary bladder during the expansion-contraction cycle (Minsky and Chlapowski, 1978), epithelia of the oviduct during egg formation and passage, and so on. Tension in a drastic morphological change such as a flat cell sheet being converted into a curved structure, forming either a tube, vesicle, or branched tree, is purposely not dealt with by our method at present. Tumor formation disturbs normal tissue organization. In experiments with a cell culture system, tumor virus infects and transforms cells. This is accompanied by great changes in cell shape which are attributed to the modification of intracellular filamentous structures. An example is neoplastic transformation of avian and mammalian cells by Rous sarcoma virus, where the transforming function is encoded in Rous sarcoma virus src gene, and its product is a phosphoprotein of molecular weight 60,000 (~~60""'). The product is considered to affect functions of adhesion plaques, cytoskeletal structures, or others of transformed cells, which are closely related to cell morphology (Willingham er al., 1979; Burr er al., 1980; Rohrschneider, 1980; Der er al., 1981 ; Boschek et al., 1981; Sefton eral., 1981; Ball and Singer, 1981). Therefore, we could expect to detect premonitory changes of cellular patterns of the early stage of tumor formation by using our geometrical cell models. This is possible because the s and A values vary according to changes of the cell state even without drastic morphological changes. These values are obtained simply by observing the living cells without killing or dissecting tissues.

242

HISAO HONDA

B . ON THE POLYGONAL PATTERNWITH

THE

MINIMUM BOUNDARY LENGTH

Now, we will mathematically discuss boundary shortening, i.e., whether a pattern is of the minimum boundary length or not after application of the BS procedure, and whether the pattern is unique or not when its boundary length is minimum. The problems described below are not simple although the BS procedure is of practical use. 1 . On Minimum Boundary Lengths and the Uniqueness of Patterns

A pattern seems to have asymptotically shortened its boundary length during the BS procedure, and becomes the pattern whose boundary length does not shorten any longer. Does the final pattern have the minimum boundary length'?Is there another way through which a pattern is transformed to one having a shorter boundary length? In Fig. 30 we used different series of random numbers for the BS procedure, that is, the sequence of elemental steps of the BS procedure was varied. There we obtain the same final pattern. As far as we have used the present BS procedure, most of normal patterns seem to become their own unique final pattern. However, the BS procedure is not the universal method for obtaining the minimum boundary. We postulated that only one side of the polygons is displaced in an elemental step, and the area of each polygon is invariable throughout the BS procedure. In actual cellular sheets, several sides are considered to be simultaneously displaced, and it is possible that the areas of polygons may change temporarily by varying the cell thickness. If we could use these additional postulations, the pattern might be transformed to one with a shorter boundary length. Figure 46 shows two patterns of regular and elongated hexagons whose areas are all the same and interior angles all 120". Figure 46b, as well as Fig. 46a, is also the final pattern of the BS procedure (i.e., the procedure does not change the pattern any more), but its boundary length is 25% longer than that of Fig. 46a. In this example, a pattern, though it is the final pattern of the BS procedure, does not have a minimum boundary length.

@Ebb@

a

Fro. 46. Two hexagonal patterns whose individual hexagonal areas are the same in (a) and (b). All interior angles are 120". The boundary length of the elongated hexagonal pattern in (b) is 25% longer than that of the regular hexagonal one in (a).

GEOMETRICAL MODELS FOR CELLS IN TISSUES

243

FIG. 47. Hexagonal patterns whose boundary lengths are the same and minimum. and whose interior angles are all 120". (a) The regular hexagonal pattern. (b), (c), (d) The patterns containing irregular hexagons, but whose interior angles are 120".

On the other hand, Fig. 47 shows hexagonal patterns whose interior angles are all 120", yet all patterns have the same boundary length, and it is the minimum. Therefore, we have many patterns whose boundary lengths are minimum. The BS procedure should be considered as the practical method to investigate states of actual given patterns, but we cannot use it to investigate the mathematical minimum or uniqueness. 2. Implication of Boundary Shortening The BS procedure is not a method to make a pattern whose total boundary length is minimum (although it locally shortens the boundary length as shown in Fig. 30). Then, what does the resultant pattern by the BS procedure imply? The triple junction with 120" (referred to in Section III,B,I) provides an s value of zero where three tensions along the three sides are the same in strength (Fig. 26c). If the arrangement is deflected from such a symmetrical one, the interior angles deviate from 120°, i.e., the tensions along the sides are not uniform, and the s value becomes larger. Therefore, the standard deviation of interior angles of a polygonal pattern is correlated with the s value. In fact, Fig. 48 shows a correlation between the deviation of angles (in this case external angles, instead of interior ones, were used for calculation) and the s value of many polygonal patterns (correlation coefficient = 0.944). A small s value of a pattern means that every interior angle is close to 120". This implies uniform tension along every side of a polygonal pattern in a contractile system. For instance, tensions along the sides of every pattern in Figs. 46 and 47 are the same since these interior

244

HISAO HONDA

0.4.

0.3,

0

1.0

2.0

3.0

s value FIG. 48. Relation between the SD/average angle (ordinate) and the s values (abscissa) of many polygonal patterns. SD/average angle, the standard deviation of external angles divided by the average external angle of polygons (60").External angle = 180" - interior angle. (Correlation coefficient = 0.944.) Solid circles, actual cellular patterns. Open circles, other polygonal patterns such as soap bubbles, spheres deformed by compression, cross-section of a bundle of blood vessels.

angles are all 120". A small s value suggests not only a tensile state of a cell sheet, but also a uniformity in tensions along cell boundaries.

VI. Conclusions 1. To understand tissues with respect to individual cell properties, two geometrical cell models were constructed: the cell aggregate model and the boundary shortening model of cells in a tissue. 2. The cell aggregate model which was made by using the geometry of Dirichlet domains is appropriate for describing a cell sheet in which independent spherical cells are crowded and packed so that they are deformed into polygons. Moreover, the model can be applied to general cellular patterns, and permits the calculation of the A value which indicates the degree of deviation of the model from an actual pattern.

GEOMETRICAL MODELS FOR CELLS IN TISSUES

245

3. In the cell aggregate model, cells in tissues are simply described by a set of points. Therefore, dynamic cell changes in tissues, cell disappearance, division, shifting, and arrangement are represented by point removal, addition, displacement, and positioning, respectively. 4. The boundary shortening model of cells in a tissue can be applied to an actual cellular pattern by using the BS (boundary shortening) procedure. In this way a pattern is transformed to another one whose boundary length is shorter, and the decrease of the length is presented as the s value in percentage. The s value indicates how much the boundary length of a pattern can be shortened by the BS procedure. A small s value means that the pattern has already so contracted as not to be shortened any longer by the BS procedure. Such a pattern is assumed to be in a tensile state. The small s value also suggests that tensions are uniform along cell boundaries which connect at triple junctions. 5. There are two causes for a tensile state of a polygonal cell sheet: contraction of the boundary length accompanied by a relatively unchanged area of individual polygons, and expansion of the polygonal area with a relatively unchanged length of the polygonal boundaries. 6. Compared with s values of some kinds of tissues, those of epithelium-like tissues fall in the range of small s values. This is reasonable since there have been findings in some epithelial cells that bands (or filamentous structures) bind the opposing cell membranes along the circumference of the apical cell surfaces, a position corresponding to the polygonal boundaries. Moreover, such structures sometimes contain actin filaments which show contraction. The s value can be used to distinguish epithelium-like tissues from other tissue types, in addition to the ordinary morphological criteria. 7. The BS procedure, including the vertex connection change, is a powerful tool to simulate cell shape changes and rearrangements in tissues. 8. Successive measurements of the A and s values elucidate a dynamic change of cells in tissues, e. g., developmental processes, wound healing, differentiation in culture dish, etc., simply by observing from outside without the need for manipulating tissues. Geometrical models, with appropriate assumptions based on actual experimental information, are valid for investigating not only the structure but also the functions of a tissue.

ACKNOWLEDGMENTS

Acknowledgment is due to Professor G. Eguchi for collaboration and invaluable discussion, Professors T. S. Okada, R . Rosen, and E. Teramoto for encouraging this study, Drs. M. DanSohkawa. S. Higuchi, R . Kodama, T. Morita, Y. Ogita, K. Watanabe, and H. Yamanaka for collaborations, Drs. M. Hasegawa and K . Yasuda for useful information, Dr. J. B . Fisher for correction of the manuscript, and Misses K . Nagai, M. Noda, S. Oshibe, Y. Tanaka, and Y. Ueura for assistance.

246

HISAO HONDA

REFERENCES Abbott, L. A., and Lindenmayer, A. (1981). J. Theor. Biol. 90, 495-544. Abercrombie, M., and Heaysman, J. E. M. (1954). Exp. Cell Res. 6, 293-306. Allen, T. D., and Potten, C. S. (1976). Nature (London) 264, 545-547. Ball, E. H.,and Singer, S. J . (1981). Proc. Natl. Acad. Sci. U.S.A. 78, 6986-6990. Beloussov, L. V., Dorfman, J. G., and Cherdantzev, V. G. (1975). J. Embryo/. Exp. Morphol. 34, 559-574. Bloom, W., and Fawcett, D. W. (1975). “A Textbook of Histology.” Saunders, Philadelphia. Boschek, C. B., Jockusch, B. M., Friis, R. R., Back, R., Grundmann, E., and Bauer, H. ( 1981). Cell 24, 175-184. Burr, J. G., Dreyfuss, G., Penman, S., and Buchanan, J . M. (1980). Proc. Narl. Acad. Sci. U.S.A. 77, 3484-3488. Christophers, E. (1972). Virchows Arch. Abt. B . Zellpathol. 10, 286-292. Cone, R. D., and Bonner, J. T. (1980). Exp. Cell Res. 128, 479-485. Connolly, J . A., Kalnins, V. I., and Barber, B. H. (1981). Proc. Natl. Acad. Sci. U.S.A. 78, 6922-6926. Coxeter, H. S. M. (1969). “Introduction to Geometry.” Wiley, New York. Crawford, B. (1975). Can. J. Zool. 53, 560-570. Crawford, B. (1979). J. Cell Biol. 81, 301-315. Crawford, B., Cloney, R. A., and Cahn, R. D. (1972). Z. Zel/forsch. 130, 135-151. Dan-Sohkawa, M. (1976). Dev. Growth Difler. 18, 439-445. Dan-Sohkawa, M., and Fujisawa, H. (1980). Dev. B i d . 77, 328-339. Der, C. J., Ash, J. F., and Stanbridge, E. J. (1981). J. Cell Sci. 52, 151-166. DiPasquale, A., and Bell, P. B., Jr. (1974). J. Cell Biol. 62, 198-214. Dirichlet, G. L. (1850). Quoted in Coxeter (1969). Dormer, K. J. (1980). “Fundamental Tissue Geometry for Biologists.” Cambridge Univ. Press, London. Edds, K. T.(1980). Exp. Cell Res. 130, 371-376. Eguchi, G. (1977). Saiensu (Japanese edition of Sci. Am.) 7, 66-77.. Eguchi, G., and Okada, T. S. (1971). Dev. Growth Differ. 12, 297-312. Garrod, D. R., and Steinberg, M. S. (1975). J . Cell Sci. 18, 405-425. Green, C. R.. and Bergquist, P. R. (1982). J. Cell Sci. 53, 279-305. Hasegawa, M., and Tanemura, M. (1976). Ann. Inst. Star. Math. 28B. 509-519. Hasegawa, M., Tanemura, M., and Takiguchi, S. (1981). Int. Roundtable Congr. Ann. Japan Stat. SOC. SOth, pp. 146-161. Hay, E. D., and Revel, J.-P. (1969). “Fine Structure of the Developing Avian Cornea.” Karger, Basel. Hofmeister, W. (1863). Quoted in Korn and Spalding (1973). Honda, H. (1973). J. Theor. Biol. 42, 461-481. Honda, H. (1978). J. Theor. Biol. 72, 523-543. Honda, H., and Eguchi, G. (1980). J. Theor. Biol. 84, 575-588. Honda, H., Morita, T., and Tanabe, A. (1979). J. Theor. Biol. 81, 745-759. Honda, H., Ogita, Y., Higuchi, S., and Kani, K. (1982). J. Morphol. 174, 25-39. Honda, H.,Dan-Sohkawa, M., and Watanabe, K. (1983). Differentiation (in press). Hudspeth, A. J. (1975). Proc. Natl. Acad. Sci. U.S.A. 72, 2711-2713. Isenberg, G., Rathke, P. C., Hiilsmann, N., Franke, W. W., and Wohlfarth-Bottermann, K. E. (1976). Cell Tissue Res. 166, 427-443. Ivanova, 0. Y.,Margolis, L. B., Vasiliev, Ju, M., and Gelfand, I. M. (1976). Exp. Cell Res. 101, 207-2 19. Kani, K., Ogita, Y., and Abe, K. (1980). Folia Ophthalmol. Jpn. 31, 28-32.

GEOMETRICAL MODELS FOR CELLS IN TISSUES

247

Kaye, G . I.. Fenoglio, C. M., Hoefle, F. B., and Fischbarg, J. (1974). J. Cell Biol. 61, 537-543. Keller. R. E. (1978). J . Morphol. 157, 223-248. Kibbelaar. M. A., Kamaekers, F. C. S., Ringens, P. J., Selten-Versteegen, A. M. E., Poels, L. G., Jap, P. H. K., van Rossum, A. L., Feltkamp, T. E. W., and Bloemendal, H. (1980). Nature (London) 285, 506-508. Kodama, R., Honda, H.. and Eguchi. G. (1981). Deu. Growth Difler. 23, 456 (Abstr.). Korn, R. W. (1976). New Phytol. 77, 153-161. Korn. R. W. (1980). Ann. Bot. 46, 649-666. Korn, R. W.. and Spalding, R. M. (1973). New Phyrol. 72, 1357-1365. Kreis. T. E.. and Birchmeier, W. (1980). Cell 22, 555-561. Lehtonen, E., and Badley. R. A. (1980). J. Embryo/. Exp. Morphol. 55, 21 1-225. Lewis, F. T. (1923). Proc. Am. Acad. Arts Sci. 58, 537-552. Lewis. F. T. (1943). Am. J. Bot. 30, 766-776. Lo, C. W., and Gilula, N. B. (1980). Dev. Biol. 75, 78-92, 93-1 1 1 . Loeb, A. L. (1976). “Space Structure.” Addison-Wesley, London. Matela. R. J.. and Fletterick, R. J . (1979). J . Theor. Biol. 76, 403-414. Matela, R. J . , and Fletterick, R. J . (1980). J . Theor. Biol. 84, 673-690. Matzke, E. B., and Duffy. R. M. (1956). Am. J . Bot. 43, 205-225. Maurice, D. M. (1968). Experientia 24, 1094-1095. Menton, D. N. (1976). Am. J. Anar. 145, 1-22. Middleton, C. A., and Pegrum, S . M. (1976). J. Cell Sci. 22, 371-383. Minsky, B. D., and Chlapowski, F. J. (1978). J . Cell Biol. 77, 685-697. Nagata, T., and Takebe, 1. (1970). Planta (Berlin) 92, 301-308. Newsome, D. A., Fletcher, R. T., Robison, W. 0..Jr., Kenyon, K. R., and Chader, G. J. (1974). J . Cell Biol. 61, 369-382. Ogita. Y.,Higuchi, S., Kani, K., and Honda, H. (1981). Jpn. J. Ophrhalmol. 25, 326-334. Owaribe, K., Araki, M . , Hatano, S., and Eguchi, G . (1979). In “Cell Motility: Molecules and Organization” (S. Hatano, H. Ishikawa, and H. Sato, eds.), pp. 491-500. University of Tokyo Press, Tokyo. Owaribe, K.. Kodama, R., and Eguchi, G.(1981). J. Cell Biol. 90, 507-514. Perry, M. M. (1975). J. Embryo/. Exp. Morphol. 33, 127-146. Phillips, H. M., Steinberg, M. S., and Lipton, B. H. (1977). Deu. Biol. 59, 124-134. Pyshnov. M. B. (1980). J. Theor. Biol. 87, 189-200. Radice, G. P. (1980). Deu. Biol. 76, 26-46. Rajaraman, R., Rounds, D. E., Yen, S. P. S., and Rembaum, A. (1974). Exp. Cell Res. 88, 327-339. Rogers. C. A. (1964). “Packing and Covering.” Cambridge Univ. Press, London. Rohrschneider, L. R. (1980). Proc. Narl. Acad. Sci. U.S.A. 77, 3514-3518. Rubin. K., Oldberg, A., Hook, M., and Obrink. B. (1978). Exp. CellRes. 117, 165-177. Saito. N. (1982). J . Theor. Biol. 95, 591-599. Scholander, P. F. (1969). In “Vertebrate Structures and Functions” (N. K. Wessells, ed.), pp. 125- 13 1. Freeman, San Francisco. Schiirch, S., Goerke, J., and Clements, J. A. (1976). Proc. Narl. Acad. Sci. U.S.A.73,4698-4702. Schiirch, S . , Goerke. J., and Clements, J. A. (1978). Proc. Natl. Acad. Sci. U.S.A. 75,3417-3421. Sefton, B. M., Hunter, T., Ball, E. H.. and Singer, S. J. (1981). Cell 24, 165-174. Seglen, P. O., and Gjessing, R. (1978). J. Cell Sci. 34, 117-131. Sherrard, E. S. (1976). Exp. Eye Res. 22, 347-357. Stevens, P. S . (1974). “Patterns in Nature.” Little, Brown, Boston. Strahs, K. R., and Berns, M. W. (1979). Exp. Cell Res. 119, 31-45. Tanernura, M., and Hasegawa, M. (1980). J. Theor. B i d . 82, 477-496. Thompson, D’Arcy W. (1942). “On Growth and Form,” 2nd ed. Cambridge Univ. Press, London.

248

HlSAO HONDA

Timpe, L ., Martz, E., and Steinberg, M. S . (1978). J . Cell Sci. 30, 293-304. Tomchik, K . 1.. and Devreotes, P. N. (1981). Science 212, 443-446. Van Horn, D. L . , and Hyndiuk, R . A. (1975). Exp. E.ye Res. 21, 113-124. Van Horn, D. L . , Sendele, D. D . , Seideman, S., and Buco, P. J . (1977). Invest. Ophthalmol. Visual Sci. 16, 597-613. Velarde, M. G., and Normand, C. (1980). Sci. Am. 243, 79-93. Voronoi, G . (1908). Quoted in Rogers (1964). Wheeler, G. E. (1962a). Am. J . Eot. 49, 246-252. Wheeler, G. E. (1962b). Am. J . Eot. 49, 355-362. Willingham, M. C., Jay, G . , and Pastan, I. (1979). Cell 18, 125-134. Winfree. A. T. (1972). Science 175, 634-636.

INTERNATIONAL REVIEW OF CYTOLOGY.VOL. 81

Growth of Cultured Cells Using Collagen as Substrate JASON YANGAND S. NANDI Cancer Reseorch Laboratory and Department of Z o ~ l o g yUniversiry ~ of California, Berkeley, California I. 11. 111.

IV. V.

VI . VII. VIII.

Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Early Studies . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Studies in the 1960s.. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Studies in the 1970s.. . . . . . . . . . . . . . . . . . . . Three-Dimensional Culture System ........... Studies in the 1980s.. . . . . . . . . . . . Studies in Our Laboratory.. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Conclusion . . . . . . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

249 250 25 I 25 1 254 255 258 211 282

I. Introduction Collagen, a major constituent of the extracellular matrix in vivo. has been used as a substrate for cultured cells over many decades. The extensive literature describing the effects of collagen substrates on morphology, migration, adhesion, differentiation, and growth has been reviewed recently by Kleinman et al. (1981). Literature dealing with collagen production by cultured cells has also been reviewed recently by Bissel (1981). However, additional literature has been published since the review dealing with contraction (Bell et al., 1979; Bellows et a / ., 1981 ; lwig rt a / ., 1981 ; Harris et a / ., 1981 ), migration (Greenberg et a/. , 1981; Fisher and Solursh, 1979; Schor, 1980; Schor et al., 1981, 1982), attachment or adhesion (Ohara and Buck, 1979; Schor, 1979; Schor and Court, 1979; Grotendorst et a/.. 1981; Mclntyre et a/.. 1981; Grinnell and Bennett, 1981; Bruns and Gross, 1980; Yoshizato et a / ., 1981 ; Chazov et a/., 1981 ; Termine et a / . . 1981; Dickey and Seals, 1981), and differentiation (Chambard et a / . , 1981). The current review will be limited to the effect of collagen substrate on the growth of cultured cells and will report some of the recent findings from our laboratory. The biochemistry of collagen, dealing with its structure and synthesis, has been reviewed recently (Bornstein and Sage, 1980). Collagen is a component of extracellular matrices and basement membrane. Collagen occurs in four chemically and genetically distinct forms: type I , found in bone, tendon, and skin; 249

Copyright 8 I Y X 3 by Academic Press. Inc. All right\ of reproduction in any lomi reserved. ISBN 0-12-36448 I - X

250

JASON YANG AND S. NAND1

type 11, found especially in cartilage and eye; type 111, associated with type 1 in skin, blood vessels, and smooth muscle; and type IV, found in basement membranes. Collagen used as a substrate in culture work, in the form of either thin film of dried collagen or hydrated collagen gel, usually consists of type I found in acid extract of rat tail. A thin film of dried collagen is prepared by spreading the collagen extract onto the surface of a dish, air dried and sterilized by ultraviolet irradiation. Collagen gel has been prepared by a number of different procedures. Ehrmann and Gey (1956) used two different methods for collagen gel preparation. The first method consisted of dialyzing the collagen extract against water, resulting in an increased viscosity of the contents. The second method consisted of exposing ammonia vapor to the collagen extract. The disadvantage of the latter method was that it required extensive washing to remove the toxic ammonia. Masurovsky and Peterson (1973) reported a method of photo-reconstituting collagen gels by adding riboflavin-5'-phosphate to collagen extract and subsequently irradiating with fluorescent light source. Elsdale and Bard (1972) described a method of preparing collagen gels by adjusting the pH and ionic strength of the collagen extract. This procedure, being more convenient, is more widely used than other methods.

11. Early Studies

In 1932, Huzella and Lengyel first studied the behavior of various cell types that were plated on fibrous collagen, either natural or reconstituted by salt precipitation from acetic acid solutions (see references in Ehrmann and Gey, 1956). They reported that the cells attached and grew along these fibers. In 1956, Ehrmann and Gey systematically compared the growth of 29 different cell strains and tissue explants on reconstituted rat tail collagen with growth on glass (Ehrmann and Gey, 1956; Gey, 1954). The technique consisted of preparing an amorphous transparent gel from rat tail collagen and placing slices in roller tubes to serve as substratum. They reported slight to greatly improved growth on collagen. It was pointed out that the resemblance of collagen gel to the natural matrix produced by cells makes it an ideal surface on which to study the physiologic functioning of cells. In 1958, Bornstein adopted the method for use on coverslips incorporated into either a classic Maximow slide assembly or a roller tube (Bornstein, 1958). After this early initial work, collagen preparations have been used from time to time in tissue culture, usually for culturing fastidious cells. Collagen substrates have been reported to enhance growth of cultured cells more than the conventional plastic or glass culture dish. A summary of these reports will follow.

GROWTH OF CULTURED CELLS

25 I

111. Studies in the 1960s

Using the procedure for reconstituting collagen as reported by Ehrmann and Gey (1956), several studies in the 1960s used collagen substrate for growing various cell types and achieved greater growth than that obtained in conventional plastic or glass dishes. Many reports dealt with cultivation of liver cells. In 1962, Hillis and Bang reported cultivation of primary explants from human embryonic liver using roller tube cultures coated with reconstituted rat tail collagen (Hillis and Bang, 1962). These cells survived for periods up to 100 continuous days. This was in contrast to reports in the existing literature of a survival period of no more than a few days. In the following year, Festenstein also reported cultivation of human embryo liver on polyethylene disks coated with a film of reconstituted rat tail collagen (Festenstein, 1963). Liver cells were cultured in this way for at least 30 days. Similarly, Zuckerman et a/. (1967) cultivated human embryo livers on rat tail collagen to study adenovirus infection of liver cells. Alexander and Grisham (1970) reported that explants from livers of rats 1 to 5 days old can be cultured with fair reproducibility using cover slips coated with collagen. They observed proliferation and migration of several identifiable types of liver cells, including hepatocytes, and noted that the hepatocytes retained morphologic and functional differential properties. In 1966, Cole el al. studied the ability of cells from various stages of preimplantation rabbit embryo to form colonies in virro (Cole et al., 1966). Cells from the embryonic disk were unable to attach to inorganic substrata but able to attach to, and multiply on, collagen-coated coverslips. Primary cell strains have also been established from single cell suspensions obtained by disaggregating isolated embryonic disks and placing them on collagen-coated surfaces. In 1966, Hauschka and Konigsberg reported that a collagen substratum could obviate the need for conditioned medium in the development of chick embryo muscle clones (Hauschka and Konigsberg, 1966). They demonstrated that single cells plated in unconditioned medium on a collagen-coated surface gave rise to muscle colonies where morphology was comparable to those which develop in the presence of the conditioned medium.

IV. Studies in the 1970s In spite of these studies demonstrating that the use of collagen substrate could considerably enhance cell growth, only a few additional reports came out in the early 1970s. Part of the reason may lie in the fact that the most commonly used cells in these studies were the less fastidious fibroblasts, and established cell lines.

252

JASON YANG AND S. NAND1

In 1970, Sanders and Smith studied the effect of exogenously added collagen from calf skin on the growth of baby hamster kidney (BHK-21) cells in semisolid media (Sanders and Smith, 1970). In the presence of collagen, the colonyforming capacity of the untransformed BHK-2 1 cells was enhanced 4- to Sfold, whereas that of transformed cells remained unaffected. In 1972, Rucker et al. reported that when collagen gel was dried it forrried a transparent film. Such dried films, prepared from microcrystalline collagen (Avilene), were used as a substrate for the growth of primary rabbit kidney fibroblast cells (Rucker et al., 1972). They reported that cells grew more rapidly on the collagen than on plastic. In the same year, Cleator and Beswick reported on the growth of a variety of cell lines and liver explants from rat and human fetuses, using crude and purified preparations of various collagens as growth surface (Cleator and Beswick, 1972). No outgrowth from either neonatal rat or human fetal liver explants was noted when explants were cultured on glass surfaces. However, when such explants were cultured on collagen, cellular outgrowth was noted. No difference was noted in the growth pattern of the cell lines and secondary cell strains, either on glass or collagen. In 1974, Gey et al. reported continuous growth of cells derived from chick embryo muscle explants placed on a slant of reconstituted rat tail collagen in roller tubes (Gey et al., 1974). In contrast to earlier reports that chick cells were maintained for 2-3 months on glass, Gey et al. were able to maintain chick cells for 2 and 3.5 years on reconstituted rat tail collagen. In 1976, McKeehan and Ham compared the effects of different culture surface coating agents on the clonal growth of WI-38 cells (McKeehan and Ham, 1976). They reported that the most improved growth was observed on surfaces treated with basic polymers and that cell growth on collagen was enhanced somewhat less. Partlow and co-workers, in a series of papers, reported results of [3H]thymidine incorporation by neuronal and nonneuronal cells from embryonic chick sympathetic ganglia cultured on dishes coated with rat tail collagen. A specific intercellular interaction was demonstrated between neuronal and nonneuronal cells that appears to increase the rate of nonneuronal cell proliferation (McCarthy and Partlow, 1976a; Hanson and Partlow, 1978). Subsequently, it was shown that stimulation of nonneuronal cell proliferation can be achieved by preparation of neuronal homogenate, demonstrating that neurons contain substances which are potent mitogens for nonneuronal cells (Hanson and Partlow, 1978). In 1978, Bunge and Bunge cultured explants of fetal rat sensory ganglia on collagen substrate (Bunge and Bunge, 1978). They observed an increase in Schwann cell numbers, ensheathment of small nerve fibers, and myelination of larger axons. No increase was observed without collagen. In the same year, Liu and Karasek reported on the isolation and serial cultivation of rabbit skin epithelial cells (Liu and Karasek, 1978a) and adult human

GROWTH OF CULTURED CELLS

253

epidermal keratinocytes (Liu and Karasek, 1978b), extending the earlier work using the collagen gel (Karasek, 1968). In both cell types, they achieved plating with high efficiency and serial cultivation for at least three passages on a collagen gel substrate. This was in contrast to plastic or glass, where plating efficiencies were low and little growth took place. Although primary culture of rabbit skin epithelial cells did not result in an increase in cell number, a 2- to 3-fold increase was observed in each subsequent subculture up to the third passage (Liu and Karasek, 1978a). The reason for this conversion of primary nonproliferative populations into proliferative ones is not known. Similar nonproliferative primary cultures were observed using a mixed population of basal and Malpighian cells from adult human epidermal keratinocytes. However, cell populations of predominantly basal cells produced proliferative primary cell cultures (Liu and Karasek, 1978b). Stanchfield and Yager, also in the same year, used collagen-coated dishes to culture amphibian hepatocytes to study vitellogenin stimulation by estrogen (Stanchfield and Yager, 1978). The nuclear labeling index of cells exposed to [3H]thymidine indicated only a very low level of cell growth, but they added that this is a usual characteristic of adult liver in vivo. In 1978, Gospodarowicz et al. compared the effects of collagen and fibroblast feeder layer on the mitogenic response of corneal epithelial cells to EGF (Gospodarowicz et al.. 1978). When corneal epithelial cells were plated on collagen coated dishes, they reached a higher cell density than when they were maintained on plastic. In addition, the cultures maintained on collagen-coated dishes responded to EGF, whereas those on plastic had no response. It was also reported that on plastic the cells remained flattened while on collagen they were round. In 1978, Liotta et al. reported studies on the mechanism of action of cishydroxyproline, the proline analog, on cell proliferation in primary cultures of murine connective tissue and of their spontaneously transformed tumorigenic counterparts (Liotta et al., 1978). Prior coating of the plates with collagen reversed the inhibitory effect of the cis-hydroxyproline on cell growth. Their interpretation was that cis-hydroxyproline inhibited murine connective tissue proliferation by preventing collagen deposition on the plastic substrate. Similar studies using cis-hydroxyproline have since been reported using primary cultures from rat mammary gland (Wicha et al., 1979; Liotta et al., 1979), 7,12-dimethylbenzanthracene-inducedrat mammary tumor (Wicha er al., 1981), and Nnitrosomethylurea-induced rat mammary tumors (Lewko et al., 1981). In all cases, cis-hydroxyproline inhibited growth of cultured mammary epithelial cells which normally produce collagen. Their interpretation was that the basement membrane collagen deposition may be necessary for the growth of mammary epithelial cells. In 1979, Chlapowski and Haynes compared growth and differentiation of rat transitional epithelial cells on conventional nonpermeable surfaces of glass or

254

JASON YANG AND S. NAND1

plastic petri dishes to pepeable collagen supports (Chlapowski and Haynes, 1979). On glass or plastic surfaces, division stopped after 2-3 weeks, hut on collagen support, transfer of cells could be effected and growth maintained for up to 4 months. In 1979, Adler et al. reported a procedure to obtain purified monolayer cultures of neurons and nonneuronal cells from chick embryo optic lobe by using two formulations for collagen coating (Adler et al., 1979). High adhesion collagen substrate has been shown to enhance neuronal survival and neuritic outgrowth while slowing down nonneuronal proliferation.

V. Three-Dimensional Culture System-Early Studies From 1960 to 1980, the use of collagen, in a form other than thin film or gel surface, has also been reported. When Ehrmann and Gey initially used rat tail collagen in their studies in 1956 (Ehrmann and Gey, 1956), they pointed out that the collagen gel can provide a three-dimensional environment. In 1972, Elsdale and Bard reported that collagen gel can be employed as both two- and threedimensional substrata in cell behavioral studies and provided some preliminary observations using human fetal diploid lung fibroblasts (Elsdale and Bard, 1972). In 1974, Cuprar and Lever, while studying growth of cells derived from a hamster fibrohemangiosarcoma, also reported migration of cells into the collagen gel matrix (Cuprar and Lever, 1974). However, in contrast to fibrohemangiosarcoma, the propagation of L cells and HeLa cells on collagen gel surfaces did not result in invasion into the matrix. In 1978, Dunn and Ebendal reported that the collagen fibrils of collagen gels formed a three-dimensional meshwork (Dunn and Ebendal, 1978). Using chick embryo heart fibroblasts, they observed that each fibroblast is adherent at many points which do not lie in the same plane. Despite these observations of cell migration into the collagen gel matrix when cells were cultured on collagen gel surface, it is only recently that there have been reports of deliberate use of cells inside the three-dimensional matrix on collagen gel followed by their in vitro cultivation. Details of these are presented in the next two sections. Since 1951, Leighton has been advocating the use of a three-dimensional culture system for the growth of various cell types (Leighton, 1973; Leighron et al., 1967, 1980). His original three-dimensional sponge matrix tissue culture consisted of cellulose sponge impregnated with a chicken plasma clot (Leighton, 1951). In 1967, he modified the supporting matrix to collagen-coated cellulose sponge (Leighton et al., 1967). It combined the three-dimensional features of sponge with the surface properties of a collagen membrane. Many types of cells adhered to the collagen surface and grew on the interstices in an organoid

GROWTH OF CULTURED CELLS

255

arrangement. Such a matrix has been used in the study of embryonic tissue, rodent tumors, and clinical cancer (Leighton, 1968a, 1973; Leighton et al., 1968, 1980; Abaza et af., 1978). In 1976, Russo et a f . used collagen-coated cellulose sponges for the study of the three-dimensional expression of d human mammary carcinoma line MCF-7. They reported that MCF-7 can reexpress the original patterns of the epithelial component of the primary mammary carcinoma, as determined at both the histological (Russo et al., 1976) and ultrastructural (Russo et af., 1977) levels. The major disadvantage of the collagen-coated cellulose sponge lies in its lack of transparency. The analysis of the growth and behavior of the cells could not be carried out directly through the microscope and depended on tedious histological sections.

VI. Studies in the 1980s During the past few years, there have been increasing reports on the use of collagen substrate for growing cultured cells. Part of the reason may lie in the increasing interest in primary culture of fastidious cell types as well as in the recognition that substrate or extracellular matrix has a profound effect on cell proliferation. Collagen substrates have been used recently for primary culture of mouse granulocyte/macrophage progenitor cells (Lanotte et al., 198l), rat brain capillary endothelium (Bowman et al., 198I), human colon carcinoma cells (Murakami and Masui, 1980), hamster renal tumor cells (Talley et af., 1982), rat mammary epithelial cells (Salomon et al., 1981), human mammary epithelial cells (Yang et af., 1981a), chick embryo cerebral and sympathetic neurons (Iverson et al., 1981), and rat sympathetic neurons (Hawrot, 1980). Lanotte et al. (1981) used collagen gel as culture matrix for the three-dimensional growth of hemopoietic cells to facilitate cellkell interaction and cell cloning. They demonstrated that collagen gels are able to support CFU-C formation, in the presence of exogenous CSF, at a level comparable to that seen in soft agar culture. In addition, the collagen gel system had the advantage of allowing the development of CSF-independent stromal foci of a type not seen in soft agar cultures. Bowman et al. (1981) reported that a homogeneous population of rat brain capillary endothelial cells can attach to a collagen substrate and incorporate ['Hlthymidine. Cells underwent five to seven population doublings in attaining confluence, and these cells retained both endothelial and blood-brain barrier features. Murakami and Masui ( 1980) established primary cultures from transplantable human colon tumor lines maintained in nude mice and a primary tumor from a patient using hormone-supplemental serum-free medium and collagen-treated

256

JASON YANG AND S. NAND1

plastic dishes. They reported that cell lines could be established from a tumor before fibroblast overgrowth became a problem. Talley et af.(1982) established primary cultures using cells from estrogeninduced primary renal tumors in Syrian hamsters and from first to fourth serially transplanted carcinomas. When cultured as monolayers in plastic flasks, isolated cells from primary tumors exhibited a marked decline in cell number after 4 to 6 days. In contrast, the decline in cell number over a 2-week period was prevented and progesterone receptor levels remained elevated when these primary renal tumor cells were cultured in collagen gels. Salomon et af. (1981) reported that growth rates of rat mammary epithelial cells are comparable on plastic, type I collagen, or type IV collagen. However, the growth response of the cells to EGF and glucocorticoids varied, depending on the substratum on which the cells are plated. Cell growth was four times more sensitive to omission of EGF or glucocorticoid on type I collagen or plastic substratum than on type IV collagen substratum. N. S. Yang et af. (1981) reported a method for sustained growth and efficient transfer of human mammary epithelial cells in monolayers using thick collagen gel surface as a substrate. They state that many previous studies have used thin collagen films, but the advantage of thicker collagen layers, which prevent cell attachment to the vessel surface, lies in efficient dissociation using collagenase and subsequent cell transfers. They have also confirmed the findings reported by the Berkeley group that human mammary organoids plated within collagen gels exhibit different types of outgrowth distinguishable by their morphology. Iversen er al. (1981) reported quantification of binding and growth of chick embryo cerebral and sympathetic neurons on collagen substrates prepared by four different methods (saline precipitation, exposure to ammonium hydroxide vapor, exposure to ultraviolet light, and air drying). Scanping electron microscopy revealed that ( 1) ammonium hydroxide and saline precipitation resulted primarily in formation of collagen fibrils, (2) air drying produced a small number of fibrils plus a large amount of amorphous material, and (3) exposure to ultraviolet light only resulted in the formation of globular, nonfribrillar collagen aggregates. They demonstrated that the capacity of collagen substrates to bind and grow neurons differed markedly with the method of preparation, and neurons prefer fibrillar to globular collagen substrates. Hawrot (1980) made a similar study of the survival and development of rat sympathetic neurons using a variety of artificial and cell-derived substrata. He reported that collagen gels supported low-density cultures, whereas survival and morphological development were greatly impaired when neurons were grown on a collagen film in the absence of Methocel or on a substratum of heat-denatured collagen. Neuronal adhesion and growth on collagen substrata appear to be dependent on some aspect of the native structure of the collagen fiber since growth on heat-denatured gelatin surfaces is greatly retarded.

GROWTH OF CULTURED CELLS

257

Schor et a / . , in a series of papers, presented results dealing with attachment, proliferation, and migration using various cells cultured on collagen substrate (Schor, 1979, 1980; Schor and Court, 1979; Schor et af., 1979, 1981, 1982). They demonstrated that a crude tumor extract containing angiogenic activity in vivo was also mitogenic for endothelial cells in vitro provided that the cells were grown on a native collagen substrate in the presence of platelet-release factors (Schor et a / ., 1979). Subsequently, low-molecular-weight compound isolated from tumor extracts was also shown to be mitogenic for endothelial cells on a native collagen substrate (Schor et al., 1980). Their data suggested that the nature of the substratum affected the response of the endothelial cells to tumor angiogenesis factors. Schor also compared the proliferation of HeLa cells, BHK cells, and human skin fibroblasts on collagen films, on the surface of collagen gels, and within the three-dimensional gel matrix (Schor, 1980). The nature of the collagen environment was found to influence the proliferation of certain cell types but not of others. The migratory behavior of a number of cell types on three-dimensional collagen gels has been described in a number of papers (Schor, 1980; Schor et al., 1981, 1982). Cell migration into the collagen gels was measured by plating cells on the gel surface and then determining the percentage of cells within the three-dimensional collagen gel at various times thereafter. None of the epithelial cells examined (normal diploid, cell line, or tumor) migrated into the collagen gel, whereas all fibroblasts (normal diploid, virally transformed, and tumor) and melanoma cells did. The advantages of using three-dimensional gels of native collagen fibers for the study of tumor cell invasion compared to other experimental model systems involving artificial substrate or complex biological membranes have been pointed out (Schor et al., 1982). Zamora et al. described another system using endothelial cells cultured on top of collagen gels to explore mechanism of tumor invasion (Zamora et a l . , 1980). They allowed mammary tumor spheroids to interact with confluent monolayers of endothelial cells cultured on top of collagen gels to analyze the mechanisms of tumor embolus interaction with blood vessel walls and observed mammary tumor cells moving underneath the edges of the endothelial cells and invading the collagen matrix. Three-dimensional collagen gels have been used specifically to study morphogenesis by embedding the cells inside the matrix. Bennett used three-dimensional gel to study morphogenesis of clonal Rama 25 cells derived from a rat mammary tumor (Bennett, 1980). These cells grew and generated three-dimensional structures with branching, hollow tubules, and sometimes with bulbous ends. Based on these observations, she concluded that all the information to specify such organization resided in a single cell type. She also suggested that this can be used as a simple mammalian system in which morphogenesis can be studied as readily as in Dicpostelium. Chambard et al. (1981) reported on the

258

JASON YANG AND S . NAND1

influence of collagen gels on the orientation of the polarity of epithelial thyroid cells in culture. When the cells were embedded inside the collagen gels, they organized into three-dimensional follicle-like structures. A description of the morphogenesis of mammary epithelial cells embedded in the collagen gel matrix will be presented in the next section. Civerchia-Perez et al. (1980) described a method of quantifying the collagen contribution to cell growth. They prepared transparent hydrogels in the presence of various concentrations of soluble native collagen and evaluated growth of IMR-90 human embryonic lung fibroblasts on such substrates. They demonstrated that, without collagen, no significant growth occurred, whereas there was a dose-response curve expressing maximal cell growth against collagen concentration.

VII. Studies in Our Laboratory We have also been using collagen substrate for culturing mouse mammary epithelial cells since 1977, predominantly for differentiation purposes (Emerman er al., 1977, 1979; Emerman and Pitelka, 1977; Yang et al., 1977; Enami and Nandi, 1978; Katiyar et al., 1978; Sakai er al., 1979; Enami e r a / . , 1979; Bksbee et al., 1979; Burwen and Pitelka, 1980; Bisbee, 1981; Shannon and Pitelka, 1981). In 1979, we adopted the collagen gel as a three-dimensional culture matrix for growing mammary epithelial cells (Yang e t a / . , 1979). The limited in v i m growth capacity of primary mammary epithelial cells in conventional tissue culture dishes is a well-known phenomenon. The cells generally undergo a few rounds of division, but proliferation cannot be sustained, nor can these cells be passaged. Mouse mammary epithelial cells cultured at low density become flattened and multinucleated, and rarely attain confluence (Das er al., 1974; Hosick, 1974). Cells plated at high density are maintained well, but little growth is ever achieved. Our demonstration of differentiated function in mouse mammary cells cultured on floating collagen gels has prompted us to examine collagen as an appropriate substance for growth. The most encouraging results were obtained when mammary cells were embedded within a three-dimensional collagen gel matrix which allowed considerably more cell growth than that achieved on plastic culture dishes. The growth of mouse mammary epithelial cells occurs with a characteristic and reproducible pattern of organization. The cells rearrange themselves and produce duct-like structures extending into the matrix, resulting in a three-dimensional outgrowth (Yang er al., 1979, 1980a,c). In contrast, the three-dimensional outgrowths from human mammary epithelial cells were of varying morphologies-ranging from a duct-like appearance to a spherical mass (Yang er al.,

GROWTH OF CULTURED CELLS

259

1980c, 198la). These differences in outgrowth morphology may indicate that different cell types give rise to different colony shapes. The following observations strongly indicated that the collagen gel outgrowths are mammary epithelial in origin and not a selected cell population with loss or reduction of functional activity: 1. When embedded cells were recovered and transferred to monolayer culture, they formed a continuous sheet of polygonal cells that were indistinguishable from primary cultures of mammary epithelial cells (Yang et a/., 1979, I980c,e). 2 . Electron microscopy has shown that the typical epithelial arrangement consists of cuboidal cells around a lumen and cells joined by epithelial junctional complexes (Yang et al., 1979, 1981a) (Figs. 1 and 2). 3. Electron microscopy examination of collagen gel outgrowths derived from M-MTV positive tissues revealed that abundant immature particles bud from luminal cell surfaces or into intracytoplasmic vacuoles and mature particles often lie free within the lumen (Yang et a / . , 1979) (Fig. 1). 4. Outgrowth derived from mouse mammary epithelial cells embedded within the collagen gels can be shown to undergo differentiation in terms of casein production as measured by radioimmunoassay by switching from growth medium to differentiation medium (Flynn et al. 1982). 5. Transplantation of collagen gel outgrowths to the gland-free mammary fat pad have shown that the mammary cells retain their original phenotype (normal, hyperplastic alveolar nodule, or tumor) and are capable of responding to mammogenic and lactogenic hormones in vivo, and that when mammary tissues containing a mixture of normal and transformed cells are cultured and transplanted, they produce a mixture of normal and transformed outgrowths (Guzman et al., 1982b) (Fig. 3). All of these results taken together provide convincing evidence that the phenotypes of the cells that were cultured in collagen gel matrix were maintained and that little or no selection occurred during the extensive growth phase in culture. Utilizing this system, we have reported in a series of studies the effects of different hormones, growth factors, and tissue extracts on the growth of mouse and human mammary cells (Yang et al., 1979, 1980a,b,c,e, 1981a). These studies have been summarized (Nandi et al., 1980, 1981, 1982; Yang et al., 1980d). Recently, a serum-free medium for cultivation of mouse and human mammary epithelial cells has been developed (Imagawa et al., 1982; Yang et al., 1982~).Normal and tumor mouse mammary epithelial cells will undergo sustained growth for as long as 3 weeks in a serum-free medium supplemented with insulin, epidermal growth factor, bovine serum albumin V, and cholera toxin.

GROWTH OF CULTURED CELLS

26 1

FIG. I . (A) Electron micrograph of a thin section of an outgrowth from BALBkfC3H mammary tumor cells embedded in collagen gel. A lumen (L) and two intracellular vacuoles (V) are shown, with numerous dense, spherical, immature virions of mammary tumor virus along the membranes and at the tips of microvilli. (B) Higher magnification of the edge of a lumen in the same area as A. Two cells are joined at their apical borders by a typical epithelial junctional complex: tight junction (T), intermediate junction (I), and desmosomes (D). Note several immature virus particles at the apical cell surface and a mature particle with an eccentric angular nucleoid in the upper right comer. (Reproduced by permission from Yang et a / . . 1979.)

Deletion of insulin and/or epidermal growth factor has been found to affect the growth more than any other deletions (Imagawa et al., 1982). Preliminary results indicate that lithium stimulates the growth of normal cells and can replace EGF (Tomooka and Imagawa, 1982). The same system has also been used to grow

FIG. 2. Eiecrron micrograph of ceiis surrounding a lumen in an outgrowth derived from reduction mammopiasty tissue. The ceiis have apical microvilli, desmosomes (arrowheads), and tight junctions (arrows). (Reproduced by permission from Yang et a/. 198 la.)

.

263

GROWTH OF CULTURED CELLS

alveolar-enriched epithelial cell populations from virgin rat mammary glands (Pasco et af., 1982). These rat mammary epithelial cells responded proliferatively to mammogenic hormones in a manner consistent with the earlier findings of the synergistic effects of prolactin and progesterone. The mammary nature of the resulting outgrowths was demonstrated by the presence of thioesterase 11, a mammary epithelial cell-specific enzyme which regulates chain length in the synthesis of the medium chain fatty acids in milk fat (Pasco el a / . , 1982). In all the studies described above, mammary tissues were enzymatically dissociated to yield a preparation consisting of small clumps of cells, and these preparations were subsequently embedded within the collagen gel matrix. Recently, mouse end buds have been isolated using a dissecting microscope and a micropipetor and embedded within the collagen gel matrix to analyze the growthpromotingeffectsofsera, hormones, andgrowthfactors(Richardsetaf., 1982) (Fig. 4). The growth of individual end buds was quantitated using a computer-assisted photodensitometry system. The end buds are of interest in understanding the developmental biology of the gland since they are the growing terminal structures of the ducts in the mammary gland. The reason mammary epithelial cells have a much greater growth capacity when embedded within a collagen gel matrix is not understood. This question has recently been addressed by systematically comparing the growth of normal and neoplastic mouse mammary epithelial cells on plastic, on collagen gel, in collagen gel, and in agar (Richards er af.,1983). These studies have also included attempts to determine the effects of basal lamina components (laminin, fibronectin, and collagen type IV) on the growth of the cells either by their addition to the cultures or by blocking their production by the cell. The development of a primary culture system that allows continuous and prolonged growth of mammary epithelial cells opens up new areas of study such as mammary epithelial transformation, three-dimensional morphogenesis, and cloning (Yang et af., 1981b). Transformation of rat mammary epithelial cells with dimethylbenzanthracene in vitro has previously been accomplished in our laboratory, but the incidence of transformation was low (Richards and Nandi, 1978). A higher growth rate of cells in collagen matrix may increase the period ~

FIG. 3. ( A ) Wholemount preparation o f a mammary fat pad with normal ductal outgrowth 8 weeks after injection of C57BL virgin mouse cells cultured in collagen gels. Mice with these ductal outgrowths were mated and allowed to g o through a pregnancy (B) and/or lactation (C). ( B ) Wholemount preparation of an outgrowth from C57BL mammary cells in a pregnant host. (C) Wholemount preparation of an outgrowth from C57BL mammary cells in a lactating host. (Reproduced by permission from Guzman et a / . . 1982b.)

FIG. 3A.

See legend on p. 263.

265

m

d

% C

FIG.3C. See legend on p. 263.

FIG.4.

Phase micrograph of isolated end buds before embedding in collagen for culture. (Reproduced by permission from Richards et a/..1982.)

268

JASON YANG A N D S . NAND1

during which cells are vulnerable to transformation; once transformed, the cells would increase their number, allowing further analysis. Preliminary results, using this system, have been reported (Guzman et al., 1982a) showing that the cells exposed to carcinogens in vitro produced abnormal outgrowths that were classified as ductal dysplasias. This system has been utilized to investigate the effects of phorbal esters on the growth of normal and tumor mouse mammary epithelial cells. In addition, the possible usefulness of phorbol esters as factors enhancing the process of in vitro transformation and the emergence of transformed mammary epithelial populations has been studied (Guzman er al., 1983). Initial studies using mouse mammary epithelial cells have shown that the clumps of cells proliferate by extending star-like projections into the matrix resulting in three-dimensional outgrowths (Yang et al., 1979, 1980a,b,e). Subsequent studies using human mammary epithelial cells (Yang et af., 198Oc, 1981), rat mammary epithelial cells (Pasco et al., 1982), transplantable rat mammary tumor lines (Richards and Osborn, 1982), and mouse submandibular epithelial cells (Yang et af., 1982a,b) indicated that the three-dimensional outgrowths derived from single cells and small clumps could assume different morphologies. The outgrowths of human mammary epithelial cells ranged in morphology from a duct-like appearance to a spherical mass (Yang et al., 198Oc, 1981) (Figs. 5 and 6). Colostrums gave rise to predominantly spherical masstype outgrowths, whereas mammoplasties and mastectomies gave rise to more heterogeneous types. Similar variations were seen using four different transplantable rat mammary tumor lines (Richards and Osborn, 1982). These variations in colony morphology are not seen on plastic and may be of value in characterizing the heterogeneity within the cell population. These differences in outgrowth morphology may show that different cell types give rise to different colony shapes (Fig. 7). In the case of mouse submandibular epithelial cells, it has been demonstrated that a simple manipulation of supplements can modulate the threedimensional colony morphology in the collagen gel matrix (Yang et al., 1982a) (Fig. 8). The collagen gel matrix has been successfully used for growth of both normal and tumor mammary epithelial cells from mouse, rat, and human sources. We have recently addressed the question of whether the same culture system can be applied to study the growth of other epithelial cell types. Mouse submandibular epithelial cells can be grown in primary culture using the collagen gel matrix in both serum-containing (Yang et al., 1982b) and serum-free (Yang et al., 1982a) medium. A characteristic and reproducible pattern of growth, similar to those seen for mouse mammary epithelial cells, is the three-dimensional outgrowths with duct-like structures projecting into the matrix. Under serum-free conditions, the morphology of the resulting outgrowths can be modulated by a simple manip-

F~G.5. Outgrowths derived from human mammary epithelial cells from reduction mammoplasty. (A) Duct-like outgrowth; (B) mixed-type outgrowth; (C) spherical mass. (Reproduced by permission from Yang er a / . , 1981a.)

N

4 0

FIG. 5B. See legend on p. 269.

FIG. 5C. See legend on p. 269.

212

N

W 4

FIG.6. Histologic section of duct-like outgrowth (A) and spherical mass (B).A is reproduced by permission from Yang er al. (1981a).

FIG. 7. Outgrowths derived from human mammary epithelial cells from infiltrating ductal carcinoma. Outgrowths derived from carcinomas tend to be comprised of masses of loosely attached cells that lack intercellular attachment to one another.

215

L

P

FIG. 8B. See legend on p. 275.

GROWTH OF CULTURED CELLS

277

ulation of supplements (Yang et a l . , 1982a). The resulting outgrowths can produce epidermal growth factor in response to dihydrotestosterone (Yang et d . , 1982a,b). Preliminary results also indicate that the same system can be used for the growth of epithelial cells from mouse vagina (Iguchi et al., 1982), mouse prostate (Turner, Tomooka, and Bern, unpublished, 1982), and mouse endometrium (Ostrander and Bern, unpublished, 1982).

VIII. Conclusion Cell culture experiments have shown repeatedly during the past few decades that the use of collagen substrate enhances the extent of growth more than glass or plastic substrates (Table I). This is especially true for fastidious cell types such as certain epithelial cells which have only a very limited proliferation on plastic or glass. However, the means by which collagen influences cell behavior are not well understood, although Grobstein proposed, as early as 1953, that cell substrate plays a role in cell proliferation and morphogenesis (Grobstein, 1953a,b). A number of factors appear to be involved, however. It has been pointed out, for example, that both the shape of a cell and its orientation to neighboring cells are important in modulating the proliferative response of a cell to a mitogen. In addition, it has been observed that the substrate upon which the cells rest can influence the shape of cells. In 1964, Wessells observed that a columnar and mitotically active basal layer of chick embryonic epidermis lost both columnar appearance and mitotic activity when the dermis was separated from the epidermis (Wessells, 1964). However, the basal cells remained oriented and mitotically active if cultured in vitro on a suitable substance such as tropocollagen gel. Using a similar system, Cohen (1965) has shown that the stimulating effects of EGF on tritiated thymidine required proper orientation between epidermis and dermis. These results suggested a relation between cellular orientation, shape, and proliferation in embryonic epidermis. It has been reported that the proliferation of normal mouse fibroblasts is anchorage-dependent (Stoker et al., 1968; Dulbecco, 1970). When mouse fibroblasts are placed on plastic or glass, they attach and proliferate until confluence is reached. In contrast, when these cells are plated in suspension, they fail to proliferate. Cells attached to plastic are flat, whereas those in suspension are rounded, agair, suggesting a relation between cell shape and proliferation. In 1976, Schubert et al. reported that FGF can stimulate tritiated thymidine incorporation in anchorage-dependent L6 myoblast but not their variant which grows in suspension culture (Schubert et al., 1976). More recently, both Folkman and Gospodarowicz have reported in a series of papers that one of the primary factors regulating the mitogenic response of cells is cell shape. Folkman and co-workers have shown that cell shape is tightly

278

JASON YANG AND S . NAND1 TABLE I CELLTYPESCULTURED USINGCOLLAGEN SUBSTRATE^ LISTOF DIFFERENT Cell types

Type of collagen

Cell lines BHIU2I cells

Addition of collagen to medium HeLa, BHK cells Gel Cell lines including HeLa Gel Hamster fibrohemangiosarcoma, Gel L, HeLa Film Diploid fibroblasts (WI-38) Gel RPMI-3460 Syrian hamster melanoma cells Rama 25 cells derived from rat Gel mammary tumor MCF-7 Collagen-coated cellulose sponge Walker tumor 256 Collagen-coated cellulose sponge Several transplantable tumors Collagen-coated cellulose sponge

Neurons Cerebral and sympathetic neurons, chick embryo Sympathetic neurons, chick embryo Optic lobe neurons, chick embryo Sympathetic neurons, rat Sensory neurons, fetal rat Tumors Mammary tumors, mouse Colon carcinoma cells, human Renal tumor cells, hamster Bladder cancer. human

Liver cells Liver, human embryo Liver, human embryo Liver, human embryo Liver, human fetus and rat Liver, rat Liver, bullfrog

Reference

Sanders and Smith (1970) Schor (1980) Cleator and Beswick (1972) Cuprar and Lever ( 1974) McKeehan and Ham (1976) Schor et al. (1982) Bennett (1980) Russo et a/. (1976. 1977) Leighton et al. (1967) Leighton et al. (1968)

Film

lverson et a/. (1981)

Film Film

McCarthy and Partlow ( I976a) Hanson and Partlow (1978) Adler et a / . ( 1979)

Film and gel Film

Hawrot ( 1980) Bunge and Bunge (1978)

Gel Film Gel Collagen-coated cellulose sponge

Yang et a / . (1979, 1980a,b) Murakami and Masui ( 1980) Talley et a/. (1982) Leighton et a/. (1980)

Film Film Film Gel Film Film

Hillis and Bang (1962) Festenstein ( 1963) Zuckerman et al. (1967) Cleator and Beswick ( I 972) Alexander and Grisham (1970) Stanchfield and Yager (1978)

~

(continued)

279

GROWTH OF CULTURED CELLS TABLE I (Continued) Cell types Mammary cells Mammary epithelial Mammary epithelial Mammary epithelial Mammary epithelial

cells, mouse cells, rat cells, human cells, human

Type of collagen

Gel Film Gel Gel

Other epithelial cells Skin epithelial cells, human, rab- Gel bit, mouse Corneal epithelial cells, bovine Transitional epithelial cells, rat Collagen-coated nylon-mesh disks Thyroid epithelial cells, porcine Gel Submandibular epithelial cells, Gel mouse Miscellaneous Brain capillary endothelial cells, rat Capillary endothelial cells, bovine Preimplantation embryo, rabbit Granulocytehnacrophage progenitor cells, mouse Muscle and fibroblasts Muscle, chick embryo Muscle, chick embryo Fibroblasts, chick embryo Foreskin fibroblasts, human Kidney fibroblasts, rabbit

Reference

Yang et al. (198Oe) Salomon er. al. ( 198 1 ) J. Yang e t a / . (1981a) N.-S. Yang et al. (1981)

Karasek and Charlton (1971); Liu and Karasek ( I978a.b) Gospodarowicz et a/. (1978) Chlapowski and Haynes ( 1979) Chambard e t a / . (1981) Yang et a / . (1982a,b)

Film

Bowman et a / : (1981)

Gel Film Gel

Schor er al. (1979) Cole et a / . (1 966) Lanotte et al. (1981)

Film Gel Gel Gel Film

Hauschka and Konigsberg (1966) Gey et a / . (1974) Dunn and Ebendal (1978) Schor et al. (1981, 1982) Rucker et a / . (1972)

OFilm refers to collagen-coated surface, whereas gel refers to polymerized solid matrix of collagen. Polymerization is accomplished by exposure to ammonia (Ehrmann and Gey, 1956). photo reconstitution (Masurovsky and Peterson, 1973). or pH and salt change (Elsdale and Bard, 1972).

coupled to DNA synthesis and growth in nontransfomed cells by applying different concentrations of poly(2-hydroxyethyl methacrylate) that varied the tissue culture plastic adhesivity and thus controlling the extent of cell spreading. They then monitored DNA synthesis on cells held at graded series of quantitated cell shapes (Folkman and Greenspan, 1975; Folkman and Moscona, 1978). Gospodarowicz er al. (1978) reported that the substrate upon which the cells rest will dictate the cellular morphology, and cellular morphology can, in turn, determine the sensitivity of cells to mitogens. In organ culture, EGF is a strong mitogen for the corneal epithelium while corneal epithelial cells cultured on

280

JASON YANG AND S. NAND1

plastic tissue culture dishes are nonresponsive to EGF. In organ culture, cells remain tall and columnar, whereas the same cells in tissue culture become flat and spread out. However, corneal epithelial cells cultured on collagen-coated dishes become columnar and, at the same time, sensitive to EGF. In our studies with mammary epithelial cells in primary culture, we speculate that a number of factors such as geometry, cell shape, and basement formation may play an important role in the control of cell proliferation as well as in eliciting responsiveness to hormones and growth factors. Sustained growth of primary mammary epithelial cells may be attributed to the fact that the hydrated collagen gel matrix allows three-dimensional growth in a manner somewhat similar to the growth of epithelial cells in vivo. That is, the geometry of cell growth inside the matrix is more in vivo-like than growth on the surface of a culture dish. Recently, the growth of normal and neoplastic mouse mammary epithelial cells has been systematically compared on plastic, on collagen gel, in collagen gel, and in agar (Richards et al., 1982) in order to substantiate our earlier observation that mammary epithelial cells consistently grew better when embedded within a collagen gel matrix. Cells plated on top of collagen gel and those embedded within the collagen gel have the same initial growth rate. On top of collagen gels, cells grow two dimensionally as expanding disks, whereas cells embedded within the collagen gel grow three dimensionally with many projections. Autoradiographs of cells exposed to tritiated thymidine for 24 hours at various times during the 2-week culture period showed that colonies growing on top of collagen labeled most heavily at their outer border while the colonies growing inside the collagen gel tended to label most heavily at their periphery (Richards et al., 1982). Because of the three-dimensional nature of the colonies inside the collagen gel, a greater proportion of the cells i s found near the outer borders of the colony than is found in a two-dimensional colony on the surface of the collagen gel. Thus, a greater percentage of cells will remain engaged in growth in a colony inside the gel than in a comparably sized one on the surface of the gel. We believe that for cell types which normally grow in three-dimension in vivo (such as mammary epithelial cells), growth enhancement is best accomplished when cells are embedded within the collagen gel matrix. In contrast, for cell types which normally grow in two dimension in vivo (such as endothelial cells), growth is best when cells are cultured on the surface of collagen gel surfaces. Besides providing a favorable geometrical environment for mammary epithelial cell growth (three-dimensional growth) the collagen gel matrix may also affect cell shape in a way that allows them to sustain growth. Mouse mammary epithelial cells cultured on collagen substrate achieve a configuration which is much more tissue-like than in a culture spread out on plastic (Emerman and Pitelka, 1977; Emerman et al., 1979; Shannon and Pitelka, 1981). As already stated, evidence is now accumulating from the use of other systems showing that

GROWTH OF CULTURED CELLS

28 1

there is an intimate relation between cell shape and proliferation (Wessels, 1964; Cohen, 1965; Folkman and Moscona, 1978; Gospodarowicz et al., 1978). The superiority of the collagen substrate, whether used as surface or as matrix culture, over plastic may lie in its ability to allow cells to produce a basement membrane. Electron microscopy has shown the formation of a basement membrane by mouse mammary cells cultured on collagen substrate but not on plastic (Emerman and Pitelka, 1977). The importance of the basement membrane deposition for the growth of rat mammary epithelial cells has been demonstrated in a series of papers by Kidwell and co-workers using cis-hydroxyproline to clock collagen type IV deposition and observing the inhibitory effect on growth (Wicha et al., 1979, 1981; Liotta et al., 1979; Lewko et al., 1981). In addition, it is believed that the well-known mesenchyme-epithelium interactions in proliferation and morphogenesis during the embryonic development involves, in part, secretion, either by mesenchyme or by the epithelium, of basement membrane upon which the epithelium rests (Hay, 1977). At this time, serum-free collagen gel primary culture of mammary epithelium is the only culture system allowing prolonged, multifold growth in which exogenously added hormones can be tested for their direct mitogenicity and subsequent differentiation, and morphogenesis can be analyzed all in a single system. We believe that this system has considerable advantages over the other existing systems. Serum-free primary cultures, using the plastic tissue culture dishes, have been reported for mouse (Medina and Osborn, 1980) and rat (Salomon et al., 1981) mammary epithelial cells, but the extent of growth was less than that accomplished with the collagen gel matrix system or fibroblast feeder layers. Wicha et al. (1982) reported use of biomatrix to promote extensive growth of rat mammary epithelium and subsequent differentiation, but this was accomplished under serum-containing conditions. Human mammary cells have been shown to undergo considerable growth in the presence of conditioned media and, more recently, clonal growth with the use of both fibroblast feeder layers and conditioned media (Stampfer er al., 1980; Smith et al., 1981). However, development of chemically defined conditions in these systems will require a more defined substrate than the feeder layer as well as the isolation of growth-promoting factors from the feeder layer and the conditioned media. Another advantage of collagen gel over feeder layers, extracellular matrix (Gospodarowicz et al., 1978), or biomatrix (Rojkind er al., 1980; Wicha et al.. 1982) lies in its chemical simplicity. Although it will not be dealt with in detail in this article, it should be mentioned that there have been numerous reports of growth of cultured cells using extracellular matrix (reviewed in Gospodarowicz et al., 1978; Gospodarowicz and 111, 1980) and biomatrix (Rojkind et al., 1980; Wicha et al., 1982). The exact nature and composition of these materials are still to be elucidated, but they are composed in large part of collagen. More complex matrices can be created by incorporation into collagen gel of matrix proteins such

282

JASON YANG AND S. NAND1

as fibronectin and laminin, as well as cell types other than the ones under investigation. This also allows an assessment of the contribution made by the additional component to cell growth. Finally, three-dimensional expression of cultured mammary epithelial cells in the collagen gel matrix may provide conditions more like those found in vivo for the study of mammogenesis, lactogenesis, and carcinogenesis. As already mentioned in the previous section, this culture system may also be applied to studies of transformation, morphology, and cloning of mammary epithelium, in addition to proliferation and differentiation. It can also be used in studies of nonmammary epithelial cells. Preliminary results of these applications have indicated that the system opens up studies which heretofore have been limited by use of the conventional primary culture.

ACKNOWLEDGMENTS The authors thank Professor S. R. Wellings of the Department of Pathology, University of California, Davis for providing space in his laboratory during the writing of this manuscript. We thank Drs. J . Richards and R. C. Guzman for their critical reading of the manuscript, I . Underhill for photographic assistance, and S. Castillo for clerical assistance. This investigation was suppofled by Grant CA05388, awarded by the National Cancer Institute, DHHS.

REFERENCES Abaza, N. A., Leighton, J., and Zajac, B. A. (1978).Cancer 42, 1364-1374. Adler, R., Manthorpe, M., and Varon, S. (1979).Dev. Biol. 69,424-435. Alexander, R. W., and Grisham, J . W. (1970).Lab. Invesr. 22, 50-62. Bard, M.C., Gabrion. I., and Mauchamp, J. (1981).J . CellBiol. 91, 157-166. Bell, E., Ivarsson, B., and Merrill, C. (1979).Proc. Narl. Acad. Sci. U.S.A. 76, 1274- 1278. Bellows, C.G., Melcher, A. H.,and Aubin, J. E. (1981).J . Cell Sci. 50, 299-314. Bennett, D. C. (1980).Nature (London) 285, 657-659. Bisbee, C. A. (1981).Am. J . Physiol. 240, C110-Cl15. Bisbee, C. A., Machen, T.E., and Bern, H. A. (1979).Proc. Narl. Acad. Sci. U.S.A. 76,536-540. Bissell, M. J. (1981).Inr. Rev. Cyrol. 70, 27-100. Bornstein, M. B. (1958).Lab Invest. 7, 134-137. Bornstein, P., and Sage, H. (1980).Annu. Rev. Biochem. 49, 957-1003. Bowman, P. B., Betz, A. L., Ar,D., Wolinsky, J. S., Penney, J . B., Shivers, R. R., andGoldstein, G. W. (1981).In Virro 17, 353-362. Bruns, R. R., and Gross, 1. (1980).Exp. Cell Res 128, 1-7. Bunge, R. P., and Bunge, M. B. (1978).Cell Biol. 78, 943-950. Bunven, S. J., and Pitelka, D. R. (1980).Exp. Cell Res. 126, 249-262. Chambard, M., Gabrion, J . , and Mauchamp. J . (1981). J . Cell Biol. 91, 157-166. Chazov, E. I., Alexeev, A. V., Antonov, A. S . , Koteliansky, V. E., Leytin, V. L., Lyubimava, E.

GROWTH OF CULTURED CELLS

283

V., Repin. V. S., Sviridov. D. D., Torchilin, V. P., and Smirnov, V. N. (1981).Proc. Narl. A ~ a d Sci. . U.S.A. 78, 5603-5607. Chlapowski, F. J., and Haynes, L. (1979).J . Cell Biol. 83, 605-614. Civerchia-Perez, L., Faris, B., LaPointe. G., Beldekas. J., Leibowitz, H., and Franzblau, C. (1980).Proc. Narl. Acad. Sci. U.S.A. 77, 2064-2068. Cleator, G. M., and Beswick, T. S. (1972).Cyrobios 5, 231-239. Cohen. S . (1965).Dev. Biol. 12, 394-407. Cole, R. J.. Edwards, R. G.. and Paul, J. (1966).Dev. Biol. 13, 385-407. Cuprar, L. J., and Lever, W. F. (1974).Proc. Soc. Exp. Biol. Med. 146, 309-315. Das, N. K.,Hosick, H. L., and Nandi, S. (1974).J. Narl. Cancer Insr. 52, 849-861. Dickey, W. D., and Seals, C. M. (1981).Cancer Res. 41, 4027-4030. Dulbecco, R. (1970).Nature (London) 227, 802-806. Dunn, G. A . , and Ebendal, D. T. (1978).Exp. Cell Res. 111, 475-479. Ehrmann, R. L., and Gey, G. 0. (1956).J . Narl. Cancer Inst. 16, 1375-1390. Elsdale, T., and Bard, J. (1972).J. Cell Biol. 54, 626-637. Emerman, J. T., and Pitelka, D. R. (1977).In Vitro 13, 316-328. Emerman. J. T., Enami. J., Pitelka, D. R., and Nandi, S. (1977).Proc. Narl. Acad. Sci. U.S.A. 74, 4466-4470. Emerman, J. T., Bunven, S. J., and Pitelka, D. R. (1979).Tissue Cell 11, 109-1 19. Enami, J., and Nandi, S. (1978).J . Dairy Sci. 61, 729-732. Enami, J., Yang, J., and Nandi, S. (1979).Cancer Lerr. 6, 99-105. Festenstein, H. (1963).Nurure (London) 981-983. Fisher, M..and Solursh, M. (1979).Exp.CellRes. 123 1-14. Flynn, D., Yang, J., and Nandi, S. (1982).Diferenriution 22, 191-194. Folkman, J., and Greenspan, H. P. (1975).Biochim. Biophys. Acra 417, 21 1-236. Folkman, J., and Moscona, A. (1978).Nature (London) 273, 345-349. Gey, G. 0.(1954).Harvey Lecr. Ser. L pp. 154-229. Gey, G. 0.. Svoltelis, M., Foard, M., and Bang, F. B. (1974).Exp. Cell Res. 84, 63-71. Gospodarowicz. P., and 111, C. R. (1980).Proc. Narl. Acad. Sci. U.S.A. 77, 2726-2730. Gospodarowicz, P., Greenburg, G., and Birdwell, C. R. (1978).Cancer Res. 38, 4155-4171. Greenberg. J. H., Seppa, S., Seppa, H., and Hewitt, A. T. (1981).Dev. B i d . 87, 259-266. Grinnell, F., and Bennett, M. H. (1981).J. Cell Sci. 48, 19-34. Grobstein. C. (1953a).Exp. Zool. 124, 383-388. Grobstein, C. (1953b).Nurure (London) 172, 869-871. Grotendorst, G . R., Sepa, H. E. J., Kleinman, H. K., and Martin, G. R. (1981).Proc. Narl. Acad. Sci. U.S.A. 78, 3669-3672. Guzman, R., Osborn, R. C., and Richards, J. (1981).Proc. Annu. Meer. Am. Assoc. Cancer Res. 22, 56. Guzman, R., Osborn, R. C., and Nandi, S. (1982a).Proc. Annu. Meer. Am. Assoc. Cancer Res. 23, 78. Guzman, R. C., Osborn, R. C., Yang, J., DeOme, K. B., and Nandi, S. (1982b).Cancer Res. 42, 2376-2383. Guzman, R. C., Osborn, R. C., Richards, J. E., and Nandi, S. (1983).Submitted. Hanson, G. R., and Partlow, L. M. (1978).Brain Res. 159, 195-210. Harris, A. K,.Stopak, D., and Wild, P. (1981).Nature (London) 290, 249-251. Hauschka. S. D., and Konigsberg, I. R. (1966).Proc. Narl. Acad. Sci. U.S.A. 55, 119-126. Hay, E. D. (1977).In “International Cell Biology” (B. R. Brinkley and K. R. Porter, eds.), pp. 50-57. Rockefeller University Press, New York. Hillis, W. D., and Bang, F. B. (1962).Exp. Cell Res. 26, 9-36.

284

JASON YANG AND S. NAND1

Hosick, H. L. (1974). Cancer Res. 34, 259-261. Hawrot, E. (1980). Dev. B i d . 74, 136- 15 1. Iguchi, T., Tomooka, Y., Bern, H. A., and Mills, K. T. (1982). Proc. Annu. Meet. Am. Assoc. Cancer Res. 23, 236. Imagawa, W., Tomooka, Y., and Nandi, S. (1982). Proc. Natl. Acad. Sci. U.S.A. 79,4074-4077. Iverson, P. L., Partlow, L. M., Stensons, L. J., and Moatamed. F. (1981). In Vitro 17, 540-552. Iwig. M., Glaesser, D., and Bethge, M. (1981). Exp. Cell Res. 131, 47-55. Karasek, M. A. (1968). J. Invest. Dermatol. 51, 247-252. Karasek. M. A., and Charlton, M. E. (1971). J. Invest. Dermarol. 56, 205-210. Katiyar, V. N., Enami, J., and Nandi, S. (1978). In Vitro 14, 771-774. Kleinman, H. K., Klebe, R. J., and Martin, G. R. (1981). J. Cell B i d . 88, 473-485. Lanotte, M., Schor, S.. and Dexter, T. M. (1981). J . Cell. Physiol. 106, 269-277. Leighton, J. (1951). J . Narl. Cancer Inst. 12, 545-561. Leighton, J. (1968a). In “The Proliferation and Spread of Neoplastic Cells” (E. Frei. ed.), pp. 533-553. Annu. Symp. M. D. Anderson Hospital. Williams & Wilkins, Baltimore, Maryland. Leighton, J. (1968b). Merhods Cancer Res. 4, 86-124. Leighton, J. (1973). In “Tissue Culture Methods and Applications” (P. F. Kruse, Jr. and M. K, Patterson, Jr., eds.), pp. 367-371. Academic Press, New York. Leighton, J., Justh, G., Esper, M., and Kronenthal, R. L. (1967). Science 155, 1259-1261. Leighton, J., Mark, R., and Justh, G. (1968). Cancer Res. 28, 286-296. Leighton, J . , Tchao, R., Stein, R., and Abaza, N. (1980). Methods Cell Biol. 21B, 287--307. Lewko, W. M., Liotta, L. A., Wicha, M. S., Vonderhaar, B. K., and Kidwell, W. R. (1981). Cancer Res. 41, 2855-2862. Liotta, L. A., Vembu, D., Kleinman, H. K., Martin, G. R., and Boone, C. (1978). Nature (Loodon) 272, 622-624. Liotta, L. A., Wicha, M. S . , Foidart, J. M., Rennard, S. 1.. Garbisa, S., and Kidwell, W. R. (1979). Lab. Invesr. 41, 511-518. Liu, S.-C., and Karasek, M. (1978a). J . Invest. Dermatol. 70, 288-293. Liu, S.-C., and Karasek, M. (1978b). J. Invest. Dermatol. 71, 157-162. McCarthy, K. D., and Partlow, L. M. (1976a). Brain Res. 114, 391-414. McCarthy, K. D., and Partlow, L. M. (1976b). Brain Res. 114, 415-426. Mclntyre, L. J . , Kleinman, H. K., Martin, G. R., and Kim, Y. S. (1981). Cancer Res. 41, 3296-3299. McKeehan, W. L., and Ham, R. G. (1976). J. Cell Biol. 71, 727-734. Masurovsky, E. B., and Peterson, E. R. (1973). Exp. Cell Res. 76, 447-448. Medina, D., and Osborn,C. J. (1980). Cancer Res. 40,3982-3987. Murakami, H., and Masui, H. (1980). Proc. Narl. Acad. Sci. U.S.A. 77, 3464-3468. Murray, I. C., Stingl, G., Kleinman, H. K., Martin, G. R., and Katz, S. 1. (1979). J . CellBiol. 80, 197-202. Nandi, S., Yang, I., Richards, J., Guzman, R., Rodriguez, R., and Imagawa, W. (1980). In “Hormones, Adaptation and Evolution” (S. Ishii, T. Hirano, and M. Wada, eds.), pp. 145-155. Japan Scientific Societies Press, Tokyo. Nandi, S., Yang, J., Richards, J., and Guzman, R. (1981). In “Banbury Report 8: Hormones and Breast Cancer” (M. C. Pike, P. K. Siiteri, and C. W. Welsch, eds.), pp. 445-456. Cold Spring Harbor Lab., Cold Spring Harbor, New York. Nandi, S., Imagawa, W., Tomooka, Y., Shiurba, R., and Yang, J. (1982). i n “Cold Spring Harbor Conferences on Cell Proliferation-Growth of Cells in Hormonally Defined Media” (G. H. Sato, A. R. Pardee, and D. A. Sirbasku, eds.), Vol. 9, pp. 779-788. Cold Spring Harbor Lab., Cold Spring Harbor, New York. Ohara, P. T., and Buck, R. C. (1979). Exp. Cell Res. 121, 235-249.

GROWTH OF CULTURED CELLS

285

Pasco, D.. Quan. A., Smith, S., and Nandi, S. (1982). Exp. Cell Res. 141, 313-324. Richards, J., and Nandi. S. (1978). Proc. Natl. Acad. Sci. U . S . A . 75, 3836-3840. Richards, J . , and Osborn, R. (1982). Proc. Annu. Meer. Am. Assoc. Cancer Res. 23, 233. Richards, J., Guzman, R., Konrad, M., Yang, J., and Nandi, S. (1982). Exp. Cell Res. 141, 433-443. Richards, J., Pasco, D., Yang, J., Guzman, R., and Nandi, S. (1983). Submitted. Rojkind, M., Gatmaitan, Z., Mackensen, S., Giambrone, M.-A,, Ponce, P., and Reid, L. M. (1980). J . Cell Biol. 87, 255-263. Rucker, I . , Kettrey, R., and Zeleznick, L. D. (1972). Proc. Soc. Exp. Biol. Med. 139, 749-752. Russo, J., Soule, H. D., McGrath, C., and Rich, M. A. (1976). J. Narl. Cancerlnsr. 56, 279-282. Russo, J., Bradley, R. H., McGrath, C., and Russo, 1. H. (1977). Cancer Res. 37, 2004-2014. Sakai, S., Bowman, P. D., Yang, J., McCormick, K., and Nandi, S. (1979). Endocrinology 104, 1447- 1449. Salomon, D. S., Liotta, L. A., and Kidwell, W. R. (1981). Proc. Nail. Acad. Sci. U . S . A . 78, 382-386. Sanders, F. K., and Smith, J. D. (1970). Nature (London) 227, 513-515. Schor. A. M., Schor, S. L., and Kumar, S. (1979). Ini. J . Cancer 24, 225-234. Schor, A. M., Schor, S. L., Weiss, J. B., Brown, R. A,, Kumar, S., and Phillips, P. (1980). Br. J . Cancer 41, 790. Schor, S. L. (1979). J. Cell Sci. 40, 271-279. Schor, S. L. (1980). J. Cell Sci. 41, 159-175. Schor. S. L., and Court, J. (1979). J. Cell Sci. 38, 267-281. Schor, S. L., Schor, A. M., and Bazill, G. W. (1981).J. CellSci. 48, 301-314. Schor, S. L., Schor, A. M., Winn, B.. and Ruston, G . (1982). Ini. J . Cancer 29, 57-62. Schubert, D., Lacorbiere, M., and Watson, J. (1976). Nature (London) 264, 266-267. Shannon, J. M.,and Pitelka, D. R. (1981). In Viiro 17, 1016-1028. Smith, H. S., Lau, S., Ceriani, R., Hackett, A. J., and Stampfer, M. R. (1981). Cancer Res. 41, 4637-4643. Stampfer, M. R., Hallowes, R. C . , and Hackett, A. J. (1980). In Vitro 16, 415-425. Stanchfield, J. E., and Yager, J. D., Jr. (1978). Exp. CellRes. 116, 239-252. Stoker, M., O’Neill, C., Benyman, S., and Waxman, V. (1968). Inr. J. Cancer 3, 683-693. Talley, D. J., Roy, W. A,, and Jonathan, J. W. (1982). In Virro 18, 149-156. Termine, J. D., Kleinman, H. K., Whitson, S. W., Conn, K. M., McGarvey, M. L., and Martin, G. R. (1981). Cell 26, 99-105. Tomooka, Y., and Irnagawa, W. (1982). Proc. Annu. Meer. Am. Assoc. Cancer Res. 23, 231. Wessels, N. K. (1964). Proc. Natl. Acad. Sci. U . S . A . 52, 252-259. Wicha, M. S., Liotta, L. A., Garbish, S., and Kidwell, W. R. (1979). Exp. CellRes. 124, 181-190. Wicha, M. S., Liotta, L. A., Lewko, W. M., and Kidwell, W. R. (1981). Cancer Leu. 12, 9-21. Wicha, M., Lowrie, G . , Kohn, E., Bagavandoss, P., and Mahn, T. (1982). Proc. Narl. Acad. Sci. U.S.A. 79, 3213-3217. Yang, J., Enami, J., and Nandi, S. (1977). Cancer Res. 37, 3644-3647. Yang, J., Richards, J.. Bowman, P., Guzman, R.. Enami, J., McCormick, K., Hamamoto, S., Pitelka, D., and Nandi, S. (1979). Proc. Narl. Acad. Sci. U.S.A. 76, 3401-3405. Yang. J., Guzman, R., Richards, J., and Nandi, S. (1980a). In Virro 16, 502-506. Yang, J., Guzman, R., Richards, J.. Imagawa, W., McCormick, K., and Nandi, S. (1980b). Endocrinology 107, 35-41. Yang, J., Guzman, R., Richards, J., Jentoft, V., DeVault, M. R., Wellings, S. R., and Nandi, S. (1980~).J. Narl. Cancer Insr. 65, 337-343. Yang, J., Richards, J., Guzman, R., and Nandi. S. (1980d). In “Cell BiologyofBreast Cancer” (C. M. McCrath, M. J. Brennan, and M. A. Rich, eds.), pp. 217-231. Academic Press, New York.

286

JASON YANG AND S. NAND1

Yang, J., Richards, J., Guzman, R.,Imagawa, W., and Nandi, S. (1980e). Proc. Narl. Acatl. Sci. U.S.A. 77, 2088-2092. Yang, J., Elias, J. J., Petrakis, N. L., Wellings, S. R., and Nandi, S. (1981a). Cancer Res. 41, 1021- 1027. Yang, J., Larson, L., and Flynn, D. (1981b). Proc. Annu. Meet. Am. Assoc. Cancer Res. 22, 40. Yang, J., Larson, L., and Nandi, S. (1982a). Exp. Cell Res. 137, 481-486. Yang, 1.. Flynn, D. L., Larson, L., and Hamamoto. S. (1982b). I n V i m 18, 435-442. Yang, J., Larson, L., Flynn, D., Elias, J., and Nandi, S. (1982~).Cell Biol. Int. Rep. 6,969-975. Yang, N.-S.,Kube, D., Park, C., and Furmanski, P. (1981). Cancer Res. 41, 4093-4100. Yoshizato, K.,Obinata, T., Huang, H.-Y., Matsuda. R., Shioya, N., and Miyata, T. (1981) Dev. Growth Differ. 23, 175-184. Zamora, P. O., Danielson, K. G . , and Hosick, H. L. (1980). Cancer Res. 40, 4631-4639. Zuckerman, A. J., Alwen, J., and Fulton, F. (1967). Narure (London) 214, 606-608.

Index

A

Cap. mRNA leader sequence and, 72-74 Carbon monoxide atmospheric sinks, 3-4 sources, 2-3 bacteria utilizing, 4 nonutilitarian, 5, 11-14 utilitarian, 5-1 I , 14-21 environmental significance of bacteria utilizing, 24-25 oxidation, applications of,25-26 physiology of oxidation CO as carbon and energy source, 21-24 mechanism of, 11-21 Cell(s) boundary shortening model in a tissue, 2 17-227 application to dynamic changes of cellular pattern, 227-233 intracellular contractile systems, 216-217 fundamental consideration of tension and shape polygonal pattern with minimum boundary length, 242-244 tension for maintaining constant shape. 240-24 I growth in culture using collagen early studies, 250-25 I studies in 1960s. 25 I studies in 1970s. 251-254 studies in 1980s. 255-258 studies in authors' laboratory, 258-277 three-dimensional culture system-early studies, 254-255 representation by points application of cell aggregate model to dynamic changes of cell patterns, 204-2 I6

Amino acid(s), receptors for, 41-42

B Bacteria adaptation in absence of methylation, 60-61 control of methylation, 58-60 functional role for CheB modification, 61-63 carbon monoxide-utilizing, 4 nonutilitarian. 5 utilitarian. 5-1 I chemotaxis, excitatory link and, 50-52 components and features of sensory system, 36-37 adaptation. 38-39 adaptation and bacterial memory, 39-40 excitation, 37-38 motility of, 35-36 as sensory cells, 34-35 sensory transduction in chemotaxis, scope of review, 33-34 structure of transducers in chemotaxis homologies and analogies among transducer genes and their products, 56-58 multiple methylation and CheB modification, 52-56 Blood-testis barrier, in nonrnammalian and invertebrate testes, I76 C

Cancer. cell cycle and, 149-150 comments and support, 150-153 287

288

INDEX

approximation of cell aggregate model to actual cellular patterns, 200-204 cell aggregate model, 194-200 properties of some cells, 192-194 states in tissues: epithelium-like or not discrimination of cellular patterns, 233-236 epithelium-like state of cells, 238-240 formation of epithelium-like cell sheets, 236-237 Cell cycle aspects of cancer and, 149-150 comments and support, 150-153 aspects of psoriasis and, 146-147 comments and support, 147-149 Cell junctions, in epithelial lining of excurrent duct, 178 ductuli efferentes, 179- 183 ductus deferens, 186-188 epididymis, 183- 186 rete testis, 179 tubuli recti, 179 Chemotaxis, see also under Bacteria pathways for unconventional excitation and adaptation, 63-64 Collagen, use as substrate in growth of cultured cells early studies, 250 studies in 1960s. 251 studies in 1970s. 251-254 studies in 1980s, 255-258 studies in authors’ laboratory, 258-277 three-dimensional culture system-early studies, 254-255 Cytogenetics, of fragile X chromosome lymphocytes, 118- 122 other cells, 122-124

D Ductuli efferentes, cell junctions in epithelial lining of, 179-183 Ductus deferens, cell junctions in epithelial lining of, 186-188

E Epididymis, cell junctions in epithelial lining of, 183-186

Excurrent duct, cell junctions in epithelial lining of, 178 ductuli efferentes, 179- 183 ductus deferens, 186- 188 epididymis, 183- 186 rete testis. 179 tubuli recti, 179

F Females, fragile X chromosome phenotype in, 134-135 Fragile X chromosome clinical aspects, 127- 128 genetic counseling and prenatal diagnosis, 136-137 phenotype in females, 134- 135 phenotype in males, 128-134 treatment, 135- 136 cytogenetics of lymphocytes, 118-122 other cells, 122- I24 genetics of, 124-127 karyotype-genotype relationship, 137- I38 nature of, 108-1 12 tissue culture conditions and, I 12- I I7

G Genetic counseling, fragile X chromosome and, 136-137 Genetics, of. fragile X chromosome, 124- 127

I Intercellular junctions, between Sertoli cells blood-testis barrier in nonmammalian and invertebrate testes, I76 development, 172-174 experimental and histopathological aspects, 176-178 specialization with spermatogenic cell, 175-176 structure, 165-172

K Karyotype-genotype relationship, fragile X chromosome and, 137- I38

289

INDEX

L Leader sequence, of mRNA functions of cap, 83-86 functions of S’noncoding region, 86-9 1 scanning model for initiation of protein synthesis, 91-93 Lymphocytes, cytogenetics of fragile X chromosome and, 1 18- I22

M Males, fragile X chromosome phenotype in, 128-134 Messenger RNA leader sequence cap and, 72-74 functional significance of, 83-93 5’ noncoding region, 74-82 trailer sequence functional significance of, 100- 102 3’ noncoding region, 93-97 poly(A) tail and, 97 synthesis of, 98-100

R Receptors, conventional, 40-41 for amino acids, 41-42 stimuli not mediated by, 45-49 for sugars, 42-45 Rete testis, cell junctions in epithelial lining of, 179

s Sertoli cells, intercellular junctions between blood-testis barrier in nonmammalian and invertebrate testes, I76 development, 172- 174 experimental and histopathological aspects, 176-178 structure, 165- 172 Sinks, for atmospheric CO, 3-4 Sources, of atmospheric CO, 2-3 Sugars, receptors for, 42-45 Spermatogenic cell, Sertoli cell and, 175-176

T

N 3’ Noncoding region, of mRNA, 93-97 5’ Noncoding sequence, of mRNA primary structure, 74-78 secondary structure, 78-79 synthesis of. 79-83

P Prenatal diagnosis, of fragile X chromosome and, 136-137 Psoriasis cell cycle and, 146-147 comments and support. 147-149 proliferative responses to therapy, 154 comments and support, 154-156

Therapy psoriatric proliferative responses to, 154 comments and support, 154- I56 tumor proliferative responses to, 156- 157 comments and support, 157-160 Trailer sequence, of mRNA functional significance of, 100- 102 3‘ noncoding region, 93-97 poly(A) tail, 97 synthesis of, 98-100 Treatment, for fragile X chromosome. 135-136 Tubuli recti, cell junctions in epithelial lining of, 179 Tumor. proliferative responses to therapy, 156-157 comments and support, 157-160

This Page Intentionally Left Blank

Contents of Recent Volumes and Supplements Volume 72

Volume 70

*

Cycling Noncycling Cell Transitions in Tissue Aging, Immunological Surveillance, Transformation, and Tumor GrowthSEYMOUR GRLFANT The Differentiated State of Normal and Malignant Cells or How to Define a “Normal” Cell in Culture-MINA J. BISSELL On the Nature of Oncogenic Transformation of Cek-GERALD L. CHAN Morphological and Biochemical Aspects of Adhesiveness and Dissociation of Cancer AND YASUJI ISHIMARU Ceb-HlDEO HAYASHI The Cells of the Gastric Mucosa-HERBERT F. HELANDER Ultrastructure and Biology of Female Gametophyte in Flowering Plants-R. N. KAPlL AND A. K. BHATNAGAR INDEX

Microtubule-Membrane Interactions in Cilia and Flagella-WILLIAM L. DENTLER The Chloroplast Endoplasmic Reticulum: Structure, Function, and Evolutionary Significance-SARAH P. GIBES DNA Repair-A. R. LEHMANN AND P. KARRAN Insulin Binding and Glucose Transport-RusSELL HILE LAURIE K . SORGE. AND ROGERJ. GAY Cell Interactions and the Control of Development in Myxobacteria Populations-DAVID WHITE Ultrastructure, Chemistry, and Function of the Bacterial Wall-T. J. BEVERIDGE INDEX

Volume 73

Protoplasts of Eukaryotic Algae-MARTHA D. BERLINER Integration of Oncogenic Viruses in Mammalian Polytene Chromosomes of PhtS-WALTER NAGL Celh-cARLO M. CROCE Mitochondria1 Genetics of Paramecium aure- Endosperm-Its Morphology, Ultrastructure, and Histochemistry-S. P. BHATNAGAR AND lia-G. H. BEALEAND A. TAIT VEENASAWHNEY Histone Gene Expression: Hybrid Cells and The Role of Phosphorylated Dolichols in MemOrganisms Establish Complex Controlsbrane Glycoprotein Biosynthesis: Relation to PHILLIP HOHMANN Cholesterol Biosynthesis-JOAN TUGENGene Expression and Cell Cycle RegulationDHAFT MILLSAND ANTHONY M. ADAMANY STEVEN J. HOCHHAUSER. JANETL. STEIN. AND Mechanisms of Intralysosomal Degradation with GARYS. STEIN Special Reference to Autophagocytosis and The Diptera as a Model System in Cell and Heterophagocytosis of Cell OrganellesMolecular Biology-ELENA c . ZEGARELLIHANSGLAUMANN. JANL. E. ERICSSON. AND SCHMIDT A N D REBAGOODMAN LOUISMARZELLA Comments on the Use of Laser Doppler Techniques in Cell Electrophoresis: Reply to Pret- Membrane Ultrastructure in Urinary TubulesLELIOORCI.FABIENNE HUMBERT.DENNIS low and Pretlow’s Review-JOEL H. KAPBROWN.AND ALAINPERRELET LAN AND E. E. UZClRlS Comments on the Use of Laser Doppler Tech- Tight Junctions in Arthropod Tissues-NANCY J. LANE niques as Represented by Kaplan and Uzgiris: Reply to Kaplan and Uzgiris-THOMAS G . Genetics and Aging in Protozoa-JOAN SMITHSONNEBORN PRETLOW II A N D THERESA P. PRETLOW Volume 71

INDEX

INDEX

29 1

292

CONTENTS OF RECENT VOLUMES AND SUPPLEMENTS

Volume 74

Organization and Expression of Viral Genes in Adenovirus-Transformed Cells-S. J. FLINT The Plasma Membrane as a Regulatory Site in Highly Repeated Sequences in Mammalian Growth and Differentiation of NeuroblasGenomes-MAXINE F. SINGER tOma Ce~~S-~IEGFRIEDw . DE LAATAND Moderately Repetitive DNA in EvolutionPAUL T. VAN DER SAAG ROBERT A. BOUCHARD Mechanisms That Regulate the Structural and' Structural Attributes of Membranous Orgarielles Functional Architecture of Cell Surfacesin BaCteria-cHARLES C. REMSEN JANETM. OLIVER AND RICHARD D. BERLIN Separated Anterior Pituitary Cells and Their ReGenome Activity and Gene Expression in Avian sponse to Hypophysiotropic HormonesErythroid Celk-KARLEN G. GASARYAN CARLDENEF.Luc SWENNEN. AND MARIA Morphological and Cytological Aspects of Algal ANDRIES Cakification-MICHAEL A. BOROWITZKA What Is the Role of Naturally Produced Electric Naturally Occurring Neuron Death and Its RegCurrent in Vertebrate Regeneration and Healulation by Developing Neural P a t h w a y s hg?-RICHARD B. BORGENS TIMOTHY J. CUNNINGHAM Metabolism of Ethylene by PIantS-JOHN AND The Brown Fat Cell-JAN NEDERGAARD A. HALL DODDSAND MICHAEL OLOVLINDBERG INDEX INDEX

Volume 77 Volume 75 Calcium-Binding Proteins and the Molecular Mitochondria1 Nuclei-TsuNEYosHI KUROIWA Basis of Calcium Action-LINDA J. VAN Slime Mold kCtinS-JAMES R. BARTLES.WILELDIK.JOSEPHG. ZENDEGUI, DANIEL R. .MARLIAM A. FRAZIER. AND STEVEN D. ROSEN SHAK. AND D. MARTIN WATTERSON Lectin-Resistant Cell Surface Variants of EuGenetic Predisposition to Cancer in Man: In karyotic Ceh-EvE BARAKBRILES Virro Studies-LEVY KOPELOVICH Cell Division: Key to Cellular Morphogenesis in Membrane Flow via the Golgi Apparatus of the Fission Yeast, SchizosaccharomycesHigher Plant Cells-DAVID G. ROBINSON BYRON F. JOHNSON.GODEB. CALLWA. BONG AND UDO KRISTEN Y. Yoo. MICHAEL ZUKER,AND IANJ. McDoCell Membranes in Sponges-WERNm E. G. NALD MULLER Microinjection of Fluorescently Labeled ProPlant Movements in the Space Environmentteins into Living Cells, with Emphasis on DAVIDG. HEATHCOTE Cytoskeletal Proteins-THOMAS E. KREIS Chloroplasts and Chloroplast DNA of AcerabuAND WALTER BIRCHMEIER laria medirerranea: Facts and HypothesesEvolutionary Aspects of Cell DifferentiationANGELA LUTTKEAND SILVANO BONOTTCI R. A. FLICKINGER Structure and Cytochemistry of the Chemical Structure and Function of Postovulatory FolliSynapSeS-sTEPHEN MANALOV AND WLADIcles (Corpora Lutea) in the Ovaries of NonMIR OVTSCHAROFF mammalian Vertebrates-SRINlvAS K. INDEX SAIDAPUR INDEX

Volume 78 Volume 76 Cytological Hybridization to Mammalian Chromosomes-ANN s. HENDERSON

Bioenergetics and Kinetics of Microtubule and Actin Filament Assembly-DissassemblyTERRELL L. HILLAND MARCW. KIRSCHNER

CONTENTS OF RECENT VOLUMES AND SUPPLEMENTS Regulation of the Cell Cycle by Somatomedins-HOWARD ROTHSTEIN Epidermal Growth Factor: Mechanisms of Action-M~~~uSRlDAS Recent Progress in the Structure, Origin, Composition, and Function of Cortical Granules in Animal Egg-SARDUL S. GURAYA

293

lmmunofluorescence Studies on Plant Cells-C. E. JEFFREE. M. M. YEOMAN.AND D. C. KILPATRICK

Biological Interactions Taking Place at a Liquid-Solid IIIttZrfaCe-ALEXANDRE ROTHEN INDEX

INDEX

Volume 79 The Formation, Structure, and Composition of the Mammalian Kinetochore and Kinetochore Fiber-CONLY L. RIEDER Motility during Fertilization-GERALD SCHATTEN

Functional Organization in the NucleusRONALDHANCOCK A N D TENIBOULIKAS The Relation of Programmed Cell Death to Development and Reproduction: Comparative Studies and an Attempt at ClassificationJACQUES BEAULATON AND RICHARD A. LOCK-

Supplement 10: Differentiated Cells in Aging Research Do Diploid Fibroblasts in Culture Age?EUGENEBELL, LOUISMAREK.STEPHANIE SHER.CHARLOITE MERRILL.DONALDLEVINSTONE. AND IAN YOUNG Urinary Track Epithelial Cells Cultured from Human Urine-J. S. FELIXAND J. W. LITTLEFIELD

The Role of Terminal Differentiation in the Finite Culture Lifetime of the Human Epidermal Keratinocyte-JAMES G . RHEINWALD

Long-Term Lymphoid Cell CU~tU~eS-GEORGE Cryofixation: A Tool in Biological UltrastrucF. SMITH. PARVIN JUSTICE,HENRIFRISCHER, tural Research-HELMUT h A r n V E R AND LUIS LEEKIN CHU,AND JAMESKRW BACHMANN Type I1 Alveolar Pneumonocytes in Vi~roStress Protein Formation: Gene Expression and W I L L I A MH . J . D O U G L A SJ, A M E SA . Environmental Interaction with Evolutionary MCATEER,JAMESR. SMITH,AND WALTERR. BRAUNSCHWEIGER Significance-C. ADAMSAND R. W. RINNE INDEX Cultured Vascular Endothelial Cells as a Model System for the Study of Cellular Senescence-ELLIOT M. LEVINEAND STEPHEN M. Volume 80 MUELLER Vascular Smooth Muscle Cells for Studies of DNA Replication Fork Movement Rates in Cellular Aging in Vitro; an Examination of Mammalian Celk-LEON N. KAPP A N D Changes in Structural Cell Lipids-OLGA 0. ROBERTB. PAINTER BLUMENFELD. ELAINESCHWARTZ. VERONICA Interaction of Viruses with Cell Surface RecepM. HEARN.AND MARIEJ. KRANEPOOL tOrS-MARC TARDIEU. ROCHELLE L. EPSTEIN. Chondrocytes in Aging Research-EDWARD J. AND HOWARD L. WEINER MILLERAND STEFFANGAY The Molecular Basis of Crown Gall InductionGrowth and Differentiation of Isolated CalvarW. P. ROBERTS ium Cells in a Serum-Free Medium-JAMES K. BURKSAND WILLIAMA. PECK The Molecular Cytology of Wheat-Rye HyStudies of Aging in Cultured Nervous System brids-R. APPELS Bioenergetic and Ultrastructural Changes AssoTissue-DONALD H. SILBERBERG AND SEUNG ciated with Chloroplast Development-A. U. KIM R. WELLBURN Aging of Adrenocortical Cells in CultureThe Biosynthesis of Microbodies (Peroxisomes, PETER J. HORNSBY. MICHAEL H. SIMONIAN. G1yoxysomes)-H. KINDL AND GORDON N. GILL SHIN

294

CONTENTS OF RECENT VOLUMES AND SUPPLEMENTS

Thyroid Celts in Culture-FRANCESCO s. AMG. COON BESI-IMPIOMBATOAND HAYDEN Permanent Teratocarcinoma-Derived Cell Lines Stabilized by Transformation with SV40 and SV40tsA Mutant ViIUSeS-wARREN MALTZM A N . DANIELI. H. LINZER.FLORENCE BROWN.ANGELIKA K. TERESKY.MAURICE AND ARNOLD J. LEVINE ROSENSTRAUS. Nonreplicating Cultures of Frog Gastric Tubular CellS-GERTRUDE H. BLUMENTHAL AND DINKAR K. KASBEKAR

Preservation of Germplasm-LYNDSEY A . WITHERS Intraovarian and in Virro Pollination-M. ZENKTELER

Endosperm Culture-B. M. JOHRI. P. S. SRIVASTAVA. AND A. P. RASTE The Formation of Secondary Metabolites in Plant Tissue and Cell Cultures-H. BOHM Embryo Culture-V. RAGHAVAN The Future-GEoRc MELCHERS SUBJECT INDEX

INDEX

Supplement llA: Perspectives in Plant Cell and Tissue Culture Cell Proliferation and Growth in Callus Cultures-M. M. YEOMANAND E. FORCHE Cell Proliferation and Growth in Suspension Cultures-P. J. KING Cytodifferentiation-RICHARD PHILLIPS Organogenesis in Virro: Structural, Physiological, and Biochemical Aspects-TREVOR A. THORPE Chromosomal Variation in Plant Tissues in Culture-M. W. BAYLISS Clonal PrOpagatiOn-INDRA K. VASIL AND VIMLA VASIL Control of Morphogenesis by Inherent and Exogenously Applied Factors in Thin Cell Layers-K. TRANTHANHVAN Androgenetic Haptoids-1NDRA K. VASIL Isolation, Characterization, and Utilization of Mutant Cell Lines in Higher PhtS-PAL MALICA SUBJECT INDEX

Supplement llB: Perspectives in Plant Cell and Tissue Culture Isolation and Culture of PrOtOplaStS-1NDRA K. VASILAND VIMLAVASIL Protoplast Fusion and Somatic Hybridizationo ” 0 SCHIEDER AND INDRA K. VASIL Genetic Modification of Plant Cells Through Uptake of Foreign DNA-c. I. KAW AND A. KLEINHOFS Nitrogen Fixation and Plant Tissue CultureKENNETH L. GlLES AND INDRA K. VASIL

Supplement l2:Membrane Research: Classic Origins and Current Concepts Membrane Events Associated with the Generation Of a BtaStocySt-MARTIN H. JOHNSON Structural and Functional Evidence of Cooperativity between Membranes and Cell Wall in Bacteria-MANFRED E. BAYER Plant Cell Surface Structure and Recognition Phenomena with Reference to SymbiosesPATRICIA S. REISERT Membranes and Cell Movement: Interactions of Membranes with the Proteins of the Cytoskeleton-JAMES A. WEATHERBEE Electrophysiology of Cells and Organelles: Studies with Optical Potentiometric IndicatorsAND PHILIPC. LARIS JEFFREYC. FREEDMAN Synthesis and Assembly of Membrane and Organelle Proteins-HARVEY F. LODISH. WILLIAMA. BRAELL.ALANL. SCHW.~RTZ. GER J. A. M. STROUS,A N D ASHERZILBERSTEIN

The Importance of Adequate Fixation in Preservation of Membrane UltrastructureB. LURK AND PAUL N . MCMILLAN RONALD Liposomes-As Artificial Organelles, Topochemical Matrices, and Therapeutic Carrier SyStemS-hTER NICHOLLS Drug and Chemical Effects on Membrane TransWIL WILLIAM 0. BERNDT INDEX

Supplement W: Biology of the Rhizobiaceae The Taxonomy of the Rhizobiaceae-GE.RALD H. ELKAN

CONTENTS OF RECENT VOLUMES AND SUPPLEMENTS Biology of Agrobucterium tumefaciens: Plant Interactions-L. W. MOOREA N D D. A. CCOKSEY Agrobacrerium tumefaciens in Agriculture and L. Research-FAwzi EL-FIKIAND KENNETH GlLES Suppression of, and Recovery from, the Neoplastic State-ROBERT TURGEON Plasmid Studies in Crown Gall TumorigenesisA N D RICK L. STEPHEN L. DELLAPORTA PESANO The Position of Agrobacrerium rhizogenesJESSEM. JAYNES AND GARYA. STROBEL SymRecognition in Rhizobium-Legume bioses-TERRENCE L. GRAHAM The Rhizobium Bacteroid State-W. D. SUTTON. C. E. PANKHURST. AND A. S. CRAIG

295

Exchange of Metabolites and Energy between Legume and Rhizobiurn-JOHN IMSANDE The Genetics of Rhizobium-ADAM KONWROSI AND ANDREW W. B. JOHNSTON Indigenous Plasmids of Rhizobium-J. DEENARIEE. P. BOISTARD. FRANCINE CASSE-DELBART. J. 0.BERRY,AND P. RUSSELL A. G . ATHERLY, Nodules Morphogenesis and DifferentiationWILLIAM NEWCOMB Mutants of Rhizobium That Are Altered in Legume Interaction and Nitrogen FixationL. D. KUYKENDALL The Significance and Application of Rhizobium in Agriculture-HAROLD L. PETERSON AND THOMAS E. LOYNACHAN INDEX

This Page Intentionally Left Blank